. a

 

     

 

 

5 11.9132...

and;

  

THESlb

||||||||ll|lll|||llllllllllllllllll|ll|lllllllllllllllllllll

3800 96 3229

This is to certify that the

thesis entitled
Cloning, Gaul Sevonctnj 0F ‘Hue Helper Camfonen‘i

R€510fl o‘F zucchini yellow MOSOIC virus

presented by
Ronnie B- BIN-DA

has been accepted towards fulfillment
of the requirements for

M. S. degree in MW-robiolog/v

    

Majo professor

Date /,’/; ?/

0-7639 MS U is an Affirmative Action/Equal Opportunity Institution

i— _
j LiBHARY ]
gMichigan State ;
University J

 

i
l
i
1_

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

MSU Is An Affirmative Action/Equal Opportunity Institution
czbimwmnuna—p:

 

 

 

Cloning and Sequencing of the Helper Component Region

of zucchini yellow mosaic virus

BY

Romulo B. Bada

A THESIS

Submitted to Michigan State University
in partial fulfillment of the requirements
for the degree of

MASTER OF SCIENCE

Department of Microbiology
1991

677-?6’6/7’

ABSTRACT

Cloning and Sequencing of the Helper Component Region
of zucchini yellow mosaic virus

BY

Romulo B. Bada

Zucchini yellow mosaic virus (ZYMV), a cucurbit
potyvirus, is an extremely aggressive pathogen with a
devastating effect on cucurbit production worldwide. Towards
developing molecular strategies for increasing resistance to
ZYMV, a gene necessary for aphid transmission, helper
component (HC) was cloned and characterized. Sequence
analysis revealed both conserved 5’ and 3’ cleavage sites,
resulting in a calculated molecular weight of 52 kd for the
ZYMV HC protein. Compared to other sequenced potyviral HC
genes, ZYMV differed in conservation towards the amino
terminus (“region I"), along with other cucurbit potyviruses.
The difference in homology between cucurbit and non—cucurbit
potyvirus groups corresponds to a difference with the
predominant aphid species vectoring each group. Furthermore,
a region I amino acid substitution shown to abolish potyviral
aphid transmission is also present in this ZYMV strain, which
is non—aphid transmissible. This data supports the hypothesis

that region I is an aphid binding domain.

 

To my mother, Norma, and father, Arturo, whose love and

support made this work possible.

 

 

ACKNOWLEDGEMENTS

Special thanks to my two major professors, Dr. Michael
Thomashow and Dr. Rebecca Grumet for their unwavering
support, encouragement and technical assistance. I also wish
to thank the other member of my guidance commitee, Dr. Loren
Snyder, whose support at the early stages of my graduate

career was greatly appreciated.

iv

 

 

TABLE OF CONTENTS

Subject
Page
LIST OF TABLES -------------------------------------------- vi

LIST OF FIGURES ------------------------------------------- vii

Chapter 1— A review of potyviral biology,
regulation of aphid transmission and

zucchini yellow mosaic Virus ———————————————————— 1
Objective ——————————————————————————————————————— 2
Potyvirus Biology ——————————————————————————————— 3
Potyviral Gene Products ————————————————————————— 8
Regulation of Aphid Transmission ———————————————— 14
Zucchini yellow mosaic virus -------------------- 17

Chapter 2- The Cloning and Sequencing of the Helper Component

Region of zucchini yellow mosaic virus —————————— 20
Introduction ———————————————————————————————————— 21
Materials and Methods ——————————————————————————— 25
Results ————————————————————————————————————————— 30%
Discussion ______________________________________ 43k
Chapter 3- Addendum ———————————————————————————————————————— 53
Bibliography ———————————————————————————————————— 63

 

LIST OF TABLES

 

 

Table 1 Conserved amino acid in the potyviral
HC region (refers to Figure ) 42
Table 2 Aphid transmission of
various ZYMV strains 58

vi

 

 

Figure 1

Figure

Figure

Figure

Figure

Figure

Figure

Figure

Figure

Figure

Figure

Figure

4a

4b

6b
6c

\0

ll
12

LIST OF FIGURES

Potyviral genome and polyprotein map ————————————— 5
Cleavage products of the TEV potyviral

 

polyprotein
Restriction endonuclease map of clone Z24 ———————— 25

Restriction digests of cDNAs containing

 

the largest inserts 31
Dot Blot Hybridizations showing internal homologies
of cDNA clones to each other and Z24 ————————————— 32
Dot Blot Hybridizations to whole plant RNA

extractions of Healthy and ZYMV infected plants—-33

Partial restriction endonuclease map

 

of Zy 2, 4, 149 34
Sequence of 3’ terminus of Zy 2, 4, 149 —————————— 35
Sequence of the 5’ ends of Zy 2, 4, 149 —————————— 35
Conserved sequences, Boxes A and B ——————————————— 35
Nested deletions used for cDNA cloning ——————————— 37

DNA sequence and deduced amino acid sequence

of the helper component region of ZYMV ——————————— 38
Alignment of HC region amino acid sequences for
ZYMV, PPV, TEV, TVMV,PVY, PVC

(a NAT strain of PVY), CaMV,

 

 

CaMV* (a NAT strain of CaMV) 40
HARR plots showing nucleic acid homology

between various potyviruses 48
Mixing Experiments 58

 

Primer at the 3’ terminus of the ZYMV—CT HC

 

with a KPN restriction site 60

vii

 

Chapter 1

Review of potyvirus biology, regulation of aphid

transmission, and zucchini yellow mosaic virus

 

M

One of the areas in which molecular genetic
techniques hold the most promise for agriculture is the
development of disease resistant plant cultivars. This is
exemplified by the development of genetically engineered
virus resistances, using cloned viral genes as a novel
source of resistance genes (Beachy et al. 1990; Grumet,
1990). By genetically engineering the host so that it
expresses a pathogen gene in a way that is detrimental to
the pathogen (e.g. at the wrong time, in the wrong amount,
or in a counterfunctional form), it is possible to
interfere with the normal pathogenic process( Sanford and
Johnson,1985; Grumet et al, 1987). Approaches to date have
interfered with viral replication by using viral coat
protein genes, satellite sequences and antisense
sequences. Another possible, but currently untested
method, would be to utilize viral encoded genes to
interfere with the transmission of virus from one host to

the next.

One group of plant viruses for which this approach
may be appropriate is the potyvirus group. The potyviruses
are the most economically important group of plant
viruses, causing approximately 25% of all viral caused
crop losses worldwide (Francki et al. 1985; Hollings and
Brunt, 1981). One member of this group, zucchini yellow
mosaic virus (ZYMV), is very aggressive and pervasive in
causing heavy damage to cucurbit crops (Davis and Mizuki,
1986; Nameth et al., 1986; Provvidenti et al. 1984). In
order to utilize molecular genetic techniques to engineer
resistance to this virus, the cloning and sequencing of

genes from ZYMV is needed. Of particular interest is the

 

3
region of the genome encoding for helper component (HC), a
protein that is necessary to facilitate transmission of
potyviruses by aphids (Govier and Kassanis, 1974).
Efficient aphid transmission has been implicated as a
possible reason for the extreme aggressiveness of ZYMV
(Lecoq and Pitrat, 1985; Alderez et al., 1985; Alderez,
1985).

In theory, interference with aphid transmission by
expressing a heterologous or mutant helper component may
be a way to interfere with the infection process. No
example of HC-mediated resistance has been demonstrated as
of yet. To evaluate this possibility, it is first
necessary to further characterize the molecular nature and
function of this protein. This thesis describes the
cloning and sequencing of the region of the genome
encoding the helper component of ZYMV. The sequence is
then compared to other known potyviral helper component
protein sequences, in order to ascertain how much of the
ZYMV helper component is conserved relative to the other
potyviruses. Also discussed are the implications any
differences might have with regard to host or vector
specificity, or HC-virion/ HC—aphid interactions. Future
courses of action are also discussed, including what
questions will need to be addressed, and ways to

accomplish them.
Potyvirus Biology

The largest known group of pathogenic plant viruses
is the Potyvirus group; it is surmised that over 100
different members belong to this group (Hollings and
Brunt, 1981; Walkey, 1985). The type virus in this group
is potato virus Y. Potyviruses have the ability to
inflict damage to a wide range of crops around the world;
it is estimated that one quarter of the world’s viruses
that infect plants come from this group (Hollings and
Brunt, 1981; Francki et al. 1985). Frequently,

 

4
potyviruses are present as part of the natural pathogen
population, causing chronic reductions in yield and

quality (Hollings and Brunt, 1981).

Potyviruses exist as unicomponent, elongated,
flexous, filamentous rods 700-900 nm in length and 12—15
nm in diameter. Each viral particle has a coat of
approximately 2000 capsid proteins surrounding a positive
sense, single stranded RNA of approximately 10 Kb in
length (Hollings and Brunt, 1981; Francki et al. 1985). A
characteristic feature of this virus is its ability to
form aggregates of pinwheel—shaped cytoplasmic inclusion
bodies in the infected host (Dougherty and Hiebert,
1980). This is a hallmark of this disease(Hollings and
Brunt, 1981).

While it has been demonstrated that potyviruses can
be mechanically transmitted, most members of this group
are transmitted by aphids in a nonpersistent,
noncirculative manner. Other possible members have been
shown to be transmitted by seed, mites, or dodder
(Hollings and Brunt,1981). Once inside the host plant,
the virus is uncoated, although it is not clear whether
this event occurs before, during or after cell entry
(Shaw et al., 1985). Expression of the Viral genome
initially results in the synthesis of a large, single
polyprotein precursor of approximately 340 Kd in length,
in a manner similar to picornaviruses. This was inferred
from studies failing to detect any evidence of subgenomic
mRNAs in infected tissue; only genome—sized RNAs have
been identified (Allison et al. 1986). Furthermore,
complete nucleotide sequences of three potyvirus members—
tobacco etch virus (TEV), tobacco vein mottling virus
(TVMV), and plum pox virus (PPV), all show that only a
single open reading frame exists in these viral genomes
(Allison et al. 1986, Domier et al. 1986, Lain et al.

 

 

Potyviral Polyprotein Map

 

 

0 Kb 1 3 4 5 6 7 8 9 .
PI l***nc**| P3 I CI lval NIa I NIb ICP AAA
31Kd 56 Rd 50Kd 71Kd 6Kd 49Kd 58Kd 30Kd

Potyvirus qene products

 

 

Putative cell to cell movement
protein, 5' protease

—————— Aphid transmission, 5’protease

 

P1 P1 protein

HC Helper Component protein

P3 P3 protein

CI Cytoplasmic Inclusion -—
protein

VPg Virally encoded, ————————
genome— linked protein

NIa Small Nuclear Inclusion
protein

NIb Large Nuclear Inclusion—
protein

CP Coat Protein

?(specific virus-host
interactions)

————— ?(RNA helicase, replication,
viral/host interactions,
long distance transport)

—————— RNA stability,
infectivity

replication,
——————— 3' protease
——————— putative RNA— dependent

RNA polymerase

Encapsidation of viral RNA,

 

vector transmission,
vector specificity

Figure 1— Potyviral genome and polyprotein map

 

6
1989). Translation is thought to occur from the 5' end
of the genome, initiating at the end of a leader sequence
of approximately 150 bp (Allison et al. 1986). Figure 1

depicts the potyviral genome and polyprotein map.

Rapid autoproteolytic processing occurs after
translation, giving rise to intermediate polyprotein
cleavage products (Fig. 2). This is accomplished by three
proteinases that are encoded by the genome, and
autocatalytically released from the polyprotein. These
proteins are known as the nuclear inclusion protein
(NIa), the helper component (HC—pro), and the P1
proteinases, and are responsible for the proteolytic
events associated with polyprotein processing (Dougherty

and Carrington, 1988; Carrington, 1991, in press).

In TEV, the NIa proteinase is 49 kD and catalyzes
cleavage at five positions from the carboxy—terminal end
of the polyprotein. The second potyvirus proteinase, HC-
Pro, appears to catalyze only one proteolytic reaction, an
autocatalyic cleavage at its own 3' carboxyl—terminus
(Carrington et al., 1989a). The third protease, PI,
catalyzes the remaining cleavage between PI and HC-Pro
(Carrington, 1991, in press) As shown in figure 2, the HC—
Pro resides near the amino terminus of the potyvirus
polyprotein and cleaves at a conserved gly—gly dipeptide,
resulting in a 87—kD precursor protein in TEV. This
protein is further cleaved in vivo into 31—kD and 56—kD
products by the 31—kD P1 protease at a conserved tyr—ser
dipeptide (Carrington et al. 1991, in press). The 56—kD
protein is the HC—Pro (Thornbury et al. 1985). In all, the
action of these proteinases result in the cleavage of

eight mature proteins from the viral polyprotein.

The positively stranded RNA is also used as a
template for negatively stranded RNA, which in turn is

similarly replicated to generate additional positively

 

0 Kb 1 2 3 4 5 6 7 8 9 .
P1 I**HC**I P3 I CI iVPGI NIa I NIb 1 CP iAAAA
31Kd 56 Rd 50Kd 71Kd 6Kd 49Kd 58Kd 30Kd

Translation and synthesis of
potyviral polyprotein

 

 

 

 

 

 

Y S G G Q G Q S_Q G Q G Q S
(*)**** *~k* **** IAAAA
l Cis processing events
V
31 kD QIG Q'S_ Q’s
*****
.56kD . . 49kD
stink '. . *~k*
I Trans processing events
V V
50 kD 71 kD .6kD. 58 kD 30kD
o o o O O‘*)I I O t o
(1): P1 HC—pro NIa NIa NIa NIa NIa

Figure 2— Cleavage products of the TEV potyviral polyprotein

**** : proteolytic domains
(1) : protease responsible for cleavage denoted above

 

 

 

8
stranded RNA. These (+)RNAs are either translated or
encapsidated. Encapsidation is thought to be accomplished
in a 5’ to 3’ direction, similar to the potexviruses
(Allison et al., 1986).

During the course of infection, viral—encoded
proteins aggregate to form pinwheel— or scroll—shaped
inclusion bodies in the cytoplasm and/or nucleus.
Additionally, some potyvirus infections result in the
formation of other types of inclusion bodies (Christie
and Edwardson, 1977).

The life cycle of potyviruses is completed by uptake
of progeny virions by aphids and transmission to other
plants. Aphid transmission requires a Virally—encoded
protein present in the sap of infected plants, the HC—
Pro. It is hypothesized that the HC mediates binding
between the aphid stylet and virion; the mechanism has

not been defined (Pirone and Thornbury, 1983).

Potyviral Gene Products

Coat Protein (CP)— The coat protein is the major
component of the virion, with approximately 2000 units
per RNA molecule (Hollings and Brunt. 1981). Its
functions include: encapsidation of the RNA, vector
transmission, and host specificity. The sizes range
from 30—45 kD for different potyviruses, with each
virus having only a single, homogeneous type of
monomeric subunit. Biochemical analysis reveals that
both the N— and C— termini of the protein are exposed
to the surface, and removal of these segments by
trypsin treatments do not affect the morphological
shape or infectivity of the virion (Shukla et al.
1988). In addition, sequence homology among the
different potyviruses indicates high variability at the

 

9
N- terminus, with the remaining portion highly
conserved. The amino-terminal segment is oriented near
the surface of the virion, and is responsible for the
immunological differences amongst the assorted members
of the potyvirus group. The conserved domains may be
responsible for protein—protein or protein—RNA

interactions (Dougherty et al., 1985).

Large Nuclear Inclusion Protein (NIb)— The large nuclear
inclusion protein is one of two virally— encoded
proteins which comprise the nuclear inclusion body. It
is hypothesized to be a RNA—dependant, RNA polymerase
due to the presence of the conserved GDD tripeptide
sequence found in all replicases of this type. This
includes picornae viruses (eg polio), bacteriophages
(eg QB) and plant viruses (Domier et al., 1987).

Small Nuclear Inclusion Protein (NIa)— The small nuclear
inclusion protein is the major proteinase of the viral
polyprotein, responsible for the majority of cleavages.
Studies have shown that nuclear inclusion bodies posses
proteolytic activity and that this action is inhibited
in the presence of antiserum to this protein
(Carrington and Dougherty, 1987a), or by site—directed
mutations within the protein (Carrington and Dougherty,
1987b). Furthermore, deletion studies indicate that the
proteolytic domain is confined to the C-terminal half
of the protein (Carrington and Dougherty, 1987b). This
domain has been shown to be highly conserved in
relation to other NIa proteinases from different
potyviruses (Allison, et al. 1986), the 24 kD protein
from cowpea mosaic virus (CpMV), and the 3C proteinase
of picornaviruses (Domier et al., 1987). There is
evidence to show that these proteins belong to the
trypsin superfamily of serine proteases by virtue of
active site homology (Bazan and Fletterick, 1988).

 

10

The NIa proteinase cleaves the polyprotein at
five sites (Fig. 2). When exogenously supplied
proteinase was added to the polyprotein, the junctions
between the P3—CI and the NIb—CP were efficiently
cleaved in trans(Carrington and Dougherty, 1988). In
addition, when synthetic polyproteins containing the
junctions connecting the ends of the NIa and VPg
proteins with the NIa proteinase were constructed,
cleavage also occurred. This suggests that these
proteolytic events can also occur in cis. Fig. 2
illustrates a hypothetical model of the different cis
and trans cleavages in the polyprotein. In vitro, these
reactions occur rapidly, suggesting that significant
levels of polyprotein do not accumulate(Carrington and

Dougherty, 1988)

Genome Linked Protein (VPg)— This small protein (6kD in
TEV, 24kD in TVMV) is covalently attached to the 5’ end
of genomic, viral RNA and confers stability. It may
play a role in the initiation of RNA synthesis, as has
been inferred from other studies of viruses having
similar genome organization (Morrow et al., 1984, and
Vartapetian et al., 1984). However, removal of this
protein in studies of tobacco vein mottling virus
(TVMV) and TEV had no effect on infectivity due to
mechanical inoculation or on translation in cell—free
systems (Siaw et al. 1985; Hari 1981).

Cytoplasmic Inclusion Protein (CI)— This protein exists
as a monomer which aggregates to form diagnostic
pinwheel—shaped inclusion bodies in the cytoplasm of
all potyviruses. Early in infection, these proteins
aggregate in the morphological form of spikes on the
plasma membrane. Eventually, these elongate and
dissociate into the cytoplasm, floating freely as

pinwheel-shaped inclusion bodies (Christie and

 

 

 

11
Edwardson, 1977). Its functions are unclear, although

it has been proposed as a putative RNA helicase.

P3 Protein (P3)— This protein has not been able to be
observed in any potyvirus—infected plants; its
existence is inferred from sequence data and cell—free
translation assays. To date, no function has been

conclusively assigned to this protein.

Helper Component (HC-Pro) This protein has been shown to
have two functions, one a proteinase, and the other in
facilitating aphid transmission. Among the various
potyviruses, the carboxyl—terminal half is the most
highly conserved (Turpen 1989). Towards the amino—
terminus, it becomes less so. The proteinase function
was discovered when cell—free translation of synthetic
transcripts of the 5’ region of the genome resulted in
accumulation of an 87 kD proteolytic product in TEV
(Carrington et al., 1989a). Site—directed mutagenesis
studies have indicated that this domain resided in the
carboxyl—terminal half of the HC—Pro protein, and is no
longer than 155 residues from the C- terminus
(Carrington et al., 1989a). In addition, microsequence
analysis determined the cleavage site to be a gly—gly
dipeptide, with the cleavage appearing to act in an
autocatalytic manner (Carrington et al., 1989a). In
vivo, the 87 kD precursor product is further cleaved
into a mature 56 kD HC—Pro and a 31 kD P1 protein. The
proteinase responsible has just been identified
(Carrington 1991, in press) and the cut site determined
in vitro using the wheat germ translation system
(Rhoades, 1991, in press). This protease, P1, is the
first protein product from the 5’ end of the
polyprotein. While the proteinase domain of HC-pro has
been shown to reside within the 3’ half of the HC,
current studies by C. D. Atreya et a1. (1991, in press)

 

12
have indicated that an important residue for aphid

transmission resides in the N—terminal region.

Based on amino acid homology, the HC—Pro most
closely resembles members of the cysteine—type family
of proteinases (type member: papain), in which a
reactive cys residue approximately 30 a.a. from the
amino—terminal domain is followed by an essential his
residue approximately 100 a.a. later (Oh and
Carrington, 1989). Site directed mutagenesis studies on
this protein have confirmed the importance of these
residues on HC—Pro activity: deletions of a cysteine
a.a. 30 residues from the approximate amino—terminus of
the proteolytic domain proved detrimental to activity,
as did a his residue 73 a.a. downstream (Oh and

Carrington, 1989).

Another function assigned to the HC—Pro is its
role as a helper component (HC) for aphid transmission
from plant to plant (Thornbury et al., 1985). This will
be discussed in further detail in a later section.
Briefly, this protein has been shown to be a necessary
factor in experiments involving aphid acquisition and
transmission of potyviruses (Govier and Kassanis,
1974). Antiserum to partially purified helper component
fractions from two different potyviruses, TVMV and
potato virus Y (PVY) inhibits aphid transmission of
either in a reconstituted assay system (Hiebert et al.,
1984). In addition, the viral origin of HC was
confirmed when the anti—HC antisera precipitated a
discrete set of polypeptides produced by cell—free
translation of potyviral RNA (Hiebert et al., 1984). It
is hypothesized that the helper component plays a role
in the binding of the virion to the aphid stylet, as

will be discussed in a later section.

 

13

Among the various proteins isolated from
potyvirus—infected plants is an amorphous, cytoplasmic
inclusion body (CIB) whose function still eludes
researchers. Immunological studies have linked this
protein to the helper component (DeMeija et al., 1985).
Findings show cross—reactivity between antiserum raised
to this protein and to the major protein component in
active helper component fractions. However, this
antiserum has been found to be ineffective against
preventing the active helper component from its
activity in aphid transmission. In addition, purified
CIB protein does not have helper component activity,
leading to the speculation that it may be in an

unstable or inactive form.

P1 Protein (P1)— This protein is encoded at the amino—

terminal end of the open reading frame of the
polyprotein. Carrington (1991, in press) has
demonstrated that this protein is also a protease,
responsible for the autocatalytic cleavage between
itself and the HC—Pro. Sequence analysis of P1 shows
homology to the 30 kD movement protein of tobacco
mosaic virus (TMV), suggesting a role in cell—to cell
movement of the virion (Domier et al. 1987). It has
yet, however, to be detected in the cells of potyvirus
infected plants.

non-coding region— This region, containing the
presumptive site of covalent linkage to the VPg
protein, has been implicated in the enhancement of RNA
translation, analogous to a eucaryotic 5’ cap structure
(Carrington and Freed, 1990). Studies show that when
this structure is fused to a reporter gene, translation
is significantly enhanced, and does not require the
presence of a stabilizing/ribosome—binding cap

structure; synthetic versions of this region compete

 

14
for factors required for protein synthesis in a cell—
free translation mix. Among potyviruses, there are two
major blocks of homology, termed “Box a" (ACAACAU) and
"Box b" (UCAAGCA) (Turpen, 1989). These have been
hypothesized to be binding sites for translation

factors.

Regulation of aphid transmission in potyviral infections

Of all insect vectors of plant viruses, aphids
comprise the largest group. Aphid transmission is divided
into three basic types, non-persistent (e.g. stylet—
borne), semi-persistent, and persistent (e.g.
circulative) (Watson and Roberts, 1939; Sylvester, 1956).
The differences between them reflect the time it takes
the aphid to acquire the virus during feeding, how soon
after acquisition it initiates viral transmission, the
length of time it retains the ability to transmit the
virus, and the anatomical location of viral retention. By
far, the most important in economical terms are viruses
transmitted in a non—persistent manner. All aphid
transmitted potyviruses are in this category. These
viruses are acquired by the aphid soon after the
initiation of feeding, are carried on the stylet or other
mouthpart, and are transmitted immediately after the
aphid inserts its stylet into another plant. In addition,
the aphid soon loses (within a few hours) its ability to
transmit the virus after leaving the infected plant
(Kennedy et al., 1962). Persistent viruses, on the other
hand, require a long acquisition feeding time (6—20
hours), and at least a 12—hour latency period before
transmission. Aphids retain these viruses throughout
their body, in some cases through a moult, and retain the
ability to transmit for at least a week. Some persistent
viruses have the ability to multiply within the aphid;

non—persistents do not (Watson and Roberts, 1939). Semi—

 

15
persistent viruses have properties intermediate between

these classifications (Sylvester, 1956).

Potyviruses, like another family of non—persistent
viruses, caulimoviruses, are not readily aphid—
transmissible unless a component from infected plant sap
is present before or during aphid acquisition (Govier and
Kassanis, 1974; Sako and Ogata, 1981). As discussed above
for potyviruses, this factor was found to be a ca. 56 kD
protein of viral origin, termed helper component. Its
importance to the non—persistent nature of aphid
transmission became clear once it was shown that virions
attach to the maxillary stylet only on the presence of HC
(Berger and Pirone, 1986). Without it, virions accumulate
in the gut and are not transmissible. This indicates that
HC in some way performs a mediator function in the
binding of virion to the aphid stylet, possibly in the
form of a "sandwich“, with the HC in between the binding

sites of the virion and the stylet.

Generally, potyviruses exhibit the highest degree of
specificity for their own helper component (Lecoq and
Pitrat, 1985). It has been shown, however, that
potyviruses are aphid transmissible in the presence of a
heterologous HC. Studies in this area have shown that
prior access to heterologous HC proteins can either
decrease or increase the ability of an aphid to transmit
various members or strains of other potyviruses (Katis et
al. 1986). The decrease in aphid transmission was
hypothesized to be due to a titration effect on the
amount of available binding sites on the aphid stylet.
Presumably, less space was available for the higher
affinity homologous HC to bind its own virion, due to the
binding of a heterologous HC (Katis et al., 1986). An
increase in aphid transmission was observed in

experiments investigating the differences in

 

16
transmissibility among three isolates of TEV (Pirone and
Thornbury, 1983). These isolates were either highly—
(HAT), poorly- (PAT) or non— (NAT) aphid transmissible.
In each of these cases, prior access to HC from a
heterologous potyvirus, PVY, allowed for successful aphid
transmission when aphids were subsequently left to feed
on the isolate source plant. In another study,
competition assays tested the affinity of a purified HC
to mixed populations of its homologous virion and a
heterologous virion (Lecoq and Pitrat, 1985). Most often,
the aphid transmission rate of the homologous virion was
unaffected, while the rate of the heterologous virion
became drastically reduced. In one case between
watermelon mosaic virus 2 (WMV—2) and zucchini yellow
mosaic virus (ZYMV), however, this situation was
reversed. When WMV—2 and ZYMV were mixed with WMV—2 HC,
the transmission rate of WMV—2 became significantly
reduced, while the rate for ZYMV remained unaffected.
This suggests that ZYMV may have a competitive advantage
(Lecoq and Pitrat, 1985).

In addition to HC, viral capsid proteins also play a
role in aphid transmissibility. The study discussed above
involving the HAT, PAT, and NAT isolates of TEV showed
that even though all were transmissible using a
heterologous HC, the HAT isolate gave the highest
infection rate, followed by the PAT, and then the NAT.
Furthermore, HC activity was shown to be greatest from
the poorly aphid—transmissible isolate, suggesting that
an absence or deficiency of HC was not responsible for
differences in transmissibility (Pirone and Thornbury,
1983). In two strains of another non—persistent virus,
cucumber mosaic virus, differences in aphid
transmissibility have been shown to be associated with
differences in their protein coat (Gera et al., 1979).

The same has been found with two persistent viruses, pea

 

17
enation mosaic virus (Hiebert and McDonald, 1973), and
barley yellow dwarf virus (Rochow, 1970). In the case for
potyviruses, the TEV isolates were found to be
distinguishable by monoclonal antibodies to capsid

proteins (Dougherty et al., 1985).

Aphid transmission has also been shown to be lost by
repeated viral propagation by means of mechanical "rub"
inoculation on cotyledons of test plants (Swenson et al.
1964). A NAT strain of TVMV, derived in this manner, was
evaluated to test the hypothesis that a specific mutation
in the coat protein gene could cause non-aphid
transmissibility (Atreya et al. 1990). The coat protein
had been implicated in aphid transmission from previous
studies; enzymatic removal of the N—terminus of the coat
protein results in loss of aphid transmissibility
(Salomon, 1989). It has also been shown that this N—
terminal domain is exposed to the surface of the viral
particle (Allison et al. 1985; Shukla et al., 1988).
Studies into the amino acid sequence of the N-terminal
domain of this and other NAT strains revealed a
tripeptide of DAG which was consistently altered in NAT
strains but not in any aphid—transmissible (AT) strains
(Harrison and Robinson, 1988; Maiss et al., 1989; Quemada
et al., 1990). Further studies have shown that point
mutations around this area, especially the G residue,
greatly reduced or abolished aphid transmissibility
(Atreya, P.L. et al., in press)

Zucchini Yellow Mosaic Virus

Cucurbit species (melons, cucumbers, and squashes),
are hosts for three economically important members of the
potyvirus group: watermelon mosaic virus (WMV—2), the
watermelon strain of papaya ringspot virus (PRV—2), and
zucchini yellow mosaic virus (ZYMV). Of the three, ZYMV,

is the newest; it is highly aggressive and competitive.

 

18
While WMV—2 and PRV—2 have been around since the 1950’s,
ZYMV was first reported in 1981 in Italy (Lisa et a1.
1981). It has since spread throughout the world, causing
severe crop losses. (Lisa and Lecoq, 1984). ZYMV causes
vein clearing, leaf mottling, and severe stunting and
malformation of fruit growth with decreased yields (Davis
1986). It has been described as one of the most
aggressive and destructive of all plant viruses and as a
serious threat to cucurbit production. A need for
resistant cultivars has been emphasized (Davis and
Mizuki, 1987).

The extreme aggressiveness of ZYMV has been, in
part, attributed to highly successful aphid transmission.
Field studies have shown that ZYMV is more successful in
establishing infections than WMV—2 and papaya ringspot
virus (PRV); natural field spread from inoculated to
adjacent uninoculated squash plants was 10—fold greater
for ZYMV (Alderz et al. 1985) Given the helper component
from WMV—2 and a mixture of WMV—2 and ZYMV virions,
infections of ZYMV were established three times more
often than were infections in WMV—2 (Lecoq and Pitrat,
1985). These provoked suggestions that ZYMV may have some

sort of competitive advantage for aphid transmission.

Therefore, the factors related to aphid transmission
may, in part, account for the success of ZYMV. These
differences may be reflected in the molecular structure
of the HC and/or coat protein genes. In order to
understand the factors which enable potyviruses to be
successful plant pathogens at the molecular level, the
study of the ZYMV helper component would be a good model
to work with. By molecularly characterizing the ZYMV
helper component, a framework of information will have

been made to serve as a basis of later studies dealing

 

19
with the manipulation of aphid transmission of

potyviruses.

The work described herein focuses on the sequence
analysis of the ZYMV helper component gene. It is
compared to the sequence of other potyvirus helper
component genes and the also the helper component gene
for cauliflower mosaic virus. Since the HCs of several
potyviruses have been shown to be functionally
interchangeable (Sako and Ogata, 1981, Lecoq and Pitrat,
1985), areas of conserved sequence might be related to
the biological activity of the HC. The comparison of
homologous areas of the HC region of ZYMV to the other
potyviruses will serve to reinforce or put into question
putative regions essential to the biological function of
this protein. In addition, if the reason for the extreme
competitiveness of ZYMV does indeed lie within the
protein sequence of its HC, it may well lie within the
areas of high homology within which ZYMV has sequence

variation.

 

 

 

20

CHAPTER 2

Cloning and Sequencing of the Helper Component Region of
ZYMV potyvirus

 

21

Introduction

In 1981, a new member of the potyvirus family was
identified, zucchini yellow mosaic virus (ZYMV). This
virus has been shown to be extremely aggressive, and is
responsible for a good deal of the Virally-related
destruction of cucurbit crops (cucumbers, melons,
squashes) around the world (Lisa and Lecoq, 1984). ZYMV
has been shown to outcompete other potyviruses in
establishing infections by rub inoculation (Davis and
Mizuki, 1987), natural field spread (Alderez et al. 1985;
Alderez, 1987) and aphid acquisition (Lecoq and Pitrat,
1985). In the U.S., as well as in other countries, this
virus has been responsible for crop losses of 50—100%
(Davis and Mizuki, 1986, Nameth et al., 1986, Provvidenti
et al. 1984).

Zucchini yellow mosaic virus, like other potyviruses,
is non—persistently aphid transmitted, meaning that the
virions are attached to the aphid via the stylet, and are
released within a few hours hours of acquisition (Hollings
and Brunt, 1981; Kennedy et al. 1962). For potyviruses,
aphid transmission requires the presence of a virally-
encoded protein, known as the helper component (HC), to
facilitate binding between the aphid stylet and the virion
(Thornbury and Pirone, 1983) In order for transmission of
purified virions to occur, aphids must come into contact
with the HC simultaneously or prior to the virions.
Contact with purified virions without HC or prior to HC
does not allow for aphid transmission (Sako and Okata,
1981). The presence of HC is necessary for the virions to
attach to the aphid stylet, specifically the inner
maxillary stylet (Berger and Pirone, 1986). Without HC,
virions accumulate in the gut and are not transmitted.
These studies suggest that the function of HC is to act as

 

22
a mediator of binding between the virion and the aphid

stylet.

In addition to HC, studies have determined that
potyviral aphid transmission is also controlled by the
coat protein (CP) (Pirone and Thornbury, 1984). When
studies of non—aphid transmissible (NAT) potyviral strains
were conducted, some cases were found to be due to the
lack of biologically active HC (Kassanis and Govier, 1971;
Paguio and Kuhn, 1976; Lecoq, 1976). Other cases were
attributed to some other variation within the virion. In
these instances, the helper component recovered from these
NAT strains was shown to be biologically active, and the
coat protein was suggested as the cause of non-
transmissibility (Pirone and Thornbury, 1983; Antignus et
a1. 1989).

The coat protein had been implicated in aphid
transmission from other studies; enzymatic removal of the
N—terminus of the coat protein results in loss of aphid
transmissibility (Salomon, 1989). It has also been shown
that this N—terminal domain is exposed to the surface of
the viral particle (Allison et al. 1985; Shukla et al.,
1988). Studies of the amino acid sequence of the N—
terminal domain of a NAT strain of tobacco vein mottling
virus (TVMV) were used to test the hypothesis that a
mutation in the coat protein could cause non—aphid
transmissibility (Atreya et al. 1990). The non—aphid
transmissibility of this TVMV strain was attributed to the
use of repeated mechanical “rub" inoculations for viral
propagation. A previous study demonstrated that the
propagation of aphid transmissible viruses in this manner
leads to a loss in aphid transmissibility (Swenson et a1.
1964). The amino acid sequence of this and other NAT
strains revealed a tripeptide of DAG in the N—terminal
domain which was consistently altered in NAT strains, but

 

 

 

23
not in aphid—transmissible (AT) strains (Harrison and
Robinson, 1988; Maiss et al., 1989; Quemada et al., 1990).
Further studies showed that point mutations around this
area, especially the G residue, greatly reduced or
abolished aphid transmissibility (Atreya et al., in press)

There is evidence to suggest that the extreme
competitiveness of ZYMV is due, at least in part, to
highly successful aphid transmission. Studies involving
the mixture of potyviruses with HCs other than their own
have shown that different HCs exhibit varying degrees of
specificity among viruses (Thornbury and Pirone, 1983;
Lecoq and Pitrat, 1985). While most viruses are most
efficiently transmitted by their own HC, a heterologous
mixture of watermelon mosaic virus—2 (WMV—2), ZYMV, and
WMV—2 HC established ZYMV infections three times more
often than WMV—2. (Lecoq and Pitrat, 1985). Furthermore,
field studies have shown that natural field spread from
inoculated to adjacent uninoculated squash plants was much
greater for ZYMV than for papaya ringspot virus (PRV) or
WMV—2 (Alderz et a1. 1985).

The importance of HC to the life cycle of ZYMV may
lead to a way to interfere with the infection process by
using a pathogen—derived resistance approach. Conceivably,
aphid transmission may be interfered with by expressing a
heterologous or mutant helper component. In order to
understand and manipulate the aphid transmission of
potyviruses in this way, the molecular basis of the
virion—HC—aphid stylet interactions must first be studied.
Towards this end, the molecular characterization of the
helper component of ZYMV has been undertaken and its amino
acid sequence deduced. The resulting sequence was compared
to the HC amino-acid sequences of previously characterized

potyviruses, tobacco etch virus (TEV), potato virus Y

 

 

 

 

 

 

24
(PVY), tobacco vein mottling virus (TVMV), and plum pox
virus (PPV).

The data indicates that the ZYMV HC sequence shares
conservation with the other potyviruses at the central and
3’ end of the region, but differs markedly at the 5’ end.
Furthermore, the 5’ end of the HC region has been shown to
be important to aphid transmissibility (Atreya, C.D. et
al., in press). This study demonstrated that a single
amino acid change in this region converted an aphid
transmissible potyviral strain to a non—aphid
transmissible strain. In support of this, the same amino
acid change has been found in this strain of ZYMV, which
is also non—aphid transmissible. In addition, recent HC
sequence data from other cucurbit potyviruses exhibit
similar differences at the 5’ end as this strain of ZYMV
(Baker and Grumet, personal communication). Thus, while
the majority of the HC region is conserved by all
potyviruses, the 5’ end conservation is divided among two
groups— non—cucurbits and cucurbits. Interestingly, when
the predominate aphid species vectoring the viruses within
each group was studied, it was found that all the non—
cucurbit potyviruses studied were carried primarily by the
Myzus species while the cucurbit potyviruses were carried
primarily by the Aphis species. Therefore, in addition to
the 5' end of the HC region being important in aphid
transmission, it may also play a role in vector
specificity, possibly serving as a domain for aphid

binding.

 

 

 

25
Materials and Methods

 

Cloning of the 5’ half of ZYMV
a) virion isolation

ZYMV Connecticut strain isolate (a gift from Dr. R.
Davis—Rutgers Univ.) was propagated by rub inoculation on
zucchini cotyledons (Cucurbita Pepo cv. Black Jack). Three
to five weeks after infection, virions were harvested
using the method of Grumet and Fang (1990). Deveined

infected leaves (100 g) were homogenized in a blender with
a 2:1 (wtzvol) ratio of grinding buffer (0.1 M KPO4, 10 mM

EDTA, 0.1% NaSO4, pH 7.0) and a 1:1 (wtzvol) ratio of
organic solvents (50% CHCl3, 50% CC14) at 4° C. After

filtration through cheesecloth the extract was centrifuged
for 15 min at 10,000 x g and the virus was concentrated
from the supernatant by precipitating twice with PEG 8000.
The first PEG precipitation involved the addition of 1%
Triton X—100 (v:v) for 20 minutes at 4° C, then PEG 8000
(89/100 ml) for one hour at 4° C. After centrifugation for
10 minutes at 5,000 x g, the pellet was resuspended in 1/5
vol Extraction Buffer (EB: 0.1 M KPO4 pH 7.0, 10 mM EDTA)
for 3 hrs. and clarified by centrifugation for 10 minutes
at 5,000 X g at 4° C. The second PEG precipitation
involved the addition of PEG 8000 (5g/100 ml) and 0.3M
NaCl (1.75g/100 ml) for 1—2 hr., and pelleting by
centrifugation for 10 minutes at 10,000 x g. The final PEG
pellet was resuspended in 1 ml EB overnight at 4° C, and
clarified by centrifugation for 10 minutes at 5,000 x g.
Na-azide was then added to 1mM.

The concentrated viral extract was further purified
by centrifugation through a 0—1.2M CSZSO4 step gradient
with 30% sucrose in an SW—28 Beckman swinging bucket rotor
for 4—5 hours at 100,000 x g at 4° C. The virion band was

removed by syringe and diluted in 3X vol EB. Virions were

 

 

 

 

26
concentrated by PEG precipitation (5g/100 ml PEG ,
1.75g/100 m1 NaCl), pelleted by centrifugation for 10
minutes at 5,000 x g, and resuspended in 200 ul EB and 1
mM Na—azide. Sucrose gradients were prepared in the

following way: 1.2M C32804 was made in 30% sucrose and

further diluted with 30% sucrose to make 0.4M and 0.8M
C82804 in 30% sucrose. 9 ml aliquots from each solution

were layered in a 38.5 ml Beckman SW-28 tube.
b) Viral RNA extraction

Linear sucrose gradients (7.5-30%) were prepared
according to the protocol of Yeh and Gonsalves (1985).
Briefly, diethyl pyrocarbonate (DEP) treated solutions of
60% sucrose, 0.6M NaCl, 0.06M Na—Citrate (pH 7.0), and H20
were prepared, and mixed to create solutions with final
concentrations of 7.5%, 15%, 22.5%, and 30% sucrose in
0.15M NaCl, 1 ug/ul bentonite and 0.015M Na—Citrate (pH
7.0). These solutions were layered (8 ml/solution) in a
Beckman SW-28 tube and allowed to stand overnight at 4° C.

Prior to releasing the RNA from the virions, 1 ug/ul
of bentonite (an RNAse inhibitor) was added to the
purified virion preparation. The virions were then
incubated with viral dissociation buffer (0.1M Tris pH
9.0, 1mM EDTA, 1% Sarkosyl, 0.125 ug proteinase K, 1:1
vol:vol) for 20 minutes at room temperature. Dissociated
virions were then centrifuged through the preprepared
sucrose gradients for 10 hours at 100,000 x g. The viral
RNA band (approximately 4 ml from bottom) was collected by
syringe in 2 ml fractions and placed in pre—baked, iced
Corex tubes. Viral RNA was immediately precipitated with
the addition of 0.1 vol DEP treated 2M NaOAc and 2X vol
EtOH, overnight at —20° C. After centrifugation at 10,000

rpm for 15 minutes, pellets were dried and resuspended in
100 ul DEP treated H20 on ice.

 

 

27

(0.5 kb fragment)
|

5’Ii:i|_| |___ | | AAA3’
H x
5.5 4.8 .3kb 2.0 1.0 kb

Figure 3— Restriction endonuclease map of clone Z24 (Grumet
and Fang, 1990)

E: EcoRl; H: HindIII; x: XhoI; S: SacI

***: position of the 16—mer, "1/2 way Primer"

( 5’ CTCTCTCCTGGCGGCG 3’), used to clone the 5’ of the ZYMV
RNA.

 

 

28
c) Primer synthesis
A 0.5 EcoRl fragment was subcloned from the 5’
terminus of the 5.5 kb 224 clone of ZYMV RNA (Grumet and
Fang, 1990), and partially sequenced; this data was used
to design a primer for cDNA cloning (Fig. 3). The primer
was synthesized at the Macromolecular Structure Facility

of Michigan State University.

d) Complementary DNA (cDNA) synthesis

cDNA cloning was based on the method of Gubler and
Hoffman (1983) and performed using a kit purchased from
Amersham. Double—stranded DNA was then extracted using
phenol: CHCl3: isoamyl alcohol (25:24:1), EtOH
precipitated, and treated with T4 polymerase for the
production of blunt ends. These cDNAs were then blunt-end
ligated into SmaI—cut Bluescript KS+ vectors (Stratagene)
and transformed into competent, DH5—alpha (rec A—) E. coli
cells. All transformants were then prepared for plasmid
purification using the STET boiling method (Maniatis et
al., 1989) and examined for inserts using the restriction
enzyme sites available on the Bluescript polylinker.
Clones measuring 3 kb or longer were validated as having
an origin in the Z24 0.5 EcoRl fragment by conventional
southern hybridization techniques (Maniatis et al. 1982),

using both the 0.5 fragment and the primer as probes.

e) RNA dot-blot hybridizations
The cDNA clones chosen were validated as to their

viral origin by dot—blot hybridization to the viral RNAs
of the following: ZYMV Connecticut strain, ZYMV CTl, ZYMV
CT2 (variants of original CT strain— see Chap.3), ZYMV
Pickens strain, ZYMV Orangeburg strain (gift of B.
Sammons, Monsanto Agricultural Co.), ZYMV Arkansas strain
(gift of H. Scott, Univ. Ark.), and WMV—2.

To prepare viral RNA, virions were harvested from 25

g of infected leaf material from each of the above

 

 

 

29
strains. After the second PEG precipitation, bentonite was
added to 1 ug/ul, and virions were stripped of their coat
protein by adding 1 vol RNA dissociation buffer, and
allowed to sit at room temperature for 20 minutes. This
crude RNA preparation was directly applied to nytran
filters, which were pre-wet with 0.4M Tris pH 7.6 + 2X
SSC. The filters were then dried and subjected to UV
irradiation to covalently bind the RNA. These dot—blots
were then subjected to 32P-labelled probe hybridizations

as described in Maniatis (1982).
Sequencing and analysis

a) Nested deletion clones for sequencing

Subsequent to identification and subcloning of
putative clones which spanned the helper component region,
nested deletions were performed to allow for efficient
sequencing of the entire 1.5 kb region. Two sets of
deletions were made, one originating from the 5' end of
the subclone, and the other from the 3’ end. Deletion
subclones were made using the exonuclease III and mung
bean protocol of BRL, which was based on the techniques

used by Yanisch—Perron (1985).

b) Sequencing reactions
All sequencing reactions were done using a kit from

U.S. Biochemical, with a protocol based on the Sanger
dideoxy method of DNA sequencing (Sanger, F., 1981).
Double stranded DNA, 35S—dCTP, and Sequenase v.2.0
(Stratagene) were used as reagents. Sequencing gels were
made from both conventional 8% acrylamide and 7% "Long

Ranger“ acrylamide (AT Biochem).

c) DNA sequence analysis
Sequence analyses were performed using DNASIS

software (Hitachi Software Engineering).

 

30
Results

The yield of virions was 1—5 mg/lOOg of infected,
freshly deveined leaf material. The absorbance ratio
(260/280 nm) of the virion isolations ranged from 1.2—l.35
absorbance units. The RNA purified from the sucrose
gradients was examined by gel electrophoresis and appeared
to be 10 kb in length, the approximate length of full—
length RNA. This was then used for cDNA cloning.

Fig. 3 (pg. 25) shows a map of the Z24 clone,
comprising the 3’ half of the ZYMV genome. The extreme 5'
end of this clone, a 0.5 kb EcoRI fragment, was subcloned
and sequenced. This information was used to design the
primer shown in Fig. 3. This primer was 61 bp from the 5’
end of the clone. cDNA clones, ranging from 0.5 to 4.0 kb,
were obtained (Fig 4a). Three clones, Zy2, Zy4, and Zy149,
were found to have the largest insertions and were chosen
for further study. These clones had inserts of
approximately 3.6 kb. A partial restriction map is shown

in Fig 5.

To validate the viral origin and relatedness of the
clones, each were probed with the terminal 0.5 Eco R1
fragment of Z24 using a dot blot hybridization assay. In
addition, the 2.0 kb internal fragment of clones Zy2, Zy4,
and Zy149 were subcloned and used as a probe to check for
homology to each other and Z24 (Fig. 4b). Finally, these
probes were used in RNA dot blot hybridizations to check
for homology to several strains of ZYMV (Fig 4c). As
expected, clones Zy2, Zy4, and Zy149 showed homology to
each other, to the 0.5 kb fragment of Z24, and to all
strains of ZYMV used.

All three clones were sequenced at their 3’ terminus
and found to include the 1/2 way primer sequence and the
rest of the overlap with the Z24 clone. This validated

 

 

 

31

22 147 153 154 156 16 118 4 2 149 21 19 224

 

22147153154156 16 118 4 2 149 21 19 224

    

insert size (kb):

Fig. 4a- Restriction digests of cDNAs containing the largest
inserts. Top, DNAs linearized with Bam H1; bottom, DNAs
double cut with EcoRl/BamHl.

 

 

 

32

Probe: 2.0 kb fragment of Zy 149

 

Probe: 0.5 kb fragment of Z24

 

Fig 4b- Dot blot hybridization showing the internal
homologies of cDNA clones to each other and 224. The 2.0 kb
E/B fragment of Zy 4 (depicted in fig.4a by arrow)was used
as a probe in the top figure, and the 0.5 kb frag. of 224 in
the bottom

 

 

 

 

 

 

 

 

 

 

 

33

Probe

Gym Rxmehi

Zy 149
(2.0 kb
fragment)

 

 

Fig. 4c-Dot blot hybridizations to whole plant RNA
extractions of healthy (H) and ZYMV infected plants (RI:
rub- inoculated ZYMV-CT ; CT1, CT2: aphid transmitted(AT)
ZYMV—CT strains; ARK: AT ZYMV—ARK strain; PIC: AT ZYMV—PIC
strain; ORG: AT ZYMV—ORG strain). The probes used originated
from clones containing the ZYMV-CT coat protein gene (Grumet
and Fang, 1990), Z24, and the 2.0 kb internal fragment from
Zy 4.

 

 

 

34

o 1 2 3 4kb
5’! |_|_|_||_l |__**

E E S PB H H
*******HC******* ** ___________ >

(*) 224 clone

(1/2 way primer)

Fig. 5- Partial restriction endonuclease map of Zy 2, 4, and
149. (*): approximate 5' end of all three clones. E: EcoRl;
S: SmaI; P: PstI; B: BamHl; H: HindIII. ***HC*** The area
denoting the ZYMV—HC region, and the area sequenced.

 

35

3’ Terminus

< ——————— Zy 2, 4, 149
5’ <—ACPT(3C'PT(ZA(ITIXC'FACDGEPAIEATPC(IA(IACPCI&TIXACPG
ATWPGAIITT(3TCIXTCZ\TAI§AC(3AAIPGC(IAT(§TC
A<ZAX§ACIA(§T(3C(3ACICAJPA(3CTPTCFCZXATPT<3T(3C
AC:T{PA1\A(3AIXTZXC1XACPTCPTCSClPG(3CIAIXACPT(3A
TTAAAGTGTCTGCAACGCCGCCAGGAGAGAGTGCG
1/2 way Primer Z 24——->

Fig. 6a- Sequence of the 3’ terminus of clones Zy2, 4, and
149. The overlap of the Z24 clone at its 5’ terminus is
underlined; the origin of these clones and sequence of the
1/2 way primer are in bold.

 

5’ Terminus

Origin of
Zy Clones:(149) (2) (4)

ZYMV 5’

OGUE’Q
VIDS’O
GIVE’V
WIPE)»
>P3>(1
0(32’0
piste»
8(1C)8
Qtiflri
C)5358

|
A
c;
T
T

warren-—
Fawcio
0(13’>
wrami>
0(1()Q
arakaw
nnfivra
mtdvan
+a>+a>
rears»
>r3>cd
riwrdm
erawra
aramio
rues!»
usw<3r
erariw

Fig. 6b- Sequence of the 5’ ends of Zy 2, 4 and 149. The
underlined nucleotides are the conserved bases, designated
as "Box B" (see Fig. 6c), that are generally located 40—60
bases from the beginning of the potyviral genome. The origin
of the 3 cDNA clones are depicted on top.

 

Conserved potyviral regions at 5’ terminus

13TCAACACAACATATIM 39AATCTCAAGCAATCAAGC 56
Box A Box B

Fig 6c— Conserved sequences, Boxes A and B, located at the
extreme 5' non—coding ends of TEV, TVMV, and PVY (Turpen,
1989)

 

36
their origin from the 5’ terminus of the Z24 clone (Fig
6a).

Clones Zy2, Zy4, and Zy149 were then sequenced at
their 5’ termini (Fig.6b). As depicted, each clone
terminated to within a few base pairs of each other. To
determine if these clones extended to the 5’ leader
sequence, sequence homology at the RNA level was compared
to the TEV 5’ terminus (Fig.6b). There was homology to the
"box B" sequence of the TEV 5’ terminus (40—60 bases from
the 5'end; Turpen, 1989), but not to the conserved "box A"
region (20-25 bases from the 5’ end) at the extreme 5' end
of the genome (Fig 6c). This suggests that cDNA synthesis
proceeded to within 50—100 bases of the 5’ end.

DNA sequencing of the helper component region first
involved subcloning the approximate region responsible for
this protein. Based on the position of the conserved 3' gly—
gly protein cleavage site in other potyviruses (Carrington et
al. 1989a; Oh and Carrington, 1989), it was estimated that
the 3’ terminus of the HC gene should reside approximately
2.5 kb from the 5' end of the virus. In addition, the sizes
of the HC proteins from different potyviruses, 52 to 56 kd
(Dougherty and Carrington 1988), suggested that the ZYMV HC
gene should be roughly 1500 base pairs long (@ MW/[100
MW/a.a.] X 3 bp/a.a.). Based on this information, a unique
BamHI site 2.0 kb from the 5’ end of Zy149 was subcloned and
sequenced towards the 3’ end. The conserved gly—gly cut site
was found to be about 100 base pairs away, providing evidence
that this BamHl site was near the 3’ terminus of the protein.
Fortunately, there was an EcoRl site 1.5 kb upstream of this
BamHl site. Sequencing was initiated once all the proper
subcloning and nested deletions were made. Fig. 7 shows the
positions of all nested deletions spanning the ZYMV HC

region.

 

 

 

37

mcflocwsvwm 42o you own: mcoflumawc cmumwz Ih.oah

I .
. .
a: I:

Tiliiv

Till-Titliliv

 

.n .
.nillddddl. aces can“ cams

A

 

ocu—

Craig—AEVADIII—

coca co. can our

cow gm cow can

 

 

38

 

 

 

 

 

 

 

 

 

 

 

 

1 Arrrcrrxrr‘srxr‘rrnl . AubVLAcTAATCATACA so
: R E a D : K 9 c c s c u v L s r N H T :o
51 TTGACTAAAAGATATTCAAGATTGC-ALA...Jviuni.c 1:0
:1 r K a Y s L v z a c R D D D c 40
121 At? TGAACGCGCTGCAACAGGTGTTA..- ‘L - \ --o
41 : ' L s Q v L r r s D v D H Y Ls s Q 60
:31 TCGGAAGTTCAGTTCT“’P‘ .LUALAAUL. -40
51 s 5 I Q s F D c u R a H F 3 K 5 R 9 s P 30
2:1 SATCATSTSTGCAAAGT*'AFFSFi-r~x~r~~n~ lr‘r“‘TFTTT 200
31 3 H v c ’ 7 3 H n n a E : 5 5 L A A I F :00
:01 TOTEn36CTCTATTCCCAGTAGTGGAACTATC:TGCCAAGCATGCAGAGAAAAACTTACT :50
:01 c Q A ' 5 = . v s L s c ‘ c “ K s '20
:51 AGAGTTAGCTT'CACGAATTCAAAGATTCTTTSAACGCAAACTTTATTATCCACAAGGAT 2
-21 a v a s F R D s v H a N s 1 I H K D :40
:21 *' . ""AFFFTCTF"T‘FC‘T"T'TTTTCAAATTAATCAAAGTG o
141 z u c s 5 R E c s Q 1 D u I F K L I K v ‘50
:31 ”'l‘r‘c" “"C‘C"”"“”3‘”CTC‘CATF*FAAFTTATGAAATTAGTTCACAAC 540
161 A T Q A r Q N L K L s s E v H K L v O H 130
541 "lf‘r‘“r‘r'lr”"\r‘\‘l‘f‘x \\n'r'\r‘\u-I Urr‘\\ \irrrr-r "Fr-'TCA 600
131 H T s r H H K o I D D I N K L H K c s 200
3 CAG "- " 3 550

5 0 l TTGGTTACGCAAGACGAAI .uuAL A .AuCTT""
ZOILV Q S DLALKQLLEHTQH 220

 

 

 

 

 

551 T':"'3‘r‘) AUAMHHUA_ ‘37-3u-r-r-v 7:0
22‘. F F. 2! H .‘1 H L T G E E A L K 31 :- R N K R :40
7:1 “F"‘lt‘c‘ I srrnxm—nrr—irxsaiimrrn 730
241 S S 3'. A .‘1 I N P S L L C D N Q L D K N G 260
731 ‘ ‘ ‘C‘ "‘ ‘Z'CGAA 540
261 N F V V G E R G H H S K R L F K N F F E 230
341 sar-vuvrnr'r-x: r‘ \ unr-v-rw-r-r-nnx-w-r-mg w 900
231 E V I P S E G Y T K Y V V R N F F N 300
'1' 1 CTAVTT’ HUN:I'MZAUCATTCr\CI\I\G:\AUCCACTCACA'I'K'Atil‘G'l‘hTGTCTCCCAACACAAT 1020
121 ' L C E S I E K .‘i P L T S A C V 5 J40
1021 CGAAATTATATACALltAiuLluLLuAuT IhUAALL l 1080
341 G N '1' l H S C C C V T H D D G T P H Y S 360

 

1031 GAGCTT‘ IAUAlAAAUUAULl ”"2"” 1140
361 E L K S P T K R H L V I G A 5 G D P K Y

 

 

 

 

 

1141 ATTGALLHK “‘ "" iA‘l‘TGCTAT 1200
381 I D L P A S E A E R H Y I A K E Y C Y 400
1201 CTCAATAT‘I’TTCCTCGCAATGCTTGTAAATGT‘I‘AATGAGAACGAAGCAAAGGATTTCACC 1260
401 N I F L A H L V N V N E N E A K D F T 420
1261 AMAAUALLLUAUAIUIAl 1 1320
421 K H I R D V I P M L G K H P S L t1 D V 440
1321 "C‘ ‘ ”‘TACCC 1380
441 A 'l‘ A A Y I L G V F H P E T G C A E L P 460
1J81 AUUALLLAHIL ‘ Awuiti 1440
61 R I L V H A T Q T H H V I D S Y C S L 430

‘ " " "“ ""'" “" “"TTAATTCAATTTGCCTCA 1500
L I O F A S 500

 

1441ACTGA
481TVGYHVLKAGTVNH

\I'Af'r‘l xr'xrnr'

1501 .
K H Y R v 01 c r P T o
3.

\
501HDLQSEH

Fig. 8- DNA sequence and deduced amino acid sequence of the
helper component region of ZYMV-HC. The putative 5' and 3'
cut sites of the ZYMV HC are indicated by brackets.

 

 

 

39

Fig. 8 shows the ZYMV HC sequence and deduced amino
acid sequence. Since potyviral genomes are expressed as
polyproteins that are subsequently cleaved, the 3’ and 5'
termini of the protein must be deduced from protease
consensus cut sites (Dougherty and Carrington 1988). In
the case of HC, the putative conserved Gly/Gly cleavage
site at the 3' end of this protein (Oh and Carrington,
1989) is also present in ZYMV (Fig. 8 a.a. #513). The 5’
cleavage site has just been defined as a conserved serine
residue approximately 450 amino acids upstream from the
conserved 3’ cut site (Carrington, in press). Presumably,
the serine residue at at position #58 (Fig. 8) corresponds
to this residue. Assuming that these two sites are used in
the processing of ZYMV HC, the calculated molecular weight
of the protein would be 51.9 kD.

Figure 9 shows the alignment of the HC region amino
acid sequences for ZYMV, plum pox virus (PPV; Lain et al.,
1989), tobacco etch virus (TEV; Allison et al., 1986),
tobacco vein mottling virus (TVMV; Domier et al, 1986),
potato virus Y (PVY; Thornbury et al., 1990) and PVC, a
non—aphid transmissible strain of PVY (Thornbury et al.,
1990). Analysis of conserved amino acids, defined here as
any residue shared by at least 4 of 5 potyviruses at a
given position, shows that the frequency of conserved
residues is highest at the 3’ carboxyl terminus and the
central portion of the HC region. At the 5’ amino
terminus, however, the frequency of conserved residues
diminishes noticeably. To examine these regions of amino
acid homology in a quantitative manner, the HC region was
subjectively divided into three areas: the 5’ terminus
(Region I), the central portion (Region II), and the 3’

terminus (Region III).

 

 

 

40

Figure 9- Alignment of HC region amino acid sequences for
ZYMV, PPV, TEV, TVMV, PVY, PVC (a NAT strain of PVY), CaMV,
and CaMV* (a NAT strain of CaMV). Differences between PVC and
PVY are indicated on the PVC line

* : conservation in 4/5 strains, ZYMV variable

41

5’ cleavage site|-———>

 

I

Degion

 

V
S
R
S
A
I D

 

Dan

 

ion I

J

**

 

Region I

 

 

——-Region I

 

*

42

 

I

1011

Dan

 

3

***

 

I

Dan

,ion

 

*

*

*

Region II

 

 

ion

 

II

DAN

 

**

3’

*

-—---—->|-5’ end of proteolytic domain (Carrington et al.1989)->

(306)

 

43
ion III

 

Dan

 

3

*

(336)

viEnxv1E
MLQMI
p.P.AD.A
miTnkcuS
GGGGG
DnDDnuD
Dnnwusz
MHLLL
TmiTmiT
anv.Vm1
Catrccnc
rccncncc
rechercc
SAUDID.P
HYYYY
TIVHVDRV
vivav.Y
NNNNN
nuEnGnuG
NnGNnuD
nankwnL
QKMRS
SSSSS
VmITIle
Catncclc

AEHEKR

SKNEK
TSGTS
LVIIV
PEEGG

ZYMV
PPV
TEV
PVY
PVC

 

Region III

 

*

 

III

Degion

 

*

*

 

 

Dan

 

ion III

3

*

 

Degion III

 

ZYMV V'L K A G T V'N H L I Q F A S N D L Q S E M K H Y R V G I G

’ cleavage site

 

 

44

Table 1— Conservation of amino acids in the potyviral HC

region (refers to Figure 9)

Region I (5’ terminus— a.a. #29— #211)
{— # of conserved amino acids —}
Total {Conserveda ZYMV PVY PPV TEV TVMV}

 

# of a.a 182 38 17 37 36 34 36
% of total a.a. 21% 9.3% 20% 20% 19% 20%
% of conserved a.a. 45% 97% 95% 89% 95%

Region II (Central region— a.a. #212— #279)
Total {Conserved ZYMV PVY PPV TEV TVMV}

# of a.a. 68 39 35 38 37 38 37
% of total a.a. 57% 51% 56% 54% 56% 54%
% of conserved a.a. 90% 97% 95% 97% 95%

Region III(3’ terminus— a.a. #280— #461)
Total {Conserved ZYMV PVY PPV TEV TVMV}

 

# of a.a. 182 87 79 86 81 82 81
% of total a.a. 48% 43% 47% 44% 45% 44%
% of conserved a.a. 91% 99% 93% 94% 93%

a: A conserved amino acid is defined as 4 of the 5 potyviruses
examined in a given amino acid at a particular position

45
Region I, which begins at the putative 5’ cleavage site
of the HC region (a.a. #29, Carrington et al., in press),
contains 182 residues, 38 of which are conserved (21%). As
seen in Table 1, this is the region containing the lowest

frequency of conserved amino acids. Most of the potyviral

HC sequences contain the majority of conserved residues,
except one— ZYMV. While the other potyviruses share in no
less than 34 out of 38 conserved residues (90%), ZYMV
shares in only 17 (45%). This abrupt departure from
conservation of ZYMV relative to the other potyviruses
ends at the conserved region FRNK (a.a. #212),where ZYMV
regains the same frequency of shared amino acids relative
to the other potyviruses. At this juncture, Region II
begins, spanning from a.a. #212 until a.a. #279, the point
at which Carrington et al. (1989) had determined the 5’
end of the proteolytic domain of the BC to be. Region II
contains 68 residues, 39 of which are conserved (57%). In
this region, ZYMV shares in 35 of the 39 conserved
residues (90%), only slightly less than the other
potyviruses, which range from 37—38 shared residues.
Region III comprises of the entire proteolytic domain as
defined by Carrington et al. (1989). This region contains
182 residues, 87 of which are conserved (48%). ZYMV shares
in 79 of these conserved residues (91%), again just

slightly less than the others.

Figure 10 presents HARR Plots depicting indicating
regions of nucleic acid homology between all the potyviral
HC regions. The data shows that all the potyviral HC
regions are homologous to one another at the 3’ half,
while the 5’ halves show varying degrees of homology, with
ZYMV showing the least homology within this half. This is

in agreement with the data at the amino acid level.

46

IUHU

PPV

.I'I'HU

TED?

 

 

 

ii. 1|. i|,r_l.y

w

P

\

 

B
t
4.

 

idSE

PVT!

 

.l b?

 

 

ullllrrllll l.

 

Illi~ i litii ll. 1:12

m

z

yllilblli . lrliilt

..

.

.ill4i1.ii...

 

 

nu;-

 

 

 

 

47

 

(mm ZI'UU ‘ ' l lb'I-l
‘ . __.

 

 

 

 

 

 

 

 

 

 

 

 

 

\ \ \
. \l x
1534 155.:
PVY .
l L'lfiU
1 PPV Wind 1
l
ZYMV 2 ZYMV '1
i - ’ ‘ .
J i \_
\ ‘\ \
- i
1554 I
1554 L7

 

Fig. 10— HARR plots showing nucleic acid homology between

various potyviruses

48

Discussion

The longest of the cDNA clones were shown, by
sequence analysis of the conserved 3’ G—G cleavage site
(Carrington et al., 1989a) and the putative 5’ Y—S
cleavage site (Carrington et al., in press), to contain
the ZYMV HC region (Fig. 8). The combined length of the
224, the clone spanning the 3' half of the ZYMV genome,
and Z149, the longest of the cDNA clones, measured 9.1 kb.
Relative to the lengths of other potyviruses, which range
from 9.4 kb (TVMV; Domier et al., 1986), to 9.7 kb (PPV;
Lain et al., 1989), the combined ZYMV cDNAs would appear
to be full—length. Indeed, the 5' termini of Zy2, Zy4, and
Zy149 revealed the presence of the conserved "Box B"
region (Turpen, 1989) from the potyviral leader sequence
(Fig. 6b). The "Box B" conserved region is found
approximately 40—60 base pairs from the 5’ potyviral
terminus. Since all three clones terminate in the same
area, there may be some type of secondary structure
preventing the reverse transcriptase from reading the
beginning of the leader sequence. One project underway is
to complete the cloning of the rest of the ZYMV virus
using a primer homologous to the 5’ end of the Zy149
clone. The three clones, Z24, Zy149 and the extreme 5’ end
could then be combined to produce a full—length infectious

transcript.

Figure 8 shows the DNA sequence of the ZYMV-CT HC
region and its corresponding proposed amino acid sequence.
Included is sequence information upstream and downstream
of the gene. Both the conserved 5’ Y-S cut site
(Carrington, in press) and the 3’ G—G cut site (Carrington
et al., 1989a) are present. The number of amino acids in
the ZYMV HC is 456. Its molecular weight is calculated to
be 52 kd, a value within the size ranges determined for
other potyviral HC proteins( 50—56 kd, Carrington et al.,

49
1989a; Dougherty and Carrington, 1988, Hiebert et al.,
1984; Raccah et al.,1984; Thornbury et al. 1985).

Assuming the hypothesis that HC acts as a mediator
molecule binding the virion to the aphid stylet is
correct, the functions of the HC protein are three—fold:
it acts as a protease, binds to the coat protein, and
binds to the aphid. Since the HCs of several potyviruses
have been shown to be functionally interchangeable (Sako
and Ogata, 1981; Lecoq and Pitrat, 1985), areas of
conserved sequence in the HC region may be related to the
biological activity of HC. The protease domain has been
assigned to the 3’ carboxyl region, within 180 amino acids
from the 3’ terminus (Carrington et al. 1989). This
region, designated Region III here, is well conserved
among all the potyviruses. As seen in Table 1, 48% of the
residues in this region are conserved, with the frequency
of conservation high (>90%) among all published potyviral

HC sequences.

Region II, the central region, is also well—conserved
among all published potyviral sequences, with 57% of the
residues in this region is shared by at least 4 out of 5
potyviruses. This region has a carboxyl domain upstream
from the 5’ terminus of the proteolytic domain (region
III), and an amino terminal domain 3’ from the FRNK
sequence. Since potyviruses have been shown to be aphid
transmitted with heterologous HCs (Lecoq and Pitrat,
1985), it is conceivable that a conserved region exists
within the HC protein which allows for common binding to
the virion. In addition, it is known that potyviruses can
be transmitted by several aphid species (Alderez, 1987;
Kennedy et al., 1962; Pirone and Harris, 1977; Van Hoof,
1980). Then, a conserved HC region may serve as a common
binding domain to aphid stylets. As all potyviral

sequences contain a high frequency of shared amino acids

 

50
in Region II, perhaps this region serves as a common
binding site to either the coat protein, aphid stylet, or
both.

Region I, which comprises the 5’ terminus of the HC
region, differs from Regions II & III in that it has a
relatively low percentage of conserved amino acids (21%).
Moreover, ZYMV is significantly lower relative to the
other potyviruses in the frequency of these conserved
residues (Table 1). The significance of this may be
understood by examining the function ascribed to this
region. Recent studies show that this region plays an
important role in aphid transmission. Comparative sequence
analysis of the HC region of PVY and an HC—defective, non—
aphid transmissible strain (PVC), showed two conserved
amino acid differences in the 5' half of the HC region.
One was a K—>E substitution at a.a. #83, and the other a
I->V at #259 (depicted in Fig. 9 in bold type). Further
mutational analysis studies by Atreya, C.D. et al. (in
press), has shown that the K—>E substitution at a.a. #83

of Region I results in a loss in aphid transmissibility.

In further support for this hypothesis, the strain of
potyvirus used for this study, ZYMV—CT, is non-aphid
transmissible, and has the K—>E and I—>V amino acid
substitutions at positions 84 and 259 respectively. By
coincidence, the mechanism by which both PVC and ZYMV—CT
are hypothesized to have become non—aphid transmissible is
the same: both strains were repeatedly propagated by
mechanical "rub” inoculations, a technique shown to select
for non—aphid transmissibility (Swenson et al., 1964).
Conceivably, the lack of transmissibility could be due to
changes in the CP, HC, or both. The CP of this strain,
however, contains the conserved tripeptide DAG (Grumet and
Fang, 1990),sfihédhtbahabeebeshmwnnbo—bphathradsmnsshb1éPss

of other non—aphid transmissible potyviral strains

 

51
(Atreya, P.F. in press). Clearly, it is of interest to
determine whether the HC of ZYMV—CT is biologically
active; this will be addressed in the Addendum. So far,
sequence analysis suggests that, due to the K—>E and I—>V
substitutions found in Region I of the ZYMV—CT HC, the HC

is probably inactive.

Given that Region I is important to aphid
transmissibility, there may be differences between the way
by which ZYMV is aphid transmitted relative to the other
potyviruses that explains the divergence of shared amino
acids in this region. Recent data indicates that ZYMV—CT
is not alone in differing from the other potyviruses in
the type and frequency of residues which are conserved in
the 5’ terminus. It has been noted at a recent meeting
(R.Grumet, personal communication) that two other strains
of ZYMV, ZYMV—FL and ZYMV—CA, and papaya ringspot virus
type W (PRV—W) share virtually the same sequence in the HC
region as does ZYMV—CT, even with the homology differences
at the 5’ end (C. Baker, personal communication) Because
the published sequences are not available at this time,
amino acid comparisons are not depicted in fig. 9.
However, it appears there are two groups of potyviruses
that share sequence similarity in Region I of the HC: the
cucurbit potyviruses (ZYMV and PRV—W) and the non—cucurbit
potyviruses (PVY, PPV, TVMV and TEV). Interestingly, there
is a correlation between these two groups and the
predominate aphid species which vectors the potyviruses in
each group. The cucurbit potyviruses are mainly carried by
the Aphis species (Alderz, 1987), while the other group,
which have either solanaceous (TEV, TVMV, and PVY) or
prunus (PPV) hosts, are primarily carried by the green
peach aphid, Myzus persicae (Van Hoof, 1980; Kennedy et
al., 1962; Pirone and Harris, 1977). Thus, perhaps Region

I may have a role in defining vector specificity.

52

The amino acid change at position 83 (K—>E), for both
PVC and ZYMV and at 81 (C—>V), for ZYMV, when examined
more closely, may shed some light as to the mechanism of
aphid binding. Both these changes occur in a conserved
cysteine-rich region. Robaglia et al. (1989) has found
that similar regions found in the HC sequence of the
tobacco veinal necrosis strain of PVY, PVYn, are similar
to sequences found in proteins known to form “zinc
fingers", and may be possible metal binding sites. Indeed,
in vitro activity of HC is known to require Mg++ ions
(Raccah and Pirone, 1984). If this conserved cys—rich
region is a metal binding site, a change from a basic
amino acid to an acidic amino acid and/or a change from an
essential cys to a nonpolar amino acid may render the site
inactive. These sites are prime candidates for in vitro
mutagenesis once an infectious in vitro full—length

transcript for ZYMV can be produced.

It is possible that the competitiveness of ZYMV for
aphid transmission may lie in the specific amino acid
changes in the highly conserved regions. These changes may
cause the HC to bind better to the virion or to its aphid
vector. A way to study this would be to generate a full—
length infectious transcript of ZYMV and generate site—
directed mutations to screen for mutants deficient in
aphid binding or virion binding. In this way, the putative
binding domains will be able to be mapped. Another
possibility is to create “pseudo—recombinants“, using
regions of DNA from an AT isolate of ZYMV and splicing it
into the homologous DNA region of the NAT isolate. This is
readily feasible, since there are convenient restriction

sites which can cut out the majority of the HC.

53

CHAPTER 3

Addendum

54

One area of interest in the study of potyvirus
biology is to determine the protein domains responsible
for aphid transmission. Past studies have determined that
potyvirus aphid transmission is in part controlled by two
viral—encoded proteins, the helper component (HC) and the
coat protein (CP) (Pirone and Thornbury, 1984). When
studies of non—aphid transmissible (NAT) potyviral strains
were conducted, some cases were found to be due to the
lack of biologically active HC (Kassanis and Govier, 1971;
Paguio and Kuhn, 1976; Lecoq, 1976). Other cases were
attributed to some other variation within the virion. In
these instances, the helper component recovered from these
NAT strains was shown to be biologically active, and the
coat protein was suggested as the cause of non—
transmissibility (Pirone and Thornbury, 1983; Antignus et
al. 1989).

The coat protein had been implicated in aphid
transmission from other studies; enzymatic removal of the
N—terminus of the coat protein results in loss of aphid
transmissibility (Salomon, 1989). It has also been shown
that this N—terminal domain is exposed to the surface of
the viral particle (Allison et al. 1985; Shukla et al.,
1988). Studies of the amino acid sequence of the N—
terminal domain of a NAT strain of tobacco vein mottling
virus (TVMV) were used to test the hypothesis that a
mutation in the coat protein could cause non—aphid
transmissibility (Atreya et al. 1990). The non—aphid
transmissibility of this TVMV strain was attributed to the
use of repeated mechanical "rub" inoculations on the
cotyledons of test plants for viral propagation. A
previous study demonstrated that aphid transmissible
viruses propagated in this manner leads to the loss in
aphid transmissibility (Swenson et al. 1964). The amino
acid sequence of this and other NAT strains revealed a

tripeptide of DAG in the N—terminal domain which was

 

55
consistently altered in NAT strains, but not in aphid-
transmissible (AT) strains (Harrison and Robinson, 1988;
Maiss et al., 1989; Quemada et al., 1990). Further studies
have shown that point mutations around this area,
especially the G residue, greatly reduced or abolished

aphid transmissibility (Atreya et al., in press)

The Connecticut (CT) strain used in our laboratory
was found to have an unaltered DAG region in the coat
protein (Grumet and Fang, 1990). However, upon aphid
transmission assays, the CT strain was found to be either
non—aphid transmissible or extremely delayed in exhibiting
symptoms when compared to other strains. Therefore, the
site of alteration causing this non—aphid transmissibility
is at a location other than the DAG region of the coat
protein. It could be at another region within the coat
protein or within the helper component. This addendum
outlines a series of experiments to locate the site of

these alterations.

The following ZYMV strains were used as a control
for aphid transmission: Orangeburg (ORG), Pickens (PIC)
and Arkansas (ARK). These strains exhibited symptoms
within 2—4 weeks following aphid transmission assays
(Table 2). Test zucchini plants aphid inoculated with the
CT strain, on the other hand, usually died within 4—5
months without exhibiting symptoms. Fortunately, two
plants which managed to survive past this time showed
symptoms at 6 months. Previous to these studies, this CT
strain was propagated for many generations by rub
inoculation, while the other strains were propagated by
aphid transmission. It may well be that the CT strain had
lost the ability to aphid transmit because of this, and

56

TABLE 2
Aphid transmission of various ZYMV strains

ZYMV Strain Symptom Onset Description of Symptoms
ARK 2—4 wks extremely severe, malformed, spiny
leaves, stunted growth

PIC 2—4 wks severe leaf mosaic and chlorosis

leaves distorted

ORG 2—4 wks severe leaf mosaic, chlorosis,

slight enations, leaves distorted

CT 6 mo. least severe mosaic and chlorotic

symptoms, leaves distorted

CT—l 2—4 wks least severe mosaic and chlorotic

symptoms, leaves distorted

CT—2 2—4 wks least severe mosaic and chlorotic

symptoms, leaves distorted

Janus -

 

57
that, somehow, some variant of the strain had multiplied
enough to infect the plant by six month’s time. The
variant CT strains collected from the two plants were
labelled CT1 and CT2. Upon subsequent aphid transmission,
both CT1 and CT2 showed classic CT symptoms 2—4 weeks

after initial infection.

Since the ZYMV-CT strain contains the conserved DAG
region in the coat protein, locating the site of the
variance could lead to an additional area of significance
concerning aphid transmissibility. It is conceivable that
this variance could be occurring within the coat protein
or the helper component. For this question, a set of
mixing experiments involving the isolation of the virions
and helper component from both the AT CT1 and CT2 strains
and NAT CT strain is proposed (fig. 10).

The main idea behind these experiments is to
determine which component, the virion or the HC, is
responsible for causing the deficiency in aphid
transmission in the NAT CT. For example, if there is a
variation in the coat protein, the mixing of the NAT
virion with the AT helper component should not allow the
aphid to successfully transmit the virus, while the mixing
of the NAT HC with the AT virions should produce normal

aphid transmission. Fig. 9 outlines the experiment.

Methods

1) aphid feeding: Aphids should be starved 3—4 hrs.
before being allowed to feed on a 20% sucrose solution
containing the above mixtures. Feeding should occur
through a parafilm—covered sachet, with 15—min.
acquisition times. Aphids should be allowed to feed on
healthy zucchini plants for 2—4 hrs. before being
killed mechanically and removed. Plants are then
sprayed to ensure complete eradication of aphids.

virion isolation: Virions should be isolated in a
similar fashion previously described in materials and
methods

2

V

 

58

MIXING EXPERIMENTS

 

Source Isolations
Non—Aphid Transmissible ————— > virion
CT strain ————— > HC-enriched plant sap (HC)
Aphid—Transmissible ————— > virion*
Revertants (CT1 & CT2) ————— > HC—enriched plant sap (HC*)
Aphid—Transmissible ————— > virion—c
Control (ZYMV-ARK) ————— > HC—enriched plant sap (HC-c)
aphid feeding rub inoculation & results
solutions ——> aphid transmission——> RI AT
A. Controls
1) virion + HC Inf. No inf.
2) virion* + HC* I I
3) virion—c + HC—c I I
4) virion, virion*,
or virion—c I NI
5) HC, HC*, or HC-c NI NI
B. Mixes virion _Q
6) virion + HC* I NI I
7) virion + HC—c I NI I
8) virion* + HC—c I I I
9) virion* + HC I I NI
10) virion—c + HC I I N1
11) virion-c + HC* I I I

Figure 11- Mixing Experiments to determine source of
variation in a revertant form of a non-aphid transmissible
ZYMV—CT strain

 

 

59
3) helper component enriched plant sap: Crude HC-enriched
plant sap should be made by methods similar to Sako &
Ogata (1981). Briefly, this includes grinding 3g of 3—
4 wk. old infected leaf tissue in 10 m1 0.3M KZHPO4

pH9; centrifugation at 3,500 x g for 10 min.;
centrifugation at 150,000 x g for 3 hr.; use upper
supernatant as virion—free, HC extract.

If the variation is occurring within the helper
component protein, then HC would be inactive, rendering
the mixes with both the virion* and virion—c non—aphid
transmissible. Meanwhile, HC* would show symptoms when
mixed with the NAT virions. The opposite would occur if
the source of the variation resided within the virion coat
protein. If the variation is occurring on both the virion
and HC, then both the NAT virion and NAT HC mixed with the
complementary HC—c or virion-c would not show aphid

transmission.

Once the region of this variation has been
identified, mutants can be made from either the coat
protein or the helper component from the AT strain to
identify the exact location of the mutation. In addition,
the area in question can be sequenced in both the NAT and
AT revertant strains to reveal the nature of the base pair

differences.

Another issue facing investigators in the field of
potyviral aphid transmission involves the exact mechanism
by which helper component acts. Since it has been
demonstrated that HC is responsible for the virion’s
ability to bind to the aphid stylet (Berger and Pirone,
1986), the next question which must be answered is to the
location on the virion and/or aphid stylet HC binds to.
With this work, it should now be possible to clone a
functional HC protein; in fact, a primer has been made
(fig. 12), which includes a restriction site exactly at
the 3’ cut site, for direct cloning into an expression

vector. The cloning of a functional HC gene can lead to

 

60

gly—gly cut site
|

V
ZYMV 5' AT”TA(IA(3A(3TTW3GCFG IG1\A(IA(IC1\A(ZA(3A 3’
RG 14 primer* TACAGAGTTGGTG GTACCCCAACACA

A

Kpn restriction site

Fig.12— Primer at the 3’ terminus of the ZYMV-CT HC with a
Kpn restriction site. *Note: RG14 primer made is
complementary to the one above:

RG14: 5’ TGTGTTGGGGTACCACCAACTCTGTA 3’

61
deletion analysis studies and to the production of HC
protein (functional or mutant) for binding studies. In
addition, antibodies may also be raised specifically
against the HC protein and be used for a number or
purposes. Finally, large scale HC purification can be
attempted using the anti—HC proteins and immuno—affinity

columns.

Once a quantity of functional HC protein is made,
studies to find physical evidence for the binding of HC to
the virion can be undertaken. For example, protein—
interactions can be investigated through size
chromatography. The HC can be shown to bind to either the
virion or to individual coat protein subunits if,
subsequent to the mixing of HC and virion/ or coat
protein, there is evidence of a third, larger fraction
comprising of the bound proteins in addition to the
individual fractions. These fractions can be visualized
through PAGE. In a different experiment, the HC can be
immobilized for a binding assay to virions and/or aphid
stylets. Anti—HC protein can then be used to inhibit
binding. If HC acts as a type of ”sandwich" between the
two, then anti—HC should inhibit binding to the virion and
the stylet individually, or together. In addition, anti—
coat protein (CP) can be utilized to ascertain whether HC
is binding to any exposed RNA portion of the virion or to
other exposed proteins, such as the vPG. If anti—CP does
not inhibit binding, this conceivably could be happening.
Furthermore, there is circumstantial evidence that HC may
bind to RNA. According to one method of purification of
TEV HC, the final step in this process involved HC binding
to an oligo—dT affinity column, leading to speculation
that the HC may be binding to the RNA (Thornbury et al.
1985). To study this, gel retardation assays involving the
binding of the RNA with the HC can be performed. Again, a

 

62
third, larger band representing the binding of RNA to the

HC would be evidence of the interaction.

For future experiments, mutant HC can be constructed
that are deficient in binding to either the virion or
aphid stylet. These can then be inserted transgenically
into plants to test for protection against the aphid
spread of this disease. Theoretically, the titration
effects of utilizing the available binding sites will

prevent the functional HC from performing properly.

63
BIBLIOGRAPHY

ALDERZ, W.C. (1987). Cucurbit potyvirus transmission by
alate aphids trapped alive. J. Econ. Entomol. 80:87—92.

ALDERZ, W.C., ELSTROM, G.W., and PURCIFULL, D.E. (1985).
Response of ’Multipik’ squash to mosaic virus infection
Hort Sci. 20: 892—893

ALLISON, R.F., JOHNSTON, R.E., and DOUGHERTY, W.G.
(1986). The nucleotide sequence of the coding region of
tobacco etch virus genomic RNA: Evidence for the
synthesis of a single polyprotein. Virology 154: 9—20

ALLISON, R.F., DOUGERTY, W.G., PARKS, T.D., and
ARMSTRONG, F.G. (1985) Biochemical analysis of the
capsid protein gene andcapsid protein of tobacco etch
virus: N—terminal amino acids are located on the
virion’s surface. Virology 147:309—316

ANTIGNUS, B., RACCAH, B., ON, A., and COHEN, s. (1989)
Biological and serological characterization of zucchini
yellow mosaic virus and watermelon mosaic virus—2
isolates in Israel. Phytoparasitica 17:289—298

ARMOUR, S.L., MELCHER, U., PIRONE, T.P., and ESSENBERG,
R.C. (1983) Helper component for aphid transmission
encoded by region II of cauliflower mosaic virus DNA.
Virology 129:25—30

ATREYA, C., RACCAH, B. and PIRONE, T.P. (1990) A point
mutation in the coat protein abolishes aphid
transmissibility of a potyvirus Virology 178:161—165

ATREYA, C.D., FRITZO, M.L., ATREYA. P.L., THORNBURY, D.W.
and PIRONE, T.P. (1991) Mutational analysis of
potyvirus helper component activity (Abstract) 1991 APS
Annual Meeting

ATREYA, P.L., ATREYA. C.D., and PIRONE, T.P. (1991) Amino
acid substitutions in the coat protein result in loss
of insect transmissibility Of a plant virus (Abstract)
1991 APS Annual Meeting

BALAZS, E., GUILLEY, H., JONARD, G., and RICHARDS, K.
(1982). Nucleotide sequence of DNA from an altered—
Virulence isolate D/H of the cauliflower mosaic virus
Gene 19:239—249

BAKER, C.A., WISLER, G.C., HIEBERT, E., and LECOQ, H.
(1991, in press) Sequence analysis at the 5' end of
three cucurbit potyviruses (Abs) 1991 APS Meeting

 

 

64

BAZAN,J.F. and FLETTERICK, R.J. (1988). Viral cysteine
proteases are homologous to the trypsin—like family of
serine proteases: Structural and functional
implications. Proc. Natl. Acad. Sci. USA 82: 3969—3972

BEACHY, R.N., FRIES, S.L., and TUMER, N.E. (1990) Coat
protein—mediated resistance against virus infection.
Ann. Rev. Phytopath. 28:451—474

BERGER, P. H., and PIRONE, T.P. (1986). The effect of
helper component on the uptake and localization of
potyvirus in Myzus persicae. Virology 153:256-261

BERGER, P.H., HUNT, A.G., DOMIER, L.L., HELLMANN, G.M.,
STRAM, Y., THORNBURY, D.W., and PIRONE, T.P. (1989)
Expression in transgenic plants of a viral gene product
that mediates insect transmission of potyviruses Proc.
Natl. Acad. Sci. USA 86:8402—8406

BRADLEY, R.H.E., (1964) Aphid transmission of stylet—
borne viruses. In Plant Virology, pp. 148—174 Univ. of
Florida Press

CARRINGTON, J.C., and DOUGHERTY, W.G. (1987). Small
nuclear inclusion protein encoded by a plant potyvirus
genome is a protease. J. Virology 61: 2540—2548

CARRINGTON, J.C., and DOUGHERTY, W.G. (1987). Processing
of the tobacco etch virus 49 kD protease requires
autoproteolysis. Virology 160: 355-362

CARRINGTON, J.C., and DOUGHERTY, W.G. (1988). Mutational
analysis of tobacco etch virus polyprotein processing;
Cis and trans proteolytic activities of polyproteins
containing the 49 kDa proteinase. J. Virol.

CARRINGTON, J.C., CARY, s., PARKS, T.D., and DOUGHERTY,
W.G. (1989a) A second proteinase encoded by a plant
potyvirus genome. EMBO J. 8: 365—362

CARRINGTON, J.C., FREED, D.D., and SANDERS, T.C. (1989b)
Autocatalytic Processing of potyvirus helper component
in E. Coli and In Vitro. J. Virology 63: 4459—4463

CARRINGTON, J.C., and FREED, D. D. (1990). Cap-
independant enhancement of translation by a plant
potyvirus 5’ nontranslated region. J. Virol.64:1590—
1597

CHRISTIE, R.G. and EDWARDSON, J.R. (1977). Light and
electron microscopy of plant viral inclusions. Fla.
Agric. Exp. Stn. Monogr. Sr. IX. 150pp.

 

65
DAVIS, R.F. (1986). Partial characterization of zucchini
yellows mosaic virus isolated from squash in Turkey.
Plant Disease 70:735-738

DAVIS, R.F., and MIZUKI, M.K. (1986). Detection of
cucurbit Viruses in New Jersey Plant Disease 71:40

DAVIS, R.F., and MIZUKI, M.K. (1987). Detection of
cucurbit viruses in New Jersey. Plant Disease 71:40-44

DeMEJIA, M.V.G., HIEBERT, E., and PURCIFUL, D.E. (1985)
Identification of potyvirus amorphous inclusion protein
as a nonstructural virus—specific protein related to
helper component. Virology 142:34-43

DOMIER, L.L., FRANKLIN, K.M., SHAHABUDDIN, M., and
RHOADS, R.E. (1986). The nucleotide sequence of tobacco
vein mottling virus RNA. Nucleic Acids Res. 14: 5417-
5430

DOMIER, L.L., SHAW, J.G., and RHOADS, R.E. (1987).
Potyviral proteins share amino acid sequence homology
with picorna—, comO-, and caulimoviral proteins.
Virology 158:20—27

DOMIER, L.L., FRANKLIN, K.M., HUNT, A.G., RHOADS, R.E.,
and SHAW, J.G. (1989) Infectious in vitro transcripts
from cloned cDNA of a potyvirus, tobacco vein mottling
virus. Proc Natl Acad Sci. 86: 3509—3513

DOUGHERTY, W.G., WILLIS, L., JOHNSTON, W.E. (1985).
Topographic analysis of tobacco etch virus capsid
protein epitopes. Virology 144:66-72

DOUGHERTY, W.G. and CARRINGTON, J.C. (1988). Expression
and function of potyviral gene products. Ann. Rev.
Phytopath. 26: 123—143

DOUGERTY, W.G. and HIEBERT, E. (1980) Translation of
potyvirus RNA in a rabbit reticulocyte lysate. Virology
104: 183

FRANCKI, R.I., MILNE, R.G. and HATTA, T. (1985) in Atlas
of Plant Viruses Vol II. CRC Press, Boca Raton, FL

GERA, A., LOEBENSTEIN, G., and RACAH, B. (1979). Protein
coats of two strains Of cucumber mosaic virus affect
transmission by Aphis gossypii. Phytopathology 69:396-
399

GRUMET, R., SANFORD, J.C., and JOHNSTON, S.A. (1987) In
Molecular Strategies for Crop Protection Alan R. Liss,
New York

 

 

66
GRUMET, R., and FANG, G. (1990). cDNA cloning and
sequence analysis of the 3’-terminal region of zucchini
yellow mosaic virus RNA. J. Gen. Virol. 71: 1619-1622

GRUMET, R. (1990) Genetically engineered Plant Virus
Resistance. HortSci 25:508—513

GUBLER, U. and HOFFMAN, B.J. (1983). A simple and very
efficient method for generating cDNA libraries. GENE
25: 263—269

GOVIER, D.A., and KASSANIS, B. (1974). A virus—induced
component of plant sap is needed when aphids acquire
potato virus Y from purified preparations. Virology
61:420—426

HARI, V. (1981). The RNA of tobacco etch virus: Further
characterization and detection of a protein linked to
the RNA. Virology 112:391—399

HARRISON, B.D., and ROBINSON, D.J. (1988) Molecular
variation in vector—borne viruses: Epidemiological
significance. Philos. Trans. R. Soc. London B 321:447—
462

HIEBERT, E., THORNBURY, D.W., PIRONE, T.P. (1984).
Immunoprecipitation analysis of potyviral in vitro
translation products using antisera to helper component
of tobacco vein mottling virus and potato virus Y.
Virology 135:1-9

HIEBERT, E., and MCDONALD, J.G. (1973). Characterization
of some proteins associated with viruses in the potato
virus Y group. Virology 56:349-361

HOLLINGS, M. and BRUNT, A.A. (1981) Potyviruses. in
Handbook of Plant Virus Infections and Comparative
Diagnosis, Kurstak, E., ed., Elsevier Amsterdam 731

HULL, R. (1977). Particle differences related to the
aphid—transmissibility of a plant virus. J. Gen.
Virol.34:183-187

KATIS, N., CARPENTER, J.M., and GIBSON, R.W. (1986).
Interference between potyviruses during aphid
transmission. Plant Pathology 35:152-157

KATIS, N., and GIBSON, R.W. (1985)Transmission of potato
virus Y by cereal aphids. Potato Research 28:65—70

KASSANIS, B., and GOVIER,D.A. (1971) New evidence on the
mechanism of transmission Of potato virus C ans potato
aucuba mosaic virus J. Gen. Virol. 10:99-101

67
KENNEDY, J.S., DAY, M.F., and ESOP,.V.F. (1962) A
conspectus of aphids as vectors of plant viruses.
Entomolgia experimentalis et applicata 1: 50—56

LAIN, S., REICHMANN, J.L., and GARCIA, J.A. (1989). The
complete nucleotide sequence of plum pox potyvirus RNA.
Virus Reasearch 13: 157-172

LECOQ, H. and PITRAT, M. (1985). Specificity of the
helper component— mediated aphid transmission of three
potyviruses infecting muskmelon. Phytopatology 75:890-
893

LECOQ, H. (1986) A poorly aphid transmissible variant of
zucchini yellow mosaic virus. Phytopathology 76:1063
(Abstract)

LIM, W.L. and HAGEDORN, D.J. (1977). Scanning electron
microscope localization of virus or virus coat protein
an aphid stylets by labelled antibody techniques. Proc
Am Phytopath Soc 3:247

LISA, V. and LECOQ, H. (1984). Zucchini Yellow Mosaic
Virus. CMI/AAB Descriptions of Plant Viruses, no. 282

LISA, v., BOCCARDO, G., D’AGOSTINO, G., DELLAVALLE, G.,
and D'AQUILIO, M. (1981) Characterization of a
potyvirus that causes zucchini mosaic. Phytopathology
571:667-672

MAISS, E., TIMPE, U., BRISSKE, A.,JELKMANN, W., and
KATINGER, H.W.D. (1989) The complete nucleotide
sequence of plum pox virus RNA. J. Gen. Virol.70: 513—
524

MANIATIS, T., FRITSCH,E.F., and SAMBROOK, J. (1982)
Molecular Cloning: A Laboratory Manual. New York: Cold
Spring Harbor Laboratory

MARKHAM, P.G., PINNER, M.S., RACCAH, B. and HULL, R.
(1987) The acquisition of a caulimovirus by different
aphid species: comparison with a potyvirus Ann. Appl
Biol 111:571-587

McLEOD, P.J., SCOTT, H.A., MORELOCK, T.E. (1986). Squash
mosaic virus (serotype—l) isolated from cucurbita
foetidissima in NW Arkansas Arkansas Farm Res 13:157

NAMETH, S.T., DODDS,J.A., and LAEMMLEN, F.F. (1986)
Cucurbit viruses of California— an ever changing
problem Plant Disease 70:80

68
MORROW, C.D., NAVAB, M., PETERSON, C., HOCKO, J., and
DASGUPTA, A. (1984). Antibody to poliovirus genome-
linked protein (VPg) precipitates an in vitro
synthesized RNA attached to VPg precursor
polypeptide(s). Virus Res. 1:89-100

OH, C-S and CARRINGTON, J. C. (1989). Identification of
essential residuesin potyvirus proteinase HC-Pro by
site-directed mutagenesis. Virology 173:692-699

QUEMADA, H., L’HOSTIS, B., GONSALVES, D., REARDON, I.M.,
SIEW, L.C., and SLIGHTOM, J.L. (1990) The nucleotide
sequences of the 3' terminal regions of papaya ringspot
virus strains W and P. J. Gen Virol. 71:203-210

PAGUIO, O.R., and KUHN, C.W. (1976). Aphidtransmission of
peanut mottle virus. Phytopathology 66:473-476

PIRONE, T.P. and THORNBURY, D.W. (1983). Role of virion
and helper component in regulating aphid transmission
of tobacco etch Virus. Phytopathology 73:872—875

PIRONE, T.P. and HARRIS, K.F. (1977). Non-persistent
transmission of plant Viruses by aphids. Annual Rev
Phytopathol 15:55-73

PROVVIDENTI, R., GONSALVES, D., and HUMAYDAN, H.S. (1984)
Occurence of zucchini yellow mosaic virus in cucurbits
from CT, NY, FL & CA Plant Disease 68:443

PURCIFULL, D., EDWARDSON, J., HIEBERT, E. and GONSALVES,
D. (1984). Papaya ringspot virus. CMI/AAB Descriptions
of Plant Viruses, no.224

RACCAH, B., and PIRONE, T.P. (1984) Characteristics of
and factors affecting helper component mediated aphid
transmission of a potyvirus Phtopath. 74:305—309

ROBAGLIA, C., DURAND-TARDIF, M., and CASSIE-DELBART,F.

(1989) Nucleotide sequence of potato virus Yn genomic
RNA J.Gen Virol 70:935—947

ROCHOW, W.F. (1970) Barley yellow dwarf Virus: Phenotypic
mixing and vector specificity. Science 167:875-878

SAKO, N. and OGATA, K. (1981). Different helper factors
associated with aphid transmission of some potyviruses.
Virology112:762—765

SALOMON, R. (1989) A possible mechanism for exclusion of
plant viruses from embryonic and meristem tissues Res
Virol 140:453-460

69

SANGER, F. (1981). Determination of nucleotide sequences
in DNA. Science 214:1205-1210

SANFORD, J.C. and JOHNSTON, S.A. (1985) The concept of
parasite-derived resistance— Deriving resistance genes
from the parasite’s own genome. J. Theor. Biol.
113:395—404

SHUKLA, D.D., STRIKE, P.M., TRACY, S.L., GOUGH, K.H., and
WARD, C.W. 1988. The N- and C- termini of the coat
protein of potyviruses and the N-terminus contains the
major virus—specific epitopes. J. Gen. Virol.

SIAW, M.F., SHAHABUDDIN, M. BALLARD, S., SHAW, J., and
RHOADS, R.E. (1985). Identification of a protein
covalently linked to the 5'-terminus of tobacco vein
mottling virus RNA. Virology 142:134—143

SWENSON, K.G., SOHI, 3.8., and WELTON, R.E. (1964) Loss
in transmissibility by aphids of bean yellow mosaic
virus. Ann. Entomol. Soc. Amer. 57:378-382

SYLVESTER, E.S. (1956). Beet Yellows Virus transmission
by the green peach aphid. J. Econ Entomol. 49:789—800

THORNBURY, D.W., and PIRONE, T.P. (1983) Helper
components of two potyviruses are serologically
distinct. Virology 125: 487—490

THORNBURY, D.W., HELLMANN, G.M., RHOADS, R.E., and
PIRONE, T.P. (1985). Purification and characterization
of potyvirus helper component. Virology 144:260-267

THORNBURY, D.W., PATTERSON, C.A., DESSENS, J.T., and
PIRONE, T.P. (1990). Comparative sequence of the helper
component (HC) region of potato virus Y and an HC-
defective strain, PVC. Virology 178:573—578

TURPEN, T. (1989). Molecular cloning of a potato virus Y
genome: Nucleotide sequence homology in non-coding
regions Of potyviruses. J. Gen. Virol. 70:1951—1960

VARTAPETIAN, A.B., KOONIN, E.V., AGOL,V.I., and BOGDANOV,
A.A. (1984). Encephalomyocarditis virus RNA synthesis
in vitro is protein—primed. EMBO J. 3:2593—2598

VAN HOOF, H.A. (1980) Aphid vectors of potato virus Yn.
Netherlands J Plant Path 86: 159-162

WALKEY, D.G.A. (1985) in Applied Plant Virology John
Wiley & Sons, New York NY pp.162-165

 

 

7O
WATSON, M.A., and ROBERTS, F.M. (1939) A comparative
study Of the transmission of Hyoscyamus virus 3, potato
virus Y and cucumber mosaic virus I by the vectors
M.persicae, M. circumflexous, and M. gei. Proc. Royal
Soc. B125:144—170

WOOLSTON,C.J., CZAPLEWSKI,L., and DAVIES,J. (1987)
Location and sequence of a region of CaMV gene II
responsible for aphid transmissibility Virology
160:246-241

YANISCH—PERRON, C., VIEIRA, J., and MESSING, J. (1985).
Improved M13 phage cloning vectors and host strains:
nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene 33:103-119

YEH, S.D., and GONSALVES, D. (1985). Translation of
papaya ringspot virus RNA in vitro: detection of a
possible polyprotein that is processed for capsid
protein, cylindrical—inclusion protein, and amorphous—
inclusion protein. Virology 143: 260—271.

 

 

 

 

 

 

 

 

 

 

 

"V ,r".
’ .1

 

 

'.'.'.......u_
Nut.

“.7...
..,. .. ,:

‘ ..":;"13’..

v
H .. {up-m)
. ....,"...L..A'..... ...:-..
l~fl ”11,20. ‘a‘.

HICHICQN

STQTE UNIV