.F“ a.

b...

rt. .-

I I..: Q: . _
: 61v.

3?.333 ...

....A|.v».v.

1..

2111. 2..
z .. . .2“

fan,

6.53... Lu
. II...

 

 

 

 

..
9:. .
..

:— , .hflwfi

. I I...
15.3.!
I. 031?...

1., :5".

ISL

 

LIBRARY
Michigan State
University

This is to certify that the

dissertation entitled

M’é/Ifi‘flc’W and Mamaten‘zaaém of 6/550
figWPc/ 980% 1‘4 Nf/omonogyfl‘c Dz‘fl/‘ergnfibjz'afi

presented by

QIW 7:24

has been accepted towards fulfillment
of the requirements for

IA - ~D . degree in MI‘WAIb/e/f

 

Major professor

Date Sb/a/g/m

 

MS U is an Affirmative Action/Equal Opportunity Institution 0- 12771

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 cJCIRC/DateDuest-p. 15

IDENTIFICATION AND CHARACTERIZATION OF CIEBP REGULATED
GENES IN MYELOMONOCYTIC DIFFERENTIATION

BY

Qiang Tian

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Microbiology
2000

ABSTRACT

IDENTIFICATION AND CHARACTERIZATION OF C/EBP REGULATED GENES
IN MYELOMONOCYTIC DIFFERENTIATION

By

Qiang Tian

The CCAAT/enhancer binding proteins (CIEBP) comprise a family of basic
leucine zipper (bZIP) transcription factors that dimerize through their leucine
zippers and bind to a consensus DNA motif through their adjacent basic regions.
The involvement of C/EBPs in myelopoiesis has been demonstrated by their
temporal pattern of expression in differentiating 32D clone 3 myeloblasts and by
the complete lack of neutrophils associated with the targeted disruption of
C/EBPa and C/EBPe in transgenic mice. However, the currently identified target
genes of C/EBP regulation seem inadequate to fully explain the role of these
transcription factors in myelomonocytic differentiation. We sought to elucidate the
regulatory scheme in which C/EBPs act in differentiation by identifying new
targets of their regulation in immature myeloid cells by utilizing differential display '
PCR. C/EBPB was overexpressed in 320 clone 3 myeloblasts and differential
display RT-PCR was performed to identify genes induced by C/EBPB
overexpression. Among the four genes identified, two were endogenous retroviral
elements, one encoded a cathepsin G, a primary granule protein of neutrophils
and monocytes, and one encoded a novel gene that we have named CDDP-l for
C/EBP Differential-Display Product-1. A CDDP-1 cDNA containing a 453 amino

acid open reading frame was isolated from a kgtll human bone marrow cDNA

library. The expression of CDDP-1 mRNA is upregulated by the overexpression
of C/EBPa, B, 5, or a. An examination of sequences immediately upstream of the
CDDP-1 cDNA reveals several potential CIEBP binding sites suggesting that
CDDP-1 may be a direct target of C/EBP regulation. CDDP-1 displays a biphasic
pattern of expression in the granulocytic differentiation of myeloid progenitor cell
lines: an early period of elevated expression just prior to and continuing through
the induction of myeloperoxidase mRNA and a later second period coincident
with the expression of lactoferrin mRNA. It is also induced upon granulocytic
differentiation of HL-60 cells, but is downregulated upon monocytic
differentiation. This pattern of expression coupled with the finding that CDDP-1 is
most highly expressed in adult bone marrow and fetal liver suggests a role in
myelopoiesis. Constitutive overexpression of CDDP-1 in MPRO promyelocyles
promoted their differentiation toward both the neutrophil and monocyte lineages.
Retinoic acid treatment can further facilitate the neutrophilic differentiation of
CDDP-l transductants. Subcellular localization studies suggested that CDDP-1
is predominantly a cytoplasmic protein. CDDP-l mRNA is also modulated during
the course of erythroid and mast cell differentiation suggesting roles for this gene
in the differentiation of these other lineages.

In Chapter 3, I conducted transient transfection assays to confirm that
truncated forms of C/EBPB which retain only the bZlP regions can confer LPS
induced activation of an lL-6 promoter. An intact NF-icB binding site on the lL-6
promoter is required for this activation. These results implicate the bZlP domain

in some function other than dimerization with known C/EBP family members.

To my family:

My great parents, lovely wife Danbin and wonderful daughter Elaine.

iv

ACKNOWLEDGEMENT

I feel greatly indebted to my thesis advisor, Dr. Richard C. Schwartz for his
enduring supports and sound guidance throughout my graduate studies. His
wealth of knowledge and technical prowess has ensured that my projects were
carried out smoothly. Not only did we share all the excitement of doing sciences,
but also, I Ieamed how to survive all the frustrations as a scientist. I am also very
grateful to the members of my guidance committee: Dr. Jerry Dodgson, Dr.
Walter Esselman, Dr. Susan Conrad, and Dr. Donald Jump for their valuable
time, advice, and generous support both in science and in my life.

I would also like to thank all the past and present members of the
Schwartz Lab, Hsien-ming Hu, Hongwei Gao, and Chauncey Spooner for their

helpful discussion and all the good times we had together.

TABLE OF CONTENTS

 

Chapter 1
Literature review ......................................................................................... 1
Introduction ............................. - 1
1.1 Overview of CIEBP isoforms .................................................... 3
1.1.1 CIEBPa .......................................................................... 3
1.1.2 CIEBPB .......................................................................... 4
1.1.3 CIEBPy .......................................................................... 5
1.1.4 C.EBP5 .......................................................................... 6
1.1.5 CIEBP: .......................................................................... 6
1.1.6 CIEBPe .......................................................................... 7
1.2 Hematopoiesis ........................................................................... 8
1.2.1 Overview of myelomonocytic development ............... 10
1.2.2 Hematopoietic growth factors in hematopoiesis ...... 13
1.3 Transcription factors in hematopoiesis and leukemia ........... 16
1.3.1 CIEBPs in myelopoiesis .............................................. 18
1 .3.2 Other important transcription factors that play a
role in myelopoiesis .................................................... 21
1 .3.3 Cross-talk between transcription factors determines
Hneage .......................................................................... 24
1.3.4 A model for myelopoiesis ........................................... 26
1.4 Objectives .................................................................................. 28
References .................................................................................................. 30
Chapter 2
A novel CIEBP-regulated gene with a role
in myelomonocytic differentiation ............................................................ 42
Abstract ............................................................................................ 43
Introduction ...................................................................................... 45
Materials and Methods .................................................................... 49
Results .............................................................................................. 55
Discussion ....................................................................................... 87
References ....................................................................................... 91
Chapter 3

The CIEBP bZlP domain can mediate Iipopolysaccharide induction
of the proinflammatory cytokines interleukin-6 and monocyte

chemoattractant protein-1 ......................................................................... 96
Abstract ............................................................................................ 97
Introduction ...................................................................................... 99
Experimental Procedures ............................................................... 102
Results .............................................................................................. 107

vi

Discussion ....................................................................................... 127

References ....................................................................................... 134
Chapter 4
Summary and Future Plans ....................................................................... 138

vii

LIST OF FIGURES

CHAPTER 1
Figure 1 Schematic representation of four trans-activator

proteins of the CIEBP family .......................................................... 2
Figure 2 Model of major hematopoietic differentiation pathways

from hematopoietic stem cells (HSCs) ............................................. 9
Figure 3 Maturation process of neutrophilic granulocytes ........................ 12

Figure 4 Regulation of hematopoiesis by cytokines that stimulate
the proliferation and/or differentiation of various

hematopoietic cells ....................................................................... 14
Figure 5 A simplified model of myeloid and erythroid differentiation

regulated by lineage specific transcription factors .......................... 27
CHAPTER 2

Figure 1 Differential display between control and
ClEBPB—overexpressing cells ................................................ 56

Figure 2 Overexpression of CIEBP isoforms in BZDclone3
induces expression of a differential display RNA species ............ 57

Figure 3 The nucleic acid and the deduced amino acid
sequences of CDDP—1 ........................................................ 59

Figure 4 The approximate 2kb upstream sequence of
CDDP-1 cDNA contains four copies of putative

CIEBP binding sites (boxed regions) ....................................... 61
Figure 5 CDDP—1 RNA is expressed most highly in

adult bone marrow and in fetal liver ....................................... 62
Figure 6 Northern blot of a panel of hematopoietic cell lines ................... 63

Figure 7 Western analysis comparing CDDP-1
antiserum to pre-immune serum ........................................... 65

Figure 8 Western analysis of cytoplasmic (C) and nuclear (N)
fractions from MPRO, B888, U937 (A) and a time
course of U937 neutrophilic differentiation induced
by ATRA for four days (B) ................................................... 66

viii

Figure 9 RNA was isolated from a time course of G-CSF-induced
differentiation of 320 clone 3 cell. A northern blot was
successively hybridized with probes for CDDP-1,
myeloperoxidase (MPO), and glyceraldehyde—3-
phosphate dehydrogenase (GAPDH) ..................................... 68

Figure 10 RNA was isolated from a time course of all trans retinoic
acid (ATRA)-induced differentiation of MPRO cells.
A northern blot was successively hybridized with probes
for CDDP-1, myeloperoxidase (MPO), lactoferrin (LF),
ClEBPe and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) ................................................... 69

Figure 11 RNA was isolated from a time course of all trans retinoic
acid (ATRA)-induced differentiation and PMA—induced
differentiation of HL-60 cells. A northern blot was
successively hybridized with probes for CDDP-1, c-fms,
myeloperoxidase (MPO), ClEBPa, C/EBPB, CIEBPS,
ClEBPs, and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) ................................................... 70

Figure 12 RNA was isolated from a time course of ATRA-induced
differentiation of EML-C1 cells. A northern blot was
successively hybridized with probes for CDDP-1,
myeloperoxidase (MPO), and glyceraldehyde-3-
phosphate dehydrogenase (GAPDH) ..................................... 72

Figure 13 Wright-Giemsa staining of representative CDDP-1
transductants of MPRO cells with either neutrophilic (N)
or monocytic (M) morphology ............................................... 75

Figure 14 RNA was isolated from 4 independent populations of
MPRO cells infected with a CDDP-1 expressing retrovirus.
A northern blot was successively hybridized with probes
for CDDP-1, lactoferrin (LF), myeloperoxidase (MPO),
cathepsin G (CG), and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) ................................................... 76

Figure 15 A western blot using CDDP-1-specific antibody showed
elevated levels of CDDP-1 protein expression in three
independent MPRO transductants of CDDP-1
(MPRO-CDDP-1) in comparison to control transductants
(MPRO-Puro) .................................................................. 77

ix

Figure 16 Wright Giemsa staining of a population of control MPRO
cells and a population of CDDP-1 MPRO transductants
over a time course of differentiation after treatment
with ATRA ........................................................................ 78

Figure 17 RNA was isolated from a population of MPRO cells
infected with a control retrovirus (Pure #10) and a
population infected with a CDDP-1 expressing
retrovirus (CDDP-1 #10). A northern blot was
successively hybridized with probes for CDDP-1,
myeloperoxidase (MPO), and glyceraldehyde-3-
phosphate dehydrogenase (GAPDH) ..................................... 79

Figure 18 RNA was isolated from a time course of EPO-induced
differentiation of EML-C1 cells. A northern blot was
successively hybridized with probed for CDDP-1,
B-globin, and glyceraldehyde-B-phosphate
dehydrogenase (GAPDH) .................................................... 82

Figure 19 RNA was isolated from a time course of DMSO-induced
erythroid differentiation of BB88 cells. A northern blot
was successively hybridized with probes for CDDP-1,
Boglobin, and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) ................................................... 83

Figure 20 RNA was isolated from a time course of lL3-induced
mast cell differentiation of EML—C1 cells. A northern
blot was successively hybridized with probes for
CDDP-1 and glyceraldehyde-3-phosphate dehydrogenase
(GAPDH). WEHl-3 conditioned medium provides a
source for IL-3 .................................................................. 84

Figure 21 Two mRNA species in v-H-ras-transfomied pre-B cell
lines (R1 and R2) can be detected using CDDP-1 probe ........... 86

CHAPTER 3

Figure 1 Structures of the various altered CIEBP isoforms used
in the studies described in this paper .................................. 108

Figure 2 Ectopic expression of CIEBPB and CIEBPB192-276.
(A) EMSA of nuclear extracts of P388-Nee, P388-CB
and P388-Cb192-276 cells. (B) Western analysis of
C/EBPB192-275 (5192-276) compared tO CIEBPB (B) in the
P388 transfectants. (C) EMSA of nuclear extracts of
P388-CB and P388-C8192“; cells in the presence of

unlabeled competing oligonucleotide binding sites .................. 110

Figure 3 Ectopically expressed C/EBPB and CIEBPB192-276
form heterodimers with ClEBPy (lg/EBP). An EMSA
was performed upon nuclear extracts of P388-Neo,
P388-CB and P388-CB1ez-276 cells ........................................ 112

Figure 4 Transfectants of P388 that stably express C/EBPB
(P388-CB) and C/EBPB192-275 (P388-CB192-276) are
stimulated by LPS to produce lL-6 and MCP-1 mRNAs,
while cells that express CIEBPfizGLz (P388-Oped) are
not induced to produce these mRNAs .................................. 114

Figure 5 Ectopic expression of CIEBPB and CIEBPfizGLz.
(A) EMSA of nuclear extracts of P388-Nee, P388-CB
and P388-083a cells. (B) Western analysis of
C/EBPfizGLz (bzGLz) compared to that of CIEBPb ([3)
in the P388 transfectants. (C) EMSA of nuclear
extracts of P388-CB and P388-CbGLz cells in the
presence of unlabeled competing oligonucleotide
binding sites ................................................................... 116

Figure 6 CIEBPB192-276 (8192-276) and LIP, although lacking
activation domains, can activate the lL-6 promoter in
transient transfections of P388 cells ..................................... 118

Figure 7 C/EBPB and ClEBPfi192Q76 ([3192-276) fail tO activate
the lL-6 promoter-reporter in the absence of a functional
NF-kB binding site ........................................................... 120

Figure 8 CIEBP6131-272 (6181-272), although lacking an activation
domain, can support the LPS induced activation of the
lL-6 promoter in transient transfections of P388 cells .............. 122

Figure 9 CIEBPy (lg/EBP) is mildly inhibitory to CIEBPB192-276
activity on the lL-6 promoter-reporter ................................... 123

Figure 10 CIEBPB192.276 (8192-276) and UP fail to activate an

albumin DEI site-reporter in transient transfections
of P388 cells with and without LPS stimulation ..................... 124

xi

Chapter 1: Literature review

Introduction

CCAAT/enhancer binding proteins (C/EBPs) comprise a family of
sequence-specific DNA-binding proteins that are critical in the regulation of
various aspects of cellular differentiation and function in multiple tissues
(reviewed by Williams and Johnson 1994). To date, six different C/EBP isoforms
have been isolated and characterized, designated C/EBPa, C/EBPB, C/EBPS,
C/EBPy, C/EBPs, and C/EBPC.

All of the CIEBP family members share a highly conserved basic region
and leucine zipper domain at the carboxyl terminus whereas the amino terminal
transactivation domains are more diverse (Fig. 1). The basic region is located
immediately to the N-terrninal side of the zipper. It is highly positively charged
and responsible for DNA binding. C/EBPs bind DNA as dimers. Dimerization is
required for DNA binding (Landschulz et al., 1989). The sequence recognition
properties of C/EBPs are identical in vitro. They can recognize the same
consensus sequence on the target promoter and form either homodimers or
heterodimers between family members through the leucine zipper region (Vinson
et al., 1993). The transactivation domain is responsible for interacting with
proteins of other transcription factor families as well as the basal transcription
apparatus. However, the unique and sometimes redundant function of each

family member is determined by its tissue- and stage- specific expression,

.>__E£ mmmB 05 Lo 2:905 8558-29. So.— Lo 5585369 258028 e 939“.

 

 

 

moocosuom 86.9 >291 \\\\

 

 

$05338 .8352

 

 

 

 

wmmma

 

 

 

mam \\\\\\\\\ \\\\x
8m §x \i
RN \\\\\\\\ \\\\\k \\\\%is.....:. $86

 

 

 

 

mamma

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Sm \\ \\ Emma
(lull {

.39.». 26:3 coaom o_mmm

 

 

alternative ribosomal reading, post-transcriptional modifications, and differential
abilities to interact with other DNA binding proteins on a given promoter. Here, I
will review the characteristics of all the CIEBP isoforms with emphasis on their

roles in myeloid differentiation.

1.1 Overview of CIEBP isoforms
1.1.1 CIEBPa

C/EBPor is the founding member of the C/EBP family. It was first identified
by Steven McKnight's group in 1986 from adult rat liver in a search for cellular
DNA-binding factors that can reCognize viral gene regulatory sequences, such as
the CCAAT box and "enhancer core" elements of retroviral LTRs, thus named
' CCAAT/Enhancer Binding Protein (CIEBP) (Graves et al., 1986; Johnson et al., -
1987; Landschulz et al., 1988). C/EBPa is highly expressed in liver and adipose
tissue where it transactivates hepatocyte and adipocyte specific gene
expression, such as albumin, 422/aP2 (Christy et al., 1989), PEPCK (Park et al.,
1990). It functions in fully differentiated non-proliferative cells and regulates
adipogenesis. Overexpression of C/EBPoz in immature adipocytes induces
differentiation whereas anti-sense to C/EBPa mRNA blocks adipocyte
differentiation (Freytag and Geddes, 1992; Lin and Lane, 1992). As will be
discussed later, C/EBPa also plays a critical role in myelopoiesis (Zhang et al.,
1997; Radomska et al., 1998).

C/EBPa can undergo autoregulation. The murine C/EBPa promoter

contains a functional C/EBP binding site that can be transactivated by C/EBPa

(Christy et al., 1991). Two isoforms of C/EBPoc can be generated from its mRNA
by a ribosomal scanning mechanism. One is a 42 kd full-length protein which
contains three transactivation domains (Nerlov and Ziff 1994; Nerlov and Ziff
1995). The other one is a 30 kd truncated protein which retains its dimerization
and DNA-binding domains (Lin et al., 1993; Ossipow et al., 1993). Two activation
domains (ADI and ADII) have been identified in the N-terminal region of C/EBPa
that are required for transcriptional activation of the serum albumin gene

(Friedman and McKnight, 1990).

1.1.2 CIEBPB

C/EBPB, also known as NF-IL6, CRP2, LAP, AGP/EBP, lL-BDBP, and NF-
M 'in chicken, is an important mediator of the inflammatory response.
Lipopolysaccharide (LPS), Interleukin 6 (IL-6), Interleukin 1 (IL-1),
dexamethasone, glucagon, and some other stimuli can strongly induce C/EBPB
expression. C/EBPB was originally identified as a nuclear factor that binds to the
IL-1 response element of the human lL-6 gene (lsshiki et al., 1990; Akira et al.,
1990). It can bind to lL-6-responsive elements in the promoters of several acute
phase response genes including those encoding lL-8, TNF, and G-CSF. TNFoc
can facilitate nuclear localization of C/EBPB and C/EBP6 in response to
inflammatory stress (Yin et al., 1996). Cytokine stimulation can further increase
C/EBPB transcriptional activity by enhanced DNA binding (Poli et al., 1990). The
activation of the MAP kinase (Tramley-Stein et al., 1996), protein kinase A and

protein kinase C (Trautwein et al., 1994), and calcium-dependent signal

transduction pathways (Wegner et al., 1992) appears to activate transcription
through the post-translational phosphorylation of C/EBPB. Most recently, Buck et
al showed that phosphorylation of rat serine 105 or mouse threonine 217 in
C/EBPB is required for hepatocyte proliferation induced by TGFa (Buck et al.,
1999)

C/EBPB also has two isoforms due to leaky ribosomal scanning. The
longer form called LAP and the shorter form termed LIP. LIP initiates at Met 132
and lacks activation domains and has been shown to be a transdominant
negative inhibitor of C/EBPB mediated transcriptional activity (Descombes and
Schibler, 1991). However, our own experiments show that LIP can also confer
LPS-induced lL-6 and MCP-1 expression to a lymphoblastoma cell line p388D1.
This indicates that the leucine zipper regionof C/EBPB may have some other
functions -in addition to dimerization (See Chapter 3 for more detail).. In at least
some instances, LIP may be a product of certain lysis procedures (Baer et al.,
1998) rather than the aforementioned mechanisms. Thus, the physiological

significance of LIP is unclear.

1.1.3 CIEBPy
C/EBPy, also known as lg/EBP, is a short intronless gene which encodes
a 16.4 kd protein. It was first discovered by Calame’s group in a search for
transcription factors from B lymphocytes that bind to a cis-regulatory site in the
immunoglobulin heavy chain enhancer (Roman et al., 1990). Its mRNA is

ubiquitously expressed and C/EBPy protein functions as a dominant negative

inhibitor of C/EBP family transactivators (Cooper et al., 1995). C/EBPy contains
only a leucine zipper dimerization domain and DNA binding region but no
transactivation domain. Although C/EBPy can heterodimerize with CIEBP family

members, it attenuates rather than activates target gene expression.

1.1.4 CIEBP8

C/EBPS is also known as CRP3 and NF-ILGB. Low amounts of C/EBPS
mRNA can be detected in mouse tissues under normal conditions. However, high
level expression occurs in many organs following stimulation by LPS or
inflammatory cytokines, such as lL-6 (Alam et al., 1992; Kinoshita et al., 1992;
Ramji et al., 1993). The transactivating ability of C/EBP5 is comparable to that of
C/EBPor and C/EBPB. It can also confer LPS-induced expression of- IL-6 and
MOP-1 when ectopically expressed in a lymphoblastic cell line P388D1,
suggesting functional redundancy with C/EBPB in regulating inflammatory
cytokines (Hu et al., 1998). The DNA binding affinity of C/EBP6 is somehow

diminished compared to other C/EBP isoforms (Cao et al., 1991 ).

1.1.5 CIEBPi;

C/EBPC, also known as CHOP and Gadd153, is another dominant
negative inhibitor of the C/EBP family. It was originally cloned in hamster and
named growth arrest and DNA damage-inducible gene (Gadd153) (Fomace et
al., 1989). It is also induced as a result of glucose deprivation in differentiating

adipocytes. C/EBPC can form heterodimers with the other members of the C/EBP

family. However, the presence of two prolines in the DNA-binding region disrupts
its helical structure and prevents the binding of C/EBPC-containing heterodimers
to classic C/EBP binding sites (Ron and Habener, 1992). A subsequent study
showed that CHOP-C/EBP dimer can actually bind to some other specific DNA
sequences and CHOP possesses a transcriptional activity which is inducible by
cellular stress (Ubeda, et al., 1996). Also of note is that CHOP can specifically
block C/EBPoc activity and induce increased apoptosis of myeloid 320 cells

(Friedman, 1996).

1.1.6 CIEBPe

C/EBPs is the human homologue of rat CRP1 (Williams et al., 1991). The
full-length cDNAofC/EBPe has (only been isolated recently. It isexpressed. .
exclusively in hematopoietic lineages (Antonson et al., 1996; Chumakov et al., -.
1997; Williams et al., 1998). The human C/EBPe gene is transcribed from two
alternative promoters. Four C/EBPs mRNA isoforms have been identified due to
alternative splicing and differential use of promoters. They encode four proteins
of 32, 30, 27, and 14 kDa (Yamanaka et al., 1997). The 32 kDa protein is an
activator of transcription of granulocyte colony stimulating factor receptor (GCSF-
R), while the 14 kDa protein is not. The transcriptional activation function of
C/EBPe is mediated through a bipartite activation domain located in the N
terminus with a minimal requirement of the first 18 amino acid residues. The
highest activity of transcription was conferred by the amino acid residues 1-77

(Williamson et al., 1998). An intrinsic repression domain was also identified

between amino acid 116 and 162. A form of C/EBPs in which this region is
deleted can enhance gene transcription from a neutrophil elastase promoter-
luciferase reporter. Thus, C/EBPe may regulate gene expression by utilizing both

transcriptional activation and repression depending upon its associated factors.

1.2 HEMATOPOIESIS

The main question that will be addressed in this thesis is: what are the
roles of C/EBP family of transcription factors in the regulation of hematopoiesis,
especially myelopoiesis? Hematopoiesis is the process by which blood cells
acquire a defining phenotype as a result of coordinated, cell specific gene
expression. During this process, pluripotent hematopoietic stem cells undergo a
series . of progressive restriction of lineage potential, and acquire the
characteristics of mature, terminally differentiated cells. In 1961, Till and
McCulloch first demonstrated the existence of pluripotent hematopoietic stem
cells (HSCs) that had the property, at the single cell level, of (i) self-renewal as
well as (ii) multilineage differentiation (Till and McCulloch, 1961). Then in the
19805, Irving Weissman's group first identified and isolated HSCs by cell sorting
using monoclonal antibodies against cell surface markers (Muller-Sieburg et al.,
1986; Spangrude et al., 1988). A subset of this stem cell population perpetually
self renews, and these cells are long term stem cells (LT-HSCs). In mice, LT-
HSCs give rise to short-term HSCs (ST-HSCs), which give rise to multipotent
progenitors (MPPs), whose further progeny are oligolineage-restricted

(Weissman, 2000). HSCs give rise alternatively to the clonal common

.mommoc: $59550 ucm ogoobmxmmcE
2 mm: 93 moms. $9sz .3985. 9.5055 new 250.335 25 oumzcocmtfi $.20 .Ammms: Begcoooa
o§ooEEQo§oobmxmmoE cam Ammzwv Eogcomoa 03858338556 2 cm: can mn=20 .8305. :8 5:3 .939.
new :8 m .__co ._. 2 cm: 96 950 .AmaEOV Boxcomoa 229:: 3868 new $38 flozcomoa 293:5. c0888
25 2220 cont—d mam—2 Ammo—2v ESEomoa 2.38-335 2 cm: 020 2033 .89.. E9 team 2 cm: 95 wow:
.59 98.. .609: m=oo Scum 03980682 ES.— m>m>>£ma cozmzcocetfi ergonofiEoc BEE Co .322 .N 939...

msoozecmal/ \.4/

ogoobmxmmo_2\ /.
oSooScEOA/a \.>\

c§ooco_2\ 0w:

9 gig

9/ \
__....|0 l8
9.\

 

:8... All!

lymphocyte progenitor (CLP), or the clonogenic common myeloid progenitor
(CMP). CLPs are restricted to give rise to T lymphocytes, B lymphocytes, and
natural killer (NK) cells. CMPs are progenitors for the myeloerythroid lineages.
Single CMPs give rise to myelomonocytic progenitors (GMPs) and
megakaryotic/erythoid progenitors (MEPs) (Akashi et al., 2000). All of these
populations are separable as pure populations using cell surface markers (Fig.

2).

1.2.1 Overview of myelomonocytic development

In the case of myeloid differentiation, the terminal stages include
granulocytes (neutrophils, eosinophils, and basophils), monocytes/macrophages,
as well as erythrocytes and megakaryocytes. The main focus of my research has
been placed on the development of myelomonocytic lineages that eventually give
rise to neutrophils and monocytes/macrophages, both of which play crucial roles
in host defense against bacterial infections. Interruption of their normal
developmental process may also cause myelogenous leukemia.

Bone marrow is the major site of de novo myelopoiesis. Cells of the
monocytes/macrophage series and neutrophilic granulocytes are derived from a
common progenitor cell, namely the colony-forming unit granulocyte-macrophage
(CPU-GM). The development of neutrophlic granulocytes proceeds through a
series of intermediate stages. Morphologically recognizable myeloid precursor
cells can only be found in the bone marrow under steady-state conditions. They

include myeloblasts, promyelocytes and myelocytes which are all still capable of

IO

cell division. Cells that mature beyond the myelocyte stage no longer have the
capacity of cell division. These include metamyelocytes, band forms, and mature
neutrophils. Each of these developmental stages has a distinctive morphology
with the most striking morphological features of mature neutrophils being
multilobed nuclei, an abundance of cytoplasmic granules, prominent deposits of
particulate glycogen, and the paucity of other cytoplasmic organelles (Fig. 3). In
addition to morphological features, each stage can also express a distinct set of
molecular markers. For example, the promyelocyte stage of granulocyte
development extends from the initiation of primary (azurophil) granule formation
to its completion. The major components of the primary granules include acid
hydrolases (B-glucuronidase, B-galactosidase), neutral proteases (cathepsin G,
elastase, collagenase), cationic proteins, myeloperoxidase, and some
lysozymes. The myelocyte stage extends from the initiation of secondary
(specific) granule formation to its completion. The secondary granule contains
lysozyme, lactoferrin, and in some species, alkaline phosphatase. The most
commonly used molecular markers for granulocytic differentiation are
myeloperoxidase and neutrophil elastase of primary granules for classification of
promyelocytes and lactoferrin of secondary granules for classification of
myelocytes.

The development of the monocytic lineage involves three different stages:
monoblast, promonocyte, and monocyte. The monocytes migrate from circulatory
system to various tissues and become tissue macrophages. Several genes

primarily expressed in macrophages have been used as markers for the

II

Marrow development, 14 days

     
 

‘1. ‘ ——->
L97 $-

myeloblast promyelocyte
" mitotic (7.5 days)

  
      

H—v

Q band cell
mature pmn

BLOOD (transit, T1/2 6hrs)
- —: TISSUE (function, ~1-2 days)

 

Figure 3. Maturation process of neutrophilic granulocyte.

12

classification of this lineage. These include M-CSF receptor (c-fms), macrophage
scavenger receptor (MSR), LPS receptor (CD14), monocyte specific esterase,
and macrophage metalloelastase (Reviewed in Clarke and Gordon).

Several myeloid specific cell lines have been established, representing
different stages of myeloid development. 320cl3 is a murine myeloblastic cell
line. Its growth depends on interleukin-3 and can be induced to differentiate into
mature neutrophils by treatment with G-CSF (Valtieri et al., 1987). MPRO is a
murine promyelocytic cell line that grows in the presence of GM-CSF. Treatment
with high concentration of all-trans retinoic acid (ATRA) can induce its terminal
differentiation into neutrophils (Tsai et al, 1993). HL-60 is a human bipotential
promyelocytic leukemia cell line that can differentiate into either neutrophils or
monocytes/macrophages following treatment by ATRA or TPA, respectively
(Collins et al, 1987). U937 and M1 are promonocytic cell lines that can be
induced to differentiate into monocytes/macrophages by treatment with TPA or

IL-6, respectively (Sundstrom and Nilsson, 1976).

1.2.2 Hematopoietic growth factors in hematopoiesis
Hematopoietic growth factors play important roles at different stages of
development (Fig. 4). The cytokines interleukin 3 (IL-3), interleukin 6 (IL-6) and
stem cell factor (SCF) have been shown to act on stem cells and multipotential
progenitors (reviewed in Watowich et al., 1996). IL-3 has the broadest specificity
of any known cytokines, as it stimulates survival, proliferation and differentiation

of hematopoietic stem cells (H803) and progenitor cells of all known

13

 

Erythroid progenitor REC

Figure 4. Regulation of hematopoiesis by cytokines that stimulate the proliferation
and/or differentiation of various hematopoietic cells.

hematopoietic lineages (reviewed in Schrader, 1994). However, targeted
disruption of lL-3 or its receptor revealed that IL-3 is not required for steady-state
hematopoiesis, but is needed for proliferation of mast cells during parasitic
infections (Nishinakamura et al., 1996; Lantz et al., 1998). SCF probably
provides the missing lL-3 activity in these knock-out mice. lL-6 stimulates
survival, proliferation and differentiation of H803 and at high concentrations can
induce proliferation of committed granulocytic progenitors (reviewed in Kishimoto,
1989; Liu et al., 1996). Targeted mutation of lL-6 causes selective reduction in
granulocytic progenitors (Liu et al., 1997). SCF promotes survival, proliferation
and differentiation of stem cells and progenitors of multiple lineages (reviewed in
Lyman and Jacobsen, 1998).

Within the myeloid lineages, granulocyte-macrophage colony stimulating
factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), and
macrophage colony stimulating factor (M-CSF) represent a set of myeloid
specific cytokines that are important for the development of granulocytes and
macrophages (reviewed in Metcalf, 1995). GM-CSF stimulates the survival,
proliferation and differentiation of bipotential granulocyte-macrophage
progenitors as well as unipotent macrophage or granulocyte progenitors.
However, targeted disruption of GM-CSF or its receptor does not disrupt
hematopoiesis in vivo (Dranoff et al., 1994; Stanley et al., 1994; Nishinakamura
et al., 1995) suggesting functional redundancy with other growth factors of similar
function. G-CSF stimulates survival, proliferation and maturation of granulocytic

progenitors (Suda et al., 1987). Targeted mutation of G-CSF or its receptors

15

causes a selective and profound reduction in the number of circulating
granulocytes in mice (Lieshke et al., 1994; Liu et al., 1996). M-CSF stimulates
survival, proliferation and maturation of committed monocytic progenitors
(Stanley, 1985). It is required for development of macrophages and monocyte-
derived lineages such as osteoclasts. Targeted mutation of M-CSF gene results
in greatly reduced numbers of tissue macrophages, as well as osteopetrosis
(Yoshida et al., 1990). Similarly, erythropoietin (EPO) and EPO receptor are
crucial for erythropoieisis (reviewed in Adamson 1988), whereas thrombopoietin
(T PO) is important for megakaryocytic development (Murone et al., 1998).
Currently, there are two models for lineage commitment and
hematopoietic differentiation. The first model is the “instructive model”, which
proposes that lineage commitment is regulated by external signals such as
hematopoietic growth factor and/or progenitor-stromal cell interactions. The
second one is the “stochastic model” which proposes that the fate of lineage
commitment is intrinsically determined; growth factors can only expand already
committed cell types but do not bias the cells toward a specific lineage. A third
one that combines the first two models has also been proposed. Whichever of
these models is correct, undoubtedly, transcription factors are likely to play

pivotal roles in specifying lineage commitment and differentiation.

1.3 Transcription factors in hematopoiesis and leukemia

Hematopoiesis is a highly regulated process in which the growth and

differentiation of pluripotent hematopoietic stem cells into specific cell lineages

I6

are controlled by the coordinated regulation of gene expression. The genetic
switches which control blood cell development are obvious sites of malfunction in
the formation of leukemia. Transcription factors make up many, if not most, of
these genetic switches. Abnormality in either the abundance or activity of these
factors can result in inappropriate expression of genes critical to the process of
growth and differentiation. The characterization of these transcription factors is of
great significance in the study of leukemia.

Several important questions need to be addressed when studying
transcriptional regulation of hematopoiesis: How is gene expression restricted in
certain lineages? What controls the temporal expression of lineage-specific
genes? Why does a common progenitor cell differentiate into one cell type but
not another? The answers to all of these questions involve transcription factors.
Several transcription factor families have been found to be involved in
hematopoiesis. Those that are thought to be important in myelopoiesis include
the C/EBP family, the GATA family, the PU-1 family, Egr—1, retinoic acid
receptors (RARs), myeloid zinc finger factor (MZF-1), AML-1, and Myb. Since the
question that interests us most is the role of the C/EBP family of transcription
factors in myelomonocytic differentiation which gives rise to monocytes and
neutrophils, emphasis will be placed on reviewing how C/EBPs specify myeloid

lineage and regulate terminal differentiation.

I7

1.3.1 CIEBPs in myelopoiesis

Early experiments performed by Alan Friedman's group showed the
temporal expression of different C/EBP isoforms during granulocytic
differentiation of 320 clone 3 myeloblast cells (Scott et al., 1992). In this study,
C/EBPa was highly expressed in proliferating myelomonocytic cells upon
induction of differentiation and down regulated with maturation. In contrast,
C/EBPB and C/EBP6 were upregulated upon differentiation. However, a recent
study showed that C/EBPa mRNA was maintained during granulocytic
differentiation, but markedly down-regulated with monocytic or erythroid
differentiation (Radomska et al., 1998). These patterns of expression suggest
that different CIEBP isoforms may play a distinct role during myelomonocytic
differentiation.

Several lines of evidence suggest that C/EBPB is an important regulator
for the activation and/or terminal differentiation of macrophages. C/EBPB
expression is dramatically induced during macrophage differentiation (Natsuka et
al., 1992; Scott et al., 1992). Several genes commonly expressed by activated
macrophages contain functional CIEBP binding sites in their promoter regions,
such as lL-6, IL-1a, lL-8, TNFa, G-CSF, NO synthase, and lysozyme genes
(Natsuka et al., 1992; Zhang and Rom, 1993; Mukaida et al., 1990; Lowenstein
et al., 1993, Pope et al., 1994). Previous studies by our lab have shown that
ectopic expression of C/EBPB, as well as C/EBPoc and C/EBPS, in a Iymphoblast
cell line P38801, which has no endogenous C/EBP expression, can result in

LPS-induced expression of lL-6 and MCP-1 (Macrophage Chemoattractant

18

Protein 1) (Bretz et al., 1994; Hu et al., 1998). Chicken C/EBPB was shown to
cooperate with Myb to induce transcription of the myeloid-specific mim-1 gene in
heterologous cell types. (Ness et al., 1993). Most recently, it was found that the
N-terminus of the full-length C/EBPB isoforrn, which is essential for induction of
the mim-1 gene in chromatin, interacts specifically with the SWl/SNF complex to
activate myeloid genes (Kowentz-Leutz et al. 1999). Overexpression of chicken
C/EBPB in multi-potential myeloid progenitor cells promotes eosinophil as well as
myeloid differentiation (Muller et al., 1995; Nerlov et al., 1998). More evidence
has come from murine knock-out analyses. The C/EBPB-deficient mice showed
defective bacterial killing and tumor cytotoxicity by macrophages, as well as
lymphoproliferative disorders (Tanaka et al., 1995; Screpanti et al., 1995). Bone
marrow B cell expansion was impaired, and stromal cell lL-7 mRNA expression
was decreased (Chen et al., 1997). However, myelopoiesis was not adversely
affected. Taken together, the data suggest that C/EBPB is essential for mature
macrophage function but less important for the differentiation of various
hematopoietic lineages including granulocytes.

On the other hand, C/EBPa has been shown to be a myeloid specific
switch toward granulocyte differentiation. First, several myeloid specific genes
have CIEBP binding sites in their promoter and can be transactivated by
C/EBPor in transient transfection studies. These include myeloperoxidase (MPO)
and neutrophil elastase (NE) (Ford et al., 1996; Oelgeschlager et al., 1996).
Secondly, several important hematopoietic growth factor receptors, such as

granulocyte colony stimulating factor (G-CSF) receptor, macrophage colony

l9

stimulating factor (M-CSF) receptor, and GM-CSF receptor are regulated by
C/EBPa, in conjunction with other hematopoietic specific transcription factors
such as PU.1 (Hohaus et al., 1995; Smith et al., 1996). Most importantly,
overexpression of C/EBPa in bipotential promyelocytic cell lines (U937 and
HL60) can promote neutrophilic differentiation and inhibit monocytic
differentiation (Radomska et al., 1998). Even more compelling evidence for the
critical role of C/EBPa in neutrophilic differentiation came from targeted
disruption experiments. C/EBPa knock-out mice display a complete lack of
mature neutrophils in both embryonic and newborn mice. This is due, in part, to
the absence of G-CSF signaling because of a significant reduction in G-CSF
receptor mRNA expression (Zhang et al., 1997). More recently, it was found that
the lL-6 receptor mRNA expression was also greatly reduced in the C/EBPa
deficient mice (Zhang et al., 1998). The G-CSF and lL-6 receptors are clearly
major target genes of C/EBPa. All the above evidence has established that
C/EBPa is a key regulator of granulocyte differentiation.

Recently, accumulating evidence has suggested that the newly cloned
CIEBP family member, C/EBPs, is essential for terminal differentiation and
functional maturation of already committed granulocyte progenitor cells. First of
all, C/EBPe is preferentially expressed in myeloid lineages. It is upregulated
during neutrophil differentiation and downregulated upon monocytic
differentiation (Chin et al., 1997; Morosetti et al., 1997). C/EBPe significantly
upregulates mim-1 and human myeloperoxidase (MPO) promoters (Chumakov et

al., 1997). It directly interacts with the DNA binding domain of c-myb and

20

cooperatively activates transcription from myeloid promoters including those of
mim-1, neutrophil elastase (NE), and GCSF receptor (Verbeek et al., 1999).
C/EBPe is also involved in the positive regulation of lactoferrin gene expression
in neutrophils (Verbeek et al., 1999). Specific disruption of the C/EBPs gene in
mice prevented the maturation of neutrophils in blood (Yamanaka et al., 1997).
The fact that C/EBPe is also a putative retinoic acid target gene suggests that
C/EBPe is a downstream effector of RA-induced granulocytic differentiation of
acute promyelocytic leukemia (APL) cells (Park et al., 1999). Consistent with the
above described data, overexpression of C/EBPe in immature myeloid U937 cells
can induce neutrophilic differentiation (Park et al., 1999). C/EBPs is another
important regulator of granulopoiesis and probably acts downstream of C/EBPa
because C/EBPa-deficient animals accumulate cells of a less mature phenotype

than C/EBPs—deficient animals (Yamanaka et al., 1997).

1.3.2 Other important transcription factors that play a role in myelopoiesis
Egr-1 can induce monocytic differentiation: Another transcription factor with an
important role in myelomonocytic differentiation is the early response gene Egr-1.
Egr-1 was cloned as an early response gene during TPA treatment of human
myeloid cell lines and was noted to be up-regulated during monocytic but not
granulocytic differentiation of these bipotential lines (Nguyen et al., 1993). The
Egr-1 gene was found to be transcriptionally silent in HL-60, but active in U-937

and M1 cells. The latter two cell lines preferentially differentiate toward the

21

monocyte/macrophage lineages. Overexpression and anti-sense studies
implicated Egr-1 as an inducer of monocytic differentiation.

Egr—1 can block granulocytic differentiation of HL-60 cells, restricting
differentiation to the monocytic lineage (Nguyen et al., 1993). It can also block G-
CSF induced differentiation of lL-3-dependent 3ZDcl3 hematopoietic precursor
cells, endowing the cells with the ability to be induced by GM-CSF for terminal
differentiation along the macrophage lineage (Krishnaraju et al., 1995). Ectopic
expression of Egr-1 in the M1 myeloblastic leukemic cell line resulted in
activation of the macrophage differentiation program in the absence of a
differentiation inducer (Krishnaraju et al., 1998). The observed function of Egr—1
as a positive modulator of monocyte/macrophage differentiation varies,
depending on the state of lineage commitment for differentiation of the
hematopoietic cell type being examined. Surprisingly, targeted-disruption of Egr-
1 in mice showed no abnormalities of monocytic differentiation or function (Lee et
al., 1996). In this mouse model, it is possible that other members of the Egr-l

family can compensate for loss of the Egr—1 gene.

RA Ha in Myeloid Differentiation and Acute Promyelocytic Leukemia (APL):
Retinoic acid receptor (RAR) has long been known as a key regulator of myeloid
differentiation (reviewed in Lawson and Berliner, 1999). In early 19803, Breitman
et al (1980) showed that all-trans retinoic acid (ATRA) can induce granulocytic
differentiation of the HL-60 cell line which was derived from a patient with acute

promyelocytic leukemia (APL) and of primary leukemia cells. Retinoic acid (RA)

22

exerts its function through RARs that belong to the nuclear receptor superfamily
of transcription factors. RARs control specific gene expression in a ligand
dependent manner. Three APL associated rearrangements of RARa genes have
been identified: t(15:17) results in a fusion protein PML-RARoz (Kakizuka et al.,
1991), t(11:17) results in PLZF-RARa (Chen et al., 1993) and t(5:17) results in
NPM-RARa (Redner et al., 1996). Both experimental and clinical data indicate
that RARa function is required for the myeloid differentiation process. When a
dominant negative RARa was introduced into mouse bone marrow cells and
cultured in stem cell factor and lL-3, hematopoietic differentiation was blocked at
the hematopoietic stem cell stage. The resultant cell line EML can be induced to
differentiate into erythroid, myeloid and lymphoid lineages depending upon the
exposure 'to Various cytokines and ATRA (Tsai et al., 1994). Treatment with
supra-normal levels of ATRA and lL-3 with stem cell factor leads to the
development of GM-CFU. When further treated with GM-CSF, EML evolves into
promyelocytic cells as represented by the cell line called EPRO whose growth is
GM-CSF dependent. A second ATRA-dependent step in myelopoiesis blocks
EPRO differentiation at the promyelocyte stage. Treatment with supra-
physiological concentrations of ATRA can fully induce neutrophilic differentiation
of EPRO producing polymorphonuclear and “band form” cells (Tsai et al. 1994).
The RARs bind to RA response elements (RAREs) within the promoter of
target genes as heterdimers with RXRs to mediate the RA response. In the
absence of ligand, RAR and RXR can bind to RAREs but repress transcription

from target genes. In this unliganded state, RARzRXR is associated with co-

23

repressors (SMRT or N-CoR), which serve to recruit histone deacetylase-1
(HDAC-1) into a ternary complex with RAR and RXR. HDAC-1 can deacetylate
histones providing a closed chromatin structure not accessible to the basal

transcription apparatus, thus inhibiting transcription (Nagy et al., 1997).

1 .3.3 Cross-talk between transcription factors determines lineage

Although individual transcription factors have been shown to be crucial for
lineage commitment, myelopoiesis is a more complicated process that is
orchestrated by multiple regulator proteins. The cross-talk between transcription
factors is very important for lineage determination and the regulation of lineage
specific genes by means of either synergism or antagonism. For example, c-Myb
and chicken C/EBPB can combinatorially activate the myeloid specific mim-1
gene. AML-1 is a transcription factor and one of the most frequent targets of
chromosomal translocation in acute myeloblastic leukemia. The resultant fusion
protein AML-1-ETO can inhibit C/EBPa-dependent activation of the myeloid cell
specific rat defensin NP-3 promoter (Westendorf et al., 1998). Since C/EBPa is
important for differentiation, AML-1-ETO may generally block differentiation
through its antagonism of C/EBPor, and thus may contribute to Ieukemogenesis.
PU.1 controls both cytokine-dependent proliferation and differentiation of
granulocyte/macrophage progenitors (Dekoter et al., 1998). Knock-out studies
demonstrated that PU.1 is required for the development of both the myeloid
(granulocyte, macrophage) and lymphoid (B, T) lineages (Scott et al, 1995). PU.1

can physically interact with C/EBPoc and synergistically activate expression of

24

myeloid growth factor receptors such as G-CSF, M-CSF and GM-CSF receptors
(Hohaus et al., 1995; Smith et al., 1996; Zhang et al., 1994). PU.1 can also
antagonize GATA-1 in mast cell lineage determination (Singh, personal
communication).

The GATA family of transcription factors has been shown to be important
for erythroid differentiation. However, in myeloid cells, GATA-1 is not expressed
at significant levels, and both GATA-1 and GATA-2 are downregulated during
myeloid differentiation. In contrast to monocytic and neutrophilic cells, high levels
of GATA-1 are detected in eosinophils. It appears that GATA proteins do not play
an important positive role in myelomonocyte development, however, their
downregulation may be critical. Consistent with this, activation of GATA-1
represses myelomonocytic gene expression (Kulessa et al., 1995). Since.
eosinophils derived either from myelomonocytic cells or from MEP (a chicken
myleloid progenitor celll line) cells showed concomitant expression of c-Myb, in
addition to NF-M (chicken C/EBPB) and GATA-1, while myelomonocytic cells
lack GATA-1 (Kulessa et al.,1995), it is speculated that the balance between
these three transcription factors plays a pivotal role in lineage determination
(Muller et al., 1995). The lineage commitment of MEP cells (and possible also of
normal progenitor cells) is influenced by the presence or absence of NF-M and
GATA-1 on a background of Myb expression. If GATA-1 is expressed in the
absence of NF-M, progenitors can differentiate into the thrombocytic and

erythroid lineage. However, when NF-M is expressed in the absence of GATA-1,

25

myelomonocytic differentiation is favored. Furthermore, the combination of both
GATA-1 and NF-M would allow eosinophilic differentiation.

The relative expression levels of an individual transcription factor may add
another level of regulation for lineage determination. One example is PU.1.
Induction of PU.1 gene expression may induce macrophage differentiation since
PU.1 is expressed at significantly higher levels in the monocytic versus 8 lineage
(Singh and Glimcher, 1999). Graded levels of PU.1 expression may participate in
cell fate decisions with high levels favoring macrophage development,
intermediate levels favoring B cell development, and an absence of PU.1

favoring T cell development.

1.3.4 A model .for myelopoiesis

' Given 2 all of the above data, a simplified model of induction of
hematopoietic differentiation by specific transcription factors has been proposed
(Daniel Tenen et al., 1997). In this model, some yet unidentified signaling events
upregulate specific transcription factors in the hematopoietic stem cells. These
transcription factors undergo autoregulation and upregulate lineage specific
growth factor receptors, such as PU.1 for M-CSF receptor, GATA-1 for EPO
receptor, and C/EBPa for G-CSF receptor. Lineage specific growth factors then

in turn lead to further maturation of corresponding lineages (figure 5).

26

8808 53.85: 050on canoe: >9 35.3mm. cozmzcocotfi 29ch new .2202: Lo .39: 3539:» < .m 059“.

a A 0am
8&2er
”50-5. 250:9:

No I
m ”E95. Q .8585
223::

      

.8585
29555

 

 

 

 

we
:00 a 69$
awash. m $0-20

 

 

”50.0

m Emotw

 

 

27

1.3.5 CIEBPs in erythroid and lymphoid lineages

CIEBP family members have also been implicated in the differentiation of
the erythroid and B cell lineages. Erythropoietin upregulates expression of
CHOP, a C/EBP family member that acts as a dominant negative regulator of
other C/EBP family members (Coutts et al., 1999). Overexpression of CHOP in
Rauscher cells enhanced erythropoietin and DMSO-induced differentiation, while
inhibition of CHOP expression reduced CFU-E formation. In C/EBPor deficient
mice, the erythropoietin receptor was upregulated, albeit erythroid differentiation
was not adversely affected (Zhang et al., 1997). CIEBPB is also upregulated in
the course of erythroid differentiation.

Mice deficient in C/EBPB expression are impaired in their generation of
bone marrow B lymphocytes (Chen et al., 1997). These mice show decreased
expression of lL-7 by bone marrow stromal cells as well as defective lL-7~
signaling. C/EBPB has also been shown to be a component of a DNA binding
complex that activates the ld1 gene, a negative regulator of differentiation in pro-
B cells (Saisanit et al., 1997). This suggests that C/EBPB participates in blocking
differentiation and promoting proliferation at the pro-B cell stage, but promotes

differentiation through the lL-7 pathway at later stages of differentiation.

1.4 OBJECTIVES
Given the fact that the C/EBP family of transcription factors are important
regulators of myelomonocytic differentiation, one legitimate question that many

investigators in the field are trying to answer is:"What are the target genes of

28

C/EBPs that are involved in this differentiation process?". Over the past several
years, numerous genes have been shown to be regulated by C/EBPs. Among
myeloid lineages, the most noteworthy ones were the genes encoding the G-CSF
and lL-6 receptors which are regulated by C/EBPa. However, unlike C/EBPa
knock-out mice, both G-CSF receptor and lL-6 receptor knock-out mice, and
even the double knock-out of both receptor genes, can still generate mature
granulocytes, although the number is much reduced (Zhang et al., 1998). This
leads to the hypothesis that some other genes regulated by C/EBPa that play a
role in myelopoiesis remain to be identified. The objective of my research is to
identify target genes regulated by C/EBPs in the course of myeloid differentiation.
By doing this, we can gain a better understanding of the role of the C/EBP family
of transcription factors in normal myeloid development, as well as in acute
myelogenous leukemia in which a block in differentiation of myeloid precursors is

a key feature of the disease.

29

References

Adamson, J. W. 1988. Erythropoietin: in vitro and in vivo studies of the regulation
of erythropoiesis. Soc Gen Physiol Ser. 43: 57-65.

Akashi, K., D. Traver, T. Miyamoto, and l. L. Weissman. 2000. A clonogenic
common myeloid progenitor that gives rise to all myeloid lineages. Nature. 404:
193-7.

Akira, S., H. lsshiki, T. Sugita, O. Tanabe, S. Kinoshita, Y. Nishio, T. Nakamima,
T. Hirano, and T. Kishimoto. 1990. A nuclear factor for lL-6 expression (NF-IL6)
is a member of a C/EBP family. EMBO J. 9:1897-1906.

Alam, T., M. R. An, and J. Papaconstantinou. 1992. Differential expression of
three CIEBP isoforms in multiple tissues during the acute phase response. J Biol
Chem. 267: 5021-4.

Antonson, P., B. Stellan, R. Yamanaka and K. G. Xanthopoulos. 1996. A novel
human CCAAT/enhancer binding protrein gene, C/EBP epsilon, is expressed in
cells of lymphoid and myloid lineages and is localized on chromosome 14q11.2
close to the T-cell receptor alpha/delta locus. Genomics 35: 30.

Baer, M., S. C. Williams, A. Dillner, R. C. Schwartz, and P. F. Johnson...1998.
Autocrine Signals control CCAAT/enhancer binding protein beta expression,
localization, and activity in macrophages. Blood. 92: 4353-65.

Breitman, T. R., S. E. Selonick and S. J. Collins. 1980. Induction of differentiation
of the human promyelocytic leukemia cell line (HL-60) by retinoic acid. Proc. Natl.
Acad. Sci. USA. 77:2936.

Bretz, J. D., S. C. Williams, M. Baer, P. F. Johnson, and RC. Schwartz. 1994.
CIEBP-related protein 2 confers lipopolysaccharide-inducible expression of

interleukin 6 and monocyte chemoattractant protein 1 to a lymphoblastic cell line.
Proc. Natl. Acad. Sci. USA 91: 7306-7310.

Buck, M., V. Poli, P. van der Geer, M. Chojkier, and T. Hunter. 1999.
Phosphorylation of rat serine 105 or mouse threonine 217 in C/EBP beta is
required for hepatocyte proliferation induced by TGF alpha. Mol Cell. 1999
4(6):1 087-92.

Cao, Z., R. M. Umek and S. L. McKnight. 1991. Related expression of three
C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev. 5: 1538.

Chen, X., W. Liu, C. Ambrosino, M. R. Ruocco, V. Poli, L. Romani, l. Quinto, S.
Barbieri, K. L. Holmes, S. Venuta, and G. Scale. 1997. Impaired generation of

30

bone marrow B lymphocytes in mice deficient in C/EBPB Blood 90: 156-164.

Chen, Z., N. J. Brand, A. Chen, S. J. Chen, J. H. Tong, Z. Y. Wang, S. Waxman
and A. Zelent. 1993. Fusion between a novel Kruppel-like zinc finger gene and
the retinoic acid receptor-alpha locus due to a variant t(11:17) translocation
associated with acute promyelocytic leukemia. EMBO J. 12: 1161.

Chih, D. Y., A. M. Chumakov, D. J. Park, A. G. Silla, and H. P. Koeffler. 1997.
Modulation of mRNA expression of a novel human myeloid-selective
CCAAT/enhancer binding protein gene (C/EBPe). Blood. 90: 2987.

Christy, R. J., V. W. Yang, J. M. Ntambi, D. E. Geiman, W. H. Landshulz, A. D.
Friedman, Y. Nakabeppu, T. J. Kelly and M. D. Lane. 1989. Differentiation-
induced gene expression in 3T3-L1 preadipocytes: CCAAT/enhancer binding
protein interact with and activate the promoters of two adipocyte-specific genes.
Gene Dev. 3: 1323.

Christy, R. J., K. H. Kaestner, D. E. Geiman, and M. D. Lane. 1991.
CCAAT/enhancer binding protein gene promoter: binding of nuclear factors
during differentiation of 3T3-L1 preadipocytes. Proc Natl Acad Sci U S A. 88:
2593-7.

Chumakov, A. M., Grillier, E. Chumakova, D. Chih, J. Slater, and H. P. Koeffler.

1997. Cloning of the novel human myeloid-cell-specific C/EBPe transcription
factor. Mol. Cell. Biol. 17: 1375-1386. ’

Collins, S. J. 1987. The HL-60 promyelocytic leukemia cell line: proliferation,
differentiation and cellular oncogen expression. Blood 70: 1233.

Cooper, 0., A. Henderson, S. Artandi, N. Avitahl and K. Calame. 1995. lg/EBP
(C/EBPy) is a transdominant negative inhibitor of CIEBP family transcriptional
activators. Nucleic Acids Res. 23: 4371.

Coutts, M., K. Cui, K. L. Davis, J. C. Keutzer, and A. J. Sytkowski. 1999.
Regulated expression and functional role of the transcription factor CHOP
(GADD153) in erythroid growth and differentiation. Blood 93: 3369-3378.

Descombes, P., M. Chojkier, S. Lichtsteiner, E. Falvey, and U. Schibler. 1990.
LAP, a novel member of the C/EBP gene family, encodes a liver-enriched
transcriptional activator protein. Genes Dev. 4:1541-1551.

Descombes, P. and U. Schibler. 1991. A liver-enriched transcriptional activator
protein LAP and a transcriptional inhibitory protein LIP are translated from the
same mRNA. Cell 67: 569.

Dranoff, G., A. D. Crawford, M. Sadelain, B. Ream, A. Rashid, R. T. Bronson, G.

31

R. Dickersin, C. J. Bachurski, E. L. Mark, J. A. Whitsett et al. 1994. Involvement
of granulocyte-macrophage colony-stimulating factor in pulmonary homeostasis.
Science. 264: 713

Fomace, A. J., D. W. Nebert, M. C. Hollander, J. D. Luethy, M. Papathanasiou, J.
Fargnoli and N. J. Holbrook. 1989. Mammalian genes coordinately regulated by
growth arrest signals and DNA-damaging agents. Mol. Cell. Biol. 9: 4196.

Ford, A. M., C. A. Bennett, L. E. Healy, M. Towatari, M. F. Greaves and T. Enver.
1996. Regulation of the myeloperoxidase enhancer binding proteins PU.1,

C/EBPa, -B, and -8 during granulocyte-lineage specification. Proc. Natl. Acad.
Sci. USA 93:10838.

Freytag, S. 0., and T. J. Geddes. 1992. Reciprocal regulation of adipogenesis by
Myc and C/EBP alpha. Science. 256: 379-82.

Friedman, A. D. and S. L. McKnight. 1990. Identification of two polypeptide
segments of CCAAT/enhancer-binding protein required for transcriptional
activation of the serum albumin gene. Gene Dev. 4:1416.

Friedman, A. D. 1996. GADD153/CHOP, a DNA damage-inducible protein,
reduced CCAAT/enhancer binding protein activities and increased apoptosis in
320 c13 myeloid cells. Cancer Res. 56: 3250-6.

Friedman,‘A. D. 1996. Regulation of immature myeloid cell differentiation by
PEPBZ/CBF, Myb, CIEBP, and Ets family members. Curr. Top. Microbiol.
Immunol. 211:149.

Furutani, Y., M. Notake, T. Fukui, M. Ohue, H. Nomura, M. Yamada, and S.
Nakamura. 1986. Complete nucleotide sequence of the gene for human
interleukin-1-alpha. Nucleic Acids Res. 14: 3167-3179.

Glimcher, L. H., and H. Singh. 1999. Transcription factors in lymphocyte
development--T and B cells get together. Cell. 96: 13-23.

Graves, B.J., P. F. Johnson, and S. L. McKnight. 1986. Homologous recognition
of a promoter domain common to the MSV LTR and the HSV tk gene. Cell. 44:
565-76.

Hohaus, S., M. S. Petrovick, M. T. Voso, 2. Sun, Zhang, D.-E., and D. G. Tenen.
1995. PU.1 (Spi-1) and ClEBPoz regulate expression of the granulocyte-

macrophage colony-stimulating factor receptor a gene. Mol Cell. Biol. 15: 5830-
5845.

Hsu, W., T. K. Kerppola, P. L. Chen, T. Curran and S. Chen-Kiang. 1994. Fos
and Jun repress transcription activation by NF-IL6 through association at the

32

basic zipper region. Mol. Cell Biol. 14: 268.

Hu, H.-M., M. Baer, S. C. Williams, P. F. Johnson, and R. C. Schwartz. 1998.
Redundancy of C/EBPoc, -B, and -8 in supporting the Iipopolysaccharide-induced
transcription of lL-6 and monocyte chemoattractant protein-1. J. Immunol.
1 60:2334-2342.

lsshiki, H., S. Akira, O. Tanabe, T. Nakajima, T. Shimamoto, T. Hirano and T.
Kishimoto. 1990. Constitutive and interleukin-1 (lL-1)-inducible factors interact
with the IL-1-responsive element in the lL-6 gene. Mol. Cell Biol. 10: 2757.

Johnson P. F., W. H. Landschulz, B. J. Graves and S. L. McKnight. 1987.
Identification of a rat liver nuclear protein that binds to the enhancer core element
of three animal viruses. Gene Dev. 1:133.

Johnson, P. F., and S. C. Williams. 1994. CAAT/enhancer binding (CIEBP)
proteins. In Liver Gene Expression. M. Yaniv and F. Tronche, eds. Raven Press,
New York. P. 231.

Kakizuka, A., W. H. Miller, K. Umesono, R. P. Warrell, S. R. Frankel, V. V. Murty,
E. Dmitrovsky and R. M. Evans. 1991. Chromosomal translocation t(15; 17) in
human acute promyelocytic leukemia fuses RAR alpha with a novel putitive
transcription factor, PML. Cell. 66: 663. .

Katz, S., E.Kowenz-Leutz, C. Muller, N. Meese, S. A. Ness and A. Leutz. 1993.
The NF-M transcription factor is related to C/EBPB and plays a role in signal

transduction, differentiation and leukemogenesis of avian myelomonocytic cells.
EMBO J. 12: 1321.

Kinoshita, S., S. Akira, and T. Kishimoto. 1992. A member of the CIEBP family,
NF-ILGB, forms a heterodimer and transcriptionally synergizes with NF-IL6. Proc.
Natl. Acad. Sci. USA 89: 1473-1476.

Kishimoto, T. 1989. The biology of interleukin-6. Blood. 74: 1.

Kowenz-Leutz, E., and A. Leutz. 1999. A CIEBP beta isofonn recruits the
SWl/SNF complex to activate myeloid genes. Mol Cell. 4: 735-43.

Krishnaraju, K., H. O. Nguyen, D. A. Lieberrnann and B. Hoffman. 1995. The zinc
finger transcription factor Egr-1 potentiates macrophage differentiation of
hematopoietic cells. Mol. Cell. Biol. 15: 5499-507.

Krishnaraju, K., B. Hoffman, D. A. Lieberrnann. 1998. The zinc finger

transcription factor Egr-1 activates macrophage differentiation in M1 myeloblastic
leukemia cells. Blood. 15:1957-66.

33

Kulessa, H., J. Frampton and T. Graf. 1995. GATA-1 reprograms avian
myelomonocytic cell lines into eosinophils, thromboblasts, and erythroblasts.
Genes Dev. 9: 1250-62.

Landschulz, W. H., P. F. Johnson, E. Y. Adashi, B. J. Graves and S. L. McKnight.
1988. Isolation of a recombinant copy of the gene encoding CIEBP. Genes Dev.
2: 786.

Landschulz, W. H., P. F. Johnson and S. L. McKnight. 1988. The leucine zipper:
a hypothetical structure common to a new class of DNA binding proteins.
Science. 240: 1759.

Lantz, C. S., J. Boesiger, C. H. Song, N. Mach, T. Kobayashi, R. C. Mulligan, Y.
Nawa, G. Dranoff and S. J. Galli. 1998. Role for interleukin-3 in mast cell and
basophil development and in immunity to parasites. Nature. 392: 90.

Lawson, N. D. and N. Berliner. 1999. Neutrophil maturation and the role of
retinoic acid. Exp. Hematol. 27: 1355.

Lee, S. L., Y. Wang and J. Milbrandt. 1996. Unimpaired macrophage
differentiation and activation in mice lacking the zinc finger transcactivation factor
NGFl-A (EGR1). Mol. Cell. Biol. 16: 4566.

Lieshke, G. J. et al. 1994. Mice lacking granulocyte colony-stimulating factor
have chronic neutropenia, granulocyte and-.macrophage progenitor deficiency,
and impaired neutrophil mobilization. Blood. 84: 1737.

Lin, F. T. and M. D. Lane. 1992. Antisense CCAAT/enhancer-binding protein
RNA suppress coordinate gene expression and triglyceride accumulation during
differentiation of 3T3-L1 preadipocytes. Genes Dev. 6:533.

Lin, F. T., O. A. MacDougaId, A. M. Diehl, and M. D. Lane. 1993. A 30-kDa
alternative translation product of the CCAAT/enhancer binding protein alpha
message: transcriptional activator lacking antimitotic activity. Proc Natl Acad Sci
U S A. 90: 9606-10.

Liu, F., H. Y. Wu, R. L. Wesselschmidt, T. Komaga, and D. C. Link. 1996.
Impaired production and increased apoptosis of neutrophils in granulocyte
colony-stimulating factor receptor-deficient mice. Immunity 5: 491 -501.

Liu, F., J. Poursine-Laurent, H. Y. Wu and D. C. Link. 1997. Interleukin-6 and the
granulocyte colony-stimulating factor receptor are major independent regulators
of granulopoiesis in vivo but are not required for lineage commitment or terminal
differentiation. Blood. 90: 2583.

Lowenstein, C. J., E. W. Alley, P. Raval, A. M. Snowman, S. H. Snyder, S. W.

34

Russell, and W. J. Murphy. 1993. Macrophage nitric oxide synthase gene: two
upstream regions mediate induction by interferon gamma and
Iipopolysaccharide. Proc. Natl. Acad. Sci. USA 90: 9730-9734.

Lyman, S. D. and S. E. W. Jacobsen. 1998. C-kit ligand and Flt3 ligand:
stern/progenitor cell factors with overlapping yet distinct activities. Blood. 91 :1 101

Metcalf, D. 1995. The granulocyte-macrophage regulators: reappraisal by gene
inactivation. Exp. Hematol. 23: 569.

Morosetti, R., D. J. Park, A. M. Chumakov, l. Grillier, M. Shiohara, A. F. Gombart,
T. Nakamaki, K. Weinberg, and H. P. Koeffler. 1997. A novel, myeloid
transcription factor, C/EBPEI, is upregulated during granulocytic, but not
monocytic, differentiation. Blood 90: 2591-2600.

Mukaida, N., Y. Mahe, and K. Matsushima. 1990. Cooperative interaction of
nuclear factor-kappa B- and cis-regulatory enhancer binding protein-like factor
binding elements in activating the interleukin-8 gene by pro-inflammatory
cytokines. J Biol Chem. 265: 21128-33.

Muller, C., E. Kowenz-Leutz, S. Grieser-Ade, T. Graf, and A. Leutz. 1995. NF-M
(chicken CIEBP beta) induces eosinophilic differentiation and apoptosis in a
hematopoietic progenitor cell line. EMBO J. 14: 6127-35.

Muller-Sieburg, C. E., C. A. Whitlock, and I. -L. Weissman. 1986. Isolation of two
early B lymphocyte progenitors from mouse marrow: a committed pre-pre-B cell
and a clonogenic Thy-1-Io hematopoietic stem cell. Cell. 44: 653-62.

Murone, M., D. A. Carpenter, and F. J. de Sauvage. 1998. Hematopoietic
deficiencies in c-mpl and TPO knockout mice. Stem Cells. 16: 1-6.

Nagy, L., H. Kao, D. Chakravarti, R. J. Lin, C. A. Hassig, D. E. Ayer, S. L.
Schreiber and R. M. Evans. 1997. Nuclear receptor repression mediated by a
complex containing SMRT, mSin3A, and histone deacetylase. Cell. 89: 373.

Natsuka, S., S. Akira, Y. Nishio, S. Hashimoto, T. Sugita, H. lsshiki, and T.
Kishimoto. 1992. Macrophage differentiation-specific expression of NF-IL6, a
transcription factor for interleukin-6. Blood 79: 460-466.

Nerlov, C, and E. B. Ziff. 1994. Three levels of functional interaction determine
the activity of CCAAT/enhancer binding protein-alpha on the serum albumin
promoter. Genes Dev. 8: 350-62.

Nerlov, C., and E. B. Ziff. 1995. CCAAT/enhancer binding protein-alpha amino

acid motifs with dual TBP and TFIIB binding ability co-operate to activate
transcription in both yeast and mammalian cells. EMBO J. 14: 4318-28.

35

Nerlov, C., K. M. McNagny, G. Doderlein, E. Kowenz-Leutz, and T. Graf. 1998.
Distinct CIEBP functions are required for eosinophil lineage commitment and
maturation. Genes Dev. 12: 2413-23.

Ness, S. A., E. Kowentz-Leutz, T. Casini, T. Graf and A. Leutz. 1993. Myb and
NF-M: combinatorial activators of myeloid genes in heterologous cell types.
Genes Dev. 7:749.

Nguyen, H. 0., B. Hoffman-Lieberrnann and D. A. Liebennann. 1993. The zinc
finger transcription factor Egr-1 is essential for and restricts differentiation along
the macrophage lineage. Cell. 72: 197.

Nishinakamura, R. et al. 1995. Mice deficient for the IL-3/GM-SCF/IL-SBc
receptor exhibit lung pathology and impaired immune response, while BIL-3
receptor-deficient mice are normal. Immunity. 2: 211.

Nishinakamura, R., A. Miyajima, P. Mee, V. Tybulewicz and R. Murray. 1996.
Hematopoiesis in mice lacking the entire granulocyte-macrophage colony-
stimulating factor/interleukin-3/interleukin-5 functions. Blood. 88: 2458.

Oelgeschlager, M., I. Nuchprayoon, B. Luscher and A. D. Friedman. 1996.
C/EBP, c-Myb and PU.1 cooperate to regulate the neutrophil elastase promoter.
Mol. Cell. Biol 16:4717. 2

Ossipow, V., P. Descombes and U. Schibler. 1993. CCAAT/enhancer-binding
protein mRNA is translated into multiple proteins with different transcription
activation potentials. Proc. Natl. Acad. Sci. USA. 90:8219-23.

Park, E. A., W. J. Roesler, J. Liu, D. J. Klemm, A. L. Gurney, J. D. Thatcher, J.
Shuman, A. Friedman, and R. W. Hanson RW. 1990. The role of the
CCAAT/enhancer-binding protein in the transcriptional regulation of the gene for
phosphoenolpyruvate carboxykinase (GTP). Mol Cell Biol. 10: 6264-72.

Park, D. J. , A. M. Chumakov, P. T. Vuong, D. Y. Chih, A. D. Gombart, W. H.
Miller, Jr., and H. P. Koeffler. 1999. CCAAT/enhancer binding protein epsilon is a
potential retinoid target gene in acute promyelocytic leukemia treatment. J. Clin.
Invest. 103: 1399-1408.

Poli, V., F. P. Mancini, and R. Cortese. 1990. lL-GDBP, a nuclear protein
involved in interleukin 6 signal transduction, defines a new family of leucine
zipper proteins related to CIEBP. Cell 63:643-653.

Pope, R. M., A. Leutz and S. Ness. 1994. C/EBPB regulation of the tumor
necrosis factor alpha gene. J. Clin. Invest. 94: 1449.

36

Radomska, H. S., C. S. Huettner, P. Zhang, T. Cheng, D. T. Scadden, and D. G.
Tenen. 1998. CCAAT/Enhancer binding protein C] is a regulatory switch sufficient
for induction of granulocytic development from bipotential myeloid progenitors.
Mol. Cell. Biol. 18: 4301-4314.

Ramji, D. P., A. Vitelli, F. Tronche, R. Cortese and G. Ciliberto. 1993. The two
CIEBP isoforms, IL-SDBP/NF-IL6 and C/EBPS/NF-ILBB, are induced by lL-6 to
promote acute phase gene transcription via different mechanisms. Nucleic Acids
Res. 21: 289.

Redner, R. L., E. A. Rush, 8. Faas, W. A. Rudert and S. J. Corey. 1996. The
t(5;17) variant of acute promyelocytic leukemia expresses a nucleophosmin-
retinoic acid receptor fusion. Blood. 87: 882.

Roman, C., J. S. Platero, J. Shuman and K. Calame. 1990. lg/EBP-1: a
ubiquitously expressed immunoglobulin enhancer binding protein that is similar to
C/EBP and heterodimerization with CIEBP. Genes Dev. 4: 1404.

Ron, D. and J. F. Habener. 1992. CHOP, a novel developmentally regulated
nuclear protein that dimerized with transcription factors C/EBP and LAP and
functions as a dominant-negative inhibitor of gene transcription. Genes Dev. 6:
439.

Saisanit, S. and X. H. Sun. 1997. Regulation of the pro-B-cell-specific enhancer
of the ld1 gene involves the C/EBP family of proteins. Mol. Cell. Biol. 17: 844-
850.

Schrader, J. W. 1994. Interleukin-3. In Thomson, A. (ed.), The Cytokine
Handbook. Academic Press, London, UK, pp. 81-88.

Scott, L. M., C. l. Civin, P. Rorth, and A. D. Friedman. 1992. A novel temporal
expression pattem of three C/EBP family members in differentiating
myelomonocytic cells. Blood 80:1725-1735.

Scott, E. W., M. C. Simon, J. Anastasi, and H. Singh. 1995. Requirement of
transcription factor PU.1 in the development of multiple hematopoietic lineages.
Science. 265: 1573-7.

Screpanti, I., L. Romani, P. Musiani, A. Modesti, E. Fattori, D. Lazzaro, C.
Sellitto, S. Scarpa, D. Bellavia, Lattanzio G, et al. 1995. Lymphoproliferative
disorder and imbalanced T-helper response in C/EBP beta-deficient mice. EMBO
J. 14: 1932-41.

Smith, L. T. , S. Hohaus, D. A. Gonzalez, S. E. Dziennis, and D. G. Tenen. 1996.

PU.1 (Spi-1) and C/EBPa regulate the granulocyte colony-stimulating factor
receptor promoter in myeloid cells. Blood 88: 1234-1247.

37

Spangrude, G.J., S. Heimfeld, and I. L. Weissman. 1988. Purification and
characterization of mouse hematopoietic stem cells. Science. 241: 58-62.

Stanley, E. R. 1985. The macrophage colony-stimulating factor, CSF-1. Methods
Enzymol. 116: 564.

Stanley, E., G. J. Lieschke, D. Grail, D. Metcalf, G. Hodgson, J. A. Gall, D. W.
Maher, J. Cebon, V. Sinickas, and A. R. Dunn. 1994. Granulocyte-macrophage
colony-stimulating factor-deficient mice show no major pertubation of
hematopoiesis but develop a characteristic pulmonary pathology. Proc. Natl.
Acad. Sci. USA. 91: 5592.

Suda, T., J. Suda, S. Kajigaya, S. Nagata, S. Asano, M. Saito and Y. Miura.
1987. Effects of recombinant murine granulocyte colony-stimulating factor on
granulocyte-macrophage and blast colony formation. Exp. Hematol. 15: 958.

Sundstrom, C. and K. Nilsson. 1976. Establishment and characterization of a
human histiocytic lymphoma cell line (U937). Int. J. Cancer. 17: 565.

Tanaka, T., S. Akira, K. Yoshida, M. Umemoto, Y. Yoneda, N. Shirafuji, H.
Fujiwara, S. Suematsu, N. Yoshida, and T. Kishimoto. 1995. Targeted disruption
of the NF-IL6 gene discloses its essential role in bacteria killing and tumor
cytotoxicity by macrophages. Cell. 80: 353-61.

Tenen, D. G., R. Hromas, J. D. Licht, and D.-E. Zhang. 1997. Transcription
factors, normal myeloid development, and leukemia. Blood 90: 489-519.

Till, J. E. and E. A. McCulloch. 1961. Radiat. Res. 14, 1419.

Trautwein, C., P. van der Geer, M. Karin, T. Hunter, and M. Chojkier. 1994.
Protein kinase A and C site-specific phosphorylations of LAP (NF-IL6) modulate
its binding affinity to DNA recognition elements. J Clin Invest. 93: 2554-61.

Tsai, S., S. Bartelmez, E. Sitnicka, and 8. Collins. 1994. Lymphohematopoietic
progenitors immortalized by a retroviral vector harboring a dominant-negative
retinoic acid receptor can recapitulate lymphoid, myeloid, and erythroid
development. Genes & Dev. 8: 2831-2841.

Tsai, S., and S. Collins. 1993. A dominant negative retinoic acid receptor blocks
neutrophil differentiation at the promyelocyte stage. Proc. Natl. Acad. Sci. USA
90: 7153-7157.

Twamley-Stein, G., E. Kowenz-Leutz, S. Ansieau, and A. Leutz. 1996.

Regulation of C/EBP beta/NF-M activity by kinase oncogenes. Curr Top Microbiol
Immunol. 211: 129-36.

38

Ubeda, M., X. Wang, H. Zinszner, I. Wu, J. F. Habener and D. Ron. 1996.
Stress-induced binding of the transcription factor CHOP to a novel DNA control
element. Mol. Cell. Biol. 16: 1479.

Valtieri, M., D. J. Tweardy, D. Caracciolo, K. Johnson, F. Mavilio, S. Altmann, D.
Santoli, and G. Rovera. 1987. Cytokine-dependent granulocytic differentiation.
Regulation of proliferative and differentiative responses in a murine progenitor
cell line. J Immunol. 138: 3829-35.

Verbeek, W., A. F. Gombart, A. M. Chumakov, C. Muller, A. D. Friedman, and H.

P. Koeffler. 1999. C/EBPs directly interacts with the DNA binding protein domain
of c-myb and cooperatively activates transcription of myeloid promoters. Blood
93: 3327-3337.

Vinson, C. R., P. B. Sigler and S. L. McKnight. 1992. Scissors-grip model for
DNA recognition by a family of leucine zipper proteins. Science. 246: 911.

Watowich, S. S., H. Wu, M. Socolovsky, U. Klingmuller, S. N. Constantinescu
and H. F. Lodish. 1996. Cytokine receptor signal transduction and the control of
hematopoietic cell development. Annu. Rev. Cell Dev. Biol. 12:91.

Wegner, M., Z. Cao and M. G. Rosenfeld. 1992. Calcium-regulated
phosphorylation within the leucine zipper of C/EBPB. Science. 256: 370. . ‘

Weissman, LL. 2000. Translating stem and progenitor cell biology to the clinic:
barriers and opportunities. Science. 287: 1442-6.

Westendorf, J. J., C. M. Yamamoto, N. Lenny, J. R. Downing, M. E. Selsted and
S. W. Hiebert. 1998. The t(8;21) fusion product, AML-1-ETO, associates with
C/EPBa, inhibits C/EPBa-dependent transcription, and blocks granulocytic
diffemetiation. Mol. Cell. Biol. 18: 322.

Williams, S. C., C. A. Cantwell and P. F. Johnson. 1991. A family of C/EBP-
related proteins capable of forming covalently linked leucine zipper dimers in
vitro. Genes Dev. 5: 1553.

Williams, S. C., M. Baer, A. J. Dillner and P. F. Johnson. 1995. CRP2 (C/EBPB)
contains a bipartite regulatory domain that controls transcriptional activation,
DNA binding and cell specificity. EMBO J. 14:3170.

Williams, S. C., Y. Du, R. C. Schwartz, S. R. Weiler, J. R. Keller, and P. F.
Johnson. 1998. C/EBPs is a myeloid-specific activator of cytokine, chemokine

and macrophage-colony stimulating factor receptor genes. J. Biol. Chem. 273:
13493-13501.

39

Williamson, E. A., H. N. Xu, A. F. Gombart, W. Verbeek, A. K. Chumakov, A. D.
Friedman and H. P. Koeffler. 1998. Identification of transcriptional activation and

repression domains in human CCAAT/enhancer-binding protein a. J. Biol. Chem.
273: 14796.

Yamanaka, R., G. D. Kim, H. S. Radomska, J. Lekstrom-Himes, L.T. Smith, P.
Antonson, D. G. Tenen, and K. G. Xanthopoulos. 1997. CCAAT/Enhancer
binding protein epsilon is preferentially upregulated during granulocytic
differentiation and its functional versatility is determined by alternative use of
promoters and differential splicing. Proc. Natl. Acad. Sci. USA 94: 6462-6467.

Yamanaka, R., C. Barlow, J. Lekstrom-Himes, L. H. Castilla, P. P. Liu, M.
Eckhaus, T. Decker, A. Wynshaw-Boris, and K. G. Xanthopoulos. 1997. Impaired
granulopoiesis, myelodysplasia, and early lethality in CCAAT/enhancer binding
protein epsilon-deficient mice. Proc. Natl. Acad. Sci. USA 94: 13187-13192.

Yin, M., S. Q. Yang, H. 2. Lin, M. D. Lane, S. Chatterjee, and A. M. Diehl. 1996.
Tumor necrosis factor alpha promotes nuclear localization of cytokine-inducible
CCAAT/enhancer binding protein isoforms in hepatocytes. J Biol Chem. 271:
17974-8.

Yoshida, H., S-l. Hayashi, T. Kunisada, M. Ogawa, S. Nishikawa, H. Okamura, T.
Sudo, L. D. Shultz and S-l. Nishikawa. 1990. The murine mutation osteopetrosis

is in the coding region of the macrophage colony stimulating factor gene. Nature.
345:442.

Zhang, D-E., C. J. Hetherington, H. M. Chen and D. G. Tenen. 1994. The
macrophage transcription factor PU.1 directs tissue specific expression of the
macrophage colony-stimulating factor receptor. Mol. Cell. Biol. 14: 373.

Zhang, D-E., J. Hetherington, S. Meyers, K. L. Rhoades, C. J. Larson, H. M.
Chen, S. W. Hiebert and D. G. Tenen. 1996. CCAAT enhancer-binding protein
(CIEBP) and AML1 (CBFa2) synergistically activate the macrophage colony-
stimulating factor receptor promoter. Mol. Cell. Biol. 16: 1231.

Zhang, D-E., P. Zhang, N.-D. Wang, C. J. Hetherington, G. R. Darlington, and D.
G. Tenen. 1997. Absence of granulocyte colony-stimulating factor signaling and
neutrophil development in CCAAT enhancer binding protein alpha-deficient mice.
Proc. Natl. Acad. Sci. USA 94:569.

Zhang, R, A. lwama, M. W. Datta, G. J. Darlington, D. C. Link, and D. G. Tenen.
1998. Upregulation of interleukin 6 and granulocyte colony-stimulating factor

receptors by transcription factor CCAAT enhancer binding protein or (C/EBPoc) is
critical for granulopoiesis. J. Exp. Med. 6: 1173-1184.

Zhang, Y. and W. N. Rom. 1993. Regulation of the interleukin-1 beta (IL-1 beta)

40

gene by mycobacterial components and Iipopolysaccharide is mediated by two
nuclear factor-IL6 motifs. Mol. Cell. Biol. 13: 3831-3837.

41

Chapter 2
A Novel CIEBP-Regulated Gene with a Role in Myelomonocytic

Differentiatlon

Oiang Tian and Richard C. Schwartz

42

ABSTRACT

The C/EBP family of transcription factors are important regulators of
myelopoiesis and the expression of genes associated with the differentiated
function of myeloid cells. The involvement of C/EBPs in myelopoiesis has been
demonstrated by their temporal pattem of expression in differentiating 32D clone
3 myeloblasts and by the complete lack of neutrophils associated with the
targeted disruption of C/EBPoc and C/EBPe in transgenic mice. We have utilized
differential display PCR to identify novel CIEBP-regulated genes that play a role
in myeloid differentiation. C/EBPB was overexpressed in 320 clone 3 myeloblasts
and differential display RT-PCR was performed to identify genes induced by
CIEBPB overexpression. Among the four genes identified, two were endogenous
retroviral elements, one encoded a cathepsin G, a primary granule protein of
neutrophils and monocytes, and one encoded a novel gene that we have named
CDDP-1 for CIEBP Differential-Display Product-1. The expression of CDDP-1
mRNA is upregulated by the overexpression of C/EBPa, B, 6, or e. CDDP-1
displays a biphasic pattern of expression in the granulocytic differentiation of
myeloid progenitor cell lines: an early period of elevated expression just prior to
and continuing through the induction of myeloperoxidase mRNA and a later
second period coincident with the expression of lactoferrin mRNA. It is also
induced upon granulocytic differentiation of HL-60 cells, but is downregulated
upon monocytic differentiation. This pattern of expression coupled with the
finding that CDDP-1 is most highly expressed in adult bone marrow and fetal liver

suggests a role in myelopoiesis. Constitutive overexpression of CDDP-1 in

43

MPRO promyelocytes promoted their differentiation toward both the neutrophil
and monocyte lineages. Retinoic acid treatment further facilitated the neutrophilic
differentiation of CDDP-1 transductants. Subcellular localization studies showed
that CDDP-l is predominantly a cytoplasmic protein. CDDP-1 mRNA is also
modulated during the course of erythroid and mast cell differentiation suggesting

roles for this gene in the differentiation of these other lineages.

44

INTRODUCTION

The CCAAT/enhancer binding proteins (C/EBP) comprise a family of basic
region-leucine zipper (bZIP) transcription factors that dimerize through their
leucine zippers and bind to a consensus DNA motif through their adjacent basic
regions (reviewed in Johnson and Williams, 1994). They are involved in the
regulation of differentiation and function in multiple tissues. Within hematopoietic
lineages, C/EBPa, B, 8, and s have been implicated in both the regulation of
differentiation and differentiated function in myelomonocytic cells.
C/EBPoc, C/EBPB, and C/EBPB are temporally regulated in the granulocyte
colony-stimulating factor (G-CSF)-stimulated differentiation of 320 clone 3
myeloblasts into neutrophils (Scott et. al., 1992). C/EBPa is expressed at high
levels early in differentiation and decreases to an undetectable level in terminally
differentiated cells, while C/EBPB and C/EBP8 are upregulated as cells
differentiate. Similarly, C/EBPB is upregulated in macrophage differentiation
(Natsuka et. al., 1992). Observations in primary human cells and in bipotential
precursor cell lines yield a somewhat different pattern of C/EBPoc expression
(Radomska et. al., 1998): C/EBPa is first expressed on the commitment of
multipotential cells to the myeloid lineage, then its expression is upregulated and
maintained during neutrophilic differentiation, while being rapidly downregulated
during monocytic differentiation. Consistent with its early appearance and high
level of expression in granulocyte differentiation, conditional expression of
C/EBPa in transfected bipotential cells induces neutrophilic differentiation and

blocks monocytic differentiation (Radomska et. al., 1998). C/EBPa-deficient mice

45

are completely blocked in the development of neutrophils and eosinophils (Zhang
et. al., 1997).

Consistent with peak expression late in myelomonocytic differentiation,
C/EBPB and C/EBPS are effectors in the induction of proinflammatory genes
responsive to lipopolysaccharide (LPS), interleukin-1 (IL-1), or IL-6 stimulation
(Akira et. al., 1990; Kinoshita et. al., 1992). The DNA binding activity of C/EBPB
is increased by a post-transcriptional mechanism when cells are exposed to LPS,
IL-1 or lL-6 (Akira et. al., 1990; Poll et. al., 1990) and C/EBPB and C/EBPS
mRNA levels can be induced by LPS, lL-1 or lL-6 (Akira et al., 1990; Kinoshita et
al., 1992). C/EBPB expression is capable of enhancing transcription from
promoters containing elements responsive to those factors (Akira et al., 1990;
Poll et al., 1990; Chang et al., 1990; Descombes et al., 1990). Both C/EBPB and
C/EBP6 can transactivate a reporter gene regulated by the lL-6 promoter in
transient expression assays (Akira et al., 1990; Kinoshita et al., 1992).
Furthermore, the promoter regions of the genes for IL-6, IL-la, lL-1B, lL-8, tumor
necrosis factor or, G-CSF, macrophage inducible nitric oxide synthase and
lysozyme (Akira et al., 1990; Furutani et al., 1986; Lowenstein et al., 1993;
Natsuka et al., 1992; Shirakawa et al., 1993; Zhang et al., 1993) all contain
C/EBP binding motifs. Our own lab has shown that ectopic expression of
C/EBPa, B, or Sconfers LPS-inducibility of IL-6 and monocyte chemoattractant
protein-1 expression to a cell line that normally lacks C/EBP expression (Bretz et

al, 1994; Hu et al., 1998).

46

C/EBPs is unique among the C/EBP family in being myeloid-specific in its
expression (Williams et al., 1998; Chumakov et al., 1997). C/EBPs is most highly
expressed in maturing neutrophils (Chih et al., 1997; Morosetti et al, 1997;
Yamanaka et al., 1997). C/EBPs-deficient mice fail to develop functional
neutrophils and eosinophils (Yamanaka et al., 1997a) with a block later in
differentiation than that seen in C/EBPa-deficient animals. Consistent with a
block later in the differentiation process, C/EBPs has been found to transactivate
in cooperation with c-myb the promoters for mim-1 and neutrophil elastase in
transient expression assays (Verbeek et al., 1999), and to upregulate
endogenous expression of a number of genes encoding proinflammatory
cytokines including IL-6, monocyte chemoattractant protein-1, macrophage
inflammatory protein-1oz, and macrophage inflammatory protein-18 (Chumakov et
aL,1997)

A major issue still incompletely resolved in our understanding of the critical
role of C/EBPa in the differentiation of neutrophils is the identity of target genes
that are necessary in the differentiation process. While C/EBPor-deficient mice no
longer express the C/EBPa-regulated G-CSF receptor, this is not a full
explanation of their inability to produce neutrophils because mice deficient in G-
CSF receptor expression are still capable of producing reduced numbers of
mature neutrophils (Liu et al., 1996). The lL-6 receptor is either directly or
indirectly regulated by C/EBPa and IL-6 signaling is certainly important for
granulopoiesis, but mice deficient in both lL-6 receptor and G-CSF receptor

expression are similar to mice deficient in expression of the G-CSF receptor

47

alone (Zhang et al., 1998). Therefore, there must be important C/EBPoc target
genes other than those encoding the G-CSF and lL-6 receptors.

Since the currently identified target genes of CIEBP regulation seem
inadequate to fully explain the role of these transcription factors in
myelomonocytic differentiation, we sought to elucidate the regulatory scheme in
which C/EBPs act in differentiation by identifying new targets of their regulation in
immature myeloid cells. To that end, we produced retroviral transductants of 320
clone 3 myeloblasts that overexpress C/EBPa, C/EBPB, C/EBPS and C/EBPe and
performed differential display reverse transcription-PCR (RT-PCR) between
C/EBP-overexpressing transductants and control transductants. In this paper, we
have characterized one product of this analysis, CDDP-1 (CIEBP Differential-
Display Product-1). The CDDP-1 gene encodes a novel protein displaying little
relationship to any proteins of known function. CDDP-1 expression is modulated
in the course of myelomonocytic differentiation and is a positive effector of

myelomonocytic differentiation.

48

MATERIALS AND METHODS

Cell lines and cell culture. 320 clone 3 murlne myeloblasts (Valteri et al., 1987)
were grown in lscove's modified Dulbecco’s medium (IMDM) supplemented with
20% fetal calf serum (FCS) and 10% WEHl-3 conditioned medium as a source of
interleukin-3. For induction of granulocytic differentiation, cells were washed
twice with phosphate-buffered saline and placed in IMDM supplemented with
20% FCS supplemented with 5 rig/ml murlne G-CSF (R&D Systems). WEHl-3
cells (ATTC TIB 68) were maintained in RPMI 1640 medium supplemented with
5% FCS. EML-C1 murine hematopoietic progenitor cells (Tsai et al., 1994) were
maintained in IMDM supplemented with 20% horse serum, and 15% conditioned
medium from BHK cells transfected with an expression vector for rat stem cell
factor (BHK/MKL cells). For induction of myelomonocytic differentiation, EML-Ct
cells were transferred to IMDM supplemented with 20% horse serum, 15%
BHK/MKL conditioned medium, 10% WEHI-3 conditioned medium, and 5 uM all-
trans retinoic acid (ATRA). For induction of erythroid differentiation, EML-C1 cells
were transferred to IMDM supplemented with 20% horse serum, 15% BHK/MKL
conditioned medium, 0.5% WEHl-3 conditioned medium, and 8 units/ml human
erythropoietin (R&D Systems). For induction of mast cell differentiation, EML-C1
cells were transferred to IMDM supplemented with 20% horse serum, 15%
BHK/MKL conditioned medium, and 10% WEHl-3 conditioned medium. MPRO
murlne promyelocytes (Tsai et al., 1993) were grown in Dulbecco’s modified

Eagle’s medium supplemented with 10% heat-inactivated FCS and 10ng/ml

49

murlne granulocyte-macrophage colony-stimulating factor (R&D Systems). For
induction of granulocytic differentiation, ATRA was added to 20uM. HL-60 human
promyelocytic leukemia cells (A'I‘I'C CCL 240) were maintained in RPMI 1640
medium supplemented with 20% FCS. HL-60 cells were treated with either 10
uM ATRA or 100nM phorbol myristate acetate to induce granulocytic or
monocytic differentiation, respectively. BB88 Friend erythroleukemia cells (ATl'C
TIB 55) were grown in RPMI 1640 supplemented with 10% heat-inactivated FCS
and 2-mercaptoethanol. For induction of erythroid differentiation, dimethyl
sulfoxide was added to a final concentration of 15% (vol/vol). U937 human
histiocytic lymphoma cells (A'I'I'C CRL 1593) were grown in RPMI 1640
supplemented with 10% FCS. U937 cells were treated with either 10 uM ATRA or
100 nM phorbol myristate acetate to induce granulocytic or monocytic
differentiation, respectively. 293T cells (Pear et al., 1993) and CV-1 cells (ATCC
CCL 70) were grown in Dulbecco’s modified Eagle’s medium supplemented with
10% FCS. All cells were grown at 37°C in the presence of 5% C02.

Differential display FIT-PCR, cDNA cloning and sequencing. Differential display
RT-PCR was performed with the Delta RNA Fingerprinting Kit (Clontech)
according to the manufacturer’s instructions. The full-length cDNA of CDDP-1
was isolated from a kgt11 human bone marrow cDNA library (Clontech). The
library was screened according to manufacturer's protocol using the 230bp
CDDP-1 differential display product, as well as a probe generated by 5' rapid
amplification of cDNA ends, as probes. Two rounds screening were performed to

eventually isolate the 2.3 kb CDDP-1 cDNA. Automated dye terminator

50

sequencing was performed by the Michigan State University DNA Sequencing
Facility.

FINA isolation and analysis. Total RNA was isolated using TRIzol reagent (Life
Technologies) according to the manufacturer's directions. RNA’s were
electrophoresed through 1% agarose/forrnaldehyde gels. Transfers to
membranes were hybridized and washed to a stringency of 0.1x SSPE at 65°C.
Hybridization probes were prepared with a random priming kit (Life
Technologies) with the incorporation of 5’-[a-32P]dATP (3000 Ci/mmol; DuPont-
New England Nuclear). The C/EBPa and C/EBPB probes were rat genomic
fragments derived from the pSV(X)C/EBPa and pSV(X)C/EBPB expression
vectors (16, 17). The C/EBP8 probe was a murlne genomic fragment derived
from the pSV(X)C/EBP6 expression Vector (17). The C/EBPe probe was a rat
genomic fragment derived from the pSV(X)C/EBPsp34 expression vector (18).
The myeloperoxidase probe was a 0.8 kb Pstl fragment derived from a 2.73 kb
murlne cDNA (from G. Rovera, The Wistar Institute, Philadelphia, PA). The
lactoferrin probe was a 0.56 kb murlne cDNA (from G. Rovera, The Wistar
Institute, Philadelphia, PA). The frns probe was a 2.7 kb Clal/BamHl fragment of
the McDonough strain of feline sarcoma virus (Donner et al., 1982). The
lysozyme probe was a 1.0 kb human cDNA (Peters et. al., 1989). The cathepsin
G probe was a 0.5 kb murlne cDNA cloned through the differential display RT-
PCR process described in this paper. The glyceraldehyde-3-phosphate

dehydrogenase probe was a 1.3 kb rat cDNA (Fort et al., 1985).

51

Expression vectors. pSV(X)C/EBPB expresses C/EBPB from the Moloney murine
leukemia virus promoter and its construction from the parent vector, pSV(X)Neo,
has been described previously (Bretz et al., 1994; Hu et al., 1998), pBABE-
CDDP-1 expresses CDDP-1 from the Moloney murine leukemia virus promoter
and was constructed by inserting the CDDP-1 cDNA into the BamHI site of the
murine retroviral vector, pBABE-Puro (Morgenstem and Land, 1990). pMTD-
CDDP-1 was constructed by inserting the CDDP-1 cDNA into the Bglll site of
pMTD (Sompayrac and Danna, 1994), which placed CDDP-1 under the
regulation of a modified metallothionein promoter. pMEX-CDDP-1 was
constructed by inserting the CDDP-1 cDNA into the EcoRI site of pMEX (Williams
et al., 1991), which utilizes the Moloney murlne sarcoma virus promoter. B-RE2-
Luc (from Ron Evans, The Salk Institute, San Diego, CA) contains 2 copies of
retinoic acid response elements. pCMV-RARa (from David Talmage, Columbia
University, New York, NY) expresses the gene encoding human retinoic acid
receptor a from the cytomegalovirus promoter. The SV40 early promoter-reporter
is a commercial product, pBgaI-Control (Clontech), where the SV40 early
promoter and enhancer sequences are cloned upstream and downstream ,
respectively, of the lacZ gene.

Retroviral infection. In order to prepare retrovirus stocks derived from
pSV(X)Neo, pSV(X)C/EBPB, pBABE-Puro and pBABE-CDDP-l , 10 cm plates of
70% confluent 293T cells were co-transfected with 3ug of pMOV-w' (Mann et al.,
1983), a packaging construct, and 3ug pBABE-CDDP-1 using DMRIE-C reagent

(Life Technologies) according to manufacturer's directions. 60 hr after

52

transfection, viral supematants were collected by centrifugation at 1000 rpm for 5
min and passed through 0.4 pm filters. 2x106 cells in normal growth medium
were mixed with an equal volume of viral stock and 8 jig/ml polybrene (Sigma)
and then incubated at 37°C for 3 hr. 24 hr after infection, cell cultures were split
1:4 and puromycin was added into the media at a final concentration of 1 Itng
for a period of 1 to 2 wk.

Transient Transfection. Transient transfections of CV-1 cells were performed
using DMRIE-C reagent (Life Technologies). B-REZ-Luc and pCMV-RARa were
cotransfected in the presence and absence of pMEX-CDDP-1 in the quantities
indicated. Total DNA was made up to 3 pg for each transfection with pMEX.
Transfectants were either untreated or treated with 10uM ATRA. A SV-40 early
promoter-reporter was used as a control for transfection efficiency. After 48 hrs,
cells were lysed and analyzed for luciferase activity by using the Luciferase
Reporter Gene Assay Kit (Roche Molecular Biochemicals) and for [3-
galactosidase activity by using the Luminescent B-Galactosidase Genetic
Reporter System II (Clontech).

Westem blotting. Whole cell protein extracts were prepared using TRIzol reagent
(Life Technologies) following the manufacturer's protocol. For cytoplasmic and
nuclear fractionation, 5x106 cells were washed in phosphate-buffered saline and
lysed in 200ul buffer A (15 mM KCI, 10 mM HEPES [pH 7.6], 2 mM MgCl2, 0.1
mM EDTA, 1 mM dithiothreitol, 0.1% [vol/vol] NP-40, 0.5 mM
phenylmethylsulfonyl fluoride, 2.5 IIng leupeptin, 5 11ng antipain, and 5 IIng

aprotinin) for 10 min on ice. Nuclei were pelleted by centrifugation at 14,000 x g

53

for 20 sec. The supernatant lysate was the cytoplasmic fraction. Proteins were
extracted from nuclei by incubation at 4°C with vigorous vortexing in buffer C
(420 mM NaCl, 20 mM HEPES [pH 7.9], 0.2 mM EDTA, 25% [vol/vol] glycerol, 1
mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 2.5 IIng leupeptin, 5
jig/ml antipain, and 5 ug/ml aprotinin). Nuclear debris was pelleted by
centrifugation at 14,000 x g for 15 min at 4°C. This supernatant extract was the
nuclear fraction. Protein samples were electrophoresed through sodium dodecyl
sulfate-12% polyacrylamide gels, transferred to a Protran membrane (Schleicher
and Schuell), and antigen-antibody complexes were visualized with the
Enhanced Chemiluminescence Kit (Amersham Pham'Iacia Biotech).

Antisera. A 540 bp BamHI fragment of CDDP-1 was subcloned into pGEX-2
(Phannacia Biotech) to encode a GST-CDDP-1 fusion protein. The CDDP-1
fusion protein was purified from bacterial extract by chromatography with a
glutathione Sepharose 48 column (Amersham Pharrnacia Biotech). The purified
CDDP-1 fusion protein was used to immunize rabbits to produce a polyclonal
antiserum specific for CDDP-1. Immunizations and serum preparation were
performed by Alpha Diagnostic lntemational (San Antonio, TX). Antisera specific
to cytoplasmic lactate dehydrogenase and nuclear Sm protein were obtained
from R. Patterson (Michigan State University, East Lansing, MI).

Cell staining. MPRO transductant cells were cytocentrifuged onto glass
microscope slides and stained in Wright-Giemsa Stain (Sigma) according to the

manufacturer’s directions.

54

 

RESULTS

Identification and sequence analysis of CDDP-1. A series of differential display
RT-PCR experiments were performed comparing 32D clone 3 myeloblasts
infected with a retroviral vector expressing C/EBPB to cells infected with an
“empty" control vector. 64 sets of primer pairs were used to identify 27 differential
display products potentially representing both gains and losses of expression.
Four of these products were confirmed as being differentially expressed by
Northern blot analysis of RNA’s from the original transduced cell lines that were
used to generate the differential display. Sequence analysis revealed that 2 of
these products were retroviral elements (most murine cell lines contain multiple
copies of endogenous retroviruses which have CIEBP binding sites in their long
terminal repeats). A third product encoded a portion of cathepsin G, a neutral
serine protease found in the primary granules of neutrophils (Heusel et al., 1993).
The fourth product, a 230 bp cDNA, is shown in Fig. 1.

The mRNA for this product was verified as being overexpressed in 320
clone 3 cells transduced for C/EBPB expression, as well as in cells transduced
for C/EBPoc, C/EBPS and C/EBPs expression (Fig. 2), suggesting a CIEBP-
regulated gene. Sequence analysis found this cDNA to represent a novel gene,
previously unreported to GenBank. We refer to this gene as CDDP-1 for C/EBP
Differential-Display Product-1. Several highly homologous murlne, rat and
human expressed sequence tag (EST) clones of unknown function were
identified. A CDDP-1 cDNA containing a 453 amino acid open reading frame was

isolated from a kgt11 human bone marrow cDNA library using the original 230 bp

55

I 320$V(X)1
I 3ZDSV(X)2

FN
a9
55
>
m?)
00
NN
(00')
l“

 

Figure 1. Differential display between control and CIEBPB—
overexpressing cells. Two control populations [3ZDSV(X)1 and 2] and
two C/EBPB-overexpressing populations [32DSV(X)]31 and 2] were
examined at two concentrations of initial cDNA products.

56

Con Con B—l [3—2 0t—l oc—2 5—1 8—2

 

Con e—l 8—2

CDDP4

GAPDH

 

Figure 2. Overexpression of CIEBP isoforms in 320clone3 induces
expression of a differential display RNA species. A Northern blot
confirmed that the gene represented by the 230 bp differential display
product (CDDP-1) was indeed expressed at a higher level in CIEBPB-
expressing cells ([31 and [32) than in controls. It also revealed that this
gene was induced by C/EBPa (a1 and a2), C/EBP8 (51 and 82), and
CIEBPs (sl and 82) expression as well.

57

cDNA and a probe generated by 5' rapid amplification of cDNA ends (RACE).
The nucleic acid sequence of this clone and the amino acid translation of that
sequence (Accession No. AF123073) are presented in Fig. 3. The 2330 bp
sequence contains an excellent Kozak sequence (GCCATGG; positions 28-34)
containing the initiating methionine codon of the 453 amino acid open reading
frame, as well as two consensus poly(A) sites (AATAAA; positions 2291-2296
and 2299-2304) upstream of an apparent poly(A) tail.

BLAST analyses of both the nucleic acid and amino acid sequences did
not reveal any significant homologies to any known genes or proteins (NCBI).
Analyses for protein motifs that might provide a clue as to mechanistic function
were unrevealing: several potential protein kinase C and casein kinase 2 sites
were found, as well as a potential N-glycosylation site (PROSITE). Interestingly,
a protein BLAST search finds a predicted protein of unknown function (GenBank
Accession No. AA050514) supported by several human EST’s with 43% identity
to amino acid sequence of CDDP-1. This raises the possibility of CDDP-1 being
a member of a larger family of as yet uncharacterized proteins. A sequence
tagged site (sts-W37771) identical to CDDP-1 sequence maps to human
chromosome 17q21-q22 of the G84 radiation hybrid map, a region with a number
of mapped chromosomal abnormalities observed in leukemias (NCBI). While
some chromosomal abnormalities in this region involve the genes encoding
retinoic acid receptor or, hepatic leukemia factor and AF17, others are not

defined.

58

10 30 50 70 90
GNCCCTCGACGGCNTGCAGCCGGGAGAGCCATQGCGGGGGCCGCAGCGGGCGGCAGAGGCGGAGGTGCCTGGGGGCCGGGGCGCGGAGGG
M .A G A. A. A G G R G G G A. W G P G R G G
110 130 150 170
GCCGGGGGGCTCCGGCGGGGCTGCTCTCCCCCAGCCCCCGCCGGCTCCCCCCGGGCTGGGCTGCAGCCGCTCAGGGCCACGATCCCCTTC
A G G L R R G C 8 P P A P A G 8 P R A G L Q P L R. A T I P P
190 210 230 250 270
CAGCTGCAGCAGCCGCACCAGCGCCGGGACGGGGGTGGCCGTGCAGCCAGCGTCCCATGCTCGGTGGCCCCAGAAAAGTCAGTGTGTAGG
Q L Q Q P 8 Q R R D G G G R .A .A 8 v P c 8 v .A P I R 8 v c R
290 310 330 350
CCTCAGCCACTTCAGGTCCGGCGTACATTCTCCCTGGACACCATCCTCAGCTCCTACCTTCTGGGCCAGTGGCCACGAGATGCTGATGGG
P Q P L Q V R R T P 8 L D T I L 8 8 I L L G Q ‘W P R D A D G
370 390 410 430 450
GCCTTCACCTGCTGCACCAATGACAAGGCCACCCAGACGCCCCTGTCCTGGCAAGAGCTAGAAGGTGAGCGTGCCAGTTCCTGTGCACAC
A P T C C T N D K A T Q T P L 8 N’ Q I L I G I R .A 8 8 C A R
470 490 510 530
AAGCGCTCAGCATCCTGGGGCAGCACAGACCACCGAAAAGAGATTTCCAAGTTGAAGCAACAACTGCAGAGGACGAAGCTGAGCCGCAGT
R R 8 A 8 W G S T D B R K I I 8 K L R Q Q L Q R T R L 8 R 8
550 570 590 610 630
GGGAAAGAGAAGGAGCGAGGTTCACCACTCCTAGGGGACCACGCAGTGCGGGGAGCACTGAGGGCGTCCCCTCCCAGCTTCCCCTCAGGG
G R I R I R G 8 P L L G D n A. v R G A L R. R 8 P P 8 P P 8 G
650 670 690 710
TCCCCTGTCTTGCGACTCAGCCCCTGCCTGCACAGGAGCCTGGAAGGGCTCAACCAAGAGCTGGAGGAGGTATTTGTGAAGGAGCAGGGA
8 P v L R L 8 P c L 8 R 8 L I c L N Q I L I I v P v R I Q G
730 750 770 790 810
GAAGAGGAGCTGCTGAGGATCCTTGATATCCCTGATGGGCACCGGGCCCCAGCTCCTCCCCAGAGTGGCAGCTGTGATCATCCCCTCCTC
P l P L L R I L D I P D G 8 R A P A P P Q 8 c 8 c D a P L L
830 850 870 890
CTCCTGGAGCCTGGCAACCTTGCCAGCTCTCCTTCCATGTCCTTGGCATCTCCCCAGCCTTGTGGCCTGGCCAGTCATGAGGAACATCGG
L L P P G N L A 8 8 P 8 M 8 L A 8 P Q P c c L A 8 8 I I 8 R
910 930 950 970 990
GGTGCCGCCGAGGAGCTGGCATCCACCCCCAACGACAAAGCCTCCTCTCCAGGACACCCAGCCTTTCTTGAAGATGGCAGCCCATCTCCA
G A A I I L A 8 T P N D K A 8 8 P G R P A P L I D G 8 P 8 P
1010 1030 1050 1070
GTCCTTGCCTTTGCTGCCTCCCCTCGACCTAATCATAGCTACATCTTCAAACGGGAGCCCCCAGAAGGCTGTGAGAAAGTGCGTGTGTTT
v L A. P A. A 8 P R P u a 8 I I P R R P P P I G c I R V’ R v P
1090 1110 1130 1150 1170
GAAGAAGCCACGTCTCCAGGTCCTGACCTGGCCTTCCTGACTTCCTGTCCTGACAAGAACAAAGTCCATTTCAACCCGACTGGCTCAGCC
I I A T S P G P D L A P L T 8 C P D R N R V R P N P T G 8 A
1190 1210 1230 1250
TTCTGCCCCGTCAACCTGATGAAGCCCCTCTTCCCCGGCATGGGCTTCATCTTCCGTAACTGCCCCTCAAACCCGGGATCTCCCCTTCCC
P c P v N L x R P L P P G x G P I P R N c P 8 R P G 8 P L P
1270 1290 1310 1330 1350
CCGGCCAGCCCCAGGCCACCACCTCGGAAGGATCCGGAAGCCTCCAAGGCCTCCCCACTGCCATTCGAGCCATGGCAGCGCACCCCACCA
P A S P R P P P R R D P I A 8 R A 8 P L P P I P W’ Q R T P P
1370 1390 1410 1630
TCAGAAGAGCCTGTGCTTTTCCAGAGCTCCCTGATGGTCTGAGGGTCCCACCCCTGCCCCACTTTACCATAGAGACCAGTGCCTTGGTGG
8 I I P v L P Q 8 s L M v t
1450 1470 1490 1510 1530
CAGGTCCCTCCCCAGGTCCCCTGAGATGGGGTATGGAGGGGCCCTTCCCTCTCGGCCTTCGAGCACTTTCTTTCACTTACTGTGTCAAAG
1550 1570 1590 1610
CCCTGGGTCCTCTTTTTGATGGGCACCGGCCCCTCTGAACGTGATGGGACCTGCCTTCTCCACTAGTAGCTGGGCAGCTCACAATTCACA
1630 1650 1670 1690 1710
CCTGTGTACCTGCCACATCCCTCACTTGGTGGAAAACACCCAGAAGGTCTTGAGTCCCCCACCCCTGGGTGTCAGTCCAAATGACTGTAT
1730 1750 1770 1790
AGGAGGCCCTTATTTTTGTCACAGAGCAAGCTGGCCATGAACGAAGGAGAGAAGACGCCACAGATTTCCTTCCCTCTCCTCCAGGAGACC
1810 1830 1850 1870 1890
ATAAGATAGATCCCCCATCCTCTCAGCCCTATTCCCATGCCTCCCTCTCATTGGAGGAGCTGACCAAAGCAGCCCTAACGGGCCATAACA
1910 1930 1950 1970
CTTGACCAATTCAGCTGCTGGCAGAGGGAGGAAACAAGTGTTTTCCCAAGTGGCATTTTCATCTCGCTTTCACCCTGACTAAAGATTGTC
1990 2010 2030 2050 2070
TTAAGTAGCAGCCCAGCCCGCCCAGCCCCAGGTGGGTAGTGGGGAGGAGAGCTGGCATTCCTCCAGGTGGCAAATGGCGACTCTATACTC
2090 2110 2130 2150
TCCGCCCGCCCCAGGGCTGGATGGATTAGAAAAATCCCTATTTTTCTTGTATCGATGTAGAGACTCTATTTTCTCCCAAAGACACTATTT
2170 2190 2210 2230 2250
TTGCAGCTGTTTGAAGTTTGTATATTTTCCGTACTGCAGAGCTTACACAAAATTGAAGAATGTTAATGTTCGAGTTTTCTTATCTTGTGT
2270 2290 2310
TTAGAGGTTGTTTTTTGCAGATCTTGGTGTTAATAGACCAAATAAATAAATAAATATTCCCAGCAAAAAAAAAA

Figure 3. The nucleic acid and the deduced amino acid sequences of CDDP-1.

59

The CDDP-1 cDNA sequence was identical to sequences reported to
GenBank as “unfinished High Throughput Genomic Sequences” (Accession No.
ACO15795). Comparison to these unordered sequences from human
chromosome 17 reveal the CDDP-1 gene to be organized into 8 exons: 16-226,
227-393, 394-491, 492-602, 603-738, 739-939, 940-1093, 1094-2314. An
examination of sequences upstream of the first exon found several potential
CIEBP binding sites consistent with the upregulation of CDDP-1 by
overexpression of C/EBP isoforms (Fig 4).

CDDP-1 is most highly expressed in fetal liver and adult bone marrow.
Hybridization of the CDDP-1 cDNA to an RNA dot blot of human tissues (RNA
Master Blot, Clontech) found CDDP-1 to be expressed most highly in fetal liver
(4.2-fold that seen in peripheral leukocytes) and adult bone marrow~(3.0-fo|d that
seen in peripheral leukocytes) as would be expected of a gene with a function in
hematopoiesis (Figure 5). Northern analysis of a diverse panel consisting mostly
of hematopoietic cell lines (Figure 6) found expression of CDDP-1 RNA in
myeloblast cell lines other than 320 clone 3 (M1 and HL60) as well as a
monocytic cell line (WEHI 274.1), but lacking in mature macrophage cell lines
(l021 and P38801[lL-1]). Expression was also observed in a 8 cell line (M12), a
pre-B cell line (702/3), a CD4+ pre-T cell line (EL4), a mastocytoma (P815), and
an erythroblast cell line (8888). In the case of 8888, expression increased upon
DMSO-induced differentiation. CDDP-1 was neither observed in a 008+ T cell

line (CTLL-2) nor NIH3T3 cells.

60

-2070 -2050 -2030 -2010 -1990
tttctccctgaagtctcaatgaagaggaaataatacccatttcacaagtgtggt-aataagataaagtatgcatggtact
-1970 -1950 -l930 —1910
taacatgtacctagcatggagaaaggaattcaatgaatattcgttgctaccattactgattttattaatgaagatgtgaggcagggtggt
-1890 -1870 -1850 -1830 -1810
tcaatatgatgtgttagagatctgagctaggaatcaaaaggactcacttctttggacttcagtttcactacttgtaacatggtaagaatc
-1790 —1770 -1750 -1730
catgtttttccttttccagattgtcatgaggatttcttaaaagtacatgaagactttgaactacttgaaattgaggaacaatataaatgc
-l710 -1690 ~1670 —1650 -1630
aagatatcttttttcaactgagttaattaatcttataaagactgagtttttaatcagttcatcaatttttgtttattcttctctgtcttt
~1610 -1590 -1570 -1550
gattagattgtcctcttcatggaaaagtagtacagcatttcttcaatcaattaaaaaaacagttcaaatgtcagatcttgaagtaaatcc

-1530 -1510 -1490 -1470 -1450
ttcaaaactgcaagagtacactctttgcaaagaaaacctttcttcggtatgttc-attcattcagtgtatgtaggctaatt
-l430 -1410 -1390 -1370
ttaatattcaacccactcttgaatttccactttgggtattatctactttcaatatttaatcccagaatgacttctctttgcctcacagca
—1350 ~1330 -1310 -1290 -1270
ggctcccagattacctctttttctctgattagttagtatggcttcagggaatatcttctttttaacattaaactgggcaaaaacagaaat

-1250 -1230 -1210 -1190
agaaagaaaaat-atcaaaaatagaattcacagctaaatataaatctggagggaattattcaattatttgaatggtcccca
—1170 -1150 -1130 -1110 -1090
atcacagacaatccagggttgattgacttttgctttttccatatgtagaacaaaatggttaacaaataccaagagtaatattttttttct

—lO7O -1050 —1030 —1010
tttgaagcataatactttttaatagtatcttaaatgttattttctttcccaaatccctttatattattatatcatgtgcttttcacaact

-990 —970 —950 -930 -910
gcatgcattctctttggggaccttccagtctcattctgacttgtaagtcagagagcattgatcttggaagaccaggatttgttaacggag

-890 -870 -850 -830
tcgcggtgcaaac—tttttcagttgctttgttcctttcactctgctgagctagacttggagtggacgactctgaagggaaat
-810 -79O -770 -750 -730
tccctgcttcttttcagagtcccaatttaatttacaggctagcaattgtttttttaaggttggatcaacaccaagtagggacttggaaac
—710 -690 —670 -650
gtggagaaagacagatgtaagtgtcacacgaggcaaggtcgccattaaatacacaaatataatgcaaatcacatgcaaatgatatgcaaa
-630 -610 -59O -570 -550
ccttgcattaatttgtaggatcttagtttggagcttgtaagtagcactgagatcctataaggatttaaaactaatgttttttaggttaaa
-530 -510 -490 —470
ttaaatgtaatactttttgaaggtatcgctttctctgtgattcagggactcaactgtgtaaagtttgacactgctccctactcccgcccc
—450 -430 -410 -390 —370
caaaaattatttcactagtgtttgactccaacctacacccagcgccgcgcccactctccagctcagcctgacgtcacgtgacattatatt
-350 -330 -310 -290
tgcatactacctgggactgggtgtgacgctcccctattctgcgtcttctcattggtggcgctggagaaccagccctcttctgtacaggcc
-270 —250 —230 -210 -190
aatcagcagcccctgggatgttggaaaaccgaagggggcggtgtgagggtggggtcttggcttggatcgctaggctcatcgaccaatcat
-17O -150 -13O -110
cctcaggaaagggaaggctaagctgtggattggctggggtggaaggtctgggtttccgcagtccaatgacagctctaggatgagggggcc
-9O —7O -50 -30 -10
ggtccccgccccgtacagcagataagcagcggcctcgggggttggggggctgtgtgagtctcgcagtggggctgaggcaggcagccggga

1 10 30 50 70
gagCCATGGCGGGGGCCGCAGCGGGCGGCAGAGGCGGAGGTGCCTGGGGGCCGGGGCGCGGAGGGGCCGGGGGGCTCCGGCGGGGCTGCT
90 110 130
CTCCCCCAGCCCCCGCCGGCTCCCCCCGGGCTGGGCTGCAGCCGCTCAGGGCCACGATCC

Figure 4. The approximate 2kb upstream sequence of CDDP-1 cDNA contains four
copies of putative CIEBP binding sites (boxed regions). The adenine residue of the
first ATG codon in CDDP-1 open reading frame was arbitrarily numbered +1.

61

l

12345678

 

 

 

 

 

 

 

 

A

B

C .. . .

D .. t

E v o O c o oQ+BM

F .

G .0 c

H 4

FL

12345678
mmmmmwrmm

Ammmmmmmm

Bun rigalde and
mmwmmmmm

C mate

memmmwm

93993693119399“

WMNWWW[WW

E me lamembmmv

Fammugtaraapamal
wwwwwuaaa

Gummmmwwnsug
mmEdEaiRlyhnmhnmtmm

memmmwmmm

 

 

 

 

 

 

 

 

 

 

Figure 5. CDDP-1 RNA is expressed most highly in adult bone marrow
and in fetal liver A multiple tissue RNA dot blot (Clontech) showed that
CDDP-1 was expressed in a variety of tissues with highest expression
in fetal liver and bone marrow.

62

gdaa/o+€Ioozs
eloozs

LZOI

(L'll) L088€d
L'VLZIHEIM
09"IH

LW

OSWCI+8888 1.

8888
€J.€H|N
9 L8d
Z'TLLO

7‘13
ZLW

ZOL

“ CDDP-1

 

 

63

I
D
CL
4:
(D

 

Figure 6. Northern blot of a panel of hematopoietic cell lines.

CDDP-1 is predominantly a cytoplasmic protein. In order to verify that the open
reading frame observed in the CDDP-1 cDNA was expressed as protein and to
examine the subcellular localization of its expression, an antiserum specific for
CDDP-1 was generated. A Western blot showed the apparent molecular weight
of CDDP-1 to be 48 kDa (Fig. 7). This is in good agreement with the calculated
weight of the CDDP-1 protein from its translated sequence. An examination of
cellular localization of CDDP-1 in cytoplasmic versus nuclear fractions of MPRO,
8888, and U937 cells revealed a largely cytoplasmic localization (Fig. 8). The
localization of CDDP-1 protein followed that of lactate dehydrogenase, an
exclusively cytoplasmic protein. The small amount of CDDP-l observed in the
nuclear fraction of MPRO cells is likely an artifact since lactate dehydrogenase
contaminates the nuclear fraction to the same extent. To examine whether the
subcellular localization of CDDP-1' changes as cells differentiate, the U937 cells
were treated with ATRA to induced neutrophilic differentiation. Both cytoplasmic
and nuclear extracts were prepared over a time course of four days. CDDP-1
protein could only be detected in the cytoplasmic fractions. As a control for
nuclear protein, SM protein, which is a component of spliceosome, could only be
found in the nuclear fractions. As an additional control, RARcr, a transcription
factor that appeared in both the cytoplasmic and the nuclear fractions in
untreated cells, translocated into nucleus upon ATRA treatment. All the above
evidence strongly suggestes that CDDP-1 is predominantly a cytoplasmic

protein. Immune-fluorescent studies using CDDP-1 specific anti-serum in MPRO

64

Immune Serum Pre-lmmune Serum

GST
GST-CDP1
MPRO
GST
GST-CDP1
MPRO

KDa
._....._—— 48.3—
—33.4—
.. --— 28.3—-

"" —19.4—

n
a

 

Figure 7. Western analysis comparing CDDP-1 antiserum to pre-
immune serum. The samples examined were a control bacterial
lysate with GST protein (GST), a bacterial lysate containing the
GST-CDDP-1 fusion protein (GST-CDDP-1), and a cellular
lysate MPRO cells.

65

 

MPRO 8888 U937

c N c N c N
w“ :— coop-1

 

 

 

H {- LDH

 

B

U937 cells Days in ATRA

_°- .1. ._2_ .3. _4_

C N C N C N C N C N

\ n l. - au- CDDP-1
.. a. a... "' SM

.35. . - _.

‘4...” a . H iii-u ; RARa

Figure 8. Western analysis of cytoplasmic (C) and nuclear (N) fractions
from MPRO, 8888, U937 (A) and a time course of U937 neutrophilic
differentiation induced by ATRA for four days (8). Porteins were
detected with antiserum specific to CDDP-1, lactate dehydrogenase
(LDH), SM, and retinoic acid receptor a (RARa).

66

promyelocytes showed that CDDP-1 protein existed mainly in the cytoplasm
(data not shown).

CDDP-1 mRNA is up-regulated during neutrophilic differentiation and down-
regulated during monocytic differentiation. The expression pattern of CDDP-1
mRNA was next examined in time courses of neutrophilic differentiation of
several immature myeloid cell lines: 320 clone 3 myeloblasts (Figure 9), MPRO
promyelocytes (Figure 10), and bipotential HL—60 late myeloblasts (Figure 11). In
all three cell lines, CDDP-1 RNA was induced by 24 hours. In 320 clone 3 cells,
CDDP-1 reached peak levels of expression ahead of myeloperoxidase, and then
is downregulated while myeloperoxidase expression is still robust. In this
experiment, viability could not be maintained past 5 days and, thus, the temporal
relationship to lactoferrin expression could not be examined. In MPRO cells,
peak CDDP-1 expression is coincident with lactoferrin expression, which would
seem later than its expression in 320 clone 3 cells. However, CDDP-1 initially
shows a decrement in RNA levels followed later by induction. Myeloperoxidase
mRNA levels decrease with CDDP-1 levels suggesting that the expression of
CDDP-1 may be biphasic: a period of elevated expression associated with the
transcription of primary granule protein-encoding genes (myeloperoxidase) and a
period of elevated expression associated with secondary granule protein-
encoding genes (lactoferrin). In HL-60 cells, myeloperoxidase is expressed at a
relatively high level in uninduced cells and lactoferrin expression is not observed
(data not shown), making it difficult to place CDDP-1 expression in a temporal

sequence with these markers of neutrophilic differentiation. However, CDDP-1

67

Days of G-CSF Treatment
0 1 2 3 4 5

 

8g 2 CDDP4

 

 

Figure 9. RNA was isolated from a time course of G-CSF-induced
differentiation of 320 clone 3 cell. A northern blot was
successively hybridized with probes for CDDP-1,
myeloperoxidase (MPO), and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH).

68

Hours of ATRA Treatment

 

0 24 6244890120

vu‘y

. _ , ‘le‘tf. —- J‘.‘€I“ 1.?Oq‘¢
. . . - A .. .. g 3.1. ', )" ‘
l . -
r .“. ,. _ r‘ 35"." , .
' I :45 . "'}" ‘ V ' ' V CDD -1

. «ma 5 . w w. MPO

 

LF

 

M C/EBPs

 

 

Figure 10. RNA was isolated from a time course of all trans tetinoic
acid (ATRA)-induced differentiation of MPRO cells. A northern blot
was successively hybridized with probes for CDDP-1,
myeloperoxidase (MPO), lactoferrin (LF), ClEBPs and
glyceraldehyde-3—phosphate dehydrogenase (GAPDH).

69

 

Days of ATRA PMA
Treatmento123 4 512 34

r if Q O 8 fl coop-1
c-FMS

\ . . , .
f ._ . fl ~ 7 - t
. M I O
s ‘. ' ' r
.’ 'g . , . :
. In oiru' ' ‘ ‘ 4‘ -L', A ' 0' ' ' '

tag if; it it i I . t ”- = C/EBPa
4C/EBPB
. I C/EBPS

C/EBPs

9 ”r
J V‘“ A
:053’4 ..
‘ :"wn . 2
‘4‘;
.3. t- ‘
:.~‘:3..-\,»- .

"?:“GAPDH

 

‘1 31“"
'm'

Figure 11. RNA was isolated from a time course of all trans retinoic acid
(ATRA)-induced differentiation and PMA-induced differentiation of HL-
60 cells. A northern blot was successively hybridized with probes for
CDDP—1, c-fms, myeloperoxidase (MPO), ClEBPa, CIEBPfl, CIEBPS,
ClEBPe, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

70

induction parallels that of C/EBPe in these cells placing its expression after
acquisition of C/EBPor expression, but prior to peak expression of C/EBPIS and
C/EBPS. In contrast to the induction of CDDP-1 RNA with neutrophilic
differentiation in the three cell lines we examined, CDDP-1 RNA was
downregulated with monocytic differentiation of HL-60 cells (Fig. 11). This is
consistent with the lack of CDDP-1 expression in mature macrophage cell lines
that was observed in Fig. 6. CDDP-1 expression is thus associated with
neutrophilic as opposed to monocytic differentiation. The data collectively
suggest a role in the later stages of neutrophilic differentiation, being similar to
that of C/EBPs (MPRO, Fig. 10; HL-60, Fig. 11). In relation to the expression of
genes encoding granule proteins, the timing of CDDP-1 expression may be
biphasic: expression is associated with induction of myeloperoxidase expression
(320 clone 3, Fig. 9) and again 'with the later induction of lactoferrin expression
(MPRO, Fig. 10). CDDP-1 expression is thus first observed at the promyelocyte
stage of differentiation.

In order to better explore earlier timepoints in the course of
myelomonocytic differentiation, CDDP-1 expression was examined during the
myeloid differentiation of the EML-C1, a hematopoietic stem cell line. Northern
analysis of RNAs isolated over a time course of ATRA-induced differentiation
showed CDDP-1 to be transiently expressed in parallel to myeloperoxidase (Fig.
12). This timing is slightly later than the observations obtained from the
differentiation of 320 clone 3 myeloblasts (Fig. 9). Granulocyte-macrophage

colony-stimulating factor-treated products of EML-Ct differentiation are blocked

71

Hours of ATRA Treatment

 

0 2 4 824 4872 96120144

  

 

MPO

 

GAPDH

 

Figure 12. RNA was isolated from a time course of ATRA-induced
differentiation of EML-C1 cells. A northern blot was successively
hybridized with probes for CDDP-1, myeloperoxidase (MPO), and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

72

at the promyelocyte stage unless further treated with retinoic acid (T sai et al.,
1993). MPRO, which displayed induction of CDDP-1 RNA at the point of
lactoferrin induction (Fig. 10), is analogous to such promyelocytes (Tsai et al,
1994) and its differentiation can be considered an extension of the EML-C1 time
course. Thus, the results from EML-C1 are consistent with a biphasic induction of
CDDP-1 occurring first with myeloperoxidase induction and then again with
lactoferrin induction, indicating that CDDP-1 may play a role in both the early and
later stages of myeloid differentiation.

Constitutive overexpression of CDDP-1 in MPRO promyelocytes promotes their
differentiation. The close temporal association of CDDP-1 with genes encoding
granule proteins led us to ask whether CDDP-1 encodes a novel granule protein
or a novel regulator of granule protein expression. In order to address that
question, we produced stable transductants of MPRO cells with either a retroviral
vector constitutively expressing CDDP-1 or an “empty vector" control. The vector
used, pBABE-Puro, allowed selection of stably transduced cells by puromycin
selection (Morgenstem and Land, 1990). Three independent retroviral
transduction experiments were carried out generating a total of 10 cell
populations overexpressing CDDP-I, as well as 12 control populations. RNAs
were isolated from all of these cell populations and analyzed by Northern blots.
All of the CDDP-1 transductants showed high levels of vector-derived CDDP-1
expression. Significantly, six of the populations transduced for CDDP-1
expression showed a more differentiated neutrophilic phenotype than the control

populations. They showed a higher proportion of band form and

73

polymorphonuclear cells (Fig. 13) and elevated levels of the mRNAs encoding
the primary granule proteins, myeloperoxidase, cathepsin G, and lysozyme. Four
of the CDDP-1 transductants also showed elevated levels of lactoferrin mRNA
(Fig. 14). Lactoferrin is a secondary granule protein that is only expressed after
the more mature myelocyte stage of neutrophilic differentiation. A western blot
confirmed that CDDP-1 transductants also expressed elevated levels of CDDP-1
protein in comparison to control transductants (Fig. 15). Furthermore, when the
neutrophilic CDDP-1 transductants were treated with ATRA to induce
differentiation, they all displayed a more rapid morphological differentiation than
control populations with band cells and polymorphonuclear cells consistently
appearing a day ahead of controls (Fig. 16).

Interestingly, two of the CDDP-1 transductants showed morphological
features suggesting monocyte/macrophage differentiation. These transductants
had become very adherent to their culture plates with a typical monocytic
morphology: higher cytoplasm/nucleus ratio, pseudopods, and a foamy
cytoplasm with many vesicles (Fig. 13). A Northern blot analysis showed
diminished levels of myeloperoxidase expression compared to controls (Fig. 17).
This is consistent with monocytic differentiation. Two of the CDDP-1-
overexpressing populations showed no dramatic differences from the control
populations. Taken together, these data point to a role for CDDP-1 in promoting

both the neutrophilic and monocytic differentiation of MPRO promyelocytes.

74

MPRO-puro

MPRO-CDDP-1 #1

MPRO-CDDP-1 #9

 

Figure 13. Wright-Giemsa staining of representative CDDP-1
transductants of MPRO cells with either neutrophilic (N) or monocytic
(M) morphology. MPRO-puro represents transductants infected with a
control retrovims.

75

MPRO-Puro MPRO-CDDP-1

 

12341234

    
 

‘- Retrovira|

‘ - EndOgenous

coop4

LF

MPO w=~.»

 

CG

GAPDH

 

Figure 14. RNA was isolated from 4 independent populations of MPRO
cells infected with a CDDP-1 expressing retrovirus. A northern blot was
successively hybridized with probes for CDDP-1, lactoferrin (LF),
myeloperoxidase (MPO), cathepsin G (CG), and glyceraldehyde-3-
phosphate dehydrogenase (GAPDH).

76

MPRO-Puro MPRO-CDDP-1

 

 

Figure 15. A western blot using CDDP-1-specific antibody showed
elevated levels of CDDP-1 protein expression in three independent
MPRO transductants of CDDP-1 (MPRO—CDDP-1) in comparison to
control transductants (MPRO-Puro).

77

MPRO-puro + ATRA MPRO-CDDP-1 + ATRA

di .1 ' 8| QV’h 1'

DayO

 

Figure 16. Wright Giemsa staining of a population of control MPRO cells and
a population of CDDP-1 MPRO transductants over a time course of
differentiation after treatment with ATRA. The numbers at the lower right
corner of each figure represent percentage of mature band form and
polymorphonuclear cells. The examples shown are representative.

78

   

o
‘— 2 0
=11: =14: ‘-
o ‘— o ,— 7*
‘- ' ‘- | o ‘—
11: D. *1: n_ ‘— I
o D o D a: 0'
. Q L o D
a :I D h
o. C? Q 0 3 D
l I I O. 0
O O O O ' '
c: 0: a: a: O 0
g g a a E E
y .2 5 5 2
Em «trauma! ‘ ‘ _ , . ,1 .
£9} . ‘ _.1_
g. ' :3.”
, -. Pg? ‘
a”
1,. .1
CDDP-1 MPO GAPDH

Figure 17. RNA was isolated from a population of MPRO cells infected
with a control retrovirus (Puro #10) and a population infected with a
CDDP-1 expressing retrovirus (CDDP-1 #10). A northern blot was
successively hybridized with probes for CDDP-1, myeloperoxidase
(MPO), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

79

CDDP-1 was upregulated upon ATRA-induced differentiation of HL60,
MPRO and EML-C1 cell lines (Figs. 10, 11, 12). When overexpressed in MPRO
cells, CDDP-1 facilitated ATRA-induced neutrophil differentiation (Fig. 16). In
addition, a weak homology (31% identity over a region of 101 amino acids) was
found between CDDP-1 and SMRT (Silencing Mediator of Retinoid and Thyroid
hormone action), a transcriptional co-repressor protein for retinoic acid receptor
(NCBI). These findings led to the hypothesis that CDDP-1 might be an effector
protein in retinoic acid signaling. To explore this, transient transfection assays of
CDDP-1 using a retinoic acid response element (RARE) promoter-reporter were
conducted in CV-1 cells. However, no consistent activation of this reporter by
CDDP-1 was observed either in the presence or absence of retinoic acid receptor
or and retinoid-X receptor or expression, and in the presence or absence of
treatment with ATRA (data not shbwn).

To further explore the mechanism of CDDP-1 in promoting
myelomonocytic differentiation, we performed a series of transient transfection
experiments in P388T lymphoblastic cells using promoter-reporter constructs
driven by several promoters that are active in myeloid cells including those for
the myeloperoxidase, G-CSF receptor, M-CSF receptor, and IL-6 genes.
However, none of these promoter-reporter constructs could be activated by
CDDP-1 (data not shown). Since myeloperoxidase was upregulated in several
instances of CDDP-1 overexpression in MPRO cells, that induction is likely not a
direct result of CDDP-1 expression. Rather, it is more likely that myeloperoxidase

is upregulated as part of a more general differentiation program that is induced

80

by CDDP-1 expression. The failure of CDDP-1 to activate the other promoters
demonstrates that CDDP-1 is likely not a direct activator of myeloid gene
expression.

CDDP-1 expression is also modulated in erythroid and mast cell differentiation.
Northern analysis of a panel of hematopoietic cells (Fig. 6) found that CDDP-1
was expressed in a broad range of hematopoietic cells, being absent only in
mature macrophage cell lines and a C08+ T cell line. Since the EML-C1 cell line
can easily be induced toward erythroid and mast cell differentiation, the pattern of
CDDP-1 expression was examined in time courses of differentiation of these two
lineages. A Northern analysis of RNAs isolated over a time course of
erythropoietin (EPO)-induced differentiation of EML-C1 cells along the erythroid
lineage showed CDDP-1 mRNA to be upregulated prior to B-globin, after one day
treatment in EPO. The highest level of expression occurred at day three. Then
CDDP-1 was downregulated to basal levels as B-globin expression kept
increasing until day seven of EPO treatment (Fig. 18). A more complete time
course of dimethyl sulfoxide-induced differentiation of 8888 cells (initially
examined in Fig. 6) revealed CDDP-1 to be induced by 10 hours post-induction,
prior to induction of B-globin (Fig. 19). Northern analysis of RNAs isolated over a
time course of differentiation of EML-C1 cells along the mast cell lineage showed
CDDP-1 to be upregulated after one day of induction in WEHI-3 conditioned
media (as a source for lL-3). High levels of CDDP-1 expression were maintained

until 6 days of treatment (Fig. 20).

81

 

Days of EPO treatment
0 1 2 3 4 5 6 7

 

 

., .
. . . - .
, ' .L, ...._'.. .t. ."". 3‘ . -‘. - . . . ' 1.‘ , I .
_ ‘ . . . . .
a m“ , . . . ' ., V 4. \
A ,‘<, . . . . ' I .
p’ ,‘7.' . . ‘ ‘ ~
. ‘ 1.. , .
1 K‘J’b’ . .. . ' . K -
. ‘ 7”,, . u- ‘ - g’y .7 - ~ ' . ‘v .' , w .
. ~ - ,, '. ’ '
,, ~- , , ‘, ,- ' '.

 

Figure 18. RNA was isolated from a time course of EPO-induced
differentiation of EML-C1 cells. A northern blot was successively
hybridized with probed for CDDP-1, B-globin, and glyceraldehyde-
3-phosphate dehydrogenase (GAPDH).

82

Hours of DMSO Treatment

 

O 2 4 10 27 72120

c a 42* i c-MYB

 

B-Globin
.... fl -. GAPDH

Figure 19. RNA was isolated from a time course of DMSO-induced
erythroid differentiation of 8888 cells. A northern blot was successively
hybridized with probes for CDDP-‘l, B-globin, and glyceraldehyde-3-
phosphate dehydrogenase (GAPDH).

83

Days in WEHl-3 conditioned media

 

O 1 :2 13 4- 5 6 7

CDDP4

Q'GAPDH

 

Figure 20. RNA was isolated from a time course of lL3-induced
mast cell differentiation of EML-C1 cells. A northern blot was
successively hybridized with probes for CDDP-1 and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH). WEHl-3
conditioned medium provides a source for lL—3.

84

The EML-Cl cell line does not yield adequate numbers of lymphoid cells
for Northern analysis. In order to examine differential expression of CDDP-1 in
the course of 8 cell differentiation, RNAs were isolated from a panel of 8 cell
lines representing several stages of differentiation: 702 is a pre-B cell line that is
positive for cytoplasmic IgM but negative for cell surface lgM; M12 is a 8 cell line
negative for cell surface lgM; R1 and R2, are pre-B cell lines that are negative for
surface, as well as being negative for cytoplasmic lgM heavy chain. Northern
analysis revealed that while CDDP-1 is expressed in pre-B (702) as well as in 8
(M12) cells (Fig. 6), there may be differential expression in regard to neoplastic
transformation (Fig. 21). R1 and R2, two v-H-ras-transformed pre-8 cell lines
(Schwartz et al., 1986), expressed a higher molecular weight form of CDDP-1
mRNA than that observed in the various myeloid cell lines, the M12 8 cell line,
and the 702/3 pre-B cell line (See Fig. 6). On the other hand, non-transformed
clone 1 and clone 3 pre-B cell lines (Whitlock et al., 1983) did not express CDDP-
1 mRNA (Fig. 21).

85

S17
pre-B H
pre-B K
cmm21
R1

R2

{-CDDP-1?

 

4-coDP-1?

GAPDH

 

Figure 21. Two mRNA species in v-H-ras-transformed pre—B cell lines
(R1 and R2) can be detected using CDDP-1 probe. Non-transfonned
control pre-B cell lines (pre-B H and pre—B K) do not express CDDP-1

mRNA. S17 and CW6.21 are stromal cell lines used to culture the pre-B
cells.

DISCUSSION

CIEBPB was overexpressed in 320 clone 3 myeloblasts and differential
display RT-PCR was performed to identify genes induced by C/EBPIS
overexpression. Among the four genes identified, two were endogenous retroviral
elements, one encoded a cathepsin G, a primary granule protein of neutrophils
and monocytes (Heusel et al., 1993), and one encoded a novel gene that we
have named CDDP-1. CDDP-1 displays a biphasic pattern of expression in the
granulocytic differentiation of myeloid progenitor cell lines: an early period of
elevated expression just prior to and continuing through the induction of
myeloperoxidase mRNA (Figs. 9 and 12) and a later second period coincident
with the expression of lactoferrin mRNA (Fig. 10). This pattern of expression
coupled with the finding-that CDDP-1 is most highly expressed in adult bone
marrow and fetal liver (Fig. 5) suggests a role in myelopoiesis. Indeed, the
overexpression of CDDP-1 in MPRO promyelocytes promoted their differentiation
toward both the neutrophil and monocyte lineages (Figs. 13, 14, 17).

The biochemical function of CDDP-1 remains unknown. Bioinformatic
approaches have not been informative as the predicted protein structure of
CDDP-1 bears little homology to proteins of known function. CDDP-1’s largely
cytoplasmic localization (Fig. 8) provides scant evidence of its molecular function
other than eliminating the possibility of its being a transcription factor. CDDP-1 is
upregulated in several cell lines where differentiation is induced by treatment with

retinoic acid, such as EML-C1, MPRO, HL-60 and U937. Additionally, when

87

CDDP-1 is overexpressed in MPRO cells, it can facilitate their retinoic acid-
induced differentiation into neutrophils (Fig. 16). This may simply be a reflection
of CDDP-1 being one of many genes that are part of the process of myeloid
differentiation that is induced in these cells by retinoic acid. On the other hand,
CDDP-1 may have a functional relationship to retinoic acid signaling. A weak
homology was observed between CDDP-1 and SMRT (Silencing Mediator of
Retinoid and Thyroid receptor) (Chen and Evans, 1995). Transient transfection
assays with a retinoic acid response element (BREQ-dependent promoter-
reporter failed to find any enhancement of promoter activity by CDDP-1 (Data not
shown) suggesting no direct involvement in retinoic acid dependent signaling.
C/EBPor-deficient mice are completely lacking in neutrophils and
eosinophils (Zhang et al., 1997), while ‘C/EBPs-deficient mice lack functional
neutrophils and eosinophils (Yamanaka et al., 1997). The G-CSF and the lL-6
receptors have been proposed as critical genes for neutrophilic differentiation
that are regulated by C/EBPor, but targeted gene disruption experiments have
shown that mice lacking the G-CSF and lL-6 receptors are still capable of
producing reduced numbers of mature neutrophils (Zhang et al., 1998). The
targets of C/EBPa and C/EBPs that are responsible for the defects observed in
animals that fail to express these transcription factors are incompletely identified.
Representational difference analysis has been applied to the RNAs of fetal livers
from wild type and PU.1 or C/EBPor knockout mice to identify eight novel genes
regulated during myeloid differentiation (lwama et al., 1998). As with the case of

CDDP-1, the functions of these genes are unknown. The ability of CDDP-1 to

88

promote differentiation of MPRO cells suggests that CDDP-1 may be one of the
critical genes in the differentiation of neutrophils that is regulated by C/EBPa
and/or C/EBPe. Though originally isolated through overexpression of
C/EBPB, CDDP-1 expression is also upregulated by overexpression of C/EBPa,
C/EBPS, and C/EBPe (Fig. 2). Analysis of the sequence upstream of the
translational start codon for CDDP-1 reveals several potential CIEBP binding
sites (Fig. 4) suggesting that CDDP-1 may be a direct target of CIEBP regulation.

Interestingly, the overexpression of CDDP-1 in MPRO cells yielded both
neutrophilic and monocytic differentiation (Figs. 13). This seems to be at odds
with the reduced CDDP-1 expression observed upon monocytic differentiation of
HL-60 cells (Fig. 11). Perhaps, the initial elevated expression of CDDP-1 prior to
myeloperoxidase expression that was observed in 32 D clone 3 cells reflects an
early role for CDDP-1 prior to neutrophil versus monocyte lineage commitment.
The overexpression of CDDP-1 in a cell line with stem cell properties, such as
EML-C1, may help to resolve this issue. For instance, CDDP-1-driven
differentiation toward both lineages would strengthen the case for a role in both
neutrophil and monocyte differentiation. The eventual production of CDDP-1-
deficient mice may also help to resolve this issue by determining whether one or
both lineages would be affected in such animals. The modulation of CDDP-1
expression in both erythroid (Figs. 18, 19) and mast cell (Fig. 20) differentiation,
as well as the observation of a uniquely sized RNA species in transformed pre-B

cells (Fig. 21) suggests roles for this gene in the differentiation of these other

89

lineages. Again, overexpression in EML-C1 and the development of CDDP-1-

deficient animals will be helpful in elucidating this finding.

90

REFERENCE

Akira, S., H. lsshiki, T. Sugita, O. Tanabe, S. Kinoshita, Y. Nishio, T.
Nakamima, T. Hirano, and T. Kishimoto. 1990. A nuclear factor for lL-6
expression (NF-IL6) is a member of a C/EBP family. EMBO J. 9:1897-1906.

Bretz, J. D., S. C. Williams, M. Baer, P. F. Johnson, and RC. Schwartz. 1994.
CIEBP-related protein 2 confers Iipopolysaccharide-inducible expression of
interleukin 6 and monocyte chemoattractant protein 1 to a lymphoblastic cell
line. Proc. Natl. Acad. Sci. USA 91: 7306-7310.

Chang, C. J., T.-T. Chen, H.-Y. Lei, D.-S. Chen, and S.-C. Lee. 1990.
Molecular cloning of a transcription factor, AGP/EBP, that belongs to
members of the C/EBP family. Mol. Cell. Biol. 10:6642-6653.

Chen, J. D., and R. M. Evans. 1995. A transcriptional co-repressor that
interacts with nuclear hormone receptors. Nature. 377:454-457.

Chih, D. Y., A. M. Chumakov, D. J. Park, A. G. Silla, and H. P. Koeffler. 1997.
Modulation of mRNA expression of a novel human myeloid-selective
CCAAT/enhancer binding protein gene (C/EBPe). Blood 90: 2987-2994.

Chumakov, A. M., Grillier, E. Chumakova, D. Chih, J. Slater, .and H. P.
Koeffler. 1997. Cloning of the novel human myeloid-cell-specific C/EBPe
transcription factor. Mol. Cell. Biol. 17: 1375-1386.

Descombes, P., M. Chojkier, S. Lichtsteiner, E. Falvey, and U. Schibler.
1990. LAP, a novel member of the CIEBP gene family, encodes a liver-
enriched transcriptional activator protein. Genes Dev. 4:1541-1551.

Donner, L., L. A. Fedele, C. F. Garon, S. J. Anderson, and C. J. Sherr. 1982.
McDonough feline leukemia virus: characterization of the molecularly cloned
provirus and its feline oncogene (v-fms). J. Virol. 41: 489-500.

Fort, P., L. Marty, M. Piechaczyk, S. El Salrouty, C. Dani, J. Jeanteur, and J.
M. Blanchard. 1985. Various rat adult tissues express only one major mRNA
species from the Glyceraldehyde-3-phosphate—dehydrogenase multigenic
family. Nucleic Acids Res. 13: 1431-1442.

Furutani, Y., M. Notake, T. Fukui, M. Ohue, H. Nomura, M. Yamada, and S.
Nakamura. 1986. Complete nucleotide sequence of the gene for human
interleukin-1-alpha. Nucleic Acids Res. 14: 3167-3179.

Heusel, J. W., E. M. Scarpati, N. A. Jenkins, D. J. Gilbert, N. G. Copeland, S.
D. Shapiro, and T. J. Ley. 1993. Molecular cloning, chromosomal location,

91

and tissue- specific expression of the murine cathepsin G gene. Blood 81:
1614-1623.

Hohaus, S., M. S. Petrovick, M. T. Voso, 2. Sun, Zhang, D.-E., and D. G.
Tenen. 1995. PU.1 (Spi-1) and C/EBPor regulate expression of the

granulocyte-macrophage colony-stimulating factor receptor gene. Mol Cell.
Biol. 15: 5830-5845.

Hu, H.-M., M. Baer, S. C. Williams, P. F. Johnson, and R. C. Schwartz. 1998.
Redundancy of C/EBPa, -B, and —6 in supporting the Iipopolysaccharide-
induced transcription of lL-6 and monocyte chemoattractant protein-1. J.
Immunol. 160:2334-2342.

lwama, A., P. Zhang, G. J. Darlington, S. R. McKercher, R. Maki, and G. G.
Tenen. 1998. Use of RDA analysis of knockout mice to identify myeloid genes
regulated in vivo by PU.1 and C/EBPor. Nucleic Acids Res. 26: 3034-3043.

Johnson, P. F. and S. C. Williams, 1994. CAAT/enhancer binding (C/EBP)
proteins. In Liver Gene Expression, Yaniv, M. and Tronche, F. (eds.) Raven
Press, New York, pp. 231-258.

Kinoshita, S., S. Akira, and T. Kishimoto. 1992. A member of the C/EBP
(family, NF-ILSB, forms a heterodimer and transcriptionally synergizes with NF-
IL6. Proc. Natl. Acad. Sci. USA 89: 1473-1476.

Liu, F., H. Y. Wu, R. L. Wesselschmidt, T. Komaga, and D. C. Link. 1996.
Impaired production and increased apoptosis of neutrophils in granulocyte
colony-stimulating factor receptor-deficient mice. Immunity 5: 491-501.

Lowenstein, C. J., E. W. Alley, P. Raval, A. M. Snowman, S. H. Snyder, S. W.
Russell, and W. J. Murphy. 1993. Macrophage nitric oxide synthase gene:

two upstream regions mediate induction by interferon y and
Iipopolysaccharide. Proc. Natl. Acad. Sci. USA 90: 9730-9734.

Mann, R., R. C. Mulligan, and D. Baltimore. 1983. Construction of a retrovirus
packaging mutant and its use to produce helper-free defective retrovirus. Cell
33: 153-159.

Morgenstem, J. P., and H. Land. 1990. Advanced mammalian gene transfer:
high titre retroviral vectors with multiple drug selection markers and a
complementary helper-free packaging cell line. Nucleic Acids Res. 18: 3587-
3596.

Morosetti, R., D. J. Park, A. M. Chumakov, l. Grillier, M. Shiohara, A. F.

Gombart, T. Nakamaki, K. Weinberg, and H. P. Koeffler. 1997. A novel,
myeloid transcription factor, C/EBPe, is upregulated during granulocytic, but

92

not monocytic, differentiation. Blood 90: 2591-2600.

Natsuka, S., S. Akira, Y. Nishio, S. Hashimoto, T. Sugita, H. lsshiki, and T.
Kishimoto. 1992. Macrophage differentiation-specific expression of NF-IL6, a
transcription factor for interleukin 6. Blood 79:460-466.

Pear, W. S., G. P. Nolan, M. L. Scott, and D. Baltimore. 1993. Production of
high-titer helper-free retroviruses by transient transfection. Proc. Natl. Acad.
Sci. USA 90: 8392-8396.

Peters CW, Kruse U, Pollwein R, Grzeschik KH, Sippel AE. 1989. The human
lysozyme gene. Sequence organization and chromosomal localization.
EurJ Biochem. 182(3):507-16.

Poli, V., F. P. Mancini, and R. Cortese. 1990. lL-6DBP, a nuclear protein
involved in interleukin 6 signal transduction, defines a new family of leucine
zipper proteins related to CIEBP. Cell 63:643-653.

Radomska, H. S., C. S. Huettner, P. Zhang, T. Cheng, D. T. Scadden, and D.
G. Tenen. 1998. CCAAT/Enhancer binding protein or is a regulatory switch
sufficient for induction of granulocytic development from bipotential myeloid
progenitors. Mol. Cell. Biol. 18: 4301-4314.

Schwartz, R. C., L. W. Stanton, S. C. Riley, K. B. Marcu, and O. N. Witte. _
1986. Synergism of v-myc and v-Ha-ras in the in vitro neoplastic progression
of murine lymphoid cells. Mol. Cell. Biol. 6:3221-3231.

Scott, L. M., C. l. Civin, P. Rorth, and A. D. Friedman. 1992. A novel temporal
expression pattern of three CIEBP family members in differentiating
myelomonocytic cells. Blood 80:1725-1735.

Shirakawa, F., K. Saito, C. A. Bonagura, D. L. Galson, M. J. Fenton, A. C.
Webb, and P. E. Auron. 1993. The human prointerleukin 18 gene requires
DNA sequences both proximal and distal to the transcription start site for
tissue-specific Induction. Mol Cell. Biol. 3: 1332-1344.

Smith, L. T., S. Hohaus, D. A. Gonzalez, S. E. Dziennis, and D. G. Tenen.
1996. PU.1 (Spi-1) and C/EBPor regulate the granulocyte colony-stimulating
factor receptor promoter in myeloid cells. Blood 88: 1234-1247.

Sompayrac, L., and K. J. Danna. 1994. An amino-terminal fragment of SV40
T antigen induces cellular DNA synthesis in quiescent rat cells. Virol. 200:
849-853.

Tsai, S., and S. Collins. 1993. A dominant negative retinoic acid receptor

blocks neutrophil differentiation at the promyelocyte stage. Proc. Natl. Acad.
Sci. USA 90: 7153-7157.

93

Tsai, S., S. Bartelmez, E. Sitnicka, and S. Collins. 1994.
Lymphohematopoietic progenitors immortalized by a retroviral vector
harboring a dominant-negative retinoic acid receptor can recapitulate
lymphoid, myeloid, and erythroid development. Genes & Dev. 8: 2831-2841.

Valtieri, M., D. J. Tweardy, D. Caracciolo, K. Johnson, F. Mavilio, S. Altman,
D. Santoli, and G. Rovera. 1987. Cytokine-dependent granulocytic
differentiation: regulation of proliferative and differentiative responses in a
murine progenitor cell line. J. Immunol. 138: 3829-3835.

Verbeek, W., A. F. Gombart, A. M. Chumakov, C. Muller, A. D. Friedman, and
H. P. Koeffler. 1999. C/EBPs directly interacts with the DNA binding protein
domain of c-myb and cooperatively activates transcription of myeloid
promoters. Blood 93: 3327-3337.

Whitlock, C. A., S. F. Ziegler, L. J. Treiman, J. l. Stafford, and O. N. Witte.
1983. Differentiation of cloned populations of immature B cells after
transformation with Abelson murine leukemia virus. Cell 32: 903-911.

Williams, S. C., C. A. Cantwell, and P. F. Johnson. (1991) A family of C/EBP-
related proteins capable of forming covalently linked leucine zipper dimers in
vitro. Genes & Dev. 5, 1553-1567.

Williams, S. C., Y. Du, R. C. Schwartz, S. R. Weiler, J. R. Keller, and P. F.
Johnson. 1998. C/EBPe is a myeloid-specific activator of cytokine,

chemokine and macrophage-colony stimulating factor receptor genes. J. Biol.
Chem. 273: 13493-13501.

Yamanaka, R., C. Barlow, J. Lekstrom-Himes, L. H. Castilla, P. P. Liu, M.
Eckhaus, T. Decker, A. Wynshaw-Boris, and K. G. Xanthopoulos. 1997.
Impaired granulopoiesis, myelodysplasia, and early lethality in
CCAAT/enhancer binding protein epsilon-deficient mice. Proc. Natl. Acad.
Sci. USA 94: 13187-13192.

Yamanaka, R., G. D. Kim, H. S. Radomska, J. Lekstrom-Himes, L.T. Smith,
P. Antonson, D. G. Tenen, and K. G. Xanthopoulos. 1997a. CCAAT/Enhancer
binding protein epsilon is preferentially upregulated during granulocytic
differentiation and its functional versatility is determined by alternative use of
promoters and differential splicing. Proc. Natl. Acad. Sci. USA 94: 6462-6467.

Zhang, D.-E., P. Zhang, N.-D. Wang, C. J. Hetherington, G. R. Darlington,
and D. G. Tenen. 1997. Absence of granulocyte colony-stimulating factor
signaling and neutrophil development in CCAAT enhancer binding protein
alpha-deficient mice. Proc. Natl. Acad. Sci. USA 94:569.

94

Zhang, R, A. lwama, M. W. Datta, G. J. Darlington, D. C. Link, and D. G.
Tenen. 1998. Upregulation of interleukin 6 and granulocyte colony-stimulating
factor receptors by transcription factor CCAAT enhancer binding protein or
(C/EBPor) is critical for granulopoiesis. J. Exp. Med. 6: 1173-1184.

Zhang, Y. and W. N. Rom. 1993. Regulation of the interleukin-1B (IL-1B) gene
by mycobacterial components and Iipopolysaccharide is mediated by two
nuclear factor-IL6 motifs. Mol. Cell. Biol. 13: 3831-3837.

95

Chapter 3

The CIEBP bZlP Domain Can Mediate Lipopolysaccharide Induction of the
Proinflammatory Cytokines Interleukin-6 and Monocyte Chemoattractant

Protein-1

Hsien-ming Hu, Qiang Tian, Mark Baer,
Chauncey J. Spooner, Simon C. Williams, Peter F. Johnson, and

Richard C. Schwartz

96

ABSTRACT

C/EBPor, [3, and 5 are all expressed by bone marrow-derived macrophages.
Ectopic expression of any of these transcription factors is sufficient to confer
Iipopolysaccharide(LPS)-inducible expression of interleukin-6 (IL-6) and
monocyte chemoattractant protein-1 (MCP-1) to a B lymphoblast cell line, which
normally lacks C/EBP factors and does not display LPS induction of
proinflammatory cytokines. Thus, the activities of C/EBPcr, B, and 6 are
redundant in regard to expression of lL-6 and MCP-1. Surprisingly, the bZIP
region of C/EBPB which lacks any previously described activation domains, can
also confer LPS-inducible expression of lL-6 and MCP-1 in stable transfectants.
Transient transfections reveal that the bZlP regions of C/EBPB C/EBP8 and, to a
lesser extent, C/EBPor can activate the lL-6 promoter and augment its induction
by LPS. Furthermore, the transdominant inhibitor, LIP, can activate expression
from the lL-6 promoter. The ability of the C/EBPB bZIP region to activate the IL-6
promoter in transient transfections is completely dependent upon an intact NF-tcB
binding site, supporting a model where the bZlP protein primarily functions to
augment the activity of NF-KB. Replacement of the leucine zipper of C/EBPB with
that of GCN4 yields a chimeric protein that can dimerize and specifically bind to a
CIEBP consensus sequence, but shows a markedly reduced ability to activate IL-
6 and MCP-1 expression. These results implicate the leucine zipper domain in

some function other than dimerization with known CIEBP family members, and

97

suggest that C/EBP redundancy in regulating cytokine expression may result

from their highly related bZlP regions.

Note: This paper has been accepted for publication by The Joumal of Biological
Chemistry. In this paper, Hsien-ming Hu, a former graduate student in our lab
made the original finding that the bZIP region of CIEBPB, which lacks the
transactivation domain, can still confer LPS induced expression of lL-6 and MCP-
1 in stably transfected P38801 cells. My work was to further confirm this finding
and to explore the mechanism for this phenomenon using transient transfection
assays. My contribution for this study was to establish and optimize the transient
transfection systems in our lab and perform most of the transient transfection

. experiments used in this paper (with the exception of Fig. 8).

98

INTRODUCTION

CCAAT/enhancer binding protein (C/EBP) or, B, and 5 are members of a
family of basic region-leucine zipper (bZIP) transcription factors (reviewed in
Johnson and Williams, 1994). These proteins dimerize through their leucine
zippers and bind to a consensus DNA motif through their adjacent basic regions.
C/EBPB and CIEBPS have been implicated in the regulation of proinflammatory
cytokines as well as other gene products associated with macrophage activation
and the acute phase response. For example, the promoter regions of the genes
for interleukin-6 (IL-6), lL-1or, lL-1j3, lL-8, tumor necrosis factor or, granulocyte-
colony stimulating factor, nitric oxide synthase, and lysozyme (Akira et al., 1990;
‘FUrutani et al., 1986; Lowenstein et al., 1993; Natsuka et al., 1992; Shirakawa et
al., 1993; Zhang et al., 1993.) contain C/EBP binding sites. Furthermore, C/EBPB
and C/EBPS have both been shown to activate a reporter gene controlled by the
lL-6 promoter in transient expression assays (Akira et al., 1990; Kinoshita et al.,
1992). We have previously demonstrated that the stable expression of C/EBPB in
a murine B lymphoblast cell line is sufficient to confer Iipopolysaccharide (LPS)
inducibility of lL-6 and monocyte chemoattractant protein 1 (MCP-1) expression
(Bretz et al., 1994).

There have been some reports demonstrating specificity of a particular
C/EBP family member for a given promoter. One example is the rat CYPZD5
gene, which encodes a cytochrome P450 protein. It is transactivated

cooperatively by C/EBPB and SP1, but not C/EBPor (Lee et al., 1994). The

99

specificity of this cooperativity is determined by both the leucine zipper and
activation domains of C/EBPB (Lee et al., 1997). Another case is promoter P1 of
furin (Ayoubi et al., 1994). It is transactivated by C/EBPB but not C/EBPor or
C/EBPS. Recently, it has been reported that C/EBP6 but not C/EBPB, can
transactivate the promoter for nerve growth factor (Colangelo et al., 1998).
Conversely, C/EBPor, B and 6 are all functional in a heterologous transgenic
rescue assay for a Drosophila CIEBP mutant, slow border cells (Rorth, 1994).
Our own studies have demonstrated redundancy in the abilities of C/EBPor, B and
5 to support LPS induction of lL-6 and MCP-1 gene transcription (Hu et al.,
1998)

A simple hypothesis for the redundancy of C/EBPs that we have observed
is that only their highly homologous b2lP regions (Williams et al., 1991) are
required for activation of the lL-6 and MCP-1 genes. Against this hypothesis '
stand results obtained with a truncated form of C/EBPB that initiates at Met 132
and lacks activation domains. This protein, referred to as LIP, could not activate
transcription and, in fact, inhibited C/EBPB-mediated transcriptional activation of
an artificial promoter derived from the DE-l site of the albumin gene (Descombes
and Schibler, 1991). In this report, we have unexpectedly found that a truncated
form of C/EBPB lacking all known activation domains and consisting solely of the
C/EBPB bZIP region is capable of supporting LPS induction of lL-6 and MCP-1
expression. Furthermore, the transdominant inhibitor LIP, as well as a truncated
form of C/EBP8 and, to a lesser extent, a truncated form of C/EBPa that similarly

lack conventional activation domains have transcriptional activity on the lL-6

100

promoter. The transcriptional activity of both C/EBPB and the C/EBPB bZIP
region is completely dependent on the presence of an intact NF-KB binding site
in the lL-6 promoter, implying that these proteins primarily act by augmenting NF-
KB activity. Replacement of the leucine zipper of C/EBPB with that of GCN4
yields a chimeric protein that can dimerize and specifically bind to a C/EBP
consensus sequence, but has reduced ability to activate lL-6 and MCP-1.
Furthermore, the majority of both full length and truncated CIEBPB exists as
heterodimers with C/EBPy (lg/EBP), a C/EBP family member lacking any known
activation domains. These results imply that the leucine zipper domain has a
function beyond dimerization to known CIEBP family members, and that the
basis for CIEBP redundancy in regulating cytokine expression resides in their

highly related bZlP regions.

10]

EXPERIMENTAL PROCEDURES

Cells and cell culture-P388 cells are murine B lymphoblasts (4) (American
Type Culture Collection; CCL46). P388-CB cells and P388-Neo cells have been
described previously by Hu et al. (1998). Cells were cultured in RPMI 1640
medium supplemented with 5% fetal calf serum and 50 pM B-mercaptoethanol.
Inductions were conducted with LPS derived from Escherichia coli serotype
055:85 (Sigma) added to 10 pg/ml.

Transfections-Stable transfections were conducted with 2x106 cells, 5 pg
of DNA, and 10 pl of DMRIE-C reagent (Life Technologies) in 1.2 ml of Opti-MEM
l medium (Life Technologies). Cells were incubated in the transfection mixture for
16 h followed by addition of 2.8 ml of standard growth medium. After 24 h, the
medium was replaced with standard growth medium supplemented with G418
(Life Technologies) at 0.67 mg/ml.

Transient transfections were conducted with 2x106 cells, 4 pg of DNA,
and 8 pl of DMRIE-C reagent (Life Technologies) in 1.2 ml of Opti-MEM I
medium (Life Technologies). The DNA was comprised of either 1 pg of lL-6
promoter-reporter or albumin DE-l promoter-reporter, 1pg of SV40 early
promoter-reporter, 0.5 pg of C/EBP expression vector, and pMEX plasmid to total
4 pg. Cells were incubated in the transfection mixture for 5 h followed by addition
of RPMI 1640 medium supplemented to 15% with fetal calf serum. After 24 h, the
medium of certain transfections was supplemented with 10 pg/ml LPS. After 4 h

in the presence or absence of LPS, transfected cells were harvested, lyzed, and

102

analyzed for luciferase activity by using the Luciferase Reporter Gene Assay Kit
(Boehringer Mannheim) and for B-galactosidase activity by using the
Luminescent B-Galactosidase Genetic Reporter System ll (Clontech).

Expression vectors and promoter-reporters-For stable transfections,
C/EBPs were expressed from pZIP-NEO SV(X)1 constructs (18). C/EBP
sequences were inserted into the BamHI site of the vector. Inserted sequences
were transcribed from the Moloney murine leukemia virus promoter and the gene
conferring G418-resistance was expressed from a subgenomic splicing product
from the same promoter. For transient transfections, ClEBPs were expressed
from pMEX (Williams et al., 1991), which utilizes the Moloney murlne sarcoma
virus promoter. The construction of C/EBP deletions and CIEBPflzGLz have been
described previously (Williams et al., 1991). .

The lL-6 promoter-reporter consists of the murine IL-6 promoter (Tanabe
et al., 1988) (-250 to +1) inserted into the luciferase vector, pXP2 (Nordeen,
1988). The IL-6 promoter-reporter with a mutated NF-tcB site replaces
GGGA‘ITTTCCC with AAGA'ITI'I’C‘I'I'. The albumin DE-l promoter-reporter is
(DEI)4(-35alb)LUC (Williams et al., 1995) which is derived from pXP2 (Nordeen,
1988) and contains four copies of the DE-l element upstream of the albumin
minimal promoter. The SV40 early promoter-reporter is a commercial product,
ngaI-Control (Clontech), where the SV40 early promoter and enhancer
sequences are cloned upstream and downstream, respectively, of the IacZ gene.

RNA isolation and analysis-Total RNA was isolated using TRIzol reagent

(Life Technologies) according to the manufacturer’s directions. RNA’s were

103

electrophoresed through 1% agarose/formaldehyde gels. Transfers to
membranes were hybridized and washed to a stringency of 0.1x SSPE at 65°C.
Hybridization probes were prepared with a random priming kit (Life
Technologies) with the incorporation of 5’-[ct-32P]dATP (3000 Cmeol; DuPont-
New England Nuclear). The lL-6 probe was a 0.65 kb murine cDNA (from N.
Jenkins and N. Copeland, National Cancer Institute-Frederick Cancer Research
and Development Center). The MCP-1 probe was a 0.58 kb murine cDNA
(Rollins et al., 1988). The gcheraldehyde-B-phospahate dehydrogenase
(GAPDH) probe was a 1.3 kb rat cDNA (Fort et al., 1985).

Western analysis-Nuclear extracts were prepared as described below.
The extracts (50 pg) were adjusted to 1x Laemmli sample buffer (Laemmli, 1970)
and processed by, sodium dodecyl sulfate-12% polyacrylamide gel
electrophoresis. The gel was transferred to a.Protran membrane (Schleicher and
Schuell), and antigen-antibody complexes were visualized with the Enhanced
Chemiluminescence Kit (Amersham).

Electrophoretic mobility shift assay (EMSA)-Nuclear extracts were
prepared as follows. Cells were washed in phosphate-buffered saline and lysed
in 15 mM KCI, 10 mM HEPES [pH 7.6], 2 mM MQCI2, 0.1 mM EDTA, 1 mM
dithiothreitol, 0.1% [vol/vol] NP-40, 0.5 mM phenylmethylsulfonyl fluoride, 2.5
pg/ml leupeptin, 5 pg/ml antipain, and 5 pg/ml aprotinin for 10 min on ice. Nuclei
were pelleted by centrifugation at 14,000 x g for 20 sec at 4°C. Proteins were
extracted from nuclei by incubation at 4°C with vigorous vortexing in buffer C

(420 mM NaCl, 20 mM HEPES [pH 7.9], 0.2 mM EDTA, 25% [vol/vol] glycerol, 1

104

 

mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 2.5 pg/ml leupeptin, 5
pg/ml antipain, and 5 pg/ml aprotinin). Nuclear debris was pelleted by
centrifugation at 14,000 x g for 15 min at 4°C and the supernatant extract was
collected and stored at -70°C.

The EMSA probe was a double-stranded oligonucleotide containing an
optimal CIEBP binding site (5’-GATCCTAGATATCCCTGA'I'I'GCGCAATAGG
CTCAAAGCTG-3’ annealed with 5’-AATTCAGCTTTGAGCCTATTGCGCAATCA
GGGATATCTAG-S’) labeled with the incorporation of 5’-[a-32P]dATP (3000
Cmeol; DuPont-New England Nuclear) and Klenow DNA polymerase. A probe
containing a CTF/NF-1 biding site (Landshulz et al, 1988) (5’-GATCC‘I'I'
TGGCATGCTGCflTATG-3’ annealed with 5’-AATTCATATTGGCAGC_3ATG
QAAAG-S’) was used as a nonspecific competitor in some assays. Underlined
sequences correspond to the binding motifs of the specified transcription factors.

DNA binding reactions were performed at room temperature in a 25 pl
reaction mixture containing 6pl of nuclear extract (1 mg/ml in buffer C) and 5 pl of
5x binding buffer (20% [wt/vol] Ficoll, 50 mM HEPES [pH 7.9], 5mM EDTA, 5 mM
dithiothreitol). The remainder of the reaction mixture contained 1 pg poly(dl-dC),
1.25 ng of probe, bromophenol blue to a final concentration of 0.06% [wt/vol],
and water to volume. For supershifts, nuclear extracts were preincubated with
antibodies for 30 min at 4°C prior to the binding reaction. Samples were
electrophoresed through 5.5% polyacrylamide gels in 1x TBE (90 mM Tris base,

90 mM boric acid, 0.5 mM EDTA) at 160 V.

105

 

Antibodies-Rabbit anti-CIEBPB specific to the carboxyl terminus (product
C-19) and normal rabbit IgG were purchased from Santa Cruz Biotechnology.
Rabbit anti-C/EBPB specific to the amino terminus has been described (Williams
et al., 1991). Rabbit anti-ClEBPy (Ig/EBP) was prepared against a synthetic
peptide corresponding to the carboxyl terminus of C/EBPy and will be described

elsewhere (S. Parkin, M. B., and P. F. J., unpublished).

106

RESULTS

Ectopic expression of the bZIP domain of C/EBPfl-m We previously found
that C/EBPor, [3 and 5 were all effective in supporting the LPS-induced
transcription of the genes encoding IL-6 and MCP-1 (Hu et al., 1998). To test
whether this redundancy was based on the bZIP domain which is highly
conserved among these CIEBP family members (Williams et al, 1991), we
examined the expression of a truncated form of C/EBPB (amino acids 192-276;
C/EBP8192-275) that lacks all conventional activation and regulatory domains and
simply consists of the bZIP domain of C/EBPB (Williams et al., 1995) (Fig. 1). It
was expected that the activity of C/EBPB192-276 would be similar to that of LIP,
which initiates at Met 132 and lacks transcriptional activation domains
(Descombes and Schibler, 1991) (Fig. 1).

We performed stable transfections of P388 cells with a murine retroviral
vector expressing ClEBPB192-276, and compared those transfectants to P388-CB
cells that had been transfected with a vector expressing CIEBPB as well as a
control population transfected with the same vector lacking an expressed insert
(P388-Neo) (Bretz et al., 1994; Hu et al., 1998). P388 is a murine B
lymphoblastic cell line (Bauer et al., 1986) that lacks C/EBPor, C/EBPB, C/EBPS,
and C/EBPs expression and has been a useful system for analyzing C/EBP
protein function (Bretz et al., 1994; Hu et al., 1998). The population of cells

transfected for C/EBPB192-276 expression was designated P388-C8192-275.

107

 

Activation and Regulatory

 

 

 

 

 

 

 

 

 

 

 

   

 

 

 

 

 

 

 

 

 

 

 

Domains Basic Region Leucine Zipper

0’53” 1l -“:l I 276
UP 276
CIEBPI3192-276 276
CI EBP (1273-358 358
CIEBP5181—272 272
C/EBPy 1 151

Leucine Zipper

from GCN4

CIEBPzGLZ [ 3““.

 

 

 

 

 

, esteete
CIEBPBi9z—276~GLZ .8

FIG. 1. Structures of the various altered CIEBP isoforms used in the studies
described in this paper.

108

EMSA of nuclear extracts from transfected populations, as well as western
blot analyses, verified proper expression of stably transfected CIEBPB genes. In
comparison to nuclear extracts from P388-Neo, nuclear extracts from P388-CB
and P388-C8192-275 yielded supershifted protein-DNA complexes upon incubation
with an antibody specific for CIEBPB (Fig. 2A, lanes 5, 6, and 9). The EMSA
species that gave rise to the supershifts were also evident in the samples
incubated with normal lgG (Fig. 2A, lanes 4 and 7). As expected, the CIEBPB-
specific EMSA species from P388-013192-275 cells were of greater mobility than
those of P388-CB cells reflecting their truncated structure. Additionally, the
CIEBPB192-276 EMSA species could only be supershifted with antibody specific to
the carboxyl-terminus of CIEBPB (Fig. 2A, lanes 8 and 9), while EMSA species of
intact CIEBPB could be supershifted by both amino- and carboxyl-terminus
specific antibodies (Fig. 2A, lanes 5 and 6).

Western analysis of nuclear extracts from transfected populations
examined actual levels of protein expression of CIEBPB and P388-C8192.275 (Fig.
28). The level of C/E8P8192-275 expression in transfected cells was much lower
than that of CIEBPB. Interestingly, although the level of protein expression for
P388-013192.276 was much lower than that of intact CIEBPB, its binding activity in
the EMSA was quite high. We note that CIE8P8192-275 has been reported to have
enhanced affinity for its binding site (Williams et al., 1995).

To ensure that the supershifted species observed in Figure 2A specifically

bound to the CIEBP binding site, competitions were performed with the addition

109

 

 

A P388-Neo P388-CB i3388-Cp,,2_276 C P388-CB r>388-cp,,,2_276
r

I I l I r l
N p-N p-c N B-N p-c N B-N p-c

I I I
CIEBP CTF/NF1 CIEBP CTF/NF1

AA 414
N B-C3010030100 NB—C3010030100

3- ..., ET...

     

   

123456789 123456 789101112

 

B192-276 B Neo
B “ "6’ "’ ~ .
. -- 66.2 kDa
45
‘ -- 31
-- 21.5 '
* "~- - 14.4

FIG.2. Ectopic expression of C/EBPB and C/EBPB19M76. (A) EMSA of nuclear
extracts of P388-Neo, P388-CB and P388-Cb192_276 cells. Cell line nomenclature is
explained in Results. Binding reactions included normal rabbit IgG (N), amino-
terminal-specific C/EBPB antibody (B-N), or carboxyl-terminal-specific C/EBPB
antibody ((5-0). The positions of C/EBPzDNA complexes are indicated by open
arrows and CIEBP-specific antibody supershift species are indicated by solid
arrows. (B) Western analysis of C/EBPsz276 (8192-276) compared to CIEBPB (B) in
the P388 transfectants. Control P388-Neo (Neo) cells are included as a control.
Arrows mark the position of the CIEBP proteins. The proteins were detected with a
carboxyl-terminal-specific ClEBPfi antibody. The positions of protein standards are
noted. (C) EMSA of nuclear extracts of P388-CB and P388-C(3192_276 cells in the
presence of unlabeled competing oligonucleotide binding sites. Binding reactions
are as described for panel A except some binding reactions, in addition to specific
antibody, included 30-fold and 100-fold excess quantities of unlabeled CIEBP or
CTF/NF1 binding oligonucleotides.

110

supershifted samples (Fig. 20). All of the supershifted protein-DNA complexes
observed upon incubation with C/EBPB-specific antibody were effectively
competed by a 30-fold excess of C/EBP binding site (Fig. 20, lanes 3 and 9)
while a 100-fold excess of CTF/NF-1 binding site had little effect (Fig. 20, lanes 6
and 12). The prominent protein-DNA complex not supershifted by specific
antibody, but effectively competed by unlabeled CIEBP binding site, was
surmised to be C/EBPy (lg/EBP) (Fig. 1), which is highly expressed in immature
B cells (Roman et al., 1990). ClEBPy has been shown to act as a transdominant
inhibitor of CIEBP family transcriptional activators (Cooper et al., 1995).

To verify the expression of C/EBPy and to ascertain whether C/EBPy
might be forming heterodimers with either C/EBPB or C/EBPB192.276 , EMSA was
performed in the presence of antibodies, specific for C/EBPB and antibodies
specific for C/EBPy (Fig. 3). Nuclear extracts from P388-N60 cells clearly showed
a C/EBPyzDNA complex that could be supershifted with C/EBPy-specific antibody
(Fig. 3, lanes 1 and 2). In nuclear extracts from P388-CB cells, a single
C/EBPB:DNA complex of lower mobility than that for C/EBPy was observed and it
could be supershifted both by antibodies specific to C/EBPB and C/EBPy (Fig. 3,
lanes 4, 5 and 6). Analysis of extracts from P388-08192.275 cells found two
C/EBPB:DNA complexes, both more rapidly migrating than that for C/EBPy (Fig.
3, lane 7). The more abundant of the two C/EBPB:DNA complexes could again
be supershifted by both C/EBPB- and C/EBPy-specific antibodies (Fig. 3, lanes 8

and 9). Surprisingly, the majority of both C/EBPB and C/EBP8192-276 was found to

111

 

P388-N90 P388-CB P388'CB192-276

 

 

FIG. 3. Ectopically expressed C/EBPIS and C/EBPB192_276 form
heterodimers with CIEBPy (lg/EBP). An EMSA was performed upon
nuclear extracts of P388-Neo, P388-CB and P388-081%276 cells. Binding
reactions included normal rabbit lgG (N), carboxyl-terminal-specific C/EBPB
antibody (B), or C/EBPy—specific antibody (y). The positions of C/EBP:DNA
complexes are indicated by open arrows and CIEBP-specific antibody
supershift species are indicated by solid arrows.

112

be in heterodimers with C/EBPy (Fig. 3 and S. Parkin, M. 8., and P. F. J.,
unpublished data). Since we had previously shown that ectopic expression of
C/EBPB was sufficient to confer LPS-inducibility of lL-6 and MCP-1 to P388 cells
(Bretz et al., 1994), it is clear that C/EBPy is _n_o_t strongly inhibitory to C/EBPB
activity on the IL-6 promoter.

A truncated form of C/EBPfl lacking activation domains retains the ability
to support LPS-induced transcription of lL-6 and MOP-1 genes---- P388-CB and
P388-013192-275 cells were treated with LPS over a time course of 0, 2, 4, 8, and
24 h, and RNA was isolated. Northern analyses were performed to detect
transcripts encoding lL-6 and MCP-1. Unexpectedly, P388-013192.276 cells
behaved similarly to P388-CB cells in their ability to induce lL-6 and MCP-1
transcription in response to LPS (Fig. 4). While IL-6 and MCP-1 mRNAs were not
induced to as high a' level with C/EBPB192-275 as with intact C/EBPB and the
kinetics of their expression were somewhat altered, the activity of a truncated
form of C/EBPB lacking all known activation domains is surprising. The level of
C/EBP8192-276 expression in P388-08192-276 cells is much lower than that of
CIEBPB in P388-CB cells (Fig. 28) making its ability to support expression of lL-6
and MCP-1 all the more remarkable. A second population of P388 cells
independently transfected for expression of C/EBP8192-275 behaved similarly (data
not shown).

A chimeric form of C/EBPfl with a heterologous leucine zipper has no

activity in stable transfectants-«Since C/EBP8192-275 retains only the DNA binding

113

 

P388-N60 P388-C13 P388'CP192-276 P388’CBGLZ
I I I r I I I

r
HWISU’S024824024824 024824 024824
Treatment 3.. w .. . . ,

IL-6

. . “-4? ~ , V" .? la is
"uni-'5 .% . ‘ , ‘ ‘- «ind-- *wau— ~

 

 

   

MCP-1

   

 

FIG. 4. Transfectants of P388 that stably express CIEBPB (P388-CB) and
CIEBP8192,276 (P388-08192476) are stimulated by LPS to produce lL-6 and
MCP-1 mRNAs, while cells that express CIEBPfizGLz (P388-C863) are not
induced to produce these mRNAs. Northern analyses of lL-6 and MCP-1
expression in P388 transfectants. RNA was isolated over time courses of LPS
treatment as indicated. Twenty micrograms of RNA analyzed on northern blots
that were hybridized in parallel to probes for lL-6, MCP-1, and GAPDH.

114

and leucine zipper domains of C/EBPB yet is still active on the lL-6 promoter, we
decided to examine whether the leucine zipper domain contains determinants for
activation other than those necessary for homo-dimerization. To that end, we
tested a chimeric C/EBPB protein in which the C/EBPB leucine zipper was
replaced with that of yeast GCN4 (C/EBszGLz) (Williams et al., 1991) by stable
expression in P388 cells (P388-C833,) (Fig. 1). C/EBPflzGLz retains wild type
amino terminal activation and regulatory domains as well as the DNA binding
domain, and has previously been shown to activate transcription from an albumin
DE-I site-driven reporter (Williams et al., 1995). We verified the ability of
C/EBPfizGLz to activate a DE-l promoter in P388 cells (data not shown). In
contrast to that result, P388-083.1 cells did not induce lL-6 or MCP-I mRNA in
response to LPS (Figure 4).

To verify that CIEBPflzGLz was properly expressed in P388-08m; cells,
both EMSA and western blot analyses were performed. While a C/EBPB:G._z
protein-DNA complex was not obvious in a simple EMSA, the addition of
C/EBPB-specific antibodies revealed a supershifted protein-DNA complex with
amino-terminal specific but not carboxyl-terminus specific antibodies (Fig. 5A,
lanes 8 and 9). This result is consistent with replacement of the leucine zipper at
the carboxyl-terminus of the C/EBPB protein. These data also demonstrate that
C/EBPfizGLz retains the capacity to dimerize and bind to the optimal C/EBP
binding site. Competition experiments were performed with unlabeled C/EBP
binding site and unlabeled CTF/NF-1 binding site to verify the specificity of

C/EBPfizGLz binding (Fig. SC). The supershifted protein-DNA complexes were

115

A P388-Neo P388-CB Pasta-citGLZ C P388416 p388'CPi92—276
l l r l l l l ' P ‘

CIEBP CTF/NF1 CIEBP CTF/NF1

N B-N is-c N B-N B-C N B-N B-c

v..-” oo—n . -c—n
two-

Q—
~ {g as .‘t "t

 

AA Ad
N B-C3010030100 N B-C 30 100 30100

—> .

it
:I
I

      

123456789 123456789101112

B Neo is [you
66.2- --
. =J~gA
45__ w
; " g
3.- g...
21.5-- "" "° '“

14.4 —

FIG. 5. Ectopic expression of CIEBPB and CIEBszGLZ. (A) EMSA of
nuclear extracts of P388-Neo, P388-CB and P388-CBGLZ cells. Cell line
nomenclature is explained in Results. Binding reactions included normal
rabbit lgG (N), amino-terminal-specific C/EBPB antibody (Ii-N), or carboxyl-
terrninal-specific CIEBPB antibody (IS-C). The positions of C/EBPzDNA
complexes are indicated by open arrows and CIEBP-specific antibody
supershift species are indicated by solid arrows. The C/EBPB:GI1:DNA
complex is not observable. (B) Western analysis of ClEBPjizGLz (bzGLz)
compared to that of C/EBPb (B) in the P388 transfectants. Control P388-
Neo (Neo) cells are included as a control. Arrows mark the position of the
CIEBP proteins. The proteins were detected with an amino-terminal-
specific C/EBPB antibody. The positions of protein standards are noted. (C)
EMSA of nuclear extracts of P388-CB and P388-CbGLZ cells in the
presence of unlabeled competing oligonucleotide binding sites. Binding
reactions are as described for panel A except some binding reactions, in
addition to specific antibody, included 30-fold and 100-fold excess
quantities of unlabeled CIEBP or CTF/NF1 binding oligonucleotides.

116

effectively competed by a 30-fold excess of the C/EBP binding site (Fig. SC,
lanes 3 and 9), while a 100-fold excess of the CTF/NF-1 binding site had little
effect (Fig. SC, lanes 6 and 12). Western analyses of nuclear extracts from P388-
CBcLz cells and other transfectant populations show that, while not expressed as
efficiently as C/EBPB, the C/EBPfizGLz protein was expressed at a level
comparable to that of C/EBPj3192-276 (Figs. 28 and 58). These data suggest that
some determinant for C/EBPB activity on the lL-6 promoter, apart from homo-
dimerization, is located in the leucine zipper.

Both C/EBPflmzzm and LIP can activate the IL-6 promoter in transient
transfections---We further examined the dispensability of the amino terminal
activation domains of C/EBPB in transient transfections with an lL-6 promoter-
driven luciferase reporter. We sought to confirm the surprising results obtained in
stable transfections and to facilitate comparisons of C/EBPB with its structural
variants and analogous truncations of other CIEBP family members. P388 cells
were cotransfected with an lL-6 promoter-luciferase reporter and expression
vectors for C/EBPB, C/EBPB192-275, or LIP. These transfections were carried out
with and without LPS treatment. As with the endogenous lL-6 promoter in stably
transfected cells, both C/EBPB and C/EBPB192-2}5, and additionally LIP, were
capable of activating the lL-6 promoter-reporter to varying degrees in transient
transfections (Fig. 6). While LPS treatment of C/EBPB transfectants induced
luciferase expression by a mean value of 12-fold over an untreated, “reporter-
only" control, LPS-treatment of C/EBPB192-275 and LIP transfectants induced

luciferase expression 6.2-fold and 8.3-foId, respectively. LPS stimulation alone

117

 

Fdd Incense

 

 

LPS by LPS
Control 2'6
8192-276 3-3
LIP 3.9
+
o 5 10 15 20

Rslatlvs Luciferase Exprosslon

FIG. 6. CIEBPB1,,2,_276 (8192-276) and LIP, although lacking activation
domains, can activate the IL-6 promoter in transient transfections of P388
cells. Transient transfections were carried in out duplicate with and without
LPS treatment. Luminometer values were normalized for expression from a
cotransfected SV40 early promoter-B-galactosidase reporter. These values
were then normalized to a relative value of 1 for the cells not receiving a
CIEBP expression vector and untreated with LPS. The data presented are
the mean of 3 experiments with their standard error.

118

(without transfection of a C/EBP expression vector) produced a mean value of
only 2.6-fold over the control value. Interestingly, the transient transfections show
C/EBPs to generally elevate the level of transcription rather than mediate LPS
induction; LPS induction of luciferase expression occurs to a similar extent in
either the presence or absence of C/EBP expression (between 2.6 and 4.4-fold
[Figs. 6 and 8]). This is in contrast to stable transfection experiments where LPS
stimulation fails to induce IL-6 mRNA expression in the absence of CIEBP
expression (see P388-Neo in Fig. 4). The greater contribution of C/EBP
expression to the LPS induction of lL-6 in stable transfection experiments may be
a reflection of the more complete endogenous lL-6 promoter, or the more
repressed basal activity of the gene in a native chromatin environment.

We previously showed that LPS stimulation induces NF-icB activity in
P388 cells (Hu et al., 1998). C/EBPB and NF-KB can synergistically activate the
lL-6 promoter requiring the cognate binding sites of both factors (Matsuaka et al.,
1993). If this synergy is largely based on the capacity of the bZIP domain by itself
to modify NF-KB activity, then the activity of C/EBPB192-276 on the lL-6 promoter
should be dependent upon NF-KB. To test this notion, we repeated the transient
transfection of expression vectors for C/EBPB and C/EBPBtozm with an IL-6
promoter-reporter containing a mutated NF-KB binding site (Fig. 7). Not only was
the promoter no longer LPS-responsive in the presence of either C/EBPB and
C/EBPB192.276 expression, but C/EBPB and C/EBP8192.276 showed a complete

lack of activity in the absence of a functional NF-KB binding site. Presumably, the

119

 

 

 

 

 

 

Control

+
C/EBPB I

+ 1
8192-276

+ i I

o 5 1 o 1 5
Relative Luciferase Expression

FIG. 7. CIEBPB and CIEBPI3192_276 (13192-276) fail to activate the lL-6
promoter-reporter in the absence of a functional NF-kB binding site. Transient
transfections were carried in out duplicate with and without LPS treatment.
Luminometer values were normalized for expression from a cotransfected
SV40 early promoter-B-galactosidase reporter. These values were then
normalized to a relative value of 1 for the cells not receiving a CIEBP
expression vector and untreated with LPS. The data presented are the mean
values of one representative experiment. Open bars are values obtained with
a wild type lL-6 promoter-reporter and solid bars are values obtained with a IL-
6 promoter-reporter containing a mutated NF-KB site.

120

activity of C/EBP isoforms on the wild type lL-6 promoter in the absence of LPS
stimulation (Figs. 6, 7, and 8) reflects a low level of constitutive NF-KB activity.

The expression of both C/EBPB and C/EBP13192-275 in P388 cells as
heterodimers with C/EBPy (Fig. 3) presents the possibility that C/EBPy as a
heterodimer with other C/EBP family members is a critical factor in activation of
the lL-6 promoter. However, cotransfection of an expression vector for ClEBPy
with one for C/EBPBioem did not augment the activity of an expression vector for
C/EBPB192-275 alone and was, in fact, mildly inhibitory both with and without LPS
stimulation (Fig. 9). Thus, it is unlikely that C/EBPy is responsible for the
observed activity.

Other investigators may not have observed significant activity of
C/EBPB192-276 and LIP because they were tested on artificial promoter-reporter
constructs based on the DE-l site of the albumin promoter and were thus solely
CIEBP-dependent (Descombes and Schibler, 1991; Williams et al., 1995). We
performed transient transfections in P388 cells with a multimeric albumin DE-l
site promoter-reporter and found that C/EBPB192-276 and LIP are, in fact, inactive
on the simpler DE-l promoter, both in the presence and absence of LPS
stimulation (Fig. 10); presumably their activity on the lL-6 promoter is dependent
on interactions with other transcription factors including NF-icB that are available
on the more complex promoter.

A truncated form of C/EBPa analogous to C/EBPfl1gg.276 is capable of
activating the IL-6 promoter-«We previously showed that C/EBPor, B, and 6 have

virtually redundant activities in regard to the lL-6 promoter (Hu et al., 1998).

121

Control

(.713an

(1273—358

8181-272

13192476,“

FIG. 8. CIEBP818,_272 (8181-272), although lacking an activation domain, can
support the LPS induced activation of the IL-6 promoter in transient
transfections of P388 cells. CIEBPOtm.358 (a273-358) has modest activity in
comparison to CIEBPB. CIEBP|3192,273:6LZ (8192-27631) is inactive.
Transient transfections were carried in out duplicate with and without LPS
treatment. Luminometer values were normalized for expression from a
cotransfected SV40 early promoter-B-galactosidase reporter. These values
were then normalized to a relative value of 1 for the cells not receiving a
CIEBP expression vector and untreated with LPS. The data presented are

 

 

I I

10 20

Relative Luciferase Expression

the mean of 3 experiments with their standard error.

122

30

Fold

Increase

11le

3.5

2.0

3.6

1.4

LPS IglEBP

 

 

1
- 2
Control + -
+ 1
+ 2
- 1'
8192-276 + 2
+ 1
+ 2

0 1 0 20

Relative Luciferase Expression

FIG. 9. CIEBPy (lg/EBP) is mildly inhibitory to CIEBPBWQ76 activity on the lL-6
promoter-reporter. Transient transfections were carried in out duplicate with and
without LPS treatment. Transfected cells received 0 mg (Control) or 1 mg of
CIEBPI3192,276 expression vector (8192-276), and 0, 1, or 2 mg of C/EBPy
expression vector as indicated. Luminometer values were normalized for
expression from a cotransfected SV40 early promoter-b-galactosidase reporter.
These values were then normalized to a relative value of 1 for the cells not
receiving a CIEBP expression vector and untreated with LPS. The data
presented are the mean values of one representative experiment.

123

 

Control

CIEBPB

8192—276

LIP

 

 

1 l 1
h T l l j

0 10 20 30 40 50 60
Relaive Luciferase Btpression

 

 

 

Fig.10. CIEBPBm,276 (8192-276) and LIP fail to activate an albumin DEI site-
reporter in transient transfections of P388 cells with and without LPS stimulation.
Transient transfections were carried in out duplicate with and without LPS
treatment. Luminometer values were normalized for expression from a
cotransfected SV40 early promoter-B-galactosidase reporter. These values were
then normalized to a relative value of 1 for the cells not receiving a CIEBP
expression vector and untreated with LPS. The data presented are the mean
values of one representative experiment.

124

These earlier results suggested that whatever structural feature allows activity of
C/EBPBtozm might be a general feature of C/EBPs. To test this hypothesis, we
performed transient transfections with vectors expressing truncated forms of
C/EBPor and C/EBP6 (C/EBPct273-358 and C/EBP8131.272; Fig. 1) in comparison to
intact C/EBPB in P388 cells (Fig. 8). To more directly examine the contribution of
the leucine zipper to CIEBP activity, we also transfected a vector expressing a
truncated form of C/EBPB in which the C/EBPB leucine zipper was replaced with
that of yeast GCN4 (C/EBPB192-276:GLZ; Fig. 1). The transfections were performed
with and without LPS stimulation, and the expression vectors were cotransfected
with an IL-6 promoter-luciferase reporter. C/EBP5131.272 was almost as active as
intact C/EBPB. LPS treatment of C/EBPB transfectants induced luciferase
expression to a mean value of. 24-fold-over an untreated, “reporter-only" control,
while LPS treatment of C/EBP6151.272 transfectants induced luciferase expression
to 20-fold over the control value. CIEBPG273.353 transfectants treated with LPS
had levels of luciferase expression 7-fold over the control value and LPS
treatment by itself without transfection of a CIEBP expression vector induced a
mean value of luciferase expression only 3.8-fold of the control value. Confirming
the critical role of the leucine zipper, C/EBP8192.276:GL2 transfectants treated with
LPS had levels of luciferase expression only 2.7-fold over the control value, less
than that observed without transfection of a C/EBP expression vector. Once
again, LPS induction of luciferase expression was observed in either the
presence or absence of C/EBP expression, although in the case of C/EBPB192-

275:GLz this induction is slight at best (1.4-fold). EMSA and western blot analysis

125

did not detect C/EBPor273-353, C/EBP5131-272, or C/EBPB192-2753GLZ species (data
not shown), so their level of expression relative to C/EBPB could not be
assessed. C/EBPor273-353 expression increases the basal level of lL-6 promoter
activity without augmenting LPS induction. This modest level of activation by
C/EBPor273.353 is consistent with the reduced activity of intact C/EBPct observed in

LPS inductions of the endogenous lL-6 promoter in stable transfectants (Hu et

al., 1993).

126

DISCUSSION

The data presented in this paper demonstrate that the conventional
activation domains of C/EBPB (Williams et al., 1995) and C/EBP8 are
dispensable for their roles in the LPS-induced activation of lL-6 and MOP-1
expression. C/EBPB192.276, a truncated form of C/EBPB lacking its first 191 amino
acids, is capable of activating transcription of IL-6 and MCP-1 genes after LPS
stimulation of both stably and transiently transfected P388 lymphoblasts.
Transient transfections showed that LIP, a form of C/EBPB lacking its first 131
amino acids, and C/EBP5181-272, a truncated form of C/EBPS were also effective in
activating the lL-6 promoter. A truncated form of C/EBPct, C/EBPa273.353, also
showed modest activity.

The activity of the C/EBP bZIP domains and of LIP was unexpected.
LIP has been found to possess little or no transcriptional activity (Descombes
and Schibler, 1991; Williams et al., 1995; Cooper et al., 1995; Cooper et al.,
1994). Previous investigators may not have observed this activity because they
used different truncations of C/EBPB, different reporters and/or different cell
types in their transfection systems. Using an embryonic carcinoma cell line, an
internally deleted form of C/EBPB failed to activate the IL-6 promoter (Matsuaka
et al., 1993). This mutant, however, would have retained regulatory sequences
that inhibit transactivation potential and mediate cell specificity (Williams et al.
1995; Kowentz-Leutz et al., 1994). Others have assayed LIP and C/EBPB192-275

on promoter-reporter constructs based on the DE-l site of the albumin promoter

127

(Descombes and Schibler 1991; Williams et al, 1995) or other tandem
arrangements of C/EBP binding sites (Cooper et al, 1995; Cooper et al., 1994),
all of which are solely CIEBP-dependent. We also found that these forms of
C/EBPB are inactive on an albumin DE-l site-based promoter in P388
lymphoblasts (Fig. 10). Presumably, the activity that we have observed on
induction of lL-6 and MCP-l is dependent on interactions with other transcription
factors, such as NF-KB, that bind to these promoters.

It is interesting that the majority of both C/EBPB and C/EBPB192-275 are
present as heterodimers with C/EBPy (lg/EBP) in P388 cells (Fig. 3). Although
C/EBPy has been characterized as a transdominant inhibitor of C/EBP
transcriptional activation (Cooper et al., 1994), it does not act in that manner in
the context of the lL-6 promoter. On the other hand, C/EBPy does not appear to
be an activator of IL-6 transcription either. Endogenous expression of C/EBPy at
a level affording DNA binding activity similar to that that of C/EBPB and
C/EBPB192-275 (Fig. 3) is not sufficient to allow LPS induction of lL-6 expression.
In addition, co-transfection of a C/EBPy expression vector with a vector for
C/EBPB192-275 expression was only mildly inhibitory to LPS activation of the IL-6
promoter (Fig. 9). Since C/EBPy lacks any known activation domains and is
essentially a C/EBP bZIP domain (Cooper et al., 1995), the apparent ability of a
C/EBPB192-276:C/EBP7 heterodimer to activate the lL-6 promoter with LPS
stimulation is consistent with the C/EBPB activation domains being dispensable

for LPS-induced transcription of the lL-6 gene.

128

There is good evidence that C/EBPB and NF-KB synergistically activate
the IL-6 promoter (Matsuaka et al., 1993). C/EBPor, B, and 5 have all been shown
to synergize with NF-KB in activating the IL-8 promoter (Kunsch et al., 1994;
Stein et al., 1993). This synergy may involve direct physical association through
their respective basic region-leucine zipper (bZIP) and Rel homology domains
(Stein and Baldwin 1993, Stein et al., 1993). Thus, the basis for the ability of
truncated C/EBPs to activate the IL-6 promoter may involve the capacity of the
bZIP domain alone to synergize with NF-KB. Supporting this notion, we found
that an intact NF-icB binding site is required for C/EBP activity in transient
transfections of the IL-6 promoter-reporter (Fig. 7). Furthermore, robust activation
of the lL-6 promoter by C/EBPs is only observed under conditions of LPS
stimulation (Bretz et al., 1994,. Hu et al., 1998, this paper), and LPS stimulation
induces NF-KB activity in P388 cells (Hu et al., 1998). Future experiments will
examine the ability of truncated forms of C/EBPB as well as point mutants within
the bZIP domain, to synergize with NF-icB in activating the IL-6 promoter.

Regardless of the mechanism by which the CIEBP bZIP domain
mediates LPS induction of lL-6 and MCP-1 expression, our findings suggest that
the basis for C/EBP redundancy in the activation of these genes (Hu et al., 1998)
resides in this well-conserved region that is shared by all C/EBP isoforms. Our
experiments replacing the leucine zipper of C/EBPB with that of GCN4 suggest
that the critical structural feature for activity of bZIP domains may be further
localized to, or at least require, the leucine zipper. While the leucine zipper swap

mutant C/EBPj32GLz can transactivate a DE-l promoter-reporter in P388 cells

129

(Fig. 10), it shows no activity compared to intact C/EBPB in the LPS induction of
IL-6 and MCP-1. There is some uncertainty in the interpretation of this result
because the levels of C/EBPflzGLz expression are below that for intact C/EBPB.
On the other hand, the level of C/EBPflzGLz expression is similar to that of
C/EBP8192-276 (Figs. 28 and 58), which is a far more potent transcriptional
activator (Fig. 4). Consistent with these findings, the truncated zipper swap
mutant C/E8P8192.275:GLZ displays very little activity in transient expression
assays and may even suppress LPS-inducibility (Fig. 8). It is possible that the
leucine zipper possesses critical determinants for the activity of C/EBPs on the
lL-6 promoter in addition to mediating dimerization to known C/EBP family
members. For example, the leucine zipper might mediate dimerization to an as
yet unknown dimerization partner with inherent activation potential or, as ..
proposed above, it might mediate synergistic interaction with NF-KB. The leucine -
zippers of C/EBP proteins have previously been implicated in functions beyond
dimerization. The leucine zipper of C/EBPct has been shown to mediate cell type
specificity of albumin promoter activation (Nerlov and Ziff, 1994). Another
instance of a non-dimerization function residing in the leucine zipper is that of
serine 276 of human C/EBPB (Wegner et al., 1992). Phosphorylation of this
serine residue confers calcium-regulated transcriptional stimulation to a promoter
that contains binding sites for C/EBPB. The experiments reported here show
C/EBPor273-353 to have quite modest activity in comparison to the truncated forms
of C/EBPB and C/EBPS in transient transfections, as well as being the least able

to support LPS induction of the IL-6 promoter-reporter. It would be useful to

130

evaluate the activity of a chimeric C/EBPor with the leucine zipper of C/EBPB.
Such a mutant would be expected to have enhanced activity in our model. In
future experiments, it will be useful to examine single amino acid substitutions in
the leucine zipper not only because they may more sharply delineate critical

structural features, but because these altered forms of C/EBPB may provide

levels of expression more comparable to that of intact C/EBPB and thus allow
more direct comparisons of activity.

Interestingly, we have found that the effects of C/EBP expression are
more profound in stable than in transient transfection assays. While CIEBP
expression activated the IL-6 promoter in both assay systems, the level of lL-6
induction and synergy with LPS stimulation is much more dramatic in stably
transfected cells. This is probably nota function of CIEBP overexpression, since
EMSA assays of P388 lymphoblasts with stable ectopic C/EBP expression do not
reveal abnormally high levels of DNA binding activity in comparison to bone
marrow-derived macrophages (Hu et al., 1998). It seems likely that stable CIEBP
transfectants with intact IL-6 promoters at normal diploid abundance in chromatin
are a more accurate reflection of C/EBP activity on the lL-6 promoter. The lL-6
promoter would be expected to be in a more repressed basal state in chromatin
and more dependent upon the activity of C/EBP to achieve activation. In either
system, however, the surprising activity of truncated forms of CIEBP is plainly
evident.

Finally, our results show a significant capacity for LIP to activate the IL-

6 promoter. LIP has previously been proposed to be a transdominant inhibitor of

131

transcription (Descombes and Schibler, 1991). It is proposed that high levels of
LIP observed in fetal liver constitute a mechanism for inhibiting the activity of
other C/EBP isoforms in hepatocytes that are not yet terminally differentiated.
Furthermore, it has been proposed that LIP could block C/EBPB mediated
inhibition of hepatocyte proliferation (Buck et al., 1994). The regulation of LIP
expression has also been proposed to play a role in the regulation of lactation-
associated genes such as B-casein (Raught et al., 1995). More recently, LIP
expression has been correlated with neoplastic transformation of mammary
tissue and has been proposed as a prognostic indicator for breast cancer
because of its overexpression in breast tumors that were negative for the
estrogen and progesterone receptors (Raught et al., 1996; Zhanow et al., 1997).
The centralthemeof these models is that the expression of LIP in immature
proliferating cells suppresses the activity of C/EBPB and other isoforms in
activating the expression of gene products associated with terminal
differentiation. It is clear from the findings reported here that conditions favoring
LIP expression would not universally down-regulate C/EBPB regulated genes,
but would be permissive for the expression of lL-6 and other genes with a similar
promoter structure.

Among tissues particularly noted for lL-6 production, high levels of LIP
expression have been observed in fetal liver (Descombes and Schibler, 1991), as
well as transiently in adult liver following partial hepatectomy (T imchenko et
al.,1998) or LPS treatment (An et al., 1996). While LIP might repress the

activation of CIEBP-dependent gene products that inhibit hepatocyte

132

proliferation, it could at the same time support the induction of lL-6 expression as
well as several other acute phase genes that show synergistic activation by
C/EBP and NF-xB family members (reviewed in Poli, 1998). Indeed, the
observation of LIP expression in LPS-treated liver that would produce lL-6 is
consistent with our findings. Any model for the physiological significance of LIP
must be tempered, however, by the finding that LIP can be the product of
proteolysis associated with hypotonic lysis procedures (Baer et al., 1998). The
findings reported here of LIP activity in the expression of lL-6, as well as
uncertainties associated with the generation of LIP, call for a reexamination of its

role as a physiological repressor of CIEBP-mediated transcription.

I33

REFERENCES

Akira, S., H. lsshiki, T. Sugita, O. Tanabe, S. Kinoshita, Y. Nishio, T. Nakamima,
T. Hirano, and T. Kishimoto. 1990. A nuclear factor for lL-6 expression (NF-1L6)
is a member of a C/EBP family. EMBO J. 9:1897-1906.

Ayoubi, T. A, J. W. Creemers, A. J. Roebroek, and W. J. Van de Ven. 1994.
Expression of the dibasic proprotein processing enzyme furin is directed by
multiple promoters. J. Biol. Chem. 269: 9298-9303.

Baer, M., S. C. Williams, A. Dillner, R. C. Schwartz, and P. F. Johnson. 1998.
Autocrine signals control C/EBPB expression, localization, and activity in
macrophages. Blood, in press.

Bauer, S. R., K. L. Holmes, H. C. Morse III, and M. Potter. 1986. Clonal
relationship of the lymphoblastic cell line P388 to the macrophage cell line
P388D1 as evidenced by immunoglobulin gene rearrangements and expression
of cell surface antigens. J. Immunol. 136: 4695-4699.

Bretz, J. D., S. C. Williams, M. Baer, P. F. Johnson, and RC. Schwartz. 1994.
CIEBP-related protein 2 confers lipopolysaccharide-inducible expression of
interleukin 6 and monocyte chemoattractant protein 1 to a lymphoblastic cell line.
Proc. Natl. Acad. Sci. USA 91: 7306-7310.

Cepko, C. L., 8. E. Roberts, and R. C. Mulligan. 1984. Construction and
applications of a highly transmissible murine retrovirus shuttle vector. Cell 37:
1053-1062.

Colangelo, A. M., P. F. Johnson, and I. Mocchetti. 1998. El-Adrenergic receptor-
induced activation of nerve growth factor gene transcription in rat cerebral cortex
involves CCAAT/enhancer binding protein El. Proc. Natl. Acad. Sci. USA 95:
1 0920-1 0925.

Cooper, C. L., A. L. Berrier, C. Roman, and K. L. Calame. 1994. Limited
expression of C/EBP family proteins during B-lymphocyte development-negative
regulator IG/EBP predominates early and activator NF-lL-6 is induced later. J.
Immunol. 153: 5049-5058.

Cooper, 0., A. Henderson, S. Artandi, N. Avitahl, and K. Calame. 1995. lg/EBP

(C/EBPy) is a transdominant negative inhibitor of C/EBP family transcriptional
activators. Nucleic Acids Res. 23: 4371-4377.

134

Descombes, P. and U. Schibler. 1991. A liver-enriched transcriptional activator
protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the
same mRNA. Cell 67: 569-579.

Fort, P., L. Marty, M. Piechaczyk, S. El Salrouty, C. Dani, J. Jeanteur, and J. M.
Blanchard. 1985. Various rat adult tissues express only one major mRNA
species from the Glyceraldehyde-3-phosphate—dehydrogenase multigenic family.
Nucleic Acids Res. 13: 1431-1442.

Furutani, Y., M. Notake, T. Fukui, M. Ohue, H. Nomura, M. Yamada, and S.
Nakamura. 1986. Complete nucleotide sequence of the gene for human
interleukin-1-alpha. Nucleic Acids Res. 14: 3167-3179.

Hu, H.-M., M. Baer, S. C. Williams, P. F. Johnson, and R. C. Schwartz. 1998.
Redundancy of C/EBPor, -B and 6 in supporting the Iipopolysaccharide-induced

transcription of lL-6 and monocyte chemoattractant protein-1. J. Immunol.
1 60:2334-2342.

Johnson, P. F. and S. C. Williams. 1994. CAAT/enhancer binding (CIEBP)
proteins, p. 231-258. In M. Yaniv and F. Tronche (ed.), Liver Gene Expression,
Raven Press, New York.

. Kinoshita, S., S. Akira, and T. Kishimoto. 1992. A member of the C/EBP family,
NF-ILSB forms a heterodimer and transcriptionally synergizes with NF-IL6. Proc.
Natl. Acad. Sci. USA 89: '1473-1476.

Kunsch, C., R. K. Lang, C. A. Rosen, and M. F. Shannon. 1994. Synergistic
transcriptional activation of the lL-8 gene by NF-xb p65 (ReIA) and NF-lL-6. J.
Immunol. 153: 153-164.

Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 227: 680-685.

Landschulz, W. H., P. F. Johnson, E. Y. Adashi, B. J. Graves, and S. L.
McKnight. 1988. Isolation of a recombinant copy of the gene encoding CIEBP.
Genes Dev. 2: 786-800.

Lee, Y.-H., M. Yano, S.-Y. Liu, E. Matsunaga, P.F. Johnson, and F. J. Gonzalez.
1994. A novel cis-acting element controlling the rat CYP2D5 gene requiring

cooperativity between C/EBPB and an SP1 factor. Mol. Cell. Biol. 14: 1383-1394.

Lee, Y.-H., S. C. Williams, M. Baer, E. Stemeck, F. J. Gonzalez, and RF.
Johnson. 1997. Ability of C/EBPB but not C/EBPor to synergize with an Sp1

protein is specified by the leucine zipper and activation domain. Mol. Cell. Biol.
17: 2038-2047.

135

Lowenstein, C. J., E. W. Alley, P. Raval, A. M. Snowman, S. H. Snyder, S. W.
Russell, and W. J. Murphy. 1993. Macrophage nitric oxide synthase gene: two

upstream regions mediate induction by interferon y and Iipopolysaccharide. Proc.
Natl. Acad. Sci. USA 90: 9730-9734.

Matsuaka, T., K. Fujikawa, Y. Nishio, N. Mukaida, K. Matsushima, T. Kishimoto,
and S. Akira. 1993. Transcription factors NF-IL6 and NF-KB synergistically
activate transcription of the inflammatory cytokines, interleukin 6 and interleukin
8. Proc. Natl. Acad. Sci. USA 90: 10193-10197.

Merika, M., A. J. Williams, G. Chen, T. Collins, and D. Thanos. 1998.
Recruitment of CBP/p300 by the IFNB enhanceosome is required for synergistic
activation of transcription. Mol. Cell 18:277-287.

Natsuka, S., S. Akira, Y. Nishio, S. Hashimoto, T. Sugita, H. lsshiki, and T.
Kishimoto. 1992. Macrophage differentiation-specific expression of NF-IL6, a
transcription factor for interleukin-6. Blood 79: 460-466.

Nerlov, C., and E. B. Ziff. 1994. Three levels of functional interaction determine

the activity of CCAAT/enhancer binding protein-ct on the serum albumin
promoter. Genes & Dev. 8: 350-362.

. Nordeen, S. K. 1988. Luciferase reporter gene vectors for analysis of promoters
and enhancers. BioTechniques 6: 454-457. .

Raught, B., W. S. Liao, and J. M. Rosen. 1995. Developmentally and hormonally
regulated CCAAT/enhancer-binding protein isoforms influence beta-casein gene
expression. Mol. Endocrinol. 9:1223-1232.

Raught, 8., A. C. Gingras, A. James, D. Medina, N. Sonenberg, and J. M. Rosen.
1996. Expression of a translationally regulated dominant-negative
CCAAT/enhancer binding protein B isofonn and up-regulation of the eukaryotic
translation initiation factor 2a are correlated with neoplastic transformation of
mammary epithelial cells. Cancer Res. 56: 4382-4386.

Robinson, G. W., P. F. Johnson, L. Hennighausen, and E. Stemeck. 1998. The
C/EBPB transcription factor regulates epithelial cell proliferation and
differentiation in the mammary gland. Genes & Dev. 12: 1907-1916.

Rollins, B. J., E. D. Morrison, and C. D. Stiles. 1988. Cloning and expression of
JE, a gene inducible by platelet-derived growth factor and whose product has
cytokine-like properties. Proc. Natl. Acad. Sci. USA 85: 3738-3742.

Roman, C., J. S. Platero, J. Shuman, and K. Calame. 1990. lg/EBP-1: a

ubiquitously expressed immunoglobulin enhancer binding protein that is similar to
C/EBP and heterodimerizes with C/EBP. Genes & Dev. 4: 1404-1415.

136

Rorth, P. 1994. Specification of C/EBP function during Drosophila development
by the bZIP basic region. Science 266: 1878-1881.

Shirakawa, F., K. Saito, C. A. Bonagura, D. L. Galson, M. J. Fenton, A. C. Webb,
and P. E. Auron. 1993. The human prointerleukin IBgene requires DNA
sequences both proximal and distal to the transcription start site for tissue-
specific induction. Mol. Cell. Biol. 13: 1332-1344.

Stein, 8., P. C. Cogswell, and A. S. Baldwin. 1993. Functional and physical
associations between NF-kB and C/EBP family members: a rel domain-bZIP
interaction. Mol. Cell. Biol. 13: 3964-3974.

Stein, 8., and A. S. Baldwin. 1993. Distinct mechanisms for regulation of the
interleukin-8 gene involve synergism and cooperativity between C/EBP and NF-
KB. Mol. Cell. Biol. 13: 7191-7198.

Tanabe, O., S. Akira, T. Kamiya, G. G. Wong, T. Hirano, and T. Kishimoto. 1988.
Genomic structure of the murine lL-6 gene. J. Immunol. 141: 3875-3881.

Thanos, D. and T. Maniatis. 1995. Virus induction of human IFNB gene
expression requires the assembly of an enhanceosome. Cell 83: 1091-1100.

.Wegner, M., Z. Cao, and M. G. Rosenfeld. 1992. Calcium-regulated
phosphorylation within the leucine zipper of C/EBPB. Science 256: 370-373.

Williams, S. C., C. A. Cantwell, and P. F. Johnson. 1991. A family of C/EBP-
related proteins capable of forming covalently linked leucine zipper dimers in
vitro. Genes & Dev. 5: 1553-1567.

Williams, S. C., M. Baer, A. J. Dillner, and P. F. Johnson. 1995. CRP2 (C/EBPB)
contains a bipartite regulatory domain that controls transcriptional activation,
DNA binding and .cell specificity. EMBO J. 14: 3170-3183.

Zhang, Y. and W. N. Rom. 1993. Regulation of the interleukin-1B (IL-1B) gene by
mycobacterial components and Iipopolysaccharide is mediated by two nuclear
factor-IL6 motifs. Mol. Cell. Biol. 13: 3831 -3837.

Zhanow, C. A., P. Younes, R. Laucirica, and J. M. Rosen. 1997. Overexpression

of C/EBPB-LIP, a naturally occurring, dominant-negative transcription factor, in
human breast cancer. J. Natl. Cancer Inst. 89: 1887-1891.

137

Chapter 4

Summary and Future Plans

138

The data presented in chapter 2 showed that we have identified and
molecularly cloned a novel gene (CDDP-1) from a myeloblastic cell line 32D cl3
overexpressing C/EBPB. CDDP-1 is apparently upregulated by the CIEBP family
of transcription factors including C/EBPor, C/EBPB, C/EBP6, and C/EBPs. It is a
potential target gene of C/EBPs because the promoter region of CDDP-I has
several putative C/EBP binding sites. CDDP-1 was induced early in
myelomonocytic differentiation and was further upregulated as the immature
myeloid cells differentiate into neutrophils but downregulated as cells advance
into monocytes/macrophages. When constitutively overexpressed in an immature
myeloid cell line MPRO, CDDP-1 can promote both neutrophilic and monocytic
differentiation programs as evidenced by morphological studies and molecular
markers. CDDP-1 was also modulated during the differentiation processes of
other hematopoietic lineages such as erythroid, mast, and B lymphoid cells .
indicating a role in the respective lineages. However, transient co-transfection
assays using promoter-reporter constructs driven by several myeloid specific
promoters including those for the myeloperoxidase, G-CSF receptor, M-CSF
receptor, retinoic acid receptor, and lL-6 genes, failed to pinpoint a specific
pathway that CDDP-1 may act upon in regulating myelomonocytic differentiation.

To further explore the mechanisms of CDDP-1 function, an immediate
future experiment would be to characterize the proteins with which CDDP-1
interacts. This will help to identify downstream elements in a regulatory scheme.
Since we already generated a polyclonal antibody against a GST- CDDP-1 fusion

protein, this antibody can be used for co-immune precipitation experiments. The

139

myelomonocytic cells where CDDP-1 is induced will be metabolically labeled with
35S-methionine and their extracts immune-precipitated with anti-CDDP-1. Co-
precipitated proteins will be visualized by fluorography of SDS-PAGE and further
characterized by protein microsequencing analyses. Alternatively, “GST pull-
down" chromatography can be used to identify CDDP-1 interacting proteins.
CDDP-1 would be expressed from a bacterial glutathione S-transferase (GST)
fusion protein expression vector. The GST fusion protein would be bound to
glutathione-Sepharose beads. Cellular extracts prepared from cells at a stage of
myelomonocytic differentiation where CDDP-1 is induced would then be
incubated with control GST beads and GST-CDDP-1 beads. Bound proteins will
be eluted and analyzed by SDS-PAGE and subsequent sequencing analyses.

To find out a more definitive function of CDDP-1 in hematopoiesis in vivo,
mice deficient in CDDP-1 will be generated by electroporation' of the CJ7
embryonic stem cell line with a replacement-type targeting vector. The targeting
vector will consist of between 2 and 5 kb of 5' homologous and 3' homologous
sequences flanking the CDDP-I locus. We have isolated a mouse genomic
clone which contains the 3’ flanking region of CDDP-1 from a 129SvJ mouse
genomic library. The 5’ flanking sequence will be isolated by screening the same
library using the 5’ region of the cloned CDDP-1 cDNA. Once obtained, CDDP-1-
deficient mice will be analyzed in comparison to wild type and heterozygous mice
for the composition of their peripheral blood and bone marrow. Hemoglobin will
be measured with a Hemoglobinometer. Leukocytes will be cytocentrifuged,

stained with Wright-Giemsa, and evaluated on the basis of their morphology.

140

Leukocytes from bone marrow and peripheral blood will also be analyzed by flow
cytometry for the following hematopoietic markers: Mac-1, myeloid; Gr-1,
granulocyte; F4/80, macrophage; B220, 8 lymphoid; Thy 1.2, T lymphoid; TER-
119, erythroid; CD41, megakaryocyte. If expected abnormality are observed,
such as decreased levels of granulocytes and/or erythroid cells, bone marrow
cells will also be tested for GM-CFU, M-CFU, E-CFU, and GEMM-CFU.

Potential downstream targets of CDDP-I activity can be identified using
cDNA microarray analyses by comparing CDDP-1 deficient mice with wild type
Iitterrnate. RNAs will be isolated from either bone marrow or fetal liver.
Radiolabeled cDNA will be used as probe on the microarray chips. Alternatively,
MPRO or U937 cells would be transiently transfected with CDDP-1 expressing
vectors. After 24 hours of transfection, RNA will be isolated and radiolebeled
cDNA prepared for hybridization to "Atlas” cDNA expression arrays (Clontech).
Any RNAs upregulated or downregulated at this early time point after CDDP-1
expression would be considered a potential target gene and will help to
understand the mechanism of CDDP-1 function.

To confirm whether CDDP-1 is a direct target of C/EBP family members
and to place CDDP-1 in a regulatory scheme, the promoter region of CDDP-1 will
be identified. The 2000 bp region proximal to the 5' coding sequence will be
placed upstream of luciferase in the pXP2 reporter construct. Transient co-
transfection with C/EBP isoforms will be performed in 320 clone 3 cells to verify
the functionality of the constructs and to compare the effectiveness of various

C/EBP isoforms to stimulate CDDP-1 transcription.

141