 

 

v-

r
U
4

gm”

 

TYLIBRAR ARIES

I [Lilli llu

 

 

 

 

 

 

lllllll\lllllllllllllllHillill

THE“ 3 1293 014171

This is to certify that the

dissertation entitled

Formation and rates of repair of polycyclic
adducts at the nucleotide level in normal

human fibroblasts
presented by

Dong Wei

has been accepted towards fulﬁllment
of the requirements for

Ph . D degree in Microbiology

 

 

 

Date 08/02/95

MS U is an Afﬁrmative Action/Equal Opportunity Institution 0-12771

 

 

 

LIBRARY
Michigan ﬁtate
University

 

 

 

PLACE ll RETURN BOX to move thlo checkout from your record.
TO AVOID FINES return on or bdoro duo duo.

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

MSU IoAn Afﬁrmative MIN/Equal Oppornmlty InotItqun
~ W

i

 

FORMATION AND RATES OF REPAIR OF POLYCYCLIC ADDUCTS AT
THE NUCLEOTIDE LEVEL IN NORMAL HUMAN FIBROBLASTS
By

Dong Wei

A DISSERTATION
Submitted to
Michigan State University
in partial fulﬁllment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Microbiology

1995

ABSTRACT

FORMATION AND RATES OF REPAIR OF POLYCYCLIC ADDUCTS AT

THE NUCLEOTIDE LEVEL IN NORMAL HUMAN FIBROBLASTS

Dong Wei

Previous studies in our laboratory showed two cell-cycle-dependent mutation hot spots
in exon 3 of the hypoxanthine phosphoribosyltransferase (HPRT) gene of normal human
ﬁbroblasts treated at early G1 phase with benzo(a)pyrene diol epoxide (BPDE) but not
in the cells treated in S phase. They were not present in cells treated at S phase but
appeared in cells that were treated at early Gl phase, so that cells could have at least 12
hr for repair before DNA replication. To investigate whether these two mutation hot
spots are caused by inefﬁcient DNA repair at these two sites, I adapted ligation mediated
polymerase chain reaction (LMPCR), in conjunction with Escherichia coli UvrABC
cxcinuclease, to study rates of repair of BPDE adducts at the nucleotide level on the
nontranscribed strand of exon 3 of the HPR T gene in normal human ﬁbroblasts. The
rates of repair of BPDE adducts at various nucleotide positions varied signiﬁcantly. The

rates of repair at these two sites where mutation hot spots were located were among the

slowest, strongly suggesting that inefﬁcient repair plays an important role in the formation
of such cell-cycle-dependent mutation hot spots. To investigate whether this site-speciﬁc
repair depends solely on the local DNA secondary structure, I determined the rates of
repair of l-nitrosopyrene (l -NOP)- induced adducts in the region of interest and compared
the result to that found with BPDE adducts in the same region. Both chemicals form
mainly guanine adducts. The average rate of repair of l-NOP induced adducts was 2- to
3- fold faster than that of BPDE adducts. However, at a particular nucleotide position,
l-NOP-induced adducts were removed at a rate faster or slower than, or equal to that of
BPDE adducts, suggesting that the rate of repair at a speciﬁc nucleotide position depends
on the adduct conformation and the secondary structure of the local DNA. To investigate
the distribution of BPDE adducts in human cells, I synchronized and treated them with
BPDE at different stages of the cell cycle, determined the distribution of BPDE adducts,
and found that the BPDE adduct distribution was essentially the same across the cell
cycle, indicating that the changing physiological conditions in the nucleus did not affect
the BPDE adduct formation. Comparison of BPDE adduct formation in the region of
interest in DNA treated in viva and in vitra indicated that the relative distribution of
BPDE adducts at most sites in viva was very similar to that in vitra, however, the relative
level of BPDE adducts at a region of multiple guanines in viva was much higher than that
in vitra. No nucleosomal structures or other protein-DNA interactions were identiﬁed to
account for this enhancement in viva. Therefore, I conclude that the difference between
BPDE adduct formation at the region of multiple guanines in viva and in vitra is due to

the physiological condition in the nucleus.

This work is dedicated to:

my wife,
my sister,
my mother,

my father,

iv

Jing Qing
Yun Wei
Junlu Yang

Zhilong Wei

ACKNOWLEDGEMENTS

I would like to express my deep appreciation and gratitude to my major professor, Dr.
Veronica M. Maher, for her invaluable advice, never failing support and guidance
throughout my graduate program. I also would like to express my deep appreciation to
Dr. J. Justin McCormick for his advice, humor and encouragement.

I also would like to give special thanks to the other members of my graduate guidance
committee, Drs. Susan Conrad, Laurie Kaguni, and Richard Schwartz for their advice and
invaluable time.

Finally, I would like to thank Scott Boley for his help in English proﬁciency in Chapter
I. I would also like to acknowledge all the past and present members of the

Carcinogenesis Laboratory for their assistance, encouragement and generous friendship.

TABLE OF CONTENTS

Page
LIST OF FIGURES ................................... ix
INTRODUCTION .................................... 1
List of References ....................................
CHAPTER 1. LITERATURE REVIEW
A. Cancer and DNA Repair ........................ 7
B. DNA repair systems
1. Basic DNA repair systems .................... 11
2. Nucleotide excision repair in E. cali .............. l3
3. Nucleotide excision repair in yeast
(Saccharamyces cerevisiae) .................... l6
4. Nucleotide excision repair in human cells .......... 21
C. Research on nucleotide excision repair at various levels
in human cell
1. Investigation of DNA repair at the level
of the genome overall ........................ 3O
2. Study of DNA repair at the gene level ............ 32
3. Study of DNA repair at the nucleotide level ........ 34
D. Effects of protein-DNA interactions on DNA
adduct formation and rates of DNA repair
1. Effects of protein-DNA interactions
on DNA adduct formation ..................... 37
2. Effects of protein-DNA interaction on DNA repair . . . . 39
LIST OF REFERENCES .......................... 43

vi

CHAPTER 11. Site speciﬁc rates of excision repair of benzo(a)pyrene
diol epoxide adducts in the hypoxanthine phosphoribosyl-
transferase gene of human ﬁbroblasts--Correlation with

mutation spectra ........................... 57
Abstract ...................................... 58
Introduction ................................... 59
Materials and methods

Cell culture and synchronization ................. 65

BPDE treatment and post-treatment Incubation ....... 65

Isolation and puriﬁcation of DNA ................ 65

UvrABC excision reaction ..................... 66

Generating a sequence ladder ................... 66

Extension of primer and linker ligation ............ 67

Isolation of the desired fragments with magnetic beads . 67

Polymerase chain reaction ..................... 67

Annealing and extending a 32P--labeled primer ........ 67
Results

Determining the initial distribution of BPDE adducts in

cells treated at early 61 phase or S phase .......... 69

Determining the rate of excision repair of BPDE

adducts using LMPCR ........................ 72

Evidence of site-speciﬁc repair of BPDE adducts

in human cells ............................. 76
Discussion .................................... 79
Acknowledgement ............................... 84
References .................................... 85

CHAPTER 111. Effect of adduct conformation and local DNA
secondary structure on rates of repair of

polycyclic adducts in human cells .............. 87
Summary ..................................... 88
Introduction ................................... 89
Experimental procedures

Cell culture and synchronization ................. 92
Carcinogen treatment and post treatment incubation . . . 92
Determination of extent of DNA synthesized ........ 92
Determination of the rates of excision repair

of l-NOP adducts at the nucleotide level ........... 93

vii

C

Results
Determination of DNA replication during the

time allowed for repair ....................... 94

Rates of repair of l-NOP adducts in exon 3

of HPRT gene ............................. 94

Comparison of rates of repair of l-NOP adducts and

BPDE adducts in the region of interest ............ 97
Discussion .................................... 101
Acknowledgements .............................. 1 04
References .................................... l 05

CHAPTER IV. Comparison of the distribution of benzo(a)pyrene
diol epoxide adducts at the nucleotide level in
DNA of human cells at various stages of

the cell cycle and in DNA treated in vitro ......... 107
Summary ..................................... 108
Introduction ................................... 109
Experimental procedures

Cell culture and synchronization ................ 111

Treatment of cells with BPDE ................. 111

Determination of the distribution of BPDE adducts

in vivo at the nucleotide level ................. 1]]

Determining the amount of 3H-BPDE adduct formation

on a DNA fragment containing exon 3 ........... 112

Analyzing the distribution of BPDE adducts on this

DNA fragment with Sequenase 2.0 .............. 113

Analyzing the efﬁciency of UvrABC excision on this

DNA fragment ............................ 113

In vivo DNA footprinting .................... 114
Results

The distribution of BPDE adducts in exon 3 of the

HPRT gene across the cell cycle ................ 116

Comparison of the BPDE adduct formation in vivo

with that in vitro in the region of interest ......... 120

Determining whether nucleosomes are present

in the region of interest ...................... 121

Evidence of a special DNA structure ............. 125
Discussion .................................... 131
Acknowledgements .............................. 1 3 6
References .................................... 1 3 7

viii

I.)

.lx.)

lb)

LIST OF FIGURES

FIGURE
Chapter II

1. Number of mutants with a base substitution

in the region of interest ...............................
2. Autoradiogram showing the initial distribution

of BPDE adducts in synchronized cell populations treated

in early G] or S phase, as analyzed using UvrABC and LMPCR . .
3. Autoradiogram illustrating extent of repair in the

nontranscribed strand of exon 3 of the HPRT gene of

cells treated with 0.5 uM BPDE .........................
4. Rates of repair of BPDE adducts in the region of interest .......

Chapter III

1. Autoradiogram illustrating extent of repair in the

nontranscribed strand of exon 3 of the HPRT gene

of cells treated with 0.8 11M l-NOP (A) or 0.5 11M BPDE (B) . . . .
2. Relative percentage of l-NOP-induced adducts (ﬁlled bars)

and BPDE adducts (blank bars) remaining in the

region of interest after 20 hr of repair .....................

Chapter IV

1. Autoradiogram showing the distribution of BPDE adducts

in exon 3 of the HPRT gene when cells were treated

with BPDE at various stages of the cell cycle or when

purified DNA was treated in vitro .......................
2. Autoradiograms showing the in vivo DNA footprinting with

dimethyl sulfate (A) or micrococcal nuclease (B) .............
3. Autoradiograms showing the distribution of BPDE adducts

in a DNA fragment treated with 3H-BPDE determined

using Sequenase 2.0 (A) or UvrABC (B) ...................

ix

Page

61

7O

74
77

95

98

123

129

10

CC

exei

INTRODUCTION

Mutations can occur when DNA is replicated in the presence of various DNA adducts,
as evidenced by the fact that_ most of the base substitutions found in cells treated with a
particular carcinogen are located where DNA adducts form (Strauss et al., 1982; Miller,
1985). However, the relative distribution of DNA adducts is usually different from the
relative distribution of mutation frequencies found (Brash et al, 1987; Yang et al., 1988).
One reason that may account for this is that DNA polymerases have different potentials
to insert an incorrect nucleotide opposite a particular DNA adduct at a certain sequence
context (Kunkel, 1992; Wang, 1991). Another major factor is DNA repair. DNA repair
systems in a cell can remove DNA adducts and replace them with correct nucleotides
(Sancar and Sancar, 1988), so when DNA replication starts, DNA polymerases actually
encounter the changed adduct spectrum instead of the original adduct spectrum. If DNA
adducts at different nucleotide positions are repaired with different efficiencies, the
changed adduct spectrum may be totally different from the original adduct spectrum,
resulting in a different mutation spectrum.

The ﬁrst evidence of site-speciﬁc repair came from studies with Escherichia cali
UvrABC excinuclease, the major components of nucleotide excision repair in E. cali,
which excises various DNA adducts (Sancar and Sancar, 1988). Measurement of the

excision efﬁciencies of various DNA adducts by UvrABC excinuclease in vitro indicated

1

\V

lee

sul

of -
diff

Dx

2

that UvrABC excises the same DNA adducts at different nucleotide positions with
different efficiencies (Thomas et al, 1985; Seeberg and Fuchs, 1990) , suggesting that the
local DNA sequence context can affect the excision efﬁciency of UvrABC in vitro. What
happens in viva remained unknown until Kunala and Brash (1992) determined rates of
excision repair of UV induced cyclobutane pyrimidine dimers (CPDs) in the lac] gene of
E. cali at single nucleotide resolution, by labeling the desired fragments and mapping the
relative frequencies of CPDs formed at each site, using T4 endonuclease V (T4EV),
which speciﬁcally cuts CPDs (Brash, 1988). They found that rates of repair of CPDs at
various nucleotide positions varied significantly, and most of the UV induced mutation
hot spots found in the lac] gene were the sites where the rates of repair were slow
(Schaaper et al, 1987), suggesting that site-speciﬁc DNA repair plays an important role
in formation of mutation hot spots in E. cali.

In human cells, nucleotide excision repair (NER) is believed to be carried out by at
least 11 different proteins (Hoeijmakers and Bootsma, 1994). The wide range of
substrates recognized by NER suggests that NER recognizes the structural changes in
DNA induced by formation of DNA adducts instead of the adducts themselves (Sancar
and Sancar, 1988). Thus, NER in human cells should also be site-speciﬁc. However,
rates of repair at the nucleotide level in human cells are very difﬁcult to study because
of the complexity of the human genome. Tornaletti and Pfeifer (1994) overcame this
difficulty by using ligation mediated polymerase chain reaction (LMPCR). They cut the
DNA isolated from UV-irradiated cells with T4 endonuclease V, and mapped the

positions and frequencies of cuts with LMPCR. They found that CPDs in the p53 gene

Ci

In
o-o

3

are repaired site-speciﬁcally in normal human ﬁbroblasts. They also found that 7 out of
8 mutation hot spots in the p53 gene found by Brash et al. (1991) in human squamous
cell and by Ziegler et al. (1993) in human basal cell carcinomas were sites where rates
of repair were slow, further conﬁrming that inefﬁcient repair contributes to the formation
of mutation hot spots. Gao et al. (1994) also demonstrated site-speciﬁc repair of CPDs
at the promoter region of the PGKI gene.

All these studies of rates of repair in viva at the nucleotide level made use of T4EV.
However, T4EV can not recognize DNA adducts induced by chemical carcinogens, such
as bulky polycyclic compounds. At the time I undertook my investigation, there were no
reports about the distribution of any bulky adducts at the nucleotide level in human cells,
nor were there reports about rates of repair of bulky adducts at the nucleotide level.
Highly puriﬁed E. cali UvrABC excinuclease, which can excise essentially all bulky DNA
adducts leaving a 5' phosphate group at the site of the cut, had just become available.
Thus it seemed theoretically possible to combine UvrABC and LMPCR to investigate at
the nucleotide level the formation and repair of bulky DNA adducts in endogenous DNA
of human cells.

The objectives of this present work were (1) to investigate the formation and repair of
BPDE adducts on the nontranscribed strand of exon 3 of the HPRT gene in normal human
ﬁbroblasts; (2) to investigate the rates of repair of 1-nitrosopyrene—induced adducts at the
nucleotide level in the region of interest and compare them with those of BPDE adducts
in the same region to determine the contribution of the adduct conformation and the local

DNA secondary structure to the rate of repair at a particular nucleotide position; (3) to

4

investigate the distribution of BPDE adducts at the nucleotide level in exon 3 of the
HPRT gene in human cells across the cell cycle, compare this to that found in puriﬁed
DNA treated with BPDE in vitro, and assess the effect of physiological conditions to the
formation of BPDE adducts.

Chapter I reviews the literature dealing with nucleotide excision repair, methods
available to study nucleotide excision repair at various level, and the effects of protein-
DNA interactions on DNA adduct formation and DNA repair; Chapter 11 consists of a
manuscript published in the March 1995 issue of Proceedings of the National Academy
of Sciences U.S.A., 92, pp.2204-2208. It describes the research I carried out to determine
rates of repair of BPDE adducts at the nucleotide level on the nontranscribed strand of
exon 3 of the HPRT gene in normal human ﬁbroblasts and correlates the result with
mutagenesis data obtained by previous studies in our laboratory; Chapter III consists of
a manuscript written in the format of Molecular and Cellular Biology. It describes my
work to compare the rates of repair of l-NOP induced adducts and BPDE adducts to
determine the contribution of the adduct conformation and the local DNA secondary
structure to the rate of repair at a particular nucleotide position; Chapter IV consists of
a manuscript written in the format of Carcinogenesis. It describes my work to determine
the distribution of BPDE adducts at the nucleotide level in human cells treated in viva and
in puriﬁed DNA treated in vitro, and compare them to assess the effect of physiological

conditions on BPDE adduct formation.

LIST OF REFERENCES

LIST OF REFERENCES

Brash, DE. 1988. in DNA repair .' A Laboratory Manual of Research Procedures, eds.
Friedberg, E.C. & Hanawalt, P.C. (Dekker, New York), 327-345.

Brash, D.E., Seetharam, S., Kraemer, K.H., Seidman, M.M.& Bredberg, A. 1987.
Photoproduct frequency is not the major determinant of ultraviolet light base substitution
hot spots or cold spots in human cells. Prac. Natl. Acad. Sci. USA, 84:3782-3786.

Brash, D.E., Rudolph, J.A., Simon, J.A., Lin, A., McKenna, G.J., Baden, H.P., Halperin,
A.J. & Ponten, J. 1991. A role for sunlight in skin cancerzUV-induced p53 mutations in
squamous cell carcinoma. Prac. Natl. Acad. Sci. USA, 88:10124-10128.

Gao, S., Drouin, R. & Holmquist, G.P. 1994. DNA repair rates mapped along the human
PGKI gene at nucleotide resolution. Science, 263:1438-1440.

Hoeijmakers, J.H.J. & Bootsma, D. 1994. Incisions for excisions. Nature, 371:654-655.

Kunala, S. & Brash, DE. 1992. Excision repair at individual bases of the Escherichia
cali lacI gene: relation to mutation spots and transcription activity. Prac. Natl. Acad. Sci.
USA, 89:11031—11035.

Kunkel, TA. 1992. DNA replication ﬁdelity. J. Bio. Chem, 267:18251-18254.

Miller, J.H. 1985. Mutagenic speciﬁcity of ultraviolet light. J. Mal. Biol, 182:45-68.
Sancar, A. & Sancar, GR. 1988. DNA repair enzymes. Annu. Rev. Biochem, 57:29-67.
Seeberg, E. & Fuchs, R.P.R. 1990. Acetylarninoﬂuorene bound to different guanines of
the sequence-GGCGCC-is excised with different efﬁciencies by the UvrABC excision

nuclease in a pattern not correlated to the potency of mutation induction. Prac. Natl.
Acad. Sci. USA, 87:191-194.

Schaaper, R.M., Dunn, R.L. & Glickman, B.W. 1987. Mechanisms of ultraviolet-induced
mutation. Mutation spectra in the Escherichia coli lac] gene for a wild type and an
excision-repair-deﬁcient strain. J. Mol. Biol., 198:187-202.

has:

Tor
spa

\l'r
Yar
ind
Bz'o
lie

10 1
90'.

6

Strauss, B., Rabkin, S., Sagher, D. & Moore, P. 1982. The role of DNA polymerase in
base substitution mutagenesis on noninstructional templates. Biochimie, 64:45-68.

Tornaletti, S. & Pfeifer, G.P. 1994. Slow repair of pyrimidine dimers at p53 mutation hot
spots in skin cancer. Science, 263:1436-1438.

Wang, T.S.-F. 1991. Eukaryotic DNA polymerases. Annu. Rev. Biochem, 60:513-552.

Yang, J.-L., Maher, V.M. & McCormick, 1.1. 1988. Kinds and spectrum of mutations
induced by l-nitrosopyrene adducts during plasmid replication in human cells. Mal. Cell.
Biol, 8:3364-3372.

Ziegler, A., Leffell, D.J., Kunala, S., Sharma, H.W., Gailani, M., Simon, J.A., Halperin,
A.J., Baden, H.P., Shapiro, P.E., Bale, A.E. & Brash, DE. 1993. Mutation hot spots due
to sun light in the p53 gene of nonmelanoma skin cancer. Prac. Natl. Acad. Sci. USA,
90:4216-4220.

CHAPTER I

LITERATURE REVIEW

A. Cancer and DNA Repair

In vitro and in vivo studies indicate that human cancer is the result of a series of
mutations that permanently change the genetic information (Cairns, 1981; Ames, 1989).
In human cells, most of the genetic information is stored in the genomic DNA and stably
transferred to the progeny cells through a semi-conservative replication mechanism.
Mutations can occur when DNA is damaged and a DNA polymerase tries to replicate
DNA in the presence of DNA damage (Strauss et al., 1982). Although human cells are
constantly subjected to various kinds of internal and external damage, mutations rarely
happen in normal human cells. This is because the integrity of DNA is constantly
protected by various DNA repair systems. DNA repair systems can detect and remove
abnormally modiﬁed nucleotides (e.g., bulky DNA adducts) (Sancar and Sancar, 1988)
or normal but mismatched nucleotides (Modrich, 1994), so no mutations will occur and
the genetic information will be kept unchanged when these repair systems are operating
effectively.

The importance of DNA repair in preventing cells from becoming tumorigenic is

evidenced in hereditary diseases that affect DNA excision repair, such as xeroderrna

7

pigmer
1972‘);
for rm:
to this
effects
therefo
“ithin
radiatic
several
skin In
malign;
Eigh'
the dtfc
for all
CIOned '
B rec0g

1994).

8
pigmentosium (XP) (Cleaver, 1968; Kraemer, 1980), Cockayne Syndrome (CS) (Guzzetta,

1972) and trichothiodystrophy (Lehmann et al., 1988). XP arises when the main pathway
for nucleotide excision repair (NER) contains an inherited defect (Kraemer, 1980). Due
to this defect, the cells of XP patients are more sensitive to the lethal and mutagenic
effects of most mutagens, such as ultraviolet (UV) light from the sun, and the cells are
therefore more prone to acquire the genetic changes necessary to become tumorigenic
within a much shorter period than normal cells when exposed to comparable levels of UV
radiation. These patients usually suffer an age-speciﬁc incidence of skin cancer that is
several thousands times higher than normal individuals. They typically develop multiple
skin tumors which lead to death from metastatic squamous or basal cell carcinoma or
malignant melanoma (Kraemer, 1980).

Eight complementation groups of XP have been identiﬁed so far (Cleaver, 1990), and
the defective genes responsible for the aberrant excision repair function have been cloned
for all groups except XP variants (Hoeijmakers and Bootsma, 1994). Studies on the
cloned genes have shown that their products are required at critical steps of NER, such
as recognition of DNA damage or excision of DNA damage (Hoeijmakers and Bootsma,
1994). In addition, some excision repair components, which are defective in some XP
patients, are found involved in other important cellular functions such as RNA
transcription (Buratowski, 1993). For example, the ERCC 3 (excision repair cross
complementation 3) protein was originally identiﬁed as a protein complementing the
defective excision repair in Complementation Group 3 rodent cells (Weeda et al., 1990a).

Later it was shown that the deﬁciency in ERCC 3 resulted in XP complementary group

9

B, in which not only photosensitivity (a symptom typical for XP patients) is found, but
also many other non-skin associated abnormalities such as the neural disorders typical in
patients with Cockayne's Syndrome (Weeda et al., 1990b). Recent studies have shown
that the ERCC 3 protein is a major component of the transcription factor II H, which is
required for RNA polymerase II transcription (Schaeffer, 1993). The defect in its dual
functions during the development of affected individuals may underlie the non-skin
abnormalities of these XP group B patients (Hanawalt, 1994).

Defective nucleotide excision repair is not the only DNA repair process implicated in
human cancer. Recently it was found that deﬁciency in DNA mismatch repair was
implicated in an important familial cancer-prone disease, hereditary nonpolyposis
colorectal cancer (HNPCC) (Modrich, 1994). Cell lines derived from tumors of patients
with HNPCC accrue mutations at rates that can be more than a hundred times that of
normal human cells (Parsons et al., 1993). Biochemical analysis of a number of these cell
lines has consistently revealed an associated deﬁciency in strand-speciﬁc mismatch repair.
The majority of HNPCC cases are attributed to a defect at any one of the multiple loci
responsible for the mismatch repair system, e.g., the hMSHZ (F ishel et al., 1993), hMLHI
(Papadopoulos et al., 1994), hPMSI (Bronner et al., 1994) and hPMS2 (Nicolaides et al.,
1994) genes. It has been hypothesized that the initial event in development of HNPCC
tumors is the functional loss of a critical mismatch repair activity (Modrich, 1994). This
loss will result in genetic destabilization, which can lead to mutations. Mutations in some
important genes may circumvent the growth regulatory system in the cell and result in

cancer. Recently, the tumor growth factor-B receptor genes, which are important for

 

negatit'efj
nisrnatc'r.
insertions

D\:\ 1".

other cell

 

example is
of humant
protein is t
process (\
damage. tl
SE‘Stem tir
cOIISCquer.
does not .
Imitation;

A norm
DNA repa
generated .

What the [3

10

negatively regulating the cell growth, were found mutated in many HNPCC tumors with
mismatch repair deﬁciency (Markowitz et al., 1995). The mutations found were either
insertions or deletions, which is consistent with deﬁcient mismatch repair.

DNA repair systems do not act alone in human cells. They constantly interact with
other cellular processes that are important in the regulation of DNA repair. A typical
example is p53, an important tumor suppressor gene that has been found mutated in half
of human tumors tested (V ogelstein and Kinzler, 1992). One of the functions of the p53
protein is to serve as a messenger between DNA repair systems and the cell cycle control
process (V ogelstein and Kinzler, 1992). When cellular DNA suffers certain kinds of
damage, the p53 protein can halt the cell cycle in the 61 phase to allow the DNA repair
system time to repair the DNA before replication. It has been hypothesized that one
consequence of p53 mutations is that the subsequent defect in the G] arrest mechanism
does not allow enough time for repair of the damaged DNA and so the cell will be
mutation-prone and therefore cancer-prone.

A normal cell is not tumorigenic, and if the integrity of its DNA can be protected by
DNA repair systems, a tumor will never occur. In order to understand how mutations are
generated and to better prevent mutations from occurring, it is necessary to understand

what the DNA repair is and how the DNA repair systems work.

B. DNA

 

1. Basic

Cells

CthllS ST.

ClC.. Ol EX

 

 

 

DNA rep;
(1). Dir
chemical
photoreac
ptrimidir.
em bor.
removalc
91 al., 19:
10 a norm
(2). in:
the remov;
(excision r1
hm pairet
“€0de
actit’ares a l;
the adenine '

DNA (Mese.

 

11
B. DNA Repair systems

1. Basic DNA repair systems

Cells use DNA repair systems to keep their DNA "damage-free" from either internal
events such as spontaneous generation of apurine/apyrimidine sites, oxidative damage,
etc., or external agents such as ultraviolet light (UV), X-rays and chemical carcinogens.
DNA repair systems can be basically divided into two categories:

(1). Direct repair systems. These systems employ speciﬁc processes to reverse the
chemical reaction causing a modiﬁed base. Examples of direct repair systems are the
photoreactivation of cyclobutane pyrimidine dimers (CPDs) (Sancar, 1990) or 6-4
pyrimidine pyrimidones ((6-4)s) (Todo et al., 1993) by various photolyases, which cut the
extra bond formed in CPDs or (6-4)s reverting them back to normal pyrimidines; the
removal of the methyl group ﬁom 06-methylguartine by Q‘s-DNA alkyltransferase (Lindahl
et al., 1988), which transfers the methyl group to itself reverting the 06-methylguanine
to a normal guanine.

(2). Indirect repair systems. The basic repair strategies used by these systems involve
the removal and replacement of the incorrect base (mismatch repair) or the modiﬁed base
(excision repair). In mismatch repair, the substrate is a pair of normal nucleotides which
have paired incorrectly (Modrich, 1994). In E. cali, this mismatched base pair is
recognized by MutS, which then recruits MutL (Grilley et al., 1989). This complex
activates a latent d(GATC) endonuclease assocciated with MutH (Au et al., 1992). Since
the adenine in the d(GATC) sequence is always methylated except in newly synthesized

DNA (Meselson, 1988), and this d(GATC) endonuclease incises the unmethylated strand

at a hen

 

endonucl

inserted t

reaction. 1

of the un

 

1993}. 111
the other ‘
excision r
removed
is filled b
excision
bases is t
complem
and Sane;
Among
mEChanisr.
all DNA 1

importantl)
lllduCed b).
discussion

SaCCthOm}.

“bled of m

 

12
at a hemirnethylated d(GATC) sequence (Au et al., 1992), the incision by the d(GATC)

endonuclease will be on the same strand with the incorrect nucleotide that has been
inserted mistakenly during DNA replication. This incision is followed by an excision
reaction, in which MutS, MutL, MutU and an appropriate exonuclease remove the portion
of the unmethylated strand spanning the GATC site and the mismatch (Grilley et al.,
1993). The gap is then ﬁlled by DNA polymerase III and DNA ligase. Excision repair,
the other type of indirect repair, can be divided into base excision repair and nucleotide
excision repair (Sancar and Sancar, 1988) In base excision repair, the modiﬁed base is
removed by a DNA glycosylase, the abasic nucleotide is excised, and the resulting gap
is ﬁlled by DNA polymerases and DNA ligases (Sancar and Sancar, 1988). In nucleotide
excision repair, an oligonucleotide containing the nucleotide with the modiﬁed base or
bases is removed, and the gap generated is then ﬁlled by DNA polymerases, using the
complementary strand as the template. The ﬁnal nick is sealed by DNA ligases (Sancar
and Sancar, 1988).

Among these repair systems, nucleotide excision repair (NER) is the major DNA repair
mechanism in most species. NER is a general repair system that can repair essentially
all DNA lesions, although at different efﬁciencies (Sancar and Sancar, 1988). Most
importantly, NER is the only mechanism found to repair bulky adducts such as those
induced by benzo(a)pyrene and l-nitrosopyrene (Sancar and Sancar, 1988). Detailed
discussion of the nucleotide excision repair in Escherichia cali (procaryotes),
Saccharomyces cerevisiae (eucaryotes) and human cells (eucaryotes) is essential to the

subject of this dissertation.

13

2. Nucleotide Excision Repair in E. cali

E. coli is the classical model for nucleotide excision repair. The basic stepwise process
of NER comes from studies in E. cali, and this process was later found to be universal
(Sancar and Sancar, 1988; Huang et al., 1992). DNA adducts are ﬁrst recognized, and
DNA endonucleases are then recruited to generate dual incisions, located 5' and 3' of the
DNA lesion. The oligonucleotide containing the DNA adduct is then displaced and the
gap is ﬁlled by a DNA polymerase using the complementary strand as the template.
Finally, a DNA ligase closes the nick completing the NER process. In E.coli, three
proteins, namely UvrA, UvrB and UvrC, are employed to recognize the DNA lesion and
excise the oligonucleotide containing the lesion. Uer and DNA polymerase I then ﬁll
the gap, and the ﬁnal nick is sealed by DNA ligase I (Sancar and Sancar, 1988; van
Houten, 1990).

The ﬁrst step of NER in E. coli is carried out by UvrA (Seeberg and Steinum, 1982),
a protein which has an energy-favored tendency to dimerize and form the UvrA dimer,
the reactive form of UvrA. The UvrA dimer can interact with both undamaged and
damaged DNA molecules (Mazur and Grossman, 1991). It has been suggested that after
the UvrA dimer binds, it can move progressively along the DNA to the damage site
because UvrA has ATPase and DNA helicase activity and thus can move along the DNA
(Grossman and Thiagalingan, 1993). The DNA/(UvrA)2 complex then undergoes a
conformational change and UvrB, which also has a cryptic ATPase activity, is directed
to this complex to form (UvrA)2UvrB/DNA. However, it is also possible that the UvrA

dimer ﬁrst interacts with UvrB, and that this (UvrA)2UvrB complex binds and progresses

14
along the DNA and locates the DNA lesion, because strong evidence shows that (UvrA)2

can form a complex with UvrB in vitro, and this (UvrA)2UvrB is capable of binding DNA
and locating the site of the damage (Orren and Sancar, 1989).

After the (UvrA)2UvrB complex reaches the site of the DNA lesion, the conformation
of this complex changes in an endothermic manner (Grossman and Thiagalingan, 1993)
possibly due to the abnormal structure induced by the DNA adduct or photoproducts.
DNA footprinting assays have shown the footprint of this (UvrA)2UvrB complex changing
from 33 bp (which is also the footprint of (UvrA)2 on DNA) to 19 bp (which is the
footprint of UvrB), suggesting that the protein that directly contacts DNA changes from
UvrA to UvrB (Orren and Sancar, 1989; Visse et al., 1992). This conformational change
eventually leads to release of the UvrA dimer. UvrB will then unwind and kink the DNA
at the damage site, resulting in a much tighter interaction between UvrB and DNA.

The stable complex between DNA and UvrB after release of UvrA is able to attract the
UvrC protein (Orren and Sancar, 1989). It is highly likely that the special conformation
of the UvrB/DNA complex serves as the binding substrate of UvrC, because in vitro
UvrC can not bind either UvrB or DNA containing an adduct (Orren and Sancar, 1989).
Both UvrB and UvrC have endonuclease activity, and in the UvrBUvrC/DNA complex,
UvrB makes the ﬁrst incision at the 4th or 5th phosphodiester bond 3' to the site of the
damage, possibly independent of the action of UvrC (Lin and Sancar, 1992). This is
followed by the incision made by UvrC at 8th phosphodiester bond 5' to the site of the
damage (Sancar and Tang, 1993). This dual incision generates an oligonucleotide 12-13

nucleotides in length containing the DNA lesion.

 

 

 

 

19E

and

E. at
the
Sine
pol}-
I0 re
Hoot
Shoo,
excin
In E.
Coup]

Of the

15
UvrB and UvrC remain bound to DNA until the arrival of Uer (DNA helicase II) and

DNA polymerase I (Husain et al., 1985; Orren et al., 1992). Although it is not clear
whether DNA helicase II recognizes the 5' nick of the DNA or interacts with the
postincision complex in a special way, DNA helicase II binds the postincision complex,
and with its 3'-5' helicase activity, removes both UvrC and the oligonucleotide containing
the DNA lesion (Orren et al., 1992). UvrB is most likely dislodged by DNA polymerase
I when the polymerase recognizes the 3'-OH of the 5'-incision and ﬁlls in the gap with
its polymerase activity, using the complementary strand as the template (Orren et al.,
1992). DNA ligase I then seals the ﬁnal nick, and the NER process is complete (Sancar
and Tang, 1993).

Besides the basic nucleotide excision repair, there is transcription-coupled repair in
E. coli (Mellon and Hanawalt, 1989; Selby and Sancar, 1993), evidenced by the fact that
the transcribed strand of an active gene is repaired faster than the nontranscribed strand.
Since most forms of DNA damage on the transcribed strand can block the RNA
polymerase, it was suggested that the stalled RNA polymerase serves as an extra signal
to recruit the DNA repair machinery (Selby and Sancar, 1990; Selby and Sancar, 1991).
However, studies with an in vitro system constructed with various puriﬁed proteins
showed that the stalled RNA polymerase actually inhibited the access of UvrABC
excinuclease, suggesting that other factors are involved in viva (Selby and Sancar, 1990).
In E. coli, a 120-kDa protein was discovered that might be responsible for the transcription
coupled repair (Selby and Sancar, 1991). This protein was later identiﬁed as the product

of the mutation frequency decline (MFD) gene, a gene deﬁned as responsible for the

 

Sane
estal
D.\'.-'
com;
nucl
Will
addu
3. N

Ju
has 1
torn]

by N

(Prat-
PAD

UV Cl

16

decrease in mutations observed when UV-irradiated E. cali cells are incubated in starvation
medium rather than in rich medium (Selby and Sancar, 1993). In vitro analysis of the
protein shows that it is capable of removing the stalled RNA polymerase from the site of
DNA damage. The UvrA protein can be retained on a column containing MFD proteins,
suggesting that in viva the MF D protein might help to recruit the UvrA protein (Selby and
Sancar, 1993). The mechanism of transcription coupled repair has not yet been
established, but it has been hypothesized that when an RNA polymerase is stalled by a
DNA adduct on the transcribed strand, the MF D protein can bind and release this stalled
complex. The MFD protein may also serve as a signal to attract UvrA and start the
nucleotide excision repair process. In this way, DNA adducts on the transcribed strand
will have more of a chance to be recognized by NER and thus be repaired faster than
adducts on the nontranscribed strand.

3. Nucleotide excision repair in yeast (Saccharamyces cerevisiae)

Just as E. coli serves as a paradigm for nucleotide excision repair in procaryotes, yeast
has been studied as an excellent model for NER in eucaryotes (Prakash et al., 1993). In
comparison to that in E. cali, NER in yeast is very complex. Since the ﬁrst formal search
by Nakin and Matsumoto (1967) for yeast mutants abnormally sensitive to UV radiation
about 30 years ago, more than 25 genes have been found to be involved in repair process
(Prakash et al., 1993). These genes are categorized into three epistasis groups: RAD3,
RAD6 and RAD52. The RAD3 group consists of genes required for excision repair of
UV damaged DNA, including RAD], RADZ, RAD3, RADIO, RAD14 and RAD25. The

RAD6 group contains genes required for postreplication repair of UV damaged DNA and

17
for UV mutagenesis, such as RAD6 and RAD18. The RAD52 group contains genes that

have only a marginal effect on UV sensitivity, but affect sensitivity to ionizing radiation.
Due to the complexity of this system, the functions of many proteins involved in NER
are still uncertain, let alone their roles in NER. Only proteins whose functions and roles
in NER have been studied very thoroughly will be discussed below.

NER in yeast is believed to start with recognition of the DNA damage by RAD14, a
zinc metalloprotein (Bankmann et al., 1992; Guzder et al., 1993). It has been shown that
RAD14 binds UV-damaged DNA with high afﬁnity (Guzda et al., 1993), and cells with
mutant RAD14 are totally defective in the incision of UV-darnaged DNA, indicating that
the RAD14 protein is involved in early steps of NER (Bankmann et al., 1992). RAD14
contains a four cysteine (4C) zinc ﬁnger motif, and zinc chelation by the 4C motif could
confer the damage-speciﬁc DNA binding activity upon the protein. However, RAD14
does not contain a nucleotide binding motif, has no ATPase or DNA helicase activity, and
can not unwind DNA or move along DNA (Bankmann et al., 1992; Guzda et al., 1993).
Thus, it is very unlikely that RAD14 can have any other functions except recognizing the
damaged DNA and possibly recruiting other proteins involved in NER. RAD14 is
hypothesized to recruit such proteins as DNA helicases (RAD3 and RAD25) and single
strand endonucleases (RADI/RADIO, RAD2), to carry out NER (Guzda et al., 1993).

DNA helicase activity and endonuclease activity are found in different proteins in yeast
NER (Prakash et al., 1993). The endonucleases identiﬁed in yeast so far are all single-
strand DNA (ssDNA)-dependent (Tomkinson et al., 1993; Habraken., 1993), leading to

the suggestion that DNA helicases act ﬁrst to unwind DNA, and then single-strand DNA

18

endonucleases make the incisions in the unwound region. RAD3 (Sung et al., 1987;
Lohman, 1992) and RAD25 (Guzda et al., 1994) are examples of yeast proteins with
DNA helicase activity. Mutations in these two genes can result in totally defective NER
(Cox and Game, 1974; Reynolds and Friedberg, 1981; Prakash et al., 1993), strongly
suggesting their involvement in early steps of yeast nucleotide excision repair.

The RAD3 protein possesses ssDNA-dependent ATPase and DNA helicase activity
(Sung et al., 1987; Lohman, 1992), and translocates on the ssDNA in the 5'-3' direction.
Various mutations in RAD3 were found to result in defective incision or a defective post-
incision step (Naumouski and Friedberg, 1983; Higgins et al., 1983; Sung et al., 1988),
indicating that RAD3 is absolutely required in incision and also functions in a step
subsequent to incision. Friedberg and his colleagues reported that RAD3 is often
sequestered at or near sites of base damage (Naegeli et al., 1992) resulting in loss of its
helicase activity (Naegeli et al., 1993), and thus hypothesized that RAD3 may function
in recognition of the DNA damage. However, Prakash and coworkers (Sung et al., 1987)
found that the RAD3 helicase is not very processive and thus could not fulﬁll the task of
unwinding the long regions of DNA packaged in chromatin in viva. They suggested that
the role of RAD3 in incision is to unwind the DNA in the vacinity of the damaged site
to attract the single-stranded DNA endonucleases (Prakash et al., 1993). In the
postincision steps, RAD3 might be necessary to displace the oligonucleotide containing
the damaged base and the bound excision repair proteins, or to participate in the repair
synthesis (Sung et al., 1988; Bailly et al., 1991). Another DNA helicase required for

NER is RAD25 (Guzder et al., 1994b). It has been suggested that RAD 25 plays a role

19

in unwinding the damaged DNA to prepare it for dual incision in the damaged strand by
the single-strand DNA-dependent endonucleases.

After DNA helicases bind and unwind the DNA double helix, ssDNA endonucleases
can bind the DNA and make incisions. It has been shown that RADl/RADIO
(Tomkinson et al., 1993) and RAD2 proteins (Habraken et al., 1993) in yeast have ssDNA
endonuclease activity. RAD] always interacts with RADIO to form RADl/RADIO
(Bailly et al., 1992), which participates in repair and recombination as a protein complex.
A complex of RADl and RADIO proteins with a speciﬁc interaction in vitro has been
shown to bind ssDNA and exhibit endonuclease activity (Tomkinson et al., 1993). It has
been shown that the RADl/RADIO enzyme makes endonucleolytic scissions in unwound
regions in negatively supercoiled DNA (Sung et al., 1993a). RAD2 is also a ssDNA
endonuclease but has shown no activity on unwound regions of negatively supercoiled
double-stranded DNA (Habraken et al., 1993). Therefore, the involvement of these two
endonucleases is most likely stepwise instead of simultaneous: the locally unwound DNA
is ﬁrst cut by RADl/ 10, and the nicked and unwound single-stranded damaged region can
then be cut by RAD2. Recent studies using specially-synthesized "spray-arm"
oligonucleotides, in which partially double-stranded oligonucleotides with a spray 5' or
3' end are used to test the preference of a ssDNA endonuclease to the 3' or 5' ends of an
unwound "bubble" in double-stranded DNA, showed that the RADl/RADl 0 complex cuts
5' of the DNA lesion (Bardwell et al., 1994), and the RAD2 protein cuts 3' of the DNA
lesion (Harrington and Lieber, 1994).

This scenario is based largely on the known functions of various proteins and on the

tr;

th

Ira

in(

R4
hel

20

dual incision model of nucleotide excision repair in E. cali. Currently there is no in vitro
NER system for yeast. DNA polymerases and DNA ligases involved in repair synthesis
in yeast have yet to be identiﬁed. The roles of other necessary gene products remain to
be studied.

Another important achievement of studies of yeast nucleotide excision repair is a
further understanding of transcription-coupled repair. In E. coli, the MF D protein is
responsible for removing the stalled RNA polymerase (Selby and Sancar, 1993), and the
components of NER are not required for viability (Sancar and Sancar, 1988). In yeast,
however, many components of NER are critical for viability (Prakash et al., 1993), and
this phenomenon has intrigued researchers for a long time. Studies in recent years have
shown that DNA helicases critical for NER also participate in other important cellular
processes that require unwinding of DNA (Guzder et al., 1993). The two DNA helicases
(RAD3 and RAD25) are found to be major components of RNA polymerase II
transcription factor b (also named TFIIH), an important factor in the initiation of
transcription. Since DNA lesions are removed at a faster rate from the transcribed strand
than from the nontranscribed strand, the involvement of these genes in both transcription
and DNA repair suggests a key role for these two proteins in preferential repair of the
transcribed strand (Guzder et al., 1994a). However, NER is not coupled to transcription
in such a simple way as just sharing some components. Studies of various mutants
indicated that the repair capacity, helicase activity and transcription ability of RAD3 and
RAD25 might be controlled by separate domains. A mutant RAD3 with defective DNA

helicase/ATPase activities was shown to be normal in NER (Sung et al., 1988). A mutant

nucieot
. ER (5
a large
contain
PADl.
intetth.‘
COUpIin
transcri
to the r
the cor

Millie

21
RAD25 with defective NER ability was fully competent for RNA polymerase II

transcription (Park et al., 1992). The exact roles of various genes in both DNA repair and
RNA transcription are still not clear.

Recently, Kornberg and coworkers reported evidence showing the existence of a
nucleotide excision "repairosome", an interactive complex of all proteins required for
NER (Svejstrup et al., 1995). Using antibodies against the core of TFIIH, they isolated
a large complex with an apparent mass between 700 KDa and 1000 KDa. This complex
contains all the essential proteins known to be required for NER in yeast, such as
RAD1/10, RAD 2, RAD4 and RAD14. The investigators went on to suggest that
interchange between holo-TFIIH and the repairsome could underlie repair-transcription
coupling. However, TFIIH has been shown to be essential only for initiation of RNA
transcription by RNA polymerase 11, while transcription coupled repair should be coupled
to the progression of RNA polymerase. Several models have been suggested to explain
the controversy, and the most likely one is that the conformation of a stalled RNA
polymerase II at the site of DNA damage resembles that of a transcription initiation
complex, and thus recruits the DNA repairosome. More work needs to be done before
the mechanisms of transcription coupled repair can be fully understood.

4. Nucleotide excision repair in human cells

Research in understanding NER in human cells was ﬁustrated for a long time because
of the lack of an efficient method to isolate the genes involved in NER. A disease with
NER deﬁciency, xeroderma pigmentosum, was ﬁrst described by Cleaver (1968). Since

then, more cases of XP (Kraemer, 1980) and other NER-deﬁcient diseases such as

C ocltayr.

compler:
more the
etiors ir
the cons
library i:
expressi

Ana

22

Cockayne's Syndrome (CS) (Guzzetta, 1972) have been reported. Complementation
experiments using cell lines derived from these patients showed that there are at least 11
complementation groups (Cleaver and Kraemer, 1989; Tanaka et al., 1981), indicating that
more than 11 independent genes are involved in the process of NER. However, the early
efforts in cloning the genes were fruitless because of the technical difﬁculty involved in
the construction of a complete cDNA or genomic DNA library and then transfecting the
library into human cells successfully, since human cells can not maintain the integrity or
expression of transfected genes stably.

An alternative approach was used to identify the human genes involved in NER.
Beginning in 1982, various Chinese hamster ovary (CHO) cell lines were selected for UV
hypersensitivity, and a series of CHO cell lines hypersensitive to UV were obtained
(Thompson et al., 1981). Complementation experiments indicated that these mutant cell
lines belonged to at least ﬁve complementation groups (Busch et al., 1989). Transfection
of human genomic DNA into these mutant CHO cell lines, followed by direct selection
for UV resistance, identiﬁed several human genes that complement these repair deﬁcient
phenotypes. These genes were isolated and designated as excision repair cross-
complementing (ERCC) genes, including ERCC] (Westerveld et al., 1984), ERCCZ
(Weber et al., 1988), ERCC3 (Weeda et al., 1990a), ERCC5 (Shiomi et al., 1994) and
ERCC6 (T roelstra et al., 1990).

Since 1989, transfection of these ERCC genes into various XP cell lines showed that
ERCCZ, ERCC3, ERCC5 and ERCC6 genes were equivalent to the XPD (Flejter et al.,

1992), )ﬂ’B (Weeda et al., 1990b), XPG (Shiomi et al., 1994) and CSB (CS group B

corn;
two 1
gene
of it

COlill

icon.
1994

leVel

fiat
001151

roles

23

complementing) genes (Troelstra et al., 1992) respectively. Within the same time period,
two different groups cloned the XPA gene and the XPC complementing genes. The XPA
gene was cloned by the complementation of UV sensitivity after large scale transfection
of XPA cells with mouse genomic DNA and subsequent isolation of the human
counterpart (Tanaka et al., 1989; Tanaka et al., 1990). The XPC gene was cloned by
complementation of UV sensitivity after transfecting XPC cells with a normal human
cDNA library (Legerski et al., 1992). The repair defect of a subset of XPE cells was
found to be complemented by DNA damage binding (DDB) proteins (Keeney et al.,
1994). DNA excision repair synthesis in the XPF cell extract was recovered to wild type
level by a partially puriﬁed protein complex containing ERCC] (however, ERCCl alone
can not complement the repair defect in XPF cells. (van Vuuren et al., 1993)) (Biggerstaff
et al., 1993). Analysis of these various proteins using cell free extracts and other in vitro
constructed systems led to further understanding of their functions and their corresponding
roles in NER. A general picture is depicted, much more complex than that in E. coli.
The ﬁrst step of NER is believed to be the recognition of damaged DNA by the XPA
protein (811ng et al., 1991; Robins et al., 1991; Miura et al., 1991). The defective XPA
protein in cell lines derived from XPA patients results in almost no NER activity,
indicating that this protein is involved in an early step (Fomace et al., 1976; Tanaka et
al., 1977). The XPA gene has been shown to be a human analog of the yeast RAD14
gene (Bankmann et al., 1992), which encodes a protein that binds speciﬁcally to UV-
darnaged DNA. Analysis of the amino acid sequence showed that the XPA protein

contains a four cysteine zinc ﬁnger motif, suggesting a DNA binding activity (Tanaka et

protein
stimuli
tDDBjt
21 124-1
1993,), .
subset (

61 al.,

24
al., 1990). It has also been shown that the XPA protein binds preferentially to DNA

damaged by UV, cisplatin or 030,, (Robins et al., 1991).

As in the yeast RAD14 protein, no other special motif has been found in the XPA
protein (Prakash et al., 1993), suggesting the involvement of auxiliary proteins or
stimulatory proteins in recognition of DNA damage. Human DNA damage binding
(DDB) protein is one such example (Chu and Chang, 1988). DDB is a heterodimer of
a 124-kDa polypeptide and a 41-kDa protein (Hwang and Chu, 1993; Keeney et al.,
1993), and binds speciﬁcally to DNA damaged by UV. Microinjection of DDB into a
subset of XPE cells stimulated the repair DNA synthesis to the wild type level (Keeney
et al., 1994). It was suggested that DDB functions in an alternative DNA damage
recognition pathway, exclusive from the XPA recognition pathway (Chu and Chang,
1988). However, the DNA repair defect in XPE cells is less severe than that in XPA
cells (Cleaver and Kraemer, 1989), suggesting that the DDB protein just plays an
auxiliary role in DNA damage recognition, whereas the XPA protein serves as the major
DNA damage recognition protein (Keeney et al., 1994).

Recently, human replication protein A (RPA) was found to increase the binding of
XPA protein about 10 fold to a DNA fragment containing actetylaminoﬂuorene adducts
(He et al., 1995), suggesting that RPA may function in conjunction with the XPA protein
at the earliest step of DNA damage recognition in excision repair. RPA was ﬁrst
identiﬁed as a human single—stranded DNA binding protein (HSSB) (Wold and Kelly,
1988), and later found to be important for DNA replication (Wold and Kelly, 1988;

Fairman and Stillman, 1988), DNA recombination (Moore etal., 1991) and DNA excision

repair (C
stranded
suggestin
the actit'i
double h:
damagea
other step
The D
hehcases
excised, 5
SEEIE-str;
The XPB
(ERCC6)
helicases;
£11994).
“H (TFtr
RNA p01).
these Drm
imIliation.
partial-13165
the cDNA

hOmO'Og. t

25

repair (Coverley et al., 1991). Substitution of RPA with a heterologous analog of single-
stranded DNA binding protein resulted in repair deﬁciency (Coverley et al., 1991),
suggesting that RPA functions in NER through unique protein-protein contact, not just by
the activity of binding to ssDNA. It has been suggested that the local melting of the
double helix induced by DNA damage attracts the RPA and then makes the site of the
damage a better substrate for the XPA protein (He et al., 1995). RPA is also involved in
other steps of NER, which will be discussed later.

The DNA damage recognition is believed to be followed by recruitment of DNA
helicases to unwind the double helix. This allows the damaged segment of DNA to be
excised, since the XPA protein has no helicase activity (Miura et al., 1991), and only
single-stranded DNA endonucleases have been identiﬁed as participating in human NER.
The XPB (ERCC3) (Weeda et al., 1990b), XPD (ERCC2) (F lejter et al., 1992) and CSB
(ERCC6) (T roelstra et al., 1992) proteins have sequence similarities to known DNA
helicases and have shown DNA helicase activity in vitro (Sung et al., 1993b; Drapkin et
al., 1994). The XPB and XPD proteins are found to be components of transcription factor
11 H (TFIIH) (Schaeffer et al., 1993), part of the basic transcription initiation complex for
RNA polymerase II (Buratowski et al., 1989; Zaawel and Reinberg, 1992), suggesting that
these proteins possess dual roles, functioning during NER as well as transcription
initiation. The XPD protein is the human homolog of the yeast RAD3 protein, which
participates in both transcription and DNA repair complexes (Prakash et al., 1993). Using
the cDNA of the XPB protein as a probe, Prakash and colleagues isolated a yeast XPB

homolog, RAD25 (Park et al., 1992), which also has DNA helicase activity and is

requir
RAD2
XPB a
system
et al.. _
The
esplana
manage
comple)
basic DI
ofthe g:-
repair w
1992). (
but lack
Transfect
AnaIFSis
et al., 199
fu“Ctionjn
the repair
the RNA F
to allow ac

hEilCaSes t(

26
required for both transcription and NER (Guzder et al., 1991). Both the RAD3 and

RAD25 proteins are required for yeast viability, further suggesting the critical role of the
XPB and XPD proteins in human cells. Wood and colleagues showed that in an in vitro
system, puriﬁed TFIIH complex is absolutely required for excision repair (Aboussekhra
et al., 1995).

The bifunction of XPB and XPD proteins in NER and transcription may offer a simple
explanation for transcription-coupled repair in human cells. However, how the cell
manages to exchange these shared factors between transcription factors and NER
complexes remains to be studied, and defects in either XPB or XPD protein affect the
basic DNA repair mechanisms including both the transcription-coupled repair and repair
of the genome overall. Furthermore, an extra factor responsible for transcription-coupled
repair was identiﬁed as ERCC 6, which is defective in CSB patients (Troelstra et al.,
1992). Cell lines derived from patients with CSB are proﬁcient in overall genome repair,
but lack the preferential repair of actively transcribed genes (V enema et al., 1990b).
Transfection of the ERCC6 gene into CSB cells corrected this repair defect of CSB cells.
Analysis of the gene sequence suggests that it has a DNA unwinding function (T roelstra
et al., 1992). It is thus very likely that the ERCC6 protein serves as a coupling factor,
functioning in removing the stalled RNA polymerase at the adducted site and attracting
the repair enzymes. However, a recent study by Hanawalt and colleagues suggests that
the RNA polymerase may stay in place, while the RNA it is making is partially degraded
to allow access for the repair enzymes (Donahue et al., 1994). After the binding of DNA

helicases to the DNA damage site, the DNA will be unwound and the exposed single-

strand:
(’ERC(
The
as the l
was f0
Group .
gene (C
gene (S
ETOUps
ERC C 5
PAD 2
(O'Donc
Colleagt
during )
XPG ce]
Of that t

The 01

27
stranded DNA will be clipped out by single-stranded DNA endonucleases: the XPG

(ERCC5) protein and the ERCCI/XPF protein complex.

The ERCC5 gene was ﬁrst localized and found to be at the same chromosomal location
as the cloned XPG gene (O'Donovan and Wood, 1993). Furthermore, a puriﬁed protein
was found to complement the repair defect in cell extracts of both Complementation
Group 5 CHO cells and the human XPG cells, indicating that the ERCC5 gene is the XPG
gene (O'Donovan and Wood, 1993). This was later conﬁrmed by the cloning of the XPG
gene (Scherly et al., 1993) and the ERCC5 gene (Shiomi et al., 1994) by two independent
groups and the complementation of the repair defect of XPG cells by transfection of the
ERCC5 gene (Shiomi et al., 1994). The XPG protein is a human homolog of the yeast
RAD 2 protein and both were shown to be able to cut single stranded M13 DNA
(O'Donovan et al., 1994b). Using a synthetic "spray arm" DNA structure, Wood and
colleagues showed that the XPG protein is required for the formation of the 3' incision
during NER (O'Donovan et al., 1994a). The absence of evidence for a 5' incision by the
XPG cell extract further suggests that either the 3' incision is made before the 5' incision,
or that both incisions are made in a coordinated fashion (O'Donovan et al., 1994a).

The other ssDNA endonuclease, ERCC 1/XPF protein complex, has not been completely
puriﬁed and characterized. ERCC] gene was the ﬁrst human excision repair gene
characterized (van Duin et al., 1986), but no patients have ever been found with a
mutation in this gene, suggesting that this gene is very critical for cell viability (van Duin
et al., 1989). ERCC] is a 33-KDa protein but always sediments as a 120-kDa complex

in a native glycerol gradient (van Vuuren et al., 1993). This complex is capable of

comp
indica
protei:
tightl}
et al..

Duin e
protein

et al., I

28

complementing activity of CHO complementation groups 1, 4, 11 and XP group F,
indicating presence of a preformed complex of ERCC], ERCC4, ERCCll and XPF
proteins (van Vuuren et al., 1993; Biggerstaff et al., 1993). This complex interacts very
tightly because cell extracts of these cell lines can not complement each other (Biggerstaff
et al., 1993). ERCCl has been shown to be a human homolog of yeast RADl gene (van
Duin et al., 1986). Since the RADl protein always exists as a complex with RADIO
protein and this complex makes an incision on the 5' side of the DNA damage (Bardwell
et al., 1994), the complex of the ERCCl protein and the XPF protein and other proteins
is very likely to carry out the same function.

Replication protein A may also play a role in this incision step. The locally melted
DNA unwound by the DNA helicases can serve as an ideal substrate for RPA binding.
The size of the binding site of a molecule of human RPA on ssDNA is ~20-30 nucleotide
(Kim et al., 1992; Seroussi et al., 1993), which corresponds well with the distance
between the two incisions in UV irradiated DNA (Huang et al., 1992). RPA has also been
shown to bind the XPG protein (He et al., 1995). It is possible that RPA might help to
target the XPG protein on DNA 5' to the DNA damage.

The XPC protein might also participate in the incision step. Cell lines derived from
XPC patients were shown to have an NER system defective in the genome overall
subpathway, but normal in the transcription-coupled repair pathway (Kantor et al., 1990;
Venema et al., 1990a). The XPC protein was identiﬁed as a 125-kDa protein (Legerski
and Peterson, 1992). Sequence analysis indicated that it is a human homolog of the yeast

RAD4 protein, which is required for NER (Gietz and Prakash, 1988; Legerski and

Petersr
sequen
a corn;
of the )
et al.. 1
displace
respons
of the P
uxmm‘
XPC cor
in Vitro t
identiﬁer
“hat
PTOIeins;
remains 1
known to
‘3 al., 198
the 3’.OH
and Stiltm

reqlllt’ed f0

29

Peterson, 1992). However, no obvious DNA binding domains are apparent from the
sequence. Hanaoka and colleagues (Matsutani et al., 1994) puriﬁed the XPC protein in
a complex with two other proteins, HHR 23A and HHR23B, which are human homolog
of the yeast RAD23. This protein complex has the activity of binding ssDNA (Matsutani
et al., 1994). It may participate in the incision step by binding the unwound DNA or the
displaced oligonucleotide. However, it is not clear which of the components is
responsible for this property. A ubiquitin-like motif has been identiﬁed in the N-terminus
of the HHR23B protein, suggesting a role for this N-tenninal domain in facilitating the
assembly of this protein complex. Recently, Wood and colleagues showed that both the
XPC complex and puriﬁed TFIIH complex were required to reconstitute the NER reaction
in vitro (Aboussekhra et al., 1995). The actual role of the XPC complex remains to be
identiﬁed.

What happens immediately after the dual incisions is not clear. Whether all these
proteins already involved dissociate automatically or are displaced by some other proteins
remains to be determined. The human proliferating cellular nuclear antigen (PCNA) is
known to play a very important role in the post incision step (Shivji et al., 1992; Toschi
et al., 1988). PCNA is an important cofactor for DNA replication, required for locating
the 3'-OH of the primer and for the processitivity of DNA polymerases 6 and e (Melendy
and Stillman, 1992; Podust et al., 1992). Shivji et al. (1991) showed that PCNA is
required for DNA excision repair. Recently, Stillman and colleagues showed that a cyclin
dependent kinase inhibitor, p21, can inhibit PCNA-dependent DNA replication, but not

PCNA-dependent excision repair (Li et al., 1994). They suggest that the functions of

locatin
separat
repair.
(Huang
NER
that the
patients
damagit
replicati

1992).

30

locating a 3'-OH and increasing the processitivity of DNA polymerase are controlled by
separate domains. Only the function of locating 3'-OH is required for nucleotide excision
repair, since the gap generated by dual incisions of NER is only 29 nucleotide long
(Huang et al., 1992) and can be easily ﬁlled by DNA polymerases without PCNA.

NER is completed as the ﬁnal DNA nick is sealed by DNA ligase. It is very likely
that the human DNA ligase I is responsible for this step, since cell lines derived from
patients with defective DNA ligase I showed hypersensitivity to a wide range of DNA
damaging agents, and a retarded rate of joining of Okazaki fragments during DNA
replication and strand breaks after exposure to DNA damaging agents (Barnes et al.,
1992). However, the participation of the human DNA ligase II and 111 can not be
excluded.

Most of the ﬁrnctions of the proteins described here have only been identiﬁed during
the past two years. What is clear is that a lot of controversy still exists, such as the
actual order of the stepwise binding and releasing of various proteins. Highly speciﬁc
interactions must exist to use so many different proteins to repair the DNA lesions with
such an efﬁciency and accuracy.

C. Research on nucleotide excision repair at various levels in human cells

Long before the ﬁrst human repair gene was identiﬁed, people had already started to
work on various cell lines to understand the characteristics of DNA repair. Over a period
of more than 20 years, the research of NER has progressed from the genome overall level
to the speciﬁc genes to the nucleotide level, leading to more thorough understanding of

how various DNA lesions are repaired by NER.

1. lnves
DNA
against
radioact
of DNA
DNA is
nith rat
adducts
antibod

The ad

31

1. Investigation of DNA repair at the level of the genome overall

DNA repair was ﬁrst studied on the level of the genome overall using antibodies
against speciﬁc DNA adducts (Pathak et al., 1986; Wani and D'Ambrosio, 1987) or
radioactive carcinogens (Heﬂich et al., 1980). To use antibodies against a speciﬁc type
of DNA adducts, cells are exposed to various carcinogens, and at different time points,
DNA is isolated and treated with antibodies. The amount of antibodies (usually labeled
with radioactive isotopes) bound to DNA is indicative of the amount of the speciﬁc DNA
adducts formed on DNA, and therefore, the quantitative decrease of the amount of
antibodies bound to DNA after repair reﬂects the extent of repair of the speciﬁc adducts.
The advantage of this assay is that, at least in theory, it can be used to detect
quantitatively the repair of any speciﬁc kind of DNA adducts without interference from
other DNA adducts, since even if a carcinogen can induce different DNA adducts,
monoclonal antibodies can be obtained against a speciﬁc kind of them. The disadvantage
is that it is hard to generate speciﬁc antibodies against DNA adducts. So far only a
limited ntunber of antibodies have been successfully used, such as antibodies against UV
induced cyclobutane pyrimidine dimers (Roth et al., 1987), UV induced 6-4 pyrimidine
pyrimidones (Mitchell et al., 1988; Mori et al., 1988) and BPDE adducts (Nakagawa et
al., 1989).

Besides antibodies against DNA adducts, radioactive carcinogens have also been used
to detect repair at the level of the genome overall (McCormick and Maher, 1983). After
cells are treated with radioactive carcinogens, the genomic DNA is isolated at various

time points and the radioactivity remaining on DNA is measured. The decrease of

radio

adduc

11183.51

32

radioactivity of the DNA after allowing cell time for repair indicates the removal of DNA
adducts by NER. Repair of DNA adducts induced by a certain carcinogen can be
measured very accurately in this way.

The studies of DNA repair in the genome overall indicate that different DNA adducts
are repaired at different rates in human cells. However, the human genome has long been
known to consist of heterogeneous regions (Weintraub and Groudine, 1976). Actively
expressed genes are usually free of nucleosomes or contain very open chromatin
structures, while other DNA may be packaged into highly condensed chromatin structures,
where the accessibility of DNA repair enzymes can be strongly hindered. DNA repair at
the genome overall level does not provide any indication of what happens in a speciﬁc
DNA fragment in the genome, let alone what happens at the nucleotide level.

2. Study of DNA repair at the gene level

A method to detect rates of repair of cyclobutane pyrimidine dimers (CPDs) in speciﬁc
genes was deveIOped by Bohr et al. (1985). This assay starts with treating cells with UV,
isolating the genomic DNA after allowing cells various amounts of time for repair and
digesting DNA with restriction enzymes. One half of a restricted DNA sample is treated
with T4 endonuclease V (T4EV), which nicks the DNA speciﬁcally at the sites of CPDs
(Haseltine et al., 1980), while the other half is used as control. Both halves of the sample
are then separated in parallel in an alkaline denaturing agarose gel, and transferred to a
nylon membrane. After probing the membrane with radioactive probes speciﬁc for either
strand of a speciﬁc gene, one can determine the ﬁequency of cuts by T4EV in the

fragment by comparing the amount of the full length intact ﬁ'agment in the T4EV treated

Cellular
increase

this frag

genome
repair a
coupled
image."

This
SP€Cifrc
0f direc
the Site
the arm
greatly
(Thom:
in"111961
Older f
10 Kb
ﬁagme

33

sample with that of the control and making use of the Poisson distribution function.
Cellular removal of CPDs results in a corresponding lack of nicking by T4EV and an
increase in the amount of the full length fragment. The amount of CPDs remaining on
this fragment can then be calculated, and the rates of repair of CPDs on a fragment of a
speciﬁc gene can be determined. Bohr et al. (1985) ﬁrst discovered that the dihydrofolate
reductase (DHFR) gene, an actively expressed gene, was repaired at a faster rate than the
genome overall in CHO cells. Later, Mellon et al. (1986) showed that this preferential
repair also happened in the DHFR gene in human cells and that excision repair was
coupled to transcription (Mellon et al., 1987). More studies followed and showed the
intragenomic heterogeneity of DNA repair in mammalian cells (Bohr, 1991).

This method not only provided an effective approach to detect DNA repair in any
speciﬁc gene, but also changed the way to measure the amount of DNA adducts. Instead
of directly measuring the amount of DNA adducts, one can incise the damaged DNA at
the sites of DNA adducts with a speciﬁc enzyme, and quantitate the ﬁequency of cuts as
the amount of DNA adducts. The substitution of T4EV with E.coli UvrABC excinuclease
greatly expanded the spectrum of this research to virtually all bulky chemical carcinogens
(Thomas et al., 1988), since UvrABC excinuclease can excise almost all DNA adducts
induced by various bulky chemical carcinogens (Sancar and Sancar, 1988). However, in
order for this method to be quantitative, the DNA fragment of interest must be at least
10 Kb long. Thus only an average rate of repair of DNA adducts from such a long

fragment can be studied using this method (Bohr, 1991).

3. Study 1
The stu
Brash an:
digested t
on its 5' e
was anne
fragment
end-label-
to showt
indicative
hat the
belts'een '
SL1Sgestir
{@116an
This n
Speciﬁca
that the '1

let'el at i

34

3. Study of DNA repair at the nucleotide level.

The study of excision repair at single nucleotide resolution was ﬁrst done in E. coli by
Brash and colleagues (Kunala and Brash, 1992). They treated E. cali with UV and
digested the genomic DNA with restriction enzymes. An oligomer that had six dTTPs
on its 5' end and was designed to be complementary to the 3' end of the desired fragment,
was annealed to the DNA and an extension reaction by Taq polymerase enabled the
ﬁagment to be extended with [32P]dATP. In this way, only the region of interest was
end-labeled. The labeled DNA was cut with T4 endo V and separated on sequencing gels
to show the various cuts at speciﬁc nucleotide positions. The intensity of each band was
indicative of the level of CPDs at that nucleotide position. With this method, they found
that the rates of repair varied from site to site. They also found a correspondence
between UV mutation hot spots (Schaaper et al., 1987) and the excision repair slow spots,
suggesting that site to site variations in the rate of excision can profoundly affect mutation
frequency.

This method uses the annealing of an oligonucleotide to label the region of interest
speciﬁcally, which guaranteed the same labeling for all bands on the sequencing gel, so
that the intensity of fragments of a certain length is quantitatively indicative of the CPDs'
level at a particular site. However, sequencing gels can only separate DNA molecules
of up to 600 bp long. E. cali has a genome of ~10° bp, so it is possible to use this method.
A human cell has a genome of 3 x 109 bp, so the region of interest which can be analyzed
can only be 1/107 of the total DNA, which makes the speciﬁc labeling with an

oligonucleotide to quantitate the adduct level at each nucleotide position practically

 

impossible

Ligatior
DNA rep:
al.. 1994;
aS'phosp
treated w
primer is
The exter
asEmmett
end. L's:
group. 211
With PC}
allow the
one to ,
frequC

35

impossible.

Ligation mediated polymerase chain reaction (LMPCR) makes it possible to study the
DNA repair at the nucleotide level in human cells (Tornaletti and Pfeifer, 1994; Gao et
al., 1994; Wei et al., 1995a). LMPCR was ﬁrst used to detect the level of any cuts with
a 5' phosphate in any desired fragment of the genomic DNA (Pfeifer, 1992). DNA is ﬁrst
treated with speciﬁc enzymes or reagents to generate such cuts, and a gene speciﬁc
primer is allowed to anneal at the region of interest and extended with DNA polymerase.
The extension terminates at the site of the cut, and a blunt end forms at that site. An
asymmetric blunt ended linker with hydroxyl groups at each end is ligated to the blunt
end. Use of T4 DNA ligase, which can only ligate a 5' phosphate group with a 3'OH
group, allows the linker to be ligated in only one direction. DNA can then be ampliﬁed
with PCR using the longer oligomer of the linker and a second gene speciﬁc primer to
allow the ampliﬁcation of the desired fragments. Separation of the ﬁnal products allows
one to detect the original cuts at particular nucleotide positions and the relative
frequencies of these cuts. Pfeifer and colleagues (Tornaletti and Pfeifer, 1994) and
Holmquist and colleagues (Gao et al., 1994) used T4 endonuclease V and photolyase to
convert CPDs into cuts ampliﬁable with LMPCR. The relative frequencies of cuts were
determined for DNA isolated ﬁom cells that had been allowed various time for repair.
The decrease in the relative frequency of cuts by T4EV at a particular nucleotide position
after DNA repair should reﬂect the rate of excision repair at that nucleotide position.
They showed that the rates of repair of CPDs vary signiﬁcantly among different sites in

human cells.

In the SR
L'trABC e‘.
to study th
(Wei et al.
adducts. 1
all bulky l

lhlPCl
PCR to ac
to detect
limitation
Cuts by a
site does .
cuts CPD
incise the
be comp;
Variablee
or 5th ph
it hard 1
mll'mera

R.Old‘ 1 9
Th

trim!

36

In the studies I will describe in this doctoral dissertation, instead of T4EV, I used E. coli
UvrABC excinuclease, which can excise all DNA adducts induced by bulky carcinogens,
to study the repair of BPDE adducts and l-NOP-induced adducts at the nucleotide level
(Wei et al., 1995a; 1995b). I showed that site speciﬁc repair also exists for bulky DNA
adducts. This use of UvrABC extends the spectrum of this kind of research to essentially
all bulky DNA adducts.

LMPCR is an effective tool to study DNA repair at the nucleotide level. It utilizes
PCR to amplify the desired fragments to increase the speciﬁc signal so that it is possible
to detect repair on a 200 bp fragment in a genome of 3x109 bp. However, it has its
limitations: for example, it is an indirect method. It actually measures the frequency of
cuts by a certain enzyme at various sites. However, the frequency of cuts at a particular
site does not necessarily reﬂect the absolute level of adduct formation at that site. T4EV
cuts CPDs and leaves a 5' nucleotide with a base dimer. Photolyase must be used to
incise the base dimer so that this 5' end is suitable for ligation. The conversion might not
be complete at all sites for both enzymes. UvrABC excises the DNA adducts with
variable efficiencies at different nucleotide positions. UvrABC makes incisions at the 4th
or 5th phosphodiester bond 3' of DNA adducts (Sancar and Rupp, 1983), which makes
it hard to determine the rate of repair at consecutive nucleotide positions. DNA
polymerase might drop off before it reaches the cut to generate a blunt end (Garrity and
Wold, 1992). The efficiency of the blunt end ligation might be different at various sites.
These will eventually result in an altered picture of the original frequencies of cuts at

different nucleotide positions.

5 OF.”

Due It
by thl
Nonethel
nucleoti:
constant
be const:
final L.\l
level, i.e
D. Effec
Npair
1- Effect

Ever 5
Various c

and 1101].

37

Due to these limitations, it is not appropriate to take the frequencies of cuts detected
by LMPCR as the quantitative reﬂection of the distribution of DNA adducts.
Nonetheless, it can serve as a quantitative tool to measure the DNA repair at the
nucleotide level. T4EV and UvrABC can be expected to cut at a particular site with a
constant efficiency. The efficiency of blunt end ligation at a particular site should also
be constant. Thus, a decrease in the intensities of the fragment of a certain length in the
ﬁnal LMPCR ampliﬁed products should reﬂect quantitatively the decrease of the adduct
level, i.e., the rate of excision repair, at that particular nucleotide position.

D. Effects of protein-DNA interactions on DNA adduct formation and rates of DNA
repair
1. Effects of protein-DNA interactions on DNA adduct formation

Ever since researchers started to study the distribution of DNA adducts induced by
various carcinogens in vitro, they have found that DNA adducts are distributed unevenly
and non-randomly (Brash et al., 1987; Yang et al., 1988; Rill and Marsch, 1990; Ponti
et al., 1991). On a DNA fragment, there are "hot spots" and "cold spots" for DNA adduct
formation, i.e., places where DNA adduct formation is frequent and places where DNA
adduct formation is inﬁ'equent. Thus it has been suggested that DNA adduct formation
is affected by the local structure of DNA, which is determined by the local DNA
sequence context. In human cells, most of the DNA either wraps around histone octamers
to form nucleosomes or forms tight interactions with other protein factors, such as
transcription factors. Protein-DNA interactions limit access of carcinogens, and

sometimes change the dynamic structure of the DNA, as revealed by DNA footprinting

Studies.
dﬁcmd
induced
protein-T
adducts:
of the p:
Dunn
gwnune
Gilbert
0f some
l99lha

thetran

Houeve

38

studies. Thus, it is expected that DNA adduct formation in human cells should be
affected by various protein-DNA interactions. However, different DNA adducts are
induced through different pathways. Various studies have shown that the effects of
protein-DNA interactions on the formation of DNA adducts differ, depending on how the
adducts are induced, what kinds of protein interactions are involved, and characteristics
of the particular carcinogen (e.g., size).

Dimethyl sulfate (DMS) is a small chemical carcinogen, which can directly modify
guanine nucleotides by adding an extra methyl group at the N7 position (Maxam and
Gilbert, 1980). It has been shown that binding of transcription factors leads to protection
of some guanines from DMS modiﬁcation (Ephrussi et al., 1985; Kara and Glimcher,
1991), and cleavage of modiﬁed nucleotides with piperidine shows a clear footprint where
the transcription factor binds, making it an excellent reagent for DNA footprinting.
However, due to its small size, the loose interaction between DNA and histone octamers
hardly has any effect on its action. DMS has been shown to have the same modiﬁcation
patterns on free DNA, chromatin DNA and chromosomal DNA (Pfeifer et al., 1992;
Pfeifer and Riggs, I991).

Benzo(a)pyrene diol epoxide (BPDE) is the ultimate metabolite of benzo(a)pyrene, an
environmental carcinogen. It forms DNA adducts in two steps: it has to intercalate
noncovalently to the DNA double helix ﬁrst and then can form covalent adducts with
DNA (MacLeod and Zachary, 1985). Smith and MacLeod (1993) studied BPDE adduct
formation on a DNA fragment before and after it wrapped around a reconstituted

nucleosome. They found that adduct formation at the core region of the nucleosome was

inhibit:
carcinc
are too
outside
BPDE
DNA. 5
adduct

(Smith

39

inhibited 2.5 fold. This phenomenon was also found in a similar experiment with another
carcinogen, aﬂatoxin-Bl (Mayer et al., 1989). This is expected since these carcinogens
are too big to diffuse through the DNA/histone contact and can only access DNA from
outside of the nucleosomal structure. However, the relative pattern of distribution of
BPDE adducts in DNA that is wrapped around the nucleosome is similar to that on free
DNA, suggesting that after intercalation of BPDE, formation of the covalent bound BPDE
adduct may be controlled by local DNA structure, unaffected by nucleosomal structures
(Smith and MacLeod, 1993).

Another carcinogen, ultraviolet light (UV) is in a ﬁxed direction from a ﬁxed source,
differing from chemical carcinogens that diffuse freely in the solution to bind DNA. Thus
in a nucleosome structure where DNA is wrapped around histones, nucleotides on the
outer side of the DNA double helix should have a shielding effect on the nucleotides in
direct contact with the histone octamer. This will result in a highly modulated UV
photoproduct (primarily CPDs and (6-4)s) distribution, with an average periodicity of
about 10 bases, as shown on puriﬁed nucleosome core particles (Brown et al., 1993).
What happens in human cells remains to be studied. Pfeifer et al. (1992) determined the
distribution of CPDs in the promoter region of the PGKI gene at the nucleotide level, and
found several CPD hot spots where a transcription factor binds, suggesting that binding
of transcription factors changes the dynamic structure of the local DNA, and enhances the

UV photoproduct formation.

2. Effects
In hum
expectedt
would in}
different
Groudine
actively 1
defined t
half mor
CXpected
adducts .
DHFR g
that the
beCause

4o

2. Effects of protein-DNA interaction on DNA repair

In human cells, DNA repair is carried out by various enzyme complexes. It might be
expected that protein interaction with DNA would inhibit DNA repair, since such proteins
would inhibit the access of the enzymes to the DNA. This was evidenced in the fact that
different regions of the genome have different sensitivity to DNase I (Weintraub and
Groudine, 1976). In 1985, Bohr et al. showed that in Chinese hamster ovary cells, an
actively transcribed DHFR gene was repaired faster than the genome overall, and they
deﬁned this phenomenon as preferential repair. Since actively transcribed genes usually
have more open chromatin structures, as shown by their sensitivity to DNaseI, it is to be
expected that the DNA repair complex can gain easy access to the DNA, and DNA
adducts will be repaired faster. In 1986, Mellon et al. showed that in human cells the
DHFR gene was also repaired faster than the genome overall. In addition, they showed
that the preferential repair was largely due to the fast repair of the transcribed strand
because of transcription-coupled repair, suggesting that the contribution of the open
chromatin structures to preferential repair of active genes is very limited (Mellon et al.,
1987; Mellon and Hanawalt, 1989).

However, later studies on DNA repair of speciﬁc genes in human cells have shown that
preferential repair can not be attributed solely to transcription-coupled repair. Comparison
of the rate of DNA repair on the nontranscribed strand of various actively-transcribed
genes in human cells and on the nontranscribed regions indicates that DNA adducts on
the nontranscribed strand of active genes usually are removed faster than those on the

nontranscribed regions, and that different nontranscribed regions are repaired at different

41

rates. BPDE adducts on the nontranscribed strand of the HPRT gene have been shown
to be repaired faster than the genome overall (Chen et al., 1992). CPDs on the
nontranscribed strand of the DHFR gene are also repaired faster than genome overall
(Evans et al., 1993). BPDE adducts and CPDs on a nonexpressed loci, 754, are repaired
much more slowly than the genome overall (Chen et al., 1992; Evans et al., 1993). DNA
adducts on the nontranscribed strand rarely interfere with transcription, and transcription-
coupled repair is believed not to be involved in the repair of DNA adducts located on the
nontranscribed strand (Bohr, 1991). Thus, these data strongly suggest that chromatin
structure plays an important role in determining the rate of repair. A recent study by
Bohr and colleagues (Kruk et al., 1995) showed that CPDs in telomeres of human cells
are repaired faster than those in the nontranscribed non-coding 754 locus, but more slowly
than those in the nontranscribed S-globin gene, suggesting that different chromatin
structures may exist in various nontranscribed regions and affect the accessibility of DNA
repair enzymes differently. The effect of protein interactions was also shown at the
nucleotide level. Gao et al. (1994) showed that CPDs at the transcription factors' binding
sites were removed at a slower rate than the average in the PGKI gene promoter region,
suggesting that binding of transcription factors inhibits the access of DNA repair
machinery and thus slows down DNA repair.

Although DNA/protein interactions may inhibit the access of DNA repair machinery
and DNaseI in a similar way, the actions of the two are different. DNaseI directly binds
DNA and makes incisions, resulting in an incision pattern with a periodicity of about 10

bp on nucleosomal DNA wrapped around histone octamers (Pfeifer and Riggs, 1991). It

42

has been shown that rates of excision repair vary signiﬁcantly at the nucleotide level,
however, this variation does not have a periodicity correlated to the nucleosomal structure
(Tornaletti and Pfeifer, I994; Gao et al., 1994). F urtherrnore, this site-speciﬁc repair also
occurs on DNA which is nucleosome—free (Wei et al., 1995a; 1995b). This suggests that,
consistent with what is known from other studies, DNA repair complexes act in a

different and more complex fashion than the direct action of DNaseI.

LIST OF REFERENCES

LIST OF REFERENCES

Aboussekhra, A., Biggerstaff, M., Shivji, M.K.K., Vilpo, J.., Moncolin, V., Podust, V.N.,
Protic, M, Hubscher, U., Egly, J.-M.& Wood, RD. 1995. Mammalian DNA nucleotide
excision repair reconstituted with puriﬁed protein components. Cell, 80:859-868.

Ames, B.N. I989. Endogenous DNA damage as related to cancer and aging. Mutat. Res.,
214:41-46.

Au, K.G., Welsh, K.& Modrich, P. 1992. Initiation of methyl-directed mismatch repair.
J. Biol. Chem, 267:12142-12148.

Bailly, V., Sung, P., Prakash, L. & Prakash, S. 1991. DNA RNA helicase activity of
RAD3 protein of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA, 88:9712-9716.

Bailly, V., Sommers, C.H., Sung, P., Prakash, L. & Prakash, S. 1992. Speciﬁc complex
formation between proteins encoded by the yeast DNA repair and recombination genes
RADI and RADIO. Prac. Natl. Acad. Sci. USA, 89:8273-8277.

Bardwell, A.J., Bardwell, L., Tomkinson, A.E. & F riedberg, EC. 1994. Speciﬁc cleavage
of model recombination and repair intermediates by the yeast RADl-RADIO DNA
endonuclease. Science, 265:2082-2085.

Barnes, D.E., Tomkinson, A.E., Lehmann, A.R., Webster, A.D.B.& Lindahl, T. 1992.
Mutations in the DNA ligase I gene of an individual with immunodeﬁciencies and cellular
hypersensitivity to DNA-damaging agents. Cell, 69:495-503.

Biggerstaff, M., Szymkowski, D.E. & Wood, RD. 1993. Co-correction of the ERCC],
ERCC4 and xeroderma pigmentosum group F DNA repair defects in vitro. EMBO J.,
12:3685-3692.

Bohr, V.A.l991. Gene-speciﬁc DNA repair. Carcinogenesis, 12:1983-1992.

Bohr, V.A., Smith, C.A., Okumoto, D.S. & Hanawalt, RC. 1985. DNA repair in an active
gene: removal of pyrimidine dimers from the DHFR gene of CHO cells is much more
efﬁcient than in the genome overall. Cell, 40:359-369.

Brash, D.E., Seetharam, S., Kraemer, K.H., Seidman, M.M. & Bredberg, A. 1987.

43

44

Photoproduct frequency is not the major determinant of UV base substitution hot spots
or cold spots in human cells. Prac. Natl. Acad. Sci. USA, 84:82-86.

Bronner, C.E., Morrison, P.T., Warren, G., Smith, L.G., Lescoe, M.K., Kane, M.,
Earobino, C., Lipford, J., Lindblom, A. Et al. 1994. Mutation in the DNA mismatch
repair gene homologue hMLHI is associated with hereditary non-polyposis colon cancer.
Nature, 368:258-261.

Brown, D.W., Libertini, L.J., Suquet, C., Small, E.W. & Smerdon, M.J. 1993. Unfolding
of nucleosome cores dramatically changes the distribution of ultraviolet photoproducts in
DNA. Biochemistry, 32:10527-10531.

Buratowski, S., Hahn, S., Guarente, L. & Sharp, PA. 1989. Five intermediate complexes
in transcription initiation by RNA polymerase II. Cell, 56:544-550.

Buratowski, S. 1993. DNA repair and transcription: the helicase connection. Science,
260:37-38.

Busch, D., Greiner, G, Lewis, K., Ford, R., Adair, G. & Thompson, L. 1989. Summary
of complementation groups of UV-sensitive CHO cell mutants isolated by large scale
screening. Mutagenesis, 4:349-354.

Cairns, J. 1981. The origin of human cancers. Nature, 289:353-357.

Chen, R.-H., Maher, V.M., Brouer, J., van de Putte, P. & McCormick, J.J. 1992.
Preferential repair and strand speciﬁc repair of benzo(a)pyrene diol epoxide adducts in
the HPRT gene of diploid human ﬁbroblasts. Prac. Natl. Acad. Sci. USA, 89:5413-5417.

Chu, G. & Chang, E. 1988.Xeroderrna pigmentosum group B cells lack a nuclear factor
that binds to damaged DNA. Science, 242:564-567.

Cleaver, J.E. 1968. Defective repair replication of DNA in xeroderma pigmentosum.
Nature, 218:652-656.

Cleaver, J .E. 1969. Xeroderma pigmentosum: a human disease in which an initial stage
of DNA repair is defective. Proc. Natl. Acad. Sci. USA, 63:428-435.

Cleaver, J .E. 1990. Do we know the cause of xeroderma pigmentosum? Carcinogenesis,
11:875-882.

Cleaver, J .E. & Kraemer, K.H. 1989. in Xeroderma pigmentosum of The Metabolic Basic
of Inherited Disease, eds, Soviver, C.R., Beaudet, A.L., Sly, W.S.& Valle, D.(McGraw-
Hill, New York) Vol.II, 2949-2971.

45

Coverly, D., Kenny, M.K., Munn, M., Rupp, W.D., Lane, D.P. & Wood, RD. 1991.
Requirement for the replication protein SSB in human DNA excision repair. Nature,
349:538-541.

Cox, B. & Game, J. 1974. Repair systems in Saccharomyces. Mutat. Res., 26:257-264.

Donahue, B.A., Yin, S., Taylor, J.S., Reines, D.& Hanawalt, RC. 1994. Transcript
cleavage by RNA polymerase 11 arrested by a cyclobutane pyrimidine dimer in the DNA
template. Prac. Natl. Acad. Sci. USA, 91:8502-8506.

Drapkin, R., Reardon, J.T., Ansari, A., Huang, J.-C., Zawel, L., Ahn, K., Sancar, A. &
Reinberg, D. 1994. Dual role of TFIIH in DNA excision repair and in transcription by
RNA polymerase II. Nature, 368:769-772.

Ephrussi, A., Church, G.M., Tonegawa, S. & Gilbert, W. 1985. B lineage speciﬁc
interactions of an irnmunoglobins enhancer with cellular factors in vivo. Science, 227: 134-

140.

Evans, M.K., Taffer, B.G., Hanis, C.C. & Bohr, V.A. 1993.DNA strand bias in the repair
of the p53 gene in normal human and xeroderma pigmentosum group C ﬁbroblasts.
Cancer Res., 53:5377-5381.

Fairman, M.P. & Stillman, B. 1988. Cellular factors required for multiple stages of SV40
DNA replication in vitro. EMBO J., 7:1211-1218.

Feaver, W.J., Svejstrup, J .Q., Bardwell, L., Bardwell, A.J., Buratowski, S., Gulyas, K.D.,
Donahue, T.F., Friedberg, E.C., Kornberg, RD. 1993. Dual roles of a multiprotein
complex from S. Cerevisiae in transcription and DNA repair. Cell, 75:1379-1387.

Fishel, R., Lescoe, M.C., Rao, M.R., Copeland, N.G., Jenkins, N.A., Garber, J., Kane,
M., Kolodner, R. Et el. 1993. The human mutation gene homologue MSH2 and its
association with hereditary nonpolyposis colon cancer. Cell, 75:1027-1037.

F lejter, W.L., McDoniel, L.D., Johns, D., Friedberg, E.C.& Schultz, RA. 1992. Correction
of xeroderma pigmentosum complementation group D mutant cell phenotypes by
chromosome and gene transfer: Involvement of the human ERCCZ DNA repair gene.

Prac. Natl. Acad. Sci. USA, 89:261-265.

F omace, A.J., Kohn, K.W.& Kann, HE. 1976. DNA single strand breaks during repair
of UV damage in human ﬁbroblasts and abnormalities of repair in xeroderma
pigmentosum. Proc. Natl. Acad. Sci. USA, 73:39-43.

Gao, S., Drouin, R. & Holmquist, G.P. 1994. DNA repair rates mapped along the human
PGKI gene at nucleotide resolution. Science, 263:1438-1440.

46

Garrity, P.A. & Wold, B.J. 1992. Effects of different DNA polymerase in ligation-
mediated PCR: Enhanced genomic sequencing and in vivo footprinting. Prac. Natl. Acad.
Sci. USA, 89:1021-1025.

Gietz, R.D.& Prakash, S. 1988.Cloning and nucleotide sequence analysis of the
Saccharomyces cerevisiae RAD4 gene required for excision repair of UV-darnaged DNA.
Gene, 74:535-541.

Grilley, M., Welsh, K.M., Su, S.-S.& Modrich, P. 1989. Isolation and characterization of
the Escherichia coli mutL gene product. J. Biol. Chem, 264:1000-1004.

Grielley, M., Griggith, J. & Modrich, P. 1993. Bidirectional excision in methyl-directed
mismatch repair. J. Biol. Chem, 268:11830-11837.

Grossman, L. & Thiagalingam. 1993. Nucleotide excision repair: a tracking mechanism
in search of damage. J. Biol. Chem, 268:16871-16874.

Guzder, S.N., Qiu, H., Sommers, C.H., Sung, P., Prakash & Prakash. 1994a DNA repair
gene RAD3 of S. Cerevisiae is essential for transcription by RNA polymerase II. Nature,
367 :91-94.

Guzder, S.N., Sung, P., Baily, V., Prakash, L. & Prakash, S. 1994b. RAD25 is a DNA
helicase required for DNA repair and RNA polymerase II transcription. Nature, 369:578-
581.

Guzzetta, F. 1972. Cockayne-Neil-Dingwall syndrome. In Handbook of clinical neurology,
eds, Vinken, P.J. & Bruyn, G.W. (North Holland, Amsterdam) vol 13, 431-440.

Habraken, Y., Sung, P., Prakash, L. & Prakash, S. 1993. Yeast excision repair gene RAD2
encodes a single-stranded DNA endonuclease. Nature, 366:365-368.

Hanawalt, RC. 1994. Transcription-coupled repair and human disease. Science, 266: 1957-
1958.

Harrington, J.J. & Lieber, M.R.C. 1994. Function domains within FEN-l and RAD2
deﬁne a family of structure-speciﬁc endonuclease: Implication for nucleotide excision
repair. EMBO J., 8:1344-1355.

Haseltine, W.A., Gordon, L.K., Lindan, C.P., Grafstrom, R.H., Shaper, L.N. & Grossman,
L. 1980. Cleavage of pyrimidine dimers in speciﬁc DNA sequences by a pyrimidine
dimer DNA glycosylase of M. Leteus. Nature , 285:634-641.

He, 2., Henricksen, L.A., Wold, M.S.& Ingles, C.J. 1995. RPA involvement in the
damage-recognition and incision steps of nucleotide excision repair. Nature, 374:566-569.

47

Heﬂich, R.H., Hazard, R.M., Lommel, L., Scribner, J .D., Maher, V.M.& McCormick, J.J.
1980.A comparison of the DNA binding, cytotoxity and repair synthesis induced in human
ﬁbroblasts by reactive derivatives of aromatic amide carcinogens. Chem. Biol. Interact,

29:43-56.

Higgins, D., Prakash, S., Reynolds, P., Polakowski, R., Weber, S. & Prakash, L. 1983.
Isolation and characterization of the RAD3 gene of Saccharomyces cerevisiae and
inviability of RAD3 deletion mutants. Proc. Natl. Acad. Sci. USA, 80:5680-5684.

Hoeijmakers, J.H.J. & Bootsma, D. 1994. Incisions for excisions. Nature, 371:654—655.

Huang, J.-C., Svoboda, D.L., Reardon, J.T. & Sancar, A. 1992. Human nucleotide
excision nuclease removes thymidine dimers from DNA by incsing the 22nd
phosphodiester bond 5' and the 6th phosphodiester bond 3' to the photodimer. Prac. Natl.
Acad Sci. USA, 89:3664-3668

Hwang, B.J. & Chu, G. 1993.Puriﬁcation and characterization of a human protein that
binds to damaged DNA. Biochemistry, 32:1657-1666.

Husain, J ., van Houton, B., Thomas, D., Abdel-Monem, M. & Sancar, A. 1985. Effect of
DNA polymerase I and DNA helicase II on the turn over rate of UvrABC excision
nuclease. Proc. Natl. Acad. Sci. USA, 82:6774--6778.

Kantor, G.J., Barsalou, L.S. & Hanawalt, P.C. 1990.Selective repair of speciﬁc chromatin
domains in UV-irradiated cells from xeroderma pigmentosum complementation group C.
Mutat. Res., 235:171-180.

Kara, K.J. & Glirncher, L.H. 1991. In vivo footprinting of MHC class 11 genes: Bare
promoters in the bare lymphocyte syndrome. Science, 252:709-712.

Keeney, 8., Chang, G.J. & Linn, S. 1993.Characterization of a human DNA damage
protein implicated in xeroderma pigmentosum E. J. Biol. Chem, 268:21293-21300.

Keeney, S., Exer, A.P.M., Brody, T., Vermeulen, W., Bootsma, D., Hoeijmakers, J.H.J.
& Linn, S. 1994. Correction of the DNA repair defect in xeroderma pigmentosum group
E by injection of a DNA damage-binding protein. Proc. Natl. Acad. Sci. USA, 91:4053-
4056.

Kim, C., Snyder, R.D.& Wold, MS. 1992. Binding properties of replication protein-A
from human and yeast cells. Mol. Cell. Biol, 12:3050-3059.

Kraemer, K.H. 1980. Xeroderrna pigmentosum. In Clinical Dermatology, eds, Demis,
D.J., Dobson, R.L. and McGuine, J. (Harper and Row, Hagerstown), 4:1-33.

48

Kruk, P.A., Rarnpino, N.J. & Bohr, VA. 1995. DNA damage and repair in telomeres.
Relation to aging. Prac. Natl. Acad. Sci. USA, 92:258-262.

Kunala, S. & Brash, DE. 1992. Excision repair at individual bases of the Escherichia coli
lac] gene: relation to mutation hot spots and transcription coupling activity. Prac. Natl.
Acad. Sci. USA, 89:11031-11035.

Leach, F.S., Nicolaides, N.C., Paradopoulos, N., Lin, B., Jen, J., Parsons, R., Peitomaki,
P., Sistonen, P., Aaltonex, L.A., et al. 1993. Mutations of a mutS homolog in hereditary
nonpolyposis colorectal cancer. Cell, 75:1215-1223.

Lehmann, A.R., Arlett, C.F., Broughton, B.C., Harcourt, S.A., Steingrims-dottir, H.,
Stefanini, M., Taylor, A.M.R., Natarajan, A.T., Green, S., King, M.D., MacKie, R.M.,
Stephenson, J.B.P. & Tohure, J.L. 1988. Trichothiodystrophy, a human DNA repair
disorder with heterogeneity in the cellular response to ultraviolet light. Cancer Res.,
48:6090-6096.

Legerski, R.& Peterson, C. 1992. Expression cloning of a human DNA repair gene
involved in xeroderma pigmentosum group C. Nature, 359:70-73.

Li, R., Waga, S., Harmon, G.J., Beach, D. & Stillman, B. 1994. Differential effects by the
p21 CDK inhibitor on PCNA CDK inhibitor on PCNA-dependent DNA replication and
repair. Nature, 371:534-537.

Lin, J.-J. & Sancar, A. 1992. (A)BC excinuclease: the E. coli nucleotide excision repair
enzyme. Mal. Microbial, 6:2219-2224.

Lindahl, T., Sedgwick, B., Sekiguchi, M. & Nakabeppu, Y. 1988. Regulation and
expression of the adaptive response to alkylating agents. Annu. Rev. Biochem, 57:133-
157.

Lohman, T.M. 1992. Escherichia coli DNA helicases: mechanisms of DNA unwinding.
Mol. Microbiol, 6:5-18.

Maclnnes, M.A.& Mudgett, J.S. 1990.Cloning of the functional human excision repair
gene ERCC-5zPotential gene regulatory features conserved with other human repair genes.
Prog. Clin. Biol. Res., 340:265-274.

MacLeod, M.C. & Zachary, K. 1985.Catalysis of carcinogen-detoxiﬁcation by DNA:
Comparison of enantiomeric diol epoxides. Chem. Biol. Interact., 54:45-55.

Markowitz, S., Wang, J., Mijeoff, L., Parsons, R., Sun, L., Lutterbaugh, J., Pan, R.S.,
Zborowska, E., Kinzler, K.W., Volgestein, B., Brattain, M. & Wilson, J.K.V. 1995.
Inactivation of the Type II TGF-B receptor in colon cancer cells with microsatellite

49
instability. Science, 268: 133 6-13 3 8.

Matsutani, C., Sugasawa, K., Yanagisawa, J., Sonoyma, T., Ui, M., van der Spek, D.J.,
Bootsma, D., Hoeijmakers, J.H.J. & Hanaoka, F. 1994. Puriﬁcation and cloning of a
nucleotide excision repair complex involving the xeroderma pigmentosum group C protein
and a human homologue of yeast RAD23. EMBO J., 13:1831-1843.

Maxam, A.M.& Gilbert, W. 1980. Sequencing end-labeled DNA with base-speciﬁc
chemical cleavages. Methods Enzymal., 65:499-560

Mazur, S.J. & Grossman, L. 1991.Dimerization of Escherichia cali UvrA and its binding
to undamaged and ultraviolet damaged DNA. Biochemistry, 30:4432-4443.

McCormick, J.J. & Maher, V.M. 1983. Role of DNA lesions and DNA repair in
mutagenesis and transformation of human cells, in Human carcinogensis (Academic Press,
Inc.), chapter 16, 401-429.

Meehan, T. & Straub, K. 1979.Double-stranded DNA selectively binds benzo(a)pyrene
diol epoxide. Nature, 277:410-412.

Melandy, T. & Stillman, B. 1992. In Nucleic Acids and Molecular Biologl, eds, Eckstein,
F. & Lilly, D.M.J. (Spinger, Berlin and Heidelberg) vol.6, 129-158.

Mellon, I. & Hanawalt, RC. 1989. Induction of the Escherichia cali lactase operon
selectively increases repair of its transcribed DNA strand. Nature, 342:95-98.

Mellon, I., Bohr, V.A., Smith, C.A.& Hanawalt, RC. 1986. Preferential DNA repair of
an active gene in human cells. Prac. Natl. Acad. Sci. USA, 83:8878-8882.

Mellon, I., Spivak, G.& Hanawalt, RC. 1987. Selective removal of transcription-blocking
DNA damage from the transcribed strand of the mammalian DHFR gene. Cell, 51:241-
249.

Meselson, M. 1988. in Recombination of the genetic material, ed., K. B. Low (Academic
Press, San Diego), pp. 91-113.

Mitchell, D.L., Hmnphrey, R.M., Adair, G.M., Thompson, L.H. & Clarkson, J.M. 1988.
Repair of (6-4) photoproducts correlates with split-dose recovery in UV-irradiated normal
and hypersensitive rodent cells. Mutat. Res., 193:53-63.

Miura, N., Miyamoto, I., Asuhina, H., Satokata, 1., Tanaka, K. & Okada, Y. 1991.
Identiﬁcation and characterization of XPAC protein: the gene product of the human XPAC
(xeroderma pigmentosum group A complementing) gene. J. Biol. Chem, 266:19786-
19789.

50
Modrich, P. 1994. Mismatch repair, genetic stability, and cancer. Science, 266:1959-1960.

Moore, S.P., Erdile, L., Kelley, T. & Fishel, R. 1991. The human homologous pairing
protein HPP-l is speciﬁcally stimulated by the cognate single-stranded binding protein
hRP-A. Proc. Natl. Acad. Sci. USA, 88:9067-9071.

Mori, T., Matsunaga, T., Hirose, T.& Nikaido, O. 1988. Establishment of a monoclonal
antibody recognizing ultraviolet light induced (6-4) photoproducts. Mutat. Res., 194:263-
270.

Moyer, R., Marien, K., van Holde, X. & Bailey, G. 1989. Site speciﬁc aﬂatoxin B1
adduction of sequence positional nucleosome core particles. J. Biol. Chem, 264:12226-
12231.

Naegeli, H., Bardwell, L. & Friedberg, EC. 1992. The DNA helicase and adenosine
triphosphatase activities of yeast RAD3 protein are inhibited by DNA damage. A potential
mechanism for damage-speciﬁc recognition. J. Biol. Chem, 267 :392-398.

Naegeli, H., Bardwell, L. & Friedberg, EC. 1993. Inhibition of RAD3 DNA helicase
activity by DNA adducts and abasic sites: Implication for the role of a DNA helicase in
damage-speciﬁc incision of DNA. Biochemistry, 32:613-621.

Nakagawa, M., Nakatsuru, Y. & Ishikawa, T. 1989. Immunohistochemical detection of
carcinogen-DNA adducts and DNA repair in mouse skin. J. Invest. Dermatol, 92:2755-
2795

Nakai, S. & Matsumoto, S. 1967. Two types of radiation-sensitive mutants in yeast.
Mutat. Res., 4:129-136.

Naurnovski, L.& Friedberg, EC. 1994. A DNA repair gene required for the incision of
damaged DNA is essential for viability in Saccharomyces cerevisiae. Prac. Natl. Acacl
Sci. USA , 80:4818-4821.

Nicolaides, N.C., Papadopoulas, N., Lin, B., Wei, X.F., Carter, K.C., Ruber, S.M., Rosen,
C.A., Haseltine, W.A., Fleischmann, R.D.& Fraser, CM. 1994. Mutations of two PMS
homologous in heretidary nonpolyposis colon cancer. Nature, 371:75-79.

O’Donovan, A.,& Wood, RD. 1993. Identical defects in DNA repair in xeroderma
pigmentosum group G and rodent ERCC group 5. Nature, 363:185-188.

O’Donovan, A., Davies, A.A., Moggs, J.G., West, S.C.& Wood, R.D. 1994a. XPG
endonuclease makes the 3' incision in human DNA nucleotide excision repair. Nature,
371:432-435.

51

O’Donovan, A., Scherly, D., Clarkson, S.G. & Wood, R.D. 1994b. Isolation of active
recombinant XPG protein, a human DNA repair endonuclease. J. Biol. Chem,
269:15965-15968.

Orren, D.K. & Sancar, A. 1989. The (A)BC excinuclease of Escherichia cali has only the
UvrB and UvrC subunits in the incision complex. Prac. Natl. Acad. Sci. USA, 86:5237-
5241.

Orren, D.K., Selby, C.P., Hearst, J .E. & Sancar, A. 1992. Post-incision steps of nucleotide
excision repair in Escherichia cali. J. Biol. Chem, 267:780-788.

Papadopoulas, N., Nicolaides, N.C., Wei, Y.F., Ruben, S.M., Carter, K.C., Haseltine,
W.A., F Ieischmann, R.D., Fraser, C.M., Adams, M.D., et al. 1994. Mutation of a mutL
homologue in hereditary colon cancer. Science, 263:1625-1628.

Park, E., Guzder, S.N., Koxen, M.H., Jaspers-Dekker, I. & Weeda, G. 1992. RAD25
(SSLZ), the yeast homolog of the human xeroderma pigmentosum group B DNA repair
gene, is essential for viability. Proc. Natl. Acad. Sci. USA, 89:11416-11420.

Parsons, R., Li, G.M., Longley, M.J., Fang, W.H., Papadopoulos, N., Jen, J., de la
Chapelle, A., Kinzler, K.W., Vogelstein, B. & Podrich, P. 1993. Hypermutability and
mismatch repair deﬁency in RER+ tumor cells. Cell, 75:1227-1235.

Pathak, M.A., Zarebska, Z., Mihm, M.C. Jr, Jarzabek, C.M., Chorzelski, T.& Jablonska,
S. 1986. Detection of DNA psoralen photoadducts in mammalian skin. J. Invest.
Dermatol, 862308-315

Pfeifer, G.P.l992. Analysis of chromatin structure by ligation mediated PCR. PCR method
and appl, 2:107-111.

Pfeifer, G.P. & Riggs, AD. 1991. Chromatin differences between active and inactive X
chromosome revealed by genomic footprinting of perrneabilized cells using DNaseI and
ligation-mediated PCR. Genes & Dev., 5:1102-1113.

Pfeifer, G.P., Drouin, R., Riggs, A.D.& Holmquist, G.P. 1992. Binding of transcription
factors creats hot spots for UV photoproducts in vivo. Mol. Cell. Biol, 12:1798-1804.

Podust, V.N., Georgaki, A., Strack, B. & Hubscher, U. 1992.Calf thymus RF-C as an
essential component for DNA polymerase delta and epsilon holoenzymes function.
Nucleic Acids Res., 20:4159-4165.

Ponti, M., Farrow, S.M., Souhani, H.L., D’Incalci, M. & Hartley, J .A. 1991. Measurement
of the sequence speciﬁcity of covalent DNA modiﬁcation by antineoplastic agents using
Taq DNA polymerase. Nucleic Acids Res., 19:2929-2934.

52

Prakash, S., Sung, P. & Prakash, L. 1993. DNA repair genes and proteins of
Saccharomyces cerevisiae. Annu. Rev. Genet., 27:53-70.

Reynolds, R.J. & Friedberg, EC. 1981. Molecular mechanisms of pyrimidine dimer
excision in Saccharomyces cerevisiae: incision of ultraviolet-irradiated deoxyribonucleic
acid in vivo. J. Bacteriol, 146:692-704.

Rill, R.L.& Marsh, GA. 1990. Sequence preference of covalent DNA binding by anti(+)-
and anti(-)-benzo(a)pyrene diol epoxide. Biochemistry, 29:6050-6058.

Robins, P., Johes, C.J., Biggerstaff, M., Lindahl, T. & Wood, RD. 1989.
Complementation of DNA repair in xeroderma pigmentosum group A cell extracts by
a protein with afﬁnity for damaged DNA. EMBO J., 10:3913-3921.

Roth, M., Multer, H.& Boyle, J .M. 1987. Immunochemical determination of an initial step
in thymine dimer excision repair in xeroderma pigmentosum variant ﬁbroblasts and
biopsy material from the normal population and patients with basal cell carcinoma and
melanoma. Carcinogenesis, 8: 1 3 O l -1 3 07.

Sancar, A. & Rupp, W.D. 1983.A novel repair enzyme: UVRABC excision nuclease of
Escherichia cali cuts a DNA strand on both sides of the damaged region. Cell, 33:249-
260.

Sancar, A. & Sancar, GR. 1988. DNA repair enzymes. Annu. Rev. Biochem, 57:29-67.

Sancar, A. & Tang, M.-S. 1993. Nucleotide excision repair. Phatachem. Phatabia.,
57:905-921.

Sancar, GB. 1990. DNA photolyaseszphysical properties, action mechanisms, and roles
in dark repair. Mutat. Res., 236:147-160.

Schaaper, R.M., Dunn, R.L. & Glickman, B.W. I987.Mechanisms of ultraviolet-induced
mutation. Mutation spectra in the Escherichia coli lacI gene for a wild type and an
excision-repair-deﬁcient strain. J. Mol. Biol, 198:187-202.

Schaeffer, L., Roy, R., Humbert, S., Moncollin, V., Vermeulen, W. Hoeijmakers, J.H.J.,
Charnbon, P. & Egly, J .M. 1993. DNA repair helicase: a component of BTF2(TFIIH)
basic transcription factor. Science, 260:58-63.

Scherly, D., Nouspikel, T., Corlet, J., Ucla, C., Bairoch, A.& Clarkson, SC. 1993.
Complementation of the DNA repair defect in xeroderma pigmentosum group G cells by
a human cDNA related to yeast RAD2. Nature, 363:182-185.

Seeberg, E. & Steinum, A. 1982. Puriﬁcation and properties of the UvrA protein from E.

53
cali. Prac. Natl. Acad. Sci. USA, 79:988-992.

Selby, C.P. & Sancar, A. 1990. Transcription preferentially inhibits nucleotide excise
repair of the template strand in vitro. J. Biol. Chem, 265:21330-21336.

Selby, C.P. & Sancar, A. 1991. Gene and strand-speciﬁc repair in vitro: partial
puriﬁcation of a transcription-repair coupling factor. Proc. Natl. Acad. Sci. USA, 88:8232-
8236.

Selby, C.P. & Sancar, A. 1993. Molecular mechanism of transcription-repair coupling.
Science, 260:53-58.

Seroussi, E. & Lavi, S. 1993. Replication protein A is the major single-stranded-DNA
binding protein detected in mammalian cell extracts by gel retardation assays and UV
cross-linking of long and short single-stranded DNA molecules. J. Biol. Chem, 268:7147-
7154.

Shiomi, T., Harada, Y., Saito, T., Shiomi, N., Okuno, Y.& Yamaizumi, M. 1994. An
ERCC5 gene with homology to yeast RAD2 is involved in group G xeroderma
pigmentosum. Mutat. Res., 314:167-175.

Shivji, M.K.K., Kenney, M.K. & Wood, RD. 1992. Proliferating cell nuclear antigen is
required for DNA excision repair. Cell, 69:367-374.

Smith, B.L. & MacLeod, MC. 1993. Covalent binding of the carcinogen benzo(a)pyrene
diol epoxide to Xenopus laevis 58 DNA reconstituted into nucleosomes. .1. Biol. Chem,
268:20620—20629.

Strauss, B., Rabkin, S., Sagher, D. & Moore, P. 1982. The role of DNA polymerase in
base substitution mutagenesis on noninstructional templates. Biochimie, 64:829-838.

Sugano, T., Uchida, T. & Yamazumi, M. 1991. Identiﬁcation of a speciﬁc protein
defective in group A xeroderma pigmentosum cells. J. Biochem (Tokyo), 110:667-674

Sung, P., Prakash, L., Matson, S.W.& Prakash, S. 1987. RAD3 protein of Saccharomyces
cerevisiae is a DNA helicase. Prac. Natl. Acad. Sci. USA, 84:8951-8955.

Sung, P., Higgins, D., Prakash, L. & Prakash, S. 1988. Mutation of lysine-48 to arginine
in the yeast RAD3 protein abolishes its ATPase and DNA helicase activities but not the
ability to bind ATP. EMBO J., 7:3263-3269.

Sung, P., Reynolds, P., Prakash, L. & Prakash, S. 1993a.Puriﬁcation and characterization
of the Saccharomyces cerevisiae RAD1/RADIO endonuclease. J. Biol. Chem, 266:26391-

26399.

54

Sung, P., Bailly, V., Weber, C., Thompson, L.H., Prakash, L. & Prakash, S. l993b.Human
xeroderma pigmentosum group D gene encodes a DNA helicase. Nature, 365:852-855.

Svejstrup, J.Q., Wang, Z., Feaver, W.J., Wu, X., Bushnell, D.A., Donahue, T.F.,
Friedberg, E.C. & Korberg, RD. 1995. Different forms of TFIIH for transcription and
DNA repair: Holo-TFIIH and a nucleotide excision repairsome. Cell, 82:21-28.

Tanaka, K., Hayakawa, H., Sekiguchi, M. & Okada, Y. 1977. Speciﬁcation of T4
endonuclease V on damaged DNA in xeroderma pigmentosum cells in vivo. Prac. Natl.
Acad. Sci. USA, 74:2958-2962.

Tanaka, K., Kawai, K., Kumahara, Y., Ikenega, M. & Okada, Y. 1981. Genetic
complementation groups in Cockayne syndrome. Somatic Cell Genet, 7:445-462.

Tanaka, K., Satokata, I., Ogita, Z., Uchido, T. & Okada, Y. 1989. Molecular cloning of
a mouse DNA repair gene that complements the defect of group A xeroderma
pigmentosum. Proc. Natl. Acad. Sci. USA, 86:5512-5516.

Tanaka, K., Miura, N., Satokata, I, Miyamoto, I., Yoshida, M., Satoh, Y., Kondo, S.,
Yasui, A., Okayama, H. & Okada, Y. 1990. Analysis of a human DNA excision repair
gene involved in group A xeroderma pigmentosum and containing a zinc ﬁnger domain.
Nature, 348:73-76.

Thomas, D.C., Morton, A.G., Bohr, V.A. & Sancar, A. 1988. General method for
quantitating base adducts in speciﬁc mammalian genes. Proc. Natl. Acad. Sci. USA,
85:3723-3727.

Thompson, L.H., Busch, D.B., Brookman, K., Mooney, C.L. & Glaser, DA. 1981.
Genetic diversity of UV-sensitive DNA repair mutants of Chinese hamster ovary cells.
Proc. Natl. Acad. Sci. USA, 78:3734-3737.

Todo, T., Takemori, H., Ryo, H., Ihara, M., Matsunaga, T., Nikaido, O., Sato, K.&
Nomura, T. 1993. A new photoreactivating enzyme that speciﬁcally repairs ultraviolet
light-induced (6-4) photoproducts. Nature, 361:371-374.

Tornaletti, S. & Pfeifer, G.P. 1994. Slow repair of pyrimidine dimers at p53 mutation hot
spots in skin cancer. Science, 263:1436-1438.

Toschi, C. & Bravo, R. 1988. Changes in cyclin/proliferating cell nuclear antigen
distribution during DNA repair synthesis. J. Cell Biol, 107:1623-1628.

Troelstra, C., Odijk, H., de Wit, J., Westerveld, A., Thompson, L.H., Bootsma, D. &
Hoeijmakers, J .H.J . 1990. Molecular cloning of the human excision repair gene ERCC-6.
Mol. Cell. Biol, 10:5806-5813.

55

Troelstra, C., van Cool, A., de Wit, J., verrneuten, W., Bootsma, D. & Hoeijmakers, J .H.J .
1992. ERCC6, a member of a subfamily of putative helicase, is involved in Cockayne’s
syndrome and preferential repair of active genes. Cell, 71:939-953.

van Duin, M., de Wit, J., Odijk, H., Westerveld, A., Yasui, A., Koken, M.H.M.,
Hoeijmakers, J.H.J. & Bootsma, D. 1986. Molecular cloning and characterization of the

human excision repair gene ERCC-1: cDNA cloning and amino acid homology with the
yeast DNA repair gene RADIO. Cell, 44:913-923.

van Duin, M., Vredeveldt, G., mayne, L.V., Vermeulen, W., Klein, B., Weeda, G.,
Hoeijmakers, J.H.J. & Westveld, A. 1989. The cloned human DNA excision repair gene
ERCC-1 fails to correct xeroderma pigmentosum complementation groups A though I.
Mutat. Res., 217:83-92.

van Houten, B. 1990. Nucleotide excision repair in Escherichia coli. Microbial. Rev.,
54:18-51.

van Vuuren, A.J., Appeldoorn, E., Odijk, H., Yasui, A., Jaspers, N.G.J., Bootsma, D. &
Hoeijmakers, J .H.J . 1993. Evidence for a repair enzyme complex involving ERCCI and
complementing activities of ERCC4, ERCCII and xeroderma pigmentosum group F.
EMBO J., 12:3693-3701.

Venema, J., van Hoffen, A., Natarajon, A.T., van Zeeland, A.A.& Mullanders, L.H.F.
1990a. The residual repair capacity of xeroderma pigmentosum complementation group
C ﬁbroblasts is highly speciﬁc for transcriptionally active gene. Nucleic Acids Res.,
18:443-448.

Venema, J., Mullenders, L.H., Natarajan, A.F., van Zeeland, A.A. & Mayne, L.V. 1990b.
The genetic defect in Cockayne’s Syndrome is associated with a defect in repair of UV-
induced DNA damage in transcriptionally active DNA. Prac. Natl. Acad. Sci. USA,
87:4707-471 1.

Visse, R., de Ruijter, M., Moolenaar, G.P. & van de Putte, P. 1992. Analysis of UvrABC
endonuclease reaction intermediates on cisplatin-damaged DNA using mobility shift gel
electrophoresis. J. Biol. Chem, 267:6736-6742.

Volgestein, B. & Kinzler, K.W. 1992. p53 function and dysfunction. Cell, 70:523-526.

Wani, A.A. & D’Ambrosio, SM. 1987. Immunological quantitation of O‘-ethylthymidine
in alkylated DNA: repair of minor miscoding base in human cells. Carcinogenesis,
8:1137-1144.

Weber, C.A., Salazar, E.P., Stewart, S.A. & Thompson, L.H. 1988. Molecular cloning and
biological characterization of a human gene, ERCC-2, which corrects the nucleotide

56
excision repair defection in CHO UVS cells. Mol. Cell. Biol, 8:1137-1146.

Weeda, G., van Ham, R.C.A., Masurel, R., Westerveld, A., Odijk, H., de Wit, J.,
Bootsma, D., van der Eb, A.J. & Hoeijmakers, J.H.J. 1990a. Molecular cloning and
biological characterization of the human excision repair gene ERCC-3. Mol. Cell. Biol,
10:2570-2581.

Weeda, G., van Ham, R.C.A., Verrnulen, W., Bootsma, D., van der Eb, A.J.&
Hoeijmakers, J .H.J . 1990b. A presumed DNA helicase encoded by ERCC-3 is involved
in the human repair disorders xeroderma pigmentosum and Cockayne’s Syndrome. Cell,
62:777-791.

Wei, D., Maher, V.M. & McCormick, J.J. 1995(a). Site-speciﬁc rates of excision repair
of benzo(a)pyrene diol epoxide adducts in the hypoxanthine phosphoribosyltranscferase
gene of human ﬁbroblasts: Correlation with mutation spectra. Prac. Natl. Acad. Sci. USA,
92:2204-2208.

Wei, D., Maher, V.M. & McCormick, J.J. 1995(b) Effect of adduct conformation and
local DNA secondary structure on rates of repair of polycyclic adducts in human cells.
Manuscript submitted.

Weintraub, H. & Groudine, M. 1976.Chromosomal subunits in active genes have an
altered conformation. Science, 193:848-856.

Westerveld, A., Hoeijmakers, J.H.J., van Duin, M., de Wit, J., Odijk, H., Pastink, A.,
Wood, R.D. & Bootsma, D. 1984. Molecular cloning of a human DNA repair gene.
Nature, 310:425-428.

Wold, M.S. & Kelly, T.J. 1988. Puriﬁcation and charicterization of replication protein A,
a cellular protein required for in vitro replication of Simian virus 40 DNA. Proc. Natl.
Acad Sci. USA, 85:2523-2327.

Yang, L.L., Maher, V.M.& McCormick, J.J. 1980. Error free excision of the cytotoxic,
mutagenic Nz-deoxyguanosine DNA adducts formed in human ﬁbroblasts by (:)-7B,8a-
dihydroxy-9a,l0a-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene. Proc. Natl. Acad. Sci. USA,
77:5933-5937.

Yang, J.-L., Maher, V.M. & McCormick, J.J. 1988. Kinds and spectrum of mutations
induced by l-nitrosopyrene adducts during plasmid replication in human cells. Mol. Cell.
Biol, 8:3364-3372.

Zawel, L. & Reinberg, D. 1992. Advances in RNA polymerase II transcription. Curr.
Biol, 4:488-452.

CHAPTER II

Site speciﬁc rates of excision repair of benzo(a)pyrene diol epoxide adducts in the
hypoxanthine phosphoribosyltransferase gene of human ﬁbroblasts—Correlation with

mutation spectra

Dong Wei, Veronica M. Maher and J. Justin McCormick

Carcinogenesis Laboratory- Fee Hall
Department of Microbiology and Department of Biochemistry
The Cancer Center

Michigan State University, East Lansing, MI 48824

57

58
ABSTRACT

When synchronized populations of repair-proﬁcient diploid human ﬁbroblasts were
treated with (:)-7B,8a-dihydroxy-9a,10a-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene
(BPDE) in early S phase, just as the hypoxanthine phosphoribosyltransferase (HPRT)
gene was being replicated, 5% of the induced base substitutions were found at nucleotide
212 and 5% at 229 in exon 3. However, when the population was treated in early G1
phase to allow 12 or more hr for repair prior to the onset of S, 21% of the substitutions
were found at nucleotide 212 and 10% at 229. No such cell cycle-dependent difference
in distribution of base substitutions occurred in excision repair deﬁcient cells. To test
whether the increase in the relative frequency of mutations resulted from inefficient repair
at these sites, we adapted ligation mediated PCR to measure the rates of removal of
BPDE adducts from individual sites in exon 3 of the HPRT gene. Cells were treated with
0.5 uM BPDE in early G1 phase and harvested immediately or after being allowed 10,
20 and 30 hr for repair. DNA was analyzed for the original distribution of BPDE adducts
in the region of interest (the nontranscribed strand of exon 3) and those remaining after
repair. The sites of adduct formation were determined using Escherichia coli UvrABC
excinuclease to excise the adducts, and annealing a 5' biotinylated gene speciﬁc primer
to the DNA and extending it with Sequenase 2.0 to generate a blunt end at the site of
each cut. A linker was ligated to the blunt end, and the desired fragments were isolated
from the rest of the genomic DNA by use of magnetic beads and ampliﬁed by PCR and

analyzed on a sequencing gel. The distribution of fragments of particular lengths

59

indicated the relative number of BPDE adducts initially formed or remaining at speciﬁc
sites in the gene. The rates of repair at individual sites varied widely along exon 3 of the
HPRT gene and were very slow at nucleotides 212 and 229, strongly supporting the
hypothesis that inefﬁcient DNA repair plays an important role in the formation of

mutation hot spots.

60
INTRODUCTION

Previous studies in this laboratory on the relationship between DNA repair and
mutations induced by carcinogens in synchronized populations of diploid human
ﬁbroblasts show that the frequency of 6-thioguanine (6-TG) resistant mutants induced by
(i)-7[3,8a-dihydroxy-9a, 1 0a-epoxy-7,8,9, 1 0-tetrahydrobenzo(a)pyrene (BPDE) in
nucleotide excision repair proﬁcient cells is highest in cells treated in early S phase just
as the HPRT gene is being replicated, and much lower in cells treated in early G, phase
so that the cells will have 12 or more hr for repair before they begin DNA replication
(Yang et al., 1982; Watanabe et al., 1985; Chen et al., 1990). This is not true for cells
from a xeroderma pigmentosum (XP) complementation group A patient, which are
virtually incapable of nucleotide excision repair; the frequency of mutants induced in XP
cells treated in G, phase is the same as in cells treated in S phase (Yang et al., 1982;
Chen et al., 1991). Analysis of the kinds and locations of mutations induced by BPDE
in the HPRT gene of repair proﬁcient cells treated in early S phase and G, phase (Chen
et al., 1990) showed that the kinds of mutations did not differ signiﬁcantly, but there was
a signiﬁcant difference in the frequency of the mutations at speciﬁc sites (see Figure 1).
Of 20 base substitutions derived from cells treated in early S phase, just as the HPRT
gene was being replicated, only one was located at nucleotide 212 and one at 229 within
exon 3 of the HPRT gene. However, of 19 base substitutions from cells treated in G,
phase and allowed at least 12 hours for excision repair before DNA replication, four

(21%) were at nucleotide 212 and two (10%) were at 229. If repair occurs with the same

61

Fig.1: Number of mutants with a base substitution in the region of interest, i.e., the 184
nucleotide of the nontranscribed strand of exon 3 of the HPRT gene, observed in 19

mutants analyzed from cells treated at early G1 phase (ﬁlled bars), and 20 mutants

analyzed from cells treated at early S phase(blank bars).

I

 

 

62

 

 

 

 

Fig. 1

212

 

63

efﬁciency at each site, the relative frequency of mutations at each site should not change.
We hypothesize that the hot spots seen in the G, cells resulted from inefﬁcient repair of
BPDE adducts in those sites so that after excision repair has occurred for a certain period
of time, the adducts remaining in those sites represents a higher fraction than originally
present. The fact that no such increase in relative frequency of mutations at particular
sites was observed in a similar study using XP cells from complementation group A
supported this hypothesis (Chen et al., 1991).

Recently, Tornaletti and Pfeifer (1994) and Holmquist and colleagues (Gao et al.,
1994) showed that the rates of excision repair of cyclobutane pyrimidine dimer, induced
by UV”, irradiation, vary at the nucleotide level along the human p53 and PGKI gene,
respectively. Using ligation mediated PCR (LMPCR), Tornaletti and Pfeifer (1994) were
able to detect the relative change in the frequency of UV photoproducts at individual sites
and show that seven out of the eight mutation hot spots found by Brash and his
colleagues (Brash et al., 1991; Ziegler et al, 1993) in the p53 gene of basal cell and
squamous cell carcinomas, are sites where repair is slow. These investigators suggest that
this slow rate of repair plays an important role in the formation of the mutation hot spots
found in the tumors. Underlying this conclusion is the assumption that the rate of repair
in the epithelial cells in skin is similar to that seen in conﬂuent ﬁbroblasts in culture, and
that such cells have adequate time for repair after irradiation before the particular
mutations occur.

The present study was designed to determine whether inefﬁcient repair at particular

sites in the HPRT gene could explain the relative increase in frequency of mutations

64

observed in diploid human ﬁbroblasts in culture treated with BPDE in early G, phase
compared to the same cells treated just as the gene is being repaired. To do so, we
synchronized repair proﬁcient ﬁbroblasts, and treated them with BPDE in early G, phase
to allow adequate time for repair, harvested them immediately or after various times,
extracted the DNA and assayed it for the relative frequency of adducts in the region of
interest (the nontranscribed strand of exon 3 of the HPRT gene). Escherichia cali
UvrABC excinuclease was used to excise the BPDE adducts generating breaks in DNA
that leave terminal 5'-phosphate groups (Seeberg et al, 1983; van Houten et al, 1986;
Tand et a1, 1992; Sancar and Rupp, 1983). The relative number of cuts at particular sites
was detemrined using LMPCR. The decrease of the number of cuts occurring in DNA at
each speciﬁc site after BPDE- treated cells were allowed time for repair indicated the
rates of excision repair at that site during the period of repair.

Using this method, we were able to quantitate the rate of repair of BPDE adducts in
exon 3 of the HPR T gene at the nucleotide level. Our data indicated that the rate of
removal of adducts from various sites differ signiﬁcantly, and as predicted by the
mutation spectra data of Chen et al. (1990), the rates of repair at the two sites that
showed a relative increase in mutation frequency (cell cycle dependent hot spots) were

among the slowest.

65
MATERIALS AND METHODS

Cell Culture and Synchronization. Diploid human male ﬁbroblasts from neonatal
foreskin (McCormick and Maher, 1981), designated SL68, were cultured in Eagle's
medium containing 10% supplemented bovine calf serum (Hyclone, Logan, UT). Cells
were driven into the G0 state by density inhibition and mitogen deprivation (Chen et a1,
1990). To stimulate the cells to reenter the cell cycle, they were trypsinized and plated
at 1.7 x 10" cells/cm2 in fresh medium.

BPDE Treatment and Post-Treatment Incubation. For the DNA repair study, the
cells in early G,, 5 hr after release from G,,, were rinsed twice with phosphate-buffered
saline and treated with 0.5 uM BPDE for 1 hr as described (Chen et al., 1990). Cells
were lysed immediately or incubated in fresh medium for the indicated time and then
lysed. To study the initial distribution of BPDE adducts formed in cells treated in early
S and in early G1 phase, two synchronized populations were treated simultaneously: one
17 hr after releasing from G0 and the other 5 hr after releasing from G,,. The two
populations were rinsed twice with phosphate-buffered saline, treated with 13 11M BPDE
for 1 hr as described (Chen et al., 1990) and lysed immediately.

Isolation and Puriﬁcation of DNA. Cells were washed with Tris-buffered saline and
lysed in buffer containing 10 mM Tris.HCl (pH 8.0), 0.5% SDS and 60 pig/ml RNase A
as described (Sambrook et al., 1989). After 1 hr incubation, proteinase K was added to
a ﬁnal concentration of 150 pig/ml, and the sample was incubated at 50°C for 3 hr before

being extracted with phenol/chloroform (1:1, vol/vol) using Phase Lock Gel tubes (5

66

Prime-3 prime, Inc., West Chester, PA). The DNA was precipitated with ethanol,
redissolved in 10 mM Tris (pH 8.0), 1 mM EDTA (TB 8.0), and was incubated overnight
with restriction enzymes BglI and SpeI (Boeringer Mannheim Biochemicals, Indianapolis,
IN) to decrease viscosity and with RNase A (10 ug/ml) to eliminate any trace amount of
contaminating RNA. The DNA was once again puriﬁed and the concentration was
measured using a spectrophotometer.

UvrABC Excision Reaction. The UvrA, UvrB and UvrC protein subunits were kindly
provided by Dr. Pieter van de Putte of Leiden University, Leiden, the Netherlands. DNA
(12 pg from cells treated with 0.5 uM BPDE and 6 1.1g from cells treated with 13 uM
BPDE) from cells that had been allowed various lengths of time to repair BPDE adducts
was used for analysis. UvrABC digestion was performed as described (Chen et al., 1992)
except that the buffer contains 100 mM NaCl, 1 mM ATP and no BSA. The reaction was
Stopped as described (Chen et al., 1992) and the samples were extracted with
Phenol/chloroform and puriﬁed with Centricon-3O microconcentrators (Amicon Inc.,
Beverly, MA). The puriﬁed DNA was precipitated with ethanol and redissolved in 11 [.11
H20.

Generating a Sequence Ladder. A genomic DNA fragment containing exon 3 of the
HPR T gene was amplified using a primer from intron 2
(CCTTATGAAACATGAGCGCAAAGG) and a primer from intron 3
(C TCACTGTAACCAAGTGAAATGAAA). The latter was designated gene speciﬁc

p Timer 2. The ampliﬁed fragment was puriﬁed with Centricon-3O tube, subjected to the

MaXanr-Gilbert sequencing method (Maxam and Gilbert, 1980), and ampliﬁed by

67
LMPCR as described below.

Extension of Primer and Linker Ligation. Extension and ligation were done
essentially as described (Mueller and Wold, 1989), except gene speciﬁc primer 2, used
as the ﬁrst primer, was biotinylated at the 5' end. The annealing temperature was adjusted
to 52°C. The linker consisted of a longer oligomer
(GTCTTATGTATGTATCTCGAATGCT) and a shorter oligomer (AGCATTCGAGAT).

Isolation of the Desired Fragments with Magnetic Beads. DNA was mixed with 75
pg Dynabeads M280-streptavidin (Dynal A/S, Oslo, Norway) and the desired fragments
were isolated using a magnet following the manufacturer's instructions.

Polymerase Chain Reaction. The puriﬁed DNA fragments were ampliﬁed in a mixture
containing 35 mM Tris.HCl (pH 8.55), 2.75 mM MgC12, 60 mM KCl, 16 mM NaCl, 0.2
m M dNTPs, 15 pmol each of gene specific primer 3
(GCAAGTATGGTTTGCAGAGATTC), which is 3' to primer 2, and the longer oligomer
0f the linker and 2.5 units of Taq DNA polymerase (Perkin Elmer Corp., Norwalk, CT)
in a total volume of 50 ill. The ampliﬁcation was performed by 22 cycles of denaturation
(94°C, 1 min), annealing (48°C, 1 min) and extension (72°C, 2 min). After the ﬁnal cycle,
one more unit of Taq polymerase was added and the sample was incubated for another
7 min at 72°C. Ampliﬁed DNA samples were puriﬁed by Centricon-30 tubes and the ﬁnal

volulne of the parallel samples was adjusted to be equal.

Annealing and Extending a 32P-labeled Primer. A gene speciﬁc sequencing primer

(ACCTAGTGTTGCCACTA), 3' to primer 3, was labeled with y-32P-ATP (New England

Nuclear, Boston, MA) by T4 polynucleotide kinase (United States Biochemicals Corp.

68

(U SE), Cleveland, OH) following the manufacturer's instructions. Labeled primer (0.5
pmol) was mixed with 6 ul puriﬁed LMPCR product and lul 0.5% NP-40 and 2 ul
Sequenase Reaction Buffer (U SB) and incubated at 95°C for 5 min. The samples were
chilled on ice for 5 min and 5 ul reaction mixture (20 mM DTT, 1 mM dNTPs, 2 units
of Sequenase 2.0) was added. The samples were incubated at 37°C for 10 min and the
reaction was stopped by adding 5 ul Stop Solution (USB). After that, the samples were
heated at 95°C for 3 min and loaded into a prewarmed 6% sequencing gel. After

electrophoresis, the gel was dried and analyzed using a PhosphorImager (Molecular

Dynamics, Sunnyvale, CA).

69
RESULTS

Determining the Initial Distribution of BPDE Adducts in Cells Treated at Early
G1 Phase or S Phase. One possible explanation for the difference Chen et a1. (3)
observed in the spectrum from cells treated at early Gl phase and that from cells treated
in early S phase is that the initial distribution of BPDE adducts in the two populations
differs signiﬁcantly because of differences in chromatin structure. To determine if this
were the case, we prepared two populations of synchronized cells, one in early S and the
other in early 61 phase and treated them at the same time with the same sample of BPDE
to avoid any variations in the concentration of BPDE. This protocol involved releasing
cells from G0 at two different times prior to the simultaneous exposure to BPDE. The
control population was only exposed to DMSO. Immediately after treatment, the cells
were lysed, and the DNA was extracted and digested with SpeI and BglI to generate a
2kb fragment containing the region of interest.

The DNA was then treated with UvrABC excinuclease to introduce an incision at 8th
nucleotide 5' to the site of a BPDE adduct and a incision at 4th or 5th nucleotide 3' to the
adduct, with the majority at 4th nucleotide(Tang et al., 1992; Sancar and Rupp, 1983).
The samples were denatured and 5' biotinylated gene speciﬁc primer 2 was annealed and
extended to the site of cut with Sequenase 2.0. After ligation of the asymmetric blunt-
ended linker, the DNA was mixed with Dynabeads. A magnet was used to attract the
Dynabeads carrying the desired fragments of DNA, and the rest of the DNA was washed

away. The fragments of interest were then released from the strand attached to the

7O

Fig.2. Autoradiogram showing the initial distribution of BPDE adducts in synchronized
cell populations treated in early 61 or S phase, as analyzed using UvrABC and LMPCR.
Cells were treated with 13 uM BPDE, a dose yielding an adduct level of approximately
0.1 in the 184 nucleotides of the nontranscribed strand of exon 3 of the HPRT gene. The
labeled products were ampliﬁed from 6 pg genomic DNA from cells treated in S (lane
S) or 61 phase (lane Gl) or treated with DMSO only (lane U). The nucleotide positions
of the region of interest are shown. Lane seq-G contains the products of the G reaction
of the Maxam-Gilbert sequencing method performed on a DNA fragment containing exon
3 followed by LMPCR, as described in the text. The bands in Lane Seq-G are 4

nucleotides longer than the corresponding UvrABC generated products.

71

 

: z

.2.

 

Fig.2

72
Dynabeads by alkali denaturation and ampliﬁed by 22 cycles of PCR as described in the

Methods section.

The result is shown in Figure 2. The DNA from cells treated at early Gl phase (5 hr
after release from Go) or S phase (17 hr after release) showed identical patterns,
indicating the difference observed in mutation spectra was not due to difference in BPDE
binding patterns. The bands correspond to those of the G lane of the sequencing ladder,
but the lengths of the fragments are four or ﬁve nucleotides shorter, with the vast majority
being four nucleotides shorter. The band patterns in Figure 2 indicate that the majority,
if not all, of the BPDE adducts involve guanine, in agreement with previous reports
(Conney, 1982). In experiments in which a DNA fragment containing exon 3 was treated
in vitro with BPDE, digested with UvrABC, and similarly analyzed, we also found that
the vast majority of the cuts generated 3' of the BPDE adducts in the region of interest
were at the fourth nucleotide (data not shown). Lane U of Figure 2 shows that there was
no nonspeciﬁc UvrABC excision of untreated DNA, indicating that UvrABC speciﬁcally
recognizes BPDE adducts.

Determining the Rate of Excision Repair of BPDE Adducts Using LMPCR. To
determine if the difference in mutation spectra between cells treated in early S or 61
phase results from inefﬁcient repair of BPDE adducts at those particular sites, we treated
populations of human cells in early G1 phase with 0.5 uM BPDE and used LMPCR to
analyze the initial distribution of BPDE adducts in exon 3 of the HPRT gene and the
fraction remaining at each site after time for repair. Chen et a1. (1992) showed that the

same cells treated with 1.2 uM BPDE were fully capable of nucleotide excision repair.

73

If DNA synthesis were to occur during the time allowed for repair, this would give an
apparent decrease in frequency of adducts. Extensive studies in this laboratory show that
under the conditions used, untreated cells enter S-phase approximately 15 hr aﬁer release
from G0 (Watanabe et al., 1985; Konze-Thomas et al, 1982). However, BPDE causes a
dose-dependent delay in DNA synthesis. Before beginning our repair study, we compared
cells treated with 0.5 uM BPDE and control cells exposed to DMSO for the amount of
incorporation of tritiated thymidine into DNA during 30 hr. This value was less than 0.5%
of the incorporation in the control (data not shown), indicating that during the period of
interest, the extent of replication would be too small to affect measurements of loss of
BPDE adducts.

To quantify adduct levels using LMPCR, ampliﬁcation must be in the exponential
range (Kalinowski et al., 1992). To determine if this were the case under our conditions,
we mixed 6 pg of DNA isolated from cells immediately after 0.5 uM BPDE treatment
with 6 ug of control DNA and analyzed it with UvrABC and LMPCR using our standard
conditions. Similar analysis was carried out using 12 ug of DNA from the treated cells.
The intensities of the various bands with the former were approximately half that of the
corresponding bands in the latter (data not shown), indicating that after 22 cycles of PCR,
the ampliﬁcation was still in the exponential range.

We used LMPCR to analyze the rate of repair in cells treated with 0.5 uM BPDE in
early 61 and allowed 0, 10, 20 and 30 hr for repair. The results are shown in Figure 3.
The DNA from these populations showed patterns similar to those observed in the

samples shown in Figure 2, i.e., the lengths of the fragments are 4 nucleotides shorter

74

Fig.3: Autoradiogram illustrating extent of repair in the nontranscribed strand of exon
3 of the HPRT gene of cells treated with 0.5 uM BPDE, a dose giving an adducts level
of 0.005 per exon 3 strand. Lane G and CT contain the products of the G and CT
reactions of the Maxam-Gilbert sequencing method as described in text; Lane U shows
analysis of the DNA from cells treated with DMSO only; Lanes 0, 10, 20 and 30 show
analysis of BPDE adducts in DNA isolated from cells treated in early Gl phase and
harvested immediately or after incubation for the indicated number of hours. The
nucleotide positions of cuts generated by UvrABC are indicated by numbers; The

corresponding bands in the G sequencing ladder are indicated by arrow heads.

Hf

197-
199-
201’

207-

212-

75

CT

Fig.3

Hf

226 "
229 '-

234 -
23L
238’"

.e

In Oo-Iﬁ 0' ‘

‘o

20

N.

76

than the corresponding fragments in the G lane of the sequencing control. The intensity
of the bands shows that binding at certain sites, e.g., 207, was more frequent than at other
sites, e.g., 212. Repair of adducts at speciﬁc sites was shown by a progressive decrease
in the intensities of the corresponding gel bands.

Evidence of Site-specific Repair of BPDE Adducts in Human Cells. The rates of
excision repair at individual nucleotides were determined by measuring the intensities of
the bands in Figure 3 with the Phosphorlmager and comparing the relative changes for
each of the corresponding bands. The results are shown in Figure 4. The rate of repair
varied along the strand and the differences were reproducible in three independent
experiments. The average rate of repair of adducts from the nontranscribed strand of exon
3 was about 52% removed after 30 hr. However, at some sites a signiﬁcant fraction of
the adducts had been removed after only 10 hr, e.g., 85% removed at position 199, while
at other sites such as 212 and 229, only 25% and 19% of the original adducts had been
removed even after 30 hr. At these positions, i.e., 212 and 229, the rates of repair were
among the slowest. These are the two sites where the relative mutation frequency
increased in cells having time for repair compared to cells having little or no time for
repair. These data strongly support the hypothesis that failure to remove adducts from
speciﬁc sites before DNA replication occurs plays an important role in the formation of

the mutation hot spots.

77

Fig.4: Rates of repair of BPDE adducts in the region of interest. The intensities of the
bands in Figure 3 were quantiﬁed using a Phosphorlmager. The intensities at time 0,
representing the initial level of adducts, were taken as 100% (First bar).The relative
percentage of BPDE adducts remaining at each site after 10 hr (Second bar), 20 hr (Third
bar) and 30 hr (Fourth bar) are shown. The standard deviations were calculated from
three independent experiments. The standard deviations for site 237 have been omitted
because in one experiment out of three, i.e., the one shown in Figure 3, the intensity of

the bands increased with time for repair.

78

 

 

‘ _ \\ .\ \wt ' \\\\‘- \\\\\\\\\_\\ t \ 5 _\\..\ \\\I~. _' \\\\\\
\\ ‘3 \\‘\\ \\\\\\ (\\\\ \\ \ \\\\ \\\‘\ \\\\ \\ \\\ ‘\.\\ \\\\\\\\ \\\\

 

 

. \\\~.s\x \\\ - s _ .\ \\.\\\ \ \\\\\\\\\\ \\\\
.\\\\.:\\ \\ 0“wa \ \\\\x“ .- \ \\ \ \\ V \ \‘

 

\\\\\\ m
mm

 

WWW“

 

_mmmmm
W\\mm

 

_mmmmm
WW“ mm

 

 

mmmmm
mm

m— .

\\.\\ \ \ \\\\\ WW

 

197 199 201 207 208 209 210 211 212 226 229 234 237 238

Fig.

79
DISCUSSION

We determined the initial distribution of BPDE adducts at the nucleotide level in the
nontranscribed strand of exon 3 of the HPRT gene of human ﬁbroblasts and the rate at
which they are repaired at each site and found that, although the initial distribution of
adducts in cells treated at G1 phase or S phase is essentially the same, some sites are
repaired signiﬁcantly slower than other sites. Tornaletti and Pfeifer (1994) recently
showed that the rate of repair of cyclobutane pyrimidine dimers from the p53 gene of
human ﬁbroblasts also differed from one site to another and that those which were
repaired slowly did not share a common primary sequence. Our data also show this.
Holmquist and coworkers (Gao et al., 1994) reported that some of the sites in the FOX]
gene that are repaired much more slowly than other sites are located within transcription
factor binding sites in the promoter. It is highly unlikely that transcription factors bind
to exon 3 of the HPRT gene, but nucleosomes might be expected to form in that region
and chromatin folding may also cause steric hindrance to the action of the repair enzymes
and account for some of the slower repair rates. Changes in DNA secondary structure
induced by photoproducts or bulky adducts are considered to be an initiating signal for

:nucleotide excision repair (Sancar and Sancar, 1988; van Houten, 1990). One possibility
to account for the very rapid rates we observed at certain sites, and the one that we
favor, is that the degree of distortion caused by a BPDE adduct at certain sites is greater
than at others, and that this contributes signiﬁcantly to the differences we observed.

Our data strongly support the hypothesis that the cell-cycle dependent mutation hot

80

spots induced by BPDE, i.e, at sites 212 and 229, are the result of inefﬁcient repair,
since the same initial distribution of BPDE adducts in cells at G1 phase or S phase
indicates that the formation of those hot spots cannot be attributed to different BPDE
binding. After 30 hr of time for repair, 75% of the adducts at position 212 and 81% of
those at 229 were still present. These percentages are much higher than the average, i.e,
about 48% left on, and are signiﬁcantly higher than the 8% and 12% left on at positions
197 and 199. Nucleotide 211 may also represent a site where there was a relative increase
in the frequency of mutations induced by BPDE in cells with time for repair; of 20 base
substitutions from cells treated in S phase, none were located there, compared to 2 out
of 19 from cells treated in G1 phase (Fig. 1). This increase may reﬂect inefﬁcient repair,
since 63% of the adducts remained at that site after 30 hr (Fig. 4).

Not all the sites in exon 3 where the initial adduct level was high or where repair was
slow show up as mutation hot spots. A major reason is that the selection system used to
detect mutants, i.e., resistance to 6-TG, affects the chance of ﬁnding a particular mutation.
Mutations at certain sites, e.g., 210, 234 and 237, will not change the amino acids
sequence and thus cannot be detected, even though the initial adduct levels at these sites
were signiﬁcant and the rates of repair at those sites were average or slower than average.

.A base substitution at site 23 8, a site which showed a signiﬁcant amount of adduct
formation (Fig. 3) and very slow repair (Fig. 4), would change the amino acid sequence,
but a search of the human HPRT mutation database of Dr. Neal Cariello at the University
Of North Carolina shows that no base substitution at this site have been reported. The

same argument holds true for site 207. The initial adduct level was very high at this site

81

and the rate of repair is close to average, but in the database only one base substitution
has ever been reported in this site and this mutation was a tandem mutation (207-208
GG>'IT). Since a G>T at 208 is selectable, it is very likely that the mutation reported
at 207 was silent. This strongly suggests that substitutions at these two sites do not
signiﬁcantly affect the function of the protein and therefore cannot be detected by the
6-TG resistance assay.

Even for mutations that do affect the function of the HPRT protein, it is likely that
different mutations at various sites affect the protein function to a different extent and can
be recovered with different efﬁciencies. Most of the base substitutions induced by BPDE
are G>T mutations. It is possible that a G>T mutation at some sites damages the function
of HPRT protein less than a G>A or G>C mutation. If so, the mutation frequency at these
sites will be low because the majority of the mutations at these sites are hard to detect
using 6-TG assay. All of these selection biases can affect the ﬁnal mutation spectrum

obtained. That explains why in cells treated at S phase, with little or no time for repair
bCfore replication of HPR T, no mutations were found at certain sites where initial adduct
l'i‘v’s’els were high and yet, 1 mutation each out of 20 mutations was found in site 212 and
229, where BPDE adduct level is relatively low. Thus, selection can make it difficult to
c(>l‘x‘elate DNA damage spectra with mutation spectra. This may especially be the case
v"l‘len the end point is a tumor, because tumors arise as the result of multiple mutations
and multiple steps of selection.

In addition to the strong effect that selection can have, many other factors play a role

in converting DNA damage into a spectrum of mutations. Rate of repair at individual sites

82

in the gene is only one of these. The original distribution of damage is also critical. What
is more, when DNA polymerases encounter a damage, e.g., a BPDE adduct, local
sequence context, the conformation of the adduct and the speciﬁc DNA polymerase itself
will determine the possibility that the polymerase can bypass the lesion, and whether or
not the result is a mutation. For example, a context in which a BPDE adduct has a high
chance of being bypassed in an error-free manner or a high chance of failing to be
bypassed at all will give a low mutation frequency even if the level of adducts at that site
is high. If the polymerase fails to bypass, this incompletely replicated DNA may
eventually be repaired by other error prone or error ﬁ’ee mechanisms.

The advantage of our system is that it allows one to compare the difference between the
mutation spectrum of cells mutagenized when the majority are replicating or about to
replicate the target gene and that of the same cells exposed many hours prior to that time
with the rates of repair at individual nucleotides in cells exposed under the same
conditions. Excision repair deﬁcient XP cells do not show a cell cycle-dependent change
in mutation hot spots (Chen et al, 1991). Therefore, the major molecular basis for the
changes in mutation spectra observed in repair proﬁcient cells is very likely the
differences in rate of repair at individual nucleotides. The chance of a cell with a certain
mutation at a particular site in the HPRT gene surviving 6-TG selection should be
constant. Therefore, if one observes an increase in relative frequency of mutations at a
particular site in one population of mutagenized repair-proﬁcient cells compared to
another and there is no signiﬁcant difference in the initial distribution of DNA damage

in the two populations, the observed difference in mutation spectra should reﬂect adducts

83

remaining at particular sites due to inefﬁcient repair at those positions.

In summary, our data show that the initial distribution of BPDE adducts in the
nontranscribed strand of the exon 3 of the HPRT gene in diploid human ﬁbroblasts was
non-random, and the rate of repair of these adducts at individual sites varied signiﬁcantly.
The rates of repair at the cell-cycle dependent mutation hot spots in that region, i.e, at
positions 211, 212 and 229, were among the slowest, indicating that inefﬁcient repair
plays an important role in the formation of such mutation hot spots. The results of our
study also indicate that UvrABC excinuclease can be used in LMPCR assays to quantify
rates of excision repair. This should greatly expand the range of investigations of repair

that can be carried out.

84
ACKNOWLEDGEMENT

This research was supported in part by a grant from ILSI Risk Assessment Science
Institute and by DHHS grants CA56796 and CA21253 from NCI. We thank Dr. P. van
de Putte at Leiden University for kindly providing the UvrABC enzyme and Dr. Pfeifer

and Dr. Holmquist at Beckman Research Institute of the City of Hope for their advice.

85
REFERENCES

Brash, D.E., Rudolph, J.A., Simon, J.A., Lin, A., McKenna, G.J., Baden, H.P., Halperin,
A.J- & Ponten, J. 1991. A role for sunlight in skin cancer: UV-induced p53 mutations in
squamous cell carcinoma. Proc. Natl. Acad. Sci. USA, 88:10124-10128.

Chen, R.-H., Maher, V.M. & McCormick, J.J. 1990. Effect of excision repair by diploid
human ﬁbroblasts on the kinds and locations of mutations induced by (:)-7B,8a-
dihydroxy-9or,l0a-epoxy-7,8,9,l0-tetrahydrobenzo(a)pyrene in the coding region of the
HPRT gene. Proc. Natl. Acad. Sci. USA, 87: 8680-8684.

Chen, R.-H., Maher, V.M. & McCormick, J .J . 1991. Lack of a cell cycle-dependent strand
bias for mutations induced in the HPRT gene by (:)-7B,8a-dihydroxy-9a,lDon-epoxy-

7,8 ,9,10-tetrahydrobenzo(a)pyrene in excision repair-deﬁcient human cells. Cancer Res.,
51 : 2587-2592.

Chen, R.-H., Maher, V.M., Brouwer, J., van de Putte, P. & McCormick, J.J. 1992.
Preferential repair and strand speciﬁc repaair of benz(a)pyrene diol epoxide adducts in the
HPRT gene of diploid human ﬁbroblasts. Proc.NatI. Acad. Sci. USA, 89:5413-5417.

Cormey, AH. 1982. Induction of microsomal enzymes by foreign chemicals and
carcinogenesis by polycyclic aromaticc hydrocarbons. Cancer Res., 42:4875-4917.

G30, 8., Drouin, R. & Holmquist, G.P. 1994. DNA repair rates mapped along the human
P GK 1 gene at nucleotide resolution. Science, 263:1438-1440.

I(alinowski, D.P., Illenye, S. & Van Houten, B. 1992. Analysis of DNA damage and

rePair in murine leukemia L1210 cells using a quantitative polymerase chain reaction.
Nucleic Acids Res., 20:3485-3494.

Konze-Thomas, 3., Hazard, R.M., Maher, V.M. & McCormick, J.J. 1982. Extent of
eXCision repair before DNA synthesis determines the mutagenic but not the lethal effect
of UV radiation. Mutat. Res., 94:421-434.

1VIEIXam, A.M. & Gilbert, W. 1980. Sequencing end-labeled DNA with base-speciﬁc
chelnical cleavage. Methods Enzymol., 65:499-560.

IVI<=Cormick, J.J. & Maher, V.M. 1981. in DNA Repair: A Laboratory Manual of Research

SSacedures, eds. Friedberg, E.C. & Hanawalt, P.C. (Dekker, New York), Vol.1B, 501-
1 .

Mueller, P.R. & Wold, B. 1989. In vivo footprinting of a muscle speciﬁc enhancer by

86

ligation mediated PCR. Science, 246:780-786.
Sambrook, J., Fritsch, E.F. & Maniatis, T. 1989. in Molecular Cloning: A Laboratory
Manual. ( Cold Spring Harbor Lab., Cold Spring Harbor, NY ) 9.16-9.18.

Sancar, A. & Rupp, W.D. 1983. A noval repair enzyme: UVRABC excision nuclease of
Escherichia coli cuts a DNA strand on both sides of the damaged region. Cell, 33:249-
260.

Sancar, A.& Sancar, GB. 1988. DNA repair enzymes. Ann. Rev. Biochem., 57: 29-67.

Seeberg, E., Steinium, A.L., Nordenskjold, N., Soderhaus, S. & Jerstrom, B. 1983. Strand-
break formation in DNA modiﬁed by benzo(a)pyrene diol epoxide. Quantitative cleavage
by Escherichia coli UvrABC endonuclease. Mutat.Res., 112:139-145.

Tatlg, M., Pierce, J.R., Doisy, R.P., Nazimiec, M.E. & MacLeod, MC. 1992.
Pifference and similarities in the repair of two benzo(a)pyrene diol epoxide isomers
Induced DNA adducts by uvrA, uvrB, aand uvrC gene products. Biochemistry, 31:8429-
843 6-

Tornaletti, S. & Pfeifer, G.P. 1994. Slow repair of pyrimidine dimers at p53 mutatio hot
SPOts in skin cancer. Science, 263:1436-1438.

Van Houten, 13., Masker, W.E., Carrier, W.L. & Regan, JD. 1986. Quantitation of
carcinogen-induced DNA damage and repair in human cells with the UVRABC excision
nuclease ﬁ'om Escherichia coli. Carcinogenesis, 7:83-87.

Van Houten, B. 1990. Nucleotide excision repair in Escherichia coli. Microbiological
Reviews, 54:18-51.

Watanabe, M., Maher, V.M. & McCormick, J.J. 1985. Excision repair of UV-or
. nzo(a)pyrene diol epoxide-induced lesions in xeroderma pigmentosum variant cells is
error free". Mutat. Res., 146: 285-294.

Yang, L.L., Maher, V.M. & McCormick, J .J . 1982. Relationship between excision repair
and the cytotoxic and mutagenic effect of the "anti"7,8-diol-9,10-epoxide of
benzo(a)pyrene in human cells. Mutat. Res., 94: 435-447.

Zi'i‘vgler, A., Leffell, D.J., Kunala, S., Sharma, H.W., Gailani, M., Simon, J.A., Halperin,
Ant, Baden, H.P., Shapiro, P.E., Bale, A.E. & Brash, DE. 1993. Mutation hot spots due
to Sun light in the p53 gene of nonmelanoma skin cancer. Proc. Natl. Acad. Sci. USA,
90 :4216-4220.

Chapter III

Effect of the adduct conformation and the local conformation of DNA on rates

of repair of polycyclic adducts in human cells

Dong Wei, Veronica M. Maher and J. Justin McCormick

‘

Carcinogenesis Laboratory, Fee Hall
Department of Microbiology and Department of Biochemistry
The Cancer Center

Michigan State University, East Lansing, MI 48824-1316

87

88
SUMMARY

To assess the effect of the adduct conformation and the local conformation of the DNA
where the adduct has formed on the rate of nucleotide excision repair in human cells, we
determined the rate of repair of l-nitrosopyrene (l-NOP)-induced adducts in exon 3 of
the hypoxanthine phosphoribosyltransferase (HPRT) gene at the nucleotide level using
ligation mediated polymerase chain reaction, and compared the results with those we
obtained previously using benzo(a)pyrene diol epoxide (BPDE). The principal DNA
adduct formed by either agent involves guanine. Although the average rate of excision
repair of l-NOP adducts in exon 3 was 2~3 times faster than that of BPDE adducts, at a
particular nucleotide, the rate of repair of l-NOP adducts was slower or faster than that
of BPDE adducts or, in some cases, equal to that of BPDE adducts. These results
strongly suggest that the rate of repair at each position depends on both the speciﬁc
adduct conformation and the local DNA conformation. The results provide experimental
support for the recent hypothesis by Sancar and colleagues [ Proc. Natl. Acad. Sci. USA
91, 12213 (1994)] that the efﬁciency of excision repair depends on the ability of the
adducted position to support a higher affinity interaction between the recognition subunits

and the DNA.

89
INTRODUCTION

It is well known that procaryotic and eucaryotic cells rely on nucleotide excision repair
(NER) to remove a wide range of DNA damage caused by various agents, including UV
irradiation and such polycyclic carcinogens as benzo(a)pyrene diol epoxide (BPDE) and
N-acetoxy-2-acetylaminoﬂuorene (N-AcO-AAF) (Sancar, 1994; Lin and Sancar, 1992;
Sancar and Tang, 1993). Studies using loss of E. coli UvrABC excinuclease sensitive
sites (van Houten et al., 1986) or loss of radiolabeled polycyclic DNA adducts (Heﬂich
et al., 1980; Yang et al., 1980) show that various types of DNA damage are removed
from the overall genome of human cells at very different rates. To account for such
differences in rate, it has generally been hypothesized that the structure of the
photoproduct or adduct, i.e., the degree of distortion it causes in the DNA helix, is the
major determining factor.

More recently it was found that actively-transcribed genes are repaired faster than non-
transcribed genes (preferential repair) (Chen et al., 1992), and what is more, nucleotide
excision repair of damage in the transcribed strand of such genes is faster than in the
nontranscribed strand (strand speciﬁc or transcription-coupled repair) (Hanawalt, 1994).
These observations focused attention on the contribution of the chromatin structure in
determining the rate of NER and the role of the transcription process itself. Nevertheless,
comparative data on the rate of repair of various kinds of damage in the individual strands
of the HPRT gene of human ﬁbroblasts in culture show that the rate of excision repair

of UV induced photoproducts (cyclobutane pyrimidine dimers (CPD) and pyrimidine-64-

90
pyrimidones (6-45)) (9) or adducts formed by l-nitrosopyrene (l-NOP) (McGregor et al.,

1995) is much faster than excision of BPDE adducts (Chen et al., 1992). Therefore, the
conformation of the damage itself appears to play a dominant role in determining the rate
of repair.

However, very recent studies in human ﬁbroblasts of the rates of excision repair of
UV-induced CPD (Tornaletti and Pfeifer, 1994; Gao et al., 1994) or BPDE adducts (Wei
et al., 1995) at the nucleotide level (site-speciﬁc repair) in particular genes indicate that
the conformation of the photoproduct or adduct cannot be the sole determinant. This is
because the rate of excision of a speciﬁc type of CPD, e.g., a cytosine-cytosine dimer, or
of the guanine-BPDE adduct varied signiﬁcantly from one position in the gene of interest
to another position in that gene, sometimes by more than 10-fold. No consensus primary
DNA sequence could be found to account for this difference. Holmquist and his
colleagues (Gao et al., 1994) proposed that the presence of transcription factors at speciﬁc
sites interfered with excision repair because they found out that the region in the PGKI
gene where the repair of CPD is the slowest is also the region where transcription factors
bind. Since most of the human DNA is considered to be wrapped around histone
octamers to form nucleosomes, Tornaletti and Pfeifer (1994) hypothesized that the
nucleosomal structure causes steric hindrance to the repair enzymes, and makes rates of
repair vary at different sites.

In the present study, we examined the question of the relative contribution of the
adduct conformation and that of the local conformation of the DNA, including

nucleosome pattern effects and possible transcription factors etc., by determining the rate

91

of excision of l-NOP adducts at the nucleotide level in exon 3 of the HPRT gene and
comparing the results with those of BPDE adducts we recently obtained in the same
region under the same conditions (Wei et al., 1995). The principal adducts of both
polycyclic compounds involve guanine, with BPDE binding primarily at the N2 position
and l-NOP at the C8 position of guanine. If steric hindrance to the action of the excision
repair enzyme complex at speciﬁc positions in the region of interest results from various
forms of protein-DNA interaction, it might be expected that the contribution of these
factors to the rate of repair at a speciﬁc position in the gene will be constant. Then,
substituting one structurally related adduct for another at that speciﬁc position ought not
to affect the pattern of site-speciﬁc repair.

To carry out such a study, we synchronized normal human ﬁbroblasts, treated them
with l-NOP in early G1 phase, determined the rates of repair at the nucleotide level using
ligation mediated PCR and E. coli UvrABC excinuclease and compared the results with
those we obtained previously with BPDE (Wei et al., 1995). The results showed that in
the region of interest, l-NOP adducts were repaired at least twice as fast as the BPDE
adducts. However, repair of l-NOP adducts at some sites was almost as slow as that of
BPDE adducts or even slower, indicating that neither the adduct conformation nor the
local DNA conformation alone is the sole determinant of the rate of repair at a particular
site. These data strongly support the hypothesis that the efﬁciency of NER depends not
only on the effect of the adduct conformation itself, but also on the local DNA

conformation.

92
MATERIALS AND METHODS

Cell culture and synchronization. Diploid human male ﬁbroblasts from neonatal
foreskin, designated SL68 (McCormick and Maher, 1981), were cultured in Eagle's
minimal essential medium containing 10% supplemented bovine calf serum. Cells were
driven into the G0 state by density inhibition and mitogen deprivation (Watanabe et al.,
1985). To stimulate the cells to reenter the cell cycle, they were trypsinized and plated
at 1.7 X 104 cells/cm2 in fresh medium containing serum.

Carcinogen treatment and post treatment incubation. l-nitrosopyrene, kindly
provided in solid form by Dr. Frederick Beland at National Center for Toxicology
Research (Jefferson, AK), was dissolved in anhydrous DMSO, stored in -80°C freezer
under nitrogen gas and thawed only prior to use. Five hr after the cells were released
from GO, the medium was removed, the cells were rinsed twice with phosphate-buffered
saline, and serum-free medium was added. The cells were treated with 0.8 uM l-NOP
by adding appropriate volume of l-nitrosopyrene stock solution and incubating for 1 hr
at 37°C. The cells were rinsed and lysed immediately or incubated in fresh medium
containing serum for the time before being lysed.

Determination of extent indicated of DNA synthesized. Cells were incubated in
fresh medium containing serum and 3H-Tdr (6.7 Ci/mmol. DuPont) for 10 hr and then
lysed and DNA were extracted and puriﬁed as described (Wei et al., 1995). The speciﬁc
activity of DNA (cpm/ pg of DNA) was determined and the amount of the newly

synthesized DNA was calculated.

93

Determination of the rates of excision repair of l-NOP adducts at the nucleotide
level. DNA was isolated from the cell lysates and puriﬁed with phenol/chloroform as
described (Wei et al., 1995). Unless otherwise speciﬁed, 12 pg of puriﬁed DNA was cut
with SpeI and BglI and then digested with UvrABC excinuclease, kindly provided by Dr.
Pieter van de Putte at Leiden Univerisity (Leiden, the Netherlands), to excise the l-NOP
adducts as described (Chen et al., 1992). The frequency of UvrABC cuts at each site was
then measured using ligation mediated PCR as described (Wei et al., 1995). Brieﬂy, the
UvrABC digested DNA was puriﬁed and redissolved in 11 111 of H20. Then DNA was
denatured and a gene speciﬁc primer (primer 2) containing a biotin at 5' end was allowed
to anneal and extended by Sequenase 2.0. A specially designed linker was ligated and the
desired fragments were isolated with 75 pg of Dynabeads M-280 Streptavidin following
the manufacturer's instructions. The puriﬁed fragments were then ampliﬁed with 22 cycles
of PCR, using the longer oligomer of the linker and a second gene speciﬁc primer (primer
3), located 3' of primer 2. Ampliﬁed DNA was puriﬁed with phenol/chloroform and
precipitated in ethanol along with 10 ug yeast tRNA, and redissolved in 15 ul solution
containing 10 mM TrisHCl (pH 7.5) and 1 mM EDTA. Six microliter of the ﬁnal PCR
product was labeled using a 32P-labeled gene speciﬁc sequencing primer and separated on

a sequencing gel. The intensity of the bands was analyzed using a Phosphorlrnager

(Molecular Dynamics).

94
RESULTS

Determination of DNA replication during the time allowed for repair. Any
semiconservative DNA synthesis occurring within the period allowed for repair would
give an apparent decrease in the frequency of adducts. Extensive studies in this
laboratory show that under the conditions used, cells synchronized by release from density
inhibition and serum deprivation begin DNA synthesis after ~15 hr (Watanabe et al., 1985).
However, treating cells with carcinogens in early G1 phase causes a dose-dependent
delay in the onset of DNA synthesis (Yang et al., 1982). Since we treated cells 5 hr after
release from G0, DNA replication during the next 10 hr should be negligible. To
determine the extent of daughter strand DNA synthesized during 10-20 hr after treatment,
we treated cells in early G1 with 0.8 11M l-NOP or with the solvent DMSO alone
(control) and measured the amount of incorporation of 3H--Tdr into DNA during the
period. This value for the l-NOP treated cells was ~2% of the incorporation in the control
cells (data not shown). Therefore we used 12.2 ug DNA from this sample to ensure the
same amount of parental DNA to start with.

Rates of repair of l-NOP adducts in exon 3 of the HPRT gene. To determine the
rates of repair of l-NOP adducts at the nucleotide level on exon 3 of the HPRT gene, we
treated synchronized populations of excision repair-proﬁcient diploid human ﬁbroblasts
in early G1 phase for 1 hr with 0.8 uM l-NOP and lysed the cells immediately or after
allowing 10 hr or 20 hr for repair. DNA was extracted and excision by E. coli UvrABC

excinuclease was used to determine the fraction of adducts remaining in each position in

95

Fig.1: Autoradiogram illustrating extent of repair in the nontranscribed strand of exon
3 of the HPRT gene of cells treated with 0.8 uM l-NOP (A) or 0.5 11M BPDE (B). Lane
G contain the products of the G reaction of the Maxam-Gilbert sequencing method as
described (13); Lane U in (B) shows analysis of the DNA from cells treated with DMSO
only; Lanes 0, 10, 20 and 30 show analysis of l-NOP adducts (A) or BPDE adducts (B)
in DNA isolated from cells treated in early Gl phase and harvested immediately or after
incubation for the indicated number of hours. The nucleotide positions of cuts generated
by UvrABC are indicated by numbers. The corresponding bands in the G sequencing
ladder are indicated by arrow heads. The obvious band located above position 207 in (A)
is indicative of a l-NOP adenine adduct formed at site 205, a very minor adduct for 1-

NOP.

anuf
haul
can I

can I
cum I

can cop

.133!

:c

1,3...

 

P .2".

«put

.3“

.. L...

1‘
new

no

 

0

197..
I99-
201’

207-

212-

CT

Fig.1

Hf

226 "
229 '-

234 .—

23K.
238’"

a. ..0‘ O

1.1

97

the DNA region of interest. The cuts generated by UvrABC were mapped with ligation
mediated PCR as described (Wei et al., 1995). The results are shown in Figure 1A. The
results we obtained previously at the same region of the HPRT gene with BPDE adducts
are shown in Fig. 1B for purpose of comparison. UvrABC excinuclease can be expected
to excise a speciﬁc adduct at a speciﬁc site with constant efﬁciency. Therefore, the
decrease in frequency of cuts at a particular site should accurately reﬂect the decrease of
the adduct level at that site, i.e., the rate of repair. The average rate of repair of l-NOP
adducts in the region of interest, i.e., positions 197-238 in exon 3 of the HPRT gene, was
approximately 67% excised in 10 hr and 78% excised in 20 hr. The corresponding
average rate for BPDE adducts is 22% in 10 hr and 34% in 20 hr (Wei et al., 1995).

Comparison of site-specific repair of l-NOP adducts and BPDE adducts in the
region of interest. The site speciﬁc rate of repair of l-NOP adducts differed from that
of BPDE adducts (Fig. 2). At some positions in exon 3, the l-NOP adducts were repaired
faster than BPDE adducts. Even at positions at which BPDE adducts were repaired the
most quickly, i.e., 197, 201 and 226 (20%, 26%, 46% remaining after 20 hr, respectively),
the repair of l-NOP adducts was signiﬁcantly faster than that of BPDE adducts (only 7%,
8%, 6% left on after 20 hr, respectively). At positions where BPDE adducts are excised
much less quickly, e.g., positions 207 and 237-238 (63% and 92% remaining after 20 hr,
respectively), l-NOP adducts were repaired signiﬁcantly faster than BPDE adducts (only
11% and 29% left on after 20 hr, respectively). These data strongly suggest that the
conformation of the adduct plays a major role in determining the rate of excision repair.

However, l-NOP adducts were not repaired faster than BPDE adducts at every position.

98

Fig.2: Relative percentage of l-NOP-induced adducts (ﬁlled bars) and BPDE adducts
(blank bars) remaining in the region of interest after 20 hr of repair. The intensities of
the bands in Figure l were quantiﬁed using a Phosphorlmager, and the relative decrease
in intensity of each of the corresponding bands was calculated. Two independent
experiments were performed for l-NOP and three were performed for BPDE. The rates
of repair reported represent the mean. The intensities at time 0, representing the initial

level of adducts, were taken as 100%.

99

Percentage of adducts remaining after 20 hr of repair

 

 

 

 

 

 

  
   
  

 

 

 

 

 

 

 

/
1oo .
<7
so " 0
so I’
40 "
BPDE
20 .

 

239/238

Fig. 2

100

At position 229, where BPDE adducts were repaired very slowly (91% remaining after
20 hr), the repair of l-NOP adducts was comparably slow (76% left on after 20 hr), and
at position 199, l-NOP adducts were repaired even more slowly than BPDE adducts, i.e.,
21% of l-NOP adducts remained after 20 hr, compared to only ~6% of BPDE adducts.
These data indicate that although on an overall level, l-NOP adducts are repaired faster
than BPDE adducts, when one examines individual nucleotide positions in the gene, the
rate of repair of l-NOP adducts can be slower or faster than that of BPDE adducts at that
same site, or equal to the rate of repair of BPDE adducts. Therefore, even though the
conformation of the adduct plays a major role, other factors having to do with the local
conformation of the DNA are critical for determining the rate of NER.

Not only did the rate of repair of the two kinds of adducts at a speciﬁc position, e.g.,
207, differ signiﬁcantly (Fig. 1), but their relative patterns of site-speciﬁc repair (Fig. 2)
also differed. In the pattern for BPDE adducts, the repair rate at position 199 is very
rapid compared to the overall average, which was 34% removed in 20 hr; at positions
237-238, it is much slower than average; and at positions 207 and 234, it is equal to
average. In contrast, in the pattern for l-NOP adducts, the rate at position 199 was equal
to the average, which was ~78% removed in 20 hr; at positions 237-238, it was also
average; but at position 207 and position 234 it was much more rapid than the average.
Therefore, we conclude that the contribution of the local conformation of DNA to the

rates of excision repair at speciﬁc sites varies among different DNA adducts.

101

DISCUSSION

We have investigated the rates of excision repair of l-NOP adducts at the nucleotide
level on the nontranscribed strand of exon 3 of the HPRT gene in normal human
ﬁbroblasts. We found that the majority of the adducts involved guanine, and that the rates
of repair at different sites varied signiﬁcantly. By comparing the site speciﬁc rate of
repair of l-NOP adducts to that of BPDE adducts in the same region, we found out that
although on average the l-NOP adducts were repaired at least two times faster than BPDE
adducts, at some sites, l-NOP adducts were repaired as slowly as or even slower than
BPDE adducts, indicating that the rates of repair depend on the adduct conformation as
well as the local conformation of the DNA where the adduct has formed.

A comparative study in a human embryonic cell line showed that the tritiated l-NOP
adducts were removed 2-3 times faster that tritiated BPDE adducts from the genomic
DNA (Yang et al., 1988). A similar result was found when McGregor et a1 (1995)
measured the rate of repair of l-NOP adducts in a 20 kb fragment of the HPRT gene in
normal human ﬁbroblasts and compared it to the repair of BPDE (Chen et al., 1992). But
the reasons underlying this difference are not clear. BPDE, a reactive intermediate of
benzo(a)pyrene, principally binds to the N2 position of guanine. The adduct is pentacyclic
and lies in the minor groove of the DNA molecule with the pyrenyl ring oriented toward
the 5' end of the modiﬁed strand, where it causes little helical distortion (Cosman et al.,
1992). l-NOP, a partially reduced metabolite of l-nitropyrene, undergoes a further

intracellular reduction step in huarnn ﬁbroblasts before it forms an unstable reactive

102

intermediate that binds principally to the C8 position of guanine to form the stable
tetracyclic adduct N-(deoxyguanosine-8-yl)-l-aminopyrene. This adduct lies in the major
groove of the DNA and causes little helical distortion (Nolan et al., 1994). It is possible
that an adduct located in the major groove is more accessible to the NER machinery than
an adduct located in the minor groove, and thus is repaired faster. If this is the case, it
could explain why the repair of l-NOP adducts was much faster than that of BPDE
adducts at nucleotide positions such as 207 and 226, but it cannot explain why l-NOP
adducts were repaired as slowly as BPDE adducts at position 229 and even more slowly
than BPDE adducts at position 199.

We also showed that the contribution of the local conformation of DNA to rates of
excision repair at speciﬁc sites varies among different types of DNA adducts. Thus, it
is unlikely that the site speciﬁc rate of repair is a mere reﬂection of the local DNA
conformation or protein interaction. What matters is the ﬁnal local conformation adopted
by the DNA after formation of the adduct. Therefore, we conclude that site speciﬁc rates
Of repair reﬂect the combined effect of the adduct conformation and the speciﬁc local

conformation of the DNA where the adduct has formed.

The model recently proposed by Sancar and colleagues for the human excinuclease
System (Huang et al., 1994) hypothesizes that excision repair in human cells starts with
nonspeciﬁc binding of the recognition subunits to DNA, and this transient, nonspeciﬁc
binding results in changes in the local DNA conformation, such as DNA kinking and
Unwinding. It proposes that if the presence of an adduct facilitates this conformational

change, a higher afﬁnity interaction between the recognition subunits and DNA occurs,

103

and this long-lived complex allows binding of the nuclease subunits that induce the
double incision. This model implies that the ﬁnal conformation of the adducted site
determines the efﬁciency of nucleotide excision repair. Our data in Figures 1 and 2,
showing that the rate of excision repair is determined by the adduct conformation and the
speciﬁc local conformation of DNA where the adduct is located, provide experimental
support for this model and also explain why no consensus primary DNA sequence was
found for either rapidly or slowly repaired sites in DNA (Tornaletti and Pfeifer, 1994;
Gao et al., 1994; Wei et al., 1995).

An unanswered question has been how nucleotide excision repair can recognize and
repair such a wide range of DNA damage. Our results, indicating that the signal for
nucleotide excision repair is the special DNA conformation adopted at a speciﬁc site as
a result of adduct formation, may shed light on that question. The nucleotide excision
repair system may detect and repair not just a speciﬁc kind of DNA damage, but rather
any section of DNA that has adopted a dynamic conformation that differs from that of

the standard conformation of DNA.

104

ACKNOWLEDGEMENTS

We thank Dr. Frederick Beland of the National Center for Toxicological Research
(Jefferson, AK) for kindly providing l-NOP and Dr. Pieter van de Putte at Leiden
University (Leiden, the Netherlands) for kindly providing UvrABC excinuclease. The
helpful discussions with Dr. W. Glenn McGregor and Beatrice Tung are gratefully

acknowledged. This work was supported by DHHS grants CA56796 and CA21253 from

NCI.

105

REFERENCES

Chen, R.-H., Maher, V.M., Brouwer, J., van de Putte, P. & McCormick, J.J. 1992.
Preferential repair and strand speciﬁc repaair of benz(a)pyrene diol epoxide adducts in the
HPRT gene of diploid human ﬁbroblasts. Proc.Natl. Acad. Sci. USA, 89:5413-5417.

Cosman, M., Santos, C.D.L., F iala, R., Hingerty, B.E., Singh, S.B., Ibanez, V., Margulis,
L.A., Live, D., Geacintov, N.E., Broyde, S., & Patel, DJ. 1992. Solution cconfonnation
of the major adduct between the carcinogen (+)-anti-benzo(a)pyrene diol epoxide and
DNA. Proc. Natl. Acad. Sci. USA, 89:1914-1918.

Gao, S., Drouin, R., Chen R. & Holmquist, G.P. 1994. DNA repair rates mapped along
the human PGKI gene at nucleotide resolution. Science, 263:1438-1440.

Hanawalt, RC. 1994. Transcription-coupled repair and human disease. Science, 266:1957-
195 8.

Huang, J.-C., Hsu, D.S., Kazantsev, A. & Sancar, A. 1994. Substrate spectrum of human
excinucleases: Repair of abasicc sites, methylated bases, mismatches and bulky adducts.
Proc. Natl. Acad. Sci. USA, 91:12213-12217.

Heﬂich, R.H., Hazard, R.M., Lommel, L., Scribner, J.D., Maher, V.M. & McCormick,
J .J . 1980. A comparison off the DNA binding, cytotoxity and repair synthesis induced in
human ﬁbroblasts by reactive derivative of aromatic amid carcinogens. Chem. Biol.
Interactions, 29:43-47.

Lin, J .-J . & Sancar, A. 1992. (ABC) excinuclease: the Escherichia coli nucleotide excision
repair enzyme. Mol. Microbiol, 6:2219-2224.

McCormick, J .J . & Maher, V.M. 1981. in DNA Repair: A Laboratory Manual of
Researcch Procedures, eds. Friedberg, E.C. & Hanawalt, P.C. (Dekker, New York), Vol.
18, 501-521.

McGregor, W.G., Mah, C.-M., Chen, R.-H., Maher. V.M. & McCormick, J.J. 1995.
Rapid, strand speciﬁc repair of l-nitrosopyrene adducts but not those of N-acetoxy-Z-
acetylarninoﬂuorene in the hypoxanthine phosphoribosyltransferase (HPRT) gene of
diploid human ﬁbroblasts. Proc. Amer. Assoc. Cancer Res., 36:142.

Nolan, J.J., Vyas, R.R., Hingerty, B.E., Broyde, S. & Basu, AK. 1994. Proc. Amer.
Assoc. Cancer Res., 35: 650 .

 

106
Sancar, A. 1994. Nucleotide excision repair. Science, 266:1954—1956.

Sancar, A. & Tang, MS. 1993. Nucleotide excision repair. Photochem. Photobiol.,
51:905-921.

Tornaletti, S. & Pfeifer, G.P. 1994. Slow repair of pyrimidine dimers at p53 mutatio hot
spots in skin cancer. Science, 263:1436-1438.

Tung, B., McGregor, W.G., Wang, Y.-C., Maher, V.M.& McCormick, J.J. 1995
Comparison of rates of excision of major UV photoproducts in the hypoxanthine
phosphoribosyltranscferase (HPRT) gene of normal and xeroderma pigmentosum variant
(XPV) cells. Mutat. Res., in press.

Van Houten, B., Masker, W.E., Carrier, W.L. & Regan, JD. 1986. Quantitation of
carcinogen-induced DNA damage and repair in human cells with the UVRABC excision
nuclease from Escherichia coli. Carcinogenesis, 7:83-87.

Watanabe, M., Maher, V.M. & McCormick, J.J. 1985. Excision repair of UV-or
benzo(a)pyrene diol epoxide-induced lesions in xeroderma pigmentosum variant cells is
"error free". Mutat. Res., 146: 285-294.

Wei, D., Maher, V.M. & McCormick, J.J. 1995. Site speciﬁc rates of excision repair of
benz(a)pyrene diol epoxide adducts in the hypoxanthine phosphoribosyltransferase gene
of human ﬁbroblasts: Correlation with mutation spectra. Proc. Natl. Acad. Sci. USA,
92:2204-2208 .

Yang, L.L., Maher, V.M. & McCormick, J.J. 1980. Error free excision of the cytotoxic,
mutagenic NZ-deoxyguanosine DNA adducts formed in human ﬁbroblasts by (i)-7B,8a-
dihydroxy-9a,10a-epoxy-7,8,9,1 0-tetrahydro-benzo(a)pyrene. Proc. Natl. Acad. Sci. USA,
77:5933-5937.

Yang, L.L., Maher, V.M. & McCormick, J .J . 1982. Relationship between excision repair
and the cytotoxic and mutagenic effect of the "anti"7,8-diol-9,10-epoxide of
benzo(a)pyrene in human cells. Mutat. Res., 94: 435-447.

Yang, J.-L., Maher, V.M. & McCormick, J.J. 1988. Kinds aand spectrum of mutations
induced by l-nitrosopyrene adducts during plasmid replication in human cells. Mol. Cell.
Biol, 8:3364-3372.

CHAPTER IV

Comparison of the distribution of benzo(a)pyrene diol epoxide adducts at the
nucleotide level in DNA of human cells at various stages of the cell cycle and in DNA

treated in vitro

Dong Wei, Veronica M. Maher and J. Justin McCormick

Carcinogenesis Laboratory, Fee Hall
Department of Microbiology and Department of Biochemistry
The Cancer Center

Michigan State University, East Lansing, MI 48824-1316

107

108
SUMMARY

(:)-7B,8a-dihydroxy-9on,l0a-epoxy-7,8,9,lO-tetrahydrobenzo(a)pyrene (BPDE) is the
principal reactive metabolite of the carcinogenic environmental pollutant benzo(a)pyrene.
To determine the effect of the cell cycle on the distribution of BPDE adducts in normal
human ﬁbroblasts, we synchronized the cells by release from density inhibition (G0), and
treated them with BPDE in early G1 phase, at the onset of S phase, in late S phase or at
G2/M border. Cell synchronized at Gl/S border with aphidicolin or at metaphase with
colcemid were also treated with BPDE. Analysis of the distribution of BPDE adducts in
the nontranscribed strand of exon 3 of the hypoxanthine phosphoribosyltransferase gene,
using E. coli UvrABC excinuclease and ligation mediated polymerase chain reaction,
showed that the relative distribution in the cellular DNA was essentially the same across
the cell cycle. Furthermore, for almost all nucleotide positions, the distribution of BPDE
adducts was similar to that found when puriﬁed DNA was treated with BPDE in vitro.
The exception was that adduct formation in vivo at a region of six consecutive guanines,
i.e., nucleotide 207-212, was strongly enhanced compared to that seen with DNA treated
in vitro. No evidence of nucleosomal structures or other protein-DNA interactions could
be found within the region of interest. Therefore, we conclude that the enhancement of
BPDE adduct formation at nucleotide 207-212 in vivo reﬂects the physiological

environment in the cell nucleus and that this effect is unchanged throughout the cell cycle.

l 09
INTRODUCTION

The ultimate reactive metabolite of benzo(a)pyrene is the (i)-7B,801-dihydroxy-9oc,100l-
epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (BPDE) (Marquardt et al., 1976), and the (+)-
enantiomer is the form that has been shown in mouse skin carcinogenesis studies to lead
to malignant transformation (Slaga et al., 1979). The major DNA adduct formed by
BPDE in vivo and in vitro is the addition of BPDE residue to the N2 position of guanine
(Weinstein et al., 1976). In vitro studies on the mechanism of carcinogenic interaction
with DNA suggest that BPDE ﬁrst intercalates noncovalently into the base pairs of DNA,
and then the intercalated BPDE either is hydrolyzed to nonreactive products (tetrols) or
covalently binds to DNA (MacLeod and Zachary, 1985; MacLeod, 1990). In fact, only
a small fraction of intercalated BPDE actually becomes covalently bound.

The distribution of BPDE adducts at the nucleotide level in DNA treated in vitro has
been studied with DNA polymerases (Thrall et al., 1992), E. coli UvrABC excinuclease
(Tang et al., 1992) or laser irradiation (Smith and MacLeod, 1993). These studies show
that the BPDE adducts are distributed in a nonrandom and consistent pattern. However,
the distribution of BPDE adducts in DNA at the nucleotide level in mammalian cells had
not previously been studied. We (Wei et al., 1995) adapted ligation mediated PCR
(LMPCR) (Mueller and Wold, 1989; Pfeifer et al., 1989) in combination with the use of
UvrABC excinuclease to carry out a study with DNA from diploid human ﬁbroblasts
treated with BPDE. That study also showed that BPDE adducts are distributed in a non-

random, consistent manner.

110

Indirect evidence predicts that the complicated environment in intact cells will result
in patterns of DNA adduct formation by bulky carcinogens that differ from the pattern
seen with DNA in vitro. Examples include the ﬁnding that a positional isomer of BPDE,
9r,10t-dihydroxy-7c,8c-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene could not form stable
adducts in vivo, but formed adducts with puriﬁed DNA almost as efﬁciently as BPDE
(Baird and Diamond, 1977), and that the bulky carcinogen cisplatin forms adducts at an
extra site in the DNA of intact cells, a site where no obvious adducts are formed in vitro
(Grimaldi et al., 1994). The ﬁnding by MacLeod and Selkirk (1982) that Mg2+ inhibits
the rate of the hydrolysis of BPDE suggests that other molecules in the nucleus may also
affect BPDE adduct formation. To see if this were the case, we used LMPCR to
investigate the pattern of DNA adduct formation at the nucleotide level in vivo in cells
exposed to BPDE at various times during the cell cycle, and compared the results with
those we obtained when we treated puriﬁed DNA with BPDE in vitro.

We found that the relative patterns of BPDE adduct formation in the region of interest
were essentially the same across the cell cycle, and at most sites were very similar to that
pattern observed in vitro. However, in vivo there was a much stronger binding of BPDE
in a region of six consecutive guanines. DNA footprinting experiments showed that this
difference was not the result of nucleosomal structures or other protein-DNA interactions
within the region of interest. We conclude that under the physiological conditions in the
nucleus of human cells, BPDE binding can be strongly enhanced in certain regions, such

as in a run of guanines, and that this effect remains constant throughout the cell cycle.

l 1 1
EXPERIMENTAL PROCEDURES

Cell culture and synchronization. Diploid human male ﬁbroblasts derived from a
neonatal foreskin, designated SL68 (McCormick and Maher, 1981), were cultured in
Eagle's minimal essential medium containing 10% supplemented bovine calf serum. Cells
were synchronized into G0 by density inhibition and mitogen deprivation (Konze-Thomas
et al., 1982) and released by being trypsinized and plated at 1.7 X 10‘ cells/cm2 in fresh
medium containing serum. A second cell population similarly released ﬁom G0 was
incubated in fresh medium containing 0.2 rig/ml aphidicolin (Sigma) for at least 24 hr to
block the cells at the onset of S phase, and the medium was replaced with fresh complete
medium, lacking aphidicolin, half an hour before the treatment. A third population
released from G0 was cultured in fresh medium with serum for about 25 hr, and the
medium was then replaced by medium containing 0.4 ug colcemid (Gibco/BRL) for
another 20 hr to block the cells at metaphase.

Treatment of cells with BPDE. BPDE, obtained as a dry powder from Chemsyn Science
Laboratory, was dissolved in anhydrous DMSO immediately before use. Before
treatment, the medium on the cells was removed, the cells were rinsed twice with
phosphate-buffered saline (PBS), and serum-free medium was added. An appropriate
volume of the BPDE stock solution was added by pipetteman. The cells were incubated
at 37°C for 1 hr, and the cells were then rinsed and lysed immediately.

Determination of the distribution of BPDE adducts in vivo at the nucleotide level.

DNA was isolated from the cell lysates and puriﬁed as described (Wei et al., 1995), and

112
6 pg of DNA per sample was cut with SpeI and BglI (Boehringer Mannheim). UvrABC

excinuclease, kindly provided by Dr. Pieter van de Putte at Leiden University (Leiden,
the Netherlands), was used to excise the BPDE adducts as described (Chen et al., 1992).
UvrABC cuts in the region of interest were then mapped using ligation mediated PCR as
described (Wei et al., 1995). Brieﬂy, the UvrABC-digested DNA was puriﬁed, redissolved
in H20, and denatured. A gene speciﬁc primer (primer 2) containing a biotin at the 5' end
was allowed to anneal and was extended to the site of cut by Sequenase 2.0 (United
States Biochemicals). A linker was ligated, and the desired fragments were isolated using
Dynabeads M-280 Streptavidin (Dynal). Unless otherwise noted, the puriﬁed fragments
were ampliﬁed by 22 cycles of PCR, using the longer oligomer of the linker and a second
gene speciﬁc primer (primer 3), located 3' of primer 2, and were puriﬁed with a
Centricon-30 microconcentrater (Amicon). Six microliters of the ﬁnal PCR product was
labeled using a 32P-labeled gene speciﬁc sequencing primer and separated on a sequencing
gel. The intensity of the bands was analyzed using a Phosphorlrnager (Molecular
Dynamics).

Determining the amount of 3H-BPDE adduct formation on a DNA ﬁagment containing
exon 3. A genomic DNA fragment containing the region of interest was ampliﬁed with
an intron primer and gene speciﬁc primer 2 as described (Wei et al., 1995). The DNA
was puriﬁed, digested with DdeI to generate a fragment of 354 bp, and was treated with
3H-BPDE (1744.2 mCi/mmol, Chemsyn Science Laboratory) at a concentration of 13.7
11M. The DNA was then puriﬁed as described (Yang et al., 1987), and the concentration

was measured on a spectrophotometer. An appropriate amount of DNA was counted on

113

a scintillation counter to determine the radioactivity remaining bound to the DNA. The
frequency of BPDE adducts formed on each DNA fragment was calculated as described
(Yang et al., 1987). The frequency on either strand of the DNA fragment was estimated
to be 50%.

Analyzing the distribution of BPDE adducts on this DNA ﬁagment with Sequenase 2. 0.
Gene speciﬁc primer 3 was labeled with y-32P-ATP (6000Ci/mmol, New England
Nuclear) and T4 polynucleotide kinase (United States Biochemicals) following the
manufacturer's suggestions. The DNA fragment with a known amount of BPDE adducts
was denatured and annealed with the labeled primer and extended with Sequenase as
described (Wei et al., 1995). The sample was then run on a sequencing gel and analyzed
with a Phosphorlmager.

Analyzing the eﬁiciency of UvrABC excision on this DNA fragment. The DNA
fragment with 3H-BPDE adducts was digested with UvrABC and puriﬁed using the
conditions described by Wei et a1 (1995). The DNA was separated on a sequencing gel
and electroblotted onto a nylon membrane with a homemade electroblotter following the
instructions of Pfeifer and Riggs (1993). After completion of transfer, the DNA was
crosslinked to the membrane with a UV crosslinker (Stratagene). Gene speciﬁc primer
3 labeled as described above was then used to probe the membrane, using the same
conditions described by Pfeifer and Riggs (1993), except that the hybridization
temperature was decreased to 40°C. After overnight hybridization, the membrane was
washed at room temperature as described (Pfeifer and Riggs, 1993), exposed to a

Phosphorlmager screen, and analyzed.

114

In vivo DNA footprinting. For dimethyl sulfate (DMS) footprinting, the cells were
rinsed twice with PBS, and the serum free medium containing 0.1% DMS (Sigma) was
added, and the cells were incubated for 10 min at room temperature. Cells were washed
again and lysed immediately. DNA was extracted and puriﬁed as described (Wei et al.,
1995). The DNA sample was treated with 1M piperidine (Sigma) at 90°C for 30 min and
puriﬁed and analyzed using LMPCR as described (Wei et al., 1995). As a control,
puriﬁed untreated genomic DNA from SL68 cells was subjected to the guanine speciﬁc
cleavage reactions in the standard Maxam-Gilbert protocol and analyzed using LMPCR
as described (Wei et al., 1995). For the purpose of comparison, all samples were
separated on a sequencing gel in parallel .

For micrococcal nuclease (MNase) footprinting, we adapted the protocol of Pfeifer and
Riggs (1991). Brieﬂy, cells were trypsinized, washed with PBS, and resuspended in
solution I (150 mM sucrose, 80 mM KCl, 35 mM Hepes at pH 7.4, 5 mM KZHPO,” 5
mM MgC12, 0.5 mM CaClz) with 0.05% lysolecithin (Sigma) for 1 min at 37°C. Cells
were washed once with solution I lacking lysolecithin, and treated for 5 min with 20
units/ml of MNase (Promega) in 150 mM sucrose, 50 mM TrisHCl (pH 7.5), 50 mM
NaCl, and 2 mM CaCl,. The treatment solution containing MNase was removed, the cells
were lysed, and DNA was extracted and puriﬁed as described (Wei et al., 1995). As a
control, puriﬁed untreated genomic DNA from the same cell line was similarly treated
with micrococcal nuclease and puriﬁed. Both the control and the sample DNA were
digested with BglI and SpeI and puriﬁed. Since DNA fragments generated by MNase

contain 5'-OH group, which prevents ligation of the linker, the DNA was phosphorylated

115

with T4 polynucleotide kinase in the presence of 0.2 mM ATP according to the
manufacturer's instructions. DNA was puriﬁed again and analyzed with LMPCR as

described (Wei et al., 1995).

1 16
RESULTS

The distribution of BPDE adducts in exon 3 of the HPRT gene across the cell cycle.
As part of a study on the effect of DNA repair on the spectrum of mutations induced by
BPDE, we showed that the initial distribution of BPDE adducts on the nontranscribed
strand of exon 3 of the HPRT gene in normal human ﬁbroblasts was essentially the same
for cells treated in early Gl phase or in early S phase (Wei et al., 1995). In the present
study, using a series of methods to achieve cell synchrony, we have investigated the
distribution of BPDE adducts in the same region of DNA in such cells treated at various
phases of the cell cycle. In the ﬁrst method, cells were released from G0 by being plated
at a lower density in fresh complete medium containing serum, and treated with BPDE
5, 17, 25, 30 hr after release. Under the culture conditions used, at these time points, the
majority of the cells were in early G1 phase, early S phase, late S phase, and at the G2/M
border, respectively (data not shown). In the second method, cells released from G0 were
further synchronized at the Gl/S border (i.e., at the very beginning of S phase) with
aphidicolin, and treated with BPDE 30 min after release from this block. Aphidicolin
stops cells at the beginning of S phase by inhibiting DNA polymerases (Pegrali-Noy et
al., 1980), and studies by Grossmann et al. (1985) in this laboratory indicate that
replication of the HPRT gene occurs during the ﬁrst 1 hr or 1.5 hr after release from
aphidicolin. In the third method, cells were synchronized with colcemid, which stops
cells at metaphase by disrupting the microtubules and thus inhibiting the formation of the

spindle (Sele et al., 1977). Staining the cells with Hoechst reagents showed that under

117

the conditions we used, about 70% of the cells were at the metaphase at the time they
were treated with BPDE. (data not shown.)

A BPDE dose of 13 11M was chosen because at this dose, no DNA replication or DNA
repair occurs (data not shown). If either such process were to occur during the 1 hr BPDE
treatment, it would interfere with the analysis. A 13 11M dose yields approximately 1
adduct per 2000 nucleotides (Chen et al., 1992), and in our analysis we examine the
BPDE adduct formation at the nucleotide level within a 200 bp fragment. Therefore, the
average frequency is 0.1 per fragment.

After BPDE treatment, DNA was extracted and digested with E. coli UvrABC
excinuclease to excise the BPDE adducts, and a gene speciﬁc primer was annealed and
extended with Sequenase 2.0 to generate a blunt end at the site of each cut. A linker was
ligated to the blunt end, and the desired fragments were ampliﬁed by PCR and labeled
with a third primer. The labeled product was separated on a sequencing gel. The
distribution of fragments of particular lengths indicated the relative number of cuts
generated at these sites by UvrABC and, therefore, the relative level of BPDE adducts
formation at these sites.

The results are shown in Figure 1, along with the sequencing ladders. Virtually every
BPDE adduct involved guanine. The most striking observation in Figure l is that the
intensities of the corresponding bands of all six samples are similar, indicating that the
relative distribution of BPDE adducts for cells at various stages of the cell cycle was
essentially the same. This strongly suggests that the permeability of BPDE was the same

for cells at the various stages of the cell cycle, that BPDE was able to diffuse freely in

118

Fig. 1. Autoradiogram showing the distribution of BPDE adducts in exon 3 of the HPRT
gene when cells were treated with BPDE at various stages of the cell cycle or when
puriﬁed DNA was treated in vitro. Cells were treated for 1 hr with 13 11M BPDE, a dose
yielding an adduct level of approximately 0.1 in the 184 nucleotides of the nontranscribed
strand of exon 3 of the HPRT gene. Treatment was at 5 hr (lane 5), 17 hr (lane 17), 25
hr (lane 25) or 30 hr (lane 30) after release from G0; or 30 min after release from
aphidicolin synchronization; or after colcemid treatment. DNA was isolated and subject
to UvrABC digestion and LMPCR to determine the distribution of BPDE adducts. A
puriﬁed DNA fragment containing exon 3 (lane Fra) or puriﬁed genomic DNA (lane Gen)
treated with BPDE in vitro was also analyzed with UvrABC and LMPCR to determine
the distribution of BPDE adducts. The ﬁnal LMPCR products were labeled and separated
on a sequencing gel. The region of six consecutive guanines, i.e., nucleotide 207-212,
is shown. Lane seq-G contains the products of the G reaction of the Maxam-Gilbert
sequencing method performed on a DNA fragment containing exon 3 followed by
LMPCR as described (Wei et al., 1995). The bands in Lane Seq-G are 4 nucleotides

longer than the corresponding UvrABC generated products (Wei et al., 1995).

he HPRl
or “in
E. adose
inscribed
a 17125
as: loll
d subject
[ducts A
are 0:11

lelermiii

307-211
m—Gllbﬁl
lowed bl

119

MS
30h25h17h5hFraGenG

 

Flg.1

120

cells at every stage of the cell cycle, and that even though the nuclear location of the
HPRT gene can be expected to change from G1 phase to metaphase, BPDE had the same
binding speciﬁcity to a particular guanine nucleotide.

In the samples from cells synchronized with aphidicolin or colcemid, the intensities of
all the bands were slightly higher than those in the other lanes. It is possible that cells
treated with these chemicals allowed BPDE to diffuse more easily, resulting in a slightly
higher local concentration of BPDE in the nucleus and therefore a higher frequency of
BPDE adduct formation, or that these chemicals increased the chance of BPDE
intercalation or conversion of intercalated BPDE to the covalently bound form.

Comparison of the BPDE adduct formation in vivo with that in vitro in the region of
interest. The fact that the pattern of BPDE adduct formation in cells was essentially the
same across the cell cycle suggested that the binding pattern was determined mainly by
local DNA sequence. If so, the pattem of BPDE adduct formation in DNA treated in vivo
should be the same as that seen when the same DNA is puriﬁed and treated with BPDE
in vitro. To test this, we determined the pattern of BPDE adduct formation in vitro on
a puriﬁed DNA fragment containing exon 3 of the HPRT gene. A genomic DNA
fragment was ampliﬁed with PCR as described in Method and Materials and digested
with restriction enzyme DdeI to generate a fragment of 354 bp. The DNA fragment was
puriﬁed and treated with BPDE and analyzed using UvrABC and LMPCR. As shown in
the lane of Figure 1 labeled Fra, the relative adduct formation at almost every site was
similar to what had been found when intact cells were treated with BPDE. However, the

relative level of BPDE adduct formation in the run of six guanines, nucleotide 207-212,

121

was signiﬁcantly lower than seen in DNA from cells, indicating that the potential for
BPDE covalent binding at this region was enhanced in vivo.

To test the possibility that this lower binding in the region 207-212 was an artifact
caused by using the ampliﬁed DNA fragment, we performed the same analysis on
genomic DNA treated with BPDE in vitro. Genomic DNA was puriﬁed and digested
with restriction enzymes Spel and BglI to decrease the viscosity. The DNA was then
treated with 13 11M BPDE and analyzed using LMPCR. The result, shown in the lane
of Figure 1 labeled Gen, indicated that the distribution of BPDE adducts in the puriﬁed
genomic DNA treated in vitro was the same as that found in the PCR-ampliﬁed DNA
fragment. A similar experiment was also done with puriﬁed, non-restricted, intact
genomic DNA (Mw>100 kDa), and the same result was obtained (data not shown). These
results indicate that the enhancement of the relative level of BPDE adducts at nucleotides
207-212 observed when cellular DNA was treated in vivo did not reﬂect a difference in
the length of DNA treated, but rather reﬂected the difference in conditions in which the
DNA was treated: i.e., the fact that the DNA was in a special microenvironment of the
nucleus in vivo, rather than dissolved in TE buffer in vitro.

Determining whether nucleosomes are present in the region of interest. One possible
explanation for BPDE adduct formation at nucleotide 207-212 being enhanced in vivo is
that the region of six guanines is located at the terminal of a nucleosome formed at exon
3 of the HPRT gene. Smith and MacLeod (1993), using a reconstructed nucleosome,
showed that covalent binding of BPDE at the terminal 20-30 bp of nucleosomal DNA is

enhanced 2.5 fold relative to the central portion. If the region of six guanines in exon3

122

of the HPRT gene were located at the terminal of a nucleosome, BPDE adduct formation
there might well be enhanced relative to that at the rest of exon 3. To test this, we
carried out in vivo DNA footprinting to determine if there were any nucleosomal structure
or other protein-DNA interactions in the region of interest.

Dimethyl sulfate (DMS) is the reagent most commonly used for in vivo footprinting,
and its small size allows it to diffuse easily through cell membranes to react with DNA
in the nucleus, so no manipulation of the cells is required prior to treatment. Therefore,
we carried out in vivo footprinting by treating normal ﬁbroblasts in GI phase with DMS,
extracting the DNA, cutting it with piperidine as described, and analyzing the products
using LMPCR. The results are shown in Fig. 2a. Comparison of the ampliﬁed pattern
with that of the highly puriﬁed genomic DNA shows that they are essentially the same,
indicating that there was no obvious nucleosomal structures or other protein-DNA
interaction at the region of interest. We found a similar pattern in cells treated with DMS
at metaphase (Fig 2a), which is consistent with other studies showing that DMS is small
enough to diffuse freely through the condensed chromosome structure (Pfeifer and Riggs,
1991)

DMS is only effective in detecting protein-DNA contacts in DNA sequences containing
G5 in the major groove of the DNA double-helix, and Pfeifer et al. (1992) showed that
use of this chemical to detect nucleosomal structure is not optimal, probably because it
can penetrate protein-DNA complexes. To conﬁrm the DMS footprinting data, we also
used micrococcal nuclease to detect the possible presence of nucleosomes in the region

of interest.

123

Fig. 2. Autoradiograms showing the in vivo DNA footprinting with dimethyl sulfate (A)
or micrococcal nuclease (B). In A, puriﬁed genomic DNA treated with dimethyl sulfate
(DMS) in vitro (lane Con) or DNA from cells treated with DMS at G1 phase (lane G1)
or metaphase (lane M) was analyzed with piperidine and LMPCR. In B, puriﬁed genomic
DNA digested with micrococcal nuclease (Con) or DNA from cells penneabilized with
lysolecithin and treated with micrococcal nuclease at G1 phase (lane G1) was
phosphorylated with T4 polynucleotide kinase and analyzed with LMPCR as described
in Materials and Methods, except that DNA was ampliﬁed by 27 cycles of PCR instead
of 22 cycles. Lane G shows the G sequence ladder as in Lane Seq-G in Fig. 1. The
region of six consecutive guanines, i.e., nucleotide 207-212, is shown. The patterns of
the in vivo DNA footprints are similar to those obtained with puriﬁed genomic DNA.
Although some extra modiﬁcations or incisions were seen in the DNA footprinting
patterns when cells were treated compared to those found when puriﬁed genomic DNA
was treated, they do not represent a pattern typical for a nucleosome. Rather, they

probably result from differences in the environment of the DNA in cells and in TE buffer.

 

124

{A}

611

llrnl:

 

W35

t‘ '
133

L.

l I»

150i

M

v...

 

Fig.2

125

Micrococcal nuclease is widely used to study the nucleosomal structure because of its
preference for incision of nucleosome-free DNA (Zhang et al., 1983). This protein cannot
readily penetrate cell membranes to incise DNA in the nucleus. Pfeifer and Riggs (1991)
showed that better in vivo footprinting can be achieved using cells permeabilized by
lysolecithin than using isolated nuclei. Therefore, we ﬁrst penneabilized populations of
normal ﬁbroblasts, synchronized in GI phase, using lysolecithin and treated them with
micrococcal nuclease. The results, shown in Figure 2b, indicated that the incision pattern
of micrococcal nuclease on genomic DNA in vivo was very similar to that on highly
puriﬁed genomic DNA in vitro. Since micrococcal nuclease is expected to incise
preferentially at the linker region in the presence of a nucleosome and generate an
incision pattern different from that on pure genomic DNA, we conclude that there is no
nucleosome formation at exon 3 of the HPRT gene. We also obtained similar results in
DNA footprinting using DNase I and hydroxyl free radicals (data not shown). The lack
of a nucleosome structures or other protein-DNA interaction in the region of interest
suggests that the strong enhancement of BPDE adduct formation at nucleotide 207-212
in vivo compared to that in vitro is caused by the special physiological environment that
exists in the cell nucleus, and is not present in the TE buffer pH 8.0. The data further
indicate that this effect is very consistent throughout the cell cycle.

Evidence of a special secondary DNA structure. Several studies on the distribution of
BPDE adducts in puriﬁed DNA treated in vitro using interference with polymerization to
detect the presence of adducts (Dittrich and Krugh, 1991; Thrall et al., 1992) or using

photodestruction by laser radiation (Boles and Holgon, 1986) have shown that long runs

126

of guanine are hot spots for BPDE adduct formation. This suggests that such runs form
a special localized DNA secondary structure that is especially favorable to BPDE binding.
As shown in Figure 1, our results using LMPCR to detect the distribution of BPDE
adducts in the run of six guanine in exon 3 of the HPRT gene of puriﬁed DNA treated
in vitro do not show such preferential binding.

To further investigate the distribution of BPDE adducts in this region, we made use of
two other approaches. A fragment of DNA containing exon 3 was ampliﬁed and cut with
DdeI to generate a fragment of 354 bp, so that BPDE adduct formation at every
nucleotide position could be analyzed later on a sequencing gel. The puriﬁed DNA
fragment was then treated with generally tritiated BPDE. Aﬁer extensive
phenol/chloroform extraction and puriﬁcation, the DNA concentration and the
radioactivity remaining on the DNA was measured. Calculation indicated that the level
of binding was approximately 0.56 BPDE adducts per DNA fragment (data not shown).
Since the two strands of this DNA fragment contain approximately equal numbers of
guanines, we estimated the level of binding to be 0.28 BPDE adducts per strand of the
fragment.

To test whether primer extension by Sequenase can be used to quantitatively determine
BPDE adduct formation at the nucleotide level in exon 3, as was shown for a poly(G)
region by Thrall et al. (1992), we denatured the DNA fragment containing this known
amount of 3H-BPDE adduct. A 32P labeled gene-speciﬁc primer was annealed and
extended with Sequenase 2.0. The product was separated on a sequencing gel, in parallel

with a sequencing control. The results (Figure 3a) showed that Sequenase 2.0 stopped one

127

nucleotide prior to each guanine exclusively. Quantitation of the gel using a
Phosphorlmager indicated that the frequency of full length DNA fragments generated by
Sequenase from the BPDE treated DNA was approximately 74%, while with the untreated
DNA, essentially all the 32P-labeled fragments were of full length (data not shown). Thus,
our data indicate that Sequenase was stopped quantitatively by BPDE adducts. It is
obvious from Fig. 3a that when termination of Sequenase extension was used as the
measure of BPDE adduct levels, the region of six consecutive guanines (nucleotide 207-
212) was a hot spot for BPDE modiﬁcation, and furthermore, there was selective
modiﬁcation of guanines at the 5' end of this polyd(G) region, which is consistent with
the previous ﬁnding of Thrall et al. (1992).

UvrABC has been shown to excise BPDE adducts with close to 100% efficiency (Tang
et al., 1992; van Houten etal., 1986; Seeberg et al., 1983), but the efficiency of UvrABC
excision has also been shown to vary according to the local DNA secondary structure
(Seeberg and Fuchs, 1990). If this region of six consecutive guanines adopts a special
secondary structure, such a secondary structure might have an impact on the efﬁciency
of UvrABC excision. To test this, we used UvrABC to digest another aliquot of the same
DNA fragment treated with tritiated BPDE that was used in the Sequenase extension
study, and we separated the products on a sequencing gel. The DNA was then
electroblotted onto a nylon membrane and probed with a 32P-labeled oligomer
complementary to the 3' end of the desired strand, so that the efﬁciency of UvrABC
incision on the 3' side of the BPDE adducts on this strand could be determined. The

result is shown in Figure 3b. Image analysis showed that the frequency of full length

 

128

fragments was approximately 75%. When the artifactual decrease of the efﬁciency of
UvrABC cutting at either end of the DNA fragment is taken into consideration, these
results indicate that UvrABC excised the BPDE adducts with close to 100% efﬁciency,
consistent with previous observations. As shown in Fig. 3b, more frequent cuts are
observed in the region of six Gs than at many other sites. However, the level of BPDE
adduct formation in that region as detected by UvrABC cutting was only about 50-60%
of the level detected using Sequenase (data not shown).

To conﬁrm this observation, the 32P-labeled primer 3 was annealed to this same DNA
fragment treated with BPDE that had or had not been digested by UvrABC, and extended
with Sequenase. In the DNA that had not digested by UvrABC, Sequenase stopped one
nucleotide before each guanine. At virtually every guanine site in exon 3 in the DNA
that was digested with UvrABC, extension by Sequenase was terminated four nucleotides
3' of the DNA adduct, as a result of UvrABC excision (data not shown). However, at
nucleotide position 207-212, only approximately half of the termination shifted. This
further conﬁrmed that UvrABC excision was impeded by the local secondary structure
in this region. The fact that this incomplete excision by UvrABC was not observed in
any other guanine position in exon 3 (data not shown), supports our conclusion that a

special secondary structure is adopted by the region of six consecutive guanines.

129

Fig. 3. Autoradiograms showing the distribution of BPDE adducts in a DNA fragment
treated with 3H-BPDE determined using Sequenase 2.0 (A) or UvrABC (B). A DNA
fragment containing exon 3 of the HPRT gene was treated with 3H-BPDE. One aliquot
of this DNA was annealed with a 32P-labeled gene-speciﬁc primer 3 and extended with
Sequenase 2.0 (lane BP). Two aliquots of this DNA were digested with UvrABC,
separated on a sequencing gel, electroblotted onto a nylon membrane and hybridized with
the 32P-labeled primer 3 (lane R1 and lane R2). Lanes C, G, A contain the products of
C, G, A sequencing reactions when the gene-speciﬁc primer 3 was used to sequence the
DNA fragment according to the standard Sanger method. Therefore, lane C indicated the

position of every guanine in the complementary strand (nontranscribed strand).

 

130

32

.‘i I. .3
i I. .3

R1

207-
212-

Tauu " "an. a I “u H.
c. 3.2a. . In . :3.
cu: linen“. 2 '. u .-
e'i .IIIIII ri. 2.-

_
2
m

207-

ram
8 DNA
311.1110i
xd mil
1'le
:d mil
all: 01
1C6 1116
ed lit

Fig.3

l3 1
DISCUSSION

Our present investigation of the distribution of BPDE adducts on the nontranscribed
strand of exon 3 of the HPRT gene in normal human ﬁbroblasts at the level of single
nucleotide resolution showed that the distribution pattern was essentially unchanged across
the cell cycle. This suggests that the action of BPDE (intercalation into DNA, conversion
to the covalent bound form) is unaffected by the changing cytoskeletal structure and
physiological conditions throughout the cell cycle, and that BPDE molecules are small
enough to diffuse freely through the highly condensed chromosomal structure, as is the
case for dimethyl sulfate. The relative distribution of BPDE adducts in vivo at most sites
in the region of interest in the HPRT gene from cells was very similar to that found at
those sites for puriﬁed DNA treated in vitro, except the region of six consecutive
guanines. This latter region, i.e., nucleotide 207-212, was a hot spot for BPDE adduct
formation for DNA in vitro, but an even "hotter" spot for BPDE adduct formation in vivo.
Because no nucleosomal structures or other protein-DNA interactions were found at exon
3 of the HPRT gene, we conclude that this difference in binding was due to the special
physiological conditions in the cell nucleus.

Cellular DNA is believed to exist in the form of nucleosomes. DNA is wrapped
around core histone octamers to form nucleosomes, and then coiled into a chromatin ﬁber
with a width of 30 nm. The existence of a histone octamer at a particular locus would
inhibit the action of the DNA endonucleases (Pfeifer and Riggs, 1991, 1993; Smith and

MacLeod, 1993), and cause a periodic cutting pattern by hydroxyl free radical (Powers

132

and Bina, 1991). However, such a pattern was not detected in exon 3 of the HPRT gene
in our study, strongly suggesting that no nucleosome structure is present in this region.
Our data do not exclude the possibility that the nucleosome structure is not single-phased
(Zhang et al., 1983; Zhang and Horz, 1984), and therefore no clear nucleosome structure
can be detected. But multiphased nucleosomes cannot account for the observed difference
in the pattern of BPDE adduct formation at the region of six guanines in vivo compared
to that seen in vitro, since this region should not always be located at the terminal end
of a nucleosome.

Our ﬁnding of a similar pattern of binding among cells at metaphase and the other
phases of the cell cycle indicates that the highly folded chromosomal structure has little
effect on the accessibility of the genomic DNA to BPDE. Pfeifer and Riggs have shown
that the chromosomal structure has no effect on the modiﬁcation of DNA by DMS
(1991), suggesting that the free space between the condensed chromosome structure is big
enough to allow small molecules such as DMS to diffuse without difficulty. The
molecular weight of BPDE is 301 Da, only 2.4 times that of DMS. Therefore, it is not
surprising that BPDE is also small enough to diffuse freely through the chromosomal
coils.

We showed that the DNA was selectively adducted by BPDE, i.e., that adducts formed
at some sites signiﬁcantly more frequently than at other sites, and that the pattern of
relative distribution of BPDE adducts was very similar for DNA exposed to BPDE in vivo
or in vitro. This ﬁnding strongly suggests that the potential to form covalent BPDE

adducts is, for the most part, determined by the local DNA sequence and remains the

133

same under different physiological conditions. No predictable pattern of modiﬁcation
could be found at either single guanine sites or guanine dinucleotide sites. However, we
did ﬁnd that the region of six consecutive guanines was a hot spot for BPDE adduct
formation with preference for binding to guanines at the 5' end of the nm. This result is
consistent with what has been observed by other groups (Thrall et al., 1992; Boles and
Hogan, 1986; Dittrich and Krugh, 1991), suggesting that a long run of Gs adopts a special
conformation favoring the BPDE adduct formation in this speciﬁc manner. It has been
shown that poly d(G) ' poly d(C) DNA can adopt a special DNA conformation similar to
that of the conventional A-DNA (Amott and Selsing, 1974; Wang et al., 1982). The
present study showed that, except at the region of six consecutive guanines, UvrABC can
excise BPDE adducts in exon 3 of the HPRT gene with close to 100% efficiency. This
further supports our hypothesis that the DNA conformation at this region is unique.

A particularly intriguing result is our ﬁnding that the potential for BPDE adduct
formation at this "hot spot" was strongly enhanced in vivo compared to that in vitro, and
that this enhancement was constant across the cell cycle. No nucleosome structures or
other protein-DNA interactions were found to account for the observed enhancement.
Since we did a direct comparison between cellular DNA treated in vivo, which exists in
a physiological microenvironment of the nucleus, and puriﬁed genomic DNA treated in
vitro, which was dissolved in TE buffer (pH8.0), we attribute the enhancement observed
in vivo to the special conditions in the nucleus.

A variety of ions, organic molecules and macromolecules exist in the nucleus, making

it a totally different environment than that provided by TE buffer. The presence of Mg2+

134

and Ca2+ has been shown to cause a low-temperature structural transition in the loop of
a DNA analog of the yeast tRNA anticodon (Guenther et al., 1992) and to make DNA
with a poly d(G)' poly d(C) tract adopt a non-B DNA structure (Kohwi, 1989). Na+ and
K” can induce structural transitions in oligonucleotides containing four repeats of a
telomeric d(G) rich sequence to a folded conformation with G-G base pairs (Raghurarna
and Cech, 1990). Therefore, these factors might cause conformational transitions in DNA
located in the nucleus of the cell. Although our data indicate that this nuclear
environment had no effect on the relative distribution of BPDE adducts at the majority
sites in the nontranscribed strand of exon 3 of the human HPRT gene, it might be
expected to affect the noncovalent intercalation and subsequent covalent binding of BPDE
at certain sites, such as a region of poly d(G)s. It is very likely that the same factors that
account for the hot spot in vitro are strongly enhanced in vivo and responsible for the
even more pronounced BPDE adduct formation at this site in vivo. We suggest that the
local DNA conformation changes to favor more BPDE intercalation and more BPDE
covalent binding at this site. Evidence supporting this hypothesis is the fact that the
selective modiﬁcation by BPDE of guanines at the 5' end of this polyd(G) region in vitro,
i.e., BPDE adduct level being highest at nucleotide 207 (5' end) and gradually decreasing
to the lowest at nucleotide 212 (3' end), was observed to occur in almost the same manner
in vivo. The consistent binding pattern in this region across the cell cycle indicates that
this contributing effect remained constant throughout every phase.

Our LMPCR data compare the relative distribution of BPDE adducts in vivo and in

vitro, but cannot be used to compare the absolute ﬁ'equency of BPDE adducts formed in

135

DNA. Therefore it is always possible that the observed enhancement at the region of six
guanines in vivo reﬂects a general inhibition of BPDE adduct formation at the other
guanines of exon 3 in vivo. However, this is unlikely since no nucleosomal structures
or other protein-DNA interactions were found to produce such inhibition. It is also highly
unlikely that a particular factor can inhibit BPDE adduct formation at virtually every site
of the genomic DNA while still keeping the relative distribution pattern untouched.
Therefore, we favor the hypothesis that the region of six consecutive guanines is

particularly favorable to adduct formation by BPDE.

l 3 6
ACKNOWLEDGEMENTS

We thank Dr. Pieter van de Putte at Leiden University (Leiden, the Netherlands) for
kindly providing UvrABC excinuclease. This work was supported by DHHS grants

CA56796 and CA21253 from NCI.

137
REFERENCES

Amott, S. & Selsing, E. 1974. The structure of polydeoxyguanylic acid with
polydeoxycytidylic acid. J. Mol. Biol. 88, 551-552.

Baird, W.M.& Diamond, L. 1977. The nature of benzo(a)pyrene-DNA adducts formed in
hamster embryo cells depends on the length of time of exposure to benzo(a)pyrene.
Biochem. Biophys. Res. Commun. 77, 162-167.

Boles, T.C.& Hogan, ME. 1986. High-resolution mapping of carcinogen binding sites on
DNA. Biochemistry 25, 3039-3043.

Chen, R.-H., Maher, V.M.& McCormick, J.J. 1990. Effect of excision repair by diploid
human ﬁbroblasts on the kinds and locations of mutations induced by (:)-7B,8a-
dihydroxy-9a,l0a-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene in the coding region of the
HPRT gene. Proc. Natl. Acad. Sci. USA 87, 8680-8684.

Chen, R.-H., Maher, V.M.& McCormick, J.J. 1991. Lack of a cell cycle-dependent strand
bias for mutations induced in the HPRT gene by (i)-7B,8a-dihydroxy-9a,lOct-epoxy-

7,8,9,10-tetrahydrobenzo(a)pyrene in excision repair deﬁcient human cells. Cancer Res.
51, 2587-2592.

Chen, R.-H., Maher, V.M.& McCormick, J.J. 1992. Preferential repair andd strand
speciﬁc repair of benzo(a)pyrene diol epoxide adducts in the HPRT gene of diploid
human ﬁbroblasts. Proc. Natl. Acad. Sci. USA 89, 5413-5417.

Dittrich, K.A.& Krugh, TR. 1991. Mapping of (i)-anti-benzo(a)pyrene diol epoxide
adducts to human-Ha-rasl protooncogene. Chem. Res. Toxic. 4, 227-231.

Grimaldi, K.A., McAdam, S.R.& Hartley, J.A. 1994. DNA damage by anti-cancer agents
resolved at the nucleotide level of a single copy gene: evidence for novel binding site for
cisplatin in cells. Nucleic Acids Res. 22, 2311-2317.

Grosovsky, A.J.& Little, J.B. 1983. Mutagenesis and lethality following S-phase
irradiation of xeroderma pigmentosum and normal human diploid ﬁbroblasts with
ultraviolet light. Carcinogenesis 4, 1389-1393.

Grossmann, A., Maher, V.M.& McCormick, J.J. 1985. The frequency of mutants in
human ﬁbroblasts UV-irradiated at various times during S-phase suggests that genes for
thioguanine- and diphtheria toxin- resistance are repaired early. Mutat. Res. 152, 67-76.

Guenther, R.H., Hardin, C.C., Sierzputowska-Gracz, H., Dao, V. & Agris, PF. 1992. A
magnesium-induced conformational transition in the loop of a DNA analog of the yeast
tRNA (Phe) antocodon is dependent on RNA-like modiﬁcations of the bases of the stem.

138
Biochemistry 31, l 1004-11011.

Kohwi, Y. 1989. Non-B DNA structure: preferential target for the chemical carcinogen
glycidaldehyde. Carcinogenesis 10, 2035-2042.

Konze-Thomas, B., Hazard, R.M., Maher, V.M. & McCormick, J.J. 1982. Extent of
excision repair before DNA synthesis determines the mutagenic but not the lethal effect
of UV-irradiation. Mutat. Res. 94, 421-434.

Lee, M.S.& Garrand, W.T. 1991. Transcription-induced nucleosome "splitting": an
underlying structure for DNaseI sensitive chromatin. Embo J.l0, 607-615.

MacLeod, MC. 1990. The importance of intercalation in the covalent binding of
benzo(a)pyrene diol epoxide to DNA J. Theor. Biol. 142, 113-122.

MacLeod, M.C. & Selkirk, J.K. 1982. Physical interactions of isomeric benzo(a)pyrene
diol-epoxides with DNA. Carcinogenesis 3, 287-292.

MacLeod, M.C.& Zachary, Z. 1985. Catalysis of carcinogen-detoxiﬁcation by DNA:
Comparison of enantiomeric diol epoxide. Chem. -Biol. Interact. 54, 45-55.

Marquardt, H., Grover, P.L. & Sims, P. 1976. In vitro malignant transformation of mouse
ﬁbroblasts by non-K-region dihydrodiols derived from 7-methylbenz(a)anthracene, 7,12-
dimethylbenz(a)anthracene, and benzo(a)pyrene. Cancer Res. 36, 2059-2064.

McCormick, J .J . & Maher, V.M. 1981. in DNA repair: A Laboratory Manual of Research
Procedures. eds. Friedberg, E.C.& Hanawalt, P.C. (Dekker, New York), Vol.1B, 501-
521.

Mueller, P. & Wold, B. 1989. In vivo footprinting of a mouse speciﬁc enhancer by
ligation mediated PCR Science 246, 780-786.

Pedrali-Noy, G., Spadari, S., Faures, A., Miller, A.O.A, Kruppa, J.& Koch, G. 1980.
Synchronization of Hela cell cultures by inhibition of DNA polymerase alpha with
aphidocolin. Nucleic Acids Res. 8, 377-387.

Pfeifer, G.P.& Riggs, AD. 1991. Chromatin differences between active and inactive X
chromosome revealed by genomic footprinting of permeabilimd cells using DNaseI and
ligation mediated PCR. Genes & Dev. 5, 1102-1113.

Pfeifer, G.P.& Riggs, AD. 1993. in Methods in Molecular Biology, vol.15: PCR
protocols: Current Methods and Applications, 153-168.

Pfeifer, G.P., Steigerwald, S.D., Mueller, P.L., Wold, B. & Riggs, A. 1989. Genomic

139

sequencing and methylation analysis by ligation mediated PCR. Science 246, 810-813.

Pfeifer, G.P., Drouin, R., Riggs, A.D.& Holmquist, G.P. 1992. Binding of transcription
factors creats hot spots for UV photoproducts in vivo. Mol. Cell. Biol. 12, 1798-1804.

Powers, J.H.& Bina, M. 1991. In vitro assembly of a positioned nucleosome near the
hypersensitive region in simian virus 40 chromatin J. Mol. Biol. 221, 795-803.

Raghuraman, N.K. & Cech, TR. 1990. Effect of monovalent cation-induced telomeric
DNA structure on the binding of oxytrichia telomeric protein. Nucleic Acids Res. 18,
4543-4552.

Seeberg, E., Steinium, A.L., Nordenskjoid, N., Soderhaus, S.& Jerstrom, B. 1983. Strand-
break formation in DNA modiﬁed by benzo(a)pyrene diol epoxide. Quantitative cleavage
by Escherichia coli UvrABC endonuclease. Mutat. Res. 112, 139-145.

Sele, B., Jalbert, P., van Cutsern, B., Lucas, M., Mouriquard, C.& Bouchez, R. 1977.
Distribution of human chromosomes on the metaphase plate using banding techniques.
Hum. Genet. 39, 39-61.

Slaga, T.J., Brachen, W.J., Gleason, G., Levin, W., Yagi, H., Jerina, D.M.& Conney, AH.
1979. Marked differences in the skin tumor-initiating activities of the optical enantiomers
of the diastereomeric benzo(a)pyrene-7,8-diol-9,10-epoxides. Cancer Res. 39, 67-71.

Smith, B.L.& MacLeod, MC. 1993. Covalent binding of the carcinogen benzo(a)pyrene
diol epoxide to Xenopus laevis SS DNA reconstituted into nucleosomes. J. Biol. Chem.
268, 20620-20629.

Tang, M., Pierce, J.R., Doisy, R.P., Nazimiec, M.E.& MacLeod, MC. 1992. Difference
and similarities in the repair of two benzo(a)pyrene diol epoxide isomers induced DNA
adducts by uvrA, uvrB and uvrC gene products. Biochemistry 31, 8429-8436.

Thrall, B.D., Mann, D.B., Smerdon, M.J.& Springer, D.L. 1992. DNA polymerase, RNA
polymerase and exonuclease activation on a DNA sequence modiﬁed by benzo(a)pyrene
diol epoxide. Carcinogenesis 13, 1529-1534.

van Houten, B., Masker, W.E., Carrier, W.L.& Regan, JD. 1986. Quantitation of
carcinogen-induced DNA damage and repair in human cells with the UVRABC excision
nucclease from Escherichia coli. Carcinogenesis 7, 83-87.

Wang, A.H., Fujii, S., van Boom, J.H. & Rich, A. 1982. Molecular structure of the
octamer d(GGCCGGCC): modiﬁed A-DNA. Proc. Natl. Acad. Sci. USA 79, 3968-3972.

Watanabe, M., Maher, V.M.& McCormick, J.J. 1985. Excision repair of UV- or

140

benzo(a)pyrene diol epoxide- induced lesions in xeroderma pigmentosum variant cells is
"error-free". Mutat. Res. 146, 285-294.

Wei, D., Maher, V.M. & McCormick, J.J. 1995. Site-speciﬁc rates of excision repair of
benzo(a)pyrene diol epoxide adducts in the hypoxanthine phosphoribosyltransferase gene
of human ﬁbroblasts: Correlation with mutation spectra. Proc. Natl. Acad. Sci. USA 92,
2204-2208.

Weinstein, I.B., Jefferey, A.M., Jennette, K.W., Blobstein, S.H., Harvey, R.G., Harris, C.,
Autrup, H., Kasai, H. & Nakanishi, K. 1976. Benzo(a)pyrene diol epoxides as
intermediates in nucleic acid binding in vitro and in vivo. Science 193, 592-595.

Yang, J.-L., Maher, V.M. & McCormick, J.J. 1987. Kinds of mutations formed when a
shuttle vector containing adducts of (:)-7B,8a-dihydroxy-9a,1001-epoxy-7,8,9,10-
tetrahydrobenzo(a)pyrene replicates in human cells. Proc. Natl. Acad Sci. USA 84, 3787-
3791.

Zhang, X.Y. & Horz, W. 1984. Nucleosomes are positioned on mouse satellite DNA in
multiple highly speciﬁc frames that are correlated with a diverged subrepeat of nine base-
pairs. J. Mol. Biol. 176, 1105-129.

Zhang, X.Y., Fittler, F.& Horz, W. 1983. Eight different highly speciﬁc nucleosome
phases on alpha-satellite DNA in the African green monkey. Nucleic Acids Res. 11, 4287-
4306.

_. . ’.-f‘- W.,...‘_a._,._-__..__ _.. . ..

   

"lllllllllillllllf