HIRARY
Michigan State
University

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

II
| l

MSU Is An Affirmative Action/Equal Opportunity Institution
cWMS—ot

 

 

 

 

 

 

 

 

 

 

 

HIGH SCHOOL MOLECULAR BIOLOGY UNIT
FOR
ADVANCED BIOLOGY STUDENTS
By

Bruce Lee Buysse

A THESIS

Submitted to
Michigan State University
in partial fulfillment Of the requirements
for the degree of

MASTER OF SCIENCE

College Of Natural Science

1992

ABSTRACT
HIGH SCHOOL MOLECULAR BIOLOGY UNIT
ADVANCED BISEISGY STUDENTS
By

Bruce Lee Buysse

The purpose of the high school molecular biology unit was to teach the basic
principals of protein synthesis and recombinant DNA to advanced biology students
through the use of hands-on lab experiments. The students used school made equipment
to do five experiments using recombinant DNA techniques. This lab approach to
teaching replaced a traditional lecture—discussion approach. The students were
interviewed and tested prior to and at the conclusion of the unit

The core of the unit was five integrated lab exercises. The labs started with DNA
isolation and properties, then continued on with bacterial transformation by plasmids and
concluded with plasmid isolations evidenced by gel electrophoresis.

The findings of the study were that the unit solidified the learning of the previous
biology courses after hands-on lab experiments with recombinant DNA. The students

were also very excited about performing the labs and learning from them.

I want to dedicate this thesis
to my children
April, Sarah, Josh, and Emily
and especially to my wife
ELLEN
their understanding, patience and encouragement
allowed me the time and gave me the inspiration tO

complete this research

iii

ACKNOWLEDGEMENTS

I would like to thank the following people for their
assistance in the completion of this study:
Dr. Merle Heidemann
Dr. Clarence Suelter
Dr. Howard Hagerman
Dr. Steven Triezenberg
Dr. Marty Hetherington
Mr. David Devore
Mrs. Helen Waldo
my family
April, Sarah, Josh, & Emily
Buysse
most especially

my wife, Ellen

iv

TABLE OF CONTENTS

I. Introduction
A. Overview
B. Written Material/ Scientific Literature
C. Outline of New Labs
11. Instruction
A. Basic Outline
B. Audio-Visual Aids
C. Pedagogical Value of Laboratory Exercises
D. Innovative Methods
HI. Student Transformation
A. Pre and Post Test Results
B. Clinical Interviews
C. Subjective Evidence of Effectiveness
IV. Discussion and Conclusions
A. Aspects of the Unit that are Effective
B. Overall Evaluation

V. Bibliography

VI. Appendix
Appendix A: Laboratory Exercises
Appendix B: Overlays used in Unit
Appendix C: Outline of Unit
Appendix D: Preth Post test
Appendix E: Felt Board Demonstration
Appendix F: Handout used in Unit
Appendix G: Unit Tests
Appendix H: Dry Lab on Plasmids

Appendix I: Comparison of Protest & Post Test Scores

vi

INTRODUCTION

Overview:

Science, unlike most other school subjects, is growing with the addition of
information discovered yearly. Biology textbooks and courses get larger and more
involved every year. I am overwhelmed with the idea of trying to get a representation
of all the new in formation to my Students. The approach I used for many years was a
”shot gun” approach. I covered a little in all areas of the science curriculum but did not
spend a great deal of time with any one area in the Advance Placement Biology class.
I felt I was in a foot race with the clock. I did not spend time looking around at the
scenery on my journey through Biology. I could only see the finish line. Often I left
class physically out of breath and tired from trying to cover so much material in so little
time.

I taught the Molecular Biology unit this same way. I covered the basic principles
and discussed the advances made in biotechnology but did not spend time in class
discussion and did no lab work to reinforce molecular biology. I felt successful with the
unit in the short term goal of preparing students to pass the chapter test, but felt a failure
in the long term when students had a difficult time applying the material discussed in
class to other biological concepts like human genetics, evolution, and classification.
Semester exams and national achievement tests also showed that the students lacked of
the ability to apply knowledge learned in class.

1

2
I consoled myself by believing that I was doing the best I could, my students still

liked the course and I could see no other way to do it. My background in biotechnology
was minimal because it was not part of my undergraduate studies twenty years ago. Not
having a background in biotechnology also made it difficult for me to feel comfortable
reaching it or doing labs in this field.

Working with recombinant DNA for the last three summers, my "comfort” level
for the material rose considerably. The summers of preparation gave me the opportunity
to work with the labs directly and learn how to do them. The equipment to do the labs
was very expensive when purchased through a supply company. The summer work
allowed me to develop low cost equipment such as 24 volt power supply, micropipettes
using syringes, electrophoresis chambers from food storage containers, and dye chambers
for the gels.

I could see that a complete revision was needed to teach the course because my
old lecture technique for teaching would be ineffective. The labs not only reinforced the
material but also enriched it and challenged the students to apply it to future problems.
The labs offered the students an opportunity to do work in an area they had not
experienced before, with equipment they had never used. I hoped that through this
experience some of the students would select this area of study to do an extensive project
during the second semester or to look into study beyond high school.

The old molecular biology unit was about two weeks in length. The total time of
instruction was ten 55 minute periods from beginning to the end of the molecular biology
unit. The new lab oriented revisions increased the molecular biology unit to about five

weeks or twenty-five 55 minute class periods. The increase in the amount of time spent

3

on the unit meant that other units had to be revised and revamped. The implementation
of the unit not only improved the molecular biology unit but also led to the revision of
the following units which include evolution, animal and plant taxonomy and the
introduction to plant physiology. I concentrated these units and combined these separate
labs into one multi-part lab that seemed to tie the concepts together better.

One of the largest changes in the new approach to molecular biology in
comparison to the old lecture approach was extensive use of lab periods. Prior to the
labs, I discussed with the students how it was done through overlays, chalkboard, and
demonstrations. The new approach followed a lecture-discussion in the classroom
concluded by one or two day lab experience which demonstrated the principle and future
possibilities of the technique. These labs all had the potential possibilities of being
expanded by the students for further study. The newness of the labs and the equipment
required more prep time for me and more time in class explaining how it all worked.
At the conclusion of the lab, a portion of the final lab day was used to discuss the results
and have a group discussion about what the data meant and how to interpret it.

I found myself much more excited in teaching this unit I think my excitement was
passed on to the students because they had more questions and discussion seemed
generated in classroom more easily. All class members asked questions and together we
tried to answer them. Time seemed to pass quickly and all the students got involved with
more and more aspects of the labs. The five extensive labs had to be written up in a lab
report by the students and submitted to me. After am initial phase of complaining, most
seemed to write the labs with good detail. The first two labs, DNA isolation and

properties, were written up simply. However, the final lab on DNA recombination was

4

written very completely and Showed time and effort by the students.

Written Material/ Scientific Literature:

There is abundant scientific literature in the field of molecular biology. Through
my reading I concluded that this literature fell into two major categories. The first and
major category was found in scientific journals about research dealing with specific
bacteria, techniques, problems, and discoveries. The second category of material was
written to help explain these research concepts and how they relate to each other and fit
into a cohesive picture of molecular biology. These articles appearing in scientific
periodicals and teaching journals formed the core of my reading for thesis research.

As I read through the literature, I became aware of the scientific information -
needed to teach this topic and also discovered ideas about presenting molecular biology

concepts to high school student.

 

and Sgiengeleacher presented a wealth of information and ideas that I included into my
research and thesis.

In reading the literature, I was surprised at the lack of understanding of DNA and
concepts of biotechnology among the American public. According to Linda Dixon(l988)
" as of 1986 57% of American said that they had little to no understanding of DNA".
She states that in 1987 a majority of Americans had not ever heard the word
”biotechnology" .

This lack of knowledge of molecular biology makes the task of instruction a

challenge to a teacher. Not only is it important to teach concepts of molecular biology

6

but it is also important that the students understand these principle and how this
technology will affect their lives now and in the future.

The purpose of an introductory molecular biology unit in high school is to provide
students with the knowledge of the structure and function of DNA so that they will be
informed citizens and be able to make educated decisions as adults about the products of
biotechnology. I wanted my students to appreciate the application of molecular biology
to their lives.

Ralph Lewis( 1988) points out an important concept for teaching molecular biology
or any science to high school students. He concludes that to improve education at the
high school levels, teachers need to change descriptive biology from lectures to
hypothetic—deductive biology. Hypothetic-deductive biology is the teaching of abstract
concepts to students and expecting them to use deductive logic to tie together concepts.
He states that a survey of the advancing fronts of biological knowledge in molecular
biology Shows that most biology today is highly theoretical. Because it is theoretical, it
is hard for the student to understand and envision uses for it. Theoretical science does
not mean it is impractical to use in a classroom, but it needs to be reinforced with
techniques that will help students visualize its implications in the world of science.

Robert G. Thompson(l988) sums up the need to move students from the
theoretical to the practical aspects of molecular biology by using the term mugging):
Literacy. He defines this term as the ability of students to have a foundation of skills that
will prepare them as citizens to make sound evaluations of biotechnological decision
which involve environmental issues, safety concerns and ethical issues. He paraphrases

an old Chinese proverb:

7

”Tell me and I will forget Show me, I might remember Involve me
and I will understand”

This old Chinese proverb sums up the whole idea of teaching high school students.
As an educator, I try to present as much scientific knowledge to my students as possible.
The science of biology increases its wealth of information yearly. Each year there is
more and more to teach and seemingly less and less time in which to do it. For years,
I have lectured daily attempting to fill the students minds with all the concepts I thought
they needed. The task is overwhelming and basically impossible to accomplish. As the
years have gone by, the hand-on aspect of biology, labs and research projects have been
done less and often replaced by demonstration and visual aids.

The Chinese proverb says that unless you involve me, I will not understand. In
teaching the molecular biology unit, I attempted to step away from lecturing to students
and towards the idea of students discovery of concepts so they would understand the
principles.

Dr. James D. Watson(l989) points out the need for an understanding of molecular
biology by all citizens. DNA research is beginning to have medical and ethieal
consequences that will affect our daily lives. This research will help us plan for the
future of our children and they for their children’s future. Watson states that we must
realize that we are living in the midst of a virtual biological global rush, searching in
areas where no one has traveled before. He continues on to say that we need also to train
a vast number of scientists who want to work with recombinant DNA procedures focusing
on cures for genetic diseases.

The challenge of teaching these concepts of recombination DNA technology to

8

high school students in a way that they can see and understand is a challenge at the
secondary level. Linda Dixon(l988) notes that despite its mystical and seeming magic,
recombinant DNA technology is a straight forward set of procedures which can be been
performed by teenagers. She believes that recombinant DNA technology is critical to
development of a complete lab program that students can do and understand.

The development of a complete lab program to supplement the molecular biology
unit I was to teach was the program that I undertook in my thesis. I wanted students to
be familiar with the terminology of the discipline and then to use lab experiences to help
them understand the concepts. I think that only through this combined effort could I
leave students with concepts they could take out of school and use in their lives as adults.

In preparing the written material used in the molecular biology unit, I found that
the textbook Biology, Journey into Life by Arms and Camp (1990) had a very good but
brief approach to molecular biology. High school texts that completely cover the
material, yet are not too detailed so the students won’t read them, are difficult to find.
Arms and Camp have done a good job keeping the unit on molecular biology brief but
complete enough to provide a foundation for understanding. However, I could see that
supplementary material was required to adequately explain the concepts in lecture so the
students could not only understand the labs but be able to see their applications into the
field of biotechnology.

AS I began to teach the unit, I found it necessary to use a series of
overlays(Appendix B) to help clarify the concepts of DNA structure, protein synthesis
especially translation and transcription, operon theory, and bacterial transformation.

The protein synthesis chapter( 10) of Arms and Camp required the use of special

9

audiovisual material, and felt board, to help the students visualize protein synthesis. This
board uses pieces of felt to illustrate the concepts of DNA, T-RNA, M-RNA, ribosomes,
proteins, amino acids and their roles in the process of synthesis.

1 read a variety of sources to help supplement the Arm and Camp text. Most of
the information came from W, W, Science, and American
W articles that were very detailed in more Specific areas of research but did
not help explain the basic concepts I needed to teach. I reviewed the textbooks that I had
used in teaching college introductory courses such KW by Champe and
Harvey(1987) and mm by Stryer(1988). Although each of the texts provided
me with bits and pieces of information to supplement the text, none of them gave a
complete overview or simple outline to follow. I found the best text that helped me in
preparation of my lecture notes for molecular biology was the book: W
W by David A. Mickels and Greg A.
Froyer(l990). This text was written with the advanced high school student in mind. The
book was divided into three parts. Each of the first eight chapters discussed a basic
theme of molecular biology and was detailed enough for high school students but not
beyond their range of experience. These chapters were extremely enlightening; for the
unit. This book began with the historical picture of the people involved in research. The
book told a very human story and helped me humanize molecular biology. In following
chapters, the basic tools and techniques of DNA science were explained. The chapters
started with the basic terminology such as recombinant DNA, Plasmids, restriction
enzymes, and bacterial transformation. The later chapters of the first part of the book

discussed the genome project, DNA probes, and constructing a DNA library, cancer

10

research and applying DNA to Human Genetics. These chapters provided the information
I needed that was not found in the student’s text. The book was written clearly and
Simply so that I could apply it directly to my class presentations. I was able to answer
many of the questions the students asked because of what I learned from this text.

The second part of W consisted of recombinant DNA
laboratory experiments. The labs were written very clearly and were easy for me and my
students to understand. I primarily used the labs that I developed in summer research and
I used the labs from this book to help trouble shoot any problems I might encounter. It
was also a consolation to see that the labs I had written were very similar to the more
polished labs presented in the text. The additional labs in the text could be done by
students with interest in further work. These labs also used materials that would be
readily available to a high school teacher. Each lab had a section at the end called "for
further research” which made the labs very open ended.

The final section of the book, DNA Seieng; First Course contained an extensive
appendix which included equipment needed and where to locate it, recipes for media,
reagent, stock solutions, restriction maps of DNA and plasmids.

The book overall was the best source as I prepared the molecular biology unit, and

it was very readable and understandable for me and my students.

ll

Outline of New Labs:

The molecular biology unit followed units on the cell and cellular processes. This
new unit was included in the Cell Biology unit and bridged to the next unit on Genetics.
The molecular biology unit was needed to familiarize the students with the general
concepts such as chromosome, gene, DNA structure and properties, DNA replication and
mutations. From these beginnings, I moved into discussions of bacterial transformation,
bacteriophages, protein synthesis, and the operon theory of gene expression. Student
understanding of these concepts leads into the application of molecular technology
including genetic engineering, restriction enzymes, cloning and gel electrophoresis.

In order to start the unit on a solid foundation, I presented the basics of molecular
biology: DNA in a lab/ lecture format.

Although DNA structure and function had been introduced earlier in the
Biochemistry unit, I reviewed basic nucleic acids structures, the base—pair combinations,
and the history of nucleic acid research.

This review was followed by an explanation of protein synthesis. The discussion
began with an overview of the protein synthesis. The discussion began with an overview
of the protein synthesis process and was followed by a detailed explanation of
transcription, transformation, the enzymes involved and codons. The discussion focused
on the "Operon Theory" and how it related to cancer. An historical picture was given

of the researchers who worked on the mechanism of protein synthesis especially Beadle

12

and Tatum.

Next was the discussion on the application of the DNA knowledge to technology,
emphasizing plasmids, restriction enzymes, gel electrophoresis, cloning, bacterial
transformation and restriction mapping. These concepts led into a discussion of the
present uses and future potentials of DNA technology. Cancer research as related to
DNA technology was discussed extensively in class on numerous occasions.

The main objective of the thesis was to present materials and activities to students
so that they would understand the research in molecular biology and allow them to
experience the lab techniques used in that discipline. Molecular Biology is a recent
addition to most textbooks and courses in high school. Students have a basic
understanding of the cell but seem to have a hard time grasping the function of nuclear
DNA. I have long been aware of the difficulty in teaching these abstract but essential
concepts to students. The techniques of recombinant DNA have become available to high
schools in recent years, so I decided to use these techniques in a series of labs to help the
students visualize concepts. These concepts include bacterial transformation, gene Slicing,
plasmid cloning and removal and action of restriction enzymes. I found that students who
do hands-on labs, take data and visually see results have a better understanding of
recombinant DNA technology.

The central theme that I wove through the six week unit was the versatility of
DNA in the cell illustrated by a series of five multi—part labs(Appendix A). During
discussion of the first chapter of the Molecular Biology unit, which was a review of DNA
structure, The students isolated DNA form tissue and massed it on a glass stirring rod.

The students were also able to look at cells and nuclei through a microscope. The

13

purpose of the lab was to have the students observe a quantitative mass of DNA on the
glass rod.

The next lab demonstrated to the student the properties of DNA. (Appendix A) In
this lab, the students obtained a quantitative mass of DNA and analyzed it with
chemicals, temperature and enzymes.

The discussion of DNA properties proceeded into a discussion or DNA function,
concentration on protein synthesis and the operon concept. This material was not
reinforced by a lab at this time.

Most of the lab techniques were performed in the last section of the unit. First
was a discussion of recombinant DNA terminology. Students visualized DNA, the
function of restriction enzymes and the plasmid’s role in recombinant DNA with a ”dry
lab”.(Appendix H) The dry lab was done with scissors and paper models of plasmids.
The students constructed a DNA chain, plasmid DNA and worked with two known
restriction enzymes EcoRI and BamHI. I wanted the students to learn how a transformed
bacteria is created.

Experiment #3(Appendix A) was a transformation of bacterium E,_egli using
plasmid pUC 18 to confer ampicillin resistance. The students made the bacteria
competent and then mixed the plasmid with the bacteria. The bacteria was cloned and
them tested against an ampicillin plate. The students saw that those bacteria that were
transformed could grow on the ampicillin whereas those not transformed did not grow on
the plates. This lab stressed the importance of the genetic material(genes) of the plasmid
and how it affected the bacterial survival. Also as part of this lab, transformed bacteria

was induced to turn off one gene and turn on another. An inducer turned the media blue.

14

This very visible lab demonstrated the operon theory of gene expression by turning on
another. The lab also allowed students to count colonies and estimate the efficiency of
the transformation. The complete lab with all of its parts took most of one week. Each
part helped reinforce the discussion in class of transformation and build on the previous
lab portion.

The culture of transformed cells was used in lab #4(Appendix A) to try to remove
the plasmid introduced into the bacteria in lab #3. Plasmid isolation is a difficult
technique and a variety of procedures can be used. I divided the class into four groups
and each group tried one of four techniques: l)filtration, 2)boiling, 3)lysis, and
4)modified lysis.

These four techniques resulted in the Students obtaining a tube of a 20 to 50
microliter sample of supposed plasmid. The samples of supposed plasmids obtained in
lab #4 were used for the first part of lab #5(Appendix A). This lab would demonstrate
the presence or absence of plasmids by gel electrophoresis. This, the final lab of the
unit, was designed to bring together all the aspects discussed in the unit and to visualize
and stimulate interest in other aspects of recombinant DNA work.

The final lab of the unit used gel electrophoresis to first isolate the supposed
plasmid from lab #4 and then to continue with gel electrophoresis to separate DNA
fragments which were digested by restriction enzymes.

The five multi-part labs gave the students the opportunity to perform a few basic
hands-on activities with recombinant DNA. The first two labs made the DNA visible to
the students and allowed them to see its properties. The last three labs gave the students

the opportunity to work with a living organism, and DNA to it, demonstrate that it was

15

there and working, then remove it again and assay. The labs were and opportunity to use
the technology described in class discussions in the lab. The labs also gave the students
an opportunity to follow up each experiment with a lab report using technology from the
chapter discussion in the lecture.

At the conclusion of each lab, a discussion was held to sample outcomes, discuss
difficulties and challenge students with future problems. As the labs progressed, the
discussion after each lab experience for more extensive by adding future applications and
problems with genetic technology. Students discussion on biotechnology increases with
each lab done. They were supporting their views with material that we had discussed in
the chapter. Overall the labs really made the unit successful to me and my students.
This success is supported by the post interview essay question at the end of the post test.
Success is also measured in the enthusiasm I observed after twenty years of teaching high

school.

INSTRUCTION

Basic Outline:

The instruction of the molecular biology unit was based on W
into Life by Arms and Camp(1989). Five experimental labs were done by students
during this unit. The entire unit took about twenty five class periods of fifty minutes.
each. This unit included a pretest and post test of the unit and two test given during the
unit. The first test followed Chapters 9 and 10 and the second test was over chapter 11.
Preceding the unit of instruction, a series of interviews were conducted by me with the
students to better understand their prior knowledge, scientific interest levels and feelings
about science in the future. The post test contained the same questions as the pretest plus
a question that asked them to discuss their learning form the labs and thoughts on the
unit.

The unit began with a review of DNA that took about three days. This review
involved a discussion about DNA including the discoveries that lead to our understanding
of the molecule. Most students only knew of Gregor Mendel and Watson/ Crick and
research in genetics. They seemed to believe that these three men did all the work. I
supplemented the DNA research with the work of Griffith(l928), Hershey &
Chase(l952), Chargoff(l940), and McClintock(1940). I wanted these chapters to build

a picture of the story of DNA research. A majority of the material was review from the

16

17

Biochemistry chapter earlier in the year. This chapter on DNA took four days to go

through and during that time two labs were done.

The following is summary of he daily teaching of the molecular biology unit:

Chapter 9-DNA Genetic Information:

Dan: Pretest of 45 multiple Choice questions

Day—21

E

E

(Appendix D)

DNA Terminology including DNA, chromosome, gene,
replication, DNA polymerase, amino acid, protein, polymers,
nucleotides; and explanation of Bacterial transformation experiment
by Griffith( 1928)

Work of Hershey and Margaret Chase(l953) with bacteriophages,
work of Franklin and Watson and Crick work in DNA structure
Lab #1 WMppendix A): The lab was to isolate nuclei
from tissue, and remove DNA from the solution for study. The
lab went well and the students were able to spool large amounts of
visible DNA on glass rods. For most of the students this was the
first time they had seen DNA other than as a concept in a book.
Lab 2 mependix A): This lab followed the
procedures of Lab #1 initially and then experiment with the mass
of DNA on the stirring rods as to its properties with heat, types of
cooling, and effects from and enzyme: DNAase 1. All of the
properties were demonstrated by the lab.

We discussed DNA replication, DNA repair, the structure of

18

chromosomes, genes, and work of McClintock.

After this thorough review of DNA and its structure and properties, I moved into

a discussion of the role of DNA in the cell: transcription and translation.

12611:

The parameters of protein synthesis were discussed and defined.
These included RNA, mRNA, tRNA, gene, transcription,
translocation, and protein. A felt board with different colors and
shapes(Appendix E) used to represent the DNA, mRNA, tRNA,
ribosomes, amino acids, and protein helped students with the basic
concepts of protein synthesis.

A brief review of the felt board began the day followed by a
discussion of how the code for the protein is formulated. The
concepts of codons. A brief overview of the concept of mutations
and was discussed, stressing the effects of a one base pair change.
The major concept of the day in class discussion was of
transcription of DNA code.

An in depth discussion about the structure of mRN A and specificity
of tRNA with the ammoniacal site and anticodon was held first.
The second major concept of the day was translocation at the
ribosome. The concept of translocation is a difficult one for the
students to follow, so I used a variety of overlays (Appendix B) to
help explain the process.

Since this was the final day of discussion concerning protein

synthesis. I focused the time to tie all the material into one

E

E

19

cohesive picture especially the ”operon theory” . I gave the
Students a handout (Appendix F) on the operon to fill in as we
discussed the material. The terms included repressors, inducers,
promoters, introns, and exons.

Review of the material in Chapters 9 and 10

Test over Chapter 9 and 10. The test consisted of 70 objective
questions and two 4 point essays and one 10 point essay.(Appendix
G)

Review the test and begin chapter 11 New Genetics: Molecular
Genetics with a discussion of the terms that will be introduced in
the chapter. These terms include genetic engineering,
hybridization, restriction enzymes, reverse transcriptase, clone,
plasmid cloning, recombinant DNA, & oncogenes.

We discussed how plasmids are formed, the action of restriction
enzymes, and cloning of transformed DNA material.

The students did a "dry lab”(Appendix H), in which they could see
how restriction enzymes work by using paper models of DNA and
plasmids they could cut. The students could visualize the concept
of "sticky ends” and see how the plasmid can join with the DNA.
All the students constructed models and some even made multiple
cuts and a variety of DNA.

I followed up this Dry Lab with Lab #3 Bacterial Transformation

of E43211 with pUC 18 plasmid(Appendix A). First the students

Day 17:

20
make an E, mli competent. Secondly, they add pUC 18 plasmid

to the colony creating a transformed E4911 colony. The
transformed colony contains a gene for ampicillin resistance.

The colonies from day 16 were counted and recorded. We then
began work with the lac Operon. The students took samples from
the bacteria that grew on the plate(+) and transferred them to a
plate of agar with X-gal(5-Bromo-4—chloro—3Indolyl b-d-
Galactopyranoside) and IPTG (Isopropyl b-d-
Thiogalactopyranosidc). The media required the transformed
bacteria to shift from using lactose , turning on the Lao operon.
The inducer of the operon is IPTG. The experiment is successful
if the bacteria grow, causing a change in the media color to blue
as bacteria use lactose as an indication of operon gene function.
The plates were checked for growth of colonies. The colonies
were counted and recorded. This lab enabled students to visualize
the genes turning of and on. The majority of the class time was
spent dividing the students into four groups and beginning Lab #4
(Appendix A). Four different techniques to remove the pUC l8
plasmid from the transformed bacteria of Lab #3 were attempted
The students used the remainder of Day 18 and all of Day 19 to try
the plasmid removal process. It was expected that two to three
samples of plasmid would be collected.

The students continued to work on plasmid extraction. Group I

21

using the filtration method was able to collect only one sample.
Group H used a boiling technique and collected two samples.
Group II and IV used mini-prep and alkaline method and each
collected three samples of plasmid. Each group had at least one
microcentrifuge tube with a 40 microliter sample of possible
plasmid in it.

Lab #5(Appendix A) induced testing for plasmid isolation by using
gel electrophoresis to isolate the pUC 18 plasmid and comparing
it to known sample pUC 18 plasmid. Each group made 1.2%
agarose gels and loaded separate wells with plasmid from Lab#4,
known pUC 18 plasmid, running dye. The gel took about two
hours to run.

The gel of part 1 of Lab #5 was strained and refrigerated for 24
hours. The students began part 2 of Lab #5 which investigated
restriction enzymes EcoRI and BamHI using lambda DNA. The
students cut the lambda DNA first with EcoRI alone, then cut
lambda with BamHi alone, and finally cut it with both enzymes.
These three samples were loaded into separate wells of Pre-
digested DNA(standard) and running dye were also loaded. The
gels took about two hours to run.

The bands in the gels of part 1 of Lab 5 were measured using a
millimeter ruler and visually inspected to identify the presence of

Puc18 in the sample from lab #4. The gels from part 2 (day 21)

Day 23:

Day 27:

22
were dyed and refrigerated

The gels of part 2 of Lab #5 were measured and all the data was
recorded on semi-log graphs. Using the semi-log paper, mark the
x-axis in 1 cm. intervals up to 5 cm. This axis represents the
migration distance. The fragment size(in base pairs) is graphed
along the y-axis.

We discussed Labs #3, #4, #5. Stressing the continuity among the
labs. The procedures and mechanisms for adding foreign DNA to
the cell, turning on/off genes, and then removing the foreign DNA
and finding it again were reviewed. We reviewed student results.
This day gave the students the ”Big Picture” of recombinant DNA
research.

We discussed the application of techniques like we had done in the
lab. A discussion of insulin and interferon research was held.
Also the future of this type research and possibilities for
improvements in both plant and animal Study were discussed.
Reviewed the material in Chapter 11 for a test.

Chapter 11 Test was given. The test contained 45 objective
questions and two 10 point essays.(Appendix G)

The students were given the day to work on the lab reports they
had to write up individually on each of the five labs.

The post test was given(Appendix D) in addition to the same 45

objective questions from the pre test, an additional essay was given

23

to evaluate the effectiveness of the labs. This essay question was

not used for comparison with the pertest.

24

Audio-visual Aids used in Unit:

I found the more audio-visuals used in class to try to explain the concepts of the
unit the better the material was received. The last three years I have been reviewing
possible textbooks for the course and have seen a tremendous variety of supplementary
material that would be used in this unit. I used a variety of overheads mainly to
demonstrate difficult concepts.

Since the majority of the material taught in the unit cannot be seen, the use of
pictures, charts, and diagrams is very helpful to the students to understand the structure
and function of DNA. I used the chalkboard to draw the various structures of DNA,
along with bonding assignments. I used overlays to describe the DNA replication
process. Appendix B which contains other overlays began with the one of DNA
replication(B-l and B-2).

I found one of the most challenging processes to present to the students was that
of protein synthesis. I have taught this process to first and second year biology students
and have used a variety of special audio visual materials to help present this material
including a felt board which contains colorful pieces of felt to represent the various
components of the process. I also used overlays from a variety of sources. Appendix
B contains overlays B—3 on the Central Dogma of Molecular Biology to give an overview
of protein synthesis. Overlays B-4, B-5 , and B-6 explain a specific aspect of the process

of protein synthesis.

25

The third chapter, Chapter 11, on molecular genetics application required a
number of overlays, B-7, 8-8, 8-9, and B- 10 to help the student understand the operon
control theory of protein synthesis. The final handout, B-1 1 , was given to the students

to fill in so they could better understand the function of the operon.

26

Pedagogical Value of Laboratory Exercises:

The purpose of the labs was to show that DNA can be isolated and manipulated.
The basic nature of DNA has been introduced to and reinforced in students since
elementary school but retains a mysterious quality. I showed in the lab exercises that
DNA can be obtained as a visual mass and experiments can be done to show its
properties.

In the first lab, DNAJselafignmppendix A), the students were able to obtain
DNA from tissue and accumulate a mass that could be seen. The lab gave the students
the opportunity to homogenize thymus, filter it through cheesecloth, centrifuge, cool the
precipitate and then spool the DNA strands on a glass stirring rod.

This lab permitted the students to see a mass of DNA fibers together. The lab
brought the abstract concept of DNA to light. The students could know see and touch
actual DNA stands.

Lab #2, mependix A), continued the study of DNA by
exarrrining some of its properties. The students took the DNA from the glass rod and
experimented with compounds and factors that might effect its structure. The students
used a 1% NaCl solution, cold, and the enzyme DNAase to test effects on the DNA
structure. The Students used a 1% NaCl solution and tested the effect NaCl on the DNA
spool ability after twenty four hours of exposure. The effects of heating and cooling

DNA slowly as opposed to quickly were tested. The concept of "denaturation" was

27

clearly demonstrated. The contrast effect of speed cooling on renaturing of DNA was
also shown. The final portion of the lab demonstrated the effects of restriction enzymes
on DNA structure.

The completion and understanding of [abs 1 & 2 provided the background for the
final three labs of the unit.

Lab #3, WWWOWHfiX A)
was the first of a series of three labs. I stressed to the students that in these labs they
would be introducing a plasmid into a culture of E54111 then testing to see if the genes in
the plasmid had transformed the bacteria to allow it to grow where it could not before.
Working with the same transformed colony of bacteria, they would then turn off one gene
and turn on another gene in the lac operon. Using the transformed culture, the students
would then remove the plasmid in one of four possible ways and identify the isolated
plasmid by using gel electrophorphoresis. I stressed to the students that success in Lab
#3 would better the chances of success in Iab#4. Success with Lab #4 would greatly
increase success in Iab#5. I reminded the students that this sequenced process is often
used in research.
lab #3, W, was a difficult lab for the students because they would
not be able to tell if it worked correctly until the next day. The students used calcium
chloride to make a colony of 11.53;]; competent to take up the plasmid pUC 18. A
discussion of the effects of ampicillin on bacterial growth was held prior to the
introduction of two different colonies of E54211 on nutrient agar plates containing
ampicillin. One of the colonies was labeled ”minus DNA” and did not contain the pUC

18 plasmid and the other colony was labeled ”plus DNA" carried the pUC l8 plasmid,

28

which contained the gene for ampicillin resistance. The plates were streaked in a Similar
pattern and allowed to grow for twenty four hours. The following day students could see
the effect of incorporating pUC 18 plasmid on the bacterial growth on ampicillin. Many
colonies had grown on the "plus”plate and very few on the "minus” plate.

After demonstrating that the E52911 containing the plasmid showed positive growth
on ampicillin plates, the student next attempted to turn off one gene of the lac operon of
the incorporated pUC 18 plasmid and at the same time turning another gene. This
portion of the lab was difficult to prepare. X-gal(a histochenrical substance which reacts
with B—galactosidase to form a blue color) and the IPTG(an inducer of B-galactosidase
activity in E54210 were expensive and hard to work with. Therefore only a limited
number of plates of nutrient agar/X-gar/ IPTG/ AMP could be prepared. Each group was
given two plates, each inoculated with the transformed E,_c&l_i and incubated for 24
hours. After incubation a number of blue colonies appeared illustrating the bacteria’s
ability to use a new food source. The students calculated the efficiency of the
transformation process from the data collected using the example explained in the lab
procedure and from the class discussion held about the process.

The real success of the lab was that there was substantial bacterial growth on the
plates. It was very striking to see blue colonies of transformed E54111 or a clear plate
where the colony that you started with was not transformed. The concept of
transformation and the lac operon were much easier to understand and visualize by the
students with this lab.

The lab. wmwwdix A). was the lab that

gave the student the best opportunity to experiment on their own. My own research

29

techniques of plasmid removal from bacteria worked. I selected four different
approaches for the students to try to remove the plasmid they had introduced in lab #3
from the bacteria. I wanted to determine which was the most successful and which
technique the students liked the best. All of the approaches were fairly successful. 1
divided the class into four groups and gave each group a different protocol to use to
extract the plasmid. The students had a chance to try slightly different methods and to
independent and investigative.

Approach I required a series of filtration through a .45 micron filter. This
technique was a time consuming process that required close attention to detail. This
approach took the students about two 50 minute class periods to complete. The students
using this technique started two samples of transformed bacteria simultaneously so that
they would have two samples to use in lab #5.

Approach H was to lysis the bacterial cells by boiling. The technique was not as
time consuming as the first approach but required the use of vacuum tubes to remove the
liquid. The technique had to practiced many times by the group before they began their
actual isolation. This approach took one 50 minute class period and the students were
able to collect three samples with this technique.

Approach 11 was the lysis of plasmid removal which required a series of
centrifugation. The technique was the Shortest of the four, taking only about thirty
minutes. The students were able to collect four to five samples of plasmid with this
technique. The students seemed to like this technique the best because it had the fewest
steps, took the least time, and resulted in the most samples of possible plasmid to be

tested in lab #5.

3O
Approach IV used an alkaline solution to lyse the bacterial cell. The technique

took about one hour to complete and the students were able to collect two samples during
the time of this lab.

At the conclusion of this lab, all students had any where from two to five micro
centrifuge tubes containing about 50 microliter of possible plasmid. Each group hoped
that in the solution would be a quantity of pUC 18 plasmid.

The microcentrifuge tubes containing a clear liquid thought to contain plasmid
were the only product produced in lab #4. Many of the students were a little unsure
about having no other results. labs done before in this and other science classes always
seemed to produce a product that was visible or showed some change. The clear liquid
in the tubes was not the type of results with which the students seemed to feel
comfortable.

The final lab. Eel—BMW. had tWO Parts- First.
the students took plasmid isolated from Lab #4 and separated DNA by agarose gel
electrophoresis. Students made their own 1.2 % agarose gels and loaded the wells using
20 microliter micropipettes. The electrophoresis equipment and the power supplies used
in class were home made. This portion of the lab was to Show if the students had been
able to isolate the plasmid from the transformed bacterial colony in the previous lab.

Secondly, the students worked testing the action of two restriction enzymes:
EcoRI and BamHI on known phage DNA. This portion of the lab also used gel
electrophoresis to separate the DNA fragments. A known DNA phage was digested with
restriction enzymes and then loaded into wells of the gel. The DNA fragments moved

through the gel via electrophoresis.

31

The lab required the introduction of new equipment to the students. I spent most
of the first hour of the lab showing students how to use the gel electrophoresis tray, the
power supply, loading the wells of the gel with the micropipettes, making the agarose
gels and staining the gels.

On the second day of the lab, the students mixed glycerol with the samples of
known and unknown(isolated from Lab#4) pUC l8 and running dye and loaded them into
separate wells along with the running dye. It took about two hours for the running dye
to separate out into three bands with the 24 volt power supply. The running dye is used
to calibrate the agarose gel. The dye contained three different dyes, xylene cyanol: blue—
green color equivalent to 2800 base pairs, bromophenol blue: purple-blue color equivalent
to 250 base pairs and Orange-G dye: orange color equivalent to 70 base pairs.

The gel was run until the Orange-G dye was about 1cm from the end of the gel.
The movement of each of the three dyes was measured and recorded for comparison with
the bands of DNA fragments that would be strained.

The students returned after school to shut off the power and mark the distances
the running dye traveled and begin the straining process. All the distances were recorded
in millimeter lengths and placed on semi-log graph paper as previously described.

The students came in during lunch on the third day and loaded the wells with the
various combinations of restriction enzymes and phage DNA. The students had the
opportunity to try various combinations of restriction enzymes together with the phage
DNA to try and get different sizes of DNA fragments. The restriction enzymes used in
this portion of the lab were EcoRI and BamHI. One of the wells in the gel was loaded

with predigested phage DNA. This phage DNA had been digested by HindIII and had

32
fragment sizes: 23.13, 9.14, 6.68, 4.36, 2.32 and 2.03. The bands measured in this well

would become the standard to estimate the size of the DNA fragments in the other wells
that had been digested by the other two restriction enzymes.

The regular class period was spent finishing the straining of the pUC gels which
were then refrigerated for 24 hours. The students stopped the gels they had started two
hours earlier an measured the distance of the running dyes.

On the fourth day of the lab, the students stained the gels with the restriction
enzymes and studied the bands of the pUC 18 gel. They were able to calculate the size
of the bands of the pUC l8 plasmid from Lab #4 from the data gathered. The students
were able to see the band of known pUC 18 plasmid and then compare it to band, if any,
of the unknown pUC 18 plasmid.

The fifth and final day of the lab was Spent analyzing the second gel that
contained the DNA fragments digested by the restriction enzymes. The students
measured the bands that were strained and calculated the size of the DNA fragments.
The procedure for the calculation of the fragments. The procedure for the calculation of
the fragment sizes was the same procedure that was used for the previous lab part. Using
the semi-log paper, the students established a slope line with the known DNA fragment
that was digested by HindHI. The DNA fragments from the action of EcoRI and BamHI
were then compared to this line and the estimated size of each fragment was recorded by
the students.

This final lab exposed the students to many new terms and concepts, which were
discussed in Chapter 11 of the textbook. A discussion of the mechanism of the restriction

enzymes and how they work was the center focus of the lab. This lab allowed the

33

students to collect a wealth of data, graph it and calculate the size of DNA fragments.
The work with gel electrophoresis showed how scientists can isolate process of DNA for
study. The use of the equipment was the most interesting technique learned by the
students. Their overall excitement and questions seemed to peak during this lab.

A student lab report was completed by each student individually at the completion
of each lab. Each report included the student’s personal reactions to the labs. As lab
reports were written soon after the completion of the labs, I judged their comments to be
fairly accurate about their true impressions of each lab. On the unit post-test, I asked the
students to comment on the positive and negative aspects of the lecture and labs. I
judged from these comments as well as the lab reports that the labs were well received
and the basic concepts of each of the labs were understood.

I did not have any expectations of what the students would understand about any
of these labs. From the interviews, I learned that the students knew very little about
DNA structure, properties, and the behavior of restriction enzymes. The conclusions by
the students written at the end of each of the labs made it clear to me that the basic
concepts of the lab were understood.

Overall, I was very pleased with the labs, although they were too long. The unit
needs to be shorter and since the lecture material is not going to shorten, the lab time
needs to shorten. I nwd to rewrite a few portions of the labs to consolidate and save
needed class time. The first two labs seem like the most likely location to consolidate

initially. These two labs could be written in one multi-part lab.

34

Innovative Methods/ Demonstrations:

The only innovative demonstration used during the unit was the felt
board(Appendix E) to explain protein synthesis, as discussed earlier. I developed it a few
years ago to help students understand this process. The use of the felt board helps
students remember mechanics of the process and build for the new principles of
recombinant DNA. The felt board is a simple tool however the students seem to pay
close attention to the colorful board and readily key in on the terms of protein synthesis.
The Students get an opportunity to use the board to explain to fellow students and further

understand the mechanism of protein synthesis.

STUDENT TRANSFORMATION DATA

Pre and Post Test Results:

This was an Advance placement class that consisted of two males and nine
females. The course is a shared time class with students of the following schools from
Shiawassee County: Durand, Morrice, Perry, and Corunna. The students in the class had
taken and Introductory Biology course and a second year Life Science course at their
home schools which included Physiology/ Anatomy, Genetics, Microbiology, Ecology or
varied topics in Biology. The students were taking or had completed Chemistry.

These four area schools are considered rural in nature, and most of the students
were in the top on-third of their respective classes. Each of the students came into the
Advance Placement program with a slightly different background in science.

The pretest(Appendix D) that was given each student consisted of twenty—one
multiple choice questions, nine true or false questions, and fifteen matching questions
over the three chapters of the unit. The questions that were given included two basic
types, Simple recall questions and conceptual questions to test for the Student’s application
of knowledge. Sixteen questions came form Chapter 9, fourteen questions from Chapter
10, and fifteen questions from Chapter 11. The relatively equal distribution of the
questions was designed to test equally over all three chapters. The True-or-False type

of question I realize gives the student a 50/50 chance at being correct but I believe that

35

36
overall it tells if the student has grasped the basic facts of the unit. The fifteen matching

questions were divided into three groups of five questions with five answers for each
question. This type of question allowed me to list a series of terms or people and give
a series of statements of discoveries and see if the students can make the correct
associations. The researchers studying DNA are important: this type of question allowed
me to see if the students were cognizant of DNA research.

The twenty-one multiple choice questions were of two types: ten simple recall
questions and eleven conceptual questions. The equal split of the questions would show
whether or not the student could apply the subject matter.

The students took the pre-test the first day of the unit without being told in
advance about it. I wanted a clear indication of their prior knowledge about the material
in the unit without advance study. The test took the students about thirty-five minutes
to complete.

The results of the test Showed quite a gap among the students in their prior
knowledge. The highest score on the pre-test was 29 and the lowest was 12 out of 45
questions. the mean score was 19.25 or 42.8% correct. The standard deviation was 5.74
and with standard error a value of 1.73.

The post test of the unit was the same test as the pre test. The questions were
identical with the addition of an essay question to help me analyze if the students
understood the material. The resulted of the post test showed improvement compared to
the results of the previous test. The highest score on this test was 35 or 78% , which was
obtained by the person who had received a 24 on the pre-test. The lowest score was 23

or 51% of the questions correct and this was not the student with the lowest score on the

37

pre-test. The mean score on the post test was 29.9 or 66.4.5 correct. The standard
deviation was 3.15 with a standard error of .9497.

Teaching the unit Showed a ten question improvement in the average score of the
student. The students did not improve as much as I would have liked but there were
positive signs that learning did take place.

A ”T—test" was done to determine of the pre and post test were valid means of
assessing the students progress. the ”T-test" allows one to statistically accept or reject
the W. The W in this case states that there is no difference
between the unit’s pre and post tests. The ”T-test" uses the standard difference of the
means and was determined by using the standard error of both samples.

The standard error of the pre—test was 1.73 and the standard error for the post test
was .949. The calculation of the standard difference, the value was 1.96. The formula
for the "T-test" is:

ave 9f past test - ave, Qf pre test
Standard difference of error

2231-1225 = M = 5.43
1.96 1.96

"T-test" value of 5 .43
I calculated the degree of freedom to be: # taking lst test + # taking the 2nd test
minus two to locate the degree of freedom. The actual calculation was: 11+ 11 - 2 =
20. Using the distribution of the probability table, I found the value of twenty and went
across to find the value of 5.42. The highest value of the table was 3.8, which was in
the .001 column. The chances of these two sets of results being different because of

probability are less than .1% of the time. I can reject the N 11 H and say that

38

the data I gathered on the tests is valid and Shows that the students did learn new material
and Show improvement.

I was quite pleased with these results. The mean average score of the students
improved and I believe that the students did learn new material and apply it. All of the
students did improve despite their disparate background.

I do not have any comparisons with students not taught the new curriculum. In
subsequent years I will continue the pre-test practice and I do not plan to return to the old
was of teaching. The group of students in the present class (1991-1992) Showed a more

significant increase in scores between the two tests.

39

Clinieal Interview:

I conducted interviews with all eleven students following the pre test. I asked
each student the same ten questions. The questions were designed to be very general and
to give the Students the opportunity to tell me if they knew any thing about the concepts
and principles of the unit. A few of the questions were to determine if the students knew
anything about the terminology of molecular biology. I interviewed each of the students
privately so they would not feel any pressure from their classmates and I told them there
were no grades being given for their answers.

The eleven students were given a private interview with the ten questions that took
most students about ten minutes. I asked the students to please be candid with me and
answer the questions honestly. The students had been in class approximately three
months when the interviews were conducted. I sensed that most of the students were at
ease with me and answered the questions honestly.

Five of the students were seniors and six were juniors. The grade point average
of the class members ranged from 2.6 to 3.8 with and average of 3.25. Seven of the
students interviewed indicated that they would like to study in science after high school.

A summary of their responses to the questions follows.

1.) What do you understand about genetics?

Five of the students said that they got genes from their parents for traits and

40

would pass these on to their children. The remaining students all had some response
which included comments on the terms dominant, recessive, RNA, DNA, X and Y
chromosomes, and genes. One student expresses high level of confidence with her
understanding of genetics and her scores were the highest on the pre and post test.

2.) How do you define DNA?

Eleven different responses to this question were recorded. Three of the answers
contained some misconceptions about DNA. One student said it ”contains
chromosomes" , another student said it ”contains genes" and a third said it contains
”proteins with and case ending”.

3.) What can you tell me about the following terms: genes/ nucleotide/ chromosomes

I expected that chromosomes would be the best understood, followed by the
concept of the gene and the least understood would be the nucleotide. Eight of the eleven
students gave and appropriate definition of the chromosome. Ten of the eleven seemed
to understand the concept of a gene. Only two students gave a response to the term
"nucleotide”.

4.) What do you understand about protein synthesis?

I had expected that the majority of the students would understand the basic
framework of the protein synthesis process involving DNA, mRN A, tRN A, and
ribosomes. Only a surprising two students of eleven students could define and summarize
the process. Four students could define protein synthesis and five students seemed to
have no ides what it was. I was quite disappointed with these responses because I had
taught some of these students for two years and had Spent time each year on this topic.

The results of this question indicated that I would need to spend more time on Chapter

41

10 and protein synthesis in the unit.
5.) Can you name anyone who has done research with DNA?

I was disappointed in their lack of knowledge of names associated with this topic.
The name of Mendel was mentioned by three students. Watson/ Crick was mentioned by
two other students and two other students said the name of Cook, a name that I had not
heard associated with Genetics. Four of the students could not think of anyone that did
research in the field of genetics.

6.) What do you understand about the science of recombinant DNA? What does
”recombinant” mean?

This subject had not been taught before and I wanted to see if the students had
picked it up from the media. Seven of the students had a good idea of what recombinant
DNA was all about. Four of the students did not even try to explain it. These responses
were encouraging because at least some of the students had some basics upon which to
build.

7.) What is a virus?

Only two of the eleven students could answer this question with specific and
correct responses. This question showed that many of the students have misconceptions
about the viral DNA and RNA and replication. The answers included responses like:
”it’s a cell”, ”it’s a thing that causes diseases” and ”it floats in the air and can make you
sick. "

8.) Do you think cancer & genetics and connected at all? If so how?
I was pleases to see that if the student thought about it, they could make a

connection between genetics and cancer and explain it using the appropriate terminology.

42

Four of the students were not sure what the specific connection between cancer and
genetics was, but knew there was a connection. No one though was not able to see the
connection.

9.) If you had to define "biotechnology” , what would you say?

This question was to give me an indication of the parts of Chapter 11 on
Biotechnology they already understood. Three of the students could define the term
properly and their answers included: "to create new living things" , "modify living cells",
and ”understand detail aspects of biological systems". Eight of the students could not
define the term or had the wrong concept.

10.) Can you tell me what you think is important about genetics?

All of the students had an answer to this question. Four of the eleven saw the
importance of Genetics to be in the understanding of diseases and how to correct them.
Other answers included" to discover how to clone organisms", ”to modify our life", "to
study behavior of people" and finally "its the new frontier of science. "

The pre test interviews indicated that the level of understanding of the field of
molecular biology was limited. I discovered that the students had a basic notion of what
DNA was but did not understand the structure of it. The subjects of recombinant DNA
and biotechnology were new and unfamiliar to most of the students. The students knew
little of the research of researchers in the field of molecular biology but all saw the field
to be important in the study of science.

These findings indicated that I needed a thorough review of basic biology
including DNA, nucleic acids, protein synthesis and possibly reinforcing lab work. I

decided that I needed to progress slowly through Chapters 9 and 10 to build the student’s

43

knowledge. The labs accompanying Chapter 9 and 10 reinforced this information. The
isolation and properties of DNA lab helped the students visualize the concepts of the
chapter. The major portion of the unit was contained in Chapter 11, Biotechnology. The
three labs on bacterial transformation, plasmid removal, and gel electrophoresis tied
together the concepts of biotechnology.

The pretest interviews indicated that the unit would take more time than the
original five weeks that I had planned. Therefore I allotted more time to reinforce

Chapter 9 and 10 than I originally planned.

Subjective Evidence of Effectiveness of the Unit:

The students gave me their thoughts on the significance of the five labs of the unit
on the final essay question of the post test. I did not grade this essay and I told them this
in hopes that they would feel free to respond candidly.

The question was written "a post interview” to see how much of the unit
information was acquired from the labs. The question was also intended to see if they
understood the significance of the labs and equipment used. I wanted to give the students
the opportunity to write down all of their thoughts about the unit without feeling
pressured by me in a clinical interview format.

The final question was:

”Explain the significance of the 5 labs done during this unit”

Students were given the following specific questions:

A.) How did they fit into the chapter material?

Eight of the eleven students could cite a specific example from the labs that
related to the chapter material. Five of the students described how that illustrated the
concept of transformation. Four students discussed the relationship between lecture
material on restriction enzymes and its use in the lab. Overall the comments were very
reflective of the cooperation between lab and lecture. Two students stated the following
comments on the coordination between lab and lecture:

"showed how to study molecular biology","Lab explained the concepts discussed

45

in the chapter” , "see how scientists went about finding information" and ”hands

on experience with concepts from the book”.
B.) What did you attempt to do in them?

Six of the eleven students listed cutting the DNA and inserting pUC 18 into the
bacterium. Five of the students mentioned gel electrophoresis of DNA fragments. Other
comments from students were on the procedures done with the bacterial transformation
experiment including competent cells, inducers, inhibitors, restriction enzymes and operon
genes. One student wrote the following about the concepts learned

"We didn’t just read about someone’s experiment, we did them. It was exciting

to see growth on the plate, working with something scientists just recently started

playing with. "
C.) Did you see any relationship between the labs? If so how?

I wanted to see if the students could see the sequence of labs and understanding
how they related to each other and the unit. All the students made positive concepts
about the relationship between the labs. Some of the comments included:

”All labs dealt with plasmids and cutting DNA", "Just like big long experiment”,

"Each lab laid down the groundwork for the next one” and "Products from one

lab were the materials for the next”

D.) What scientific principles did you learn from them?

All of the students listed at least two scientific principles. The three principles
mentioned by a majority of the students were restriction enzymes; DNA restriction,
insertion, and isolation; and electrophoresis of the gels. Other students commented on

recombinant DNA, bacterial transformation and plasmids.

46
E.) Were there any special skills you acquired as results of doing the labs?

Five students cited electrophoresis work including loaded wells and measuring and
staining gels. Two students mentioned making electrophoresis gels, using micropipettes
and microcentrifuge tubes, and inserting plasmids into bacterial. One student summed
it up this way: "I learned that it works and will not always give the same result to each
group, also it takes patience to get it to work. "

It was very rewarding the read comments like the one above. I think that besides
learning about scientific technology and DNA terminology, the students also learned
much about the scientific method and scientific patience. The labs seemed to provide

students with a realistic look at performing an experiment in a real life situation.

DISCUSSION AND CONCLUSION

Aspects of the Unit that are Effective:

The aspect of the unit that was most effective was the labs. The students seemed
genuinely interested in the new technology that I was presenting. They were unusually
quiet during the explanations for the labs. The newness of the labs and the equipment
was the primary reasons for their interest. The number of the students in each group who
got actively involved in each lab was greatly increased compared to other classes. In my
other lab classes, a usual lab group of four students working together involved one or two
of the students doing the work and two recording the data or just watching. The labs in
the molecular biology unit seemed to involve all of the Students in the experiments.
During the final three labs there was not a student who did not load a well or stain a gel
or measure a band of DNA on a gel. Students who were generally reserved in most labs
were actively involved in performing these labs.

Discussions during the labs centered on the experiments and the results they were
getting, not normal classroom talk. Often during other labs I have to remind students to
stay focused on the task at hand and to discuss what they were doing with each other.
I was pleasantly surprised that I did not have to do this with these labs. I actually had
students come up to me to ask questions about the labs and their future applications in

society. These kind of positive experiences, I would like to have with all labs. The

47

48

students actually came into class early and immediately went to work of would get their
results from the previous day’s lab. Many students would come in before school, others
would stay after school, and some came in during their lunch period or study hall to work
on the labs. The excitement and concern by the students gave me the feeling that this
was the most effective part of the unit.

I would like to make the final three labs more open ended than they are. There
are opportunities to open the labs for independent research. The students seemed
interested in the labs and with some options at the end of the lab the students could go
further and discover more. For example, Lab #4(Appendix A) gives the students four
options of plasmid removal. In the actual lab only one option is tried by each of the
students. I would like each student to have the opportunity to try the other three plasmid
removal techniques. The students then could revise them of possibly combine them to
a more effective plasmid removal technique. Lab#5 (Appendix A) could be expanded by
increasing the types of restriction enzymes used in the experiment. The lab could also
be used to Show the separation of proteins as well as DNA.

The equipment used in the labs needs to be more extensive and precise. Most of
the equipment used in the labs homemade in our lab. I would like to purchase more
commercially made equipment.

The audio visual materials used were adequate to explain the material. I would
like to find a good video tape that demonstrates some of the techniques needed for the
unit. I think that often times students listen better to others than to their teacher when
new materials is explained.

The aspects of the unit that need improvement include the chapter on protein

49

synthesis. I have an adequate amount of material to explain the process but I would like
to find a good video tape that shows the sequence of events that occur Simultaneously but
a video could do a better job of this.

I think that it would be possible to combine Lab #1 and Lab #2(Appendix A)
together. These two labs are similar and by combining the students would accomplish
the same objectives and save some additional time in the unit for other procedures.

I need to acquire more lab equipment so the lab groups could be smaller. Ideally,
a group of two students would work the best. The equipment is small and its difficult
for all of the students to see the procedure when the group is as large as four or five
students.

The use of weekly quizzes over the lecture and lab material would help the
students keep up with the material weekly instead of putting off review until the unit test.

The use of weekly quizzes might improve the test results on the chapter tests.

50

Overall Evaluation:

My evaluation of the unit was that it was very successful. Each day of the unit,
I left the class excited to come back the next day to continue the work. My excitement
was mirrored by my students trying to learn new techniques, new terminology, and apply
them in lab. I think the Students learned a great deal about molecular biology. Learning
the material was important but also they gained an appreciation for the future of
molecular genetics. I think they are literate enough to pick up a newspaper, magazine,
or watch a newscast and understand the meaning of new discoveries in molecular biology.
The geome human unfolding project can be understood by my students.

I think the students got genuinely excited about science and especially molecular
genetics. Excitement in the classroom is something I do not often see in teaching. Their
excitement with science of molecular biology was the biggest accomplishment of the unit.

This excitement carried on through to the following other units.

APPENDIX A

LABORATORY EXERCISES

51

EXPERIMENT #1: DNAJSQLAIIQN
Winn:

To understand the eukaryotic cell at the molecular level requires
isolating the nucleus. We must rupture the cell membranes in a controlled
fashion. If careful, you can remove the soluble components of the cell and
separate them from the nucleus. The nuclei can be separated by low speed
centrifugation from the rest of the cell components.

Ql' I' :
To isolate DNA from the nuclei of eukaryotic cells
Materials:

Calf Thymus - 15 grams
Cold Denatured Alcohol
Glass vials/T est tubes
Glass Rods
Micropipets(100 ul)
Sodium Dodecyl Sulfate (SDS)
Nuclear Stain

Cheese Cloth

Nuclear Buffer

lce Bath

Microscope

Microscope Slides
Clinical Centrifuge
Blender

Funnel

500 ml Beakers
Toothpicks

Scisssors

Emeriure:
PART I - lsolatiouLNuclelemJells

1. Place the 15 grams of calf thymus into a 500 ml
beaker-cut into less than 1 cm pieces with scissors

 

Pi

52
2. Place one section for every pair of students into a

beaker,seai it, and refrigerate for part ill
and the remaining sections in the blender.
3. Add 100 ml of cold nuclear buffer into a blender

4. Add 12 ice chips, blend for one minute at high speed

5. Filter the homogenate through two layers of cheese
cloth

6. Pour the homogenate into test tubes and centrifuge
for 5 minutes at 2000x rpm

7. Carefully pour off and discard the supernatant(top)-
the peliet at the bottom contains the nuclei

8. Transfer the nuclear pellet to the blender with
100 ml of cold nuclear buffer

9. Blend the pellet for 10 seconds - refiiter with
cheese cloth

10. Store the mixture in the refrigerator until needed

PART II -D_NA_lS_QLAILQN
1. Place 2 ml of the nuclear suspension in a test tube

2. Add 1 ml of 1% SDS solution into the vial/test tube
note the appearance and consistency

3. Allow to sit for 5 minutes
4. Pour 3 mi of cold denatured alcohol(on top)

5. Dip the glass stirring rod through the solution
and slowly rotate - JUST DNA will spool on rod

53
Part III - W

1. Take two clean microscope slides

2. Take a clean toothpick,scrape the surface of the
saved thymus section and smear on both microscope
slides. Allow to air dry

3. Using a micropipete add one drop of nuclear
suspension(part I, step 10) to the center of the
slides, smear-air dry

4. Place three drops of alcohol on both slides to fix
the tissue to the slide. After 2 minutes rinse with
water with slide inverted.

5. Add three drops of nuclear stain. allow to stand for
5-10 minutes - rinse by inverse wash of water

6. Air dry for a least 10 minutes and examine under
high power(43x). Nuclei should be purple,cytopiasm
pale blue, nucleoli will appear small dark dots in

the nuclei.

BMW

Draw a picture of the nucleus view under the
microscope at high power.

II II' {C l'

1. Make a list of five comparisions in the morphology
of the isolated nuclei to the intact thymus cells

2. SDS solution is a detergent that dissociates histone
proteins from DNA. Describe the change in the
clarity and viscosity of the nuclear suspension
when 808 was added.

54

EXPERIMENT1 -DNA_LS_QLAI|QN
Teacher's Guide
Time Frame: One Class Period(50 minutes)
Target Group: 2nd-3rd Biology Students
Prepartation of Materials:

1. Call Thymus Sample: 15 grams of fresh thymus
Which can be obtained from a local butcher shop or meat dept

2. Nuclear Buffer(Modern Biology Kit #1)
Magnesium Chloride 1M
Sodium Chloride (1% solution)
Nonidet P-40 1M
Tris pH 7.5 : .19 grams of Tris HCl
.09 grams of Tris Base
.07 grams of EDTA
mix in 200 ml of distilled water
Dilute Sml of concentrated buffer in 500 ml
of distilled water - store in refrigerator
The above chemicals come as a kit,formulas by

writing ModemfiioloorLJm.
3. Nuclear Stain: 1% Methylene Blue( 1 grams/100 ml)

4. Sodium Dodecyl Sulfate(SDS):1 grams/100 ml of water

Sources of Materials:

Modern Biology Inc. Biochemical Stores
P.O. Box 97 Biochemistry Bldg.
Dayton, lndiana 47941-0097 M.S.U.
1-800-7336544 East Lansing,Ml.
48824

Sigma Chemical Co.
P.O. Box 14508
St. Louis,MO. 63178-9916

 

55

Comments: This lab is a good visual lab for the students to
see DNA in the cell and compare what they see on a
glass rod to under the microscope, which is nuclei
of the cell.

References:

Anderson, John; W, Purdue
University,1987.

Sambrook, Fritsal, Maniatis; Whining; 1989.

Advance Placement: LaboratonLManuaLcLSludems;
The College Board, 1989.

56

EXPERIMENT 2 - W
W

A single human chromosome DNA molecule is about 40 cm long. isolating
DNA can be done by adding alcohol to a homogenized cell in a test tube. The DNA
fibers can be precipitated and spooled on a glass rod.

DNA is an extremely long molecule that is very thin.yet quite rigid. The
isolation of DNA is difficult because the long rod like molecules can be broken.
DNA can be broken down by an enzyme called deoxyribonuclease l or DNAsel. THis
enzyme breaks the bonds between the nucleotide units in the DNA.

ijactiya: To study the structure of DNA and the factors
that denature it, particularly DNase

Mandala:

Cold Denatured Alcohol
Bottle of blended Calf Thymus
DNAse l(Modern Biology Kit #1)
Glass Vials/T est tubes(1 per 2 students)
Glass Rods ( 1 per 2 students)
transfer pipettes
2 Large transfer pipettes
ice bath

hot plate/bunsen burner
1% NaCl soltion

Emedura:
Part I - QNAfioocllng
This portion of the lab is similar to Lab #1 part II
1. Place 3 ml of blended thymus into a glass vialfi‘T

2. Carefully pour 3 ml of cold alcohol into vial; the
alcohol should form a layer on the top of the solution.

3. Dip the glass rod into the vial and slowly rotate
the rod and raise it into the alcohol. Fine fibers
should form on the end of the rod.

4. Record the observations of the DNA on the rod.

57

Part II - WW
(Putting DNA back into solution)

1. Place the rod with DNA fibers into a test tube

2. Add 2ml of 1% NaCl, shake the rod until the DNA
fibers are in solution

3. Let stand for 24 hours

4. After 24 hours attempt to respool the DNA on the
glass rod by first adding 3 ml of cold alcohol.

5. Record your observations of the DNA on the glass rod

Part I" - WW

1. Place a new sample of 3 ml of DNA solution in the
glass vial/LT.

f0

. Hold the vial with a test tube holder and hail
carefully for 1 to 2 minutes

3. Place the heated solution in an ice bath to cool
quickly for three minutes

4. Add 3 ml of cold alcohol to the solution

5. Attempt to spool the DNA with a glass rod.

6. Record your observations of the attempt to spool
7. Repeat steps #1 and #2 with a new DNA sample.

8. Cool the solution slowly at room temperature for
five minutes

9. Add 3 ml of cold alcohol to the solution
10. Attempt to spool the DNA with a glass rod

11. Record your observations of the attempt to spool

58

Part Iv - WM

1.

6.

7.

Place a new sample 3 ml of DNA solution in a glass
vial/ Test tube

. Using a micropipette add 50 ui(about 4 drops) of

DNAse l and mix

Let it stand for 10 minutes, then add 3 ml of cold
alcohol

Attempt to spool the DNA on the glass rod

. Record the results of the attempt to spool.

Stir the alcohol and DNA mixture together

Record the color and appearance of the mixture

W: Make a chart to coordinate the data

from the many observations made. Below the results,
list the factors that influence the results.

lnlemmlatlohs:

l.

2.

List the basic properties of DNA as observed in lab

Describe and explain the action of the DNAse l on
the DNA.

59

EXPERIMENT #2 - EBQEEBIJESQEQNA

I I . G . |

Time Frame: One Class Period (50 minutes)
Target Group: 2nd - 3rd year Biology Students

Preparations of Materials:
1. Cali Thymus DNA solution: 15 grams of fresh calf
thymus blended at high speed with 100 ml of
1M magnesium chloride, 1% NaCl, Tris buffer
(pH 7.5) in 100 ml of distilled water.
(same as the DNA solution from Lab #1)

2. DNAse l : 500 ul I of DNAse I suspended in Tris
buffer of pH 7.5

3. Tris Buffer: .19 grams of Tris HCl
.09 grams of Tris Base
.07 grams of EDTA (mix in 200 mi of distilled water)

4. 1% NaCl Solution: 1 gram of NaCI in 100 ml of distilled water

5. Denatured Alcohol: 200 ml of 90-100% ethyl alcohol

SourcasmLMaterial:
Modern Biology Inc.
PO. Box 97
Dayton, IN 47941-0097

Sigma Chemical
St. Loius , MO.

Carolina Biological Supply
Burlington, North Carolina

Comments:

This four part lab can be done in one class period
with a little advance prep time. From this lab. the
student should get a good overall picture of the
properties of DNA. Actually this lab could be done by
first year students to help explain the basic
properties of molecular genetics.

References:
Anderson, John; W, Purdue Univ., 1987.

61

EXPERIMENT #3 - W
W

W:

The bacteria Esehariahjmli (£43211) is an ideal organism for molecular
biologists to manipulate and is used extensively in recombinant DNA research. It
easily can be grown in luria broth(L.B.) or luria agar(L.B. agar). The single
circular chromosome of E42911 contains 5 million DNA base pairs, only 1/600th
of the total amount of DNA in a human cell. In addition, small circular DNA
molecule called PLASMIDS also carry genetic information. The plasmids are
extrachromosomal; they exist separately from the chromosome. Under normal
circumstances, plasmids contain genes that enable bacteria to survive and grow
in certain environments. Some plasmids carry one or more genes that confer
resistance to antiboitics to the bacterium.

Bacterial transformation is the uptake and expression of foreign plasmid
DNA by the recipient bacterium that can result in conferring a particular trait to
the recipient. The transformation occurs when the bacteria is in the growth
stage called COMPETENCE,when they are most receptive to foreign DNA uptake.
Competence to incorporate DNA develops in time. Competency is achieved by
treatment with calcium cations.

themiya: To introduce the pUC18 plasmid into 59911 in
order to create a population of bacterial cells
resistant to ampicillin and action of the operon gene
'Iac operon“ by bacterial transformation.

Materials:
plasmid pUC18
am picillin

luria broth(LB broth)

luria agar(LB agar)
inoculating loops
micropipetes (10 ul, 100 ul)
sterile microcentrifuge tubes
calcium chloride solution (2% solution)
test tubes/test tube racks
Emu(JM101 strain)
X-gal/iPTG/Amp LB plates
water bath (37 degrees)

Ice bath

Incubator (37 degrees)

glass pasteur pipette

62

Emcedure:
Paul-WW5

1.

2.

3.

4.

Place 5 mi of a 2% calcium chloride solution into a
test tube and place in an ice bath.

Add 100 III of Limit to the calcium chloride/mix

incubate the cells for 10 minutes on ice,cells
should be competent at this stage

Cells can be stored in refrigerator for up to 24 hrs

Part II-umakLeLQNLbuhefimmtemfiells

1.

Take two microcentrifuge test tubes,label one "+"
and the other '-"DNA.

. Place the tubes on ice for 5 minutes.

. Transfer 10 ul of plasmid pUC 18 to the test tube

labeled "+" DNA

Transfer 50 ul of the competent Emil to both
positive and negative microcentrifuge test tubes and swirl

Store both tubes on ice for 15 minutes

. Transfer both tubes to 37 degree water bath for

5 minutes

Add .7 ml or 700 ul of LB broth to both
microcentrifuge tubes. Incubate for 30 minutes in

the 37 degree water bath.This allows the bacteria to
recover from the procedure and begin to express the
plasmid's genes

. Obtain two ampicillin LB piates(LB+). Label one "+"

DNA and the other DNA

. Transfer 200 ul of bacterial suspension from each

microcentrifuge tube to the appropriate plate:
'+" to '+" and to

63

10. Using a modified pasteur pipette/ loop
spread the bacteria evenly over the agar

11. Let the media stand at room temp. for 30 minutes
12. Invert the plates and store in incubator 37 degrees

NEXT DAY: count the colonies on each plate and record

Part III - Win

The pUClB plasmid besides confering resistance to ampicillin can
also transform Emil to use a different energy source for growth. When the
bacteria is grown on LB+ plates with X-gal/lPTG(a histochemical substrate
which forms a blue-colored product and an inducer of the activity), the bacteria
stops using galactose and uses lactose as the energy source. The inducer lPTG
turns on a new gene on the plasmid to operate. As the bacteria grow and uses
lactose they will turn the media blue, as an indicator of the bacteria
transformation.

1. Using the same cells from part llstep 4(Compenet +),
place a 200 ul of the transformed cells on
LB X-galllPTG/Amp plate.

2. Smear the culture evenly over the plate using a
sterile modified pasteur pipette.

3. Allow the smear to sit for 30 minutes then incubate
inverted for 24 hours.

NEXT DAY: Count the number of colonies that grew on the
experimental X-gal/lPTG/Amp plate and record
number and appearance of colonies

BesultsLDatajheet:

1. Draw a picture of the three plates used in parts II
and lil,iabei each drawing and describe the events
that occured.

2. Count the nuber of visible colonies on each plate:
Minus DNA:
Plus DNA:
LB X-gal/lPTG/Amp:

 

 

 

64

3. Calculate the transformation efficieny of the
LB/X-gal/lPTG/Amp plate. Using the following formula

Formula: # of colonies on X W

plate total vol. of mix
used on plate

Example Problem:
if you observed 100 colonies on your plate, the
efficiency is calculated as follows:

32045911492919
(100 colonies on plate) x 200 sample used =455

Note: total mixture=300 ul competent cel|s+
600 ul of LB broth + 10 ul of pUC18

100 colonies x 4.55 = 455 colonies expected from
total reaction mixture

455 colonies/30 ng plasmid DNA = 15.1 colonies/ng
plasmid DNA
(30 ng is concentration of plasmid DNA used)

15.1 colonies/ng x 1,000ng/mg=1.51x 104
colonies/ui g plasmid used
Therefore, the transformation efficiency in this
example would be on the order of 104 per mg
of plasmid used

II II' [C l'

1. Explain how and why the cells can be resistant to
ampicillin and have the lac Operon too?

65

EXPERIMENT #3 BAQIEBIALIBANSEQBMAIIQN
W12

W:

Time Frame: two day lab: Parts I and "(first class )
Part III (second class)

Target Group: 2nd - 3rd year Biology Students
Preparations of Materials:

1. 2% Calcium chloride solution

2. E42911 suspension: strain JM101

3. pUC 18 plasmid: 30 ng plasmid in suspension
(Modern Biology Kit #3)

4. LB broth: 10 grams of tryptone
10 grams of sodium chloride
5 grams of yeast extract
.1 gram of NaOH
1 liter of distilled water
Autoclave for 15 mins at 121 degrees and 15 psi

5. LB plates: use 500 ml of LB broth and add 7.5 grams
of bacto-agar and combine if both sterile, need to
heat to boil and pour in sterile petri dishes.

6. Ampicillin(25 mg of Amp/mi): add .5 grams of
ampicillin to 25 ml of distilled water and pass
through a sterile diposable .45 micron Millex filter
collect in 1 ml samples which can be frozen until
needed. (.22 micron Millex filter works better)

7. Pasteur pipette: heat bend the narrow part of the
pipette as shown below. Cautionzglass heats quickly

 

Ll

66

8. LB X-gal/IPTG/Amp plates: 500 ml of LB+ agar,
autoclave,as cools add 2.5 ml of 2% X-gal and
add .5 ml of fresh 100mM IPTG(Isopropyi
b-d-Thiogalacto-pyranoside),1 ml of Ampicillian &
pour into sterile petri dishes

9. 2% X-gal: .16 grams of X-gal(5-Bromo-4Chloro-
3-lndolyl b-d-Galactopyranoside) in 8 ml of DMF
solution (N,N Dimethyiformamide)

10. 100mM lPTG solution: .07 grams of lPTG in 3 ml of
sterile water

SeumeuzLMaterials
Modern Biology Inc. Biochemical Store
P.O. Box 97 Biochemistry Building
Dayton, IN. 47941-0097 Michigan State University

East Lansing, MI. 48824
Sigma Chemical Co.

PO. Box 14508 Carolina Biological
St. Louis, MO. 63178-9916 Burlington,N.C. 27215
220111131115!

This lab requires a lot of explanation and discussion of DNA, plasmids,
recombinant DNA, cloning, bacterial transformation, and nucleotide sequences
AHEAD of time.

The lab will work well if done two consecutive days. It can be broken up
between parts ii and Ill, because each will take about one class period to do. The
lab can be shortened if the teacher makes the cells competent before class
starts.

Balances:
Anderson, John; W; Purdue Univ.;
1987.

Sambrook, Fritsel, Maniatis; MglagulaLngning; 1989.

Helms, Doris and Phillip, Corker; W;
Worth Publishers; 1989.

Advance Placement Biology; W;
The College Board; 1989.

67

EXPERIMENT #4

W
W:

The removal of a plasmid from a bacteral colony can be done by a variety
of techniques, including boiling, pH changes(alkalanity) and filtration. The lab on
plasmid extraction has four parts. You will be assigned one of the four
techniques to remove the plasmid(pUC18) from the colony of 59911 you used in
experiment #3.

Qbiegtjya: To extract the pUC18 plasmid from mil
cells that have shown they possess the plasmid

Materials:
overnight bacterial culture of Emil with pU018
four 15 ml screw top pyrex or disposal test tubes
two Millex 0.45 micron filters + holder
one 1/16 inch female Iuer adapter
two 20 ml syringes(with Iuer locking fitting)
two 30 ml Iuer locking fitting syringes
single layers of 4"x4" cheese cloth
pastuer pipette with bulb
ice bath
10% flocculating agent(polyethylenimine)
TENS solution
50 ml beaker
centrifuge
precipitating agent(potassium acetate)
100% isopropyl alcohol
TE buffer

2mm: Filtration Process

1. Remove a 15 ml sample of an overnight culture of
Email to a sterile 15 mi tube

2. Cap the sample and invert five times - observe
consistence of the solution

68

Add 4 drops of flocculating agent to sample/invert
the tube five times - clumping of sample should
begin.

. Place the tube in an ice bath for 10 - 20 minutes

to allow the clumps to settle - DO NOT DISTURB

. After the clumps have settled out, use a pasteur

pipette to remove the clear broth down to the 4 ml
mark on the test tube. Discard the liquid.

. Swirl the concentrated colonies to resuspend them

. Add 3.5 ml of TENS solution to the supension, cap

and gently invert the tube ten times.

Increase the volume from 7.5 ml to 12 ml by adding
4.5 mi of precipating agent,cap, invert 10 times
stand at room temperature for five minutes

. Place four layers of cheese cloth over the 50 ml

beaker and push down in the center to form a
funnel shaped area.

10. Carefully pour the solution through the cheese

11.

12.

cloth and discard the material and cheese cloth but
save the liquid.

Remove the plunger from the 20 ml syringe and
attach the barrel of the syringe to a .45 micron
filter. Place the other end over a new clean 15 ml
test tube, pour the solution into the barrel of the
syringe and insert the plunger and SLOWLY push all
solution through the filter.

Add 6 ml of isopropyl alcohol to the test tube of
solution, cap the sample and invert 10 times. Let
the tube sit at room temperature for 5 minutes.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

69

Connect a clean 20 ml syringe to a new clean .45
micron Millex filter. Remove the plunger. Place the
other end over a clean 15 ml test tube to collect
wastes. Pour the solution of #12 step into the
syringe barrel, insert plunger and push SLOWLY the
solution through. The plasmid should be collected
on the filter, on the surface closest to the

syfinge.

W the filter from the syringe, draw

20 ml of air into the empty syringe and connect
syringe to the filter. Push the air through the
filter. Push the air through the filter to remove
the remaining liquid.

Remove the 20 ml syringe from the filter

Remove the plunger from a 3 ml syringe and attach
it to the .45 micron filter.

Attach a 1/16" female Iuer fitting coupling to the
other end of the filter.

Connect another clean 3 ml syringe with plunger
into this female Iuer coupling.

Add 1 ml of TE buffer to the open barrel syringe,
insert plunger and push SLOWLY the buffer solution
through the filter into the other syringe. It helps

if you slowly PULL the opposing syringe's plunger
at the same time as you are pushing, back and forth

Push the solution through the filter 10 times.
Remove the original(1st) syringe with the solution
and inject it into a clean microcentrifuge tube to

save for Experiment #5.

The sample should contain 5 to 30 micrograms of
pUC18 plasmid in it, which will be saved for Lab #5

70

CLEANING: syringes, tubes, and equipment can be rinsed
in water. .45 micron filter are reuseable
and need to be cleaned with alcohol by using
the syringe to rinse through.

Emu: Boiling Technique

Materials:
overnight culture of germ
LB broth
Microcentrifuge
Microcentrifuge tubes
STET solution
Lysoszyme solution
2.5M sodium acetate solution (pH 5.2)
isopropanol
70% ethanol
micropipettes
vacuum 'source(water aspirator is fine)
TE buffer
sterile toothpicks
vortex mixer (optional)

1. Remove a 1.5 mi sample of an overnight Emil
suspension and place in microcentrifuge tube.

2. Centrifuge the tube at high speed for 45 seconds
and store the remainder of the culture in the
refrigator.

3. After centrifuging, the bacteria will be a pellet
on the bottom of the tube. Connect a length of
rubber tubing to the vacuum source and insert a
disposable pastuer pipette into the other opening of
the tubing. Remove the liquid medium in the
microcentrifuge tube by gentle aspiration. Touch the
tip of the pipette to the surface of the liquid and
keep the tip as far as possible from the pellet of
bacteria. Vacuum the walls of the tube to remove
any drops of liquid.

71

. Add 350 ul of STET solution to the tube and

resupend the bacteria.

. Add 250 ul of freshly prepared Iysozyme solution

which has been held on ice. Resuspend by vortexing
for 3 to 5 seconds or shake gently to resuspend.

Place the tube in a boiling water bath for exactly
40 seconds.

. Centrifuge the solution for 10 minutes in the micro-

centrifuge.

. Using a sterile toothpick remove the pellet of cell

debris from the bottom of the tube.

. Add 40 ul of 2.5M sodium acetate and 420 ul of

isopropanol. Mix by vortexing or shaking and store
for 5 minutes.

10. Centrifuge the solution for 5 minutes

11.

12.

13.

14.

15.

16.

Remove the liquid by aspiration (step #3)

Invert the microcentrifuge tube on paper towel
until all traces of fluid are gone.(Up to 10 mins)

Add 1 ml of 70% ethanol. Centrifuge for 2 minutes

Remove the ethanol by aspiration and store the tube
until all liquid has evaporated.

Resuspend the plasmid in 50 ul of TE buffer.
Typical yield of 4 mg per millilter of bacteria
should be produced.

This plasmid will be assayed in Experiment #5

72

Materials:
Overnight culture of Emu with plasmid
TENS solution
TE buffer
3M sodium acetate
100% ethanol
70% ethanol
micropipettes

1. Place 1.5 ml of the overnight E42911 culture in
a micro-centrifuge tube and centrifuge for one min.

2. Discard all the supernatant fluid except the last
three drops. Vortex or mix to resuspend the cells.

3. Add 300 ul of TENS solution to the suspension and
mix or vortex. This solution is basic and will lysis
the cell wall of the bacteria and denature the DNA.

4. Add 150 ul of sodium acetate to neutralize the
solution and renature the DNA. Mix for 10-20 seconds

5. Centrifuge for two minutes to pellet the cell
debris. The DNA will remain in solution.

6. Pour the supernatant fluid into a clean test tube
and add 0.9 ml of 100% ethanol that was in the
freezer overnight.

7. Centrifuge for two min., a white pellet will form.

8. Discard the supernatant fluid and rinse the pellet
twice with 70% ethanol.

9. Air dry the pellet for 5 minutes.
10. Add 40 ul of TE buffer to resuspend the pellet.

11. Save the microcentrifuge tube with sample of
the plasmind for experiment #5.

73

E l III'EII I' llll II | 1

Materials:
overnight culture of Egan containing pUC18
centrifuge
microcentrifuge tubes
Iysozyme solution
TENS solution
TE buffer
3M sodium acetate solution
95% ethanol
1 ml pipette
micropipettes
vortex (optional)
ice bath

1. Pour 6-8 ml of overnight culture of 5.0.011 into a
microcentrifuge tube and centrifuge for five minutes

2. After discarding the supernatant fluid, add .5 ml of
lysozyme solution to the cell pellet and vortex or
mix and let stand for five minutes.

3. Add .5 ml of TENS solution, mix and place tube on
crushed ice bath for 15 minutes.

4. Add 0.5 ml of sodium acetate solution to neutralize
the mixture and renature the plasmid DNA.

5. Centrifuge the solution for 10 minutes to pellet
cell debris.

6. Transfer the supernatant fluid to a clean test tube
and add 2 ml of 95% ethanol(which was in a freezer)
and mix for 10 seconds and place on ice for 10 mins.

7. Centrifuge for 10 minutes to pellet the plasmid DNA

8. Discard the supernatant fluid and rinse the pellet
twice with 95% ethanol.

74

9. Dry the pellet for 15 minutes in the air.

10. Add 40 ul of TE buffer and vortex/mix for 30
seconds. The solution should contain the plasmid.

11. Save the microcentrifuge tube of plasmid for
experiment #5.

75

EXPERIMENT #4 WW
IeaeheflLGuide:

IimLErame: two class periods of 50 minutes(if materials
prepared ahead of time)

W: 2nd-3rd year Biology Students

E l' 1 II | . | :
1. Flocculating Agent: 10% of Poly(ethylinemine)
in distilled water

2. TENS solution: .4 grams of NaOH
1.4 grams of SDS
sodium dodecyl sulfate)
100 ml of distilled water

3. TE Buffer(ph 8): .19 grams of Tris HCl
.09 grams Tris
.07 grams of EDTA
dissolve in 200 ml in distilled
water

4. Precipitating Agent: 60 ml of 5M potassium acetate
11.5 ml of glacial acetic acid
28.5 ml of distilled water

5. lsopropyl Alcohol: 100 ml of 90—100% isopropyl
alcohol

6. Lysozyme Solution: .24 grams of Tris H01
.12 grams of Tris
.34 grams EDTA
1.71 grams of sucrose
100 ml of distilled water

76

7.Sodium Acetate Solution(pH 5.2):
10 ml of 3M sodium acetate by
4.1 grams of sodium acetate
10 ml of distilled water
add 1.5 ml acetic acid to adjust
pH to 5.2

8. Ampicillin Stock: dissolving .5 gr of ampicillin
to 25 ml of distilled water, then
sterize by passing through .45
micron sterilizing filter

SourceLcLMaterials:
Sigma Chemical CO.
P.O. Box 14508
St. Louis, MO. 63178-9916

Biochemical Stores Poly(ethyleimenine)#A3143
Biochemistry Building 50 ml/$9.15

Michigan State Univeristy Millex Filters

East Lansing, MI. 48824 #15900 filter .45 m $1.46

#15084 1/16 female Iuer $.21
Modern Biology
P.O. Box 97
Dayton, Indiana
47941-0097

Cements:

This lab is being refined. There are still some problems with the filter
systems of the cheeese cloth and the millex filters. Finding the correct
courseness of material to filter out the debris but not the plasmid is difficult.

References:
Anderson. John N.. A_Laberatcnr_QQurse_in_Mcdem
BLQLng, Purdue Univeristy, 1986.

II'ISI IB'I IGI 'I E III |

Workshop in Molecular Biology, Michigan State Universit
1989 and 1990.

77
Maniatis, T, E..T Fritsch and J. Sambrook, MaleguLaL

CloningLAJabcratcnrMannal Cold Spring Harbor Lab,
Cold Spring Harbor, New York, 1982.

Smith. Richard G.. BeccmhmanLQNAMrkstanen.
Loftstrand Labs Limited, Gaithersburg, Maryland,1989.

Weaver, Bob, “Plasmid Isolation", N.S.F. workshop paper
Michigan State University, 1990.

9112'
593
Diff.
at C
plas
DN;

10 i
isci.
sho
#4.

long
pair
rest
into
con'

 

 

 

 

78

EXPERIMENTIIS WWW
Backcmununtcrmatien:

The DNA molecule is very large. With the use of restriction nuclease
enzymes it can be cut in precise locations. The resultant fragments can be
separated by the use of electrical current through a medium or substrate.
Different molecular weight fragments of DNA will move through an agarose gel
at different rates depending on charge and size of the fragment. The pUC18
plasmid that transformed the bacterium E4911, can be reisolated.The reisolated
DNA from experiment #4 can be visualized by gel electrophoresis.

In this lab, you will be using two different gel elctrophoresis procedures
to isolate DNA fragments. First you will take the pUC18 plasmid that you
isolated in Lab #4 and run a gel against a known pUC18 plasmid to isolate it and
show its presence. Evidence of DNA (plasmid) will indicate your success in lab
#4.

in the second part of the lab, you will use restriction enzymes to cut up a
long strand of DNA called “lambda DNA'. The lambda DNA contains 48,502 base
pairs. The restriction enzymes will cut the DNA at specific sites. The two
restriction enzymes you will use are EcoRI and BamH1. They will cut the DNA
into six fragments. You will run the fragments in a gel against a well that
contains “known size fragments of DNA' to compare the results.

ijacflya: To identify the plasmid(pUCtB) removed in experiment #4 by the use
of gel electrophoresis and to study the effects of the restriction enzymes, EcoR1
and BamH1. on phage lambda DNA and identify the restriction fragments.

Materials:
Electrophoresis Equipment
Agarose
Distilled water
Electrophoresis buffer
Methylene blue stain
Running dye mixture
phage DNA
restriction enzymeszEcoR1 and BamHI
water bath at 37 degrees
ice bath
micropipetes of (5 ul, 10 ul, and 20 ul)
sterile microcentrifuge tubes
Power source of 24 volts to 50 volts

79

Brocadurs:
Part1 - puma Elasmid Isglatign by Elagtmnhgraisis

1.

Make three gels to use in electrophoresis by adding
1.2 grams of agarose to 100 ml of electrophoresis
buffer. Bring to a SLIGHT boil in the microwave( it
takes about 1 minute at high power). Make sure all
the agarose has dissolved.

. Let the agarose sit for two minutes to cool, then

pour into trays with combs placed about 1 inch from
one end. Allow to solidify.

. Once the gel is set, remove the comb and the

tape from the edges of the tray.Place the tray in
the chamber for electrophoresis.

. Cover the gel with electrophoresis buffer until it

just covers the top of the gel.

. Take the sample of possible plasmid from experiment

#4 and mix 60 ul of glycerol with it.

. Load well #1, #3, and #5 with a 20 ul sample.

. Load a 20 ul sample of ”known pUCIB plasmid” in

wells #2 and #4. Load a 20 ul sample of the
running dye in well #6.

. Draw a diagram of the gel with the wells and the

location of the various materials. HINT: cut one
corner of the gel off as a reference point to
finding the correct wells after staining.

. Connect the positive lead of the power source

to the electrode furthest from the wells. DNA is
negatively charged and will migrate toward the
positive charge. Connect the negative lead to the
other electrode.

10.

11.

12.

13.

14.

15.

16.

80

Turn on the power supply and watch for bubbles to
form near the carbon rods. If the power supply is
24 volts it will take about two hours for the gel

to completely separate the fragments or to'run'.
You can watch the progress of the separation by
watching the colors separate from the running dye,
when the first color gets 1 cm from the end of the
gel - turn off the power supply.

After the gel has run, disconnect the power supply,
take the gel out and measure the distances from the
wells, the running dye colors moved in
electrophoresis. Measure in millimeters from the

well to the center of the color band(three color
bands) and record. Draw a picture of the gel

following electrophoresis

Place the gel in a shallow dish and cover the gel
(flood) with 1% methylene blue stain(USE GLOVES)
and let it stain for 15 minutes.

Wearing Gloves, remove the gel from the stain and
rinse in distilled water for two minutes.

Repeat the process four times. The stain can be
saved and reused many times.

After the final rinse, wrap the gel in plastic
wrap and refrigerate for 24 hours to develop
the bands of DNA

NEXT DAY: measure the bands of dark blue stain that
will be found in the lanes next to the wells.

Record the measurements in mm. on the diagram you
made of the running dye distances.

The data from this experiment will be graphed on
semi-log paper to determine the size of each of
the uncut DNA fragments. See teacher for further
help.

81

Part 2: Warn

1. Label four sterile microcentrifuge tubes
#1 - #4. with a waterproof marker.

2. Load each of the tubes with the following:
#1 - 10 ul of predigested DNA,5 ul of glycerol
#2 - 10 ul of EcoR1, 5 ul of glycerol
#3 - 10 ul of EcoR1, 10 ul of BamH1. 8 5 ul of
glycerol
#4 - 10 ul of BamH1. 5 ul of glycerol

3. Add 5 ul of lambda DNA to each tube except #1.
Tap the tubes with your finger to mix.lncubate
the tubes in a 37 degree water bath for 30 minutes.

4. Place one of the gels in the tray of the
electrophoresis chamber and fill with
electrophoresis solution to the top of the gel.

5. Load 15 ul samples into the wells as listed below:

IuhLNumher
1(predigested DNA)

2(EcoR1)

3(EcoR1 8 BamHI)
4(BamH1)

Running Dye(kit)
2(EcoR1)

3(EcoR1 8 BamHI)
4(BamH1)

QVODUIDQNAE

6. Run the gels similarly to Part 1

7. Remove the gels and measure the distances of the
color bands of the running dyes and record. Draw a
picture of the gel and label the wells and draw in
distances of the bands.

8. Stain the gel similar to Part 1,steps 13 8 14

9. Store overnight in the refrigerator

82

10. Measure from the wells the bands on dye found in
ach well lane and record. Graph the data of the
known predigested DNA on semi-log paper and
calculate the sizes of fragments of pieces digested
by EcoR1 and BamH1.

Results:

1. Graph the known fragment of DNA on the semi—log
paper and then the fragments you cut with the two
restriction enzymes to find the number of base pairs

of each of the pieces of DNA.

APPENDIX B

OVERLAYS USED IN UNIT

83

 

Sugar- Sugar-
phOSphate Base phosphate
backbone pairs backbone

 

 

 

 

46 Anne and Camp © 1988 by W.B. Saunders Company

 

Copyrlght O The Benhmln/Cummings Publishi

85

Central dogma of molecular biology (Figure 16.1)

    
 
 

 

   

6:61;; ruplicntiur\
menses \

l 'l’rnnscriplinn /

ITTRN r\ _ ’/

     
  

 
 

  
 
 

Tm “5ch “1 In

 
 

m
‘3’?

Protein

 

    

Copyright t‘ 19117 In lhtt III-manva’unrmmgs Publishing Company, Inc. L’ampbell Barrio“

86

Transcription and translation of a DNA sequence
Figure 16.15

or

3. Transcribed strand\

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

"TA£TTCAAACEGATC"
DNA A AA“ r Ad
v VVV 9M
__ATCAACI;TTGGCTAG__

'5"; 37"

 

 

l Transcription

mRNA wmflWMHflflflmflr

 

 

 

5'

 

T 1 ti Termination
fans a 0n COdOt‘t

HzN Met ® @ A COOH
Protein

Codon

Coowfeht 0 “I Benhmin ICumrnfnn Pnhlkhim runes-av Irv-

r - '
cub-on so reproduce ems page be granted to users of MOOIHN BIOLOGY. Hon. linen." and Winston, Publishers.

87
PROTEIN SYNTHESIS

m Transcription:

DNA

 

m-RNA: after
transcription goes
to ribosoma

/ for translation.

 

   

ribosome subunits
contain r-RNA

 
   

 

 

 

 

start
k m-RNA
m-RNA
E \ ”It! an
HR x" "K
u A c A c c G G
A u o u G G c c c u A A
g . m-RNA

 

k J

 

 

 

 

88

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

lntrons in a eukaryotic gene
Figure 16.17
Exon Intron Exon Intron f Exon f
DNA 1 l L l I I J
l‘l‘ranscription
RNA‘ 1 l l l l I l
Codons: 1 30 31 104 105 146
lntrons excised
l J l
1 30 31 104 105 146
I Exons spliced together
mRNA [J
Codons: 1 .146

 

§

Copyright 0 The Benjamin] Cummings Publishing Company, inc.

2.8.50 8858 .35 B 82 o

9.082 mu 6289.:
55 823328 9t
8306 new 3.sz 05 9
9.5 ZBmEoEE SESoDE
.94sz 9.6.605 60.80
m5 5 mecca one Bremen:
new .EOEOE m5 9 0:3
26: emu 9.65828 42m
.6580 9: EC: : 99......
new .0883. 05 9
EB 8386:. .839:

.898. .o 8885 9: c_ .3

.BOEOE m5 9 35:5
E0: www.mEZOa <Zm
3555 new .9880

m5 9 8:3 589%. m

.3969 96 8:33 9: c. 3.

89

830989: 3.082 E

mmE>~cm or: +0 2.032605
20...:8 35 Beam .0

8.628 m 60.80 on. of. :3

2832.2 8

$25828

 
       

C
SESODE
’ «.sz

$88.28 42m . AvIIIIIIAV

meEoo .83nc_-.0n8.am. 9:85

5905 586.com

mmmBEZOa Jim.

3882 3:289: 35 $E>~cm or: .8 2.8.
Scam 5.382%

P

<20

2.805 .8859 .0. at... 9.623 .2880

83.3.28 <21 .9 arm 9.558 .oHOEok.

8.820;. .839:

 

 

90
Two types of negative control (Figure 17.2)

Example: trp operon — encodes enzymes for tryptophan synthesis

 

 

Active repressor

1...... OI. /

repressor
Compressor CO <——CC]+—(:]<—C:l<-C:l+l:l
\ J

Tryptophan precursors

 

Example: lac Operon -— encodes enzymes for lactose breakdown

 

Inactive repressor / O / G 9

lnducer Lactose
O breakdown
products

meriohl a 10117 In: m Minminlf‘ummlnon pllHic'riiui (‘nmnamr Inc. Campbell: Biolorv

Cloning of a gene

  

AmpI Tet“

Restriction
sites

(Methcias box, p. 401)

 

estriction enzyme

N

V Sticky ends

Base pairing
d

  
  
 

an
DNA ligase
Recombinant plasmid

/
/

/ Transformation

Bacterial reproduction

Bacterial clone carrying many copies of the foreign gene

The plasmid is isolated from E. coli,
and "foreign” DNA is isolated from
other cells.

A restriction enzyme opens the
plasmid at a known cleavage site,
disrupting the Tet" gene. The same
enzyme is used to cut up the for-
eign DNA.

The sticky ends of the plasmid
hydrogen-bond with the sticky ends
of a restriction fragment from the
foreign DNA. The two DNA mole-
cules are joined covalently by DNA
ligase.

The result is recombinant DNA, an
E. 0011' plasmid carrying DNA from
another source.

The recombinant plasmid is intro-
duced into a bacterial cell by trans-
formation. As the bacterium repro-
duces, so does the recombinant
plasmid. The final result is a bacte-
rial clone (colony) in which the for-
eign gene has been cloned. Colonies
carrying recombinant plasmids can
be identified by the fact that their
cells are ampicillin-resistant (since
they carry the Amp“ gene) but tetra-
cycline-sensitive (since the Tbt" gene
has been inactivated by the insertion
of foreign DNA). Thus, the cells will
grow on media containing ampicil-
lin but not on media with tetracy-
cline. More sophisticated methods
must be used to identify the recom-
binant clones carrying the particular
gene of interest, as discussed in the
text.

CODVI'iQhI 0 "2517 IN The! Raniamin/(‘umminae Puhliehino ('mnnanv Inr Camnholl- Rinlow

APPENDIX C

OUTLINE FOR MOLECULAR BIOLOGY UNIT

TEXTBOOK:

Chapter 9:

II.

III.

92

OUTLINE FOR THE MOLECULAR BIOLOGY UNIT

BIQLQXEX; JQURNEX INILQ LIFE
by Arms and Camp (1990)

DNA and Genetic Informafign

Terminology: DNA - Chromosomes - genes - replication - proteins -
DNA polymerase - amino acids - polymers - nucleotides

DNA Evidence as Genetic Material:
A. Bacterial Transformation: Griffith(1928) virulent vs
nonvirulent
B. Bacteriophages(phages):Hershey/ Margarent Chase (1952)

Structure of DNA:
A. Four experimental findings of the 1950’s
B. Franklin’s work

C. Watson and Crick work

EXPERIMENI: 11 DNA ISOLATION

IV.

EP

V.

VI.

DNA Replication:
A. Template Hypothesis
B. DNA polymerase
C. Prokaryotes vs eukaryotes

ME PR F

DNA Repair
A. Repair genes
B. Mutations: mutagens-types and effects

Structure of Eukaryotic Chromosomes

Properties of Chromatin

Chromosomal Proteins: jistones

Nucleosomes (drawings)

Genomes - Research

Jumping Genes: McClintock’s work(1940) transposable
elements

P157095?

Chapter 10:

I.

II.

III.

IV.

VI.

93

RNA 3!; Protein Synmesis

Terminology: RNA - gene expression - structural genes - proteins -
mRN A - tRNA - ATP - transcription - translation - operon
gene

Overview of Protein Synthesis: {gum
transcription translation

DNA mRN A protein
Genetic Code:
A. four nucleotides: three letter ”words” (codons) 64 different
codes
B. Punctuation: effects on proteins
C. Codons: full stop/ nonsense oodons, degeneration frameshift
mutations.

Transcription of DNA into RNA:
A. RNA polymerase - termination sign - M-RNA role
B. Introns - intervening sequence
C. T-RN A role: aminoacyl attachment site; anticodon

Protein Synthesis:
A. Initialization: polypeptide chain formation (translocation),

termination

Control of Protein Synthesis: eukaryotic vs prokaryotic

cells; overview of the ”Operon Theory” of Jacob/Monad

Operon Theory: structural genes, prometer, regulatory,

repressor, inducers

HANDOUT: ”Operon Theory”

Control in Eukaryotes: change in chromosomes, giant

chromosomes, regulators

£119.09"

Control of Gene Activity: differentiation, metamorphosis, and
regeneration.

94

Chapter 11: New Geneties: Meleeela; Teehnelegy

I. Terminology: molecular biology, genetic engineering, hybrid, and
hybridization

DRY LAB; PLASMID LAB (models of plasmid cloning)

H. Bacterial Restriction enzymes
A. Techniques of Amplify
IV. Cloning of DNA
A. clone - vector(plasmid)
B. technique in bacteria/ yeast restriction enzymes - sticky ends
typical recombinant DNA experiment

EXPERIM 4 I LATI F PLA MID D

V. Sequencing DNA
A. Electrophoresis - procedure
B. Human Geome Project

E EL ELE TR P I
VI. Application of Genetic Technology
A. Recombinant DNA: insulin, interferons, feline vaccine
B. Reverse Genetics: identifying defective proteins such as
MS, Huntington’s Disease, cystic fibrosis, Alzheimer’s
Disease
C. Gene Transplants: improve crops disease resistance and

nitrogen fixing ability; implant cell on the
zygote(totipotent), and nuclear transplant of germ cells

D. Cancer:
Tumors-malignant(metastasize)
Causes-mutagen
Activation-onocogenes:translocation, retroviruses, AIDS,
latent period

E. Safety of Genetic Engineering

APPENDIX D

PRETEST & POST TEST

95

 

 

PRETEST ON GENETIC INFORMATION FORM: #201
INSTRUCTOR: DATE:
CLASS: STUDENT NAME:

 

 

DIRECTIONS: FOR EACH QUESTION, CIRCLE THE BEST ANSWER.

1) If the base pairing rules, i.e., A=T, G=C, are followed, then in a double helix
of DNA

A. A=G, C=T. B. A + T/G + C = 1.

C. A+T=G+C. D. A+G=C+T.

2) bonds join the two strands of DNA together to form the double helix.
A. Hydrogen B. Covalent C. Ionic D. Polar Covalent

3) Consider the DNA sequence: -C C G A T G -. The complementary strand
made after replication is

 

A. -CCGATG-. B. -GGCTAC-.

C. -TTAGCA-. D. -TTAGCA-.

4) Translation is the process in which is synthesized from

A. DNA, RNA B. mRNA, the nucleolus

C. a polypeptide, mRNA D. tRNA, DNA

5) DNA contains sugar and while RNA contains sugar and _
A. ribose, uracil, deoxyribose, adenine

B. deoxyribose, adenine, ribose, thymine

C. ribose, quanine, riboose, quanine

D. deoxyribose, thymine, ribose, uracil

PCP?

POP? d

W
v

.0?

\O
v

0?

10)

96
The terrrrination of protein synthesis normally occurs
when the cell runs out of ATP
upon recognition of a stop codon.
upon recognition of an exon
when more than 10 ribosomes attach to the mRNA.
The operator of an operon
encodes information for the repressor protein.
is the binding site for the inducer.
is the binding site for the repressor.
controls only one structural gene.
The enzyme which joins two pieces of DNA together is called
restriction endonclease. B. ligase.
polymerase. D. Reverse transcriptase.
Cancer cells are characterized by
immortality. B. lack of contact inhibition.

uncontrolled growth. D. all of the above.

DNA can be introduced into the host cell by

A. viruses. B. plasmids. C. mutagens. D. a and b are correct.

11)

Thirty percent of the bases in DNA extracted from prokaryotic cells is adenine.

What percentage of cytosine is present in this DNA?

A.

B. 20 C. 30 D. 40

97

12) An actively dividing culture of E. COLI is grown in a medium containing
radioactive thymine (*1). After all the thymine in the DNA is labeled the culture is
transferred to a medium containing nonradioactive thymine (T). Samples are removed
after one round of DNA replication. Which of the following sequences represents the
DNA after one round of replication in the medium containing nonradioactive T?

A. *T*TAAG*TA
TTCAT

B *TTAAG’I‘A
AA*T*TCAT

C. *T*TAAG*TA
AA*T*TCA*T

D TTAAGTA
AATTCAT

13) Which part(s) of the nucleotide is(are) essential for forming the structural
backbone of the DNA molecule?

the base

the phosphate group

the base and the sugar

the phosphate group and the sugar

POP?

14) Consider the following double helix of DNA: A T C C G G G A
T A G G C G G T
Which of the following sequences represents a mutation of the original sequence?

A ATCCGCCA
TACGCGGA
B ATCGCCCA
TAGCGGGT
C TAGGCGGT
ATCCGGCA
D alloftheabove

15) Which of the following sequences represents the hierarchial organization of genetic
information?

gene - nucleotide - DNA - chromosome - genome
nucleotide - DNA - gene - chromosome - genome
genome - DNA - chromosome - gene - nucleotide
chromosome - gene - DNA - genome - nucleotide

POP?

98

16) Consider the following sequence of DNA: -C C G T A T G C T G C C-.
The mRNA synthesized from this DNA is

A.-CCGTATGCTGCC- B.-CCGAUAGCACGG-
C.-GGCAUACGACGG- D.-GGCATACGACGG-

l7) Liver cells and brain cells isolated from the same mouse have identical quantities
of DNA, but different amounts and types of mRNA’s. On the basis of the above
information, one might hypothesize that differentiation results from

A. the loss of chromosomes or genes.

B. differential gene activity.

C. the duplication of genes responsible for the differentiated state.
D. all of the above.

18) Consider the DNA sequence: -T A C G C C G A G C G C A C T-. The codons
for select amino acids are:

codon amino acid codon amino acid codon amino acid
GCG alanine (ala) GGC glycine (gly) CGG arginine (arg)
AGU serine (ser) AUG methionine (met) CUC leucine (leu)

CGU arginine (arg) UGC cysteine (cys) GUA valine (val)
UCG serine (ser)

Which of the following sequences of amino acids would be encoded in the given DNA
sequence?

A. met-arg- leu-ala B. met-cys- gly- ser
C.ser-ala-1eu-gly-val D.ala-gly-ser—arg-val

19) In order for two DNA molecules to form a recombinant DNA, they must

A. be from the same organism.

B. be the same length.

C. have complementary sticky ends.
D. all of the above.

99

20) EcoR1, a restriction enzyme, recognizes the sequence GAATTC.
C'ITAAG
Into how many fragments will EcoR1 cut the double helix of DNA presented below?

DNAHELIX: CCGATTCCGCTCGGAATTCGATT
GGCTAAGGCGAGCCTTAAGCTAA

A. 0 fragments B. 1 fragment C. 2 fragments D. 3 fragments

21) Recombinant DNA technology is possible because of

A. specific base pairing rules.
B. the universality of the genetic code.

C. restriction endonuclease.
D. all of the above.

DIRECTIONS: FOR EACH QUESTION, CIRCLE THE ONE BEST ANSWER.

22) TRUE or FALSE --- In DNA, the sugar and phosphate groups are covalent bonded

together while the bases of the two strands are held by hydrogen bonds.

23) TRUE or FALSE --- All the DNA in eukaryotic cells contains information for
making proteins.

24) TRUE or FALSE --- Griffith demonstrated the phenomenon of bacterial
transformation.

25) TRUE or FALSE --- Introns contain the information for making a poly peptide.

26) TRUE or FALSE --- The genetic code is degenerate, almost universal, and lacks

punctuation.

27) TRUE or FALSE --- Only DNA from the same or similar organisms can be

combined to form a hybrid molecule.
28) TRUE or FALSE --- Restriction enzymes randomly cut DNA molecules.

29) TRUE or FALSE --- An oncogene functions in normal growth and embryogenesis,
but has the potential to cause cancer.

30) TRUE or FALSE --- Metastasis is a characteristic of malignant cells.

100

DIRECTIONS: FOR EACH QUESTION, WRITE YOUR ANSWER ON THE LINE
PROVIDED.

31) Which of the following scientists (Watson and Crick, Franklin, McClintock,
Griffith, Chargaff) matches with his/her discovery or contribution to genetics: discovered
jumping genes.

 

32) Which of the following scientists (Watson and Crick, Franklin, McClintok,
Griffith, Chargaff) matches with his/ her discovery or contribution to genetics: determined
the helical structure of DNA.

 

33) Which of the following scientists (Watson and Crick, Franklin, McClintok,
Griffith, Chargaff) matches with his/her discovery or contribution to genetics: discovered
thattheamountofA = TandG = CinDNA.

 

34) Which of the following scientists (Watson and Crick, Franklin, McClintok,
Griffith, Chargaff) matches with his/ her discovery or contribution to genetics: provided
evidence from X-ray diffraction for the periodicity in DNA.

 

35) Which of the following scientists (Watson and Crick, Franklin, McClintok,
Griffith, Chargaff) matches with his/her discovery or contribution to genetics:
demonstrated bacterial transformation.

 

36) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: movement of ribosome along mRNA.

 

37) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: synthesis of RNA from DNA.

 

38) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: synthesis of DNA from DNA.

 

39)Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: attachment of amino acid to tRN A.

 

101

40) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: conversion of language of nucleotides to language
of amino acids.

 

41) Which of the following terms (vector, zygote, oncogene, clone, plasmid) matches
the definition: group of genetically identical organisms or cells.

 

42) Which of the following terms (vector, zygote, oncogene, clone, plasmid) matches
the definition: group of genetically identical organisms or cells.

 

43) Which of the following terms (vector, zygote, oncogene, clone, plasmid) matches
the definition: fertilized egg.

 

44) Which of the following terms (vector, zygote, oncogene, clone, plasmid) matches
the definition: small circular DNA molecule in bacterial cell.

 

45) Which of the following terms (vector, zygote, oncogene, clone, plasmid) matches
the definition: carrier of DNA.

 

102
ANSWER KEY FOR: PRETEST ON GENETIC INFORMATION FORM:#201

INSTRUCTOR: DATE:

 

CLASS:

 

If you are using alternate forms, be sure that the form # on this answer key matches the
student’s answer sheet form #.

1)--c--
2)A----
3)-B---
4)--c--
5)---D-
6)-B--—
7)--C--
8)-B---
9)---D-
10)---D-
11)-B---
12)A----
l3)---D-
14)---D-
15)-B---
l6)A----
17)-B---
l8)A----
1m--C--
20)—B---
21)-no-
22)T-
23)-r=
24)'r-
25)-F
26)T-
2D-F
2&-F
29)T-
30)r-

103
MATCHING (SHORT-ANSWER) QUESTIONS:

31) McClintock 39) acylation
32) Watson and Crick 40) translation
33) Chargaff 41) oncogenes
34) Franklin 42) clone

35) Griffith 43) zygote
36) translocation 44) plasmid
37) transcription 45) vector

38) replication

104

 

A.P.BIOLOGY CH.9-11 FORM: #201
INSTRUCTOR: DATE:
CLASS: STUDENT NAME:

 

 

DIRECTIONS: FOR EACH QUESTION, CIRCLE THE BEST ANSWER.

1) If the base pairing rules, i.e., A=T, G=C, are followed, then in a double helix
of DNA

A. A=G, =T B. A + T/G + C = 1

C. A+T=G+C D. A+G=C+T

2) bonds join the two strands of DNA together to form the double helix.
A. Hydrogen B. Covalent C. Ionic D. Polar Covalent

3) Consider the DNA sequence: -C C G A T G -. The complementary strand
made after replication is

A. -CCGATG-. B. -GGCTAC-.
C. ~TTAGCA-. D. -TTAGCA-.

4) Translation is the process in which is synthesized from

 

A. DNA, RNA B. mRNA, the nucleolus

C. a polypeptide, mRNA D. tRNA, DNA

5) DNA contains sugar and while RNA contains sugar and _.
A. ribose, uracil, deoxyribose, adenine

B. deoxyribose, adenine, ribose, thymine

C. ribose, quanine, riboose, quanine

D. deoxyribose, thymine, ribose, uracil

6) The termination of protein synthesis normally occurs

A. when the cell runs out of ATP

B. upon recognition of a stop codon.

C. upon recognition of an exon

D. when more than 10 ribosomes attach to the mRNA.

7) The operator of an operon

A. encodes information for the repressor protein.

B. is the binding site for the inducer.

C. is the binding site for the repressor.

D. controls only one structural gene.

8) The enzyme which joins two pieces of DNA together is called

A. restriction endonclease. B. ligase.

C. polymerase. D. Reverse transcriptase.
9) Cancer cells are characterized by

A. immortality. B. lack of contact inhibition.

C. uncontrolled growth. D. all of the above.

10) DNA can be introduced into the host cell by

A. viruses. B. plasmids. C. mutagens. D. a and b are correct.
11) Thirty percent of the bases in DNA extracted from prokaryotic cells is adenine.

105

What percentage of cytosine is present in this DNA?

A.

B. 20 C. 30 D. 40

106

12) An actively dividing culture of E. COLI is grown in a medium containing
radioactive thymine (*T). After all the thymine in the DNA is labeled the culture is
transferred to a medium containing nonradioactive thymine (T). Samples are removed
after one round of DNA replication. Which of the following sequences represents the
DNA after one round of replication in the medium containing nonradioactive T?

A. *T*TAAG*TA

AATTCAT
B. *TTAAG*TA
AA*T*TCAT
C. *T*TAAG*TA
AA*T*TCA*T
D. TTAAGTA
AATTCAT

13) Which part(s) of the nucleotide is(are) essential for forming the structural
backbone of the DNA molecule?

the base

the phosphate group

the base and the sugar

the phosphate group and the sugar

P05”?

14) Consider the following double helix of DNA: A T C C G G G A
T A G G C G G T
Which of the following sequences represents a mutation of the original sequence?

A. ATCCGCCA
TACGCGGA
B. ATCGCCCA
TAGCGGGT
C. TAGGCGGT
ATCCGGCA
D. alloftheabove

15) Which of the following sequences represents the hierarchial organization of genetic
information?

A. gene - nucleotide - DNA - chromosome - genome
B nucleotide - DNA - gene - chromosome - genome
C. genome - DNA - chromosome - gene - nucleotide
D chromosome - gene - DNA - genome - nucleotide

107

16) Consider the following sequence of DNA: -C C G T A T G C T G C C-.
The mRNA synthesized from this DNA is

A.-CCGTATGCTGCC- B.-CCGAUAGCACGG-
C.-GGCAUACGACGG- D.-GGCATACGACGG-

l7) Liver cells and brain cells isolated from the same mouse have identical quantities
of DNA, but different amounts and types of mRNA’s. On the basis of the above
information, one might hypothesize that differentiation results from

the loss of chromosomes or genes.

differential gene activity.

the duplication of genes responsible for the differentiated state.
all of the above.

POP?

18) Consider the DNA sequence: -T A C G C C G A G C G C A C T—. The codons
for select amino acids are:

codon amino acid codon anrino acid codon amino acid
GCG alanine (ala) GGC glycine (gly) CGG arginine (arg)
AGU serine (ser) AUG methionine (met) CUC leucine (leu)

CGU arginine (arg) UGC cysteine (cys) GUA valine (val)
UCG serine (ser)

Which of the following sequences of amino acids would be encoded in the given DNA
sequence?

A. met-arg-leu-ala B. met-cys-gly-ser
C. ser-ala-leu-gly-val D.a1a-gly-ser-arg-val

19) In order for two DNA molecules to form a recombinant DNA, they must

A. be from the same organism.

B. be the same length.

C. have complementary sticky ends.
D. all of the above.

108

20) EcoR1, a restriction enzyme, recognizes the sequence GAATTC.
C'l'l‘AAG

Into how many fragments will EcoR1 cut the double helix of DNA presented below?

DNAHELIX: CCGATTCCGCTCGGAATTCGATT
GGCTAAGGCGAGCCTTAAGCTAA

A. 0 fragments B. 1 fragment C. 2 fragments D. 3 fragments

21) Recombinant DNA technology is possible because of

A. specific base pairing rules.
B. the universality of the genetic code.

C. restriction endonuclease.
D. all of the above.

DIRECTIONS: FOR EACH QUESTION, CIRCLE THE ONE BEST ANSWER.

22) TRUE or FALSE --- In DNA, the sugar and phosphate groups are covalent bonded
together while the bases of the two strands are held by hydrogen bonds.

23) TRUE or FALSE --- All the DNA in eukaryotic cells contains information for
making proteins.

24) TRUE or FALSE --- Griffith demonstrated the phenomenon of bacterial
transformation.

25) TRUE or FALSE --- Introns contain the information for making a poly peptide.

26) TRUE or FALSE --- The genetic code is degenerate, almost universal, and lacks
punctuation.

27) TRUE or FALSE --- Only DNA from the same or similar organisms can be
combined to form a hybrid molecule.

28) TRUE or FALSE --- Restriction enzymes randomly cut DNA molecules.

29) TRUE or FALSE --- An oncogene functions in normal growth and embryogenesis,
but has the potential to cause cancer.

30) TRUE or FALSE --- Metastasis is a characteristic of malignant cells.

109

DIRECTIONS: FOR EACH QUESTION, WRITE YOUR ANSWER ON THE LINE
PROVIDED.

31) Which of the following scientists (Watson and Crick, Franklin, McClintock,
Griffith, Chargaff) matches with his/ her discovery or contribution to genetics: discovered
jumping genes.

 

32) Which of the following scientists (Watson and Crick, Franklin, McClintok,
Griffith, Chargaff) matches with his/ her discovery or contribution to genetics: determined
the helical structure of DNA.

 

33) Which of the following scientists (Watson and Crick, Franklin, McClintok,
Griffith, Chargaff) matches with his/her discovery or contribution to genetics: discovered
that the amount ofA = T and G = C in DNA.

 

34) Which of the following scientists (Watson and Crick, Franklin, McClintok,
Griffith, Chargaff) matches with his/her discovery or contribution to genetics: provided
evidence from X-ray diffraction for the periodicity in DNA.

 

35) Which of the following scientists (Watson and Crick, Franklin, McClintok,
Griffith, Chargaff) matches with his/her discovery or contribution to genetics:
demonstrated bacterial transformation.

 

36) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: movement of ribosome along mRNA.

 

37) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: synthesis of RNA from DNA.

 

38) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: synthesis of DNA from DNA.

 

39) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: attachment of amino acid to tRNA.

 

110

40) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: conversion of language of nucleotides to language
of amino acids.

 

41) Which of the following terms (vector, zygote, oncogene, clone, plasmid) matches
the definition: group of genetically identical organisms or cells.

 

42) Which of the following terms (vector, zygote, oncogene, clone, plasmid) matches
the definition: group of genetically identical organisms or cells.

 

43) Which of the following terms (vector, zygote, oncogene, clone, plasmid) matches
the definition: fertilized egg.

 

44) Which of the following terms (vector, zygote, oncogene, clone, plasmid) matches
the definition: small circular DNA molecule in bacterial cell.

 

45) Which of the following terms (vector, zygote, oncogene, clone, plasmid) matches
the definition: carrier of DNA.

 

111

 

 

ANSWER KEY FOR: A.P.BIOLOGY CH.9-11 FORM:#201
INSTRUCTOR: DATE:
CLASS:

 

If you are using alternate forms, be sure that the form # on this answer key matches the
student’s answer sheet form #.

1)--C--

7)--C--

8)-B---
9)---D-
lO)---D-
u)-B---
12)A----
13)---D-
14)---D-
15)-B---
16)A----
lD-B---
18)A----
19)--c--
20)-B---
21)---D-
22)T-
23)-F
24)T-
25)-F
26)T-
zn-F
2&-F
29)T-
30)T-

1 12
MATCHING (SHORT-ANSWER) QUESTIONS:

31) McClintock 39) acylation
32) Watson and Crick 40) translation
33) Chargaff 41) oncogenes
34) Franklin 42) clone

35) Griffith 43) zygote
36) translocation 44) plasmid
37) transcription 45) vector

38) replication

APPENDIX E

F ELTBOARD DEMONSTRATION

113

F ELTBOARD DEMONSTRATION

I do not have the felt board presentation in a form that can be put down on paper.
It consists of a white piece of felt approximately 3’ by 3’ on a stiff piece of cardboard.
I cutout models of the parts needed to show transcription and translocation from colored
felt, to indicate DNA, T-RNA, and M-RNA. The felt DNA shows two triplets and their
nucleotides.

With different colored felt I made two small amino acid molecules and a large
ribosomes model. By the cuts made on the T-RNA, they would only properly fit one
type of amino acid. The T-RNA’s also were matched to bind with one specific M-RNA
codon.

With these simple moveable pieces of felt, it was possible to show both
transcription and translocation. It was also possible to discuss the effects of slight
changes in the DNA or M-RNA and how that might effect the protein product.

The felt board demonstration is simple, colorful, and effective way to review the
concepts of protein synthesis with the students. They seem to enjoy the different type of
approach I use here.

APPENDIX F

HANDOUTS USED IN THE UNIT

 

 

 

 

 

 

 

 

 

 

 

APPENDIX G

UNIT TESTS

115

A.P. BIOLOGY CHAPTER 9&10 FORM:#201 .
INSTRUCTOR: DATE:

CLASS: STUDENT NAME:

 

DIRECTIONS: FOR EACH QUESTION, CIRCLE THE ONE BEST ANSWER.

1) If the base pairing rules, i.e., A=T, G=C, are followed, then in double helix of
DNA

A. A=G, C+T. B. A +
C.A+T=G+C. D.A+G
2) Chargraff determined that

A. a gamete has half the DNA that is present in a liver cell from the same organism.
B. A = T and G = C

C. DNA is the genetic material.
D. DNA isolated from virulent bacteria could transform cells.

3) The enzyme responsible for DNA replication and proofreading is DNA

 

A. replicase. B. polymerase. C. synthetase. D. ligase.

4) bonds that join the two strands of DNA together to form the double
helix.

A. Hydrogen B. Covalent C. Ionic D. Polar covalent

5) This scientist’s X-ray diffraction studies of DNA crystals provided important
information regarding the structure of DNA. Who was the scientist?

A. Crick B. McClintok C. Franklin D. Hershey

116
6) All of the following are features of DNA isolated from eukaryotic cells except

A. organization into circular chromosomes.
B. association with histones.

C. organization into nucleosomes.

D. capability of mutation.

7) Mutations

A. cannot be passed to an organism’s offspring.
B. always cause detrimental effects.

C. provide the raw material for evolution.

D. always result in deletions of nucleotides.

8) Consider the DNA sequence: - C C G A T G-. The complementary strand made
after replication is

A.-CCGATG-. B.-GGCTAC-.
C.-TTAGCA-. D.-TTAGCA-.

9) Which of the following events occurs first in the replication of DNA?

A. breaking of covalent binds between the nitrogenous bases

B. unwinding of the helix

C. breaking of the hydrogen bonds between the sugar and phosphate

D. addition of complementary nucleotides to one end of the DNA strand

10) Translation is the process in which is synthesized from

 

A. DNA, RNA B. mRNA, the nucleolus
C. a polypeptide, mRNA D. tRNA, DNA

11) For each amino acid there

A. is only one codon and tRNA.

B. can be more than one codon and tRNA.
C. are two codons, but only one tRNA.

D. are two tRNA molecules, but one codon.

117

12) In the process of acylation a(n) is attached to a(n) at its_

 

site.
A. tRNA, mRNA, peptidyl B. amino acid, tRNA, anticodon
C. codon, anticodon, aminoacyl D. amino acid, tRN A, aminoacyl
13) DNA contains sugar and while RNA contains sugar and

 

 

A. ribose, uracil, deoxyribose, adenine
B. deoxyribose, adrine, ribose, thymine
C. ribose, guanine, ribose, quanine

D. deoxyribose, thymine, ribose, uracil

14) The termination of protein synthesis normally occurs

A. when the cell runs out of ATP.

B. upon recognition of stop codon.

C. upon recognition of an exon.

D. when more than 10 ribosomes attach to the mRNA.

15) All of the following are directly required for protein synthesis except

A. GTP. B. ribosomes. C. tRNA. D. DNA.

16) All of the following are associated with increased transcription except

A. formation of lampbrush chromosomes.
B. binding of activator regulatory protein to the operator.
D. puffing of polytene chromosomes.

17) The operator of an operon

A. encodes information for the repressor protein.
B. is the binding site for the inducer.

C. is the binding site for the repressor.

D. controls only one structural gene.

118

18) Which of the following statements about genetic regulatory mechanisms is
eukaryotic cells is true?

A. Genes are organized into operons whose activity is controlled by regulatory proteins.
B. Gene regulation occurs primarily at the level of translation.

C. Gene activation involves a change in the structure of the chromosome.

D. Histones play no role in the control of gene activity.

19) When a cell becomes differentiated,

A. gene no longer needed are lost.

B. genes responsible for the differentiated state are duplicated.
C. certain genes become inactivated.

D. all the chromatin becomes decondensed.

20) Thirty percent of the bases in DNA extracted from prokaryotic cells is adenine.
What percentage of cytosine is present in this DNA?

A. 10 B. 20 C. 30 D. 40

21) For a double helix of DNA, which of the following statements is true?

A.A=G,C=T B.A=C,G=T C.A+T=G+C D.A=T,G=C

22) An actively dividing culture of E. COLI is grown in a medium containing
radioactive thymine (‘1‘). After all the thymine in the DNA is labeled the culture is
transferred to a medium containing nonradioactive thymine (T). Samples are removed
after one round of DNA replication. Which of the following sequences represents the
DNA after one round of replication in the medium containing nonradioactive T?

A.*T"‘T A A G*T A
A AT T C AT
B. *T T A A G*T A
AA*T"'TC AT
C. *T*T A A G*T A
A A*T*TC A*T
D. T T A A G T A
A AT T C AT

119

23) Which part(s) of a nucleotide is(are) essential for forming the structural backbone
of the DNA molecule?

A. the base

B. the phosphate group

C. the base and the sugar

D. the phosphate group and the sugar

24) Which of the following criteria could you use to distinguish a prokaryotic from
a eukaryotic chromosome?

A. shape B. presence of protein
C. method of replication D. all of the above

25) Consider the following double helix of DNA: A T C C G G G A
T A G G C G G T.
Which of the following sequences represents a mutation of the original sequence?

A. ATCCGCCA
TACGCGGA
B ATCGCCCA
TAGCGGGT
C. TAGGCGGT
ATCCGGCA
D alloftheabove

26) Which of the following sequences represents the hierarchial organization of the
genetic information?

A. gene - nucleotide - DNA - chromosome - genome
B. nucleotide - DNA - gene - chromosome - genome
C. genome - DNA - chromosome - gene - nucleotide
D. chromosome - gene - DNA - genome - nucleotide

27) A strand of DNA has the sequence: A C *G C C T C A A G. The nucleotide
marked by the (*) is mutated to a C. Which of the following sequences represents a
DNA replicated from the mutated strand?

A.ACCCCTCAAG B.TGGGGAGTTC
C.TGCGGAGTTC D.GTATTCTGGA

120

28) What is the minimum number of tRN A molecules required to produce a
polypeptide containing 50 amino acids but only 15 different kinds of amino acids?

A. 15 B. 20 C. 35 D. 50

29) Consider the following sequence of DNA: -C C G T A T G C T G C C -. The
mRNA synthesized form this DNA is

A.-CCGTATGCTGCC- B.-CCGAUAGCACGG-
C.-GGCAUACGACGG- D.-GGCATACGACGG-

30) The type of bond between the anticodon and the codon, or between the codon and
its triplet is a

A. hydrogen bond. B. covalent bond.
C. peptide bond. D. ionic bond.

31) Liver cells and brain cells isolated from the same mouse have identical quantities
of DNA, but different amounts and types of mRNA’s. On the basis of the above
information, one might hypothesize that differentiation results from

A. the loss of chromosomes or genes.

B. differential gene activity.

C. the duplication of the genes responsible for the differentiated state.
D. all of the above.

32) Bacterial cells are grown for two hours in a medium containing lactose as the sole
source of sugar, and then transferred into a medium with glucose as the sole source of
carbohydrate. Which of the following most likely occurs after the cells are transferred
to the glucose medium?

A. The structural genes in the lac operon continue to be transcribed.

B. A repressor protein binds to the prometer of the lac operon.

C. RNA polymerase no longer binds to the prometer of the lac operon.
D. The repressor protein inactivates RNA polymerase by binding to it.

121

33) ConsidertheDNA sequence: -TA C GC C GA G C GC A C T -. Thecodons
for select amino acids are:

codon amino acid codon amino acid codon amino acid
GCG alanine (ala) GGC glycine (gly) CGG arginine (arg)
AGU serine (ser) AUG methionine (met) CUC leucine (leu)
CGU arginine (arg) UGC cysteine (cys) GUA valine (val)

Which of the following sequences of amino acids would be encoded in the given DNA
sequence?

A.met-arg-leu-ala B.met—cys-gly-ser
C.ser-ala-leu-gly-val D.ala-gly-ser-srg-val

DIRECTIONS: FOR EACH QUESTION, CIRCLE THE ONE BEST ANSWER.

34) TRUE or FALSE --- Immediately after replication a cell has four times the
amount of DNA found in a gamete from the same organism.

35) TRUE or FALSE --- The DNA from all organisms has the same amount of
guanine and adenine.

36) TRUE or FALSE --- DNA replication represents a series of exergonic reactions.

37) TRUE or FALSE --- In DNA, the sugar and phosphate groups are covalently
bonded together while the bases of the two strands are held by hydrogen bonds.

38) TRUE or FALSE --- DNA polymerase’s sole function is to proofread and repair
damage caused by mutagens.

39) TRUE or FALSE --- All the DNA in eukaryotic cells contains information for
making proteins.

40) TRUE or FALSE --- Griffith demonstrated the phenomenon of bacterial
transformation.

41) TRUE or FALSE --- Chromatin contains roughly equal amounts of DNA and
histone and nonhistone proteins.

42) TRUE or FALSE --- Jumping genes are found only in prokayotes.

43) TRUE or FALSE --- In RNA the Ratio of the purine, adenine, to the pyrimidine,
thymine is 1.

122
44) TRUE or FALSE --- Introns contain the information for making a polypeptide.

45) TRUE or FALSE --- The genetic code is degenerate, almost universal, and lacks
punctuation.

46) TRUE or FALSE --- Eukaryotic mRNA molecules that are translated always
contain the same number of nucleotides as the DNA from which they were transcribed.

47) TRUE or FALSE --- In translation the anticodon are covalently bonded together.

48) TRUE or FALSE --- A cell actively involved in protein synthesis would have very
few ribosomes compared to one not engaged in protein synthesis.

49) TRUE or FALSE --- Uncoiled or decondensed chromatin is a sign of gene
activity.

50) TRUE or FALSE --- In eukaryotes mRNA is translated as soon as it is
transcribed.

DIRECTIONS: FOR EACH QUESTION, WRITE YOUR ANSWER ON THE LINE
PROVIDED.

51) Which of the following scientists (Watson and Crick, Franklin, McClintock,
Griffith, Chargaff) matches with his/her discovery or contribution to genetics:
discovering jumping genes.

 

52) Which of the following scientists (Watson and Crick, Franklin, McClintock,
Griffith, Chargaff) matches with his/her discovery or contribution to genetics:
determined the helical structure of DNA.

 

53) Which of the following scientists (Watson and Crick, Franklin, McClintock,
Griffith, Chargaff) matches with his/her discovery or contribution to genetics: discovered
thattheamountofA = TandG = CinDNA.

 

54) Which of the following scientists (Watson and Crick, Franklin, McClintock,
Griffith, Chargaff) matches with his/her discovery or contribution to genetics: provided
evidence from X-ray diffraction for the periodicity in DNA.

 

123

55) Which of the following scientists (Watson and Crick, Franklin, McClintock,
Griffith, Chargaff) matches with his/ her discovery or contribution to genetics:
demonstrated bacterial transformation.

 

56) Which of the following terms (bacteriophage, thymine, guanine, nucleosome,
nucleotide) matches the definition: composed of base, sugar and phosphate group.

 

57) Which of the following terms (bacteriophage, thymine, guanine, nucleosome,
nucleotide) matches the definition: pairs with cytosine.

 

58) Which of the following terms (bacteriophage, thymine, guanine, nucleosome,
nucleotide) matches the definition: pairs with adenine.

 

59) Which of the following terms (bacteriophage, thymine, guanine, nucleosome,
nucleotide) matches the definition: virus infecting bacterial cell.

 

60) Which of the following terms (bacteriophage, thymine, guanine, nucleosome,
nucleotide) matches the definition: DNA wound round histone core.

 

61) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: movement of ribosome along mRN A.

 

62) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: synthesis of RNA from DNA.

 

63) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: synthesis of DNA form DNA.

 

124

64) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: attachment of amino acid to tRN A.

 

65) Which of the following terms (replication, acylation, translation, translocation,
transcription) matches the definition: conversion of language of nucleotides to language
of amino acids.

 

66) Which of the following molecules (polymerase, rRNA, mRNA, DNA, tRNA)
matches the function: carries coded information for specifying polypeptide to be made.

 

67) Which of the following molecules (polymerase, rRNA, mRNA, DNA, tRNA)
matches the functionzcarries amino acid to ribosome.

 

68) Which of the following molecules (polymerase, rRNA, mRNA, DNA, tRNA)
matches the functionmecessary for transcription to occur.

 

69) Which of the following molecules (polymerase, rRNA, mRNA, DNA, tRNA)
matches the function: major component of ribosome.

 

70) Which of the following molecules (polymerase, rRNA, mRNA, DNA, tRNA)
matches the function: carries information for protein complexed with histones.

 

DIRECTIONS: FOR ESSAYS, FOLLOW DIRECTIONS GIVEN BY YOUR
INSTRUCTOR.

71) ESSAY —-- Compare the three types of RNA regarding formation of the mature
RNA, size, three dimensional structure, and role in protein synthesis. (5 points)

72) ESSAY --- In a certain strain of bacteria, the operation site of an operon
containing the structural genes for enzymes X, Y, Z, has been deleted as a result of a
mutation. Enzymes X, Y, and Z are inducible under specific conditions. What is the
effect of this deletion of the operator site on the production of these enzymes? (5 points)

80-90”

 

125
THEORY" by

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

126

 

ANSWER KEY FOR: A.P. BIOLOGY CHAPTER 9&10 FORM: #201
INSTRUCTOR: DATE:
CLASS:

 

If you are using alternate forms, be sure that the FORM # on this answer key matches
the student’s answer sheet form #.

1)--C--
2)-B---

ro)--c--
1D-B---
12)---D-
1$---D-
lo—B--—
15)---D-
1®-B---
lD--C--
1&--c--
1m--c--
2m-B---
21)---D-
2%Aw---
23)---D-
2Q---D-
25)---D-
2®-B---
2n--c--
2&--c--
anA----
mnA----
3D-B---
3»--c--
33)A----
3o-F

35)-F

3®-F

127
37) T -
38) - F
39) - F
40) T -
41) T -
42) - F
43) - F
44) - F
45) T -
46) - F
47) - F
48) — F
49) T -
50) - F
MATCHING (SHORT-ANSWER) QUESTIONS:
51) McClintock
52) Watson and Crick
53) Chargraff
54) Franklin
55) Griffith
56) nucleotide
57) guanine
58) thymine
59) bacteriophage
60) nucleosome
61) translocation
62) transcription
63) replication

64) acylation

128

65) translation

66) mRNA

67) tRNA

68) polymerase

69) rRNA

70) DNA

ESSAY QUESTIONS:

71) CHAPTER 10, QUESTION #2
72) CHAPTER 10 QUESTION #3

129

 

 

A.P. BIOLOGY CHAPTER 11 FORM: #301
INSTRUCTOR: DATE:
CLASS:

 

DIRECTIONS: FOR EACH QUESTION, CIRCLE THE ONE BEST ANSWER.
1) First Letter of a restriction enzyme stands for the:

Strain of the organism
Genus of the organism
Specific epithet

None of these

$70!”?

2) Inserting a plasmid into a cell capable of generating many COpies of itself, this is
called:

A. Cloning B. Endonuclease C. Recombination D. All of these

3) All fragments of DNA that are separated by gel electrophoresis are influenced by
all the following except:

A. Charge of the molecule

B. Strength of the electrical field

C. Density of the gel

D. PH of the buffer solution

4) Which substance was the inducer of the Lac Operon Gene:

A. LB AGAR B. JMlOl STRAIN C. X-GAL D. IPTG
5) LB+ plates contain:

A. JMlOl Strain B. pUC 18 plasmid
C. ampicillin D. none of these

6) The enzyme which joins two pieces of DNA together is called

A. restriction endonclease. B. ligase.
C. polymerase. D. reverse transcriptase.

130

7) To create complementary sticky ends, two pieces of DNA are treated with the
same

A. restriction endoclease. B. ligase.
C. polymerase. D. reverse transcriptase.

8) Extrachromal pieces of DNA in bacterial cells are called
A. plasmids B. clones C. oncogenes. D. vectors.
9) Restriction endonuclease

are produced only by E. COLI.

protect the bacterium against bacteriophages.
cut only one strand on a piece of DNA.
join two pieces of DNA together.

PCP”?

10) Cancer cells are characterized by

A. immorality. B. lack of contact inhibition.
C. uncontrolled growth. D. all of the above.

11) Which of the following might be a step in carcinogenesis?

A. base substitution resulting from exposure to a mutagen
B. viral infection
C. chromosomal rearrangement

D. all of the above

12) In order to join human DNA and cow DNA, both must first be treated with the

A. DNA polymerase. B. DNA ligase.
C. reverse transcriptase. D. restriction endonuclease.

13) The formation of hybrid nucleic acids depends on the

A fact that DNA will anneal with DNA but not RNA.

B. association of identical strands of DNA.

C. weakness of the covalent bonds between the bases in DNA.
D strands having a high degree of complementary.

131

14) It may be concluded from experiments demonstrating totipotency and from nuclear
transplantation that

A. gene loss accompanies differentiation.
B. differentiation results from differential gene expression.
C. germ cells have the haploid number of chromosomes.

D. no cell is totipotent expect a malignant cell.

15) DNA can be introduced into the host cell by

A. viruses. B. plasmids. C.mutagens. D. a and b are correct.
16) Restriction endonuclease cleave

A. hydrogen bonds between bases.

B. covalent bonds between the sugar and phosphate.

C. ionic bonds between A and T, and C and G.

D. hydrogen bonds between deoxyribose and phosphate.

17) Consider the DNA sequence: A A T C G G C T A T. Which of the following
sequences would form a hybrid with the given molecule?

A.AATCGGCTAT B.TTAGCGGATA
C.TAAGGCGATA D.UUAGCCGAUA

18) In order for the two DNA molecules to form a recombinant DNA, they must

A be from the same organism.

B. be the same length.

C. have complementary sticky ends.
D all of the above.

19) Bacterial DNA is not cleaved by restriction endonuclease because it is

A. circular B. covered with histones
C. methylated. D. coiled very tightly.

20) EcoR1, a restriction enzyme, recognizes the sequence GAATTC.
CTI‘AAG
Into how many fragments will EcoRI cut the double helix of DNA presented below?

DNAHELIX: CCGATTCCGCTCGGAATTCGATT
GGCTAAGGCGAGCCTTAAGCTAA

A. 0 fragments B. 1 fragment C. 2 fragments D. 3 fragments

22)

132
Recombinant DNA technology is possible because of

specific base pairing rules.

the universality of the genetic code.
restriction endonuclease.

all of the above.

Which of the following limit the usefulness of recombinant DNA technology as

a tool for obtaining human gene products from bacterial cells?

P CW?

24)

the lack of specificity of reverse transcriptase.

the lack of bacteria which take up vectors

the lack of the appropriate regulatory aequences and signals.
all of the above.

Nucleic acid hybridization

can occur only between two identical DNA strands.

requires brealn'ng the sugar-phosphate backbone.

can be used to determine evolutionary relationships between different species and
kingdoms.

cannot occur between DNA and RNA.

A pathologist analyzed a tumor surgically removed from a large intestine of a 60

year old man. She performed a series of tests to determine whether or not the tumor was
malignant. Cells from the tumor exhibit the same pattern of growth in a culture medium
as normal cells from the large intestine. Which of the following characteristics would
you expect to be true for these cells?

POW?

difference in morphology, compared to normal cells

presence of chromosomal rearrangements or extra chromosomes
changes in the cell‘s motility

none of the above.

133

25) Restriction endonclease, EcoR1, recognizes the sequence GAA'ITC
CTI‘AAC

A recombinant DNA molecule can be made between this short piece of DNA and which
of the following sequences?

A. CTACCGGTAT
GATGGCCATA
B GAATTCAGCG
CTTAAGTCGC
C. CAATTGATCG
GTTAACTAGC
D AACCGAATTG
TTGGCTTAAC

DIRECTIONS: FOR EACH QUESTION, CIRCLE THE ONE BEST ANSWER.

26) TRUE or FALSE --- Hybridization occurs only between complementary DNA
single strands and cannot occur between DNA and RNA.

27) TRUE or FALSE --- Only DNA from the same or similar organisms can be
combined to form a hybrid molecule.

28) TRUE or FALSE --- Restriction enzymes randomly cut DNA molecules.

29) TRUE or FALSE --- An oncogene functions in normal growth and embryogenesis,
but has the potential to cause cancer.

30) TRUE or FALSE --- Cellular transformation to a malignant state results from
changes in the cell’s DNA.

31) TRUE or FALSE --- The sugar-phosphate backbone is destroyed by heating DNA
to 100 degrees Centigrade.

32) TRUE or FALSE --- Metastasis is a characteristic of malignant cells.

33) TRUE or FALSE --- A piece of DNA 10,00 nucleotides long moves farther when
subjected to electrophoresis than a piece of DNA 5,00 nucleotides long.

34) TRUE or FALSE --- Any human gene transplanted or transferred into a bacterial
cell will be expressed.

35) TRUE or FALSE --- Some retroviruses contain oncogenes of animal origin.

134

DIRECTIONS: FOR EACH QUESTION, WRITE YOUR ANSWER ON THE LINE
PROVIDED.

36) Which of the following terms (vector zygote, oncogene, clone, plasmid) matches
the definition: cancer causing gene.

 

37) Which of the following terms (vector zygote, oncogene, clone, plasmid) matches
the definition: group of genetically identical organisms or cells.

 

38) Which of the following terms (vector zygote, oncogene, clone, plasmid) matches
the definition: fertilized egg.

 

39) Which of the following terms (vector zygote, oncogene, clone, plasmid) matches
the definition: small circular DNA molecule in bacterial cell.

 

40) Which of the following terms (vector zygote, oncogene, clone, plasmid) matches
the definition: carrier of DNA.

 

41) Which of the following enzymes (DNA polymerase, reverse transcriptase,
restriction enzyme, RNA polymerase, DNA ligase) matches the function: cutting enzyme.

 

42) Which of the following enzymes (DNA polymerase, reverse transcriptase,
restriction enzyme, RNA polymerase, DNA ligase) matches the function: joining enzyme.

 

43) Which of the following enzymes (DNA polymerase, reverse transcriptase,
restriction enzyme, RNA polymerase, DNA ligase) matches the function: makes DNA
from RNA.

 

135

44) Which of the following enzymes (DNA polymerase, reverse transcriptase,
restriction enzyme, RNA polymerase, DNA ligase) matches the function: makes DNA
from RNA.

 

45) Which of the following enzymes (DNA polymerase, reverse transcriptase,
restriction enzyme, RNA polymerase, DNA ligase) matches the function: makes RNA
from DNA.

 

DIRECTIONS: FOR ESSAYS, FOLLOW DIRECTIONS GIVEN BY YOUR
INSTRUCTOR.

46) ESSAY —-- How do you think it was determined that retroviruses carry genetic
material of cellular origin?

47) ESSAY —-- Consider the following situation. You have ten clones of bacteria each
of which has a different piece of human DNA inserted into a plasmid. From these ten
clones you want to select the one which has the gene for protein A. In each of the
clones, the DNA in the plasmid is isolated and made into a single stranded molecule.
This DNA is exposed to radioactively labeled mRNA for protein A. The following
results were obtained:

clone# 12345678910
reactionwithmRNA +---+---+-

(+) indicates radioactivity associated with DNA
(-) indicates no radioactivity associated with DNA

a. Which clone(s) contain the gene for protein A?
b. Why can mRNA be used as a "probe" for locating the gene for protein A?

136

 

 

ANSWER KEY FOR: A.P. BIOLOGY CHAPTER 11 FORM: #301
INSTRUCTOR: DATE:
CLASS:

 

If you are using alternate forms, be sure that the FORM # on this answer key matches
the student’s answer sheet form #.

1)-B---
2)A----
3)---D-
4)---D-
5)--c--
Q-B---
7)A----
8)A----
m-E---
10)---D-
11)---D—
12)-~0-
l3)---D-
14)-B---
15)---D-
1Q-B---
17)--—D-
l8)--C--
19)--c--
20)-B---
21)---D-
22)--C--
23)--C--
24)---D-
25)-B---
26)-F
2n-F
2&-F
29)T-
30)T-
31)-F
32)T-
33)-F
34)-F
35)T-

137
MATCHING (SHORT-ANSWER) QUESTIONS:

36) oncogenes

37) clone

38) zygote

39) plasmid

40) vector

41) restriction enzyme
42) DNA ligase

43) reverse transcriptase
44) DNA polymerase

45) RNA polymerase

ESSAY QUESTIONS:

46) CHAPTER 11, QUESTION #1
47) CHAPTER 11, QUESTION #2

APPENDIX H

"DRY LAB” ON PLASMIDS

138

PLASMID LAB

OBJECTIVE: To observe the process of recombinant DNA technology and
visualize the product on paper.

BACKGROUND INFORMATION:

Biotechnology includes three technologies that all use living
organisms to carry out chemical processes or to produce substances.
Current biotechnology includes bioprocesses. monoclonal antibodies, and
recombinant DNA technology. Bioprocesses are part of the manufacture of
bread, cheese, and beer. They may also be used to break-down sewage
wastes. -

Monoclonal antibody technology allows the fusion of cancer cells that
reproduce very frequently with cells that produce a particular antibody.
The new cells, hybridomas, are cloned to produce the antibody in quantity.
Recombinant DNA technology also produces some substance in large
quantities. A gene coding for a particular protein is transferred into a host
bacteria. This bacterium multiplies and produces the protein in volume.

MATERIALS FOR THE LAB: scissors and glue

STEPS FOR RECOMBINATION:

A. The scientists must identify the gene that codes for the production
of the protein they want to manufacture. One way is to work backwards
from the amino acid sequence of the desired protein to the nucleotide
sequence of the gene. The gene must be isolated, that is removed from the
host chromosome. Restriction enzymes, or endonucleases, from bacterial
cells are used. Bacteria normally use these to destroy foreign DNA that
gets into the bacterial cell. These enzymes recognize and cut specific
sequences of the DNA. The cut is a staggered one, called a sticky end
These ends will automatically bind with complementary base pair
sequences on other DNA strands cut with the same enzyme. The enzyme
can be used to cut on either side of the gene desired.

8. Now begins the process of trying to get the gene into a host
bacteria cell. A small circular piece of DNA that is a normal component of
bacteria is used to carry the gene. Plasmids have a region, called the
replication origin, that enables them to be replicated. After removing a
plasmid from a bacterial cell. scientists cleave the plasmid using the same
enzyme they used to clip out the gene. This way the sticky ends of the
plasmid will match those of the gene. It is important to use restriction
enzymes that do not out within the gene itself. The cleaved plasmid and
the cleaved gene are mixed together. The sticky ends of the gene and the
sticky ends of the plasmid come together and their complementary bases
pair with hydrogen bonds. A DNA ligase enzyme is added. which completes

the bond.

c. The new plasmid is mixed with the host bacteria, and is taken up
by the bacteria. This process is called transformation. To check that the
plasmid has been taken up, they test the bacteria for some basic charac-
teristic of the plasmid. For example, if a plasmid produces resistance to an
antibiotic, scientists could spread the bacteria they hope contain the

139

plasmids on a petri dish of agar mixed With antibiotic. Only the bacteria
containing plasmids with antibiotic resistance and the replication origin
wtll survive. Then it would be tested for the presence of the gene. The
plasmids are replicated within the host and begin producing the protein.

LAD PROCEDURE:

l. CONSTRUCT THE PLASMID. The strips on the plasmid sheet are
written with the DNA 3' to 5' from top to bottom on the left-hand side of
the strip and from 5' to 3' from top to bottom on the right—hand side of the
strip. Some of the base pairs have been left out. Fill in the correct
matching base pairs first. Cut out the plasmid strips along the dotted lines
and put them together end to end in any order. You may even discard one
of the strips if you choose. Be sure your plasmid still contains the
replication origin. Tape your final plasmid into a circle shape.

2. LOCATE RESTRICTION SITES. Use your enzyme sheet to compare
the sequences of base pairs on the cards with what you have on your
plasmid. Mark a starting point on the plasmid and work your way
around, writing the restriction sites on your plasmid as you find them.
Draw a diagram, or restriction map. of the plasmid. Mark the antibiotic
sites, restriction sites, and the replication origin in relative distance to one
another on a circle.

3. ASSEMBLE YOUR DNA AND REMOVE THE GENE. Cut out the strips
on the cell DNA sheet and assemble the strips in the order one through six,
as indicated on' the handout, to end up with a long flat strip. The gene
starts with-the code for methionine and ends with a stop codon. Determine
which restriction sites occur above and below the gene. Match these to the
ones on the plasmid. Use one enzyme to cut the DNA above the gene and
then cut your plasmid with the same enzyme. Find a second enzyme to
out below the gene and use this enzyme to cut the plasmid again. Be sure
the portion of the plasmid that remains contains the origin and at least one
antibiotic resistance site.

4. ASSEMBLE FINAL PLASMID. Mix the gene fragment with the
plasmid fragment and use the DNA ligase to bond the sticky ends making a
complete plasmid containing the gene.

5. DETECTING THE PLASMID. In a lab situation, the recombinant DNA
plasmids are mixed with the host bacterial cells and could be followed by
screening for the antibiotic resistance and the protein produced. Decide
which antibiotic or antibiotics you will use to detect your plasmid.

QUESTIONS:

Which enzymes did you use?

Which antibiotics would you use to test for the presence of the plasmid?
What is a gene?

Why is the plasmid a circle while the DNA was not?

What are the three types of biotechnology?

Why do you think bacteria naturally contain plasmids?

What are hybridomas and how do they help modern medicine?

How can recombinant DNA technology be a benefit? a threat?

395999???

Eonzymes

 

 

 

 

 

 

 

 

 

m m u m .m m
m m m m m a... m
n B u E " mm “
WGCATQCmGAATTE“ u n
"QCTAGGmCTTAAGm m
T-----------------J ................... 1 .................. .
. H _ I - I -
. rd . I . a u
m m m m m m. m
u H u H m X n
mAAGCle FKEG “cccccén
mlTCGAAh QGCC mGEGCCCm
m ......... m ........ mil-1 ........ n. ......... m
. _ H... . C .
_ m . 8 _ a n
m A m . B m s m
mp¥72%amACATQTLCAbCTEn
wrFTEEVthTAGAmCfiCGAGm

 

l

l

H
II
||
4

l

l

I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I
I

The Srirm Turin/Ami "87

141

Cell DNA

 

AAGCTTGCCCCCCCATCCTCG
TTCCAACGCCCCCCTACCACC

 

EETTETEWCCAGGAATTCTTA

 

 

 

 

 

 

 

 

 

_
_
CTEATATTCCTCCTTAACAAT
_

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

.EEGCEQLAEEFGCATTAfrlwa
_m “E 1; “En : WV] . A: la
.eflgaieaje4-crrrrsg.a.
AACCTTCCE T LAQAG

 

 

l

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

,. H a T A T -_ C

TTCCAACQt. .Tfie

 

 

 

r\ fir

n
_ EC in...» fig TE ft l C

 

 

CTCTAACAATTCACTTCCTCC
CACATTCTTAAGTCAAGCAGC

 

ACCCGCATCCcTGTCCCGGCC

 

TGGGCCTAGGCACAGGGCCCC

 

 

a 2 protein gene

142

Plasmid

 

 

 

 

 

 

I

 

MATTCGGCATCCAAQCTTGAGGT
_TAAGCCGTACGTTCC 3m
T...- r i... i... awe-HEM.
WACCAC.©¢\."VAGTTCCAATATIGA_ .m
345s mm
TGcTceecemoscAAGGT-TATACTr...
Til v.7. .ifia
WGCTCAATW/wyfl. .// ' CGG”:
mCGAGTTAIH/r/I , ,. GGCCCE
ll! .
”ATCCGGGGGAAAAAEFFCTGA_
"TACGCCCCCTTTTTzzchCT_
Tlillllllul.

 

 

 

 

 

 

TETTTTWWWWACAGGTCATC
_AGAAAAT¢WCTGTCCAGTAG

 

 

 

 

 

 

_GCCCAGAGTTTCTTAAGGTC

C

FIIIIIIIIIIIIIIIIIII

J.

_

LG
mmmm

A__
~ 9;" .

Ta

 

Part A: 143
I. What was the goal of the procedure?
What was represented by the first chain of beads?
Why were the four beads removed? What did they represent?

2.

3.

4. What removes these in nature?

5. What in nature forms the DNA from the mRNA?
6. From what was this molecule first obtained?

Part B:

7. You constructed a plasmid. From what do plasmids come?

8. What cuts the plasmid?

9. From what does this molecule come?

10. Why must the sane cutting molecule be used on both the plasmid and the DNA?
11. Why was HindIII used?

12. What is HindIII?

13. Why was the loss of the four beads from each end of the DNA no loss to the

coded message it carries?
14. What two steps would follow these?

 

APPENDIX I

COMPARISON OF PRETEST & POST TEST SCORES

N

144

N

mm.m muz<Hm<>

0.0N
m.n<
—.h¢
N.om
v.0m
0.00
P.0m

mmoum

OE<DZ(FM

m IZKOm F0002 mek

vN\bo\Fm mkdo 23m

mm.Nm muz<Hm<>

m

ou<oz<#m

< IEEOu paloz hawk

¢N\h0\—a mh<o 23¢

m.hm
m.ov
m.vv
m.m¢
n..m
h.vm
n.0m
n.00
m.mo
moon

0—

o—

uo.zonk(u>wo ou<oz<#m 024 on no z<m! m<I mmoum om<OZ(km
mv kmmh zo WSMFH J<POF

m—.n onP<H>wo ou<oz<hm Pm.ON z<ux
v F? —
m— o— F
PM a n
«m o N
Nb v N
on N F
mm — —
xz<m >Uzm30mmm >Uzm30m¢m
NJHbzmumma w>HP<JDISDU

omnumzummmnou NnNmIMJHm
zomknmmmkmno maoom 3<¢
HHH mmo<mo 014 «MFDQZOU 3w:

MN
0N
mN
on
PM
#0
mm
maoum
3(m

Noananz m

m.hrom\mp\0puzmu>

mV PmMP zo WZNFH J<POF

no ZOHF<H>MO om<oz<kw oz< cm to z<m3 m<I muoum om<oz«km

ch.m onk(a>mo om<oz<km nN.mp z<m2
o N— N N—
mN O— N VP
pm a P @—
nv h p a—
vm o P ON
N0 n F NN
ms v N ”N
no N — 5N
no p p @N
xz<¢ >Uzm30m¢m >Uzm30m¢u mcoum

MJszmummn m>HF<JDIZDU 3<¢

omnumznmmcaou PnNmIMJHm
ZOHFDGHKPMHO muoum 3<¢
HRH umo<ma 0‘4 mmknnlou 3m!

—OflNl¢OZ n.
m.h—om\m—\O’Izm¢>

BIBLIOGRAPHY

 

BIBLIOGRAPHY

Anderson, John N. , 1987, ”A Basic Laboratory Course in Modern Biology”, Modom
Biology_$_e_r_io§, Purdue University.

Arms, Karen and Camp,Pamela, 1990, Biology; loomoy of Lifo(1st Edition), W.B.
Saunders Company, 1990.

Baltimore, David,1984, The Brain of a Cell, Science 84 5(A): 149-151.
Bishop, Michael J ., 1987, The Molecular Genetics of Cancer, Science: 235: 305-311.

Bloom, Mark, 1990, Mapping and Sequence the Human Geome, W
lips, Volume 4 #1.

Campbell, Neil,1987, B_io_logy, Benjamin/Cummings Publishing Co.
Campbell, Neil,1990, B_iology, Benjamin/Cummings Publishing Co.

College Board. WWW. 1989,1990.
and 1991.

Cook, James L.,1987, Plasmid Lab, Tho Soionm Toaohor 37:34-38.

Dixon, Linda, 1988, teaching Recombinant DNA Technology in High School Biology
Course, Amorioao Biology Togohor: 50: 368-373.

Glover, D. M., 1980, fionog’o Engiomriog - Cloning DEA, Chapman and Hall
Publishers.

Guilfoile, Patrick, 1989, A simple DNA Isolation Technique using Halophilic Bacteria,
Amorigao Biology Taohor, 51(3): 170-171.

Hagerman, Howard, national Science Foundation Workshop Summer 1991, Kellogg
biological Station, michigan State University, July 1991 .

Helms, Doris and Coker, Phillip,1989,Qoo§atory_MaouaJ_for__Smdoms, Worth
Publisher’s

145

146
Kornberg, Arthur,1974, DNA Synthosis, W.H. Freeman and Co.
Lewis, Ralph W.,1988, Biology: A Hypothetic-Deductive Science, Amoriom Biology
MM, 50(6): 362-366.
Micklis, David and Freyer, Greg, 1989, A laboratory Introduction to DNA Restriction
Analysis, Biotechnology Education: 1(1): 16-22.

Micklins, David and Freyer, Greg, 1990,2NA Soionoo; A first Coorx in Rgomoioaot
DNA nghnology, Cold Spring Harbor laboratory Press.

Myers, Richard, 1988, Recombinant DNA Technology in High School Biology
Laboratory, American Biology Teacher: 50(1): 43-45.

Ogden, Richard and Adams, Deborah, 1989, Recombinant DNA Technology:
Applications, Carolina Tips, May 1st.

Old, R.W. and Primrose, S.B. , 1981 , Prinoiolos of Gong manipulation, University of
California Press.

Sambrook, J., Fritsch E. F., Maiatis, C.,1989, 1 1 l 11‘ ° A
Maoula, 2nd Edition. Cold Spring Harbor Lab Press.

Sharp, Charles, 1989, Use of Methylene Blue for Staining DNA, National Science
Workshop:Molecular Biology, Michigan State University.

Smith, Richard G., 12%), Rommbinaot DNA WoLkstaLion, Lofstrand Labs Limited.
Stone, Harry J. ,1982, Biotechnology, Carolina Tips, 45 (11).
Stryer, Lubert, 1986, Biotechemistry, 3rd edition.

Suelter, Clarence, 1989, National Science Foundation Workshop:Molecular Biology,
Michigan State University.

Thompson, Robert G.,1988 Recombinant DNA Made Easy: Jumping Genes, American
Biology Teacher, 50(2): 101-106.

Thompson, Robert G. , 1989, Recombinant DNA Made Easy 11: Gene, Gene, Who’s Got
the Gene?, American Biology Teacher, 51(4): 226-232.

Vigue, C., 1984, Oswald, Avery, and DNA, American Biology Teacher, 46: 207-211.

Watson, James D. , 1989,For a Few Dollars More, Biotechnology Education: 1(1): 3-5.