V

A s

---.,:~ fl“.

1.—
=g.'._ -'R- " ”I

 

v

.5".

.uv

 

    

-m

 

     
  

     

 
   

    
 
  
   
    
  
 
 
   
  
  
  
  
  
  
  
 
    
  
   

    

‘ v

flit)", 213% VV; 5%).

“PMW??

      

V
4‘ 2 ‘IEVV‘V‘M...’ 2;,3122—12255'5 3: Vin?“ VHV‘VV :1:
922m M 3“

.v‘l ~
W” .‘7‘ 0.. ’1 r‘“ 'l':' ‘I'H‘ ”fl is.”
I3 QV 32m; [.ndmo‘

.V2‘Iu,

             

'V_

. .afifigg?

2.1:
mefififlfifl~ 22 ”Kg! . i
fifififiwWW‘wwme_ ”WW4 flukhmfi&y
“122;” ,2] wrap .1-M "I I: 313,21. 23!! 1.229") I422

”"1 kfla"
di‘NI‘. km" ‘
1’“; “it “2‘ fag!- I" ‘ 1“..." 15.33093“

 
 
 
 

12222)} 2 _.

13.5;
é
3;-VT‘V.

         
  
 
 
 
    
 
 
     
    
    
       
 
      
  

 

 

   
   

   
    
     
 
      
  
  
 

  
    

  

VVVVV.” .21)“ PM!) 2‘ ”311v Mfr) M" VI?" 215‘. 1‘1
“r 4 V V V VV; .” .:V\‘V'V 4132“!) ! fltv‘ 3‘" '- 3:34,; IF“ I . ‘.
if??? gum.“ ,th!’ ‘Vilt‘ it: LI” iii; :2: 11p '1. I “3 PE! film " 2,1. 2 ggw.‘ #1?" 'gfiil‘éz'ikég " A -’
2.221321 1% .2351. 2". $232 2' ;;2 24:22:22 2 #1,“ IE!?'~:"~‘~.. '. -
2 ' v 'm it‘ll ”‘OII‘J" 4 “E V "'1 2L ' g f ‘2 ’t). .
.91} 1-‘1' m 339.}; wt}? 2 “WVf .H'idixtw‘hl51".22gg‘jfifx :VJVLUQVLV'WQ ti; . .2124??? .32};
:T’ifil‘g‘in-"z 3:2 1 gr " q'ji'd nun-2 2‘“ .‘i' '1 “via? "T‘fl (:125'2“ CM?“ LEI
$55.3“ "Nip ."g Am ft 231;” 26'“ "3 25):. Mai”) 32%;“, ’5'qu {5.58 34914;; 5,}32322212
fflr‘” . "“51!“ ‘ xd'lI" 35*“ I”: 44th WNW] “" “I" “1.1-: {'1}:qu “.5!" It: " 7“ ":‘J ' ft
l)!’;fid.ii‘l(4' :22 IE“: In" ‘- 'H‘JB 1'“ a" .3 $1.35“. WV“! !:m g’ ' 1%”: ”- H1:3 ; 'ihkgi; 2.“, 4 Al
M:"‘:::‘5§l 1:1: VV'VI VVVfl {IUVVVVVVV “14%.? . - . . fl} V153???“ '{E’I‘IF‘ V: i I" "W4 ‘2‘? VV_VVVV!$ ‘::'.‘V§3‘! ‘5";‘15
'11::th NV];- 1; 1:- Eh" $11.1; :3. V| .1. V Vi“ V???” :1". . V #12 W
2 “,2“ m, " ‘qlcl‘ 1"“ ‘Il\°"V"“ M é‘flxfi {‘3‘ 1333]“ ”‘5‘! ‘1;
Law 31’2” ”4225“ 2| IL” . 23. ah, NVIIWWWSI‘L
Vafii‘tf‘1V2'VV‘VVn'fl.“ {Ndlfi'g‘ 2—H hi“, .2813" .‘VEa “(1%:th [5.9212]! 555.4%de , o
XIV-ru‘ if} - " Emir. . . . $12“; , 2- fly ‘
‘V‘i ‘Vlgu " “Til“? 1“,- "v”
I] ‘2"22‘- “22" W 3| .2.

W

      

 

 

[NV 2;

o ‘ I” "21".?L . LI " I!

‘VV "1" VVVVV-VJVVEVV VVV

‘ 2 '3 521:2, "' :5: 1V

‘ 5"! in 11;? VI} tullff‘ ‘1
. o . ”“ $1.22 'V '1'
Z" 7V 2. y] . I fxfil.’ 15.2; quh' ‘0‘]
"§¥~:I’s‘ ‘ } :I
‘32‘,2:712I'.|‘;lnl17",lhl'lii; [-1 ‘|J\ I...
VVVVVV‘VVVVVVV I, n. '_l ' “2;“! 1le 2‘ ‘, ‘IVV; .‘ ,EVE'N

» H“. " 2 ' I I[ .
; '{tlifiL' fr.‘ ' 1' V in. l- "I .212 [32"! 2:.
.' 'z 1"?! ;2“’ “.é’u ‘i 2' VI‘AtvIII“ 2.‘-‘- " ‘

I}; I
'2122; 2.3.1. .2

 

 
  
      
 
  
 
  
  

    

  
    

    
 
 

      
       
 
 

  

           
  
  
    
         
  
  

  
     

     

        
  
 

‘3

.'.
2“:-

I
.2 pr

I
o
‘ . I'll 1' W2 2 In” H ‘1-
'1';;" ‘.‘»' .V I .E" H“
V. . V) ".- I L t 1 2 VV{V£gEz1:‘VVVV V“: ‘V'u'luhzé VVLVVVV
“27",:5- ‘ '2 ‘ ' . - 'I 2;! '

. , I . T ‘2, I " k .2 - . » {7" 6‘71?“ " f‘Ulh 1‘ Ii“? 2 ."L

Elwéi'i'y2ulai ’4'”! . . : 3‘22? “17‘. 23.33.5212“ :T'it, 213:2 3"}
”3‘! 1”: “i“ “.‘A‘v'u ' '1). III. - 'VV‘.“ 1. ‘ NLillirhi‘;fl1:t'.:1:rlz‘l In ”lit. TVVV’V. 'V, V1.“ '6‘ ;-;-

I. In! ‘J'. :.-,V:; :12 r :2 :2 2 :1 I._' .u.‘ . . p3:.VL ‘

" 'II’IL'IJV‘I "(122%. 2‘2 7 ‘ ,:.21.,1V2"§§§":25H. :. .. 1‘1"th“1.'|“‘."’I‘:"rf,.‘,V; ‘1 I15} [215; m" 212 ‘21 H 3:»;
.‘l‘ VIVKKUNEII‘ l‘r {'2» . “ft V2_y:‘is‘t€‘.|li§;“.l£l Vin i V V V I VVVyL IV? V." V'VVIV IVIV . L t Vi" I5 I {\J 1V' 1' i ‘ 2 ‘1%'
2" '5’ 212‘ 2V 1', ..|V'I‘ 2 ,. ,,'y|.' s l 2-,‘

;,<_2,..2 _-2.‘I .:’.I 2 2 .2 ,2“ 32 2 2--.:_ {-12 m1. _ , £2 I firm": I, .2 ‘I' :Ijv'y .!;2nygt;: ': "'2 a:

“:{--'.W11]”"=II|#712"21‘-2-"' . :2 “2': 2 Mn "2=‘.I:::' 2 "' 1’: It“ I “22%? '5'222 ‘I' 222‘ 25m 5‘5? ugli, '1‘ 2"II2;‘I‘S-:;'-?‘“fig-4'}hntzb‘fi'

. 2- ~ ' I'.r."I‘2 1 2 I1 .'I-.- .‘ . 2 H ‘ "‘1 2-»:‘J’I‘1i‘ .'

V\;_ VV 3 -V 2'13“: ”V VI“ 2 '. 2'.‘ I;"i1',“l2"l:1'.lllh'x {éz'fltl'i};u‘h11'|;'fl7 2h 1‘ I] ,1: - ”‘IJ‘5'h2'I,-2.'zi:§o~| xVIV .

2 2 -: 2 .. 2.2.62 22. w W. 2-2? ‘2 ‘22.: VI‘: 22 25!! 2‘ .2 I 14H!» w? 2
1 r. . I.' J. 22 "1|“ 2V2 I, IV: E '5 . f
2 22 22.212. 2»
I 1‘ .l I

.5.‘

      

‘lz‘fii‘lfi; o
22.2. has:
ilk?

...- "2 ‘72} V ,‘f. V. V
i ”drug,“ ;%Hq~{sfl1 [‘fi’fil‘lb; 1331:3513: ‘11 v}!
‘"“ Vii”. 1’ fifli‘l. ‘ ~ ~ 1"“ 2 3:12-32:72445. .3

‘J 2 . V

2m22Vi
" """ 4
5G

3' l u "‘3'"

“Wm? :c‘~r\“2.’1»f'§‘. I ‘ .-
IMHINII‘IIW? 4‘22”"?

33"; " '

   

   
 

 

5..
\

‘JVII".
:lI
MI

illlllilllilllllllillillllilill“Hillllllilillllllli

31293 01397 9509

This is to certify that the

dissertation entitled

Exploring a Novel Virus-Host Interaction in a

Baculovirus-Infected Insect Cell Line

presented by

Xianlin Du

has been accepted towards fulfillment
of the requirements for

Doctoral degreein Microbiology

Suzanne M. Thiem

RM/h’m

Major professor

Date—JAILleJQQL

MSU is an Affirmative Action/Equal Opportunity Institution 0-12771

 

LIBRARY

Michigan State
University

 

 

 

——v—'———‘- —‘

'- -_ - - "vw

PLACE IN RETURN BOX
to remove this checkout from your record.
TO AVOID FINES return on or before date due.

 

DATE DUE

MTE DUE

DATE DUE

 

arm! 3 I939
f“! W (

 

 

'(I

 

 

 

 

 

 

 

 

 

 

 

 

1/98 chIRCJDataDuapfiS—p.“

 

EXPLORING A NOVEL VIRUS-HOST INTERACTION IN A BACULOVIRUS-
INFECTED INSECT CELL LINE

By

Xianlin Du

A DISSERTATION
Submitted to
Michigan State University

in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Microbiology

1997

ABSTRACT

EXPLORING A NOVEL VIRUS-HOST INTERACTION IN A BACULOVIRUS-
INFECTED INSECT CELL LINE

By

Xianlin Du

Global protein synthesis is shut down at late times post infection (p.i.) in Ld652Y
cells derived from gypsy moth infected with baculovirus Autographa californica
nucleopolyhedrovirus (AcMNPV) in the presence of apparently normal mRNAs. A single
gene, host range factor 1 (hrf-I) was identified from another baculovirus, Lymantria
dispar nucleopolyhedrovirus (LdMNPV), that promoted AcMNPV replication in Ld652Y
cells. Recombinant AcMNPVs bearing hrf-I were constructed that replicated in Ld652Y
cells. hrf-I was transcribed as an early gene and encoded a novel protein of 25.7 kDa that
did not have any motif that might imply its function.

Experiments were carried out to investigate the possible connections between
apoptosis and protein synthesis shut down. The apoptosis suppressor AcMNPV P35 was
translated prior to protein synthesis shut down and functiOned to prevent apoptosis in
AcMNPV-infected Ld652Y cells. HRF -1 could prevent protein synthesis shut down even
when cells were undergoing apoptosis but I-IRF-l could not functionally substitute for
P35. The DNA synthesis inhibitor aphidicolin could block both apoptosis and protein
synthesis shut down in Ld652Y cells induced by p35' AcMNPV but not protein synthesis
shut down in wt AcMNPV-infected Ld652Y cells. These data suggested that protein

synthesis shut down and apoptosis were separate responses of Ld652Y cells to AcMNPV

infection and that P35 was involved in inducing a second pathway that led to protein
synthesis shut down.

A cell—free translation system (cytoplasmic lysate) was established from insect
cells and a series of in vitro translation assays were carried out to identify the defect in
protein synthesis in AcMNPV-infected Ld652Y cells. Lysate derived from AcMNPV-
infected Ld652Y cells at late times p.i. did not display in vitro translation ability but its
translation ability could be restored by addition of uncharged eukaryotic tRN A. Our 'data
suggested that the defect of protein synthesis in AcMNPV-infected Ld652Y cells lied in
the adaptor ability of a single or a small group of tRNA species and that a common
mechanism of protein synthesis shut down was shared in AcMNPV-infected Ld652Y and

BmN cells.

To my wife Jingheng Cheng

To my sons Pengcheng (Daniel) and Wanli (Kevin)

iv

ACKNOWLEDGMENTS

I would like to express my deep appreciation and gratitude to my major professor,
Dr. Suzanne M. Thiem, for her continued financial support and excellent guidance
throughout my graduate program. I also want to express my deep gratitude to my
committee members, Dr. Alex Raikhel, Dr. Sue Conrad, Dr. Patrick Venta, especially
Dr. Steven Triezenberg and Dr. Loren Snyder, for their invaluble time and advice. I am
particularly grateful to our lab technician Steven Cassar for his excellent job in

maintaining our lab and excellent technical assistance.

TABLE OF CONTENTS

LIST OF TABLES ........................................................................................................... viii
LIST OF FIGURES ............................................................................................................ ix
INTRODUCTION ............................................................................................................... 1
CHAPTER 1
Literature Review ................................................................................................................ 4
The Biology of Baculoviruses ................................................................................. 4
The Characteristics of Baculoviruses .......................................................... 4
In Vivo and In Vitro Infection ..................................................................... 5
Gene Organization and Function ................................................................. 7
Gene Expression in Cell Culture ................................................................ lO
Virus Host Interaction ............................................................................................ 11
Host Range Determination ......................................................................... ll
Apoptosis ................................................................................................... 16
Protein Synthesis Shut Down .................................................................... 19
CHAPTER 2

Identification of a Baculovirus Gene That Promotes
Autographa californica Nucleopolyhedrovirus

Replication in a Nonpermissive Insect Cell Line .............................................................. 23
Abstract .................................................................................................................. 24
Introduction ............................................................................................................ 24
Materials and Methods ........................................................................................... 27
Results .................................................................................................................... 32
Discussion .............................................................................................................. 45
Acknowledgments .................................................................................................. 48

CHAPTER 3

Characterization of Host Range Factor 1 (hrf-I) Expression
in Lymantria dispar Nucleopolyhedrovirus- and
Recombinant Autographa californica Nucleopolyhedrovirus-

Infected IPLB-Ld652Y Cells ............................................................................................. 49
Abstract .................................................................................................................. 50
Introduction ............................................................................................................ 50

vi

Materials and Methods ........................................................................................... 52

Results .................................................................................................................... 58
Discussion .............................................................................................................. 73
Acknowledgments .................................................................................................. 79

CHAPTER 4 '

Responses of Insect Cells To Baculovirus Infection:

Protein Synthesis Shut Down and Apoptosis .................................................................... 80
Abstract... ............................................................................................................... 81
Introduction ............................................................................................................ 82
Materials and Methods ........................................................................................... 85
Results .................................................................................................................... 88
Discussion .............................................................................................................. 98
Acknowledgments ................................................................................................ 105

CHAPTER 5

Investigation of the Defect in Protein Synthesis in
Autographa californica Nucleopolyhedrovirus-Infected

Ld652Y Cells ................................................................................................................... 106
Abstract. ............................................................................................................... 107
Introduction .......................................................................................................... 107
Materials and Methods ......................................................................................... 110
Results and Discussion ........................................................................................ 114
Acknowledgment ................................................................................................. 125

LIST OF REFERENCES ............................................... 125

vii

LIST OF TABLES

Table 1 - Replication of AcMNPV in Ld652Y Cells Following Transfection

of Viral and Cosmid DNAs into Ld652Y cells ................................................... 33
Table 2 - Occluded Virus Production in Ld652Y Cells ..................................................... 62
Table 3 - Budded Virus Production in Ld652Y Cells Assayed on Both

Ld652Y and SF-21 Cells ................................................................................... 62
Table 4 - tRNA Adaptor Abilities .................................................................................... 121

viii

LIST OF FIGURES

Figure 1 - Location of Clones Used to Map the LdMNPV Gene
in Transfection Assays ...................................................................................... 34

Figure 2 - Analysis of ORFs and Nucleotide Sequence of the LdMNPV

Genome Between 43.3 and 43.8 m.u ................................................................ 37
Figure 3 - Bright-Field Micrographs of Ld652Y Cells Post Transfection ......................... 39
Figure 4 - Diagram Showing the Construction of Recombinant

AcMNPV, vAchPS ......................................................................................... 42
Figure 5 - Coomassie Blue Stained Gels and Western Blot Analysis of

Protein Synthesis ............................................................................................... 44
Figure 6 - Schematic Diagram of hrf-I Context in LdMNPV, vAchPS,

and vAchPD .................................................................................................... 59
Figure 7 - Northern Blot Analysis of hrf-I Transcription in LdMNPV-

and Recombinant AcMNPV-Infected Ld652Y Cells ....................................... 64
Figure 8 - Primer Extension Analysis of LdMNPV-, vAchPS-, and

vAchPD-Infected Ld652Y Cells .................................................................... 66
Figure 9 - Nuclease Protection Mapping of 3’-End of hrf-I Transcripts

in LdMNPV- and vAchPS-Infected Ld652Y Cells ........................................ 68
Figure 10 - RT-PCR Mapping of 3’-End of hrf-I Transcripts in

vAchPD-Infected Ld652Y Cells .................................................................. 70

Figure 11 - Sequence of hIf-I Upstream Region ............................................................... 72

Figure 12 - Western Blot Analysis of HRF-l Expression in Recombinant
AcMNPV-Infected Ld652Y Cells .................................................................. 74

Figure 13 - Western Blot Analysis of P35 Expression in AcMNPV-
Infected SF-21 and Ld652Y Cells .............................................................. 89

Figure 14 - Schematic Diagram Showing the Virueses Used in Apoptosis
and Protein Synthesis Assays .......................................................................... 91

Figure 15 - Agarose Gel Showing DNA Fragmentation in SF -21
and Ld652Y Cells ........................................................................................... 92

Figure 16 - Pulse Labeling Analysis of Protein Synthesis in Ld652Y Cells
Infected with Wt or Recombinant AcMNPVs ................................................ 94

Figure 17 - Pulse Labeling Analysis of Protein Synthesis in Ld652Y Cells
Infected with Wt or Recombinant AcMNPVs in the Presence
of Aphidicolin ................................................................................................. 97

Figure 18 - RT-PCR Analysis of hrf-I Transcription in vAp35/hrf-l-
or vAc/hrf-l-infected Ld652Y Cells in the Presence of
Aphidicolin ..................................................................................................... 99

Figure 19 - Diagram Showing a Model of Responses in Ld652Y Cells to
AcMNPV Infection ........................................................................................ 102

Figure 20 - Autoradiogram Showing In Vitro Translation Abilities of Lysates
from Mock- and AcMNPV-Infected Ld652Y Cells ..................................... 116

Figure 21 - Autoradiogram Showing In Vitro Translation Rescue Abilities
of Lysate Fractions and Total RNA .............................................................. 117

Figure 22 - Autoradiogram Showing In Vitro Translation Rescue Abilities
of tRNA ......................................................................................................... 119

Figure 23 - Autoradiogram Showing In VitroTranslation Assays of Lysate
from Mock- or AcMNPV-Infected BmN Cells ............................................ 122

INTRODUCTION

Baculoviruses are a large group of DNA-containing viruses that primarily infect
insects. In addition to being used for effective protein expression vectors, baculoviruses
have been used as biological insecticides in agriculture and forestry. The molecular
biology of host range determination of baculoviruses has been a subject of interest since
host range is an important issue in developing and improving baculoviruses as pest
control agents. Most baculoviruses have narrow host ranges. This property is considered
to be an advantage in terms of safety. However, it is a shortcoming in terms of efficacy
and economy since many baculoviruses have to be used in order to control a variety of
different pest insects. Thus the efficacy of biological insecticides can be greatly improved
if the host range of the baculoviruses can be expanded. On the other hand, host range has
to be in good control in order to protect beneficial insects, animals, and even human
beings. Understanding the molecular biology of virus-host interaction will give rise to
better understanding of the mechanisms for host range determination and thus will
improve both efficacy and safety of biological insecticides.

One particular baculovirus, Autographa calrfornica nucleopolyhedrovirus
(AcMNPV), provides an excellent model for the study of the mechanism of baculovirus
host range determination. AcMNPV has the potential to be a wide range insecticide since

it has a wider host range than most other baculoviruses with the ability to infect insect

2

larvae of at least 33 species in 10 families and at least 25 insect cell lines. In addition,
AcMNPV can infect many cell lines in a sernipermissive fashion. In these sernipermissive
cell lines, AcMNPV can enter the cells but virus infection is restricted at different stages.
One of these sernipermissive cell lines, Ld652Y derived from gypsy moth, displays a
novel virus-host interaction when infected with AcMNPV . In AcMNPV-infected
Ld652Y cells, viral and host mRNAs are transcribed, transported, and are of normal size.
However, both viral and host cellular protein synthesis is shut down at late times post
infection and no viral progeny are produced. Superinfection of AcMNPV-infected
Ld652Y cells with another baculovirus, Lymantria dispar nucleopolyhedrovirus
(LdMNPV), which normally replicates in Ld652Y cells results in production of
AcMNPV viral progeny, suggesting a helper function in LdMNPV that promotes
AcMNPV replication in the nonpermissive cell line Ld652Y. Identification of this helper
fimction gene(s) and the defect of protein synthesis will provide clues to the
understanding of the mechanisms of protein synthesis shut down and host range
determination.

AcMNPV contains a potent apoptotic suppressor gene p35 and apoptosis is
implicated in AcMNPV host range determination. p35 is not required for AcMNPV
replication in Trichoplusia ni cell line TN368. However, p35’AcMNPV induces
extensive apoptosis in Spodoptera frugiperda SF-21 cells and protein synthesis shut
down is reported in the apoptotic SF -21 cells. It is of interest to test the possible
connections between apoptosis and protein synthesis shut down in AcMNPV-infected
Ld652Y cells. Whether they are two separate responses or two phenotypes of a same

response will provide insight into the nature of this novel virus-host interaction.

3

In exploring this novel virus-host interaction, we identified and characterized a
single gene in LdMNPV, host range factor 1 (hrf-I) that promoted AcMNPV replication
in Ld652Y cells. Then I investigated the roles of AcMNPV P35 and LdMNPV HRF-l in
controlling apoptosis and protein synthesis shut down in AcMNPV-infected Ld652Y
cells and obtained evidence supporting the hypothesis that apoptosis and protein synthesis
shut down are separate responses of Ld652Y cells to AcMNPV infection. Finally, I
established cell-flee translation systems from insect cells and investigated the defect in
protein synthesis in AcMNPV-infected Ld652Y cells by a series of in vitro translation
assays. Our data suggested a defect in tRNA in protein synthesis in AcMNPV-infected
Ld652Y cells and a same mechanism of protein synthesis shut down shared in another
nonpermissive AcMNPV infection.

In this dissertation, chapter 1 is a literature review. Chapter 2 is a manuscript
published in Journal of Virology (1996, 70:2221-2229) titled “Identification of a
baculovirus gene that promotes Autographa californica nucleopolyhedrovirus
replication in a nonpermissive insect cell line”. Chapter 3 is a manuscript published in
Virology (1997, 227:420-430) titled “Characterization of host range factor 1 (hrf-I)
expression in Lymantrr’a dispar nucleopolyhedrovirus- and recombinant Autographa
calrfornica nucleopolyhedrovirus-infected IPLB-Ld652Y cells”. Chapter 4 is a
manuscript submitted to Journal of Virology for publication titled “Responses of insect
cells to baculovirus infection: protein synthesis shut down and apoptosis”. Chapter 5 is a
manuscript in preparation for publication titled “Investigation of the defect in protein

synthesis in Autographa califomica nucleopolyhedrovirus-infected Ld652Y cells”.

CHAPTER 1

Literature Review

The Biology of Baculoviruses

The Characteristics of Baculoviruses

Baculoviruses are one diverse group of viruses found only in arthropods, mainly
in insects. The family Baculoviridae is characterized by a rod-shaped, enveloped virion
(I-Iarrap, 1972b) containing a circular double-stranded DNA genome (Summers and
Anderson, 1972) ranging from 80- 200 kbp (Burgess, 1977). This family contains two
genera: Nucleopolyhedrovirus (NPV) and Granulovirus (GV) (Murphy et al., 1995).

Baculoviruses have a unique biphasic life cycle in which they produce two
structurally and functionally distinct forms of viral progeny (V olkman et al., 1976). One
is budded virus (BV) which is produced at early stage of infection when progeny
nucleocapsids migrate from the nucleus to the cytoplasm and bud through the plasma
membrane; the other is occluded virus (0V) which is produced at late stages when
progeny nucleocapsids are enveloped by a membrane generated in the nucleus (Braunagel
etal., 1996; Braunagel and Summers, 1994; Stoltz et al., 1973) and are embedded in a
crystalline protein matrix within the nucleus to form polyhedral inclusion bodies (PIBs).

Baculoviruses are named after the insects from which they are originally isolated.

For example, AcMNPV is isolated from alfalfa looper Autographa californica. BmNPV

5
is isolated from silkworm Bombyx’mori. LdMNPV is isolated from the gypsy moth

Lymantria dispar. Baculoviruses have been developed as biological insecticides for
agriculture and forestry (Bishop, 1989; Podgwaite, 1985; Wood and Granados, 1991). In
addition, baculoviruses especially AcMNPV have been developed into vectors for high
level expression of heterologous proteins in insect cells (Jarvis et al., 1996; Luckow and
Summers, 1988; Miller, 1988; O’Reilly etal., 1992).
In Vivo and In Vitro Infection

AcMNPV is the prototype virus for studying molecular biology of baculoviruses.
The biology of baculoviruses is usually represented by AcMNPV. The two forms of
progeny have different roles in infection (V olkman and Summers, 1977). In a typical
AcMNPV infection, insect larvae ingest PIBs as contaminants of their food. The
crystalline polyhedrin matrix is solubilized in the alkaline juice in the midgut of the
insects and the embedded virions (OV) are released (Harrap and Longworth, 1974). The
released virions enter midgut cells by; fusion with the membrane of the microvilli
(Granados and Williams, 1986; Wang et al., 1994). This primary infection in the midgut
cells results in production of BVs. The newly produced BVs are released from the cells
(Keddie et al., 1989) and enter the hemocoel where they are transported via the
hemolymph to other tissues in the insect. They can also infect the epithelial cells of
tracheoles, spreading the infection along the tracheal network (Engelhard et al., 1994;
Flipsen et al., 1995; Kirkpatrick, 1994). Thus 0V is responsible for establishing the
primary infection and BV spreads the infection to many other tissues within the insect.

Many cell lines have been established that support baculovirus replication (Hink,

1970; Hink, 1979; Hink and Hall, 1989). Infection in cell culture is mediated by budded

6

viruses and can be considered to occur in three basic phases: early, late and very late
(Blissard and Rohnnann, 1990; Friesen and Miller, 1986). BV enters the cells by
adsorptive endocytosis (Volkrnan, 1986; Volkrnan and Goldsmith, 1985). Nu‘cleocapsids
are released in the cytoplasm and migrate to the nucleus presumably through nuclear
pores (Granados and Williams, 1986). Infected cells undergo significant changes during
the early phase of infection from viral entry to 6 hours post infection (h p.i.).
Cytoskeleton rearranges, host chromatin enlarges and is dispersed within the nucleus
(Charlton and Volkrnan, 1991; Lanier et al., 1996; Volkman and Zaal, 1990). Following
the early phase is the late phase which extends from 6 h p.i. to approximately 20 to 24 h
p.i. Extensive viral DNA replication, late gene expression, and BV production take place
in the late phase. A distinct electron-dense structure known as the virogenic stroma forms
in the nucleus (Harrap, 1972c; Kelly, 1981) where the progeny nucleocapsids are formed
(Bassemir et al., 1983; Fraser, 1986). The newly assembled nucleocapsids leave the
nucleus, travel through the cytoplasm (Bassemir et al., 1983; Raghow and Grace, 1974)
and bud out through the plasma membrane modified by the viral major glycoprotein
GP64 (Blissard and Rohnnann, 1989; Blissard and Wenx, 1992; Oomens et al., 1995;
Volkman et al., 1984). During the budding process, the nucleocapsid becomes enveloped
by the modified membrane. Logarithmic production of BV occurs from approximately 12
to 20 h p.i. (Knudson and Harrap, 1976; Lee and Miller, 1979). In the mean time, the host
gene expression is shut off. A decline in the steady-state levels of host mRNAs begins
approximately 12 h p.i. (Ooi and Miller, 1988). Host protein synthesis declines from 18 h
p.i. and is completely shut off by 24 h p.i. (Carstens et al., 1979; Dobos and Cochran,

1980; Kelly and Lescott, 1981; Miller et al., 1983). The very late phase is occlusion-

7

specific phase and begins around 20 h p.i. Membrane envelope segments are generated
. within the nucleus during this occlusion process as revealed by electron microscopy
(Chung et al., 1980; Harrap, 1972c). The origin or mechanism of synthesis of these
membranes is not known (Braunagel et al., 1996; Braunagel and Summers, 1994; Hong et
al., 1994; Stoltz et al., 1973). Nucleocapsids interact with these membranes and
eventually become enveloped (Bassemir etal., 1983; Fraser, 1986). The enveloped
nucleocapsids are further occluded to form PIBs. As the PIBs accumulate, the nucleus
becomes virtually filled with occlusion bodies that can be seen under the optical
microscope.
Gene Organization and Function

AcMNPV consists of a genome of 134 kb that can potentially encode up to 154
genes (Ayres, et al., 1994). One notable feature of AcMNPV genome is the presence of 6
homologous regions (hr) (Cochran and Faulk, 1983; Guarino et al., 1986). These hrs
contain two to eight reiterations of an imperfect palindromic sequence containing an
EcoRI site at the center of each palindrome. The hrs act as enhancers for some early
promoters in transient expression assays (Guarino and Summers, 1986b; 1987; Nissen
and Friesen, 1989; Rasmussen et al., 1996) and origins for DNA replication (Kool et al.,
1993; Leisy etal., 1993; Pearson et al., 1992).

AcMNPV ORFs are usually very closely spaced along the genome. The
sequences between many ORFs are extremely A+T rich, which may be related to
promoter and transcriptional termination functions (Ayres et al., 1994). There seems to be
little or no clustering of functionally related genes, nor of genes belonging to the same

transcriptional class (Ayres etal., 1994; O’Reilly et al., 1992).

8

The sequence of entire AcMNPV genome is available and the functions of many
genes have been identified (Ayres et al., 1994; K001 and Vlak, 1993). Among those
important structural genes are polh, vp39, and gp64. polh is not essential for viral
replication in cell culture but is essential for OV formation (Smith et al., 1983a).
Polyhedrin is highly expressed late in infection and it is the most common locus for
insertion of foreign genes in the baculovirus expression system. Vp39 encodes the major
capsid protein which forms the basic shell of the rod-shaped nucleocapsid (Thiem and
Miller, 1989a). The major glycoprotein of BV is encoded by gp64 (also called gp6 7)
(Whitford et al., 1989). GP64 is exclusively found associated with the BV envelope and
is specifically involved in BV interaction with receptors or the cell surface. Antibodies
against GP64 block infectivity but not adsorption (V olkrnan et al., 1984; Volkman and
Glodsmith, 1985). Functional studies of GP64 show that it mediates membrane fusion in
a pH-dependent manner, which is essential during viral entry by endocytosis (Blissard
and Wenx, 1992; Monsma et al., 1996; Monsma and Blissard, 1995)

Important regulatory genes include ie-O, ie-I , ie-2 (also known as ie-n). ie-0 is
actually another form of ie-I which contains an extra upstream exon (Chishohn and
Henner, 1988). ie-I encodes a multifunctional regulatory protein transactivating both
some early and late gene expression in transient expression assays (Carson et al., 1988;
Carstens, 1993; Guarino and Summers, 1986a; 1987; Kovacs et al., 1991a; Lu et al.,
1996; Lu and Carstens, 1993; Monis et a1, 1994; Nissen and Friesen 1989). IE-2 is a
promiscuous transactivator and also regulates its own promoter in transient expression
assays (Y 00 and Guarino, 1994).

A set of 18 genes have been identified as late gene expression factors (Li et al.,

9
1993; Lu and Miller, 1995; Morris et al., 1994; Passarelli and Miller, 1993a; 1993b;

1993c; 1994; Passarelli et al., 1994; Todd et al., 1995). Among them, ie-I, ie-Z, lef-1-3,
Ief- 7, p143, p35, and dnapol are related to DNA replication. The remaining lefs, lef-4-11,
p47 and 39K, firnction either at the level of transcription or at that of mRNA stabilization.
lef-3 has been shown to bind single-stranded DNA (Hang et al., 1995). The predicted
sequence of lef-7 suggests that it is a homologue of herpes virus single-stranded DNA
binding protein (UL29) (Lu and Miller, 1995). dnapol and p143 encode polypeptides
with sequence motifs shared by DNA polymerases (T omalski et al., 1988) and DNA
helicases (Lu and Carstens, 1991), respectively. lef-8 (Passarelli et al., 1994) and lef-9
(Lu and Miller, 1994) encode proteins with motifs found within the two largest subunits
of prokaryotic and eukaryotic RNA polymerases. 39K gene product is a phosphoprotein
(pp31) associated with the virogenic stroma (Guarino et al., 1992). P35 suppresses
apoptosis in Spodopterafi-ugiperda cells and larvae (Clem et al., 1991; Clem and Miller
1993; Hershberger et al., 1992) as well as in cells and larvae of other organisms
(Rabizadeh et al., 1993; Sugimoto et al., 1994). In addition to these 18 lefs, a gene,
termed very late factor 1 (vlf-I ), is required for very late but not late gene expression. vlf-
1 encodes a polypeptide with sequence motif characteristic of a family of
integrase/resolvases (McLachlin and Miller, 1994).

Some genes appear to be nonessential as judged by the ability of knock-out
mutant viruses to replicate in both cell culture and in insects. These nonessential genes
may provide some advantage for growth or survival of the virus under specific
conditions. For example, the product of the nonessential gene ecdysteroid UDP-

glucosyltransferase (egt) is secreted from the cell and transfers the sugar moiety from

10

UDP-sugar to ecdysone, the hormone governing insect molting. This will block the
molting of the infected insect host and thus promote viral progeny production (O’Reilly
and Miller, 1989).
Gene Expression in Cell Culture

AcMNPV gene expression appears to be primarily controlled at the level of
transcription and transcription is coordinately regulated (Erlanderson et al., 1985; Gordon
and Carstens, 1984; Rice and Miller, 1986). Transcription of early genes is achieved by
cellular RNA polymerase H before the onset of viral DNA replication (Glocker et al.,
1993; Grula et al., 1981; Hoopes and Rohrmann, 1991; Huh and Weaver, 1990). Early
gene transcription is activated by two other early gene products IE-l and IE-2 (Guarino
and Summers, 1987; Kovacs etal., 1991; Lu and Carstens, 1993; Morris et al., 1994;
Nissen and Friesen, 1989; Passarelli and Miller, 1993; Ribeiro, et al., 1994). The .
transition between the early and late phases of gene expression is marked by a switch
from host RNA polymerase H to a novel alpha-amanitin—resistant RNA polymerase
activity (Grula et al., 1981; Huh and Weaver, 1990). This novel polymerase is believed to
be encoded or modified by the virus (Beniya et al., 1996; Fuchs et al., 1983; Yang et al.,
1991). Activation of late and very late genes requires early gene products and depends on
the onset of viral DNA replication (Erlandson et al., 1985; Rice and Miller, 1986). These
transcripts initiate from a characteristic T AAG motif (Howard et al., 1986; Rohnnann,
1986; Thiem and Miller, 1989b; Wilson et al., 1987).

Most viral genes are transcribed primarily during one phase, however, some genes
are transcribed in two or possibly three phases. These genes such as 39K, p35, and 964

contain both early and late promoters (Guarino and Smith, 1990; Guarino and Summers,

ll
1986a; Nissen and Friesen, 1989; Whitford et al., 1989). Baculovirus mRNAs are capped

(Jun-Chuan and Weaver, 1982) and most appear to be polyadenylated (F riesen and
Miller, 1986; Lubbert and Doerfler, 1984; Rohel and Faulkner, 1984). Multiple
overlapping transcripts with coterminal 5’- or 3’-ends are a characteristic feature in
baculovirus gene transcription (F riesen and Miller, 1985; 1986; Lubbert and Doerfler,
1984 a, b; Oellig et al., 1987; Rankin et al., 1986). Bicistronic and multicistronic
transcripts are also observed (Oellig et al., 1987; Passarelli and Miller, 1994; Thiem and
Miller, 1989a). 3

Another striking characteristic of baculovirus gene expression is the lack of RNA
splicing. The only RNA splicing event is the transcription of ie-0 and ie-I in which the
upstream ie-0 exon is fused to the ie-I open reading frame. This produces protein IE-O
which has a sequence identical to IE-l except for additional 57 amino acids at its N
terminus (Chishohn and Henner, 1988).

Virus-Host Interaction

Host Range Determination

Host range determination has been a subject of interest in the study of molecular
biology of baculoviruses since it plays a critical role in the development and
improvement of baculoviruses as effective, economic, and safe biological pesticides.
Baculoviruses generally have narrow host specificity. Individual isolates normally infect
only closely related species. AcMNPV has a relatively wider host range than most other
baculoviruses. AcMNPV reportedly can infect at least 33 species of insect larvae in 10
families (Groner, 1986) as well as more than 25 insect cell lines (Hink, 1979; Hink and

Hall, 1989). In addition, it can infect at least 26 insect cell lines in a sernipermissive

12

fashion (Possee et al., 1993). Host range determination involves virus-host interaction.
Major steps in the AcMNPV replication cycle which may be relevant to host specificity
include entry of the virus into the cell, virus early gene expression, DNA replication,
virus late gene expression, budded virus formation and release, very late gene expression
and PIB formation. AcMNPV can enter most insect cells and express genes under the
control of insect or early viral promoters but expression from late and very late promoters
is increasingly inefficient (Carbonell et al., 1985; Morris and Miller, 1992; 1993). Thus,
the ability of AcMNPV to infect nonpermissive insect cells is not restricted at the step of
viral entry to the cells but is probably limited by factors which influence viral DNA
replication and/or late gene expression (Morris and Miller, 1993).

A total of 5 genes have been identified that influence the ability of AcMNPV to
replicate in specific host cells. Among the 18 lefs that collectively transactivate
expression from a plasmid containing a reporter gene under late viral promoter control in
SF -21 cells (Lu and Miller, 1995; Todd et al., 1995), three of them, ie-2, lef- 7, and p35
are not required in TN368 cells (Chen and Thiem, 1997; Lu and Miller, 1995). In
contrast, another AcMNPV gene, host cell-specific factor 1 (hcf-I) is involved in
transactivation of late reporter plasmid in TN368 cells but not in SF-21 cells (Lu and
Miller, 1995).

lef-7 affects AcMNPV replication in a cell-specific fashion (Chen and Thiem,
1997; Lu and Miller, 1995). lef-7 is solely responsible for the phenotypes of two mutant
AcMNPVs which display much decreased progeny virus production in infected SF—21
cells and SElc cells derived from Spodoptera exigua (Gelemter and Federici, 1986) but

production of the mutant viral progeny on TN368 cells is not affected (Chen and Thiem,

13
1997). It has been shown that lef-7 stimulates DNA synthesis and the mutant phenotypes

result from an inability of the virus to efficiently replicate its DNA in SF-21 and SElc
cells (Chen and Thiem, 1997). lef-7 encodes a polypeptide with homology to single
stranded DNA binding protein (Lu and Miller, 1995) but this function has not been
confirmed. The transcriptional activator ie-2 also stimulates DNA replication (Lu and
Miller, 1995) and it is very likely that ie-2 exerts on AcMNPV the differential host
specificity between TN368 and SF-21 cells in a similar way to that of Ief- 7.

The p35 gene is required to inhibit apoptosis during AcMNPV infection in S.
fiugiperda cells (Clem et al., 1991; Clem et al., 1994; Clem and Miller, 1993;
Hershberger et al., 1992). In contrast, p35 is not required for successful AcMNPV
infection of Trichoplusi nr‘ cells either in culture or in larvae (Clem and Miller, 1993;
Hershberger et al., 1992). Thus the ability of AcMNPV to block an apoptotic response of
its host can effectively expand its host range and the presence of functional p35 can be
considered a host range-determining event during AcMNPV replication.

hcf-I affects AcMNPV replication in both cell line-specific and species-specific
fashion (Lu and Miller, 1996). hcf-I’ AcMNPV replicates normally in SF—21 cells and
exhibits normal infectivity and virulence in S. frugiperda larvae (Lu and Miller, 1996). In
contrast, replication of hcf-I' AcMNPV in TN368 cells was severely defective and the
virulence in T. ni. larvae is much decreased (Lu and Miller, 1996). An arrest of protein

synthesis is observed by318 h p.i. in hcf-I’ AcMNPV-infected TN368 cells together with
a defect in DNA replication and late gene transcription (Lu and Miller, 1996). 11ch is
predicted to encode a very cysteine-rich polypeptide with several motifs suggestive of

metal ion binding but no extensive homologies to other genes are found (Lu and Miller,

14
1995)

The putative baculovirus DNA helicase gene, p143 (Lu and Carstens, 1991), has
also been implicated in baculovirus host range determination (Croizier et al., 1993;
Maeda et al., 1993). AcMNPV is not able to replicate in BmN cells derived from Bombyx
mori. In AcMNPV-infected BmN cells, accompanying an atypical cytopathic effect,
protein synthesis is dramatically attenuated by 5 h p.i. in the presence of apparently
normal mRNAs (Kamita and Maeda, 1993). This inhibition is shown to be induced by the
putative helicase gene p143 of AcMNPV and precluded by the homologous helicase gene
in BmNPV (Croizier et al., 1993; Kamita and Maeda, 1993; Maeda et al., 1993).
Recombinants containing a 572 bp segment of pl 43 from BmNPV in place of the
homologous region of the AcMNPV p143 are able to replicate in BmN cells (Croizier et
al., 1993; Maeda et al., 1993). How this segment assists AcMNPV replication in the BmN
cells is not known.

Another host range determinant is implied in LdMNPV that is able to expand
AcMNPV host range to nonpermissive cell lines Ld652Y and LdF B both derived from L.
dispar (McClintock and Dougherty, 1987). AcMNPV replication in Ld652Y and LdFB
cells is blocked at late phase of infection (McClintock et al., 1986; Guzo et al., 1992). In
AcMNPV-infected Ld652Y and LdFB cells, virus can enter the cells, viral DNA is
replicated, both viral and host cellular mRNA are transcribed, translated, and of normal
size (Guzo et al., 1992; Morris and Miller, 1992; 1993). However, both viral and host
translation is shut down at late times p.i. and no viral progeny is produced (Guzo et al.,
1992; McClintock et al., 1986). Superinfection of AcMNPV-infected Ld652Y cells with

LdMNPV results in production of AcMNPV progeny (Du and Thiem, unpublished data;

15
McClintock and Dougherty, 1987) suggesting a helper function in LdMNPV to AcMNPV

replication in the nonpermissive 1x1652Y cells.

The ability of virus to replicate in a host cell depends on the interaction of virus
and the host. Virus must compete with their host cell for macromolecular machinery at
many levels subsequent to infection. Many viruses establish conditions within the
infected cell that enable them to dominate various components of the cellular machinery
(Hershey, 1991). The infected cell, for its part, can respond to virus infection by
implementing defensive strategies designed to inhibit viral replication, and on the other
hand, viruses have, in turn, evolved functions that frustrated the cellular defenses
(Hershey, 1991; Schneider and Shenk, 1987).

The nonpermissive AcMNPV infections have demonstrated two major types of
virus-host interactions. The ability of cells to undergo apoptotic cell death in response to
viral infection constitutes a significant host defense mechanism. Protein synthesis shut
down may represent a second host defense mechanism in insect cells against baculovirus
infection. Much progress on the study of baculovirus-induced apoptosis has been made
such as effects of apoptosis on viral replication (Clem and Miller, 1993; Hershberger et
al., 1992), factors involved in the induction and control of apoptosis (Clem and Miller,
1994; LaCount and Friesen, 1997; Prikhod’ko and Miller. 1996), and the function of P35
in the apoptosis signal transduction pathway (Bertin et al., 1996; Bump et al., 1995;
Hershberger et al., 1994; Xue and Horvitz, 1995). However, little is known about the

mechanism of protein synthesis shut down.

1 6
Apoptosis

Apoptosis is programmed cell death, a process by which a cell commits suicide in
an orderly fashion. Apoptosis is involved in a wide variety of normal and abnormal
organismal processes, including tissue homeostasis, immune system function, embryonic
development, cancer, and pathogenesis. The characteristic phenotype includes extensive
blebbing of the cell surface, nucleus condensation and fragmentation, degradation of
cellular DNA into oligonucleosome-sized fragments, disintegration of affected cells into
small membrane-bound vesicles (apoptotic bodies), and premature cell death (Hale et al.,
1996)

Research on apoptosis in mammalian cells and developmental programmed cell
death in Caenorhabditis elegans have led to identification of several important genes
involved in the apoptosis pathway (Hale et al., 1996). Genes that encode the interleukin—
IB converting enzyme (ICE) family of cysteine proteases (caspase) have a central role in
triggering apoptosis. Activation of the caspase in turn activates a series of enzymes that
rapidly kill the cell. The caspase induced apoptosis is inhibited by the products of human
gene bcl-Z (Hockenbery et al., 1990; Tsujimoto and Croce, 1986), its relative bcl-x (Boise
et al., 1993), and its homologue in C. elegans ced-9 (Hengartner et al., 1992; Hengartner
and Horvitz, 1994).

The role of p35 in blocking apoptosis was discovered during the characterization
of a spontaneous mutant of the baculovirus AcMNPV, which triggers but does not block
apoptosis in the cell line SF-21 (Clem et al., 1991). p35‘AcMNPV also induces apoptosis

in BmN cells (Clem et al., 1991) and a functional p35 homologue is present in the

17
BmNPV (Kamita et al., 1993), a close relative of AcMNPV. AcMNPV p35 encodes a

stoichiometric inhibitor of caspase (Bump et al., 1995; Xue and Horvitz, 1995). P35
prevents the autoproteolytic activation of caspase from its precursor form and thus blocks
caspase—induced apoptosis (Bump et al., 1995; Xue and Horvitz, 1995).

A second baculovirus gene, inhibitor of apoptosis (iap), was identified to prevent
apoptosis by its ability to functionally replace p35 in a genetic complementation assay
(Birnbaum et al., 1994; Crook et al., 1993). Homologues of iap have been found in Cydia
pomonella granulovirus (CpGV) (Cp-iap), Orgyia pseudotsugata MNPV (OpMPNV)
(OP-iap), and AcMNPV (Ac-iap). The Ac-iap gene was identified only by its homology
to the other two iaps but it is not firntional. All three iap homologues encode a C3HC4
zinc finger as well as two additional Cys/His motifs (baculovirus iap repeats) (Birnbaum
et al., 1994; Crook et al., 1993) and thus iap may control apoptosis directly at the
transcriptional level. Cellular homologues of iaps with antiapoptotic activities were
discovered recently(Clem et al., 1996; Hay et al., 1994; Liston et al., 1996; Rothe et
al., 1995). This may suggest that the gene products of iaps are normal components of the
cellular apoptotic pathway that have been acquired by baculoviruses to block cellular
apoptosis during infection.

Many viruses carry genes involved in blocking cellular apoptosis (Teodoro and
Branton, 1997). The adenovirus BIB-19K gene prevents apoptosis induced by ElA
through a p53-dependent mechanism (Debbas and White, 1993; Lowe and Ruley, 1993;
Rao et al., 1992). E1B-19K also protects cells against apoptosis stimulated by tumor
necrosis factor alpha or anti-Fas antibodies (Gooding et al., 1991; Hashimoto et al., 1991;

White et al., 1992). Epstein-Barr virus carries two genes that are involved in protecting

1 8
cells from apoptosis: LMP-l is expressed during viral latency and may act by inducing

cellular bcl-2 expression (Henderson etal., 1991; Martin et al., 1993) and BHRF-1 is
expressed during the lytic cycle and shares homology with Bel-2 (Henderson et al.,
1993). African swine fever virus also encodes a protein LMWS-HL containing sequences
homologous to Bel-2 that prevents apoptosis (Neilan et al., 1993). Poxvirus encodes a
serine protease inhibitor CrmA which specifically inhibits caspase activity and prevents
or delays apoptosis (Tewari et al., 1995; Tewari and Dixit, 1995).

P35 can firnction in a phylogenetically broad range of organisms to block
apoptosis induced by a variety of signals including mammalian cells (Beidler et al., 1995;
Martinou et al., 1995, Rabizadeh et al., 1993; Zhong et al., 1993), Drosophila (Hay et al.,
1994), and C. elegans (Sugimoto et al., 1994). Thus, the pathway or the points at which
both P35 and Bcl-2 act is conserved between invertebrates and vertebrates (Hengartner
and Horvitz, 1994; Rabizadeh et al., 1993; Vaux et al., 1992). However, p35 bears no
obvious sequence similarity to other proteins required for apoptotic suppression, I
including the mammalian proto-oncogene bcl-Z, adenovirus BIB-19K, Epstein-Barr virus
BHRF 1, Poxvirus CrmA, or baculovirus iap gene (Cleary et al., 1986; Crook et al., 1993;
Pearson et al., 1987; White et al., 1992).

The molecular mechanisms by which baculoviruses induce apoptosis are not
known. Transfection of SF-21 cells with the AcMNPV ie-I gene is sufficient to induce
apoptosis (Prikhod’ko and Miller, 1996). However, ie-I is not the sole factor that induces
apoptosis in SF -21 cells since aphidicolin, a DNA replication inhibitor, which blocks
viral DNA replication and DNA replication dependent late gene expression but not ie-I

expression prevents induction of apoptosis by IE-l (Clem and Miller, 1994; Prikhod'ko

19
and Miller, 1996). This indicates that a late event is needed for the induction of apoptosis.

Other studies using DNA replication deficient temperature mutants revealed that DNA
replication or late gene expression is not essential for induction of apoptosis but is
essential for firll development of apoptosis (LaCount and F riesen, 1997). Studies using
RNA transcription inhibitors seem to support the hypothesis that viral trigger of
apoptosis in these cells is related to the shutoff of host RNA synthesis since actinomycin
D, DRB, and or-amanitin are all inhibitors of RNA synthesis with different modes and all
three drugs induce rapid and wide-spread apoptosis in SF-21 cells (Clem and Miller,
1994)
Protein Synthesis Shut Down

Protein synthesis shut down is a common strategy employed by many host cells
against viral infection and viruses in turn have evolved methods to overcome this cellular
defense (Hershey, 1991; Schneider and Shenk, 1987). In mammals, vaccinia virus is not
able to replicate in CHO cells although mRNA is synthesized. Both viral and cellular
protein synthesis is shut down at the stage of intermediate viral proteins. A gene from
cowpox virus, CHO hr, can overcome the protein synthesis shutoff (Ramsey-Ewing and
Moss, 1995; Spehner et al., 1988). In herpes simplex virus 1 (HSV-l), protein synthesis is

shut down after the expression of or genes in neuronal cells infected with a y134.5 minus
mutant HSV-l but not wt HSV-l (Chou and Roizrnan. 1992; 1994). 7134.5 gene of HSV-

1 is able to preclude the protein synthesis inhibition in HSV-l—infected neuronal cells

(Chou and Roizman, 1992; 1994). The carboxyl-terminal domain of 7134.5 is

homologous to the corresponding domain of MyDI I 6, a gene expressed in myeloid

20
leukemia cells induced to differentiate by interleukin 6 (Lord et al., 1990; McGeoch and

Barnett, 1991), and growth arrest and DNA damage gene 34 (GADD34), a gene induced
by growth arrest and DNA damage (F omace et al., 1989). The carboxyl terminus of the

Murine MyDI 16 gene can substitute for 7134.5 gene to preclude the protein synthesis

shutoff (He et al., 1996). Plants activate enzymes in response to virus infection that
depurinate 28S RNA thereby inactivating the ribosome and thus inhibiting protein
synthesis (Endo and Ysurugi, 1987). In prokaryotes, protein synthesis shut down is

observed in some phage exclusions which involve Cleavage of the components of the

translation apparatus, EF-Tu (Y u and Snyder, 1994) or tRNAlYS (Levitz et al., 1990).
The best understood mechanisms of protein synthesis shut down are those
mediated by interferon in mammals and other vertebrates (Lengyel, 1982; Samuel, 1991).

Interferons are a class of small molecular weight proteins synthesized and secreted in
some cell types in mammals and other vertebrates in response to viruses, as'well as other
stimuli (Lengyel, 1982). Interferon-mediated protein synthesis shut down includes three
different pathways (Farrel et al., 1978; Zilberstein et al., 1978). One pathway is mediated
by a dsRNA dependent protein kinase PKR that phosphorylates eukaryotic initiation
factor 2 or subunit (elZF-Za) and thus inhibiting translation initiation (Chemajovsky et al.,
1979). This is the most common pathway and awide variety of different viruses have
developed effective and varied measures to prevent the function of PKR (Samuel, 1991).
Adenovirus and HIV-1 produce an RNA, VA RNA (adenovirus) and TAR RNA (HIV -
l), which antagonizes the activation of the PKR (Gunnery et al., 1990; Kitajewski et al.,

1986; O’Malley et al., 1986). Reovirus produces 0-3 protein (Imani and Jacobs, 1988)

21
that bind the activator dsRNA and prevent the activation of PKR. Poxvirus produces two

proteins, K3L and E3L, to counteract the effects of PKR. The K3L product is a
homologue of the a-subunit of eIF-2 and E3L is a dsRNA binding protein. K3L binds to
the PKR (Carroll et al., 1993) and E3L binds to the dsRNA activator (Chang et 1a., 1992;
Yuwen et al., 1993) and prevent activation of PKR. The second translational inhibitory
pathway is mediated through synthesis of 2’-5’ pppApApA (Kerr and Brown, 1977) by
the dsRNA/ATP-dependent oligoisoadenylate synthetase E, another interferon-induced
enzyme (Farrel et al., 1978; Hovanessian et al., 1977; Zilberstein et al., 1978) which
activates RNase L that degrades mRNAs. The third pathway is mediated by a 2’-
5’phosphodiesterase (Schmidt et al., 1978). This enzyme degrades the CCA terminus of
tRNA, thereby blocking protein synthesis elongation due to tRNA deficiency (Schmidt et
al., 1978) which can be reversed by adding tRNA in the cell-free system (Content et al.,
1975; Falcoff et al., 1978; Mayr et al., 1977; Samuel, 1976; Sen et al., 1975;
Weissenbach et al., 1977; Zilberstein et al., 1976).

Investigation of protein synthesis shut down in baculovirus-infected insect cells
has just initiated. The possible function of pl 43 is predicted by its homology in sequence
to helicase gene but its actual role in this virus-host interaction remains unclear. Limited
work has been reported regarding the factor(s) that triggers the protein synthesis shut
down in AcMNPV-infected Ld652Y and LdFB cells (Guzo et al., 1991). A factor
designated as macromolecular synthesis inhibition factor (MSIF) is found to be produced
and secreted from the infected cells in the absence of viral gene activity (Guzo et al.,

1991). It is postulated that the MSIF is the AcMNPV GP64 glycoprotein or some

22
component or complex of this protein (Guzo et al., 1991). However, this hypothesis has

not been confirmed and further research on this issue has not been continued. It is the
objective of this research project to gain understanding of the nature of this novel virus-

host interaction.

CHAPTER 2

Identification of a Baculovirus Gene That Promotes Autographa calrfornica
N ucleopolyhedrovirus Replication in a N onpermissive Insect Cell Line

Suzanne M. Thiem1:2a3:4, Xianlin Du2, Martha E. Quentin1,4, and Michelle M. Bemer2
Department of Entomology 1 and Microbiology 2, Program in Genetics3, and Pesticide
Research Center4

Michigan State University
East Lansing, Michigan 48824-1115

This work has been published in J. Virol., 1996, 70:2221-2229.

23

24
Abstract

A gene was identified in Lymantria dispar nucleopolyhedrovirus (LdMNPV) that
promotes Autographa califomica nucleopolyhedrovirus (AcMNPV) replication in IPLB-
Ld652Y cells, a cell line that is non-permissive for AcMNPV. Co-transfection of
AcMNPV DNA and a plasmid comprising the LdMNPV gene into IPLB-Ld652Y cells
results in AcMNPV replication. The gene maps between 43.3-43.8 m.u. on the 162 kbp
genome of LdMNPV. It comprises a 218 amino acid open reading frame and encodes a
polypeptide with a predicted molecular weight of 25.7 kDa. The predicted polypeptide is
glutarnic acid and valine rich and negatively charged, with a pI of 4.61. No protein
sequence motifs were identified and no matches with known nucleotide or peptide
sequences were found in the AcMNPV genome or database searches that suggest how
this gene might function. A recombinant AcMNPV bearing the LdMNPV gene
overcomes a block in protein synthesis observed in AcMNPV-infected IPLB-Ld652Y
cells. Using Southern blotting techniques, we were unable to identify a homologue in
Orgyia pseudotsugata nucleopolyhedrovirus, a baculovirus that is routinely propagated in
IPLB-Ld652Y cells. This suggests that the LdMNPV host range gene is unique among
baculoviruses studied to date. We named this gene hrf-I (for host range factor 1).

Introduction

Baculoviruses are large double stranded DNA viruses that infect arthropods and
are of interest for use as viral insecticides against Lepidopteran larvae and as eukaryotic
gene expression vectors. While understanding of baculovirus genetics and molecular
biology has advanced rapidly in recent years (Blissard and Rohrmann, 1990; O'Reilly et

al., 1992; Rohrmann, 1992), mechanisms that control baculovirus host specificity are

25

poorly understood. Understanding these mechanisms is important for assessing potential
risks of genetically engineered baculovirus insecticides and for tailoring baculovirus
insecticides against specific pest insects. Studies of baculoviruses bearing reporter genes
demonstrate that although these viruses do not replicate in non-permissive insect cells,
they are able to enter and express some genes (Carbonell et al., 1985; Morris and Miller,
1992). Thus the block in virus infectivity in non-permissive insect cells occurs
subsequent to viral entry, uncoating, and early gene expression.

A few baculovirus genes that affect viral host range have been identified. Two
virus encoded proteins, P35 and inhibitor of apoptosis (IAP), prevent apoptosis,
programmed cell death, in baculovirus-infected cells (Clem et al., 1991; Crook et a1.
1993). The deletion of the p35 gene from Autographa caliform'ca nucleopolyhedrovirus
(AcMNPV) results in premature cell death in infected SF -21 and BmN cells but does
not impair virus replication in TN368 cells (Clem et al., 1991) or Trichoplusia ni larvae
(Clem and Miller, 1993). p35 is required for efficient AcMNPV replication in both SF-21
cells (Clem et al., 1991; Hershberger et al., 1992) and in Spodopterafi'ugiperda larvae
(Clem and Miller, 1993). IAP can functionally substitute for P35 in SF-21 cells
(Birnbaum et al., 1994; Crook et al., 1993). p143, a baculovirus encoded protein with
homology to DNA helicases (Lu and Carstens, 1991), also affects host range. Viruses
with expanded host ranges result from recombination between a small region of the DNA
helicase genes of Bombyx mori nucleopolyhedrovirus (BmNPV) and AcMNPV (Croizier
et al., 1994; Maeda et al., 1993). These viruses replicate in both S. frugiperda and B. mori
cell lines. The mechanism by which this region of the DNA helicase expands the virus

host range is unknown. A suite of eighteen late expression factors (lefs) are required for

26
expression of late AcMNPV genes in SF -21 cells (Lu and Miller, 1995; Todd et al.,

1995). p35 and p143 are among these lefir. Different lefs may be required for virus
replication in different cell types, thus afi‘ecting virus host range. For example, lef-7 is
not required for AcMNPV replication in TN—368 cells (Lu and Miller, 1995). A new lef
gene, host cell-specific factor-1 (hcf-I) corresponding to AcMNPV ORF7O (Ayres et al.,
1994) was identified that is required for late gene expression in TN-368 cells (Lu and
Miller, 1995).

Baculoviruses are generally quite host-specific. Infection by most is limited to a
single species or few closely related species of insects (Groner, 1986). AcMNPV has a
broader host range than many baculoviruses both in vivo and in vitro, reportedly infecting
at least 33 species of Lepidopteran larvae in 10 families (Groner, 1986) as well as over
25 different insect cell lines (Hink, 1979; Hink and Hall, 1989). Although AcMNPV does
not infect gypsy moth, Lymantria dispar (L. dispar), larvae some L. dispar cell lines have
been established that will support AcMNPV replication (Goodwin et al., 1978; Lynn et ‘
al., 1988). However, the cell line IPLB-Ld652Y (subsequently abbreviated Ld652Y)
(Goodwin et al., 1978) that is routinely used to propagate the nucleopolyhedroviruses of
Lymantria dispar (LdMNPV) and Orgyia pseudotsugata (OpMNPV), does not support
AcMNPV replication. The Ld652Y cell line has been described as semi-permissive for
AcMNPV replication because of an observed cytopathic effect and the production of
several infected-cell-specific proteins, but no production of infectious virions
(McClintock et al., 1986). Infection of Ld652Y cells with AcMNPV results in shut off of
both viral and cellular protein synthesis between sixteen and twenty hours post infection

(Guzo et al., 1992). However, viral DNA is replicated and viral mRNA from all temporal

27
classes can be isolated from AcMNPV-infected Ld652Y cells (Guzo et al., 1992; Morris

and Miller, 1992; 1993). The amounts of viral DNA isolated fiom AcMNPV-infected
Ld652Y cells at 24 and 36 h post infection (p.i.) are similar to amounts isolated fi'om
AcMNPV-infected SF -21 cells (Morris and Miller, 1993). Dot blot analysis of virus DNA
in AcMNPV-infected Ld652Y cells over time suggests that AcMNPV DNA synthesis
ceases between 20 and 36 h p.i. (McClintock et al., 1986). The amount of viral mRNA
isolated from AcMNPV-infected Ld652Y at different times, up to 72 h p.i., is the same or
greater than levels of AcMNPV mRNA isolated from infected TN-368 cells at identical
times p.i. (Guzo et al., 1992). Reports of AcNfl\lPV replication in AcMNPV-infected
Ld652Y cells superinfected with LMPV (McClintock and Dougherty, 1987) suggested
that LdMNPV could provide a factor necessary for AcMNPV replication in Ld652Y
cells. Identification and characterization of this factor is important for understanding the
nature of the block for AcMNPV replication in Ld652Y cells.

In preliminary experiments, we determined that co-transfection of AcMNPV and
LdMNPV DNA into SF-21 cells resulted in generation of chimeric viruses, comprised of
LdMNPV DNA integrated into the AcMNPV genome that could replicate in Ld652Y
cells. In this study we have used a transfection assay to functionally map the LdMNPV
gene that encodes the factor required for AcMNPV replication in Ld652Y cells. Here we
report the physical map location and sequence of the LdMNPV host range gene.

Materials and Methods
Virus and Cell Lines
Spodopterafiugiperda, IPLB-SF-21 (Vaughn et 1a., 1977), and Lymantria dispar,

IPLB-Ld652Y cells (Goodwin et al., 1978) were maintained in TClOO medium (Life

28
Technologies, Grand Island, NY) supplemented with 10% fetal bovine serum and 0.26%

tryptose broth. The gypsy moth cell line, IPLB-Ld652Y, was provided by D. Lynn,
iUSDA—ARS, Beltsville, MD and subsequently adapted for growth in TC100 medium.
Viruses used in this study were AcMNPV variant L1 (Lee and Miller, 197 8), LdMNPV
isolate A21-MPV (Slavicek et al., 1992), and OpMNPV provided by G.W. Blissard,
Boyce Thompson Institute at Comell University, Ithaca, NY. AcMNPV and LdMNPV
were propagated in T richoplusia ni larvae and SF-21 cells or Lymantria dispar larvae and
Ld652Y cells respectively. OpMNPV was propagated in Ld652Y cells.
DNA Isolation

Cosrrrid and plasmid DNA were prepared using the method of Clewell and
Helinski (Clewell and Helinski, 1969) and purified through CsCl gradients or with the
Wizard miniprep kit (Promega, Madison, WI) following the manufacturer's instructions.
For transfection assays, viral DNA was purified from larval occluded viruses following

dissolution with 0.1M NaCO3. DNA from virus plaque isolates was prepared from

budded virus using a miniprep procedure (O'Reilly et al., 1992).
Cotransfection Assays

Ld652Y cells were co-transfected with AcMNPV DNA and either intact

LdMNPV DNA or cloned fi'agments of LdMNPV DNA. Cells were seeded 4.5 x 105
cells per 35 mm plate. Cell monolayers were washed 2X with serum-free TC100 medium
and overlaid with a final volume of 1.5 ml serum-free TC100 medium. Transfections
were by the lipofectin technique (F legner et al., 1987) using lipofectin fiom BRL—Life

Technologies (Bethesda, MD) and 2.5 ug AcMNPV viral DNA and 2.5 pg each

29
LdMNPV viral DNA, cosmid or plasmid clone. DNAs were suspended in final volume of

50 ul of sterile Milli-Q H20 then mixed with 50 pl of lipofectin. The DNA-lipofectin

suspension was added dropwise to the cell monolayers and mixed by gentle swirling.
Following 2 h incubation at 27°C the lipofectin solution was removed fi'om the cells and
replaced with TC100 medium supplemented with 10% fetal bovine serum (Life
Technologies, Grand Island, NY). Cloned LdMNPV DNA comprised a cosmid library of
overlapping LdMNPV genomic fragments from isolate A21-MPV (Slavicek et al., in
press), cloned into the Supercos vector (Stratagene, Inc., Palo Alto, CA), provided by J.
M. Slavicek, US. Forest Service, Delaware, OH. Subclones of cosmid C77 were
constructed in Bluescript plasmids (Stratagene, Inc., Palo Alto, CA) using standard
protocols (Sambrook et al., 1989). The presence of a fimctional host range gene was
scored by the observation of polyhedra in transfected Ld652Y cells and by the presence
of infectious budded virus in the cell supernatant. Polyhedra in transfected cells were
observed using a Nikon TMS inverted miCroscope at 200 X magnification. The presence
of budded virus was scored by the ability of AcMNPV and co-transfection supematants
to infect SF-21 cells and LdMNPV transfections to infect Ld652Y cells.
Sequencing

A series of overlapping clones were generated by a combination of subcloning
restriction fragments into Bluescript plasmids and by the generation of nested deletion
clones using exonuclease HI (l-Ienikoff, 1984) and mungbean nuclease. The clones were
sequenced by dideoxynucleotide chain termination (Sanger et al., 197 7) using the

Circumvent sequencing kit (New England Biolabs, Beverly, MA) following the

30

manufacturer instructions. Specific sequencing primers were designed and synthesized
(Michigan State University, Macromolecular Structure, Sequencing and Synthesis
Facility) to sequence regions we were unable to obtain in both directions by sequencing
the various subclones. Both strands were completely sequenced. Sequence data was
compiled and analyzed using the Genetics Computer Group (GCG) Sequence Analysis
Programs (Devereux et al., 1984). GenBank 91.0, EMBL 44.0, and SWISS-PROT 31.0
databases were searched for sequence homology.
Construction of Recombinant AcMNPV

A recombinant AcMNPV, vAchPS, was constructed by first inserting a 2093 bp
PstI-SstI (43.3-44.6 m.u.) LdMNPV DNA fragment into the polylinker site of transfer
vector pSynXIV VI+ (Wang et al., 1991) to generate the plasmid, pSynLdPS. The
recipient virus was vSynVI'gal, a recombinant AcMNPV in which the polyhedrin gene
has been replaced with the lacZ gene resulting in an occlusion negative virus that forms
blue plaques in the presence of X-gal (Wang et al., 1991). vSynVI'gal DNA was
linearized by cleavage at a unique Bsu36I site within lacZ. pSynLdPS and linearized
vSynVI'gal DNA were co-transfected into SF -21 cells using lipofectin (F legner et al.,
1987; O'Reilly et al., 1992). White occlusion positive viruses were selected and plaque
A purified. Correct insertion of the LdMNPV fragment was confirmed by analysis of DNA
restriction patterns of the recombinant virus.
Western Blot Analysis

SF—21 cells and Ld652Y cells were infected with wt AcMNPV or vAchPS at an

MOI of 10. Virus infected cells were harvested at 0, 6, 12, 18, 24 and 48 h p.i. Time zero

31

was defined as the time when the inoculum was removed and incubation at 27°C was
initiated. Mock infection received identical treatment except that cell culture medium
was used as inoculum. Mock infected cells were harvested at 48 h p.i. Cells were lysed in
2X disruption buffer (125 mM-Tris-HCI pH 6.8, 4% SDS, 10% 2-mercaptoethanol, 20%

glycerol and 0.002% bromophenol blue). Proteins were run on 10% SDS polyacrylamide
gel (Laemmli, 1970). An amount of protein equivalent to approximately 4 X 105 cells
(SF-21) or 3 X 105 (Ld652Y) were loaded per lane for Coomassie blue stained gels while

2.5 X 104 cells (SF -21) or 2 X 104 (Ld652Y) loaded per lane for Western blots. Proteins
were transferred to Hybond-ECL nitrocellulose membranes (Amersharn Life Science,
Arlington Heights, IL) and incubated with antibodies (Towbin et al., 1979). Anti-gp67
monoclonal antibody (V olkrnan et al., 1984) (provided by L. Volkrnan, U.C. Berkeley,
Berkeley, CA) was used at the dilution of 1:50. Anti-p39 polyclonal antibody (Pearson et
al., 1988) (provided by G. Rohrmann, Oregon State U., Corvallis, OR) was used at
1:1000. Secondary antibodies, anti-mouse peroxidase conjugate and anti-rabbit
peroxidase conjugate (Sigma, St. Louis, M0), were used at 1:5000. The ECL Western
blot detection system (Amersharn Life Science, Arlington Heights, IL) was employed for
signal detection.
Nucleotide Sequence Accession Number

The nucleotide sequence presented in this report was submitted to GenBank and

assigned the accession number LdNPV U38895.

32
Results

LdMNPV Encodes a Factor That Permits AcMNPV Replication in Ld652Y Cells

AcMNPV does not normally replicate in Ld652Y cells and LdMNPV does not
replicate in SF -21 cells. However, AcMNPV replicates in Ld652Y cells superinfected
with LdMNPV (McClintock and Dougherty, 1987). The ability of transfected LdMNPV
DNA to provide a factor needed for AcMNPV replication in Ld652Y cells was tested by
co-transfecting AcMNPV and intact genomic LdMNPV DNA into Ld652Y cells. Cells
were observed for the formation of polyhedral inclusion bodies (PIBs). Production of
budded AcMNPV was assessed by observation of PBS in SF-21 cells inoculated with
transfection supematants. Transfection of LdMNPV or LdMNPV plus AcMNPV DNA
resulted in the production of P138 within two to four days, while no PBS were produced
when AcMNPV alone was transfected. Supematants from the LdMNPV plus AcMNPV
transfections, but not AcMNPV or LdMNPV transfections alone, were able to infect SF-
21 cells (Table 1). This suggested that the budded viruses produced were AcMNPV and
demonstrated that the factor necessary for replication in Ld652Y cells could be provided
by transfected LdMNPV DNA.

In order to map the gene encoding this factor, we transfected Ld652Y cells with
cloned fragments of LdMNPV along with total genomic AcMNPV DNA. A cosmid
library comprising six overlapping fiagments of 20-30 kbp each, encompassing the entire
LdMNPV genome (Figure 1A), was used in the initial experiments. Virus replication was
assessed as described above. Of the six cosmids two (C-12 and C-77), were able to
provide the factor that allowed AcMNPV replication in Ld652Y cells (Table 1). When

AcMNPV DNA was transfected with all cosmids except either 012 or 077, AcMNPV

33

Table l. Replication of AcMNPV in Ld652Y Cells Following
Transfection of Viral and Cosmid DNAs into Ld652Y Cells

 

 

Transfected DNA Virus Productiona
AcMNPV -
LdMNPV -
AcMNPV + LdMNPV +
AcMNPV + C- 15 -
AcMNPV + C-2 -

* AcMNPV + 012 - '+
AcMNPV + 077 +
AcMNPV + 038 -
AcMNPV + C-64 , -
AcMNPV + 063 -
AcMNPV + All cosmids except C- 12 +
AcMNPV + All cosmids except 077 +

AcMNPV + All cosmids except C-12 and C-77 -

 

aPIBs are produced and transfection supematants are infectious for SF—21 cells.

34

Figure 1. Location of Clones Used to Map the LdMNPV Gene in Transfection
Assays A: BgIII restriction map of LdMNPV A-21 with scales indicating map units
(m.u.) and kbp above. The regions of LdMNPV comprising cosrrrid clones, C-2, C-12, C-
77, C-38, C63, C-64, and C-15, in the overlapping genomic library are shown as lines
below the restriction map. B: Restriction map of cosrrrid C-77 indicating locations of the
EcoRI, BamHI, and HindIII sites used for subcloning and the BgIII site at the BglII A/H
junction. Map locations are indicated below the restriction sites in m.u. The restriction
fragments comprising individual subclones are depicted as lines below the map, with
batch marks at the restriction sites, and are labeled with lower case letters. The ability of
individual clones to promote AcMNPV replication in Ld652Y cells in transfection assays
is indicated by a "+" under virus production. Clones unable to promote AcMNPV
replication are indicated by "-". Virus replication was assessed by observation of P135 in
transfected Ld652Y cells and the ability of budded virus in transfection supematants to
infect SF-21 cells. C: Restriction maps of the EcoRI-HindIII region, 42.6-46.5 m.u., of
LdMNPV. The positions of restriction sites are indicated in m.u. below the maps.
Locations of individual subclones and their ability to promote AcMNPV replication in
Ld652Y cells is indicated in the same manner as in B. Subclones h and i are named
pBSLdSD and pBSLdPD respectively. Abbreviations: E=EcoRI, B=BamHI, H=HindIII,
B g=BglII, P=PstI, N=NarI, S=SstI, Sa=SalI, X=XhoI, and D=DraI.

35

10 20 30 40 SO 60 70 80 90100 mu

 

ovo?

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

so ‘ ' T fro'o I ' ‘mé kbp
__ C 12 C 38 C 15
C 63 C 77 C 64 C 63
C 2
H
3377 E- E. .3 15 . 1i 3.9 ”Gym,"
3. ~—-—| -
b. '-----‘ ..
c. .____. -
d. L———————J +
e, 1.....1 _
f. ' -
E P N S H Vrus
C * 4 Prod'uctlo' n
a. _
b.
+
c. . , -
d.
/ ‘~-‘ +
£522.” 99.x N was
e. -
f. +
g. L -
h. .____.___.r -
i. . +

 

Figure 1. Location of Clones Used to Map the LdMNPV Gene in
Transfection Assays

36
could replicate. However if both were omitted AcMNPV was unable to replicate (Table

1). Since C-12 and C-77 overlap between 33 and 45 m.u. of the LdMNPV genome
(Figure 1A), the gene for the factor mapped to the region common to C-12 and C-77. To
further localize the gene, we subcloned individual restriction fragments from cosmid C-
77 in Bluescript vectors (Figure 1B) and tested each subclone for its ability to promote
AclVH‘lPV replication in Ld652Y cells in transfection assays. Only one subclone, a 6.3
kbp EcoRI- HindIII fragment (Figure 1B, (1), could provide the required factor. We then
tested nine subclones of this fragment (Figure 1C) and were able to localize the gene
encoding the factor to a single 835 bp PstI-DraI fragment (Figure 1C, i) that mapped
between 43.3-43.8 m.u. This subclone was named pBSLdPD.

The PstI-DraI fragment was sequenced and four open reading frames (ORFs)
were identified (Figure 2). The largest encodes a predicted protein of 21 8 amino acids
(25.7 kDa) and is preceded by an initiator sequence, TCAGT (Cherbas and Cherbas,
1993) and followed by a polyadenylation signal, but no TATA box was identified (Figure
2A). Similar initiator sequences have been identified in other baculovirus genes,
including the LdMNPV G22 that also lacks a TATA box (Bischoff and Slavicek, 1995).

Microscopic examination of transfected Ld652Y cells revealed that LdMNPV,
but not AcMNPV DNA, transfected into Ld652Y cells results in the formation of
polyhedra in the cell nuclei (Figure 3, compare panels a and b). A clone with ORF218
truncated (pBSLdSD) did not rescue cotransfected AcMNPV DNA in Ld652Y cells
(Figure 3c), whereas the clone (pBSLdPD) containing the complete 218 amino acid ORF
along with its 5' flanking region was able to supply this factor (Figure 3d). The three

smaller ORFs located between 43.4 to 43.8, as well as their 5' and 3' flanking regions,

Figure 2. Analysis of ORFs and Nucleotide Sequence of the LdMNPV Genome
Between 43.3 and 43.8 m.u. A: Diagram of ORFs in six reading frames. The locations of
PstI, SaII, and DraI restriction sites, six possible reading flames, and significant ORFs
are shown. The locations of stop codons in each reading frame are indicated by vertical
lines and the 218 amino acid ORF encoding HRF-l is labeled. ORFs capable of
encoding polypeptides with greater than 49 amino acids are depicted as open arrows,
indicating the direction of transcription, below the diagram of the reading frames. hrf-I is
shaded. B: Nucleotide sequence of LdMNPV A21-MPV, 43.3-43.8 m.u., and the deduced
amino acid sequence of hrf-I . A predicted polyadenylation recognition signal is double
underlined. An arthropod initiator sequence, TCAGT (Cherbas and Cherbas, 1993), is
underlined.

38

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

A.
Psti} 4501} [Fag
\.
I l I r1 ”1 IE T1
1 (ml: TR 11 i
ll Inf I l l l l
L, l
I l I I l 11 1
L )
I l 2mg 3
:::I 5 1 < 1 <:
B.

1 CTGCAGCGTGTGTMCTGTACTTGCAATIGCGACCCGTGTCAGTACACGCCAGCGCACAG
6 1 TGCGGAGCGAACGCGACCAGCGCCGCGCAGCGAGACGAATATCGATPCATITTATTTAGC

12 1 GCGCCGACGACCATGGGCATGGACGCCGAGWGTGGACGGCGAACGCGTGGBCAGC
HGHDAEPFVDGBRVDS

181 TACAAGTGCACCGGGCGGTGGTCCGCCATCGTCGACGTGCGCCACCGTCCCGCCTI‘GACG
YRCTGRWSAIVDVRBRPA‘LT

2 4 1 GTGCGCTACOGGTACGAGCGCGGCTACGGCCACTACGCGCTCTITGTTTA‘ITTICGRCAC
VRYRYERGYGBYALFVYPRU

301 GTGGCCACCGGCATGCTGGAGACGGAGCGCGTGGACGTCGCCGACCGCGACCGCGTCGTG
VATGHLBTERVDVADRDRVV

3 6 1 CCCGTGCCCGAAGAGTGGCTOGAGTACATCGACGAOGACGACGAGGAGCGCGMCGCCAA
PVPBEWLBYIDDDDBBRHRQ

4 2 l GTGGAGGTGTTCGTGTGCATGAAGGGCGACTGCPACGCCCACGACGGCCCCCTGTTCGTC
VBVPVCHKGDCYAHDGPLFV

4 6 1 TCCGAGGCGTCCAMTGGTGCAGCCGCGAGCCCXEAACACGMCGCATCAGAGACTCGCCG
SBASKWCSREPBEVRIRDSP

5 2 1 CTCGAGGCCGTGCGACAMTCAAG‘IGCGCGGAGGACGTGITCGCGNCGTCGAAGCGTTC
LEAVRQIXCAEDVFAFVEAF

58 1 ATGCGGATCGAAGAGGGCGAGTACGCGTGGCGCGATCCGCTI‘GTGATCQCCMTPAMC
MRIEEGEYAWRDPLVIDQLN

6 4 1 GACCAAGAACTGGCCTCGAICGAGAAGGTTTPCGCCTCGACGGTGTGGAACTAMATGAA
DQELASIBKVPASTVWHYYB

701 MAGNMCGCGCGACCGGTTTI‘GACCITTGCCGAMATTATTI‘GMGAMTTAMTGAA
KVNARPVLTPABNYLKKLNE

761 AGT‘ITGTMTGT‘HTTATAGGATCTCGGTGCGTATAMTATTTMMTIT
S L *

Figure 2. Analysis of ORFs and Nucleotide Sequence of the LdMNPV Genome Between
43.3 and 43.8 m.u.

39

 

Figure 3. Brightfield Micrographs of Ld652Y Cells Post Transfection Four days post
transfection with the following DNAs: (a) LdMNPV, (b) AcMNPV, (c) AcMNPV and
pLdSD (Figure 1C, h.), and (d) AcMNPV and pLdPD (Figure 1C, i.).

40
were present in both clones. Therefore the 218 amino acid ORF encodes the LdMNPV

host range factor. We named this gene hrf-I for host range factor-1.

The nucleotide and predicted protein sequences of hrf-I were compared to known
sequences in the GenBank (release 91.0), EMBL (release 44.0), and SWISS-PROT
(release 31.0) databases using F asta and Tfasta algorithms of the Wisconsin User Group
GCG sequence analysis programs (Devereux et al., 1984) and no significant identity was
observed. A search of the National Center for Biotechnology Information (N CBI) non-
redundant protein database employing the Blast algorithm (Altschul et al., 1990)
revealed a limited identity with AcMNPV polyhedrin (40% over 32 amino acid residues).

Although no characteristic protein motifs were identified that might suggest how
HRF -1 might function, the predicted peptide is rich in glutarnic acid (12%) and valine
(12%) residues, containing 26 and 25 residues respectively. It also contains 20 (9%)
aspartic acid and 18 (8%) arginine residues. The concentration of glutamic and aspartic
acid residues contribute to an unusually high negative charge (-16) and an isoelectric
point of 4.61. Dividing the net charge of -16 by the number of amino acids, 218, results
in a net charge percent of -7.3. Karlin and Brendel (Karlin and Brendel, 1992)
statistically analyzed amino acid characteristics of protein sets from humans, Drosophila,
yeast, Escherichia coli, Bacillus subtilis, and four herpes viruses, complied fi'om the
SWISS-PROT database. Among these data sets less than 5% of the proteins analyzed
were more acidic than I-IRF -1. High net negative charge due to numerous acidic residues
has also been observed in proteins that respond to growth arrest and DNA damage (Gadd)

(Zhan et al., 1994).

. 41
Late Virus Genes Are Translated in Recombinant AcMNPV-Infected Ld652Y Cells

In order to determine if hIf-I would facilitate AcMNPV replication in infected, as
well as in transfected Ld652Y cells, we constructed recombinant AcMNPV. The PstI-
SstII (43.3-44.6 m.u.) fragment (Figure 4A) was cloned into the polylinker site of the
transfer vector pSynXIV VI+ (Wang et al., 1991). The resulting plasmid, pSynLdPS, and
recipient virus, VsynVI'gal (Wang et al., 1991), DNA were transfected into SF-21 cells.
A recombinant virus, vAchPS, was generated by homologous recombination. Polyhedra
are observed in vAchPS-infected Ld652Y cells by 24 h p.i., indicating the recombinant
is infectious (data not shown). vAchPS comprises the entire AcMNPV genome with the
addition of the 2093 bp LdMNPV genomic fragment and two synthetic promoters from
the transfer vector inserted between 4427 and 4428 bp of the AcMNPV genome (Ayres et
al., 1994), adjacent to the polyhedrin gene locus (Figure 4B). The PstI-SstI fragment used
for production of this construct contains both hrf-I and a gene with homology to
entomopox firsolin genes (firs) (Cassar and Thiem, submitted) (Figure 4A). We have no
evidence that LdMNPVfilS contributes to AcMNPV replication in Ld652Y cells. The
LdMNPV DraI-Sall fragment comprising firs (Figure 4A, hatched) does not promote
AcMNPV replication in Ld652Y cells in transfection assays (Figure 1C, g). An
AcMNPV recombinant bearing only hrf-I (Figure 4A, stippled) replicates in Ld652Y

cells (Du and Thiem, 1997).

Since the inability of Ld652Y cells to support AcMNPV infection involves a
block in protein synthesis (Guzo et al., 1992; Morris and Miller, 1992; 1993), we
compared the synthesis of two baculovirus structural proteins, gp67 a peplomer protein

found exclusively in the budded form of the virus (Whitford et al., 1989) and p39 the

42

 

 

 

 

A. LdMNPV
[fix ........... i ....................... i ag---.-;J.‘.‘---.-.-.u_---.---.-.- .....
fins SalI Xhol Xhol Dral Dral Xhol Nari Xhol $116833
I mu 0
*‘b ‘w
k \ hrf-I ins , ’ ,J

 

 

 

Psyn Ppolh polh
PXIV

Figure 4. Diagram Showing the Construction of a Recombinant AcMNPV, vAchPS
A: An expanded restriction map of the LdMNPV PstI-Sstl restriction fragment (43.3-44.6
m.u.) showing the location and orientation of hrf-I and fus with respect to the linearized
LdMNPV physical map. The stippled region indicates the location of the smallest
restriction fragment able to rescue AcMNPV in transfection assays. A restriction
fiagrnent containing firs that does not rescue AcMNPV is hatched. B: The polyhedrin
gene region of vAchPS. The LdMNPV DNA and two synthetic promoters have been
inserted adjacent to the AcMNPV polyhedrin gene, nt 4428 (Ayres et al., 1994). The
direction of arrows indicate the orientation of genes and promoters. The tandem synthetic
promoters derived from the transfer vector, pSynXIV VI+ (Wang et al., 1991), are labeled
"tv".

43
major capsid protein (Thiem and Miller, 1989), in AcMNPV- and vAchPS-infected

cells by Western blot analysis (Figure 5). SF-21 and Ld652Y cells were infected with
AcMNPV and vAchPS and harvested at different times p.i. Proteins were separated by
SDS-PAGE (Laemmli, 1970) and stained with Coomassie blue or transferred to
membranes (Towbin et al., 1979) and incubated with antibodies against gp67 (V olkrnan
et al., 1984) or p39 (Pearson et al., 1988). In SF-21 cells (Figure 5, A-C) gp67 was
observed by 12 h p.i. in both wt AcMNPV-infected cells (Figure 5B, 1) and in vAchPS-
infected cells (Figure 5B, II). By 48 h p.i. gp67 production is reduced in cells infected
with either virus. p39 is expressed in a similar manner in both AcMNPV- and vAchPS-
infected SF-21 cells (Figure 5C, compare I and II). However, in Ld652Y cells (Figure 5,
D-F) both gp67 and p39 are expressed in vAchPS-infected but not in AcMNPV-infected
cells (Figure 5E and F, compare panels H and I). In vAchPS-infected Ld652Y cells,
gp67 expression is observed by 6 h p.i. and diminishes by 48 h p.i. At 48 h p.i. p39
expression is greater in vAchPS-infected Ld652Y cells than SF-2l cells (Figure 5,
panels C and F). Although polyhedrin antiserum was not used, polyhedrin is observed in
all panels that were incubated with antibodies. This is most likely due to non-specific
secondary antibody binding, because polyhedrin is present at such high levels at late
times p.i.

Evidence That a Gene With Homology to LdMNPV [tr/21 Is Not Present in the
OpMNPV Genome

Since Ld652Y cells are permissive for OpMNPV replication, it seemed likely that
OpMNPV might carry a gene homologous to LdMNPV hrf-I . To determine if OpMNPV

carries a similar gene, we used Southern blots with low stringency hybridization and

44

A 8 C
| I l I
I -, 11‘182448 (1 612182448 M00 612182448 0 612182448

ll
I400 6121824480 612182-448

  

    

V

 

as ‘ t‘.
36 ‘ u
29 90,, 2 w-.. “W‘" “ '
-2 _:
D E F

M“ M M00 612132448 0612182448 Ibo 61216 2448 0612182448

‘C— polh

   

Figure 5. Comassie Blue Stained Gels and Western Blot Analysis of Protein
Synthesis A-C: SF-21; D-E: Ld652Y cells. Roman numerals above the panels indicated
the virus used for infection; I = wt AcMNPV and II = vAchPS. Coomassie blue stained
gels are shown in Panel A (SF-21 cells) and D (Ld652Y cells). Western blot analyses
with antibodies to gp67 are shown in panels B (SF-21 cells) and E (Ld652Y cells).
Western blot analyses with p39 antibodies are shown in panels C (SF-21 cells) and F
(Ld652Y cells). Lanes labeled Mo indicate mock infected cells. Arabic numbers above
the lanes indicate the time, in hours, after infection that cells were harvested. Lanes MW
in Panels A and D are molecular weight standards with molecular weights in kDa
indicated to the left of the panels. gp67, p39 and polyhedrin protein bands are indicated
by arrows and labeled to the right of individual panels.

45
wash conditions. The LdMNPV hrf-I probe did not hybridize to OpMNPV DNA (data

not shown). Based on this study, there does not appear to be an OpMNPV gene with
homology to hif-I . Furthermore, OpMNPV was unable to promote AcMNPV replication
in Ld652Y cells in transfection assays or when used to superinfect AcMNPV-infected
Ld652Y cells (data not shown), suggesting that it does not carry a gene with a similar
function.

Discussion

We have identified a unique gene, hrf-I, encoding a 25.7 kDa predicted protein
that enables AcMNPV to replicate in Ld652Y cells, a non-permissive cell line. Cloned
Inf—1 DNA is able to overcome the block for AcMNPV replication in Ld652Y cells in co-
transfection assays. Recombinant AcMNPV carrying hrf-I replicate in Ld652Y cells and
overcome a block in protein synthesis observed in wt AcMNPV-infected cells. No
homologies to genes of known function or characteristic protein motifs that might
suggest possible roles for HRF-l were identified in database searches.

The block for AcMNPV replication in Ld652Y cells involves total inhibition of
protein synthesis. When Ld652Y cells are infected with AcMNPV the cells respond by
shutting off all protein synthesis, both viral and cellular before 20 h p.i. (Guzo et al.,
1992; McClintock et al., 1986). In contrast, viral DNA is replicated and mRNA is
transcribed (Guzo et al., 1992; Morris and Miller, 1993). AcMNPV-specific mRNAs are
found in both cytoplasmic and nuclear fractions of infected Ld652Y cells and can be
translated in vitro using rabbit reticulocyte lysates (Guzo et al., 1992). Thus, there are no
apparent problems in either transport from the nucleus or in the translatability of viral

mRNA in AcMNPV-infected Ld652Y cells. Therefore, it is likely that the block in

46
AcMNPV replication in Ld652Y cells in some way directly affects protein synthesis.

Recombinant AcMNPV containing reporter genes under the control of either the
early AcMNPV ETL or the Drosophila hsp70 promoter show low levels of expression in
Ld652Y cells (Morris and Miller, 1992; 1993), suggesting that the translation of any
genes introduced by AcMNPV-infection in this cell line is minimal. This is puzzling
because both late gene transcription and DNA replication occur in AcMNPV-infected
Ld652Y cells. Both of these processes require early viral gene products (Lu and Miller,
1995; Todd et al., 1995). Therefore the block in protein synthesis in AcMNPV-infected
Ld652Y cells must occur subsequent to the translation of at least some early AcMNPV
genes. It is possible that sufficient levels of some viral gene products, essential for late
transcription and DNA replication, are translated in the period prior to total protein
synthesis shut down. This issue is currently being investigated.

Understanding when and how protein synthesis is blocked in AcMNPV-infected
Ld652Y cells could provide clues for the function of HRF-l. Inhibition of protein
synthesis in response to virus infection is common in cells infected with a variety of
viruses (Schneider and Shenk, 1987). Virus mediated processes include degradation of
host mRNA, inactivation of translation factors, and alterations of intracellular ion
concentrations in order to favor translation of virus genes. Cells also shutdown protein
synthesis in response to viral infection. One of the best characterized cellular responses is
the interferon-mediated pathway of vertebrates (Samuel, 1991). Viruses in turn have
evolved diverse mechanisms to counteract the cellular response (Samuel, 1991;
Schneider and Shenk, 1987) .

The amino acid composition of HRF-l may be significant. The predicted protein

47
is unusually highly charged and acidic. This feature is shared with mammalian Gadd

proteins (Zhan et al., 1994). All Gadd proteins are negatively charged but, with the
exception of GADD45 and MyD116, share no sequence homology (Zhan et al., 1994) .
Recently a Herpes Simplex Virus (HSV-l) gene was identified that encodes a protein,
ICP34.5, with homology to GADD45 and MyDl l6 (Chou and Roizman, 1992). Like the
Gadd proteins the HSV-l protein is highly charged. However, unlike Gadd proteins,
ICP34.5 is positively, rather than negatively charged. In neuronal cells, this gene
overcomes a block in protein synthesis for HSV-1(+17), a variant mutated in this gene. ,
The protein synthesis block in HSV-1(+l7)-infected neuronal cells is similar to that
observed in AcMNPV-infected Ld652Y cells. How ICP34.5 acts to overcome this is
unknown.

Possible explanations for the shutoff of protein synthesis in AcMNPV-infected
Ld652Y cells include both viral and cellular mediated processes. Baculoviruses might
have a mechanism for shutting down host protein synthesis and selectively maintaining
virus protein synthesis. AcMNPV may simply lack a factor, HRF-l, needed to maintain
virus protein synthesis in Ld652Y cells. As a consequence all protein synthesis is shut
down. Another possibility is that the shut off of protein synthesis in AcMNPV-infected
Ld652Y cells may be a cellular defense mechanism against virus infection. Thus the role
of HRF-l may be to circumvent the host's defenses to virus infection and permit a
productive virus replication cycle. In baculoviruses there are two different genes, p35 and
iap, that are capable of overcoming apoptosis, another cellular defense mechanism (Clem
et al., 1991; Crook et al., 1993). The response of Ld652Y cells to AcMNPV infection

may represent an additional host defense system against viral infection, the shut off of

48

protein synthesis. All other baculovirus genes that have been implicated in host range
determination, p35 (Clem et al., 1991; Clem and Miller, 1993), the p143 helicase
(Croizier et al., 1994; Maeda et al., 1993), and hcf-I (Lu and Miller, 1995), have roles in
DNA replication (Lu and Miller, 1995; Todd et al., 1995). Thus the role of hrf-I in host
range determination appears to be different from these other genes.
Acknowledgments

We thank Jim M. Slavicek for providing LdMNPV A21-MPV virus and the
LdMNPV cosmid library, Dwight Lynn for the IPLB-Ld652Y cell line, Loy Volkrnan
and George Rohrmann for antibodies, and Gary Blissard for OpMNPV. We are
particularly grateful to Steven C. Cassar for excellent technical assistance. We also thank
Jim M. Slavicek, Steven C. Cassar, and Chi-Ju Chen for critical reading of the
manuscript.

This work was supported in part by Cooperative Research Agreement 23-816
with Northeastern Forest Experiment Station, Forest Service, USDA and by Public
Health Service Grant GM48608 from the National Institute of General Medical Sciences

to S.M.T.

CHAPTER 3

Characterization of Host Range Factor 1 (hrf-I) Expression in Lymantria dispar
Nucleopolyhedrovirus— and Recombinant Autographa californica
Nucleopolyhedrovirus-Infected IPLB-Ld652Y Cells

Xianlin Du1 and Suzanne M. Thiemlaze3,4
Department of Microbiology1 and Entomologyz, Program in Genetics3, and Pesticide
Research Center“4

Michigan State University
East Lansing, Michigan 48824-1115

This work has been published in Virology, 1997, 227 :420—430.

49

50
Abstract

We previously identified a gene, host range factor 1 (hrf-I), in Lymantria dispar
nucleopolyhedrovirus (LdMNPV) which promoted Autographa calzfornica
nucleopolyhedrovirus (AcMNPV) replication in a nonpermissive cell line IPLB-Ld652Y
(Ld652Y). A recombinant AcMNPV, vAchPS, bearing hrf-I controlled by two
synthetic baculovirus late promoters was constructed that replicated in Ld652Y cells. In
this study, we constructed a new recombinant AcMNPV, vAchPD, bearing only hif-I
controlled by its own promoter. vAchPD replicated in Ld652Y cells in the same manner
as vAchPS confirming that hrf-I alone was sufficient to promote AcMNPV replication
in Ld652Y cells. hrf-I was transcribed as a delayed early gene in LdMNPV but as an
immediate early gene in both recombinant AcMNPVs. Primer extension analysis showed
that the initiator sequence TCAGT was used as transcription start site in both LdMNPV
and recombinant AcMNPVs. Additional sequencing revealed several regulatory motifs in
hif-I upstream region. hif—I transcripts in LdMNPV- and vAchPS-infected Ld652Y
cells terminated near the polyadenylation signal at the end of hIf-I ORF while in
vAchPD, terminated at a downstream polyadenylation signal at the end of ORF 603.
Using Western blot analysis, we detected HRF -1 expression in both recombinant
AcMNPV-infected but not in LdMNPV-infected Ld652Y cells.

Introduction
Nucleopolyhedroviruses (NPVs) belong to the family Baculoviridae. They are
large DNA—containing viruses which infect insects. During their infection cycles, viral
genes are activated in a cascade fashion and are expressed in three temporal phases:

early, late, and very late (F riesen and Miller, 1986). Early gene promoters resemble those

51
of the host and many contain the transcription initiator sequence TCAGT (Blissard et al.,

1992; Cherbas and Cherbas, 1993; Dickson and F riesen, 1991; Guarino and Smith,
1992). Transcription of early genes is achieved by cellular RNA polymerase II (Hoopes
and Rohrmann, 1991; Huh and Weaver, 1990) before the onset of viral DNA replication.
Activation of late and very late genes requires early gene products and depends on the
onset of viral DNA replication (Erlandson et al., 1985; Rice and Miller, 1986). Late and
very late genes are transcribed by a viral-induced or-amanitin—insensitive RNA
polymerase (Beniya et al., 1996; Fuchs et al., 1983; Hub and Weaver, 1990). These
transcripts initiate from a characteristic TAAG motif (Howard et al., 1986; Rohrmann,
1986; Thiem and Miller, 1989b; Wilson et al., 1987). Multiple overlapping transcripts
with coterminal 5'- or 3'-ends are a common feature in baculovirus gene transcription
(F riesen and Miller, 1986). Bicistronic and multicistronic transcripts are also observed
(Oellig et al., 1987 ; Passarelli and Miller, 1994; Thiem and Miller, 1989a).

Autographa califomica NPV (AcMNPV), is widely used as a eukaryotic
expression vector and serves as a model for studying molecular biology of baculoviruses.
AcMNPV was originally isolated from the alfalfa looper and is routinely propagated in
IPLB-SF -21 cells (SF -21) (Vaughn et al., 1977). Lymantria dispar NPV (LdMNPV) is
currently used as a control agent for gypsy moth, a serious pest of forest and shade trees
in Northeastern United States. LdMNPV is routinely propagated in the gypsy moth cell
line lPLB-Ld652Y (Ld652Y) (Goodwin et al., 1978).

AcMNPV is not able to replicate in the gypsy moth cell line Ld652Y (McClintock

et al., 1986). Virus can enter the cell and viral DNA is synthesized (Guzo et al., 1992;

52
McClintock et al., 1986; Monis and Miller, 1992). Viral and host cellular RNAs are

transcribed, transported, and of normal size (Guzo et al., 1992; Morris and Miller, 1993).
However, protein synthesis is shut off by late times post infection (p.i.) and no viral
progeny is produced (Du and'Thiem, submitted; Guzo et al., 1992; McClintock et al.,
1986). In previous studies, we identified and sequenced a single gene, host range factor 1
(hrf-I) in LdMNPV, which was able to promote AcMNPV replication in Ld652Y cells
and ensure the production of AcMNPV progeny in cotransfection assays (Thiem et al.,
1996). A recombinant AcMNPV, vAchPS, bearing hrf-I , controlled by two synthetic
late promoters, and a second LdMNPV gene, firs (Cassar and Thiem, submitted), was
constructed that replicated in Ld652Y cells (Thiem et al., 1996). In this study, we
constructed a new recombinant AcMNPV, vAchPD, bearing only hrf—I controlled by its
own promoter. We compared virus production in Ld652Y cells infected with these two
recombinant AcMNPVs and characterized hrf-I expression in LdMNPV- and in
recombinant AcMNPV-infected Ld652Y cells.
- Materials and Methods

Cells. and Viruses

SF-21 cells (Vaughn et al., 1977) and Ld652Y cells (Goodwin et al., 1978) were
maintained in TC100 medium (Life Technologies, Grand Island, NY) supplemented with
10% fetal bovine serum and 0.26% tryptose broth. LdMNPV isolate A21-2 (Bischoff and
Slavicek, 1996) was propagated in Ld652Y cells. AcMNPV variant L1 (Lee and Miller,
1978) and recombinant AcMNPVs were propagated in SF—21 cells. Construction of
vAchPS, the recombinant AcMNPV, was described previously (Thiem et al., 1996). To

generate vAchPD (Figure 6C), the PstI-DraI fragment which contained only hrf-I was

53
cloned in a transfer vector pAcUW2B (W eyer et al., 1990) to generate the transfer

plasmid pAcUWLdPD. This transfer plasmid and DNA from a modified AcMNPV,
vSynVI'gal (Wang et al., 1991), in which the polyhedrin (polh) gene was replaced by
LacZ, were cotransfected into SF-21 cells using lipofectin (F legner et al., 1987; O'Reilly
et al., 1992). White occlusion positive viruses were selected and plaque purified. Correct
insertion of the LdMNPV fragment was confirmed by analysis of DNA restriction
patterns of the recombinant virus. This recombinant AcMNPV was named vAchPD.
Comparison of Virus Production

Ld652Y cells were infected with wt AcMNPV, vAchPS, or vAchPD at a
multiplicity of infection (MOI) of 10 plaque formation units (PFU) per cell. After 1 h
adsorption, the inoculum was removed and cells were washed twice with incomplete
medium and refed with complete medium. Time zero was defined as the time when the
inoculum was removed and incubation at 27 °C was initiated. To compare occluded virus
production, infected cells were collected at 24 and 48 h p.i. Numbers of cells containing
polyhedrin inclusion bodies (PIB) were counted using hemacytometer in a total of about
1000 cells and the percentages of cells containing PIB versus total cells were calculated.
To compare budded virus production, supernatant of infected cells was collected at 0, 12,
24, and 48 h p.i. and budded virus titers were quantitated as pfu/ml by plaque assays on
both Ld652Y and SF-21 cells.
RNA Isolation and PolyA-RNA Selection

Ld652Y cells were infected with LdMNPV at an MOI of 8, vAchPS or
vAchPD at an MOI of 10 and harvested at O, 6, 12, 18, 24, and 48 h p.i. Mock-infected

cells were inoculated with incomplete medium and harvested at 48 h p.i. To block

54
protein synthesis, cycloheximide was used at 100 ug/ml throughout the time course

beginning with a 30 minute pretreatment prior to the addition of inoculum. To block
DNA replication, aphidicolin was added at 5 ug/ml following the adsorption period. Both
cyclohexirnide and aphidicolin treated infections were harvested at 12 h p.i. (vAchPS
and vAchPD) or 18 h p.i. (LdMNPV).

Total cellular RNAs were isolated by a single step method (Chomczynski and
Sacchi, 1987). Oligo(dT) attached to metal beads (PerSeptive Diagnostics, Inc.,
Cambridge, MA ) was employed to isolate polyadenylated RNA.

Northern Blot Analysis

Seven ug polyA-RNA from LdMNPV-infected or 4 ug polyA-RNA from
recombinant AcMNPV-infected Ld652Y cells were used for Northern blot analysis.
PolyA-RNA from each time point was separated by electrophoresis on a 1.2%
formaldehyde agarose gel and transferred to nylon membranes. The PstI-Dral fragment
(Figure 6A) cloned in a Bluescript plasmid (Stratagene, La Jolla, CA) was used as a
template to synthesize a strand-specific ribo-probe using or-[32P] CTP (3000Ci/mMol,
Dupont NEN, Wilmington, DE) and an in vitro transcription system (Promega, Madison,
WS). Northern hybridization was performed at 55°C in 50% formamide. An RNA size
ladder (Life Technologies, Bethesda, MD) was co-electrophoresed and stained separately
as a size marker.
Primer Extension

Total cellular RNAs fi'om mock-, LdMNPV-, vAchPS-, and vAchPD-infected

cells were used for primer extension. A primer, TGCACTTGTAGCTGTCCA,

55
complementary to the mRNA strand approximately 180 bps downstream fi'om the PstI

site (Figure 6A and Figure 11) was synthesized (Michigan State University
Macromolecular Structure, Sequencing, and Synthesis Facility, East Lansing, MI), 5'-end
labeled using y-[32P]ATP (3000Ci/mMol, NEN Dupont, Wilmington, DE), and used to
prime cDNA synthesis. The primer was annealed to 25 pg total cellular RNA at 30°C
overnight and extended with M-MLV reverse transcriptase (Life Technologies, Bethesda,
MD). A sequencing ladder was generated using the same labeled primer in a
dideoxyribonucleotide-chain termination sequencing reaction (CircumVent, New
England Biolabs Inc., Beverly, MA) using cloned LdMNPV EcoRI-Sstl DNA fragment
spanning this region (42.6-44.6 m.u.) (LdMNPV), the transfer plasmid PsynLdPS (Thiem
et al., 1996) (vAchPS), or pAcUWLdPD as template. PUC18 DNA was cut with MspI
and 5'-end labeled as a size marker. Primer extension products and the sequencing ladder
were analyzed on 8% polyacrylamide-7M urea sequencing gels.
Nuclease Protection Assay

A 3'-end labeled probe was annealed to polyA-RNAs from mock-, LdMNPV-,
and vAchPS-infected Ld652Y cells. To generate the probe, a 1.3 kb SaII-Narl fiagrnent
(43.4-44.1 m.u.) (Figure 6A) spanning the putative 3'-end region was selectively labeled
at the Still site by filling in the 5' overhanging end of the restriction digested DNA using
T4 DNA polymerase and both a-[32P]-dATP and or-[32P]-dTTP (3000 Ci/mMol, Dupont
NEN, Wilmington, DE). Two ug polyA-RNA was hybridized to the probe at 59°C
overnight followed by mung bean nuclease digestion (1000u/ml, LifeTechnologies,

Bethesda, MD) at 37°C for 1 h. Nuclease-resistant fragments were analyzed on an 8%

56
polyacrylamide-7M urea sequencing gel.

RT-PCR

Twenty pg of total RNA isolated from mock-, vAchPS-, and vAchPD-infected
Ld652Y cells was used to synthesize cDNA with Oligo(dT) primer (Promega, Madison,
WI) and M-MLV reverse transcriptase (Life Technologies, Bethesda, MD). These cDNA
products and DNA from the transfer plasmid, pAcUWLdPD, was used for PCR. PCR
was performed 25 cycles (94°C 1 min, 55°C 50 sec, and 72°C 3 rrrin ) using two synthetic
primers (Michigan State University Macromolecular Structure, Sequencing, and
Synthesis Facility, East Lansing, MI), CAGCGAGACGAATATCGA which was 43
nucleotides downstream of the hrf-I transcription start site TCAGT and
CGATACAAACCAAACGCA which was 2 nucleotides upstream of the polyadenylation
signal at the end of ORF 603 (Figure 6C). PCR product was resolved in 1% agarose gel
together with DNA size marker and stained with ethidium bromide.
Sequencing

hrf-I upstream sequence was obtained using synthetic primers,
AATTGCAAGTACAGTTAC for the antisense strand and ATTCAACACATTCGACCC
for the coding strand (Michigan State University macromolecular structure, sequencing
and synthesis facility), and a cloned LdMNPV EcoRI-Sstl DNA fragment (42.6-44.6
m.u.) as template in a dideoxynucleotide chain termination reaction (Sanger et al., 1977)

by employing a Circumvent Sequencing Kit (New England Biolabs, Beverly, MA).

57 ,
Antibody Preparation

The SalI- DraI fragment ( 43.4-43.8 m.u.) in hrf-I C-terminus (Figure 6A) was
ligated to the 3'-end of maltose binding protein (MBP) DNA sequence in a bacterial
protein expression plasmid pMAL-c2 (New England Biolabs). The resulting fusion
protein was expressed in E. coli. This fusion protein contained 40 kDa MBP and 20.6
kDa truncated HRF-l (SaII-DraI). The highly expressed fusion protein was isolated
through amylose colrunn and further purified by eluting fi'om protein gel. 60 pg (0.5 ml)
purified fusion protein was emulsified with 0.5 ml Titennax (V axcel Inc., Norcross, GA)
and used to irnmunize rabbits by subcutaneous injections. Antiserum was collected every
2 weeks beginning the 4th week after immunization.

Western Blot Analysis

Ld652Y cells were infected with Llemva, vAchPS, or vAchPD at an MOI
of 10 PFU as described previously. SF-21 cells were infected with AcMNPV at an MOI
of 10 PFU and harvested at 24 hr p.i. Cells were lysed in 2 X disruption buffer (125 mM
Tris-HCl pH 6.8, 4% SDS, 10% 2-mercaptoethanol, 20% glycerol and 0.002%

bromophenol blue). Proteins were run on 10% SDS polyacrylamide gels (Laemmli,

1970). An amount of protein equivalent to approximately 1 X 10‘5 cells was loaded per
lane. The HRF-l fusion protein (60.6 kDa) and the truncated HRF -1 (20.6 kDa) cleaved
from the fusion protein by Xa factor (New England Biolabs) were used as HRF-l
controls. Following electrophoresis, a parallel gel of vAchPS infections was stained
with Coomassie blue. For blotting, gels were electrophoretically transferred to Hybond-

ECL nitrocellulose membranes (Amersham Life Science, Arlington Heights, IL) in a

58
transfer buffer containing 20 mM Tris-Cl, 150 mM Glycine (pH 8.3), and 20% methanol

and incubated with antibody by standard method (Towbin et al., 1979). Polyclonal
antibodies against HRF-l fusion protein were used at the dilution of 1:100. Secondary
antibody, anti-rabbit peroxidase conjugate (Sigma, St. Louis, MO), was used at 1:
100,000. The ECL Western blot detection system (Amersham Life Science, Arlington
Heights, IL) was employed for signal detection.
Nucleotide Sequence Accession Number

The GenBank accession number for the nucleotide sequence presented in this
report is U38895.

Results

Construction of vAchPD

hrjll was identified by its ability to promote AcMNPV replication in Ld652Y
cells in cotransfection assays (Thiem et al., 1996). A recombinant AcMNPV, vAchPS,
bearing hrf-I was able to replicate in infected Ld652Y cells. vAchPS contained an
additional LdMNPV gene, fus (Cassar and Thiem, submitted), and hrf-I expression was
regulated by two synthetic late promoters in addition to its own promoter. To rule out the
possibility that either fus or the synthetic promoters were required for AcMNPV
replication in Ld652Y cells, another recombinant AcMNPV, vAchPD, was constructed
(Figure 6C). vAchPD contained only the Inf-1 gene controlled by its own promoter.
Virus production of vAchPS and vAchPD on Ld652Y cells was compared. For
occluded virus production, percentage of cells containing PIB versus total cells was
determined at 24 and 48 h p.i. In both recombinant virus-infected Ld652Y cells, 82% of

the cells produced PIB by 24 h p.i. and the percentage of cells containing PIB reached

59

Figure 6. Schematic Diagram of hrf-I Context in LdMNPV, vAchPS, and
vAchPD A: LdMNPV; B: vAchPS; C: vAchPD. For ease of comparison, the
conventional orientation of AcMNPV is reversed for recombinant AcMNPVs to show
hrf-I oriented as in LdMNPV. The location of the synthetic promoters, Psyn and PXIV,
from the transfer vector pSynXIV VI+ (Wang et al., 1991), is indicated by hatched lines
in vAchPS (B). Selected restriction sites are indicated. ORFs are represented by open
arrows. Spacing between ORFs and restriction sites is given in bps. The positions of
primers and probes are indicated by lines beneath the schematic for LdMNPV (A) or
vAchPD (C). The restriction fragment used to generate the HRF-l fusion protein is
shaded in the schematic of LdMNPV (A). Labeled ends are indicated by " * ".

60

A LdMNPV DraI PstI SalI DraI Na I 55:1
1 1134. f l

 

 

 

 

 

 

1 V9? )119I fiH-l >165 ( M ]

 

 

 

3' — a: 5' Primer for primer extension
3' 5'
Ribo-probe for Northem blot
3' * 5'

 

Probe for nuclease protection assay

 

 

 

 

 

 

 

 

B. vAchPS PetI SalI DraI NarI SstI
will 1 '41! J -‘
A NPV Psyn AcMNPV
&r§:| L an > we < are a w
C. VACLdPD PstI Sal]: DraI
1341 1 L411 454
AcMNPV LacZeeq AcMNPV
rim—3

 

 

5' —- 3'
Primers for RT-PCR

Figure 6. Schematic Diagram of Inf-I Context in LdMNPV, vAchPS,
and vAchPD

61
100% by 48 h p.i. (Table 2). No cells containing PIB in wt AcMNPV-infected Ld652Y

cells were observed (Table 2). Budded virus titers in supernatant at different times p.i.

were quantitated by plaque assays on both SF-21 and Ld652Y cells (Table 3). In both

recombinant virus-infected Ld652Y cells, virus titers remained at about 4-6 X 103 pfu/ml

due to residual virus inoculum at 0 and 12 h p.i. when titered on either SF -21 or Ld652Y

cells. Virus titers of vAchPS-infected Ld652Y cells reached 6 X 107 pfu/ml at 24 h p.i.

and remained the same at 48 h p.i. when titered on SF-21 cells. When titered on Ld652Y
cells, titers of vAchPS-infected cells reached 5 X 107 pfu/ml at 24 h p.i. and increased
to 6 x 10’ pfu/ml at 48 h p.i. Titers of vAchPD-infected cells reached 6 x 10’ at 24 h

p.i. and increased to 7 X 107 pfu/ml when titered on SF-21 cells and 8 X 107 pfu/ml when

titered on Ld652Y cells. In contrast, virus titers in wt AcMNPV-infected Ld652Y cells

remained at 5-6 X 103 pfir/ml throughout the time course when assayed on SF-21 cells
and at zero when assayed on Ld652Y cells. These data demonstrated that hrf-I alone was
sufficient to promote AcMNPV replication in the nonpermissive cell line Ld652Y. The
kinetics of recombinant virus replication in Ld652Y cells more closely reflected that of
AcMNPV replication on permissive cell lines than LdMNPV replication in Ld652Y cells
in which virus progeny is not produced until 48 h p.i. (J. Slavicek, personal
communication; McClintock et al., 1987).

The viral context of hif-I in LdMNPV is different from that of recombinant
AcMNPVs (Figure 6). In LdMNPV (Figure 6A), hrf-I is located between 43.3 and 43.8
m.u., immediately downstream of the virus enhancing factor (vef) (J. Slavicek, personal

communication) and oriented in the same direction. There were 119 bps between the stop

62

Table 2. Occluded Virus Production in Ld652Y Cells

 

24 h p.i. 48 h p.i.

 

Total cells Cells with Percentage Total cells Cells with Percentage

 

PIB PIB
vAchPS 1012 826 82% 1045 1045 100%
vAchPD 1077 879 82% 1056 1056 100%
AcMNPV 1097 0 0 1074 O 0

 

Table 3. Budded Virus Production in Ld652Y Cells Assayed on
Both Ld652Y and SF-21 Cells

 

SF-21 Ld652Y

 

 

03 12 24 48 0 12 2A 48

vAchPS 4xro3b 6x103 6X107 6X107 4x103 5x103 5x107 6xro7
vAcldPD 6xro3 6X103 6X107 7xro7 5xro3 6x103 6X107 sxro7
AcMNPV 6X103 5x103 6xro3 6x103 0 0 0 0

a H p.i. when supematants were collected for plaque assays
b Titers in pfu/ml

 

63
codon, TAA, of vef and the start codon of hif-I . fus is located immediately downstream

from hrf-I , oriented in the opposite direction. The hIf-I and firs stop codons are
separated by 165 bps. In vAchPS (Thiem et al., 1996) (Figure 6B), the PstI-Sstl
fragment containing both hrf-I and firs was inserted upstream of AcMNPV polh at 3.4

m.u. together with two synthetic late promoter sequences, Psyn and PXIV, derived from

the transfer vector pSynXIV VI+ (Wang et al., 1991). In vAchPD (Figure 6C), the PstI-
DraI fragment containing the hif-I ORF, 5' (134 bps) and 3' (41 bps) flanking regions
and a run of 454 bps of LacZ 3'-end sequence derived from the transfer vector,
pAcUW2B (W eyer et al., 1990) was inserted upstream of AcMNPV polh at 3.4 m.u. This
fragment includes the TCAGT initiator motif. Thus, the hrf-I locus is identical in both
recombinant AcMNPVs. Both vAchPS and vAchPD have the same hif-I upstream
sequences. However, in vAchPS, hrf-I transcription is also controlled by the two
synthetic baculovirus late promoters. The recombinants differ in their sequences at the 3'-
end of the hrf-I ORF. The sequence in vAchPS includes fits and thus is identical to
LdMNPV at the 3'-end of hrf-I . In vAchPD, the LdMNPV sequence terminates 4
nucleotides downstream of the hif-I polyadenylation signal.
Transcriptional Analysis

hrf-I transcription patterns in LdMNPV- and recombinant AcMNPV-infected

Ld652Y cells were analyzed by Northern blot analysis (Figure 7) using a strand-specific,
32P-labeled, RNA probe (Figure 6A). In LdMNPV infections, a transcript of
approximately 1 kb consistent with the estimated size of hrf-I , based on sequence data,

was observed at 12, 18, and 24 h p.i. and in aphidicolin-treated cells harvested at 18 hr

A

M 6 121818A18C Z4 48

1.77-
1.32- '
r. 8- .
>
0.78-
0.53-
0.40-
0.28-

I II
M 0 6 1212A12C 2448 0 6 1212A12C2448

Figure 7. Northern Blot Analysis of Inf-1 Transcription in LdMNPV- and
Recombinant AcMNPV-Infected Ld652Y Cells A: mRNA isolated from LdMNPV-
infected Ld652Y cells; B: mRNA fi‘om recombinant AcMNPV-infected Ld652Y cells. I
= vAchPS infections and II = vAchPD infections. Numbers and letters at the top of the
lanes indicate mRNA isolated from mock-infected (M); LdMNPV-, vAchPS, or
vAchPD-infected Ld652Y cells harvested at 0, 6, 12, 18, 24, and 48 h p.i.; and from
aphidicolin (A) or cyclohexirrride (C) treated virus-infected Ld652Y cells harvested at 12
or 18 h p.i. hrf-I transcripts are indicated by arrowheads. The positions of RNA size
standards are indicated in kb to the left of the panels.

. 65
p.i. (Figure 7A, arrowhead). No transcript was observed at 6 h p.i. or in cycloheximide

treated cells harvested at 18 h p.i. The absence of hrf-I transcripts in the cycloheximide
treated cells indicated that de novo protein synthesis was required. Therefore hrf-I was .
classified as a delayed early gene in LdMNPV-infected Ld652Y cells. Larger transcripts
of 1.4 and 1.8 kb were observed at 12, 18, 24, and 48 h p.i. The 1.8 kb transcript was
also observed as a faint band in aphidicolin-treated cells harvested at 18 h p.i. Two
larger transcripts were also prominent at 24 and 48 h p.i. In vAchPS, a transcript,
approximately 1 kb, was first detected at 6 h p.i. and also observed in cycloheximide
treated cells at 12 h p.i. (Figure 7B, 1, arrowhead). This transcript diminished after 6 h
p.i. A 1.2 kb transcript appeared at 12 h p.i. and was abundant at 24 and 48 h p.i.,
consistent with initiation from the strong synthetic late promoters. In vAchPD,
transcript of about 2.0 kb was detected at 6 h p.i. and in cycloheximide treated cells
harvested at 12 h p.i. (Figure 7B, II, arrowhead). This transcript diminished after 6 h p.i.
Thus in both vAchPS- and vAchPD-infected Ld652Y cells, hrf-I was transcribed as
an immediate early gene with no requirement for de novo protein synthesis. A faint 1.8
kb band detected throughout the time course was apparently non-specific as it was also
observed in mock-infected cells.

Primer extension analysis was employed to map the transcription start sites
(Figure 8). A primer complementary to the hrf-I coding sequence (Figure 6A; Figure 11)
was synthesized and 3'zP-end-labeled for primer extension experiments. The labeled
primer was annealed to RNA isolated from LdMNPV-, vAchPS-, and vAchPD-

infected Ld652Y cells and extended using reverse transcriptase. The extension products

66

A B C
G A T C M6121818C24 GATC MGZ4CZ4 GATCG 1ZCM
501
-
489 _ sor . . 501
a. 404 ‘39 489
3‘ - 404
. 404
ix I
3. - 331 Cf __ N. 331 ' 33‘
c 5, .. c- .
E .- 3. .n
r ix ~'
3. -242 E/ : 2‘2 I 3‘2
5.
us- 190 | 190
‘190 3, -. 3.
,- c\ c\
e. -.._< a' . 147/
S r/ - :2: r/
g - ‘ A . A
i -147/ 5' m 5' .
3 Ha I I

 

Figure 8. Primer Extension Analysis of LdMNPV-, vAchPS-, and vAchPD-
Infected Ld652Y Cells A: LdMNPV-infected Ld652Y cells; B: vAchPS- infected
Ld652Y cells; C: vAchPD-infected Ld652Y cells. Numbers and letters at the top of the
lanes indicate total RNA isolated from mock-infected Ld652Y cells (M), virus-infected
Ld652Y cells treated with cycloheximide (18C or 24C), and virus-infected Ld652Y cells
at 6, 12, 18, or 24 h p.i. Lanes G, A, T, and C are sequencing reactions using the labeled
primer and a cloned LdMNPV DNA template (A), a transfer plasmid pSynLdPS (Thiem
et al., 1996) DNA template (B), or a transfer plasmid pAcUWLdPD DNA template (C).
The sequence at the start sites is indicated to the left of each panel. Marker sizes are
shown to the right of each panel in bp.

67

were analyzed on a denaturing sequencing gel along with molecular size markers: In
LdMNPV infections, two extension products were observed (Figure 8A). The stronger
signal was from a 153 nucleotide- band observed at 12 and 18 h p.i. that mapped to the
first thymidine in the TCAGT early initiator sequence (Figure 8A, arrowhead). A second,
weaker band of 265 nucleotides mapping to thymidine in GGTGA was observed at 18
and 24 h p.i. (Figure 8A, arrow). In vAchPS infections, primer extension products
mapping to the initiation sequence TCAGT were observed at 6 h p.i. and in
cycloheximide treated cells harvested at 24 h p.i. (Figure 8B, arrowhead). A prominent
primer extension product mapping to the proximal synthetic promoter, TAAG, was
detected at late time (24 h p.i.) (Figure SB, arrow). For the distal TAAG, only a minor
extension product was seen (Figure 8B, arrow). A strong band at 24C (cycloheximide
treated) which mapped to the PstI junction used in constructing vAchPS was also
observed (Figure 8B, open arrow). Additional bands observed at 24 h p.i. might be due
to premature termination of cDNA synthesis because of the high GC content of hrf-I
(69%) (Thiem et al., 1996) and thus possible formation of mRNA secondary structure. In
vAchPD infections, primer extension product at 6 h p.i. mapped to the TCAGT motif
(Figure 8C, arrowhead).

Nuclease protection assays were employed to map the 3'-ends of hrf-I transcripts
in LdMNPV- and vAchPS-infected Ld652Y cells (Figure 9). The probe was a 1.3 kb
nucleotide SalI-Narl fragment (43.4-44.2 m.u.), 3'-end-labeled at the S011 site (Figure
6A). The probe was annealed to polyA-RNA isolated from mock-, LdMNPV-, and
vAchPS-infected Ld652Y cells, digested with mung bean nuclease and analyzed on a

sequencing gel. A 620 bp nucleotide major protected fragment was observed in both

68

A B

P M 1ZC24 M 1818A 24 P

-1444

-501
-476

-404

- 33S

 

Figure 9. Nuclease Protection Mapping of 3'-Ends of hrf-I Transcripts in LdMNPV-
and vAchPS-lnfected Ld652Y Cells A: vAchPS-infected Ld652Y cells; B:
LdMNPV-infected Ld652Y cells. Numbers and letters at the top of the lanes indicate
polyA-RNA isolated from mock-infected cells (M), virus-infected cells at 18 or 24 h p.i.,
virus-infected cells treated with cycloheximide and harvested at 12 h p.i. (12C), and
virus-infected cells treated with aphidicolin and harvested at 18 hr p.i. (18A). P is the
probe by itself. Size markers are labeled to the right of the panel in bp. The arrowhead
indicates the location of the predominant protected fiagment of 620 bps.

69
LdMNPV- and vAchPS-infected cells (Figure 9, arrowhead). This corresponded to the

polyadenylation signal identified 34 bps downstream of the hrf-I ORF (Thiem et al.,
1 996).

Since hrf-I transcription in vAchPD-infected Ld652Y cells also initiated at the
TCAGT motif as mapped by primer extension (Figure 8C, arrowhead), it was
hypothesized that the larger size of about 2 kb, as detected by Northern blot analysis
(Figure 7B, 11, arrowhead), was due to transcription through the normal termination site
as a result of the truncation of the ~3'-end of hrf-I . The predicted termination site was near
the polyadenylation signal at the end of ORF 603 located downstream of hrf-I (Figure
6C). To test this hypothesis, A primer near the hrf-I transcription start site TCAGT and a
primer adjacent to the ORF 603 polyadenylation signal (Figure 6C) were used for RT-
PCR analysis using total RNA isolated from vAchPD-infected Ld652Y cells. RNA
from mock-, or vAchPS-infected Ld652Y cells and DNA from the transfer plasmid,
pAcUWLdPD, used to generate vAchPD were used as controls. A 1.8 kb PCR product
was obtained in the reaction that contained cDNA generated from total RNA of
vAchPD-infected cells at 6 h p.i. (Figure 10, lane 4) and in the reaction which
contained DNA fi'om the transfer plasmid pAcUWLdPD (Figure 10, lane 5) but not in the
reactions that contained cDNA generated from either mock-infected cells or vAchPS-
infected cells (Figure 10, lane 1-3). These data are consistent with the 2 kb transcript
detected by Northern analysis (Figure 7B, 11, arrowhead) when polyadenylation is
accounted for and support the hypothesis that the larger hrf-I transcripts observed in

vAchPD-infected cells are the result of transcriptional read-through.

70

12345

1919?me

0.6—

 

Figure 10. RT-PCR Mapping of 3'-End of hrf-I Transcripts in vAchPD-Infected
Ld652Y Cells Numbers on the top represent cDNA generated from total RNA isolated
from mock-infected cells (1), vAchPS-infected cells at 6 (2) and 24 (3) h p.i.,
vAchPD-infected cells at 6 h p.i. (4), and DNA from the transfer plasmid pAcUWLdPD

(5). DNA size markers are indicated to the left of the panel in kb.

71
Inf-1 Upstream Sequence

Because the second hrf-I primer extension product in LdMNPV-infected cells
was mapped beyond the previously sequenced region, additional hrf-I upstream sequence
was obtained (Figure 11). The second primer extension product was mapped to 211 bps
upstream of the hrf-I translation start codon and did not correspond to any previously
identified initiation sequences. However, two copies of a putative baculovirus early gene
regulatory element a/cthTGTnc/t (Tomalski et al., 1988) were found in this region. One
was located 209 bps the other 130 bps upstream of the htf-I translation initiation codon
(Figure 11, double underlined sequence). The distal copy also matched another
baculovirus early regulatory motif CGT with the consensus AA/TCGTG/T (Dickson and
Friesen, 1991; Nissen and Friesen, 1989) (Figure 11, asterisks). A transcription activation
factor NF-l binding motif, TGGCGG (Caruso et al., 1990), and a transforming growth
factor 131 (TFG-Bl) inhibitory element (TIE) GNNTTGGTGA (Kerr et al., 1990) motif
were found 250 bps and 218 bps upstream of the hrf-I coding sequence respectively
(Figure 11).

HRF-l Expression

To investigate HRF-l expression in LdMNPV- and in recombinant AcMNPV- .
infected Ld652Y cells, a HRF-l-MBP fusion protein was synthesized by cloning the
SalI-DraI fragment (Figure 6A) into a bacterial protein expression plasmid pMAL-c2
(New England Biolabs) and used to raise antibodies. Because the predicted size of I-[RF-l
(25.7 kDa) was very close to that of polyhedrin (29 kDa), SF-21 cells infected with
AcMNPV and harvested at 24 h p.i. were used as an additional control. Proteins from

mock-, LdMNPV-, vAchPS-, or vAchPD-infected Ld652Y cells harvested at different

72

01111
1 mmrrcmcacan-ccaccccaceaccGemcaecaccarcarcwcrc

 

NF-l
61 ATTTTTTGTTTCGTTCTA TTGG TCGTGTTCATTTTGGTGTTTGTCAATCGA
TIE W PStI

121 CGCGGTAGGCAAAGCCCGARAGCGGCCGAACGCGCGCCGCCGCCGCTGCAGCGTGTGIII
I———> _..____.
181 CTGTACTTGCAATTGCGACCCGTGTCAGTACACGCCAGCGCACAGTGCGGAGCGAACGCG
241 ACCAGCGCCGCGCAGCGAGACGAATATCGATTCATTTTATTTAGCGCGCGCCGACGACCI
301 IOGGCATGGACGCCGAGTTTTTCGTGGACGGCGAACGCGIGGICIOCEICIIOICCICCG

SalI
361 GGCGGTGGTCCGCCATCGTCGAC

 

Figure 11. Sequence of hrf-I upstream region 240 bps nucleotide sequence upstream
and 80 bps nucleotide sequence downstream the hrf-I start codon are shown. Selected
restriction sites are labeled. The two transcription start sites are indicated by arrows.
GTGT motifs are double underlined. The CGT motif is indicated by asterisks underneath.
The TIE consensus sequence and the NF-l binding sequence are boxed. The stop codon
of vefORF (TAA) and the start codon of hrf-I (ATG) are in bold. The sequence of the
primer used for primer extension analysis is in bold and underlined with an arrow
indicating direction.

73
times p.i. and from AcMNPV-infected SF-21 cells were separated by SDS-PAGE

(Laemmli, 197 8) and stained with Coomassie blue or transferred to membranes (Towbin
et al., 1979) and incubated with antibodies against the I-IRF-l fusion protein (Figure 12).
In vAchPS-infected Ld652Y cells, I-IRF-l was detected from 6 h p.i. until 48 h p.i.
(Figure 12B, arrowhead). These bands appeared in a lower position than the polyhedrin
protein band on the Coomassie blue stained gel (Figure 12A, arrow) and no proteins were
detected by antisera in the lane containing AcMNPV-infected SF -21 cell lysate (Figure
123) indicating that these bands represented HRF -1 and not polyhedrin. In vAchPD-
infected Ld652Y cells, a weak band was detected fiom 12 h p.i. until late times (Figure
12C, arrowhead). In other experiments, we observed this band as early as 6 h p.i. (Data
not shown). This band most likely represented I-[RF -1 because the size was the same as
that of the HRF—l control and it was not observed in the mock-infected cells. Other bands
were apparently nonspecific due to overloading of protein samples since all of them also
appeared in mock-infected cells. We were unable to detect HRF -1 in LdMNPV-infected
Ld652Y cells (Data not shown).
Discussion

In this study, we demonstrated that LdMNPV hif—I was sufficient to promote
AcMNPV replication in Ld652Y cells. Virus production of vAchPD—infected Ld652Y
cells in which hrf-I was controlled by its own promoter was the same as that of
vAchPS-infected Ld652Y cells in which hIf-I was overexpressed and which also
canied another LdMNPV gene, firs. hrf-I expression was differentially regulated in
LdMNPV, vAchPS, and vAchPD. Transcript size and temporal expression of hif-I

depended on the viral context of the gene. In LdMNPV- and vAchPS-infected Ld652Y

74

A B C

”1461218244841: FHMS12182448AC FNPSM612182448

216.8-

110.8-
71.5-

43.8-

c— M
«ms-r 27"

18.2-
15.5—

   

Figure 12. Western Blot Analysis of HRF-l Expression in Recombinant AcMNPV-
Infected Ld652Y Cells A: Coomassie stained parallel gel of vAchPS-infected Ld652Y
cells; B: Western blots of vAchPS-infected Ld652Y cells; C: vAchPD-infected
Ld652Y cells. Lane labeled M indicates mock-infected Ld652Y cells. Arabic numbers
above the lanes indicate the time, in hours, after infection that the cells were harvested.
Lane F indicates HRF-l fusion protein (60.6 kDa). H indicates truncated I-IRF-l portion
(SaII-DraI) (20.6 kDa) cleaved from the fusion protein. Ac represents AcMNPV-infected
SF-21 cells harvested at 24 h p.i. PS represents vAchPS—infected Ld652Y cells
harvested at 24 h p.i. Lane MW is the molecular weight standards with molecular weights
in kDa indicated to the left of panels A and C. The position of the polyhedrin protein
band is indicated by arrows. HRF -1 bands are indicated by arrowheads.

 

75
cells transcripts were approximately 1 kb, as compared to 2 kb in vAchPD-infected

Ld652Y cells. Abundant 1.2 kb transcripts originated fi‘om the synthetic late promoters in
vAchPS. The 1 kb transcript was consistent with the size of HIRF -1 predicted by
nucleotide sequence (Thiem et al., 1996) and observed on Western blots (Figure 12). The
larger transcripts observed in vAchPD-infected cells resulted from transcription through
the normal termination site. The 3'-end region truncated in vAchPD was important for
termination of hrf-I transcription. Larger transcripts observed in LdMNPV-infected cells
most likely represented transcripts of the gene immediately upstream, vef, that extended
through hrf-I, since no protected 3' fragments larger than those corresponding to the
polyadenylation signal following the hrf-I ORF were observed (Figure 9). Overlapping
transcripts with common 3' ends are often observed in baculovirus infections (F riesen and
Miller, 1986). It was also possible that the second primer extension product observed in
LdMNPV (Figure 8A, arrow) was of premature termination of cDNA synthesis from vef
mRNA due to possible mRNA secondary structure.

Transcriptional regulation of hif-I and responses to the inhibitors cycloheximide
and aphidicolin differed between LdMNPV-and recombinant AcMNPV-infected Ld652Y
cells. hrf-I transcription was not observed until 12 h p.i. and was inhibited in the
presence of cycloheximide in LdMNPV-infected Ld652Y cells, indicating a dependence
on new protein synthesis. In recombinant AcMNPV-infected cells hrf-I was transcribed
at early times (6 h p.i.) and in the presence of cycloheximide. Since late baculovirus
gene expression is contingent on the onset of viral DNA replication, aphidicolin, a DNA
synthesis inhibitor, can be used to distinguish early and late genes. When infected cells

were treated with aphidicolin, hrf-I was not transcribed in recombinant AcMNPV-

76

infected cells. This inconsistency of responses to aphidicolin was also observed in
transcription of other early genes, the dnapol gene (Tomalski et al., 1988), lef-I
(Passarelli and Miller, 1993), and [cf-6 (Passarelli and Miller, 1994). The reason for the
inconsistency is not known.

A possible explanation for the difference in temporal regulation of hrf-I
transcription in recombinant AcMNPV- and LdMNPV-infected Ld652Y cells is the
absence of potential regulatory sequences upstream of hrf-I in the recombinant
AcMNPVs. The delayed expression in LdMNPV-infected cells suggests that these
upstream sequences might serve as binding sites for transcriptional repressors in
LdMNPV infected cells. Both recombinant AcMNPVs were constructed using the PstI
restriction site upstream of the hrf-I ORF (Figure 6). Several putative regulatory motifs
upstream of the PstI site (Figure 11) could be important for controlling hrf-I expression.
A GTGT motif, of unknown function, previously identified in the AcMNPV DNA
polymerase gene (Tomalski et al., 1988),ie-1 (Guarino and Summers, 1987), p35 and
p94 (Friesen and Miller, 1987), and ed (Crawford and Miller, 1988), was present in two
copies. One of these motifs also matched a CGT motif (Dickson and Friesen, 1991;
Nissen and Friesen, 1989) that was required for full p35 promoter activity during the
early phase of infection (Dickson and Friesen, 1991). This motif was also present in other
early baculovirus genes including 39K (Guarino and Summers, 1986), ie-I (Guarino and
Summers, 1987), and ets and etl (Crawford and Miller, 1988). Two regulatory sequences
previously identified in vertebrate systems were also found in this region. One was a

binding site for a nuclear factor belonging to the NF-l family of transcription factors,

77
TGGCGG, that was identified in an enhancer of a polyoma virus mutant selected for high

efficiency of growth in neuroblastoma cells (Caruso et al., 1990). The other was a
transforming growth factor-Bl (TGF-Bl) inhibitory response element (TIE),
GNNTTGGTGA (Kerr et al., 1990), which firnctions as a transcription silencer for genes
regulated by TGF-Bl. Possible roles for these motifs or other upstream sequences in the
regulation of hrf-I transcription remains to be determined.

Alternatively, the requirement for de nova protein synthesis for htf-I transcription
in LdMNPV-infected cells may reflect a fundamental difference in the regulation of
LdMNPV gene expression as compared to AcMNPV. Additional factors might be
required for transcriptional activation of delayed early genes in LdMNPV-infected cells.
For example, there are different requirements for new protein synthesis for
transcriptional regulation of the ecdysteroid UDP-glucosyltransferase (egt) gene in
LdMNPV- and AcMNPV-infected cells. Transcription of the LdMNPV egt gene in
LdMNPV-infected Ld652Y cells required de nova protein synthesis (Riegel et al., 1994),
but the AcMNPV egt gene was expressed immediately after infection without prior
protein synthesis in AcMNPV-infected SF-21 cells (O'Reilly and Miller, 1989). Both
virus production and temporal patterns of LdMNPV gene expression in Ld652Y cells are
delayed relative to AcMNPV gene expression in SF-21 cells (J. Slavicek, personal
communication). These differences most likely reflect differences in the virus rather
than the host cell, since the temporal appearance of ie-I, ie-n, p39 (capsid), and polh
transcripts are similar in AcMNPV-infected Ld652Y and TN368 cells (Guzo et al.,
1992). Furthermore, in Ld652Y cells infected with AcMNPV recombinants bearing hrf-I

the temporal expression of virus proteins (Thiem. et al., 1996) and the appearance of viral

78
progeny are identical to AcMNPV-infected SF—21 cells.

hrf-I was expressed at a low level fiom its natural promoter. In order to detect

hrf-I transcripts on Northern blots it was necessary to use large quantities of polyA-RNA.

I-IRF-l could be detected as early as 6 h p.i. in vAchPS- or vAchPD-infected Ld652Y

cells, but only when protein samples equivalent to 1 x 106 cells per lane were loaded. In
vAchPS-infected Ld652Y cells, abundant HRF-l detected from 12 h p.i. until 48 h p.i.
can be attributed to expression from the two synthetic late promoters. However, we were
not able to detect HRF-l expression in LdMNPV-infected Ld652Y cells. The inability to
detect HRF-l in LdMNPV-infected Ld652Y cells may be due to limited sensitivity for
low level expression in our assay. It is also possible that HRF-l was not translated in
LdMNPV-infected Ld652Y cells. Work is in progress to disrupt hrf-I in LdMNPV and
investigate its role in LdMNPV replication on Ld652Y cells.

In AcMNPV-infected Ld652Y cells both viral and host protein synthesis is shut
off at late times p.i. (Du and Thiem, submitted; Guzo et al., 1992; McClintock et al.,
1986). hrf-l is a novel gene isolated from LdMNPV which replicates in Ld652Y cells
that can relieve the block for protein synthesis and ensure production of AcMNPV
progeny in Ld652Y cells (Thiem et al., 1996). No motifs have been found in hrf-I
nucleotide or amino acid sequence that may imply hrf-I's function. Examination of hrf-I
expression in LdMNPV- and recombinant AcMNPV-infected Ld652Y cells suggested
that only low levels of expression are required for its function. Understanding how hif-I
functions are important for understanding the host-specificity of baculoviruses. The

mechanism responsible for shutting off protein synthesis in AcMNPV-infected Ld652Y

79

cells and the function of hrf-l in overcoming the protein synthesis shut down in
AcMNPV-infected Ld652Y cells are currently being investigated.
Acknowledgments

We thank Jim Slavicek for providing LdMNPV virus, Dwight Lynn for the IPLB-
Ld652Y cell line, Lois Miller for vSynVI-gal and Bob Possee for pAcUWZB. We are
particularly grateful to Neal Dittrner for constructing vAchPD and Steven Cassar for
technical assistance. We also thank Jim Slavicek, Rebecca Grumet, and Ke Dong for
critical reading of the manuscript.

This work was supported by Public Health Service Grant GM 48608 from the

National Institute of General Medical Sciences to S. M. T.

CHAPTER 4

Responses of Insect Cells to Baculovirus Infection: Protein Synthesis Shut Down
and Apoptosis

Xianlin Du1 and Suzanne M. Thiem1:2,3a4*

Department of Microbiology1 and Entomologyz, Program in Genetics3, and Pesticide

Research Center4
Michigan State University
East Lansing, Michigan 48824-1115

This work has been submitted to J. Virol.

80

8 1
Abstract

Protein synthesis is globally shut down at late times post infection in the
baculovirus AcMNPV-infected gypsy moth cell line Ld652Y. A single gene hrjf-I from
another baculovirus LdMNPV is able to preclude the protein synthesis shut down and
ensure production of AcMNPV progeny in Ld652Y cells (Thiem, S. M., X. Du, M. M.
Quentin, and M. M. Bemer, 1996. J. Virol. 70:2221-2229; Du, X., and S. M. Thiem,
1997. Virology 227:420-430). AcMNPV contains a potent apoptotic supressor gene p35
and protein synthesis shut down was reported in apoptotic insect cells induced by
infection with AcMNPV lacking p35. In exploring the fimction of HRF-l and the
possible connection between apoptosis and protein synthesis shut down, a series of
recombinant AcMNPVs with different compliments of p35 and hrf-I were constructed
and employed in apoptosis and protein synthesis assays. We found that P35 was
translated prior to protein synthesis shut down and functioned to prevent apoptosis. HRF-
1 prevented protein synthesis shut down even when the cells were undergoing apoptosis
but I-IRF-l could not firnctionally substitute for P35. The DNA synthesis inhibitor,

aphidicolin, could block both apoptosis and protein synthesis shut down in Ld652Y cells

induced by p35- AcMNPVs but not protein synthesis shut down in wt AcMNPV-infected
Ld652Y cells. These data suggest that protein synthesis shut down and apoptosis are
separate responses of Ld652Y cells to AcMNPV infection and that P35 is involved in
inducing aprotein synthesis shut down response in Ld652Y cells in the absence of late
viral gene expression. A model was developed for these responses of Ld652Y cells to

AcMNPV infection.

82
Introduction

Autographa califarnica nucleopolyhedrovirus (AcMNPV) is a large DNA
containing virus that belongs to the family Baculoviridae. It is a model virus for studying
the molecular biology of baculoviruses. AcMNPV has a relatively wide host range
compared to most other baculoviruses with the ability to replicate in at least 33 species of
insect larvae in 10 families (Groner, 1986) as well as more than 25 different insect cell
lines (Hink, 1979; Hink and Hall, 1989). However, it is not able to replicate in gypsy
moth cell line Ld652Y (Goodwin et al., 1978; McClintock et al., 1986; Morris and
Miller, 1992; 1993). When AcMNPV infects Ld652Y cells, virus can enter the cell, both
viral and host cellular mRNAs are transcribed and are of normal size (Guzo et al., 1992;
Morris and Miller, 1992; 1993) but both viral and host cellular protein synthesis is shut
down at late times post infection (p.i.) and no viral progeny are produced (Guzo et al.,
1992; McClintock et al., 1986). A single early gene, hrjll, in Lymantria dispar
nucleopolyhedrovirus (LdMNPV) precludes protein synthesis shutoff and promotes
AcMNPV replication in Ld652Y cells (Du and Thiem, 1997; Thiem et al., 1996). hrf-I
encodes a novel 25.7 kDa protein that has no characteristic motifs that may imply how
hrf-I assists AcMNPV replication in Ld652Y cells (Thiem et al., 1996).

AcMNPV contains an antiapoptotic gene, p35 (Clem et al., 1991; Hershberger et
al., 1992). The product of the early gene p35 is required for AcMNPV replication in
Spadaptera frugiperda cell line SF-21. AcMNPV lacking p35 induces extensive
apoptosis in SF-21 cells and an arrest of protein synthesis was reported in the apoptotic
SF-21 cells (Clem and Miller, 1993; Birnbamn et al., 1994). Apoptosis is characterized

by plasma membrane blebbing and degradation of chromosomal DNA into

83
oligonucleosome—sized DNA fragments (Hale et al., 1996). Apoptosis dramatically

reduces AcMNPV budded virus production and completely eliminates AcMNPV
occluded virus formation in SF-21 cells and thus is considered to be an effective host
defense response against viral infection (Clem and Miller, 1993. Hershberger et al.,
1992). P35 functions by inhibiting the ICE-like proteases, caspase, activity and thus
preventing caspase-induced apoptosis (Bertin et al., 1996; Bump et al., 1995; LaCount
and Friesen, 1997; Xue and Horvitz, 1995). This is a central, highly conserved step in the
apoptotic pathway (Hale et al., 1996) and p35 functions in a wide variety of organisms
including Drosophila (Hay et al., 1994; White et al., 1996), Caenarhabditis elegans
(Sugimoto et al., 1994; Xue and Horvitz, 1995), and mammalian cells (Beidler et al.,
1995; Martinou et al., 1995; Rabizadeh et al., 1993). However, P35 is not always
effective, even in insect cell lines. P35 did not prevent apoptosis in AcMNPV-infected
Cf-203 cells, although expression of P35 was detected (Palli et al., 1996). AcMNPV-
infected SL2 cells also undergo apoptosis suggesting that p35 is either not expressed or
not active in this cell line (Chej anovsky and Gershburg, 1995). A second type of
apoptotic suppressor gene, inhibitor of apoptosis (iap), has been identified in the
baculovims Cydia pamanella granulovirus (CpGV) (Cp-iap) and Orgyia pseudatsugata
M nucleopolyhedrovirus (OpMNPV) (Op-iap) that can substitute for p35 to prevent
apoptosis in a genetic complementation assay in which replacement of p35 with iap
prevented apoptosis (Birnbaum et al., 1994; Crook et al., 1993). P35 and IAP do not
share any homology in either nucleotide or amino acid sequence (Crook et al., 1993;
Friesen and Miller, 1987). It is believed that IAP functions upstream of P35 in the

apoptotic pathway.

84

Shut off of host gene expression is normally observed in permissive AcMNPV
infections. A decline in the steady-state levels of host mRNAs begins approximately 12 h
p.i. (Ooi and Miller, 1988). Host protein synthesis declines from 18 h p.i. and is
completely shut off by 24 h p.i. (Carstens et al., 1979; Dobos and Cochran, 1980). The
viral gene product which mediates this host shutoff has not been identified. The protein
synthesis shut down in AcMNPV-infected Ld652Y cells, however, was global, earlier (12
h p.i. versus 18 h p.i.) (Guzo et al., 1992), and occurred in the absence of decline of either
host or viral mRNA synthesis (Cuzo et al., 1992; Morris and Miller, 1992, 1993). These
distinctions suggested that protein synthesis shut down in AcMNPV-infected Ld652Y
cells was a cellular response to viral infection.

In exploring the mechanism by which the protein synthesis is shut down and the
function of HRF -1 in precluding the protein synthesis inhibition in AcMNPV-infected
Ld652Y cells, we initially considered two possibilities. One was that protein synthesis
shut down may be a part of the apoptosis response of Ld652Y cells and hf] encodes
another apoptotic suppressor. The other was that protein synthesis shut down and
apoptosis might be two separate responses of Ld652Y cells to AcMNPV infection. When
we examined AcMNPV-infected Ld652Y cells for hallmarks of apoptosis none were
observed. The absence of apoptosis supports the second hypothesis. However, it was
possible that P35 prevented apoptosis in AcMNPV-infected Ld652Y cells. The goal of
this study was to determine the relationship between these two responses by investigating
the roles of AcMNPV P35 and LdMNPV HRF-l in controlling apoptosis and protein
synthesis shut down. Here we present data that support the hypothesis that protein

synthesis shut down and apoptosis are separate responses of Ld652Y cells to AcMNPV

85
infection. Our data also suggest that P35 induces a protein synthesis shut down response

in the absence of DNA replication and late viral gene expression in Ld652Y cells.
Materials and Methods

Cells and Viruses

SF -21 cells (Vaughn et al., 1977) and Ld652Y cells (Goodwin et al., 1978) were
maintained in TC100 medium (Life Technologies, Grand Island, NY) supplemented with
10% fetal bovine serum and 0.26% tryptose broth. AcMNPV variant Ll (Lee and Miller,
197 8) and the recombinant AcMNPV, vAc/hrf-l [previously designated vAchPD (Du
and Thiem, 1997)] were propagated in SF-21 cells. All p35 deletion recombinant
AcMNPVs were propagated in TN368 cells (Hink, 1970). The recombinant AcMNPVs,
vAp35 [previously designated vA35K (Hershberger et al., 1992; LaCount and F riesen,
1997)] (Figure 14) , which lacked p35 and vA35K/lacZ (Figure 14) (Hershberger et al.,
1992), in which p35 was deleted and the polyhedrin gene was replaced by LacZ were
obtained from Paul Friesen (University of Wisconsin, Madison). To construct a
recombinant AcMNPV lacking p35 but carrying hrf-I, DNA fiom a transfer plasmid
containing hrf-I, pAcUWLdPD (Du and Thiem, 1997), and from vA35K/lacZ, were
cotransfected into TN368 cells (Hink, 1970), using lipofectin (F legner et al., 1987;
O'Reilly et al., 1992), to generate vAp35/hrf-1 (Figure 14). To construct a recombinant
AcMNPV lacking p35 but carrying a truncated hrf-I ORF, DNA of pAcUWLdPD was
cut at the SaII site located in the first one third portion of hrf-I coding region, blunt-ended
by mung bean nuclease, and religated with T4 DNA ligase. A stop codon was introduced

in the resulting plasmid pAcUWPDstop near the original SaII site. DNA from

86
pAcUWPDstop and DNA from vA35K/lacZ, were cotransfected into TN368 cells using

lipofectin to generate vAp35/hrf-1stop (Figure 14). In both cases, white occlusion positive
viruses were selected and plaque purified. Correct insertion was confirmed by DNA
restriction pattern and Southern blot analyses of the recombinant viruses.
Western Bot Analysis

Ld652Y cells and SF -21 control cells were infected with AcMNPV at multiplicity
of infection (MOI) of 10 plaque forming units (PFU) per cell. After 1 h adsorption,
inoculum was removed and cells were fed with complete medium. Time 0 was defined as
the time when incubation at 27°C was initiated. Mock-infected cells were treated in the
same way except that incomplete medium was used as inoculum and cells were harvested
at 48 h p.i. AcMNPV-infected Ld652Y and SF-21 cells were harvested at 6, 12, 24, and
48 h p.i. Samples preparation and Western blot analysis were done as previously

described (Du and Thiem, 1997; Thiem et al., 1996). An amount of protein equivalent to

approximately 5 X 105 cells was loaded per lane. Polyclonal antibodies against P35,
ap35-NF (Hershberger et al., 1994) were used at the dilution of 125000.
Apoptosis Test

Ld652Y cells and SF-21 cells were infected with AcMNPV, vAp35, or vAp35/hrf-
1 at an MOI of 10. Uninfected SF -21 and Ld652Y cells were treated with actinomycin D
as a control. Actinomycin D was added to the medium at a concentration of 1pg/ml after
virus inoculum was removed. Infected or treated cells were observed for morphological
changes and harvested at 12, 24, and 36 h p.i. Total DNA was isolated,

electrophoretically separated in 1.2% agarose gels in the presence of RNase A, and

87
stained with ethidium bromide (Clem et al., 1991).

Protein Synthesis Labeling Assay

Ld652Y cells were infected at an MOI of 10 with AcMNPV, vAp35, vAp35/hrf-1,
vAp3 5/hrf-lstop, or vAc/hrf-l (Du and Thiem, 1997). For aphidicolin treatment, Ld652Y
cells were pretreated with 5 pg/ml of aphidicolin (Sigma, St. Louis, MO) in DMSO 1 h
before the addition of inoculum and infected cells were incubated in medium containing 5

p g/ml of aphidicolin throughout the time course. Mock- or virus-infected cells were

labeled with 35S methionine (1000Ci/mMol, Dupont NEN, Wilmington, DE) for 4 hour
periods 0-4, 12-16, and 24-28 h p.i. At the beginning of each time period, the medium

was removed and 0.5 ml methionine flee medium was added to each 35 mm plate

followed by addition of 35S methionine. Cells were collected at the end of each labeling
period and disrupted in 2X protein sample buffer (125mM Tris-HCl pH 6.8, 4% SDS,
10% 2-mercaptoethanol, 20% glycerol and 0.002% bromophenol blue). For those
infected cells that were undergoing extensive apoptosis at 24-28 h p.i., small floating I
vesicles (apoptotic bodies) were collected by gentle centrifugation (500g, 5 min) and
resuspended in 0.5 ml methionine flee medium and returned to the plates for labeling.
Proteins were resolved in 10% SDS-PAGE (Laemmli, 1970) and the gel was stained with
Coomassie blue to confirm the equality of loading before autoradiography.
RT-PCR

Ld652Y cells were infected at an MOI of 10 with vAp35/hrf-l, or vAc/hrf-l (Du

and Thiem, 1997) in the presence or absence of aphidicolin and harvested at 6 and 24 h

p.i. Aphidicolin treatment was performed in the same way as described above. Total

88
RNA was isolated by a single step method (Chomczynski and Sacchi, 1987). Twenty pg

of total RNA was used to synthesize cDNA with Oligo(dT) primer (Promega, Madison,
WI) and M-MLV reverse transcriptase (Life Technologies, Bethesda, MD). These cDNA
products were then used for PCR. PCR was performed 25 cycles (94°C 1 min, 55°C 50
sec, and 72°C 3 min) using two synthetic Inf-1 specific primers (Michigan State
University Macromolecular Structure, Sequencing, and Synthesis Facility, East Lansing,
MI), CAGCGAGACGAATATCGA near the 5'-end and CGATACAAACCAAACGCA
near the 3'-end of hrf-I transcript (Du and Thiem, 1997). PCR product was resolved in
1% agarose gel together with DNA size markers and stained with ethidium bromide.
Results

P35 Was Expressed Prior to Global Protein Synthesis Shut Down in AcMNPV-
Infected Ld652Y Cells '

In preliminary experiments we did not observe apoptosis in AcMNPV-infected
Ld652Y cells prior to or following protein synthesis shut down. Since AcMNPV encodes
a potent apoptotic suppressor P35, the absence of apoptosis implied that AcMNPV P35
might function to prevent apoptosis. However, no evidence was available that any viral
gene was translated in AcMNPV-infected Ld652Y cells. To determine if P35 might
prevent apoptosis in AcMNPV-infected Ld652Y cells, we first determined if P35 was
translated prior to protein synthesis shut down. Ld652Y cells and SF-21 control cells
were infected with AcMNPV and cell lysates were subjected to Western blot analysis
with polyclonal antibody against P35. We detected P35 protein in both SF-21 and
Ld652Y cells infected with AcMNPV flom 6 h p.i. until 48 h p.i. (Figure 13)

demonstrating that P35 was translated in AcMNPV-infected Ld652Y cells prior to global

89

SF—21 Ld652Y

 

I 11 j
M6122448M6122448

-mo “‘9' P35

Figure 13. Western Blot Analysis of P35 Expression in AcMNPV-Infected SF-21 and
Ld652Y Cells Cell types are indicated on the top of the panel. Arabic numbers above the
lanes indicate the time (in hours) after infection that cells were harvested. M represents
mock-infected cells. Size markers are shown to the left of the panel in kD. Protein P35
(arrow) is indicated to the right.

90

protein. synthesis shut down. This is the first direct evidence to show a viral gene was
translated in AcMNPV-infected Ld652Y cells prior to global arrest of protein synthesis.
P35 Prevented Apoptosis and HRF-l Could Not Functionally Substitute For P35
We next determined if P35 was functional in AcMNPV-infected Ld652Y cells
and if HRF-l could functionally substitute for P35. If P35 prevented apoptosis, Ld652Y
cells infected with AcMNPV lacking p35 would undergo apoptosis as do SF -21 cells
(Clem et al., 1991; Hershberger et al., 1992). If HRF -1 could functionally substitute for
P35, cells infected with AcMNPV lacking p35 but carrying hlf-I would not undergo
apoptosis. To test this hypothesis, we obtained a p35 minus AcMNPV, Ap35 (Figure 14,
b) (Hershberger et al., 1992), and constructed a recombinant AcMNPV lacking p35 but
carrying hrf-I, Ap35/hrf-1 (Figure 14, c). Ld652Y cells and SF-21 control cells were
infected with wt AcMNPV, Ap35, or Ap35/hrf-l. Mock-infected cells and actinomycin D
treated cells were used as additional‘controls. Infected or treated cells were observed for
morphological changes and DNA was isolated to determine the presence of DNA
flagrnentation ladders. We observed typical apoptotic plasma membrane blebbing
beginning flom 12 h p.i. in both SF-21 and Ld652Y cells infected with vAp35 or
vAp3 5/hrf-1 and in actinomycin D treated cells but not in wt AcMNPV-infected or mock-
infected cells (Data not shown). Total DNA isolated flom cells displaying plasma
membrane blebbing showed typical DNA flagrnentation ladders on agarose gels (Figure
15). These data indicated that P35 prevented apoptosis in AcMNPV-infected Ld652Y
cells (Figure 15B, lanes 4-6) and HRF-l could not substitute for p35 to prevent apoptosis

in either SF-21 (Figure 15A, lanes 10-12) or Ld652Y cells (Figure 15B, lanes 10-12).

91

  
 
 

 

 

a. AcMNPV

 

 

b.vAp35

 

 

 

 

 

e.vAclhr1-1

 

 

Figure 14. Schematic Diagram Showing the Viruses Used in Apoptosis and Protein
Synthesis Assays The positions and orientations of ORFs are indicated by arrows.
Deletion of p35 gene was indicated by indentation line. Truncation of hrf-I ORF was
indicated by blank arrow.

92

M ActD Ac vAp35 vAp35/ M ActD Ac vAp35 vAp35l
hit-1 hit-1
+ - - p35 + - - p35
- - + hrf-1 - - + hrf-i

I_II—II—I I—I
ababcabcabc

2072
-1 500 ‘2072
-1 500
-600
-600
400
400

   

123456789101112 123456789101112

Figure 15. Agarose Gel Showing DNA Fragmentation in SF-21 and Ld652Y Cells A:
SF-21 cells infected with wt AcMNPV, vAp35, vAp3 S/hrf-l; B: Ld652Y cells infected
with wt AcMNPV, vAp35, vAp35/hrf-1. Viruses with or without p35 or htf-I were
indicated by "+" or "-" at the top of the panels. Mock-infected cells, 1; Actinomycin D
treated cells, 2-3; Wt AcMNPV—infected cells, 4-6; vAp35-infected cells, 7-9;
vAp35/hrf-1-infected cells, 10-12. a = 12 h p.i or p.t.; b = 24 h p.i. or p.t.; c = 36 h p.i.
100 bp size markers are shown in bp to the right of each panel.

93

HRF-l Prevented Protein Synthesis Shut Down Even When Ld652Y Cells Were
Undergoing Apoptosis

In order to investigate the roles of P35 and HRF-l in controlling protein synthesis
shut down, we examined protein synthesis in Ld652Y cells infected with recombinant
AcMNPVs carrying different compliments of p35 and hrf-I (Figure 14). Another
recombinant AcMNPV, vAp35/hrf-lstop (Figure 14, d), carrying a truncated hrf-I ORF
but not p35 was constructed and employed in protein synthesis assays in infected

Ld652Y cells as an additional control for HRF-l function. Protein synthesis in mock- or

virus-infected Ld652Y cells was monitored by 35S methionine labeling (Figure 16). We
found that protein synthesis was shut down at 12-16 h p.i. in Ld652Y cells infected with
wt AcMNPV, carrying p35 but not hrf-I, (Figure 16, compare lanes 4 and 5). In Ld652Y
cells infected with vAp35, carrying neither p35 nor hrf-I, protein synthesis shut down
was also observed but delayed since a limited amount of protein synthesis occurred 12-16
h p.i. followed by an arrest by 24-28 h p.i. (Figure 16, lanes 8 and 9). In Ld652Y cells
infected with vAp3 5/hrf-1, carrying hrf-I but not p35, protein synthesis shut down was
not observed although the protein synthesis ability was reduced at 24-28 h p.i. (Figure
16, lanes 11 and 12). In Ld652Y cells infected with vAp35/hrf-lstop, carrying a truncated
hrf-I ORF but not p35, protein synthesis shut down was observed and was delayed as in
vAp35-infected Ld652Y cells (Figure 16, lanes 14 and 15; compare with lanes 8 and 9).
In Ld652Y cells infected with vAc/hrf-l, carrying both p35 and hrf-I , global protein
synthesis arrest was not observed as several proteins, presumably viral, were abundantly
synthesized (Figure 16, lanes 17 and 18). These data demonstrated that HRF-l prevented

protein synthesis shut down even when cells were undergoing apoptosis. The reduction of

94

Mock Ac vAp35 vAp35/ vAp35/ vAc/
hrf-t hrt-tstop hrf-t

+ - - + + p35
- - + + + rm. 1
i

           

,, -217

-111

-72

-44

- Kg .: 48
‘—

12 3 4 5 6 7 8 9101112131415161718

Figure 16. Pulse Labeling Analysis of Protein Synthesis in Ld652Y Cells Infected
with Wt or Recombinant AcMNPVs Ld652Y cells were infected with vAp35,
vAp35/hrf-l, vAp35/hrf-lstop, and vAc/hrf-l. Viruses with or without p35 or hif-I were
indicated by "+" or "-" at the top of the panel. Mock-infected cells, 1-3; Wt AcMNPV-
infected cells, 4-6; vAp35-infected cells, 7-9; vAp35/hrf-1-infected cells, 10-12;
vAp35/hrf-1 stop-infected cells, 13-15; vAc/hrf- 1 -infected cells, 16-1 8. Labeling time
periods are indicated by lower case letters. a: 0-4 h p.i.; b: 12-16 h p.i.; c: 24—28 h p.i.
Size markers are shown in kD to the left of the panel.

95
protein synthesis ability at very late times (24-28 h p.i.) in vAp35/hrf-1-infected Ld652Y

cells (Figure 16, lane 12) may be due to the apoptotic cell death of some cells at this very
late phase of apoptosis. By 24-28 h p.i., almost all cells had disintegrated into small
apoptotic bodies. Some of the cells may have already died. Most apoptotic bodies did not
take up the dye trypan blue (data not shown) and displayed translation ability (Figure 16,
lane 12). Protein synthesis was shut down in vAp35/hrf-1stop-infected Ld652Y cells
containing a truncated hrf-I ORF (Figure 16, lanes 14 and 15) confirming the role of
HRF-l in preventing protein synthesis shut down.
Effects of Aphidicolin On Apoptosis and Protein Synthesis Shut Down

The DNA synthesis inhibitor aphidicolin has been used to distinguish early and

late gene expressions, since late but not early gene expression of baculovirus depends on

DNA replication. Aphidicolin blocks apoptosis in SF-21 cells induced by p35' AcMNPV
infections (Clem and Miller, 1994) indicating that apoptosis involves late events.
However, aphidicolin did not block protein synthesis shut down in AcMNPV-infected
Ld652Y cells (Guzo et al., 1992). This suggested that aphidicolin could be used to
discriminate between apoptosis and protein synthesis shut down. In order to separate the
roles of HRF-l and P35 in these responses, Ld652Y cells were infected with AcMNPV,
vAp35, vAp35/hrf-1, and vAc/hrf-l in the presence of aphidicolin. Apoptosis was

determined by observing morphological changes of the infected cells and protein
synthesis was monitored by 35S methionine labeling. We found that aphidicolin blocked

apoptosis in Ld652Y cells induced by p35- AcMNPV infections as it did in SF-21 cells

(Clem and Miller, 1994). Protein synthesis shut down in wt AcMNPV-infected Ld652Y

96
cells was not blocked by aphidicolin but was much delayed (Figure 17, lanes 5-6;

compare with Figure 16, lanes 5-6). In contrast, protein synthesis shut down did not occur
in any p35- AcMNPV (vAp35 and vAp35/hrf-1) -infected Ld652Y cells (Figure 17, lanes
7-12). The ability of aphidicolin to block p35- AcMNPV-induced protein synthesis shut

down suggested that the protein synthesis shut down response in p35- AcMNPV-infected
Ld652Y cells involved DNA replication or DNA replication dependent late gene
expression. In contrast, protein synthesis shut down appeared to be an early event in wt
AcMNPV-infected Ld652Y cells since aphidicolin did not block protein synthesis shut
down. The~ only difference between wt AcMNPV and vAp35 was the presence or absence
of p35 . These data implied the existence of two pathways that led to protein synthesis
shut down, one involving late events and another that is independent of late events that
involves P35 as an inducer.
hrf-I Was Transcribed at Very Low Levels in the Presence of Aphidicolin

Protein synthesis shut down was not observed in vAc/hrf-l-infected Ld652Y cells
in the presence of aphidicolin (Figure 17, lanes 12-15). This indicated that HRF-l
prevented protein synthesis arrest (Figure 17, compare lanes 5 and 6 with 14 and 15).
However, previous studies employing Northern blot analysis failed to detect hrf-I
transcription in vAc/hrf-l-infected Ld652Y cells in the presence of aphidicolin (Du and
Thiem, 1997). We hypothesized that hrf-I was expressed at a very low level in the
presence of aphidicolin and this limited expression of HRF-l was sufficient to prevent
protein synthesis shut down induced by P35. To test this hypothesis, a more sensitive

method, RT-PCR using hif-I specific primers was employed to detect hrf-I

97

Mock Ac vAp35 vAp35/ vAc/

hit-1 hrf-1
+ - - + p35
- - - + + hrf-i

I—fiI—fir—IF—Ir—fi
abcabcabcabcabc

' o

 

12 3 4 5 6 7 8 9101112131415

Figure 17. Pulse Labeling Analysis of Protein Synthesis in Ld652Y Cells Infected
with Wt or Recombinant AcMNPVs in the Presence of Aphidicolin Ld652Y cells
were infected with AcMNPV, vAp35, vAp35/hrf-1, and vAc/hrf-l-infected Ld652Y cells
in the presence of aphidicolin. Viruses with or without p35 or hif-I were indicated by "+"
or "-" at the top of the panel. Mock-infected cells, 1-3; Wt AcMNPV-infected cells, 4-6;
vAp35-infected cells, 7-9; vAp35/hrf-l-infected cells, 10-12; vAc/hrf-l-infected cells, 13-
15. Labeling time periods are indicated by lower case letters. a: 0-4 h p.i.; b: 12-16 h p.i.;
c: 24-28 h p.i. Size markers are shown in kD to the left of the panel.

98
transcription in vAc/hrf-l-infected Ld652Y cells in the presence of aphidicolin. We

detected hrf-I specific RT-PCR product in both vA35K/hrf-l and vAc/hrf-l-infected
Ld652Y cells in the presence of aphidicolin (Figure 18).
Discussion

The roles of P35 and HRF-l in controlling apoptosis and protein synthesis shut
down in AcMNPV-infected Ld652Y cells were investigated. Our data support the
hypothesis that protein synthesis shut down and apoptosis are separate responses of
Ld652Y cells to AcWPV infection. In addition, our data suggest that P35 is involved
in a second pathway leading to protein synthesis shut down in AcMNPV-infected
Ld652Y cells. These conclusions are based on the following observations: 1) P35 was
translated and prevented apoptosis but protein synthesis was still shut down; 2) HRF -1
prevented protein synthesis shut down even when the cells were undergoing apoptosis but

it could not substitute for P35 to prevent apoptosis; 3) Aphidicolin blocked apoptosis and

protein synthesis shut down in all p35. AcMNPV infections but not protein synthesis shut
down in wt AcMNPV-infected Ld652Y cells.

Both apoptosis and protein synthesis shut down appear to be common responses
of insect cells to baculovirus infections. AcMNPV lacking p35 induces apoptosis in BmN
cells (Clem et al., 1991) and a functional homologous p35 was identified in Bambyx
mari nucleopolyhedrovirus (BmNPV) (Kamita et al., 1993). wt AcMNPV induces
apoptosis in Cf-203 and SL2 cells where P35 is either not functional or not expressed
(Chejanovsky and Gershburg, 1995; Palli et al., 1996). Many DNA viruses cany genes

involved in blocking cellular apoptosis (Teodoro and Branton, 1997). The pathways of

99

 

Figure 18. RT-PCR Analysis of hrf-I Transcription in vp35/hrf-l- or vAc/hrf-l-
infected Ld652Y Cells in the Presence of Aphidicolin Ld652Y cells were infected with
vAp35/hrf-1- or vAc/hrf-l in the presence of aphidicolin. cDNA was generated from total
RNA isolated flom mock-infected cells (lane 1), vAp35/hrf-1-infected cells in the absence
of aphidicolin at 24 h p.i. (lane 2), vAc/hrf-l-infected cells in the absence of aphidicolin
at 24 h p.i. (lane 3), vAp35/hrf-1-infected Ld652Y cells in the presence of aphidicolin at 6
(lane 4) and 24 (lane 5) h p.i., vAc/hrf-l-infected cells in the presence of aphidicolin at 6
(lane 6) and 24 (lane 7) h p.i. DNA size markers are indicated to the left of the panel in
kb.

100

apoptosis induction in these virus-infected cells are different but all converge at the
activation of caspase (Teodoro and Branton, 1997). For example, adenovirus ElA
induces apoptosis through a p53-dependent mechanism which is prevented by the
adenovirus BIB-19K (Debbas and White, 1993; Lowe and Ruley, 1993; Rao et al., 1992).
E1B-19K also protects cells against apoptosis stimulated by tumor necrosis factor alpha
or anti-Fas antibody (Gooding et al., 1991; Hashimoto et al., 1991; White et al., 1992).
The AcMNPV transactivator [E-l is sufficient to induce apoptosis in SF-21 cells
(Prikod'ko and Miller, 1996). However, IE—l does not appear to be the sole factor since
aphidicolin, which blocks DNA replication and DNA replication dependent viral late
gene expression but not IE-l expression, blocks induction of apoptosis (Clem and Miller,
1994; this study), indicating a late event is involved in the induction of apoptosis.
Experiments using temperature sensitive DNA replication mutants showed that DNA
replication or DNA replication dependent late gene expression was not essential for
induction but was required for full development of an apoptotic response (LaCount and
Friesen, 1997).

Protein synthesis shut down was also observed in other nonpermissive AcMNPV
infections in addition to AcMNPV-infected Ld652Y cells. AcMNPV induces dramatic
attenuation of protein synthesis by 5 h p.i. and a complete shut down of protein synthesis
by 24 h p.i. in BmN cells (Kamita and Maeda, 1993). Transcription of mRNA in
AcMNPV-infected BmN cells is apparently normal (Kamita and Maeda, 1993). Protein
synthesis arrest is induced by the putative helicase gene p143 of AcMNPV (Kamita and
Maeda, 1993). Replacing a small region of the AcMNPV p143 with BmNPV

homologous sequence prevents protein synthesis shut down (Croizier et al., 1993; Maeda,

101

et al., 1993). Another example of protein synthesis shut down in baculovirus-infected
insect cells involves host cell-specific factor 1 (hcf-I) (Lu and Miller, 1995; 1996). hcf-I
is not required for AcMNPV replication in SF—21 cells but replication of hcf-I null
mutant in T richaplisa ni cell line TN368 (Hink, 1970) is impaired (Lu and Miller, 1996).
Complete shut down of protein synthesis is observed by 18 h p.i. together with defects in
viral DNA replication and late gene transcription (Lu and Miller, 1996). The mechanism
of protein synthesis shut down in either case is not known. Limited work has been
conducted to investigate the inducer of protein synthesis shut down in AcMNPV-infected
Ld652Y cells (Guzo et al., 1991). A compound desigated macromolecular synthesis
inhibition factor (MSIF) was found in the media in AcMNPV-infected Ld652Y cells that
induced protein synthesis arrest in noninfected cells (Guzo et al., 1991). It was postulated
that this compound was the AclVflNIPV GP64 glycoprotein or a component of GP64
(Guzo et al., 1991). However, this hypothesis has not been confirmed.

Our observations on protein synthesis shut down and apoptosis in AcMNPV-
infected Ld652Y cells led us to develop a model of the responses of Ld652Y cells to
AcMNPV infection (Figure 19). Since protein synthesis shut down and apoptosis
appeared to be separate responses, two separate pathways were hypothesized. The
specific inducers of both protein synthesis shut down and apoptosis have not been
resolved. Although two inducers are shown in our model, we don't exclude the possibility
that these two responses share the same inducer (11 = 12) or that these two responses
converge upstream of the pathways (X1 = X2). The apoptosis pathway leads to activation

of caspase. This pathway can be blocked by the early gene product P35 which

102

Figure 19. Diagram Showing a Model of the Responses of Ld652Y Cells to
AcMNPV-Infection DNA replication is the point to determine early and late gene
expression. Both P35 and HRF-l are early gene products that are expressed prior to DNA
replication. Apoptosis is induced by an unidentified inducer through a mediator X1 and
the activation of caspase. P35 blocks apoptosis pathway be preventing activation of
caspase (Bump et al., 1995; Xue and Horvitz, 1995). An undefined inducer 12 triggers
protein synthesis shut down through mediator X2 and an undefined process Y. Both these
two pathways require DNA replication dependent late gene expression and thus can be
blocked by DNA synthesis inhibitor aphidicolin. A second signal transduction pathway is
induced by P35 that leads to protein synthesis shut down. This pathway does not involve
late events and is not blocked by aphidicolin. Both protein synthesis shut down pathways
can be blocked by HRF-l by an unknown mechanism. ‘

103

8:8...— >mz=e< a are.
fine...— 5 828.3. Ce see: . «5325 same: .2 2am...—

 

_§en 3.5
$8593

538..

 

£8~men<

 

 

 

nauseous—no one» 83 ll

 

 

 

 

 

 

11 85—30

 

 

—
_

E

 

883:5. <2:

E

 

4/W
\?

 

 

 

 

 

 

TE
mm.—

=

 

IV . nemwmeumxo one» 3.5%

 

104
specifically acts on caspase. The protein synthesis shut down pathway operates through

an undefined mediator Y. This pathway can be blocked by I-IRF-l but not P35. Both
apoptosis and protein synthesis shut down pathways in p35‘ AcMNPV-infected Ld652Y
cells involve DNA replication or DNA replication dependent late gene expression. A
second protein synthesis shut down response induced by P35 that does not involve late
events was hypothesized. This second protein synthesis shut down response can also be
blocked by HRF -1. These two protein synthesis shut down pathways appear to act
synergistically. When both pathways were induced, protein synthesis shut down was
more extensive and rapid (Figure 16, lanes 4 and 5) than when either one was blocked
. (Figure 16, lanes 8 and 9; Figure 17, lanes 5 and 6).

Protein synthesis shut down is a common strategy employed by many host cells
against viral infection (Hershey, 1991). Most of these systems involve an inactivation of a
conserved component of translation apparatus. Viruses in turn have evolved methods to
overcome this cullular defense (Hershey, 1991). In prokaryotes, protein synthesis shut
down was overved in some phage exclusions which involve cleavage of the components
of the translation apparatus, EF-Tu (Y u and Snyder, 1994) or tRNAlys (Levitz et al.,
1990). Plants activate enzymes in response to virus infection that depurinate 28S RNA
thereby inactivating the ribosome and thus inhibiting protein synthesis (Endo and
Ysurugi, 1987). In herpes simplex virus 1 (HSV-l), protein synthesis is shut down after
the expression of or genes in neuronal cells infected with a 734.5 minus mutant HSV-l
but not wt HSV-l (Chou and Roizrnan, 1992, 1994). 7,345 gene of HSV-1 is able to

preclude the protein synthesis inhibition in HSV-l-infected neuronal cells (Chou and

105
Roizrnan, 1992, 1994). This global protein synthesis shut down reponse of host cells

against viral infection is distinct flom that of viral host shutoff firnction of HSV-1
mediated by the virion vhs protein (Poon and Roizrnan, 1997). The best undestood
mecharnins of protein synthesis shut down are those mediated by interferon in mammals
and other vertebrates (Lengyel, 1982; Samuel, 1991). Interferon mediated protein
synthesis shut down includes inactivation of eukaryotic initiation factor 2 or subunit (eIF-
2a) through phosphorylation by dsRNA dependent protein kinase PKR (Chernajovslcy et
al., 1979), degradation of mRNA through activation of RNase L (Farrel et al., 1978;
Hovanessian et al., 1977; Zillberstein et al., 1978), or degradation of CCA terminus of
tRNA by 2'-5' phosphodiesterase (Schmidt et al., 1978). It is likely that global protein
synthesis shut down observed in AcMNPV-infected Ld652Y cells is due to inactivation
of a component of the protein synthesis machinery and I-IRF-l functions to prevent this
occurrence. Studies are in progress to analyze the protein synthesis defect in AcMNPV-
infected Ld652Y cells and to determine how HRF-l firnctions to overcomes the block in
protein synthesis. Continuing studies to elucidate these mechanisms will provide insight
into the nature of the responses of Ld652Y cells against AcMNPV infection.
Acknowledgments

We thank Paul Friesen for providing the viruses vAp35 and vAp35/lacZ, and the
antibody against P35. We also thank Steven Cassar for constructing vAp3 5/hrf-1stop This
work was supported by Public Health Service grant GM48608 flom the National Institute

of General Medical Sciences to S.M.T.

CHAPTER 5

Investigation of the Defect in Protein Synthesis in Autographa califarnica
Nucleopolyhedrovirus-Infected Ld652Y Cells

Xianlin Du1 and Suzanne M. Thiemlrzr3r4
Department of Microbiology1 and Entomologyz, Program in Genetics3, and Pesticide
Research Center4

Michigan State University
East Lansing, Michigan 48824-1115

This work is in preparation for publication.

106

107
, Abstract

Global protein synthesis arrest is observed in AcMNPV-infected Ld652Y cells at
late times post infection (p.i.) in the presence of apparently normal mRNAs. A cell-flee
translation system was established flom cytoplasmic lysate of insect cells and in vitro
translation assays were carried out to identify the defect in protein synthesis in AcMNPV-
infected Ld652Y cells. Lysate derived flom AcMNPV-infected Ld652Y cells at late
times p.i. did not display in vitro translation ability but its translation ability could be
restored by addition of lysate derived flom mock-infected cells. The lysate flom mock-
infected Ld652Y cells was then flactionated and each flaction was tested for its rescue
ability. The ribosomal flaction but not the supernatant flaction could rescue; total RNA
isolated from mock- or AcMNPV-infected Ld652Y cells at early times but not late times
p.i. could rescue; total uncharged tRNA flom both calf and yeast but not E. coli could
rescue. However, no significant decrease in total tRN A adaptor ability was found in
AcMNPV-infected Ld652Y cells at late times p.i. compared to mock- or AcMNPV-
infected Ld652Y cells at early times p.i. These data suggest that the defect in protein
synthesis in AcMNPV-infected Ld652Y cells lies in a single or a small group of tRNA
species. The same in vitro translation assays were applied to other nonpermissive
AcMNPV infections in which protein synthesis shut down was also observed. Our data
suggest that a common mechanism of protein synthesis shut down is shared in AcMNPV-
infected Ld652Y and BmN cells.

Introduction
Autographa califarnica nucleopolyhedrovirus (AcMNPV) is a member of the

family Baculoviridae, a large family of double-stranded DNA-containing viruses that

108

primarily infect insects. AcMNPV serves as a model virus for the study of molecular
biology of baculoviruses and has been developed into effective eukaryotic protein
expression vectors (Luckow and Summers, 1988; Miller, 1988;.O’Reilly et al., 1992) as
well as biological pesticides (Bishop, 1989; Wood and Granados, 1991). AcMNPV has a
wider host range than most other baculoviruses. AcMNPV is able to replicate in insect
larvae of at least 33 species in 10 families (Groner, 1986) and in more than 25 different
insect cell lines (Hink, 1979; Hink and Hall, 1989). In addition, it can infect at least 26
different insect cell lines in a semipermissive manner (Possee et al., 1993). One of these
sernipermissive cell lines, Ld652Y derived flom gypsy moth, displays a novel virus-host
interaction when infected with AcMNPV (Du and Thiem, 1997; Du and Thiem,
submitted; Guzo et al., 1992; McClintock etal., 1986; 1987; Thiem et al., 1996). When
AcMNPV infects Ld652Y cells, virus can enter the cells, viral DNA is replicated
(McClintock et al., 1986; Morris and Miller, 1992), both viral and host mRNAs are
transcribed, transported, and are of normal size (Guzo et al, 1992; Morris and Miller,
1993). However, both viral and host cellular protein synthesis is shut down at late times
post infection (p.i.) and no viral progeny is produced (Du and Thiem, submitted; Guzo et
al., 1992; McClintock et al., 1986). A single gene, host range factor 1 (hrf-I) was
identified and characterized in Lymantria dispar nucleopolyhedrovirus (LdMNPV) that is
able to preclude the protein synthesis shut down and ensure the production of AcMNPV
progeny (Du and Thiem, 1997; Thiem et al., 1996). Our previous studies have shown that
HRF -1 most likely functions directly on the translation system to maintain the protein
synthesis ability (Du and Thiem, submitted).

Protein synthesis shut down is also observed in. AcMNPV-infected nonpermissive

109 _
cells of other insect species. In AcMNPV-infected BmN cells derived flom Bambyx mari,

infected cells exhibited atypical cytopathic effect (CPR) and protein synthesis was
dramatically attenuated by 5 h p.i. and completely shut down by 24 h p.i. in the presence
of apparently normal mRNA (Kamita and Maeda, 1993). This inhibition was induced by
the putative helicase gene of AcMNPV, p143, and precluded by the homologous helicase
gene in Bambyx mari nucleopolyhedrovirus (BmNPV) (Croizer et al., 1994; Kamita and
Maeda, 1993; Maeda et al., 1993). Another gene involved in protein synthesis shut down
response is the host cell specific factor 1 (hcf-I) of AcMNPV (Lu and Miller, 1995;
1996). AcMNPV hcf-I is not required for AcMNPV replication in Spadapterafiugiperda
cell line SF-21 but hcf-I' AcMNPV replication in TN368 cells derived flom Trichaplusia
ni (Hink, 1970) is greatly impaired (Lu and Miller, 1996). A complete shut down of both
viral and host protein synthesis is observed by 18 h p.i. (Lu and Miller, 1996). However,
other defects including DNA replication and late gene transcription are also observed in
hcf-I' AcMNPV—infected TN368 cells (Lu and Miller, 1996). The mechanisms of protein
synthesis shut down remain unkown.

Protein synthesis arrest is a common strategy of cells against a variety of stimuli
including viral infection in many other systems (Hershey, 1991; Schneider and Shenk,
1987). Cell-flee translation assays have proved to be a very effective way to investigate
the protein synthesis control in virus-infected host cells. For example, cell-flee translation
lysates prepared flom vaccinia virus-infected mouse L cells were employed in
identification of a Pl/eIF kinase inhibitor, encoded by vaccinia virus E3L gene (Chang et
al., 1992). Translation assays employing flactionated lysates prepared flom uninfected or

mengovirus-infected mouse L cells provided evidence of the presence of an inhibitor in

110

the ribosomes of mengovirus-infected mouse L cells (Pensiero and Lucas-Lenard, 1985).
Cell lysates prepared flom E. coli cells also contributed to the discovery that elongation
factor EF-Tu cleavage was responsible for T4 phage exclusion (Y u and Snyder, 1994).
Protein synthesis shut down in AcMNPV-infected Ld652Y cells in the presence of
apparently normal mRNA suggested that the block was at translational level. Towards the
goal of elucidating the mechanism by which protein synthesis is shut down and the
function of HRF-l in precluding the translation inhibition, we established a cell-flee
translation system flom insect cells and investigated the defect of protein synthesis in
AcMNPV-infected Ld652Y cells by a series of in vitro translation rescue assays. Our data
suggest that the defect in protein synthesis in AcMNPV-infected Ld652Y cells is at tRN A
and that a common mechanism of protein synthesis shut down is shared in AcMNPV-
infected Ld652Y and BmN cells.
Materials and Methods

Cells and Viruses

SF-21 cells (Vaughn et al., 1977), Ld652Y cells (Goodwin et al., 1978), TN368
Cells (Hink, 1970), and BmN cells were maintained in TC100 medium (Life
Technologies, Grand Island, NY) supplemented with 10% fetal bovine serum and 0.26%
tryptose broth. AcMNPV variant Ll (Lee and Miller, 1978) and hcf-I' AcMNPV (Lu and
Miller, 1996) obtained flom L. Miller (University of Georgia, Athen, GA) were
propagated in SF-21 cells.
Preparation of Cell-Free Translation Lysate

Ld652Y cells or BmN cells were infected with AcMNPV at a multiplicity of

infection (MOI) of 10 plaque formation units (PFU) per cell. TN368 cells were infected

l l 1
with hcf-I' AcMNPV at an MOI of 10 per cell. Mock-infected cells were treated in the

same way as virus infected except that incomplete medium was used as inoculum. Time
zero was defined as the time when the inoculum was removed and incubation at 27°C
was initiated. Virus-infected cells were harvested at 8, 12, 16, 20, and 28 h p.i. Mock-
infected cells were harvested at 20 h p.i. Cell-flee translation lysates were prepared as

described by Carroll and Lucas-Lenard (Carroll and Lucas-Lenard, 1993) with minor

modification. 4 X 107 mock- or virus-infected cells were collected in 50-ml conical tubes
and centrifuged at 500g for 3 min. The pellets were suspended in 12 ml ice-cold insect
PBS (pH 6.2) (O’Reilly et al., 1992), transferred to a 15-ml conical tube, and again
centrifuged for 2 min as above. The pellet was then suspended in 1 m1 of cold insect PBS,
transferred to a microfuge tube, and repelleted for 10 sec in the microfuge at 14,000g.
Cells were kept in PBS in less than 10 min in all above washing steps.

The cell pellet was resuspended in 1 ml lysolecithin lysis buffer (20 mM HEPES-
KOH, pH 7.4; 100 mM KAc; 2.2 mM MgAcz; 2 mM DTT). The final volume was about
1.5 ml and 15 pl of 100 X lysolecithin (10 mg/ml) (Sigma, St. Louis, MO) was added and
mixed by gentle pipetting. The cells were kept on ice for 50 sec (no longer than 1 min)
and centrifuged for 10 sec at 14,000g in the microfuge. The pellet was resuspended in 0.5
ml cell mix (25 mM I-IEPES-KOH, pH 7.4; 125 mM KAc; 2.8 mM MgAcz; 2.5 mM
DTT; 1.25 mM ATP; 0.25 mM GTP; 187 pg/ml creatine phosphokinase; 37.5 mM
creatine phosphate; 0.125 mM amino acid mixture minus methionine). The cells were
lysed by pipetting them 25 times with a P1000 followed by passing them through a 22-

gauge hypodermic needle attached to a 1 ml syringe 10 times. The lysed cells were left

l 12
on ice for 5 rrrin, after which they were centrifuged for 20 sec at 14,000g. The supernatant

was collected as cell-flee translation lysate.
Fractionation of Lysate

To flactionate lysate flom mock-infected Ld652Y cells, 0.5 ml of the lysate was
ultracentrifuged at 31,000 rpm on a Beckrnan SW41 rotor for 2.5 hours. The supernatant
was collected as ribosomal flee supernatant flaction. The pellet was resuspended in 0.5
ml cell mix as the ribosomal flaction.

Isolation of Total RNA

Mock- or corresponding virus-infected Ld652Y cells, BmN cells, or TN368 cells
described as above were harvested at 6, 12, and 24 h p.i. Total cellular RNAs were
isolated by a single step method (Chomczynski and Sacchi, 1987).

In Vitro Translation Assays '

The above lysate (20 pl) was used in in vitro translation assays to compose 80%
in the tatal reaction volume (25 pl). The final reaction contained 20 mM l-IEPES-KOH
(pH 7.4), 100 mM potassium acetate, 2.2 mM magnesium acetate, 2 mM DTT, 1 mM
ATP, 0.2 mM GTP, 150 pg/ml creatine phosphokinase; 30 mM creatine phosphate; 20
units RNase inhibitor; 0.1 mM amino acid mixture minus methionine, and 0.4 mCi/rnl 35S
methionine. For rescue assays with lysate flom mock-infected cells, 10 p1 of lysate flom
mock-infected cells was combined with 10 p1 of lysate flom virus-infected cells. For
rescue assays with flactions of mock-infected Ld652Y cells, 10 p1 of either supernatant
flaction or ribosomal flaction was combined with 10 pl of lysate flom AcMNPV-infected

Ld652Y cells prepared at 20 h p.i. In all other rescue assays with total RNA or tRNA, 20

1 13
pl lysate of virus-infected Ld652Y cells prepared at 20 h p.i. was used. Fifteen pg of total

RNA isolated flom mock- or virus-infected cells was used for total RNA rescue assays
and different amount of uncharged bulk tRNA (4, 8, 16, and 32 pg) flom calf liver, yeast,
or E. coli (Sigma, St. Louis, MO) was used for tRNA rescue assays. Endogenous mRNAs
were the templates for protein synthesis in all in vitro translation assays. Incubations were
carried out at 30 °C for 2 h after which 5 pl of the reactions was mixed with 20 pl 2 X
protein sample buffer (125 mM Tris-HCl, pH 6.8, 4% SDS, 10% 2-mercaptoethanol, 20%
glycerol, and 0.002% bromophenol blue) and analyzed in 10% SDS polyacrylamide gels
(Laemmli, 1970).
Examination of Total tRNA Adaptor Abilities

The adaptor abilities (amino acid acceptance abilities) of tRNA flom mock- and
AcMNPV-infected Ld652Y cells were determined according to Derwenskus and Sprinzl
(1986) with some modifications. Total RNAs flom mock- or AcMNPV-infected Ld652Y
cells at 6 or 24 h p.i. were first deacylated to eliminate endogenous aminoacyl-tRNA by
CuSO4 treatment (Derwenskus et al., 1984). tRNAs were then arrrinoacylated in 20 pl
buffer containing 50 mM HEPES (pH 7.6), 160 mM KCl, 1 mM ATP, 200 pM spermine,
2 mM MgC12, 50 pg/ml bovine serum albumin, 100 pM DTT, 35 pg total RNA, 20 pM
of l‘C labeled amino acid mixture containing 15 amino acids (Ala, Arg, Asp, Gly, Glu,
His, Ile, Leu, Lys, Phe, Pro, Ser, Thr, Tyr, Val) (ICN Pharmaceuticals Inc., Costa Mesa,
CA). After preincubation for 5 min at 37°C the arrrinoacylation reaction was started by
addition of 14 units of yeast crude aminoacyl-tRNA synthetase (Sigma, St. Louis, MO).

Aminoacylation reaction was performed at 37°C for 20 min after which samples were

114

precipitated with ethanol and the radioactivity retained measured by scintillation
counting. The abilities of tRNA to accept amino acids were determined by retained
radioactivities which was an indication of the amount of amino acids being charged to the
tRNA. As background control, a tube containing only labeled amino acid mixture were
performed in vitro aminoacylation together with the samples. The in vitro arninoacylation
experiments were repeated three times with three different batches of total RNA
preparation. The mean values were calculated and data were analyzed by standard t-test.
Results and Discussion

Establishment of Cell-Free Translation System from Insect Cells

To identify the translation defect in AcMNPV-infected Ld652Y cells, cell-flee
translation systems were established flom both mock- and AcMNPV-infected Ld652Y
cells at different times p.i. In vitro translation assays were canied out with these
cytoplasmic lysates and protein translation abilities were monitored by including 35 S
methionine in the in vitro translation reactions. The working hypothesis was that the
lysate derived flom mock-infected Ld652Y cells should display in vitro translation ability
andvthat flom AcMNPV-infected Ld652Y cells at late times p.i. when protein synthesis
has been shut down should not. Then we would try to combine the lysates flom both
mock- and AcMNPV-infected Ld652Y cells and monitor the in vitro translation abilities.
If the combined lysates displayed in vitro translation abilities, this may suggest a helper
factor in the lysate flom mock-infected Ld652Y cells; if the combined lysates did not
display in vitro translation abilities, this may suggest a inhibitor in the lysate flom
AcMNPV-infected Ld652Y cells at late times p.i. By flactionating the lysate flom either

mock- or AcMNPV-infected Ld652Y cells at late times p.i., and testing each flaction for

l 15
its rescue or inhibiting ability, we would be able to identify the helper factor(s) or

inhibitor(s). Lysate derived flom mock-infeCted Ld652Y cells and lysates derived flom
AcMNPV-infected Ld652Y cells at early times p.i. displayed in vitro translation abilities
(Figure 20, lanes 1 and 2). Lysates derived flom AcMNPV-infected Ld652Y cells at late
times p.i. beginning flom 12 h p.i. did not display in vitro translation abilities (Figure 20,
lanes 3-6). These observations were consistent with in vivo pulse labeling experiments
which showed protein synthesis in AclVflNPV-infected Ld652Y cells at early times p.i.
and protein synthesis arrest at 12-16 h p.i. (Du and Thiem, submitted; Guzo et al., 1992).
The different profiles of protein bands in the reactions of lysate flom mock- and
AcMNPV-infected Ld652Y cells presumably reflected the different composition of
mRNAs in these lysates.
In vitro Translation Rescue Assays

Lysates flom mock- and AcMNPV-infected Ld652Y cells at late times p.i. were
then combined and the in vitro translation abilities were tested. Addition of lysate flom
mock-infected Ld652Y cells restored the in vitro translation abilities of the lysates
derived flom AcMNPV-infected Ld652Y cells at late times p.i. (Figure 20, lanes 7-10).
To identify the putative helper factor(s) in the lysate derived flom mock-infected Ld652Y
cells, lysate flom mock-infected Ld652Y cells was flactionated by ultracentrifugation and
the resulting two flactions were tested for their rescue abilities. The ribosomal flaction
that that presumably contained mostly insoluble factors and the ribosomes was able to
rescue but the supernatant flaction which presumably contained mostly soluble factors
was not (Figure 21, lanes 4 and 5). Moreover, total RNA isolated flom mock- and

AcMNPV-infected Ld652Y cells at early times p.i. but not late times p.i. could rescue

116

Mock

+

lfiI
x No on
assessssss
2<<<<<<<<<

 

12345678910

Figure 20. Autoradiogram Showing In Vitro Translation Abilities of Lysates

From Mock- or AcMNPV-Infected Ld652Y Cells Protein size markers are indicated to
the left of the panel. Mock: lysate derived flom mock-infected cells; Ac8, Ac12, Acl6,
Ac20, and Ac28: lysates derived flom AcMNPV-infected Ld652Y cells at 8, 12, 16, 20,
and 28 h p.i.

117

111-

72-

28-

 

123456789

Figure 21. Autoradiogram Showing In Vitro Translation Rescue Abilities of Lysate
Fractions and Total RNA Protein size markers are indicated to the left of the panel.
Mock: lysate derived flom mock-infected Ld652Y cells; Ac: lysate derived from
AcMNPV-infected Ld652Y cells at 20 h p.i.; Mock sup.: supernatant flaction flom mock-
infected Ld652Y cells; Mock rib.: ribosomal flaction flom mock-infected Ld652Y cells;
Ac6 RNA, Ac12 RNA, and Ac24 RNA: total RNA isolated flom AcMNPV-infected
Ld652Y cells at 6, 12, and 24 h p.i.

118
(Figure 21, lanes 6-9).

Since protein synthesis in AcMNPV-infected Ld652Y cells is shut down in the
presence of apparently normal mRNA (Guzo et al., 1992; Morris and Miller, 1993), the
ability of total RNA to rescue implied a defect of either ribosomal RNA (rRNA), tRN A
or some of the RNA required for translation. Uncharged bulk tRNAs flom calf liver,
yeast and E. coli were tested for their rescue abilities. Both eukaryotic tRNAs either flom
calf liver or yeast could rescue the in vitro translation ability of lysate derived flom
AcMNPV-infected Ld652Y cells (Figure 22). The ability to rescue increased with the
increasing concentrations of tRNA. However, prokaryotic tRN A flom E. coli showed
only limited rescue ability at high concentration (Figure 22, lane 15). These data
suggested a defect in tRNA in protein synthesis in AcMNPV-infected Ld652Y cells. The
inability of prokaryotic tRNA to rescue may reflect an inability of eukaryotic and
prokaryotic tRN As to exchange for each other in the translation reactions.

Examination of the tRNA Adaptor Ability

The function of tRNA in protein synthesis is to cany cognate amino acids and
insert them into the elongating protein chains in response to the codon in the mRNA. To
fulfill this adaptor role, tRNA must be charged first with amino acids by the charging
system during which the cognate amino acid is attached to the tRNA at its 3’-end. Since
the tRNAs we used for rescue assays were uncharged, the charging system in AcMNPV-
infected Ld652Ycells must be normal, otherwise, the uncharged tRNA could not rescue.
Thus the defect most likely lies in the ability of tRNA flom AcMNPV-infected Ld652Y
cells to accept amino acids.

To investigate the tRNA adaptor ability in AcMNPV-infected Ld652Y cells, total

119

g Calf tR NA Yeast tRNA E. colitFiNA

5 + + +
x

8 a r. (JP/’1 AC A°

111-

 

6 7 8 9101112131415161718

Figure 22. Autoradiogram Showing In Vitro Translation Rescue Abilities of tRNA
Origin of tRNA is indicated at the top. Protein size markers are indicated to the left of the
panel. Slope indicates the increment of tRNA added (4, 8, 16, 32 pg). Mock: lysate

derived flom mock-infected Ld652Y cells; Ac: lysate derived flom AcMNPV-infected
Ld652Y cells at 20 h p.i.

120
RNA isolated from mock- and AcMNPV—infected Ld652Y cells at early and late time p.i.

were charged with ”C labeled amino acid mixture in vitro by crude yeast aminoacyl-
tRNA synthetase. The ability of the tRNA to accept amino acids was determined by the
amount of labeled amino acids coprecipitated with RNA. Triple experiments were
performed with different batches of total RNA and mean values were obtained. Data were
analyzed by the standard t-test. A slight decrease of total tRNA adaptor ability was found
in AcMNPV—infected Ld652Y cells at late time p.i. from that in mock- or AcMNPV-
infected Ld652Y cells at early time p.i. (Table 4). However, this decrease was not
significant from that in either mock- (p = 0.2610 > 0.05) or AcMNPV-infected Ld652Y
cells at early time p.i. (p = 0.2161 > 0.05). These data suggest that the defect is not
general but restricted to a single or a small group of tRNA species.

A Common Mechanism of Protein Synthesis Shut Down Appeared To Be Shared in
AcMNPV-Infected Ld652Y and BmN Cells

To determine whether protein synthesis shut down observed in different
nonpermissive AcMNPV infections shared a common mechanism, cell-free translation
lysates were prepared from mock- or AcMNPV-infected BmN cells and mock- or hcf-I'
AcMNPV-infected TN368 cells. In vitro cell-free translation assays were performed in
the same way as for AcMNPV-infected Ld652Y cells. In AcMNPV-infected BmN cells,
lysate from mock-infected BmN cells displayed in vitro translation ability (Figure 23,
lane 1). Lysate derived from AcMNPV-infected cells at 20 h p.i. was not translation
competent, however, its in vitro translation ability could be restored by addition of mock-
infected BmN cells (Figure 23, lanes 2 and 3). Total RNA isolated from mock-infected

BmN cells (Figure 23, lane 4) and bulk uncharged calf liver tRNA showed limited rescue

121

Table 4. tRNA Adaptor Abilities

 

 

 

tRNA Retained
Radioactivities (CPM)

Mock 3075.70 +l- 186.66

Ac6 3103.04 +/- 282.57

Ac20 2836.07 +/- 230.51

 

...
N

2

<
Z
a:
'25 is CalftRNA
O O
x 2 2 +
8 + + AC
2 g g g .4
111-
72-
44-
28-

 

1234567

Figure 23. Autoradiogram Showing In Vitro Translation Assays in AcMNPV-
Infected BmN Cells Mock: lysate from mock-infected BmN cells; Ac: lysate fi'om
AcMNPV-infected BmN cells prepared at 20 h p.i.; Mock RNA: total RNA isolated from
mock-infected BmN cells; Slopes indicate the increment of tRNA added (4, 8, 16, 32 pg).

123
abilities(Figure 23, lanes 5-7). These data suggested that the defect in protein synthesis in

AcMNPV-infected BmN cells is probably the same as that in AcMNPV-infected Ld652Y
cells. However, we do not know why we observed a reduced rescue ability of both total
RNA and tRNA in AcMNPV-infected BmN cells as compared to AcMNPV-infected
Ld652Y cells. This may indicate an involvement of another factor.

In hcf-I' AcMNPV-infected TN368 cells, however, although in vitro translation
ability of virus-infected cells could be restored by combining lysates from mock- and hcf-
1' AcMNPV-infected TN368 cells, it could not be restored by either total RNA of mock-
or virus-infected TN368 cells at early times p.i. or eukaryotic total tRNA (data not
shown). These data indicated that the mechanism for protein synthesis shut down in hcf-I '
AcMNPV-infectede652Y cells was different. This was not surprising since the response
in hcf-I’ AcMNPV-infected TN3 68 cells was quite different from that in AcMNPV-
infected Ld652Y and BmN cells. The block in hcf-I' AcMNPV-infected TN368 cells
involved defects in both DNA replication and late gene transcription in addition to
protein synthesis shut down (Lu and Miller, 1996). In AcMNPV-infected Ld652Y and
BmN cells, protein synthesis was shut down in the presence of apparently normal DNA
replication, and late gene transcription (Guzo et al., 1992; McClintock et al., 1986;
Morris and Miller, 1992; 1993).

Protein synthesis shut down has been reported in many systems as a strategy of
host cellular defense (Hershey, 1991; Schneider and Shenk, 1987). The best understood
mechanisms are those mediated by interferon in mammals and other vertebrates
(Lengyel, 1982; Samuel, 1991). Interferon is a class of small molecular weight proteins

synthesized and secreted in some cell types in mammals and other vertebrates in response

124 .
to viruses, as well as other stimuli (Lengyel, 1982). Interferon mediated protein synthesis

shut down includes three different pathways (Zilberstein et al., 1978; Farrel et al., 1978)
one of which is mediated by a 2’-5’ phosphodiesterase (Schmidt et al., 1978). This
enzyme degrades the CCA terminus of tRNA, resulting in minor tRNA deficiency and
thereby blocking protein synthesis elongation (Schmidt et al., 1978). This inhibition of
protein synthesis can be reversed by adding tRNA in cell-free translation system (Content
et al., 1975; Sen et al., 1975; Zilberstein et al., 1976; Weissenbach et al., 1977; Samuel,
1976; Mayr et al., 1977; Falcoff et al., 1978).

Our observation is very similar to that of 2’-5’ phosphodiesterase mediated
protein synthesis shut down induced by interferon. However, interferon has so far not
been reported in insects. We are currently trying to test whether the protein synthesis shut
down in AcMNPV-infected Ld652Y cells is due to the same damage in tRNA as in that
mediated by interferon. In the meantime, other possible damage in tRNA will be
examined through identifying the individual or small group of defective tRNA species in
AcMNPV-infected Ld652Y cells. HRF-l protein is also being prepared in order to test
its role in in vitro translation assays and in other functional assays. The fact that a same
mechanism may be shared in AcMNPV-infected cell lines of different species suggested
that a conserved host cellular defense response against viral infection has evolved in
insect.

Acknowledgments

We thank Lois Miller for providing hcf-I' AcMNPV virus and S. Maeda for BmN

cells. This work was supported by Public Health Service Grant GM 48608 from the

National Institute of General Medical Sciences to S. M. T.

LIST OF REFERENCES

LIST OF REFERENCES

Adams, J. R., and J. T. McClintock. 1991. Nuclear polyhedrosis viruses of insect, in
“Atlas of Invetebrate of viruses”. pp. 87-204. CRC Press, Boca Raton, FL.

Akkaraju, G. R., P. Whitaker-Dowling, J. S. Youngner, and R. Jagus. 1989. Vaccinia
specific kinase inhibitory factor prevents translational inhibition by double-stranded
RNA in rabbit reticulocyte lysate. J. Biol. Chem. 264: 10321-10325.

Altschul, S. F., W. Gish, W. Miller, E. W. Myers and D. J. Lipman. 1990. Basic local
alignment search tool. J. Molec. Biol. 215:403-410.

Ayres, M. D., S. C. Howard, J. Kuzio, M. Lopezfer, and R. D. Possee. 1994. The
complete DNA sequence of Autographa californica nuclear polyhedrosis virus.
Virology 202:586-605.

Bassemir, U., H. Miltenburger, and P. David. 1983. Morphogenesis of nuclear
polyhedrosis virus fiom Autographa californica in a cell line from Marnestra brassicae
(caggage moth). Cell Tissue Res. 228:587-595.

Beams, B., and M. D. Summers. 1989. Locaion and nucleotide sequence of the 25K
protein missing from baculovirus few polyhedra (FP) mutants. Virology 168:344-353.

Beidler, D. R., M. Tewari, P. D. Friesen, G. Poirier, and V. M. Dixit. 1995. The
baculovirus P35 protein inhibits Fas- and tumor necrosis factor-induced apoptosis. J.
Biol. Chem. 270:16526-16528.

Beniya, H., C. J. Funk, G. F. Rohrmann, and R. F. Weaver. 1996. Purification of a
virus-induced RNA polymerase from Autographa californica nuclear polyhedrosis
virus-infected Spodoptera fi'ugiperda cells that accurately initiates late and very late
transcription in vitro. Virology 216: 12-19.

Bertin, J., S. M. Mendrysa, D. J. LaCount, S. Guar, J. F. Krebs, R. C. Armstrong,
K. J. Tomaselli, and P. D. Friesen. 1996. Apoptotic suppression by baculovirus P35
involves cleavage by and inhibition of a virus-induced CED-3/ICE-like pretease. J.
Virol. 70:6251-6259.

125

126

Blrnbaum, M. J., R. J. Clem, and L. K. Miller. 1994. An apoptosis-inhibiting gene
from a nuclear polyhedrosis virus encoding a polypeptide with Cys/His sequence
motif. J. Virol. 68:2521-2528.

Bischoff, D. S. and J. M. Slavicek. 1995. Identification and characterization of an early
gene in the Lymantria dispar multinucleocapsid nuclear polyhedrosis virus. J. Gen.
Virol. 76: In Press.

Bischoff, D. S., and J. M. Slavicek. 1996. Characterization of the Lymantria dispar
nucleopolyhedrovirus 25k FP gene. J. Gen. Virol. In press.

Bishop, D. H. L. 1989. Control of insect pests by baculoviruses. In :concepts in Viral
Pathogenesis Volume III” (A. L. Notkins and M. B. A. Oldstone, Eds.), pp. 368-382.
Springer-Verlag, New York.

Bishop, D. H. L., P. F. Entwhistle, I. R. Cameron, C. J. Allen, and R. D. Possee.
1988. Field trials of genetically-engineered baculovirus insecticides, p. 143-179. In M.
Sussman, C. H. Collins, F. A. Skinner, and D. E. Stewart Tull (ed.), The release of
genetically-engineered miceooganisms. Academic Press, London, New York

Blissard, G. W., and G. F. Rohrmann. 1989. Location, sequence, transcriptional
mapping, and temporal expression of the gp64 envelope glycoprotein gene of the
Orgyia pseudotsugata multicapid nuclear polyhedrisos virus. Virology 170:537-555.

Blissard, G. W., and G. F. Rohrmann. 1990. Baculovirus diversity and molecular
biology. Annu. Rev. Entomol. 35:127-155.

Blissard, G. W., and J. R. Wenz. 1992. Baculovirus gp64 envelope glycoprotein is
sufficient to mediate pH-dependent membrane fusion. J. Virol. 66:6829-6835.

Blissard, G. W., P. H. Kogan, R. Wei, and G. F. Rohrmann. 1992. A synthetic early
promoter from a baculovirus: Roles of the TATA box and conserved start CAGT
sequence in basal levels of transcription. Virology 190:783-793.

Boise, L. H., M. Gonzalez-Garcia, C. E. Postema, L. Ding, T. Lindsten, L. A. Turka,
X. Mao, G. Nunez, and C. B. Thompson. 1993. bcl—x, a bcl—2-related gene that
functions as a dominant regulator of apoptotic cell death. Cell 74:597-608.

Braunagel, S. C., and M. D. Summers. 1994. Autographa californica nuclear
polyhedrosis virus, PDV, and ECV viral envelopes and nucleocapsids: structural
proteins, antigens, lipid and fatty acid profiles. Virology 202:315-328.

Braunagel, S. C., D. M. Elton, H. Ma, and M. D. Summers. 1996. Identification and
analysis of an Autograpoha californica nuclear polyhedrosis virus structural protein of
the occlusion-derived virus envelope: ODV-E56.

127

Bump, N. J., M. Hackett, M. Hugunin, S. Seshagiri, K. Brady, P. Chen, C. Ferenz, S.
Franklin, T. Ghayur, P. Li, P. Licari, J, Mankovich, L. Shi, A. H. Greenberg, L.
K. Miller, and W. W. Wong. 1995. Inhibition of ICE family proteases by baculovirus
antiapoptotic protein P35. Science 269: 1885-1888.

Burgess, S. 197 7. Molecular weights of Lepidopteran baculovirus DNAs: derivation by
electron microscopy. J. Gen. Virol. 37:501-510.

Carbonell, L. F., M. J. Klowden, and L. K. Miller. 1985. Baculovirus-mediated
expression of bacteral genes in dipteran and mammalian cells. J. Virol. 56:153-160.

Carroll, K., O. Elroy-Stein, B. Moss, and R. Jagus. 1993. Recombinant vaccinia virus
K3L gene product prevents activation of double-stranded RNA-dependent initiation
factor Zen-specific protein kinase. J. Biol. Chem. 268:12873-12842.

Carson, D. D., L. A. Guarino, and M. D. Summers. 1988. Functional mapping of an
AcNPV immediately early gene which argments expression of the ie-I trans-activated
39k gene. Virology 162:4-44-451.

Carson, D. D., M. D. Summers, and L. A. Guarino. 1991a. Molecular analysis of a
baculovirus regulatory gene. Virology 182:279—286.

Carson, D. D., M. D. Summers, and L. A. Guarino. 1991b. Transient expression of the
Autographa californica nuclear polyhedrosis virus immediate-early gene IE-N is
regulated by three viral elements. J. Virol. 65:945-951.

Carstens, E. B., A. L. Lu, and H. L. B. Chan. 1993. Sequence, transcriptional mapping,
and overexpression of p4 7, a baculovirus gene regulating late gene expression. J.
Virol. 67 :2513-2520.

Carstens, E. B., S. T. Tjia, and W. Doerfler. 1979. Infection of Spodopterafi-ugiperta
cells with Autographa californica nuclear polyhedrosis virus. 1. Synthesis of
intracellular proteins after virus infection. Virology 99:386-398.

Caruso, M., C. Iacobinl, C. Passananti, A. Felsani, and P. Amati. 1990. Protein
recognition sites in polyomavirus enhancer: formation of a novel site for NF-l factor

in an enhancer mutant and characterization of a site in the enhancer D domain. EMBO
J. 9:947-955.

Cassar, S., and S. M. Thiem. Relatedness of Lymantria dispar nucleopolyhedrovirus
fusolin gene among fusolin genes from two disparate virus families. Submitted.

128

Chang, H. W., J. C. Watson, and B. L. Jacobs. 1992. The E3L gene of vaccinia virus
encodes an inhibitor of interferon-induced, double-stranded RN A-dependent protein
kinase. Proc. Natl. Acad. Sci. USA 89:4825-4829.

Charlton, C. A., and L. E. Volkman. 1991. Sequential rearrangement and nuclear
polymerization of actin in baculovirus-infected Spodoptera fi'ugiperda cells. J. Virol.
65:1219-1227.

Chejanovsky, N., and E. Gershburg. 1995. The wild-type Autographa californica
nuclear polyhedrosis virus induces apopotosis of Spodoptera littotalis cells. Virology
209:519-525.

Chen, C-J., and S. M. Thiem. 1997. Differential infectivity of two Autographa
californica nucleopolyhedrovirus mutants on three permissive cell lines is the result of
lef-7 deletion. Virology 227:88-95.

Cherbas, L., and P. Cherbas. 1993. The arthropod initiator: the capsite consensus plays
an important role in transcription. Insect Biochem. Mol. Biol. 23:81-90.

Chernajovsky, Y., A. Kimchi, A. Schmidt, A. Zilberstein, and M. Revel. 1979.
Differential effects of two interferon-induced translational inhibitors on initiation of
protein synthesis. Eur. J. Biochem. 96:35-41.

Chisholm, G. E., and D. J. Henner. 1988. Multiple early transcripts and splicing of the
Autographa californica nuclear polyhedrosis virus IE-l gene, J. Virol. 62:3193-3200.

Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid
guanidiurn thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159.

Chou, J., and B. Roizman. 1992. The r,34.5 gene of herpes simplex virus 1 precludes
neuroblastoma cells fiom triggering total shutoff of protein synthesis characteristic of
programmed cell death in neuronal cells. Proc. Natl. Acad. Sci. USA 89:3266-3270.

Chou, J., and B. Roizman. 1994. Herpes simplex virus 1 r,34.5 gene function, which
blocks the host response to infection, maps in the homologous domain of the genes
expressed during growth arrest and DNA damage. Proc. Natl. Acad. Sci. USA
91 :5247-5251.

Chung, K. L., M. Brown, and P. Faulkner. 1980. Studies on the morphogenesis of
polyhedral inclusion bodies of a baculovirus Autographa californica nuclear
polyhedrosis virus. J. Gen. Virol. 46:335-348.

Clarence, C., E. E. Penhoet, and C. E. Samuel. 1976. A comparison of transfer RNA
from untreated and interferon-treated cells. Virology 74:262-264.

129

Cleary, M. L., S. D. Smith, and J. Sklar. 1986. Cloning and structural analysis of
cDNAs from bcl-Z and a hybrid bcl-Z/immunoglobulin transcript resulting from the
t( 14; l 8) translocation. Cell 47: 19-28.

Clem, R. J., J. M. Hardwick, and L. K. Miller. 1996. Anti-apoptotic genes of
baculoviruses. Cell Death Differ. 3:9-16.

Clem, R. J ., and L. K. Miller. 1993. Apoptosis reduces both the in vitro replication and
the in vivo infectivity of a baculovirus. J. Virol. 67:3730-3738.

Clem, R. J, and L. K. Miller. 1994, Control of programmed cell death by the
baculovirus genes p35 and iap. Mole. Cell. Biol. 14:5212-5222.

Clem, R. J., M. Fechheimer, and L. K. Miller. 1991. Prevention of apoptosis by a
baculovirus gene during infection of insect cells. Science 254:1388—1390.

Clewell, D. and D. Helinski. 1969. Supercoiled circular DNA protein complex in
Escherichia coli: purification and induced conversion to an open circular DNA form.
Proc. Natl. Acad. Sci. USA 62:1159-1166.

Cochran, M. A., and P. Faulkner. 1983. Locaion of homologous DNA sequences
interspersed at 5 regions in the baculovirus Autographa californica nuclear
polyhedrosis virus genome. J. Virol. 45:961-970.

Content, J., B. Lebleu, U. Nudel, A. Zilberstein, H. Berissi, and M. Revel. 1975.
Blocks in elongation and initiation of protein synthesis induced by interferon treatment
in mouse L cells. Eur. J. Biochem. 54:1-10.

Crawford, A. M., and L. K. Miller. 1988. Characterization of an early gene accelerating
expression of late genes of the baculovirus Autographa californica nuclear
polyhedrosis virus. J. Virol. 62:2773-2781.

Croizier, G., L. Croizier, O. Argaud, and D. Poudevigne. 1994. Extension of
Autographa californica nuclear plyhedrosis virus host range by interspecific
replacement of a short DNA sequence in the p143 helicase gene. Proc. Natl. Acad. Sci.
USA 91:48-52.

Crook, N. E., R. J. Clem, and L. K. Miller. 1993. An apoptosis-inhibiting baculovirus
gene with a zinc finger—like motif. J. Virol. 67:2168-2174.

Debbas, M., and E. White. 1993. Wild-type p53 mediates apopotosis by ElA, which is
inhibited by ElB. Genes Dev. 7:546-554.

Derwenskus, K.-H., and M. Sprinzl. 1986. Transfer ribonucleic acid populations in
concanavalin-A-stimulated bovine lymphocytes. Biochim.Biophys. 868:91-99.

130

Derwenskus, K.-H., W. Fischer, and M. Sprinzl. 1984. Isolation of tRNA isoacceptors
by affinity chromatography on immobilized bacterial elongation factor Tu. Anal.
Biochem. 136. 161- 167.

Devereux, J., P. Haeberli and O. Smithies. 1984. A comprehensive set of sequence
analysis programs for the VAX. Nucl. Acids Res. 12:387-395.

Dickson, J. A., and P. D. Friesen. 1991. Identification of upstream promoter elements
mediating early transcription from the 35,000-molecular—weight protein gene of
Autographa caliform'ca nuclear polyhedrosis virus. J. Virol. 65:4006-4016.

Dobos, P., and M. A. Cochran. 1980. Protein synthesis in cells infected by Autographa
calr'fornica nuclear polyhedrosis virus (AcNPV): the effect of cytosine arabinoside.
Virology 103:446-464.

Du, X., and S. M. Thiem. Unpublished data.

Du, X., and S. M. Thiem. 1997. Characterization of hrf-I expression in Lymantria
dispar nucleopolyhedrovirus- and recombinant Autogwpha californica
nucleopolyhedrovirus-infected IPLB-Ld652Y cells. Virology 227:420—430.

Du, X., and S. M. Thiem. Evidence for two independent responses of Ld652Y cells to
AcMNPV infection: protein synthesis shut down and apoptosis. Submitted.

Duchs, L. Y., M. S. Woods, and R. F. Weaver. 1983. Viral transcription during
Autographa californica nuclear polyhedrosis virus infecion: a novel RNA polymerase
induced in infected Spodopterafiugiperda cells. J. Virol. 43:641-646.

Endo, Y., K. Mitsui, M. Motizuki, and K. Tsurugi. 1987. The mechanism of action of
ricin and related toxic lectins on eukaryotic ribosones. J. Biol. Chem. 262:5908-5912.

Endo Y, and K. Ysurugi. 1987. RNA N-glycosidase activity of ricin A-chain. J. Biol.
Chem. 262:8128-8130.

Engelhard, E. K., L. N. W. Kam-Morgan, J. O. Washburn, and L. E. Volkman.
1994. The insect tracheal system: a conduit for the systemic spread of Autographa
californica M nuclear polyhedrsos virus. Proc. Natl. Acad. Sci. USA 91 :3224-3227.

Erlandson, M. A., J. Gordon, and E. B. Carstens. 1985. Size and map locations of
early transcription products on the Autographa californica nuclear polyhedrosis virus
genome. Virology 142:12-23.

Falcoff, R., E. Falcoff, J. Sanceau, J. A. Lewis. 1978. Influence of preincubation on the
development of the inhibition of protein synthesis in extracts fi'om interferon-treated
mouse L cells: action on tRNA. Virology 86:507-515.

131

Farrell, P. J., G. C. Sen, M. F. Dubois, L. Ratner, E. Slattery, and P. Lengyel. 1978.
Interferon action: two distinct pathways for inhibition of protein synthesis by double-
stranded RNA. Proc. Natl. Acad. Sci. USA 75:5893-5897.

Flegner, P., T. Gadek, M. Holm, R. Roman, H. Chan, M. Wenz, J. Northrop, G.
Ringold, and M. Danielson. 1987. Lipofection, a highly efficient lipid-mediated
DNA-transfection procedure. Proc. Natl. Acad. Sci. USA. 84:7413-7417.

Flipsen, J. T. M., J. W. M. Martens, M. M. Van Oers, J. M. Vlak, and J. W. M. Van
Lent. 1995. Passage of Autographa caliform'ca nuclear polyhedrosis virus through the
midgut epithelium of Spodoptera exigua larvae. Virology 208:328-335.

Furnace, A. J., D. W. Nebert, M. C. Hollander, J. D. Luethy, M. Papathanasiou, J.
Fargnoli, and N. J. Holbrook. 1989. Mammalian gene coordinately regulated by
growth arrest signals and DNA-damaging agents. Mol. Cell. Biol. 9:4196-4203.

Fraser, M. J. 1986. Ultrastructural observations of virion maturation in Autographa
californica nuclear polyhedrosis virus infected Spodoptera frugiperda cell cultures. J.
Ultrastruc. Mol. Struct. Res. 95:189-195.

Friesen, P. D., and L. K. Miller. 1985. Temporal regulation of baculovirus RNA:
overlapping early and late transcripts. J. Virol. 54:392—400.

Friesen, P. D., and L. K. Miller. 1986. The regulation of baculovirus gene expression.
Curr. Top. Microbial. Irnmunol. 131 :31-49.

Friesen, P. D., and L. K. Miller. 1987. Devergent transcription of early 35- and 94-
kilodalton protein genes encoded by the HindIII-K genome fragment of the
baculovirus Autographa californica nuclear polyhedrosis virus. J. Virol. 61 :2264-
2272. ‘

Fuchs, L. Y., M. S. Woods, and R. F. Weaver. 1983. Viral transcription during
Autographa califomica nuclear polyhedrosis virus infection: A novel RNA
polymerase induced in infected Spodopterafiugiperda cells. J. Virol. 48:641-646.

Gearing, K. L., and R. D. Possee. 1990. Functional analysis of a 603 nucleotide open
reading We upstram of the polyhedrin gene of Autographa caliform’ca nuclear
polyhedrosis virus. J. Gen. Virol. 71 :251-262.

Gelernter, W. D., and B. A. Federici. 1986. Continuous cell line fi'om Spodoptera
exigua (Lepidoptera: Noctuidae) that supports replication of nuclear polyhedrosis

viruses from Spodoptera exigua and Autographa califomica. J. Invertebr. Pathol.
48: 199-207.

132

Glocker, B., R. R. Hoopes, andG. F. Rohrmann. 1992. In vitro transactivation of
baculovirus early genes by nuclear extracts fiom Autographa califomica nuclear
polyhedrosis virus-infected Spodopteraflugiperda cell. J. Virol. 66:3476-3484.

Goodwin, R. H., G. J. Tompkins, and P. McCawley. 1978. Gypsy moth cell lines
divergent in viral susceptibility. In Vitro. 14:485-494.

Gooding, L. R., L. Aquino, P. J. Duerksen-Hughes, D. Day, T. M. Horton, S. Yei,
and W. S. M. Wold. 1991. The ElB 19000-molecular weight protein of group C

adenoviruses prevents tumor necrosis factor cytolysis of human cells but not of mouse
cells. J. Virol. 65:3083-3094.

Gordon, J. D., and E. B. Carstens. 1984. Phenotypic characterizaion and physical
mapping of a temperature-sensitive mutant of Autogrpha californica nuclear
polyhedrosis virus defective in DNA synthesis. Virology 138:69—81

Granados, R. R., and K. A. Lawler. 1981. In vivo pathway of Autographa californica
baculovirus invasion and infection. Virology 108:297-308.

Granados, R. R., and L. Williams. 1986. In vivo infection and replication of
baculoviruses. In the Biology of Baculoviruses, Vol. 1, Eds. R. Granados, and B.
F ederici, pp. 89-108. Boca Raton, Fla: CRC Press.

Gregory, C. D., C. Dive, S. Henderson, C. A. Smith, G. T. Williams, J. Gordon, and
A. B. Rickinson. 1991. Activation of Epstein-Barr virus latent genes protects human B
cells fi'om death by apoptosis. Nature (London) 349:612-614.

Grether, M. E., J. M. Abrams, J. Agapite, K. White, and H. Steller. 1995. The head
involution defective gene of Drosophila melanogaster functions in programmed cell
death. Genes Dev. 9:1694-1708.

Groner, A. 1986. Specificity and safety of baculoviruses. In The Biology of
Baculoviruses. Vol. 1, eds. R. R. Granados, and B. A. Federici, pp. 177-202. Boca
Raton, Fla: CRC Press.

Guarino, L. A., M. A. Gonzalez, and M. D. Summers. 1986. Complete sequence and
enhancer function of the homologous DNA regions ofAutographa califomica nuclear
polyhedrosis virus. J. Virol. 60:224-229.

Guarino. L. A., and M. D. Summers. 1986a. Fuctional mapping of a trans-activating
gene required for expression of a baculovirus delayed early gene. J. Virol. 57:563-571.

Guarino. L. A., and M. D. Summers. 1986b. Interspersed homologous DNA of
Autographa califorinca nuclear polyhedrosis virus enhances delayed-early gene
expression. J. Virol. 60:215-223.

133

Guarino, L. A., and M. D. Summers. 1987. Nucleotide sequence and temporal
expression of a baculovirus regulatory gene. J. Virol. 61 :2091-2099.

Guarino. L. A., and M. Smith. 1992. Regulation of delayed-early transcription by dual
TATA boxes. J. Virol. 66:3733-3739.

Guarino, L. A., W. Dong, B. Xu, D. R. Broussard, R. W. Dacis, and D. L. Jarvis.
1992. Baculovirus phosphoprotein pp3l is associated with virogenic stroma. J. Virol.
66:7113-7120.

Gunnery, S., A. P. Rice, H. D. Robertson, and M. B. Mathews. 1990. Tat-responsive
region RNA of hulman immunodeficiency virus 1 can prevent activation of the
double-stranded RNA-activated protein kinase. Proc. Natl. Acad. Sci. USA 87:8687-
8691.

Guzo, D., E. M. Dougherty, S. K. Braun, D. E. Lynn, and R. M. Weiner. 1991.
Production of a cellular macromolecular synthesis inhibition factor(s) in gypsy mloth
cells infected with the Autographa californica nuclear polyhedrosis virus. J. Invert.
Pathol. 57:413-425.

Guzo, D., H. Rathburn, K. Guthrie, and E. Daugherty. 1992. Viral and host cellular
transcription in Autographa californica nuclear polyhedrosis virus-infected gypsy
moth cell lines. J. Virol. 66:2966-2972.

Hale, A. J., C A. Smith, L. C. Sutherland. V. E. A. Stoneman, V. L. Longthrne, A. C.
Culhane, and G. T. Williams. 1996. Apptosis: molecular regulation of cell death.
Eur. J. Biochem. 236:1-26.

Hang, S., W. Dong, and L. F. Guarino. 1995. The lef-3 gene of baculovirus Autographa
californica nuclear polyhedrosis virus encodes a single-stranded DNA-binding protein.
J. Virol. 69:3924-3928.

Harrap, K. 1972a. The structure of nuclear polyhedrosis viruses. 1. The inclusion body.
' Virology 50:114-123.

Harrap, K. 1972b. The structure of nuclear polyhedrosis viruses. 11. The virus particle.
Virology 50:124-132.

Harrap, K. 19720. The structure of nuclear polyhedrosis viruses. III. Virus assembly.
Virology 50:133-139.

Hashimoto, S., A. Ishii, and S. Yonehara. 1991. The ElB oncogene of adenovirus
confers cellular resistance to cytotoxicity of tumor necrosis factor and monoclonal
anti-Pas antibody. Int. Irnmunol. 3:343-351.

134

Hay, B. A., D. A. Wassarman, and G. M. Rubin. 1995. Drosophila homologs of
baculovirus inhibitor of apoptosis proteins fimction to block cell-death. Cell 83:1253-
1262.

Hay, B. A., T. Wolff, and G. M. Rubin. 1994. Expression of baculovirus P35 prevents
cell death in Drosophila. Development (Cambridge) 120:2121-2129.

He, B., J. Chou, D. A. Liebermann, B. Hoffman, and B. Roizman. 1996. The carboxyl
terminus of the murine MyD116 gene substitutes for the corresponding domain of the
7134.5 gene of herpes simplex virus to preclude the premature shutoff of total protein

synthesis in infected human cells. J. Virol. 70:84-89.

Henderson, S., D. Huen, M. Rowe, C. Dawson, G. Johnson, and A. Rickinson. 1993.
Epstein-Barr virus-encoded BHRF] protein, a viral homologue of Bel-2, protects
human B cells from programmed cell death. Proc. Natl. Acad. Sci. USA 90:8479-
8483.

Henderson, S., M. Rowe, C. Gregory, D. Groom-Carter, F. Wang, R. Longnecker, E.
Kieff, and A. Richinson. 1991. Induction of bcl-2 expression by Epstein-Barr virus
latent membrane protein 1 protects infected B cells from programmed cell death. Cell
65:1107-1115.

Hengartner, M. 0., and H. R. Horvitz. 1994. C. elegans cell survival gene ced-9
encodes a functional homolog of the mammalian proto-oncogene bcl-2. Cell 76:665-
676.

Hengartner, M. 0., R. E. Ellis, and H. R. Horvitz. 1992. Caenorhabditis elegans gene
cad-9 protects cells from programmed cell death. Nature (London) 356:494-499.

Henikoff, S. 1984. Unidirectional digestion with exonuclease III creates targeted
breakpoints for DNA sequencing. Gene 28:351-359.

Hershberger, P. A., J. A. Dickson, and P. D. Friesen. 1992. Site-specific mutagenesis
of the 35-kilodalton protein gene encoded by Autographa californica nuclear
polyhedrosis virus----cell line-specific effects on virus replication. J. Virol. 66:5525-
5533.

Hersherberg, P. A., D. J. Lacount, and P. D. Friesen. 1994. The apoptotic suppressor
p35 is required early during baculovirus replication and is targeted to the cytosol of
infected cells. J. Virol. 68:3467-3477.

Hershey, J. W. B. 1991. Translation control in mammalian cells. Annu. Rev. Biochem.
60:717-755.

135

Hink, W. F. 1970. Established insect cell line from the cabbage looper, T nchoplusza ni.
Nature (London) 226: 466-467.

Hink, W. F. 1979. The 1979 compilation of invertebrate cell lines and culture media, p.
553-57 8. In E. Kurstak, K. Maramorosch, and A. Dubendorfer (ed.), Invertebrate
systems in vitro. Elsevier/North-Holland Biomedical Press, Amsterdam.

Hink, W. F., and R. K. Hall. 1989. Recently established invertebrate cell lines, p. 269-
293. In J. Mitsuhashi (ed. ) Invertebrate cell system applications. CRC Press, Inc., Boca
Raton, Fla.

Hockenbery, D., G. Nunez, C. Milliman, R. D. Schreinber, and S. J. Korsmeyer.
1990. Bel-2 is an inner mitochondrial membrane protein that blocks programmed cell
death. Cell 348:334-336.

Hohmann, A. W., and P. Faulkner. 1983. Monoclonal antibodies to baculovirus
structural proteins: determination of specificities by Western blot analysis. Virology
125:432-444.

Hong, T., S. C. Braunagel. And M. D. Summers. 1994. Transcription, translation, and
cellular location of PDV-E66: a structural protein of the PDV envelope of
Autographa calzfornica nuclear polyhedrosis virus. Virology 204:210-222.

Hooft van Iddekinge, B. J. L., G. E. Smith, and M. D. Summers. 1983: Nucleotide
sequence of the polyhedrin gene of Autographa californica nuclear polyhedrosis virus.
Virology 131 :561—565.

Hoopes, P. R., and G. F. Rohrmann. 1991. In vitro transcription of baculovirus

immediate early genes: Accurate messenger RNA initiation by nuclear extracts fi'om
both insect and human cells. Proc. Natl. Acad. Sci. USA 88:4513-4517.

Horton, H. M., and J. P. Burand. 1993. Saturable attachment sites for polyhedrin-
derived baculovirus on insect cells and evidence for entry via derect membrane fusion.
J. Virol. 67. 1860-1868.

Hovanessian, A. G., R. E. Brown, and I. M. Kerr. 1977. Synthesis of low molecular
weight inhibitor of protein synthesis with enzyme from interferon-treated cell. Nature
268:537-540.

Howard, S. C., M. D. Ayres, and R. D. Possee. 1986. Mapping the 5’ and 3’ ends of
Autographa calzfornica nuclear polyhedrosis virus polyhedrin mRNA. Virus Res.
5:109-1 l9.

136

Huh, N. E., and R. F. Weaver. 1990. Identifying the RNA polymerases that synthesize
specific transcripts of Autographa calzfornica nuclear polyhedrosis virus. J. Gen.
Virol. 71:195-201.

Jun-Chuan, Q., and R. Weaver. 1982. Capping of viral RNA in cultured Spodoptera
fi'ugiperda cells infected with Autographa californica nuclear polyhedrsis virus. J.
Virol. 43. 234- 240.

Kamita, S. G., K. Majima, and S. Maeda. 1993. Identification and characterization of
the p35 gene of the Bombyx mori nuclear polyhedrosis virus that prevents virus-
induced apoptosis. J. Virol. 67:455-463.

Kamita, S. G., and S. Maeda. 1993. Inhibition of Bombyx mori nuclear polyhedrosis
virus (NPV) replication by the putative DNA helicse gene of Autographa califomica
NPV. J. Virol. 67: 6239- 6245.

Karlin, S. and V. Brendel. 1992. Chance and statistical significance in protein and DNA
sequence analysis. Science. 257:39-49.

Keddie, B. A., G. W. Aponte, and L. E. Volkman. 1989. The pathway of infection of
Autographa californica nuclear polyhedrosis virus in an insect host. Science
243: 1728-1730.

Kelly, D. 1981. Baculovirus replication: electron microscopy of the sequence of infection
of Trichoplusia ni nuclear polyhedrosis virus in Spodopterafiugiperda cells. J. Gen. '
Virol. 52:209-219.

Kelly, D. C., D. A. Brown, M. D. Ayres, C. J. Allen, and I. 0. Walker. 1983.
Properties of the major nucleocapsid protein of Heliothis zea singly enveloped nuclear
polyhedrosis virus. J. Gen. Virol. 64:399-408.

Kelly, D. C., and T. Lescott. 1981. Baculovirus replication: protein syntehsis in
Spodopterafrugiperda cells infected with T richoplusia ni nuclear polyhedrosis virus.
Microbiologica 4:35-37.

Kerr, 1. M., R. E. Brown, and A. G. Hovanessian. 1977. Nature of inhibitor of cell-free
protein synthesis formed in response to interferon and double-stranded RNA. Nature
268:540-542.

Kerr, L. D., D. B. Miller, and L. M. Matrisian. 1990. TGF-Bl inhibition of
transin/stromelysin gene expression is mediated through a fos binding sequence. Cell.
61 :267-278.

137

Kirkpatrick, B. A., J. O. Washburn, E. K. Engelhard, and L. E. Volkman. 1994.
Primary infection of insect tracheae by Autograha calzfomica M nuclear polyhedrsis
virus. Vriology 203:184-186.

Kitajewski, J., R. Schneider, S. Safer, S. Munemitsu, C. E. Samuel, B. Thimmapaya,
and T. Shenk. 1986. Adenovirus VAl RNA antagonizes the antiviral action of

interferon by preventing activation of the interferon-induced eIF-2a kinase. Cell
45: 195-200.

Knudson, D., and K. Harrap. 1976. Replication of a nuclear polyhedrosis virus in a
continuous cell culture of Spodoptera frugiperda: microscopy study of the sequence of
events of the virus infection. J. Virol. 17:254-268.

Kool, M and J. M. Vlak. 1993. The structural and fimctional organizaion of the
Autographa calzfornica nuclear polyhedrosis virus genome. Arch. Virol. 130:1-16.

Kool, M., P. M. M. M. Van Den Berg, J. Tramper, R. W. Goldbach, and J. M. Vlak.
1993. Location of two putative origins of DNA replication ofAutographa califorinca
nuclear polyhedrosis virus. Virology 192294-101.

Kovacs, G. R., L. A. Guarino, and M. D. Summers. 1991. Novel regulatory properties
of the IE1 and IEO transactivators encoded by the baculovirus Autographa californica
multicapsid nuclear polyhedrosis virus. J. Virol. 65:5281-5288.

Krappa, R., and D. Knebel-Morsdorf. 1991. Identification of the very early transcribed
baculovirus gene PE-38. J. Virol. 65:805-812.

Kuzio, J. D., Z. Rohel, C. J. Curry, A. Krebs, E. B. Carstens, and P. Faulkner. 1984.
Nucleotide sequence of the p10 polypeptide gene of Autographa californica nuclear
polyhedrosis virus. Virology 139:414-418.

Kuzio, J., R. J aques, and P. Faulkner. 1989. Identification of p 74, a gene essential for
virulence of baculovirus occlusion bodies. Virology 173:759-763.

LaCount, D. J., and P. D. Friesen. 1997. Role of early and late replication events in
induction of apoptosis by baculoviruses. J. Virol. 71 :1530-1537.

Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature (London). 227:680-685.

Lanier, L. M., J. M. Slack, and L. E. volkman. 1996. Actin binding and proteolysis by
the baculovirus AcMNPV: the role of virion-associated V-CATH. Virology 216:380—
388.

138

Lee, H. H., and L. K. Miller. 1979. Isolation, complimentation, and initial
characterization of temperature-sensitive mutants of the baculovirus Autographa
californica nuclear polyhedrosis virus. J. Virol. 31 :240-252.

Leisy, D. J., and G. F. Rohrmann. 1993. Characterizaiton of replication of plasmids
containing hr sequeces in baculovirus-infected Spodopterafiugiperda cell. Virology
196:722-730.

Lengyel, P. 1982. Biochemistry of interferons and their actions. Ann. Rev. Biochem.
5 l :25 1-282.

Levine, B., Q. Huang, J. T. Isaacs, J. C. Reed, D. E. Giff'm, and J. M. Hardwick.
1993. Concersion of lytic to persistent alphavirus infection by the bcI-2 cellular
oncogene. Nature (London) 361 :739-742.

Levitz, R., D. M. Chapman, R. Amitsur, L. Green, L. Snyder, and G. Kaufmann.
1990. The Optional E. coli prr locus encodes a latant form of phage T4-induced
anticodon nuclease. EMBO J. 9:1383-1389.

Li, Y., A. L. Passarelli, and L. K. Miller. 1993. Identification, sequence, and
transcriptional mapping of lef-3, a baculovirus gene involved in late and very late gene
expression . J. Vorol. 67:5260-5268.

Liston, P., N. Roy, K. Tamai, C. Lefebvre, S. Baird, G. Cherton-Horvat, R.
Farahani, M. McLean, and J. E. Ikeda. 1996. Suppression of apoptosis in
mammalian cells by NAIP and a related family of IAP genes. Nature (London)
379:349-353.

Lord, K. A., B. Hoffman-Liebermann, and D. A. Liebermann. 1990. Sequence of
MyDl 16 cDNA: 3 novel myeloid differentiation primary response gene induced by
1L6. Nucleic Acids Res. 18:2823.

Lowe, S. W., and H. E. Ruley. 1993. Stabilization of the p53 tuhnor suppressor is
induced by adenovirus 5 EIA and accompanies apopotosis. Genes Dev. 72535-545.

Lu, A., and E. B. Carstens. 1991. Nucleotide sequence of a gene essential for viral DNA
replication in the baculovirus Autographa californica nuclear polyhedrosis virus.
Virology 181:336-347.

Lu, A., and E. B. Carstens. 1992. Transcription analysis of the EcoRI-D region of the
baculovirus Autographa calzfornica nuclear polyhedrosis virus identifies an early 4-
kilobase RNA encoding the essential p143 gene. J. Virol. 66:655-663.

139

Lu, A., and E. B. Carstens. 1993. Immediate-early baculovirus genes transactivate the
p143 gene promoter of Autographa californica nuclear polyhedrosos virus. Virology
195:710-718.

Lu, A., and L. K. Miller. 1994. Identification of three late expression factor genes within
the 33.8— to 43.4map-unit region of Autographa californica nuclear polyhedrosis virus.
J. Viral. 68:6710-6718.

Lu, A., and L. K. Miller. 1995a. Differential requirements for baculovirus late
expression factor in two cell lines. J. Viral. 69:6265-6272.

Lu, A. and L. K. Miller. 1995b. Nucleotide sequence of a gene essential for viral DNA
replication in the bacuovirus of Autographa califomica nuclear polyhedrosis virus.
Virology 181 :336-347.

Lu, A., and L. K. Miller. 1995c. The roles of eighteen baculovirus late expression factor
genes in transcription and DNA replication. J. Viral. 69:97 5-982.

Lu, A., and L. K. Miller. 1996. Species-specific effects of the hcf-I gene on baculovirus
virulence. J. Viral. 70:5123-5130.

Lu, M., R. R. Johnson, K. Iatrou. 1996. Trans-activation of a cell housekeeping gene
promoter by the IE1 gene product of baculovirus. Virology 218:103-113.

Lubbert, H., and W. Doerfler. 1984a. Mapping of early and late transcripts encoded by
the Autographa californica nuclear polyhedrosis virus genome: is viral RNA spliced?
J. Viral. 50:497-506.

Lubbert, H., and W. Doerfler. 1984b. Transcription of overlapping sets of RNAs from
the genome of Autographa californica nucllear polyhedrosis virus: a novel method for
mapping rNAs. J. Viral. 52:255-265.

Luckow, V. L., and M. D. Summers. 1988. Trends in the development of baculovirus
expression vectors. Bio/Technology 6:47-55.

Lynn, D. E., E. M. Daugherty, J. T. McClintock and M. Loeb. 1988. Development of
cell lines from various tissues of Lepidoptera, p. 239-242. In: Y. Kurada, E. Kurstak,
K. Maramorosch (ed.), Invertebrate and fish tissue culture. Springer-Verlag, New
York.

Maeda, S., G. Kamita, and A. Kondo. 1993. Host range expansion of Autographa
californica nuclear palyhedraiss virus (NPV) following recombination of a 0.6-
kilobase-pair DNA fiagment ariginationg from Bombyx mori NPV. J. Viral. 6726234-
6238. -

140

Martin, J. M., D. Veis, S. J. Korsmeyer, and B. Sugden. 1993. Latent membrane
protein of Epstein-Barr virus induces cellular phenotypes independently of expression
of Bel-2. J. Viral. 67 :5269-5278.

Martinou, 1., P. A. Fernandez, M. Missotten, E. White, B. Allet, R. Sadoul, and J. C.
Martinou. 1995. Viral proteins E1B19K and P35 protect sympathetic neurons fiam
cell death induced by NGF deprivation. J. Cell. Biol. 128:201-208.

Mayr, U., H. P. Bermayer, G. Weidinger, and C. Jungwirth. 1977. Release of
interferon-induced translation inhibition by tRN A in cell-free extracts from mouse
erythroleukemia cells. Eru. J. Biochem. 76:541-551.

McClintock, J. T. and E. M. Daugherty. 1987. Superinfection of baculovirus-infected
gypsy moth cells with the nuclear polyhedrosis viruses of Autographa californica and
Lymantria dispar. Virus Res. 7:351-364.

McClintock, J. T., E. M. Dougherty, and R. M. Weiner. 1986. Sernipermissive
replication of a nuclear polyhedrosis virus of Autographa californica in a gypsy math
cell line. J. Viral. 57:197-204.

McGeoch, D. J., and B. C. Barnett. 1991. Neurovirulence factor. Nature (London)
3532609. '

McLachlin, J. R. and L. K. Miller. 1994. Identification and characterizaion of va-I, a
baculovirus gene involved in very late gene expression. J. Viral. 68:7746-7756.

Miller, L. K. 1988. Baculoviruses as gene expression vectors. Annu. Rev. Microbial.
42:177-199.

Miller, L. K., R. E. Trimarchi, D. Browne, and G. D. Pennock. 1983. A temperature-
sensitive mutant of the baculovirus Autographa californica nuclear polyhedrosis virus

defective in an early fimctian required for further gene expression. Virology 126:376-
380.

Monsma, S. A., A. G. P. Oomens, and G. W. Blissard. 1996. The GP64 envelope
fusion protein is an essential baculovirus protein required for cell-ta-cell transmission
of infection. J. Viral. 70:4607-4616.

Monsma, S. A., and G. W. Blissard. 1995. Idnetificatian of a membrane fusion domain
and an aligamerizatian domain in th baculovirus GP64 envelope fiisian protein. J.
Viral. 69:2583-2595.

Morris, T., J. W. Todd, B. Fisher, and L. K. Miller. 1994. Identification of lef- 7: a
baculovirus gene affecting late gene expression. Virology 200:360-369.

141

Morris, T., and L. K. Miller. 1992. Promoter influence on baculovirus-mediated gene
expression in permissive and nonpermissive insect cell lines. J. Viral. 66:7397-7405.

Morris, T., and L. K. Miller. 1993. Characterization of productive and nonpraductive
AcMNPV infection in selected insect cell lines. Virology 197:339-348.

Morris, T., and L. K. Miller. 1994. Mutational analysis of a baculovirus major late
promoter. Gene 140:147-153.

Murphy, F. A., C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P.
Martelli, M. A. Mayo, M. D. Summers. 1995. Virus Taxonomy-the classification and
Nomenclature of Viruses: sixth Report of the International Committee an Taxonomy
of Viruses. Vienna: Springer Verlag.

Neilan, J. G., Z. Lu, C. L. Afonso, G. F. Kutish, M. D. Sussman, and D. L. Rock.
1993. An Afiican swine fever virus gene with similarity to the prataancagene bcl-2
and the Epstein-Barr virsu gene BHRF-l. J. Cell Biol. 128:201-208.

Nissen, M. S., and P. D. Friesen. 1989. Molecular analysis of the transcriptional
regulatory region of an early baculovirus gene. J. Viral. 63:493-503.

Oellig, C., B. Happ, T. Muller, and W. Doerfler. 1987. Overlapping sets of viral RNAs
reflect the array of polypeptides in the EcoRI J and N fragments (map positions 81.2 to

85.0) of the Autographa californica nuclear polyhedrosis virus genome. J. Viral.
61 :3048-3057.

O’Malley, R., T. Mariano, J. Siekierka, and M. B. Mathews. 1986. A mechanism for
the control of protein synthesis by adenovirus VA RNA 1. Cell 44:391-400.

Ooi, B. G., C. Rankin, and L. K. Miller. 1989. Dawnstram sequences augment
transcription from the essentail initiation site of a baculovirus polyhedrin gene. J. Mol.
Biol. 210:721-736.

Ooi, B. G., and L. K. Miller. 1988. Regulation of host RNA levels during baculovirus
infection. Virology 166:515-523. '

Oomens, A G. P., S. A. Monsma, and G. W. Blissard. 1995. The baculovirus GP64
envelope fusion protein: synthesis, aligamerizatian, and processing. Virology
209:592-603.

O’Reilly, D. R., A. M. Crawford, and L. K. Miller. 1989. Viral proliferating cell
nuclear antigen. Nature 337:606.

O’Relly, D. R., and L. K. Miller. 1989. A baculovirus blacks insect molting by
producing ecdysteroid UDP-glucasyltransferase. Science 245:1110-11 12.

142

O'Reilly, D. R., L. K. Miller, and V. A. Luckow. 1992. Baculovirus expression vectors:
A laboratory mannual. W. H. Freeman and Company, New York.

Palli, S. R., G. F. Capato, S. S. Sohi, A. J. Brownwright, T. R. Ladd, B. J. Cook, M.
Primavera, B. M. Arif, and A. Retnakaran. 1996. CfllePV blocks AcMNPV-
induced apoptosis in a continuous midgut cell line. Virology 222:201-213.

Passarelli, A. L., .1. w. Todd, and L. K. Miller. 1994. A baculovirus gene involved in
late gene expression predicts a large polypeptide with a conserved motif of RNA
polymerases. J. Viral. 68:4673-4678.

Passarelli, A. L., and L. K. Miller. 1993a. Identification and characterization of Ief-I, a
baculovirus gene involved in late and very late gene expression. J. Viral. 67:3481-
3488.

Passarelli, A. L., and L. K. Miller. 1993b. Identificaion of genes encoding late
expression factors lacatied between 56.0 and 65.4 map units of the Autographa
californica nuclear polyhedrosis virus genome. Virology 197:704-714.

Passarelli, A. L., and L. K. Miller. 19930. Three baculovirus genes involved in late and
very late gene expression : ieI, ie-n, and lef-2 . J. Viral. 67:2149-2158.

Passarelli, A. L., and L. K. Miller. 1994. Identification and transcriptional regulation of
the baculovirus lef-6 gene. J. Viral. 68:4458-4467.

Pearson, G. R., J. Luka, L. Petti, J. Sample, M. Birkenbach, D. Braun, and E. Kieff.
1987. Identificaion of an Epstein-Barr virus early gene encoding a second component
of the restricted early antigen complex. Virology 160:151-161.

Pearson, M., R. Bjornson, G. Pearson, and G. Rohrmann. 1992. The Autographa
californica baculovirus genome: evidence for multiple replication origins. Science
257:1382-1384.

Pearson, M. N., R. L. Q. Russell, G. F. Rohrmann and G. S. Beaudreau. 1988. p39, a
major baculovirus structural protein: Immunocytochemical characterization and
genetic location. Viral. 167:407-413

Pensiero, M. N., and J. M. Lucas-Lenard. 1985. Evidence for presence of an inhibitor
on ribosomes in mouse L cells infected with megovirus. J. Viral. 56:161-171.

Podgwaite, J. D. 1985. Strategies for field use of baculoviruses. In: K. Maramorosch and
K. E. Sherman (Eds.), Viral Insectidides for Biological Control. pp. 775-797.
Academic Press, Orlando, FL.

143

Possee, R. D., M. Hirst, L. D. Jones, and D. H. L. Bishop. 1993. Field tests of
genetically genineered baculoviruses, p. 23-26. D. J. Beadle, D. H. L. Bishop, L. G.
Capping, G. K. Dixon, and D. W. Hollomon (ed.), BCPC monograph no. 55:
opportunities for molecular biology in crop production. The British crop Protecion
Council, F amham, Surrey, England

Prikhod’ko, E. A. and L. K. Miller. 1996, Induction of apoptosis by baculovirus
transactivator IE-l. 70:71 16-7124.

Quant, R. L., M. N. Pearson, G. F. Rohrmann, and G. S. Beaudreau. 1984.
Production of polyhedrin monoclonal antibodies for distinguishing two Orgyia
pseudotsugata baculovirueses. App. Envir. Micro. 48:732-736.

Rabizadeh, S., D. J. LaCount, P. D. Friesen, and D. E, Bredesen. 1993. Expression of
the baculovirus p35 gene inhibits mammalian neural cell death. J. Neurochem.
61:2318-2321.

Raghow, R., and T. Grace. 1974. Studies on a nuclear polyhedrosis virus in Bombyx
mori cells in vitro. J. Ultrastructure Res. 47:384-399.

Ramsey-Ewing, A, and B. Moss. 1995. Restriction of vaccinia virus replication in CHO
Cells occurs at the stage of virla intennidiate protein synthesis. Viraliogy. 206:984-
993.

Rankin, C., B. F. Ladin, and R. F. Weaver. 1986. Physical mapping of temporally
regulated, overlapping transcripts in the region of the 10K protein gene in Autographa
californica nuclear polyhedrosis virus. J. Virolo. 57:18-27.

Rao, L., M. Debbas, P. Sabbatini, D. Hockenbery, S. Korsmeyer, and E. White.
1992. The adenovirus ElA proteins induce apoptosis, which is inhibited by the E13 19
-kDa and Bel-2 proteins. Proc. Natl. Sci. USA 89:7742-7746.

Rasmussen, C., D. J. Leisy, P. S. Ho, and G. F. Rohrmann. 1996. Structure-function
analysis of the Autographa californica capsid nuclear polyhedrosis virus homologous
region palindromes. Virology 224:235-245.

Ribeiro, B., K. Hutchinson, and L. K. Miller. 1994. A mutant baculovirus with a
temperature-sensitive IE-l transregulatory protein. J. Viral. 68:1075-1084.

Rice, W. C., and L. K. Miller. 1986. Baculovirus transcription in the presence of
inhibitors and in nonperrrrissive Drosophila cells. Virus Res. 6:155-172.

Riegel, C. 1., C. Lanner-Herrera, and J. M. Slavicek. 1994. Identification and
characterization of the ecdysteroid UDP-glucosyltransferase gene of the Lymantria
dispar multinucleocapsid nuclear polyhedrosis virus. J. Gen. Virol. 75:829-838.

144

Roberts, S. R., and J. S. Manning. 1993. The major envelope glycoprotein of the
extracellular virion of Autographa californica nuclear olyhedrosis virus possesses at
least three distinct neutralizing epitopes. Virus Res. 28:285-297.

Rodems, S. M., and P. D. Friesen. 1993. The hr5 transcriptional enhancer stimulates
early expression fiom the Autographa californica nuclear polyhedrosis virus genome
but is not required for virus replication. J. Viral. 67:5776-57 85.

Rohel, D. Z., and P. Faulkner. 1984. Time course analysis and mapping of Autographa
californica nuclear polyhedrosis virus transcripts. J. Viral. 50:739-747.

Rohrmann, G. F. 1986. Polyhedrin structure. J. Gen. Virol. 67:1499-1513.
Rohrmann, G. F. 1992. Baculovirus structural proteins. J. Gen. Virol. 73:749-761.

Rothe, M., M. G. Pan, W. J. Henzel, T. M. Ayres, and D. V. Goeddel. 1996. The
TNFRZ-TRAF signaling complex contains 2 novel proteins related baculoviral-
inhibitor of apoptosis proteins. Cell 83:1243-1252.

Sambrook, J., E. F. Fritsch and T. Maniatis. 1989. Molecular cloning: a laboratory
manual, 2nd ed.., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Samuel, C. E. 1976. Mechanism of interferon action: studies on the mechanism of
interferon-mediated inhibition of reovirus messenger RNA translation in cell-fi'ee
protein synthesis systems from mouse ascites tumor cells. Virology 75: 166-176.

Samuel, C. E. 1991. Antiviral actions of interferon: interferon-regulated cellular protiens
and their surprisingly selective antiveral activities. Virology 183: 1-1 1.

Samuel, C. E. 1993. The eIF-2a protein kinases, regulators of translation in eukaryotes
from yeasts to humans. J. Biol. Chem. 268:7603-7606.

Sanger, F., S. N icklen, and A. Coulson. 1977. DNA sequencing with chain-terminating
inhibitors. Proc. Natl. Acad. Sci. USA. 74:5463-5467.

Schmidt, A., A. Zilberstein, L. Shulman, P. Federman, H. Berissi, and M. Revel.
1978. Interferon action: isolation of nuclease F, a translation inhibitor activated by
interferon-induced (2’-5’) oligo-isaadenylate. F EBS Lett. 95:257-264.

Schneider, R. J. and T. Shenk. 1987. Impact of virus infections on host cell protein
synthesis. Ann. Rev. Biochem. 56:317-32.

145

Sen, G. C., S. L. Gupta, G. E. Brown, B. Lebleu, M. A. Rebello, and P. Lengyel.
1975. Interferon treatment of Ehrlich ascites tumor cells: effects an exogenous mRNA
translation and tRNA inactivation in cell extract. J. Viral. 17:191-203.

Smith, G. E., M. J. Fraser, and M. D. Summers. 1983. Molecular engineering of the
Autographa californica nuclear polyhedrosis virus genomezdeletion mutations within
the polyhedrin gene. J. Viral. 46:584-593.

Slavicek, J. M., J. Podgewaite and C. Lanner-Herrera. 1992. Properties of two
Lymantria dispar nuclear polyhedrosis virus isolates obtained from the microbial
pesticide gypchek. J. Invertebr. Pathol. 59:142-148.

Slavicek, J. M., M. J. Mercer, M. E. Kelly and N. Hayes-Plazolles. 1995. Isolation of a
baculovirus that exhibits enhanced polyhedra production stability during serial passage
in cell culture. J. Invertebr. Pathol. in press.

Steller, H. 1995. Mechanisms and genes of cellular suicide. Science 267: 1445-1449.

Stoltz, D., C. Pavan, and A. Da Cunha. 1973. Nuclear polyhedrosis virus: a possible
expample of de novo intranuclear membrane morphogenesis. J. Gen. Virol. 19:145-
150.

Sugimoto, A., P. D. Friesen, and J. H. Rothman. 1994. Baculovirus p35 prevents
developmentally programmed cell death and rescues a ced-9 mutant in the nematode
Caenorhabditis elegans. EMBO J. 13:2023-2028.

Summers, M., and D. Anderson. 1972. Granulosis virus deoxyribonucleic acid: a closed
double-stranded molecule. J. Viral. 9:7 10-71 3.

Teodoro, J. G. and P. E. Branton. 1997. Regulation of apoptosis by viral gene products.
J. Vriol. 71:1739-1746.

Tewari, M., and V. M. Dizit. 1995. F as- and tumor necrosis factor-induced apoptosis is
inhibited by the poxvirus crmA gene product. J. Biol. Chem. 270:3255-3260.

Tewari, M. , W. G. Telford, R. A. Miller, and V. M. Dixit. 1995. CrmA, a poxvirus-
encoded serpin, inhibits cytotoxic T-lymphocyte-mediated apoptosis. J. Biol. Chem.
270:22705-22708.

Theilmann , M. A., and S. Stewart. 1991. Identification and characterizaion of the IE-l
gene of Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Virology
180:492-508.

146

Thiem, S. M., and L. K. Miller. 1989a. A baculovirus gene with a novel transcription
pattern enCodes a polypeptide with a zinc finger and a leucine zipper. J. Viral.
63:4489-4497.

Thiem, S. M., and L. K. Miller. 1989b. Identification, sequence, and transcriptional
mapping of the major capsid protein gene of the baculovirus Autographa californica
nuclear polyhedrosis virus. J. Viral. 63:2008-2018.

Thiem, S. M., X. Du, M. E. Quentin, and M. M. Berner. 1996. Identification of a
baculovirus gene that promotes Autographa californica nuclear polyhedrosis virus
replication in a non-permissive insect cell line. J. Viral. 70:2221-2229.

Todd, J. W., A. L. Passarelli, A. Lu, and L. K. Miller. 1996. Factors regulating
baculovirus late and very late gene expression oin Transient-expression assays. J.
Viral. 70:2307-2317. '

Todd, J. W., A. L. Passarelli, and L. K. Miller. 1995. Eighteen baculovirus genes.
Including Ief-11,p35, 39k, and p4 7, support late gene expression, J. Viral. 69:968-
974.

Tomalski, M. D., J. Wu, and L. K. Miller. 1988. The location, sequence, transcription
and regulation of a baculovirus DNA polymerase gene. Virology 167:591-600.

Tomalski, M. D., and L. K. Miller. 1992. Expression of a paralytic neurotoxin gene to
improve insect baculoviruses as biopesticides. Bio. Technology 10:545-549.

Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins
fi'om polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA. 76:4350-4354.

Tsujimoto, Y., L. R. Finger, J. Yunis, P. C. Novel], and C. M. Croce. 1984. Cloning
of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome
translocation. Science 226:1097-1099.

Tweeten, K. A., L. A. Bulla, and R. A. Consigli. 1980. Characterizaion of an extremely
basic protein derived from granulosis virus nucleocapsid. J. Viral. 33:866-876.

Van der Wilk, F., J. W. M. Van Lent, and J. M. Vlak. 1987. Irnmunogold detection of
polyhedrin, p10 and virion antigens in Autographa californica nuclear polyhedrosis
virus-infectd Spodopterafiugiperda cells. J. Gen. Virol. 68:2615-2623.

Van Oers, M. M., J. T. M. Flipsen, C. B. E. M. Reusken, E. L. Sliwinsky, R. W.
Goldbach, and J. M. Vlak. 1993. Functional domans of the p10 protein of
Autographa californica nuclear polyhedrosis virus. J. Gen. Virol. 74:563-574.

147

Van Oers, M. M., .1. T. M. Flipsen, C. B. E. M. Reusken,'and J. M. Vlak. 1994.
Specificity of baculovirus p10 functions. Virology 200:513-523.

Vaughn, J. L., R. H. Goodwin, G. J. Tompkins, and P. McCawley. 1977. The
establishment of two cell lines from the insect Spodoptera fi-ugiperta (Lepidoptera:
noctuidae). In Vitro. 13:213-217.

Vaux, D. L., I. L. Wessman, and S. K. Kim. 1992. Prevention of programmed cell
death in Caenorhabditis elegans by human bcl-Z. Science 258: 1955-1957.

Volkman, L. E. 1986. The 64-k envelope protein of budded Autographa califomica
nuclear polyhedrosis virus. In Current Topics in Microbiology and immunology, eds.
W. Doerfler, and P. boehm, pp. 103-118. Berlin, Heidleberg, and New York: Springer-
verlag.

Volkman, L. E., and K. J. Zaal. 1990. Autographa californica M nuclear polyhedrosis
virus: microtubules and replication. Virology. 175:292-302.

Volkman, L. E., M. D. Summers, and C. H. Hsieh. 1976. Occluded and nonoccluded
nuclear polyhedrosis virus grown in Trichoplusia ni: comparative neutralizaion,
comaprative infectivity, and in vitro growth studies. J. Viral. 19:820-830.

Volkmann. L. E. and M. D. Summers. 1977. Autographa californica nuclear
polyhedrosis virus: comparative infectivity of the occluded, alkali-liberated, and
nonoccluded forms. J. Invert. Path. 30:102-103.

Volkman, L. E., and P. A. Goldsmith. 1985. Mechanism of neutralizaion of budded
Autographa californica nuclear polyhedrosis virus by a monoclonal antibody:
inhibition of entry by adsorptive endocytosis. Virology 143:185-195.

Volkman, L. E., P. A. Goldsmith, R. T. Hess, and P. Faulkner. 1984. Neutralizaion of
budded Autographa californica NPV by a monoclonal antibody: identification of the
target antigen. Virology: 133:354-362.

Wang, P., D. A. Hammer, R. R. Granados. 1994. Interaction of Trichoplisia ni
granulosis virus encoded enhancin with the midgut epithelium and peritraphic
membrane of four lepidopteran insects. J. Gen. Virol. 75:1961-1967.

Wang, X., B. G. Ooi, and L. K. Miller. 1991. Baculovirus vectors for multiple gene
expression and for occluded virus production. Gene 110: 131-1 37.

Weissenbach, J., G. Dirheimer, R. Falcoff, J. Sanceau, and E. Falcoff. 1977. Yeast
tRNA"m (anticodon U-A-G) translates all six leucine codons in extracts from interferon
treated cells. FEBS Lett. 82:71-76.

148

Weyer, U. S. Knight, and R. D. Possee. 1990. Analysis of very late gene expression by
Autographa californaca nuclear polyhedrosis virus and the further development of
multiple expression vectors. J. Gen. Virol. 71: 1525- 1534.

Whitaker-Dowling, P., and J. Youngner. 1984. Characterization of a specific kinase
inhibitoryfactor produced by vaccinia virus which inhibits the interferon-induced
protein kinase. Virology 137: 17 l- 181.

White, K., E. Tahaoglu, and H. Steller. 1996. Cell killing by the Drosophila gene
reaper. Science 271 :805-807.

White, E., P. Sabbatini, M. Debbas, W. S. M. Wold, D. I. Kusher, and L. R.
Gooding. 1992. The 19-kilodalton adenovirus ElB transforming protein inhibis
programmed cell death and prevnets cytolysis by tumor necrosis factor alpha. Mol.
Cell. Biol. 12:2570-2580.

Whiteford, M., S. Stevart, J. Kuzio, and P. Faulkner. 1989. Identification and
sequence analysis of a gene encoding gp67, an abundant envelope glycoprotein of the

baculovirus Autogrpaha callifornica nuclear polyhedrosis virus. J. Viral. 6321393-
1 399.

Wilson, M. E., and R. A. Consigli. 1985. Function of a protein kinase activity associated
with purified capsids of the granulosis virus infecting Plodia interpunctella. Virology
143. 526- 535.

Wilson, M. E., T. H. Mainprize, P. D. Friesen, and L. K. Miller. 1987. Location,
transcription, and sequence of a baculovirus gene encoding a small arginine-rich
polypeptide. J. Viral. 61:661-666.

Wood, H. A., and R. R. Granados. 1991. Genetically engineered baculoviruses as
agents for pest control. Annu. Rev. Mivrobiol. 45:69-87.

Xue, D., and H. R. Horvitz. 1995. Inhibition of the Caenorhabditis elegans cell-death
protease CBS-3 by a CED-3 cleavage site in baculovirus P35 protein. Nature 377:248-
25 1 .

Yang, C. L., D. A. Stetler, and R. F. Weaver. 1991. Structural comparison of the
Autographa californica nuclear polyhedrosis virus-induced RNA polymerase and the

three nuclear RNA polymerase from the host Spodopterafmgiperda. Virus Res.
20:25 1-264.

Yoo, S. and L. A. Guarino. 1994. The Autographa californica nuclear polyhedrosis
virus ie-2 gene encodes a transcriptional regulator. Virology 202:746-753.

149

Yu, T-T. N ., and L. Snyder. 1994. Tmaslation elongation factor Tu cleaved by a
phsage-exclusion system. Proc. Natl. Acad. Sci. USA 91 :802-806.

Yuwen, H., J. H. Cox, J. W. Yewdell, J. R. Bennink, and B. Moss. 1993. Nuclear
lacalizaion of a double-stranded RNA-binding protein encoded by the vaccinia virus
E3L gene. Virology 195:732-744.

Zhan, Q., K. A. Lord, J. Alma Isaac , M. C. Hollander, F. Carrier, D. Ron, K. W.
Kohn, B. Hoffman, D. A. Liebermann and J. Fornace Albert. 1994. The gadd and
MyD genes define a novel set of mammalian genes encoding acidic proteins that
synergistically suppress cell growth. Molec. Cell. Biol. 14:2361-2371.

Zhong, L., T. Sarafian, D. J. Kane, A. C. Charles, S. P. Mah, R. H. Edwards, and D.
E. Bredesen. 1993. Bel-2 inhibits death of central neural cells induced by multiple
agents. Proc. Natl. Acad. Sci. USA 90:4533-4537.

Zilberstein, A., A. Kimchi, A. Schmidt, and M. Revel. 197 8. Isolation of two
interferon-induced translational inhibitors: a protein kinase and an oligo-isoadenylate
synthetase. Proc. Natl. Acad. Sci. USA. 75:4734-4738.

Ziberstein, A., B. Dudock, H. Berissi, and M. Revel. 1976. Control of messenger RNA
translation by minor species of leucyl-transfer RNA in extracts from interferon-treated
L cells. J. Mol. Biol. 108:43-54.