k
4 r :3 :. .:
235'»...
.

3. .
‘ui. ...

(WEE .
i.

:
zafiaica
2
«111’: as...
.54
.t

l. 15:9:
_ . If! . . ,
, , .‘v
€1.5an
.99"...

in».

. It. .

. x .1523“; x ,
1“ Le. 4 n ‘

a i...

.9.

E

.. :2!!!
{Oil}. .2.
~| at"!
I~

.
.rt. ~n o e
.3. it...!n{.
x~v1 £91.]
1': p

. 49
. it; . .2t.
3 3

 

 

 

 

 

   

"g ~"""-'h';"lf“9‘??"lyiit’iiljgl’374),!03!?)‘3ay‘as”. um M .

 

too I ‘ LIBRARY
E'tiicl‘aigan Sim-:1
Unirmaéty

*1

 

 

This is to certify that the
dissertation entitled
THE XRN FAMILY OF 5'-3' EXORIBONUCLEASES
IN ARABIDOPSIS THALIANA
presented by

JAMES PAUL KASTENMAYER

has been accepted towards fulfillment
of the requirements for

Ph. D. degree in mm

 

W/A

M rofessor

 

Date 5/2/01

MS U i: an Affirmative Action/Equal Opportunity Institution 0- 12771

 

 

PLACE IN RETURN Box to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

DATE DUE DATE DUE DATE DUE

6/01 cJClRC/DateDuepGS—p. 15

 

 

THE XRN FAMILY OF 53' EXORIBONUCLEASES
IN
ARABIDOPSIS THALIANA
By

James Paul Kastenmayer

AN ABSTRACT OF A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
DOCTOR OF PHILOSOPHY
Department of Biochemistry and Molecular Biology
Department of Cell and Molecular Biology

2001

Professor Pamela]. Green

ABSTRACT
THE XRN FAMILY OF 5'-3' EXORIBONUCLEASES IN ARABIDOPSIS THALIAN A
By
James Paul Kastenmayer

The regulated expression of many genes requires selective and active degradation
of mRNAs in the cytoplasm. Insight into the manner by which plants identify targets for
rapid degradation has been gained in recent years, but there are many unresolved
questions about what occurs following this recognition event. In particular, the RNases
which catalyze mRN A decay in plants, and other multicellular eukaryotes, have not been
identified. The main goal of this dissertation was to investigate the possible role of
members of the Arabidopsis thaliana XRN-family of exoribonucleases in cytoplasmic
mRNA degradation, with a minor goal of examining the importance of deadenylation to
the mechanism of mRNA decay in plants.

The XRN-family of 5'-3' exoribonucleases was first described in budding yeast,
and is present in many eukaryotes, including plants. However, the XRN-family in
Arabidopsis has features that differ from those of other eukaryotes. Arabidopsis lacks an
ortholog of Xrnlp, the cytoplasmic enzyme in yeast responsible for the decay of the
majority of mRN As, but expresses three orthologs of Xm2p/Ratlp, a nuclear rRNA and
snoRNA processing enzyme in yeast. To characterize the basic features of the three
Arabidopsis XRN-like enzymes (AtXRNs), assays which made use of heterologous
expression in yeast xrn mutants were employed. The results of these experiments
demonstrated that all three of the AtXRNs are active as 5'-3' exoribonucleases when

expressed in yeast. In addition, the results of the studies of the AtXRNs in yeast

indicated that AtXRN4, in contrast to AtXRN 2 or AtXRN 3, might be a cytoplasmic
enzyme, and could therefore have a role in mRN A degradation.

To investigate these possibilities, the intracellular location of AtXRN4 in plant
cells was examined by localization of an AtXRN4-OFF fusion protein and mRNA decay
analyzed in an xrn4 mutant. AtXRN4-OFF accumulates in the cytoplasm, in contrast to
AtXRNZ-GFP and AtXRN3-GFP which are targeted to the nucleus. To directly examine
AtXRN4’s potential role in mRN A degradation in Arabidopsis, the decay of mRNAs in
an xm4 mutant was examined using DNA microarrays and northern blots. The
preliminary results of these experiments indicate that the decay of at least three mRNAs
is apparently altered in the xrn4 mutant. AtXRN4 could be a key enzyme in the decay
pathways of these mRNAs.

The mechanism by which mRN As are degraded in plant cells is unknown. Rapid
deadenylation is often a first step in the decay of unstable mRNAs in yeast and
mammalian systems, and could be a first step in the decay of some mRNAs in plants. To
investigate the importance of deadenylation to rapid mRN A decay in plants, the rate of

deadenylation of mRNAs in plants was examined using several methods.

ACKNOWLEDGEMENTS

First and foremost I would like to acknowledge my mentor Pam Green. Pam has
made so many contributions to this dissertation and my development as a researcher that I
couldn't begin to list all of them. Without her support and encouragement, not to mention
her remarkable enthusiasm, the research described in this dissertation would never have
been completed.

As with any Ph.D., there are many people who contributed to the work. I would
like to specifically recognize the technical support of Linda Danhof. The lab has always
been well maintained with almost any reagent you could want (look up!) and for anything
that we didn't have it would be ordered and received quickly. Linda has also supervised a
veritable army of undergraduates who have provided many helping hands. I would also
like to specifically recognize the efforts of Chris Behrens. Chris joined the lab as a
professorial assistant at a time when there were a lot of exiting experiments to be done,
but before we could do the experiments, a lot of work was required. His assistance
proved invaluable to several experiments in this thesis. I am also indebted to Ambro van
Hoof who supervised me during my rotation, and provided help with the experiments
using the yeast meA mutant. I'd also like to thank Shawn Anderson for providing me
with basic molecular biology skills while I was a technician, and for encouraging me to
attend graduate school at MSU.

Perhaps equally important are those who contributed to the atmosphere of the lab.
I've really enjoyed my experience as a graduate student in Pam's lab in large part because

of the other students and post-docs in the lab. I'd like to thank Mark Johnson, Nikki

iv

LeBrasseur, Rodrigo Gutierrez, Preet Lidder and Gustavo MacIntosh for being great
colleagues and friends.

Last, but certainly not least, I would like to thank my parents, my brother Tom,
my sister Susi and my fiancé Robin for their support and encouragement. Graduate
school has been a very exciting and rewarding experience and I am fortunate that I have

been able to share this with them.

 

 

 

 

 

 

 

 

 

 

 

 

 

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ............................................................................................... iv
LIST OF TABLES .............................................................................................................. x
LIST OF FIGURES ............................................................................................................ xi
LIST OF ABREVIATIONS .............................................................................................. xii
CHAPTER 1 ........................................................................................................................ 1

DEGRADATION OF mRNAs: CIS-ACTING ELEMENTS, THE BASAL mRNA
DECAY MACHINERY AND THE REGULATION OF mRNA TURNOVER

INTRODUCTION ............................................................................................................... 2
INSTABILITY DETERMINANTS TARGET SPECIFIC mRN As FOR RAPID
DEGRADATION ................................................................................................................ 3
Constitutive mRN A decay mediated by the DST-element ............................................. 4
Premature stop codons .................................................................................................... 5
Regulated mRNA degradation mediated by the SRE ..................................................... 7
5'-3' EXORIBONUCLEASES LH<ELY FUNCTION IN mRNA
DECAY IN PLANTS .......................................................................................................... 8
Natural mRNA degradation intermediates ...................................................................... 9
mRNA degradation intermediates induced by PTGS ................................................... 10
Degradation of RNAs in plant cell extracts .................................................................. 12
Xrnlp, A 5’-3’ EXORIBONUCLEASE, IS A MAJOR COMPONENT
OF THE BASAL mRNA DECAY MACHINERY OF YEAST ...................................... 12
Expression of poly(G)-containing genes in yeast results in the accumulation of
poly(G)-stabilized mRNA degradation intermediates ................................................... 17
THE FUNCTION OF Xrn2p/Ratlp, A SECOND S’-3’ EXORIBONUCLEASE OF
YEAST, PARTIALLY OVERLAPS WITH THE FUNCTIONS OF Xrnlp ................... 19
LINKS BETWEEN INSTABILITY DETERMINANTS AND THE BASAL mRNA
DECAY MACHINERY .................................................................................................... 21
SCOPE OF THIS THESIS ................................................................................................ 23
REFERENCES .................................................................................................................. 25

‘ 7'

~ r’ V‘swrrve— ~ v -

 

 

 

 

 

 

 

 

 

 

 

CHAPTER 2 ..................................................................................................................... 31
DEVELOPMENT OF ASSAYS TO STUDY THE XRN-FAMILY

OF ARABIDOPSIS
INTRODUCTION ............................................................................................................ 32
Analysis of XRN-enzyme activity on poly(G)-containing mRNAs ............................. 34
Use of a yeast meA mutant and poly(G)-containing mRNAs to analyze
the enzymatic activity of XRN enzymes ..................................................................... 36
Determining the intracellular localization of XRN-family members ........................... 4O
Localization of XRN-GFP fusion proteins in yeast ...................................................... 43
CONCLUSIONS ..................................... 45
REFERENCES ................................................................................................................. 46
CHAPTER 3 ..................................................................................................................... 48

NOVEL FEATURES OF THE XRN-FAMEY IN ARABIDOPSIS: EVIDENCE
THAT AtXRN4, ONE OF SEVERAL ORTHOLOGS OF NUCLEAR
Xrn2p/Ratlp, FUNCTIONS IN THE CYTOPLASM

ABSTRACT ...................................................................................................................... 49
INTRODUCTION ............................................................................................................ 50
MATERIALS AND METHODS ...................................................................................... 52
Cloning of AtXRN 3 and AtXRN4 cDNAs and analyses of sequences. ....................... 52
Complementation of yeast mutants ............................................................................... 53
Northern blot analyses of RNA from Arabidopsis plants ............................................. 53
Southern Blot Analysis ................................................................................................. 54
Construction of GFP-fusions and localization studies .................................................. 54
RESULTS ......................................................................................................................... 55
AtXRN 2, AtXRN 3 and AtXRN4 are orthologs of the Saccharomyces cerevisiae
protein Xrn2p/Rat1p ..................................................................................................... 55
AtXRN 2, AtXRN 3 and AtXRN4 are expressed in the major organs
of Arabidopsis .............................................................................................................. 59
AtXRN 2, AtXRN 3 and AtXRN4 function as 5'-3' exoribonucleases
and are blocked by poly(G) tracts when expressed in yeast ......................................... 59
AtXRN2 and AtXRN 3 but not AtXRN4 complements the ratI-I"s mutation .............. 62
AtXRN2-GFP is targeted to the nucleus while AtXRN4-GFP is cytoplasmic ............. 63
DISCUSSION ................................................................................................................... 68
REFERENCES ................................................................................................................. 73

vii

CHAPTER 4 ..................................................................................................................... 77
ANALYSIS OF mRN A DEGRADTION IN AN xm4 MUTANT INDICATES
THAT AtXRN4 MAY FUNCTION IN mRNA TURNOVER

INTRODUCTION ............................................................................................................ 78
RESULTS ......................................................................................................................... 80
Identification of T-DNA insertion alleles of the AtXRN genes ..................................... 80
Isolation of xm4-1 homozygotes .................................................................................. 83
Less than full-length AtXRN4 transcripts are expressed in xm4-I seedlings .............. 86
Full-length AtXRN4 transcript is not detected in homozygous xrn4-1 seedlings ........ 87
Phenotypic Characterization of xrn4-I homozygotes ................................................... 89
Preliminary Analysis of mRNA decay in xrn4-1 seedlings using
cDNA microarrays ....................................................................................................... 89
MATERIALS AND METHODS ...................................................................................... 98
PCR screening for T-DNA insertion mutants ............................................................... 98
Northern blot analysis ................................................................................................... 99
RT-PCR ......................................................................................................................... 99
Southern blot analysis ................................................................................................. 100
Microarray analysis ..................................................................................................... 100
DISCUSSION ................................................................................................................. 100
FUTURE EXPERIMENTS ............................................................................................ 103
Additional characterization of xm4-I ......................................................................... 103
Characterization of the PGRR transcript to gain insight into mRNA
decay mechanisms ..................................................................................................... 104
REFERENCES ............................................................................................................... 106
CHAPTER 5 ................................................................................................................... 108

INVESTIGATION OF THE ROLE OF DEADENYLATION IN mRN A DECAY IN
HIGHER PLANTS

INTRODUCTION .......................................................................................................... 109
RESULTS AND DISCUSSION ..................................................................................... 112
Analysis of deadenylation of Globin-ATAGATXZ-E9 by RN ase H cleavage .......... 114
Analysis of deadenylation of Globin-ATAGATXZ-E9 by PAT-PCR ....................... 118
CONCLUSIONS AND FUTURE PROSPECTS ........................................................... 123
MATERIALS AND METHODS .................................................................................... 124
RNase H cleavage ....................................................................................................... 124

viii

Actinomycin D time courses and northern analysis .................................................... 124

PAT-PCR .................................................................................................................... 125
REFERENCES ................................................................................................................ 127
SYNOPSIS ...................................................................................................................... 130
REFERENCES ................................................................................................................ 132

ix

 

"¥.

'4‘

 

 

 

 

 

LIST OF TABLES

Table 4-1. The position of the T-DN A insertions in the AtXRN genes ...................... 81
Table 4-2. Transcripts elevated in xrn4-I seedlings detected by microarray ............... 92
Table 4—3. Transcripts reduced in xrn4-1 seedlings detected by microarray ............... 93

LIST OF FIGURES
Figure 1-1. mRNA decay pathways in yeast .................................................................... 14

Figure 2-1. Analysis of the enzymatic activity of AtXRN2 on
poly(G)-containing mRNAs when expressed in yeast lacking

Xrnlp (xrnIA). .......................................................................................................... 37
Figure 3-1. The Arabidopsis proteins AtXRN2, AtXRN3 and

AtXRN4 are orthologs of the XmZp/Ratlp protein of S. cerevisiae. ....................... 56
Figure 3-2. Analysis of AtXRN expression ...................................................................... 60
Figure 3-3. All three AtXRNs function as exoribonucleases

which are blocked by poly(G) tracts when expressed in yeast ................................. 61
Figure 3-4. AtXRN2 and AtXRN 3 but not AtXRN4 complement the

rat] -1 ‘3 mutation ....................................................................................................... 63
Figure 3-5. AtXRN-GFP firsion proteins are functional. ................................................ 64
Figure 3-6. AtXRN2-OFF and AtXRN4-OPP localization ........................................... 66
Figure 4-1. Schematic diagram of T-DNA insertions in the AtXRN genes

and proteins ............................................................................................................... 81
Figure 4-2. Southern blot analysis of wildtype (WT) and xrn4-I plants ....................... 84

Figure 4-3. Less than full-length AtXRN4 transcripts are expressed
in xrn4-1 seedlings .................................................................................................... 87

Figure 4-4. Full-length AtXRN4 transcripts are not detected
in xrn4—1 homozygotes .............................................................................................. 88

Figure 4-5. Two transcripts detected as elevated in xrn4-1 seedlings
by microarray appear to be stabilized 3-5 fold .......................................................... 94

Figure 4-6. The decay of the PGRR transcript is accompanied
by the accumulation of an additional band in xrn4-I seedlings. ............................... 95

Figure 4-7. The additional band detected in xrn4-1 seedlings

corresponds to the 3' end of the PGRR transcript. .................................................... 97
Figure 5-1. The poly(A) tail of Globin-ATAGATXZ-E9 shortens over time ............. 115
Figure 5-2. Use of the PAT-PCR method to measure deadenylation .......................... 120

xi

www— -

@‘a‘

 

 

 

 

LIST OF ABREVIATIONS
ARE-AU-rich element
DAPI-4',6'-diamidino-2-phenylindole
DST-down stream element
EST-expressed sequence tag
GFP- green fluorescent protein
NLS-nuclear localization sequence
NMD-nonsense mediated mRN A decay
PARN-poly(A) ribonuclease
PAT-PCR-poly(A) test PCR
PCR-polymerase chain reaction
PGRR-putative glucose regulated repressor protein
PTGS-post transcriptional gene silencing
RACE-rapid amplification of cDNA ends
RT-reverse transcription
SD-synthetic drop out medium

snoRNA-small nucleolar RNA

xii

CHAPTER 1

DEGRADATION OF mRNAs: CIS-ACTING ELEMENTS, THE BASAL mRNA
DECAY MACHINERY AND THE REGULATION OF mRN A TURNOVER

 

 

 

 

 

INTRODUCTION

Of particular importance to the expression of many genes are mechanisms which
alter mRN A abundance. Clearly, changing the rate of transcription is an important way
that mRN A abundance is altered. However, the rate at which transcripts are degraded
also plays a critical role in establishing the abundance of transcripts, and is a key
determinant of the rate at which new steady-state transcript levels can be achieved. The
focus of early research on mRN A degradation in higher plants has been on identifying
and characterizing RNA sequence elements that target individual transcripts for rapid
mRNA degradation. While these studies have provided key insight into the regulation of
mRNA stability, little is known about the RNases which are responsible for degrading
mRNAs in plants, or in other multicellular eukaryotes. This chapter briefly describes
well-characterized examples of sequence elements which mediate rapid mRN A
degradation in plants. It is likely that these elements mediate interactions between the
mRNAs and the RN ases that degrade them. Thus, studies of rapid mRNA degradation
mediated by specific sequence elements may shed light on the activities responsible for
transcript degradation. The discussion of sequences which mediate rapid mRN A
degradation in plants is followed by a description of the enzymes that function in mRN A
decay in yeast, a well-characterized system with respect to the mechanism of mRNA
decay. However, there are several differences between mRNA decay in higher plants and
yeast which may have important consequences for the mechanism and regulation of

mRN A degradation in plants.

 

 

 

INSTABILITY DETERMINANTS TARGET SPECIFIC mRNAs FOR RAPID
DEGRADATION

Modulation of gene expression for many genes involves changing the steady—state
abundance of mRN As. The steady-state abundance is a dynamic condition that is
achieved when mRN A synthesis balances mRNA decay. Altering either the mRNA
synthesis rate or the rate of mRNA degradation can change the steady-state, but the
combination of the rates of these two processes determines the speed at which new
steady-state levels can be achieved. This effect is most clear in the case where the
synthesis rate of the mRNA decreases. If an mRN A decays rapidly, it will have a short
half-life and its abundance will decrease rapidly following a reduction in its synthesis
rate. The unstable mRN A can quickly achieve a new steady-state level. In contrast, if
the mRN A decays slowly, it will persist for a longer period of time following inhibition
of transcription, and a greater amount of time is required to attain the same new steady-
state level. Thus, following a decrease in transcription rate, mRNA stability limits the
speed at which mRNA steady-state levels decrease, with unstable mRNAs able to reach
lowered steady-state levels faster than stable mRN As. A less intuitive consequence of
mRN A stability is its affect on the rate at which mRN A steady-state abundance can
increase. Following an increase in mRN A synthesis rate, a stable transcript will
accumulate at a faster rate than an mRN A of lesser stability; however, the unstable
mRNA will more quickly reach its new-steady state level than will the stable mRN A.
Therefore, following a change in mRNA synthesis rate, unstable mRNAs reach new
steady-state levels faster than stable mRNAs. By destabilizing mRNAs through selective

degradation, cells can enhance regulation of gene expression at the level of transcription.

 

 

 

 

 

 

 

In order for cells to selectively target specific transcripts for degradation, the
process of mRNA decay must be regulated. An indication of this regulation is that all
mRNAs do not have the same stability. The half-lives of mRNAs from different genes,
as well as the stability of particular mRNAs at different times in the life of an organism,
can vary over a wide range. In plants, most mRNAs have half-lives on the order of
several hours; however, within this population of relatively stable mRNAs there are
transcripts which are highly unstable with half-lives on the order of minutes (Gutierrez et
al., 1999). To achieve this differential stability, cells must be capable of recognizing
particular mRNAs and targeting them for rapid degradation among a population of stable
mRNAs. Much of the work on mRNA stability in plants, as well as in mammalian cells,
has focused on identifying nucleotide sequences within unstable mRNAs, referred to as
“mRNA instability determinants”, that serve as signals to target specific mRNAs for
rapid degradation. The way in which instability determinants stimulate decay of specific
mRN As is unknown; however, they likely function to directly or indirectly affect the
activity of RNases involved in mRN A degradation in plants. Rapid mRN A degradation
mediated by these elements is both constitutive as well as regulated in response to
stimuli. The following examples of instability determinants from plants highlight these

types of regulation.

Constitutive mRN A decay mediated by the DST-element

A well characterized mRNA instability determinant from plants is the DST
element. The DST (gown-stream) element is a sequence that is conserved in the 3’

untranslated regions (UTRs) of many SA UR (small auxin 11p RNA) genes. First described

 

 

 

 

 

 

 

 

 

 

 

 

 

 

in soybean, transcripts encoded by the SA UR genes are induced by auxin, and are some of
the most unstable mRNAs known in plants, with half-lives of between 10 and 50 minutes
(McClure and Guilfoyle, 1989; Franco et al., 1990). The presence of a conserved
sequence in the 3’UTR of many of the SA UR genes, the DST sequence, indicated that this
element might mediate mRN A instability (McClure et al., 1989). This function for the
DST element was subsequently demonstrated. Insertion of two copies of a DST element
into the 3’ UTR of a reporter RNA is sufficient to trigger rapid decay of an otherwise
stable RNA in transformed tobacco cells in culture, and to decrease mRN A abundance in
leaves of reporter RNAs in transgenic tobacco plants (Newman et al., 1993). Studies of
mRNA decay mediated by the 3’ UTR of the SA UR-ACI gene of Arabidopsis, which
contains one DST sequence and several partial DST sequences, indicate that the DST
element also functions as an mRN A instability element in Arabidopsis, and that its
instability function is not controlled by auxin (Gil and Green, 1996). In fact, the DST
element may be an example of an instability sequence that functions to constitutively
target mRN As for rapid degradation. Constitutive mRN A degradation mediated by the
DST element may function to continuously effect the rates of induction and repression of
SA UR genes, thus allowing more rapid changes in the steady-state levels of transcripts

containing the DST-element (e. g. in response to auxin).

Premature stop codons

A specialized class of mRNA instability sequence that could be considered to
function as a constitutive instability elements are early nonsense codons. In plant, animal

and fungal systems, the presence of a nonsense codon upstream of its normal position

 

 

 

 

 

 

 

 

 

 

will target transcripts for rapid decay (Hentze and Kulozik, 1999; van Hoof and Green,
1996). This nonsense-mediated mRN A decay (NMD) likely functions to target
improperly processed mRNAs for decay to prevent the translation of truncated, possibly
deleterious, proteins. Research on NMD in recent years has focused on elucidating how
NMD targets are distinguished from normal mRNAs, sometimes referred to as 'RNA
surveillance'. The position of the nonsense codon is important. In plants and yeast, if the
early stop codon is within the first 60% of the open reading frame, the transcript is
targeted by NMD (Peltz et al., 1993; van Hoof and Green, 1996). This similarity
between yeast and plants may indicate that the machinery that recognizes NMD targets in
plant resembles that of yeast cells. It is not clear how cells recognize transcripts with
early stop codons; however the position dependence of a stop codon's ability to trigger
NMD may point to the importance of processes occurring at the 3’ end of the transcript
during translation termination. One current model for NMD in yeast proposes that
changes in the mRNP-domain structure of the 3' end of the mRNA is triggered by
premature termination, and that these structural changes lead to rapid mRN A decay
(Hilleren and Parker, 1999). However, in at least one case in yeast, a sequence element
located in the 3’ end of a NMD substrate has been implicated in triggering NMD, which
may indicate that recognition of specific sequence elements in response to premature
termination of translation is important (Peltz et al., 1993). Work in mammalian cells has
also pointed to the potential importance of interactions of the translation machinery with
proteins bound to the 3’ end of mRN As.

Recognition of early nonsense codons in mammalian cells involves an interesting

link with the process of mRN A splicing. The ability of an early stop codon to trigger

NMD in mammals depends on the position of the stop codon relative to the final exon-
exon junction. If the stop codon is greater than 50-55 nt upstream of the last exon-exon
splice site, it will trigger NMD (Nagy and Maquat, 1998). This observation led to the
idea that splicing in mammalian cells results in a ‘mark’ being deposited on the transcript
indicating where it was spliced and that it may be the proximity of the early stop codon to
this mark that is sensed by the NMD machinery. Interestingly, recent work in
mammalian cells has identified several proteins that are bound to transcripts following
their splicing, including several splicesome associated factors (Le Hir et al., 2000). It is
not yet known whether these proteins function in the recognition of premature stop
codons in NMD; however the position of these protein complexes near exon-exon

junctions indicates they could have a function in the recognition of NMD substrates.

Regulated mRN A degradation mediated by the SRE

In contrast to mRN As that are rapidly degraded in a constitutive manner, the
decay of some mRN As is regulated in response to stimuli. Such regulated decay allows
for cells to quickly adjust the expression of specific genes in response to a stimulus. One
such example is the Amy3 transcript of rice which encodes an a—amlyase. The Amy3
transcript exhibits rapid changes in abundance in response to carbohydrate availability.
Addition of sucrose to rice cells in culture results in a rapid decrease in the Amy3 mRNA
due to repression of its transcription and selective degradation of the Amy3 transcript
(Chan and Yu, 1998). Sequences mediating the rapid decay of the Amy3 mRNA have
been mapped to the 3’UTR and are called the sucrose response element (SRE).

Interestingly, the SRE contains one copy of the motif AUUUA, a sequence known to

 

 

 

 

 

 

 

target mRNAs for rapid decay in animal and plant cells when present in multiple copies
(Chen and Shyu, 1995). Regulation of Amy3 is one example of the role that mRN A
stability plays in modulating gene expression in response to stimuli.

Regulated mRN A decay is widespread in plants and has been described for the
Fed] transcript in pea in response to light in a mechanism that involves changes in
translation (Petracek, et al., 1998), for the PvPRPl transcript in bean in response to
fungal elicitor (Sheng et al., 1991), the CM] transcript in soybean in response to
cytokinin (Downes et al., 1998) and the cystathionine gamma-synthase mRNA in

Arabidopsis in response to methionine (Chiba, et al., 1999).

5'-3' EXORIBONUCLEASES LIKELY FUNCTION IN mRNA DECAY IN PLANTS
While several examples of instability determinants have been identified in plants
and other organisms, it is not known how they function to target mRN As for rapid
degradation. One possibility is that they may recruit a ‘basal mRNA degradation
machinery’, a set of proteins required for the degradation of the majority of mRNAs. In
this model, most mRNAs, both stable and unstable would be degraded by a common set
of RNases. Sequence-specific RNA binding proteins may bind to instability determinants
and recruit or activate components of this basal mRN A decay machinery, resulting in
rapid degradation of specific mRN As. This function of instability determinants would be
analogous to sequence elements in promoters involved in recruiting or activating the
basal transcription machinery at particular genes. It is also possible that some instability
determinants are recognition sites for endoribonucleases that cleave the mRN A

internally. A basal mRN A decay machinery might degrade the products of this initial

cleavage. Both of these models invoke the presence of RNases that are involved in the
degradation of many transcripts and which may therefore be considered to be part of a
basal mRN A decay machinery. While the components of a basal mRN A decay
machinery in plants are as yet unknown, the decay of several transcripts in plants
indicates that degradation by 5'-3' exoribonucleases may be an important feature of the

decay of some mRNAs in plants.

Natural mRN A degradation intermediates

In plant cells, as in other eukaryotic cells, the process of mRNA degradation is

quite rapid, and intermediates of mRNA degradation usually do not accumulate to
detectable levels. However, in at least two cases in plants, the degradation of specific
mRNAs is accompanied by the accumulation of mRN A decay intermediates.
Degradation of the PhyA mRN A in oat seedlings, and the SRS4 mRNA in petunia and
tobacco plants each results in the accumulation of specific mRN A decay intermediates
(Higgs and Colbert, 1994; Tanzer and Meagher, 1995). However, as discussed below,
these intermediates differ from each other, and indicate that both 5’-3’ as well as 3’-5’
exoribonuclease-mediated mRN A decay pathways likely function in plants.

PhyA mRN A degradation intermediates in oat seedlings accumulate as a series of
increasingly shorter transcripts. This pattern of degradation intermediates is consistent
with exoribonuclease-mediated degradation from both ends (Higgs and Colbert, 1994).
Approximately 75% of these intermediates appear to be the result of degradation from the
5’ end, with the remainder being due to degradation from both ends simultaneously.
Exoribonuclease-mediated degradation has also been implicated in mRN A degradation of

the SRS4 mRN A in petunia and tobacco. However, an important difference in the

proposed mechanism of SRS4 mRNA degradation from that of PhyA turnover is that an
endoribonuclease(s) likely cleaves the SRS4 transcript at an early step. The SRS4
degradation intermediates consist of several discrete bands indicative of
endoribonuclease-mediated cleavage, and are likely subsequently degraded by
exoribonucleases (T anzer and Meagher, 1995). It is not known if the mechanisms of
PhyA and SRS4 mRNA degradation are particular to these transcripts, or if other mRNAs
are degraded by mechanisms involving exoribonucleases. Interestingly, exoribonucleases
have also been implicated in mRN A degradation during post transcriptional gene

silencing (PT GS), a process which resembles ‘normal’ mRNA degradation in several

respects.

mRN A degradation intermediates induced by PTGS

PTGS, first described in plants and subsequently discovered in several eukaryotes,
is the simultaneous down-regulation of multiple genes that share high levels of sequence
identity (reviewed in Sijen and Kooter, 2000). This down-regulation is accomplished at
the post-transcriptional level by rapid degradation of PT GS substrates. Insight into the
mechanism of mRN A degradation mediated by PTGS has been gained by the analysis of
mRN A decay intermediates that accumulate during PTGS. The structures of these decay
intermediates are consistent with PTGS-mediated mRN A degradation resembling the
proposed mechanism for SRS4 degradation, with initial endoribonuclease cleavage
followed by exoribonuclease degradation. In several cases, targets of PTGS accumulate
as truncated RN As that are believed to be mRN A degradation intermediates (Goodwin et

al., 1996; Lee et al., 1997; Tanzer et al., 1997; van Eldik et al., 1998). PTGS-mediated

degradation of B-l,3 glucanse transcripts, and an RNA encoding the coat protein of

10

 

 

 

 

 

 

 

 

 

 

 

 

tobacco etch virus (TEV-CP) in tobacco, results in the accumulation of several decay
intermediates as discrete bands detected on northern blots (van Eldik et al., 1998;
Goodwin, et al., 1996). It is likely that these bands represent decay intermediates
generated by an endoribonuclease(s) (van Eldik et al., 1998). In addition to discrete
bands, a continuous distribution of products can be detected in plants when either the [3-
1,3 glucanse or the TEV-CP genes are silenced, indicative of exoribonuclease activity.
The products proposed to be generated by an endoribonuclease are likely degraded by
exoribonucleases from both ends (van Eldik et al., 1998). While these studies point to a
possible similarity between the mechanism of ‘normal’ mRNA decay and PT GS-
mediated decay, the mechanism of PTGS involves more than cleavage by endo- and
exoribonucleases.

An important feature of PTGS in multiple systems is the accumulation of small
(21-23 nt) RNAs which are products of the degradation event (Hamilton and Baulcombe,
1999; Zamore et al., 2000). Studies using end-labeled substrates and a cell extract from
Drosophila cells which carries out PTGS (referred to as RN Ai in Drosophila) indicates
that PTGS substrates are cleaved one or twice and can be cleaved anywhere throughout
the transcript to generate the 21-23 nt RN As (Zamore et al., 2000). This indicates that
PTGS-induced degradation may result in the production of many transcripts that have
been cleaved internally. These products could be substrates for the same
exoribonucleases that might catalyze ‘normal’ mRN A degradation.

It is worth noting that the intracellular location of PTGS-mediated mRNA decay
is not known. There is evidence indicating that the decay is cytoplasmic in plants, as

some viruses that replicate in the cytoplasm are targets of PTGS (reviewed in Sijen and

11

 

 

 

 

 

 

 

 

 

 

Kooter, 2000). However, in at least one case, silencing of chalcone synthase in petunia,
products of PTGS activity are enriched in the nucleus (Metzlaff et al., 1997). The
RNases that function in the PTGS machinery may be located in the cytoplasm, similar to
the expected location of the basal mRNA decay machinery, or in the nucleus, or in both

intracellular compartments.

Degradation of RN As in plant cell extracts

The 7 methyl-guanosine cap at the 5’ end of eukaryotic mRNAs has functions in
both mRN A stability and translation (reviewed in Jacobson and Peltz, 1996). The
possible role of the cap in promoting mRNA stability was established over 20 years ago
by the demonstration that capped RNAs are more stable than non-capped RNAs when
incubated in wheat germ extracts (Shimotohno et al., 1977a). Analysis of the decay
products of RN As incubated in wheat germ extract indicated that the decay might be
catalyzed by a 5'-3' exoribonuclease that produced 5’-mononucleotides, but which could
not degrade capped RNAs. Subsequently, an exoribonuclease exhibiting these
characteristics was partially purified from wheat germ extract in the late 19708
(Shimotohno and Miura, 1977b). Although nothing more has been reported about this,
RNase from plants, the 5'-3' exoribonuclease Xrnlp has been shown to be a major
enzyme in mRNA decay in yeast.

Xrnlp, A 5’-3’ EXORIBONUCLEASE, IS A MAJOR COMPONENT OF THE BASAL
mRNA DECAY MACHINERY OF YEAST

Perhaps the strongest evidence that 5’-3’ exoribonucleases play a role in mRN A
degradation in plants is that this type of activity is a key component of mRN A decay in

several mRNA decay pathways in yeast and might be conserved in plants. Xrnlp is a

12

 

 

 

 

 

 

 

 

 

 

 

constituent of the basal mRNA decay machinery in yeast, a group of proteins that
catalyze the decay of the majority of mRNAs. In yeast, the majority of mRNAs are
degraded by the deadenylation-dependent-decapping pathway (Figure 1-1 , center;
reviewed in McCarthy, 1998). The first step in this pathway is the removal of the
poly(A) tail, most likely by a complex of proteins containing Ccr4p and Caf 1p (Tucker et
al., 2001). Interestingly, removal of the poly(A) tail is an early step in mRNA decay
conserved in several systems, including mammalian cells (Shyu et al., 1991) and
Chlamydomonas rheinhardtii (Baker, 1993); however, the enzyme(s) responsible have
not been definitively identified. While it is not known if deadenylation plays an
important role in mRN A degradation in higher plants; the Arabidopsis genome encodes
an ortholog of mammalian PARN (poly(A) ribonuclease; Johnson, 2000). PARN has
been suggested to be the nuclease that catalyzes deadenylation of mRN As in mammalian
cells (Khmer, 1998, Gao, 2000).

Although deadenylation is a common first step in mRN A degradation in multiple
systems, the steps of mRN A degradation following deadenylation have only been
definitively identified in yeast. Following deadenylation in yeast, mRNAs are decapped
by Dcplp, and degraded to completion by the 5’-3’ exoribonuclease Xrnlp.
Surprisingly, while a potential Dcplp ortholog can be found in the Arabidopsis genome
(Kastenmayer et al., 1998; Gutierrez et al., 1999)Xm1p orthologs are absent, and have

not been found in the available sequences from additional higher plants (Chapter 3).

l3

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figurel-l. mRNA decay pathways in yeast. The major deadenylation-dependent-
decapping decay pathway is shown in the middle. The majority of mRNAs in yeast are
believed to be degraded through this pathway. On the left is shown a specialized version
of the major pathway which functions on mRNAs containing early non-sense codons.
Transcripts degraded through this pathway are not deadenylated prior to decapping. On
the right is shown a 3’-5’ decay pathway catalyzed by a complex of 3’-5’
exoribonucleases known as the exosome. This pathway is believed to play a minor role in
mRN A degradation.

 

 

 

 

 

 

33% 5 “23353 .38“. <ZME ._-_ 053n—

OEOQOXO

* Uni—Eng:

c3389.. .9» A,

.2. I
< .395.

co=a_>couuou A; atuoivcoucozagcoumou A; mciauoou a

mtam<<<<<lllaaoé

caucus—woe man

u
u m
m
u m
a FEx 3
:23...an 2 :ozauahuou
a _.:._x
......|flHu.U
a 2.5»
cozavfimou ban a a Ema mhém<<flv

 

mwuor . r.
< I
QQMV

5
3.38% A. « co_sueuou_n..m x—a

2.....flHiir m3....

   

”Effillfiafi Refillfiaufi

.. I t . L 55.5 >32. coinagomcomcoz

I Il.‘ II II I‘ I I

15

However, Xrnlp orthologs are present in a number of eukaryotes which may indicate that
Xrnlp-mediated mRN A degradation is conserved in a variety of eukaryotes, but is
lacking from higher plants.

In addition to this major mRNA decay pathway (Figure 1-1 center), additional
pathways exist which catalyze degradation of mRNAs in yeast. The NMD pathway,
responsible for degrading mRNAs with premature stop codons, does not require prior
deadenylation, but is dependent on Xmlp-mediated degradation (Figure 1-1, left).
Transcripts in yeast are also degraded from the 3’ end by a complex of exoribonucleases
known as the exosome (Figure 1-1 right; Jacobs-Anderson 1998). Exosome-mediated
degradation likely occurs in mammalian and plant cells, as orthologs of components of
the exosome have been found in both of these systems (Mitchell et al., 1997; Gutierrez et
al., 1999, Chekanova et al., 2000).

Elucidation of these known mRNA degradation pathways in yeast depended on
two complementary experimental approaches, the analyses of mRNA decay intermediates
and analyses of mutants of the basal mRN A decay machinery. As mentioned previously,
mRN A degradation in eukaryotic cells usually does not result in the accumulation of
detectable mRN A decay intermediates. The absence of naturally occurring mRN A decay
intermediates for the majority of transcripts has precluded the ability to elucidate mRN A
degradation pathways based on the structures of these intermediates or the kinetics of
their appearance or disappearance during the course of degradation. This obstacle has

been in large part overcome in studies on mRNA decay in yeast.

16

 

 

 

Expression of poly(G)-containing genes in yeast results in the accumulation of poly(G)-
stabilized mRN A degradation intermediates ‘

It is possible to trap mRN A decay intermediates in yeast by the introduction of
stable secondary structures, such as poly(G) tracts of 18 nts, into mRNAs. These stable
secondary structures inhibit exoribonuclease-mediated mRNA decay in yeast, resulting in
the accumulation of poly(G)-stabilized mRNA decay intermediates (Muhlrad et al., 1994;
J acobson-Anderson et al., 1998). Interestingly, similar experiments have failed to
produce poly(G)-stabilized mRNA decay intermediates in plant and mammalian cells, an
indication that mRNA decay may differ mechanistically between yeast and multicellular
eukaryotes (Johnson, 2000). The majority of the poly(G)-stabilized mRN A decay
intermediates which accumulate in yeast begin at the 5’ end of the poly(G) tract and end
at the poly(A) tail which has been shortened to 10-12 adenosines (Muhlrad et al., 1994).
These intermediates are consistent with mRN A degradation occurring preferentially from
the 5’ end, most likely catalyzed by a 5’-3’ exoribonuclease which is blocked by the
poly(G) tract.

The demonstration that Xrnlp generates the poly(G)-stabilized mRNA decay
intermediates was accomplished in two ways. The activity of Xrnlp on RNA substrates
in vitro was examined, and mRNA turnover was analyzed in an meA mutant. Xrnlp
exhibits 5’-3’ exoribonuclease activity in vitro, releases 5’-mononucleotides, and
importantly, its progression through RNA substrates is blocked by poly(G) tracts
(Stevens, 1979; Poole and Stevens, 1997). The most compelling evidence that Xrnlp
functions in mRN A degradation in vivo is that many mRNAs are stabilized in meA

cells, including mRN As containing early stop codons (Larimer et al., 1992; Hsu and

17

 

 

 

 

 

 

 

 

 

Stevens, 1993). In addition, formation of poly(G)-stabilized mRNA decay. intermediates
is greatly reduced in meA cells, with a concomitant increase in the steady-state level of
the full-length poly(G)-containing mRNA (Decker and Parker, 1993).

An additional discovery made through the analysis of poly(G)-containing genes in
xml A cells was the exosome mediated mRNA degradation pathway (Figure 1-1 A, right).
5’-3’ mediated mRNA degradation appears to predorrrinate mRN A decay in yeast;
poly(G)-stabilized mRN A decay intermediates consistent with this decay pathway
accumulate to high levels (J acobson-Anderson et al., 1998). However, when 5’-3’ decay
is inhibited by deletion of DCPl , poly(G)-stabilized mRN A decay intermediates
accumulate which retain the full 5’-end of the mRNA and end at the 3’ end of the
poly(G) tract (J acobson-Anderson et al., 1998). Further studies demonstrated that these
intermediates are due to degradation from the 3’ end by the exosome, and that these
intermediates accumulate to low levels in wildtype yeast (J acobson-Anderson et al.,
1998). Thus the analysis of poly(G)-stabilized mRNA decay intermediates, in
combination with studies of xrn] mutants, was critical not only to the elucidation of
Xrnlp’s function in mRN A degradation in yeast, but also to the discovery of additional
mRN A decay pathways.

Xrnlp has roles in rRN A and snoRNA processing in addition to catalyzing
cytoplasmic mRN A degradation. rRNAs are synthesized as large precursors which are
first cleaved internally by endoribonucleases, and then trimmed to their mature forms by
exoribonucleases (for current review see Kressler et al., 1999). Xrnlp trims the 5' ends of
several pre-rRN As, and the exosome trims the 3’ ends of these pre-rRNAs. Xrnlp has a

similar role in the maturation of the 5’ ends of small nucleolar RNAs (snoRNAs).

18

 

 

 

 

 

snoRNAs can be divided into two classes based on conserved sequences present in the
RNA, the OD box and H/ACA box classes. These RNAs serve as guides for rRNA
processing, including 2’OH methylation directed by members of the CID class (Kiss-
Laszlo et al., 1996) and pseudouridylation by members of the H/ACA class (Ganot et a1,
1997). Many snoRNAs in yeast are encoded in introns of mRN As and mature through
two separate pathways. In the first pathway, the intron is spliced out as an intron lariat by
the mRNA splicing machinery. Following debranching of the intron lariat, the ends of
the intron are trimmed by exoribonucleases, including Xrnlp, to yield the mature
snoRNA (Villa et al., 1998). A second pathway of snoRNA processing involves the
direct cleavage of the mature snoRNA out of the mRN A by endoribonuclease cleavage,
and does not depend on exoribonuclease trimming (Villa et al., 1998). The role of Xrnlp
in trimming of the 5' ends of rRNAs and snoRNAs was revealed by analysis of xml A
cells in which the 5’ ends of these RNA species are not trimmed to their mature length
(Henry et al., 1994; Villa etal., 1998). In addition to trimming rRNA and snoRNA 5'

ends, Xrnlp degrades the rRNA processing intermediate ITS] (Stevens et al., 1991).

THE FUNCTION OF Xm2p/Ratlp, A SECOND 5’-3’ EXORIBONUCLEASE OF
YEAST, PARTIALLY OVERLAPS WITH THE FUNCTIONS OF Xrnlp

Xmlp’s function in both rRN A and snoRNA processing is shared with the second
known 5'-3' exoribonuclease in yeast, Xm2p/Rat1p. Xrn2p/Rat1p is highly similar in
sequence and enzymatic activity to Xrnlp. Xm2p/Rat1p is also a 5’-3’ exoribonuclease
that is blocked by poly(G) tracts (Poole and Stevens, 1997). The processing of rRNAs
and snoRNAs exhibit similar defects in xml and me/ratl mutants indicating overlap in

function (Henry et al., 1994, Villa et al., 1998). Double mutants exhibit the most

19

 

 

 

 

 

 

 

 

 

dramatic defects. However, while both XRNs of yeast share these similarities,
Xrn2p/Ratlp differs from Xrnlp in two important ways. First, Xm2p/Ratlp is targeted
to the nucleus while Xrnlp is found in the cytoplasm (Heyer et al., 1995, Johnson, 1997).
Second, Xm2p/Rat1p is encoded by an essential gene, while meA cells are viable
(Larimer et al., 1992; Amberg et al., 1992) indicating that Xm2p/Ratpl likely has a
function(s) distinct from that of Xrnlp. Interestingly, while Xm2p/Ratlp is targeted to
the nucleus, it appears to have activity on mRNAs, an activity that can be detected when
XRN] is deleted (Decker and Parker, 1993; He and Jacobson, 2001). This could be due
to a residual amount of Xm2p/Rat1p remaining in the cytoplasm that is active on

mRN As.

An additional activity of Xm2p/Rat1 may be degradation of pre-mRNAs in the
nucleus. In the ratI-I strain after a shift to the non-permissive temperature, several pre-
mRN A species are elevated, including mRN As which are improperly spliced (Bousquet-
Antonelli, 2000). Similar results were observed with mutants of the exosome, indicating
decay of pre-mRN As in the nucleus may be catalyzed in part by the same enzymes
involved in mRN A degradation in the cytoplasm. The essential function of Xm2p/Ratlp
is unknown, but impaired degradation of pre-mRN As in the nucleus catalyzed by
Xrn2p/Ratlp could be one reason that rat] -1 cells arrest growth, while meA cells are
viable.

Further evidence for distinct functions of the XRN proteins of yeast comes from
the analysis of the xml A and ratI-I mutants. Mutation of either of the yeast XRN genes
results in distinct phenotypes. Loss of Xrnlp function results in hypersensitivity to the

microtubule depolymerizing drug benomyl and defects in karyogamy, recombination and

20

.f———

 

 

 

sporulation (Kim et a1, 1990). The conditional ratI-I allele of XRNZ/RATI was cloned in
a screen for mutants which failed to properly transport mRN A from the nucleus (RNA
trafficking RAT mutants; Amberg et al., 1992), and the conditional allele tap] in a screen
for suppressors of a mutated RNA polymerase III promoter (transcriptional activator
protein; Di Sengi et al., 1993). That the phenotypes of the xml A and rat] -1 strains differ

indicates that Xrnlp and Xm2p/Rat1p likely have distinct functions in yeast.

LINKS BETWEEN INSTABILITY DETERMINANTS AND THE BASAL mRN A
DECAY MACHINERY

As mentioned above, the manner in which instability determinants function to
increase mRN A degradation rates is not known. However there is evidence that the basal
mRN A decay machinery could be regulated by these sequence elements. In support of
this model are experiments showing that each of the steps of the major deadenylation-
dependent-decapping pathway of yeast occur at different rates when RNAs bearing
instability determinants are compared to mRN As lacking such elements.

The most well characterized function of instability determinants is to increase
deadenylation rates. Several instability elements from yeast are known to increase the
rate at which unstable mRN As are deadenylated as do ARES from mammalian cells
(Decker and Parker, 1993; Chen and Shyu, 1995). It is easy to imagine that instability
determinants in yeast could function to recruit the Crr4p/Caf1p complex to unstable
mRNA s, leading to rapid deadenylation followed by decapping. The rate of decapping is
also stimulated by several instability determinants in yeast (Muhlrad and Parker, 1992;
Muhlrad et al., 1994), and the activity of Dcplp might also be a target of instability

elements. ARES in mammalian cells may have a similar function as instability

21

«nu-t -' aaaa

 

 

 

 

 

determinants in yeast, although the components of the mRN A decay machinery, and the
steps of mRNA degradation following deadenylation are unknown in mammalian cells.
ARES might recruit PARN in animal cells (or AtPARN in plant cells?) to unstable
mRNAs to facilitate their rapid deadenylation. Interestingly, a decapping activity has
recently been characterized in mammalian cell extracts that is stimulated by the presence
of an ARE in the 3’ UTR of substrate RNAS (Gao et al., 2001). These data indicate that a
conserved mechanism of some instability determinants might be to stimulate
deadenylation and decapping, and also support a model in which decapping is a regulated
step in the in the decay of some mammalian transcripts.

The least is known about regulation of the last step in the deadenylation-
dependent-decay-pathway, degradation from the 5’ end by Xrnlp. However, several
experiments indicate that the activity of Xrnlp might be regulated. Yeast two-hybrid
assays have shown that proteins related to the SM-proteins of splicing, LSMS, interact
with the C-terminus of Xrnlp (Fromont-Racine, 2000). The significance of this
interaction is unknown; however, it is worth noting that these Lsm proteins are members
of a complex known to physically interact with the decapper Dcplp and are required for
mRNA decapping in yeast (Tharun et al., 2000). This could indicate that the Lsm
proteins may have a function in regulating the access of Xrnlp to the 5’ end of mRNAs
following decapping, a process mediated by the interaction of the Lsms with the C-
temrinus of Xrnlp. The apparent absence of Xrnlp orthologs from higher plants
(Chapter 3) may indicate that this type of regulation does not occur in plant cells.
Additional evidence for regulation of 5'-3’ decay following decapping comes from the

observation that a point mutation in eIF5A results in the accumulation of mRNAs which

22

 

 

 

 

 

 

 

 

 

 

 

 

are decapped, but Stable (Zuk and Jacobson, 1998). Xrnlp may be unable to gain access
to the 5’ ends of these transcripts. Finally, accumulation of decapped mRNAs in an
meA strain is enhanced when genes required for NMD, UPFI, NMD2 and UPF 3, are
also deleted, indicating that proteins involved in NMD might regulate 5’-3’ decay (He
and Jacobson, 2001). Since this observation is only seen in the absence of Xrnlp
function, its significance to general mRNA degradation is unclear, but may be a result of
changes in the activity of Xm2p/Rat1p on mRNAs in the cytoplasm (He and Jacobson,

2001).

SCOPE OF THIS THESIS

Rapid turnover of mRNAs can be broken down into two phases, recognition of
substrates for rapid decay and active degradation. Several instability determinants have
been identified and characterized providing important insight into how genes can be
regulated in plants at the level of mRN A stability. Recently, Arabidopsis mutants which
are unable to efficiently recognize and degrade mRNAs bearing the DST element have
isolated (Johnson et al., 2000). These mutants will likely provide key insight into the
manner in which the DST element is recognized. As the function of the DST element,
and other instability determinants, likely involves modulation of the activities which
ultimately degrade mRNAs, identification of components of the basal mRN A decay
machinery in plants may yield insight into the function of instability determinants as well
as into mRN A degradation in general. The main goal of this thesis was to identify
RNases which might catalyze cytoplasmic mRN A degradation in plants. Chapter 2

describes how assays were developed to assess basic features of an XRN-family member

23

 

 

 

 

   

 

 

identified in Arabidopsis thaliana (AtXRN 2). In Chapter 3, these assays are applied to
investigate the potential role of all three of XRN-family members in mRN A degradation
in Arabidopsis. Evidence is presented that although XRN 1 orthologs are absent from
Arabidopsis, and probably higher plants, the Xrn2p/Rat1p-like protein AtXRN4 may
function in cytoplasmic mRN A decay in Arabidopsis. Chapter 4 describes the
identification of T-DN A insertion alleles in each of the AtXRN genes. Preliminary
analysis of mRN A decay in Arabidopsis seedlings mutant for AtXRN4 using cDN A
microarrays is presented. These experiments indicate that AtXRN4 may have a role in
catalyzing mRN A degradation in Arabidopsis. Chapter 5 describes attempts to address
the possibility that deadenylation is a key step in the mechanism of mRNA degradation in
plants stimulated by the presence of a DST element or a synthetic ARE. The most
important contribution of this thesis is likely to be the discovery that AtXRN4 may
degrade some mRNAs in Arabidopsis. This would provide the first evidence that the
XRN-family functions in mRNA decay in higher eukaryotes and would be the first
example of an RN ase with a general role in degrading mRNAs in a multicellular

eukaryote.

24

 

 

 

 

 

 

 

 

REFERENCES

Amberg, D. C., Goldstein, A. L., and Cole, C. N. (1992). Isolation and characterization
of RAT] : An essential gene of Saccharomyces cerevisiae required for the efficient
nucleocytoplasnric trafficking of mRNA. Genes Dev. 6, 1173-1189.

Baker, E. J. (1993). Control of poly(A) length. Control of Messenger RNA Stability, J.
Belasco and G. Brawerrnan eds (New York: Academic Press), pp.367-415.

Bousquet-Antonelli, C., Presutti, C., and Tollervey, D. (2000). Identification of a
regulated pathway for nuclear pre-mRN A turnover. Cell 102, 765-775.

Brown, C. E. and Sachs, A. B. (1998). Poly(A) tail length control in Saccharomyces

cerevisiae occurs by message-specific deadenylation. Mol. Cell. Biol. 18, 6548-
6559.

Chan, M. T. and Yu, S. M. (1998). The 3' untranslated region of a rice or-amylase gene
functions as a sugar-dependent mRN A stability determinant. Proc. Nat. Acad. Sci.
USA 95, 6543-6547.

Chen, C. Y. A. and Shyu, A. B. (1995). AU-rich elements: Characterization and
importance in mRN A degradation. Trends Biochem. Sci. 20, 465-470.

Chiba, Y., Ishikawa, M., Kijirna, F., Tyson, R. H., Kim, J ., Yamamoto, A.,
Nambara, E., Leustek, T., Wallsgrove, R. M., and Naito, S. (1999). Evidence for
autoregulation of cystathionine gamma-synthase mRNA stability in arabidopsis.
Science 286, 1371-1374.

Decker, C. J. and Parker, R. (1993). A turnover pathway for both stable and unstable
mRNAs in yeast: evidence for a requirement for deadenylation. Genes Dev. 7, 1632-
1643.

Di Sengi, G., McConaughy, B. L., Shapiro, R. A., Aldrich, T. L., and Hall, B. D.
(1993). TAPl, a yeast gene that activates the expression of a tRN A gene with a
defective internal promoter. Mol. Cell. Biol. 13, 3424-3433.

Downes, B. P. and Crowell, D. N. (1998). Cytokinin regulates the expression of a

soybean B-expansin gene by a post-transcriptional mechanism. Plant Mol.Biol. 37,
437-444.

Franco, A. R., Gee, M. A., and Guilfoyle, T. J. (1990). Induction and superinduction of
auxin-responsive mRNAs with auxin and protein synthesis inhibitors. J. Biol. Chem.
265, 15845-15849.

25

Fromont-Racine, M., Mayes, A. E., Brunet-Simon, A., Rain, J. C., Colley, A., Dix, 1.,
Deeourty, L., Joly, N., Ricard, F., Beggs, J. D., and Legrain, P. (2000). Genome-
wide protein interaction screens reveal functional networks involving Sm—like
proteins. Yeast 17, 95-110.

Gao, M., Fritz, D. T., Ford, L. P., and Wilusz, J. (2000). Interaction between a
poly(A)-specific ribonuclease and the 5' cap influences mRN A deadenylation rates in
vitro. Mol. Cell 5, 479-488.

Gao, M., Wilusz C.J., Peltz, S. W., and Wilusz, J. (2001). A novel mRNA-decapping
activity in HeLa cytoplasmic extracts is regulated by AU-rich elements. EMBO J.
20,1134-1143.

Gil, P. and Green, P. J. (1996). Multiple regions of the Arabidopsis SA UR-ACI gene
control trascript abundance: the 3' untranslated region functions as an mRN A
instability determinant. EMBO J. Journal 15, 1678-1686.

Goodwin, J ., Chapman, K., Swaney, 8., Parks, T. D., Wernsman, E. A., and
Daugherty, W. G. (1996). Genetic and biochemical dissection of transgenic RN A-
mediated virus resistance. Plant Cell 8 , 95-105.

Gutiérrez, R. A., MacIntosh, G. C., and Green, P. J. (1999). Current perspectives on
mRNA stability in plants: multiple levels and mechanisms of control. Trends Plant
Sci. 4, 429-438.

Hamilton, A. J. and Baulcombe, D. C. (1999). A species of small antisense RNA in
posttranscriptional gene silencing in plants. Science 286, 950-952.

He, F. and Jacobson, A. (2001). Upfl p, de2p, and Upf3p regulate the decapping and
exonucleolytic degradation of both nonsense-containing mRNAs and wild-type
mRNAs. Mol. Cell. Biol. 5, 1515-1530.

Henry, Y., Wood, H, Morrissey, J. P., Petfalski, E., Kearsey S, and Tollervey, D.
(1994). The 5' end of yeast 5.8S rRN A is generated by exonucleases from an
upstream cleavage site. EMBO J. 13, 2452-2463.

Hentze, M. W. and Kulozik, A. E. (1999). A perfect message: RNA surveillance and
nonsense-mediated decay. Cell 96, 307-310.

Heyer, W.-D., Johnson, A. W., Reinhart, U., and Kolodner, R. D. (1995). Regulation
and intracellular localization of Saccharomyces cerevisiae strand exchange protein 1
(Sepl/Xrnl/Keml), a multifunctional exonuclease. Mol.Cell.Biol. 15, 2728-2736.

Higgs, D. C. and Colbert, J. T. (1994). Oat phytochrome A mRN A degradation appears
to occur via two distinct pathways. Plant Cell 6, 1007-1019.

26

Hilleren, P. and Parker, R. (1999). mRN A surveillance in eukaryotes: Kinetic
proofreading of proper translation termination as assessed by mRNP domain
organization? RNA 5, 711-719.

Hsu, C. L. and Stevens, A. (1993). Yeast cells lacking 5'-->3' exoribonuclease 1 contain
mRN A species that are poly(A) deficient and partially lack the 5' cap structure.
Mol.Cell.Biol. 13, 4826-4835.

Jacobs Anderson, J. S. and Parker, R. (1998). The 3' to 5' degradation of yeast mRNAs
is a general mechanism for mRN A turnover that requires the SKIZ DEVH box

protein and 3' to 5' exonucleases of the exosome complex. EMBO J. Journal 17,
1497-1506.

Jacobson, A. and Peltz, S. W. (1996). Interrelationships of the pathways of mRNA
decay and translation in eukaryotic cells. Annu. Rev. Biochem.65, 693-739.

Johnson, A. W. (1997). Ratlp and Xrnlp are functionally interchangeable
exoribonucleases that are restricted to and required in the nucleus and cytoplasm,
respectively. Mol.Cell.Biol. 17, 6122-6130.

Johnson, M. A. (2000). Genetic Determinants of mRNA Stability in Plants. Ph.D.
dissertation, Michigan State University

Johnson, M.A., Perez-Amador M.A., Lidder, P. and Green, P.,]. (2000) Mutants of
Arabidopsis defective in a sequence-specific mRN A degradation pathway. Proc.
Natl. Acad. Sci. USA 97, 13991-13996.

Kastenmayer, J. P., van Hoof, A., Johnson, M. & Green, P. J. (1998) in Plant
Molecular Biology, eds. Raikhel, N., Last, R., Morelli, G., & LaShavo, F. (Springer-
Verlag, Berlin), pp. 125-133.

Kim, J ., Ljungdahl, P. 0., and Fink, G. R. (1990). kem mutations affect nuclear fusion
in Saccharomyces cerevisiae. Genetics 126, 799-812.

Kiss-Lészlé, Z., Henry, Y., and Kiss, T. (1998). Sequence and structural elements of
methylation guide snoRNAs essential for site-specific ribose methylation of pre-
rRNA. EMBO J. 17, 797-807.

Kiirner, C. G., Wormington, M., Muckenthaler, M., Schneider, 8., Dehlin, E., and
Wahle, E. (1998). The deadenylating nuclease (DAN) is involved in poly(A) tail
removal during the meiotic maturation of Xenopus oocytes. EMBO J. 17, 5427-5437.

Kressler, D, Linder, P., and Dela Cruz, j. (1999). Protein trans-acting factors involved
in ribosome biogenesis in Saccharomyces cerevisiae. Mol. Cell. Biol. 12, 7897-7912.

Larimer, F. W., Hsu, C. L., Maupin, M. K., and Stevens, A. (1992). Characterization
of the XRN 1 gene encoding a 5'-->3' exoribonuclease: sequence data and analysis of
disparate protein and mRN A levels of gene-disrupted yeast cells. Gene 120, 51-57.

27

 

 

 

 

   

Le Hir, H., Maquat, L. E., Maquat, L. E., and Moore, M. J. (2000). The Spliceosome
deposits multiple proteins 20-24 nucleotides upstream of mRN A exon-exon
junctions. EMBO J. 19, 6860-6890.

McCarthy, J. E. G. (1998). Posttranscriptional control of gene expression in yeast.
Micro. Mol. Biol. Rev.62, 1492-1553.

McClure, B. A. and Guilfoyle, T. J. (1989). Rapid redistribution of auxin-regulated
RNAS during gravitropism. Science 243, 91-93.

Metzlaff, M., O'Dell, M., Cluster, P. D., and Flavell, R. B. (1997). RN A-mediated
RNA degradation and chalcone synthase A silencing in Petunia. Cell 88, 845-854.

Mitchell, P., Petfalski, E., Shevchenko, A., Mann, M., and Tollervey, D. (1997). The
exosome: A conserved eukaryotic RNA processing complex containing multiple 3'--
>5' exoribonucleases. Cell 91, 457-466.

Muhlrad, D., Decker, C. J ., and Parker, R. (1994). Deadenylation of the unstable
mRN A encoded by the yeast MFA2 gene leads to decapping followed by 5'-->3'
digestion of the transcript. Genes Dev. 8, 855-866.

Muhlrad, D. and Parker, R. (1992). Mutations affecting stability and deadenylation of
the yeast MFA2 transcript. Genes and Dev. 6, 2100-2111.

Nagy, E. and Maquat, L. E. (1998). A rule for termination-codon position within intron-

containing genes: when nonsense affects RNA abundance. Trends Biochem.Sci. 6,
198-199.

Newman, T. C., Ohme-Takagi, M., Taylor, C. B., and Green, P. J. (1993). DST
sequences, highly conserved among plant SA UR genes, target reporter transcripts for
rapid decay in tobacco. Plant Cell 5, 701-714.

Peltz, S. W., Brown, A. H., and Jacobson, A. (1993). mRNA destabilization triggered
by premature translational termination depends on at least three cis-acting sequence
elements and one trans-acting factor. Genes Dev. 7, 1737-1754.

Petracek, M. E., Dickey, L. F., Nguyen, T. T., Gatz, C., Sowinski, D. A., Allen, G. C.,
and Thompson, W. F. (1998). Ferredoxin-l mRNA is destabilized by changes in
photosynthetic electron transport. Proc. Natl. Acad. Sci. USA 95, 9009-9013.

Poole, T. L. and Stevens, A. (1997). Structrual modifications of RNA influence the 5'
exoribonucleolytic hydrolysis by XRN 1 and HKEl of Saccharomyces cerevisiae.
Biochem.and Biophys. Res. Comm.235, 799-805.

Sachs, A. B. and Deardorff, J. A. (1992). Translation initiation requires the PAB-
dependent poly(A) ribonuclease in yeast. Cell 70, 961-973.

28

Sheng, J ., D'Ovidio, R., and Mehdy, M. C. (1991). Negative and positive regulation of
a novel proline-rich protein mRN A by fungal elicitor and wounding. Plant J. 1, 345-
354.

Shimotohno, K., Kodama Y., and Hashimoto, J. and Miura K. (1977a). Importance of
5'-terminal blocking structure to stabilize mRN A in eukaryotic protein synthesis.
Proc. Natl. Acad. Sci. USA 74, 2734-2738.

Shirnotohno, K. and Miura, K. (1977b). A novel 5 '-exonuclease which degrades
uncapped mRN A. Proceedings of the 1977 Molecular Biology Meeting of Japan ,
83-85.

Shyu, A.-B., Belasco, J. G., and Greenberg, M. E. (1991). Two distinct destabilizing
elements in the c-fos message trigger deadenylation as a first step in rapid mRN A
decay. Genes Dev. 5, 221-231.

Sijen, T. and Kooter, J. M. (2000). Post-transcriptional gene-silencing: RNAS on the
attack or on the defense? BioEssays 22, 520-531.

Stevens, A. (1979). Evidence for a 5'-3' direction of hydrolysis by a 5'-mononucleotide-
producing exoribonuclease from saccharomyces cerevisiae. Biochem. Biophys.Res.
Comm. 86, 1126-1132.

Stevens, A., Hsu, C. L., Isham K.R., and Larimer, F. W. (1991). Fragments of the
internal transcribed spacer 1 of pre-mRNA accumulate in Saccharomyces cerevisiae
lacking 5'-3'exoribonuclease l. J. Bacteriol. 173., 7024-7028.

Tanzer, M. M. and Meagher, R. B. (1995). Degradation of the soybean ribulose-l,5-
bisphosphate carboxylase small-subunit mRNA, SRS4, initiates with endonucleolytic
cleavage. Mol.Cell.Biol. 15 , 6641-6652.

Tharun, S., He, W. H., Mayes, A. E., Lennertz, P., Beggs, J. D., and Parker, R.
(2000). Yeast Sm-like proteins function in mRNA decapping and decay. Nature 404,
5 15-5 18.

Tucker, M., Valencia-Sanchez, M. A., Staples, R. R., Chen, J ., Denis, C. L., and
Parker, R. (2001). The Transcription Factor Associated Ccr4 and Cafl Proteins are
Components of the Major Cytoplasmic mRNA Deadenylase in Saccharomyces
cerevisiae. Cell 104, 377-386.

Van Eldik, G. J ., Litiere, K., Jacobs, J. J. M. R., Van Montagu, M., and Cornelissen,
M. (1998). Silencing of B-1,3-glucanase genes in tobacco correlates with an

increased abundance of RNA degradation intermediates. Nucleic Acids Res. 26,
5 176-5 181 .

van Hoof, A. and Green, P. J. (1996). Premature nonsense codonS decrease the stability
of phytohemagglutinin mRNA in a position-dependent manner. Plant J. 10, 415-424.

29

 

 

 

 

 

 

-WA—

Villa, T., Ceradini F, Presutti, C., and Bozzoni, I. (1998). Processing of theintron-
encoded U18 small nucleolar RNA in the yeast Saccharomyces cervisiae relies on
both exo- and endonucleolytic activities. Mol. Cell. Biol. 18 , 3376-3383.

Zamore, P. D., Tuschl, T., Sharp, P. A., and Bartel, D. P. (2000). RNAi: double-
stranded RNA directs the ATP-dependent cleavage of mRN A at 21 to 23 nucleotide
intervals. Cell 101, 25-33.

Zuk, D. and Jacobson, A. (1998). A single anrino acid substitution in yeast eIF-5A
results in mRNA stabilization. EMBO J. 17, 2914-2925.

30

CHAPTER 2

DEVELOPMENT OF ASSAYS TO STUDY THE XRN-FAMILY OF ARABIDOPSIS

The original form of this manuscript is in press in Methods in Enzymology. Reference:
Kastenmayer J. P., Johnson M.J. and Green P.J. “Analysis of XRN-orthologs Through
Complementation of Yeast Mutants and Localization of XRN-GFP Fusion Proteins". It
has been modified to fit within the context of this thesis.

31

 

 

 

 

 

 

 

 

 

 

INTRODUCTION

A surprising result of our investigation of the XRN-family in Arabidopsis was the
discovery that multiple orthologs of Xm2p/Rat1p of yeast are encoded in the Arabidopsis
genome (discussed in Chapter 3). However, analysis of the complete sequence of the
Arabidopsis genome indicates that many segmental duplications have occurred in the
evolution of the genome, and that many genes are members of multi-gene families in
Arabidopsis (Vision et al., 2000). In the years to come, one of the challenges facing the
plant community will be determining the individual functions of members of multi-gene
families. This chapter describes the use of specific yeast mutants to study the enzymatic
activities and intracellular locations of the three members of the XRN-family in
Arabidopsis (AtXRNs). The use of these yeast strains was of great aid in rapidly
characterizing the basic features of the AtXRN-family, and, as discussed in Chapter 3,
allowed important questions regarding the activities and intracellular locations of the
AtXRNs to be addressed. In addition, the results of these experiments directed the
subsequent emphasis on genetic studies of AtXRN4 described in Chapter 4. This chapter
serves primarily as a guide for those wishing to study XRN-family members from other
eukaryotes but also provides a theoretical framework for how one might begin to
distinguish between members of a multi-gene family.

The XRN-family of 5'-3' exoribonucleases was first described in Saccharomyces
cerevisiae in which it consists of two related proteins, Xrnlp and Xm2p/Rat1p. These
enzymes are similar in sequence and enzymatic activity but differ in their intracellular
locations and cellular functions. Xrnlp is an abundant cytoplasmic enzyme and plays a

major role in the degradation of mRNAs in the cytoplasm, as well as trimnring the 5’

32

 

LJI

 

 

 

 

 

ends of rRNAs and degrading rRN A processing intermediates (Heyer et al., 1995; Hsu
and Stevens, 1993; Henry et al., 1994; Stevens et al., 1991). In contrast to Xrnlp,
Xrn2p/Rat1p is a nuclear protein that functions in the processing of rRNA and snoRNAs
(Johnson, 1997; Petfalski et al., 1998, Villa et al., 2000). In other eukaryotes for which
sequence iS available, the XRN-family consists of a Single member of the Xmlp-like
class and a single member of the Xm2p/Rat1p-like class. In contrast, the Arabidopsis
genome encodes three Xm2p/Ratlp orthologs and no Xrnlp orthologs (Chapter 3). The
function of these XRN-enzymes, or the XRN enzymes of other multicellular eukaryotes
are unknown. Since certain aspects of mRN A degradation appear to differ between yeast
and multicellular eukaryotes, differences that could be due to mechanisms specific to the
XRN enzymes of multicellular eukaryotes, an investigation of these XRNs is warranted.
Insight into the possible cellular function of XRN orthologs can be gained by
examining their exoribonuclease activities and intracellular locations. The
exoribonuclease activity of recombinant XRN enzymes has been examined on RNA
substrates in vitro, an approach used to study the mouse Xrnlp ortholog mXRN 1p
(Bashkirov et al., 1997). The intracellular location of Xrnl p and its ortholog from
mouse, mXRN 1 , has been examined by immunocytochernistry using anti-XRN
antibodies (Bashkirov et al., 1997; Heyer, 1995). The localization of Xrn2p/Rat1p and its
orthologs from Arabidopsis has been studied with XRN-GFP fusion proteins (Johnson,
1997; Chapter 3). While these approaches can yield detailed information about the
characteristics of XRN enzymes, a few simple experiments performed prior to such
detailed analyses can give rapid insight into the basic features of XRN enzymes. These

experiments have the advantage that they are easy to perform, and their results can

33

 

 

 

 

 

 

 

 

 

 

 

enhance subsequent Studies of the XRN-enzymes both in vitro and in their native

CODICXIS.

Analysis of XRN-enzyme activity on poly(G)-containing mRNAs

Making use of RNA substrates with labeled 5’ or 3’ ends, Stevens and co-workers
demonstrated that both Xrnlp and Xm2p/Ratlp function as RN ases that preferentially
degrade RNAS from the 5’ end in vitro (Poole and Stevens 1997). A modification of
these studies was the use of RNA substrates which contained secondary structures known
to block mRN A degradation in vivo, such as poly(G) tracts. Tracts of poly(G) are able to
form stable structures in which four guanosines interact thorough non-Watson-Crick
base-pairing (Kang et al., 1992). By introducing poly(G) tracts or stem-loops into
substrate RN As, it was Shown that sequences 3’ of the stable structure were not
effectively degraded by Xrnlp or by Xm2p/Rat1p, indicating that these structures
inhibited the XRNS progression through the RNA (Poole and Stevens, 1997). Therefore,
this approach confirms that the XRN S are active as exoribonucleases, demonstrates that
they are blocked by poly(G) tracts, and that they degrade RNA from the 5’ end.

The inability of the XRNS of yeast to progress through poly(G) tracts in vitro is
consistent with studies of mRN A degradation in yeast. Experiments performed several
years ago showed that the expression of genes in yeast which contain poly(G) tracts of 18
guanosines results in the accumulation of mRN A degradation intermediates that begin at
the poly(G) tract and end at the poly(A) tail (Muhlrad et al., 1994). That the abundance
of such poly(G)-stabilized mRN A decay intermediates is greatly reduced when the XRN]

gene is deleted led to the hypothesis that Xml p degrades mRNAs from the 5’ end and

34

 

 

 

 

 

 

 

 

 

 

that its progression through mRNAs is inhibited by poly(G) tracts (Muhlrad et al., 1994).
The demonstration that Xmlp's activity is indeed blocked by poly(G) tracts in vitro is
strong support for this hypothesis. Therefore, the accumulation of poly(G)-stabilized
mRN A decay intermediates, when poly(G)-containing genes are expressed in yeast, is a
demonstration of Xmlp’s enzymatic function. As discussed below, the accumulation of
poly(G)-stabilized mRN A decay intermediates in yeast in the absence of Xrnl p function
can serve as a rapid method to analyze the activity of XRN orthologs from other
organisms.

Given the utility of the poly(G) tract approach to understanding mRNA decay in
yeast, the application of a similar approach to other eukaryotes may also lead to insight
into mRN A degradation. The accumulation of poly(G)-stabilized mRN A decay
intermediates similar to those observed in yeast could indicate that XRN-mediated
degradation occurs. Such intermediates have been observed in Chlamydomonas
rheinhardtiz’ (Gera and Baker, 1998), an indication that degradation by an XRN-like
enzyme may occur in this organism. However, in several plant and mammalian systems,
expression of poly(G) tract-containing genes does not result in poly(G)-stabilized mRN A
degradation intermediates (Johnson, 2000). The analysis of poly(G)-containing mRNAs
in other eukaryotes may indicate if the absence of poly(G)-stabilized mRN A decay
intermediates is the result of a mRN A degradation mechanism common to multicellular
eukaryotes, or is particular to specific groups of eukaryotes. Such knowledge should aid
in determining the extent to which the mechanism of mRNA decay in multicellular

eukaryotes differs from the major mRN A decay pathway in yeast.

35

 

._'F"~ '

 

 

Use of a yeast meA mutant and poly(G)-containing mRNAs to analyze the enzymatic
activity of XRN enzymes

A possible explanation for the lack of poly(G)-stabilized mRNA decay
intermediates in plants was that one of the AtXRNs might progress through the stable
secondary structures formed by poly(G) tracts. However, as described in Chapter 3, each
of the AtXRNs are unable to progress through poly(G) tracts. It is likely that blockage by
poly(G) tracts is an inherent property of XRN enzymes. This property is experimentally
advantageous, as it allows for the exoribonuclease activity of the XRN enzymes to be
rapidly assessed.

A simple test of the potential exoribonuclease activity of an XRN enzyme is to
express it in a xml A yeast strain and analyze the degradation of poly(G)-containing
mRNAs. If an XRN protein is active as an exoribonuclease, and degrades transcripts
from the 5’ end, then it will likely generate poly(G)-stabilized mRN A decay
intermediates similar to those produced by Xrnlp. Studies of mouse mXRN 1 (Bashkirov
et al., 1997) and Drosophila Pacman (Till et al., 2000) have made use of xrnI
complementation, but have not studied poly(G)-containing genes. Expression of mXRN 1
or Pacman in an xml mutant was shown to reduce the abundance of endogenous mRNAs
which normally accumulate to high levels in the absence of Xrnlp. It was further shown
that this reduction in mRN A abundance when Pacman was expressed in the xml mutant
was due to increased mRN A degradation rates. Studies of me complementation can be
enhanced by the analysis of poly(G)-containing genes. This approach does not require
mRNA half-life determinations, as the accumulation of an mRNA decay intermediate is
monitored. This property could be advantageous if expression of the XRN does not

completely restore mRN A turnover, since small differences in mRN A degradation rates

36

. r ‘.-.v
1,,“ - . s
t 7'13.
_ . X o
.4 r
.. a I
'w ‘fi‘r" ‘—-
«1 T.
-

i- 3".)

1'.

f‘. rm.
. I.
:1;

I ; .1
.L._.
‘._r..

I .3
15,.

.. ~10.)

' 2‘? it)

i'vti‘fl

aunt-1:13

 

 

 

 

can be hard to detect. In addition, it enables the direction of catalysis to be determined as
well as the effect of poly(G) tracts on the progression of the XRN enzymes to be
addressed. A further advantage of this approach is that it can yield results for both
nuclear-targeted as well as cytoplasmic exoribonucleases, and therefore can be used to
study Xrnlp orthologs as well as Xm2p/Rat1p orthologs (see below and Chapter 3).
Complementation of the xml A mutant was used to study AtXRN 2 of Arabidopsis

thaliana. AtXRN2 was expressed from a 211 plasmid (p1954 in Figure 2-2 A) in an

N

1?:

§ 25

1- <

+ +

Q <

1- ‘-

" E E

3 x x
~' ‘ , AUG PGK1 UAA no-

Figure 2-1. Analysis of the enzymatic activity of AtXRN2 on poly(G)-containing
mRNAs when expressed in yeast lacking Xrnlp (meA). A cDNA encoding AtXRN2
was inserted into pl954 (see Figure 2-2) and expressed in an meA strain. The meA
strain expresses two poly(G)-containing genes, PGKl and MFA2, each of which has a 18
guanosine tract in the 3’ UTR. The accumulation of the poly(G) reporter mRNA PGKl,
and its corresponding poly(G)-stabilized mRNA decay intermediate were analyzed by
northern blot. 20ug of total RNA was separated on a 1.2% agarose formaldehyde gel,
and transferred to a membrane which was hybridized with a radiolabeled oligonucleotide
complementary to the poly(G)-containing PGKl mRNA. The structure of the poly(G)
reporter transcript and its poly(G)-stabilized decay intermediate generated by Xrnlp or
AtXRN 2 are shown at right

 

 

 

xml A strain which also expresses two poly(G)-containing reporter genes, PGKl and
MFA2. Expression of AtXRN 2 in the xml A strain leads to a decrease in the
accumulation of the full length PGKl reporter RNA, and the formation of a poly(G)-
stabilized PGKl mRN A decay intermediate similar that formed by Xrnlp in wildtype
(Figure 2-1). Similar results were obtained when the MFA2 poly(G) reporter was
examined (data not shown). This indicates that AtXRN 2 is active as a 5’-3’
exoribonuclease, can complement the mRN A turnover defect of the xrn IA mutation, and

is blocked by poly(G) tracts when expressed in yeast.

xmlA complementation-Yeast strains (WT) yRP841 (MATa, twp] -A1, ura3-52, leu2-
3,112, lys2-201, cup::LEU2pm), and (meA) yRP884 (MATa, trpI-AI, ura3-52, leu2-
3,112, lys2-201, cup::LEU2pm, XRN1::URA3) have been previously described
(Caponigro and Parker, 1995). Both of these strains harbor chromosomal genes encoding
PGKl and MFA2 reporter RNAS with poly(G) tracts of 18 guanosines in their 3’ UTRs.
These genes are under the control of the GAL] upstream activating sequence, requiring
growth in galactose to induce expression. High levels of expression of heterologous
proteins can be accomplished with the yeast expression vector pGl (Schena et al., 1991).
We have modified the polylinker of this vector to include an additional unique restriction
Site (NotI, p1954 in Figure 2-2) and generated a vector that can be used to generate GFP-
fusions for protein localization studies in yeast (p1972 in Figure 2-2). The vector p1972
has a unique Xhol site (Figure 2-2 B).

The yRP841 and yRP884 strains are easily transformed with the vectors described

in Figure 2-2 using standard methods. We recommend the following procedure, which

38

includes a small-volume sub-culturing step, to obtain good growth of the transformed
strains and high expression levels of the poly(G) reporter genes. A single colony of each

transforrnant is used to inoculate lml of SD medium containing 2% glucose, which is

A.

BamHl Notl Sall BamHl Xhol Ncol

- \,
EcoRg)‘
(6,2- GPD PGK1 ..

5
,.

éf Q?
p1954 TrP1
‘s 7400 bp B glll
2 micron

   
  
  
   

 
   
 

pUC18

 

Barn HI Not I Sal I
I l l

GGATCCCCCGGGCTGCAGGAATTCGCGGCCGGAATTCGATATCAGCTTATCGATACCGTCGAC
p1954 ---------------------------------------------------------------
CCTAGGGGGCCCGACGTCCTTAAGCGCCGGCCTTAAGCTAIAGTCGAATAGCTATGGCAGCTG

BanrH: Xhol Ncol

|
GGATCCGATCCTTCAAGCTCGAGACCACTCGGATCTCTCTC‘I‘AATCGCCCGATCGGAATCCGCCATGGT

p1972 ---------------------------------------------------------------------
CCTAGGCTAGGAAGTTCGAGCTCTCGGTGAGCCTAGAGAGAGATTAGCGGCTAGCCTTAGGCGGTACCA

Figure 2-2. Derivatives of pGl vector for expression of proteins in yeast. (A) p1954 is a
mulitcopy plasmid (211) with the GPD promoter and PGKl terminator. For expression in
yeast, sequences can be inserted between the promoter and terminator using the unique
BamHI, Sall or Notl Sites. p1972 is similar to p1954 but contains the mGFP5 derivative
of GFP(von Amim et al., 1998) and also contains the 35S terminator for the cauliflower
mosaic virus. Fusion of GFP to the C-terminus of a protein is accomplished by insertion
of an open reading frame into the Ncol site. This vector could also be used to express
proteins (not as a GFP fusion) using the Xhol site not available in p1954.(B) Polylinker
sequence of p1954 and p1972. Unique enzyme Sites are indicated.

39

 

 

 

 

 

grown for 2 days at 28°C in a shaker. A 20 ul aliquot of each two-day culture is used to
inoculate 1ml of SD containing 2% galactose (to induce expression of poly(G) reporters)
which is grown for an additional one to two days. The cells grown in SD+galactose are
used to inoculate 30 mls of SD+galactose to an OD600 of 0.05. It is possible to inoculate
the 30 ml SD+galactose culture directly with the initial SD+glucose culture; however,
this can result in a significant lag in growth and poor growth. The 30 ml culture is grown
to an OD...» of 0.3-0.4 (usually takes 2 days) and harvested by centrifugation in 50 ml
conical tubes. Total RNA is isolated using the method described previously (Parker et al.,
1991), and analyzed using standard northern blotting techniques. The probes used for
analysis of the PGKl and MFA2 reporter RNAS are oligonucleotides PGKl: 5’-
AA'I'TGATCTATCGAGGAATI‘CC-3’, and MFA2: 5’-
ATAT‘I‘GATTAGATCAGGAAT'TCC-3’ as previously described (Caponigro and Parker,
1995). The oligonucleotides are 5’ end labeled as follows: 300 ng of oligonucleotide and
400nm of [y-P32]-ATP (ICN) are incubated with 10 units of T4 polynucleotide kinase
(Roche) and kinase buffer (supplied by the manufacturer) in a 20 ul total volume at 37°C
for 1 hour. The labeled oligonucleotide is isolated from free nucleotide by gel filtration

chromatography using a NucTrap column (Stratagene).

Determining the intracellular localization of XRN-family members

The cellular function of XRN-family members is dependent upon their
intracellular locations. As mentioned above, yeast Xrnlp is cytoplasmic, while
Xm2p/Rat1p is nuclear. However, as described in Chapter 3, AtXRN4, an Xm2p/Rat1p

ortholog, accumulates in the cytoplasm. This indicates that the intracellular location of

40

 

 

 

 

   

an XRN-farrrily member may not be reliably predicted based on its similarity to either
Xrnlp or Xm2p/Ratlp. In addition, while AOGlN 2 is targeted to the nucleus (Chapter 3),
expression of AtXRN 2 in yeast led to the accumulation of a poly(G) intermediate Similar
to the one produced by cytoplasrrric Xrnlp (Figure 2-1). Similarly, over-expression of
Xm2p/Ratlp in yeast can partially complement the mRNA turnover defect of xml A cells
(Poole and Stevens). It is likely that nuclear-targeted XRNS accumulate at some level in
the cytoplasm when expressed to high levels. The cytoplasmic accumulation of nuclear
XRN-proteins is advantageous as it facilitates the analysis of their exoribonuclease
activity on mRNAs. However, this indicates that xml A complementation apparently
does not distinguish between cytoplasmic and nuclear enzymes, and that additional
experiments are required to examine the intracellular location of an XRN-enzyme. Prior
to in-depth localization studies, insight into intracellular localization can be gained by an
additional yeast complementation experiment using the xm2/rat1 mutant rat] -1 '8.

If expression in the xml A strain indicates that an XRN enzyme is active as an
exoribonuclease, complementation of an xm2/rat1 mutant can then be tested.
Xm2p/Rat1p is encoded by an essential gene, and cells harboring the rat] J“ mutation
rapidly arrest their growth at the non-permissive temperature (Amberg et al., 1992).
Rescuing the rat] -I'5 mutation appears to require an active exoribonuclease in the nucleus
(Johnson, 1997). This indicates that complementation of rat] -1"’ by an XRN protein may
serve as an additional assay for exoribonuclease activity as well as for nuclear targeting.

Complementation studies of rat] -1" were employed to gain insight into the
intracellular locations of the AtXRNs. The results of these experiments, which will be

discussed in Chapter 3, indicated that complementation of rat] -1 '5 by heterologous

41

 

 

 

 

 

proteins is dependent on the same intracellular location requirements as for the
endogenous yeast proteins. Furthermore, the localization of the AtXRNs in plant cells
was consistent with complementation of rat] -1"’ serving as an indicator of intracellular
location. Therefore, rat] -Its complementation may serve as an indication not only of the
intracellular location of XRN-proteins when expressed in yeast, but perhaps also in their

native contexts.

Complementation of ratI-I'S- The yeast strains employed are FY86 (MATa, ura3-52,
his3A200, leuZAI) and DAtl-l (MATa, ura3-52, leuZAI, tip] A63, rat] -1) (Amberg et
al., 1992). This particular ratI-I'S strain allows for the use of the same expression vectors
employed in xml A complementation as transforrnants can be selected for growth in the
absence of tryptophan. After transformation, single colonies are used to inoculate 1 ml of
SD medium. Following growth overnight, the cultures are diluted to equal OD600 with

SD medium and the cultures are streaked on plates. The best results have been obtained
by streaking out 3 ul of the overnight culture which had been diluted to an OD600 of
approximately 1.0. This amount proved optimal since no growth of the rat] -1 '5 cells was
observed at the non-permissive temperature, while with greater volumes or with a lesser
dilution, some growth can occur which can complicate the analysis. 3 ul of the diluted
cells are pipeted onto two SD plates and spread with a sterile loop. One plate is
incubated at the permissive temperature (26° C) and the other at the non-permissive
temperature (37° C). Incubation of these plates for three days will result in abundant
growth of the wildtype and complemented rat] -I"’ strains. The rat] -1 '5 strain transformed

with the yeast XRN2/RAT1 gene is used as a positive control. It should be noted that

42

 

 

 

complementation of the rat] -1ts strain by heterologous proteins may not result in growth
at 37° C equivalent to rat] J“ complemented with RATl (Chapter 3). Therefore, if it
appears that growth does not occur in three days, the plates should be incubated for a
longer period to determine if the cells are growing very slowly. The ratl-Its strain
transformed with empty vector (p1954) will not grow even when incubated for seven
days at the non-permissive temperature. In addition, the growth of the transformed rat]-
Its strain at the permissive temperature could also be informative. Overexpression of
Xrnlp in wildtype cells has been reported to adversely affect growth rate (Bashkirov et
al., 1995; Page et al., 1998), and it is possible that high levels of expression of other
XRN-proteins could affect growth of the ratI-Its strain. If so, this may be evident at the
permissive temperature. Expression of the AtXRN S using the vectors in Figure 2-2 had
no apparent effect on the growth of the rat] -1 '5 strain at the non-permissive temperature
indicating that the level of expression obtained with these vectors does not appear to
inhibit growth. A final note with respect to ratI-Its complementation relates to the solid
SD medium used for growing the transformed strains. While some protocols indicate that
SD medium can be autoclaved, we have found that the complemented ratI-Its grows very

poorly on autoclaved medium. The SD medium should be filter-sterilized.

Localization of XRN-GFP fusion proteins in yeast

A more direct approach to protein localization is the analysis of fusions of the
XRNS to the green fluorescent protein (GFP), a technique successfully used to study
Xm2p/Rat1p of yeast and the AtXRNs (Johnson, 1997; Chapter 3). Analysis of XRN-

GFP fusions expressed in yeast can be used to confirm the results of rat] -1"’

43

.a—r

 

complementation. AS mentioned above, we have constructed a derivative of the pGl
vector that allows for the expression in yeast of proteins with mGFP5 fused to the C-
terrrrinus (p1972, Figure 2-2; von Arnirn et al., 1998). Insertion of an open reading in the
unique NcoI site is used to generate the XRN-GFP fusion plasmid. Prior to protein
localization studies in any system, it should be demonstrated that the XRN-GFP fusions
retain exoribonucleolytic activity and that rat] 4" complementation is not affected by the
fusion. This is easily accomplished by testing if the XRN-GFP fusion retains the ability
to generate a poly(G)-stabilized mRN A decay intermediate when expressed in the xm IA
strain and does not differ in ability to complement rat] J" relative to the XRN protein
without the GFP fusion. Fusion of GFP to the C-terrrrinus of the yeast XRN proteins
does not appear to adversely affect their function (Johnson, 1997) and as described in
Chapter 3 had no apparent effect on the function of the AtXRNs. If the XRN-GFP
protein retains exoribonucleolytic activity and is not altered in ability to complement

rat] -1 '3, its localization can then be determined by fluorescence microscopy.

Localization of XRN-GFP proteins in yeast cells- The rat] -1 ts Strain is transformed with
the plasmid for expression of the XRN-GFP fusion using standard methods. GFP without
a fusion, expressed from p1972 (Figure 2), can be used as a control as this protein is
distributed uniformly across cells and is not localized preferentially to the nucleus or
cytoplasm (von Arnim, et al., 1998). The growth of the transformants should be carried
out in a manner Similar to that used for the rat] J" complementation studies described
above. Following dilution with SD medium to an OD6oo of approximately 1, the cells are

grown at 26° for an additional 4 hours. To stain nuclear DNA, DAPI (Sigma) is added to

 

a final concentration of 0.5 rig/ml, for the final 30 rrrinutes of the 4 hour growth. It is
sometimes difficult to obtain adequate staining of yeast nuclear DNA with DAPI.
Staining can be enhanced by the addition of 20% ethanol and incubation for
approximately 5 rrrinutes. This treatment does not appear to effect the intracellular
localization or distribution of the AtXRN-GFP fusions. However, it leads to decreased
intensity of GFP fluorescence, and a rapid quenching of GFP fluorescence for some
AtXRN-GFP fusion proteins. For proteins whose expression is low in yeast, the decrease
in GFP fluorescence due to ethanol treatment may make it difficult to obtain
representative images of protein localization before GFP fluorescence decreases below
detection. Optimization of ethanol concentration or incubation times may be required to

obtain the best results for individual XRN-GFP fusions.

CONCLUSIONS

A complete understanding of the function of XRN proteins requires an
examination of their enzymatic activity and their intracellular localization. These two
aspects of XRN proteins can be rapidly investigated by complementation of me and
xrn2/rat1 yeast mutants. The advantages of these experiments are that they are easy to
perform, and in the case of rail-1's complementation, give insight into the function of
XRN-enzymes in their native contexts. Use of these assays allowed for the basic
characteristics of the AtXRNs to be examined, and as described in Chapter 3, enabled the

investigation of the possible role of an AtXRN in mRNA degradation.

45

 

 

 

 

REFERENCES

Amberg, D. C., Goldstein, A. L., and Cole, C. N. (1992). Isolation and characterization
of RATI : An essential gene of Saccharomyces cerevisiae required for the efficient
nucleocytoplasmic trafficking of mRN A. Genes Dev. 6, 1173-1189.

Bashkirov, V. 1., Scherthan, H., Solinger, J. A., Buerstedde, J -M., and Heyer, W.-D.
(1997). A mouse cytoplasnric exoribonuclease (mXRN 1p) with preference for G4
tetraplex substrates. J. Cell Biol. 136, 761-733.

Bashkirov, V. I., Salinger JA, and Heyer WD. (1995). Identification of functional
domains in the Sepl protein (=Kem1, Xrnl), which are required for transition
through meiotic prophase in Saccharomyces cerevisiae. Chromosoma 104, 215-222.

Caponigro, G. and Parker, R. (1995). Multiple functions for poly(A)-binding protein in
mRNA decapping and deadenylation in yeast. Genes Dev. 9, 2421-2432.

Gera, J. F. and Baker, E. J. (1998). Deadenylation-dependent and -independent decay
pathways for betal-tubulin mRNA in Chlamydomonas reinhardtii. Mol.Cell.Biol.
18, 1498-1505.

Henry, Y., Wood, H, Morrissey, J. P., Petfalski, E., Kearsey S, and Tollervey, D.
(1994). The 5' end of yeast 5.8S rRNA is generated by exonucleases from an
upstream cleavage site. EMBO J. 13, 2452-2463.

Heyer, W.-D., Johnson, A. W., Reinhart, U., and Kolodner, R. D. (1995). Regulation
and intracellular localization of Saccharomyces cerevisiae strand exchange protein 1
(Sepl/Xml/Keml), a multifunctional exonuclease. Mol.Cell.Biol. 15, 2728-2736.

Hsu, C. L. and Stevens, A. (1993). Yeast cells lacking 5'-->3' exoribonuclease 1 contain
mRNA species that are poly(A) deficient and partially lack the 5' cap structure.
Mol.Cell.Biol. 13, 4826-4835.

Johnson, A. W. (1997). Ratlp and Xrnlp are functionally interchangeable

exoribonucleases that are restricted to and required in the nucleus and cytoplasm,
respectively. Mol.Cell.Biol. 17, 6122-6130.

Johnson, M. A. (2000). Genetic Determinants of mRNA Stability in Plants. Ph.D.
dissertation. Michigan State University

Kang,C., Zhang, X., Ratliff, R., Moyzis, R., and Rich, A. (1992) Crystal structure of
four-stranded Oxytricha telomeric DNA. Nature 365, 126-31.

46

Muhlrad, D., Decker, C. J ., and Parker, R. (1994). Deadenylation of the unstable
mRN A encoded by the yeast MFA2 gene leads to decapping followed by 5'-->3'
digestion of the transcript. Genes Dev. 8, 855-866.

Petfalski, E., Dandekar, T., Henry, Y., and Tollervey, D. (1998). Processing of the
precursors to small nucleolar RNAS and rRNAs requires common components.
Mol.Cell Biol. 18, 1181-1189.

Poole, T. L. and Stevens, A. (1997). Structrual modifications of RNA influence the 5'
exoribonucleolytic hydrolysis by XRN 1 and HKEl of Saccharomyces cerevisiae.
Biochem. Biophys. Res. Comm. 235, 799-805.

Schena, M., Picard, D, and Yamamoto, K. R. (1991). Vectors for constitutive and
inducible Expression in Yeast. Methods Enzymol. 194, 389-398.

Stevens, A., Hsu, C. L., [sham K.R., and Larimer, F. W. (1991). Fragments of the
internal transcribed spacer 1 of pre-mRNA accumulate in Saccharomyces cerevisiae
lacking 5'-3' exoribonuclease 1. J. Bacteriol. 173., 7024-7028.

Till, D. D., Linz, B., Seago, J. E., Elgar, S. J ., Marujo, P. E., Elias, M. D., Arraiano,
C. M., McClellan, J. A., McCarthy, J. E. G., and Newbury, 8. F. (1998).
Identification and developmental expression of a 5'-3' exoribonuclease from
Drosophila melanogaster . Mech. Dev. 79, 51-55.

Villa, T., Ceradini F, Presutti, C., and Bozzoni, I. (2000). Processing of the intron-
encoded U18 Small nucleolar RNA in the yeast Saccharomyces cervisiae relies on
both exo- and endonucleolytic activities. Mol. Cell. Biol. 18 , 3376-3383.

Vision, T.J., Brown, D.G., and Tanksley, SD. (2000) The origins of duplications in
Arabidopsis. Science 290: 2114-2117.

von Arnirn, A. G., Deng, X. W., and Stacey, M. G. (1998). Cloning vectors for the
expression of green fluorescent protein fusion proteins in transgenic plants. Gene
221, 35-43.

Xue, Y., Bai, X. X., Lee, 1., Kallstrom, G., Ho, J ., Brown, J ., Stevens, A., and
Johnson, A. W. (2000). Saccharomyces cerevisiae RAII (Y GL246c) is homologous

to human DOM3Z and encodes a protein that binds the nuclear exoribonuclease
Ratlp. Mol. Cell. Biol. 20, 4006-4015.

47

 

 

 

 

 

CHAPTER 3

NOVEL FEATURES OF THE XRN-FAMILY IN ARABIDOPSIS: EVIDENCE THAT
AtXRN4, ONE OF SEVERAL ORTHOLOGS OF NUCLEAR Xm2p/Rat1p,
FUNCTIONS IN THE CYTOPLASM

In its original form, this manuscript was published in the Proceedings of the National
Academy of Sciences, Reference: Kastenmayer and Green (2000) Novel Features of the
XRN-Family of Arabidopsis: Multiple Orthologs of Nuclear Xm2p/Rat1p and Evidence
that AtXRN4 Functions in the Cytoplasm. PNAS 97: 13985-90. Control experiments
which could not be included in the publication have been incorporated in this chapter as
well as analysis of the complete Arabidopsis genome with respect to the XRN-family.

48

 

 

 

 

 

 

 

ABSTRACT

The 5’-3’ exoribonucleases, Xrnlp and Xrn2p/Ratlp, function in the degradation and
processing of several classes of RNA in Saccharomyces cerevisiae. Xrnlp is the main
enzyme catalyzing cytoplasmic mRN A degradation in multiple decay pathways, while
Xrn2p/Rat1p functions in the processing of rRNAs and snoRNAs in the nucleus. Much
less is known about the XRN-like proteins of multicellular eukaryotes; however,
differences in their activities could explain differences in mRN A degradation between
multicellular and unicellular eukaryotes. One such difference is the lack in plants and
animals of mRN A decay intermediates like those generated in yeast when Xrnlp is
blocked by poly(G) tracts that are inserted within mRNAs. We investigated the XRN-
family in Arabidopsis thaliana and found it to have several novel features. The
Arabidopsis genome contains three XRN-like genes (AtXRNs) that are structurally similar
to Xm2p/Rat1p, a characteristic unique to plants. Furthermore, our experimental results
and sequence database searches indicate that Xrnlp orthologs may be absent from higher
plants. The lack of poly(G) mRN A decay intermediates in plants cannot be explained by
the activity of the AtXRNs, as they are blocked by poly(G) tracts. Finally,
complementation of yeast mutants and localization studies indicate that two of the
AtXRNs likely function in the nucleus, while the third acts in the cytoplasm. Thus, the
XRN-fanrily in plants is more complex than in other eukaryotes, and if an XRN -1ike
enzyme plays a role in mRN A decay in plants, the likely participant is a cytoplasmic

Xm2p/Rat1p ortholog, rather than an Xrnlp ortholog.

49

 

 

INTRODUCTION

5’-3’ exoribonucleases play key roles in many RNA processing pathways,
including mRNA degradation and the processing of rRN A and snoRNAs. In the yeast
Saccharomyces cerevisiae, Xrnlp and Xm2p/Rat1p are particularly prominent in these
processes. These two exoribonucleases are highly related in sequence and enzymatic
activity, but they differ with respect to their main in vivo substrates, intracellular
locations, and relative abundance. Xrnlp catalyzes the degradation of the majority of
mRNAs, is cytoplasmic, and is highly expressed (1,2). It is the main enzyme catalyzing
mRN A degradation of decapped mRNAs in both the deadenylation-dependent—decapping
as well as the nonsense-mediated decay (NMD) pathways (3). In the deadenylation-
dependent-decapping pathway, transcripts are deadenylated, decapped, and then degraded
5’-3’ by Xrnl p. The NMD pathway is similar, except that decapping and subsequent 5’-
3’ degradation by Xrnlp is not dependent on prior deadenylation. In addition to mRNA
degradation, Xrnlp functions in the maturation of the 5’ ends of rRNAs, and degrades
rRNA processing intermediates (4, 5). Processing of rRNA 5’ ends is a function shared
with Xrn2p/Rat1p. In contrast to Xrnlp, Xm2p/Rat1p is located primarily in the nucleus,
is essential, and is expressed at lower levels than Xrnlp (6, 7). It is believed to be the
major activity responsible for trimming the 5’ ends of several rRNAs, and also trims the
5’ ends of many snoRNAs during their maturation (8, 9).

Studies of Xmlp’s role in mRNA degradation in yeast were aided by the analyses
of mRN A decay intermediates. While mRNA degradation intermediates usually do not
accumulate to detectable levels in eukaryotic cells, it is possible to trap them in yeast by

the insertion of a poly(G) tract into a mRN A. Expression of poly(G)-containing mRNAs

50

 

 

 

 

   

in yeast cells results in the accumulation of mRN A decay intermediates which begin at
the 5’ end of the poly(G) tract and end at the poly(A) tail, an indication that mRNA
degradation is catalyzed from the 5’ end in yeast (10-12). The demonstration that Xrnlp
cannot progress through poly(G) tracts in vitro (13), and genetic studies which showed
that the generation of the poly(G)-stabilized mRN A decay intermediates in vivo is almost
exclusively dependent on Xrnlp (12), implicated Xrnlp as a major enzyme in mRNA
degradation. Thus, the ability to generate mRNA decay intermediates by insertion of
poly(G) tracts, in combination with studies of xrnI mutants, was crucial in determining
Xmlp’s role in mRNA degradation in yeast cells. However, expression of poly(G)
containing mRNAs in plant or animal cells does not result in the accumulation of
poly(G)-stabilized mRN A decay intermediates, despite the presence of XRN-like
enzymes in these organisms (14, 15, L. Maquat, A.-B. Shyu, G. Goodall, personal
communications). This indicates that there is likely a difference in the mechanism by
which mRNAs are degraded in multicellular eukaryotes compared to yeast.

To investigate this difference, we cloned three members of the Arabidopsis XRN-
family and examined their enzymatic activities through heterologous expression in yeast.
As the absence of poly(G)-stabilized mRNA decay intermediates in plant cells could
most easily be explained by the AtXRNs progressing directly through poly(G) tracts, we
investigated their activity on poly(G)-containing mRNAs. All three AtXRNs are blocked
by poly(G) tracts when expressed in yeast, indicating that the absence of poly(G)-
Stabilized mRNA decay intermediates in plant cells is likely due to a novel mechanism.
Beyond addressing the absence of poly(G)-stabilized mRN A decay intermediates in plant

cells, our experiments provide evidence that the number, type and intracellular

51

 

 

 

 

distribution of these Xm2p/Rat1p orthologs iS unique in Arabidopsis, observations that

may have important implications for the mechanism of mRN A turnover in higher plants.

MATERIALS AND METHODS

Cloning of AtXRN 3 and AtXRN4 cDNAs and analyses of sequences.

The EST H4B9T7 (accession no. W43714), which contains the entire AtXRN 2
open reading frame, was obtained from the Arabidopsis Biological Resource Center
(http://aims.cps.msu.edu/aims/). The 3’ end of a cDNA clone for AtXRN3 was isolated
by using the internal Sad to ClaI fragment of H4B9T7 as a probe to screen the PRL2
library (16). The 5’ end of the AtXRN 3 cDNA was obtained by rapid amplification of
cDNA ends (RACE), using as a template, cDNAs generated from seven day old
Arabidopsis seedlings grown on plates containing 1x MS medium and 3% sucrose.
These template cDNAs were produced with a Marathon 5’ 3’ RACE kit (Clonetech). The
primers used for amplification were the Marathon APl primer and an AtXRN 3 cDNA
specific primer PG469 5’-GCTCTGGAAGTGCATGCGAACTTGC-3’. The full-length
AtXRN 3 sequence was constructed by ligation of 5’ RACE product and partial cDNA.
The AtXRN4 cDNA was generated by RT-PCR and 3’ RACE using the above described
seedling cDNAs as template. The 5’ end of the AtXRN4 cDNA was obtained with
PG676 5’-CCTTCAAGCTCGAGACCAC-3’, and PG704 5’-
CCCGAAGCCGCACCAGTAGAGGA-3’, the 3’ end with PG734 5’-
CCCATACCATTATGCTCC-3’ and APl. The full length AtXRN4 sequence was

constructed by ligation of 5’ and 3’ RT-PCR products into the yeast expression vector

52

 

 

 

 

 

 

 

.‘ _.

{I’ll

 

 

 

 

PGI (described below) to generate p2038. The sequences of all PCR products were

determined, and matched the corresponding genomic sequences.

Complementation of yeast mutants

All of the studies in yeast employed derivatives of the shuttle vector pGl (17)
with the AtXRN cDNAs inserted between the BamHI and Sall sites. They were pl846
(AtXRN2), p1958 (AtXRN3), and p2038 (AtXRN4). Yeast strains yRP841 (MATa,
trpI-AI, ura3-52, leu2-3,112, lysZ-ZOI, cup::LEU2pm), and yRP884 (MATa, trpI -A1,
ura3—52, leu2-3,112, lys2-201, cup::LEU2pm, XRN1::URA3), generously provided by Dr.
Roy Parker, were used to study the activity of the AtXRNs on poly(G) mRNAs as
described (18).

Yeast strains FY86 (MATa, ura3-52, his3A200, leu2AI) and DAtl-l (MATa,
ura3-52, leuZAI, trpIA63, rat] -1), generously provided by Dr. Charles Cole, were used
to study rat] -1 '5 complementation (19). Over-night liquid cultures of ratI-Its
transformants were diluted to a similar 01)“, streaked on duplicate plates, and one plate

incubated at 26° C and the other at 37 °C for three days.

Northern blot analyses of RNA from Arabidopsis plants

Total RNA from most tissues was isolated as described in (20) from Arabidopsis
thaliana ecotype Columbia grown in soil for 30 days under standard conditions. The root
tissue was harvested from seedlings grown on MS medium for 14 days. 20 ug of total

RNA was separated with a 1% agarose formaldehyde gel, transferred to nylon membrane

53

l

 

 

 

(N ytran plus, Schleicher and Shuell), and hybridized with AtXRN gene specific probes.
The gene specific probes used were the Xhol to NotI fragment of H4B9T7(AtXRN2), the
XbaI to NotI fragment of p1958 (AtXRN3), and the Xhol to NotI fragment of p2038

(AtXRN4).

Southern Blot Analysis

15 ug of genomic DNA was incubated overnight with 100 units of the restriction
enzymes indicated in the text. The restriction digests were separated with a 1% agarose
gel, and blotted to nylon membrane. A separate blot was generated and hybridized with

each of the gene specific probes.

Construction of GFP-fusions and localization studies

The open reading frames of AtXRN 2 and AtXRN4 were amplified by PCR and
inserted into the NcoI site of pAVA393 (21) for studies in onion epidermal cells. The
correct sequence of all PCR products was verified. The primers used were: PG773 5’-
CCATGGAACTGT'ITTGGGAGG-3’ and PG774 5’-CCATGGGTGTACCGTCGT'ITI‘-
3’ for AtXRN 2, and PG766 5’-GGAATCCGCCATGGGAGTACCGGC-3’ and PG767
5’-CCATGGACAAGTTTGCACCTGC-3’ for AtXRN4.

For localization studies in yeast, the AtXRN4-GFP fusion was expressed in rat]-
1" from p2039, a pGl derivative containing an AtXRN4-GFP fusion. Transformed cells
were grown overnight at the permissive temperature, diluted to an OD600 similar to that

used for rat] -I" complementation and photographed with a Kodak DC120 camera

54

4? T

 

w! .5 ”line
=l .‘i_. «

 

 

 

 

(3.

St

\\

 

(Kodak) and a Zeis Axiophot fluorescence microscope (Zeis) using appropriate filters.
Treatment with 20% ethanol was used to facilitate DAPI staining and did not effect
AtXRN4-GFP localization (data not shown).

Bombardment of onion epidermal cell layers was carried out as described (22),
with the exception that 1.0 um gold particles were used and the amounts of DNA were as
indicated in Figure 3-6. The plasmids used were: pGFP-GUS and pAVA 367(GFP-NIa)
(21), p2046 (AtXRN2-GFP), and p2042 (AtXRN4-GFP). Transformed onion epidermal
layers were incubated on plates containing 1X MS medium and 3% sucrose for 20-24

hours in the dark and then photographed as described above.

RESULTS

AtXRN 2, AtXRN 3 and AtXRN4 are orthologs of the Saccharomyces cerevisiae protein
Xm2p/Rat1p

To identify XRN-like sequences of Arabidopsis, we searched the GenBank
database for sequences Similar to Xrnlp. Portions of three chromosomal sequences, TAC
K16E1 (accession no. AB022210), BAC F10A5 (accession no. AC006434), BAC
F20D21 (accession no. AC005287) and two ESTS, H4B9T7 (accession no. W43714) and
H4B8T7 (accession no. W43713) contained sequences highly Similar to Xrnlp. The two
ESTS correspond to the XRN-like gene present on TAC K16El. Analysis of the entire
sequence of the EST H4B9T7 revealed an open reading frame highly Similar to Xrnlp, as
well as to Xrn2p/Rat1p. Due to its greater similarity to Xm2p/Rat1p, the protein encoded

by H4B9T7 was designated AtXRN 2 (accession no. AF286720). cDNAs corresponding

55

 

 

 

EVE:

 

 

 

 

 

 

 

Figure 3-1. The Arabidopsis proteins AtXRN2, AtXRN3 and AtXRN4 are orthologs of
the Xrn2p/Rat1p protein of S. cerevisiae. (A) Members of the XRN family were aligned
with the program CLUSTALW (http://dot.imgen.bcm.tmc.edu:933llmulti-align/multi-
align.html) revealing conserved regions of the XRN-family (black regions) and an
Xmlp-specific domain (gray regions). Bipartite NLS consensus motifs (diamonds), in
the regions indicated by the bracket, were identified with the program PSORT
(http://psort.nibb.ac.jp). The half diamond in AtXRN4 indicates the lack of the C-
terrrrinal portion of a consensus bipartite NLS. The AtXRNs, M. musculus Dhml
(accession no. 149635), S. pombe thl (accession no. 843891), S. cerevisiae
Xm2p/Rat1p (accession no. NP_014691), D. melanogaster gene product (accession
AAF52452), Mus musculus mel (accession no. CAA62820), D. melanogaster Pacman
(accession no. CAB43711), S. cerevisiae Xrnlp (accession no. P22147) and S. pombe
EonI (accession no. P40383) were aligned. (B) The anrino acid sequences of the
AtXRNs which correspond to the bracket in part A are shown. Identical residues are
shown in black, Similar residues are in gray. The basic residues constituting a bipartite
NLS found in AtXRN2 and AtXRN3, only part of which is conserved in AtXRN4, are
indicated by asterisks.

56

 

 

 

 

 

 

 

argumm mogmzzeama . . .. 0.2992342me
95.. gomgauovnzméa

   

 

hmmmammm m a. gnome?
LAMP 4.0m m Am uoqmoquAxo 0mm. 4 uuuuuuuu

3qu .m
:03
063329.. .m
EEx

. Hnanometfios d
:anam
3302:: .E
:52.
3qu .m
3.5
3323 .m
nsamawsx
Lona—30:63.: d
«Ex .Ed
2.3.82: .E
:55
23:65 .<
1259‘
23:2: .<
”2534‘
26:2: .<
«259‘

 

 

beg—Eu $3-3"... . . .. ._,
3352 $8.9. ul

 

 

 

57

 

 

 

 

 

Si

ar

 

 

to the remaining XRN-like sequences were obtained by cDNA library screening and RT-

PCR as described in Materials and Methods. The protein encoded by the cDNA
corresponding to the XRN-like gene on BAC F10A5 was designated AtXRN 3 (accession
no. AF286719), and the protein encoded by the cDN A corresponding to the XRN-like
gene on BAC F20D21 was designated AtXRN4 (accession no. AF286718).

By comparing arrrino acid sequences, it is possible to distinguish between Xmlp-
like and Xrn2p/Rat1p-like proteins because members of the Xrnlp-like class have a
carboxy-terminal domain specific to this class (gray boxes Figure 3-1 A). The AtXRNs
lack this carboxy-terrrrinal domain. An additional characteristic of Xmlp-like class is the
closer spacing of the four N -terminal most conserved regions relative to that of the
Xrn2p/Rat1p-like class (black boxes Figure 3-1A). The spacing of these N -terminal
conserved regions in the AtXRNs is most like members of the Xrn2p/Rat1p-like class.
Based on these sequence features, we classified the AtXRNs as Xm2p/Rat1p orthologs.

Additional experiments were carried out to identify XRN-like sequences from
Arabidopsis and other plant species that were more similar to Xml p than to
Xm2p/Ratlp; however, no evidence for XRNl-like sequences in plants was obtained.
Extensive searches of sequence databases, including the complete Arabidopsis genome,
have not yielded evidence for an XRNl-like gene in Arabidopsis or any other plant
species. The absence of XRN l-like sequences from the complete Arabidopsis genome,
and from the variety of sequences available from other plant species, makes it likely that

Xrnlp orthologs are absent from higher plants.

58

 

.355: 1’

 

 

 

SI.

pn

C01

 

pt) f

 

 

AtXRN 2, AtXRN 3 and AtXRN4 are expressed in the major organs of Arabidopsis

The 3’ ends of the AtXRN cDNAs, including a portion of the open reading frames
and 3’ untranslated regions, are not conserved, and were used to generate gene Specific
probes to study the expression of the AtXRN S using northern blots. These probes were
able to specifically recognize the individual AtXRN genes on Southern blots (Figure 3-2
A). As seen in Figure 3-2 B, all three AtXRN transcripts were detected in roots,
leaves, stems, and flowers. The levels of the AtXRN transcripts were similar to each
other, and to themselves in different tissues, relative to the control eIF4A (quantitation

not shown).

AtXRN 2, AtXRN 3 and AtXRN4 function as 5'-3' exoribonucleases and are blocked by
poly(G) tracts when expressed in yeast

The enzymatic activity of the AtXRNs could explain the absence of poly(G)-
stabilized mRNA decay intermediates in plants. The Simplest explanation could be that
the XRN-like enzymes of plants (and possibly other multicellular eukaryotes) can
progress directly through poly(G) tracts degrading poly(G)-containing mRNAs to
completion. To examine this possibility, and to determine if the AtXRNs were functional
as exoribonucleases, the activity of each of the AtXRNs on poly(G) mRNAs was tested
through heterologous expression in yeast. The AtXRN 2, AtXRN 3 and AtXRN4 proteins
were expressed from a multicopy plasmid in wildtype and xml A yeast strains. These
strains expressed two poly(G)-containing genes, PGKl and MFA2, under the control of
the GAL1 upstream activating sequence. For each gene, two transcripts, full-length and

poly(G)-stabilized mRNA decay intermediate, readily were detected in northern blots of

59

 

 

AtXRN2 AtXRN3 AtXRN4
_ > = — > = — > =
% ‘5 g “6 % g “o ‘5‘ 2
u u ._ U o .- U o ._
U1 11.1 I "J 1.1.1 I U1 1.1.1 I
an

 

   

 
 

AtXRN2.
fl is '2
Cm“

AtXRN4

eIF4A

 

Figure 3-2. Analysis of AtXRN expression. (A) Gene specific probes generated from the
3’ ends of the AtXRN cDNAs are specific for the individual AtXRN genes on Southern
blots. 15ug of genomic DNA was digested with the restriction enzymes indicated,
separated with a 1% agarose gel and blotted to nylon membrane. Each blot was
hybridized with the AtXRN gene specific probe indicated at top of each blot. Tick marks
indicate the size of molecular weight markers, 10 kb to 1.6 kb and 1 kb. (B) AtXRN2,
AtXRN3 and AtXRN4 are expressed in the major Arabidopsis organs. Northern blot
analysis was carried out on 20 ug total RNA isolated from the indicated organs. Gene
Specific probes for the AtXRNs, as well as a probe against the eIF4A transcript which
served as a control, were used in the hybridization. AtXRN4 was analyzed separately

and rs Shown relative to the eIF4A control for that experiment. R=roots L=leaves
S=stems, F=flowers

RNA isolated from wildtype yeast (Figure 3-3). In contrast, in xml A cells, little or no
poly(G) intermediate accumulated for either reporter transcript as previously observed

(Figure 3-3, and ref. 11). Expression of AtXRN2, AtXRN3 or AtXRN4 in the meA

xm1A+AtXRN2
xrn1A+AtXRN3
xm1A+AtXRN4

xrn1A

'—
3

' AUG PGK1 UAA pG-

 

 

 

Figure 3-3. All three AtXRNs function as exoribonucleases which are blocked by
poly(G) tracts when expressed in yeast. The AtXRNs were expressed in the xrnI A strain,
and the accumulation of the poly(G) reporter mRNAs PGKl (top) and MFA2 (bottom)
was analyzed by northern blot. The structure of the poly(G) reporters is shown at right,
and the AtXRN expressed in the xrnA strain is shown above.

cells resulted in a decrease in the abundance of the full-length reporter mRNAs, and in an
increase in the accumulation of the poly(G) intermediates for both reporter transcripts
(Figure 3-3). This result indicates that all three AtXRNs function as 5'-3‘
exoribonucleases which are able to degrade mRN As, and that they are blocked by

poly(G) tracts when expressed in yeast. Therefore, the absence of poly(G)-stabilized

61

~——-— - -...a- ‘.w ~

 

 

 

O.
\x.

 

 

mRNA decay intermediates in plant cells is unlikely due solely to an AtXRN progressing
through poly(G) tracts and indicates that additional cellular proteins would likely be

required for one of the AtXRNs to degrade poly(G)-containing mRNAs in plant cells.

AtXRN 2 and AtXRN 3 but not AtXRN4 complements the rat] -1 ‘3 mutation

All three of the AtXRNs are structurally more similar to Xrn2p/Rat1p than to
Xrnlp, indicating that they may have a nuclear function as does Xm2p/Rat1p.
Xrn2p/Rat1p is encoded by an essential gene and cells harboring a temperature sensitive
allele, ratI-I‘S, rapidly arrest growth at the non-permissive temperature (19). The
function of Xrn2p/Rat1p required for cell viability is unknown, but is thought to be
exoribonuclease activity within the nucleus (7). Coupled with our observation that the
AtXRNs have exoribonuclease activity when expressed in yeast (Figure 3-3), successful
complementation of rat] -1 ‘5 would imply nuclear localization in yeast cells.

The AtXRN yeast expression plasmids were introduced into the rat] -1 ‘3 strain and
the growth of the transformants on solid medium was monitored. Expression of the
AtXRNs did not alter the growth of the rat] 4‘5 strain at the permissive temperature,
indicating that expression of the AtXRNs had no deleterious effects on the growth of the
ratI-Its strain in this assay (Figure 3—4). At the non-permissive temperature, expression
of AtXRN 2 and AtXRN 3 in the ratI-Its strain restored growth, albeit to a lesser extent
than the XRN2/RAT1 control (Figure 3—4). This indicated that AtXRN2 and AtXRN 3
likely entered the nucleus and replaced the essential function of X1n2p/Rat1p. In
contrast, expression of AtXRN4 did not rescue the growth arrest of the rat] 4“ strain

indicating that it likely did not enter the yeast nucleus.

62

 

 

 

 

_- v-2.w‘ -57»

._
| PT

. .
1h

Permissive
ran-1+
AtXRN2

rat1-1+
AtXRN3

Non-permissive
Ian-1+
AtXRN2

   

rat1-1+
~ RAT1

   
 
 

   
 

ran-1+ .
AtXRN4

ran-1+
AtXRN4

“ rat1 -1+
vector

Figure 3-4. AtXRN2 and AtXRN3 but not AtXRN4 complement the rat] -1 ‘5 mutation.
The rat] -1 ‘5 strain was transformed with the expression plasmids employed in Figure 3-3
and the growth of the transformants monitored at the permissive (left) and non-
pemiissive (right) temperatures.

AtXRN2-GFP is targeted to the nucleus while AtXRN4-GFP is cytoplasmic
Complementation of rat] -1 ‘5 indicated that the AtXRNs likely differ regarding
nuclear targeting, and therefore might differ with respect to nuclear localization
sequences (NLS). The AtXRNs are about 65% identical to each other in the regions
encompassing the XRN-family conserved domains (black boxes Figure 3-1 A); however,
AtXRN4 lacks about 90 amino acids present in AtXRN2 and AtXRN 3 (indicated by
bracket in Figure 3-1 A). These 90 amino acids of AtXRN 2 and AtXRN 3 contain an
obvious bipartite NLS beginning at amino acid 407 (diamonds in Figure 3-1 A). The
bipartite NLS is a well—characterized motif that targets proteins to the nucleus in plants

and other eukaryotes, and consists of two basic regions separated by a variable spacer

63

 

 

 

I J

LL.

 

rt.

 

('23). The N-terminal domain of the NLS in also conserved in AtXRN4, but as a result of

the sequence deletion (relative to the other AtXRNs), the C-terminal region of this NLS

   
  
 
 

     

A.
Permissive Non-pennissive
rat1-1 + .. . y ' 5; rat1-1 + rat1-1 + . rat1-1 +
AtXRN3-GFP -. ‘5 " AtXRN2-GFP AtXRN3-GFP .AtXRNz-GFP
rat1-1 + -
AtXRN4-GFP
B.

0.
IL
(9
V
Z
Z
15
<
+
Q
q.
.5,

. AUG PGK1 UAA :36 I

 

' WT
. xrn1A + vector
. xrn1A + AtXRN4

Figure 3-5. AtXRN-GFP fusion proteins are functional. (A) The ratI-I ‘3 strain was
transformed with AtXRN-GFP expression plasmids and the growth of the transformants
monitored at the permissive (left) and non-permissive (right) temperatures as in Figure 3-
4. (B) AtXRN4—GFP is functional as an exoribonuclease. AtXRN4-GFP was expressed in
the meA strain, and the accumulation of the poly(G) reporter mRNA PGKl was
analyzed by northern blot. The structure of the poly(G) reporter is shown at right, and
the AtXRN expressed in the xmA strain is shown above.

is absent (Figure 3—1 B). If AtXRN2 and AtXRN3 were targeted to the nucleus, but
AtXRN4 was not, this would explain the AtXRNs differential ability to complement

ratI-Its and could indicate that AtXRN4 has a cytoplasmic function.

.(m‘i'p-

AL“

 

To examine this possibility, an AtXRN4-GFP fusion was expressed and
characterized first in yeast and subsequently in plant cells. The RNase activity of the
AtXRN4-GFP fusion was confirmed by its ability to generate a poly(G)-stabilized
mRNA decay intermediate when expressed in xml A cells (Figure 3-5 B), and, like
AtXRN4, AtXRN4-GFP did not complement rail-1ts (Figure 3-5 A). Yeast cells
expressing AtXRN4-GFP exhibited two expression patterns, uniform cytoplasmic
fluorescence, and spots which varied in both size and number (Figure 3-6). The uniform
fluorescence was distributed evenly across the yeast cells, but appeared to be excluded
from the nucleus. Exclusion from the nucleus is illustrated by the cells within the box,
where a region without fluorescence (indicated by the arrow) corresponds to DAPI
stained nuclear DNA (Figure 3-6 A, Overlay). Similarly, the spots did not correspond to
the nucleus (Figure 3-6 A, Overlay). Although we cannot rule out that some AtXRN4-
GFP may enter the nucleus, these results indicate that the most likely reason for the
inability of AtXRN4 to complement ratI-Its is due to its exclusion from the nucleus, and
might indicate that AtXRN4 functions as a cytoplasmic protein in Arabidopsis

To examine the intracellular location of the AtXRNs in plant cells, AtXRN-GFP
fusion proteins were transiently expressed in onion epidermal cells by particle
bombardment (22). As expected, based on successful rat] -1 ‘8 complementation,
AtXRN2-GFP showed high fluorescence in the nucleus, an expression pattern similar to
the nuclear GFP-NIa protein (21) (Figure 3-6 B). In addition to a general nuclear
localization, AtXRN2-GFP accumulated in bright spots within the nucleus that may
represent targeting of AtXRN2-GFP to the nucleoli. As an ortholog of Xrn2p/Rat1p of

yeast, AtXRN 2 may also function in rRNA processing and could be targeted to this

65

 

 

 

 

 

Figure 3-6. AtXRN2-GFP and AtXRN4-GFP localization. (A) AtXRN4-GFP was
expressed in the ratI-Irs strain, and GFP fluorescence compared with DAPI stained
nuclear DNA. The GFP and DAPI images of the boxed cells are shown superimposed
(Overlay). (B) Plasmids encoding AtXRN2-GFP and AtXRN4-GFP were used to
transform onion epidermal cells by particle bombardment. GFP fluorescence of
AtXRN2-GFP and AtXRN4-GFP was compared to that of GFP-GUS, a primarily
cytoplasmic protein, and GFP-Nla which is targeted to the nucleus. The onion epidermal

cell images were obtained with a 20X objective. A 40X image of AtXRN4-GFP lug is
also shown. The arrows indicate the nuclei.

66

 

 

 

 

>mtm>0

 

nimvézmxz

Sausage $0-2me Es Eoszmxi .3 2:?

  

31....
9642me 3.0-?me 22-9.0

_n_<n_ anOézmxfix

      

 

EoEsmrm

67

 

 

 

 

SUb-nuclear region. Similar to AtXRN2-GFP, transient expression of AtXRN3-GFP in
onion epidermal cells revealed a nuclear localization (data not shown). In contrast to the
intense nuclear fluorescence of AtXRN2-GFP, the intracellular distribution of AtXRN4-
GFP appeared more similar to that of GFP-GUS, a protein known to accumulate in the
cytoplasm (21). In addition, similar to its expression in yeast, AtXRN4-GFP
accumulated as both uniform fluorescence and as spots that were not detected within the
nucleus (Figure 3-6B). Since the AtXRN4-GFP spots may have been cytoplasmic
inclusions (24), we tested if lowering AtXRN4-GFP expression would diminish the
number of spots. As seen in Figure 3—6 B, (AtXRN4-GFP 1 pg), reducing the amount of
DNA used in the bombardment resulted in a reduction in the number and size of the
spots. A higher magnification shows uniform AtXRN4-GFP fluorescence and the
reduction in the number of spots (AtXRN4-GFP 1 pg, 40X). Thus, reducing the amount
of DNA decreases the number and size of the spots, while not effecting the cytoplasmic

localization of AtXRN4-GFP.

DISCUSSION

In this study, we investigated the XRN-family in Arabidopsis and discovered it
has several features not found in other eukaryotes. The Arabidopsis genome encodes an
unusual number and distribution of XRN enzymes. All three AtXRNs are Xrn2p/Ratlp
orthologs, and Xrnlp orthologs are apparently absent from higher plants. The absence of
a Xrnlp ortholog is surprising since they have been described from S. pombe (25), M.
musculus (26), D. melanogaster (27), and are present in sequence databases from a

variety of other eukaryotes (Kastenmayer and Green, unpublished). This indicates that

68

 

Xrnlp-like function may be conserved in eukaryotes; however, the lack an Xrnlp
ortholog from Arabidopsis, and possibly higher plants, would require that the conserved
function be catalyzed by different RN ase. This study indicates that Xrnlp-like function
may be carried out by AtXRN4-like enzymes in higher plants. AtXRN4 functions as an
exoribonuclease, and is cytoplasmic where it could function in the degradation of
mRNAs.

A potential difference in the mechanisms of mRN A decay between yeast and
multicellular eukaryotes is indicated by the accumulation of poly(G)-stabilized mRN A
decay intermediates in yeast, but not in higher eukaryotes (14, 15, L. Maquat, A.-B.
Shyu, G. Goodall, personal communications). In plant cells, expression of mRNAs
containing poly(G) tracts does not lead to the accumulation of poly(G)-stabilized mRNA
decay intermediates like those observed when Xrnlp is blocked by the insertion of
poly(G) tracts in mRN As in yeast (14). One possible explanation for the absence of
poly(G)-stabilized mRN A decay intermediates in higher eukaryotes may be that the
XRNS from multicellular eukaryotes are more robust than their yeast counterparts and
can progress directly through poly(G) tracts. Alternatively, these XRNS may be blocked
by poly(G) tracts, but additional proteins, such as RNA helicases, resolve the structures
formed by poly(G) tracts thus allowing XRN-like enzymes to complete degradation. It is
also possible that a highly active 3’-5’ mRN A degradation pathway in plants degrades
through poly(G) tracts from the 3’ end. However, while our experiments in plant cells
were designed to detect poly(G)-stabilized mRN A decay intermediates due to the action
of a 3’-5’ exoribonuclease mediated pathway, or intermediates due to degradation from

both ends of the mRN A simultaneously [“poly(G) stub” (28)]. such intermediates were

69

 

 

1.}

 

 

not detected. A 3’-5’ pathway in plants would therefore also likely require the activity of
an RNA helicase to degrade poly(G)-containing mRN As. RNA helicases are likely
associated with mRNA degradation machinery in eukaryotes (29), and since is it is
known that greater than 30 RNA helicase-like genes are present in the Arabidopsis
genome (30), such activities could be quite prevalent in the cytoplasm. It is unlikely that
blockage of XRN proteins by poly(G) tracts in yeast depends on cellular factors
particular to yeast, as poly(G) tracts and other stable secondary structures inhibit both
Xrnlp and Xrn2p/Rat1p in vitro with only purified components present (13). Although
the XRNS from animals have not been directly tested for their ability to progress through
poly(G) tracts, the five XRNS that have so far been tested do not progress through
poly(G). This indicates that blockage by poly(G) tracts is likely an inherent property of
XRN enzymes, and that the absence of poly(G)-stabilized mRNA decay intermediates in
animal cells is likely due to a similar reason as in plants.

Several observations indicate that some mRNAs in plants may be degraded by 5’-

3’ exoribonuclease-mediated pathways that could involve AtXRN4 in Arabidopsis, or
AtXRN4-like enzymes of other plants. The most compelling evidence comes from
studies of degradation intermediates of PhyA mRN A in oat seedlings. The majority of
these intermediates exist as a series of transcripts lacking increasing amounts of the 5’
end, consistent with degradation mediated by a 5’-3’ exoribonuclease (31). Degradation
of at least some of mRN As from the 5’ end in plants may resemble the major mRN A
decay pathway in yeast in which mRNAs are degraded from the 5’ end by Xrnlp
following their deadenylation and decapping. In addition to AtXRN4, orthologs of other

components relevant to this pathway exist in the Arabidopsis genome (32), including

70

PABZ. PAB2 is a poly(A) binding protein which is able to function in the coupling of
deadenylation to mRN A decay when expressed in yeast (33). Alternatively,
endoribonuclease cleavage may initiate mRN A decay, with AtXRN4 catalyzing the
degradation of the products of endoribonuclease cleavage. Such a mechanism has been
proposed for the degradation of SRS4 mRN A in petunia (34), as well as for the
degradation of mRNAs in a variety of plant species targeted by post-transcriptional gene
silencing (35-37). Post-transcriptional gene silencing is a phenomenon which occurs in
plants, animals and fungi in which mRN As that share a high degree of similarity are
selectively degraded (reviewed in 38). Because both cytoplasmic and nuclear mRN A
decay may be involved in this process, any of the AtXRNs could participate.

The presence of three Xrn2p/Rat1p orthologs in Arabidopsis is a particularly
interesting aspect of the XRN-family in Arabidopsis. Since AtXRN 2 and AtXRN3 are
both targeted to the nucleus, they may have functions similar to Xrn2p/Rat1p, such as
rRNA or snoRNA processing (8,9). These functions may be redundant, substrate-specific
or specific to particular cell types. Insight into these possibilities may be gained by a
more detailed analysis of their expression patterns in different cells, intranuclear
distributions and enzymatic activities. Another implication of multiple XRN2/RAT1
orthologs in Arabidopsis is the potential to gain insight into the evolution of gene
function. The three AtXRN genes are likely to have arisen due to duplication of an
XRN2/RAT1-like gene. The deletion of the region encoding the bipartite NLS during
duplication may have given rise to an AtXRN4-like protein. Loss of the NLS would
allow this protein to gain cytoplasmic function, and this protein may have eventually

replaced a Xrnlp ortholog. That a Xrn2p/Rat1p protein can replace Xrnlp function is

71

 

 

 

supported by the observation that Xm2p/Ratlp expressed in the cytoplasm of yeast can
complement an xml A strain (7). Therefore, mRN A degradation in plants may resemble
the major mRNA decay pathway of yeast; however, in contrast to yeast, the final
degradation of mRNAs could be catalyzed by a cytoplasmic Xrn2p/Rat1p-like enzyme
such as AtXRN4. This may be a feature of mRN A degradation unique to the plants, as
this is the only eukaryotic kingdom from which XRN 1-like genes are apparently absent.
Ultimately, it should be possible to determine the substrates and functions of the
AtXRNs in Arabidopsis by the isolation and characterization of xm mutants. Analyses of
these mutants may aid in dissecting the potentially Overlapping roles of AtXRN 2 and
AtXRN 3 in the nucleus. It should be noted that analyses of xml and xrnZ/ratI mutants
has implicated Xrnlp as having a meiosis specific role independent from its
exoribonuclease activity (39), and Xrn2p/Rat1p in nucleocytoplasmic mRN A trafficking
(19). Thus, analysis of Arabidopsis xm mutants may provide further insight not only into
mRNA decay and RNA processing in plants, but also into functions of the XRN -family

in general.

Acknowledgements: We thank Dr. Mark Johnson and Dr. Ambro van Hoof for helpful
comments on this manuscript, Chris Behrens for contributing to the localization studies,
and Linda Danhof for expert technical assistance. This work was supported by the
National Science Foundation (grant no. IBN 9408052), U.S. Department of Energy (grant
no. DE-FG02-91E920021) and the U.S. Department of Agriculture (grant no. 9801498)

72

 

REFERENCES

l-Heyer, W.-D., Johnson, A. W., Reinhart, U., and Kolodner, R. D. (1995).
Regulation and intracellular localization of Saccharomyces cerevisiae strand
exchange protein 1 (Sepllel/Keml), a multifunctional exonuclease. Mol. Cell.
Biol. 15, 2728-2736.

2-Hsu, C. L. and Stevens, A. (1993). Yeast cells lacking 5'-->3' exoribonuclease 1
contain mRNA species that are poly(A) deficient and partially lack the 5' cap
structure. M01. Cell. Biol. 13, 48264835..

3-Tharun, S. and Parker, R. (1997) in mRNA Metabolism & Post-Transcriptional Gene
Regulation, eds. Harford, J. B. & Morris, D. (W iley-Liss Inc, pp. 181-200.

4-Henry, Y., Wood, H, Morrissey, J. P., Petfalski, E., Kearsey S, and Tollervey, D.
(1994). The 5' end of yeast 5.8S rRNA is generated by exonucleases from an
upstream cleavage site. EMBO J. 13, 2452-2463.

5-Stevens, A., Hsu, C. L., Isham K.R., and Larimer, F. W. (1991). Fragments of the
internal transcribed spacer 1 of pre-mRN A accumulate in Saccharomyces cerevisiae
lacking 5'-3'exoribonuclease 1. J. Bacteriol. 173., 7024-7028.

6-Kenna, M., Stevens, A., McCannon, M. & Douglas, M. G. (1993) An essential yeast
gene with homology to the exonuclease-encoding XRN l/KEMl gene also encodes
a protein with exoribonuclease activity. Mol. Cell. Biol. 13, 341-350.

7-Johnson, A. W. (1997). Ratlp and Xrnlp are functionally interchangeable
exoribonucleases that are restricted to and required in the nucleus and cytoplasm,
respectively. Mol. Cell. Biol. 17, 6122-6130

8-Petfalski, E., Dandekar, T., Henry, Y., and Tollervey, D. (1998). Processing of the
precursors to small nucleolar RNAS and rRNAs requires common components.
Mol. Cell. Biol. 18, 1181-1189.

9-Villa, T., Ceradini F, Presutti, C., and Bozzoni, I. (1998). Processing of the intron-
encoded U18 small nucleolar RNA in the yeast Saccharomyces cervisiae relies on
both exo- and endonucleolytic activities. Mol. Cell. Biol. 18 , 3376-3383.

10-Vreken, P. & Raué, H. A. (1992) The rate-limiting step in yeast PGKl mRNA
degradation is an endonucleolytic cleavage in the 3'-terminal part of the coding
regionMol. Cell. Biol. 12, 2986-2996.

11-Decker, C. J. and Parker, R. (1993). A turnover pathway for both stable and
unstable mRNAs in yeast: evidence for a requirement for deadenylation. Genes
Dev. 7, 1632-1643.

73

 

12-Muhlrad, D., Decker, C. J ., and Parker, R. (1994). Deadenylation of the unstable
mRNA encoded by the yeast MFA2 gene leads to decapping followed by 5'-->3'
digestion of the transcript. Genes Dev. 8, 855-866.

13-Poole, T. L. and Stevens, A. (1997). Structrual modifications of RNA influence the 5'
exoribonucleolytic hydrolysis by XRN 1 and HKEl of Saccharomyces cerevisiae.
Biochem.and Biophys. Res. Comm.235, 799-805.

14-Johnson MA. (2000). Genetic Determinants of mRNA Stability in Plants.
Doctoral Dissertation Michigan State University.

15-Kastenmayer, J. P., van Hoof, A., Johnson, M. & Green, P. J. (1998) in Plant
Molecular Biology, eds. Raikhel, N., Last, R., Morelli, G., & LaShavo, F. (Springer-
Verlag, Berlin), pp. 125-133.

16-Newman, T. C., de Bruijn, F., Green, P. J ., Keegstra, K., Kende, H., McIntosh,
L., Ohlrogge, J ., Raikhel, N. V., Somerville, S. C., Tomashow, M., Retzel, E.,
and Somerville, C. R. (1994). Genes Galore: A summary of methods for accessing
results from partial sequencing of anonymous Arabidopsis cDNA clones. Plant
Physiol. 106, 1241-1255.

l7-Schena, M., Picard, D. & Yamamoto, K. R. (1991). Vectors for constitutive and
inducible gene expression in yeast.Methods Enzymol. 194, 389-398.

18-Caponigro, G. and Parker, R. (1995). Multiple functions for poly(A)-binding
protein in mRNA decapping and deadenylation in yeast. Genes Dev. 9, 2421-2432.

19-Amberg, D. C., Goldstein, A. L., and Cole, C. N. (1992). Isolation and
characterization of RAT1: An essential gene of Saccharomyces cerevisiae required
for the efficient nucleocytoplasmic trafficking of mRNA. Genes Dev. 6, 1173-1189.

20-Taylor, C. B., Bariola, P. A., DelCardayré, S. B., Raines, R. T. 8: Green, P. J.
(1993). RN82: a senescence-associated RNase of Arabidopsis that diverged from
the S-RNases before speciation (1993) Proc. Natl. Acad. Sci. USA 90, 5118-5122.

21-von Arnim, A. G., Deng, X. W., and Stacey, M. G. (1998). Cloning vectors for the
expression of green fluorescent protein fusion proteins in transgenic plants. Gene
221, 35-43.

22-Vargona, M. J ., Schmidt, R. J. & Raikhel, N. (1992). Nuclear localization signal(s)
required for nuclear targeting of the maize regulatory protein Opaque-2. Plant Cell
4,1213-1227.

23-Hieks, G. R. & Raikhel, N. (1995). Protein import into the nucleus: an integrated
view. Annual Rev. of Cell Dev. Biology 11, 155-188.

74

24-Stacey, M. G., Hicks, S. N. & von Amirn, A. G. (1999). Discrete domains mediate
the light-responsive nuclear and cytoplasmic localization of Arabidopsis
COPlPlant Cell 11, 349-363.

25-Szankasi, P. & Smith, G. R. (1996). Requirement of S. pombe exonuclease II, a
homologue of S. cerevisiae Sepl, for normal mitotic growth and viability. Current
Genetics 30, 284-293.

26-Bashkirov, V. 1., Scherthan, H., Salinger, J. A., Buerstedde, J -M., and Heyer, W.-
D. (1997). A mouse cytoplasmic exoribonuclease (mXRN 1p) with preference for
G4 tetraplex substrates. J. Cell Biol. 136, 761-733.

27-Till, D. D., Linz, B., Seago, J. E., Elgar, 'S. J., Marujo, P. E., Elias, M. D.,
Arraiano, C. M., McClellan, J. A., McCarthy, J. E. G., and Newbury, S. F.
(1998). Identification and developmental expression of a 5 '-3' exoribonuclease from
Drosophila melanogaster . Mech. Dev. 79, 51-55.

28-Jacobs-Anderson, J. and Parker, R. (1998). The 3' to 5' degradation of yeast
mRNAs is a general mechanism for mRNA turnover that requires the SKI2 DEVH

box protein and 3' to 5' exonucleases of the exosome complex. EMBO J. 17, 1497-
1506.

29-Jacobs Anderson, J. S. & Parker, R. (1996) RNA turnover: The helicase story
unwinds. Current Biology 6, 780-782.

30-Aubourg S, Kreis M & Lecharny A (1999) The DEAD box RNA helicase family in
Arabidopsis thaliana. Nucleic Acids Res 27, 628-636.

31-Higgs, D. C. and Colbert, J. T. (1994). Oat phytochrome A mRNA degradation
appears to occur via two distinct pathways. Plant Cell 6, 1007-1019.

32-Gutiérrez, R. A., MacIntosh, G. C., and Green, P. J. (1999). Current perspectives
on mRNA stability in plants: multiple levels and mechanisms of control. Trends
Plant Sci. 4, 429-43833. Palanivelu, R., Belostotsky, D. A. & Meagher, R. B.
(2000) Plant Journal 22, 187-198.

34-Tanzer, M. M. and Meagher, R. B. (1995). Degradation of the soybean ribulose-1,5-
bisphosphate carboxylase small-subunit mRN A, SRS4, initiates with endonucleolytic
cleavage. Mol.Cell.Biol. 15 , 6641-6652.

35-Tanzer, M. M., Thompson, W. F ., Law, M. D., Wernsman, E. A. & Uknes, S.
(1997). Characterization of post-transcriptionally suppressed transgene expression

that confers resistance to tobacco etch virus infection in tobacco. Plant Cell 9,
1411-1423.

36-van Eldik C.J., Litiere K., Jacobs J .J ., Van Montagu M & Cornelissen M (1998).

Silencing of beta-1,3-glucanase genes in tobacco correlates with an increased
abundance of RNA degradation intermediates Nucleic Acids Res. 26, 5176-5181.

75

37 -Metzlaff, M., O'Dell, M., Cluster, P. D. & Flavell, R. B. (1997). RNA-mediated
RNA degradation and chalcone synthase A silencing in Petunia. Cell 88, 845-854.

38-Siien, T. and Kooter, J. M. (2000). Post-transcriptional gene-silencing: RNAS on the
attack or on the defense? BioEssays 22, 520-531.

39-Solinger J .A., Pascolini D & Heyer WD (1999) Identification of functional domains
in the SeplProtein (=Kem1, Xrnl), which is required for transition through meiotic
prophase in Saccharomyces cerevisiae. Mol. Cell Biol. 9, 5930-5942.

76

 

 

CHAPTER 4

ANALYSIS OF mRN A DEGRADTION IN AN xm4 MUTANT INDICATES THAT
AtXRN4 MAY FUNCTION IN mRN A TURNOVER

77

INTRODUCTION

As mentioned in Chapter 1, analyses of mutants of components of the basal
mRNA decay machinery in yeast were critical in demonstrating the role that particular
proteins play in the major mRN A decay pathway. Similarly, characterization of mutants
of the AtXRN genes has the potential to shed light on their individual functions in
Arabidopsis. In yeast, deletion of XRN] , which encodes the cytoplasmic 5 ’-3’
exoribonuclease Xrnlp, decreases the rate of mRN A degradation and results in the
accumulation of mRNAs to high levels (Larimer et al., 1992). In addition, the mRNAs
which accumulate have short poly(A) tails, and are decapped (Hsu and Stevens, 1993).
These observations not only demonstrated that Xrnlp likely degrades mRNAs, but also
indicated that deadenylation and decapping most likely precede decay catalyzed by
Xrnlp. Therefore, the analysis of the structures of mRNAs which accumulated in xml
mutants facilitated the elucidation of the sequence of events in the major mRN A decay
pathway in yeast. A second benefit of these analyses was the discovery of an additional
mRNA decay pathway in yeast, the 3’-5’ exosome-mediated decay pathway.

The exosome is a complex of multiple 3’-5’ exoribonucleases involved in mRN A
degradation and rRNA processing reactions (van Hoof and Parker, 1999). There are
orthologs of exosome components in Arabidopsis and mammals, indicating that mRNA
degradation catalyzed from the 3' end by the exosome may be conserved in eukaryotes
(Gutierrez et al., 1999; Mitchell et al., 1997). The role of the exosome in mRNA decay
was discovered when the expression of poly(G)-containing genes was analyzed in yeast
cells mutant for components of the deadenylation-dependent-decappin g pathway.

Expression of poly(G)-containing genes in wildtype yeast results in the accumulation of

78

 

m .1-5‘ -9 13:3“? an:

 

 

 

 

 

an mRNA decay intermediate which begins at the poly(G) tract and ends at the poly(A)
tail (Muhlrad et al., 1994). Deletion of the decapping enzyme gene DCPI, results in a
decrease in the amount of this mRNA decay intermediate (J acobs-Anderson et al., 1998).
However, a new a poly(G)-stabilized mRN A decay intermediate, consistent with
degradation from the 3’ end, accumulates to high levels. It was subsequently found that a
small amount of this intermediate can be detected in wildtype yeast (J acobs-Anderson et
al., 1998). This insight led to the discovery of the 3’-5’ mRNA. decay pathway of yeast
which is less active than the 5 ’-3’ pathway, but is easily detectable when degradation
from the 5’ end is reduced. Thus, analysis of mutants of the basal mRNA decay
machinery facilitated the elucidation of the mechanism of the major mRN A decay
pathway as well uncovered additional mRN A decay pathways.

AtXRN4, a cytoplasmic exoribonuclease, may be part of a basal mRNA decay
machinery in Arabidopsis. Analysis of mutants of AtXRN4 might allow for its role in
mRN A decay to be examined, and could also facilitate the discovery of new mRNA
degradation pathways. Recently, a collection of T-DNA insertion mutants of Arabidopsis
thaliana has been generated (Krysan et al., 1999). This collection can be screened by
PCR to identify T-DNA insertion mutants of genes of interest. Through PCR screening
of this population, multiple insertions were found in each of the AtXRN genes. Due to
AtXRN4’s potential role as an mRNA degrading enzyme, RNA metabolism in an xrn4
mutant was characterized to the greatest extent by a combination of primer extension,
northern blot, and DNA microarray. The results of these analyses indicate that AtXRN4
is likely encoded by a non-essential gene, as homozygous xrn4 T-DNA insertion mutants

could be obtained. Preliminary analysis of mRN A decay in an xrn4 mutant indicates that

79

- L

 

 

the decay of three mRNAs may be impaired in the mutant, and that AtXRN4 could play a

role in the degradation of these transcripts in Arabidopsis.

RESULTS

Identification of T-DNA insertion alleles of the AtXRN genes

The T-DN A insertion population which was screened for xrn mutants was
generated by infiltration of thousands of wildtype Arabidopsis plants with a T-DN A
vector that confers resistance to kanamycin (Krysan et al., 1999). Genomic DNA isolated
from pools of the infiltrated plants was screened by PCR for T-DN A insertions in the
AtXRN genes by the Arabidopsis Functional Genomics Consortium (AFGC;
httpzllafgcstanfordedul). Two rounds of PCR were used to identify a sub-pool made up
of 25 pools of 9 plants (referred to as “J pools”). These pools were obtained from the
Arabidopsis Biological Resource Center Orttp://aims.cps.msu.edulaims/) and single plants
harboring the T-DNA inserts of interest were identified. Figure 4-1 A shows a schematic
diagram of the T-DNA alleles found for each of the AtXRN genes. Table 1 summarizes
the position of each of the T-DNAs relative to the start codon, the intron/exon borders, as
well as whether single plants harboring each of the xrn alleles have been identified. In all
cases, the T-DNA insertions are found within the AtXRN coding regions, a position which
might allow for transcripts to be produced from the mutant locus. However, should the
mutated xm genes get expressed, truncated AtXRN proteins lacking the C-terminus
would be generated due to the intervening T-DNA sequence. Based on deletion analysis

of Xrnlp of yeast, it is likely that these truncated proteins would be inactive; small

80

 

 

 

 

 

 

 

 

 

‘-. = XRN-“Mi” Noni" domains

Hindllll-Iindlll

C. £°°flls°°fll G000!

 
  
  

 

 

-El-‘fi[Il'-Illl .1.

\ _
‘1‘,

‘m.
H‘_~

5°03, Xbal Hindlll

Figure 4-1. Schematic diagram of T-DNA insertions in the AtXRN genes and proteins.
(A) The location of each of the T-DNAs in the AtXRN genes is indicated by a triangle
above which the name of the allele is given. Exons are indicated by black boxes. (B) The
position of the T-DNAs in the AtXRN proteins is indicated to show the amount of the
protein which could be synthesized in each of the mutant backgrounds. Gray boxes
indicate regions conserved in the XRN-family of proteins. (C) Detailed diagram of the
xm4-1 allele showing the position of restriction enzyme cleavage sites. At least two
copies of the T-DN A are present in this insertion. LB=left border, RB=right border, Mas
3’: mannopine synthase terminator, NptII=neomycin phosphotransferase, 3SS=35 S
promoter, Nos 3’=nopaline synthase temrinator, GUS: [3 glucuronidase, AP3=portion of
the APETELA3 promoter, PG820 and PG821=primers used to screen the insertion
collection.

81

deletions of the C-terminus of Xrnlp abolish exoribonuclease activity (Page et al., 1998).
Therefore, it is likely that plants homozygous for each T-DN A insertion would lack the
exoribonuclease activity of the corresponding AtXRN protein.

AtXRN4’s cytoplasmic localization is consistent with a role in mRNA
degradation (Chapter 3), and plants with a mutation in the AtXRN4 gene may be defective
in mRN A decay. To examine this possibility, plants harboring the m4 alleles were
further characterized. The most progress has been made on the xrn4-I allele.

Experiments on plants harboring the xrn4-2 allele have been prevented due to the fact

Table 4-1
Position of T-DNA insertions in AtXRN genes

The position of each of the T-DNAs relative to the start
codon, and whether the insertion is in an intron or an exon
is shown. The identification of single plants from the J-
pools is indicated

 

Distance

 

 

 

 

 

Allele from AT G intron/exon Single plant
me-I +553 intron yes
xrn2-2 +4159 exon yes
xm3-I +3493 intron yes
xrn4-1 +3592 intron yes
xm4-2 +2915 intron yes

 

that the generation of this insertion was likely accompanied by a chromosomal deletion.
While uncommon, T-DNA insertion sometimes results in large scale genomic
rearrangements and deletions of the chromosomal DNA flanking the insertion point; such
deletions are sometimes lethal when homozygous (Krysan et al., 2000). The lethality of

chromosomal deletions due to T-DNA insertion could result from loss of individual

82

essential genes, or the simultaneous deletion of a large numbers of genes may be lethal.
Based on PCR, chromosomal DNA 5’ of the xm4-2 insertion point was likely deleted.
Although it was not possible to determine the extent of the deletion, plants homozygous
for the xrn4-2 mutation could not be recovered, indicating that the deletion is likely lethal
when homozygous. However, as described below, it was possible to obtain homozygous
xm4-I plants, indicating that the lethality of the xrn4-2 mutation is unlikely due to the
mutation of the AtXRN4 gene. Figure 4-1 C shows a schematic diagram of the
characteristics of the xrn4-I locus determined by PCR (data not shown) and Southern
blot analysis (Figure 4-2 A). At least two T-DNAs are present at this locus with the left

border facing both the 5’ and 3’ ends of the AtXRN4 gene.

Isolation of xrn4-I homozygotes

A plant containing the xm4-1 mutation was identified in J pool 2902 plant #44, by
PCR screening with the internal AtXRN4 primer PG820 shown in Figure 1-1 C, and the
T-DNA left border primer JL-202. PCR analysis indicated that this plant was
heterozygous for the xm 4-1 mutation (data not shown). The pollen from this plant was
used in a cross to wildtype, and the progeny of this cross (F 1) were selected on
kanamycin. The kanamycin resistant seedlings were transferred to soil, grown, and
allowed to set seed (F2). F2 seeds were plated on kanamycin containing medium and
scored for resistance. As expected for a single insert, the majority of F2 plants
segregated 3:1 for kanamycin resistance. The progeny of one plant segregated in a ratio
of approximately 5:1 indicating an additional T-DNA(s) was segregating in this plant. To

identify homozygous xrn4-I plants, 50 kanamycin resistant F2 seedlings of a population

83

 

 

 

 

segregating approximately 3:1 for kanamycin resistance (269 resistantz88 sensitive) were
screened by PCR using three primers PG820, PG821 (shown in Figure 4-1 C) and the T-
DNA left border primer JL-202. PCR analysis of 30 of the kanamycin selected F2 plants
revealed the presence of xm4-1 heterozygous and homozygous plants in a ratio of
approximately 2:1 (data not shown).

A genomic Southern blot was carried out on DNA isolated from the progeny of an

F2 plant (F3) determined to be an xm4-1 homozygote by PCR. Southern blot analysis
confirmed that the F3 plants were homozygous for the xm4-1 mutation (Figure 4-2 A).

The mobility of the bands detected with an AtXRN4-specie probe indicated that at least

Hindlll EcoRl Xbal
WT 4-1 WT 4-1 WT 4-1}

      

Figure 4-2. Southern blot analysis of wildtype (WT) and xrn4-I plants. long of
genomic DNA was digested with the restriction enzymes indicated above each lane. The
digested DNA was separated with a 0.8% agarose gel and blotted to membrane. (A) The
membrane was hybridized with probes complementary to the AtXRN4 gene. (B) The
same blot as in A was stripped and hybridized with probes complementary to the NOS 3’
temrinator. The lines to the left of the blots indicate the migration of molecular weight
markers: 11kb, 10kb, 9kb, 8kb, 7kb, 6kb, 5kb, 4kb, 3kb, 2kb, 1.6kb and 1.0kb.

two T-DNAs are present in the xm4-I locus. For example, cleavage of DNA isolated
from the xrn4-1 plants with HindIII, with cleaves on both sides of the T-DNA insertion
and in the right border sequence, (see Figure 4-1 for position of HindIII sites) resulted in
bands of approximately 9500b, 6500 bp and 1300 bp (Figure 4-2 A). The total mass of
these bands (approximately 17300 bp) is consistent with at least two of the approximately
5 kb T-DN As inserted into the 7.0 kb AtXRN4 gene. Multiple T-DNAs inserted at one
position is quite common, and has been found in additional T-DNA mutants, including
the me-I allele (data not shown). Hybridizing the Southern blot with a probe specific
for the NOS terminator present in the T-DNA revealed a more complex pattern than
expected for two T-DNAs inserted at the xm4-I locus. It is likely that additional T-
DNA-derived sequence lies between the right borders shown in Figure 41 C. Consistent
with this possibility is the fact that no PCR products were generated when primers
complementary to the GUS coding region, which were designed to amplify across the
right borders, were used. This region likely contains sequence too large to be amplified.
A second possibility is that an additional T-DNA(s) is segregating in these xrn4-1
seedlings. However, the parental plant (F2) was selected from a population that was
segregating in a ratio of 3:1 for kanamycin resistance, the expected result for a single
insertion. A final possibility is that there are fragments of the T-DNA which lack the
kanamycin resistance cassette inserted elsewhere in the genome and these fragments were

not detected when the kanamycin segregation ratios were calculated.

85

Less than full-length AtXRN4 transcripts are expressed in xm4-I seedlings

Since the xm4-I T-DN A insertion is distal to the AtXRN4 promoter it was likely that
transcription from the xrn4-1 locus would produce transcripts containing the 5' end of the
AtXRN4 transcript fused to T-DNA derived sequence. To examine this possibility, RNA
isolated from wildtype seedlings and from the progeny of a xm4-I heterozygote, which
were selected on kanamycin, was analyzed by northern blot. Multiple smaller than full-
length bands were detected in the RNA from the xm4-I plants but not in RNA isolated
from the wildtype plants (Figure 4-3). The less than full-length bands present in the
xm4-1 plants are likely due to aberrant splicing of transcripts containing the 5’ end of
AtXRN4 and portions of T- DNA derived sequence. These bands may arise if sequences
transcribed from the T-DNA contain cryptic splice sites. Differential use of these sites
might result in splicing of the AtXRN4-T-DNA fusion transcripts in several different
places. Consistent with this hypothesis, an RT-PCR product of expected size can be
generated with a primer which anneals in the 5’ end of the AtXRN4 transcript,
P6821,and a primer which anneals in the left border sequence of the T-DNA, JL-202
(data not shown). Sequencing of the end of this product confirmed that it corresponds to
an AtXRN4 transcript fused to sequence derived from the left border of the T-DNA and
also revealed that a stop codon in-frame with the AtXRN4 open reading frame lies
immediately downstream of the AtXRN4-T-DNA junction. The results of RT-PCR with
the left border primer and a primer which anneals in the 3’ end of the AtXRN4 transcript
indicates that several products are likely produced which include AtXRN4 sequence

lying downstream of the T-DNA insertion (data not shown).

86

 

 

2/3 xm4-1 bet.
"3 xm4-1 hom

_ WT

 

Figure 4-3. Less than full-length AtXRN4 transcripts are expressed in xrn4-I seedlings.
1 pg of poly(A) enriched RNA from wildtype and the progeny of an xrn4-I heterozygote

was separated with a 1% agarose/formaldehyde gel, transferred to membrane, and
hybridized with probes specific for the 3’ end of AtXRN4.

Full-length AtXRN4 transcript is not detected in homozygous xrn4-1 seedlings

Since the xm4-I insertion resides in an intron, it was possible that the T-DNAs
might be spliced out of transcripts generated from this locus, and that full-length
AtXRN4 transcript might be expressed in this mutant. While northern blot analysis of
xm4-1 heterozygotes indicated that full-length AtXRN4 transcript was likely greatly
reduced due to the T-DN A insertion (Figure 4-3), it remained possible that a small
amount of full-length transcript might be synthesized in the mutant. Since a small
amount of full-length transcript might not be detected by northern analysis, RT-PCR, a

more sensitive technique, was employed. Total RNA was isolated from the leaves of

87

     

 

3 § §
, E 8 2
AtXRN4-9
<— AtXRN2
M“
1 2 3 s

 

Figure 4-4. Full-length AtXRN4 transcripts are not detected in xm4-I homozygotes.
RT-PCR was carried out on total RNA from wildtype and xrn4-I homozygous plants.
AtXRN4-specific primers P6820 and P6821 (shown in Figure 4-1 C) were used in lanes
1-3 and AtXRN2-specific primers P6840 and P6841 were used in lanes 4-6. The PCR
products were separated with a 1% agarose gel and transferred to membrane. The
membrane was hybridized with probes complementary to AtXRN 2 and AtXRN4.

wildtype and xrn4-1 plants and used to generated cDNAs. These cDNAs were used in a
PCR reaction with primers P6820 and P6821. These primers anneal in the 5' and 3' ends
of the AtXRN4 gene on opposite sides of the T-DN A (shown in Figure 4-1 C). These
primers gave a robust PCR product when used with cDNAs generated from wildtype
plants (Figure 4-4 lane 1). In contrast, these primers did not yield PCR products when
used with cDNAs generated from xrn4-I homozygotes (Figure 4-4 lane 2). As a control
for the quality of the cDNAs, RT-PCR was carried out using primers specific for the
AtXRN 2 transcript. Similar amounts of this product were seen in samples from wildtype
and xrn4-1 homozygous mutants indicating that the inability to detect RT-PCR products
corresponding to full-length AtXRN4 transcript in xrn4-I plants was not due to poor
cDNA quality (Figure 4-4, lanes 4 and 5). The preceding analysis indicated that full-
length AtXRN4 transcripts are likely absent in xrn4-I plants, and that these mutants

would be suitable for further analyses.

88

 

 

Phenotypic Characterization of xrn4-1 homozygotes

The vector used to generate the T-DNA insertion collection contains a few
hundred bases of the APETELA3 promoter (Krysan et al., 1999; shown as AP3 in Figure
4-1 C). Plants containing this T-DN A have been reported to undergo silencing of the
endogenous APETELA3 gene (Krysan et al., 1999) a homeotic gene involved in the
development of sepals and stamens (Jack et al., 1992). The morphology of flowers on
plants homozygous for the xrn4-I mutation is indicative of APETELA3 silencing.
Similar to petals from plants mutant for APETELA3, the petals of homozygous xm4-1
plants are similar in morphology to sepals, but in contrast to sepals, have white regions at
their tops (data not shown and Jack et al., 1992). APETELA3 is also involved in stamen
development and strong APETELA3 mutant alleles are male sterile (Jack et al., 1992).
Consistent with silencing of APETELA3, the fertility xrn4-I homozygotes was greatly
reduced, but not completely abolished (data not shown). Since the phenotypes apparently
due to APEI‘ALA3 silencing-dependent morphological phenotypes were only detected in
mature plants, the search for molecular phenotypes was restricted to two-week old xrn4-I
seedlings with the hope that any phenotypes detected would be as a result of mutation of

AtXRN4 and not APETELA3 silencing.

Preliminary Analysis of mRNA decay in xm4-I seedlings using cDNA microarrays

A likely phenotype for the xm4-I mutation is impaired degradation of mRN As.
However, since xrn4-I plants appear to have no aberrant morphological phenotypes
(other than the APETELA3 silencing-associated phenotype mentioned above), it seemed
unlikely that large numbers of transcripts would be nus-expressed in the mutant, and that

microarray analysis might aid in identifying a small number of transcripts elevated in the

89

 

 

xrn4-I mutant. Since the reduction in fertility due to APETELA3 silencing limited the
amount of homozygous mutants that could be analyzed, a more crude analysis was
undertaken. mRN A degradation in wildtype plants was compared to degradation in the
progeny of an xm4-1 heterozygote selected on kanamycin. In this experiment wildtype is
compared to plants of which 213 are xm4-I heterozygotes and “3 are homozygotes. Due
to the crude nature of this experiment the hybridization was limited to a single slide.
While four slides are normally used to account for technical variation, it was hoped that a
few transcripts which were the most elevated in xrn4-1 seedlings could be detected and
that these might be substrates of AtXRN4.

To compare mRN A degradation in wildtype and xm4-I seedlings, a cordycepin
time course experiment was canied out as described (Johnson et al., 2000). Two week
old seedlings were transferred to liquid medium, equilibrated for 30 minutes in buffer,
followed by the addition of the transcription inhibitor cordycepin to a final concentration
of 150 rig/ml. Seedlings were collected after 0 and 120 minutes of incubation with
cordycepin. Total RNA was isolated from the 120 minute samples and used to generate
probes that were hybridized to the AFGC 11 K microarray (Schaffer et al., 2000). The
AFGC array contains approximately 11,000 clones from the PRL2 library (Newman et
al., 1994). The 120 minute samples were compared because a greater difference in
transcript abundance due to differences in degradation rates would be expected to exist
between these samples rather than between samples at steady-state. For example, if an
mRN A is stabilized two-fold in the xm4-I mutant compared to wildtype, its abundance at
steady state would be two-fold higher in the mutant (assuming that the transcription rate

is unaffected by the xm4-I mutation). While a two-fold difference can be detected on a

90

 

2: .gfih‘? * ' "

   

microarray, it is close to the limit of detection. However, after a 120 minute treatment
with cordycepin, the difference in degradation rates of the two mRNAs would result in a
greater than two-fold difference in abundance. Thus, it was predicted to be easier to
detect subtle changes in mRN A stability by comparing differences in abundance of
transcripts after the 120 minute of cordycepin treatment rather than at steady-state.

As expected, the abundance of the vast majority of transcripts was unchanged in
the mutant relative to wildtype after the 120 minute cordycepin treatment. However,
approximately 130 transcripts were detected as elevated greater than two-fold in the xm4-
1 mutant relative to the wildtype, while a similar number were detected as reduced
greater than two-fold. The 10 most elevated and the 10 most reduced transcripts in xm4-
I seedlings are shown in Tables 4-2 and 4-3, respectively. If representative of true
differences, the change in abundance of these transcripts in xrn4-1 seedlings could arise
from either changes in transcription rate, or changes in stability. To distinguish between
these possibilities, the decay kinetics of several of these transcripts was compared in
mutant and wildtype using northern blots. As northern blots do not require as much RNA
as microarray analysis, it was feasible to examine the expression of these transcripts in
the small number of homozygous xm4-I seedlings which could be obtained.

The cordycepin time course was repeated on wildtype and xrn4-I homozygous
seedlings. Total RNA was isolated from the 0 and 120 minute time points, and the decay
of several transcripts which were detected as elevated in xrn4-1 seedlings on microarrays
was examined by northern blot. Since n'anscript elevation is the most likely primary
effect of mutation of AtXRN4, northern blot analysis was used to examine transcripts

which were elevated in the mutant. A reduction in transcript abundance is most likely

91

 

 

Table 4-2. Transcripts elevated in xrn4-I seedlings detected by microarrays

The 10 most-elevated transcripts in xm4-1 seedlings are indicated. The
normalized ratio of signal intensity is shown, as well as annotation from TIGR

 

 

 

 

 

 

 

 

 

 

 

(http//:www.tigr.org)
clone name xm4-I/wt at annotation
t=120
214A6T7 5.4 28 storage protein-like
123N21T7 4.3 123 cruciferin seed storage protein (atcru3)
126C19XP 4.1 putative auxin-regulated protein
136E11T7 3.8 125 seed storage protein precursor
124N17T7 3.2 lipid transfer protein, putative
17 1 N 2T7 3.2 putative glucose regulated repressor protein
201 Al 1T7 3.2 putative protein
176K14T7 3.0 not assigned
115F4T7 2.9 not assignejd
107I3T7 2.8 isocitrate lyase

 

due to a secondary effect of the xrn4-I mutation, and transcripts whose abundance
decreased have not yet been examined by northern blot. Two transcripts, 214A6T7,
annotated as encoding 3 2S seed storage protein and 124N17T7, annotated as encoding a
putative lipid transfer protein (annotation from TIGR, http://www.tigr.org/), appear to be
elevated in xrn4-I plants and to decay more slowly than in the wildtype (Figure 4-5).
The apparent stabilization of these transcripts in xm4-I seedlings is between 3-5 fold, a
value similar to the degree of mRN A stabilization seen in yeast when 5’-3’ decay is
inhibited by deletion of the XRN] or DCPI genes (Larimer and Stevens, 1992; Beelman
et al., 1996). The fact that the elevation of the 214A6T7 and124N17T7 transcripts in the
xrn4-I mutant appears to be due to increased stability indicates that they may be direct

targets of AtXRN4 and that their decay warrants further study.

92

 

 

Table 4-3. Transcripts reduced in xm4-I seedlings detected by microarrays

The 10 most-reduced transcripts in xm4-I seedlings are indicated. The
normalized ratio of signal intensity is shown, as well as annotation from TIGR

 

 

 

 

 

 

 

 

 

 

 

(http//:www.tigr.org)
clone name xm:1—-f;vgt at annotation
196M20T7 0.29 glycine-rich protein, AtGRP-S
123M2T7 0.29 similar to protein kinase 1
206B23T7 0.28 unknown protein
40B8T7 0.28 putative ABC transporter
247A3T7 0.28 beta-N-acetylhexosaminidase-like gotein
196J20T7 0.27 ATP dependent copper transporter
222A14T7 0.26 probable imbibition protein - wild cabbage
176A10T7 0.25 glucosyltransferase like protein.
67H8T7 0.18 lypothetical 213.7 KD protein YCFl
H5D4T7 0.16 contains similarity to heat shock protein

 

One additional transcript appears to decay in the xm4-1 mutant in a manner that

differs from wildtype. The EST 171N2T7 encodes a protein that is annotated as a

putative glucose regulated repressor, and will be referred to as PGRR. Northern blot

analysis of the cordycepin time course with probes generated from the 171N2T7 clone

was carried out and is shown in Figure 4-6. While the PGRR transcript is elevated in the

mutant, it appears to decay at a similar rate in both the xm4-I mutant and in wildtype,

with a half-life of approximately 85 minutes. This indicates that its elevation in xrn4-I

seedlings may be due to an increase in its transcription rate. However, an additional band

could be detected in the RNA isolated from the xrn4-I mutant (indicated by the arrow in

93

 

 

i=0 t=120 t 112 (min)
WT. 4-1. WT 4:1,_ WT ""44

 

 

124N2T7
(putative lipid
transfer protein) 1‘1: . ..

60 310

       

5‘ . " . ' '."§ ‘.\¢ , " - ~ - ‘. j.’.\_“ .' -. -, . - -. .
e. . V
(2 ‘ 41-, .‘ ’
, .

sora r em " ' ‘ ' '
M ' ~ .. x.‘ , y. . ~ ’- > .. ~ ~
.-:-':>~..-.».’.i.’\u.'~-s‘~: «new: é ' -:?.‘ 1' 3.. ..~\ "

eIF4A

 

Figure 4-5. Two transcripts detected as elevated in xm4-I seedlings by microarray
appear to be stabilized 3-5 fold. Total RNA was isolated from wildtype and xrn4-I
seedlings of 0 and 120 minute time points of a cordycepin time-course. 10 pg of each
sample was separated with a 1% agarose/formaldehyde gel and blotted to membrane.
The membrane was hybridized with the probes indicated on the left. eIF4A served as a
loading control and the half-live values shown at the right were calculated normalized to
eIF4A.

Figure 4-6). This band can also be detected in wildtype plants, but only at the zero time
point of the cordycepin time course, indicating that it likely decays rapidly in wildtype
seedlings (Figure 4-6, compare lanes 1 and 3). In contrast, the abundance of this band
does not change appreciably in xrn4-I seedlings over the time course (Figure 4-6,
compare lanes 2 and 4). While the source of this additional band is not yet clear, it might
represent an mRN A decay intermediate which accumulates in the xrn4-1 mutant. In
addition to this putative mRNA decay intermediate, a ‘smear’ can be seen which extends
from the full-length down to the mobility of the putative intermediate. This smear can be

seen most clearly in the RNA from the mutant but can also be detected in RNA from

94

wildtype seedlings (Figure 4-6, compare lanes 1 and 2). Over the cordycepin time-course

this smear decreases in intensity, which is likely due to its degradation.

t=0 t=120
WT 4-1 WT 4-1

game

 

1 71 N2T7
(glucose regulated
repressor protein)

 

 

eIF4A fi “ «raft? u

Figure 4-6. The decay of the PGRR transcript is accompanied by the accumulation of
an additional band in xrn4-I seedlings. Total RNA was analyzed as described in Figure
4-5 and hybridized with probes generated from the EST 171N 2T7, and eIF4A as a
loading control. The arrow indicates the additional band detected in xm4-1 seedlings.

To characterize the putative mRNA decay intermediate that accumulates in xm4-I
seedlings it was further analyzed by northern blot. Based on an alignment of the
sequence of the 171N2T7 clone with the PGRR gene, this clone corresponds to the 3’ end
of the PGRR gene. Since probes generated from 171N2T7 detected the putative mRNA
decay intermediate, it seemed likely that the putative intermediate corresponded to the 3’
end of the transcript. To examine this possibility, northern blot analysis was carried out
with a probe that anneals towards the 5’ end of the transcript. The EST 188L22T7
includes sequence complementary to the 5’ end of the PGRR gene. A portion of this

EST, which is predicted to anneal approximately 500 nt 5' of where probes generated

95

 

 

from 171N2T7 hybridize, was used for northern analysis. As seen in Figure 4-7 A, these
probes (probe 1 in Figure 4-7 A) do not detect the additional band in the xm4-I mutant.
This result indicates that the additional band likely corresponds to the 3’ end of the
PGRR transcript. To further investigate this possibility the ability of the putative mRNA
decay intermediate to be cleaved with a complementary oligonucleotide and RNase H
was examined. RNase H degrades the RNA of an RNA-DNA duplex. Total RNA from
the xrn4-I mutant was incubated with P6978, an oligonucleotide complementary to a
region approximately 300 bp from the 3’ end of the PGRR transcript, and RNase H. This
resulted in cleavage of the additional band (Figure 4-1 B, compare lanes 3 and 4),
indicating that it most likely corresponds to the 3’ end of the PGRR transcript. A final
observation about the structure of this putative mRN A decay intermediate is that it likely
has no poly(A) tail, or at most a short poly(A) tail. Removal of the poly(A) tail in vitro
using oligo dT and RNase H should result in an increase in the mobility of the putative
intermediate if it were polyadenylated. However, treatment with RNase H and oligo dT
had no apparent effect on the mobility of the putative decay intermediate (Figure 4—7 B
compare lanes 3 and 5). Figure 4-7 B also shows more clearly than Figure 4-6 that a
small amount of the putative mRNA decay intermediate can be detected in RNA from

wildtype plants.

96

 

 

 

 

 

 

yy_T xm4-1

P6978 + -
oli odT - -
R ase H + +

unclaimed-9 :4 if"? g Q 5' cleavage
i .55;- -z_: product

putative
intermediate

 

3' cleavage
product

Figure 4-7. The additional band detected in xm4-I seedlings corresponds to the 3' end
of the PGRR transcript. (A) Northern blot analysis of RNA from wildtype and xrn4-I
plants with probes that hybridize in the middle of the PGRR transcript (probel) and
probes complementary to the 3' end (Probe 2).Total RNA from the rosette leaves of
mature wildtype and xm4-I plants was analyzed as described in Figure 4-5. The arrow
indicates the putative 3' mRNA decay intermediate. (B) RNase H cleavage of RNA from
wildtype and xm4-I rosette leaves. 20ug of total RNA was incubated with the
oligonucleotides indicated at the top in the presence of RNaseH. The RNase H cleavage
reactions were separated with a 2% agarose/formaldehyde gel and blotted to membrane.
The membrane was hybridized with probes complementary to the entire PGRR transcript.
P6987 is complementary to the 3’ end of the PGRR transcript

97

 

MATERIALS AND METHODS

PCR screening for T—DN A insertion mutants

Primers for each of the AtXRNs were selected using the suggested parameters
described by the AFGC knockout facility (http://www.biotech.wisc.edu/Arabidopsisl).

The primers used to screen for insertions in the AtXRN genes are described in table 4-4.

Table 4-4. Primers used to screen for T-DNA insertions in the AtXRN genes

ene primer rimer se uence
g name P q
AtXRN2 P6840: 5’-TT6ATAGGC'I'I'I'I'I'G'ITATGG'ITCGACCT-B

P6841 : 5 ’ -G'l'I"l'I‘ATCA'I'I"I'TCGCCTC'ITCCATCATG-3

AtXRN3 P6842: 5’-CCAAGAATCATAAI I' I CT GCCGGAATAGA-3’
P6843: 5 ’ -TGAGCCAAAGCCT'ITGACGTG' I " I 'I ATAGT-3 ’

AtXRN4 P6820: 5’ -ATACCCGAAGTCAATTAGTGACGTCGTTG-3’
PG821 : 5 ’ -TGGACTACTGTTCATGACGAATTCC’ITTG-3 ’ .

 

 

 

 

The AFGC used these primers in combination with T-DNA border primers to screen
superpools of DNA for insertions in the AtXRN genes by PCR. Following the
identification of superpools containing insertions in the AtXRNs, the positions of the
insertions were determined by sequencing of the PCR products. The insertions lying
closest to the 5’ end of each of the AtXRN genes were selected for further screens.
Secondary PCR screens were carried out by the AFGC to identify the sub-pools
containing DNA with the xm insertions. Following this PCR, seeds were obtained
corresponding to 25 pools of seeds from nine plants which had been used to generate the
DNAs used in the second round (J -pools). These seeds were planted, and J -pools with
each of the xrn alleles were identified. To identify single plants with the xrn alleles

individual leaves were harvested from J-pool plants and analyzed by PCR. DNA was

98

i -“y'

’1;

...‘

 

isolated using an abbreviated CT AB method. Individual leaves were freeze-dried and
ground to powder by shaking with 2.5 mm zirconia/silica beads (Biospec Products). The
powered leaves were incubated in 500 pl of CT AB buffer (Saghai-Maroof, et al., 1984)
for 30 minutes at 68 °C, chloroform extracted, and the DNA was ethanol precipitated.
The PCR conditions were identical to those described by the AFGC website. Southern

blots of 5 pl of the PCR products were used to confirm their identity.

Northern blot analysis

Total RNA was isolated from wildtype and xm4-1 Arabidopsis plants (W S) plants
as described (Newman et al, 1993). Poly(A) enriched RNA was obtained with an
Oligotex kit and used to compare AtXRN4 expression in wildtype and xrn4-I
homozygotes (Qiagen). 10 pg of total RNA was used for the comparison of mRNA
decay in wildtype and xrn4-1 homozygotes. The RNA was separated with 1% agarose

gels, transferred to nylon membrane and hybridized with random primed probes.

RT-PCR

Total RNA isolated from single leaves of wildtype and xm4-I plants was reverse
transcribed with Superscript H (Gibco) and PCR amplified with primers P6820 and
P6821 to detect AtXRN4, and P6840 and P6841 to detect AtXRN 2 using the AFGC

PCR protocol. The PCR products were analyzed by Southern blot.

99

 

   

 

Southern blot analysis

Genomic DNA was isolated from wildtype and xm4-1 homozygous mutants using
the CT AB method (Saghai-Maroof et al., 1984). 10 pg of DNA was incubated with the
restriction endonucleases indicated in Figure 4-2, separated with a 0.9% agarose gel and
transferred to a Nytran membrane. To detect AtXRN4, the blot was hybridized with
probes generated from the PCR product of P6820 and P6821. To detect the T-DNA,

probes generated from the NOS 3’ end were used.

Microarray analysis

Total RNA was isolated from wildtype and the progeny of an xrn4-1 heterozygote
selected on kanamycin after the 120 minute treatment with cordycepin. 100 pg of this
RNA was reverse transcribed using an oligo dT primer in the presence of Cy dyes to
generate the microarray probes as described (Schaffer et al., 2001). The cordycepin time
course was carried out on two-week old seedlings using 150 pg/ml of cordycepin as

previously described (Johnson et al., 2000). Microarray data was normalized as

described (Schaffer et al., 2001).

DISCUSSION

Microarray analysis of xrn4-1 seedlings resulted in the identification of two
transcripts which were apparently stabilized in the xrn4-I mutant, and a third transcript

Whose decay may give rise to an mRNA decay intermediate in xrn4-I plants. These

100

 

'1

 

 

 

 

results provide support for the hypothesis that the cytoplasmic exoribonuclease AtXRN4
could function in the decay of some mRN As.

The apparent stabilization of the 214A6T7 and 124N17T7 transcripts in xm4-1
seedlings is consistent with AtXRN4 functioning in a mRNA decay pathway similar to
the major deadenylation-dependent-decapping pathway of yeast. However, a more
detailed analysis of the structures of these transcripts in xm4-I seedlings would be
required to address this possibility, and could shed light on the pathway by which these
mRNAs are degraded. In yeast, deletion of the XRN] gene, which encodes the
cytoplasmic 5’-3’exoribonuclease, results in the accumulation of mRN As which have
shortened poly(A) tails, and which are decapped (Hsu and Stevens, 1993). These
changes in structure would likely not be observed with standard northern blots and
require closer examination. If the two transcripts which are apparently stabilized in xrn4-
I seedlings are also decapped and have short poly(A) tails, this would indicate that they
might be degraded by a pathway that resembles the deadenylation-dependent-decapping
pathway of yeast. If they retain the cap or a long poly(A) tail this would likely point to a
different mechanism. With respect to the poly(A) tail, it seems likely that the elevated
transcripts retain at least a short poly(A) tail. The probes used to hybridize the
microarray were generated by reverse transcription of total RNAS using an oligo dT

primer. In order for the transcripts which were elevated in the xm4-1 mutant to have
been detected as elevated on microarrays, they would have had to have at least enough
Poly(A) tail to be efficiently primed with oligo dT. It is possible that additional
transcripts which are degraded by AtXRN4 might not have been detected by the

rIlicroarray if they accumulated with very short poly(A) tails and were inefficiently

101

 

 

reverse transcribed. It may be possible to hybridize the microarray with randomly primed
probes generated from xm4-1 plants to detect these species.

The decay of the PGRR transcript, which is accompanied by the accumulation of
the 3' end of the transcript in xrn4-I seedlings, may indicate that AtXRN4 participates in
an mRN A decay pathway which differs from the major pathway of yeast. This putative
intermediate appears to be present at low levels in wildtype plants but is more abundant
in the xm4-I mutant (Figure 4-6) and might represent a natural mRN A decay
intermediate that is stabilized due to mutation of AtXRN4. The decay kinetics of the
PGRR transcript indicates that the mechanism of its decay may differ from the 124N2T'7
and 214A6T7 transcripts, the transcripts which are apparently stabilized by the xrn4-1
mutation. lrnpaired degradation following decapping would be expected to result in an
increase in the stability of the full-length transcript. However, the full-length PGRR
transcript decays in the xrn4-1 mutant with similar kinetics as in wildtype (Figure 4-6).
This could indicate that an early step in the degradation of this transcript is internal

cleavage by an endoribonuclease. Mutation of AtXRN4 would likely not affect the
activity of such an endoribonuclease, and the full-length would decrease at the same rate
in wildtype and the xm4-1 mutant. If the 3’ product of the initial endoribonuclease
cleavage is a substrate for AtXRN4, this product might accumulate in the xm4-I mutant.
An activity like the exosome, a complex of 3’-5’ exoribonucleases which functions in 3’-
5’ mRNA decay in yeast (van Hoof and Parker, 1999), might degrade the 5’ cleavage
Product. The putative mRNA decay intermediate can be detected at low levels in
wildtype plants (Figure 4-7) which may indicate that it is inefficiently degraded in the

Wildtype by AtXRN4. The presence of a stable secondary structure in the 3’ end of the

102

 

 

‘4

 

PGRR transcript might inhibit AtXRN4’s progression through the PGRR mRNA, similar

to the blockage of AtXRN4 by poly(G) tracts (Chapter 3).

FUTURE EXPERINIEN TS

Additional characterization of xm4-I

The analysis of mRNA decay in homozygous xm4-I seedlings by microarray
should be repeated to confirm previous results, as well as to identify additional candidates
for AtXRN4 substrates. It is likely that many targets of AtXRN4 may not have been
identified in the relatively crude experiment described. An additional important
experiment with respect to the xrn4-I mutation is to determine if expression of wildtype
AtXRN4 in xrn4-1 seedlings can complement any of the phenotypes of the xm4-1 plants.
This should help to confirm if the phenotypes observed are due to mutation of AtXRN4.
A final experiment with respect to the xrn4-I mutation is to try to determine if this
mutation causes loss of AtXRN4's exoribonuclease activity. A transcript consisting of
the 5’ end of AtXRN4 fused to sequences derived from the T-DNA can be detected in
xrn4-I seedlings and a portion of the N -terminus of the AtXRN4 protein may be
produced in AtXRN4 plants. However, it is unlikely that this truncated protein would
have exoribonuclease activity as Xrnlp mutants in yeast with smaller deletions in the C-
terminus are inactive (Page et al, 1998). Nevertheless, it should be possible to determine
if the truncated AtXRN4 protein which could be expressed in xrn4-I plants has activity.
This would most easily be accomplished by expressing the n'uncated AtXRN4 protein in
an meA yeast strain and analyzing the accumulation of poly(G)-stabilized mRN A decay

intermediates as described for the AtXRNs in Chapter 3.

103

While more analyses of xrn4-1 seedlings should be carried out, characterization of
mRN A turnover with additional xrn4 alleles should also facilitate the investigation of
AtXRN4's role in mRNA degradation. Isolation of additional T-DNA alleles (from a T-
DNA insertion population generated with a T-DNA that does not have APETELA3
promoter sequence) is currently underway. In addition to T-DN A insertion mutants,
plants with reduced levels of AtXRN4 transcript might also be examined. The expression
of RNAs which are self-complementary and which are also complementary to an
endogenous gene has been used to decrease the expression of several genes in
Arabidopsis (Chuang; and Meyerowitz, 2000). These self-complementary RNAS are able
to form ‘panhandle’ structures that are believed to trigger post-transcriptional gene
silencing (W aterhouse, 1998; Smith et al., 2000). Expression of AtXRN4-panhandle
RNAS could be used to reduce the expression of AtXRN4 and the decay of mRNAs could

be examined in these plants.

Characterization of the PGRR transcript to gain insight into mRN A decay mechanisms

Expression of the PGRR transcript under the control of a regulated promoter in
plants compromised for AtXRN4 function should allow for several aspects of its decay to
be addressed. Such an experiment should allow for the determination if the full-length
PGRR transcript and its putative intermediate share a precursor-product relationship.
This is an important step in demonstrating that the putative intermediate is generated
from decay of the full-length. In addition, cloning and characterizing the sequence of this
putative intermediate will useful in determining the mechanism of its production.
Analysis of this putative mRNA decay intermediate could also shed light on AtXRN4

independent mRN A degradation. It is likely that the putative intermediate decays slowly

104

in xm4-1 seedlings, indicating that additional activities which can catalyze the
degradation of this transcript are present in the cytoplasm of Arabidopsis cells. It may be
possible to use genetics to identify proteins which could degrade this intermediate.

A second direction of future research on mRN A decay in xm4 mutants may yield
insight into mRN A decay in general. While it appears that AtXRN4 may catalyze the
degradation of some mRNAs, the decay of the majority of transcripts appears unaffected
in xm4-1 seedlings. It is likely that several mRN A decay pathways function in
Arabidopsis; however, the manner in which specific mRNAs would be targeted to
particular mRNA decay pathways is unclear. As mentioned in Chapter 1, instability
determinants which target transcripts for rapid degradation likely modulate components
of the basal mRN A decay machinery. A comparison of the sequences of all transcripts
stabilized in xm4 mutants may reveal common sequence or structural motifs required for
AtXRN4-specific degradation. It may be possible to identify sequence elements which
regulate AtXRN4's activity, or are involved in directing AtXRN4 activity. This could

provide important information about how AtXRN4 is regulated.

105

 

REFERENCES

Beelman, C. A., Stevens, A., Caponigro, G., LaGrandeur, T. E., Hatfield, L.,
Fortner, D. M., and Parker, R. (1996). An essential component of the decapping
enzyme required for normal rates of mRN A turnover. Nature 382, 642-646.

Chuang, CF. and Meyerowitz, EM. (2000) Specific and heritable genetic interference
by double-stranded RNA in Arabidopsis thaliana. Proc. Natl. Acad. Sci.USA 97,
4985-4990.

Gutierrez, R. A., MacIntosh, G. C., and Green, P. J. (1999). Current perspectives on
mRNA stability in plants: multiple levels and mechanisms of control. Trends Plant
Sci. 4, 429-438.

Henry, Y., Wood, H, Morrissey, J. P., Petfalski, E., Kearsey S, and Tollervey, D.
(1994). The 5' end of yeast 5.8S rRN A is generated by exonucleases from an
upstream cleavage site. EMBO J. 13, 2452-2463.

Hsu, C. L. and Stevens, A. (1993). Yeast cells lacking 5'-->3' exoribonuclease 1 contain
mRN A species that are poly(A) deficient and partially lack the 5' cap structure.
Mol.Cell.Biol. 13, 4826-4835.

Jack, T., Fox, G. L., and Meyerowitz, E. M. (1994). Arabidopsis homeotic gene
APETALA3 ectopic expression: transcriptional and posttranscriptional regulation
determine floral organ identity. Cell 76, 703-716.

Jacobs-Anderson, J. and Parker, R. (1998). The 3' to 5' degradation of yeast mRN As is
a general mechanism for mRN A turnover that requires the SK12 DEVH box protein
and 3' to 5' exonucleases of the exosome complex. EMBO J. 17, 1497-1506.

Johnson, M. A. (2000). Genetic Determinants of mRNA Stability in Plants. Ph.D.
dissertation. Michigan State University.

Kastenmayer, J. P., van Hoof, A., Johnson, M. & Green, P. J. (1998) in Plant
Molecular Biology, eds. Raikhel, N., Last, R., Morelli, 6., & LaShavo, F. (Springer-
Verlag, Berlin), pp. 125-133.

Krysan, P. J ., Young, J. C., and Sussman, M. R. (1999). T-DNA as an Insertional
Mutagen in Arabidopsis. Plant Cell 11, 2283-2290.

Larirner, F. W., Hsu, C. L., Maupin, M. K., and Stevens, A. (1992). Characterization
of the XRN 1 gene encoding a 5'-->3' exoribonuclease: sequence data and analysis of
disparate protein and mRN A levels of gene-disrupted yeast cells. Gene 120, 51-57.

Mitchell, P., Petfalski, E., Shevehenko, A., Mann, M., and Tollervey, D. (1997). The
exosome: A conserved eukaryotic RNA processing complex containing multiple 3'--
>5' exoribonucleases. Cell 91, 457-466.

106

     

Muhlrad, D., Decker, C. J ., and Parker, R. (1994). Deadenylation of the unstable
mRNA encoded by the yeast MFA2 gene leads to decapping followed by 5'-->3'
digestion of the transcript. Genes Dev. 8, 855-866.

Newman, T. C., de Bruijn, R, Green, P. J ., Keegstra, K., Kende, H., McIntosh, L.,
Ohlrogge, J ., Raikhel, N. V., Somerville, S. C., Tomashow, M., Retzel, E., and
Somerville, C. R. (1994). Genes Galore: A summary of methods for accessing
results from partial sequencing of anonymous Arabidopsis cDNA clones. Plant
Physiol. 106, 1241-1255.

Newman, T. C., Ohme-Takagi, M., Taylor, C. B., and Green, P. J. (1993). DST
sequences, highly conserved among plant SA UR genes, target reporter transcripts for
rapid decay in tobacco. Plant Cell 5, 701-714.

Page, A. M., Davis, K., Molineux, C., Kolodner, R. D., and Johnson, A. W. (1998).
Mutational analysis of exoribonuclease I from Saccharomyces cerevisiae. Nucleic
Acids Res. 26, 3707-3716.

Petfalski, E., Dandekar, T., Henry, Y., and Tollervey, D. (1998). Processing of the
precursors to small nucleolar RN As and rRNAs requires common components. Mol.
Cell. Biol. 18, 1181-1189.

Saghai Maroof, M. A., Biyashev, R. M., Yang, 6. P., Zhang, 0., and Allard, R. W.
(1994). Extraordinarily polymorphic microsatellite DNA in barley: species diversity,
chromosomal locations, and population dynamics. Natl. Acad. Sci. USA 91, 5466-
5470.

Sehafl'er, R., Landgraf, J ., Aceerbi, M., Simon, V., Larson, M., and Wisman, E.
(2000). Microarray analysis of diurnal and circadian-regulated genes in Arabidopsis.
Plant Cell 13, 113-123.

Smith N.A., Singh, S.P., Wang, M.B., Stoutjesdijk, P.A., Green, A.G., and
Waterhouse, RM. (2000). Total silencing by intron-spliced hairpin RNAS. Nature
407, 319-320.

van Hoof, A. and Parker, R. (1999). The exosome: A proteasome for RNA? Cell 99,
347-350.

Villa, T., Ceradini F, Presutti, C., and Bozzoni, I. (1998). Processing of the intron-
encoded U18 small nucleolar RNA in the yeast Saccharomyces cervisiae relies on
both exo- and endonucleolytic activities. Mol. Cell. Biol. 18 , 3376-3383.

Waterhouse, P. M., Graham, H. W., and Wang, M. B. (1998). Virus resistance and
gene silencing in plants can be induced by simultaneous expression of sense and
antisense RNA. Proc. Natl. Acad. Sci. USA 95, 13959-13964.

107

     

 

 

CHAPTER 5

INVESTIGATION OF THE ROLE OF DEADENYLATION IN mRN A DECAY IN
HIGHER PLANTS

108

INTRODUCTION

A first step in the elucidation of how an mRNA instability determinant regulates
mRN A decay is to determine the mechanism by which mRNAs bearing the instability
determinant are degraded. Once these steps are known, it is then possible to investigate
which steps might be modulated by the instability determinant to bring about rapid decay.
A well characterized instability determinant in plants is the DST-element, a sequence
found in the 3' UTRs of SAUR genes (Sullivan and Green, 1996). Insertion of two
copies of the DST-element from the SAUR-15A gene into the 3’ UTR of a reporter
mRN A is sufficient to target an otherwise stable transcript for rapid decay in plant cells
(Newman et al., 1993). Mutational analyses indicated that the DST element functions in
a sequence dependent manner, and that mutation of the ATAGAT region of the DST
element inhibits its destabilizing function (Sullivan and Green, 1995). An additional
instability determinant which functions in plant cells is a sequence based on the AU-rich
elements (ARES) of several mammalian instability determinants. A synthetic ARE
containing 11 copies of the pentamer AUUUA targets transcripts for rapid decay in plant
cells (Ohme-Takagi, 1993). While it has been demonstrated that both the DST-element
and the synthetic ARE function in a sequence specific manner to target mRN As for rapid
degradation, their mode of action is unknown. There are several possible ways that they
might function to stimulate mRNA turnover; however, a likely possibility is that they
destabilize mRNAs by causing rapid deadenylation.

Many studies have pointed to the role of the poly(A) tail in stabilizing mRNAs
when injected into plant or animal cells (reviewed in Baker, 1993). That transcripts with

poly(A) tails are more stable than transcripts lacking poly(A) tails when injected into

109

 

cells indicated that the poly(A) tail might provide a protective role in vivo. Furthermore,
as had been hypothesized for the mRN A stabilizing function of the 5' cap, these
experiments indicated that the regulated removal of the poly(A) tail may have a function
in the regulation of mRN A stability. This appears to be the case for several unstable
mammalian and yeast transcripts in which poly(A) tail removal is the first step of mRN A
degradation.

The link between deadenylation and mRN A degradation was first made in studies
of the unstable mammalian c-fos mRNA. The c-fos transcript contains an ARE in its 3’

UTR which contains multiple copies of the pentamer AUUUA. The degradation rate of

 

the unstable c-fos mRN A was compared to that of a stable control transcript. For both
populations, deadenylation occurred over time; however, the unstable mRNA was
deadenylated more rapidly, and this rapid deadenylation depended on the presence of the
ARE (Wilson and Treisman, 1988). A key observation of mRNA decay directed by the
c-fos AREs was that deadenylation preceded decay of the mRNA. This indicated that
deadenylation was likely required for the decay of ARE-containing mRNAs and that
removal of the poly(A) tail might stimulate mRN A degradation. Since these initial
studies, the function of several different classes of ARES in increasing deadenylation

rates has become well established (Chen and Shyu, 1995). Increasing the rate of

 

deadenylation also appears to be a common feature of instability determinants in yeast
(Muhlrad and Parker, 1992; Caponigro and Parker, 1996) and deadenylation is a first step
in the degradation of several yeast transcripts (Decker and Parker, 1993). Deadenylation
preceding mRN A decay has also been observed in Chlamydomonas rheinhardtii (Baker,

1993).

110

J .

 

 

 

 

A current model for how deadenylation triggers mRN A degradation involves the
link between the 5’ and 3’ end of mRNAs. There are several models for how the 5' and 3'
ends of mRNAs might interact mediated by the poly(A) binding protein (PAB) (reviewed
in Jacobson, 1996). This interaction has been proposed to stabilize mRN As in yeast that
are degraded by the deadenylation-dependent-decapping pathway (Caponigro and Parker,
1996). According to this model, the interaction between the ends of the mRNA mediated
through PAB stabilizes transcripts by preventing them from being decapped by Dcplp. In
support of this model, PAB deletions result in premature decapping and decay of mRN As
in yeast (Caponigro and Parker, 1995). In yeast, transcripts are deadenylated to 10-12
adenylates prior to their decapping and degradation (Decker and Parker, 1993). Since a
poly(A) tail of 10-12 adenylates is unlikely to bind PAB with high efficiency(Sachs et al.,
1987), one effect of deadenylation might be to disrupt the interactions of PABs with the
poly(A) tail. This would in turn disturb the interaction of the ends of mRNA mediated by
PAB leading to decapping and degradation of transcripts in yeast. This model is
attractive because it explains in part how modulation of deadenylation could lead to
differences in mRN A half-lives in yeast. However, it is not clear if such an explanation
is applicable to the turnover of transcripts in mammalian cells, which are deadenylated
prior to their degradation.

The poly(A) tails of several transcripts bearing ARES in mammalian cells are
shortened to approximately 35 nts prior to degradation (Shyu et al., 1991), a length which
could still support binding of at least one PAB (Sachs et al., 1987). Therefore, the effect
of shortening the poly(A) tail in mammalian cells may be more complex than disrupting

the interactions of the 5’ and 3’ ends of mRNAs by loss of PAB binding. Nevertheless,

111

 

 

 

 

 

 

'7»-

 

there is indirect evidence that deadenylation may lead to decapping of some mRNAs in
mammalian cells and mRNAs containing ARES are rapidly decapped in mammalian cell
free extracts (6ao et al., 2001; Coutteteta1., 1997).

To gain insight into the potential role of deadenylation in the mechanism of
mRNA decay in plants, mRNA decay directed by the synthetic ARE and the DST
element was examined in tobacco cells. The fact that ARES likely target some
mammalian transcripts for decay by increasing the deadenylation rate indicates that the
synthetic ARE may have a similar mechanistic function in plants cells. The DST-element
could use a similar mechanism, or may have a function distinct from instability
determinants such as ARES. To address these possibilities, attempts were made to
measure and compare the deadenylation rates of stable mRNAs, and those destabilized by
insertion of two copies of the DST element or the synthetic ARE, in tobacco cells.
However, while it was possible to measure the deadenylation rate of a stable reporter
mRNA, it was not possible to measure the deadenylation rate of unstable mRNAs due to

their low steady-state abundance.

RESULTS AND DISCUSSION

If the decay of some transcripts in plants resembles the mechanism of decay of
many mRNAs in yeast and mammalian cells, rapid deadenylation may precede, and be
required for degradation. The DST element or the synthetic ARE may function as
instability determinants in plants by increasing the deadenylation rate of transcripts
bearing these sequences and thus lead to rapid mRNA degradation. If true, reporter

transcripts containing two copies of the DST sequence or the synthetic ARE should be

112

 

 

deadenylated more rapidly than stable control transcripts lacking these elements. In
addition, reporter RNAS bearing two copies of a DST element which has been mutated in
one of the regions required for instability function, the ATAGAT region, should also be
deadenylated more slowly. To examine these hypotheses, attempts were made to
measure and compare the deadenylation rates of unstable reporter transcripts containing
two copies of the DST element (DSTX2), stable transcripts containing two copies of the
mutated DST element (ATAGATXZ), unstable transcripts bearing the synthetic ARE
consisting of 11 overlapping AUUUA pentamers (AUUUAXl 1) and a stable spacer
control for the synthetic ARE which is AU-rich but lacks AUUUA pentamers.

Previous studies of the instability function of the DST element made use of a
transformed suspension culture of tobacco cells, NT cells, which expressed reporter
genes (Newman et al., 1993, Ohme-Takagi et al., 1993). The reporter genes consisted of
the cauliflower mosaic virus 358 promoter, the murine B-globin coding region, and the
pea rch-E9 polyadenylation sequence (Figure 4-1 A). Instability elements, and control
sequences which do not alter mRN A stability, were inserted in the 3’ UTR between
globin and E9. These constructs were used to stably transform NT cells and the decay
rates of transcripts expressed from these genes was measured in the absence of on-going
mRN A synthesis. The transcriptional inhibitor actinomycin D was added to the
transformed cells grown in liquid culture, aliquots of these cells were taken at intervals,
and mRN A decay was followed by northern blot analysis of RNAS isolated from each
time-point.

NT cells were stably transformed with each of the constructs described above and

used for actinomycin D time courses. To measure the deadenylation rates of the reporter

113

 

 

 

RNAS two approaches were taken, the RNase H cleavage method which has been used to
measure deadenylation rates of transcripts in yeast (e.g. Muhlrad et al., 1994) and a newly
developed method called the poly(A) test (PAT), which makes use of RT-PCR (Sallés

and Strickland, 1999).

Analysis of deadenylation of 610bin-ATAGATX2-E9 by RNase H cleavage

The RNase H cleavage method relies on an increase in the electrophoretic
mobility of mRNAs in polyacrylamide gels due to loss of the poly(A) tail over time. To
more easily detect this change in mobility, the reporter transcripts are cleaved close to the
poly(A) tail to produce small species which undergo more substantial changes in mobility
due to differences in the length of the poly(A) tail. RNase H is used to cleave the
reporter RN As. RNase H cleaves the RNA of an RNAzDNA duplex, thus the reporter
RNAS can be cleaved into two pieces if incubated with a complementary DNA
oligonucleotide in the presence of RNase H. Cleavage with P6244, an oligonucleotide
which is complementary to the 3’ end of the globin coding region, yields a 5' cleavage
product corresponding to the majority of the 5’ end of the reporter mRN A, and a smaller
3’ cleavage product corresponding to the E9 sequence and the poly(A) tail. Since the E9
polyadenylation sequence directs poly(A) tail addition at four sites, four cleavage
products corresponding to the 3' end of the reporter RNA are produced. The mobility of
these short 3’ cleavage products undergoes substantial changes in migration due to loss of
the poly(A) tail over time, and it is this change in migration that is used to derive the
deadenylation rate.

The deadenylation rate of the 610bin-ATAGATX2-E9 RNAS were examined

114

 

first. For transcripts at steady-state, the distribution of poly(A) tails spans from
transcripts with tails which are newly synthesized and are the longest, to older transcripts
with shorter tails due to deadenylation. This distribution results in a heterogeneous
population of transcripts, but the reporter RNAS must be cleaved close to the 3' end for

this population to be detected. The heterogeneity is not detected for the un-cleaved

 

   

A.
B.
P6244
Oligo d'l'
RNase H
o“ o 4_ so 9012015q(min)
1000 ... .. ._
60° 5' cleavage
9 products
400 "
3' cleavage
products
300

12 3‘4 5'6 78
Figure 5-1. The poly(A) tail of Globin-ATAGATXZ-E9 shortens over time. (A)
Schematic diagram of reporter gene expressed in NT cells. 35S: promoter from
cauliflower mosaic virus, Globin: murine globin coding region, E9: polyadenylation
sequence from pea rch gene, P6244: globin-specific oligonucleotide. (B) RNase H
cleavage analysis of Globin-ATAGATXZ-E9 actinomycin D time course. 20 pg of total
RNA of the indicated time points was cleaved with RNase H and P6244. The poly(A)
tail of the RNA from the first time point was removed in vitro with oligo dT and RNase
H in a separate reaction The cleaved RNAS were separated with a 6% polyacrylamide
8.0 M urea gel, and transferred to a membrane which was hybridized with probes specific
for globin. The mobility of molecular weight markers is shown at the left and the time of
acitnomycin D treatment at the top.

115

 

transcript (Figure 5-1 B, lane 1), but when the reporter RNA is cleaved with P6244 and
RNase H, the 3’ cleavage products are detected on northern blots as a diffuse band
(Figure 5-1 B, lanes 3-8). To demonstrate that the diffuse band is due to differences in
poly(A) tail length, the poly(A) tails of the 3’ cleavage products from first time point
(i=0) were removed in vitro prior to electrophoresis. This was accomplished by
incubating the RNA with RNase H in the presence of oligo dT and the Globin-specific
oligonucleotide P6244, resulting in cleavage of the reporter RNA and degradation of the
poly(A) tails of the 3’ cleavage products. If the diffuse band detected on northern blots is
due to heterogeneity in length of the poly(A) tails, in vitro removal of the poly(A) tail
should result in the disappearance of the diffuse band. The band should then migrate as a
discrete band of the size expected for the 3’ cleavage product without poly(A) tails. In
this case, the four sizes of the E9 3’ UTR are expected. AS can be seen in Figure 5-1 B
lane 2, in vitro removal of the poly(A) tail of Globin-ATAGATXZ-E9 transcripts
generated distinct bands corresponding to the approximate sizes expected for the E9 3’
UTR. The variation in intensity of these bands is due to differential use of the poly(A)
addition sites, with the most intense band reflective of polyadenylation at site two (Hunt,
1989). This indicates that the diffuse band detected on northern blots is due to
heterogeneity in length of the poly(A) tails and can be used to monitor changes in
deadenylation.

To measure the deadenylation rate over time, the initial length of the poly(A) tail
was calculated and its shortening rate over the time-course determined. The mobility of
the top of the diffuse band at time zero, which corresponds to transcripts with the longest

poly(A) tails, was compared to molecular weight markers. The size of the 3' RNase H

116

 

 

-9 ..,.- Lg-

 

e-q’-._r a- . . _ , _.-..13_.v,4- '»~, In. _

cleavage product in which site two of the E9 tail has been used, the site at which most of
the reporter RNAS were polyadenylated, is 340 nt (Figure 5-1 B, lane 2). The top of the
diffuse band at time zero migrates to a position of approximately 450 nt (Figure 5-1 B,
lane 3). This indicates that the poly(A) tail is approximately110 nt long at time zero. This
length is intermediate between yeast and mammals which have poly(A) tails of
approximately 75 nt and 300 nt, respectively (Baker, 1993). To calculate the degree to
which the poly(A) tail Shortens, the change in the mobility of the top of the diffuse band
is monitored over time. AS can be seen in lanes, the top of the diffuse band migrates
further down the gel with increasing time due to deadenylation (Figure 5-1 B, lanes 3-8).
The average change in mobility over the entire time-course reflects a deadenylation rate
of approximately 0.5 nt/min, a value similar to stable mRNAs measured in mammalian
and yeast systems (Shyu et al., 1991; Decker and Parker, 1993). A repeat of this analysis
with an independently generated time course of the same stable ATAGATX2 RNA
resulted in a similar measurement (data not shown).

The next step in the analysis was to measure the deadenylation rate of the unstable
Globin-DSTXZ-E9 and Globin-AUUUAXI 1-E9 transcripts. If these sequences function
by increasing deadenylation rate, deadenylation of transcripts bearing these elements
would be expected to occur faster than rate of deadenylation of the stable Globin-
ATAGATXZ-E9 transcripts determined above. Unfortunately, due to technical
limitations, such a measurement was not obtained.

The steady-state abundance of Globin-DSTXZ-E9 and Globin-AUUUAX11-E9
transcripts is quite low due to their high degradation rates. When the RNase H cleaved

RNA was separated by electrophoresis, the intensity of the Signal detected on a northern

117

 

 

blot was further reduced due to the diffuse nature of the 3’ cleavage product. This made

the low abundance n'anscripts even more difficult to detect. The diffuse band
corresponding to the 3’ end of the Globin-DSTX2-E9, or 610bin-AUUUAX11-E9, was
not detected in any of several experiments when polyacrylamide gels were used. The 3’
cleavage product could be observed when agarose gels were used, indicating that these
reporter RNAS could be cleaved. However, concentrations of up to 4% agarose failed to
resolve the small differences in the migration of these cleavage products, or of the 3’
cleavage products of a repeat of the Globin-ATAGATX2-E9 time course (data not

Shown).

Analysis of deadenylation of 610bin-ATA6ATX2-E9 by PAT-PCR

As an alternative to the RNase H cleavage method, an RT-PCR method was
attempted. For RT-PCR to be applicable to measuring changes in poly(A) tail lengths,
the reverse transcription reaction must generate cDNAs which contain as much as
possible of the poly(A) tail-derived sequence. A method to generate cDNAs which
include poly(A) derived sequence has been recently developed called PAT-PCR (Sallés
and Strickland, 1999; diagrammed schematically in Figure 5-2 A). In this method, oligo
dT12-13 is annealed to the RNA. The oligonucleotides anneal along the length of the
poly(A) tails, but can leave some of the 3’ end without poly(A) annealed. These
oligonucleotides are phosphorylated on their 5' ends and are ligated together with DNA
ligase. An excess of an ‘anchor primer’, which consists of poly(T) followed by 16 bases
of a non T-rich sequence, is added to this mixture of total RNA and ligated oligo dT. The

anchor primer can anneal to any un-paired poly(A) tail at the 3’ end. Following

118

 

 

 

 

 

annealing of the anchor primer, the oligo dT and anchor primers are ligated to each other
with DNA ligase. This oligo dT-anchor primer ligation product is used as the primer for
reverse transcription, thus incorporating sequence from the poly(A) tail in the first strand
cDNA. The cDNAs generated are used in a PCR reaction with a gene specific primer and
a primer which anneals to the anchor sequence. Radiolabled dATP is included in the
PCR reaction to label the PCR products which are separated by PAGE and detected with
autoradiography.

The RNA from an actinomycin D time course of cells expressing Globin-
ATAGATX2-E9 was analyzed by PAT-PCR. It should be noted that PAT-PCR was
developed to monitor changes in poly(A) tail length of transcripts with a discrete poly(A)
distribution at steady state and whose abundance doesn’t change over time (Sallés et al.,
1999). It was unclear if PAT-PCR would work on transcripts whose poly(A) tails vary
over a wide range in length, and for transcripts which are decaying over time. The main
concern was that PAT-PCR would not distinguish between disappearance of full-length

transcript over time without loss of the poly(A) tail, and deadenylation occurring over

 

time. To simulate a dead...,l..:iu.. ' J r J ‘ decay of mRNA, the cDNAs generated
from one time point (time 15 for Globin-ATAGATXZ-E9) were serially diluted, with
cDNAs from non-transformed NT cells added to maintain the same total template
concentration across the dilution series. The cDNAs were subjected to PCR analysis.
The expected result was that a diffuse band of PAT-PCR products corresponding to the
disnibution of differing poly(A) tail lengths at steady-state would be detected. Across the

dilution series the diffuse band should not decrease in length but Should decrease in

119

 

 

 

 

 

 

overall radioactive signal due to the dilution of the template. However, this was not the

case (Figure 5-2 B). The top of the PAT-PCR products appeared lower on the gel across

A.
IEEEEEEEHDEEIAAAAAAA

Anneal and ligate oligo dT

\/
AAAAAAA
5133 [alarm [31 m.”

Anneal and Iigate anchor primer

\/
AAAAAAA
BE m B] Trr'n'rTr-Anchor

 

Reverse transcribe and PCR
with globin and anchor primers

P'°R°"i°" °f 1.00 0.67 0.50 0.40 0.33 0.25 0.01
starting cDNA

 

12345967

Figure 5-2. Use of the PAT-PCR method to measure deadenylation (A) Schematic
diagram of the PAT-PCR strategy. (B). PAT-PCR of a dilution series of Globin-
ATAGATXZ—E9 cDNAs generated from the 15 minute time point of an actinomcyin D
time course. PAT-PCR was carried out as described in the text and the reactions were
separated on a non-denaturing 6% acrylamide gel. Above each lane is shown the amount
of cDNA from the first time point used for each PCR reaction of the dilution series.

120

the dilution series Similar to what would be expected for deadenylation over time. It
appears that the longer products are not detected below a certain concentration. From
this result it appears that PAT-PCR, at least in its present state, causes loss of transcript
over time to mimic a decrease in the length of the poly(A) tail over time. While this effect
is minimal with up to a two-fold dilution (Figure 5-2 B compare lanes 1-3) with dilutions
greater than two-fold the effect is quite significant, giving the appearance that the poly(A)
tail has shortened by greater than 25 nucleotides. As the expecmd change in abundance
of unstable mRNAs would likely exceed two-fold in an actinomycin D time course, it
would be difficult to distinguish between loss of the poly(A) tail and inefficient PCR of
long poly(A)-tailed mRNAs. Despite these drawbacks to PAT-PCR, there are several
ways that the technique might be optimized to measure deadenylation rates of decaying
mRNAs in the future.

If the measurement of deadenylation were restricted to early time points such that
the change in mRN A abundance is not very great, this may alleviate the effect of loss of
transcripts over time. However, as it is known that deadenylation exhibits biphasic
kinetics in yeast cells (Muhlrad and Parker, 1992), restricting measurement to early time
points might result in a measurement not reflective of the over all deadenylation rate.
Alternatively, it may be possible to use equivalent amounts of RNA for each time point.
For example, if the reporter RNA is known to decay three-fold after a particular time
interval, three-fold more RNA for this time point could be used in the PAT-PCR. This
could have the effect of reducing the effects of decreasing amounts of reporter RNA over
time and allow for a deadenylation rate to be calculated. Either of these approaches might

be successful in determining if deadenylation rates correlate with mRN A instability

121

 

 

 

 

 

sin-”iii ‘? ..

 

 

triggered by DST or ARES. However, prior to more optimization, it would be beneficial
to modify the overall design of the experiment to gain more information about the
relationship between deadenylation and mRN A degradation.

A significant limitation to the analysis of changes in poly(A) tail lengths of a
steady-state RNA population generated from a constitutive promoter is that the
relationship between deadenylation and decay cannot be fully determined. While it is
possible to determine if mRN A instability correlates with a higher rate of deadenylation,
it is not possible to determine if deadenylation precedes, and therefore might be required
for, mRNA decay. To make such a determination requires the analysis of a
synchronously synthesized population of transcripts to determine if removal of the
poly(A) tail precedes disappearance of the mRNA. Such a population could be generated
by a promoter that is rapidly induced and repressed.

Recently, a transcript that is rapidly and transiently induced has been discovered
in Arabidopsis (R.A. Gutierrez and R]. Green, unpublished). If the promoter of the gene
encoding this transcript mediates its expression kinetics, this promoter might be a good
way to control the expression of reporter genes in Arabidopsis. It could allow for the
generation of a synchronous population of reporter transcripts whose deadenylation could
be measured and compared to the kinetics of decay in intact Arabidopsis seedlings. A
further modification to the expression of the reporter gene would be to use a transcription
terminator which directs polyadenylation at only one site. The reporter genes in this
study made use of the pea rch-E9 polyadenylation sequence which directs
polyadenylation at four sites (Hunt, 1988). Transcripts polyadenylated at each of these

sites are produced which leads to overlapping of the 3' RNase H cleavage products

122

 

 

 

 

generated from these transcripts on northern blots. This makes the determination of
deadenylation rates more challenging, since it is difficult to determine where the top of
the diffuse band for each of these heterogeneous mRNAs migrates. The use of a
regulated promoter and a “stricter” polyadenylation sequence should greatly enhance the

ability to determine if deadenylation precedes the decay of some mRNAs in plants.

CONCLUSIONS AND FUTURE PROSPECTS

Although technical limitations prevented a comparison of deadenylation rates of a
stable and unstable reporter RN As in tobacco cells, the results presented here indicate
that such measurements may be possible. The RNase H-cleavage method was successful
in measuring the deadenylation rate of a stable mRNA and this method may be
appropriate for future studies. As a limitation of this method is the difficulty of detecting
RNase H cleavage products of mRNAs expressed at low levels, application of this
method will require expression levels that surpass those achieved by the 35S promoter
used in the experiments described above. The transiently induced promoter described
above will likely give higher expression levels than the 35S promoter, and likely can be
used to produce a synchronous population of transcripts. The use of the RNase H
cleavage method in combination with this promoter has the greatest potential to address
the role of deadenylation in the function of the DST element and the synthetic ARE in

stimulating mRNA decay in plants.

123

 

 

 

'~‘ 0 .6". P- "i m

MATERIALS AND METHODS

RNase H cleavage

A DNA oligonucleotide complementary to the 3’ end of the globin coding region,
P6244: 5’-CCCAAT6CCATAATACTCG-3’, was used to direct cleavage or the reporter
transcripts. 20 pg of total RNA was incubated with 2 pg of oligonucleotide at 65°C for
10 minutes in a water bath. Over the course of about one hour, the water bath was slowly
cooled to room temperature. The reactions were then placed on ice for 5 minutes. RNase
H digestions are incubated at 37°C for 1 hour in 50 pl of RNase H reaction mix
containing 4 mM Tris-HCl, pH 8.0, 10 mM MgC12, 20 mM KCl, 1 mM DTT and three
units of RNase H (GIBCO-BRL). The reactions were then ethanol precipitated and
resuspended in formamide loading buffer containing: 10 mM EDTA, 1 ug/ul xylene

cyanol and lug/ul bromophenol blue in 100% formamide (Hilamond and Sproat, 1994).

Actinomycin D time courses and northern analysis

Time courses were performed with 50 ml cultures of stably transformed NT cells
five days after sub-culture using 500 ug/ml of actinomycin D as previously described
(Newman et al., 1993). Total RNA was isolated from 5 ml aliquots of the NT cells at 15
or 30 minute time intervals of treatment with actinomycin D. Northern blot analyses of
RNase H cleaved RNAS were conducted as follows. RNase H cleavage reactions were
separated with 6% polyacrylamide (30:1 acrylamide: bis-acrylamide) 8.0 M urea gels.
The gels were 15 cm long and were run at 300V for 10 hours. Following electrophoresis

9

the RNA was transferred to Zetaprobe membrane (Biorad) using a Hoeffer TE42 transfer

124

 

 

 

 

~x

- __—«b— .. -n—r—

 

 

apparatus (Hoeffer). The transfer was done at 300 mA for 12 hours in 0.5X TBE at 4 °C.
Pre-hybridizations and hybridizations were done using standard techniques. The best

results were obtained by washing once with 2XSSC 0.1% SDS for 30 minutes at 65 °C.

PAT-PCR

The RT-PCR reactions were carried out according to the method of Sallés et al.,
(1999) as follows: 20 pg of total RNA was incubated in a 7 pl volume with 20 ng of
oligo dT [pd(T)12-13 (Pharmacia)] at 65 °C for 10 minutes. The reactions were
transferred to 42 °C for ligation of the oligo dT primers. This ligation was conducted in a
20 pl volume including 4 pl 5 X RT buffer (Gibco) 2p 0.1 M DTI‘, lpl mixture of all
four dNTPs at 10 mM each, lpl of 10 mM ATP and 1 pl of high concentration T4 DNA
ligase (10 Weiss U/pl). This reaction mix was incubated for 30 minutes at 42 °C.
Following ligation of the oligo dT primers, 200 ng of the anchor primer PG 461: 5’-
GCGAGCTCCGCGGCCGCG'I'ITITI'I'I'ITIT-3’ was added and the reaction
incubated at 16 °C for 2 hours to ligate the anchor primer to the poly dT. Following
ligation of the anchor primer, the reaction was incubated at 42 °C for two minutes after
which 200 U of Superscript reverse transcriptase (Gibco) was added. Reverse
transcription was carried out at 42 °C for 1 hour. PCR was carried out with the following
cycles: 2 minutes at 94 °C, 20 cycles of 1 minute at 94 °C, 2 minutes at 58 °C and 3
minutes at 68 °C. The best results were obtained with Advantage cDNA polymerase mix
(Clontech). The PCR reactions included 5 pCi of (it-32 P dATP (NEN). The primers used

for the PCR were the Globin specific primer P6485, which is the reverse complement of

125

 

 

,fi mn—-_.__~ _ ._ fl

 

PG244, and a primer identical to the anchor primer P6461, but lacking the thymidylates
at the 3’ end (primer P6 484). Use of the anchor primer in the PCR as recommended in
Sallés et al., (1999) resulted in the amplification of non-specific products. These products
were greatly reduced by substituting the anchor primer with primer P6484. The PAT-
PCR reactions were separated on a non-denaturing 6% polyacrylamide gel and exposed

to film.

 

126

 

 

 

 

REFERENCES

Baker, E. J. (1993). Control of poly(A) length. Control of Messenger RNA Stability, J.
Belasco and G. Brawerman eds (New York: Academic Press), pp.367-415.

Brown, C. E. and Sachs, A. B. (1998). Poly(A) tail length control in Saccharomyces
cerevisiae occurs by message-specific deadenylation. Mol. Cell. Biol. 18, 6548-
6559.

Caponigro, G. and Parker, R. (1995). Multiple functions for poly(A)-binding protein in
mRN A decapping and deadenylation in yeast. Genes Dev. 9, 2421-2432.

Caponigro, G. and Parker, R. (1996). mRNA turnover in yeast promoted by the
MATal instability element. Nucleic Acids Res. 24, 4304-4312.

Chen, C. Y. A. and Shyu, A. B. (1995). AU—rich elements: Characterization and
importance in mRNA degradation. Trends Biochem. Sci. 20, 465-470.

Couttet, P., Fromont-Racine, M., Steel, D., Pictet, R., and Grange, T. (1997).
Messenger RNA deadenylylation precedes decapping in mammalian cells. Proc.
Natl. Acad. Sci. USA 94, 5628-5633.

Decker, C. J. and Parker, R. (1993). A turnover pathway for both stable and unstable
mRNAs in yeast: evidence for a requirement for deadenylation. Genes Dev. 7, 1632-
1643.

Gao, M., Fritz, D. T., Ford, L. P., and Wilusz, J. (2000). Interaction between a
poly(A)-specific ribonuclease and the 5' cap influences mRN A deadenylation rates in
vitro. Mol. Cell 5, 479—488.

Gao, M., Wilusz C.J., Peltz, S. W., and Wilusz, J. (2001). A Novel mRNA-decapping
Activity in HeLa Cytoplasmic Extracts is Regulated by AU-rich Elements. EMBO J.
20,1134-1143.

Hunt, A. G. and MacDonald, M. H. (1989). Deletion analysis of the polyadenylation
signal of a pea ribulose-1,5-bisphosphate carboxylase small-subunit gene. Plant Mol.
Biol. 13, 125-138.

Jacobson, A. (1996). Poly(A) metabolism and translation: The closed loop model. In
Translational Control. M. Hershey, M. Mathews,. and N. Sonenberg eds (New York:
Cold Spring Harbor Press) pp 451—480.

Johnson, M. A. (2000). Genetic Determinants of mRNA Stability in Plants. Ph.D.
dissertation. Michigan State University

127

 

Khmer, C. G., Wormington, M., Muckenthaler, M., Schneider, S., Dehlin, E., and
Wahle, E. (1998). The deadenylating nuclease (DAN) is involved in poly(A) tail
removal during the meiotic maturation of Xenopus oocytes. EMBO J. 17, 5427-5437.

Lamond, A. I. and Sproat, B. S. (1994). In RNA Processing, A Practical Approach. S.
J. Higgins and B. D. Hames eds (New York: IRL Press) p. 127.

Muhlrad, D., Decker, C. J ., and Parker, R. (1994). Deadenylation of the unstable
mRNA encoded by the yeast MFA2 gene leads to decapping followed by 5'-->3'
digestion of the transcript. Genes Dev. 8, 855-866.

Muhlrad, D. and Parker, R. (1992). Mutations affecting stability and deadenylation of
the yeast MFA2 transcript. Genes Dev. 6, 2100-2111.

Newman, T. C., Ohme-Takagi, M., Taylor, C. B., and Green, P. J. (1993). DST
sequences, highly conserved among plant SA UR genes, target reporter n'anscripts for
rapid decay in tobacco. Plant Cell 5, 701-714.

Ohme-Takagi, M., Taylor, C. B., Newman, T. C., and Green, P. J. (1993). The effect
of sequences with high AU content on mRNA stability in tobacco. Proc. Natl. Acad.
Sci. USA 90,11811-11815.

Sachs, A. B., Davis, R. W., and Kornberg, R. D. (1987). A Single Domain of Yeast
Poly(A)-binding Protein is Necessary and Sufficient for RNA Binding and Yeast
Viability. Mol.Cell.Biol. 7, 3268-3276.

Sachs, A. B. and Deardorff, J. A. (1992). Translation initiation requires the PAB-
dependent poly(A) ribonuclease in yeast. Cell 70, 961-973.

Sallés, F. J ., Richards, W. G., and Strickland, S. (1999). In Methods, a Companion to
Methods in Enzymology. A. Jacobson and S.W. Peltz eds (New York: Academic
Press) pp 38-45.

Shyu, A.-B., Belasco, J. G., and Greenberg, M. E. (1991). Two distinct destabilizing

elements in the c-fos message trigger deadenylation as a first step in rapid mRNA
decay. Genes Dev. 5, 221-231.

Tucker, M., Valencia-Sanchez, M. A., Staples, R. R., Chen, J ., Denis, C. L., and
Parker, R. (2001). The Transcription Factor Associated Ccr4 and Cafl Proteins are
Components of the Major Cytoplasmic mRN A Deadenylase in Saccharomyces
cerevisiae. Cell 104, 377-386.

Wilson, T. and Treisman, R. (1988). Removal of poly(A) and consequent degradation
of c-fos mRNA facilitated by 3' AU-rich sequences. Nature 336, 396-399.

128

nzrw- '..-. . .. .sb‘.

 

 

 

SYNOPSIS

129

 

 

 

 

SYNOPSIS

Many of the experiments canied out on in this dissertation were based on the
assumption that mRN A decay in plants may resemble mRNA decay in yeast, but also
might differ in several important ways. The experimental results presented in this
dissertation indicate that mRN A degradation of some mRNAs in plants likely occurs
thorough a pathway which resembles the major deadenylation-dependent-decapping
pathway of yeast; however, this degradation is most likely catalyzed by AtXRN4, an
ortholog of the nuclear yeast enzyme Xm2p/Ratl. Furthermore, experiments reported in
this dissertation indicate that additional highly active mRN A degradation pathways exist
in Arabidopsis.

The presence of orthologs in the Arabidopsis genome of components of the major
5'-3' , as well as the 3'-5' mRNA decay pathways of yeast (Kastenmayer et al., 1998;
Gutierrez, et al., 1999) indicates that mRNA degradation pathways in yeast may be
conserved in higher plants. In addition, the presence of such mRN A decay pathways in
plants is supported in several cases by the structures of natural mRNA decay
intermediates (e.g. Tanzer and Meagher, 1995). However, the striking absence of an
Xrnlp ortholog from Arabidopsis and other plants species clearly indicates that mRN A
decay catalyzed from the 5' end in higher plants differs from mRNA degradation in yeast.
In addition, the absence of poly(G)-stabilized mRN A decay intermediates in plant cells,
like those observed in yeast due to blockage of Xrnl p, further indicates that mRNA
decay differs between plants and yeast (Kastenmayer et al., 1998; Johnson, 2000). The
discovery that the Xm2p/Rat1p ortholog AtXRN4 is cytoplasmic, rather than nuclear

(Chapter 3), indicates that 5'-3' mRN A decay in Arabidopsis may be catalyzed by

130

a". tract- burr-tr

 

AtXRN4. However, as AtXRN4 is blocked by poly(G) tracts (Chapter 3), its activity
cannot solely account for the absence of poly(G)-stabilized mRNA decay intermediates
in Arabidopsis. AtXRN4 may catalyze the degradation of mRNAs, similar to Xrnlp in
yeast, but might function in concert with additional cellular proteins which facilitate the
degradation of highly structured mRNAs.

Although AtXRN4 may have an Xmlp-like function with respect to mRNA
degradation, it is likely that AtXRN4's contribution to mRN A degradation in Arabidopsis
is not as great as Xmlp's role in mRNA decay in yeast. In contrast to Xrnlp, AtXRN4 is
not highly expressed (Chapter 3), and the AtXRN4 protein is unlikely to be particularly
abundant. This could indicate that mRNA degradation catalyzed from the 5' end is a less
prominent mRN A decay pathway in plants than in yeast. The preliminary observation
that the abundance of relatively few transcripts is altered in the xm4-1 mutant (Chapter 4)
is consistent with this possibility.

Taken together, the experiments presented in this dissertation support the
hypothesis that the degradation of some mRNAs in plants resembles 5'-3' mRNA decay
in yeast, with the exception that the Xm2p/Ratlp ortholog AtXRN4 may catalyze mRN A
degradation in Arabidopsis. In addition, studies of mRNA degradation in the xm4-I
mutant indicate that additional mRN A decay pathways exist in Arabidopsis. In the
future, it will be interesting to address the contribution that AtXRN4 makes to global
mRN A degradation as well as the mRNA degradation pathway in which AtXRN4

functions.

131

 

 

REFERENCES

Gutierrez, R. A., MacIntosh, G. C., and Green, P. J. (1999). Current perspectives on
mRNA stability in plants: multiple levels and mechanisms of control. Trends Plant

Sci. 4, 429-438.

Johnson, M. A. (2000). Genetic Determinants of mRNA Stability in Plants. Ph.D.
dissertation. Michigan State University

Kastenmayer, J. P., van Hoof, A., Johnson, M. & Green, P. J. (1998) in Plant
Molecular Biology, eds. Raikhel, N., Last, R., Morelli, G., & LaShavo, F. (Springer-
Verlag, Berlin), pp. 125-133.

Tanzer, M. M. and Meagher, R. B. (1995). Degradation of the soybean ribulose-1,5-

bisphosphate carboxylase small-subunit mRNA, SRS4, initiates with endonucleolytic
cleavage. Mol.Cell.Biol. 15 , 6641-6652.

132

 

 

 

 

IIIIIIIIIIIIIIIIIIIII

lullllllljllllllllltwill