39..

9“}:
I, ‘6

. V a.
2.... I
fifiwMWc..& an... ..

i.
play.

glut.

.51
59533 . . . V . .
. t V V . .31}. 13/.

c n
11::

. :u a. .a.
. o. 24.91.65,.

0 . 1-39.23;
5.! .05: e ‘

‘1
inky». . . . , . V VV .. . '81.» -
.. . . . V . . 6 5.3%. a."
V V .XLJ. ”4W. .v: ab
21% i. »
oV 01V #1
.2 y . ..
~J I: 5“! DD‘D
. naflw “Mr! .lttlfi!‘
a: «fin .Ilrl

in? V . . . V .
. V . . . V . V (13.9.» .

3')!!! :0
5.1.5.3.? .
Ell‘vi

I.

X91: . . . .
i... 5...... . . . V .1...
$.10 T. . . ‘ A . . V .
II: or. . . , . ., . . . Ifizyvs‘ai
}¢Vv!, .\
. . . V ,1... ,
. V V . . $3..

37;].

mg.

ly‘vilc

.51 63.9.1311}?

:15?!” {IA 151‘!!! z p but.

Al’§;1.u:7..; .v s it
a

.5:=,wr;l V

§ "‘ |‘I$‘:i

2’; ’h’l'fi

i ,tx u‘:1¢

1;. th .
I.

y
!
‘

no

t 1

k

i
:

‘u).. .8).

.5 iv. , 51...,“ 3:3
o. . w 18.... .HWUHM...
22;, :r .V... V .7 . . 3 ‘dwvhdlli . h...

i 1 I ‘1: . . y 7......- .s< 4 )1) I A.;)~..v.\‘

V . . V . . . V V A .vvu 2.34.... .1...» .c . .. Swan") . ... . u

. j . . . , . . i II I ,\l V §“\I1‘I.)\;’\,\ I
. . V . . . V . V ‘ilé’SDJQc
V 2.2.. I: .1 31.1.;
:51: 2:.“ ‘12..

. ‘1‘ V l.‘
.9 39;; 5.153% ‘13.) ‘ :4!
. .\. .5?! ‘A?. I. v: évr‘l
. : v»). v y (‘30 biannual!» .8...
1r . I
. : . V . V . ..V I.‘V0..l 40ft ‘x

‘u. . lv/ 1.

 

"‘ 8819

MSU i: an Affirmative Action/Equal Opportunity Institution

MICHIGAN STATE UNIVERSITY L BEAR ES

1 l (M {Hill/WM!!!Milli/I'll!!!

3 1293 01421 7263

ll

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

This is to certify that the

dissertation entitled

Cytokinin and Nitrate~
Regulation of Nitrate Reductases

in Agrostemma gjthago
presented by

Ronda White

has been accepted towards fulfillment
of the requirements for

Ph. D. degree in Biochemistry/Genetics

Liz/LA, (Jud. ck.

Major professor

Date 4/19/96

0-12771

 

LIBRARY
Michigan State
Unlversity

 

 

 

 

PLACE IN RETURN BOX to remove thle checkout from your record.
TO AVOID FINES return on or before dete due.

F——__—_'———_—=_I
DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

usu le'An Nflmetlve AotIon/Equel Opportunlty InetItqun
Wt

 

CYTOKININ AND NITRATE REGULATION
OF NITRATE REDUCTASE IN AGROSTEMMA GITHAGO

Bv

Ronda White

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degrees of

DOCTOR OF PHILOSOPHY

Department of Biochemistry
and
Genetics Program

1996

ABSTRACT

CYTOKININ AND NITRATE REGULATION
OF NITRATE REDUCTASE IN AGROSTEMMA GITHAGO

Bv
Ronda White

Cytokinins are a class of phytohormones that regulate various aspects of
plant growth and development. To understand the mechanism of cytokinin
regulation, research has focussed on cytokinin regulation of gene expression.
We studied the regulation of nitrate reductase (NR) by cytokinin in Agrostemma
githago because it is a fast and specific response, and we are studying an
enzyme where much biochemical and molecular biological information is known.

Three partial NR cDNA clones were isolated and showed high sequence
homology. All three genes were regulated by nitrate; two genes were regulated
by cytokinin. Changes in mRNA levels were transient and preceded changes
in NR activity. Cytokinin increased NR activity in the cotyledons but increased
NR mRNA levels in roots and cotyledons. Nitrate increased NR activity and NR
mRNA levels in roots and cotyledons. Increases in NR mRNA levels were
observed sooner in the cotyledons than in the roots. Agnr2 mRNA levels were
much less abundant than Agnr1 or Agnr3 mRNA levels, and were increased
only by nitrate, primarily in the roots.

There were low levels of NR activity at the zero time point that
transiently increased with incubation of embryos on water. At the zero time

point when there were low levels of NR activity, there were very high levels of

NR mRNAs. The mRNA levels greatly decreased within 2 h of incubation on
water.

Nuclear runoff transcription analysis suggested nitrate regulated Agnr1
and Agnr3 at least partially at the transcriptional level, and cytokinin regulated
the genes at the post-transcriptional level. When NR activity was additive, NR
mRNA levels were not additive. And there were high levels of mRNAs present
at the zero time point when there was low NR activity. Taken together, the
results suggest multiple levels of regulation by nitrate and cytokinin. Two
genomic clones, corresponding to the genes regulated by cytokinin and nitrate,
were isolated. These results may lead to further analysis of the mechanismls)
of cytokinin regulation of NR, and to further understanding of how cytokinin

regulate plant growth and development.

To Joseph, Laura, and Baby

Without you, I would not be where I am

iv

ACKNOWLEDGEMENTS

I would like to thank Hans Kende, in whose laboratory I spent many years on
this project. I would also to like thank my committee members for their
assistance: Pam Green, Lee Kroos, Lee McIntosh, and Shelagh Ferguson-

Miller.

I would also like to thank all past and present members of the Kende Lab who
have taught and supported me in my work. Special thanks go to Wilfried
Peters, who was the only other person working on this project in the lab. I
enjoyed our discussions and his eternal optimism. Thank you to Sergei
Mekhodov, who shared discussions on the RT-PCR analysis. And thank you to

David Silver and Alexander Pinaev who helped in the nuclei isolations.

And thank you to Joseph White, for everything.

TABLE OF CONTENTS

Page

LIST OF TABLES ............................................ ix
LIST OF FIGURES ............................................ X
CHAPTER 1: Introduction .................................... 1
CYTOKININS ............................................ l
LOCALIZATION ..................................... 2
BIOSYNTHESIS ..................................... 5

CYTOKININ METABOLISM ............................. 9

CYTOKININ ACTIVITIES ............................ 10

GENE REGULATION BY CYTOKININS ................... 11

NITRATE REDUCTASE .................................... l6
FUNCTIONAL PROPERTIES ........................... l7
REGULATION OF NR ................................ 19
LOCALIZATION OF NR .............................. 20
AGROSTEMMA GITHAGO ................................... 20
OBJECTIVES ........................................... 23
REFERENCES ........................................... 24
CHAPTER 2: The Biochemical Analysis of Nitrate Reductase in
Agrostemma githago Embryos ........................... 33
ABSTRACT ............................................. 33
INTRODUCTION ......................................... 35
MATERIALS AND METHODS ................................ 37

vi

RESULTS ............................................. 39

DISCUSSION .......................................... 54
REFERENCES .......................................... 57
CHAPTER 3: Molecular Cloning of Three Nitrate Reductase
cDNA Clones from Agrostemma githago Embryos ........ 59
ABSTRACT ............................................ 59
INTRODUCTION ........................................ 60
MATERIALS AND METHODS ............................... 62
RESULTS ............................................. 66
DISCUSSION .......................................... 89
REFERENCES .......................................... 91
CHAPTER 4: Cytokinin and Nitrate Regulation of Nitrate
Reductases in Agrostemma githago Embryos ................. 95
ABSTRACT ............................................ 95
INTRODUCTION ........................................ 97
MATERIALS AND METHODS .............................. 100
RESULTS ............................................ 106
DISCUSSION ......................................... 131
REFERENCES ......................................... 135
CHAPTER 5: The Isolation of Nitrate Reductase Genomic Clones
from Agrostemma githago ................................. 137
ABSTRACT ........................................... 137
INTRODUCTION ....................................... 138
MATERIALS AND METHODS .............................. 139
RESULTS ............................................ 142
DISCUSSION ......................................... 150
REFERENCES ......................................... 153

vii

CHAPTER 6: Summary and Discussion ....................... 155

SUMMARY ............................................ 155
PHYSIOLOGICAL SIGNIFICANCE OF CYTOKININ ON NR ...... 159
DISCUSSION ......................................... 161
CONCLUDING REMARKS ................................. 164
REFERENCES ......................................... 1 6 5
APPENDIX ................................................ 167

viii

LIST OF TABLES

Table 1.1. Examples of enzymes regulated by cytokinins....13

Table 2.1. The localization of cytokinin-
and nitrate-induced NR activity in
embryos, roots, and cotyledon pairs .................. 44

Table 3.1. Nucleotide sequence homology of three
A. githago nitrate reductase partial
cDNA clones .......................................... 76

Table 3.2. Nucleotide sequence homology of three
NR subclones ......................................... 88

LIST OF FIGURES

Page

Figure 1.1. Structures of cytokinins ...................... 4
Figure 1.2. Cytokinin biosynthesis ........................ 7
Figure 1.3. Nitrate assimilation pathway ................. 18
Figure 1.4. Structural diagram of nitrate reductase ...... 18
Figure 2.1 Induction and additive effect of cytokinin

and nitrate on NR activity ......................... 40
Figure 2.2 Time course for cytokinin and nitrate

induction of NR activity ........................... 41
Figure 2.3. The effect of pre—incubation of embryos

on cytokinin-induced NR activity ................... 43
Figure 2.4. The effect of various cytokinins on

NR activity ........................................ 46
Figure 2.5. The effect of light on induction of

NR activity ........................................ 47
Figure 2.6. The effect of ammonia on

cytokinin- and nitrate-induced NR activity ......... 48
Figure 2.7. The effect of various ratios of nitrate to

ammonia on NR activity ............................. 50

Figure 2.8. The effect of ethylene on

cytokinin- and nitrate-induced NR activity ......... 51
Figure 2.9. Temperature-dependent NR activity in

imbibed seeds and incubated embryos ................ 52
Figure 3.1. The linear structure of NR ................... 67
Figure 3.2. The sequences of the hinge 1 region

of three A. githago NR clones ...................... 68

Figure 3.3. The structure and sequencing strategy
of three A. githago NR partial cDNA clones ......... 71

Figure 3.4. Nucleotide sequence comparison between
three A. githago NR partial cDNA clones ............ 73

Figure 3.5. Amino acid sequence alignment between
NRs from various higher plants ..................... 79

Figure 3.6. The 3’-untranslated regions of three

A. githago Agnr3 cDNA clones ....................... 86
Figure 3.7. The location and lengths of three

A. githago NR subclones ............................ 87
Figure 4.1. Cross-hybridization of Agnr1—1

and Agnr2—1 ....................................... 107
Figure 4.2. Schematic representation of RT-PCR .......... 108
Figure 4.3. Quantitative analysis of NR mRNA levels

by RT-PCR analysis ................................ 110
Figure 4.4. RT-PCR with varying amounts of total RNA....112

Figure 4.5. Time course of nitrate reductase activity...114

Figure 4.6. Northern blot analysis of Agnr1 and Agnr3
mRNAs in A. githago embryos ....................... 117

Figure 4.7. Quantitative analysis of Agnr1 mRNA
in A. githago embryos ............................. 118

Figure 4.8. Quantitative analysis of Agnr1 and Agnr3
mRNAs in roots and cotyledons of A. githago ....... 120

Figure 4.9. Quantitative analysis of Agnr2 mRNA
in A. githago ..................................... 123

Figure 4.10. Quantitative analysis of NR mRNAs
in A. githago embryos isolated from seeds
imbibed for various times ......................... 125

Figure 4.11. Transcriptional competence of
isolated nuclei ................................... 126

Figure 4.12. Nuclear runoff transcriptional analysis ..... 127
Figure 5.1. Restriction enzyme maps of the

13.5-kb insert of AAgnrl and the
11-kb insert of kAgan ............................. 143

xi

Figure 5.2. Schematic representation of the
A. githago NR cDNA clones, Agnr1, Agnr2,
and Agnr3 .......................................... 145

Figure 5.3. The 5’ and 3’ splice‘junction sequences
from introns in A. githago NR genes ................ 146

Figure 5.4. Southern blot analysis of A. githago
genomic DNA ....................................... 149

Figure 6.1. Summary of cytokinin and nitrate
regulation of NR activity and NR mRNA levels ....... 156

xii

CHAPTER 1

Introduction

Cytokinins are a class of phytohormones that regulate processes in plant
growth and development which are usually measurable only after days or
weeks. Since the first identification of the cytokinin kinetin in 1955 (Miller et
al., 1955), much of cytokinin biology has focussed on the characterization of
naturally occurring cytokinins and their metabolites and the response of plants
to applied cytokinins. The advances in biochemical analysis, molecular biology,
and genetics have brought further analysis and understanding of the role of
cytokinins in plant growth and development. However, there are still many
unanswered questions concerning the synthesis, metabolism, and activities of
cytokinins. The identification of genes whose expression is affected by
cytokinins will lead to answers about the mechanism of cytokinin action. This
work examines the regulation of nitrate reductase by cytokinins and nitrate in

Agrostemma githago embryos.

CYTOKININS

In the early 1950’s, Skoog and colleagues were studying the stimulation
of growth by auxin in cultured tobacco pith cells. In response to auxin, these
cells enlarged but did not divide. When segments of vascular tissue were

placed on the pith or in the medium next to the pith, cell division occurred in

2

the pith tissue. Cell division was also stimulated by adding coconut milk or
yeast extract to the medium. This work lead to the isolation and identification
of the cytokinin kinetin from autoclaved herring-sperm DNA (The cytokinin
resulted from a chemical rearrangement of the DNA during autoclaving; for a
review, see Skoog, 1994). The first naturally occurring cytokinin identified was
zeatin, isolated from corn endosperm independently by both Letham and Miller
in 1964.

Cytokinins are defined as substituted adenine compounds that promote
cell division in defined tissue systems (Skoog et al., 1965; Salisbury and Ross,
1992). The structures of some cytokinins are shown in Figure 1.1 . Matsubara
(1990) reviewed the activity of more than 200 natural and synthetic cytokinins
in bioassays. Cytokinin activity varied greatly depending on the side groups
present. In general, the N6 side chain primarily defined cytokinin activity. Side
chains at positions N9 and, to a lesser extent, N7 also influenced cytokinin
activity.

LOCALIZATION

Cytokinins are specifically found at the base adjacent to the 3' end of the
anticodon of tRNAs recognizing codons beginning with uridine in essentially all
organisms and are known to be synthesized during post-transcriptional
processing (Murai, 1994; Taller, 1994). This bound cytokinin is not believed
to contribute significantly to free cytokinins in plants responsible for hormonal
effects (Letham and Palni, 1983; McGaw, 1988; Binns, 1994). In prokaryotes,

the cytokinins in tRNAs have been found to influence aspects of translation.

Figure 1.1. Structures of cytokinins.

The structures of the first discovered cytokinin, kinetin, and the frst naturally
occurring cytokinin identified, trans-zeatin, are shown along with other cytokinins.
Benzyladenine is a synthetic cytokinin, as is kinetin. Glucosylation may also be
found at the N-3 and N-7 positions.

 

 

 

 

R 1 R 2 Tnvnal name
CH3 H isopentenyl adenine
/—< ribosyl isopentenyl adenosine
CH2 CH3 ribotide isopentenyl AMP
H trans-zeatin
0“on ribosyl t-zeatin riboside
CH Hm glucosyl t-zeatin-9-glucoside
2 3 ribotide t-zeatin ribotide
H dihydrozeatin
CH2°H ribosyl dihydrozeatin riboside
CH / (CH ribotide dihydrozeatin ribotide
2 3 glucosyl dihydrozeatin-9-g|ucoside
CHZO 9mm“ H dihydrozeatin O-glucoside
CH2] (CH3 ribosyl dihydrozeatin riboside O-glucoside
CH ' H benzyladenine
2 ribosyl benzyladenosine
CH2
I! u H kinetin
O

5

Experiments with mutants have shown that cytokinin nucleotides in tRNA are
not required for cell growth or protein synthesis, but appear to have a
regulatory role (Taller, 1994 and references within). Little is known about the
role of cytokinins in tRNAs in plants, but presumably their function is analogous
to that in prokaryotes.

Free cytokinins are found in plants and microorganisms that form
associations with plants and are present at <1-200 nmoles per 100 g fresh
weight (McGaw et al. , 1984). Cytokinins are probably found in all plant tissues
and cells. Cytokinins and their metabolites are differentially distributed between
species, plant organs, and developmental stages (for a review, see Jameson,
1994). While experimental evidence has supported a compartmentalization of
some cytokinins, only one study has directly shown that cytokinin-O-glucosides
are localized within the vacuole (Fusseder and Ziegler, 1988). The vacuole may
serve as a storage compartment for 0-glucosides and other cytokinins,
protecting them from degradation and irreversible inactivation.

BIOS YN THESIS

Indirect synthesis. Since some tRNAs contain cytokinins, biosynthesis
of free cytokinins could occur via the hydrolysis of the tRNA. However, there
is evidence that hydrolysis of cytokinins in tRNA does not contribute
significantly to the pool of free cytokinins. Most of the biologically active
naturally occurring cytokinins do not occur as constituents of tRNA (McGaw,
1988). In plant tissues, the free and tRNA-bound cytokinins are usually

structurally distinct, i.e., free zeatin occurs mainly as the trans isomer while

6

zeatin present in tRNA occurs mainly as the cis isomer. Cytokinin-requiring
plant tissue cultures contain cytokinins in their tRNAs but still require
exogenous cytokinins for growth (Chen and Hall, 1969). The rate of tRNA
turnover is not rapid enough to account for the levels of endogenous cytokinins
in most tissues (Letham and Palni, 1983).

The recent partial purification and characterization of a cis-trans zeatin
isomerase from bean endosperm (Bassil et al., 1993) suggests the possibility
that tRNA cytokinins could be precursors of biologically active free cytokinins,
but this has not been shown. However, tRNA hydrolysis may contribute to the
free cytokinin pool to some degree in specific tissues or developmental stages,
but the likely primary route for free cytokinin biosynthesis in plants is via the de
novo biosynthetic pathway (McGaw, 1988; Binns, 1994).

De novo synthesis. Except in Agrobacterium tumefaciens-induced crown
gall tumors, the biosynthetic pathway of cytokinins has not been unequivoCally
elucidated. The currently favored model shown in Figure 1.2 predicts the
formation of isopentenyl adenosine-5'-phosphate (isopentenyl AMP) from AMP
and A-2-isopentenyl pyrophosphate, catalyzed by isopentenyl transferase (lPT).
lsopentenyl AMP can be modified in a series of reactions to yield other
cytokinins, their ribotides, ribosides, and free bases.

Since cytokinins are present at low levels in plants, cytokinin biosynthetic
enzymes are also expected to be present at low levels. The low levels and
instability of IPT, as well as the susceptibility of the substrates and products to

phosphatases, has made purification of the enzyme difficult. IPT has been

CH3
NH, Hu—cn,’ :CH3
N/ N/ N
if \>
\ IPT \
N N + CH3 __’ N N + ®'®
®'°°"'2 o /_< ®-OCH2 o
®»®-ocr~r2 CH3
OH OH OH OH
5'-AMP iPePP iPeAMP

Figure 1.2. Cytokinin biosynthesis.

Cytokinins are synthesized de novo by transfer of an isopentenyl group from
A—2-isopentenyl pyrophosphate (iPePP) to 5'-AMP by isopentenyl transferase
(lPT). lsopentenyl AMP (iPeAMP) is the first cytokinin synthesized, and is then
converted to zeatin and other cytokinins.

8

partially purified from tobacco cell lines and slime mold (for a review, see Chen
and Ertl, 1994), suggesting the de novo synthetic pathway is also present in
higher plants. Unfortunately, the enzyme has not been purified in quantities
sufficient for antibody generation or microsequencing. Although a variety of
bacteria contain ipt or dot-like genes, plant DNA sequences homologous to the
bacterial ipt have not been reported. Comparisons of bacterial ipt genes reveal
conserved sequences that may lead to the isolation of a plant gene (Crespi et
al., 1992; Chen and Ertl, 1994).

Site of biosynthesis and translocation. While cytokinins have been found
in most plant tissues, the site of biosynthesis is difficult to determine with
certainty. The extremely low levels of endogenous cytokinins in plant tissues
and the central role of the putative adenine-derived precursors in cellular
metabolism have posed technical problems in identifying sites of cytokinin
biosynthesis. The primary site of cytokinin biosynthesis is likely the root tips,
but synthesis can also occur in the shoots (Letham, 1994). Germinating seeds
may also synthesize cytokinins. Cytokinins are translocated primarily from the
roots to the shoots through the xylem (Kende, 1965; Letham, 1994).
Ribosides, nucleotides, and O-glucosides appear to be important in root-to-shoot
translocation (Letham, 1994). Evidence also supports some movement of
cytokinins through the phloem. Cytokinins may also be translocated from the
embryonic axis to the cotyledons early in seed germination (for a review, see

Letham, 1 994).

CYTOKININ METABOLISM

An important way to regulate the availability of active cytokinins in plant
tissues is through metabolic interconversions. The first metabolic step is the
stereospecific hydroxylation of isopentenyl AMP to trans-zeatin derivatives.
Further cytokinin metabolism can be grouped into purine ring and side chain
modifications (Jameson, 1994). Changes in the purine ring include base-
riboside-nucleotide conversions, N3-, N7-, and N9-glucosylations, and N9-
alanylation. Changes in the NG-side chain include side chain reduction,
cleavage, and conjugation (including O-glucosylation, 0-xylosylation, and 0-
acetylation; for a review, see Jameson, 1994). The elucidation of the metabolic
pathways has been based largely on the use of radiolabelled cytokinins. The
cytokinin nucleotides are the prominent metabolites formed immediately after
cytokinin uptake. Ultimately, applied cytokinins are either broken down by side
chain cleavage to the corresponding adenine derivatives or are conjugated to
glucose, xylose, alanine, or acetate (Jameson, 1994).

Which molecules have biological activity, which are used for temporary
storage, and which are used to remove cytokinin from the active pool? Zeatin,
its riboside and nucleotide are all active in bioassays, but because of the
interconversions it is not known which molecules are active per se. The N-
glucosides are very stable and have low biological activity, apparently
withdrawing cytokinin from the active pool. The N9-alanylation may be a
storage form of the cytokinin. Reduced side chains (dihydro derivatives) are not

substrates of cytokinin oxidase, which cleaves side chains, and are, therefore,

10

more stable. Reduction of the side chain appears to precede conjugation of the
side chain with glucose, xylose, or acetate. Cytokinins with conjugated side
chains may be involved with transport and storage. Side chain cleavage leads
to irreversible loss of biological activity (for a review, see Jameson, 1994).
There are reports of crude activities for many of the cytokinin metabolic

enzymes (for reviews, see Armstrong, 1994; Mok and Martin, 1994), but few
have been purified sufficiently for antibody production or microsequencing. The
most advanced molecular analysis of a cytokinin metabolic enzyme is the
purification and characterization of zeatin O-xylosyl transferase from Phaseolus
vulgaris embryos (Turner et al., 1987). A monoclonal antibody has been used
to show that the transferase is found in both the cytoplasm and the nucleus
(Martin etal., 1993a) and to isolate a cDNA clone containing an insert proposed
to code for the transferase (Martin et al., 1993b). As more metabolic genes are
identified, transgenic methodologies could be used to alter cytokinin metabolism
and determine the role of metabolism in cytokinin activities.
CYTOKININ A CT! VI TIES

Since the discovery of cytokinins in the 1950’s, there have been many
studies to elucidate the effects of cytokinins on plant growth and development.
Most effects have been observed by application of cytokinins or analysis of
endogenous cytokinins. However, results observed with exogenous cytokinins
do not necessarily indicate the involvement of endogenous cytokinins. Many
studies of endogenous cytokinins have supported the involvement of cytokinins

in developmental processes, but the analyses were often flawed by inadequate

11

analytical techniques, reliance on bioassays, or determination of only a few
cytokinin metabolites (Mok, 1994). Still, much has been learned about
cytokinin effects on plant growth and development.

It is clear that plant development is determined by many internal and
external factors, and cytokinins are just one of these factors. Other hormones
may interact cooperatively, independently, or antagonistically with cytokinins.
Environmental stimuli such as light and temperature effect plant growth and
development. It is often difficult to undertstand the interaction between the
various signals. In summary, cytokinins play a role throughout development,
from seed germination to leaf senescence. Some of the effects include the
following: promotion of cell division; enhanced seed germination under non-
permissive conditions; bud formation in tissue culture at high cytokinin-to-auxin
ratios; release of lateral buds from apical dominance; stimulation of leaf
expansion; delay of leaf senescence; increase in chloroplast development; and
regulation of the cell cycle. More detailed reviews on cytokinin effects have
been written recently (Jacqmard et al., 1994; Mok, 1994; Musgrave, 1994;
Reski, 1994).

GENE RE GULA TION BY CYTOKININS

The diversity of cytokinin effects suggests that changes in gene
expression may mediate the response of plant cells to cytokinins. Studies have
shown that cytokinins affect steady-state mRNA levels, protein levels, and the
activity of numerous enzymes. Table 1 lists many of these enzymes, showing

regulation of various enzymes that might affect plant growth and development.

12

ANchitrate reductase; LHCP-light-harvesting chlorophyll a/b binding
protein; PEPCsphosphoenolpyruvate carboxylase; ca-carbonic anhydrase;
SSUssmall subunit of ribulose-l,S-bisphoephate; HPRshydroxypyruvate
reductase; COscytokinin oxidase; Asactivity of the enzyme.

1. Borriss 1967.

2. Kende et a1. 1971.

3. Xulaeva et a1. 1976.

4. Banisch ten Cate and Breteler 1982.
5. Knypl 1973.

6. Guadinovi 1990.

7. Rao et a1. 1984.

8. Suty et a1. 1993.

9. Roth-Bejerano and Lips 1970.
10. Banowetz 1992.

11. Gzik and Gunther 1984.

12. Lu et a1. 1990.

13. Flores and Tobin 1986.

14. Flores and Tobin 1988.

15. Teyssendier de la Serve at al. 1985.
16. Abdelghani et a1. 1991.

17. Longo et al. 1990.

18. Sugiharto et a1. 1992.

19. Suzuki et a1. 1994.

20. Thomas et a1. 1992.

21. Axelos et a1. 1987.

22. Lerbs et a1. 1984.

23. Chen and Leisner 1985.

24. Chen et a1. 1993.

25. Deikman and Hammer 1995.

26. Simmons et a1. 1992.

27. Mohnen et al. 1985.

28. Crowell 1994.

29. Sano and Youesefian 1994.
30. Dehio and de Bruijn 1992.
31. Teramoto et a1. 1995.

32. Cotton et a1. 1990.

33. Watillon et a1. 1991.

34. Crowell et a1. 1990.

35. Teramoto et a1. 1993.

36. Chen et a1. 1987.

37. Dominov et a1. 1992.

38. Chatfield and Armstrong 1986.

CThe treatment time that gave a significant difference in the results, or
the only time tested. A: <4 hours; 8: 4-24 hours; C: > 24 hours.

13

 

 

Table 1.1. Examples of enzymes regulated by cytokinins.
A B C

Plant Enzyme Regulation. Inst. Time
A. githago NR t NRA 1-3 A,B
Bean 1 NRA 4 B
Cucumber t NRA 5,6 3
Maize t NRA 7 A
Tobacco t NRA 8,9 C
Wheat f NRA 6,10 8,0
B. vulgaris t NRA 11 A
C. album 1 NRA 11 A
Barley T NRA, T mRNA 6,12 A,C
L. gibba LHCP 1 mRNA 13,14 3
Tobacco t mRNA 15,16 C
Watermelon t mRNA, 1 LHCP 17 C
Maize PBPC, CA 1 mRNA 18,19 A
H. crystallinum PEPC t mRNA 20 C
L. gibba 880 t mRNA 13 8
Tobacco 1 mRNA, 16,21
Pumpkin T 880, f SSUA 22 C
Pumpkin HPR t HPRA 23,24 8
A. thaliana 4 anthocyanin t mRNA 25 A

biosynthetic

genes
Rice Bl,3;1,4-glucanase 1 mRNA 26 C
Tobacco Bl,3-glucanase l mRNA 27 B
Soybean pollen allergen 1 mRNA 28 A
Wheat wa4 1 mRNA 29 A
S. rostrata Enodz 1 mRNA 30 A
Cucumber CR9, CRZO 4 mRNA 31 A

phytochrome 1 mRNA 32 A
Apple unknown t mRNA 33 C

10-kD P811 4 mRNA 33 C
Soybean 2O cDNAs t mRNAs 34 A

(2 ribosomal

proteins)
Cucumber unknowns ti transl. 35,36 A,B
Pumpkin unknowns mRNAs 23 C
N. plumbaginifolia pL8216 t mRNA 37 8
Bean cytokinin oxidase t COA 38 A

 

14

Most of these experiments have lead to the identification of genes whose
expression is enhanced by cytokinins. Other experiments have shown that
cytokinins also suppress gene expression (ref. 23, 31, 32, 35, 36 from Table
1).

Most cytokinin—responsive genes also respond to other signals, such as
light, stress, other plant hormones, sucrose, nutrient status, or other factors.
It is often difficult to separate the effects of independent stimuli, or to
understand how multiple stimuli interact. Many of the cytokinin-responsive
genes are regulated over longer periods of time (Table 1), and are, therefore,
not likely to represent the primary molecular responses to cytokinins but rather
the results of a series of signalling activities. Studies of rapid responses to
cytokinins are likely to lead to the identification of the early events in the
cytokinin signal transduction pathway.

The mechanism(s) by which cytokinins regulate plant gene expression
remains unclear but information is starting to accumulate. Inhibitors of
transcription or translation have been used to show the requirement of either
or both of these processes in enhancement of gene expression (Kende and
Shen, 1972; ref. 3, 12, 22, 23, 34, 38 from Table 1). Results of nuclear runoff
experiments have indicated both transcriptional (ref. 12, 19, 25, 37 from Table
1) and post-transcriptional (ref. 14, 19, 25, 30 from Table 1) regulation of
cytokinin-responsive genes.

A role for transcription in cytokinin regulation of specific plant genes has

been confirmed by the isolation and characterization of gene promoters that are

15

regulated by cytokinins. Studies have shown that the mannopine synthase
(mas) promoter (Langridge etal., 1989) and the gene-5 promoter (Boerjan et al.,
1992) from Agrobacterium tumefaciens plasmids are regulated by cytokinin and
auxin in transformed tobacco plants. Therefore, genes carried by prokaryotic
plasmids have acquired cis elements that function following transfer and
integration into plant cells. A promoter from Oryza sativa is induced by both
cytokinin and auxin in transformed tobacco plants, indicating that a
monocotyledonous promotor is active and recognized by the hormonal signal
transduction mechanism in a dicotyledonous plant (Claes et al., 1991 ).

Protein kinases and phosphatases are also involved in the regulation of
gene expression by cytokinins. Dominov et al. (1992) showed that the
enhancement of pL8216 mRNA levels by cytokinin is blocked by a protein
kinase inhibitor (staurosporine) and stimulated by a protein phosphatase
inhibitor (okadaic acid). In contrast, Crowell (1994) showed that the
enhancement of cimI mRNA levels is stimulated by staurosporine and blocked
by okadaic acid.

These observations indicate that different cytokinin signal transduction
pathways may regulate the expression of different plant genes. Future work
will likely reveal many of the molecular events that mediate the effects of
cytokinin on gene expression and, thus, on the growth and development of
plants. Similarities and differences to animal and other plant hormone signal

transduction systems will emerge as more information is obtained.

16
NITRATE REDUCTASE

Inorganic nitrogen in the biosphere must be converted to a biologically
useful form either by the fixation of N2 or the assimilation of nitrate. For plants
that do not establish Nz-fixing symbioses, the important nitrogen sources are
nitrate and ammonium. Because ammonium is readily oxidized to nitrate by soil
bacteria, nitrate is usually the main nitrogen source available to most higher
plants. Nitrate assimilation is estimated to produce in excess of 20,000
megatons of organic nitrogen per year compared with 200 megatons from
nitrogen fixation (Guerrero et al., 1981 ). Nitrate assimilation occurs in higher
plants, algae, fungi, and some bacteria. These organisms then supply reduced
nitrogen to other forms of life.

Agriculture has used nitrogen fertilizers to enhance crop yield. However,
there is wide concern over the use of these fertilizers. Fertilizer production uses
fossil fuel and is costly; the highly soluble nitrate can accumulate in surface and
ground waters, resulting in health concerns since in humans nitrate is reduced
by bacteria to toxic compounds; and nitrous oxides are generated via
denitrification in soils, leading to air pollution (Campbell and Kinghorn, 1990).
Enhancing the efficiency of nitrate assimilation has become one of the
objectives of research in plant nutrition. To achieve this, understanding the
mechanisms and regulation of nitrate uptake and assimilation is of great
importance.

There are at least two reasons why plants must regulate nitrate

reduction. First, the process is very energy consuming, with as much as 25%

17

of the energy generated by photosynthesis consumed in driving nitrate
assimilation (Solomonson and Barber, 1990). Second, nitrite, the primary
product of nitrate reduction, as well as ammonium, are cytotoxic.

The pathway of nitrate assimilation is shown in Figure 1.3. After uptake,
nitrate is reduced to nitrite by nitrate reductase (NR) in the cytoplasm, then
nitrite is transported into the chloroplast and reduced to ammonium by nitrite
reductase. Ammonium is incorporated into glutamine and other organic
compounds. The rate-limiting and regulated step is the reduction of nitrate to
nitrite by NR. This enzyme is considered to be a limiting factor for growth,
development, and protein production in plants (Solomonson and Barber, 1990).
FUNCTIONAL PROPERTIES

Because NR is a large and unstable enzyme of low abundance,
purification of higher plant NR has been difficult (for reviews, see Beevers and
Hageman, 1983; Campbell and Smarrelli, 1986; Crawford and Davis, 1988;
Solomonson and Barber, 1990). Even though Evans and Nason (1953)
discovered NR more than forty years ago, major advances in understanding the
enzyme came within the last decade with better purification procedures (Notton
et al., 1977; Campbell and Smarrelli, 1978) and the production of monoclonal
antibodies (Snapp et al., 1984; Notton et al., 1985; Hyde et al., 1989). The
first isolation of a partial cDNA clone encoding a NR in higher plants was from
squash (Crawford etal., 1986). Since then, more than eleven cDNAs encoding
NRs have been isolated (for a review, see Rouzé and Caboche, 1992). Many

higher plants have two NR genes, including Arabidopsis thaliana, which is often

18

NADH NAD+ 6Fdred 6R1...
NO' kJ» NOz' k)» NH:

3 2e“ 6e-

 

 

NR NiR

Figure 1.3. Nitrate assimilation pathway.

The assimilation of nitrate occurs via a two-step reduction. Nitrate reductase (NR)

catalyzes the reduction of nitrate to nitrite, and nitrite reductase (NiR) the reduction
of nitrite to ammonium.

 

 

 

 

 

 

 

 

 

N
\
N0;
_ >[ MoCo
NO 2
N0;
>[ MoCo
NO
f

 

Figure 1.4. Structural diagram of nitrate reductase.

A schematic diagram of the nitrate reductase homodimer with the functional

domains indicated. MoCo, molybdenum cofactor domain; Fe, heme domain; FAD,
flavin domain; N, N terminus of nitrate reductase.

19

used in molecular genetics because of its small genome size.

The sizes of the subunits of the homodimeric NR from ten higher plants
range from 100-120 kD (Campbell and Smarrelli, 1986; Solomonson and
Barber, 1990). NR is a multicenter redox enzyme where each subunit contains
specific binding domains for FAD, heme, and a molybdenum-pterin cofactor in
a 1:1:1 stoichiometry. Three forms of NR have been found in eukaryotes.
Most common in higher plants is a NADH-specific NR. A NAD(P)H-bispecific
NR may occur as a second isoform, or may occur as the only form. NADPH-
specific NR has not been found in higher plants, but is present in fungi and
mosses. A structural model for NR is shown in Figure 1.4. Electrons are
transferred sequentially from NADH through the prosthetic groups to nitrate,
reducing nitrate to nitrite.

RE GULA TION of NI?

NR activity is inducible by nitrate in all organisms and is one of only a
few substrate-inducible enzymes in plants. In general, there is little or no NR
mRNA or protein in the absence of nitrate. The addition of nitrate increases the
level of mRNA, protein, and enzyme activity to varying degrees, depending on
plant species, plant tissue, and plant age. While nitrate is the primary signal
that enhances NR expression, other factors also influence NR gene expression,
i.e., light, circadian rhythms, COZ, reduced nitrogen compounds, sucrose,
cytokinins, and a plastidic factor. NR has been shown to be regulated in
various ways by these factors, including transcriptionally, post-transcriptionally,

and post-translationally (for reviews, see Crawford, 1993; Hoff et al., 1994;

20

Rouzé and Caboche, 1992; Crawford et al., 1992). In plants with more than
one NR gene, differential regulation has been found.
LOCAL/2A TION of NR

NR from higher plants is generally believed to be localized in the cytosol,
although a minor fraction may be associated with membranes (Ward et al.,
1988). Little is known about the spatial localization of NR in plants. Some
studies examined tissue specificity by measuring NR protein, activity, or mRNA
in roots versus leaves or in the scutellum, roots, and leaves in corn (Redinbaugh
and Campbell, 1981; Sorger et al., 1986). The only studies in higher plants
examining cellular localization of NR are with corn. Using immunogold labelling,
NR in corn leaves was found to be localized exclusively in the cytoplasm of leaf
mesophyll cells (Vaughn and Campbell, 1988), in the cytoplasm of root
epidermal and cortical cells, and in the parenchyma and pericycle within the
vascular cylinder (Federova et al., 1994). NR was shown to be localized in
epidermal cells of corn roots by measuring NR protein content in epidermal,
cortical, and stelar cells (Rufty et al., 1986). No work has addressed the

localization of NR mRNA in plants.

A GROS TEMMA GI THA GO

Agrostemma githago was widely distributed in many temperate regions
throughout the world. It is believed to have originated in the eastern
Mediterranean area and was introduced into Britain around 500 BC. (Firbank,

1988; Svensson and Wigren, 1983). The plant was a prevalent weed and

21

found as a contaminant of cereal grains for at least 4000 years. Improved seed
cleaning techniques of this century have essentially eliminated the plant in
nature. Plants are now maintained in reserves and are becoming more popular
as garden plants.

A. githago, known by the common name corn cockle, is a tetraploid dicot
(n=24) in the family of the Caryophyllacea. Borriss was the first to study
physiological processes in A. githago, namely after-ripening and seed
germination (Borriss, 1967; Borriss, 1977). A. githago seeds are ripe about 33
days after fertilization (Svensson and Wigren, 1983), but are in a dormant stage
and cannot germinate. During an after-ripening period of several months to a
year at 15°C to 20°C (Borriss, 1977; Firbank, 1988), the germination rate
increases up to 100%. Dormancy can be preserved for several years by
maintaining the seeds at -15°C to -20°C (Borriss, 1977). The viability of the
seeds may be maintained for several years in dry storage (Borriss, 1977;
Firbank, 1988).

Borriss (1977) examined the effect of plant hormones on enzyme
activities during early germination of A. githago. Plant hormones applied to
isolated embryos regulated specific enzymes dependent on the development
stage of the seeds, i.e, dormant versus after-ripened. One enzyme examined
was NR (Borriss, 1967; Borriss, 1977). Applied auxin and gibberellin had no
effect on NR activity, while cytokinin increased and abscisic acid decreased NR
activity of dark grown embryos. Electrophoresis of in viva labelled proteins

identified differences in patterns of newly synthesized proteins between

22
imbibed, after-ripened young and aged embryos (Bernhardt et al., 1993).

Differences were also shown between cotyledons and axes. Based on Borriss'
results (1967), Kende and colleagues studied the regulation of NR by cytokinins
in A. githago. In particular, the question was asked whether cytokinins
affected NR directly or through the substrate nitrate, which also increases NR
activity. Kende et al. (1971) showed that cytokinin and nitrate enhanced NR
activity independently, and that this was a result of de novo protein synthesis
(Kende and Shen, 1972).

Changes in gene expression may mediate the various responses of plant
cells to cytokinins. Identification of genes regulated by cytokinins as well as
the mechanism of that regulation will further increase the knowledge of
cytokinin action in plants. The regulation of NR by cytokinins in A. githago was
chosen for further study for several reasons. The induction of NR activity in A.
githago embryos occurs in less than one hour (Kende et al., 1971), allowing
examination of an early response to cytokinins. This is the only plant where it
has been shown that induction by cytokinins is specific and not dependent on
exogenous or endogenous nitrate or the presence of light (Kende et al. , 1971 ).
While cytokinin regulation of unknown genes will surely prove useful, the
regulation of NR allows the study of a known enzyme for which much
biochemical, genetic, and more recently molecular biological information is

known.

23
OBJECTIVES

Cytokinins were initially identified and characterized because of their role
in cell division. Since then, cytokinins have been found to be involved with
various aspects of plant growth and development. However, little is known
about the primary mode of action of cytokinins. Regulation of gene expression
by cytokinins has been studied at the molecular level only in recent years, and
the mechanism(s) of regulation are just starting to be elucidated.

The goal of this project was to study the regulation of NR by cytokinins
and nitrate by addressing the following questions: How many NR genes are
there in A. githago? ls (are) the same genels) regulated by nitrate and by
cytokinin? Do cytokinin and nitrate regulate NR differentially? If there is more
than one gene, are the genes differentially regulated? Are the genes regulated
at the transcriptional or post-transcriptional levels? ls expression of the nitrate-
and cytokinin-regulated NR genels) localized in the same or in different cells of

the embryo?

24
REFERENCES

Abdelghani, M., Suty, L., Chen, J., Renaudin, J.-P., and Teyssendier de la
Serve, B. (1991). Cytokinins modulate the steady-state levels of light-depen-

dent and light-independent proteins and mRNAs in tobacco cell suspensions.
Plant Science 77, 29-40.

Armstrong, D. (1994). Cytokinin oxidase and the regulation of cytokinin
degradation. In Cytokinins: Chemistry, activity, and function. D. Mok and M.
Mok, eds. (Boca Raton: CRC Press), pp. 139-154.

Axelos, M., Teyssendier de la Serve, B., and Péaud-Lenoél, C. (1987). Level
of messenger RNA encoding small subuniit of ribulose biphosphate carboxylase
is enhanced by cytokinin in tobacco cell suspension cultures. Biochemie, 69,
671-676.

Banowetz, G. (1992). The effects of endogenous cytokinin content on
benzyladenine-enhanced nitrate reductase induction. Physiol. Plant. 86, 341-
348.

Bassil, N., Mok, D., and Mok, M. (1993). Partial purification of a cis-trans-

isomerase of zeatin from immature seed of Phaseo/us vulgaris L. Plant Physiol.
102, 867-872.

Beevers, L., and Hageman, R. (1983). Uptake and reduction of nitrate: bacteria
and higher plants. In Encyclopedia of Plant Physiology, vol. 15A. Inorganic plant
nutrition. A. Lauchi and R. Bieleski, eds. (New York:Springer Verlag), pp. 351-
375.

Bernhardt, D., Kopke, T., and Voigt, B. (1993). Differences in patterns of
newly synthesized proteins in imbibing embryos of after-ripened and aged seeds

of Agrostemma githago and comparison of protein synthesis in vivo and in
vitro. J. Exptl. Bot. 44(259), 415-418.

Binns, A. (1994). Cytokinin accumulation and action: Biochemical, genetic, and
molecular approaches. Annu. Rev. Plant Physiol. Plant Mol. Biol. 45, 173-196.

Boerjan, W., Genetello, C., Van Montagu, M., and lnze, D. (1992). A new
bioassay for auxins and cytokinins. Plant Physiol. 99, 1090-1098.

Borriss, H. (1967). Untersuchungen fiber die steurung der enzymaktivitat in
pflanzlichen embryonen durch cytokinine. Wiss. 2. Univ. Rostock Math.-
Naturwiss. Reihe 16, 629-639.

25

Borriss, H. (1977). Regulation of enzyme synthesis in seed germination. In
Regulations of Developmental Processes in Plants. H. R. Schlitte and D. Goss,
eds. (JenazFischer Verlag), pp. 98-110.

Campbell, W., and Kinghorn, J. (1990). Functional domains of assimilatory
nitrate reductases and nitrite reductases. TIBS 15, 315-319.

Campbell, W., and Smarrelli, J., Jr. (1986). Nitrate reductase: Biochemistry
and regulation. In: Biochemical basis of plant breeding, vol. 2. Nitrogen
Metabolism. C. Neyra, ed. (Boca RatonzCRC Press), pp. 1-39.

Campbell, W., and Smarrelli, J., Jr. (1978). Purification and kinetics of higher
plant NADH:nitrate reductase. Plant Physiol. 61, 611-616.

Chatfield, J., and Armstrong, D. (1986). Regulation of cytokinin oxidase
activity in callus tissues of Phaseolus vulgaris L. cv Great Northern. Plant
Physiol. 80, 493-499.

Chen, C.-M., and Hall, R. (1969). Biosynthesis of Ns-Az-(isopentenyl) adenosine
in the transfer ribonucleic acid of cultured tobacco pith tissue. Phytochemistry
8, 1687-1695.

Chen, C.-M., and Leisner, S. (1985). Cytokinin-modulated gene expression in
excised pumpkin cotyledons. Plant Physiol. 77, 99-103.

Chen, C.-M., Jin, 6., Andersen, B., and Ertl, J. (1993). Modulation of plant
gene expression by cytokinins. Aust. J. Plant Physiol. 20, 609-619.

Chen, C.-M., and Ertl, J. (1994). Cytokinins biosynthetic enzymes in plants
and slime mold. ln Cytokinins: Chemistry, activity, and function. D. Mok and
M. Mok, eds. (Boca Raton: CRC Press), pp. 81-85.

Chen, C.-M.. Ertl, J., Yang, M.-S., and Chang, C.-C. (1987). Cytokinin-induced
changes in the population of translatable mRNA in excised pumpkin cotyledons.
Plant Science 52, 169-174.

Claes, B., Smalle, J., Dekeyser, R., Van Montagu, M., and Caplan, A. (1991).
Organ-dependent regulation of a plant promoter isolated from rice by 'promoter-
trapping' in tobacco. Plant J. 1(1), 15-26.

Cotton, J., Ross. C., Byrne, D., and Colbert, J. (1990). Down-regulation of
phytochrome mRNA abundance by red light and benzyladenine in etiolated
cucumber cotyledons. Plant Mol. Biol. 14, 707-714.

26

Crawford, N., and Arst, H., Jr. (1993). The molecular genetics of nitrate
assimilation in fungi and plants. Annu. Rev. Genet. 27, 115-146.

Crawford, N., Campbell, W., and Davis, R. (1986). Nitrate reductase from
squash: cDNA cloning and nitrate regulation. Proc. Natl. Acad. Sci. USA 83,
8073-8076.

Crawford, N., and Davis, R. (1988). Plant nitrate reductase is a tripartite
electron transfer protein that belongs to the cytochrome b5 superfamily of
enzymes. Curr. Topics in Plant Bioch. and Physiol. 7, 16-25.

Crawford, M., Wilkinson, J., and LaBrie, S. (1992). Control of nitrate reduction
in plants. Aust. J. Plant Physiol. 19, 377-385.

Crespi, M., Messens, E., Caplan, A., van Montagu, M., and Desomer, J.
(1992). Fasciation induction by the phytopathogen Rhodococcus fascians
depends upon a linear plasmid encoding a cytokinin synthase gene. EMBO J.
11(3), 795—804.

Crowell, D. (1994). Cytokinin regulation of a soybean pollen allergen gene.
Plant Mol. Biol. 25, 829-835.

Crowell, D., Kadlecek, A., John, M., and Amasino, R. (1990). Cytokinin-
induced mRNAs in cultured soybean cells. Proc. Natl. Acad. Sci. USA 87,
8815-8819.

Dehio, C., and de Bruijn, F. (1992). The early nodulin gene SrEnodZ from
Sesbania rostrata is inducible by cytokinin. Plant Journal 2(1), 1 17-128.

Deikman, J., and Hammer, P. (1995). Induction of anthocyanin accumulation
by cytokinins in Arabidopsis thaliana. Plant Physiol. 108, 47-57.

Dominov, J., Stenzler, L., Lee, 8., Schwarz, J., Leisner, S., and Howell, S.
(1992). Cytokinins and auxins control the expression of a gene in Nicotiana
plumbaginifo/ia cells by feedback regulation. Plant Cell 4, 451-461.

Evans, H., and Nason. A. (1953). Pyridine nucleotide-nitrate reductase from
extracts of higher plants. Plant Physiol. 28, 233-254.

Federova, E., Greenwood, J., and Oaks, A. (1994). ln-situ localization of
nitrate reductase in maize roots. Planta 194, 279-286.

Firbank, L. (1988). Biological flora of the British Isles. J. Ecology 76, 1232-
1246.

27

Flores, S., and Tobin, E. (1988). Cytokinin modulation of LHCP mRNA levels:
The involvement of post-transcriptional regulation. Plant Mol. Biol. 11, 409-
415.

Flores, S., and Tobin, E. (1986). Benzyladenine modulation of the expression
of two genes for nuclear-encoded chloroplast proteins in Lemna gibba: Apparent
post-transcriptional regulation. Planta 168, 340-349.

Fusseder, A., and Ziegler, P. (1988). Metabolism and compartmentalization of
dihydrozeatin exogenously supplied to photoautotrophic suspension cultures of
Chenopodium rubrum. Planta 173, 104-109.

Gaudinova, A. (1990). The effect of cytokinins on nitrate reductase activity.
Biologia Plantarum 32(2), 89-96.

Guerrero, M., Vega, J., and Losada, M. (1981). The assimilatory nitrate-
reducing system and its regulation. Ann. Rev. Plant Physiol. 32, 169-204.

Gzik, A., and Giinther, G. (1984). Influence of cytokinins on the nitrate
reductase activity in leaves of Beta vulgaris (sugar beet) and Chenopodium
album (goosefoot). Biochem. Physiol. Pflanzen. 179, 295-301.

H'a'nisch ten Cate, C., and Breteler, H. (1982). Effect of plant growth regulators
on nitrate utilization by roots of nitrogen-depleted dwarf bean. J. Exp. Bot.
33(132). 37-46.

Hoff, T., Truong, H.-N., and Caboche, M. (1994). The use of mutants and
transgenic plants to study nitrate assimilation. Plant, Cell, and Environ. 17,
489-506.

Hyde, G., Wilberding, J., Meyer, A., Campbell, 5., and Campbell, W. (1989).
Monoclonal antibody-based immunoaffinity chromatography for purifying corn
and squash NADH: nitrate reductases. Evidence for an interchain disulfide bond
in nitrate reductase. Plant Mol. Biol. 13, 233-246.

Jacqmard, A., Housse, C., and Bernier, G. (1994). Regulation of the cell cycle
by cytokinins. ln Cytokinins: Chemistry, activity, and function. D. Mok and M.
Mok, eds. (Boca Raton: CRC Press), pp. 197-215.

Jameson, P. (1994). Cytokinin metabolism and compartmentation. ln
Cytokinins: Chemistry, activity, and function. D. Mok and M. Mok, eds. (Boca
Raton: CRC Press), pp. 113-128.

Kende, H. (1965). Kinetinlike factors in the root exudate of sunflowers. Proc.
Natl. Acad. Sci. USA 53(6), 1302-1307.

28

Kende, H., Hahn, H., and Keys, 8. (1971). Enhancement of nitrate reductase
activity by benzyladenine in Agrostemma githago. Plant Physiol. 48, 702-706.

Kende, H., and Shen, T. (1972). Nitrate reductase in Agrostemma githago.
Comparison of the inductive effects of nitrate and cytokinin. Biochim. Biophy.
Acta 286, 118-125.

Knypl, J. (1973). Synergistic induction of nitrate reductase activity by nitrate
and benzylaminopurine in detached cucumber cotyledons. Z. Pflanzenphysiol.
70, 1-11.

Kulaeva, O., Kuznetsov, V. V., and Kuznetsov, V. V. (1976). Cytokinin

induction of nitrate reductase activity in isolated embryos of Agrostemma
githago. Soviet Pl. Physiol. 23, 1061-1068.

Langridge, W., Fitzgerald, K., Koncz, C., Schell, J., and Szalay, A. (1989).
Dual promoter of Agrobacterium tumefaciens mannopine synthase genes is
regulated by plant growth hormones. Proc. Natl. Acad. Sci. USA 86, 3219-
3223.

Lerbs, S., Lerbs, W., Klyachko, N., Romanko, E., Kulaeva, 0., Wollgiehn, R.,
and Parthier, B. (1984). Gene expression in cytokinin- and light-mediated
plastogenesis of Cucurbita cotyledons: Ribulose-l ,5-bisphosphate
carboxylase/oxygenase. Planta 162, 289-298.

Letham, D. (1994). Cytokinins as phytohormones-sites of biosynthesis,
translocation, and function of translocated cytokinin. In Cytokinins: Chemistry,
activity, and function. D. Mok and M. Mok, eds. (Boca Raton: CRC Press), pp.
57—80.

Letham, D., and Palni, L. (1983). The biosynthesis and metabolism of
cytokinins. Ann. Rev. Plant Physiol. 34, 163-197.

Longo, G., Bracale, M., Rossi, 6., and Longo, C. (1990). Benzyladenine
induces the appearance of LHCP-mRNA and of the relevant protein in dark-
grown excised watermelon cotyledons. Plant Mol. Biol. 14, 569-573.

Lu, J.-L., Ertl, J., and Chen, C.-M. (1990). Cytokinin enhancement of the light
induction of nitrate reductase transcript levels in etiolated barley leaves. Plant
Mol. Biol. 14, 585-594.

Martin, R., Mok, M., and Mok, D. (1993a). Cytolocalization of zeatin O-xylosyl-
transferase in Phaseoulus. Proc. Natl. Acad. Sci. USA 90, 953-957.

29

Martin, R., Mok, M., and Mok, D. (1993b). Localization and cloning of a
cytokinin metabolic enzyme, zeatin O-xylosyl-transferase. Plant Physiol. 102,
24 (suppl.).

Matsubara, S. (1990). Structure-activity relationships of cytokinins. Critical
Rev. in Plant Sciences 9(1), pp. 17-57.

McGaw, B. (1988). Cytokinin synthesis and metabolism. In: Plant hormones
and their role in plant growth and deevelopment. P. Davies, ed.
(Dordrecht:Kluwer Academic Publishers). Pp. 76-93.

McGaw, B., Scott, |., Horgan, R. (1984). Cytokinin biosynthesis and
metabolism. In: The biosynthesis and metabolism of plant hormones. A. Crozier
and J. Hillman, eds. (Cambridge:Cambridge University Press), pp. 105-133.

Miller, C., Skoog. F., von Saltza. M., and Strong, F. (1955). Kinetin, a cell
division factor from deoxyribonucleic acid. J. Am. Chem. Soc. 77, 1392-1393.

Mohnen, D., Shinshi, H., Felix, G., and Meins, F., Jr. (1985). Hormonal
regulation offil ,3-glucanase messenger RNA levels in cultured tobacco tissues.
EMBO J. 4(7). 1631-1635.

Mok, M. (1994). Cytokinins and plant development-An overview. In Cytokinins:
Chemistry, activity, and function. D. Mok and M. Mok, eds. (Boca Raton: CRC
Press), pp. 155-166.

Mok, D., and Martin, R. (1994). Cytokinin metabolic enzymes. In Cytokinins:
Chemistry, activity, and function. D. Mok and M. Mok, eds. (Boca Raton: CRC
Press). pp. 129-137.

Murai, N. (1994). Cytokinin biosynthesis in tRNA and cytokinin incorporation
into plant RNA. In Cytokinins: Chemistry, activity, and function. D. Mok and
M. Mok, eds. (Boca Raton: CRC Press). pp. 87-100.

Musgrave, M. (1994). Cytokinins and oxidative processes. In Cytokinins:
Chemistry, activity, and function. D. Mok and M. Mok, eds. (Boca Raton: CRC
Press). pp. 167-178.

Notton, B., Fido, R., and Galfre, G. (1985). Monoclonal antibodies to a higher-
plant nitrate reductase: differential inhibition of enzyme activities. Planta 165,
1 14-1 1 9.

Notton, B., Fido, R., and Hewitt, E. (1977). The presence of functional haem
in a higher plant nitrate reductase. Plant Sci. Lett. 8, 165-170.

3O

Rao, L. V. M., Datta, M., Mahadevan, M., Guha-Mukherjee, S., and Sopory, S.
K. (1984). Influence of cytokinins and phytochrome on nitrate reductase
activity in etiolated leaves of maize. Phytochemistry 23(9), 1875-1879.

Redinbaugh, M., and Campbell, W. (1981). Purification and characterization of
NAD(P)Hznitrate reductase and NADH:nitrate reductase from corn roots. Plant
Physiol. 68, 115-120.

Reski, R. (1994). Plastid genes and chloroplast biogenesis. In Cytokinins:
Chemistry, activity, and function. D. Mok and M. Mok, eds. (Boca Raton: CRC
Press). pp. 179-195.

Roth-Bejerano, N., and Lips, S. (1970). Hormonal regulation of nitrate
reductase activity in leaves. New Phytol. 69, 165-169.

Rouzé, F., and Caboche, M. (1992). Nitrate reduction in higher plants:
Molecular approaches to function and regulation. In Inducible Plant Proteins.
J. Wray, ed. (Cambridge: Cambridge University), pp. 45-77.

Rufty, T., Jr., Thomas, J., Remmler, J., Campbell, W., and Walk, R. (1986).
lntercellular localization of nitrate reductase in roots. Plant Physiol. 82, 675-
580.

Salisbury, F. and Ross, C. (1992). Hormones and growth regulators:
cytokinins, ethylene, abscisic acid, and other compounds. In Plant Physiology.
(Belmont:Wadsworth Publishing), pp. 382-393.

Sano, H., and Youssefian, S. (1994). Light and nutritional regulation of
transcripts encoding a wheat protein kinase homolog is mediated by cytokinins.
Proc. Natl. Acad. Sci. USA 91, 2582-2586.

Simmons, C., Litts, J., Huang, N., and Rodriguez, R. (1992). Structure of a rice
fi-glucanase gene regulated by ethylene, cytokinin, wounding, salicylic acid and
fungal elicitors. Plant Mol. Biol. 18, 33-45.

Skoog, F., Strong. F., and Miller, C. (1965). Cytokinins. Science 148, 532-
533.

Skoog, F. (1994). A personal history of cytokinin and plant hormone research.
In Cytokinins: Chemistry, activity, and function. D. Mok and M. Mok, eds.
(Boca Raton: CRC Press), pp. 1-14.

Snapp, S., Somers, D., Warner, R., and Kleinhofs, A. (1984). Immunological
comparisons of higher plant nitrate reductases. Plant Science Lett. 36, 13-18.

31

Solomonson, L., and Barber, M. (1990). Assimilatory nitrate reductase:
Functional properties and regulation. Annu. Rev. Plant Physiol. Plant Mol. Biol.
41, 225-253.

Sorger, G., Gooden, D., Earle, E., and McKinnon, J. (1986). NADH nitrate
reductase and NAD(P)H nitrate reductase in genetic variants and regenerating
callus of maize. Plant Physiol. 82, 473-478.

Sugiharto, B., Burnell, J., and Sugiyama, T. (1992). Cytokinin is required to
induce the nitrogen-dependent accumulation of mRNAs for phos-
phoeno/pyruvate carboxylase and carbonic anhydrase in detached maize leaves.
Plant Physiol. 100, 153-156.

Suty, L., Moureaux. T., Leydecker, M.-T., and Teyssendier de la Serve, B.
(1993). Cytokinin affects nitrate reductase expression through the modulation
of polyadenylation of the nitrate reductase mRNA transcript. Plant Science 90,
1 1-19.

Suzuki, 1., Crétin, T. O., Omata, T., and Sugiyama, T. (1994). Transcriptional
and posttranscriptional regulation of nitrogen-responding expression of

phosphoenolpyruvate carboxylase gene in maize. Plant Physiol. 105, 1223-
1229.

Svensson, R., and Wigren, M. (1983). Kléittens historia och biologi i Sverige.
Svensk Bot. Tidskr. 77, 165-190.

Taller, B. (1994). Distribution, biosynthesis, and function of cytokinins in tRNA.
In Cytokinins: Chemistry, activity, and function. D. Mok and M. Mok, eds.
(Boca Raton: CRC Press), pp. 101-112.

Teramoto, H., Toyama, T., Takeba, G., and Tsuji, H. (1995). Changes in
expression of two cytokinin-repressed genes, CR9 and CRZO, in relation to
aging, greening and wounding in cucumber. Planta 196, 387-395.

Teramoto, H., Momotani, E., and Tsuji, H. (1993). Benzyladenine-induced
changes in the translatable mRNA population in excised cucumber cotyledons.
Physiol. Plant. 87, 584-591.

Teyssendier de la Serve, B., Axelos, M., and Péaud-Lenoél, C. (1985).
Cytokinins modulate the expression of genes encoding the protein of the light-
harvesting chlorophyll a/b complex. Plant Mol. Biol. 5, 155-163.

Thomas, J., McEIwain, E., and Bohnert, H. (1992). Convergent induction of
osmotic stress-responses. Plant Physiol. 100, 416-423.

32

Turner, J., Mok, D., Mok, M., and Shaw, G. (1987). Isolation and partial
purification of an enzyme catalyzing the formation of O-xylosylzeatin in
Phaseolus vulgaris embryos. Proc. Natl. Acad. Sci. USA 84, 3714-3717.

Vaughn, K., and Campbell, W. (1988). lmmunogold localization of nitrate
reductase in maize leaves. Plant Physiol. 88, 1354-1357.

Ward, M., Tischner, R., and Huffaker, R. (1988). Inhibition of nitrate transport
by anti-nitrate reductase lgG fragments and the identification of plasma
membrane associated nitrate reductase in roots of barley seedlings. Plant
Physiol. 88, 1141-1145.

Watillon, B., Kettmann, R., Boxus, P., and Burny, A. (1991). Characterization
of two gene transcripts modulated by cytokinins in micropropagated apple
(Ma/us domestica [L.] Borkh) plantlets. Plant Physiol 96, 479-484.

CHAPTER 2

The Biochemical Analysis of Nitrate Reductase
in A grostemma githago Embryos

ABSTRACT

Nitrate reductase (NR) activity was induced independently by cytokinins
and nitrate in A. githago embryos, and the inductions were additive at 6 h of
treatment. Nitrate-induced activity increased faster and decreased faster than
did cytokinin-induced activity. Nitrate-induced activity peaked at 6 to 12 h,
cytokinin-induced activity peaked at 12 to 18 h, and both nitrate and cytokinins
enhanced enzyme activity 4 to 6 times over that of water-treated embryos.
Cytokinin-induced activity had a lag phase that was dependent on the state of
the embryos and was localized primarily in the cotyledons, while nitrate-induced
activity showed no lag phase and was localized in both roots and cotyledons.
The transient increase in activity in the controls was localized in the roots. The
decrease in nitrate-induced activity after 12 h was primarily due to loss of
activity in the cotyledons. The induction by cytokinin was specific; several
cytokinins increased NR activity while adenine did not.

Ambient room light did not affect the induction of NR activity at 6 h.
Ammonia had no effect on NR activity, either by itself or in combination with
nitrate or cytokinin. Ethylene increased NR activity ~ 50% above the control,

but had no effect on nitrate-induced activity. Contrary to published results,

33

34

ethylene inhibited cytokinin-induced NR activity after 6 h of incubation. NR
activity varied during the course of imbibition of the seeds. This activity was
temperature dependent, as was the increase in activity in isolated embryos

incubated in water.

35
INTRODUCTION

Nitrate reductase (NR) has been studied in a large number of plants for
many years. All plants have nitrate-inducible NR activity, and nitrate is the
primary regulator of NR. In most plants, NR is also regulated secondarily by
factors such as light, circadian rhythms, C02, reduced nitrogen compounds,
sucrose, cytokinins, and a plastidic factor (for reviews, see Crawford et al.,
1992; Hoff et al., 1992; Rouzé and Caboche, 1992; Crawford et al., 1993,
Hoff et al., 1994; Crawford, 1995).

Cytokinins regulate NR activity in several plants (see Table 1.1).
However, other factors are usually required for induction of enzyme activity,
9.9. light and/or nitrate, and cytokinins enhance the response to these factors.
Some nitrate is stored in plant vacuoles (Granstedt and Huffaker, 1982), and
regulators may increase activity by releasing the nitrate into the metabolic pool
where it induces NR activity. Gzik and Giinther (1984) showed that cytokinins
increased NR activity in the dark in the absence of exogenous nitrate in Beta
vulgaris and Chenopodium album leaf discs. Although cytokinin inducible in the
dark, these activities were very low in comparison to those in light. Only in A.
githago embryos has it been shown that cytokinins induce NR activity
independently of the presence of light or exogenous or endogenous nitrate
(Kende et al., 1971). Thus, the study of cytokinin regulation of NR in A.
githago embryos allows the study of a specific cytokinin response without other
interacting factors such as nitrate and light. It has been shown that the effects

of cytokinin and nitrate on the induction of NR activity are additive and require

36
de nova synthesis of the enzyme (Kende et al., 1971; Kende et al., 1974;
Kuznetsov et al., 1979). Schmerder and Borriss (1986) also demonstrated that
ethylene increased NR activity in A. githago embryos, and that cytokinin
regulation only occurred in the presence of ethylene. The purpose of this work
was to examine the regulation of NR in A. githago embryos in comparison to
previous results in A. githago and other plants, and to determine optimum
conditions for further molecular biological studies. Because of variations in

seed lots, the inductive effects of cytokinin and nitrate needed to be

reexamined.

37
MATERIALS AND METHODS

Plant material. Seeds of A. githago were collected from plants grown in
the greenhouse and size fractionated to select for larger seeds. After harvest,
the seeds were kept in dry storage to break dormancy. Dr. K.H. Kr'ihler
(Greifswald University, Germany) also provided multiple seed lots used in these
experiments.

Incubation procedures. A. githago seeds were surface sterilized in 1%
NaOCl, rinsed five times in sterile water, and then placed in sterile Petri plates
on two layers of Whatman filter paper moistened with 5 ml sterile water. The
length of imbibition varied as indicated in the figures. Unless specified
otherwise, seeds were imbibed at room temperature (RT) in the dark. Embryos
were then isolated in ambient room light (except for the experiments in Figure
2.5 where embryos were isolated under a green safelight) and placed in new
sterile Petri plates on two layers of Whatman filter paper moistened with 5 ml
of the test solution. Embryos were incubated in the dark at 30°C unless
otherwise indicated. For experiments using ethylene, the Petri plates were
placed without lids in a closed glass container, and ethylene was injected into
the container when appropriate. At the end of the indicated treatments,
embryos were dried off, weighed when necessary, frozen in liquid nitrogen and
stored at -80°C until they were assayed. In the experiment shown in Table
2.1 , embryos were first divided into roots and cotyledons.

Tissue extraction and NADH-NR assay. Tissue was homogenized on ice

with 0.6 ml of extraction buffer (25 mM KPO4, pH 7.5, 5 mM EDTA, 5 mM

38

cysteine), then spun in a microcentrifuge for 10 to 15 min at 14,000 rpm. The
supernatant was used for assaying. NR activity was assayed in vitra according
to Wray and Filner (1970). This assay measures spectrophotometrically‘the
production of nitrite by NR. Typically, four embryos or eight roots or cotyledon
pairs were homogenized per sample, and 100 pl of supernatant was assayed

in duplicate. Each experiment was done with at least triplicate samples.

 

I:

)1

39

RESULTS

Inducibility af NR by cytokinins and nitrate. Both benzyladenine (BA) and
nitrate showed dosage-dependent responses on the increase in NR activity (data
not shown). Therefore, experiments were done with optimum concentrations
of 1-5 pM BA or 50 mM nitrate. Figure 2.1 shows that there was a background
level of NR activity in embryos incubated in water. Both BA and nitrate
increased the enzyme activity, and, at 6 h, gave an additive effect (Figure 2.1).
This additive effect was observed over an entire 24 h incubation period but not
in all experiments. Kuznetsov et al. (1979) observed an additive effect up to
‘18 h of incubation (peak activities were 18 h for nitrate and 24 h for BA), but
the enzyme activities for BA plus nitrate were not as large experimentally as
would be expected from BA and nitrate treatments alone after 18 h of
treatment. Kuznetsov suggested that this was due to carbohydrate starvation
of the embryos since the addition of glucose could increase NR activity at this
time. Therefore, depending on the state of the seeds and the embryos,
cytokinin and nitrate increased NR activity and showed an additive effect.

Many NR activities are reported on a fresh-weight basis and vary greatly
between 75 nmol/h-g FW in cucumber cotyledons (Guadinova, 1990) to 40,000
nmol/h-g FW in rice seedlings (Kleinhof et al., 1988). Maximum inductions
observed in A. githago fall in this range at 5000 nmol/h-g FW (data not shown).

Figure 2.2 shows a representative time-course experiment. Although the
absolute activities varied between experiments, certain results were consistent.

NR activity typically increased transiently in embryos incubated in water.

 

 

 

 

80
'o
g 60-
£22»
2':
4—0
2? 40-
(re
2'01
0
Z
a 20-
E
5 l i

 

 

 

 

 

Control BA Nitrate Nitrate

BA
Embryo Treatment

Figure 2.1. Induction and additive effect of cytokinin and nitrate on NR
activity.

Seeds were imbibed for 12 h at RT. The embryos were then isolated and
incubated at 30°C for 6 h in water (control), 5 pM BA, 50 mM nitrate, or nitrate plus
BA. Each point represents the average of triplicate samples, 4 embryos per
sample. The darkened bars represent NR activity with the water control
subtracted.

41

 

 

 

 

 

 

 

 

 

 

120
—-— Control
.7" —e— BA
3. 100 + Nitrate
.0
a? 5 80 5
=6 "'=
<2: 3 60
'0‘“ 40
Z
T:
E 20 \
0 l l
18 24
Embryo Treatment (h)

Figure 2.2. Time course for cytokinin and nitrate induction of NR activity.

Seeds were imbibed for 12 h at RT. The embryos were then isolated and
incubated at 30°C for the indicated times in water (control), 5 uM BA, or 50 mM
nitrate. Each point represents the average of triplicate samples, 4 embryos per
sample.

42

Nitrate-induced activity always increased faster than did BA-induced activity,
but BA-induced activity remained elevated longer than nitrate-induced activity.
Nitrate-induced activity peaked at 6 to 12 h and BA-induced activity peaked at
12 to 18 h. The activity in water-incubated embryos varied significantly with
various seed lots, age of seeds, and time of imbibition (personal observations
and Figure 2.9). Overall, both BA and nitrate increased NR activity 4 to 6 times
over control.

Closer examination of the early time points showed a lag phase for BA-
induced activity that was not observed for nitrate-induced activity (Figure 2.3).
The time when a significant increase in BA-induced NR activity could be
detected varied with seed lot, age of seeds, and individual experiments from 4-
12 h. This lag phase could be due to time for cytokinin uptake or to the state
of the embryos. Pre-incubation of the embryos for 4 h in water followed by a
2-h incubation in IA showed no lag phase in the enhancement of NR activity
(Figure 2.3). This means that the presence of the lag phase was not due to
time required for BA uptake, but rather due to the state of the embryos.

Localization of NR activity. Table 2.1 shows the localization of NR
activity. CK-induced activity was found primarily in the cotyledons, while
nitrate-induced activity was found throughout the embryo. The transient
increase in NR activity in water-incubated embryos was found in the roots. The
decrease in nitrate-induced activity in the embryos after 12 h (Figure 2.2) was
primarily due to loss of activity in the cotyledons, although there was some loss

in the roots also (Table 2.1).

 

 

70
3a
A 60 -
'o
E E 50 - 3b 2a °
> E
z: w 9
g ‘7; 4o -
°‘ 9”
z 5 “‘ 3° " 2b
E ,o
I: a
V 20 7 1a
10 - /"/
0 l l l l l l

 

0 2 4 6 8 10 12

Embryo Treatment (h)

Figure 2.3. The effect of pre-incubation of embryos on cytokinin-induced NR
activity.

Seeds were imbibed for 12 h at RT. The embryos were then isolated and
incubated at 30°C for the indicated times in water (1a), 5 uM BA (2a), or 50 mM
nitrate (3a). Seeds were imbibed for 12 h at RT. The embryos were isolated and
incubated at 30°C for 4 h in water, and the embryos were then transferred to BA
(2b) or nitrate (SD) for 2 h. The results represent the average of triplicate samples,
4 embryos per sample.

 

44

 

Table 2.1. The localization of cytokinin- and nitrate-induced NR activity in embryos,
roots, and cotyledon pairs.

Seeds were inbibed for 12 h at RT, then the embryos were isolated and incubated at
30 °C for 6 or 12 h in water (control), 5 pM BA, or 50 mM nitrate. At the end of the
'ncubation period, some embryos were separated into roots and cotyledon pairs
(GP) for measurement of NR activity. Results are 1 SEM (n=10-12 for 6 h; n=6-9 for
12 h). Values represent NR activity, nmoles nitrite/ho embryo, root, or cotyledon pair
(CP).

 

 

 

6 hours
Embryo Root CP
Control 16.0 1 1.4 7.0 1 0.7 11.8 1 1.1
BA 30.3 1 4.7 5.9 1 0.6 23.1 1 3.3
Nitrate 64.7 1 6.4 27.0 1 2.3 42.0 1 4.3
12 hours
Embryo Root CP
Control 24.2 1 3.5 13.9 1 1.6 9.5 1 1.5
BA 64.4 1 11.8 15.2 1 1.7 41.8 1 5.3
Nitrate 54.5 1 7.9 22.0 1 3.2 22.7 1 2.7

 

45

Specificity of cytokinin-induced NR activity. If NR activity is regulated
by cytokinins, the response should be specific. Six cytokinins (BA, BA riboside,
zeatin, IPA (Figure 2.4), kinetin, and zeatin riboside (data not shown) increased
NR activity to varying degrees. Adenine was ineffective (Figure 2.4). Abscisic
acid has been shown to be antagonistic to both cytokinin- and nitrate-induced
activities in A. githago embryos (Kende et al., 1971; Kuznetsov et al., 1979)
and barley seedlings (Lu et al., 1992). Abscisic acid (1 pM) inhibited NR
activity by ~37% below the control level (data not shown).

Regula tian af NR activity.

_L_'gm. Light regulates NR at various levels in many plants. While seeds
have been imbibed and embryos incubated in the dark in previous experiments
(Kende et al., 1971; Kuznetsov, 1979), embryos have usually been isolated in
the light. The effect of ambient room light on NR activity was tested. Seeds
were imbibed, isolated, and incubated in the light or in the dark. Figure 2.5
shows that light had no effect on background or induced NR activity. Since
these experiments were done at different times and under different conditions,
the absolute activities cannot be compared between experiments, but within
each experiment no effect by light was observed. Thus, in all other
experiments, imbibition and incubation were carried out in the dark, but
embryos were isolated as quickly as possible in the light.

Ammonia. Ammonia, the product of nitrite reduction, has varying effects
on NR activity. In A. githago embryos, ammonia has no effect on background

or cytokinin- or nitrate-induced NR activity (Figure 2.6). The ratio of nitrate to

 

40

N (a)
O 0

NR ActIVIty
(nmol N02; formed h‘1 embryo'1)
8

 

 

 

Control Ade BA BAR Z i PA

Embryo Treatment

Figure 2.4. The effect of various cytokinins on NR activity.

Seeds were imbibed for 12 h at RT. The embryos were then isolated and incubated
at 30°C for 12 h in water (control), 5 uM Ade, or 5 uM of the indicated cytokinins.
The results represent the average of triplicate samples, 4 embryos per sample.
Ade=adenine; BA=benzyIadenine; BAR=benzyladenosine; Z=zeatin; IPA=N° -(
-isopentenyladenine).

A A100
'0
5..
3.5
2.3.3: 60
(B
m§4o
2,0"

520

O

E

C

V o

B :50

§
40

3.5
as...

0

<3
0:320

Z,ON
510

O

E

C
V o

47

 

 

 

[El Light

I Dark

 

 

 

 

   

 

 

Control Nitrate + BA
Embryo Treatment

 

 

 

 

 

 

 

 

 

 

BA Nitrate
Embryo Treatment

Figure 2.5. The effect of light on induction of NR activity.

Seeds were imbibed for 7 h (A) or 16 h (B) at RT. The embryos were then isolated
and incubated at 30°C for 6 h in water (control), 1 uM BA, 50 mM nitrate or BA plus
nitrate. Embryos were imbibed, excised, and incubated in room light or in the dark.
The embryos for the dark treatment were isolated under green safelights. Bars
indicate 1 SEM (A:n=9; an= 5 to 7).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

80 —
A [:l -ammonia
7%. I + ammonia
3:5: 60 —
LEE
T5
< E 40 -
m 2
Z '0“
z
T:
E
5
Control BA Nitrate Nitrate
+
Embryo Treatment BA

Figure 2.6. The effect of ammonia on cytokin'n- and nitrate-induced NR activity.

Seeds were imbibed for 7 h at RT. The embryos were then isolated and incubated
at 30°C for 6 h in water (control), 1 uM BA, 50 mM nitrate, or 1 pM BA plus 50 mM
nitrate, plus or minus 50 mM ammonium chloride. Bars indicate 1 SEM (n=8 to 9).

49

ammonia has been shown to affect nitrate uptake and utilization (Takécs and
Técsi, 1992); this was also examined in A. githago embryos. Ammonia by
itself or in equivalent amounts with nitrate had no effect on NR activity (Figure
2.7, 0:0 vs. 0:1 and 1:0 vs. 1:0+0:1). While keeping the total nitrogen
concentraton at 50 mM, the ratios of nitrate to ammonia were varied. Only
when nitrate was decreased to 12.5 mM (Figure 2.7, lane 1:3) was there any
decrease in NR activity.

Ethylene. Schmerder and Borriss (1986) showed that ethylene increased
NR activity in A. githago embryos, and that ethylene and cytokinin acted
synergistically to enhance NR activity. Figure 2.8 shows results from ethylene
treatments. Ethylene increased NR activity ~50% over control, but had no
effect on nitrate-induced NR activity. Contrary to Schmerder and Borriss’
results, ethylene had an inhibitory effect on cytokinin-induced NR activity.
Similar results were obtained in four independent experiments.

The effect of imbibition an NR activity. Different seed lots had varying
levels of background NR activity, both at the zero time point when embryos
were first isolated, and during the incubation of the embryos in water (personal
observation). The changes in NR activity during the course of imbibition were
measured. The low level of NR activity in imbibed embryos increased with a
longer imbibition time. This increase was temperature dependent, with
imbibition at 30°C increasing activity more than imbibition at 23°C (Figure 2.9,
1a, 2a). This increase was observed in many experiments, but the time of the

initial increase in activity varied between seed lots and with the age of seeds.

50

 

To
2‘
.0
as)
a.
.5:
3'0
Or»
<5
ire
Z'ON
Z
'6
E
5

 

 

 

1:0 1:0 3:1 1:1 1:3 0:1 0:0
+

0” NO3' / NH:

Figure 2.7. The effect of various ratios of nitrate to ammonia on NR activity.

Seeds were imbibed for 12 h at RT. The embryos were then isolated and
incubated at 30°C for 12 h in various concentrations of nitrate/ammonia.
1:0+0:1=50 mM nitrate plus 50 mM ammonia; 1:0, 3:1, 1:1, 1:3, and 0:1=ratios of
nitrate! ammonia so that the sum of nitrogen is 50 mM; 0:0=water. The results
represent the average of triplicate samples, four embryos per sample. Ammonia
was applied in the form of ammonium chloride.

51

 

60

 

(:1 - ethylene
50 P I + ethylene

 

 

 

40r

NR Actrvrty
(nmol N0; formed h'1 embryo")
8
l

 

 

 

 

 

 

 

 

 

 

 

20 -
10 -
Control BA Nitrate
Embryo Treatment

Figure 2.8. The effect of ethylene on cytokinin- and nitrate-induced NR activity.

Seeds were imbibed for 13 h at RT. The embryos were then isolated and incubated
at 28°C for 6 h in water (control), 1 pM BA, or 50 mM nitrate, plus or minus 14 plll
ethylene. The results represent the average of triplicate samples, 4 embryos per
sample.

52

 

30
7g 25
.D
g8 20
.3";
2815
LIE
z..-
'o~ 10
Z
3 5
e

 

 

 

 

Time (h)

Figure 2.9. Temperature-dependent NR activity in imbibed seeds and isolated
embryos.

Seeds were imbibed in water at 23°C (1 a) or 30°C (2a) for the indicated times. The
embryos were then isolated, frozen and NR activity was measured . Seeds were
imbibed for 7 h at 23°C (15) or 30°C (2b). The embryos were then isolated and
incubated in water at the same temperature as during imbibition. The times for 1b
and 2b represent cumulative times of imbibition and incubation. The arrow
represents the time of embryo isolation for 1b and 2b. The results represent the
average of triplicate samples, 4 embryos per sample.

53

Figures 2.2 and 2.3 show that the low level of NR activity present when
embryos were first isolated increased when the embryos were incubated in
water. The reason for this increase is unknown. Figure 2.9 shows that this
increase in activity was also temperature dependent with a greater increase at

a higher temperature (1b, 2b).

54
DISCUSSION

Studies of cytokinin and nitrate regulation of NR activity in A. githago
embryos have shown variations in the seeds. Studies (Kende et al., 1971;
Kuznetsov et al., 1979; Schmerder and Borriss, 1986) have shown differences
in the times of maximum induction, the presence or absence of a lag phase for
cytokinin induction, and whether cytokinin or nitrate increased activity to a
greater extent. These results, as well as differences observed in these
experiments, suggest that the state of the seeds is important in cytokinin and
nitrate regulation of NR activity.

Many factors regulate NR activity in plants and some of them were
examined in A. githago embryos. Light is known to regulate NR in many plants
in one or more of the following ways (for a review, see Hoff et al., 1994). In
green tissues, light activates one or both of the photosystems of
photosynthesis, causing an increase in transport of nitrate from the vacuole to
the cytosol where NR induction occurs (Granstedt and Huffaker, 1982). Light
may also activate phytochrome, which in turn increases NR mRNA level and
enzyme activity. By activation of photosynthesis, light increases the
carbohydrate supply and NADH level necessary for nitrate reduction, and thus
increases NR activity.

A. githago embryos have typically been imbibed and incubated in the
dark, and embryos isolated either under green safelights or in room light. Since
large numbers of embryos were needed for molecular biological experiments,

the effect of room light on NR activity was examined and found to have no

55

effect on cytokinin- or nitrate-induced activity. Since individual wavelengths of
light and longer incubation times were not tested, regulation by light under
certain conditions is still possible. However, in most of these and future
experiments, embryos were isolated in room light as quickly as possible,
keeping light exposure to under 10 minutes.

While ammonia had no effect on NR activity, ethylene did regulate
activity. The effects of ethylene by itself and in combination with nitrate were
similar to reported results (Schmerder and Borriss, 1986). However, the
enhancement of cytokinin-induced activity by ethylene (Schmerder and Borriss,
1986) was not observed here, rather a significant and reproducible inhibition
was observed. Since these experiments were done in only one set of seeds,
differences due to seed lots are possible. One might expect that endogenous
cytokinin and ethylene levels may affect the regulation by exogenous factors,
or perhaps the differences in the times of incubation account for the differing
results.

Cytokinins have been shown to be synthesized in the embryonic axis of
germinating seeds and transported to the cotyledons where they increase the
development of enzymatic activities (i. e. amyolytic and proteolytic activities; for
a review, see Letham, 1994). The cytokinin-induced NR activity in A. githago
embryos was localized primarily in the cotyledons, similar to some other
cytokinin-regulated proteins.

There are low levels of endogenous cytokinins in A. githago embryos that

vary during imbibition and germination and that are dependent on the state of

56

the seeds (Schmerder and Borriss, 1986; Borriss, 1977). Schmerder and
Borriss (1986) suggested that changes in NR activity in water-incubated
embryos were due to endogenous cytokinins. Higher levels of NR activity in
water-incubated embryos were sometimes observed when the seeds were
imbibed long enough for the radicles to protrude (personal observation). Since
roots are known to synthesize cytokinins (Letham, 1994), perhaps the higher
levels of NR activity in water-incubated embryos are due to regulation by
endogenous cytokinins. Experiments testing NR activity in imbibing seeds
showed an increase in NR activity over time, perhaps also due to changes in
endogenous cytokinin levels. Kende et al. (1974) showed that while nitrate
could induce NR activity in seeds that had been imbibed for up to 65 h,
cytokinin could induce activity only up to 24 h of imbibition. This time might
correspond with germination, or radicle emergence, that brings about changes
in the embryos such that they are no longer susceptible to exogenous cytokinin
induction of NR activity.

Since cytokinins are known to be involved with cell growth and
differentiation, it may not be surprising to find cytokinins present and regulating
NR activity in fast growing tissues such as embryos. If endogenous cytokinin
levels vary with germination, perhaps they enhance NR activity so that more
nitrogen is reduced for early growth of embryos. Differences in seed lots may
partially be due to plant growth conditions and how much cytokinin and nitrate
were stored in the seeds during development, or to the ability of the embryo to

synthesize cytokinins.

57
REFERENCES

Borriss, H. (1977). Regulation of enzyme synthesis in seed germination. In
Regulations of Developmental Processes in Plants. H. R. Schlitte and D. Goss,
eds. (Jena:Fischer Verlag), pp. 98-110.

Crawford, N. (1995). Nitrate: Nutrient and signal for plant growth. Plant Cell
7. 859-868.

Crawford, N., and Arst, H., Jr. (1993). The molecular genetics of nitrate
assimilation in fungi and plants. Annu. Rev. Genet. 27, 115-146.

Crawford, N., Wilkinson, J., and LaBrie, S. (1992). Control of nitrate reduction
in plants. Aust. J. Plant Physiol. 19, 377-385.

Granstedt, R., and Huffaker, R. (1982). Identification of the leaf vacuole as a
major nitrate storage pool. Plant Physiol. 70, 410-413.

Guadinova, A. (1990). The effect of cytokinins on nitrate reductase activity.
Biologia Plantarum 32(2), 89-96.

Gzik, A., and Giinther, G. (1984). Influence of cytokinins on the nitrate
reductase activity in leaves of Beta vulgaris (sugar best) and Chenopodium
album (goosefoot). Biochem. Physiol. Pflanzen. 179, 295-301.

Hoff, T., Stummann, B., and Henningsen, K. (1992). Structure, function and
regulation of nitrate reductase in higher plants. Physiol. Plant. 84, 616-624.

Hoff, T., Truong, H.-N., and Caboche, M. (1994). The use of mutants and
transgenic plants to study nitrate assimilation. Plant, Cell and Environ. 17, 489-
506.

Kende, H., Hahn, H., and Kays, S. (1971). Enhancement of nitrate reductase
activity by benzyladenine in Agrostemma githago. Plant Physiol. 48, 702-706.

Kende, H., Fukuyama-Dilworth, M., and deZacks, R. (1974). On the control of
nitrate reductase by nitrate and benzyladenine in Agrostemma githago embryos.

In Plant Growth Substances-1973. S. Tamura, ed. (Tokyo: Hirokawa Publ.), pp.
675-682.

Kleinhofs, A., Warner, R., Hamat, H., Juricek, M., Huang, C., and Schnorr, K.
(1988). Molecular genetics of barley and rice nitrate reductases. Curr. Topics
in Plant Biochem. and Physiol. 7, 35-42.

58

Kuznetsov, V. V., Kuznetsov, V. V., and Kulaeva, O. (1979). Influence of
nitrate and cytokinin on nitrate reductase activity in isolated Agrostemma
githago seed buds. Biochimia 44, 684-692.

Letham, D. (1994). Cytokinins as phytohormones-sites of biosynthesis,
translocation, and function of translocated cytokinin. In Cytokinins: Chemistry,
activity, and function. D. Mok and M. Mok, eds. (Boca Raton: CRC Press), pp.
57-80.

Lu, J.-L., Ertl, J. R., and Chen, C.-M. (1992). Transcriptional regulation of
nitrate reductase mRNA levels by cytokinin-abscisic acid interactions in etiolated
barley leaves. Plant Physiol. 98, 1255-1260.

Rouzé, P., and Caboche, M. (1992). Nitrate reduction in higher plants:
Molecular approaches to function and regulation. In Inducible Plant Proteins.
J. Wray, ed. (Cambridge: Cambridge University), pp. 45-77.

Schmerder, B., and Borriss, H. (1986). Induction of nitrate reductase by
cytokinin and ethylene in Agrostemma githago L. embryos. Planta 169, 589-
593.

Takacs, E., and Técsi, L. (1992). Effects of NO3'/NH4* ratio on photosynthetic
rate, nitrate reductase activity and chloroplast ultrastructure in three cultivars
of red pepper (Capsicum annuum L.). J. Plant Physiol. 140, 298-305.

Wray, J., and Filner, P. (1970). Structural and functional relationships of
enzyme activities induced by nitrate in barley. Biochem. J. 119, 715-725.

CHAPTER 3

Molecular Cloning of Three Nitrate Reductase cDNA
Clones from Agrostemma githago Embryos

ABSTRACT

Degenerate oligonucleotide primers synthesized to conserved regions of
nitrate reductases were used to obtain 495-bp clones from A. githago using the
polymerase chain reaction (PCR). Three groups of PCR-clones were identified.
Partial cDNA clones corresponding to each of the PCR-clones were isolated
from an A. githago cDNA library. A representative clone from each group was
characterized in detail. The inserts of Agnr125, Agnr223, and Agnr321 are
2046 bp, 1502 bp, and 1729 bp, respectively. All three clones are partial
clones with the 5'-ends beginning in the molybdenum-binding domain and the
3’-ends containing untranslated sequences. In most plants, NR cDNA clones
hybridize to 3 to 3.7-kb mRNAs.

Agnr125 and Agnr321 were highly homologous to each other, with 94%
nucleotide identity within the coding region and high homology extending into
the 3’-untranslated region. Agnr223 had 82% nucleotide identity to either
Agnr125 or Agnr321 and did not share homology within the 3’-untranslated
region. The three A. githago NR clones had 60-77% nucleotide identity to
other plant NR clones. The greatest homology was to spinach, with 77%
nucleotide homology and 86% amino acid homology. The hinge region lying

between the molybdenum and heme binding domains had the least homology.

59

60
INTRODUCTION

Plants obtain most of their nitrogen in the form of nitrate. Nitrate is
actively transported into the cell and reduced by cytosolic nitrate reductase (NR)
to nitrite. Nitrite is toxic to the cell and is translocated into the plastids where
it is reduced to ammonium by nitrite reductase (NiR). Ammonium ions enter the
amino acid pool primarily via the action of glutamine synthetase.

Because the rate-limiting and regulated step of nitrate assimilation is
catalyzed by nitrate reductase (NR), much research has focussed on NR and its
regulation (for reviews, see Rouzé and Caboche, 1992; Hoff et al., 1994;
Crawford, 1995). NR is a multifunctional homodimer containing molybdenum
cofactor, heme, and FAD as prosthetic groups in each of the 100 to 1 15-kDa
subunits. Electrons are transferred from NADH or NADPH through the
prosthetic groups to nitrate.

The NR gene, which is nuclear encoded, has now been isolated from
many plant species. More than one gene has been found in various plants,
including in the relatively small genome of Arabidapsis thaliana (Cheng et al.,
1988). Based on sequence homology to the members of the cytochrome b5
superfamily and cytochrome b5 reductase (Calza et al., 1987), the boundaries
of the heme and flavin domains have been defined. A number of proteins utilize
a molybdopterin, but only sulfite oxidase has significant sequence homology to
the assimilatory NR molybdenum cofactor binding domain. Protease-sensitive
regions separate the functional domains of NR and are less conserved.

NR is regulated by nitrate in all plants. NR may also be regulated by

61

light, circadian rhythms, C02, reduced nitrogen compounds, sucrose,
phytohormones, and a plastidic factor (for a review, see Rouzé and Caboche,
1992). While the physiological responses to these factors has been well
studied, the molecular mechanisms of these responses are only beginning to be
understood.

Cytokinins and nitrate have been shown to increase NR activity
independently in A. githago embryos (Kende et al., 1971), but only a single
NADH-NR protein could be identified (Dilworth and Kende, 1974). Kende and
Shen (1972) showed that both nitrate and cytokinins induce the synthesis of
new NR protein. The aim of this study was to isolate NR cDNA clones from A.
githago and to investigate the regulation of NR mRNAls) by cytokinins and

nitrate.

62
MATERIALS AND METHODS

Plant material, Incuba tian procedures, Tissue ex traction and NADH-NR
assay. See Materials and Methods, Chapter 2.

Polymerase chain reaction. PCR was performed on lambda DNA isolated
from an A. githago cDNA library. The following degenerate primers were used:
HK35 (upstream primer), 5'-TGGTGYTGGTGYTTYTGG-3' and HK34
(downstream primer), 5’-TCRAAYTCYTCNGTRCARTC-3’. The 50 pl PCR
reaction was run in standard PCR buffer containing 1 pM HK35, 3 pM HK34,
and 0.8 pg lambda DNA under the following conditions: 5 min at 94°C and
then 35 cycles of 1 min at 94°C, 2 min at 50°C, and 2 min at 72°C. In the
last cycle, the extension time was prolonged to 9 min. DNA products were gel
purified, proteinase K treated, ligated into the TA cloning vector pCRll
(lnvitrogen, San Diego, CA), and transformed into lnvaF’ cells (lnvitrogen, San
Diego, CA). NR clones were initially identified by hybridization to an internal
degenerate oligonucleotide HK30: 5’-AACCARCARTTRTTCATCAT-3'.

Gene-specific aliganucleatides. Gene-specific anti-sense oligonucleotides
were synthesized to the hinge 1 region of each of the three PCR clones. These
oligonucleotides were used to further screeen the PCR clones and to identify
cDNA clones.

HK39 (Agnr1): 5’-GGTTATTGCCACCTGGCACA-3';
HK38 (Agnr2): 5'-ACGCGTGGCTAACTGCGTCC-3';

HK76 (Agnr3): 5'-AGTTATTGCCACCCGGCACT-3’.

63

RNA extraction. Total RNA was isolated according to Puissant and
Houdeline (1990). One hundred embryos weighed 1.1 to 1.2 g, and total RNA
yield was 800-1400 pg RNA per g fresh weight. PolylA)+ RNA was isolated
using the PolyATract Isolation System (Promega, Madison, WI) or by selection
on an oligo(dT) cellulose (Boehringer Mannheim, Indianapolis, IN) column
according to Schleif and Wensink (1981) with yields of 1.0 to 1.4%.

Construction of cDNA library. A. githago seeds were imbibed for 7 h at
23°C, and isolated embryos were incubated in 1 pM BA plus 50 mM nitrate for
4 to 6 h at 30°C. Isolated polylA)+ RNA was size fractionated on 5 to 30%
linear sucrose gradients by centrifugation for 16 h at 28,000 rpm in a SW40
rotor (Beckman, Fullerton, CA; Schleif and Wensink, 1981). Fractions
containing 2.5 to 3.5 kb RNA that cross-hybridized with a 1671-bp partial
tobacco hie-2 gene (Calza etal. , 1987; Vaucheret etal. , 1989) were combined.
An A. githago cDNA library was constructed by Stratagene (La Jolla, CA) in the
EcaRl site of lambda Zapll. The oligo(dT)-primed library contained 4.2 X 10‘3
recombinants with <5% nonrecombinants and inserts greater than 1 kb.

Library screening. The A. githago unamplified cDNA library was screened
with the random primer-labelled insert of Agpcrl , an A. githago 495- bp PCR
NR clone. E. cali Sure cells (Stratagene) were used to plate 35 to 50,000 pfu
per 150 mm plate. Bacterial lawns were lifted in duplicate with nitrocellulose
filters (Schleicher and Schuell, Keene, NH). Pre-hybridizations and
hybridizations were carried out at 55°C or 60°C in 6XSSC, 50 mM sodium

phosphate, 5X Denhardt’s solution, 0.5% SDS, and 0.25 mg/ml of denatured

64
salmon sperm DNA [20X SSC: 3M NaCl, 0.3M sodium citrate, pH 7.0; 50 X

Denhardt’s solution: 1% Ficoll (w/v), 1% polyvinylpyrrolidine (w/v), 1% bovine
serum albumin (w/v)]. pBluescript SK“ clones were isolated from positive
lambda Zapll clones using R408 helper phage according to Stratagene.

Radialabel/ed probes. Isolated DNA fragments were radiolabelled using
a random-primed labelling kit (Boehringer Mannheim). Oligonucleotides were
end-labelled according to Maniatis etal. (1982). All radioactive materials were
supplied by New England Nuclear (Wilmington, DE).

DNA sequencing. The DNA sequences were determined by the dideoxy
chain-termination method (Sanger et al., 1977) using a T7 polymerase
Sequenase kit (United States Biochemical Corp., Cleveland, OH). Subcloning
of restriction enzyme-digested fragments into pBluescript SK' (Stratagene) and
synthetic oligonucleotide primers were used for further sequencing. All DNA
sequences were determined completely from both strands.

Subc/anes. Agnr1-1 was generated by digesting Agpcrl with EcaRl,
then digesting the isolated 495-bp fragment with Hpall. The isolated 171 bp
Hpall fragment was ligated into the Smal site of pBluescript SK'. Agnr2-1 was
generated by digesting a 3'-truncated Agpcr2 clone with Smal/EcaRl and
ligating the 144-bp DNA fragment into pBluescript SK'. Agnr3-1 was generated
by digesting Apcr3 with Smal/EcaRl and ligating the 245-bp DNA fragment into
pBluescript SK‘.

Camputerpragrams. All analyses of the nucleic acid and derived amino

acid sequences were performed using the Genetics Computer Group Wisconsin

65
Package.

Standard molecular biological methods. Most other methods were
performed according to standard molecular biological techniques (Maniatis et

al., 1982; Sambrook et al., 1989).

66
RESULTS

Isolation of three PCR clones. Figure 3.1 shows the structure of the
tobacco nia-2 NR gene (Vaucheret et al., 1989). Based on the plant NR
sequences available, degenerate oligonucleotides were synthesized to three
conserved regions in the coding sequence of NR genes. HK35, located in the
molybdenum binding domain, and HK34, located in the heme binding domain
(Figure 3.1), were used to amplify by PCR DNA isolated from the A. githago
cDNA library. There were 3 to 4 PCR products, but only one 495-bp PCR
product hybridized to the internal HK30 degenerate oligonucleotide (Figure 3.1).
This DNA was ligated into pCRlI (lnvitrogen), and three different groups of NR
clones were identified by DNA sequencing. Eleven clones corresponded to
Agpcrl , two clones to Agpcr2, and one clone to Agpcr3.

The three groups of PCR clones were highly homologous to each other.
Agpcrl shared 95% and 85% nucleotide indentity with Agpcr3 and Agpcr2,
respectively. The PCR clones contained the hinge 1 region (Figure 3.1) that lies
between the molybdenum and heme binding domains and this region had less
homology. Three gene-specific oligonucleotides were synthesized to the hinge
1 sequences (HK39, HK38, HK76; Figure 3.2). Even though HK39 and HK76
differ by only three nucleotides, all three of the end-labelled oligonucleotides
hybridized only with their corresponding cDNA clones (data not shown).

Isolation of NR cDNA clones from A. githago. Due to the high sequence
homology between the three PCR clones, the 495-bp insert of Agpcrl was used

to screen an A. githago cDNA library under intermediate stringency conditions

67

HK35 HK34
HK30 H1

   

I §\\\\\\\\\§ |||l|l||l|||lll| §Illllllllllllllllllll|l||l|||l||l|ll|l|||||lll § Illl||||l|l||||||||l|l||l||l| §
Swami... cmfs'm

— Promoter sequence
I: 5' and 3' untranslated sequences
Molybdenum binding domain
- Heme binding domain
FAD binding domain
........ lntrons

Figure 3.1. The linear structure of nitrate reductase.

The organization of the Nicatiana tabacum NR gene, nia-2 (Vaucheret et al.,
1989), is shown. NR has three binding domains as indicated, with two hinge
regions (H1, H2) lying between the domains. The locations of the degenerate
oligonucleotides used for PCR amplification from A. githago DNA (HK35 and
HK34) and for screening the PCR clones (HK30) are indicated (sequences shown
in Material and Methods). Areas of sequence homology to other genes are
identified below nitrate reductase: rat sulfite oxidase (Crawford et al., 1988),
bovine liver cytochrome b5 (Ozols and Strittmatter, 1969), and human cytochrome
b5 reductase (Yubisui et al., 1984).

Hinge 1

 

Agpcrl GAACTGAQTGTGCCAGGTGGCAATAACCFGAAGCGTACTTCATCCACC HK39

******** ***** ************ ********************

Agpcr3 GAACTGAqAGTGCCGGGTGGCAATAACTFGAAGCGTACTTCATCCACC HK76

** ** i f * ** * ************ * ** **

 

 

 

 

Agpcr2 GAGTTGTdGGACGCAGTTAGCCACGCGTFGAAGCGTACTGCGTCGACA HK38

 

Figure 3.2. The sequences of the hinge 1 region of three A. githago NR clones.

The 48 nucleotides of the hinge 1 region (Daniel-Vedele et al.,1989) of A. githago
NR clones are shown. Identical nucleotides between sequences are indicated with
asterisks. The sites of the gene-specific 20-mer oligonucleotides are boxed, and
their names are indicated on the right.

69

that would allow cross-hybridization to all three NR clones. Seventy primary
phage were isolated from 280,000 recombinant clones. Twenty clones were
selected for further purification, and fifteen of these were carried through to
isolation. These clones were grouped based on hybridization to the gene-
specific oligonucleotides (HK39, HK38, and HK76). Ten clones corresponded
to Agnr1, one clone to Agnr2, and four clones to Agnr3.

Analysis of the nucleotide sequences of A. githago NR cDNA clones.
The largest clone from each of the three NR groups in A. githago was chosen
for detailed analysis. To determine the nucleotide sequences of the clones,
restriction enzyme digested DNA fragments were subcloned into pBluescript SK’
and sequenced from the ends. Oligonucleotides were synthesized to complete
the sequences of all three clones on both strands. Figure 3.3 shows the
sequencing strategies for Agnr125 (2046 bp), Agnr223(1502 bp) and Agnr321
(1729 bp). Since NR cDNAs hybridize to 3 to 3.7-kb mRNAs in other plants,
all three isolated clones are partial clones missing the 5’-ends of the sequences.

The nucleotide sequences and comparisons of the three NR clones are
shown in Figure 3.4. All three clones begin in the molybdenum-binding domain
and extend into the 3’-untranslated region. Table 3.1 shows that there is great
homology between the clones, with Agnr125 and Agnr321 sharing 94%
nucleotide sequence identity within the coding region. The nucleotide
differences between the sequences are all single base-pair changes. Portions
of the nine clones corresponding to Agnr1 and the three clones corresponding

to Agnr3 were sequenced.

70

Figure 3.3. The structure and sequencing strategy of three A. githago NR partial
cDNA clones.

The sequencing strategies of representative clones for each of the three NR genes
are shown. The three NR binding domains and hinge regions (H1 and H2) are
indicated based on sequence homology to NR sequences from other plants. The
stop codon and scale in bp are also indicated. The numbered base pair (+900)
corresponds to the analagous position in the spinach NR cDNA sequence (Prosser
and Lazarus, 1990) relative to the start of transcription (+1 ). The horizontal arrows
denote the directions and positions of sequencing. Agnr125, Agnr223, and
Agnr321 are 2046, 1502, and 1729 bp, respectively.

 

 

Molybdenum Heme FAD
stop codon
Agnr125

ll ll ‘ l

—

 

#
fl
—#

—
— ‘

 

Agnr223

Agnr321

 

—
fl
_

—‘

— 100 bp

Figure 3.3. The structure and sequencing strategy of three
A. githago NR partial cDNA clones.

72

Figure 3.4. Nucleotide sequence comparison between three A. githago NR partial
cDNA clones.

The sequences of three A. githago cDNA clones are compared. Identical
nucleotides to Amr125 are indicated by asterisks. Gap positions, inserted to
optimize the alignment, are indicated by dashes. The three binding domains are
indicated above the sequences according to Daniel-Vedele et al. (1989). The
locations of the degenerate oligonucleotides used for PCR amplification (HK35 and
HK34) and for screening the PCR clones (HK30) are underlined. The borders of
the three subclones surrounding the hinge 1 region are bracketed (Agnr1-1,
Agnr2-1, Agnr3-1). The position of the gene-specific oligonucleotides is boxed
(HK39, HK38, HK76). Asterisks above the sequences identify the stop codons,
and putative polyadenylation signals are double underlined. The conserved
positions of the three introns (I1, l2, I3) in NR genes are indicated (Daniel-Vedele et
al., 1989).

 

 

73

itii¥£<rrh«4Hiaiiai<khcisttu«U¥isiri¢i¥u11<a«rorucrkscskahtiiiiuscikisithichirhitaracism«staircaiaiairr<itcitr
iikikasifiist«raritctsaa«strutaaiikitkttuassaaiac<sihiiaaiirrti iiiaraea«hiihsiariaataaawistaaaaatiactisiaiaaia

uh<ohpo<uuuouk<<o<hkku<uu<whh<oh<<<<o<<Huuo<<u<oouhu<uwh<ouuu < Hu<<oohuoh<<0h<whhhh<ho<u<wuu
omm vmx: How

 

r<kaUkkicsaretaiaaaocrhiassiresurchashitackha<iiisa«atawithisitstitheii¥¢ii¥<i¥biLW£iiccisaoacirrhatsituiiiiti
sistaiahataashariatiiaatiiriikatsac«chic«iiariiiiacatatactiraciiiiaiitaarhsiaaahtistressaiaiakkasairaiiutkisit

Houwhoueuuu<uu<wo<<UkUUFhonwuu<uuou<wu<hohou<u<oou<u<huhpwuh<oohuuo<9ho<uuuwuUhu<<u<uw<<<<<hh<o<woUhoh<<UFuhho
omm Hun

 

«caiihaikikoriiiakiisii<ts<stwkcoiur«stairs«iakouousU¥¢<ahartwu<iQ?hiahoatfirstakisimiihtswcciircicfiisbcikrhara
sic«aweiaiacairrat«a«cittissiaiitcaiiiiiatrisakkitaitisaaiacassaigittiritthttstssiacritmrttairsrriiiaiiiassist

h<<<<UUHu<<<u<u<<oh<uphouuuu<uoh<Ukhu<hwuc<<ubuu<<h<<uowboo<uuohuhu<wku<<uubuu<ueou<<cuWuuu¢wh<owhwuuuowouu<<<
emu med: H: H: or How

 

 

 

isiwimiiiiithesisiissctitiiiiiikisasiiiaiiUkiruihsi<¥itkahtria<hsacrass«rirrskhiriaaiitiiaiiiscirrahisirirsuia
assistaiiiiriaaariaacaisiaiiifisiiaretriaiaktsrirrisiiaaaaiiiiiiriicartraiaiiiaircaiasaairitiriraiaih{skiritiii

u<<houuuu<<uuu<uuup<uo<oUhhwkohh<huouh<<<0kouo<<u<uhuuo<<uobchcu<<uu<c<<ceowouuehuabhohh<<u<<wh<ok<uo ch<UFoh<
one any: amm
n.

asrsriiiisiaiititiriciticusiihirciriousarssuafiiiiririitiairc{airstrikii«archaiiciiUirsraisrristsitcciiitraaiie

 

tritiiaikittskishciiicisiaichiiia##iriirrisiiihiititiiikk¢<riiiiasa«iisssaiiiraUiihihiiihffiiikiisiraasiiiiikci
(uwhhh<Uhu<<<<<ouuu<<UPu<h<<u<uhu<<<UE<wuwhhuo<uUhhowuohh<w<o<<<huohwwhhu<HUh<wbhu<ho<<uUhu<<o<hh<0hwohhhhbokw
cmm va

 

aisitiiiiiiiiihi

circaserrate«scribesifiihiiitiiitoiorit<iih¥ti
ohhwhwchh<h<<<oouu<h<<<uu<<oo<<<<<u<<uUh<u<oohh<<o<uu<h<<u<oak<u<<<w<uw<uwh<owh<<u<obo<<w<hu<u<<u<ukw<<<o<<owu
mmx: fimm

N.

<0o< h9hh<hhuou<hhwwuo<ukhhu<u<hhuuhwu<<o<u<ko<00houoh<<hh<ouuokh<h<<<w<<uU<Uhoh<uu<u<uu<<h<uthUHh<<<h<h<<oh
Ho<ou<<<b<<h<h<hw<uou<o<<h<h¢ohocho (<0UUPh<<uuokhu<<o<uou<00koh<uh0hhuoohhhhoouUH<<h<awo<h<hh<0h<hb<kho<h<ou
Uhu<ohhauuu<uwhh90h<hh<uw<o<<okhuoh <hh0¢h<<ououuhockh<hbkowowuUhh<hh<oh<oo<hhwouUhkboouh<uh<o000hu<uhh<<<o<w

can H
:

 

60:20 (200 3:3 mz oucfio .< o2£ c323 comLaeEoo 8.533. 0360.032 .1.” 239....

MN~L=6<
mercm<
mNHr=m<

m-1=m<
s~n1=m<
mNHLcm<

mwwtcm<
awnicu<
mNHL=m<

m-r=m<
H~mL=m<
mwfitcm<

m-1=m<
H~m2=m<
mwfitcm<

m-r=m<
H~ML=6<
m-1=m<

mNHLEm<
mwnccm<
mungcm<

74

aiskt<aarit<tu<itaoktraririicuu<a¥rriisitaeaairiciactrUi<icieiskcus1Uiiiiiiiosii<ii<£§hiiii¢ttih¥tii¢<4tisiiuc
«iiriafiua«rsrsaa«stir#1titres«aresects«a«tact«sosiiioi¢1<¢csaitasaiiikairiiasiicaaiicassassiiatcaaiiiisiastira
<o<u<PPUhh<o<<o<ub<<bb<hhhhoabhoh<oh<b<<<owho<o<<wh<<<wco<<<<cuho<hwh<hooh<ku<<<uhocw<<<oo<<u<Ho<ohh<uuoouh<<<
comm HmmH

htrhackas<<w<s<aaattsatritioat<<wUrsa«riseuiiaat<assi¢¢are¢¢<aa<tt<ataakosciuUhiiosicker«trittauaaaaitosshaaht
chaiseaaaaii<iissas¥ascitcsiiiairistwtruseisfiaaeccassiciiaasici<ieusaiakastUiairioiaaa;criticaiiarsiititiceahc
u<w9hu<<wuuuuou<hh<hUhh<h<ou<okk<<u<hwUh<<<uuu<PUP<ohuu<uah<u<ouu<u<uu<wu<c<<ou<o<<<<hu<h<wuu<<<uh<<ho<<uU<hUh
ommH Hcmfl

1111110uas<aircrtcakkauUktsreatkrwsrkiassaesaaa#101191aorcakcaaickrssrcrrhtrhrro«scarcitsarraeaaaascarcittokrk
asarsaktsthisiiikicscittssatirisacttu<i¥¥tiakkhstoisiiirrrhacassettearcrthcrhric«stsairchrtitaskcuctcsiiirrkik
<¢uuuu<<k<wuouu<coohouhoHUH<¢h<uu<<hkw<<<<<buoUhh<<<Huu<<<<uou<uupuoh<uhhu<<<oo<<<<ou<hhu<hw<oUh<H<uuooohh<uuu
ovma Hmum

siaichsssicushsitsttaariiiu<<¥iius<s¢roas¢caa¢cucciiiiiuatahcihrsc«titiiasciiiii<11<wct<¥ur<iathrao¢aiiihribar

«sicchiairstriiaasiafiitittisha«tisiariasaiitartUiaiiiia«stabisksihstasiiiiiiiirsraskissiiisiiiiiaieciifiiiiiiii
wo<<<0kc<<o<h<UH<<UPuouohk<uu<PUPUhh<o<Hkh<u<<U<UPuP<UHoooououu<<uUUUPF<w<Huuu<uo<UU<GQu<0khu<h0hu<<<0h00hw<bu
omvH “NMH

hushaticihcchsiiiiesshiccs<uoc<¢¥¢ta<iriseaisiisitiiohritaasairiiaua<ur<riirririraktua<¢¥iusaustfierhiisiiistua

risksatirictocrisisii«kciiiiirciiattiira«ritttiitiiiiaitiiicaashris«iisiisiiiiii<iaficcaiifii«satiriciariiriikia
u<cuphu<huco<ho<<oh<oUh<<uw<u<uu<<uuuu<u<houo<c<ok<UFohhu<<<h<cu<o<ho<UFuuohuhupuupkokau<u<<<ooohokwuuUPUHoo<P
ommH HH~H

«wieoaiiaicaskrausikchowihiica<usfiaaUtkfiUiaiicciiiiiirhiiit<crai0411¥¥iiiasiiiiiitttisrciii<cu<tu<¢isri¢rih¥au

«siicitcaisciiaikcitssiifistiriiiietiiiiiiaisiiaacisisicisastaoiaaaiiaiticaciiiiiiriiiiiiiiiiashissiitiiiiikiit
uupo<<uu<uo<<uuhpuu<huuouchhuwuphpoc<<c<uhou<ou<uuubahu<ueu»o<<<<<oup<upuo<<hobuuuUh<<<<o<owo<uuuw<<UPuuuo<hwp
oHNfl HoHH

ri<¢<u#soia¢u«race«aheait##4##sa<iturchrssiii¥<iaia«hoiiatcaairsitairraiii<aicct#ucuii<¢iiisats<rrh##hitOiaias
isiaicaisisiraiicaiiacaisaaeccsascrssrassraceaar«craiiiaaa«acacia«a«arkaaiiiisrescissirssiisra«eiisaioiisaiiai

<<uoohpeeooo<aue<<<oao<up<<oo<uaopoho<uoeup<ucuoupuuu<oou<uucaausu<<caoouuauepupaa<oo<uohh<auuea<uu<e<aouu<uu<
a<1 N: ~1_ use:

3:8 4.... 2.3.“.

mNNL=m<
HNmL=m<
mNHL=m<

mmwrcm<
awnicm<
mmfitcm<

mmmrcm<
HNMLcm<
mwstcm<

mmmtcm<
H~m1=m<
m~H1=m<

mwmtcm<
CNmrcm<
mwfltcm<

MNNLcm<
awnicm<
mmarcm<

mwwccm<
HNMLcm<
mNchm<

75

<<<<<<<<Huo<h<uupp<<<u<<oo<<u<Hu<<<QH<
mNHN Hmow

«(hkkhOFOUHHFHQ<P¢HPHP<H<Ho<o<<<<<h<H<hU<h¢b<bhh<khhoohhocihhiiiituiiiiaasscitaistisiisiiiaiiaacaiiitciitrccci
<<<<<<<<<<<<<<<<<<<<Hhh<chhhhflflHHflflhhhh<bkoH<hhhou<<ohwhoh<kuhh<<<uhh
omom HmmH

<<<<<<<<wuuu<<<khhh<H<<H<<<<<<<ouuu<s<iiir<ac<¢a<siae¢¢a
iiii¢<hhaaci<hiaaasaa<hUh<ic¥¢¢kia<<aciaitaiiaaaciiioatat¢t<raUtcaiaaacasaiaausaaaast-..ctssititasasaassaacaia
(hkohohoh<h<h<<hhu<hbh<h<h<<<<<<hh--h<<h<<hk<<kh<<hhhohhh<<hhh-hk<hhh<<hhu<uupo<hh<uhb<u<o<ohhhhUh<ohkwhh<<u<<
ommm sea Hmmfl

atesai<iacsachctaassrssiiisasaacsraaaUiiiaaasa<ieaaiitaaichasuraastsaaheauaurethasiistsahaaao<<icstaeaacaciaia
sitescaretrachearecurririittrirrstsititttttiaareassersa<ssetasarcastisaao<a«#141tritecaaircraiactiiiaaaascaaaa

ou<<hhcp<oh<huwwuh<<<<w<uohhh<<uuu<<0hkupoohbho<UUP<ah<huu<uupuuouohop<u<whh<uoopuwhou<uu<ohoohup<<wouuohou<UF
ohmH Anna

3:8 3 can:

H~m1=m<

amnicm<
m~fl1=m<

mwwtcm<
HNML=m<
m~fitcm<

m-r=m<
fiNML=m<
mNHL=m<

76

 

Table 3.1. Nucleotide sequence homology of three A. githago nitrate reductase
partial cDNA clones.

The nucleotide sequence homology is calculated as a percentage of perfect
matches between the cDNA clones over the length of the shorter clone. The
greatest homology between any of the A. githago clones and other plant sequences
is to spinach (Prosser and Lazarus, 1990).

 

%_H_0m_0|99!

Agnr125 Agnr223 Agnr321 Spinach

 

Agnr125 —-— 82 94 77

Agnr223 —— 82 77

Agnr321 —— 76

 

77

Analysis of the amino acid sequences of A. githago NR cDNA clones.
The translations of the three NR cDNA clones give open reading frames of 630,
488, and 498 amino acids. Full-length NR proteins vary from 881 amino acids
in bean (Hoff et al., 1991) to 926 amino acids in spinach (Prosser and Lazarus,
1990). Therefore, 1/3 to 1/2 of the amino-terminal portion of the A. githago
NRs have not been cloned. Many of the nucleotide differences between the
sequences are at the third base of the codon. Amino acid sequence identities
between Agnr125 and either Agnr223 or Agnr321 increase to 90% and 98%,
respectively.

Comparison of the A. githago NR sequences with NRs from other plants.
Figure 3.5 shows the amino acid sequence alignment of twenty partial or full
length NRs from higher plants. The three A. githago NR clones have 60-77%
nucleotide sequence identity to other plant NR sequences, with greatest
homology to the spinach sequence (Prosser and Lazarus, 1990). The derived
A. githago sequences show 86% amino acid identity to the spinach amino acid
sequence. While the homologies between plant NRs are less in the hinge 1 and
hinge 2 region, the three A. githago sequences were quite conserved in the
hinge 2 region.

Analysis of the 3’-untranslated regions of A. githago NR sequences. As
seen in Figure 3.4, the 3'-untranslated regions of the three A. githago NR
clones vary in length. All three clones carry putative polyadenylation signals
(Joshi, 1987) and ponA tails. However, Agnr223 has a very short 3’-

untranslated sequence that may be incomplete. No other Agnr2 clones were

78

Figure 3.5. Amino acid sequence alignment between NRs from various himer
plants.

Three A. githago NR sequences (Agnr125, Agnr223, Agnr321) are compared to
other higher-plant NRs. Positions where the same amino acid is found as in the
Arab2 sequence are shown with asterisks. Gap sequences, inserted to optimize
the alignment, are indicated by dashes. Periods indicate the unavailability of
sequence information. The binding domains and the N-terminal region are
indicated above the sequences according to Daniel-Vedele et al. (1989). The
conserved positions of the three introns (I1, I2, IS) in NR genes are indicated
(Daniel-Vedele et al., 1989). References are as indicated at the end of the
sequences. Boxes above the sequences identify amino acids referred to in the
discussion.

'79

“camacasacasa«as:«aaaaeamaamaca«acaciaa«new;«OccmcmsunccsahH«wea«HBO:asdfladltzqfifiommmommma
«ccmcaccccmaemas«acscaeamce«adsasaa«thatcedeamendsssostcaccdcdcfiaccdsaada«Ahm€DDZOQmQQmmmG
acadscecsceaaca«cacamccameemccassaacsaaa441$cfi>s¢afls4ctsse¥cca«>Ddllmmqumm3nmm>mnmoomamol
maedccc¢scaa<¢auaa«acaqmflaamaOadasaaac«Hflca¢¢¢8s¢¢a¢0¢2a<aMcme«>adoammuwQNKSGmOmmmanomwoll
zaadsucsacaaaflacaacascaa¢a1m1014¢ca«ceaHAe«use«adeccwcscscmfiua«>«Aaamm0w¢mmzommuwaocnae«ma
scams.«caucusarecacaaceadcamcfieecsscsaa«actcs¢>a0c«¢0ccencasedcfiaa¢¢¢¢>Aaagemanozmnnammmka
meantimecacHaMecan«sarcomaemadccssaaaaeHas¢a«&«c0amaonc«camH¢««>Usmc1A>que3>¢xmmoznzemom4m
use>ceeaccacaaaa«streetcacemacsecaaacacacateseeaZaeaOsacmacH«aresmc0¢>cdommlmzmzmomm0mn«2m
eacmeseceaaaaflse«accessefiseaceuccua«ascaeBtase>aZaca£aescacH«use«UeUaOadcaalozwzmommmmoall
Zaamseessas:a«acdusaaaaafikamacsaccacc«cHassessasOssschaWa>msasa«mc0¢&ua¢23>22mzmnoomamoaa

«camaceceseasaasaaaa«chewsumsc«ceecmseeHQahescachssUsecficmHsass«8:013:aO>cmzxmonaoaQamm«>
ecumcacseesea«ascaessataesamcaesassesasHachaseceZaacUsesHsmacesscmcUsXe«Oucmzxmnooonoammcw
«acme«secs«ascacccscccasccsmeacescauca«Hflahceaccastawassmcmecsasawkwaxa¢0A¢M2¥maonnaoammaw
scanners;«useace«aceeaccdaemaccac«asaa«Ha421:sachacvcscHamcc¢«>«A¥U«csaddemzxonoanoaammko

xm>mvmzm>wmam>m8Hhummzqmzqmdmm2hmmx094m>2mmzmmH3mnfifiwwnmmofi>mmmqmdzmxmHZNXXN><zmszmzQOmm

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

can 0: EHNUIZ Hm
mnmmmfldmAKXQMQIl I HGmUqullms«lllcdsmHUmlllamadla«sacs
Idcbcmmdmllll IIIIIII IIIIIIII HZhDAUUII‘sallladsHIBUlllaeeels«sass
IIIIIIII lllllllllllllllllllllll IIIIIIIIIIIIICUe«mmlIIlIa00mmmhqah4¢xm04aBQSmm<m>sacwmaeeca
IIQOxmmmcm>a.....................mmmUOUlm>¢aedemaHUz¢lmmwflxdozam‘domamtmecsurchaamlaakass
mm¢>muxmm¢mHa IIIIII 1 lmmh0001m>ase¢ammHUZmUm llllllll 4M¢Bm¢9¢mdaqmommucml was.

Idahequ III I ll mmKQDOUUIIaasllll>01l2238ahsa2|lwuusea
lamqu&& IIIIIIII mmm>omwwcmacaIIII>OIImOmmBmm¢ZI twinks:
fldddmOHx>mm¥Ammzzzwl D>ZmzthUUlK>ssedelelllIllZflUZsme«allleemamadamUuassistance
IUB¢>OXXQmmmHOGI UIADesaa«mlllllllwzm>sshfica402¢¢lllaammfihmcaIM¢csaa
umzzzzzwozzwzmzzn>qxmeomx>>02mmmmzmmaw02m>eaaa«mlllllllllmzmhmfic«Illawm2mdm121ecallecasaa
DAMHQQZOaXIldamAm mzmmmmhaoclm>cacma «smasellladmccaaamamccclmaaaaa
OANHBmzmaXIIOeZ¢ l mzmmmlha001m>ceaae «the«Illlllm404eemmhacclma«use
GAEHBmzm¢XIIO«Za mzmmmlhsowlm>sseac asmscllllllmdcflcHEmhcaclfiasasa
DAwHHHzmexIIO¢Z¢ IIIANZZAmhaOOIK>a¢ecc sumacclllaaflascecflMheaelfla«are
>omonom>¥<mxam>911 OZHBOIIZOEIdxmmDmmIIIIIIIIUm>mmXNmm>III>OZAUQWAM¢%OMZID>Q¢¢S

om H

Ncmmbm
acmmnm
H>maumm
comm
cuoo
N>maumm
Ncmmm
”comm
nmmnvm
nouwm
nomcadm
mmmucma
mmflucma
ammucma
oumeoe
whoa
Haas
macsumm
about
Named

mammnm
Hcmmbm
H>maumm
coax
cuoo
Namaumm
«comm
acmmm
cocoon
couwm
nomcwmm
mwmucoc
mmaucom
ammucmc
oumeoa
whoa
anoa
macsuom
about
wound
.m.n enamwh

8O

«Nasaaaaonaitsa«acetateaaa«asexcaeeecaamcmkcecaeaasucceecqa>smqaaaa«scalllaluaccaedaaea«Ea
casemm«0cmmsc>a«aaaaasaaccatacZeseascasdshaseaahcciassa«cacxtms>csasacclllalcaccsaflaa¢m>wx
xweaammce20<a>eaaaaaeauaaeae>c>aceecaecdsmeceeccaaa>ae¢acaa>mmmdaaeaaoelllaleaauaaflsaaaa«m
cwceucecadacsaasa>asscaac0aaea¢eeaa«casdcmcaseacacxaaeacadeSOmfisa«asacclllclaacaccdaaa«are
«caswccaadmasaaacaaaauechaaac>ssaca......................................................
«seawaeaadecs>¢t¢>sasasasOeacfl>ssefiac«addmccecékmcuscecacaazammxsa«aaaalllelsacacaflsesaaaa
Kwaczmmoaamcs>cacuesaa«asasecaZaHaeaecadcmaasceaaeaa«seaaca=«mmac«causalllclaasachseamama
«raumm01002m¢>eeacscacaasacousticscsecswaQicaasecascacscade>smzqcaaschlllklcccccedaascama
«asawemaause:aa«asac«as«use;112a«cease«dudesasecaaeeaadsecedeesaa«acacalllalcaecaadaaaces;
zwsarccaecsae«necessitatessuchcccasaccmcmsas«accusese‘sces2«»¢>eccaseclllelasccscdcaacash
cuaawcaacaaaaaaaa«as:«asasaaaaZse«Maccsmaxaaaaacaaaaactaatahcfia>atakes«Illalaaacaadaaaaaea

..........................................................................................
museumaea>mflcaa«aa«a«asacaseu«2«aecaaceme&¢...............................................
..........................................................................................
qaaaammaa0¢sa>aaaa«tease«a«atexaaceaca«waxesasaae>eseaaaasahasaaa«acecalllalckaa>ocaauaaaa
cataumaeaOseaeaaaH«use:aa«ascetic«use«adsxksaasse>caes¢cacsmcasausesaaallluleaes>o€a«sauce
«eccumaaaacsacacaHsaute«acaaecxsea«caaadaXeseaacuHsseadaasshc«accessesclilclcase>0<sc«aces
«ascwmms¢0cca«usestasisasaac¥e2agcasaasssXs«acaaCHssasasseehasa«accusetllltlt¢¢¢>0¢accaHka

thwhzomWXBB>HHm&43x>szUHhOQHHHm>mhumom8ANmUZOZN¢AHHammmDZCmexHmawwxmwdhoduwmqommomh0>zq
own HBN

acxaeeaauamx«damaaaac«as.aHdudsaaaaHaaaaacaseaaccuaeaaamacammsamqaaMaaaOHQaBaQauaa«acomamu
caKchAsesaxccmmacssaaa«aat.«fistasaHsccasameseaacaciaa«maccmmcemxsxmcsamhmaccqe«a«casanaxu
¢<¢I¢02>aa«asaememaacsaacaHcomca«camaomuaseca«successa>meu>¢0auaaamwaase>¢aaadcaacaa«Emacs
cauMmQZsaeas«aamcmdcccccececcdasaea>fidacaisaaausecauc¢>ch>¢m«UZaamse¢Amasaccdccsnaasemaaw
caeexaz>ceafise«mamficcaasccact‘acsce>800¢¢casasecs«itsacm>a¢¢ma02¢kmksa4¢<camcdecease«Ba«Q0
«exocfidceasee«mm>aeaaca«acascaaaauaHBasaacscceecaaeeeaamaaammaemaamaacamaataaqachsaenm«ma
aaxfleawcesixadmmaMsssae«acac04«aacaHeOsceaesaaasccsascemssmmma02¢cafisssUBaafisdcaesaaeomaMa
«exaceqaaaaxeA«aaaameua«cassettesa«Hecaacaaaa«aaaaaeaaamaaahmceZAaeaaaastersadaOaasaaDaaXa
«excessesaaxaccmaacccuasaceacflsseeeHBusecceaseesausaaa>mssamma«Baamcsccmdcaaschsaamanmama
saxqmaz>cachcsmut«aacaceaaflaaeasceH¢OcB¢«aaaaaasaaaaa>mccam0uoz«casteaMHaaaaqaaasacaomcxa

OOOOOOOOOOOO0......OOOOOOOOOOOOCOOO...0..0..DOOOOOODOO0......0..COCOOOOOOOIOOOOOOOOOOOO0..
DOOOOOOOOOOOODOOCOO...OOOOOOOOOOOOOOODODODO...OOODOOOOODOUOOOOOOOO0.000DOOOOOOQDOOOOOOOOOO

caXa¥c0>aaexeqtmcactceafieeatadceaccHBOtaasseaaeceescae>mseemma«Zaccaa«aseecaaflescceauomcma
caxzxee>cc«gaudmcecaeeHBccefledccsecHBO¢asccaecasecsasa>mna¢0ms«ZaaacacasuasaaA¢ecc{a«DD3BU
eaXZXec>¢Nsx¢A¢mcausesaaeaadadsacaeHHOacsseeeaaeeaeaas>m4cemmsa2¢acasaeeseacadaaceaaaflflaav
acxasaflcasofiaHdmasacsaaaaacdadtaaeaHBOasecaacassetteas>hdcsMhae2caamsaseaecaedsccauaaooazu
(wwxmmhH00mmfl>noqm>0¢3>mfim>0£m032hUKmXX>ZZONXKKZU¢O>AB¢<hEmadhmm>AODZHhXEmm¥>hUfi>fl>83m¢306
Ohm a HQH

Ncmunm
acumen
H>maumm
coax
cuoo
Naoaumm
Ncmmm
acmom
nmmzqm
nouam
nochmm
mmmucmc
mmflucoa
ammucmm
oumeoe
mnoe
anoa
macsumm
Hanna
meum

Ncmmnm
Hcmobw
H>m~umm
coax
:uoo
Nxmauom
mcmmm
Assam
nmmsqm
spasm
numcwmm
nmwucma
mmflucmc
ammucmd
cameos
«nos
anoa
dwcsumm
Hound
about

.m.n ouamas

81

cancccOasaaauseasa«asmeskassaaaaaaaas«>scaflecascaadassa«esscmsosskcasua>scqcc¢axaksacaasm
seeOeccOeacaausecease«xeaccscaaaacausec>sa«Acacssaadaacssaessmawscscscas>sacacceasesarcasm
cacOaasOaccneaAaaeusesmescheeeaescecaaaaasqmssasaeflceaacastssaUcemacsac>a«acaaswccaaficxam
asBOaaaOaceaacqasacsscficcs>ce¥aca«aa«saaaecnecacaamm0¢aaaflaaasaUcaahaaca>maamaa«mcaaaauekm
«ceaaacaeaaacaaaacescttassaisaeeaaa«asa>a«aqueaasacmaeaccccsuccessestake«asaacaafiacsafice«m
caBOccaOaaeccadcaccaacmaas>achaaecascssaasgeasaasmsaeaeaaa>asa0aasaa«Hc>aaaascewmaasaaaam
«incessant;a«aascaccueaeaeceuaeaaacasscasssAZ¢ae«¢¢Uaeeaeaa«acfiwecssasaaaaaaaaaawasaascaam
eecdea101ccaaaacaaa«MeacacsaeaccaecHaaeficscqscac110¢aeaasasssssUascccuas«aaaaaccwa«succeed
cceacccaea«asaces«useataxi«saaceeeaacsucceedeceaechaecaustics«acetate«acaaccaacwcccteflaem
casescadeaec«(acesexcfitccasceccecaeat¢a>¢asdssaaca=¢ae«acetatesweatsassaeeaccaaawceaaaccam
«sagaceaaaaas«a«a:aasassctecseaeca«aeaa>aecqsaaasacMccaaa«scaeawatcaaasaaacuuaaea«acumumcs
canficscdacaacsaaaa«mus«excaacacaa«sauce«as«Auscsceccasaeaacacc«Usssccasasccaaaeswa........
sahfiescOaause«useasaaa«its«accessuse¢c¢>cscdcsacasflquccacccsa«Ocsaaaaaaa«acaacsuaaatheOa
cafifieeedaaeasaccessessaccccaeceaecasaac>eaaqeescssme0ecceasaeccUecsasacceaaaa«sawsseaw0«aa
cacdeeadecseaaeaaaeaa«sesaZcicsceaceacs>ascusaac«staccaasaaaacaeeeaccuseacacaasawcaaafiaacm
sacdacadcaaaassccat«aa«atcrasecceeaacae>ccana¢¢saeaecaceeas«use;assuaasaecacaaccweascficcam
ascOescanaacsesccc«as«ataxiceccacceaec>¢eias¢ecsccseeeecaeaccaaaaacaaaccactcaacuace«Bream
accusaaOacaeeacause«eaaasassaccasccesca>aasdsasssecceaaaaceaccescaaccaeccaueeaaaasaaaaacem
..........................................................................................
UOmNZUmABmmmh>HOHmoxmmxo>ZBx>¢m3ozzxzoxdzzHZimmOqufimozdm>¢HmxdmnaQa>m>mqm3m0303mxwuxzmxm0
ovm MH Hmv

Uacfia«0eaa«cede.«aa«eamsccaaaaamnmaaZsaaSmcssucccsaaaaeaaaaaaaaccsneercaddflaaeacaamcuaaaca
Usafiananaseduceasaa«mascacaacmHhaexec«SmcscccscsscaacscsaasasscssacacsaaDZaecaaczacaucus
cfiaGccOccacaeAcaa«useamaceaccaccxaceX¢cedacsee>c0¢0cceeaeaaeeeacZU¢aaea¢¢a¢Z¢ccec«maccease
Qsc>a14aaaae..............acaceexaawcaa«HUasaaceowuaaaaaaa>cusesscccacccdfl‘Zaaaaasuccesses
«a.Bcaqeaeecauacaaa«secsccaaceeea«easecauccicceeotca«caaaaaacaaaaeaaa«asdaflZaasaaaicascuaa
HacHaAZ¢meseaAaa¢cssH«acsccccacuHs«flecesccscaceencwceasaaceasesasaccfiakada¢2¢ccecamaasccca
«acacamaeuecaAaccata«uflasaaaaccfl>>caesaa3flacasssossecacaascccas«assashuacsuZaaemaumsacassa
¢w>mca0«¢¢ecadetcan:cs¢eccccaestWca2eae3mieasse0cmcscaieaa«>sassesssaccaaaZeaaaaemaamAXaa
cacfieeOesaamexaaeaaacesasaaamaamssaaaaca3cese¢¢accaccaaacaacastecIsceacc¢¢¢2c>naacmscsauce
ssusecflefiasezerassassmsssc«seemeaaccecc3mcsstsaseacasccacscsasssmacsusc¢a<¥a>aaacmcceueas
«acmaHDacacaa2cacauseexcessescafiZaeaasccSatecctetaaemaaaca>eseasassOeaea‘cmZaacae«reassess

.OOOOOOOOOODOOOCOOOUOOOODDDDDODODUDDI00......0...0......O.DOD.0.0...ODOODDDOCDDOCOODODOOOO

HsamflHmaaeaaaZ«a«asaaa«asaas«sumacas«aem3sacicaaaasacaaeaasa{at«assasssedachuaaasmaccc«as
H‘eeeseeeeoooeeeeeeoeeeeeeseeeeeeeeoeeeeeeeeoeoeeoeeeeeeeoeeeosoeeeeeeoeeeeeeeeeeeeeeeeeee
saaascmeaeccadeccaaasuseasaeeeumacasassaSs«sceceacaeaecaesae«useaacssesadadZaseeaamma«can;
eeafimaOeacsceAsaaaaeca«esteemacmascacceaZaaeeaaeakcceaeca«aaaasaacaaaeaa‘aHZasaeaammaasses
cecaacaeeaaeedaccaaaasaseaccmcamaecasaeaZc«ceaaaaaaceeaaasaaaccacacsceac‘sficheacammcaaaua
as>9asaecaeea£aa«caaacccscaemeamaceasess3flaacsaceaaaeesaaaece«assscuesssfiadZeaeesammaeca«a

ECA¢O>ZZBNUUD>B>W>KB>¥M000mu¢aUXABMm¢OBBh<ZHQAHmmmOmHBH>mZHZANZHHNmmxwkzomwndqmda>qmmq>mzo
omv NH HH Hon

mcmmnm
acmmnm
H>maumm
comm
cuoo
m>maumm
mcmmm
Hcmmm
cumsvm
souam
consamm
mmmucmc
mmaucmc
ammucma
oumeoa
woos
anoa
macsuum
about
mound

mammnm
Humane
H>oaumm
scam
cuoo
m>maumm
mcmmm
Hcmmm
nmmavm
:ouam
comcwmm
mmmucma
mmflucma
Hmmucma
oumeoe
woos
anoa
macsumm
about
about

.m.n enemas

82!

«AccseuaauamncaveHomealZsa>m«=IlIaaHl>c8eufiemHBOIilecaescflZleamlesaZcoaaBeaaseccaaadaaaaaa
«Qaeaeeceeamua&0¢H«maeIHae>chlllcaHl>eXeeacmHBDlllc¢etichlaamlcchcUcuBcassassacanacaac
cdesZacxeX¢na«momaaficaedsc>lll¢m<mdmm>>>¢cclfl>Hllla¢AQ¢2¢mOcskfllelllca>acac>ce2eafl0¢e«flee
«Aaaemcdmxana¢¢0aacacemmc«>IllmdlmdxHaexcaceOadlllz«¢aascznmaNU<lllllsccaassessfiflchacaecc
«documequeucamUZH«weeemsallillllh¢m>cmmeecemsfllll>a6acaszamuNUBllllleecaaaaeccfiosqdea«use
«useacaamxenacmOacameammcaHillm¢0¢>fifiuemace«madlllmaceasszomzaofilllllaaaaseaeaafiflcdflaeause
«AusasaeaaeMcafiUsH«Us:alsa>mmmmdmmHfifiHc2cecesHtalllaanceeaasellfldsfiaaaaacassaaaaaaeaa«use
AficeaaaaeacmAcKOaHamaeclca> aflcaccSBflfllllaZecesecmacliessasac¢2¢acaeeeceeccaacau
a>cc¢acaa¢cmH«fiveHcflZel‘ae>¢alllm>mlllemeaseflsellllc‘scficcccazmmasaflcsccacascscscecsaaassc
aqua;cadaZawuaxfieHaaUsIHae>acllllIAm¢chcscslefileladccchaeelltlas>cecsacacaceeeesaeacssa
«maceacAc>aaHaxoeHa>¢alZse>salllllam>ca8eacsU¢AUm¥>aUaecaeoeasllcssacsumaeaccehaecdmaaeusu
«meaaeedaaacHaanHemsalgac>¢alllllmthchaecm¢ZIllH«3*asceUsecBHeasOaucaaasucceeaaaaaacflca
«macasaAe>aeH¢&O¢Haficdlfia«>aclllllhmDHcheasmellllnauaaaeacaecmfiaa¢0¢sacaa«acchacHaceacsau
«useaacqu>eaHagueHcfla¢1&¢c>¢alllllhmOHeBaccam¢Z.llAeUaacatUeasMBeaneuseacccachceHceaaa«at
«casecacadcflanUchwcclHaa>mclllB¢¢O>AsXecaathImHmaaaa«unusualllcsfiasscsaaaschcceflaees«as
accascceaOaDHaxOcHamialHe¢>melIIO¢mI>AaXeaachallmhmaeaeeaaUsslllla«Heaaeuaaaaaheucdesaa«an
«acaesaeedaaHa¥U¢H¢MeelHe¢>m¢IIIO¢mI>A¢Kaec«hellmhmcaaaessOeullllcefiaeacqceeaehmesqeea«use
«ause«asaxanccxvaeamaalnc¢>mslll>4m1¢4e¥sacchIOImMMasaaasaaaalllaacfiacaaaccceehseedcaccsca
«a«cacaaasasHsmasHamcaa«aaH«XIIIOeeIIAc&c««aahUIIhZadsase>eee¢llalllaecccacanaecsedeaaa«at
hxm>nmmHmaxm>AO>m>xdmmz>A¢dzmlIl>mhll¢flUHmdnnmhll>¢mmum>mzzmmmllmommNOHBHAHOHmaomAZXX4¥Qmm
0N5 Ddh Nm Nm mEmm I

 

asscaiaaaaeceaeacaficasucueaccacc>c¢ceaa¢¢ca¢2a«mmaaaeaeaesmllaaacscmcccacaazwmmaeaacxsscca
aacc«a«acesccaccmeficaac«is¢c¢3ea>scaccc¢¢eceZcemmsaaafieascmllcaaacamerasceazmmmccacaX¢¢¢1e
aaoacccaame«acascades;«axesdccae>a¢e¢>¢cdcexadcmmaeceflh0¢m..dcmaisasBcflccBOOBBmcficHaXOmacc
«soaecccaaaaciaeaeflaaaa«fiestaase>e¢se>ee¢aa0aflee¢eaathOaUlnescc«aathflu¢Ua¢c¢W¢Bceuxamccs
«sous«use;aa:secsatacccsxaaxeasa>aaaa>ee¢afldc¢asmuasc9hfic0>oeaa¢saccfiaflancdadfldBaaexc«use
«enacuaacmacaaacs«fleesaageatcaaa>saes>eaficNXaUc«mesaeBmOchwdece«assasmaecadcdmdfiaesxomcas
successes«accuses«Beccaaficecasa¢>ceccaca<aemcwccccsc>¢hc«wildcat«cascaccac«Mamaadsec&csuea
canteecucecacdacacmcaa«axeeaseca>es2eee¢¢eaflZaaKfiscadasmeBll¢aascamsecaccHazmmmceceOX¢macn
aeossceeeceaccessesacctnicescaes>ccceheadachescaesaadfiaazmllflceaaaseascecfiozmmfisneassamnae
«anccccaaaueueaaecdeacaaficcmceaecaeseeeudsflecescc>aacabccmllmeaacamcceaeeaOZcaflcficeZfiamaaa
«cacaeceaaaacaecsaaa«aaex:e¢e¢2c>2e¢c>ea¢ee«BessceaceescamtlfiaaaeasedfimeaBIcUmGeHeee«emcee
asoeeaaaeaeaaaaaana«usage«aedsadZscc>ee4amaa«a{aceacahsem112¢ea«ascdfiflaaflSW>¢Qadeeaaa¢csa
e«accessesuse«successesalscaadaa>eece>ae¢afleacaseHaeachcchIZ¢aeceiamfimaczzoum>fiqaca«amass
senesccseaaaeaeccaaaaaa«isaaa¢s¢>s¢ac>ce¢¢flaaceache«chasmIIchusaecmfimaazzuum>adccuac¢¢ac
censusesaccessesaa>e«asaxesentenceaseeeedcsmccasflecacaccemlldeeascechccaaeas>ccheeeaccee
«so:a«ceaseeaseascaseaaagree«teacaeececeteecamcemcecccecemlltaacuse«Hceauaaeefleeuceaaaasce
a«successesuseaacuseaaa«Zea«edceaeacaaeadeeaemaemaaaeeaecmlltaaaeeeaHaeaafieaeflecnceaaaacac
acnecasaueeaesaeecHaeaaemceea4ue>eeeeece¢ceaseeeeeeaaaeeeMll‘cae«aechaecBaeefiauHaaeaaeeae
ceasseeascueecaaeafiacea«Micaeaacaeecaeecdae«Haecmaccheeewlldeesc«meccaaaazzmflms..........
HdmmmmBOOBU¢zHAHmomwwmmaxthHUONH=0m>Honmnflmzmxx>mm2m¥ZX4IIBBZZhm9m>mqummmdadmxudzmmxdxz
Ono- II III- I I GEO: H2 H3 02

meadow
annuum
H>0Humm
coax
cuoo
Namaumm
Ncmmm
Assam
Lawson
couwm
abandon
mmmucoc
mmflucoc
ammucma
oumeoa
whoa
Anoe
owcnumm
Hound
~nmu<

meadow
Acmoom
H>maumm
comm
cuou
N>maumm
«comm
Assam
condom
nouwm
cumcwdm
mmmucoc
mmauco¢
Hmmucmd
cameos
mnoe
Amos
macnuom
about
about

.m.n annuum

83

Hm¢OH¢«a«aasuchXsamcceeXcaa«areaase>e3cceoecclscae¢a¢>caHuscaccae«caemaacmcueccchsmcau>H
HmmOHaaccsacalaxXa¢Meaecxeessaeeaaee>amae«Doualaceeea>>aeHa¢¢ssecce«camacamaeaaaqsz«meacsH
U>KmaacaaccadeZ‘deamch¢«¢«Zaoaesscc>flmcea9¢0c0cma>cca>c¢caacecsca>a«ammasmmmawcscdamafleaH
x>OnHea¢¢acacacflflesmcscossesaaaa«asa>Amcec8¢ccOeMa>m¢a>Oe2aeetmaseHeuaGM¢ZMaeaZH>«Mcmaaaaa
X>OoHaaeaacaweamdaamaeaocaacsacsaaa«>AmesexecaOcfi>>¢acas¢2¢¢aomccoH«a«mmammOa¢ZH>emamaaaca
fi>Oansccss«a«anheameacacaesaoema«ac>AS¢eccceaOa¢¢>c¢¢>a«ZecccmmcUHsc«mmummOcsZH>sOcmeH«ae
luauaaaa«chcflommxaaaacaaeaccaneccaae>cmseedssolacescs¢>saHaeeeescaascefifiasfi%ec2css2e¢c8aaH
HZ‘OqcccscccclEfifieaflcceeXcseuOccessa>asesemcsslaaescc>>achecsceasas8cfi¥t¢mascccds2amafiaaH
HmmdacaisuseOZlfiXachceasccsanacacaa>aaceuccsaleaeaaa>>aaHaeaecccsaaaemmccmacansZaZamaaacH
xmmxcaecc¢¢¥fll3¥¥sc0esacasasanec«asc>ahe¢¢c¢sslssas¢s¢>eaHcausesaa>csamicaccmessde2¢msficcH
legatosetu>¢ommmaaaxaaeaceare«aa«aas>a$aes¥eseleaaccex>aaH«acaccsmHac«agaeassaaaa«ZasaaacH
lexcaaess¢>cDXaDHecficscccaucuses«a«a«excessesalsttata2>seHsmeeaeamH«asexucasaacuEaZsacceaH
IOficeccaQa>aflMaQHeaxma«mecca«DH;asassazcceoenfllcceeaxz>ccHascecccOH«Basxcaaecs«¢2e2aaauccH
IUXaeacada>cfiXcmHaaxmaemcauacaH«acatacmaccseaalceccaxz>eaHacaaaa¢UHa8ac¥a¢sa¢aac2¢2aeecaeH
Hmmccc«aca>eZe>eaac¢¢ceQ¥sesalcaa«ae>accacaeaslscaame2>cscssccaceaH¢¢««&¢a«0¢assdsz«aa0¢«H
Handecscau>afiechaamscecaaaaaaeaaaea>eesea0ccalaaacacZ>caaaaaccaeaHue«excaaOaassAeZaaaOaaH
Handset«ae>sflcHxsscmecccxessaossasac>escaeoceelssesac2>ccaeucsssssHsc«execsOccscAs2¢a¢O¢¢H
HmDOccsscc>¢ficd¥>ewmseaaxas«auseaceascmaaaaeaslceaccs2>seasunceeeececcsxcaamaacadaZsmaUaeH
IeH«asacHasshfiEfiMceaMsasa>esanaccsce>eccacccaclcmcumccac«Heaccsssccaeeaxsaacccch¢ZaacxssH
ldmm>>w3>XAmDmN0N¢3unqmflmAAHDMEBKZ‘flH>NZNBMDNAIQKAH¢OHHO¥>QBHUBUUCAZ‘AMD‘hmeUE>Hhmwxoawm>
com Ham

useaca>na>ala¢succecmaaHsaeeaxsasegue>aeesnccaemmemaficaaca2¢s¢m9>eeceaasaeaacctddcomlaaaaa
usease>O¢>eleassesselecHsccechescxsc>csesncss«firemaficeechccsfln>e>cccsacccfleeSflAODfilacUae
ae>aeaeo>mdleaeataeaecesecdsefieDflDXeeeeHAea>=¢cuflame8¢caaaxeecuuamea>fl>eeeca«inflatmmlaccca
aseccc>DHH¢I¢>aceecstaseacnsaxecmzxuc>cHAaDs3¢sfleexcficcsea2cca0flsmss>ccasaccaccsasmmlceeec
canc¢¢>OHNOIs>acasascfiaaacseefiacMZXae>asAaOhmcHEachfimch¢2aec0Ncmea>aseschccsaOemmlcaMaa
useeea>nHmcm¢>OeaflceeBaa«aa«aficama¢a¢>ccdeecacHfic«Zefieescsxaaccaceaa>eacccecacaaOcQMlcsccs
«usecs>oczslsamseMaecccaccasagessamea>cHAchhsammcM¢Bsescarcacwnaaeaseacaeieascqozxmluzmue
easeee>a>>slcaccaasmaeeHcasceZeacaMec>¢ceaDshscNeuMaBesecaZasaHO>sacca>¢2¢¢cse2e0ac¢lacaaa
sacasc>neccle>mxsascas¢Hacscalesaexas>scaccchs=flsHmsBacase2¢ae09>ascHesoaeacacsdasawuaeeca
«aaeea>mc>eleacascameceece«use«ZmzxsaseeuaaflseaflsHeafiaeeeczccaaOcccssa>eaaccaaeedanmlccsdc
anas¢c>D>H¢I¢Amascarcea>ecs«sacssQKaa>ssceDscscasHeeccccsaxaeuen>2eacasceccecessOccfllcaUec
«useae>echlaA2¢Baamceeesaa«usec0a¥2¢>aaeenecc«flaHcaaaaeaexeascaeeaa>aaseabeacesdalflleauae
eceaaa>eHHeleqececamaaa>eec«asacoax.e>cace0ccccflaH‘Bfieacaa=>caan>mea>c>acc0ecc¢a0s¥mlaaeaa
catc¢e>eHHslcamcsaamcaa>ccceasec0fl¢ac>cccen¢scstHdfihscsea2>cacn>ma«Hs>ecc0ccces0a¥m1ecaas
«aeuac>Och¢Iee«sesameucOeceaaKeasefiaeeeeeecchesfleaaeflceceaxcaecn>cceaaeeaeaaccesOasmlcsaax
«aaeaa>ochslaflexceeccae0scssaXaaH{XeseesacceacsflcHssheceae!¢cscfls>sesaItsceeeassasemlaeaeu
«aaaae>aehalcaaaasecaceasesacxaeHskecaaeescecccflsHscBecaaaSeeecDe>acaucusesceeeeasemleaeea
«casec>D>h¢l¢AaaacceacsOccaccxa>H«aceeccacccescfiacc«BasesaxaeccasHeeassessescasadcemlaea«a
ccaaeceoHchcasaccessesuse«asasacQXes>ccecDHZee¢eH‘tBecescacecaceZen>e>aeeaasee00ucm1ceeae
ZOAmUxHMQBmIUHmqmoqaomZAeozmmmmm>00hwHK>>Aflh¥0>>D>BmmmaudmnudxazHH‘UAMHSMU>QA0Q>SOfl>lm4¢hm
Cam I I I a HNh

«combm
acomnm
H>mauom
mowm
cuoo
«>mauom
«comm
Hcomm
cmosqm
couam
noocwdm
ammucmc
mmflucma
ammucme
ouoeoa
«boa
Haas
oacsumm
about
«noum

«comnm
Acomnm
H>mauom
moam
cuoo
«>mauom
«comm
Acomm
cmosvm
couam
coocwmm
nmwucoc
m«aucm¢
HNMucmd
ouoan
«n09
anoa
oacsumm
about
«nou¢

.m.n ausmwh

84-

..Ao no as
..Ao mm as
..«o um Aono>ax
..«o «0 mono
.AamnmEoo oco au3oo
..«o no unocnom
..Ho um concmo
..~o «0 «mom
..~o no mess
..«o as ccoemauh
.msuouom oco ummuoum

..«o um mamom>ramwcom
..Ho um umumcoso>
..~o um umumcu=o>

.om oco uonzocoaom

..«o um .mcmco

..Ho um ouOmzouo

«SeAZZOHDcUdccsceeeaaasacscas?dscfiomml¢2cea«Bdrmafiscc>cafiaasllm
a3¢d2208fla0flseeeeaaaaasausaacfidsafiommldz«caefiqsmaaeae>a¢maksllm
u>eUeXDADaUcsceUeKcBOflAe‘eeas>AcaBfla«Defleflsccd>0ca>m¢>0£madnmmm
e>H¢wz<ZDaXaccaesfiasefisu¢cuaccdacanlccaflc>accfl>msa>ac>0«&¢comma
s>>amz¢SDeX¢ccaeaMHescaeeasesagsa89leUafla>sucfl>csfi>aa>aaXs«all!
cmHaMZ‘ZQeXesccesch{gustscascdssfifllaUamc>sdaflsnefi>cs>¢h¥¢aommm
c>eAcZasDaUaeeaaacaaaasaccaeaBecamOmMIflflcqcaasoccfiaca>wc0a«all!
«>«AcZOanUAcccccas«cassettesBAscBGmmlflqs>aa¢A¢maEssa>csmc«slim
s>edMZsBoe2a«use«ceaseaudioaasflaafiflfidldflesuaechchaa>semcsallm
asHAmZeHOcheascqmaemflacmcflecedec>oamlcflcaceedemcmafle>a«Mecallm
saunas;aDhUacncacacaesacaacsaBQss>0Q0l>€e>sDanMssca«cockscalla
«csdaaaanaueaeeececaeaeaaaeccadc¢>mmmlmmc>coafla0aascanaXcmallz
asc40¢c>ne01aaeeceaaeeeaeeccafiflca>mwclmmc>cneua392aec>naxaflallz
asa40s¢>ns0c¢ccacea«atsauceaaedsa>mm010ma>saa>eXaZcaa>0axsmalln
c>edflcaa0s0e«eccaZHaasaeuseaasAcaBBmmlmflecaecqamcfi>csassMsaOllB
a>¢flmnccna0caseac2csca«asusea«AscfifimmlmfiseessqscaaaccH«axesalla
a>sdmascasesaasceasea«ceaseasaflaafifimmlmflsaeaaqea«assaneaxaaells
c>¢amncuDaUsuecaneasacacssacena«Bacalmqacasefl>ec9.cccaa&ccalla
caenaae>ea0¢ccacacdaas«aaccassqaemflaM«cflsaaeafl>a«Busaacamsaalla
hHAhDNXHzwaxxmazm0>¢h0HzmmmuudxddflmunfluomHENGEH‘flmHmUBmM430mllx
mwm I I Hom

«combm
Hcombm
Hhmauom
mowm
cuoo
«amauom
«comm
«comm
cmoaqm
couwm
coocwmm
nmmucoo
mmaucmo
Hunucoo
ouoeoa
«nos
Amos
owcsumm
aboum
«bond

.m.n 0&50wm

85

isolated for comparison. Agnr125 and Agnr321 have highly homologous
sequences in the 3'-untranslated region. Of the nine Agnr1 clones sequenced,
Agnr125 had the longest 3' end and the only putative polyA tail. The 3'-
untranslated sequences of the three Agnr3 clones are shown in Figure 3.6.
Agnr321 had the longest sequence, but two shorter clones also carried putative
polyA tails. However, the putative polyadenylation signals were not always
obvious.

Subcloning DNA fragments from A. githago NR clones. Because of the
high sequence homology between the three A. githago NR clones, smaller DNA
fragments that might be gene specific for differentiating the NR mRNAs were
subcloned. Figure 3.7 shows the locations chosen for obtaining subclones
surrounding the hinge 1 region and Table 3.2 shows the nucleotide sequence
homology between the subclones. The sequences of the subclones are
identified in Figure 3.5. Agnr1-1 and Agnr3-1 shared very high homology and
therefore could not be used as gene-specific probes. Agnr2-1 had less
sequence homology and under stringent conditions did not cross-hybridize

appreciably with the other two NRs (discussed in more detail in Chapter 4).

86

Agnr321 IfiAGAGATTAGCCCACTTAATTTATTCTTAAATTTGGTTAATTAATTAATAA

Agnr324 IEA*************************************************
Agnr319 IfiA*************************************************

Agnr321 TAATTTAAAAAATCTATTACTTATAATATTTATGTTATTGAAATTGTATATG

Agnr324 ****************************************************
Agnr319 ****************************************AAAAAAAA

Agnr321 TTATTTTAATTAATTTGGATTTTTAAGTTGGTTTATTTATGTACATATATAA

Agnr324 ****************************************************

Agnr321 AAAGAGTATATTTTGTAGTTTTCGTGTTTTAAATGAAAGTACAAGGAAGAAA
Agnr324 ******************************AAAAAAAAAAA

Agnr321 TTCCTATGTGTGAAGGTTATAGCTAAAAAAAA

Figure 3.6. The 3'-untranslated regions of three A. githago Agnr3 cDNA clones.

The 3'-untranslated regions of three A. githago cDNA clones corresponding to Agnr3
are compared. A fourth clone had the same 3'-end as Agnr321. Asterisks
represent identical nucleotides to Agnr321. The stop codons are underlined.

87

 

 

 

Molybdenum Hinge 1 Heme
Agnr1-1 171 bp
Agnr2-1 144 bp
Agnr3-1

 

245 bp

Flgure 3.7. The location and lengths of three A. githago NR subclones.

DNA fragments surrounding the hinge 1 region were subcloned from the three A.
githago nitrate reductase clones in an attempt to generate gene-specific probes.

88

 

Table 3.2. Nucleotide sequence homology of three A. githago NR subclones.

The sequence homology is calculated as a percentage of perfect matches between
the subclone (Agnr1-1, AgnrQ-1, Agnr3-1) and the cDNA clones over the length of
the subclone.

 

 

% Homolggy
Agnr1 Agnr2 Agnr3
Agnr1-1 —— 77 95
Agnr2-1 78 —— 78

Agnr3-1 95 so -—-

 

89
DISCUSSION

Three A. githago NR partial cDNA clones that show high sequence
homology to other plant NRs have been isolated. The greatest homology
between A. githago and the seventeen NR sequences available was to spinach,
which is in agreement with spinach being the most closely related of these
plants to A. githago, both in the order Caryophyllales. Agnr1 and Agnr3 show
very high sequence homology to each other in the coding and 3’-untranslated
regions. A. githago is a tetraploid plant (2n=48; Firbank, 1988). While the
origin of this species is unknown, it has been suggested that A. githago may
have arisen as a polyploid of Agrostemma gracilis (2n=24; Firbank, 1988).
Agnr1 and Agnr3 may have evolved from the same A. gracilis ancestral gene,
while Agnr2 is a second NR gene. However, since there is greater sequence
homology in the 3' half of NR genes, full length clones are needed to determine
if the high sequence homology extends into the 5'-half of the genes.

There are many conserved amino acids in NR believed to be important in
enzyme activity. Figure 3.5 identifies the positions of these amino acids. In the
molybdenum domain, the cysteine is believed to be associated with the binding
of the molybdenum cofactor (Neame and Barber, 1989). One of several other
conserved cysteines in this domain may be involved in forming an interchain
disulfide bridge (Hyde et al., 1989). In the heme binding domain, ten residues
are conserved in all plant NRs and in all other members of the cytochrome b5
superfamily. The two conserved histidines are involved in heme binding (Meyer

et al., 1991). In the flavin binding domain, the histidine, cysteine, lysine, two

90

arginines, and serine/threonine are all believed to be involved at the NADH-
binding site (for a review, see Rouzé and Caboche, 1992). All of these amino
acids involved with the NR activity are also conserved in the three A. githago
clones.

Nitrate reductase is a key enzyme in nitrogen metabolism in higher plants.
The importance of NR may be reflected by the presence of more than one NR
gene in many higher plants, including the relatively small genome ofA. thaliana.
In some plants, the genes are differentially expressed in different organs. For
example, in Phaseolus vulgaris one gene is expressed exclusively in the roots,
while a second gene is expressed in the roots and leaves (Jensen et al., 1994).
In other plants such as barley, the requirement for NADH or NAD(P)H as the
electron donor biochemically differentiates between NRs (Dailey et al., 1982).
NR proteins may also be active under different pH optima (Streit et al., 1985)
or have different kinetics (Kleinhofs et al., 1988). NR activity is regulated by
both nitrate and cytokinins in A. githago embryos. The three NR cDNA clones

will be used to examine the regulation of NR by nitrate and cytokinins.

91
REFERENCES

Calza, R., Huttner. E., Vincentz, M., Rouzé, P., Galangau, F., Vaucheret, H.,
Cherel, I., Meyer, C., Kronenberger, J., and Caboche, M. (1987). Cloning of
DNA fragments complementary to tobacco nitrate reductase mRNA and
encoding epitopes common to the nitrate reductases from higher plants. Mol.
Gen. Genet. 209, 552-562.

Cheng, C.-L., Dewdney, J., Nam, H.-G., den Boer, B., and Goodman, H.
(1988). A new locus (NIA1) in Arabidopsis thaliana encoding nitrate reductase.
EMBO J. 7(11), 3309-3314.

Choi, H., Kleinhofs, A., and An, G. (1989). Nucleotide sequence of rice nitrate
reductase genes. Plant Mol. Biol. 13, 731-733.

Crawford, N. (1995). Nitrate: Nutrient and signal for plant growth. Plant Cell
7, 859-868.

Crawford, N., Smith, M., Bellisimo, D., and Davis, R. (1988). Sequence and
nitrate regulation of the Arabidopsis thaliana mRNA encoding nitrate reductase,

a metalloflavoprotein with three functional domains. Proc. Natl. Acad. Sci. USA
85, 5006-5010.

Dailey, F., Kuo, T., and Warner, R. (1982). Pyridine nucleotide specificity of
barley nitrate reductase. Plant Physiol. 69, 1 196-1 199.

Daniel-Vedele, F., Dorbe, M.-F., Caboche, M., and Rouzé, R. (1989). Cloning
and analyis of the tomato nitrate reductase-encoding gene: protein domain
structure and amino acid homologies in higher plants. Gene 85, 371-380.

Dilworth, M., and Kende, H. (1974). Comparitive studies on nitrate reductase
in Agrostemma githago induced by nitrate and benzyladenine. Plant Physiol.
54, 821-825.

Firbank, L. (1988). Biological flora of the British Isles. J. Ecology 76, 1232-
1246.

Friemann, A., Lange, M., Hachtel, W., and Brinkmann, K. (1992). Induction of
nitrate assimilatory enzymes in the tree Betula pendula. Plant Physiol. 99, 837-
842.

Gowri, G., and Campbell. W. (1989). cDNA clones for corn leaf NADH:nitrate
reductase and chloroplast NAD(P) +:glyceraldehyde-3-phosphate dehydrogenase.
Plant Physiol. 90, 792-798.

92

Hoff, T., Truong, H.-N.. and Caboche, M. (1994). The use of mutants and
transgenic plants to study nitrate assimilation. Plant, Cell and Environ. 17,
489-506.

Hoff, T., Stummann, B. M., and Henningsen, K. W. (1991). Cloning and
expression of a gene encoding a root specific nitrate reductase in bean
(Phaseolus vulgaris). Physiol. Plant. 82, 197-204.

Hyde, G., Crawford, N., and Campbell, W. (1991). The sequence of squash
NADH nitrate reductase and its relationship to the sequence of other
flavoprotein oxidoreductases. J. Biolog. Chem. 266(35). 23542-23547.

Hyde, G., Wilberding, J., Meyer, A., Campbell, E., and Campbell, W. (1989).
Monoclonal antibody-based immunoaffinity chromatography for purifying corn
and squash NADH: nitrate reductases. Evidence for an interchain disulfide bond
in nitrate reductase. Plant Mol. Biol. 13, 233-246.

Jensen, P., Hoff. T., Moller, M., Stummann, B., and Henningsen, K. (1994).
Identification and characterization of a nitrate reductase gene from bean
(Phaseolus vulgaris) containing four introns. Physiol. Plant. 92, 613-624.

Joshi, C. (1987). Putative polyadenylation signals in nuclear genes of higher
plants: a compilation and analysis. Nucleic Acids Res. 15(23), 9627-9640.

Kende. H., Hahn, H., and Kaye, S. (1971). Enhancement of nitrate reductase
activity by benzyladenine in Agrostemma githago. Plant Physiol. 48, 702-706.

Kende, H., and Shen. T. (1972). Nitrate reductase in Agrostemma githago.
Comparison of the inductive effects of nitrate and cytokinin. Biochim. Biophy.
Acta 286, 118-125.

Kleinhofs, A., Warner, R., Hamat, H., Juricek, M., Huang. C., and Schnorr, K.
(1988). Molecular genetics of barley and rice nitrate reductases. Curr. Topics
in Plant Biochem. and Physiol. 7, 35-42.

Maniatis, T., Fritsch, E., and Sambrook. J. (1982). Molecular Cloning: A
Laboratory Manual. (New York: Cold Spring Harbor Laboratory Press).

Meyer, C., Levin, J., Roussel. J., and Rouzé, P. (1991). Mutational and
structural analysis of the nitrate reductase heme domain of Nicotiana
plumbaginifolia. J. Biol. Chem. 266, 20561-20566.

Miyazakl, J., Juricek, M., Angelis, K., Schnorr, K., Kleinhofs, A., and Warner,
R. (1991). Characterization and sequence of a novel nitrate reductase from
barley. Mol. Gen. Genet. 228. 329-334.

93

Neame. P., and Barber, M. (1989). Conserved domains in the molybdenum
hydroxylases. J. Biol. Chem. 264, 20894-20901.

Ozols, J., and Strittmatter. P. (1969). Correction of the amino acid sequence
of calf liver cytochrome b5. J. Biol. Chem. 244, 6617-7718.

Prosser, l., and Lazarus, C. (1990). Nucleotide sequence of a spincah nitrate
reductase cDNA. Plant Mol. Biol. 15, 187-190.

Puissant, C., and Houdeline. L.-M. (1990). An improvement of the single-step
method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform
extraction. BioTechniques 8(2), 148-149.

Rouzé, P., and Caboche, M. (1992). Nitrate reduction in higher plants:
Molecular approaches to function and regulation. In Inducible Plant Proteins.
J. Wray, ed. (Cambridge: Cambridge University), pp. 45-77.

Salanoubat, M., and Ha, D. (1993). Analysis of the petunia nitrate reductase
apoenzyme-encoding gene: a first step for sequence modification analysis.
Gene 128, 147-154.

Sambrook, J., Fritsch. E., and Maniatis. T. (1989). Molecular Cloning: A
Laboratory Manual. (New York: Cold Spring Harbor Laboratory Press).

Sanger, F. Nicklen, S., and Coulson, A. (1977). DNA sequencing with chain-
terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467.

Schleif. R., and Wensink, P. (1981). Practical Methods in Molecular Biology.
(New York, Springer-Verlag), pp 168-172.

Schnorr, K., Juricek, M., Huang, C., Culley, D., and Kleinhofs, A. (1991).
Analysis of barley nitrate reductase cDNA and genomic clones. Mol. Gen.
Genet. 227, 411-416.

Strait, L., Nelson, R., and Harper, J. (1985). Nitrate reductases from wild-type
and nr1-mutant soybean (Glycine max [L.l Merr.) leaves. Plant Physiol. 78, 80-
84.

Vaucheret. H., Kronenberger, J., Rouzé. P., and Caboche, M. (1989).
Complete nucleotide sequence of the two homeologous tobacco nitrate
reductase genes. Plant Mol. Biol. 12, 597-600.

Wu, 8.. Lu. 0., Kriz, A., and Harper, J. (1995). Identification of cDNA clones
corresponding to two inducible nitrate reductase genes in soybean: analysis in
wild-type and nr1 mutant. Plant Mol. Biol. 29, 491-506.

94

Yubisui, T., Miyata, T., Iwanaga, S., Tamura, M., Yoshida, S., Takeshita, M.,
and Nakajima, H. (1984). Amino-acid sequence of NADH-cytochrome b5
reductase of human erythrocytes. J. Biochem. 96, 579-582.

CHAPTER 4

Cytokinin and Nitrate Regulation of Nitrate Reductases
in A grostemma githago Embryos

ABSTRACT

Northern blot analysis and reverse transcription-polymerase chain reaction
(RT-PCR) analysis were used to study the expression of the three nitrate
reductase transcripts in A. githago. All three NR clones hybridized to a 3.5-kb
mRNA. Agnr1 and Agnr3 were both regulated in a similar manner. The mRNA
levels were transiently increased up to ten fold by both cytokinin and nitrate in
a time-dependent manner similar to but preceding the induction of NR activity.
Cytokinin plus nitrate did not show an additive effect on NR Agnr1 mRNA even
when NR activities were additive. Both cytokinin and nitrate increased these
mRNA levels in both roots and cotyledons, but the increase was observed in
cotyledons earlier than in roots. The decrease in nitrate-regulated mRNA levels
over time was initially due to a decrease in levels in the cotyledons.

Agnr2 was much less abundant than were the other two NR mRNAs.
Agnr2 mRNA level was not increased by cytokinin but was increased by nitrate
predominantly in the roots. In control embryos, there were low levels of all
three mRNAs that decreased with time of incubation.

The length of seed imbibition affected the levels of the three NR mRNAs

in isolated embryos. The levels of the three NR messages in embryos isolated

95

96

from seeds imbibed for 12 h but not incubated on media were at least as great
as the maximum message levels obtained by cytokinin or nitrate incubation.
Nuclear runoff transcription studies showed that the increase of Agnr1
and Agnr3 mRNA levels by cytokinin were not due to increased rates of
transcription. The increase in these mRNA levels by nitrate was due, in part,
to increased rates of transcription. Due to the low levels of Agnr2 mRNA, it

could not be determined how expression of this mRNA was regulated.

97
INTRODUCTION

Most plants assimilate nitrogen in the form of nitrate. Because the rate-
Iimiting and regulated step of nitrate assimilation is catalyzed by nitrate
reductase (NR), much research has focussed on NR and its regulation. NR is
regulated by nitrate in all plants. NR may also be regulated by light, circadian
rhythms, C02,, reduced nitrogen compounds, sucrose, plant hormones, and a
plastidic factor (for reviews, see Rouzé and Caboche, 1992; Hoff et al., 1994;
Crawford, 1995).

Nitrate reductase cDNA or genomic clones have been identified in at least
twelve plant species (Figure 3.5). More than one gene is present in many of
these plants, including in the relatively small genome of Arabidapsis thaliana
(Cheng et al., 1988). These clones have allowed the study of NR gene
expression in these and trangenic plants.

In most plants, NR cDNA clones hybridize to 3 to 3.7-kb mRNAs. These
mRNAs are typically present at low levels in the absence of nitrate and increase
in response to nitrate and other signals. In time course experiments of nitrate
treatment, both NR activity and NR mRNA expression are transiently increased
(e.g., Kleinhofs et al., 1988; Cheng et al., 1991; Jensen et al., 1994).

It is of particular interest to determine the regulation of multiple NR genes
from the same plant. In soybean, three NR proteins are active under different
pH optima (Streit et al., 1985). In barley, e.g., the requirement for NADH or
NADPH as the electron donor biochemically differentiates between NRs (Dailey

etal., 1982). However, many higher plants have only one identified form of NR

98

protein but more than one NR gene. In several plants, the genes are
differentially expressed in different organs. In Phaseolus vulgaris, e.g., one
gene is expressed exclusively in the roots (Hoff et al. , 1991), whereas a second
gene is expressed in the roots and leaves (Jensen et al., 1994). In rice and A.
thaliana, two NR genes are expressed with very different kinetics (Kleinhofs et
al., 1988; Cheng et al., 1991).

The mechanisms of regulation of NR are being examined. Nuclear runoff
transcription studies have shown at least partial transcriptional regulation of NR
by nitrate in soybean (Callaci and Smarrelli, 1991) and corn (Lillo, 1991), and
transcriptional regulation by cytokinin in barley (Lu et al., 1990). The circadian
rhythms in A. thaliana were shown to be post-transcriptionally regulated
(Pilgrim et al., 1993). Studies using transgenic plants or mutants have shown
multiple levels of regulation. Nitrate may regulate gene expression at the
transcriptional or post-transcriptional levels. Light may regulate gene
expression at the transcriptional, post-transcriptional, or post-translational
levels. Circadian rhythms may regulate expression both transcriptionally and
post-transcriptionally, whereas sucrose regulates at the transcriptional level (for
reviews, see Rouzé and Caboche, 1992; Hoff et al., 1994; Crawford, 1995).

Cytokinins have been shown to regulate gene expression both at the
transcriptional and post-transcriptional levels (see Chapter 1). In barley,
cytokinins have been shown to regulate NR expression, at least partly, at the
transcriptional level (Lu et al. , 1990). The goal of this work was to examine the

expression of the three A. githago NR genes in time-course experiments and in

99

specific tissues of the embryos as influenced by nitrate and cytokinin.
Regulation by nitrate and cytokinin was examined with nuclear runoff
transcription experiments to determine whether regulation was at the

transcriptional level.

100
MATERIALS AND METHODS

Plantma terial, Incubation procedures, Tissue ex tracton, NA DH-NR assa y,
Radiolabe/Iing probes, and other Standard molecular biological methods. See
Materials and Methods, Chapter 3.

RNA extraction. Total RNA was extracted as described in Chapter 3.
The RNA was DNAse I treated to remove any DNA that could interfere with the
reverse transcription-polymerase chain reaction (RT-PCR) analysis.

Reverse transcription-polymerase chain reaction. A non-degenerate
oligonucleotide common to all three A. githago NR clones was synthesized and
used as the 5' primer in RT-PCR amplification of all three NR mRNAs. HK52
(5’-TGGTGTTTTTGGTCATTAGAAGT-3’) overlaps the degenerate
oligonucleotide HK35 (see Chapter 3 for location) and has a similar melting
temperature as the gene-specific oligonucleotides used as 3’ primers. PCR
amplification with HK52 and the gene-specific oligonucleotides HK38, HK39,
or HK76 (sequences in Materials and Methods, Chapter 3) generates a 286-bp
DNA fragment. RT-PCR amplification from the sense RNAs transcribed from the
three NR cDNA clones (Agnr1, Agnr2, Agnr3; Chapter3) was used to determine
optimum conditions and show specificity of the gene-specific oligonucleotides
in RT-PCR amplification. RNA was reverse transcribed into cDNA with the NR
gene-specific oligonucleotides. A 33.5 pl mixture containing varying amounts
of total RNA in 10 pl, 1-20 pl internal standard (see below), and 0.82 pg gene-
specific oligonucleotide (HK39, HK38, or HK76) was incubated at 65°C for 5

min and then cooled on ice. Following this, 14 U RNAsin RNAse inhibitor

101
(Promega, Madison, WI) and 100 U M-MLV reverse transcriptase (Gibco BRL,

Gaithersburg, MD) were added to the cDNA in a total volume of 50 pl
containing 0.5 mM of each dNTP, 50 mM Tris-HCI (pH 8.3), 75 mM KCI, 10
mM DTT, and 3 mM MgCl2. This mixture was incubated at 37°C for 1 h and
the reaction stapped by incubation at 95°C for 10 min. Ten pl of the RT
reaction was used in a 50 pl PCR reaction. A 50 pl PCR reaction was run in
standard PCR buffer containing 1 pM HK52 and 1 pM of the gene-specific
oligonucleotide under the following conditions: 3 min at 94°C and then 22
cycles of 1 min at 94°C, 2 min at 63°C, and 2 min at 72°C. In the last cycle
the extension time was prolonged to 9 min. Ten to 20 pl of the reaction
mixtures were separated in 1.2% agarose gels, blotted onto Hybond N+ nylon
membranes (Amersham, Arlingon Heights, IL), and the membranes were baked
at 80°C for 1 to 2 h. Controls without reverse transcriptase added were
always performed in parallel to check for contamination from the RNAs or stock
solutions.

Southern blots were hybridized with the 495-bp random-primed labelled
insert of Agpcrl (Chapter 3) or end-labelled HK40 (a non-degenerate internal
oligonucleotide common to all three A. githago NR clones: 5'-
TGTGTTCGAGCATCCGAC-B'). Autoradiography was performed using
Hyperfilm-MP (Amersham). The signals were quantitated with a
phosphorimager (Molecular Dynamics, Sunnyvale, CA). Experiments were
repeated two to three times with each set of RNAs.

Cross-hybridization of A. githago NR clones. Because of the high degree

102

of sequence identity between the NR clones, smaller DNA fragments
surrounding the hinge 1 region were subcloned for all three NR clones,
corresponding to Agnr1-1, Agnr2-1, and Agnr3-1 (see Figure 3.7 and Table
3.2). Sense strand RNAs were produced by in vitro transcription from the
Agnr1 and Agnr2 (Chapter 3) linearized plasmids. The templates were removed
by DNAse l digestion. The RNAs were extracted, precipitated, suspended in
water, and their concentrations were measured. Equivalent amounts of sense
RNAs were serially diluted, blotted, and hybridized with antisense RNA probes.

RNA probes. Agnr1-1, Agnr2-1, and Agnr3-1 were linearized by
digestion with EcoRI, Xbal, or Xbal, respectively. T7 or T3 polymerase was
used to synthesize antisense radiolabelled RNA probes from the linearized
templates using [32]PUTP, 800 Ci/mmol (New England Nuclear). Probes were
DNAse I treated to remove the DNA template.

RNA blot analysis. Total (Figure 4.8) or polylA)+ (Figure 4.6) RNA was
separated on 1% agarose-formaldehyde gels. 'Ethidium bromide staining of the
ribosomal bands was used to confirm equal loading of total RNAs. RNA was
transferred to Hybond N nylon membranes (Amersham). The membranes were
baked at 80°C for 1 to 2 h and prehybridized at 65°C in 5X SSPE, 10X
Denhardt’s solution, 0.5% SDS, 0.25 mg/ml salmon sperm DNA, and 50%
formamide (20X SSPE: 3.6 M NaCl, 0.2 M sodium phosphate, 0.02 M EDTA,
pH 7.7). 32P-labelled antisense strand RNA probes were hybridized at 65°C in
the above prehybridization buffer. The final wash of the filters was in 0.2X

SSC, 0.1% SDS at 65°C.

103

Internal Standards (IS). Controls containing the same primer sites as
target mRNAs but generating different size DNA fragments from RT-PCR were
constructed. For |Sl and IS3, DNA fragments that spanned an intron were PCR
amplified from genomic clones (Chapter 5) with HK52 and the gene-specific
oligonucleotide (HK39 or HK76) and ligated into the Smal site of pBluescript SK'
. I82 was generated by using an Agpcr2 (Chapter 3) clone that was missing
part of the 3’ sequence. This clone was linearized by digestion with Smal. The
Smal restriction site lies between HK52 and the gene-specific oligonucleotide
HK38. A 300-bp unrelated DNA sequence was ligated into this Smal site to
change the distance between HK52 and HK38. This larger insert was released
from pCRll by digestion with EcoRI and was ligated into the EcoRI site of
pBluescript SK'. Each of the IS clones was linearized and sense strand RNAs
were synthesized and added to the RT-PCR reactions as internal standards.
Test experiments were done to determine the amounts of internal standard
RNAs needed to produce PCR products in similar amounts as the target mRNAs.
|Sl , ISZ, and IS3 generate DNA fragments from RT-PCR of approximately 1 100
bp, 586 bp, and 1200 bp, respectively.

Preparation of nuclei. Nuclei prepared from 1.5 to 2.0 9 embryos were
suspended in 20 ml of nuclear suspension buffer A and 0.5% Triton X-100
(buffer A: 20 mM MES buffer, pH 5.7, 2.5% Ficoll 400, 2.5% dextran 40,000,
50 mM KCI, 0.44 M sucrose, 0.5 mM EDTA, 1% thiodiglycol, 0.5 mM
spermidine, 0.1 mM spermine, 5 pg/ml aprotinin, 1 mM phenylmethylsulfonyl

fluoride, 5 pg/ml leupeptin). The nuclei were consecutively filtered through 4

104

layers of cheesecloth, 2 layers of miracloth, and a 20 pm filter. The nuclei were
collected by centrifugation for 15 min at 2500 rpm in an HB-4 rotor (Du Pont
Sorvall, Wilmington, DE), resuspended in 5 ml buffer A, and applied to a Percoll
gradient. The gradients consisted of 5 ml each of 1.8 M sucrose, 80% Percoll,
and 60% Percoll (pH ~ 6.0 in buffer A). The gradients were centrifuged for 20
min at 5000 rpm in an HB-4 rotor, and the nuclei were collected from the 80%
Percoll/1.8 M sucrose interface. (The nuclei from the 60%/80% Percoll
interface were much fewer in number and therefore discarded.) The nuclei
were washed with buffer A plus 50% glycerol to remove the Percoll and
centrifuged for 10 min at 3000 rpm in an HB-4 rotor. The nuclei were counted
with a hemocytometer and the volume adjusted such that 50-pl aliquots,
containing 1 to 3 X 10° nuclei, could be stored at -80°C. All treatments were
performed at 0 to 4°C. The nuclei yields were 2 to 4 X 10° nuclei/g tissue and
>95% of the nuclei appeared intact.

Transcription in isolated nuclei. The reaction mixture for in vitro nuclear
runoff transcription contained: 100 mM Hepes buffer, pH 7.9, 50 mM MgCl2,
500 mM (NH4IZSO4, 20% glycerol, 2 mM DTT, 100 pM ATP, GTP, CTP, 150
pC [32]PUTP (3000 Ci/mmol, New England Nuclear), 72 units of RNAse inhibitor
(Boehringer Mannheim Biochemicals, Indianapolis, IN), and 50 pl nuclei in a total
volume of 100 pl. The reaction was incubated at 30°C for 20 min and then
treated with DNAse I for 5 min. The transcribed RNA was phenol extracted,
precipitated, suspended in water, and counted in a scintillation counter. The

reaction mixture typically contained 1 to 3 X 10° nuclei and yielded 1 to 2 X

105

10° cpm incorporated into RNA. All treatments were performed under RNAse-
free conditions. The transcriptional competence of each of the nuclear
preparations was tested by measuring the incorporation of [321PUTP at 5-min
intervals during the transcription reaction. One-pl aliquots of the transcribed
RNA were spotted in duplicate onto DE81 filters and incorporated counts
determined according to Maniatis et al. (1982).

DNA slot blot hybridization. To quantitate levels of NR transcript
produced in the nuclear runoff assays, hybridizations were carried out in DNA
excess by applying 5 pg of linearized Agnr1, Agnr2, and Agnr3 plasmid DNA
(Chapter 3) to nitrocellulose using a slot blot apparatus (Bio-Rad, Hercules, CA).
Linearized pBluescipt SK' and pRl_5 were used as negative and positive controls,
respectively. pRL5 is a pBluescript plasmid containing a 1.2 kb insert coding
for a rice ribosomal 58 RNA-binding protein (Kim and Wu, 1993). Blots were
prehybridized in 5X SSC, 10X Denhardt’s solution, 0.1 M potassium phosphate,
pH 6.8, 100 pg/ml salmon sperm DNA, 10% dextran sulfate, and 30%
formamide for at least 24 h at 51 °C. Blots were hybridized in the same buffer
with equivalent counts from each transcription assay, typically 40 to 100 X 10°
cpm, for at least 48 h at 51 °C. The negative controls typically gave no signal,
and relative amounts of NR mRNAs were related to the signals from the positive
control. Two to three experiments were done with each set of nuclear

preparations.

106

RESULTS

Cross-h ybridization of A. githago nitrate reductase clones. Because of
the high sequence homology between the three nitrate reductase cDNA clones,
smaller DNA fragments surrounding the hinge 1 region were subcloned in an
attempt to generate gene-specific probes (Chapter 3). Using in vitro transcribed
sense RNAs from Agnr1 and Agnr2, it was determined that Agnr1-1 and Agnr2-
1 antisense RNA probes showed less than 1% cross-hybridization (Figure 4.1)
and Agnr2-1 could be used as a gene-specific probe. Agnr1-1 and Agnr3-1
showed 10% cross-hybridization (data not shown) and could not be used as
gene-specific probes.

Regulation of NR mRNAs.

RT-PCR. Because it was not possible to differentiate between all three
NR clones, and because the NR mRNA levels were of low abundance, RT-PCR
analysis was used to study the regulation of NR mRNAs in A. githago. The
gene-specific oligonucleotides (HK39, HK38, HK76, Chapter 3) were used for
priming the reverse transcription reactions, as well as for PCR amplification.
Synthetic RNAs served as internal standards for both reverse transcription and
PCR amplification. The internal standards contained the same primer sequences
as the target mRNAs but yielded PCR products of different sizes. The addition
of the internal standards to each RNA sample also served as controls for
sample-to-sample and tube-to-tube variations. RT-PCR analysis, illustrated in
Figure 4.2, allowed for the relative quantitation of target mRNAs.

An example of how mRNAs were quantitated is shown in Figure 4.3.

107

 

100104162163
A nr1
9 .-
Agnr2 . .
B

O - - -
10 101102103
Agnr2 ~ g .

Agnr1 ‘C. .o, _

 

 

 

Figure 4.1. Cross-hybridization of Agnr1-1 and Agnr2-1.

The cDNA clones Agnr1 and AgnQ (Chapter 3) were used to produce sense
strand RNAs by in vitro transcription. Equivalent amounts of sense RNAs were
serially diluted, blotted, and probed with [32Pj-labelled antisense RNA prepared
from either (A) Agnr1-1 or (B) Agnr2-1.

108

 

linearized IS1 cDNA

in vitro transcription

Total cellular RNA + IS1 synthetic sense RNA

reverse transcription with HK39

cDNA of target mRNA + cDNA of synthetic RNA

PCR with HK52 and HK39

286 bp PCR product + 1100 bp PCR product

 

 

 

Figure 4.2. Schematic representation of RT-PCR.

An example of RT-PCR analysis is shown. An internal standard (IS1) containing
the same primer sites as the targeted mRNA is generated by in vitro transcription
from a linearized plasmid DNA. The IS1 RNA is added to the total RNA in various
amounts, and both are reverse transcribed using the gene-specific oligonucleotide
HK39 as primer. A fraction of the synthesized cDNA is amplified by PCR,
resulting in amplified products of 286 bp from the total RNA and 1100 bp from the
IS1 RNA.

109

Figure 4.3. Quantitative analysis of NR mRNA by RT-PCR analysis.

(A) Ethidium bromide staining of PCR products separated in 1.2% agarose. Total
RNAs isolated from embryos incubated for 4 h in water (C), 5 pM BA (B), or 50 mM
nitrate (N) were analyzed. 1, 2, 10, or20 pl of |Sl sense RNA was added to 0.5 pg
of total RNA for RT-PCR analysis. The sizes of the NR products and the IS1
products are 286 bp and 1100 bp, respectiver M=molecular weight markers, bp.
(B) The gel in (A) was blotted and hybridized with the random-primed labelled insert
of Agpcr1 (Chapter 3). The autoradiogram of this filter is shown. (C) Relative
signal intensities were quantitated using a phosphorimager, and the relative
abundances of NR and IS1 signals were plotted against amount of IS1 RNA added
to the reaction. Lines and intercepts were determined by linear regression.

110

 

 

 

 

 

 

 

 

 

 

 

 

 

M 121020 121020 121020 pl
1093-
805—
339-
M 121020 121020 121020 pl
1093— '0 O. " "
805—
339- .. --- - c n o
8.8 3.6 17.2
BA .Control Q U /
120 * ,0 _

8

 

Relative Abundance
8

 

  

 

 

 

 

 

 

 

O
O

5 '10 15 20 0 5 to 15 20
lntemal Standard (pl) Internal Standard (pl)

 

O lntemal Standard
0 NR RNA

 

 

 

o E. to 15 20
lntemal Standard (pl)

Figure 4.3. Quantitative analysis of NR mRNA by RT—PCR analysis.

25

111

Varying amounts of internal standard RNA were added to a defined amount of
total RNA for each sample analyzed. RT-PCR was performed and an aliquot
was separated on an agarose gel (Figure 4.3A). The gel was blotted, hybridized
with the necessary probe (Figure 4.33), and signals quantitated with a
phosphorimager. The relative signal intensities from both the target and the
internal standard DNA products were plotted against the amount of internal
standard RNA added (Figure 4.3C). The intercepts of the linear regression lines
were used to determine the amounts of target mRNA in the samples relative to
the amount of internal standard.

Since PCR amplification is an exponential process, the first step was to
determine the optimum number of cycles for PCR amplification. Based on
published results (Chelly et al., 1988; Wang et al., 1989; Simson et al., 1992;
Chang etal., 1993), 16-30 cycles, in increments of two cycles, were tested for
the amplification of target mRNAs. The amounts of products were
exponentially related up to 26 cycles before reaching a plateau (data not
shown), and 22 cycles were chosen for all other experiments.

Another requirement for RT-PCR analysis is that the amounts of RNA
used are linearly related to the amount of amplified DNA obtained. Initial
experiments using serial dilutions of RNA helped to determine the amounts of
total RNA needed to remain within a linear range. Within this range, 2 to 3
concentrations of RNA were tested in RT-PCR. One example of this is shown
in Figure 4.4. The addition of 5 times the total RNA resulted in 5 times the

relative signal. Each time new RNA was isolated, random samples were tested

112

 

 

 

 

 

 

 

2,500
8 0 NR RNA, 1 pg Total RNA
5 2.000 _ e lntemal Standard 0
'8 .
3 1,500 -
<
"g: 1,000 -
E 500 O O
a) ..
tr 2.3 O
0 . l I 1 4L
0 5 10 15 20 25
lntemal Standard (pl)
3,000
0 NR RNA, 5 pg Total RNA
2:3 2,500 - e lntemal Standard 0
to
'2 2,000 ~
3
.o
<1: 1,500
m
1% 1,000 -
_ 14.1
5'; 500 -

 

 

 

 

 

o0 5 10 15 20 25

lntemal Standard (pl)

Figure 4.4. RT-PCR with varying amounts of total RNA.

Agnr1 and IS1 RNAs were amplified by RT-PCR. Either 1 pg or 5 pg of total RNA
was analyzed. Ten pl of the PCR reaction was separated by agarose gel ”
electrophoresis, blotted onto Hybond N nylon membrane, and probed with the
random-primed labelled insert of Agpcr1 (Chapter 3). Relative signal intensities
were quantified on the phosphorimager, and the relative abundances of NR and
IS1 signals were plotted against the amount of IS1 RNA added to the reaction.
Lines and intercepts were determined by linear regression.

113

in this manner over a five to tenfold range. The results not only showed that
the amounts of RNA used were linearly related to the amounts of amplified DNA
obtained, but they also indicated there were no contaminants in the RNA
samples that might have interfered with the RT-PCR analysis.

Time-course experiments, NR activity was regulated by cytokinin and
nitrate in a time-dependent manner, and a combination of cytokinin plus nitrate
showed an additive effect on activity (Figure 4.5). This additive effect was not
always seen for time points beyond 12 h, however. Kuznetsov (1979) also
observed an additive effect on NR activity in A. githago embryos by cytokinin
and nitrate for early time points but not for later time points and suggested that
carbohydrate starvation was responsible for experimental data that were below
the expected values. Variations between seed lots and experimental variations
showed differences in the increase in NR activity, but overall the trends were
always the same. Nitrate-enhanced NR activity increased within 2 h, peaked
at 6 to 12 h, and declined quite rapidly thereafter. Cytokinin-enhanced NR
activity typically did not increase until 6 h, peaked at 12 to 18 h, and stayed
more elevated than did nitrate-enhanced NR activity after 24 h. The increase
in NR mRNAs was expected to precede the increase in NR activity and to be
transient. Therefore, 6, 12, and 18 h of treatment were examined in initial
experiments.

Because of cross-hybridization, northern blot analysis with the Agnr1-1
RNA probe detects both Agnr1 and Agnr3 mRNAs (see p. 106). Northern blot

analysis showed a transient increase in Agnr1 +Agnr3 mRNA levels by both

114

 

 

 

 

 

 

 

 

 

 

 

 

80
,S‘ + Control
'0 70 r c 3A
3‘ 60 _ e- Nitrate
0E: 96 BA+Nitrate
3‘ .— '
'5 1c 50 ’
'5' -
< E 40 A
0: .9 30 _
Z
ION
z 20 r
_ 0
g 10 ~
5 ~-
0 I l l l l l I I

III)
0 2 4 6 81012141618202224

Embryo Treatment (h)

Figure 4.5. Time course of nitrate reductase activity.

Seeds were imbibed for 12 h at RT. The embryos were then isolated and
incubated at 30°C in water (control), 5 pM BA, 50 mM nitrate, or 5 pM BA plus 50
mM nitrate for the indicated times. Each point represents the average of
triplicate samples, 4 embryos per sample.

115

cytokinin and nitrate treatments (Figure 4.6). The level of Agnr1+Agnr3
mRNAs decreased faster with the nitrate treatment than it did with the
cytokinin treatment. A low level of Agnr1 +Agnr3 mRNAs was present in the
controls and decreased with time. A cytokinin plus nitrate treatment did not
show an additive effect on the Agnr1 +Agnr3 mRNA levels, which was
observed in two similar experiments. The zero time point showed a relatively
high level of the mRNAs (139%) even though NR activity was low. A similar
experiment with Agnr2 showed only very weak signals in the control, 6 h
nitrate, and 6 h nitrate plus cytokinin (data not shown).

Based on these results, RT-PCR analysis was performed on embryos
treated for 2 to 12 h (Figure 4.7). Agnr1 and Agnr3 showed similar results in
two experiments. Nitrate-regulated mRNA levels increased by 2 h, peaked at
about 4 h, and decreased to near control levels by 12 h. Cytokinin-regulated
mRNA levels increased by 2 h, peaked at 4 to 6 h, and decreased by 12 h but
still remained at 3 to 5 times the control level. Cytokinin and nitrate enhanced
Agnr1 and Agnr3 mRNA levels a maximum of 8 to 10 times. The mRNA levels
at the zero time point were relatively high, while the mRNA levels in the isolated
embryos incubated in water were low and decreased with time. Northern blot
analysis with total RNAs from one experiment using the Agnr3-1 RNA probe
showed similar results as the RT-PCR analysis for Agnr1 and Agnr3 mRNAs
(data not shown).

Localization of NR mRNAs. Enhancement of NR activity by cytokinins is

localized primarily in the cotyledons, whereas enhancement by nitrate is

116

Figure 4.6. Northern blot analysis of Agnr1 and Agnr3 mRNAs in A. githago
embryos.

(A) Time course of NR activity (see Figure 4.5 legend). (B) poly(A)“ RNA was
isolated from embryos analyzed in (A). Five pg RNA was separated by
electrophoresis on a 1% agarose-formaldehyde gel, blotted onto Hybond N
nylon membrane, and hybridized with Agnr1-1 RNA probe (Chapter 3). The
autoradiogram was exposed for 4 d with two intensifying screens at -80°C. (C)
Relative signal intensities were quantitated using a phosphorimager and plotted
as percent relative abundances. The signal from the 6 h of BA plus nitrate
treatment was set at 100%. The signal from the zero time point had a relative
abundance of 139% (data not plotted). Because of cross-hybridization, the
Agnr1-1 probe detected Agnr3 mRNA as well as Agnr1 mRNA.

117

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

A 140
FA + Control
'0 120 - -.— BA
5 100 _ 4+ Nitrate
3. GE) .34 BA+Nitrate
I; '7: 80 —
2 B so .
o: E
Z .9 40 ..
1 or
(z3 20 _
‘o
0 l l 1
E O 6 12 18
Embryo Treatment (h)
B o 6 12 18 (h)
Control ' .
BA
NItrate ” “
BA+Nitrate a.
C
$3 100 [:1 Control
‘5; [3 BA
2 Q 80 , - Nitrate
(0 g, BA+Nitrate
.o .-
< E) 40
9 <
'13 20
E’ o
6
Embryo Treatment (h)w - _

Figure 4.6. Northern blot analysis of Agnr1 and Agnr3 mRNAs in A. githago
embryos.

118

 

 

+ Control

 

 

 

 

 

2

 

 

NR Actrvrty
(nmol NO' formed h‘lembryo")

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

o l l l l L l I
o 2 4 6 8 1o 12
Embryo Treatment (h)
2% 100 — E] Control
8 — .' 3‘
Nitrat
6 so - °
2 t
a a eo~
< <
9 40 *
E
m 20 -
o:
O 523 555 352 225
o 2 4 6 8 1o 12
Embryo Treatment (h)

Figure 4.7. Quantitative analysis of Agnr1 mRNA in A. githago embryos.

(A) Time course of NR activity (see Figure 4.5 legend). (B) Total RNAs were
isolated from embryos analyzed in (A) and 0.5 pg was used for RT-PCR analysis of
Agnr1 mRNA. Percent relative abundance is plotted. Agnr1 and Agnr3 showed
similar results in two experiments. Similar results were seen by Northern blot
analysis with an Agnr3-1 RNA probe and 20 pg total RNA.

119

localized in both roots and cotyledons (Table 2.1). The localization of the NR
mRNAs was also examined. Cytokinins ususally increased NR activity by 6 h
(Figures 4.6, 4.7) or later, but increased NR mRNA levels by 2 h (Figure 4.7B).
Therefore, when NR mRNA levels were examined in cotyledons and roots at 2
and 4 h of treatment, nitrate had increased NR activity in cotyledons and roots,
but cytokinin had not increased NR activity yet (Figure 4.8A). Unlike NR
activity, cytokinins increased Agnr1 and Agnr3 mRNA levels in both roots and
cotyledons, with the increase in cotyledons observed sooner than that in roots
(Figure 4.8C, D). Nitrate also increased Agnr1 and Agnr3 mRNA levels in
cotyledons earlier than in roots. The nitrate-regulated mRNA levels in the
cotyledons started to decrease by 4 h, perhaps responsible for the decrease in
nitrate-regulated mRNA levels in the embryos. This would agree with earlier
experiments showing that the decrease in NR activity was due to a loss of
activity in the cotyledons (Table 2.1). Northern blot analysis (Figure 4.8C) and
RT-PCR analysis (Figure 4.8D) showed similar results.

Agnr2 mRNA levels were regulated by nitrate but not cytokinins.
Northern blot analysis with total RNAs from 6, 12, and 18 h of treatment
showed only weak signals in the control, 6 h nitrate, and 6 h nitrate plus
cytokinin treatments using the Agnr2-1 RNA probe (data not shown). Nitrate
regulation was localized predominantly in the roots (Figure 4.9). Although the
overall level of Agnr2 mRNA was much lower in the cotyledons, some
regulation by nitrate may also be present in the cotyledons.

The effect of imbibition time on NR mRNAs. Seeds are typically imbibed

120

Figure 4.8. Quantitative analysis of Agnr1 and Agan mRNAs in roots and
cotyledons of A. githago.

(A) Seeds were imbibed for 12 h at RT. The embryos were then isolated and
incubated at 30°C for 2 or 4 h in water (control), 5 pM BA, or 50 mM nitrate.
Embryos were then separated into cotyledons and roots. Results represents the
average of triplicate samples, 8 cotyledon pairs or 8 roots per sample. (B) Total
RNA was isolated from cotyledons and roots from (A). Twenty pg of total RNAs
were separated on a 1% agarose-formaldehyde gel. The gel was blotted onto
Hybond N nylon membrane and hybridized with the Agnr3-1 RNA probe (Chapter
3). The autoradiogram was exposed for 14 d with two intensifying screens at
-80°C. The size of the hybridizing band was 3.5 kb. C=water control; B=5 pM
benzyladenine; N=50 mM nitrate. 2 and 4 represent h of treatment. c=cotyledons;
r=roots. (C) The autoradiogram from (B) was quantitated using a phosphorimager
and signals plotted as percent relative abundance. Because of cross-hybridization,
the Agnr3-1 RNA probe detected Agnr1 mRNA as well as Agnr3 mRNA. (D)
RT-PCR analysis of Agnr1 mRNA using 0.5 pg of each total RNA from (A). Percent
relative abundance is plotted. Similar results were seen with RT-PCR analysis of
Agnr3 mRNA.

121

 

 

 

 

 

 

 

 

 

 

 

.42: s
“5 =3.
Ir .
z 9‘
'5
E
Embryo Treatment (h)
B
wwwowwwewwww
3.51m— "W...“

 

 

 

Figure 4.8. Quantitative analysis of Agnr1 and Agan mRNAs in roots and
cotyledons of A. githago.

122

 

      
   
   
 

 

 

 

 

   
 

 

 

 

1?: 100 Cotyledons El Control
8 E Nitrate
: ‘2
w a
E < Roots
B +
< t ......
m S:
.3 <
L“
:15
2 4
Embryo Treatment (h)
"o‘
E 100 Cotyledons 1:] Control
w ...... EBA
g 80
8
C «t: 60 555525
3 a
< < 40
d)
.2
E 20
ID ......
(I 0
2 4 4
Embryo Treatment (h)

Figure 4.8 cont... Quantitative analysis of Agnr1 and Agan mRNAs in roots and
cotyledons of A. githago.

123

 

  
 
  

 

100 F A El Control
BA
80 I Nitrate

 

 

 

 

 

 

 

 

is?

(D

o

c

8

<1: < _

m 40

.2

E 20 F """

m
Cotyledons Roots Embryos

Treatment (4 h)

Figure 4.9. Quantitative analysis of Agnr2 mRNA in A. githago.

Ten pg of total RNA was used for RT-PCR analysis of Agnr2 in (A) roots and
cotyledons, or (B) embryos. The same RNAs used for 4 h treatments of roots
and cotyledons in Figure 4.8 were used for this analysis. Percent relative
abundance was based on the maximum signal in each of the experiments.

124

for 12 h before embryo isolation and treatment. The zero time point has very
low NR activity levels, but was found to have mRNA levels similar to maximum
levels in cytokinin- or nitrate-treated embryos (Figures 4.6, 4.7). The length of
imbibition may effect NR mRNAs. Seeds were imbibed for 8, 12, or 16 h, and
the NR mRNA levels measured in the isolated embryos. For all three NRs,
maximum mRNA levels were found at 12 h imbibition followed by a decrease
in mRNA levels at 16 h imbibition (Figure 4.10). NR activity was changed little
during this length of imbibition (Figure 4.10).

Transcriptional regulation of NR mRNAs. Nuclear runoff transcription
assays were performed to assess whether the increases in NR mRNA levels by
cytokinin and nitrate were due, at least in part, to the enhancement of rates of
transcription. Based on results from the time course experiments, nuclei were
isolated from embryos treated for 4 h in water, 5 pM BA or 50 mM nitrate.
Nuclei were also isolated from embryos isolated from seeds imbibed for 8, 12,
or 16 h. The transcriptional competence of isolated nuclei was tested and
found to be similar for all treatments. An example is shown in Figure 4.11.

Two nuclear runoff transcription experiments showed similar results
(Figure 4.12A, B). Although there was an increase in the level of Agnr1 mRNA
(Figure 4.12A) or Agnr1 +Agnr3 mRNAs (Figure 4.12B) in cytokinin-treated
embryos. there were no increases in the transcription rates of Agnr1 +Agnr3
(Figure 4.12A, B). Nitrate increased the transcription rates of Agnr1 +Agnr3,
but not to the same extent as the increase in Agnr1 (Figure 4.12A) or

Agnr1 +Agnr3 (Figure 4.12B) mRNA levels. This suggests that the increases

125

 

 

 

 

 

 

 

 

 

«E 100—
m
8 80-
8
g 60-
.0
< 40~
(D
.2
E 20:-
0)
(I 0
12 16
lmbibition Time (h)

Figure 4.10. Quantitative analysis of NR mRNAs in A. githago embryos isolated
from seeds imbibed for various times.

Seeds were imbibed for 8, 12, or 16 h at RT. The embryos were then isolated and
immediately frozen. NR activities, representing the average of triplicate samples,
4 embryos per sample, are indicated above the bars (nmol N01", formed h‘1
embryo") . Percent relative abundance was set at 100% for each mRNA at 12 h
and cannot be compared between the three mRNAs. Ten pg total RNA was used
for RT-PCR analysis of Agn12, and 0.5 pg total RNA was used for RT-PCR
analysis of Agnr1 and Agnr3. Similar results were obtained in two experiments.

126

 

 

 

 

 

 

 

 

 

300
o.
'5 250
E
R i? 200
HO
5 § 150
i" E
30 100
g) 50
0 l J l l
O 5 10 15 20 25

Time (min)

Figure 4.11. Transcriptional competence of isolated nuclei.

Incorporation of P2P]UTP into RNA was measured for nuclei isolated from
embryos isolated from seeds imbibed for 8, 12, or 16 h. Each point' IS the average
of duplicate samples using 2 X 10° nuclei and 150 pC [32 P]UTP 1n a standard in
vitro transcription reaction mixture. Lines are drawn by linear regression. Similar
results were observed in all experiments with all isolated nuclei.

127

Figure 4.12. Nuclear runoff transcription analysis.

Embryos were treated for 4 h in water (control), 5 pM BA, or 50 mM nitrate (A, B) or
embryos were isolated from seeds imbibed for 8, 12, or 16 h (C). NR activities
(nmoles nitrite/h embryo) were measured and relative levels can be compared
between (B) and (C). In (B) and (C), 20 pg total RNA was analyzed by Northern
blot analysis with the Agnr3-1 RNA probe, and relative levels can be compared
between (B) and (C). Because of cross-hybridization, the Agnr3-1 probe detected
Agnr1 as well as Agnr3 mRNA. In (A), 0.5 pg total RNA was analyzed by RT-PCR
analysis for Agnr1 mRNA levels (similar results were seen by RT-PCR analysis for
Agnr3). [32P]-labelled RNAs were synthesized using nuclei isolated from the
embryos. The reaction mixtures contained 2 X 10 ° nuclei. One hundred, 50, or 33
million cpm (A, B, and C, respectively) were hybridized to the linearized Agnr1
plasmid DNA (Chapter 3) immobilized to nitrocellulose. Because of differing
amounts of radioactive RNA used in the hybridizations, relative transcription levels
cannot be compared between experiments. Similar results were observed when
linearized Agnr3 plasmid was immobilized to nitrocellulose.

128

 

 

 
 

 

 

    
  

 

 
 

 

  

 

  

 
 

 

 

A
7
6 _ 1:) Control
[3 BA
E, 5 r I Nitrate
3 4 1
.‘é’ 3 ~
5 2 -
1r
‘” I
NR Activity Relative
RNA Transcription
B
3.5
3 El Control
BA
2-5 I Nitrate

 

 

 

Relative Level
OI

  

 

 

 

 

 

 

 

 

 

 

 

Relative Relative
RNA Transcription

NR Activity

Figure 4.12. Nuclear runoff transcription analysis.

129

 

 

 

 

 

 

 

 

 

 

 

5_ D8 ......
12

TD- 4- .16

>

a.)

_1 3-

a)

.2

E 2*

a)

m
12
O_—

 

 

 

 

NR Activity Relative Relative
RNA Transcription

Figure 4.12 cont... Nuclear runoff transcription analysis.

130

in mRNA levels by nitrate are partly due to increases in the rates of
transcription. Insufficient signal was obtained with Agnr2 for quantitation.

Although there were very low levels of enzyme activity in embryos that
had not been treated (zero time point), there were high levels of all three NR
mRNAs. The mRNA levels varied dependent on the time of seed imbibition
(Figure 4.10). Figure 4.12C shows an increase in the transcription rate of
Agnr1 +Agnr3 with longer imbibition times.

Nuclear runoff transcription analysis is most reliable when there is a large
increase in mRNA levels. The increases in NR mRNA levels observed in these
experiments were only a few fold. Therefore, although nuclear runoff analysis
may give a general idea of the mechanisms of regulation, further analysis such

as promoter analysis is required.

131

DISCUSSION

The NR genes in A. githago were differentially regulated. Agnr2 mRNA
levels were much less abundant than Agnr1 or Agnr3 mRNA levels. Agnr2
mRNA levels were not regulated by cytokinin, but were increased by nitrate,
predominantly in the roots. Agnr1 and Agnr3 mRNAs were regulated in a
similar manner. Their mRNA levels were increased by cytokinin and nitrate in
both roots and cotyledons, but the increases were earlier in the cotyledons.
Cytokinin and nitrate did not show an additive effect on the mRNA levels even
when NR activities were additive. All the mRNA levels were transiently
enhanced a maximum of 8 to 10 times, preceding changes in NR activity.

Regulation of NR in A. githago appears to be complex and may vary
during imbibition, embryo isolation, and embryo treatment, and vary between
tissues. All three mRNAs were present at relatively high levels in embryos at
time zero, i. e. at the end of the imbibition period when embryos were isolated
from seeds, but NR activity was very low (Figures 4.6, 4.7). The mRNA levels
varied dependent on the imbibition time, while there were little changes in NR
activity over the length of imbibition (Figure 4.10). This indicated that in
imbibed seeds there were high levels of mRNAs that were either not translated,
or if translated, the proteins were inactive. Nuclear runoff experiments
indicated that there were changes in the rates of transcription of Agnr1 and
Agnr3 during the imbibition period (Figure 4.12C). Within 2 h of embryo
isolation and incubation in water, the mRNA levels were markedly decreased

while NR activity had increased slightly (Figure 4.7). This indicated that the

132

isolation of the embryos lead to a significant decrease in the NR mRNA levels.
This decrease in mRNA levels might be due to a decrease in the rate of
transcription of the mRNAs and/or a decrease in the mRNA stabilities.
Incubation of isolated embryos with cytokinin or nitrate lead to an
increase in NR mRNA levels, preceding the increase in NR activity. The yield
of RNA was typically 800-1400 pg/g fresh weight for all samples and did not
differ with various treatments. Therefore, cytokinin and nitrate could increase
the rate of transcription of the mRNAs and/or increase the mRNA stabilities.
Nitrate regulated Agnr1 and Agnr3 mRNA levels, at least partly, at the
transcriptional level (Figure 4.12A, B). It would appear that nitrate also
regulates mRNA levels post-transcriptionally. Transcriptional regulation of
Agnr1 and Agnr3 mRNAs by cytokinins was not observed. Because the
changes in mRNA levels were relatively small, promoter analysis is necessary
to determine with certainty the involvement of transcription in regulation of NR.
It is not known whether there is translation of mRNAs carried over from the
seeds, or whether there is only translation of newly transcribed mRNAs.
Cytokinin was shown to increase NR activity primarily in the cotyledons
(Table 2.1). However, cytokinin increased Agnr1 and Agnr3 mRNA levels in
both roots and cotyledons (Figure 4.8). Since Agnr1 and Agnr3 mRNAs were
much more abundant than Agnr2 mRNA, they are likely responsible for a major
part of the NR activity. It is possible the general response to cytokinin is to
increase NR mRNA levels in all tissues, but only in the cotyledons does

cytokinin or other factors allow expression of the protein. Agnr2 mRNA levels

133

were increased by nitrate primarily in the roots, but at a much lower level than
Agnr1 or Agnr3 mRNAs.

Because it was not possible to differentiate between all three NR clones,
and because the NR mRNA levels were of low abundance, RT-PCR analysis was
used to study the regulation of NR mRNAs in A. githago. PCR amplification is
an exponential process; the extent of amplification (N) is given by the equation
N = No(1 + eff)”, where No is the initial amount of material, eff is the efficiency,
and n is the number of cycles (Wang et al., 1989). Small differences in
efficiency can lead to large differences in the yield of product. Construction of
internal standards that contain the same primers as target mRNAs for RT and
PCR allow co-amplification of RNAs with the same efficiencies and provide
controls for sample-to-sample and tube-to-tube effects. Regardless of the
amount of RNA used for RT-PCR analysis, the RNA was always added in a 10
pl volume. Addition of smaller volumes were found to have greater variation
in results, probably due to inaccuracies in pipetting.

The RT-PCR analysis used here should allow for quantification of target
mRNAs. However, I found that over time the relative signals from the internal
standard RNAs increased significantly even though the amounts of the RNAs
were the same. Therefore, although relative RNA amounts could be compared
between RNA samples within an experiment, absolute RNA amounts could not
be used. Similar results have been observed with RT-PCR analysis of other
mRNAs (Sergei Mekhedov, personal communication), but the reasons behind

these results are unknown. Therefore, quantitation of the NR mRNA levels

134

allowed only relative comparisons and target mRNAs could not be quantified.
However, RNA blot analysis showed similar results to RT-PCR analysis,

confirming the results of this analysis.

1 35
REFERENCES

Callaci, J. J., and Smarrelli, J., Jr. (1991). Regulation of the inducible nitrate
reductase isoform from soybeans. Biochim. Biophys. Acta 1088, 127-130.

Chang, P.-F., Narasimhan, M., Hasegawa. P., and Bressan, R. (1993).
Quantitative mRNA-PCR for expression analysis of low-abundance transcripts.
Plant Mol. Biol. Report. 11(3), 237-248.

Chelly, J., Kaplan, J.-C., Maire, P., Gautron, S., and Kahn. A. (1988).
Transcription of the dystrophin gene in human muscle and non-muscle tissues.
Nature 333, 858-860.

Cheng, C.-L.. Acedo, G., Dewdney, J., Goodman, H., and Conkling. M.
(1991). Differential expression of the two Arabidapsis nitrate reductase genes.
Plant Physiol. 96, 275-279.

Cheng, C.-L., Dewdney, J., Nam, H.-G., den Boer. B., and Goodman, H.
(1988). A new locus (NIA1) in Arabidopsis thaliana encoding nitrate reductase.
EMBO J. 7(11). 3309-3314.

Crawford, N. (1995). Nitrate: Nutrient and signal for plant growth. Plant Cell
7. 859-868.

Dailey, F., Kuo, T., and Warner, R. (1982). Pyridine nucleotide specificity of
barley nitrate reductase. Plant Physiol. 69, 1196-1199.

Hoff, T., Stummann, B. M., and Henningsen, K. W. (1991). Cloning and
expression of a gene encoding a root specific nitrate reductase in bean
(Phaseolus vulgaris). Physiol. Plant. 82, 197-204.

Hoff, T., Truong, H.-N., and Caboche, M. (1994). The use of mutants and
transgenic plants to study nitrate assimilation. Plant, Cell and Environ. 17, 489-
506.

Jensen, P., Hoff, T., Moller, M., Stummann, B., and Henningsen, K. (1994).
Identification and characterization of a nitrate reductase gene from bean
(Phaseolus vulgaris) containing four introns. Physiol. Plant. 92, 613-624.

Kim, J.-K., and Wu, R. (1993). A rice (Oryza sativa L.) cDNA encodes a protein
sequence homologous to the eukaryotic ribosomal 5S RNA-binding protein.
Plant Mol. Biol. 23, 409-413.

136

Kleinhofs, A., Warner, R., Hamat, H., Juricek, M., Huang, C., and Schnorr, K.
(1988). Molecular genetics of barley and rice nitrate reductases. Curr. Topics
in Plant Biochem. and Physiol. 7, 35-42.

Kuznetsov, V. V., Kuznetsov, VI. V., and Kulaeva, O. (1979). Influence of
nitrate and cytokinins on notrate reductase activity in isolated Agrostemma
githago seed buds. Biochemica 44(4), 684-692.

Lillo, C. (1991). Diurnal variations of corn leaf nitrate reductase: An experi-
mental distinction between transcriptional and post-transcriptional control.
Plant Science 73, 149-154.

Lu, J.-L.. Ertl, J. R., and Chen. C.-M. (1990). Cytokinin enhancement of the
light induction of nitrate reductase transcript levels in etiolated barley leaves.
Plant Mol. Biol. 14, 585-594.

Pilgrim, M. L., Caspar. T., Quail, P. H., and McCIung, C. R. (1993). Circadian
and light-regulated expression of nitrate reductase in Arabidapsis. Plant Mol.
Biol. 23, 349-364.

Rouzé, P., and Caboche, M. (1992). Nitrate reduction in higher plants:
Molecular approaches to function and regulation. In Inducible Plant Proteins.
J. L. Wray, eds. (Cambridge: Cambridge University), pp. 45-77.

Simpson. C., Sinibaldi, R., and Brown, J. (1992). Rapid analysis of plant gene
expression by a novel reverse transcriptase-PCR method. Plant J. 2(5), 835-
836.

Streit, L., Nelson, R., and Harper, J. (1985). Nitrate reductases from wild-type
and nr1-mutant soybean (Glycine max [L.] Merr.) leaves. Plant Physiol. 78, 80-
84.

Wang, A., Doyle, M., and Mark, D. (1989). Quantitation of mRNA by the
polymerase chain reaction. Proc. Natl. Acad. Sci. USA 86, 9717-9721.

CHAPTER 5

The Isolation of Nitrate Reductase
Genomic Clones from Agrostemma githago

ABSTRACT

Genomic clones corresponding to two of the three nitrate reductase
cDNA clones previously identified have been isolated. AAgnrl contains a 13.5-
kb insert that spans the entire coding region of Agnr1 and 5 kb of sequence 5’
to the coding region. AAgnr3 contains an 11-kb insert that is lacking 1 kb of
the 3' end of the coding region, but contains 7 kb of sequence 5’ to the coding
region.

AAgnr3 contains three introns at conserved positions of introns in other
NR genes. lntron 1, intron 2, and intron 3 are 88 bp, 1000 bp, and 900 bp,
respectively. AAgnrl contains intron 3, which is 800 bp, and must also
contain one or more as yet unidentified introns. Southern blot analysis

suggests that no other unidentified NR genes exist in A. githago.

137

138

INTRODUCTION

Plants obtain most of their nitrogen in the form of nitrate. Because the
rate-limiting and regulated step of nitrate assimilation is catalyzed by nitrate
reductase (NR), much research has focussed on NR and its regulation (for
reviews, see Rouzé and Caboche, 1992; Hoff et al., 1994; Crawford, 1995).

NR is a multifunctional enzyme containing one each of a molybdenum
cofactor, heme, and FAD prosthetic groups for each subunit of the homodimer.
Ten higher-plant NR genes have been cloned, including two from bean (Hoff et
al., 1991; Jensen et al., 1994) and two from barley (Miyazaki et al., 1991;
Schnorr et al., 1991). Although the sizes and numbers of introns vary, the
positions of the introns are conserved. Three introns are present in the
molybdenum binding domain. Only in bean has a fourth intron been found,
located between the heme and FAD binding domains (Jensen et al., 1994).
Except for the bean NR2 gene that contains four introns, higher plant NR genes
contain either one, two or three introns, all located in the three conserved
positions in the molybdenum binding domain. The goal of this work was to
isolate and characterize genomic clones corresponding to the three NR cDNA

clones from A. githago.

139
MATERIALS AND METHODS

Plant Material. A. githago seeds were sterilized and imbibed in water for
2 to 3 days in the dark. The seedlings (3 to 4 cm in length) were used for DNA
isolation. For some samples, embryos isolated from seeds imbibed for 12 h at
room temperature in the dark were used for DNA isolation.

Isolation of genomic DNA. Tissue was frozen and ground in liquid
nitrogen. Five ml of lysis buffer per gram of tissue was added and stirred gently
at 4°C for 15 min (lysis buffer: 30 mM EDTA, 50 mM Tris-HCI, pH 8.0, 2%
sarkosyl, 0.2% B-mercaptoethanol, 200 pg/ml ethidium bromide). Cesium
chloride was added to the samples (0.9 g/ml). The samples were centrifuged
at 17,000 X g in an SS-34 rotor (Du Pont Sorvall) for 20 min at 4°C. The DNA
supernatent was filtered through cheesecloth, and the density of the DNA
solution was adjusted to 1.55 g/ml. Samples were centrifuged according to
Maniatis et al. (1982), and genomic DNA was isolated from the gradients.

Construction of an A. githago genomic DNA library. Genomic DNA was
partially digested with Sau3A by varying the enzyme concentration in a 1 h
digestion according to Maniatis et al. (1982). The DNA was size fractionated
on 5 to 20% potassium acetate gradients. Fractions of 0.5 ml were collected
from the. gradients, and the DNA from each sample was separated by
electrophoresis on 0.5% agarose gels. Fractions containing 9 kb to 23 kb DNA
fragments were pooled and precipitated with ethanol. This DNA was ligated
into the BamHI site of lambda EMBL3 (Stratagene) according to the

manufacturer’s instruction. In vitro encapsidation of the ligated molecules was

140

achieved at 22°C during 2 h using commercial extracts (Gigapackll Plus,
Stratagene). Recombinant phage were grown on E. coli strain LE392. One
million recombinant phages were amplified according to Stratagene's
instructions. An amplified library of ~1010 recombinant clones was obtained.

Screening of A. githago genomic libraries. Both unamplified and
amplified libraries were used for screening. Initially, the radiolabelled insert of
Agpcr1 (Materials and Methods, Chapter 3) was used for screening the libraries.
Hybridizations were at 58°C to 60°C in 6X SSC, 5X Denhardt's solution, 0.5
M sodium phosphate, 0.5% SDS. Final washes were in 0.2X SSC, 0.5% SDS
at 58°C to 60°C. Positive phages were purified through further screening to
obtain isolated phages. Phage DNA was isolated according to Maniatis et al.
(1982) and digested with restriction enzymes. 32P-labelled gene-specific
oligonucleotides (HK38, HK39, and HK76) were used to identify the genomic
clones. Genomic clones corresponding to Agnr1 and Agnr3 were obtained.
Both libraries were further screened with radiolabelled insert of Agpcr2 or in
vitro transcribed antisense strand RNA from Agnr2-1 in an attempt to isolate a
genomic clone corresponding to Agnr2. No clone was obtained.

Analysis of genomic clones. Phage DNAs were digested with restriction
enzymes to create partial restriction enzyme maps. Some DNA fragments were
subcloned into pBluescript SK‘ for further analysis and sequencing.

Polymerase chain reaction. HK52 (Materials and Methods, Chapter 4)
and either the gene-specific oligonucleotide HK39 or HK76 (Materials and

Methods, Chapter 3) were used for PCR amplification from .IAgnrl or AAgnr3

141

phage DNA. The resulting DNA fragments were ligated into the Smal site of
pBluescript SK'. PCR conditions were as previously described (Materials and
Methods, Chapter 3). These clones were also used as templates for in vitro
transcription of sense RNAs used as internal standards for RT-PCR analysis
(Chapter 4).

Southern blot analysis. Genomic DNA samples were digested with
restriction enzymes and separated by electrophoresis on 0.6% agarose gels.
The gels were treated according to Maniatis et al. (1982), and the DNA was
transferred to Hybond N+ nylon membranes in 10X SSC. Blots were hybridized
with the random-primed labelled insert of Agpcr1 (Chapter 3), and hybridization
conditions were the same as used for library screening.

DNA Sequencing. The DNA sequences were determined as in Materials
and Methods, Chapter 3, except that the DNAs were not completely sequenced
on both strands. Most DNA subclones were sequenced only from the terminal
ends.

Standard molecular biological methods. Most other methods were
performed according to standard molecular biological techniques (Maniatis et

al., 1982; Sambrook et al., 1989).

142
RESULTS

Isolation of NR genomic clones from A. githago. Approximately 1 X 10°
recombinant clones from both the amplified and unamplified libraries were
screened with the radiolabelled insert of Agpcr1 (Materials and Methods,
Chapter 3) at intermediate-stringency conditions that would recognize all three
NR clones. Five clones corresponding to Agnr1 and two clones corresponding
to Agnr3 were isolated, as identified by hybridization with the gene-specific
oligonucleotides (HK39 and HK76). AAgnrl (13.5-kb insert) and AAgnr3 (1 1-kb
insert) were chosen for further analysis. More than 2 X 10° recombinant clones
from the unamplified library and 3 X 10° recombinants from the amplified library
were screened with the insert of Agpcr2 (Materials and Methods, Chapter 3) or
the in vitro transcribed antisense RNA of Agnr2-1 (Materials and Methods,
Chapter 3). No clones corresponding to Agnr2 were found.

Analysis of A. githago NR genomic clones. Restriction enzyme maps
were constructed for AAgnrl and AAgnr3 (Figure 5.1). The two restriction
maps were aligned at the common Smal site to show relative positioning
between the two maps. Several restriction enzyme fragments were subcloned
into pBluescript SK' and sequenced. AAgnrl contains the entire coding
sequence of Agnr1. AAgnr3 is missing 1 kb of the 3’-terminal end of the
coding region of Agnr3. Based on sequence homology to tobacco NR
(Vaucheret et al., 1989), AAgnrl and .lAgnr3 contain ~5 kb and ~7 kb,
respectively, of sequence upstream from the start of the coding region.

By comparison of the Agnr3 cDNA sequence to the AAgnr3 sequence,

 

143

  

 

 

 

- filllllllllll
HK52 HK39 TGA
,\Agnr1 I I I
13.5 kb X Xh H E E) x H
_ 7 3.21m —-
1kb
11 12 I3
I flllllllllll
A Ag ”,3 HK52 HK76
11 kb I

XhBX SmEl B
III

2.7 kb

 

 

 

Molybdenum bind'ng domain
Heme binding domain
FAD binding domain

lntrons

 

unknown introns and exons

 

 

Figure 5.1. Restriction enzyme maps of the 13.5-kb insert of AAgnr1 and the
11-kb insert of AAgnr3.

Restriction enzyme maps of the two genomic clones are shown. Enzymes that
are boxed correspond to the same enzymes indicated in Figure 5.2. The positions
of the 5' oligonucleotide (HK52) and the gene-specific oligonucleotides (HK39 and
HK76) used for PCR amplification are indicated. The organizations of the genes
are indicated, with the position of the start of the 5' coding region estimated. The
positions of the identified introns are indicated as l1, l2, and IS. Restriction
enzyme sites are as follows: 8, BamHl; E, EcoRl; H, Hinolll; S, Sall, Sm, Smal; X,
Xbal, Xh, Xhol. Not all restriction enzyme sites are shown. The position of the
stop codon in A Agnr1 is indicated, but is not present in Mgnr3. The 3.2-kb
Sail/Smal and the 2.7-kb Sall fragments are referred to in the results.

144

three introns were identified in .IAgnr3 (Figures 5.1, 5.2). All three introns
were located in conserved positions for introns in NR genes (Rouzé and
Caboche, 1992). lntron 1 was 88 bp. Based on PCR analysis, intron 3 was
estimated to be 900 bp (see PCR analysis below). The Sall DNA fragment in
AAgnr3 (Figure 5.1) is 2.7 kb. The distance between the Sall and Smal
restriction enzyme sites in the cDNA clone is 525 bp (Figure 5.2). Therefore,
if intron 1 is 88 bp, intron 3 is 900 bp, and the distance from the Smal site to
the end of AAgnr3 is 190 bp (Figure 5.1), intron 2 must be 1 kb [i.e. (2.7 kb) -
(0.525 + 0.088 + 0.9 + 0.19 kb) = 1 kbl.

For AAgnr1, intron 3 was estimated by PCR analysis to be 800 bp (see
PCR analysis below). The distance between the Sell and Smal restriction
enzyme sites in AAgnrl is 3.2 kb (Figure 5.1). The distance between these
sites in the cDNA clone is 525 bp (Figure 5.2). Therefore, if intron 3 is 800 bp,
there must be another ~ 1.9 kb of intron sequence between the Sall and Smal
sites [i.e. (3.2 kb) - (0.525 + 0.8) = 1.9 kbl.

Analysis of the nucleotide sequences of the A. githago genomic clones.
Partial sequence information was obtained from subclones of the genomic
clones. The conserved sequences at the 5’ (GzGT) and 3' (AG:) splice junctions
of higher plants (Brown, 1986) were present at the intron boundaries in A.
githago genes. Figure 5.3 shows the conservation between the A. githago
intron splice junctions and the plant consensus splice junction sequences. The
locations of the introns within the cDNA sequences (Figure 3.4) and the protein

sequences (Figure 3.5) are at conserved locations for NR introns. The average

145
HK35, HK52 GSO HK34

 

 

 

 

Molybdenum H1 Heme H2 FAD
A nr1
g 11 12 13 Sm X“ TGA
S 5’ {7 °°x97°°l l l
525 bp
Agnr2 (3 TAA
650 bp
v I
A nr3
g 11 12 13 Sm X“ TGA

 

 

0.5 kb

Figure 5.2. Schematic representation of the A. githago NR cDNA clones, Agnr1,
Agn12, and Agnr3.

The three A. githago NR cDNA clones are aligned. Agnr3 is extended with a
dashed line to represent information obtained from /\ Agn13. The positions of the
binding domains and the hinge regions (H1, H2) are indicated above. The
positions of HK52 and the gene-specific oligonucleotides (GSO) used for PCR
amplification from lambda DNA are indicated. The positions of the degenerate
oligonucleotides HK35 and HK34 used for initial PCR amplification of NR clones
are indicated. Restriction enzyme sites correspond to sites in the genomic
clones in Figure 5.1. I1, l2, and IS are the three introns. I3 is present in all three
NR genes. l1 and/or |2 may be present in AAgnrl, and both I1 and l2 are present
in AAgnr3. The 525-bp Sall/Smal fragment is referred to in the results. The
sequences of the oligonucleotides are shown in Chapter 3 (HK35, HK34, GSO)
and Chapter 4 (HK52).

146

5' SPLICE JUNCTION 3' SPLICE JUNCTION
Agnr3
Intron 1 AAG: GTATAA TATTTTAATTTGCAG: C
Intron 2 CTG: GTTTGT ?
Intron 3 ATG: GTATGT TCTAAATGTATGCAG: G
Agnr1
Intron 3 ATG: GTACGT TAATCTGTTATGTAG: G
c T TTTT
Consensus AAli: GTAAGT TTTRTT RRRRTGCAG. G

Figure 5.3. The 5' and 3' splice junction sequences from introns in A. githago
NR genes.

The 5' and 3' splice junction sequences of the A. githago NR genes are aligned
on the basis of the conserved GT and AG dinucleotides, respectiver The plant
splice junction consensus sequences are also indicated (Brown, 1986). R=G or
A.

147

A+T content of the coding regions of the three A. githago NR clones was
53%. In AAgnr3, the A+T content of intron 1, intron 2, and intron 3 was
89%, 72% (over 127 bp), and 65% (over 560 bp), respectively. In AAgnrl , the
A +T content of the 409 bp sequenced from l3 was 67%. High A +T content
in introns is a general feature of plant genes and may play an important role in
splicing of plant introns (Montero et al., 1990; Wiebauer et al., 1988).

PCR analysis. Based on conserved intron positions in other NR genes,
it was possible that PCR amplification with HK52 and the gene-specific
olionucleotides would span an intron. The distance between HK52 and the
gene-specific oligonucleotides in cDNA clones is 286 bp (Figure 5.2). PCR
amplification of AAgnrl and AAgnr3 lambda phage DNA with HK52 and the
gene-specific oligonucleotides HK39 and HK76 (Figure 5.1) indicated that
llAgnrl and AAgnr3 contained an intron of 800 bp and 900 bp, respectively.
Sequencing of DNA subclones showed that this intron corresponded to the
conserved position of the third intron in other NR genes. PCR amplification of
lambda phage DNA isolated from the amplified genomic library also showed the
presence of this intron. The PCR fragments were ligated into the Smal site of
pBluescript SK' and further analyzed by restriction enzyme digestions and
sequencing. HK52 and the gene-specific oligonucleotide HK38 were used in
PCR amplification to analyze the presence of a genomic clone corresponding to
Agnr2. PCR amplification of lambda phage DNA isolated from either the
amplified or unampified genomic libraries indicated that clones for Agnr2 were

not present in the libraries. PCR amplification of genomic DNA indicated the

148

presence of an intron estimated to be 650 bp between HK52 and HK38, likely
corresponding to l3 (data not shown; Figure 5.2).

Analysis of A. githago genomic DNA. Total genomic DNA from A.
githago was digested with restriction enzymes and subjected to Southern blot
analysis. Figure 5.4 shows a Southern blot hybridized with the random-primed
labelled insert of Agpcr1 (Materials and Methods, Chapter 3). One to three
hybridization bands are seen with each digest. This suggests that there are

probably no other unidentified NR genes in A. githago.

149

 

E R B 89 H K Sa
M
,b

9.4 — D
6.6 - " ~
4.3 — h. '0.
2.3 — -
2.0 - -
0.6 -

 

 

 

Figure 5.4. Southern blot analysis of A. githago genomic DNA

Genomic DNA (approximately 12 pg) was digested with the following restriction
enzymes: EcoRl (E), EcoRV (R), BamHl (B), Bglll (Bg), Hindlll (H), Kpnl (K),
and Seal (Sa). DNA was hybridized with the 495-bp insert of Agpcr1 (Chapter
3). M=molecular weight markers, bp.

150
DISCUSSION

Genomic clones corresponding to Agnr1 and Agnr3 have been isolated
from A. githago, but no clones for Agnr2 were found in the genomic libraries.
The organization of the genes appears to be similar to other NR genes. AAgnr3
contains three introns at the conserved positions of other NR genes. AAgnrl
contains intron 3 and likely also contains intron 1 and/or intron 2. Although no
genomic clone corresponding to Agnr2 was found, PCR amplification indicated
that a 650-bp intron lies between HK52 and HK38, likely corresponding to
intron 3. Of the NR genes sequenced, the size of intron 1 varies from 74 bp in
tomato (Daniel-Vedele etal., 1989) to 854 bp in bean (Jensen et al., 1994), but
is not present in one of the two barley genes (Schnorr et al., 1991). Intron 2
varies from 96 bp in Arabidapsis thaliana (Wilkinson and Crawford, 1991) to
1954 bp in rice (Choi et al., 1989), and is present in all higher plant genes
isolated to date. Intron 3 varies from 85 bp in rice (Choi et al., 1989) to 1646
bp in bean (Jensen et al., 1994), but is not present in either of the barley genes
(Schnorr et al., 1991; Miyazaki et al., 1991). All three intron sizes in AAgnr3
and intron 3 of AAgnrl lie within these ranges. It is not known whether there
are other introns present.

Because NR has three defined functional domains, it is a good example
of evolution by gene fusion (Rouzé and Caboche, 1992). One hypothesis
claims that this results from exon shuffling. Exons encoded functional domains,
and the exons rather than the whole genes were the evolutionary units. Exon

shuffling among various sites in the genome would form functionally complex

151

proteins (Campbell and Kinghorn, 1990). The three functional domains of NR
share homology with domains of other eukaryotic proteins utilizing these
cofactors (Figure 3.1). This observation supports a role for exon shuffling as
a mechanism in the evolution of NR.

The conservation of intron positioning in NR has been used for (Campbell
and Kinghorn, 1990) and against (Rouzé and Caboche, 1992) the hypothesis
of exon shuffling. If a multifunctional enzyme arose by exon shuffling, the
introns might be expected to lie between the functional domains. Although the
positions of the first three introns in NR are conserved, they all lie within the
molybdenum binding domain and not between binding domains. This might
suggest that NR did not evolve through exon shuffling.

In fungi, the Aspergillus nidulans NR gene contains 6 introns (Johnstone
et al., 1990) while Neurospora crassa contains only the last one (Okamoto et
al., 1991). Five of these introns are in the molybdenum binding domain and the
sixth intron is located in the heme binding domain, but none correspond to the
introns found in higher plants. In algae, the Volvox carteri NR gene contains 10
introns, only two of which correspond to higher-plant introns; one separates the
heme and FAD binding domains (Gruber et al., 1992). Campbell and Kinghorn
(1990) suggest that the primordial gene for NR must have contained all of these
introns plus additional ones for dividing the functional domains. Many of the
introns would have been lost during evolution of the NR genes. A fourth intron
in higher plants, thus far only found in bean (Jensen et al., 1994), is the first

example of an intron which divides the functional domains of higher-plant NR.

152

Thus, exon shuffling may have been fundamental in the evolution of the NR

gene.

1 53
REFERENCES

Brown, J. (1986). A catalogue of splice junction and putative branch point
sequences from plant introns. Nucleic Acids Res. 14(24), 9549-9557.

Campbell, W., and Kinghorn, J. (1990). Functional domains of assimilatory
nitrate reductases and nitrite reductases. TIBS 15, 315-319.

Choi, H., Kleinhofs, A., and An, G. (1989). Nucleotide sequence of rice nitrate
reductase genes. Plant Mol. Biol. 13, 731-733.

Crawford, N. (1995). Nitrate: Nutrient and signal for plant growth. Plant Cell
7, 859-868.

Daniel-Vedele, F., Dorbe, M.-F., Caboche, M., and Rouzé, R. (1989). Cloning
and analysis of the tomato nitrate reductase-encoding gene: protein domain
structure and amino acid homologies in higher plants. Gene 85, 371-380.

Gruber, R., Goetinck, 8., Kirk, D., and Schmitt, R. (1992). The nitrate
reductase-encoding gene of Volvox carteri: map location, sequence and
induction kinetics. Gene 120, 75-83.

Hoff, T., Stummann, B., and Henningsen, K. (1991). Cloning and expression
of a gene encoding a root specific nitrate reductase in bean (Phaseolus
vulgaris). Physiol. Plant. 82, 197-204.

Hoff, T., Truong, H.-N., and Caboche, M. (1994). The use of mutants and
transgenic plants to study nitrate assimilation. Plant, Cell and Environ. 17, 489-
506.

Jensen, P., Hoff, T., Moller, M., Stummann, B., and Henningsen, K. (1994).
Identification and characterization of a nitrate reductase gene from bean
(Phaseolus vulgaris) containing four introns. Physiol. Plant. 92, 613-624.

Johnstone I., McCabe, P., Greaves, P., Gun, 8., Cole, G., Brow, M., Unkles,
8., Clutterbuck, A., Kinghorn, J., and lnnis, M. (1990). Isolation and
characterization of the crnA-niiA-niaD gene cluster for nitrate assimilation in
Aspergillus nidulans. Gene 90, 181-192.

Maniatis, T., Fritsch. E., and Sambrook, J. (1982). Molecular Cloning: A
Laboratory Manual. (New York: Cold Spring Harbor Laboratory Press).

Miyazaki, J., Juricek, M., Angelis, K., Schnorr, K., Kleinhofs, A., and Warner,
R. (1991). Characterization and sequence of a novel nitrate reductase from
barley. Mol. Gen. Genet. 228, 329-334.

154

Montero, L., Salinas, J., Matassi, G., and Bernardi, G. (1990). Gene distri-
bution and isochore organization in the nuclear genome of plants. Nucleic
Acids Res. 18(7), 1859-1866.

Okamoto, P., Fu, Y-H., and Marzluf, G. (1991). Nit-3, the structural gene of
nitrate reductase in Neurospora crassa: nucleotide sequence and regulation of
mRNA synthesis and turnover. Mol. Gen. Genet. 227, 213-233.

Rouzé, P., and Caboche, M. (1992). Nitrate reduction in higher plants:
Molecular approaches to function and regulation. In Inducible Plant Proteins.
J. L. Wray, eds. (Cambridge: Cambridge University), pp. 45-77.

Sambrook, J., Fritsch. E., and Maniatis, T. (1989). Molecular Cloning: A
Laboratory Manual. (New York: Cold Spring Harbor Laboratory Press).

Schnorr, K., Juricek, M., Huang, C., Culley, D., and Kleinhofs, A. (1991).
Analysis of barley nitrate reductase cDNA and genomic clones. Mol. Gen.
Genet. 227, 411-416.

Wiebauer, K., Herraro, J., and Filipowicz, W. (1988). Nuclear pre-mRNA
processing in plants: distinct models of 3'-splic site selection in plants and
animals. Mol. Cell. Biol. 8, 2042-2051.

Wilkinson, K., and Crawford, N. (1991). Identification of the Arabidapsis CHL3
gene as the nitrate reductase structural gene NIA2. Plant Cell 3, 461-471.

CHAPTER 6

Summary
and
Discussion

SUMMARY

The regulation of NR by cytokinin and nitrate in A. githago embryos was
examined. Cytokinin and nitrate increased both NR activity (4 to 6 times
control) and Agnr1 and Agnr3 mRNA levels (8 to 10 times control) transiently
in a time-dependent manner, with the increases in mRNA levels preceding the
increases in NR activity (summarized in Figure 6.1 ). Nitrate increased both NR
activity (peak at 6-12 h) and NR mRNA levels (peak at 2 to 4 h) sooner than did
cytokinin (NR activity peak at 12 to 18 h; mRNA levels peak at 4 to 6 h).
Nitrate-regulated NR activity and NR mRNA levels decreased sooner than did
cytokinin-regulated NR activity or NR mRNA levels. Cytokinin and nitrate
effects on NR activity were often additive, but sometimes an additive effect
was not observed, particularly after 12 h of treatment. Cytokinin and nitrate
effects on Agnr1 and Agnr3 mRNA levels were not additive. Ammonia had no
effect on NR activity, either by itself or in comination with cytokinin or nitrate.
Ethylene alone increased NR activity, but in combination with nitrate had no
effect and in combination with cytokinin decreased NR activity.

There were low levels of NR activity in embryos during imbibition, while

there were high levels of the three NR mRNAs. Within 2 h of embryo isolation

155

156

Figure 6.1. Summary of cytokinin and nitrate regulation of NR activity and
NR mRNA levels.

Relative levels of NR activity and Agnr1 or Agnr2 mRNAs are summarized.
Basal levels in the controls were set at 1. Agnr2 mRNA levels are regulated
by nitrate but not cytokinin. Agnr3 mRNA levels were similar to Agnr1 mRNA
levels.

 

 

 

157

 

 

 
   
   

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

A 12
T5 10 Control ‘9 NR “WW
5 «o- Agnr1 mRNA
-' 8 " Agnr2 mRNA
in 5 _
.2
a 4—
a: 2—
0 1 I Q I 1‘69
0 2 4 6 12 18 24
Embryo Treatment (h)
B 12
'0‘) 10_ BA @- NRActivity
5 .- Agnr1 mRNA
.1 8 r
E 6-
a 4—
92 2—
0 G <3 U 1 1 1 . . I .
o 2 4 6 12 18 24
Embryo Treatment (h)
C 10

 

 

Nitrate @- NR Activity
-0- Agnr1 mRNA

Agnr2 mRNA

 
 
 

 

 

    

 

 

 

 

; 1

6246111211115 24

 

Relative Level
C N .5 o: m

Embryo Treatment (h)

Figure 6.1. Summary of cytokinin and nitrate regulation of NR activity and
NR mRNA levels.

158

and incubation on water, the high levels of the NR mRNAs had decreased
dramatically, while there was little change in NR activity. Embryos incubated
in water showed a transient increase of the low level of NR activity, while NR
mRNA levels decreased after 2 h of treatment. NR activity in embryos isolated
from seeds imbibed for various times was temperature dependent, as was the
NR activity in embryos incubated on water.

Cytokinin increased NR activity primarily in the cotyledons, but increased
Agnr1 and Agnr3 mRNA levels in both roots and cotyledons. Nitrate increased
NR activity and Agnr1 and Agnr3 mRNA levels in both roots and cotyledons.
The increases in NR mRNA levels by both cytokinin and nitrate were observed
sooner in the cotyledons than in the roots. Nitrate also increased Agnr2 mRNA
levels, but primarily in the roots. Agnr2 mRNA levels were much less abundant
than either Agnr1 or Agnr3 mRNA levels. The decrease in nitrate—regulated NR
activity and NR mRNAs over time was initially due to loss of NR activity and NR
mRNA levels in the cotyledons.

Three NR cDNA clones all hybridized to a 3.5-kb mRNA and were highly
homologous to each other at both the nucleotide and amino acid levels. Agnr1
and Agnr3 were at least in part transcriptionally regulated by nitrate but not by
cytokinin. The nitrate regulation of Agnr1 and Agnr3 likely also involves post-
transcriptional regulation. There was also transcriptional regulation of these
genes during imbibition. It is not known how Agnr2 is regulated.

Genomic clones containing Agnr1 and Agnr3 were isolated, and both

appear to contain the promoter sequences. Three introns, corresponding to

159

conserved intron positions for NR genes, were identified in AAgnr3. Intron 3
was identified in AAgnr1; one or more other introns were also present, but their

positions were not identified.

Physiological significance of cytokinin on NR

Because the study of cytokinin regulation of NR in A. githago has
involved the application of cytokinins, the question often arises whether
endogenous cytokinins regulate NR. While this has not been determined, a
number of observations suggest that endogenous cytokinins might play a role
in the regulation of NR.

In a number of plants, cytokinins synthesized in the embryonic axis are
translocated to the cotyledons where they regulate amyolytic or proteolytic
enzymes (for a review, see Letham, 1994). Cytokinin increased NR activity in
the cotyledons (Chapter 3) and increased NR mRNA levels in both roots and
cotyledons (Chapter 4). It has also been reported that there are endogenous
cytokinins in A. githago embryos whose levels vary during imbibition and
germination (Borriss, 1977, and references within). Therefore, endogenous
cytokinins are present, and their concentrations vary in A. githago embryos.
It is possible that these cytokinins play a role in regulating NR as other enzymes
have been shown to be regulated by endogenous cytokinins in the cotyledons.

Banowetz (1992) showed that cytokinin regulation of NR activity in
wheat was correlated with endogenous cytokinin levels. When endogenous

cytokinin levels were low, exogenous cytokinins increased NR activity to a

160

greater extent than when endogenous cytokinin levels were high. A similar
situation in A. githago could explain some results. Dependent on the growth
conditions of plants, seeds may contain or have the ability to synthesize
differing amounts of cytokinins and/or contain differing amounts of nitrate.
These factors could affect the levels of NR activity in embryos incubated in
water as well as the ability of the embryos to increase NR activity. Both of
these factors were found to vary with different seed lots and with the age of
the seeds. Schmerder and Borriss (1986) showed that the changes in NR
activity in A. githago embryos incubated on water were likely due to
endogenous cytokinins and not endogenous nitrate. Therefore, endogenous
cytokinins may regulate NR activity in water-treated embryos and applied
cytokinins increase the response.

Cytokinins increase NR activity in A. githago embryos only during a
limited phase of seed germination and growth, whereas nitrate increases NR
activity in seedlings that are at least 5 d old (Kende et al., 1974). This
suggests a more specific role for cytokinins in regulating NR activity during seed
germination and early plant development. Because of the increased growth
during seed imbibition and germination, a higher demand on protein synthesis
can be expected. Cytokinins and nitrate may regulate NR to help meet this
demand. Perhaps cytokinins regulate NR only during a limited time because this
is a crucial developmental period, and/or cytokinins already present to regulate

other cell functions such as cell division are utilized to regulate NR as well..

161
DISCUSSION

This project has accomplished many of its initially established goals.
However, the system lends itself to further analysis. The following is a brief
discussion of future experiments that would help in the understanding of the
mechanism(s) by which cytokinin regulates gene expression.

The first objective in continuing this project would be further analysis of
the genomic clones. The complete sequences of the Agnr1 and Agnr3 genes
should be determined, including promoter and 3’-untranslated sequences. Since
nuclear runoff trancription analysis showed post-transcriptional regulation of NR
by cytokinin, the 3’-untranslated sequences should be examined for their ability
to regulate reporter gene expression in response to cytokinin in transgenic
plants such as Arabidapsis thaliana. If cytokinin regulation of the reporter gene
is controlled by the 3'-untranslated sequence, further analysis could determine
cis and trans elements involved with this regulation.

Although nuclear runoff transcription analysis did not show
transcriptional regulation of NR by cytokinins, it cannot exclude that some
transcriptional regulation does occur. Promoter analysis of Agnr1 and Agnr3
would determine if there is any transcriptional regulation by cytokinins. If
transcriptional regulation is present, the promoter could be used to isolate cis
and trans factors involved with that regulation. The use of reporter genes for
the analysis of transcriptional regulation of nitrate reductase has not been
successful in transient expression assays in protoplasts (i. e. Vaucheret et al.,

1992). Therefore, stable transformation methods should be used, i.e,

162

transformations into the Arabidapsis thaliana mutant carrying mutations in both
NR genes (Wilkinson and Crawford, 1993).

There have been no published results on the mRNA localization of NR.
In situ hybridizations could give information on the localization of the NR
mRNAs in A. githago embryos. These results might also provide a better
understanding of the physiological significance of cytokinin regulation of NR.
In situ hybridization experiments in A. githago are being done (Wilfried Peters,
personal communication). It would be interesting to see if a reporter gene
linked to the 3’-untranslated sequence of NR is not only cytokinin regulated, but
tissue specifically regulated as well.

The large differences between NR mRNA levels and NR activity in
isolated embryos not incubated on water suggest that there may be regulation
at the protein level. The determination of NR protein levels in A. githago
embryos would give a better understanding of cytokinin and nitrate regulation
of NR. Several monoclonal and polyclonal antibodies to NR have been raised,
but all have drawbacks. The most likely candidate for analysis in A. githago is
a spinach monoclonal antibody (Sueyoshi er al., 1988). The A. githago NR
genes show the most sequence identity to the spinach sequence (Prosser and
Lazarus, 1 990) and, therefore, the spinach antibody may most likely cross-react
with A. githago NR. This antibody will also cross-react with NR proteins on
Westerns, unlike some of the other antibodies available. However, all of the NR
antibodies that cross-react with proteins on Westerns require at least partial

protein purification or many non-NR proteins will also cross-react (Wilbur

163

Campbell, personal communication).

Protein kinases and phosphatases have been shown to be involved in
cytokinin regulation of gene expression, but with differing effects. Dominov et
al. (1992) showed that the enhancement of pL8216 mRNA levels by cytokinin
is blocked by the protein kinase inhibitor staurosporine and stimulated by the
protein phosphatase inhibitor okadaic acid (a specific inhibitor of type 1 and
type2A protein phosphatases). In contrast, Crowell (1994) showed that the
enhancement of cim1 mRNA level is stimulated by staurosporine and blocked
by okadaic acid. Cytokinin enhancement of SrEnodZ mRNA levels was inhibited
by both staurosporine and okadaic acid (David Silver, personal communication).
pSL216 is at least partially transcriptionally regulated by cytokinin (Dominov et
al. , 1992), SrEnod2 is post-transcriptionally regulated by cytokinin (David Silver,
personal communication), and the regulation of cimI is unknown. Thus, it
appears that cytokinin regulation of gene expression involves protein kinases
and phosphatases but that different mechanisms underly these processes.
Inactivation of NR in the dark has been shown to involve a rapid and reversible
protein phosphorylation in spinach (Huber et al., 1992), A. thaliana (LaBrie and
Crawford, 1994), and maize (Huber et al., 1994). In spinach, a calcium-
dependent protein kinase required for activation of NR has been partially purified
(Bachmann etal., 1995), and okadaic acid prevented the dephosphorylation and
inactivation of NR (Huber et al., 1992). Therefore, inhibitor studies could reveal
the involvement of protein kinases and/or phosphatases in cytokinin regulation

of NR. Cycloheximide, an inhibitor of protein synthesis, could also be used to

164

determine if the cytokinin-regulated increase in NR mRNA levels requires protein

synthesis.

Concluding Remarks

Cytokinin studies fell behind studies of other plant hormones for many
years. Recently, much information has been gathered on the effects of
cytokinin in plants at the molecular level. However, many cytokinin studies
examined gene expression over long periods of time (e.g. days). Thus, these
cytokinin-stimulated genes are not likely to represent the primary molecular
responses to cytokinins but rather the results of a series of signalling activities.
The goal of this project was to examine the regulation of NR by cytokinins in
A. githago, a fast and specific response. The ultimate goal is to better
understand the mechanism(s) by which cytokinins regulate gene expression.
This work will contribute to the knowledge of cytokinin responses and lay a
foundation for future studies on cytokinin signal transduction. Future studies
examining cytokinin regulation of gene expression of different genes in different
plants are likely to reveal many of the molecular events that mediate the effects
of cytokinin on gene expression and, thus, on the growth and development of

plants.

1 65
REFERENCES

Bachman, M., McMichael, Jr., R., Huber, J., Kaiser, W., and Huber, S. (1995).
Partial purification and characterization of a calcium-dependent protein kinase

and an inhibitor protein required for inactivation of spinach leaf nitrate
reductase. Plant Physiol. 108, 1083-1091.

Banowetz, G. (1992). The effects of endogenous cytokinin content on
benzyladenine-enhanced nitrate reductase induction. Physiol. Plant. 86, 341-
348.

Borriss, H. (1977). Regulation of enzyme synthesis in seed germination. In
Regulations of Developmental Processes in Plants. H. Schiitte and D. Goss,
eds. (Jena:Fischer Verlag), pp. 98-110.

Crowell, D. (1994). Cytokinin regulation of a soybean pollen allergen gene.
Plant Mol. Biol. 25, 829-835.

Dominov, J., Stenzler, L., Lee, S., Schwarz, J., Leisner, S., and Howell, S.
(1992). Cytokinins and auxins control the expression of a gene in Nicotiana
plumbaginifo/ia cells by feedback regulation. Plant Cell 4, 451-461.

Huber, J., Huber, S., Campbell, W., and Redinbaugh, M. (1992). Reversible
light/dark modulation of spinach leaf nitrate reductase activity involves protein
phosphorylation. Arch. Biochem. Biophys. 296, 58-65.

Huber, J., Redinbaugh, M., Huber, S., and Campbell, W. (1994). Regulation of
maize leaf nitrate reductase activity involves both gene expression and protein
phoshporylation. Plant Physiol. 106, 1 17-1674.

Kende, H., Fukuyama-Dilworth, M., and deZacks, R. (1974). On the control of
nitrate reductase by nitrate and benzyladenine in Agrostemma githago embryos.
In Plant Growth Substances-1973. S. Tamura, ed. (Tokyo: Hirokawa Publ.), pp.
675-682.

LaBrie, S., and Crawford, N. (1994). A glycine to aspartic acid change in the
MoCo domain of nitrate reductase reduces both activity and phosphorylation
levels in Arabidapsis. J. Biol. Chem. 269, 14497-14501.

Letham, D. (1994). Cytokinins as phytohormones-sites of biosynthesis,
translocation, and function of translocated cytokinin. In Cytokinins: Chemistry,
activity, and function. D. Mok and M. Mok, eds. (Boca Raton: CRC Press), pp.
57-80.

166

Prosser, l., and Lazarus, C. (1990). Nucleotide sequence of a spincah nitrate
reductase cDNA. Plant Mol. Biol. 15, 187-190.

Schmerder, B., and Borriss, H. (1986). Induction of nitrate reductase by
cytokinin and ethylene in Agrostemma githago L. embryos. Planta 169, 589-
593.

Sueyoshi, K., Kubo, Y., Yamagishi, K., Ogura, N., Ochiai, K., Fukushima, K.,
Ikeda, T., and Nakagawa, H. (1988). Monoclonal antibodies specific for NADH-
ferricyanide reductase domain of spinach leaf nitrate reductase. Plant Cell
Physiol. 29(6), 975-980.

Vaucheret, H., Marion-Poll, A., Meyer, C., Faure, J.-D., Marin, E., and Caboche,
M. (1992). Interest in and limits to the utilization of reporter genes for the
analysis of transcriptional regulation of nirate reductase. Mol. Gen. Genet. 235,
259-268.

Wilkinson, J., and Crawford, N. (1993). Identification and characterization of
a chlorate-resistant mutant of Arabidapsis thaliana with mutations in both
nitrate reductase structural genes NIA1 and NIA2. Mol. Gen. Genet. 239, 289-
297.

nmi ‘ Haw"

APPENDIX

APPENDIX

Nomenclature

OLIGONUCLEOTIDES

HK30 5’-AACCARCARTTRTTCATCAT-3’ :20—mer;
redundancy=8; antisense; in the molybdenum binding domain; 562-
581; used as an internal probe in initial screening of NR clones.

HK34 5’-TCRAAYTCYTCNGTRCARTC-S' : 20-mer;
redundancy=128; antisense; in the heme binding domain; 910-929;
used in PCR for obtaining NR clones.

HK35 5’-TGGTGYTGGTGYTTYTGG-3’ : 18-mer;
redundancy=8; sense; in the molybdenum binding domain; 433-450;
used in PCR for obtaining NR clones.

HK38 5'-ACGCGTGGCTAACTGCGTCC-3’ : 20-mer; antisense; in the
hinge 1 region specific to Agnr2; 705-724; used to identify clones,
and in RT-PCR analysis.

HK39 5'-GGTTATTGCCACCTGGCACA-3’ : 20-mer; antisense; in the
hinge 1 region specific to Agnr1; 705-724; used to identify clones,
and in RT-PCR analysis.

HK40 5’-TGTGTTCGAGCATCCGAC-3' : 18-mer; sense; in the
molybdenum binding domain, complementary to Agnr1, Agnr2, and
Agnr3; 630-647; used as an internal probe in RT-PCR analysis.

HK52 5'-TGGTGTTTTTGGTCATTAGAAGT—3’ : 23-mer; sense; in the
molybdenum binding domain; complementary to Agnr1, Agnr 2, and
Agnr3; 439-461; used for PCR amplification from genomic clones.

HK76 5'-AGTTATTGCCACCCGGCACT-3’ : 20-mer; antisense; in the
hinge 1 region specific to Agnr3; 705-724; used to identify clones,
and in RT-PCR analysis.

167

1 68
PCR Clones

Agpcr1 a 497-bp clone in the EcoRI site of pCRll generated by PCR
amplification with HK35 and HK34; corresponds to Agnr1; encodes
part of the molybdenum binding domain, the hinge 1 region, and part
of the heme binding domain; 433—929.

Agpcr2 a 497-bp clone in the EcoRI site of pCRll generated by PCR
amplification with HK35 and HK34; corresponds to Agnr2; encodes
part of the molybdenum binding domain, the hinge 1 region, and part
of the heme binding domain; 433-929.

Agpcr3 a 497-bp clone in the EcoRI site of pCRll generated by PCR
amplification with HK35 and HK34; corresponds to Agnr3; encodes
part of the molybdenum binding domain, the hinge 1 region, and part
of the heme binding domain; 433-929.

NR cDNA Clones

Agnr1 i.e, Agnr125; a 2046-hp clone the EcoRI site of pBluescript SK';
encodes part of the molybdenum binding domain, the hinge 1 region,
the heme binding domain, the hinge 2 region, the FAD binding
domain, and 156 bp of 3' untranslated sequence.

Agnr2 i.e.Agnr223; a 1502-bp clone in the EcoRI site of pBluescript SK';
encodes part of the molybdenum binding domain, the hinge 1 region,
the heme binding domain, the hinge 2 region, the FAD binding
domain, and 36 bp of 3’ untranslated sequence.

Agnr3 i.e, Agnr321; a 1729-bp clone in the EcoRI site of pBluescript SK';
encodes part of the molybdenum binding domain, the hinge 1 region,
the heme binding domain, the hinge 2 region, the FAD binding
domain, and 234 bp of 3' untranslated sequence.