3.... #0..
garb. .
a. . .i

..... «.1 .2
. Lr! ‘ ..
BMW.%.1 awn.

’t
3... m2. .
WWW?“ 5% m

tixt

Thyfiufu

. a. 5.3.. ..
as“... a $de
5.5-? V :3 . .1
...3.:....;.

z .. «2.2...
as: etuwii

.. x
2.3%....
.. iv»...

7
”$.I;
.‘ 7;: w
4,.

1'

Q,

. :i .
up .

e
,2:
.. 2...; a. e
«Luanda: .2 x..\ .

L...,..u.l.\..U 1;. U.»

.. :3 {a
r :5:
i=3

.0
.i .r .. ..
b... I)“. v ()3
z. 1. 3.5 3.15315

.. .. if 585. .

2.... :3.
c. 1...; . .
y’t-‘k.5$..a 'i 1-9 1.5». {g
.v. u... . i. .
2.... x. 35.5.: 1.. s 2.... z. %§?ss. .. {
. 2.. 5 n a . , 12.3.33. t... 3...... I...»
3.33:. inks? 5.13;.» 52!. 1 .{afivtiszISQanA

3...; .1.....{.. 4... .i.

 

 

lllllltlllllllllllllllllllllllllllllllllllllllllllllllll

3 1293 01417 1973
THE$S

‘ LIBRARY
Michiean State
Universi V

This is to certify that the

dissertation entitled

Expression of the SAUR-ACI gene of
Arabidopsis thaliana

presented by

Pedro Gil

has been accepted towards fulfillment
of the requirements for

 

 

 

Ph.D. degree in Botany
Pamela J. Green
7 Major professor
“ A,
V’cflk«¢b€£— I-./Z;:;Z’x__d
Date 5/2/95 ,A
(/

 

MSU is an Affirmative Action/Equal Opportunity Institution 0-12771

PLACE It RETURN BOXto "mm-thin mum your record.
TO AVOID FINES mum onotbdonddo duO.

E DATE DUE DATE

       

 

 

MSU I: An Affirmative Action/EM OpportUnnv Imam
Wanna-M

EXPRESSION OF THE SA UR—ACI GENE OF ARABIDOPSIS T HALIANA

By

Pedro Gil

A THESIS

Submitted to
Michigan State University
in partial fulfilment of the requirements

for the degree of

DOCTOR OF PHILOSOPHY

Department of Botany and Plant Pathology

1995

ABSTRACT

EXPRESSION OF THE SA UR-A C1 GENE OF ARABIDOPSIS THALIANA

By

Pedro Gil

The Small Auxin 11p RNA (SA UR) genes were originally characterized in soybean where
they encode a set of unstable transcripts that are rapidly induced by auxin. In this study,
the expression of a SA UR gene, designated SA UR-ACI , from Arabidopsis thaliana (L.)
Heynh. ecotype Columbia is characterized. The promoter of SAUR-A C1 gene contains
putative regulatory motifs conserved among soybean SA UR promoters, as well as
sequences implicated in the regulation of other genes in response to auxin. Accumulation
of SA UR-A C1 mRN A is readily induced by natural and synthetic auxins and by the
translational inhibitor cycloheximide. Moreover, several auxin- and gravity-response
mutants of Arabidopsis exhibit decreased accumulation of the SA UR-A C1 mRN A in
elongating etiolated seedlings. These studies indicate that SA UR—ACI will be a useful
probe of auxin-induced gene expression in Arabidopsis. To monitor the contribution of
SA UR promoter and downstream sequences on mRN A accumulation, chimeric genes
containing different regions of the SA UR-A C1 gene have been introduced into Arabidopsis

and tobacco plants. These experiments demonstrate that the SA UR-A CI promoter region

P. Gil

is responsible for auxin- and cycloheximide-induced mRN A accumulation in transgenic
Arabidopsis and tobacco plants. In both types of plants, the promoter region is most active
in aerial organs, including flowers, and also displays preferential expression in tissues that
are potential targets for auxin action. In contrast, SA UR-A CI downstream sequences are
partially responsible for cycloheximide-induced mRNA accumulation, but do not
participate in auxin induction in transgenic tobacco. SA UR downstream sequences mediate
an effect on mRN A accumulation in tobacco plants and stably transformed cells, with both
the coding region and the 3' untranslated region (UTR) independently limiting mRN A
accumulation levels. In order to measure the mRN A half-lives of chimeric transcripts
including different regions of the SA UR-ACI transcript, we have used the tetracycline-
regulated ToplO promoter system. Upon treatment with tetracycline, this promoter
selectively stops transcription of transgenes in stably transformed tobacco cell lines. We
have found that the coding region of SA UR-A CI , although sufficient to limit mRNA
accumulation, does not decrease stability of the mRN A. The SA UR—A CI 3'UTR, which
contains the putative mRN A instability determinant DST element conserved in plant SAUR
genes, was shown to function as a mRN A instability determinant in plant cells. Consistent
with the idea that multiple unstability determinants are present in 3'UTR of SA UR-A C1 ,

disruption of a conserved motif of the DST does not create a stable mRN A.

ACKNOWLEDGENIENTS

I would like to thank Dr. Pam Green for being a great teacher and for her overall
contribution to complete this study, Andre Dandridge for his expert technical assistance,
Dr. Hans Kende, Dr. Ken Poff and Dr. Zack Burton for their contribution as members of
my committee, Yang Liu for his contribution to the early stages of this project, described
in the text, and for constructing 358 plasmids, Dr. Michael Sullivan for the construction
of the stably transformed BY-2(Teth16) cell lines, Dr. Jay de Rocher for participating
in constructing ToplO plasmids, Drs. Natasha Raikhel and Hyung-Il Lee for the Southern
blot in Figure 3-3, the Green Lab for their comments on the manuscript and for their
friendly support, Drs. Mark Estelle and Candace Timpte for providing the aux] —7 and
aer-I seeds, Drs. Nam-Hai Chua, Chris Somerville, Alex Gasch, and Carrie Schneider

for libraries, Marlene Cameron for art-work and Kurt Stepnitz for photographic materials.

iv

TABLE OF CONTENTS

LIST OF FIGURES ................................................................................. vi
CHAPTER 1: Introduction ........................................................................ 1
CHAPTER 2: Materials and Methods ........................................................... 7

CHAPTER 3: Characterization of the SA UR-A CI gene for use as a molecular
genetic tool in Arabidopsis
RESULTS .......................................................................... 16
DISCUSSION ..................................................................... 29
CHAPTER 4: Effect of promoter sequences on the expression of the SA UR-ACI
gene
RESULTS .......................................................................... 38
DISCUSSION ..................................................................... 47

CHAPTER 5: Effect of transcribed sequences of the SA UR-ACI gene on mRNA

stability
RESULTS ......................................................................... 54
DISCUSSION ..................................................................... 73
CHAPTER 6: CONCLUSIONS ............................................................... 78
LITERATURE CITED ............................................................................ 82

V

LIST OF FIGURES

Figure 3-1. The nucleotide and deduced amino acid sequences of the SA UR-A CI
gene ...................................................................................................... 18
Figure 3-2. Alignment of the deduced amino acid sequences of SAUR-AC1, the consensus
soybean SA URs and ARG7 ......................................................................... 20
Figure 3-3. Southern blot hybridization analysis of the SAUR-AC1 gene ................ 23
Figure 3-4. 81 protection analysis of the 5' end of the SA UR-ACI

transcript ................................................................................................ 24
Figure 3-5. Alignment of DST sequences found in SA UR genes .......................... 26
Figure 3-6. Northern analysis of SA UR-A C1 mRNA levels in etiolated seedlings of
Arabidopsis ............................................................................................... 28
Figure 3-7. Expression of SAUR-AC1 in auxin-resistant and gravity-response mutants of
Arabidopsis ........................................................................................... 31
Figure 4-1. Vector with test and reference genes ............................................. 40
Figure 4-2. Induction of the SA UR-A CI promoter in transgenic

Arabidopsis ............................................................................................... 41

vi

Figure 4-3. Histochemical analysis of the expression of the SA UR-GUS-E9 gene in
transgenic Arabidopsis .............................................................................. 44
Figure 44. Induction of the SA UR-A CI promoter in transgenic

tobacco ................................................................................................. 46
Figure 4-5. Histochemical analysis of the expression of the SA UR-GUS-E9 gene in
transgenic tobacco ................................................................................... 49
Figure 5-1. Structure of test and reference genes ............................................ 56
Figure 5—2. Effect of auxin and cycloheximide on mRN A accumulation on mRN A
encoded by a 35S-SA UR-SA UR gene ............................................................. 57
Figure 5-3. Effect of SA UR-A CI transcribed sequences on mRN A accumulation in
transgenic tobacco plants ............................................................................ 60

Figure 5-4. Effect of the SA UR-ACI coding region and 3' untranslated region on

transcript accumulation in tobacco cell lines ..................................................... 64
Figure 5-5. Determination of mRN A half-lives .............................................. 68

Figure 5-6. Effect of the 3'UTR of SA UR-ACI with a mutant DST on transcript

accumulation and mRN A stability ................................................................ 72

vii

CHAPTER 1

INTRODUCTION

A number of plant mRNAs have been identified that accumulate rapidly following
induction with natural or synthetic auxins (Theologis, 1986). In excised elongating
soybean hypocotyls, one family of transcripts, known as the Small Auxin 11p RNAs
(SA URs), begins to accumulate within 2.5 min after auxin application (McClure and
Guilfoyle, 1987). Although the function of the SA UR gene products is unknown, the
transcripts have been localized in tissues that are targets for auxin-induced cell elongation
(Gee et al. , 1991). The observation that SA URs appear before auxin-induced cell
elongation is observed (McClure and Guilfoyle, 1987; Vanderhoef and Stahl, 1975),
suggests that they may contribute to the process (McClure et al., 1989). A correlation
between SA UR gene expression and cell elongation has also been observed during the
gravitropic response. In gravity-stimulated seedlings, an asymmetric accumulation of the
SA UR transcripts is evident before visible bending of the plants occurs (McClure and
Guilfoyle, 1989). The SA UR transcripts accumulate in the cells that are destined to
elongate, presumably due to a rapid redistribution of endogenous auxin (McClure and
Guilfoyle, 1989; Li et al., 1991).

In an effort to elucidate mechanisms of auxin signal transduction, a number of
mutants have been isolated that have altered responses to auxin (Estelle, 1992) and/or
defects in gravitropism (e. g. Bullen et al. , 1990), a process considered to be controlled by
auxin. Many of these mutants have been isolated in Arabidopsis because of the widely

recognized advantages of this system for molecular genetics (Somerville, 1989). The

3

analysis of auxin-responsive gene expression could provide a particular advantage in the
characterization of these mutants because many of their physiological traits are tedious to
score quantitatively, or develop too slowly to provide insight into the early events in auxin
action. The main reason that auxin—responsive gene expression, as a means to characterize
mutants, has received a minimal amount of attention to date is the paucity of well-
characterized auxin-regulated genes of Arabidopsis that are suitable for these studies.

The accumulation of the soybean SAUR transcripts in response to auxin is due, at
least in part, to transcription (Franco et al. , 1990), and is likely to involve regulatory
sequences in the promoter region (Li et al. , 1994). The soybean SA URIOA promoter is
mostly active in epidermal and cortical cells of transgenic tobacco stems (Li et al. 1991).
Since SAUR transcripts were also localized in similar tissues of soybean hypocotyls (Gee
et al. , 1991), it is likely that, as in the case of other plant genes, tissue-specificity of
SA UR genes is determined by promoter sequences. However, it is unknown whether the
localized expression of the soybean SA URs is common to all SA UR genes.

During gravitropism, SA UR transcripts disappear very rapidly from cells that are
not targeted for enhanced elongation (McClure and Guilfoyle, 1989). This result, together
with mRN A half-life measurements made using the transcriptional inhibitor Actinomycin
D (Franco et al. , 1990) indicated that SA UR transcripts are very short-lived. In plants,
as in other eukaryotic organisms, unstable transcripts seem to be the exception and not
the norm. Experiments done in soybean cells estimated the half-lives of most plant mRN As
on the order of several hours (Silflow and Key, 1979). In general, the low stability of

eukaryotic transcripts is an active process that depends on the presence of RNA sequences

4

within the transcripts. Examples of RNA sequences that promote mRN A decay have been
found both in coding regions and 3' untranslated regions (UTRs) of unstable transcripts
of yeast and mamalian cells (Sachs, 1993). In some cases, multiple mRNA instability
elements are present in a transcript. For example, multiple instability determinants were
detected in the human c—fos mRN A, which remained unstable after one of its mRN A
instability determinants had been inactivated (Shyu et al. 1989). This message encodes
a transcriptional factor involved in the regulation of cell growth and development.

It has been observed that two synthetic elements cause mRN A instability in plants.
One of this sequences consists of 11 copies of the AUUUA sequence motif. The AUUUA
motif is present in multiple copies in the 3'UTR of certain unstable mammalian mRN As,
including c— as and granulocyte-macrophage colony stimulating factor (GM-CSF) (Peltz
et al. 1991). The AUUUA sequences are necessary for the 3'UTR of c-fos to function as
an mRN A stability determinant (Shyu et al. 1989). In stably transformed tobacco cells,
insertion of the AUUUA repeats into the 3'UTR of reporter transcripts was found to
induce rapid transcript decay (Ohme—Takagi et al. , 1993). In transgenic tobacco plants
insertion of the AUUUA repeats into the 3'UTR of a globin reporter gene was also shown
to decrease mRN A accumulation (Ohme-Takagi et al. , 1993). Although AUUUA motifs
have been observed in endogenous plant transcripts, it is not known whether they function
as mRNA instability determinants.

A second sequence that functions as an mRN A instability determinant is a dimer
of the DST element. The DST element consists of about 40 bases and is conserved

downstream the coding region of the SAUR genes (McClure and Guilfoyle, 1989). A

5

synthetic dimer of the DST element has been shown to destabilize the mRN A of reporter
genes when inserted in their 3' UTRs (Newman et al. , 1993). In addition, the
accumulation of reporter transcripts containing DST dimers was also limited in transgenic
tobacco, suggesting that DSTs can also target transcripts for rapid decay in plants.
However, only isolated dimers of a DST element have been shown to be sufficient to cause
rapid decay of reporter transcripts, therefore it is still necessary to test if DST sequences
contribute to the instability of native SA UR transcripts. At present, there is no evidence
supporting the hypothesis that auxin affects the stability of the SA UR transcripts or the
function of DST sequences (Li et al. , 1991; Newman et al. , 1993), suggesting that DST
sequences act constitutively to destabilize the SA UR transcripts (Newman et al. , 1993).
To provide a SAUR gene that could be used as a molecular probe for the analysis
of gravity-response and auxin-response mutants, as well as to identify potentially important
regulatory features of SA UR genes, we sought to isolate a SA UR gene from Arabidopsis.
In this study, we describe the isolation and characterization of the auxin-inducible SA UR-
ACI gene of Arabidopsis. This gene shares many structural features with its soybean
counterparts, including the presence of a DST sequence in the 3' UTR. The identification
of auxin- and gravity-response mutants with defects in SA UR-A C1 expression indicated that
this gene should be an effective tool for studying auxin signal transduction in Arabidopsis.
The role of the different regions of the SAUR-AC1 gene in the control of its expression has
also been investigated. By using chimeric genes we have observed that the SA UR-ACI
promoter is responsible for auxin induction and preferential expression in certain tissues

of Arabidopsis and tobacco. Another goal was to determine which sequences were

6

responsible for SA UR mRN A instability. We used a regulated promoter to measure
directly mRNA accumulation and mRNA half-lives of chimeric messages containing
transcribed SA UR sequences. These studies demonstrate that the 3'UTR of SA UR-A CI

limits accumulation of a transcript by targeting it for rapid degradation.

CHAPTER 2

MATERIALS AND METHODS

Isolation and Sequencing of SA UR-ACI Genomic and cDNA Clones

Primers corresponding to two highly conserved regions of the soybean SA UR open reading
frames (ORFS) were synthesized as follows: 5' GCAGTCTATGT(T/C)GGAGA 3' and
5' CA(T/A)GG(T/A)ATTGTGAG(G/A)CC 3'. Amplification of DNA sequences flanked
by these primers was accomplished by two sequential polymerase chain reaction (PCR)
experiments using genomic DNA of Arabidopsis thaliana (L.) ecotype Columbia as
template. The initial amplification was carried out in a volume of 100 “L and contained
100 ng of heat-denatured Arabidopsis genomic DNA, 163 pmol of each primer, 50 mM
KCl, 10 mM Tris-HCl, pH 8.3, 1.5 mM MgC12, 0.01% (w/v) gelatin, 200 ”M of each
dNTP, and 2.5 units of Taq DNA polymerase (Perkin Elmer). Reactions were subjected
to 25 cycles of 94°C for 1 min, 37°C for 2 min, and 72°C for 3 min. After a final 7 min
incubation at 72°C, the PCR products were separated on a low melting temperature
agarose gel and the major product (130-150 bp) was excised and used for a second round
of PCR under the same conditions as above. The major PCR product was gel purified,
blunt-end ligated into a plasmid vector, and the clones were sequenced using the dideoxy
method of Sanger et al. , (1977). The deduced amino acid sequence of one of the PCR
clones was found to be 78% identical to the soybean consensus and was used as a probe
to isolate the corresponding gene designated SA UR-A CI . The gene resides on an EcoRI
fragment of genomic DNA approximately 6 kb in length isolated from an A. thaliana (L.)

ecotype Columbia genomic library that was kindly provided by Drs. Carrie Schneider and

9

Chris Somerville. A cDNA clone identical to positions +45 to +485 was isolated from
an Arabidopsis cDNA library described previously (Taylor and Green, 1991) that was
kindly provided by Drs. Alex Gasch and Nam-Hai Chua. Both the cDNA clone and the

genomic clone were sequenced on both strands to generate the sequence shown in Figure

3-1.

Transgenic Arabidopsis Plants

A. thaliana ecotype RLD plants used for transformation were grown in square Petri dishes
(80 X 25 mm) containing AGM medium (4.3 g/L Murashige-Skoog salts [Sigma], 3%
[w/v] sucrose, 1X Murashige-Skoog vitamins [Sigma], 2.5 mM MES, pH 5.7, 8 g/L
phytagar [Gibco]) placed vertically to facilitate collecting roots from the agar surface under
sterile conditions. Root transformation was performed as described by Valvekens et al.
(1988). Etiolated seedlings of transgenic Arabidopsis were grown in complete darkness
for 7 to 10 days in Petri dishes (80 X 25 mm) containing AGMK medium (AGM medium
with 100 pg/mL Kanamycin) under sterile conditions. Transgenic Arabidopsis plants for
histochemical studies were grown in a 1:1:1 mixture of fine vermiculite, perlite and

Sphagnum pea under a 16-h light/8-h dark cycle at 20°C.

Transgenic Tobacco Plants
N. tabacum SR-l plants were grown and transformed as previously described by Newman
et al. (1993). Plantlets testing positive for expression of the GUS reference gene were

transferred to soil, under conditions of 16-h light/8-h dark at 27°C and 75 % humidity. For

10

analysis of RNA levels (Figure 3-7), plants were grown to the 10- to l4—leaf stage, and a
fully expanded leaf of the third pair from the apex was harvested and frozen in liquid

nitrogen prior to extraction of RNA.

BY-2 Cells

Untransformed Nicotiana tabacum cv Bright Yellow 2 (BY-2) cultured cells, were grown
and subcultured as described previously by Newman et al. (1993). To facilitate
transformation, constructs were introduced into A grobacten'um tumefaciens LBA4404 by
electroporation under the conditions recommended by the manufacturer (Bio-Rad: 25 uF,
2.5 kV, 200 O). Agrobacterium strains containing the construct of interest were used to
transform BY-2 cells as described previously (An, 1985) with minor modifications
described by Newman et al. (1993). In the case of ToplO chimeric genes, 2 rounds of
transformation of the same cells were necessary. The first transformation was performed
to introduce the 35S-TETVp16 construct. This construct contains the hygromycin
resistance (HPT) gene, making possible for transformed cells to be selected on NTCH
medium (NT medium with 500 pg/mL carbenicilin and 50 pg/mL hygromycin).
Individual transformed calli were tested for expression of the TETVp16 gene by Northern
blot analysis as described below. Transformed lines with highest TETVp16 mRN A levels
were selected and named BY-2(Tethl6). They were grown in liquid cultures and
retransformed with Top10 constructs. These constructs included a kanamycin resistance
(NPTII) gene, making possible a selection for retransformed cells using NTKCH medium

(NT medium with 100 ,ug/mL kanamycin, 500 ug/mL carbenicilin and 50 pg/mL

11

hygromycin). After 3 to 4 weeks individual calli were transferred to fresh plates and
cultured at 28°C. Transformed lines were screened for expression of reporter GUS genes
by enzymatic assay (p-Glucuronidase) and subsequently by Northern blot analysis. Liquid
cultures were generated by resuspending transformed calli in 10 mL of N TKCH liquid

medium (without phytagar), and subsequently were subcultured weekly.

Gene Constructions and Site-directed Mutagenesis

Test genes were constructed in pBluescript SKII- (Stratagene) intermediate vectors that
have the following cassette structure: SacI-Promoter-BglII-XbaI-Coding region-BamI-II-
3'UTR-ClaI. The SA UR-GUS-E9 test gene contains the -2300 to +30 promoter region
of SA UR-A C1 fused to the GUS-E9 gene, constructed by exchanging the 3'UTR of the
GUS-3C and the CAT -E9 genes described by Fang et al. (1989). The SAUR—GUS-E9 gene
was inserted between the SacI and ClaI sites of the polylinker of the plasmid p847
described by Newman et al. (1993). The 35S—SA UR-E9 gene includes the (-940 to +9)
358 promoter (Fang et al. 1989), the +61 to +352 fragment of the SAUR-AC1 gene
which contains 26 nucleotides of the 5' untranslated leader and the complete coding region
followed by the E9 3'UTR of the CAT -E9 gene described by Fang et al. (1989). The 358-
Globin-SA UR gene includes the same 358 promoter fused to the human B-globin coding
region described by Newman et al. (1993), followed by the +353 to +1347 SA UR-ACI
3'UTR. The 35S-SA UR-SA UR gene includes the same 358 promoter fused to the +61 to
+1347 fragment of the SAUR-A CI gene. These three genes and the 3SS-Globin-E9 gene,

which contains the same 358 promoter fused to the globin coding region and the E9

12

3'UTR fragments described above, were inserted between the SacI and ClaI sites of the
polylinker of the plasmid p851 described by Newman et al. (1993). Top10 constructs
were derivatives of pMON505 (Rogers et a1, , 1987) that contain a T 0p] 0-GUS-3C
reference gene cassette inserted in the HpaI site and test genes T 0p] 0—Globin-E9, Top10-
SA UR-E9 and T op] O-Globin-SA UR inserted between the SacI and ClaI sites of the
polylinker. The ToplO promoter consists of the EcoRI-BglII fragment of pToplO
(W einnann et al. , 1994). Coding regions and 3'UTRs are identical to the corresponding
constructs driven by the 358 promoter. To generate the 3SS-Teth16 construct, the
EcoRI-HindIII fragment containing sequences encoding TETVP16 from the plasmid pTetl-
Vp16 described by Weinnann et al. (1994) was inserted between the EcoRI and HindIII
sites of the binary vector pBIG-HYG (Becker, 1990). Site-directed mutagenesis of the
ATAGAT sequence of the DST element was performed as described by Kunkel et al.
(1987). We used as a template a Globin-SA UR pBluescript SKII(-) intermediate vector and
the primer: 5' GGAATATACAATACGCATGCCGTAATTGATC 3'. ATAGAT mutant
clones were screened for the presence of the SphI restriction site present in the mutagenic

oligo and their identities were confirmed by DNA sequencing.

Auxin and cycloheximide treatments

Transgenic etiolated seedlings from Arabidopsis and tobacco were sectioned at the base
of the hypocotyls and the roots were discarded. The hypocotyls were cut into 2- to 3- mm
sections and incubated in KPSC (10 mM potassium phosphate, pH 6; 2% [w/v] sucrose,

50 p.M chloranphenicol) medium for 4 hours to deplete endogenous auxins (McClure and

13

Guilfoyle, 1987). Samples were transferred to fresh buffer with or without 50 p.M 2,4-D

or 70 uM cycloheximide for 1h at 28°C and then frozen in liquid nitrogen.

Histochemical Analyses

Intact seedlings and hand-cut sections were placed directly into a solution containing 1 mM
X-Gluc, 0.025 mM KFeCN, 0.025 mM KzFeCN, 0.01% Triton X-100, 50 mM NaH2P04
pH 7, 1 mM EDTA and 10 mM p-mercaptoethanol and vacuum infiltrated for 30 minutes.
Subsequently, they were incubated at 37°C for 12 hours or until sufficient staining
developed. Destaining and mounting of the samples were performed as described by
Benfey et al., (1989). Photographs were taken using a Wild M420 microscope

(Heerburg).

Sl Nuclease Protection Analysis

The 5' end of the SAUR-A C1 mRN A was analyzed by S1 nuclease protection as described
previously (Newman et al. , 1993), with minor modifications. The probe was a single-
stranded DNA fragment covering the sequence from -414 to +141 in Figure 3-1 that was
labeled according to Nagy et al. (1987). A primer complementary to the sequence from
+119 to +141 was used to prime synthesis of the probe and generate a sequencing ladder
to size the protection products. 20 pg of total RNA from Arabidopsis seedlings treated

with 2,4-D as described above were used for the SI nuclease protection reaction.

14

RNA isolation and Northern Blot Analysis

Total RNA was isolated from 7 to 10-day old etiolated seedlings, fully developed leaves
from mature tobacco plants or BY-2 cells, essentially as described by Newman et al.
(1993), except that a second phenol extraction was performed after solubilizatium of the
lithium chloride precipitate. Total RNA samples were denatured and separated on
formaldehyde/agarose gels. Following transfer to Biotrace HP (Gelrnan), the blots were
treated as described by Taylor and Green (1991). Radioactive DNA probes were
synthesized using a random primed DNA kit (Boehringer) as recommended by the
supplier. Coding region probes were made using as templates XbaI-BamHI fragments
isolated from pBluescript intermediates. The probes were GUS, Globin, SA UR and CA T.
3'UTR probes were made using as templates BamHI-Clal fragments from pBluescript

intermediates. The probes were E9 and SA UR.

Half-Life Determination

Half-life determinations were performed on stably transformed BY-2 cell lines three to
four days after subculture. Tetracycline was added to the culture to a final concentration
of 10 ug/mL, and 10 mL samples were removed from the culture every 15 min for 75
min. Each sample was immediately sedimented at 700 g for 1 min and frozen in liquid
nitrogen. Following analysis of the RNA on RNA gel blots as described above, signals
were quantified using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). The
values for each time course were subjected to linear regression analysis using SigmaPlot

(Jandel Scientific, Corte Madera, CA) to calculate mRNA half-lives.

CHAPTER 3

CHARACTERIZATION OF THE SA UR-ACI GENE FOR USE AS A

MOLECULAR GENETIC TOOL IN ARABIDOPSIS

16

RESULTS

Structure of the SA UR-A C1 Gene

The soybean SA UR genes contain several stretches of highly conserved amino acids and
no introns (McClure et al. , 1989). Based on these observations, we devised a strategy to
generate an Arabidopsis SA UR probe from genomic DNA using the polymerase chain
reaction (PCR). Oligonucleotide primers corresponding to the most highly conserved
regions of the soybean SA UR genes were synthesized as described in Materials and
Methods, and used to amplify Arabidopsis genomic DNA. A major amplification product
of the expected size (about 140 bp) was isolated, reamplified and cloned into a plasmid
vector. The inserts from twenty-five clones were partially or completely sequenced, but
only one was found to contain sequences homologous to the soybean SA UR genes. This
insert was used as a probe to isolate genomic and cDNA clones of the corresponding gene,
which was designated SA UR-A CI (for Arabidopsis Columbia SA UR gene 1).

Figure 3-1 shows the nucleotide and deduced amino acid sequence of SA UR-A C1.
Similar to soybean SA UR genes (McClure et al. , 1989), SA UR-ACI potentially encodes
a small (89 amino acid) polypeptide and contains no introns. Approximately 400 bp of the
promoter region and 500 bp 3' of the gene have been sequenced, allowing for the

identification of a TATA box at -39, and two putative poly(A) signals (underlined

17

Legend to Figure 3-1. The nucleotide and deduced amino acid sequences of the SA UR-
ACI gene. Capitalized nucleotides indicate transcribed sequences. Numbers on the left
refer to the nucleotide sequence. The first nucleotide of the SA UR-ACI mRN A is
numbered +1. The sequence for the putative TATA box (-39) and promoter sequences (Z
element, -51; DUE element, -84; NDE element, -105; A box, -255) found in other auxin-
regulated promoters, and in the SA UR-A CI promoter, are boxed. A DST element in the
3' UTR is indicated by shading. Two possible poly (A) signals are underlined. All
nucleotide positions designate the 5'-proximal nucleotide of the corresponding sequence.

This figure represents the data derived from sequencing SA UR-A CI cDNA and genomic
clones.

Cloning and sequencing of the genomic clones were performed by Yang Liu and Elizabeth
Verkamp

18

-616 tag tea aat ttt ect tte ttg cca can eat ttt ttt see one ttt tot
-368 aae ttt ate act ata taa tea aat eat gtg ate eta tct ttt oaa tat
-320 eat tga gaa aea got ata act tea tea gtg ata can act tot not tea
-272 tta got aea caa ett efiE aea taa tet ata gag aea ttt age
-226 ata tga tot ett tea nae aaa taa gee eea ata aae tta tea tat ago
~176 aea tea tta aae act aae ttc tea nae ace att tat tea ttt gtt ett
-128 not tta gta tet aea aee eaa aieat gtg etc tot aafl taa afia:

-80 aaa eet eaa }a tae tta ate att tet t- teg t-

-32 eaa ata act aaa cec ett tan att eac aaa ctA AAG AAG ATc CAA TTT

 

17 TAA AAT CTC AAA GCT TTC TCC AAG ACT AAG AAA CAT TTA AGC TTC AGG

Met Ala Phe Leu Ara Ser Phe Leu Gly Ala
65 AAA ACA TAA 666 AAA ATA ATG GCT TTT TTG A66 AGT TTC TTG GGT GCT

Lye Gln [la [la Arg Arg Glu Sar Ser Ser Thr Pro Ara Gly Phe "at
113 AAG CAA ATT ATT CGA AGG GAA TCA TCG TCG ACA CCA AGA 66A TTC ATG

Ala Val Tyr Val Gly Glu Asn Asp Gln Lye Lye Lya Ara Tyr Val Val
161 sec GTc TAT GTA GGA GAG AAT GAT GAG AAG AAG AAG AGA TAT GTG GTG

Pro Val Ser Tyr Leu Asn Gln Pro Leu Phe Gln Gln Leu Leu Sar Lye
209 CCG GTT TCA TAG TTA AAC GAG CCT TTG TTT CAA CAA CTG TTG AGT AAA

Ser Glu Glu Glu Phe Gly Tyr Asp His Pro "at Gly Gly Leu Thr lle
257 TCT GAG GAA GAG TTT GGT TAT GAT CAT CCA ATG GGC GGC TTA ACA ATA

Pro Cya His Gtu Sar Lou Phe Phe Thr Val Thr Ser Gln Ila Gln *
305 CGA TGT CAT GAA TCT TTG TTC TTC ACA GTc ACA TCT GAG ATA GAA TGA

353 ACT ACT ATA CTA CAA CAT TTC CAT ATT TTT TTT AGA TTG TTA GCT AAT
gfiftfizzfij-Efi:‘-Z’:T-':‘.-.‘-‘Z"-T~T-.'-'~‘.~i"~2'T~T"’T~f"".~'.’.'2't-

1.01 TTC ccc TGG aea TAA TTG TAA ATT err TCA ATG aea

'I.‘(._‘.f.f.:‘j.f.)f(.:-f¢f.\f.“.:.:{.'ajf.‘_4f.>f.f.:.'_.:.’.:(.:.f¢:-ja“~fpxjnf-fiflfx.\x¢xl ‘ '

- -.‘.-‘. 233.1 .

 

      

TTT GCA TGT T88 tac att tot

497 etc ttg tae eaa aaa aag gaa tta tac att tgt ate att taa etc tag
565 aea eea tae att tea tea tta eag tga aae age aea att tga aea etc
593 att att eta gtt ggt agt tat tte cat att tct caa aga aea ttt ata
641 tea eta tta tea tte ett neg aea act gta ata atg aga aaa ett get
689 att ttt ttt 99c tet tea tat aag ttg ttt aaa ata sat tte gaa gee
737 eaa age eea taa att aaa ege eta aea tte aeg egc tet ttg act atg
785 gtt get tag gaa eag atg ege ata 999 can ttg yea cca ttt ttt etc
833 ttg ett aea tet att ttt ttt tet taa aea tet att tat ttg ett too
881 etc att gta aea ttt gtt tgt ttt ete tgt ate gtt agt tat tot aea
929 ctt ata eta tog aea ttg aae tgc not tag tee not tea get age att
977 ttt taa ata tae ate tat ttt ett att gat tat ata tat aat gtt att

Figure 3—1. The nucleotide and deduced amino acid sequences of the SA UR-ACI gene.

19

in Figure 3-1) located at +439 and +446 (37 and 44 bp, respectively, upstream of
poly(A) addition site of the cDNA clone).

The calculated molecular mass and isoelectric point of the SA UR-A C1 polypeptide
are 10 RD and 9.2, respectively. The amino acid sequence does not contain a typical
signal sequence, ER retention signal, or N -glycosylation signal, suggesting that the SAUR-
ACl polypeptide does not enter the secretory pathway. However, it is possible that SAUR-
ACl is a nuclear protein because it contains two short regions of basic amino acids (amino
acids 18 to 23 and 47 to 50, as numbered in Figure 3-2) that may form a bipartite nuclear
localization signal (Raikhel, 1993).

The deduced amino acid sequence of SAUR-AC1 is aligned in Figure 3-2 with that
of the soybean SA UR consensus (McClure et al. , 1989) and a mung bean SA UR cDNA,
designated ARG7 (Yamamoto et al. , 1992), that was recently isolated. The soybean SAUR
genes are least similar upstream of amino acid 31 (McClure et al. , 1989), and the SA UR-
AC1 gene shows little similarity to the soybean or ARG7 sequences in this region. In
contrast, the sequences are highly similar within the region amplified initially with PCR
from amino acid 38 to 87. Between these residues, SA UR-ACI is 78% identical to the
soybean SAUR consensus and 80% identical to the ARG7 amino acid sequence. Over the
same region, the nucleotide sequence of SAUR—A C1 is 75 % identical to that of ARG7 and
74% identical to the soybean prototype, SA UR-15A (McClure et al. , 1989). There were
two mismatches between the SAUR-AC1 nucleotide sequence and each of the two primers

used for PCR, which could explain the low frequency of SAUR clones isolated in that

20

.> .3 .m 98 mm .M
.m ”> .2 J 4 mm d ”O .2 ”H .m .< “mm 395% 0.3 man ofifim .835m .828 55 86a 038a 3:86 98 83.8%,“ 5:»
coo—ES can mEom 058w Rowena .Aamfl . .3 co 8335C neon mesa Bob <75”. may? 65 c5 Ema . .3 Ho 23 02.6 85%
us Em. cavemen 05 c8 35.58 38088 05 . B “.55 Va. no 88258 Box 285 coon—eon 05 no 825%? .N-m Pawwm

O<WQUMBH=OhAommUmHfidolxmmorummmm<0mdaoomdm0242m>mH>LMIIxttzmu>w>4qroxmmdoa>¥mm<ltIflZfl‘lllmdfifixHumthoz Addcn OGSIV hOM<

c u «a. «cca caeoae aaeaeccaae. ccc acaaaac cacao. .a a cacao... . a" a" a a
OIIHOmB>BLhAmm=UmHaaooxm=o>ummmmmxmAJOOmAmqu>m>m>>>mxxxoozmo>>><xhoutmalltmmmmmmHHox<uahmltlmqtlllh<2 HU<nmb¢u
" ca. a" a aaeaceaccaaacaaca. «at ca aaeaeeaa. .a. .e. a «cacao. " a a «a a" a a
.naonaou. momzumzoo ga<w

zutaomaanum>ummomHaqooaazuyuammm<ouqqcommmvzH>m>mH>cmuaxuunoo>>>oHyoxte>c>oxmmouuuumcouuumoumeeaammoz

ooH mh om mN a

21

experiment (<5%). Beyond amino acid 87, three of the five amino residues most highly
conserved among the soybean SA UR genes are also found in SA UR-A CI . There are
conservative changes at the other two positions. The overall size of the coding region is
similar for all SA UR genes.

The promoter region of SA UR-A CI contains several sequence motifs that are
homologous to those found in the soybean SAUR genes and other auxin-inducible genes
(see boxes in Figure 3-1). These include the first 6 bp of the 8-bp A box and the last 7
bp of the 10-bp Z element, implicated in auxin induction of the pea PS-IAA4/5 and PS—
IAA6 promoters (Ballas et al. , 1993), and nos promoter (An et al. , 1990), respectively.
SA UR-ACI also contains a 12/14 bp match with the DUE element, and a 12/16 bp match
with the NDE element, which are the most highly conserved sequences in soybean SA UR
promoters (McClure et al. , 1989). Thus, there are many candidates for auxin-responsive
elements upstream of the SA UR-A C1 TATA box.

In Southern analyses shown in Figure 3-3, a probe covering the SA UR-A C1 coding
region hybridizes to a single band of genomic DNA unless the coding region contains a
site for the restriction enzyme used (e. g., Hinc II and Ach). The lack of detection of
other SA UR genes in these hybridizations, which were performed at high stringency,
indicates that this probe is specific for the SA UR-A C1 gene under these conditions.
Several faint bands can be detected in most digests if low stringency conditions are used

(data not shown). This is consistent with the observation that other SA UR genes are .

22

 

A s c
+ +
I s H H C A
21.2-
-
.0-
42- - .fi
2.0- .
1.5— .
1.3- “
0.9-
B
—->
I 1 I]
I——'1
11(1)

Figure 3-3. Southern blot hybridization analysis of the SA UR-ACI gene. (A) Samples of
10 pg of Arabidopsis genomic DNA were cut with HincII (I), SacI (8), Sad and HindIII
(S +H), HindIII (H), ClaI (C) or ClaI and Ach (C+A) as indicated. The blot was
hybridized to a 32P-labeled probe covering the SAUR-A C1 coding region as described in
Materials and Methods. Size markers in kb are indicated on the left. (B) Partial
restriction map of the SA UR-A C1 gene derived from the genomic clone and its nucleotide
sequence. Restriction enzymes abbreviations are as in (A). The arrow indicates the
position of the SA UR-A C1 coding region.

23
present in Arabidopsis (Guilfoyle et al. , 1992), but the sequences of these genes and their

regulatory properties have not been described.

Structure of the SA UR-ACI mRN A

To map the 5' end of the SAUR-AC1 mRNA, a single-stranded probe covering the region
between —414 and +141 was annealed to total RNA from 2,4—D treated seedlings and
digested with $1 nuclease, as described in Materials and Methods. Figure 3-4 shows the
S1 protection products electrophoresed adjacent to a sequencing ladder of the probe. The
5' ends are clustered within a 7-bp region, with start sites at two A residues (see asterisks
in Figure 34) being favored. The A residue designated as +1 in Figure 3-1 corresponds
to the most 5’ of the two As.

The 3' end of the SAUR-AC1 mRNA shown in Figure 3-1 (at +485) was deduced
from the position of poly(A) addition within the cDNA clone. Since only one cDNA clone
was isolated, the presence of additional 3' ends cannot be ruled out; however, if they exist
they may be located nearby, because the two putative poly(A) signals are adjacent to each
other at about the expected distance (Mogen et al. , 1992) from the poly(A) site of the
cDNA. Perhaps the most interesting sequence motif conserved among the 3' ends of SAUR
genes is the DST element implicated in mRNA instability. One feature of DST sequences
is that they consist of three highly conserved sequences separated by two more variable
sequences (McClure et al. , 1989; Newman et al. , 1993). As shown in Figure 3-5, SAUR-
ACI contains a DST element with these characteristics that is located 10 bases upstream

of the poly(A) addition site of the transcript (see Figure 3-1).

24

I III -'
*8

]>

a

II III I
:3 ' «1.11:.

'1
1

/ \

Q>>004>m>gm>g>qo>>>q

”N 11 35'

I
I
1

Figure 3-4. S1 protection analysis of the 5' end of the SA UR-ACI transcript.
Transcriptional start sites were detected by alignment of the protected DNA fragment with
a sequencing ladder of the sense strand of the SA UR-ACI DNA. The major protection

products in the 81 lane are marked with asterisks on the nonsense strand sequence to the
right.

This experiment was performed by Yang Liu

SE

cy

SO

8x:

Til

alc

25

Induction of SAUR-AC1 Expression in Wild-type and Mutants of Arabidopsis
Most studies of SA UR gene expression in soybean have been conducted using etiolated
elongating soybean hypocotyl sections that respond rapidly to auxin treatment (McClure
and Guilfoyle, 1987; McClure et al. , 1989). In an effort to use an analogous system to
investigate the effect of auxin on SA UR-ACI , we performed a series of induction
experiments using segments of etiolated Arabidopsis seedlings as described in Materials
and Methods. Seedlings were incubated for 4 h in buffer in order to deplete endogenous
auxin (McClure et al. , 1989) and then treated with either the synthetic auxin 2,4—D or the
natural auxin IAA for 1 h. The level of SA UR-ACI is below the level of detection
following the depletion step as shown in Figure 3-6, and the same was true in untreated
seedlings (data not shown). Treatment with either 2,4-D or IAA led to a significant
induction of the SA UR-A CI mRN A. The effect of the protein synthesis inhibitor
cycloheximide (CHX) was also investigated because of the inductive effect of CHX on the
soybean SA UR genes (Franco et al. , 1990). A very large increase in SA UR-A C1
expression was observed following a 1-h treatment with CHX as shown in Figure 3-6.
Treatment with 2,4-D plus CHX induced only slightly more SAUR-AC1 mRNA than CHX
alone. This is in contrast to the superinduction of SA UR mRN A that occurs in soybean
seedlings subjected to treatment with 2,4-D and CHX (Franco et al. , 1990).

One of the main reasons for isolating an Arabidopsis SA UR gene is its potential

26

 

 

 

 

 

 

 

 

 

 

SAUR-ACT sroe 83 ?A— 1 1 ———ATAGATCGT— a -—AIATG GTATT
SOYBEAN 3109 19 — GIT—ATAGATTaG— 7/8 —p1m111't GTAcA
SAUR consensus (TA

ARG7 srop— 14 —ET— 6 —IATAGAT'I'AG— a — fl 1 1 6751111

 

 

 

 

Figure 3-5. Alignment of DST sequences found in SA UR genes. Nucleotides that are
identical in SA UR-A C1 , ARG7, and the soybean consensus described by McClure et al.
(1989) are boxed. The number of nucleotides in the variable regions separating each box
or separating the DST elements from their respective STOP codons are indicated.

de

27

use as a molecular probe to study signal transduction in a system amenable to molecular
genetics. Therefore, it was of interest to investigate whether known mutants of
Arabidopsis exhibit deficiencies in the expression of SA UR-A CI . We chose to focus on
mutants with altered auxin and gravity responses because the influence of both of these
stimuli on SA UR expression in soybean has been well documented.

Figure 3-7A shows a comparison of SA UR-A C1 expression in wild-type and two
auxin-resistant mutants of Arabidopsis, following 2,4-D treatment for l h. The most
severe effect on transcript accumulation was exhibited by seedlings of the aer-I mutant,
where little or no expression was routinely observed. As shown in Figure 3-7C, when
expression is observed in aer-I, the level is less than 5% of the wild-type level. The
auxI-7 mutant induces about 45 % less SA UR-ACI mRN A than the wild type.

Defects were also observed when gravity-response mutants (Bullen et al. , 1990;
Bullen, 1992) were assayed for SAUR-A C1 expression. Seedlings of two of these mutants,
ngO and mg421, exhibit reduced induction of SA UR-ACI mRN A in response to 2,4-D,
whereas seedlings of the third (mg65) induced wild-type levels of the mRN A (Figures 3-7B
and 3-7C). None of the gravity-response or auxin-response mutants in this study express
detectible SA UR-A C1 mRN A in etiolated seedlings without 2,4—D treatment (data not

shown).

28

- 244-DIAACHX +

-1 .28

-o.7s
94m» . .~ -o.53

-0.40

Figure 3-6. Northern analysis of SA UR-ACI mRNA levels in etiolated seedlings of
Arabidopsis. Seedlings were depleted for endogenous auxin, and then subjected to one of
the following l-h treatments: none (-); 50 pM 2,4-D (2,4—D); 10 pM IAA (IAA); 70 nM
cycloheximide (CHX); or 50 pM 2,4—D, 70 ”M cycloheximide (2,4-D + CHX). Samples
of 20 pg of total RNA were separated on a formaldehyde gel and blotted to nylon
membrane. The blot was hybridized with a 32P-labeled probe covering the SA UR-ACI
coding region as described in Materials and Methods.

29

DISCUSSION

The isolation and characterization of the SA UR-A C1 gene of Arabidopsis described in this
report serves two important purposes. First, because Arabidopsis is rather distantly
related to the legumes from which the other reported SA UR genes derive, the structural
features conserved in SA UR-ACI should suggest which characteristics are of importance
to SAUR genes in general. Second, the identification of an auxin-regulated SAUR gene of
Arabidopsis provides a means to exploit the unique genetic resources of this model system
so that the nature and mechanisms of auxin respOnses can be investigated at the molecular
level.

Within the promoter regions of the soybean SA UR genes, the most prominent
conserved elements are the NDE and DUE elements, both of which are also found in the
SAUR-A C1 promoter, albeit in the opposite order. Several other sequence motifs that have
been implicated in auxin-responsive expression, either experimentally or on the basis of
sequence conservation, are also present upstream of the SA UR-A C1 transcription start site.
In addition to the A box and the Z element shown in Figure 1, the SA UR-A C1 promoter
contains multiple copies of both the R and CCATT elements conserved among other auxin-
inducible genes (Conner et al. , 1990; Gielen et al. , 1984, Slighton et al. , 1986; Hagen et

al. ,1991). In the future, it should be possible to employ deletion and gain of function

30

Legend to Figure 3-7. Expression of SA UR-A CI in auxin-resistant and gravity-response
mutants of Arabidopsis. (A) SA UR-ACI mRN A accumulation in wild-type and auxin-
resistant mutants of Arabidopsis ecotype Columbia. 03) SA UR-A CI mRN A accumulation
in wild-type and gravity-response mutants of Arabidopsis ecotype Estland. Northern blots
contained 20 pg total RNA per lane from wild-type or mutant seedlings following 2,4-D
treatment as described for Figure 6. (C) Histogram of the relative accumulation of SA UR-
ACI mRN A in 2,4-D treated, etiolated seedlings of Arabidopsis mutants expressed as a
percentage of the expression in the appropriate wild-type parent. The results represent the
data average :1: the standard deviation from three independent experiments, each of which
has been normalized to an endogenous internal standard as described in Materials and
Methods.

The gravity—response mutants were analyzed in collaboration with Vladimir Orbovic and
Ken Pofi

31

 

 

 

 

Figure 3-7. Expression of SAUR—AC1 in auxin-resistant and gravity—response mutants of

Arabidopsis.

SC

aft:
Cha
"1211

31m

32

experiments to delineate the contribution of each of these sequence motifs to the
transcriptional control of SAUR-AC1.

Another potentially important sequence, the DST element, was identified in the 3'
UTR of the SAUR—AC1 transcript. DST sequences have also been identified downstream
of the other SAUR coding regions. As in the case of SAUR-AC1, the cDN A sequence of
ARG7 (Yamamoto et al. , 1992), demonstrates that the DST sequence falls within the
transcribed region. The other SA UR mRN As have not been mapped, but based on the
proximity of the DST sequences to the coding regions in the soybean SA UR genes, it is
likely that the DST elements are transcribed as part of the mRN As in these cases as well.
DST sequences have been proposed to contribute to the instability of the soybean SA UR
transcripts (McClure et al. , 1989., Li et al. , 1991) and recently it was shown that DST
sequences can destabilize both GUS and globin reporter transcripts in tobacco (Newman
et al. , 1993). These observations indicate that the DST element within the SA UR-ACI
mRN A may function as a determinant of mRN A instability. The alignment of DST
sequences among SAUR genes (see Figure 3-5) demonstrates that the ATAGAT and GTA
sequences in the second and third blocks are invariant and thus may be important
functional determinants.

The time required for a transcript to reach a new steady state (higher or lower)
after a change in transcription is dependent on the stability of the mRNA. A common
characteristic of unstable transcripts is that they can be induced or repressed rapidly. The
marked induction of the SA UR-A C1 mRN A within 1 h in response to natural and synthetic

auxins is therefore consistent with the transcript having a short half-life. In addition, many

Ill
1’6:

101

33

unstable transcripts can be induced by CHX, as is SA UR-A CI . At present it is unknown
whether the CHX effect occurs because 1) a labile trans-acting factor required for rapid
mRN A degradation or transcriptional repression is depleted, or 2) rapid degradation of the
SA UR mRN A requires translation in cis. The soybean SA UR genes are also induced by
CHX but this induction differs from that of SA UR-A CI in two respects. First, for the
soybean SA UR genes, the mRN A accumulation following CHX treatment is only sightly
greater than that following 2,4-D treatment. However, in the case of SA UR-ACI , CHX
is a much stronger inducer of mRN A accumulation than is 2,4-D. The second difference,
which is particularly striking, relates to the lack of superinduction of SA UR-ACI when
CHX and 2,4—D treatments are combined. With the soybean SA UR genes, a prominent
superinduction effect was observed under the same conditions (Franco et al. , 1990). This
distinction indicates that the mechanisms by which CHX, and/or 2,4-D, act to induce
SA UR-ACI and the soybean SA UR genes may differ.

One of the most promising approaches to the study of plant regulatory mechanisms
is the isolation and analysis of mutants. In Arabidopsis, a number of mutants have been
isolated that exhibit altered responses to hormones and to external stimuli that are
presumed to be mediated by hormones. Although most of these mutants have been
thoroughly characterized physiologically, in many cases the molecular analysis has been
limited by the lack of availability of suitable molecular probes. The work described in this
report demonstrates that the SA UR-A C1 gene should provide a useful molecular marker

for the study of both gravity and auxin-response mutants because seedlings of several of

ir

ir

At

0.1

34

these mutants have observable defects in SAUR—A CI expression. The auxin-responsive
mutants investigated in this study, aux1-7 and aer-I, were both isolated as auxin
resistant, but they differ from each other with respect to many other characteristics such
as their inheritance pattern, resistance to other hormones, response to gravity, and patterns
of growth (Pickett et al. , 1990; Wilson et al. , 1990). Therefore, it is not surprising that
the aux1-7 and aer-I mutations have different effects on SA UR-A C1 expression. The
accumulation of the SA UR-ACI transcript in response to 2,4-D is almost completely
blocked in etiolated seedlings of aer-I whereas only a modest reduction is evident in
aux1-7 seedlings. At present it is unknown whether the residual effect of the auxI-7
mutation on SAUR-AC1 expression is due to incomplete inactivation of the AUX] gene
in this mutant or because the mutation alters a pathway that is not totally responsible for
induction of SA UR-A C1 by auxin.

A modest reduction in expression of SAUR-A C1 is also seen with two of the three
gravity-response mutants analyzed. Although all of the mutants studied (including the
auxin-resistant mutants) have some defect in gravitropism, this defect does not appear to
correlate directly with SA UR-A C1 mRN A levels in the mutant seedlings. In mg20,
gravitropism is normal in root but altered in stem (Bullen, 1992; Wilson et al. , 1990),
whereas in aux1-7 the opposite is true. mg421 exhibits defects in both root and stem
gravitropism (Bullen, 1992); yet mg20, aux1-7, and mg421 have similar effects on SAUR-
ACI expression in seedlings (Fig. 3-7C). This lack of correlation also extends to mg65 and

aer-I , both of which affect the gravity response in roots and shoots. Little or no SA UR-

35

AC1 expression was detected in axr2-1 seedlings, while mRN A accumulation was induced
normally in mg65. However, it should be noted that defects in gravitropism may be more
likely to affect the distribution of the SA UR-ACI mRN A rather than its overall
accumulation in the seedling. Work done with soybean SA UR genes has demonstrated that
the redistribution of SAUR expression can be visualized using tissue printing (McClure and
Guilfoyle, 1989) or promoter fusion studies (Li et al. , 1991). Similar studies with the,
SA UR-ACI gene may now be designed to reveal more subtle defects among the mutants
affecting the gravity response.

The most obvious difference among the mutants studied in this report has to do
with growth. With the exception of aer-I, all of the mutants exhibit a normal stature.
In contrast, aer-I, which is the most deficient in SAUR-AC1 expression, displays an
extreme dwarf phenotype and very short internodes (Wilson et al. , 1990). Examination
of the cellular anatomy of aer-I has indicated that the primary reason for the shortened
internodes is a reduction in cell elongation rather than cell number (Timpte et al. , 1992).
Although the rapid induction of cell elongation by auxin is well documented, it has been
difficult to attribute the elongation deficiency in aer-I to a defect in auxin action because
this mutant is highly pleiotropic (Wilson et al., 1990). However, SAUR expression is
highly correlated with the rapid effects of auxin on cell elongation. Therefore, the strong
effect of aer-I on SA UR-ACI expression and on elongation lends support to the
possibility that the growth defect in aer-I is the direct result of a defect in auxin action.

SA UR-A C] may be useful not only in the evaluation of known phenotypes of auxin

36

and gravity-response mutants, but may also detect phenotypes that are not morphologically
evident. Moreover, the SA UR-ACI gene will likely be an expedient tool in evaluating
double mutants for epistatic relationships and thus aid in efforts to elucidate how the
components that comprise auxin signal transduction chains interact. Conversely, it is also
likely that the aforementioned mutants can be used to enhance future expression studies

of the SA UR-ACI gene as well as studies of SAUR function.

CHAPTER 4

EFFECT OF PROMOTER SEQUENCES ON THE EXPRESSION OF SA UR-ACI

38

RESULTS

Analysis of the activity of the SA UR-ACI promoter region in Arabidopsis plants

One of our goals was to test if the promoter region of SA UR-ACI controls transcript
accumulation in Arabidopsis. With this aim in mind, we constructed a chimeric gene with
the promoter region of SA UR-A CI fused to a GUS reporter transcript. Etiolated seedlings
of transgenic Arabidopsis plants from two independent lines containing the SA UR-GUS-E9
test gene and the 35S-CAT-3C reference gene (Figure 4-1) were subjected to auxin or
cycloheximide treatments. These treatments were identical to those found to induce
accumulation of the endogenous SA UR-A C1 transcript in Arabidopsis (Chapter 3). The
accumulation of the test and reference transcripts was monitored by Northern blot analysis
as shown in Figure 4-2. The SA UR-A C1 promoter region (-2300 to +30) directed low
GUS transcript accumulation in etiolated seedlings depleted of endogenous auxins. When
auxin was supplied exogenously, the GUS-E9 transcript accumulated to significantly
higher levels. A similar effect was observed in seedlings treated with cycloheximide. Such
treatments had little effect on the accumulation of the reference transcript. This indicated
that changes in GUS-E9 mRN A levels were specifically mediated by the SA UR-A C1
promoter region and not due to a general increase on transcriptional activity of auxin- or

cycloheximide treated cells.

39

Legend to the Figure 4-1. Vector with test and reference genes. The SA UR-GUS-E9
gene was engineered into the binary vector p841 as described in Materials and Methods.
The SA UR-GUS—E9 test gene contains a 2Kb region of SAUR-AC1 followed by the coding
region of GUS gene and the E9 3'UTR, derived from the pea RBCS-E9 gene. The
construct containing the SA UR—GUS-E9 test gene also includes a 35S-CAT-3C reference
gene. This gene consists of the 35S promoter followed by sequences encoding a bacterial
chloranphenicol acetyl-transferase (CAT) and the 3' UTR of the pea RBCS-3C gene.
Arrows indicate the direction of the coding regions.

 

4O

 

  
     
  

 
 

RK2
replicon

Right border

Figure 4—1. Vector with test and reference genes.

41

.23? we
may "0

+ 4-
2,40 CHX

Figure 4-2. Induction of the SA UR-ACI promoter in transgenic Arabidopsis. Northern
blot of 20 pg of RNA isolated from transgenic Arabidopsis containing the SA UR-GUS—E9
test gene and the 3SS-CAT—3C reference gene. Sections of etiolated seedlings (progeny of
regenerated transgenic plants) were depleted of endogenous auxin (-) or additionally
treated for 1 hour with 50 pM 2,4-D (2,4—D) or 70 pM cycloheximide (CHX). The blot
was hybridized with a GUS probe and a CAT probe.

42

We also sought to identify the Arabidopsis tissues where the SA UR-A CI promoter
is active. Such tissues are potential targets for SA UR-ACI mRNA accumulation, thus
indicating where the regulatory machinery is most likely to be active. A histochemical
analysis of transgenic Arabidopsis plants containing the SA UR-GUS-E9 gene described
above was therefore performed. Promoter activity can be monitored in transgenic plants
indirectly by observing where the activity of the GUS gene product, p-glucuronidase, is
located. This method has been used extensively to localize the activity of a variety of plant
promoters. Figure 4-3 shows the tissues where the SA UR-ACI promoter is active in
Arabidopsis. This pattern of expression was confirmed by analyzing three transgenic
lines. The SA UR-A C1 promoter was active in plants grown both in darkness and light.
GUS activity was present in all aerial tissues of etiolated seedlings (Figure 4-3A, upper
panel). However, it was notably predominant in the elongating region of the hypocotyl
(Figure 4-3A lower panel). Moderate GUS activity was occasionally detected in root tips
(Figure 4-3A lower panel). Floral stems of light grown plants displayed highest GUS
activity in cortical cells and vascular tissues (Figure 4-3C), although low GUS activity was
also present in other tissues. Transverse sections of rosette leaves indicated high GUS
activity in the vascular tissue, epidermis and adjacent cortex in the midrib, and in
mesophyll cells of the lamina (Figure 4-3D). In addition high GUS activity was also

detected in mature flowers (Figure 4-3E).

43

Legend to the Figure 4-3 Histochemical analysis of the expression of the SA UR-GUS-E9
gene in transgenic Arabidopsis. (A) 7—day old etiolated seedling. (B) 7-day old light
grown seedling. (C) Transverse section of floral stem. (D) Transverse section of midrib
of a rossette leaf. (E) Mature flower

 

Figure 4-3. Histochemical analysis of the expression of the SAUR-GUS—E9 gene in
transgenic Arabidopsis.

45

Analysis of the activity of the SA UR-A C1 promoter region in tobacco plants

The next question to address was whether the SA UR-ACI promoter was regulated in a
similar fashion in tobacco. This was important because we wanted to use tobacco, a plant
easily transformed, as a model system to understand the role of SA UR transcribed
sequences in regulating transcript accumulation. The use of tobacco would allow the
transcripts of the transgenes to be monitored by Northern blot analysis, without
interference from the endogenous SA UR-A C1 transcript. In addition, the soybean
SA UR10A promoter was previously characterized in tobacco using 3 SA UR-GUS promoter
fusion (Li et al. 1991). Thus, the study of the activity of the SA UR-ACI promoter in
tobacco allows the activity of both SA UR promoters to be compared directly.

The strategy used to study the activity of the SA UR—ACI promoter region in
Arabidopsis was also used to investigate the behavior of this promoter region in transgenic
tobacco. Etiolated seedlings of transgenic tobacco containing the SA UR-GUS-E9 gene
were depleted of endogenous auxins or treated with either 2,4-D or cycloheximide. The
co-transformed 35S-CAT—3C reference gene was also present in the transgenic seedlings
to serve as an internal standard. Northern blot analysis of mRN A accumulation revealed
that the SA UR-ACI promoter region was sufficient to direct auxin-inducible expression in
transgenic tobacco and accumulation of the GUS-E9 transcript upon treatment with

cycloheximide (Figure 4-4). The induction of the SA UR-ACI promoter under these

46

GUS
mRNA ) . .

CAT +4 -
mRNA) . . .

_ + +
2,40 CHX

Figure 4-4. Induction of the SA UR-A C1 promoter in transgenic tobacco. Northern blot
of 20 pg of RNA isolated from transgenic tobacco containing the SA UR-GUS—E9 test gene
and the 35S-CAT-3C reference gene. Etiolated seedlings were depleted yof endogenous
auxin (-) or additionally treated for 1 hour with 50 pM 2,4-D (2,4—D) or 70 pM
cycloheximide (CHX). The blot was hybridized with a GUS probe, stripped and
hybridized with a CAT probe.

47

conditions was nearly identical in tobacco and Arabidopsis, the only difference being that
the activity of the promoter appeared weaker in transgenic tobacco.

By using tobacco plants containing the SA UR-GUS-E9 reporter gene as a visible
marker, we have also performed a histochemical analysis of the transcriptional activity of
the SA UR-A CI promoter region in tobacco (Figure 4-5). The SA UR-ACI promoter is
mostly active in tobacco aerial tissues (Figure 4-5A). On occasion, we could detect low
activity in the root tips (data not shown). Etiolated seedlings showed a similar pattern in
tobacco and in Arabidopsis, but with lower GUS activity in tobacco (data not shown).
Stems of mature tobacco plants displayed highest GUS activity in epidermal cells, cortical
cells and vascular tissues (Figure 4-5B). Leaves also display high GUS activity with
expression in the vascular tissue, the epidermis and its adjacent cortex (Figure 4-5C).
Interestingly, an asymmetrical distribution of GUS activity was observed in the leaf
laminae. Strong GUS activity was consistently present in the palisade parenchyma of the
mesophyll (Figure 4—5D). GUS activity could also be seen in transgenic tobacco flowers

(Figure 4-5E).

DISCUSSION

The expression of the SA UR-ACI gene in plants, is regulated at at least two different
levels. The first level of regulation consists of the auxin-induction of SA UR-A C1 mRN A
accumulation that is mediated by the promoter region presumably by transcriptional

activation. The second level consists of the differential activity of the promoter

48

Legend to the Figure 4—5 Histochemical analysis of the expression of the SA UR-GUS-E9
gene in transgenic tobacco. (A) 7-day old tobacco seedling grown under white light
seedling. (B) Transverse section of stem from mature plant. (C) Transverse section of
midrib of a mature leaf. (D) Transverse section of the lamina of a mature leaf. (E) Petal

from a mature flower

49

 

 

Figure 4—5. Histochemical analysis of the expression of the SAUR-GUS—E9 gene in
transgenic tobacco

50

region of SAUR-AC1 in certain tissues of the plant.

With respect to transcriptional control of the accumulation of SA UR-A C1 mRN A,
we have found that the SA UR—A C1 promoter region is responsible for auxin induction of
the SA UR-ACI transcript. This is consistent with the presence of multiple sequences in
the SA UR-A C1 promoter which are conserved in other auxin-inducible promoters (Chapter
3). Less probable, but still possible is that other promoter sequences or a 30bp sequence
from the 5'UTR may participate in auxin induction. We have also found that
cycloheximide-induced accumulation of the SA UR-A C1 transcript is, at least in part,
mediated by promoter sequences. This indicates that this protein synthesis inhibitor is
likely to promote transcriptional activation of the SA UR-A C1 promoter, and suggests that
a repressor may be a component of the auxin signal transduction pathway. Alternatively,
cycloheximide could function to stimulate phosphorylation and thus stimulate
transcriptional activation. This latter effect has been detected studying the activity of
promoters from mammalian proto-oncogenes like c—fos and c-jun in cells treated with
cycloheximide (Edwards and Mahadevan, 1992).

By generating transgenic Arabidopsis plants containing the SA UR-GUS-E9 gene,
we also generated a potential tool for the study of auxin-signal transduction. First,
because the SA UR-A CI promoter is auxin inducible, these plants could allow mutants with
diminished auxin-induction of the SA UR-A CI promoter to be isolated. Limited auxin-
induction of SA UR-A C1 mRN A accumulation occurs in several auxin-resistant and gravity-

responsive mutants (Chapter 3). Second, plants containing the SAUR-GUS-E9 gene can

51

be crossed with mutants suspected to be affected in processes controlled by auxin.
Accordingly, the effect of the mutations on the activity of the promoter could be examined.

The second level of regulation of SAUR-AC1, namely the spatial pattern of mRN A
accumulation, is also most likely to be transcriptional, since the promoter region of SA UR-
AC] is preferentially active in certain plant tissues. In etiolated seedlings of Arabidopsis,
maximum activity of the promoter is localized to the elongating region of the hypocotyls,
a fact consistent with the proposed role of SA UR gene products in cell elongation
(McClure and Guilfoyle, 1989). In addition, transgenic tobacco stems display high
promoter activity in the epidermis, a tissue suggested to direct auxin-induced cell
elongation in stems (Nick et al. , 1990). GUS activity in epidermal cells was also observed
in Arabidopsis albeit at a lower level. In leaves, it is interesting that an asymmetry of the
distribution of GUS activity in mesophyll cells was observed, with stronger GUS activity
in the upper section of the leaves. Again this effect was more evident in tobacco, but
exhibited by Arabidopdsis as well. The high promoter activity in vascular tissues where
auxin has been implicated in the differentiation process (Clutter, 1960), indicates that
SA UR-A CI may play a role in cell differentiation in addition to auxin-induced cell-
elongation. To reveal possible roles of auxin in specific tissues, mutants with altered
localization of the expression of the SA UR-A CI gene can be identified and they could be
affected in a subset of auxin responses. Interestingly, the axr3 mutant is the first example
of a mutant which displays ectopic activity of the SA UR-A CI promoter in roots

(H.M.Ottoline Leyser, F. Bryan Pickett, Sunnethra Dharmaseri and Mark Estelle,

52

unpublished results).

In transgenic tobacco, the activity of the SA UR-A CI promoter shows a similar
pattern of tissue-specific expression in tobacco compared to the soybean SA URIOA
promoter. However, certain differences could indicate that there are divergences between
species or that different members of SA UR gene families are not expressed in identical
fashion. For instance, the presence of SAUR expression in mature floral organs seems
to be unique to SA UR-A CI . In contrast, the soybean SA URs are expressed in elongating
filaments of the stamen (Li et al., 1991). The different patterns of tissue-specific
localization of SAUR expression among divergent SA UR promoters should make it easier
to identify conserved promoter sequences mediating preferential expression in different

tissues.

CHAPTER 5
EFFECT OF TRANSCRIBED SEQUENCES OF SA UR-ACI ON mRNA

STABILITY

54

RESULTS

Effect of downstream sequences on SAUR-AC1 transcript accumulation

One of the goals of the experiments in this chapter was to test whether SA UR transcribed
sequences contributed to auxin- and cycloheximide-induced mRN A accumulation. To this
end, we used seedlings of transgenic tobacco plants containing the 35S-SA UR-SA UR test
gene and the 35S-GUS—3C reference gene (Figure 5-1). These seedlings were subjected
to treatments with 2,4-D and cycloheximide identical to the ones used to test the promoter
region (Chapter 4). The effects were monitored by Northern blot analyses. As shown in
Figure 5-2, application of the synthetic auxin 2,4—D had little effect on SA UR-A C1 mRN A
levels compared to the untreated control. The low induction of the 35S-SA UR-3C gene
after treatment with 2,4-D can be accounted for by a small inductive effect on the 358
promoter (1.4-fold increase in transcript accumulation for both GUS reference and SA UR
test transcripts). In contrast, there is a specific increase in the amount of the SAUR
message detected upon treatment with cycloheximide, compared to the GUS reference
transcript. Interestingly, when downstream sequences of the SAUR-AC1 were expressed
under the control of the strong 358 promoter, very little SA UR mRN A accumulated. This

indicated that downstream sequences constitutively limited the accumulation of the SA UR

55

Legend to the Figure 5—1. Structure of test and reference genes. A series of test and
reference chimeric genes made for this study are shown. First, second and third boxes
represent promoter region, coding region and 3'UTR respectively. The 35S-SA UR-SA UR
gene consists of the CaMV 35S promoter followed by the SA UR-A C1 gene coding region
and 3' UTR. The 35S-Globin-E9 and T opIO-Globin-E9 genes contain the 35S and Top10
promoters respectively, followed by the coding region of the human [S-globin gene and the
E9 3' UTR, derived from the pea RBCS-E9 gene. The 35S-SA UR-E9 and T op] 0-SA UR-E9
genes contain the 35S promoter and the Top10 promoter respectively, followed by the
SA UR-A C1 coding region and the E9 3' UTR. The 35S-Globin-SA UR and T op1 0-Globin-
SAUR contain the 358 and Top10 promoters followed by the p-globin coding region and
the 3' UTR of SAUR-AC1. The T opIO-Globin-MSA UR is identical to the T op1 O-Globin-
SA UR except the sequence ATAGAT in the 3 'UTR of SA UR-A C] was replaced by a SphI
restriction site. All constructs in which test genes are under control of the 35S promoter
also contain a 3SS-GUS-3C reference gene in which the GUS coding region is under the
control of the 35S promoter and polyadenylation signals are provided from the 3' UTR of
the pea RBCS—3C gene. Similarly, constructs in which test genes are under the control of
the ToplO promoter also include a Top] 0-GUS-3C reference gene. Test genes along with
suitable reference genes were engineered into the binary vector p951 (described in Chapter
2).

56

 

 

 

  

 

 

Globln
—B\Tjop‘10_\\| Globln [ 59 |-—
fifopflfi
—I\\fop‘10\\l Globln

 

 

 

AM"IAM-.LL%A‘ IM A..~ e-h gh‘u n... cat. ~..'.-.
6, '1

   

 

 

 

 

$\1‘opf10\ Globln

 

 

 

3c 1—
—|\ \rjopj1 q\\ff-i;::::g:?f~t-;;G935:5? $321 30 l-

 

 

Figure 5- 1. Structure of test and reference genes.

57

 

SAUR , t. u
MHNA ) .

GUS
mRNA > O .-

+ «1-
2,40 CHX

Figure 5-2. Effect of transcribed sequences on mRN A accumulation. Etiolated seedlings
(the progeny of a primary transforrnant expressing the 35S-SA UR-SA UR gene) were treated
as described in Figure 4-2. RNA was isolated from the treated seedlings and 20 pg per
lane was used for Northern blot analysis. The blot was hybridized first with a SAUR-AC1
probe, stripped and reprobed with a GUS probe to generate the upper and lower panels,
respectively.

58

transcript, an observation consistent with the idea that SA UR-A C1 mRN A is rapidly
degraded. To localize downstream sequences that limit SA UR-A C1 mRN A accumulation,
we have compared the mRN A levels of transgenes driven by an identical promoter
containing different regions of SAUR-AC1. Our strategy was to replace the coding region
or the 3'UTR of a control 35S-Globin-E9 test gene by equivalent SA UR-A CI sequences,
introduce the constructs into tobacco plants, and compare transcript accumulation. The
35 S-Globin-E9 gene consisted of the 358 promoter followed by the human p-globin coding
region and the 3' UTR of the RBCS-E9 gene (Figure 5-1). By replacing the p-Globin
coding region by the SA UR-A CI coding region, we generated the 3SS-SA UR-E9 test gene
(Figure 5-1). The 35S-Globin-SA UR test gene was generated by replacement of the E9
3'UTR of the 35S-Globin-E9 by the SA UR-ACI 3'UTR (Figure 5-1). In all constructs,
as well as in the 35S—SA UR-SA UR construct described above, there was also a 35S-GUS-
3C reference gene present on the same plasmid (Figure 5-1). We quantified test and
reference mRN A levels by Northern blot analysis from at least seven independent
transgenic tobacco plants for each construct. We compared pairs of constructs using the
common part of the chimeric transcripts as a probe in simultaneous hybridization. For
each plant, mRN A levels of test genes were normalized to the reference GUS-3C transcript
to help to minimize position effects. To examine differences in transcript accumulation
due to the coding region of SA UR—A C1 , the 35S-GLOBIN-E9 and the 35S-SA UR-E9 test
genes were compared (Figure 5-3A, first panel). For the same purpose, and also to test

whether the SA UR-ACI coding region and its 3' UTR might act synergistically, mRN A

59

Legend to Figure 5-3. The effect of SA UR-ACI transcribed sequences on mRNA
accumulation in transgenic tobacco plants. Dots represent test mRN A accumulation
normalized to the internal standard GUS mRN A accumulation (Test mRNA/GUS mRN A)
for each independent transgenic tobacco plant as determined by Northern Blot analysis.
Bars represent the average value for each construct. To monitor the effect of SA UR
transcribed sequences, test mRN A accumulation was compared for pairs of test genes that
differ only in the region to be tested. Blots to be compared were simultaneously
hybridized to the test probe which corresponded to the common part of the test transcripts
being compared as a probe and the GUS reference probe. (A) To monitor the effect of the
coding region, we compared mRN A levels from plants expressing the 3SS—Globin-E9 gene
to those of plants expressing the 35S-SA UR-E9 gene, and mRN A levels of plants
expressing the 35S-GLOBIN—SA UR gene to those expressing the 35S—SA UR—SA UR gene.
(B) To monitor the effect of the 3' UTR, we compared mRN A levels of plants expressing
the 35S-GLOBIN-E9 gene to those of plants expressing the 35S-GLOBIN-SA UR gene, and
mRN A levels of plants expressing the 35S-SA UR-E9 gene to those of plants containing the
35S-SA UR-SA UR gene.

6O

 

 

 

 

 

 

 

 

 

 

10‘ :
.2.
fi
0
8 .
l-
. -
s 8 °
:
.8 10"1 8 ‘
s = '
0
a 3
< c-
‘z‘ 3
I 10" 1
E :
10" r . . .
Globln SAUR Globln SAUR
ES 59 SAUR SAUR
Constructs
10' l
' 8
1 O
'8 10,1 .
§ : a
e l =
o“
o
5 .. - '
2 10 a
3 « 1 °
< O
< ° '
,2. z
E 10 j 8
104 r y l I
Globln Globln SAUR SAUR
ES SAUR £9 SAUR
Constructs

Figure 5-3. Effect of SA UR-A CI transcribed sequences on mRN A accumulation in
transgenic tobacco.

61

accumulation of the 35S-GLOBIN-SA UR and the 35S-SA UR-SA UR test genes were also
compared (Figure 5-3A, second panel). The data showed that replacement of the Globin
coding region by the SA UR coding region resulted in an average decrease in transcript
accumulation of about five-fold whether the coding region was followed by the E9 3' UTR
or the SAUR 3' UTR.

The SA UR-A C1 3'UTR was examined in a similar fashion for its effect on
transcript accumulation in transgenic plants. The data in the first panel of Figure 5-3B
shows a comparison of the abundance of the GLOBIN-E9 test transcript to the GLOBIN-
SAUR transcript. Expression levels of the 35S-SA UR-E9 gene were also compared to the
35S-SA UR-SA UR gene in the second panel of Figure 5-3B. Again the results were quite
similar with both sets of constructs. Presence of the SAUR-A C1 3'UTR caused a four-fold
and a six-fold decrease in mRN A levels when fused to the Globin or SA UR coding regions,
V respectively.

To further test the limited transcript accumulation due to SA UR-A C1 transcribed
sequences, we compared the levels of similar transcripts driven by the Top10 promoter,
instead of the 358 promoter. Obtaining the same results with both promoters would
exclude the possibility that the effects on mRN A accumulation were mediated by the
specific interaction between the 35S promoter and SA UR-A C1 dowstream sequences. In
addition, to confirm that the effect on transcript accumulation caused by SA UR-A C1
sequences observed in transgenic tobacco plants occurs also in tobacco cells, transcript

accumulation was compared in stably transformed tobacco BY-2 cells. This was important

62

because the BY-2 system, previously shown to be an effective model system for mRNA
half-life measurements (Newman et al. , 1993; Ohme-Takagi et al. 1993), could then be
applied to the study of SAUR-AC1 sequences. To test the effect caused by coding region
sequences, a large number (> 50) of transformed calli containing the TopIO-Globin-E9 or
the Top] 0—SA UR-E9 test genes, together with a T op1 0-GUS-3C reference gene asigure 5-
l), were pooled and RNA was isolated and subjected to Northern blot analysis (Figure 5-
4A). A GUS-3C reference gene under control of the Top10 promoter was present with
each test gene to allow comparison of ratios of test to reference gene expression levels.
Similarly, to monitor the effect of the SAUR-A C1 3'UTR on transcript accumulation, pools
of transformed calli containing the T op1 0—Globin-E9 or the T op1 0—Globin-SA UR constructs
(Figure 5-1) were compared as shown in Figure 5-4B. From these experiments, we
determined that both the coding region or the 3'UTR of SA UR-ACI are individually
sufficient to decrease mRN A accumulation four-fold in comparison to the GLOBIN-E9
transcript in stably transformed BY-2 calli, mimicking not only qualitatively but also

quantitatively the effect seen in transgenic tobacco plants.

Effect of SAUR-AC1 transcribed sequences on mRNA stability

To determine if the low accumulation of the chimeric messages containing the SA UR-A C1
coding region or 3'UTR was due to their rapid turnover, we directly measured mRN A
half-lives of test genes by shutting off transcription in stably transformed tobacco celllines.
The decay of test and reference transcripts could therefore be followed in the absence of

on-going mRNA synthesis. Our first approach was to treat liquid cultures of stably

63

Legend to Figure 5—4. Effect of the SA UR-ACI coding region and 3' untranslated region
on transcript accumulation in tobacco cell lines. BY-2(Tethl6) tobacco cell lines were
stably retransformed with a TopIO-GLOBIN—E9, a T opIO-GLOBIN—SA UR or a T op10-
SA UR-E9 test genes. A T op1 0-GUS-3C reference gene was also cotransformed in each
case, and RNA was isolated from pools of transformed calli. Northern blots containing
30 pg total RNA per lane were analyzed to compare mRN A levels of the T op1 0-Globin-E9
gene and the T op1 0-SA UR-E9 gene (A) or the T opIO-Globin-E9 gene and the T op10-
Globin-SA UR gene (B).

 

A
GUS-REF )

Globin-E9 )
SAUR-E9 >

 

    

GUS-REF >V

. ‘-
r
‘4'

Globin-E9 ; . I.

Globin-SAUR

Figure 5—4. Effect of the SA UR—ACI coding region and 3' untranslated region on
transcript accumulation in tobacco cell lines.

65

transformed BY-2 cell lines containing the 35S—Globin-E9, 35S-SA UR-E9 and 35S-Globin-
SA UR test genes with the transcriptional inhibitor Actinomycin D. Subsequently mRN A
decay rates were monitored as previously described (Newman et al. 1993). No significant
effects on mRNA stability due to SAUR-AC1 sequences were observed in those
experiments (data not shown). We suspected that the general inhibitory effect on
transcription by Actinomycin D may have interfered with the function of the possible
SA UR-A C1 mRN A instability determinants. To circumvent this potential problem, we
measured mRN A half-lives of test and reference genes using the Top10 promoter
(Weinnann et al., 1994). This regulated promoter allowed us to specifically shut off
transcription of test and reference genes without affecting transcription of endogenous
genes.

ToplO consists of a series of Tet operators upstream of a TATA box and is
dependent on the presence of a transcriptional activator, TETVP16 which binds to the Tet
operators. TETVP16 is a protein fusion between the DNA-binding domain of the bacterial
'I‘et repressor and the activation domain of the transcription factor VP16 of Herpes
Simplex Virus (Weinnann et al. , 1994). Treatment with tetracycline rapidly inactivates
TETVP16, and this in turn shuts off transcription from Top10. In order to measure the
decay rates of our test and reference transcripts driven by the ToplO promoter, we first
transformed BY-2 tobacco cell lines with a construct which contains the sequences
encoding the fusion protein TETVP16 under the control of the 35S promoter.
Subsequently, we selected stably transformed cell lines with the highest level of

expression for the TETVP16 mRNA (data not shown). These cell lines were then

66

retransformed with constructs containing test and reference genes under the control of the
Top10 promoter. To measure mRN A half-lives, we treated stably double-transformed
liquid cultures of BY-2 cells with tetracycline and RNA was isolated from samples
withdrawn at 15 min intervals thereafter. Time course experiments were performed for
transformed cell lines containing the T op1 0-GLOBIN-E9 gene (Figure 5-5A), the T op1 0-
SA UR-E9 gene (Figure 5-5B), or the T opIO-GLOBIN-SA UR gene (Figure 5-5C). All
transformed cell lines also contained the T op] 0-GUS-3C reference gene. Northern blots
were prepared, quantified, and mRNA half-lives were plotted (Figure 5-5D). These
experiments showed that the half-lives of the GLOBIN-E9 transcript and the SAUR-E9
transcript were not significantly different. In contrast, the GLOBIN—SAUR transcript
displayed a very short half-life of less than 20 minutes in the three lines tested. Because
GUS is the reference transcript in all constructs, we could also determine that its half-life
was less than 30 minutes in tobacco cells. We also calculated the relative mRNA half-life
for each test gene, i.e. the ratio of the test mRN A half-life divided by the reference GUS
mRN A half-life. Relative mRNA half-lives are better indicators of direct differences
between mRNA decay rates than absolute mRNA half-lives as demonstrated previously
(Newman et al. , 1993). The histogram in Figure 5-5E displays the relative half-lives of
the test transcripts determined for at least three independent cell lines. When we compared
the mRN A half—lives of the T op] 0-Globin-E9 and the T op] 0—SA UR-E9 test transcripts in
at least three independent transformed cell lines we do not observe any significant
difference in their relative decay rates. This indicated that the SA UR-A C1 coding region

sequences did not contain an mRN A instability determinant. We also compared the mRN A

67

Legend to Figure 5-5 Determination of mRNA half-lives. Stably retransformed BY-2
(Teth16) cell lines expressing the indicated test genes and a co-transformed T op1 0-GUS-
3C reference gene were treated with 10 pg/ml tetracycline, and RNA was isolated from
samples withdrawn at 15 min intervals thereafter. Northern blots containing 30 pg total
RNA per lane were hybridized to test and reference probes. Representative blots for cell
lines transformed with the T op] 0—GLOBIN—E9 test gene (A), the T opIO-GLOBIN—SA UR
test gene (B) or the TopIO—SA UR—E9 (C) test gene are shown. (D) Radioactive signals
from the blots were quantified, plotted, and subjected to linear regression analysis. Solid
squares represent Globin-E9 mRNA levels, solid triangles represent SAUR-E9 mRNA
levels, solid circles represent Globin-SAUR mRNA levels. Reference mRN A levels for
these test transcripts, are represented by open squares, open triangles and open circles,
respectively. (B) Histogram representing the data from at least three independent cell lines
per construct analyzed as in D above. Relative half-lives were calculated by normalizing
the half-lives of the Globin test transcripts to that of the GUS reference transcripts in each
experiment. The relative half-life of the Globin-E9 transcript was arbitrarily assigned a
value of one and other values were adjusted accordingly. Error bars represent the standard
deviation.

68

 

 

 

 

 

 

A 15' 75' D
10
Gus-REF} . ‘1 :2 ‘
' U)
C
I:
. ‘ ,,
Globln-E9 P . . Q g A ,5,
I
<
z .
E I
E :
B ‘ 0 as '
GUS'REF’”. 0.310 {5 so 43 so 75
:w' '4‘}?

 

 

 

 

Minutes
E
SAUR-E9 > m . . 1.0 _
c . E -
GUS-REF b 32-}. 7.. $0.5 _
E
G)
I —
Globln-SAUR b . ‘ q; _ _ o %

Globin SAUR Globln
E9 E9 SAUR

Figure 5-5. Determination of mRNA half-lives.

69

half-life of the TopIO-Globin-E9 and the TopIO-Globin-SA UR test transcripts in a similar
manner. In this case, we found that the presence of the SA UR 3'UTR led to a decrease
of the mRN A half-life of the test transcript of about 5-fold. By comparing this resultto the
effect on mRN A steady-state levels, we observed that the reduction in mRNA stability
caused by the SAUR 3'UTR was of similar magnitude to the reduction that it causes in
mRNA accumulation (as shown in Figures 5-4B and 5-5B). This indicates that an mRN A
instability determinant can completely explain the decrease on mRN A accumulation caused

by the SA UR-A c1 3'UTR.

Effect of a mutation in a conserved region of the DST element on mRN A
accumulation and mRN A stability

The DST element present in the 3' UTR of several plant SA UR genes, consists of three
blocks of conserved motifs separated by two variable regions of conserved length (Figure
3-5). There is one well conserved DST element in the 3'UTR of the SA UR-ACI gene.
Tamdem repeats of a synthetic DST derived from the soybean SA UR15A have previously
been shown to target transcripts for rapid decay when inserted in the 3'UTR of GUS or
Globin reporter genes (Newman et al. , 1993). Because the 3'UTR of SA UR-ACI
functions as an mRNA instability determinant, we wanted to test if a mutation in the DST
element could stabilize the mRNA. To this end, we have modified the 3'UTR of the
SA UR-A C1 gene by site-directed mutagenesis of the conserved sequence present in the
middle of the DST element, replacing the invariant ATAGAT with the sequence GCATGC

(Figure 5-6A). This mutation is known to inactivate a synthetic dimer of the DST

 

70

sequence (M.Sullivan and P.Green, unpublished results). A test gene incorporating the
mutant SAUR 3' UTR, designated Top] 0—Globin-MSA UR, was transformed along with a
T op] 0-GUS-3C reference gene into BY-2(Teth16) cells. We first monitored the
accumulation of the Globin-MSAUR transcript compared to that of the Globin-E9 and
Globin-SAUR transcripts. As described above for other test genes, we pooled more than
50 stably transformed calli for each construct, isolated total RNA from the pools, and
analyzed the accumulation of test transcripts by Northern blot analysis. As shown in
Figure 5-6B, the levels of the Globin-MSA UR transcript were similar to those of the
Globin-SA UR transcript, and the levels of the GUS-3C reference transcript were also
similar in pools of calli transformed with either construct.

Since a mutation disrupting the ATAGAT sequence conserved in DST elements did
not affect mRN A accumulation, such a mutation should not affect mRN A decay rates,
which are in part responsible for mRNA levels. To confirm this, we decided to test
whether the sequence ATAGAT in the DST sequence was required for the instability of
the Globin-SAUR transcript. We measured directly mRN A half-lives of test transcripts
using the tetracycline-regulated Top10 promoter as detailed above. The histogram in
Figure 5-7B displays the relative half-lives of Globin-E9, Globin—SA UR and Globin-
MSAUR test transcripts for at least two independent stably transformed BY-2 cell lines for
each construct. When we compared the relative mRN A half-lives of the T op] O-Globin-
SA UR and the TopIO-Globin—MSA UR test genes we did not observe any significant

difference in mRN A decay rate. This indicated that the ATAGAT sequence of the 3 'UTR

71

Legend to Figure 5-6 Effect on transcript accumulation and mRN A stability of a mutation
in the SA UR-A CI 3'UTR that alters the ATAGAT sequence conserved in DST elements.
(A) Comparison of the wild-type DST element in the 3'UTR of the Globin-SAUR
transcript to the mutant DST element in the Globin-MSAUR transcript. (B) A tobacco cell
line stably transformed with the 35S-TETVP16, was retransformed with a construct
containing the T op] 0-GLOBIN-MSA UR gene and the T op1 0—GUS-3C reference gene.
RNA was isolated from pools of transformed calli and Northern blots containing 30 pg
total RNA per lane were performed to compare mRNA levels of the T op] 0—Globin-E9
gene, the T opIO-Globin-SA UR gene and the T opIO-Globin-MSA UR gene. (C) Histogram
that represents the effect on mRNA stability of the wild-type SA UR-A C1 3'UTR compared
to the effect of the mutant MDSTl SA UR-ACI 3'UTR. Time courses, Northern blot
analyses and calculations of the relative mRN A half-life of the Globin-MSAUR transcript
were performed as described in Figure 5-5. The histogram represents the data from at
least two independent cell lines per construct. Error bars represents the standard
deviation, except in the case of the Globin-MSA UR transcript in which it represents the
range of separation of two values.

72

A

WildType :- -11-if*T‘AG‘;r:isc-11- GCG‘T'f‘j
MSAUR -11- cc; GCT- 11- acct

     
 

GUS-REF r . O .

Globin-E9 > ,
Globin-SAUR > an O <Globm-MSAUR

 

C

1.0-

Relative Half-life
0
0|

 

 

 

 

\ \\\\\\\\\\

8%

Globin GloAqun Globin
RSAUR

 

Figure 5-6 Effect on transcript accumulation and mRN A stability of a mutation in the
SA UR—ACI 3'UTR that alters the ATAGAT sequence conserved in DST elements.

73

SA UR-A C1 , absolutely conserved in all known DST elements, was not required for rapid

mRN A decay.

DISCUSSION

A second level of regulation of the expression of the SA UR genes, in addition to
transcriptional regulation, exists because they encode unstable transcripts. We first
showed that the SA UR-A CI 3'UTR limits transcript accumulation in transgenic tobacco
and stably transformed cultured cells. It could be argued that the presence of sequences
downstream the SA UR-A C1 3'UTR may regulate the accumulation of the Globin-SAUR
transcript. However, in this study, we also present evidence showing that the 3 'UTR from
SA UR-A C1 functions as a potent mRN A instability determinant. This indicates that both
effects are mediated by transcribed sequences in the 3'UTR, because the 3'UTR causes
an effect on mRN A stability of similar magnitude to its effect on mRN A accumulation and
an mRNA instability determinant must be in the transcript.

The 3'UTR of SAUR-AC1 is of particular interest. Not only is it the first example
of a native plant sequence element shown to function as an mRN A instability determinant,
but because it also contains one copy of the DST element, which is conserved in the
3'UTR of plant SA UR genes. Two copies of this element has previously been shown to
target reporter transcripts for rapid decay (Newman et al. , 1993), suggesting it could also
have a role in the mRN A instability of SAUR transcripts. DST sequences are interesting

because unlike many other eukaryotic mRN A unstability determinants, they are not AU-

74

rich sequences and they are well conserved in a family of genes across plant species. It
is possible that they mediate a mechanism to control mRNA stability that is novel and
unique for plants. However, we have determined that a five base pair substitution in the
invariant ATAGAT motif of the SA UR-A CI DST element does not result in increased
transcript stability in the context of the SA UR-ACI 3'UTR. This can be interpreted in
several ways. One possibility is that there are multiple mRN A instability determinants in
the 3'UTR of SA UR-ACI. Several unstable transcripts contain multiple instability
determinants and the DST covers only the last third of the 3'UTR. In addition, two copies
of a synthetic DST element were required to destabilize GUS and Globin reporter
transcripts in BY-2 cells (Newman et al. , 1993). Perhaps in the native context another
sequence is required for DST to destabilize SAUR transcripts. Alternatively, the
disruption of the ATAGAT motif may not be sufficient to inactivate the DST element.

We do not favor this hypothesis, because a similar mutation inactivates a synthetic dimer
of DST elements inserted in the 3'UTR of reporter genes (M.Sullivan and R]. Green,
unpublished results). However, it could be the case that SA UR sequences flanking the
DST element and absent in the synthetic dimer, stabilize the interaction with a DST-
binding factor. A third possibility is that the 3'end of SA UR-ACI was changed by the
ATAGAT mutation such that sequences controlling polyadenylation were affected. This
could result in a negative indirect effect on mRN A stability that would compensate the lack
of function of the DST element. The ATAGAT mutation had no detectable effect on the
size of the transcript on Northern blots (data not shown), suggesting that if polyadenylation

were affected by the mutation, it resulted in the inclusion of only a small number of bases.

75

Further mutagenesis studies will be necessary to investigate the contribution of the DST
to the instability of the SA UR-ACI mRNA.

Concerning the kinetics of redistribution of SA URs during gravitropism, the
presence of the 3 'UTR of SAUR-AC1 can account for the instability of SA URs deduced
from RNA tissue-printing. Those experiments showed that SA URs are undetectable in the
upper side of etiolated seedlings 20 minutes after they are placed horizontally (McClure
and Guilfoyle, 1989). This is consistent with the fact that when the 3'UTR of SAUR-AC1
is present in a test transcript, it causes a decrease in mRN A stability enough to render an
absolute mRN A half-life of less than 20 minutes. We have also observed that SA UR-A C1
mRN A accumulation is unaffected by auxin, indicating that the instability of the SA UR-
ACI transcript is probably constitutive. The function of the DST elements inserted in
reporter genes was also found not to be affected by auxin (Newman et al. , 1993).
Therefore, it appears that the SA UR-A C1 mRN A is inherently unstable in order to respond
rapidlyto changes in transcription in response to auxin.

The general transcriptional inhibitor Actinomycin D eliminates the rapid mRN A
decay caused by the 3'UTR of SA UR-ACI. This may explain the half-life of soybean
SA URs in pea seedlings, after treatment with Actinomycin D, that was more than 40
minutes (Franco et al. 1990). This effect also suggests the presence of labile components
in the mRN A degradation machinery, although it might just be an unspecific effect caused

by the drug.

76

The coding region of SA UR-A CI has a negative effect on the accumulation of the
messages in which it is present. In this respect, a recent report indicates that the coding
region of soybean SA URs is responsible for cycloheximide induction (Li et al., 1994).
The induction by cycloheximide of SAUR-A C1 mRN A accumulation, when this transcript
is driven by a promoter that shows little or no induction, indicates that transcribed
sequences also mediate cycloheximide induction of mRN A accumulation. However, we
have not detected any effect on mRN A stability due to this region. It is possible that the
cycloheximide effect on mRN A accumulation caused by a soybean SA UR coding region
is related to the limited transcript accumulation caused by the SA UR-A CI coding region.
If that is the case, both effects could be due to the presence of a cycloheximide-inducible
transcriptional elongation factor.

The coding region effect on mRNA abundance is independent of the 3'UTR effect.
When the accumulation of test transcripts was monitored in transgenic tobacco plants, we
observed that the contributions of coding region and 3'UTR in limiting mRN A
accumulation occurred similarly when both regions were present or when they acted
separately. This indicates that two separate pathways limit mRN A accumulation of SAUR
transcripts, and is consistent with only one them involving mRN A instability. In addition,
both processes occurred in transgenic tobacco plants and in stably transformed tobacco cell
lines, indicating that the mechanisms that regulate SA UR mRN A accumulation are likely

to be of general importance in plant cells.

CHAPTER 6

CONCLUSIONS

78

The main goal of this study was to identify sequences within unstable plant mRN As that
mediate rapid mRN A decay in plants. At the onset of this project, the plant genes that
were best candidates to achieve this goal were a family of auxin inducible soybean genes,
named SAURs. The SA UR transcripts displayed short mRN A half-life and contained a
particular sequence motif, the DST element, conserved in the dowstream region of five
members of the soybean SAUR gene family. We decided to clone and characterize the
SA UR-A C1 gene from Arabidopsis, instead of analyzing one of the soybean SAURs,
because of the advantages of Arabidopsis as a genetic model system. With these
observations as a starting point, the SA UR-A C1 gene of Arabidopsis was shown to be auxin
inducible (Chapter 3). Sequences in the promoter region were found to be responsible for
auxin-induction and for preferential expression in aerial tissues (Chapter 4). Transcribed
regions of SAUR-AC1 constitutively limited transcript accumulation, both coding region
and 3'UTR contributing to the process (Chapter 5).

The 3 'UTR of SA UR-A C1 promotes rapid transcript decay in tobacco cells, as well
as low transcript accumulation in tobacco plants (Chapter 5). This suggests that it also
performs a similar function in Arabidopsis destabilizing the SA UR—A C1 transcript. During
the time when these experiments were performed, Newman et al. (1993) demonstrated that
a synthetic dimer of a soybean DST element, was sufficient to destabilize reporter
transcripts in tobacco cells. Surprisingly, we have found that a conserved region of the

DST element of SAUR-A C] was not required for rapid transcript decay (Chapter 5). This

79

could indicate that multiple instability elements are present in the 3 'UTR of SA UR-A C1.
This redundancy may be required to assure the low accumulation of the SA UR—A C1
transcript. Consistent with this idea, we have also observed that the SA UR-ACI coding
region also limited transcript accumulation, although in this case an mRNA unstability
determinant was not responsible for this effect (Chapter 5).

A second goal of this project was to generate a tool to study auxin signal
transduction pathways. When SA UR-A C] was cloned we first confumed that its transcript
was auxin inducible (Chapter 3). This indicated that the SA UR-A C1 gene could be used
as a molecular marker to study Arabidopsis mutants suspected to be affected in auxin
metabolism. As an example, we have shown that several auxin-resistant and gravity
responsive mutants display altered expression of SA UR—ACI in response to exogenous
auxin (Chapter 3). In addition, the sequences in the SA UR-A CI promoter region are
responsible for auxin-induced activity of a SA UR-GUS promoter fusion and for preferential
promoter activity in certain tissues of transgenic Arabidopsis plants (Chapter 4).
Therefore, it should also be possible to cross these transgenic plants to mutants with
defects in processes involving auxins, to test for differences in promoter activity in
different tissues in the mutants.

One of the long-term goals of this project was to understand the molecular
mechanisms that plants use for the rapid degradation of unstable mRNAs. The first step
was to localize cis-acting elements responsible to target messages for rapid decay which

we have achieved identifying the 3'UTR of SA UR-ACI as an mRN A instability

80

determinant. The second step will be to characterize the factors that are likely to interact
with such elements. This can be achieved by cross-linking of proteins that interact with
the 3' UTR of SA UR-ACI . A different approach, possible in Arabidopsis, can be to
identify mutations in trans that stabilize transcripts containing the SA UR-A CI 3' UTR.
This should make it possible to clone and characterize molecular components involved in

mRN A decay.

LITERATURE CITED

82

An G (1985) High efficiency transformation of cultured tobacco cells. Plant Physiol.
79:568—570

An G, Costa MA, Ha S-B (1990) Nopaline synthase promoter is wound inducible and
auxin inducible. Plant Cell 2: 225-233

Ballas N, Wong L-M, Theologis A (1993) Identification of the auxin-responsive element,
AuxRE, in the primary indoleacetic acid-inducible gene, PS—IAA4/5, of pea (Pisum
sativum). J Mol Biol, in press

Becker 0 (1990) Binary vectors which allow the exchange of plant selectable markers and
reporter genes. Nucleic Acids Research 18:203

Benfey PN, Ren L, Chua N-H (1989) The CaMV enhancer contains at least two domains
that confer different developmental and tissue-specific expression patterns. EMBO J
8:2195-2202

Bullen BL, Best TR, Gregg MM, Barsel S-E, Poff KL (1990) A direct screening
procedure for gravitropism mutants in Arabidopsis thaliana (L.) Heynh. Plant Physiol 93:
525-531

Bullen BL (1992) Development of a genetic system for the study of gravitropism in
Arabidopsis thaliana. PhD thesis. Michigan State University, East Lansing

Byme DH, Seeley KA, and Colbert JT (1993) Half-lives of oat mRNAs in vivo and in

a polysome-based in vitro system. Planta 189:249-256

83

Clutter ME (1960) Hormonal induction of vascular tissue in tobacco pith in vitro. Science
132:548-549

Conner TW, GoekjianVH, LaFayette PR, Key JL (1990) Structure and expression of
two auxin-inducible genes from Arabidopsis. Plant Mol Biol 15: 623-632

Edwards DR and Mahadevan LC (1992) Protein synthesis inhibitors differentially
superinduce c-fos and c-jun by three distinct mechanisms: lack of evidence for labile
repressor. EMBO J 11:2415-2424

Estelle M (1992) Hormone auxins: Insight in sight. BioEssays 14: 439-444

Fang R-X, Nagy F, Sivasubramaniam S, and Chua N-H (1989) Multiple cis regulatory
elements for maximal expression of the cauliflower mosaic virus 35S promoter in
transgenic plants. Plant Cell 1:141-150

Franco AR, Gee MA, Guilfoyle TJ (1990) Induction and superinduction of auxin-
responsive mRN As with auxin and protein synthesis inhibitors. J Biol Chem 265: 15845-
15849

Gee MA, Hagen G, Guilfoyle TJ (1991) Tissue-specific and organ-specific expression
of soybean auxin-responsive transcripts GH3 and SAURs. Plant Cell 32419-430

Gielen J, DeBeuckeleer M, Seurinck J, Deboeck F, DeGrave H, Lemmers M, Van
Montagu M, Schell J (1984) The complete nucleotide sequence of the TL—DNA of
Agrobacterium tumefaciens plasmid pTiAch5. EMBO J 3:835-846

Green PJ, (1993) Control of mRNA stability in higher plants. Plant Physiol 102: 1065-

1020.

34
Guilfoyle TJ, Hagen G, Li Y, Gee MA, Ulmasov TN, Martin G (1992) Expression of
auxin-responsive genes in soybean and transgenic tobacco. Biochem Soc Trans 20: 97-101
Hagen G, Martin G, Li Y, Guilfoyle TJ (1991) Auxin-induced expression of the soybean
GH3 promoter in transgenic tobacco plants. Plant Mol Biol 17: 567-579
Li Y, Hagen G, Guilfoyle TJ (1991) An auxin-responsive promoter is differentially
induced by auxin gradients during tropisms. Plant Cell 3: 1 167-1775
McClure BA, Guilfoyle TJ (1987) Characterization of a class of small auxin-inducible
soybean polyadenylated RNAs. Plant Mol Biol 9:611-623
McClure BA, Guilfoyle TJ (1989) Rapid redistribution of auxin-regulated RNAs during
gravitropism. Science 243: 91-93
McClure BA, Hagen G, Brown CS, Gee MA, Guilfoyle TJ (1989) Transcription,
organization, and sequence of an auxin-regulated gene cluster in soybean. Plant Cell 1:
229-239
Mogen BD, MacDonald MH, Leggewie 'G, Hunt AG (1992) Several distinct types of
sequence elements are required for efficient mRN A 3' end formation in a pea rch gene.
Mol Cell Biol 12: 5406-5414
Newman TC, Ohme-Takagi M, Taylor CB, Green PJ. (1993) DST sequences, highly
conserved among plant SA UR genes, target reporter transcripts for rapid decay in tobacco.

Plant Cell 5:701-714

85
Nagy F, Boutry M, Hsu M-Y, Wong M, Chua N-H (1987) The 5' proximal region of
the wheat Cab-1 gene contains a 268-bp enhancer-like sequence for the phytochrome
response. EMBO J. 6:2537-2542
Nick P, Bergfel R, Schafer E, Schopfer P (1990) Unilateral reorientation of microtubules
at the outer epidermal wall during photo- and gravitropic curvature of maize coleoptiles
and sunflower hypocotyls. Planta (1990) 181:162-168
Ohme-Takagi M, Taylor CB, Newman TC, and Green PJ (1993) The effect of
sequences with high AU content on mRNA stability in tobacco. Proc. Natl. Acad. Sci.
USA 90:11811-11815
Peltz SW, Brewer G, Bernstein P, Hart PA, and Ross, J (1991) Regulation of mRN A
turnover in eukaryotic cells. In Critical Reviews in Eukaryotic Gene Expression,
G.S.Stein eds (Boca Raton: CRC press) pp. 99-126
Pickett FB, Wilson AK, Estelle M (1990) The aux] mutation of Arabidopsis confers both
auxin and ethylene resistance. Plant Physiol 94: 1462-1466
Raikhel N (1992) Nuclear targeting in plants. Plant Physiol 100: 1627-1632
Rogers SG, Klee HJ, Horsch RB, and Fraley RT (1987) Methods Enzymol. 153:253-
277
Sachs AB (1993) Messenger RNA degradation in eukaryotes. Cell 74-413-421
Sanger F, Nicklen S, Coulsen AR (1977) DNA sequencing with chain terminating

inhibitors. Proc Natl Acad Sci USA 74:5463-5467

86

Shyu AB, Greenberg ME, and Belasco JG (1989) The c—fos transcript is targeted for
rapid decay by two distinct mRN A degradation pathways. Genes Dev 3:60-72

Siflow CD and Key JL (1979) Stability of polysome associated polyadenylated RNA from
soybean suspension cultured cells. Biochemistry 18: 1013-1018

Slighton JL, Durand-Tardiff M, Jonamin L, and Tepfer D (1986) Nucleotide sequence
of TL—DNA of Agrobacterium rhizogenes agropine type plasmid. J Biol Chem 261 : 108-
121

Somerville CR (1989) Arabidopsis blooms. Plant Cell 1:1131-1135

Taylor CB, Bariola PA, DelCardayré SB, Raines RT, Green PJ (1993) RNS2: A
senescence-associated RNase of Arabidopsis that diverged from the S-RNases before
speciation. Proc Natl Acad Sci USA 90:5118-5122

Taylor CB, Green PJ (1991) Genes with homology to fungal and S-gene RNases are
expressed in Arabidopsis thaliana. Plant Physiol 96: 980-984

Theologis A (1986) Rapid gene regulation by auxin. Annu Rev Plant Physiol Plant Mol
Biol 37:407-438

Timpte CS, Wilson AK, Estelle M (1992) Effects of the aer mutation of Arabidopsis
on cell shape in hypocotyl and inflorescence. Planta 188: 271-278

Vanderhoef LN, Stahl CA (1975) Separation of two responses to auxin by means of

cytokinin inhibition. Proc Natl Acad Sci USA 72: 1822-1825

87

Wilson AK, Pickett FB, Turner J C, Estelle M (1990) A dominant mutation in
Arabidopsis confers resistance to auxin, ethylene and abscisic acid. Mol Gen Genet 222:
377-383

Yamamoto KT, Mori H, Imaseki H (1992) cDNA cloning of indole—3-acetic acid-
regulated genes: Aux22 and SAUR from mung bean (Vigna radiata) hypocotyl tissue.

Plant Cell Physiol 33:93-97

"11111111"11111111115