THE ROLE OF ARABIDOPSIS ACTIN DEPOLYMERIZING FACTOR 4 IN IMMUNE
SIGNALING AND GENE EXPRESSION
By
Katie Porter

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
Cell and Molecular Biology - Doctor of Philosophy
	
  

2014

ABSTRACT
THE ROLE OF ARABIDOPSIS ACTIN DEPOLYMERIZING FACTOR 4 IN IMMUNE
SIGNALING AND GENE EXPRESSION
By
Katie Porter
Arabidopsis thaliana actin-depolymerizing factor 4 (AtADF4) is a member of the over 75
characterized actin binding proteins (ABPs) including the 11 ADFs in Arabidopsis. As an
ADF, AtADF4 has been shown to possess many of the biochemical and cellular
functions associated with its role in the modification and regulation of the actin
cytoskeleton. The collective works of numerous studies over the past few decades have
demonstrated that ADFs from both plants and animals bind, sever, and/or depolymerize
the aging pointed ends of filamentous actin. In the present study, I demonstrated that
AtADF4 also contributes to a cellular function that has not previously been shown. In
brief, the current body of work shows that AtADF4 specifically is required for the
resistance of Arabidopsis when infected with Pseudomonas syringae pv. tomato
expressing the bacterial effector AvrPphB, a cysteine protease known to target
components of the immune-signaling responsible for recognition of non-self. While it is
apparent that AtADF4 is required for resistance to Pst AvrPphB, the exact mechanism
by which loss of AtADF4 (adf4) results in enhanced susceptibility remains largely
unknown. Plant immunity is often achieved through recognition of bacterial effectors by
a cognate resistance gene (R-gene). The R-gene of Arabidopsis that confers resistance
to Pst AvrPphB is resistance to Pseudomonas syringae-5 (RPS5). Analysis of the
expression of known R-genes of Arabidopsis in adf4 revealed a significant reduction in
the expression of RPS5 while expression of other R-genes was not affected. Mitogen-

activated protein kinase (MAPK) activation was examined in adf4 for the ability to
recognize non-self through the pattern recognition receptor flagellin-sensitive 2 (FLS2)
in the presence of AvrPphB. It was found that MAPK activation was reduced specifically
in the adf4, while MAPK-signaling was not affected in the wild-type Col-0 or the rps5
mutant. The reduction of MAPK activation in adf4 but not rps5 suggests that in addition
to regulating the expression of RPS5, AtADF4 also plays a role in FLS2-MAPK signaling
in the presence of AvrPphB. The loss of resistance to Pst AvrPphB could be alleviated
in adf4 when complemented with the serine-6 phosphorylation mimic AtADF4S6D.
Although phosphorylation of serine-6 of plant ADFs is often associated with a reduced
affinity for the actin cytoskeleton and is considered the inactive form of ADF,
phosphorylation of serine-6 is in fact required for the immune-related functions of
AtADF4. Establishment of the correlation of AtADF4 phosphorylation at serine-6 and
resistance led to the examination of AtADF4 for additional unique biochemical features
that may be related to immunity. Comparison of AtADF4 with its closest homologue
AtADF1 revealed potential motifs of AtADF4 that may contribute to immune signaling,
including phosphorylation of an additional residue, tyrosine-53. Interestingly, other
recent examples of ADFs being required for immunity support these predictions. Taken
together, the data presented herein identify the components of the immune response to
which AtADF4 is associated, including the regulation of gene expression and
recognition of non-self. These results provide a foundation for further defining the
biochemical properties of AtADF4’s role(s) in immune signaling.

I would like to dedicate this dissertation to my husband, Joe and my son, Xavier.
You two have given me the motivation to be my best.
	
  

	
  

iv	
  

ACKNOWLEDGEMENTS

I would like to thank Brad Day for all of the help and encouragement throughout my
entire PhD career. When I joined the lab I knew nothing about the physiology of plants,
as was evident when I asked about “soil containment units”, but now I feel confident in
considering myself a plant molecular biologist. Aside from teaching me scientific
principles, Brad patiently guided me through the process of scientific writing, for which I
am grateful. I would also like to thank all of the Day lab members, past and present, for
dealing with my crazy, it takes a special group of people to handle me when I’m off on a
wild tangent. I am happy to take a part of all of the Day lab members with me in my
future endeavors. I would specifically like to thank Dr. Miaoying Tian for her initial work
on the AtADF4 project.

I would also like to thank my committee members; Dr. Sheng Yang He, Dr. Beronda
Montgomery, Dr. Federica Brandizzi, and Dr. Karen Friderici, for helping keep me on
track and hearing out my ideas and making great suggestions for my research.

I want to thank the National Science Foundation (IOS-1021044), for supporting the actin
project and allowing for collaborations with Dr. Jeff Chang and Dr. Chris Staiger.

I want to thank my parents for continuously supporting me to get my PhD and even
though they may not have understood what I was talking about when I called to tell
them about a result or miss-step taking the time to listen and encourage me.

	
  

v	
  

I also want to thank my husband, who with his amazing family kept me grounded
throughout this entire process. I could not have imagined that when I started my PhD I
would get married, get a dog and have a child along the way. Thank you for not letting
me forget about life, and showing me how to love life as much as I love science.

	
  

vi	
  

TABLE OF CONTENTS

LIST OF TABLES……………………………………………………………………………….x
LIST OF FIGURES……………………………………………………………………………..xi
KEY TO ABBREVIATIONS…………………………………………………………………..xiii
CHAPTER 1: Assembly, regulation, and pathogen targeting of the plant actin
cytoskeleton……………………………………………………………………………………...1
Abstract…………………………………………………………………………………..2
Introduction………………………………………………………………………………3
Assembly and regulation of the actin cytoskeleton………………………………….5
Actin dependent cytosolic-plasma membrane connectivity: preformed
connections as targets and barriers of pathogenesis……………………………….7
Passport control: hijacking endomembrane transport………………………8
Plasma membrane – cell wall connectivity………………………………….11
Pathogen perception and receptor dynamics…………………………........13
Actin and guard cells movement: controlling entry to the apoplast……....14
Involvement of actin cytoskeleton in immunological signaling: a dynamic target of
pathogens………………………………………………………………………………15
Stochastic dynamism of basal immunity and the actin cytoskeleton…….16
Effectors effects on actin and immunity………………………………….....18
Toxic targeting of the actin cytoskeleton…………………………………….21
Pathogen targeting of the eukaryotic cytoskeleton in mammalian systems.........23
Actin’s role in nuclear reprograming: a potential for pathogens to gain control of
host gene expression...……………………………………………………………….26
What role(s) does actin play in the nucleus?............................................26
Are ABPs nuclear localized, and if so, what are their nuclear functions...27
How prevalent is F-actin in the nucleus and what is the role of F-actin
within the nucleus?...................................................................................30
Is there any pathogen that targets nuclear actin or ABPs to enhance
virulence?..................................................................................................31
Final Thoughts…………………………………………………………………………33
CHAPTER 2: Arabidopsis Actin-Depolymerizing Factor-4 Links Pathogen Perception,
Defense Activation and Transcription to Cytoskeletal Dynamics…………………………35
Abstract…………………………………………………………………………………36
Author Summary……………………………………………………………….37
Introduction……………………………………………………………………………..38
Results……………………………………………………………………...................42
ADF4 is required for RPS5 expression……………………………………...42
The virulence activity of AvrPphB blocks MAPK signaling in adf4…….....47

	
  

vii	
  

Phosphorylated ADF4 is required for RPS5 expression and subsequent
activation of resistance………………………………………………………..55
Phosphorylation of ADF4 reduces its co-localization with F-actin, but does
not influence nuclear targeting……………………………………………….60
Discussion…………………………………………………………............................64
Methods and Materials…………………………………………………....................70
Plant growth, transformation, and bacterial growth assays……………….70
Plasmid construction…………………………………………………………..72
Nuclei isolation and immunocytochemistry……………………………........72
Laser-scanning confocal microscopy and co-localization analysis…........73
RNA isolation and qRT-PCR analysis……………………………………….73
Statistical analysis……………………………………………………………..74
Immunoblot analysis…………………………………………………………..75
Acknowledgements……………………………………………………………………76
CHAPTER 3: In silico comparison of Arabidopsis thaliana actin depolymerizing factors
AtADF1 and AtADF4 identify subtle biochemical features that support their distinct
cellular functions……………………………………………………………………………….77
Abstract…………………………………………………………………………………78
Introduction…………………………………………………………………................79
Results………………………………………………………………………………….87
Arabidopsis actin depolymerizing factor-4 and -1 are highly homologous,
yet the mutant plants adf1 and adf4 have differing disease phenotypes..87
In silico analysis of differing amino acids in AtADF1 and AtADF4 that may
account for the unique cellular function of AtADF4………………………...88
Phosphorylation prediction software reveals potential differing secondary
phosphorylation site(s) between AtADF1 and AtADF4…………………....91
Comparison of AtADF4 and AtADF1 with other plant ADFs………………96
Discussion…………………………………………………………………………….104
Methods and Materials………………………………………………………………108
Arabidopsis thaliana ADF protein sequence alignment and ADF4
homology model construction………………………………………………108
Prediction of tolerance of amino acid substitutions and phosphorylatable
residues……………………………………………………………………….109
Plasmid construction and cloning…………………………………………..109
Plant growth and Arabidopsis transformation……………………………..110
RNA extraction and qRT-PCR………………………………………………110
Quick change PCR………………………………………………………......111
CHAPTER 4: Conclusions and Future Directions………………………………………...113
Conclusions…………………………………………………………………………...114
Future Directions……………………………………………………………………..119
Methods and Materials………………………………………………………………130
Plasmid construction and cloning…………………………………………..130
Plant growth and transient Nicotiana benthamiana transformation….....131
RNA extraction and qRT-PCR………………………………………………132

	
  

viii	
  

APPENDIX……………………………………………………………………………………133
LITERATURE CITED………………………………………………………………………..142

	
  

ix	
  

LIST OF TABLES

Table 1.1. Pathogen virulence factors that specifically target the host cytoskeleton,
actin, and/or actin binding proteins…………………………………………………………..10
Table 2.1 Microscopy overlay equations……………………………………………….......74
Table 2.2 List of primers………………………………………………………………………75
Table 3.1. Amino acid substitutions of AtADF1 and AtADF4……………………………..89
Table 3.2. List of protein constructs and their predicted ability to complement the adf4
mutant for expression of RPS5 and resistance to Pst AvrPphB……………...................90
Table 3.3. Predicted phosphorylation residues of AtADF1 and AtADF4……………......93
Table 3.4. Cofilin 1 phosphorylation prediction…………………………………………….94
Table 3.5. List of phosphorylation-related protein constructs and their predicted ability to
complement the adf4 mutant for expression of RPS5 and resistance to Pst AvrPphB..96
Table 3.6. Amino acid substitutions of AtADF1, AtADF4, TaADF7 and AtADF9 around
regions predicted to be involved in actin binding…………………………………………101
Table 3.7. List of primers used for cloning…................................................................111
Table 4.1. List of primers……………………………………………………………………131

	
  

x	
  

LIST OF FIGURES

Figure 1.1. Schematic of actin remodeling in the plant cell………………………………..4
Figure 1.2. Examples of preformed cellular functions of the actin cytoskeleton utilized in
defense signaling and targeted by pathogens……………………………………………….9
Figure 1.3. Direct targeting of the actin cytoskeleton by pathogens to enhance
virulence………………………………………………………………………………………...17
Figure 1.4. Nuclear involvement of the actin cytoskeleton in gene expression and it’s
targeting by plant pathogens…………………………………………………………………29
Figure 2.1. ADF4 is required for RPS5 mRNA accumulation and resistance to
Pseudomonas syringae expressing the cysteine protease effector AvrPphB…………..43
Figure 2.2. ADF4 expression does not change during the course of infection with
Pseudomonas syringae expressing AvrPphB………………………………………………44
Figure 2.3. Expression of 35S:RPS5-sYFP in adf4 recovers the Hypersensitive
Response……………………………………………………………………………………….45
Figure 2.4. The adf4 mutant does not have altered expression of other resistance
genes……………………………………………………………………………………………46
Figure 2.5. Flg22-induced receptor kinase 1 expression in the adf4 mutant is reduced
when the effector protein AvrPphB is expressed in planta………………………………..48
Figure 2.6. adf4 mutants are sensitive to fl22 in root length assay……………………...49
Figure 2.7. Expression of RPS5 mRNA is not affected by treatment with flg22, or by
inoculation with the hrpH- mutant of Pseudomonas syringae………………………….....50
Figure 2.8. Both Col-0 and adf4 have induced FRK1 expression when treated with
elf18……………………………………………………………………………………………..52
Figure 2.9. Increased FRK1 expression in Col-0 and adf4 when challenged by Pst
AvrPphB-C98S, and HR phenotypes in Col-0, adf4, and rps5-1…………………………53
Figure 2.10. Mitogen Activated Protein Kinase (MAPK) phosphorylation is reduced in
the adf4 mutant in the presence of AvrPphB ………………………………………………54
Figure 2.11. Estradiol-inducible expression of avrPphB in Col-0, adf4 and rps5-1……56

	
  

xi	
  

Figure 2.12 Phosphorylation of ADF4 is required for RPS5 mRNA expression………..57
Figure 2.13. RPS5 mRNA expression in additional adf4/35S:ADF4_S6A and
adf4/35S:ADF4_S6D lines confirm observed RPS5 expression is not due to positional
effects of the transgene nor disproportionate levels of protein levels of protein
expression………………………………………………………………………………………59
Figure 2.14. FRK1 expression in adf4/35S:ADF4_S6A and adf4/35S:ADF4_S6D lines
confirm link between RPS5 expression and FRK1 in the presence of Pseudomonas
syringae expressing AvrPphB………………………………………………………………..60
Figure 2.15. Confocal microscopy demonstrates phosphorylation of ADF4 affects
cytoskeletal localization, but not nuclear localization………………………………………62
Figure 2.16. Proposed model illustrating the virulence and avirulence function of the
bacterial cysteine protease AvrPphB through an ADF4-dependent mechanism……….65
Figure 3.1. Structural comparison and sequence alignment of AtADF1 and AtADF4…82
Figure 3.2. Expression of resistance to Pseudomonas syringae-5 in AtADF1 mutant
(adf1) and AtADF4 mutant (adf4) as compared to wild-type Col-0.……………………...88
Figure 3.3 Sequence alignments of AtADF1, AtADF3, AtADF4 and TaADF7……........98
Figure 3.4 Sequence alignments of actin binding regions of AtADF1, AtADF4, AtADF9
and TaADF7…………………………………………………………………………………..100
Figure 3.5. Alignment of 11 rice Actin depolymerizing factors (OsADFs) and AtADF1
and AtADF4…………………………………………………………………………………...103
Figure 4.1. RPS5 mRNA expression is reduced in the Act2 OE2 line and act2
mutant……………………………………………………………………………………........124
Figure 4.2. Nuclear localization mutants transiently expressed in Nicotiana
benthamiana……………………………………………………………………………….....125
Figure A.1. Working hypothesis for the modulation of host resistance and cell signaling
through control of actin cytoskeletal dynamics………….………………………………...141

	
  
	
  

	
  

	
  

xii	
  

KEY TO ABBREVIATIONS
	
  
	
  
	
  
AtADF4

Arabidopsis thaliana Actin depolymerizing factor 4

AvrPphB

Pseudomonas syringae bacterial effector

RPS5

Resistance to Pseudomonas syringae-5

PAMP

Pathogen associated molecular pattern

PTI

(PAMP)-triggered immunity

ETI

Effector triggered immunity

FLS2

Flagellin sensitive-2

FRK1

Flg22-induced receptor like kinase 1

	
  

xiii	
  

CHAPTER 1

Assembly, regulation, and pathogen targeting of the plant actin cytoskeleton

Alex Corrion; Michigan State University Graduate program in Plant Pathology;
contributed the image of the actin cytoskeleton used in Figure 1.3.

	
  

1	
  

Abstract

Actin is required for numerous eukaryotic processes, inducing development, movement,
gene expression, signal transduction, and response to stress. In recent years, studies in
plants and animals have identified and characterized the role of the actin cytoskeleton in
each of these processes, demonstrating both the requirement of, and potential for actin
as a key component of cellular signaling. Collectively, these studies have demonstrated
that the activity and organization of the actin cytoskeleton underpins the function of
numerous cellular processes, providing further strong support for the hypothesis that the
actin cytoskeleton functions as a key cellular hub. In recent years, advances in
genomics and cell biology have enabled the elucidation of the mechanisms that drive
the dynamic changes in host cytoskeletal architecture. For example, quantitative cell
biology-based approaches of living cells during development, pathogen infection, and
cell movement have not only helped define the critical cellular processes that are
required for signaling, but have enabled the discovery of environmental (biotic and
abiotic) stimuli that influence host cytoskeletal dynamics. In this chapter I will highlight
key advances that have enabled a better understanding of the regulation and activity of
the eukaryotic actin cytoskeleton, focusing on the role of actin as a signaling and
surveillance platform.

	
  

2	
  

Introduction

The eukaryotic actin cytoskeleton is a dynamic network whose activity is governed by
spatial and organizational changes in monomeric globular (G)- and filamentous (F)-actin
(Day et al., 2011). As a tightly regulated component of cell architecture and signaling –
with more than 200 actin binding proteins (ABPs) described in mammals, and nearly 75
in plants – actin has been demonstrated to be required for the activity and function of a
diverse suite of cellular processes. In brief, these can include cell elongation and
division (Barrero et al., 2002), polarity and movement (Blanchoin et al., 2014),
endocytosis and vesicle trafficking (Robertson et al., 2009; Johnson et al., 2012;
Mooren et al., 2012), gene expression (Percipalle, 2013), and immunity (Tian et al.,
2009; Day et al., 2011; Porter et al., 2012; Henty-Ridilla et al., 2014). Underpinning
each of these processes is the expression, regulation, and activity of the ABP
superfamily, collectively required for a wide variety of actin remodeling processes,
including nucleation, polymerization and elongation, cross-linking and branching, and
depolymerization (Winder & Ayscough, 2005; Uribe & Jay, 2009; Figure 1.1).

Given its ubiquity, stochastic behavior, and functional association with numerous
cellular processes, the actin cytoskeleton can be viewed as the ideal surveillance
platform. In this review, we focus on the assembly, regulation, and activity of key cellular
processes in plants whose functions rely on the dynamism of the eukaryotic actin
cytoskeleton. Additionally, as a means to describe the regulation of these processes in
response to external and developmental stimuli, we will highlight a growing body of	
  

	
  

3	
  

!"#$%&#'()#$(!*)#+,&#'(
/)(()*!
",0123!
4"/526%"7!

-./.*&#'0$.12%34.*&5)6&2#(
!!!!!!!!!!!!!!"#$!
!!!!!!!!!!!!!!%&'()*!!!

12%34.*&5)6&2#0(
.%2#')6&2#(
+,&'()*!
$&,-)*.!

*.+,)*'&#'(
%"+!

-.7".-6.*&#'(
+,&'()*!

#"+%.)6&2#(
",0123!
$&,-)*!
%+!

89:;<*"#+!
89:;<*"#+!
$9:;<*!

Figure 1.1. Schematic of actin remodeling in the plant cell. Illustration of the
basic actin cycling that occurs in the plant cell including some of the ~75 actin binding
proteins. Free globular (G-) actin is initially sequestered by profilin in order to both
prevent spontaneous nucleation and elongation, and to incorporate G-actin into
filamentous F-actin in a controlled manner. Nucleation of G-actin is aided by actin
nucleators including: Arp2/3, formins, and capping proteins (CPs). Elongation of Factin occurs at the barbed end, and is achieved through the actions of both formins
and profilin. F-actin can then be bundled and/or branched through the accessory
proteins: vilins and Arp2/3. The aging pointed end of F-actin is then severed or
depolymerized by ADFs allowing for recharging of ADP to ATP by cyclase associated
protein (CAP) for eventual re-incorporation into growing F-actin.
	
  
literature that has collectively demonstrated active targeting of the actin cytoskeleton by
pathogens in plants. It is the ultimate aim of this review to illustrate that through multiple
points of converging function and regulation, actin is an important component of

	
  

4	
  

immunity, defined by both its role as a signaling platform, as well as a key target of
immune subversion by pathogens.	
  

Assembly and regulation of the actin cytoskeleton

The primary building block of the eukaryotic actin cytoskeleton is G-actin, a 42 kDa
ATP-binding protein capable of undergoing spontaneous self-assembly – a process by
which G-actin is added to the barbed ends of existing F-actin filaments (Day et al.,
2011; Figure 1.1). In Arabidopsis there are 10 actin genes, eight of which are expressed
(Meagher et al., 1999; Kandasamy et al., 2002). The actin genes can be divided into
two classes, vegetative and reproductive, and ectopic expression of reproductive actin
variants within vegetative tissues can lead to morphological defects in plant
development (Kandasamy et al., 2002). Actin filament assembly begins with the
formation of a homo-/hetero-trimer complex, a multi-step process referred to as actin
nucleation. Energetically, this is the most expensive step in F-actin formation, and is
influenced by a multitude of factors, including 1) the availability of filament ends, 2) the
size of the G-actin pool, 3) the nucleotide-loaded state of the G-actin monomers, and 4)
the spatial and temporal expression of ABPs. In both plants and mammals, each of
these four steps have been extensively characterized (Day et al., 2011; Mullins &
Hansen, 2013; Lee & Dominguez, 2010; Hussey et al., 2006), and in short, have been
shown to be regulated by the activity of a multi-protein complex referred to as the actinrelated 2/3 (Arp2/3) complex (Campellone & Welch, 2010; Mathur et al., 2003).

	
  

5	
  

Additional actin nucleators have also been identified, and include formin (Chesarone et
al., 2010), capping protein (CP; Huang et al., 2003), and gelsolin (Silacci et al., 2004).

Once nucleation is initiated, trimeric-actin seeds F-actin maturation through a process
known as elongation, a process that requires the addition of

ATP

G-actin to the barbed

plus end of either newly nucleated actin-trimer or to a preformed severed F-actin strand
(Day et al., 2011; Figure 1.1). As the filament matures, ATP hydrolysis, coupled to the
activity of actin depolymerizing factor (ADF) proteins, drives the depolymerization of the
filament at the pointed

ADP

F-actin end. This processes – referred to as “treadmilling” –

results in the directional remodeling of actin through the precise control of both balance
and direction of F-actin formation. In plants, G-actin availability is regulated by three
ABPs: profilin (PRF), an adenylate cyclase-associated protein (CAP), and ADF (Bugyi &
Carlier, 2010; Figure 1.1). As illustrated, PRF, whose activity is responsible not only for
the prevention of spontaneous nucleation, but also the addition of

ATP

G-actin to the

barbed end of F-actin, drives F-actin formation. It is noteworthy that in plants, PRF only
binds ATPG-actin, while the process of nucleotide exchange (i.e., recharging the of ADPGactin monomers) from the pointed ends of F-actin, is performed by CAP (Barrero et al.,
2002). In mammalian systems, however, PRF performs both G-actin sequestration and
nucleotide exchange (Porta & Borgstahl, 2012). Further illustrating the complexity and
tight regulation of this process, as well as the explosive rates of expansion of the
cytoskeletal network, filament elongation occurs from both nucleated actin, as well as
from available preformed actin filaments, which again can be generated through the
severing activities of multiple additional ABPs, including villin/gelsolin (Ono, 2007).

	
  

6	
  

Once nucleated, F-actin exists within the cell in one of two forms: the first, a fine and
highly dynamic singular filament structure, and the second, a thick bundle of multiple
filaments arranged in a stable yet stochastic state (Thomas, 2012). It is hypothesized
that these fine filamentous structures serve as substrates for further integration into
actin bundles, which have been demonstrated to function in organelle movement and in
cellular trafficking via the activity of myosin motors (Akkerman et al., 2011; Day et al.,
2011; Thomas, 2012).

Actin dependent cytosolic-plasma membrane connectivity: preformed
connections as targets and barriers of pathogenesis

The actin cytoskeleton is required for numerous cellular processes, ranging from cell
membrane-associated dynamics (e.g., receptor activation and attenuation; Beck et al.,
2012), to the regulated delivery, as well as secretion, of signals within and from the cell.
We argue that additionally, one of actin’s most important roles is as a dynamic interface
between the cell and the environment. In this role actin has been described as the ideal
surveillance mechanism (Staiger et al., 2009; Lee & Dominguez, 2010; Day et al., 2011;
Smethurst et al., 2013), linking the extracellular matrix of mammalian cells and apoplast
of plants to numerous intracellular processes, such as organelle movement and gene
transcription. Through its function as a surveillance mechanism, actin has been
demonstrated to regulate a plethora of cellular signaling pathways, including those
required for response to injury, infection, development, and environment. It is therefore

	
  

7	
  

not surprising that the actin cytoskeleton, while connecting many facets of cellular
signaling, form and function, would be an ideal target of pathogens.

Passport control: hijacking endomembrane transport

In contrast to mammalian cells where endomembrane organization is dependent upon
microtubules, the plant endomembrane system is largely dependent upon actin and
myosin (Brandizzi & Wasteneys, 2013). Indeed, recent studies have demonstrated that
plant myosin co-fractionates with the endoplasmic reticulum (ER; Yokota et al., 2011),
and that disruption of either the actin cytoskeleton through chemical treatment or
utilization of a myosin tail over expressing line, which competes with intact myosin in
plants, leads to a disruption in ER integrity (Sparkes et al., 2009). Similarly, actin also
plays a role in Golgi body motility and functions in the trans-Golgi network (TGN;
Brandizzi & Wasteneys, 2013). Interestingly, Akkerman et al. (2011) demonstrated a
distinct difference in the motility of Golgi depending upon the state of F-actin i.e.
bundled cortical actin and a more free moving singular microfilament.

While our understanding of the interplay between host endomembrane dynamics and
pathogen invasion is limited, there are two recent reports that highlight the importance
of actin-dependent hijacking of the ER by the plant enveloped virus Tomato spotted wilt
tospovirus (TSVW; Feng et al., 2013; Ribeiro et al., 2013; Figure 1.2.a; Table 1.1). As
an infectious agent, the TSWV membrane envelope is predominantly formed by two
viral glycoproteins, Gc and Gn (Ribeiro et al., 2013). In addition to the membrane

	
  

8	
  

/'012$

98'

:;(<*=2;$

/8'
!"#$

"3)12$

%&$
45%$

#'()*'+$

/8,9$
%063+37*$

!"#$%&'

.8'

(#")*%&+,-./0&'

!,-.$

4-5#"67%&'
12"3%&'

Figure 1.2. Examples of preformed cellular functions of the actin cytoskeleton
utilized in defense signaling and targeted by pathogens. (a.) Actin-dependent
intracellular movement of the Tomato spotted virus wilt tospovirus (TSVW) N-protein.
N-protein of TSVW forms inclusion bodies that then associate with the endoplasmic
reticulum (ER) and are trafficked through the endomembrane system in an actin and
myosin dependent manner. (b.) Involvement of the actin cytoskeleton in the formation
of the cell wall apposition (CWA), a defense related formation of anti-fungal
compounds at the site of fungal penetration. Fungal penetration also signals the
recruitment of actin filaments towards the penetration site. (c.) The actin cytoskeleton
and myosin play key roles in the clathrin-mediated endocytosis (CME) of pattern
recognition receptors including FLS2, which recognizes bacterial flagellin. Inhibition
of either myosin or the actin cytoskeleton results in improper internalization of and
endomembrane trafficking of FLS2.
	
  
envelope,

TSWV

also

synthesizes

a

spherical

viral

particle

consisting

of

ribonucleoproteins, where the single stranded genomic RNA is in tight association with
the nucleoprotein (N-protein; Feng et al., 2013). This work demonstrated that N-protein

	
  

9	
  

Table 1.1. Pathogen virulence factors that specifically target the host
cytoskeleton, actin, and/or actin binding proteins. 	
  

	
  

10	
  

Table 1.1. (cont’d) Pathogen associated molecular pattern (PAMP); Actin
depolymerizing factor 4 (ADF4); Mitogen associate protein kinase (MAPK); Clathrin
mediated endocytosis (CME).	
  
forms cytoplasmic inclusion bodies that associate with and are trafficked along the host
ER in an actin- and myosin-dependent manner. Interestingly, they determined that this
intracellular trafficking, while actin-dependent, functions independently of microtubules.
In parallel, Ribero et al. (2013) came to a similar conclusion, showing that N-protein
trafficking

was

actin-dependent

and

microtubule-independent,

while

further

demonstrating that actin was not required for the assembly of the viral glycoproteins
with N-protein. Taken together, these two studies demonstrate a role for the actin
cytoskeleton in cellular trafficking of the viral proteins, yet not in the formation of the viral
complexes. This is noteworthy, as while there are many examples of enveloped viruses
in the animal kingdom, few have been identified to infect plants. Thus, TSVW
represents an exciting foundation, and case study, for the further analysis of actinendomembrane dynamics and function during host-virus interactions.

Plasma membrane – cell wall connectivity

In addition to the cellular link of the actin cytoskeleton and the endomembrane system,
there is growing evidence of the involvement of two ABPs, formins and profilins, in
actin-plasma membrane (PM)-cell wall connectivity (van Gisbergen & Bezanilla, 2013;
Sun et al., 2013; Figure 1.2.b). Formins posses certain biochemical features that would
make them ideal for connecting the plant cytoskeleton to the plasma membrane; for
example some classes of formins contain a predicted trans-membrane domain, a signal
peptide, and a proline-rich peptide that is hypothesized to interact with proteins within
	
  

11	
  

the cell wall; others still have a phosphate and tension homolog (PTEN)-like domain that
catalyzes and binds phosphoinisotides in the PM (van Gisbergen & Bezanilla, 2013). As
a direct link between the host cytoskeletal network and the plasma membrane, profilin
has been shown to have biochemical properties that would allow for its direct or indirect
interaction with the PM (Sun et al., 2013). In addition to binding actin, profilin can
interact with proline-rich peptides of itself and other proteins including formins, which in
turn interact with the PM, as well as bind phosphoinisotides directly in the PM (Sun et
al., 2013).

The actin cytoskeleton has been shown to play a key role in the formation of cell wall
apposition (CWA), the accumulation of anti-fungal compounds, and resistance to
penetration by fungi (Hardham et al., 2007; Kobayashi & Kobayashi, 2013). Indeed, the
involvement of actin in resistance to penetration is even apparent when the plant is
micro-wounded as a mimic of failed penetration, where treatment with actin
polymerization inhibitor cytochalasin A eliminated the observed penetration resistance
(Kobayashi & Kobayashi, 2013). A study in cultured parsley cells infected with the
oomycete Phytophthora infestans revealed pathogen-induced rearrangement of the
actin cytoskeleton and ABPs. They found that upon attachment and penetration of the
plant cell by the pathogen, the actin cytoskeleton oriented itself towards the area on
infection (Schutz et al., 2006). Additionally, this group demonstrated that the ABP
profilin was also found to locate to the infection site (Schutz et al., 2006; Figure 1.2.b).
This accumulation of profilin to the PM and reorientation of the actin cytoskeleton during

	
  

12	
  

oomycete infection further supports the potential for profilin to connect the actin
cytoskeleton and PM.

Pathogen perception and receptor dynamics

Another interesting example of the link between cellular membranes and the function of
the actin cytoskeleton is the process of clathrin-mediated endocytosis (CME). Originally
defined in yeast (Kaksonen et al., 2003), a growing body of literature in other systems,
including animals and plants, has demonstrated a requirement for several ABPs,
including Arp2/3, CP, and ADFs, for the function of endocytosis (Galletta et al., 2010).
Recent work using mammalian models has described a similar function for CME-actin
cooperation, demonstrating a function for actin as both a filamentous network that not
only links endocytosis and the plasma membrane, but also as a mechanical process
that can alter membrane shape, inducing membrane curvature, hypothesized to be an
early key step in CME (Galletta et al., 2010; Figure 1.2.c).

In plants, a recent study by Beck et al. (2012) dissected the process of the endocytosis
of the immune-related pattern recognition receptor (PRR) flagellin sensing 2 (FLS2),
which recognizes the pathogen associate molecular pattern (PAMP) flagellin or the 22
amino acid peptide flg22, further demonstrating the correlation between the actin
cytoskeleton and endocytosis (Figure 1.2.c). The authors utilized a series of inhibitors in
order to determine to what degree the actin cytoskeleton is involved in endocytosis and
endomembrane trafficking. They found that in contrast to their previous study, treatment

	
  

13	
  

with the actin depolymerization inhibitor latrunculin B (LatB) did not inhibit internalization
of FLS2, but instead LatB impaired the trafficking of the FLS2 endosome, while the
myosin inhibitor, 2,3-butanedione monoxime, inhibited FLS2 endocytosis. Furthermore,
this study demonstrated that use of endosidin 1, an inhibitor of receptor-mediated
endocytosis, both reduced the motility of FLS2 endosomes as well as stabilized actin
filaments. Taken together this study suggests a synergistic function for myosin and the
actin cytoskeleton in the internalization and endomembrane trafficking of FLS2 (Beck et
al., 2012).

Actin and guard cells movement: controlling entry to the apoplast

The actin cytoskeleton has also been implicated in having a role in Arabidopsis guard
cell architecture (Higaki et al., 2010). Higaki and colleagues (2010) utilized confocal
microscopy techniques and cluster analysis to quantitatively analyze cytoskeletal
orientation, as well as actin filament bundling (skewness) and percent occupancy
(density), during diurnal cycles. This group found that the actin cytoskeleton has a radial
orientation when stomata are open, and that actin is transiently bundled during the
stomata opening process, but these bundled actin structures dissolve once the stomata
is opened. Furthermore, it was determined that during the light portion of the day heavy
bundles are present continuously while the stomata remained closed. Taken together
these results suggest a correlation between actin bundling and stomata movement
(Higaki et al., 2010). A recent study has examined the actin orientation of the crop plant
grapevine during leaf infection with various plant pathogens (Guan et al., 2014). This

	
  

14	
  

group treated grapevine leaves with 3 pathogens; Erwinia amylovora, Agrobacterium
tumefaciens, and Agrobacterium vitis, representing true pathogen, non-host pathogen
and host pathogen that does not infect through the leaves respectively, and measured
changes in the actin cytoskeleton of the guard cells. They determined that there was no
change in the skewness of the guard cells inoculated with Erwinia amylovora, but there
were greater than 50% reductions in the skewness of the guard cells inoculated with
either Agrobacterium tumefaciens or Agrobacterium vitis (Guan et al., 2014). These
observed changes in the skewness of actin filaments within the guard cells of grapevine
may be due to elicitors of the pathogens, and suggest a role for the actin cytoskeleton
as an output of pathogen-dependent guard cell re-orientation.

Involvement of actin cytoskeleton in immunological signaling: a dynamic target
of pathogens

Numerous parallels exist between immune signaling in plants and animals (Ausubel,
2005). Broadly, these include the signaling of resistance via receptor-ligand interactions
(Chisholm et al., 2006; Chtarbanova & Imler, 2011), the activation of MAPK cascades
(Rodriguez et al., 2010; Whelan et al., 2011), and the transcriptional reprogramming of
cellular processes associated with cell death and defense (Pandey & Somssich, 2009).
The immune systems of both plants and animals are among the best-defined examples
of biological platforms that function as cell surveillance mechanisms. Indeed, much like
the dynamism of the eukaryotic actin cytoskeleton, immune signaling is tightly
regulated, highly responsive, and is seamlessly integrated with numerous signaling

	
  

15	
  

cascades. In this regard, it is not surprising that the actin cytoskeleton is required for the
function and regulation of immunity.

Stochastic dynamism of basal immunity and the actin cytoskeleton

In plants, immune responses are typically classified based on the characterization of
two primary nodes of defense signaling: PAPM-triggered immunity (PTI) and effectortriggered immunity (ETI; Chisholm et al., 2006). In PTI, perception and activation is
mediated by extracellular recognition of PAMPs (e.g., flagellin, LPS, chitin) by plasma
membrane-localized PRRs. Binding of PAMPs by PRRs initiates downstream signaling,
including the activation of the MAPK signaling cascade, the generation of reactive
oxygen species (ROS), and transcriptional reprogramming of pathogen-responsive
genes (Zhang & Zhou, 2010; Figure 1.3.a). In total, PTI responses appear to be highly
conserved in plants and animals, both in terms of the mode of activation (e.g., receptorligand interactions), as well as with respect to regulation (e.g., MAPK signaling). Several
recent studies have demonstrated the importance of actin – and ABPs – as a
component of PTI signaling cascades (Porter et al., 2012; Henty-Ridilla et al., 2013;
Henty-Ridilla et al., 2014). This is of particular interest, as recent data demonstrate an
increase in density of the actin cytoskeleton in Arabidopsis thaliana cotyledons
inoculated with a myriad of plant pathogens; Pseudomonas syringae pv. tomato
DC3000, Pseudomonas syringae pv. phaseolicola, Agrobacterium tumefaciens, or
Magnaporthe grisea, as well as the purified PAMPs flg22 and chitin (Henty-Ridilla et al.,
2013; Figure 1.3b; Table 1.1). Additionally, the authors demonstrated an enhanced

	
  

16	
  

!"#

$%"#
234%
567%

8&9$/"&,:#)$9+%
&':&)-&9(,$-%

!"#$%&'()*'+,$-%
!;<=%
.)/0%*'1'$/'%
><2%

>A'"0)&/%

8&9$/"&,:#)$9+%
&':&)-&9(,$-%

'"#

&"#

>$*)('(I&9$'%
<B4?%

!;<=%

'+1%?@%

.):GH%

567%

C-%??%

.):GH%

("#

!D&6:EF%

)"#
Figure 1.3. Direct targeting of the actin cytoskeleton by pathogens to enhance
virulence. (a.). Examples of pathogen associated molecular pattern (PAMP)triggered immunity (PTI). Recognition of conserved PAMPs results in a multitude of
cellular signaling, including; formation of reactive oxygen species (ROS), mitogen
associated protein kinase (MPK) activation, transcriptional reprograming, and (b.)
actin remodeling. PTI responses aid in the basal resistance of plants to pathogens.
(c.) The actin depolymerization factor 4 (ADF4) of Arabidopsis has been
demonstrated to play a role in the actin remodeling associated with the PTI response
of the pattern recognition receptor (PRR) EFR, that recognized the peptide elf26. (d.)
Pathogenic effectors are secreted into the host cell in order to target components of
the PTI response that will ultimately reduce the resistance of the plant cell. (e.) The
bacterial effector HopW1 specifically targets actin and alters the endomembrane
trafficking associated with resistance through the actions of both actin and myosin.
(f.) Arabidopsis ADF4 has also been demonstrated to play a role in MPK activation by
the ligand flg22 through the PRR FLS2 specifically when the bacterial effector
AvrPphB is present.
	
  
virulence of Pseudomonas syringae pv. tomato DC3000 in mature plants whose actin

	
  

17	
  

cytoskeleton was disrupted with the pharmacological agent LatB (Henty-Ridilla et al.,
2013). A second study implicated the importance of the ABP ADF4 in PTI responses to
the PAMP elf26 (Henty-Ridilla et al., 2014; Figure 1.3c; Table 1.1). In this study, dark
grown hypocotyls of Arabidopsis were used to examine the changes in actin dynamism
in the adf4 mutant as compared to wild-type plants. It was determined that wild-type
density increased with elf26 and that this increase in density was not observed in the
adf4 mutant (Henty-Ridilla et al., 2014; Figure 1.3.c). Additionally, an increase in actin
filament length, filament lifetime and a decrease in severing frequency were also
observed in the wild-type hypocotyls treated with elf26. These observations were
phenocopied in the adf4 mutant and furthermore, no change of these outputs was
measured in the adf4 mutant with elf26 treatment (Henty-Ridilla et al., 2014). These
collective works open the door to additional studies aimed at defining the role of actin as
a senor and activator of numerous signal transduction cascades.

Effectors effects on actin and immunity

To subvert the host PTI response, pathogens deploy secreted effector proteins (Figure
1.3.d) whose collective activities function to abrogate the host immune responses by
perturbing host cellular processes. To prevent this, hosts have evolved mechanisms to
recognize and respond to pathogen secreted effector proteins. This process, ETI, has
been best-described as an enhanced PTI-like response that is initiated via the direct or
indirect recognition of pathogen effectors by host resistance (R) proteins (Chisholm et
al., 2006). Numerous virulence targets of pathogen effectors identified thus far are

	
  

18	
  

components of PTI signaling pathways – the hypothesis being that targeting of PTI
components can lead to increased growth of the pathogen (Zhang et al., 2010; Zhang &
Zhou, 2010; Figure 1.3.d).

As virulence molecules, effectors from bacterial pathogens of plants induce a wide
range of cellular changes in their host(s), including alterations in transcription,
perturbations in cellular trafficking, as well as the enzymatic targeting of host proteins
required for immunity. Thus, it is not surprising that bacterial effectors have been
identified which target the host actin cytoskeleton for the purpose of blocking immune
signaling. Recently, an effector from Pseudomonas syringae pv. maculicola, HopW1,
was shown to disrupt the actin cytoskeleton, and through this activity, enhance
pathogen virulence (Kang et al., 2014; Figure 1.3.e; Table 1.1). In this study, Kang et
al., 2014 found that the effector HopW1 directly interacts with actin both in vitro and in
vivo. In vitro HopW1 bound to and disrupted actin remodeling, as demonstrated both
through sedimentation assays as well as through confocal visualization techniques.
Experiments in vivo mirrored the in vitro results with reduced bundling of actin as well as
enhanced bacterial growth in planta when infected with Pseudomonas syringae HopW1
similar

to

reduced

bundling

and

enhanced

growth

when

treated

with

the

pharmacological agent LatB (Kang et al., 2014; Figure 1.3.e). Further analysis of the
effects of HopW1 on plant function demonstrated an inhibition of endocytosis and
trafficking to the vacuole, which again can be reproduced with LatB treatment (Kang et
al., 2014; Figure 1.3.e; Table 1.1). Taken together these data suggest HopW1 disrupts

	
  

19	
  

the actin cytoskeleton, which in turn perturb cellular functions including endocytosis and
cellular trafficking to enhance pathogenic virulence.

As a final demonstration of the connection between pathogen effectors, the host actin
cytoskeleton, and the numerous homeostatic processes in plants that require the
activity of actin for their function, the work of Tian et al. (2009) and myself provides
insight into the intimate relationships that underpin the link(s) between cytoskeletal
dynamics and immune signaling. The functional analysis of ADF4 has not only shown
that actin depolymerization is important for immunity, but through a series of
complementary genetic and cell biology-based approaches, has shown that
compromised immune signaling in the adf4 mutant is the result of a drastic reduction in
the expression of the mRNA encoding the resistance protein RPS5. As a mechanism
supporting this function, my work (Porter et al., 2012; Chapter 2) defined that phosphoregulation of ADF4 influences association with actin as well as correlates with the
expression of RPS5. In addition to the actin-binding activity of ADF4, I also
demonstrated that the loss of RPS5 mRNA expression did not fully explain the parallel
reduction in MAPK signaling also observed in the adf4 mutant. It was only in the
presence of the bacterial effector AvrPphB that a reduction in MAPK signaling was
observed (Figure 1.3.f; Table 1.1). Because this loss was not observed in the rps5
mutant in the presence of AvrPphB, these data support a role for ADF4 in the activation
of MAPK signaling. Taken together, these findings offer a unique example of a multilayered interaction of a bacterial effector targeting both PTI and ETI in an actindependent manner. Recently, these works were supported by the observations of Fu et

	
  

20	
  

al., (2013) in the crop plant Triticum aestivum (wheat) where silencing of the three
copies of TaADF7 resulted in an enhanced susceptibility to Puccinia striiformis f. sp.
tritici.

Toxic targeting of the actin cytoskeleton

One of the best-characterized virulence mechanisms of pathogens is the production,
delivery, and site of action of a suite of host-specific toxins. As a class of highly
conserved diffusible compounds, toxins serve many functions during infection, including
roles as long-range signaling molecules, extracellular triggers of host cell lysis, and
internalized inducers of programed cell death. Pathogens of plants, particularly fungi,
have been shown to perturb the homeostatic function of the host actin cytoskeleton
through the delivery of strain-specific elicitors and toxins, presumably as a mechanism
to alter defense signaling, including host-derived secretion of anti-fungal compounds. In
most cases described thus far, these toxins (Table 1.1) have been shown to either
mimic the biochemical activities of eukaryotic ABPs, or more broadly, disrupt the
structure/function of the microfilaments themselves. To date, two well-established
examples of toxin-specific targeting of the host actin cytoskeleton by plant pathogens
have been described. In the first, Yuan et al. (2006) showed that treatment of
Arabidopsis suspension-cultured cells with the toxin from Verticillium dahlia, VD toxin,
induces a dose-dependent response to the broader organization of the cytoskeleton. At
low concentrations, the overall actin filament structure was disrupted; however, changes
to microtubules were not detected. Conversely, at high concentrations of VD toxin, both

	
  

21	
  

actin and microtubule structures were disrupted, suggesting a convergent point of
targeting by V. dahlia, and moreover, implicating both the actin cytoskeleton and the
microtubule network as virulence targets of fungal pathogens.

Lastly, ToxA, from the necrotrophic fungus Pyrenophora tritici-repentis has been shown
to elicit cell death if expressed in either sensitive or insensitive wheat mesophyll cells,
yet is only actively translocated into the cytoplasm of the sensitive wheat cells (Manning
& Ciuffetti, 2005; Table 1.1). What is most striking about ToxA is that it contains an RGD
tripeptide sequence (i.e., Arginine-Glycine-Aspartic acid), which is required for its
function (Meinhardt et al., 2002). This is interesting as the RGD motif is most commonly
associated with the function of mammalian integrins, required for their actin-dependent
association with the extracellular matrix. In plants, it was recently demonstrated that the
immune signaling regulator, non-race specific disease resistance-1 (NDR1), is an
integrin-like protein that plays a role in cell wall-plasma membrane adhesion through the
function of an NGD-like (i.e., Asparagine-Glycine-Aspartic acid) motif (Knepper et al.,
2011). As described above CME is known to involve the actin cytoskeleton, thus, it is
tempting to hypothesize that actin plays a role in the internalization of the ToxA protein
through a yet to be identified extracellular receptor (e.g., integrin-like protein). In total,
this is a nice example of cellular mimicry, whereby the structure-function activity of a
fungal toxin can mimic the endogenous behavior of a cell wall-plasma membrane
process, thereby driving changes in host actin cytoskeletal dynamics for the purpose of
promoting pathogen infection.

	
  

22	
  

Pathogen targeting of the eukaryotic cytoskeleton in mammalian systems

Numerous parallels exist between immune signaling in plants and animals (Ausubel,
2005). Broadly, these include the signaling of resistance via receptor-ligand interactions
(Chisholm et al., 2006; Chtarbanova & Imler, 2011), the activation of MAPK cascades
(Rodriguez et al., 2010; Whelan et al., 2011), and the transcriptional reprogramming of
cellular processes associated with cell death and defense (Pandey & Somssich, 2009).
The specific targeting of the actin cytoskeleton to promote pathogen virulence is another
shared component of plant- and mammalian- pathogen interactions. In this section I will
highlight some key examples of perturbation of the mammalian actin cytoskeleton by
pathogens.

Akin to what has been observed in plants, bacterial toxins have been identified which
can directly modify actin of mammalian cells, as is the case of the Clostridium
botulinium C2 toxin, an actin-ADP-ribosylating exotoxin that causes ADP-ribosylation of
arginine-177 of actin, leading to the inhibition of actin polymerization (Aktories, 2011;
Aktories et al., 2011). Similarly, a second toxin from C. botulinium, C3 toxin, while not
directly targeting actin, instead targets the Rho-family of GTPases, altering cytoskeletal
dynamics, and ultimately phagocytosis (Visvikis et al., 2010). Interestingly, this virulence
activity is similar to that of YopT, a type III effector from Yersinia pestis, described
below. In addition to activities associated with the physical disruption of host actin
cytoskeletal dynamics, toxins have also been identified which usurp, or mimic, the
endogenous function of ABPs. For example, the Tc toxin from Photorhabdus

	
  

23	
  

luminescens was shown to impact actin cytoskeletal architecture by inducing ADPribosylation of actin, initiating unregulated polymerization, ultimately leading to the
formation of actin aggregates (Aktories et al., 2011). Thus, as noted, regardless of the
specific toxin targeting the actin cytoskeleton, whether direct or indirect, the primary
function of these toxins are to disrupt actin cytoskeletal dynamism, thereby hindering
the cell’s ability to respond to pathogenesis.

Mammalian pathogens, like those of plants, secrete effectors directly into the host cells
to alter cellular processes for their own advantage. Identification of secreted effectors
targeting the actin cytoskeleton has been established in mammalian systems for a
relatively long time. Among the best-described examples of this are the numerous
functional analyses of the suite of effectors from Yersinia pestis, which have been
shown to block the activation of phagocytosis (Shao, 2008). In total, three host RhoGTPases are targeted by the secreted effectors (i.e., YopT, YopE, and YpkA) from Y.
pestis: RhoA, Rac and Cdc42. Similar to the toxins described above, once delivered into
the host cells, these effectors inhibit the function of the key regulators of phagocytosis,
resulting in the inhibition of pathogen uptake, which in turn permits the proliferation of Y.
pestis within its host.

Salmonella

enterica

modulates

the

actin

cytoskeleton

and

additionally

the

endomembrane system of epithelial cells to cause infection and promote proliferation
(McGhie et al., 2009; Haglund & Welch, 2011). The infection cycle of Salmonella begins
with entry in the host cells. Salmonella delivers six secreted proteins, known as the SPI-

	
  

24	
  

1 class of effectors (SopE, SopE2, SptP, SipA, SopB, and SipC), in a well-orchestrated,
temporal manner to gain entry into epithelial cells through a process referred to as
cellular ruffling (McGhie et al., 2009; Haglund & Welch, 2011). Once inside the cell, the
bacterium utilizes effector release to create a protected niche to allow for pathogen
replication. Through this process of regulated effector delivery and hijacking of host
processes, Salmonella manipulates its host to allow for the formation and maturation of
the Salmonella-containing vacuole (SCV), utilizing the preformed endosomal maturation
pathway as well as components of the exocytic pathway (Ramos-Morales, 2012). To
persist, it is crucial that the SCV does not encounter the same fate as that of the
phagosome or lysosome. To avoid the endosomal pathway, thereby evading host
immunity, Salmonella secretes the type III effector SifA to form Salmonella-induced
filaments (Sifs) that protrude from the SCV, thereby driving SCV motility along
microtubules via kinesin interactions with the host protein SKIP (SifA and kinesininteracting protein; Boucrot et al., 2005).

Similar to the activity of secreted effectors from Salmonella, Listeria also utilizes
subterfuge of the actin cytoskeleton to gain cellular entry. Listeria utilizes a surface
bacterial invasion protein InlA to hijack actin dependent internalization via interactions
with E-cadherin (Pizarro-Cerda & Cossart, 2009). As a second, perhaps more striking
example of pathogen targeting of the host actin cytoskeleton is the case of how Listeria
infection spreads within animal cells. Listeria utilizes yet another surface protein, ActA,
as a mimic of N-WASP, resulting in the activation of the Arp2/3 nucleating factor to
encourage the rapid formation of F-actin “rocket-tails”, filamentous actin structures used

	
  

25	
  

by the pathogen for motility and infection of neighboring cells (Pizarro-Cerda & Cossart,
2009).

Actin’s role in nuclear reprograming: a potential for pathogens to gain control of
host gene expression

The movement of actin, including both the induction of changes in filament architecture
as well as the (re) distribution of actin and ABPs within the cell, not only illustrates the
dynamism of the cytoskeleton, but also the breadth of cellular engagement. Until
recently, it was not widely accepted that actin was purposefully present in the nucleus
(i.e. it was assumed that actin was present in the nucleus either due to sample prep
contamination or simple passive diffusion) let alone possessed any physiologically
relative functions. Actin was first observed in isolated nuclear fractions from Xenopus
laevis in 1977 (Clark & Merriam, 1977), and since this time, the proposed function(s) of
actin within the nucleus has been a point of discussion (Bettinger et al., 2004). In the
following section we aim to review some of the main questions that have arisen since
this initial observation in 1977, as well as the new question that is of most interest to us
regarding the potential of pathogens to target nuclear actin.

What role(s) does actin play in the nucleus?

After the initial observation of actins presence in the nucleus, researchers sought to
demonstrate that actin played an active role in nuclear processes. It was found that the

	
  

26	
  

microinjection of actin antibodies directly into the nuclei of salamander oocytes resulted
in cessation of RNA synthesis from the lampbrush chromosomes (Scheer et al., 1984).
It was later determined through a multitude of studies reviewed in (Miyamoto & Gurdon,
2012; Percipalle, 2013) that actin plays a role in transcription by all 3 of the RNA
polymerases. More specifically it has been demonstrated that actin plays a key part in
enhancing the assembly of protein complexes required for RNA polymerase function. In
addition to aiding in the functionality of RNA polymerases, actin has also been found in
association with chromatin remodeling complexes (Olave et al., 2002; Kapoor & Shen,
2014; Figure 1.4.b). Kandasamy et al. (2010) demonstrated the localization of multiple
vegetative class actin variants within the plant nucleus. Additionally, within this subclass
of actin it was demonstrated that Act 7 had a different localization pattern inside the
nucleus from that of Act 2 or Act 8 (Kandasamy et al., 2010). These differing subnuclear localizations of different actins may suggest that there are unique nuclear roles
for Act 7 that differ from that of Act 2 or Act 8. Future work will hopefully shed light on
the functional importance of these differing sub-nuclear localizations of various actins as
visualization techniques improve.

Are ABPs nuclear localized, and if so, what are their nuclear functions?

In mammals, actin is hypothesized to be shuttled into the nucleus by ADF/Cofilin (AC),
one of few members of the ABP superfamily that contain a nuclear localization signal. In
humans, the import/translocation of AC-actin into the nucleus has been shown to
require the function of importin-9, while the favored hypothesis is that the export of actin

	
  

27	
  

is mediated by PRF, through the activity of exportin-6 (Wada et al., 1998; Dopie et al.,
2012; Figure 1.4.a). In plants, the import/export control of actin and ABPs into and out of
the nucleus is unclear; however, it has been demonstrated that like mammalian
systems, plant nuclei contain ABPs, specifically ADF1-4 and profilin (Kandasamy et al.,
2010; Porter et al., 2012).

In addition to the active nuclear import/export of actin, ABPs themselves have been
identified to have direct interactions with genes as well as the nuclear machinery
(Percipalle, 2013; Miyamoto & Gurdon, 2012). While direct interactions have been
observed in mammalian systems, plant research has currently revealed indirect
alterations in gene expression due to either loss of ABPs or alterations in cytoskeletal
dynamics (Porter et al., 2012; Burgos-Rivera et al., 2008; Moes et al., 2013). It has
been demonstrated that knocking out ADF9 in Arabidopsis thaliana results in reduced
expression of flowering locus C (FLC; Burgos-Rivera et al., 2008; Figure 1.4.b).
Chromatin Immunoprecipitation (ChIP) revealed a reduction in histone H3 lysine 4
trimethylation and histone H3 lysine 9 and 14 acetylation of the FLC promoter, which is
associated with reduced expression. I will show that my Arabidopsis thaliana ADF of
interest, ADF4, is associated with the expression of the resistance protein RPS5 (Porter
et al., 2012; Chapter 2).

In Nicotiana tabacum the LIM protein WLIM2, which is predicted to occupy both the
cytosol and nucleus as well as bind actin, was recently shown to interact with the
Arabidopsis thaliana histone H4A748 (Moes et al., 2013). Additionally, it was confirmed

	
  

28	
  

!"#

()*+&+$'

!"#$%"&'

-"#
23456'

1"#
>!-'?+$$)'44'

(+$<$01='

,!-./0&*+1%&'

2"#

@%1%'
%A?B%&&0+1'

5789(9'

-,:;'

$%&'()*+,-.*#
34,-.*#
,/0+,-.*#

!"#$

Figure 1.4. Nuclear involvement of the actin cytoskeleton in gene expression
and it’s targeting by plant pathogens. (a.) Proposed translocation of actin into and
out of the nucleus by the actin binding proteins; actin depolymerizing factors (ADFs)
and profilin, as demonstrated in mammalian systems. (b.) Sub-nuclear functions of
monomeric globular (G-) actin, filamentous (F-) actin and ADFs in gene transcription.
G- and F- actin, as well as Cofilin1 have been determined to play a role in gene
expression in mammalian systems. Arabidopsis ADF9 has been demonstrated to be
required for expression of the flowering locus C (FLC) in a histone modification
dependent manner. (c.) The Nicotiana tabaccum LIM protein WLIM2 associated with
both actin and histone H4A748. Additionally WLIM2 has subcellular localization
patterns in the cytosol and nucleus. (d.) Turnip Vein Clearing Virus (TVCV)
movement protein (MPTVCV) posses a strong nuclear localization signal and interacts
with F-actin. Visualization of MPTVCV resulted in visualization of F-actin structures
within the nucleus of plants as well as co-localization of MPTVCV with histone H2B.
that WLIM2 did indeed localize to the cytosol and nucleus as well as bind to, and
bundle, actin filaments. Interestingly, treatment of cells with LatB resulted in increased

	
  

29	
  

nuclear occupancy of WLIM2, suggesting cross-talk between cytoskeletal dynamics and
the nucleus (Moes et al., 2013; Figure 1.4.c).

How prevalent is F-actin in the nucleus and what is the role of F-actin within the
nucleus?

This has been a major question from the earliest studies that identified the formation of
actin rods in Dictyostelium is response to stress (Fukui, 1978). A recent study in
mammalian systems found that cofilin-1 is in a complex with actin and phosphorylated
polymerase II (Obrdlik & Percipalle, 2011). Additionally, they found that cofilin-1 was in
association with transcribed regions of genes, and this occupancy is affected by the
polymerization of actin. Knocking down cofilin-1 resulted in reduction in gene expression
and a loss of actin and RNA polymerase II from the transcribed regions, as well as an
increase in the accumulation of F-actin foci in the nucleus (Obrdlik & Percipalle, 2011;
Figure 1.4.b). It has been suggested that the high levels of profilin and cofilin in the
nucleus, as well as additional ABPs, allow for the utilization of both G- and F-actin in the
nuclear remodeling machinery (Miyamoto & Gurdon, 2012).

There are many obstacles to the visualization of F-actin within both plant and
mammalian cells, although there have been many breakthroughs in recent years. A few
of these concerns were presented in Kandasamy et al. (2010) in which actin rods were
visualized in Arabidopsis thaliana by attaching a strong NLS to the C-terminus of Act 7.
The authors worried that the addition of the NLS may have caused the actin to

	
  

30	
  

aggregate in the nucleus so that the overexpression needed to visualize these
structures in the nucleus may have disrupted the ability of the actin to be turned over in
the nucleus by ABPs (Kandasamy et al., 2010). Some advances in the visualization of
F-actin in the nucleus are being developed that do not appear to require the over
expression of actin nor seem to affect the natural remodeling of the actin cytoskeleton
(Belin & Mullins, 2013; Grosse & Vartiainen, 2013). Recently, Levy et al. (2013) utilized
TagRFP-UtrCH, a protein that contains the calponin-binding domain of UthCH and
TagRFP, to visualize F-actin in the nuclei of N. benthamiana. The advantage of utilizing
the calponin-binding domain is that it is reported to label F-actin without affecting actin’s
dynamism.

Is there any pathogen that targets nuclear actin or ABPs to enhance virulence?

A recent review by (Deslandes & Rivas, 2011), suggested that the plant nucleus could
be the next major area of study in plant immunity research, including transport of
macromolecules into and out of the nucleus and regulation of gene expression. Given
the shuttling of actin and ABPs into and out of the nucleus, as well as the involvement of
these components in gene transcription, we feel that actin and its components should
not be overlooked when endeavoring into this research. Indeed, I have demonstrated a
requirement for Arabidopsis ADF4 for the proper expression of the resistance gene
RPS5, and ultimately, resistance to P. syringae expressing the cysteine protease
AvrPphB (Chapter 2). Furthermore, I determined that expression of RPS5 was not only
dependent upon the presence of ADF4, but also the phosphorylation status of ADF4.

	
  

31	
  

These data provide preliminary insight into the potential mechanisms by which
expression of resistance genes may be regulated by ABPs in a post-translational
dependent manner and could be targeted by plant pathogens to enhance virulence.

In support of ADFs playing a role in both resistance and nuclear function a group
working in rice has recently identified a pathway involving the direct interaction of rice
ADF with a lectin receptor-like kinase, OsleRK, and expression of α-amylase, required
for seed germination and expression of defense genes (Cheng et al., 2013).
Specifically, knock down of either OsleRK or rice ADF resulted in reduced expression of
the resistance genes PR1a, a pathogen-related gene, LOX, encoding a lipoxygenase
and CHS, which encodes a peroxidase. In addition to this alteration of gene expression
both mutants also exhibited enhanced susceptibility to multiple pathogens including the
bacterium Xanthomonas oryzae pv. oryzae and the fungi Magnaporthe grisea (Cheng et
al., 2013; Figure 1.4.b).

Another recent study examined the movement protein (MP) of the tobamovirus Turnip
Vein Clearing Virus (TVCV: MPTVCV) and found that in addition to its expected
localization to endoplasmic reticulum and plasmodesmata MPTVCV was located in the
plant nucleus in association with F-actin within the nucleus (Levy et al., 2013; Figure
1.4.d). Within the nucleus MPTVCV did not co-localize with nucleoli or Cajal bodies, but
instead co-localized with histone H2B. It was further determined that MPTVCV posses a
strong NLS signal that is required for proper infection by TVCV. Taken together these

	
  

32	
  

data suggest that MPTVCV may directly alter nuclear actin dynamics to alter the
expression of genes in order to enhance virulence.

Final Thoughts

As highlighted above, the plant actin cytoskeleton is ubiquitous, dynamic, and highly
regulated, requiring the activity of more than 75 ABPs for its assembly and function. In
addition to the basic processes that regulate the filament architecture and organization,
actin cytoskeletal dynamics are intimately governed by a suite of host processes that
require its function, including those associated with growth and development, movement
and organization, and response to stimuli. In recent years, advances in genomics and
cell biology have further enhanced our understanding of the processes governing, and
governed by, the actin cytoskeleton. From these collective studies, it is evident that we
have only begun to scratch the surface of our understanding of the hows and whys
regarding the extent of the role of the actin cytoskeleton in plant biology. Of particular
interest is the role of actin as a surveillance mechanism, continually sensing the cell for
perturbations, including both chemical and physical changes in the intracellular and
extracellular environment. As a central component of actin’s role as a surveillance
platform, the localization, including changes in the subcellular concentration of actin and
various ABPs, is noteworthy. To begin to address this knowledge gap, studies using
plant - pathogen cell models have demonstrated that changes in ABP localization within
the cell serves not only as a stimulus for reorientation of actin filament architecture, but
also as a trigger that initiates the induction of processes including changes in signal

	
  

33	
  

transduction pathways and gene expression. To this end, the role of actin in the nucleus
represents largely unexplored areas of research, possibly holding the answers to areas
of biology beyond the dynamics of actin assembly, and the realm of actin as a mediator
of gene activation and cellular homeostasis.

	
  

34	
  

CHAPTER 2
Arabidopsis Actin-Depolymerizing Factor-4 Links Pathogen Perception, Defense
Activation and Transcription to Cytoskeletal Dynamics.

This research was originally published in PLoS Pathogens.
Porter K, Shimono M, Tian M, Bay B. 2012. Arabidopsis Actin-Depolymerizing Factor4 links pathogen perception, defense activation and transcription to cytoskeletal
dynamics. PLoS Pathog 8: e1003006. Minor edits have been made in formatting this
chapter and addressing committee concerns.
The confocal images of the co-localization of ADF4_S6A and ADF4_S6D were
performed by co-author Masaki Shimono; Department of Plant Pathology at Michigan
State University, while the image analysis was performed by me, Katie Porter. The plant
lines adf4/35S:ADF4S6A and adf4/35S:ADF4S6A were constructed by co-author
Miayoing Tian while in the Department of Plant Pathology at Michigan State University.

	
  

35	
  

Abstract

The primary role of Actin-Depolymerizing Factors (ADFs) is to sever filamentous actin,
generating pointed ends, which in turn are incorporated into newly formed filaments,
thus supporting stochastic actin dynamics. Arabidopsis ADF4 was recently shown to be
required for the activation of resistance in Arabidopsis following infection with the
phytopathogenic bacterium Pseudomonas syringae pv. tomato DC3000 (Pst)
expressing the effector protein AvrPphB. Herein, we demonstrate that the expression of
RPS5, the cognate resistance protein of AvrPphB, was dramatically reduced in the adf4
mutant, suggesting a link between actin cytoskeletal dynamics and the transcriptional
regulation of R-protein activation. By examining the PTI (PAMP Triggered Immunity)
response in the adf4 mutant when challenged with Pst expressing AvrPphB, we
observed a significant reduction in the expression of the PTI-specific target gene FRK1
(Flg22-Induced Receptor Kinase 1). These data are in agreement with recent
observations demonstrating a requirement for RPS5 in PTI-signaling in the presence of
AvrPphB. Furthermore, MAPK (Mitogen-Activated Protein Kinase)-signaling was
significantly reduced in the adf4 mutant, while no such reduction was observed in the
rps5-1 point mutation under similar conditions. Isoelectric focusing confirmed
phosphorylation of ADF4 at serine-6, and additional in planta analyses of ADF4’s role in
immune

signaling

demonstrates

that

nuclear

localization

is

phosphorylation

independent, while localization to the actin cytoskeleton is linked to ADF4
phosphorylation. Taken together, these data suggest a novel role for ADF4 in controlling

	
  

36	
  

gene-for-gene resistance activation, as well as MAPK-signaling, via the coordinated
regulation of actin cytoskeletal dynamics and R-gene transcription.

Author Summary

The activation and regulation of the plant immune system requires the coordinated
function of numerous pre-formed and inducible cellular responses. Following pathogen
perception, plants not only activate specific defense-associated signaling, such as
resistance (R) genes, but also redirect basic cellular machinery to support innate
immune signaling. Within each of these processes, the actin cytoskeleton has been
demonstrated to play a significant role in structural-based defense signaling in plants in
response to pathogen infection. Most notably, the actin cytoskeleton of plants has been
shown to play a role in structural-based defense signaling following fungal pathogen
infection. Recent work from our laboratory has demonstrated that the actin cytoskeleton
of Arabidopsis mediates defense signaling following perception of the phytopathogenic
bacterium Pseudomonas syringae. Using a combination of genetic and cell biologybased approaches, we found that ADF4, a regulator of actin cytoskeletal dynamics, is
required for the specific activation of R-gene-mediated signaling. By analyzing the
activation of signaling following pathogen perception, we have identified substantial
crosstalk between recognition of pathogen virulence factors (e.g., effector proteins) and
the regulation of R-gene transcription. In total, our work highlights the intimate
relationship between basic cellular processes and the perception and activation of
defense signaling following pathogen infection.

	
  

37	
  

Introduction

The actin cytoskeleton is an essential, dynamic component of eukaryotic cells, involved
in numerous processes including growth and development, cellular organization and
organelle movement, and abiotic and biotic stress signaling (Day et al., 2011).
Underpinning these processes in plants is a tightly regulated genetic and biochemical
mechanism driven by the function of more than 70 actin-binding proteins (ABPs), which
through their coordinated activity, regulates the balance of free globular (G)-actin versus
filamentous (F)-actin, of which nearly 95% is unpolymerized in plants (Gibbon et al.,
1999; Snowman et al., 2002). As a consequence of this large pool of free G-actin, the
potential exists for explosive rates of polymerization following elicitation by a broad
range of external stimuli, including pathogen infection (Day et al., 2011). Among the
numerous ABPs in plants responsible for modulating the balance of G- to F-actin, one
subclass, Actin-Depolymerizing Factors (ADFs), both sever and disassemble F-actin. In
addition to thier primary role in modulating host cytoskeletal architecture, a role for
ADFs in defense signaling following pathogen infection is emerging (Miklis et al., 2007;
Clément et al., 2009; Tian et al., 2009).

The initiation of innate immune signaling in plants relies on multiple pre-formed and
inducible processes to surveil, respond, and activate defense signaling following
pathogen perception (Chisholm et al., 2006; Knepper & Day, 2010). In total, these
responses can be cataloged based on two primary nodes of defense signaling:
pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI) and effector-

	
  

38	
  

triggered immunity (ETI) (Chisholm et al., 2006). In the case of PTI, perception and
activation is typically mediated by extracellular plasma membrane-localized pattern
recognition receptors (PRRs), which are responsible for the recognition of conserved
pathogen motifs (i.e., PAMPs; e.g., flagellin, LPS, chitin). Recognition of PAMPs by
PRRs initiates downstream signaling, including the activation of the Mitogen-Activated
Protein Kinase (MAPK) signaling cascade, the generation of reactive oxygen species,
and transcription of pathogen-responsive genes (Zhang & Zhou, 2010). Arguably the
best-characterized example of PTI signaling in plants is the activation of signaling
associated with FLS2 (Flagellin Sensitive-2), a receptor-like kinase containing a
serine/threonine kinase, which recognizes flagellin as well as the 22-amino acid peptide
flg22 via the extracellular leucine rich repeat (LRR) domain (Gomez-Gomez et al., 1999;
Gomez-Gomez & Boller, 2000). Activation of FLS2 by flg22 results in the association of
FLS2 with BAK1 (BRI1-associated receptor kinase), as well as the phosphorylation of
both FLS2 and BAK1 (Chinchilla et al., 2007). FLS2 ligand binding and association with
BAK1 has been shown to activate the MAPK signaling pathway resulting in dual
phosphorylation of conserved tyrosine and threonine residues of Arabidopsis
(Arabidopsis thaliana) MAP kinases MPK3/6 (Rodriguez et al., 2010), which in turn
leads to transcription of PTI-related genes including FRK1 (Flg22-induced receptor
kinase 1; (Asai et al., 2002)). The expression of FRK1, however, is believed to be both
MAPK dependent and independent (Asai et al., 2002).

As a counter to the activation of PTI, many plant pathogens deploy secreted effector
proteins, which induce a host response (e.g., ETI) - an enhanced PTI-like response, as

	
  

39	
  

well as a more robust, programmed cell death-like, response known as the
hypersensitive response (HR) that is initiated via the direct or indirect recognition of
pathogen effectors by host resistance (R) proteins (Chisholm et al., 2006). As expected,
numerous virulence targets of pathogen effectors identified thus far are components of
PTI signaling pathways – with the hypothesis being that targeting PTI-components can
lead to increased virulence of the pathogen (Zhang et al., 2010; Zhang & Zhou, 2010).
Among the best-characterized signaling pathways leading to the activation of ETI, as
well as a mechanistic example of the functional overlap between PTI and ETI, is the
recognition of the bacterial effector protein AvrPphB by the Arabidopsis resistance
protein RPS5 (resistance to Pseudomonas syringae-5) (Chisholm et al., 2006). RPS5 is
a member of the coiled-coil (CC) nucleotide-binding-site (NBS) LRR R-gene family,
required for recognition of Pseudomonas syringae pv. tomato DC3000 (Pst) expressing
the cysteine protease effector protein AvrPphB (Warren et al., 1999; Ade et al., 2007).
RPS5-mediated resistance signaling is dependent upon AvrPphB cleavage of the
receptor-like cytoplasmic kinase (RLCK) AvrPphB-Susceptible 1 (PBS1), which in turn
results in the activation of ETI (Shao et al., 2003). Recently, it has been suggested that
the virulence target of AvrPphB may in fact be another RLCK, the PTI component BIK1
(Botrytis-induced kinase; (Zhang et al., 2010)). This hypothesis is based on the
observation that not only does AvrPphB cleave BIK1, as well as other RLCKs, including
PBL1 (PBS1-like 1), but also that cleavage in the absence of RPS5 results in a
significant reduction in PTI responses. It should be noted, that while the bik1/pbl1
double mutant does have significant reductions in many PTI responses, bik1/pbl1 does

	
  

40	
  

not exhibit reduced MPK3/6 phosphorylation upon flg22 stimulation (Zhang et al., 2010;
Feng et al., 2012).

In the current study, we report the identification of a reduction in the expression and
accumulation of RPS5 mRNA in the absence of ADF4. In total, our data demonstrate
that this reduction results in the down-regulation of PTI-signaling in the presence of the
bacterial effector AvrPphB. Additionally, we demonstrate this reduction in PTI-signaling
is due in part to an ADF4-dependent abrogation of the MPK3/6 branch of the MAPK
pathway. From the standpoint of cellular dynamics and the activation of ETI, expression
of RPS5 was restored in an ADF4 phosphorylation-dependent manner, demonstrating a
link between ADF4 phosphorylation, activity (e.g., F-actin binding), RPS5 mRNA
accumulation and subsequent resistance signaling. In addition to elucidating the
signaling cascade from perception through MAPK activation, we identified a link
between reduced actin cytoskeleton co-localization of ADF4 and the activation of RPS5mediated resistance in a phosphorylation-dependent manner. In total, the work
presented herein represents the first identification of linkage between the actin
cytoskeleton, the dynamic control of ADF4, and the regulation of a resistance gene
transcription.

	
  

41	
  

Results

ADF4 is required for RPS5 expression

Previous work has shown that Arabidopsis Actin-Depolymerizing Factor-4 (ADF4) is
required for resistance to Pst AvrPphB, however, the biochemical and genetic
mechanism(s) associated with activation were largely undefined (Tian et al., 2009). To
elucidate the signaling cascade leading from the recognition of AvrPphB to the
activation of resistance, we first investigated the expression of the resistance (R) gene
(i.e., RPS5) required for the recognition of AvrPphB. As shown in Figure 2.1A, we found
a significant reduction (~250-fold) in the accumulation of RPS5 mRNA in the adf4
mutant compared to wild-type Col-0. It was further determined that there is no
significant alteration in the expression of ADF4 in Col-0 during the course of infection
with Pst AvrPphB (Figure 2.2). To address the possibility of positional effects in the adf4
T-DNA SALK line, Tian et al. (Tian et al., 2009) demonstrated that complementation of
the adf4 mutant with native promoter-driven ADF4 restored resistance to Pst AvrPphB.
Similarly, these lines also showed a restoration in mRNA expression of RPS5 (Figure
2.1B). The expression of RPS5 in a second ADF mutant, adf3, was not altered (Figure
2.1B), confirming that the loss of resistance is specific to ADF4, as previously reported
(Tian et al., 2009). To confirm that the loss of RPS5-mediated resistance in the adf4
mutant is specific to RPS5, we transformed the adf4 mutant with a RPS5-sYFP
(adf4/35S:RPS5-sYFP; (Qi et al., 2012)) to uncouple RPS5 expression from native
regulation. As shown in Figure 2.3, RPS5 mRNA (Figure 2.3A) and HR-induced cell

	
  

42	
  

Figure 2.1. ADF4 is required for RPS5 mRNA accumulation and resistance to
Pseudomonas syringae expressing the cysteine protease effector AvrPphB.
Time-course of mRNA accumulation of (A) RPS5 and (C) PBS1 in Col-0 and adf4
mutant plants following dip inoculation with Pst AvrPphB. (B) Expression levels of
RPS5 in Col-0, pbs1, adf4/g:ADF4, and adf3. (D) RPS5 mRNA accumulation in Col-0
and rps5-1, comparing each to their basal untreated levels at 24 hpi with Pst
AvrPphB. Error bars represent mean ± SEM from two technical replicates of two
independent biological repeats (n = 4). Statistical significance was determined using
two-way ANOVA as compared to Col-0, with Bonferroni post test, where *p<0.05 and
***p<0.001. hpi = hours post inoculation.
	
  

	
  

43	
  

Figure 2.2. ADF4 expression does not change during the course of infection
with Pseudomonas syringae expressing AvrPphB. The expression levels of ADF4
in Col-0, over time, when inoculated with Pseudomonas syringae expressing
AvrPphB (Pst AvrPphB). Error bars represent mean ± SEM from two technical
replicates of two independent biological replicates (n = 4). hpi = hours post
inoculation. An unpaired student t-test with a 95% confidence interval was performed
to determine if change over time was significant, where p>0.05 is considered not
significant.
	
  
death following AvrPphB recognition (Figure 2.3B) was restored. Taken together, these
data demonstrate a direct and specific requirement of ADF4 for RPS5-mediated
resistance.

To determine the specificity of the ADF4-RPS5 genetic interaction, we investigated if
the mRNA expression of additional Arabidopsis R-genes are altered in the adf4 mutant.
To this end, we examined the expression of RPS2 (Kunkel et al., 1993), RPM1 (Grant et
al., 1995), RPS4 (Gassmann et al., 1999) and RPS6 (Kim et al., 2009). As an additional
measure, we monitored the mRNA accumulation of NDR1 (non race-specific disease
resistance-1; (Century et al., 1997; Knepper et al., 2011a; Knepper et al., 2011b)), a
required component of most CC-NB-LRR defense signaling pathways in Arabidopsis,

	
  

44	
  

including
Figure 2.3. Expression of 35S:RPS5-sYFP in adf4 recovers the Hypersensitive
Response. (A) RPS5 expression in two adf4 mutant-complemented lines expressing
35S:RPS5-sYFP, adf4/35S:RPS5-sYFP-4 and adf4/35S:RPS5-sYFP-12. (B)
Hypersensitive Response (HR) in adf4/35S:RPS5-sYFP-4 and adf4/35S:RPS5sYFP-12 when challenged with Pseudomonas syringae expressing AvrPphB (Pst
AvrPphB; left) and untreated (right).
	
  
RPS5. As shown in Figure 2.4, we did not observe a reduction in the resting levels of
these mRNAs in the adf4 mutant. To confirm that increased susceptibility and the loss

	
  

45	
  

Figure 2.4. The adf4 mutant does not have altered expression of other
resistance genes. The mRNA expression levels of RPS2, RPM1, RPS4, RPS6 and
NDR1 in Col-0 and adf4. Error bars represent mean ± SEM from two technical
replicates of two independent biological replicates (n = 4). hpi = hours post
inoculation.
of the HR in the adf4 mutant is due to altered expression of RPS5 (i.e., mRNA
reduction) and not a reduction in the expression of the AvrPphB cleavage target PBS1
(Warren et al., 1999; Swiderski & Innes, 2001; Innes, 2003; Shao et al., 2003b; Ade et
al., 2007), the expression of PBS1 mRNA was also measured. As shown in Figure
2.1C, we did not detect a significant difference between PBS1 expression in the adf4
mutant and Col-0. Additionally, there was no alteration of RPS5 mRNA expression in
the functional PBS1 mutant, pbs1-2 (Swiderski & Innes, 2001; Figure 2.1B).

Our data present a role for ADF4 in the expression of RPS5, but not for the expression
of PBS1, suggesting the loss of ETI in the adf4 mutant may be a direct result of reduced
RPS5 expression (Figure 2.1A, Figure 2.1C). However, whether a role for AvrPphB in
the down-regulation of RPS5 expression exists is unknown. In order to address this
	
  

46	
  

question, we measured the expression of RPS5 in both Col-0 and the RPS5 pointmutant, rps5-1, generated by EMS and thus while inactive is expressed at wild-type
levels and therefore is able to be quantitated by qRT-PCR; the rationale being that if
AvrPphB negatively regulates the expression of RPS5, its expression should be
reduced in the absence of the activation of ETI (Warren et al., 1999). In support of this
hypothesis, as shown in Figure 2.1D, we observed a significant reduction in RPS5
expression in rps5-1 at 24 hpi following inoculation with Pst AvrPphB.

The virulence activity of AvrPphB blocks MAPK signaling in adf4

Based on our observations above, we hypothesize that absence of RPS5-derived ETI in
adf4 is most likely due to the reduced expression of RPS5. Based on this, and given the
significant overlap in signaling of ETI and PTI, particularly with regard to AvrPphB
activity (Lu et al., 2010; Zhang et al., 2010; Zhang & Zhou, 2010), we asked if PTI
signaling is affected in the adf4 mutant. To address this question, we first monitored the
activation of FRK1 expression, a transcriptional marker for FLS2 activation (Asai et al.,
2002), in wild-type (WT) Col-0, adf4 and rps5-1. As shown in Figure 2.5A, when Col-0,
adf4 and rps5-1 plants were treated with flg22, no significant changes in FRK1 mRNA
expression were observed, and mock infiltration did little to activate FRK1 (Figure 2.5A,
Figure 2.5B). As a second, complementary analysis of the fidelity of PTI-based signaling
responses in the adf4 mutant, we also monitored root growth inhibition in the presence
of flg22 (Chinchilla, 2007; same as in the methods section). As shown in Figure 2.6, we
did not observe a significant difference in root growth in adf4 in the presence of flg22 as

	
  

47	
  

Figure 2.5. Flg22-induced receptor kinase 1 expression in the adf4 mutant is
reduced when the effector protein AvrPphB is expressed in planta. Relative
expression levels of FRK1 mRNA in Col-0, adf4, and rps5-1 plants when treated with
(A) 10 µM flg22, (B) mock inoculated with MgCl2 by hand infiltration (C) Pst AvrPphB,
or (D) the hrpH- (Pst hrpH-). Error bars represent mean ± SEM from two technical
replicates of two independent biological repeats (n = 4). Statistical significance was
determined using two-way ANOVA, as compared to Col-0, with Bonferroni post test
where *p<0.05 and **p<0.005. hpi = hours post-inoculation.
compared to Col-0. In total, these data demonstrate that flg22-induced PTI-signaling is
functional in both the rps5-1 and adf4 mutants. As an additional measure to ensure that
the technique employed in Figure 2.5A and B did not have an adverse effects on RPS5
	
  

48	
  

Figure 2.6. adf4 mutants are sensitive to fl22 in root length assay. (A) Graphical
representation of root lengths of Col-0 and adf4 grown 10 days in the presence
(+flg22) or absence (-flg22) of 10 nM flg22. Error bars represent mean ± SEM from
two independent biological replicates (n = 32-46). Statistical significance was
determined using two-way ANOVA, with Bonferroni post test, where ***p<0.001. (B)
Col-0 and adf4 seedlings grown for 10 days ± 10 nM flg22.
mRNA expression in either Col-0 or adf4, RPS5 mRNA was monitored following handinfiltration with either flg22 or mock (i.e., buffer alone). As shown in Figure 2.7A, we
observed that flg22-induced expressional changes of RPS5 mRNA was similar to that of
mock, thus assuring the observed activation of FRK1 in Col-0 and adf4 (Figure 2.5A)
can be attributed specifically to flg22, and is independent of the infiltration technique
(Figure 2.5B), or changes in RPS5 expression (Figure 2.7A).

Recent work from Zhang et al. (2010) suggests that FRK1 mRNA accumulation is
reduced in the rps5-1 mutant following flg22 treatment of protoplasts expressing
AvrPphB. This raises the question of the relationship between the activation of PTIsignaling in parallel with the activation of ETI. To investigate the downstream signaling

	
  

49	
  

Figure 2.7. Expression of RPS5 mRNA is not affected by treatment with flg22,
or by inoculation with the hrpH- mutant of Pseudomonas syringae. Real-time
PCR analysis of RPS5 mRNA accumulation in Col-0 and adf4 following (A) flg22
treatment, mock inoculation or (B) dip-inoculation with the hrpH- mutant of
Pseudomonas syringae (Pst hrpH-). Expression was determined by qRT-PCR,
utilizing amplification of UBQ10 as an endogenous control. Error bars, representing
mean ± SEM, were calculated from two technical replicates of two independent
biological repeats (n = 4). Statistical significance was determined using two-way
ANOVA as compared to Col-0, with Bonferroni post test, where ***p<0.001. hpi =
hours post inoculation.
response(s) associated with the activation of RPS5-mediated resistance, we measured
the expression of FRK1 mRNA accumulation in Col-0, adf4, and rps5-1 when inoculated
with Pst AvrPphB. As shown in Figure 2.5C, we observed a significant decrease in
FRK1 mRNA expression in both the adf4 and rps5-1 mutants, as compared to Col-0, at
6 hpi with Pst AvrPphB. Coupled with the results of Zhang et al. (Zhang et al., 2010),
this would suggest that the adf4 mutant has a decreased level of RPS5. In support of
this, we did not detect a significant difference between FRK1 expression in the adf4 and
rps5-1 mutants when inoculated with flg22 (Figure 2.5A), demonstrating that the
mutants had equivalent signaling potential following to FLS2 activation, and that

	
  

50	
  

ultimately, the reduction in FRK1 expression is a direct result of a loss in ETI, most likely
due to a reduction in RPS5 mRNA expression and accumulation (Figure 2.1A).

It is possible that our observations described above could be an indirect result of crosstalk of PTI response signaling pathways in adf4 and rps5-1 in the presence of Pst. To
test this, FRK1 mRNA expression in Col-0, adf4 and rps5-1 following inoculation with
the type three secretion system (T3SS) mutant Pst hrpH- was assessed to differentiate
PTI from ETI in the ADF4-RPS5 signaling node. As shown in 2.2D, we detected no
difference in FRK1 mRNA expression between Col-0, adf4 or rps5-1. Additionally, RPS5
mRNA expression following Pst hrpH- inoculation (Figure 2.7B) and elf18-induced PTIsignaling in Col-0 and adf4 (Figure 2.8) further supports these observations. When
challenged with Pst expressing the catalytically inactive AvrPphB-C98S isoform (Ade et
al., 2007; Shao et al., 2003), both WT Col-0 and the adf4 mutant showed increased
expression levels of FRK1 mRNA, in agreement with previously published data (Zhang
et al., 2010; Figure 2.9A). A loss of induction of the HR in Col-0, adf4 and rps5-1 when
challenged by Pst-AvrPphB-C98S variant (Shao et al., 2003a) confirms the catalytic
inactivity of AvrPphB-C98S (Figure 2.9B).

At this point, we reasoned that altered FRK1 expression in both the rps5-1 and adf4
mutants is due to a specific block in the MAPK signal cascade, most likely a function of
the virulence activity of AvrPphB in the absence of ETI. To examine MAPK activation in
the presence of both flg22 and AvrPphB, in the absence of pathogen, Col-0, adf4 and
rps5-1 plants were transformed with an estradiol-inducible AvrPphB construct (i.e., Col-

	
  

51	
  

Figure 2.8. Both Col-0 and adf4 have induced FRK1 expression when treated
with elf18. Relative expression levels of FRK1 in Col-0 and adf4 mutant plants, hand
infiltrated with elf18. All expression values were determined by qRT-PCR, with
amplification of UBQ10 as an endogenous control. Error bars, representing mean ±
SEM, are representative of two technical replicates of one biological repeat (n = 2).
hpi = hours post inoculation.
0/pER8:AvrPphB, adf4/pER8:AvrPphB and rps5-1/pER8:AvrPphB) to enable us to
monitor the interplay between flg22 perception (i.e., PTI) and AvrPphB (i.e., ETI). As
shown in Figure 2.10A and Figure 2.10C, when phosphorylation of both MPK3 and
MPK6

was

measured

in

response

to

flg22,

a

significant

reduction

in

adf4/pER8:AvrPphB was observed as compared to Col-0 at 10 minutes; this reduction
was not observed in adf4, and Col-0/pER8:AvrPphB. Interestingly, no significant
reduction of MPK3 and MPK6 was observed in the rps5-1/pER8:AvrPphB 10 minutes
after flg22 treatment (Figure 2.10B and Figure 2.10C). This observation suggests a
potential combinatory role for ADF4 in both the expression of RPS5 (Figure 2.1A),
resulting in reduced PTI-signaling (Figure 2.5C), as well as in the proper regulation of
MAPK-signaling in the presence of AvrPphB (Figure 2.10A and Figure 2.10C). Estradiol
induction of AvrPphB is shown in Figure 2.11.
	
  

52	
  

Figure 2.9. Increased FRK1 expression in Col-0 and adf4 when challenged by
Pst AvrPphB-C98S, and HR phenotypes in Col-0, adf4, and rps5-1. (A) The
expression levels of FRK1 in Col-0, adf4 and rps5-1 following dip-inoculation with
Pseudomonas syringae expression the AvrPphB catalytic mutant C98S (Pst
AvrPphB-C98S). All expression values were determined by qRT-PCR, with
amplification of UBQ10 as an endogenous control. Error bars, representing mean ±
SEM, are representative of two technical replicates of three biological replicates (n =
6). hpi = hours post inoculation. (B) HR phenotypes in Col-0, adf4 and rps5-1 when
hand inoculated with Pst AvrPphB-C98S.

	
  

53	
  

Figure 2.10. Mitogen Activated Protein Kinase (MAPK) phosphorylation is
reduced in the adf4 mutant in the presence of AvrPphB.

	
  

54	
  

Figure 2.10 (con’d). Mitogen Activated Protein Kinase (MAPK) phosphorylation
is reduced in the adf4 mutant in the presence of AvrPphB. (A) Percent maximal
phosphorylation of the MPK3/6 TEY motif in Col-0 and the adf4 mutant, +/- AvrPphB,
followed by 1 µM flg22 treatment. (B) Percent maximal phosphorylation of the
MPK3/6 TEY motif in Col-0 and the rps5-1 mutant, +/- AvrPphB, followed by 1 µM
flg22 treatment. AvrPphB expression was induced at 48 h pre-treatment with 100 µM
estradiol in Col-0, adf4 and rps5-1 mutant plants containing an estradiol-inducible
AvrPphB transgene (pER8:AvrPphB). Statistical significance was determined using
two-way ANOVA as compared to Col-0 untreated, with Bonferroni post test, where
*p<0.05, **p<0.005, n = 3. (C) Western blot analysis of MPK3/6 TEY phosphorylation.

Phosphorylated ADF4 is required for RPS5 expression and subsequent activation
of resistance

ADF4-mediated actin depolymerization is regulated in large part by the phosphorylation
status of ADF. Indeed, previous work has demonstrated that mammalian cofilin/ADF
activity is regulated by phosphorylation at serine-3, and that de/phosphorylation at this
residue is responsible for the regulating the activation of actin depolymerization (Yang
et al., 1998). In plants, a direct correlation between the phosphorylation status of ADF
and its function has not been demonstrated; however, ADF4 function is presumed to be
regulated in a manner similar to that of mammalian cofilin (Yang et al., 1998; Allwood et
al., 2002; Shvetsov et al., 2009). Herein, we demonstrate for the first time that
Arabidopsis ADF4 is indeed phosphorylated at serine-6, and that the phosphorylation
status directly correlates with its activity and function of actin cytoskeletal dynamics.
ADF4 and the phospho-null ADF4_S6A (i.e., serine-6 to alanine) plant lines were
generated by expressing T7:ADF4 and T7:ADF4_S6A in the adf4 mutant under the
control of a constitutive promoter (adf4/35S:ADF4 and adf4/35S:ADF4_S6A). As shown
in Figure 2.12A, after 2D isoelectric focusing (IEF) and SDS PAGE, native ADF4 shows

	
  

55	
  

Figure 2.11. Estradiol-inducible expression of avrPphB in Col-0, adf4 and rps51. Induction of avrPphB expression in Col-0, adf4 and rps5-1 plants containing the
estradiol-inducible avrPphB construct pER8:AvrPphB following 48 h pre-treatment
with 100 µM estradiol. Expression values were determined by quantitative real-time
PCR (qRT-PCR), with amplification of UBQ10 as an endogenous control. Error bars,
representing mean ± SEM, are representative two technical replicates of one
biological repeat (n = 2).
a differential IEF profile than the phospho-null ADF4_S6A. In order to determine if
phosphorylation of ADF4 affects RPS5 expression, an additional phosphorylation
isoform line was generated: a phospho-mimic isotype, reflecting a serine to aspartic
acid change at amino acid position 6 (i.e., S6D) expressed in the adf4 mutant
background (adf4/35S:ADF4_S6D). As shown in Figure 2.12B, the phosphomimetic
isoform, adf4/35S:ADF4_S6D, restored RPS5 mRNA expression, while the phosphonull isoform, adf4/35S:ADF4_S6A, did not. A second independent transgenic
Arabidopsis line expressing the ADF4 phosphorylation mutants were generated and
tested for RPS5 expression to ensure that altered mRNA expression was not due to a
positional transgene insertion effect (Figure 2.13A).

To confirm that the ADF4 phosphomimetic constructs were functional in their ability to
restore resistance in the adf4 mutant, the induction of HR and disease phenotypes, as
	
  

56	
  

Figure 2.12. Phosphorylation of ADF4 is required for RPS5 mRNA expression.

	
  

57	
  

Figure 2.12 (cont’d). Phosphorylation of ADF4 is required for RPS5 mRNA
expression. (A) Western blot of isoelectric focusing (IEF) and SDS PAGE analysis of
wild type ADF4 (upper) and phospho-null ADF4_S6A (lower). Arrows indicate
direction of IEF and SDS PAGE. (B) The relative expression levels of RPS5 were
determined by qRT-PCR. (C) HR phenotypes at 22 hours after bacterial infiltration
(upper), disease phenotypes at 4 dpi (lower). (D) Enumeration of bacterial growth at
0 and 4 dpi. HR and bacterial population experiments were repeated at least 3 times.
Error bars, representing mean ± SEM, were calculated from two (A; n = 4) or three
(D; n = 9) technical replicates of two independent biological repeats. Statistical
significance was determined using two-way ANOVA, comparing adf4 to Col-0, with
Bonferroni post test, where *p<0.05; ***p<0.001. hpi = hours post inoculation; dpi =
days post inoculation.
well as bacterial growth were assessed to determine the relationship between ADF4
phosphorylation and resistance activation through AvrPphB-RPS5. As shown in Figure
2.12C and 2.4D, inoculation of adf4 mutant plants expressing the phosphomimetic
(ADF4_S6D) with Pst AvrPphB restored the WT Col-0 resistance phenotype, both in
terms of HR (Figure 2.12C, top panel), disease symptoms (Figure 2.12C, lower panel),
and bacterial growth at 4 dpi (Figure 2.12D). Conversely, inoculation of the phosphonull-expressing plants (i.e., adf4/35S:ADF4_S6A) with Pst AvrPphB resulted in the
absence of HR (Figure 2.12C, top panel), the development of disease symptoms
(Figure 2.12C, lower panel), and an increased growth of the pathogen (Figure 2.12D),
similar to that observed in the adf4 mutant. As a control, to correlate transgene
expression levels with our observations, the relative expression levels of both
ADF4_S6A and ADF4_S6D were assessed by western blot to confirm that the observed
restoration of RPS5 with the phosphomimetic isoform was in fact due to the
phosphorylation status and not an artifact of expression (Figure 2.13B). In total, our data
confirms a restoration in resistance, as well as supports the hypothesis that
phosphorylated ADF4 is required for resistance to Pst AvrPphB. Similarly, and in
agreement our phosphorylation data, expression of FRK1 following Pst AvrPphB

	
  

58	
  

i
Figure 2.13. RPS5 mRNA expression in additional adf4/35S:ADF4_S6A and
adf4/35S:ADF4_S6D lines confirm observed RPS5 expression is not due to
positional effects of the transgene nor disproportionate levels of protein levels
of protein expression. (A) The expression level of RPS5 in a second set of
adf4/35S:ADF4_S6A
(adf4/35S:ADF4_S6A-2)
and
adf4/35S:ADF4_S6D
(adf4/35S:ADF4_S6D-2) transgenic lines, as compared to the first line shown in
Figure 4A. All expression values were determined by quantitative real-time PCR
(qRT-PCR), with amplification of UBQ10 as an endogenous control. Error bars,
representing mean ± SEM, are representative of two technical replicates of one
biological repeat (n = 2). hpi = hours post inoculation. (B) Relative protein levels of
ADF4_S6A and ADF4_S6D in adf4/35S:ADF4_S6A and adf4/35S:ADF4_S6D as
determined by western blot when probed with anti-T7-HRP. Ponceau blot is shown to
demonstrate equal loading.
noculation in the adf4/35S:ADF4_S6D mutant was similar to that observed in Col-0,
whereas the adf4/35S:ADF4_S6A plants had an FRK1 expression pattern similar to the
adf4 mutant (Figure 2.14).

	
  

59	
  

Figure 2.14. FRK1 expression in adf4/35S:ADF4_S6A and adf4/35S:ADF4_S6D
lines confirm link between RPS5 expression and FRK1 in the presence of
Pseudomonas syringae expressing AvrPphB. Relative expression levels of FRK1
mRNA following dip-inoculation with Pseudomonas syringae expressing AvrPphB
(Pst AvrPphB) in adf4/35S:ADF4_S6A and adf4/35S:ADF4_S6D determined by
quantitative real-time PCR (qRT-PCR), with amplification of UBQ10 as an
endogenous control. Error bars, representing mean ± SEM, are representative of two
technical replicates of two independent biological replicates (n = 4). Statistical
significance was determined using two-way ANOVA as compared to Col-0, with
Bonferroni post test, where *p<0.05. hpi = hours post inoculation.

Phosphorylation of ADF4 reduces its co-localization with F-actin, but does not
influence nuclear targeting

As shown above, phosphorylated ADF4 is required for the accumulation of RPS5
mRNA, as well as for resistance signaling in response to Pst AvrPphB (Figure 2.12).
Previous work has demonstrated the potential for nuclear localization of ADFs,
supportive of a role for actin and ADFs in regulating gene transcription (Burgos-Rivera
et al., 2008; Kandasamy et al., 2010; Meagher et al., 2010). To this end, we sought to
determine if translocation of ADF4 into the nucleus is dependent upon the
phosphorylation status of ADF4. As shown in Figure 2.15A, we found that ADF4,

	
  

60	
  

ADF4_S6A and ADF4_S6D are all present in the nucleus. These data would suggest
that perturbation of RPS5 expression in the adf4/35S:ADF4_S6A plants is not due to an
inability of phospho-null ADF4 to enter the nucleus. However, the phospho-null
ADF_S6A (ds-Red_ADF4) does show an increased co-localization with the actin
cytoskeleton (filamentous Actin Binding Domain 2-GFP; fABD2-GFP), as well as the
formation of filamentous like structures in the ADF4_S6A panel (Figure 2.15B).
Conversely, phosphomimetic ADF4_S6D is more diffuse within the cytosol and has
reduced co-localization with the actin cytoskeleton (Figure 2.15B).

To confirm our observations of a phosphorylation-specific alternation in the colocalization of our ADF4 isoforms (i.e., S6A versus S6D) with the actin cytoskeleton, we
next performed a red-green analysis on the collected images, calculating the overlap
coefficients, according to Manders (R). In short, this analysis will determine the actual
overlap of the red/green signals in our collected images (Zinchuk & GrossenbacherZinchuk, 2011), providing an in vivo quantification of the co-localization of ADF4 with the
actin cytoskeleton. As shown in Figure 2.15C, both ADF4_S6A and ADF4_S6D were
found to have a significant R-value, 0.697 ± 0.009 and 0.701 ± 0.009 respectively, with
significant differences in co-localization of ADF4_S6A and ADF4_S6D based on colocalization coefficients m1 and m2. For a red-green pairing, such as was performed in
our analysis, m1 refers to the fraction of red pixels co-localized with green pixels, while
m2 is the fraction of green pixels co-localized with red pixels. The m1 values for
ADF4_S6A and ADF4_S6D are 0.604 ± 0.032 and 0.485 ± 0.033 respectively, while the
m2 values are 0.250 ± 0.028 and 0.353 ± 0.030 (Figure 2.15C). The co-localization

	
  

61	
  

Figure 2.15. Confocal microscopy demonstrates phosphorylation of ADF4
affects cytoskeletal localization, but not nuclear localization.

	
  

62	
  

Figure 2.15 (cont’d)

Figure 2.15 (cont’d). Confocal microscopy demonstrates phosphorylation of
ADF4 affects cytoskeletal localization, but not nuclear localization. (A) Laserscanning confocal microscopy of adf4, adf4/35S:ADF4, adf4/35S:ADF4_S6A and
adf4/35S:ADF4_S6D isolated nuclei; DAPI stained nuclei (blue), immunochemistry
FITC (green), and overlay. Bar = 2 µm. (B) Images of transiently expressed fABD2GFP (green), dsRed- ADF4 _S6A/_S6D (red), and overlay in Nicotiana benthamiana
taken by laser-scanning confocal microscopy. Bar = 5 µm. (C) Graphical
representation of the overlay coefficient according to Manders (R) and the colocalization coefficients m1 and m2. Error bars, representing mean ± SEM, were
calculated from two biological repeats (n = 40). Overlap coefficient (R) is considered
to be co-localized when #R = 0.6 to 1.0, and co-localization coefficients indicate colocalization when *m1>0.5 and *m2>0.5.

	
  

63	
  

coefficients suggest a significant co-localization of ADF_S6A with fABD2, but not for
ADF4_S6D. In total, these observations are in agreement with previous reports of
phosphorylated cofilin having reduced binding to both G- and F-actin (Bamburg &
Bernstein, 2010).

Discussion

Understanding the mechanism(s) of pathogen effector recognition, as well as
elucidating the putative virulence function(s) of these secreted proteins, provides the
foundation for our understanding of innate immune signaling in plants (Knepper & Day,
2010). Using a combination of cell biology, biochemical, and genetics-based
approaches, we show that ADF4 is required for the specific activation of RPS5mediated resistance. In both plants and animals, the actin cytoskeletal network plays a
broad role in numerous cellular processes, including cell organization, growth,
development and response to external stimuli, including pathogen infection. Herein, we
propose a mechanism through which the expression of the R-gene RPS5 is under the
control of the actin binding protein ADF4, in a phosphorylation dependent manner,
independent of nuclear localization, which subsequently affects co-localization with
actin, suggesting a possible cytoskeletal role in gene transcription (Figure 2.16).

In animal cells, a complex signaling network involving Rho-GTPase activation, actin
cytoskeletal dynamics, and the interplay between pathogen virulence has been
extensively characterized (Day et al., 2011). In plants, however, the elucidation of the

	
  

64	
  

,&./%

!"#$%

1)...%

,-./0),"/%

)F-%

),#/%

C)#D%

&'()*+,%

EF-%

&AG6%

4%.56789%
&<!=%

&<!=% >% 1).%203%
)+:8*+:;&<!=%

>%

!"#$%

>%
>%

)F-%

&!'(%

?@AB9@8%

Figure 2.16. Proposed model illustrating the virulence and avirulence function
of the bacterial cysteine protease AvrPphB through an ADF4-dependent
mechanism. Following delivery of AvrPphB into the plant cells by Pst via the T3SS,
AvrPphB targets multiple innate immune signaling pathways, including: 1) PTI, via
the cleavage of BIK1 kinase; 2) ETI, via the cleavage of the kinase PBS1, a guardee
of the resistance protein RPS5. We propose a potential role for AvrPphB in the
modulation of actin cytoskeletal dynamics via the targeting of an unknown kinase
responsible for the phosphorylation of ADF4 that ultimately results in reduced
expression of RPS5, as well as specific down-regulation of MAP kinase signaling.
ADF4 translocation into the nucleus is independent of phosphorylation status,
however, F-actin co-localization and RPS5 gene expression are dependent upon the
phosphorylation of ADF4.
genetic link between pathogen virulence and the regulation of actin cytoskeletal
dynamics has only recently been described (Clément et al., 2009; Tian et al., 2009). In
plant-pathogen interactions, the effects of modulation to the host actin cytoskeleton
have been best characterized using a combination of pharmacological and cell biologybased approaches to monitor focal orientation of F-actin filaments to the site of infection
	
  

65	
  

during fungal pathogenesis (Takemoto & Hardham, 2004; Takemoto et al., 2006;
Hardham et al., 2007; Miklis et al., 2007; Hardham et al., 2008). As a first step towards
elucidating the mechanism of activation of RPS5-mediated resistance, we examined the
expression levels of Arabidopsis genes associated with resistance to Pst AvrPphB. We
observed a marked reduction in mRNA levels of the R-gene RPS5, while the protein
kinase PBS1 was not affected (Figure 2.1B, Figure 2.1C). Additionally, the mRNA levels
of R-genes unrelated to the recognition of AvrPphB were not affected in the adf4 mutant
(Figure 2.3B). From these data, we conclude that ADF4 is specifically required for the
expression of RPS5 and subsequent resistance to Pst AvrPphB.

The initiation of resistance signaling in plants following pathogen infection engages a
multitude of processes, including PRR activation (Chinchilla et al., 2007), MAPK
signaling (Asai et al., 2002) and transcriptional reprogramming (Pandey & Somssich,
2009). In the current study, our observation of a reduction in PTI-signaling in the adf4
mutant supports our hypothesis that RPS5 mRNA levels correlate with reduced levels of
RPS5 protein. In support of this, we observed a reduction in FRK1 transcript
accumulation in the presence of AvrPphB in both the adf4 and rps5-1 mutants. This
observation is in agreement with recent reports, including a study demonstrating a
physical interaction between FLS2 and RPS5, which would suggest that PTI and ETI
signaling is more interdependent than previously hypothesized (Qi et al., 2011).
Subsequent analysis of upstream MAPK components partially attributed diminished
FRK1 mRNA levels to a reduced activation of MPK3/6. Herein, we did not detect a
significant reduction in flg22-induced phosphorylation of MPK3/6 in either Col-

	
  

66	
  

0/pER8:AvrPphB or rps5-1/pER8:AvrPphB; however, in adf4/pER8:AvrPphB plants, a
significant reduction in MPK3/6 phosphorylation following flg22 treatment was observed
(Figure 2.10). MAPK signaling is often primarily associated with PTI (i.e. flagellin
activation of the FLS2 receptor); however, many reports have demonstrated the
necessity of these components for ETI. For example, in tomato (Solanum lycopersicum)
and tobacco (Nicotiana tabacum) the requirement of MAPK signaling-components for
AvrPto- and N-mediated ETI has been well documented (Ekengren et al., 2003; Jin et
al., 2003; Oh & Martin, 2011). Our data would suggest that in the case of AvrPphB, RAvr activation does not specifically induce MPK3/6 within 48 hours of estradiol-induced
expression of AvrPphB (Figure 2.10B). Furthermore, the absence of perturbation to
MPK3/6 in the rps5-1/pER8:AvrPphB suggest that while it appears recognition is
important for aspects of PTI-signaling i.e. FRK1 mRNA expression (Figure 2.5C),
MAPK-signaling specifically is independent of the need for recognition (Figure 2.10B).

One possible explanation for reduced MAPK-signaling in the absence of ADF4 reflects
the virulence activity of AvrPphB. Indeed, recent work has demonstrated a physical
interaction between BIK1 and the FLS2 receptor upon ligand activation – an association
that is required for the activation of PTI-signaling (Zhang et al., 2010). As a mechanism
linking with the virulence activity of AvrPphB with both PTI and ETI, cleavage of BIK1 by
AvrPphB results in reduced PTI-signaling in the absence of recognition (i.e. the rps5-1
mutant). Our observation of a reduction in MPK3/6 phosphorylation in adf4, but not Col0 nor rps5-1, would suggest an additional role for ADF4 in regulation of MAPKsignaling, while the reduced FRK1 in adf4 and rps5-1 as compared to Col-0, supports

	
  

67	
  

the aforementioned potential virulence activity of AvrPphB, as well as a possible role for
recognition (i.e. ETI) in the protection/recovery of the targeted PTI-signaling pathway.
Although the mechanism(s) utilized by Arabidopsis to preserve the integrity of the
MAPK- and PTI-signaling pathway are not yet fully understood, it is possible that ETIinduced SA accumulation, which has been demonstrated to prime and enhance
accumulation of MPK3/6, can be partially responsible for the recovery of MAPK
signaling in Col-0 (Beckers et al., 2009). Another possible contribution to the reduction
in PTI-signaling associated with loss of ETI is the aforementioned direct association of
FLS2 with RPS5 (Qi et al., 2011).

In plants, ADF localization is intimately associated with actin reorganization (Jiang et al.,
1997). At present, a full understanding of how translocation of ADFs into the nucleus
occurs has not been defined (Bamburg, 1999); moreover, the precise function within the
nucleus is unclear (Kandasamy et al., 2010). The current hypothesis is the translocation
of ADFs, as well as other ABPs, into the nucleus may serve a chaperone function
(Bamburg & Bernstein, 2010). In support of this, actin, as well as several actin-binding
proteins (including ADFs), has recently been shown to be present in the nuclei of
Arabidopsis (Kandasamy et al., 2010). This data support the hypothesis that in addition
to actin, ABPs and actin-related proteins (ARPs) may have specific functions within the
nucleus, including chromatin assembly and remodeling, as well as participation in
various steps of RNA transcription and processing (Castano et al., 2010; Kandasamy et
al., 2010). It is quite possible that ADF4 either facilitates nuclear translocation of specific
actin isoforms required for processes related to the expression of RPS5, or, ADF4 itself

	
  

68	
  

is required for gene expression (i.e., transcription), as has been demonstrated to be the
case for other ARPs. Mechanistically, however, it is unclear how ADF proteins are
translocated into the nucleus. Plant ADFs do not have a conserved nuclear localization
signal sequence, as is found in the vertebrate ADFs/cofilins; however, plant ADFs do
have two regions with basic amino acids which are similar to domains in other plant
proteins that function together as a nuclear localization signal (NLS; Shieh et al., 1993).
To date, the function of these domains has not been explored. Our data, as well as a
recent study by Kandasamy et al. (2010), suggests that these two regions of basic
amino acids may be both sufficient for translocation to the nucleus, which is not affected
by the phosphorylation status of ADF4 at serine-6 (Figure 2.15).

In the current study, we demonstrate that ADF4 phosphorylation influences both actin
cytoskeletal localization, and ultimately, RPS5 mRNA expression (Figure 2.12, Figure
2.15). In total, our data provide prima facie evidence for an actin-based regulatory
mechanism controlling R-gene expression, and further support the emerging hypothesis
that there are critical physiological roles for phosphorylated ADFs in plants (Bamburg &
Bernstein, 2010). Phosphorylation of cofilin, the predominant ADF found in animal cells,
is regulated in part through the action of LIM kinase (Bernard, 2007), and results in a
reduced affinity of cofilin for F-actin. To this end, ADF phosphorylation has commonly
been viewed as an inactivation mechanism, however, recent data suggest that this is
not the case (Bamburg & Bernstein, 2010). In plant-pathogen interactions, numerous
defense-associated processes are regulated by kinase phosphorylation (Shao et al.,
2003a; Zhang et al., 2010; Chung et al., 2011; Liu et al., 2011). Conversely, the

	
  

69	
  

regulatory mechanisms controlling the phosphorylation, and subsequent regulation of
actin dynamics, have not been well established, nor has the crosstalk between ADF
regulation and innate immune signaling been fully defined. One obvious disconnect in
the link between innate immune signaling and kinase activity in plants and animals is
that plants do not have a kinase family homologous to mammalian LIM kinases
(Bernard, 2007), and thus, ADF phosphorylation is likely mediated by the activity of
additional kinase(s), such as calcium dependent protein kinases (Allwood et al., 2002).
One interesting hypothesis in support of the work described herein is that the kinase
responsible for the phosphorylation of ADF4 may be a virulence target of AvrPphB. This
hypothesis is supported in part by Figure 2.1D, in which RPS5 expression is
significantly reduced in the rps5-1 point mutant following inoculation with Pst AvrPphB.
Additionally, the observed requirement of ADF4 for MAPK-signaling in the presence of
AvrPphB (Figure 2.10A) lends support for the idea of ADF4, or the kinases required for
its regulation as potential virulence targets. In this regard, such a mechanism would
further solidify a link between the virulence function and activity of AvrPphB and the role
of the actin cytoskeleton in controlling RPS5 transcription and disease signaling.

Methods and Materials
Plant growth, transformation, and bacterial growth assays

Arabidopsis plants were grown in a BioChambers walk-in growth chamber (model FLX37; Winnipeg, Manitoba, Canada) at 20 °C under a 12-hour light/12-hour dark cycle,
with 60% relative humidity and a light intensity of 100 µmol photons m-2s-1.

	
  

70	
  

Transformation of Arabidopsis, as well as selection of transformants, was performed as
described by Clough and Bent (Clough & Bent, 1998).
Pseudomonas syringae pv. tomato DC3000 (Pst) strains were grown as previously
described (Tian et al., 2009). Four-week-old plants were used for bacterial inoculations.
For growth assays and qRT-PCR analyses, whole plants were dip inoculated into
bacterial suspensions of 3 x 108 colony-forming units (cfu) mL-1 in 10 mM MgCl2
containing 0.1% Silwet L-77. Three 0.7 cm diameter leaf disks were collected from three
plants for bacterial growth assays, as previously described (Tian et al., 2009). The
hypersensitive response (HR) was analyzed by hand infiltrating bacterial suspension in
10 mM MgCl2 at 5 x 107 cfu mL-1 and scoring leaves for tissue collapse 20 to 24 hours
post inoculation.

flg22 infiltration was performed at a concentration of 1-10 µM in 10 mM MgCl2, as
previously described (Knepper et al., 2011b). Col-0 and adf4 plants were grown upright
on plates containing MS media for 10 days ± 10 nM flg22 in a GC8-2H growth chamber
(Environmental Growth Chambers LTD., Winnipeg, Manitoba, Canada) at 20 °C under a
12-hour light/12-hour dark cycle, with 60% relative humidity and a light intensity of 120
µmol photons m-2s-1. Analysis of flg22 inhibition of root growth was performed as
previously described (Chinchilla et al., 2007).

	
  

71	
  

Plasmid construction

The native promoter driven pMD1-g:ADF4 (g:ADF4) was constructed as described in
Tian

et

al.

(Tian

et

al.,

2009).

GCGGTCGACATGGCTAATGCTGCGTCAGGAATGG-3´

Primer

sequences

(forward

ADF4),

5´5´-

GCGGTCGACATGGCTAATGCTGCGGCAGGAATGG-3´ (forward ADF4_S6A), 5´GCGGTCGACATGGCTAATGCTGCGGACGGAATGG-3´ (forward ADF4_S6D) and 5´GCGGTCGACATGGCTAATGCTGCGTCAGGAATGG -3´ (reverse for all 3) were used
to add SalI restriction enzyme sites (underlined) for cloning ADF4 and its phosphomutants into pMD1:35S:T7 (Knepper et al., 2011b).

Nuclei isolation and immunocytochemistry

Nuclei isolations were conducted as described in Kandasamy et al. (2010).
Approximately 1g of 2- to 3-week old adf4/35S:ADF4, _S6A, and _S6D Arabidopsis
seedlings, grown upright on MS medium plates were used for each nuclear extraction.
The isolated nuclei were fixed on chrome alum slides, permeabilized, and incubated
with primary antibody T7-monoclonal (EMD Chemicals, Gibbstown, NJ, USA),
secondary anti-mouse IgG-FITC (Sigma-Aldrich) and DAPI (Sigma-Aldrich) before
imaging (Kandasamy et al., 2010).

	
  

72	
  

Laser-scanning confocal microscopy and co-localization analysis

Isolated nuclei and transiently expressed dsRed-ADF4 constructs, and fABD2-GFP
generated using Agrobacterium tumefaciens-mediated transient expression in Nicotiana
benthamiana, were imaged using laser confocal scanning microscopy using a 60x/1.42
PlanApo N objective on an Olympus FV1000 (Olympus America Inc, Center Valley, PA),
as described in Tian et al. (2011). Co-localization was performed utilizing FluoView
FV1000 (System Analysis Software, Olympus). An area of each image was selected for
analysis containing < 50 % fABD2-GFP occupancy in order to examine true colocalization and not artificial co-localization due to over abundance of fABD2-GFP.
Thresholds were set manually to account for background, and overlap coefficient
according to Manders (R), and co-localization coefficients m1 and m2 were generated
by the FV1000-ASW. Co-localization coefficient equations used can be found in Table
2.1.

RNA isolation and qRT-PCR analysis

Total RNA was extracted from leaves using the PrepEase Plant RNA Spin kit (USB
Affymetrix, Santa Clara, CA, USA). First-strand cDNA was synthesized from 1 µg total
RNA using the First-Strand cDNA Synthesis kit (USB Affymetrix). Primers used for
quantitative real-time PCR (qRT-PCR) are listed in Table 2.2. qRT-PCR was performed
using the Mastercycler ep Realplex system (Eppendorf AG, Hamburg, Germany), as
previously described (Knepper et al., 2011b), using the Hot Start SYBR Master mix 2X

	
  

73	
  

Table 2.1 Microscopy overlay equations.

(USB Affymetrix). Ubiquitin (UBQ10) was used as an endogenous control for
amplification. Fold Col-0 was determined using the following equation: (relative
expression)/(relative expression of Col-0 untreated), where “relative expression” = 2(- Ct),
Δ

where ΔCt = Ctgene of interest – CtUBQ10.
Statistical analysis
All data were analyzed using GRAPHPAD PRISM Software (San Diego, California,
USA). Values are represented as mean ±SEM. All statistical analysis was performed
using two-way ANOVA, followed by the Bonferroni post-test as compared to Col-0. In
Figure 2.5C, a two-way ANOVA, followed by the Bonferroni post-test was performed in
order to determine if there is a significant difference between rps5-1 and adf4. In Figure
2.2, an unpaired student t-test with a 95% confidence interval was performed to
determine if change over time was significant. P values ≤ 0.05 are considered
significant, where *p<0.05; **p<0.01 and ***p<0.005.
	
  

74	
  

Table 2.2 List of primers.

Immunoblot analysis

Western blot analysis of phosho-MPK3/6 was performed using 40 µg total protein,
utilizing anti-pTEpY (Cell Signaling Technology, Danvers, MA, USA), while analysis of
adf4/35S:ADF4_S6A and adf4/35S:ADF4_S6D was prerformed using 20 µg total
protein, utilizing anti-T7-HRP (EMD Chemicals, Gibbstown, NJ, USA), as previously
described (Knepper et al., 2011a).

2D IEF was performed on 500mg of total lysate from adf4/35S:ADF4 and

	
  

75	
  

adf4/35S:ADF4_S6A. The lysates were precipitated using chloroform:methanol (1:4)
and reconstituted in Urea buffer (7 M Urea, 2 M Thiourea, 2% CHAPS, 2% ASA-14, 50
mM DTT, 0.2% Biolyte ampholytes and 0.1% bromophenol blue). Isoelectric focusing
was conducted according to manufacturing guidelines at the proteomics core at
Michigan State University Research Technology Support Facility (Bio-Rad). Immunoblot
analysis was performed as above.

Acknowledgements

We would like to thank Doug Whitten (MSU RTSF) for assisting with the 2D IEF,
Melinda Frame and Elizabeth Savory for confocal microscopy assistance, Caitlin
Thireault for assisting with screening of adf4/35S:RPS5-sYFP lines, and Alyssa
Burkhardt and Jeff Chang for critical reading of the manuscript. Special thanks to Roger
Innes for providing the AvrPphB C98S catalytic mutant and the RPS5-sYFP construct.

	
  

76	
  

CHAPTER 3
In silico comparison of Arabidopsis thaliana actin depolymerizing factors AtADF1
and AtADF4 identify subtle biochemical features that support their distinct
cellular functions.

The AtADF1 and AtADF4 structural modeling was performed by Leann Buhrow; Cell
and Molecular Biology graduate program at Michigan State University. The floral dip
transformation and maintenance of Arabidopsis thaliana adf4 mutant transformation
plant lines described within were performed with the aid of Jessica Schein; Cell and
Molecular Biology graduate program at Michigan State University.

	
  

77	
  

Abstract

Plant actin depolymerizing factors (ADFs) are a conserved family of proteins
represented by multiple distinct members. This is in contrast to other eukaryotes; e.g.,
yeast that have only one ADF and humans that possess three ADFs. The plant ADF
family is a large and ancient clade, and the possession of multiple members within the
family is estimated to have occurred prior to the divergence of monocots and dicots.
Given that plants have such a multitude of ADFs, it would not be unexpected that some
of the ADFs may have adopted additional cellular functions in addition to the regulation
of the actin cytoskeleton. One such example is that of Arabidopsis ADF4 (AtADF4),
which, as I have shown in the last chapter, plays a role in immune signaling and the
regulation of gene expression. Specifically, AtADF4 is required for resistance to
Pseudomonas syringae containing the bacterial effector AvrPphB (Pst AvrPphB) and
the expression of the resistance gene Resistance to Pseudomonas syringae-5.
Interestingly, AtADF4 possesses high sequence identity to Arabidopsis ADF1 (AtADF1),
the mutant of which, adf1, is resistant to Pst AvrPphB. Due to this high sequence
identity, and yet differing immunity phenotypes, I have chosen to utilize computational in
silico analysis to explore the differential amino acid residues between AtADF1 and
AtADF4. In this chapter I outline my findings of these comparisons and propose a suite
of AtADF1 and AtADF4 chimeric proteins, as well as single point mutations, which will
allow me to gain insight into the important amino acid residue(s) that contribute to the
unique cellular roles of AtADF4.

	
  

78	
  

Introduction

Actin Depolymerizing Factors (ADFs) represent a large and highly conserved class of
actin binding proteins (ABPs) whose function – analogous to the mammalian ADF/cofilin
family of proteins – is the regulation of the stochastic eukaryotic actin cytoskeleton (Day
et al., 2011; Bamburg & Bernstein, 2010). At a fundamental level, ADFs alter the
organization and dynamics of the actin cytoskeleton by depolymerizing pointed
filamentous (F-) actin in to globular (G-) actin monomers, which in turn, can be acted
upon by additional ABPs, in order to be reincorporated into the barbed ends of growing
actin filaments. Collectively, this process of filament assembly and disassembly is
modeled as a process referred to as treadmilling (McGough et al., 1997; Bugyi &
Carlier, 2010; Day et al., 2011). Although the mechanism is not well understood, plant
ADFs have been identified to, in addition to their better characterized function of
depolymerizing actin, sever actin filaments and act to assist in the bundling of multiple
actin filaments to form stable actin cables (Tholl et al., 2011; Henty et al., 2011).

While lower eukaryotes, such as yeast, have as few as one ADF, higher eukaryotes
tend to have more than one; for example, mammals have 3 ADF/Cofilin proteins,
whereas the model plant Arabidopsis thaliana has 11 expressed ADFs. The 11
Arabidopsis ADFs (AtADFs) can be divided into four subclasses based on amino acid
sequence alignments, suggesting that plant ADFs may have a variety of functions
(Poukkula et al., 2011; Ruzicka et al., 2007). The differences between developmental,
and tissue-specific expression of the four subclasses AtADFs, suggest that these

	
  

79	
  

proteins have a wide assortment of cellular and tissue-specific functions. This is best
exemplified by the differing expression and subcellular localization of AtADF subclass I
and AtADF subclass II. The AtADFs in subclass I, including AtADF1, AtADF2, AtADF3
and AtADF4 are expressed in a vegetative pattern throughout the whole plant excluding
pollen during all developmental stages, and at the subcellular level are expressed both
in the cytosol and nucleus (Ruzicka et al., 2007; Kandasamy et al., 2010; Porter et al.,
2012). AtADF subclass II, containing AtADF7, AtADF8, AtADF10 and AtADF11, unlike
subclass I, are only expressed in the cytosol and can be divided into two smaller clades
dependent upon their tissue specific expression patterns within the plant. The first clade
containing AtADF7 and AtADF10, which are expressed in a reproductive pattern, are
specifically expressed in pollen and pollen tubes while the second clade containing
AtADF8 and AtADF11 are expressed in certain cells of the root system and at the tips of
fast growing cells (Ruzicka et al., 2007).

As an experimental demonstration of the tissue- and developmental- specific roles and
interactions of the various subclasses of ADFs, it was determined that the ectopic overexpression of Arabidopsis reproductive actin AtAct1 in vegetative tissue would cause
morphological defects in the plant. Such defects include dwarfism, which is alleviated by
ectopic over expression of either subclass II members, AtADF7 or AtADF8, but not
AtADF9, a member of subclass III (Kandasamy et al., 2007). Interestingly, when the
ADFs of rice, Oryza sativa L. (OsADFs), are grouped in phylogeny based upon amino
acid sequence similarities with AtADFs, four subclasses are also observed. The
grouping of rice ADFs results in an apparent division based upon vegetative and

	
  

80	
  

reproductive OsADFs (Feng et al., 2006). Taken together, these amino acid sequence
phylogenies and expression pattern clustering of rice and Arabidopsis ADFs suggest
that the multi-protein, and most likely multi-functional nature of plant ADF families
existed before monocots and dicots diverged (Feng et al., 2006; Ruzicka et al., 2007).

ADF proteins possess a 13-19kDa domain known as the actin depolymerizing factor
homology domain (ADF-H domain), a region of the protein required for F-actin
disassembly that in most true ADFs, represents nearly the entire protein (Bamburg &
Bernstein, 2010; Poukkula et al., 2011). As a primary driver for ADF/Cofilin function, the
ADF-H domain is required for binding F- and G- actin; however, in a few rare instances,
the ADF-H domain does not enable proteins to bind both forms of actin, but instead
binds either F- or G- actin, or neither (Poukkula et al., 2011). A characterized example
of the latter is that of mammalian glia maturation factor, which does not interact directly
with actin, but instead binds Arp2/3 (Poukkula et al., 2011).

Structurally, the ADF-H domain consists of 5 mixed internal β-strands, of which the two
most carboxyl-terminal strands are parallel, surrounded by 4 α-helicies, 2 on each face
of the domain (Poukkula et al., 2011). In the case of AtADF1, and predicted for AtADF4,
there are 6 β-strands, only 5 of which are internal (Poukkula et al., 2011; Dong et al.,
2013; Figure 3.1A). While the crystal structure of both the N-terminal ADF-H domain of
mammalian gelsolin, an ABP that contains 6 ADF-H domains and severs actin, and the
C-terminal ADF-H domain of twinfilin, a two ADF-H domain containing protein from
yeast and drosophila, have been solved in complex with bound actin, this is not the

	
  

81	
  

Figure 3.1. Structural comparison and sequence alignment of AtADF1 and
AtADF4.
	
  

82	
  

Figure 3.1 (cont’d). Structural comparison and sequence alignment of AtADF1
and AtADF4. A.) Side by side comparison of the AtADF1 (left) and AtADF4 (right)
structural models. The β-strands and α-helices are numbered and the red arrows
indicate the region within the two structures with the largest predicted difference in
amino acid sequences. B.) Sequence alignments of AtADF4 and AtADF1. The βstrands are indicated by purple lines, while the α-helices are indicated by orange
lines. Differing amino acids are highlighted in blue. The phosphorylatable serine
residue is highlighted in red, while the tyrosine-53 residue, predicted to be
phosphorylated in AtADF4, is bolded and is denoted by an asterisk. The region of
swapped amino acids in the formation of the chimeric proteins is underlined in red.
case for Arabidopsis ADFs (Burtnick et al., 2004; Paavilainen et al., 2008). Although the
structure of the ADF-actin interaction of plants has not been solved, experimental
evidence exists whereby site directed mutagenesis of AtADF1 has identified that two
residues within α3, arginine-98 and lysine-100, are important for both F- and G- actin
binding (Dong et al., 2013; Figure 3.1B). These findings are in agreement with what has
been previously observed in the site directed mutagenesis studies of mammalian
ADF/cofilin and Drosophila twinfilin, both of which studies determined that in addition to
α3, the unstructured N-terminus as well as the loop area prior to the C-terminal α-helix
are also involved in G-actin binding (Paavilainen et al., 2008; Poukkula et al., 2011). A
second apparent function of these two residues within the α3 is the proper
depolymerization of actin, as the AtADF1R98AK100A mutant has a severely reduced ability
to depolymerize F-actin in vitro (Dong et al., 2013). This work, as well as the work of
others has further identified residues important for F-actin binding, but not G-actin
binding; specifically, these studies showed that lysine-82 of β5 and both arginine-135
and arginine-137 of α4 all play critical roles in the binding of ADF1 to F-actin (Ono,
2007; Lappalainen et al., 1997; Dong et al., 2013; Figure 3.1B).

	
  

83	
  

In addition to the importance of the above identified specific residues for AtADFs
binding to and depolymerizing actin, ATP/ADP loading, as well as monomeric or
polymeric actin interactions have also been shown to affect interactions between ADFs
and actin (Tian et al., 2009; Carlier et al., 1997; Day et al., 2011). The stochastic cycling
of actin from monomeric G-actin to filamentous F-actin and back again begins with ATP
loaded G-actin (G-actinATP), which can spontaneously from heterotrimeric complexes in
a concentration dependent manner, through a process known as actin nucleation (Day
et al., 2011; Campellone & Welch, 2010). This initial actin nucleation however is
kinetically expensive and therefore, is often aided by the ABP Arp2/3, which mimics
dimeric actin allowing for more energetically favorable actin nucleation (Day et al., 2011;
Mathur et al., 2003). Once this initial step is achieved additional G-actinATP are
incorporated into the pointed end and F-actin elongates and matures, hydrolyzing
actinATP to actinADP-Pi and eventually to actinADP (Day et al., 2011; Bugyi & Carlier, 2010).
Upon dissociation of Pi from actinADP-Pi the barbed end of F-actin becomes less
structurally secure and more susceptible to dissociation to monomeric actinADP
(Poukkula et al., 2011; Day et al., 2011). Cofilin itself has been demonstrated to
enhance the dissociation of Pi from actinADP-Pi thus increasing the recruitment of
additional cofilin to further promote actin depolymerization (Poukkula et al., 2011;
Blanchoin et al., 2000). When interacting with F-actin, ADFs preferentially bind FactinADP and promote actin disassembly either by severing F-actin or through the
depolymerization of single G-actinADP by altering the twist of the F-actin polymer, thus
destabilizing the barbed end (McGough et al., 1997; Carlier et al., 1997; Henty et al.,
2011). The resulting free G-actinADP is then recharged with ATP, typically via the activity

	
  

84	
  

of cyclase-associated protein (CAP), and sequestered by profilin (PRF) until it is reincorporated into F-actin (Day et al., 2011; Barrero, 2002; Sun et al., 2013).

Given the substantial influence ADFs have on the organization of the actin cytoskeleton,
it is important that the cell possesses the biochemical mechanism(s) required for the
regulation of ADF/cofilin actin binding, severing, and depolymerization activity. In short,
the primary mechanism for this regulation is the phosphorylation at a N-terminal serine
residue (Ressad et al., 1998; Smertenko et al., 1998). While it is unclear if
phosphorylation of serine directly inhibits the ability of ADF to depolymerize actin, it has
been demonstrated that phosphorylation does significantly reduce ADFs’ ability to
interact with F- and G-actin (Ressad et al., 1998; Smertenko et al., 1998; Porter et al.,
2012). In plants, it has been demonstrated that calmodulin-like domain protein kinases
are capable of phosphorylating ADFs of both Arabidopsis, AtADF1 and maize, ZmADF3
(Dong & Hong, 2013; Allwood et al., 2001). Whether serine is the only residue of plant
ADFs that can/is being phosphorylated is still a point of interest (Dong & Hong, 2013;
Porter et al., 2012).

My work outlined in the last chapter, as well as the work of others have suggested noncanonical roles for AtADF4 in immune signaling and gene expression (Chapter 2; Tian
et al., 2009; Porter et al., 2012; Henty-Ridilla et al., 2014). In addition to what I have
demonstrated in Chapter 2, it has been reported that AtADF4 is required for the
dynamic reorganization of the actin cytoskeleton observed during recognition of
pathogen associated molecular patterns (PAMPs), specifically elongation factor-Tu

	
  

85	
  

(Henty-Ridilla et al., 2014). Moreover, this finding is in further support that AtADF4 and
the actin cytoskeleton are key components of the basal immune response referred to as
PAMP-triggered immunity (PTI; Chisolm et al., 2006; Henty-Ridilla et al., 2014). I have
also demonstrated that AtADF4 also plays a role in the second phase of plant immunity;
often referred to as effector-triggered immunity (ETI; Chisholm et al., 2006). Specifically,
I have shown that AtADF4 is required for the expression of Resistance to Pseudomonas
syringae-5 (RPS5), the resistance protein that recognizes the bacterial effector AvrPphB
(Chapter 2; Porter et al., 2012). My finding were in addition to work done previously in
our lab, that when challenged with Pseudomonas syringae containing AvrPphB (Pst
AvrPphB), the AtADF4 mutant (adf4) has reduced expression of Pathogen related
protein 1 (PR1), a resistance related gene, and also a loss of the hypersensitive
response (HR), a phenotype suggestive of a resistant interaction in Arabidopsis (Tian et
al., 2009).

In addition to the characterization of the disease phenotypes for the adf4 mutant, Tian et
al., (2009) examined two other class I ADF mutants for their disease phenotypes to Pst
AvrPphB. They demonstrated that both the AtADF1 mutant (adf1) and AtADF3 mutant
(adf3) are resistant Pst AvrPphB, while the adf4 mutant plant is susceptible to Pst
AvrPphB (Tian et al., 2009). These findings are of interest due to the close relation of
AtADF1 and AtADF4 (Ruzicka et al., 2007). In this chapter, I utilize the high sequence
identity of AtADF1 and AtADF4 to identify biochemical features of AtADF4 that may
account for the unique immunity related roles of AtADF4 through an in silico approach.

	
  

86	
  

The work presented herein will allow for additional, well-focused in planta follow up
experiments.

RESULTS
Arabidopsis actin depolymerizing factor-4 and -1 are highly homologous, yet the
mutant plants adf1 and adf4 have differing disease phenotypes

As described above, the adf4 mutant is susceptible to Pst AvrPphB, while the adf1
mutant is resistant (Tian et al., 2009). The differences in the resistance phenotypes of
adf1 and adf4 to Pst AvrPphB, is due in part to the inability of adf4 to express RPS5,
and therefore recognize AvrPphB; while adf1 should properly express RPS5 (Porter et
al., 2012). In order to confirm this, we examined mutant adf1 and compared the
expression of RPS5 to wild type Col-0 as well as the adf4 mutant (Figure 3.2). As
shown in Figure 3.2, the adf1 mutant expresses RPS5 at near wild-type levels, which
allows the adf1 mutant plant to recognize AvrPphB and therefore the mutant is resistant
to Pst AvrPphB.

These results are interesting given that AtADF1 and AtADF4 are 97% homologous with
a 93.5% amino acid sequence identity, as determined by NCBI Blast and CLUSTAL
Omega (Figure 3.1B). In order to better understand what implications the nine differing
amino acids between AtADF1 and AtADF4 would have on the structure of the proteins,
models were generated of both AtADF1 and AtADF4 (Figure 3.1A). As shown by the
red arrows, the free loop between β3 and α2 appears to have the largest region of
	
  

87	
  

Figure 3.2. Expression of resistance to Pseudomonas syringae-5 in AtADF1
mutant (adf1) and AtADF4 mutant (adf4) as compared to wild-type Col-0. The
relative expression levels of RPS5 were determined by qRT-PCR.
structural difference. This result is logical, given that four of the nine amino acid
differences are located within this region of AtADF1 ad AtADF4 (Figure 3.1B).

In silico analysis of differing amino acids in AtADF1 and AtADF4 that may
account for the unique cellular function of AtADF4

We decided to use the high amino acid sequence identity of AtADF1 and AtADF4 to our
advantage in deciphering their differing cellular functions. Initial in silico analysis of the
amino acid sequences of AtADF1 and AtADF4 revealed two amino acids that were
unfavored when changed in the AtADF4 with the amino acids from AtADF1. Both SIFT

	
  

88	
  

Table 3.1. Amino acid substitutions of AtADF1 and AtADF4. This table displays
the SIFT score values of amino acid substitutions where either AtADF1 or AtADF4 is
proposed to have the nine amino acids of the other in substitution for their own. All
SIFT substitutions are predicted to be tolerated, as only scores <0.05 are not
tolerated. Additionally, BLOSUM62 values are shown which examine the favorability
of individual amino acid substitutions in the without regard to the surrounding
sequences. Positive BLOSUM62 values are favorable, while negative values are less
favorable.
analysis and the BLOSUM62 amino acid substitution table, summarized in Table 3.1,
suggest that the substitution of AtADF4 leucine-51 for AtADF1 glutamine-51 and
AtADF4 serine-59 for AtADF1 cysteine-59 are the least favorable (Ng, 2003; Henikoff &
Henikoff, 1992). This information as well as the relatively dense region of differing
amino acids between β3 and α2 resulting in an alteration of the free loop, led me to
decide to swap the four amino acids between glycine-47 and leucine-60, as indicated by
the red underline in Figure 3.1B, to generate AtADF1 and AtADF4 chimeric proteins to
test the effect of multiple amino acid substitutions at once (Figure 3.1A; 3.1B). The
resulting AtADF1Q48E, Q51L, E55D, C59S and AtADF4E48Q, L51Q, D55E, S59C chimeric proteins will
then be used to complement the adf4 mutant to determine the importance of the
substituted amino acids in the expression of RPS5 and resistance to Pst AvrPphB

	
  

89	
  

Table 3.2. List of protein constructs and their predicted ability to complement
the adf4 mutant for expression of RPS5 and resistance to Pst AvrPphB.
(Table 3.2). It is expected that complementation of adf4 with 35S:T7-AtADF1Q48E, Q51L,
E55D, C59S

will restore RPS5 expression, while complementation with 35S:T7-AtADF4E48Q,

L51Q, D55E, S59C

will not. Additionally, due to the very low SIFT score of the substitution of

glutamine for leucine at position 51 I have also developed individual amino acid
substitution constructs to examine the impact of this specific substitution within the
above described region (Table 3.2). If the SIFT predictive software is correct in the
identification of this amino acid substitution as the least favorable, the 35S:T7AtADF1Q51L construct may indeed be capable and sufficient to restore both RPS5
expression and resistance to Pst AvrPphB in the adf4 mutant. Conversely, the
substitution of leucine to glutamine at position 51 may be the minimal required change
to AtADF4 to alter its ability to participate in the expression of RPS5 and subsequent

	
  

90	
  

resistance to Pst AvrPphB, thus the 35S:T7-AtADF4L51Q complementation of adf4 would
not result in restoration to wild-type function with regard to immunity.

Phosphorylation prediction software reveals potential differing secondary
phosphorylation site(s) between AtADF1 and AtADF4

AtADF4 does not only have to be present for resistance to Pst AvrPphB and expression
of RPS5, but must also be phosphorylated at serine-6 (Tian et al., 2009; Porter et al.,
2012). To confirm the necessity of the phosphorylation of serine-6, as well as the
importance of the four amino acids of the AtADF1 and AtADF4 chimeras, I have
developed serine-6 phosphorylation mutants of the chimeric proteins (Table 3.2). I
believe that similar to what was observed in Chapter 2, the phosphorylation mimic
35S:T7-AtADF1S6D

Q48E, Q51L, E55D, C59S

will complement the adf4 mutant and restore

RPS5 expression, because this chimeric phosphomimic will possess both the mimicked
phosphorylation at serine-6 and the swapped four amino acids expected to be required
for RPS5 expression. Additionally, neither the 35S:T7-AtADF4S6D, E48Q, L51Q, D55E, S59C nor
the two phosphorylation null mutants; 35S:T7-AtADF1S6A,
35S:T7-AtADF4S6A,

E48Q, L51Q, D55E, S59C

Q48E, Q51L, E55D, C59S

, and

, should complement the adf4 mutant. Taken

together these complements should confirm the importance of one or more of the
substituted amino acids, as well as reiterate the requirement of phosphorylation of
serine-6 for the AtADF4 dependent expression of RPS5.

	
  

91	
  

While the impact of the phosphorylation of serine-6 of plant ADFs has been well
documented as a cellular mechanism to regulate the affinity of ADFs for actin, and
therefore their ability to depolymerize F-actinADP, as well as the apparent requirement
for AtADF4 to be phosphorylated at serine-6 for proper gene expression,
phosphorylation of additional amino acids is less apparent (Porter et al., 2012; Dong &
Hong, 2013; Ressad et al., 1998; Smertenko et al., 1998; Allwood et al., 2001). The
recent report from Dong & Hong (2013) demonstrated that AtADF1 is phosphorylated at
serine-6 by the calmodulin-like domain protein kinase (CDPK6). This report is useful in
that, with the additional works in maize, it demonstrates the importance of calcium
signaling and calmodulin-like protein kinases in the regulation of ADFs by
phosphorylation, and ultimately the remodeling of the actin cytoskeleton. This report
was not able to definitively determine that serine-6 is the only phosphorylation site of
AtADF1 (Dong & Hong, 2013; Allwood et al., 2001; Smertenko et al., 1998).
Additionally, as I demonstrated in Chapter 2, serine-6 is confirmed to be a
phosphorylatable residue of AtADF4 by 2D electrophoresis; however, there are
additional isoelectric focused points on the 2D gel in both AtADF4 and the phospho-null
AtADF4S6A (Chapter 2; Porter et al., 2012).

In order to identify alternative phosphorylated residues of AtADF1 and AtADF4,
NetPhos 2.0 server software was used to predict the phosphorylation potential of each
residue (Blom et al., 1999; Table 3.3). It should be noted, that while NetPhos 2.0 server
software does not predict the phosphorylation of serine-6 in either AtADF1 or AtADF4,
the software also fails to predict phosphorylation of serine-3 in mammalian cofilin1,

	
  

92	
  

Table 3.3. Predicted phosphorylation residues of AtADF1 and AtADF4. NetPhos
2.0 software was used to analyze the potential of all the serine, tyrosine and
threonine to be phosphorylated within AtADF4 and AtADF1. A score >0.5 indicates a
predicted phosphorylation potential. The N/A for AtADF1 at serine-59 is because
AtADF1 has a cysteine at position 59.
which is a well-established phosphorylated residue of cofilin1 (Ressad et al., 1998;
Table 3.3; Table 3.4). Of interest is the potential phosphorylation of tyrosine-67 and 103, which are residues identical to those in maize found to be important for G- and Factin binding (Jiang et al., 1997). Specifically, it was demonstrated that mutation of
tyrosine-103 and alanine-104 to phenylalanine and glycine respectively resulted in a
reduced affinity for both F- and G- actin; while mutation of tyrosine-67 and -70 to
phenylalanine prevented binding to F-actin completely with no effect on G-actin affinity
(Jiang et al., 1997).

	
  

93	
  

Table 3.4. Cofilin 1 phosphorylation prediction. NetPhos 2.0 software was used to
analyze the potential of all the serine, tyrosine and threonine to be phosphorylated
within Cofilin 1. A score >0.5 indicates a predicted phosphorylation potential.

The aforementioned residues should be considered for additional analysis, however,
what is most interesting to the current study is the difference in the potential of
phosphorylation of tyrosine-53 (Table 3.3). It appears that AtADF4 tyrosine-53 is
capable of being phosphorylated while the exact same residue in AtADF1 is not
predicted to possess a phosphorylation potential (Table 3.3). This finding is given
further credence because the tyrosine-53 is located within the region of amino acids that

	
  

94	
  

was originally swapped in the construction of AtADF1 and AtADF4 chimers, due to the
clustering of four different amino acids (Figure 3.1). In order to test the involvement of
tyrosine-53 phosphorylation in AtADF4’s regulation of gene expression, various
tyrosine-53 to phenylalanine-53 mutants were constructed utilizing Quick change PCR
(Table 3.5). If phosphorylation of tyrosine is required for expression of RPS5, it is
expected that the 35S:T7-AtADF4Y53F will not complement the adf4 mutant’s loss of
RPS5 expression as 35S:T7-AtADF4 has in previous works (Table 3.5; Porter et al.,
2012). Additionally, Quick change PCR was performed on the chimeric proteins as well
to determine the contribution of the amino acids from AtADF4, as well as the
contribution of phosphorylation of tyrosin-53 will play in immunity (Table 3.5).

Within the focus of the above AtADF1 and AtADF4 chimeric proteins with regard to
tyrosine-phosphorylation I next sought to examine the role of individual amino acids that
differ between AtADF1 and AtADF4 and how they would effect the aforementioned
phosphorylation of tyrosine. To achieve this, I ran the NetPhos 2.0 software on AtADF1
with single insertions of AtADF4 amino acid residues within the swapped region and
determined how each amino acid substitution would effect the phosphorylation potential
of tyrosine-53. I found that while neither the substitution of glutamic acid-48, leucine-51,
nor cysteine-59 would change the potential of phosphorylation at tyrosine-53,
substitution of aspartic acid at position 55 would allow for the predicted phosphorylation
of tyrosine-53 in AtADF1. Because of these findings I have created a single point
mutation construct, AtADF1E55D, to test the requirement of aspartic acid at position 55
for the phosphorylation of tyrosine-53 (Table 3.5). Additionally, this construct will be

	
  

95	
  

Table 3.5. List of phosphorylation-related protein constructs and their
predicted ability to complement the adf4 mutant for expression of RPS5 and
resistance to Pst AvrPphB.
used to examine its ability to complement the adf4 mutant for resistance to Pst AvrPphB
and expression of RPS5. This construct is very interesting in that it has the potential to
address three facets of AtADF4’s role in immunity. Complementation of adf4 with
35S:T7-AtADF1E55D would identify the minimal amino acid substitution required for the
immune function of AtADF4, while simultaneously confirming the necessity of tyrosine53 phosphorylation and the dependence of aspartic acid-55 for said phosphorylation.

Comparison of AtADF4 and AtADF1 with other plant ADFs

Recent work using other plant species, including Triticum aestivum (wheat) and Oryza
sativa (rice), has identified potential roles for ADFs in immune signaling and resistance
(Cheng et al., 2013; Fu et al., 2014). In rice, for example, the OsADF mutant displayed
enhanced susceptibility to both the fungal pathogen Magnaporthe grisea and the
bacterial pathogen Xanthomonas oryzae pv oryzae (Cheng et al., 2013). A reduction in
the expression of defense genes including PR1a, was also observed, which relates to
what was found in the adf4 mutant of Arabidopsis (Tian et al., 2009; Cheng et al., 2013).
Fu et al., (2014) found that silencing the tree copies of TaADF7 in wheat resulted in
enhanced susceptibility to the fungal pathogen Puccinia striiformis f. sp. trici (Fu et al.,
	
  

96	
  

2014). Interestingly, similar to what was observed in Tian et al., 2009, both HR and
expression of PR1 were also reduced in the wheat TaADF7 mutant (Tian et al., 2009;
Fu et al., 2014).

Based on the above functions of ADFs in broader immune signaling pathways, I
decided to use CLUSTAL Omega alignment software to compare the sequences of
AtADF1 and AtADF4 with the wheat TaADF7 sequence, including AtADF3 as a control
for the differences among class I AtADFs (Figure 3.3). The adf3 mutant also expresses
RPS5 at wild type levels, as well is resistant to Pst AvrPphB (Tian et al., 2009; Porter et
al., 2012). Surprisingly, TaADF7 shared all of the AtADF4 amino acid residues within
the swapped region used in the creation of the chimeric proteins (Figure 3.3).
Additionally, AtADF4 was most similar with TaADF7 as compared to the other AtADFs
with 79.86% sequence identity. AtADF3 does possess aspartic acid at position 55,
however AtADF3 does not have tyrosine at position 53, but instead has a histone
(Figure 3.3).

In an attempt to rule out the possibility that the immunity phenotype in wheat TaADF7
mutant was not due to a different function of TaADF7 with regard to actin-binding or
modification of the actin cytoskeleton via bundling or severing I sought to identify
studies that found plant ADFs known to preform these functions and have a reduced
ability to depolymerize actin. It should be noted that both AtADF1 and AtADF4 have
been demonstrated to both sever and depolymerize F-actin (Tian et al., 2009; Henty et
al., 2011). These findings, along with other recent data, suggest that severing may be a

	
  

97	
  

Figure 3.3 Sequence alignments of AtADF1, AtADF3, AtADF4 and TaADF7.
Differing amino acids are highlighted in blue. The phosphorylatable serine residue is
highlighted in red, while the tyrosine-53 residue, which is predicted to have the
potential to be phosphorylated in AtADF4 and TaADF7, is bolded and is denoted by
an asterisk.
key mechanism of ADFs for filament turnover (Henty et al., 2011; Andrianantoandro &
Pollard, 2006; Roland et al., 2008). With regard to plant ADFs with an enhanced ability
to bundle F-actin, a recent study by Tholl et al. (2011) found that AtADF9 does not
depolymerize, but instead acts to stabilize and bundles F-actin. This study focused on

	
  

98	
  

functional data as well as potential changes in the secondary structure of AtADF9,
specifically in the F-actin binding pocket (Tholl et al., 2011).

I decided to use this information and the sequence of AtADF9 in combination with what
is known about important residues for actin binding to determine if TaADF7 shared any
similarities with the differing amino acids of AtADF9 that may account for its bundling
activities (Tholl et al., 2011; Ono, 2007; Lappalainen et al., 1997; Dong et al., 2013).
Initially, I used CLUSTAL omega to perform sequence alignments between AtADF1,
AtADF4, AtADF9 and TaADF7; I have highlighted the regions that I will examine further
with respect to actin binding (Figure 3.4). Next the SIFT amino acid substitution
software was utilized to examine the differing amino acids between AtADF1 and
AtADF9 because these are the two proteins that were examined for function differences
in actin binding in the original manuscript (Table 3.6). It was determined that there are
two unfavorable substitutions predicted by SIFT software, the arginine-82 to methionine
and asparagine-139 to lysine (Table 3.6). These findings are interesting because
arginine-82 has been demonstrated to be important for F-actin binding, and furthermore
has a BLOSUM 62 value of -1, indicating an unfavorable substitution (Ono 2007;
Lappalainen et al., 1997; Table 3.6). Asparagine-139 has not been demonstrated to be
required for F-actin binding, but is close to arginine-137 and has a SIFT score of 0.00,
which is predicted to be deleterious to the function of the protein (Table 3.6). It should
be noted that three of the five amino acids demonstrated to have a role in actin binding
in AtADF1 are completely unchanged in AtADF9, which may allow for binding of
AtADF9 to F-actin, but alter the interaction such that instead of depolymerizing F-actin,

	
  

99	
  

!"!#$%& )&&&&&&&&&&&&*&+&,&$&&
-& !"
-& !"
!"!#$'& )&&&&&&&&&&&&*&+&,&$&&
45647&
.& #"
!"!#$(& )&&&&&&&&&&&&*&+&,&$&&
-& !"
;<!#$7& )&&&&&&&&&&&&*&+&,&$&&

+& 0& $" *& !"/&,"
0& $& $" *&
+& 0& $" *& !"/&," %896%8'& 0& 2& !" *&
.& ,& $" 1& !"/&,"
+& ,& %" #&
.& 0& $" *& !"/&,"
0& ,& %" =&

$" !& 3&
$" 0& 3& %:(6%'%&
$" !& +&
$" !& 3&

Figure 3.4 Sequence alignments of actin binding regions of AtADF1, AtADF4,
AtADF9 and TaADF7. Differing amino acids not demonstrated to be required for
actin binding are highlighted in blue, while amino acids required for actin binding are
highlighted in green. The residues required for actin binding are denoted in red text.
The amino acid position numbering is different because AtADF9 has 141 amino
acids, while AtADF1, AtADF4 and TaADF7 have 139 amino acids.

AtADF9 instead bundles F-actin. Taken together with the functional data from Tholl et
al. (2011), the amino acids identified above were used to compare AtADF4 and TaADF7
to AtADF9 (Table 3.6).

Similar to what was found in the AtADF1 comparison to AtADF9, both AtADF4 and
TaADF7 possess an arginine at position 82, while AtADF9 has a methionine, resulting
in a lower SIFT score and -1 BLOSUM62 score (Table 3.6). Additionally, both AtADF4
and TaADF7 have asparagine-139 as compared to lysine-141 of AtADF9 resulting in a
SIFT score of 0.00, which again is predicted to be deleterious to protein function (Table
3.6). Interestingly, the valine-138 to alanine-140 substitution between AtADF4 and
AtADF9 also has a SIFT score of 0.00, while this same substitution between AtADF4
and either AtADF1 or TaADF7 results in a SIFT score of 0.78 (Table 3.1; Table 3.6).
This output is most likely due to the SIFT parameters, which take into account
neighboring amino acids in its comparison (Ng, 2003). The low SIFT score seen is this
substitution between AtADF4 and AtADF9 is most likely due to the additional differing
amino acid at position 139 (Table 3.6). A unique shared residue of TaADF7 and AtADF9
	
  

100	
  

Table 3.6. Amino acid substitutions of AtADF1, AtADF4, TaADF7 and AtADF9
around regions predicted to be involved in actin binding. This table displays the
SIFT score values of amino acid. SIFT substitutions with scores <0.05 are not
predicted to be tolerated. The bolded SIFT values are either low and should be
considered or are below 0.05 and therefore not tolerated. The amino acids and SIFT
scores in red text are those amino acids that have been demonstrated to have a role
in actin binding.
is glutamine-135, however there appears to be little negative impact of substitution of
either glutamine or lysine for the arginine in AtADF1 (Table 3.1; Table 3.6). Lastly, when
AtADF4 and TaADF7 are compared within the region of interest there are only five
differing amino acids, none of which are predicted to negatively impact protein function
(Table 3.6). Taken together, these data suggest that in addition to the four shared
amino acids between AtADF4 and TaADF7 within our initial region of interest
surrounding tyrosine-53 (Figure 3.3), AtADF4 and TaADF7 most likely have the ability to
interact with actin in a similar manner (Figure 3.4; Table 3.6). TaADF7 is most similar to
AtADF4 with respect to the regions thought to be involved in actin binding, where
AtADF4 has been experimentally shown to interacts with actin like AtADF1 (Henty et al.,
2011). Furthermore, TaADF7 also share differing amino acids as compared to AtADF9,

	
  

101	
  

which has been functionally demonstrated to interact with actin in a manner that is
antagonistic to AtADF1 (Tholl et al., 2011).

When AtADF4 was compared to all 11 of the rice ADFs by CLUSTAL omega software,
additional patterns emerged (Figure 3.5). Rice OsADF7, which was recently reannotated, possesses glutamic acid-48, leucine-51, tyrosine-53, aspartic acid-55 and
cysteine-59 and has an 81.29% sequence identity to AtADF4 (Figure 3.5). Interestingly,
OsADF7 and TaADF7 have a 92.81% sequence identity. Additionally, nine rice OsADFs
have an aspartic acid aligning with AtADF4 aspartic acid-55 and nine have tyrosine
aligning to tyrosine-53 (Figure 3.5). Taken together these alignments highlight an
interesting region of plant ADFs that may give insight into additional cellular functions of
some of the members of the large family of ADFs found in plants.

	
  

102	
  

Figure 3.5. Alignment of 11 rice Actin depolymerizing factors (OsADFs) and
AtADF1 and AtADF4. Differing amino acids within the region swapped in the
formation of the chimeric proteins are highlighted in blue. The phosphorylatable
serine residue is highlighted in red, while the tyrosine-53 residue, predicted to be
phosphorylated in AtADF4 and TaADF7, highlighted in green.

	
  

103	
  

Discussion

AtADF4 has been demonstrated to be an important component of defense-signaling in
Arabidopsis protection against the phytopathogen Pseudomonas syringae AvrPphB (Pst
AvrPphB; Porter et al., 2012; Tian et al., 2009). Previous studies have identified that this
importance extends to the expression of the pathogen-related gene PR1 and the
resistance gene (R-gene) resistance to Pseudomonas syringae-5 (RPS5), as well as
the activation of immune-signaling pathways in the presence of the bacterial effector
AvrPphB (Tian et al., 2009; Chapter 2; Porter et al., 2012). Additionally, AtADF4 is
required for defense specific remodeling of the actin cytoskeleton upon recognition of
pathogen associated molecular patterns (PAMPs) and subsequent PAMP-triggered
immunity (PTI; Henty-Ridilla et al., 2014).

With regard to the biochemical properties of AtADF4 that allow for its observed defenserelated properties, I have demonstrated in the previous chapter that AtADF4 can indeed
be phosphorylated at the predicted serine-6 residue, and furthermore, that this
phosphorylation was required for the appropriate expression of RPS5 and subsequent
resistance to Pst AvrPphB (Chapter 2; Porter et al., 2012). This finding was unexpected,
as concurrent works demonstrated that, as is the case for other ADFs, the
phosphorylation of serine-6 is often associated with a loss of activity, through the
reduced affinity of the ADF for the actin cytoskeleton (Carlier et al., 1997; Ouellet et al.,
2001; Porter et al., 2012). The phosphorylation of serine-6 as an activation of gene

	
  

104	
  

expression is suggestive of a role for AtADF4 that is less tightly correlated with the actin
cytoskeleton, and may in fact be independent of the well-established functions of ADFs.

In the current study, I attempted to identify additional biochemical features of AtADF4
that may explain the divergent role of AtADF4 in immune-signaling by utilizing in silico
protein analysis techniques. This undertaking was initialized with the comparison of
AtADF4 to its closest Arabidopsis homologue AtADF1. It was determined that AtADF1
and AtADF4 are 97% homologous with 93.5% sequence identity (Figure 3.1).
Furthermore, it was determined that in addition to the observed resistance phenotype to
Pst AvrPphB, the AtADF1 mutant (adf1) also properly expresses RPS5 (Figure 3.2).

There must however be some motif and/or amino acid differences between AtADF4 and
AtADF1 that can explain the differences in susceptibility to Pst AvrPphB. In depth
computational examination of the sequences, differing amino acids and projected
protein structures of AtADF4 and AtADF1 identified a region containing four amino acid
differences with the greatest likelihood of inducing changes in structure and/or function
between the two proteins (Figure 3.1; Table 3.1). Although these differing amino acids
are not directly implicated in known β5 and α4 regions of the proteins for binding
filamentous (F-actin), the affected α2 and free loop are distal to these regions, and
therefore there could be some differences in F-actin association, although whatever
subtle difference may be present, it does not seem to alter the depolymerization or
severing functions of AtADF4 (Figure 3.1; Tian et al., 2009; Henty et al., 2011; Carlier et
al., 1997; Ono et al., 2007; Lappalainen et al., 1997; Tholl et al., 2011). More

	
  

105	
  

importantly, these residues may indeed affect the resistance to Pst AvrPphB. In order to
test this possibility, I developed chimeric proteins for complementation of the adf4
mutant to test this hypothesis. Specifically, I believe that the complementation of adf4
with AtADF1 containing the substitution of the four differing amino acids in this region
(AtADF1Q48E,

Q51L, E55D, C59S

) will allow for complementation of RPS5 expression and

subsequent resistance to Pst AvrPphB based on my computational analysis of the
potential impact of these amino acids. Furthermore, based on the aforementioned
predictive software, substitution of leucine-51 for glutamine in AtADF1 may be the
minimal substitution required for complementation.

An important control of AtADF4 mediated resistance to Pst AvrPphB is the
aforementioned phosphorylation of serine-6 (Chapter 2; Porter et al., 2012). While there
are a considerable number of amino acids within AtADF4 and AtADF1 that are
predicted to possess the potential for phosphorylation, there is only one differing residue
between the two, tyrosine-53 (Table 3.3). Because I have focused my work primarily on
the biochemical differences between AtADF4 and AtADF1 I chose to create a suite of
point mutations that would allow us to definitively determine if tyrosine-53 is indeed
phosphorylated in AtADF4 (Table 3.5). Furthermore, I created an additional point
mutation to address the predicted importance of aspartic acid-55 in the phosphorylation
of tyrosine-53. Taken together this set of experiments will allow me to 1) determine if
tyrosine-53 is phosphorylated in AtADF4, 2) demonstrate to what extent aspartic acid55 has on this phosphorylation and, 3) examine the importance of this phosphorylation
in the immune-signaling cellular function of AtADF4.

	
  

106	
  

It should be noted, that with respect to amino acids substitutions leucine-51 of AtADF4
appears to have the greatest impact, while aspartic acid-55 of AtADF4 may regulate the
phosphorylation of tyrosine-53. Because of this neither AtADF1Q51L nor AtADF1E55D may
be sufficient to complement the adf4 for immune-related function and in fact
AtADF1Q51L, E55D may be the minimal substitutions required to restore this function.

The overall goal of this chapter was to identify unique biochemical features of AtADF4
that allowed for its role in defense signaling. While ultimately, the complementation of
the adf4 mutant with the constructs outlined in this chapter is required to determine the
minimal substitution(s) of AtADF4 amino acids in AtADF1, the computational analyses
performed herein will dramatically reduce the number of constructs needed for this
determination. Furthermore, I hypothesize that due to the relatively large size of the
ADF family in plants, some members could adopt additional cellular functions outside
their well-described role in cytoskeleton regulation. Recent publications support this
hypothesis, in that there is an observed susceptibility in other plant species, including
rice and wheat, where an ADF has been silenced or knocked-out (Cheng et al., 2013;
Fu et al., 2014). My in silico examination of specific residues and motifs of AtADF4 as
compared to other plant ADFs determined to play a role in resistance has highlighted a
potential immunity-related region of these ADFs. Taken together, I believe that the
observed unique cellular function of AtADF4 in immune-related signaling is conserved in
plants and has existed since the expansion of the ADF family.

	
  

107	
  

Methods and Materials

Arabidopsis thaliana ADF protein sequence alignment and ADF4 homology model
construction

The A. thaliana genome was searched for sequences similar to the ADF1 amino acid
sequence using BLASTP. Eleven identified ADF protein sequences were aligned using
CLUSTAL Omega (Sievers et al., 2011) with five MBED-like Clustering Guide-Tree and
five HMM iterations. The three-dimensional protein structure of A. thaliana ADF4 was
predicted using SWISS-MODEL (Arnold et al., 2006; Kiefer et al., 2009) and the A.
thaliana ADF1 crystal structure (PDB ID: 1F7S; (Bowman et al., 2000)) or a A. thaliana
ADF1 molecular dynamic (MD) snapshot (Tholl et al., 2011) as template structures.
The MD structure was selected as an additional template as the amino and carboxyl
termini structures and confirmations were included. These templates had greater than
93% sequence identity with resultant homology structures having E-values greater than
3 x 10-68 and Q-mean scores less than -2.5. The SWISS-MODEL Anolea and Qmean
quality metrics identified a loop region, residues G47-E54, as having high-energy
backbone and side chain conformations. This loop region had no steric overlap or
neighboring charged groups with the remainder of the protein. It is possible that another
confirmation of this mobile region would be more stable, but no modification of the
alignment to the ADF1 template or side chain rotation improved energy values.

	
  

108	
  

Prediction of tolerance of amino acid substitutions and phosphorylatable
residues

Prediction of the tolerance of amino acid substitutions within was performed using the
publically available SIFT software (http://sift.jcvi.org; (Ng, 2003)). The analysis was run
on AtADF1 with regard to the nine amino acids of AtADF4 that were different and
conversely, with AtADF4 with the nine amino acids that were different in AtADF1. Any
SIFT score > 0.05 is considered to be a tolerated amino acid substitution. Examination
of the tolerance of individual amino acid substitutions without the influence of the
neighboring amino acids was performed with the BLOSUM62 chart (Henikoff &
Henikoff, 1992). Amino acid substitutions with positive scores are more likely to occur,
while negative scores indicate less favorable substitutions.

Plasmid construction and cloning

The AtADF1Q48E,

Q51L, E55D, C59S

and AtADF4E48Q,

L51Q, D55E, S59C

plasmids were

synthesized by Life Technologies Gene Art AG (www.lifetechnologies.com) in the
pENTR 221 vector backbone. The pENTR 221 constructs were sub-cloned into the
binary vector pMDT7 as described in Chapter 2. All primers used for cloning are listed in
Table 3.7.

	
  

109	
  

Plant growth and Arabidopsis transformation

Arabidopsis plants were grown in a BioChambers walk-in growth chamber (model FLX37; Winnipeg, Manitoba, Canada) at 20 °C under a 12-hour light/12-hour dark cycle,
with 60% relative humidity and a light intensity of 100 µmol photons m-2s-1.
Transformation of Arabidopsis, as well as selection of transformants, was performed as
described by Clough & Bent, (1998).

RNA extraction and qRT-PCR

Total RNA was extracted from leaves using the PrepEase Plant RNA Spin kit (USB
Affymetrix, Santa Clara, CA, USA). First-strand cDNA was synthesized from 1 µg total
RNA using the First-Strand cDNA Synthesis kit (USB Affymetrix). Primers, specifically,
RPS5 and UBI10, used for quantitative real-time PCR (qRT-PCR) are listed in Table 2.2
in Chapter 2. qRT-PCR was performed using the Mastercycler ep Realplex system
(Eppendorf AG, Hamburg, Germany), as previously described(Chapter 2), using the Hot
Start SYBR Master mix 2X (USB Affymetrix). Ubiquitin (UBQ10) was used as an
endogenous control for amplification. Fold Col-0 was determined using the following
equation: (relative expression)/(relative expression of Col-0 untreated), where “relative
expression” = 2(- Ct), where ΔCt = Ctgene of interest – CtUBQ10.
Δ

	
  

110	
  

Table 3.7. List of primers used for cloning.

Quick change PCR

An adapted version of the Quik Change Site Directed Mutagenesis kit instruction
manual was used to preform the Quick change PCRs (Stratagene catalog # 200518). In
short, Quick change primers were designed using the Agilent Technologies Quik
Change

Primer

Design

software

((www.genomics.agilent.com/primerDesignProgram.jsp); Table 3.7). PCR reaction
	
  

111	
  

contained: 1 unit Pfu Turbo DNA polymerase (Agilent), 1:10 dilution of 10X PCR
reaction buffer (Agilent), 300ng sense and antisense Quick change primer (Invitrogen),
100nM dNTPs (Denville), and 50ng of ds DNA plasmid. Recommended thermocycler
reactions were performed followed by digestion of parental plasmid with 1 unit Dnp1
(New England Biosciences) at 37ºC for 1 hour followed by heat inactivation and
subcloning into E. coli DH5α (Invitrogen).

	
  

112	
  

CHAPTER 4
Conclusions and Future directions

The actin 2 data presented in this chapter was performed by myself, and is part of an
ongoing collaboration with Dr. Jeff Chang and Allison Creason at Oregon State
University.

	
  

113	
  

Conclusions

Arabidopsis actin-depolymerizing factors (AtADFs) are actin binding proteins (ABPs)
with well-characterized biochemical functions to depolymerize and/or sever actin
filaments contributing to the overall regulation of cytoskeletal dynamics (Carlier et al.,
1997; McGough et al., 1997; Ruzicka et al., 2007). As such, much of the research on
AtADFs and other ABPs has focused primarily on their interactions with and on the actin
cytoskeleton. My research pursuits, however, have centered on the requirement of a
specific AtADF, AtADF4, for the defense responses of Arabidopsis to the
phytopathogen Pseudomonas syringae expressing the bacterial effector AvrPphB (Pst
AvrPphB; Tian et al., 2009). The purpose of the dissertation project was to identify the
immune pathways of Arabidopsis lacking ADF4 (adf4) that are compromised during the
compatible interaction with Pst AvrPphB, and ultimately, to determine the role of
AtADF4 is in these defense-related pathways. Additionally, I wanted to examine unique
biochemical properties of AtADF4 that would allow for the divergence and expansion of
cellular functions to include disease signaling. The hypothesis being that AtADF4
possesses specific biochemical attributes that allow for non-canonical cellular functions
related to immune signaling that may be directly related to, or independent of its preestablished interactions with the actin cytoskeleton or a fine-tuned balance of both. To
this end, I have established, in Chapter 2 of this thesis, a role for AtADF4 in expression
of the resistance gene (R-gene) resistance to Pseudomonas syringae-5 (RPS5), and
immune signaling related to the recognition of pathogen associated molecular patterns
(PAMPs). Additionally, I have utilized in silico protein analysis tools, in Chapter 3, to

	
  

114	
  

identified biochemical features and specific amino acids that may allow for the unique
cellular functions of AtADF4. These findings have contributed to the expansion of the
field of study of actin and ABPs past the singular role in cellular architecture, towards
gene expression, surveillance, and signal transduction.

My findings in Chapter 2 explored further our lab’s initial findings that identified a unique
and unexpected feature of one of the Arabidopsis ABPs, AtADF4, in the defense
response to Pst AvrPphB (Tian et al., 2009). Briefly, it was determined that the adf4
mutant plant specifically is susceptible to Pst AvrPphB, but maintains resistance to Pst
expressing other bacterial effectors, including ArvRpt2 and AvrB (Tian et al., 2009).
However the mechanism by which this compatible interaction occurred was not well
understood. Due to the unique gene-for-gene defense response of plants that ultimately
results in effector-triggered immunity (ETI), I initially measured the expression of the Rgene required for recognition of AvrPphB, RPS5 and determined that the adf4 mutant
has significantly reduced expression of RPS5 (Figure 2.1A), while the expression other
well-characterized R-genes is not affected (Figure 2.4). Furthermore, complementation
of adf4 with AtADF4 under the control of the native promoter allows for restoration of the
expression of RPS5 (Figure 2.1B). These findings are in support of my hypothesis that
AtADF4 has additional cellular functions including regulating the expression of the Rgene RPS5, that contribute to its role in the host defense response.

Although ETI is effective in activating a robust immune response that is often associated
with conferring resistance to a specific pathogen, it is not the only immune response of

	
  

115	
  

plants. Upon initial recognition of non-self PAMPs through pattern recognition receptors
(PRRs) the plant cell activates PAMP-triggered immunity (PTI), which includes many of
the same pathways of ETI. I found that adf4 was indeed sensitive to flg22, a 22-amino
acid peptide of the PAMP flagellin (Figure 2.6), and responded appropriately with
activation of the flg22-induced receptor-like kinase 1 (FRK1; Figure 2.5A), which
suggests intact signaling by flagellin-sensitive 2 (FLS2), the PRR for flg22 and flagellin.
The activation of FRK1 was, however, significantly reduced when adf4 was challenged
with Pst AvrPphB (Figure 2.5C).

Initially, it was believed that the reduction of FRK1 when challenged with Pst AvrPphB
was due to a reduction in the activation of the mitogen-activated protein kinase (MAPK)
signaling pathway due the loss of RPS5 expression in the adf4 mutant. This hypothesis
was supported by the mirrored reduction in FRK1 in the RPS5 point mutant (rps5) when
challenged similarly with Pst AvrPphB (Figure 2.5C). However, a more in depth
molecular examination of the activation of the MAPK signaling pathway, wherein
AvrPphB was expressed in planta in the absence of the pathogen, and MAPK was
activated by flg22, revealed that MAPK signaling was reduced distinctively in the adf4
mutant and not the rps5 mutant (Figure 2.10). These findings are of interest in two
aspects. First, it supports our hypothesis that AtADF4 is required for RPS5 expression
and subsequent accumulation of RPS5 protein, in that the adf4 and rps5 have nearly
identical reduction in FRK1 expression when challenged by Pst AvrPphB. Secondly, it
suggests a specialized role for AtADF4 in the PTI-related MAPK activation in the
presence of AvrPphB.

	
  

116	
  

Beyond identifying the requirement of AtADF4 for both ETI- and PTI- responses to Pst
AvrPphB through the expression of RPS5 and the proper activation of FLS2-driven
MAPK signaling pathway, respectively, I sought to identify the individual biochemical
aspects of AtADF4 that regulate and facilitate these functions of immunity. Because of
the well-established phosphorylation of serine-6 in other plant ADFs (Allwood et al.,
2001; Smertenko et al., 1998; Ouellet et al., 2001), including AtADF1 (Carlier et al.,
1997; Ressad et al., 1998; Dong & Hong, 2013), I chose to examine the impact of
serine-6 phosphorylation on the ability of AtADF4 to complement adf4 with regard to
RPS5 gene expression and disease response to Pst AvrPphB. First I established, using
2-D gel electrophoresis and the AtADF4S6A phospho-null complement, that serine-6 was
indeed a residue capable of being phosphorylated in AtADF4 (Figure 2.12A).
Furthermore, I established that, as previous works had identified of other plant ADFs
(Carlier et al., 1997), that the phospho-null AtADF4S6A co-localized to the actin
cytoskeleton with a higher affinity than the phospho-mimic AtADF4S6D (Figure 2.15B; C).
Interestingly, the phospho-mimic AtADF4S6D complemented the disease resistance and
RPS5 expression of the adf4 mutant, while the phospho-null AtADF4S6A did not (Figure
2.12B; C; D). Although this finding was unexpected, it did support my original
hypothesis that AtADF4 may function as a component of the immune response in plants
in a less actin-centric manner.

To identify additional biochemical aspects of AtADF4 that would allow for a role in
immune signaling, I chose to utilize an in silico approach and examine other members

	
  

117	
  

of AtADFs to see if there were any striking similarities or differences. I found that
AtADF4 and AtADF1 have a 97% homology and furthermore a 93.5% sequence identity
(Figure 3.1B). Given the surprising level of sequence identity between AtADF1 and
AtADF4, yet differing resistance phenotypes of the adf4 mutant and AtADF1 mutant
(adf1) to Pst AvrPphB (Tian et al., 2009; Figure 3.2), I decided to compare AtADF1 and
AtADF4 further in order to identify potential differing biochemical features that may
contribute to the differences in disease resistance.

Comparison of the amino acid difference between AtADF4 and AtADF1 (Figure 3.1B;
Table 3.1) and the potential impacts these substitutions would have on protein structure
(Figure 3.1A) revealed a region between β3 and α2 that had the most dense amount of
differing amino acids as well as the largest negative impact on amino acid substitution.
Based on these findings I proposed a set of chimeric proteins, as well as individual point
mutant proteins that could address what effects this region of AtADF4 and AtADF1
would have on disease resistance to Pst AvrPphB (Table 3.2). The hypothesis being
that if the differing amino acids within this region are of importance to the immunity
function of AtADF4 the AtADF1Q48E, Q51L, E55D, C59S construct, and perhaps even the single
amino acid substitution construct AtADF1Q51L, will complement adf4 mutant. This would
further support my original hypothesis that there are unique biochemical features of
AtADF4 that allow for its faculty in immune signaling.

Both AtADF1 and AtADF4 are phosphorylated at serine-6, which affects their
interactions with actin (Carlier et al., 1997; Porter et al., 2012). However, it is not known

	
  

118	
  

if there are additional phosphorylation sites on either. Predictive software was used to
identify potential phosphorylatable resides of AtADF4 and AtADF1 (Table 3.3). AtADF4
is predicted to have a single amino acid with differing phosphorylation potential not
predicted to be phosphorylated in AtADF1, tyrosine-53 (Table 3.3). Further
computational analysis demonstrated that the amino acid responsible for the differing
phosphorylation potential of tyrosine-53 in AtADF4 is aspartic acid-55. The creation of
AtADF4Y53F, and AtADF1E55D complements of adf4 will allow us to determine if tyrosine53 phosphorylation is required for the immunity roles of AtADF4; and if so, if the
substitution of a single amino acid from AtADF4 into AtADF1, that allows for this
phosphorylation, is enough to complement the resistance of adf4 to Pst AvrPphB (Table
3.5). All together, my in depth in silico biochemical comparison of AtADF4 and AtADF4
has given me insight into the unique features of AtADF4 that allow for its exceptional
role in defense signaling.

Future Directions

The dissertation research described herein has illuminated unique properties of AtADF4
that contribute to disease signaling and resistance to Pst AvrPphB, providing support for
the hypothesis that domain-specific features of ADFs – specifically, AtADF4 - may be
required for its part in immune signaling. These works have answered many questions,
and have also introduced many more with respect to the unique functions of AtADF4
and the actin cytoskeleton in response to disease, as well as the cellular functions of
AtADF4 itself. In this section of my thesis I would like to outline the future directions of

	
  

119	
  

the AtADF4 project and what I believe will be gained from completion of these future
directions. There are three distinct directions that this project should go in order to
completely examine AtADF4’s role in immunity.

First, in continuation of my in silico identification of important residues and motifs of
AtADF4, the in vivo complementation of the adf4 mutant with the proposed chimeric
and/or single amino acid substitution constructs should be completed. These plants can
then be used to determine the importance of the identified residues as well as predicted
phosphorylation of tyrosine-53 in expression of RPS5 and resistance to Pst AvrPphB.
Additionally, works in other plant species have also demonstrated a role for ADFs in
immune signaling, as outlined in Chapter 3, further support my initial findings and
proposed region of interest in AtADF4 (Cheng et al., 2013; Fu et al., 2014; Figure 3.3;
Figure 3.5). Given the importance of the proposed region of AtADF4 and its
conservation in additional plant lines, an interesting question arose: Would ADFs of
other plant species with this motif complement the Arabidopsis adf4 mutant for
resistance to Pst ArvPphB? Exploring cross-species complementation would definitively
demonstrate the expansion of certain members of the ADF family in plants to adopt
additional diverse cellular functions in immune signaling.

I encountered another question during the comparison of AtADF1 and AtADF4: How
similar are the biochemical functions of AtADF1 and AtADF4 to act upon actin, and what
effects would the proposed amino acid substitutions have on these functions? As
exemplified by the antagonistic functions of AtADF1 and AtADF9, discussed in

	
  

120	
  

Chapter3, not all ADFs in plants appear to interact with actin in the same way (Tholl et
al., 2011). While I have demonstrated the differences between AtADF1 and AtADF4
should not be as severe, prior examination of AtADF4 biochemically suggests there are
subtle differences. It has been shown that AtADF4 has a markedly increased affinity for
G-actinATP as compared to AtADF1, while little to no change was observed in affinity for
G-actinADP (Tian et al., 2009). Additionally, knocking out AtADF4 does result in changes
to the organization of the actin cytoskeleton in planta, confirming our hypothesis that
functional redundancy of AtADFs cannot be assumed (Henty et al., 2011). An in-depth
biochemical analysis of AtADF1, AtADF4, and the chimeric proteins, with regard to their
interactions with and upon the actin cytoskeleton, will give further insight into the role(s)
of the specific regions of AtADF4 and AtADF1.

Second, due to the alterations of gene expression in the adf4 mutant, and other plant
species with ADF knock-outs, including the re-occurrence of reduced PR1 expression,
many questions have arose about the specificity and mechanism of AtADF4’s
importance in gene expression. An initial question being: Are the AtADF4-regulated
genes specifically immune-related genes? Although we have examined the expression
of genes related to immune signaling in the adf4 mutant, because differences in
resistance exist when plants are challenged with biotic stresses, this does not mean that
the only genes AtADF4 regulates are defense-related. A critical next step in this project
would be examining the global changes in gene expression within the adf4 mutant
compared to the wild-type Arabidopsis Col-0, through RNA sequencing techniques. The
samples for this RNA-sequencing analysis should include both resting state plants and

	
  

121	
  

plants that have been challenged with Pst AvrPphB. This analysis would result in
determining if AtADF4 regulates the expression of genes in a defense-related pattern or
regulates multiple genes related to many cellular functions, as wells as identify
additional potential gaps in the immune-signaling of adf4 due to loss of transcriptional
reprograming within specific immune-related signaling pathways.

Within the scope of AtADF4 and it’s role in gene expression I pose another question: To
what degree does actin play a role in the AtADF4 dependent regulation of gene
expression? As discussed in Chapter 1, the past few decades have seen numerous
advances towards understanding the role and activity of actin and the actin cytoskeleton
within the nucleus (Chapter1; Pederson & Aebi, 2002; Bettinger et al., 2004). In 2010
Kandasamy et al. identified the presence of the 3 vegetative forms of actin – ACT2,
ACT8, and ACT7 – within the nuclei of plant cells, although actin itself posses no true
nuclear localization signal (NLS: Kandasamy et al., 2010). These findings confirm that
what is believed in other systems with regard to actin having a nuclear function is a
possibility in plants as well. Of particular interest to our work, it has been determined
that the nuclear import of actin is facilitated by cofilin, the predominant mammalian ADF,
in a Ran-dependent manner through interactions with nuclear importin 9 (Dopie et al.,
2012; Figure 1.4). Additional work in this area has demonstrated that profilin, an actin
binding protein that functions in the polymerization of G-actin into F-actin filaments,
facilitates the export nuclear actin through association with exportin-6 (Stuven et al.,
2003; Dopie et al., 2012; Figure 1.4). This mechanism is supported in plants by the
observation of each of these ABPs (i.e., ADF and Profilin), including specifically

	
  

122	
  

AtADF4, is localized within the nucleus (Kandasamy et al., 2007; Kandasamy et al.,
2010; Figure 2.15A).

Based upon the above information, that vegetative actins and AtADF4 are present in the
nucleus and that the presence of actin within in the nucleus may be dependent upon
ADFs, I wondered if perhaps the expression of RPS5 is altered in actin mutants
(Kandasamy et al., 2007; Kandasamy et al., 2010; Figure 2.15A). In collaboration with
Dr. Jeff Chang’s laboratory at Oregon State University, who identified a disease
phenotype of the AtActin2 over expression mutant (Act2OE2) when challenged with Pst
AvrPphB, I identified alteration of RPS5 expression in not only the Act2OE2 plant line,
but also the AtActin2 mutant act2 (Figure 4.1). Specifically, the Act2OE2 line has a
highly significant loss in RPS5 expression and the act2 mutant also has a significant
reduction in RPS5 expression (Figure 4.1). Interestingly, it seem that either the over
expression of, or the loss of AtActin2 results in alteration of RPS5 expression,
suggesting that it may be the balance of specific isoforms of actin that regulate gene
expression. These findings support the hypothesis that the reduction in RPS5
expression in the adf4 mutant may be related to AtADF4’s interaction with and possible
import of actin into the nucleus.

AtADF4 nuclear localization mutants (i.e. AtADF4-NLS and AtADF4-NES; Figure 4.2)
can be used to investigate the necessity of AtADF4 in the nucleus, as well as its
proposed role in the delivery of actin into the nucleus. If the differences in gene
expression only require AtActin2, and not AtADF4 directly, then AtADF4 with the strong

	
  

123	
  

Figure 4.1. RPS5 mRNA expression is reduced in the Act2 OE2 line and act2
mutant. mRNA expression of RPS5 in the Actin2 overexpression line Act2 OE2 and
act2 mutant plants. Expression values are normalized to wild-type Col-0. The other
mutant lines; adf4, adf4/35S:ADF4, adf4/35S:ADF4S6A, adf4/35S:ADF4S6D, adf1,
and adf3, previously shown are included for comparison purpose. Error bars
represent mean ± SEM from three independent biological repeats. Statistical
significance was determined using two-way ANOVA as compared to Col-0, with
Bonferroni post test, where **p<0.005 and ***p<0.0005.
	
  
nuclear export signal, AtADF4-NES, should still be able to deliver AtActin2 to the
nucleus before its export, thus complementing the adf4 mutant gene expression
deficiencies. However, if the AtADF4-NES does not complement gene expression in
adf4 then we would predict that AtADF4 is required to not only for translocation of actin

	
  

124	
  

Figure 4.2. Nuclear localization mutants transiently expressed in Nicotiana
benthamiana. Localization of (A) 35S:ADF4-cCFP, (B) 35S:ADF4-NLS-cCFP, (C)
35S:ADF4-nls-cCFP, (D) 35S:ADF4-NES-cCFP and (E) 35S:ADF4-nes-cCFP when
expressed in Nicotiana benthamiana. AtFib-YFP (F-J) is co-expressed to indicate
location of nuclei in ADF4-cCFP constructs in panels (A-E). Overlay (K-O) of
ADF4cCFP constructs (A-E) with AtFib (F-J).
	
  
into the nucleus, but also play a role itself within the nucleus. This nuclear function may
be independent of, or in collaboration with actin.

The presence of ABPs and actin within the nucleus has led researchers to further
examine the possibility that not only is actin actively imported into and exported out of
the nucleus, but that it may also exist in various forms including monomeric G-actin as
well as filamentous F-actin. At present, however, it is not known if nuclear polymeric
actin assumes the same structural configuration as F-actin found in the cytosol
(Pederson & Aebi, 2002; Belin & Mullins, 2013; Grosse & Vartiainen, 2013; Kapoor &
Shen, 2014). An interesting question is: Does AtADF4 effect the organization of nuclear
	
  

125	
  

actin, as it does within the cytosol? This question is a particularly tricky one to answer
as imaging of F-actin in the nucleus of plants and other systems is in its infancy.
However, recent studies demonstrate the possibility of imaging nuclear F-actin in plant
cells. Kandasamy et al. (2010) were able to visualize actin rods in the nucleus when Act
7 was overexpressed and tagged with a putative NLS (Kandasamy et al., 2010).
Additionally, a recent report found that the viral movement protein of Turnip vein
clearing virus contained an NLS required for virulence, and in addition to being present
in the nucleus, appeared to co-localize with F-actin that was labeled with nuclei specific
TagRFP-UtrCH, a protein that contains TagRFP and the calponin-binding of UtrCH
(Levy et al., 2013). This study demonstrated F-actin structures are present in the plant
nucleus, can be visualized using a nuclear specific F-actin probe, and may be targeted
to enhance a pathogen’s virulence (Levy et al., 2013). Utilization of such probes would
allow for examination of nuclear actin in presence and absence of AtADF4.

The remaining question is: What is the mechanism by which AtADF4 is altering gene
expression? There are three main functions within the nucleus that actin has been
demonstrated to affect, and are therefore potential mechanisms by which AtADF4 may
regulate gene expression. The first is actin’s role in the activities of RNA polymerases.
Actin has been implicated in being a component of and/or playing a role in multiple
phases of gene transcription by all three RNA polymerases (Grosse & Vartiainen, 2013;
Percipalle, 2013). There is specific evidence in mammals that cofilin is required for
elongation by RNA polymerase II, and is found to interact with actin, RNA polymerase II
and DNA, specifically with the transcribed regions of genes (Percipalle, 2013; Obrdlik &

	
  

126	
  

Percipalle). Nuclear immuno-precipitation (IP) followed by mass spectroscopy (MS/MS)
of AtADF4-NLS constructs could be utilized to identify specific components of the
nucleus that AtADF4 is able to interact with, including perhaps RNA polymerase
machinery.

Second, gene expression is influenced by actin not only through it’s interactions with the
transcriptional machinery (i.e., RNA polymerase II), but through interactions with
chromatin modifying and remodeling complexes (Kapoor et al. 2013; Belin & Mullins,
2013). In plants, Arabidopsis ADF9 has been shown to be required for appropriate
expression of flowering locus C (FLC) in a histone modification dependent manner
(Burgos-Rivera et al., 2008). The aforementioned IPs could in fact identify interactions
with chromatin modifying complexes, however there is the chance that the IPs may not
work well due to weak interactions with nuclear components. Utilizing chromatin IP-PCR
(ChIP PCR) with known hetero- and eu- chromatic targets for the RPS5 gene could
determine if the mechanism of gene regulation by adf4 is through influences on
chromatin modification machinery.

Lastly, the actin cytoskeleton in its various nuclear forms has been demonstrated to be
involved in chromatin spatial organization (Dundr et al., 2007). The three-dimensional
spatial positioning of regions of chromatin within the interphase nucleus is not random,
but instead is a well-orchestrated process that allows for an energetically favorable
control of gene expression throughout the nucleus (Cope et al., 2010). Long-range
chromatin interactions for instance, allow the sharing of specific transcriptional

	
  

127	
  

machinery, or conversely gene silencing machinery, for multiple genes on the same
(cis) or different (trans) chromosomes (Cope et al., 2010). Both fluorescent in situ
hybridization and transmission electron microscopy could be used to identify potential
differential localization of specific genes within the nucleus, i.e. RPS5, or gross
morphological differences of the nucleus of the adf4 mutant that might suggest that
AtADF4 plays a role in the overall structural organization of the nucleus.

What may come to light is, that as with the apparent importance of the balance of
AtActin2 and AtADF4 in the expression of RPS5, the mechanism by which these
proteins regulate said expression might be combinatory. A combinatory role in multiple
mechanisms of expression may also explain why the loss of AtActin2 does not nearly
abolish RPS5 expression as either loss of AtADF4 or overexpression of AtActin2 does.
My findings within my thesis coupled with the proposed future directions with regard to
AtADF4 and actin having a role in expression of RPS5 will contribute to the overall
understanding of the role of actin and ABPs in gene expression.

As a final measure to identify what roles AtADF4 is playing in immunity a global cellular
approach should be taken. That is to say, the cell as a whole needs to be examined
because, as outlined in Chapter 1, the actin cytoskeleton is involved in numerous
cellular processes. The endomembrane trafficking system in the adf4 mutant specifically
should be examined due to the identification of actin as a key component of the system
as well as recent findings that demonstrated the endocytosis of plasma membrane
localized receptors as targets of pathogenesis through the targeting of the actin

	
  

128	
  

cytoskeleton (Brandizzi & Wasteneys, 2013; Beck et al., 2012; Kang et al., 2014;
Chapter 1; Figure 1.2; Figure 1.3). It is possible that the differences in MAPK activation
observed in Chapter 3 in the adf4 mutant in the presence of the bacterial effector
AvrPphB are due in part to an alteration of either the positioning of FLS2 at the plasma
membrane after denovo synthesis, or improper endocytosis of FLS2 after activation
(Beck et al., 2012; Kang et al., 2014; Figure 2.10).

When I began this dissertation project little was known about the molecular role the
actin cytoskeleton, let alone an individual ABP, played in defense signaling in plants.
Much of the pre-existing literature focused on actin as a potential physical barrier to
oomycete and fungal penetration peg formation or as a component of cellular
architecture for the movement and trafficking of organelles and other cellular
components (reviewed in Day et al., 2011; Chapter 1). The publication by Tian et al.
(2009) demonstrated the requirement of a specific ABP, AtADF4 for resistance to a
bacterial pathogen, Pst AvrPphB, and introduced the possibility that components of the
actin cytoskeleton may have specialized roles in defense signaling. The findings herein
demonstrate the requirement for AtADF4 in both PTI and ETI pathways of the immune
response to Pst AvrPphB, through the expression of the cognate R-gene RPS5 and the
activation of MAPK-signaling in the presence of AvrPphB (Figure 2.1.A; Figure 2.10). In
turn, AtADF4 possesses biochemical features that allow for these distinct cellular
functions not commonly attributed to ADFs. While AtADF4 is capable of being
phosphorylated at serine-6, this phosphorylation, which is commonly associated with
the reduced functionality of plant ADFs, is required for AtADF4’s role in the expression

	
  

129	
  

of RPS5. In depth comparisons of AtADF4 with its closest homologue AtADF1, the latter
of which has been shown not to play a role in defense signaling to Pst AvrPphB,
revealed additional unique features that may contribute to the divergent cellular
functions of AtADF4, including the potential phosphorylation of tyrosine-53. In
conclusion the work of this dissertation project expand our collective understanding of
the roles of ABPs within the cell. AtADF4, and other ABPs of plants, should now be
considered, in addition to their influence on the actin cytoskeleton, as critical
components of immune signaling and gene expression.

Methods and Materials

Plasmid construction and cloning

All primers used for cloning are listed in Table 4.1. ADF4 was initially cloned into the
pENT/D Topo vector using the pENT/D Topo Cloning kit (www.Invitrogen.com), followed
by LR clonase reaction (www.invitorgen.com) into pVKH18En6gw-cCFP (Tian et al.,
2011). Next the pGEM cloning kit was used to add the nuclear localization tag to the
ADF4-cCFP construct (www,promega.com). Lastly the ADF4-cCFP localization mutants
were cloned into pENT/D and LR clonase was performed to clone the constructs into
the pGWB.2 bianary expression vector (Nakagawa et al., 2007).

	
  

130	
  

Table 4.1 List of primers. With the exception of the first two primers; the cut sites
are indicated by lowercase letters, the stop codon is italicized, while the nuclear
locaization tag is normal font, and the cCFP sequence is undelined. Constructs were
cloned with cut sites in the case that the bianary vecotor pMD1 would be used for
expression in plants.

Plant growth and transient Nicotiana benthamiana transformation

Arabidopsis and Nicotiana benthamiana plants were grown in a BioChambers walk-in
growth chamber (model FLX-37; Winnipeg, Manitoba, Canada) at 20 °C under a 12hour light/12-hour dark cycle, with 60% relative humidity and a light intensity of 100
µmol photons m-2s-1. Agrobacterium tumefaciens GV3101 containing the pGWB.2
ADF4-cCFP localization mutants were infiltrated into Nicotiana benthamiana leaves for
transient expression as described in Tian et al., 2009.

	
  

131	
  

RNA extraction and qRT-PCR

Total RNA was extracted from leaves using the PrepEase Plant RNA Spin kit (USB
Affymetrix, Santa Clara, CA, USA). First-strand cDNA was synthesized from 1 µg total
RNA using the First-Strand cDNA Synthesis kit (USB Affymetrix). RPS5 primers used
for quantitative real-time PCR (qRT-PCR) are listed in Table 2.2. qRT-PCR was
performed using the Mastercycler ep Realplex system (Eppendorf AG, Hamburg,
Germany), as previously described (Chapter 2), using the Hot Start SYBR Master mix
2X (USB Affymetrix). Ubiquitin (UBQ10) was used as an endogenous control for
amplification, Table 2.2. Fold Col-0 was determined using the following equation:
(relative

expression)/(relative

expression

of

Col-0

expression” = 2(- Ct), where ΔCt = Ctgene of interest – CtUBQ10.
Δ

	
  
	
  

	
  

	
  

132	
  

untreated),

where

“relative

APENDIX

	
  

133	
  

APPENDIX

Actin branches out to link pathogen perception and host gene regulation

This Appendix was originally published in Plant Signaling and Behavior.
Porter, K and Day, B. 2013. Actin branches out to link pathogen perception to host
gene regulation. Plant Signal Behav. 8(3), e23468.

	
  

134	
  

ABSTRACT

Cellular functions of actin, and associated actin binding proteins (ABPs), have been well
characterized with respect to their dynamic cytosolic role as components of the complex
cytoskeletal network. Currently, research has expanded the role of actin to include
functioning within the nucleus as an integral part gene organization and expression.
Herein, we describe the requirement of the ABP actin-depolymerizing factor-4 (ADF4)
for resistance to Pseudomonas syringae DC3000 AvrPphB via ADF4’s cytosolic and
nuclear functions. Significant alterations in the expression of the resistance protein
RPS5 in an ADF4 phosphorylation-dependent manner support both a nuclear function
for ADF4, and the potential targeting of the actin cytoskeleton by the bacterial effector
AvrPphB.

Introduction

Actin remodeling is required for a multitude of cellular functions in both plants and
animals, including growth, development, cell architecture, and response to stress (Day
et al. 2011). As a ubiquitous network linking extracellular perception to intracellular
signaling, the actin cytoskeleton is composed of both filamentous-actin (F-actin) and
monomeric globular-actin (G-actin), tightly regulated by the precise interplay of a large
group of more than 70 actin-binding proteins (ABPs; Day et al., 2011). In the recent
manuscript by Porter et al. the authors demonstrate a cellular function for actin

	
  

135	
  

cytoskeletal dynamics, describing a function which links pathogen perception, gene
transcription, and the activation of defense signaling (Porter et al., 2012). In this minireview, we will highlight the significance of this work, which provides the first
mechanistic description of actin as a cellular platform for defense signaling in plants
following perception of a phytopathogenic bacterium.

ADF4 possesses both classic cellular functions of actin-depolymerizing factors
as well as confers resistance to a bacterial pathogen

Among the more than 70 ABPs in plants responsible for the regulation and organization
of cytoskeletal dynamics and remodeling, the actin depolymerizing factor (ADF) family
fulfills a classic biochemical function to both sever and depolymerize F-actin, functioning
in large part as a primary regulator of actin turnover (Ruzicka et al. 2007). In
Arabidopsis, there are 11 members of the ADF family, further subdivided into 5
subclasses whose function and expression are hypothesized to both differentiate and
specify numerous cellular functions. ADF4 is a member of subclass I which includes
ADF1, ADF2, and ADF3, each of which are expressed in a wide variety of tissues, as
well as within the cell cytoplasm and nucleus (Ruzicka et al. 2007; Kandasamy et al.
2010; Porter et al., 2012).

Biochemically, ADF4 was initially characterized using a reverse genetics approach,
identified in a screen of ABP mutants showing enhanced susceptibility to Pseudomonas
syringae (Tian et al., 2009). Using a complementary series of cell biology and

	
  

136	
  

pharmacological experiments, Tian et al. further defined the actin binding specificity of
ADF4, demonstrating that the biochemical function of ADF4 is linked to the ability of the
host to activate immune signaling following pathogen infection. In total, this work first
described a role for actin cytoskeletal dynamics in the activation of plant defense
signaling following perception of P. syringae. In a recent publication, the role of ADF4
has been further defined through the application of live cell imaging to monitor actin
dynamics (Henty et al., 2011). Taken together, these two studies provide a platform
hypothesizing that the cellular function of ADF4 controls – and links – development and
defense signaling through modulating the rate of actin turnover. This would suggest that
the structural activity of the actin cytoskeleton might serve as a surveillance platform,
functioning in large part to both monitor and modulate changes in host cell homeostasis
in response to external stimuli.

ADF4 is required for RPS5 gene expression and supports the emerging
hypothesis of nuclear functions for ABPS

As noted above, in addition to functioning as an ADF, ADF4 has also been
demonstrated to play a key role in immunity to P. syringae expressing the bacterial
effector AvrPphB (Pst AvrPphB; Tian et al., 2009; Porter et al., 2012). AvrPphB is a
bacterial effector that upon delivery into the host cell via the type three-secretion system
utilizes its cysteine protease activities to cleave host targets including PBS1, PBL1 and
BIK1 (Shao et al., 2003; Zhang & Zhou, 2010). While the cleavage of BIK1 and PBL1
result in a dampening of PTI, cleavage of PBS1 leads to activation of ETI though

	
  

137	
  

PBS1’s association with the cognate resistant (R)-gene RPS5 (Shao et al., 2003; Zhang
& Zhou, 2010). In examining the expression of both, RPS5 and PBS1 in wild type Col-0
and the adf4 mutant it was demonstrated that the adf4 mutant has a significant
reduction in the mRNA levels of RPS5 and no reduction in PBS1 (Porter et al., 2012).
This observation is in agreement, and furthermore, supports a growing hypothesis that
the fluctuation of nuclear actin levels contribute to the activation of gene transcription, in
large part through the association of actin with all three RNA polymerases, including
chromatin maintenance machinery (Vartiainen et al., 2012). Indeed, the recent work by
Porter et al. demonstrating abrogation of RPS5 expression in the adf4 mutant coupled
with ADF4’s presence within the nucleus (Porter et al., 2012), suggests a nuclear role
for ADF4 in controlling the activation of defense signaling in plants.

The next step in the current work is to understand the “ins and outs” of the temporal and
spatial localization of actin, ABPs, and the dynamics therein. For example, while plant
actin has a nuclear export signal, it does not possess a strong nuclear localization
signal (Kandasamy et al., 2010). Thus, the precise nature by which actin enters the
nucleus remains undefined. However, a recent paper has demonstrated that actin,
through interactions with both cofilin and Importin9, is actively translocated into the
nucleus, and furthermore, that cofilin/importin9 dependent differential nuclear actin
levels ultimately effect transcription efficiency (Dopie et al., 2012). This would support
the hypothesis that ABPs themselves are the chaperones that facilitate nuclear
localization of G-actin. If this hypothesis proves correct, it would support a model
(Figure A.1) whereby ADF4 association with actin may facilitate active nuclear import of

	
  

138	
  

actin, thus regulating expression of RPS5 through actin dependent assembly and
activation of transcription or chromatin modifying machinery.

Phosphorylation of ADF4 regulates its cellular function and reveals a potential
new virulence target for Pseudomonas syringae DC3000 AvrPphB

To define the mechanism(s) through which the broader function (e.g., actin binding,
filament severing, depolymerization) of ADF4 is regulated, Tian et al. investigated the
biochemical activity (affinity and depolymerization) of ADF4 (Tian et al., 2009). To
elucidate the link between (in vitro) biochemical function and the regulation of actin
cytoskeletal dynamics ultimately leading to immune signaling, Porter et al. (2012)
investigated phosphorylation as a likely regulatory processes required for activation and
attenuation of signaling. Support for this comes from previous work using the vertebrate
homolog ADF/cofilin, where numerous factors have been identified as regulatory steps
which

alter

the

biochemical

function

of

cofilin,

including

most

importantly,

phosphorylation at Serine-3, binding of phosphatidylinositol 4,5-bisphosphate, and
cellular pH (Mizuno, 2013). Indeed, our own work not only showed that ADF4 is
phosphorylated at the Serine-6 position, but that this phosphorylation event was
required for regulating ADF4 affinity for F-actin, as well as for activation of immune
signaling through RPS5 mRNA accumulation and MAPK activation (Porter et al., 2012).
Thus, as proposed in Figure A.1, our data support the hypothesis that not only is the
actin cytoskeleton a virulence target of P. syringae expressing AvrPphB, but that this

	
  

139	
  

function regulates a complex network, linking pathogen perception and virulence to
nuclear dynamics and the control of transcription.

FINAL REMARKS

Identifying the ADF4 dependent expression of RPS5 advances current research into the
role of actin within the nucleus, and additionally supporting reports of the actin
cytoskeleton as a virulence target of not only mammalian pathogens, but of plant
pathogens as well (Tian et al., 2009; Day et al., 2011; Porter et al., 2012).

Acknowledgements

We would like to thank members of the Day lab for critical reading of the manuscript.
The work described herein was supported by grants from the Early CAREER award
from the National Science Foundation (IOS-0641319) and Arabidopsis 2010 grant from
the National Science Foundation (IOS-1021044).

	
  

140	
  

Figure A.1. Working hypothesis for the modulation of host resistance and cell
signaling through control of actin cytoskeletal dynamics. The virulence activity of
the bacterial cysteine protease AvrPphB targets an unidentified kinase that is
responsible for the phosphorylation and subsequent regulation of actin depolymerizing
factor-4 (ADF4). As a key regulator in controlling not only actin filament organization,
but also as a modulator of the balance of globular (G) and filamentous (F) actin,
targeting of ADF4 by pathogens represents a key switch in controlling host cell
response. At a transcriptional level, the balance of cytoplasmic versus nuclear actin is
required for RNA polymerase function and the general organization and maintenance of
chromatin architecture. ETI, effector triggered immunity; PTI, pathogen-associated
molecular pattern (PAMP)-triggered immunity; ADF, actin depolymerizing factor; PRF,
profilin. This figure was inspired by Vartiainen et al. (2012).
	
  

141	
  

LITERATURE CITED

	
  

142	
  

LITERATURE CITED

Ade J, DeYoung B, Golstein C, Innes RW. 2007. Indirect activation of a plant
nucleotide binding site–leucine-rich repeat protein by a bacterial protease. Proceedings
of the National Academy of Sciences of the United States of America 104(7): 2531.
Akkerman M, Overdijk EJ, Schel JH, Emons AM, Ketelaar T. 2011. Golgi body
motility in the plant cell cortex correlates with actin cytoskeleton organization. Plant &
cell physiology 52(10): 1844-1855.
Aktories K. 2011. Bacterial protein toxins that modify host regulatory GTPases. Nature
reviews. Microbiology 9(7): 487-498.
Aktories K, Lang AE, Schwan C, Mannherz HG. 2011. Actin as target for modification
by bacterial protein toxins. The FEBS journal 278(23): 4526-4543.
Allwood EG. 2002. Regulation of the Pollen-Specific Actin-Depolymerizing Factor
LlADF1. THE PLANT CELL ONLINE 14(11): 2915-2927.
Allwood EG, Smertenko A, Hussey PJ. 2001. Phosphorylation of plant actindepolymerising factor by calmodulin-like domain protein kinase. FEBS Letters 499(1-2):
97-100.
Andrianantoandro E, Pollard TD. 2006. Mechanism of actin filament turnover by
severing and nucleation at different concentrations of ADF/cofilin. Molecular cell 24(1):
13-23.
Arnold K, Bordoli L, Kopp J, Schwede T. 2006. The SWISS-MODEL workspace: a
web-based environment for protein structure homology modelling. Bioinformatics 22(2):
195-201.
Asai T, Tena G, Plotnikova J, Willmann MR, Chiu W-L, Gomez-Gomez L, Boller T,
Ausubel FM, Sheen J. 2002. MAP kinase signalling cascade in Arabidopsis innate
immunity. Nature 415(6875): 977-983.
Ausubel FM. 2005. Are innate immune signaling pathways in plants and animals
conserved? Nature immunology 6(10): 973-979.
	
  

143	
  

Bamburg JR. 1999. Proteins of the ADF/cofilin family: essential regulators of actin
dynamics. Annual review of cell and developmental biology 15: 185-230.
Bamburg JR, Bernstein BW. 2010. Roles of ADF/cofilin in actin polymerization and
beyond. F1000 biology reports 2: 62.
Barrero RA. 2002. Arabidopsis CAP Regulates the Actin Cytoskeleton Necessary for
Plant Cell Elongation and Division. THE PLANT CELL ONLINE 14(1): 149-163.
Beck M, Zhou J, Faulkner C, MacLean D, Robatzek S. 2012. Spatio-temporal cellular
dynamics of the Arabidopsis flagellin receptor reveal activation status-dependent
endosomal sorting. The Plant cell 24(10): 4205-4219.
Beckers GJM, Jaskiewicz M, Liu Y, Underwood WR, He SY, Zhang S, Conrath U.
2009. Mitogen-activated protein kinases 3 and 6 are required for full priming of stress
responses in Arabidopsis thaliana. The Plant Cell … 21(3): 944-953.
Belin BJ, Mullins RD. 2013. What we talk about when we talk about nuclear actin.
Nucleus 4(4): 291-297.
Bernard O. 2007. Lim kinases, regulators of actin dynamics. The international journal of
biochemistry & cell biology 39(6): 1071-1076.
Bettinger BT, Gilbert DM, Amberg DC. 2004. Actin up in the nucleus. Nature reviews.
Molecular cell biology 5(5): 410-415.
Blanchoin L, Boujemaa-Paterski R, Sykes C, Plastino J. 2014. Actin dynamics,
architecture, and mechanics in cell motility. Physiological reviews 94(1): 235-263.
Blanchoin L, Pollard TD, Mullins RD. 2000. Interactions of ADF/cofilin, Arp2/3
complex, capping protein and profilin in remodeling of branched actin filament networks.
Current biology : CB 10(20): 1273-1282.
Blom N, Gammeltoft S, Brunak S. 1999. Sequence and structure-based prediction of
eukaryotic protein phosphorylation sites. Journal of molecular biology 294(5): 13511362.

	
  

144	
  

Boucrot E, Henry T, Borg JP, Gorvel JP, Meresse S. 2005. The intracellular fate of
Salmonella depends on the recruitment of kinesin. Science 308(5725): 1174-1178.
Bowman GD, Nodelman IM, Hong Y, Chua NH, Lindberg U, Schutt CE. 2000. A
comparative structural analysis of the ADF/cofilin family. Proteins 41(3): 374-384.
Brandizzi F, Wasteneys GO. 2013. Cytoskeleton-dependent endomembrane
organization in plant cells: an emerging role for microtubules. The Plant journal : for cell
and molecular biology 75(2): 339-349.
Bugyi B, Carlier M-F. 2010. Control of Actin Filament Treadmilling in Cell Motility.
Annual Review of Biophysics 39(1): 449-470.
Burgos-Rivera B, Ruzicka DR, Deal R, McKinney EC, King-Reid L, Meagher RB.
2008. ACTIN DEPOLYMERIZING FACTOR9 controls development and gene
expression in Arabidopsis. Plant Molecular Biology 68(6): 619-632.
Burtnick LD, Urosev D, Irobi E, Narayan K, Robinson RC. 2004. Structure of the Nterminal half of gelsolin bound to actin: roles in severing, apoptosis and FAF. The
EMBO Journal 23(14): 2713-2722.
Campellone KG, Welch MD. 2010. A nucleator arms race: cellular control of actin
assembly. Nature reviews. Molecular cell biology 11(4): 237-251.
Carlier MF, Laurent V, Santolini J, Melki R, Didry D, Xia GX, Hong Y, Chua NH,
Pantaloni D. 1997. Actin depolymerizing factor (ADF/cofilin) enhances the rate of
filament turnover: implication in actin-based motility. The Journal of Cell Biology 136(6):
1307-1322.
Castano E, Philimonenko VV, Kahle M, Fukalova J, Kalendova A, Yildirim S, Dzijak
R, Dingova-Krasna H, Hozak P. 2010. Actin complexes in the cell nucleus: new stones
in an old field. Histochemistry and cell biology 133(6): 607-626.
Century KS, Shapiro AD, Repetti PP, Dahlbeck D, Holub E, Staskawicz BJ. 1997.
NDR1, a pathogen-induced component required for Arabidopsis disease resistance.
Science 278(5345): 1963-1965.

	
  

145	
  

Cheng X, Wu Y, Guo J, Du B, Chen R, Zhu L, He G. 2013. A rice lectin receptor-like
kinase that is involved in innate immune responses also contributes to seed
germination. The Plant journal : for cell and molecular biology 76(4): 687-698.
Chesarone MA, DuPage AG, Goode BL. 2010. Unleashing formins to remodel the
actin and microtubule cytoskeletons. Nature reviews. Molecular cell biology 11(1): 6274.
Chinchilla D, Zipfel C, Robatzek S, Kemmerling B, Nürnberger T, Jones JDG, Felix
G, Boller T. 2007. A flagellin-induced complex of the receptor FLS2 and BAK1 initiates
plant defence. Nature 448(7152): 497-500.
Chisholm ST, Coaker G, Day B, Staskawicz BJ. 2006. Host-microbe interactions:
shaping the evolution of the plant immune response. Cell 124(4): 803-814.
Chtarbanova S, Imler JL. 2011. Microbial sensing by Toll receptors: a historical
perspective. Arteriosclerosis, thrombosis, and vascular biology 31(8): 1734-1738.
Chung EH, da Cunha L, Wu AJ, Gao Z, Cherkis K, Afzal AJ, Mackey D, Dangl JL.
2011. Specific threonine phosphorylation of a host target by two unrelated type III
effectors activates a host innate immune receptor in plants. Cell host & microbe 9(2):
125-136.
Clark TG, Merriam RW. 1977. Diffusible and bound actin nuclei of Xenopus laevis
oocytes. Cell 12(4): 883-891.
Clement M, Ketelaar T, Rodiuc N, Banora MY, Smertenko A, Engler G, Abad P,
Hussey PJ, de Almeida Engler J. 2009. Actin-depolymerizing factor2-mediated actin
dynamics are essential for root-knot nematode infection of Arabidopsis. The Plant cell
21(9): 2963-2979.
Clough SJ, Bent AF. 1998. Floral dip: a simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana. The Plant journal : for cell and molecular biology
16(6): 735-743.
Cope NF, Fraser P, Eskiw CH. 2010. The yin and yang of chromatin spatial
organization. Genome biology 11(3): 204.

	
  

146	
  

Day B, Henty JL, Porter KJ, Staiger CJ. 2011. The Pathogen-Actin Connection: A
Platform for Defense Signaling in Plants. Annual Review of Phytopathology 49(1): 483506.
Deslandes L, Rivas S. 2011. The plant cell nucleus: a true arena for the fight between
plants and pathogens. Plant signaling & behavior 6(1): 42-48.
Dong CH, Hong Y. 2013. Arabidopsis CDPK6 phosphorylates ADF1 at N-terminal
serine 6 predominantly. Plant cell reports 32(11): 1715-1728.
Dong CH, Tang W-P, Liu J-Y. 2013. ArabidopsisAtADF1 is Functionally Affected by
Mutations on Actin Binding Sites. Journal of integrative plant biology 55(3): 250-261.
Dopie J, Skarp K-P, Rajakylä EK, Tanhuanpää K, Vartiainen MK. 2012. Active
maintenance of nuclear actin by importin 9 supports transcription. Proceedings of the
National Academy of Sciences of the United States of America 109(9): E544-552.
Dundr M, Ospina JK, Sung MH, John S, Upender M, Ried T, Hager GL, Matera AG.
2007. Actin-dependent intranuclear repositioning of an active gene locus in vivo. The
Journal of Cell Biology 179(6): 1095-1103.
Ekengren SK, Liu Y, Schiff M, Dinesh-Kumar SP, Martin GB. 2003. Two MAPK
cascades, NPR1, and TGA transcription factors play a role in Pto-mediated disease
resistance in tomato. The Plant journal : for cell and molecular biology 36(6): 905-917.
Feng F, Yang F, Rong W, Wu X, Zhang J, Chen S, He C, Zhou JM. 2012. A
Xanthomonas uridine 5'-monophosphate transferase inhibits plant immune kinases.
Nature 485(7396): 114-118.
Feng Y, Liu Q, Xue Q. 2006. Comparative study of rice and Arabidopsis actindepolymerizing factors gene families. Journal of plant physiology 163(1): 69-79.
Feng Z, Chen X, Bao Y, Dong J, Zhang Z, Tao X. 2013. Nucleocapsid of Tomato
spotted wilt tospovirus forms mobile particles that traffic on an actin/endoplasmic
reticulum network driven by myosin XI-K. The New phytologist 200(4): 1212-1224.
Fu Y, Duan X, Tang C, Li X, Voegele RT, Wang X, Wei G, Kang Z. 2014. TaADF7, an
actin-depolymerizing factor, contributes to wheat resistance against Puccinia striiformis
f. sp. tritici. The Plant journal : for cell and molecular biology 78(1): 16-30.
	
  

147	
  

Fukui Y. 1978. Intranuclear actin bundles induced by dimethyl sulfoxide in interphase
nucleus of Dictyostelium. The Journal of Cell Biology 76(1): 146-157.
Galletta BJ, Mooren OL, Cooper JA. 2010. Actin dynamics and endocytosis in yeast
and mammals. Current opinion in biotechnology 21(5): 604-610.
Gassmann W, Hinsch ME, Staskawicz BJ. 1999. The Arabidopsis RPS4 bacterialresistance gene is a member of the TIR-NBS-LRR family of disease-resistance genes.
The Plant journal : for cell and molecular biology 20(3): 265-277.
Gibbon BC, Kovar DR, Staiger CJ. 1999. Latrunculin B has different effects on pollen
germination and tube growth. The Plant cell 11(12): 2349-2363.
Gómez Gómez L, Felix G, Boller T. 1999. A single locus determines sensitivity to
bacterial flagellin in Arabidopsis thaliana. The Plant Journal 18(3): 277-284.
Gómez-Gómez L, Boller T. 2000. FLS2: an LRR receptor-like kinase involved in the
perception of the bacterial elicitor flagellin in Arabidopsis. Molecular cell 5(6): 10031011.
Grant MR, Godiard L, Straube E, Ashfield T, Lewald J, Sattler A, Innes RW, Dangl
JL. 1995. Structure of the Arabidopsis RPM1 gene enabling dual specificity disease
resistance. Science (New York, NY) 269(5225): 843-846.
Grosse R, Vartiainen MK. 2013. To be or not to be assembled: progressing into
nuclear actin filaments. Nature reviews. Molecular cell biology 14(11): 693-697.
Guan X, Buchholz G, Nick P. 2014. Actin marker lines in grapevine reveal a
gatekeeper function of guard cells. Journal of plant physiology 171(13): 1164-1173.
Haglund CM, Welch MD. 2011. Pathogens and polymers: microbe-host interactions
illuminate the cytoskeleton. The Journal of Cell Biology 195(1): 7-17.
Hardham AR, Jones DA, Takemoto D. 2007. Cytoskeleton and cell wall function in
penetration resistance. Current opinion in plant biology 10(4): 342-348.

	
  

148	
  

Hardham AR, Takemoto D, White RG. 2008. Rapid and dynamic subcellular
reorganization following mechanical stimulation of Arabidopsis epidermal cells mimics
responses to fungal and oomycete attack. BMC plant biology 8: 63.
Henikoff S, Henikoff JG. 1992. Amino acid substitution matrices from protein blocks.
Proceedings of the National Academy of Sciences of the United States of America
89(22): 10915-10919.
Henty JL, Bledsoe SW, Khurana P, Meagher RB, Day B, Blanchoin L, Staiger CJ.
2011. Arabidopsis Actin Depolymerizing Factor4 Modulates the Stochastic Dynamic
Behavior of Actin Filaments in the Cortical Array of Epidermal Cells. THE PLANT CELL
ONLINE 23(10): 3711-3726.
Henty-Ridilla JL, Li J, Day B, Staiger CJ. 2014. ACTIN DEPOLYMERIZING
FACTOR4 regulates actin dynamics during innate immune signaling in Arabidopsis. The
Plant cell 26(1): 340-352.
Henty-Ridilla JL, Shimono M, Li J, Chang JH, Day B, Staiger CJ. 2013. The plant
actin cytoskeleton responds to signals from microbe-associated molecular patterns.
PLoS Pathogens 9(4): e1003290.
Higaki T, Kutsuna N, Sano T, Kondo N, Hasezawa S. 2010. Quantification and cluster
analysis of actin cytoskeletal structures in plant cells: role of actin bundling in stomatal
movement during diurnal cycles in Arabidopsis guard cells. The Plant journal : for cell
and molecular biology 61(1): 156-165.
Huang S, Blanchoin L, Kovar DR, Staiger CJ. 2003. Arabidopsis capping protein
(AtCP) is a heterodimer that regulates assembly at the barbed ends of actin filaments.
The Journal of biological chemistry 278(45): 44832-44842.
Hussey PJ, Ketelaar T, Deeks MJ. 2006. Control of the actin cytoskeleton in plant cell
growth. Annual Review of Plant Biology 57: 109-125.
Innes R. 2003. New effects of type III effectors. Molecular microbiology 50(2): 363-365.
Jiang CJ, Weeds AG, Khan S, Hussey PJ. 1997. F-actin and G-actin binding are
uncoupled by mutation of conserved tyrosine residues in maize actin depolymerizing
factor (ZmADF). Proceedings of the National Academy of Sciences of the United States
of America 94(18): 9973-9978.

	
  

149	
  

Jin H, Liu Y, Yang KY, Kim CY, Baker B, Zhang S. 2003. Function of a mitogenactivated protein kinase pathway in N gene-mediated resistance in tobacco. The Plant
journal : for cell and molecular biology 33(4): 719-731.
Johnson JL, Monfregola J, Napolitano G, Kiosses WB, Catz SD. 2012. Vesicular
trafficking through cortical actin during exocytosis is regulated by the Rab27a effector
JFC1/Slp1 and the RhoA-GTPase-activating protein Gem-interacting protein. Molecular
biology of the cell 23(10): 1902-1916.
Kaksonen M, Sun Y, Drubin DG. 2003. A pathway for association of receptors,
adaptors, and actin during endocytic internalization. Cell 115(4): 475-487.
Kandasamy MK, Burgos-Rivera B, McKinney EC, Ruzicka DR, Meagher RB. 2007.
Class-Specific Interaction of Profilin and ADF Isovariants with Actin in the Regulation of
Plant Development. THE PLANT CELL ONLINE 19(10): 3111-3126.
Kandasamy MK, McKinney EC, Meagher RB. 2002. Functional nonequivalency of
actin isovariants in Arabidopsis. Molecular biology of the cell 13(1): 251-261.
Kandasamy MK, McKinney EC, Meagher RB. 2010. Differential sublocalization of
actin variants within the nucleus. Cytoskeleton 67(11): 729-743.
Kang Y, Jelenska J, Cecchini NM, Li Y, Lee MW, Kovar DR, Greenberg JT. 2014.
HopW1 from Pseudomonas syringae Disrupts the Actin Cytoskeleton to Promote
Virulence in Arabidopsis. PLoS Pathogens 10(6): e1004232.
Kapoor P, Chen M, Winkler DD, Luger K, Shen X. 2013. Evidence for monomeric
actin function in INO80 chromatin remodeling. Nature structural & molecular biology
20(4): 426-432.
Kapoor P, Shen X. 2014. Mechanisms of nuclear actin in chromatin-remodeling
complexes. Trends in Cell Biology 24(4): 238-246.
Kiefer F, Arnold K, Kunzli M, Bordoli L, Schwede T. 2009. The SWISS-MODEL
Repository and associated resources. Nucleic Acids Research 37(Database): D387D392.
Kim SH, Kwon SI, Saha D, Anyanwu NC, Gassmann W. 2009. Resistance to the
Pseudomonas syringae Effector HopA1 Is Governed by the TIR-NBS-LRR Protein
	
  

150	
  

RPS6 and Is Enhanced by Mutations in SRFR1. PLANT PHYSIOLOGY 150(4): 17231732.
Knepper C, Day B. 2010. From Perception to Activation: The Molecular-Genetic and
Biochemical Landscape of Disease Resistance Signaling in Plants. The Arabidopsis
Book.
Knepper C, Savory EA, Day B. 2011. Arabidopsis NDR1 Is an Integrin-Like Protein
with a Role in Fluid Loss and Plasma Membrane-Cell Wall Adhesion. PLANT
PHYSIOLOGY 156(1): 286-300.
Knepper C, Savory EA, Day B. 2011. The role of NDR1 in pathogen perception and
plant defense signaling. Plant signaling & behavior 6(8): 1114-1116.
Kobayashi Y, Kobayashi I. 2013. Microwounding is a pivotal factor for the induction of
actin-dependent penetration resistance against fungal attack. Planta 237(5): 1187-1198.
Kunkel BN, Bent AF, Dahlbeck D, Innes RW, Staskawicz BJ. 1993. RPS2, an
Arabidopsis disease resistance locus specifying recognition of Pseudomonas syringae
strains expressing the avirulence gene avrRpt2. The Plant Cell … 5(8): 865-875.
Lappalainen P, Fedorov EV, Fedorov AA, Almo SC, Drubin DG. 1997. Essential
functions and actin-binding surfaces of yeast cofilin revealed by systematic
mutagenesis. The EMBO Journal 16(18): 5520-5530.
Lee SH, Dominguez R. 2010. Regulation of actin cytoskeleton dynamics in cells.
Molecules and cells 29(4): 311-325.
Levy A, Zheng JY, Lazarowitz SG. 2013. The Tobamovirus Turnip Vein Clearing Virus
30-Kilodalton Movement Protein Localizes to Novel Nuclear Filaments To Enhance
Virus Infection. Journal of Virology 87(11): 6428-6440.
Liu J, Elmore JM, Lin ZJ, Coaker G. 2011. A receptor-like cytoplasmic kinase
phosphorylates the host target RIN4, leading to the activation of a plant innate immune
receptor. Cell host & microbe 9(2): 137-146.
Lu D, Wu S, Gao X, Zhang Y, Shan L, He P. 2010. A receptor-like cytoplasmic kinase,
BIK1, associates with a flagellin receptor complex to initiate plant innate immunity.

	
  

151	
  

Proceedings of the National Academy of Sciences of the United States of America
107(1): 496-501.
Manning VA, Ciuffetti LM. 2005. Localization of Ptr ToxA Produced by Pyrenophora
tritici-repentis Reveals Protein Import into Wheat Mesophyll Cells. The Plant cell 17(11):
3203-3212.
Mathur J, Mathur N, Kirik V, Kernebeck B, Srinivas BP, Hulskamp M. 2003.
Arabidopsis CROOKED encodes for the smallest subunit of the ARP2/3 complex and
controls cell shape by region specific fine F-actin formation. Development 130(14):
3137-3146.
McGhie EJ, Brawn LC, Hume PJ, Humphreys D, Koronakis V. 2009. Salmonella
takes control: effector-driven manipulation of the host. Current opinion in microbiology
12(1): 117-124.
McGough A, Pope B, Chiu W, Weeds A. 1997. Cofilin changes the twist of F-actin:
Implications for actin filament dynamics and cellular function. The Journal of Cell
Biology 138(4): 771-781.
Meagher RB, Kandasamy MK, Smith AP, McKinney EC. 2010. Nuclear actin-related
proteins at the core of epigenetic control. Plant signaling & behavior 5(5): 518-522.
Meagher RB, McKinney EC, Kandasamy MK. 1999. Isovariant dynamics expand and
buffer the responses of complex systems: the diverse plant actin gene family. The Plant
cell 11(6): 995-1006.
Meinhardt SW, Cheng W, Kwon CY, Donohue CM, Rasmussen JB. 2002. Role of
the arginyl-glycyl-aspartic motif in the action of Ptr ToxA produced by Pyrenophora
tritici-repentis. PLANT PHYSIOLOGY 130(3): 1545-1551.
Miklis M, Consonni C, Bhat RA, Lipka V, Schulze-Lefert P, Panstruga R. 2007.
Barley MLO modulates actin-dependent and actin-independent antifungal defense
pathways at the cell periphery. PLANT PHYSIOLOGY 144(2): 1132-1143.
Miyamoto K, Gurdon JB. 2012. Transcriptional regulation and nuclear reprogramming:
roles of nuclear actin and actin-binding proteins. Cellular and Molecular Life Sciences
70(18): 3289-3302.

	
  

152	
  

Mizuno K. 2013. Signaling mechanisms and functional roles of cofilin phosphorylation
and dephosphorylation. Cellular Signalling 25(2): 457-469.
Moes D, Gatti S, Hoffmann C, Dieterle M, Moreau F, Neumann K, Schumacher M,
Diederich M, Grill E, Shen WH, Steinmetz A, Thomas C. 2013. A LIM domain protein
from tobacco involved in actin-bundling and histone gene transcription. Molecular Plant
6(2): 483-502.
Mooren OL, Galletta BJ, Cooper JA. 2012. Roles for actin assembly in endocytosis.
Annual Review Of Biochemistry 81: 661-686.
Mullins RD, Hansen SD. 2013. In vitro studies of actin filament and network dynamics.
Current opinion in cell biology 25(1): 6-13.
Nakagawa T, Kurose T, Hino T, Tanaka K, Kawamukai M, Niwa Y, Toyooka K,
Matsuoka K, Jinbo T, Kimura T. 2007. Development of series of gateway binary
vectors, pGWBs, for realizing efficient construction of fusion genes for plant
transformation. Journal of bioscience and bioengineering 104(1): 34-41.
Ng PC. 2003. SIFT: predicting amino acid changes that affect protein function. Nucleic
Acids Research 31(13): 3812-3814.
Obrdlik A, Percipalle P. 2011. The F-actin severing protein cofilin-1 is required for
RNA polymerase II transcription elongation. Nucleus 2(1): 72-79.
Oh CS, Martin GB. 2011. Tomato 14-3-3 protein TFT7 interacts with a MAP kinase
kinase to regulate immunity-associated programmed cell death mediated by diverse
disease resistance proteins. The Journal of biological chemistry 286(16): 14129-14136.
Olave IA, Reck-Peterson SL, Crabtree GR. 2002. Nuclear actin and actin-related
proteins in chromatin remodeling. Annual Review Of Biochemistry 71(1): 755-781.
Ono S. 2007. Mechanism of depolymerization and severing of actin filaments and its
significance in cytoskeletal dynamics. International review of cytology 258: 1-82.
Ouellet F, Carpentier E, Cope MJ, Monroy AF, Sarhan F. 2001. Regulation of a
wheat actin-depolymerizing factor during cold acclimation. PLANT PHYSIOLOGY
125(1): 360-368.

	
  

153	
  

Paavilainen VO, Oksanen E, Goldman A, Lappalainen P. 2008. Structure of the
actin-depolymerizing factor homology domain in complex with actin. The Journal of Cell
Biology 182(1): 51-59.
Pandey SP, Somssich IE. 2009. The role of WRKY transcription factors in plant
immunity. PLANT PHYSIOLOGY 150(4): 1648-1655.
Pederson T, Aebi U. 2002. Actin in the nucleus: what form and what for? Journal of
structural biology 140(1-3): 3-9.
Percipalle. 2013. Co-transcriptional nuclear actin dynamics. Nucleus 4(1): 43-52.
Pizarro-Cerda J, Cossart P. 2009. Listeria monocytogenes membrane trafficking and
lifestyle: the exception or the rule? Annual review of cell and developmental biology 25:
649-670.
Porta JC, Borgstahl GE. 2012. Structural basis for profilin-mediated actin nucleotide
exchange. Journal of molecular biology 418(1-2): 103-116.
Porter, Shimono M, Tian M, Day B. 2012. Arabidopsis Actin-Depolymerizing Factor-4
Links Pathogen Perception, Defense Activation and Transcription to Cytoskeletal
Dynamics. PLoS Pathogens 8(11): e1003006.
Poukkula M, Kremneva E, Serlachius M, Lappalainen P. 2011. Actin-depolymerizing
factor homology domain: A conserved fold performing diverse roles in cytoskeletal
dynamics. Cytoskeleton 68(9): 471-490.
Qi D, DeYoung BJ, Innes RW. 2012. Structure-function analysis of the coiled-coil and
leucine-rich repeat domains of the RPS5 disease resistance protein. PLANT
PHYSIOLOGY 158(4): 1819-1832.
Qi Y, Tsuda K, Glazebrook J, Katagiri F. 2011. Physical association of patterntriggered immunity (PTI) and effector-triggered immunity (ETI) immune receptors in
Arabidopsis. Molecular plant pathology 12(7): 702-708.
Ramos-Morales F. 2012. Impact of Salmonella enterica Type III Secretion System
Effectors on the Eukaryotic Host Cell. ISRN Cell Biology 2012(6): 1-36.

	
  

154	
  

Ressad F, Didry D, Xia GX, Hong Y, Chua NH, Pantaloni D, Carlier MF. 1998.
Kinetic analysis of the interaction of actin-depolymerizing factor (ADF)/cofilin with Gand F-actins. Comparison of plant and human ADFs and effect of phosphorylation. The
Journal of biological chemistry 273(33): 20894-20902.
Ribeiro D, Jung M, Moling S, Borst JW, Goldbach R, Kormelink R. 2013. The
cytosolic nucleoprotein of the plant-infecting bunyavirus tomato spotted wilt recruits
endoplasmic reticulum-resident proteins to endoplasmic reticulum export sites. The
Plant cell 25(9): 3602-3614.
Robertson AS, Smythe E, Ayscough KR. 2009. Functions of actin in endocytosis.
Cellular and molecular life sciences : CMLS 66(13): 2049-2065.
Rodriguez MCS, Petersen M, Mundy J. 2010. Mitogen-activated protein kinase
signaling in plants. Annual Review of Plant Biology 61: 621-649.
Roland J, Berro J, Michelot A, Blanchoin L, Martiel JL. 2008. Stochastic severing of
actin filaments by actin depolymerizing factor/cofilin controls the emergence of a steady
dynamical regime. Biophysical journal 94(6): 2082-2094.
Ruzicka DR, McKinney EC, Burgos-Rivera B, Meagher RB. 2007. The ancient
subclasses of Arabidopsis ACTIN DEPOLYMERIZING FACTOR genes exhibit novel
and differential expression. The Plant Journal 52(3): 460-472.
Scheer U, Hinssen H, Franke WW, Jockusch BM. 1984. Microinjection of actinbinding proteins and actin antibodies demonstrates involvement of nuclear actin in
transcription of lampbrush chromosomes. Cell 39(1): 111-122.
Schutz I, Gus-Mayer S, Schmelzer E. 2006. Profilin and Rop GTPases are localized at
infection sites of plant cells. Protoplasma 227(2-4): 229-235.
Shao F. 2008. Biochemical functions of Yersinia type III effectors. Current opinion in
microbiology 11(1): 21-29.
Shao F, Golstein C, Ade J, stoutemyer M, dixon JE, Innes RW. 2003. Cleavage of
Arabidopsis PBS1 by a Bacterial Type III Effector. Science (New York, NY) 301(5637):
1230-1233.

	
  

155	
  

Shieh MW, Wessler SR, Raikhel NV. 1993. Nuclear targeting of the maize R protein
requires two nuclear localization sequences. PLANT PHYSIOLOGY 101(2): 353-361.
Shvetsov A, Berkane E, Chereau D, Dominguez R, Reisler E. 2009. The actinbinding domain of cortactin is dynamic and unstructured and affects lateral and
longitudinal contacts in F-actin. Cell Motility and the Cytoskeleton 66(2): 90-98.
Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H,
Remmert M, Soding J, Thompson JD, Higgins DG. 2011. Fast, scalable generation
of high-quality protein multiple sequence alignments using Clustal Omega. Molecular
systems biology 7: 539.
Silacci P, Mazzolai L, Gauci C, Stergiopulos N, Yin HL, Hayoz D. 2004. Gelsolin
superfamily proteins: key regulators of cellular functions. Cellular and molecular life
sciences : CMLS 61(19-20): 2614-2623.
Smertenko A, Jiang C, Simmons N, Weeds A, Davies D, Hussey PJ. 1998. Ser6 in
the maize actin‐depolymerizing factor, ZmADF3, is phosphorylated by a calcium‐
stimulated protein kinase and is essential for the control of functional activity. The Plant
Journal 14(2): 187-193.
Smethurst DG, Dawes IW, Gourlay CW. 2013. Actin - a biosensor that determines cell
fate in yeasts. FEMS yeast research.
Snowman BN, Kovar DR, Shevchenko G, Franklin-Tong VE, Staiger CJ. 2002.
Signal-mediated depolymerization of actin in pollen during the self-incompatibility
response. The Plant cell 14(10): 2613-2626.
Sparkes I, Runions J, Hawes C, Griffing L. 2009. Movement and remodeling of the
endoplasmic reticulum in nondividing cells of tobacco leaves. The Plant cell 21(12):
3937-3949.
Staiger CJ, Sheahan MB, Khurana P, Wang X, McCurdy DW, Blanchoin L. 2009.
Actin filament dynamics are dominated by rapid growth and severing activity in the
Arabidopsis cortical array. The Journal of Cell Biology 184(2): 269-280.
Stuven T, Hartmann E, Gorlich D. 2003. Exportin 6: a novel nuclear export receptor
that is specific for profilin.actin complexes. The EMBO Journal 22(21): 5928-5940.

	
  

156	
  

Sun T, Li S, Ren H. 2013. Profilin as a regulator of the membrane-actin cytoskeleton
interface in plant cells. Frontiers in plant science 4: 1-7.
Swiderski M, Innes RW. 2001. The Arabidopsis PBS1 resistance gene encodes a
member of a novel protein kinase subfamily. The Plant Journal 26(1): 101-112.
Takemoto D, Hardham AR. 2004. The cytoskeleton as a regulator and target of biotic
interactions in plants. PLANT PHYSIOLOGY 136(4): 3864-3876.
Takemoto D, Jones DA, Hardham AR. 2006. Re-organization of the cytoskeleton and
endoplasmic reticulum in the Arabidopsis pen1-1 mutant inoculated with the nonadapted powdery mildew pathogen, Blumeria graminis f. sp. hordei. Molecular plant
pathology 7(6): 553-563.
Tholl S, Moreau F, Hoffmann C, Arumugam K, Dieterle M, Moes D, Neumann K,
Steinmetz A, Thomas C. 2011. Arabidopsis actin-depolymerizing factors (ADFs) 1 and
9 display antagonist activities. FEBS Letters 585(12): 1821-1827.
Thomas C. 2012. Bundling actin filaments from membranes: some novel players.
Frontiers in plant science 3: 188.
Tian M, Chaudhry F, Ruzicka DR, Meagher RB, Staiger CJ, Day B. 2009.
Arabidopsis actin-depolymerizing factor AtADF4 mediates defense signal transduction
triggered by the Pseudomonas syringae effector AvrPphB. PLANT PHYSIOLOGY
150(2): 815.
Tian M, Win J, Savory E, Burkhardt A, Held M, Brandizzi F, Day B. 2011. 454
Genome sequencing of Pseudoperonospora cubensis reveals effector proteins with a
QXLR translocation motif. Molecular plant-microbe interactions : MPMI 24(5): 543-553.
Uribe R, Jay D. 2009. A review of actin binding proteins: new perspectives. Molecular
biology reports 36(1): 121-125.
van Gisbergen PAC, Bezanilla M. 2013. Plant formins: membrane anchors for actin
polymerization. Trends in Cell Biology 23(5): 227-233.
Vartiainen MK, Huet G, Skarp K-P. 2012. Nuclear actin levels as an important
transcriptional switch. Transcription 3(5): 226-230.

	
  

157	
  

Visvikis O, Maddugoda MP, Lemichez E. 2010. Direct modifications of Rho proteins:
deconstructing GTPase regulation. Biology of the cell / under the auspices of the
European Cell Biology Organization 102(7): 377-389.
Wada A, Fukuda M, Mishima M, Nishida E. 1998. Nuclear export of actin: a novel
mechanism regulating the subcellular localization of a major cytoskeletal protein. The
EMBO Journal 17(6): 1635-1641.
Warren RF, Merritt PM, Holub E, Innes RW. 1999. Identification of three putative
signal transduction genes involved in R gene-specified disease resistance in
Arabidopsis. Genetics 152(1): 401-412.
Whelan JT, Hollis SE, Cha DS, Asch AS, Lee MH. 2012. Post-transcriptional
regulation of the Ras-ERK/MAPK signaling pathway. Journal of cellular physiology
227(3): 1235-1241.
Winder SJ, Ayscough KR. 2005. Actin-binding proteins. Journal of cell science 118(Pt
4): 651-654.
Yang N, Higuchi O, Ohashi K, Nagata K, Wada A, Kangawa K, Nishida E, Mizuno
K. 1998. Cofilin phosphorylation by LIM-kinase 1 and its role in Rac-mediated actin
reorganization. Nature 393(6687): 809-812.
Yokota E, Ueda H, Hashimoto K, Orii H, Shimada T, Hara-Nishimura I, Shimmen T.
2011. Myosin XI-dependent formation of tubular structures from endoplasmic reticulum
isolated from tobacco cultured BY-2 cells. PLANT PHYSIOLOGY 156(1): 129-143.
Yuan HY, Yao LL, Jia ZQ, Li Y, Li YZ. 2006. Verticillium dahliae toxin induced
alterations of cytoskeletons and nucleoli in Arabidopsis thaliana suspension cells.
Protoplasma 229(1): 75-82.
Zhang J, Li W, Xiang T, Liu Z, Laluk K, Ding X, Zou Y, Gao M, Zhang X, Chen S.
2010. Receptor-like Cytoplasmic Kinases Integrate Signaling from Multiple Plant
Immune Receptors and Are Targeted by a Pseudomonas syringae Effector. Cell Host
and Microbe 7(4): 290-301.
Zhang J, Zhou J-M. 2010. Plant Immunity Triggered by Microbial Molecular Signatures.
Molecular Plant 3(5): 783-793.

	
  

158	
  

Zinchuk V, Grossenbacher-Zinchuk O. 2014. Quantitative colocalization analysis of
fluorescence microscopy images. Current protocols in cell biology / editorial board, Juan
S. Bonifacino ... [et al.] 62: Unit 4 19 11-14.
	
  

	
  

159