v
_. m
..c'~‘
'5‘, .. » I
v

‘

Auk“ ¢
. u "I
«-

,
fl «1,: ~ ‘
Inhmmfi'“
It"! . " ’ “

-,,, hm
. u r

¢ I ’ ‘ ‘
,‘UVW'

 

 

 

 

 

 

»:.,
Lv-d‘E-z'l-

 

~‘“..‘..‘ . -l
M. , A.
\.L

”Cm

.m
“:3
.w»

.m.
, 6".

~14“:
5/" ~

“7:;
.n. \W‘I‘VU‘ ~

,
.I ‘f'

 

. U.
: vqfi'

‘Jw
.21.“
.' 1"

“UH:-
.uw‘
_ .4 r

w H,4.
\\“ (
“Hr.“ "'4”
. w:

, ...-.

”‘1'.“
H M .w.

1 ' ‘

 

 

ER ITY LIBRARIES

llillll\il\\ii\\e\\\il'l\\\\\l\\\\\\l\\\\\\\\\\\\\\\\ ‘

3 1293 00908 922

 

 

 

\\

This is to certify that the

dissertation entitled

MOLECULAR GENETIC APPROACHES TOWARDS THE UNDERSTANDING
OF HETEROCYST DIFFERENTIATION AND PATTERN FORMATION
IN THE CYANOBACTERIUM Anabaena SP.

presented by

Yuping Cai

has been accepted towards fulfillment
of the requirements for

the Ph.D. degreein Botany & Plant Pathology

 

(:EFLLA;;:EEIE§%3:PNQH;

Major professor

Date cm: ”W

MS U is an Affirmative Action/Equal Opportunity Institution 0- 12771

 

 

 

 

LSERARY i

1Miei‘iiggar‘i “We 5
L Universiiy I]

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.

 

DATE DUE DATE DUE DATE DUE

 

“1333 ‘9”.
11045291556

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

MSU Is An Affirmative Action/Equal Opportunity Institution

c:\clrc\datedua. DmSHM

MOLECULAR GENETIC APPROACHES TOWARDS THE
UNDERSTANDING OF HETEROCYST DIFFERENTIATION
AND PATTERN FORMATION IN THE
CYANOBACTERIUM Anabaena SP.

By

Yuping Cai

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Botany and Plant Pathology.
and
MSU-DOE Plant Research Laboratory

1991

680 ’sl/oi

ABSTRACT

MOLECULAR GENETIC APPROACHES TOWARDS THE
UNDERSTANDING OF HETEROCYST DIFFERENTIATION
AND PATTERN FORMATION IN THE
CYANOBACTERIUM Anabaena SP.

By

Yuping Cai

Certain cyanobacteria (blue-green algae) are the only free-living
prokaryotes capable of both oxygenic (higher-plant type) photosynthesis and
aerobic nitrogen fixation. Anabaena spp. are of developmental interest because,
when deprived of fixed nitrogen, they differentiate to form N2-fixing cells called
heterocysts in a patterned array along the cyanobacterial filaments.

In order to facilitate analysis of the development of Anabaena spp., a
positive selection system for gene replacement was developed. The conditionally
lethal gene $308 from Bacillus subtilis is inserted into the vector portion of a
suicide plasmid bearing a mutant version of a chromosomal gene. Cells in which
such a plasmid has integrated into the chromosome through single
recombination are plated on solid medium containing 5% sucrose, which is toxic
to cells bearing 5363. A small fraction of the cells becomes sucrose-resistant.

Most of the cells in that fraction have undergone a second recombinational event

 

in which the sacB-containing vector has been lost, and the wild-type form of the
chromosomal gene has been replaced by the mutant form. Three versatile
plasmids were constructed to facilitate the use of this technique.

The conditionally lethal nature of sacB was also used to entrap insertion
sequences 033) from Anabaena sp. strain PCC 7120. Analysis of spontaneous
sucrose-resistant colonies derived from cells bearing the sacB-containing,
. replicating plasmid pRL250 revealed insertion of at least six different lSs in $308.
l8892, most frequently observed to transpose in this study, was sequenced and
further characterized.

To help elucidate the early responses to nitrogen-stepdown which are
significant for the onset of heterocyst differentiation and pattern formation, a
derivative of transposon Tn5 that incorporates the promoterless bacterial
luciferase genes, luxAB, as a reporter of transcriptional activity was used to
isolate nitrogen-responsive mutants. Two mutants, TLN2 and TLN6, showed
increased luminescence within 1 or 4 h, respectively, when cultures were shifted
from N03' to N2 as a nitrogen source. Using a l7-based transcription-
amplifying/reporting system, t/n6-directed luciferase activity at a single-cell level
was observed by microscopic photon-counting and was found distributed
unevenly along the filament at 7 h after nitrogen-stepdown. Mutations in TLN2
and TLN6 were characterized and localized in the chromosome. The fusion of
each gene to quA3 was regenerated in the wild-type chromosome by gene
replacement using sacB, and the resulting mutants were subjected to secondary
mutagenesis by a Tn5 derivative lacking luxAB. Four secondary mutants were
isolated that showed altered t/n6::luxAB expression as well as defective

differentiation of heterocysts.

© Copyright by
YUPING CAI
1991

To

my Motfler

ACKNOWLEDGMENTS

I thank my advisor C. Peter Wolk for nurturing my professional growth.
His strict scientific attitude, creative imagination and astute advice have made my
graduate career a very rewarding one, both scientifically and ethically. He also
jointly performed some of the experiments described in chapter 4. I thank Lee
McIntosh, Harold Sadoff and Loren Snyder for serving in my guidance committee
and for their thoughtful suggestions.

My gratitude also goes to A. Collmer (Cornell University) for the gift of
plasmid pUM24, C. I. Kado (University of California, Davis) for plasmid pUCDBOO,
and J. R. Coleman (University of Toronto), S. E. Curtis (North Carolina State
University), M. Steinmetz (Université Paris Vll), N. Tandeau de Marsac (Institut
Pasteur), and T. Thiel (University of Missouri, St. Louis) for communications of
unpublished data during the course of this study.

I thank past and present members of the Wolk lab for all the stimulating
discussions and helpful suggestions. Specifically, I thank Jeff Elhai for making,
and teaching me to use, the computer program permitting superposition of
luminescent and bright-field images and the computer program for processing
bright-field and photon-counting images of single filaments, Doron Holland for

helpful advice on DNA sequencing, Elaine Oren for her extensive work on the

vi

 

 

mapping of t/n22Tn5-1063 and tln6‘.:Tn5-1063 in the chromosome by pulsed-field
gel electrophoresis, and Anneliese Ernst for her unpublished results of the
nitrogenase assay of the nifD mutant Anabaena P8263. I greatly appreciate the
generosity of members of this lab whose many unpublished constructs were
used during the course of this study. I would also like to thank members of the
DOE Plant Research Laboratory for making PRL a wonderful place to work in.

Special thanks go to Lily and Sunny who make a warm home to look
forward to after everyday’s work. Finally I thank my best friend "CAT", whose
long-lasting friendship has greatly enriched my life.

This work was supported by a fellowship from the Science and
Technology Committee of the Guangdong province, China, a fellowship from the
Nitrogen-Availability Program at Michigan State University, and the US.
Department of Energy under contract DE-ACOZ-76ERO-1338 and Grant DE-FGOZ-
90ER20021. '

vii

 

(1711's one-tfiousanJ-pfizs-year oéf Cflinese poem eyqyresserf t/ie poet’s pfeasant surprise 5y
tfie stunning momirg spectacé created 6}] tfle first snow of tfie Winter ovem'g/it

viii

TABLE OF CONTENTS

 

Page
List of tables .................................................................................................... xii
List of figures .................................................................................................. xiii
List of abbreviations and symbols ................................................................ xvi
Chapter 1. General Introduction
Introduction .......................................................................................... 1
Goal of this study ................................................................................ 5

Chapter 2. Development of a system of Positive Selection for gene
replacement in the filamentous cyanobacterium Anabaena sp.

Summary .............................................................................................. 7
Introduction .......................................................................................... 8
Materials and methods ....................................................................... 10
Media and growth conditions ................................................ 10
Isolation and manipulation of DNA ........................................ 11
Genetic transfer and selection ............................................... 12
Results .................................................................................................. 13
Construction of plasmids pRL250, pRL256, and pRL263
for the initial experiments ..................................................... 13
Effect of sacB expression on cells of Anabaena spp. ........ 16
Site—directed inactivation of the nifD gene in the
chromosome of Anabaena sp. strain PCC 7120 .............. 17
Site-directed inactivation of the hetA gene in the
chromosome of Anabaena sp. strain PCC 7120 .............. 20

Construction of plasmids pRL271, pRL277, and pRL278,
and facilitated application of the sacB-mediated
positive selection system for gene replacement ............... 23
Discussion ............................................................................................ 27

 

 

Chapter 3. Use of a conditionally lethal gene to entrap insertion
sequences in Anabaena sp. strain PCC 7120, and characterization
of the family of the insertion sequence I3892

Summary .............................................................................................. 32
Introduction .......................................................................................... 33
Materials and methods ....................................................................... 35
Isolation of plasmid DNA from Anabaena sp. ...................... 35
Determination and analysis of DNA sequence .................... 35
Nucleotide sequence accession number ............................. 37
Results and discussion ...................................................................... 37
Spontaneous mutations in Anabaena sp. strain
PCC 7120 .......... . ................................................................... 37
General features of I8892 ....................................................... 42
A family of I8892-related insertion sequences ..................... 47
Target sequence and specificity ............................................ 50
The changing genome of Anabaena sp. strain PCC
7120 and the l8892 family ................................................... 51
Unique nucleotide structure of l8892 .................................... 55
Resemblance of IS892 and the nifD element ....................... 57
Distribution of l8892 ................................................................ 60

Chapter 4. Study of genes that respond early to nitrogen-stepdown
and of others that regulate their expression

Summary .............................................................................................. 61

Introduction .......................................................................................... 62

Materials and methods ....................................................................... 66

Results .................................................................................................. 69
Construction of Tn5-derived transposons and of the

BLOS cassettes .................................................................... 69

Use of Tn5-1063 with luciferase as a reporter to identify

genes that respond rapidly to nitrogen-stepdown,

and study of the induction of those genes ........................ 76
Genetic characterization of tan and t/n6, and

regeneration of their luxAB fusions in the

wild-type chromosome ......................................................... 83
Observation, at a single-cell level, of expression of t/n6

along the filament, using a T7 RNA polymerase-based ,

transcription-amplifying reporter system ............................ 91

 

 

Secondary transposon-mutagenesis to identify genes
that regulate both the expression of t/n6 and the
differentiation of heterocysts ................................................ 99
Introduction, by gene replacement, of a known
secondary mutation to study its possible regulatory

 

relationships with genes tan and t/n6 ................................ 106
Discussion ............................................................................................ 107
Appendices

Appendix A. Growth media for Anabaena spp. ............................. 112

Appendix B. Bacterial strains discussed in this study .................. 115

Appendix C. Plasmids used in this study ....................................... 122

Appendix D. Nomenclature and list of phenotypes ....................... 128

Appendix E. List of genes discussed in this study ........................ 133
Appendix F. Resistance-conferring genes and dosage of

corresponding antibiotics ......................................... 143

Bibliography .................................................................................................... 148

xi

LIST OF TABLES

Table page

3.1. Insertion sequences found in Anabaena sp. strain
PCC 7120 ............................................................................................. 41

3.2. Comparison of G+C contents of ISBQZ the chromosome, and
the nifD element of Anabaena sp. strain PCC 7120 ....................... 47

3.3. Comparison of codon usage of l8892 the chromosome, and

the nifD element of Anabaena sp. strain PCC 7120 ....................... 48
3.4. Target duplications produced by insertion of members of

the l8892 family in Anabaena sp. strain PCC 7120 ........................ 51
A1. Composition and preparation of the modified basal AA

medium for Anabaena spp. ............................................................... 114
A2. Bacterial strains discussed in this study .......................................... 115
A3. Plasmids used in this study ............................................................... 122

A.4. Resistance-conferring genes and dosage of
corresponding antibiotics ................................................................... 144

xii

Figure

2.1

2.2

2.3

2.4

3.1

3.2

3.3

3.4

LIST OF FIGURES

Page

Essential features of plasmids (a) pRL250, (b) pRL256,
and (c) pRL263 ................................................................................... 14
Southern analysis of DNA from Anabaena P8263
colonies ........................................................................................ 19
Southern analysis of DNA from Anabaena P8256
colonies ................................................................................................ 22
Essential features of plasmids pRL271, pRL277,
and pRL278 ......................................................................................... 25
The sequencing strategy used for determination of
the nucleotide sequence of l8892 .................................................... 36
Southern analysis of DNA from colonies of Anabaena
P8250-N (N=1, 2, ..... , 22)

(a) Insertion of IS elements into sacB of pRL250 ...................... 40

(b) Detection of l8892-related elements ..................................... 40
Complete nucleotide sequence of the transposable
element I8892 from the cyanobacterium Anabaena sp.
strain PCC 7120 ............................................................................ 44
Comparison of partial nucleotide sequences of three
members of the I8892 family from the cyanobacterium
Anabaena sp. strain PCC 7120 ......................................................... 49

xiii

Southern hybridization of I8892 to total DNA
of Anabaena spp.
(a) Copy number of I8892-like elements
in the genomesof Anabaena sp. strains

PCC 7120 and M-131 ........................................................... 54
(b) DNA rearrangement in the genome of
Anabaena sp. strain PCC 7120 ........................................... 54

Alignment and comparison of the M sequence to the

L-end and R-end sequences of l8892, and of those three

sequences to the 11-bp directly repeated sequence

flanking the 11-kb insertion (the nifD element) interrupting

the nifD gene in the chromosome of the same strain of

Anabaena sp. ...................................................................................... 56

Possible nucleotide secondary structures that could
be formed by l8892 ............................................................................ 59

Essential features of (a) plasmids pRL1063a and
pRL764; (b) transposons Tn5~1063, Tn5-1058, and
Tn5-764; and (c) the BLOS cassettes .............................................. 73

Screening of transposon-mutagenized colonies of

Anabaena sp. strain PCC 7120 to identify mutants that

respond to removal of fixed nitrogen from the medium

by increase or decrease of luminescence ............................ 78

Response of mutants TLN2 (a) and TLN6 (b) to
deprivation of fixed nitrogen (N03) .................................................. 80

Utilization of nitrate and of ammonium by cyanobacteria
and response of mutants TLN2 and TLN6 to removal of
nitrate or of ammonium from the growth media
(a) Scheme of metabolic pathways in the
utilization of nitrate and of ammonium
in cyanobacteria .................................................................... 82
(b) Response of mutants TLN2 and TLN6 to removal
removal of nitrate or of ammonium from
the growth media .................................................................. 82

xiv

4.5.

4.6.

4.7.

4.8.

4.9.

4.10.

4.11.

Southern analysis of total DNA isolated from mutants
TLN2 and TLN6 of Anabaena sp. ..................................................... 84

Diagram of a portion of the chromosomes of Anabaena
mutants (a) TLN2 and P8760; and (b) TLN6 and P8763 .............. 87

Localization of tln22Tn5-1063 and tln6‘.:Tn5-1063 in

the chromosomes of mutants TLN2 and TLN6,

respectively, by pulsed-field gel electrophoresis

and Southern hybridization ................................................................ 89

Scheme of amplified reporting of transcription of tln6
in Anabaena sp. strain TAL6 by the T7-based binary
vector system ...................................................................................... 94

Observation of tln6directed luciferase activity along

the filament of Anabaena strain TAL6.

(a) 7 hr after nitrogen-stepdown ....................................................... 97
(b) 21 hr after nitrogen-stepdown ..................................................... 98

Altered expression of tln6::luxAB in secondary mutants
TTL615, TTL616, TTL619, and TTL620, as compared to
that of the primary mutant P8763 (TLN6) ........................................ 103

Southern analysis of secondary mutants produced by
transposition of Tn5-764 or of Tn5-1058 in mutant
Anabaena P8763 ................................................................................ 105

()

ANT
Ap
APH

ATP

BLOS

Bom
CAT

Cm

LIST OF ABBREVIATIONS AND SYMBOLS

Novel joint of DNA

Designates carriage of a replicating plasmid

In possession of a functional gene* or a phenotype**
Lack of a functional gene* or a phenotype**
Deletion, when used in the description of genotypes
Allen and Arnon medium (see Appendix A)
Aminoglycoside adenylyltransferase

Aminoglycoside nucleotidyltransferase

Ampicillin

Aminoglycoside phosphotransferase

Adenosine 5’-triphosphate

Basepair(s)

A family of 5.6-kb gene cassettes that contains a ham (oriT) region,
the genes quAB, an oriV, and a Sm'i/Spr determinant

Basis of mobilization (oriT, See Appendix E)
Chloramphenicol acetyltransferase

Chloramphenicol

EDTA

Em

Gm

GOGAT

GS

IPTG

IS

Kd

LB

MCS

MDFIS

MSX

NMT

Nm

Nx

ORF

Ethylenedinitrilotetraacetic acid

Erythromycin

Gentamicin

Glutaminezoxoglutarate aminotransferase (glutamate synthase)
Glutamine synthetase

lsopropyl-thiogalactoside

Insertion sequence

Kilobasepair(s)

Ifilodalton(s)

Kanamycin

Luria-Bertani medium

Multiple cloning sites

Methylation-dependent restriction systems
L-methionine-D,L-sulfoximine

Fixed nitrogen (N03; or NH4+)

An rRNA N6-amino adenine N-methyltransferase
Neomycin

Nalidixic acid

Open reading frame

Resistant

Sensitive

SDS Sodium dodecyl sulfate, also called sodium Iauryl sulfate

SEM Standard deviation of the mean

Sm Streptomycin

Sp Spectinomycin

Suc 5% sucrose

Tc Tetracycline

TES N-tris-(hydroxymethyl)methyl-2-aminoethanesulfonic acid
Tn Transposon

Xgal 5-bromo-4—chloro-3-indolyl-B-D-galactoside

 

* Names of genes are presented in italic letters.

** Names of phenotypes are presented with their first letters capitalized.

xviii

Chapter 1
GENERAL INTRODUCTION

INTRODUCTION

Cyanobacteria, formerly called blue-green algae, constitute a highly diverse
group of prokaryotes that pose, as well as provide organisms to answer, a
variety of biological and evolutionary questions. Cyanobacteria constitute the
major group of prokaryotes that perform oxygenic (higher-plant type)
photosynthesis, and many species are capable of nitrogen fixation (Stanier, 1977;
Stanier and Cohen-Bazire, 1977). The recently discovered and characterized
Prochlorales are another group of photosynthetic prokaryotes that have
chlorophyll a, but unlike cyanobacteria, have chlorophyll b rather than phycobilins
(Lewin, 1976; Burger-Wiersma, 1986). According to the endosymbiont
hypothesis (Margulis, 1981), cyanobacteria and the Prochlorales are considered
the progenitors of chloroplasts of eukaryotic plants based on their morphological,
biochemical, and genetic similarities (Whitton et al., 1971; Morden and Golden,
1989; Kuhsel et al., 1990; Xu et al., 1990) .

Cyanobacteria are comprised of unicellular and filamentous species. The
ca. 300 strains axenically cultured in the Pasteur collection have been divided into
five sections based on comparative studies of their structure and development

(Rippka et al., 1979; in this dissertation I refer to this system as the 1979 Rippka

1

2

Assignment). The cyanobacterial strain that was almost exclusively used
throughout this study, Anabaena sp. strain PCC 7120, was originally named
Nostoc muscorum. But in the 1979 Rippka Assignments this strain was placed
in the genus Anabaena, rather than Nostoc, under Section IV. Although the
name Nostocwas recently recommended again for this strain (Rippka, 1988), the
name Anabaena has been used in the majority of publications of studies of this
strain and is therefore used throughout this presentation.

Since the discovery of genetic transformability of the cyanobacterium
Anacystis nidulans in 1970 (Shestakov and Khuyen, 1970), several strains (Porter,
1986) of unicellular cyanobacteria (all in Section I of the 1979 Rippka
Assignment), including Synechocystis sp. strain PCC 6803 that is capable of
light-activated heterotrophic growth (Anderson and McIntosh, 1991), have been
extensively used in molecular genetic studies of the structural and functional
aspects of oxygenic photosynthesis (Bryant and Tandeau de Marsac, 1988;
McFadden and Small, 1988). The heterocystous filamentous cyanobacteria
(Section IV and V of the 1979 Rippka Assignment), on the other hand, were
studied extensively long before the availability of molecular genetic means
because they, unlike almost all other prokaryotes, are capable of cellular
differentiation to form heterocysts and akinetes (also called spores; Nichols and
Adams, 1982), as well as of aerobic nitrogen fixation.

When grown in media with a sufficient amount of fixed nitrogen such as
nitrate or ammonium, the filamentous cyanobacterium Anabaena sp. strain PCC
7120 forms filaments that are comprised of only vegetative cells. However, when
deprived of a source of fixed nitrogen, this and other Anabaena spp. differentiate

to form thick-walled cells called heterocysts at semi-regular intervals along the

3

filaments (Wolk, 1982). In such nitrogen-fixing filaments, vegetative cells and
heterocysts perform different but interdependent metabolic functions. Vegetative
cells use light as an energy source to split water (producing reductant and 02)
and fix C02, and thus to maintain growth. Heterocysts fix nitrogen and export
the fixed nitrogen to the vegetative cells. Part of the reductant produced in
vegetative cells is transported to the heterocysts and used for reduction of
dinitrogen. Heterocysts, terminally differentiated cells, have unique morphological
and biochemical characteristics suited for nitrogen fixation. They form a thick
envelope that is very little permeable to 02 (Murry and Wolk, 1989) and have a
much reduced connection with neighboring vegetative cells (Vchox et al., 1973).
The activity of photosystem II, which produces 02, is absent, and heterocysts
devote photosystem I to cyclic photophosphorylation to produce ATP needed for
nitrogen fixation (Haselkorn, 1978). Heterocysts are thought also to respire a
large fraction of the reductant that they receive from vegetative cells, in order to
maintain a very low internal p02 (Murry and Wolk, 1989), and thus to preserve
the activity of the inherently Oz-sensitive, nitrogen-fixing enzyme, nitrogenase
(Wolk, 1982).

In Anabaena variabi/is about 15 to 25% of the genome is devoted to the
production of RNA transcripts that are heterocyst-specific under aerobic
conditions (Lynn et al., 1986). In the process of heterocyst differentiation, genes
of various functions are differentially turned on or off (Elhai and Wolk, 1990).
Mutants that are defective in various aspects of heterocyst differentiation have
been isolated and complemented (Wolk et' al., 1988; Buikema and Haselkorn,
1991a), and some of the mutated genes studied in detail (Holland and Wolk,

1990; Buikema and Haselkorn, 1991b). In addition, DNA is rearranged at a late

4
stage of heterocyst differentiation (Golden et al., 1985; Haselkorn, 1989). The
development of the endospore of the well studied Gram-positive bacterium,
Bacillus subtilis, is governed by a regulatory transcriptional cascade in which the
expression of certain genes is dependent on prior activity of other genes
(Stragier and Losick, 1990). However, very few of the Anabaena genes involved
in the heterocyst differentiation process have been characterized. The regulation
of the expression of these genes and possible regulatory relationships among
them remain virtually unknown.

Because of its morphological simplicity, Anabaena sp. can be used as a
model organism for the elucidation of the detailed biochemical mechanisms that
control the formation of multicellular patterns (Dworkin, 1985). The mechanisms
that govern the initiation of the pattern of heterocyst spacing in Anabaena sp.
may differ from the mechanism(s) that preserves that pattern because once the
spatial pattern of heterocysts is formed, it may be maintained by the gradient of

nitrogenous compound(s) exported from heterocysts. The initial establishment

of the heterocyst pattern is, however, independent of nitrogen fixation because;

mutants unable to fix nitrogen can form normally spaced heterocysts, and
patterned heterocyst formation can be induced under growth conditions free of
N2. Two distinct, but experimentally distinguishable mechanisms have been
proposed to explain the initial formation of the pattern of spaced heterocysts
(Wolk, 1989). One mechanism proposed (which I denote the volunteer model)
is that the first cells to sense nitrogen-stepdown differentiate to form heterocysts,
and simultaneously produce the heterocyst pattern by exporting a differentiation-
inhibiting substance to adjacent vegetative cells. The second mechanism

proposed (which I call the scavenger model), is that the first cells to sense N-

..

 

5
stepdown activate a nitrogen-scavenging system that drains available nitrogen
from adjacent cells, thus permitting the scavenging cells to continue growing
vegetatively. Subsequent similar action of neighboring cells puts the cell that
senses nitrogen deprivation the last farthest away from the cells that sense N~
stepdown first, and leads to the formation of a heterocyst by this cell. The two
proposed mechanisms can be tested experimentally if one can identify an
Anabaena gene that responds rapidly to removal of fixed nitrogen, and can follow
the developmental fate of the cells in which that gene is first activated after N-
stepdown. According to the volunteer model, this cell will differentiate into a
heterocyst, whereas according to the scavenger model, this cell will be distant

from the heterocysts that are formed.

GOAL OF THIS STUDY

In 1984, the Wolk laboratory successfully transferred foreign DNA from
Escherichia coli to Anabaena sp. by conjugation (Wolk et al., 1984). This
achievement marked the start of manipulatory molecular genetic studies of the
filamentous cyanobacteria. However, it was difficult to introduce a site-directed
mutation into the genome of Anabaena sp. because when homologous DNA
sequences within suicide plasmids were transferred to Anabaena sp. by
conjugation, single-crossover events (integration recombinations) occur far more
frequently than do double-crossover events (replacement recombinations). In
order to facilitate analysis of the development of Anabaena sp., I therefore sought
a means to select for double recombinants. The application of a conditionally
lethal gene, the sacB from B. subtilis, led to the technique of positive selection

for double recombinants in Anabaena spp. The conditionally lethal nature of

 

6
sacB was also used to entrap insertion sequences in cells of Anabaena spp.,
leading to the discovery of at least six different insertion sequences in Anabaena
sp. strain PCC 7120, and to an insight into dynamic changes occurring in the
genome of that strain. In the later part of my studies, two additional powerful
techniques were made available by work of this laboratory: use of bacterial
luciferase as a reporter to report transcriptional activity at a single-cell level (Elhai
and Wolk, 1990) and the efficient transposition of Tn5 derivatives that can
produce fusions of the bacterial luciferase genes, luxAB, with the genome of
Anabaena sp. (Wolk et al., 1991). Two genes, tan and tln6, that respond rapidly
to removal of fixed nitrogen were identified. l have also tentatively identified
mutations that affect heterocyst differentiation as well as the expression of tln6.
Such mutations are likely to be in the very early genes that sense nitrogen-

starvation and are involved in the initiation of patterned formation of heterocysts.

 

 

Chapter 2

DEVELOPMENT OF A SYSTEM OF POSITIVE
SELECTION FOR GENE REPLACEMENT IN THE
FILAMENTOUS CYANOBACTERIUM Anabaena SP. 1

SUMMARY

Use of the conditionally lethal gene sacB provides a simple, effective,
positive selection for double recombinants in Anabaena sp. strain PCC 7120, a
filamentous cyanobacterium. This gene, which encodes the secretory
levansucrase of Bacillus subtilis, is inserted into the vector portion of a suicide
plasmid bearing a mutant version of a chromosomal gene. ' Cells of colonies in
which such a plasmid has integrated into the chromosome of Anabaena sp.
through single recombination are plated on solid medium containing 5% sucrose.
Under this condition, the presence of the sacB gene is lethal. A small fraction of
the cells from initially sucrose-sensitive colonies becomes sucrose-resistant; the
majority of these sucrose-resistant derivatives has undergone a second

recombinational event in which the sacB-containing vector has been lost, and the

 

1 Most of the content of this chapter has been published in the Journal of
Bacteriology (Cal and Walk, 1990).

 

8

wild type form of the chromosomal gene has been replaced by the mutant form.
By the use of this technique several selected wild-type genes in the chromosome
of Anabaena sp. strain PCC 7120 have been mutated, and replaced by
corresponding mutant genes. This sacB-mediated positive selection system was
further improved by the construction of three plasmids, pRL271, pRL277 and
pRL278. By using one of these plasmids, the introduction of a specific mutation
into the chromosome of Anabaena sp. can be as easy as one subcloning plus
one conjugal transfer, provided that a marked, mutated fragment of DNA from

Anabaena sp. is readily available.

INTRODUCTION

Molecular genetic studies of cyanobacteria have been greatly facilitated by
advances in techniques for genetic transfer (Wolk et al., 1984; Porter, 1986).
However, site-directed modification of the chromosome, a powerful tool for study
of gene function, has been applied nearly exclusively to unicellular cyanobacteria
(Porter, 1986) because of the ease with which double recombinants can be
isolated from these organisms.

Isolation of double recombinants from filamentous cyanobacteria such as
Anabaena species has been difficult for two reasons. First, when homologous
DNA sequences within suicide plasmids are transferred to Anabaena sp. by
. conjugation, single-crossover events (integration recombinations) occur far more
frequently than double-crossover events (replacement recombinations) (Golden
and Wiest, 1988; this work). Second, because cells of Anabaena sp. have
multiple genomic equivalents as calculated from the genetic complexity (Herdman

et al., 1979b; Bancroft et al., 1989) and the amount of DNA per cell (Craig et al.,

 

9

1969), and are linked, isolation of recessive mutants requires both segregation
of mutant and wild-type forms of the genome and physical disjunction of adjacent
cells of a filament bearing the two genomic forms (Currier et al., 1977).

Golden and West (1988) first introduced an insertional mutation into the
xisA gene in the chromosome of Anabaena sp., by screening for double-
recombinant derivatives of selected single recombinants. Their screening
experiment made use of a 17-kb, homologous DNA fragment, with a Sm'lSpr
cassette (the Q cassette; Prentki and Krisch, 1984) inserted near the middle to
inactivate the gene of interest (an antibiotic resistant gene used in this manner
has been referred to as an "inactivation cassette" [Golden, 1988]). Quantitative
work with Escherichia call has shown that the rate of recombination decreases
greatly as the length of a homologous sequence decreases (Shen and Huang,
1986). Recombination in Anabaena sp. may have a similar size-dependence. In
Anabaena sp. strain PCC 7120, exhaustive screens have failed to isolate double
recombinants when the size of the homologous region was below 4 kb (J. Elhai,
personal communication; this work). For this reason, we sought to isolate double
recombinants by positive selection for loss of the vector portions of plasmids that
had integrated into the chromosome. Such positive selection can be achieved
by inclusion of a conditionally lethal gene within the vector portion of the plasmid.

The conditionally lethal gene, sacB, has been used to isolate double
recombinants in the Gram negative bacterium, Erwinia chrysanthemi (Ried and
Collmer, 1987). This gene, from the unicellular Gram-positive bacterium, Bacillus
subtilis, encodes levansucrase (sucrose:2,6-l3-D-fructan 6-B-D-
fructosyltransferase; EC. 2.4.1.10), a 50-kd secretory protein, production of which

is induced by sucrose (Gay et al., 1983 and 1985). The gene has been cloned

 

 

10
(Gay et. al, 1983) and sequenced (Steinmetz et al., 1985), and its expression has
been well studied (Aymerich et al., 1986 and Klier et al., 1987). Expression of the
gene is lethal to such Gram negative bacteria as E. coli, Agrobacterium
tumefaciens, Rhizobium meli/oti and E. chrysanthemi in the presence of 5%
sucrose in solid medium (Gay et al., 1983 and 1985; Ried and Collmer, 1987).
Growth is inhibited and cells lyse within as little as 1 h after induction of $308
expression by sucrose (Gay et al., 1983). The mechanism of lethality of the 5303
product to a variety of Gram-negative bacteria is not well understood. Lethality
may be due to transfructosylation from sucrose to various metabolically important
acceptors (Gay et al., 1983), or to accumulation of unsecreted protein in the cell
membranes because of inadequate cleavage and export (Beckwith and Silhavy,
1983). Because cyanobacteria have the peripheral structure characteristic of
Gram-negative bacteria, I tested two strains of Anabaena sp., and found both of
them susceptible to sucrose when bearing the sacB gene. I further found that
the conditional lethality of $308 in Anabaena sp. enables direct selection for

double recombinants on sucrose-containing solid medium.

MATERIALS AND METHODS

Media and growth conditions. The bacterial strains used are listed in
Table A2 of Appendix B. Axenic strains of Anabaena sp. were grown
photoauxotrophically at 30°C in AA-based media (Allen and Arnon, 1955; see
Appendix A) in air under cool white fluorescent lighting of ca. 60 uE m'2 s",
agitated on a rotary shaker when liquid medium was used. E. coli was grown,
usually at 37°C, in LB (Luria-Bertani)-based media (Maniatis et al., 1982).

Antibiotic concentrations used for selection are listed in Appendix F. A 50%

 

 

 

11

aqueous solution of sucrose, sterilized by filtration though a filter of pore size 0.22
pm (type GA) or 0.45 pm (type HA) (Millipore Corp., Bedford, MA), was added
to autoclaved LB agar or AA+N03’ agar medium to a final concentration of 5%
sucrose.

Isolation and manipulation of DNA. Restriction enzymes and modifying
enzymes used were mostly from Bethesda Research Laboratories (BRL) of Life
Technologies, Inc. (Gaithersburg, MD), New England Biolabs, Inc. (Beverly, MA),
United States Biochemicals Corp. (Cleveland, OH), and Boehringer Mannheim
Corp. (Indianapolis, IN), and were used essentially according to the
recommendations of the suppliers.

Plasmids used are listed in Table A3 of Appendix C. Cloning procedures
followed standard methods (Maniatis et al., 1982). Plasmid mini-preps from E.
coli was performed essentially as published (Holmes and Quigley, 1981).

Total DNA was isolated from Anabaena sp. by the following modification
of a published technique (Golden et al., 1985; D. Holland, personal
communication). Cells of Anabaena sp. in the mid- or late-log phase of growth
were harvested from 25 to 50 ml of liquid culture and resuspended in a final
volume of 400 pl in a 1.5-ml microfuge tube with 10 mM TrisCl, 0.1 mM‘EDTA
(pH 7.5). Then, 150 pl of sterile glass beads (Sigma Chemical Co. catalog No.
G-9143), 20 pl of 10% Sodium docecyl sulfate (SDS; Boehringer Mannheim
Biochemicals, lndianopolis, IN), and 450 pl of a 1:1 (v/v) mixture of phenol and
chloroform were added. The mixture was subjected to a cycle of vigorous
vortexing for 1 min followed by cooling on ice for 1 min, for a total of 4 to 6 times.

The resulting suspension was centrifuged at 15,000 x gfor 15 min, and the clear

 

 

 

 

12
supernatant solution was transferred to a new microfuge tube, phenol- and then
chloroform-extracted, and its DNA ethanol-precipitated.

DNA probes were labelled with [a-32P]-deoxyadenosine 5’-triphosphate
([a-32P1dATP, as ca. 13.0 pM triethylammonium salt at a concentration of ca. 10.0
mCi per ml) purchased from New England Nuclear (Boston, MA), or Amersham
Corp. (Arlington Heights, IL), using a random primer labeling kit purchased from
BRL. Southern analyses were performed as follows: DNA digested with
appropriate restriction enzyme(s) was first separated by electropheresis in a 0.7%
agarose gel (Ultrapure agarose from BRL),‘then transferred (Davis et al., 1986)
to a nitrocellulose membrane (Immobilon-NC Transfer Membranes, pore size:
0.45 pM, type HA, Millipore Corp.) and hybridized by a standard procedure
(Maniatis et al., 1982) with the following specifics: hybridizations were always
carried out at 65° C, followed by one 5—min wash and then two 30-min washes,
all with 0.5 X 88C (formula for the SSC solution is found in Maniatis et al., 1982)
and 0.1% SDS at 65°C (high stringency washes) or room temperature (low
stringency washes).

Genetic transfer and selection. Preparation of competent cells and
transformation of E. coli were carried out according to a published procedure
(Hanahan, 1985). Plasmid DNA was introduced into cells of Anabaena sp. by
conjugation from E. coli, with pRL528 as helper plasmid, following standard
procedures (Wolk et al., 1984; Elhai and Wolk, 1988b).

To isolate double recombinants of Anabaena sp., initial exconjugants were
suspended in 50 ml of AA/8+N03’ medium, shaken under growth conditions for
4 to 6 h, subjected to cavitation in a sonic cleaning bath for 5 to 10 min, and

washed twice with the same medium. About 106 to 107 cells were then plated

 

13
on AA+N03' agar containing Sm, Sp, and 5% sucrose. I refer to this procedure
as direct plating. In some experiments, exconjugants were also subcultured in
50 ml of AA/8+N03'+Sm+8p liquid medium, with cavitation of the culture for 5
min at 4- to 7-da intervals, for 1 month. The cells were then washed once and
plated on solid medium of AA+NO3'+Sm+Sp+Suc at 106, 105, and 104
cells/plate. Cell density was estimated from methanolic extracts of cells

(Mackinney, 1941) by assuming a content of 0.4 pg of chlorophyll a per cell.

RESULTS

Construction of plasmlds pRL250, pRL256, and pRL263 for the Initial
experiments. Plasmid pRL57 (Elhai and Wolk, 1988a), a positive selection shuttle
cloning vector, was constructed by ligation of the pDUl-containing Cla l-Nde I
fragment of pRL1 (Wolk et al., 1984) with the nptll—containing Nde I-Asu II
fragment of pRL44 (Table A2; for a list of genes described in this study, see
Appendix E). Plasmid pRL250 (Fig. 2.1a) was constructed by cloning the 3881-
bp BamH I fragment containing the sacB-nptl cartridge from pUM24 (Ried and
Collmer, 1987) between the two BamH I sites of pRL57.

The suicide (integration) plasmid pRL256 (Fig. 2.1b) was constructed as
follows. Sm'lSpr cassette C.S4 (Bancroft and Wolk, 1989), bounded by Smal
sites, from plasmid pRL171PSm (Table A2) was inserted into the Nrul site of the
3.5-kb, partial-SarfiA I fragment of Anabaena DNA in plasmid pRL52, inactivating
the hetA gene which is required for complementation of the Fox’ (fixation of
nitrogen in the presence of gygen; nomenclature and list of phenotypes
described in this study are presented in Appendices D and F) mutant EF116
(Wolk et al., 1988; Holland and Wolk, 1990). The resulting plasmid, pRL61, was

14

Ei Pstl Pstl Pstl

321mml ___. ,1 < lBamm
npu sacB

 

YS‘\\ /Ps”

10 not ~
Grill 1
/80m
2
8 pill 250
0m' 14.3 kl)
7
s“
6
5

IR!)

Figure 2.1. Essential features of plasmids (a) pRL250, (b) pRL256, and (c)
pRL263. The horizontal line in B and C. represents a portion of the chromosome
of Anabaena sp. strain PCC 7120; the bold region represents the portion
subcloned into the corresponding plasmids. For information on the hetA gene,
see Holland and Wolk, 1990.

‘lkh

1 kb

15

 

 

 

 

 

 

 

1<———5.8 kh—IEEITV
EcoRV
fimOrIV 603
10 I
9
2
Econll 3 FBI- 255 g
15.9 kl) q 3
sacB 5;
‘b
7 is
4
5 ‘5
E0081! MM
Kpfl' {__— Kpnl
(LS4
(Hal [Hal
1 47 1 -
nflH nun
Ck"
. (Hal
Glhnv 1 (”3|

sacB
’Bom pRL263
5 12.4 kb 2

 

1 6
then stripped of its ability to replicate autonomously in Anabaena sp. by deleting
a 1.7-kb Mlu I fragment from the pDU1 portion (Schmetterer and Wolk, 1988),
yielding plasmid pRL61 M. Finally, the 2597-bp BamH l-sacB-Pstl fragment from
plasmid pUCD800 (Gay et al., 1985) was inserted between the 89/ II and Pstl
sites in the nptll region of pRL61 M.

The suicide plasmid pRL263 (Fig. 2.10) was constructed as follows. The
cat gene of plasmid pRL517b (Table 2.2), excised with Nhe l and Asu II, was
replaced by the 3851-bp Xba l-sacB-nptl—Accl fragment from pUM24. The nptl
gene was then cut out with Pstl and replaced by cassette C.CE1 (Cmr and Em';
Elhai and Wolk, 1988) from Nsil to Hind Ill supplemented with a 42-bp Hind Ill-
Pstl fragment from plasmid uvx (Seed, 1983).

Effect of sacB expression on cells of Anabaena spp. The two strains of
Anabaena sp. that were tested, PCC 7120 and M-131, grow as well, and often
better, on media containing 5% sucrose than on media lacking sucrose. When
bearing plasmid pRL250 that contains the sacB gene (Fig. 2.1a), both strains, .
Anabaena sp. strains PCC 7120(pRL250) and M131 (pRL250), become extremely
sensitive to 5% sucrose in solid medium. Following plating of ca. 107 cells of
‘ newly derived exconjugants, filaments decomposed and cells bleached within 12
h, and few (see chapter 3) or no colonies subsequently arose. A similar
phenotype was observed when the sacB gene was present as a single copy in
the chromosome of Anabaena sp. strain PCC 7120 (see below, strains PCC
7120::pRL256 and PCC 7120::pRL263). Thus, despite the complexity of the
regulatory region of the $308 gene from B. subtilis (Steinmetz et al., 1985), that

gene appears to be well expressed in Anabaena spp.

 

17

Site-directed inactivation of the niiDgene in the chromosome of Anabaena
sp. strain PCC 7120. Although plasmid pRL263 (Fig. 2.1c) cannot replicate in
Anabaena sp. strain PCC 7120, the cyanobacterium can acquire resistance to
Sm/Sp by homologous recombination with cloned Anabaena DNA that flanks the
drug-resistance cassette. Single recombinants would be predicted to exhibit the
phenotype Sm'lSpr Emr Sucs Fox+ and double recombinants to exhibit the
phenotype Sm'r/Spr Ems Sucr Nif' (therefore Fox’). Following mating,
exconjugants arose at a frequency of ca. 10’5 of cells plated. All 200 Sm'lSpr
exconjugants that I tested were Fox+, and were therefore provisionally
considered single recombinants and denoted PCC 7120::pRL263. Another 200
colonies derived from a two-month-old culture of a single-recombinant colony
(see Fig. 2.3, lane C) were screened for Fox‘ phenotype arising as a result of
double recombination; that phenotype was not observed.

I selected for double recombinants by plating exconjugants on AA+N03'
solid medium containing Sm, Sp and 5% sucrose. Positively selected sucrose-
resistant colonies (denoted P8263) appeared at a frequency of ca. 10‘5 in
experiments using direct plating, and approximately 104 when initial exconjugants
were grown for one month in liquid medium before cavitation and plating. Of the
20 P8263 colonies resulting from direct plating, all but one, PS263-42, had an
Sm'lSpr Ems Sucr Fox‘ phenotype, suggestive of double recombination.
Replacement of the wild-type nifD gene by the nifD.:C.S4 derivative as a result
of double recombination was confirmed by Southern analysis (Fig. 2.2). P8263-
42 had an Sm’lSpr EmIr Sucr Fox+ phenotype and showed a pattern of
hybridization predicted for a single recombinant (Fig. 2.2). Presumably, the sacB

gene had been inactivated, rather than lost as in authentic double recombinants.

 

 

18

Figure 2.2. Southern analysis of DNA from Anabaena P8263 colonies. Markers
indicate sizes of DNA (in kilobases). Total DNA from wild-type PCC 7120 (lane
A), single-recombinant PCC 7120::pRL263 (lane B), double recombinants P8263-
1, -2, and -50, respectively (lanes C, D, and F), and pseudo-double recombinant
PS263—42 (lane E) was digested with Cla l and probed with linearized plasmid
pRL393 (see table A3). The origins of the bands observed can be deduced
from Fig. 2.10. The 4.1-kb band in the wild type containing the nifH gene and
part of the nifD gene is replaced by a 6.0-kb band in all other colonies, in which
the 1.9-kb cassette 0.84 is inserted within the nifD gene. Single recombinant
PCC 7120::pRL263 (lane B) and pseudo-double recombinant P8263-42 (lane E)
have a 9.0-kb band generated from the junction to the vector, and lane 8 '
contains also a 10.8-kb band which resulted from duplication of the whole
plasmid. In the double recombinants (lanes C, D, and F), the 6.0-kb band which
contains the nifD gene with the 0.84 insert is present, but the 9.0-kb band to
which the vector contributes has been lost.

19

 

10.8—
9.0— ‘
6.0— d C. O C '-

4.1—- 9"

20

I refer to such strains as “pseudo-double recombinants." Possible mechanisms
for their occurrence are discussed below. Thirty P8263 colonies isolated after
extra cycles of growth in liquid, and cavitation, were examined, and 28 proved to
have the phenotype of a double recombinant. Two, P8263-53 and P8263-54,
resembled P8263-42 in phenotype.

Anabaena strain P8263-1, a representive, authentic double recombinant,
is indistinguishable from wild-type Anabaena sp. strain PCC 7120 in both growth
rate and morphology when grown in medium containing fixed nitrogen. When
transferred to medium free of fixed nitrogen, in which it cannot grow, Anabaena
P8263-1 develops heterocysts that are not distinguishable, by light microscopy,
from those of the wild type strain. On the average, heterocysts are separated by
fewer vegetative cells in the mutant than in the wild type strain (data not shown),
presumably because the mutant is more deficient in nitrogen. The Nif‘ phenotype
of this strain was confirmed by the negative result of acetylene-reduction assay
of nitrogenase activity under aerobic and anaerobic conditions (A. Ernst, personal
communication).

Site-directed inactivation of the hetA gene in the chromosome ofAnabaena
sp. PCC 7120. The hetA gene is a differentially regulated gene that affects the
biosynthesis of the polysaccharide layer of the heterocyst envelope. A hem
mutant, EF116, generated by UV irradiation, can be complemented by a 3.5-kb
sequence of chromosomal DNA that harbors the hetA gene; complementation
is abolished when a drug cassette is inserted into the Nrul site within hetA (Wolk
et al., 1988; Holland and Wolk, 1990). Using sacB-mediated positive selection
and the suicide plasmid pRL256 (Fig. 2.1b), the wild-type hetA gene in the

chromosome of PCC 7120 was replaced, through double recombination, by a

 

 

 

21

Figure 2.3. Southern analysis of DNA from Anabaena P8256 colonies. Markers
indicate sizes of DNA (in kilobases). Total DNA was digested with EcoR V and
probed with linearized plasmid pRL351 (see table A3). The bands of 2.4, 2.1
and 5.8 kb correspond to the three EcoRV segments in the horizontal line of Fig.
2.1b. The bands of 3.4 and 1.7 kb, which appear only in single and pseudo-
double recombinants, arise from the vector-insert junctions on the left and right
sides of Fig. 2.1b, respectively. Wild-type strain PCC 7120 (lane A) and mutant
EF116 (lane B) have bands of equal size, indicating that there is no significant
variation in the hem region of the mutant chromosome. In double recombinant
PS256-17 (lane E), the 2.1-kb band is replaced by a 4.0-kb band, reflecting the
insertion of 084 into the hetA gene. Pseudo-double recombinant P8256-5 (lane
D) has the same pattern of hybridization as single recombinant
PCC7120::pRL256 (lane C).

5 8 _ $9132)“ {“39“ “a“; £13”, #96th
I

4.0— d C a
3.4— to ~

 

 

23

mutant hetA gene in which the SmI/Spr cassette C.S4 had been inserted into its
Nrul site. Resulting hetA mutants, represented by PS256-17, are Sm'i/Spr Fox‘.
Pseudo-double recombinants, represented by P8256-5, were identified by their
phenotype (Sm'lSp'Fox+) and by Southern analysis (Fig. 2.3). Single and
double recombinants arose in these experiments with frequencies slightly lower
than those observed in the nifD-inactivation experiments described above.

In medium free of fixed nitrogen the mutant strain P8256-17 develops cells
that have the shape and spacing of heterocysts but that show no deposition of
heterocyst envelope polysaccharide. In contrast, heterocyst envelope
polysaccharide is deposited irregularly in mutant EF116 (Wolk et al., 1988). The
difference may be attributable to the type of mutation present in hetA of the two
mutants. ‘

Construction of plasmids pRL271, pRL277, and pRL278, and facilitated
application of the sacB-mediated positive selection system for gene replacement.
A set of plasmids was designed to simplify the introduction of a mutated DNA
fragment from Anabaena sp. into a sacB-containing suicide plasmid. Plasmid
pRL271 (Fig. 2.4) has the following composition: bp 1 (E0047 lIl, destroyed) to
bp 2369 (Sal l) contains the gene $308 from pUM24; following the Sal I site is the
sequence 5’ CTGCA 3’ followed by the Em' gene (bp 1995-2896 of plasmid
pE194; Horinouchi and Weisblum, 1982), then followed by the sequence
CGAATI'CA (contains an EcoR I site), then the 954-bp Cmr gene from hp 4357
(Asu ll, destroyed) to bp 5310 (Asu ll, destroyed) of plasmid pBR325 (Balbés et
al., 1986), followed by the EcoR V-Bgl ll fragment of the plC20H polylinker (Marsh
et al., 1984). Thereafter comes a 527-bp Xho l-Sstl polylinker fragment derived
from bp 1943 to 1572 and bp 1443 to 1289 of plasmid pJRD184 (Heusterspreute

 

24

Figure 2.4. Essential features of plasmids pRL271, pRL277, and pRL278. See
text for composition of the plasmids. The 970-bp region of multiple cloning sites
(MCS) between EcoR V (excluded) and BspH I (included) has sites for 20
different, hexanucleotide-specificity restriction endonucleases that cut nowhere
else in the plasmids with the following exceptions: in pRL277, Bsm I also cuts
within the Cmr determinant; in pRL277, Nae l, BssH ll, BstE ll, Ase I, 89/ I, and
BspH I also cut the Sm'lSpr determinant; and in pRL278, Nae l, Bssl-l ll, Sph l,
and Pstl also cut the Km'ler determinant. The Xbal site in parenthesis is dam-
methylated. Three sites (not shown), Eag l, an l, and Xcm l, upstream from the
aadA gene (Sm'lSp') are unique in plasmid pRL277 and therefore can be used
also as cloning sites. There is a Sph I site between those three addtional cloning
sites and the MOS region, which draws caution to using Sph I in the subcloning
because digestion by this enzyme removes most of the cloning sites from
pRL277. Three sites, Asu ll, BamH I, and Xba I, downstream from the nptll gene
(Km'le') in pRL278 may also be used as cloning sites. The an l and Sca I
sites in pRL277 and pRL278 are destroyed, and the antibiotic resistance
cassettes between these two sites are not drawn to scale.

25

EcoRV (Xbal) Bglll Xhol Nael BssHll Bsml
BstEll EcoNl Spel Spll Xbal Avril Afil
Asull Sstl Nrul Sphl Pstl Asel Bgll Bsle

[Sea l]

Xbal
BamHl

Asull

 

EcoRV

1.0 kb

26

et al., 1985; bp 1571 to 1444 was deleted by treatment with T4 DNA polymerase
of the 39/ II and Pstl ends, and subsequent ligation), followed by the Nru I to Pst
I fragment of the polylinker from plC20H. Finally, the oriV (pMB1)- and oriT
(pMB1)-containing portion of the plasmid is derived from the Pet I to Pvu II
(destroyed) fragment of pBR322 (Balbas et al., 1986). The an I and Sca l sites
(both blunt) in the 3’ portion of the Emr and CmIr genes, respectively, permit
convenient replacement of antibiotic resistance cassettes to generate derivatives
of pRL271. A Sm"/Spr derivative (pRL277) was made by ligation of the Dra l-
bounded aadA-containing £2 cassette (from pHP45S2; Prentki and Krisch, 1984),
and a Km'ler derivative (pRL278) was made-by ligation of the nptll-containing
cassette C.K3 (Elhai and Wolk, 1988a; the Xbal ends were made blunt by filling-
in reactions using the Klenow fragment), with the larger an I-Sca I fragment of
pRL271 (Fig. 2.4).

These three plasmids are identical except for their antibiotic resistance
genes that permit selection in both E. coli and Anabaena spp. The region of
multiple cloning sites (MCS) has 20 possible sites that are compatible with the
ends generated by many restriction endonucleases. The relative simplicity of
using one of these plasmids to achieve gene replacement in Anabaena sp. was
illustrated by the inactivation, in cooperation with D. Holland, of the gene conA.

Positioned 3’ from hetA is a single-copy gene (partially characterized, and
denoted ORF2 in Holland and Wolk, 1990) to which I refer as conA because it
is constitutively expressed during growth with N03' and during heterocyst
differentiation. Because the hetA mutant PS256-17 (see above) could not be
complemented by cosmids that complement mutant EF116 (D. Holland,

unpublished results), we speculated that the function of conA might be needed

27

for the function of hetA. The Sm'lSpr $2 fragment (Prentki and Krisch, 1988),
provided with Xba I ends by passage through plasmid pRL453 (Elhai and Wolk,
1988a), was inserted into the Xba I site in the 5’ region of conA, disrupting the
predicted ORF. A 5-kb Pvu ll fragment containing this insertionally mutated conA
and the entire hetA was then cloned into the unique Nrul site of pRL271. The
resulting plasmid, pRL743, was transferred into Anabaena sp. strain PCC 7120
by conjugation. Sucrose-resistant exconjugants (denoted P8743) derived from
a sucrose-sensitive single recombinant (Anabaena sp. strain PCC 7120::pRL743)
were analyzed by Southern analysis. Five of the six colonies examined were
double recombinants in which‘the mutated conA gene had replaced the wild-type
gene (data not shown). None of the five mutants differed phenotypically from the
wild type, suggesting that the product of conA is dispensable under the growth
conditions employed.

Plasmid pRL270, a precursor of pRL271 which lacks the polylinker
fragment from pJRD184, was similarly used to inactivate the gene (prcA)
encoding a calcium-dependent protease in the genomes of Anabaena spp.

strains PCC 7120 and ATCC 29413 FD (Maldener et al., 1991).

DISCUSSION

Utilization of the conditional Iethalitity of $308 permits positive selection for
double recombinants in the filamentous cyanobacterium Anabaena sp. strain
PCC 7120 and presumably in any other cyanobacterial strains that show similar
susceptibility to sucrose when bearing the sacB gene. Using this technique with
Anabaena sp. strain PCC 7120, I inserted a Sm'lSpr cassette (0.84) into the nifD

gene in the chromosome to create a nifD mutant P8263-1, and into the hetA

28
gene to create a hetA mutant PS256-17 that is defective in heterocyst formation
and Fox’.

This technique has significant advantages relative to screening. Double
recombinants can be obtained within less than one month following conjugation.
As in the experiment using plasmid pRL263, pseudo-double recombinants can
be easily distinguished by testing for the antibiotic resistance (Em') conferred by
the vector. Experimental data available so far (J.-M. Panoff, personal
communication) indicate that as little as 0.2 kb of homologous DNA bordering the
inactivation cassette is sufficient for isolating double recombinants. By contrast,
it is very difficult, if at all possible, to isolate double recombinants by screening
when there is nearly as small an amount of bordering, homologous DNA.
Because the size of homologous DNA required is small, it is relatively easy to find
an unique site at which to insert an inactivation cassette into the gene of interest.
Moreover, use of sacB should allow an unmarked mutation to be introduced into
the chromosome (Ried and Collmer, 1987).

In the history of molecular genetic studies of Anabaena sp. strain PCC
7120, many genes such as the nitrogenase genes nifHDK (Rice et al., 1982), the
ribulose-1,5-bisphosphate carboxylase genes rbcLS (Curtis and Haselkorn,
1983), and the ATP synthase (atp) genes (Curtis, 1988) were identified by
heterologous hybridization and subsequent nucleotide sequencing. Although
valuable information has been obtained from studies of such gene homologs and
their presumed promoters, the true identity and function of those proposed
genes (e.g., the second copy of nifl-i, Rice et al., 1982) and promoters (e.g., the
series of glnA promoters; Turner et al., 1985) remain theoretical without

mutational investigation. Some of the presumptions such as the initially defined

 

29

nifD open reading frame (Lammers and Haselkorn, 1983), and the proposed nifK
promoter and its sequence per se (Mazur and Chui, 1982) have later proved
incorrect (Golden et al., 1985, and Haselkorn, 1986). Development of the sacB-
mediated positive selection system provides an easy means of achieving gene
replacement and should facilitate the verification of proposed genetic
constituents. The insertional mutation introduced into the nifD gene in this study
provided the first confirmation of the function of a gene of Anabaena sp. strain
PCC 7120 that had been proposed on the basis of heterologous hybridization
and sequencing. Inactivation of conA provided the first experimental
demonstration that a constitutive gene in Anabaena sp. could be mutated without
causing any obvious change of the phenotype of the organism (except for the
antibiotic resistance introduced into the mutant). Accordingly, a similar
experiment can determine whether insertional mutation of any chosen constitutive
gene is lethal to Anabaena sp.

One problem in the use of the 5308 system is the production of pseudo-
double recombinants as a result of inactivation of the $308 gene. Spontaneous
mutations of sacB in cells of Anabaena sp., including point mutations, deletions
and the insertion of IS elements (see chapter 3), can certainly contribute to the
appearance of pseudo-double recombinants. My results upon plating cells of
Anabaena strain PCC 7120(pRL250) in the presence of 5% sucrose suggest that
spontaneous mutations of $308 in cells of Anabaena sp. accumulate with time of
cell culture.

Nonetheless, Inactivation of the $308 gene in E. coli cells prior to
conjugation is probably the major cause of the appearance of pseudo-double

recombinants. l have observed that an overnight liquid culture inoculated with

30

a single small sucrose-sensitive colony of E. coli strain DH5(pUM24) gave rise to
large and small sucrose-resistant colonies at a total frequency of 103. Restriction
analysis of plasmid pUM24 from these sucrose-resistant colonies suggested that
in 1% of the total, and mostly in large colonies, the plasmid had experienced
insertion of transposable elements. l82- and l810-like elements, tentatively
identified by size and by restriction analysis (Ghosal et al., 1979; Halling et al.,
1982; Galas and Chandler, 1989), were found in the $303 gene in this test. If
sacB-bearing cells of E. coli are subcultured repeatedly prior to conjugation, the
percentage of pseudo-double recombinants among sucrose-resistant colonies
of Anabaena sp. can exceed 50%. However, if care is taken in choosing
sucrose-sensitive colonies for inoculation of plasmid-donating cultures of E. coli
and in their length of culture, the percentage of pseudo-double recombinants can
usually be contorlled to be under 5%. Similarly, although a longer period of
culturing single-recombinant colonies increases the absolute number of double
recombinants, such subculture of single recombinants has also been observed
to increase the percentage of pseudo-double recombinants among sucrose-
resistant colonies, presumably due to an accumulation of spontaneous mutations
of the 3308 gene in the cells of Anabaena sp.

Surprisingly, Anabaena sp. strians PCC 7120::pRL256 and PCC
7120::pRL263, both of which have a functional copy of sacB in the chromosome,
grow well in the liquid medium AA/8+N03'+5% sucrose, so that culture in
sucrose-containing liquid medium does not enrich double recombinants. I
cannot account for this difference in results between solid and liquid media.
Similarly, UV—irradiation' of single recombinants in liquid (with the intent of

increasing the frequency of a second recombinational event prior to selection on

31

sucrose plates) only increases the percentage of pseudo-double recombinants,
possibly by increasing the mutation rate of sacB in the cells of Anabaena sp.

Construction of the suicide plasmids pRL256 and pRL263 for the initial
experiments of gene replacement was case-specific and the two contructs were
not useful for introduction of other mutated genes into the chromosome.
Construction of plasmids pRL271, pRL277 and pRL 278 facilitated such
application by providing a set of plasmids, with a variety of antibiotic resistance
markers, that are much more adaptable to other cloned fragments. As described
in this chapter and in chapter 4, by using one of these plasmids or their
derivatives, introduction of a specific mutation into the chromosome of Anabaena
sp. can be as easy as one subcloning plus one conjugal transfer, followed by
selection, provided that a marked, mutated DNA fragment from Anabaena sp. is
readily available. During the past two years the three plasmids, and their
immediate progenitors, have been distributed to 19 laboratories worldwide to use

for this and similar purposes in cyanobacteria or other Gram-negative bacteria.

Chapter 3

USE OF A CONDITIONALLY LETHAL GENE TO ENT RAP
INSERTION SEQUENCES IN Anabaena SP. STRAIN PCC 7120
AND CHARACTERIZATION OF THE FAMILY OF
THE INSERTION SEQUENCE |S8921

SUMMARY

The conditionally lethal nature of the $308 gene was used to entrap
insertion sequences from Anabaena sp. strain PCC 7120. Selected,
spontaneously sucrose-resistant colonies derived from cells bearing the sacB-
containing, autonomously replicating plasmid pRL250 were analyzed. Inactivation
of sacB proved to be largely due to insertions into the gene by a variety of
insertion sequences in cells of Anabaena sp. At least six different, presumed
insertion sequences were found in this study.

l8892, the insertion sequence most frequently observed in this study, has

been further characterized. It is 1675 basepairs (bp) in size with 24-bp near-

 

1 Most of the data presented in this chapter have been published in the
Journal of Bacteriology (Cal and Walk, 1990; Cal, 1991).

32

 

33

perfect inverted terminal repeats, and has two cpen reading frames (ORFs) that
could code for proteins of 233 and 137 amino acids, respectively. Upon insertion
into target sites, which are usually A/T rich, this IS generates an 8-bp directly
repeated target duplication. A 32-bp sequence in the region between ORF1 and
ORF2 is similar to the sequence of the inverted termini. Similar inverted repeats
are found within each of those three segments, and the sequences of these
repeats bear some similarity to the 11-bp direct repeats flanking the 11-kb
insertion interrupting the nifD gene of this strain (Golden et al., 1985). A
sequence similar to that of a binding site for the E. coli integration host factor
(IHF) is found about 120 bp from the 'L and of I8892. Partial nucleotide
sequences of active IS elements l8892N and l8892T, members of the l8892
family from the same strain of Anabaena sp., were shown to be very similar, but

not identical, to the sequence of l8892.

INTRODUCTION

Insertion sequences (IS) are transposable DNA-elements that are generally
smaller than transposons and normally bear only genes related to transposition
(for a review, see Galas and Chandler, 1989). Because IS elements lack
selectable markers, direct genetic selection for transposition of these elements
is generally not possible. However, IS elements can be detected indirectly as a
consequence of their transposition into, and inactivation of, a marker gene or an
operon (Malamy, 1970; Fiandt et al., 1972; Gay et al., 1985). IS elements have
been isolated from a variety of prokaryotes. Some of the elements have been
sequenced and studied in detail. Most IS elements are 0.8 to 2.5 kb in size and

have near-perfect inverted terminal repeats ranging from 8 to 41 bp. Almost all

34

bacterial IS elements characterized to date generate directly repeated
duplications of their target DNA sequences upon insertion, presumably as a
result of staggered cutting of target DNA. Many of these elements generate a
duplication of a fixed number of base pairs, ranging from 2 to 13 bp, as a
characteristic of the element (Galas and Chandler, 1989).

Cyanobacteria differ physiologically and phylogenetically (Woese, 1987)
from other eubacteria. Two active IS elements have been isolated and
sequenced from cyanobacteria: IS701 from Calothrix sp. strain PCC 7601 (Mazel
et al., 1988) and I8891 from Anabaena sp. strain M-131 (Bancroft and Wolk,
1989). IS701 appears to be a typical IS element with inverted terminal repeats
and the generation of target duplications (Galas and Chandler, 1989). By
contrast, l8891 lacks inverted terminal repeats and fails to generate a target
duplication upon insertion. In addition, genetic elements, collectively denoted the
mys family, from the cyanobacterium Anabaena sp. strain PCC 7120 were
suggested to be insertion sequences on the basis of the structural similarity of
their nucleotide sequence to that of typical l8 elements (Alam and Curtis, 1985).

The gene sacB is conditionally lethal to some Gram-negative bacteria and
has been used to entrap insertion sequences in some of those bacteria (Gay et
al., 1985). The cyanobacterium Anabaena sp., when bearing that gene, was
shown to be sensitive to sucrose (see chapter 2). In this chapter, I shall disCuss
the discovery, by the use of sacB, of a variety of insertion sequences in cells of
Anabaena sp. strain PCC 7120, and a detailed study of one of the insertion

sequences, l8892, and related elements in this strain of Anabaena.

 

35
MATERIALS AND METHODS

Bacterial strains, growth media, cultural conditions, most molecular
biological techniques used in this study, and chemical suppliers have been
described in chapter 2. A nitrocellulose filter that was to be rehybridized for
further Southern analysis was first stripped of radioactivity by immersion for 10
min in 1 liter of boiling 5 mM EDTA (pH 8.0).

Isolation of plasmid DNA from Anabaena spp. Plasmid DNA was extracted
from Anabaena sp. strains PCC 7120 and M-131 by a boiling procedure modified
from Holmes and Quigley (1981): cells from a 50-ml liquid culture in early
stationary phase were harvested, washed with 1.0 ml of H20, and mixed with 700
pl of STET solution (2% sucrose, 5% Triton X-100, 50 mM EDTA [pH 8.0], 10 mM
Tris -HC| [pH 8.0]) plus 50 pl of 10 mg Iysozyme per ml of H20. After 5 min at
room temperature, the suspension was heated in boiling water for 40 s. The
mixture was then centrifuged at 21,000 x g for 20 min at 4° C, and the pellet
removed. The supernatant solution was extracted with phenol and then with
chloroform. DNA was precipitated by isopropanol at -70°C and resuspended in
50 pl of TmoE solution (10 mM Tris-HCI, 0.1 mM EDTA [pH 8.0]).

Determination and analysis of DNA sequence. DNA sequence was
determined by using synthetic DNA primers and ordered deletions of fragments
subcloned into vectors pUC118 and pUC119 (Vieira and Messing, 1987). The
sequencing strategy used is shown in Fig. 3.1. Deletions were made by a
combination of timed digestion by exonuclease III and treatment with mung bean
nuclease according to a protocol provided by Stratagene (La Jolla, CA). DNA
oligonucleotide primers were synthesized and purified with equipment and

reagents supplied by Applied Biosystems, Inc. (Foster City, CA). Double-

 

 

36

 

 

 

 

R[>———>
> 2[>————>- ————>
1 [>——> > ————>
Xbal
4.— +—— +-—- <
1f <——— <—
<————<]L
mot?
l.___l

Figure 3.1. The sequencing strategy used for determination of the nucleotide
sequence of I8892. The Xba I site is shown for orientation. All arrows point from
5’ to 3’. An open triangle indicates a synthetic DNA primer. Primers L and R
were used mainly for sequencing of insertion target sites. The sequences of the
synthetic primers were:

5’ TGCTTATATAGGAGC 3’
5’ TTGCTI'ATCAGGAGA 3’
5’ GCTGTAGTTCTACTAC 3’

1.
2.
L.
R. 5’ TGCCTGTGCCATCGC 3’

37

-stranded DNA and the chain termination technique using dideoxynucleotides
(Sanger et al., 1977) were used in DNA sequencing, utilizing Sequenase version
2.0 from United States Biochemical Corp., and adenosine 5’-a-
[358]thiotriphosphate ("358-ATP", as ca. 1.0 mg per ml triethylammonium salt at
a concentration of 10 mCi per ml) from Amersham Corp. Electrolyte gradient
polyacrylamide sequencing gels were prepared and run as described previously
(Sheen and Seed, 1988). The gels were fixed in a solution of 5% methanol plus
5% acetic acid (Biggin et al., 1983) and dried at 80°C in vacuo before
autoradiog raphy. Both strands of the nucleotide sequence presented in Fig. 3.3
were sequenced. Nucleotide and amino acid sequences were analyzed‘with the
assistance of the software Editbase (Purdue Research Foundation and
USDA/ARS), HIBIO DNASIS, and HIBIO PROSIS (Hitachi America Ltd., San
Bruno, CA).

Nucleotide sequence accession number. The nucleotide sequence of
l8892 shown in Fig. 3.3 has been deposited in GenBank under accession

number M64297.

RESULTS AND DISCUSSION

Spontaneous mutations in Anabaena sp. strain PCC 7120. Plasmid
pRL250 (See Fig. 2.1a of chapter 2) bears the gene sacB and a clone of the
cyanobacterial plasmid pDU1 that confers autonomous replication in Anabaena
spp. (Wolk et al., 1984; Schmetterer and Wolk, 1988). Anabaena sp. strain PCC
7120 bearing this plasmid cannot grow on sucrose-containing solid medium
because of the presence of a functional sacB gene (see Chapter 2). One such

colony of Anabaena strain PCC 7120(pRL250) was subcultured continuously for

38

2 months in liquid medium AA/8 plus N033 and about 107 cells were then plated
on solid medium AA plus N03“, neomycin, and 5% sucrose. Approximately 300
colonies were recovered after 10 days. The pRL250-like plasmids isolated from
twenty-two of these colonies (denoted PS250-N, where N=1, 2..., 22; see
Appendix B) were analyzed by Southern hybridization (Fig. 3.2a). In 15 of these
plasmids, the 2.6-kb sacB-containing Pstl fragment of pRL250 was replaced by
a larger Pst I fragment, while other Pst I fragments of the plasmid were
unchanged. In the remaining seven cases the 2.6-kb fragment showed no visible
change in size, or appeared to have been deleted entirely. In the strains that
showed no visible change in the 2.6-kb fragment the sacB gene may have been
inactivated by a point mutation or a small deletion, thus accounting for the
viability of the strains on sucrose-containing medium. -

The 15 variant plasmids of pRL250 that showed an increase in size of the
2.6-kb fragment were recovered by transformation of Escherichia coli strain
H8101 or DH5a with total or plasmid DNA extracted from the corresponding
Anabaena colonies (the E. coli strain HB101 is better suited than strain DH5a for
recovery of Anabaena DNA: see Appendix B), and are listed in Table A3 of
Appendix C. Although colony P8250-1 appeared (see Fig. 3.2a) to contain a
second variant bearing a 1.7-kb insertion that hybridizes to l8892 (see Fig. 3.2b),
this variant was not recovered. On the basis of limited data from restriction
mapping and Southern analysis, the 15 presumptive IS elements that entered
these 15 plasmids have been tentatively grouped and named (Table 3.1).

Plasmid pRL272, a variant of pRL250 recovered from colony P8250-3, was
restriction-mapped. The data revealed a 1.7-kb insertion in the 58-bp region from

EcoR l to Pvu ll of sacB (Cai and Wolk, 1990). This insertion element, denoted

 

39

Figure 3.2. Southern analysis of DNA from colonies of Anabaena PS250-N (N= 1,
2, ..... , 22). Total DNA from PS250-1 to PS250-22 (lanes 1 to 22) and from PCC
7120(pRL250) (lane 23) and DNA of plasmid pRL250 (lane 24) were digested with
Pst l. (a) Insertion of IS elements into sacB of pRL250. The blotted filter was
probed with labelled plasmid pRL250. The band of 2.6 kb corresponds to the
Pst I fragment that bears the entire sacB gene, while the bands of 9.5, 1.2, and
0.5 kb are from the rest of plasmid pRL250 (Fig. 2.1a). (b) Detection of l8892-
related elements. The same filter, stripped of radioactivity from the above
hybridization, was reprobed with the internal Dra I-EcoR V fragment from l8892
(see Fig. 3.3). The unnumbered lanes on the left in both panels provide size
markers of DNA (in kilobases).

4O

OPNCOVIO‘ONQOIC
v-v-v-v-v-v-v-w-v-v-N

23
24

F
a. v—NCOQ‘IOCONQO) N

N
N

23.1—

9.4—
6.6-

4.4—

 

ID
F

23.1— «-

9.4—
6.6—

4.4— m . U a no. ~‘
3.1 —
2.3—

1.7— .

1.4—
1.1—

0.8—
0.5—

41

Table 3.1. Insertion sequences found in Anabaena sp. strain PCC 7120

 

 

IS Size Source of Comment
element (kb) insertion

I8892 1.7 kb PS250-3 Also PS250-6, -9, -10, -11 and -15;

see text

l8893 1.2 kb P8250-2 Possibly also PS250-13

l8894 1.9 kb PS250-4

l8895 1.2 kb PS250-5 A mys element; see text

l8897 1.5 kb PS250-7 Possibly also P8250-1 and PS250-12
l8898 1.0 kb P8250-8 Possibly also PS250-18

 

l8892, and other hybridizing elements discovered in this experiment were further
characterized (see below).

The 0.8-kb Hind Ill-EcoR I fragment from plasmid pAn625 (a gift of S. E.
Curtis, North Carolina State University) that contains most of the presumed
insertion element mysA (Alam and Curtis, 1985), hybridized strongly to the IS
element (denoted l8895) that had inserted into the sacB gene of pRL250 in
colony PS250-5 (data not shown), suggesting extensive homology between the
two DNA elements. The lSBQ5-containing plasmid pRL745 was therefore sent to
S. E. Curtis for further characterization. A detailed study of the family of I8895
from Anabaena sp. strain PCC 7120 has been published (Alam et al., 1991).

The transposable element l8891, isolated from the closely related

Anabaena sp. strain M-131, hybridized to the genome of Anabaena sp. strain

42
PCC 7120 (Bancroft and Wolk, 1989), but failed to hybridize to the 15 active
insertion sequences discovered in this experiment.

General features of ISM I8892 (Fig. 3.3) is 1,675 bp in length and has
24-bp near-perfect (21 out of 24 bp; Fig. 3.6) inverted terminal repeats that show
no significant sequence similarity to termini of other known bacterial IS elements
(Galas and Chandler, 1989). Two open reading frames (ORFs) are present in
tandem on the same DNA strand. When the first methionine residue is taken as
the translational initiation codon, the two ORFs, ORF1 and ORF2, are predicted
to code for proteins of 233 and 137 amino acids, respectively. Possible
alternative start codons TTG (Zhang et al., 1989; Tsinoremas et al., 1991) and
GTG (Reddy et al., 1988) could extend ORF1 to 262 amino acids and ORF2 to
188 or 173 amino acids (Fig. 3.3). As has been observed in a number of
cyanobacterial genes (Tandeau de Marsac and Houmard, 1987) and the other
three sequenced cyanobacterial l8 elements (Bancroft and Wolk, 1989; Alam et
al., 1991; Tandeau de Marsac, personal communication), neither ORF of l8892,
in defined or extended version, is preceded by a typical ribosome binding
sequence. The complementary strand does not contain complete ORFs of
greater than 82 codons with a reasonably positioned initiation codon. An
incomplete reading frame, initiated at the first methionine codon at bp 357 to 355,
extends for 118 codons and out of the left (L) end of I8892 without a stop codon.

An E. coli-type promoter (Mulligan et al., 1984) is present 5’to ORF1 (Fig.
3.3). The -35 region of that presumed promoter, 5’ TTACTA 3’, lies within the L-
and terminal repeat sequence. A -35 region of an E. coli-like promoter, pointing
outward, can be found in the inverted termini: 5’ TTGCCA 3’ at the L end and 5’

TTACCA 3’at the right (R) end. Such outward-pointing half promoters have been

43

Figure 3.3. Complete nucleotide sequence of the transposable element l8892
from the cyanobacterium Anabaena sp. strain PCC 7120. The noncoding strand
of the sequence is presented in 5’ (left [L] end) to 3’ (right [R] end) direction.
Numbering of the nucleotide sequence and of the amino-acid sequences of
ORF1 and ORF2 are presented, respectively, to the left and to the right of the
sequence. The deduced amino acid sequences of ORF1 and ORF2 and their
possible 5’ extensions are displayed above the DNA sequence, with presumed
translational initiation sites printed in boldface. Possible alternative start codons
are indicated in parentheses. Also shown are the -35 and -10 regions of a
presumed promoter for ORF1. The inverted termini are double underlined.
Potential stem-loop structures are indicated by pairs of counterpointing arrows
under the nucleotide sequence. Restriction sites mentioned in the text are
underlined, and the site for dam methylation is marked with filled diamonds. The
M sequence, from bp 953 to 984, which is similar to sequences of the terminal
repeats (see Fig. 3.6), is highlighted by a bar above the sequence. The shaded
DNA sequence around bp 125 is a possible binding site for the E. coli integration
host factor (IHF, see text), and the shaded amino acid sequences at the carboxyl
end of ORF2 may be a potential helix-turn-helix DNA binding structure.

44

-3 S —1 0
1 CTAGCGTGGC AAAACTT ACTAGAGCGCGCGGAAATCCTGTAATCTTGACCTTGTAGCGAAATAATGGCGCAAAAAC

—--- > < -——- --_-
(flet)Ala Arg Lye Ser Len Lye Pro Gln Ala Thr Ser Phe Gln Y 1 Len Asp gye val Gln
TTG GCA AGA AAA AGT TTA AAA CCA GAG GCA ACA TCG TTT GAAGTACTTGATi‘TGT GTT CAA

.............

77 m.w.w, ..... saw” ........................ ..
-> < ----- D r a I Evian-:32“. a. an. .-. .-. .'.'. .-.v.'.‘.~.°:.~.\~.~.'.-.\'.\'.v. .-.*
Lye Lye Cye Pro Ser Cye Gly Gln Ala Met Trp Asn Gln Tyr Asn Asn Pro Arg Hie Ile 11
137 AAAAAATGCCCATCGTGCGGT CAAGCAATGTGG AATGAATAC AATAATCCT CGACAT ATA
l——-OORF1
Arg Thr Len Asn Gly val val Gln Len Gln Len Lye Ile Arg Arg Cye Gln Asn Lye Ser 31

197 AGA ACG TTA AAT GGG GTA GTA GAA CTA CAG CTA AAA ATT CGG CGA TGT CAA AAT AAG TCA

Cye net Arg Tyr Lye Lye Ala Tyr Arg Pro Gln Gln Gln Gly Ser Len Ala Len Pro Gln 51
257 TGT ATG CGG TAT AAA AAA GCA TAT CGA CCA GAG CAA GAA GGG TCA CTC GCT CTA CCA CM;

Asn Gln Phe Gly Len Asp val Ile Ala Tyr Ile Gly Ala Len Arg Tyr Gln Gln Hie Arg 71
317 AACGAATTTGGTTTGGATGTAATTGCTTAT ATAGGAGCATTACGC TATCAAGAACAT AGA

ASer val Pro Gln Ile Bis Thr Hie Len Gln Len Lye Gly Ile Cye Ile Ser Gln Arg Thr 91
377 AGT GTT CCA CAA ATA CAC ACT CAC CTT GAA TTA AAG GGT ATA TGT ATC AGT CAA CGA ACG

val Thr His Len Ile Asp Arg Tyr Asp Gln Len Len Ser Len'Trp Len Lye Asp Hie Lye? 111
437 GTC ACG CAC CTA ATT GAC AGA TAT GAC GAG TTA CTT TCT TTA TGG CTA AAA GAC CAT AAA

Arg Len Lye Thr Ile val Ala Asn Gln Gly Arg val Ile Len Ala Ile Asp Gly Met Gln 131
497 AGGTTAAAAACAATAGTGGCTAATCAAGGACGGGTGATATTAGCCATTGATGGGATGCAG

Pro Gln Ile Gly Hie Gln val Len Trp val Ile Arg Asp Cye Len Ser Gly Gln Ile Len 151
557 CCA GAA ATT GGA CAT GAG GTA TTA TGG GTA ATT CGA GAT TGC TTA TCA GGA GAA ATC TTA

Len Ala Lye Thr Len Len Ser Ser Arg Asn Gln Asp Len val Ala Len Len Len Gln val 171
617 CTA GCT AAA ACC 'I'I‘A TTA TCA TCA AGA AAT GAA GAT TTA GTG GCG TTA TTA TTA GAA GTA

Thr Asn Thr Len Asp val Pro Ile Asp Gly val val Ser Asp Gly Gln Gln Ser Ile Arg 191
677 ACTAATACTTTGGATGTACCAATTGATGGAGTTGTTAGTGATGGGCAACAATCAATTCGC

Lye Ala val Arg Len Ala Len Pro Arg Ile Ala His Gly Len Cye His Tyr Hie Tyr Len 211'
737 AAAGCTGTTAGGTTAGCATTACCTAGAATTGCTCACGGTTTATGTCATTACCATTACCTG

Lye Gln Ala Ile Lye Pro Ile Tyr Gln Ala Asp Arg Hie Ala Len Lye Gly Ile Lye Gln 231
797 AAGGAAGCAATTAAACCC ATATATGAGGCGGAT AGACATGCT CTCAAAGGAATTAAAGAA

Lye Ser *
857 AAA AGT TAG AGGATTACGAGACATTGAACGTAGTGTTACCAATGMMTCAGGAAATGGCAACTATTATCGAMAT

 

933 TATTGCTCGGCAGTACGTAGTTCTATAACTAATGATGGTCATCCACCATTAEAGGCATCAGGATTAAAGTTACAAGAAA
SnaBI -- ------ -> <— — -------
1 0 1 2 AT'I‘TGACA'I‘I‘GATAGAGCAAAGCTTAGATCGGATGGAAAAAAAAGTGCTTTACCACCACCTTTAATCAACCTAAAACAC
HindIII OOOO—- --- --> < -------
(Met)11e Ala Lye Gly Len Ser Ala Thr Ala Scr Len Phe Ser Pro(Va1)Arg val Ala Tyr
1091 TTG ATA GCT AAA GGA TTA TCT GCG ACT GCA TCT TTA TTT TCA CCT GTG AGG GTT GCA TAT
Gln Trp val Asp Lye Ala Ser Asp Ile Len Asn Asn Lye Ile Gly Len Asp Ala Ala Gly
1151 CAG TGGGTT GATAAAGCT AGT GATATTCTC AATAATAAAATAGGT CTT GAT GCTGCTGGT

val Lye Gln Ser Tyr Gln Gln Len Len Thr Gln net Ser Gln Gln Lye Gln Lye Ala Gly 9
1211 GTCAAACAAAGT TAT CAGCAACTGTTAACTCAAATGTCC CAACAAAAGCAGAAAGCTGGT
-—- —-- —-> <-— ----- ORF2
Thr Len Asn Thr Ala Ile Asp Asn Phe Ile Lye Thr Thr Hie Ser Tyr Trp Ser Gly Len 29
1271 ACC CTGAAC ACT GCAATC GATAACTTTATAAAAACC ACC CATAGCTACTGGTCT GGACTT

Phe Hie Cye Tyr Gln Ile Gln Asp Phe Pro Arg Thr Asn Asn Asp Len Gln Hie Ala Phe 49
1331 TTTCATTGTTACGAAATTGAAGATTTTCCC AGAACTAATAACGACTTAGAACACGCTTTT

Gly Met Len Arg His Bis Gln Arg Arg Cye Thr Gly Arg Lye val Ala Pro Ser Ser Len 69
1391 GGT ATG CTC CGT CAT CAT CAA CGT CGT TGT ACT CGT CGT AAA GTT GCC CCC TCA TCC CTC

val Ile Arg Gly Scr val Lye Len Ala Cye Ala Ile Ala Thr Lye Len Hie Ser Phe Thr 89
1451 GTT ATT CGT GGC TCT GTC AAA CTT GCC TGT GCC ATC GCT ACT AAA CTT CAT TCT TTT ACC

   

Ala Ser Asp Len Ala Gln val Asp Ile va1 Thr Trp Len Asp Len Arg Ser Ashen“; _M’
1511 GCA TCT GAT TTA GCA CAA GTT GA‘I‘ ATC GTT ACT TGG CTC GAT TTA CGT TCT 6AA”TTG""CKA
EcoRV
”W’Hismifiwsfla’firgimmflfilfi””Waffle“? Arg 4‘89 Pro .3' .. 1.1..
1 571 A'AA'M'CA'CCAC""'AAA""GCC""‘AGA"""ATT"’G‘AA""'C'A’G""TATI’ICGA'Q'T‘I'I'"’CGC CGC GAC CCA

 

129

 

1631

 

45
found at the ends of many IS elements, and their implication has been discussed
previously (Galas and Chandler, 1989).

The sequence 5’ GAAGTACTTGATT 3’, from bp 116 to 128 (Fig. 3.3),
matches well with the consensus sequence 5’TAAnTnnTTGATT 3’ (Goodrich et
al., 1990) of binding sites for the E. coli integration host factor (IHF). In E. coli,
the histonelike protein IHF (Drlica and Rouviere-Yaniv, 1987; Friedman, 1988) has
been shown to participate in the transposition of lSi and l810, which have IHF
binding sites at or near their and sequences (Gamas et al., 1987; Morisato and
Kleckner, 1987). Possible IHF binding sites have been found in IS elements of
various origins (Galas and Chandler, 1989). The presence of a putative IHF-
binding site near one end of l8892, in IS701 (Galas and Chandler, 1989), and in
l8895 (Alam et al., 1991) makes it tempting to speculate that an IHF-like protein,
although not yet observed in cyanobacteria, could be involved in the
transposition of their IS elements.

Several strains of cyanobacteria, including Anabaena sp. strain PCC 7120,
exhibit dam methylation of their DNA (Padhy et al., 1988). Sites for dam
methylation found at the ends of l810, IS50, and l8903 have been reported to
influence transposition of these IS elements in E. coli (Roberts et al., 1985;
Dodson and Berg, 1989). The sole site for dam methylation found in l8892 is
located at the end of a stem-loop structure 5’to ORF2 (the N sequence, see Fig.
3.3 and discussion below). Whether that site influences the activity of l8892 is,
however, unknown.

The two proteins predicted by ORF1 and ORF2 in l8892, 26.8 and 15.8
kDa in molecular mass, respectively, are likely cytosolic proteins because each

has an overall hydropathy index of -0.1 with no peaks over +/-- 1.0 (window size:

46

19 amino-acid residues; von Heijne, 1987). Although calculated isoelectric points
are close to 7.0, both proteins have a moderately high content of basic amino
acids (arginine and lysine residues account for ca. 15% of the amino acids in
each protein), consistent with possible interactions of the proteins with DNA
(Galas and Chandler, 1989). Prediction of secondary structure by the Garnier—
Robson method (von Heijne, 1987) suggested that a helix-turn-helix conformation,
a structural motif found repeatedly in prokaryotic DNA binding proteins (Pabo
and Sauer, 1984), could form at the carboxyl end of ORF2 (Fig. 3.3).

The G+C contents and codon usage of the genome of Anabaena sp.
strain PCC 7120 and of l8892 were compared (Table 3.2 and 3.3). l8892 has a
markedly lower G+C content than that of the genome, and its codon usage
differs extensively from that of abundantly expressed chromosomal genes: of the
18 amino acids that have multiple synonymous codons, only five amino acids
(Pro, Gln, Ala, Val, and Glu) are represented by similar codon preferences. The
altered codon usage in I8892 seems consistent with its lower G+C content:
almost all changed codon preferences favor codons ending with A or U.
Alternatively, codon usage, often not correlated with the G+C content of an
organism (lkemura, 1985), may be attributable to the presumed low expressivity
of the genes of l8892 (Gouy and Gautier, 1982).

Computer-assisted sequence comparisons (Lipman and Pearson, 1985;
von Heijne, 1987) between l8892 and other cyanobacterial IS elements IS701
(T andeau de Marsac, personal communication), l8891, and l8895 failed to
identify regions of significant similarity of nucleic acid or protein sequence. A

search covering both the GenBank and the EMBL data bases also failed to

47

Table 3.2. Comparison of G+C contents of l8892 the chromosome, and the nifD
element of Anabaena sp. strain PCC 7120 a

 

G+C content Anabaena sp. nifD element l8892
strain PCC 7120

 

Overall 42.5 38.7 38.7
Of ORFs 47.9 40.5 39.7

 

a Data on overall G+C content of the strain is as previously published
(Herdman et al., 1979a), and that of the nifD element is calculated from published
sequence data (Lammers et al., 1986, 1990). The G+C content of the ORFs of
this strain of Anabaena is calculated from eight abundantly expressed
chromosomal genes (T andeau de Marsac and Houmard, 1987), that of the nifD
element is calculated from five proposed ORFs in the sequenced region
(Lammers et al., 1986, 1990), and that of I8892 is calculated from its two ORFs.

recognize a known transposable element that shares significant sequence
similarity with l8892.

A family of l8892-related Insertion sequences. The internal Dra I-EcoR V
fragment of l8892 (Fig. 3.3) was used to re-probe the filter used in Fig. 3.2a. Six
bands of the same size as the band from PS250-3 showed strong hybridization
(Fig. 3.2b), suggesting that the IS elements from these seven colonies are
homologous. Plasmids were recovered from these colonies (except for colony
PS250-1, see above), and the L-end portion of their insertions partially
sequenced. The partial sequences (ca. 400 bp) of the insertions from PS250-6,

-11, and -15 were identical to the corresponding sequence of l8892. However,

48

Table 3.3. Comparison of codon usage of 18892 the chromosome, and the nifD element
of Anabaena sp. strain PCC 7120 ‘1

 

 

 

 

Codon usage frequency of: Codon usage frequency of:
Amino Anabaena . Amino Gcnc «don Anabaena -
acrd Gene codon s p. strain mID 18892 acrd c sp. strain “(m ISSOZ
PCC 7120 °'°"‘°‘“ PCC 7120 °‘°'“‘“‘
Arg CGA 1.5 13.7 20.0 NC AUA 1.4 31.8 29.6
CGC 29.4 28.8 13.3 AUC 69.5 23.5 18.5
CGG 6.6 11.0 10.0 AUU 29.1 44.7 51.9
CGU 51.5 20.5 23.3
AGA 9.6 20.5 26.7 Lys AAA 54.7 80.5 79.2
AGG 1.5 5.5 6.7 AAG 45.3 19.5 20.8
Lcu CUA 11.1 17.9 14.9 Asn AAC 91.7 32.3 28.6
CUC 14.6 10.6 12.8 AAU 8.3 67.7 71.4
CUG 19.4 13.0 4.2
CUU 4.4 9.7 12.8 Gln CAA 80.4 74.0 73.7
UUA 16.6 30.9 48.9 C AG 19.6 26.0 26.3
UUG 40.0 17.9 6.4
Ilis CAC 91.0 33.3 36.8
Ser UCA 6.8 21.0 33.3 CAU 9.0 66.7 63.2
UCC 28.4 13.6 9.5
UCG 0.0 6.2 0.0 Glu GAA 80.4 68.0 76.2
UCU 39.8 23.4 28.6 GAG 19.6 32.0 23.8
AGC 21.6 14.8 4.8 '
AGU 3.4 21.0 23.8 Asp GAC 55.4 34.2 27.8
GAU 44.6 65.8 72.2
Thr ACA 25.6 37.8 5.9
ACC 59.5 28.4 29.4 Tyr UAC 80.2 38.1 46.2
AC0 2.4 9.5 17.6‘ UAU 19.8 61.9 53.8
ACU 12.5 24.3 47.1
Cys UGC 68.2 45.4 12.5
Pro CCA 26.4 27.6 54.5 UGU 31.8 54.6 87.5
CCC 23.6 25.9 27.3
CCG 0.0 3.4 0.0 Phe U UC 73.6 25.0 0.0
CCU 50.0 43.1 18.2 UUU 26.4 75.0 100.0
Ala GCA 26.8 33.3 26.9 Mct AUG
GCC 9.0 21.2 19.2
GCG 7.1 7.4 7.7 Trp UGG
GCU 57.1 37.1 46.1
Slop UAA 66.7 40.0 0.0
Gly GGA 7.0 35.6 38.9 UAG 22.2 20.0 66.7
GGC 17.1 27.1 5.5 UGA 11.1 40.0 33.3
GGG 2.3 8.5 22.2
GGU 73.6 28.8 33.3
Val GUA 46.8 25.4 35.0
GUC 6.4 20.0 10.0
GUG 6.4 20.0 15.0
GUU 40.4 34.6 40.0

 

 

 

, 3‘ Codon usage frequency is presented as a percentage of the total usage of :
corresponding sets of synonymous codons. Methionine and tryptophan are not compared
because a single codon corresponds to each of those amino acids. See footnote 3 of Table
3.2 for references on ORFs used in the calculation.

18892
18892N
18892T

I8892
IS892N
IS892T

18892
IS892N
18892T

18892
IS892N
IS892T

18892
IS892N
IS892T

18892
IS892N
IS892T

18892
IS892N
18892T

18892
IS892N
IS892T

18892
IS892N
18892T

I8892
IS892N
18892T

HHH

60
61
61

120
121
121

180
181
181

240
241
241

300
301
301

360
361
361

420
421
421

480
481
481

540
541
541

49

_______________________ >

CTAGCGTGGCAAAACTTACTACAGC‘GCCCCGAAATCCTGTAATCTTGACCTTGTAGCGA
CTAGCGTGGCAAAACTTACTACAGagGeGCaGAgATCCTGTAATCTTGAgCTTGTAaCGA
CTAGCGTGGCAAAACTTACTAGAGfigGaGCaGAgATCCTGTAATCTTGACCTTGTAGCGA

.......

—
TACTTGATTGTGTTCAAAAAAAATGCCCATCGTGCGGTCAAGCAATGTGGAATGAATACA
TACTeGATTGTGTnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TACTTGATTGTGTnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

ATAATCCTCGACATATAACAACGTTAAATGGGGTAGTAGAACTACAGCTAAAAATTCGGC
nnnnunnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

GATGTCAAAATAAGTCATGTATGCGGTATAAAAAAGCATATCGACCAGAGCAAGAAGGGT
nnnGTCAAAATAAGTCATGTATGCGGTATAAAAAAGCATATCGACCAGAGCAAGAAGGGT
nnnGTCAAAATAhGTCATGTATGCeGTATAAAAAAGCATATCGACCAGAGCAACAAGGGT

CACTCGCTCTACCACAGAACGAATTTGGTTTGGATGTfiATTGCTTATATAGGAGCATTAC
CACTCGCTCTACCACAGAACGAATTTGGTTTGGATGTEATTGCTTATATAGGAGCATTAC
CACTCGCTCTACCACAGAACGAATTTGGTTTGGATGTEATTGCTTATATAGGAGCATTAC

GCTATCAAGAACATAGAACTGTTCCACAAATACACACTCACCTTGAATTAAAGGGTATAT
GCTAECAQGAACATACAAGTGTTCCfiCAAATACACACTCACCTTGAATTAAAGGGTATAT
GCTAdCAgCAACATAGAAGTGTTCCbCAAATACACACTCACCTTGAATTAAAGGGTATAT

GTATCAGTCAACGAACGGTCACCCACGTAATTGACAGATATGACGAGTTACTTTCTTTAT
GTATaACTaAACGAACGGTCACaCACtTAATTGACAGATATGACGAGTTACTTTCTTTAT
GTATaAGTaAACGAACGGTCACaCACtTAATTGACAGATATGACGAGTTACTTTCTTTAT

GGCTAAAAGACCATAAAAGGTTAAAAACAATAGTGGCTAATCAAGGACGGGTGATATTAC
GGCTAAAAGACCATAAAAGGTT ‘I'CAATAGTGGCTAATCAAGGACGGGTGATATTAG
GGCTAAAAGACCATAAAAGaTTAAAAgCAATAGTGGCTAATCAAGGACGGGTGATATTAG

CCATTGATGGGATGCAGCCAGAAATTGGACATGAGGTATTATGGGTAATTCGAGATTGCT
CCATTGATGGGATGnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CCATTGATGGGATCnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Figure 3.4. Comparison of partial nucleotide sequences of three members of the
l8892 family from the cyanobacterium Anabaena sp. strain PCC 7120. Their L-
end terminal repeats are highlighted by an arrow above the sequence. Basepairs
different from those of I8892 are in lower case and the changed regions shaded.
Stretches of n’s represent regions not sequenced. Both possible start codons
of ORF1 are marked with a bar on top.

50

sequences of the IS elements from P8250-9 and P8250-1 O (denoted l8892N and
ISBQZT, respectively) differed slightly from that of |8892 as well as from each
other. Compared with I8892, the incompletely sequenced insertion sequences
l8892N and l8892T have a 1-bp insertion following the L-end terminus and have
at least 20 and 16 base pair changes (transition/transversion == 2:1), respectively
(Fig. 3.4). There are 8 base pair differences between the sequenced regions of
l8892N and I8892T. Most of the changes within ORF1 affect the second or the
third base of a codon and do not result in any amino-acid replacement. A few
changes affect the first base of a codon and generate conservative amino acid
replacements (data not shown). None of the basepair changes leads to the
disruption of ORF1 (even in the extended version), supporting the idea that this
ORF encodes a functional protein.

Target sequence and specificity. The junctions produced by insertion of
members of the lS892 family into the $308 gene were sequenced. All such
insertions were shown to lie within the ORF of $308 (Steinmetz et al., 1985). The
data showed that l8892 makes directly repeated 8-bp target duplications (T able
3.4). All three members of the l8892 family inserted into M rich target sites.
The sequence AAAT(a/t) appeared in all the target sites for l8892 and ISBQZT in
this experiment. The site 5’ AAAATATC 3’ appears to be particularly favorable
because at least two independent insertions by |8892, in colonies P8250-3 and
P8250-1 1, targeted this site. These two insertions recognized the same site but
inserted in opposite orientations, indicating that the orientation of a target site

does not necessarily dictate the orientation of insertion.

51

Table 3.4 Target duplications produced by insertion of members of the I8892
family in Anabaena sp. strain PCC 7120 a

 

 

Source of insertion IS element Target duplication
PS250-3 I8892 5’ 684 AAAATATC 69‘ 3'
P8250-1 5 l8892 5' 634 AAAATATC 69‘ 3’
P525041 l8892 5' 691* GATATITI' 684* 3’
P8250-6 IS892 5’ 1508* ‘leTAAAG 1501* 3'
PS250-9 lS892N 5' 1468* GTTAGATG 1461* 3'
P825040 I3892T 5’ 123‘ CAAATACT ‘238 3'

 

a Target sequences in the $308 gene are presented from 5’ to 3’ where
insertion immediately follows in the same orientation as shown in figure 3.3.
Basepair numbering is after the published sacB sequence (Steinmetz et al.,
1985), and numbers with an asterisk indicate sequence of the complementary
strand. The R—end junctions of l8892N and ISBQZT were not satisfactorily
sequenced, so that 8-bp duplications are partially assumed.

The changing genome of Anabaena sp. strain PCC 7120 and the l8892
family. The presence of active insertion sequences may strongly influence the
structure and stability of the genome by transposition, and by acting as
substrates for homologous recombination (Grindley and Reed, 1985; Galas and
Chandler, 1989). When three batches of total DNA, extracted at 1-year intervals
from serially subcultured wild-type Anabaena sp. strain PCC 7120 (always in

liquid medium, with or without fixed nitrogen source; inoculation interval: ca. 2.5

52
weeks), were digested with Xba I or EcoR V and probed with the Dra l-EcoR V

fragment of lS892, three similar, but nonidentical patterns of hybridization were
observed (Fig. 3.5b) A more dramatically different banding pattern was observed
in the genome of a culture recovered from an 8-year old frozen sample (data not
shown). The changes may reflect the activity of the l8892 family, although DNA
rearrangement not related to l8892 remains a possibility. By contrast, l8895 did
not show any changed pattern of hybridization to total DNA of several cultures
of wild-type Anabaena sp. strain PCC 7120, including one with which the
hybridization pattern of IS892 had changed (S. E. Curtis, personal
communication; personal observation). Given the comparison with l8895, and
the fact that they were most frequently observed among insertions into the $303
gene, members of the l8892 family appear to transpose actively. Anabaena
species have multiple copies of the chromosome per cell (see Chapter 2) and is
filamentous. It is unknown whether random chance or some unidentified
selective pressure led to conversion of all copies of the chromosome to the new
configuration in a relatively short period of time. It has been suggested that
some cyanobacterial strains lost some of their properties, such as the production
of gas vacuoles, in the history of pure culture (Rippka, 1988). Similarly, among
the filamentous Anabaena species, strain PCC 7118 has lost its ability to form
mature heterocysts (Elhai and Wolk, 1990), strain M-131 has lost its capability of
heterocyst differentiation (C. P. Wolk, personal communication), and strain PCC
7120 is thought to have lost its ability to produce hormogonia (Rippka, 1988).
The activity of transposable DNA elements, as visualized in cells of Anabaena sp.
strain PCC 7120, may be one of the mutational forces that led to loss of cellular

characteristics.

 

53

Figure 3.5. Southern hybridization of l8892 to total DNA of Anabaena spp. (a)
Copy number of l8892-like elements in the genomes of Anabaena sp. strains
PCC 7120 and M-131. Total DNAs from strain PCC 7120 (lanes 1 and 2) and
strain M-131 (lanes 3 and 4) were digested with EcoR V (lanes 1 and 3) or
Xba I (lanes 2 and 4) and probed with the radioactively labelled internal Dra l-
EcoR V fragment from lS892. The unnumbered lane on the left indicates sizes
of DNA (in kilobases). (b) DNA rearrangement in the genome of Anabaena sp.
strain PCC 7120. Total DNA extracted from a serial subculture of this strain of
Anabaena sp. at the beginning of the years 1989 (lane 1), 1990 (lane 2) and 1991
(lane 3) were digested with Xba I and hybridized with the same probe used in
panel A. One of two 3.6-kb bands in the earliest batch of DNA was replaced by
a 3.4- or 1 .9-kb band in subsequent DNA samples (arrowheads).

54

 

we. . 1.9—un-

55
Southern analysis of EcoR V- or Xba I-digested total DNA from four

cultures (one shown in Fig. 3.5a) of wild type Anabaena sp. strain PCC 7120
showed that there were at least nine copies of members of IS892 family in the
genome (two cultures showed ten distinct bands). It was not determined which
hybridizing band corresponded to a particular member of the l8892 family or
whether all hybridizing copies were capable of transposition. No data are
available to indicate whether members of the l8892 family transpose in a
conservative or replicative manner. The same probe was also used to probe
total DNA of E. co/iHB101(pRL528) and DH5a, transient hosts of plasmid pRL250
during conjugation and transformation. Under the standard, high-stringency
conditions employed, no hybridization was observed, thus excluding the
possibility that l8892 had been derived from cells of E. coli.

Unique nucleotide structure of l8892. The sequence comprising the two
stem-loop structures in the region between ORF1 and ORF2 show some similarity
to those of the terminal repeats. When properly aligned, a 32-bp sequence,
which I denote the M sequence (bp 953 to 984, in which the first stem-loop is
formed [Fig. 33]), could be viewed as an imperfect direct repeat of the R-end
terminal sequence (and therefore as an imperfect inverted repeat of the L end).
Discounting the 6 bases that introduce gaps in the alignment, 20 of 26 bases in
the M sequence are identical, in order, to 20 of the 26 bases at the R-end (Fig.
3.6). Downstream from the M sequence is another stem-loop structure (denoted
the N sequence) which is immediately preceded by the dam methylation site (Fig.
3.3). The sequence of one arm of this stem-loop, 5’ TITACCAC 3’ (bp 1060 to
1067), is exactly repeated in the R-end sequence. With such unique sequence

structure, l8892 could form, in addition to a normal " racket frame " structure

56

26* GTCT CTAGTAA GTTTTGCCA CGCTAG 1* L—end sequence

953 TTCTfitfifiCTAATGAtGGTCfi::CCACCAgTAG 984 The M sequence
1650 TTCT CTAGTGA GTTTTACCA CACTAG 1675 R-end sequence

** ** ***

GCCT CATTAGG 11-bp direct repeats
of the nifD element '

 

 

 

Figure 3.6. Alignment and comparison of the M sequence to the L-end and R-
end sequences of I8892, and of those three sequences to the 11-bp directly
repeated sequence flanking the 11-kb insertion (the nifD element) interrupting the
nifD gene in the chromosome of the same strain of Anabaena sp. All sequences
are presented in 5’ to 3’ order. Inverted repeats in the three sequences are
marked with arrows underneath the sequences. The strand complementary to
the L-end sequence in Fig. 3.3 is shown (numbered from large to small, with an
asterisk), and base 25 (T) is for l8892N and lS892T only. The six bases in the
M sequence that introduce gaps in the alignment are presented in lower case.
Non-matching bases are shaded. Matching bases between the 11-bp repeat of
the nifD element and the other three sequences are indicated with asterisks.

57
(Sakaguchi, 1990), an alternative secondary structure that contains a mini l8892
element bearing only ORF1 (Fig. 3.7).

Alternatively, the M and R-end sequences could be viewed as direct
repeats containing intrinsic inverted repeats. Such a structure surrounding ORF2
is reminiscent of the aadA and satgenes in Tn7 and related Tn 1825, which were
suggested to have inserted into the transposons via integrase-mediated site-
specific recombinations (Fling et al., 1985; Sundstrbm et al., 1991).

To observe whether the postulated mini l8892 transposes, or whether
ORF2 is removable from l8892, the 0.85-kb Dra l-SnaB I fragment (L end to M)
and the 0.5-kb Hind lll-EcoR V fragment (M to R end) from I8892 (see Fig. 3.3)
were individually‘used to probe EcoR V- or Xba l-digested total DNA. Patterns
of hybridization by both probes were identical to that by the Dra l-EcoR V
fragment containing both ORF1 and ORF2 (Fig. 3.5a), suggesting that
transposition of the complete lS892 is the predominant event. A computer
search of both ORFs of l8892failed to identify a structural motif similar to the one
that is conserved in the integrase family of site-specific recombinases (Argos et
al., 1986).

Resemblance of l8892and the nifD element. The nifD element is an 11-kb
sequence interrupting the nifD gene in the chromosome of vegetative cells of the
same strain of Anabaena sp., and it is excised from the chromosome by site-
specific recombination between its 11-bp directly repeated border sequences in
a late stage of heterocyst differentiation, whereupon a functional nifD gene is
created (Golden et al., 1985; Lammers et al., 1986; Golden and Wiest, 1988). Six
or 7 bases of the sequence of that 11-bp recombination site were found to be

identical to corresponding bases ( no gaps introduced in the alignment) in the

58

 

823823 6on =m E 88% 2a .Aomomcmv .m
<00 .m ocm .m 05. .m .wEoE magma 9: 6 Son ._o 25 .mmEBSU 9.: Co Eu: 9.: 9 Esocm w_ mccfiommmo 8:950
@5826 82-89% 65me m E22 tom: 3 cmo mocozomm 95$ 2.: Egg “0: m_ 82 5:25 £5 costs 82 5:95
m c_ NHEO £3 88038 ocmi 05 new 2 or: _o meta; .Emo 2:0 9me $5 EmEmE N39 _c_E 9288 8 E52
9 :8 $8908 _2 me. new .80 ._ we: 22:; c_ 83025 Emocoomm 82-0538 35598 cm ”.88 .633 .muEO
ocm Emo 95988 A2 98 5; $5826 82-8me 02; oozoc om_< .82: .389me U_I_ ocm ommmoomcmb mm. :03
8665 Co c2669: 3 cowoqm§2 <20 829883233 65.. 9 :3 E752 8:82: 05 52:; E 93.02% __mEmc
“0x03: _mEzoc m ”_ocmo Loo: Nmmw. >2 ooEqu on 9300 SE $56:un bmocoomm mozoflosc 6.96.0.8 Nd 950E

 

59

aooa1umum m

5.5.4-0-

«a

a2 _

0.0

4.8

U .0 ~
A

AOOHLEoum z.q

 

“Tawny...
639
9-0-... Aim... 6......
moo Leona . _ . . .
H m z oééééééé
.m o-<-e-o-<-o-me.3mm-<.o.o-o3746-42..- a _
me a. a. a. a. 4 .8
Pa 2.
< < H. 0<
8 Cd < 0
.H. o< 4‘ 0H.
a a e a
H. 0‘ 4 o
\ / H .<
o .o
w /

mooa1uouw Mod
mooa1ueum z

-<-o-o.me.mw-<.od-o-e-<io-<-e-
awe...” .1 a. i i
e. .4.
a...
a...
9%

o < mooaiumum z

.oioélmwemééé-
mg
..m

.I.

 
 

 

60

sequences comprising the intrinsic repeats in the termini of I8892 and in the M
sequence (Fig. 3.6). The nifD element also has essentially the same G+C
content and codon usage as I8892 (r able 3.2 and 3.3). However, no significant
sequence similarity was found between l8892 and the nifD element, except for
their termini.

Distribution of ISM lS892 from Anabaena sp. strain PCC 7120
hybridized to genomic DNA from several other strains of Anabaena spp. and
Nostoc spp., which are filamentous (in Section IV of the 1979 Rippka Assignment
[Rippka et al., 1979]), including Anabaena sp. strain M-131 (lanes 3 and 4 of Fig.
3.5a), Anabaena sp. strain PCC 7118, Nostoc sp. strain Mac, Nostoc
ell/psosporum, and Nostoc sp. strain ATCC 29150 (none of the hybridizations
give identical banding patterns; T. Thiel, personal communication), but did not
hybridize to genomes of the heterocystous filamentous strain Anabaena variabilis
ATCC 29413, the nonheterocystous filamentous strain Pseudanabaena sp. (in
Section III of the 1979 Rippka Assigment), and the unicellular strains
Synechocystis sp. strain PCC 6803 and Synechococcus sp. strain PCC 7002
(both are in Section I of the 1979 Rippka Assigment) (T. Thiel, personal
communication). I attempted to entrap an active l8892-like transposable element
from Anabaena sp. strain M-131, which is also sensitive to sucrose when bearing
pRL250 (see Chapter 2), but failed (unpublished results). It is possible that the
lSBQZ—hybridizing elements in Anabaena sp. strain M-131 transpose relatively

infrequently or no longer at all.

 

 

Chapter 4

STUDY OF GENES THAT RESPOND EARLY TO
NITROGEN-STEPDOWN AND OF OTHERS
THAT REGULATE THEIR EXPRESSION 1

SUMMARY

Filamentous cyanobacteria of the genus Anabaena are of developmental
interest because, When deprived of fixed nitrOgen, they show patterned
differentiation of Nz-fixing cells called heterocysts. To help elucidate the early
responses of these organisms to nitrogen-stepdown, mutants were isolated that
responded rapidly to removal of fixed nitrogen. This was accomplished using a
derivative of transposon Tn5 that incorporates the promoterless bacterial
luciferase genes, luxAB, as a reporter of gene transcription. Two mutant strains,
TLN2 and TLN6, showed increased luminescence within 1 or 4 hr, respectively.
Using a coliphage T7-based transcription-amplifying system, tln6-directed

luciferase activity at single-cell level was observed by microscopic photon-

 

1 Part of the contents of this chapter has been published in the Proceedings of
the National Academy of Sciences, U.S.A. (Wolk, Cal, and Panoff, 1991).

61

 

62
counting and was found distributed unevenly along the filament at the earliest
time point of observation, 7 hr after nitrogen-stepdown.

Mutations in strains TLN2 and TLN6 were further characterized and
localized in the chromosome. The fusion of each mutant gene to luxAB was
regenerated in the wild-type chromosome using sacB-mediated selection for
gene replacement, and the resulting mutants were subjected to secondary
mutagenesis by a Tn5 derivative that lacks quAB. Four secondary mutants were
isolated which showed altered tln6::luxAB expression and were defective in

heterocyst differentiation.

INTRODUCTION

The cyanobacterium Anabaena sp. responds to starvation of fixed nitrogen
by initiating the differentiation of Nz-fixing cells called heterocysts at semi-regular
intervals along its filaments (Wolk, 1982). Genetic studies in recent years have
been directed toward analysis of 1) the process of heterocyst differentiation and
2) the mechanism of heterocyst pattern formation.

The availability of molecular tools has made Anabaena sp. a model
prokaryote for study of multicellular development and cellular differentiation.
Bacillus subtilis, a gram-positive, sporulating bacterium, and Myxococcus
xanthus, a gram-negative bacterium which shows colonial morphogenesis, are
other such models that have been extensively studied in these regards
(Gottesman, 1984; Dworkin, 1985; Kroos et. al., 1986). Studies on B. subtilis
suggest that a phospho-transfer pathway (Burbulys et al., 1991) is involved in the
initiation of sporulation, and that during endospore formation, gene expression

is controlled by a cascade of sigma (0) factors (Stragier and Losick, 1990).

63

Expression of many developmentally regulated genes in Myxococcus sp. has
been shown to be dependent on a sequence of intercellular interactions (Kroos
and Kaiser, 1987). In Anabaena sp., mutants lacking or defective in heterocyst
differentiation have been isolated by UV or chemical mutagenesis (Wolk et al.,
1988; Buikema and Haselkorn, 1991a). Some of these mutants have been
complemented and the complementing genes studied in detail (Holland and
Wolk, 1990; Buikema and Haselkorn, 1991b). In addition, rearrangements of
DNA at a late stage of heterocyst differentiation have also been reported (Golden
et al., 1985; Haselkorn, 1989). Nonetheless, few genes that are important
specifically for the development of Anabaena sp. have been characterized. The
regulation of the expression of these genes and possible regulatory relationships
between them, are virtually unknown. The differentiation process in Anabaena
sp. is accompanied by the compartmentalization of gene expression, with certain
genes (e.g., the rbcLS genes) being transcribed only in vegetative cells and
others (e.g., the nifHDK genes) only in heterocysts (Elhai and Wolk, 1990). The
possible role of RNA polymerase modification by alternative 0 factors has begun
to be examined. At least two genes for 0 factors have been identified tentatively
on the basis of their hybridization to the gene (sigA) encoding the
‘housekeeping" a factor of Anabaena sp. strain PCC 7120 '(Brahamsha and
Haselkorn, 1991). One of the proposed genes, sigB, was observed to be
transcribed only under nitrogen-fixing conditions. lnsertional inactivation of the
gene, however, did not appear to affect heterocyst differentiation or nitrogen
fixation (Brahamsha, 1991; B. Brahamsha, personal communication).
Anabaena sp. provides an opportunity to elucidate, in a morphologically

simple organism, the detailed biochemical mechanisms that govern the formation

 

__.____,.-.- Hau- wu- .‘fi o~--—¢—H

64
of multicellular patterns. The pattern of spaced heterocysts has been suggested
to arise de novo by two very distinct, but experimentally distinguishable
mechanisms (Wolk, 1989).

According to the first mechanism, sometimes called the "altruistic" model,
and which I call the volunteer model, the first cells that sense nitrogen-stepdown
differentiate to form heterocysts voluntarily, and produce and maintain the
heterocyst-distribution pattern by exporting a differentiation-inhibiting substance
to adjacent vegetative cells. It should be noted that in this model the inhibitory
substance that ultimately governs pattern formation is distributed simultaneously
with the onset of heterocyst differentiation by the few early volunteer
proheterocysts. All genes induced by -N condition are directly involved in the
differentiation program although they are not necessarily involved in either
differentiation or pattern formation.

According to the second mechanism, sometimes called the I‘selfish " model,
and which I call the scavenger model, the first cells that sense N-stepdown
activate a system that scavenges nitrogen from acfiacent cells; consequent
deprivation of the latter cells of nitrogen leads them to activate a nitrogen-
scavenging system that drains nitrogen from their distal, neighboring cells; and
so on along a filament. The last cell of a group of contiguous cells that senses
nitrogen deprivation, unable to tap any source of nitrogen other than N2, is
stimulated to differentiate to form a heterocyst. The scavenging stage that occurs
between vegetative growth and the onset of heterocyst differentiation is a distinct
feature of this model. Mutation of genes involved in scavenging may not prevent
the formation of heterocysts although the pattern of heterocysts would be

expected to be altered.

 

65

Because the two models lead to different predictions about possible
spatial relationships between the cells that differentiate and the cells that first
sense N-deprivation, the models might be tested experimentally as follows. The
promoter of a gene that is activated very early after N-stepdown should be fused
to a promoterless reporter operon, e. g., the luciferase genes luxAB, and
expression observed at a single-cell level. According to the volunteer model,
expression would be observed first in the cells that will eventually become
heterocysts. In contrast, according to the scavenger model, that expression
would be initiated in cells that are distant from the sites of eventual heterocyst
formation (Wolk, 1989).

The wild-type transposon Tn5 (Berg, 1989) has been shown to transpose
in Anabaena sp. strain PCC 7120 (Borthakur and Haselkorn, 1989), and
derivatives of Tn5, including those that contain reporter genes, have been
constructed for use in Gram-negative eubacteria (Boivin et al., 1988; Simon et al.,
1989; de Lorenzo et al., 1990). The genes (luxAB) for the light-emitting protein
complex, luciferase, have been shown to permit localization of transcription from
specific promoters to individual cells of a filament (Elhai and Wolk, 1990). A
derivative of Tn5 that incorporates the Vibrio fischeri luxAB as a transcriptional
reporter was constructed and used to mutagenize wild-type Anabaena sp. strain
PCC 7120. Anabaena genes that are activated rapidly in response to removal
of fixed nitrogen were thereby identifed. One of these genes, tln6, increases its
expression within 4 hr after removal of nitrate from the medium. Expression of
tln6::luxAB along the filament was also examined.

Restriction with enzymes for which sites are present in the transposon and

in few copies in the genome (Bancroft and Wolk, 1989) allowed mapping of the

66
site of insertion with a resolution of ca. 10 kb, by pulsed-field gel electrophoresis.
The direction of the transcription reported by the transposon was determined by
hybridization to blots of the pulsed-field gels. Genomic DNA contiguous to the
insertions was recovered by transfer to E. coli by electroporation. . The tln6::luxAB
fusion was then regenerated by introduction into the wild-type genome of a
luxAB-bearing cassette that bears no homology to transposon Tn5. The resulting
mutant was subjected to secondary transposon mutagenesis to identify genes
that control both the expression of tln6 and eventual heterocyst differentiation.
Such genes may be useful in elucidating the mechanisms underlying heterocyst
differentiation and pattern formation. They may include the genes that, by

sensing N-starvation, lead to initiation of patterned formation of heterocysts.

MATERIALS AND METHODS

Bacterial strains and plasmids used are listed in Table A2 and Table A3
of Appendixes B and C, respectively. Anabaena sp. strain PCC 7120 and its
transposition- or gene replacement-generated mutants were groWn with AA-
based media (Allen and Arnon, 1955) supplemented with various concentrations
of neomycin (Nm), streptomycin (Sm), and/or spectinomycin (Sp), as appropriate.
The concentrations of antibiotics used are presented in Appendix F. Media used
are described in Appendix A. L-methionine-D,L-sulfoximine (MSX), an inhibitor
of glutamine synthetase (GS), was used at a concentration of 1.0 mM.

Plasmids bearing transposons were transferred from E. coli to Anabaena
sp. by triparental matings (Wolk et al., 1984) which were performed on filters
(Type REC-85 pre-sterilized filters, Nuclepore Corp., Pleasanton, CA) atop

solidified AA plus nitrate media (with or without 5% LB). About 1 x 107 to 5 x 107

67
cells of Anabaena sp. were plated on a 100-mm Petri dish. Cell counts were
estimated from methanolic extracts of cells (Mackinney, 1941) by assuming a
content of 0.4 pg of chlorophyll a-per cell. Nitrogen-stepdown of transposition-
generated colonies was initiated by moving the filter onto solid medium free of
fixed nitrogen. Colonies of interest were purified as described (Wolk et al., 1984).

Luminescence of colonies on a Petri dish was monitored (Maly et al., 1988)
with the Hamamatsu Photonic System model 01966-20 (Photonic Microscopy,
Inc., Oak Brook, IL) coupled to a Nikon 35-mm f 2.0 macro-lens. Several pl of
n-decanal (C10H200; catalog # D-7384, Sigma Chemical Co., St. Louis, MO.),
spread inside the top of a glass Petri dish, provided substrate for luciferase. The
top of a plastic disposable Petri dish was used in the initial experiments but this
procedure was later discontinued because the aldehyde slowly etched, and
reduced the transparency of, the plastic. Exposure of cells to aldehyde was kept
to no more than a few min., usually less than 2 min. . After imaging of
luminescence, the Petri dishes were blown with sterile air until free of an odor of
aldehyde, and were provided with new. covers. Microscopy and localization of
luciferase activity of individual cells along the filament were performed as
described previously (Elhai and Wolk, 1990)

Mutants with a particular temporal response of luxAB activity to N-
stepdown were first identified on mating filters. Such mutants were then picked
and streaked onto NO3‘-containing agar medium. Cells from these streaks were
resuspended in AA/8 + N03" liquid medium for 6 to 16 hr under growth
conditions and then 4 or 6 replicative spots were made from 2 or 3 pl of each of
the suspensions on a filter atop N03'-containing agar. medium. After 1 to 2 days

of cell growth, half of the filter was transferred to agar medium free of fixed N for

 

68

a period of time before the other half was transferred to the same petri dish and
imaged under the Photonic camera. Many N-responsive mutants initially picked
from mating filters were re-examined this way. More precise measurements of
induced luxAB activity were performed by the time—course induction assay of
artificial colonies: 2-pl portions of a culture of a mutant of interest, growing
exponentially or nearly so (0.0.665 of a methanolic extract of a liquid culture 5
0.2) in medium AA/8 + nitrate + appropriate antibiotic(s), were spotted onto cut
pieces of filter atop solidified AA medium containing nitrate or ammonium plus
appropriate antibiotic(s) to form homogeneous and nearly identical artificial
colonies. About 2 days thereafter, and at various times, pieces of filter bearing
artificial colonies were transferred to solidified basal AA medium plus antibiotic(s)
before imaging of luminescence from all spots (see Fig. 4.10).

Most molecular biological techniques were standard, as described in
chapters 2 and 3. DNA of high molecular weight was prepared, digested with
appropriate restriction endonucleases, and subjected to pulsed-field gel
electrophoresis, and Southern analysis of the gels performed, as described
previously (Bancroft et al., 1989) except that digested samples were not treated
with Proteinase K In order to recover genomic sequences contiguous with the
transposon, DNA extracted from Anabaena sp. (using the glass-bead method,
see chapter 2) was digested with appropriate restriction enzymes, self-ligated,
and transferred into E. coli HB101 by electroporation (Dower and Ragsdale,
1988). DNA so extracted was also used for most of the Southern analyses.
Introduction of a specific mutation into the Anabaena genome was achieved

using the sacB-mediated gene replacement procedure described in chapter 2.

69

RESULTS

Construction of Tn5-derived transposons and of the BLOS cassettes. The
promoter-probe transposon, Tn5-1063 (Fig. 4.1), was constructed by C. P. Wolk
(Wolk et al., 1991). This Tn5 derivative retains, from Tn5 lac (Kroos and Kaiser,
1984; Kroos et al., 1986), 53 bp of the outside end of I850L that enable
transposition, and that allow outside promoter activity to control transcription of
the reporter genes luxAB from V. fischeri (via pRL488; see Elhai and Wolk, 1990)
that are placed immediately downstream. The 53-bp fragment introduces stop
codons in all three reading frames, preventing the formation of fusion proteins
with the reporter luciferase. The transposon contains a p15A origin of replication
(oriV) from the plasmid pACYC184 (Chang and Cohen, 1978; Rose, 1988) that
functions in E. coli (but not in Anabaena sp.), and therefore enables DNA
contiguous with the transposon to be recovered from the Anabaena genome by
excision, circularization, and transfer to E. coli. Excision is possible using
enzymes, including Cla I, Dra I, EcoR l, EcoR V, Sca l, and Spa I, that cut the
genome frequently but do not cut Tn51063. In addition, Eco47 Ill and Mlul may
be used to clone Anabaena DNA lying to the L and of the transposon, and Xba
I to clone Anabaena DNA lying to the R end of the transposon (see Fig. 4.1).

Wild-type Anabaena sp. is sensitive to Sm, Nm or Bm at 1, 25, or 0.2
ug/ml when (ca. 5 x 107) cells containing 15 pg of chlorophyll a are plated on
agar medium in a 100-mm Petri dish. Anabaena sp. bearing wild-type Tn5 was
reported to be resistant to Nm at 30 pg/ml (Borthakur and Haselkorn, 1989) but
is sensitive to 1 pg Sm/ml (our observation). In Tn5-1063 the wild-type Tn5
promoter of the antibiotic resistance operon is replaced with the psbA promoter

from Amaranthus hybridus (Hirschberg and McIntosh, 1983; L. McIntosh,

70

personal communication), and the wild-type Smr gene is replaced with the Smr
gene from plasmid pPM111*. A 6—bp deletion in the 3’ region of the Smr gene
in pPM111* results in greatly enhanced resistance to Sm in E. coli (Mazodier et
al., 1986). The presence of Tn5-1063 confers greatly enhanced resistance to Bm,
Nm, and Sm upon Anabaena sp. Strains of Anabaena sp. bearing Tn5-1063 can
be selected on 400-500 pg Nm/ml, 1-4 ug/ml Bm, or 5-20 pg/ml Sm. Selection
after mating was carried out with either 400 pg Nm/ml or 10 pg Sm/ml. At 400
pg Nm/ml, inoculation with more than ca. 3.8 x 107 cells (i.e., containing >15 pg
of chlorophyll a) of Anabaena sp. per mating filter can lead to confluent growth.
The lawn on the mating filter can then be cleared, and true transposition-derived
colonies permitted to grow, by transferring the filter to 20 pg Sm/ml or 4 pg
Bm/ml. Experiments (Fig. 4.2) in which ca. 3,000 transposon-derived colonies
were generated per filter were performed with mating filters treated with 20 pg
Sm/ml after overgrowth of Anabaena sp. on initial Nm selection.

Two additional modifications were incorporated into Tn5-1063 with the aim
of increasing the frequency of transposition relative to wild-type Tn5. Addition of
a rho-independent transcriptional terminator from the [pp gene of E. coli (Tipp)
(from pJDC406; Coleman et al., 1985) near the 3’ end of the Smr gene may
reduce antisense transcription of the transposase gene from the strong psbA
promoter. The 5’ GATC 3’ sequences in the promoter region of the transposase,
which when dam-methylated reduce transposition of wild-type Tn5 (Wn et al.,
1988, Dodson and Berg, 1989) in E. coli, were eliminated by replacement with
. sequences from pRZ1107 (Yin et al., 1988) in order that the frequency of
transposition of the transposon not be reduced by the dam methylation of

Anabaena sp. (Padhy et al., 1988).

71

A 0.7-kb fragment containing an RK2 origin of transfer (oriT) from plasmid
pAT187 (T rieu-Cuot et al., 1987), bordered by polylinkers and short sequences
from ColE1 and pBR322, connects the ends of Tn5-1063 to form plasmid
pRL1063a. This oriT permits efficient mobilization of the plasmid from E. coli to
Anabaena sp. Plasmid pRL1063a lacks sites for Ava Ill and Avr ll, Type-ll
restriction enzymes derived from strains of Anabaena sp. (T andeau de Marsac
and Houmard, 1987), and so would not be restricted by those enzymes upon
transfer into those strains.

The Tn5 derivative Tn5-764 is present in plasmids pRL764 (Fig. 4.1) and
pRL764SX. Plasmid pRL764 was derived from plasmid pRL1058 (the luxAB-less
progenitor of pRL10633) by deletion of the 1,250-bp Sma I fragment that contains
a large portion of the Bmr gene and the entire Smr gene. Plasmid pRL764SX
was derived from pRL764 by deletion of the short fragment from Sma l (at the
transposase-proximal end of oriT) to EcoR V (in polylinker a). In addition to
retaining useful features of pRL1058, except for the Bmr and Sm’ determinants,
pRL764SX allows easy replacement of the oriV-containing fragment (BamH | or
Xba I to an I) and the antibiotic resistance cassette (anl or partial Mam I to
Sma I) with desired alternatives.

The transposition frequencies of Tn5-1 063 (7.83 kb) and Tn5-764 (4.15 kb)
in Anabaena sp. strain PCC 7120 are ca. 1 x 10 '5 to 4 x 10 '5, and 3 x 10 '5 to
9 x 10 ‘5 per cell, respectively. The slightly higher frequency of transposition of
Tn5-764 may be attributable to its smaller size, which is closer in size to the wild-
type Tn5 (5.8 kb; Berg, 1989) than is Tn51063.

Two other Tn5 derivatives, Tn5800 and Tn51087b, were also used in the

experiments described in this chapter. Plasmid pRL800, bearing Tn5-800, is a

72

Figure 4.1. Essential features of (a) plasmids pRL1063a and pRL764; (b)
transposons Tn5—1063, Tn5-1058 and Tn5-764; and (c) the BLOS cassettes.
Details of the structure of plasmid pRL1063a are presented in Wolk et al. (1991).
Plasmid pRL1058, bearing Tn5-1058, is the precursor of pRL1063a (bearing Tn5-
1063) and pRL764 (bearing Tn5-764). The genes luxAB from Vibrio fischeri in the
form of a BamH I fragment from pRL488 (Elhai and Wolk, 1990), provided with
Xba I ends by passage through pRL498 (Elhai and Wolk, 1988a), was inserted
into the Xba I site of pRL1058, giving pRL1063a. Plasmid pRL764 was made
from pRL1058 by deleting the 1.25-kb Sma I fragment that includes a large
portion of the Bmr gene and the entire Smr gene. Only restriction sites within the
transposon and mentioned in the text are shown. Polylinker a is, clockwise,
EcoR l - Clal -EcoRV -(Xba I) -Bg/|l -Xhol - Sstl -Nrul -Hind lll -Sphl -
Pst l. Polylinker b is Sa/l - Pstl - Sphl - Hind Ill - Nrul - Sstl -Xhol - Bgl |l -
(Xba I). The Xba I sites in parentheses are methylated by dam+ strains of E coli.
The left (L) and right (R) ends of the transposons are indicated (4, >). An open
triangle at the end of the Smr gene depicts the 6-bp deletion, and the two dots
at the promoter region of the transposase gene represent the two mutated
5’ GATC 3’ sequences (see text). Components of the BLOS cassettes are
described in text. The 54-bp EcoR V-Eco47 lll fragment is deleted in cassette
BLOS2; in addition to that 54-bp deletion, the BamH | site (not shown) 3’ from
luxAB is also eliminated in cassette BLOSS (see text).

asal‘;
will?
dollI
III-Si
Ml.
self:-
,llnli'
elwoi
grill-‘5
welt“
M
will?

Pstl
Eco47 i ll

Bglll

|_ lax/l

73

 

Xbal
it
Sma I ""'plll
a (”oriT L
.’ (RK2) O luxA
8 kb 1
Tn’ase
quB
7 Sphl
2
pRL1-063a
oriV Xbal
6 ( p1 5A)
3
T,,,,,
S I 5 PpsbA ‘
ma A Sm 4 Nm
Brn Pstl
Eco47Ill psu SphI
$3” Sma I
I 1.0 kb
onV(p15A) pr

Sma I I

b

quA

“"3 aadA Prbc '

Alel

onV(p15A) T”,

L I Ppsm Nm Bm Sm R Tn’ase n

oriV(p15A) Th,

L I PpsM Nm 1 [ Tn’ase R

T17 orIT(pMB1)
onV(pMB1)

(EcoRV) (500471") 33mm

1.0 kb
H

 

Tn5-1063 (7.3 kb)

Tn5-1058 (5.4 kb)

Tn5-764 (4.2 kb)

BLOS (5.6 kb)

74
derivative of pRL1058. In pRL800, the sequence of pRL1058 from bp 65 (Xbal
at the L end, destroyed) to hp 3871 (Bc/ I, destroyed) is replaced by the following
sequence (in the same direction): first, 36 bp from bp 1584 (Asu ll, destroyed)
to bp 1620 (SnaB l, destroyed) of plasmid pJRD184 (Heusterspreute et al., 1985),
then an A, then the 956-bp Cmr determinant from bp 4357 (Asu ll, destroyed) to
bp 5312 (Asu lI, destroyed) of plasmid pBR325 (Balbés et al., 1986), then bp
3292 (EcoR l) to bp 2378 (Sal l, destroyed) and hp 6115 (Nde I, destroyed) to
bp 4616 (Avr ll, destroyed) from plasmid pRL271 (chapter 2), then 5’AG 3’. This
sequence was joined to bp 3871 of pRL1058 by ligation of a BamH l-generated
5’ overhang to a BC! I-generated 5’ overhang. The termination codon (T GA) of
the transposase gene, falling within the BC! I site, was not altered in the
manipulation. Overall, the BamH l-Xba l-oriV(p15A)-Nm'-Bm'—Sm'-Bcll fragment
in Tn5-1058 is replaced by a BamH I-Xba l-Cm'-Em'-oriV (pMB1)-BamH I
(destroyed) fragment in Tn5-800. The transposon Tn5-1087b (C. P. Wolk,
unpublished) is very similar to Tn5-800. In Tn5-800 the cat and arm genes
(comprising the Cm' Emr cassette C.CE3) point in the same direction, while in
Tn5-1087b (which contains cassette C.CE2) the cat gene points in the opposite
direction. Because the cat gene of Tn5-1087b is not followed by a transcriptional
termination signal, the cat transcript may read out of the L end, or read-through
from outside of the L and may produce an anti-cat transcript, after transposition.
Both Tn5-800 and Tn51087b transpose in cells of Anabaena sp. strain PCC 7120
at a frequency close to that of Tn5-764.

The BLOS cassettes (Fig. 4.1) were designed specifically for replacement
of transposon Tn51063 in recovered Anabaena DNA fragments into which the

transposon had inserted. Cassette BLOS1 has the following components: bp 1

75
to 2415 are Sst l-luxAB-BamH I from pRL488 (Elhai and Wolk, 1990), bp 24161

2560 are BamH l-T17-Bgl ll (destoyed) from pET3 (Rosenberg et al., 1987), l:
2561 -2567 are BamH l (destroyed)-Dra l (destroyed) from pRL25 (Wolk et a
1988), the following 1724 basepairs are a trimmed Sm'l/Spr cassette 0.5
(Bancroft and Wolk, 1989) which now retains the portion from bp 1,463 (Stu
destroyed) to bp 5 (Ava I, destroyed) of the aadA sequence (Fling et al., 1981
and bp -410 to bp -160 (Nla III; in the article by Bancroft and Wolk [1989] it we
incorrectly reported as -240; C. P. Wolk, personal communication) that contair
the promoter for rbcLS (Pm) of Anacystis nidulans (Shinozaki and Sugiur
1985). Next (this ligation generated an EcoR V site), bp 4292-4374 are bp 44
to 525 (SauQG I) of pBR322, and then bp 4375-5658 are Sa096 l (bp 1951)-ori
oriV-Dra I (bp 3234, destroyed) from pBR322. Finally, a Sma l (destroyed
BamHl linker at bp 5659-5666 completes cassette BLOS1. The EcoR V si
upstream from Pmc in BLOS1 was eliminated by cutting with EcoR V and Eca
Ill, and religating, thus deleting 54 bp and forming BLOSZ. The ends of tI
BLOS cassettes (BLOS1 is present in pRL739, pRL7398, and pRL7398; BLOS
is present in pRL759 and pRL7598) are connected by different polylinke
depending on the plasmids in which they reside. The polylinker in pRL739 at
pRL759 is ( from the luxAB-distal end ) BamH I - Xba I - Sall - Pstl - Sph
Hind Ill - Nrul - Sstl - Xhol - Bgl ll - (Xba I) - Kpn l - Sstl (luxAB-proximal em
in pRL7398 and pRL7598 is BamH l - Sma l - Kpnl - Set I; and in pRL739S
BamH l - Xba I - Sail - Pstl - Sphl- Hind lll - Nrul- Sstl. The Xbal site
parenthesis is methylated by dam+ strains of E. coli. The BamH I site 3’ frc

luxAB in BLOS2 in pRL759 was eliminated by a filling-in reaction using T4 DI

76
polymerase, producing cassette BLOS3 in plasmid pRL7590 (T. Black and C. P.
Wolk, unpublished results).

As described in the text below, a BLOS cassette is used both as a
reporter of transcription and as an inactivation cassette (see chapter 2). A
mutation in a DNA fragment of Anabaena sp. containing a BLOS cassette was
introduced into the wild-type chromosome by the sacB-mediated positive
selection for double recombinants (chapter 2); in the two particular manipulations
described in this chapter, the sacB-containing plasmid pRL278R was used.
Plasmid pRL278R was derived from plasmid pRL278 (Fig. 2.4) by digestion of
pRL278 with EcoR V and religation. The desired product of this ligation,
pRL278R, had the 2.5-kb EcoR V-oriV-on’T-EcoR V fragment inverted as
compared to pRI278. The sacB-C.K3 (Km'le') fragment of plasmid pRL278R
can be excised by digestion with Asu II (which produces C/a I-compatible
5’ overhangs), BamH l plus Bgl ll, EcoR V, or Xba I.

Use of Tn5-1063 with luciferase as a reporter to identify genes that
respond rapidly to nitrogen-stepdown, and study ofthe induction of those genes.
When viewed through the Photonic System, a mating filter (on solid medium
containing N03) with hundreds or thousands of Tn5-1063 transposition-derived
colonies (Fig. 4.2a) shows many sources of light (Fig. 4.2b). The luminescent
intensity of the colonies is re-observed after transfer of the colony-bearing filter
to agar medium free of fixed nitrogen for a period of time (Fig. 4.2c).
Comparison of images of luminescence observed before and after the shift of
medium identifies light sources that respond to nitrogen -stepdown. By superim-

posing an image of luminescence and a corresponding analog ( bright-field )

 

 

77

Figure 4.2. Screening of transposon-mutagenized colonies of Anabaena sp.
strain PCC 7120 to identify mutants that respond to removal of fixed nitrogen
from the medium by increase or decrease of luminescence. (a) Photograph of
a filter bearing thousands of colonies derived from transposition of Tn5-1063, and
luminescent (photon-counting) images of the filter prior to N-deprivation (b) and
after 6.5 hr of deprivation of fixed N (c). Colonies indicated with arrows, including
the colony from which mutant TLN6 was derived, showed increased
luminescence in response to N-deprivation. Colonies indicated by arrowheads
showed reduced luminescence.

78

 

79
image, specific colonies of interest can be readily identified and picked from the
mating filter.

Filters containing several thousand colonies derived from transposition of
Tn5-1063 were used in the initial experiments. Two mutants, TLN2 and TLN6,
that responded rapidly to N-stepdown by increase of luminescence were chosen
for intensive study.

The genes fused with luxAB in mutant Anabaena strains TLN2 and TLN6
were denoted tan and tln6, respectively. Artificial colonies of purified mutants
TLN2 and TLN6 showed increased luminescence within 1 or 4 hr, respectively,
after N-stepdown (Fig. 4.3). As shown in Fig. 4.3, induction of tan and tln6
appeared to be specific to the removal of nitrate from the medium rather than to
the reduced ionic strength in the nitrate-free medium from which nitrate had
simply been omitted.

In cyanobacteria, nitrate is reduced to nitrite and then to ammonium by
ferredoxin-dependent nitrate reductase and nitrite reductase (Manzano et al.,
1976). Ammonium, the end product of the nitrate-reduction pathWay, is funneled
to the cellular amino-acid pool by the glutamine synthetase/glutamate synthase
(GS/GOGAT) system. Glutamine synthetase (GS, encoded by the gInA gene;
Turner et al., 1985), which catalyzes the ATP-dependent combination of
ammonium and glutamate to form glutamine, is inhibited by L-methionine-D,L-
sulfoximine (MSX) (Meeks et al., 1977; see Fig. 4.4a). Ammonium has also been
observed to inhibit cellular uptake of nitrate (Flores et al., 1980) and the activity
of nitrate reductase (Herrero et al., 1981) in cyanobacteria, but appears to exert
such inhibitory effects via ammonium-derived nitrogenous compounds (possibly

glutamine), rather than ammonium per 39, because MSX blocks those inhibitions.

80

100
E 80 'E,‘
a) a:
9 60 2
a) a)
0- 4o 0-

 

 

 

 

 

 

Figure 4.3. Response of mutants TLN2 (a) and TLN6 (b) to deprivation of fixed
nitrogen (NO3’). N-stepdown was initiated by moving cells in artificial colonies
(see Materials and Methods) from agar medium AA + 10 mM Na/KNOS + Sm
(10 pg/ml) to NO3‘-free agar medium AA + Sm (10 pg/ml) without (0) or, as a
control having unaltered ionic strength, with (o) 10 mM Na/KCI. Relative
luminescent intensities were measured. Each value is the mean of measurements
from three independent experiments, : SEM. Mean luminescence did not

change significantly when cells were transferred to fresh NO3'-containing medium
(data not shown).

 

 

81

Figure 4.4. Utilization of nitrate and of ammonium by cyanobacteria and
response of mutants TLN2 and TLN6 to removal of nitrate or of ammonium from
the growth media. (a) Scheme of metabolic pathways in the utilization of nitrate
and of ammonium in cyanobacteria (adopted from Meeks et al., 1977, and
Tsinoremas et al., 1991). (b) Response of mutants TLN2 and TLN6 to removal
of nitrate or of ammonium from the growth media. Experimental procedures are
identical to those described in Fig. 4.3; growth media are AA + Sm (10 pg/ml),
with or without sources of fixed nitrogen (see Appendix A) as indicated. Relative
luminescent intensities were measured. Each value is the mean of measurements
from three independent experiments. SEM, not shown, is smaller than 15% of
the corresponding mean value for most of the measurements.

 

82

 

 

- various
3 MSX Gln .....-2L"£!.-9.'3339§--...-”... metabo-
.\\ tronsferoses lites
Nitrate Nitrite \ \
reductase reductase @\ \Q’ ______ A 0A__
N03’ > No; > NH; 9' "3312199 ASP
A A @ AS ‘(gi—
@ /
2mm, 2de 51:8,, 5rd,”, / \ .
+ 2w + H20 + 8H + 2H20 Alo GIU-[~CIl————u— Arg

AOA

b

Induction of TLN2 Induction of TLN6

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

|20 120

100 ~ ~ - - .. - —~--~——---~~~—~-~ ‘ ------- :00E
0) (D
g U
w 50- --- -~—— --——-—-~--—----'--— 5 80
U U
m U)
Q) Q)
C C
E 60 — .- - - - _- --———-~----——-—--—-——1 E 60
3 3
r— r—
0) G)
> 40. . ~— -. - W. > 40:
o'— i o'—
u 4»
CO ('0
'33 '63
o: 20 _ , -- . , ~ —-- -----—'«—~———-~ -—--———— o: 20‘

o g L 4 l l o l l l L l
0 1 Z 3 4 5 6 7 0 I 2 3 6 5 6
hour hour
—-— N03' —> N2 "" N03- ‘—> “2
NH ‘ > N 4
+ ‘ 2 _ *— NH‘ > N2

+ NH.’ ——> NH.f + MSX

+ N03. —> NH‘§ —9— N03. > NH‘O

83

Observations from alternative N-stepdown experiments (Fig. 4.4b)
suggested that tln2 and tln6 respond differently to the removal of various
nitrogenous compounds. The gene tln2 appeared to respond to NO3'
concentration per 59, rather than to an ammonium-derived metabolic pool
because tln2::luxAB 1) was rapidly induced in response to the shift from N03' to -
N, 2) showed similar induction in response to the shift from N03' to NH4+, and
3) remained highly expressed when mutant TLN2 was grown with ammonium as
nitrogen source, and did not respond to the removal of ammonium from the
medium (Fig. 4.4b). Gene tln6, on the other hand, appeared to sense the
concentration (or ratio) of ammonium-derived metabolites because tln6::luxAB 1)
was not induced when shifted from NOa' to NH4+ (remains at the low,
constitutive level of expression), 2) responded with an induction similar to the one
shown in Fig. 4.3 (but the lag period of ca. 3.5 hr was replaced by a slow but
continuous increase) when mutant TLN6 was transferred from NH4+ to -N, and
3) showed induction when shifted from NH4+ to NH4+ + MSX (Fig. 4.4b).

Both Anabaena mutants, TLN2 and TLN6, appear to differentiate normally,
forming N2-fixing heterocysts, and are similar to the wild type in regard to growth
rate and morphology.

Genetic characterization of flnz and tins, and regeneration of their luxAB
fusions in the wild-type chromosome. Southern analysis of total DNA from
mutants TLN2 and TLN6, digested with the enzymes EcoR I, EcoR V, and Ola
I, none of which cuts inside the transposon, showed only single bands of
hybridization, suggesting that the genome of each mutant bears only one copy
of the transposon Tn5-1063 (Fig. 4.5). Because pRL1063 has no known

homology with the genome of Anabaena sp. strain PCC 7120, integration of the

84

kbp abcdefgh

23.1 _-
12.0\
11 .2—

9.7—

 

7.5—

3.8—

Figure 4.5. Southern analysis of total DNA isolated from mutants TLN2 and TLN6
of Anabaena sp. Samples of total DNA isolated from mutants TLN2 (lanes a, c,
e, and g) and TLN6 (lanes b, d, f, and h) were digested with the restriction
endonucleases EcoR l (lanes a and b), EcoR V (lanes 0 and d), Cla l (lanes e
and f), or Bgl || (lanes g and h), subjected to electrophoresis, blotted, and
probed with the two larger Bgl Il fragments of pRL1063a that span Tn51063 (Fig.
4.1) and that were 32P-labelled. Generation of bands produced by digestion with
C/a l or EcoR V is illustrated in Fig. 4.6.

 

 

___.—.— .1

85

plasmid into the chromosome would be by illegitimate recombination. Plasmid
pRL1063a is comprised of three Bgl lI fragments of sizes 6.4, 1.6, and 0.8 kb;
illegitimate recombination would give rise to least one band of one of the three
sizes. However, Bgl Il-digested total DNA from TLN2 and TLN6 showed no
hybridizing band of size below 7 kb (Fig. 4.5). Therefore, the transposon cannot
have integrated into the chromosome simply by recombination.

The Cla I and EcoR V fragments containing Tn5-1063 and contiguous
Anabaena DNA in the genome of TLN2 and TLN6 (Fig. 4.6) were recovered by
digestion of DNA with C/a l or EcoR V, circularization by ligation, and transfer to
E. coli by electroporation. Sizes of all recovered fragments were consistent with
sizes of hybridizing bands shown in Fig. 4.5. The recovered 9.6-kb C/a I
fragment (pRL731) from TLN2 has 0.8 kb of contiguous chromosomal DNA
upstream from the L end of the transposon and luxAB, and 1.0 kb adjacent to
the R end of the transposon. The 11-kb EcoR V fragment (pRL732) has 0.5 kb
contiguous DNA at the L end and 2.7 kb at the R end. The recovered 29-kb Cla
I fragment (pRL733) from TLN6 has 1.2 kb adjacent to the L and and luxAB, and
ca. 20 kb at the R and of Tn5-1063. The 11.1-kb EcoR V fragment (pRL734) has
0.6 kb at the L and and 2.7 kb at the R and (Fig. 4.6).

The locations of insertion in the chromosomes of mutants TLN2 and TLN6
were determined by pulsed-field gel electrophoresis and hybridization in
cooperation with E. Oren and C. P. Wolk (Fig. 4.7). The banding pattern of
digestion with Sal I (Fig. 4.7, lanes 2 and 5) and hybridization (lanes 3 and 4) with
a 32P-labelled fragment containing the luxAB genes localized the transposon in
TLN2 and TLN6 within fragments SalB and SalJ, ca. 170 and 80 kb from the

nearest Sal l sites, respectively. Hybridization with DNA from IS50 R (contains the

 

 

86

 

.mmcmm $8: 85 .0 2.28996 9.5096 .8965. So ocm .. 9: E0: E8593: .2 805m ocm mzd. cc we: .0 Lo
85.. E. «2.: come. 5 €255 55 55an 85:85 2: .29 33 89m .5 8859 2 08me so 82
85m Ease 5 ”504m mtmmmmo of: >9 8832 m_ 3076:... comoowcmb or: Co «moE 85mm EmSE 5 5.826839
.8on5 cowoamcm: m5 .6 6:5 Ammmmoomcmi Em: one new 3853:: :6. me. 9865 m ocm ._ .<20 @63me
889:8 use 88.9; 55:8 55 62.: Ease :55 85% use 85% use 62.: Ease :55 85%. use
55mg mo_Emm_a .6 86:0 may 9m omfiofig 8?. 6.68895 55 Co coEoo 8 E659 woe: .695. 50.. on... .8an
ocm 92.; 3V ocm comma new «2.2. 8v mucmSE mcmmomcc. Co mmEomoEoEo on“ Co Coupon 8 .6 E995 .0... 9:9“.

87

 

 

   
  

 

 

 

       
    
 

 

 

 

 

 

  

 

 

     

      

 

1: _
rilhxlllll ox ON mAwwvicvéeo _ Bea <66
:8 282358 E. 85mm
TI llllllll as. E: 85% llllllll i
> mg.“ _ Ev. _NEW > «gm
.1 \WF _ _r _
i 9. 0.0. 08.5. Ew. Em 82 38v. _ mxé 33 n. _
_ so a: 2m e925 50
_l lllllllllll 33. 8C 85% l I II I I l I. L mzfi
>m8m g >m8m >m8m
:20 m 18239.“..qu =_o 8... «am... he 4 _so
comma
_Illlllllsfcmmbma llllll i
3.8 _ 2.5. _28 2.8
_ t _
_ m. 895 5 Em 52 38¢ _ mg 33. ml _
2m Erato _ so
NZIE.

.30 as...

T. I l l I 33. 8.9 55% lllllll L

88

.09.: 9.: :_ 550% 0% Em .0409 :8
.85 s: <50 .memc .86: icon gm mm :03 628886 2E :_ omcozcoE 8:00 5:6 .6 30:82 2t .8me _._m 8
touocmm E0: omfimomv om E. 00: £95 .8 8808:. .0 mEOmoEoEo 2.: :0 9:0: 85 0: one 9.: :_ 68:26.8 0:3. :0
5:8 8:5 6:3. we 98%: E? .wommcaotm >0 UBSBE Em 02.: ocm «2.2. 9:92: :_ 80 RE c8889.. :0 :ozfico:o
:8 8:82 Eh .92 09 um 8:82.890 msocw <20 .« m2: 6:60 $8038.: 9: £3 8 9 n wocm: 8:86:95
2988 < 289 .._w «m tobcmm oBQEoo ”Iv 280 ocm mam wucmEmmt 5028608.. 69209 Ai mucoEmm: 58:38: _
Em 25: .ozfi :8 N24... 9:92: :_ .<20 3. m2: 833: £3) 036:0? .9682 .20 .08 8:8. 805 Co 6.: E3500
8 :0 89006998 :m Sm o :8 _v _m _e 8:8. ocm .60 28.82:: 8:88.889: E2958 :8 E0: 9m m ocm N
8:3 .420 a 583:8 :0 EmESmocoo Em A ocm .8 .F 8:3 .3 ocm 0 8:8; 23% man __ Ex 5:; :o AWN mmcm: _
\mm as. so so; a 95; 8: oo: :98 .8 8885.. 836:; new a 95 e 8%; ozfi use a 8m .8 88;
m2.:. m:_mbm ESE: E0: 920 2:550 .:o:mN__o:o>: E2500 :8 28.059626 _mm 222.823: .5 2.625608:
.ozfi :8 ~22. 9:32: :0 mmEomoEoEo 0:“ :_ 89.08.82: ocm 89-808: .6 :ozmufiofl .5. 930E

mJon:
2::
mm=o_

E
mcwmnmc< m

 

figflfiwfl'
. .

I

 

"*0‘“. on-..“ I a.

90

R end and the entire transposase gene of TnQ after restriction with a combina-
tion of Avr ll plus Sph l (lane9) localized the transposon in the chromosome of
mutant TLN2 to a position of 3.5 Mb on the map, with luxAB pointing clockwise.
This site of insertion was further confirmed by restriction with Pst l, and
hybridization (data not shown). TLN6 was tentatively localized at 4.2 Mb, with
luxAB oriented counterclockwise, by a weak hybridization of the Aer fragment
with the 80-kb Sail fragment generated by insertion of Tn5-1063 (data not
shown).

In order to perform second-round mutagenesis with Tn5-derived
transposons to identify mutations that alter the expression of tln6 (see below), the
tln6::luxAB fusion was regenerated in the wild-type chromosome as follows, using
the sacB-mediated gene replacement technique described in chapter 2. Plasmid
pRL734 (Fig. 4.6) contains the tln6::luxAB fusion, and lacks Ale l and Sma l
sites outside of Tn5-1063. Most of Tn5-1063 was removed from this plasmid by
digestion with Ale l and Sma I, the 3’ overhang of the AIwN I end was made
blunt by treatment with Klenow fragment, and the transposon was replaced with
the cassette BLOSZ by ligation to Sma l-opened plasmid pRL7598. A
transformant (denoted pRL762) in which tln6::luxAB (oriented as before) was
regenerated, was selected for further use. Plasmid pRL762, opened with EcoFl
V, was ligated to the 3.4-kb $308- and C.K3-containing EcoR V fragment of
pRL278R to give plasmid pRL763. The suicide plasmid pRL763 was transferred
to the cells of wild-type Anabaena sp. strain PCC 7120 by conjugation to produce
a sucrose-sensitive single recombinant Anabaena sp. strain PCC 7120::pRL763.
A sucrose-resistant double recombinant, Anabaena P8763, was derived from the

single recombinant, and its structure confirmed by Southern analysis. The

 

91

EcoR V-hybridizing fragment in the genome of P8763 is 8.9 kb (lane 1 of Fig.
4.11), 2.2 kb smaller than that of TLN6 (lane d of Fig. 4.5), reflecting the size
difference (illustrated in Fig. 4.6) between Tn5-1063 (7.8 kb) and the BLOS2
cassette (5.62 kb). The temporal pattern of induction of luxAB in mutant P8763
was virtually identical to that observed with TLN6 (see Fig. 4.10). Using a similar
method and Asu ll-digested pRL278R, Tn5-1063 in plasmid pRL731 was replaced
with the cassette BLOS1 (from plasmid pRL739) and the tln2::luxAB fusion was
regenerated in the wild-type chromosome to give mutant strain Anabaena P8760
(illustrated in Fig. 4.6) whose temporal pattern of induction of luxAB is
indistinguishable from that of TLN2 (data not shown).

Observation, at a single-cell level, of expression of tln6 along the filament,
using a T7 RNA polymerase-based transcription-amplifying reporter system.
Genes tln2 and tln6 respond to removal of fixed nitrogen rapidly, and so the
tln2::luxAB and tln6::luxAB fusions provide an opportunity to examine whether
genes activated shortly after N-stepdown show patterned expression along a
filament. Unfortunately, both genes were expressed so weakly that with neither
of the luxAB fusions imaged at a single-cell level was I able to observe light at a
level above the electronic background seen with our photon-recording system.
I therefore made use of a binary vector system for the amplification of
transcriptional reporting that had been constructed by C. P. Wolk (unpublished).

The rifampicin (Rm-resistant RNA polymerase of phage T7 has been widely
used to over-express genes cloned downstream from the T7 ¢1O promoter
(Tabor and Richardson, 1985; Rosenberg et al., 1987). The binary vector system
for transcriptional amplification constructed for use in Anabaena sp. consists of

a replicating plasmid and an integrating plasmid. The replicating plasmid

92
pRL1050 (Fig. 4.8) contains 1) the reporter operon luxAB (as in Tn5-1063 and the

BLOS cassettes, from Vibrio fisheri) that is under the control of the 17 ([210
promoter (P17), a promoter that is highly specific for the RNA polymerase
encoded by the phage T7 ¢1 gene (rpoT7 ), and is terminated with a T7
terminator; 2) the cyanobacterial plasmid pDU1 that permits replication in
Anabaena spp. (Wolk et al., 1984; Schmetterer and Wolk, 1988); 3) the pMB1-
derived oriV and oriT from pBR322 that permit replication in, and mobilization
from, E. coli (Balbés et al., 1986); and 4) the Sm'lSpr cassette C.S4 (Bancroft
and Wolk, 1989). The precursor of the final integrating plasmid is plasmid
pRL1081 which was designed to contain no sequence homologous to pRL1050.
This suicide plasmid was constructed from 1) the rpo'l7gene, terminated with the
bidirectional transcriptional terminator T,pp from plasmid pJDC406; 2) multiple
cloning sites immediately upstream of rpoT7 for insertion of a gene of interest;
3) a p15A-derived oriV from pACYC184 for replication in E. coli and an RK2-
derived 1 orinrom pAT187; and 4) the Km'ler cassette C.K3 (see Appendix F),
all on a scaffold of the polylinker from pJRD184 (Heusterspreute et al., 1985).
The 0.76-kb and 1.2-kb Cla l-BamH l fragments upstream from the L end
of Tn51063 in plasmids pRL731 and pRL733, respectively (Fig. 4.6; the BamH
I site is to the left of the Sma I site next to the L end of Tn51063), were cloned
between the C/a l and Bgl ll sites in the multiple cloning region of pRL1081,
giving integrating plasmids pRL772 and pRL776, respectively. Both plasmids
were individually introduced into Anabaena sp. strain PCC 7120(pRL1050) by
conjugation. Selected exconj ugants bore tln2::rpoT7(in Anabaena strain TAL2)
and tln6::rpoT7(in Anabaena strain TAL6) fusions in the chromosome by single

homologous recombination. ln strain TAL2 or TAL6, promoter activity of tln2 or

93

Figure 4.8. Scheme of amplified reporting of transcription of tln6 in Anabaena sp.
strain TAL6 by the T7-based binary vector system. The 1.2-kb Cla l-BamH l
fragment overlapping the L end of Tn51063 in pRL733 (see text) was inserted
into plasmid pRL1081 between Cla | and Bgl II to give plasmid pRL776.
Integration of pRL776 into the chromosome (top horizontal line) by single
homologous recombination puts the phage T7 ¢1 gene (rpoT7) under the
control of the t/n6 promoter. The product of gene rp077, the phage T7 RNA
polymerase, binds specifically to the phage ¢10 promoter P17 and transcribes the
luxAB genes. No information is available on the size of tln6, so that the drawing
of that gene in the figure is hypothetical.

 

94

fln6

 

I 1.0 kb I

oriV (p1 5A)

 

pRL776

   

    

 

OI'IV (p M 81)
OI'IT (p M81 ) quB

Prbc
aadA

    
 
 

pRL1050

  

1.0 kb
L.._..l

95
tln6 directs production of the T7 RNA‘ polymerase which in turn binds specifically

to P17 and strongly expresses luxAB (Fig. 4.8). Luminescence of TAL2 and TAL6
is much greater than that of TLN2 and TLN6 under both non-inducing and
inducing conditions (data not shown). The control strain, Anabaena sp. strain
PCC 7120(pRL1050), showed very little luminescence, suggesting that there is
minimal read-through promotion into the luciferase genes (C. P. Wolk,
unpublished; personal observation).

The distribution of luminescence was examined along filaments of strain
Anabaena TAL6 (tln6::rpo77 + szzluxAB) (but not yet along filaments of TAL2)
by photon-counting microscopy. At the earliest time point after N-stepdown that
was studied, 7 hr, virtually all cells along the filament showed luminescence. A
few cells, often spaced well apart, showed much lower luminescence, close to the
background level (Fig. 4.9a, arrows). At 21 hr after N-stepdown, (nearly) mature
heterocysts could be seen in the filaments, suggesting that heterocysts
differentiate at a normal rate in this strain of Anabaena sp. At this time point,
heterocysts showed virtually no luminescence; possibly insufficient 02 was
present to support luminescence. Although most cells other than heterocysts
showed luminescence, a few cells luminesced only very weakly (Fig. 4.9b,
arrows). These observations are based on two independent experiments;
additional experiments are needed to assess the reproducibility of the

observations.

96

Figure 4.9. Observation of tln6-directed luciferase activity along the filament of
Anabaena strain TAL6 at 7 hr (a) and 21 hr (b) after nitrogen-stepdown.
Vegetative cells are outlined in green and heterocysts in red. There is variation
in the degree of luminescence among vegetative cells, and those that show
markedly lower luminescence than do others are indicated by arrows. The gap
(+) in the upper filament in (a) is the result of a cell that had burst before photon-
recording (see Discussion).

 

 

97

 

Figure 4.9a

   

 

98

 

Figure 4.9b

   

 

 

 

99
Secondary transposon-mutagenesis to identify genes that regulate both

the expression of fins and the differentiation of heterocysts. * I tried, by random
transposon mutagenesis of strains that contain the tln6::luxAB fusion, to identify
regulatory genes whose products control both the expression of tln6 and the
differentiation of heterocysts. In the initial experiments, transposons Tn5-1087b
(C. P. Wolk, unpublished) and Tn5-800 were used to mutagenize mutant
Anabaena TLN6 (tln6‘.:Tn5-1063). Although both transposons appeared to
transpose frequently in TLN6, Southern analysis (data not shown) of two such
secondary mutants (denoted TTL62 and TTL68) showed that the transposon
(T n5-1 087b) had integrated into the chromosome not by transposition, but
through single homologous recombination of plasmid pRL1087b with the resident
Tn5-1063 within the transposase sequence. Because Tn5-1063 in TLN6 and
other Tn5 derivatives share the 1.43-kb sequence from IS50-1 that contains the
whole transposase and Anabaena sp. strain PCC 7120 is not a recA strain (a
defect in the recA gene results in the virtual elimination of homologous
recombination of DNA in E. coli, Radding, 1985), using TLN6 as target to perform
subsequent transposon-mutagenesis by other Tn5 derivatives might frequently
lead to production of recombinants rather than, or in addition to, transposon-
mutants. Such experiments were therefore terminated. Although recA genes
have been found in the cyanobacteria Anabaena variabilis ATCC 29413 (Owttrim
and Coleman, 1989), Synechococcus sp. strain PCC 7002 (Murphy et al., 1990),

and Anabaena sp. strain PCC 7120 (J. R. Coleman, personal communication),

 

* Attempts at secondary mutagenesis of a strain with a tln2::luxAB fusion
were unproductive, and are therefore not reported here.

 

100
a complete recA mutation appears to be lethal to Synechococcus sp. strain PCC
7002 (Murphy et al., 1990). Therefore, use of a recA strain of Anabaena sp.
strain PCC 7120 may not be the solution to this problem of unwanted
homologous recombination.

Mutant strain Anabaena P8763 (tlnbszLOSZ) retains the tln6::luxAB fusion
and less than 120 bp (a maximum of 67 bp at the L end and 52 hp at the R end)
of sequence homologous to other luxAB-lacking Tn5 derivatives that we have
Constructed. Use of Anabaena P8763 as target to perform secondary
transposon-mutagenesis should dramatically reduce the probability of
homologous recombination of the incoming Tn5-derivatives with the
chromosome, as well as possibly increase their transposition frequency because,
unlike TLN6, cells of Anabaena P8763 do not contain the Tn5 transposase gene
which encodes for both the transposase and an inhibitor of transposition (Berg,
1989).

The transposons Tn5-764 and Tn5-1058 (Fig. 4.1) were used to
mutagenize cells of Anabaena P8763. Thousands of secondary mutants on
mating filters were screened for those whose tln6::luxAB expression had been
altered. Theoretically one can screen for those that show low luminescence
under -N (induced) condition but it proved impractical because looking for such
colonies was like fishing out a dead bulb in a field of "a thousand points of light".
Nonetheless, screening under +N (non-inducing) condition identified several
mutants (denoted TTL631, TTL632, TTL633, and TTL635) that showed strong
luminescence constitutively (data not shown). However, these mutants were
capable of normal heterocyst differentiation and nitrogen fixation, and therefore

were not further studied.

 

101

In order to isolate mutants that are altered both in the expression of
tln6::luxAB and in heterocyst formation, a different strategy was employed. I first
screened for secondary mutants that were unable to fix dinitrogen, and then
screened such mutants for possible alterations in the induction of tln6::luxAB.
Fox' mutants are easily identified because they become and stay yellow after a
mating filter bearing many small, transposition-generated colonies is transferred
from +N to -N conditions. More than a hundred secondary Fox’ mutants were
recovered in this way. Four of them (denoted TTL615, TTL616, TTL619, and
TTL620) were found to be altered in the induction of tln6::luxAB in response to
N-stepdown: mutants TTL615 and TTL620 stay at the non-induced level and do
not appear to respond to N-‘stepdown, while mutants TTL616 and TTL619
constitutively express tln6::luxAB at a high level (Fig. 4.10). Southern analysis
showed that all four secondary insertions by Tn5-764 or Tn5-1058 were
independent, and apparently not closely linked to the original mutation of
tln6‘.:BLOSZ (Fig. 4.11).

Preliminary examinations by bright-field microscopy revealed a distinct
phenotype for each mutant. When grown in the presence of N03“, mutant
TTL615 had short, fragmented filaments, whereas the other three mutants had
a normal morphology. The four mutants responded in differing ways to N-
stepdown. Mutant TTL615 became even more fragmented, and produced, with
delayed timing, only immature heterocysts that tended to have widened junctions
with vegetative cells. Mutant TTL616 appeared to differentiate normally. Mutant
TTL619 tended to break into short filaments and produced heterocysts that were
"empty" and thin-walled. Finally, mutant TTL620 became yellow very slowly

(suggesting that the cells were not degrading phycocyanin in response to N-

 

102

Figure 4.10. Altered expression of tln6::luxAB in secondary mutants TTL615,
TTL616, TTL619, and TTL620, as compared to that of the primary mutant P8763
(TLN6). See Materials and Methods for experimental procedure. Nitrogen-
stepdown of the secondary mutants was initiated by, at various times, transferring
filters bearing artificial colonies from AA + 10 mM Na/KN03 + Nm (200 pg/ml)
+ Sp (5 pg/ml) agar medium to AA + Nm (20 pg/ml) + Sp (5 pg/ml) agar
medium. Mutants TLN6 and P8763 (shown) were induced by a transfer from AA
+ 10 mM Na/KNOa + Sm (2.5 pg/ml) to AA + Sm (2.5 pg/ml) and showed
virtually identical expression of tln6::luxAB. In the -N medium the concentration
of Nm is reduced from 200 ug/ml to 20 pg/ml to avoid use by the cell of Nm, a
nitrogenous compound, as a source of fixed nitrogen (see Appendix F).

103

TTL615 TTL620

0hr

 

TLN6/P8763

 

0hr

   

3hr 3hr

TTL619 TTL616

104

Figure 4.11. Southern analysis of secondary mutants produced by transposition
of Tn5-764 or of Tn5-1058 in mutant Anabaena P8763. Total DNA isolated from
strain P8763 (lane 1) and secondary mutants TTL615 (lane 2), TTL616 (lane 3),
TTL619 (lane 4), and TTL620 (lane 5) were digested by EcoR V and hybridized
with a 32P-labelled probe made from the luxAB-containing BamH I fragment from
pRL1022a (see Appendix C) and from the entire plasmid pRL764 that had been
linearized by digestion with BamH I. The 8.9-kb hybridizing band in lanes 1 to
5 represents the EcoR V fragment that contains the primary t/n6::lerB mutation
with the cassette BLOS2 (Fig. 4.6). Additional single bands suggest independent
insertion of Tn5-764 (lanes 4 and 5) or Tn5-1058 (lanes 2 and 3) in the genome
of Anabaena P8763. Plasmids pRL764 and pRL1058 (bearing transposon Tn5-
764 and Tn5-1058, respectively) cannot have integrated, intact, into the genome
in these four secondary mutants because such recombination would have
produced two, instead of one, hybridizing bands in addition to the 8.9-kb band.
The unnumbered lanes on both sides provide DNA size markers (in kilobases).

105

 

4 . 3— ..

2.3—
2.0—

 

 

 

106

starvation; Bradley and Carr, 1976) and did not appear to initiate heterocyst
differentiation (one observation of a culture 5 days after removal of fixed nitrogen
from the medium showed some cells that could possibly be considered
proheterocysts). l have not yet determined whether 1) the morphogenetic
aspects of the phenotype of these mutants and 2) the effects on expression of
tln6::luxAB, are consequences of insertion of the transposon that has rendered
them Nm'.

Introduction. by gene replacement, of a known secondary mutation to
study its possible regulatory relationships with genes fln2 and tln6. Possible
regulatory relationships between tln2, tln6, and other known genes were also
explored using the sacB-mediated gene replacement technique described in
chapter 2. Mutation in the gene hetFi blocks heterocyst differentiation (Buikema
and Haselkorn, 1991a and b). A hetR ::Tn5-1058 insertional mutant (0:41) was
independently obtained by C. P. Wolk in our lab, and the gene was shown to be
induced within 3.5 hr after N-stepdown (T. Black and C. P. Wolk, unpublished
results). The 9.8-kb EcoR V fragment bearing Tn51058 plus 4.4 kb of
contiguous Anabaena DNA was recovered (as pRL880) from mutant a41, and
ligated to the EcoR V fragment that contains 5308 and the C.CE2 cassette (Cm'
and Em') from plasmid pRL1075, a derivative of pRL271 (see Appendix C), to
give positive selection plasmid pRL908 (T. Black and C. P. Wolk, unpublished
results). The hetR ::Tn5-1058 mutation was then introduced into mutants P8760
and P8763 by conjugation using pRL908. Sucr Fox‘ colonies Anabaena P8908L2
and P8908L6 from Sucs Fox+ single-recombinants PS760::pRL908 and
PS763::pRL908, respectively, showed inductions of tln2::/uxAB and tln6::luxAB
similar to those of P8760 and P8763, respectively, suggesting that the hetR

 

107

mutation does not affect expression of either tan or tln6. Nonetheless, whereas
strain Anabaena P8908L6 is morphologically normal when grown with N03",
series of partially plasmolyzed cells are frequently seen in strain P8908L2 grown
with N03‘-containing media. The reasons for the expression of such a phenotype

remain to be investigated.

DISCUSSION

Mutagenesis using transposon Tn5-1058 and its derivatives in Anabaena
sp. exhibits distinct advantages over chemical- and UV-mutagenesis. First, many
colonies representing presumptive transpositions are obtained, and each such
colony is a genuine mutant. Second, because we have yet to find evidence of
multiple insertions, the great majority of mutants probably bear only a single
lesion resulting from transposition. Third, because each mutated gene is linked
to the transposon, which contains an origin of replication (oriV) functional in E.
coli, at least part of the gene is easily cloned in E. coli for further study. Fourth,
transcriptional activity of the mutated gene can be monitored by a reporter gene
in the transposon (e. g., Tn5-1063) if insertion has been in the appropriate
orientation. Fifth, the site of mutation and the orientation of the mutated gene in
the chromosome can be mapped by pulsed-field gel electrophoresis and
Southern analysis. In addition, by introducing the mutated gene, fused to a
reporter, into the wild-type chromosome, secondary mutagenesis can be used
to identify trans-acting regulatory genes.

Fusions to IacZ, encoding B-galactosidase, have been invaluable in the
elucidation of bacterial regulatory networks (Gottesman, 1984; Silhavy and

Beckwith, 1985), and is similarly applicable to cyanobacteria (Elhai and Wolk,

 

108

1990; Scanlan et al., 1990). Nonetheless, use of luciferase as a reporter has
several advantages relative to use of B-galactosidase. Its product, light, is rapidly
dissipated; and because luciferase appears to turn over in cells of Anabaena sp.
with a half-life s 2.6 hr (Wolk et al., 1991), repeated measurements can assess
decreases, as well as increases, in promoter activity (Fig. 4.2). Luciferase activity,
easily assayed, is not obscured by the pigmentation of cyanobacterial cells. The
assay, subject only to instrumental background, provides sufficient sensitivity and
spatial resolution to permit single-cell measurements in vivo as shown by Elhai
and Wolk (1990) and further illustrated in this chapter.

In the experiment of Fig. 4.2, the photonic detector was operated at < 1%
of its maximum sensitivity, to prevent overloading by bright colonies. This
probably accounts for the relatively low ratio of light sources to colonies in Fig.
4.2. In experiments lacking sources of "intense" light, sources of weaker
luminescence can be studied with greatly increased instrumental sensitivity. A
high density of colonies on mating filters (Fig. 4.2) enhances the probability that
rare types of mutants will be represented on a given number of filters, but
increases the difficulty of identifying and isolating a particular colony, and
prolongs the experimentation because stronger selection is needed following
overgrowth. We therefore now perform conjugation to cells containing, per filter,
5 15 pg of chlorophyll a.

The reaction catalyzed by bacterial luciferases can be summarized as
follows (Meighen, 1991):

FMNH2 + RCHO + 02 ___> FMN + H20 + RCOOH + ha(490 nm)

The substrate provided in our experiments was n-decanal because it was shown

to cross the cell membrane much more readily than do longer-chain aldehydes

 

109

(Meighen, 1991). However, assay of luciferase with n-decanal appeared to be
toxic to cells of Anabaena sp. The toxicity may be due to one or more of the
following reasons: 1) the hydrophobic aldehyde substrate accumulates in the cell
membranes; 2) the reaction catalyzed by luciferase consumes a large amount of
cellular FMNHZ; 3) the weakly acidic fatty acid produced by the oxidation of
aldehyde is a protonophore which can directly dissipate the proton gradient, a
core element of Mitchell’s chemiosmotic hypothesis (Mitchell, 1961), and thus
inhibit bioenergetic work (Krulwich et al., 1990). Therefore, I exposed Anabaena
cells to aldehyde for a minimal possible length of time in assays for luciferase
activitry. Colonies on Petri dishes were usually viable after being subjected to a
luciferase assay carried out as described in the Materials and Methods section.
Microscopic observation of luciferase activity, however, poses the following
problem. To initiate the luciferase assay, n-decanal was added to a suspension
of cells of Anabaena sp. to a final concentration of 0.01% (v/v;-Elhai and Wolk,
1990), and was often left in contact with the cells for a period of more than 5 min.
in the dark for photon counting. This procedure appeared to be very stressful
to the Anabaena cells, and frequently led to cells bursting (Fig. 4.9a). A possibly
better condition of assay, sustained endogenous production of aldehyde by cells
of Anabaena sp., is being sought but has yet to be achieved (C. P. Wolk,
personal communication).

The gene tln6 increases its expression 4 hr after N-stepdown (Fig. 4.3),
and by 7 hr (Fig. 4.9a), it has apparently been expressed in most, if not all, cells
of the filament. The product of this gene could be, among other possibilities, part
of a nitrogen-uptake/scavenging system that is stimulated by a lowered level of

an ammonium-derived nitrogenous compound. Cells that showed much reduced

 

110

tln6 expression in the filament N-starved for 21 hr were often either heterocysts
or presumptive proheterocysts. the latter appearing usually several cells away
from the heterocysts (Fig. 4.9b). Perhaps, therefore, the dim cells in the 7-hr, N-
starved filaments (Fig. 4.9a) were also presumptive heterocysts. l have not yet
tried to follow the fate of individual cells that respond rapidly to N-stepdown to
see whether these cells differentiate into heterocysts (as predicted by the
volunteer model) or prove distant from eventual heterocysts (as predicted by the
scavenger model). Because gene tln6 responds relatively slowly to N-stepdown
compared with heth (T. Black and C. P. Wolk, unpublished observations), tln6
seems inadequate for use to distinguish the two proposed models of pattern
formation experimentally.

l have found several secondary mutations that alter the expression of tln6.
Four of these mutations, in TTL615, TTL616, TTL619, and especially TTL620,
appear also to affect heterocyst differentiation. This work thus represents a step
toward determining whether heterocyst differentiation is " the culmination of a
process which begins as a non-developmental response to nitrogen deprivation"
(Wolk, 1982), or whether that differentiation is elicited independently, for example
by more stringent N-deprivation.

As results in chapter 3 suggest, Anabaena sp. strain PCC 7120 may have
a high rate of spontaneous mutation. When a wild-type culture maintained in
nitrate-containing medium was used in transposition mutagenesis and
subsequently screened for Fox' mutant colonies, the frequency of such colonies
was usually around 10% to 15% (personal observation), compared to below 5%
when a culture maintained under nitrogen-fixing conditions was used. To reduce

the interference of spontaneous Fox“ mutants, Anabaena cells used for mating

111

in later experiments were maintained on solid or liquid media without fixed
nitrogen, but then grown to moderate cell density in nitrate-containing liquid
medium for mating (to achieve high growth rate and to reduce clumping of
filaments). In the strain Anabaena P8763 the BLOS cassette that provides luxAB
reporting of transcription of gene tln6 is bordered by the 53-bp L- and 52-bp R-
end sequences of Tn5 (Fig. 4.6), and is potentially mobile when a transposase
is provided in cis (de Lorenzo et al., 1990). When a Tn5 derivative is introduced
into the cells in secondary transposon mutagenesis, Tn5-BLOS could transpose
to a new location in the genome and possibly put luxAB under the control of a
different promoter or no promoter (although Tn5 transposes conservatively, the
original t/n6::luxAB might or might not be lost after transposition of Tn5-BLOS;
Berg, 1989). Results of Southern analysis have essentially ruled out transposition
of Tn5-BLOS. However, the Fox‘ phenotype in the four secondary mutants could
still possibly be the result of independent spontaneous mutations. Therefore,
reintroduction of an isolated secondary mutation into the genome of Anabaena
P8763 to observe whether the same phenotype recurs will be an essential step

in the characterization of each of the four secondary mutations.

 

APPENDICES

 

APPENDIX A

GROWTH MEDIA FOR Anabaena SPP.

AA-based media used in this study were made by following a modification
of the formula described by Allen and Arnon (1955). The composition and
preparation of the basal medium are listed in Table A1

Agar was purchase from Difco Laboratories (Detroet, Ml) or Sigma
Chemical Co. (St. Louis, MO). Solidified media were prepared by two different
procedures: 1) by addition of agar, purified as described (Braun and Wood,
1962), to the final solution to a final concentration of 1% prior to autoclaving or,
2) by autoclaving separately, 2% agar (Difco) and a 2X concentrated final solution
from which the Pi stock is omitted, and by then combining the agar, the double-
strength solution and sterile Pi stock solution 1:1:0.0125 (v/v). I prefer agar
plates made by the second procedure because they seem to be more consistent
between different batches.

Nitrate, 5 mM KN03 plus 5 mM NaNOa, was generally used as fixed
nitrogen source where so indicated. A concentrated stock solution was added,
1:100 (v/v), before autoclaving. When ammonium was used to replace nitrate as

fixed nitrogen source, 200 mM NH4CI solution (sterile filtered) was added to

112

113
autoclaved agar medium to a final concentration of 2 mM. Ten mM N-tris-
(hydroxymethyl)methyl-2-aminoethanesulfonic acid (TES, pH 7.5) was added to
such ammonium medium to maintain neutral pH.
The ingredients are diluted 8-fold (except for nitrate which, if present, is

diluted only 2-fold) in all AA-based liquid media.

 

 

114

Table A1. Composition and preparation of the modified basal AA medium for

Anabaena spp.

 

Final solution (1,000 ml)

 

ddHZO 969.0 mi
AA-P stock solution 25.0 ml
Pi stock solution 6.25 ml

 

AA-P stock solution (1.000 ml)

 

MgSO4 stock solution
CaClz stock solution

NaCl stock solution
Microelement stock solution

250 ml
250 ml
250 ml
250 ml

 

Microelement stock solution (1.000 ml)

 

MnCl2 4HZO

M003

211804 ‘7H20

CuSO4 SHZO

H3B03

COC|2 6H20

Fe ~EDTA stock solution

288.0 mg
28.8 mg
35.2 mg
12.6 mg
457.6 mg
6.4 mg
128.0 ml

 

Fe EDTA stock solution (1 ,000 ml)

 

KOH
Na2EDTA‘2H20
FeSO4'7H20 (or FeClz)

9.12 g
35.79 g
24.01 g (17.19 g)

 

Other simple stock solutions

 

Pi stock solution (1,000 ml)
MgSO4 stock solution (1,000 ml)
CaCl2 stock solution (1 ,000 ml)
NaCl stock solution (1 ,000 ml)
Na/KNO3 stock solution (1,000 ml)

57.38 g of KZHPO4

40.98 g of MgSO4-7H20
12.18 g of CaCl2-2H20

38.68 g of NaCl

42.51 g of NaNOa (0.5 mole)
+ 50.56 g of KN03 (0.5 mole)

APPENDIX B

BACTERIAL STRAINS DISCUSSED IN THIS STUDY

TABLE A.2. Bacterial strains discussed in this study

 

 

Strains Marker 1 Other relevant properties 2 Note
Cyanobacteria
Anabaena sp. strain PCC 7120 and its derivatives
PCC 7120 — Fox+ Het+; contains at least six 3, 4
different insertion sequences
including l8892 and l8895
a41 Bmr Nmr Smr hetR ::Tn51058; Hdi' Fix' 5, 6
EF114 —— Fox‘, Hgl' 7
EF116 — hetA; Fox' Hep‘ 7, 8
M8 Bmr Nm’ Smr Hen' Hep+ Hgl+; 8
PCC 7120::Tn5-1063;
defective in connection
between heterocyst envenlope
and the cell membrane .
N10 Brnr Nmr Smr Fox+, Pat'; 9
PCC 7120::Tn5-1063; has
much reduced heterocyst
frequency
P9 Bmr Nm' Smr Fix‘ Het+; PCC 7120::Tn51037 10

PCC 7120(pRL250)
PCC 7120(pRL1050)
PCC 7120::pRL256
PCC 7120::pRL263

Nmr
Sm'lSp'
Sm'lSpr
Emr Sm’lSpr

Sucs

PW-luxAB in pDUl-base plasmid 5
Sucs Fox+

Sucs Fox+

115

q—n,

1 16
Table A2 (continued)

 

Strains Marker Other relevant properties Note

 

PCC 7120::pRL743 Emr Sm'lSpr Suc$ Fox+

PCC 7120::pRL760 Smr/Spr Sucs

PCC 7120::pRL763 Sm'lSpr Sucs

P8250-1 Nmr Sucr variant of PCC 7120(pRL250),
with a 1.5-kb insertion in $308

P8250-2 Nmr Sucr variant of PCC 7120(pRL250);
sacB::l8893

PS250—3 Nmr Suclr variant of PCC 7120(pRL250);
sacB::l8892

PS250-4 Nmr Sucr variant of PCC 7120(pRL250);
sacB::l8894

P8250-5 Nmr Sucr variant of PCC 7120(pRL250);
sachzl8895

P8250-6 Nmr Sucr variant of PCC 7120(pRL250);
sacB::l8892

P8250-7 Nmr Sucr variant of PCC 7120(pRL250);
sachzl8897

P8250-8 Nmr Sucr variant of PCC 7120(pRL250);
sachzl8898

PS250—9 Nmr Sucr variant of PCC 7120(pRL250);
sacB::|8892N

PS250-10 Nmr Sucr variant of PCC 7120(pRL250);
sachzl8892T

P8250-11 Nmr Suc’ variant of PCC 7120(pRL250);
sachzl8892

P8250-12 Nrnr Sucr variant of PCC 7120(pRL250),
with a 1.5-kb insertion in sacB

P8250-13 Nmr Sucr variant of PCC 7120(pRL250),
with a 1.2-kb insertion in $308

P8250-14 Nmr Sucr variant of PCC 7120(pRL250)

P8250-15 Nm' Suc" variant of PCC 7120(pRL250);
sachzl8892

P8250-1 6 Nmr Sucr variant of PCC 7120(pRL250)

P8250-17 Nmr Suc’ variant of PCC 7120(pRL250)

PS250-18 Nmr Sucr variant of PCC 7120(pRL250),

with a 1.0-kb insertion in 3303

 

Table A2 (continued)

117

 

 

Strains Marker Other relevant properties

P8250-19 Nm' Suc’ variant of PCC 7120(pRL250)

PS250-20 Nmr Suc' variant of PCC 7120(pRL250)

P8250-21 Nmr Suc' variant of PCC 7120(pRL250);
AsacB

P8250-22 Nmr Sucr variant of PCC 7120(pRL250);
AsacB

P8256-5 Sm'i/Spr Sucr variant of PCC 7120::pRL256;
Fox+ Hep+

P8256-17 Sm’lSpr hetA::C.S4; Fox‘ Hep‘ Sucr

P8263-1 Sm'lSp' nifD.:C.84; Het+ Nif' Sucr Ems

(also -2,-50)
P8263-42 Emr Sm'VSpr Sucr variant of PCC 7120::pRL263;
(also -53,-54) Fox+

P8743 Sm'lSpr conA::C.S3; Fox+; Suc'

P8760 Smr/Spr tln2::luxAB (BLOS1); Fox+ Sucr

PS760::pRL908 Emr Nmr Sm'ISpr Sucs

P8763 Sm'lSpr tln6::luxAB (BLOS2); Fox+ Sucr

PS763::pRL908 Emr Nmr Sm'lSpr Suc:s

P8908L2 Nmr Sm'lSpr tln2::luxAB plus hetR ::Tn5—1058;
Hdi’ Sucr

P8908L6 NmIr Sm’lSpr tln6::luxAB plus hetFi ::Tn51058;
Hdi' Sucr

TAL2 Nmr Sm'/8pr tln2::rpoT7 plus pRL1050

TAL6 Nm' Sm’lSpr tln6::rpo77 plus pRL1050

TLN2 Bmr Nm' 8mr tln2::luxAB (T n5-1063); Fox+

TLN6 Brnr Nmr 8mr tln6::luxAB (Tn51063); Fox+

TTL62 Emr Sm'lSpr P8763::Tn51087b; Fox+

TTL68 Emr Sm'lSpr P8763::Tn51087b; Fox+

TTL615 Nmr Sm’lSpr P8763::Tn51058; Fox‘

TTL616 Nmr Sm'lSpr P8763::Tn51058; Fox'

TTL619 Nmr Sm'lSpr P8763::Tn5764; Fox‘

TTL620 Nmr Sm'lSpr P8763::Tn5764; Fox‘ (Het‘ ?)

TTL631 Nmr Sm'r/Spr P8763::Tn5764; Fox+

T‘l'L632 Nmr Smr/Spr P8763::Tn5764; Fox+

TTL633 Nmr Sm'lSpr P8763::Tn5764; Fox+

TTL635 Nmr Sm'lSp’ P8763::Tn5-764; Fox+

 

 

Table A2 (continued)

118

 

 

Strains Marker Other relevant properties Note
WJBZ16 — hetR; Fix‘ Hdi‘ 11
Y34 Cm' Emr Fix'; PCC 7120::Tn55-1087a 12
Y46 Cmr Emr Fix‘; PCC 7120::Tn55—1087a 12
Anabaena sp. strain M-131 Het'; contains l8891 and 4, 13,
homologs of l8892 and l8895 14
Anabaena sp. strain PCC 7118 Fix+, Hdi+, Het'; contains , 14,15
homologs of l8892 and l8895 16
Anabaena variabilis ATCC 29413 Het+ ; capable of facultitive 16, 17
heterotrophic growth; contains
no l8892 homolog
FD A mutantg that is a better strain 17, 18
for genetic transfer
Anacystis nidulans Also called Synechocossus sp.; 13, 19,
Unicellular; capable of genetic 20
transformation; donor of Prbc
of 0.84
Calothrix sp. strain PCC 7601 Filamentous; contains IS701 21
Nostoc ellipsosporum Filamentous; contains 16
homologs of l8892
Nostoc sp. strain Mac Filamentous; contains 16
homologs of l8892
Nostoc sp. strain ATCC 29150 Filamentous; contains 16
homologs of l8892
Synechococcus sp. strain PCC 7002 Unicellular; capable of genetic 16,22

transformation; contains no
l8892 homolog

 

 

1 19
Table A2 (continued)

 

Strains Marker Other relevant properties Note

 

Synechocystis sp. strain PCC 6803 Unicellular; capable of genetic 16 2,
transformation and light- 23
activated hetrotrophic growth;
contains no l8892 homolog

Non-cyanobacteria
Bacillus subtilis Unicellular Gram-positive 24, 25
bacterium capable of
endospore development;
source of sacB
Escherichia coli A Gram-negative enteric
bacterium
DHSa Nxr ¢80dlacZAM15 26, 27
A(IacZYA-argF) U169 endA1
gyrA96 recA1
hdei17(rK’, mK+)
DH5a(pUM24) Km' Nxr Sucs
HB101 8mr mchC mrr hsd820(rB', ms) 27, 28
recA rpsL20
HB101(pRL528) Cmr 8mr Transient host of conjugal
plasmids
Myxococcus xanthus A Gram-negative soil bacterium 24

capable of multicellular
fruiting body formation

 

Note to Table A2:

1. Resistance-conferring genes and usage of antibiotics are listed in
Appendix F.

 

 

 

possess»

11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.

23.
24.
25.
26.
27.

120

Nomenclature and list of phenotypes are presented in Appendix D, list of
genes is in Appendix E. Name of a gene listed in this column indicates
mutation in the gene (a genotype).

Wolk et al., 1984.

Cai, 1991.

C. P. Wolk, unpublished.

T. Black and C. P. Wolk, unpublished results.

Wolk et al., 1988.

A. L. Ernst and C. P. Wolk, unpublished results.

D. N. Trwari and C. P. Wolk, unpublished data.

A. L. Ernst, J.-M. Panoff, and C. P. Wolk, unpublished results.

Buikema and Haselkorn, 1991a and 1991b.

A. L. Ernst, Y. Cai, and C. P. Wolk, unpublished results.

Bancroft and Wolk, 1989.

Alam et al., 1991.

Elhai and Wolk, 1990.

T. Thiel, personal communication.

Currier and Wolk, 1979.

Maldener et al., 1991.

Golden et al., 1989.

Shinozaki and Sugiura, 1985.

Mazel et al., 1988.

Porter, 1986.

Anderson and McIntosh, 1991.

Dworkin, 1985.

Gay et al., 1983.

Grant et al., 1990.

The E. coli strain DH5a was used in most of the transformation
experiments using DNA isolated from E. coli in the couse of this study
because this strain gives high frequency of transformation and mini-prep
DNA of good quality, partially due to its endA1 mutation which eliminates
the production of endonuclease 1 (1991 BRL catalog, life technologies,
lnc., Gaithersburg, MD). However, this strain retains all three of its
methylation-dependent restriction systems (MDRS): McrA, MchC, and Mrr
(see mcrA, mchC, and mrr in Appendix E), and therefore exhibits strong
restriction on DNAs methylated in a foreign pattern (Grant et al., 1990).
In fact, in my experience transformation of competent DH5a with DNA
isolated from Anabaena sp. strain PCC 7120 consistently gave very poor
results, which led to my switch to strain HB101. The E. coli strain HB101

28.

121

shows much less restriction on foreign methylated DNA, including DNA
isolated from Anabaena sp. strain PCC 7120, because both of its MchC

and Mrr systems have been rendered nonfunctional (Raleigh et al., 1988).
Raleigh et al., 1988.

APPENDIX C

PLASMIDS USED IN THIS STUDY

Table A3. Plasmids used in this study

 

 

Plasmids Marker 1 Other relevant features 2 Note
pACYC184 Cmr Tcr Source of oriV(p15A) 3
pAn625 Apr Tcr l88950 (mysA), psbA1 4, 5
pAT187 Kmr Source of oriT(RK2) 6
pBR322 Apr Tcr Cloning vector, source of pMB1 oriV 7

and oriT
pBR325 Apr Cmr Tcr Source of Cmr determinant 7
pDU1 —— Confers capacity to replicate in 8, 9
Anabaena spp.
pE194 Emr Source of Emr determinant 10
pET3 Apr Doner of P17 and T17 11
pICZOH Apr Cloning vector; IacIZ’ 12
pJDC406 Apr Source of bidirectional transcriptional 13
terminator T,pp
pJRD184 Apr Tcr Restriction site bank 14
pPM111* Apr Source of modified Smr gene (str‘) 15
pRL1 CmIr Shuttle vector 8
pRL44 Km'ler Sm'lSpr S.K3+L.HEH2+C.83 16
pRL52 Km'ler hetA in pRL25C 17, 18
pRL57 Cmr Km'ler S.K5+L.HEH2+C.83; positive 2
and Sm'VSpr selection shuttle cloning vector
pRL61 Km’ler Sm'lSpr hetA::C.S4 derivative of PRL52 16

122

123
Table A3 (continued)

 

Plasmids Marker Other relevant features Note

 

pRL61M Km'ler Sm'lSpr Mlul deletion of pRL61; a suicide

plasmid
pRL171P8m Apr Sm'lSpr S.A1+L.HEH1+C.S4 16,19
pRL250 Cmr Km'ler pRL57-based shuttle vector, contains
sacB
pRL256 8m'/Spr hetAxC.84, sacB
pRL263 Cm' Emr Sm'lSpr nifD ::C.84, sacB
pRL270 Cmr Emr sacB; precursor of pRL271
pRL271 Cmr Emr sacB-containing cloning vector;
C.CE2
pRL272 Cmr Km'i/Nmr sacB::l8892, a variant of pRL250

isolated from Anabaena PS250-3
pRL274 Cmr Km'ler sachzlS892N; a variant of pRL250
isolated from Anabaena P8250-9

pRL277 Sm’lSp' sachontaining cloning vector; C.K3
pRL278 Km'ler sacB-containing cloning vector; C.S4
pRL278R Km'le' A derivative of pRL278, sacB+C.K3

can be cut out by Asu ll, BamH l
plus Bgl ll, EcoR V, and Xba I,

pRL351 Apr hetA in pUCB 18, 20
pRL393 Kmr/Nmr nifH and part of nifD in pRL19B 2, 21
pRL453 Apr Smr pUC18/19 containing L.EHE1 and 2
C81
pRL488 Kmr/Nmr Donor of luxAB from Vibrio fischeri 22
pRL498 Kmr/Nmr S.K3+L.HEH1 2
pRL517b Cmr Sm'lSp' nifH and part of nifD from pAn154; 19,23
C.S4 inserted in Kpn l of nifD
pRL528 Cm' Helper plasmid for conjugal transfer; 24
contains M.Aval and M.Eco47 ll
methylases
pRL731 Bmr Km'ler Smr tln21Tn51063; C/a l-recovered 25
fragment from mutant TLN2
pRL732 Bmr Km'ler 8mr tln2:Tn5-1063; EcoR V-recovered 25
fragment from mutant TLN2
pRL733 Bmr Km'ler 8mr tln6‘.:Tn5-1063; C/a l-recovered 25

fragment from mutant TLN6

1 24
Table A3 (continued)

 

 

Plasmids Marker Other relevant features Note

pRL734 Bmr Km'ler 8mr tln6‘.:Tn5—1063; EcoR V-recovered 25
fragment from mutant TLN6

pRL739 Sm'lSpr Bears cassette BLOS1, unique
polylinker; luxAB

pRL739B Sm’lSpr Bears cassette BLOS1, unique
polylinker; luxAB

pRL7398 Sm"/Spr Bears cassette BLOS1, unique

polylinker; luxAB

pRL741 Cmr Km'ler A variant of pRL250 isolated from
Anabaena P8250-1, with a 1.5-kb
insertion in sacB

pRL742 Cmr Km'i/Nmr sacB::I8893‘, avariant of pRL250
isolated from Anabaena P8250-2

pRL743 Cmr Emr Sm’lSpr conA::C.S3, contains sacB

pRL744 Cm' Km'ler sachzl8894; a variant of pRL250
isolated from Anabaena P8250-4

pRL745 Cmr Km'ler sacB::l8895; a variant of pRL250
isolated from Anabaena P8250-5

pRL746 Cmr Km'ler sacB::l8892, a variant of pRL250
isolated from Anabaena PS250-6

pRL747 Cmr Km'i/Nmr sachzlS897, a variant of pRL250
isolated from Anabaena P8250-7

pRL748 Cmr Km'ler sachzlS898; a variant of pRL250
isolated from Anabaena P8250-8

pRL750 Cmr KmI/Nmr sachzl8892T; a variant of pRL250
isolated from Anabaena PS250-10

pRL751 Cmr Km'le’ sacB::l8892, a variant of pRL250
isolated from Anabaena P8250-11

pRL752 Cmr Km'le' A variant of pRL250 isolated from
Anabaena P8250-12, with a 1.5-kb
insertion in sacB

pRL753 Cmr Km'ler A variant of pRL250 isolated from
Anabaena P8250-1 3, with a 1.2-kb
insertion in sacB

pRL755 Cmr Km'ler sachzl8892, a variant of pRL250
isolated from Anabaena P8250-15

Table A3 (continued)

125

 

 

Plasmids Marker Other relevant features Note
pRL758 Cmr Km'ler A variant of pRL250 isolated from
Anabaena PS250-18, with a 1.0-kb
insertion in sacB
pRL759 Sm'ISpr Bears cassette BLOSZ, unique
polylinker; luxAB
pRL759B Sm"/Spr Bears cassette BLOSZ, unique
polylinker; luxAB
pRL7590 Sm'ISpr Bears cassette BLOS3 which lacks 26
internal BamH l sites; polylinker
same as in pRL759; luxAB
pRL760 Km'ler Sm'lSpr tln2:BLOS1, sacB
pRL762 Apr Sm'lSpr tln6‘.:BLOSZ
.pRL763 Km'ler Sm'lSpr tln6‘.:BL082, sacB
pRL764 Km'ler Bears Tn5-764; PpsbA-npt
pRL764SX KmI/Nmr Bears Tn5-764; PpsbA-npt; unique
Sma I site
pRL772 Km'ler tln2::rpoT7; C.K3
pRL776 Km'le' tln6::rpoT7; C.K3
pRL800 Cm’ Emr Bears Tn5-800; C.CE3
pRL880 Bmr Km'ler Smr hetH ::Tn5«1058; EcoR V-recovered 25, 26
fragment from mutant a41
pRL908 Cmr Emr Km'ler hetR ::Tn5—1058, sacB 25, 26
and Smr
pRL1022a Kmr/Nmr luxAB (BamH l)/L.HEH1 16
pRL1050 Sm'VSpr P-n-quAB, Pm-aadA; pDU1-based 16
replicating plasmid
pRL1058 Bmr Km‘i/Nm'Smr Bears Tn5-1058; PpsbA-npt-ble-str* 25, 27
pRL1063a Brnr Km'ler 8mr Bears Tn5-1063; luxAB, 23, 27
P psb A-npt—ble-str"
pRL1075 CmIr Emr A derivative of pRL271, sacB+C.CE2 16
in an inverted polylinker _
pRL1081 Km'ler A suicide plasmid containing 16
promoterless rpoT7; C.K3
pRL1087b Cmr Emr Bears Tn5-1087b; C.CE2 16
pRZ1107 Gmr The two dam methylation sites in the 28

promoter of Tn5 are mutated

 

 

 

1 26
Table A3 (continued)

 

Plasmids Marker Other relevant features Note

 

pUC118 Apr lac/Z ’; A cloning vector that 29
carries the intergenic region (lG)
from phage M13 for production of
single-stranded plasmid DNA.

pUC119 Apr Same as pUC118 but the polylinker is 29
in the opposite orientation

pUCD800 Kmr Contains sacB 30

pUM24 Apr Km'ler Contains the sacB-nptl cartridge 31

arvx _- pBR322-derived vector for screening 32

of recombinants

 

Note to Table A3:

1. See Appendix F for information on resistance-conferring genes and
dosage of corresponding antibiotics.

2. See Elhai and Wolk (1988a) for nomenclature of polylinkers and antibiotic
resistance cassettes.

3. Chang and Cohen, 1978, and Rose, 1988.

4. S. E. Curtis, personal communication

5. Alam et al., 1991.

6. Trieu-Cuot et al., 1987

7. Balbés et al., 1986, and references therein.

8. Wolk et al., 1984.

9. Schmetterer and Wolk, 1988.

10. Horinouchi and Weisblum, 1982.

11. Rosenberg et al., 1987 .

12. Marsh et al., 1984

13. Coleman et al., 1985.

14. Heusterspreute et al., 1985.

15. Mazodier et al., 1986.

16. C. P. Wolk, unpublished.

17. Wolk et al., 1988.

18. Holland and Wolk, 1990.

19. Composition of the Smr/Spr cassette 0.84 is described in Bancroft and
Wolk (1989).

20.
21 .

23.

24.
25.

26.
27.
28.
29.
30.
31 .
32.

 

127

D. Holland and C. P. Wolk, unpublished.

G. Schmetterer, unpublished.

Elhai and Wolk, 1990

J. Elhai and C. P. Wolk, unpublished; for information on plasmid pAN154
and the nifHD genes, see Rice et al., 1982.

Elhai and Wolk, 1988b.

In E. coli the Smr gene in Tn5-1058 and Tn5-1063 confers only weak
resistance to Sm, see Appendix F.

T. Black and C. P. Wolk, unpublished.

Wolk et al., 1991.

Yin et al., 1988.

\fieira and Messing, 1987

Gay et al., 1985

Ried and Collmer, 1987

Seed, 1983.

APPENDIX D

NOMENCLATURE AND LIST OF PHENOTYPES 1

There are many different Anabaena mutants with phenotypes that are
related to nitrogen fixation and heterocyst differentiation. Names of phenotypes
used to describe such mutants have been inadequate and often unclear. A
series of new names for different phenotypes is proposed and used in this
presentation. Names and definitions of the phenotypes, and representative
mutants are listed below. Possible inclusion/exclusion relationships of the
phenotypes (except for Sucs) are illustrated in Fig. A1. I would like to point out
the restrictions of this listing: 1) this listing, although somewhat extensive, is by
no means intended to be encyclopedic. With the accumulation of our knowledge
this listing will surely be expanded and improved; 2) only one form of
differentiation, the differentiation of heterocysts, is considered because our
knowledge on the other, the differentiation of akinetes, is very limited; 3)
concerning nitrogen fixation, only that of the conventional (molybdenum-
dependent) nitrogenase is considered because the alternative (vanadium-

dependent) nitrogenase present in some Anabaena spp. (Kentemich et al., 1988;

 

‘ The nomenclature incorporates information from personal communications with
A. L. Ernst, C. P. Wolk, and T. Black.

128

 

 

129

Thiel, 1991), is poorly understood and is repressed in normal growth medium like

AA; 4) phenotypes of antibiotic resistance are discussed separately (see

Appendix F).

Fix’

Fox

Hdi'

Unable to fix dinitrogen under anaerobic conditions (Ar/C02).

Sample strains: Anabaena Y34, and Anabaena Y46 (A. Ernst, Y. Cai, and
C. P. Wolk, unpublished results); Anabaena P9 (A. Ernst, J.-M. Panoff, and
C. P. Wolk, unpublished results)

Unable to fix dinitrogen in the presence of gygen.
Sample strains: those that are Fix‘, Hdi', Hem', Hen', Hep’, Het', Hgl', or

Nif' (see above and below)

Unable to initiate, or carry heterocyst differentiation to a stage in which
nifHDK genes are expressed under anaerobic conditions (Ar/C02). This
definition is based on the conclusion that expression of the nifHDKoperon
is developmentally regulated (Elhai and Wolk, 1990) in filamentous
cyanobacteria such as Anabaena spp.

Sample strains: Anabaena a41 (T. Black and C. P. Wolk, unpublished
results); Anabaena WJ8216 (Buikema and Haselkorn, 1991a; the mutant
216 described in the article is presented as WJB216 here)

Hem' Hgterocyst maturation mutant; unable to form morphologically mature

heterocysts which have envelope deposition.

Hen'

Hep

Het'

Hgl‘

Nif'

Pat‘

130
Sample strain: (a typical mutant will be one that forms only

proheterocysts)

Defective in the heterocyst envelope.
Sample strain: Anabaena M17 (A. L. Ernst and C. P. Wolk, unpublished

results)

Defective in the synthesis of _h_e_terocyst envelope polysaccharides.

Sample strain: Anabaena EF116 (Wolk et al., 1988); Anabaena P8256-1 7

Unable to form proh_et_erocysts discernible by bright-field microscopy.

Sample strain: Anabaena sp. strain PCC 7118 (Elhai and Wolk, 1990)

Defective in the synthesis of heterocyst glycolipids.
Sample strain: Anabaena EF114 (Wolk et al., 1988)

A phenotype resulting from a mutation in the nif genes (this definition
makes this phenotype more of a genotype because specific genetic
mutation is required).

Sample strain: Anabaena P8263-1

Altered in the spatial pattern of heterocysts along the filament.
Sample strain: Anabaena N10 (D. N. Tiwari and C. P. Wolk, unpublished

results)

131
Sucs Unable to grow on agar medium containing 5% sucrose because of the
presence of a functional sacB gene.

Sample strain: Anabaena sp. strain PCC7120(pRL250)

 

 

132

Fox+

Pat+l Pat“

 

Figure A.1. Probable inclusion/exclusion relationships between mutants of
different phenotypes.

 

 

aadA

atp

bla

APPENDIX E

LIST OF GENES DISCUSSED IN THIS STUDY

This name appears to be used specifically for genes that encode
an aminoglycoside 3"(9)-O-nucleotidyltransferase, abbreviated as
AAD(3")(9). Among the many characterized aminoglycoside
nucleotidyltransferases (ANTs; often referred to as aminoglycoside
adenylyltransferases because of their strong preference for ATP as
substrate, and abbreviated as AADs), the AAD(3") (9) enzymes, which form
a unique group, are able to inactivate streptomycin by adenylylation of the
3"-hydroxyl group on the amino-hexose Ill ring and to inactivate
spectinomycin by adenylylation of the 9-hydroxyl group on the actinamine

ring (Davies and Smith, 1978; Fling et al., 1985).

The 9 genes encoding the 9 polypeptides of the ATP synthase of
Anabaena sp. strain PCC 7120 (Curtis, 1988)

Encodes B-lactamase which detoxifies B-lactam antibiotics
(penicillins and ampicillin, etc.) by hydrolysis, and therefore opening, of the

B-lactam ring. The bla gene we used is originally from transposon Tn3

133

 

 

 

 

his

cat

conA

dam

134
and encodes a 286-amino acid prepeptide. The first 23 amino acid
residues form a hydrophobic leader peptide for secretion of the 263-amino
acid mature, active B-lactamase into the periplasmic space and sometimes

out of the cells (Davies and Smith, 1978; Balbas et al., 1986)

Encodes a function conferring resistance to bleomycin. The

resistance mechanism encoded by his of Tn5 is not known (Berg, 1989)

Encodes the Chloramphenicol acetyltransferase (CA1) which
inactivates Chloramphenicol (Cm) by acetylation of its hydroxyl groups

(Davies and Smith, 1978)

A gene 3’to hetA in the chromosome of Anabaena sp. strain PCC
7120, which could encode a protein of at least 280 amino acids. This
gene is constitutively expressed during growth with N03‘ and during
heterocyst differentiation (partially characterized, and denoted ORF2 in

Holland and Wolk, 1990; D. Holland, personal communication)

Encodes a methyltransferase that methylates at the N6 position of
the adenine in the sequence 5’ GATC 3’. Such methylation, present both
in E. coli and Anabaena spp., blocks digestion of DNA by many restriction
endonucleases, e. g., Xba I, when their recognition sequences overlap the

5’ GATC 3’ sequence (Padhy et al., 1988; Nelson and McClelland, 1989)

endA 1

erm

g/nA

QYTA

135

Encodes endonuclease 1. A defect in this gene in E. coli strain
DH5a is considered to be one of the reasons that this strain gives
somewhat higher frequency of transformation and better quality of

miniprep DNA

Genes conferring resistance to erythromycin (Em). From the
literature it appears that this name is used specifically for genes that
encode an rRNA N6-amino adenine N-methyltransferase (NMT) that
transfers one or two methyl group(s) to a particular adenine residue of the
238 rRNA, and thereby reduces its binding affinity for Em (Horinouchi and
Weisblum, 1982). A different Emr gene, ereA, encodes an erythromycin
esterase that hydrolyzes the Iactone ring of Em (Ounissi and Couvalin,

1 985)

Encbdes glutamine synthetase (G8) which, with expenditure of ATP,
combines ammonium and glutamate to form glutamine (Turner et al.,

1 983)

Also referred to as na/A. This gene encodes one of the two
subunits of the DNA gyrase, function of which is required for DNA
synthesis to proceed. A particular mutation (gyrA96) in the E. coli strain
DH5a renders the product of this gene resistant to the action of nalidixic

acid (Lewin, 1985)

hetA

hetR

hsd

IacZ

136

A single-copy chromosomal gene in Anabaena sp. strain PCC 7120
that could code for a protein of 601 amimo acids. Mutation of this gene
results in the formation of heterocysts with a defective polysaccharide

layer (Wolk et al., 1988; Holland and Wolk, 1990; also see chapter 2)

A single-copy gene in Anabaena sp. strain PCC 7120 that encodes
a 299-amino acid protein. Mutaion of this gene gives a Hdi‘ phenotype
(Het' Fix'), and overexpression of this gene in the wild-type strain leads to
formation of pairs and groups of heterocysts (Buikema and Haselkorn,

1991a and 1991b; T. Black and C. P. Wolk, unpublished results)

Host-specificity determinant. Loci in E. coli that govern host-
specified restriction function such as restriction by Type I or Type II

endonucleases (Yuan, 1981)

Encodes the E. coli B-galactosidase. The gene IacZ is widely used
as a marker. Often a fragment of the E. coli lac regulatory region (lacl)
is used along with an incomplete IacZ gene, lacZ’, which 1) encodes ca.
150 amino acids of the aminoterminal portion of the B-galactosidase; 2) is
able to complement (a complementation) a defective B-galactosidase gene
present usually in the chromosome to produce active B-galactosidase; and
3) contains a region of multiple cloning sites (cloning of a fragment into
this region destroys the a complementation). Derepression of the lac!
region by the inducer isopropyl-thiogalactoside (IPTG) allows expression

of IacZ (or lacZ’ ). Activity of functional B-galactosidases turns the

hetA

hetR

hsd

[302

136

A single-copy chromosomal gene in Anabaena sp. strain PCC 7120
that could code for a protein of 601 amimo acids. Mutation of this gene
results in the formation of heterocysts with a defective polysaccharide

layer (Wolk et al., 1988; Holland and Wolk, 1990; also see chapter 2)

A single-copy gene in Anabaena sp. strain PCC 7120 that encodes
a 299-amino acid protein. Mutaion of this gene gives a Hdi' phenotype
(Het' Fix‘), and overexpression of this gene in the wild-type strain leads to
formation of pairs and groups of heterocysts (Buikema and Haselkorn,

1991a and 1991b; T. Black and C. P. Wolk, unpublished results)

Host-specificity determinant. Loci in E. coli that govern host-
specified restriction function such as restriction by Type I or Type II

endonucleases (Yuan, 1981)

Encodes the E. coli B-galactosidase. The gene IacZ is widely used
as a marker. Often a fragment of the E. coli lac regulatory region (Iacl )
is used along with an incomplete IacZ gene, lacZ’, which 1) encodes ca.
150 amino acids of the aminoterminal portion of the B-galactosidase; 2) is
able to complement (a complementation) a defective B-galactosidase gene
present usually in the chromosome to produce active B-galactosidase; and
3) contains a region of multiple cloning sites (cloning of a fragment into
this region destroys the a complementation). Derepression of the lac]
region by the inducer isopropyI-thiogalactoside (IPTG) allows expression

of IacZ (or IacZ' ). Activity of functional B-galactosidases turns the

137

colorless chromogenic substrate 5-bromo-4-chloro-3—indolyI-B-D-

galactoside (Xgal) blue (Maniatis et al., 1982)

luxAB Structural genes encoding for a bacterial luciferase (Meighen, 1991)

mcrA Encodes the type A modified cytosine restriction function (McrA),
one of the three known methylation-dependent restriction systems (M DRS)
of E. coli. McrA restricts DNA that contains the 5’ CmCGG 3’ methylated
sequence (Raleigh and Wilson, 1986; Grant et al., 1990)

mchC Encode a different type of cytosine restriction function (MchC), one
of the MDRS of E. coli. MchC restricts DNA that contains the 5’ GmC 3’

methylated sequence (Raleigh and Wilson, 1986)

mrr Encodes the function of methylated adenine recognition and
restriction (Mrr), a third MDRS of E. coli. Mrr restricts DNA containing the
5’ GmAC 3’ and/or 5’ CmAG 3’ methylated sequences (Heitman and
Model, 1987)

mys The name given to members of the l8895 family before one of them

was proven mobile (Alam and Curtis, 1985)

nif Nitrogen fixation genes. While many genes are involved in nitrogen
fixation in one way or another, only genes that are homologs of defined

nif genes of the extensively studied diazotroph, Mebsiella pneumoniae, are

nifD

nifH

nifK

138

denoted nif genes. To date, only six nif genes have been proposed in
Anabaena sp. strain PCC 7120, and these are present in a nif-gene
cluster. Unlike other diazotrophs, two insertions of unknown function are
found in this nif gene cluster in vegetative cells: an 11-kb insertion (the
nifD element) interrupting nifD, and a 55-kb insertion (the nifS element) 5’
to nifS. In mature heterocysts both insertions are excised from the
chromosome by site-specific recombinations to form a "cured“, functional

nif-gene cluster (Haselkorn, 1986; Haselkorn, 1989)

Encodes the a subunit of dinitrogenase (MoFe protein) of the
molybdenum-dependent (conventional) nitrogenase. In Anabaena sp.
strain PCC 7120 this gene is interrupted by the 11-kb nifD element. After
excision of the 11-kb element, the I'cured" nifD gene codes for a protein

of 497 amino acids (Lammers and Haselkorn, 1983; Golden et al., 1985)

Encodes nitrogenase reductase (Fe protein). In Anabaena sp.
strain PCC 7120 there is another nifH homolog (nifH2 or nifH* ) of
unknown function that is located distant from the nif gene cluster (see Fig.

4.5) (Mevarech et al., 1980; Rice et al., 1982)

Encodes the 8 subunit of dinitrogenase (MoFe protein) (Mazur and

Chui, 1982)

Encodes a neomycin phosphotransferase which is an alias for

some of the aminoglycoside phosphotransferases (APHs). Two npt

ori V

ori T

prcA

psbA

139

genes, nptl and nptll, were used in this study. The gene nptl, originally
from transposon Tn903 (also known as Tn601), encodes a type |
aminoglycoside 3’-phosphotransferase, abriviated as APH(3’ ). The gene
nptll, originally from transposon Tn5, encodes a type II APH(3’). Products
(sharing significant homology at amino-acid level) of both genes (sharing
moderate similarity at their 3’ regions) inactivate deoxystreptamine
aminoglycosides (e.g., neomycin and kanamycin) by phosphorylation of
the 3 ’-hydroxyl group on the amino-hexose l ring (Davies and Smith, 1978;
Beck et al., 1982)

Origin of (vegetative) replication, sometimes called oriR. A site in
a replicon at which DNA repliction is initiated and, often after completing

the replication, terminated

Origin of transfer (also called the Bom site for basis of mobilization).
A site in a mobilizable replicon at which product(s) of tra gene(s) nick one

strand of the DNA, and initiate conjugal transfer

A single-copy gene in the chromosome of Anabaena sp. strain PCC

7120 that encodes a calcium-dependent protease (Maldener et al., 1991)

Encodes the D1 protein, one of the five (or more) polypeptides
comprising the core complex of the reaction center of photosystem II.

More than one copy of the gene may be present in the genome

 

rbc

recA

rpoT7

rpsL

sacB

140
The two genes encoding the large (rbcL) and small (rch) subunits
of ribulose-1,5—bisphosphate carboxylase. In Anabaena sp. strain PCC
7120 and Anacystis nidulans, rbcLS are cotranscribed in a polycistronic
transcript (Curtis and Haselkorn, 1983; Nierzwicki-Bauer et al., 1984;

Shinozaki and Sugiura, 1985)

Encodes a function essential to DNA homologous recombination.
The RecA protein is a dual-function protein that is 1) a specific DNA-
dependent protease that cleaves certain repressors, and 2) a DNA-
dependent ATPase that promotes homologous pairing of DNA molecules

(Radding, 1985)

Gene ¢1, encoding RNA polymerase, of coliphage T7

Encoding a ribosomal protein. In E. coli strain HB101, a particular
mutation (rpsL20) of this gene greatly reduces the affinity of the product

of the gene to binding by Sm, and thereby confers resistance to Sm

Encodes the secretory levansucrase (sucrosezz, 6-B-D-fructan 6-B-D-
fructosyltransferase; EC. 2.4.1.10) of the unicellular Gram-positive
bacterium, Bacillus subtilis. When bearing a functional sacB, many Gram-
negative bacteria, including Anabaena spp., are killed on solid media
containing 5% sucrose which induces the expression of sacB (Gay et al.,

1983 and 1985; chapter 2)

sigA

sigB

str

141

Encodes the housekeeping a factor (cofactor of an mRNA

polymerase) (Brahamsha and Haselkorn, 1991)

A sig homolog proposed on the basis of hybridization with sigA.
lnsertional mutation of this gene, which is transcribed only under nitrogen-
fixing conditions, does not cause an observable change of phenotype

(Brahamsha, 1991; B. Brahamsha, personal communication)

Genes that confer resistance to streptomycin (Sm). Several such
genes, however, are named aad because the function of their products
are known to be aminoglycoside nucleotidyltransferases (see aad, above).
The str gene in transposon Tn5 encodes an aminoglycoside
phosphotransferase (APH), possibly an aminoglycoside 6-0-
phosphotransferase, abriviated as APH(6). APH(6) inactivates
streptomycin by phosphorylation of the 6-hydroxyl group on the
streptidine ring. In the mycelial Gram-positive bacterium, Streptomyces
griseus, the gene encoding an APH(6) enzyme is named aphD, and the
one encoding an aminoglycoside 3"-0-phosphotransferase (APH3") is
named aphE. A mutated str gene of Tn5, str*, from plasmid pPM111* ,
confers substantially greater resistance to Sm than the wild-type gene
(Davies and Smith, 1978; Mazodier et al., 1985; Mazodier et al., 1986;
Heinzel et al., 1988)

tet

tln2

tln6

tra

xisA

142
A Tcr determinant. This gene encodes a protein that modifies the
cell membrane and thereby blocks the transport of tetracycline into the cell

(Maniatis et al., 1982)

A single-copy gene in the chromosome of Anabaena sp. strain PCC
7120, expression of which increases rapidly following removal of nitrate (as

a source of fixed nitrogen) from the growth medium (see chapter 4)

A single-copy gene in the chromosome of Anabaena sp. strain PCC
7120, expression of which increases within 4 hour following removal of
nitrate or ammonium (as a source of fixed nitrogen) from the growth

medium (see chapter 4)

Genes that determine conjugation. These genes can be divided
into two groups: those whose products are involved in the formation of

mating pairs, and those involved in DNA transfer

Present at the nifK-proximal end of the 11-kb nifD element, this
gene encodes a protein of 354 amino acids that is required for excision
of the nifD element from the nifD gene via site-specific recombination

(Lammers et al., 1986; Golden and Wiest, 1988)

 

 

APPENDIX F

RESISTANCE-CONFERRING GENES AND
DOSAGE OF CORRESPONDING ANTIBIOTICS

A number of genes that confer resistance to specific antibiotics were used
in this study. The dosages used for selection of functions of those genes are

listed in Table A.4.

143

144

Table A.4. Resistance-conferring genes and dosage of corresponding antibiotics.

 

Cassette 1 Gene 2 Antibotics Concentration used (pg/ml) 3 Note
used AA + NO3' AA/8 + N03‘ LB 4

 

C.A1 bla Ap -- -- 50 5
(Tn51 063) P psb A—ble Bm 1 -4 . 6
C.CE1 cat, erm Cm -- -- 25 7
Em 1 0-40 5 (1,000) 8
C.CE2 cat, erm Cm 15 25 9
Em 10-40 5 (1,000) 8
C.CE3 cat, erm Same as C.CE2
C.K1 nptll Km -- -- 50 1 0
Nm 25 3
C.K2 nptl Same as C.K1 10
C.K3 and P psbA-nptll Km -- -- 50 10
(Tn5-1063) Nm 200-400 25-45 1 1
0.83 (S2) aadA Sm 2.5 1.5 25 12
Sm/Sp 2.5/2.5 _1 .5/1 .5 25
or 1.0/1.0
Sp 10 1.0 100
C84 P,bc-aadA Same as 0.83
(Tn5-1063) P psbA-st” Sm 5-10 2-5 (25) 13
C.T1 tet Tc -- -- 10 14

 

Notes to Table A.4:

1. For nonmenclature and construction of most of the drug-resistance
cassettes see Elhai and Wolk (1988a). Construction of cassettes C.CE2
and C.CE3 is described in Chapter 2 and 4, respectively. Cassette 0.84
was described by Bancroft and Wolk (1989).

2. For a more detailed description of these genes please see Appendix E.
For a comprehensive review concerning antibiotics please see Davies and
Smith (1978) and references therein.

145

3. All antibiotics used in this study were purchased from Sigma Chemical
Co., St. Louis, MO. The concentration of an antibiotics presented here is
specific to the chemical form of the antibiotics (listed below).

Am: ampicillin, sodium salt (C16H18N3048Na, FW 371.4)

Bm: bleomycin sulfate (mixture, chemical content not clear; Sigma
catalog number B-5507)

Cm: Chloramphenicol, crystalline (C11H1ZCl2N205, FW 323.1)

Em: erythromycin (C37H67NO13, FW 733.9)

Km: kanamycin monosulfate (95% kanamycin A plus 5% kanamycin B;
C18H36N4O11‘H2804, FW 582.6)

Nm: neomycin sulfate (90-95% neomycin B plus 10-5% neomycin C;
C23H46N6013‘3H2804, FW 908.9)

Sm: streptomycin, sulfate salt (FW 1457.4, which suggests a formula of
C21H39N7O129H2804 [Bérdy, 1980])

Sp: spectinomycin dihydrochloride (C14H24N207-2HCI, FW 405.3)

Tc: tetracycline hydrochloride (C22H24N208HCI, FW 480.9)

4. AA-based media containing nitrate are most often used for culture of
Anabaena spp. When media free of fixed nitrogen are used, or
resistances to two or more antibiotics are simultaneously selected, the
concentration of antibiotics used is usually reduced 50 to 80%, depending
on the particular antibiotic(s) and the combination used. Concentrations
of antibiotics used in both liquid and solidified LB media for culture of.
Escherichia coli are presented.

5. Anabaena sp. strain PCC 7120 produces B-Iactamase that degrades
ampicillin as well as penicillin (Kushner and Breuil, 1977), but apparently
not at a high level. However, secretion of B-lactamase at higher pH
envirnoment (Kushner and Breuil, 1977; also see bla in Appendix E) by a
donor strain could protect a recipient strain. Ap therefore may not be
suitable for use for selection in conjugation experiments with Anabaena sp.
strain PCC 7120 (Wolk et al., 1984).

6. Bm was very effective for selection of Anabaena sp. Nonetheless, because
it is very expensive, it was used only occasionally. For the same reason
it was rarely used with E. coli (C._ P. Wolk, personal communication).

7. The natural promoter of the cat gene in cassette C.CE1 was removed
during construction of the cassette (Elhai and Wolk, 1988a). This cassette
confers very weak resistance to Cm in Anabaena sp. strain PCC 7120, but

 

10.

11.

12.

146

is useful in Anabaena sp. strain M-131 (C. P. Wolk, personal
communication).

Em is used very infrequently with cells of E. coli because about 1 mg/ml
is required for selection, and that is an inconveniently high level to use.

Cassettes C.CE2 and C.CE3, unlike C.CE1, retain the natural promoter of
the cat gene, and confer greater resistance to Cm. Cells of Anabaena sp.
strain PCC 7120 bearing either of these two cassettes can be selected
with 15 ug/ml and 10 pg/ml of Cm on AA+N03' and AA agar media,
respectively.

The nptl and nptll genes confer resistance to both Km and Nm. Nm and
Km were used in Anabaena sp. and E. coli, respectively, to select for
resistance conferred by the npt genes (Wolk et al., 1984). Km is not used
in cells of Anabaena sp. strain PCC 7120 because those cells show a high
level of natural resistance to Km. Nm is not used in E. coli for a similar
reason.

Cells of Anabaena sp. bearing the PpsbA-nptll construct show strong
resistance to Nm and are usually selected with 200 to 400 pg/ml of Nm.
However, such a high level of Nm is not suitable for use in experiments,
e.g., the N-stepdown induction assay, in which a minimal content of fixed
nitrogen is important, because the degradation products of neomycin
appear to be used by cells of Anabaena sp. as fixed nitrogen. The
neomycin sulfate used has a nitrogen (N) content of 9.24%, which
translates into 2.64 mM and 0.132 mM N for 400 pg/ml and 20 pg/ml of
neomycin sulfate, respectively. All of the nitrogen in neomycin is in the
form of amino groups (Bérdy, 1980), which might be readily used by cells
of Anabaena sp. Streptomycin is ideal for use in the N-stepdown
induction assay because 1) the streptomycin sulfate salt that we use has
a nitrogen content of 6.72%, which translates into 0.048 mM N for 10
pg/ml Sm, and 2) less than 43% of the nitrogen in streptomycin is in the
form of amino groups (Bérdy, 1980).

The aadA gene in cassette C.S3, and Pmc-aadA in 0.84, confer resistance
to both Sm and Sp. Selection with both antibiotics (Golden and Wiest,
1988) gives lower background than with either alone. Cells selected on
Sp alone tend tobe healthier than those selected on Sm alone.

13.

14.

147

P psbA-str" (Mazodier et al., 1986) confers excellent resistance to Sm in
Anabaena sp. but only very weak resistance to Sm in E. coli.

Tetracycline is light-sensitive and its action is antagonized by magnesium
ions (Maniatis et al., 1982). It was therefore not used for selection of
Anabaena sp. (Wolk et al., 1984) but was used for selection of E. coli in
LB medium which contains virtually no magnesium. Preferably,
tetracycline-containing media should be prepared fresh.

 

 

 

BIBLIOGRAPHY

 

BIBLIOGRAPHY

Alam, J., and S. E. Curtis. 1985. Characterization of a family of putative
insertional elements from the cyanobacterium Anabaena, abstr. OR-22-07, 1st Int.
Congr. Plant Mol. Biol. Oct. 27-31, 1985. Savannah, GA.

Alam, J., J. M. vrba, Y. Cai, J. A. Martin. L J. Welslo, and S. E. Curtis. 1991.
Characterization of the l8895 family of insertion sequences from the
cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol. 173.5778-5783.

Allen, M. B., and D. I. Arnon. 1955. Studies on nitrogen-fixing blue-green algae.
l. Growth and nitrogen fixation by Anabaena cylindrica Lemm. Plant Physiol.
30366-372.

Anderson, 8., and L McIntosh. 1991. Light-activated heterotrophic growth of the
cyanobacterium Synechocystis sp. strain PCC 6803: a blue-light-requiring
process. J. Bacteriol. 173.2761-2767.

Argos, P., A. Landy, K. Abramski, J. B. Egan, E. Haggard-Uungqulst, R. H.
Hoess, M. L Kahn. H. Kalionis, S. V. L Narayana, L S. Pierson III, N. Stemberg,
and J. M. Leong. 1986. The integrase family of site-specific recombinases:
regional similarities and global diversity. EMBO J. 5:433-440.

Aymerich, S., G. Gonzy-Tréboul and M. Steinmetz. 1986. 5’-Noncoding region
3303 is the target of all identified regulation affecting the levansucrase gene in
Bacillus subtilis. J. Bacteriol. 1 661993-998.

Balbas, P., X. Soberon, E. Merino, M. Zurita, H. Lomell, F. Valle, N. Horas, and
F. Bolivar. 1986. Plasmid vector pBR322 and its special-purpose derivatives -
a review. Gene 503-40.

Bancroft, I., C. P. Walk, and E. V. Oren. 1989. Physical and genetic maps of the

genome of the heterocyst-forming cyanobacterium, Anabaena sp. strain PCC
7120. J. Bacteriol. 171:5940-5948.

148

149

Bancroft, l., and C. P. Walk. 1989. Characterization of an insertion sequence
(lS891) of novel structure from the cyanobacterium Anabaena sp. strain M-131.
J. Bacteriol. 171:5949-5954.

Beck, E., G. Ludwig, E. A. Auerswald, B. Reiss, and H. Sohaller. 1982.
Nucleotide sequence and exact localization of the neomycin phosphotransferase
gene from transposon Tn5. Gene 19327-336.

Beckwith, J., and T. J. Silhavy. 1983. Genetic analysis of protein export in.
Escherichia coli. Meth. Enz. 97:3-11.

Bérdy, J. 1980. Handbook of Antibiotic Compounds, vol. 1, Carbohydrate
antibiotics, p. 85-245. CRC Press, Inc., Boca Raton, FL.

Berg, D. E. 1989. Transposon Tn5, p. 185-210. In D. E. Berg and M. M. Howe
(eds.), Mobile DNA. American Society for Microbiology, Washington, DC.

Biggin, M. D., T. J. Gibson, and G. F. Hong. 1983. Buffer gradient gels and 358
label as an aid to rapid DNA sequence determination. Proc. Natl. Acad. Sci. USA
808963-3965.

Boivin. FL, F.-P. Chalifour, and P. Dion. 1988. Construction of a Tn5 derivative
encoding bioluminescence and its introduction in Pseudomonas, Agrobacterium
and Rhizobium. Mol. Gen. Genet. 21350-55.

Borthakur, D., and R. Haselkom. 1989. Tn5 mutagenesis of Anabaena sp. strain
PCC 7120: isolation of a new mutant unable to grow without combined nitrogen.
J. Bacteriol. 171:5759-5761.

Bradley, 8., and N. G. Carr. 1976. Heterocyst and nitrogenase development in
Anabaena cylindrica. J. Gen. Microbiol. 96175-184.

Brahamsha, B. 1991. Identification of RNA polymerase sigma factor homologs
in the cyanobacterium Anabaena sp. strain PCC 7120. Abstr. 112B. Vll lntl.
Symp. Photosynthetic prokaryotes. July 21-26, 1991. Amherst, MA.

Brahamsha, B., and R. Haselkorn. 1991. Isolation and characterization of the
gene encoding the principal sigma factor of the vegetative cell RNA polymerase
from the cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol. 173.2422-
2450.

Braun, A. C., and H. N. Wood. 1962. On the activation of certain essential
biosynthetic systems in cells of Vince rosea L. Proc. Natl. Acad. Sci. USA
481776-1782.

 

 

 

150

Bryant, D. A.. and N. Tandeau de Marsac. 1988. Isolation of genes encoding
components of the photosynthetic apparatus. Meth. Enz. 167:755-765.

Buikema, W. J., and R. Haselkom. 1991 a. Isolation and complementation of
nitrogen fixation mutants of the cyanobacterium Anabaena sp. strain PCC 7120.
J. Bacteriol. 1 731879-1885.

Buikema. W. J., and R. Haselkom. 1991 b. Characterization of a gene controlling
heterocyst differentiation in the cyanobacterium Anabaena 7120. Gene &
Development 5:321 -330.

Burbulys, D., K. A. Trach, and J. A. Hoch. 1991. Initiation of sporulation in B.
subtilis is controlled by a multicomponent phosphorelay. Cell 64:545-552.

Burger-Momma, T., M. Veenbuls, H. J. Korthals, C. C. M. Van de \Mel, and L R.
Mur. 1986. A new prokaryote containing chlorophylls a and b. Nature (London)
320262-264.

Cai, Y. 1991. Characterization of insertion sequence I8892 and related elements
from the cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol. 173:5771-
5777.

Cai, Y.. and C. P. Wolk. 1990. Use‘of a conditionally lethal gene in Anabaena
sp. strain PCC 7120 to select for double recombinants and to entrap insertion
sequences. J. Bacteriol. 172.3138-3145.

Chang. A. C. Y.. and S. N. Cohen. 1978. Construction and characterization of
amplifiable multicopy DNA cloning vehicles derived from the p15A cryptic
miniplasmid. J. Bacteriol. 134:1141-1156.

Coleman, J. D.. A. Hirashima, Y. Inokuchi, P. J. Green, and M. Inouye. 1985. A
novel immune system against bacteriophage infection using complementary RNA
(micRNA). Nature (London) 315:601-603.

Craig, I. W., C. K. Leach. and N. G. Carr. 1969. Studies with deoxyribonucleic
acid from blue-green algae. Arch. Mikrobiol. 65:218-227.

Currier, T. C., J. F. Haury, and C. P. Walk. 1977. Isolation and preliminary
characterization of auxotrophs of a filamentous cyanobacterium. J. Bacteriol.
12.9.1 556-1 562.

Currier, T. C., and C. P. Wolk. 1979. Characteristics of Anabaena variabilis
influencing plaque formation by cyanophage N-1. J. Bacteriol. 13388-92.

 

 

151

Curtis, 8. E. 1988. Structure, organization and expression of cyanobacterial ATP
synthase genes. Photosyn. Res. 18:223-244.

Curtis, S. E., and R. Haselkom. 1983. Isolation and sequence of the gene for
the large subunit of ribulose-1,5-bisphosphate carboxylase from the
cyanobacterium Anabaena 7120. Proc. Natl. Acad. Sci. USA. 801835-1839.

Davies, J., and D. I. Smith. 1978. Plasmid-determined resistance to antimicrobial
agents. Ann. Rev. Microbiol. 32469-518.

Davis, L G., M. D. Dibner, and J. F. Battey. 1986. Basic methods in molecular
biology. Elsevier, N. Y.

de Lorenzo, V., M. Herrero, U. Jakubzik. and K. N. 11mmls. 1990. Mini-Tn5
transposon derivatives for insertion mutagenesis, promoter probing, and
chromosomal insertion of cloned DNA in Gram-negative eubacteria. J. Bacteriol.
1 72. 6568-6572.

Dodson, K. W., and D. E. Berg. 1989. Factors affecting transposition activity of
IS50 and Tn5 ends. Gene 76207-213.

Dower. W. J., and C. W. Ragsdale. 1988. High efficiency transformation of E.
coli by high voltage electroporation. Nucleic Acids Res. 16.6127-6145.

Drlica, K., and J. Rouviere-Yaniv. 1987. Histonelike proteins of bacteria.
Microbiol. Rev. 51:301-319.

Dworkin, M. 1985. Developmental Biology of the Bacteria, Benjamin/Cummings,
Menlo Park, CA.

Elhai, J., and C. P. Wolk. 1988a. A versatile class of positive-selection vectors
based on the nonviability of palindrome-containing plasmids that allows cloning
into long polylinkers. Gene 68:119-138.

Elhai, J., and C. P. Wolk. 1988b. Conjugal transfer of DNA to cyanobacteria.
Meth. Enz. 167:747-754.

Elhai, J., and C. P. Wolk. 1990. Developmental regulation and spatial pattern of
expression of the structural genes for nitrogenase in the cyanobacterium
Anabaena. EMBO J. 93379-3388.

Fiandt, M., w. Szybalski, and M. H. Malamy. 1972. Polar mutations in lac, gal
and phage A consist of a few IS-DNA sequences inserted with either orientation.
Mol. Gen. Genet. 119223-231.

 

151

Curtis, 8. E. 1988. Structure, organization and expression of cyanobacterial ATP
synthase genes. Photosyn. Res. 18:223-244.

Curtis, 8. E., and R. Haselkom. 1983. Isolation and sequence of the gene for
the large subunit of ribulose-1,5-bisphosphate carboxylase from the
cyanobacterium Anabaena 7120. Proc. Natl. Acad. Sci. USA. 8018354 839.

Davies, J., and D. I. Smith. 1978. Plasmid-determined resistance to antimicrobial
agents. Ann. Rev. Microbiol. 32469-518.

Davis, L G., M. D. Dibner, and J. F. Battey. 1986. Basic methods in molecular
biology. Elsevier, N. Y.

de Lorenzo, V., M. Herrero, U. Jakubzlk, and K. N. Tlmmls. 1990. Mini-Tn5
transposon derivatives for insertion mutagenesis, promoter probing, and
chromosomal insertion of cloned DNA in Gram-negative eubacteria. J. Bacteriol.
172.6568-6572.

Dodson, K. W., and D. E. Berg. 1989. Factors affecting transposition activity of
IS50 and Tn5 ends. Gene 76:207-213.

Dower, W. J., and C. W. Ragsdale. 1988. High efficiency transformation of E.
coli by high voltage electroporation. Nucleic Acids Res. 16.6127-6145.

Drlica, K., and J. Rouviere-Yaniv. 1987. Histonelike proteins of bacteria.
Microbiol. Rev. 51:301-319.

Dworkin, M. 1985. Developmental Biology of the Bacteria, Benjamin/Cummings,
Menlo Park, CA.

Elhai, J., and C. P. Wolk. 1988a. A versatile class of positive-selection vectors
based on the nonviability of palindrome-containing plasmids that allows cloning
into long polylinkers. Gene 68:119-138.

Elhai, J., and C. P. Wolk. 1988b. Conjugal transfer of DNA to cyanobacteria.
Meth. Enz. 167:747-754.

Elhai, J., and C. P. Wolk. 1990. Developmental regulation and spatial pattern of
expression of the structural genes for nitrogenase in the cyanobacterium
Anabaena. EMBO J. 33379-3388.

Fiandt. M., w. Szybalski, and M. H. Malamy. 1972. Polar mutations in lac, gal
and phage A consist of a few lS-DNA sequences inserted with either orientation.
Mol. Gen. Genet. 119223-231.

 

 

152

Fling. M. E., J. Kopf, and C. Richards. 1985. Nucleotide sequence of the
transposon Tn7 gene encoding an aminoglycoside-modifying enzyme, 3"(9)-0-
nucleotidyltransferase. Nucl. Acids Res. 137095-7106.

Horas, E., M. G. Guerrero, and M. Losada. 1980. Short-term ammonium
inhibition of nitrate utilization by Anacystis nidulans and other cyanobacteria.
Arch. Microbiol. 128:1 37-1 44.

Friedman, D. I. 1988. Integration host factor: a protein for all reasons. Cell
55:545-554.

Galas, D. J., and M. Chandler. 1989. Bacterial insertion sequences, p. 109-162.
In E. D. Berg and M. M. Howe (eds.), Mobile DNA. American Society for
Microbiology, Washington, D. C.

Games, P., M. Chandler, P. Prentki, and D. J. Galas. 1987. Escherichia coli
integration host factor binds specifically to the ends of the insertion seq uence IS1
and to its major insertion hotspot in pBR322. J. Mol. Biol. 195:261-272.

Gay, P., D. LeCoq, M. Steinmetz. E. Ferrarl, and J. A. Hoch. 1983. Cloning
structural gene sacB, which codes for exoenzyme levansucrase of Bacillus
subtilis“. expression of the gene in Escherichia coli. J. Bacteriol. 1531424-1 431.

Gay, P., D. Le Coq, M. Steinmetz. T. Berkilman and C. I. Kado. 1985. Positive
selection procedure for entrapment of insertion sequence elements in Gram-
negative bacteria. J. Bacteriol. 164:918-921.

Ghosal, D., H. Sommer, and H. Saedler. 1979. Nucleotide sequence of the
transposable DNA-element I82. Nucl. Acids Res. 621111-1122.

Golden. J. W., S. J. Robinson, and R. Haselkom. 1985. Rearrangement of
nitrogen fixation genes during heterocyst differentiation in the cyanobacterium
Anabaena. Nature (London) 314:419-423.

Golden, J. W., and D. R. Wiest. 1988. Genome rearrangement and nitrogen
fixation in Anabaena blocked by inactivation of xisA gene. Science 242.1421-
1423.

Golden, S. S. 1988. Mutagenesis of cyanobacteria by classical and gene-
transfer-based methods. Meth. Enz. 167:714-727.

Golden, S. 8., M. S. Nalty, and D.-S. C. Cho. 1989. Genetic relationship of two
highly studied Synechococcus strains designated Anacystis nidulans. J.
Bacteriol. 171124-29.

 

153

Goodrich, J. A., M. L Schwartz, and W. R. McClure. 1990. Searching for and
predicting the activity of sites for DNA binding proteins: compilation and analysis
of the binding sites for Escherichia coli integration host factor (IHF). Nucl. Acids
Res. 184993-5000.

Gottesman, S. 1984. Bacterial regulation: global regulatory networks. Ann. Rev.
Genet. 18:415-441.

Gouy, M., and C. Gautier. 1982. Codon usage in bacteria: correlation with gene
expressivity. Nucl. Acids Res. 197055-7074.

Grant, S. G. N., J. Jessee, F. R. Bloom, and D. Hanahan. 1990. Differential
plasmid rescue from transgenic mouse DNAs into Escherichia coli methylation-
restriction mutants. Proc. Natl. Acad. Sci. USA. 87:4645-4649.

Grindley, N. D. F., and R. R. Reed. 1985. Transpositional recombination in
prokaryotes. Annu. Rev. Biochem. 54:863-896.

Halling, S. M., R. W. Simons, J. 0. Way, R. B. Walsh, and N. Kleckner. 1982.
DNA sequence organization of IS 1 Oright of Tn 10 and comparison with IS 10-left.
Proc. Natl. Acad. Sci. USA 792608-2612.

Hanahan. D. 1985. Techniques for transformation of Escherichia coli, p. 109-
135. In D. M. Glover (ed.), DNA cloning, vol. I. IRL Press, Oxford.

Haselkom. R. 1978. Heterocysts. Ann. Rev. Plant Physiol. 29319-344.

Haselkom. R. 1986. Organization of the genes for nitrogen fixation in
photosynthetic bacteria and cyanobacteria. Ann. Rev. Microbiol. 49525-527.

Haselkorn, R. 1989. Excision of elements interrupting nitrogen fixation operons
in cyanobacteria, p. 735-742. In D. E. Berg and M. M. Howe (eds.), Mobile DNA.
American Society for Microbiology, Washington, D. C.

Heitman, J., and P. Model. 1987. Site-specific methylases induce the SOS DNA
repair response in Escherichia coli. J. Bacteriol. 169.3243-3250.

Heinzel. P., O. Werbitzky, J. Distler, and W. Piepersberg. 1988. A second
strptomycin resistance gene from Streptomyces griseus codes for streptomycin-
3"-phosphotransferase. Arch. Microbiol. 159184-192.

Herdman, M., M. Janvier, J. B. Waterbury, R. Rippka. and R. Y. Stanier. 1979a.
Deoxyribonucleic acid base composition of cyanobacteria. J. Gen. Microbiol.
11 1:63-71.

154

Herdman, M., M. Janvier, R. Rippka, and R. Y. Stanier. 1979b. Genome size of
cyanobacteria. J. Gen. Microbiol. 111273-85.

Herrero, A., E. Flores, and M. G. Guerrero. 1981. Regulation of nitrate reductase
levels in the cyanobacteria Anacystis nidulans, Anabaena sp. strain 7119, and
Nostoc sp. strain 6719. J. Bacteriol. 145:175-180.

Heusterspreute, M., V. H. Thi, S. Emery, S. Toumis-Gamble, N. Kennedy, and J.
Davison. 1985. Vectors with restriction site banks: lV. pJRD184, a 3793-bp
plasmid vector having 43 unique cloning sites. Gene 39299-304.

Hirschberg, J., and L McIntosh. 1983. Molecular basis of herbicide resistance
in Amaranthus hybridus. Science 21346-1348.

Holland, D., and C. P. Wolk. 1990. Identification and characterization of hetA,
a gene that acts early in the process of morphological differentiation of
heterocysts. J. Bacteriol. 172:3131-3137.

Holmes, D. S., and M. Quigley. 1981. A rapid boiling method for the preparation
of bacterial plasmids. Anal. Biochem. 114:193-197

Horinouchi, S., and B. Weisblum. 1982. Nucleotide sequence and functional
map of pE194, a plasmid that specifies inducible resistance to macrolide,
Iincosamide, and streptogramin type B antibiotics. J. Bacteriol. 159804-814

lkemura, T. 1985. Codon usage and tRNA content in unicellular and multicellular
organisms. Mol. Biol. Evol. 213-34.

Kentemioh, T., G. Danneberg, B. Hundeshagen, and H. Bothe. 1988. Evidence
for the occurrence of the alternative, vanadium-containing nitrogenase in the
cyanobacterium Anabaena variabilis. FEMS Microbiol. Lett. 51:19-24. '

Klier, A., A. Fouet, M. Debarboullle, F. Kunst and G. Papoport. 1987. Distinct
control sites located upstream from the levansucrase gene of Bacillus subtilis.
Mol. Microbiol. 1:233-241.

Kroos, L, and D. Kaiser. 1984. Construction of Tn5 lac, a transposon that fuses
IacZ expression to exogenous promoters, and its introduction into Myxococcus
xanthus. Proc. Natl. Acad. Sci. USA 81:5816-5820.

Kroos, L, and D. Kaiser. 1987. Expression of many developmentally regulated
genes in Myxocuccus depends on a sequence of cell interactions. Genes &
Development 1:840-854.

155

Kroos, L, A. Kuspa, and D. Kaiser. 1986. A global analysis of developmentally
regulated genes in Myxococcus xanthus. Develop. Biol. 117:252-266.

Krulwich, T. A., P. G. Quirk, and A. A. Guffanti. 1990. Uncoupler-resistant
mutants of bacteria. Microbiol. Rev. 54:52-65.

Kuhsel, M. G., R. Strlcldand, and J. D. Palmer. 1990. An ancient group I intron
shared by eubacteria and chloroplasts. Science 250.1570—1573.

Kushner, D. J., C. Breuil. 1977. Penicillinase (B-lactamase) formation by blue-
green algae. Arch. Microbiol. 112219-223.

Lammers, P. J., J. W. Golden, and R. Haselkom. 1986. Identification and
sequence of a gene required for a developmentally regulated DNA excision in
Anabaena. Cell 44: 905-91 1 .

Lammers, P. J., and R. Haselkom. 1983. Sequence of the nifD gene coding for
the a subunit of dinitrogenase from the cyanobacterium Anabaena. Proc. Natl.
Acad. Sci. USA 80. 4723-4727.

Lammers, P. J., S. McLaughlin, S. Pepin, C. Trujillo-Provenclo, and A. J. Ryncarz
II. 1990. Developmental rearrangement of cyanobacterial nif genes: nucleotide
sequence, open reading frames, and cytochrome P-450 homology of the
Anabaena sp. strain PCC 7120 nifD element. J. Bacteriol. 1726981 -6990.

Lewin, B. M. 1985. Genes, second edition. John Wiley and Sons, Inc., New
York, NY.

Lewin, R. A. 1976. Prochlorophyta as a proposed new division of algae. Nature
(London) 261:697-698.

Lipman, D. J., and W. R. Pearson. 1985. Rapid and sensitive protein similarity
searches. Science 227:1435-1441.

Lynn, M. E., J. A. Bantle, and J. D. Ownby. 1986. Estimation of gene expression
in heterocysts of Anabaena variabilis by using DNA-RNA hybridization. J.
Bacteriol. 167:940-946.

Mackinney, G. 1941. Absorption of fight by chlorophyll solutIons J. Biol. Chem.
140.315-322.

Malamy. M. J. 1970. Some properties of insertion mutations in the lac operon,
p. 359-373. In J. R. Beckwith and D. Zipser (eds.), The lactose operon. Cold
Spring Harbor Laboratory, Cold Spring Harbor, N. Y.

   

 

156

Maldener, |., W. Lockau, Y. Cai, and C. P. Walk. 1991. Calcium-dependent
protease of the cyanobacterium Anabaena: molecular cloning and expression of
the gene in Escherichia coli, sequencing and site-directed mutagenesis. Mol.
Gen. Genet. $51 13—120.

Maly, F. E., A. Urwyler, H. P. Rolll, C. A. Dahinden, and A. L de Week. 1988. A
single-photon imaging system for the simultaneous quantitation of luminescent
emissions from multiple samples. Analyt. Biochem. 168:462-469.

Maniatis, T., E. F. Fritsch and J. Sambrook. 1982. Molecular cloning, a
laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y.

Manzano, C., P. Candau, C. G6mez-Moreno, A. M. Relimplo, and M. Losada.
1976. Ferredoxin-dependent photosynthetic reduction of nitrate and nitrite by
particles of Anacystis nidulans. Mol. Cell. Biochem. 10.161-169.

Margulis, L 1981. Symbiosis in Cell Evolution. W. H. Freeman and Co., San
Francisco, CA.

Marsh, J. L, M. Erfle, and E. J. Wykes. 1984. The plC plasmid and phage
vectors with versatile cloning sites for recombinant selection by insertional
inactivation. Gene 32481-485.

Mazel, D., A.-M. Castets, J. Houmard, and N. Tandeau de Marsac. 1988.
Cyanobacterial insertion elements: characterization and potential, p. 227. Abstr.
VI lntl. Symp. Photosynthetic Prokaryotes. Aug. 8-13, 1988. Noordwijkerhout,
The Netherlands.

Mazodier, P. P. Cossart, E. Giraud, and F. Gasser. 1985. Completion of the
nucleotide sequence of the central region of Tn5 confirms the presence of three
resistance genes. Nucl. Acids Res. 13195-205.

Mazodier, P., O. Genilloud, E. Giraud, and F. Gasser. 1986. Expression of Tn5
encoded streptomycin resistance in E. coli. Mol. Gen. Genet. 204:404-409.

Mazur, B. J., and C.-F. Chui. 1982. Sequence of the gene coding for the 8-
subunit of dinitrogenase from the blue-green alga Anabaena. Proc. Natl. Acad.
Sci. USA. 796782-6786.

McFadden, B. A., and C. L Small. 1988. Cloning, expression and directed
mutagenesis of the genes for ribulose bisphosphate carboxylase/oxygenase.
Photosynthesis Res. 18:245-260.

 

157

Meeks, J. C., C. P. Wolk, J. Thomas, W. Lockau, P. W. Shaffer, S. M. Austin, W.-
S. Chien, and A. Galonsky. 1977. The pathways of assimilation of 13NH4+ by
the cyanobacterium, Anabaena cylindrica. J. Biol. Chem. 252:7894-7900.

Meighen, E. A. 1991. Molecular biology of bacterial bioluminescence. Microbiol.
Rev. 55:123-142.

Mevarech, M., D. Rice, and R. Haselkom. 1980. Nucleotide sequence of a
cyanobacterial nifH gene coding for nitrogenase reductase. Proc. Natl. Acad.
Sci. USA. 77:6476-6480.

Mitchell, P. 1961. Coupling of phosphorylation to electron and hydrogen transfer
by a chemiosmotic type of mechanism. Nature (London) 191:144-148.

Morden, C. W., and S. S. Golden. 1989. psbA genes indicate common ancestry
of prochlorophytes and chloroplasts. Nature (London) 337:282-285.

Morisato, D., and N. Kleckner. 1987. Tn 10transposition and circle formation in
vitro. Cell 51:1-01-111.

Mulligan, M. E., D. K. Hawley, R. Entriken, and W. R. McClure. 1984. Escherichia
coli promoter sequences predict in vitro RNA polymerase selectivity. Nucl. Acids
Res. 12789-800.

Murphy, R. C., G. E. Gasparich, D. A. Bryant. and R. D. Porter. 1990. Nucleotide
sequence and further characterization of the Synechococcus sp. strain PCC 7002
recA gene: complementation of a cyanobacterial recA mutation by the
Escherichia coli recA gene. J. Bacteriol. 172967-976.

Murry, M. A., and C. P. Wolk. 1989. Evidence that the barrier to the penetration
of oxygen into heterocysts depends upon two layers of the cell envelope. Arch.
Microbiol. 151:469-474.

Nelson, M., and M. McClelland. 1989. Effect of site-specific methylation on DNA
modification methyltransferases and restrictionendonucleases. Nucleic Acids
Res. 17:r388—r405.

Nichols, J. M., and D. G. Adams. 1982. Akinetes, p. 387-412. In N. G. Carr and
B. A. Whitton (eds.), The Biology of Cyanobacteria. Blackwell, Oxford.

Nierzwicki-Bauer, S. A., S. E. Curtis, and R. Haselkom. 1984. Cotranscription of
genes encoding the small and large subunits of ribulose-1,5-bisphosphate
carboxylase in the cyanobacterium Anabaena 7120. Proc. Natl. Acad. Sci. USA
8125961 -5965.

 

158

Ounissi, H., and P. Courvalin. 1985. Nucleotide sequence of the gene ereA
encoding the erythromycin esterase in Escherichia coli. Gene 35:271-278.

Owttrirn. G. W., and J. R. Coleman. 1989. Regulation of expression and
' nucleotide sequence of the Anabaena variabilis recA gene. J. Bacteriol.
171:5713-5719.

Pabo, C. 0., and R. T. Sauer. 1984. Protein-DNA recognition. Ann. Rev.
Biochem. 53293-321.

Padhy, R. N., F. G. Hottat, M. M. Coene, and P. P. Hoet. 1988. Restriction
analysis and quantitative estimation of methylated bases of filamentous and
unicellular cyanobacterial DNAs. J. Bacteriol. 170.1934-1939.

Porter, R. D. 1986. Transformation in cyanobacteria. Crit. Rev. Microbiol.
13:111-132.

Prentkl, P, and H. M. Krisch. 1984. In vitro insertional mutagenesis with a
selectable DNA fragment. Gene 29303-313.

Radding, C. M. 1985. The molecular and enzymatic basis of homologous
recombination, p. 217-237. In J. Scaife, D. Leach, and A. Galizzi (eds.), Genetics
of Bacteria. Academic Press, Orlando, FL.

Ralelgh, E. A., and G. Wilson. 1986. Escherichia coli K-12 restricts DNA
containing 5-methylcytosine. Proc. Natl. Acad. Sci. USA. 839070-9074.

Raleigh, E. A., N. E. Murray. H. Revel, R. M. Blumenthal, D. Westaway, A. D.
Reith, P. W. J. Rigby, J. Elhai, and D. Hanahan. 1988. McrA and Mch restriction
phenotypes of some E. coli strains and implications for gene cloning. Nucleic
Acids Res. 191563-1575.

Reddy, K. J., G. S. Bullerjahn, D. M. Sherman, and L A. Sherman. 1988. Cloning,
nucleotide sequence and mutagenesis of a gene (irpA) involved in iron-deficient
growth of the cyanobacterium Synechococcus sp. strain PCC 7942. J. Bacteriol.
1 70. 4466-4476.

Rice, D., B. Mazur, and R. Haselkom. 1982. Isolation and physical mapping of
nitrogen fixation genes from the cyanobacterium Anabaena 7120. J. Biol. Chem.
257:13157-13163.

Ried, J. L, and A. Collmer. 1987. An nptl-sacB-sach cartridge for constructing
directed, unmarked mutations in Gram-negative bacteria by marker exchange-
eviction mutagenesis. Gene 57:239-246.

159

Rippka. R. 1988. Recognition and identification of cyanobacteria. Methods
Enzymol. 167:28-67. '

Rippka, R., J. Deruelles, J. B. Waterbury, M. Herdman, and R. Y. Stanler. 1979.
Generic assignments, strain histories and properties of pure cultures of
cyanobacteria. J. Gen. Microbiol. 111:1-61.

Roberts, 0., D. C. Hoopes, W. R. McClure, and N. Kleckner. 1985. ISIO
transposition is regulated by DNA adenine methylation. Cell 43:117-130.

Rose, R. E. 1988. The nucleotide sequence of pACYC184. Nucleic Acids Res.
16.355.

Rosenberg, A. H., B. N. Lake, D.-S. Chui, S.-W. Lin, J. J. Dunn, and F. W. Studier.
1987. Vectors for selective expression of cloned DNAs by T7 RNA polymerase.
Gene 56:125-135.

Sakaguchl, K. 1990. Invertrons, a class of structurally and functionally related
genetic elements that includes linear DNA plasmids, transposable elements, and
genomes of adeno-type viruses. Microbiol. Rev. 54:66-74.

Sanger, F.. S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-
terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467.

Scanlan, D. J., S. A. Bloye, N. H. Mann, D. A. Hodgson, and N. G. Carr. 1990
Construction of IacZ promoter probe vectors for use in Synechococcus:
application to the identification of COz-regulated promoters. Gene 9943-49.

Schmetterer, G., and C. P. Walk. 1988. Identification of the region of
cyanobacterial plasmid pDU1 necessary for replication in Anabaena sp. strain M-
131. Gene 62101-109.

Seed, B. 1983. Purification of genomic sequences from bacteriophage libraries
by recombination and selection in vivo. Nucl. Acids Res. 11:2427-2445.

Sheen, J., and B. Seed. 1988. Electrolyte gradient gels for DNA sequencing.
BioTechniques 6.942-944.

Shen, P., and H. V. Huang. 1986. Homologous recombination in Escherichia coli
dependence on substrate length and homology. Genetics 112441-457.

Shestakov, S. V., and N. T. Khuyen. 1970. Evidence for genetic transformation
in blue-green alga Anacystis nidulans. Mol. Gen. Genet. 107:372-375.

160

Shinozaki, D, and M. Sugiura. 1985. Genes for the large and small subunits of
ribulose-1,5-bisphosphate carboxylase/oxygenase constitute a single operon in
a cyanobacterium Anacystis nidulans 6301. Mol. Gen. Genet. 20027-32.

Silhavy, T. J., and J. R. Beckwith. 1985. Uses of lac fusions for the study of
biological problems. Microbiol. Rev. 49398-418.

Simon. R., J. Quandt, and W. Klipp. 1989. New derivatives of transposon Tn5
suitable for mobilization of replicons, generation of operon fusions and induction
of genes in Gram-negative bacteria. Gene 89161-169.

Stanler. R. Y., and G. Cohen-Bazlre. 1977. Phototrophic prokaryotes: the
cyanobacteria. Ann. Rev. Microbiol. 31:225-274.

Stanler. R. Y. 1977. The position of cyanobacteria in the world of phototrophs.
Carlsberg Res. Commun. 4277-98.

Steinmetz, M., D. Le Coq, S. Aymerlch, G. Gonzy-Tréboul, and P. Gay. 1985.
The DNA sequence of the gene for the secreted Bacillus subtilis enzyme
levansucrase and its genetic control sites. Mol. Gen. Genet. 200220-228.

Stragier, P. R. Losick. 1990. Cascades of sigma factors revisited. Mol.
Microbiol. 421801-1806.

Sundstrbm, L, P. H. Roy, and O. Skbld. 1991. Site-specific insertion of three
structural gene cassettes in transposon Tn7. J. Bacteriol. 173:3025-3028.

Tabor, S., and C. Richardson. 1985. A bacteriophage T7 RNA
polymerase/promoter system for controlled exclusive expression of specific
genes. Proc. Natl. Acad. Sci. USA. 821074-1078.

Tandeau de Marsac, N., and J. Houmard. 1987. Advances in cyanobacterial
molecular genetics, p. 251-302. In P. Fay and C. Van Baalen (eds), The
Cyanobacteria. Elsevier Science Publishing, Inc., New York.

Thiel, T. 1991. Isolation and characterization of genes for an alternate
nitrogenase in the cyanobacterium Anabaena variabilis ATCC 29413. Abstr.
152B. VII lntl. Symp. Photosynthetic prokaryotes. July 21-26, 1991. Amherst,
MA.

Trieu-Cuot, P., C. Carlier, P. Martin, and P. Courvalin. 1987. Plasmid transfer by

conjugation from Escherichia coli to gram-positive bacteria. FEMS Microbiol. Lett.
48289-294.

161

Tsinoremas. N. F., A. M. Castets, M. A. Harrison, J. F. Allen, and N. Tandeau de
Marsac. 1991. Photosynthetic electron transport controls nitrogen assimilation
in cyanobacteria by means of posttranslational modification of the gInB gene
product. Proc. Natl. Acad. Sci. USA. 88:4565-4569.

Turner, N. E., S. J. Robinson, and R. Haselkom. 1983. Different promoters for
the Anabaena glutamine synthetase gene during growth using molecular or fixed
nitrogen. Nature (London) 306.337-342.

Vieira, J., and J. Messing. 1987. Production of single-stranded plasmid DNA.
Methods Enzymol. 153:3-11.

Von Heijne, G. 1987. Sequence analysis in molecular biology: treasure trove or
trivial pursuit? p. 81-121. Academic Press, Inc. New York, NY.

Whltton. B. A., N. G. Carr, and I. W. Cralg. 1971. A comparison of the fine
structure and nucleic acid biochemistry of chloroplasts and blue-green algae.
Protoplasma 72325-357.

Wilcox. M., G. J. Mitchison, and R. J. Smith. 1973. Pattern formation in the blue-
green alga Anabaena. ll. Controlled proheterocyst regression. J. Cell Sci.
13:637-649.

Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51:221-271.

Wolk, C. P. 1982. Heterocysts, p. 359-386. In N. G. Carr and B. A. Whitton
(eds), The Biology of Cyanobacteria. Blackwell Scientific Publ., Oxford.

Wolk, C. P. 1989. Alternative models for the development of the pattern of
spaced heterocysts in Anabaena (Cyanophyta). PI. Syst. Evol. 164:27-31.

Wolk, C. P., Y. Cai, L Cardemil, E. Flores, B. Hohn, M. Murry, G. Schmetterer, B.
Schrautemeler and R. Wilson. 1988. Isolation and complementation of mutants
of Anabaena sp. strain PCC 7120 unable to grow aerobically on dinitrogen. J.
Bacteriol. 17912391 244.

Wolk, C. P., Y. Cal, and J.-M. Panoff. 1991. Use of a transposon with luciferase
as a reporter to identify environmentally responsive genes in a cyanobacterium.
Proc. Natl. Acad. Sci. USA. 88:5355-5359.

Wolk, C. P., A. Vonshak, P. Kehoe, and J. Elhai. 1984. Construction of shuttle
vectors capable of conjugative transfer from Escherichia coli to nitrogen-fixing
filamentous cyanobacteria. Proc. Natl. Acad. Sci. USA 81:1561-1565.

162

Xu, M.—Q., S. D. Kathe, H. Goodrich-Blair, S. A. Nierzwicki-Bauer, and D. A. Shub.
1990. Bacterial origin of a chloroplast intron: conserved self-splicing group I
introns in cyanobacteria. Science 25915664570.

Yin, J. C. P., M. P. Krebs, and W. S. Reznikoff. 1988. Effect of dam methylation
on Tn5 transposition. J. Mol. Biol. 19935-45.

Yuan, R. 1981. Structure and mechanism of multifunctional restriction
endonucleases. Ann. Rev. Biochem. 59285-315.

Zhang. G., M. Durand, R. Jeanjean, and F. Joset. 1989. Molecular and genetical
analysis of the fructose-glucose transport system in the cyanobacterium
Synechocystis PCC6803. Mol. Microbiol. 91221-1229.

IGQN STR TE UN IV

m‘IIaII I2IIg III OIIOI

um.

I III:
9081

[all

‘hf FIVKIhQP,

H

gum.‘ I .II V\

I
..I.

L'Lf

fir

 

 

 

33141:»?

 

MAI