PLACE IN RETURN Box to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 cJCIRC/DateDUOpGS-DJ 5

 

IDENTIFICATION OF POLMRPHISMS AT THE BOVINE
HOME-SENSITIVE LIPASB LOCUS

By

Galal Moustafa Yousif

A DISSERTATION

Submitted to
Michigan State University
in partial fulfilment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Animal Science

2001

ABSTRACT

IDENTIFICATION OF POLYMORPHISMS AT THE BOVINE HORIONE-
SENSITIVE LIRASE LOCUS

By

Galal Moustafa Yousif

Genomic DNA was isolated from four beef breeds (Angus,
Brahman, Simmental, and Tarantaise), one dairy breed
(Holstein), and one dual-purpose breed (Shorthorn). One
forward primer and one reverse primer was designed to amplify
part of exon 8 (based on the human sequence) of the hormone-
sensitive lipase (HSL) gene, downstream of the phosphorylation
activation site. The amplified fragments were sequenced and
polymorphisms were found at base 51 (A/G) and base 93 (A/G)
from the start of the sequenced fragment. Changes in the two
bases result in a change in amino acids from isoleucine to
valine (base 51) and from glutamic acid to lysine (base 93).
These changes may change the 3D-structure of the protein and,
therefore, affect enzymatic activity. The polymorphisms were
found in all breeds. This study suggests that there may be an
association 'between polymorphisms at those sites and

phenotypic traits, such as rate of lipid hydrolysis.

To my wife
for her love and support

iii

ACKNOWLEDGMENTS

I am grateful to the individuals who contributed to the
completion of this research. First of all I would like to
thank my major professor, Dr. Robert M. Cook, for his
patience, support and understanding.

To the members of my guidance committee: Drs. Loran
Bieber who shared with us his lab and knowledge, Mel
Yokoyama,, John Kaneene, and Karen chou, I am grateful for
their contributions to my research project as well as my
graduate education as a whole.

I would especially like to thank Dr. Cathy Ernest for her
technical guidance, and for providing me with space and
equipment in her laboratory.

Also I would like to thank Dr. James Jay for financial
support through most of my graduate program. To my colleagues
Melvin Pagan and Nancy Raney, and to Dr. Jeane Burton, I
appreciate their help and support.

My deepest appreciation is expressed to Dr. Ahmed M.
Rafaat who taught me basics in molecular biology. Dr. Bill
Thomas for giving me the opportunity to learn molecular
biology and interact with many scientists by providing a

fellowship to attend the Molecular Biology and PCR summer

iv

workshop in hkmthampton (Thomas Enrichment Fellowship). My
thanks to Dr. Peter Saama for his assistance with the cluster
analysis and Jim Liesman for his useful comments on this
dissertation.

I express sincere gratitude to my family and friends in

Lansing and at home in Sudan.

TABLE OF CONTENTS

LIST OF FIGURES ................................... viii
LIST OF ABBREVIATION .............................. xii
INTRODUCTION ...................................... 1
LITERATURE REVIEW’ ................................. 5
Adipose Tissue ............................... 5
Lipid Pathways ............................... 10
Hormone-sensitive Lipase ................ 13
Phosphorylation/Dephosphorylation of ESL ..... 16
Hormonal Regulation of HSL ................... 20
Molecular Biology of ESL ..................... 21
Rationale .................................... 29
MATERIALS AND METHODS ............................. 31
Isolation of Genomic DNA ..................... 31
DNA.Electrophorysis .......................... 32
Strategy to amplify HSL gene ................. 35
Primer Design ................................ 37
Polymerase Chain Reaction (PCR) .............. 37
Cloning of the Bovine PCR Product ............ 41
Preparation of Agar Plates.... ............... 42
Transformation ............................... 42
Restriction Enzyme Digest .................... 44
Sequencing ................................... 44
Sequencing reaction ..................... 45
Post sequencing reaction preparation....45
Preparation of samples for loading ...... 45
PCR of HSL for 6 Bovine Breeds ............... 46
Titering Bovine Genomic Library .............. 47
Plate Lysate ................................. 48
Screening the Bovine Genomic Library ......... 51
Plaque Lifting .......................... 51
Probe Labeling .......................... 52
Micro Bio-Spin Chromatography columns...53
Hybridization ........................... 54
Autoradiography .............................. 55
Probe labeling ............................... 56
Southern Blot ................................ 58
Bovine PCR for Pools and Individuals ......... 60

Single Stranded Conformation Polymerphimm....61

vi

Bovine Spleen cDNA Library ................... 62

Materials .................................... 64
RESULTS ........................................... 65
Quantification of genomic DNA ................ 65
Primer Design ................................ 65
Polymerase Chain Reaction (PCR) .............. 67
Miniprep and Restriction Enzyme Digest ....... 67
Sequencing ................................... 68
PCR of ESL for the 6 Bovine Breeds ........... 76
Titer and Phage Lysate of the Bovine
Genomic DNA Library .......................... 78
PCR for the Genomic DNA Library .............. 80
Hybridization and Autoradiography ............ 82
Southern Blot ................................ 82
Bovine PCR for Pools ......................... 88
Single Stranded Conformation Polymorphism. . . .91
Bovine Spleen cDNA Library ................... 91
Part of the Bovine HSL Gene Sequence and
Polymorphisms ................................ 94
Cluster Analysis ............................. 94
DISCUSSION ........................................ 103

Amplification of Bovine HSL from Genomic DNA.103

PCR for the Spleen cDNA ...................... 107
Bovine Genomic Library Screening ............. 107
Southern Blot ................................ 108
Single—Stranded Conformation Polymorphisms. . .108
Restrictio Fragment Length Polymorphism ...... 109
Bovine Pool HSL Sequences .................... 109
Cluster Analysis ............................. 109
SUDMARY AND CONCLUSION ............................ 1 1 1
REFERENCES ........................................ 112

LIST OF FIGURES

Figure 1. Adipose tissue lipolysis .................. 6
Figure 2. Cascade of reactions involved in

activation (phosphorylation) of

ESL hydrolysis of triglycerides ........... 18
Figure 3. Agarose gel image (1%) illustrating

bovine genomic DNA obtained from
whole blood which was collected in
heparin and EDTA tubes .................... 34

Figure 4. Agarose gel image illustrating the
same concentration of bovine genomic
DNA obtained when the whole blood was

collected in heparin and EDTA.tubes ....... 66
Figure 5. Agarose gel image (2%) illustrating HSL

PCR.products’ results ..................... 40
Figure 6. Agarose gel image (1%) illustrating

part of exon 8 of HSL PCR products
(263 bp) cloned in pGEM-T vector and

cut with EcoRI... ........................ 69
Figure 7. Sequence signals for part of exon 8 of

the bovine HSL gene ....................... 70
Figure 8. The HSL PCR.product sequence

(251 bp) for part of bovine exon 8

Before editing ............................ 71
Figure 9. .Alignment of part of the bovine exon 8

HSL PCR product sequence before editing
and the published bovine HSL partial
sequence .......... . ....................... 72

Figure 10. Sequence comparison between part of
the bovine exon 8 HSL PCR.product and
part of the swine HSL gene showing 78%
Homology .................................. 73

Figure 11. Sequence comparison between part of
the bovine exon 8 HSL PCR product and

Figure

Figure

Figure

Figure

Figure

Figure

Figure

Figure

Figure

12.

13.

14.

15.

16.

17.

18.

19.

20.

part of the rat HSL gene showing 73%
Homology .................................. 74

Sequence comparison between part of

the bovine exon 8 HSL PCR product and

part of the Human HSL gene showing 76%
Hemology .................................. 75

Agarose gel image (1%) illustrating PCR
products (263 bp) of part of exon 8 of
HSL gene from 6 different bovine breeds. . .77

Agarose gel image illustrating DNA samples
obtained from.bovine genomic library ...... 79

Agarose gel image illustrating part of

exon 8 PCR products of bovine

genomic DNA library and bovine genomic
DNA.and using the same primer and

reaction conditions ....................... 81

Agarose gel image illustrating the
quantification of PCR product (263 bp)

of part of exon 8 of the bovine HSL to

be used as a probe ........................ 57

X-ray film.i11ustrating signals for HSL
gene picked up by P32 labeled probe from
the first genomic library screening ....... 83

Southern blot analysis (1). Agarose

gel image illustrating the separation

of genomic DNA.bands from 4 different
breeds after digestion with EcoRI

for hybridization with labeled probe ...... 84

Southern blot analysis (2). Agarose gel
image illustrating bands separated of
Holstein and Shorthorn genomic DNA

after digestion with EcoRI for
hybridization with labeled probe.. ....... 85

Southern blot analysis (1). Agarose gel
image illustrating the lack of DNA.bands
from digested genomic DNA of four

different cattle breeds as a result

of a complete transfer of the bands

to the nylon membrane ..................... 86

Figure 21 Southern blot analysis (1). X-ray
film illustrating DNA.bands of
4 different cattle breeds after
labeled probe hybridization and
before eliminating the background ......... 87

Figure 22. Agarose gel image illustrating part of
exon 8 HSL PCR.products (263 bp) for
bovine genomic DNA pools
and individuals ........................... 89

Figure 23. Agarose gel image (1%) illustrating
the quantification of the genomic
DNA PCR.product (263 bp) of part of
exon 8 of HSL gene for individual
and pooled bovine breed ................... 90

Figure 24. Single-strand conformation polymorphism
gel image (8% non-denaturing gel)
illustrating the same distance of
band.migration of part of exon 8 HSL
PCR product (263 bp) of 6 different
bovine breeds ............................. 92

Figure 25. Agarose gel image (1%) illustrating
PCR products of part of exon 8 of
HSL from bovine spleen cDNA library and
bovine genomic DNA.from.4 different

bovine breeds ............................. 93
Figure 26. Part of exon 8 sequence of the bovine

HSL gene (233 bp) illustrating the two

(G/A) polymorphic sites ................... 96
Figure 27. .Alignment of part of the bovine exon 8

HSL PCR.product sequence after editing
and the published bovine HSL partial

sequence .................................. 97
Figure 28. The two potential polymorphic sites

for HSL gene in 26 animals from 6

cattle breeds ............................. 98
Figure 29. Part of exon 8 of HSL gene

sequence signals .......................... 99

Figure

Figure 31.

Figure

Figure

Figure

30.

32.

33.

34.

Part of exon 8 of HSL gene sequence
signals ................................... 100

Amino acid sequences for part of exon

8 of the bovine HSL gene from.three
different animals illustrating amino

acid differences in two different

positions ................................. 101

Cluster analysis, using clustan

graphics software, illustrating an
association between 5 different

groups of animals from 6 bovine

breeds according to their HSL gene

sequence ........ . ...................... 102

.A flow chart illustrating the steps
followed to isolate the bovine HSL gene...33

Schematic diagram illustrating
the arrangements of the 5 fragments
to be amplified ........................... 36

LIST OF ABBREVIATION

DNA:

EDTA:

ETBr:

SDS:

SSC:

SSCP:

Deoxyribonucleic acid
Ethylenediaminetetraacetic acid

Ethedium bromide

Polymerase chain reaction

Restriction fragment length polymorphism
Sodium.dodecyl sulfate
Sodium.chloride/Sodium.citrate
Single-stranded conformation polymorphism
Sodium.chloride/sodiumhydroxyphosphate/EDTA
Tris-berate/EDTA

Tris-EDTA

Tetramethylethyl-enediamine

mi

 

 

 

(fl

 

 

’(1

INTRODUCT ION

Lavoisier was the first to suggest that “life is a
chemical process” (Maynard et al., 1979). We now know that
sustenance involves a series of chemical reactions and
physiological processes in which food is transformed into body
tissues and activities. In a broad sense the chemistry of life
can be considered a cycle. Food is consumed, and following
digestion in the gut, nutrients are absorbed. These nutrients
are utilized by body tissues and in turn through several
mechanisms, play a role in regulating food intake (Baile,
1971), thus completing the cycle. In mammals, nutrients are
utilized. by tissues for' maintenance and growth and for
establishing body reserves including energy stores (lipids),
glucose reserves (glycogen), and amino acid reserves (labile
protein).

Short-term fluctuations in energy balance are to some
extent buffered by glycogen stores. However, the capacity to
store glycogen is limited. Longer-term imbalances between
energy intake and expenditure are translated into changes in
the body's store of lipids, mainly in the form of
intracellular triacylglycerol (TC) in adipose tissue. Adipose
tissue lipolysis is the major regulator of the supply of lipid
energy because it controls the release of fatty acids into the

plasma.

The rate limiting step in adipose tissue lipolysis is the
hydrolysis of TG by hormone-sensitive lipase (HSL). This
enzyme is so-named because it is susceptible to regulation by
phosphorylation and dephosphorylation in response to
hormonally controlled cAMP levels (Vaughan et al., 1964).
Phosphorylation activates HSL, thereby stimulating lipolysis
in adipose tissue, raising blood fatty acid levels, and
ultimately activating the 2—oxidation pathway in other tissues
such as muscle and may also lead to the accumulation of fatty
acids in liver that cause fatty liver. Two additional tissues
utilizing a substantial portion of maternal nutrients are the
developing fetus and the lactating mammary gland. One should
not underestimate the importance of partitioning nutrients to
support pregnancy and lactation, because these physiological
states are the essence of survival of the species and, of
course, the foundation of the dairy industry. However, these
tissues differ from other body tissues in that they confer no
special advantage to the animal. Instead they make tremendous
demands such that the total metabolism of the pregnant or
lactating animal must be altered to accommodate these needs.

To appreciate the remarkable synthesizing capacity of
dairy cows, it is appropriate to examine the adaptive changes
that occur during the periparturient (30 days before and after
parturition) period. Fetal growth curves (Bauman and Curie,
1980) show that over 50% of fetal development occurs during

the last month. The additional nutrients are directed toward

«I

we

fetal membranes, the gravid uterus, and the mammary gland
(Bauman and Curie, 1980). Lactation in many, if not all
species brings rapid changes in adipose metabolism resulting
in decreased lipogenesis and increased lipolysis, which
increases the nutrient supply for milk production. Fatty acid
oxidation is regulated in part by the concentration of fatty
acids in the blood, which is, in turn, controlled by the rate
of hydrolysis rate of triacylglycerols in adipose tissue by
hormone sensitive lipase (HSL).

During the first one-third of lactation, cows are in
negative energy balance and use body reserves to meet their
energy needs. In fact a zero net energy balance (i.e., intake
sufficient to meet requirements) is not achieved until a point
in lactation where milk production has decreased to less than
80% of peak production (Bauman and Curie, 1980). During the
first 10 weeks of lactation the net energy deficit of cows is
energetically equivalent to approximately 50 kg pure lipids or
an average daily production of 9 kg milk (Bauman and Curie,
1980). During the first month of lactation the body reserves
being utilized (i.e., net energy deficit) are energetically
equivalent to about 33% of the milk produced (Bauman and
Curie, 1980).

Chilliard and coworkers (Chilliard et al., 1977;
Chilliard et al. 1978), working with goats, demonstrated that
both lipoprotein lipase and acetyl CoA carboxylase (a

regulatory enzyme in de-novo synthesis of fatty acids)

 

C,

 

 

 

A.»

P...
L e

 

decreased in activity in adipose tissue during late pregnancy
and remain low during lactation. Investigations with cows in
late pregnancy and early lactation have demonstrated the same
increased rates of lipid mobilization (Metz and Van den Bergh,
1977; Sidhu and Emery, 1972) and decreased rates of pathways
of lipid synthesis in adipose tissue (Metz and Biolabs° Inc.,
1977; Shirley et al., 1973; Sidhu and Emery, 1972). Rabbits
(Mellenberger, 1972), sheep (Noble, 1971), and humans (Kaplan
and Grumbach, 1974) are other species in which these
coordinated changes in adipose tissue metabolism and in
concentration of lipid in serum have been observed during this
physiological transition.

Energy requirements for maintenance and pregnancy
increase 23% during the last month prepartum.(Moe and Tyrrell,
1972). During this time, feed intake typically decreases ~30%
(Grummer, 1993). An inadequate energy intake causes
mobilization of body lipids.

Explicit recognition of constraints on the evolution of
molecules, and the growing realization that there are limits
to how much we can learn about selection from studying it’s
footprints on. DNA. sequences, should force biologists to
rediscovered the phenotype. Identification of polymorphisms
at the HSL locus may lead to factors regulating the rate of
adipose tissue metabolism which would be useful in a number of

ways.

LITERATURE REVIEW

Adipose Tissue:

Adipose tissue is a dispersed organ consisting of adipose
cells (adipocytes) in a matrix of connective tissue.
Triacylglycerol stored as fat droplets in adipose tissue, is
the most important energy depot in mammals. During fasting,
starvation, or negative energy balance, mobilization of lipids
provides most of the energy needs of the body. HSLcatalyzes
the first, rate—limiting, and the second step in this process
(Fig. l). The enzyme is under tight hormonal and neural
control. Its activity is regulated through
phosphorylation/dephosphorylation tn? a single activity
controlling phosphorylation site (Belfrage et al., 1986). The
third step ill adipose tissue lipolysis is catalyzed by a
separate enzyme, monoacylglycerol lipase (Tornquist et al.,
1978), the activity of which is not regulated by hormones or
nutritional state. The term hormone-sensitive lipase was first
coined by Vaughan et a1. (1964). Early purification efforts
were unsuccessful (Tsia et al., 1970). HSL turned out to be
difficult to purify mainly because of its low tissue

concentration, general lability, and properties resembling

hormone-sensitive monoacylglycerol

Lipase lipase
l “ l
\
adipocyte V \- V
tn'acyglycerol-fl ,2-diacylglycerol-+2-monacylglycerol-Glycerol
\. t \
FFA FF A FFA

Figure l. Adipose tissue lipolysis

those of intrinsic membrane proteins (Holm et al., 1986).
Although some of the properties of the enzyme were described
earlier (Vaughan et al., 1964) it was not until 1977 (Belfrage
et al., 1977) that HSL was first identified after its
detergent solubilization and partial purification.
Furthermore, as revealed by the work of Cordle et al. (1986),
bovine adipose tissue HSL was found to be similar to the rat,
mouse, and swine enzyme (Kawamura, et al. 1981; Lee et al.
1985). Moreover HSL has been detected in a variety of other
tissues, e.g., heart and skeletal muscle (Holm et al., 1987).

Since fatty acids can be transferred among different
tissues or mobilized for use by other organs, synthesis is not
a prerequisite to deposition in a given tissue. Fatty acid
synthesis in adipose tissue of cows may increase during
lactation in the absence of fat deposition presumably to
supply fatty acids for production of milk fat (Baldwin, et
al., 1976).

The three basic functions of ruminant adipose tissue are
synthesis, storage, and mobilization of lipids. Adipose tissue
is a dynamic energy store through which 10 to 80% of the daily
energy flux passes depending on productive function, type of
feed and animal requirements in relation to intake (Emery,
1979; Emery, 1969; Belferage, et al., 1980; Allen, et al.,
1976). Adipose and lactating mammary tissues are the major
sites of fatty acid synthesis in cattle, sheep, and pigs in .

contrast to significant hepatic synthesis of fatty acids in

rats, mice, and human (Allen et al., 1976; Bauman, 1976).
Mobilized fat not only serves as a source of energy and as a
precursor for other components, e.g., membranes,
prostaglandin, but in the lactating cow it is a major
contributor to milk fat. These roles partly explain the
importance of adipose tissue to the lactating cow. Bauman
(1976) illustrated the immense capacity cows have for fat
mobilization in his summary of an energy balance study on one
cow for an entire lactation. During the first 62 days of
lactation, the average net energy loss was 20.6 Mcal/day. If
80% of this loss was met by body fat, mobilization of
approximately 2 Kg/day of body TG would be required. During
late lactation, as the need for energy subsides, energy
balance becomes positive with cows depositing 10 to 15
Mcal/day (1—1.5 Kg/day)in adipose tissue while still producing
milk (Bauman, 1976). Bauman and Davis (1974) indicated that
adipose tissue is the major site of fatty acid synthesis in
non-lactating ruminants, with a variable but minor
contribution from the liver.

It is not clear whether disappearance of mammary adipose
tissue with initiation of lactation in cows and reappearance
of mammary fat after prolonged cessation of lactation is due
to loss and formation of adipocytes or due to depletion and
refilling of the central vacuole of the same adipocytes with
triacylglycerol(Bauman and Davis, 1974).

Fatty acid composition of adipose tissue triacylglycerol

 

 

 

v... 6 Cu
4.. r. .. . L... at A; CL
wt. .. . .Il W I +. no

 

 

(TG) is rather complex, it composed of fifty to sixty
individual fatty acids (FA) varying in chain length, degree of
saturation and position of double bonds (Lafontan and Langin,
1995). In non-ruminants adipose—tissue FA profiles roughly
correlate with dietary lipid composition. But in ruminants,
adipose tissue contains a higher proportion of saturated FAs
compared with polyunsaturated FAs (PUFA) relative to other
tissues and organs because of biohydrogenation in the rumen by
microorganisms.

Baird et al. (1977) found increased glycerol production
in lactating cows fasted six days. Surprisingly, stimulated
lipolysis was positively correlated with lipogenesis in steers
where both basal and stimulated lipolysis were reduced by feed
restriction (Pothoven, et al., 1975). Glycerol synthesis seems
to be an important long-term control for increasing deposition
of fat in growing ruminants. Reduced glyceride synthesis also
permits fat mobilization with initiation of lactation (Metz,
et al., 1977). Adipose tissue from lambs with a greater
propensity to fatten due to breed (Southdown) or sex (ewes and
wethers) had more glyceride synthesizing activity than tissue
from leaner lambs (Sidhu, et a1. 1973).

In ruminant as well as nonruminant adipose tissue, the
major pathway of TG synthesis is acylation of glycerol—3—
phosphate to form phosphatidic acid from which phosphate is
hydrolyzed and the resulting diglyceride is acylated by a

third acyl transferase to form triglyceride (Benson and Emery,

9

 

 

 

r\

(I)

'HL‘

“a
‘

 

O
O
O
(T)

 

 

1971; Bickerstaffe, en: al., 1974). Glyceride synthesis in
bovine mammary gland has been extensively studied (Patton and
Jensen, 1975). Mammary glyceride synthesis increased six-fold
with initiation of lactation (Shirely, et al., 1973). A.study
of adipose tissue is complicated by the fact that it is
composed of nonadipocytes and adipocytes that vary widely in
size and lipid content (Hood, 1982; Hirsch and Gillian,
1968). There are only limited reports on adipocyte size and
density in bovine adipose tissue during lactation (Bauman and

Curie, 1980; Chilliard, et al., 1984).

Lipid Pathways:

The lipid digestion products absorbed by the intestinal
mucosa are converted by these tissues to triacylglycerols and
then packaged into lipoprotein particles called chylomicrons.
These are released into the bloodstream via the lymph system
for delivery to different tissues. Similarly triacylglycerols
synthesized by the liver are packaged into very low density
lipoproteins (VLDL) and released into the blood. The
triacylglycerol components of the chylomicrons and VLDL are
hydrolyzed to free fatty acids and glycerol in the capillaries
of adipose tissues and skeletal muscles by lipoprotein lipase.
The resulting free fatty acids are taken up by the different
tissues while glycerol is transported to liver and kidneys.

Lipoprotein lipase and HSL are two major enzymes,

10

.5.

‘ n

 

 

 

.- o . r . n a . e r. a -. C RX» 6, e
. . -7 A; . . a . a C 2» u. n at N. no .3 .3 L L
rd: 1 n G. A: Q m .2 he. he. I x L. n F .2

negatively correlated, in lipid metabolism. Lipoprotein lipase
(LPL) is an adipocyte enzyme that cleaves fatty acids from
circulating lipoproteins (intercellular). Fatty acids enter
the cell to be oxidized or esterified. Hormone-sensitive
lipase (HSL) is an adipocyte enzyme that cleaves fatty acids
from intracellular triacylglycerol. Lipoprotein lipase is not
a large contributor to peripartum bovine adipose adaptation
(McNamara and Bauman, 1987), but is important in retainment of
body composition in mid and late lactation. Hormone-sensitive
lipase activity is increased during peak and mid-lactation
(McNamara and Bauman, 1987).

In ruminants, the liver is the major source of endogenous
plasma triglyceride, with intestinal denovo synthesis being of
little consequence (Pullen, et al., 1988). In contrast to many
nonruminant species, however, ruminant liver is
quantitatively unimportant in fatty acid synthesis (Ballard,
et al., 1969). Most synthesis of fatty acids in ruminants
occurs in adipose tissues. The liver is involved in numerous
metabolic processes central to the maintenance of homeostasis
and productive function. Because of this central role in
metabolism, energy expenditure per kilogram of liver tissue is
much greater than that of other major tissues in the animal
(Baldwin et al. 1976). Most of the incoming dietary nutrients
pass via the portal blood system to the liver where they are
packaged according to the specific requirements of the animal

at that time and then either stored or distributed to

11

peripheral tissues. It shouhd be emphasized that ruminant
liver is not an important site of fatty acid synthesis but it
is central to formation of lipoproteins and transport of lipid
among organs.

Lipolysis refers to the hydrolysis of TG, via di- and
monoacylglycerol intermediates, to fatty acids and glycerol.
The result of changes in adipose tissue metabolism during
early lactation is a tremendous increase in the ability of
adipose tissue to mobilize non-esterified fatty acids (NEEA).
During early lactation, dairy cows mobilize subcutaneous fat
‘which increases the supply of blood NEEA to the liver. Fatty
acids are taken up by liver in proportion to their blood flow
and concentration reaching the liver (Emery, et al., 1992).
The liver then esterifies fatty acids and exports
ltriglycerides. Metabolically, VLDL and chylomicron fractions
are the main fractions active in providing triglyceride-fatty
acids to peripheral tissues, most of which will be taken up by
the mammary gland in lactating cows (Palmquist and Mattos,
1978). With the onset of lactation, metabolism of adipose
tissue is redirected toward providing fatty acids to other
organs of the body (Vernon, 1980). During the last month
before parturition, lipolysis increases and lipogenesis ceases
(McNamara and Hillers, 1986;,Pike and roberts, 1980).

The flux of fatty acids from blood to tissues depends
upon local concentration of fatty acids and the enzymic

capacity of the tissue. Lipoprotein lipase is sequestered on

12

 

 

 

 

I III L!
L . AF . . .v a re 9 .. .LC v)! at r.uJ
. The FHA «a re 1 .

14
O in. .
(r l H

 

 

the capillary endothelium where it acts upon triacylglycerol
contained in the circulating lipoproteins to release fatty
acids. The extra supply of fatty acids provided by lipoprotein
lipase comes predominantly from triacylglycerol but some may
also come from phospholipids. Glycerol is poorly utilized in
adipose tissue, therefore its release reflects lipolysis
(Allen, et al., 1976). Since fatty acids can be reacylated
within adipocytes, their release may be less than total
lipolytic activity.

Details of biochemical pathways of adipose tissue have
been reviewed (Bauman, 1976; Bauman and Davis, 1975). The
temporal relationship between metabolism of adipose tissue and
onset of lactation has been studied most extensively in rats
(Graham, 1964; Knopp, et al., 1975). At about day 19 of
pregnancy, lipoprotein lipase (necessary for the uptake of
preformed fatty acids) activity in adipose tissue decreases,
and both flux rates and activities of key enzymes in the
regulation of denovo fatty acid synthesis decrease rapidly
(Knopp, et al., 1973;McNamara and Bauman, 1978; Fain and Scow,

1966).

Hormone-Sensitive Lipase:

Lipolysis in ruminants occurs by a mechanism similar to
that of non-ruminants. The initial step involves the

hydrolysis of TG to diacylglycerol and monoacylglycerol by HSL

.13

 

flu;

.5

 

III II III |. |_
. I . . , r r A. .: >L« 3»

6. v . v. .3 y . \ .... . ._ . . rt. rt. I a .h u .. r l \ .3

.i. r. «C .C l l L t and .d l .. a find ‘C We. .3 ii « € \

 

 

that is activated by CAMP (Vernon, 1980). The monoacylglycerol
is hydrolyzed by non regulated lipases to free fatty acids and
glycerol (Vernon, 1980).

The hallmark of HSL, which distinguishes this enzyme from
all other known lipases, is the control of its activity
through phosphorylation/dephosphorylation. A single serine
residue (regulatory site) is phosphorylated by cAMP—PK
(Stralfors and Belfrage, 1983).

Adipose tissue metabolism is coordinated during pregnancy
and lactation to ensure that the energy needs of the mother
and young are met. In the bovine, the adaptation to
lactogenesis by adipose tissue is characterized by an increase
in catabolic reactions and a decrease in anabolic reactions
(Metz and Van den Bergh, 1977). Numerous studies have shown
that HSL is involved in the adaptations of adipose tissue
during lactation, by increasing blood FFA levels (McNamara, et
al., 1987; Smith and MaNamara, 1990). The increase of basal
lipolysis during very—low calorie intake was caused by an
increase in HSL expression (Sztalryd and Kraemer, 1994).
Hormone-sensitive lipase mRNA levels increased twofold in rats
after 3—5 days of fasting (Sztalryd and Kraemer, 1994).

Adipose tissue HSL is thus one of the enzymes determining
whole body lipid fuel availability. In the post-absorptive
state, HSL activity accounts for most of the detectable
lipolysis (Frayed, et al., 1995). Exercise and short term

fasting increase hormone-sensitive lipase activity in non-

14

 

 

'6‘

(r)

(f)

 

ruminants (Masoro, 1977).

Adaptations in tissue metabolism taking place just before
parturition, include a decrease in rate of lipid synthesis,
and an increase in rate of lipolysis. The occurrence of this
coordination of metabolism in the rat (Flint, et al., 1983),
sheep (Chilliard, et al., 1979), human (Kalkhoff, et al.,
1978), pig (McNamara, et al., 1985), and cow (Metz and Van den
Bergh, 1977), along with the consistency of biochemical and
endocrinological adaptations among species, has led to the
concept of homeorhesis (Bauman and Curie, 1980). Homeorhesis
is the orchestration of a coordinated set of adaptations in
support of a dominant physiological process.

Subcutaneous adipose tissue cell size and density and HSL
activity were determined during late pregnancy and first
lactation in Holstein heifers (Smith and McNamara, 1990). HSL
activity was found to be similar in high and low genetic lines
for milk production prepartum and increased in both at 60 day
postpartum (Smith and MaNamara, 1990).

The adipose tissue activities of HSL seemed to differ
between Brahman and Angus heifers (Sprinkle, et al., 1998).
Brahman heifers seem to have greater basal activities of
subcutaneous adipose tissue HSL than Angus. Therefore, non—
lactating Brahman heifers may have the ability to more readily
adapt to changes in nutritional status by increasing the
activities of those enzymes.

In 1992, Egan et al. reported that the nature of the

15

 

. I. I I I
C i . E C .. C . l ... . .. .. .2
1C . .. :1. MW mic .nm inch M... .l e u C. rcit T. P. nro
1 h .v n \ a \. .4 2.; V V a “M . ‘
n Dr 5 . i t L C .C S. W in MN MW . m. We.

 

Cr \
are

fr, .
a:
- 1‘

 

binding of HSL to a component of the lipid droplet is not
known, the primary structure of HSL does not show regions with
high hydrophobicity which would clearly explain the propensity
of phosphorylated HSL to bind directly to the lipid droplet.
Reconsidering previous reports attributing a putative role to
the lipid droplet substrate (Wise and Jungas, 1978), it may be
that a protein component of the lipid droplet surface may
undergo some kind of substrate activation, occurring
concomitantly with HSL activation, and governing droplet-
driven translocation of HSL. Or, it may be that perilipins,
specific adipocyte lipid-droplet-associated proteins, which
could have a role in the packaging and/or the trafficking of
lipids, are possible candidates in docking proteins for HSL
(Greenberg, et al., 1991). These proteins probably contribute
to the organization of lipid droplets and lipid vacuoles found
in mature adipocytes (Hare, et al., 1994 ). Perilipins are

phosphorylated by cAMP—PK.

Phosphorylation/Dephosphorylation of HSL:

Definitive evidence correlating' hormone-stimulated
lipolysis with accumulation of cyclic AMP came from the work
of Butcher and Sutherland (Butcher, et al., 1966). Stimulation
of lipolysis by CAMP in cell-free systems was noted (Rizak,
1964). The activity' controlling' phosphorylation. site ‘was

localized to Ser551 in a markedly hydrophilic domain, and a

16

lipid binding consensus site was tentatively identified
(Langin and Holm, 1993) .

The understanding of molecular mechanisms underlying
cellular variations of lipolysis is important with respect to
milk and energy production in dairy cows. It is generally
accepted that lipolysis is controlled mainly by sympathetic
nervous system activity and plasma insulin levels. Basically,
the lipolytic response of the fat cell depends on the balanced
action of stimulatory and inhibitory pathways on HSL activity.
The first step leading to activation of the lipolytic cascade
involves this multi-regulated enzyme, adenylate cyclase, which
produces CAMP (Lafonton, et al., 1993; Sidhu and Emery, 1993).
An important point in the metabolic actions initiated by
endocrine and paracrine regulators concerns the functional
significance of intracellular cAMP elevations promoted by
receptor— mediated adenylate cyclase control. In fat cells,
the lipolytic hormones (catecholamines) increases
concentration of cAMP which activates cAMP-PK (Fain Garcia-
Sainz, 1983). Phosphorylation of HSL by the activated cAMP-PK
causes HSL activation and lipolysis (Fig. 2).
Monoacylglycerol lipase hydrolyze the breakdown of
monoacylglycerol into fatty acid and glycerol. The abundance
of this enzyme, which is not under hormonal control, is
sufficient to avoid accumulation of intermediary products of
lipolysis (Fredrickson, et al., 1986). Because HSL has 10

fold higher activity toward diacylglycerol than

17

Primary =3=i>~=§>=§>Moditied primary

Receptor

Receptor
ll
Inactive Adenyl =§>=i>=§>c§>Active Adenyle
cyclase cyclase
ll 11
ATP cbci>=§>=1> cAMP

Figure 2.

H
Inactive =§>=§>=§>=i> Active
Protein kinase Protein kinase
I) ll
Inactive HSL c§>=3=i>ci>Active HSL
5 ll
TG =i>=§>=§>=§> DG + FFA
i ll
MG + FFA
W
Glycerol + FFA

Cascade of reactions involved in activation (phosphorylation) of HSL

and hydrolysis of triglycerides

18

 

.iai 4 4 e A.v fun.
I C .n .1 a“
LL .6 +e p a

 

v.
fix
l.\"w

l:

.3

triacylglycerol, when not activated, the diacylglycerol lipase
activity is not dependent upon the phosphorylation state of
the enzyme (Stich, et al., 1997).

Peptide :mapping studies have suggested. that HSL is
phosphorylated at only one site in vitro by cAMP—PK (Stralfors
and Belfrage, 1983). This site is also that which is
phosphorylated in isolated adipocytes in response to
noradrenaline, consistent with the conclusion that this
hormone acts via activation of cAMP-PK (Stralfors, et al.,
1984). A second site was found on HSL that is phosphorylated
in the absence of lipolytic hormones. However, the extent of
phosphorylation of this site does not change in the presence
of lipolytic hormones (Stralfors, et al., 1984) and its
phosphorylation does not apparently have a direct effect on
the activity of HSL (Olsson, et al., 1986).

Hormone-sensitive lipase was purified from.bovine adipose
tissue (Cordle, et al., 1986). The 27-residue region of the
HSL polypeptide containing the serine residue phosphorylated
by cAMP-PK was sequenced. The sequence, K T E P M R R S (P) V
SEAALTQPEGPLGTDSLK, isconsistentwiththe
known specificity of this protein kinase in that two adjacent
basic residues are present on the amino-terminal side of the

phosphorylated serine (Cohen, 1985).

19

REL.
CVE

Ho

 

.:

e

wqu
«Q

Hormonal Regulation of HSL:

Adipose tissue lipolysns is under acute hormonal and
neural control. Lipolytic agents include noradrenaline
(released from sympathetic nerve endings), and adrenalin.
Their action is opposed by insulin, the major anti-lipolytic
hormone, which reduces phosphorylation of HSL (Nilsson, 1980),
and acts, at least in part, by lowering the level of cyclic
AMP (Londos, 1985). The activity of the enzyme, and thus, the
over all lipolysis rate in the adipocyte, changes in response
to a variety of hormones (Vaughan and Steinberg, 1965).

The different steps of the lipolytic process leading to
the activation of HSL are well defined (Lafontan and Berlan,
1993). The first cellular action of catecholamines, and a
number of endocrine-paracrine regulators of lipolysis, is
their binding to plasma membrane receptors. The stimulatory
effect on lipolysis is strictly connected to the receptors-
controlled increment of intracellular cAMP concentrations
which in turn promotes activation of cAMP-PK (Honnor, et al.,
1985).

Glucose and insulin are homeostatic regulators of lipid
metabolism in adipose tissue. Insulin, the anti-lipolytic
hormone, causes dephosphorylation of HSL and thereby it's
deactivation. Insulin is the most physiologically important
and potent inhibitor of basal and hormone-stimulated

lipolysis. Consistent with the continuous need for lipid

20

 

K4

1 ,..
1'?"

u.“

an ..

 

r 5
ash

mobilization during early lactation in a dairy cow, adaptation
has occurred in adipose tissue such that lipolytic rates are
unaffected by glucose during this period (Metz and Van den
Bergh, 1977).

Several investigators have proposed that prolactin
coordinates lipid metabolism in adipose and liver in a manner
to partition nutrients to the nmmmary gland (McNamara and
Bauman, 1978; Zinder, et al., 1974). Blocking release of
prolactin during lactogenesis or in early lactation produces
a negative effect on mammary synthesis of milk as well as a
reduction in the rates of lipid mobilization from adipose
tissue (McNamara and Bauman, 1978).

Noradrenaline, released from sympathetic nerve endings,
and circulating adrenalin, and glucagon all stimulate
lipolysis by raising the intracellular concentration of cyclic
AMP. This leads to phosphorylation of HSL, causing activation

of the enzyme and subsequent lipolysis (Nilsson, et al. 1980).

Molecular Biology of HSL:

The expression of HSL gene has been detected in a variety
of tissues including adrenal glands, adipose tissue, heart,
skeletal. muscle, and. steroidogenic tissues (Sztalryd. and
kraemer, 1994; Kramer, et al., 1991; Holm, et al., 19888). In
rat adipose tissue, HSL mRNA abundance was reported in steady

state through development and aging (Kramer, et al., 1991),

21

and the levels increase in rats during starvation (Sztalryd
and Kraemer, 1994) and in patients with hyperlipidaemia (Holm,
et al., 1988 A). The HSL mRNA in testes and corpus luteum
varies by 200—600 nucleotides in length from that in adipose
tissue (Holm, et al., 1988 B). There has been little
investigation into the regulation of the HSL gene in organs
other than adipose tissue.

Nucleotide sequence of the region surrounding the serine
residue in. bovine hormone-sensitive lipase that is
phosphorylated in vitro by cyclic AMP-dependent protein kinase
was reported (Garton, et al., 1988).

The human HSL gene encodes a 786 amino acid polypeptide
(85.5 Kda) (Langin and Holm, 1993). It is composed of nine
exons spanning ~ 11 Kb, with exons 2—5 clustered in a 1.1 Kb
region. The putative catalytic site (Ser”3) and a possible
lipid-binding region (a short hydrophobic stretch) in the C-
terminal part are encoded by exons 6 and 9, respectively. The
phosphorylation site sequence (Met-Arg—Arg-SerSSI-Val-Ser553-
GlueAlaeAla) is completely preserved in bovine, rat and mouse
HSL. Exon 8 encodes the phosphorylation site (Ser 551) that
controls cAMP-mediated activity and a second site (Serfifi) that
is phosphorylated by 5’-AMP activated protein kinase. The
human HSL gene sequence showed 83% homology with the rat
enzyme and contained a 12—aa deletion immediately upstream of
the phosphorylation sites with an unknown effect on the enzyme

activity. Site-directed.:mutagenesis of Ser423 leads to a

22

 

 

 

 

 

 

at»

.14

complete abolition of both lipase and esterase activity (Holm,
et al., 1994). Besides the catalytic site motif (Gly—X—Ser—X-
Gly) found in most lipases, where ‘X' is any amino acid, HSL
exhibits no homology to other known lipases or proteins,
except for a recently reported unexpected homology between the
region surrounding its catalytic site and that of the lipase
2 of Akuaxella TA144, an antarctic psychrotrophic bacterium
(Langin, and Holm, 1993). The catalytic role of Ser423 of the
consensus pentapeptide (CflyBX-Ser-X—Gly), was analyzed by
site-directed.mutagenesis and substitution of ser“” by several
different amino acids. This resulted in complete abolition of
both lipase and esterase activity, whereas mutation of other
conserved serine residues had no effect on catalytic activity
(Holm, et al., 1994). This shows that the pentapeptide serine
is analogous to the active site serine in several lipases,
including hepatic lipase, lipoprotein lipase, and pancreatic
lipase.

HSL exhibits cholesterol hydrolase activity in
steroidogenic tissue and macrophage. Thus, common genetic
variations in HSL gene could affect both energy metabolism and
atherogenesis.

Using overlapping single-stranded conformation
polymorphism analysis (SSCP), a common single base change
(T/C) in intron 4 of the human gene, and variable CA repeat in
intron 6 with 9 alleles were identified (Talmud, et al.,

1998). The 5’ sequence shows 57-59% homology with the mouse

23

 

V‘

e...

(.7

l":

f‘r
VA. _

 

 

 

the

5“.“

i.

s“

promoter with higher homology at potential regulatory motifs.
It was concluded that 1.7 kb of 5/ sequences is well conserved
and.may play a role in the regulation of HSL gene expression.
Grober et al. (1997) re-characterized the promoter of the
human adipose HSL gene and defined a short and a long 5’IHEM
one of 54 bp about 1.5 kb upstream of the first coding exon
and the other of 150 bp about 13 kb upstream of the
translation start site.

Laurel et al. (1996, 1997) found that in human
adipocytes, instead of a full-length 88 kDa enzyme, an 80 kDa
truncated form of HSL is synthesized as a result of skipping
exon 6 which encodes the active serine. The extent of exon
skipping varied from 5 to 40% in different human fat biopsies
(Grober, et al., 1997). The skipping of exon 6 is human
specific and could represent an important additional control
mechanisms in human adipose tissue or macrophage since the
truncated form still encodes the lipid binding domain but not
the active site (Laurel, et al., 1996).

To investigate whether mutations in the HSL gene are
associated with non-insulin dependent diabetes mellitus
(NIDDM), Shimada et al. (1996) reported polymorphisms for HSL
in 35 Japanese human subjects with NIDDM. Single stranded
conformation polymorphism analysis identified a variant
pattern in exon 4, and the sequence at this variant pattern
resulted from amino acid polymorphisms (Arg309Cys). They

identified a variation in HSL gene at two sites. The first is

24

 

 

 

 

 

V‘
.1

(.n
(D

r

(l

7
v

 

an amino acid change R309C identified at a carrier frequency
of 0.17 in the Japanese population. In their small study in
type two diabetics and healthy controls, the C309 allele was
shown to be associated with higher plasma total cholesterol
but not plasma TG or obesity (Shimada, et al., 1996). The
second variant is a hyper-variable CA.repeat in intron 7 with
7 alleles (Levitt, et al., 1992) which has been used in
linkage analysis in families with familial combined
hyperlipidaemia (Pajukanta, et al., 1997).

Another study (Li, et al., 1994), examined the 5’
flanking region for nucleotide sequences that may modulate HSL
gene transcription in the mouse. Using primer extension, a
major transcription initiation site 593 nucleotides upstream
of the protein coding sequence was identified. Homology with
several known gene regulatory elements are present in the HSL
EV flanking region, including a sequence motif that appears to
direct expression in adipose, testis, adrenal, and myeloid
tissues (Li, et al., 1994).

Part of bovine HSL has been sequenced. Lee, et al. (1997)
from the university of Minnesota (unpublished data) submitted
the partial cDNA (429 bp) of bovine HSL sequence to the
GenBank (Accession # U78042), which is part of exon 8 in the
human HSL gene. Also, Einspanier, R., and Kettler, A. (1999;
unpublished data) have recently submitted 311 bp of the
bovine sequence to the GenBank (accession #.AJ237675) which

represents the end of exon 1 and beginning of exon 2 in the

25

rt

1...

Q J

a a

Cu

aid 4
e i‘

to

S

 

FL

 

 

human HSL gene.

The predicted primary translation product of rat HSL
:MS 757 amino acid in length and is 82,820 Dalton in size
(Holm, et al., 1986). Rat HSL shares no homology with either
the members of the lipase gene family (lipoprotein lipase,
hepatic lipase, and pancreatic lipase) or any other sequence
lipase (Kirchgessner, et al., 1987).

The human (Langin and Holm, 1993) and rat (Holm, et al.,
1988A) HSL genes have been cloned, and the phosphorylation
site in the human gene has been determined (Langin, et al.,
1996). A 3.3 kb HSL mRNA was found in swine adipose tissue,
liver, heart, testis, skeletal muscle, and spleen (Liu, et
al., 1995), and the cDNA was 86% similar to the rat HSL gene.
The mouse HSL gene has also been cloned and it shows 94%
sequence identity with the rat gene and 85% with the human
sequence (Li, et al., 1994).

The nucleotide sequence of rat adipose HSL cDNA
(accession no. J03087; Holm, et al., 1988A) was used to
measure mRNA levels in rat adipose tissue, testes, adrenals
and heart (Kramer, et al., 1991). The 757-amino acid sequence
of hormone sensitive lipase predicted from a cloned rat
adipocyte cDNA showed no homology with any other known lipase
or protein (Holm, et al., 1988A). One of several mRNA species
was expressed in adipose tissue, steroidogenic tissues, heart
and skeletal muscle.

HSL shares no homology with known eukaryotic proteins. In

26

particular, HSL does not belong to the so-called lipase gene
family that includes lipoprotein lipase, hepatic lipase and
pancreatic lipase. However it does show sequence similarity to
five prokaryotic enzymes from distantly related eubacteria
(Langin, et al., 1993). The region of similarity is bordered
by the catalytic site motif which is identical in the six
proteins and a His-Gly dipeptide which may constitute one of
the hydrophobic ‘wings' flanking the catalytic site. The
strongest sequence similarity is found with lipase 2 of
.MOraxella TA144, an antarctic psychrotrophic bacterium” Since
lipase 2 is active below 4 0C, the cold adaptability of HSL,
an unexpected property for a nemmalian lipase, was
investigated. HSL retained distinctly more catalytic activity
at low temperatures than either lipoprotein lipase or carboxyl
ester lipase. The so-called ‘cold adaptability' of HSL has
been discussed (Langin, et al., 1993). This unexpected
property of HSL could be of critical survival value when
lipids mobilized at low temperatures are the primary energy
source. e.g. in hibernators or poikilotherms.

Recent studies have shown that HSL gene is differentially
expressed in tissue during growth (Huttenen, et al., 1970) and
fasting (Sztalryd and Kraemer, 1994). HSL levels increased in
subcutaneous adipose tissue of cancer patients (Thompson, et
al., 1993). This increase could be one of the mechanisms
involved in the depletion of lipid from adipose tissues in

these patients.

27

as-

f:

 

1F.
VL

Determining the 3-D structure of HSL and mapping of
functional domains by site-directed mutagenesis will elucidate
structure-function relationships of HSL. A recent expression
system utilizing recombinant baculovirus arraying a full rat
HSL cDNA downstream from the polyhedrin promoter in insect
cell has allowed production of large amounts of functional
recombinant HSL protein. It is expected that determination of
the 3-D structure of HSL by crystallization studies will be
considerably facilitated (Holm, et al., 1994).

The chromosomal mappimg of HSL gene was performed in
human and mice. The human HSL gene is located in chromosome
l9q13.1 (Holm, et al., 19888; Schonk, et al., 1990), while the
mouse gene is positioned approximately 8 cM from the
centromere of chromosome 7 (Warden, et al., 1993). However, a
recent analysis showed that at least one portion of the HSL
gene or a pseudogene could also be mapped to 19p13.3 (Holm, et
al., 19888). Precise knowledge of the HSL gene chromosomal
location and the possibility of gene duplication are critical
for genetic linkage analysis and studies of regulatory
elements involved in HSL gene expression.

It has been speculated that HSL is an intrinsic membrane
protein (Holm, et al., 1986). However, its predicted amino
acid sequence does not appear to contain a membrane-spanning
region. The combined knowledge of the gene structure and its
localization to chromosome 19cent—q13.3 (Holm, et al., 19888)

would clearly' be important for future genetic studies.

28

Existing genetic variation provides the material for genetic

change, be it between or within breeds.

Rationale:

The rate-limiting step in lipolysis, namely the
hydrolysis of triacylglycerol to diacylglycerol and free fatty
acid is catalyzed by the enzyme HSL. The activity of this
enzyme is controlled by reversible phosphorylation.
Activation of the enzyme results from phosphorylation
catalyzed by cAMP-dependant protein kinase. Inactivation by
dephosphorylation. The bovine HSL enzyme has been purified
near homogeneity (Cordle, et al., 1986). It was identified as
a polypeptide of Mr 84,000 by affinity labeling with [3H]
diiso-propyl fluorophosphate.

Cattle breeds that originated in different climates of
the world may have unique cellular control of energy retrieval
and storage through their enzymes, enabling them to adapt to
their environments (Sprinkle, et al., 1998).

Evaluation of allelic differences of specific genes among
animals of different genetic :merit offers potential for
identification of markers associated with genetic merit(Lee,
et al., 1996). Development of these molecular markers could
result in marker-assisted selection programs and methods of
determining, at an early age, the potential genetic merit of

individual animals. Comprehensive investigation of the

29

relationships among genetic polymorphisms and. phenotypic
traits requires evaluation of distribution frequencies of
alleles of various proteins known to have critical roles in
the phenotypic traits of interest. Polymorphism refers to
the simultaneous occurrence in the population of genomes
showing allelic variations (as seen either in alleles
producing different phenotypes or, for example, in changes in
DNA affecting the restriction pattern).

The identification of polymorphisms at the bovine HSL
locus between and within different cattle breeds is useful
for increasing our understanding of the mechanism responsible
for differences in body fat mobilization between and within
different breeds. This will permit identification of
potential associations between sequence polymorphisms in the
bovine HSL gene and economically important traits and diseases
such as milk production and fatty liver. The specific aim of
this dissertation is to identify polymorphisms at exon 8

(phosphorylation site) of the bovine HSL locus.

30

 

r11

('1 i

{1

 

MATERIALS AND METHOD

The steps taken to isolate the bovine HSL gene are

illustrated in Figure 33.

Isolation of Bovine Genomic DNA:

Blood samples were collected from one Holstein lactating
cow into two different vacutainers (one heparin and the other
was EDTA), and held at 4 °C. Bovine genomic DNA was isolated
and purified using Promega kit (Wizard Genomic DNA
Purification System cat. # A1120). The Promega kit provides a
rapid way to isolate double-stranded genomic DNA from fresh
whole blood. It is based on a four-step process (Miller, et
al., 1988). The first step in the purification process lyses
red blood cells leéi Cell Lysis Solution. This leaves the
white blood cells intact. In the second step, the white blood
cells and their nuclei are lysed and solubilized in the Nuclei
Lysis Solution. RNase digestion followed by protein
jprecipitation, leaves the high molecular weight genomic DNA in
solutiont Finally’ the genomic DNA. was concentrated and
desalted by isopropanol precipitation. The genomic DNA was
loaded in 1% agarose gel [50 ml TBE buffer (1x) + 0.5 g
agarose] along with 1.0 ul of 9 cut with Hind III (heated at

65 0C for 10 minutes before loaded). 6x loading dye [0.25%

31

bromophenol blue, 0.25% xylene cyanol, and 15% Ficoll (Type
400; Pharmacia)]was used (Figure 3; Images in this

dissertation are presented in color).

DNA Electrophoresis:

1.0% agarose solution was prepared in TBE buffer ( 0.089
.M Tris-base, 0.089 M boric acid, 0.002 M EDTA, pH 8.0) by
heating in a microwave oven. The solution was cooled to 50 %3
and ethidium bromide added to a final concentration of 0.5
ug/ml. The solution was poured into the gel plate. After the
solution gelled, the comb was removed and TBE electrophoresis
buffer was added to the apparatus to a volume of about 0.25 ml
above the gel. DNA samples were placed in the sample wells and
a potential difference of 100 V applied until the tracking dye
moved about two thirds of the length of the gel (Sambrook, et
al., 1989). The gel was examined under UV light. Gels were

photographed using a Polaroid camera.

32

 

 

Figure 33.

A flow-chart showing the steps
followed to isolate the bovine HSL
gene.

(+) means the experiment produced
positive products.

(-) means the experiment produced
negative products.

33

 

Lane 1
Lane3

Lane 4

Lanes

Agarose gel image (1%) illustrating
bovine genomic DNA obtained from
whole blood which was collected in

heparin and EDTA tubes

D 1 Kb DNA Ladder

D 7.0 ul genomic DNA (heparin
tube)

D 3.5 ul genomic DNA (EDTA
tube)

C) 7 .0 ul genomic DNA (EDTA
tube)

34

Strategy to Amplify HSL Gene:

Human HSL gene sequence was divided into 5 different
fragments (Figure 34), assuming that there is a high homology
between the human and bovine HSL gene, so that each fragment
could be amplified separately, by the polymerase chain
reaction (PCR), and then the whole gene could be identified by
overlapping the different fragment sequences. The fragments
were determined as follows:

1) Fragment l (#516 bp) that includes exon 1.

2) Fragment 2 (#2707 bp) that includes exon 1 (#516 bp) and
exon 2 (#91 bp) and the intron between them (#2.1 kb).

3) Fragment 3 (# 2991) that includes exon 2 (# 91 bp), exon

3 (# 146 bp), exon 4 (#186 bp), exon 5 ( #295 bp), exon

6 (#228 bp), exon 7 (#177 bp), intron 2 (#110 bp), intron

3 (#183 bp), intron 4 (#137 bp), intron 5 (#800 bp), and

intron 6 (#620 bp).

4) Fragment 4 (#3002 bp) that includes exon 7 (177 bp), exon

8 ( #425 bp), and intron 7 (#2.4 kb).

5) Fragment 5 ( #1503 bp) that includes exon 8 (#425 bp),

exon 9 (#558 bp), and intron 8 (#520 bp)

bkyte: whenever exon 8 is mentioned in this dissertation, it

refers to the human exon 8.

35

 

 

 

 

 

Fr

 

Figi

Frag. #Sizc(bp) El 11 E2 [2 E3 I3 E4 14 E5 15 E6 16 E717E818E9

 

1 516 ...-
2 2707 ---------- .-

3 2991

4 3002 .. ....... ..

5 1503 --.....-----

Figure 34. Schematic diagram illustrating the arrangements of the 5 fragments to be

amplified
E = Exon
I = Intros
---- = DNA fragment

36

Primer Design:

To design a primer for each of the 5 fragments described
above, the HSL sequences for' human, rat, swine and the
published part of the bovine were lined up in the GCG (Genetic

Computer Group; http://www.ggg.com/) program, using the

 

bestfit command, in order to find conserved sequences among
the different species to Ibe used. as jprimers. The Oligo
software program (National Biosciences Incorporation NET,
version 5) was used to design and fine tune the primers, e.g.
free from primer dimers and hairpins, and to make the GC% as
close as possible to 50%. Also the expected product lengths
were noted.

The designed primers (forward and reverse) were then
entered into the database of the NCBI (National Center for
Biotechnology Information; http://searchlauncher.bcm.tmc.edu)
tunma page (which includes Genbank, PubMed, Genomes, Locus
Link, OMIM, Proteins, and Structures). The blast command was
then used, and the primers were confirmed after they hit, with
high-scoring, the hormone-sensitive lipase sequence for any
of the species. After all designed primers hit HSL sequences

as described above, they were used in PCR as described below.

Polymerase Chain Reaction (PCR):

About 80 different polymerase chain reactions were

performed for the 5 fragments above using different

37

combinations of primers and adjusting reaction conditions.
Another six polymerase chain reactions were performed using a
new set of primers designed for exon 8 (Figure 5, panel 1) in
a 50 ul total reaction volume [Reaction 1 to 6: 5.0 ul Taq
DNA Polymerase buffer (10x), 1 ul dNTPs (10 mM), 2.5 ul upper
primer ( 7.6 pM/ul), 2.0 ul lower primer (10.4 pM/ul), 34.25
ul milliQ water, 4.0 ul MgCl (25 mM), 1.0 ul template DNA (25
ng/ul), 0.25 ul Taq DNA Polymerase (5 u/ul)]. Also a new set
of primers, designed for the fragment includes exons 2, 3, 4,
5, and the introns between them, were used in four polymerase
chain reactions (Figure 5, panel 2). The reactions condition
for Figure 5, panel 2 is as follows: 5.0 ul Taq DNA
Polymerase buffer (10x), 1.0 ul dNTPs (10 mM), 3.0 ul upper
primer ( 6.6 pM/ul), 1.5 ul lower primer (13.4 pM/ul), 35.25
ul milliQ water, 3.0 ul MgCl (25 mM), 1.0 ul template DNA (25

ng/ul), 0.25 ul Taq DNA Polymerase (5 u/ul)].
Rgb_ogrcler:(Stratagene Gradient 96) WW] Research model PTC-200)
Thermal chler Conditions:

Reaction 1 Reaction 2

94 °C for 5 minutes 94 °C for 5 minutes

94 °C for 50 sec CD C9 C1) 30 Times 94 °C for 50 sec. ED C9 :1) 30 Times
55 °C for 50 sec. :1) :9 d) 30 Times 55 °C for 50 see. c? a) :1) 30 Times
72 °C for 50 sec. CD :0 :1) 30 Times 72 °C for 1:05 minutesco CD ct) 30 Times
72 °C for 10 minutes 72 °C for 10 minutes

6°C force 4°C foroo

38

The PCR products were then purified with the Micron kit

(Amicon cat # 42413), and run in a 2% agarose gel.

39

Figure 5.

Lane 0
Lane 1
Lane 2
Lane 3
Lane 4
Lane 5
Lane 6
Lane 7
Lane 8
Lane 9
Lane 10

 

Agarose gel image (2%) illustrating HSL
PCR products’ results. Panel 1: part of exon
8 (263 bp); Panel 2: exon 2, 3, 4, 5, and the
introns between them (nothing being
amplified).

D 100 bp PCR ruler

D Sample 1 (part of exon 8; panel 1)
D Sample 2 (part of exon 8; panel 1)
D Sample 3 (part of exon 8; panel 1)
D Sample 4 (part of exon 8; panel 1)
D Sample 5 (part of exon 8; panel 1)
D Sample 6 (part of exon 8; panel 1)
D Sample 7 (fragment 2; panel 2)

D Sample 8 (fragment 2; panel 2)

D Sample 9 (fragment 2; panel 2)

D Sample 10 (fragment 2; panel 2)

40

 

a.»

 

.
rho

 

Ce

Ar]-

 

Cloning of the Bovine PCR Product:

The pGEM-T Easy Vector Systems ( Promega pGEM-T Vector
cat. # A3600), which has a 3’ thymidine added to both ends,
was used as a plasmid to clone the PCR product. These single
3’—T overhangs at the insertion site greatly improve the
efficiency of ligation of a PCR product into the plasmids by
preventing recircularization of the vector and providing a
compatible overhang for PCR products generated by certain
thermostable polymerase (Robles and Doers, 1994).

Three reactions were performed as follows:

Reaction (A): IIILL of pGEM-T Easy Vector (50 ng) was
added to 1 ul T4 DNA Ligase 10x buffer and 2 ul of the PCR
product, 1 ul I} DNA ligase (3 weiss unit; Wiess, et al.,
1968), and 5 ul of MilliQ water to a final volume of 10 ul.

Reaction (8): same as reaction (A) except that 1 ul of
the PCR product and 6 ul of MilliQ water were added.

Reaction (C): This was the positive control which was the
same as reaction (A) except that instead of the PCR product,
2 ul of control insert DNA were added.

The tubes were mixed by pipetting and were incubated
(overnight at 4 0C. 40 ul of MilliQ water were added to each

:reaction after the ligation was completed.

41

Preparation of Agar Plates:

950 ml of milliQ water, 10 g Bacto-trypton, 5.0 g Bacto-
yeast extract and 10.0 g Nacl were mixed. The pH was adjusted
to 7.0 with 5 N NaOH, and 15.0 g bacto-agar were added, the
volume made to 1.0 liter with milliQ water and autoclaved for
20 mdnutes at 15 lb / sq. inches on liquid cycle. The medium
was cooled to about 50 0C before adding ampicillin (50 ug /
ml) . Plates were then poured directly from the flask, 30-35
ml of medium per 90-mm plate. After the medium had harden
completely, the plates were inverted and stored at 4 °C. The
plates were incubated at 37 °C 2-3 hours before they were

used.

Transformation:

Most methods for bacterial transformation are based on
the observations of Mandel and Higa (1970), who showed that
bacteria treated with ice-cold solutions of CaCl2 and then
briefly heated could be transfected with bacteriophage 1amda
DNA. The same method was subsequently used to transform
bacteria with plasmid DNA (Cohen, et al., 1972) and E. coli
chromosomal DNA (Olishi and Cosloy, 1972).

Subcloning of’ JM109 Competent cells (Promega cat. #
1¥3610 JM109) was used for routine subcloning into plasmid
vectors according to the manufacturer’s procedure. JM109

competent cell stored at —70 °C were thawed on ice. 5.0 ul of

42

‘Pi-AAHE-.‘ .- .:‘IF‘:- L! O

the ligation product above were added to 50 ul of the
competent cells, mixed gently with pipet tip, and incubated 30
minutes on ice. The cells were heat shocked by incubation for
20 seconds at 37 °C followed by 2 minutes on ice. 950 ul of
LB medium were added and the tube incubated for 1 hour at 37
OC. LB medium was prepared by mixing 950 ml of milliQ water,
10 g Bacto-trypton, 5.0 g Bacto-yeast extract, and 10.0 g
Nacl, the pH was adjusted to 7.0 with 5 N NaOH. The volume was
adjusted to 1.0 liter with milliQ water and autoclaved for 20
minutes at 15 lb/square inch on liquid cycle. The cells were
isolated by centrifuging 20 seconds at 3,000 x g. Eight
hundred ul of supernatant were removed and the cells were
suspended in the remaining 200 ul of LB medium. To isolate
cells containing recombinant pGEM-T Easy Vector, 40, 60, and
100 111 of the cell suspension were spread on agar plates
containing 40 ul of 100 mM isopropyl 2-D thiogalactopyranoside
(IPTG) in water, 40 ul of 2% 5-bromo-4-chloro-3-indolyl-2-De
galactopyraniside (X-gal) in dimethyl—formamide, using sterile
.rod and incubated overnight at 37 33. Positive colonies were
selected and cultured in 10 ml medium with ampicillin (50 ug
/ rml) and then incubated aerobically Overnight at 37 °C in a
225 rpm shaker. The DNA miniprep kit (Promega Wizard plus
lHinipreps DNA Purification System, cat. # A7500) was used to
purify the product. The plasmid with the insert was then

quantified and submitted for sequencing.

43

Restriction Enzyme Digest:

Restriction enzyme digest was performed to check for the
presence of the amplified fragment in the cloning vector.
Restriction enzymes bind specifically to and cleave double-
stranded DNA at specific sites within or adjacent to
particular sequences lounni as recognition sites (Roberts,
1988).

An EcoRI digest (New England Biolabs0 Inc. cat. # 1018)
was performed using 0.25 ul of each of the cloned samples
above (250 ng/ul) placed in a 1.5 ml eppendorf tube containing
7.75 ul MilliQ water and 1 ul EcoRI enzyme buffer (10x buffer)
and 1 ul of EcoRI enzyme. The tube was incubated at 37 °C for
4 hours. The digestion product was then run in 1% agarose gel

for 1% hours.

Sequencing:

ABI automated sequencer (Perkin-Elmer Applied Biosystems,
model 373; protocol P/N 402114) was used to sequence the DNA
in both direction, which implies the chain termination method
(Sagner and Coulson, 1977).

Microcon-lOO's chromatography columns (Amicon cat #
42413) were used to purify and concentrate 100 ul of PCR
product. The DNA was then quantified by comparing it with

known bands of 9 cut with Hind III.

._.*‘__

'P.‘ 64"”. .‘C't;»

l) sequencing reaction:

To 8.0 ul ABI (sequencer) Ready Reaction Mix in a 200 ul
PCR tube, 10 ul milliQ water, 1.0 ul PCR product (10 ng / 100
bp), and 1.0 ul primer (3.2 pmole) were added. Because samples
were light sensitive, all subsequent steps were done in
reduced light. All samples were put in a thermal cycler and a

sequencing program was run.

2) Post sequencing reaction preparation:

The above PCR was stopped, and then 74 ul of 70% ETOH
with 0.5 mM MgClz‘was added to the 20 ul sequencing reaction
tube. The product was then transferred to 1.5 ml eppendorf
tube. Samples were mixed and remained at room temperature for
15 minutes, then centrifuged for 20 minutes at 4 °C at 10,000
x g with the back edge of the tubes pointed to the outside of
the centrifuge. The supernatant was removed carefully with a
vacuum and the samples were dried for 3 minutes using a speed
vac. Samples were stored at room temperature until they were

loaded in the sequencing gel.

3) Preparation of samples for loading:

To each DNA sample tube, 4.0 ul loading buffer, 5.0 ml
formamide, and 0.5 g AmberLite Resin were added and vortexed
for 1 minute. The tubes were heated at 90‘T2f0r 3 minutes to
(denature the DNA. The samples were centrifuged briefly to

lxring'the solution to the bottom of the tube. The tubes were

45

stfl.‘-.'d¢a.mu ~t—a 1:. '

placed immediately on ice before being loaded into the ABI
sequencing gel. The loading buffer was made by mixing 0.5 ml

EDTA (0.5 M), 9.5 ml Sterile water, and 0.5 g Blue Dextran.

PCR of HSL for 6 Bovine Breeds:

Six different breeds of cattle, obtained from Michigan
Cattlemen’s Association / Michigan State University Farm-to-
Fab Program, were used to amplify a partial sequence of exon
8 for HSL gene from their genomic DNA (10 ng /m1). In a 200 ul
PCR tube, 0.25 ul Taq DNA polymerase(5 u/ul) was added to
47.70 ul PCR premix ( 5.0 ul Taq DNA polymerase buffer (10x),
0.5 ul dNTPs (10 mM), 2.5 ul Upper primer (7.6 pM/ul), 2.0 ul
Lower primer (10.4 pM/ul), 4.0 ul Mgcl2 (25 mM), and 34.75 ul
MilliQ water were vortexed briefly and then 2 ul genomic DNA
(10 ng / ul) were added. The thermal cycler machine was set as
follows:

Robocycler:

94 °C for 10 minutes

94 °C for 50 sec. D D D 30 Times
55 °C for 50 sec. D D D 30 Times
72 °C for 1 minutes CD C!) D 30 Times
72 °C for 10 minutes

6 °C for co

1% agarose gel, 2 ul 100 bp ladder, 6 ul PCR product, running

46

time was 1 hour.

Since this was the only part of the bovine HSL gene being
amplified by the different PCR trials, other approaches were
then tried to see if the HSL gene could be isolated from a

bovine genomic DNA library.

Ti tering Bovine Genomic Library:

Since it was first used as a cloning vehicle (Murray and
Murray, 1974), bacteriophage 9 has occupied a central role in
molecular cloning. It adsorbs to receptors in the outer
membrane of the bacteria that are normally used to transport
maltose into the cell.

A.bovine genomic library (adult male liver digested with
.MboI) was obtained from. Clontech (cat. # 8L1015j). The
fragments (average size was 15 Kb) were cloned at the BamHl
site in phage EMBL3 SP6/T7. The titer of the phage was
determined by standard procedures using the bacterial host
K802. The Clontech library protocol was followed for titering
the phage (protocol # PTlOlO-l; version # PR47377). 2, 5, 10,
and 0 ul of the diluted phage (1:250,000 dilution) were
incubated with 100 pl (2 X 108 cells) of the bacteria for 20
minutes at 37cc. The phage-infected bacteria were added to 4
ml of sterile top agarose (10 g bacto trypton, 5 g bacto yeast

extract, 10 g NaCl, and 8 g of agarose in 1 liter of milliQ

47

water) in 15 ml tubes at 50 T3. Top agarose was layered onto
90 mm agar Petri dishes[ top agarose: 10 g bacto trypton, 5 g
bacto yeast extract, 15 g bacto agar, and 5 g NaCl in one
liter of milliQ water which was autoclaved and cooled to Room
temperature]. The plates were incubated overnight at 37 OC.
The individual lysed bacterial colonies were not in contact

with each other.

Plate Lysate:

Adsorption of bacteriophage particles to the receptors is
facilitated by magnesium ions and occurs efficiently and
rapidly (within a few minutes) both at room temperature and at
37 °C. However, penetration of the cell by bacteriophage DNA
and the subsequent events in the lytic cycle do not occur
efficiently at room temperature.

450 ul of the diluted titered samples were plated after
infecting 600 ul of bacteria (K802) at 37’°C for 25 minutes.
The plates were incubated at 37 33 for 11 hours, until fully
lysed. Phage were eluted by adding 12 ml 1x dilution buffer
[100 ml of 10x dilution buffer: 5.83 g of 1.0 M NaCl, 2.47 g
of 0.1 M MgSO,, 3.5 ml of 1.0 M Tris-HCl (pH 7.5) and MilliQ
water to a final volume of 100 ml, autoclave and store at 4°C]
and 2 ml of 2% gelatin to each 150 mm plate and left overnight
at 4 °C. The plates were then placed on a rocker and slowly

shaken at room temperature for 1 hour. The 1x dilution buffer

48

was collected from each pair of plates and put in 50 ml tubes.
The plates were washed with 2 ml of 1x dilution buffer and
then added to the 50 ml tubes. These 50 ml tubes were
centrifuged at 2,000Xg for 10 minutes at 4 °C. DNase 1 (1
ug/ml) and RNase A (5 ug / ml) were added to the supernatant
and incubated at 37 °C for 1 hour. Then 5 g of PEG800 and 2.92
g of Nacl were added to each tube and the volume brought to 50
ml with 1x dilution buffer. The tubes were left on ice
Overnight to precipitate. The next day PEG800 crystals were
dissolved and small amounts of the white cloud of the phage
were seen. The supernatant was decanted after centrifuging
(2000 xg) for 30 minutes at 4 °C.

The precipitate was resuspended in 1x dilution buffer and
transferred to 15 ml tubes. The solution was extracted three
times with CH3Cl by centrifuging at 2500-3000 xg for 15
minutes at 4 °C until the white interface disappeared. 20 ul
of EDTA (0.5 M), 20 ul 10% SDS, and 10 ul proteinases K (10
mg/ml) were added and the tubes were incubated for 1 hour at
50 °C in a shaking water bath and cooled at room temperature
The tubes were then phenol / chloroform extracted twice by
centrifuging each time at 2,500 xg for 15 nunutes at room
temperature. The tubes were extracted again with CHNII. The
solution was aliquoted to 1.5 m1 eppendorf tubes. 1/10 volume
NaOAc pH 7.0 and two volume absolute ETOH (freezer cold) were
added to each tube, then centrifuged at 12,000 xg for 15

lninutes at 4 °C. The supernatant was decanted and the pellet

49

.a, -2311 |
A

W tau—nun-

was rinsed with 70% ETOH and centrifugated (microcentrifuge to
max. speed) for 5 minutes. The pellet was dried at room
temperature, resuspended in 80 ul TE buffer pH 8.0 and kept
overnight at 4 33. 5 ul of the sample was run in a 1% agarose
gel to check for the presence of the library DNA.

21 ul RNase (10 mg/ml) was added to 1.1Ll of the phage
lysate above and then incubated atil7°C for 1 hour, the 2 ul
were used in a 50 ul PCR reaction ( 5 ul Taq Polymerase
buffer, 1 ul dNTPs (10 mM), 2.5 ul upper primer ( 7.6 pM/ul),
2 ul lower primer (10.4 pM/ul), 33.25 ul milliQ water, 4 ul
MgCl (25 mM), 2 ul of bovine library above, and 0.25 ul Taq

Polymerase (5 u/ul))

The thermal cycler was adjusted as follows:

94 °C for 5 minutes

94 °C for 50 sec D D D 30 Times
55 °C for 50 sec. D D D 30 Times
72 °C for 1 minutes D D D 30 Times
72 °C for 10 minutes

6 °C for w

The PCR product was then run in a 1% agarose gel

50

 

CU

 

 

Du .

3.

 

Screening The Bovine Genomic Library:

1) Plaque Lifting:

Oligonucleotide screening was performed as described by
Grunstein and Hogness (1975).

Nylon membranes (Hybond-N from Amersham part # 71720-31)
were used for plaque lifting from 25 plates of bovine genomic
library (Clonetech cat # 8L1015j). Two membranes were used for
plaque lifting from each plate which were then treated with a
UV cross-linker and left overnight to air dry. They were
packed in Zipper plastic bags and shelved for further
processing.

Agar plates containing the bacteria infected with the
phage were incubated overnight at 37 °C. Lysed colonies grew
large enough till they come in contact with each other. The
petri-dishes were then cooled for at least 30 minutes at 4 0C
before the dry nylon membranes were placed on the agar . Each
membrane was marked ‘DNA' and the plate numbered with a blunt
ended pencil. The membranes were folded in half with the DNA
side outward. The resulting troughs were placed across the
center of the petri-dishes. The troughs were released and the
inembranes were allowed to sit on the surface for 30 seconds,
tine disk position was marked at three positions by using a
sterilized sharp pin. The membrane was removed from the petri-
dishes after 30 seconds in one continuous movement using

sterilized forceps. The same process was repeated with another

51

membrane. Membranes were put in a denaturation solution (1.5
M NaCl and 0.5 N NaOH in water) for 3 minutes, then in a
neutralization solution (1.5 M Nacl, 0.5 M Tris-HCl pH 8.0 )
for 3 minutes. The membranes were then washed for 5 minutes
in 2x SSC (1 x SSC is 150 mM NaCl, 15 mM Na citrate pH 7.0)
and transferred, DNA side up, to a pad of 3MM paper to air
dry. DNA was fixed to the membrane by using UV cross-linker C3
(HyBaid model # H9320; Benton and Davis, 1977) and left to air
dry overnight. They were packaged in zipper plastic bags and

kept for further processing.

2) Probe Labeling:

DNA fragments were routinely labeled to a high specific
activity by the random hexamer priming method (Fienberg and
Vogelstein, 1983). The concentration (70 ng/ul) of the bovine
HSL PCR product (264 bp) to be labeled with 32P was measured at
260 nm. The concentration was confirmed with 9 cut with Hind
III and run in 1.5 % agarose gel for 40 minutes.

Amersham standard protocol (cat. # 16012) was used for
probe labeling. 1 ul Probe DNA (70 ng) to be labeled was
dissolved in 4 ul MilliQ water in a 1.5 eppendorf tube, heated
at 95 °C in a boiling water bath for 2 minutes, and then
chilled on ice for 10 minutes. The tube was centrifuged
Ibriefly to concentrate the contents at the bottom of the tube,
then.the tube was placed on ice. 10 ul of random primer buffer

were added to the 5 ul of denatured probe above. 5 ul of

52

arm-WT"; .

random hexanucleotide primers, 23 ul milliQ water, 5 ul of a
mixture of ATP, dGTP, dTTP, and [”PJdCTP containing 50 uCi
(#3000 Ci/mmol), and 2 ul Klenow enzyme (exonuclease free)
were added consecutively.

The reaction was mixed gently by pipetting up and down
and spun for a few seconds. The reaction was carried out
overnight at room temperature under the hood. A second
reaction was run for 30 minutes at 37 °C . Micro Bio-Spin
chromatography columns (Bio—Rad cat. # 732-6202) were used to
isolate the product from the reaction mixture. The exclusion
limit for these columns was 5 base pairs. Samples were diluted

1:10 before placing on the column.

Micro Bio-Spin Chromatography Columns:

The columns were inverted. sharply several times to
resuspend the settled gel and remove any bubbles. The tips
were snapped off and the columns were placed in a 2.0 ml
microcentrifuge tube, then the top caps were removed. The
excess packing buffer was allowed to drain by gravity to the
top of gel bed (about two minutes). The drained buffer was
discarded and then the columns were placed back into the 2.0
ml tube. The columns were then centrifuged for 2 minutes in a
Inicrocentrifuge at 1,000xg to remove and discard the remaining
packing buffer. The columns were placed in 1.5 ml
microcentrifuge tubes. The samples (20-75 ul) were carefully

applied.directly to the center of the column. The columns were

53

 

centrifuged for 4 minutes at 1,000xg. The purified samples
are now in Tris buffer. Molecules smaller than the column's

exclusion limit are retained by the column.

3) Hybridization:

When using oligonucleotides as probes to hybridize with
complimentary DNA sequences , the aim is to find conditions
that are stringent enough to guarantee specificity and
sufficiently flexible to allow formation of stable hybrids at
an acceptable rate.

Each 6-8 nylon membrane, prepared as described above,
were placed.ix1ea UV cross linker's cylinder. The labeled
probe was denatured in a IOO‘T: water bath for 10 minutes and
then put on ice, 30 ml prehybridization solution [50 ml
Formamide, 25 ml SSPE 20x (Clonetech manual), 5 ml Denharts
100x, 0.3 9 SDS, and 20 ml water] were poured into the
cylinders, containing the membranes, and the temperature was
adjusted to 50‘T2. After rocking the cylinder for two hours
the prehybridization solution. was dicarded and. 5 :ml of
hybridization solution [5 ml Formamide, 2.5 ml SSPE 20x, 0.5
:ml Denharts, 0.01 g SDS, 0.1 ml Denatured Salmon Sperm DNA
(denatured at 95-100 °C for 2 minutes), 1.9 ml water] were
poured in the cylinders. The denatured labeled probe was
pipetted gently to the center of each cylinder and left on a
rocker overnight.

The next day the hybridization solution was removed, the

54

 

membranes were washed with wash buffer 1 (50 ml 20x SSC, 2.5
g SDS, and 450 ml sterile water) for 20 minutes at 50‘Tiin
the cylinders. The membranes, were transferred to tupperware
where they were washed with wash buffer 2 at 65 W3 (50 ml 20x
SSC, 1.0 g SDS, and 950 ml sterile water), in a shaking water
bath, for 1 hour. Then the membranes were put in wash buffer
3 (5 ml 20x SSC, 495 ml sterile water) at 65 °C in a water
bath for 1 hour. Membranes were taken individually and placed
on 3MM Whatman papers cut to the size of the membrane and

wrapped with Saran Wrap.

Autoradi ography :

Autoradiography produces permanent images on photographic
film of the distribution of radioactive atoms on a two-
dimensional surface. In molecular cloning, autoradiography is
used for a variety of purposes, including the visualization of
bands of radioactive nucleic acids in Southern and Northern
hybridization and localization of bands of DNA in gels.

Wrapped.membranes were placed in film cassettes and taken
to the dark room to add the film. Between 4-8 membranes were
put on one film for autoradiography. The membranes were
exposed to a Kodak X-ray film in cassettes at -80 W: for 72
hours(Sambrook, et al., 1989).

Positive plaques were picked using blue pipet tips cut

from.the edge and then sucked with a pipetman and put in a 1.5

55

PH .lc- -I—Mu-Fv. 01:1 I

ul eppendorf tube containing 1 ml sterile 1x 1amda dilution
buffer. A drop of chloroform was added and the tubes were
vortexed briefly, and left overnight at room temperature. The
next day the tubes were centrifuged at 8,000g for 2 minutes
and the solution transferred to new tubes. These tubes were
titered and plated again, as above, for a second screen.
Positive colonies were picked again and a third screen was

done.

Probe Labeling:

The PCR product, obtained by using the primers that were
used successfully to amplify part of exon 8 of HSL gene from
genomic DNA as described before, was used as a probe for
plaque lifting and Southern blot. The PCR product to be
labeled was first quantified by comparison with known bands of
9 cut with Hind III (Figure 16). The probe was then labeled
wit111”P and the percentage of the 32P incorporated into the
probe was calculated as follows:

(CPM after column / CPM before column) X 100%

‘When.70 ng DNA were used, the incorporation was 16.9% when the
reaction was incubated overnight at room temperature compared
to 5.67% when it was incubated for 30 minutes at 37°C.
Total amount of 32P was 1.36 X 107 cpm for the overnight

sample, and 5.83 X 106 for the 37 °C sample.

56

P' inmaugwmvgq '

 

Figure 16.

Lane]
Lane2
Lane3

Agarose gel image illustrating
the quantification of PCR
product (263 bp) of part of
exon 8 of the bovine HSL to be
used as a probe. 9 cut with
Hind III was used as standard
for the quantification

DIKbLadder
DSuIPCRproduct
D5ul9cutwithHindIII

57

southern Blot:

Localization of particular sequences within genomic DNA
is sometimes accomplished by transfer techniques described by
southern (1975) .

3 ng of genomic DNA extracted from each of Simmental,
Tarentaise, Shorthorn, and Holstein breeds were digested, in
four different tubes, with 15 U of EcoRI at 37 °C . The
digests were left overnight in a 20 ul reaction volume. The
next day the samples were run in 1% agarose gel until the dye
reached the end of the gel (150V; 1 *2 hour.). The gel was
stained with ETBr [300 ul (10 mg/ul) in 500 111 water] for 15
minutes, destained for 1 hour in water, and photographed. The
agarose gel was placed for 15 minutes in tupperware containing
250 ml depurination solution (0.25 N HCl). A nitrocellulose
membrane, that was cut to the size of the gel and marked DNA
on one side, was bended in half without creasing it, then the
membrane at the bend was immersed into a tray of milliQ water
for 5 minutes. The membrane was transferred to a tray
containing 10x SSC for a minimum of 15 minutes. The
delulrination solution was carefully poured off and the gel
rinsed once in 250 ml of milliQ water. The gel was then
denatUred by incubating in 250 ml of denaturing solution (0.5
N NaOH, 1.5 M Nacl) for 20 minutes. The denaturing solution
then Was poured off and the gel was rinsed once in 250 ml of

milliQ water. The gel was neutralized by incubating in 250 ml

58

of neutralization solution (1.0 M Tris—HCL pH 7.5, 1.5 M Nacl)
for 20 minutes with occasional rocking. The agarose gel tray
was then placed upside-down in a tupperware container. 10x
SSC was added so that the level was half-way up the side of
the gel tray. The wick of filter paper (3MM Whatman paper cut
3 inches more than the size of the gel) was then saturated in
10x SSC and aligned on the back of the gel tray. .Air bubbles
were removed using a disposable glass Pasteur pipet. The gel
was placed face up on the saturated filter papers and checked
that no air bubbles were trapped between the gel and the wick.
The wetted nitrocellulose membrane was then placed DNA side
down on the gel. The membrane was checked so as not to hang
over the gel and come in contact with the wick. A pasteur
pipet was then used to remove air bubbles. One pre-cut filter
paper saturated with 10x SSC was placed on the top of the
membrane. The other two dry filter papers were then added to
the stack. They were checked to make sure that they were not
in direct contact with gel or the wick. The filter paper was
then covered so as to not directly contact the gel or wick,
with the 3-inch high stack of pre-cut paper towels. The paper
towels were then covered with a rigid support. The whole
apparatus was then covered with a plastic wrap to prevent
evaporation. A blot weight of about 200-500 g was placed on
the rigid support. Transfer of DNA was allowed to precede
overnight(Southern, 1975). The membrane was removed from the

(gel and.placed DNA side up on a clean filter paper. The gel

59

was then checked under the UV light to make sure that the DNA
was transferred properly. The membrane was rinsed for about 5
minutes in 6x SSC. The membrane was laid DNA side up on a
clean sheet of filter paper to air dry and then X-Linked.
Hybridization and autoradiography with a labeled probe was

done as above.

Bovine PCR for Pools and Individual:

PCR was carried out on 100 ng of DNA from each of the
Holstein pools (6 animals), Angus pools (2 animals), Hereford
pools (5 animals), Shorthorn cow, Tarentaise cow, and
Simmental cow [10 ul genomic DNA(10 ng/ul) 1.0 ul dNTPs (10
mM), 2.5 ul upper primer(7.6 pM/ul), 2.0 ul lower primer(10.4
pM/ul), 25.25 ul milliQ water, 4.0 ul Mgcl2 (25 mM), 5.0 ul
Taq DNA Polymerase Buffer (10x), 0.25 ul Taq DNA polymerase (5

U/ul)].

Robocycler:

 

94 °C for 5 minutes
94 °C for 50 sec/ D D D 30 Times
55 °C for 50 sec. D D D 30 Times
72 °C for 1 minutes D D D 30 Times
72 °C for 10 minutes

6 °C for on

l-‘ WM" ‘T'W

The PCR product was run in 1% agarose gel

The PCR products above were cloned in pGEM-T Easy vector
as described above. Then the PCR products were purified using

Microcon columns from Amersham (cat. # 42413).

Single-Strand Conformation Polymorphism (SSCP) :

The SSCP technique is based on the fact that single-
stranded DNA has a sequence-specific secondary structure.
Sequence differences as small as a single base change can
affect this secondary structure and can be detected by
electrophoresis in a non-denaturing polyacrylamide gel.
Double-stranded mutant and wild-type samples are first
denatured into single strands and then loaded onto the gel.
Differences in mobility of the single strands between the
control wild-type DNA. and the other samples indicate a
mutation. SSCP is a widely used mutation screening method
because of its simplicity. However, since experimental
conditions cannot be predicted for a particular DNA, it is
important to optimize gel electrophoresis conditions. The cold
SSCP method (Hongyo, et al., 1993) and an SSCP machine
(BioRad model DCode System) were used. When connected to an
appropriate external chiller, the Dcode system can control the

buffer temperature between 5-25 CC. The electrophoresis

61

’m' rants“ nan-aw

cooling tank is cmmfitted with two cooling fingers. Tygon
tubing connects the cooling fingers in the electrophoresis
tank to an external chiller. The chiller recirculates a
coolant through the cooling fingers which, in turn, cool the
buffer. The external chiller is set to cool the coolant to
approximately -20 oC, and the Dcode heater regulates the
buffer temperature. 8% gel (No glycerol) reaction was prepared
[8 ml 40% acrylamide / Bis solution, 4 ml 10 x TBE, and 23.5
ml MilliQ water were mixed and degassed for 15 minutes before
adding 40 ml TEMED and 400 ul 10% Ammonium Persulfate(0.1 g
Ammonium Persulfate in 1.0 ml milliQ water)]. The gel was cast
immediately after the above step and was placed at 4°C for 7
hours.

8 ul of SSCP 2x loading dye (0.05% Bromophenol Blue,
0.05% Xylene cyanol, 95% Formamide, 20 mM 0.5 M EDTA, pH 8)
were added to 8 ul of each PCR product and the samples were
placed in heating blocks at 95 W: for 10 minutes and then on
ice before loading. The best running condition was 10 W: for

6 hours.

Bovine Spleen cDNA Library:

PCR was carried out, as above, on bovine spleen cDNA and

bovine genomic DNA libraries.

62

 

Robocycler:

 

94

94

55

72

72

6

°C

°C

°C

°C

°C

°C for on

for

for

for

for

for

5 minutes

50 sec D D D 35 Times

50 sec. D D D 35 Times

1 minutes. D D D 35 Times

10 minutes

63

1'!‘. "- .. ._ I no I" .

Materials

Bacto-trypton, bacto-yeast extract, and bacto-agar were
from DIFCO laboratories. Agarose, tris-base, 1amda cut with
Hind III, and EDTA.were from GIBCOBRL. Sodium chloride, sodium
hydroxide, sodium acetate, chloroform, and boric acid were
from J.T. Baker. I} DNA ligase was from New England Biolabs0
Inc.. Formamide, and PEG8000 were from Fisher Biotechnology.
SDS, IPTG, X-gal, ampicillin, RNase A, and DNase 1 were from
Boehringer' 'Mannheim. Denharts, and sheared Salmon sperms
were from Eppendorf. TEMED, acrylamide/bis acrylamide
solution, 1 Kb molecular ruler, 100 bp rular, and ammonium
perusulfate were from Biorad. 3MM whatman papers were from
Whatman. The restriction enzymes, and Taq DNA.polymerase, were
from.Promega, 8MB and New England Biolabs0 Inc.. Proteinase K
was from Life technology. Ethidium bromide, bromophenol blue,

and xylene cyanol were from Sigma

 

RESULTS

Quantification of Genomic DNA:

Promega strongly suggests not to use A.260 measurement to
quantify DNA. Therefore, to estimate DNA concentration,
genomic DNA was run in 1% agarose gel along with 1.0 ul 9 cut
with Hind III as a marker (Figure 4). The estimated genomic
DNA concentration isolated from both the heparin and the EDTA

tubes was found to be the same (25 ng/ul).

Primer Design:

More than fifteen different sets of primers were not able
to amplify any of the HSL 5 fragments, described above, after
several experiments using different combinations of primers
and adjusting reaction conditions. The only successful ones
were for part of exon 8. The sequence of those primers were:
Upper primer = 21 bp; Tm= 65.7 °C; GAC ACA ACA GAC ACG CCA
GAG
Lower primer = 17 bp; Tm = 64.9 WC; CAG CAG CGG TGA CAT GAA.G

Expected product length was 263.

65

mi

| P .' .1 ham-:1.- -.-t‘-_ulw

Figure 4.

Lane]
Lane2
Lane3
Lane4
Lanes
Lane6
Lane7
Lane8

 

gel image illustrating the same
concentration of bovine genomic DNA obtained
when the whole blood was collected in heparin and
EDTA tubes. The 1amda cut with Hind 1]] was
used as standard to measure the concentration.

D 1 ul 9 cut with Hind 111

D 1 ul genomic DNA (EDTA tube)
D 2 ul genomic DNA (EDTA tube)
D 4 ul genomic DNA (EDTA tube)
D 1 ul genomic DNA ( heparin tube)
D 2 ul genomic DNA (heparin tube)
D 4 ul genomic DNA (heparin tube)
D 0.5u19cutwithHindIII

 

Polymerase Chain Reaction (PCR) :

When six PCR (Figure 5, panel 1) for part of exon 8 and
4 PCR (Figure 5, panel 2) for a fragment consisting of exons
2, 3, 4, 5, and the intron between them (according to the
human sequence) were performed, the expected product lengths
were 263 bp and 1062 bp, for exon 8 and exon 2-5 respectively
(Figure 5). Only the fragment for exon 8 (Figure 5, panel 1)
was amplified but not the other fragment (Figure 5, panel 2)
that consists of exon 2, 3, 4, 5, and the introns between them
although different reaction conditions and sets of primers

were tried.

Miniprep and Restriction Enzyme Digest:

The PCR product (263 bp)from the above reaction (Figure
5, panel 1) was cloned successfully into pGEM-T plasmid vector
and transformed into bacteria (strain JM109). The transformed
bacteria were then plated onto agar plates and incubated
overnight at 37 °C. Three white colonies and one blue colony
(as a negative control) were picked randomly and grown
overnight in a LB liquid media in a 37 °C shaker. A.miniprep
was done and the products were cut with EcoRI and run in 1%
agarose gel for 1% hours (Figure 6) to check for the presence
of the insert. .A 263 bp insert and 3.3 kb plasmid were clear
on the gel when the clone was cut with EcoRI in lanes 1, 2,

and 3 (Figure 6). Only the circular uncut plasmids appeared

67

or munch-t. L fl-sf-f a..."
' L

on the other lanes.

Sequencing :

The cloned bovine PCR product was sent to the sequencing
facility at Michigan State University along with both the
forward (upper) and reverse (lower) primer. The sequence
(Figure 7 and 8) was edited whenever the color-coded signal
was clear. A bestfit command was done, to the edit sequence
using the GCG program ( http://www.gcg.com/), with HSL for
other species and the bovine published sequence (GenBank
accession # U78042). A high homology was found between the
amplified part of exon 8, the published HSL gene for bovine
sequence (GenBank accession # U78042; Figure 9), swine
(Figures 10) rat (Figure 11), and human (Figure 12). Also the
sequence was blasted into the NCBI home page
(http://searchlauncher.bcm.tmc.edu) and it hit the HSL gene

for different species.

68

rem-“r.

 

Figure 6.

LaneO
Lanel

Lane 1
Lane 2
Lane 2
Lane 3
Lane 3
Lane 4

Lane4

Agarose gel image (1%) illustrating
part of exon 8 of ESL PCR products
(263 bp) cloned in pGEM-T vector and
cut with EcoRI

D PCR ruler

D Uncut cloned sample (the vector and
the insert), white colony # 1

D The insert cut fi'om the plasmid ,
white colony # 1

D Uncut cloned sample (the vector and
the insert), white colony # 2

D The insert cut from the plasmid ,
white colony # 2

D Uncut cloned sample (the vector and
the insert), white colony # 3

D The insert cut from the plasmid ,
white colony # 3

D Uncut sample fiom the miniprep (the
blue colony)

D The digestion product for the blue
colony.

69

 

 

 

325.32. i=3“: f.:::§§::: E 55:: .. 2;:5222:3225:22:553:35:2:22....»
mm a 3 an

3.: E; L; g... i it a: i; E:

Karlie.13.222.2223«21:22:35.2HA2:522:212:22.52»:LZZZAAAQMZHSCK ":3?” 34.13..“

c

Sequence signals for part of exon 8 of

bovine HSL gene

  

 

R,

1::=‘:.._.s_?i_9.192.913 .3 gr...

The red peak is Th

The green peak is Adenine
The black peak is Guanine
The blue peak is Cytocine

 

Figure—u.~ 7.

 

70

MNTCTGCNCTCAGTCCGCGGNCACACTCGGCCCCTCCGCACCC TCAACCATCAAC
TTCTTACTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCCCCAGAGGAGCTGAACAAC
AAGGACCGAGTTCGAGGTGTGGGCGCCGCCTTCCCCGAGGGTTTCCACCCACGGCGCTGC
AGCCAGGGTTGCCATGTGGATGCCCCTCTACTCGGCCCCATCGTCAAAAATCCNTCT§T_C

CCGNCGGGGAA

 

Figure 8. The HSL PCR product sequence (251 bp) for part of
bovine exon 8 before editing showing 4 more bases
at the beginning and 14 more base at the end
(underlined) of the sequence compared to the 233 bp

sequenced on this study.

71

2 I~I Ir'e . I. l . e re s . e: t 51

:::::::I:::I: II ::||I|||IIII IIIIIIIIIIII
87 cacaacagaoacgccagagttg. tcactgtcogoggagacactcggcccc 135

l

52 es 8 s s . ..101

IIII IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
136 tccgtaccctcaaccatcaacttcttacttggatctgaggatggatctga 185

102 its sv .. .. e to e s e 151

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
186 aatgtctgaggccccagaggagctgaacaacaaggacogagttogaggtg 235

152mm

IIIIIIIIIlIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIII
thmcmcatwwgagggtttccacccacrcgctgtagocagr 284

202 2mm 247

IIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIIIIIII IIIII=I
285 tgccatgtggatgcccctctactoggcccccatogtcaagaatccct 331

‘-

Fignre 9. Alignment ofpart ofthe bovine exon 8 HSL PCR product sequence
(upper) before editing and the published bovine HSL partial
sequence (lower) accession # U78042. Note the high homology
between the two sequences which indicates that the sequenced
fragment (upper) is part of HSL gene. The alignment was prepared
using the GCG program

72

Animall X SwineHSL

2195

51

2245

101

2295

148

2345

198

2395

CAGAGCTGTCACTGTCCGCGGAGACACTCGGCCCCTCCGCACCCTCAACC 50

I IIIIIIIIIIIIII II lllIl II llIlII II ||I|I|| I
cggagctgtcactgtcagctgagacgcttggccccaccacaccctcggct 244

ATCAACTTACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCCCC 100

IIIIIII I II II IIIIIIIII I IIIII I IIIIIIIII
gtcaacttcttatttcgacctgaggatgcacctgaagaggctgaggcccg 2294

AGAGGAGCTGAACAACA...AGGACCGAGTTCGAGGTGTGGGCGCCGCCT 147

IIIIIIIIIIII IIII III IIIIIIIIIIIII
agacgagattagcaccaaggaggagaaagtctacagtgtgagggccgcct 2344

TCCCCGAGGGTTTCCACCCACGGCGCTGCAGCCAGGGTGCCATGTGGATG 197

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII Illl
tccctgagggtttccacccaaggcgctccagccaaggtgcaatacagatg 2394

CCCCTCTACTCGGCCCCCATCGTCAAGAATCCCTTC 233
lIlIlllllll II IIIIIIIIIIIIIIIIIIIII

cccctctactcagctcccatcgtcaagaatcccttc 2430

Figure 10. Sequence comparison between part of the bovine

exon 8 HSL PCR product (upper) and part of the
swine HSL gene (lower) showing 78% homology.

73

2417

51

2467

101

2517

151

2567

201

2617

Figure 11.

Animall x RatHSL

CAGAGCTGTCACTGTCCGCGGAGACACTCGGCCCCTCCGCACCCTCAACC
I III IIIIII III IIIIIIIII IIIIIIIII IIIIIII

ccgagatgtcacagtcaatggagacacttggcccctccacaccctcggat

ATCAACTTACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCCCC

IIIIIII IIII IIII I I II III I IIII II
gtcaacttttttctgcgatccgggaattcccaggaagaggctgaaaccag

AGAGGAGCTGAACAACAAGGACCGAGTTCGAGGTGTGGGCGCCGCCTTCC

III II I l I II IlII II I l I III IIII IIIIIII
agatgatataagccccatggacggaatcccccgcgtgcgcgctgccttcc

CCGAGGGTTTCCACCCACGGCGCTGCAGCCAGGGTGCCATGTGGATGCCC

I IIIIIIIIIIIIIIIIIIIII IIIII IIII I I IIIIII
ctgatggtttccacccacggcgctcaagccaaggtgtcctccacatgccc

CTCTACTCGGCCCCCATCGTCAAGAATCCCTTC 233
IIIIIIIII IIIIII IIIIIIIIIIIIII

ctctactcgtcacccatagtcaagaaccccttc 2649

50

2466

100

2516

150

2566

200

2616

Sequence comparison between part of the bovine

exon 8 HSL PCR product (upper)and part of the
rat HSL gene (lower) showing 73% homology. The
alignment was prepared using the GCG program

74

Animall x HumanHSL

2403

51

2453

101

2503

151

2553

201

2603

CAGAGCTGTCACTGTCCGCGGAGACACTCGGCCCCTCCGCACCCTCAACC
I III IIII IIIII II IIIIIIII IIIIIIII IIIIIII

ccgagatgtcgctgtcagctgagacacttagcccctccacaccctccgat

ATCAACTTACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCCCC

IIIIIII I I I IIIIIIIII I III I IIIIIIII
gtcaacttcttattaccacctgaggatgcaggggaagaggctgaggccaa

AGAGGAGCTGAACAACAAGGACCGAGTTCGAGGTGTGGGCGCCGCCTTCC

I I IIIIIII I II IIII III I II II I IIIIIIIIII
aaatgagctgagccccatggacagaggcctgggcgtccgtgccgccttcc

CCGAGGGTTTCCACCCACGGCGCTGCAGCCAGGGTGCCATGTGGATGCCC
IIIIIIIIIIIIIIII II IIII IIIIIIIIIIIIII IIIIIII

ccgagggtttccacccccgacgctccagccagggtgccacacagatgccc

CTCTACTCGGCCCCCATCGTCAAGAATCCCTTC 233
IIIIIIII I IIIII IIIIIIII IIIIII

ctctactcctcacccatagtcaagaaccccttc 2635

50

2452

100

2502

150

2552

200

2602

Figure 12. Sequence comparison between part of exon 8
(233 bp) of the bovine HSL PCR product
(upper)and part of the Human HSL gene (lower)
showing 76% hanology. The aligmuent was prepared

using the GCG program

75

PCR of HSL for the 6 Bovine Breeds :

When 32 animals from six breeds of cattle (6 Brahman, 5
Simmental, 3 Tarentaise, 5 Shorthorn, 5 Angus, and 8 Holstein
cows) were used to amplify the partial sequence of HSL gene
from their genomic DNA (10 ng/ml), only PCR products from 26
animals were obtained (5 Brahman, 5 Simmental, 3 tarentaise,
5 Shorthorn, 2 Angus, 6 Holstein; Figure 13).

The Holstein breed was originally from Netherlands,
Tarentaise was from France, Angus was from Scotland, Brahman
was from India, Shorthorn was from British Isles, and
Simmental was from Switzerland.

263 bp were obtained from the PCR product of 5 Brahman,
5 Simmental, 3 Tarentaise, 5 Shorthorn, 2 .Angus, and 6
Holstein as shown in Figure 13. This amplified fragment is
located in exon 8, downstream of the phosphorylation site.
All attempts to amplify the other parts of the gene were not
successful, although different primers and reaction conditions

were used.

76

 

Figure 13. Agarose gd image (1%) ilestrating PCR
products (263 bp) of part of exon 8 of ESL gene
from 6 different bovine breeds

laneo DIOOpradder

Lane 1 to 32 D The 32 animals samples (Brahman, Simental,
Tarentaise, Shorthorn, Angus, Holstein)

77

Titer and Phage Lysate of the Bovine Genomic DNA
Lib' rary:

When using 2, 5, 10, and 0 ul of the diluted
bacteriophage 9 (l:250,000 dilution) from a male bovine liver
genomic DNA library (Clontech corporation) to infect 100 pl (2
X 108 cells) of the bacteria and plated onto top agarose
plates, the number of lysed colonies were 59, 171, 297, and 0
respectively. Plaque forming units (pfu) were calculated as

follows:

pfu = (# ofplaques/ulused) Xdilution factorX lo’ul/ml

Plate#1 (59/2)X25X10‘X103ul/ml= 7.4XlO’pfu/ml
Plate#2 (171/5)x25x10‘x103u1/ml= 8.6X10’pfiJ/ml
Plate#3 (297/10)X25X10‘X103ul/ml= 7.4x109pfu/ml

To use 3 X 10‘ colonies as recommended by the protocol, 2 ul (1:500) were needed.
2ul(1:500)=(7.4XlO’X2)/(5X102X103)= 3X10‘

It was found that it was better to use 1 ul (1:500) in-
order to obtain half that amount of colonies. The DNA from
the eluted phage was run in 1% agarose gel to check for the
presence of genomic DNA (Figure 14). Large DNA fragments (more
than 10 Kb)were observed in lanes 1 to 7 (Figure 14), as
suggested by the company (Clonetech), and the same fragments
were observed, after being purified with columns, in lanes 1’
‘UD'V. The purified samples were used later on in PCR, library

screening, and hybridization.

78

Figure 14.

Lane 0
Lane 1
Lane 1
Lane 2
Lane 2
Lane 3
Lane 3
Lane 4
Lane 5
Lane 5
Lane 5
Lane 6
Lane 6
Lane 7
Lane 1

 

Agarose gel image illustrating DNA
samples obtained from bovine genomic

library

D 100 bp Ruler

D Sample after column purification
D Sample before column purification
D Sample alter column purification
D Sample before column purification
D Sample after column purification
D Sample before column purification
D Sample alter column purification
D Sample before column purification
D Sample after column purification
D Sample before column purification
D Sample afier column purification
D Sample before column purification
D Sample after column purification
D Sample before column purification

79

PCR for the Genomic DNA Library:

No PCR product was obtained when the genomic DNA.library
was used as a template in a PCR as shown in lanes 1 to 6
(Figure 15). The bovine genomic DNA was used as a positive
control in lane 7. The primers were the same primers that were
used successfully to isolate the HSL gene fragment from the

genomic DNA as described above (Figure 13).

80

Figure 15.

Lane 0
Lane (0)
Lane 1
Lane 2
Lane 3
Lane 4
Lane 5
Lane 6
Lane 7

 

Agarose gel image (1%) illustrating part of
exon 8 PCR products of bovine genomic
DNA library (nothing being amplified) and
bovine genomic DNA (263 bp) using the
same primers and reaction conditions

D 1 kb Ladder

D 100 bp Ladder

D Phage Lysate Sample (genomic library)
D Phage Lysate Sample (genomic library)
D Phage Lysate Sample (genomic library)
D Phage Lysate Sample (genomic library)
D Phage Lysate Sample (genomic library)
D Phage Lysate Sample (genomic library)
D Bovine Genomic DNA

81

HYbridization and.Autoradiography:

The PCR product of part of exon 8 (Figure 16) was used as
a probe, after being labeled , 'UD screen the genomic DNA
library by hybridizing to the nylon membranes that were used
in plaque lifting. The membranes were then exposed to the X-
ray film to later identify positive signals. About four false
positive plaques were found (Figure 17). The positive signals
were then picked for a second and a third screening to check
for false positives. No positive signals were found after the
third screening. Therefore, this procedure was rejected as a

way to isolate the HSL gene.

Southern Blot:

Genomic DNA from each of Simmental, Tarantaise,
Shorthorn, and Holstein breeds were digested with EcoRI and
examined using Southern blot. The resulting fragments were
separated, according to their sizes (<100 bp - >10,000 kb), by
electrophoresis (1% agarose gel; Figure 18 and 19). After the
Southern blot was completed, the gel was observed under a UV
light to make sure that the DNA was transferred successfully.
No DNA was left behind as shown in Figure 20. After
hybridization. with the probe, the autoradiography showed
positive signals (Figure 21). The probe was not able to pick

up the gene after the background was eliminated.

82

 
     

4
l
i
i
l
I
I
I

Figure 17. ‘X-ray film illustrating signals for HSL gene
picked up by P32 labeled probed from the first
genomic library screening

83

 

Figure 18. Southern blot analysis (1). Agarose gel
image illustrating the separation of
genomic DNA bands from 4 different
breeds after digestion with EcoRI for

hybridization with labeled probe
Lane 1 D Simmental genomic DNA
Lane 2 D Tarantaise genomic DNA
Lane 3 D Shorthorn genomic DNA
Lane 4 D Holstein genomic DNA

84

 

Figure 19.

Lane]
Lane2
Lane3

Southern blot analysis (2). Agarose gel
image illustrating bands separated of
Holstein and Shorthorn genomic DNA
after digestion with EcoRI for
hybridization with labeled probe

D 1 Kb Ladder

D Holstein genomic DNA

D Shorthorn genomic DNA

85

Figure 20.

 

Southern blot analysis (1). Agarose
gel image illustrating the lack of
DNA bands from digested genomic
DNA of 4 different cattle breeds as a
result of a complete transfer of the
bands to the nylon membrane

86

 

 

 

Figure 21. Southern blot analysis (1). X-ray
film illustrating DNA bands of 4
different cattle breeds after labeled
probe hybridization and before
eliminating the background

87

Bovine PCR for Pools:

PCR, using the set of primers described in the primer
cieesign section, was also done for the genomic DNA of Holstein
13(301, Angus pool, Hereford, Shorthorn cow, Tarentaise cow, and
Simmental cow. The PCR product was run in 1% agarose gel,
adoout 263 bp fragments were observed as expected (Figure 22).

The amplified fragments above were then quantified by
Jrunning in an agarose gel with known bands of 1amda cut with
Ilind III (Figure 23). The fragments were purified. with
hdicrocon columns and cloned in pGEM-T Easy vector as described
lbefore and then sequenced. The results were then used as a
second proof for polymorphisms due to the undetermined (N)
signals at the polymorphic sites and to the presence of two

expected bases (A and G) at the same polymorphic position.

88

Figure 22.

Lane 0
Lane 1
Lane 2
Lane 3
Lane 4
Lane 5
Lane 6

 

Agarose gel image illustrating
part of exon 8 HSL PCR products
(263 bp) for bovine genomic DNA
pools and individuals

D 100 bp Ladder

D Holstein Pool

D Angus Pool

D Hereford Pool

D Shorthorn Cow

D Tarentaise Cow

D Simmental Cow

89

Figure 23.

LaneO
Lanel
Lane(l)

Lane (2)
Lane 3
Lane (3)
Lane 4
Lane (4)

Lane (5)
Lane 6
Lane (6)

    

Agarose gel image (1%) inflating the
quantification of the genomic DNA PCR
product (263 bp) of part of exon 8 of HSL
gene for individual and pooled bovine breed.
lamdacutwithHindIIlwasused asstandard
for the quantification

D9cutwithHindIlI(0.5 ug)
D 0.5 ul Holstein Pool
D 1.0 ul Holstein Pool
D0.5 ul Angus Pool
D1.0 ul Angus Pool
D05 11] Hereford Pool
D 1.0 ul Hereford Pool
D 0.5 ul Shorthorn Cow
D 1.0 ul Shorthorn Cow
D 0.5 ul Tarentaise Cow
D 1.0 ul Tarentaise Cow
D 0.5 ul Simmental Cow
D 1.0 ul Simmental Cow

Single-Strand Conformation Polymorphism (SSCP):

When SSCP is used , it is expected to see a difference in
mobility in a single stranded DNA.when there is a polymorphism
at one or more bases of that DNA fragment. The bovine PCR
fragments, obtained from individual cows, were denatured and
run in 8% non-denaturing polyacrylamide gel. No difference in
band migration was observed, and all the 263 bp fragments were
seen at the same migration position in all lanes (Figure 24).
6 different SSCP reactions had been tried under different

reaction conditions but polymorphism was not detected.

Bovine Spleen cDNA Library:

PCR products were not obtained from a bovine spleen cDNA
library using the same primers that amplified the genomic DNA
isolated from six different breeds of cattle (Figure 25). It

may be that the HSL gene is not expressed in the spleen.

91

 

Figure 24.

LaneO
Lanelto32

 

Single-strand conformation polymorphism gel
image (8% non-denaturing polyacrylamide gel)
Insulting the same distance of band migration of
part of exon 8 HSL PCR products (263 bp) of 6

different bovine breeds

D 8 ul Undenatured PCR product

D8ulDenaturedPCRproductsforsixdifi'ereut
cattle breeds (Brahman, Tarentaise, Angus,
Semintal, Shorthorn, and Holstein)

 

Lane 0
Lane (1)
Lane (ll)
Lane (3)
Lane (3/)
Lane (6)
Lane (6])
Lane (9)
Lane (9/)
Lane 1
Lane 2
Lane 15
Lane 16
Lane 17
Lane 0’

FiguneZS. Agarose gel image (1%) illustrating PCR

 

"y $3.152; 3‘ .- g .- .-

products of part of exon 8 of ESL from bovine
spleen cDNA library (nothing being amplified)
and bovine genomic DNA (263 bp) from 4
different bovine breeds

Dul9cutwithHindlII(0.5 ug)

D 4 ul PCR product of Spleen cDNA lib.

D 4 ul PCR product of Spleen cDNA lib.

D 4 ul PCR product of Spleen cDNA lib.

D 4 ul PCR product of Spleen cDNA lib.

D 4 ul PCR product of Spleen cDNA lib.

D 4 ul PCR product of Spleen cDNA lib.

D 4 ul PCR product of Spleen cDNA lib.

D 4 ul PCR product of Spleen cDNA lib.

D 4 ul PCR product of Brahman genomic DNA
D 4 ul PCR product of Brahman genomic DNA
D 4 ul PCR product of Shorthorn genomic DNA
D 4 ul PCR product of Tarentaise genomic DNA
D 4 ul PCR product of Holstein genomic DNA
:> 100 bp ladder

93

Part of the Bovine HSL Gene Sequence and
Polymorphisms:

When part of the HSL gene was sequenced and edited
according to color-coded signals for six bovine breeds (26
cows total), 233 bp fragments were noted, which were part of
HSL bovine gene (Figure 26). The sequence shows 233 bp
instead of 263 bp because the PCR products were sequenced
directly and not cloned before sequencing, therefore, few
bases at the beginning and the end cannot be sequenced. When
this sequence was compared with the published bovine sequence
(GenBank accession # U78042), five nucleotides were found
different (Figure 27). Base number 6 (C) is base number 116
(T) ill the published sequence, base number 40 MD is base
number 140 (T) in the published sequence, bases number 59 and
60 (AC) are number 159 and 160 in the published sequence (CT),
and base number 176 (C) is base number 276 (T) in the
published sequence.

Two potential polymorphic sites were noted (Figure 28).
These were base number 51 (A/G) (Figure 29) and base number 93
(G/A) (Figure 30). The nucleotide changes for base 51 change
the amino acids from Isoleucine to Valine and from Glutamic
acid to Lysine in base 93 (Figure 31). 19 cows out of the 26
have an A instead of a G in position 51 (frequency of 73%),
and 3 cows out of 26 have an A on position 93 instead of a G
(frequency of 11.5%). No heterozygous alleles (a diploid
nucleus that contains two different alleles for a particular
gene) were found among the animals.

All the Shorthorn and. Angus breeds have an ‘A/ at
position 51, and all the Tarentaise cows have a ‘G' on the
similar position,. The Brahman, Simmental, and Holstein breeds
may have either ‘A' or ‘G’ at position 51, but they have more
‘A? than ‘G'. All the Brahman, Tarentaise, Angus, and Holstein
cows have ‘G’ on position 93. Simmental and Shorthorn have
either ‘A' or ‘G' on that position, Simmental have more ‘6'
than ‘A? on position 93,‘A' and ‘G' are equal for Shorthorn.

Cluster Analysis:

.A cluster analysis of the 233 bp fragments sequenced
from 26 samples from six different cattle breeds was done
according to the Wards hierarchical clusters algorithm as
implemented in Clustan Graphics (http://clustan.com/). This is
a computer software package developed by' I). Wishart

94

(University of Edinburgh, Scotland, 1996). The cluster
analysis is an exploratory tool for solving classification
problems (Gordon, 1981). The Jukes-Cantor genetic distance
metric, which is suitable for DNA sequence data (Weir, 1996),
was used to compute the similarity matrix. Cows were grouped
according to the 233 bp sequences of HSL in three different
groups and two subgroups. Samples from all breeds except
Tarentaise were clustered in one group. Samples from Holstein,
Brahman, Simmental, and Tarantaise were a second group. The
third group has Shorthorn and Tarentaise. Two subgroups
emerged from the three groups, one subgroup contains Holstein
Brahman, Simmental and Tarentaise. The other subgroup has
Simmental, Tarentaise and Holstein (Figure 32).

95

CAGAGCTGTCACTGTCCGCGGAGACACTCGGCCCCT
CCGCACCCTCAACC (G/A) TCAACTTACTTCTTGGA
TCTGAGGATGGATCTGAAATGTCT (G/A) AGGCCCC
AGAGGAGCTGAACAACAAGGACCGAGTTCGAGGTGT
GGGCGCCGCCTTCCCCGAGGGTTTCCACCCACGGCG
CTGCAGCCAGGGTGCCATGTGGATGCCCCTCTACTC
GGCCCCCATCGTCAAGAATCCCTTC

Figure 26. Part of exon 8 sequence of the bovine HSL gene
(233 bp) illustrating the two (G/A) polymorphic

sites (hold)

96

 

It.

Animall x Publ.hsl

1 CAGAGCTGTCACTGTCCGCGGAGACACTCGGCCCCTCCGCACCCTCAACC 50

IIIII IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IllIIIIIII
101 cagagttgtcactgtccgcggagacactcggcccctccgtaccctcaacc 150

51 ATCAACTTACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCCCC 100
IIIIIIII IIIIII|IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
151 atcaacttcttacttggatctgaggatggatctgaaatgtctgaggcccc 200

101 AGAGGAGCTGAACAACAAGGACCGAGTTCGAGGTGTGGGCGCCGCCTTCC 150

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIl
201 agaggagctgaacaacaaggaccgagttcgaggtgtgggcgccgccttcc 250

 

151 CCGAGGGTTTCCACCCACGGCGCTGCAGCCAGGGTGCCATGTGGATGCCC 200

IIIIIIIIIIIIIIIIIIIIIIIII IIIIIIIIIIIIIIIIIIIIIIII
251 ccgagggtttccacccacggcgctgtagccagggtgccatgtggatgccc 300

201 CTCTACTCGGCCCCCATCGTCAAGAATCCCTTC 233

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
301 ctctactcggcccccatcgtcaagaatcccttc 333

Figure 27. Alignment of part of the bovine exon 8 HSL PCR
product sequence (233) after editing (upper)
and the published bovine partial HSL sequence
(lower) accession 9 078042. The alignment was
prepared using the GCG program. Note the 5
bases difference between the two sequences
(bold)

97

Br
Br
Br
Br
Br

ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCGTCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC

 

Si
Si
Si
Si
Si

ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCGTCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCGTCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTAAGGCC
ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTAAGGCC

 

Ta
Ta
Ta

ACCGTCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCGTCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCGTCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC

 

Sh
Sh
Sh
Sh

ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
.ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCBTCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTAAGGCC
ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC

 

ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC

 

SEE???

Ho
Ho
Ho
Ho
Ho

Figure 28. The two potential polymorphic sites (bold) for
HSL gene in 26 animals from 6 cattle breeds
Br - Brahman
Si - Simental
Sh - Shorthorn
Ta - Tarentaise
An - Angus
Ho - Holstein

ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCGTCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC
ACCATCAACTTCTTGGATCTGAGGATGGATCTGAAATGTCTGAGGCC

98

 

1.“

was“ immerse Puma

arms-mm memento»:

%?zfl W lls-Go-For mammals woman swarm
Vsnbn 30 me rm 1: 1

MTG lGll'lC CACTI‘C [TI-0mm 40"

 

 

 

 

 

Willi WI II IIIII

[III Hi"

 

 

I II “I G
”in t“slim IIII Ii IIIIIII III

exon 8 of HSL gene sequence signals. The arrows illustrate

 

Figure 29.
an ‘A’ at position 51 in one animal (top) and a ‘G’ at a similar
position in another animal (bottom)

 

 

GMAT}? tiaraoooalo leflGlACMCAMGmlG'H CGDGNMGCGCCGCCTTKGIGMGG I
00

I ‘ . l
I I 1 I I I
F I.‘
I, . ,
l ' I
I ‘i l HI "
L I , ' I‘ v
I», g ' i I ‘ I.
i!“ ii ‘ i y I l i
1 5 , Y 1 , , , , I,
: I I . I
a, I ,r
‘I
A, I ’ I r I I‘
I u I l I .I ll . Ill Il
WW
W

T C [G I. Hi) null-P ‘
50m , 7 > :I- : 90 100 no , o I
I l I' l1 , l I
I I I
l I ‘
i 1 i 4 i 1“ '7: .:
. Ii‘ I f. I ! i E '3 i
I III-I "II,“ , l i?" , , I I '
I ‘ . II I III: I : I' = I J '
’ I : ’ . ,I' '2 III , .
, I“, I 1 ‘1“, ‘.:, I ,
I , 1 ~..
1 l ‘t‘ayl “ ill if i ‘l .a “i \I

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

,. iiII
Figure30. Partfex 8ofLHSgee euseqencesignalsm'l‘heanpws

illustratean‘A atipostion nin93 nno nimal (to p)
similarposition ina noather nimal e(bottom)

 

(a:

   

Animall
ELSLSAETLGPSAPSTLNLLLGSE
DGSEMSEAPEELNNKDRVRGVG

AAFPEGFHPRRCSQGAMWMPLY
SAPIVKNPF

Anima18
ELSLSAETLGPSAPSTXNLLLGSE
DGSEMSEAPEELNNKDRVRGVG

AAFPEGFHPRRCSQGAMWMPLY
SAPIVKNPF

AnimallO

ELSLSAETLGPSAPSTINLLLGSE
DGSEMSEAPEELNNKDRVRGVG
AAFPEGFHPRRCSQGAMWMPLY
SAPIVKNPF

Figure 3]. Amino acids sequences for part of exon 8 of the bovine HSL gene from
three different animals illustrating amino acid differences [IV and EIK

(bold and underlined) in two different positions. The amino acid sequence
was obtained by using the GCG program

101

 

 

I=Ultfit§"‘HUNIRBHI=‘E"““""""

sign-232.

 

illustrating an association between 5 different
groups ofanimals from 6 bovine breeds according
to their HSL gene sequence

DISCUSSION

Amplification of Bovine HSL from Genomic DNA:

When blood samples from four different beef breeds
(Angus, Tarentaise, Simmental, and Brahman), one dairy breed
(Holstein), and one dual purpose breed (Shorthorn) were used
to isolate the HSL gene, a 263 bp fragment of the HSL gene was
amplified (Figure 13) and sequenced (Figure 26). Polymorphisms
were found (Figure 28) in position 51 (A/G) and position 93
(A/G). The change of base 51 (A to G) changes the codon AUC
(Figure 31) which translates to the amino acid isoleucine (I),
that has a four carbon atoms side chain and a nonpolar R
group, to the GUC codon which translates to valine (V) that
also has a nonpolar R group and three carbon atoms in its side
chain. This is in agreement with the study of Bordo and Argas
(1991), who reported that the favorite substitution partners
for valine are isoleucine and leucine. They tend to substitute
amongst themselves despite some exposure at the surface. This
change in the number of the side chain carbon atoms may affect
the structure of the protein which could lead to a change in
the function, due to the extra space occupied by the fourth
carbon atom.

Isoleucine and valine have hydrophobic side chains. The
hydrophobic side chains like to cluster by coming together to
avoid contact with water.

H CH, H
I \ I
CH,-CH,—CH-C -C00’ CH-C ~COO'
I I / I
CH3NH3 CH3 NH3
+ +
Isoleucine Valine

103

 

’f‘f .

Changing base 93 (G to A), shown in Figure 28, changes
the codon GAG (Figure 31) which translates to the amino acid
glutamic acid (E) that has a negatively charged R group at
physiological pH, to AAG which translates to lysine (K) having
a positively charged R group at neutral pH. Both glutamic acid
and lysine have polar side chains that make them highly
hydrophilic and therefore located on the surface of the
protein in contact with the aqueous solvent. In cases where
these amino acids occur in the interior of a protein, they
often have a specific chemical function such as promoting
catalysis or participating in metal ion binding.

-0 H
\ I
c - cm—cnz-C -coo‘
// I

0 mg

+

Glutamic.Acid

H
+ I

H3N - CHf‘CHz — CHQ’CH2“C “cm -

104

 

A. change in. an amino acid charge could change the
structure of the protein which may change the function.
Changing the function of a protein could lead to a desirable
or undesirable change in a phenotypic trait and consequently
this may be useful in selection.

The mutagenesis experiments of serine”3, in exon 6, is

the first demonstration in HSL of a relationship between
catalytic function and structure (Holm, et al., 1994). .Also
correlations between milk traits and polymorphism at the
growth, hormone gene ‘were reported. (Lucy, et al., 1993).
Another example of the structure and function is in one of the
different forms of acetyl-CoA carboxylase coexisting in vivo.
An insertion of eight extra amino acids located upstream of
the phosphorylation site inhibits the phosphorylation by cAMP-
dependent protein kinase (Kong, et al., 1990) and consequently
fatty acid synthesis. Polymorphisms found here at positions 51
and 93 could be associated with phenotypic traits, such as
milk production.

The 233 bp fragment sequenced here resembles part of exon
8 in the Human gene, which is the third largest exon after
exon 1 and 9 in human HSL gene. If the 3’UTR of exon 9 is
excluded, exon 8 is the second largest exon. Exon 8 encodes
the serine residue (regulatory site) phosphorylated by cAMP-
dependent protein kinase and a second phosphorylation site
(basal site) upstream of the sequenced bovine fragments. Exon
8 is 425 bp in human and the sequenced bovine fragment is
about 132 bp downstream of the start of the exon and about 117
bp downstream of the phosphorylated serine relative to the
human sequence. Therefore, the sequenced bovine fragment is
near the phosphorylation site in exon 8. Consequently, any
changes in the sequence of that fragment could affect the
function of the bovine HSL. The sequence analysis of the
region downstream of the phosphorylation site has a high
homology with the other species which indicates the importance
of this region to the function of the protein.

The regulatory site of HSL phosphorylated. by' cAMP-
dependent protein kinase (Garton, et al., 1988) was identified
in human as Ser551 in exon 8. Sers'i"3 has been found to be a
second phosphorylation site (basal site). This basal site is
phosphorylated by the 5’—AMP—activated protein kinase without
concomitant increase of enzyme activity (Garton, et al.,

105

 

1989). Phosphorylation of Ser553 prevents the phosphorylation
of the regulatory site (Garton et al., 1989). The hydroxyl
group on the serine makes it much more hydrophilic (water-
loving). Therefore, when found on the surface of the protein,
serine is more reactive than some other amino acids.

Although Figures 10, 11, and 12 show homology between
the HSL bovine sequenced fragment, the swine (78% homology),
rat (72% homology), and human (76% homologY), all attempts to
amplify the whole bovine gene from bovine genomic DNA, using
the conserved sequences of other species, was not successful.
This may be because the primers were designed according to the
human HSL gene sequence with the assumption that there is a
high homology between the human and bovine HSL gene sequences
and also the number and the positions of the exons and
introns were assumed similar. Therefore, there could be an
interruption of the different bovine exons by large introns
which are not found in other species. This is probably why
most of the primers failed to amplify the HSL gene from the
bovine genomic DNA.

An example of HSL gene difference is that the
phosphorylation site sequence (Met-Arg-Arg-Ser-Val-Ser-Glu—
Ala-ala) is completely conserved in bovine (Garton, et al.,
1998), rat (Holm, et al., 1988B), mouse, and. human. HSL
(Langin, et al., 1993). The region surrounding these residues
is predicted to be hydrophilic and K-helical, consistent with
a position at the surface of the protein accessible to the
protein kinases (Kyte and Doolittle, 1982). The human HSL
differs from. the rat sequence in the region immediately
upstream of the phosphorylation site (Langin, et al., 1993),
where the phosphorylation site is at the beginning of exon 8.
The 12 amino acids deleted in human HSL modifies the HSL
secondary structure since a connecting loop present in the rat
HSL between a hydrophilic region and the K-helix containing
the phosphorylation sites is not found in human HSL. The
contact between the triacylglycerol substrate and the active
serine probably requires a conformational change in this
segment. An appropriate folding flexibility is important for
catalyzing lipolysis and could be achieved by a relatively
high number of small-sized amino acids that are known to be
involved in peptide chain 2 -turn structures.

It is speculated that HSL may exist in two conformational

106

 

states, an, active form. corresponding' to the “open” form
exposing a large hydropbobic area observed in other lipases,
and inactive(“closed”) form (Holm, et al., 2000).
Phosphorylation of HSL would be required to trigger the
transition from the closed to the open form, exposing a
hydrophobic area that would interact with the lipids. Any
disturbance in the structure of this region could affect the
function of the protein.

PCR for the Spleen cDNA:

The gene may not be highly expressed in the bovine
spleen, this may be why the primers, that were used to amplify
the 263 bp fragment, were not successful in the PCR for the
spleen cDNA (Figure 25).

Bovine Genomic Library Screening:

Selection of recombinant clones based on hybridization to
specific nucleic acid sequence, is perhaps, the most widely
used screening' method since it does not require jprotein
expression but only the presence of a correct DNA sequence.
Nucleic acid hybridization is the most general approach to
screening libraries since the selection of probes and
stringency of hybridization can be readily altered to suit the
requirements of specific sequence.

Nylon membranes were used to immobilize the DNA
fragments. Their advantage over the nitrocellulose membranes
is that small nucleic acid fragments (<250 bp), about the size
of the probe used here, bind inefficiently to nitrocellulose
membranes (Meinkoth and Wahl, 1984).

The HSL gene was not detected by the above method when
genomic DNA library was screened. The reason could be that
the mammalian genome contains approximately 3 X 106 Kb of DNA
per haploid genome, so that screening for single copy gene in
a mammalian genomic library would be a very difficult task.
An alternative is screening a cDNA library which contains only
the exons of the genes as compared to the whole gene (introns
and exons) in the genomic library. Because a bovine cDNA
library from organs that express HSL protein was not found in

107

 

the market, bovine genomic library was used. Therefore, there
was a very low probability that the gene could be found using
the genomic library. This is confirmed when samples of the
genomic library were used in the PCR (Figure 15) using the
same primers that amplified the 263 bp from the genomic DNA
(Figure 13).

Isolation of a clone from a cDNA or genomic library often
involves screening the library by several rounds of plating
and filter hybridization. This is not only laborious and time-
consuming, but also is prone to artifacts, such as false
positives commonly encountered in filter hybridization. The
false positive signals seen in the first and second screening
(Figure 17) could be because background signals are generally
higher for nylon membranes than with nitrocellulose as

concluded by Johnson et al.(1984).

Southern Blot:

An advantage of using nylon membranes for Southern blots
is that high salt is not required, so the DNA transfer can be
done directly in 0.5N NaOH (Reed and Mann, 1985). This
permits less handling of the gel and filter and more rapid
transfer. As shown in Figures 18 and 19, the digestion of the
genomic DNA produced separated fragments by electrophoresis.
Adthough a complete transfer of the digested DNA to the Nylon
membrane was accomplished (Figure 20), no hybridization to the
labeled probe had occurred which remains unexplained. The
failure to recover the gene in both the genomic library
screening and the Southern assay could also be due to a loss
of the hybrid from the Nylon membrane for an unknown reason.

Single-Strand Conformation Polymorphisn.(SSCP):

Polymorphism was not detected by the PCR-SSCP method,
where PCR products, as shown in Figure 13, were used in the
SSCP assay (Figure 24) to detect the presence of mutations.
This may be because there were many parameters in the SSCP
assay that needed to be optimized. Detection of polymorphisms
by sequencing rather than the SSCP method is the most accurate
method.

108

 

Restriction Fragment Length Polymorphism.(RFLP):

Restriction fragment length polymorphism (RFLP) is
another method to identify polymorphism. The ability to score
genetic variation at the recognition sites of restrictions
endonucleases has enabled new ways to detect polymorphisms

between individuals. RFLP involves a series of steps
involving restriction digestion, electrophoresis, and
visualization of bands. Restriction endonucleases recognize

specific DNA sequences and cut in a specific manner relative
to that sequence, but not necessarily within that sequence.
RFLP was not used here because when the sequence was entered
in the GCG program (http://www.gcg.com/) and a ‘map' command
used to show all the recognition sites, no restriction enzyme
recognition sites that included the polymorphic sites were
found. Restriction analyses are usually unable to provide
information about the patterns of substitutions that caused
observed differences in RFLPs. Actual DNA sequences do
provide this information. Therefore, this study relied
mainly on the DNA sequence.

Bovine Pool HSL Sequence:

Further evidence for polymorphisms was from the sequences
of the Holstein and Angus DNA pools. It was clear that there
were signals for both A.and G at the same polymorphic site for
both positions but one of them (A or G) was stronger than the
other (G or A). If we consider the occurrence of the
nucleotide A as genotype AA and G as BB, no heterozygous
individual (AB) was found. This may be due to the small number
of samples or to the absence of heterozygosity among those
breeds.

Cluster Analysis:

The objective of the cluster analysis is to group either
the data units or the variables into clusters such that the
elements within a cluster have a high degree of natural
association among themselves while the clusters are relatively
distinct from one another. Cluster analysis may be used to

109

.1 ‘~ "Efic-L.‘tuafl}hn¥zmfla'

reveal structure relations in the data. One of the principal
applications of cluster analysis is to construct taxonomies.
Cluster analysis is a device for suggesting hypothesis. The
cluster analysis, in this experiment, did group the cows,
which means there could be an association between each group
of samples. Since we don’t know much about the phenotypic
traits of those cows relative to production, reproduction,
and diseases associated with body fat mobilization, further
studies are needed to relate the genotypic differences to
different phenotypic traits such as milk production, disease
resistant, and cold or heat tolerance for selection purposes.
Effect of different polymorphisms on protein function could be
determined by studying enzyme activity at different
physiological states.

110

.1 a! flag".
flu

 

SUMMARY AND CONCLUSION

The objective of this study was to determine if there is
polymorphism at the bovine hormone-sensitive lipase locus. It
was found that there are two polymorphic sites about 168 bp
and 210 bp downstream of the phosphorylation activation site.
One polymorphism at base 51 (A/G) and the other at base 93
(A/G) from the start of the sequenced fragment. These changes
in bases result in the amino acid substitution (Iso/Val) and
(Glu/Lys) at sites 51 and 93, respectively. The amino acid
changes may alter enzyme activity by changing the 3D-structure
of hormone-sensitive lipase. Variation in the structure of
hormone-sensitive lipase may affect rate of lipid hydrolysis.
Further studies are needed to establish the functional
significance of these polymorphisms. It is also expected that
the exon and/or intron positions and lengths of the bovine HSL
gene are different than the human HSL gene.

11]

 

I“
6

REFERENCE

Allen, C.E., D.C. Beitz, D-A. Cramer, and R.C. Kauffman. 1976.
Biology of fat in meat animals. North Central Regional
Publ., 234, 75 pp. (Madison: Univ. Wisconsin).

Baile, C.A. 1971. Control of feed intake and the fat depots.
J. Dairy Sci. 54:564.

Baird, G.D., I.M. Reid, M.AJ Lomax, H.W. Symonds, C.J.
Roberts, and D. Mather. 1977. Hepatic gluconeogenesis and
fat metabolism in fed and fasted lactating dairy cows
invivo. Proc. Nutr. Soc. 36:40.

Baldwin, R.L., Y.T. Yang, K. Crist, and G. Grichting. 1976.
Theoratical model of ruminant adipose tissue metabolism
in relation to the whole animal fat. Fed. Proc. 35:2314.

Ballard, F.J., R.W. Hanson, and D.S. Kronfeld. 1969.
Gluconeogenesis and lipogenesis in tissue from ruminant
and nonruminant animals. Fed. Proc. 28:218.

Bauman, D.E., and C.L. Davis. 1975. , page 496 in Regulation
of lipid metabolism. In Digestion and metabolism in the
ruminants, I. W. McDonald and A. C. I. warner, ed. The
Univ. New England Publ. Unit, Armidale, Australia.

Bauman, D.E. and C.L. Davis. 1974. Biosynthesis of milk fat.
, page 39 in Lactation, a comprehensive treatise. Vol.
II. B.L. Larson and V.R. Smith (eds.).Academic Press, New
York, N.Y.

Bauman, D.E. 1976. Intermediary metabolism of adipose tissue.
Fed. Proc. 35:2308.

Bauman, D.E., and W.B. Curie. 1980. Partitioning of nutrients
during pregnancy and lactation: a review of mechanisms
involving homeostasis and homeorhesis. J. Dairy Sci.
63:1514.

Belfrage, P., B. Jergil, P. Stralfors, and H. Tornqvist. 1977.
Hormone-sensitive lipase cflf rat adipose ‘tissue:
identifications aand some properties of the enzyme
protein. FEBS Lett. 75(1):259.

Belfrage, P., G. Fredrikson, N.O. Nilsson, and P.
Stralfors. 1980. Regulation of adipose tissue lipolysis:

112

 

phosphorylation of hormone-sensitive lipase in intact rat
adipocytes. FEBS Lett. 111(1):120.

Belfrage, P., J. Donner, H. Eriksson, P. Starlofers. 1986.
page 23 in Mechanisms of Insulin Action. Elsevier,
Amsterdam.

Benson, J.D. and R.S. Emery. 1971. Fatty acid
esterification by homogenates of bovine liver and adipose
tissue. J. Dairy Sci. 54:1034.

Benton, W.D. and R.W. Davis. 1977. Screening 9gT recombinant
clones by hybridization. 133 a single plaques in situ.
Science 196:180.

Bickerstaffe, R., E.F. Annison and J.L. Linzell. 1974. The
metabolism of glucose, acetate, lipids, and amino acids
in lactating dairy cows. J. Agr. Sci. Camb. 82:71.

Bordo, D., and P..Argas. 1991. Suggestions for “Safe” residue
substitutions in site-directed mutagenesis. J. Mol. Biol.
217:721.

Butcher, R.W., J.G. Sneyd, C.R. Park, and E.W. Southerland.
1966. Effect of insulin on adinosine 3C EV-monophosphate
in the rat epididymal fat pad. J. Biol. Chem., 241:1651.

Chilliard, Y., G. Durand, and D. Sauvant, P. Morand-Fehr.
1978. Activite metaboliquue du tissue a dipeux de la
chevre au cours de la gestation et en debut de lactation.
Can. Roy. Acad. Sci. Paris, series D, 287:1131.

Chilliard, Y., D. Sauvant, J. Hervieu, M. Dorleans, and P.
Morand-Fehr. 1977. Lipoprotein lipase activity and
composition of omental adipose tissue as related to lipid
:metabolism. of the goat in alte pregnancy’ and late
lactation. Ann. Biol. Anim. Biochem. Biophys. 17:1021.

Chilliard, Y., P. Morand-Fehr, G. Durand, and D. Sauvant.
1979. Evolution de l'activite metabolique du tissu
adipeux chez la chevre au cours des deux premiers mois de
lactation. Bull. Acad. Vet. France 52:417.

Chilliard, Y., J. Robelin, and B. Reymond. 1984. In vivo
estimation of body lipid mobilization and reconstitution
in dairy cattle. Can. J. Anim. Sci. 64 (Suppl.):236.

Cohen, P. 1985. The role of protein phosphorylation in the

hormonal control of enzyme activity. Eur. J. Biochem.
151:439.

113

 

 

 

Cohen, S.N., A.C. Chang, and L. Hsu. 1972. Non chromosomal
antibiotic resistance in bacteria: Genetic transformation
of Escherichia coli by R-factor DNA. Proc. Natl. Acad.
Sci. 69:2110.

Cordle, S.R., R.J. Colbran, and S.J. Yeaman. 1986. Hormone-
sensitive lipase from bovine adipose tissue. Biochem.
Biophys. Act. 887(1):51.

Egan, J.J., A.S. Greenberg, M.K. Chang, S.A. Wek, M.C. Moos,
and.CL. Londos. 1992. Mechanism of hormone-stimulated
lipolysis in adipocytes: Translocation of hormone-
sensitive lipase to the lipid storage droplet. Proc. Nat.
Aca. Sci. 89:8537.

Einsspanier, R., and A. Kettler. Bovine lipid metabolism in
reproductive tissues. [Online] Available
http://searchlauncher.bcm-tmc.edu, August 27, 1999.

 

Emery, R.S. 1979. Deposition, secretion, transport, and
oxidation of fat in ruminants. J. Anim. Sci. 48:1530.

Emery, R.S. 1969. Lipids and adipose tissue. page 236 in E. W.
E. Hafez and I. A. Dyer, Ed., Animal Growth and
Nutrition. Lea and Febiger, Philadelphia, P. A.

Emery, R.S., J.S. Liesman, and T.H. Herdt. 1992. Metabolism
of long chain fatty acids by ruminants liver. J.
Nutrition 122:832.

Fain, J.N., and R.C. Scow. 1966. Fatty acid synthesis invivo
in maternal and fetal tissue in the rat. Am. J. Physiol.
210:19.

Fain, J.N. and J.A. Garcia-Sainz. 1983. Adrenergic regulation
of adipocyte metabolism. J. Lipid Res. 24:945.

Fienberg, A.P. and B. Vogelstein. 1983. A technique for
radiolabeling DNA restriction endonuclease fragments to
high specific activity. Anal. Biochem. 132:6.

Flint, D.J., RIA. Cleggr and R.G. Vernon. 1983. Adipose tissue
metabolism during early pregnancy in the rat temporal
relationships of changes in the metabolic activity,
number of insulin receptors, and serum hormone
concentration. Arch. Biochem. Biophys. 224:677.

Frayed, K.N., S.W. Coppack, B.A. Fielding, and S.M. Humphreys.
1995. Coordinated regulation of hormone sensitive lipase
and lipoprotein lipase in human adipose tissue in vivo:
implications for the control of fat storage and fat

114

 

{I

 

1.. :9...

L
.2.—

< .. t3:
1. It:

. _
2.3»..T10 .3: v
3. .x: . r" . .

s

h. x...

 

 

T2:
a
._

 

._...._n..
‘

        

mobilization. Adv. Enz. Reg. 35:163.

Fredrikson, G., H. Tornqvist, and P. Belfrage. 1986. Hormone
sensitive lipase and monoacylglycerol lipase are both
required for complete degradation of adipocyte
triacylglycerol. Bioch. et Biophy. Acta 876:288.

Garton, A.J., D.G. Campbell, D. Carling, D.G. Hardie, R.J.
Colbran, and S.J. Yeaman. 1989. Phosphorylation of
bovine hormone-sensitive lipase by the AMP—activated
protein kinase. A possible antilipolytic mechanism. Eur.
J. Biochem. 179:249.

Garton,.A.J., D.G. Campbell, P. Cohen, and S.J. Yeaman. 1988.
Primary structure of the site on bovine hormone-sensitive
lipase phosphorylated by cyclic AMP-dependent protein
kinase FEBS Lett. 229:68.

Gordon, A.D. 1981. Classification: Methods of exploratory Data
Analysis for Multivariate Data. (Chapman and Hall).

Graham, N.M. 1964. Energy exchanges of pregnant and lactating
ewes. Aus. J. Agric. Res. 15:127.

Greenberg, A., J.J. Egan, S.A. Wek, N.B. Garty, E.J.
Blanchette-Mackie, and C. Londos. 1991. Perilipin, a
major hormonally regulated adipocye-specific
phosphoprotein associated with the periphery of lipid
storage droplets. J. Biol. Chem. 266:11341.

Grober, J., H. Laurell, R. Blaise, B. Fabry, S. Schaak, C.
Holm, and D. Langin. 1997. Charaterization of the
promotor of human adipocyte hormone-sensitive lipase.
Biochem. J. 328:453.

Grunstein, M. and D.S. Hogness. 1975. Colony hybridization: A
method for the isolation of cloned DNAs that contain a
specific gene. Proc. Natl. Acad. Sci. 72:3961.

Grummer, R.R. 1993. Etiology of lipid-related. metabolic
disorders in periparturient dairy cows. J. Dairy. Sci.
76:3882.

Hare, J.F., K. Taylor, and A. Holocher. 1994. Energy-dependent
protein glycerol interaction in a cell-free system from
3T3-L1 adipocytes. J. Biol. Chem. 269:771.

HirsCh, J., and E. Cullian. 1968. Methods for the

determination of adipose cell size in man and animals. J.
Lipid Res. 9:110.

115

Holm, C., P. Belfrage, T. Osterlund, R.C. Davis, M.C. Schotz,
and D. Langin. 1994. Hormone-sensitive lipase: structure,
function, evolution and overproduction in insects cells
using the baculovirus expression system. Protein
Engeneering 7:537.

Holm, C., P. Belfrage, and G. Fredrikson. 1987. Immunological
evidence for the presence of hormone-sensitive lipase in
rat tissues other than adipose tissues. Biochem. Biophys.
Res. Commun. 148(1):99.

Holm, C., T.G. Kirchgessner, K.L. Svenson, AJJ. Lusis, P.
Belfrage, and M.C. Schotz. 1988A. Nucleotide sequence of
rat adipose hormone sensitive lipase cDNA. Nucleic Acid
Res. 16(20):9879.

Holm, C. , T.G. Kirchgessener, K.L. Svenson, G. Fredrikson, S.
Nilson, C.G. Miller, J.E. Shively, C. Heinzmann, R.S.
Sparkes, T. Mohandas, A.J. Lusis, P. Belfrage, M.C.
Schotz. 1988B. Hormone-sensitive lipase: Sequence,
expression, and chromosomal localization to 19 cent-
q13.3. Science. 241:1503.

Holm, C., G. Fredrikson, P. Belfrage. 1986. Demonstration of
the amphiphilic character of hormone-sensitive lipase by
temperature-induced phase separation in triton X- 114 and
charge-shift electrophoresis. J. Biol. Chem.
261(33):15659.

Holm C., R.C. Davis, T. Osterlund, M.C. Schotz, and G.
Fredrikson. 1994. Identification of the active site
serine of hormone-sensitive lipase by site-directed
mutagenesis. FEBS Lett. 344(2-3):234.

Holm, C., T. Osterlund, H. Laurell, and J. Contreras. 2000.
Molecular mechanisms regulating hormone-sensitive lipase
and lipolysis. Annu. Rev. Nutr. 20:365.

Hongyo, T., G. Buzard, R. Calvert, and C. Weghorst. 1993.
‘Cold SSCP’: a simple rapid and non-radioactive method
for optimized single-strand conformation polymorphism
analysis. Nucl. Acids Res. 21(16):3637.

IHonnor, R.C., G.S. Dhillon, and. C. Londos. 1985. CAMP-
dependent protein kinase and lipolysis in rat adipocytes.
1. Cell preparation, manipulation and predictability in
bahaviour. J. Biol. Chem. 260:15122.

Hood, R.L. 1982. Relationships among growth, adipose cell size
and lipid metabolism in ruminant adipose tissue. Fed.
Proc. 41:2555.

116

43-

 

e

 

.4111

Huttunen, J.K., D. Steinberg, and S.E. Mayer. 1970. ATP-
dependant and cyclic AMP-dependent activation of rat
adipose tissue lipase by protein kinase from rabbit
skeletal muscle. Proc. Natl. Acad. Sci. U.S.A. 67(1):290.

Johnson, D., J. Gautsch, R. Sportsman, and J. Elder. 1984.
Improved ‘technique: Utilization. nonfat. dry':mi1k for
analysis of proteins and nucleic acids transferred to
nitrocellulose, Gene Anal. Techn. 1:3.

Kalkhoff, R.K., AJH. Kissebah, anui H.J. Kim. 1978.
Carbohydrate and lipid metabolism during normal
pregnancy: relationship to gestational hormone action.
Semin. Perinatol. 2:291.

Kaplan, S.L., and M.M. Grumbach. 1974. Effects of primate
chorionic somatomammotropin of maternal and fetal
metabolism. Page 183 in Lactogenic hormones, fetal
nutrition, and lactation. J. B. Josimovich, M. Reynolds,
and E. Cobo, ed. John Willy & Sons, New York, N.Y.

Kawamura, M., DuF. Jensen, E.V. Wancewicz, L.L. Joy, J.C.
Khoo, and D. Steinberg. 1981. Hormone-sensitive lipase in
differentiated 3T3-L1 cells and its activation by cyclic-
AMP—dependent protein kinase. Proc. Natl. Acad. Sci.
U.S.A. 78(2):732.

Kirchgessner, T.G., K.L. Svenson, A.J. lusis, M.C. Schotz.
1987. Th sequence of cDNA encoding lipoprotein lipase. A
member of a lipase gene family. J. Biol. Chem.
262(18):8463.

Knopp, R.H., M-A. Boroush, and J.B. O’sullivan. 1975. Lipid
metabolism in pregnancy. II. Post-heparin lipolytic
activity and hypertiglyceridemia in the pmegnant rat.
Metabolism 24:481

Knopp, RNH., C.D. Saudek, R.A. Arky, and JZB. CVsullivan.
1973. Two phases of adipose tissue metabolism in
pregnancy: Maternal adaptations for fetal growth.
Endocrinology 92:984.

Kong, I.S., F. Lopez-Castilla, and K.H. Kim. 1990. Acetyl-CoA
carboxylase mRNA species with or without inhibitory
coding sequence for ser-1200 phosphorylation. J. Biol.
Chem. 265:13695.

Kramer, F.B., K. Tavangarn , and .A.R. Hoffman. 1991.
Developmental regulation. of hormone-sensitive lipase
messenger" RNA. in the rat: Changes in steroidogenic
tissues. J. Lipid Res. 32(8):1303.

117

 

 

 

._........_ ._ . . .
... _ ......:..;2.12:}? r E :27: .: 7 .. . .
. . r cuff: .4 I... if??? 5. .e. .

.r......u.n..xfi.nfi.u. .. . .. .. . .. a . : . . . .
. . . z... 9.5: E p .. . . .2. . F... 5:14“...
. . .a. ,....- v.1 .- .1263 .,.~.._..rl__w..fit..r .5“. .3... . .owwi . ..

 
 
 
  

Kyte, J. and R.F. Doolittle. 1982. A simple method for
displaying the hydropathic character of a protein. J. M.
Biol. 157:105.

Lafontan M., and M. Berlan. 1993. Fat cell adrenergic
receptors and the control of white and brown fat cell
function. J. Lipid Res. 34:1057.

Lafontan, M. and D. Langin. 1995. Cellular Aspects of fuel
mobilization & selection. Proc-Nutr-Soc. Cambridge
54(1):49.

Langin, D. and C. Holm. 1993. Sequence similarities between
hormone-sensitive lipase and five procaryotic enzymes.
Trends in Biochemical Sciences 18:466.

Langin, D., H. Lawrell, L.S. Holst, P. Belfrage, and C. Holm.
1993. Gene organization and primary structure of human
hormone-sensitive lipase: Possible significance of a
sequence homology with a lipase of.Morarella TA144, an
antarctic bacterium. Proc. Natl. Acad. Sci. USA
90(11):4897.

Langin, D., C. Holm, and M. Lafontan. 1996. Adipose hormone-
sensitive lipase: a major regulator of lipid metabolism.
Proceedings of the Nutrition Society 55:93.

Laurell, H., J. Grober, C. Vindis, T. Lacomb, M. Dauzats, C.
Holm, and D. Langin. 1997. Species specific alternative
splicing generates a catalytically inactive form of human
hormone-sensitive lipase. Biochem. J. 328:137.

Lee, B.K., G.F. Lin, B.A. Krooker, M.P. Murtaugh, L.B. Hansen,
and H. Chester—Jones. 1996. Association of somatotropin
(BST) gene polymorphism at the 5th exon with selection
for milk yield. in Holstein cows. Domestic .Animal
Endocrinology 13(4):373.

Lee, B. K. and R.A. Crooker . Partial sequence and
polymorphisms in the bovine hormone-sensitive lipase gene
[Online] Anailable ‘http://searchlauncher.bcm.tmc.edu,

 

Jan. 31, 1997.

Lee, F3T., S.J. Yeaman. G. Fredrikson, P. Stralfors, and P.
Belfrage. 1985. Hormone-sensitive lipase from swine
adipose tissue: Identification and some properties. Comp.
Biochem. Physiol. 80:609.

Levitt, R.C., AJE. Jedlicka, and N. Nouri. 1992. Dinucleotide

repeat polymorphism at the hormone-sensitive lipase
(LIPE) locus. Hum. Mol. Genet. 1(2):139.

118

 

Li, Z., M. Sumida, A. Birchbauer, M.C. Schotz, and K. Reue.
1994. Isolation and characterization of the gene for
mouse hormone-sensitive lipase. Genomic 24(2):259.

Liu, C.Y., L.C. Liang, and Chang. 1995. Differential
responses of hormone-sensitive lipase gene to nutritional
transition in adipose tissue, liver, and skeletal muscle
of pigs. Biochem. Mol. Biol. Int. Australia: Academic
Press 36:689.

Londos, C., R.C. Honnor, and G.S. Dhillon. 1985. cAMP—
dependent protein kinase and lipolysis in rat adipocytes.
III. Multiple modes of insulin regulation of lipolysis
and regulation of insulin responses by adenylate cyclase
regulators. J. Biol. Chem. 260(28):151.

Lucy, M.C., S.D. Hauser, P.J. Eppard, G.G. Kirivi, J.H. Clark,
D.E. Bauman, and R.J. Cllier. 1993. Variants of
somatotropins in cattle: gene frequencies in major dairy
breeds and associated milk production. Domestic Animal
Endocrinology 10:325.

Mandel, M. and Higa. 1970. Calcium-dependent bacteriophage DNA
infection. J. Mol. Biol. 53:159.

Masoro, E.J. 1977. Fat metabolism in normal and abnormal
states. Amer. J. Clin. Nutr. 30:1311.

Maynard, L.A., J.K. Loosli, H.F. Hintz, and R.G. Warner. 1979.
The expanding field of nutrition. Page 1 in Animal
Nutrition. 7th ed. McGraw-Hill Corp., New York, NY.

McNamara, J.P., and. D.E. Bauman. 1978. Partitioning of
nutrients between mammary and adipose tissue of the rat
during lactogenesis. J. Dairy Sci. 61 (Suppl. 1):156
(Abst.).

McNamara, J.P., M. Dehoff, R.J. Collier, and F.W. Bazer. 1985.
Adipose tissue fatty acid metabolism changes during
pregnancy in swine. J. Anim. Sci. 61:410.

McNamara, J.P., C. Douglass, McFarland, and B. Sungchul. 1987.
Regulation of adipose tissue metabolism during lactation.
3. Adaptations of hormone-sensitive and lipoprotien
lipases. J. Dairy Sci. 70:1377.

McNamara, J.P., and J.K. Hillers. 1986. Adaptations in lipid
metabolism of bovine adipose tissue in lactogenesis and
lactation. J. Lipid Res. 27:150.

Meinkoth, J. and G. Wahl. 1984. Hybridization of nucleic

119

 

 

 

acids immobilized (n1 solid. supports. Anal. Biochem.
138:267.

Mellenberger, R.W. 1972. Metabolic adaptations at
lactogenesis in the cow and rabbit. Ph. D. thesis,
university of Illinois, Urbana.

Metz, S.H.M., and S.G. Van den Bergh. 1977. Regulation of fat
mobilization in dairy cows in the period around
parturition. Neth. J. Agric. 25:198.

Miller, S.A., D.D. Dykes, and H.F. Polesky. 1988. A simple
salting out procedure for extracting DNA from human
nucleated cells. Nucl. Acids Res. 16(3):1215.

Moe, P.W., and H.F. Tyrrell. 1972. Mobilizable energy
requirements of pregnant dairy cows . J. Dairy. Sci .
55:480.

Murray, N.B. and K. Murray. 1974. Manipulation of restriction
targets in phage 9 to form receptor chromosomes for DNA
fragments. Nature 251:476.

Nilsson, N.O., P. Stralfors, G. Fredrikson, and P.
Belfrage. 1980. Regulation of adipose tissue lipolysis:
effects of noradrenaline and insulin on phosphorylation
of hormone-sensitive lipase and lipolysis in intact rat
adipocytes. FEBS Lett. 111(1):125.

Noble, R.C., W. steele, and J.H., Moore. 1971. The plasma
lipids of the ewe during pregnancy and lactation. Res.
Vet. Sci. 12:47.

Olishi, M. and S.D. Cosloy. 1972. The genetic and biochemical
basis of the transformability of Escherichia coli K12.
Biochem. Biophy. Res. Commun. 49:1568.

Olsson, H., P. Stralfors, and P. Belfrage. 1986.
Phosphorylation of the basal site of hormone-sensitive
lipase by glycogen synthase kinase-4. FEBS Lett.
209(2):175.

Pajukanta, P., K.V. Porkka, M. Antikainen, M.R. Taskinen, M.
Perola, S.M; Repo, S. IEhnholnu I. Nuotio, L.
Suurinkeroinen, .A.T. Lahdenkari, .A.C. Syvanen, J.S.
Viikari, C. Ehnholm, and L. peltonen. 1997. No evidence
of linkage between familial combined hyperlipidemia and
genes encoding lipolytic enzymes in finnish families.
Arterioscler. Thromb. Vasc. Biol. 17(5):841.

Palmquist, D.L. and W. Mattos. 1978. Turnover of lipoprotein

120

 

‘M-l' ‘

Fl.

 

 

and transfer to milk fat of dietary [1-carbon-14]
linoleic acid in lactating cows. J. Dairy Sci. 70:474.

Patton, S. and R.G. Jensen. 1975.Lipid metabolism and
membrane functions of the mammary gland . Progress in the
Chemistry of Fats and other Lipids 14:167.

Pike, B.V. and C.J. Roberts. 1980. The metabolic activity of
bovine adipocytes before and after parturition. Res.
Vet. Sci. 29:108.

Pothoven, M.AJ, D.C. Beitz and J.H. Thornton. 1975.
Lipogenesis and Lipolysis in adipose tissue od adlibitum
and restricted-fed beef cattle during growth. J. Anim.
Sci. 40:957.

Pullen, D.L., R.S. Emery, and N.K. Ames. 1988. Turn over of
hepatic and plasma triacylglycerol in sheep. J. Anim.
Sci. 66:1538.

Reed, K. C. and M.A. Mann. 1985. Rapid transfer of DNA from
agarose gels to nylon. membranes. Nucleic .Acid. Res.
13:7207.

Rizack, M. A, 1964. Activation of an epinephrine-sensitive
lipolytic activity from adipose tissue by adinosine 3L—5’
phosphate. J. Biol. Chem. 239:392.

Roberts, R.J. 1988. Restriction enzymes and their
isoschizomers. Nucleic Acids Res. (Suppl.) 16:r271.

Robles, J. and.M. Doers. 1994. pGEM9'T4Vector troubleshooting
guide. Promega Notes 45:19.

Sagner, F.S.N, and A.R. Coulson. 1977. DNA sequencing with
chain termination inhibitors. Proc. Natl. Acad. Sci.
74:5463.

Sambrook, J., E.F., Fritsch, and T. Maniatis. 1989. Molecular
cloning. A laboratory manual. 2nd ed. Vol. 1, 2, and 3.
Cold Spring Harbor Laboratory Press, NY.

Schonk, D., P.V. Dijik, P. Riegmann, J. Trapman, C. Holm, T.C.
Willcocks, P. Sillekens, W.V. Venrooij, E. Wimmer, ArG.V.
Kessel, H.H. Roppers, and B. Wieringa. 1990. Assignments
of seven genes to distinct intervals on the midportion of
human chromosome 19q suurounding the myotonic dystrophy
gene region. Cytogenics and Cell Genetics 54:15.

Shimada, F., H. Makino, N. Hashimoto, H. Iwaoka, M. Taira, O.
Nozaki, A. Kanatsuka, C. Holm, D. Langin, and Y. Saito.

121

 

1996. Detection. of an amino acid. polymorphism in
hormone-sensitive lipase in Japanese subjects.
Metabolism, Clinical and experimental 45(7):862.

Shirley, J.E., R.S. Emery, E.M. Convey and W.D. Oxender. 1973.
Enzymatic changes in bovine adipose and mammary tissue
with initiation of lactation. J. Dairy Sci. 56:569.

Sidhu, K.S., and R.S. Emery. 1972. Regulation of blood fatty
acids and glycerol in lactating cows. J. Dairy Sci.
55:926.

Sidhu, K.S. and R.S. Emery. 1993. Blood fatty acid and
glycerol response to diet and norepinephrine in cows. J.
Dairy Sci. 56:258.

Sidhu, K.S., R.S. Emery, A.F. Parr and R.A. Merkel. 1973.

Glyceride synthesis in ovine adipose homogenates J. Anim.
Sci. 37:271 (Abstr.).

Smith, T.R. and J.P. MacNamara. 1990. Regulation of bovine
adipose tissue metabolism during lactation. 6.
Cellularity and hormone-sensitive lipase activity as
affected by genetic merit and energy intake. J. Dairy
science 73:772.

Southern, E.M. 1975. Detection of specific sequences among DNA

fragments separated by gel electrophoresis. J. Mol.
98:503.

Sprinkle, J.E., H.S. Hansard, B.G. Warrington, J.W. Holloway,
G. Wu, and 8.8. Smith. 1998. Physiological Adaptations in
Adipose Tissue of Brahman Vs Angus Heifers. J. Anim. Sci.
76:743.

Stich, V., I. Harant, I. De-Glisezinski, F. Crampes, M.
Berlan, M. Kunisova, V. Hainer, M. Dauzats, D. Riviere,
Garrigues, C. Holm, M. Lafontan, and D. Langin. 1997.
Adipose tissue lipolysis auui hormone-sensitive lipase
expression during very-low-calorie diet on obese female
identical twins. J. Clinical Endocrinology and Metabolism
82 (3):739.

Stralfors, P. and. P. IBelfrage. 1983. Phosphorylation. of
hormone sensitive lipase by cyclic AMP-dependant protein
kinase. J. Biol. Chem. 258:15146.

Stralfors, P., P. Bjorgell, and P. Belfrage. 1984. Hormonal
regulation of hormone-sensitive lipase in intact
adipocytes: identification of phosphorylated sites and
effects on the phosphorylation by lipolytic hormones and

122

 

 

insulin. Proc. Natl. Acad. Sci. USA 81(11):3317.

Sztalryd, C., and F.B. Kraemer. 1994. Regulation of hormone
sensitive lipase during fasting. Am. J. Physiol.
266:El79.

Talmud, P.J., J. Palmen, and M. Walker. 1998. Identification
of genetic variation in the human hormone-sensitive
lipase gene and 5’ sequences: homology of 5’ sequences
with mouse promoter and identification of potential
regulatory e1ements.Biochem. Biophys. Res. Comm.
252:661.

Thompson, M.P., S.T. Cooper, B.R. Parry, and J.A. Tucky. 1993.
Increased expression of the mRNA for hormone-sensitive
lipase in adipose tissue of cancer patiants. Bioch.
Biophy. acta 1180:236.

Tornqvist, H., P. Bjorgell, L. Krabisch and P. Belfrage. 1978.
Monoacylmonoalkylglycerol as a substrate for
diacylglycerol hydrolase activity in adipose tissue. J.
Lipid Res. 19:654.

Tsia, S.C., P. Belfrage, and M. Vaughan. 1970. Activation of
hormone-sensitive lipase in extracts of adipose tissue.
J. Lipid Res.19:654.

Vaughan, M., and D. Steinberg. 1965. Page 239 in “ Handbook
of Physiology” section 5, “Adipose Tissue” (A4 E. Renold
and G. F. Cahill, Jr., eds.). Williams & Wilkins,
Baltimore, Maryland.

Vaughan, M., J.E. Berger, and D. Steinberg. 1964. Hormone-
sensitive lipase and nwmoglyceride lipase activity in
adipose tissue. J. Biol. Chem. 239:401.

Vernon, R.G. 1980. Lipid metabolism in adipose tissue of
ruminants. Prog. Lipid Res. 19:23.

Warden, C.H., R.C. Davis, M.Y. Yoon, D.Y. Hui, K. Svenson,
Y.Ru Xia, A, Diep, K.Y. He, and. A.J. Lusis. 1993.
Chromosomal localization of lipolytic enzymes in the
mouse: pancreatic lipase, colipase, hormone-sensitive
lipase, hepatic lipase and carboxy ester lipase. Journal
of Lipid Research 34:1451.

Weir, 8.5. 1996. Genetic Data Analysis II. Sinauer,
Sunderland, MA.

Wiess, B., A, Jacquemin-sablon, T.R. Live, G.C. Fareed, and C.
Crichardson. 1968. Enzymatic breakage and joining of

123

 

deoxyribonucleic acid. VI. Further purification and
properties of polynucleotide ligase from Esterichia coli
infected with bacterophage T4. J. Biol. Chem. 243:4543.

Wise, L.S. and R.L. Jungas. 1978. Evidence for a dual
mechanism of lipolysis activation by epinephrine in rat
adipose tissue. J. Biol. Chem. 253:2624.

Zinder, O.M., M. Hamosh, T.R.C. Fleck, and R.C. Scow. 1974.
Effect of prolactin on lipoprotein lipase in mammary
gland and adipose tissue of rats. Am» J. Physiol.
226:744.

124