L)

(‘7
<3
’3

This is to certify that the

thesis entitled

Determination of the Developmental Profiles of
Lysosomal Enzyme Activities in Normal Goats and
Cloning and Sequencing the Bovine Beta-Mannosidase
Gene Promoter

presented by

MEI‘ZHU

has been accepted towards fulfillment
of the requirements for

 

 

M. S . degree in PATHOLOGY

 

(/1254 \Jflgvfifévt (‘6 [
Wauiflcam; [

Major professor

Date 8/10/1999

 

0-7639 MS U is an Affirmative Action/Equal Opportunity Institution

 

 

DETERMINATION OF THE DEVELOPMENTAL PROFILES OF LYSOSOMAL
ENZYME ACTIVITIES IN NORMAL GOATS AND CLONING AND SEQUENCING
THE BOVINE B-MANNOSIDASE GENE PROMOTER
By

MEI ZHU

A THESIS
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
MASTER OF SCIENCE
Department of Pathology

1999

ABSTRACT

DETERMINATION OF THE DEVELOPMENTAL PROFILES OF LYSOSOMAL
ENZYME ACTIVITIES IN NORMAL GOATS AND CLONING AND SEQUENCING
THE BOVINE B-MANNOSIDASE GENE PROMOTER

By

MEI ZHU

B—Mannosidosis, an autosomal recessive disorder of glycoprotein metabolism
caused by a deficiency of B-mannosidase, is associated with early prenatal pathological
changes, including cytoplasmic vacuolation in the nervous system and viscera. The first
goal of this study was to investigate the developmental profiles of caprine B-mannosidase
activities in various organs. Four lysosomal enzyme activities were assayed at different
gestation stages. The results showed tissue-specific and enzyme-specific developmental
patterns. In thyroid, B-mannosidase specific activities significantly increased during the
second half of gestation and had the highest activity compared with other tissues,
suggesting that there may be cell-specific transcription factors involved in the regulation
of gene expression. The second goal of this study was to clone and sequence the
promoter region of the bovine B-mannosidase gene. The 5’-end of bovine B-mannosidase
cDNA (203bp) was used as a probe to screen the bovine genomic library by PCR.
Further analysis of this promoter region by computer search showed the common
characteristics of a housekeeping gene promoter: no TATA box, but highly GC rich with
potential Spl binding sites. In order to understand the mechanism of the cell-specific
gene expression of B-mannosidase, further characterization of this promoter region is

needed.

Copyright by
MEI ZHU
1 999

To my parents, Yulan Chen and Xiucheng Zhu, and my sisters, Tong, Li and Ping
for their love, support, and encouragement; also to my dear husband Hongwei and
our lovely daughter Anqi for giving me strength and always be there for me.

iv

ACKNOWLEDGMENTS

I wish I could use words to express my deep feelings of thanks to my mentors, Dr.
Karen Friderici and Dr. Kathryn Lovell, for giving me the opportunity to work and study
in their laboratories, and for their guidance, encouragement, support, and patience during
my studies and through my writing this thesis. I really appreciated the generous financial
support from Dr. Karen Friderici, which was very helpful to me for finishing this study so
soon. Special thanks are extended to my advisory committee, Dr. John F yfe, for his
valuable discussion and suggestion throughout this research work and the time and effort
spent on reviewing this thesis.

I would also like to thank all the past and present members of Margaret J ones’s,
Kathryn Lovell’s and Karen Friderici’s laboratories for their helpful suggestion, valuable
technical advice, encouragement and friendships. They include Dr. Stacey Kraemer,
Becky Lucas, Jeff Leipprandt, Ribka Bedilu and Dr. Kevin Cavanagh. I also want to
thank Dr. Margaret Jones for providing laboratory facilities and her encouragement.

I feel fortunate to have had the support and fi'iendship of so many wonderful people
through my graduate studies in the Department of Pathology at Michigan State
University. I will never forget this special part time of my life.

At the end, I want to express my gratitude to my whole family, my parents, parents-
in-law, my sisters, my husband and my lovely daughter. Without their love, support
encouragement and sacrifice, it would not have been possible for me to pursue my dream

to study here.

L)

 

 

LIST OF CONTENTS

LIST OF TABLES ........................................................................................................... vii
LIST OF FIGURES ......................................................................................................... viii
LIST OF ABBREVIATIONS .......................................................................................... ix
INTRODUCTION ............................................................................................................. 2
CHAPTER 1

DETERMINATION OF THE DEVELOPMENTAL PROFILES OF
LYSOSOMAL ENZYME ACTIVITIES IN NORMAL GOATS

Introduction ................................................................................................................ 1 1

Materials and Methods ................................................................................................ 12

Results ....................................................................................................................... 19

Discussion ................................................................................................................. 28
CHAPTER 2

CLONING AND SEQUENCING THE BOVINE B-MANNOSIDASE GENE
PROMOTER

Introduction ................................................................................................................ 32
Materials and Methods ............................................................................................... 35
Results ........................................................................................................................ 40
Discussion ................................................................................................................. 51
CHAPTER 3
SUMMARY AND PROSPECTS ..................................................................................... 55
BIBLIOGRAPHY ............................................................................................................. 59

vi

LIST OF TABLES

Table Page
1. 4-MU dilutions for standard curve .......................................................................... 16
2. Tissue dilutions for enzyme assay .......................................................................... 17
3. B-Mannosidase specific activities in selected goat tissues ...................................... 20
4. a-Mannosidase specific activities in selected goat tissues ..................................... 21
5. Total B-hexosaminidase specific activities in selected goat tissues ....................... 22
6. Acid phosphatase specific activities in selected goat tissues ................................. 23
7. Oligonucleotides used for screening and sequencing ............................................. 41

vii

Figure

10.
11.
12.
13.

14.

LIST OF FIGURES

Page
The degradative pathway for the oligosaccharide portion of ASN-linked
glycoproteins ......................................................................................................... 4
DNA test for selecting normal tissues ................................................................. 14
The developmental pattern of B-mannosidase specific activities
in selected goat tissues ......................................................................................... 24
The developmental pattern of a-mannosidase specific activities
in selected goat tissues ......................................................................................... 25
The developmental pattern of B-hexosaminidase specific activities
in selected goat tissues ......................................................................................... 26
The developmental pattern of acid phosphatase specific activities
in selected goat tissues ......................................................................................... 27
The first round screening of the bovine genomic library ..................................... 42
The second round screening of the bovine genomic library ............................... 43
The third round screening of the bovine genomic library ................................... 44
Insert analysis of lambda phage clone ................................................................. 46
PUC18 subclone analysis .................................................................................... 47
PCI-neo subclone analysis ................................................................................... 48
The strategy for sequencing the bovine B-mannosidase promoter region ........... 49
Sequence of the 5’ flanking region of the bovine B-mannosidase gene .............. 50

viii

LIST OF ABBREVIATIONS

Abbreviations

4-MU
ASN

AIRS

cDNA
g
GlcNAc
hr

min

ml

ul
PCR
BSA
vol.
Cfu

dg

Full Description

4-methylumbelliferone
asparagine

artificial introduction of
restriction sites

base pair
complementary DNA
gram
N-acetylglucosamine
hour

minutes

milliliter

second

microliter
polymerasse chain reaction
bovine serum albumin
volume

colony forming unit

days of gestation

INTRODUCTION

INTRODUCTION

Lysosomal storage disease

Lysosomes are cytoplasmic organelles that contain many different acid hydrolases
which are responsible for the degradation of a variety of macromolecules, such as
proteins, lipids, complex carbohydrates, and nucleic acids (Berman, 1994). These
hydrolases that function at acidic pH are referred to as lysosomal enzymes. The
deficiency or dysfunction of any one of these enzymes leads to the accumulation of
undigested substrate in the lysosomes, which progressively increases in size and number,
and eventually leads to disruption of cellular function. The concept of “lysosomal
storage diseases” was first introduced by Hers (Hers, 1965) when he described how
genetically determined absence of a-glucosidase could lead to the fatal condition known
as Pompe disease. Later on, this concept led to the discovery of several dozen lysosomal
storage disorders. Most of them are caused by deficiency of a single lysosomal enzyme;
some may be caused by the failure to synthesize, transport and process the lysosomal
enzyme (Durand, 1987).

There are more than fifty lysosomal enzymes and all of them are glycoproteins.
Lysosomal enzymes are synthesized as preproproteins on membrane-bound ribosomes
attached to the rough endoplasmic reticulum. Then they undergo a series of
posttranslational modifications involving protein and carbohydrate recognition signals
that enable them to reach their final destination in lysosomes. Defects in any of these

steps during the whole process of enzyme biosynthesis could lead to deficiency of the

specific enzyme activity, which would lead to the specific accumulation of undigested
substrates in the organelles of cells, called lysosomal storage disease.

Lysosomal enzymes are relatively stable and can be assayed by different methods.
Some studies have shown certain lysosomal enzyme activities that varied with ages and
the developmental periods of the animals (Verity et al., 1968; Shailubhai et al., 1990;
Verdugo, M., and Ray, J ., 1997). Studies also have shown that lysosomal enzyme
activities in normal animals exhibit species variation and tissue-specific expression
(Freysz et al., 1979; Abe et al., 1979; Reiner and Horowitz, 1988; Aronson et al., 1989).
A deficiency of one lysosomal enzyme activity usually causes an increase in several other
lysosomal enzyme activities (Healy et al., 1981; Jones et al., 1981; Pearce et al., 1987;
Jolly et al., 1990; Embury et al., 1985; and Vandevelde et al., 1982).

There are two categories of oligosaccharides: (1) the O-linked oligosaccharides, in
which oligosaccharides are linked O-glycosidically to serine or threonine; (2) the N-
linked oligosaccharides, in which oligosaccharides are linked N-glycosidically to
asparagine(ASN). The oligosaccharides are degraded in the lysosome by (1) a group of
exoglycosidases acting at the non-reducing termini, (2) endo-B-N-acetylglucosaminidase,
and (3) aspartylglucosaminidase. In the lysosome the N-linked oligosaccharides of
glycoproteins are sequentially catabolized from the non-reducing end by at least six
different exoglycosidases. The lysosomal enzymes involved in cleaving steps include

neuraminidase (sialidase), B-galactosidase, B-N-acetylhexosaminidase, a-mannosidase,

B-mannosidase, and a-fucosidase. The stepwise removal of sugars is illustrated in Figure

1.

SA SA
l 4— OL-Neuraminidase —> i

Gal Gal
l4— B—Galactosidase —> 1

GlcNAc GlcNAc
l 4— B—Hexosaminidase —> i

Man OL-Mannosidase Man
\/

Man

14— B-Mannosidase *

GlcNAc

OL-Fucosidase <— Endo—B-N-Acetyl-
Glucosaminidase

v
:tFuc _’ GlcNAc

‘_ Aspartylglucos-
aminidase

Asn Peptide

Figure 1. The degradative pathway for the oligosaccharide portion of Asn-linked
glycoproteins.

Several animal models have been employed in studying human lysosomal storage
diseases, including cat, dog, cow, goat, sheep, and mouse. Animal models play a central
role in unraveling the molecular pathology of specific lysosomal enzyme deficiencies,
and also are especially suited for testing new therapeutic approaches that are either
impractical or difficult to conduct in humans. In the study of caprine B-mannosidosis,
Jones and colleagues (Jones and Kennedy, 1993; Jones et al., 1993) found that early
intervention is effective in altering the phenotype. For example, a caprine B-
mannosidosis genotype, with a much milder disease expression, occurred in a chimera
resulting from prenatal transfusion of hematopoietic stem cells from an unaffected to an
affected sibling. This with other examples (Walkley et al., 1994; Snyder et al., 1995)
suggested that early supply of normal cells to organs, including brain, may be a good way
to supply missing enzyme. Other strategies include enzyme replacement, bone marrow
transplantation, and gene therapy. The discovery of lysosomal storage disease was
accompanied by the suggestion that this class of disorders could be treated by
administration of exogenous enzymes, which might find their way to lysosomes by the
process of endocytosis. One major problem of this treatment is the minute amounts of
enzymes that can be administered. The ideal treatment for inherited metabolic disorders
would be gene therapy. In principle such treatment would entail not only insertion of
DNA containing the normal gene into the defective host genome but also appropriate
management of its expression in host tissues; and this strategy may only be tested first in
animal models.

The molecular approach for studying lysosomal enzymes involved in lysosomal

storage disease has been successful in the past decade, especially with the rapid

development of recombinant DNA technologies. Over two dozen complementary DNAs
encoding lysosomal enzymes have been cloned and characterized, and most of the
promoter regions have also been analyzed. Lysosomal enzyme genes have been thought
to be housekeeping genes. Typical housekeeping gene promoters are characterized by no
TATA box and /or CAAT box, and high GC content with potential Spl binding sites.
Most promoters of lysosomal enzymes have the typical characteristics expected for a
housekeeping gene, and these genes include: human acid phosphatase (Geier et al., 1989),
human a-glucosidase (Hoefsloot et al., 1990), human arylsulfatase A (Kreysing et
al.,1990), human a—N-acetylgalactosaminidase (Wang et al., 1990), canine IDUA
(Menon, 1992), human a-L-iduronidase (Moskovvitz et al., 1992), human or and [5-
subunit of B-hexosaminisidase (Neote et al., 1988; Norflus et al., 1996), mouse a-
galactosidase A (Ohshima et al., 1995), human a-mannosidase (Riise et al., 1997), and
human galactocerebrosidase (Sakai et al., 1998). However, some lysosomal enzyme gene
promoters do contain TATA box and potential Spl binding sites, including genes for
human acid B-glucosidase (Doll et al., 1994), a-subunit of B-hexosaminidase (Proia et
al.1987), cathepsin D (Cavailles et al., 1991,1993), B-subunit of murine B-
hexosaminidase (Yamanaka et al., 1994), and murine a-D-mannosidase (Stinchi et al.,
1998). The gene encoding glucocerebrosidase has a TATA box, no Spl binding sites,
and causes differential expression of a reporter gene in different cell types, similar to the
expression level of endogenous glucocerebrosidase in the same cells (Reiner et al., 1988).
All these indicated that the genes encoded for lysosomal enzymes are differentially

regulated by different mechanisms.

B-Mannosidosis

B-Mannosidosis is an autosomal recessive inherited disorder (Fisher et al., 1986) of
glycoprotein catabolism, which is caused by deficiency of B-mannosidase (EC 3.2.1.25).
This disease was first decribed in Nubian goats (Jones and Dawson, 1981; Healy et al.,
1981; Jones and Laine, 1981) and later on was also found in humans (Cooper et al., 1988;
Wenger et al., 1986; Dorland et al., 1988 Kleijer et al., 1990), and cattle (Jolly, et al.,
1990; Abbitt et al., 1991; and Patterson et al., 1991). The disease in all species is
characterized by decreased B-mannosidase activity, but is phenotypically variable.

Affected goats and cattle have very similar clinical features which include inability
to stand, facial dysmorphism (dome-shaped skulls, small palpebral fissures, depressed
nasal bridge, and elongated, narrow muzzle), intention tremors, carpal flexion
contractures, and pastem joint hyperextension (Jones et al., 1983; and Abbitt et al., 1991).
Affected animals usually die in the neonatal period if intensive care is not provided.
Gross pathological characteristics include ventricular dilatation with a marked paucity of
myelin in cerebral hemispheres, cerebellum, and brain stem. Microscopic examination
reveals ubiquitous cytoplasmic vacuolation and myelin deficiency in the central nervous
system but not in peripheral nerves (Jones et al., 1983; Lovell and Jones, 1983; and
Patterson et a1, 1991). Affected goats and calves are hypothyroid, possibly contributing
to the central nervous system hypomyelination (Boyer et al., 1990; Lovell et al., 1991).
In contrast with the ruminant B-mannosidosis, the human cases have a milder and more
heterogeneous clinical expression. The most severe cases are associated with mental

retardation, developmental delay and dysmorphology, and hearing loss (Wenger et al.,

1986; Kleijer et al.1990; and Cooper et al., 1991). The reason for the difference between
ruminants and humans is not known. However it was found that the accumulated
substrates were different in these two species. In both affected goats and calves the
predominant accumulated substrates are the trisaccharide ManB l -4GlcNAc[31-4GlcNAc
with lesser amounts of the disaccharide ManBl-4GlcNAc (Jones et al., 1981; Jones et al.,
1992; Matsuura et al., 1981; and Cavanagh et al., 1982), whereas in humans the major
accumulated substrates are disaccharide (Van Pelt et al., 1990; Cooper et al., 1988).
B-Mannosidase catalyzes the penultimate step in N-linked oligosaccharide
catabolism (Figure 1), cleaving the single B-linked mannose residue. B-mannosidase
activity has been measured in various tissues and body fluids, such as brain, thyroid,
kidney, liver, spleen, urine, and plasma (Cavanagh et al., 1982; Bernard et al., 1986;
Pearce et al., 1987; Jones etal., 1984 ). In newborn goats, the activity of B-mannosidase
is highest in thyroid, with decreasing activity in the order: kidney, liver, muscle, and
brain (Pearce et al., 1987; Lovell et al., 1994). A regional difference of B-mannosidase
specific activity in the central nervous system has also been observed by Lovell et a1.
(1994): B-mannosidase as well as a-mannosidase, B-hexosamiriidase, a-fucosidase, and
B-glucuronidase all have higher specific activities in white matter than in gray matter in
normal goats, which suggested that a high level of enzyme activities are needed in white
matter, and may relate to turnover of glycoproteins in myelin or axonal membranes. The
purification of B-mannosidase from caprine and bovine kidney (Sopher et al., 1992;
1993) by using monoclonal and polyclonal antibodies permitted successful cloning and

sequencing of bovine and caprine B-mannosidase cDNAs (Chen et al., 1995; Leipprandt

et al., 1996). Human B-mannosidase cDNA has also been characterized in this laboratory
by Alkhayat et al. (1998).
Current research

This research was designed to investigate the developmental pattern of B-
mannosidase activity during gestation in various normal goat tissues, which may provide
baseline information for testing new prenatal therapies in goats, and provide information
related to pathogenesis of lesions. Two other lysosomal enzymes, a-mannosidase (EC
3.2.1.24) and total B-hexosaminidase (EC 3.2.1.52), which are also involved in the
pathway of N-linked glycoprotein catabolism, were examined. Acid phosphatase (EC
3.1.3.2), which is not in this pathway but usually used as a marker, was also studied. In
order to understand the regulatory mechanism of expression of normal B-mannosidase
which may contribute to the cell-specific and developmental enzyme activities, we
further characterized this gene by cloning and sequencing the 5’-flanking region of the
bovine B-mannosidase gene, and then compared it with the promoter regions of other

lysosomal enzymes.

CHAPTER 1

DETERMINATIOIN OF THE DEVELOPMENTAL PROFILES OF
LYSOSOMAL ENZYME ACTIVITIES IN NORMAL GOATS

10

INTRODUCTION

B-Mannosidosis, associated with deficiency of B-mannosidase, is an autosomal
recessive inherited lysosomal storage disease involving N-linked glycoprotein
catabolism. It was first described in Nubian goats (Jones and Dawson, 1981; Healy et al.,
1981; Jones and Laine, 1981), and has also been found in humans (Cooper et al., 1988;
Wenger et al., 1986; Dorland et al., 1988; Kleijer et al.,1990), and cattle (Jolly et al.,
1990; Patterson et al.,1991). The caprine model has been used to study this disease for
approximately 18 years, including investigation of clinical features and pathological

changes (Jones etal., 1983; Lovell et al., 1983; and Lovell et al., 1997), the molecular
level studies (Leipprandt et al., 1996), and prenatal therapy. In order to understand the
pathogenetic mechanisms and provide therapy for this disease, further studies of the
nature of B-mannosidase activity and the mechanism involving regulation of its
expression is needed. The current study was originally designed to determine the
developmental profiles of B-mannosidase specific activities in selected tissues of goats,
which may provide information for the optimal time for therapy. Three other lysosomal
enzymes, OL-mannosidase, total B-hexosaminidase and acid phosphatase, were also

assayed for comparison.

11

MATERIALS AND METHODS

Materials
Most artificial substrates and protease inhibitors were purchased from Sigma

Chemical Company (St. Louis, MO, USA), including 4-methylumbelliferone (4-MU),
free acid (M 1381) as standard curve; 4-methylumbelliferyl-a-D-mannopyranoside (M
3657); 4-methylumbelliferyl-B-D-mannopyranoside (M 0905); 4-methylumbelliferyl
phosphate (M 8883); and Leupeptin and Pepstatin A. 4-Methylumbelliferyl-2-acetamido-
2-deoxy-B-D-glucopyranoside (# 474502) was purchased from Calbiochem (La J olla,
CA). Ampli Taq® DNA polymerase was purchased from Perkin Elmer (Branchburg,
New Jersey, USA).
DNA test for selecting normal tissues

Animals used in this study included 18 normal goats and 1 B-mannosidosis carrier
goat, which were identified by a PCR based assay for artificial introduction of restriction
sites (AIRS) (Cotton, 1993). This method was developed by creating modified PCR
primers that flank the mutation site. The antisense primer, which elongates from a
position immediately adjacent to the mutation site, had two bases that were mismatched
with the template such that the resulting amplicons from normal genes had Ban I
restriction sites (recognition sequencezGGPyPuCC). The amplicons produced from
mutant genes did not have the site. The sense primer also had two mismatched bases to
introduce a different Ban I site in both the normal and the mutant amplicons, to act as an
internal control for monitoring the completeness of the subsequent restriction cutting. In
this study, most of the animal DNAs were extracted from liver (relatively high yield of

DNA), except two from kidney, using a Puregene Gentra Kit. The DNA preparation was

12

diluted to 1:100, and then 1 pl was used as template for PCR. The total reaction volume

was 20 pl, and the primers used for PCR were MJ179
(5’ACGTCCGGTGCCTGAAATCT 3’) and MJ180 (5’AGCCGGGCTITGTATGGTAC
3’). Following PCR, the amplicons were cut by restriction enzyme Ban I at 37°C for 1
hr, and then analyzed by 4% agarose gel electrophoresis (Figure 2).
Tissue Extraction

Animals selected from goat research herds at MSU ranged from 65 days of
gestation to 3 days of age. After euthanasia tissue samples were stored at —80°C. Tissues
were removed from the freezer individually and weighed. After weighing, the tissue was
minced using a razor blade and suspended in extraction buffer giving a final
concentration of 0.2 g/ml. Extraction buffer (pH 5.5) contained 0.01M citrate, 0.05M
NaCl, lmM MnClz, 1 mM CaClz, 0.02% NaN3, 10% glycerol, with final concentration
0.5mg/l of both leupeptin and pepstatin A (protease inhibitors). Tissues were disrupted
by sonication (Micro Ultrasonic Cell Disrupter, Model 50—Watt) for 15-60 s at setting
output control 40; the sonication time varied between 15-60 s depends on different
tissues: the brain needed a shorter time, while the thyroid needed a longer time. A 10 3
period of sonication was followed by a 20 s cooling time. Sonication was continued until
a homogeneous solution was attained, or a total of 60 3. Samples were kept on ice during
the processing. The tissue solutions were centrifuged for 10 min at maximum speed

(Micro Centrifuge, Model 23 So) at 4°C; and the supematants were removed and stored at

—80°C.

13

MCNCAAF12345678

 

Figure 2. DNA test for normal tissue selection. (4 % agarose
gel). M: Marker V, C: negative control (H20), N: normal animal
control, CA: carrier animal control, AF: affected animal control.
Samples were run in duplicate. Lane 1,2 are from a carrier; lane
3,4 and 7,8 are from two normal animals; lane 5,6 are from an
affected animal.

Substrate Preparation

4-MU substrates were first dissolved in 200-400 ul of dimethyl sulfoxide (DMSO),
heated for 1 min at 50-55°C and then brought to volume in the appropriate buffer in a
volumetric flask. The substrate for B-mannosidase was 2 mM 4-methylumbelliferyl-B-D-
mannopyranoside in 24 mM citrate-51 mM phosphate buffer, pH 5.0, with BSA of final
concentration 0.2 mg/ml. The substrate for oc-mannosidase was 2 mM 4-
methylumbelliferyl-oc-D-mannopyranoside in 31 mM citrate-37 mM phosphate buffer,
pH 4.0. The substrate for acid phosphatase was 2 mM 4-methylumbelliferyl phosphate in
0.1 M sodium acetate buffer, pH 4.8. The substrate for B-hexosaminidase was 4 mM 4-
methylumbelliferyl-2-acetamido-2-deoxyl-B-D-glucopyranoside in 0.1 M citrate buffer,
pH 4.4. All the substrate solutions were stored at —20°C.

Standard Curve
4-MU free acid is stable for 30 days once in solution. The fresh 4-MU free acid
was made monthly and each time the standard curve was checked for consistency. 4-MU

free acid (2 mM) was prepared directly in methanol and stored in a dark bottle at 4°C.
Table 1 shows the serial dilutions. In this study, we used B—>H dilution solution as

standard curve.
Enzyme Assay

In order to make the fluorimeter reading within range of the standard curve, some
samples needed appropriate dilution (Table 2). The dilution buffer contained 0.2 mg/ml
BSA in extraction buffer (pH 5.5). The fluorescence of the liberated 4-MU was

measured by Luminescence Spectrometer (Model LS 50B) using 4-MU method program.

15

Table 1. 4-MU Dilutions for Standard Curve.

 

 

Tube Citrate buffer 4-MU volume Final [4-MU] 4-MU nmol/20pl
(#) (p1) (pl) (mol) dilution solutions
AA 800 200 “stock” 4 x10‘4 8

A 500 500 “AA” 2 x10“4 4

B 800 200 “A” 4 x 10'5 0.8

C 500 500 “B” 2 x 10'5 0.4

D 800 200 “C” 4 x 10‘6 0.08

E 500 500 “D” 2 x 106 0.04

F 800 200 “E” 4 x 10” 0.008

G 500 500 “F” 2 x 10:7 0.004

H 800 200 “G” 4 x 10'8 0.0008

 

4-MU stock concentration is 2 x 10'3 M.

16

Table 2. Tissue Dilutions for Enzyme Assay.

 

 

Tissue B-mannosidase a-mannosidase B-hexosaminidase acid phosphatase
Thyroid 1:20 1:20 1:100 1:100
Kidney 1:5 1:20 1:100 1:50

Spleen 1:5 1:5 1:50 1:50
Epididymis none none 1 :10 1 :20

Testis 1:5 1 :5 1 :50 1:20

White matter* none none 1:5 1:20

Gray matterar none none 1 :5 1:20

Spinal cord none none 1:10 1:50
Plasma none 1:10 none 1:10

 

* - Cerebral hemisphere white matter and gray matter. Tissue extract was diluted in
series in dilution buffer: extraction buffer (pH 5.5) with BSA (0.2 mg/ml).

17

The samples were loaded in a 96-well plate using a multichannel pipetter. Each tissue
extract and standard curve was run in duplicate. For the standard curve, 20 pl of 4-MU
standard dilutions (B—>H) was added to 10 p1 citrate-phosphate buffer (pH 5.0); for the
unknown tissue extracts, 20 pl of the substrate was added to 10 pl of the tissue extracts,
then incubated at 37°C for 5 min for a-mannosidase, B-hexosaminidase, acid
phosphatase, and 30 min for B-mannosidase. Following incubation, 170 pl 0.1M glycine
stop buffer (pH 2 10.8) was added to stop the reaction. Substrate blank and plasma
controls were used during the assay. The substrate blank control was used for the free
fluorescence from the artificial substrate, and the value was subtracted from the
fluorimeter reading of samples when doing the calculation for specific activity. A plasma
control was used for the consistency of the assay system. Plasma samples were prepared
from a normal goat, and stored at —80°C in aliquots. If the plasma values were out of a
specified range (10% of difference), then the enzyme assay was repeated until the plasma
control values were consistent.
Protein Assay

Protein concentrations were determined by using bicinchoninic acid (BCA) and
bovine serum albumin as a standard (Smith et al., 1985). A BCA Protein Assay Kit was
purchased from Pierce company. This method combines the well-known reduction of
Cu+2 to Cu)”] by protein in an alkaline medium (the biuret reaction) with the highly
sensitive and selective colorimetric detection of the cuprous cation (CuH) using a unique
reagent containing bicinchoninic acid. Tissue extracts were run in duplicate without
dilution. The standard curve contains a serial dilution (0,10,25,50,100, 150 pg) of BSA.

0.5 pl tissue extracts were added to 9.5 p1 sterile water, then 2 ml BCA working buffer

18

was added to both standard and unknown samples, and the whole reaction was incubated
at 37°C for 30 min. The sample absorbances were read by Beckman DU 64
spectrophotometer with absorbance at wavelength 562 nm. All samples had to be read in
10 min, otherwise the results would not be consistent due to the color developing.
Statistical analysis

Comparisons between groups were performed using the Mann-Whitney

nonparametric test (Conover, 1971 ).

RESULTS

The prenatal profiles of a-mannosidase, B-mannosidase, total B-hexosaminidase,
and acid phosphatase specific activities (nmol /hr per mg of protein) were determined in
selected normal goat tissues. Our results showed tissue-specific and enzyme-specific
developmental patterns. The data are summarized in Tables 3-6 and the developmental
patterns are shown in Figures 3-6. One of the significant findings in this study is the
dramatic increase of B-mannosidase activity in thyroid during development. In newborn
goats the highest activity for B-mannosidase in thyroid is consistent with previous reports
(Pearce et al., 1987 et al., Lovell et al., 1994). The developmental patterns for different
enzymes are not the same (Figures 3-6). For instance, in thyroid, B-mannosidase activity
significantly (P< 0.005) increased from 85 dg group to 113-120 dg group, and from 113-
120 dg group to newborn, but a significant increase of a-mannosidase activity was
observed only between 85 dg group and 113-120 dg group (P< 0.005 ), there were no

significant changes between 113-120 dg and newborn group. No statistical differences

A v 3 mom: mm 95% own some com 82.? mo own... 2:- .A V E 8.6% £
@295 2.25.8 mo .38.... 2:- .EE H A28 .5 one... Bow-Boo. moo—5» BEE-.83 8.. I Q Z doufimow mo 99% I mo

 

 

33-8.: 33.8... as. .3 3 3....- .ow.m. awn-Rd goons. .393:
:9: .82 8.: .8. a .33
A... 2.." E 3.. a. 3.. a. can E 3... 6 .3 A... 38 52:52
.8933 sew-No: 3.2 .3... a? .83 ”8.83.3 Ame-on: 2.3-8.2.
so: 5...: 5.3 a... z 7... a
5 mm... 6 8.. S S. 5 E... A... :3 5 a: E «on an 2.4...
:2 .2... 3.. .42.. .30-: .3 32... 3. 8.. I Z: .334:
:2: 34.3 .22 so: an:
3 m..." 3 mp... 5 I: 5 a...» 5 2..»- 5 mm... E 3. 2. ma
5... .8... 2.2-8.3
.25
oz 5 cm. oz oz oz 5 m... oz 2. 3.8
28 35% 32.. fish £522.... 52% .055. 29.5 ou<

 

A539:— uo a... .5.— ..éDE-v 385 83353 9592.... «Exxon.—

 

.moommfl. .aoU canoe—om on 85.53. 959on emaEmooané .m 03:.

20

A . 3 Ram: m. moo-a own some 8.. moo—.3 we own... on... A v o. :39? m.
36.5 2.255. .0 .38.... on... .Em. H 9.0.. .5 :3... .5852 mono; 6058.83. .0: I OZ doufimow .0 who“. I mu

 

 

33.3-3.2. 33.3-43.2. 33.. .53... 33..-. ....~. 3.3-2.2. 3.33-3.3. 3.9.1.3.
33: 3. . z 35.. 35.. 3.2 a 332
3. 8.3 3. and" 3. 3...... 3. 2.2 3. 2.2 3. an"... 3. 3.3 £2.52
34.2-2.3... gem-33.3. 3...: .25.. 3.2.. 5...... 3.333.. 3.3-28. 3.8.1.3..
.2 .2. 3...... 3mm. .35 33.3.
3. 333 3. .3..." 3. ...... 3. 3.9. 2.. m2. 3. 3.3" 3. E...- ue 8......
32m .8... 3.42-3.4... 5.8-8.3. gag-8...... 3.2.-XS. .33-. .43..
3....2 39m: :3. :3: 3a....
2. 9.... 3.. 5.." 3. N3... 3.. Sam 3. a...” 3. 3.9. 3. 2.: as m...
3.... m .223. 3.8.3.3..
.383
oz 3. a..." oz oz oz 3. amp-N oz we 3.8
.:8 seam as... mes-p ashes... 52% 32...... 22....- on...

 

A589... be ME .3.— ..EDSIV 3...... 83.2.2. 953% ofiznom

 

3.2.3; :39 auto—om 5 85.3.3. #:9on omwcmmoooazé .v 93:.

21

A . o. 3.2. m. 95% own :03 .o. 8......» (.0 ems... 2.... .A v o. 859.3 m.
v2.2.3 £2.58 mo .38.... 0...... .5m. H 3.0.. .5 :8... 2.80.3.9. 32...; 6058.806 .2. I QZ doufimom .o 3.3.... I wv

 

 

3.23.83. 3.33.32. 33... 6.8... 332......33. 3... .33.... 323.23.. 3.33.32.
....2. .233. 3.8.. 3.33. 8.83. 3.33.
3. 3.3.3 3. «an... 3. 3...... 3. 3.33. 3. 3...: 3. .5. 3. mm: 52.52
3.39338. 3.2.3.3.. 33.. 3...... 3.... 3.83. 3.3.3.953. 33.3-2.2. 3....~-...2....
3...... 33... 33.3. 3.... .. 3......
3. «.8... 3. 3.3. 3. 33. 3. 2.2. 3. 3.3.3 3. 2.2 3. 23. 2. 3.3..
3...... .32. 3.3.33. .. 332-23. 8.8.3.3.... 3.3-2:. 33.3.3...
........3. 3.... 3. 3.2 .. 8.32... 3. . 3.
... 3.9.3 3. 5.3. 3. S... 3. 3.8 3. 3.33.. 3. 3.8 3. 5.. we 3..
8...... .32. 333-... ..
2.8...
oz 3. 3.3.3 oz oz oz 3. 32.. oz we 2......
E... 35.3 as... 2.8... 3.5.2.2.... 52.3 .25. 28...... a»...

 

3.39:. .8 u... .2. .552... 3...... 3.2.52. 953.... coins..—

 

.moommfi. «com. cote—om on mo=.>to< 953.5 93......Eamouoflé .33. .m 93......

22

A V E 3%: fl 3on own some 85 83? ,«o owcfl BE. .A v E 850% mm
36:3 £955 mo Baas: 2F ADE H 9:3 as 538 68058 mo=_m> deem—58% no: I 92 dowfimow mo mag I mu

 

 

£635.85 3.2%-a33 3&2 «.25 3.3683 S.§-n8£ :8 72: 3 a: 3.2:
:8: 5:5 :33 33.: 8.23 :26:
5 33 5 33. 5 Se. 5 was 6 325 5 S: 5 38 ESE:
3.23.3: 353.33 $.30 «.83 3:: .123 3.8533 3.9735 323.33
:3: :33 :n. _ a :83 3.33
5 3.2 5 98.. 5 33 5 28 5 3.8 5 ES 5 2.: we 33.:
3.33: 5 33:2: 3.23.33 3.85.23 :82 . _ m3 3mg; .33
.33 58$ :3: .33. W. 3.:
5 was 5 3.8 5 «.8» 5 we? 5 QE 5 an: 5 3.5 w... m»
3.8» 5.83 33798:
8.03
:z 5 38 :z :z nz 5 33 az we $3
.23 BEA—m SEM— mzmuh «ESE—gam— =ooEm >055— Eoumah. ou<

 

A539:— uc ME .3.— ..ED—zé 355 8:253 958% ofizufim

.358: :30 vogue—om 5 83333.. 953mm omauaanmcam Eo< .e 03:;

23

Specific Activity (nmol/hr mg)
N u # 0| as
O O O O O
l ” W
I
‘ |

.5
O
!

 

 

 

O
1
l
i

50 100 150 200
Days of Gestation (dg)

O

Figure 3. Developmental pattern of B-mannosidase specific activity in selected
goat tissues. Each point represents the mean of values of a group (see corresponding
table for n and SD for each group). There were significant differences (P<0.005) in
thyroid and kidney respectively between 85 dg group and 113-120 dg group, and
between 113-120 dg and newborn group. No significant differences for other tissues
were observed during development.

24

400 "j

a
O
O
__#+44_
1
\

200 f '*

Specific Activity (nmol/hr mg)

i + kidney
; -— thyroid
: + test'u

.‘ + epididym's '

 

!

l

. -- spleen 1
i + spinal cord ;

 

 

50 100 150 200
Days of Gestation (dg)

Figure 4. Developmental pattern of a-mannosidase specific activity in selected
goat tissues. Each point represents the mean of values of a group (see corresponding
table for n and SD for each group). There was significant difference between 85 dg
and 113-120 dg group (P<0.005) in thyroid, and significant difference between 113-
120 dg and newborn group (P<0.05) in testis. No significant differences for other
tissues were observed during development.

25

2500

 

 

 

  
 

 

32mm m 1
E “kidney '
g !--tl|yroid i
Smear * A — v v v Hams ;
E | Ii-u-epididymisi
§1ooo L f~ * f w * E+SP'°°" i
< !-°-spinalcordl
% . 'tbnugfi
£- 500 -+—4 ~ ~ - r

o. _ _-_ __ h __

0 50 100 150 200

Days of Gestation (dg)

Figure 5. Developmental pattern of B-hexosaminidase specific activity in
selected goat tissues. Each point represents the mean of values of a group (see
corresponding table for n and SD for each group). No significant differences
(P<0.05 or 0.01) were observed in all tissues during development.

26

 

1

1

1
A 1500 1 7 - ,
ED
5 1 T.“
g 1 I "a? 1
E 1! 1+thyrold 1
:2; 1000 f - , , 1+testis
fig ‘ 1+ epididymis 1
:5 1+spleen 1
9‘3). v #7 , g 14—spinal cord1
i 500 . 1+brain _'
m 1 —~—«——~——.. _

1

1

0 - ,.__, 4 A T * # I ~ ~ * - A 4
0 50 100 150 200

Days of Gestation (dg)

Figure 6. Developmental pattern of acid phosphatase specific activity in selected
goat tissues. Each point represents the mean of values of a group (see corresponding
table for n and SD for each group). There were significant differences between 85 dg
group and 113-120 dg group (P<0.005) and between113-120 dg and newborn group
(P<0.05) in kidney; and significant difference between 113-120 dg and newborn group
(P<0.05) in spleen. No significant differences for other tissues were observed during
development.

27

were noted for total B-hexosaminidase and acid phosphatase activities during
development in thyroid. In kidney, B-mannosidase activity also showed a significant
change. The enzyme activity first increased to reach a peak around 113-120 days of
gestation, and then decreased by the time of birth. Thus the pattern of prenatal B-
mannosidase activity change is different in kidney and thyroid. For acid phosphatase, the
enzyme activity significantly (P< 0.05) increased from 85 dg to 113-120 dg group. There
were no significant differences between 65 dg and 85 dg groups and between113-120 dg
and newborn groups. There were no statistical differences for a—mannosidase and B-
hexosaminidase activities during development in kidney. All other tissues being
examined did not show significant changes for all four enzyme activities during
development except that in testis, oc-mannosidase activity significantly (P< 0.05)
decreased from 113-120 dg to newborn, and in spleen, acid phosphatase activity
significantly (P< 0.05) increased from 113-120 dg to newborn. In brain all four enzyme

activities were steady and lowest compared to other tissues.

DISCUSSION

This study has determined the specific activities (nmol /h per mg protein) of B-
mannosidase, a-mannosidase, B-hexosamim'dase, and acid phosphatase in a wide range
of tissue types and gestation stages (65 dg - newborn). Our results have demonstrated
that the specific activities of each enzyme in various tissues had different developmental
patterns (Figures 3—6), suggesting tissue-specific and enzyme-specific regulation of

expression of enzyme activity. Variations among tissues have been previously

28

demonstrated (Cook et al., 1984; Pearce et al., 1987; Lovell etal., 1994; Cingle et al.,
1995; Verdugo et al., 1997), but the patterns of developmental expression have not been
compared.

One of the most important findings in this study is the significant (P < 0.005)
increase of B-mannosidase activity in thyroid from 85 dg to newborn (Figure 3)
compared to all other examined tissues. The highest activity in thyroid in newborn goats
was consistent with previous reports (Pearce et al., 1987; Lovell et al., 1994). These
results suggested that high level activity of B-mannosidase may be needed for thyroid
function. Thyroid hormone is synthesized as a prohormone, thyroglobulin, which is a
huge glycoprotein (660 kda) and contains many mannose residues, including ManB l -
4GlcNAc and 0.1-3(6) Man, bond in its N-linked oligosaccharides (Y amamoto et al.,
1981; Burrow et al., 1989). Thyroid hormones are known to be important for the growth
and differentiation of many tissues. For example, during brain development, thyroid
hormones are essential for cell migration, dendrite and axon outgrouth, myelination and
gliogenesis (Porterfield & Hendrich, 1993; Berna] & Nunez, 1995). Boyer et al. (1990)
and Lovell et al. (1991) have reported that in caprine and bovine B-mannosidosis severe
morphological thyroid lesions are accompanied by decreased thyroid hormone
concentration, possibly contributing to the severe paucity of myelin in the central nervous
system (CNS) characteristic of B-mannosidosis. The unique developmental pattern and
the high expression of B-mannosidase in thyroid may be related to the requirement for the
synthesis of thyroid hormone during developmental stages, which is necessary for growth
and differentiation. Although the B-mannosidase gene, presumed to be a housekeeping

gene, exists in all types of tissues, the highest activity and substantial increase during

29

prenatal development was observed only in thyroid. The reasonable explanation would
be the tissue-specific regulation of gene expression.

In the present research, some tissues such as thyroid, kidney, brain and spleen have
enough animals available to study and are well studied, however, for epididymis and
testis we do not have enough tissues to study at this time, therefore they may need further
examination. Another limitation of this study is that we could not get the tissues from
very early gestational stages, especially for thyroid (too little to be extracted). To assay
earlier stages new technique or methods need to be developed.

The current study was initially designed to investigate the prenatal profiles of B-
mannosidase in various goat organs in different gestation stages. However, three other
lysosomal enzymes (a-mannosidase, B-hexosaminidase, and acid phosphatase) were
measured at the same time for comparison. All the results from this study supported one
conclusion: enzyme activities were differentially regulated in different tissues. To

understand the molecular basis of such variations, further studies were undertaken.

30

CHAPTER 2

CLONING AND SEQUENCING THE BOVINE B-MANNOSIDASE
GENE PROMOTER

31

INTRODUCTION

Housekeeping genes encode products required for growth, metabolism, or
replication of all cell types, and therefore are expressed ubiquitously. Lysosomal
enzymes and lysosomal enzyme deficiency can be found in every type of cell except for
the organelle-less mature erythrocyte, so they have been considered to be “housekeeping
gene” enzymes. There are several lysosomal gene families summarized by Neufeld
(1991). Genes in each family presumably originated from the same ancestral gene.
Most housekeeping genes share the common characteristics of the promoter region: lack
a recognizable TATA box but contain multiple GC boxes acting as putative binding sites
for the transcription factor Spl(Dynan, 1986; Blake et al., 1990). Housekeeping genes
usually have multiple initiation sites of transcription (Cavailles et al., 1993).

The developmental patterns of lysosomal enzyme specific activities described
previously (Chapter 1), especially that of B-mannosidase, suggested that tissue-specific
gene expression may be differentially regulated in different cell types. If this is the case,
the promoter for this gene would be expected to have elements that respond to tissue
specific signals. We are most interested in the dramatic changes of B-mannosidase
specific activity in thyroid, and this made our second goal to clone and sequence the B-
mannosidase gene promoter and look for tissue-specific transcription binding sites,
especially for thyroid-specific transcription factors.

To date, three thyroid-specific transcription factors (TTF) have been identified:
'ITF-l, TTF-Z, and Pax-8 (Guazzi et al. 1990; Musti et al., 1987; Civitareale et al., 1989;

Francis-Lang et al., 1992; Plachov et al., 1990; and Poleev et al., 1992). Thyroid

32

transcription factor 1 (TTF -1) was initially identified as a thyroid-specific factor for
thyroglobulin (TG) gene expression (Musti et al., 1987). It is a homeodomain-containing
protein (Guazzi et al., 1990), preferentially recognizing sequences having the 5’-CAAG-
3’ core motif. The homeodomain (HD) is the DNA-binding domain of several
transcription regulators, and HD-containing proteins play important roles in regulating
deve10pmental programs (Scott et al., 1989). Damaute et al.(1994) have reported that
TTF-l is involved in the regulation of thyroid development and differentiation. It was
later also found that TTF-l was important in tissue-specific expression of
thyroperoxidase (TPO) ( Francis-Lang et al., 1992), thyrotropin receptor (TSHR)
(Civitareale et al., 1993; Ohmori et al., 1995), and sodium iodide symporter (N IS) (Endo
et al., 1997) genes, which all expressed specifically in thyroid. Additional studies,
including gene targeting experiments, have shown that expression of TTF-l is essential
for organogenesis of lung, ventral forebrain, and pituitary, as well as thyroid, tissues in
TTF-l knockout experiments (Kimura et al., 1996). Therefore, TTF-l seems to be able
to regulate the expression of ubiquitous as well as tissue-specific genes during
development. Several consensus TTF-l binding sites core sequences from the rat TG,
TPO, and TSHR genes have been identified (F rancis-Lang et al., 1992; Guazzi et al.,
1990; Ohmori et al., 1995). In this study, we were also interested in looking for these
binding motifs in the bovine B-mannosidase promoter region, which may provide some
information for further studies.

Although the activity studies were performed on goat tissues, the bovine promoter
was chosen for this study for several reasons: (1) The phenotypic consequences of B-

mannosidosis are nearly identical in the two ruminant species, suggesting similar

33

expression patterns (Jones et al., 1983; Abbitt et al., 1991). (2) Previous studies in this
laboratory have shown that the caprine and bovine B-mannosidase cDNAs share 96.3 %
homology at the nucleotide level and 95.2 % at the deduced amino acid level (Leipprandt
et al., 1996), and have 86.4 % homology to human B-mannosidase cDNA ( Alkhayat et
a1, 1998). (3) A bovine genomic library is available in the commercial market but no
caprine library is available. In this study we used the 5’-end of bovine B-mannosidase
cDNA (203 bp) as a probe to screen the bovine genomic library using a PCR based
method, and the results show the characteristics of housekeeping gene promoter. Similar
nucleotide sequences to the TTF-l consensus motif were found in this promoter region,
which raised the possibility that Tl‘F-l may be involved in the regulation of tissue-

specific expression of B-mannosidase in the thyroid.

34

MATERIALS AND METHODS

Materials

A bovine genomic DNA library constructed in Lambda FIX II vector and XLl-Blue
E. coli cells were obtained from Stratagene (La Jolla, CA). PCI-neo vector was a gift
from Dr. McCabe’s lab. Ampli Taq® DNA polymerase was from Perkin Elmer.
Restriction enzyme EcoR I was purchased from GIBCO. All primers used in this study
were synthesized in the MSU Macromolecular Structure Facility. All primers are listed
in Table 7.
Genomic library screening

The library was screened using a PCR-based method (Israel, D.I.,1993). This
method needed a piece of known sequence, or 3 Oligonucleotides (two PCR primers, and
the hybridization probe) as a probe. Briefly, a library was subdivided into 64 wells, each
containing 1000 clones, and propagated in bacteria. Amplified phage fi'om each of 8
wells across columns, and each of 8 wells down rows, were pooled. The pooled phage
were screened for the sequence of interest by PCR using specific primers. A single well
that contained the known sequence was identified by the synthesis of a PCR product of
the correct size that hybridized to an internal oligonucleotide probe. This well was
subdivided into 64 wells, each containing approximately 30 individual phage,
reamplified, and rescreened utilizing the same protocol. A positive well was then
screened a third time with about 2 phage per well. In the current research we used the 5’-
end of bovine cDNA (203bp), which has been sequenced and characterized previously, as

a probe, and two specific primers: MJ 120 and KF 204 (that flank the probe) were used.

35

To titer the library, 5 pl of the library was used and diluted in series: AA, 1:102; A, 1:104;
B, 1:105; C, 1:106; and D, 1:107, in SM buffer, 10 p1 of each A, B, C, and D dilution was
used to infect 200 pl of cultured XLl-Blue cells (A600 = 0.5). Phage and bacteria were
incubated at 37°C for 15 min, then 2.5 m1 of top agar (45°C) were added to the infected
cells, mixed well and poured evenly on the NZY plate. Plates were incubated at 37°C
overnight. The total number of plaques from plate C was 54 (the duplicated plate was
55), so the library concentration is about 5.4 X 109 pfu/ml. In order to get approximately
1000 pfu/ 100 pl per well for the first round screening and based on the titer of the library,
we used 5 pl of the library dilution (1:100) to infect a 2.4 ml-cultured of XLl-Blue cells
(A600=0.5) (followed the former experiment). To figure out the optimal ratio of phage/
cells for efficient infection, we performed an experiment, in which a fixed amount of
phage (~3000 pfu) was used to infect a series amount of cells, 10 pl, 25 pl, 50 pl, 75 pl,
100 pl, 200 pl, 400 pl, and 600 pl (A600 = 0.5), and grown in 10 ml NZY broth at 37°C
for overnight. The results showed all the cells were lysed well, especially in the infection
culture with 50 pl of cells. Following the infection, 18 ml of NZY broth and 180 pl 1 M
MgSO4 (10mM MgSO4 final concentration) were added to the infected cells and then the
culture was subdivided into 64 x 2 wells in two 96-well plates (plate I and plate 11) with
100pl per well. Concomitantly, 100 pl of the culture was used to do the titering for
confirming the initial concentration of phage. The plates were sealed with GeNuncTM
sealing tape, and grown at 37°C for 6 hr while shaking at 225 rpm. The culture was
observed until there was a change from cloudy to clear, which indicated cells were

completely lysed by phage. Following phage amplification, 25 pl of culture was

removed from each well to pool across the rows (A—> H) and down the columns (1 —> 8),

36

resulting in 16 pools for one plate with 200 pl/pool. To prepare phage DNA, 50 pl of
phage lysates of 200 pl pool was added to 50 p1 (equal vol.)100mM NaOH, heated at
90°C for 10 min, and then neutralized with 10 pl (1/ 10 vol.) 1 M Tris.HCL (pH 7.6). 2 pl
was used as template for PCR. PCR program: denature templates at 94°C for 7 min,
following 35 cycles: 94°C /30 s, 55°C /45 s, and 72°C /45 3; extension at 72°C for 10
min. The PCR products were analyzed for the correct size on 2.5 % agarose gel with 1x
TBE buffer. For the secondary phage amplification, the positive well from the first
screening was titered following the same protocol described previously (for the library
titering). To get approximately 30 pfu/ 100 pl per well, the well was diluted to 1:104 in
SM buffer, then 15 pl of the dilution was used to infected 50 pl XLl-Blue cells (A600 =
0.5). Ten ml NZY of broth with 10 mM MgSO4 were added to the infected cells, and
then aliquoted to 8 x 8 wells in one plate with 100 p1 per well, and another 100 pl was
used for titering. Then following the same protocol used in the first screening. For the
tertiary screen, again, the positive wells from the second round screening were titered,
then we prepared plates containing ~ 100 pfu/plate to do the plaque lifi hybridization
experiment, plaques were transferred to Hybond-N nylon membrane and using biotin-
labeled probe, PCR products of the 5’-end sequence of B-mannosidase cDNA (203 bp).
Somehow, this system did not work out and we did not get any information from that.
Since the actual low concentration (~18 pfu/well) was used for the secondary
amplification, we decided to pick individual plaques for screening positive signals. A
total of 64 plaques were picked from a plate containing ~100 plaques prepared from one

positive well of the second screening. Individual phage was eluted in 400 pl of SM

buffer at — 4 °C for overnight. After titering the elution (~2 x107 or 108 pfu/ml), 10 pl of

37

the eluted plaque phage was used to infect 10 pl cells in 96-well plate. Following the
infection 100 pl of NZY broth with 10 mM MgSO4 were added to each well containing
the infected cells, and grown at 37°C for 6 hr. The amplified phages were then analyzed
by PCR and gel electrophoresis following the same protocol used in the first two round
screening. To purify the positive plaques (from the tertiary screening), we replated the
phage from the positive plaques on NZY plates for overnight at 37°C. Then we picked
all plaques from the plates to grow in 5 ml NZY broth for overnight, followed by PCR
and gel electrophoresis analysis. Afier having pure positive phage clone we prepared
phage stocks by performing both liquid and plate lysates. The titering results showed
higher yield from plate lysates (1.1 X 10ll pfu/ml), so plate lysates were used to prepare
phage DNA by polyethylene glycol precipitation (PEG) according to the method
described in Current Protocols in Molecular Biology (Ausubel et al., 1994).
Subcloning

A positive phage clone was subcloned into two vectors, Ready-to-goTM pUC18
EcoR I /BAP + ligase (from Pharmacia) and PCI-neo expression vector (From Promega).
Lambda FIX II vector contains Not I cloning sites that flank the insert region and also
contains EcoR I cloning sites. To estimate the size of insert and look for the fragment for
subcloning with EcoR I digestion, the positive phage DNA was digested by each of EcoR
I, Not I, and EcoR I with Not I together. A 10 p1 reaction, with 1 pl of each enzyme and
1 pl 10x Reac3 buffer, was incubated at 37°C overnight. The digestion reactions were
resolved on 0.8 % agarose / l x TAE gel. The insert contained three EcoR I sites and one
Not I site. The total length of insert is approximate 15 kb. With EcoR I digestion the two

fragments, ~7.7 kb and ~3.2 kb (estimated by computer analysis using Marker III as

38

standard), were cut out from a 0.8 % low melting agarose gel/1 x TAE buffer and
purified using a Wizard Kit (Promega). Southern blot and also PCR, using the purified
fragment from the gel as template, were used to identify the fragment containing the
5’-end of B-mannosidase sequence. The results revealed the smaller fragment (3.2 kb)
contained the 5’ sequence information. For subcloning, we first tried to put the 3.2 kb
fragment into the Ready-to-go pUC18 vector, but the ligation reaction failed several
times yielding unexplained strange bands, which did not match the size of either vector or
insert. We thought that there might have some damage to the fragment DNA when we
performed the gel purification. Then we directly used the mixture of digestion reaction
of EcoRl , after phenol/chloroform extraction and ethanol precipitation (following the
standard protocols), to do the ligation with the ratio of insert/vector at approximate 1:6
(referred to 3.2 kb fragment). Two pl of ligation reaction was used to transform 100 pl
DHSa competent cells (2.48 x 107 cfu/ pg) following the standard protocol. Such as: chill
30 min on ice, heat shock at 42 °C for 45 s, then add 900 pl SOC medium to grow 1 hr at
37°C with shaking. Then 2 x 200 pl of culture were spreaded on two LB plates
containing ampicillin (100 pg/ml), and the plates were incubated at 37°C for overnight.
Colonies were then randomly picked and grown in 3 ml LB broth containing ampicillin at
37°C for overnight. Plasmid DNA was prepared from overnight culture using a
Promega’s Wizard miniprep Kit. Three of six randomly picked colonies contained the
insert of the 7.7 kb fragment (Figure 11). We still could not get the smaller size fragment
into the pUC18 vector. Then we tried to subclone the 3.2 kb fragment using PCI-neo

vector. Fragment DNA (3.2 kb) was purified from low melting agarose gel/ 1 x TAE

39

buffer and used to do the ligation, then total 10 pl ligation reaction was used to transform
DHSa competent cells following the same proctocol described earlier.
Nucleotide sequence analysis

Sequencing was performed by dye terminator reaction in the DNA Sequencing
Facility (MSU). Reactions consisted of 1 pg of plasmid DNA and 7.2 pMol (more than 6
pMol) of primer in 10 pl sterile water. New primers were designed as sequencing
progressed. The strategy for sequencing is illustrated in Figure 13, and the primers used
for sequencing were listed in Table 7. Contig assembly and sequence analysis were done

by using Sequencher project and GCG computer program.

RESULTS

Genomic screening and subcloning

The bovine genomic library in lambda FIX II was first titered and found to contain
approximately 5.4 x 109 pfu/ml. The first screening produced two positive pools, or one
positive well (row E and column 3) (Figure 7). The second round yielded three positive
pools, or two positive wells (row F, column 2 and 6) (Figure 8). Sixty—four plaques were
picked for the tertiary screening and only two plaques #58 and #59 had the positive signal
(Figure 9). The two positive plaques were then replated for purifying. The plate
prepared from #58 plaque contained 6 plaques, all were picked and all came out positive.
The total 10 plaques from the plate containing #59 plaque were all negative (PCR
analysis data not shown). Thus, we assumed that we had one pure positive phage clone

(#5 8). We amplified this positive phage clone using plate lysates and titered the lysates

40

Table 7. Oligonucleotides Used For Screening And Sequencing

 

 

Location* Primer Sequence 5’—) 3’
-44 M] 120 CGCATCCCTCGGGTTCTT
1 59 _KF_204 GAACAAGGCGCTGTGCACGC
-523 KF 354 AAACTGGGGAAAACTGAAGTGA
-360 _K_F_3§2_ GCGAGAGCCATGCACGGTAA
-853 KF 389 CACAGCTACTGAGCGACAGA

 

* —oligonucleotides started from upstream (-) or downstream of the initiation codon (ATG).
Antisense primers were indicated by underline.

41

._ 3% 5 mm a

:25 03:89 2:. .3838 mo «.38 m ”at; E8 £38 mo £08 w um T< A305 an 88
35:8 0358 ”m ACNE Sumo“. 033mg ”Z .> 5x32 ”2 .AmmC. x M >0» 80.8mm .X.

Wu no S: 203 $2605 M03 .055: 3880» 05.5.. no ”£595... 3...: 2E. .b MERE

 

x 50m v m N _20mmaom<mzz w h on V+mm_mcm+flnum<m22

3 083 H 82;

42

MNPABCDEF+GH12t3456"78

unsung-“mum.”-

l

 

Figure 8. The second screening of bovine genomic library (PCR
products were run on 2.5 % agarose gel/1 x TBE). M: Marker V. N:
negative control (H20). P: positive control(203 bp probe). A—) H: 8
pools of rows, and 1—9 8: 8 pools of columns. The positive wells are
F2 and F6.

43

.3}. c5 ”mu Pa moms—8 gamma 2E. .Aowmna 05 15:8 «E803

”m 405:8 03:89 i ACNE 35:8 ”Summon ”Z .> SxEE ”E .mmh x fl how 803mm .X. Wm
no 5: 203 $2608 MUA dragons E newsman 85 can commas 2m 5 853 .8on 083
8:83 we 6:39 95:8.— ..8 his: 2823» 2:25 .3 9:823. 9:5 25. d 95»:—

!,ll'll- 8":

II.

Illl’llll lI‘OI'IolIo-lll

. It'tl
I,” I”. flu
Ram:
mfg-i ”.‘a .. a

44

".""""m"'1

Allen-'1' ll
“”l'mm " m"
. nu

warmr'lr

av .................................. 35ng 3 ..................................... “mmZE

 

about 1.1 x 10H pfu/ml, then we used this lysates to prepare the phage DNA using PEG
precipitation method; 8 ml of plate lysates yielded approximate 6 pg of DNA. Direct
sequencing of phage DNA did not yield good sequence information, therefore, the phage
insert was subcloned into plasmid vectors. Figure 10 shows the restriction digest of the
insert, three EcoR I sites and one Not I site were within the insert. The total length of
insert is approximatel 5 kb. EcoR I digestion of insert created two fragments, ~7.7 kb
and ~3.2 kb in addition to the vector arms plus insert. Not I yielded a 4.5 kb fragment
and a fragment of 11.4 kb similar to the 10.7 kb arm, indicating a Not I site in the insert
as well as at both sides of the cloning site. Double digest was compatible with the results
of two single digests. Total seven fragments including the two arms of the vector and
five fragments of the insert, 7.95 kb, 2.43 kb, 1.94 kb, 1.63 kb, and 0.857 kb, were
produced from the double digest. Both Southern blot and PCR analysis revealed that 3.2
kb EcoR I fragment contained the 5’sequence information of B-mannosidase (data not
shown). For subcloning, the 7.7 kb fragment was ligated into the Ready-to-go PUC18
vector, three out of six randomly picked colonies came out positive (Figure 1 1); and the
3.2 kb fragment was subcloned into the PCI-neo vector, four out of seven were positive
(Figure 12). The results of restriction digest of the two subclones with EcoR I, Not I, and
EcoR I with Not 1, respectively, confirmed that the internal Not I site is within the 3.2 kb
fragment (data not shown).
Nucleotide sequencing

In total 1182-bp of sequence, including 203-bp 5’-end of B-mannosidase exonl ,
200-bp 3’ single direction, and 779-bp two direction DNA sequence, of the promoter

region was produced in this study (Figure 14). The nucleotide sequence and several

45

 

Figure 10. Insert analysis of lambda phage clone. The positive phage
clone was digested by EcoRI (lane 2), EcoR I and Not I (lane 3), and
Not I (lane 4). Lane 1 is the uncut control. M is 0.5 pg of Marker 111.
Two arrows indicates two bands are closely located in lane 4.

46

 

Figure 11. Subclone analysis (PUC18 vector).
EcoRl digest of 6 colonies from subclone using
pUC18 vector, clones 1,3, and 4 have insert (7.7
kb). M is Marker II (0.5 pg).

47

   

-- - -- 5.4kb

Figure 12. Subclone analysis (PCI-neo vector).
EcoRl digest of seven colonies, lane 1,3,6, and 7
show the positive clones. M is 0.5 pg Marker III.

48

 

 

 

 

 

 

   

 

KF 389 (-853) . i
>
KF 362 -360
‘ < >
KF 354 (523)
’
KF 204 (159)
4
F . . ';-..~~ae@
. MJ 120(-44)

KF 204(159

Figure 13. The strategy for sequencing the bovine B—mannosidase gene
promoter region. The primers are indicated with ID# and with location shown in
parenthesis. The two primers (MI 120 and KF 204) flanking the probe (203-hp 5’-

end of B-mannosidase cDNA), which was used for screening, were also displayed.

49

-1053 CAAATTGGGACTCAGGTAAACTGTGCTGCCATTAAGACTTGACATAAACCTGTGGTGT’I‘TTGGGGG
437 TACCTTGGCATTCCTAGGACAGCCAAATATGTTAACTCATTGTGTGCTGATCACAACCCGGAAAAA
'lTF-l motif

-921 AGAGTACTGTCTCCATT'I'TCGAGTTCAAGGAACAGGGGTATTAGAAATI‘TCGTGGCTTGCCTAAGT
~855 CCCACAGCTACTGAGCGACAGAGGATI‘TTAAATITGCCTGTGCATI‘TTAG'ITCAGGTITCCCG
_792 AACGTCAGGAACC'I‘CC’I‘CTGCGTGAC’I'I'I‘ACAAACAGAAGGTI‘GTAGTCCACGAACATCAGG
-730 CCAACGTGCTTI‘GTTI‘TCTCTGGCTGGGCCCI‘ATGTTGCACGC'I‘GTACACGAATI‘TTCTCAG

CTCTCACAACAACCCTACGAATAGGTAC'I'I'I‘AGTATITATACTI‘G’I'I‘I‘ACI‘GCGCAGACI‘GTT
-605 CTTGAGACCAACCI‘GTAGAGCAGCAAAAGATGCGCGTI‘ACCCGTGCCGGGGAGACGCCTGC
-544 AGCACGGACGAGGGTC'I‘GGGGAAACTGGGGGAAACTGAAGTGATGGGGTGTC’I'I‘GGTI‘I‘TC
483 TGTTCT’I'I‘GGAGCGTCTCTGGCTGTATTCTCCTCACACI‘ACTGTCTGTCCCTGAGCTCCCCG

421 AGGC'I‘GTGCGCCAC’ITI‘GCGCCCAGAGA'I‘TI'GTGTGTCCCAATTACCGTGCATGGCTCTCGC

-359 C'ITCCG'l'l‘CACACGCCGAAGCAG'ITGGAATAAGCCCAGAGGAGGACGCAGACCGCGGCAGT

-293 C CGAGCCC AGAGC GATCC GAGCCC GGAGCGAAGC ACAGGTGCAGCGGCT CCAGCACT CACG

TTF-l motif
_237 ACCGCAGGCTTCCGCCAAACCGAGCGATCTCTGCGCTGCCAGCCCGCCGGCGGAGCTGGGG
AP-2 AP-2
-1 76 AATCCGTCGAGGTGCC'ITTAGCTCAGCTGACCTGGGGWGCGAATCGGGGGCGTQ
AP-Z
-1 15 QgflGGGACCGGGGGCGGGCCCCGGGEGQGGACAGCCAGAGCTCAGGCC AGCGTGGCTTC
Sp—l Sp—l Sp—l
_54 CGCTGCCCACCGCATCCCTCGGGTTCTTGCCCTGTGCGGGTACCGGGCAACACCATQCTCCTCCGC

Met

13 CTGCTCCTGCTGCI‘TGCGCCGTGCGGTGCGGGCTTCGCTACCAAGGTGGTCAGCATCAGTTTGCGG
79 GGAAACTGGAAGATCCACAGCGGGAACGGTTCGCTGCAGCTGCCCGCGACGGTTCCCGGTTGCGT

144 GCAC

Figure 14. Sequence of the 5’ flanking region of the bovine B—mannosidase gene.
The bold portion represents the putative promoter region with strands sequenced in both
direction; AP-2, putative binding sites for the AP-2 transcription factor; Sp—l , putative
binding sites for the Sp-l transcription factor; TTF -1 motif, putative binding sites for the
thyroid transcription factor. An arrow indicates the 5’-end sequence of B-mannosidase
cDNA.

50

potential promoter elements revealed by computer search are shown in Figure 14. The
200-bp region upstream from the initiation codon (ATG) was relatively high GC contents
(75.5 %) with three potential Spl binding sites and two AP-2 binding sites. A CAAT box
was noted at —3 82 upstream from the initiation codon. Over one hundred of other
potential transcription factor binding sites were found in this promoter region by GCG
computer program analysis. Two potential TTF-l sites were identified using published
consensus sites from other species as input into the sequencher homology search

program.
DISCUSSION

We have cloned and sequenced the promoter region of B-mannosidase using a PCR
based method, and this region was shown to share the common characteristics of a typical
housekeeping promoter by computer database analysis. Lysosomal enzymes have been
thought as housekeeping genes, which are expressed ubiquitously. Most of the promoters
of lysosomal enzyme genes generally have housekeeping gene characteristics: they are
strongly GC rich in the region directly upstream of the initiation codon (ATG) with
potential Spl binding sites; they generally lack TATA and /or CAAT boxes; and their
initiation of transcription occurs at multiple points (Geier et al., 1989; Hoefsloot et al.,
1990; Kreysing et al., 1990; Wang and Desnick, 1990; Menon et al., 1992). Other
lysosomal enzyme gene promoters do contain CAAT and TATA motifs in their 5’

flanking regions as well as being GC rich (Park et al., 1991; Schuchman et al., 1992).

51

As shown in Figure 14, the 5’ flanking sequence of B-mannosidsae is highly GC
rich (75.5 %), containing three Spl binding sites at -116, -104, and ~92 within a 200-bp
region upstream from the initiation codon (ATG). This is consistent with the
characteristics of housekeeping gene promoter. A CAAT box was found in the 5’
proximal flanking region (-382) of B-mannosidase gene, which is probably too far from
the transcription start site to be significant.

Tissue-specific expression of lysosomal enzyme has been demonstrated by a
number of studies (Freysz et al., 1979; Abe et al., 1979; Reiner and Horowitz, 1988;
Aronson et al., 1989) as well as our results presented earlier in this thesis. These results
suggested that lysosomal enzyme activities may be under regulatory control. We are

most interested in the results of the specific activity of B-mannosidase in thyroid where

the highest expression levels are observed and with a sharp increase (P < 0.005, Mann-
Whitney test) from gestation 85 days to newborn compared to other tissues. It was this
interesting finding that prompted us to isolate the B-mannosidase promoter region and
look for the thyroid-specific transcription factor binding sites. TTF-l is a homeodomain
(HD) protein that was initially identified as a thyroid-specific factor responsible for
thyroglobulin (Tg) gene transcription. TTF-l specifically recognizes oligonucleotide
sequence containing the 5’-CAAG-3’ core motif, contrary to other HDs that recognize a
5’-TAAT-3’ core motif. One recent study has shown that two binding sites for TTF-l in
the bovine thyroglobulin gene upstream were essential for the activity of enhancer
elements in this gene (Christophe-Hobertus et al., 1999). Several consensus TTF-l
binding site core motifs derived from TTF -1-specific binding sites in the rat TG, TPO,

and TSHR genes were summarized by Suzuki et al. (1998). With the help of the

52

computer, we found two similar sequence, GTGCTGATCA (-944) and CACTCACGAC
(-245) in the bovine B-mannosidase promoter region with two of the consensus TTF-l
binding site core sequence, GTGCTGAAGA and CACTCAAGTG, respectively. In
addition, one consensus TTF-l binding motif (CACTCAAGTG) is aligned to the human
B-mannosidase promoter region (unpublished data) with 80% similarity
(ATCTCAAGATG), and contains a 5’-CAAG-3’ motif. This interesting finding raised
the possibility that TTF-l may be involved in the regulatory expression of B-mannosidase
gene in thyroid in both ruminants and humans.

In summary, we have shown the cloning and sequencing of the 5’flanking region of
the bovine B-mannosidase gene. Analysis of the sequence yielded two findings: (1) This
region shares the characteristics of a housekeeping promoter. (2) Nucleotide sequences
similar to TTF-l binding sites were found in this promoter region. The next step will be

the characterization of this promoter and confirmation of these interesting findings.

53

CHAPTER 3

SUMMARY AND PROSPECTS

54

SUMMARY AND PROSPECTS

There are two objectives in this thesis: (1) determination of the developmental
profile of lysosomal enzyme activities in normal goats: (2) cloning and sequencing the
bovine B-mannosidase gene promoter. The two separate projects are complementary
although we utilized two ruminant species, which have 96.3 % identical nucleotides of B-
mannosidase cDNA and 95.4 % identity of the deduced amino acids (Leipprandt et al.,
1996). The first project, at the biochemical function and developmental level, studied
lysosomal enzyme activity. This was undertaken to provide information about disease
development by determining the developmental requirements for lysosomal enzymes.
Also this could give us information to design appropriate therapies, either enzyme
replacement or gene therapy. The second project, at the molecular level of regulation of
gene expression, investigated the basic mechanism that may explain the cell-specific and
enzyme-specific developmental patterns found in the results of the first study.

The occurence of various patterns among different tissues and four lysosomal
enzymes (B-mannosidase,a-mannosidase, B-hexosaminidase and acid phosphatase) is
expected. The existence of variation in other enzyme activities is known as well (Verity
et al., 1968; Zanetta et al., 1980; Cook et al., 1984; Cingle et al., 1995; Verdugo et al.,
1997). But the developmental expression of B-mannosidase had not been studied
previously. The significance of different patterns in developmental function of various

organs is not yet determined.

55

Since the caprine genomic library is not currently available right now, and we also
have been using the bovine as an animal model to study B-mannosidosis (Jones etal.,
1992; Sopher et al., 1993, and Chen et al., 1995), we decided to clone and sequence the
bovine B-mannosidase promoter region. PCR based screening method described earlier
was used. In our case the probe size (203 -bp) fell into a region with no non-specific
amplification product (Figures 7- 9), so we did not even need to do the hybridization.
The strategy for the sequencing is shown in Figure 13, and the total 5’ flanking sequence
was shown in Figure 14. From the sequence analysis by computer search, this region is a
candidate promoter region: (1) It is located directly upstream of the transcription start
site. (2) It shares the common characteristics of housekeeping gene promoter with no
TATA box, but highly GC rich with three potential Spl binding sites. (3) Computer
database analysis showed over 100 potential transcription factor binding sites in this
region. However, further studies are strongly recommended to characterize this region
and confirm these findings.

Tissue-specific transcription factors are important for the regulation of specific gene
expression in specific tissues and during aging, or in the variation of enzyme activities.
In order to look for cell-specific transcription factor binding sites, the functional
characterization of genomic clones is a necessary step. And it is also useful for the gene
and enzyme replacement therapies, in which vectors are made from naturally-regulated
promoters rather than a promoter from a retrovirus; and also, the function analysis may
lead us to further understand the biochemical and pathological relationship of this
lysosomal storage disease. So the next step we are going to do is the function analysis of

the bovine B-mannosidase gene, which may help us to understand tissue-specific

56

expression of enzyme activity and the development of pathogenesis. This may also

contribute to regulation of enzyme activity with gene therapy approaches.

 

57

BIBLIOGRAPHY

58

BIBLIOGRAPHY

Abbitt, B., Jones, M.Z., Kasari, T.R., Storts, R.W., Templeton, J .W., Holland, PS. and
Castenson, PE. (1991). B-mannosidosis in twelve Salers calves. J. Am. Vet. Med.
Assoc. 198, 109-113.

Abe, T., Miyatake, T., Norton, WT and Suzuki, K. (1979). Activities of glycolipid
hydrolases in neurons and astroglia from rat and calf brains and in oigodendroglia
from calf brain. Brain Res. 161, 179-182.

Alkhayat, A.H., Kraemer, S.A., Leipprandt, J .R., Macek, M., Kleijer, W.J. and Friderici,
K.H. (1998). Human beta-mannosidase cDNA characterization and first

identification of a mutation associated with human beta-mannosidosis. Hum Mol
Genet 7, 75-83.

Aronson, N.N. Jr. and Kuranda, M.J. (1989). Lysosomal degradation of Asn-linked
glycoproteins. FASEB J. 3, 2615-2622.

Ausubel, F .M., Brent, R., Kingston, RE, Moore, D.D., Seidman, J .G., Smith, J .A. and
Struhl, K., eds. Current Protocols In Molecular Biology. Massachusetts General
Hospital and Harvard Medical School: John Wiley and Sons, Inc., 1990: Vol 1,
1.13.7.

Berrnan, ER. (1994). Retinal pigment epithelium: lysosomal enzymes and aging. Br. J.
Ophthalmol. 78,82-83.

Bemal, J. and Nunez, J. (1995). Thyroid hormones and brain development. Eur. J.
Endocrinol. 133, 390-398.

Bernard, M., Sioud, M., Percheron, F. and Foglietti, M.J. (1986). B-mannosidase in
human serum and urine: a comparative study. Int]. J. Biochem. 18, 1065-1068.

Blake, M.C., Jambou, R.C., Swick, A.G., Kahn, J .W. and Azizkhan, J .C. (1990).
Transcriptional initiation is controlled by upstream GC-box interaction in a
TATAA-less promoter. Mol. Cell. Biol. 10, 6632-6641.

Boyer, P.J., Jones, M.Z., Nachreiner, R.F., Refsal, K.R., Common, R.S., Kelley, J. and
Lovell, KL, (1990). Caprine B-mannosidosis: Abnormal thyroid structure and
function in a lysosomal storage disease. Lab. Invest. 63, 100-106.

Burrow, G.N. Thyroid gland and control. In: Burrow, G.N., Oppenheimer, J .H. and

Volpe, R., ed. Thyroid Function and Disease. Philadelphia: W.B. Saunders,
1989: 11-14.

59

Cavanagh, K., Dunstan, R. W. and Jones, M.Z. (1982). Plasma a- and B-mannosidase
activities in caprine B-mannosidosis. Am. J. Vet. Res. 43, 1058-1059.

Cavailles, V., Augereau, P. and Rochefort, H. (1991). Catheosin D gene of human
MCF7 cells contains estrogen-responsive sequences in its 5’ proximal flanking
region. Biochem. Biophys. Res. Comm. 174, 816-824.

Cavailles, V., Augereau, P. and Rochefort, H. (1993). Cathepsin D gene is controlled by
a mixed promoter, and estrogens stimulate only TATA-dependent transcription in
breast cancer cells. Proc. Natl. Acad. Sci. USA , Vol. 90, 203-207.

Chen, H., Leipprandt, J .R., Traviss, C.E., Sopher, B.L., Jones, M.Z., Cavanagh, K.T. and
F riderici, K.H. (1995). Molecular cloning and characterization of bovine [3-
mannosidase. J. Biol. Chem. 270, 3841-3848.

Christophe-Hobertus, C. and Christophe, D. (1999). Two binding sites for thyroid
transcription factor 1 (TTF-l) determine the activity of the bovine thyroglobulin
gene upstream enhancer element. Mol. Cell. Endocrinol. 149, 79-84.

Cingle, K.A., Kalski, R.S., Bruner, W.B., O’Brien, C.M., Erhard, P. and Wyszynski,
RE. (1995). Age-related changes of glycosidases in human retinal pigment
epithelium. Curr. Eye Res. 433-438.

Civitareale, D., Lonigro, R., Sinchair, AJ. and Di Lauro, R. (1989). A thyroid-specific
nuclear protein essential for tissue-specific expression of the thyroglobulin
promoter. EMBO J. 8, 2537-42.

Civitareale, D., Castelli, M.P., Falasca, P. and Saiardi, A. (1993). Thyroid transcription
factor 1 activates the promoter of the thyrotropin receptor gene. Mol. Endocrinol.
7, 1589-1595.

Conover, W.J. The use of ranks. In: Conover, W.J., ed. Practical Nonparametric
Statistics. New York 0 London 0 Sydney 0 Toronto: John Wiley and Sons INC,
1971: 223-237.

Cook, N.J., Dontenwill, M., Meyer, A., Vincendon, G. and Zanetta, J .P. (1984).
Postnatal variations of endo-B-D-N-acetyl-glucosaminidase in the developing rat
cerebellum. Brain Res. 317, 298-301.

Cooper, A., Hatton, C., Thornley, M. and Sardharwalla, I. B. (1988). Human [3-
mannosidase deficiency: biochemical findings in plasma, fibroblasts, white cells
and urine, J. Inher. Metab. Dis., 11, 17-29.

Cooper, A., Wraith, J .E., Savage, W.J., Thornley, M. and Noronha, M.J. (1991). B-

Mannosidase deficiency in a female infant with epileptic encephalopathy. J.
Inher. Metab. Dis. 14, 18-22.

60

Cotton, R.G.H. (1993). Current methods of mutation detection. Mutat. Res. 285, 125-144.

Damante, G. and Di Lauro, R. (1994). Thyroid-specific gene expression. Biochim.
Biophys. Acta. 1218, 255-266.

Dynan, W.S. (1986). Promoters for housekeeping genes. Trends Genet. 2, 196-197.

Doll, R.F., Bruce, A. and Smith, RI. (1994). Regulation of the human acid a-glucosidase
promoter in multiple cell types. Biochim. Biophys. Acta. 1261 , 57-67.

Dorland, L., Duran, M., Hoefnagels, F .E.T., Breg, J .N., F abery de Jonge, H., van Eeghen-
Cransberg, K., Van Sprang, F.J. and van Diggelen, OR (1988). B-mannosidosis
in two brothers with hearing loss. J. Inher. Metab. Dis., 11, 255-258.

Durand, P. (1987). Recent progress of lysosomal disease. Enzyme 38, 256-261.

Embury, DH. and Jerrett, I.V. (1985). Mannosidosis in Galloway calves. Vet. Pathol.
22, 548-551.

Endo, T., Kaneshige, M., Nakazato, M., Ohmori, M., Harii, N. and Onaya, T. (1997).
Thyroid transcription factor-l activates the promoter activity of rat thyroid Na+ /I'
symporter activity. Mol. Endocrinol. 11, 1747-1755.

Fisher, R.A., Rathke E. J. S., Kelley, J. A., Dunstan R. W., Cavanagh, K. and Jones,
M.Z. (1986). Inherited B-mannosidosis in goats. Anim. Genet. 17, 183-190.

Francis-Lang, H., Price, M., Polycarpou-Schwarz, M. and Di Lauro, R. (1992). Cell-
type-specific expression of the rat thyroperoxidase promoter indicates common
mechanisms for thyroid-specific gene expression. Mol. Cell. Biol. 12, 576-588.

Freysz, L., Farooqui, A.A., Adamcczeewska-Goncerzewicz, Z. and Mandel, P. (1979)
Lysosomal hydrolases in neuronal, astroglia], and oligodendroglial enriched
fractions of rabbit and beef brain. J. Lipid Res. 20, 503-508.

Geier, C., von Figura, K. and Pohlmann, R. (1989). Structure of the human lysosomal
acid phosphatase gene. Eur. J. Biochem. 183, 611-616.

Guazzi, S., Price, M., De Felice, M., Damante, G., Mattei, MG. and Di Lauro, R.
(1990). Thyroid nuclear factor 1 (TTF-l) contains a homeodomain and displays a
novel DNA binding specificity. EMBO J. 9, 3631-3639.

Healy, P. J ., Seaman, J. T., Gardner, 1. A. and Sewell, C. A. (1981). B-mannosidase
deficiency in Anglo-Nubian goats. Aust. Vet. J. 57, 504-507.

61

Hers, H.G. (1965). Progress in gastroenterology: inborn lysosomal disease.
Gastroenterology 48, 625-633.

Hoefsloot, L.H., Hoogeveen-westerveld, M., Reuser, A.J.J. and Oostra, BA. (1990).
Characterization of the human lysosomal a—glucosidase gene. Biochem. J. 272,
493-497.

Istrael, DJ. (1993). A PCR-based method for high stringency screening of DNA
libraries. Nucleic Acid Research, 1993, Vol. 21, No. 11, 2627-2631.

Jolly, R.D., Thompson, K.G., Bayliss, S.L., Vidler, B.M., Orr, MB. and Healy, P.J.
(1990). B-mannosidosis in a salers calf: a new storage disease of cattle. N. Z. Vet.
J. 38, 102-105.

Jones, M.Z., Cavanagh, K.T., Kranich, R., Traviss, C., Fujita, Y., Ohta, M. and
Matsuura, F. (1993). Possible B-mannosidosis chimera. Altered expression of
metabolic perturbations. J. Inher. Metab. Dis. 16, 1012-1023.

Jones, M.Z., Cunningham, J .G., Dade, A.W., Alessi, D.W., Mostosky, U.V., Vorro, J .R.,
Benitez, J. T. and Lovell, KL. (1983). Caprine B-mannosidosis: Clinical and
pathological features. J. Neuropath. Exp. Neurol. 42, 268-285.

Jones, M. Z. and Dawson, G. (1981). Caprine B-mannosidosis. Inherited deficiency of 13-
mannosidase. J .Biol. Chem. 256, 5185-5188.

Jones, M.Z. and Kennedy, F .A. (1993). Caprine B-mannosidosis: aberrant phenotype in
a 5-month-old euthyroid animal. J. Inher. Metab. Dis. 16, 910-911.

Jones, M. Z., and Laine, R. A. (1981). Caprine oligosaccharide storage disease.
Accumulation of B-mannosyl (1-4) B-N-acetylglucosaminyl (1-4) B-N-
acetylglucosamine in brain. J. Biol. Chem. 256, 5181-5184.

Jones, M.Z., Rathke, E.J.S. and Cavanagh, K. (1984). B-mannosidosis: prenatal
biochemical and morphological characteristics. J. Inher. Metab. Dis. 7, 8085.

Jones, M.Z., Rathke, E.J.S., Gage, D.A., Costello, C.E., Murakami, K., Ohta, M. and
Matsuura, F. (1992). Oligosaccharides accumulated in the bovine B-mannosidosis
kidney. J. Inher. Metab. Dis. 15, 57-67.

Kimura, S., Hara, Y., Pineau, T., Femandez-Salguero, P., Fox, C.H., Ward, J .M. and
Gonzalez, F. (1996). The T/ebp null mouse: thyroid-specific enhancer-binding
protein is essential for the organogenesis of the thyroid, lung, ventral forebrain,
and pituitary. Genes Dev., 10, 60-69.

Kleijer, W.J., Hu, P., Thoomes, R., Boer, M., Huijmans, G.M., Blom, W., van Diggelen,
O.P., Seemanova, E. and Macek, M. (1990). B-Mannosidase deficiency:

62

heterogeneous manifestation in the first female patient and her brother, J. Inher.
Metab. Dis., 13, 867-872.

Kreysing, J ., von F igura, K. and Gieselrnann, V. (1990). Structure of the arylsulfatase A
gene. Eur. J. Biochem. 191, 627-31.

Leipprandt, J .R., Kraemer, S.A., Haithcock, B.E., chen, H., Dyme, J .L., Cavanagh, K.T.,
Friderici, K.H. and Jones, M.Z. (1996). Caprine B-mannosidase: sequencing and
characterization of the cDNA and identification of the molecular defect of caprine
B-mannosidase. Genomics 37, 51-56.

Lovell, KL. and Jones, M.Z. (1983). Distribution of central nervous system lesions in B-
mannosidosis. Acta Neuropathol 62, 121-126.

Lovell, K.L., Kranich, R.J. and Cavanagh, K.T. (1994). Biochemical and histochemical
analysis of lysosomal enzyme activities in caprine B-mannosidosis. Mol. Chem.
Neuropathol. Vol. 21 ,61-73.

Lovell, K.L., Jones, M.Z., Patterson, J ., Abbit, B. and Castenson, P. (1991). Thyroid
structure and function in bovine B-mannosidosis. J. Inher. Metab. Dis. 14, 228-
230.

Lovell , K.L., Matsuura, F., Patterson, J ., Baeverfjord, G., Ames, N.K. and Jones, M.Z.
(1997). Biochemical and morphological expression of early prenatal caprine B-
mannosidosis. Prenat. Diagn. Vol. 17, 551-557.

Matsuura, F., Laine, RA. and Jones, M.Z. (1981). Oligosaccharides accumulated in the

kidney of a goat with B-mannosidosis: Mass spectrometry of intact pennethylated
derivatives. Arch. Biochem. Biopohys. 211, 485-493.

Menon, K.P., Tieu, RT. and Neufeld, ER (1992). Architecture of the canine IDUG
gene and mutation underlying canine mucopolysaccharidosis I. Genomics 14,
763-768.

Moskkowitz, S.M., Menson, K.P., Tieu, PT. and Neufeld, ER (1992). Architecture of
the gene encoding alpha-L-iduronidase and some mutations underlying human

and canine mucopolysaccharidosis I (MSP I). Am. J. Hum. Genet. 51, supple.
A680.

Musti, A.M., Ursini, E.V., Avvedimento, E.V., Zimarino, V. and Di Lauro, R. (1987).
A cell type specific factor recognizes the rat thyroglobulin promoter. Nucleic
Acids Res. 15, 8149-8166.

Neote, K., Bapat, B., Dumbrille-Ross, A., Troxel, C., Schuster, S.M., Mahuran, DJ. and

Gravel, RA. (1988). Characterization of the human HEXB gene encoding
lysosomal B-hexosaminidase. Genomics 3, 279-286.

63

Neufeld, E.F. (1991). Lysosomal storage diseases. Ann. Rev. Biochem. 60, 257-280.

Norflus, F., yarnanaka, S. and Proia, R.L. (1996). Promoters for the human
B-hexosaminidase genes, HEXA and HEXB. DNA cell Biol. 15, 89-97.

Ohmori, M., Shimura, H., Shimura, Y., Ikuyama, S. and Kohn, L.D. (1995).
Characterization of an up-stream thyroid transcription factor-l-binding site in the
thyrotropin receptor promoter. Endocrinology 136, 269-282.

Ohshirna, T., Murray, G.J., Nagle, J .W., Quirk, J .M., Kraus, M.H., Barton, N.W., Brady,
RD. and Kulkarni, AB. (1995). Structural organization and expression of the
mouse gene encoding a-galactosidase A. Gene 166, 277-280.

Park, H., Fisher, K.J. and Aronson, N.N., Jr. (1991). Genomic structure of human
lysosomal glycosylasparaginase. FEBS Lett. 288, 168-172.

Patterson, J. S., Jones, M. Z., Lovell, KL. and Abbitt, B. (1991). Neuropathology of
bovine B-mannosidosis. J. Neuropathol. Exp. Neurol., 50, 538-546.

Pearce, R.D., Callahan, J .W., Little, P.B., Armstrong, D.T., Kiehm, D. and Clarke, J .T.R.
(1987). Properties and prenatal ontogeny of B-D-mannosidase in selected goat
tissues. Biochem. J. 243, 603-609.

Plachov, D., Chowdhury, K., Walther, C., Simon, D., Guenet, J .L. and Gruss, P. (1990).
Pax-8, a murine paired box gene expressed in the developing excretory system
and thyroid gland. Development 110, 643-651.

Poleev, A., Fickenscher, H., Mundlos, S., Winterpacht, A., Zabel, B., Fidler, A., Gruss,
P. and Plachov, D. (1992). PAX8, a human paired box gene: isolation and

expression in developing thyroid, kidney and Wilms’ tumors. Development 116,
611-623.

Porterfield, SP. and Hendrich, CE. (1993). The role of thyroid hormones in prenatal and
neonatal neurological development: current perspectives. Endocrine Reviews 14,
94-106.

Proia, R.L. and Soravia, E. (1987). Organization of the gene encoding the human B-
hexosaminidase a-chain. J. Biol. Chem. 262, 5677-5681.

Reiner, O. and Horowitz, M. (1988). Differential expression of the human
glucocerebrosidase-coding gene. Gene 73, 469-478.

Riise, H.M., Berg, T., Nilssen, 0., Romeo, 0., Tollersrud, OK. and Ceccherini, I. (1997).
Genomic structure of the human lysosomal alpha-mannosidase gene (MANB).
Genomics 42, 200-207.

64

Sakai, N., Fukushima, H., Inui, K., Fu, L., Nishigaki, T., Yanagihara, I., Tatsumi, N.,
Ozono, K. and Okada, S. (1998). Human galactocerebrosidase gene: promoter
analysis of the 5’-flanking region and structural organization. Biochim Biophys
Acta 1395, 62-67.

Schuchman, E.H., Levran, O., Pereira, L.V. and Desnick, R.J. (1992). Structural
organization and complete nucleotide sequence of the gene encoding human acid
sphingomylinase(SMPD1). Genomics 12, 197-205.

Scott, M.P., Tamkun, J .W. and Hartzell, G.W. 3d (1989). The structure and function of
the homeodomain. Biochim. Biophys. Acta. 989, 25-48.

Shailubhai, K., Saxena, E.S., Balapure, AK. and Vijay, I.K. (1990). Developmental
regulation of glucosidase I, an enzyme involved in the processing of asparagine-
linked glycoprotein in rat mammary gland. J. Biol. Chem. 265, 9701 -9706.

Smith, P.K., Krohn, R.I., Herrnanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano,
M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J. and Klenk, DC. (1985).
Measurement of protein using bicinchoninic acid. Anal. Biochem. 150, 76-85.

Snyder, E.Y., Taylor, RM. and Wolfe, J .H. (1995). Neural progenitor cell engraftment
corrects lysosomal storage throughout the MPS VII mouse brain. Nature, 374,
367-370.

Sopher, B.L., Traviss, C.E., Cavanagh, K.T., Jones, M.Z. and Friderici, K.H. (1992).
Purification and characterization of goat lysosomal B-mannosidase using
monoclonal and polyclonal antibodies. J. Biol. Chem. 267, 6178-6182.

Sopher, B.L., Traviss, C.E., Cavanagh, K.T., Jones, M.Z. and Friderici, K.H. (1993).
Bovine kidney B-mannosidase: purification and characterization. Biochem. J. 289,
343-347.

Stinchi, S., Orlacchio, A., Costanzi, E., Stirling, J .L., Menghini, AR. and Beccari, T.
(1998). Promoter characterization and structure of the gene encoding mouse
lysosomal alpha-d-mannosidase. Mamm Genome 9, 869-873.

Suzuki, K., Lavaroni, S., Mori, A., Okajima, F., Kimura, S., Katoh, R., Kawaoi, A. and
Kohn, L.D. (1998). Thyroid transcription factor 1 is calcium modulated and

coordinately regulates genes involved in calcium homeostasis in C cells.
Mol. Cell. Biol. 18, 7410-7422.

Vandevelde, M., Fankhauser, R. Bichsel, P., Wiesmann, U. and Herschkovvitz, N. (1982).

Hereditary neurovisceral mannosidosis associated with a-mannosidase deficiency
in a family of Persian cats. Acta. Neuropathol. 58, 64-68.

65

Van Pelt, J ., Hokke, C.H., Dorland, L., Duran, M., Kamerling, J .P. and Vliegenthart,
J .F.G. (1990). Accumulation of mannosyl-B(1 —>4)-N-acetylglucosarnine in

fibroblast and leukocytes of patients with a deficiency of B-mannosidase. Clin.
Chim. Acta. 187, 55-60.

Verdugo, ME. and Ray, J ., (1997). Age-related increase in activity of specific
lysosomal enzymes in the human retinal pigment epithelium. Exp.Eye Res.65,
231-240.

Verity, M.A., Brown, W.J. and Reith, A. (1968). Structure-linked activity of lysosomal
enzymes in the developing mouse brain. J. Neuorchem. 15, 69-80.

Walkley, S.U., Thrall, M.A., Dobrenis, K., Huang, M., March, P.A., Siegel, DA. and
Wurzelmann, S. (1994). Bone marrow transplantation corrects the enzyme defect
in neurons of the central nervous system in a lysosomal storage disease. Proc.
Natl. Acad. Sci. U.S.A. 91, 2970-2974.

Wang, A.M., Bishop, DP. and Desnick, R.J. (1990). Human a-N-
acetylgalactosaminidase: molecular cloning, nucleotide sequence, and expression
of a full-length cDNA. J. Biol. Chem. 265, 21859-21866.

Wenger, D.A., Sujansky, E., Fennessey, RV. and Thompson, J .N. (1986). Human B-
mannosidase deficiency, N. Engl. J. Med. 315, 1201-1205.

Yamanaka, S., Johnson, O.N., Norflus, F., Boles, DJ. and Proia, R.L. (1994). Structure
and expression of the mouse B-hexosaminidase genes, Hexa and Hexb. Genomics
21, 588-596.

Yamamoto, K., Tsuji, T. and Osawa, T. (1981). The structure of carbohydrate unit B of
porcine thyroglobulin. Biochem J. 195, 701-713.

Zanetta, J .P., Federico, A. and Vincendon, G. (1980). Glycosidase and cerebellar
ontogenesis in the rat. J. Neurochem. 34, 831-834.

66