This is to certify that the

thesis entitled

FORKHEAD GENE EXPRESSION IN PROSTATE TISSUES

AND CELL LINES

presented by

CONG DING

has been accepted towards fulfillment
of the requirements for

MASIER—degree in W

www

DR. WILL KOPACHIK

 

Major professor

Date (rayon/mm

0-7639 MS U is an Affirmative Action/Equal Opportunity Institution

 

LIBRARY

Mlchlgan State
University

 

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FlNESretum on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6’01 cJCIRCJDatoDuepss-ots

F ORKHEAD GENE EXPRESSION IN PROSTATE TISSUES
AND CELL LINES

By

CONG DING

A THESIS

Submitted to
Michigan State University
In partial fulfillment of the requirements
For the degree of

Master of Science
Department of Zoology

2001

ABSTRACT

FORKHEAD GENE EXPRESSION IN PROSTATE TISSUES
AND CELL LINES

By
Cong Ding

Some members of the forkhead class of transcription factors may play a role in
controlling the cell cycle or cell survival. The AFX forkhead subfamily might
transcriptionally activate the p27Kipl gene. The FREAC—4 gene of the FREAC subfamily
is related by sequence to the qin. We determined which subfamily members were
expressed in the prostate by RT-PCR analysis using degenerate primers made to the
conserved DNA-binding domain of the forkhead sequences. We used prostate cancer
tissue, BPH tissue and prostatic cell lines (LNCaP, LNCaP C4-ZB, DU-l45, PC-3) as
sources of the RNA. The sequence analysis of the cloned cDNAs showed no novel
family members (if PCR generated mutations are discounted). Of five AFX subfamily
members (AFX, FKHR FKHRLI, FKHRPI, FKHRLlPl), only the first three were
detected. For the FREAC subfamily, only FREAC-3 and FREAC-4 were detected. We
designed sequence-specific primers to examine the expression of the individual family
members by semi-quantitative RT-PCR in comparison to GAPDH expression. For the
tissues, AFX expression was a minimum of 8 fold higher in prostatic cancer than in BPH,
whereas FKHR and FKHRLI expression were lacking in the BPH. For the cell lines, all
expressed AFX but PC-3 was unusual in that it alone had negligible expression of FKHR
and FKHRLl. The negligible expression of FKHR and FKHRLI correlated with the very
low expression of p27 Kip! in PC-3 cells and BPH. Thus, FKHR and/or FKHRLI, but not

AF X, may be responsible for p27 Ki“ expression in prostate cells.

Dedicated to my parents and my husband

For their endless love and support

iii

ACKNOWLEDGEMENTS

I would like to express my sincere gratitude and appreciation to Dr. Will
Kopachik for his guidance, advice, support, and constant assistance in the completion of
this thesis and other aspects of my graduate program. Sincere thanks and appreciation are
also extended to my committee members Drs. Sarah Elsea and Kathleen Gallo for their

time, valuable suggestions, and review of this manuscript.

I would like to acknowledge Mr. Eric Olle for his advice and assistance in setting
up my experiments. Thanks are also due to Ms. Judy Pardee and Ms. Lisa Craft for their

administrative assistance.

Last but not least, a special acknowledgment is due to my husband for his

technical advice and assistance, and for his love. Without his support, this

accomplishment would not have been possible.

iv

TABLE OF CONTENTS

List of Figures ........................................................................... vii
List of Abbreviations ...................................................................... ix
Introduction .............................................................................. 1
Materials and Methods .................................................................. 12
Cells and tissues ................................................................ 12
RNA Isolation .................................................................. 12
DNase digestion ...................................................................................... 13
Reverse Transcription ............................................................ 13
Design of primers ............................................................... 14
Polymerase Chain Reaction (PCR) of degenerate primers .................. 14
DNA cloning ....................................................................... 15
Sequencing Analysis .............................................................. 16
Semiquantitative RT-PCR ........................................................ 16
Data analysis ..................................................................... 17
SAGE analysis .......................................................................................... 17
Results ........................................................................................ 19

Expression of FREAC forkhead gene subfamily

DNA binding domain ........................................ 19
Expression of FREAC-4 in PCa and BPH

tissues and LNCaP cell line ................................. 20

FREAC-4 mRNA level in prostate cancer

tissues and cell lines .......................................... 21
Expression of AF X forkhead gene subfamily
DNA binding domain ......................................... 22

AFX, FKHR and FKHRL] mRNA level in

prostate cancer tissues and cell lines ......................... 23

Expression of 1327““ in PC and cell lines ..................................... 25

SAGE Analysis of Forkhead Factors .......................................... 26
Discussion ................................................................................... 27
Reference List ............................................................................... 34
Table .......................................................................................... 41
Figures ........................................................................................ 42

LIST OF TABLE AND FIGURES

Table 1. PCR primers .................................................................... 41
Figure 1. Forkhead genes and PIBK signaling pathway .............................. 42

Figure 2. Forkhead DBD sequences obtained aligned to the
DBD of known HFH family proteins ........................ 43
Figure 3. DNA Sequences for the primer part ......................................... 44

Figure 4. RT-PCR analysis of the FREAC-4 expression in human PCa,

BPH and prostatic cancer cell line LNCaP ................. 45
Figure 5. PCR products as a fimction of PCR cycles for both FREAC-4

and GAPDH cDNAs ........................................... 46
Figure 6. PCR products as a fianction of the amount of template RNA ............ 47
Figure 7. Semi-quantitative RT-PCR analysis of FREAC-4 gene expression

in human PCa tissues and BPH tissue ....................... 48
Figure 8. Semi-quantitative RT-PCR analysis of FREAC-4 gene expression

in human prostate cancer cell lines .......................... 49
Figure 9. F orkhead DBD sequences obtained aligned to

AFX/FKHR subfamily members ............................ 50
Figure 10. Semi-quantitative RT-PCR analysis of AF X gene expression

in human PCa tissues and BPH tissue ....................... 51
Figure 11. Semi-quantitative RT-PCR analysis of AF X gene expression

in human prostate cancer cell lines .......................... 52

Figure 12. Semi-quantitative RT-PCR analysis of FKHR gene expression

vii

in human PCa tissues and BPH tissue ....................... 53
Figure 13. Semi-quantitative RT-PCR analysis of FKHR gene expression

in human prostate cancer cell lines ........................... 54
Figure 14. Semi-quantitative RT-PCR analysis of FKHRLI gene expression

in human PCa tissues and BPH tissue ....................... 55
Figure 15. Semi-quantitative RT-PCR analysis of FKHRLI gene expression

in human prostate cancer cell lines ........................... 56
Figure 16. Semi-quantitative RT-PCR analysis of p27ml gene expression

in human PCa tissues and BPH tissue ....................... 57
Figure 17. Semi-quantitative RT-PCR analysis of p27KIPI gene expression

in human prostate cancer cell lines .......................... 58

Figure 18. Expression profiles by SAGE analysis ................................... 59

BPH

CEF

CWH

DBD

DHT

DTT
GAPDH

HNF-30t

PCa

PCR

PI3K

PKB

PSA

RT

SAGE

LIST OF ABBREVIATIONS:

«acute lymphoblastic leukemia
«androgen receptor
«benign prostate hyperplasia
«chicken embryo fibroblasts
«chicken winged helix
«DNA binding domain
«dihyfrotestosterone
«dithiothreitol
«glyceraldehyde-3-phosphate dehydrogenase
«hepatocyte/forkhead homologue
«hepatocyte nuclear factor-3a
«prostate cancer
«polymerase chain reaction
«phosphatidylinositol 3-kinase
«protein kinase B
«prostate-specific antigen
«reverse transcription

«serial analysis of gene expression

ix

INTRODUCTION:

Prostate Cancer and Androgen Response:

Prostate cancer is the most commonly diagnosed human cancer and the second
leading cause of cancer mortality (after lung cancer) among males in the United States
(Greenlee et al. 2000). It is reported that in 2000, more than 180,000 American men have
been diagnosed with prostate cancer and 38,000 will have died of the disease. The rate of
prostate cancer (PCa) increases dramatically as men age. In men over the age of 55, PCa
is responsible for nearly 4% of all deaths (Parker et a1. 1997). An understanding of the
molecular basis for prostate tumorigenesis is thus important.

The adult male prostate surrounds the neck of the bladder and prostatic urethra.
Normal prostate is composed of tubuloalveolar glands embedded in fibromuscular
stroma. The prostate can be divided into several zones: peripheral, central, transitional,
and periurethral. About 70% of prostatic carcinomas develop from the peripheral zone
(De Marzo et al. 1999). Normal prostate evolves atypical epithelial proliferations of the
prostate gland. Benign prostate hyperplasia (BPH) is a benign disorder that develops
predominantly in the transsition zone of the prostate. BPH can be overgrowth or
hyperplasia of both the epithelial and stromal compartments. Very large BPH glands are
primarily rich in epithelial growth, but in some BPH glands the stromal elements are
predominant.

Prostate homeostasis is controlled by balanced cell proliferation, cell survival, and
cell death. Apoptosis is the process of programmed cell death in vertebrates that plays a

central role in development and homeostasis. There is a close association between

programmed cell death (apoptosis) and prostate cancer initiation, progression, metastasis,
and response to treatment. Prostate cancer cells require androgen for growth at early
stages of development and later during puberty. The androgen dihydrotestosterone (DHT)
can bind to the prostatic androgen receptor (AR). After binding DHT, the AR is released
from cell membrane, then transferred into nucleus. AR can bind specific DNA sequences
called androgen-responsive elements. The androgen-responsive elements are located in
the promoter region of the androgen-responsive genes, such as prostate-specific antigen
(PSA) (Sadar et al. 1999). Then the AR is able to induce the transcription of the
androgen-responsive genes (Murtha et al. 1993).

The aim of androgen deprivation therapy is to reduce the androgen level in
prostate cancer or interfere with the AR activity and thus reduce AR—mediated
transcription. Deprivation of androgen function can lead to prostate cancer atrophy.
However, during cancer progression, prostate cancer is composed of androgen-dependent
and androgen-independent cells (Taplin et al. 1995). The androgen deprivation therapy
fails when the androgen—independent cells keep growing even in very low androgen
concentration. Failure to prevent androgen-independent progression is the main obstacle
to improving the survival of this disease. Androgen deprivation eliminates most
androgen-dependent cancer cells by inducing apoptosis but can rarely cure the patients
due to the presence of androgen-independent cells and emergent of apoptosis-resistant
clones (Kyprianou et al. 1990; Denmeade et al. 1996). Androgen-independent growth of
prostate carcinoma is thought to mainly arise through mutations of AR. For example,
mutations of AR in the steroid-binding domain could cause the loss of normal repression

of AR transactivation in the absence of androgen. Some mutant AR will be constitutively

active (Castagnaro et al. 1993).

Forkhead Transcription Factor:

Transcriptional factors other than steroid receptors can also control vertebrate
organ and tissue development through binding to their target DNA sequences.
Transcription factors are classified according to the structural motif involved in DNA
binding. The forkhead/HNF-3 motif was detected in the Drosophila forkhead gene
product and in rat hepatocyte nuclear factors 3 (HNF-3). The prototype gene coding for
forkhead was discovered during developmental studies in Drosophila. The Drosophila
forkhead gene is essential for the proper formation of terminal structures of the embryo.
Forkhead refers to the phenotype of mutants that show homeotic transformations in the
anterior and posterior gut with head-like structures at both ends of the embryo (W eigel et
al. 1989). The prototypes of forkhead in mammals are hepatic nuclear factor (HNF) 3a,
[3, and 'y. The HNF—3 protein family is hepatocyte enriched DNA-binding transcription
factors in rodents.

Since the discovery of the winged-helix domain in the Drosophila forkhead and
the rodent HNF-3 factors, approximately 90 members with homologues have been
identified. They usually are a large family within a species. For instance there are 35
forkhead genes in the human genome. They are expressed in a wide range of organisms
such as Saccharomyces cerevisiae (Bork et al. 1992), Caenorhabditis elegans (Miller et
al. 1993), Zebra fish (Strahle et al. 1993), Xenopus laevis (Knochel et al. 1992), mouse
(Kaestner et al. 1993), rat (Clevidence et al. 1993), and human (Pierrou et al. 1994;

Kaufmann et al. 1996). Recently, in the domain-based comparative analysis by Venter et.

al, the forkhead domain was found in 36 proteins in H. sapiens, 16 proteins in D.
Melanogaster, 6 proteins in C. elegans and 16 proteins in S. cerevisiae (Venter et al.
2001). All members of the family show high sequence homology within their 110 amino
acid DNA-binding domain. Forkhead transcription factors are also called winged-helix
proteins based on their three dimensional structure when bound to DNA. Winged helix
domain is a variant of the helix-tum-helix motif as determined from the crystal structure
of PINE-37 (Clark et al. 1993). Three (Jr-helices (H1, H2 and H3) dominate the amino-
terrninal half of the protein and form a globular, three—helix cluster, whereas two wing (or
loop)-like regions W1 and W2 are near the carboxyl-terminal end. The target DNA is
recognized by the a—helix H3 and the two wings W1 and W2. H3 helix makes contacts
with the major groove of double-stranded DNA and the two adjacent loop structures
stabilizes the contacts.

The forkhead family members have been shown to play key regulatory roles in
embryonic development, differentiation, and tumorigenesis. For example, the HNF-3
proteins exert a profound role at all stages of embryogenesis beyond their role as a liver—
specific transcription factor (Ang et al. 1993; Monaghan et al. 1993). In vertebrates, the
forkhead proteins control a wide variety of developmental processes, including formation
of the node and notochord, the development of the cerebral hemispheres and the
differentiation of the gastrointestinal epithelium (Ang et al. 1994; Xuan et al. 1995;
Kaestner et al. 1997). The expression of AR is regulated by Hepatocyte nuclear factor-3a
(HNF-30t). HNF-30t is a member of the hepatocyte/forkhead homologue (HFH) family of
transcription factors originally identified in the liver and expressed in the rodent prostate

epithelial cells at a 14-20 fold higher level than the liver. The HNF-30t consensus

sequence, VAWTRTI‘KRYTY, was found in regulatory sequences of the androgen
receptor in a database search (Overdier et a1. 1994) and HNF-30t can repress gene
transcription from the androgen receptor promoter in vitro (Olle and Kopachik,

unpublished results).

Forkhead Transcription Factors and Tumorigenesis:

Three forkhead family members, qin oncogene, AFX and FKHR, are linked to
tumorigenic progression (Li et al. 1993; Parry et al. 1994; Fredericks et al. 1995). The
first oncogene reported with winged helix structure was the avian sarcoma virus 31 (ASV
31) gene qin. ASV 31 is a highly oncogenic retrovirus found in a spontaneous connective
tissue tumor of an adult chicken (Li et al. 1993). Retroviral oncogenes are derived from
the genome of the host cell and are cellular growth-regulatory genes. They are mutated
and inserted into the viral genome and expressed under control of viral regulatory
sequences. Incorporation of a mutated cellular oncogene makes a retrovirus highly
tumorigenic and capable of transforming cells in culture. The qin gene is a cell-derived
insert in the genome of ASV 31 and determines the transforming activity of the retrovirus
(Galili et al. 1993). The viral qin gene (v-qin) is the oncogene in the virus. Part of the
viral gag and all of the pol region are missing and replaced by the qin insert that is
expressed as a Gag-Qin fusion protein. The v-qin gene differs from its cellular
counterpart c-qin by an N-terminal leader sequence, several amino acids substitutions and
a C-terminal deletion. Both c-qin and v-qin stimulate the growth of chicken embryo
fibroblasts (CEF) and induce transformed cell foci and colonies in soft agar culture (Li et

al. 1997a). V-Qin is also highly tumorigenic in the animal in contrast to c-Qin, which

causes tumors in only a small fraction of the injected animals and only after a prolonged
latent period (Li et al. 1997a).

Three cDNA clones "chicken winged helix (CWH) 1, 2, and 3" were isolated
from a chicken embryonic cDNA library by low-stringency hybridization using the c-qin
DNA binding domain as a probe (Freyaldenhoven et al. 1997a). The amino acid sequence
of the DBD of CWH-1 is highly conserved in rat fork head factor HFH-B2, mouse fork
head factor BF—2, and human fork head factor FREAC-4 (Freyaldenhoven et al. 1997b).
Overexpression of wild type CW H-l protein from the replication competent retroviral
vector RCAS induces changes in morphology (Freyaldenhoven et al. 1997a), stimulates
anchorage independent growth and causes increased saturation density of CEF. These
results suggest that winged helix transcription factor CWH-1 has the potential to
stimulate abnormal cell proliferation.

The FREAC-4 gene is probably the human homologue of CWH-1. It was first
obtained by a PCR-based strategy with primers designed from regions conserved between
rat HNF-3 and Drosophila forkhead and a human cDNA template (Pierrou et al. 1994).
Northern blot analysis by Pierrou et al. (1994) showed that FREAC-4 expressed in the
human kidney and testis tissue but not in normal prostate tissue. Cotransfection
experiments done by Ernstsson et al. (1996) demonstrated that FREAC-4 is regulated by
two tumor suppressors, WT-l and p53 (Emstsson et al. 1996). FREAC-4 promoter
contains a binding site capable of interacting with WT-l. A WT-l expression- plasmid
cotransfected with the FREAC-4-luc reporter construct induced a 3-fold increase in
reporter gene activity. The tumor suppressor gene, p53, was found to repress the same

reporter gene activity approximately 4-fold (Emstsson et al. 1996).

Two additional forkhead genes, AFX and FKHR, were first identified at
chromosomal breakpoints in human tumors. In one type of acute lymphoblastic leukemia
(ALL), the t(X;11) translocation arises from the fusion of the Zn-finger transcription
factor MLUALLl gene on chromosome 11 to the AFX forkhead gene on chromosome X
(Parry et al. 1994; Borkhardt et al. 1997). The AFX gene contributes a truncated forkhead
domain and C-terminal sequences to the t(X;11) translocation. Similar to AFX, FKHR
has also been implicated in oncogenesis as a result of its involvement in the chromosomal
translocation t(2:13)(q35;q14) frequently found in human alveolar rhabdomyosarcomas
(Galili et al. 1993; Davis et al. 1994). This translocation leads to the generation of a
chimeric gene composed of PAX3, a member of the paired box transcription factor
family, and FKHR. The resulting PAX-FKHR fusion protein contains an intact DNA-
binding domain of PAX fused to the COOH-terminal half of the forkhead domain and the
transactivation domain of FKHR. The PAX3-FKHR product exhibits potent
transactivation activity when compared to wild-type PAX3. The fusion of FKHR and
AFX with their corresponding partner genes PAX3 or MLL, respectively, occurs at
identical amino acid positions. Previous studies have shown that members of the
forkhead gene family can be subgrouped according to their degree of similarity within the
DNA-binding forkhead domain (Kaufmann et al. 1996). The five human forkhead genes
(FKHR, FKHRL], FKHRLlPl, AFX, FKHRPI) that show striking similarity within the
DBD can be grouped into a AFX subfamily (Galili et al. 1993; Shapiro et al. 1993; Davis

et al. 1994; Anderson et al. 1998).

Forkhead Transcription Factors in Cell Signaling Pathway and Cell Cycle Control:

Recent studies strongly suggest that AFX, FKHR and FKHRL] are downstream
targets of the phosphatidylinositol 3-kinase (PI3K) pathway (Figurel). Akt (also called
PKB) is the downstream target protein of PI3K. It is also a Ser/Thr protein kinase.
Following insulin or insulin-like growth factor stimulation AFX, FKHR and FKHRLI
can be phosphorylated by PKB. AFX, FKHR and FKHRLI contain multiple putative
PKB phosphorylation sites that can be recognized by the amino acid sequence
RXRXXS/T. Thus these transcription factors are potentially direct targets of insulin-
activated PKB (Paradis et al. 1998; Ogg et al. 1998).

The activation of endogenous PKB can be impaired by PTEN/MMACI tumor
suppressor gene. PTEN encodes a phospholipid phosphatase and acts a negative regulator
of the P13K pathway (Li et al. 1998). The PTEN gene, identified and mapped to
chromosome 10q23, is implicated in causing a wide range of human cancers (Steck et al.
1997). A previous study showed the metastatic capabilities of rat prostate tumor cells can
be significantly inhibited by the reintroduction of the 10q region (Nihei et al. 1995).
PTEN homozygous deletion and point mutations were detected in prostate cancer cell
lines and a set of prostate cancer samples. PTEN expression levels are reduced in prostate
cancer xenografts derived from patients with advanced prostate cancer (Li et al. 1997b;
Whang et al. 1998). Somatic mutations of PTEN are found in a number of human
malignancies, and loss of expression, or mutational inactivation of PTEN, leads to the
constitutive activation of PKB via enhanced phosphorylation of Thr-308 and Ser-473.
Higher levels of PKB activation are observed in human prostate cancer cell lines and

xenografts lacking PTEN expression when compared with PTEN positive prostate tumors

or normal prostate tissue (Wu et al. 1998). An antiapoptotic signal is provided by the
induction of Akt activity (Kennedy et al. 1997). In addition, PTEN represses gene
expression that can be rescued by Akt but not PI3-kinase (Li et al. 1998). It also can
inhibit Gl phase progression in cells that lack PTEN (Ramaswamy et al. 1999).

AFX, FKHR, and FKHRLI are mammalian homologues of the C. elegans
forkhead transcription factor daf-16. Daf-I6 is critical to the regulation of life span in
Caenorhabditis elegans. Daf-l6 and its mammalian homologues AFX, FKHR and
FKHRLI contain three putative phosphorylation sites for PKB. PKB also inhibits the
translocation of AFX, FKHR and FKHRLl to the nucleus, and therefore inhibits their
transcriptional activity. AFX transcriptional activity is inhibited by phosphorylation from
PKB (Kops et al. 1999). FKHR’s phosphorylation by PKB also negatively regulated its
transcriptional activity (Nakae et al. 1999; Guo et al. 1999). Similarly, FKHRLI is
phosphorylated by PKB resulting in suppression of transcriptional activity and promotion
of cell survival (Brunet et al. 1999).

FKHRLl plays a role in apoptosis. When survival factors such as insulin-like
growth factor 1 are present, Akt phosphorylates FKHRLI at T32 and 8253. Akt
phosphorylated FKHRLl binds to a scaffolding protein called 14-3-3 protein and remains
in the cytoplasm (Brunet et al. 1999). The absence of survival factors leads to FKHRLl
dephosphorylation. The dephosphorylated FKHRLI is translocated into nucleus and
activates target gene transcription (Brunet et al. 1999). Within the nucleus,
nonphosphorylated form of FKHRLI triggers apoptosis probably by induction of
expression of genes and cell cycle blockage that are critical for cell death. . Furuyama et

al. (2000) determined that the target genes of the four forkhead proteins share a core

consensus binding sequences, TTG'ITAC (Furuyama et al. 2000). Thus any one of the
three could potentially redundantly activate target gene transcription from P27KIPI for
instance.

P27KIPl is cyclin-dependent kinase inhibitor. The p27 Km gene was first identified
in cells arrested in G1. The GI phase of the cell cycle is inhibited by two families of
cyclin dependent kinase inhibitors (CKIs). The two CKI families, Cip/Kip and INK4,
have previously been shown to inactivate the cyclin-Cdk holoenzyme complexes.
Members of the Cip/Kip family include p21CiP’WAFl, p27KIPl and p57Kipz. The Cip/Kip
inhibitors at high concentrations blocked cyclin D-, E-, and A-dependent kinase

activities. P271“? 1

preferentially binds to and inactivates the CyclinE/Cdk2 complexes
therefore inhibiting entry into S-phase (Slingerland et al. 1994). Upregulation of p27 K1“
is linked to cell cycle arrest in Go/G1 through its interaction with CDK-cyclin complexes
(Toyoshima et al. 1994). p27KIPI levels decrease in response to mitogens and increase in
quiescence. Increasing levels of p27KlPl serve as a barrier to (31-8 transition and may
promote cell cycle exit. Dijkers et al. (2000) showed cytokine-mediated proliferation and
survival are regulated through downregulation of p27Km (Dijkers et al. 2000). p27KIPl is
rarely mutated, but its reduced expression has been seen in several cancers including
prostate. Recently, reduced p27KlPl has shown promise as a marker of malignant prostate
cancer (Yang et al. 1998; Tsihlias et al. 1998; Cordon-Cardo et al. 1998; Lloyd et al.
1999). Decreased expression of p27KIP‘ has been correlated with androgen deprivation
failure, aggressive metastases and poor prognosis (Yang et al. 1998). Cordon-Cardo et al.
(1998) found low/absent p27 xrpr expression in the majority of metastatic, androgen-

7 KIPl

independent tumors. Low p2 may be used to identify androgen independent tumors

10

(Yang et al. 1998; Cote et al. 1998). Transcriptional induction of p27Klpl in murine pre-B-
cell line Ba/F3 is regulated by the forkhead-related transcription factor FKHRLI (Dijkers
et al. 2000). Activation of FKHRLl is sufficient to elevate p27“?! mRNA and protein

levels and induce apoptosis. The regulation of p27xrpr

transcription by forkhead-related
transcription factors may be a general mechanism of cell survival, proliferation or
differentiation (Dijkers et al. 2000).

The objective of my project was to examine the expression of the forkhead genes
involved in tumorigenesis to uncover potential roles in development of normal and
neoplastic cells of the prostate. We investigated the expression of FREAC subfamily and
AFX subfamily of forkhead factors in prostate cancer tissues. FREAC-4, AFX, FKHR
and FKHRLl were found to be expressed. The expression levels of the four forkhead

genes were then detected in prostate cancer (PCa) tissues, benign prostate hyperplasia

(BPH) tissues and prostate cancer cell lines.

11

METHODS:

Cells and tissues: Human prostatic carcinoma cell line LNCaP was established from a
metastatic lesion of human prostatic adenocarcinoma by Horoszewicz et al (1983)
(Horoszewicz et al. 1983). LNCaP is an androgen-responsive cell line but the C4-2B
subline is more tumorigenic, metastatic and androgen-independent than LNCaP cell line
(Chen et a1. 1998). DU-145 (metastasis to brain), and PC3 (metastasis to bone) are two
androgen-independent prostate carcinoma cell lines; they were obtained from Simon
Hayward (UCSF). Cells were grown in HEPES-buffered RMPI 1640 medium
(GibcoBRL) containing 10% fetal bovine serum (Intergen), 100 rig/ml streptomycin
(Sigma) and 100 U/ml of penicillin (Sigma) at 37°C. Every 34 days the cells were
subcultured trypsinization (0.05% trypsin/ lmM EDTA) for 5 min at 37°C, 5% C02 and
neutralization with serum. The cells were then recovered by low speed centrifugation
and one tenth of the cell suspension was added to T75 flasks. Prostatic carcinoma tissue
and benign prostatic hyperplasia tissue were obtained from Dr. Wartinger (MSU

Urology).

RNA Isolation: Total RNA were prepared from 0.2 g tissue or 2 T75 flasks of near-
confluent LNCaP, LNCaP C4-2B, DU-145 and PC3 cell lines. The tissue samples were
minced with a razor blade. Five ml of 4M guanidinium/0.1 mM B-mecaptoethanol
solution was added into the minced tissue, and tissues were homogenized. Cells were
collected directly into guanidinium/B-mecaptoethanol, and scraped into a 15 ml tube.
The volume was made up to 13 ml with guanidinium solution and total RNA was isolated

by the method of centrifugation through a cesium chloride cushion described by

12

Chirgwin et al (1979) (Chirgwin et al. 1979). The OD260 and Ongo were determined by
spectrophotometic analysis (Spectronic 601, Milton Roy) and the concentration of the
RNA was obtained by multiplying the OD250 by 40 [lg/ml. The quality and integrity of
the RNA were checked by visual inspection of the 188 and 28S rRNAs in ethidium-

bromide-stained agarose gels.

DNase digestion: Twenty [lg RNA was digested by RQl DNase (Promega) to eliminate
the contaminating genomic DNA. DNase digestion was performed in a final volume of
100 111 containing 5 mM Tris pH 7.5, 15 pg BSA, 100 M MgClz, and 2 units of RQl
DNase. The reaction was incubated in a 37°C water bath for 15 minutes. RNA was

recovered after phenolzchloroform extraction and ethanol precipitation.

Reverse Transcription (RT): First strand cDNA was made from 10 ug RNA using M-
MLV Reverse Transcriptase (Promega). In order to eliminate any secondary structure,
initial denaturation of 10 ug of RNA was performed in a total volume of 10 111 for 5 min
at 80°C. RT was performed on tissue samples in a final volume of 80 ul containing 10 ug
total RNA, 5 mM dithiothreitol (DTT), 200 ng random primers, 0.5 M Tris-HCl, pH 8.3,
75 mM KCl, 1 mM each of dATP, dCI‘P, dGTP, d'I'I‘P, 40 units of RNase inhibitor, and
400 units of Promega MML-V reverse transcriptase (Promega). The reaction was
incubated at 37°C for 1 hour. A negative RT control was prepared using the same RNA
but without the addition of reverse transcriptase in order to check for contaminating
genomic DNA in the RNA sample. Extraneous bands were not found in the negative

control lanes.

13

Design of primers: Primers used are listed in Table 1. For FREAC subfamily expression,
we used comparisons among the FREAC-3, FREAC-4, HFH-2, HNF-3'y motifs to design
degenerate primers corresponding to conserved residues within the DNA-binding
domain. We synthesized a sense primer corresponding to the KPPYSYI amino acid
sequence and an antisense primer corresponding to REKFPAW amino acid sequence. For
the AFX/FKHR subfamily, we designed degenerate primers according to the conserved
residues within the DBD of five AFX subfamily members (AFX, FKHR, FKHRLI,
FKHRLlPl, and FKHRPl). We synthesized a sense primer corresponding to the
AWGNQSY amino acid sequence and an antisense primer corresponding to WKNSIRH
amino acid sequence. The sense and antisense primers contain Hind III and Sal I
restriction sites at the 5’ end, respectively. We also designed oligonucleotide primers
based on the published human cDNA sequences FREAC—4, AFX, FKHR, FKHRLl and
GAPDH (Galili et al. 1993; Emstsson et al. 1996; Borkhardt et a]. 1997; Anderson et a1.
1998). Expected sizes of the PCR products are as follows: FREAC and AFX subfamily:
180bp; FREAC-4, 311bp; AFX, 221bp; FKHR, 437bp; FKHRLI, l93bp; p27KIP1,
469bp; GAPDH, 452bp. The primers were synthesized by Michigan State University

Macromolecular Structure, Sequencing and Synthesis Facility.

Polymerase Chain Reaction (PCR) of degenerate primers: For the amplification of
DBD sequences of FREAC and AFX subfamily, a PCR reaction mixture containing a

final concentration of 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgC12, 0.2 mM dNTP mix,

0.4 uM each of sense and antisense primers, 4.0 units Taq polymerase in a final volume

14

of 100 1.11. All samples were heat treated for 4 minutes at 94°C in a therrnocycler for an
initial denaturation, and then amplified for 40 cycles at 94°C for 1 min; 48°C for 2 min;
and 72°C for l min. The samples were finally incubated at 72°C for 15 min for a final

extension, and then stored at 4°C.

DNA cloning: The PCR amplification products made using degenerate primers were
separated by 1.8% agarose gel electrophoresis. No PCR products were obtained in the
negative RT samples that did not contain the reverse transcriptase. PCR products were
isolated from agarose blocks with a Qiagen kit H (Qiagen). The isolated PCR products
were subcloned into Hind 111/ Sal I cut Bluescript KS plasmids and then transformed into
E.coli DH 50L competent cells (Strotagene). Bacterial colonies with inserts were selected
by white/blue selection.

White colonies or light blue colonies were transferred into 20 “.1 water in a 500 111
rnicrofuge tube, and heated in a boiling water bath for 10 min. The cell suspension was
clarified by 2 min centrifugation. One pl of the supernatant was used in a 25 111 final
volume PCR reaction. Primers T7 and T3 of the Bluescript KS plasmid were used in the
PCR amplification. The 140 bp PCR product was obtained from the intact Bluescript KS
plasmid and served as a reference. The plasmids containing the 180 bp DNA insertion
have an expected size of 320 bp. Contrary to the expectation, the white colonies did not,
but the light blue colonies did have the insertion.

The light blue colonies were cultured in 5 ml SOB broth containing 500 ug
ampicillin overnight in a 37°C degree shaking incubator. Plasmid DNA was purified with

the Wizard plasmid preparation kit (Promega).

15

Sequencing Analysis: The nucleotide sequence of the DNA insertions was determined
by the dideoxynucleotide chain-termination method (Dalphin et al. 1997) with the
Sequenasem* Version 2.0 DNA sequencing kit wnited States Biochemical). Template
DNA was purified with a Wizard Kit (Promega) and annealed to synthetic
oligonucleotide primer T7 of the Bluescript KS plasmid. The primer was extended using
10 nM of dGTP, <1ch, d'I'I‘P, 6.25 uCi 353 labeled dATP, 3.25 units 17 DNA
polymerase, and 0.625 units of pyrophosphatase. The elongation was terminated by
adding 80 nM dideoxynucleotide ddA, ddG, ddT and ddC. The reactions were terminated
by the addition of 48 nM Ethylenediarnine Tetraacetic Acid (EDTA) and 16%
formamide, denatured by heating and separated by a 6% acrylamide gel electr0phoresis

(50 watts constant power).

Semiquantitative RT-PCR: PCR was performed in 50 u] reactions with a final
concentration of 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgC12, 0.2 mM dNTP mix, 0.4
uM each of sense and antisense primers, and 2 units of Taq polymerase. The reactions
were incubated in a thermal cycler for 31 cycles (FREAC-4, FKHR and FKHRLl), 32
cycles (AFX), 30 cycles (p27Km), or 23 cycles glyceraldehyde-3-phosphate
dehydrogenase (GAPDH). The forkhead genes expression were normalized to the house
keeping gene GAPDH. Results were expressed as the ratio of forkheadeAPDH.

PCR reaction parameters: for FREAC-4, 94°C 605, 52°C 60s and 72°C 605; for
AFX, 94°C 605, 60°C 905 and 72°C 90s; for FKHR, 94°C 608, 55°C 603 and 72°C 603;

for FKHRLl, 94°C 603, 60°C 608 and 72°C 608; for p27m1, 94°C 608, 62°C 1205 and

16

72°C 1803; for GAPDH, 94°C 608, 60°C 60s and 72°C 603. PCR was completed by a
final extension at 72°C for 10 min, and then stored at 4°C. Fifteen microlitres of the PCR
products were separated on 1.8% agarose gels and stained with 0.2 ug/ml ethidium
bromide for 20 minutes under 80 volts. The PCR product was visualized with UV light.
Photographic documentation of the gels was performed using Type 667 black and white
Polaroid films. The correct size of the PCR products was determined by the use of a
standard DNA marker, and the sequences were confirmed by manual sequencing
analysis. The polaroid images were scanned with a HP ScanJet IIC Scanner. Scans were
saved as 8-bit TIFF files and imported into image analyzing software, UN-SCAN-IT
(Silk scientific) for analysis. A standard baseline for samples was used and magnification
of the image and width of the measurement window were constant. Areas of FREAC-4,
AFX, FKHR, and FKHRLI DNA bands measured in square pixels were normalized to

the area of GAPDH bands.

Data analysis: Each RNA sample was analyzed by RT-PCR 3 times, and the average
intensity of the gel image of the PCR products obtained was taken. Data were expressed
as means :1: SD. Values were compared using student’s t-test, and considered statistically

significant when the p value was less than 0.05.

SAGE analysis: SAGE provides a quantitative profile of the mRNAs expressed in a
tissue or cell line by generating short-sequence tags that identify specific mRNAs
(Velculescu et al. 1995). The short sequence tags (~10bp) used in SAGE are isolated

from mRNA at a defined position (directly 3'-adjacent to the 3'-most restriction site for a

17

particular restriction enzyme). The short tags are long enough to uniquely identify the
corresponding transcript in database searches. The frequency of each tag directly reflects
transcript abundance. Basically, the SAGE technique measures not the expression level
of a gene, but quantifies a "tag" which represents the transcription product of a gene.
Thus, SAGE results in an accurate picture of gene expression at both the qualitative and
the quantitative level. The use of SAGE in expression profiling has been demonstrated in

analysis of expression profiles in normal versus cancer cells (Zhang et al. 1997).

18

RESULTS:

Expression of FREAC forkhead gene subfamily DNA binding domain:

To detect the expression of the FREAC forkhead gene subfamily, we designed
degenerate primers according to the conserved DNA binding domain (DBD) sequences
of four forkhead genes (FREAC-4, HFH-2, HNF—3'y and FREAC-3). The degenerate
primers were used in a polymerase chain reaction (PCR) to amplify forkhead family
members from cDNA pools prepared from human prostatic carcinoma (PCa) tissue,
benign prostate hyperplasia (BPH) tissue and LNCaP cell line. The PCR products of the
degenerate primers amplification were cloned and sequenced.

Among the fourteen forkhead DBD sequences we obtained, twelve of them were
FREAC-4 or FREAC-4-like, and two were FREAC-3 (Figure 2). Because every clone
had a different flanking oligonucleotide primer sequence (Figure 3), we will only
consider the sequence between the primers. The differences in the flanking amino acids
sequences (KPPYSYI and REKFPAW) probably result from mismatched
oligonucleotides at the low annealing temperature of 48°C. The FREAC-4 DBD
sequence was found in PCa #2,3,9,10,15, 17, BPH #21, 38 and LNCaP #26. PCa samples
#13, #16 and BPH #26 have one amino acid different from the published FREAC-4
sequence: a serine (S-coded by ‘tcc’ in PC #13) replaced a proline (P-coded by ‘ccc’); a
valine (V-coded by ‘gtg’ in PC #16 and BPH #26) replaced a Leucine (L-coded by ‘ctg’).
Valine and leucine are conservative changes, resulting from a single base change. Of
fourteen sequences only PC #12 and BPH #7 are similar to FREAC-3 DBD sequence.

Thus, only sequences most similar to FREAC-4 and FREAC-3 are found using these

19

primers. No sequences similar or identical to HFH-2 and PINE-37 were found in this

small group.

Expression of FREAC-4 in PCa and BPH tissues and LNCaP cell line:

Previous studies have shown that FREAC-4 is not expressed in normal human
prostate tissue (Pierrou et al. 1994). Therefore it is important to know if increased
FREAC-4 expression occurs in prostate cancer tissues and cell lines.

To detect the expression of FREAC-4 in PCa and BPH tissues, and LNCaP cell
line samples, we designed FREAC-4 primers based on unique human FREAC-4 cDNA
sequence (GenBankm/EBI Data Bank, accession number U59832.) (Emstsson et al.
1996). The FREAC-4 cDNA products derived from RT-PCR analysis using these primers
in human PCa, BPH tissues and LNCaP cell lines are shown in Figure 4. The length of
the amplified FREAC-4 cDNA fragment, 311 bp, was as predicted. The sequence
analysis of the fragment showed it to be identical to the published human FREAC-4
cDNA sequence from position 1693-2003 (GenBankTM/EBI Data Bank, accession
number U59832) (Emstsson et al. 1996). The 293 cell line derived from human
embryonic kidney known to express FREAC-4 (Emstsson et al. 1996), was used as a
positive control. A minus-RT control was prepared for all tissues and cell lines, but in all
cases of reverse transcriptase deletion, no band was obtained on the ethidium bromide
stained agarose gel after PCR amplification (Fig 4).

Although these results confirm the expression of FREAC-4 mRNA in PCa, BPH
and LNCaP, we could not conclude that the apparent differences in expression were real

in Figure 4 because no precaution was taken to be ensure that the amplification was

20

linear. Next we used a semi-quantitative method to examine the differential expression
level of FREAC-4 between PCa tissues and BPH tissue, as well as among four prostate

cancer cell lines, LNCaP, LNCaP C4-ZB, DU-145 and PC-3.

FREAC-4 mRNA level in prostate cancer tissues and cell lines.

The RT-PCR method was employed in a serniquantitative manner (Horikoshi et
al. 1992) to study the expression of FREAC-4 mRNA relative to the expression of the
housekeeping gene GAPDH (Zentella et al. 1991).

To establish a serniquantitative RT-PCR method, two preliminary experiments
were carried out. A constant amount of cDNA was amplified for a variable number of
cycles to determine the number of cycles within the linear range. The amount of
amplified DNA was plotted as a function of the number of PCR cycles in Figure 5. The
linear amplification for FREAC-4 is within 20—40 PCR cycles, whereas the linear
amplification for GAPDH is within 20-30 PCR cycles. Therefore thirty cycles were used
for FREAC-4, and twenty-three cycles were used for GAPDH. Next, different amounts
of cDNA were amplified for 30 cycles of PCR. Figure 6 shows the linear amplification of
FREAC-4 PCR product as a function of the amount of template RNA. In the range of 4 to
16 1.11 (equivalent to 0.2 to 0.8 ug of total RNA), a linear correlation was observed
between the amount of amplified product and cDNA input. Therefore 8 ul of cDNA
mixture (equivalent to 0.4 pg of total RNA) were used for RT-PCR in this study. These
preliminary experiments were also carried out to detect expression from other genes

(AFX, FKHR, FKHRLI, and 1327er1) in the subsequent experiments to determine the

21

number of cycles and amount of cDNA to be used in PCR amplification (results not
shown).

All subsequent analyses used scanned photographs of ethidium bromide stained
gels to obtain an intensity value of the FREAC-4 band to be normalized to the intensity
value of a GAPDH PCR band (Figures 7 and 8).

The semiquantitative RT-PCR analysis of FREAC-4 gene expression level in
human PCa and BPH tissues shows some variation in expression of FREAC-4. These
differences, however, were not statistically significant.

In contrast, there were interesting differences in the FREAC-4 gene expression in
prostate cancer cell lines LNCaP, LNCaP C4-2B, DU-l45 and PC-3 (Figure 8). Cell line
C4-2B shows 2.2-fold lower FREAC-4 expression than LNCaP, and DU-145 has 1.5-fold
higher FREAC-4 expression than LNCaP. Surprisingly no FREAC-4 expression was
found in the PC-3 cell line. The differences between the following groups are statistically
significant (p<0.05): LNCaP vs PC-3; C4-2B vs PC-3; DU-145 vs P03; and C4-2Bvs

DU-145.

Expression of AFX forkhead gene subfamily DNA binding domain:

AFX and FKHR forkhead transcription factors have been shown to be involved in
tumorigenesis (Galili et al. 1993; Shapiro et al. 1993; Parry et al. 1994; Borkhardt et al.
1997). Five human forkhead genes (FKHR, FKHRLl, FKHRLlPl, AFX, FKHRPI) that
show sequence similarity have been found and grouped into a AFX subfamily (Anderson

et al. 1998).

22

To detect the role of AFX subfamily members in prostate tumorigenesis, we
examined the expression of the AFX subfamily genes in prostate cancer tissue.
Degenerate primers were designed according to the conserved DBD sequences of the five
subfamily members. The degenerate primers were used in PCR to amplify the subfamily
members from cDNA pools prepared from the same human PCa tissues used previously.
The PCR products were purified, subcloned and sequenced. Among the nineteen
forkhead DBD sequences we obtained, eleven of them are FKHRLl DBD, five are AFX
DBD and three are FKHR DBD (Figure 9). DBD sequences of FKHR subfamily

members FKHRLlPl and FKHRPI were not found.

AFX, FKHR and FKHRLl expression in prostate cancer tissues and cell lines:

To investigate the differential expression of the three AFX subfamily forkhead
genes which were found in PC tissue, we used the same semiquantitative RT-PCR
method as we did for FREAC-4 to compare the mRNA levels between PCa tissues and
BPH tissue, as well as between cell lines LNCaP, LNCaP C4-2B, DU-l45, and PC3.

We designed unique AFX, FKHR, and FKHRLl primers based on the sequences
of human cDNA to amplify the three forkhead genes in those tissues and cell lines (Table
1). The length of the amplified AFX, FKHR, and FKHRLl cDNA fragments are 211 bp,
469 bp, and 193 bp, respectively. The sequence analysis of the fragments showed them
to be identical to the revised published human AFX cDNA sequence, position 566-787

(GenBank"'M IEBI Data Bank, accession number GI=1418758) (Borkhardt et al. 1997);

FKHR cDNA sequence, position 581-1028 (GenBankm/EBI Data Bank, accession

23

number GI=435422) (Galili et al. 1993); FKHRLl cDNA sequence, position 1598-1790
(GenBankm/EBI Data Bank, accession number GI=2895493) (Anderson et al. 1998).

The semiquantitative RT-PCR method was used to study the expression of AFX,
FKHR, and FKHRLl mRNA relative to the expression of the housekeeping gene
GAPDH mRNA. To use this method, we first determined the linear amplification range
for the three forkhead genes as a function of PCR cycles and the amount of template
cDNA (cDNA from all tissues and cell lines were used). The number of PCR cycles used
for AFX, FKHR, and FKHRLl amplification was 32, 31, and 31, respectively. Four
micro liters of cDNA (made from 0.2 pg) was used in this RT-PCR study.

The semiquantitative RT-PCR analyse of AFX, FKHR, and FKHRLl gene
expression levels in human PCa tissues and cell lines are shown in Figures 10—15.

The RT-PCR analysis revealed an unequal distribution of AFX, FKHR and
FKHRLI between PCa tissues and BPH tissue. There was a 7.2-9.7 fold higher
expression of AFX in PCa tissues than in BPH tissue. The differences between PCa
tissues and BPH tissue are statistically significant (p<0.05). For cell lines LNCaP and
PC-3, the AFX expression is approximately equal but 2 fold lower than in C4-2B and
DU-145. The difference between the following groups are statistically significant
(p<0.05): LNCaP vs DU-145; C4-2B vs PC-3; and DU-145 vs PC-3.

FKHR and FKHRLl show similar patterns to that of AFX in that they were
undetectable or barely detectable in BPH tissue and PC-3 cell lines (Figure 13). Once
again, cell line C4-2B and DU-145 showed higher FKHR expression level than LNCaP
(1.5-fold and 3.1-fold, respectively). The differences between the following groups are

statistically significant (p<0.05): LNCaP vs PC-3, C4-2B vs PC-3; and DU-l45 vs PC-3.

24

For FKHRLI, C4-2B shows higher expression than LNCaP and DU-145 (1.2—fold and
1.8-fold, repectively). The differences between the following groups are statistically

significant (p<0.05) (Figure 15): LNCaP vs PC-3, C4-2B vs P03; and DU-145 vs PC-3.

Expression of 1527”“ in PCa, BPH and cell lines:

As previously mentioned, AFX, FKHR and FKHRLI forkhead genes are part of
the P13K pathway for the inhibition of apoptosis. Furthermore, consititutively active AFX
and FKHR induces p27KlPl transcription. Is just the constitutively active AFX that
induces p27 or can the wild type do it as well? In order to investigate the potential role of
these forkhead genes in alteration of apoptosis and cell cycle regulation in prostate

7KIPl

cancer, we examined the expression level of p2 in PC tissues and cell lines. The

expectation was that because all three forkhead proteins can bind to the same promoter

sequences any one would be sufficient for expression of the p27KIPI

gene transcription.
The semiquantitative RT-PCR method was applied to study the expression level
of p27”,1 in PCa and BPH tissues and cell lines (Figures 16,17). Interestingly, the PCB
cells and BPH tissue that have negligible FKHR and FKHRLl also have negligible
p27m1 expression. The highest p27KlPl expression level is in the LNCaP cell line where
it is 2.5 and 2.0 fold higher than in C4-2B and DU-145, respectively. The differences
between the following groups are statistically significant (p<0.05): LNCaP vs PC-3, C4-

2B vs PC-3; and DU-145 vs PC-3 (Figure 17).

25

SAGE Analysis of Forkhead Factors:

We also used the serial analysis of gene expression (SAGE) database to study the
gene expression profile of the forkhead transcription factors and downstream target
genes. The SAGE expression profiles of several forkhead transcription factors are shown
in Figure 18. The data was obtained from human transcriptome map web site,
(http://bioinfoamc.sara.nl). The total number of SAGE tags for each library is: 136968
for normal prostate tissue; 133493 for primary prostate tissue; 399291 for prostate tumor
tissue; and 265798 for prostate cancer cell line LNCaP. The tag numbers shown on
Figure 18 are counts per 100,000 tags.

The SAGE data showed that AFX, FKHR, FKHRLl and p27KIPl genes are
detected in prostate tumor tissue (Figure 18). This is in agreement with our results that
these genes are expressed in PCa tissues using RT-PCR (Figures 10, 12, 14, 16). SAGE
data are also useful for the information on expression of these genes in normal prostate
tissue, since our RT-PCR analysis lacks a normal group. Only AFX and p27KlPl are
detected in normal tissue in SAGE data, but not FKHR or FKHRLI, despite their
expression in PCa tissue,

The expression of FREAC-4 is different between SAGE analysis (Figure 18) and
RT-PCR results (Figures 7, 8). In all prostate tissues and cells examined there is FREAC-
4 expression by RT—PCR analysis but not by SAGE analysis.

The SAGE analysis also showed expression information for two other forkhead
factors, FREAC-2 and HFH-11A (Figure 18). Both FREAC-2 and HFH-11A were
expressed in an interesting pattern of increasing amounts in the transition from normal to

PCa to LNCaP.

26

DISCUSSION:

The forkhead group is very large, with 35 human genes found in the Human
Genome Project analysis (Venter et al. 2001). Therefore, we approached our objective of
examining the expression of the forkhead genes to uncover potential roles in neoplastic
cells of the prostate by concentrating on members most likely to have an effect on
prostate tumorigenesis. We analyzed two subgroups of the family (the FREAC-4 group
that is related to qin and AFX group that is implicated in promotion of apoptosis and cell
cycle arrest) in an effort to find those that may play a role in prostate tumorigenesis.

Several different chromosomal deletions or rearrangements have been found in
prostate cancer cells (Bova et al. 1996): including 1) loss of sequences within the short
arm of chromosomes 8; 2) loss of sequences within the long arm of chromosome l3q;
and 3) gain of sequences within the long arm of chromosomes 8 and X, particularly in
advanced disease. The chromosome loci of the forkhead factors and p27m1 are: AFX,
Xq13.1; FKHR, 13q14.1; FKHRLl, 6q21; FREAC-4, 5ql2-q13; p27m1, 12p13.1-p12.
Loss of sequence with in the long arm of chromosome 13 might result in the loss of
forkhead factor FKHR (13q14.1). The loss of FKHR gene could account for the lower
amount of RT-PCR products in BPH tissue and P03 cell line since losses of gene result
in losses of transcription. My results show FREAC—4 is expressed in prostate cancer
tissues and cell lines in contrast to the absence of FREAC-4 expression in normal prostate
tissue demonstrated by Pierrou et al. (1994) (Pierrou et al. 1994). The detection of
FREAC-4 expression in prostate cancer tissues and cell lines could result from an
increase in copy number of chromosome 5q since higher copy number could result in

higher transcription level. A number of rearrangements have been identified in LNCaP,

27

DU-145 and PC-3 cell lines, both androgen-insensitive cell lines DU-145 and PC-3
exhibited a higher number of chromosome rearrangements than the androgen-sensitive
cell line LNCaP. PC-3 exhibited rearrangement of chromosome 1, 2q, 4, 5, 6q, 8, 10, 11,
12q, 14, and 15, but the breakpoints of these rearrangements could not be ascertained.
The high frequency of rearrangement may be a result of increased genetic instability
caused by deficient cell cycle control or DNA repair.

The sequencing and RT-PCR analysis used in this project would not detect some
types of mutations. The primers used for AFX PCR amplification are located in the N-
terrninal potion of AFX gene, so the primers could not be used to detect the expression of
fusion gene MLL-l/AFX in which the C-terminus of AFX fused to N-terminus of MLL-l
gene. FKHR primers crossed the fusion point of PAX-3 gene and FKHR gene, so the
FKHR primers could not detect the expression of fusion genes PAX-3/FKHR either, and
so maybe there is a fusion in BPH or P03 and that is why we did not see a FKHR band..
There are also point mutations and deletions in the N-terminal of qin gene, which RT-
PCR analysis would miss if FREAC-4 has the same kind of mutations and deletion. We
did find amplified sequences have differences when compare to FREAC sequences
(Figure 2), but the differences are most likely resulted from PCR artifacts or primers
mismatches (Figure 3). This will be discussed in detail later. Also if the designed primers
happened on the mutation region, the mutation would perhaps prevent binding of the
primer to the template DNA, so the detection of the gene would be missed.

We used sequencing and RT-PCR in the search for expression level of several
forkhead transcription factors, because elevated or otherwise inappropriate expression of

transcription factors has been implicated in tumorigenesis. We designed degenerate

28

primers based on the FREAC-4 subgroup of forkhead transcription factors. Fourteen
forkhead DBD sequences (all either FREAC-3 or 4) were found using PCa tissue cDNA.
All of the 14 sequences had different flanking oligonucleotide primer sequences (Figure
3). The nucleotide differences in the flanking primer region might simply be due to
mismatched oligonucleotides at the low annealing temperature of 48°C, so these
differences from published sequences are probably artifacts and not from novel
sequences. There are three sequences that have only one nucleotide different from
FREAC-4 gene. The changes include a serine (coded by ‘tcc’) to a proline (coded by
‘ccc’) and from a valine (coded by ‘gtg’) to a leucine (coded by ‘ctg’). Although the
serine to proline, valine and leucine are conservative changes, there are no other
nucleotide changes in the three sequences. Therefore these changes most likely result
from mutation during PCR amplification. The absence of novel forkhead DBD sequences
meant that we could concentrate on FREAC-3 and 4. It is interesting that FREAC—4 had
not previously been reported in the prostate (Pierrou et al. 1994). The absence of
FREAC-4, however, could perhaps be explained by our use of RT-PCR in contrast to the
less sensitive northern blotting technique used or because the previous study used normal
prostate tissue in contrast to the PCa tissue we used (Pierrou et a1. 1994).

We concentrated on detecting FREAC-4 expression because of its relatedness to
known oncogenic versions of qin (Freyaldenhoven et al. 1997b). Semiquantitative RT-
PCR was used to examine FREAC-4 mRNA levels in human PC and BPH tissues and
cell lines. Alterations in expression were not found in tumorigenic PCa versus non-
tumorigenic BPH tissue. Histologically, PCa is classical adenocarcinoma and made of

epithelial cells, whereas BPH has a variable composition ranging from a highly epithelial

29

but usually a fibromuscular type largely devoid of epithelial components. Unfortunately,
we did not have the histological information of the PCa and BPH tissue used to determine
the cellular composition. If we assume that the PCa was predominately epithelial and the
BPH predominately stromal then the equal expression between the PCa and BPH could
mean that epithelial and stromal cell types express FREAC-4 equally or that the increased
FREAC-4 mRNA levels are not characteristic of malignant prostate growth. Elevated c-
qin levels, however, can transform chicken embryo fibroblasts into tumorigenic cells
(Freyaldenhoven et al. 1997a). Unfortunately, we didn’t have normal prostate tissues
available to see if normal cells have low FREAC-4 and elevated FREAC-4 is associated
with both benign and malignant growth. However, in the SAGE analysis no FREAC-4
was detected in normal prostate tissue, or PCa tissue and LNCaP cell line for that matter.
The SAGE results suggest that the FREAC-4 expression is extremely low because it can
not be detected in over 100,000 tags (hgpzllbioinfoamcsaranl). Another explanation
relevant to tissues is that perhaps the expression is low because only a few cells of many
in the tissue express the FREAC-4. Maybe only cycling cells express it or only basal but
not lurninal epithelial cells do. The possibility of only certain cells expressing a gene can
be addressed by ISH. FREAC-4 expression level comparison was also done among
prostate cell lines LNCaP, LNCaP C4-2B, DU-145 and PC-3. Cell line LNCaP C4-2B
showed lower (2.2-fold) FREAC-4 expression than LNCaP and PC-3 did not have
FREAC-4 expression. This suggests that FREAC-4 expression is downregulated with
prostate cancer progression since C4-2B is amore tumorigenic, metastatic and androgen-
independent subline of LNCaP (Chen et al. 1998), whereas PC-3 is even more highly

metastatic and androgen-independent. The absence of FREAC-4 expression in PC-3 cell

30

line is very interesting since it correlates with the similar FKHR and FKHRLI forkhead
gene expression characteristics in PC-3 cell line in our studies. Since the three forkhead
genes are located in different chromosomes (FKHR in 13q, FKHRLl in 6q and FREAC-4
in 5q), the correlation of expression loss with chromosome loss in the P03 cell line for
the three forkhead genes can be discounted.

The second subgroup to be analyzed was the AFX forkhead subfamily in prostate
cancer tissue. Five members in this subfamily are known but only FKHRLI/AFX/FKHR
(not FKHRLlPl or FKHRPl) were found in PCa. We therefore could concentrate on
these three and their proposed role in promoting apoptosis via the PI3K pathway. Our
expectation was that decreases in transcription of one or more of the three forkhead
factors would aid oncogenesis.

Semiquantitative RT-PCR analysis showed that AFX levels are at least 7-fold
lower in BPH versus PCa tissues. The FKHR and FKHRLl expression patterns are
similar in that they are undetectable or barely detectable in BPH tissue, whereas they are
equally expressed among the three prostate cancer tissues. Interestingly, the PCB cell
line, in contrast to all other cell lines and PCa tissues, lacks FKHR and FKHRLl mRNA
expression. The PC-3 cell line is more resistant to apoptosis than LNCaP (Liu et al. 1998;
Sintich et al. 1999; de la et al. 1999). Possibly the resistance is due to lack of FKHR and
FKHRLl. It would be interesting to see if increased apoptosis could be restored in PC-3
cells transfected to express FKHR or FKHRLl. Several apoptosis proteins are expressed
differently among cell lines: PC-3 cells are p53-null whereas LNCaP cells express wild-
type P53 and DU-145 cells express mutant P53; P03 cells express more anti-apoptotic

protein Bcl-2 than LNCaP and DU-l45 cells; PC-3 cells also lack pro-apoptotic factor

31

Bak (Tang et al. 1998). It is conceivable that the decreased expression of FKHR and
FKHRLl is more important than AFX decreased expression in prostate cell
tumorigenesis.

P27KIPl is a target of AFX and FKHRLl forkhead transcription factors in
osteosarcoma cells U87MG and murine pre-B-cell line Ba/F3, respectively (Medema et
al. 2000; Dijkers et al. 2000). The Cyclin E/Cdk2 inhibitor p27KIPl is involved in cell
cycle control by acting as a barrier to Gl-S transition. P27KIPl preferentially binds to and
inactivates the Cyclin E/Cdk2 complexes, therefore inhibiting entry into S-phase
(Slingerland et al. 1994). BPH, prostatic intraepithelial neoplasia (PIN), and PCa all
exhibit decreased levels of p27KlPl (Yang et al. 1998). Normal human prostate tissue
exhibited high levels of p27KIPl mRNA in both epithelial cells and stromal cells (Yang et
al. 1998). However, p27Km mRNA was almost undetectable in epithelial and stromal
cells of BPH lesions (Cordon-Cardo et al. 1998). In contrast to BPH, PCa was found to
contain abundant p27KIPl mRNA (Cordon-Cardo et al. 1998). Our results similarly show
that the mRNA expression of p27”?1 was abundant in PCa tissues but undetectable in
BPH tissue. Interestingly, the lack P27KIPl correlates with the lack of FKHRLl and very
low levels of FKHR mRNA in BPH.

BPH and PCa have been suggested to share a common origin because they
commonly coexist and are both androgen dependent (Scher et al. 1995 ; Oesterling 1996).
However, since BPH occurs in the periurethral transitional region of the human prostate,
and 70% of PCa arises from the peripheral zone (De Marzo et al. 1999), the relationship
between BPH and PCa remains unclear. It is likely that prostate cancers arise from

prostatic intraepithelial neoplasia (PIN) instead of BPH. PIN shares similar genetic

32

lesions to prostate cancer (Haggman et al. 1997; Qian et al. 1999). The results on
forkhead gene expression certainly are consistent with the expected different origins of
BPH and Pca.

The active non-phosphorylated forms of FKHRLI and AFX may affect cell cycle
regulation by inducing the expression of p27KIP1. As found for FKHR and FKHRLl, PC-
3 cells in contrast to all other cell lines and PCa tissues, lack p27KIP1 expression. The very
low levels of FKHR and FKHRLl that were found in this study could explain the
lowered p27KIP1 in PC-3. It was not unexpected that p27KIP1 mRNA should be low in
PC-3 cell line because it is more invasive and metastatic than LNCaP and low levels
correlate with more advanced cancers (Medema et al. 2000). Furthermore these data
suggest that perhaps FKHR and/or FKHRLl but not AFX is capable of increasing the

expression of the p27KIP1

gene transcription in prostate cancer cells. This hypothesis
would be testable by transfection of the FKHRLl or FKHR gene into PC-3 ressulting in
increased P27KIP' levels.

The results presented here provide an initial analysis of the role of forkhead
proteins in prostate tumorigenesis. Our survey of forkhead gene expression indicates

where efforts can now be directed to analyze the function of this important class of

transcriptional regulators in prostate cancer.

33

10.

ll.

12.

Reference List

. Anderson,M.J., Viars,C.S., Czekay,S., Cavenee,W.K., and Arden,K.C., Cloning and

characterization of three human forkhead genes that comprise an FKHR-like gene
subfamily, Genomics, 47 (1998) 187-199.

Ang,S.L. and Rossant,J., I-INF-3 beta is essential for node and notochord formation
in mouse development, Cell, 78 (1994) 561-574.

Ang,S.L., Wierda,A., Wong,D., Stevens,K.A., Cascio,S., Rossant,J., and Zaret,K.S.,
The formation and maintenance of the definitive endoderm lineage in the mouse:
involvement of HNF3/forkhead proteins, Development, 119 (1993) 1301-1315.

Bork,P., Ouzounis,C., Sander,C., Scharf,M., Schneider,R., and Sonnhammer,E.,
Comprehensive sequence analysis of the 182 predicted open reading frames of yeast
chromosome 111, Protein Sci., 1 (1992) 1677-1690.

Borkhardt,A., Repp,R., Haas,O.A., Leis,T., Harbott,J., Kreuder,J., Hammerrnann,J.,
Henn,T., and Lampert,F., Cloning and characterization of AFX, the gene that fuses
to MLL in acute leukemias with a t(X;1 1)(q13;q23), Oncogene, 14 (1997) 195-202.

Bova,G.S. and Isaacs,W.B., Review of allelic loss and gain in prostate cancer,
World J Urol., 14 (1996) 338-346.

Brunet,A., Bonni,A., Zigmond,M.J., Lin,M.Z., Juo,P., Hu,L.S., Anderson,M.J.,
Arden,K.C., Blenis,J., and Greenberg,M.E., Akt promotes cell survival by
phosphorylating and inhibiting a Forkhead transcription factor, Cell, 96 (1999) 857-
868.

Castagnaro,M., Yandell,D.W., Dockhom-Dwomiczak,B., Wolfe,H.J., and
Poremba,C., [Androgen receptor gene mutations and p53 gene analysis in advanced
prostate cancer], Verh Dtsch Ges Pathol., 77 ( 1993) 119-123.

Chen,M.E., Lin,S.H., Chung,L.W., and Sikes,R.A., Isolation and characterization of
PAGE-1 and GAGE-7. New genes expressed in the LNCaP prostate cancer

progression model that share homology with melanoma-associated antigens, J Biol
Chem., 273 (1998) 17618-17625.

Chirgwin,J.M., Przybyla,A.E., MacDonald,R.J., and Rutter,W.J., Isolation of
biologically active ribonucleic acid from sources enriched in ribonuclease,
Biochemistry, 18 (1979) 5294-5299.

Clark,K.L., Halay,E.D., Lai,E., and Burley,S.K., Co-crystal structure of the HNF-
3/fork head DNA-recognition motif resembles histone H5, Nature, 364 (1993) 412-
420.

Clevidence,D.E., Overdier,D.G., Tao,W., Qian,X., Pani,L., Lai,E., and Costa,R.H.,
Identification of nine tissue-specific transcription factors of the hepatocyte nuclear

34

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

factor 3/forkhead DNA-binding-domain family, Proc Natl Acad Sci U S A, 90
(1993) 3948-3952.

Cordon-Cardo,C., Koff,A., Drobnjak,M., Capodieci,P., Osman,I., Millard,S.S.,
Gaudin,P.B., Fazzari,M., Zhang,Z.F., Massague,J., and Scher,H.I., Distinct altered

patterns of p27KIP1 gene expression in benign prostatic hyperplasia and prostatic
carcinoma, J Natl Cancer Inst., 90 (1998) 1284-1291.

Cote,R.J., Shi,Y., Groshen,S., Feng,A.C., Cordon-Cardo,C., Skinner,D., and
Lieskovosky,G., Association of p27Kip1 levels with recurrence and survival in
patients with stage C prostate carcinoma, J Natl Cancer Inst., 90 (1998) 916-920.

Dalphin,M.E., Brown,C.M., Stockwell,P.A., and Tate,W.P., The translational signal
database, TransTerm: more organisms, complete genomes, Nucleic Acids Res., 25
(1997) 246-247.

Davis,R.J., D’Cruz,C.M., Lovell,M.A., Biegel,J.A., and Barr,F.G., Fusion of PAX7
to FKHR by the variant t(1;13)(p36;q14) translocation in alveolar
rhabdomyosarcoma, Cancer Res, 54 (1994) 2869-2872.

de la,T.A., Hayek,O.R., Buttyan,R., Bagiella,E., Burchardt,M., and Katz,A.E.,
Effects of a phytotherapeutic agent, PC-SPES, on prostate cancer: a preliminary
investigation on human cell lines and patients, BIU Int., 84 (1999) 845-850.

De Marzo,A.M., Coffey,D.S., and Nelson,W.G., New concepts in tissue specificity
for prostate cancer and benign prostatic hyperplasia, Urology, 53 (1999) 29-39.

Denmeade,S.R., Lin,X.S., and Isaacs,J.T., Role of programmed (apoptotic) cell
death during the progression and therapy for prostate cancer, Prostate, 28 (1996)
251-265.

Dijkers,P.F., Medema,R.H., Pals,C., Banerji,L., Thomas,N.S., Lam,E.W.,
Burgering,B.M., Raaijmakers,J.A., Lammers,J.W., Koenderman,L., and Coffer,P.J.,
Forkhead transcription factor FKHR-Ll modulates cytokine-dependent
transcriptional regulation of p27(KIPl) [In Process Citation], Mol Cell Biol., 20
(2000) 9138-9148.

Emstsson,S., Pierrou,S., Hulander,M., Cederberg,A., Hellqvist,M., Carlsson,P., and
Enerback,S., Characterization of the human forkhead gene FREAC-4. Evidence for
regulation by Wilms’ tumor suppressor gene (WT -1) and p53, J Biol Chem, 271
(1996) 21094-21099.

Fredericks,W.J., Galili,N., Mukh0padhyay,S., Rovera,G., Bennicelli,J., Barr,F.G.,
and Rauscher,F.J., III, The PAX3-FKHR fusion protein created by the t(2;13)

translocation in alveolar rhabdomyosarcomas is a more potent transcriptional
activator than PAX3, Mol Cell Biol., 15 (1995) 1522-1535.

35

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

Freyaldenhoven,B.S., Freyaldenhoven,M.P., Iacovoni,J.S., and Vogt,P.K., Aberrant
cell growth induced by avian winged helix proteins, Cancer Res., 57 (1997a) 123-
129. -

Freyaldenhoven,B.S., Freyaldenhoven,M.P., Iacovoni,J.S., and Vogt,P.K., Avian
winged helix proteins CWH-1, CW H-2 and CW H-3 repress transcription from Qin
binding sites, Oncogene, 15 (1997b) 483-488.

Furuyama,T., N akazawa,T., Nakano,I., and Mori,N., Identification of the
differential distribution patterns of mRNAs and consensus binding sequences for
mouse DAF-16 homologues, Biochem J., 349 (2000) 629-634.

Galili,N., Davis,R.J., Fredericks,W.J., Mukhopadhyay,S., Rauscher,F.J., III,
Emanuel,B.S., Rovera,G., and Barr,F.G., Fusion of a fork head domain gene to

PAX3 in the solid tumour alveolar rhabdomyosarcoma [published erratum appears
in Nat Genet 1994 Feb;6(2):214], Nat Genet., 5 (1993) 230-235.

Greenlee,R.T., Murray,T., Bolden,S., and Wingo,P.A., Cancer statistics, 2000, CA
Cancer J Clin., 50 (2000) 7-33.

Guo,S., Rena,G., Cichy,S., He,X., Cohen,P., and Unterman,T., Phosphorylation of
serine 256 by protein kinase B disrupts transactivation by FKHR and mediates
effects of insulin on insulin-like growth factor-binding protein-1 promoter activity
through a conserved insulin response sequence, J Biol Chem., 274 (1999) 17184-
17192.

Haggman,M.J., Macoska,J.A., Wojno,K.J., and Oesterling,J.E., The relationship
between prostatic intraepithelial neoplasia and prostate cancer: critical issues, J
Urol., 158 (1997) 12-22.

Horikoshi,S., Fukuda,K., Ray,P.E., Sawada,M., Bruggeman,L.A., and
Klotman,P.E., A PCR method for the quantitative assessment of mRNA for laminin
A, B1, and B2 chains, Kidney Int., 42 (1992) 764-769.

Horoszewicz,J.S., Leong,S.S., Kawinski,E., Karr,J.P., Rosenthal,H., Chu,T.M.,
Mirand,E.A., and Murphy,G.P., LNCaP model of human prostatic carcinoma,
Cancer Res., 43 (1983) 1809-1818.

Kaestner,K.H., Lee,K.H., Schlondorff,J., Hiemisch,H., Monaghan,A.P., and
Schutz,G., Six members of the mouse forkhead gene family are developmentally
regulated, Proc Natl Acad Sci U S A, 90 (1993) 7628-7631.

Kaestner,K.H., Silberg,D.G., Traber,P.G., and Schutz,G., The mesenchymal winged
helix transcription factor Fkh6 is required for the control of gastrointestinal
proliferation and differentiation, Genes Dev., 11 (1997) 1583-1595.

Kaufmann,E. and Knochel,W., Five years on the wings of fork head, Mech Dev., 57
(1996) 3-20.

36

35.

36.

37.

38.

39.

40.

41.

42.

43.

45.

Kennedy,S.G., Wagner,A.J., Conzen,S.D., Jordan,J., Bellacosa,A., Tsichlis,P.N.,
and Hay,N., The PI 3-kinase/Akt signaling pathway delivers an anti-apoptotic
signal, Genes Dev., 11 (1997) 701-713.

Knochel,S., Lef,J., Clement,J., Klocke,B., Hille,S., Koster,M., and Knochel,W.,
Activin A induced expression of a fork head related gene in posterior

chordarnesoderrn (notochord) of Xenopus laevis embryos, Mech Dev., 38 (1992)
157-165.

Kops,G.J., de Ruiter,N.D., Vries-Smits,A.M., Powell,D.R., Bos,J.L., and
Burgering,B.M., Direct control of the Forkhead transcription factor AFX by protein
kinase B, Nature, 398 (1999) 630-634.

Kyprianou,N., English,H.F., and Isaacs,J.T., Programmed cell death during
regression of PC-82 human prostate cancer following androgen ablation, Cancer
Res., 50 (1990) 3748-3753.

Li,J., Simpson,L., Takahashi,M., Miliaresis,C., Myers,M.P., Tonks,N., and
Parsons,R., The PTEN/MMACI tumor suppressor induces cell death that is rescued
by the AKT/protein kinase B oncogene, Cancer Res., 58 (1998) 5667-5672.

Li,J., Thurm,H., Chang,H.W., Iacovoni,J.S., and Vogt,P.K., Oncogenic
transformation induced by the Qin protein is correlated with transcriptional
repression, Proc Natl Acad Sci U S A, 94 (1997a) 10885-10888.

Li,J. and Vogt,P.K., The retroviral oncogene qin belongs to the transcription factor
family that includes the homeotic gene fork head, Proc Natl Acad Sci U S A, 90
(1993) 4490-4494.

Li,J., Yen,C., Liaw,D., Podsypanina,K., Bose,S., Wang,S.I., Puc,J., Miliaresis,C.,
Rodgers,L., McCombie,R., Bigner,S.H., Giovanella,B.C., Ittmann,M., Tycko,B.,
Hibshoosh,H., Wigler,M.H., and Parsons,R., PTEN, a putative protein tyrosine
phosphatase gene mutated in human brain, breast, and prostate cancer, Science, 275
(1997b) 1943-1947.

Liu,Q.Y., Rubin,M.A., Omene,C., Lederman,S., and Stein,C.A., Fas ligand is
constitutively secreted by prostate cancer cells in vitro, Clin Cancer Res., 4 (1998)
1803-1811.

Lloyd,R.V., Erickson,L.A., Jin,L., Kulig,E., Qian,X., Cheville,J.C., and
Scheithauer,B.W., p27kip1: a multifunctional cyclin-dependent kinase inhibitor
with prognostic significance in human cancers, Am J Pathol., 154 (1999) 313-323.

Medema,R.H., Kops,G.J., Bos,J.L., and Burgering,B.M., AFX-like Forkhead
transcription factors mediate cell-cycle regulation by Ras and PKB through
p27kip1, Nature, 404 (2000) 782-787.

37

46.

47.

48.

49.

50.

51.

52.

53.

54.

55.

56.

57.

Miller,L.M., Gallegos,M.E., Morisseau,B.A., and Kim,S.K., 1in-31, a
Caenorhabditis elegans HNF-3/fork head transcription factor homolog, specifies
three alternative cell fates in vulva] development, Genes Dev., 7 (1993) 933-947.

Monaghan,A.P., Kaestner,K.H., Grau,E., and Schutz,G., Postimplantation
expression patterns indicate a role for the mouse forkhead/HNF-3 alpha, beta and
gamma genes in determination of the definitive endoderm, chordarnesoderm and
neuroectoderm, Development, 119 (1993) 567-578.

Murtha,P., Tindall,D.J., and Young,C.Y., Androgen induction of a human prostate-
specific kallikrein, hKLK2: characterization of an androgen response element in the
5’ promoter region of the gene, Biochemistry, 32 (1993) 6459-6464.

Nakae,J., Park,B.C., and Accili,D., Insulin stimulates phosphorylation of the
forkhead transcription factor FKHR on serine 253 through a Wortmannin-sensitive
pathway, J Biol Chem., 274 (1999) 15982-15985.

Nihei,N., Ichikawa,T., Kawana,Y., Kuramochi,H., Kugo,H., Oshimura,M.,
Killary,A.M., Rinker-Schaeffer,C.W., Barrett,J.C., Isaacs,J.T., and ., Localization of
metastasis suppressor gene(s) for rat prostatic cancer to the long arm of human
chromosome 10, Genes Chromosomes Cancer, 14 (1995) 112-119.

Oesterling,J.E., Benign prostatic hyperplasia: a review of its histogenesis and
natural history, Prostate Suppl, 6 (1996) 67-73.

Ogg,S. and Ruvkun,G., The C. elegans PTEN homolog, DAF-18, acts in the insulin
receptor-like metabolic signaling pathway, Mol Cell, 2 (1998) 887-893.

Overdier,D.G., Porcella,A., and Costa,R.H., The DNA-binding specificity of the
hepatocyte nuclear factor 3/forkhead domain is influenced by amino-acid residues
adjacent to the recognition helix, Mol Cell Biol., 14 (1994) 2755-2766.

Paradis,S. and Ruvkun,G., Caenorhabditis elegans Akt/PKB transduces insulin
receptor-like signals from AGE-1 P13 kinase to the DAF-l6 transcription factor,
Genes Dev., 12 (1998) 2488-2498.

Parker,S.L., Tong,T., Bolden,S., and Wingo,P.A., Cancer statistics, 1997, CA
Cancer J Clin., 47 (1997) 5-27.

Parry,P., Wei,Y., and Evans,G., Cloning and characterization of the t(X;11)
breakpoint from a leukemic cell line identify a new member of the forkhead gene
family, Genes Chromosomes Cancer, 11 (1994) 79-84.

Pierrou,S., Hellqvist,M., Samuelsson,L., Enerback,S., and Carlsson,P., Cloning and
characterization of seven human forkhead proteins: binding site specificity and
DNA bending, EMBO J ., 13 (1994) 5002-5012.

38

58.

59.

60.

61.

62.

63.

65.

66.

67.

68.

Qian,J., Jenkins,R.B., and Bostwick,D.G., Genetic and chromosomal alterations in

prostatic intraepithelial neoplasia and carcinoma detected by fluorescence in situ
hybridization, Eur Urol., 35 (1999) 479-483.

Ramaswamy,S., Nakamura,N., Vazquez,F., Batt,D.B., Perera,S., Roberts,T.M., and
Sellers,W.R., Regulation of G1 progression by the PTEN tumor suppressor protein
is linked to inhibition of the phosphatidylinositol 3-kinase/Akt pathway, Proc Natl
Acad Sci U S A, 96 (1999) 2110-2115.

Sadar,M.D., Hussain,M., and Bruchovsky,N., Prostate cancer: molecular biology of
early progression to androgen independence, Endocr Relat Cancer, 6 (1999) 487-
502.

Scher,H.I., Steineck,G., and Kelly,W.K., Horrnone-refractory (D3) prostate cancer:
refining the concept, Urology, 46 (1995) 142-148.

Shapiro,D.N., Sublett,J.E., Li,B., Downing,J.R., and Naeve,C.W., Fusion of PAX3
to a member of the forkhead family of transcription factors in human alveolar
rhabdomyosarcoma, Cancer Res, 53 (1993) 5108-5112.

Sintich,S.M., Steinberg,J., Kozlowski,J.M., Lee,C., Pruden,S., Sayeed,S., and
Sensibar,J.A., Cytotoxic sensitivity to tumor necrosis factor-alpha in PC3 and
LNCaP prostatic cancer cells is regulated by extracellular levels of SGP—2
(clusterin), Prostate, 39 (1999) 87-93.

SlingerlandJ.M., Hengst,L., Pan,C.H., Alexander,D., Stampfer,M.R., and Reed,S.I.,
A novel inhibitor of cyclin-Cdk activity detected in transforming growth factor
beta-arrested epithelial cells, Mol Cell Biol., 14 (1994) 3683-3694.

Steck,P.A., Pershouse,M.A., Jasser,S.A., Yung,W.K., Lin,H., Ligon,A.H.,
Langford,L.A., Baumgard,M.L., Hattier,T., Davis,T., Frye,C., Hu,R., Swedlund,B.,
Teng,D.H., and Tavtigian,S.V., Identification of a candidate tumour suppressor

gene, MMACl, at chromosome 10q23.3 that is mutated in multiple advanced
cancers, Nat Genet., 15 (1997) 356-362.

Strahle,U., Blader,P., Henrique,D., and Ingharn,P.W., Axial, a zebrafish gene
expressed along the developing body axis, shows altered expression in cyclops
mutant embryos, Genes Dev., 7 (1993) 1436-1446.

Tang,D.G., Li,L., Chopra,D.P., and Porter,A.T., Extended survivability of prostate
cancer cells in the absence of trophic factors: increased proliferation, evasion of
apoptosis, and the role of apoptosis proteins, Cancer Res, 58 (1998) 3466-3479.

Taplin,M.E., Bubley,G.J., Shuster,T.D., Frantz,M.E., Spooner,A.E., Ogata,G.K.,
Keer,H.N., and Balk,S.P., Mutation of the androgen-receptor gene in metastatic
androgen-independent prostate cancer, N Engl J Med., 332 (1995) 1393-1398.

39

69.

70.

71.

72.

73.

74.

75.

76.

77.

78.

79.

Toyoshima,H. and Hunter,T., p27, a novel inhibitor of GI cyclin-Cdk protein
kinase activity, is related to p21, Cell, 78 (1994) 67-74.

Tsihlias,J., Kapusta,L.R., DeBoer,G., Morava—Protzner,I., Zbieranowski,I.,
Bhattacharya,N., Catzavelos,G.C., Klotz,L.H., and Slingerland,J.M., Loss of cyclin-
dependent kinase inhibitor p27Kip1 is a novel prognostic factor in localized human
prostate adenocarcinoma, Cancer Res, 58 (1998) 542-548.

Velculescu,V.E., Zhang,L., Vogelstein,B., and Kinzler,K.W., Serial analysis of
gene expression, Science, 270 (1995) 484-487.

Venter,J.C., Adams,M.D., and Myers,E.W., The sequence of the human genome,
Science, 291 (2001) 1304-1351.

Weigel,D., Jurgens,G., Kuttner,F., Seifert,E., and J ackle,H., The homeotic gene
fork head encodes a nuclear protein and is expressed in the terminal regions of the
Drosophila embryo, Cell, 57 (1989) 645-658.

Whang,Y.E., Wu,X., Suzuki,H., Reiter,R.E., Tran,C., Vessella,R.L., Said,J.W.,
Isaacs,W.B., and Sawyers,C.L., Inactivation of the tumor suppressor

PTEN/MMACI in advanced human prostate cancer through loss of expression,
Proc Natl Acad Sci U S A, 95 (1998) 5246-5250.

Wu,X., Senechal,K., Neshat,M.S., Whang,Y.E., and Sawyers,C.L., The
PTEN/MMACI tumor suppressor phosphatase functions as a negative regulator of
the phosphoinositide 3-kinase/Akt pathway, Proc Natl Acad Sci U S A, 95 (1998)
15587-15591.

Xuan,S., Baptista,C.A., Balas,G., Tao,W., Soares,V.C., and Lai,E., Winged helix
transcription factor BF—l is essential for the development of the cerebral
hemispheres, Neuron, 14(1995) 1141-1152.

Yang,R.M., Naitoh,J., Murphy,M., Wang,H.J., Phillipson,J., deKernion,J.B.,
Loda,M., and Reiter,R.E., Low p27 expression predicts poor disease-free survival in
patients with prostate cancer, J Urol., 159 (1998) 941-945.

Zentella,A., Weis,F.M., Ralph,D.A., Laiho,M., and Massague,J., Early gene
responses to transforming growth factor-beta in cells lacking growth-suppressive
RB function, Mol Cell Biol., 11 (1991) 4952-4958.

Zhang,L., Zhou,W., Velculescu,V.E., Kem,S.E., Hruban,R.H., Hamilton,S.R.,
Vogelstein,B., and Kinzler,K.W., Gene expression profiles in normal and cancer
cells, Science, 276 (1997) 1268-1272.

40

4920 ._. to.» 0:363

 

 

 

 

 

 

 

 

 

Geno moncoaoo Que cg
magnum—em?

mmm>o «case—:3. moamo >m®oomoooq><40m4><<<<o $0
3533 Ooo>0momx0m>mojmaooo

>nx «53.3.2 833 00m4000®§>><0<<040§4> 80
$2333 mamm00m>4<0>mjojoo>

>mx monmo 004>0404>0004>Ojo>>00>0> NB
mammoamo o0960.9.0odmoamoqmodqooeflmmepmo

29:» «came >0>0004m0004>ojo>> 3o
mazmoamo >._.o>._.oo._.0j.omm.«o>._.>

IAIN: «came >40>00®>>04000>>0>0 8w
mammoamo o>0>004000>000>0404

nude} mosmo 00404400000009.0036 3m
mazmoamo 40400400>o>0>>00000

_u mm>oL mosmo 4000234040095: 3 ._
mazmozmo gage-«00004000

960... «came >oo>o>®qoo>amoo>qo>o 5mm
mammoamo doo>oo>000d0100404>

 

Amu> man 0. <uo man A. mum man 0. <<u> man ._.. Xum man .3

41

Insulin

kinase HM?" 210,45) PI(4,5)P2
p kinas ° hosphatase
\ +P lagsi -P
Cytoplasm

 

 

 

 

 

Nucleus
+
Cyclin E/CDK2
i + Apoptosis
G0 cell
cycle arrest

Figure 1. Forkhead genes and PI3K signaling pathway. Insulin activates
PI3 -kinase via autophosphorylation of the insulin receptor. PI3K produces
phosphatidylinositol 3,4,5-triphosphate (PI(3,4,5)P3) that acts as a second
messenger to recruit AKT to the plasma membrane. AKT becomes
phosphorylated on T308 and 8473 by PIP(3, 4, 5)P3. PTEN is a lipid
phosphatase which can degrade PIP3, thereby negatively regulating AKT
activation. AKT can phosphorylate and inactive forkhead transcription
factors (AF X, FKHR, and FKHRL 1), which results in forkhead retention in
the cytoplasm. Thus, phosphorylation of forkhead factors by AKT
suppresses transcription of their target genes, p27KIPI and Fas. Upregulation
of p27KIPl is linked to cell cycle arrest in Go through its inhibition of

cyclin E/CDKZ complexes. Fas ligand gene promotes apoptosis.

42

 

 

3mm qmom»m mmmmzm mo»Hoz qumma mmonm.z»qum »m»mmm as mmm
zoo qmmm»m mmmmzH mo»Hoz mmHmmm mmonm.z»qu» »m»mmm was om
mmm.xznm»m mamas» ma»»oz ABHMMQ mazaumbzqu<H »m»mmx mtoemmm
zoo qmmm»» mmmwmm mmonm m»qmmm mmqum.z»qum »m»mmm we mmm
30m qmom»» mmmme mmonm Mqumm mmomHm.z»qu> »m»mmm was um
zmo mm»m»» mmmomH mmonm Amqmmm mmqum.z»Hm<m »m»mmz ms om
3mm qmmm»» mmmomH mmommm qeqmmm mmoqam zBqum »m»mmm mas om
3mm mmom»» mmmwmm mmonm qmqmmm mmqum.z»Hmmm »m»mmm ems mmozq
gem mmmm»» mmmme mmonm mmqmmm mmqum.zqu<m »ssssm mme mmm
3mg mmmm»» mmmme mmonm qeqmmm mmqum.zeHmmm »m»mmm Hms mmm
zoo qmmm»» mmswmm mmonm qmqmmm mmqum.z»qum »m»mmm was um
:00 qmmm»» mmmomH mmonm qmqmmm mmqum.z»qum »m»mmm me om
3mg qmom»» mmmme mmonm asqmmm mmqum.z»qum »m»mmm oat om
mom qmmm»» mmmomm mmonm qeqmmm mmqum.z»Hq¢m »m»mmm efis om
3mg qmmm»» mmmwm» mmonm memmmm mmqum.z»qum »m»mmm me om
3mm mumm»» mmmomn mmommm qaqum mmanHagzqueu »m»mmx alumnae

MO 9mg 0&0

.mcwwuoum MHHEMM mum ates:

on vwaofiam Umcwmuno awocwnvwm mo HGQEGUAH¢_.N whamflm

43

Figure 3. DNA Sequences of the primers used:

 

 

Sense primer: 5' ARGCCRCCCTAYTCSTAYWYC
FREAC-4: 5' AAGCCGCCCTACTCGTATATC
PC #3: 5’ AQGCCGCCCTACTCQTATTQC
PC #17: 5’ AGGCCGCCCTATTCCTATTCC
PC #10: 5' AGGCCGCCCTATTCCTACTTC
PC #9: 5’ AGGCCACCCTATTCCTACTTC
PC #15: 5’ A§GCCGCCCTACTC§TA§TTC
PC #13: 5' ??GCCGCCCTA£TCGTATT§C
PC #2: 5' TGGCCGCCCTACTCCTATTTC
PC #16: 5’ ?????GCCCTACTCGTAT§TC
BPH #21: 5’ AAGCCGCCCTATTCGTAEEQC
BPH #26: 5' ??????CCCTACTCGTA§I§C
BPH #38: 5’ ???????????????TATTCC
LNCap #26: 5’ AGGCCGCCCTATTCQTATITC
FREAC-3: 5’ AAGCCGCCCTATAGCTACATC
PC #12: 5’ AAGCCGCCCTATTQCTACAQC
BPH #7: 5’ AAGCCGCCCTATTQQTACTTC

Antisense primer:5’ GGGASAAGYTSCMSGSCTGGC

 

 

FREAC-4: 5' GGGAGAAGTTCCCCGCCTGGC
PC #3: 5' GGGAGAAGQTCCACGGCTGGC
PC #17: 5' GGGAGAAGQTQCCCGGCT???
PC #10: 5' GGGAEAAGQTQCTCGCCTGGC
PC #9: 5' GGGAGAAGTTGCAEGGCTGGC
PC #15: 5' GGGAGAAGCTCCAEGGCTGGC
PC #13: 5' GGGAGAAGQTCCACGCCTGGC
PC #2: 5' GGGAQAAGQTGCAQGCCTGGC
PC #16: 5' GGGAEAAGQTGCACGGCTGGC
BPH #21: 5' GGGAGAAGCTGCAGGCCTGGC
BPH #26: 5' GGGAGAAG§TCCAGGGCTGGC
BPH #38: 5' GGGAGAAGTTCGAGGGCTGGC
LNCaP #26: 5' GGGAQAAGTTCCACGCCTGGC
FREAC-3: 5' GGGACAACAAGCAGGGCTGGC
PC #12: 5' GGGAgAAGCTCCAGGGNTGGC

BPH #7: 5' GGGACAAGCTGCQGGQCTGGC

44

FREAC-4 293 PCa BPH LNCaP -RT

    

400
300
200

4—311bp

l 00
GAPDH 293 PCa BPH LNCaP -RT

400 45%?

300
200

100

 

Figure 4. RT-PCR analysis of the FREAC-4 expression in human PCa
(prostatic cancer tissue), BPH (benign prostatic hyperplasia tissue)
and prostatic cancer cell line LNCaP. Images of agarose gels stained
with ethidium bromide show electrophoretic bands corresponding to the
cDNA amplification products derived from PCR amplification using

F REAC-4 primers or GAPDH primers. Size of the molecular marker is
shown on the left of the pictures. 293 is a kidney cell line used as a
positive control for FREAC-4 expression. GAPDH is a housekeeping gene
used as a control for RNA loading and integrity. No band was found in the
reverse transcriptase (-RT) control.

45

A. FREAC-4

§

 

§ § §

PCR product image intensity
'8’

 

 

 

 

 

 

 

 

B. GAPDH
240
a? 220 -
2
2m ..
£3
.E 180 -
3:
160 -
cu
.§ 140
‘5
3 120 <
'0
9 100 «
a. so .
93
w d
O.
40 I Y 1 1* I fir
18 20 22 24 26 28 30 32

Cycle

 

Figure 5. PCR products as a function of PCR cycles for both Freac-4
and GAPDH cDNAs. Total RNA was reverse transcribed. The RT reaction
was used to: (A) amplify F reac-4 cDNA for 20-40 PCR cycles; (B) amplify
GAPDH cDNA for 20-30 PCR cycles.

240 -

220 -

2001

180A

160‘

140-

120 -

100-

PCR produce image intensity

80*

 

 

60 r l l T 1
0.0 0.2 0.4 0.6 0.8 1.0

RT concentration (pg)
RNA 0.2 0.4 0.6 0.8 pg

FREAC-4

 

Figure 6. PCR products as a function of the amount of template RNA.
Different amounts of FREAC-4 cDNAs (equivalent to 0.2-0.8 pg of total
RNA) were amplified for 30 cycles. The PCR products were plotted as a
function of total RNA made into cDNA.

47

PCR results of FREAC-4 expression in PCa tissues and BPH tissue

 

Relative FREAC-4 gene expression

 

 

PCa1 PCaZ PCa3 PCa4 BPH

FREAC-4

GAPDH

 

Figure 7. Semi-quantitative RT-PCR analysis of FREAC-4 gene expression
in human PCa tissues (PCal, PCa2, PCa3) and BPH tissue. Images of
agarose gels stained with ethidium bromide show bands corresponding to

the cDNA amplification products derived from PCR amplification using
FREAC-4 primers and GAPDH primers. Eight ul of cDNA was used for

F REAC-4 amplification, and 4 ul of cDNA used for GAPDH amplification.
The relative expression of FREAC-4 for each tissue specimen was normalized
to housekeeping gene GAPDH to control for RNA loading. Three experiments
were done for each sample with results expressed as the mean :ESD. No
statistically significant differences were found between the samples.

48

PCR results of FREAC-4 expression in prostate cancer cell lines
3 -

 

 

Relative FREAC-4 gene expression

-,, .4 r. . iL,. g .4. 1T." I;
LNCaP C4-2B DU—145 PC—3

FREAC—4 ” m 1“

GAPDH ”maneu—

Figure 8. Semi-quantitative RT-PCR analysis of FREAC-4 gene expression
in human prostate cancer cell lines (LNCaP, C4-2B, DU-145 and PC-3).
Images of agarose gel stained with ethidium bromide show bands
corresponding to the cDNA amplification products derived from PCR
amplification using FREAC-4 primers and GAPDH primers. Four ul of cDNA
was used for FREAC-4 amplification. The relative expression of F REAC-4 for
each cell line specimen was normalized to housekeeping gene GAPDH to
control for RNA loading. Three experiments were done for each sample with
results expressed as the mean iSD. The differences between the following
groups are statistically significant (p<0.05):LNCaP vs PC-3; C4-2B vs PC-3;
DU-l45 vs PC-3; and C4-2B vs DU-l45.

 

 

 

3.053 m. 3.90.5505" on. UwU moan—ounce no .595 E\§ acumen—HHK 30:5on
Nauru. «4ng ZufiHH. gum mag fingng 4W3 Kama 89.6 mg ~4ng
moo *m SmZfimK WUHHH gHmm mmumw bebmo HKMSZ <w0<mu 5393A mUmZm MWQSHA Zmawm
m0 #6 $52me .PUHHH. gHmm mmoxw Habmo HKMSZ <w0<m KEAUHA OUmZm mmrmsm Zmem
m0 #Ho SmmeK FUBHH gHmm mwcmw hebmo HKMSZ <w0<m KWHAUHA mUmZm mmwmsx 75me
mo *HH 95me% EubHe gHmm mwcmw fiebmo HKMSZ <w0<w Kmfidm GOMZm mwmzm Zmem
mo *HN SQZHMK PUBHH gHmm mmomw babmo HKHSZ <w0<m .KEAUHA mUmZm m>Q§ Zmem
mo Mawwo 2025mm. >UHHH gHmm mmcxw bahmo Hing <wO<w Kmficx momZm mPQSHA meww
m0 *m SOZEMK WUHHH WPHmm mmcmw habmo HKMZZ <w0<m KWHAUHA QUmZm mPQSW 75me
mo #NH 9.5me% POEMS. gHmm mmomw Habmo HKNSS <w0<m KEAUHA QUmZm mWQSN ZMHWE
mo #NN 95me% waHH gHmm mmomw bebmo HKMSZ <wO<m Kmfiox mUmZm mfimsm ZMHWE
m0 #Hq MMZOmK PUHHH gHmm mmoxw babmo HKMSZ <W0<w KWNUN mUmZm mmwmzm ZMme
men #m mmmefi WUfiHH gHmm mwoxw Habmo HKNZZ <w0<w KWXUW QUHZM mmwmsm Zmem
E SQZDmK guru—”m bfiHmm Eng fifififig 4W3 Kama QmZm myg ZmHWm
m0 #Ha SQZOmK Emme OWHMm >223» bago HKESZ <wa<w Kmfiox QUmZm mmrmsw ZMHWZ
m0 #4 wwwth ngm OPHmm wwmmw bago HKMSZ <we<m Kmficm QUmZm mvymsm Zmem
m0 *Hw SOZHM% ngm CWHmm vmmmw Han—.50 HKNSZ <wa<m KWNUN mDmZm m>®22 Zmem
mo #30 wwwwmw PMEHM CWH—mm Pwmxw bego HKHSZ <w8<w KWWUK QUmZm MPQSN ZMme
mo #Nw SQZEMK «(@me OfiHmm Nymmxw HHEO mezz <wa<m NEON mUmZm mWQSHA Zmem
ME «~ng gut—”P. Emu Eng figmbng 5% Hana 83.6 aura ZMHWE
m0 #Nb SQmeK WUEHH gHmm mama» bafimo HKMSZ §m<m KMHAUHA OUMZm mWQSW ZMHWE
m0 #N 2079mm. >UH.H_H. §Hmm mag Habmo HKWSZ §m<m .KEAUHA ODmZm m>OSN ZMme
m0 *Hm wQZHmK >UHHH §Hmm mmwmmw fiHHmO Hfiwzz SAM/2w KWWUN Qummw wmwww wwwwm

50

PCR results of AFX expression in PCa tissues and BPH tissue

 

 

 

Relative AF X gene expression
&

 

 

 

 

 

 

 

 

P031 P032 P083 BPH

GAPDH

 

Figure 10. Semi-quantitative RT-PCR analysis of AF X gene expression in
human PCa tissues and BPH tissue. Images of agarose gel stained with
ethidium bromide show bands corresponding to the cDNA amplification
products derived from PCR amplification using AF X primers and GAPDH
primers. Four ul of cDNA was used for AFX amplification. The relative
expression of AF X for each tissue specimen was normalized to housekeeping
gene GAPDH to control for RNA loading. Three experiments were done for
each sample with results expressed as the mean iSDThe difference between
PCa tissues and BPH tissue are statistically significant (p<0.05).

51

PCR results of AFX expression in prostate cancer cell lines

 

 

 

 

 

 

 

 

 

 

 

 

 

 

:: I I
.2

a

o 1 - '

a

><

0

O

8

on

E; T

.. i
E:

.9:

O

a:

o l I l l
LNCaP 04-28 DU-145 PC—3

 

Figure 11. Semi-quantitative RT-PCR analysis of AFX gene expression in
human prostate cancer cell lines (LNCaP, C4-2B, DU-l45, and PC-3).
Images of agarose gel stained with ethidium bromide show bands
corresponding to the cDNA amplification products derived fiom PCR
amplification using AF X primers and GAPDH primers. The relative expression
of AF X for each cell line specimen was normalized to housekeeping gene
GAPDH to control for RNA loading. Three experiments were done for each
sample with results expressed as the mean :l:SD. The differences between the
following groups are statistically significant (p<0.05): LNCaP vs DU-l45; C4-
ZB vs PC-3; and DU-l45 vs P03.

52

PCR results of FKHR expression in PCa tissues and BPH tissue

 

 

 

 

 

 

 

 

 

 

 

s a
8 4
'a 1
m
g i
35 3 _ T
O
t:
D
no
a 2 -
LL.
0
E:
2 1 P
D
a:
0 I I T l
PCa1 PCa2 PCa3 BPH
FKHR
GAPDH

 

Figure 12. Semi-quantitative RT-PCR analysis of FKHR gene
expression in human PCa tissues and BPH tissue. Images of agarose gel
stained with ethidium bromide show bands corresponding to the cDNA
amplification products derived from PCR amplification using FKHR
primers and GAPDH primers. Four ul of cDNA was used for FKHR
amplification. The relative expression of FKHR for each tissue specimen
was normalized to housekeeping gene GAPDH to control for RNA loading.
Three experiments were done for each sample with results expressed as the
mean :tSD. The difference between PCa tissues and BPH tissue are
statistically significant (p<0.05).

53

PCR results of FKHR expression in prostate cancer cell lines

 

 

3'!
t:
.2
a 2.
B
P
0
a
0
01)
g 1.
[A
O
a
.9.
0)
a:
0

 

 

 

 

 

 

 

Figure 13. Semi-quantitative RT-PCR analysis of FKHR gene expression
in human prostate cancer cell lines (LNCaP, C4-2B, DU-145, and PC-3).
Images of agarose gel stained with ethidium bromide show bands
corresponding to the cDNA amplification products derived fi'om PCR
amplification using FKHR primers and GAPDH primers. The relative
expression of FKHR for each cell line specimen was normalized to
housekeeping gene GAPDH to control for RNA loading. Three experiments
were done for each sample with results expressed as the mean :tSD. The
difi‘erences between the following groups are statistically significant
(p<0.05): LNCaP vs PC-3, C4-2B vs PC-3; and DU—l45 vs P03.

54

PCR results of FKHRL] expression in PCa tissues and BPH tissue

 

 

 

 

 

 

 

 

 

 

 

12 ‘1 1'

10 -1

8 -1

I T

6 s

4 '1

2 _

o I T I I

P081 P082 P083 BPH

FKHRLl
GAPDH

 

Figure 14. Semi-quantitative RT-PCR analysis of FKHRL] gene
expression in human PCa tissues and BPH tissue. Images of agarose gel
stained with ethidium bromide show bands corresponding to the cDNA
amplification products derived from PCR amplification using F KHRLl
primers and GAPDH primers. Four ul of cDNA was used for F KHRLI
amplification. The relative expression of FKHRLl for each tissue specimen
was normalized to housekeeping gene GAPDH to control for RNA loading.
Three experiments were done for each sample with results expressed as the
mean iSD. The difference between PCa tissues and BPH tissue are statistically
significant (p<0.05).

55

PCR results of FKHRL] expression in prostate cancer cell lines

 

 

 

 

 

 

 

 

 

 

 

3 1
G
.9
m
3
‘5.
X 2 a
O
O
G
D
00
'— i
5 1 q
[-14
0
E:
.9.
U
M

o l l I l l

LNCaP 04—23 DU-145 P0-3
FKHRL 1

 

 

Figure 15. Semi-quantitative RT-PCR analysis of FKHRL] gene
expression in human prostate cancer cell lines (LNCaP, C4-2B, DU-145,
and PC-3). Images of agarose gel stained with ethidium bromide show bands
corresponding to the cDNA amplification products derived from PCR
amplification using FKHRL] primers and GAPDH primers. The relative
expression of FKHRL] for each cell line specimen was normalized to
housekeeping gene GAPDH to control for RNA loading. Three experiments
were done for each sample with results expressed as the mean :l:SD. The
differences between the following groups are statistically significant (p<0.05):
LNCaP vs PC-3, C4-ZB vs PC-3; and DU-145 vs PC-3.

56

PCR results of p27KIP1 expression in PCa tissues and BPH tissue

21

.......

     

   

. -v. 7‘. v ‘ ‘ '
' ( . a. ‘- xl- s .
9:5_.r-'ir, JAN ‘-l U .-
.' L . _ .‘., “1‘, .
A]; fit.‘ _- a. ..
,. v .
. _ j. - ‘. "l u.
' . ' - .
. . = - \

  

Relative p27“1P1 gene expression

1 (.1 .
fl va-1Frlh "I.
. o
o .r D ‘1
a...
..‘

 

 

GAPDH

Figure 16. Semi-quantitative RT-PCR analysis of p27Km gene expression
in human PCa tissues and BPH tissue. Images of agarose gel stained with
ethidium bromide show bands corresponding to the cDNA amplification
products derived from PCR amplification using p27KIPl primers and GAPDH
primers. Four ul of cDNA was used for p27KIPl amplification. The relative
expression of p27KIPI for each tissue specimen was normalized to
housekeeping gene GAPDH to control for RNA loading. Three experiments
were done for each sample with results expressed as the mean :l:SD. The
difference between PCa tissues and BPH tissue are statistically significant

(p<0.05).

57

PCR results of p27'“”‘ expression in prostate cancer cell lines

 

 

 

Relative p27'm’l gene expression

 

 

 

 

 

 

 

 

LNCaP 04-28 DU-145 PC-3

p27KIP1
GAPDH m m “a. "I.

Figure 17. Semi—quantitative RT-PCR analysis of p27“"’1 gene expression
in human prostate cancer cell lines (LNCaP, C4-ZB, DU-145, and P03).
Images of agarose gel stained with ethidium bromide show bands
corresponding to the cDNA amplification products derived from PCR
amplification using p27KIPl primers and GAPDH primers. The relative
expression of p27KIP1 for each cell line specimen was normalized to
housekeeping gene GAPDH to control for RNA loading. Three experiments
were done for each sample with results expressed as the mean :bSD. The
differences between the following groups are statistically significant (p<0.05):
LNCaP vs PC-3, C4-ZB vs PC-3; and DU-145 vs PC-3.

 

58

SAGE analysis of the expression profile of forkhead transcription
factors and p27Km

[:1 Normal

E223 Primary Tumor
Tumor

- Cell Line LNCaP

PE???

 

' €57 fiflfiffifgfifi-‘ififi #13!“ 13.39%?

 

'1’15- .,'._.?;‘_. ' ' ‘;' ~,-":'A:J.L' _4 . car 3 .
’b..:c"~"-‘!~‘M'cfws‘.—3"F-r‘=rz'3s7x‘:: ‘x. “521::

SAGE tag numbers per 100,000

.3 S ’z-‘flafi

 

 

 

 

 

T ,

AFX FKHR FKHRL1 p27 FREAC-4 FREAC-2 HFH11A

Figure 18. Expression profiles by SAGE analysis. The expression levels in
the four libraries are normalized per 100,000 and are shown by gray scale
bars.

59

uHo'oofiflwmoo«I