r. qmflrua
53. .:=.J.V
.40

 

1. .2 .
.t. .. .
.... 20.. .I .B.
I. L 51:14.9
uni...

.. 4n.»

3‘

z... ,5. .

.25 film.
a!" 3

x

u?hufladn."
.1 fix... ‘ t
.5.

xii. (.641. .r
anyuuAl . w...

J .2!
.1 .. fit \Al-
2.)!" ii;

7.5 31.0 i .
‘n

a...”

‘ .
.195!

 

qfiiigfiségggifa; gin, gg

 

 

THESIS .1 I.‘

6:9 lllllllllllllllllllllllllllllllllllllllllllllllll

/ 31293 018341796

LIBRARY
Michigan State
University

 

 

 

 

This is to certify that the

dissertation entitled

Inhibition of CREB, NF-kB, and
interleukin-2: a mechanism of
immune suppression by cannabinol

presented by

Amy C. Herring

has been accepted towards fulfillment
of the requirements for

Doctoral (kgmfinPharmacology/Toxicology

 

Major professor

Date 61/1/99

MS U is an Affirmative Action/Equal Opportunity Institution 0-12771

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINE return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE ours DATE DUE DATE ours
x: mm M

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1196 www.m-p.“

INHIBITION OF CREB, NF-KB, AND INTERLEUKIN-Z: A MECHANISM
OF IMMUNE SUPPRESSION BY CANNABINOL

By

Amy C. Herring

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Pharmacology and Toxicology
1999

ABSTRACT

INHIBITION OF CREB, NF-KB, AND INTERLEUKIN-Z: A MECHANISM
OF IMMUNE SUPPRESSION BY CANNABINOL

By
Amy C. Herring

Immune suppression by cannabinoid compounds has been widely demonstrated in
a variety of experimental models. The identification of CB1 and CB2 cannabinoid
receptors on leukocytes has provided a putative mechanism of action for immune
modulation by cannabinoids. CB1 and CB2 are G-protein coupled receptors, and ligand
binding to either receptor negatively regulates adenylate cyclase. Cannabinol (CBN), a
cannabinoid with minimal CNS activity, is one ligand that exhibits higher binding affinity
for the CB2 receptor. In light of the CB2 selectivity of CBN, the objectives of this
research project were (1) to examine the effects of CBN on immunocompetence, CAMP-
mediated signal transduction, and IL-2 expression; (2) to identify specific CREB/ATF
and NF—KB/c-Rel proteins modulated by CBN in activated thymocytes; (3) to characterize
the inhibition of CREB and NF-KB transcription factor activation by CBN, and (4) to
determine the role of CAMP and PKA in the CBN-mediated inhibition of IL-2, CREB,
and NF—KB following T-cell activation.

Analysis of in vitro immune function endpoints demonstrated that CBN possessed
immunomodulatory activity that was comparable to that of A9-THC. An evaluation of
the CAMP signaling cascade in the presence of CBN showed a concentration—dependent
inhibition of adenylate cyclase and PKA activity. These alterations in upstream signaling
correlated with the inhibition of transcription factor binding to CRE and KB motifs in

splenocytes and thymocytes.

An inhibition of IL—2 expression at both the mRNA and protein level was
demonstrated by CBN. The identification of the specific CREB/ATF and NF-KB/c-Rel
dimers modulated by CBN following T-Cell activation was accomplished using both
supershift and EMSA-Western techniques. A CREB-1 homodimer was identified as the
major CRE binding complex affected by CBN treatment whereas the inducible KB
binding complex was shown to be a p65/C-Rel heterodimer. In addition, CBN inhibited
the phosphorylation of CREB-1 and prevented the degradation of IKB-a suggesting that
CBN inhibited CREB and NF-KB activation through an inhibition of phosphorylation.

The role of CAMP and PKA in the inhibition of IL~2, CREB, and NF—KB by CBN
was addressed by using the membrane permeable CAMP analog dibutyryl CAMP or the
specific PKA inhibitor H89. Co-stimulation of thymocytes with dibutyryl CAMP and
PMA/Io could not reverse the inhibition of CREB phosphorylation, CRE binding, or KB
binding produced by CBN. Furthermore, dibutyryl CAMP failed to reverse the inhibition
of IL-2 protein secretion by CBN. Pretreatment of thymocytes with H89 resulted in
minimal inhibition of CRE binding activity and CREB phosphorylation whereas KB
binding and IKB-a degradation were unaffected by H89. In addition, H89 produced only
a modest inhibition of thymocyte IL-2 protein. These results demonstrated a modest
involvement of the CAMP/PKA pathway in the CBN-mediated inhibition of CREB, NF-
KB, and IL-2 in activated thymocytes.

Together this series of studies established that CBN exhibits immunosuppressive
activity thereby implicating the involvement of the CB2 receptor in immune modulation
by cannabinoid compounds. This work is also the first to investigate the molecular
mechanisms of cannabinoid-mediated immune suppression of T-Cells. Furthermore,
these findings suggest that signaling pathways other than the CAMP cascade significantly
contribute to the modulation of CREB, NF-KB and IL-2 by cannabinol in mouse

thymocytes.

I would like to dedicate this dissertation to my mom and dad. They have always
encouraged me to follow my dreams and attain my goals. Earning my doctorate degree
has been the biggest Challenge of my life, and I couldn't have done it without the support

of my parents. Their love and encouragement means more to me than they will ever

know.

ACKNOWLEDGMENTS

I would first like to thank my advisor, Dr. Norb Kaminski, for his guidance and
support during my graduate career. He provided a Challenging environment which
enabled me to become an independent research scientist. I have really enjoyed working
on this research project with you!

I would also like to thank the members of my guidance committee: Dr. Ken
Moore, Dr. Jay Goodman, Dr. Mike Holsapple, and Dr. Kathie Brooks for their insight
and lively discussions. Your interest and encouragement throughout this research project
is greatly appreciated. I want to especially thank Dr. Holsapple for taking the time to
come to MSU for each committee meeting.

Thank you to all the members of the Kaminski lab, past and present, who have
made graduate school and research enjoyable. I'd also like to thank Bob Crawford for all
of the times you were there to help and answer questions. A special thanks goes to my
fellow students and good friends Courtney Sulentic and Barb Faubert. We've had a lot of
fun together over the years, and your friendship means a lot to me. I'm really going to
miss you!

Most importantly, I want to thank my boyfriend Don for his love and support.
You always knew when I needed encouraging words to press forward toward completing

my degree. You are wonderful, and I appreciate everything you've done for me.

ii

TABLE OF CONTENTS

Begs

LIST OF TABLES ............................................................................................................... v
LIST OF FIGURES ............................................................................................................ vi
ABBREVIATIONS ............................................................................................................ ix
INTRODUCTION ............................................................................................................... l
I. Cannabinoid background .................................................................................... l

A. Structure and biological effects of cannabinoids ......................................... 1

B. Medical use of marijuana ............................................................................. 4

C. General profile of immune modulation by A9-THC .................................... 7

D. Cannabinoid receptors ................................................................................ ll

1. Receptor subtypes and signal transduction pathways ........................... 11

2. Tissue distribution of CB1 and C32 ..................................................... 13

II. Intracellular signal transduction ...................................................................... 15

A. G-protein coupled receptor signals ............................................................ 15

B. The CAMP signaling cascade ..................................................................... 18

1. Protein family members ........................................................................ 18

2. Activation and regulation of the CAMP cascade .................................. 19

3. Kinetics of CAMP signal transduction .................................................. 23

4. CBP, a transcriptional coactivator ........................................................ 24

5. Cross-talk between the PKA and PKC pathways ................................. 25

C. The NF-KB signaling pathway .................................................................... 27

1. Protein family members ........................................................................ 27

2. The NF—icB inhibitor,le ...................................................................... 27

3. Induction and regulation of NF-KB ....................................................... 28

4. Immune response genes regulated by NF-KB ....................................... 33

111. T lymphocyte background .............................................................................. 34

A. T-cells and the immune system ................................................................. 34

B. T-CCll development .................................................................................... 35

1. Double negative thymocytes ................................................................. 35

2. Double positive thymocytes ................................................................. 39

C. T lymphocyte activation and associated signaling pathways .................... 41

D. IL-2 and the regulation of its expression .................................................. 47

E. The role of the CAMP pathway in T-Cells ................................................. 52

1. Inhibition by CAMP .............................................................................. 52

2. Stimulation by CAMP ........................................................................... 54

METHODS ........................................................................................................................ 56
1. Animals ...................................................................................................... 56

H. Chemicals ................................................................................................... 56

111. Culture Medium ......................................................................................... 56

IV. Antibodies .................................................................................................. 56
V. In Vitro Proliferation Assays ...................................................................... 57

VI. In Vitro IgM Antibody Forming Cell Response ........................................ 57

VII. In Vivo IgM Antibody Forming Cell Response ......................................... 58

VIII. Pronase viability determination ................................................................. 58

IX. CAMP determination .................................................................................. 58

iii

X. Analysis of Protein Kinase A activity ........................................................ 59
XI. Cellular Lysis Methods .............................................................................. 60
A. Whole Cell ........................................................................................... 60
B. Nuclear ................................................................................................ 60
C. Cytosolic ............................................................................................. 6O
XII. Protein Determination ................................................................................ 61
XIII. Electrophoretic Mobility Shift Assay ........................................................ 61
XIV. Western Blot Analysis ............................................................................... 62
XV. EMSA-Western Analysis ........................................................................... 62
XVI. Quantitative RT-PCR ................................................................................. 63
A. Preparation of Internal Standard ......................................................... 63
B. Reverse transcriptase-polymerase Chain reaction ............................... 63
XVH. ELISA ........................................................................................................ 64
XVIII. Densitometry .............................................................................................. 65
XIX. Statistical Analysis ..................................................................................... 65
EXPERIMENTAL RESULTS ........................................................................................... 66
I. Effects of cannabinol on immune function ................................................ 67
A. Proliferative Responses ....................................................................... 67
B. IgM antibody forming cell response ................................................... 67
II. Inhibition of the CAMP signaling cascade by cannabinol .......................... 71
A. Inhibition of forskolin-stimulated adenylate cyclase activity by
cannabinol in murine leukocytes ......................................................... 71
B. Effect of cannabinol on PKA activity ................................................. 74
C. Inhibition of transcription factor binding to a CRE motif by
cannabinol ........................................................................................... 76
D. Inhibition of transcription factor binding to a KB motif by
cannabinol ........................................................................................... 8 1
HI. Inhibition of IL-2 expression by cannabinol .............................................. 86
IV. The effects of cannabinol on thymocyte activation by PMA/Io ................ 86
A. Cannabinol inhibits CRE and KB binding in PMA/Ionomycin
stimulated thymocytes ......................................................................... 86
B. Identification of the specific CRE binding proteins regulated
by cannabinol ...................................................................................... 89
C. Identification of the specific KB binding proteins regulated
by cannabinol ...................................................................................... 93
V. The effects of cannabinol on CREB and NF-KB activation in PMA/Io
activated thymocytes .................................................................................. 98
A. Inhibition of CREB phosphorylation by cannabinol ........................... 98
B. The effect of cannabinol on IKB-a degradation and p65
cellular localization ............................................................................. 98
VI. The role of CAMP and PKA 1n the cannabinol- mediated inhibition of
CREB, NF- KB, and IL-21n activated thymocytes ................................... 101
A. Effect of DBCAMP on the inhibition of CREB, NF—KB, and
and IL-2 by cannabinol ..................................................................... 101
B. Effect of forskolin on the inhibition of CREB, NF-KB, and IL-2
by cannabinol .................................................................................... 109
C. Effect of H89 on the regulation of CREB, NF-KB, and IL-2 in
activated thymocytes ......................................................................... 115
DISCUSSION .................................................................................................................. 124
LITERATURE CITED .................................................................................................... 141

iv

Table 1:
Table 2:

Table 3:

LIST OF TABLES

Bag:
Effect of cannabinol on mitogen-stimulated proliferation ......................... 68
Effect of cannabinol on the in vitro IgM AFC response to
sRBC .......................................................................................................... 69
Inhibition of IL-2 gene expression by cannabinol in PMA/Io
activated thymocytes .................................................................................. 87

Figure 1:
Figure 2:
Figure 3:
Figure 4:
Figure 5:
Figure 6:
Figure 7:
Figure 8:
Figure 9:

Figure 10:
Figure 11:
Figure 12:
Figure 13:

Figure 14:

Figure 15:

Figure 16:
Figure 17:

Figure 18:

LIST OF FIGURES

Bags
Structures of A9-THC and Cannabinol ........................................................ 3
Structures of synthetic cannabinoid analogs ................................................ 5
Schematic representation of the CAMP signaling cascade ......................... 21
Schematic representation of the NF-KB signaling pathway ....................... 31
The ordered progression of thymocyte development ................................. 37
Activation of a T—Cell by PMA/Io .............................................................. 44
Minimal essential region of the interleukin-2 promoter ............................ 50
Effect of cannabinol on the in viva IgM AFC response to sRBC .............. 7O
Inhibition of forskolin-stimulated adenylate cyclase activity by
cannabinol in mouse splenocytes ............................................................... 72
Cannabinol-mediated inhibition of forskolin-stimulated adenylate
cyclase activity in mouse thymocytes ........................................................ 73
Inhibition of PKA activity in forskolin-stimulated splenocytes
by cannabinol ............................................................................................. 75
Inhibition of forskolin-induced binding to a CRE motif in
mouse splenocytes by cannabinol .............................................................. 78
Inhibition of forskolin-induced binding to a CRE motif in
mouse thymocytes by cannabinol .............................................................. 80
Inhibition of NF-KB/C-Rel binding to a KB motif in forksolin
stimulated splenocytes by cannabinol ........................................................ 83
Inhibition of NF—KB/C-Rel binding to a KB motif in forksolin
stimulated thymocytes by cannabinol ........................................................ 85
Inhibition of IL-2 protein secretion by cannabinol in thymocytes ............ 88
Cannabinol inhibits protein binding to a CRE motif in PMA/Io
activated mouse thymocytes ...................................................................... 90
Inhibition of PMA/Io-induced protein binding to a KB motif
in mouse thymocytes by cannabinol .......................................................... 91

vi

Figure 19:

Figure 20:

Figure 21:

Figure 22:

Figure 23:

Figure 24:

Figure 25:
Figure 26:
Figure 27:
Figure 28:

Figure 29:

Figure 30:

Figure 31:
Figure 32:

Figure 33:

Figure 34:

Figure 35:

Figure 36:
Figure 37:

Effect of bovine calf serum on the cannabinol-mediated inhibition of
NF—KB DNA binding activity in PMA/Io activated thymocytes ................ 92

Identification of specific CRE transcription factors modulated by
cannabinol following PMA/Io activation of thymocytes ........................... 94

Identification of specific KB transcription factors modulated by
cannabinol following PMA/Io activation of thymocytes ........................... 95

Identification of the components of the upper KB binding complex
induced by PMA/Io in thymocytes ............................................................ 97

Phosphorylation of CREB and ATF-l is inhibited by cannabinol
in stimulated thymocytes ........................................................................... 99

Time course of IKB-a degradation following PMA/Io activation

of thymocytes ........................................................................................... 100
Inhibition of IKB-a degradation by cannabinol ....................................... 102
Cellular localization of p65 in the presence of cannabinol ...................... 103
DBCAMP induces the phosphorylation of CREB .................................... 104

Inhibition of CREB phosphorylation by cannabinol in activated
thymocytes is not reversed by DBCAMP ................................................. 106

Effect of DBCAMP on the inhibition of CRE binding by cannabinol
in activated thymocytes ............................................................................ 107

Effect of DBCAMP on the inhibition of KB binding by cannabinol

in activated thymocytes ............................................................................ 108
Inhibition of IL-2 protein secretion by DBCAMP in thymocytes ............ 110
DBCAMP fails to reverse cannabinol-mediated inhibition of IL—2

protein secretion in PMA/Io activated thymocytes .................................. 111
Forskolin failed to reverse the inhibition of CREB phosphorylation

by cannabinol in activated thymocytes .................................................... 112
Inhibition of CRE binding activity by cannabinol is not reversed by
forskolin ................................................................................................... 113
Inhibition of KB binding activity by cannabinol is not reversed by
forskolin ................................................................................................... 1 14
Phosphorylation of CREB is inhibited by H89 ....................................... 116

Inhibition of CRE binding by H89 in DBCAMP treated
thymocytes .............................................................................................. 1 17

vii

Figure 38:

Figure 39:

Figure 40:

Figure 41:
Figure 42:

Figure 43:

H89 has a modest effect on PMA/Io-induced CREB phosphorylation

in thymocytes .......................................................................................... 118
Effect of H89 on CRE binding activity in PMA/Io activated

thymocytes ............................................................................................... 119
H89 does not inhibit binding to a KB motif in PMA/Io

activated thymocytes ................................................................................ 120
Effect of H89 on IKB-Ot degradation in activated thymocytes ................. 121

Effect of H89 on IL-2 protein secretion in PMA/Io activated
thymocytes ............................................................................................... 123

Proposed mechanism of cannabinol-mediated inhibition of
T-Cells ...................................................................................................... 139

viii

[3H1
°C

A9-THC
AFC
AIDS

ATF
ATP

BARK
B-Cell

BCS
BSA

CD28RE

ABBREVIATIONS

tritium

degrees celcius

delta

delta-9-tetrahydrocannabinol

antibody forming cell

acquired immunodeficiency syndrome
activator protein-1

activating transcription factor

adenosine triphosphate

beta-adrenergic receptor kinase

B lymphocyte

bovine calf serum

bovine serum albumin

calcium

calmodulin
calcium/calmodulin-dependent protein kinase type four
cyclic adenosine 3':5'-monophosphate
Chloramphenicol aminotransferase
cannabinoid receptor

cannabidiol

cannabinol

CREB binding protein

Cluster designation

CD28 response element

ix

cpm

CREB
CREM
DAG
DBCAMP
DNA
D'I‘I‘
EBSS
ELISA
EMSA
ERK
EtOH
FBS
FSK

GDP

Gi

G protein
Gs

GTP
HEPES
HPB-ALL

Chinese hamster ovary

central nervous system

carbon dioxide

concanavalin A

counts per minute

CAMP response element

CAMP response element binding protein
CAMP response element modulator
diacylglycerol

dibutyryl CAMP

deoxyribonucleic acid

dithiothreitol

Earle's balanced salt solution
enzyme-linked immunosorbent assay
electrophoretic mobility shift assay
extracellular signal-regulated kinase
ethanol

fetal bovine serum

forskolin

gravity

guanosine diphosphate

inhibitory G-protein
guanine-nucleotide-binding protein
stimulatory G—protein

guanosine triphosphate

N -2-hydroxyethylpiperazine-N'-2-ethane sulfonic acid

human peripheral blood-acute leukemia lymphocyte

HSV
ICER

IgM
IKB-a
IKK

IL-2R
iN OS
Io

IP3

IS

J AK
JN K

LPS
MAPK
MEK

118
MHC

hour(s)

herpes simplex virus

inducible CAMP early repressor
interferon-gamma
immunoglobulin M

inhibitor of nuclear factor-KB
I-kappa B kinase

interleukin-2

interleukin-2 receptor

inducible nitric oxide synthase
ionomyCin

inositol 1,4,5-triphosphate
internal standard

janus kinase

C-jun N-terminal kinase

kappa B

kilodalton

kinase inducible domain
lipopolysaccharide
mitogen-activated protein kinase
mitogen-activated protein kinase kinase
microgram

major histocompatibility complex
minutes

microliter

micromolar

millimolar

xi

mRNA
N2
NA
NEMO
NF-AT
NF-KB
ng
NIK
NK

nm

N O
02
PAGE
PBS
PCNA
PCR
PGE2
PHA
PI 3-K

PKA
PKC
PKI
PLA2
PLC

messenger ribonucleic acid
nitrogen

naive

NF—kappa B essential modulator
nuclear factor of activated T-cells
nuclear factor for immunoglobulin K chain in B cells
nanogram

NF-kappa B inducible kinase
natural killer

nuclear localization signal
nanomolar

nanometer

nitric oxide

oxygen

polyacrylamide gel electrophoresis
phosphate buffered saline
proliferating-cell nuclear antigen
polymerase Chain reaction
prostaglandin E2
phytohemagglutinin
phosphoinositide 3-kinase
phosphatidylinositol 4,5-bisphosphate
protein kinase A

protein kinase C

protein kinase A inhibitor
phospholipase A2

phospholipase C

xii

SDS
SE

SCC

SPLC

THMC
TNFor

phorbol- 12-myristate-13-acetate
phenylmethylsulfonyl fluoride
Rel homology domain
radioimmunoassay

ribonucleic acid

Roswell Park Memorial Institute
reverse transcriptase
stress-activated protein kinase
structure activity relationship
sodium dodecyl sulfate

standard error

second(s)

splenocyte

sheep red blood cells

signal transducers and activators of transcription
Tris-boric acid-EDTA

tris buffered saline

cytotoxic T lymphocyte

T lymphocyte

T cell receptor

transcription factor type H
helper T lymphocyte
tetrahydrocannabinol
thymocyte

tumor necrosis factor alpha
TPA responsive element

vehicle

xiii

times

xiv

INTRODUCTION

1. Cannabinoid Backgron

A. Structure and biological effects of cannabinoids

Cannabinoid compounds are derived from the Cannabis sativa plant which is
more commonly known as marijuana. More than 60 different cannabinoids have been
isolated from cannabis including A9-tetrahydrocannabinol (A9-THC), cannabinol (CBN),
and cannabidiol (CBD). Of these constituents, A9-THC is the primary psychoactive
component of marijuana (Mechoulam, 1970) and is therefore the most extensively
studied cannabinoid. By comparison, CBN exhibits only minimal psychotomimetic
activity, and CBD is an inactive cannabinoid congener.

A9-THC produces diverse biological effects in animals and humans. The
predominant effect of cannabinoids is an alteration of central nervous system (CNS)
function. Specifically, cannabinoid intoxication is marked by hypothermia, catalepsy,
antinociception, and Changes in spontaneous activity. A9-THC also produces Changes in
mood, decreases psychomotor skills, and modifies cognition and memory (Dewey, 1986;
Pertwee, 1988). In general, A9-THC creates a state of CNS depression that is initially
accompanied by a state of hyperexcitability. For example, mice exposed to low doses of
A9-THC become sedated and hypersensitive to external auditory or tactile stimuli
(Dewey, 1986). Behavioral Changes have also been linked to cannabinoid exposure.
Acute administration of A9-THC has demonstrated a decrease in stimulus-controlled
behavior in several animal models (Black et al., 1970; Carlini, 1968; Ferraro and Grilly,
1972). Similarly, an amotivational syndrome characterized by general apathy is often
associated with chronic marijuana use. In some cases, high doses of A9-THC have
resulted in acute paranoia, panic reactions, and delusions in humans (Hollister, 1986).

Cannabinoids also generate effects in a variety of peripheral organ systems. A

number of endocrine Changes have been described following A9-THC exposure. These

include reduced secretion of prolactin, follicle-stimulating hormone and leutinizing
hormone as well as the stimulation of ACTH release (Block et al., 1991; Marks, 1973;
Smith et al., 1979). Furthermore, a single injection of A9—THC can decrease serum levels
of thyrotropin, triiodothyroxine, and thyroxine (Hillard et al., 1984). Several studies have
also reported alterations of the male reproductive tract by cannabinoids. For instance,
A9-THC causes a reduction in spermatogenesis, a regression of Leydig cells, and an
alteration of sperm morphology (Dixit et al., 1974; Husain and Lamb, 1984).
Immunosuppression is another well-characterized effect of cannabinoid compounds, and
a general profile of A9-THC activity within the immune system will be provided in a
subsequent section. In addition, cannabinoids have potential therapeutic applications
such as bronchodilation, reducing intraocular pressure, stimulating appetite, and relieving
the nausea associated with Chemotherapy (Hollister, 1986). Cannabinoid compounds are
unique from other drugs of abuse in that they produce no physical dependence, lack
respiratory-depressant activity, and possess relatively low toxicity.

Extensive structure activity relationship (SAR) studies have determined at least
four structural requirements for cannabimimetic activity (Razdan, 1986). A benzopyran
ring provides the backbone for cannabinoid compounds (Figure 1). The benzopyran
structure is necessary for activity as demonstrated by the inactive cannabidiol, an open-
ring compound. However, the benzopyran is not solely responsible for activity. The
presence of a phenolic hydroxyl group at the C-1 position is also a definite structural
requirement. Elimination or substitution of this hydroxyl group results in a significant
loss of potency (Johnson et al., 1981; Loev et al., 1973). In addition, the length of the
aliphatic side Chain determines the potency of cannabinoid compounds. A three carbon
side Chain appears to be the minimal requirement while nine carbons or more leads to a

reduction in activity. Furthermore, branching of the aromatic side chain

 

Cannabinol

Figure 1. Structures of A9-THC and Cannabinol. A9-tetrahydrocannabinol (A9-THC)
and cannabinol (CBN) are natural cannabinoid compounds derived from Cannabis sativa.
The structural backbone of Classical cannabinoids is a benzopyran ring. Additional
features necessary for activity include the phenolic hydroxyl group, the aliphatic side
chain, and the presence of an alicyClic ring (C ring). A9-THC and CBN are very similar
in structure with the exception of the number of bonds in the C ring.

can enhance potency. Lastly, the attachment of an alicyclic ring (i. e., ring C) to the
benzopyran backbone at the 3,4-position is critical for cannabimimetic activity.

Several non-Classical cannabinoid analogs have been synthesized which are more
potent than A9-THC and demonstrate high affinity binding to cannabinoid receptors
(Figure 2). The CP-55,940 synthetic analogs produced by Pfizer are bicyclic and possess
the essential structural requirements for activity. The dimethylheptyl HU-210/HU-211
analogs are structurally very similar to A9-THC and exhibit a branched aliphatic side
Chain. Recently, Sterling Winthrop has developed arninoalkylindole compounds such as
WIN-55,212. Although these analogs are structurally different from the Classical
cannabinoids, they exhibit pharmacological properties Characteristic of the natural
compounds (Compton et al., 1992). Regardless of structural differences, the natural and
synthetic cannabinoid compounds display enantiomer specificity with only the negative (-
) isomer showing pharmacological activity (Little et al., 1988). Interestingly, plant-
den'ved A9-THC and CBN differ only in the number of double bonds within the C ring
(Figure 1). Although cannabinol is very similar in structure to A9-THC, it lacks activity
in the central nervous system. As a result, CBN has been historically considered a

minimally active cannabinoid based on CNS endpoints.

B. Medical use of marijuana

Marijuana has long been used as an herbal remedy for a variety of conditions such
as convulsions, muscle tension, pain, and bronchoconstriction. Recently, California,
Arizona, Alaska, Nevada, Oregon, and Washington have legalized the use of marijuana
for medicinal purposes. The proposed medical uses include appetite stimulation, anti-
emetic for Chemotherapy, glaucoma, and multiple sclerosis. Dronabinol is an oral form

of A9-THC available by prescription for use as an appetite stimulant and an antinauseant.

 

EM...

CP—55,940

 

HU-210/HU-211

 

WIN-55,212

Figure 2. Structures of the synthetic cannabinoid analogs. CP-55,940 is a bicyclic
cannabinoid analog with a 7 carbon aromatic side Chain and an open benzopyran ring.
These structural modifications increase the potency and affinity of CP-55,940 for

cannabinoid receptors. HU-210/211 is structurally similar to A9-THC and possesses a
dimethyl-heptyl aromatic side Chain which increases the potency of this cannabinoid

analog. The aminoalkylindole, WIN-55,212, produces cannabinoid-like effects and binds
to cannabinoid receptors.

The potential therapeutic use of cannabinoids has inspired interest in the development of
new compounds with minimal side effects.

A comprehensive evaluation of the Clinical research on medical uses of marijuana
was recently written by Voth and Schwartz (1997). In this report, the authors assessed
the available data concerning the use of crude marijuana and/or pure A9—THC for
multiple sclerosis, glaucoma, appetite stimulation, and cancer Chemotherapy. Overall, the
literature supported the therapeutic use of marijuana for stimulating appetite and for
relieving the nausea of Chemotherapy; however, insufficient data for multiple sclerosis
and glaucoma were reported. Considerable Clinical evidence exists for the use of
marijuana as an antinauseant. In fact, A9-THC was found to be most useful for patients
that were refractory to other anti-emetic therapy. However, THC therapy has more
significant side effects and toxicity than ondansetron and granisetron, the more common
anti-nausea drugs. Appetite stimulation was also proven to be a useful medical
application of marijuana. A9-THC promotes the maintenance of weight and increases the
appetite of AIDS patients. Low doses of A9-THC can also stimulate the appetite of
cancer patients.

Unfortunately, numerous side effects hinder the medical use of marijuana. The
psychoactive effects of A9-THC cause many patients to stop therapy. Predominant
complaints include loss of concentration and memory, alterations in coordination, and
distortion of reality. Several respiratory complications have also been associated with
smoking marijuana as marijuana contains more tar and carcinogens than tobacco.
Additionally, the long-term side effects of A9-THC therapy remain relatively unknown.
Therefore, the development of synthetic compounds which are therapeutic and lack

undesirable side effects is of great interest.

C. General profile of immune modulation by 139-THC

Immune suppression is a well Characterized effect of cannabinoids as
demonstrated by their ability to inhibit cell-mediated, humoral, and innate immune
responses. As will be described below, these compounds have been shown to suppress B
and T-Cell function, macrophage and natural killer cell activity, as well as host resistance
using various immunological models (Kaminski, 1994; Klein et al., 1998; Munson and
Fehr, 1983).

T-cells play a critical role in cell-mediated immunity and are responsible for
antitumoricidal and antiviral activities. A number of studies have reported cannabinoid-
mediated inhibition of T-Cell function as assessed by a variety of functional endpoints.
Clonal expansion of T-Cells is central to cell-mediated immune responses, and in vitro
administration of T-cell specific mitogens such as anti-CD3, PHA, and Con A can induce
this proliferative response. Several investigators have demonstrated that A9-THC can
inhibit mitogen-induced T-Cell proliferation of mouse spleen cells (Pross et al., 1987;
Pross et al., 1990; Schatz et al., 1993). A Closer investigation of these findings
determined that inhibition of proliferation by A9-THC occurred only when the drug was
present during Clonal expansion (Specter et al., 1990). Interestingly, a differential
sensitivity of the T-Cell subpopulations to A9-THC has been observed in vitro with a
reduction in CD8+ but not CD4+ cell numbers following mitogen stimulation (Pross et
al., 1990). A similar inhibition of Clonal expansion by A9-THC has been reported in
PHA-stimulated human peripheral blood lymphocytes (Specter et al., 1990). It has also
been established that cannabinoids alter T-Cell function at the level of cytokine secretion
and responsiveness. Splenocytes stimulated with either PHA, LPS, or Con A produced
significantly less interferon in the presence of A9-THC than the untreated controls
(Blanchard et al., 1986). Additionally, A9-THC has been shown to decrease the
responsiveness of T-Cells to IL-2 (Kawakami et al., 1988). Decreases in NK cell

cytolytic activity and the development of lymphokine-activated killer cells has also been

attributed to decreased IL-2 responsiveness (Kawakami et al., 1988). Furthermore, we
have recently reported that IL—2 transcription is altered by cannabinoid compounds as
detected by significant decreases in IL-2 mRNA and protein (Condie et al., 1996).
Together these findings suggest that 139-THC interferes with induction of IL-2 as well as
promotion of several IL-2 dependent processes.

B-lymphocytes participate in acquired immune responses and are the primary
effector cells of humoral immunity. Recognition and binding of specific antigen by
surface immunoglobulin stimulates B-Cells to proliferate and differentiate into antibody
secreting plasma cells. A9-THC and the synthetic cannabinoids CP-55,940 and
WINSS,212 produce a modest stimulatory effect on B-Cell proliferation at nanomolar
concentrations (Derocq et al., 1995). In contrast, Klein and coworkers have reported a
dose-dependent inhibition of LPS-stimulated splenocyte proliferation by A9-THC (Klein
et al., 1985). Both of these studies described THC-mediated alterations of
lymphoproliferation; however, direct Changes in B-Cell effector function have not been
definitively established following A9-THC exposure. Rather, the effects of A9-THC on
humoral immune responses are Characterized as indirect and result from alterations in
accessory cell function (i.e., T helper cells). The IgM antibody forming cell (AFC)
response is routinely employed to measure humoral immunity. Sheep red blood cells
(sRBC) are commonly used as the T-dependent antigen, and the generation of this
antibody reponse requires functional accessory T cells and antigen-presenting cells. A9-
THC has been shown to inhibit the AFC humoral response to T-CCll dependent antigens
both in vivo and in vitro (Schatz et al., 1993; Smith et al., 1978; Watson et al., 1983).
The IgM AFC response can also be initiated to the T-Cell independent antigens DNP—
Ficoll and LPS; however, A9-THC does not inhibit these responses in vivo or in vitro
(Schatz er al., 1993). These findings suggest that the inhibition of humoral immune
responses by A9-THC occurs primarily through the inhibition of T-lymphocyte accessory

cell function. Interestingly, the timing of antigen sensitization in relationship to

cannabinoid exposure appears to be critical for A9-THC-induced inhibition of humoral
responses. Studies investigating the relationship between antigen sensitization and A9-
THC exposure have determined that A9-THC administration surrounding the time of
sensitization with sRBC produces the greatest magnitude of inhibition (Schatz et al.,
1992; Schatz et al., 1993). These findings were interpreted as suggesting that
suppression of immune function by cannabinoid compounds is likely mediated through
the alteration of an early T-Cell activation event.

Macrophages are an integral part of the immune system and participate in both
innate and acquired immune responses. These cells play an important role in innate
immunity through phagocytosis of foreign antigen and production of tumor necrosis
factor 01. Additionally, macrophages possess intrinsic cytolytic activity which is partially
mediated through the release of hydrolytic enzymes, reactive oxygen species, and nitric
oxide (NO-). Macrophages also function as antigen presenting cells in acquired
immunity by presenting antigen to T-lymphocytes. A variety of Changes in macrophage
function have also been attributed to A9-THC. Analysis of functional endpoints
indicative of macrophage activation demonstrated a dose-dependent inhibition of
macrophage spreading and decreased phagocytosis by A9-THC (Lopez-Cepero et al.,
1986). Chronic exposure to marijuana was shown to cause irregular cell surface
morphology, increased vacuolization, and altered protein expression following activation
of macrophages (Cabral et al., 1991). Functional studies further demonstrated that A9-
THC inhibits the extrinsic activity of macrophages in a dose dependent manner whereas
intrinsic activity (uptake of the herpes virus) was unaffected (Cabral and Vasquez, 1992).
In addition, the production of TNFOL from activated macrophages was repressed by A9-
THC treatment (Zheng et al., 1992). Subsequent studies have reported that the A9-THC-
mediated alteration of TNFa occurs at the level of maturation and secretion from

macrophages rather than through a decrease in TNFa mRNA expression (Fischer-Stenger

er al., 1993; Zheng and Specter, 1996b). It was evident that macrophage effector function

was compromised by A9-THC; therefore, studies were performed to characterize the
mechanism(s) underlying these functional Changes. An inhibition of early signaling
events by cannabinoids has been demonstrated in activated macrophages. A9-THC
markedly prevented the tyrosine phosphorylation of two specific proteins (p77 and p82)
in peritoneal macrophages stimulated with lipopolysaccharide (Zheng and Specter, 1994);
however, the identity and function of these proteins remains unclear. Similarly, the IFN'y-
induced phosphorylation of the STATla transcription factor was inhibited by A9-THC in
murine macrophages (Zheng and Specter, 1996a). Recently, A9-THC was found to
produce a dose-dependent inhibition of nitric oxide (NO-) production in response to LPS
plus IFN-y treatment (Coffey et al., 1996). Maximal inhibition of NO- was detected only
when A9-THC was present prior to macrophage stimulation suggesting that cannabinoids
may interfere with activation signals. Icon and coworkers also reported a A9-THC-
mediated reduction in NO levels in the macrophage cell line, RAW 264.7 (Jeon et al.,
1996). Furthermore, A9-THC was shown to inhibit adenylate cyclase activity and
transcription of the inducible nitric oxide synthase (iNOS) gene (Jeon et al., 1996).
Interestingly, the inhibition of NO- by A9-THC was reversed by membrane permeable
CAMP analogs in both studies (Coffey et al., 1996; Icon et al., 1996). Together these
findings provide insight into the mechanism of inhibition by A9-THC and indicate that
cannabinoids can modulate the cytolytic function of activated macrophages at the
molecular level.

Examination of A9-THC effects on host resistance have determined that
cannabinoid compounds can markedly suppress resistance to herpes simplex virus type 2
(HSV-2) and Listeria monocytogenes (Cabral et al., 1986a; Morahan et al., 1979) as
measured by a decrease in the time to lethality. Additional studies with HSV-2
demonstrated an increase in frequency and severity of lesions in guinea pigs receiving
A9-THC (Cabral et al., 1984). Subsequent work has revealed a decrease in proliferative

responses and a reduction in IFN 0: and [3 release by 139-THC during HSV-2 infection

10

(Cabral et al., 1987; Cabral et al., 1986b) thereby providing a possible mechanism for
compromised host resistance following A9-THC exposure. Additionally, increases in IL-
6 mRNA were detected in A9-THC treated mice infected with Legionella pneumophila
(Smith et al., 1997) suggesting that acute phase proteins may play a role in the decreased
survival of infected animals.

In summary, considerable evidence exists for the immunosuppressive activity of
cannabinoid compounds. 139-THC alters numerous immunological responses; however,
T-lymphocytes appear to be particularly sensitive to inhibition by cannabinoids. In
addition, the precise molecular Changes responsible for cannabinoid-mediated immune

suppression have not been extensively Characterized.

D. Cannabinoid Receptors

1. Receptor subtypes and signal transduction pathways

Historically, the mechanism of action for cannabinoids has been attributed to
intercalation and disruption of the plasma membrane due to the lipophilic nature of these
compounds. Over the last decade, however, a large body of evidence has accumulated
supporting the involvement of receptors in mediating the physiological effects of
cannabinoids. First and foremost, binding studies performed in neuronal tissue
demonstrated specific and saturable binding by cannabinoid compounds (Harris et al.,
1978). Furthermore, stereoselective differences in biologic activity were observed among
cannabinoid enantiomer pairs although the degree of lipophilicity was equivalent between
(+) and (-) isomers (Thomas et al., 1990). Accordingly, early studies performed by
Howlett and co-workers demonstrated that cannabinoids negatively regulate adenylate
cyclase activity in neuronal cells (Howlett, 1985; Howlett and Fleming, 1984). This was
a significant finding considering the specific association of adenylate cyclase and G-
protein receptors. The above findings were ultimately supported by the isolation and

Cloning of a novel G—protein coupled receptor (CB1) from a rat brain CDNA library

11

(Matsuda et al., 1990). The CB1 receptor has also been Cloned in mouse (Chakrabarti et
al., 1995) and human (Gerard et al., 1990) and exhibits a highly conserved sequence
identity at the amino acid level among these species. A splice variant of the CB1
receptor, termed CB 1A, has also been described in human tissues and differs from CB1 at
the amino terminal tail (Shire et al., 1995). Recently, a second cannabinoid receptor
(CB2) has been Cloned from HL60 cells, a promyelocytic leukemia cell line (Munro et
al., 1993). Interestingly, CB1 and CB2 share only 44% identity which increases to a
modest 68% when comparing the transmembrane domains which are thought to
constitute the putative ligand binding portion of the receptor. Despite significant
differences in the amino acid sequence between the two forms of cannabinoid receptors,
most natural and synthetic receptor ligands exhibit similar binding affinities for both CB1
and CBZ. Cannabinol, however, is one ligand capable of discriminating between the two
receptors exhibiting significantly greater binding affinity for CB2 than for CB1 (Munro et
al., 1993; Schatz et al., 1997).

Ligand binding to either CB1 or CB2 produces a marked inhibition of adenylate
cyclase activity thereby lowering intracellular CAMP levels (Condie et al., 1996; Howlett,
1985; Howlett and Fleming, 1984; Icon et al., 1996). The cannabinoid-mediated
inhibition of adenylate cyclase is abrogated by pertussis toxin demonstrating that
cannabinoid receptors couple to a Gi-like protein (Howlett et al., 1986; Kaminski et al.,
1994). Initially, the inhibition of adenylate cylcase by cannabinoids was described in
neuroblastoma cell lines (Howlett, 1985) and has since been extended to several cell
types including rat Sertoli cells (Heindel and Keith, 1989), human leukemic cells
(Rowley and Rowley, 1989), murine splenocytes (Kaminski et al., 1992 ), RAW 264.7
cells (Jeon et al., 1996), and CHO cells transfected with cannabinoid receptors (Felder et
al., 1993; Vogel et al., 1993). Although modulation of CAMP production by cannabinoid
receptors has been the most extensively studied, additional receptor-mediated signaling

mechanisms have been Characterized for the CB1 receptor. For example, cannabinoid

12

compounds can repress calcium influx through N-type calcium Channels in
neuroblastoma-glioma cells through a pertussis toxin sensitive mechanism (Caufield and
Brown, 1992; Mackie and Hille, 1992). Similarly, transfection of CB1 into the At20
pituitary cell line established the inhibition of Q-type calcium Channels as well as the
stimulation of potassium influx by cannabinoids (Felder et al., 1995). In contrast,
transfection of the CB2 receptor into either At20 or CHO cells produced no effect on
calcium or potassium Channels (Felder et al., 1995), thus it currently appears that
modulation of ion Channels by cannabinoid receptors is a unique Characteristic of the CBI
subtype. Additionally, the coupling of CB1 and CB2 to the mitogen-activated protein
(MAP) kinase pathway has been described in unstimulated CHO cells transfected with

either receptor subtype (Bouaboula et al., 1995; Bouaboula et al., 1996).

2. Tissue distribution of CB] and CB2

The tissue and cell-type distribution of CB1 and CBZ have not yet been
comprehensively characterized; however, CB1 appears to be primarily expressed within
the CNS whereas CB2 seems to be predominantly expressed within the immune system.
CB1 was originally isolated from the rat cerebellum (Matsuda et al., 1990) and has since
been detected in human brain (Gerard et al., 1990; Herkenham et al., 1990) and testis
(Gerard et al., 1991). Herkenham and coworkers have reported dense expression of the
CB1 receptor specifically in the hippocampus, cerebellum, and basal ganglia outflow
nuclei regions of the brain (Herkenham et al., 1990). Studies investigating the level of
CB1 expression within the immune system have determined that this receptor subtype is
only modestly expressed on immunocompetent cells (Bouaboula et al., 1993; Kaminski et
al., 1992; Schatz et al., 1997). More specifically, RT-PCR analysis has detected mRN A
for CB1 in human T-Cells, B-cells, and monocytes (Bouaboula et al., 1993) as well as
mouse spleen (Kaminski et al., 1992), but not in mouse thymus (Schatz et al., 1997).

Alternatively, CB2 appears to be the predominant cannabinoid receptor associated with

13

the immune system. CB2 expression was first detected in HL60 cells and rat spleen
(Munro et al., 1993) and has recently been identified in primary cells of the mouse spleen
and thymus (Schatz er al., 1997). Moreover, CB2 has also been detected in several cell
lines including the EL-4.IL-2, HPB-ALL, and Jurkat E6-l T-Cell lines (Condie et al.,
1996); the macrophage cell line, RAW264.7 (Jeon et al., 1996); and the RBL-2H3 mast
cell line (Facci er al., 1995).

Cannabinoid receptor expression in the immune system was first identified in
mouse spleen cells based on the following lines of evidence: (a) specific and saturable
binding of [3H]-CP-55,940, a high affinity cannabinoid receptor ligand; (b) significant
inhibition of adenylate cyclase activity; (C) stereoselective inhibition of humoral immune
responses; and ((1) detection of CB1 mRN A trancripts by RT-PCR (Kaminski et al., 1992;
Schatz et al., 1992). As previously mentioned, CB2 has been Characterized and
determined to be the prominent cannabinoid receptor subtype expressed on
immunocompetent cells. Cannabinoid-mediated inhibition of adenylate cyclase activity
has been shown in a variety of lymphoid models including mouse splenocytes, EL-4 and
HPB-ALL T-CCll lines, RAW264.7 cells, and purified T- and B-lymphocytes (Condie et
al., 1996; Jeon er al., 1996; Schatz er al., 1992; Schatz et al., 1997) demonstrating the
functional expression of cannabinoid receptors on leukocytes. Interestingly, similar
studies performed in the human Jurkat E6-l T-Cell line failed to detect modulation of
adenylate cyclase by cannabinoid compounds. Further investigation of this cell line
revealed three aberrantly sized mRNA transcripts for CB2 suggesting that the CB2
receptors expressed in Jurkat E6-l cells are not functional. These findings further
demonstrate that the modulation of adenylate cyclase by cannabinoid compounds is a
receptor-mediated event. Recently, a novel role for the CB2 receptor in the
differentiation of B-lymphocytes was proposed. Analysis of protein expression

demonstrated a significant upregulation of CB2 initially following CD40 activation of

14

both naive and memory B-cells, and a downregulation of CB2 receptor mRNA and

protein during the process of differentiation (Carayon et al., 1998).

II. Intracellular Signal Transduction

A. G-protein coupled receptor signals

As already discussed, cannabinoid receptors are members of the G-protein
coupled receptor superfamily. This family of receptors transmits information from the
cell surface to the nucleus through a G-protein tn'meric complex composed of alpha (on),
beta ([3), and gamma (7) subunits. Signaling from G-protein coupled receptors initially
utilizes a common mechanism which can ultimately interact with numerous effector
molecules. During the inactivated state, the at subunit is bound to GDP and remains
associated with the By dimer. Ligand binding to G-protein coupled receptors stimulates
the activation of Ga by exchanging GDP for GTP which results in the dissociation of Ga
from Gfiy. In general, the activated Ga subunit directly interacts with an effector to
either stimulate or inhibit its activity typically through Gas or Gori, respectively. The Ga
subunit has been shown to positively or negatively modulate a variety of effectors
including adenylate cylcase, potassium and calcium ion channels, phospholipase A2, and
phospholipase C (Hepler and Gilman, 1992). The best characterized effector coupled to
cannabinoid receptor G-proteins is adenylate cyclase, and engagement of the inhibitory
G-protein (Gi) by cannabinoid ligands results in an inhibition of adenylate cyclase
activity. The attenuation of Goc signaling is mediated through the activation of specific
GTPases which convert the GTP bound to 601 into GDP thereby inactivating the ct
subunit.

It is now well established that By dimers of the G-protein can initiate and transmit
independent signals through an interaction with several of the known effectors of G-
protein coupled receptors. For example, [37 subunits were originally found to stimulate

potassium Channels of the heart by increasing the opening frequency of these Channels

15

(Logothetis et al., 1987). By subunits can also modulate the metabolism of phospholipids
through effects on phospholipase A2 (PLA2) and phospholipase C (PLC) activity.
Specifically, stimulation of PLA2 by the By subunit of transducin has been observed in
bovine retina (Jelsema and Axelrod, 1987). The beta component of transducin was
identified as an isoform common to other G-protein complexes; therefore, it is likely that
additional GBy units may be able to regulate PLA2 activity. Similarly, By subunits
purified from retina and brain can stimulate the activity of soluble PLC isolated from
human HL60 cells (Camps, 1992). Transient transfection of PLC beta isoforms into
COS-1 cells further revealed the activation of PLCBl and PLCB2 by free By dimers with
the B2 isozyme displaying greater sensitivity to GBy stimulation (Camps et al., 1992).
The modulation of specific PLC isoforms by By has also been reported with PLCBl and
PLCB3 from rat brain and PLCB2 from HL60 cells (Smrcka and Sternweis, 1993). In
addition to regulating enzyme activity, By subunits can inhibit calcium influx through N-
type voltage-gated calcium channels. This alteration in calcium is mediated by different
combinations of By subunits (i.e., Bly3 or B3y4) that are activated by somatostatin and
M4 muscarinic receptors, respectively (Kleuss et al., 1992; Kleuss et al., 1993).
Recently, the mechanism by which By dimers modulate calcium Channel activity has been
shown to occur through the direct interaction of GBy with the pore-forming (1] subunit of
the Channel (DeWaard et al., 1997). A majority of the aforementioned results are general
and were obtained using brain By units to Characterize GByzeffeCtor interactions.
However, specific effects have been attributed to the By subunit of the G1 protein once
detached from Gai. For example, the By dimer of 61 can stimulate MAP kinase activity
in both Rat-1 fibroblasts and COS-7 cells transfected with Gi-Coupled receptors (Koch et
al., 1994). The effect on MAPK was dependent on the activation of Ras, and further

examination described a role for the phosphoinositide 3-kinase in the activation of
MAPK by GiBy (Lopez-Ilasaca et al., 1997). The activation of SAPK and p38 by these

By subunits has also been demonstrated recently and appears to involve Racl and Cdc42,

l6

members of the Rho protein family (Coso er al., 1995; Minden et al., 1995). Despite the
extensive evidence for By signaling following G—protein coupled receptor activation, the
effects of By subunits interacting with cannabinoid receptors have yet to be Characterized.

Several variations of effector modulation by By subunits have been described
including regulation solely by By, GBy effects independent of Ga, or simultaneous
regulation of the effector by 0t and By subunits (Clapham and Neer, 1993; Smrcka and
Sternweis, 1993). Two models have been proposed for the latter which describe
modulation of the effector by the entire aBy complex or through separate or and By
interacting sites on the effector molecule (Clapham and Neer, 1993). As mentioned
above, hydrolysis of a-GTP to a-GDP terminates signaling mediated by the on subunit.
This regulatory mechanism also indirectly functions to attenuate By dimers because the
activation state of Ga dictates the activity of GBy (Clapham and Neer, 1993).
Alternatively, the presence of the By subunit significantly increases the affinity of Ga for
GDP (Higashijima et al., 1987) which facilitates inactivation of the G-protein. Thus, it
appears that these mechanisms enable Ga and GBy to cross—regulate the activity of one
another. In addition to modulating G-protein activity, By dimers are involved in the
regulation of the receptors. Agonist-dependent phosphorylation of receptors is a well
known desensitization mechanism, and a Classic example is the phosphorylation of the B-
adrenergic receptor by a B-adrenergic receptor kinase (BARK) (Stadel et al., 1983).
Interestingly, By subunits induce significant increases in the BARK-mediated
phosphorylation of active muscarinic and B2-adrenergic receptors (Haga and Haga, 1992;
Inglese et al., 1992). This resulted from a GBy directed localization of the kinase to the
membrane as opposed to an increase in kinase activity. It has now become apparent that
one signal may activate multiple pathways and that G-protein signal transduction is a

complex process.

17

B. The CAMP signaling cascade

1. Protein family members

The CAMP signaling pathway is comprised of several components that serve to
transmit signals from the cell surface to the nucleus. The transcription factors involved in
CAMP signal transduction have been identified as the CREB/ATF proteins. The
CREB/ATF family is composed of several members including CREBI, CREB2, ATFl,
ATF2, and CREM (Papavassiliou, 1994). These proteins are constitutively expressed in
the nucleus and can form homo- or heterodimers with each other. The CREB/ATF
transcription factors have been Classified as members of the BZip superfamily of proteins,
as they possess the Characteristic BZip structure consisting of a basic amino acid region
and a leucine zipper motif at their C-terminus. These regions are highly conserved and
enable DNA binding and dimerization, respectively (Lalli and Sassone-Corsi, 1994). In
addition to the BZip region, CREB/ATF proteins contain a transcriptional activation
sequence consisting of a kinase-inducible domain (KID) and two flanking glutamine-rich
regions (Gonzalez et al., 1991; Habener, 1990). The KID possesses phosphorylation sites
for several kinases; however, the specific phosphorylation of Ser-133 within this domain
is critical for the transcriptional activity of CREB. CREB-1, ATF-l, and CREM“: have
been Characterized as transcriptional activators (Papavassiliou, 1994) whereas CREB-2,
ICER (inducible CAMP early repressor), and the CREMOL, -B, -y isoforms have been
shown to repress gene expression (Karpinski er al., 1992; Laoide er al., 1993; Molina et
al., 1993). The mode of inhibition by CRE repressor proteins has been proposed to occur
either by direct binding to CRE motifs or through interactions with activators to quench
their activity (Lalli and Sassone-Corsi, 1994). ICER is unique among the repressors as its

expression is induced by CAMP (Molina er al., 1993).

18

2. Activation and regulation of the CAMP cascade

G-protein stimulation of adenylate cyclase stimulates the conversion of ATP into
CAMP. CAMP-dependent protein kinase, also known as protein kinase A (PKA), is the
fundamental kinase component of the CAMP pathway. In the absence of CAMP, PKA
exists as a tetramer complex composed of two regulatory subunits and two catalytic
subunits (R2C2). Two isoforms of the regulatory subunit, termed RI and R11, have been
Characterized and exhibit different subcellular localization. RI has been found to reside in
the cytosol whereas R11 is often associated with the plasma membrane (Scott and
McCartney, 1994). The primary function of CAMP is to bind cooperatively to A and B
sites of the regulatory subunit which are located near the C-terminus of the protein. The
binding of CAMP to these sites alters the affinity of the regulatory dimer for the catalytic
units resulting in the dissociation of active catalytic units (Taylor et al., 1990). The
soluble catalytic subunits phosphorylate serine or threonine residues of several target
proteins located within the PKA recognition sequence identified as X-Arg-Arg-X-
Sgfljhr-X. The catalytic subunit of PKA can translocate to the nucleus where
phosphorylation of additional regulatory proteins occurs (Meinkoth et al., 1993). The
CREB/ATP family of transcription factors is a critical nuclear target of PKA-mediated
phosphorylation which enables their binding to palindromic CAMP response elements
(CRE: 5'-TGACGTCA-3') located in the promoter region of CAMP responsive genes
(Figure 3). CREB-1, the best Characterized within this family, is phosphorylated on Ser-
133 which induces a conformational Change facilitating DNA binding and subsequent
induction of transcription (Gonzalez and Montminy, 1989; Yamamoto et al., 1989). PKA
phosphorylation sites have also been identified in the ATF-l and CREM proteins (de
Groot et al., 1993; Hai et al., 1989).

Early studies examining the attenuation of CREB activity focused on the levels of
CREB protein. Analysis of CREB following extended forskolin stimulation (12 hr)

showed that protein levels remained unchanged (Gonzalez and Montminy, 1989);

19

Figure 3. Schematic representation of the CAMP signaling cascade. Signals are
transmitted from membrane receptors to the nucleus through an intial receptor:G-protein
interaction. Ligand binding to the receptor releases the Ga subunit which stimulates
adenylate cyclase to convert ATP into CAMP. Once produced, CAMP binds to the
regulatory subunits (R) of PKA thereby releasing two active catalytic subunits (C) of the
enzyme to phosphorylate target proteins. The catalytic subunits of PKA translocate into
the nucleus and phosphorylate the CREB/ATF family of transcription factors which form
homo- or heterodimers and bind to CRE sequences in the promoter region of CAMP-
responsive genes.

20

 

 

 

 

#8030

 

 

 

 

 

therefore, degradation of CREB did not appear to be a regulatory mechanism. Consistent
with the post-translational modification of CREB, activation has been reported to peak at
30-60 min and declines rapidly thereafter (Seasholtz et al., 1995) implicating
dephosphorylation as a potential negative regulatory mechanism. OkadaiC acid is a
common inhibitor of protein phosphatase activity, and the inactivation of CREB can be
prevented in the presence of okadaic acid. The Characterization of the specific protein
phosphatase inhibited in this study identified protein phosphatase 1 (PP-l) as the enzyme
responsible for dephosphorylating CREB (Hagiwara et al., 1992). Similarly, inhibition of
liver cell protein phosphatase 2A (PP-2A) with okadaic acid enhanced CREB
phosphorylation and CRE-mediated gene expression suggesting that nuclear PP-2A may
also be involved in the regulation of CREB activity (Wadzinski et al., 1993). Thus,
dephosphorylation was considered to be the primary mechanism of terminating CAMP-
induced activation of the CREB/ATF family of proteins. However, the existence of
repressors and their role in regulating CRE activity can not be disregarded. As previously
mentioned, ICER protein expression is induced by CAMP and functions to down-regulate
CAMP responsive genes establishing a negative feedback loop for the regulation of
CAMP signal transduction at the nuclear level.

In addition to the phosphorylation state of CREB, regulation of the upstream
components of the CAMP pathway has been described. Several mechanisms, both direct
and indirect, are known to modulate the activity of PKA. PKI, the endogenous inhibitor
of PKA, is ubiquitously expressed and primarily serves to sequester the active PKA
catalytic units. PKI also transports the nuclear catalytic subunits into the cytosol thereby
promoting reassociation with the regulatory dimer (Wen er al., 1995). Furthermore, the
overexpression of R subunits regulates PKA activity by facilitating formation of the
tetrameric holoenzyme once basal levels of CAMP are attained (Amieux et al., 1997).
Termination of the CAMP signaling cascade is also mediated by the enzymes regulating

CAMP synthesis. The desensitization of adenylate cyclase occurs following an initial

22

stimulus rendering it insensitive to subsequent signals (Mons et al., 1995), and
phosphodiesterases are stimulated to degrade and inactivate CAMP molecules (Smith et
al., 1996). It is likely that a combination of these regulatory mechanisms ensures that

CAMP/PKA signal transduction is tightly controlled.

3. Kinetics of CAMP signal transduction

The kinetics of the CAMP pathway have been termed 'burst-attenuation' kinetics
and can be divided into three specific phases which possess distinct regulatory
mechanisms. The first phase in CAMP signal transduction is traditionally Characterized
by a rapid and transient burst of CAMP production. The nuclear translocation of PKA
catalytic units and the Set-133 phosphorylation of the CREB protein is also included in
this initial phase (Hagiwara er al., 1993). Peak activation of the CAMP cascade occurs
between 30-60 min post-stimulation as demonstrated by maximum induction of CRE
DNA binding complexes.

The second stage of CAMP signaling kinetics is known as the attenuation phase
and is identified by the termination of CAMP-mediated signals. The principal event of
this phase is the dephosphorylation of CREB at Set-133 by PP-l (Hagiwara et al., 1992)
which facilitates the steady decline of the signal to prestimulation status by 4-6 hr.
Okadaic acid, a broad spectrum phosphatase inhibitor, prevents the attenuation and
prolongs both the phosphorylation state of CREB and the expression of CAMP regulated
genes (Hagiwara er al., 1992).

The final phase of CAMP kinetics is the refractory period during which cells are
unresponsive to additional CAMP stimulation. The refractory phase was originally
identified using the thyroid follicular cell line, FRTL-S. Treatment of these cells with
thyroid stimulating hormone increased CAMP levels initially; however, subsequent
forskolin stimulation failed to induce CREB phosphorylation or CRE reporter activity

(Armstrong et al., 1995). This phase develops approximately 6-8 hrs following

23

stimulation and may last up to 3-5 days. A Characterization of the underlying mechanism
of CAMP unresponsiveness revealed a significant decrease in the translation of PKA
catalytic subunits rather than a stimulation of phosphatase activity or an increase in the

regulatory subunits of PKA (Armstrong et al., 1995).

4. CBP, a transcriptional coactivator

The final step in CAMP responsive gene expression occurs at the level of the
transcriptional coactivator identified as CREB binding protein (CBP). CBP is a large 265
kD nuclear protein that binds to CREB along with components of the basal transcriptional
machinery including TFHB, TFIID, and the RNA polymerase complex (Bisotto et al.,
1996; Kee et al., 1996; Kwok et al., 1994). Initial studies established a specific
interaction between CBP and the Set-133 phosphorylated form of CREB (Chrivia et al.,
1993). This was further demonstrated by the inability of CBP expression alone or in
combination with a CREB Ser-l33 mutant to induce transcription (Kwok et al., 1994).
The CREB binding domain of CBP interacts with the KID region of CREB and is
composed of 200 amino acids located near the N -terrninus of the protein (Goldman et al.,
1997). Thus, CBP is only recruited by activated CREB and provides a functional link
between CRE DNA binding proteins and the transcriptional enzymes essential for gene
expression. However, it is notable that interactions between CREB and CBP are
insufficient for transcriptional induction indicating the involvement of additional
regulatory mechanisms (Sun and Maurer, 1995). Chawla and coworkers recently
identified a transcriptional activator domain within CBP that was regulated by nuclear
calcium and CaM kinase IV (Chawla et al., 1998). This region was also sensitive to
increases in CAMP suggesting that CBP-mediated transcription is stimulated by both
calcium and CAMP signals. Currently, increases in intracellular CAMP result in the
following sequence of events: (1) phosphorylation of CREB and binding to the CRE

motif; (2) recruitment and activation of CBP; and (3) induction of target gene expression.

24

Interestingly, an association between CBP and other transcription factors has also
been demonstrated. CBP can interact with p65, C-jun, C-fos, Elk-l, C-myb, and members
of the steroid hormone receptor family (Goldman et al., 1997; Zhong et al., 1998).
Therefore, CBP may integrate signals from multiple pathways as a universal mechanism

of conjoining activated transcription factors with the transcriptional machinery.

5. Cross-talk between the PKA and PKC pathways 2

Several lines of evidence have demonstrated cross-talk between the PKA and
PKC pathways at multiple levels within the signaling cascades. Early studies have
demonstrated the phosphorylation of the catalytic subunit of adenylate cyclase following
phorbol ester treatment of frog erythrocytes (Yoshimasa et al., 1987). PMA can also
stimulate specific types of adenylate cyclase in 293 cells transiently expressing enzyme
types 1, 2, or 3 (Jacobowitz er al., 1993). The activation of type 2 adenylate cyclase by
PMA was thought to be mediated by phosphorylation of adenylate cyclase by PKC
because staurosporine markedly blocked the activation of adenylate cyclase by phorbol
esters (Yoshimura and Cooper, 1993). Similarly, a rapid and transient increase in
intracellular CAMP levels following PMA/Io stimulation of mouse splenocytes has been
described (Kaminski et al., 1994) demonstrating that PKA/PKC cross-talk occurs in
lymphoid cells. Increases in CAMP following PMA stimulation have also been reported
in vascular smooth muscle cells further suggesting that activation of PKC may potentiate
the CAMP pathway (Ren et al., 1996). The MAPK pathway is one downstream target of
PKC, and the activation of MAPK (specifically ERKl) has been shown following
increases in intracellular CAMP in PC12 cells (Frodin et al., 1994). This CAMP effect
was also synergistic with phorbol ester stimulation of ERKl activity. Furthermore,
CAMP elevating agents such as forskolin, dibutyryl CAMP, or isoproterenol activated

MAPK as early as 8 min post-stimulation in rat cardiomyocytes (Yamazaki, 1997).

25

Interestingly, stimulation of MAPK by CAMP was dependent on calcium in these cells
and could not be detected under calcium-free conditions.

Cross-talk between these two signaling pathways also occurs at the transcription
factor level. Along with the CREB/ATP proteins, C-fos and C-jun are members of the
leucine zipper superfamily of transcription factors. Fos and Jun dimerize to form AP-l
which binds to DNA sequences known as TRE sites (5'-TGACTCA-3') in the promoter
region of various genes. AP-l is one of the DNA binding proteins situated downstream
of PKC and can bind to TRE sites following phorbol ester stimulation. As members of
the leucine zipper family, C-fos and C-jun could potentially form 'Cross-family' dimers
with other leucine zipper proteins, namely the CREB/ATP transcription factors. It should
also be noted that the TRE motif differs from the CRE by only one base pair. Indeed,
several studies have established that CREB is capable of forming heterodimers with Jun
which then bind to AP-l sites on DNA (Chatton et al., 1994; Hai and Curran, 1991;
Ivashkiv et al., 1990). Furthermore, CREB, Fos and Jun were all detected in the protein
complex bound to the AP-l proximal site of the IL-2 promoter in both immature and
mature T-lymphocytes (Chen and Rothenberg, 1993). Cross-family dimerization is not
limited exclusively to TRE sites as a similar interaction has been observed with a
CREB/CJun heterodimer binding to a CRE motif (Benbrook and Jones, 1990). Together
these observations imply that activation of CREB/ATF and AP-l proteins can regulate
gene expression through both CRE and TRE motifs. Additionally, a CRE site exists
within the C-fos promoter (Sheng et al., 1990) suggesting that CREB/ATF proteins are
involved in regulating C-fos expression thereby providing another level of interaction

between the PKA and PKC pathways.

26

C. The NF-KB signaling pathway

1. Family members

The NF-KB/C-Rel proteins are members of the Rel family of transcription factors.
These proteins contain a Rel homology domain (RHD) consisting of approximately 300
amino acids which contains the necessary sequences for DNA binding and dimerization

(Verma et al., 1995). A nuclear localization signal (NLS) is also present in the N-

terminal portion of the protein to direct NF-KB into the nucleus upon cellular activation.
The current members of the NF-KB/C-Rel family are p50/p105, p65, C-Rel, RelB, and
p52/p100 (Ghosh et al., 1998). These proteins can form homodimers or heterodimers
with one another and bind to KB sequences (GGGAC'I'I‘T CC) in the promoter regions of
responsive target genes (Ghosh and Baltimore, 1990). Extensive Characterization has
been done to determine the transcriptional effects of various dimer combinations. In fact,
most NF-KB dimers have been Classified as transcriptional activators including the
heterodimers of p50/p65, p50/c-rel, p65/C-rel and the p65/p65 homodimer. However, the
p50/p50 and p52/p52 homodimers have been described as repressors of gene transcription
(Brown et al., 1994; Hansen et al., 1994; Plaskin er al., 1993).

2. The NF-KB inhibitor, IKB

IKB functions as an inhibitor of NF-KB activity by sequestering this transcription
factor in the cytosol of quiescent cells. Several IKB molecules have been indentified to
date including IKBa, IKB B, IKBy, IKBe, BCl-3, p105, p100, and IKBR (May and Ghosh,
1998; Miyamoto and Verma, 1995). The structure of the IKB proteins contains several
ankryin repeat motifs which are necessary for noncovalent protein-protein interactions
with NF—KB dimers (Inoue et al., 1992). The interaction between IKB and NF-KB
functions to maintain NF-KB dimers in an inactive form by masking their nuclear
localization signal and preventing nuclear translocation. Of the IKB family members,

IKB—oz was the first to be identified and is therefore the most extensively Characterized

27

inhibitor protein. IKB-or is a 37 kD protein and binds to dimers containing p65 and/or C-
Rel proteins (Verma et al., 1995). Several recent studies have also begun to investigate
the function of IKB-B during NF-KB activation. IKB-B is a 45 kD protein and can
regulate p50/p65 and p50/C—Rel complexes also (Ghosh et al., 1998); however, distinct
differences in signal response kinetics exist between IKB-0t and IKB-B. Specifically, IKB-
a is rapidly degraded in response to activating stimuli and reappears to terminate gene
expression (Arenzana-Seisdedos et al., 1995). In contrast, the regeneration of IKB-B
occurs only upon removal of the activation stimulus, therefore the duration of responses
regulated by IKB-B is prolonged (Thompson et al., 1995). An additional mechanism also
contributes to the persistent activation by IKB-B. Unphosphorylated IKB-B reportedly
binds to cytosoliC NF-KB to protect it from IKB-0t (Suyang et al., 1996). This NF-
KleKB-B complex translocates to the nucleus where NF-KB activates gene expression.
The degradation of IKB-e also follows slower kinetics. An initial Characterization of IKB-
8 has suggests the selective modulation of dimers containing only p65 or C-Rel
(W hiteside et al., 1997). It is thought that IKB-e regulates a specific subset of dimers and
may serve a specialized function. BCl-3, another IKB family member, resides in the
nucleus rather than the cytosol to interact with homodimers of p50/p50 or p52/p52 (Nolan
et al., 1993). Another unique feature of BCl-3 is its ability to bind to KB sites on DNA as
a BCl-3:p50/p50 complex which results in gene activation (Bours et al., 1993).
Additional insight into the mechanism of NF—KB regulation by Bel-3 or other members of

the IKB family is presently unknown.

3. Induction and regulation of NF-KB
A diverse group of stimuli are known to induce NF—KB DNA binding activity in a
variety of cell types. Such stimuli include pro-inflammatory cytokines,

lipopolysaccharide, PMA, UV light, reactive oxygen species, antigen, and viral proteins

(Barnes and Karin, 1997). As mentioned above, NF-KB exists in the cytosol of

28

unstimulated cells bound to the IKB proteins. Originally, the mechanism by which NF-
KB dissociated from IKB was unclear. Early studies demonstrated that PMA was a
potent inducer of NF-KB, thus phosphorylation by PKC was considered important for
activation (Baeuerle et al., 1988). PKA was also shown to activate NF-KB through a
phosphorylation event (Muroi and Suzuk, 1993; Shirakawa et al., 1989; Shirakawa and
Mizel, 1989). Evidence supporting PKA-mediated phosphorylation of IKB includes the
induction of NF-KB DNA binding by forskolin or dibutyryl CAMP and inhibition of NF-
KB binding activity in the presence of the PKA inhibitor H89 (Muroi and Suzuk, 1993).
Further Characterization of the stimuli-induced phosphorylation mechanism uncovered
the specific phosphorylation of IKB-0t on two serine residues (Ser 32 and Ser 36)
(Brockman et al., 1995; Brown et al., 1995). Conversely, peptide aldehyde inhibitors of
the 26S proteosome (i.e. calpain I or MG-132) prevent the degradation of IKB-0t (Brown
et al., 1995; Lin et al., 1995). These findings suggested that additional regulatory
mechanisms are involved in the release of NF-KB from IKB. Chen and co-workers
discovered that IKB-0t was ubiquitinated in HeLa cell extracts following phosphorylation,
and the ubiquitinated IKB-0t remained associated with the NF-KB dimer (Chen et al.,
1995). These studies also described the degradation of the ubiquitinated form of IKB-0t
by the 26S proteosome. It is notable that the initial phosphorylation of IKB-0t is essential
for subsequent ubiquitination and degradation. In summary, a specific series of events is
required for NF-KB activation (Figure 4): (1) phosphorylation of IKB-0t on Ser 32 and Ser
36; (2) ubiquitination of neighbor lysine residues; (3) degradation of IKB-0t by the 26S
proteosome; and (4) nuclear translocation of NF-KB to bind KB sequences in DNA.
Recently, a large cytosolic IKB kinase complex has been identified (Mercurio et
al., 1997; Regnier et al., 1997; Zandi et al., 1997). Two IKB kinases, designated IKKOI
and IKKB, have been Characterized as subunits of the larger IKB regulatory complex

(DiDonato er al., 1997). IKKot and IKKB can form heterodimers and function to

29

Figure 4. Schematic representation of the NF-KB signaling pathway. In quiescent
cells, NF-KB is retained in the cytosol bound to the inhibitor, IKB-a. Following an
activation stimulus, IKB-a is phosphorylated by IKB kinases within the IKB kinase
complex. The phosphorylation triggers the ubiquitination (Ub) and subsequent
degradation of IKB-a by the 26S proteosome. IKB-a degradation enables the nuclear

translocation and DNA binding of NF-KB to KB sequences in the promoter region of
target genes.

30

 

£63: Z

 

 

 

 

 

comumgfiwofi 358205 3.3
5-6.. I a”. 4' Q
s. 0 4/ 333600
.5pr e . 63:2 mo:
~89th

 

mmmmmgmmmmgmmmmg $33 33% mag 33%
EEEEEEEEEEEEEEEEE Eat

magma
countable.

phosphorylate IKB proteins in response to NF-KB inducing stimuli (DiDonato et al.,
1997; Woronicz er al., 1997). In addition to the IKK molecules, a protein named NF-KB
Essential Modulator (NEMO) has been described as a critical component of the IKB
kinase complex (Yamaoka er al., 1998). NEMO appears to be essential for kinase
complex formation and necessary for NF-KB activation by PMA, LPS, and IL-1. Current
research efforts have focused on the elucidation of the mechanisms involved in the
regulation of the IKB kinase complex. Initially, Malinin and coworkers reported the
involvement of a MEKK-l related kinase termed NF-KB-inducing kinase (NIK) in the
activation of NF-KB following TNFa and IL-1 stimulation (Malinin et al., 1997).
Recently, NIK has been shown to preferentially phosphorylate IKKa following cytokine
stimulation which results in the activation of IKKa kinase activity (Ling et al., 1998). A
specific activation of IKKB by MEKKI has also been described (Nakano et al., 1998)
further demonstrating the differential activation of IKKa and IKKB by upstream kinases.
These studies suggest that MEKKl and NIK can activate the IKB kinase complex
independent of each other. Although the complete regulation of the IKB kinase complex
is presently unclear, it has been speculated that the multi-subunit complex may function
to integrate signals from a variety of NF-KB activation pathways (May and Ghosh, 1998).

Additional regulation of the NF-KB dimer has been described at the level of the
cytosolic NF-KB:IKB complex. The catalytic subunit of PKA (PKAC) is associated with
the complex and remains inactive when bound with the NF-KleKB proteins (Zhong et
al., 1997; Zhong et al., 1998). Upon degradation of IKBot, PKAC becomes activated and
phosphorylates the p65 component of the NF-KB dimer. This function of PKA in the
regulation of NF-KB has therefore been Characterized as a CAMP-independent
mechanism. The post-translational modification of p65 by PKAC can significantly
increase p65 DNA binding and to potently augment the transactivating activity of p65

(Zhong et al., 1997; Zhong et al., 1998).

32

Attenuation of NF-KB gene expression occurs through an autoregulatory feedback
loop. This is mediated through the binding of NF—KB to KB sequences in the promoter
region of IKB-0t resulting in an increased expression of the IKB-or gene. Following its
degradation, IKB-0t rapidly reappears and has been detected as early as 90 min post-
stimulation (Henkel et al., 1993). The newly synthesized IKB-0t reforms a complex with
cytosolic NF-KB dimers rendering them inactive. IKB-or can also extinguish the
activation signal by entering the nucleus and removing the NF-KB bound to DNA

(Arenzana-Seisdedos er al., 1995).

4. Immune response genes regulated by NF-KB

Several pathological conditions have been associated with Chronic or abberant
NF—KB activation including cancer, atherosclerosis, septic shock, and inflammatory
conditions. With respect to the immune system, NF—KB regulates many of the genes
involved in inflammation and leukocyte activation. Examples of genes up-regulated by
NF-KB include acute phase response proteins, cytokines and Chemokines, adhesion
molecules, inducible nitric oxide synthase (iNOS), and cyclooxygenase-2 (COX-2)
(Barnes and Karin, 1997). The prominent involvement of NF-KB in regulating
inflammatory genes has generated substantial interest in NF-KB regulation as a potential
therapeutic strategy. The current therapy for inflammatory disease conditions utilizes
glucocorticoids as immunosuppressive agents. Interestingly, glucocorticoids modulate

the transcription of inflammatory response genes, in part, by altering the activation of
NF-KB. This occurs at the molecular level through several independent mechanisms. A
direct interaction between the glucocorticoid receptor and NF-KB has been demonstrated
in the nucleus which causes sequestration of NF-KB thereby preventing its binding to KB
sites in DNA (Ray and Prefontaine, 1994; Scheinman et al., 1995b). The glucocorticoid
receptor also utilizes the negative feedback loop involved in NF-KB regulation by binding

to the KB sites in the promoter of IKB-0t and initiating the synthesis of new IKB-0t

33

(Scheinman et al., 19953). As previously stated, IKB-0t sequesters NF-KB into the
inactive form located in the cytosol. However, the abundance of negative side-effects

associated with Chronic glucocorticoid therapy has heightened interest into the

development of molecularly specific inhibitors of NF-KB.

III. T-lymphocyte Background

A. T-Cells and the immune system

T lymphocytes perform a multitude of biological functions and are important
effector cells of the acquired immune response. Two populations of T-CClls exist and are
distinguished by the differential expression of CD4 or CD8 coreceptors on their surface.
These T-Cells can also be identified by their immunologic activities with CD4+
lymphocytes usually referred to as T helper (Th) cells and CD8+ lymphocytes typically
known as T cytotoxic (Tc) cells. More specifically, Th cells produce and secrete
cytokines in response to stimulation while Tc cells eliminate virus-infected and tumor
cells. Two distinct subpopulations of T helper cells have been Characterized (i.e., Th1
and Th2), and each Class displays a specific cytokine profile. Th1 lymphocytes
synthesize IL-2 and IFN-y and are involved in cell-mediated immunity whereas Th2 cells
produce IL-4, IL-5, and IL-10 to facilitate humoral immune responses (Mosmann et al.,
1986). Additionally, Th1 and Th2 Subsets can cross-regulate each other with IFN-y
down-regulating Th2 cells and IL-10 inhibiting Th1 activity.

The stimulation of T-Cell effector function depends upon antigen activation of the
T-CCll receptor expressed on the surface of mature T-Cells. The T-Cell receptor (TCR) is a
heterodimer of or and B proteins and associates with a multi-unit CD3 complex consisting
of delta, epsilon, gamma, and zeta polypeptide Chains. The CD3 Chains are organized as
specific dimers including a gamma/epsilon heterodimer, a delta/epsilon heterodimer, and
a zeta homodimer. The principal role of the CD3 complex is the transmission and

amplification of activation signals from the TCR to the nucleus.

34

B. T-Cell development

T-cell development is a complex, multi-step process that originates in the bone
marrow and continues in the thymus. Hematopoietic stem cells are the lymphoid
precursors within the bone marrow which give rise to several different lymphoid lineages.
The earliest step in the developmental process is the migration of T-Cell progenitors from
the bone marrow to the thymus by entering the bloodstream. Once in the thymus, pro-
thymocytes express the Thy-1 surface marker indicating these progenitor cells are
committed to the T-CCll lineage (Rodewald et al., 1994). The expression of the receptor
tyrosine kinase C-kit is also detected on thymus progenitors (Hattori et al., 1996);
therefore, the earliest thymocytes are denoted as Thy-1+C-kit+ cells. The progression of
T-cell development is generally monitored by Changes in surface molecule expression,

and subpopulations of thymocytes are often identified by such nomenclature (Figure 5).

1. Double negative thymocytes

During the first stage of development in the thymus, immature T-Cells are
considered double negative thymocytes as they lack expression of CD4 and CD8 co-
receptors (i.e., CD4'CD8'). These double negative thymocytes are located in the
subcapsular region of the thymus. The CD4'CD8' cells also lack any form of a T-Cell
receptor initially; however, they do express multiple surface markers including CD44,
CD25, and C-kit (Ceredig et al., 1985; Godfrey et al., 1992; Raulet, 1985; Trowbridge et
al., 1985). CD25 is the alpha subunit of the interleukin-2 receptor and CD44 is an
adhesion molecule. In fact, four subsets of double negative thymocytes have been
identified through the differential expression of C-kit, CD25, and CD44 (Godfrey et al.,
1993; Pearse et al., 1989). The first two subsets differ only in the level of CD25
expression with the earliest thymocytes being C-kit+CD4~4+CD25' and the second
population being C-kit+CD4-4+CD25+. With the loss of C-kit and a decrease in CD44, the
third subset of double negative thymocytes (CD25+CD44‘/1°W) acquires a pre-TCR

35

Figure 5. The ordered progression of T-lymphocyte development. Immature T-Cells
progress through three major stages of development within the thymus. Each phase is
defined by the surface expression of the CD4 and CD8 coreceptors. The expression of
other specific molecules unique to each phase has also been described as depicted in the
figure. Thymocytes in the first stage of development are denoted as double negative due
to the lack of CD4 and CD8 expression (CD4-CD8-). Double negative thymocytes
possess an early form of the TCR known as the preTCR. Acquisition of CD4 and CD8
molecules occurs during the second developmental stage to produce double positive
thymocytes (CD4+CD8+). The a and B Chains of the TCR can be detected at the double
positive stage. Positive and negative selection of double positive cells generates single
positive thymocytes expressing either the CD4 or CD8 coreceptor (CD4+CD8-; CD4-
CD8+). Single positive thymocytes exit the thymus and become the mature T-Cell
population.

36

 

 

 

 

 

 

 

 

 

\ J
+mQO + - a a a
Bu «we a a
nexus nexus $8 369
£8.50 Till +wQU TANGO +390 +3..an -mNQU
-mQUiA—U nouoflcm +50 1350 Bo<évQU go +3.90
o>uewoz -36 .56 +63 +53
new 03:ch— .
- wDU - EU
F k
mDSCEH

m 83E

eczeomoa
All :89
b

 

m=oo 88m

30%2
m—ZOm

37

through the rearrangement of the TCR B subunit gene (Dudley et al., 1994; Mallick et al.,
1993). Further analysis of TCRB in CD4'CD8' murine thymocytes determined the
association of a 33 kD peptide that functions as a partner for TCRB in the absence of
TCRa (Groettrup et al., 1993; Groettrup and von Boehmer, 1993). This additional
polypeptide was appropriately identified as pTa (Saint-Ruf et al., 1994). Thus, the pre-
TCR on developing thymocytes is a heterodimer composed of TCRB and pTa peptides.
The significance of pTOt expression was demonstrated by Fehling and coworkers using
pTOt‘l' mice. These animals exhibited a 10-fold decrease in thymocyte number along
with compromised development of T-Cells expressing the formal OtBTCR (Fehling et al.,
1995).

Consistent with a fundamental role for the pre-TCR during development, several
reports have demonstrated the signaling potential of the thymocyte TCR. The pre-TCR
associates with a CD3 complex that differs from the mature TCR:CD3. Select protions of
the CD3 complex have been shown to weakly interact with the preTCR, namely the
epsilon, gamma, and zeta Chains of CD3 (Borst et al., 1996; Groettrup et al., 1992; Punt
et al., 1991). Biochemical analysis of the CD3 expressed on immature thymocytes has
revealed an impairment in the production of double positive cells in the absence of CD3§
(Love et al., 1993; Malissen et al., 1993; Ohno er al., 1993). Furthermore, cross-linking
of CD38 or CD3§ initiated signals important for the transition from CD4'CD8' to
CD4'*'CD8+ thymocytes (Shinkai et al., 1995). Although the specific details of pre-TCR
signaling have yet to be elucidated, an involvement of the tyrosine kinase p56ICk has
been suggested. This is supported by the disruption of aB thymocyte development in
mice with targeted mutations in the le gene (Molina et al., 1992). Similar effects were
also detected in a dominant-negative p56ICk transgenic model (Levin et al., 1993).
Moreover, normal maturation of pTa'/' thymocytes occurs when an active form of le is
expressed (Fehling er al., 1997) implicating p56le in the transmission of pre-TCR

signals. The participation of additional downstream signaling components, including

38

kinases and specific nuclear targets, is relatively uncharacterized at the present time
(Rodewald and Fehling, 1998).

The final subset in the double negative sequence is the C-kit'CD25'CD44‘l19W
thymocytes which possess a productive pre-TCR and demonstrate an increase in the CD2
surface molecule. It is now recognized that proper B gene rearrangement and synthesis of
a functional pre—TCR is essential for triggering the proliferation and progression of late

CD4'CD8' thymocytes to the double positive stage.

2. Double positive thymocytes

The differentiation into double positive thymocytes is marked by the acquisition
of CD4 and CD8 coreceptor molecules (i.e., CD4+CD8+)- The pTot Chain is also
replaced by the rearranged (1 gene of the TCR during this stage of thymopoiesis (Petrie et
al., 1995; Wilson et al., 1996) resulting in the formation of the aBTCR. Thymocytes
unable to generate productive TCRocB dimers fail to mature and subsequently undergo
apoptotic cell death. CD4+CD8+ thymocytes also experience positive and negative
selection which establishes the MHC restricted, self-tolerant TCR repertoire of mature T-
cells. Positive selection examines the ability of newly synthesized aBTCR to recognize
self-MHC I and II molecules on the cortical epithelial cells of the thymus (von Boehmer,
1994). Specific recognition of self-MHC by the TCR maintains thymocytes for further
maturation. Studies utilizing a thymic organ culture system have demonstrated the
importance of the MHC interaction in positive selection. For example, mice deficient in
key components of either the MHC I or MHC II complex had diminished CD8+ and
CD4+ positive selection, respectively (Tourne et al., 1995; Zijlstra et al., 1990). By
comparison, negative selection is mediated by the macrophages and dendritic cells of the
bone marrow. Specifically, these APCs present antigenic peptides to the CD4+CD8+
cells to determine the degree of antigenzTCR interactions. Thymocytes displaying either

high affinity for the peptide/MHC complex or recognition of 'self antigen are eliminated

39

by apoptosis (Nossal, 1994). In addition to the affinity of the TCR, negative selection
also appears to be dependent on the concentration of the antigen. Several studies have
shown that low peptide concentrations promote positive thymocyte selection while high
concentrations result in negative selection (Alarn et al., 1996; Ashton-Rickardt et al.,
1994; Sebzda et al., 1994). Thus, low affinity TCRs and low concentrations of antigen
can rescue developing thymocytes from death by providing survival signals . '

Despite recent advances in T-Cell development, the molecular aspects of thymic
selection are relatively unknown. A direct relationship between the quantity of TCR
signals and selection has been described in CD3; knock-out mice expressing low levels
of an HY-specific TCR. HY is a male—specific antigen that normally induces the negative
selection of T-Cells in males that recognize HY; however, positive selection of HY-
speCifiC T-CClls occurred in the male mice of the CD3C‘I‘ model (Yamazaki et al., 1997).
The authors suggest these findings are due to decreased HY-TCR levels rather than the
stimulation of a unique positive selection signal. Alternatively, the nature of the
antigenic peptide has been proposed to modulate TCR-mediated signaling events. Two
kinetic models, the kinetic proofreading model and the kinetic discrimination model,
attribute variations in TCR signaling during selection to differences in peptide affinity
(MCKeithan, 1995; Rabinowitz et al., 1996). For example, low affinity peptides may lead
to incomplete formation of the TCR signaling complex whereas high affinity peptides are
more likely to generate complete activation complexes. Therefore, alterations in
signaling induced by differential ligand affinity may be involved in the overall selection
of CD4+CD8+ thymocytes.

It is also unclear whether distinct signals exist for positive and negative selection
processes. Recently, several transgenic studies have provided insight into the specific
involvement of various signaling pathways. The expression of an inactive form of the
p56lck tyrosine kinase demonstrated its participation in positive and negative selection

(Hashimoto et al., 1996). A similar role for the Zap-70 kinase in both selection processes

40

has also been shown in Zap-70 deficient mice (Negishi et al., 1995). In contrast, calcium
signals and the MAP kinase pathway appear to be involved only in positive selection.
Overexpression of dominant negative forms of several components of the MAPK
pathway, including Ras, Raf-1, and Mek-l, interferred with positive selection (Alberola-
Ila et al., 1995; O'Shea et al., 1996; Swan et al., 1995). Similarly, cyclosporin A
inhibition of the calcium/calmodulin dependent phosphatase, calcineurin, significantly
reduced positive selection (Wang et al., 1995). Based on this initial evidence, several
elements of the mature aBTCR signaling network seem to play selective roles in
CD4‘"CD8+ thymocyte selection.

The final stage in T-Cell development is the lineage commitment of selected
thymocytes. At this point, double positive cells differentiate into single positive
thymocytes that express only one of the surface coreceptors (i.e., CD4+CD8' or CD4'
CD8+). Consequently, the two major populations of mature T-Cells are established and
their effector function is determined. The CD4+CD8‘ subset represents the T helper

lymphocytes and the CD4'CD8+°subset serves as cytotoxic T-Cells.

C. T-lymphocyte activation and associated signaling pathways

The activation of mature T-Cells is initiated by T-Cell receptor recognition of
antigen presented by the major histocompatability complex (MHC) I or II expressed on
the surface of antigen presenting cells (APC). The associated CD4 and CD8 coreceptors
interact with antigen in the context of MHC II or MHC 1, respectively, and activate the
p5610k and p59f)’n src-family tyrosine kinases. Upon activation, le and fyn
phosphorylate the immunoreceptor tyrosine-based activation motifs within the
cytoplasmic regions of the TCR/CD3 complex which serve to recruit additional early
signaling components, namely the Zap-70 and phosphoinositide (PI)-3 kinases (Carpenter
and Cantley, 1996; Chan et al., 1992). The tyrosine kinases also couple the TCR to
multiple signaling pathways through the activation of phospholipase Cy (PLC) and p21r as

41

thereby initiating a complex cascade of biochemical events. PLC transmits a
fundamental signal through the production of two second messengers which trigger
pathways essential for T-Cell activation. PLCy hydrolyzes phosphatidylinositol 4,5-
biphosphate (PIP2) into inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG) which
initiates calcium responsive signals and activates PKC.

The regulation of calcium by IP3 occurs through an IP3 receptor present on the
membrane of the endoplasmic reticulum. Binding of IP3 to the IP3 receptor mobilizes
calcium stores resulting in an increase in intracellular calcium levels. Following the
initial burst of calcium, a depletion of the endoplasmic reticulum stores is sensed and
extracellular (332+ enters the T-cell through an unidentified Channel in the plasma
membrane. The regulation of calcium levels in lymphocytes is mediated by calcium-
release-activated calcium (CRAC) Channels that differ from the traditional voltage-gated
calcium channels (Hoth and Penner, 1992). Therefore, the process of modulating and
maintaining Ca2+ levels in immune cells has been termed capacitative calcium entry
(Berridge, 1995). The primary action of calcium is to activate Ca2 +/Calmodulin
dependent enzymes involved in transcription factor regulation including the serine
phosphatase calcineurin and Ca2+lCaM kinase IV. CalCineurin is the best Characterized
effector of the calcium signal and functions to regulate the activity of the NF-AT
transcription factor family. Specifically, activated calcineurin dephosphorylates the
cytosolic NF—AT protein allowing its nuclear translocation and induction of cytokine
gene expression. Recently, several studies have demonstrated the importance of the
Ca2+/CaM kinase type IV (CaMKIV) during T-CCll activation events. The involvement
of CaMKIV was initially supported by its selective expression in the nucleus of T-
lymphocytes along with an increase in its kinase activity following activation of the T-
cell (Gringhius et al., 1998; Means er al., 1997). Furthermore, the expression of a kinase
inactive form of CaMKIV in thymocytes resulted in a significant reduction of PMA/Io-

induced IL-2 (Anderson et al., 1997) suggesting a critical role for CaMKIV in IL-2

42

regulation. CaMKIV has also been shown to regulate transcription factors as evidenced
by an increase in CREB phosphorylation and AP-l activity in T-Cells (Anderson et al.,
1997; Gringhuis et al., 1997).

Once produced, diacylglycerol activates PKC; however, the specific contribution
of PKC to T-CCll activation is not well defined. An involvement of PKC is supported by
considerable evidence using phorbol esters to activate PKC which results in transcription
factor phosphorylation and gene expression. In fact, phorbol ester plus calcium
ionophore (PMA/Ionomycin) is a stimulus that Closely mimics activation of the TCR and
is often used experimentally to stimulate T-Cells in vitro. As depicted in figure 6, PMA
activates PKC and ionomycin increases intracellular Ca2+ levels which together induce
the signaling cascades necessary for T-Cell activation. Multiple isozymes of PKC have
been identified in several cell types, but the precise function of particular isoforms in T-
cells is the focus of current investigation. Studies using activated isoforms have
demonstrated that PKCe can stimulate NF—AT, AP-l, and NF-KB in the Jurkat cell line
whereas PKCO activates AP-l in EL-4 cells (Baier-Bitterlich et al., 1996; Genot et al.,
1995). In addition, PKCa has been shown to induce NF-AT activity (Berridge, 1997).
Thus, it appears that several PKC isoforms may modulate the activity of DNA binding
proteins and participate in T cell activation. The involvement of PKC in the regulation of
p21ras is controversial in T-Cells as PKC-dependent and PKC-independent activation of
Ras has been described (Izquierdo et al., 1994; Ohtsuka et al., 1996). The potential
stimulation of Ras by PKC would suggest an upstream regulatory role for PKC in T-Cell
activation.

Activation of p21ras transmits signals to the nucleus through a kinase
phosphorylation cascade involving Raf-1, MEK, and MAP kinase. Initiation of the Ras
pathway occurs through the tyrosine phosphorylation and activation of the Raf-1 kinase
by Ras-GTP. Once activated, Raf-1 phosphorylates serine residues on MEK-l and MEK-
2 which subsequently phosphorylate the MAPK kinases ERK-1 and ERK-2 on tyrosine

43

 

Phosphatases

Transcription
Factors

Figure 6. Activation of a T-cell by PMA plus Ionomycin. The phorbol ester and
calcium ionophore combination of PMA/Ionomycin mimics signaling through the T-Cell
receptor and is used in vitro to activate T-Cells. PMA activates PKC and ionomycin
increases intracellular calcium levels. Together these signals activate kinase cascades and
transcription factors essential for T-CCll activation.

and threonine residues. The terminal event in the Ras cascade is the nuclear translocation
of activated ERK-l and ERK-2 and the phosphorylation of AP-l and Elk-1 proteins
(Graves et al., 1995; Karin, 1995). The Ras pathway has also been described as an
important signaling component of the TCR complex. For example, activation of T-
lymphocytes with anti-CD3 antibody or the phytohemagglutinin mitogen was shown to
induce Ras activity (Downward, 1990). Transfection of activated p21ras in the presence
of increased intracellular Caz+ stimulated the IL-2 promoter whereas expression of an
inhibitory Ras mutant blocked the induction of IL-2 following TCR activation (Rayter et
al., 1992). Similarly, expression of a donrinant-negative Ras in thymocytes abrogated
TCR-mediated signals for proliferation and maturation (Sawn et al., 1995). AP-l, the
predominant downstream effector of the Ras pathway, is essential for the regulation of
IL-2 expression. In addition to AP-l, Ras can synergize with calcium signals to activate
NF—AT which results in IL-2 transcription (Woodrow et al., 1993). Taken together, these
studies have established a role for p21ras in T-Cell activation and IL-2 production.
Although the Ras signaling cascade is stimulated by the TCR, the regulation of p21r as in
T-lymphocytes is poorly understood. As mentioned above, the activation of Ras by PKC
is controversial due to conflicting results from independent studies. Recently, the
modulation of MAPK activity by P1 3-kinase has been described in primary T-Cells of the
lymph node. Eder and coworkers demonstrated that activated PI 3-kinase was necessary
for MEK-l and ERK-2 activation (Eder et al., 1998). Expression of a dominant-negative
mutant of PI 3-kinase also inhibited the activation of AP-l and NF-AT transcription
factors and IL-2 expression in activated T-cells. These findings suggest that PI 3-kinase
may regulate the Ras pathway through a PKC—independent mechanism in primary T-
cells.

Complete activation of T-lymphocytes requires a second costimulatory signal
delivered by CD28. CD28 is constitutively expressed as a homodimer on the surface of

T-cells and interacts with B7 molecules on antigen presenting cells. Activation of CD28

45

delivers distinct signals to compliment those emanating from the TCR and is necessary to
prevent a state of unresponsiveness known as anergy or tolerance (Harding et al., 1992).
Although the cytoplasmic domain of the CD28 costimulatory molecule lacks intrinsic
enzyme activity, it does contain known motifs for protein-protein interactions (June at al.,
1994). The exact signaling events coupled to CD28 have not been completely resolved;
however, evidence does exist for several potential mechanisms. CD28 costimulation
induces the tyrosine phosphorylation of several cellular proteins including the cytoplamic
tail of CD28 (Lu et al., 1992; Pages et al., 1994; Vandenberghe et al., 1992). An
association between the tyrosine kinases p56le and psgfyn and CD28 has been shown in
the Jurkat human T-Cell line suggesting their involvement in CD28-mediated signaling
(Hutchcroft and Bierer, 1994). Similarly, the activation of p72ITK’EMT, a TeC family
tyrosine kinase, occurs following ligation of the CD28 molecule (August et al., 1994).
Therefore, it is likely that multiple tyrosine kinases can mediate the early signals from
CD28. The recruitment of PI 3-kinase to the cytoplasmic tail of CD28 has implicated its
involvement in the CD28 signaling cascade. A role for PI 3-kinase is also supported by
kinase inhibition studies which reported a decrease in IL-2 upon stimulation of resting T-
cells in the presence of wortmannin, a PI 3—kinase inhibitor (Ward, 1995). Furthermore,
mutation of essential tyrosine residues within the CD28 tail markedly diminished PI 3-
kinase activation and IL-2 production induced by CD28 activation (Pages at al., 1994).
Anti-CD28 antibodies have been shown to activate the p21ras pathway resulting in
increased Raf-1 and MAPK activity suggesting the participation of these kinases in
CD28-mediated signaling (Nunes et al., 1994). The coupling of CD28 to the Ras
signaling cascade may occur through the tyrosine phosphorylation of select adaptor
molecules. For example, phosphorylation of the p62 protein is specific to CD28
activation, and p62 can associate with p21ras (Nunes et al., 1996) demonstrating a
potential link between CD28 and MAPK pathway. Although the biochemical signals

mediated by CD28 are still being dissected, the end result is the activation of transcription

46

factors. Evidence exists for the activation of both NF—KB and AP-l following CD28
ligation suggesting that signaling through the TCR and CD28 can modulate some of the
same DNA binding proteins (Emead er al., 1996). In fact, it has been postulated that
CD28-mediated signals may serve to increase the extent and/or the duration of TCR-
mediated signals to achieve full activation of the T—Cell. Ultimately, these signaling
pathways culminate in the production and secretion of IL-2 as well as the induction of IL-

2 receptor expression on the T-CCll surface.

D. Interleukin-2 and the regulation of its expression

The hallmark of T-lymphocyte activation is the production and secretion of IL-2.
IL-2 is a 15 kD glycoprotein produced only by activated T helper cells and is central to
the generation of an immune response. IL-2 possesses pleiotropic activity and functions
as an autocrine and paracrine factor by stimulating the proliferation and differentiation of
several cell types within the immune system. IL-2 was initially Characterized as a T-Cell
specific growth factor because it was essential for the clonal expansion and cell cycle
progression of T-Cells. Specifically, IL-2 stimulates advancement through 61 into the S
phase of the cell cycle following an antigen-induced transition from Go to G1 (Stern and
Smith, 1986). This cytokine also plays an important role in the differentiation of CD4+
and CD8+ T-Cells into functional effector cells, an example being the stimulation of CI‘L
cytolytic activity (Wagner and Rollinghoff, 1978). In addition to T-Cell regulation, IL-2
plays a fundamental role in the proliferation and differentiation of B lymphocytes
(Forman and Pure, 1991; Zubler et al., 1984). For instance, examination of in vitro
humoral immune responses detected an augmentation of antibody production in the
presence of lL-2 (Watson et al., 1979). Subsequent studies in murine B-cells determined
that IL-2 could stimulate mRNA expression of the J chain and the secretory 11 Chain, both
of which are necessary for the assembly of the IgM pentamer molecule (Blackman et al.,

1986; Nakanishi et al., 1984). The positive effects of IL-2 on T- and B-Cells demonstrate

47

its involvement in acquired immune responses; however, IL-2 can also modulate the
cellular constituents of innate immunity. IL-2 functions to stimulate natural killer (NK)
cell activity and promotes the derivation of lymphokine-activated killer cells from the NK
cells. Additionally, an enhancement of the phagocytotic activity of macrophages has
been described with IL-2 (Gomez et al., 1998).

In order to elicit its biological effects, IL-2 must bind to IL—2 receptors (IL-2R)
expressed on target cells. In fact, IL-2 receptor expression has been identified on Th1
cells, CD8+ cytotoxic T cells, N K cells, B cells, and macrophages (Gomez et al., 1998).
The complete IL-2R is composed of three separate polypeptides of varying sizes that
have been established as the or, B, and y Chains . The trimeric complex of aBy is
considered to be the high affinity form of the IL-2 receptor. The or chain is a 55 kD
protein, and its expression is rapidly induced by antigen or mitogen stimulation
(Aschennan et al., 1997). However, the presence of the or Chain alone represents only a
low affinity binding site for IL-2 (Wang and Smith, 1987). By comparison, a
heterodimer of the B and y Chains produces an IL-2 binding site of intermediate affinity
(Wang and Smith, 1987) whereas either chain alone has very low affinity for lL-2. The B
Chain of the receptor is 75 kD and possesses an extensive cytoplasmic region that is
essential for IL-2-mediated signal transduction (Merida et al., 1993). Similarly, the 64
kD y Chain is also involved in transmitting signals from the receptor, and several studies
have shown that heterodimerization of IL-2RB and IL-2Ry is required for IL-2R signaling
(N akamura et al., 1994; Nelson et al., 1994). The binding of IL—2 to its receptor activates
the proximal signaling mediators recognized as the JAK tyrosine kinases. Specifically,
the B and y Chains of the IL-2R interact with the JAKl and JAK3 kinases which results in
the tyrosine phosphorylation of target proteins (Miyazaki et al., 1994; Nelson et al.,
1996). One such target of the JAK kinases is the STAT family of transcription factors
that transmit cytokine-induced signals to the nucleus. The recruitment and activation of

both Stat 3 and Stat 5 proteins has been demonstrated following engagement of the IL-2R

48

(Lin et al., 1996; Stahl et al., 1995). The down-regulation of high affinity receptors has
been reported as a consequence of the IL-2:IL-2R interaction (Smith and Cantrell, 1985).
This Change is accompanied by a marked increase in the number of low affinity binding
sites apparently as a mechanism for regulating cellular responses to IL-2.

Expression of the IL-2 gene is tightly regulated at the level of transcription;
therefore, activation of the TCR is a prerequisite for IL-2 production. The 300 base pairs
located directly upstream of the transcriptional start site are designated the minimal
essential promoter region of the IL-2 gene (Serfling et al., 1989). This portion of DNA is
the least amount required for IL-2 mRNA synthesis and contains binding sites for a
variety of transcription factors. As depicted in figure 7, the essential IL-2 promoter
consists of two AP-l sites, a pair of NF-AT sequences, two Octamer sites, an NF-KB
sequence, and a CD28 responsive element (CD28RE) (Fraser et al., 1991; Novak er al.,
1990). All of the transcription factors that bind to these sites are induced by T-cell
activation with the exception of the octamer proteins. Moreover, the diversity of these
DNA binding proteins illustrates the integration and cooperation of multiple signaling
pathways for IL—2 expression.

The prototypic AP-l complex is a heterodimer of Fos and Jun nuclear proteins
and binds to TPA-responsive elements (TRE) following cellular activation. Two TRE
motifs known as the proximal and distal AP-l sites within the IL-2 promoter are located
from -145 to -151 and -l79 to -185 bp, respectively. DNA footprint protection of the AP-
lp site (Jain et al., 1992b) coupled with the detection of DNA bound Fos and Jun in
activated T-Cells (Vacca et al., 1992) demonstrated that the proximal sequence was
critical for induction of the IL-2 gene. Furthermore, mutation of the AP-lp sequence
resulted in a substantial reduction in IL-2 induced by phorbol ester plus calcium
ionophore (Jain et al., 1992b). Similar analysis of the AP-ld site in these studies failed to

detect significant Changes in IL-2 expression. In addition to the proximal and distal TRE

49

.Coucha mud 06 no common £5 £55 3282 0.3 5:805 68.800 use .32 F<¢Z .mgiz 95535
Beaofi confinement .8 but? a C8 moi manage <75 .26 gm Racumtomcwb 05 88m 8353: an 8m boaefimxcamm mm
commmeaxo oeow C8 3.662 8880:“ mad 2: mo common 22. .3389:— Nfii 2: me new»?— 33:88 15:52 .5 953%

mm. an- 92. ET m5- mm“- tum- emm-
so 3.? En? so

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

L Srmz mango mormz e<mz
.352. OS. 9:. #2- VB- m3- vow- com- com-

50

sequences, AP-l participates in the regulation of IL-2 at both NF-AT and Octamer motifs
as will be described below.

Two binding sites for NF-AT (nuclear factor of activated T-CClls) are positioned at
-130 to -140 bp and -260 to -290 bp upstream of the IL—2 transcriptional start site.
Mutational studies have determined that the presence of both sequences is vital for IL-2
promoter activity (Boise et al., 1993). T-cell activation induces a protein/DNA binding
complex composed of NF-ATC and NF-ATn which display different subcellular
localization. NF-AT C is dephosphorylated by calcineurin enabling its nuclear entry and
DNA binding to NF-AT motifs (Flanagan et al., 1991). The nuclear component (NF-
ATn) of the protein complex is a Fos/Jun heterodimer (Jain et al., 1992a) which functions
to stabilize the binding of NF-ATC to the distal DNA site (Jain et al., 1993).
Interestingly, the NF-AT protein exhibits sequence homology to the NF-KB family of
proteins (Nolan, 1994).

NF-IKB/C-Rel transcription factors also play an important role in regulating the
expression of IL-2 in activated T-CClls. The recognized KB binding sequence is located
between the AP-ld and one of the octamer motifs at base pairs -l95 to -204 relative to the
transcriptional start site. This KB site has been shown to be a significant regulatory
element of the IL-2 promoter in primary T-cells (Hughes and Pober, 1996).
Traditionally, the p65/p50 heterodimer binds the KB motif in activated T-CClls to increase
the expression of target genes. Several recent reports have also established that select
members of the NF-KB family can bind to the CD28RE (-154 to -164) within the IL-2
promoter demonstrating further regulation of IL-2 by the NF-KB/C-Rel proteins (Butscher
et al., 1998; Ghosh er al., 1993; Lai et al., 1995; McGuire and Iacobelli, 1997). p50, p65,
and C-Rel have all been identified in the CD28RE binding complex and the specific
p65/C—Rel heterodimer was shown to be a potent transcriptional activator of the CD28RE
(Ghosh et al., 1993; Lai et al., 1995).

51

The remaining DNA sequences of the IL-2 promoter are the binding sites for the
octamer transcription factors (-72 to -79 bp and -247 to -254 bp). The Oct—1 protein is
ubiquitously expressed in most cell types whereas Oct-2 is a lymphocyte specific protein.
Interestingly, Oct-l and Oct-2 bind to the octamer sequences with equal binding affinity
and occupy adjacent DNA regions in resting cells. Examination of the DNA binding
activity of Oct-1 in stimulated cells detected a necessary interaction with an octarner-
associated protein (OAP40) for IL-2 production (Ullman er al., 1991). CAP40 was later
described as the AP-l heterodimer of Fos and Jun (deGrazia et al., 1994; Ullman et al.,

1993) and was also shown to interact with the Oct-2 protein (deGrazia et al., 1994).

E. The role of the CAMP pathway in T-cells

1. Inhibition by CAMP

The role of CAMP in immune function has conventionally been thought of as a
negative regulatory signal based on studies utilizing high concentrations of membrane-
perrneable CAMP analogs or agents that dramatically elevate intracellular CAMP levels.
This immunoinhibitory effect of CAMP has often been associated with a reduction in
mitogen-stimulated lymphoproliferation and cell cycle arrest at the transition between G1
and the S phase (Goodwin et al., 1977; Johnson et al., 1988; Maraguchi et al., 1984).
The activation of PKA type I in T-cells has been shown to inhibit TCR-triggered
proliferation (Skalhegg, 1992) providing a potential mechanism for dysregulation of T-
cell replication by CAMP. An increase in CAMP also alters T-CCll cytokine production by
decreasing Th1 cytokine levels and enhancing the expression of Th2 cytokines. Several
reports have described an inhibition of IL-2 and IFN-y synthesis in activated mouse and
human T-CClls by forskolin, CAMP analogs, and PGE2 (Betz and Fox, 1991; Didier et al.,
1987; Snijdewint et al., 1993). By comparison, IL—4 was resistant to inhibition by CAMP
and IL—5 was up-regulated by CAMP elevating agents in these T-Cells. In addition, the
presence of PGE2 during the priming of naive CD4+ T-Cells inhibits the mRNA

52

expression of IL-2 and IFN-y in a dose-dependent manner whereas IL-4 and IL-5
synthesis was not affected (Katamura et al., 1995). Similar results were obtained with
forksolin and dibutyryl CAMP in this study suggesting that CAMP may differentially
regulate the development of Th1 and Th2 cytokine production.

Analysis of the molecular mechanisms of CAMP-mediated inhibition of T-Cells
has detected Changes in the signaling cascades essential to T-Cell activation. Several
studies have reported that increased intracellular CAMP suppresses PLCy activity and
phosphoinositide turnover (Alava et al., 1992; Bismuth et al., 1988; Lerner et al., 1988)
indicating that CAMP can inhibit the initiation of upstream biochemical signals. An
association of PKA I with the TCR/CD3 complex also occurs following T-Cell activation
(Skalhegg et al., 1994). These authors speculated that the inhibitory effect of CAMP may
be mediated by PKA phosphorylation interfering with TCR signaling pathways.
Pretreatment of Jurkat cells with Cholera toxin, which increases CAMP by direct
activation of Gas, inhibits TCR-mediated activation of Ras resulting in decreased IL-2
promoter activity (Ohtsuka et al., 1996). A similar inhibition of IL-2 has been
demonstrated in EL-4 cells and occurs, in part, through the repression of NF-AT by
CAMP (T suruta et al., 1995). In addition to interfering with initial activation signals,
CAMP also modulates the activity of downstream kinases. Recently, Hsueh and Lai
observed that C-Jun N-terminal kinase (JNK) and MAP kinase display a diffferential
sensitivity to CAMP-mediated inhibition in both EL-4 cells and splenic T-lymphocytes.
The activity of IN K was selectively inhibited by CAMP and correlated with a repression
of IL-2, but ERK activation remained unaffected by CAMP treatment (Hsueh and Lai,
1995). Furthermore, the inhibition of JNK was a delayed effect of CAMP and required
protein synthesis for effective antagonism of kinase activity. In contrast, forskolin and
dibutyryl CAMP were found to suppress the activation of ERK in phorbol ester or CD3
stimulated Jurkat and EL-4 T cell lines (Tamir et al., 1996).

53

2. Stimulation by CAMP

Interestingly, those studies reporting an inhibition of immune function by CAMP
analogs at high concentrations also found these analogs to be immunostimulatory at
lower, physiological concentrations. A positive role of CAMP in lymphoid systems is
further supported by the rapid and transient increase in intracellular CAMP levels
following lymphocyte activation through the TCR or with mitogen (Hadden et al., 1972;
Kaminski et al., 1994; Kammer, 1988; Kammer et al., 1988; Russell, 1978). In contrast
to inhibition by PKA, considerable evidence exists for a stimulatory role of PKA in T-Cell
activation and proliferation. Stimulation of human T lymphocytes with either anti-CD3
or phorbol ester/calcium ionophore resulted in an increase of type I PKA activity and
phosphorylation of proteins associated with the T-cell plasma membrane (Laxminarayana
et al., 1993). Additionally, expression of antisense oligomers to the PKA regulatory or
catalytic subunits produced an inhibition of basal PKA activity and IL-2 synthesis in
activated mouse hybridoma cells (Sugiyama et al., 1997). These findings implicate PKA
as an antigen-responsive kinase involved in the propagation of TCR signals essential for
T-CCll lymphokine expression. A critical involvement of PKA in cell cycle progression
has also been demonstrated through the induction of cell cycle arrest by inhibition of
PKA and reversal of this arrest by low concentration of 8-bromo-CAMP (Grieco et al.,
1996). Moreover, direct addition of CAMP analogs (10-100 11M) to mouse spleen
cultures was shown to increase the humoral immune response to sheep red blood cells as
well as to enhance PMA/Io stimulated lymphoproliferation (Koh et al., 1995).
Furthermore, activation of human peripheral T-lymphocytes with mitogen induces CRE
binding complexes (W ollberg et al., 1994). Together this evidence implicates CAMP as a
positive second messenger in lymphocyte activation and function at physiological
concentrations.

Despite the lack of a consensus CRE sequence in the IL-2 promoter, several

recent reports have described a fundamental role for the CREB/ATF proteins in IL-2

54

regulation (Barton et al., 1996; Butscher et al., 1998; Hsueh et al., 1997). This was
initially shown by a novel study in transgenic mice expressing a dominant-negative form
of CREB. Expression of this abberant form of CREB produced a significant decrease in
mitogen-stimulated proliferation and IL-2 production in thymocytes and induced cell
cycle arrest in these T-cells (Barton et al., 1996). Supershift studies have also identified
CREB as part of the protein complex binding to the AP-l proximal (AP-1p) site of the
IL-2 promoter (Chen and Rothenberg, 1993). In addition, stimulation of EL-4.IL-2 cells
with PMA/Io plus forskolin enhanced binding to the AP-lp site further suggesting the
direct involvement of CREB/ATP proteins in IL-2 regulation through the CAMP pathway
(Condie et al., 1996). Collectively, these findings indicate that the CAMP pathway has a

positive regulatory role during T-lymphocyte activation.

55

MATERIALS AND METHODS

1. Animals

Virus-free female B6C3F1 mice, 5-6 weeks of age were purchased from the
National Cancer Institute. On arrival, mice were randomized and transferred to plastic
cages containing a saw dust bedding (5 mice per cage). Mice were given food (Purina
Certified Laboratory Chow) and water ad libitum. Thymocyte studies were performed
using mice between 6 and 8 weeks of age. Animal holding rooms were kept at 21-24°C

and 40-60% relative humidity with a 12 hour light/dark cycle.

H. Chemicals

Cannabinol (CBN) and A9-THC were both provided by the National Institute on
Drug Abuse. LPS, PMA, ionomycin, forskolin, and dibutyryl CAMP were all purchased
from Sigma (St. Louis, MO). H89 was purchased from Calbiochem (San Diego, CA).

III. Culture Medium

For cell proliferation, IgM AFC responses, and the ELISA, splenocytes or
thymocytes were cultured in RPMI 1640 supplemented with 5% BCS (Hyclone, Logan,
UT), 2 mM L-glutamine, antibiotic-antimicotic (100 units penicillin and 100 11g
streptomycin) (GIBCO, Grand Island, NY), and 5 x 10'5 M 2-mercaptoethanol (complete
RPMI medium). For EMSA and western analysis, 1% BCS was used in complete

medium.
IV. Antibodies

Rabbit polyclonal antibodies for CREB-1, ATF-l, ATF-2, p50, p65, C-Rel, and
IKB-0t were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The phospho-

56

CREB/phospho-ATF-l antibody was purchased from New England Biolabs, Inc.
(Beverly, MA).

V. In vitro proliferative responses

Splenocytes were cultured in a 96 well culture plate at l x 105 cells/well in the
presence of either vehicle (0.1% ethanol), CBN (1, 5, 10, 15, 20 11M), or A9-THC (22
11M) and stimulated with either anti-CD3 (1.0 jig/ml; PharMingen, San Diego, CA), LPS
(100 uglml), or PMA (80 nM) plus ionomycin (1 11M). Splenocytes were cultured at
37°C and 5% CO2 for 48 hr (PMA/Io) or 72 hr (anti-CD3 and LPS) and pulsed with 1.0
uCi/well of [3H]-thymidine (NEN, Boston, MA) for the last 15 hr of the culture period.
Cells were harvested onto glass fiber filters with a PHD Cell Harvester (Cambridge
Technology, Inc., Cambridge, MA), and tritium incorporation was measured using a
Packard 460C liquid scintillation counter. Results are expressed as mean cpm j; SE of

quadruplicate samples.

VI. In vitro IgM antibody forming cell response (AFC)

Splenocytes were cultured at 1 x 107 cells/ml in a 48 well Costar culture plate
(Cambridge, MA) and A9-THC (22 11M), CBN (1, 5, 10, 15, 20 11M), or vehicle (0.01%
ethanol) were added directly to spleen cell cultures. Each well was sensitized with 6.5 x
106 sRBC and cultured for 5 days in a Bellco stainless steel tissue culture chamber
pressurized to 6.0 psi with a gas mixture consisting of 10% 02’ 7% C02, and 83% N2.
The culture Chamber was continously rocked on a rocking platform for the duration of the
culture period. Enumeration of the AFC response was performed as previously described
(Kaminski and Holsapple, 1987). Results were expressed as the mean AFC/106
splenocytes 1: SE.

57

VII. In vivo IgM antibody forming cell response (AFC)

Mice (5 animals/group) were treated orally with either vehicle (corn oil, Sigma,
St. Louis, MO), cannabinol, or A9-THC for 3 consecutive days and were sensitized on
day 2 with sheep erythrocytes (sRBC) (5 x 108 c/rnl) by i.v. injection. Enumeration of
the AFC response was performed on day 5 as previously described (Schatz et al., 1993).
Briefly, spleens were removed from the mice, made into a single cell suspension, and
adjusted to 1 x 107 cells/n11 in RPMI 1640. A 50 ul aliquot of splenocytes was added to a
12 x 75 mm heated culture tube containing 400 [11 of 0.5% agar (DIFCO, Detroit, MI)
dissolved in EBSS plus 0.05% DEAE-Dextran. Guinea pig complement (25 111) and
sRBC (25 111) were added to each tube and samples were quickly vortexed. Each sample
was poured onto a 100 x 15 mm petri dish and immediately covered with a 45 x 50 mm
microscope cover slip. The petri dishes were placed in an incubator at 37°C for 3 hr and
the number of AFCs were counted using a plaque viewer. Results are expressed as the

mean AFC/106 splenocytes :1: SE for 5 mice.

VIII. Pronase viability determination

Resuspended splenocytes (100 1.11) from each AFC treatment group were added to
an equal volume of pronase (Calbiochem-Behring Corp., San Diego, CA) and incubated
for 10 min at 37°C. Following incubation, splenocytes were diluted with 10 ml of Isoton
(Coulter, Addison, NJ) and counted on a Coulter counter. The percent viability was
calculated by the following equation: (cell counts with pronase/cell counts without

pronase) x 100 = viable cells.

IX. CAMP determination

Splenocytes or thymocytes were resuspended in RPMI 1640 containing 1 mg/ml
fatty acid-poor bovine serum albumin and adjusted to 5 x 106 C/ml. Aliquots of cells (1
ml) were incubated with either vehicle (0.1% ethanol), A9-THC (22 11M), or CBN (1, 5,

58

10, 15, 20 M) for 10 min followed by stimulation with forskolin (50 11M) for 15 min at
37°C in 5% CO2. Adenylate cyclase activity was terminated by addition of extraction
buffer (1 ml 1N HCl/100 ml EtOH) and cells were sonicated for 20 sec on ice to release
the intracellular CAMP into solution. Samples were centrifuged at 1600 x g for 15 min to
pellet the cellular debris and the supernatant was retained. Levels of CAMP in
reconstituted cell lysates were determined using a CAMP RIA assay kit (Diagnostic
Products Inc., Los Angeles, CA). Tritium incorporation was measured using a Packard
460C liquid scintillation counter. The concentration of CAMP in each sample was
determined by comparison with a standard curve. Results are expressed as mean cpm i

SE of triplicate samples.

X. Analysis of PKA activity

Splenocytes were washed in phosphate buffered saline and lysed in ice cold lysis
buffer (0.25 M Sucrose, 5 mM Tris Base, 5mM EGTA, 1 mM PMSF, 0.1 mM DTT,
0.1% Trition X100, 10 ug/ml leupeptin, 10 mg/ml aprotinin) followed by gentle
sonication (i.e., twice at 50 Hz for 5 sec). Lysates were centrifuged at 270 x g for 5 min,
and aliquots of the cell extract (100 1.11) were incubated with appropriate concentrations of
CBN or A9-THC for 5 min in triplicate for use in the PKA assay (GIBCO BRL, Grand
Island, NY). The assay reaction mixture contained 10 111 of cell extract, 50 mM Tris-HCl
(pH 7.5), 10 mM MgCl2, 100 11M ATP (20 uCi/ml y-[32P]ATP, 0.25 mg/ml BSA, 50
11M Leu—Arg-Arg-Ala-Ser-Leu-Gly (Kemptide; PKA substrate). The background enzyme
activity for each treatment group was determined using 1 11M PKI-(6-22)-amide and total
PKA activity was assessed using 10 11M CAMP. Samples were incubated at 37°C for 10
min and spotted on phosphocellulose discs (20 111 of sample) followed by two phosphoric
acid washes (1% v/v) and two washes with distilled water. The amount of 32F was

quantified by scintillation counting.

59

XI. Cellular Lysis Methods

A. Whole Cell

Thymocytes (l x 106 C/ml) were stimulated with PMA/Io (80 anl 1.1M) for the
indicated time points (0-120 min). For the studies with CBN, thymocytes were pretreated
with CBN ( 1, 5, 10, 15, 20 11M) for 15 min and stimulated with PMA/Io (80 nM/l M)
for 30 min. At the end of the culture period, thymocytes were lysed with 500 u] of RIPA
buffer (1x phosphate buffered saline, 1% Nonidet P40, 0.5% sodium deoxycholate, and
0.1% SDS) supplemented with 1mM DTT, 1 mM PMSF, and 1 jig/ml of aprotinin and
leupeptin. Following addition of RIPA buffer, cells were homogenized with a dounce
homogenizer (30 strokes) and incubated on ice for 30 min. Samples were then

centrifuged at 17500 x g for 20 min and the supernatant retained as whole cell protein.

B. Nuclear

Splenocytes and thymocytes were stimulated with forskolin (50 11M) or PMA/Io
(80 nM/ 1 tLM) in the presence and absence of CBN (20 BM). Following treatment, cells
were lysed with HB buffer (10 mM HEPES and 1.5 mM MgCl2, 1mM DTT, 1mM
PMSF, and l rig/ml of aprotinin and leupeptin) and the nuclei were pelleted by
centrifugation at 6700 x g for 5 min. Nuclei were lysed on ice for 30 min in hypertonic
buffer (30 mM HEPES, 1.5 mM MgCl2, 450 mM NaCl, 0.3 mM EDTA, and 10%
glycerol) supplemented with 1mM DTT, 1 mM PMSF, and 1 ug/ml of aprotinin and
leupeptin. Following nuclear lysis the samples were centrifuged at 17500 x g for 15 min,

and the supernatant was retained.

C. Cytosolic
Treated thymocytes were lysed with 500 u] of HB buffer (same as above in
nuclear lysis protocol) and incubated on ice for 15 min. The nuclei were pelleted by

centrifugation at 6700 x g for 5 min and the supernatant was retained. Glycerol (10%)

60

was added to the supernatant and samples were centrifuged at 100,000 x g for 1 hr at 4°C.

The resulting supernatant contained cytosolic proteins.

XII. Protein Determination

Determination of protein values for samples isolated using all lysis methods was
performed using the bicinchoninic acid method (Sigma, St. Louis, MO). A standard
curve was prepared using increasing concentrations of BSA (0, 5, 10, 15, 20, and 25 ug)
in a total volume of 100 111. Unknown protein samples (10 111) were also prepared into a
final volume of 100 u]. The protein assay reagent (bicinchoninic acid plus copper (H)
sulfate) was added (2.0 ml/sample) and samples were incubated for 30 min at 37°C. The
absorbance was determined at 562 nm using a Beckman DU-600 spectrophotometer

(Fullerton, CA).

XIII. Electrophoretic mobility shift assay (EMSA)

Double stranded DNA oligomers containing either the CRE (TGACGTCA) or
the KB (GGGGACTTTCC) consensus sequence were end-labeled with [y-32P]dATP
(NEN, Boston, MA) using T4 kinase (Pharmacia Biotech, Piscataway, NJ). Nuclear
extract (5 pg) was incubated in binding buffer (100 mM NaCl, 30 mM HEPES, 1.5 mM
MgCl2, 0.3 mM EDTA, 10% glycerol, 0.05% Nonidet P-40, 1mM DTT, 1 mM PMSF,
and 1 rig/m1 of aprotinin and leupeptin) with 0.5 pg of poly (dI-dC) and the 32P-labeled
probe for 10 min on ice. DNA binding activity was separated from free probe using a 4%
acrylamide gel (National Diagnostics, Atlanta, GA) in 1x TBE buffer (89 mM Tris, 89
mM boric acid, and 2 mM EDTA). After electrophoresis, the gel was dried and
autoradiographed for analysis. For supershift analysis, antibodies for ATF-l, ATP-2,
p50, p65, and C-Rel were added following the incubation of nuclear proteins with
radiolabeled probe. CREB-1 antibody was incubated with the nuclear proteins prior to

addition of the radiolabeled CRE probe.

61

XIV. Western analysis

Isolated proteins from treated thymocytes (25 ug) were incubated with 4x loading
dye (62.5 mM Tris, 2% SDS, 10% glycerol, 0.01% bromophenol blue, and 1% 2-
mercaptoethanol) and heated for 10 min at 95 °C. Samples were then resolved on a 10%
SDS-PAGE gel and transferred overnight at 4°C to nitrocellulose in transfer buffer (24
mM Tris, 191 mM Glycine, 20% methanol). The nitrocellulose was blocked for 1 hr with
5% milk-TBST (Tris Buffered Saline plus Tween 20) and probed with the indicated
primary antibody. For the IKB-or studies, the nitrocellulose was incubated with either
IKB-0t (200 ng) or IKB-0t (200 ng) plus p65 antibody (200 ng) for 2 hr at room
temperature. Analysis of phospho-CREB was determined using 30 ng of phospho-
CREB/ATF-l specific antibody. An anti-rabbit Ig horseradish peroxidase-linked
secondary antibody was used for phospho-CREB, p65, and IKB-0t protein detection using
the ECL chemiluminescent system (Amersham, Arlington Heights, IL).

XV. EMSA-Western

Nuclear proteins (8 ug) from treated and untreated thymocytes were incubated
with 0.5 pg of poly (dI-dC) and either the 32P-labeled KB probe (30,000 cpm) or the cold
KB probe (10 pMoles) in binding buffer on ice for 10 min followed by separation on a 4%
acrylamide gel. Following electrophoresis, the 32P-labeled samples were dried and
subjected to autoradiography, and the protein complexes bound to cold KB probe were
transferred overnight at 4°C to nitrocellulose in transfer buffer (0.4% SDS, 48 mM Tris,
39 mM Glycine, 20% methanol). Following transfer, nitrocellulose was blocked with 1%
milk-TBST for 1 hr followed by incubation with either p65 (200 ng) or C-Rel (400 ng)
antibody for 2 hr. An anti-rabbit Ig horseradish peroxidase-linked secondary antibody

was used for protein detection using the ECL system (Amersham, Arlington Heights, IL).

62

XVI. Quantitative RT-PCR

A. Preparation of Internal Standard for RT-PCR

A recombinant mRNA (rCRN A) was constructed using a rat B-globin sequence as
the spacer gene for the IL-2 internal standard (IS). The IS contained specific PCR primer
sequences for mouse IL-2 and was added to RNA samples in a dilution series. The
primer sequences from 5' to 3’ for IL-2 are: forward primer =
TGCTCCTTGTCAACAGCG, and reverse primer = TCATCATCGAATTGGCACTC.
The design of the IS primers from 5' to 3' is: IS forward primer = T7 promoter
(T AATACGACT CACT ATAGG), IL-2 forward primer (stated above), and rat B-globin
forward primer (GGTGC'I'I‘GGAGACAGAGGTC); and IS reverse primer = (dT)13, IL-
2 reverse primer (stated above), and rat B-globin reverse primer
(TCCTGTCAACAATCCACAGG). PCR conditions for making the internal standard
were performed using 100 ng of rat genomic DNA as previously described (Vanden
Heuvel et al., 1993). Purification of PCR products was performed using the Wizard PCR
Prep DNA purification system (Promega, Madison, WI) and was followed by
transcription of the products into RNA using Promega's Gemini II In Vitro Transcription

System. The IS was treated with RNase-free DNase to remove the DNA template.

B. Quantitative competitive reverse transcriptase-polymerase chain reaction

RNA was isolated using TriReagent (Sigma, St. Louis, MO) as outlined by
Chomczynski and Mackey (Chomczynski and Mackey, 1995). Competitive RT-PCR was
performed as previously described (Gilliland et al., 1990) except that rcRNA was used as
the internal standard instead of genomic DNA. Aliquots of internal standard ranging
from 5 x 102 to 1 x 106 molecules were used to generate a standard curve for IL-2. Total
RNA from treated thymocytes (100 ng) and known amounts of IS rcRNA were reverse-
transcribed into CDNA using oligo(dT)15 as primers. A PCR reaction mixture containing

PCR buffer, 4 mM MgCl2, 6 pmol of IL-2 forward and reverse primers, and 2.5 units of

63

Taq DNA polymerase was added to the CDNA products. Samples were then heated to
94°C for 15 sec, 55°C for 30 sec, and 72°C for 30 sec followed by an additional
extension step at 72°C for 5 min. This process was repeated for 32 cycles to amplify the
IL-2 DNA product. PCR products were electrophoresed in 3% NuSieve 3:1 gels (FMC
Bioproducts, Rockland, ME) and visualized by ethidium bromide staining. The IL-2
primers produce an amplified product of 391 bp from the sample RNA and a 474 bp
product from the IS. Quantitation was performed using the Gel Doc 1000 (BioRad,
Hercules, CA) to determine the amount of IL—2 present in the cellular RNA. The ratio of
the volume of the IS rcRNA to IL-2 RNA bands is plotted against the concentration of IS
rcRNA (molecules) added to each reaction. The point at which the ratio of IS to IL-2
RNA equals one is designated the "cross-over" point. This point indicates the amount of

IL-2 molecules present in the cellular RNA sample.

XVII. ELISA

Thymocytes were cultured in triplicate (1 x 106 C/ml) in 12-well culture plates for
24 hr. Supematants were collected post-stimulation and quantified for IL-2 using the
sandwich ELISA method. The IL-2 standard (mouse recombinant IL-2), purified rat anti-
mouse IL-2 antibody, and biotinylated anti-mouse IL-2 antibody were purchased from
PharMingen (San Diego, CA). Irnmunolon IV Removawell microtiter strip wells (Dynex
Technologies, Inc., Chantilly, VA) were coated overnight at 4°C with 50 1.11 of purified rat
anti-mouse IL-2 antibody (1.0 jig/ml) in 0.1 M sodium bicarbonate buffer (pH 8.2).
Wells were blocked with 300 11.1 of BSA (3% v/v) in 0.01 M PBS containing 0.1% (v/v)
Tween 20 (BSA-PBST) at 37 °C for 30 min. Wells were washed 4 times with PBST
followed by addition of IL-2 standard or sample (50 111) and incubated at 37°C for 1 hr.
The standard curve was generated using recombinant mouse IL-2. After the incubation
period, the plate was washed 4 times with PBST and once with distilled water. The

biotinylated anti-mouse IL-2 (1.5 til/ml) was diluted in 3% BSA-PBST, added to each

well (50 111), and incubated at room temperature for 1 hr. The plate was washed 6 times
using the PBST solution and once with distilled water followed by addition of 50 111
streptavidin-horseradish peroxidase (1.5 jig/ml) for 1 hr at room temperature. Lastly,
samples were washed 8 times and the bound peroxidase conjugate was detected by
addition of substrate solution (100 til/well) containing 0.1 M Citric-phosphate buffer (pH
5.5), 0.1 mg/ml tetramethylbenzidine (Fluka Chemical Corp., Ronkonkoma, NY), and 1%
H202. The reaction was terminated with an equal volume of 6N H2SO4, and absorbance
values were obtained at 450 nm using a microplate reader (Bio-Tek Instruments, Inc.,
Winooski, VT). IL-2 concentrations were quantitated using Delta Soft 3 software

(BioMetallics, Princeton, NJ).

XVIII. Densitometry

The optical density of each treatment group was obtained using the Multi-Analyst
program and a GS-700 imaging densitometer (BioRad, Hercules, CA). Using the density
values, the ratio between the control and treated samples was calculated. The control
group was designated with the value of 1.0 in order to assess qualitative Changes between

treatments.

XVIX. Statistical analysis

The mean 1 SE was determined for each treatment group in the individual
experiments. Homogeneous data were evaluated by a parametric analysis of variance,
and Dunnett's two-tailed t-test was used to compare treatment groups to the vehicle

control when significant differences were observed (Dunnett, 1955).

65

EXPERIIVIENT AL RESULTS

The identification of CB1 and CB2 cannabinoid receptors on immunocompetent
cells has provided a putative mechanism of action for cannabinoids; however, the
molecular mechanisms of cannabinoid-induced immune suppression have not been
characterized. Furthermore, the preference of cannabinol for the CB2 receptor coupled
with its minimal activity in the CNS makes cannabinol an intriguing plant-derived
cannabinoid compound. The hypothesis of this research project was: Cannabinol disrupts
the CAMP signaling cascade in thymocytes thereby decreasing the activation of
CREB/ATF and N F—KB/C-Rel transcription factors. The DNA binding of these proteins
within the promoter region of IL-2, a T-cell derived lymphokine, is subsequently
inhibited and ultimately alters immunocompetence. The specific aims of this research
were: 1) to examine the effects of cannabinol on immune function, CAMP-mediated
signal transduction, and IL-2 expression; 2) to identify specific CREB/ATP and NF-KB/c-
Rel proteins modulated by cannabinol in activated thymocytes; 3) to characterize the
inhibition of CREB and NF-KB transcription factor activation by cannabinol, and 4) to
determine the role of CAMP and PKA in the regulation of IL-2, CREB, and NF-KB
following T—Cell activation.

The results for studies fulfilling these objectives are described in six separate
sections below. The effects of cannabinol on immune function endpoints are described in
section 1. Inhibition of the CAMP signaling pathway by cannabinol, including effects on
adenylate cylcase, PKA, and CRE binding activity in splenocytes and thymocytes is
presented in section II. Section IH describes the cannabinol-induced inhibition of IL-2
mRNA and protein secretion in thymocytes. In section IV, the effects of cannabinol on
CREB/ATF and NF-KB/C-Rel DNA binding activity following PMA/Io activation of
thymocytes are presented. The identification of specific CRE and KB transcription

factors modulated by cannabinol is also provided in section IV. The studies in section V

66

address the mechanism by which cannabinol modulates the activation of CREB and NF-
KB proteins. Lastly, results Characterizing the role of CAMP and PKA in the regulation of
CREB, NF-KB, and IL-2 are shown in section VI.

I. Effects of cannabinol on immune function

A. Proliferative responses

To determine the potential immunomodulatory activity of cannabinol, mitogen-
induced proliferation of mouse splenocytes was measured. As presented in Table 1,
cannabinol inhibited anti-CD3 induced proliferation by 30% and 74% at 15 and 20 11M
concentrations, respectively. Cannabinol also produced a dose dependent inhibition of
LPS-induced proliferation at all concentrations (1, 5, 10, 15, 20 11M) tested (Table 1). It
is notable that the magnitude of inhibition by A9-THC (22 11M), a positive control, and
cannabinol (20 1.1M) were very comparable. Cannabinol was also found to alter antigen
receptor independent lymphocyte activation as shown by a marked inhibition of PMA/Io-
induced proliferation (Table 1). Interestingly, as previously reported with A9-THC, of
these three proliferative stimuli tested, the PMA/Io response appeared to be the most

sensitive to inhibition by cannabinol (Kaminski et al., 1994; Schatz et al., 1993).

B. IgM Antibody forming cell response

The effects of cannabinol on humoral immunity were investigated by employing
the hemolytic plaque assay. The IgM T-dependent AFC humoral response has been
previously found to be highly sensitive to inhibition by A9-THC, CP-55,940, and HU-210
(Kaminski et al., 1992; Schatz er al., 1993); therefore, a similar experimental approach
was utilized to evaluate the activity of cannabinol. In the present studies, cannabinol
exhibited a dose dependent inhibition of the in vitro T-dependent AFC response at 10, 15,
and 20 11M concentrations as compared to the vehicle control (0.01% ethanol) (Table 2).

No effect on cell viability was observed at any of the cannabinol concentrations tested.

67

 

 

2 .8» .232 mm .48 a so: em 3% Haws. 21 cm 28
a. .830. SE mm .82 H32 2 .25 25.2 21 2 200
ow .32 32:. mm .32“ $3 o: 9.2 0.88». 21 2 28
Ne .542 358 oo 3% H :42 e2 .32 “team 21 m 28
em .Now H88» a as A woman a: $4288 21 A 200
cm .mmemamwma. A $3 08% a. $3268 21 am one
2: 3.33% 2: 82 08%.“ OS 82 #8: :>
2: $3388 a Raw 39% N2 Eamon: <2
N *8: Home m .8 “22 e .4382 eowaa. oz
Aoeeou a. £22m aheou cs m5 soaeou e. 8905.. 25:85

 

 

Baum oaowsi

 

98% 0BE0> 05 9 cemtmmfioo
53» 3.03 @2055 .5 358.000 3 36 v a... .8383 8023503 08 mm in 508 05 00 “003898 03 San— fiota 03:50

2: Co a 2 as one 80 8655951 a? Baa so; 6.682% .25»: 8: was Co 5.5»: 08 Boss. .221 s on as
A2: o8 SE hose 5? Basses. as 05.42 Co .200 .2500 e3 ”Ev some? sec .8 ooeoaoa 2: a =o§=oo S x _

H0 03R :03? a 5 3.530 803 BS0823 .eeucamsm =00 Ewan m 95 038 was 008—004 203 802% 8:9: 2

262

:0530505 60338505033:— ec 3:32:30 «0 Beam

fl Emir

68

TABLE 2

Effect of cannabinol on the in vitro IgM AFC response to sRBC

Spleens from naive B6C3F1 mice were isolated and made into a single cell suspension.
Splenocytes (l x 107 cells/ml) were added to a 48 well culture plate and treated with
either vehicle (VH; 0.1% EtOH), CBN, or A9-THC. The cultures were sensitized with

sRBC (1 x 109 cells/ml). On day 5, the number of antibody forming cells (AFC) were
determined. The results are expressed as the mean i SE for quadruplicate samples.
*p<0.05 as determined by Dunnett's t-test with comparison to the vehicle group.

 

 

Treatment AFC / 106 splc % Control Viability (°/o)
NA 1046 i: 65 118 70 i5
VH 884: 28 100 78 i 3
THC 22 uM 265i 22* 30 80 :t 2
CBN 1 uM 643i105 73 78 i 2
CBN 5 uM 6721'. 33 76 81 i 3
CBN 10 [1M 5902': 45* 67 87 i 2
CBN 15 uM 545 i 27* 62 79 i 3
CBN 20 [1M 3861': 51* 44 91 i3

 

69

 

2000'
T THC
I CBN
1500 -
£ *
T; .
u
\c .
a 1000
\
U
in
<1
500-

 

 

 

 

NA 'VH 100 25 50 75 100
Treatment (mg/kg)

Figure 8. Effect of cannabinol on the in viva IgM AFC response to sRBC. Female
B6C3F1 mice were treated orally for 3 consecutive days with either vehicle (VH; corn
oil), A9-THC, or CBN at the indicated doses. Mice were sensitized with sRBC (5 x 108
c/ml) on day 2 and the IgM AFC response was measured on day 5. The results are
expressed as the mean :1; SE for five animals per treatment group. *p<0.05 as determined
by Dunnett's t-test with comparison to the vehicle group.

70

The effects of cannabinol administration on the in viva IgM AFC response were also
examined. For these studies, mice were treated with cannabinol (25, SO, 75, and 100
mg/kg) for 3 consecutive days and sensitized with sRBC on day 2. As shown in figure 8,
cannabinol inhibited the IgM AFC response at 75 mg/kg and 100 mg/kg.

In summary, the analysis of immune function endpoints demonstrated that
cannabinol exhibits immunosuppressive activity. The degree of immune suppression
produced by cannabinol was comparable to that of A9-THC and was consistent with the

preference of cannabinol for the CB2 receptor.

II. Inhibition of the cAMP signaling cascade by cannabinol

A. Inhibition of forskolin-stimulated adenylate cyclase activity by

cannabinol in murine leukocytes

The binding of A9-THC to cannabinoid receptors has been widely established to
negatively regulate adenylate cyclase activity in a variety of leukocyte preparations
(Condie et al., 1996; Icon et al., 1996; Kaminski et al., 1994; Schatz et al., 1992). Due to
the similarity in structure of cannabinol to A9-THC and their comparable binding
affinities in mouse splenocytes (Schatz et al., 1997), studies were conducted to determine
if cannabinol, presumably acting through the CB2 receptor, would likewise inhibit
adenylate cyclase. Mouse splenocytes treated with forskolin (50 nM) for 15 min
exhibited stimulation of adenylate cyclase as demonstrated by approximately a 4-fold
increase in intracellular cAMP as compared to the unstimulated naive and vehicle treated
cells (Figure 9). Pretreatment of splenocytes with cannabinol prior to forskolin
stimulation decreased intracellular CAMP by 25% at 15 and 20 M. The magnitude of
inhibition by 20 uM cannabinol was again comparable to 22 11M A9-THC, the positive
control. The effects of cannabinol on adenylate cyclase activity in thymocytes were also
investigated because past studies have shown that T-cells are markedly sensitive to

inhibition by cannabinoid compounds (Condie et al., 1996; Kaminski et al., 1992; Schatz

71

NA
VH
VH+F
THC( M) 22
+ Fairs & -|*
1

 

 

 

CBN(uM)
+ Forsk 10

 

 

r

0 1 2 3 ' 4 5
CAMP (pMoles/ 5 x 10 6 cells)

 

Figure 9. Inhibition of forskolin-stimulated adenylate cyclase activity by cannabinol
in mouse splenocytes. Spleens were isolated and made into a single cell suspension of 5
x 106 cells/ml. Splenocytes were treated with either vehicle (VH; 0.1% ethanol), CBN,
or A9-THC for 10 min followed by a 15 min forskolin stimulation (50 nM). Intracellular
CAMP concentrations are expressed as the mean i SE for triplicate samples. *p < 0.05 as
determined by Dunnett's t-test with comparison to the forskolin-stimulated vehicle group.
One of three representative experiments is shown.

72

NA

 

 

VH
VH+FSK

' V

THC( M) \
_1
CBN (nM) 10

+FSK

15
_20

 

 

 

o-l
£11
p—A
O
p—A
LII
N
O
N
U’I
D)
O

CAMP (pMoles/S x 106 cells)

Figure 10. Cannabinol-mediated inhibition of forskolin-stimulated adenylate
cyclase activity in mouse thymocytes. Thymocytes were freshly isolated, adjusted to 5
x 106 cells/ml, and incubated with either vehicle (VH; 0.1% ethanol), CBN, or A9-THC
for 10 min followed by a 15 min stimulation with forskolin (50 nM). Intracellular cAMP
concentrations are expressed as the mean i SE for triplicate samples. *p< 0.05 as
determined by Dunnett's t-test with comparison to the forskolin-stimulated vehicle group.
One of three representative experiments is shown.

73

et al., 1993). Consistent with this observation, cannabinol dose-dependently inhibited
forskolin-stimulated adenylate cyclase activity in mouse thymocytes (Figure 10).
Interestingly, the increase in adenylate cyclase activity by forskolin was
significantlygreater in thymocytes than in splenocyte preparations. Scherer and
coworkers have recently demonstrated a similar difference in intracellular CAMP levels
following forskolin stimulation of thymocytes suggesting that CAMP may play a critical
role in T-cell differentiation (Scherer et al., 1995). Moreover, the magnitude of adenylate
cyclase inhibition by cannabinol is significantly greater in thymocytes than in splenocytes

which further supports the sensitivity of T-cells to cannabinoids.

B. Effect of cannabinol on PKA activity

PKA is immediately downstream from adenylate cyclase, and increases in
intracellular CAMP result in the dissociation and activation of the kinase catalytic subunit.
The inhibition of adenylate cyclase by A9-THC in the EL—4 cell line consequently leads
to a reduction in PKA activity (Condie et al., 1996). Considering the inhibition of
adenylate cyclase by cannabinol, splenocyte PKA activity was evaluated in the presence
of cannabinol. As shown in figure 11, cannabinol produced a concentration-dependent
inhibition of PKA activity at all concentrations (1, 5, 10, 15, 20 nM) tested. Again, the
magnitude of PKA inhibition between cannabinol and A9-THC was comparable at 20 M
and 22 uM concentrations, respectively. It is notable that experiments have been
performed in the presence of exogenous cAMP and no direct inhibition of PKA activity
was observed with A9-THC (Koh et al., 1997). These studies indicate that the inhibition
of PKA activity by cannabinol is mediated through an inhibition of cAMP formation

rather than through direct modulation of the protein kinase.

74

600—

   
   
   

 

 

 

 

33 ICBN
a 500 .
E ITHC
it; 400-
2
8:
E 300-
Z .
([3 200.
<
NA'FSK 1 5 10 15 20 22 Total

     

TREATMENT (uM)

Figure 11. Inhibition of PKA activity in forskolin-stimulated splenocytes by
cannabinol. Cell extracts were preincubated with CBN or 139-THC for 5 min and then
placed in reaction mixture containing substrate and 7-32P in the presence or absence of
forskolin (FSK; 50 nM) for 10 min. The results are expressed as the mean 3; SE for
triplicate samples. *p<0.05 as determined by Dunnett's t-test as compared to the forskolin
control group. One of two representative experiments is shown.

75

C. Inhibition of transcription factor binding to a CRE motif by cannabinol

Upon activation of PKA, the catalytic subunits translocate to the nucleus to
phosphorylate target proteins including the CREB/ATP family of transcription factors
(Hagiwara et al., 1993; Meinkoth et al., 1993). Due to the inhibition of CAMP formation
and PKA activity by cannabinol, the binding of PKA activated transcription factors to
DNA binding motifs was investigated. These studies demonstrated that forskolin
treatment alone induced binding to the CRE in spleen cells at 15, 30, 60 and 90 min
(Figure 12A compare lane 2, no forskolin stimulation to lanes 3, 5, 7, and 9) which
returned to basal level at 120 min. The observed time course is typical for forskolin-
stimulated CRE protein binding following activation of the CAMP signaling cascade as
measured by gel shift assays in a variety of cell types (Armstrong et al., 1995; Hagiwara
et al., 1992). Conversely, protein/CRE binding was markedly decreased in nuclear
proteins isolated from cannabinol (20 nM) treated splenocytes as evident at 15, 30, 60,
90, and 120 min (Figure 12A; lanes 4, 6, 8, 10, and 12 respectively). The specificity of
protein binding was demonstrated by addition of excess unlabeled CRE oligonucleotide
(Figure 12B). CRE binding was also investigated in thymocytes under identical
conditions to those used in the splenocyte preparations. A distinct protein complex was
induced by forskolin treatment of thymocytes at 15, 30, 60, 90, and 120 min (Figure 13A;
lanes 3, 5, 7, 9, and 11) with maximum binding detected at 90 min. The kinetics of CRE
binding appear to be slightly delayed in the thymocytes as compared to splenocytes in
that protein binding remains induced at 120 min in thymocytes whereas CRE binding
activity returned to basal levels in splenocytes by 120 min. Similarly, stimulation of
thymocytes with forskolin in the presence of cannabinol (20 nM) resulted in a marked
inhibition of CRE binding at all time points assayed (Figure 13A; lanes 4, 6, 8, 10, and
12). Protein binding to the CRE consensus motif was also specific as determined by cold

competitor studies (Figure 13B). In general, the diminution of CRE binding by

76

Figure 12. Inhibition of forskolin-induced binding to a CRE motif in mouse
splenocytes by cannabinol. A) Nuclear proteins (3 ug) from treated and untreated

splenocytes were incubated with 0.5 1.1g of poly (dI-dC) and the 32P—labeled DNA probe
in binding buffer on ice for 10 min followed by separation on a 4% acrylamide gel. Lane
1 represents free probe and lane 2 indicates unstimulated splenocytes. Lanes 3, 5, 7, 9,
and 11 represent forskolin-stimulated splenocytes while lanes 4, 6, 8, 10, and 12 indicate
forskolin-stimulated/CBN treated splenocytes. B) Cold competitor studies were
perfomred by adding 1 pmol of unlabeled CRE to the nuclear protein isolated from the 90
min forskolin sample. Results are representative of four separate experiments.

77

S semi

2:25.. new...“ mseefi

 

+ - -5028
+ + .8. ON. om 8 o... m: o 3.52::

.m <

 

78

Figure 13. Inhibition of forskolin-induced binding to a CRE motif in mouse
thymocytes by cannabinol. A) Nuclear proteins (3 ug) from treated and untreated

thymocytes were incubated with 0.5 ug of poly (dI-dC) and the 32P-labeled DNA probe
in binding buffer on ice for 10 min followed by separation on a 4% acrylamide gel. Lane
1 represents free probe and lane 2 indicates unstimulated thymocytes. Lanes 3, 5, 7, 9,
and 11 represent forskolin stimulated thymocytes while lanes 4, 6, 8, 10, and 12 indicate
forskolin stimulated/CBN treated thymocytes. B) Cold competitor studies were
performed by adding 1 pmol of unlabeled CRE to the nuclear protein isolated from the 90
min forskolin sample. Results are representative of three separate experiments.

79

2 semen

Nfififiofimwhomwmmfiofifi

 

Ammo
Ammu
._ +-+.“.+.H.H..+-.2mo
H ... H fiancee +o~.+ +8 +9... cm+ +m++ o waves:

.m .<

80

cannabinol is indicative of a marked decrease in the activation of CREB/ATF family of

transcription factors.

D. Inhibition of transcription factor binding to a KB motif by cannabinol

PKA is also involved in the activation of NF-KB/C-Rel transcription factors as
demonstrated by the induction of KB binding following stimulation with CAMP elevating
agents such as LPS, forskolin, and IL-1 (Muroi and Suzuk, 1993; Shirakawa et al., 1989;
Shirakawa and Mizel, 1989). Additionally, we have recently reported the regulation of
NF—KB/C- Rel transcription factors by the CAMP signaling cascade in the macrophage cell
line, RAW 264.7 (Jeon et al., 1996). In light of this, the DNA binding activity of NF-
KB/C-Rel proteins was examined in primary spleen cells and thymocytes. Incubation of
nuclear proteins from forskolin-stimulated splenocytes with a 32P-labeled KB oligomer
resulted in the formation of two distinct DNA binding complexes (Figure 14A). More
importantly, cells stimulated in the presence of cannabinol exhibited an attenuation of
NF-KB binding activity at 30 and 60 min (Figure 14A; lanes 6 and 8 respectively).
Studies in thymocytes revealed two major KB complexes and a minor upper complex in
forskolin-stimulated nuclear proteins (Figure 15A). Similarly, stimulation of cells in the
presence of cannabinol resulted in a marked inhibition of KB binding at 60, 90, and 120
min (Figure 15A; lanes 8, 10, 12). The formation of all protein complexes was inhibited
by excess unlabeled KB oligonucleotide in both cell preparations (Figure 14B
splenocytes; Figure 153 thymocytes).

This series of experiments demonstrated that cannabinol inhibits adenylate
cyclase activity presumably through the CB2 receptor which leads to downstream
signaling Changes in the CAMP pathway. In addition, forskolin stimulation was shown to
induce KB protein binding that is sensitive to inhibition by cannabinol. As T-Cells are

sensitive to inhibition by cannabinoid compounds, thymocytes were Chosen as the

81

Figure 14. Inhibition of NF-KB/c-Rel binding to a KB motif in forskolin-stimulated
splenocytes by cannabinol. A) Nuclear proteins (3 ug) from treated and untreated

spleen cells were incubated with 0.5 pg of poly (dI-dC) and the 32P-labeled DNA probe
in binding buffer on ice for 10 min followed by separation on a 4% acrylamide gel. Lane
1 represents free probe and lane 2 indicates unstimulated splenocytes. Lanes 3, 5, and 7
represent forskolin stimulated splenocytes while lanes 4, 6, and 8 indicate forskolin
stimulated/CBN treated spleen cells. B) Cold competitor studies were done by adding 1
pmol of unlabeled KB to the nuclear protein isolated from the 60 min forskolin sample.
One of three representative experiments is shown.

82

A
Ame.

  

, - MM 38
. gm“.

.m

E enema

 

o 3.5 e... p

.<

83

Figure 15. Inhibition of NF-KB/c-Rel binding to a KB motif in forskolin-stimulated
thymocytes by cannabinol. A) Nuclear proteins (3 ug) from treated and untreated

thymocytes were incubated with 0.5 pg of poly (dI-dC) and the 32P-labeled DNA probe in
binding buffer on ice for 10 min followed by separation on a 4% acrylamide gel. Lane 1
represents free probe and lane 2 indicates unstimulated thymocytes. Lanes 3, 5, 7, 9, and
11 represent forskolin stimulated thymocytes while lanes 4, 6, 8, 10, and 12 indicate
forskolin stimulated/CBN treated thymocytes. B) Cold competitor studies were done by
adding 1 pmol of unlabeled KB to the nuclear protein isolated from the 90 min forskolin
sample. One of three representative experiments is shown.

84

120

90

 

 

85

9101112

8

Lane

Figure 15

primary cell model for all subsequent experiments. The purpose of these studies was to

further investigate the mechanism of T-CCll suppression by cannabinol.

III. Inhibition of IL-2 expression by cannabinol

CREB and NF-KB are centrally involved in the regulation of IL-2 gene expression
through several regulatory elements within the IL-2 promoter. In light of the cannabinol-
mediated inhibition of CRE and KB DNA binding (Figures 13 and 15), the effects of
cannabinol on IL-2 production in primary T-Cells were examined. For these studies,
thymocytes were treated with cannabinol prior to activation with PMA/Io for 24 hr. A
significant reduction in IL-2 steady state mRNA expression was observed in cannabinol
(20 11M) treated thymocytes as compared to controls (Table 3). IL-2 mRNA was not
detected in unstimulated cells. Analysis of supernatants by ELISA demonstrated that the
maximal induction of IL-2 by PMA/Io in the absence of cannabinol was approximately
16.1 units/ml (Figure 16). By comparison, cannabinol inhibited IL-2 secretion by
thymocytes in a concentration-dependent manner. At 20 uM, cannabinol produced a
55% reduction in IL-2 as compared to the PMA/Io activated control. A positive
correlation was observed between the cannabinol-mediated inhibition of IL-2 steady state
mRNA expression and IL-2 secretion. No effect on cell viability was observed in any of

the treatment groups.

IV. The effects of cannabinol on thymocyte activation by PMA/Ionomycin
A. Cannabinol inhibits CRE and KB binding in PMA/Io activated
thymocytes
Cannabinol can inhibit the CAMP cascade in forskolin-stimulated thymocytes as
evidenced by a decrease in intracellular CAMP and protein binding to a CRE motif
(figures 10 and 13). Although forskolin is useful for assessing alterations of the CAMP

pathway, it is not a relevant T—Cell activation stimulus. Antigen stimulation induces

86

TABLE 3

Inhibition of IL-2 gene expression by cannabinol in PMA/Io activated thymocytes
Thymocytes (1 x 106 C/ml) were activated with PMA/Io (80 nM/l nM) in the presence or
absence of CBN (20 uM) for 24 hr. Total RNA was isolated and the molecules of IL-2

mRN A were quantified using competitive reverse transcriptase-polymerase Chain reaction
(RT-PCR). The results of two separate experiments are shown.

Molecules/ 100 ng RNA

 

Treatment Experiment 1 Experiment 2
NA ND. ND.
4 4
PMA/Io 5.5 x 10 8.6 x 10
PMA/Io 4 4
+CBN 2.5 x 10 4.6 x 10

 

ND: not detected

87

25'

§

 

 

 

 

1
0

 

 

@338 mu:

 

multiple signaling pathways, including the CAMP cascade, that are essential for the
complete activation of T—cells. PMA/Io is one stimulus that simulates antigen activation
of T-Cells as it mimics signaling induced through the TCR. Consequently, PMA/Io was
employed in order to further investigate the effects of cannabinol in activated thymocytes.
The EMSA was utilized to Characterize the effect of cannabinol on CRE and KB binding
activity following PMA/Io activation of thymocytes. Nuclear proteins were prepared
from thymocytes activated with PMA/Io (80 nM/luM) for 60 min in the presence or
absence of cannabinol (20 11M). PMA/Io treatment induced the formation of two CRE
binding complexes, a major complex (lower band) and a minor complex (upper band)
(Figure 17). Cannabinol treatment produced a marked decrease in the DNA binding of
the major CRE complex induced by PMA/Io.

Using identical culture conditions as for the CRE EMSA studies, the effect of
cannabinol on NF-KB/C-Rel DNA binding was examined in PMA/Io activated
thymocytes. Two distinct KB binding complexes were detected in naive thymocytes.
PMA/Io strongly induced only the upper KB binding complex (Figure 18) which was
significantly inhibited in the presence of cannabinol. Interestingly, we also observed that
the percentage of bovine calf serum in the medium exhibited some influence on the
ability of cannabinol to inhibit NF-KB binding activity. Specifically, the inhibition of
NF-KB binding by cannabinol was marked in the presence of 1% serum while no

inhibition was observed when cells were cultured in 5% serum (Figure 19).

B. Identification of the specific CRE binding proteins regulated by
cannabinol
The CREB/ATE family of transcription factors is composed of several different
proteins which can form homodimers or heterodimers to regulate gene expression. In
order to determine the specific components of the CRE complexes induced by PMA/Io

and inhibited by cannabinol, supershift analysis was performed. In these experiments

89

Time (min) 0 60
PMA/Io ' + +
CBN - - +
>

CRE
>

 

Relative 0.64 1.0 0.33
Intensity

Figure 17. Cannabinol inhibits protein binding to a CRE motif in PMA/Io activated
mouse thymocytes. Nuclear proteins (5 ug) from treated and untreated thymocytes
were incubated with 0.5 ug of poly (dI-dC) and the 32P-1abeled CRE probe in binding
buffer on ice for 10 min followed by separation on a 4% acrylamide gel. Lane 1
represents free probe and lane 2 indicates naive thymocytes. Lane 3 represents nuclear
proteins isolated from thymocytes (l x 106 C/ml) activated for 60 min with PMA/Io
(80nM/l uM). Lane 4 represents nuclear proteins isolated from thymocytes treated with
CBN (20 nM) for 15 min followed by PMA/Io (80 nM/l M) for 60 min. One of three
representative experiments is shown.

Time (min) 0 60

PMA/Io - + +
CBN - - +
)

KB >

Relati

 

ve
Intensity 0.57 1.0 0.37

Figure 18. Inhibition of PMA/Io-induced protein binding to a KB motif in mouse
thymocytes by cannabinol. Nuclear proteins (5 ug) from treated and untreated
thymocytes were incubated with 0.5 pg of poly (dI-dC) and the 32P-labeled KB probe in
binding buffer on ice for 10 min followed by separation on a 4% acrylamide gel. Lane 1
represents free probe and lane 2 indicates naive thymocytes. Lane 3 represents nuclear
proteins isolated from thymocytes (1 x 106 C/ml) activated for 60 min with PMA/Io (80
nM/l . Lane 4 represents nuclear proteins isolated from thymocytes treated with
CBN (20 nM) for 15 min followed by PMA/Io (80 nM/ 1 M) for 60 min. One of three
representative experiments is shown.

91

1% BCS 5% BCS

Time (min) 0 60 O 60
PMA/IO " + + - + +
CBN - - + - - +

  

>
KB>

   

Figure 19. Effect of bovine calf serum on the cannabinol-mediated inhibition of NF-
KB DNA binding activity in PMA/Io activated thymocytes. Thymocytes (l x 106
C/ml) were pretreated with CBN (20 nM) for 15 min and activated with PMA/Io (80
M1 nM) for 60 min in complete medium supplemented with either 1% or 5% bovine
calf serum (BCS). Nuclear proteins (5 pg) from treated and untreated thymocytes were
incubated with 0.5 ug of poly (dI-dC) and the 32P-labeled KB probe in binding buffer on

ice for 10 min followed by separation on a 4% acrylamide gel. One of two representative
experiments is shown.

92

nuclear proteins were isolated from thymocytes 60 min after PMA/Io treatment. As
shown in figure 20, CREB-1 was identified in both the upper and lower binding
complexes as evidenced by the loss of CRE binding activity in the presence of anti-
CREB-l. Anti-CREB-l recognizes epitopes within the DNA binding domain of CREB-1
to block DNA binding. ATP-2 was identified only in the minor upper CRE complex.
Anti-ATF-l antibody had no effect on either CRE binding complex in the supershift
assays. Thus, the lower CRE complex consisted of a CREB-1 homodimer whereas the

upper CRE complex was a CREB-1/ATF—2 heterodimer.

C. Identification of the specific KB binding proteins regulated by
cannabinol

In light of the cannabinol-mediated inhibition of the inducible KB DNA binding
complex, supershift and EMSA/Western analysis were performed to identify which
specific NF—KB proteins were being modulated by cannabinoids. For the supershift
studies, nuclear proteins isolated from thymocytes activated for 60 min with PMA/Io
were incubated with antibodies specific for p50, p65, or C-Rel (Figure 21). The p50
antibody produced a shift (lane 3) that was predominantly from the lower KB complex.
By comparison, anti-p65 and anti-C-Rel appeared to primarily shift the upper KB
complex. Due to the difficulty in determining which KB binding complexes were being
supershifted, EMSA/Western was conducted to confirm the identity of the DNA binding
proteins. In these experiments, the protein/KB complexes were subjected to Western
analysis using either p65 or c-Rel antibody and compared to the EMSA. EMSA/Western
analysis identified both p65 and C-Rel proteins as components of the upper KB complex
which verified the supershift results (Figure 22). Therefore, the lower KB complex was
identified as a p50 homodimer whereas the inducible (upper) KB complex consisted of a
p65/C-Rel heterodimer. These findings also demonstrated that cannabinol primarily

inhibits the DNA binding of p65 and C-Rel in PMA/Io activated thymocytes (Figure 22).

93

Time (min) 60
PMA/Io + + + +

CREB-1 - + - -
ATF-l - - + -
ATF? ' ' +

 

CRE

Figure 20. Identification of specific CRE transcription factors modulated by
cannabinol following PMA/Io activation of thymocytes. EMSA was performed using
nuclear proteins isolated from thymocytes activated with PMA/Io (80 nM/l nM) for 60
min and a 32P—labeled CRE probe. CREB-l antibody (1 ug) was incubated with nuclear
proteins at 4°C for 45 min prior to addition of the CRE probe. ATF-l or ATP-2 antibody
(1 pg) was incubated with the protein/CRE complex at 4°C for 45 min. Lane 1 represents
free probe and lane 2 indicates PMA/Io activated thymocytes. Lanes 3, 4, and 5 contain
CREB-1, ATF-l, and ATP-2 antibody respectively. One of three representative
experiments is shown.

Time (min) 0 60

 

PMA/Io-++++

 

Figure 21. Identification of specific KB transcription factors modulated by
cannabinol following PMA/Io activation of thymocytes. EMSA was performed using
nuclear proteins isolated from thymocytes stimulated with PMA/Io (80 nM/ 1 nM) for 60
min and a 32P-labeled KB probe. p50, p65, or C-Rel antibody (1 ug) was incubated with
the protein/kB complex for 30 min at room temperature. Lane 1 represents free probe,
lane 2 indicates basal binding activity, and lane 3 indicates PMA/Io activated thymocytes.
Lanes 4, 5, and 6 contain p50, p65, and c-Rel antibody respectively. One of three
representative experiments is shown.

95

Figure 22. Identification of the components of the upper KB binding complex
induced by PMA/Io in thymocytes. A) Nuclear proteins (8 ug) from treated and

untreated thymocytes were incubated with 0.5 pg of poly (dI-dC) and the 32P—labeled
KB probe in binding buffer on ice for 10 min followed by separation on a 4% acrylamide
gel. Lane 1 represents free probe and lane 2 indicates naive thymocytes. Lane 3

represents nuclear proteins isolated from thymocytes (1 x 106 C/ml) activated for 60 min
with PMA/Io (80nM/1 11M). Lane 4 represents nuclear proteins isolated from
thymocytes treated with CBN (20 nM) for 15 min followed by PMA/Io (8O nM/l nM)
for 60 min. B) Identical nuclear protein samples were incubated with 0.5 ug of poly (dI-
dC) and 10 pMoles of cold KB probe for 10 min on ice and separated on a 4%
acrylamide gel. Following electrophoresis, the protein complexes were transferred to
nitrocellulose and incubated with either p65 (200 ng) or C-Rel (400 ng) antibody for 2
hr. An anti-rabbit Ig horseradish peroxidase-linked secondary antibody was used for
protein detection using the ECL system.

96

 

  

8 news

93 as 28
832m
ass as:

<

97

V. The effects of cannabinol on CREB and NF-KB activation in PMA/Io

activated thymocytes

A. Inhibition of CREB phosphorylation by cannabinol

The phosphorylation of CREB/ATF proteins facilitates protein dimerization and
DNA binding to CRE motifs. In light of the inhibition of CRE binding by cannabinol
described above (Figures 13 and 17), the effect of cannabinol on forskolin and PMA/Io
induced phosphorylation of CREB and ATF-l nuclear proteins was examined.
Stimulation of thymocytes with either forskolin or PMA/Io for 60 min induced the
phosphorylation of CREB and modestly increased the phosphorylation of ATF-l (Figure
23). Densitometric analysis revealed that PMA/Io produced a 2-fold greater increase in
CREB phosphorylation as compared to forskolin. Conversely, thymocytes that were
pretreated with cannabinol (20 11M) prior to stimulation exhibited a marked decrease in
the phosphorylation status of CREB and ATF-l (Figure 23). Interestingly, this decrease
in phosphorylation correlated with the inhibition in CRE binding activity. Moreover, the
modest amount of phosphorylated ATF-l in thymocytes is most likely the reason why

ATF-l was not detected in the supershift studies.

B. The effect of cannabinol on IKB-0i degradation and p65 cellular
localization

The phosphorylation of IKB-0t is essential for ubiquitination and required for the
aCtivation and DNA binding of NF-KB. To gain further insights into the mechanism by
Which cannabinol modulates NF-KB proteins, we examined the effects of cannabinol on
IKB-0t. Initial studies were performed to determine the time course of IKB-0t degradation
in thymocytes. Thymocytes were activated with PMA/Io for 15, 30, 60, 45, 90, and 120
min and whole cell lysates were analyzed for IKB-0t protein levels. As expected, PMA/Io
PrOduced a rapid degradation of IKB-0t during the first 60 min which was followed by an

increase in IKB-0t at 90 and 120 min (Figure 24). Because maximal degradation of IKB-0t

98

Time (min) 0 60 0 60
CBN - - + - - +
137.0 kD >
79.0 kD >

42.3 kD > <PCREB
< pATF—l

31.6 kD>

 

Relative 1.0 9.30.7510 20.6 0.08. pCREB
Intensny 1.0 2.2 0.15 1.0 4.0 ND pATF-l

Figure 23. Phosphorylation of CREB and ATF-l is inhibited by cannabinol in
Stimulated thymocytes. Nuclear proteins (25 ug) from treated thymocytes were
resolved on a 10% SDS-PAGE gel, transferred to nitrocellulose, and incubated for 2 hr
With 30 ng of a rabbit polyclonal antibody which recognizes the phosphorylated Ser-133
residue on CREB and ATF~1.An anti—rabbit Ig horseradish peroxidase- -linked secondary

XIT'IIEOdyw was used for protein detection using the ECL system. CREB- l is 43 kD and
-l ls3

99

Time(min) 0 15 3o 45 60 90 120
PMA/Io-++++++

73.0 kD> .,

43.0 kD> {ff
32.3 kD >

  

Relative 1.0 '- 00:: 0.003 0.01 0.01 0.34 0.27.
Intensity

Figure 24. Time course of IKB-0t degradation following PMA/Io activation of
thymocytes. Thymocytes (1 x 106 C/ml) were treated with PMA/Io for 0-120 min and
Whole cell lysates (25 ug) were resolved on a 10% SDS-PAGE gel. Proteins were
transferred to nitrocellulose and incubated with 200 ng of a rabbit polyclonal antibody for
IKB-a for 2 hr. An anti-rabbit Ig horseradish peroxidase-linked secondary antibody was
used for detection using the ECL system. IKB-Ct is a 38 kD protein.

was detected 30 min after PMA/Io activation, this time point was Chosen to examine the
effects of cannabinol on IKB-0i. As shown in figure 25, cannabinol prevented the
degradation of IKB-0t in a concentration dependent manner presumably through an»
inhibition of IKB-0t phosphorylation.

The level of p65 protein was also examined at 30 min in the presence of
cannabinol to investigate possible direct effects of cannabinol on p65 expression. p65
protein levels were relatively unchanged in the presence of increasing concentrations of
cannabinol (Figure 25) suggesting that the decrease of NF-KB DNA binding activity by
CBN occurs at the level of IKB-0t and not p65. This was further demonstrated by
examining the cellular localization of p65 in the presence of cannabinol. Nuclear levels
of p65 were induced following PMA/Io activation (30 min) and this induction was
suppressed by cannabinol at 15 and 20 11M (Figure 26A). No significant Change in
cytosolic p65 expression was observed between treatment groups (Figure 26B). These
results suggest that the decrease in NF-KB DNA binding in the presence of cannabinol is
due to an inhibition of IKB-0t phosphorylation and subsequent degradation which

Precludes NF-KB translocation into the nucleus.

VI. The role of CAMP and PKA in the cannabinol-mediated inhibition of CREB,
NF-KB, and IL-2 in activated thymocytes

i

A. Effect of DBCAMP on the inhibition of CREB, NF-KB, and IL-2 by
cannabinol
Membrane permeable analogs of CAMP are often employed as a biological probe
to experimentally modulate the CAMP pathway. Dibutyryl CAMP (DBCAMP) was used
in the present studies to determine the involvement of the CAMP cascade in the

Cannabinol-mediated inhibition of CREB, NF-KB, and IL-2 in activated T-Cells.
Treatment of thymocytes with DBCAMP (60 min) induced CREB phosphorylation at 10
and 100 uM with the greatest magnitude of phosphorylation being detected at 100 M

101

 

Time(min) 0 l 30 l

PMA/lo - + + + + + +
CBN (u M) - - 1 5 10 15 20
81 0 k0» ,. . _

IKB-a

       
       

Relative 12.43 1.0 1.23 2.49 1.89 1.53 7.41

Intensity

Figure 25. Inhibition of IKB-0t degradation by cannabinol. Whole cell lysates were
prepared from thymocytes (l x 106 C/ml) pretreated with CBN (1, 5, 10, 15, 20 nM) for
15 min followed by PMA/Io (80 Ml nM) for 30 min. In each experiment, whole cell
lysates (25 rig) were resolved on a 10% SDS-PAGE gel, transferred to nitrocellulose, and
incubated for 2 hr with 200 ng of a rabbit polyclonal antibody for IKB-0t. An anti-rabbit
Ig horseradish peroxidase-linked secondary antibody was used for protein detection. The
whole cell lysates (25 ug) were also examined for Changes in p65 protein expression
using 200 ng of p65 antibody and the anti-rabbit Ig horseradish peroxidase secondary

antibody.

102

 

Time (min) 0 . 30 .
PMA/Io -
CBN (yM) -

+ + +
15 20

A. ( p65

 

RelatiYe 0.12 1.0 0.47 0.54
IntenSlty

B.

 

Relative 10 141
Intensity ' ' '

0.93

Figure 26. Cellular localization of p65 in the presence of cannabinol. A) Nuclear
proteins were isolated from thymocytes (1 x 106 C/ml) pretreated with CBN (15 or 20
11M) for 15 min followed by PMA/Io (80 nM/l 11M) for 30 min. B) Cytosolic proteins
isolated from thymocytes treated as described in part A. Proteins (25 ug) were resolved
on a 10% SDS-PAGE gel, transferred to nitrocellulose, and incubated for 2 hr with 200
ng of p65 antibody. An anti-rabbit Ig horseradish peroxidase—linked secondary antibody
was used for protein detection.

103

60 min
DBCAMPQtM) - 1 10 100 1000

 

( p-CREB
4 p-ATF-l

 

Relative 1.0 1.47 9.93 10.50 1.79 p-CREB
Intensity

Figure 27. DBCAMP induces the phosphorylation of CREB. Thymocytes were
treated with DBCAMP (1, 10, 100, 1000 11M) for 60 min. Nuclear proteins (25 ug) were
isolated and resolved on a 10% SDS-PAGE gel. Proteins were transferred to
nitrocellulose and incubated for 2 hr with 30 ng of a rabbit polyclonal antibody directed
toward the phosphorylated Set-133 residue on CREB and ATF-l. An anti-rabbit Ig
horseradish peroxidase-linked secondary antibody was used for protein detection using
the ECL system. ,

DBCAMP (Figure 27). In light of this, studies were performed to examine whether the
inhibition of CREB phosphorylation and CRE binding by cannabinol in activated
thymocytes could be reversed with DBCAMP. Thymocytes were treated with either
DBCAMP (100 nM), PMA/Io (80 anl 11M), or PMA/Io plus DBCAMP for 60 min in the
presence or absence of cannabinol (5, 10, 15 nM). As shown in figure 28, CREB
phosphorylation was induced by DBCAMP or PMA/Io alone. Densitometric analysis
revealed that PMA/Io plus DBCAMP produced an additive effect on CREB
phosphorylation. Interestingly, the inhibition of CREB phosphorylation by cannabinol in
PMA/Io activated thymocytes could not be reversed by concomitant treatment with
DBCAMP (Figure 28). CRE binding activity was also investigated in thymocytes under
identical culture conditions. DBCAMP, PMA/Io, and PMA/Io plus DBCAMP induced a
major CRE binding complex that was sensitive to inhibition by cannabinol. However, the
decrease in CRE binding activity produced by cannabinol in PMA/Io activated
thymocytes was not reversed by DBCAMP co-stimulation (Figure 29). The profile of
CRE binding activity correlated strongly with the CREB phosphorylation results.
Previous experiments demonstrating the modulation of NF-KB binding by
cannabinol in forskolin-stimulated thymocytes also suggested that NF-KB/C-Rel proteins
are regulated, in part, by the CAMP signaling pathway. Based on this, the ability of
DBCAMP (100 11M) to reverse the cannabinol-mediated inhibition of KB DNA binding in
activated thymocytes was examined. As shown in figure 30, thymocyte activation by
PMA/Io or PMA/Io plus DBCAMP induced one of the two constitutive (upper) KB DNA
binding complexes. By comparison, DBCAMP alone failed to increase binding to the KB
motif in thymocytes. This is in contrast to the induction of NF-KB binding activity
observed after forskolin stimulation (Figure 15). Additionally, DBCAMP was unable to

reverse the inhibition of KB binding activity by cannabinol in PMA/Io activated

thymocytes (Fing 30).

105

 

PMA/lo _ + - + + + + + + +
DBCAMP - - + + - - - + + +
CBN(uM)- - - - 5 1O 15 5 10 15

  
  

42.4 kD)

     

Relative 1.0 2.25 6.92 9.59 6.54 6.62 1.08 5.40 6.05 0.96
Intensity 1.0 0.20 1.10 1.08 0.56 0.57 0.15 0.60 0.64 0.21 pATF-l

Figure 28. Inhibition of CREB phosphorylation by cannabinol in activated
thymocytes is not reversed by DBCAMP. Thymocytes were pretreated with CBN (5,
10, 15 11M) for 15 min followed by stimulation with either PMA/Io or PMA/Io plus
DBCAMP (100 1.1M). Nuclear proteins (25 1.1g) were isolated and resolved on a 10%
SDS-PAGE gel. Proteins were transferred to nitrocellulose and incubated for 2 hr with 30
ng of a rabbit polyclonal antibody directed toward the phosphorylated Ser-133 residue on
CREB and ATF-l. An anti-rabbit Ig horseradish peroxidase-linked secondary antibody
was used for protein detection using the ECL system.

106

PMA/Io - + - + + + + + + +
DBCAMP - - + + - - - + + +
CBNQAD ' ' ‘ ‘ 5 1015 5 1015

     
 
 
      

CRE»

      

Relative

Intensity 1.0 1.4 1.3 1.0 1.0 1.1 0,7 10 0.8 05

Figure 29. Effect of DBCAMP on the inhibition of CRE binding by cannabinol in
activated thymocytes. Thymocytes (1 x 106 C/ml) were pretreated with CBN (5, 10, 15
LLM) and stimulated with PMA/Io, DBCAMP (100 nM), or PMA/Io plus DBCAMP for 60
min. Nuclear proteins (5 ug) were incubated with 0.5 1.1g of poly (dI-dC) and the 32P-
labeled CRE probe in binding buffer on ice for 10 min followed by separation on a 4%
acrylamide gel.

107

PMA/Io-+-+++++++
DBcAMP--++---+++

CBN(}4MV) -, - ' ' 5 1015 5 10 15

.,

     

KB)

Relative “-v
Intensity 1.0 2.4 1.0 2.4 2.2 2.4 1.6 1.9 2.0 1.4

Figure 30. Effect of DBCAMP on the inhibition of KB binding by cannabinol in

activated thymocytes. Thymocytes (l x 106 C/ml) were pretreated with CBN (5, 10, 15
nM) and stimulated with PMA/Io, DBCAMP (100 nM), or PMA/Io plus DBCAMP for 60
min. Nuclear proteins (5 ug) were incubated with 0.5 pg of poly (dI-dC) and the 32P-
labeled KB probe in binding buffer on ice for 10 min followed by separation on a 4%
acrylamide gel.

108

Based on the inhibitory effects cannabinol exerts on the CAMP cascade, the
suppression of thymocyte lL-2 expression by cannabinol implicated a positive role for
CAMP in the regulation of IL-2. Therefore, studies were also performed to determine
whether DBCAMP could reverse the cannabinol-induced inhibition of IL-2 in activated T-
cells. Thymocytes were treated simultaneously with DBCAMP (1, 10, 100, 1000 1.1M)
and PMA/Io for 24 hr, and supernatants were analyzed for IL-2 protein by ELISA.
DBCAMP produced a marked inhibition of IL-2 secretion at 10, 100, and 1000 11M as
compared to the PMA/Io activated control (Figure 31). The observed decrease in IL-2
by DBCAMP is consistent with previous reports that high concentrations of CAMP inhibit
Th1 cytokine expression (Betz and Fox, 1991). In light of this dose response, low
concentrations of DBCAMP (1 and 5 11M) were employed in an attempt to reverse the
suppression of IL-2 by cannabinol. For these studies, thymocytes were pretreated with
cannabinol (5, 10, 15 11M) and activated with either PMA/Io or PMA/Io plus DBCAMP (1
or 5 1.1M) for 24 hr. As expected, cannabinol produced a concentration-dependent
decrease in IL-2 secretion following PMA/Io activation. Co-treatment with DBCAMP (1
or 5 11M) failed to abolish the inhibition of IL-2 at all concentrations of cannabinol tested
(Figure 32). Interestingly, DBCAMP enhanced the inhibition of IL-2 produced by

cannabinol at 10 and 15 11M in activated thymocytes.

B. Effect of forskolin on the inhibition of CREB and NF-KB by cannabinol

As already discussed, forskolin (FSK) directly activates adenylate cyclase to
elevate endogenous intracellular CAMP levels. To ensure that the inability of DBCAMP
to reverse the cannabinol-mediated inhibition of CREB and NF—KB in activated
thymocytes was not unique to CAMP analogs, similar experiments were performed with
forskolin. Stimulation of thymocytes with forskolin, PMA/Io, or PMA/Io plus forskolin
induced CREB phosphorylation and CRE binding activity. In contrast, concomitant

stimulation with forskolin and PMA/Io failed to reverse the inhibition of CRE binding

109

   

 

 

 

 

//M
/////.
em

 

 

6 4 2 0

28333 mi:

 

Dibutyryl CAMP (11M)

.au
m

thymocytes.

in s etion by DBCAMP in

m
um
g

BCAMP (1, 10, 100, 1000

dnm

0

n
8
SW

      
       

 

 

 

 

121
1
10‘
EQCBN
8‘ .DB (1 11M)
E EDB (5 11M)
":3
3 6'
N
E". 1
4-
2-
0" ll 99 ‘ g.
NA P/I DB1 DB5 CBN (5 11M) CBN (10 11M) CBN (15 HM)
+ PMA/Io

Figure 32. DBCAMP fails to reverse cannabinol-mediated inhibition of IL-2 protein
secretion in PMA/Io activated thymocytes. Thymocytes ( 1 x 10 C/ml) were
pretreated with CBN (5, 10, 15 11M) for 15 min followed by stimulation with PMA/Io (80
nM/l 1.1M), DBCAMP (l or 5 11M), or PMA/Io plus DBCAMP ( 1 or 5 M) for 24 hr at 37
°C. IL-2 levels in the supernatant were determined by ELISA. Data are expressed as the
mean 1 SE for triplicate samples. *p< 0.05 with comparison to the PMA/Io group.

111

PMA/Io- + - + + + + + + +
FSK- - + + - - - + + +
CBN(uM)- - - - 10_15 201015 20

42.4 kD> -m m m (p—CREB
«t ' ' _g < p-ATF-l
32.6 kD) "” '

Figure 33. Forskolin failed to reverse the inhibition of CREB phosphorylation by
cannabinol in activated thymocytes. Thymocytes were pretreated with CBN (10, 15,
20 11M) for 15 min followed by stimulation with either PMA/Io or PMA/Io plus FSK (50
1.1M). Nuclear proteins (25 ug) were isolated and resolved on a 10% SDS-PAGE gel.
Proteins were transferred to nitrocellulose and incubated for 2 hr with 30 ng of a rabbit
polyclonal antibody directed toward the phosphorylated Ser-133 residue on CREB and
ATF-l. An anti-rabbit Ig horseradish peroxidase-linked secondary antibody was used for
protein detection using the ECL system.

112

PMA/Io - + - + + + + + + +
FSK " " + + - - - + + +
CBN(]4M) ' ' ' ' 10 152010 15 20

CRE >

 

R 1 ti
Infeisivt; 1.0 1.2 1.0 1.2 0.6 0.5 0.5 0.5 0,4 0,4

Figure 34. Inhibition of CRE binding activity by cannabinol is not reversed by
forskolin. Thymocytes (1 x 106 c/ml) were pretreated with CBN (10, 15, 20 nM) and
stimulated with PMA/Io, FSK (50 nM), or PMA/Io plus FSK for 60 min. Nuclear

proteins (5 pg) were incubated with 0.5 ug of poly (dI-dC) and the 32P-labeled CRE
probe in binding buffer on ice for 10 min followed by separation on a 4% acrylamide gel.

113

_+-+++++++

   

- - + + - - - + + +
‘ ' - ' 1 O 1 5 20 1 0 1 5 20

     

 

Relative 1.0 1.5 0.9 1.4 1.0 0.8 0.7 0.7 0.7 0.7
Intensity

Figure 35. Inhibition of KB binding activity by cannabinol is not reversed by

forskolin. Thymocytes (l x 106 c/ml) were pretreated with CBN (10, 15, 20 pM) and
stimulated with PMA/Io, FSK (50 pM), or PMA/Io plus FSK for 60 min. Nuclear

proteins (5 pg) were incubated with 0.5 pg of poly (dI-dC) and the 32P-labeled KB probe
in binding buffer on ice for 10 min followed by separation on a 4% acrylamide gel.

114

and CREB phosphorylation by cannabinol (Figures 34 and 33, respectively). Similarly,

forskolin co-stimulation was unable to reverse the decrease in NF-KB binding activity

produced by cannabinol in activated thymocytes (Figure 35).

C. Effect of H89 on the regulation of CREB, NF-KB, and IL-2 in activated
thymocytes

To further elucidate the role of PKA in the inhibition of CREB, NF-KB, and IL-2
by cannabinol, the specific PKA inhibitor H89 was employed. The reported IC 50 for the
inhibition of PKA by H89 is 48 nM (Chijiwa et al., 1990). Initially, we conducted an
analysis of H89 activity in DBcAMP or forskolin-treated cells. Thymocytes were
stimulated with either DBcAMP (100 pM) or forskolin (50 pM) for 60 min in the
presence or absence of H89 (50 and 500 nM). H89 blocked both DBcAMP and
forskolin-induced CREB phosphorylation (Figure 36). The activity of H89 was also
assessed using EMSA analysis of nuclear proteins isolated from DBcAMP-treated
thymocytes. Consistent with the above findings, H89 (50 and 500 nM) also produced a
concentration-dependent inhibition of the CRE binding complex induced by DBcAMP
(Figure 37). Collectively these results demonstrated that H89 was effective in inhibiting
PKA function. To examine the involvement of PKA in the regulation of CREB in
activated T-cells, thymocytes were pretreated with increasing concentrations of H89 (10-
500 nM) for 30 min prior to activation with PMA/Io. H89 produced a 30% inhibition of
PMA/Io-induced CREB phosphorylation at 50 nM with relatively little effect detected at
other H89 concentrations (Figure 38). Similarly, H89 (50 nM) produced a modest
reduction of protein/DNA binding to a CRE motif in PMA/Io activated thymocytes
whereas minimal effects were detected in all other H89 treatment groups (Figure 39).

Identical EMSA studies were performed for KB DNA binding activity to
determine the role of PKA in NF-KB regulation following T-cell activation. Interestingly,

pretreatment of thymocytes with H89 (IO-500 nM) produced no effect on the PMA/Io

115

DBCAMP FSK
(100 14M) (50 pM)

H89 (nM) - 0 50 500 0 50 500

 

42.4 kD) -. .,.',.;;1223 ' fl “'4" < P'CREB
., V _ - -< p-ATF—l

 

32.6 kD)

Relative ND 1.0 0.51 0.22 1.0 1.1 0.25
Intensity

Figure 36. Phosphorylation of CREB is inhibited by H89. Thymocytes (1 x 106 c/ml)
were pretreated with H89 (50 or 500 nM) for 30 min and stimulated with either DBcAMP
(100 pM) or FSK (50 pM) for 60 min. Nuclear proteins (25 pg) were isolated and
resolved on a 10% SDS-PAGE gel. Proteins were transferred to nitrocellulose and
incubated for 2 hr with 30 ng of a rabbit polyclonal antibody directed toward the
phosphorylated Set-133 residue on CREB and ATF-l. An anti-rabbit Ig horseradish

peroxidase-linked secondary antibody was used for protein detection using the ECL
system.

116

DBcAMP (100 14M) - ——+ + +
H89(nM) - 0 so 500

 

CRE >

[RelatiYe 0.54 1.0 0.78 0.59
ntenSIty

Figure 37. Inhibition of CRE binding by H89 in DBcAMP treated thymocytes.
Thymocytes were incubated with H89 (50 or 500 nM) for 30 min and treated with
DBcAMP (100 pM) for 60 min. Nuclear proteins (5 pg) were incubated with 0.5 pg of
poly (dI-dC) and the 32P-labeled CRE probe in binding buffer on ice for 10 min followed
by separation on a 4% acrylamide gel.

117

OPMA/Io (60 min)

 

 

NA 10 50 100 500 H89 (nM)

80.0 kD) ‘ '

42.4 kD) m... ' .1 w 4 p— CREB
g, ..... , ( p-ATF-l

32.6 kD)

Relative 0.13 1.0 1.52 0.69 1.0 0.92
Intensity

Figure 38. H89 has a modest effect on PMA/Io-induced CREB phosphorylation 1n
thymocytes. Thymocytes (1 x 106 c/ml) were pretreated (30 min) with H89 (10,50,100,
500 nM) prior to activation with PMA/Io for 60 min. Nuclear proteins (25 pg) were
isolated and resolved on a 10% SDS-PAGE gel. Proteins were transferred to
nitrocellulose and incubated for 2 hr with 30 ng of a rabbit polyclonal antibody directed
toward the phosphorylated Set-133 residue on CREB and ATF-l. An anti—rabbit Ig
horseradish peroxidase-linked secondary antibody was used for protein detection using
the ECL system.

118

PMA/Io (60 min)
10 _. 50 _ 100 500

H89 (nM) - O

 

CRE > f 1.

Relative
Intensity 0.58 1.0 0.85 0.81 1.1 1.0

Figure 39. Effect of H89 on CRE binding activity in PMA/Io activated thymocytes.
Thymocytes were pretreated with H89 (10, 50, 100, 500 nM) for 30 min followed by
PMA/Io for 60 min. Nuclear proteins (5 pg) were incubated with 0.5 pg of poly (dI-dC)

and the 32P-labeled CRE probe in binding buffer on ice for 10 min followed by
separation on a 4% acrylamide gel.

119

PMA/Io (60 min)
H89(nM) - 0 10 50100 500

’wtfi‘ 2.4.121

 

     

KB)

Relative
Intensity 0321.0 1.0 1.1 1.1 1.1

Figure 40. H89 does not inhibit binding to a KB motif in PMA/Io activated
thymocytes. Thymocytes were pretreated with H89 (10, 50, 100, 500 nM) for 30 min
followed by PMA/Io for 60 min. Nuclear proteins (5 pg) were incubated with 0.5 pg of
poly (dI-dC) and the 32P—labeled KB probe in binding buffer on ice for 10 min followed
by separation on a 4% acrylamide gel.

120

P/I (30 min)
NA 0 10 50 100 500 (nM H89)

 

  

42.4 kD) -,

i 1‘ ( IKB-(1
32.6 kD)

Relatiye 2.8 1.0 0.46 0.64 0.62 0.37
Intens1ty

Figure 41. Effect of H89 on IKB-0t degradation in activated thymocytes. Thymocytes
(l x 106 c/ml) were pretreated for 30 min with H89 (10, 50, 100, 500 nM) followed by
PMA/Io for 30 min. Whole cell lysates (25 pg) were resolved on a 10% SDS-PAGE gel,
transferred to nitrocellulose and incubated with 200 ng of a rabbit polyclonal antibody for
IKB-(l for 2 hr. An anti-rabbit Ig horseradish peroxidase-linked secondary antibody was
used for detection using the ECL system. IKB-(11S a 38 kD protein.

121

induced protein binding to a KB motif (Figure 40). Consistent with these findings, H89
did not prevent the IKB-0t degradation induced by PMA/Io and appeared to enhance the
degradation at all concentrations of H89 tested (Figure 41).

Although a central role for CREB in T-cell activation and IL-2 expression has
recently been established, the specific involvement of PKA remains unclear. As a result,
H89 was employed to assess the participation of PKA in the cannabinol-mediated
inhibition of IL-2 expression. Thymocytes were pretreated for 30 min with H89 (10-500
nM) followed by PMA/Io activation for 24 hr. Supematants were collected and analyzed
for IL-2 activity by ELISA. As shown in figure 42, H89 inhibited PMA/Io-induced IL-2

secretion by 17% and 27% at 50 and 100 nM concentrations, respectively.

122

PMA/Io + H89 (nM)

 

 

w <
l r

fetnmtsw

 

causes «1:... 8%

E
meks

DISCUSSION

Cannabinoid compounds produce a diverse range of physiological effects in the
CNS and peripheral organ systems. Due to the lipophilic structure of cannabinoids, the
original mechanism for these effects was attributed to intercalation and disruption of the
plasma membrane lipid bilayer. However, the isolation and cloning of C81 and CB2
cannabinoid receptors in the early 1990's provided a putative mechanism of action for
cannabinoid compounds (Matsuda et al., 1990; Munro et al., 1993). C31 and CB2 are
novel G-protein coupled receptors, and ligand binding to either receptor subtype
negatively regulates adenylate cyclase through a pertussis toxin-sensitive protein.
Previous studies in mouse splenocytes have provided evidence for the involvement of
CB1 in the immunosuppressive effects of A9—THC (Kaminski et al., 1992; Schatz et al.,
1992). By comparison, the role of the CBZ receptor in cannabinoid-mediated immune
suppression was relatively uncharacterized.

A systematic evaluation of cell-type receptor distribution has not yet been
performed; however, previous studies have identified RNA transcripts for both CB1 and
CB2 in a number of lymphoid tissue preparations (Kaminski et al., 1992; Munro et al.,
1993; Schatz et al., 1997), purified leukocytes (Bouaboula et al., 1993; Facci et al.,
1995), and immune system-derived cell lines (Condie et al., 1996; Facci et al., 1995; Jean
et al., 1996; Schatz et al., 1997). Northern analysis and quantitative RT-PCR of mRNA
determined a greater expression of CBZ than C81 in mouse spleen and expression of only
CB2 in thymus (Schatz et al., 1997). Furthermore, competition binding analysis in
mouse splenocytes demonstrated that cannabinol exhibited modestly greater binding
affinity than A9-THC (Schatz et al., 1997) which is similar to previous results in C32
transfected cells (Felder et al., 1995; Munro et al., 1993). Taken together, these findings
suggested that CBZ was the predominant cannabinoid receptor expressed on primary

mouse leukocytes.

124

Although A9-THC and the synthetic bicyclic cannabinoid CP-55,940 are two of
the most widely utilized cannabinoids experimentally, they are incapable of
distinguishing between CB1 and CB2. In contrast, cannabinol, which is similar in
structure to A9-THC, is one of the first cannabinoid receptor ligands identified which
exhibits higher binding affinity for CB2 than CB1 (Felder et al., 1995; Munro et al.,
1993; Schatz et al., 1997). In light of this property, we utilized cannabinol in the present
studies as a biological probe to examine the functional role of CB2 on immune
modulation by cannabinoids in primary mouse splenocytes and thymocytes. Direct
addition of cannabinol to mouse spleen cell cultures produced a significant inhibition of
proliferative responses to anti-CD3, LPS, and PMA plus ionomycin. Cannabinol also
inhibited the in vivo and in vitro T-cell dependent IgM antibody forming cell response to
sRBC. It is important to emphasize that cannabinol produced no effect on cell viability at
the concentrations utilized in vitro even after 5 days of culture. Interestingly, cannabinol
exhibited a similar profile of immunomodulatory activity in the B6C3Fl mouse as
previously described for A9-THC (Schatz et al., 1993). The suppression of functional
immune responses by cannabinol suggests an involvement of the CB2 receptor in
immune modulation by cannabinoid compounds.

Based on the fact that cannabinoid receptors negatively regulate adenylate cyclase
activity, one of the major focuses of this research project was to evaluate the status of the
cAMP signaling pathway in splenocyte and thymocyte preparations in the presence of
cannabinol. For these studies, forskolin was used to activate the CAMP cascade through
the direct stimulation of adenylate cyclase activity. Forskolin stimulation of either
splenocytes or thymocytes in the presence of cannabinol resulted in a significant
inhibition of intracellular CAMP levels indicating the functional expression of CB2
receptors in both of these murine cell preparations. In addition to the fact that thymocytes
express virtually no CBl mRNA, the thymocyte studies are particularly interesting for

two reasons: (1) intracellular cAMP levels were approximately 4-fold greater in

125

thymocytes than splenocytes following forskolin stimulation; and (2) the magnitude of
adenylate cyclase inhibition by cannabinol was significantly greater in thymocytes. A
similar difference in intracellular CAMP levels has been shown in thymocytes and
peripheral T-Cells following forskolin stimulation suggesting an important role for CAMP
in T -Cell development and differentiation (Scherer et al., 1995).

The effect of cannabinol on downstream components of the CAMP signaling
cascade; specifically, the activation of PKA and the induction of PKA-regulated
transcription factors was further examined. These studies showed that cannabinol
produced a marked inhibition of PKA activity in forskolin-stimulated splenocytes. It is
notable that the inhibition of PKA activity was not due to a direct effect of cannabinoids
on the kinase. Rather, PKA inhibition occurs indirectly through a decrease in CAMP
formation as demonstrated by the ability of exogenous CAMP to activate PKA in the
presence of cannabinoids (Koh et al., 1997). Interestingly, although the reduction in
adenylate cyclase activity by cannabinol was moderate (approximately 30% decrease at
20 pM), Changes at the level of PKA were more profound as evidenced by a greater than
50% decrease in kinase activity at the same cannabinol concentration. This difference is
most likely due to the amplification of the signal as it is transduced from the plasma
membrane to the nucleus.

The effect of cannabinol on the terminal event of the CAMP cascade, the binding
of CREB/ATP transcription factors to a CRE motif, was evaluated by EMSA. Forskolin
treatment alone (0-120 min) readily induced a CRE binding complex in both splenocytes
and thymocytes which was markedly inhibited by cannabinol at every time point tested.
The kinetics of DNA binding and the sensitivity to inhibition by cannabinol correlate
with previous findings demonstrating that CAMP analogs reverse the cannabinoid-
mediated inhibition of the IgM AFC response only within the first 60 min after antigen
sensitization (Kaminski et al., 1994). The regulation of NF-KB/C-Rel transcription factors

has been shown to be partially under the control of PKA in leukocytes (Muroi and Suzuk,

126

1993; Shirakawa et al., 1989; Shirakawa and Mizel, 1989). Cannabinol was also found to
inhibit the NF-KB/C-Rel DNA binding complexes in primary mouse splenocytes and
thymocytes following forskolin stimulation. The decrease in NF-KB binding by
cannabinoids is further supported by additional studies from our laboratory. A direct
association has been identified between the inhibition of CAMP signaling, a decrease in
NF-KB/C-Rel DNA binding, and the inhibition of iNOS in macrophages treated with A9-
THC (Coffey et al., 1996; Jeon et al., 1996). Taken together, the cannabinol-induced
inhibition of CRE and KB DNA binding complexes within 60 min of stimulation supports
the hypothesis that cannabinoids inhibit an early leukocyte activation event.

The role of CAMP signaling in immune regulation is not well defined, however
numerous studies suggest a positive/stimulatory role for CAMP in mediating certain
leukocyte cellular responses. Evidence supporting this premise includes a rapid and
transient increase in intracellular CAMP following mitogenic stimulation of splenocytes
(Hadden et al., 1972; Kaminski et al., 1994; Russell, 1978; Smith et al., 1971) and
enhancement of proliferative and T-Cell dependent AFC responses by CAMP analogs
(Kaminski et al., 1994; Koh et al., 1995). Additionally, inhibition of adenylate cyclase
activity by cannabinoids is Closely correlated with the suppression of certain cell-
mediated and humoral immune responses (Kaminski et al., 1994). A cause and effect
relationship between the inhibition of intracellular CAMP and decreased immune function
is further supported by the ability of exogenous CAMP or glucagon, a hormone which
elevates CAMP levels, to reverse the inhibition of immune function by cannabinoids
(Kaminski et al., 1994; Koh et al., 1996). Studies investigating the inhibitory effects of
A9-THC on humoral immune responses have shown that only immunoglobulin
production to T-Cell dependent antigens (i.e., sheep erythrocytes) is suppressed by
cannabinoids (Schatz et al., 1993) suggesting that helper T-Cells are a sensitive target for
inhibition by cannabinoid compounds. Additional evidence supporting the sensitivity of

helper T-Cells to cannabinoids includes A9-THC-mediated disruption of CAMP signal

127

transduction and IL-2 production in the murine T-Cell line EL-4.IL-2 (Condie et al.,
1996). Collectively, these findings suggest that alterations in CAMP signaling may lead
to T-lymphocyte dysfunction.

It is notable that not all immune responses appear to be sensitive to inhibition by
cannabinoid compounds; however, this differential sensitivity does not appear to be due
to a lack of cannabinoid receptor expression in certain subpopulations of cells.
Cannabinoid receptor expression has been detected in all three major leukocyte cell types
present in the spleen; B-Cells, T-Cells, and macrophages (Bouaboula et al., 1993; Condie
et al., 1996; Icon et al., 1996; Munro et al., 1993; Schatz et al., 1997). A more likely
explanation for the differential sensitivity of immune responses to cannabinoids pertains
to whether the CAMP signaling cascade is critical to a specific effector function. For
example, iNOS expression is positively regulated by CAMP in macrophages (Alonso et
al., 1995; Icon et al., 1996; Koide et al., 1993; Mullet et al., 1997), and A9-THC
suppresses iNOS transcription in these cells (Coffey et al., 1996; Icon et al., 1996).
Conversely, B-Cells do not appear to be as dependent on CAMP signals for
immunoglobulin secretion. This is based on the fact that IgM secretion in response to T-
cell independent antigens (i.e., LPS or DNP-Ficoll) is refractory to inhibition by A9-THC
(Schatz et al., 1993) despite a marked decrease in B-Cell adenylate cyclase activity
(Schatz et al., 1997). Interestingly, the current studies demonstrate that cannabinol
inhibits LPS-induced proliferation by B-Cells which may reflect the critical role PKA
plays in cell-cycle control (Grieco et al., 1996). Proliferating-cell nuclear antigen
(PCNA), an auxiliary factor of DNA polymerase 5, is also central to proliferation and cell
cycle progression (Bravo et al., 1987; Madsen and Celis, 1985). The regulation of PCNA
gene expression is mediated by tandem CRE sequences in the PCNA promoter, and IL-2
stimulation of T-Cells induces CREB/ATP protein binding to these CRE motifs

(Feuerstein et al., 1995; Huang et al., 1994). Thus, the inhibition of CRE binding

128

complexes by cannabinol suggests that a reduction in PCNA expression may also be
involved in the inhibition of lymphoproliferation by cannabinoids.

In light of the T-Cell sensitivity to inhibition by cannabinoids and the sole
expression of CB2, thymocytes were Chosen as the experimental model for all subsequent
studies of this research project. The focus on thymocytes provided a primary T-Cell
model to further characterize the mechanism of cannabinoid-mediated suppression of T-
cells. Although the forskolin studies contributed significant insight into the effects of
cannabinol on the CAMP cascade in mouse thymocytes, the effects of cannabinol in the
presence of a relevant T-Cell activation signal had not been examined. PMA/Io is often
used to activate T-Cells as it mimics signaling through the T-Cell antigen receptor.
Previous studies have shown a rapid and transient increase in intracellular CAMP levels
following PMA/Io activation of splenocytes suggesting that PMA/Io can activate the
CAMP pathway in leukocytes (Kaminski et al., 1994). Furthermore, phorbol ester
activation of PKC was reported to enhance adenylate cyclase activity indicating cross-
talk between the CAMP and PKC signaling pathways (Yoshimasa et al., 1987). The
present results demonstrate that PMA/Io activation of thymocytes induced a predominant
CRE complex consisting of a CREB-1 homodimer. The binding of the CREB-1
homodimer was markedly inhibited by cannabinol indicating the potential activation of
the CAMP pathway by PMA/Io. The detection of CREB-1 in this CRE complex is
consistent with recent findings that CREB-l is a major component of the CRE complexes
induced following T-Cell activation through the antigen receptor or by co-treatment with
Con A plus TPA (Feuerstein et al., 1996; Wollberg et al., 1994).

PKA is the most extensively Characterized kinase by which CREB/ATF proteins
are regulated, and PKA phosphorylation of CREB at Ser-133 induces the expression of
CAMP responsive genes. In light of the cannabinol-mediated inhibition of forskolin-
stimulated PKA activity, Changes in the phosphorylation status of CREB were

investigated in the presence of cannabinol. Cannabinol produced a marked inhibition of

129

CREB phosphorylation in thymocytes treated with either forskolin or PMA/Io. The
cannabinol-mediated decrease in phospho-CREB following forskolin stimulation
demonstrates the regulation of CREB by PKA and provides a mechanism for the
suppression of CRE DNA binding complexes. Based on the established cross-talk
between PKA and PKC pathways, the induction of CREB phosphorylation by PMA/Io
and the inhibition by cannabinol implicates PKA phosphorylation of CREB in activated
T-Cells. However, several other kinases have been shown to phosphorylate CREB at Ser-
133 including casein kinase, PKC, CaM kinase II and IV, and the RSK family of kinases
(Gonzalez et al., 1991; Gonzalez et al., 1989; Means et al., 1997; Tamai et al., 1997). It
is also notable that recent studies have suggested that CREB phosphorylation following
T-Cell activation occurs by a CAMP-independent mechanism (Barton et al., 1996; Hsueh
etaL,1997)

The studies with H89 indicate a modest involvement of PKA in CREB
phosphorylation in PMA/Io activated thymocytes. Furthermore, DBCAMP failed to
reverse the cannabinol-mediated inhibition of CREB phosphorylation and IL-2 following
PMA/Io activation of thymocytes. These findings suggest that an inhibition of PKA by
cannabinol can not fully account for the significant decrease in phospho-CREB following
thymocyte activation in the presence of cannabinol. These results are supported by recent
work demonstrating that H89 was unable to inhibit the phosphorylation of CREB induced
by phorbol ester plus calcium ionophore in EL-4 cells (Hsueh et al., 1997). Moreover,
CREB phosphorylation following phorbol ester and CD28 costimulation of EL-4 cells
was associated with MAPKK activity rather than PKC, PKA, or p70s6k (Hsueh et al.,
1997). The responsiveness of CREB to CAMP, calcium, and mitogenic stimuli implicates
CREB as a convergence point for multiple pathways in activated thymocytes, and more
importantly, offers the possibility that cannabinol may modulate kinases other than PKA.
Of these kinases, CaM kinase IV (CaMKIV) is critically relevant to T-Cell activation
studies. CaM kinase IV has been shown to phosphorylate Set-133 of CREB in activated

130

T-Cells indicating that CaMKIV functions as a CREB kinase in T lymphocytes
(Gringhius et al., 1998; Means et al., 1997). This premise was strengthened further by
recent transgenic studies using a kinase inactive form of CaMKIV specifically expressed
in thymocytes. Anderson and coworkers reported a significant inhibition of CREB
phosphorylation and IL-2 production when CaMKIV transgenic thymocytes were
activated with PMA/Io (Anderson et al., 1997). Their results were strikingly similar to
the thymocyte-specific expression of a dominant negative CREB (Barton et al., 1996)
suggesting a mechanistic relationship between CREB and CaMKIV in early T-Cell
activation events. Interestingly, kinetic studies for A9-THC demonstrated that maximal
inhibition of the T-Cell dependent IgM antibody forming cell response occurred within 30
min of drug exposure suggesting that cannabinoids inhibit an early T-Cell activation event
(Schatz et al., 1993). In addition, A9-THC has been shown to decrease intracellular
calcium flux in Con A stimulated thymocytes (Yebra et al., 1992). Based on the above
evidence, CaMKIV appears to be one potential target of cannabinol-mediated inhibition
in T-Cells. An inhibition of CaMKIV by cannabinol may partially explain the effects of
H89 and DBCAMP on CREB phosphorylation and IL-2 production in activated
thymocytes. The MAP kinase cascade is also central to T-Cell activation, and recent
studies have shown an inhibition of MAP kinase activity by cannabinol in PMA/Io
activated splenocytes (Faubert and Kaminski, 1999). Thus, the modulation of MAPK by
cannabinol may also contribute to the inhibition of CREB phosphorylation and IL-2
secretion following PMA/Io activation of thymocytes.

According to densitometric analysis, cannabinol inhibited CREB phosphorylation
below the basal level of phosphorylation detected in naive thymocytes. The magnitude of
this effect may be partially explained by the protein phosphatase regulation of CREB;
specifically the dephosphorylation of Ser-133 by PP-l. PP-l activity is regulated by the
I-1 inhibitor, and LI requires PKA phosphorylation in order to effectively inhibit PP—l
(Hagiwara et al., 1992). The inhibition of PKA by cannabinol may indirectly decrease I-

131

1 regulation of PP-l resulting in an enhancement of phosphatase activity. Therefore, an
inhibition of kinase-induced phosphorylation coupled with an increase in PP-l activity
likely accounts for the marked decrease in phospho-CREB produced by cannabinol.

As previously noted, several studies have suggested that an elevation of
intracellular CAMP leads to the activation of NF-KB (Muroi and Suzuk, 1993; Shirakawa
et al., 1989; Shirakawa and Mizel, 1989). The KB DNA binding results with forskolin
and cannabinol would implicate an involvement of the CAMP pathway in NF-KB
regulation. PMA/Io activation of thymocytes induced an upper KB binding complex that
was sensitive to inhibition by cannabinol. The specific NF-KB/C-Rel proteins induced by
PMA/Io and modulated by cannabinol were identified as a p65/C-Rel heterodimer.
Interestingly, the CAMP cascade has been found to regulate c-Rel in T-Cells as evidenced
by increased C-Rel DNA binding after the activation of PKA (Lahdenpohja et al., 1996).
An increase in p65 binding activity has also been reported following phosphorylation by
a PKA catalytic subunit found associated with the cytosolic NF-KB-IKB complex (Zhong
et al., 1997; Zhong et al., 1998). This PKAC is inactive when bound to the NF-KB-IKB
complex and becomes activated upon degradation of IKB-0t; therefore, this regulation of
PKA has been Classified as a CAMP-independent mechanism. The phosphorylation of
p65 by PKAC has also been shown to potently increase the transactivating activity of NF-
KB (Zhong et al., 1998). Moreover, the p65/C—Rel heterodimer is a transcriptional
activator (Hansen et al., 1994) and suggests that the inhibition of p65/C-Rel DNA binding
by cannabinol decreases the expression of critical genes regulated by p65/C-Rel dimers.

The activation and subsequent nuclear translocation of NF-KB requires
phosphorylation of the cytosolic IKB-0t inhibitor which was initially thought to be
mediated by several kinases including PKA and PKC. Recently, a large cytoplasmic IKB
kinase complex has been Characterized, and two IKB kinases (IKKOL and IKKB) that can
phosphorylate IKB-0t in response to activating stimuli have been identified as part of this

larger IKB regulatory complex (DiDonato et al., 1997). Although the regulation of the

132

IKB kinase complex is still unclear, it has been speculated that this complex may integrate
signals from a variety of NF—KB activation pathways (May and Ghosh, 1998). In fact,
upstream signals from NIK and MEKK have been reported to activate IKKa and IKKB,
respectively (Ling et al., 1998; Nakano et al., 1998). Based on the present results, the
inhibition of NF-KB activation and DNA binding by cannabinol appears to be mediated
through a reduction in IKB-0t degradation. We believe that an inhibition of
phosphorylation is the primary mechanism by which cannabinol interferes with the
degradation of IKB-0t. This initial decrease in phosphorylation retains NF-KB in the
cytosol and prevents the degradation of IKB-0t. As a result, the PKAC associated with the
NF-KB-IKB complex remains inactive and unable to phosphorylate p65 thereby inhibiting
its DNA binding and activation of target gene expression.

The H89 studies revealed no involvement of PKA in the regulation of NF-KB in
thymocytes as evidenced by the lack of an effect on NF-KB binding and IKB-a
degradation. This was further substantiated by the inability of DBCAMP or forskolin to
reverse the cannabinol-induced inhibition of NF-KB binding activity. These findings
strongly suggest that the mechanism of NF-KB inhibition by cannabinol in PMA/Io
activated thymocytes occurs through signaling pathways other than CAMP. With the
recent identification of the IKB kinase regulatory complex, the modulation of NF-KB by
cannabinol may be mediated at several levels. The inhibition of IKKOt and/or IKKB
kinase activity by cannabinol is one possible mechanism consistent with the interpretation
that cannabinol decreases the phosphorylation of IKB-0t. Alternatively, cannabinol may
interfere with upstream regulatory signals involved in the activation of the IKB kinases.
For example, an inhibition of NIK or MEKK activity by cannabinol would result in the
decreased phosphorylation of IKB-a by IKKa and IKKB. These conclusions are based
on the premise that cannabinol alters the phosphorylation status of IKB-0t; however, the
degradation of IKB-0t is a multi-step process. A similar profile of IKB-0t protein

expression would be observed in the presence of cannabinol if the drug: (1) interfered

133

with the ubiquitination of IKB-0t; (2) inhibited the activity of the 26S proteosome; or (3)
activated a phosphatase that dephosphorylated IKB-0t. These possibilities await further
investigation and can not be excluded at this time.

The minimal essential promoter region of the IL-2 gene contains binding sites for
several inducible transcription factors including NF-AT, AP-l and NF-KB; however, no
specific CRE binding sites are present in the IL—2 promoter region. Despite the lack of a
CRE in the IL-2 promoter, several recent reports have described a critical role for the
CREB/ATP proteins in IL-2 regulation following T-Cell activation (Barton et al., 1996;
Butscher et al., 1998; Hsueh et al., 1997). An essential role for CREB in IL-2 regulation
was initially demonstrated using a dominant negative form of CREB which revealed a
drastic inhibition of IL-2 production in PMA/Io activated thymocytes (Barton et al.,
1996). This effect was attributed to a decrease in the CREB-dependent expression of fos
and jun proteins in the transgenic thymocytes. Alternatively, a direct role for CREB at
the IL-2 promoter has also been proposed. For example, supershift studies in thymocytes
have identified CREB as part of the protein complex binding to the AP-l proximal (AP-
1p) site of the IL-2 promoter (Chen and Rothenberg, 1993). It is important to emphasize
that this particular AP—l site is critical for AP-l induction of the IL-2 gene (Jain et al.,
1992b). In addition, treatment of EL-4.IL—2 cells with PMA/Io plus forskolin enhanced
binding to the AP-lp site further suggesting the direct involvement of CREB/ATP
transcription factors in IL-2 regulation (Condie et al., 1996). In accordance with this,
CREB has also been shown to bind to the CD28RE site within the IL-2 promoter which is
further supported by the observation that activation of a CD28RE-TRE CAT reporter
construct was inhibited by dominant-negative CREB expression vectors (Butscher et al.,
1998). In light of this, the findings with cannabinol strongly suggest that inhibition of
CREB binding in PMA/Io activated thymocytes is involved in the cannabinol-mediated
suppression of IL-2 in these cells. NF-KB/C-Rel transcription factors also play an

important role in regulating IL-2 expression by binding to the KB sequence within the IL-

134

2 promoter. Several recent reports have established that members of the NF-KB family
can bind to the CD28RE of the IL-2 promoter demonstrating further regulation of IL-2 by
these proteins (Butscher et al., 1998; Ghosh et al., 1993; Lai et al., 1995). p50, p65, and
C-Rel have all been identified in the CD28RE binding complex and the p65/c-Rel
heterodimer was specifically shown to be a potent activator of the CD28RE (Ghosh et al.,
1993; Lai et al., 1995). In light of this evidence, the inhibition of p65/C-Rel binding to
the KB motif produced by cannabinol may be modulating IL-2 levels through both the KB
and CD28RE sites of the IL-2 promoter. In addition to CREB and NF-KB, the induction
of NF-AT and AP-l is also essential for IL-2 expression. Recent studies have
demonstrated the inhibition of NF-AT and AP-l DNA binding complexes by
cannabinoids in mouse splenocytes and the EL-4 T-Cell line (Faubert and Kaminski,
1999; Yea et al., 1999). Therefore, it is likely that the coordinated inhibition of CREB,
NF-KB, NF-AT, and AP-l results in the significant suppression of IL-2 expression by
cannabinol in thymocytes.

Although the CAMP signaling cascade has been the most extensively studied
signal transduction pathway coupled to both CB1 and CB2 receptors, additional signaling
mechanisms for cannabinoid receptors have been reported. For example, the modulation
of MAP kinase by cannabinoids has been shown in unstimulated CHO cells tranfected
with either CB1 or CB2 (Bouaboula et al., 1995; Bouaboula et al., 1996). Consistent
with the predominant expression of CB1 in the CNS, the CB1 receptor can inhibit both
N-type and Q-type calcium Channels as well as stimulate potassium influx (Felder et al.,
1995; Mackie and Hille, 1992). Interestingly, transfection of the At20 pituitary cell line
with either CB1 or CB2 demonstrated that modulation of ion Channels by cannabinoid
receptors is unique to the CB] subtype (Felder et al., 1995). With the exception of
CAMP, the identification of other signaling pathways coupled to the CB2 receptor in
lymphocytes has not been extensively studied. The inability of membrane permeable

CAMP analogs to reverse the inhibition produced by cannabinol suggests that modulation

135

of the CAMP cascade is not solely responsible for the effects of cannabinol on CREB,
NF-KB, and IL-2 in activated thymocytes. However, the interpretation of these results is
limited by the burst-attenuation kinetics of the CAMP pathway. The continual stimulation
of thymocytes with DBCAMP or forskolin (60 min) does not mimic the rapid burst of
intracellular CAMP that occurs following activation and may not represent endogenous
CAMP activity. Despite this limitation, the results with H89 and DBCAMP suggest that
the CB2 receptor may couple to additional signaling pathways in activated T-cells.
Based on the complex regulation of IL-2, CREB, and NF-KB, two signaling pathways
potentially coupled to CB2 are Ca2+/CaMKIV and the MAPK cascade. Compelling
evidence exists to correlate CREB phosphorylation and IL-2 expression with CaMKIV
activity in thymocytes (Anderson et al., 1997). As previously discussed, the modulation
of MAPK activity by cannabinoids has been observed (Bouaboula et al., 1995;
Bouaboula et al., 1996; Faubert and Kaminski, 1999). However, it is presently unknown
whether the cannabinol-mediated inhibition of MAPK results from upstream modulation
of Ras, MEKK, and/or MEK by the CB2 receptor. Alternatively, it is also possible that
cannabinol produces direct effects on CaMKIV and the MAP kinases. Previous studies
have reported CBl receptor-independent effects of cannabinoids. For example, CP-
55,940 induced the release of arachidonic acid in both CB1 transfected and untransfected
CHO cells (Felder et al., 1992). In addition, both stereoisomers of A9-THC were shown
to increase arachidonic acid levels in the guinea pig cortex (Reichman et al., 1988). As a
result, additional studies are necessary to examine CB2-mediated and/or CB2-
independent effects of cannabinol on the regulation of IL-2, CREB, and NF-KB. The
development of SR141716A, a CB1 receptor antagonist, has furthered the understanding
of CB1-mediated effects of cannabinoids in the CNS (Rinaldi-Carmona et al., 1994).
Recently, a CB2-specific antagonist, SR144528, has been identified (Rinaldi-Carmona et
al., 1998). Therefore, future studies with CB2 receptor antagonists should provide

significant insight into CB2-mediated versus CB2-independent effects of cannabinol.

136

In summary, this work has demonstrated that cannabinol inhibits the CAMP
signaling cascade in mouse splenocytes and thymocytes which implicates a role for the
CB2 receptor in immune modulation by cannabinoid compounds (Figure 43). Previous
studies have determined that T-Cells are sensitive to inhibition by A9-THC (Schatz et al.,
1993); therefore, the present studies examined molecular mechanisms whereby
cannabinoids suppress T-Cell activation. Specifically, cannabinol inhibits the binding of a
CREB-l homodimer and a p65/C-Rel heterodimer to a CRE and KB DNA motif,
respectively, in activated thymocytes. CREB/ATF and NF-KB/C-Rel transcription factors
are critically involved in the regulation of IL-2. The decrease in CRE and KB DNA
binding by cannabinol provides a potential explanation for the suppression of IL—2
expression by cannabinoid compounds following T-Cell activation. Additionally,
cannabinol inhibited the phosphorylation of CREB and prevented the degradation of IKB-
ot suggesting that cannabinol inhibited CREB and NF-KB activation through an inhibition
of phosphorylation. Although the CAMP cascade is the best characterized signaling
pathway coupled to cannabinoid receptors, DBCAMP was unable to reverse the
cannabinol-mediated inhibition of CREB, NF-KB, and IL-2 in PMA/Io activated
thymocytes. The major contributions of this research are as follows: (1) these results
have established that cannabinol, a plant-derived cannabinoid with minimal CNS activity,
is an immunosuppressive compound; (2) these findings provide significant insight into
the molecular mechanisms of immunosuppression by cannabinoid compounds; and (3)
these studies also suggest that signaling pathways other than the CAMP cascade
significantly contribute to the modulation of CREB, NF-KB, and IL-2 by cannabinol in
mouse thymocytes (Figure 43).

Despite the potential medicinal applications of cannabinoids, they have not been
widely used as therapeutic agents. This primarily stems from their undesirable CNS
effects. The unique tissue distribution of the CB2 receptor enables the selective targeting
of the immune system. The modulation of CREB/ATF and NF-KB/C-Rel

137

Figure 43. Proposed mechanism of cannabinol-mediated inhibition of T-Cells. The
binding of cannabinol to the CBZ receptor inhibits the CAMP signaling cascade resulting
in an inhibition of CREB phosphorylation and CRE DNA binding activity. Cannabinol
also prevents the degradation of IKB-a which inhibits the nuclear translocation and DNA
binding of a p65/C-Rel heterodimer. The inhibition produced by cannabinol in
thymocytes is denoted by an X. The cannabinol-mediated inhibition of CREB and NF-
xB transcription factors partially explains the decrease in IL-2 by cannabinoid
compounds. It is likely that additional signaling pathways are modulated by cannabinol
and/or the CB2 receptor as indicated by the (----) arrows.

138

 

g®>®
Inc—@800
.933 mu:

 

+

ESE—SRO

v.5.
/ v

/
‘I /
/

 

         

 

139

transcription factors by cannabinol is exciting in light of the fact that several cytokines,

including inflammatory mediators, are regulated by CREB and NF-KB proteins.
Therefore, CB2-selective compounds may have therapeutic potential as anti-
inflammatory agents, and cannabinol may be a prototype for cannabinoid based immune

modulators.

140

LITERATURE CITED

141

LITERATURE CITED

Alam, S. M., Travers, P. J ., Wung, J. L., Nasholds, W., Redpath, S., Jameson, S. C. and
Gascoigne, N. R. (1996). T-Cell-receptor affinity and thymocyte positive
selection. Nature 381: 616-620.

Alava, M. A., DeBell, K. E., Conti, A., Hoffman, T. and Bonvini, E. (1992). Increased
intracellular CAMP inhibits inositol phospholipid hydrolysis induced by
perturbation of the T cell receptor/CD3 complex but not by G-protein stimulation:

association with protein kinase A-mediated phosphorylation of phospholipase C-y.
Biochem. J. 284: 189-199.

Alberola-Ila, J ., Forbush, K. A., Seger, R., Krebs, E. G. and Perlmutter, R. M. (1995).
Selective requirement for MAP kinase activation in thymocyte differentiation.
Nature 373: 620-623.

Alonso, A., Carvalho, J ., Alonso-Torre, S., Nunex, L., Bosca, L. and Crespo, M. (1995).
Nitric oxide synthesis in rat peritoneal macrophages is induced by IgE/DNP
complexes and cyclic AMP analogues: evidence in favor of a common signaling
mechanism. J. Immunol. 154: 6475-6483.

Amieux, P. S., Cummings, D. E., Motamed, K., Brandon, E. P., Wailes, L. A., Le, K.,
Idzerda, R. L. and McKnight, G. S. (1997). Compensatory regulation of RI alpha
protein levels in protein kinase A mutant mice. J. Biol. Chem. 272: 3993-3998.

Anderson, K. A., Ribar, T. J ., Illario, M. and Means, A. R. (1997). Defective survival and
activation of thymocytes in transgenic mice expressing a catalytically inactive
form of Ca2+lCalmodulin-dependent protein kinase IV. Mol. Endocrinol. 11:
725-737.

Arenzana-Seisdedos, R, Thompson, J ., Rodriguez, M. S., Bachelerie, E, Thomas, D. and
Hay, R. T. (1995). Inducible nuclear expression of newly synthesized IxBoz
negatively regulates DNA-binding and transcriptional activities of NF-KB. Mol.
Cell. Biol. 15: 2689-2696.

Armstrong, R., Wen, W., Taylor, S. and Montminy, M. (1995). A refractory phase in
cyclic AMP-responsive transcription requires down regulation of protein kinase
A. Mol. Cell. Biol. 15: 1826-1832.

Ascherman, D. P., Migone, T. S., Friedman, M. C. and Leonard, W. J. (1997).
Interleukin-2 (IL-2)-mediated induction of the IL-2 receptor a Chain gene. J. Biol.
Chem. 272: 8704—8709.

Ashton-Rickardt, P. G., Bandeira, A., Delaney, J. R., Van Kaer, L., Pircher, H. P.,

Zinkemagel, R. M. and Tonegawa, S. (1994). Evidence for a differential avidity
model of T cell selection in the thymus. Cell 76: 651-663.

142

August, A., Gibson, 8., Kawakami, Y., Kawakami, T., Mills, G. and Dupont, B. (1994).
CD28 is associated with and induces the immediate tyrosine phosphorylation and
activation of the TCC family kinase IT K/EMT in the human Jurkat leukemic T-Cell
line. Proc. Natl. Acad. Sci. USA 91: 9347-9351.

Baeuerle, P. A., Lenardo, M., Peirce, J. W. and Baltimore, D. (1988). Phorbol-ester-
induced activation of the NF-KB transcription factor involves dissociation of an
apparently cytoplasmic NF—xB/inhibitor complex. Cold Spring Harbor Symp.
Quant. Biol. 53: 789-798.

Baier-Bitterlich, G., Uberall, F., Bauer, B., Fresser, F., Wachter, H., Grunicke, H.,
Utermann, G., Altman, A. and Baier, G. (1996). Protein kinase C-q isoenzyme
selective stimulation of the transcription factor complex AP—l in T lymphocytes.
Mol. Cell. Biol. 16: 1842-1850.

Barnes, P. J. and Karin, M. (1997). Nuclear Factor-kB-a pivotal transcription factor in
chronic inflammatory diseases. NEJM 336: 1066-1071.

Barton, K., Muthusamy, N., Chanyangam, M., Fischer, G, Clendenin, C. and Leiden, J.
M. (1996). Defective thymocyte proliferation and IL—2 production in transgenic
mice expressing a dominant-negative form of CREB. Nature 379: 81-85.

Benbrook, D. M. and Jones, N. C. (1990). Heterodimer formation between CREB and
JUN proteins. Oncogene 5: 295-302.

Berridge, M. J. (1995). Capacitative calcium entry. Biochem. J. 312: 1-1 1.

Berridge, M. J. (1997). Lymphocyte activation in health and disease. Crit. Rev. Immunol.
17: 155-178.

Betz, M. and Fox, B. S. (1991). Prostaglandin E2 inhibits production of Th1 lymphokines
but not of Th2 lymphokines. J. Immunol. 146: 108-113.

Bismuth, G., Theodorou, I., Gouy, H., Le Gouvello, 8., Bernard, A. and Debre, P. (1988).
CyCliC AMP-mediated alteration of the CD2 activation process in human T
lymphocytes: preferential inhibition of the phosphoinositide cycle-related
transduction pathway. Eur. J. Immunol. 18: 1351-1357.

Bisotto, S., Minorgan, S. and Rehfuss, R. P. (1996). Identification and Characterization of

a novel transcriptional activation domain in the CREB-binding protein. J. Biol.
Chem. 271: 17746-17750.

Black, M. B., Woods, J. H. and Domino, E. F. (1970). Some effects of A9-trans-
tetrahydrocannabinol and other cannabis derivatives on schedule-controlled
behavior. Pharmacologist 12: 258.

Blackman, M. A., Tigges, M. A., Minie, M. E. and Koshland, M. E. (1986). A model

system for peptide hormone action in differentiation: interleukin 2 induces a B
lymphoma to transcribe the J Chain gene. Cell 47: 609-617.

143

Blanchard, D., Newton, C., Klein, T., Stewart, W. and Friedman, H. (1986). In vitro and
in vivo suppressive effects of delta-9-tetrahydrocannabinol on interferon
production by murine spleen cells. Int. J. Immunopharmacol. 8: 819-824.

Block, R. 1., Arinpour, R. and Schlechte, J. A. (1991). Effects of Chronic marijuana use
on testosterone, luteinizing hormone, follicle stimulating hormone, prolactin, and
cortisol in men and women. Drug Alcohol Depend. 28: 121-128.

Boise, L. H., Petryniak, B., Mao, X., June, C. H., Wang, C. Y., Lindsten, T., Bravo, R.,
Kovary, K., Leiden, J. M. and Thompson, C. B. (1993). The NFAT-l DNA

binding complex in activated T cells contains Fra-l and JunB. Mol. Cell. Biol. 13:
191 1-1919.

Borst, J ., Jacobs, H. and Brouns, G. (1996). Composition and function of T-Cell receptor
and B-Cell receptor complexes on precursor lymphocytes. Curr. Opin. Immunol.
8: 181-190.

Bouaboula, M., Poinot-Chazel, C., Bourrie, B., Canat, X., Calandra, B., Rinaldi-
Carmona, M., Le Fur, G. and Casellas, P. (1995). Activation of mitogen-activated
protein kinases by stimulation of the central cannabinoid receptor CB1. Biochem.
J. 312: 637-641.

Bouaboula, M., Poinot-Chazel, C., Marchand, J., Canat, X., Bourrie, B., Rinaldi-
Carrnona, M., Calandra, B., Le Fur, G. and Casellas, P. (1996). Signaling pathway
associated with stimulation of CB2 peripheral cannabinoid receptor; involvement
of both mitogen-activated protein kinase and induction of Krox-24 expression.
Eur. J. Biochem. 237: 704-71 1.

Bouaboula, M., Rinaldi, M., Carayon, P., Carillon, C., Delpech, B., Shire, D., Le Fur, G.
and Casellas, P. (1993). Cannabinoid-receptor expression in human leukocytes.
Eur. J. Biochem. 214: 173-180.

Bours, V., Franzoso, G., Azarenko, V., Park, S., Kanno, T., Brown, K. and U., S. (1993).
The oncoprotein BCl-3 directly transactivates through KB motifs via association
with DNA-binding p50B homodimers. Cell 72: 729-739.

Bravo, R., Frank, R., Blundell, P. A. and Macdonald-Bravo, H. (1987). Cyclin/PCNA is
the auxiliary protein of DNA polymerase delta. Nature 326: 515-517.

Brockman, J. A., Scherer, D. C., McKinsey, T. A., Hall, S. M., Qi, X., Lee, W. Y. and
Ballard, D. W. (1995). Coupling of a signal response domain in IxBa to multiple
pathways for NF-xB activation. Mol. Cell. Biol. 15: 2809-2818.

Brown, A., Linhoff, M., Stein, B., Wright, K., Baldwin, A., Basta, P. and Ting, J. (1994).
Function of NFKB/Rel binding sites in the major histocompatability complex Class
II invariant Chain promoter is dependent on cell-specific binding of different
NFKB/Rel subunits. Mol. Cell. Biol. 14: 2926-2935.

Brown, K., Gerstberger, S., Carlson, L., Franzoso, G. and Siebenlist, U. (1995). Control
of IKB-a proteolysis by site-specific, signal-induced phosphorylation. Science
267: 1485-1488.

144

Butscher, W. G., Powers, C., Olive, M., Vinson, C. and Gardner, K. (1998). Coordinate
transactivation of the interleukin-2 CD28 response element by C-Rel and ATF-
l/CREB2. J. Biol. Chem. 273: 552-560.

Cabral, G., MCNerney, P. and Mishkin, E. (1986a). Delta-9-tetrahydrocannabinol
enhances release of herpes simplex virus. J. Gen. Virol. 67: 2017-2022.

Cabral, G., MCNerney, P. and Mishkin, E. (1987). Delta-9-tetrahydrocannabinol inhibits
the splenocyte proliferate response to herpes simplex virus type 2.
Immunopharmacol. Immunotoxicol. 9: 361-370.

Cabral, G. A., Lockmuller, J. C. and Mishkin, E. M. (1986b). Delta-9-
tetrahydrocannabinol decreases alpha/beta interferon response to herpes simplex
virus type 2 in the B6C3F1 mouse. Proc. Soc. Exp. Biol. Med. 181: 305-311.

Cabral, G. A., Mishkin, E. M. and Holsapple, M. P. (1984). Delta-9-tetrahydrocannabinol
decreases host resistance to herpes simplex virus type 2 vaginal infection in

guinea pig. Marijuana '84 In Proceedings of the Oxford Symposium on Cannabis:
43 1-438.

Cabral, G. A., Stinnett, A. L., Bailey, J., Ali, S. F., Paule, M. G., Scallet, A. C. and
Slikker, W. (1991). Chronic marijuana smoke alters alveolar macrophage
morphology and protein expression. Pharmacol. Biochem. Behav. 40: 643-649.

Cabral, G. A. and Vasquez, R. (1992). Delta-9-tetrahydrocannabinol suppresses

macrophage extrinsic antiherpes virus activity. Proc. Soc. Exp. Biol. Med. 199:
255-263.

Camps, M. (1992). Stimulation of phospholipase C by guanine-nucleotide-binding
protein beta gamma subunits. Eur. J. Biochem. 206: 821-831.

Camps, M., Carozzi, A., Schnabel, P., Scheer, A., Parker, P. J. and Gierschik, P. (1992).
Isozyme-selective stimulation of phospholipase C-B2 by G protein [iv-subunits.
Nature 360: 684-686.

Carayon, P., Marchand, J ., Dussossoy, D., Derocq, J. M., Jbilo, 0., Bord, A., Bouaboula,
M., Galiegue, S., Mondiere, P., Penarier, G., Fur, G. L., Defrance, T. and
Casellas, P. (1998). Modulation and functional involvement of CB2 peripheral
cannabinoid receptors during B-Cell differentiation. Blood 92: 3605-3615.

Carlini, E. A. (1968). Tolerance to Chronic administration of cannabis sativa (marihuana)
in rats. Pharmacology 1: 135-142.

Carpenter, C. L. and Cantley, L. C. (1996). Phosphoinositide kinases. Curr. Opin. Cell.
Biol. 8: 153-158.

Caufield, M. P. and Brown, D. A. (1992). Cannabinoid receptor agonists inhibit Ca2+

current in NG108-15 neuroblastoma cells via a pertussis toxin-sensitive
mechanism. Br. J. Pharmacol. 106: 231-232.

145

Ceredig, R., Lowenthal, J. W., Nabholz, M. and MacDonaled, H. R. (1985). Expression
of interleukin-2 receptors as a differentiation marker on intrathymic stem cells.
Nature 314: 98-100.

Chakrabarti, A., Onaivi, E. and Chaudhuri, G. (1995). Cloning and sequencing of a

CDNA encoding the mouse brain-type cannabinoid receptor protein. DNA Seq. 5:
385-388.

Chan, A. C., Iwashima, M., Tuer, C. W. and Weiss, A. (1992). Zap-70: a 70 kD protein-
tyrosine kinase that associates with the TCR C Chain. Cell 71: 649-662.

Chatton, B., Bocco, J., Goetz, J., Lutz, Y. and Kedinger, C. (1994). Jun and Fos
heterodimerize with ATFa, a member of the ATP/CREB family and modulate its
transcriptional activity. Oncogene 9: 375-385.

Chawla, S., Hardingham, G. E., Quinn, D. R. and Bading, H. (1998). CBP: a signal-
regulated transcriptional coactivator controlled by nuclear calcium and CaM
Kinase IV. Science 281: 1505-1509.

Chen, D. and Rothenberg, E. (1993). Molecular basis for developmental Changes in
interleukin-2 gene inducibility. Mol. Cell. Biol. 13: 228-237.

Chen, Z., Hagler, J., Palombella, V. J., Melandri, F., Scherer, D., Ballard, D. and
Maniatis, T. (1995). Signal-induced site-specific phosphorylation targets IKBoc to
the ubiqitin-proteosome pathway. Genes Dev. 9: 1586-1597.

Chijiwa, T., Mishima, A., Hagiwara, M., Sano, M., Hayashi, K., Inoue, T., Naito, K.,
Toshioka, T. and Hidaka, H. (1990). Inhibition of forskolin-induced neurite
outgrowth and protein phosphorylation by a newly synthesized selective inhibitor
of cyclic AMP-dependent protein kinase, N -[2-(p-Bromocinnamylamino)ethyl]-5-
isoquinolinesulfonamide (H-89), of PC12D pheochromocytoma cells. J. Biol.
Chem. 265: 5267-5272.

Chomczynski, P. and Mackey, K. (1995). Substitution of chloroform with

bromochloroproane in the single-step method of RNA isoloation. Anal. Biochem.
225: 163-164.

Chrivia, J. C., Kwok, R. P. S., Lamb, N., Hagiwara, M., Montminy, M. R. and Goodman,
R. H. (1993). Phosphorylated CREB binds specifically to the nuclear protein
CBP. Nature 365: 855-859.

Clapham, D. E. and Neer, E. J. (1993). New roles for G-protein B'y-dimers in
transmembrane signaling. Nature 365: 403-406.

Coffey, R. G., Yamamoto, Y., Snella, E. and Pross, S. (1996). Tetrahydrocannabinol

inhibition of macrophage nitric oxide production. Biochem. Pharmacol. 52: 743-
751.

Compton, D. R., Fold, L. H., Ward, S. J., Balster, R. L. and Martin, B. R. (1992).
Arninoalkylindole analogs: cannabimimetic activity of a Class of compounds
structurally distinct from delta-9-tetrahydrocannabinol. J. Pharmacol. Exp. Ther.
263: 1118-1126.

146

Condie, R. C., Herring, A., Koh, W. S., Lee, M. and Kaminski, N. E. (1996).
Cannabinoid inhibition of adenylate cyclase-mediated signal transduction and IL-
2 expression in the murine T-Cell line, EL4.IL-2. J. Biol. Chem. 271: 13175-
13183.

Coso, O. A., Chiariello, M., Yu, J. C., Teramoto, H., Crespo, P., Xu, N., Miki, T. and
Gutkind, J. S. (1995). The small GTP-binding proteins Racl and Cdc42 regulate
the activity of the JNK/SAPK signaling pathway. Cell 81: 1137-1146.

de Groot, R. P., den Hertog, J., Vandenheede, J. R., Goris, J. and Sassone-Corsi, P.
(1993). Multiple and cooperative phosphorylation events regulate the CREM
activator function. EMBO J. 12: 3903-3911.

deGrazia, U., Felli, M. P., Vacca, A., Farina, A., Maroder, M., Cappabianca, L., Meco,
D., Farina, M., Screpanti, I., Frati, L. and Gulino, A. (1994). Positive and negative
regulation of the composite octamer motif of the interleukin 2 enhancer by AP-l,
Oct-2, and retinoic acid receptor. J. Exp. Med. 180: 1485-1497.

Derocq, J. M., Segui, M., Marchand, J ., Le Fur, G. and Casellas, P. (1995). Cannabinoids

enhance human B-Cell growth at low nanomolar concentrations. FEBS Lett 369:
177-182.

DeWaard, M., Liu, H., Walker, D., Scott, V. E. S., Gurnett, C. A. and Campbell, K. P.
(1997). Direct binding of G-protein fly complex to voltage-dependent calcium
Channels. Nature 385: 446-450.

Dewey, W. L. (1986). Cannabinoid pharmacology. Pharmacol. Rev. 38: 151-178.

Didier, M., Aussel, C., Ferrua, B. and Fehlmann, M. (1987). Regulation of interleukin-2
synthesis by CAMP in human T cells. J. Immunol. 139: 1179-1184.

DiDonato, J. A., Hayakawa, M., Rothwarf, D. M., Zandi, E. and Karin, M. (1997). A
cytokine-responsive IKB kinase that activates the transcription factor NF-KB.
Nature 388: 548-554.

Dixit, V. P., Sharma, V. N. and Lohiya, N. K. (1974). The effects of chronically
administered cannabis extract on the testicular function of mice. Eur. J.
Pharmacol. 26: 111-114.

Downward, J. (1990). Stimulation of p2lras upon T-Cell activation. Nature 364: 719-723.

Dudley, E. C., Petrie, H. T., Shah, L. M., Owen, M. J. and Hayday, A. C. (1994). T cell
receptor [3 Chain gene rearrangement and selection during thymocyte development
in adult mice. Immunity 1: 83-93.

Dunnett, C. W. (1955). A multiple comparison procedure for comparing several
treatments with a control. J. Amer. Stat. Assoc. 50: 1096-1121.

Eder, A. M., Dominguez, L., Franke, T. F. and Ashwell, J. D. (1998). Phosphoinositide 3-

kinase regulation of T cell receptor-mediated interleukin-2 gene expression in
normal T cells. J. Biol. Chem. 273: 28025-28031.

147

Emead, C. R., Patel, Y. 1., Wilson, A., Boulougouris, G., Hall, N. D., Ward, S. G. and
Samson, D. M. (1996). Induction of activator protein (AP)-1 and nuclear factor-
KB by CD28 stimulation involves both phosphatidylinositol 3-kinase and acidic
shingomyelinase signals. J. Immunol. 157: 3290-3297.

Facci, L., Dal Toso, R., Romanello, S., Buriani, A., Skaper, D. and Leon, A. (1995). Mast
cells express a peripheral cannabinoid receptor with differential sensitivity to
anandamide and palnutoylethanolamide. Proc. Natl. Acad. Sci. USA 92: 3376-
3380.

Faubert, B. L. and Kaminski, N. E. (1999). AP-l activity is negatively regulated by
cannabinol through inhibition of its protein components, C-fos and C-jun.
submitted.

Fehling, H. J ., Iritani, B. M., Krotkova, A., Forbush, K. A., Laplace, C., Perlmutter, R. M.
and von Boehmer, H. (1997). Restoration of thymopoiesis in pTa-l- mice by anti-
CD3C antibody treatment or with transgenes encoding activated le or tailless
pTa. Immunity 6: 703-714.

Fehling, H. J., Krotkova, A., Saint Ruf, C. and von Boehmer, H. (1995). Crucial role of
the pre-T-cell receptor a gene in development of ozB but not 78 T cells. Nature 375:
795-798.

Felder, C. C., Briley, E. M., Axelrod, J., Simpson, J. T., Mackie, K. and Devane, W. A.
(1993). Anandamide, an endogenous cannabinmimetic eicosinoid, binds to the
Cloned human cannabinoid receptor and stimulates receptor-mediated signal
transduction. Proc. Natl. Acad. Sci. USA 90: 7656-7660.

Felder, C. C., Joyce, K. E., Briley, E. M., Mansouri, J., Mackie, K., Blond, 0., Lai, Y.,
Ma, A. L. and Mitchell, R. L. (1995). Comparison of the pharmacology and signal
transduction of the human cannabinoid CB1 and CB2 receptors. Mol. Pharmacol.
48: 443-450.

Felder, C. C., Veluz, J. S., Williams, H. L., Briley, E. M. and Matsuda, L. A. (1992).
Cannabinoid agonists stimulate both receptor- and non-receptor-mediated signal
transduction pathway in cells transfected with and expressing cannabinoid
receptor Clones. Mol. Pharmacol. 42: 838-845.

Ferraro, D. P. and Grilly, D. M. (1972). Lack of tolerance to A9-tetrahydrocannabinol in
chimpanzees. Science 179: 490-492.

Feuerstein, N., Firestein, R., Aiyar, N., He, X., Murasko, D. and Cristofalo, V. (1996).
Late induction of CREB/ATF binding and a concomitant increase in CAMP levels

in T and B lymphocytes stimulated via the antigen receptor. J. Immunol. 156:
4582-4593.

Feuerstein, N., Huang, D. and Prystowsky, M. B. (1995). Rapamycin selectively blocks

interleukin-Z-induced proliferating cell nuclear antigen gene expression in T
lymphocyte. J. Biol. Chem. 270: 9454-9458.

148

Fischer-Stenger, K., Dove Pettit, D. A. and Cabral, G. A. (1993). Delta-9-
tetrahydrocannabinol inhibition of tumor necrosis factor-alpha: suppression of
post-translational events. J. Pharmacol. Exp. Ther. 267: 1558-1565.

Flanagan, W. M., Corthesy, B., Bram, R. J. and Crabtree, G. R. (1991). Nuclear
association of a T-cell transcription factor blocked by FK-506 and cyclosporin A.
Nature 352: 803-807.

Forman, M. S. and Pure, E. (1991). T-independent and T-dependent B lymphoblasts:
helper T cells prime for interleukin 2-induced growth and secretion of

immunoglobulins that utilize downstream heavy Chains. J. Exp. Med. 173: 687-
697.

Fraser, J. D., Irving, B. A., Crabtree, G. R. and Weiss, A. (1991). Regulation of
interleukin-2 gene enhancer activity by the T cell accessory molecule CD28.
Science 251: 313-316.

Frodin, M., Peraldi, P. and Van Obberghen, E. (1994). Cyclic AMP activates the

mitogen-activated protein kinase cascade in PC12 cells. J. Biol. Chem. 269: 6207-
6214.

Genot, E. M., Parker, P. J. and Cantrell, D. A. (1995). Analysis of the role of protein
kinase C-oc, -e, and J; in T cell activation. J. Biol. Chem. 270: 9833-9839.

Gerard, C. M., Mollereau, C., Vassart, G. and Parmentier, M. (1990). Nucleotide
sequence of a human cannabinoid receptor CDNA. Nucleic Acids Res. 18: 7142.

Gerard, C. M., Mollereau, C., Vassart, G. and Parmentier, M. (1991). Molecular Cloning

of a human cannabinoid receptor which is also expressed in testis. Biochem. J.
279: 129-134.

Ghosh, P. and Baltimore, D. (1990). Activation in vitro of NF-KB by phosphorylation of
its inhibitor IKB. Nature 344: 678-682.

Ghosh, P., Tan, T.-H., Rice, N. R., Sica, A. and Young, H. A. (1993). The interleukin 2
CD28-responsive complex contains at least three members of the NF-KB family:
C-rel, p50, and p65. Proc. Natl. Acad. Sci. USA 90: 1696-1700.

Ghosh, S., May, M. J. and Kopp, E. B. (1998). NF-KB and Rel Proteins: evolutionary
conserved mediators of immune responses. Annu. Rev. Immunol. 16: 225-260.

Gilliland, G., Perrin, K., Blanchard, K. and Bunn, H. (1990). Analysis of cytokine mRNA
and DNA: detection and quantitation by competitive polymerase Chain reaction.
Proc. Natl. Acad. Sci., USA 87: 2725-2729.

Godfrey, D. 1., Kennedy, J ., Suda, T. and Zlotnik, A. (1993). A developmental pathway
involving four phenotypically and functionally distinct subsets of CD3-CD4-
CD8- triple-negative adult mouse thymocytes defined by CD44 and CD25
expression. J. Immunol. 150: 4244-4252.

149

Godfrey, D. I., Zlotnik, A. and Suda, T. (1992). Phenotypic and functional
Characterization of C-kit expression during intrathymic T cell development. J.
Immunol. 149: 2281-2285.

Goldman, P. S., Tran, V. K. and Goodman, R. H. (1997). The multifunctional role of the
co-activator CBP in transcriptional regulation. Rec. Prog. Horm. Res. 52: 103-
1 l9.

Gomez, J ., Gonzalez, A., Martinez-A, C. and Rebollo, A. (1998). IL-2-induced cellular
events. Crit. Rev. Immunol. 18: 185-220.

Gonzalez, G. A., Menzel, P., Leonard, J ., Fischer, W. H. and Montminy, M. R. (1991).
Characterization of motifs which are critical for activity of the cyclic AMP-
responsive transcription factor CREB. Mol. Cell. Biol. 11: 1306-1312.

Gonzalez, G. A. and Montminy, M. R. (1989). Cyclic AMP stimulates somatostatin gene
transcription by phosphorylation of CREB at Serine 133. Cell 59: 675-680.

Gonzalez, G. A., Yamamoto, K. K., Fischer, W. H., Karr, K., Menzel, P., Briggs 111, W.
H., Vale, W. W. and Montminy, M. R. (1989). A Cluster of phosphorylation sites
on the CAMP-regulated nuclear factor CREB predicted by its sequence. Nature
337: 749-752.

Goodwin, J. S., Bankhurst, A. D. and Messner, R. P. (1977). Suppression of human T-Cell
mitogenesis by prostaglandin. J. Exp. Med. 146: 1719-1734.

Graves, J. D., Campbell, J. S. and Krebs, E. G. (1995). Protein serine/threonine kinases of
the MAPK cascade. Ann. NY Acad. Sci. 766: 320-343.

Grieco, D., Porcellini, A., Avvedimento, E. V. and Gottesman, M. E. (1996).
Requirement for CAMP-PKA pathway activation by M phase-promoting factor in
the transition from mitosis to interphase. Science 271: 1718-1722.

Gringhius, S. I., deLeij, L. F., Coffer, P. J. and Vellenga, E. (1998). Signaling through
CD5 activates a pathway involving phosphatidylinositol 3-kinase, vav, and Racl
in human mature T lymphocytes. Mol. Cell. Biol. 18: 1725-1735.

Gringhuis, S. I., deLeij, L. F., Wayman, G. A., Tokumitsu, H. and Vellenga, E. (1997).
The Ca2+/calmodulin-dependent kinase type IV is involved in the CD5-mediated
signaling pathway in human T lymphocytes. J. Biol. Chem. 272: 31809-31820.

Groettrup, M., Baron, A., Griffiths, G., Palacios, R. and von Boehmer, H. (1992). T cell

receptor (TCR) B Chain homodimers on the surface of immature but not mature or,
y, 5 Chain deficient T cell lines. EMBO J. 11: 2735-2745.

Groettrup, M., Ungewiss, K., Azogui, 0., Palacios, R., Owen, M. J ., Hayday, A. C. and
von Boehmer, H. (1993). A novel disulfide-linked heterodimer on pre-T cells
consists of the T cell receptor B Chain and a 33 kD glycoprotein. Cell 75: 283-294.

Groettrup, M. and von Boehmer, H. (1993). T cell receptor B Chain dimers on immature
thymocytes from normal mice. Eur. J. Immunol. 23: 1393-1396.

150

Habener, J. F. (1990). Cyclic AMP response element binding proteins: a cornucopia of
transcription factors. Mol. Endocrinol. 4: 1087-1094.

Hadden, J. W., Hadden, E. M., Haddox, M. K. and Goldberg, N. D. (1972). Guanosine
3':5'-Cyclic monophosphates: A possible intracellular mediator of mitogenic
influences in lymphocytes. Proc. Natl. Acad. Sci. USA 69: 3024-3027.

Haga, K. and Haga, T. (1992). Activation by G protein beta gamma subunits of agonist-
or light-dependent phosphorylation of muscarinic acetlycholine receptors and
rhodopsin. J. Biol. Chem. 267: 2222-2227.

Hagiwara, M., Alberts, A., Brindle, P., Meinkoth, J ., Feramisco, J ., Deng, T., Karin, M.,
Shenolikar, S. and Montminy, M. (1992). Transcriptional attenuation following
CAMP induction requires PP-l-mediated dephosphorylation of CREB. Cell 70:
105-1 13.

Hagiwara, M., Brindle, P., Harootunian, A., Armstrong, R., Rivier, J ., Vale, W., T sien, R.
and Montminy, M. R. (1993). Coupling of hormonal stimulation and transcription
via the cyclic AMP-responsive factor CREB is rate limited by nuclear entry of
protein kinase A. Mol. Cell. Biol. 13: 4852-4859.

Hai, T.-Y. and Curran, T. (1991). Cross-family dimerization of transcription factors Fos:
Jun and ATF/CREB alters DNA binding specificity. Proc. Natl. Acad. Sci. USA
88: 3720-3724.

Hai, T.-Y., Liu, F., Coukos, W. J. and Green, M. R. (1989). Transcription factor ATF
CDNA clones: an extensive family of leucine zipper proteins able to selectively
form DNA-binding heterodimers. Genes Dev. 3: 2083-2090.

Hansen, S. K., Baeuerle, P. A. and Blasi, F. (1994). Purification, reconstitution, and IKB
association of the c-Rel-p65 (RelA) complex, a strong activator of transcription.
Mol. Cell. Biol. 14: 2593-2603.

Harding, F., McArthur, J. G., Gross, J. A., Raulet, D. H. and Allison, J. P. (1992). CD28-
mediated signaling co-stimulates murine T cells and prevents induction of anergy
in T-Cell Clones. Nature 356: 607-609.

Harris, L. S., Carchman, R. A. and Martin, B. R. (1978). Evidence for the existence of
specific cannabinoid binding sites. Life Sci. 22: 1131-1138.

Hashimoto, K., Sohn, S. J ., Lavin, S. D., Tada, T., Perlmutter, R. M. and Nakayama, T.
(1996). Requirement for p56le tyrosine activation in T cell receptor mediated
thymic selection. J. Exp. Med. 184: 931-943.

Hattori, N., Kawamoto, H. and Katsura, Y. (1996). Isolation of the most immature
population of murine fetal thymocytes that includes progenitors capable of
generating T, B, and myeloid cells. J. Exp. Med. 184: 1901-1908.

Heindel, J. J. and Keith, W. B. (1989). Specific inhibition of FSH-stimulated CAMP

accumulation by A9-tetrahydrocannabinol in cultures of rat Sertoli cells. Toxicol.
Appl. Pharmacol. 101: 124-134.

151

Henkel, T., Machleidt, T., Alkalay, I., Kronke, M., Ben-Neriah, Y. and Baeuerle, P. A.
(1993). Rapid proteolysis of IxBa is necessary for activation of transcription

factor NF-KB. Nature 365: 182-185.

Hepler, J. R. and Gilman, A. G. (1992). G proteins. NBS 17: 383-387.

Herkenham, M., Lynn, A. B., Little, M. D., Johnson, M. R., Melvin, L. S., de Costa, B. R.
and Rice, K. C. (1990). Cannabinoid receptor localization in brain. Proc. Natl.
Acad. Sci. USA 87: 1932-1936.

Higashijima, T., Ferguson, K. M., Stemweis, P. C., Smigel, M. D. and Gilman, A. G.
(1987). Effects of Mg2+ and the beta gamma-subunit complex on the interactions
of guanine nucleotides with G proteins. J. Biol. Chem. 262: 762-766.

Hillard, C. J ., Farber, N. E., Hagen, T. C. and Bloom, A. S. (1984). The effects of A9-
tetrahydrocannabinol on serum tyrotropin levels in the rat. Pharmacol. Biochem.
Behav. 20: 547-550.

Hollister, L. E. (1986). Health aspects of cannabis. Pharmacol. Rev. 38: 1-20.

Hoth, M. and Penner, R. (1992). Depletion of intracellular calcium stores activates a
calcium current in mast cells. Nature 355: 353-356.

Howlett, A. C. (1985). Cannabinoid inhibition of adenylate cyclase. Biochemistry of the
response in neuroblastoma cell membranes. Mol. Pharmacol. 27 : 429-436.

Howlett, A. C. and Fleming, R. M. (1984). Cannabinoid inhibition of adenylate cyclase.

Pharmacology of the response in neuroblastoma cell membranes. Mol.
Pharmacol. 26: 532-538.

Howlett, A. C., Qualy, J. M. and Khachtn'an, L. L. (1986). Involvement of Gi in the

inhibition of adenylate cyclase by cannabimimetic drugs. Mol. Pharmacol. 29:
307-313.

Hsueh, Y.-P. and Lai, M.-Z. (1995). C-Jun N-terminal kinase but not mitogen-activated

protein kinase is sensitive to CAMP inhibition in T lymphocytes. J. Biol. Chem.
270: 18094-18098.

Hsueh, Y.-P., Liang, H.-E., Ng, S.-Y. and Lai, M.-Z. (1997). CD28-Costimulation
activates cyclic AMP-responsive element-binding protein in T lymphocytes. J.
Immunol. 158: 85-93.

Huang, D., Shipman-Appasamy, P. M., Orten, D. J ., Hinrichs, S. H. and Prystowsky, M.
B. (1994). Promoter activity of the proliferating-cell nuclear antigen gene is
associated with inducible CRE-binding proteins in interleukin 2-stimulated T
lymphocytes. Mol. Cell. Biol. 14: 4233-4243.

Hughes, C. C. and Pober, J. S. (1996). Transcriptional regulation of the interleukin-2

gene in normal human peripheral blood T cells. Convergence of costimulatory
signals and differences from transformed T cells. J. Biol. Chem. 271: 5369-5377.

152

Husain, S. and Lamb, M. W. (1984). Possible mechanism for the cellular effects of
marijuana on male reproductive function. In The Cannabinoids: Chemical,

Pharmacologic, and Therapeutic Aspects (ed. W. L. D. S. Agurell, and R. E.
Willette), pp. 453—470. New York: Academic Press.

Hutchcroft, J. and Bierer, B. (1994). Activation-dependent phosphorylation of the T-
lymphocyte surface receptor CD28 and associated proteins. Proc. Natl. Acad. Sci.
USA 91: 3260-3264.

Inglese, J ., Kock, W. J., Caron, M. G. and Lefkowitz, R. J. (1992). Isoprenylation in
regulation of signal transduction by G-protein-coupled receptor kinases. Nature
359: 147-150.

Inoue, J., Kerr, L. D., Kakizuka, A. and Verma, I. M. (1992). IKB‘Y, a 70 kD protein
identical to the C-terminal half of p110 NF—xB-A new member of the IKB family.
Cell 68: 1109-1120.

Ivashkiv, L. B., Liou, H. C., Kara, C. J ., Lamph, W. W., Verma, I. M. and Glimcher, L.
H. (1990). mXBP/CRE-BP2 and C-jun form a complex which binds CAMP, but
not to the 12-O-tetradecanoyl phorbol-l3-acetate response element. Mol. Cell.
Biol. 10: 1609-1621.

Izquierdo, M., Leevers, S. J ., Williams, D. H., Marshall, C. J ., Weiss, A. and Cantrell, D.
(1994). The role of protein kinase C in the regulation of extracellular signal-
regulated kinase by the T cell antigen receptor. Eur. J. Immunol. 24: 2462-2468.

Jacobowitz, 0., Chen, J ., Premont, R. T. and Iyengar, R. (1993). Stimulation of specific

types of Gs-stimulated adenylyl cyclases by phorbol ester treatment. J. Biol.
Chem. 268: 3829-3832.

Jain, J ., McCaffrey, P. G., Miner, S., Kerppola, T. K., Lambert, J. N., Verdine, G. L.,
Curran, T. and Rao, A. (1993). The T-Cell transcription factor NFATp is a
substrate for calcineurin and interacts with Fos and Jun. Nature 365: 352-355.

Jain, J., McCaffrey, P. G., Valge-Archer, V. E. and Rao, A. (1992a). Nuclear factor of
activated T cells contains Fos and Jun. Nature 356: 801-804.

Jain, J ., Valge-Archer, V. E. and Rao, A. (1992b). Analysis of the AP-l sites of the IL-2
promoter. J. Immunol. 148: 1240-1250.

Jelsema, C. L. and Axelrod, J. (1987). Stimulation of phospholipase A2 activity in bovine
rod outer segments by the By subunits of transducin and its inhibition by the a
subunit. Proc. Natl. Acad. Sci. USA 84: 3623-3627.

Jeon, Y. J ., Yang, K.-H., Pulaski, J. T. and Kaminski, N. E. (1996). Attenuation of iNOS

gene expression by A9-THC is mediated through the inhibition of NF-KB/Rel
activation. Mol. Pharmacol. 50: 334-341.

153

Johnson, K. W., Davis, B. H. and Smith, K. A. (1988). CAMP antagonizes interleukin 2-
promoted T-Cell cycle progression at a discrete point in early G1. Proc. Natl.

Acad. Sci. USA 83: 6072-6076.

Johnson, M. R., Melvin, L. S., Althius, T. H., Bindra, J. S., Harbert, C. A., Milne, G. M.
and Weissman, A. (1981). Selective and potent analgetics derived from
cannabinoids. J. Clin. Pharmacol. 21: 27ls-282s.

June, C. H., Bluestone, J. A., Nadler, L. M. and Thompson, C. B. (1994). The B7 and
CD28 receptor families. Immunol. Today 15:321-331.

Kaminski, N. E. (1994). Immunopharmacology and Immunotoxicology. In Target

Oragan Toxicology Series (ed. J. H. Dean, M. I. Luster, A. E. Munson and I.
Kimber), pp. 349-362. New York: Raven.

Kaminski, N. E., Abood, M. E., Kessler, F. K., Martin, B. R. and Schatz, A. R. (1992).
Identification of a functionally relevant cannabinoid receptor on mouse spleen

cells involved in cannabinoid-mediated immune modulation. Mol. Pharmacol. 42:
736-742.

Kaminski, N. E. and Holsapple, M. P. (1987). Inhibition of macrophage accessory cell
function in casein-treated B6C3F1 mice. J. Immunol. 139: 1804-1810.

Kaminski, N. E., Koh, W. S., Lee, M., Yang, K. H. and Kessler, F. K. (1994).
Suppression of the humoral immune response by cannabinoids is partially
mediated through inhibition of adenylate cyclase by a pertussis toxin-sensitive G-
protein coupled mechanism. Biochem. Pharmacol. 48: 1899-1908.

Kammer, G. M. (1988). The adenylate cyclase-CAMP-protein kinase A pathway and
regulation of the immune response. Immunol. Today 9: 222-229.

Kammer, G. M., Boehm, C. A., Rudolf, S. A. and Schultz, L. A. (1988). Mobility of the
human T lymphocyte surface molecules CD3, CD4, CD8; regulation by a CAMP-
dependent pathway. Proc. Natl. Acad. Sci. USA 85: 792-796.

Karin, M. (1995). The regulation of AP-l activity by mitogen-activated protein kinases.
J. Biol. Chem. 270: 16483-16486.

Karpinski, B. A., Morle, G. D., Huggenvii, J., Uhler, M. D. and Leiden, J. M. (1992).
Molecular cloning of human CREB-2: an ATF/CREB transcription factor that can
negatively regulate transcription from the CAMP response element. Proc. Natl.
Acad. Sci. USA. 89: 4820-4824.

Katamura, K., Shintaku, N., Yamauchi, Y., Fukui, T., Ohshima, Y., Mayumi, M. and
Furusho, K. (1995). Prostaglandin E2 at priming of naive CD4+ T cells inhibits
acquisition of ability to produce IFN-g and IL-2, but not IL-4 and IL-5. J.
Immunol. 155: 4604-4612.

Kawakami, Y., Klein, T. W., Newton, C., Djeu, J. Y., Specter, S. and Friedman, H.
(1988). Suppression by delta-9-tetrahydrocannabinol of interleukin 2-induccd
lymphocyte proliferation and lymphokine-activated killer cell activity. Int. J.
Immunopharmacol. 10: 485-488.

154

Kee, B. L., Arias, J. and Montminy, M. R. (1996). Adaptor-mediated recruitment of RNA
polymerase H to a signal-dependent activator. J. Biol. Chem. 271: 2373-2375.

Klein, T. W., Newt6on, C. and Friedman, H. (1998). Cannabinoid receptors and
immunity. Immunol. Today 19: 373-382.

Klein, T. W., Newton, C. A., Widen, R. and Friedman, H. (1985). The effect of delta-9-
tetrahydrocannabinol and ll-hydroxy-delta-9-tetrahydrocannabinol on T-

lymphocyte and B-lymphocyte mitogen responses. J. Immunopharmacol 7: 451-
466.

Kleuss, C., Scherubl, H., Hescheler, J ., Schultz, G. and Wittig, B. (1992). Different beta-
subunits determine G-protein interaction with transmembrane receptors. Nature
358: 424-426.

Kleuss, C., Scherubl, H., Hcscheler, J ., Schultz, G. and Wittig, B. (1993). Selectivity in
signal transduction determined by gamma subunits of heterotrimeric G proteins.
Science 259: 832-834.

Koch, W. J ., Hawes, B. E., Allen, L. F. and Lefkowitz, R. J. (1994). Direct evidence that
Gi-Coupled receptor stimulation of mitogen-activated protein kinase is mediated
by GBy activation of p21ras. Proc. Natl. Acad. Sci. USA 91: 12706-12710.

Koh, W. S., Crawford, R. B., and Kaminski, N. E. (1997). Inhibition of protein kinase A
and cyclic AMP response element (CRE)-specific transcription factor binding by
A9-tetrahydrocannabinol (139-THC). Biochem. Pharmacol. 53: 1477-1484.

Koh, W. S., Lee, M., Yang, K.-H. and Kaminski, N. E. (1996). Expression of functional
glucagon receptors on lymphoid cells. Life Sci. 58: 741-751.

Koh, W. S., Yang, K.-H. and Kaminski, N. E. (1995). Cyclic AMP is an essential factor
in immune responses. Biochem. Biophys. Res. Comm. 206: 703-709.

Koide, M., Kawahara, Y., Nakayama, I., Tsuda, T. and Yokoyama, M. (1993). Cyclic
AMP-elevating agents induce an inducible type of nitric oxide synthase in
cultured vascular smooth muscle cells. J. Biol. Chem. 268: 24959-24966.

Kwok, R. P. S., Lundblad, J. R., Chrivia, J. C., Richards, J. P., Bachinger, H. P., Brennan,
R. G., Roberts, 8. G. E., Green, M. R. and Goodman, R. H. (1994). Nuclear

protein CBP is a coactivator for the transcription factor CREB. Nature 370: 223-
229.

Lahdenpohja, N ., Henttinen, T. and Hurrne, M. (1996). Activation of the protein kinase A

increases the DNA-binding and transcriptional activity of c-Rel in T cells. Scand.
J. Immunol. 43: 640-645.

Lai, J .-H., Horvath, G., Subleski, J ., Bruder, J ., Ghosh, P. and Tan, T.-H. (1995). RelA is

a potent transcriptional activator of the CD28 response element within the
interleukin 2 promoter. Mol. Cell. Biol. 15: 4260-4271.

155

Lalli, E. and Sassone-Corsi, P. (1994). Signal transduction and gene regulation: the
nuclear response to CAMP. J. Biol. Chem. 269: 17359-17362.

Laoide, B. M., Foulkes, N. S., Schlotter, F. and Sassone-Corsi, P. (1993). The functional

versatility of CREM is determined by its modular structure. EMBO J. 12: 1179-
1191.

Laxminarayana, D., Berrada, A. and Kammer, G. M. (1993). Early events of human T
lymphocyte activation are associated with type I protein kinase A activity. J. Clin.
Invest. 92: 2207-2214.

Lerner, A., Jacobson, B. and Miller, R. (1988). Cyclic AMP concentrations modulate
both calcium flux and hydrolysis of phosphatidylinositol phosphates in mouse T
lymphocytes. J. Immunol. 140: 936-940.

Levin, S. D., Anderson, S. J ., Forbush, K. A. and Perlmutter, R. M. (1993). A dominant-

negative transgene defines a role for p56le in thymopoiesis. EMBO J. 12: 1671-
1680.

Lin, J. X., Mietz, J ., Modi, W. S., John, S. and Leonard, W. J. (1996). Cloning of human
Stat5b. Reconstitution of interleukin-Z-induced StatSA and StatSB DNA binding
activity in COS-7 cells. J. Biol. Chem. 271: 19738-19744.

Lin, Y.-C., Brown, K. and Siebenlist, U. (1995). Activation of NF-KB requires proteolysis
of the inhibitor IxB-signal-induced phosphorylation of IKB-(X alone does not
release active NF-KB. Proc. Natl. Acad. Sci. USA 92: 552-556.

Ling, L., Cao, Z. and Goeddel, D. V. (1998). NF-kappaB-inducing kinase activates IKK-
alpha by phosphorylation of Ser—176. Proc. Natl. Acad. Sci. USA 95: 3792-3797.

Little, P. J., Compton, D. R., Johnson, M. R., Melvin, L. S. and Martin, B. R. (1988).
Pharmacology and stereoselectivity of structurally novel cannabinoids in mice. J.
Pharmacol. Exp. Ther. 247: 1046-1051.

Loev, B., Bender, P. E., Dowalo, F., Macko, E. and Fowler, P. J. (1973). Cannabinoids.
Structure-activity studies related to 1,2-dimethylheptyl derivatives. J. Med. Chem.
16: 1200-1206.

Logothetis, D. E., Kurachi, Y., Galper, J ., Neer, E. J. and Clapham, D. E. (1987). The
beta gamma subunits of GTP-binding proteins activate the muscarinic K+ Channel
in heart. Nature 325: 321-326.

Lopez-Cepero, M., Friedman, M., Klein, T. and Friedman, H. (1986).
Tetrahydrocannabinol-induced suppression of macrophage spreading and
phagocytic activity in vitro. J. Leuko. Biol. 39:679-686.

Lopez-Ilasaca, M., Crespo, P., Pellici, P. G., Gutkind, J. S. and Wetzker, R. (1997).

Linkage of G protein-coupled receptors to the MAPK signaling pathway through
PI 3-kinase. Science 275: 394-397.

156

Love, P. E., Shores, E. W., Johnson, M. D., Tremblay, M. L., Lee, E. J., Grinberg, A.,
Huang, S. P., Singer, A. and Westphal, H. (1993). T cell development in mice that
lack the zeta chain of the T cell antigen receptor complex. Science 261: 918-921.

Lu, Y., Granelli-pipemo, A., Bjomdahl, J. M., Phillips, C. A. and Trevillyan, J. M.
(1992). CD28-induced T cell activation. Evidence for a protein-tyrosine kinase
signal transduction pathway. J. Immunol. 149: 24-29.

Mackie, K. and Hille, B. (1992). Cannabinoids inhibit N-type calcium channels in
neuroblastoma-glioma cells. Proc. Natl. Acad. Sci. USA 89: 3825-3829.

Madsen, P. and Celis, J. E. (1985). S-phase patterns of cyclin (PCNA) antigen staining
resemble topographical patternsof DNA synthesis. FEBS Lett. 193: 5-11.

Malinin, N. L., Boldin, M. P., Kovalenko, A. V. and Wallach, D. (1997). MAP3K-relatcd

kinase involved in NF-kappaB induction by TNF, CD95, and IL-1. Nature 385:
540-544.

Malissen, M., Gillet, A., Rocha, B., Trucy, J., Vivier, E., Boyer, C., Kontgen, F., Brun,
N., Mazza, G., Spanopoulou, E., Guy-Grand, D. and Malissen, B. (1993). T cell

development in mice lacking the CD3-UV gene. EMBO J. 12: 4347-4355.

Mallick, C. A., Dudley, E. C., Viney, J. L., Owen, M. J. and Hayday, A. C. (1993).
Rearrangement and diversity of T cell receptor B Chain genes in thymocytes: a
critical role for the B Chain in development. Cell 73: 513-519.

Maraguchi, A., Miyazaki, K. and Fauci, A. S. (1984). Inhibition of human B cell
activation by diterpine forskolin: Interference with B cell growth factor-induced
G1 to S transition of the B cell cycle. J. Immunol. 133: 1283-1287.

Marks, B. H. (1973). A9-tetrahydrocannabinol and leuteinizing hormone secretion. Prog.
Brain Res. 39: 331-338.

Matsuda, L. A., Lolait, S. J ., Brownstein, M. J ., Young, A. C. and Bonner, T. I. (1990).
Structure of a cannabinoid receptor and functional expression of the Cloned
CDNA. Nature 346: 561-564.

May, M. J. and Ghosh, S. (1998). Signal transduction through NF-KB. Immunol. Today
19: 80-88.

McGuire, K. L. and Iacobelli, M. (1997). Involvement of Rel, Fos, and Jun proteins in
binding activity to the IL-2 promoter CD28 response element/AP-l sequence in
human T cells. J. Immunol. 159: 1319-1327.

McKeithan, T. W. (1995). Kinetic proofreading in T-Cell receptor signal transduction.
Proc. Natl. Acad. Sci. USA 92: 5042-5046.

Means, A. R., Ribar, T. J., Kane, C. D., Hook, S. S. and Anderson, K. A. (1997).

Regulation and properties of the rat Ca2+/Calmodulin-dependent protein kinase
IV gene and its protein production. Rec. Prog. Horm. Res. 52: 389-407.

157

Mechoularn, R. (1970). Marihuana Chemistry. Science 168: 1159-1160.

Meinkoth, J. L., Alberts, A. S., Went, W., Fantozzi, D., Taylor, S. S., Hagiwara, M.,
Montminy, M. and Feramisco, J. R. (1993). Signal transduction through the
CAMP-dependent protein kinase. Mol. Cell. Biochem. 127/128: 179-186.

Mercurio, F., Zhu, H. and Murray, B. W. (1997). IKK-1 and IKK-2: cytokine-activated
IkappaB kinases essential for NF-kappaB activation. Science 278: 860-866.

Merida, I., Williamson, P., Kuziel, W. A., Green, W. A. and Gaulton, G. N. (1993). The
serine-rich cytoplasmic domain of the IL-2RB Chain is essential for IL-2-
dependent tyrosine protein kinase and P13 kinase. J. Biol. Chem. 268: 6765-6779.

Minden, A., Lin, A., Claret, F. X., Abo, A. and Karin, M. (1995). Selective activation of
the JN K signaling cascade and C-Jun transcriptional activity by the small GTPases
Rac and Cdc42Hs. Cell 81: 1147-1157.

Miyamoto, S. and Verma, I. M. (1995). Rel/NF-KB/IKB story. Adv. Cancer Res. 66: 255-
292.

Miyazaki, T., Kawahara, A., Fujui, H., Nakawaga, Y., Minai, Y., Liu, Z. J., Oishi, I.,
Silvennoineu, W., Witthuhn, B. A., Ihle, J. A. and Taniguchi, T. (1994).
Functional activation of JAKl and JAK3 by selective association with IL-2
receptor subunits. Science 266: 1045-1047.

Molina, C. A., Foulkes, N. S., Lalli, E. and Sassone-Corsi, P. (1993). Inducibility and
negative autoregulation of CREM: an alternative promoter directs the expression
of ICER, an early response repressor. Cell 75: 875-886.

Molina, T. J ., Kishihara, K., Siderovski, D. P., van Ewijk, W., Narendran, A., Timms, E.,
Wakeham, A., Paige, C. J ., Hartmann, K. U., Veillette, A., Davidson, D. and Mak,
T. M. (1992). Profound block in thymocyte development in mice lacking p56lck.
Nature 357: 161-164.

Mons, N., Harry, A., Dubourg, P., Premont, R. T., Iyengar, R. and Cooper, D. (1995).
Immunohistochemical localization of adenylyl cyclase in rat brain indicates a

highly selective concentration at synapses. Proc. Natl. Acad. Sci. USA 92: 8473-
8477.

Morahan, P. S., Klykken, P. C., Smith, S. H., Harris, L. S. and Munson, A. E. (1979).
Effects of cannabinoids on host resistance to listeria monocytogenes and herpes
simplex virus. Infec. Immun. 23: 670-674.

Mosmann, T. R., Cherwinski, H., Bond, M. W., Giedlin, M. A. and Coffman, R. L.
(1986). Two types of murine helper T cell clone: 1. Definition according to

profiles of lymphokine activities and secreted proteins. J. Immunol. 136: 2348-
2357.

Mullet, D., Fertel, R. H., Kniss, D. and Cox, G. W. (1997). An increase in intracellualr

CAMP modulates nitric oxide production in IFN-y treated macrophages. J.
Immunol. 158: 897-904.

158

Munro, S., Thomas, K. L. and Abu-Shaar, M. (1993). Molecular Characterization of
peripheral receptor for cannabinoids. Nature 365: 61-65.

Munson, A. E. and Fehr, K. O. (1983). Immunological effects of cannabis. In adverse
health and behavioral consequences of cannabis use. In Addiction Research

Foundation (ed. K. O. F. a. H. Kalant), pp. 257-353. Toronto: Working papers for
the ARS-WHO Scientific Meetings.

Muroi, M. and Suzuk, T. (1993). Role of protein kinase A in LPS-induced activation of

NF-KB proteins of a mouse macrophage-like cell line, J774. Cellular Signalling 5:
289-298.

Nakamura, Y., Russell, S. M., Mess, S. A., Friedman, M., Erdos, M., Francois, C.,
Jacques, Y., Adelstein, S. and Leonard, W. J. (1994). Heterodimerization of the
IL-2 receptor beta- and gamma-Chain cytoplasmic domains is required for
signaling. Nature 369: 330-333.

Nakanishi, K., Malek, T. R., Smith, K. A., Hamaoka, T., Shevach, E. M. and Paul, W. E.
(1984). Both interleukin-2 and a second T cell-derived factor in IL-4 supernatant
have activity as differentiation factors in IgM synthesis. J. Exp. Med. 160: 1605-
1621.

Nakano, H., Shindo, M., Sakon, S., Nishinaka, S., Mihara, M., Yagita, H. and Okumura,
K. (1998). Differential regulation of IkappaB kinase alpha and beta by two
upstream kinases, NF—kappaB-inducing kinase and mitogen-activated protein
kinase/ERK kinase kinase-1.Proc. Natl. Acad. Sci. USA 95: 3537-3542.

Negishi, I., Motoyama, N., Nakayama, K., Senju, S., Hatakeyarna, S., Zhang, Q., Chan,
A. C. and Loh, D. Y. (1995). Essential role for ZAP-70 in both positive and
negative selection of thymocytes. Nature 376: 435-438.

Nelson, B. H., Lord, J. D. and Greenberg, P. D. (1994). Cytoplasmic domains of the
interleukin-2 receptor beta and gamma Chains mediate the signal for T-Cell
proliferation. Nature 369: 333-336.

Nelson, B. H., Lord, J. D. and Greenberg, P. D. (1996). A membrane-proximal region of
the interleukin-2 receptor 7 Chain sufficient for J ak kinase activation and induction
of proliferation in T cells. Mol. Cell. Biol. 16: 309-317.

Nolan, G. P., Fujita, T., Bhatia, K., Huppi, C., Liou, H. C., Scott, M. L. and Baltimore, D.
(1993). The bCl-3 proto-oncogene encodes a nuclear IKB-like molecule that
preferentially interacts with NF-KB p50 and p52 in a phosphorylation-dependent
manner. Mol. Cell. Biol. 13: 3557-3566.

Nolan, G. P. (1994). NF-AT-AP-l and Rel-bZIP: hybrid vigor and binding under the
influence. Cell 77: 795-798.

Nossal, G. J. V. (1994). Negative selection of lymphocytes. Cell 76: 229-239.

159

Novak, T. J., Chen, D. and Rothenberg, E. V. (1990). Interleukin-1 synergy with
phosphoinositide pathway agonists for induction of Interleukin-2 gene expression:
molecular basis of costimulation. Mol. Cell. Biol. 10: 6325-6334.

Nunes, J., Collette, Y., Truneh, A., Olive, D. and Cantrell, D. A. (1994). The role of
p21ras in CD28 signal transduction: triggering of CD28 with antibodies, but not
the ligand B7-1, activates p21ras. J. Exp. Med. 180: 1067-1076.

Nunes, J ., Truneh, A., Olive, D. and Cantrell, D. A. (1996). Signal transduction by CD28
costimulatory receptor on T cells. B7-1 and B7-2 regulation of tyrosine kinase
adaptor molecules. J. Biol. Chem. 271: 1591-1598.

O'Shea, C. C., Crompton, T., Rosewell, I. R., Hayday, A. C. and Owen, M. J. (1996). Raf
regulates positive selection. Eur. J. Immunol. 26: 2350-2355.

Ohno, H., Aoe, T., Taki, S., Kitamura, D., Ishida, Y., Rajewsky, K. and Saito, T. (1993).
Developmental and functional impairment of T cells in mice lacking CD3; Chains.
EMBO J. 12: 4357-4366.

Ohtsuka, T., Kaziro, Y. and Satoh, T. (1996). Analysis of the T-cell activation signaling
pathway mediated by tyrosine kinases, protein kinase C, and Ras protein, which is
modulated by intracellular cyclic AMP. Biochim. et Biophys. Acta 1310: 223-232.

Pages, F., Ragueneau, M., Rottapel, R., Truneh, A., Nunes, J ., Irnbert, J. and Olive, D.
(1994). Binding of phosphatidylinositol-3-OH kinase to CD28 is required for T-
cell signaling. Nature 369: 327-329.

Papavassiliou, A. (1994). The CREB/ATF Family of Transcrition Factors: Modulation
by Reversible Phosphorylation. Anticancer Res. 14: 1801-1806.

Pearse, M., Wu, L., Egerton, M., Wilson, A., Shortman, K. and Scollay, R. (1989). A
murine early thymocyte developmental sequence is marked by transient

expression of the interleukin 2 receptor. Proc. Natl. Acad. Sci. USA 86: 1614-
1618.

Pertwee, R. G. (1988). The central neuropharmacology of psychotropic cannabinoids.
Pharmacol. Ther. 36: 189-261.

Petrie, H. T., Livak, F., Burtrum, D. and Maze], S. (1995). T cell receptor gene
recombination patterns and mechanisms: cell death, rescue, and T cell production.
J. Exp. Med. 182: 121-127.

Plaskin, D., Baeuerle, P. A. and Eisenbach, L. (1993). KBFl (p50 NF-KB homodimer)
acta as a repressor of H-2K(b) gene expression in metastatic tumor cells. J. Exp.
Med. 177: 1651-1662.

Pross, S., Newton, G, Klein, T. and Friedman, H. (1987). Age-associated differences in

cannabinoid-induced suppression of murine spleen, lymph node and thymus cell
blastogenic responses. Immunopharmacol. 14: 159-168.

160

Pross, S. H., Klein, T. W., Newton, C., Smith, J., Widen, R. and Friedman, H. (1990).
Age-related suppression of murine lymphoid cell blastogenesis by marijuana
components. Dev. Comp. Immunol. 14: 131-137.

Punt, J. A., Kubo, R. T., Saito, T., Finlel, T. H., Kathiresan, S., Blank, K. J. and
Hashimoto, Y. (1991). Surface expression of a T cell receptor B (TCR-B) Chain in

the absence of TCR-a, —8, and -7 proteins. J. Exp. Med. 174: 775-783.

Rabinowitz, J. D., Beeson, C., Lyons, D. S., Davis, M. M. and McConnell, H. M. (1996).
Kinetic discrimination in T-cell activation. Proc. Natl. Acad. Sci. USA 93: 1401-
1405.

Raulet, D. H. (1985). Expression and function of interleukin-2 receptors on imature
thymocytes. Nature 314: 101-103.

Ray, A. and Prefontaine, K. E. (1994). Physical association and functional antagonism
between the p65 subunit of transcription factor NF-KB and the glucocorticoid
receptor. Proc. Natl. Acad. Sci. U.S.A 91: 752-756.

Rayter, S., Woodrow, M., Lucas, S. C., Cantrell, D. and Downward, J. (1992). p21ras

mediates control of IL-2 gene promoter function in T cell activation. EMBO J. 11:
4549-4556.

Razdan, R. K. (1986). Structure-activity relationships in cannabinoids. Pharmacol. Rev.
38: 75-149.

Regnier, C. H., Song, H. Y., Gao, X., Goeddel, D. V., Cao, Z. and Rothe, M. (1997).
Identification and characterization of an IKB kinase. Cell 90: 373-383.

Reichman, M., Nen, W., Hokin, L. E. (1988). A9-tetrahydrocannabinol increases
arachidonic acid levels in guinea pig cerebral cortex slices. Mol. Pharmacol. 34:
823-828.

Ren, J ., Karpinski, E. and Benishin, C. G. (1996). The actions of prostaglandin E2 on
potassium currents in rat tail artery vascular smooth muscle cells: regulation by
protein kinase A and protein kinase C. J. Pharmacol. Exp. Ther. 277: 394-402.

Rinaldi-Carmona, M., Barth, F., Heaulme, M., Shire, D., Calandra, B., Congy, C.,
Martinez, S., Mauruani, J ., Neliat, G., Caput, D., Ferrara, P., Soubrie, P., Breliere,
J. C. and Le Fur, G. (1994). SR141716A, a potent and selective antagonist of the
brain cannabinoid receptor. F EBS Letters 350: 240-244.

Rinaldi-Carmona, M., Barth, F., Millan, J., Derocq, J.-M., Casellas, P., Congy, C.,
Oustric, D., Sarran, M., Bouaboula, M., Calandra, B., Portier, M., Shire, D.,
Breliere, J .-C. and Le Fur, G. (1998). SR 144528, the first potent and selective
antagonist of the CB2 cannabinoid receptor. J. Pharmacol. Exp. Ther. 284: 644-
650. '

Rodewald, H.-R. and Fehling, H. J. (1998). Molecular and cellular events in early
thymocyte development. Adv. Immunol. 69: 1-112.

161

Rodewald, H.-R., Kretzschmar, K., Takeda, S., Hohl, C. and Dessing, M. (1994).
Identification of pro-thymocytes in murine fetal blood: T lineage commitment can
precede thymus colonization. EMBO J. 13: 4229-4240.

Rowley, J. T. and Rowley, P. T. (1989). Tetrahydrocannabinol inhibits adenylate cyclase
in human leukemia cells. Life Sci. 46: 217-222.

Russell, D. H. (1978). Type I cyclic AMP-dependent protein kinase as a positive effector
of growth. Adv. Cyclic Nucleotide Res. 9: 493-506.

Saint-Ruf, C., Ungewiss, K., Groettrup, M., Bruno, L., Fehling, H. J. and von Boehmer,
H. (1994). Analysis and expression of a Cloned pre-T cell receptor gene. Science
266: 1208-1212.

Sawn, K. A., Alberola-Ila, J., Gross, J. A., Appleby, M. W., Forbush, K. A., Thomas, J.
F. and Perlmutter, R. M. (1995). Involvement of p21ras distinguishes positive and
negative selection in thymocytes. EMBO J. 14: 276-285.

Schatz, A. R., Kessler, F. K. and Kaminski, N. E. (1992). Inhibition of adenylate cyclase
by 139-tetrahydrocannabinol in mouse spleen cells: A potential mechanism for
cannabinoid-mediated immunosuppression. Life Sci. 51: 25-30.

Schatz, A. R., Koh, W. S. and Kaminski, N. E. (1993). A9-tetrahydrocanabinol
selectively inhibits T-cell dependent humoral immune responses through direct
inhibition of accessory T-Cell function. Immunopharmacol. 26: 129-137.

Schatz, A. R., Lee, M., Condie, R. B., Pulaski, J. T. and Kaminski, N. E. (1997).
Cannabinoid receptors CB1 and C82: a Characterization of expression and

adenylate cyclase modulation within the immune system. Toxicol. Appl.
Pharmacol. 142: 278-287.

Scheinman, R. I., Cogswell, P. C., Lofquist, A. K. and Baldwin, A. S. J. (1995a). The role
of transcriptional activation of IxBoz in mediation of immunosuppression by
glucocorticoids. Science 270: 283-286.

Scheinman, R. I., Gualberto, A., Jewell, C. M., Cidlowski, J. A. and Baldwin, A. S. J.
(1995b). Characterization of mechanisms involved in transrepression of NF-KB by
activated glucocorticoid receptors. Mol. Cell. Biol. 15: 943-953.

Scherer, L. J ., Diamond, R. A. and Rothenberg, E. V. (1995). Developmental regulation
of CAMP signaling pathways in thymocyte development. Thymus 23: 231-257.

Scott, J. D. and McCartney, S. (1994). Localization of A-kinase through anchoring
proteins. Mol. Endocrinol. 8: 5-11.

Seasholtz, A., Gamm, D., Ballestero, P., Scarpetta, M. and Uhler, M. (1995). Differential
expression of mRNAs for protein kinase inhibitor isoforms in mouse brain. Proc.
Natl. Acad. Sci. USA 92: 1734-1738.

Sebzda, E., Wallace, V. A., Mayer, J., Yeung, R. S. M., Make, T. W. and Ohashi, P. S.

(1994). Positive and negative thymocyte selection induced by different
concentration of a single peptide. Science 263: 1615-1618.

162

Serfling, E., Barthelmas, R., Pfeuffer, 1., Schenk, B., Zarius, S., Swoboda, R., Mercurio,
F. and Karin, M. (1989). Ubiquitous and lymphocyte-specific factors are involved

in the induction of the mouse interleukin 2 gene in T lymphocytes. EMBO J. 8:
465-473.

Sheng, M., McFadden, G. and Greenberg, M. E. (1990). Membrane depolarization and
calcium induced C-fos transcription via phosphorylation of transcription factor
CREB. Neuron 4: 571-582.

Shinkai, Y., Ma, A., Cheng, H. L. and Alt, F. W. (1995). CD3 epsilon and CD3 zeta
cytoplasmic domains can independently generate signals for T cell development
and function. Immunity 2: 401—411.

Shirakawa, F., Chedid, M., Suttles, J ., Pollok, B. and Mizel, S. (1989). IL-1 and CAMP
induce 1c immunoglobin light-Chain expression via activation of an NF-xB-like
DNA-binding protein. Mol. Cell. Biol. 9: 959-964.

Shirakawa, F. and Mizel, S. (1989). In vitro activation and nuclear translocation of NF-
KB catalyzed by cyclic AMP-dependent protein kinase and protein kinase C. Mol.
Cell. Biol. 9: 2424-2430.

Shire, D., Carillon, C., Kaghad, M., Calandra, B., Rinaldi-Carmona, M., Le Fur, G.,
Caput, D. and Ferrara, P. (1995). An amino-terminal variant of the central

cannabinoid receptor resulting from alternative splicing. J. Biol. Chem. 270:
3726-3731.

Skalhegg, B. S. (1992). Cyclic AMP-dependent protein kinase type I mediates the
inhibitory effects of 3',5'—cyclic adenosine monophosphate on cell replication in
human T lymphocytes. J. Biol. Chem. 267 : 15707-15714.

Skalhegg, B. S., Tasken, K., Hansson, V., Huitfeldt, H. S., Jahnsen, T. and Lea, T.
(1994). Location of CAMP-dependent protein kinase type I with the TCR-CD3
complex. Science 263: 84-86.

Smith, C. G., Besch, N. F., Smith, R. G. and Besch, P. K. (1979). Effect of
tetrahydrocannabinol on the hypothalamiC-pituitary axis in the ovariectomized
rhesus monkey. Fertil. Steril. 31: 335-339.

Smith, J. K., Scotland, G., Beattie, J ., Trayer, I. P. and Houslay, M. D. (1996).
Determination of the structure of the N-terminal splice region of the cyclic AMP-
specific phosphodiesterase RDl (RNPDE4A1) by 1H NMR and identification of

the membrane association domain using chimeric constructs. J. Biol. Chem. 271:
16703-16711.

Smith, J. W., Steiner, A. L., Newberry, W. M. and Parker, C. W. (1971). Cyclic
adenosine 3', 5'-monophosphate in human lymphocytes. Alteration after
phytohemagglutinin. J. Clin. Invest. 50: 432-441.

Smith, K. A. and Cantrell, D. A. (1985). Interleukin-2 regulates its own receptors. Proc.
Natl. Acad. Sci. USA 82: 864-868.

163

Smith, M. S., Yamamoto, Y., Newton, C., Friedman, H. and Klein, T. (1997).
Psychoactive cannabinoids increase mortality and alter acute phase cytokine
responses in mice sublethally infected with Legionella pneumophila. Proc. Soc.
Exp. Biol. Med. 214: 69-75.

Smith, S. H., Harris, L. S., Uwaydah, I. M. and Munson, A. E. (1978). Structure-activity
relationships of natural and synthetic cannabinoids in suppression of humoral and
cell-mediated immunity. J. Pharmacol. Exp. Ther. 207: 165-170.

Smrcka, A. V. and Stemweis, P. C. (1993). Regulation of purified subtypes of
phosphatidylinositol-specific phospholipase C B by G protein a and By subunits. J.
Biol. Chem. 268: 9667-9674.

Snijdewint, F. G. M., Kalinski, P., Wierenga, E. A., Bos, J. D. and Kapsenberg, M. L.
(1993). Prostaglandin E2 differentially modulates cytokine secretion profiles of
human T helper lymphocytes. J. Immunol. 150: 5321-5329.

Specter, S., Lancz, G. and Hazelden, J. (1990). Marijuana and immunity:
tetrahydrocannabinol mediated inhibition of lymphocyte blastogenesis. Int. J.
Immunopharmacol. 12:261-267.

Stadel, J. M., Strulovici, B., Nambi, P., Lavin, T. N., Briggs, M. M., Caron, M. G. and
Lefkowitz, R. J. (1983). Desensitization of the beta-adrenergic receptor of frog
erythrocytes. J. Biol. Chem. 258: 3032-3038.

Stahl, N., Farruggella, T. J., Boulton, T. G., Zhong, Z., Darnell, J. E. and Yankopoulos,
G. D. (1995). Choice of STATa and other substrates specified by modular
tyrosine-based motifs in cytokine receptor. Science 267: 1349-1353.

Stern, J. B. and Smith, K. A. (1986). Interleukin-2 induction of T-cell G1 progression and
C-myb expression. Science 233: 203-206.

Sugiyama, H., Chen, P., Hunter, M. G. and Sitkovsky, M. V. (1997). Perturbation of the
expression of the catalytic subunit of Ca of cyclic AMP-dependent protein kinase
inhibits TCR-triggered secretion of IL-2 by T helper hybridoma cells. J. Immunol.
158: 171-179.

Sun, P. and Maurer, R. A. (1995). An inactivating point mutation demonstrates that
interaction of CAMP response element binding protein (CREB) with the CREB

binding protein is not sufficient for transcriptional activation. J. Biol. Chem. 270:
7041-7044.

Suyang, H., Phillips, R., Douglas, 1. and Ghosh, S. (1996). Role of unphosphorylatcd,

newly synthesized IKBB in persistent activationof NF-KB. Mol. Cell. Biol. 16:
5444-5449.

Swan, K. A., Alberola-Ila, J ., Gross, J. A., Appleby, M. W., Forbush, K. A., Thomas, J.

F. and Perlmutter, R. M. (1995). Involvement of p21ras distinguishes positive and
negative selection in thymocytes. EMBO J. 14: 276-285.

164

Tamai, K. T., Monaco, L., Nantel, F., Zazopoulos, E. and Sassone-Corsi, P. (1997).
Coupling signaling pathways to transcriptional control: nuclear factors responsive
to CAMP. Rec. Prog. Horm. Res. 52: 121-140.

Tamir, A., Granot, Y. and Isakov, N. (1996). Inhibition of T lymphocyte activation by
CAMP is associated with down-regulation of two parallel mitogen-activated
protein kinase pathways, the extracellular signal-related kinase and C-Jun N-
terminal kinase. J. Immunol. 157: 1514-1522.

Taylor, S. S., Buechler, J. A. and Yonemoto, W. (1990). CAMP-dependent protein kinase:
framework for a diverse family of regulatory enzymes. Annu. Rev. Biochem. 59:
97 l- 1005.

Thomas, B. F., Compton, D. R. and Martin, B. R. (1990). Characterization of the
lipophilicity of natural and synthetic analogs of 139-tetrahydrocannabinol and its
relationship to pharmacological potency. J. Pharmacol. Exp. Ther. 255: 624-630.

Thompson, J ., Phillips, R., Erdjument-Bromage, H., Tempst, P. and Ghosh, S. (1995).
IKB-B regulates the persistent response in a biphasic activation of NF-KB. Cell 80:
573-582.

Tourne, S., Nakano, N., Viville, S., Benoist, C. and Mathis, D. (1995). The influence of
invariant Chain on the positive selection of single T cell receptor specificities. Eur.
J. Immunol. 25: 1851-1856.

Trowbridge, I. S., Lesley, J ., Trotter, J. and Hyman, R. (1985). Thymocyte subpopulation
enriched for progenitors with an unrearranged T-Cell receptor B-Chain gene.
Nature 315: 666-669.

Tsuruta, L., Lee, H., Masuda, B., Koyano-Nakagawa, N ., Arai, N., Arai, K. and Yokota,
T. (1995). Cyclic AMP inhibits expression of the IL-2 gene through the nuclear
factor of activated T cells (NF-AT) site, and transfection of NF-AT CDNAs
abrogates the sensitivity of EL-4 cells to cyclic AMP. J. Immunol. 154: 5255-
5264.

Ullman, K. S., Flanagan, W. M., Edwards, C. A. and Crabtree, G. R. (1991). Activation
of early gene expression in T lymphocytes by Oct-l and an inducible protein,
OAP40. Science 254: 558-561.

Ullman, K. S., Northrop, J. P., Admon, A. and Crabtree, G. R. (1993). Jun family
members are controlled by a calcium-regulated, cyclosporin A-sensitive signaling
pathway in activated T lymphocytes. Genes Dev. 7: 188-196.

Vacca, A., Felli, M. P., Farina, A. R., Martinotti, S., Maroder, M., Screpanti, I., Meco, D.,
Petrangeli, B., Frati, L. and Gulino, A. (1992). Glucocorticoid receptor-mediated
suppression of the interleukin 2 gene expression through impairment of the
cooperativity between nuclear factor of activated T cells and AP-l enhancer
elements. J. Exp. Med. 175: 637-646.

165

Vanden Heuvel, J ., Tyson, F. and Bell, D. (1993). Construction of recombinant RNA

templates for use as internal standards in quantitative RT-PCR. BioTechniques 14:
395-398.

Vandenberghe, P., Freeman, G. J ., Nadler, L. M., Fletcher, M. C., Kamoun, M., Turka, L.
A., Ledbetter, J. A., Thompson, C. B. and June, C. H. (1992). Antibody and
B7/BB1-mediated ligation of the CD28 receptor induces tyrosine phosphorylation
in human T cells. J. Exp. Med. 175: 951-960.

 

Verma, I. M., Stevenson, J. K., Schwarz, E. M., Van Antwerp, D. and Miyamoto, S.
(1995). Rel/NF-xB/IKB family: intimate tales of association and dissociation.
Genes Dev. 9: 2723-2735.

Vogel, Z., Barg, J., Levy, R., Saya, D., Heldman, E. and Mechoulam, R. (1993).
Anandamide, a brain endogenous compound, interacts specifically with
cannabinoid receptors and inhibits adenylate cyclase. J. Neurochem. 61: 352-355.

von Boehmer, H. (1994). Positive selection of lymphocytes. Cell 76: 219-228.

Wadzinski, B., Wheat, W., Jaspers, S., Peruski, L., Lickteig, R., Johnson, G. and Klemm,
D. (1993). Nuclear protein phosphatase 2A dephosphorylates protein kinase A-
phosphorylated CREB transcriptional stimulation. Mol. Cell. Biol. 15: 1826-1832.

Wagner, H. and Rollinghoff, M. (1978). T-T-cell interactions during in vitro cytotoxic
allograft responses. I Soluble products from activated Ly1+ T cells triger
autonomously antigen-primed Ly23+ T cells to cell proliferation and cytolytic
activity. J. Exp. Med. 148: 1523-1538.

Wang, C. R., Hashimoto, K., Kubo, S., Yokochi, T., Kubo, M., Suzuki, M., Suzuki, K.,
Tada, T. and Nakayama, T. (1995). T cell receptor-mediated signaling events in
CD4+CD8+ thymocytes undergoing thymic selection: requirement of calcineurin
activation for thymic positive selection but not negative selection. J. Exp. Med.
181: 927-941.

Wang, H. M. and Smith, K. A. (1987). The interleukin-Z-receptor. Functional
consequences of its bimolecular structure. J. Exp. Med. 166: 1055-1069.

Ward, S. G. (1995). Inhibition of CD28-mediated T cell costimulation by the
phosphoinositide 3-kinase inhibitor wortmannin. Eur. J. Immunol. 25: 526-532.

Watson, E., Murphy, J ., Elsohly, H., Elsohly, M. and Turner, C. (1983). Effects of the
administration of coca alkaloids on the primary immune responses of mice:

interaction with A9-tetrahyrdocannabinol and ethanol. Toxicol. Appl. Pharmacol.
71: 1-13.

Watson, J ., Aarden, L. A., Shaw, J. and Paetkau, V. (1979). Molecular and quantitative
analysis of helper T cell replacing factors on the induction of antigen-sensitive B
and T lymphocytes. J. Immunol. 122: 1633-1638.

Wen, W., Meinkoth, J. L., Tsien, R. Y. and Taylor, S. S. (1995). Identification of a signal
for rapid export of proteins from the nucleus. Cell 82: 463-473.

166

Whiteside, S. T., Epinat, J. C., Rice, N. R. and Israel, A. (1997). IKB epsilon, a novel
member of the IKB family, controls RelA and c-Rel NF-KB activity. EMBO J. 16:
1413-1426.

Wilson, A., de Villartay, J. P. and MacDonald, H. R. (1996). T cell receptor 8 gene
rearrangement and T early 0: (TBA) expression in immature otB lineage

thymocytes: implications for otB/yfi lineage commitment. Immunity 4: 37-45.

Wollberg, P., Soderqvist, H. and Nelson, B. (1994). Mitogen activation of human
peipheral T-lymphocytes induces the formation of new cyclic AMP response
element-binding protein nuclear complexes. J. Biol. Chem. 269: 19719-19724.

Woodrow, M., Clipstone, N. A. and Cantrell, D. (1993). p21ras and calcineurin synergize
to regulate the nuclear factor of activate T cells. J. Exp. Med. 178: 1517-1522.

Woronicz, J. D., Gao, X., Cao, Z., Rothe, M. and Goeddel, D. V. (1997). IKB kinase-B:
NF-KB activation and complex formation with IKB kinase-or and NIK. Science
278: 866-869.

Yamamoto, K. K., Gonzalez, G. A., Briggs III, W. H. and Montminy, M. R. (1989).
Phosphorylation-induced binding and transcriptional efficiency of nuclear factor
CREB. Nature 334: 494—498.

Yamaoka, S., Courtois, G., Bessia, C., T., W. S., Weil, R., Agou, F., Kirk, H. E., Kay, R.
J. and Israel, A. (1998). Complementation cloning of NEMO, a component of the
IkappaB kinase complex essential for NF-kappaB activation. Cell 93: 1231-1240.

Yamazaki. (1997 ). Protein kinase A and protein kinase C synergistically activate the Raf-
1 kinase/Mitogen-activated protein kinase cascade in neonatal rat cardiomyocytes.
J. Mol. Cell. Cardiol. 29: 2491-2501.

Yamazaki, T., Arase, H., Ono, S., Ohno, H., Watanabe, H. and Saito, T. (1997). A shift
from negative to positive selection of autoreactive T cells by the reduced level of
TCR signal in TCR-transgenic CD3z-deficient mice. J. Immunol. 158: 1634-1640.

Yea, S. S., Yang, K-H. and Kaminski, N. E. (1999). Transcriptional repression of the
interleukin-2 gene by cannabinol in the murine T-Cell line, EL4, is mediated
through down-regulation of NF-AT and AP—l. submitted.

Yebra, M., Klein, T. W. and Friedman, H. (1992). A9-tetrahydrocannabinol suppresses
concanavalin A induced increase in cytoplasmic free calcium in mouse
thymocytes. Life Sci. 51: 151-160.

Yoshimasa, T., Silbey, D., Bouvier, M., Lefltowitz, R. and Caron, M. (1987). Cross-talk
between cellular signaling of pathways suggested by phorbol-ester-induced
adenylate cyclase phosphorylation. Nature 327: 67-70.

Yoshimura, M. and Cooper, D. M. F. (1993). Type-specific stimulation of adenylyl
cyclase by protein kinase C. J. Biol. Chem. 268: 4604-4607.

167

Zandi, E., Rothward, D. M., Delhase, M., Hayakawa, M. and Karin, M. (1997). The IKB
kinase complex (IKK) contains two kinase subunits, IKKot and IKKB, necessary
for IKB phosphorylation and NF-KB activation. Cell 91: 243-252.

Zheng, Z. M. and Specter, S. (1994). Suppression by delta-9-tetrahydrocannabinol of
lipopolysaccharide-induced and intrinsic tyrosine phosphorylation and protein

expression in mouse peritoneal macrophages. Biochem. Pharmacol. 47: 2243—
2252.

Zheng, Z. M. and Specter, S. (1996a). Delta-9-tetrahydrocannabinol: an inhibitor of

STATl alpha protein tyrosine phosphorylation. Biochem. Pharmacol. 51: 967-
973.

Zheng, Z. M., Specter, S. and Friedman, H. (1992). Inhibition by delta-9-
tetrahydrocannabinol of tumor necrosis factor alpha production by mouse and
human macrophages. Int. J. Immunopharmacol. 14: 1445-1452.

Zheng, Z. M. and Specter, S. C. (1996b). Delta-9-tetrahydrocannabinol suppresses tumor
necrosis factor alpha maturation and secretion but not its transcription in mouse
macrophages. Int. J. Immunopharmacol 18: 53-68.

Zhong, H., SuYang, H., Erdjument-Bromage, H., Tempst, P. and Ghosh, S. (1997). The
transcriptional activity of NF-KB is regulated by the IKB-associated PKAC subunit
through a cyclic AMP-independent mechanism. Cell 89: 413-424.

Zhong, H., Voll, R. E. and Ghosh, S. (1998). Phosphorylation of NF-KB p65 by PKA
stimulates transcriptional activity by promoting a novel bivalent interaction with
the coactivator CBP/p300. Molecular Cell 1: 661-671.

Zijlstra, M., Bix, M., Simister, N. E., Loring, J. M., Raulet, D. H. and Jaenisch, R. (1990).

B2-microglobulin deficient mice lack CD4—CD8+ cytolytic T cells. Nature 344:
742-746.

Zubler, R. H., Lowenthal, J. W., Erard, F., Hashimoto, N., Devos, R. and MacDonald, H.

R. (1984). Activated B cells express receptors for, and proliferate in response to,
pure interleukin 2. J. Exp. Med. 160: 1170-1183.

168

MICHIGAN smTE UNIV. LIBRARIES
11111111111111111111111llllHlllWllWlllllllm111111
31293018341796