SEXUAL DEVELOPMENT AND ASCOSPORE DISCHARGE IN FUSARIUM
GRAMINEARUM: THE ROLE OF CALCIUM AND MYOSIN 2
By
Brad Lee Cavinder

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
DOCTOR OF PHILOSOPHY
Genetics
2011

ABSTRACT
By
Brad Lee Cavinder
The plant pathogen Fusarium graminearum is a cosmopolitan filamentous ascomycete
fungus and the primary etiological species of Fusarium Head Blight (FHB) of wheat in North
America, infecting the heads of the plants and contaminating the grain with mycotoxins. Direct
infection of the heads is needed for development of FHB. An important source of inoculum for
FHB is the aerial dispersal of forcibly discharged ascospores (sexual spores). Previous Trail lab
results indicated that calcium signaling was involved in ascospores discharge, stimulating the
examination of the role calcium channels and possible targets of calcium signaling play in the
growth and development of F. graminearum.
In fungi, the high affinity calcium uptake system (HACS), consisting of the calcium
channel Cch1 and the calcium channel/regulatory protein Mid1, and the low affinity calcium
uptake system (LACS), for which only the transmembrane protein Fig1 is a known component,
have been characterized. Previously, deletion of CCH1 resulted in significantly reduced
vegetative growth with a more fluffy appearance than wild-type, macroconidia (asexual spores)
production, and ascospore discharge, and a few abnormally developed ascospores. Here, deletion
of MID1 resulted in phenotypes similar to the ∆cch1 mutant but with a much higher rate of
abnormal ascospore development. Results were similar but slightly more severe in a ∆mid1
∆cch1 double mutant. Exogenous calcium partially rescued the phenotypes of all strains,
suggesting an alternate route for calcium entry. As FIG1 is involved in low affinity calcium
uptake in other fungi, the role of Fig1 in the calcium uptake was explored. As with the HACS
mutants, loss of Fig1 resulted in significantly slowed vegetative growth rate, but with mycelium

appressed to the surface of the medium rather than fluffy, and reduced conidiation. Following
induction of sexual development, ∆fig1 mutants did not produce perithecia, and a microscopic
examination led to the finding that sexual development halted after the production of perithecium
initials. The LACS and HACS double and triple mutants’ phenotypes were similar but more
severe than the ∆fig1 mutants and included reduced pathogenicity on wheat. Addition of calcium
did not lead to any detectable phenotypic rescue. As perithecia did not develop, the function of
FIG1 during ascus and ascospore development could not be determined.
To facilitate the examination of genes essential for sexual development, such as FIG1, a
doxycycline inducible RNA interference (RNAi) system was adopted for use in F. graminearum.
Vectors were constructed targeting a PKS3, a polyketide synthase gene needed to make a dark
perithecium pigment, and MYO2, a myosin gene. Myosins are calcium regulated molecular
motors that move along actin filaments, transporting membranous structures. Induction of RNAi
during sexual development of strains with the MYO2 construct resulted in severely slowed ascus
growth and altered vesicle trafficking and ascospore delimitation. A transformant containing the
PKS3 construct was found to lack perithecium pigment without doxycycline induction,
suggesting that either transcriptional read-through from upstream sequences or the influence of
an enhancer drove expression of the RNAi construct.
These results indicate the importance of calcium uptake and signaling in the growth and
development of F. graminearum and provide impetus for investigating the roles of other calcium
signaling components. These results also show that doxycycline inducible RNAi can be
effectively utilized in F. graminearum to investigate the function of genes involved in sexual
development.

TABLE OF CONTENTS

LIST OF TABLES

vi

LIST OF FIGURES

vii

CHAPTER 1
LITERATURE REVIEW
Fusarium graminearum- a pathogenic fungus
The Life Cycle of F. graminearum
Forcible spore dispersal and ascus development
Calcium signaling
Myosins
Current research

1
1
4
7
9
15
17

CHAPTER 2
MID1, A MECHANOSENSITIVE CALCIUM ION
CHANNEL, AFFECTS GROWTH, DEVELOPMENT, AND
ASCOSPORE DISCHARGE IN THE FILAMENTOUS
FUNGUS GIBBERELLA ZEAE
Abstract
Introduction
Material and Methods
Results
Discussion
Acknowledgements

19
20
21
23
34
47
51

CHAPTER 3
FIG1, A COMPONENT OF THE LOW AFFINITY CALCIUM
UPTAKE SYSTEM, IS ESSENTIAL FOR PERITHECIUM
DEVELOPMENT AND AFFECTS FILAMENTOUS
GROWTH AND ASEXUAL DEVELOPMENT IN FUSARIUM
GRAMINEARUM
Abstract
Introduction
Material and Methods
Results
Discussion

52
53
54
56
65
74

CHAPTER 4
DEVELOPMENT OF INDUCED RNA INTERFERENCE
VECTORS FOR USE IN FUSARIUM GRAMINEARUM
AND RELATED FILAMENTOUS FUNGI
Abstract

79
80

iv 

Introduction
Material and Methods
Results
Discussion

81
83
99
102

CONCLUSION

106

REFERENCES

108

v 

LIST OF TABLES
Table 1
Strains used in this study

25

Table 2
Primers used in this study

26

Table 3
Strains used in this study

58

Table 4
Primers used in this study

60

Table 5
Strains used in this study

84

Table 6
Primers used in this study

86

vi 

LIST OF FIGURES

Figure 1
Southern analysis of G. zeae Mid1 deletion and complementation strains

35

Figure 2
Growth of G. zeae strains on carrot agar and calcium-limited medium.

36

Figure 3
2+
Effect of Ca ionophore on G. zeae mycelial growth.

37

Figure 4
G. zeae ascospore morphology of mutant Δ2 .

38

Figure 5
2+
Effect of mutation and Ca supplementation on G. zeae ascospore discharge.

39

Figure 6
Characterization of G. zeae growth and development.

40

Figure 7
Electrical properties of the plasma membrane of hyphae from G. zeae
strains PH-1, Δ2 (mid1), T14 (cch1).

44

Figure 8
F. graminearum FIG1 gene models.

68

Figure 9
Growth of Δf1, Δf2, ΔfΔm and ΔfΔmΔc strains on carrot agar, carrot agar
with BAPTA to limit available calcium, and on V8 agar and V8 agar with
2+
Ca ionophore A23187.

70

Figure 10
Characterization of F. graminearum growth and asexual development.

71

vii 

Figure 11
Sexual development in wt and Δf1.

73

Figure 12
Plasmid maps of constructed vectors.

90

Figure 13
Growth rates of wild-type MYO2 RNAi strains.

100

Figure 14
Asci of wild-type and MYO2 RNAi strains with or without doxycycline
treatment.

104

Figure 15
Loss of perithecium pigment in P3-1.

105

Figure 16
Working model of ascospore discharge.

107

viii 

CHAPTER 1

LITERATURE REVIEW

Fusarium graminearum- a pathogenic fungus.
The filamentous ascomycete Fusarium graminearum is a cosmopolitan soilassociated haploid fungus living saprobically on plant debris, and is also a capable
pathogen, infecting numerous plants worldwide (Burgess, 1981). The fungus is also
known as Gibberella zeae due to long term use of early classification of the
vegetative/asexual (anamorph: F. graminearum) and sexual (teleomorph: Gibberella
zeae) stages of development as separate species. The taxonomy and nomenclature of
Fusarium and Gibberella has undergone numerous changes since the first description of
the anamorphic genus Fusisporium by Link (1809) from periods of lumping together or
separating species from each other, resulting in as few as 9 to > 1,000 species over the
years (Summerell and Leslie, 2011). The teleomorphs of Fusarium spp., when known,
are mostly in but not limited to the genus Gibberella (Leslie and Summerell, 2006).
Additionally, it has been known that many Fusaria are plant pathogens since the first
description of the genus of Fusarium (Summerell and Leslie, 2011).
For F. graminearum, the current nomenclature comes from classifications of the
anamorph and teleomorph, respectively, by Schwabe (1839) and Petch (1936). Previous
designations include Fusarium rosea for the anamorph and Sphaeria zeae (1822) and
Dothidea zeae (1832) by Schweinitz, Gibbera saubinetii (Montagne, 1856), and
Gibberella saubinetii (Saccardo, 1879) for the teleomorph. F. graminearum became the

1 

preferred binomial in the 1980s. Later phylogenetic studies support 13 lineages within F.
graminearum, some that could interbreed and others that could not (O'Donnell et al.,
2000; O'Donnell, 2004; Leslie and Summerell, 2006; Starkey, 2007), suggesting that
even this classification may contain multiple species. The most economically significant
hosts of F. graminearum are cereal crops such as wheat, barley, and corn though
infection of rice, wild rice, and other crop and ornamental plants occurs (Chongo et al.,
2001; Lee et al., 2009; Nyvall and Mirocha, 1999; Tomioka et al., 2008).
In North America, F. graminearum is the primary cause of Fusarium Head Blight
of wheat and barley, with the earliest description on wheat occurring in the 1884 (Stack,
2003). Epidemics were documented at the turn of the twentieth century (Atanasoff, 1920;
Pugh and Johann, 1933). By that time, the anamorph and teleomorph were recognized as
a single species (Wollenweber, 1914). Infection of cereals by F. graminearum is variable
in severity and distribution from year to year but has remained a concern through the 20th
and into the 21st century. There was an increase in the distribution and severity of disease
in the early 90s, possibly from the increased application of no-till practices for soil
conservation that leave infected crop litter from harvest on the soil surface (Dill-Macky
and Jones, 2000; Miller et al., 1998; Steinkellner and Langer, 2004; Yi et al., 2001). From
1998-2000 alone, the total loss to infection of crops by F. graminearum in nine
Midwestern states was estimated to be $2.7 billion (Nganje et al., 2001). In addition to
reducing grain size and yield, F. graminearum produces toxins, including zearalenone
and deoxynivalenol, which render the grain inedible for humans and animals.
The United States Department of Agriculture screens harvested grains for both
zearalenone and deoxynivalenol to reduce the levels of each that enter the food supply for

2 

both human and animal consumption. Zearalenone is a nonsteroidal estrogenic mycotoxin
that acts as an agonist to estrogen receptors, resulting in numerous effects on the
reproductive systems of animals (Minervini and Dell’Aquila, 2008). Swine are
particularly sensitive to the toxin, and zearalenone also has an immunomodulatory effect
on swine cellular innate immunity response (Marin et al., 2010). Additionally, short-term
exposure (21 d) of zebrafish to zearalenone at levels relevant to those found in North
American and European rivers from field drainage resulted in reduced fecundity
(Hartmann et al., 2008; Schwartz et al., 2010). Deoxynivalenol (DON) is a trichothecene
mycotoxin that strongly inhibits protein synthesis at the ribosomal level both in vivo and
in vitro and acts as a virulence factor during infection of wheat by F. graminearum
(Desjardins et al., 1996). Consumption of sufficient quantities of DON by animals,
including humans, can lead to digestive tract irritation and ulcers, feed refusal, vomiting,
diarrhea, and weight loss (Bennett and Klich, 2003; Ramakrishna et al., 1989; Dänicke et
al., 2006; Desjardins, 2006; Raghavender and Reddy, 2009; Robbana-Barnat et al., 1987;
Stępień and Chełkowski, 2010; Ueno et al., 1968). As with zearalenone, DON has been
found in environmental samples, including runoff water from fields and discharge from
waste water treatment plants (Bucheli et al, 2008; Wettstein and Bucheli, 2010).
Screening programs certainly reduce the levels of F. graminearum mycotoxins
entering the food supply, but do not address the issues of environmental contamination or
the economic losses suffered by farmers with contaminated grain. Reduction of the
incidence and severity of FHB would address all these issues. One route to accomplish
FHB reduction is to develop our understanding of the biological processes governing the
life cycle of F. graminearum. Of particular interest are the stages crucial for FHB

3 

transmission in order to identify possible control methods, which may be applicable to
other ascomycetous plant pathogens that also utilize forcible discharge to distribute the
primary inoculum of ascospores, including Sclerotinia sclerotiorum and Venturia
inaequalis (Clarkson et al., 2003; MacHardy, 1996).

The life cycle of F. graminearum
The life cycle of F. graminearum can be seen both in the field and in culture with
only slight differences and consists of vegetative hyphae that colonize hosts or substrates
and are capable of undergoing asexual and sexual development. Starting from
germinating asexual (macroconidia) or sexual (ascospores) spores, vegetative hyphae
grow and colonize a substrate or host. Behind the front of growing vegetative hyphae,
older hyphae can generate differentiated phialide-bearing hyphae called conidiophores
that are often but not exclusively aerial and produce macroconidia. The fungus can also
form tightly packed clusters of conidiophores, arising from a hyphal stroma underneath,
called sporodochia that produce copious amounts of macroconidia (Khonga and Sutton,
1988). Macroconidia are released and carried away by wind or water to new substrates or
hosts to start vegetative growth again. F. graminearum also undergoes sexual
development, producing flask shaped perithecia filled with asci containing eight
multicelled ascospores.
The phenotypic course of sexual development of F. graminearum has been
described thoroughly in culture (Trail and Common, 2000) and during colonization of
wheat (Guenther and Trail, 2005). In culture, sexual development is easily induced and
progresses rapidly. Perithecium initials and dikaryotic hyphae with lipid bodies are

4 

present within 24 hours, growing and developing a central hollow cavity with croziers by
three days post induction. Croziers are ascus precursor cells that maintain the dikaryotic
state by an asymmetric and synchronous mitotic division of the two nuclei of the
dikaryon, with septa formation blocking off one nucleus from each division and leaving
the other two in the starting cell. Karyogamy follows and asci are present by the fourth
day, growing upwards. Eight ascospores are produced by meiosis followed by a round of
mitosis. Asci continue to grow towards an opening in the top of the perithecium called
the ostiole and discharge their contents variably around day seven, one ascus at a time.
Around three weeks post induction, fruiting bodies extrude undischarged ascospores and
asci en masse, producing filaments called cirrhi.
Development on wheat proceeds similarly to that in culture, except the fungus can
lie dormant after perithecium initial formation during unfavorable conditions
(overwintering). Following initial colonization, the fungus enters the vascular tissue of
the plant, develops wide binucleate hyphae, and begins storing lipids in numerous lipid
bodies that likely serve as energy stores sexual development after overwintering
(Guenther and Trail, 2005). An examination of gene expression during the course of
sexual development found that lipid biosynthesis gene are upregulated early in
development and that lipid degradation genes are upregulated later in development,
supporting the role of lipid metabolism in sexual development (Guenther et al., 2009).
Once favorable conditions are again present, development resumes and proceeds rapidly.
Germination of ascospores on suitable hosts or substrates returns the fungus to the
vegetative growth stage. Sexual development is associated with host infection and
colonization in the field as perithecia develop on colonized crop debris left after grain

5 

harvesting (Dill-Macky and Salas, 2002; Teich and Nelson, 1984; Windels and
Kommedahl, 1984). There are no reports examining the ability of F. graminearum to
sexually develop on already senesced plant material colonized only after contact with
soil. However, this concept has been stated before (Sutton, 1982). Ascospores of F.
graminearum are believed to be the primary inoculum of FHB, but there is some
uncertainty to this presumption as both ascospores and macroconidia are capable of
causing FHB when inoculated onto wheat spikelets (Sutton, 1982; Mitter et al., 2006).
Support for ascospores being the primary inoculum of FHB comes from several
lines of research. While surveys of airborne fungal spores find both ascospores and
macroconidia, they consistently find considerably more ascospores, though macroconidia
levels are sometimes equivalent or greater than ascospore levels (Fernando et al., 2000;
Inch et al., 2005; Markell and Francl, 2003). A number of phylogenetic studies from
around the world characterizing field isolates each showed high genetic diversity among
the isolates, little to no linkage disequilibrium between genetic markers, and almost as
many haplotypes as isolates, suggesting a high rate of recombination and thus sexual
reproduction in the field (Karugia et al., 2009; Tóth et al., 2005; Walker et al., 2001;
Ward et al., 2008, Zeller et al., 2003). Those studies examining the same sites over
numerous years found the allelic frequencies in the local populations are stable through
the course of the studies, which was interpreted as the local population being part of a
larger panmictic population. Desjardins et al (2006) found that ascospore non-producing
strains of F. graminearum were significantly less able to cause FHB epidemics and DON
accumulation in grain than wild-type ascospore producing strains with the source of
inoculum being pieces of colonized corn placed on the ground. The ascospore non-

6 

producing strains (hygromycin resistant) were isolated from ten-fold fewer infected
kernels than complemented ascospore producing strains (hygromycin and geneticin
resistant). Markell and Francl (2003) examined the adherence of both spore types to
wheat by inoculating plants with known numbers of spores followed by washing them off
with water from 30m to 24 hr post inoculation and found that significantly fewer
ascospores than macroconidia were washed off at all time points. Considered together,
these results provide good support for F. graminearum ascospores being the primary
inoculum of FHB and suggest that developing ways to stop or reduced ascospore
discharge could provide significant reduction of the incidence and severity of the disease.
In order to do so, we need to understand the biological processes involved in sexual
development and ascospore discharge.

Forcible spore dispersal and ascus development
The ability of fungi to discharge spores has been long associated with airborne
spores of plant disease agents (Coons, 1918; Plowright, 1880). The buildup and release of
turgor pressure had originally been hypothesized as driving ascospore discharge and the
launching of zygomycete copriphilous fungus Pilobolus spp. sporangia. Pfeffer (1858)
described a case of ascospore discharge in which one ascospore is discharged at a time
through an apical pore in the ascus, another ascospore then blocks the pore, and turgor
pressure builds until discharge occurs again. De Bary (1887) discusses the ascospore
discharge of numerous species, integrating original research with the previous work of
others, and emphasizes the swelling of asci as they mature, the buildup of turgor pressure
within asci, and the likeliness that osmolytes within asci drive an influx of water to

7 

generate the pressure needed for discharge. The simultaneous ascospore discharge of
numerous asci caused by a physical disturbance, called puffing, by cup fungi in Peziza
and the discharge of ascospores by Ascobolus immersus, a dung inhabiting fungus, was
described by Buller (1909). Buller also discussed the physics involved in dividing the
initial jet of discharged Peziza periplasmic fluid and ascospores into individual projectiles
that can be carried away by wind and in allowing the large Ascobolus ascospores held
together by mucilage to travel farther as a group than if they were separate and thus land
on fresh plants for grazing herbivores to consume.
Through the 20th century, research consisted mainly of observational and
descriptive studies of ascus development and ascospore discharge by numerous species
and the environmental conditions that promote discharge (Chrismas, 1980; Gregory and
Stedman, 1958; Jones, 1926; Lortie and Kuntz, 1963; Tschanz et al., 1976). However, a
few studies by Ingold investigated the pressures obtained within asci for discharge. The
osmotic pressure in mature asci of Ascobolus stercorarius (Ingold, 1939) and Sordaria
fimicola (Ingold, 1966) were estimated to be between 1.0- 1.3 MPa and 1.0-3.0 mPA as
assessed by incipient plasmolysis analysis and freezing point measurements of diluted
ascus periplasmic fluid, respectively. Ingold (1939, 1966, 1971) offered that breakdown
products of glycogen, sugars, and ions may serve as osmolytes in asci.
Although few researchers have tackled the ascospore discharge problem since
Debary, the dramatic technical advances in biological research over the last forty years
has facilitated other research into numerous biological processes in fungi, and the genes
and proteins involved in them, that have shown connections to fungal growth and sexual
development, influencing the initiation of more recent studies on ascospore discharge.

8 

Measurement of the turgor pressure in Ascobolus immersus asci by pressure microprobe
found an average pressure of 0.31 MPa and detected glycerol in ascus periplasmic fluid
(Fischer et al., 2004). Pharmacological chemicals were screened for inhibition of F.
+

graminearum ascospore discharge. Several K channel blockers inhibited ascospore
discharge up to 50%, and two L-type calcium channel blockers, verapamil and TMB8,
showed almost complete inhibition of discharge (Trail et al., 2002). High calcium
concentrations have been observed in the tips of cells undergoing polarized growth in
fungi (Levina et al. 1995) and may be present in ascus tips as they elongate. A
biomechanical study of F. graminearum ascospore discharge estimated that 1.54 MPa of
pressure was needed to achieve the launch acceleration of 970,000 g and the trajectory
+

characteristics observed. Analysis of periplasmic fluid from asci showed that [K ] and
-

2+

[Cl ] generated turgor pressure close to the estimate needed for discharge and that [Ca ]
was below detection, suggesting a role in signaling (Trail et al., 2005).

Calcium signaling
Calcium was well known to play a structural role in bones and teeth during the
18th century, but its role as a signaling messenger were not known until hinted at in a
series of discoveries in the late 18th century. Ringer (1883a; 1883b) first noticed that frog
hearts were able to continue beating when placed in tap water but stopped beating shortly
after being placed in distilled water. Only when a calcium salt was added to the distilled
water were the frog hearts able to keep beating. This was shortly followed by work
showing that calcium was needed for frog hind leg muscle contraction, to prevent cells of

9 

the brown alga Laminaria from bursting when placed in otherwise distilled water, for
frog egg development, and for survival of the aquatic worm Tubifex, again in otherwise
distilled water (Ringer, 1886, 1890; Ringer and Sainsbury, 1894). Although calcium
signaling research did not progress until the 1950s, these initial results were rediscovered,
and the known roles of calcium in cells have greatly expanded.
Calcium is a ubiquitous messenger in eukaryotic cells, acting both directly and
indirectly to modulate protein activity, gene transcription, energy metabolism, endo- and
exocytosis, and many other cellular processes (Berridge et al., 2003; Carafoli, 2005;
Michalak et al., 2002). Calcium is normally abundant in many environments and shows a
propensity for forming insoluble salts with inorganic and organic anions and also binds
with complex macromolecules such as proteins (Carafoli, 2005; Carafoli, 2007;
Williams, 2006). These properties likely made calcium toxic to early life and necessitated
a system to maintain low cytosolic levels of calcium, setting up calcium to be an
excellent messenger with the appearance of internally compartmentalized eukaryotes and
the need for fast communication between compartments (Williams, 2006; 2007). The
duality of calcium being integral to eukaryotic cell function yet also toxic is still seen
today. Prolonged elevation of cytosolic calcium disrupts cellular processes often leading
to cell death, and calcium is involved in both apoptotic and non-apoptotic programmed
cell death and (Demaurex and Distelhorst, 2003; Dorn, 2009; Mattson and Chan, 2003).
Generally, low cytosolic calcium levels are maintained by the coordination of
calcium influx and efflux through the plasma membrane and sequestration to and release
from intracellular stores such as the endoplasmic reticulum (Berridge et al., 2003;
Williams, 2007). Calcium diffusion in the cytosol is typically slow because proteins

10 

quickly bind free calcium, some acting purely as calcium buffers and others as calcium
signaling sensors (Allbritton et al., 1992; Biess et al., 2011). The buffering capacity of the
cytosol is finite however. In response to stimuli, plasma membrane influx and
intracellular stores release can generate local calcium gradients, or microdomains, that
can be propagated as cytosol-wide or cytosol transversing calcium signals (Berridge et
al., 2003; Laude and Simpson, 2009). Generally, calcium signals can be grouped into
three classes: oscillations, sustained, and transient signals (Uhlén and Fritz, 2010). A
number of calcium binding protein domains have evolved in eukaryotes, including the
EF-hand, the annexin fold, and the C-2 domain. In particular, the EF-hand domain first
found by Kretsinger and Nockolds (1973) in the protein parvalbumin from fish muscle is
now known to be part of numerous proteins throughout eukaryotes (Carafoli, 2007). The
binding of calcium by sensor proteins can elicit functional changes in the sensors and
even interacting proteins. For example, calmodulin is a calcium sensor highly conserved
in eukaryotes, containing four EF-hand domains, that undergoes a conformational change
upon binding calcium. Calmodulin can then bind to and activate the protein phosphatase
calcineurin by displacing an autoinhibitory domain from the calcineurin active site
(Sagoo et al. 1996). The response of the cells to calcium signals is dependent on the
spatial, temporal, and intensity qualities of the signal in addition to cell type and the
current stage of the cell and life cycles (Berridge, 2007; Brenner et al., 2007).
While calcium signaling is used in many processes and can originate from both
intra- and extracellular stimuli, there is a general scheme that occurs. A calcium signal
starts with the detection of a stimulus often by receptor proteins that then interact either
directly or indirectly with a calcium channel or pump (Hille, 1994). The interaction turns

11 

on the calcium channel starting a calcium flux that generates the signal. The calcium ions
are bound by sensor proteins that decode the signal by interaction with their target(s).
Calmodulin is currently unique among calcium sensors in that it is known to interact with
hundreds of proteins while other sensors interact with a few or even only one other
protein (Carafoli et al., 2001). As the targets of calcium sensors perform their functions,
creating the cellular response to the stimulus, the need for response to the stimulus is no
longer necessary and feedback inhibition to the calcium channel stops the calcium flux
(Armstrong, 1989). Finally, calcium is transported out of the cell or into internal stores to
return the cytosolic calcium concentration back to its starting state.
Calcium signaling is ancient as evidenced by the fact that all eukaryotes utilize it.
However, there is considerable evolutionary malleability to calcium signaling with only a
few components highly conserved in all eukaryotes examined. More commonly, the
conservation is scattered throughout the groups with each component displaying a
2+

different pattern. For instance, homologs to mammalian plasma membrane Ca -ATPase
2+

efflux pumps (PMCA), including mammalian sarcoplasmic reticulum Ca -ATPase
pumps (SERCA), are found in all eukaryotes but in vascular land plants (gymnosperms
and angiosperms) only an ortholog of the SERCA pump is present and the plasma
2+

membrane efflux pump is a non-homologous plant autoinhibited Ca -ATPase pump
(Connorton et al., 2011).
An important aspect of calcium signaling and homeostasis is the controlled
importation of calcium into cells through the plasma membrane. In fungi, two types of
calcium uptake are known – a high affinity calcium uptake system (HACS) and a low

12 

affinity calcium uptake system. FIG1 encodes a transmembrane protein of the low
affinity calcium uptake system in S. cerevisiae (Muller et al., 2008) and another
ascomycete yeast Candida albicans (Brand et al., 2007) but is lacking in the current
assembly of the F. graminearum genome sequence. The HACS is composed of at least
the calcium channels Cch1 and Mid1. In S. cervisiae, both mid1 and cch1 mutants died
after exposure to mating pheromone (Iida et al., 1994; Fischer et al., 1997). Calcium
uptake was significantly reduced in both single and double mutants. Growth in calciumsupplemented medium rescued the mutant phenotypes. Cch1 and Mid1 were found to
coimmunoprecipitate, suggesting they form one complex, but mutants of the two
channels differentially responded to some stimuli, suggesting both cooperative and
individual function (Courchesne and Ozturk, 2003; Tokes-Fuzesi et al., 2002). HACS has
been shown to respond to a number of stimuli such as exposure to mating pheromone,
heat shock and cold stress, ionic stress, and mechanical stretching (Matsumoto et al.,
2002; Peiter et al., 2005; Watts et al., 1998; Zhao et al., 1998).
In F. graminearum, Δcch1 mutants have been characterized (Hallen and Trail,
2008). These mutants displayed lower growth vigor, delayed sexual development, and
significantly reduced ascospore discharge. The vegetative mycelium was distinctively
fluffy and grew at ~50% the rate of the wild-type strain. Sexual development proceeded
to completion but was delayed approximately 24 h. The Δcch1 mutants failed to grow on
medium with low calcium availability. Addition of exogenous calcium restores the wild2+

type phenotype. These results suggest that Cch1 is needed for proper import of Ca
during all stages of growth, that calcium signaling may be involved in ascospore
discharge, and that the other HACS component Mid1 may also be involved.

13 

The S. cerevisiae Mid1 protein is an N-glycosylated stretch-activated calcium
permeable ion channel (Iida et al., 1994; Maruoka et al., 2002). Parts of the C-terminus
are required for proper localization and function (Ozeki-Miyawaki et al., 2005). Mid1
was found to localize to both the endoplasmic reticulum and cellular membranes, leading
to the possibility of Mid1 having a function in both calcium entry into a cell and in
intracellular sequestration and release of calcium. The presence of Mid1 homodimers,
and computational structural analysis suggesting homotetramer formation, support earlier
hypotheses that Mid1 may form its own channel (Yoshimura et al., 2003). When
heterologously expressed in mammalian cells, Mid1 mediated a stretch-activated influx
of calcium, but it was not determined whether Mid1 was modulating the activity of an
endogenous channel or forming a channel itself (Kanzaki et al., 1999). In the nonpathogenic filamentous ascomycete Neurospora crassa, which also forcibly discharges
ascospores, a mid1 mutant displayed reduced vigor, reduced conidiation, lower hyphal
turgor pressure, and lower membrane potential (Lew et al., 2008). Unlike S. cerevisiae,
addition of calcium to culture medium did not restore the wild-type phenotype. The mid1
mutants successfully mated and produced viable ascospores.  
LACS is minimally composed of the Fig1 membrane protein, a PMP22_Claudin
superfamily member, and is involved in calcium influx and membrane fusion during mating of S.
cerevisiae and Candida albicans (Muller et al. 2003; Yang et al., 2011), mating projection
development and cell wall degradation at the fusion site of appressed shmoos, haploid yeast cells
with a mating projection, in S. cerevisiae (Erdman et al., 1998), and thigmotropism and
repression of hyphal growth in C. albicans (Brand et al., 2007). Mammalian PMP22_Claudin
superfamily members are involved in membrane-membrane interactions such as epithelial tight

14 

junction formation and signal transduction such as ion flux (Matter and Balda, 2003; Tsukita et
al., 1999). The fungal members show little overall sequence identity with the mammalian
orthologs but most have similar secondary structure and topology including cytoplasmic N- and
C- termini, four transmembrane domains, two extracellular and one intracellular loops, and a
conserved GΦΦGXC(n)C motif (Φ = F, L, M, or Y hydrophobic residues, n = 8 > n > 20 amino
acids) in the first extracellular loop (Brand et al., 2007; Erdman et al., 1998; Zhang et al., 2006).
There have been no reports on the function of Fig1 in filamentous fungi.

Myosins
Myosins are eukaryotic molecular motors that can bind and move along actin
filaments. Myosins are known to be involved in many motility processes, including
amoeboid movement, the elongation of pollen germ tubes in plants, and muscle
contraction (Franca-Koh et al., 2006; Krichevsky et al., 2007; Craig and Woodhead,
2006), and can be either activated or deactivated by calcium signaling (Krementsov et al.,
2004). Myosins are a large and diverse family of proteins that has been expanded recently
from 15 to 18 and then to 35 classes as scientists have found new classes. (Odronitz and
Kollmar, 2007; Richards and Cavalier-Smith, 2005; Sellers, 200). Myosins consist of
three domains: the head, neck, and tail (Bement and Mooseker, 1995). The head domain
is conserved in all functional myosins and is the motor, containing an ATP modulated
actin binding site and ATPase domain. The neck domain binds myosin light chains,
regulatory proteins that increase myosin movement rates (Lowey et al., 1993; Watanabe
et al., 2007). The tail domain is highly variable between myosin classes being composed
of different combinations of domains, including dimerization, protein interaction and

15 

membrane binding domains, though some myosins have no recognizable tail (Richards
and Cavalier-Smith, 2005). Some myosins also bind actin in an ATP independent manner
in the tail region, allowing the cross-linking of actin filaments (Fujisaki et al. 1985; Jung
and Hammer, 1994; Rosenfeld and Renert, 1994). Some myosin tails are known to bind
to membranes and are involved in endo- and exocytosis and vesicle transport (Desnos et
al., 2007; Satoh et al., 2008) and sliding of plasma membranes across the cytoskeletal
cortex (McConnell and Tyska, 2007).
In yeast and filamentous fungi, myosins were found to be required for polarized
growth and secretion (McGoldrick et al., 1995; Woo et al., 2003; Schuchardt et al.,
2005). Calmodulin was found to regulate both myosins and the actin cytoskeleton in S.
cerevisiae (Cyert, 2001; Desrivières et al., 2002). Studies of ascus development in
numerous species have described extensive actin cytoskeleton remodeling and membrane
dynamics with actin and myosins being involved in the transition of croziers to asci,
karyogamy and subsequent meiotic and mitotic divisions, migration and separation of
spindle pole bodies, fungal equivalents of centrioles, and ascospore spore delimitation
with a double-membrane layer derived from invaginations of a double membrane near the
ascus plasma membrane, generating vesicles that migrate to the developing ascospores
(Beckett and Crawford, 1973; Czymmek and Klomparens, 1992; Hackett and Chen,
1976; Healy, 2003; Raju, 2008; Read and Beckett, 1996; Thompson-Coffe and Zickler,
1993; Wu and Kimbrough, 2001).
Myosins may also be involved in the growth of asci by moving along actin
polymers while attached to the ascus membrane, stretching the membrane, or while
attached to transport vesicles carrying material and enzymes to the ascus tip. It is

16 

conceivable that myosins may play roles in retention or firing mechanisms by generating
tension along actin filaments anchored to the plasma membrane or other structures or by
crosslinking actin filaments. There are three annotated myosins within the F.
graminearum genome, MYOI, MYOII, and MYO2. Deletion of F. graminearum MYOI, a
type I myosin, resulted in sickly mutants with severely reduced filamentous growth that
failed to undergo sexual development, and deletion of MYOII, a type II myosin, was
attempted several times but was not obtained, suggesting that MYOII is an essential gene
(Trail, unpublished results). Deletion of MYO2, a type V myosin, has not been
attempted.

Current research
In the following chapters, I present my investigations on the role of MID1 and
FIG1 in the growth and sexual development of F. graminearum and the development of a
doxycycline inducible RNAi system, and utilizing it to study the role of MYO2, a myosin,
in ascus development. Given that deletion of F. graminearum CCH1 resulted in reduced
growth, conidiation, and ascospore discharge, that MID1 is also a component of HACS,
and that Δcch1 and Δmid1 mutants of S. cerevisiae have nearly identical phenotypes, it
seemed likely that MID1 would also play a role in the same processes. If MID1 plays a
role in calcium signaling, growth, and development of F. graminearum, then MID1
deletion will result in phenotypes similar to the Δcch1 mutants. The results of the
experiments designed to test that hypothesis showed that there was another route of
calcium entry even in mutants lacking Mid1 and Cch1 as addition of exogenous calcium
partially restored most of the observed phenotypes. Since LACS is the only other calcium

17 

entry route in fungi, LACS is involved in sexual development of S. cerevisiae and C.
albicans, and Fig1 is the only known component of LACS, Fig1 was hypothesized to
mediate the calcium entry in the Δmid1 Δcch1 double mutants and play a role in sexual
development. If Fig1 plays a role in F. graminearum sexual development and the
importation of calcium seen in Δmid1 Δcch1 mutants, then deletion of FIG1 will result in
altered sexual development and the abolishment of the ability of calcium supplementation
to rescue the Δmid1 Δcch1 double mutants in a Δfig1 Δmid1 Δcch1 triple mutant.
Because the loss of essential genes is lethal and the loss of genes essential for sexual
development prevent or halt sexual development, the adaptation of a doxycycline
inducible RNAi system effective in another filamentous ascomycete for use in F.
graminearum was thought to both feasible and a possible way to investigate genes
essential for sexual development during sexual development. Because myosins are
involved in sexual development, MYO2 was targeting for doxycycline induced RNAi. If
doxycycline induced RNAi is effective in F. graminearum and MYO2 is involved in
ascus development, then MYO2 expression will be reduced when RNAi is induced and
the normal development of asci and ascospores will be altered.

18 

CHAPTER 2

MID1, A MECHANOSENSITIVE CALCIUM ION CHANNEL, AFFECTS GROWTH,
DEVELOPMENT, AND ASCOSPORE DISCHARGE IN THE FILAMENTOUS FUNGUS
GIBBERELLA ZEAE

1

2

2

Brad Cavinder, Ahmed Hamam, Roger R. Lew, and Frances Trail

3,4

1

Genetics Graduate Program, Michigan State University, East Lansing, Michigan, 48824-43201 ;
Department of Biology, York University, 4700 Keele Street, Toronto, Ontario M3J 1P3,
Canada2; and Department of Plant Biology3 and Department of Plant Pathology,4 Michigan
State University, East Lansing, Michigan 48824-1312

I performed all the work of this chapter in the Trail lab except the electrophysiology experiments
that our collaborators Ahmed Hamam and Roger R. Lew carried out.

This chapter was published in Eukaryotic Cell Vol 10:832-842, 2011.

19 

ABSTRACT

The role of Mid1, a stretch-activated calcium permeable ion channel, in ascospore
development and forcible discharge from asci, was examined in the pathogenic fungus,
Gibberella zeae (anamorph Fusarium graminearum). The Δmid1 mutants exhibited >12-fold
reduction in ascospore discharge activity and produced predominately abnormal two-celled
ascospores with constricted and fragile septa. The vegetative growth rate of the mutants was
~50% of the wild-type rate, and production of macroconidia was >10-fold lower than in wildtype. To better understand the role of calcium flux, Δmid1 Δcch1 double mutants were also
examined, as Cch1, an L-type calcium ion channel, is associated with Mid1 in yeast. The
phenotype of the Δmid1 Δcch1 double mutants was similar, but more severe than in the Δmid1
mutants for all categories. Potential and current voltage measurements were taken in the
vegetative hyphae of the Δmid1 and Δcch1 mutants and wild-type, and both measurements were
remarkably similar in all three strains, indicating that neither protein contributes significantly to
the overall electrical properties of the plasma membrane. Pathogenicity of the Δmid1 and
Δmid1Δcch1 mutants on the host, wheat, was not affected by the mutations. Exogenous calcium
supplementation partially restored the ascospore discharge and vegetative growth defects for all
mutants, but abnormal ascospores were still produced. These results extend the known roles of
Mid1 to ascospore development and forcible discharge. However, Neurospora crassa Δmid1
mutants were also examined and did not exhibit defects in ascospore development nor in
ascospore discharge. In comparison to other ascomycetes, Mid1 shows remarkable adaptability
of roles, particularly with regard to niche-specific adaptation.

20 

Introduction
The majority of fungal spores are nonmotile, driving evolutionary creativity for other
means of dispersal. In the Ascomycota, asci function predominantly as water cannons that
forcibly discharge ascospores into the air. The buildup and release of turgor pressure within asci
has long been hypothesized as driving ascospore discharge, with the first such reference by
DeBary (1887), yet the mechanism of ascus function has never been elucidated in any fungus. In
+

Gibberella zeae, pharmacological screens showed that K channel and L-type calcium channel
blockers inhibit discharge (Trail et al., 2002). Analysis of periplasmic fluid from discharging asci
+

-

revealed that accumulation of K and Cl would generate turgor pressure close to that necessary
for discharge, with Ca

2+

below detectable levels (Trail et al., 2005; Trail, unpublished results).

These results suggest that potassium functions as the osmoticum and calcium plays an essential
role in signaling ascospore discharge. Calcium signaling can result in rapid cellular responses
such as cell motility and contractile events, or more paced responses, such as shifts in gene
expression, and cell division (Berridge et al., 2003; Clapham, 2007).
In fungi, two types of calcium uptake are known – a high affinity calcium uptake system
(HACS) and a low affinity calcium uptake system (LACS). Initially characterized in
Saccharomyces cerevisiae, the HACS is composed minimally of Cch1, an L-type voltage gated
calcium channel, and Mid1, a stretch-activated non-selective calcium permeable channel, acting
as the major calcium entry route when calcium availability is low (Iida et al., 1994; Fischer et al.,
1997; Paidhungat & Garrett, 1997); whereas, the LACS is composed minimally of Fig1, a
transmembrane calcium channel or regulatory protein, and is the primary calcium entry route
during high calcium availability (Muller et al., 2001; Muller et al., 2003). Mid1 and Cch1 have

21 

been shown to be involved in calcium uptake from the environment for homeostasis and
signaling. In calcium limited medium, calcium uptake was significantly reduced and death of
MATa cells followed formation of shmoos upon exposure to α-factor in single mutants of each of
these genes; double mutants behaved similarly. In mammalian cells, heterologous expression of
2+

ScMid1 resulted in stretch-activated influx of Ca . Whether the influx arose from direct
formation of Mid1 channels or from regulatory modulation of an endogenous channel is still
unclear as is whether Mid1 forms a channel, serves in a regulatory capacity, or both
endogenously in fungi (Kanzaki et al., 1999; Locke et al., 2000; Tada et al., 2003).
In filamentous fungi, published investigations to date report only on MID1 and CCH1 of
the HACS, with the LACS components uncharacterized. In the filamentous ascomycete
Neurospora crassa, Δmid1 mutants displayed reduced vigor, reduced conidiation, lower hyphal
turgor pressure, and lower membrane potential (Lew et al., 2008). Unlike Δmid1 mutants of S.
cerevisiae, addition of calcium to culture medium does not restore the wild-type phenotype to N.
crassa Δmid1 mutants. However, N. crassa Δmid1 mutants successfully mate and produce viable
ascospores. In G. zeae, Δcch1 mutants displayed less vigorous hyphal growth, delayed sexual
development, and significantly reduced ascospore discharge (Hallen and Trail, 2008).
Application of exogenous calcium to Δcch1 mutants restored the wild-type phenotype. In
particular, addition of calcium to cultures of Δcch1 mutants with mature perithecia rescued
ascospore discharge, supporting a role for calcium signaling directly in the discharge mechanism.
To further the understanding of the role of the HACS in growth and development of G. zeae, we
report the generation Δmid1 and Δmid1 Δcch1 double mutants, and characterize the mutant
phenotypes through a series of culture based assays, electrophysiology experiments, and a
pathogenicity assay on the host, wheat. Additionally, the ability of N. crassa Δmid1 mutants to

22 

forcibly discharge ascospores was not assessed in the Lew et al. (2008) study, so we also monitor
the sexual development and ability to discharge ascospores in reciprocal crosses of these mutants
to assess whether the role of HACS in forcible ascospore discharge is conserved between G. zeae
and N. crassa.

Materials and Methods
Strains, culture conditions
All strains used in this study are listed in Table 1. N. crassa strains were obtained from
the Fungal Genetics Stock Center (FGSC) and stored at -20°C. G. zeae strains were maintained
6

8

on sterile soil at -20°C and as macroconidia stocks (10 -10 conidia/ml) in 35% glycerol at 80°C. Macroconidia were produced in carboxymethylcellulose (CMC) liquid media as
previously described (Cappellini and Peterson, 1965). For G. zeae, perithecia were induced in
culture on carrot agar as previously detailed (Bowden and Leslie, 1999; Trail and Common,
2000). Briefly, strains were center inoculated on carrot agar, and cultures were incubated at room
temperature (RT) under continuous fluorescent lighting. As mycelia reached the edge of the
plates, it was gently removed from the surface, 1 ml of a 2.5% Tween 60 solution was spread
across the surface, and the incubation was continued.

Sexual crosses
G. zeae is homothallic but can outcross. Crosses were initiated by the mycelial plug method.
Along the interface between strains, cirrhi (masses of exuded ascospores) were isolated from
individual perithecia and suspended in 200 µl of sterile deionized water (diH2O) by vortexing.

23 

Aliquots of the ascospore suspension (80 µl) were spread across the surface of minimal medium
supplemented with tergitol and L(-)sorbose (MMTS) (Bowden and Leslie, 1999). Growth of
-

non-nitrate-utilizing mutants (nit ) is sparse on MMTS and easily distinguished from wild-type.
+

-

As a result, recombinant cirrhi contained both wild-type nitrate-utilizing (nit ) and nit mutant
progeny and were easy to distinguish from cirrhi from homozygous perithecia. After 3-5 days of
growth at RT, colonies from plates containing recombinant cirrhi were individually transferred to
V8 agar to maintain the culture and also to Czapek-Dox agar (Thom and Church, 1926) for
confirmation of nit phenotype before subsequent analysis. For the Δmid1 x PH-1 55 crosses, only
-

+

nit colonies were harvested. Nit colonies were selected from the mn-11 x Δcch1-T14 crosses.
N. crassa crosses were performed by inoculating single strains of opposite mating type
onto synthetic crossing medium (Davis and de Serres, 1970) and maintaining under continuous
fluorescent lighting. Seven days post-inoculation, macro- and microconidia were washed from
the medium and transferred to the culture of the opposite mating type where both conidial types
function as spermatia to fertilize protoperithecia (Dodge, 1935; Bistis, 1981). Crosses were
maintained under continuous fluorescent lighting at RT during perithecial development.

DNA constructs and genetic transformation
DNA was isolated from G. zeae and N. crassa mycelia using a
hexadecyltrimethylammonium bromide (CTAB) method as previously described (Hallen and
Trail 2008), modified by treatment with proteinase K (final concentration 2.0 mg/ml) for 1-2 hr
at ≤ 65°C or overnight at 37°C following the RNase digestion after the first precipitation and
resuspension.

24 

TABLE 1. Strains used in this study
Genotype
Abbreviation used

Strain
Gibberella zeae
PH-1
PH-1 55
M- Δ2
M- Δ12
M-E1
M-C1
M-C2
Δcch 1 −Τ11
mn-11
MC-4

wild-type (FGSC 9075; NRRL 31084)
nit1
Δmid1
Δmid1
Ectopic insertion of MID1 disruption construct
Δmid1 complement (M- Δ2)
Δmid1 complement (M- Δ2)
Δcch 1
Δmid1 nit1 (M- Δ2 x PH-1 55)
Δmid1 Δcch1 (mn-11 x Δcch1 -T11)

wt
PH-1 55
Δ2
Δ12
E1
C1
C2
Τ11
mn-11
ΔmΔc

Source
Trail and Common, 2000
a

H. C. Kistler
This Study
This Study
This Study
This Study
This Study
Hallen and Trail, 2008
This Study
This Study

Neurospora crassa
FGSC 2489

wild-type, A mating type

Colot et al., 2006

FGSC 4200

wild-type, a mating type

Colot et al., 2006

FGSC 11708 Δmid1 , A mating type
FGSC 11709 Δmid1 , a mating type
a
b

Colot et al., 2006
Colot et al., 2006

USDA-ARS, University of Minnesota
Directly received from the Fungal Genetics Stock Center

25 

b
b
b
b

TABLE 2. Primers used in this study
Sequence (5'-3')

Name
For replacement of the G. zeaeMID1 locus
CTTTGGAACGTCATGAGAACACGTTTCG
Mid1 L5
TATTCAGGCGTAGCAACCAGGCGTGCTTAGTACGGCTTCGATCTAGC
Mid1 L3
ATCTTTTACTTTCACCAGCGTTGGGATGTGCTTCTTGGGTATGTTTG
Mid1 R5
CTGTAGTCTCAGTTCTATCGCACATTCAC
Mid1 R3
AACTTCCGTCGAGCAGAGTCTAAGAC
Mid1 checkF
GTTGGCATACATCTTTCTGGCGTAGTC
Mid1 checkR
GCCGTACTAAGCACGCCTGGTTGCTACGCCTGAATAAGTG
HygF for M1
CACATCCCAACGCTGGTGAAAGTAAAAGATGCTGAAGATC
HygR for M1
AGTACTTCTACACAGCCATCGGTCCAGACG
3’ 1/2 HygF
CTGCTGCTTGGTGCACGATAACTTGGTGC
5’ 1/2 HygR

Contig

Coordinates

supercontig_3.4
supercontig_3.4
supercontig_3.4
supercontig_3.4
supercontig_3.4
supercontig_3.4
-

3454860-3454833
3454173-3454197
3452227-3452202
3451691-3451719
3453746-3453721
3452775-3452801
-

For complementation of G. zeae Δmid1 mutants
ATGCTGCACGGTTTGAAGGTGGATGA
Mid1 compF
AGGCCCTGTAAGTTAAATGGGTTGCTAAC
Mid1 compR
ATGGAACTGACGGGACGTTAAGGTACC
Nit1 F
CTCACCTGTGTACGACAGGAGCAGA
Nit1 R
CAGCAGTTGACCTATCCAGTTACATTCG
3’ 1/2 Nit1F
TTGACCAGCTGCACCAAAGATAGATG
5’ 1/2 Nit1R

supercontig_3.4
supercontig_3.4
supercontig_3.1
supercontig_3.1
supercontig_3.1
supercontig_3.1

3455042-3455017
3451300-3451328
6384100-6384074
6379737-6379760
6382391-6382418
6381114-6381139

For probe generation
CTCAATCTCCTGCGAAGTGGAATGAG
Cch1 probeF
GCAGACAAGGGACTAATAATCGCCAAC
Cch1 probeR

supercontig_3.1
supercontig_3.1

4488045-4488020
4487335-4487308

For confirmation of N. crassa MID1 locus presence or absence
GTCCTTTATCGCATTATCTCTTCTCGTCG
NcM1-F

contig 7.31

26 

109555-109527

All G. zeae nucleotide data was obtained from http://mips.helmholtzmuenchen.de/genre/proj/FGDB/. Unless otherwise noted, PCR amplifications used PH-1 gDNA
as the template. Primers used in this study are listed in Table 2. For targeted gene replacement
constructs, a split marker protocol was performed (Catlett et al., 2003; Fairhead et al., 1996;
Fairhead et al., 1998). Primers were designed to amplify a 687 bp (supercontig_3.4: 34548583454172) and a 536 bp (supercontig_3.4: 3452227-3451692) region upstream (L) and
downstream (R), respectively, of the coding sequence of MID1 using primers Mid1 L5 & L3 and
Mid1 R5 & R3. Primers closest to MID1 coding sequence, Mid1 L3 and R5, have 5’ tails of 24
and 22 bases complementary to the 5’ and 3’ ends of the hygromycin resistance marker from
pCB1004 (Carroll et al. 1994), which encodes hygromycin phosphotransferase (hph) and allows
for selection of transformants with hygromycin B (HygB). For split hph, a 1.4 KB 5’ fragment
and a 1.2 KB 3’ fragment of hph overlapping each other by 800 bp was amplified from using
primers HygF for M1 & 5’ 1/2 HygR and 3’ 1/2 HygF & HygR for M1, respectively. Primers
HygF for M1 and HygR for M1 contain 5’ tails of 13 and 8 bases complementary to the 3’ and 5’
ends of the MID1 L and R fragments, respectively. The 5’ hph fragment was merged with the
amplified L flank, and the 3’ hph fragment was merged with the R flanking region by PCR. Both
merged products were transformed into G. zeae. Thus, successful replacement of the MID1 gene
required two recombination events for each construct to integrate into the MID1 locus and a third
recombination between the constructs to create a functional hph marker.
For complementation of the mid1 mutants, a 3741 bp fragment of the MID1 locus,
spanning 906 bp upstream to 927 bp downstream of the MID1 coding sequence
(supercontig_3.4: 3455040-3451301), was generated by PCR using primers Mid1 compF and
compR. Split NIT1 constructs were generated by PCR amplification of 2987 bp

27 

(supercontig_3.1: 6383925-6380938) and 2478 bp (supercontig_3.1: 6382215-6379737)
fragments that overlap by 1278 bp, using primers Nit1 F & 5’ 1/2 Nit1R and 3’ 1/2 Nit1F & Nit1
R, respectively. All three amplicons were used simultaneously to cotransform mn-11 protoplasts.
Genetic transformation of G. zeae protoplasts was polyethylene glycol-mediated as
previously described (Gaffoor et al., 2005). Following transformation for gene replacement,
protoplasts recovered on regeneration medium for 15 hr followed by an overlay of regeneration
medium containing 150 μg/ml HygB. Putative transformants were selected for growth through
the overlay and were transferred to V8 agar containing 450 μg/ml HygB. Following the
complementation cotransformation, protoplasts recovered on Czapek-Dox agar adjusted to 0.79
M sucrose for 15 hr, and were then overlaid with standard Czapek-Dox agar. Colonies growing
vigorously on the overlay were transferred individually to Czapek-Dox agar to confirm the nit

+

phenotype. All putative transformants were regenerated from single spores to obtain pure genetic
cultures as previously described (Hallen and Trail, 2008) and were then transferred to V8 agar
for subsequent phenotype analysis.
Southern hybridization was performed as previously described using standard molecular
techniques (Gaffoor et al., 2005; Sambrook and Russell, 2001). Genomic DNA was digested to
completion with PvuI and was resolved by electrophoresis in Tris-acetate-EDTA. DNA was
transferred to Nytran Supercharge nylon membrane (Schleicher and Schuell Bioscience, Keene,
New Hampshire). Three probes were generated by PCR. The MID1 L (Left flank) fragment, a
1.2 kb hph fragment amplified using primers 3’ 1/2 HygF and 5’ 1/2 HygR, and a 738 bp internal
CCH1 fragment (supercontig_3.1: 4488045-4497308) using primers Cch1 probeF and Cch1
32

probeR. Probes were labeled with [α- P]dCTP using the Random Primer DNA Labeling System
(Invitrogen, Carlsbad, California) as per the manufacturer’s instructions with the addition of 0.5

28 

µl of the 10mM primers used to generate each probe. After hybridization and washing,
membranes were used to expose Hyperfilm MP (GE Healthcare, Chalfont St. Giles, United
Kingdom).
The nucleotide sequence of the N. crassa MID1 locus was obtained from
http://mips.helmholtz-muenchen.de/genre/proj/ncrassa/. Analysis of PCR amplifications of an
internal 808 bp sequence of MID1 using primers NcM1-F & NcM1-R from gDNA of the wildtype and mid1 mutant strains confirmed the presence or absence of MID1, respectively.

Characterization of G. zeae Δmid1 phenotypes
For characterization of vegetative growth and sexual development, carrot agar was center
inoculated with a mycelial plug of the wild-type or individual mutants and incubated at RT under
continuous light. Radial growth was measured at 24 h intervals until mycelia reached the edge of
the Petri dish (approximately 4 d). The first and last day’s growth were discounted. The growth
rate was calculated by subtracting colony diameter at 24 h from the diameter at 48 h. Four
biological replicates of each strain were performed, and the calculated growth rates of the
replicates were averaged. Sexual development was monitored using squash mounts of perithecia
at previously defined stages of development (Trail and Common, 2000). Samples were observed
on a Zeiss Standard microscope or a Leica DMRA2 microscope.
The level of calcium available in growth medium was adjusted to determine the effect on
the wild-type and mutants. The characterization of vegetative growth was repeated for growth on
carrot agar amended with 80 mM CaCl2 and with 80 mM Magnesium (MgCl2). Significance
between the strains growth on carrot agar compared to PH-1 and between the strains’ growth on
carrot agar versus carrot agar + 80 mM CaCl2 was assessed. Because carrot agar is a rich,

29 

undefined medium, Bilay’s medium (Booth, 1971) was supplemented to 10 mM with the cell
impermeable calcium chelator 1,2-bis(2-aminophenoxy)ethane-N,N,N,N,-tetraacetic acid
tetrapotassium salt (BAPTA) to determine the ability of Δmid1 mutants to grow in limited
calcium conditions, as previously described with Δcch1 mutants (Hallen and Trail, 2008) except
that mycelia was used as inoculum instead of macroconidia. To determine the effect of increased
intracellular calcium levels, some strains were center inoculated on V8 agar, and after 48 h
growth, a point treatment of 10 µl of either a 9.5 mM solution of calcium ionophore A23187 (in
ETOH) or 100% ETOH was applied to a point slightly ahead of the leading edge of mycelial
growth. Images were taken of the cultures 72 h post treatment.
Ascospore discharge assays were performed as previously described (Trail et al, 2002)
using 12 mm diameter discs of carrot agar removed from mature cultures, cut in half, and placed
cut side down on glass microscope slides so spores were shot down the length of the slide. Slides
were incubated in a humidity chamber for 24 h at RT to allow discharged spores to collect on the
glass slides. Ascospore discharge assays were repeated for all strains grown on carrot agar + 79.6
mM CaCl2 and for PH-1 grown and matured on carrot agar with the addition of BAPTA to 1
mM and 10 mM at the time of assay setup. To quantify ascospore discharge, after the 24 h
incubation, the spores were washed off the slides and quantified. The results of the three
replicates were averaged.
A qualitative assessment of ascospore viability for all strains was performed. Three cirrhi
per strain were recovered and suspended in 200 µl of sterile diH2O. For strains that lacked cirrhi,
three perithecia were crushed on a glass slide with a glass rod in 30 µl of sterile diH2O to release
ascospores. The crushed perithecia and ascospores were rinsed off the glass slides with 170 µl of

30 

sterile diH2O. From these suspensions, 30 µl from each strain were spread on water agar. The
plates were incubated at RT for 48 h and examined under a dissecting microscope for the
presence and abundance of germ tubes.
To quantify conidiation, surface mycelia collected from 12 mm diameter circles of fully
colonized V8 medium of each strain was used to inoculate 100 ml of CMC medium. The CMC
cultures were incubated for 4 d at RT shaking at 250 rpm. The 4 d cultures were filtered through
Miracloth (Calbiochem, La Jolla, CA) to separate macroconidia from mycelia. The macroconidia
were pelleted by centrifugation, resuspended in 1 ml of sterile diH2O and quantified. Total
conidiation of the strains in 100 ml of CMC + 79.6 mM CaCl2 was performed in the same
manner.
Pathogenicity tests were performed with all strains on 7 greenhouse grown plants of
5

Triticum aestivum L. cv. Norm. Plants near anthesis were inoculated with 10 µl of 10 conidia
-1

ml to a single floret in the middle of the head as previously described (Guenther and Trail,
2005). Fourteen days after inoculation, plants were scored for the number of symptomatic and
asymptomatic florets.

Characterization of N. crassa Δmid1 ascus and ascospore morphology and ascospore
discharge phenotype
Reciprocal wild-type and reciprocal ∆mid1 crosses were performed and cultured as
detailed above. When discharged ascospores were observed on the covers of the Petri dishes
containing the N. crassa wild-type or ∆mid1 crosses, the lids were washed with 1 ml of diH2O to

31 

collect the spores, and ascospores were observed by light microscopy. Squash mounts of mature
perithecia from the two wild-type and the two ∆mid1 crosses were also examined by light
microscopy.

Statistical Analysis
Analysis of variance (ANOVA) was performed to assess the significance of intragroup
variation and of intergroup interaction and, if any were significant, was followed by the post hoc
Tukey's Honestly Significant Difference (HSD) test to return associated p-values for all pairwise
comparisons. ANOVA and Tukey's HSD were performed in the R language and environment for
Windows (R Development Core Team, 2010). The electrophysiological data are shown as mean
± SD (sample size). Independent two-tail t-tests comparisons of the two mutant strains with the
PH1 wild-type were performed in Excel (Microsoft).

Microscopy and Imaging
Samples were first observed on a Zeiss Standard microscope. To capture images, samples
were observed on a Leica DMRA2 microscope using Q-Capture camera control software (QImaging; Surrey, BC Canada). Images of strain growth and ascospore discharge assays were
captured with a Nikon Coolpix 995 (Tokyo, Japan) except the images of growth on Bilay’s + 1
mM BAPTA which were captured with by an Alpha Innotech FluorChem 8900 imaging system
(San Leandro, CA).

Electrophysiology experiments
Cultures were prepared by inoculating agar blocks of mycelium of the G. zeae strains

32 

onto strips (2.5 X 6 cm) of dialysis tubing that overlay Czapek medium (with 1.5% w/v agar) in
Petri dishes, then incubating at 25°C for 3–4 days. The dialysis tubing was cut with a razor blade
to a size of about 1 X 3 cm, which included the growing edge of the colony, placed inside the
cover of a 30 mm Petri dish, and immobilized on the bottom with narrow strips of masking tape.
The culture was flooded with 3 ml of buffer solution (BS) (in mM): KCl (10), CaCl2 (1), MgCl2
(1), sucrose (133), and MES (10), pH adjusted to 5.8 with KOH. Growth of hyphae at the colony
edge resumed after flooding with BS (growth was monitored by taking thermal video prints of
hyphae at the colony edge immediately after transfer to the microscope stage, and about 10 min
later with a X10 objective). Electrical measurements were alternated between the three strains.
Trunk hyphae (3–10 µm diameter) about 0.5 cm behind the colony edge were selected
(with a X40 water immersion objective) for potential and current voltage measurements using
double barrel micropipettes. Micropipette fabrication was described in detail by Lew (2006).
Voltage clamp methods have been described elsewhere for measurements performed in
Neurospora crassa (Lew, 2006; 2007). Current was injected through one barrel and voltage
monitored through the other barrel. The voltage clamp protocol was a bipolar staircase of resting
potential and alternating positive and negative voltage clamps, each with a duration of 100 ms;
voltage (to check voltage clamping fidelity) and clamping current were measured during the last
5 ms of the clamp. There was no indication of any difference in time dependent currents amongst
the three strains: the clamping current had reached steady state by 100 ms (data not shown).
Measurements of current density in hyphae are complicated by the cable properties of the hypha;
but the length constant (a measure of current along the hypha) for G. zeae hyphae is not known,
–2

so that current densities (A m ) could not be calculated (cf Lew, 2007). The hyphal diameters of

33 

the two mutant strains (cch1 and mid1) were smaller than the PH1 wild-type. Since hyphal
diameters will affect the input conductance measured from the slopes of the current-voltage
relations, to compare the current-voltage relations of the three strains, the currents (and current2

voltage slopes) were normalized to (hyphal diameter) .
The potential is comprised of contributions from the Goldman-Hodgkin-Katz potential
+

for permeant ions and the activity of the plasma membrane electrogenic H -ATPase. To assess
+

as directly as possible the contribution of the H -ATPase to electrogenicity at the plasma
membrane, hyphae were treated with the respiratory inhibitor cyanide (0.5 ml from a 50 mM
+

NaCN stock in BS, final concentration 7.1 mM) to deplete cellular ATP and inhibit the H ATPase (Slayman et al., 1973; Lew and Kapishon, 2009).

Results
Function of Mid1 and Cch1 in Gibberella zeae.
Mid1 function was examined by replacing the entire MID1 coding sequence with the
dominant selectable marker hph, encoding hygromycin phosphotransferase, conferring
hygromycin resistance. From a single transformation experiment using split marker constructs
targeted to the MID1 locus, 24 hygromycin resistant colonies were obtained. Two of three
colonies examined displayed slowed vegetative growth and were designated Δ2 and Δ12. PCR
analysis of the two mutants revealed amplicons consistent with replacement of MID1 by hph.
The remaining strain, designated E1, displayed wild-type growth and PCR analysis was
consistent with ectopic insertion of the disruption construct. To generate a strain for Mid1
complementation, Δ2 was first crossed to nit3 mutant PH-1 55 and progeny were screened for

34 

the Δmid1 nit3 phenotype. From three
recombinant cirrhi analyzed from the
cross, 16 nit- colonies were isolated.
PCR analysis indicated four progeny
were Δmid1 nit3 double mutants. The
Δmid1 nit3 double mutant, designated
mn-11, was used for
complementation. Cotransformation
of mn-11 protoplasts with the MID1
complementation amplicon and split
NIT3 constructs was performed,
resulting in selection of 25 nitrateutilizing colonies. PCR analysis
revealed that two transformants,
Figure 1. Southern analysis of G. zeae Mid1 deletion
and complementation strains (A) Hybridization of the
MID1 probe. (B) Hybridization of the hph probe. (C)
Hybridization of the CCH1 probe. The numbers to the
left indicate the approximate size of bands in kb. For all
figures, strain genotypes are as follows: wt (MID1
CCH1), Δ2 and Δ12 (Δmid1 CCH1), E1 (MID1 CCH1),
C1 and C2 (Δmid1 CCH1 ::MID1), and ΔmΔc (Δmid1
Δcch1).

designated C1 and C2, contained both
hph and MID1 sequences. Both
complements exhibited wild-type
vegetative growth and colony
morphology. To generate Δmid1

Δcch1 double mutants, Δmid1 nit3 double mutant mn-11 was crossed with Δcch1-T14 (T14;
Hallen and Trail, 2008). We isolated 24 colonies displaying slow but dense colony growth

35 

Figure 2. Growth of G. zeae strains on carrot agar and calcium-limited medium. Top panel:
Growth (4 d) on CA. wt, E1, C1, and C2 fully colonized the medium; the remaining strains (Δ2,
Δ12, ΔmΔc) did not. Bottom panel: Growth (14 d) on medium supplemented to 1 mM BAPTA;
the extent of growth is outlined by black dotted lines. 
on MMTS, indicating nit+ and calcium uptake deficiency phenotypes. PCR analysis of 12
isolates indicated that one strain lacked both MID1 and CCH1 coding sequences and was
designated ΔmΔc The status of all strains was confirmed by Southern analysis (Fig. 1). The L
(Left flank, see Methods) fragment of Mid1 was expected to hybridize to a 5.4 kb band in PH-1
and a 3.9 kb fragment in the mutants. The probe hybridized to multiple unidentified fragments in
E1 indicating that multiple ectopic insertions of the L5 containing replacement construct
occurred (Fig1A). Complements C1 and C2 also displayed probe hybridization to the ~3.9 KB
fragment and to a larger ~6.5 KB fragment, showing that MID1 was deleted and complemented
by an ectopic insertion of the wild-type MID1 sequence. Unexpectedly, wild-type parent strain
PH-1 and E1 showed hybridization to the ~3.9 KB fragment. To ensure that the unexpected
hybridization was nonspecific rather than from contamination with a Δmid1 strain, an internal
hph probe was used to hybridize to an identically prepared membrane (Fig. 1B). Hybridization to
the expected ~3.9 KB and ~1.4 KB fragments if MID1 was replaced occurred in all strains
except PH-1 and E1. No hybridization of the hph probe occurred in PH-1, indicating that the
unexpected hybridization of the L5 fragment was nonspecific. In strain E1, the hph probe
hybridized to the ~3.9 KB and numerous other fragments of various sizes but not the ~1.4 KB

36 

fragment also supporting the L5
probe results. Strains Δ2 and C2 also
have multiple probe hybridizations to
other fragments. The double mutant
ΔmΔc has multiple other hybridized
fragments because CCH1 was also
replaced using an hph construct.
Mutants lacking functional
Mid1 grew at a slower rate than PH-1
(Fig. 2). No distinctive pattern of

2+

Figure 3. Effect of Ca ionophore on G. zeae mycelial
growth. (A) and (C) PH-1 and Δ2 controls, respectively.
(B) and (D) PH-1 and Δ2 treated with A23187. The
point of treatment is indicated by black dots and was
made after 48 h initial growth. Images were taken 72 h
after treatment.

branching could be discerned that correlated with the fluffy phenotype. PH-1, E1, C1, and C2
grew in the presence of 1 mM chelating agent BAPTA for 4 days before growth was arrested,
while mutants Δ2, Δ12, and ΔmΔc were unable to colonize (Fig. 2). Growth of PH-1 and Δ2 on
V8 medium, spot amended with calcium ionophore A23187, or with ETOH (control) was
examined. Both strains were unaffected on the control medium (Fig. 3A & C). PH-1 fully
colonized the ionophore-amended medium and showed only a slight reduction of aerial hyphae
at the point of ionophore application (Fig. 3B). Mutant Δ2 slowly colonized the ionophore
amended medium and produce much less aerial hyphae than in the control (Fig. 3D). Addition of
up to 1.2 M NaCl to Czapek-Dox agar showed similar growth reduction in both mutants and PH1 (data not shown).

37 

All strains produced morphologically
normal mature perithecia. Examination of
perithecial squash mounts by light
microscopy at 24 h intervals from 4 to 6 d
post induction showed that asci and spores of
all strains appeared normal; however,
perithecia reached maturity
~24 h later in the Δmid1 and Δmid1 Δcch1
mutants. The mutants also displayed
abnormal ascospore development, producing
predominately two-celled spores (Fig. 4A).
Some mutant spores developed constrictions
at the central septum and occasionally split in
half after release from the ascus. PH-1, E1,
C1, and C2 strains produced predominately
Figure 4. G. zeae ascospore morphology of
mutant Δ2 (A), complemented strain C1 (B), and
PH-1(C). White arrowhead indicate single cell
fragments arising from two-celled abnormal
ascospores. White arrow indicate two-celled
abnormal ascospores with restricted septae that
may fragment. Black arrowheads point to
emerging germination tubes. Black arrows
indicate wild-type four-celled ascospores. Bars =
20µm.

normal four-celled ascospores (Fig. 4C & D).
A qualitative examination of ascospore
viability showed that spores from all strains
germinated, but the hyphal density of the
mutants was lower after two days of growth
by germinating ascospores. Ascospore

discharge was reduced in the mutants and partially restored by exogenous calcium added upon
induction of the sexual stage (Fig. 5). Strains E1, C1,

38 

 

2+

Figure 5. Effect of mutation and Ca supplementation on G. zeae ascospore discharge. Agar
plugs supporting mature perithecia (across the bottom of each panel) from each strain were
oriented perpendicular to the glass slides so spores accumulated on slides (black arrowhead
2+
for each panel). Unamended medium (top) and medium amended with Ca (bottom).
and C2 forcibly discharged ascospores as in PH-1. The Δmid1 and Δmid1 Δcch1 mutants failed
to produce cirrhi and additional calcium did not provide a notable increase in cirrhus formation.
To better determine the effects of MID1 deletion on growth and development,
quantification of vegetative growth, ascospore discharge, and macroconidia production was
performed on each strain (Fig. 6). On carrot agar, the Δmid1 mutants and the Δmid1 Δcch1
mutant showed large and significant reductions in vegetative growth rate when compared to PH1 (P <0.001) (Fig. 6A). The complement C1 also showed a smaller but significant reduction (P
<0.05). The growth rates of E1 and C2 strains did not differ significantly from PH-1. When
2+

grown on carrot agar + 80 mM Ca , the growth rates of all mutants increased significantly from
their growth rate on unamended carrot agar (P <0.05) but were still significantly different at
approximately 67% or less of PH-1 rates on unamended carrot agar (P <0.001). The growth of
PH-1, E1, C1, and C2 were not significantly different on carrot agar with or without calcium
2+

supplementation. The growth rates of all strains on carrot agar amended with 80 mM Mg

was

not significantly different from growth rates on unamended carrot agar.On unmodified carrot
agar, the mutants Δ2, Δ12, T14, and ΔmΔc showed significant reductions (12-, 14-, 10- and 19-

39 

Figure 6
40 

Figure 6 (cont'd)
Figure 6. Characterization of G. zeae growth and development. (A) Growth rates on carrot agar with and
2+
2+
without Ca or Mg supplementation (change of diameter in mm/day). (B) Ascospore discharge. (C)
Macroconidia production. Error bars represent the SD of the means of 5 (A), 10 (B), or 3 (C) biological
replicates. Asterisks above open bars denote significant differences in the measurements of the indicated
strains compared to PH-1 (wt). Asterisks below the bars denote significant differences in the
measurements of the indicated strains between untreated and calcium supplemented treatments for that
strain. * = p < 0.05 ** = p < 0.01 *** = p < 0.001. Strain genotypes are as listed in Fig. 1 except T14
(MID1 Δcch1).

fold, respectively) in ascospores discharged (P <0.001; Fig. 6B). Complement C2 and ectopic E1
displayed smaller but significant reduction (~2-fold) in ascospore discharge (P <0.01 and P
<0.05, respectively). E1 and C1 did not vary significantly from PH-1 levels. When supplemented
with 80 mM CaCl2, all mutants showed significant increases in ascospore discharge (P <0.001).
Additionally, wild-type on carrot agar treated with 1 mM or 10 mM BAPTA at the initiation of
the discharge assay showed significant dose dependent reduction in ascospore release (P <0.001)
compared to wild-type on unmodified carrot agar, while the water control was not significantly
different than untreated wild-type.

41 

All mutants produced significantly fewer macroconidia compared to PH-1 (P <0.01; Fig.
6C). Complement C1 produced significantly more macroconidia than wild-type (P <0.05).
Quantification of macroconidia production of the strains grown in CMC amended with 80 mM
Ca

2+

was unsuccessful. For all strains, the calcium supplemented culture stimulated secretion of

a gelatinous substance that pelleted with the conidia, preventing an accurate tally.
To assess the impact of the loss of Mid1 on G. zeae pathogenicity, seven wheat plants
were inoculated with macroconidia from each strain, and all were successfully infected. While
infection by the mutants seemed slightly less vigorous than the other strains, no significant
difference in the number of symptomatic kernels was found (data not shown).

Function of Mid1 in Neurospora crassa
The reciprocal crosses of N. crassa ∆mid1 mutants produced normal perithecia and
discharged ascospores. The discharged ascospores were compared to those from wild-type
crosses and were found to be morphologically normal. Examination of perithecia squash mounts
also revealed morphologically normal asci and ascospores arising from the ∆mid1 crosses (data
not shown).

Gibberella electrophysiology.
PH-1, Δ2, and T14 strains were impaled successfully with double barrel micropipettes. A
summary of electrical properties is shown in Figure 6 (examples of electrical traces in Fig. 6A,
summary of potentials before and after cyanide treatment in fig. 6B, and current-voltage relations
in Fig. 6C). When the micropipette was pressed against the cell, a small negative potential of –5
to –20 mV, presumably a Donnan potential for the wall, was occasionally observed. Upon

42 

impalement into the cell, a stable negative-inside potential was obtained within about 1 min (Fig.
6A). The potentials of the three strains were similar: the wild-type was –149 ± 21 (n=14), the
mid1 mutant was –146 ± 19 mV (n=13) and the cch1 mutant was –145 ± 18 mV (n=13).
Electrophysiology experiments on asci were not possible due to size limitations.
+

To compare as directly as possible in vivo activity of the electrogenic H -ATPase in the
three strains, ATP was depleted by treatment with the respiratory inhibitor cyanide, per
experimental results in N. crassa (Slaymen et al., 1973) (Fig. 6B). The depolarized potentials —
due to the Goldman-Hodgkin-Katz potential for permeant ions— were very similar: the wildtype was –47 ± 11 (n=14), the mid1 mutant was –51 ± 12 mV (n=13) (P=0.402) and the cch1
mutant was –56 ± 15 mV (n=13) (P=0.092). The ATP-dependent contribution to the potentials
(potential after cyanide treatment minus the potential before cyanide treatment) was also very
similar: the wild-type was 102 ± 19 (n=14), the mid1 mutant was 95 ± 17 mV (n=13) (P=0.374)
and the cch1 mutant was 89 ± 14 mV (n=13) (P=0.057). Thus, both ‘passive’ (Nernstian) and
+

active (H -ATPase) contributions are the same for the three strains.
After the potential achieved steady state, three current-voltage measurements were
performed before and after cyanide treatment. Conductances were calculated from the slopes of
the current versus voltage relations (which were linear, Fig. 7C). The conductance of the wildtype was significantly higher than that of either mutant: 32.3 ± 11.3 nS (n=14) compared to 17.8
± 7.1 nS (n=13) for the mid1 mutant (P=0.001), and 21.1 ± 10.0 nS (n=13) for the cch1 mutant
(P=0.008), but these differences can be attributed to the hyphal diameters of the measured cells.
The wild-type had larger hyphae then either mutant: diameters of 8.0 ± 1.2 µm (n=14) compared
–6

–4

to 5.4 ± 0.7 µm for the mid1 mutant (P<10 ) and 5.8 ± 0.8 µm for the cch1 mutant (P<10 ).

43 

Figure 7
44 

Figure 7 (cont'd)
45 

Figure 7 (cont'd)
Figure 7. Electrical properties of the plasma membrane of hyphae from G. zeae strains PH-1,
Δ2 (mid1), T14 (cch1). (A) Examples of electrical measurements for the three strains. After
impalement, the potential stabilized within about 1 min. Then three current-voltage
measurements were performed (vertical bars), followed by the addition of cyanide to deplete
+
cellular ATP and inhibit the H -ATPase (horizontal bars, as marked). After the depolarized
potential neared steady state, three more current voltage measurements were commenced,
followed by removal of the micropipette from the cell. (B) Compiled measurements of initial
Em (circles), cyanide-induced depolarization (squares), and the difference (Em after cyanide
+

treatment minus Em before cyanide treatment) (a measure of H -ATPase activity) (triangles).
None of these measures are significantly different amongst the three strains. (C) Currentvoltage relations for the three strains. These are the means (n=12) of the average currentvoltage measurements (n=3) before (circles) and after (squares) cyanide treatment. These data
have been normalized to the significantly different hyphal diameters of the three strains by
–2
dividing by the hyphal diameter (squared). The units (nA µm ) should not be interpreted as
current density, which would require experimental measurements of the length constant of the
hyphae (cf Lew, 2007).
–

Because input conductance (S) will be higher for larger hyphae if the specific conductance (S m
2

) is the same, the conductance were normalized to hyphal diameter by dividing by (hyphal
2

diameter) (the current-voltage relations in Fig. 7C have been so normalized).
–2

After normalization, the wild-type conductance was 0.521 ± 0.225 nS µm
–2

mid1 mutant conductance was 0.609 ± 0.184 nS µm
–2

conductance was 0.609 ± 0.316 nS µm

(n=13), the

(n=13) (P=0.294), and the cch1 mutant

(n=12) (P=0.995). Thus, both potential and

conductance were the same in wild-type and the two mutant strains. Changes in the conductance
after cyanide treatment were small and not statistically different: wild-type, –0.051 ± 0.211 nS
–2

µm

–2

(n=12); mid1, –0.179 ± 0.180 nS µm

–2

(n=12) (P=0.125); cch1, 0.033 ± 0.481 nS µm

(n=12) (P=0.585).

46 

Discussion
An obvious application for the stretch-activated channel Mid1 is membrane stretch
during ascospore discharge, which stimulated our exploration of the Cch1/Mid1 complex in G.
zeae. Here, we showed that Δmid1 mutants and the Δmid1 Δcch1 double mutant of G. zeae
exhibited significantly reduced forcible ascospore discharge, slowed vegetative growth, reduced
conidiation, and a high frequency of abnormal ascospores. These characteristics are similar to
those of the Δcch1 mutant (Hallen and Trail 2008), but loss of Mid1 function resulted in more
severe phenotypes than loss of Cch1 in G. zeae. Here we also show that neither the potential Em
nor the conductance gm are affected in the Δmid1 and Δcch1mutants indicating that, as
transporters, the mid1 and cch1 gene products do not contribute measurably to the plasma
membrane potential, nor are the downstream phenotypic effects (exemplified by poor growth)
reflected by changes in plasma membrane ion transport. Furthermore, osmotic sensitivity
experiments did not indicate any defect in osmotic response among the mutants.
Supplementation of cultures of the Δmid1 and the Δmid1 Δcch1 mutants with exogenous Ca

2+

partially rescued forcible discharge and vegetative growth, but did not rescue the abnormal
development of ascospores. These results indicate that the defect in the mid1 and cch1 mutants is
one of calcium signaling, supported by the ability to rescue the mutants with supplementary
calcium. The sensitivity of the mutants to the ionophore A23187, which artificially elevates
cytoplasmic calcium, suggests that there is also a lesion in calcium homeostasis. Assuming that
the electrical properties are similar in asci and hyphae, we can conclude that the Cch1/Mid1
complex has a signaling role in ascospore discharge.

47 

Should the G. zeae MID1 and CCH1 gene products contribute significantly to the overall
electrical properties of the hyphal plasma membrane, either the potential or conductance would
be affected in the mutants, which was not the case. The electrical potential reflects the
contributions of permeant ions and active transport; this is commonly summarized by the
equation Em = Ipump/gm + EG, which states that the membrane potential is the sum of pump
current divided by conductance (Ipump/gm) and the Goldman-Hodgkin-Katz potential for
permeant ions (EG) (Spanswick, 2006). Conductance reflects the total voltage dependent ion
transport across the plasma membrane. This is different from the situation in the N. crassa, for
+

which the mid1 mutant exhibits significantly lower H -ATPase activity as measured by cyanideinduced depolarization of the membrane. BLAST search reveals a very close match between the
+

N. crassa plasma membrane H -ATPase (pma-1, NCU01680) and G. zeae (FGSG_01425)
(identities 86% over 923 amino acids). Thus, despite the presence of MID1, CCH1, and PMA1 in
both organisms, the roles of Mid1 and Cch1 with respect to Pma1 are distinct in the hyphae.
As a respiratory inhibitor, the use of cyanide in N. crassa to deplete ATP is wellestablished (Slayman et al., 1973). Longer term (about 30 minutes), N. crassa becomes resistant
to cyanide due to expression of an alternate oxidase (Lew and Levina, 2007); alternate oxidases
are also found in Fusarium spp. (Alberghina and Benni, 1980). And, both fungi have cyanidedegrading enzymes (Basile et al., 2008). However, the cyanide-induced depolarizations in G.
zeae and N. crassa are the same, so it is very likely that the rapid effect of cyanide-induced ATP+

depletion leading to inhibition of the electrogenic H -ATPase occurs in G. zeae, similarly to N.
crassa.

48 

Previous studies have shown a role in higher fungi for stretch activated ion channels in
thigmotropic responses to ridges on plant surfaces in the bean rust Uromyces appendiculatus
(Zhou et al., 1992), responses to surface ridges and fungicide sensitivity in the human pathogen
Candida albicans (Brand et al., 2009; Watts et al., 1998), pheromone responses in S. cerevisiae
(Kanzaki et al., 1999), infection of plant tissues in C. purpurea (Bormann and Tudzenski, 2009)
and vigorous mycelial growth of N. crassa (Lew et al., 2008). In S. cerevisiae, Cch1 and Mid1
were found to coimmunoprecipitate, yet respond to some stimuli differently, suggesting both
cooperative and individual function (Locke et al., 2000; Courchesne and Ozturk, 2003; TokesFuzesi et al., 2002). In G. zeae, the Δmid1 Δcch1 double mutant exhibited slightly more severe
phenotypes than the Δmid1 mutant from which it was generated, supporting both dependent and
independent roles for Mid1 and Cch1 in calcium entry. However, even in the absence of both
calcium channels, the double mutant showed a partial rescue of the mutant phenotypes with
calcium supplementation, suggesting the presence of one or more alternate calcium uptake
routes.
The results from the quantification of vegetative growth, ascospore discharge, and
macroconidia production demonstrate that complementation of ∆mid1 mutants does not perfectly
recapitulate the wild-type phenotypes, as complement strain C1 showed a significant reduction in
growth rate and a significant increase in macroconidia production, and complement C2 showed a
significant decrease in ascospore discharge. Since both complements show hybridization to a
fragment of expected size for the replacement construct at the MID1 locus and a second fragment
larger than the fragment expected of the wild-type MID1 locus (Fig. 1A), MID1 is most likely
being provided in trans and differences in distal cis regulatory elements at the integration site
and the native MID1 locus may explain the observed results. It is also possible that during the

49 

integration event not all of the proximal MID1 promoter integrated. Further investigation into the
nature of these differences was not pursued.
In Claviceps purpurea, ∆mid1 mutants were apathogenic (Bormann and Tudzynski,
2009) while pathogenicity of Magneporthe grisea ∆mid1 and Δcch1 mutants were only slightly
reduced (Nguyen et al., 2008). In G. zeae Δcch1 mutants (Hallen and Trail, 2008) and Δcch1
and Δcch1Δmid1 mutants examined here showed a slightly slower progression of disease.
However, reduction in conidium production and greatly reduced ascospore discharge
characteristic of these mutants would likely result in reduced disease spread in these mutants in
the field.
Despite the divergence of phenotypes among Δmid1 mutants of the fungi studied, the
ability to complement using exogenous calcium appears to distinguish two phenotypes. Growth
defects in N. crassa and C. purpurea, and the thigmotropism and sinusoid growth in C. albicans
are unable to be chemically complemented. In contrast, G. zeae (except for ascospore shape),
yeast and galvanotropism of C. albicans can be at least partially complemented. One possible
explanation is a critical role for Mid1 in calcium transport in the former set, but not the latter.
Interestingly, both G. zeae and C. albicans have phenotypes in both groups. In the case of
ascospore shape in G. zeae, Mid1 may play a crucial role in transport during spore formation.
Interestingly, Mid1 plays an important role in niche adaptation of G. zeae (ascospore discharge),
C. albicans (sinusoidal growth for penetration of host tissues; Brand et al., 2009), Cl. purpurea
(infection of hosts; Tudzynski, 2009), and yeast (mating; Iida et al., 1994). The diversity of roles
this protein plays among fungi indicates its evolutionary malleability to support niche-specific
activities.

50 

Ascus function is unique in several respects: it is a one-way, single occurrence,
destructive process, without a requirement to regenerate a functional ascus; it occurs after all of
the nuclei are packaged within walled spores; and, it occurs rapidly (in G. zeae, one ascus fires
every 45 sec under optimal conditions; Trail, unpublished observation). The ascus naturally
stretches lengthwise when external pressure is applied. It seems likely that the natural conditions
of humidity and wetness that trigger ascospore discharge would cause mature asci to swell,
activating Mid1 and sending a signal for rapid firing of spores. The downstream targets of that
signal are currently not known, and experiments designed to identify them are in progress.
Localized vesicle fusion is thought to explain the calcium-regulated tip-reorientation of C.
albicans (Gow, 2007). Vesicles are not prominent in the mature asci of G. zeae (unpublished
observations) and the process appears to be more rapid than fusion would permit, so another
mechanism must contribute to the rapid stretch of the asci leading to spore ejection.

Acknowledgments
The authors thank the Fungal Genetics Stock Center, which provided the Neurospora
strains used in this study.
This work was supported by a grant from the National Science Foundation (0923794 to
FT) and the Michigan Agricultural Experiment Station and was also funded in part by a
Discovery Grant from the Natural Sciences and Engineering Research Council of Canada (RRL).
In addition, the authors would like to acknowledge continued support by the USDA Wheat and
Barley Scab Initiative.

51 

CHAPTER 3

FIG1, A COMPONENT OF THE LOW AFFINITY CALCIUM UPTAKE SYSTEM, IS
ESSENTIAL FOR PERITHECIUM DEVELOPMENT AND AFFECTS FILAMENTOUS
GROWTH AND ASEXUAL DEVELOPMENT IN FUSARIUM GRAMINEARUM
Brad Cavinder and Frances Trail

I performed the work of this chapter in the Trail lab except for the following experiments.
The Illumina genomic sequencing library for the insertional mutant was performed by Dr.
Kristina Smith in Dr. Michael Freitag’s lab at Oregon State University. For the wild-type
Fusarium graminearum Illumina RNAseq, RNA extraction, sequencing library preparation, and
the quality score filtering and trimming of the resultant reads were performed by Usha Sikhakolli
in the Trail Lab.

52 

ABSTRACT
The function of Fig1, a transmembrane protein of the low affinity calcium uptake system
(LACS) in fungi, in the growth and development of the plant pathogen Fusarium graminearum
was examined. The Δfig1 mutants failed to produce mature perithecia and sexual development
was halted early in the formation of perithecium initials. Loss of Fig1 function also resulted in a
reduced vegetative growth rate. Macroconidia production was reduced 70-fold in the Δfig1
mutants when compared to wild-type. Function of the high affinity calcium uptake system
(HACS), comprised of Ca

2+

channels Mid1 and Cch1, has also been explored in F.

graminearum. To better understand the roles of LACS and HACS, Δfig1 Δmid1, Δfig1 Δcch1,
and Δfig1 Δmid1 Δcch1 double and triple mutants were generated, and the phenotypes of these
mutants were more severe than the Δfig1 mutants. Pathogenicity on wheat was unaffected for the
Δfig1 mutants, but the Δfig1 Δmid1, Δfig1 Δcch1, and Δfig1 Δmid1 mutants, lacking both LACS
and HACS function, were apathogenic. Supplementation with exogenous calcium did not rescue
any of the mutant phenotypes. Additionally, Δfig1 mutants of Neurospora crassa were examined
and did not affect the filamentous growth or female fertility in a Δfig1 mat A strain, but the Δfig1
mat a strain failed to produce fertile fruiting bodies. These results are the first report on Fig1
function in filamentous ascomycetes and expand its role to include complex fruiting body and
ascus development.

53 

Introduction
Calcium is a ubiquitous messenger in eukaryotic cells, acting both directly and indirectly
to modulate protein activity, gene transcription, energy metabolism, endo- and exocytosis, and
many other cellular processes (Berridge et al., 2003; Carafoli, 2005; Michalak et al., 2002). In
fungi, two major calcium uptake pathways have been identified and characterized: the high
affinity calcium uptake system (HACS), active during low calcium availability; and the low
affinity calcium uptake system (LACS), active when calcium availability is high; (Erdman et al.,
1998; Fischer et al., 1997; Iida et al., 1994; Martin et al., 2007; Paidhungat and Garrett, 1997). A
third calcium uptake pathway was recently described in S. cerevisiae, but has yet to have its
genetic components identified (Groppi et al., 2011). In the filamentous fungus, Fusarium
graminearum (sexual stage Gibberella zeae), causal agent of head blight of wheat and barley,
calcium signaling has been shown to have a role in hyphal growth, sporulation, and fruiting body
function, and regulation of components of the HACS system have been shown to be involved in
these processes (Cavinder et al., 2011; Hallen and Trail, 2008; Trail et al., 2002; Trail et al.,
2005).
HACS is minimally composed of the voltage-gated Ca

2+

channel (VGCC) Cch1 (Fischer

et al., 1997; Paidhungat and Garrett, 1997), the stretch activated calcium channel/regulatory
protein Mid1 (Iida et al., 1994), and the PMP22_Claudin superfamily member regulatory protein
Ecm7 (Martin et al., 2007). In yeasts, HACS responds to environmental and endoplasmic
reticulum stress and to exposure to mating pheromone (Courchesne et al. 2010; Brand et al.,
2007; Brand et al., 2009; Hong et al. 2010; Iida et al., 1994; Locke et al., 2000; Peiter et al.,
2005; Viladevall et al., 2004). In filamentous fungi, HACS mutants show both shared and
variable phenotypes across species, including reduced vegetative growth and calcium

54 

homeostasis lesions on the one hand, and effects on pathogenicity and sexual development,
respectively (Bormann and Tudzynski, 2009; Cavinder et al., 2011; Hallen and Trail, 2008; Lew
et al., 2008).
LACS is minimally composed of the Fig1 membrane protein, a PMP22_Claudin
superfamily member like Ecm7, and is involved in calcium influx and membrane fusion during
mating of S. cerevisiae and Candida albicans (Muller et al. 2003; Yang et al., 2011), mating
projection development and cell wall degradation at the fusion site of appressed shmoos in S.
cerevisiae (Erdman et al., 1998), and thigmotropism and repression of hyphal growth in C.
albicans (Brand et al., 2007). Mammalian PMP22_Claudin superfamily members are involved in
membrane-membrane interactions such as epithelial tight junction formation and signal
transduction such as ion flux (Matter and Balda, 2003; Tsukita et al., 1999). The fungal members
show little overall sequence identity with the mammalian orthologs, but most have similar
secondary structure and topology including cytoplasmic N- and C- termini, four transmembrane
domains, two extracellular and one intracellular loops, and a conserved GΦΦGXC(n)C motif (Φ
= F, L, M, or Y hydrophobic residues, n = 8 > n > 20 amino acids) in the first extracellular loop
(Brand et al., 2007; Erdman et al., 1998; Zhang et al., 2006).
In F. graminearum, deletion of CCH1, MID1, or both resulted in almost identical
phenotypes, including reduced vegetative growth rate, conidiation, ascospore development and
forcible ascospore discharge from asci. Chemical complementation with exogenous calcium
rescued all phenotypes, at least partially, except the abnormal ascospore development seen in
strains lacking Mid1, including the Δcch1 Δmid1 double mutant (Cavinder et al., 2011; Hallen
and Trail, 2008). Because addition of calcium rescued the phenotypes even in the Δcch1 Δmid1
double mutant, and because LACS is involved in calcium importation, is active in environments

55 

of high calcium availability, and is involved in sexual development of yeasts, we investigated the
role of Fig1 in the growth and development of F. graminearum. We asked whether Fig1 is
involved in the uptake of calcium essential for chemical complementation of the HACS mutant
phenotype. We identified the putative F. graminearum FIG1 ortholog, and generated Δfig1,
Δcch1 Δfig1, Δfig1 Δmid1, and Δcch1 Δfig1 Δmid1 strains to characterize FIG1 function and
interaction with HACS components. Additionally, we investigated the effect of Fig1 loss on
growth, calcium homeostasis, and sexual development in Neurospora crassa, which has been
shown to have different roles for HACS components than F. graminearum (Cavinder et al.,
2011; Lew et al., 2008).

Materials and Methods
Strains, culture conditions
Strains used in this study are described in Table 1. Strains of F. graminearum
6

8

were maintained on sterile soil at -20°C, as macroconidia (10 -10 conidia/ml), and as colonized
pieces of V8 agar in sterile 35% glycerol at -80°C. Macroconidia were produced in
carboxymethylcellulose (CMC) liquid medium as previously described (Cappellini and Peterson,
1965) or on Bilay's agar medium (Booth, 1971). Sexual development was induced in culture on
carrot agar by gentle removal of surface mycelia followed by treatment with 1 ml of 2.5% (w/v)
Tween 60 solution as previously detailed (Bowden and Leslie, 1999; Trail and Common, 2000).
Although F. graminearum is homothallic, it can outcross, a process accomplished by inoculating
carrot agar with two different strains side by side. Recombinant perithecia are found along the
centerline where the colonies meet.

56 

N. crassa is heterothallic, with two mating type idiomorphs, a and A (Glass et al. 1988;
Metzenberg and Glass, 1990). N. crassa wild-type and Δfig1 mat a (Colot et al., 2006) strains
were obtained from the Fungal Genetics Stock Center (FGSC) and were maintained on synthetic
crossing medium (SC; Davis and de Serres, 1970) slants at -20°C. Sexual crosses were
performed as previously described except cultures on SC were incubated for 7 d in ambient light
instead of continuous fluorescent lighting (Cavinder et al. 2011).

Analysis of sexual crosses
+

All F. graminearum crosses were performed between NIT3 nitrate-utilizing (nit ) and
-

nit3 non-nitrate-utilizing mutant (nit ) strains. Cirrhi (spores oozing from perithecia) from single
perithecia were collected individually, the spores were suspended in water and distributed across
the surface of MMTS medium as previously described (Bowden and Leslie, 1999; Cavinder et
al., 2011). Recombinant perithecia can be easily identified by the presence of approximately
+

-

equal numbers of nit and nit progeny, which have different growth phenotypes on this medium.
For strains that did not form cirrhi (cch1 and mid1 mutants), 10 perithecia at the interface
between strains were collected, crushed in bulk on a glass slide in sterile diH2O to release
ascospores, rinsed off the glass slides, and a portion of the suspension was spread onto the
+

-

surface of MMTS agar. After 5-7 days of growth at RT, nit and nit colonies from recombinant
perithecia or bulk mixtures were individually collected. To confirm the nit phenotype, cultures
were subsequently transferred to Czapek-Dox agar (Thom and Church, 1926) and Czapek-Dox
agar supplemented to 470 mM potassium chlorate and 0.17% L-arginine (Wu and Linz, 1993).
PCR was used to confirm the presence or absence of CCH1, FIG1, and MID1.

57 

TABLE 3. Strains used in this study
Genotype
Abbreviation

Strain
Fusarium graminearum
PH-1(FGSC 9075) wild-type (NRRL 31084)
PH-1 55 nit3
Δfig1-1 Δfig1
Δfig1-2 Δfig1
Δcch 1− Τ11 Δcch 1
mn-11 Δmid1 nit3
cn-5 Δcch1 nit3
cn-7 Δcch1 nit3
cmn-1 Δcch1 Δmid1 nit3
cmn-9 Δcch1 Δmid1 nit3
fm-1 Δfig1 Δmid1
fm-5 Δfig1 Δmid1
fc-1 Δfig1 Δcch1
fc-6 Δfig1 Δcch1
fcm-2 Δmid1 Δcch1 Δfig1
f12-C1 Δfig1 ::FIG1
f12-C2 Δfig1 ::FIG1

wt
−
Δf1
Δf2
−
−
−
−
−
−
−
ΔfΔm
−
ΔfΔc
ΔfΔcΔm
Δf12-C1
Δf12-C2

Source
Trail and Common, 2000
Cavinder et al., 2011
This Study
This Study
Hallen and Trail, 2008
Cavinder et al., 2011
This Study
This Study
This Study
This Study
This Study
This Study
This Study
This Study
This Study
This Study
This Study

Neurospora crassa
FGSC 2489

wild-type, mat A

Colot et al., 2006

FGSC 4200

wild-type, mat a

Colot et al., 2006

Δfig1 mat a
Δfig1 mat A
Δfig1 mat A
Δfig1 mat A

Colot et al., 2006
This Study
This Study
This Study

FGSC 17273
fig1A-18
fig1A-20
fig1A-21
a

a
a
a

Directly received from the Fungal Genetics Stock Center
To generate N. crassa Δfig1 mat A mutants, a Δfig1 mat a mutant strain (FGSG 17273)

was crossed with wild-type mat A (FGSG 4200). To recover progeny, ascospores were then  
washed off the lids, subjected to heat shock to promote germination, and placed on SC amended
to 1% sorbose and 0.05% glucose and fructose with sucrose omitted for germination as
previously described (Shear and Dodge, 1927; Strickland and Perkins, 1973; Perkins, 2006).

58 

Single spore isolates were transferred to SC, and PCR was used to confirm the presence or
absence of fig1 and mat A-2 (present in mat A and absent in mat a).

Nucleic acids manipulation and genetic transformation
DNA was extracted from F. graminearum and N. crassa mycelium using a
hexadecyltrimethylammonium bromide (CTAB) method as previously described (Cavinder et
al., 2011). F. graminearum and N. crassa nucleotide data were obtained from the MIPS
Fusarium graminearum Genome Database (http://mips.helmholtzmuenchen.de/genre/proj/FGDB/; version 3.2) and the MIPS Neurospora crassa Genome
Database (http://mips.helmholtz-muenchen.de/genre/proj/ncrassa/; accessed: June, 2011),
respectively. Primers used in this study are listed in Table 2. Phusion High-Fidelity DNA
Polymerase (New England Biolabs, Ipswich, MA) was used for PCR unless otherwise noted. For
targeted gene replacement constructs, a split marker protocol (Catlett et al., 2003; Fairhead et al.,
1996; Fairhead et al., 1998) was performed as previously described (Cavinder et al., 2011) with
modifications to target FIG1 with the hygromycin resistance (hph) marker from pCB1004
(Carroll et al., 1994), as described below.
The split marker technique involves amplification of 500-750 bp fragments immediately
upstream (L) and downstream (R) of the coding sequence of the target gene with 3’ and 5’ tails
complementary to the 5' and 3' ends of the hph marker, respectively, allowing the fusion of the L
and R flanks to overlapping partial hph amplicons by PCR. A successful gene replacement will
result from a crossover between the hph fragments of the two merged products, and the
replacement of the FIG1 gene with the crossover fragment. In the case of FIG1, the annotated
stop codon is 36 bp upstream from a contig gap, so we used 473 bp of coding sequence upstream

59 

TABLE 4. Primers used in this study
Name
Sequence (5'-3')
For replacement of the F . graminearum FIG1 locus
CGACCTGACTTGACTGACTGACTG
Fig1-L5
GTAGCAACCAGGCGTGGTAGATGTGGTCGACTTTGTTCTCC
Fig1-L3-Hyg
CTTTTACTTTCACCAGCGTTGGCTAACCAGATCTCTCAGGTTTTGTACC
Fig1-R5-Hyg
ACATGAGATAGGGGAACACAATCATGTCC
Fig1-R3
GACCACATCTACCACGCCTGGTTGCTACGCCTGAATAAGTG
Fig1-HygF
GAGATCTGGTTAGCCAACGCTGGTGAAAGTAAAAGATGCTGAAGATC
Fig1-HygR
AGTACTTCTACACAGCCATCGGTCCAGACG
3’ 1/2 HygF
CTGCTGCTTGGTGCACGATAACTTGGTGC
5’ 1/2 HygR
For complementation of F. graminearum Δfig1 mutants
TAGAAGAGCGCTACGTAAGATCGTAGATC
Fig1-compF
CGTTATTCATGAACCAGTACACGGAGATG
Fig1-compR
For probe generation
CTCAATCTCCTGCGAAGTGGAATGAG
Cch1 probeF
GCAGACAAGGGACTAATAATCGCCAAC
Cch1 probeR
ACATCGCCTCACTTTGTGATCTACAGTG
Mid1 probeF
GCTTAGTACGGCTTCGATCTAGCG
Mid1 probeR
For confirmation of N. crassa fig1 and mat A locus presence or absence
GTTGGTTTCTTCGGCATCTGCGTTAATC
Nc Fig1-F
CGATGATCAACAGCGTGAAGCTGAAC
Nc Fig1-R
Nc MAT-A2 F TGCTATGCTCAACGAGAACGAAGTATCG
Nc MAT-A2 R ACTTCTGAGGACCGACTCGGTAACTG

60 

of the contig gap to generate the R fragment. Therefore, the final construct results in a partial
gene replacement rather than full gene replacement with 475 nucleotides of reference gene
sequence remaining in the genome of the replacement strains. For generation of the Δfig1 single
mutants, the L-hph fragment (593 bp, supercontig_3.3: 4947747-4947176) was amplified by
primers Fig1-L5 & Fig1-L3-Hyg while primers Fig1-R5-Hyg and Fig1-R3 generated a 474 bp Rhph fragment (supercontig_3.3: 4947302-4947775). Primers Fig1-L3-Hyg and Fig1-R5-Hyg
have 5’ tails of 15 and 20 bases complementary to the 5’ and 3’ ends of the hph marker from
pCB1004 (Carroll et al., 1994), respectively, allowing for selection of transformants with
hygromycin B (HygB). For split hph, Fig1-HygF and Fig1-HygR contain 5’ tails of 13 and 15
bases complementary to the 3’ and 5’ ends of the FIG1 L- and R-hph fragments' FIG1 sequences
and were paired with primers 5' 1/2 HygR and 3' 1/2 HygF to generate the 5'- and 3' hph
fragments, respectively. Using PCR, the 5’ hph and L-hph, and the 3’ hph and R-hph fragments
were merged together. Both merged products were transformed into wild-type F. graminearum
protoplasts.
For complementation of the Δfig1 mutants, a 1599 bp fragment of the FIG1 locus
(FGSG_06302; supercontig_3.3: 4946177-4947775), spanning 1,000 bp upstream of the first
(supercontig_3.3: 4947177) and to 2 bp upstream of the last (supercontig_3.3: 4947777) FIG1
coding nucleotides, was generated by PCR using primers Fig-compF and Fig1-compR. The
amplicon was used to transform Δfig1 protoplasts.
Polyethylene glycol mediated transformation of protoplasts of F. graminearum was
performed and Hyg+ strains were selected as previously described (Gaffoor et al., 2005). For
complementation of Δfig1 mutants, protoplasts were regenerated on regeneration medium and
then divided into three groups and overlaid regeneration medium containing 0.57 mM, 1.4 mM,

61 

or 3.1 mM of calcium ionophore A23187. Colonies growing to the surface of the overlays were
transferred to V8 agar containing 450 μg/ml HygB or unammended V8 agar as appropriate.
Transformants thriving on selective medium were then transferred to V8 agar for maintenance,
storage, and subsequent phenotype analysis.
RNA was extracted from lyophilized F. graminearum mycelia using the TRIzol reagent
(Life Technologies, Carlsbad, California) as per the manufacturer's protocol with two phenol (pH
6.6):chloroform:isoamyl alcohol (25:24:1) followed by two chloroform extraction steps after the
initial TRIzol:chloroform phase separation. Sample aliquots of 120 µg were purified using the
RNeasy Mini Kit (Qiagen, Germantown, MD), following the manufacturer’s RNA cleanup
instructions and eluting with nuclease free H2O (Promega). All RNA was stored at -80°C.
One µg RNA was used as template for cDNA synthesis reactions. The SMARTer RACE
cDNA Amplification Kit (Clontech, Mountain View, CA) was used for cDNA synthesis for
subsequent 5’- and 3’-rapid amplification of cDNA ends (RACE) reactions per the
manufacturers' instructions. Along with the kit included universal primer, primers Fig1 RACE
R1 and Fig1 RACE F1 for the 5'- and 3' RACE reactions, respectively, and Phusion HighFidelity DNA polymerase (New England Biolabs) were used in the RACE reactions. Amplified
fragments were then cloned into pCR2.1-TOPO using the TOPO TA Cloning kit (Life
Technologies) and sequenced at Michigan State University’s Research Technology Support
Facility using an ABI PRISM 3730 Genetic Analyzer (Life Technologies).

Characterization of Δfig1 phenotypes
To characterize vegetative growth and sexual development of Δfig1 in F. graminearum,
individual strains were grown on carrot agar amended with 80 mM CaCl2, 80 mM MgCl2 or

62 

unamended, and incubated at RT under continuous light. Radial growth was measured at 24 h
intervals for 3 d with four biological replicates for each strain. The first day’s growth was
discounted. The growth rate was calculated by subtracting colony diameter at 24 h from the
diameter at 48 h and was averaged between the replicates. Significance between the growth of
Δfig1 strains compared to PH-1 and among the treatments was assessed. Bilay’s medium (Booth,
1971) was supplemented to 1 mM with the extracellular calcium chelator 1,2-bis(2aminophenoxy)ethane-N,N,N,N,-tetraacetic acid tetrapotassium salt (BAPTA) to determine the
ability of Δfig1 mutants to grow in limited calcium conditions, as previously described for Δcch1
mutants (Cavinder et al., 2008). To determine the effect of increased intracellular calcium levels,
strains were center inoculated on V8 agar, and after 48 h growth, a point treatment of 10 µl of
either a 9.5 mM solution of calcium ionophore A23187 (in ETOH) or 100% ETOH (control) was
applied to a point slightly ahead of the leading edge of mycelial growth.
To quantify conidiation in F. graminearum mutants, strains were grown shaking in 100
ml CMC for 4 d at room temperature (RT). Macroconidia were harvested by filtration through
sterilized Miracloth (Calbiochem). The macroconidia were pelleted by centrifugation,
resuspended in 1 ml of sterile diH2O, and quantified.
PCR identified Δfig1 mat A progeny of N. crassa were reciprocally crossed to wt mat a,
wt mat A, and Δfig1 mat A strains both to test the mating type determination and to assess the
effect of the loss of fig1 on sexual development. Squash mounts of perithecia from the crosses
were examined microscopically to observe ascus and ascospore development. Culture dish lids
of the crosses were monitored for discharged ascospores.

63 

Statistical Analysis
To assess the significance of intragroup variation and intergroup interaction and to return
associated p-values for all pairwise comparisons, analysis of variance (ANOVA) and Tukey's
HSD were performed using the R language and environment for Windows (R Development Core
Team, 2010).

Illumina sequencing and bioinformatics
Genomic DNA from an insertional mutant generated from wild-type strain PH-1 was
sequenced using Illumina GAII (San Diego, CA) with 76 bp paired-end reads and a 400 bp
average library insert size. The 3’-ends of the reads were trimmed with a Biopython script (Cock
et al., 2009) script and a Phred scale quality cutoff score of 28. The reads were assembled using
the Velvet assembler, using k-mer values of 37-49 nucleotides (version 1.1.03; Zerbino and
Birney, 2008; Zerbino et al., 2009). No reads were manually discarded because of length, but
reads shorter than the k-mer size used in an assembly are automatically ignored by Velvet. The
FIG1 locus was located in the assembly using standalone BLAST+ (Camacho et al., 2009).
Using wild-type RNA collected from perithecia at 96 hr after sexual development induction, a
sequencing library was constructed and sequenced using Illumina GA II 36 bp single end reads
and a 400 bp average cDNA library insert size (to be published separately)
Burrows-Wheeler Aligner (BWA, version 0.5.9; Li and Durbin, 2009) was used to align
the RNAseq reads to either the genomic FIG1 sequence from the Velvet assembly or to the same
sequence with introns removed. The 5'- and 3'-RACE clone sequences were aligned manually.
Multiple alignment of the putative full length F. graminearum Fig1 protein to Fig1 sequences
from multiple fungi was performed with T-Coffee (Di Tommaso et al., 2011). The multiple

64 

sequence alignment was viewed and edited in with Jalview (Waterhouse et al., 2009) and
Seaview (Gouy et al., 2010). The putative full length F. graminearum Fig1 protein sequence was
used search the Conserved Domains Database (Marchler-Bauer et al., 2011).

Microscopy and Imaging
For microscopic examination, samples were fixed in 2X phosphate-buffered saline (PBS)
containing 4% (w/v) paraformaldehyde for 20 min on ice, washed twice with 2X PBS, and
stained with 0.06% (w/v) toluidine blue in sterile H2O overnight. Stained samples were washed
twice each in 50%, 75%, and 100% ethanol in sterile water before being stored in sterile H2O.
A Zeiss Standard microscope was used to observe samples and images were captured
with a Zeiss AxioCam MRc color camera using AxioVision 4.8.2 (Göttingen, Germany). Nonmicroscopic images were captured with a Nikon Coolpix 995 (Tokyo, Japan). Image processing,
manipulation, and annotation were performed with ImageJ (Abramoff et al., 2004) or Adobe
Photoshop CS2 (San Jose, CA).

Results
Identification of Fig1 through RACE and Illumina sequencing
The reference sequence of F. graminearum contains a contig gap in the region of FIG1
(Fusarium Comparative Sequencing Project, Broad Institute of Harvard and MIT;
http://www.broadinstitute.org/annotation/genome/fusarium_graminearum/MultiHome.html;
assembly 3; contigs 204-205). Due to the gap, the FIG1 annotation (at both the MIPS Fusarium
graminearum Genome Database and the Broad Institute Fusarium Comparative Database)
contains two introns and three exons (Fig. 1A) ending 36 bp upstream of the contig gap and

65 

predicting a protein of 156 amino acids that is more than 100 aa shorter than most filamentous
ascomycete homologs. To recover the missing sequence, 5’- and 3’-RACE were performed, and
two clones from each preparation were sequenced, revealing the presence of a third intron and
fourth exon (Fig. 1B). Subsequently, we performed Illumina sequencing on genomic DNA from
a strain derived from wild-type (to be published separately). In addition, Illumina RNAseq was
performed on developmental stages of wild-type (to be published separately). FIG1 genomic
sequence was identified from the Velvet assembly of the genomic DNA by BLAST. Sequence
spanning the annotated end of the previous gene upstream to the start of the next gene
downstream of FIG1 was used for alignment. The RACE sequences and RNAseq reads were
aligned to the Velvet FIG1 sequence and both sets of data aligned well to the exons, but not the
introns (Fig. 1B). The introns were removed from the Velvet FIG1 genomic sequence and the
RNAseq reads were aligned to the putative spliced transcript, resulting in read coverage across
the splice junctions instead of the loss of coverage seen with introns included (Fig. 1C).
To assess whether the new longer F. graminearum FIG1 sequence from the Velvet
assembly represents the full length of the gene, the translated protein sequence was aligned to 20
Fig1 homologs from ascomycetes. The Claudin motif found in all Fig1 homologs was present in
the new longer sequence, the longer protein aligned well across the full length of the protein
especially to other filamentous species (data not shown), a search of the Conserved Domains
Database (Marchler-Bauer et al., 2011) found a full length Fig1 domain (data not shown),
indicating that longer sequence includes the complete F. graminearum FIG1 ortholog.

Generation and characterization of FIG1 mutants in F. graminearum.
Mutants of FIG1 in F. graminearum were generated by replacing the first 125 bp of the

66 

coding sequence with hph as described in the Methods. From a single transformation experiment,
10 transformants resistant to hygromycin were obtained. PCR amplicons of three transformants
were consistent with replacement of the targeted FIG1 sequence with hph and the remaining 7
transformants were not tested (not shown). Two of these three transformants, designated Δfig1-1
and Δfig1-2, were used in subsequent experiments. To generate Δcch1 nit3 and Δcch1 Δmid1
nit3 strains, crosses were initiated between Δcch1-T11 (Δcch1) and mn-11 (Δmid1 nit3). PCR
screening of 12 progeny growing slowly and sparsely on MMTS (indicative of nit-) revealed two
strains, cn-5 and cn-7, that produced amplicons expected from a Δcch1 genotype and two strains,
cmn-1 and cmn-9, that produced amplicons expected from a Δcch1 Δmid1 genotype. Crosses
between Δfig1 1 x mn-11, Δfig1 1 x cn-7 (Δcch1 nit3) and Δfig1 1 x cmn-1 (Δcch1 Δmid1 nit3)
were performed to isolate Δfig1 Δmid1, Δcch1 Δfig1, and Δcch1 Δfig1 Δmid1 strains,
respectively. Six progeny displaying slow and dense growth on MMTS (indicative of nit+) were
recovered from each of the three crosses. Screening by PCR confirmed the presence of the
appropriate amplicons for two Δfig1 Δmid1 strains (fm-1 and fm-5), two Δcch1 Δfig1 strains (fc1 and fc-6), and one Δcch1 Δfig1 Δmid1 strain.
To examine the effects of FIG1 deletion on vegetative growth, calcium uptake, and
calcium homeostasis, all strains were grown on media with or without the addition of calcium,
magnesium, calcium chelator BAPTA, and calcium ionophore A23187 (which raises the
cytosolic concentration of calcium). Differences in mycelial growth were tested under several
conditions. Growth on unamended carrot agar revealed that all LACS and HACS mutants grew
at a slower rate than wild-type (Fig. 2A). Growth on Bilay’s medium containing 1 mM BAPTA,
was used to test growth in calcium restrictive medium. Strains lacking Mid1 or Cch1 grew
slightly for one day and failed to colonize further, but Δfig1 mutants fully colonized the medium

67 

Figure 8
68 

Figure 8 (cont'd)
Figure 8. F. graminearum FIG1 gene models. (A) Current gene model from MIPS. (B)
Predicted gene model from a Velvet assembly of insertion mutant 729g-112 . Gray bars above
the model are aligned 5'- and 3'-RACE clone sequences. The graph below the model shows the
coverage of aligned wt RNAseq reads. (C) Predicted spliced transcript from wt RACE and
RNAseq alignments in B. The black arrowheads above the model are the locations of the intron
splice sites. Alignment of the wt RNAseq reads to the model is graphed below the model. Scale
bar = 200 bp.
as did wild-type. Growth on V8 agar spot amended with either calcium ionophore A23187 or
ETOH (control) showed that wild-type fully colonized the A23187 treated medium while the
remaining strains were unable colonize the treated spot (Fig. 2B). All strains colonized the
ETOH control medium.
Quantification of growth rates and macroconidia production was performed to better
understand the effect of Fig1 loss on vegetative growth and asexual reproduction. When grown
on unamended carrot agar, LACS mutants without functional Fig1 grew at a significantly slower
rate than wild-type while mutants having both LACS and HACS defects grew at a significantly
slower rate than Δf1 (Fig. 3A). Growth of all strains on carrot agar amended with 80 mM
calcium or 80 mM magnesium was not significantly different than growth of the same strain on
unamended carrot agar. In contrast, the Δcch1 Δfig1 Δmid1 triple mutant grew significantly
slower on carrot agar amended with magnesium than on both carrot agar and carrot agar
amended with calcium. All mutants produced significantly fewer macroconidia in CMC than
wild-type, but were not significantly different from each other (Fig. 3B).
To observe the effect of the loss of Fig1 on sexual development, strains were inoculated
onto carrot agar and after fully colonizing the medium were induced to undergo sexual
development. Strains lacking a functional Fig1 failed to develop perithecia, although they
produced the characteristic black pigment seen in the top 2-4 mm of the medium after induction

69 

 

Figure 9. Growth of Δf1, Δf2, ΔfΔm and ΔfΔmΔc strains on carrot agar, carrot agar
2+
with BAPTA to limit available calcium, and on V8 agar and V8 agar with Ca
ionophore A23187. (A) Top panel: Growth (4 d) on CA. wt, Δf1, and Δf2 fully
colonized the medium. Strains ΔfΔm and ΔfΔmΔc did not. Bottom panel: Growth (14
d) on medium supplemented to 1 mM BAPTA. wt, Δf1, and Δf2 fully colonized the
medium, but ΔfΔm and ΔfΔmΔc ceased growing after some initial colonization. (B)
Top panel: Growth on V8 agar treated with EtOH control. wt fully colonized the
medium. Strains Δf1 and Δf2 colonized the medium but with less aerial hyphae than
wt. Strains ΔfΔm and ΔfΔmΔc were similar but more severe and did not fully colonize
the medium. Bottom panel: wt fully colonized the ionophore treated medium but the
remaining strains failed to do so.
(Fig. 3A). To determine whether sexual development initiates at all or if it halts at a specific
stage of development, wild-type and the Δfig1 single mutants were inoculated onto carrot agar
with several pieces of cellulose membrane placed onto the surface of the medium. After full
colonization, sexual development was induced. At 24 hr and 48 hr post induction, the

70 

Figure 10
71 

Figure 10 (cont'd) 
Figure 10. Characterization of F. graminearum growth and asexual development. (A) Growth
2+
2+
rates on carrot agar with and without Ca or Mg supplementation (change of diameter in mm/day).
Asterisks above brackets indicate a significant difference between all growth conditions of the
bracketed strain and wild-type on carrot agar. Number signs above brackets indicate a significant
difference between the bracketed strain on carrot agar and Δf1, but not Δf2, on carrot agar. (B)
Macroconidia production. Error bars represent the SD of the means of 3 biological replicates. *
= p < 0.005; # = p < 0.05.
cellulose membranes were removed from the carrot agar. The tissue on the membranes were
fixed, stained with toluidine blue, destained, and viewed by light microscopy (Fig. 3B). At 24 hr,
wild-type developed perithecium initials, but the Δfig1 mutants only had hyphae curving back
onto themselves. By 48 hr, the membranes with wild-type contained larger immature perithecia
with developing walls, and the Δfig1 mutants developed perithecium initials that failed to
develop any further.
Characterization of FIG1 mutants in N. crassa
The N. crassa fig1 ortholog (NCU02219) was identified by BLAST using the S.
cerevisiae Fig1 protein sequence. A Δfig1 mat a, but not a Δfig1 mat A strain, was generated by
Colot et al. (2006), so the Δfig1 mat a strain was crossed to wt mat A to generate Δfig1 mat A
progeny. Twenty-four progeny were screened by PCR for the absence of fig1 and the presence of
mat A-2. PCR analysis revealed that three progeny, fig1A-18, fig1 A-20, and fig1 A-21, lacked
fig1, but harbored mat A-2. Strain fig1 A-21 was used for subsequent experiments.
To examine the effect of Fig1 loss on calcium homeostasis, YEPD agar was inoculated
wt mat a, wt mat A, Δfig1 mat a, and Δfig1 mat A, and spot treated with calcium ionophore
A23187 or ETOH as a control. The cultures were examined 38 hr post inoculation and all strains
colonized the treated medium without any noticeable difference (data not shown). Crosses were

72 

Figure 11
73 

Figure 11 (cont'd) 
Figure 11. Sexual development in wt and Δf1. (A) Mature wt culture has normal sexual
development (right side) and Δf1 exhibits an absence of perithecia development. (B). Sexually
induced cultures at 24 and 48 hr stained with toluidine blue. Perithecium initials (white
arrowheads) develop at 24 hr in wt. Initials in Δf1 developed more slowly. By 48 hr, immature
walled perithecia (white arrow) are found in wt but in Δf1 perithecium initials are noticeable,
but do not develop further. Scale bars = 20 µM.
initiated between the Δfig1 strains of both mating types to each other and to the reciprocal mat
wild-type strains to observe the effects of Fig1 loss on sexual development. Microscopic
examination of squashed perithecia found that the fruiting bodies of the Δfig1 mat a strain were
not fertile as they were devoid of asci but the Δfig1 mat A strain developed normally (Data not
shown).

Discussion
The results presented here demonstrate divergent roles for Fig1 in F. graminearum and
N. crassa. In F. graminearum, Fig1 function affects all stages of the life cycle examined and is
essential for sexual development. In N. crassa, loss of Fig1 resulted in little to no effect on
vegetative growth, but reduced the female fertility and halted perithecium development in a mat
2+

a background. Fig1 is required for both Ca

influx dependent and independent responses to

exposure to mating pheromone in yeasts (Erdman et al., 1998; Lockhart et al., 2003; Yang et al.,
2011; Zhang et al., 2006), however, to date there have been no reported functional studies of
Fig1 in filamentous species. The apparent divergence of LACS function between N, crassa and
F. graminearum is reminiscent of that previously reported for HACS function between F.
graminearum and N. crassa in which both similar (slowed vegetative growth, calcium
homeostasis lesion) and divergent phenotypes (reduced ascospore discharge and abnormal
ascospore morphology in F. graminearum and altered hyphal electrophysiology in N. crassa)
74 

were observed (Cavinder et al, 2011; Lew et al. 2008). That the roles of HACS and LACS both
show divergence points to the evolutionary malleability of calcium signaling.
Recent studies, including the analysis of genomes in the Origins of Multicellularity
Database
(http://www.broadinstitute.org/annotation/genome/multicellularity_project/MultiHome.html;
accessed: July. 2011) have shown that some components of calcium signaling once thought to be
unique to either fungi or metazoans appeared before the divergence of these lineages
approximately a billion years ago (Cai and Chlapman, 2011; Rokas 2008; Ruiz-Trillo et al.
2007). This sequence database contains basal members of the Unikonts, organisms with cell
bearing only one flagellum type that includes metazoans, fungi, and amoebae. Metazoans and
fungi are further subdivided into the Opisthokonts, cells bearing a single posterior flagellum.
Comparative analyses of the genome in the database are being utilized to understand the origins,
commonalities, and differences of multicellularity between animals and fungi. The genome of
Thecamonas trahens, a member of the phylum Apusozoa, contains the only known ortholog of
Mid1 outside of the true fungi. In addition, T. trahens contains several homologs of mammalian
VGCC, rather than a fungal Cch1 ortholog. The Apusozoa are a possible sister group to the
Opisthokonts, having diverged before the fungal-metazoan split (Cavalier-Smith, 2009;
Glücksman et al., 2010), so Mid1 was present before Apusozoa and Opisthokonts diverged. In
addition, Allomyces macrogynus, a Blastocladiomycete (James et al., 2006), possesses six Cch1
homologs (Cai and Chlapman, 2011). Although the presence of Fig1 and other PMP22_Claudin
superfamily members was not examined by Cai and Chlapman (2011), multiple members are
already known to exist in both metazoans and fungi, suggesting that at least one member was
present in the common ancestor. Lineage specific adaptation resulting in the loss, gain, or

75 

expansion of calcium signaling components in combination with the changes to the specific roles
may account for the differences seen in the extant species of Unikont organisms.
Members of the PMP22_Claudin superfamily, of which Fig1 is a member, are involved
in membrane-to-membrane interactions and also commonly form diffusion barriers that
selectively allow ions, water, and other solutes to pass between cells (Furuse, 2010; Grey et al.,
2003; Rosenthal et al., 2010; Wu et al., 2004). The known functions of Fig1 in fungi fit well with
those known for non-fungal proteins in the PMP22_Claudin superfamily, involving cell to cell
interactions and ion flux. Fig1 is involved in the sexual development of C. albicans and S.
cereviseae, and the results here show that it is also involved in the sexual development of F.
graminearum and N. crassa. Fig1 expression and calcium uptake increases in response to mating
pheromone and Fig1 localizes to the mating projections and membranes destined for fusion
during mating in both S. cerevisiae and C. ablicans. Deletion of Fig1 resulted in lowered
pheromone-induced calcium accumulation and decreased cell fusion during mating of both
yeasts. In S. cerevisiae, undigested cell wall remaining between the appressed shmoos was
observed, which was rescued by addition of exogenous calcium, and this phenotype was not seen
in C. albicans (Alby et al., 2010; Erdman et al., 1998). Cell to cell interactions and membrane
dynamics appear to be central to the function of Fig1 in yeast mating and point to a possible
similar role in filamentous fungi that may explain the blocking of sexual development in F.
graminearum and the reduced female fertility N. crassa seen in Δfig1 mutants. Cellular fusion is
critical to the formation of the coiled perithecium initials and the formation of parenchymatous
tissue from hyphae during fruiting (Trail and Common 2000). Although the blocking of F.
graminearum sexual development at the perithecium initials stage did not allow investigation of
the role of Fig1 in later stages of development in the present study, it seems likely that Fig1

76 

would also be involved at later stages of F. graminearum sexual development. Membrane
dynamics and trafficking are essential for asci development (Beckett and Crawford, 1973; Hung,
1977; Read and Beckett, 1996) and for the delimitation of ascospores by the formation of double
membranes around the progeny nuclei (Czymmek and Klomparens, 1992; Wu and Kimbrough,
2001). As Fig1 is involved in membrane fusion, a role for Fig1 in ascus development and
ascospore delimitation is possible.
The role of Fig1 during vegetative and hyphal grow is also variable among the fungi.
Loss of Fig1 did not affect the growth rate or calcium accumulation of S. cerevisiae or C.
albicans vegetative yeast cells (Brand et al., 2007; Muller et al., 2003). During hyphal growth of
C. albicans, Fig1 expression is low and fluorescence from Fig1-GFP fusion proteins was
undetectable but was readily detected after increased expression upon exposure to mating
pheromone (Yang et al., 2011). Deletion of FIG1 resulted in increased conversion to hyphal
growth of yeast grown on agar, indicating Fig1 plays a role in hyphal suppression in some
environments (Brand et al., 2007). Additionally, loss of Fig1 did not decrease calcium uptake in
C. albicans hyphae, but did affect the thigmotropic response of hyphae to physical ridges,
resulting in the reduced frequency of hyphal tip growth reorientation upon contact with a ridge
compared to wild-type (Brand et al., 2007). Our results show that Fig1 has no detectable effect
on N. crassa vegetative growth. However in F. graminearum, FIG1 deletion results in similar
phenotypes to HACS mutants: reduced vegetative growth, reduced macroconidiation, and
defective calcium homeostasis (Cavinder et al. 2011; Hallen and Trail, 2008). However, the
mycelium of HACS mutants is fluffy compared to wild-type, while Δfig1 strains have mycelia
that are appressed to the substrate surface with little aerial hyphae. The nutrient availability
seems to affect this phenotype some as less aerial hyphae is produced on V8 agar than on the

77 

more nutrient rich carrot agar. Another difference is that the Δfig1 mutants grow on calcium
limited medium, supplemented with BAPTA, as well as wild-type, but Δmid1 and Δcch1 strains
fail to colonize the BAPTA containing medium, supporting the need for HACS, but not LACS,
to support calcium influx in calcium limited environments. It would be interesting to see if
LACS has a function in the hyphal electrophysiology of F. graminearum and N. crassa. HACS
disruption in N crassa resulted in altered electrical properties as measured by voltage clamp
(Lew et al., 2008). In contrast, HACS disruption in F. graminearum did not alter hyphal
electrochemical properties (Cavinder et al., 2011).
The results presented here, taken together with the previous HACS and LACS results in
other fungi and the analysis of calcium signaling components in the origins of multicellularity
database, show the evolutionary flexibility of calcium signaling in the different lineages of extant
eukaryotes. Even within the Sordariomycetes, the roles of HACS and LACS has diverged as seen
by the results with Cch1, Mid1, and Fig1 in F. graminearum and N. crassa. Although not
examined here because of the block in sexual development, we think it is likely that Fig1 plays a
role in sexual development after the transition from perithecium initials to immature perithecium,
and application of sexual development stage specific or inducible RNAi would allow the
investigation of any such role. Additionally, the importance of calcium importation genes in
sexual development suggest that the roles of other calcium signaling components will also be
involved. Finally, the end targets of calcium signaling during sexual development are not known
and investigations to identify them are being pursued.

78 

CHAPTER 4

DEVELOPMENT OF INDUCED RNA INTERFERENCE VECTORS FOR USE IN
FUSARIUM GRAMINEARUM AND RELATED FILAMENTOUS FUNGI
Brad Cavinder and Frances Trail

79 

ABSTRACT
Since its discovery, RNA interference (RNAi) has become an important tool for
biologists, allowing the investigation of genes whose loss is lethal. Here a doxyxyline inducible
expression system was adapted for use in Fusarium graminearum and was utilized to drive
expression of an inverted repeat transgene targeting MYO2, a type V myosin. Induction of RNAi
during sexual development resulted in severely slowed ascus growth, and altered vesicle
trafficking and ascospore delimitation. Removal of the inducing agent resulted in the recovery of
normal sexual development. Induction of RNAi of MYO2 during vegetative growth did not affect
the growth rate. In addition, RNAi of PKS3, a gene involved in synthesis of the black perithecial
pigment was explored. A transformant containing the PKS3 RNAi construct was found to lack
perithecium pigment without doxycycline induction. This result may be from transcriptional
read-through from upstream sequences or from the influence of an enhancer drove expression of
the RNAi construct. If an enhancer is involved, then RNAi constructs can be used for
developmentally specific enhancer trapping provided that a suitable target for RNAi with a
useful phenotype is known. These results show that the doxycycline induced expression system
is effective in F. graminearum, and coupled to RNAi constructs, the system can be used
effectively to examine the role of genes at desired time points.

80 

Introduction
Fusarium graminearum is a cosmopolitan filamentous ascomycete fungus and a plant
pathogen capable of infecting numerous hosts. In North America, F. graminearum is the primary
cause of Fusarium Head Blight (FHB) of wheat and barley and has caused significant financial
losses in the past two decades (Nganje et al., 2001; Trail, 2009). Both ascospores and
macroconidia are inoculum for FHB, but ascospores are thought to be the primary inoculum in
the field. Ascospores were found to adhere to wheat spikes more robustly than macroconidia
(Markell and Francl, 2003), and air sampling studies consistently find more airborne ascospores
than macroconidia, although macroconidia are occasionally found in equal or greater numbers
(Fernando et al., 2000; Inch et al., 2005; Markell and Francl, 2003). Desjardins et al (2006)
found that ascospore non-producing strains of F. graminearum were significantly less able to
cause FHB epidemics than wild-type ascospore producing strains. Finally, phylogenetic studies
from around the world characterizing field isolates showed high genetic diversity among the
isolates, little to no linkage disequilibrium between genetic markers, and almost as many
haplotypes as isolates, suggesting a high rate of recombination and thus sexual reproduction in
the field (Karugia et al., 2009; Tóth et al., 2005; Walker et al., 2001; Ward et al., 2008, Zeller et
al., 2003).
Ascus development is a dynamic process that results in the destruction of asci upon the
forcible discharge of ascospores, meaning that the process is one way and asci do not need to
recover from the changes they undergo during development. Membrane dynamics is an
important part of ascus development as karyogamy, meiosis, and a round of mitosis all occur in
the ascus to generate eight progeny nuclei and a double layer of membranes is used to delimit
progeny ascospores (Czymmek and Klomparens, 1992; Read and Beckett, 1996). In Sordaria

81 

macrospora, actin and myosin were shown to be required for the transition from crozier to ascus.
These two proteins also played a role in ascospore delimitation, as pharmacological inhibition of
either actin polymerization or actin-myosin interaction function disrupted these processes
(Thompson-Coffe and Zickler, 1993). This function is likely carried out by class V myosins,
which are involved in vesicle transport in S. cerevisiae (Pruyne et al., 2004). The class V myosin
ortholog in F. graminearum is MYO2 (FGSG_07469).
RNA interference (RNAi) is the process by which mRNAs are posttranscriptionally
downregulated by short 21-25 nucleotide double-stranded RNA (dsRNA) fragments. The process
starts when Dicer, an RNAse III enzyme, digests dsDNA into short interfering RNA (siRNA)
that are incorporated into the RNA induced silencing complex (Bernstein et al. 2001; Pham et al.,
2004; Tomari et al., 2004 ).The RNA induced silencing complex utilizes the siRNA to target
complementary sequences in mRNA for digestion. Since its discovery, RNAi has become a
widely used tool to study gene function. RNAi techniques have used constitutive, induced, and
tissue and developmental stage specific expression systems for transcription of the RNAi
construct (Lee and Kumar, 2009; Rao et al., 2006). A doxycycline induced expression system
employing an engineered tet-ON system derived from the Escherichia coli tetracyclineresistance operon was adopted for use in the filamentous ascomycete Aspergillus nidulans (Vogt
et al., 2005). This system consists of two parts. The first part is a reverse transactivator (rtTA2SM2) fusion protein between the DNA binding domain of TetR, a transcriptional repressor protein
that binds to tetracycline operator sequences (tetO), and a multimerized minimal VP16
transcriptional activator domain. The fusion protein contains additional mutations to increase
binding affinity to doxycycline. The second part is an expression construct with seven copies of
tetO (tetO7) followed by an A. nidulans minimal gpdA promoter (Pmin). In the presence of

82 

doxycycline, rtTA2S-M2 will bind to tetO7 and drive expression from Pmin. RNAi was
effectively applied in F. graminearum to knockdown the expression of the TRI6 gene, a
transcription factor needed for trichothecene mycotoxin production, using a constitutively
expressed inverted repeat transgene (IRT) construct with ~600 bp TRI6 repeats to generate a
hairpin RNA with a long dsRNA region (McDonald et al., 2005).
Our goal in this study was to develop inducible RNAi for studies of genes important in
perithecium development and function. Many of these genes cause loss of sexual development
in knockout strains (Kim et al., 2007; Oide et al., 2007; Turgeon et al., 2008; Urban et al., 2003).
Here we combined the doxycycline induced expression system of Vogt et al. (2005) with the IRT
RNAi expression construct of McDonald et al (2005) for use in F. graminearum. To this end,
targeted IRT RNAi expression vectors for PKS3 (FGSG_17168), a polyketide synthase needed
to produce the dark perithecium pigment of F. graminearum, and MYO2 were constructed and
introduced into F. graminearum using the doxycycline inducible system. The results illustrate
the ability to down regulate gene expression at specific time points to affect development and
understand gene function. Taken with the previous results of driving reporter gene expression,
the doxycycline inducible expression system can be used for both positive and negative
regulation of gene expression.

Material and Methods
Strains, culture conditions
Strains of F. graminearum used in this study are listed in Table 1. Strains were
maintained as macroconidia and colonized V8 agar pieces in 35% sterile glycerol at -80°C.
Macroconidia were produced in carboxymethylcellulose (CMC) broth as previously described

83 

TABLE 5. Strains used in this study
Genotype
Strain
Fusarium graminearum
PH-1(FGSC 9075)
PH-1 55
502-4
M2-II
M2-2
M2-5
M2-7
P3-1

wild-type (NRRL 31084)
nit3
nit3 rtTA2s-M2
MYO2 RNAi
MYO2 RNAi rtTA2s-M2
MYO2 RNAi rtTA2s-M2
MYO2 RNAi rtTA2s-M2
PKS3 RNAi

Source

Trail and Common, 2000
Cavinder et al., 2011
This Study
This Study
This Study
This Study
This Study
This Study

(Cappellini and Peterson, 1965). Sexual development was induced by removing the surface
hyphae from fully colonized carrot agar and adding 1 ml of a sterile 2.5% (w/v) Tween 60
solution (Bowden and Leslie, 1999; Trail and Common, 2000). Outcrosses were performed by
inoculating carrot agar plates with two strains and inducing sexual development after full
colonization of the medium. Recombinant perithecia form at the interface of the two strains.
Saccharomyces cerevisiae strain FY834 (Winston et al., 1995) was used for yeast
transformations and was received from Dr. Angus Dawe (New Mexico State University, Las
Cruces, NM). S. cerevisiae strains were stored at -80°C in an appropriate liquid growth medium
amended to 35% glycerol. One Shot TOP10 Chemically Competent Escherichia coli cells (Life
Technologies, Carlsbad, CA) were used for bacterial transformations.

Nucleic acids manipulation
DNA was extracted from F. graminearum mycelium grown in liquid yeast extractsucrose medium using a hexadecyltrimethylammonium bromide (CTAB) method as previously
described (Cavinder et al., 2011; Hallen and Trail, 2008). F. graminearum nucleotide data were
obtained from the MIPS Fusarium graminearum Genome Database (http://mips.helmholtz-

84 

muenchen.de/genre/proj/FGDB/). A standard alkaline lysis protocol was followed to extract
plasmid DNA from E. coli (Sambrook and Russell, 2001). Plasmid DNA was extracted from S.
cerevisiae cells using the Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research) or by
incubating cells in 400 µl of 50 mM potassium phosphate, pH 7.5 with 5 µl (25 U) of Zymolyase
(Zymo Research) for 45 min at 37°C followed by the standard E. coli alkaline lysis protocol.
Extracted plasmids were screened by PCR to identify clones with the desired constructs.
The Primers used in this study are listed in Table 2. Phusion High-Fidelity DNA
Polymerase (New England Biolabs) was used for PCR. All PCR products were size fractionated
by agarose gel electrophoresis. The appropriately sized band for a given reaction was cut out of
the gel and purified using the Wizard SV Gel and PCR Clean-Up System (Promega, Madison,
WI) following the manufacturer's protocol. Single and double restriction enzyme digests were
performed using the manufacturer's suggested reaction conditions and digested DNA fragments
were purified using the DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA). DNA
ligations were performed using T4 DNA ligase (New England Biolabs, Ipswich, MA) following
the manufacturer's protocol. Plasmids p500 and p502 (Vogt et al., 2005) were obtained from the
Fungal Genetics Stock Center, and pTMH44.2 (McDonald et al., 2005) and pRS426
(Christianson et al., 1992) were gifts from Dr. Nancy Keller (University of Wisconsin, Madison,
WI) and Dr. Angus Dawe (New Mexico State University, Las Cruces, NM), respectively.

Vector construction
Vectors were generated by a combination of merging PCR amplified DNA fragments
with short overlaps to each other by PCR and by homologous recombination in Saccharomyces

85 

TABLE 6. Primers used in this study
Sequence (5'-3')

Name
For genertion of pYUCH
2µm-F GATCTTTTCTACGCACCTGAACGAAGCATCTGTGCTTCA
2µm-R CTGTGGTATGGTGCGAAGTTCCTATTCTCTAGAAAGTA
Ura3-F GAATAGGAACTTCGCACCATACCACAGCTTTTCAATTCAATTCATC
Ura3-R GACCCCGTAGAAACAGTTTTTTAGTTTTGCTGGCCGCATCTTC
Ori-F GAAGCATAAAGTGTAAAGCGCGTTGCTGGCGTTTTTCCATAG
Ori-R GTTCAGGTGCGTAGAAAAGATCAAAGGATCTTCTTGAGATCC
MCS-F CTTTCACCAGCGTTCCATTCAGGCTGCGCAACTGTTG
MCS-R CAGCAACGCGCTTTACACTTTATGCTTCCGGCTCGTATG
CAT/hph -F CAAAACTAAAAAACTGATGGAGAAAAAAATCACTGGATATACCACCGTTG
CAT/hph -R CAGCCTGAATGGAACGCTGGTGAAAGTAAAAGATGCTGAAGATC
For generation of pYUCH-RNA
TcgrA-F TTTCCCAGTCACGACGACAGCAGAAGAATCTCTCTCCGCTGT
TcgrA-R GTAAACTCGATCGAGGGATTCATGACGTATATTCACCGAGATAGTC
tetO7-F GCAAAACTAAAAAACTGTTTCTACGGGGTCTGACGCTCAGTG
tetO7-R ACTGAAGATGGGCACATGCATGCCATAGGGTACCGA
Pmin-F ATGGCATGCATGTGCCCATCTTCAGTATATTCATCTTCCCATC
Term-R CGTAGCAACCAGGCGTCCAAGCTCTAGAAAGAAGGATTACCTCTA
pYUCH-F
pYUCH-R

86 

TABLE 6 (cont'd)
Name
Sequence (5'-3')
For generation of pYUCH-RNA-MYO2 and pYUCH-RNA-PKS3
pCode-F CATGGGGCGGAATTCGGGCTATGTGCAGGAGAGAACCATCT
pCode-R CGCCGCGCCACTAGTTGATGTCTGCTCAAGCGGGGTAGC
pTemp-F CGTGAATCGCGGCCGCGCTTGAGATCCACTTAACGTTACTGAAATCATC
pTemp-R AAGCTTGGACAATTGCTCAATGTTGTGTCTGATCTTGAAGTTGACC
Myo2 Code-F TGTCGCAAGGAATTCGTCTTCGCTCTTCGGTGGATGAGATC
Myo2 Code-R TGTCTTCAGACTAGTCTCGACCTTGTCGCGCATCCTTG
Myo2 Temp-F ATTGTCTTCGCGGCCGCCTCGACCTTGTCGCGCATCCTTG
Myo2 Temp-R TGTCGCAAGCAATTGGTCTTCGCTCTTCGGTGGATGAGATC
PKS3 Code-F CCCTTACCCGAATTCGCGGTTTCGCCATGAATTGTAATGACC
PKS3 Code-R ACCACTGACACTAGTTTCTGGACCTTGAAGGAAGTTGCGAAG
PKS3 Temp-F GTCAGTGGTGCGGCCGCTTCTGGACCTTGAAGGAAGTTGCGAAG
PKS3 Temp-R CCCTTACCCCAATTGGCGGTTTCGCCATGAATTGTAATGACC
For TAIL-PCR
AD2
AD3
AD5
AD7
AD8

NGTCGASWGANAWGAA
WGTGNAGWANCANAGA
NTCGASTWTSGWGTT
TGWGNAGWANCASAGA
AGWGNAGWANCAWAGG

87 

cerevisiae along with traditional cloning in E. coli. Plasmids amplified by PCR for cloning
cotransformations in S. cerevisiae were cut with DpnI (New England Biolabs) directly in the
PCR reactions to digest methylated DNA from the starting plasmid template. Plasmid p502
contains a reverse tetracycline transactivator (rtTA2s-M2) expression construct and a
hygromycin phosphotransferase (hph) marker and was transformed as is into F. graminearum
strain PH-1 55 protoplasts without modification. Plasmid maps were generated using PlasMapper
(Xiaoli et al., 2004), and are shown in Fig. 1.
Construction of pYUCH. A 1,049 bp fragment containing the URA3 marker and a 1,003 bp
fragment containing the 2 micron origin of replication (2 µM) for selection and episomal
maintenance in S. cerevisiae were amplified from pRS426 using primers Ura3-F and Ura3-R and
2µm-F and 2µm-R, respectively. Three fragments of 430, 638, and 2,499 bp containing the
pBR322 origin of replication (Ori), the pBC SK+ multiple cloning site (MCS), and the
chloramphenicol acetyltransferase (CAT) and hph markers (CAT-hph) for episomal
maintenance, traditional cloning, and selection in E. coli and F. graminearum were amplified by
PCR from pCB1004 (Carroll et al., 1994), using primers Ori-F and Ori-R, MCS-F and MCS-R,
and CAT/hph-F and Cat/hph-R, respectively. Primers Ura3-R and CAT/hph-F contain 5' tails of
23 and 24 bp complementary to the 5' sequence of the CAT/hph and URA3 fragment,
respectively, and the fragments were merged by PCR, generating a 3,570 bp URA3-CAT/hph
fragment. Primers MCS-R and Ori-F contain 11 and 18 bp 5'overlaps to the 5' end of Ori and 3'
end of MCS, respectively, and the fragments were merged by PCR, generating the bp MCS-Ori
fragment. Primers MCS-R and 2µm-F contain 5' tail of 25 and 23 bp complementary to the 5'
end of the 2 µm fragment and the 3' end of the MCS fragment, respectively, and PCR was used
to merge the fragments into the bp MCS-Ori-2µm fragment. Primers Ura3-F and CAT/hph-R

88 

contain 5' overlaps of 13 and 12 bp to the 3' and 5' ends of the MCS-Ori-2µm fragment, and
primers MCS-F and 2µm-R contain 14 bp 5' tails complementary to the 3' and 5' end of the
URA3-CAT/hph fragment, respectively. The URA3-CAT/hph and MCS-Ori-2µm fragments
were cotransformed into S. cerevisiae to generate pYUCH by homologous recombination.
Construction of pYUCH-RNA. A 276 bp fragment containing the A. nidulans cgrA terminator
(TcgrA) and a 330 bp fragment containing seven repeats of the tetracycline operator (tetO7) were
amplified from p502 using primers TcgrA-F and TcgrA-R and tetO7-F and tetO7-R,
respectively. Primers TcgrA-R and tetO7-F contain a 5' tails of 16 and 18 bp complementary to
the 5' end of the tetO7 and the 3' end of the TcgrA fragments, respectively, and the fragments
were merged by PCR to generate a 635 bp TcgrA-tetO7 fragment. A 1,194 bp fragment (eRNAi)
containing a minimal A. midulans gpdA promoter, the empty IRT RNAi sequence with two
cloning sites separated by a partial GFP sequence spacer, and the A. midulans trpC terminator
was amplified by PCR from pTMH44.2 using primers Pmin-F and Term-R. Primers tetO7-R and
Pmin-F contain 5' overlaps of 16 and 14 bp to the 5' end of the eRNAi and the 3' end of tetO7
fragments, respectively. The TcgrA-tetO7 and eRNAi fragments were merged by PCR to
generate the 1,830 bp TcgrA-tetO7-eRNAi fragment. Primers TcgrA-F and Term-R respectively
contain 13 and 17bp 5' overlaps complementary to internal MCS sequences. The entire pYUCH
plasmid excluding 223 bp of internal MCS sequence (pYUCH-amp) was amplified by PCR
using primers pYUCH-R and pYUCH-F that contain 5' tails of 17 and 12 bp complementary

89 

Figure 12
90 

Figure 12 (cont'd)
91 

Figure 12 (cont'd)
92 

Figure 12 (cont'd)
93 

Figure 12 (cont'd)
Figure 12. Plasmid maps of constructed vectors (pages 88-91). Unique sites of commonly
used restriction enzymes are shown with their nucleotide position. For interpretation of the
reference to color in this and all other figures, the reader is referred to the electronic version
of this dissertation.
to the 5' and 3' ends of the TcgrA-tetO7-eRNAi fragment, respectively. The overlapping
pYUCH-amp and TcgrA-tetO7-eRNAi fragments were cotransformed into S. cerevisiae to
generate pYUCH-RNA by homologous recombination.
Construction of targeted RNAi vectors pYUCH-RNAi-Myo2 and pYUCH-RNAi-PKS3. A 644
bp fragment of MYO2 (FGSG_07469) and a 658 bp fragment of PKS3 (FGSG_17168) were
amplified by PCR (Code fragments: fragments to be cloned in one orientation) using primers
Myo2 Code-F and Myo2 Code-R and PKS3 Code-F and PKS3 Code-R, respectively. The same
fragments were also amplified by primers MyoC Temp-F and Myo2 Temp-R and PKS3 Temp-F
and PKS3 Temp-R (Temp fragments: fragments to be cloned in the reverse orientation of the
Code fragments), but differ from the Code fragments in the restriction enzyme restriction sites
contained in 5' tails of the primers. When the Code fragment is ligated into the first IRT cloning
site and the Temp fragment is ligated into the second IRT cloning site, the Code and Temp gene
fragments will be in the reverse orientation of each other, thus generating the hairpin loop. The
Code-F and Code-R primers for both Myo2 and PKS3 contain 5' tails with a EcoRI or SpeI
recognition site and the next 9 bp of the genomic sequence, respectively. Similarly, the Temp-F
and Temp-R primers contain 5' tails containing a NotI or MfeI recognition site and the next 9 bp
of the genomic sequence. The entire pYUCH-RNA plasmid except some sequence between and
including the NcoI and AscI restriction sites of the first IRT cloning site was amplified by PCR
(pCode fragment) using primers pCode-F and pCode-R that are complementary to the 25 and 24

94 

bp immediately downstream of the AscI site and upstream of the NcoI site followed by a EcoRI
or SpeI recognition site and the next 9 bp of the pYUCH-eRNAi sequence, respectively. Double
EcoRI-HF and SpeI (New England Biolabs) digests on the pCode, Myo2 Code, and PKS3 Code
fragments were, individually, performed and purified as previously described. The digests were
purified using the DNA Clean & Concentrator-5 kit (Zymo Research, Irvine, CA), and the
digested pCode fragment was ligated to the digested Myo2 and PKS3 fragments separately and
each ligation was transformed into E. coli to generate pYUCH-RNAi-Myo2c and pYUCHRNAi-PKS3c. Primers pTemp-F and pTemp-R were used to amplify the entire from pYUCHRNAi-Myo2c and from pYUCH-RNAi-PKS3c plasmids by PCR (pTemp fragments) except for
sequence between the BamHI and HindIII recognition sites in second IRT cloning site. NotI-HF
and MfeI-HF (New England Biolobs) double digestions of the Myo2 and PKS3 pTemp and
Temp fragments were performed and purified. The digested MYO2 pTemp and Temp fragments
and PKS3 pTemp and Temp fragments were ligated and transformed into E. coli to isolate the
final doxycycline inducible RNAi vectors pYUCH-RNAi-Myo2 and pYUCH-RNAi-PKS3 that
were used to transform PH-1 protoplasts. Vectors were constructed as detailed with at least two
clones of the desired construct obtained from each E. coli transformation.

Genetic transformations
Transformation of chemically competent One Shot TOP10 E. coli (Life Technologies)
with a ligation reaction was performed per the manufacturer's protocol and transformed cells
were spread on LB agar with an appropriate antibiotic for selection. Single transformed colonies
were transferred to LB broth amended with the appropriate antibiotic for further screening.
Competent cells of S. cerevisiae strain FY834 were prepared and transformed using the Frozen-

95 

EZ Yeast Transformation II Kit (Zymo Research) per the manufacturer's protocol. Polyethylene 
glycol mediated transformation of F. graminearum protoplasts was performed and hygromycin
R

B resistant (hyg ) strains were selected as previously described (Gaffoor et al., 2005). All
transformations were performed with undigested plasmid. To identify transformants containing
complete constructs, DNA extracted from putative transformants was used as template for PCR
with primers Pmin-F and TcgrA-R for the rtTA2s-M2 construct in p502 and TcgrA-F and GFP-R
and GFP-F and Term-R for the doxycycline inducible IRT RNAi constructs in pYUCH-RNAiMyo2 and pYUCH-RNAi-PKS3. Primers Pmin-F and PKS3 Code-R were also paired
individually with GFP-R for PCR using pYUCH-RNAi-PKS3 transformant P3-1 DNA as
template. Amplification from the GFP spacer sequence to the start or end of the construct was
performed because PCR across both IRT sequences was unsuccessful using either plasmid or
transformant DNA as the template likely because the IRT sequences anneal to each during
r

thermocycling. To determine if the plasmid insertions affect sexual development, all hyg

transformants were grown on carrot agar and sexual development was induced and monitored by
visual examination of the cultures and microscopic examination of perithecium squash mounts
during the course of development.

Analysis of sexual crosses
F. graminearum crosses were performed individually between NIT3 nitrate-utilizing
+

(nit ) strains, containing the doxycycline inducible RNAi expression construct from pYUCH-

RNAi-Myo2 or from pYUCH-RNAi-PKS3, and a nit3 non-nitrate-utilizing mutant (nit ) strain,
containing the rtTA2s-M2 expression construct, which have different growth phenotypes on

96 

minimal medium supplemented with tergitol and L(-)sorbose (MMTS; Bowden and Leslie,
1999). Ascospores in cirrhi from individual perithecia were suspended in water and spread onto
MMTS. Progeny from recombinant perithecia were identified as MMTS plates containing nearly
+

-

+

equal numbers of progeny displaying the nit and nit growth phenotypes. Nit progeny were
selected from these plates and individually transferred to Czapek-Dox agar (Thom and Church,
1926) amended to 450 µg/L hygromycin B, and strains displaying vigorous growth were then
transferred to V8 agar for maintenance and subsequent phenotypic characterization, DNA
extraction, and macroconidia production. PCR analysis of DNA extracted from the progeny was
used to screen progeny for those that contained both the rtTA2s-M2 and the doxycycline
inducible RNAi expression constructs, using the same primers for the constructs used to verify
transformants above.

Characterization of the effects of doxycycline on PH-1 and inducible RNAi strains
To determine the effects of doxycycline on F. graminearum vegetative growth, PH-1,
Myo2-2, Myo2-5, and Myo2-7 were grown on carrot agar and carrot agar amended to 200 µg/ml
doxycycline, which is well above the minimum 15 µg/ml doxycycline found to effectively
induce expression of an hph marker using the rtTA2s-M2 and tetO7-Pmin system in A. nidulans
(Vogt et al., 2005). Hyphae from the strains were center inoculated and the colony diameters
were measures after 24 and 48 hr of growth. The first day's growth was subtracted from the
second day's growth to give the growth rate. The effect of doxycycline on sexual development
was also examined. Sexual development was induced on carrot agar normally for each strain, and
at 48 hr post-induction, 12 mm diameter circles were removed from the cultures, trimmed to ~5
mm thickness, and transferred to carrot agar amended to 200 µg/ml doxycycline and to carrot

97 

agar amended to 400 µg/ml doxycycline. Squash mounts of perithecia of all strains were made at
120, 144, and 168 hr post-induction and were examined by microscopy
TAIL-PCR
Three sets of TAIL-PCR reactions were performed on a transformant P3-1 using a
standard protocol modified as follows: 98°C for 45 s initial melting step and 20 s for all other
cycles in all reactions; and 60°C as the annealing temperature for the construct specific primers
(Liu and Whittier, 1994; Nakayama et al., 2001). All three sets consisted of five reactions that
individually used degenerate primers AD2, AD3, AD5, AD7, and AD8 (Nakayama et al., 2001)
and nested primers specific for the PKS3 doxycycline inducible RNAi construct. The first set
used specific primers 3' GFP-R, GFP-R. and 5' GFP-R in the primary, secondary, and tertiary
TAIL-PCR reactions, respectively. The second and third sets used the primers PKS3 TAIL1,
PKS3 TAIL2, and Pmin TAIL3 and PKS3 TAIL2, Pmin TAIL3, and Pmin TAIL4 for the
primary, secondary, and tertiary reactions, respectively. The secondary and tertiary reactions
were size-fractionated by gel electrophoresis with the reactions for the same AD primer in
adjacent lanes. Amplicons in the tertiary reactions that were of an appropriately smaller size than
bands in the secondary reactions were gel purified and submitted for sequencing with the specific
primer used in the tertiary reaction. Samples were sequenced by Michigan State University’s
Research Technology Support Facility using an ABI PRISM 3730 Genetic Analyzer (Applied
Biosystems, Carlsbad, CA).

Statistical Analysis
To assess the significance of intragroup variation and intergroup interaction, analysis of variance

98 

was performed using the R Language and Environment for Windows (R Development Core
Team, 2010).

Microscopy and Imaging
A Leica DM LB microscope (Leica Microsystems GmbH, Wetzlar, Germany) with differential
interference contrast (DIC) capabilities was used to observe samples and images were captured
with a Zeiss AxioCam MRc color camera using AxioVision 4.8.2 (Göttingen, Germany). Nonmicroscopic images were captured with a Nikon Coolpix 995 (Tokyo, Japan). Image processing,
manipulation, and annotation were performed with ImageJ (Abramoff et al., 2004) or Adobe
Photoshop CS2 (San Jose, CA).

Results
r

Six hyg transformants were recovered from transformation of wild-type protoplasts with
pYUCH-RNAi-Myo2, the MYO2 targeting doxycycline inducible RNAi vector. PCR analysis
identified one transformant, designated M2-II, which contained the full Myo2 RNAi construct,
-

r

when induced on carrot agar. Sexual development of M2-II was normal. Six nit hyg
-

transformants were isolated from transformation of PH-1 55 (nit ) protoplasts with p502
containing the rtTA2s-M2 expression construct conferring transformants with constitutive
expression of the doxycycline responsive transactivator and the selectable hph marker. PCR
analysis of the PH-1 55 nit+ colonies revealed one transformant, designated 502-4, that

99 

Growth rate (mm/day)

22.5

20.0

17.5
Control
Doxy

15.0

12.5

10.0
wt

M2‐2

M2‐5

M2‐7

Strains
Figure 13. Growth rates of wild-type MYO2 RNAi strains. Growth rates on carrot agar for
all strains were not significantly different from each other with or without doxycycline
treatment.
contained the full rtTA2s-M2 expression construct. Sexual development of 502-4 was similar to
wild-type PH-1.
r

M2-II was crossed to 502-4, and 8 nit+ progeny were recovered with 5 progeny being hyg . PCR
r

analysis indicated that 3 nit+ hyg progeny harbored both the p502 rtTA2s-M2 expression
construct and the full pYUCH-RNAi-Myo2 doxycycline inducible RNAi expression construct
and were designated M2-2, M2-7, and M2-5. The growth rates of PH-1, M2-2, M2-5, and M2-7
on carrot agar and carrot agar amended to 200µg/ml doxycycline were assessed (Fig. 2). No
significant differences were found between the strains with or without doxycycline treatment.

100 

Sexual development of the strains was induced on carrot agar, and at 72 hr post-induction,
portions of the cultures were transferred to carrot agar with 200 µg/ml doxycycline.
Development of both sets of cultures was monitored by microscopic examination of perithecia
squash mounts (Figure 3). On carrot agar, all strains developed normal perithecia.
For the cultures transferred to carrot agar with 200 µg/ml doxycycline, sexual
development was normal for wild-type, but was altered in M2-2, M2-5, and M2-7, which
exhibited phenotypes of different severity (M2-7 > M2-2 >M2-5; Figure 3). Exposure to
doxycycline slowed development in all three strains. Specifically, croziers (young, hook-shaped
asci) remained for an extended time before developing further into asci and were still numerous
at 168 hr post-induction, normally beyond the time when asci are fully mature in wild-type (Trail
and Common, 2000; Hallen et al, 2009). Asci that were delayed in development were filled with
vesicles even at 168 hr post-induction, the time-point at which normal maturation is complete.
Delimitation and development of ascospores in these strains was also altered with a combination
of reduced delimitation and abnormal morphology of ascospores. Asci of wild-type are normally
filled with vesicles during early stages of development, but they become more sparse as
development progresses until there are almost no vesicles in the ascus cytosol at ascus maturity
(144 - 168 hr). In addition to those involved in ascospore delimitation, these vesicles merge with
the outer ascus membrane and are the source of material for ascus elongation (Trail and
Common, 2000). Development of all strains, including wild-type, transferred to carrot agar
amended to 400 µg/ml doxycycline was slowed (data not shown), so these cultures were not used
further. Transfer of M2-2, M2-5, and M2-7 cultures from carrot agar with 20 µg/ml doxycycline
to unamended carrot agar at 168 hr post-induction resumed normal development (personal
observation).

101 

r

Five hyg transformants were recovered from a single transformation experiment of wildtype protoplasts with pYUCH-RNAi-PKS3, the doxycycline inducible RNAi vector targeting
PKS3. Sexual development of the 5 transformants was normal. However, strain P3-1 lacked the
dark perithecium pigment that requires PKS3 function in order to be produced (Fig. 4). PCR
analysis on extracted P3-1 DNA failed to produce an amplicon with primers TcgrA-F and GFPR. Approximately sized amplicons, of 990 and 756 bp, were produced using primers Pmin-F and
PKS3 Code-R, individually, with GFP-R, respectively. These results suggest that only some of
the TcgrA sequence inserted with the rest of the construct during integration of pYUCH-RNAiPKS3 into the F. graminearum genome. To determine the extent of the TcgrA-Pmin end of the
PKS3 construct that integrated and the adjacent genomic sequence, three sets of TAIL-PCR
reactions were performed. The first set of reactions used nested primers that were all
complementary to the gfp spacer of the RNAi construct. An amplicon in the AD8 tertiary
reaction was purified and sequenced. The sequence contained gfp sequence, the EcoRI
recognition site used for cloning, and then PKS3 Code fragment (see methods) sequence but did
not reach Pmin sequence.

Discussion
Doxycycline induced IRT expression targeting MYO2 effectively reduced the rate of
crozier to ascus transition, ascus maturation, and disrupted ascospore delimitation, demonstrating
that Myo2 function is important for proper ascus and ascospore development, but not for
filamentous growth. These results share similarities with previous results in S. macrospora using
Cytochalasin D, an inhibitor of actin polymerization, and, separately, the actin-myosin
interaction inhibitor 2,3-butanedione monoxime (BDM), which found that both actin and

102 

myosins are required for crozier developmental progression and play a role in ascospore
delimitation and development (Thompson-Coffe and Zickler, 1993). However, BDM has been
found to inhibit ATPase acitvity of type II myosins, but not type I or type V. The specific
targeting of MYO2 and the ability to target the other F. graminearum myosins will allow the
individual examination of their function in ascus development.
Uninduced expression of a PKS3 targeting RNAi vector resulted in perithecia lacking
pigment, a phenotype seen in PKS3 knockouts (Gaffoor et al., 2005). Although the genetic
location of the insertion is not yet known, it is likely that transcription read-through from a gene
in the 5' direction from Pmin or transcriptional activation by an enhancer may be involved in the
loss of PKS3 function. These results suggest that the doxycycline inducible RNAi vectors can be
used without the rtTA2s-M2 expression vector for developmentally specific enhancer trapping
provided that a suitable target for RNAi with a useful phenotype is known.
The tet-ON inducible expression is known to display some leaky expression (Ostap,
2002), and Vogt et al. (2005) found that only 10-15% of strains with both rtTA2s-M2 and an
inducible expression construct were inducible. However, the variation in the severity of the
phenotypes between M2-2, M2-5, and M2-7 is somewhat different given that they are siblings
from the same cross and progeny from the same insertion event. The leaky expression of the tetOn system refers to expression from Pmin without addition of doxycycline. Here that would
result in RNAi against MYO2, but this effect was not seen in M2-2, M2-5, and M2-7, which
developed similarly to wild-type when doxycycline was absent. The differences seen with these
strains may result from differing amounts of the reverse transactivator rtTA2s-M2 being
produced and, thus, differing capability of these strains to respond to doxycycline. Though PH-1
55 was generated from PH-1 and no noticeable phenotypic differences are seen between the

103 

Figure 14
104 

Figure 14 (cont'd)
Figure 14. Asci of wild-type and MYO2 RNAi strains with or without doxycycline
treatment. Wild-type is unaffected at all time points by doxycycline treatment. Strains
M2-2, M2-5, and M2-7 develop normally on unamended carrot agar but development is
slowed on carrot agar containing doxycycline. The effect is greatest in M2-7. Even at
168 post-sexual induction, there are many immature asci filled with vesicles and very
few ascospores are developing. Scale is the same for all images, and scale bars = 20 µm.
strains other than nitrate utilization capability, there could be other genetic mutations present in
PH-1 55 that segregated differently in three siblings. These results suggest other factors may be
involved such as differences in genetic background or in epigenetic regulation from
recombination during meiosis. While it would be interesting to know the cause of the differences
seen here, they do not diminish the utility or versatility of doxycycline induced RNAi. The
doxycycline induced expression
system used here to can be used to
influence gene expression both
positively and negatively, expressing a
desired gene or RNAi construct,
respectively, and provides a powerful
tool for investigations into essential or
process essential genes in F.
graminearum and other filamentous
fungi.

 
Figure 15. Loss of perithecium pigment in P3-1.
Sexual development was induced in co-culture of
P3-1 and wild-type. The left side of the image is P31 with wild-type on the right. A P3-1 perithecium is
indicated by the white arrowhead. The black arrow
head points to a wild-type wt perithecium.

105 

CONCLUSION
This work has provided insight into some of the pathways involved in F. graminearum
growth and development and has generated tools for use in filamentous fungi. The results of the
work presented here show that calcium signaling and myosin function play important roles in the
sexual development of F. graminearum. Gene deletion strains of all three HACS and LACS
components MID1 and CCH1 and FIG1, respectively, significantly reduce F. graminearum
growth and development. There are likely more components to both of these calcium uptake
systems. Fig1 is involved in importation of calcium, but it has no primary sequence or structural
domains that suggest it functions as a calcium channel itself. Its role in membrane-membrane
interaction seems a likely reason for the aborted perithecium development seen in the Δfig1
mutants. The mechanism and gene(s) directly involved in LACS calcium importation remain
cryptic. MID1 is also mostly thought to play a modulatory role in calcium uptake, but there are
some results in studies of S. cervisiae that suggest it may form channels itself (Kanzaki et al.,
1999; Locke et al., 2000; Tada et al., 2003). The role of CCH1 is well established as a calcium
channel orthologous to mammalian L-type voltage gated calcium channels, though the fungal
members appear to have amino acid substitutions in the voltage sensing domains that may reduce
voltage sensing (Liu and Gelli, 2008; Hong et al., 2010).
Future studies should be geared towards determining the other genes and proteins
involved in the ascospore discharge mechanism. Is calcium regulation involved in their function
as well? It is clear that MYO2 is crucial for ascus development, but a direct role in discharge has
not been examined yet. These results also show that a doxycycline inducible expression system
can be utilized in this fungus to drive expression of a RNAi construct, and presumably, any other
desired construct or gene whether an endogenous or transgenic sequence. Targeting the other two

106 

F. graminearum myosins for RNAi during sexual development is partially completed and it will
be interesting to see if they also are involved in sexual development. FIG1 is also a prime target
for gene expression knockdown by the doxycycline induced RNAi, because examination of its
role in later stages of sexual development was not possible with deletion mutants. Other genes
involved in membrane dynamics, cytoskeleton organization, and polarized growth are also
candidate targets. Without the reverse transactivator, rtTA2s-M2, the TcgrA tetO7-Pmin
constructs could be used in enhancer trapping experiments, using either a reporter gene or an
RNAi construct.
A working model of ascus development and ascospore discharge is presented in Fig. 1.

Figure 1. Working model of ascospore discharge. (A) Osmolyte primimg (B) Osmolyte
accumulation and rapid ascus expansion. (C) Possible discharge trigger. (D) Forcible ejection of
ascospores. Not to scale. M = mannitol, p = periphyses

107 

Calcium or other signals activate a proton pumping ATPase. Mannitol buildup may be the result
of the lipid catalysis that occurs during the middle to late stages of sexual development. Whether
+

+

a calcium signal is involved is not known. The plasma membrane H -ATPase pumps H ions out
+

+

-

of the ascus. H efflux drives the influx of K and Cl ions into the ascus, and the increased
concentration of mannitol drives the initial influx of water and ascus expansion. This expansion
activates Mid1 and Cch1 in the ascus membrane, causing an influx if calcium. The Ca

2+

influx

activates calcineurin which interacts with Cch1 to decrease calcium influx, providing cytosolic
calcium availability feedback. Actin reorganization during development may be influenced by
calcium signals and allows the ascus to freely stretch. Increasing turgor pressure throughout the
process may facilitate ascus expansion. As an expanding ascus reaches the ostiole, it comes into
contact with the periphyses that line the inside of the ostiole. This contact may trigger
mechanosensitive calcium influx through Mid1/Cch1. This calcium signal may induce further
actin reorganization. Actin and myosins may be involved in ascospore discharge by the
transportation of vesicles containing cell wall degrading enzymes to the ascus pore where they
degrade the pore, by the generation or release of tension on actin filaments and myosins at the
pore to either pull apart or allow the opening of the pore, respectively, or both mechanisms. It is
also possible that enzymes secreted from the periphyses help degrade the ascus wall and pore
from the outside. Regardless of the mechanism, the opening of the pore releases the ascospores.
Further work remains to identify the genes involved in ascospore discharge and to clarify the
proposed roles of the components of this working model of F. graminearum ascospore
discharge.

108 

REFERENCES

109 

REFERENCES

Alberghina, A., and A. Benni. 1980. Different sensitivity to mitochondrial inhibitors of
respiration in Fusarium oxysporum and Fusarium solani. Phytopathologische Zeitschrift.
99:138-145.
Allbritton, N.L., T. Meyer, and L. Stryer. 1992. Range of messenger action of calcium ion and
inositol 1,4,5-trisphosphate. Science 258: 1812-1815.
Atanasoff, D. 1920. Fusarium-blight (scab) of wheat and other cereals. Journal of Agricultural
Research 10.
2+

Armstrong. D.L. 1989. Calcium channel regulation by calcineurin, a Ca -activated phosphatase
in mammalian brain. Trends in Neurosciences 12: 117-122.
Basile L. J., R. C. Willson, B. T. Sewell, and M. J. Benedik. 2008. Genome mining of cyanidedegrading nitrilases from filamentous fungi. Appl. Microbiol. Biotechnol. 80: 427-435.
Bement, W.M., and M.S. Mooseker. 1995. TEDS Rule: A molecular rationale for differential
regulation of myosins by phosphorylation of the heavy chain head. Cell Motility and the
Cytoskeleton 31: 87-92.
Bennett, J.W., and M. Klich. 2003. Mycotoxins. Clinical Microbiology Reviews 16: 497-516.
Berridge, M.J., M.D. Bootman, and H.L. Roderick. 2003. Calcium Signalling: Dynamics,
Homeostasis and Remodelling. Nat. Rev. Mol. Cell. Biol. 4: 517-529.
Berridge, M.J. 2007. Calcium signalling, a spatiotemporal phenomenon. In: Calcium: a matter of
life or death, Eds. J. Krebs and M. Michalak, Elsevier Science.
Beckett, A., and R.M. Crawford. 1973. The Development and Fine Structure of the Ascus Apex
and its Role During Spore Discharge in Xylaria longipes. New Phytologist 72: 357-369.

110 

Biess, A., E. Korkotian, and D. Holcman. 2011. Barriers to Diffusion in Dendrites and
Estimation of Calcium Spread Following Synaptic Inputs. PLoS Computational Biology
7: e1002182. doi:10.1371/journal.pcbi.1002182
Bistis, G.N., 1981. Chemotropic Interactions between Trichogynes and Conidia of Opposite
Mating-Type in Neurospora crassa. Mycologia. 73: 959-975.
Bonila, M., K.K. Nastase, and K.W. Cunningham. 2002. Essential role of calcineurin in response
to endoplasmic reticulum stress. The EMBO Journal 21: 2343-2353.
Booth, C. 1971. The genus Fusarium. Commonwealth Mycological Institute, Kew, Surrey,
England.
Bowden, R.L., and J. F. Leslie. 1999. Sexual recombination in Gibberella zeae. Phytopathology
89: 182-188.
Brand, A., K. Lee, V. Veses, N. Gow. 2009. Calcium homeostasis is required for contactdependent helical and sinusoidal tip growth in Candida albicans hyphae. Molecular
Microbiology 71: 1155-1164.
Brand, A., S. Shanks, V. Duncan, M. Yang, K. Mackenzie, and N. Gow. 2007. Hyphal
orientation of Candida albicans is regulated by a calcium-dependent mechanism. Current
Biology 17: 347-352.
Brenner, J., N. Gomez-Ospina, and R. Dolmetsch. 2007. Temporal and spatial regulation of
calcium-dependent transcription. In: Calcium: a matter of life or death, Eds. J. Krebs and
M. Michalak, Elsevier Science.
Bucheli, T.D., F.E. Wettstein, N. Hartmann, M. Erbs, S. Vogelgsang, H-R. Forrer, and R.P.
Schwarzenbach. 2008. Fusarium Mycotoxins: Overlooked Aquatic Micropollutants?.
Journal of Agricultural and Food Chemistry 56: 1029-1034.
Buller, A.H.R. 1909. Researches on Fungi. Longmans, Green and CO., London, England. 287
pp.

111 

Burgess, L. w., Dodman, R. L, Pont, W. and Mayers, P. 1981. Fusarium diseases of wheat, maize
and grain sorghum in Eastern Australia. In Fusarium: Diseases, Biology, and Taxonomy,
P.E. Nelson, T.A. Toussoun and R.J. Cook eds., The Pennsylvania State University Press,
University Park, PA.
Canero, E., J.C. Ribas, B. Garcia, A. Duran, and Y. Sanchez. 2000. Schizosaccharomyces pombe
ehs1p is involved in maintaining cell wall integrity and in calcium uptake. Mol. Gen.
Genet. 264: 173-183.
Cappellini, R.A., and J.L. Peterson. 1965. Macroconidium formation in submerged cultures by a
non-sporulating strain of Gibberella zeae. Mycologia 57: 962-966.
Carafoli, E.L. 2005. Calcium - a universal carrier of biological signals. The FEBS Journal 272:
1073-1089.
Carafoli, E. 2007. The unusual history and unique properties of the calcium signal. New
Comprehensive Biochemistry 41: 3-22.
Carafoli, E., L. Santella, D. Branca, and M. Brini. 2001. Generation, control, and processing of
cellular calcium signals. Critical Crit Rev Biochem Mol Biol. 36:107-260.
Carroll, A.M., J.A. Sweigard, and B. Valent. 1994. Improved Vectors for Selecting Resistance to
Hygromycin. Fungal Genetics Newsletter 41: 22.
Carroll, G.C. 1969. A study of the fine structure of ascosporogenesis in Saccobolus kerverni.
Arch Mikrobiol 66: 321-339.
Catlett, N.L., B. Lee, O.C. Yoder, and B.G. Turgeon. 2003. Split-marker recombination for
efficient targeted deletion of fungal genes. Fungal Genetics Newsletter 50: 9-11.
Chongo G., B.D. Gossen, H.R. Kutcher J. Gilbert, T.K. Turkington, M.R. Fernandez, and D.
Mclaren. 2001. Reaction of seedling roots of 14 crop species to Fusarium graminearum
from wheat heads. Canadian Journal of Plant Pathology 23: 132-137.
Chrismas, M. 1980. Ascospore Discharge and Germination in Xanthoria Parietina. The
Lichenologist 12: 403-405.

112 

Clapham, D.E. 2007. Calcium Signaling. Cell 131: 1047-1058.
Clarkson, J., J. Staveley, K. Phelps, C. Young, and J. Whipps. 2003. Ascospore release and
survival in Sclerotinia sclerotiorum. Mycological Research 107: 213-222.
Connorton, J.M., K.D. Hirschi, and J.K. Pittman. 2011. Mechanism and Evolution of Calcium
Transport Across the Plant Plasma Membrane. In: The Plant Plasma Membrane, Eds.
A.S. Murphy, B. Schulz, and W. Peer, Springer.
Coons, G.H. 1918. Twentieth Annual Report of The Michigan Academy of Science. Fort Wayne
Printing Company, Fort Wayne, IN.
Courchesne, W., and S. Ozturk. 2003. Amiodarone induces a caffeine-inhibited, MID1-depedent
rise in free cytoplasmic calcium in Saccharomyces cerevisiae. Molecular Microbiolgy 47:
223-234.
Courchesne, W.E., C. Vlasek, R. Klukovich, and S. Coffee. 2011. Ethanol induces calcium
influx via the Cch1-Mid1 transporter in Saccharomyces cerevisiae. Arch Microbiol 193:
323-334.
Craig, R., and J.L. Woodhead. 2006. Structure and function of myosin filaments. Current
Opinion in Structural Biology 16: 204-212.
Cyert, M.S. 2001. Genetic analysis of calmodulin and its targets in Saccharomyces cerevisiae.
Annual Review of Genetics 35: 647-672.
Czymmek, K.J., and K.L. Klomparens. 1992. The ultrastructure of ascosporogenesis in freezesubstituted Thelebolus crustaceus: enveloping membrane system and ascospore initial
development. Canadian Journal of Botany 70: 1669-1683.
Dänicke, S., K.-P. Brüssow, H. Valenta, K.-H. Ueberschär, U. Tiemann, and M. Schollenberger.
On the effects of graded levels of Fusarium toxin contaminated wheat in diets for gilts on
feed intake, growth performance and metabolism of deoxynivalenol and zearalenone.
Molecular Nutrition and Food Research 49: 932-943.

113 

Davis, R.H. 2000. Neurospora. Contributions of a model organism. Oxford University Press,
New York.
Davis, R.L., and D. de Serres. 1970. Genetic and microbial research techniques for Neurospora
crassa. Methods Enzymology 27A: 79-143.
DeBary, A. 1887. Comparative Morphology and Biology of the Fungi Mycetozoa and Bacteria.
Clarendon Press, Oxford.
Demaurex, N., and C. Distelhorst. 2003. Apoptosis - the calcium connection. Science 300: 6567.
Desjardins, A.E., R.H. Proctor, G. Bai, S.P. McCormick, G. Shaner, G. Buechley, and T.M.
Hohn. Reduced virulence of trichothecene-nonproducing mutants of Gibberella zeae in
wheat field tests. Molecular Plant-Microbe Interactions 9: 775-781.
Desnos, C., S. Huet, and F. Darchen. 2007. ‘Should I stay or should I go?’: myosin V function in
organelle trafficking. Biology of the Cell 99: 411-423.
Desrivières, S., F.T. Cooke, H. Morales-Johansson, P.J. Parker, and M.N. Hall. 2002.
Calmodulin controls organization of the actin cytoskeleton via regulation of
phosphatidylinositol (4,5)-bisphosphate synthesis in Saccharomyces cerevisiae.
Biochemical Journal 366: 945-951.
Di Tommaso, P., S. Moretti, I. Xenarios, M. Orobitg, A. Montanyola, J.M. Chang, J.F. Taly, and
C. Notredame. 2011. T-Coffee: a web server for the multiple sequence alignment of
protein and RNA sequences using structural information and homology extension.
Nucleic Acids Research 39: W13-W17.
Dill-Macky, R., and R.K Jones. 2000. The effect of previous crop residues and tillage on
Fusarium head blight of wheat. Plant Disease 84: 71-76.
Dill-Macky, R., and B. Salas. 2002. Effect of cereal residue burning on the incidence and
stratified distribution of Fusarium graminearum and Cochliobolus sativus in wheat and
barley plants. In: 2002 National Fusarium Head Blight Forum Proceedings. East Lansing,
MI, USA: Michigan State University, 140.

114 

Dodge, B.0. 1935. Mechanics of Sexual Reproduction in Neurospora. Mycologia. 27: 418-438.
Dorn, G.W.II. 2009. Apoptotic and non-apoptotic programmed cardiomyocyte death in
ventricular remodelling. Cardiovascular Research 81: 465-473.
Erdman, S.E., L. Lin, M. Malczynski, and M. Snyder. 1998. Pheromone regulated genes required
for yeast mating differentiation. J. Cell Biol. 140:461-483.
Fairhead, C., A. Thierry, F. Denis, M. Eck, and B. Dujon. 1998. ‘Mass-murder’ of ORFs from
three regions of chromosome XI from Saccharomyces cerevisiae. Gene 223: 33-46.
Fairhead, C., B. Llorente, F. Denis, M. Soler, and B. Dujon. 1996. New vectors for combinatorial
deletions in yeast chromosomes and for gap-repair cloning using ‘split-marker’
recombination. Yeast 12: 1439-1457.
Fischer, M., J. Cox, D.J. Davis, A. Wagner, R. Taylor, A.J. Huerta, and N.P. Money. New
information on the mechanism of forcible ascospore discharge from Ascobolus immersus.
Fungal Genetics and Biology 41: 698-707.
Fischer, M., N. Schnell, J. Chattaway, P. Davies, G. Dixon, and D. Sanders. 1997. The
Saccharomyces cerevisiae CCH1 gene is involved in calcium influx and mating.
Federation of European Biochemical Societies Letters 419: 259-262.
Fernando, W.G.D., J.D. Miller, W.L. Seaman, K. Seifert, and T.C. Paulitz. 2000. Daily and
seasonal dynamics of airborne spores of Fusarium graminearum and other Fusarium
species sampled over wheat plots. Canadian Journal of Botany 78: 497-505.
Franca-Koh, J., Y. Kamimura, and P. Devreotes. 2006. Navigating signaling networks:
chemotaxis in Dictyostelium discoideum. Current Opinion in Genetics & Development
16: 333-338.
Fujisaki, H., J.P. Albanesi, and E.D, Korn. 1985. Experimental Evidence for the Contractile
Activitoife sA canthamoeba Myosins IA and IB. The Journal of Biological Chemistry
260: 11183-11189.

115 

Gaffoor, I., D.W. Brown, R. Plattner, R.H. Proctor, W. Qi, and F. Trail. 2005. Analysis of the
polyketide synthase genes in the filamentous fungus Gibberella zeae (anamorph
Fusarium graminearum). Eukaryotic Cell 4: 1926-1933.
Glass, N.L., S.J. Vollmer, C. Staben, J. Grotelueschen, R..L Metzenberg and C. Yanofsky. 1988.
DNAs of the two mating-type alleles of Neurospora crassa are highly dissimilar. Science
241:570-573.
Gouy M., S. Guindon, and O.Gascuel. 2010. SeaView version 4: a multiplatform graphical user
interface for sequence alignment and phylogenetic tree building. Molecular Biology and
Evolution 27: 221-224.
Gregory, P.H., and O.J. Stedman. Spore dispersal in Ophiobolus graminis and other fungi of
cereal foot rots. Transactions of the British Mycological Society 41: 449-456.
Groppi, S., F. Belotti, R.L. Brandão, E. Martegania, and R. Tisi. 2001. Glucose-induced calcium
influx in budding yeast involves a novel calcium transport system and can activate
calcineurin. Cell Calcium 49:376-386.
Guenther, J., H.E. Hallen-Adams, H. Bücking, Y. Shachar-Hill, and F. Trail. 2009.
Triacylglyceride metabolism by Fusarium graminearum during colonization and sexual
development on wheat. Molecular Plant-Microbe Interactions 22: 1492-1503.
Guenther, J. and F. Trail. 2005. The development and differentiation of Gibberella zeae
(anamorph: Fusarium graminearum) during colonization of wheat. Mycologia 97: 229237.
Hackett, C.J., and K.C. Chen. 1976. Ultrastructure of developing ascospores in Sordaria
brevicollis. Journal of Bacteriology 126: 883-894.
Hallen H.E., M. Huebner, S.H. Shiu, U. Güldener, and F. Trail. 2007. Gene expression shifts
during perithecium development in Gibberella zeae (anamorph Fusarium graminearum),
with particular emphasis on ion transport proteins. Fungal Genet. Biol. 44: 1146-56.
Hallen, H., and F. Trail. 2008. The L-Type calcium ion channel Cch1 affects ascospore discharge
and mycelial growth in the filamentous fungus Gibberella zeae (anamorph Fusarium
graminearum). Eukaryotic Cell. 7:415-424.

116 

Hartmann, N., M. Erbs, H.-R. Forrerm S. Vogelgsang, F.E. Wettstein, R.P. Scharzenbach, and
T.D. Bucheli. 2008. Occurrence of Zearalenone on Fusarium graminearum Infected
Wheat and Maize Fields in Crop Organs, Soil, and Drainage Water. Environmental
Science and Technology 42: 5455-5460.
Healy, R.A. 2003. Mattirolomyces tiffanyae, a new truffle from Iowa, with ultrastructural
evidence for its classification in the Pezizaceae. Mycologia 95: 765-772.
Hille, B. 1994. Modulation of ion-channel function by G-protein-coupled receptors. Trends in
Neuroscience 17: 531-536.
2+

Hong, M.P., K. Vu, J. Bautos, and A. Gelli. 2010. Cch1 restores intracellular Ca in fungal cells
during ER stress. The Journal of Biological Chemistry 285: 10951-10958.
Iida, H., H. Nakamura, T. Ono, M.Okumura, and Y. Anraku. 1994. MID1, a novel
Saccharomyces cerevisiae gene encoding a plasma membrane protein, is required for
2+
Ca influx and mating. Mollecular and Cellular Biology 14: 8259-8271.
Inch, S., W.G.D. Fernando, and J. Gilbert. 2005. Seasonal and daily variation in the airborne
concentration of Gibberella zeae (Schw.) Petch spores in Manitoba. Canadian Journal of
Plant Pathology 27: 357-363.
Ingold, C. T. 1939. Spore Discharge in Land Plants. Clarendon Press: Oxford.
Ingold, C.T., 1966. Aspects of spore liberation: violent discharge. In: Madelin, M.F. (Ed.), The
Fungus Spore, Proceedings of the Eighteenth Symposium of the Colston Research
Society, Bristol, England. Buttersworths, London, pp. 113–132.
Ingold, C.T., 1971. Fungal Spores: Their Liberation and Dispersal. Clarendon Press, Oxford.
James, T.Y., P.M. Letcher, J.E. Longcore, S.E. Mozler-Standridge, D. Porter, M.J. Powell, G.W.,
Griffith, and R. Vilgalys. 2006. A molecular phylogeny of the flagellated fungi
(Chytridiomycota) and description of a new phylum (Blastocladiomycota). Mycologia
98: 860-871.

117 

Jones, S.G. 1926. The Development of the Perithecium of Ophiobolus graminis, Sacc. Annals of
Botany os-40: 607-629.
Jung, G., and J.A. Hammer III. 1994. The actin binding site in the tail domain of Dictyostelium
myosin 1C (myoC) resides within the glycine- and proline-rich sequence (tail homology
region 2). FEBS Letters 342: 197-202.
Karugia, G.W., H. Suga, L.R. Gale, T. Nakajima, K. Tomimura, and M. Hyakumachi. 2009.
Population structure of the Fusarium graminearum species complex from a single
Japanese wheat field sampled in two consecutive years. Plant Disease. 93: 170-174.
Kanzaki, M., M. Nagasawa, I. Kojima, C. Sato, K. Naruse, M. Sokabe, and H. Iida. 1999.
Molecular identification of a eukaryotic, stretch-activated nonselective cation channel.
Science 285: 882-886.
Khonga, E.B., and Sutton, J.C., 1988. Inoculum production and survival of Gibberella zeae in
maize and wheat residues. Canadian Journal of Plant Pathology 10: 232-240.
Krementsov, D.N., E.B. Krementsova, and K.M. Trybus. 2004. Myosin V regulation by calcium,
calmodulin, and the tail domain. The Journal of Biological Chemistry 164: 877-886.
Kretsinger, R.H., and C.E. Nockolds. 1973. Carp Muscle Calcium-binding Protein II. structure
determination and general description. The Journal of Biological Chemistry 248: 33133326.
Krichevsky, A., S.V. Kozlovsky, G.-W. Tian, M.-H. Chen, A. Zaltsman, and V. Citovsky. 2007.
How pollen tubes grow. Developmental Biology 303: 405-420.
Kurtz, S., A. Phillippy, A.L. Delcher, M. Smoot, M. Shumway, C. Antonescu, and S.L. Salzberg.
2004.Versatile and open software for comparing large genomes. Genome Biology 5: R12.
2+

Laude, A.J., and A.W.M. Simpson. Compartmentalized signalling: Ca
microdomains and the many facets of Ca
1816.

2+

118 

compartments,

signalling. The FEBS Journal 276: 1800-

Lee, J., I.-Y. Chang, H. Kim, S.-H. Yun, J.F. Leslie, and Y.-W. Lee. 2009. Genetic Diversity and
Fitness of Fusarium graminearum Populations from Rice in Korea. Appl. Environ.
Microbiol. 75: 3289-3295.
Leslie, J.F., and B.A. Summerell. 2006. The Fusarium Laboratory Manual. Blackwell
Professional, Ames, Iowa.
Lew, R. R., Z. Abbas, M. Anderca, and S. Free. 2008. Phenotype of a mechanosensitive channel
mutant, mid-1, in a filamentous fungus, Neurospora crassa. Eukaryotic Cell 7: 647-655.
Lew, R.R. 2006. Use of double barrel micropipettes to voltage-clamp plant and fungal cells, p.
139-154. In A. G. Volkov (ed.), Plant electrophysiology - theory and methods. Springer,
Berlin, Germany.
Lew, R.R. 2007. Ionic currents and ion fluxes in Neurospora crassa. J. Exp. Bot. 58: 3475-3481.
doi:10.1093/jxb/erm204.
Lew, R.R. and N.N. Levina. 2004. Oxygen flux magnitude and location along growing hyphae of
Neurospora crassa. FEMS Microbiology Letters. 233: 125-130.
Lew, R.R., and V. Kapishon. 2009. Ptk2 contributes to osmoadaptation in the filamentous fungus
Neurospora crassa. Fungal Genetics and Biology. 46: 949-955.
Link, H.F. 1809. Observationes in ordines plantarum naturales. Magazin der Gesellschaft
Naturforschenden Freunde Berlin 3: 3-42.
Liu, M., and A. Gelli. 2008. Elongation Factor 3, EF3, associates with the calcium channel Cch1
and targets Cch1 to the plasma membrane in Cryptococcus neoformans. Eukaryotic Cell
7: 118-1126.
Locke, E, Bonilla, M., Liang, L., Takita, Y., Cunningham, K. 2000. A homolog of voltage-gated
2+
2+
Ca channels stimulated by depletion of secretory Ca in yeast. Mol. Cell Biol. 20:
6686-6694.
Lortie, M., and J.E. Kuntz. 1963. Ascospore discharge and conidium release by nectria galligena
bres. under field and laboratory conditions. Canadian Journal of Botany 41: 1203-1210.

119 

Lowey, S., G.S. Waller, and K.M. Trybus. 1993. Skeletal muscle myosin light chains are
essential for physiological speeds of shortening. Nature 365: 454-456.
MacHardy, W. E. 1996. Apple Scab: Biology, Epidemiology, and Management. The American
Phytopathological Society, St. Paul, MN.
Marchler-Bauer, A. et al. 2011. CDD: a Conserved Domain Database for the functional
annotation of proteins. Nucleic Acids Research 39: D225-D229.
Markell, S.G., and L.J. Francl. Fusarium Head Blight Inoculum: Species Prevalence and
Gibberella zeae Spore Type. 7: 814-820.
Marin, D.E., I. Taranu, R. Burlacu, and D.S. Tudor. Effects of zearalenone and its derivatives on
the innate immune response of swine.Toxicon 56: 956-963.
Maruoka, T., Y. Nagasoe, S. Inoue, Y. Mori, J. Goto, M. Ikeda, and H. Iida. 2002. Essential
hydrophilic carboxyl-terminal regions including cysteine residues of the yeast stretchactivated calcium-permeable channel Mid1. The Journal of Biological Chemistry 277:
11645-11652.
Matter, K., and M.S. Balda. 2003. Signalling to and from tight juctions. Nature Reviews
Molecular Cell Biology 4: 225-237.
Mattson, M.P., and S.L. Chan. 2003. Calcium orchestrates apoptosis. Nature Cell Biology 5:
1041-1043.
McConnell, R., and M. Tyska. 2007. Myosin-1a powers the sliding of apical membrane along
microvillar actin bundles. The Journal of Cell Biology 177: 671-681.
McGoldrick, C., C. Gruver, and G. May. 1995. myoA of Aspergillus nidulans encodes an
essential Myosin I required for secretion and polarized growth. The Journal of Cell
Biology 128: 577-587.
Metzenberg, R.L. and N.L. Glass. 1990. Mating type and mating strategies in Neurospora.
BioEssays 12:53-59.

120 

Michalak, M., J.M.R Parker, and M. Opas. 2002. Ca2+ signaling and calcium binding
chaperones of the endoplasmic reticulum. Cell Calcium 32: 269-78.
Miller, J.D., J. Culley, K. Fraser, S. Hubbard, F. Meloche, T. Ouellet, W.L. Seaman, K.A.
Seifert, K. Turkington, and H. Voldeng. 1998. Effect of tillage practice on Fusarium head
blight of wheat. Revue Canadienne de Phytopathologie 20: 95-103.
Minervini, F., and M.E. Dell'Aquila. 2008. Zearalenone and Reproductive Function in Farm
Animals. International Journal of Molecular Sciences 9: 2570-2584.
Mitter, V., L.J. Francl, S. Ali, S. Simpfendorfer, and S. Chakraborty. 2006. Ascosporic and
conidial inoculum of Gibberella zeae play different roles in Fusarium head blight and
crown rot of wheat in Australia and the USA. Australasian Plant Pathology 35: 441-452.
Montagne, J.F.C. 1856. Sylloge generum specierumque plantarum cryptogamarum. Parisiis,
sumptibus J.-B. Baillière.
2+

Muller, E.M., E.G. Locke, and K.W. Cunnungham. 2001. Differential regulation of two Ca
influx systems by pheromone signaling in Saccharomyces cerevisiae. Genetics 159:
1527-1538.
2+

Muller, E., N. Mackin, S. Erdman, and K. Cunningham. 2003. Fig1p facilitates Ca influx and
cell fusion during mating of Saccharomyces cerevisiae. The Journal of Biological
Chemistry 278: 38461-38469.
Petch, T. 1936. Gibberella Saubinetii (Mont.) Sacc. Annals of Mycology 34: 257-260.
Nganje, W., D. Johnson, W. Wilson, F. Leistritz, D. Bangsund, and N. Tiapo. 2001. Economic
impacts of Fusarium Head Blight in wheat and barley: 1998-2000. Agribusiness and
Applied Economics Report No. 464.
Nguyen, Q.B., N. Kadotani, s. Kasahara, Y. Tosa, S. Mayama, and H. Nakayahiki. 2008.
Systematic functional analysis of calcium-signalling proteins in the genome of the riceblast fungus, Magnaporthe oryzae, using a high-throughput RNA-silencing system.
Molecular Microbiology 68: 1348-1365.

121 

Nyvall, R.F., and J.A. Percich. 1999. Fusarium Head Blight of Cultivated and Natural Wild Rice
(Zizania palustris) in Minnesota Caused by Fusarium graminearum and Associated
Fusarium spp. Plant Disease 83: 159-164.
O’Donnell, K., Kistler, H.C., Tacke, B.K., Casper, H.H., 2000. Gene genealogies reveal global
phylogeographic structure and reproductive isolation among lineages of Fusarium
graminearum, the fungus causing wheat scab. Proc. Natl. Acad. Sci. USA 97: 7905-7910.
O’Donnell, K., Ward, T.J., Geiser, D.M., Kistler, H.C., Aoki, T., 2004. Genealogical
concordance between the mating type locus and seven other nuclear genes supports
formal recognition of nine phylogenetically distinct species within the Fusarium
graminearum clade. Fungal Genet. Biol. 41: 600-623.
Odrinitz, F., and M. Kollmar. 2007. Drawing the tree of eukaryotic life based on the analysis of
2,269 manually annotated myosins from 328 species. Genome Biology 8: R196.
Ozeki-Miyawaki, C., Y. Moriya, H. Tatsumi, H. Iida, and M. Sokabe. 2005. Identification of
functional domains of Mid1, a stretch-activated channel component, necessary for
2+
localization to the plasma membrane and Ca permeation. Experimental Cell Research
311: 84-95.
Paidhungat, M., and S. Garrett. A homolog of mammalian, voltage-gated calcium channels
mediates yeast pheromone-stimulated Ca2+ uptake and exacerbates the cdc1(Ts) growth
defect. Molecular and Cell Biology 17: 6339-6347.
Peiter, E., M. Fischer, K. Sidaway, S. Roberts, and D. Sanders. 2005. The Saccharomyces
2+
cerevisiae Ca channel Cch1pMid1p is essential for tolerance to cold stress and iron
toxicity. FEBS Letters 579: 5697-5703.
2+

Perraud, A., C. Schmiz, and A. Scharenberg. 2003. TRPM2 Ca permeable cation channels:
from gene to biological function. Cell Calcium 33: 519-531.
Plowright, C.B. 1880. On spore diffusion in the larger Elvellacei. In Grevillea vol. ix, pp 47-51.
Pugh, W.G., and H. Johann. 1933. Factors affecting infection of wheat heads by Gibberella
saubinetti. Journal of Agricultural Research 46: 771-797.

122 

R Development Core Team. 2010. R: A language and environment for statistical computing. R
Foundation for Statistical Computing, Vienna, Austria. ISBN 3-900051-07-0, URL
http://www.R-project.org.
Raghavender, C.R., and B.N. Reddy. 2008. Human and animal disease outbreaks in India due to
mycotoxins other than aflatoxins. World Mycotoxin Journal 2: 23-30.
Raju, N.B., 2008. Meiosis and ascospore development in Cochliobolus heterostrophus. Fungal
Genetics and Biology 45: 554-564.
Ramakrishna, Y., R.V. Bhat, and V. Ravindranath. 1989. Production of deoxynivalenol by
Fusarium isolates from samples of wheat associated with a human mycotoxicosis
outbreak and from sorghum cultivars. Applied and Environmental Microbiology 55:
2619-2620.
Read, N.D., and A. Beckett. 1996. Ascus and ascospore morphogenesis. Mycological Research
100: 1281-1314.
Richards, T.A., and T. Cavalier-Smith. 2005. Myosin domain evolution and the primary
divergence of eukaryotes. Nature 436: 1113-1118.
Ringer, S. 1883a. A further contribution regarding the influence of the different constituents of
the blood on the contraction of the heart. The Journal of Physiology 4: 29-42.
Ringer, S. 1883b. A third contribution regarding the influence of the inorganic constituents of the
blood on the ventricular contraction. The Journal of Physiology 4: 222-225.
Ringer, S. 1886. Further experiments regarding the influence of small quantities of lime
potassium and other salts on muscular tissue. The Journal of Physiology 7: 291-308.
Ringer, S. 1890. Concerning experiments to test the influence of lime, sodium and potassium
salts on the development of ova and growth of tadpoles. The Journal of Physiology 11:
79-84.
Ringer, S., and H. Sainsbury. 1894. The action of potassium, sodium and calcium salts on
Tubifex rivulorum. The Journal of Physiology 16: 1-9.

123 

Robbana-Barnat, S., B. Loridon-Rosa, H. Cohen, C. Lafarge-Frayssinet, G.A. Neish, and C.
Frayssinet. 1987. Protein synthesis inhibition and cardiac lesions associated with
deoxynivalenol ingestion in mice. Food Addit Contam. 4: 49-56.
Rosenfeld, S.S., and B. Rener. 1994. The GPQ-Rich segment of Dictyostelium myosin IB
contains an actin binding site. Biochemistry 33: 2322-2328.
Saccardo, P.A. 1879. Fungi Gallici lecti a cl. viris P. Brunaud, C.C. Gillet et Abb. Letendre.
Michelia 1 5: 500-538.
Sambrook, J., and D.W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Satoh, A.K., B.X. Li, H. Xia, and D.F. Ready. 2008. Calcium-Activated Myosin V Closes the
Drosophila Pupil. Current Biology 18: 951-955.
Schuchardt, I., D. Aßmann, E. Thines, C. Schuberth, and G. Steinberg. Myosin-V, Kinesin-1,
and Kinesin-3 cooperate in hyphal growth of the fungus Ustilago maydis. Molecular
Biology of the Cell 16: 5191-5201.
Schwabe, S.H. 1839. Flora Anhaltina. Tomus 2. Berlin.
Schwartz, P., T.D. Bucheli, F.E. Wettstein, and P. Burkhardt-Holm. Short-term exposure to the
environmentally relevant estrogenic mycotoxin zearalenone impairs reproduction in fish.
Science of the Total Environment 409: 326-333.
Schweinitz, L. D. de. 1822. Synopsis fungorum Carolinae superioris, secundum observationes.
Johann Ambrosium Barth, Leipzig.
Schweinitz, L.D. de. 1832. Transactions of the American Philosophical Society 4: 230.
Sellers, J.R. 2000. Myosins: a diverse superfamily. Biochimica et Biophysica Acta 1496: 3-22.
Shear, C.L., and B.O. Dodge. 1927. Life histories and heterothallism of the red bread-mold fungi
of the Monilia sitophila group. J. Agr. Res. 34: 1019-1042.

124 

Slayman, C.L., W.S. Long, and C.Y. Lu. 1973. The relationship between ATP and electrogenic
pump in the plasma membrane of Neurospora crassa. J. Membr. Biol. 14: 305-338.
Spanswick, R.M. 2006. Electrogenic pumps. p. 221-246. In A. G. Volkov (ed.), Plant
electrophysiology—theory and methods. Springer, Berlin, Germany.
Starkey, D.E., Ward, T.J., Aoki, T., Gale, L.R., Kistler, H.C., Geiser, D.M., Suga, H., Toth, B.,
Varga, J., O’Donnell, K., 2007. Global molecular surveillance reveals novel Fusarium
head blight species and trichothecene toxin diversity. Fungal Genet. Biol. 44: 1191-1204.
Steinkellner, S., and I. Langer. 2004. Impact of tillage on the incidence of Fusarium spp. in soil.
Plant and Soil 267: 13-22.
Stępień, Ł, and J. Chełkowski. 2010. Fusarium head blight of wheat: pathogenic species and
their mycotoxins. World Mycotoxin Journal 3: 107-119.
Strickland, W.N., and D.D. Perkins. 1973. Rehydrating ascospores to improve germination.
Neurospora Newsletter 20: 34-35.
Stack, R.W. 2003. History of fusarium head blight with emphasis on North America. In
Fusarium head blight of wheat and barley. Eds., K.J. Leonard and W.R. Bushnell. APS
Press, St.Paul, MN.
Summerell, B.A., and J.F. Leslie. 2011. Fifty years of Fusarium: how could nine species have
ever been enough?. Fungal Diversity 50: 135-144.
Sutton, J.C. 1982. Epidemiology of wheat head blight and maize ear rot caused by Fusarium
graminearum. Canadian Journal of Plant Pathology 4: 195-209.
Tada, T., M. Ohmori, and H. Iida. 2003. Molecular Dissection of the Hydrophobic Segments H3
2+
and H4 of the Yeast Ca Channel Component Mid1. The Journal of Biological
Chemistry 278: 9647-9654.
Teich, A.M., and K. Nelson. 1984. Survey of Fusarium head blight and possible effects of
cultural practices in wheat fields in Lambton County in 1983. Canadian Plant Disease
Survey 64: 11-13.

125 

Thom, C., and M.B. Church. 1926. The Aspergilli. Williams and Wilkins Co., Baltimore, MD.
Thompson-Coffe, C., and D. Zickler. 1993. Cytoskeleton interactions in the ascus development
and sporulation of Sordaria macrospora. Journal of Cell Science 104: 883-898.
Tokes-Fuzesi, M., D. Bedwell, I. Repa, K. Sipos, B. Sumegi, A. Rab, and A. Miseta. 2002.
Hexose phosphorylation and the putative calcium channel component Mid1p are required
for the hexose-induced transient elevation of cytosolic calcium response in
Saccharomyces cerevisiae. Molecular Microbiology 44: 1299-1308.
Tóth, B., Mesterházy, Á., Horváth, Z., Bartók, T., Varga, M., Varga, J., 2005. Genetic variability
of central European isolates of the Fusarium graminearum species complex. European
Journal of Plant Pathology 113: 35-45.
Trail, F. and R. Common. 2000. Perithecial development by Gibberella zeae: a light microscopy
study. Mycologia 92: 130-138.
Trail, F., H. Xu, R. Loranger, and D. Gadoury. 2002. Physiological and environmental aspects of
ascospore discharge in Gibberella zeae (anamorph Fusarium graminearum). Mycologia
94: 181-189.
Trail, F., I. Gaffoor, and S. Vogel, 2005. Ejection mechanics and trajectory of the ascospores of
Gibberella zeae (anamorph Fusarium graminearum). Fungal Genetics and Biology 42:
528-533.
Tschanz, A.T., and R.K. Horst. 1976. The effect of environment on sexual reproduction of
Gibberella zeae. Mycologia 68: 327-340.
Tsukita, S., M. Furuse, and M. Itoh. 1999. Structural and signalling molecules come together at
tight junctions. Current Opinion in Cell Biology 11: 628-633.
Ueno, Y., M. Hosoya, Y. Morita, I. Ueno, and T. Tatsuno. Inhibition of the Protein Synthesis in
Rabbit Reticulocyte by Nivalenol, a Toxic Principle Isolated from Fusarium nivaleGrowing Rice. The Journal of Biochemistry 64: 479-485.

126 

Uhlén, P., and N. Fritz. 2010. Biochemistry of calcium oscillations. Biochemical and
Biophysical Research Communications 396: 28-32.
Upadhyay, S. and B. Shaw. 2008. The role of actin, fimbrin and endocytosis in growth of hyphae
in Aspergillus nidulans. Molecular Microbiology 68: 690-705.
Walker, S. L., S. Leath, W.M. Hagler, Jr., and J.P. Murphy. 2001. Variation Among Isolates of
Fusarium graminearum Associated with Fusarium Head Blight in North Carolina. Plant
Disease 85: 404-410.
Ward, T.J., R.M. Clear, A.P. Rooney, K. O'Donnell, D. Gaba, S. Patrick, D.E. Starkey, J.
Gilbert, D.M. Geiser, and T.W. Nowicki. 2007. An adaptive evolutionary shift in
Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic
Fusarium graminearum in North America. Fungal Genetics and Biology 45: 473-484.
Watanabe, T., H. Hosoya, and S. Yonemura. 2007. Regulation of myosin II dynamics by
phosphorylation and dephosphorylation of its light chain in epithelial cells. Molecular
Biology of the Cell 18: 605-616.
Waterhouse, A.M., J.B. Procter, D.M.A Martin, M. Clamp, and G.J. Barton. 2009.
Jalview Version 2 - a multiple sequence alignment editor and analysis workbench.
Bioinformatics 25: 1189-1191.
Watts, H.J., A.-A. Very, T.H.S. Perera, J.M. Davies, and N.A.R. Gow. 1998. Thigmotropism and
stretch-activated channels in the pathogenic fungus Candida albicans. Microbiology 144:
689-695.
Wettstein, F.E., and T.D. Bucheli. 2010. Poor elimination rates in waste water treatment plants
lead to continuous emission of deoxynivalenol into the aquatic environment. Water
Research 44: 4137-4142.
Williams, R.J.P. 2006. The evolution of calcium biochemistry. Biochimica et Biophysica Acta
(BBA) - Molecular Cell Research 1763: 1139-1146.
Williams, R.J.P. 2007. The evolution of the biochemistry of calcium. In Calcium: a Matter of
Life or Death, Eds. J. Krebs and M. Michalak.Elsevier Science.

127 

Windels C.E., and T. Kommedahl. 1984. Late-season colonization and survival of Fusarium
graminearum group II in cornstalks in Minnesota. Plant Disease 68: 791-793.
Wollenweber, H.W. 1914. Identification of species of Fusarium occurring on the sweet potato,
Ipomoea batatas. Journal of Agricultural Research 2: 251-286.
Woo, M., K. Lee, and K. Song. 2003. MYO2 is not essential for viability, but is required for
polarized growth and dimorphic switches in Candida albicans. FEMS Microbiology
Letters 218: 195-202.
Wu, C.-G., and J.W. Kimbrough. 2001. Ascosporogenesis in Tarzetta (Otideaceae, Pezizales).
International Journal of Plant Sciences 162: 1075-1080.
Yafetto, L., L. Carroll, Y. Cui, D.J. Davis, M.W.F. Fischer, A.C. Henterly, J.D. Kessler, H.A.
Kilroy, J.B. Shidler, J.L. Stolze-Rybczynski, Z. Sugawara, and N.P. Money. 2008. The
Fastest Flights in Nature: High-Speed Spore Discharge Mechanisms among Fungi. PLoS
ONE 3: e3237. doi:10.1371/journal.pone.0003237.
Yang, M., A. Brand, T. Srikantha, K.J. Daniels, D.R. Soll, and N.A.R. Gow. 2011. Fig1
Facilitates Calcium Influx and Localizes to Membranes Destined To Undergo Fusion
during Mating in Candida albicans. Eukaryotic Cell 10: 435-444.
Yi, C., H.P. Kaul, E.Kubler, K. Schwadorf, and W. Aufhammer. 2001. Head blight (Fusarium
graminearum) and deoxynivalenol concentration in winter wheat as affected by pre-crop,
soil tillage and nitrogen fertilization. Zeitschrift für Pflanzenkrankheiten und
Pflanzenschutz 108: 217-230.
Yoshimura, H., T. Tada, and H. Iida. 2004. Subcellular localization and oligomeric structure of
2+
the yeast putative stretch-activated Ca channel component Mid1. Experimental Cell
Research 293: 185-195.
Zeller, K.A., R.L. Bowden, and J.F. Leslie. 2003. Diversity of Epidemic Populations of
Gibberella zeae from Small Quadrats in Kansas and North Dakota. Ecology and
Population Biology 93: 874-880.
Zerbino, D.R., and E. Birney. 2008. Velvet: Algorithms for de novo short read assembly using de
Bruijn graphs. Genome Research 18: 821-829.

128 

Zerbino, D.R., G.K. McEwen, E.H. Margulies, and E. Birney. 2009. Pebble and Rock Band:
Heuristic Resolution of Repeats and Scaffolding in the Velvet Short-Read de Novo
Assembler. PLos ONE 4: e8407. doi:10.1371/journal.pone.0008407.
Zhang, N.-N., D.D. Dudgeon, S. Paliwal, A. Levchenko, E. Grote, and K.W. Cunningham. 2006.
Multiple Signaling Pathways Regulate Yeast Cell Death during the Response to Mating
Pheromones. Molecular Biology of the Cell 17: 3409-3422.
Zhou, X.L., M.A. Stumpf, C. Kung, and H.C. Hoch. 1991. A mechanosensitive channel in whole
cells and in membrane patches of the fungus Uromyces. Science 253: 1415-1417.

129