WV .
is
.95. . u

'1

 

 

 

 

 

 

 

can

3;

 

,x
1 ., .a .3}:

.
k

..
H43.

 

.\
n i 11%; ,
.41. .u.

WEmv

sfl‘rai.»
Y’v‘t’t
, v: rgth‘td
$5.15.: .
3:231: . _

. .5
.3? , .55.... {sis -
‘ V 5;: .2 5...}?

‘ .

as): 1.1:!
(til .. L.

 

This is to certify that the

dissertation entitled
ROLE OF C/EBPgamma AND C/EBPzeta IN REGULATING
IL-6 EXPRESSION IN B CELLS

presented by

HONGWEI GAO

has been accepted towards fulfillment
of the requirements for

Ph. D. M
degree in 1crob iology &

/.

 

 

Molecular Genetics

Major professor

A
Date ugust 19, 2002

 

MS U is an Affirmative Action/Equal Opportunity Institution 042771

 

 

 

 

LIBRARY
Michigan State
University

 

 

 

PMCE IN RETURN Box to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 cJClFiC/DatoDuopGS-p. 15

 

ROLE OF CIEBPy AND CIEBPC; IN REGULATING lL-6
EXPRESSION IN B CELLS

By

Hongwei Gao

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Microbiology and Molecular Genetics

2002

ABSTRACT
ROLE OF CIEBP'y AND cream; lN REGULATING lL-6
EXPRESSION IN B CELLS
By

Hongwei Gao

CCAAT/enhancer binding protein 7 (C/EBPy) is an ubiquitously expressed
member of the C/EBP family of transcription factors that has been shown to be
an inhibitor of C/EBP transcriptional activators and has been proposed to act as
a buffer against C/EBP-mediated activation. We have now unexpectedly found
that C/EBPy dramatically augments the activity of C/EBPB in Iipopolysaccharide
induction of the interleukin-6 and interleukin-8 promoters in a B lymphoblast cell
line. This activating role for C/EBPy is promoter-specific. neither being observed
in the regulation of a simple C/EBP-dependent promoter nor the TNFa promoter.
C/EBPy activity also shows cell-specificity with no activity being observed in a
macrophage cell line. Studies with chimeric C/EBP proteins implicate the
formation of a heterodimeric leucine zipper between C/EBPB and C/EBPy as the
critical structural feature required for C/EBPy stimulatory activity. These findings
suggest a unique role for C/EBPy in B cell gene regulation and, along with our
previous observation of the ability of C/EBP basic region-leucine zipper domains
to confer Iipopolysaccharide inducibility of interleukin-6, suggest that the C/EBP

leucine zipper domain has a role in C/EBP function beyond allowing dimerization

between C/EBP family members.

In the second part of my study, I evaluated the roles of C/EBPQ in LPS
induction of interleukin-6 in B cells. C/EBP; was originally identified as a gene
induced upon DNA damage and growth arrest. It has been shown to be involved
in the cellular response to endoplasmic reticulum stress. Because of sequence
divergence from other C/EBP family members in its DNA binding domain and its
consequent inability to bind the C/EBP consensus-binding motif, C/EBP; can act
as a dominant negative inhibitor of other C/EBPs. C/EBP transactivators are
essential to the expression of many proinflammatory cytokines and acute phase
proteins, but a role for C/EBPQ in regulating their expression has not been
described. We have found that expression of C/EBPQ is induced in response to
LPS treatment of B cells at both the mRNA and protein levels. Correlating with
the highest levels of C/EBPQ expression at 48 hours after LPS treatment, both
the abundance of C/EBP DNA binding species and lL-6 expression are
downregulated. Furthermore, ectopic expression of C/EBPQ inhibited C/EBPB-
dependent lL-6 expression from both the endogenous lL-6 gene and an lL-6
promoter-reporter. These results suggest that C/EBPQ functions as negative

regulator of lL-6 expression in B cells and that it contributes to the transitory

expression of lL-6 that is observed after LPS treatment.

To my wife, Mel and my daughter, Anqi
&

To my parents, Shuzhen Wei and Deshun Gao, and my sister, Shuangmei

For their deep love and sustained support

ACKNOWLEDGMENTS

First and foremost, I would like to thank my mentor, Dr. Richard C.
Schwartz, for his friendship, guidance and encouragement through my graduate
study. Without his tremendous support and understanding, it would be
impossible for me to finish up the dissertation. His wisdom, humor and
generosity have made my time at MSU a great, joyful experience, I am very
grateful for having such a wonderful and knowledgeable advisor.

I give my special thanks to Dr. Jerry Dodgson, Dr. Walter Esselman and
Dr. Ronald Patterson, for their encouragement and support in the most difficult
time of my career. I want to express my deep gratitude to all my committee
members including Dr. Jerry Dodgson, Dr. Walter Esselman, Dr. John Fyfe and
Dr. Kathleen A. Gallo for their invaluable discussion and suggestions. Also, I
would like to express my appreciation to Dr. Walter Esselman, Dr. Jerry Dodgson
Dr. John Fyfe, Dr. Karen Friderici and people in their labs for sharing equipment.
I owe my thanks to Dr. Peter F. Johnson in National Cancer Institute for providing
C/EBP mutants and a lot of helpful suggestions. Furthermore, I would like to
acknowledge Mr. Chauncey Spooner and Dr. Qiang Tian in Dr. Schwartz's
laboratory for their collaboration and friendship.

Finally and most importantly, I give my special thanks to my wonderful
family, my parents and my sister for their unconditional love and support during
my life. I would like especially to acknowledge Mei, who has been a steadfast

and faithful friend and companion for the last fifteen years.

TABLE OF CONTENTS

LIST OF TABLES ................................................................................................ viii
LIST OF FIGURES ............................................................................................... ix
LIST OF ABBREVIATIONS ................................................................................. xiii
CHAPTER 1
LITERATURE REVIEW ........................................................................................ 1
INTRODUCTION ................................................................................................... 2
1. C/EBP family of transcription factors ......................................................... 2
1.1 C/EBPa ....................... . ......................................................................... 6
1.2 C/EBPB ................................................................................................. 8
1.3 C/EBP6 ............................................................................................... 10
1.4 C/EBPe ............................................................................................... 11
1.5 C/EBPy ............................................................................................... 13
1.6 C/EBPt; ............................................................................................... 15
2. Regulation of IL-6 expression .................................................................. 18
2.1 Introduction to cytokine ..................................................................... 18
2.2 Overview of IL-6. .. ............................................................................ 20
2.3 Transcriptional regulation .................................................................. 23
2.4 Post-transcriptional regulation ........................................................... 26
2.5 C/EBPs in regulation of IL-6 expression ............................................ 28
2.6 Other cooperating transcription factors ............................................. 29
3. Transcription factors of pre-B and B cells ................................................ 33
3.1 B cell development ............................................................................ 33
3.2 C/EBPs .............................................................................................. 34
3.3 NF-xB ................................................................................................ 36
3.4 AP-1 .................................................................................................. 37
4. Objectives for this thesis ......................................................................... 38
REFERENCES .................................................................................................... 40
CHAPTER 2
C/EBPy HAS A STIMULATORY ROLE ON THE lL-6 AND lL-8 PROMOTER ...58
Abstract ........................................................................................................ 59
Introduction .................................................................................................. 60
Materials and Methods ................................................................................. 64
Results ......................................................................................................... 71
Discussion .................................................................................................. 1 17
References ................................................................................................. 1 23
CHAPTER 3
C/EBPQ (CHOP/GADD153) IS A NEGATIVE REGULATOR OF LPS-INDUCED
lL-6 EXPRESSION IN B CELLS ....................................................................... 128

vi

Abstract ...................................................................................................... 1 29

Introduction ................................................................................................ 130
Materials and Methods ............................................................................... 133
Results ....................................................................................................... 138
Discussion .................................................................................................. 157
References ................................................................................................. 162
SUMMARY AND FUTURE DIRECTION ........................................................... 167

vii

LIST OF TABLES

CHAPTER 1
Table 1 Pleiotropic function of lL-6 ............................................................... 22

viii

CHAPTER 1
Figure 1

Figure 2
CHAPTER 2
Figure 1
Figure 2

Figure 3

Figure 4

Figure 5.

Figure 6.

Figure 7.

Figure 8.

Figure 9.

Figure 10.
Figure 11.

Figure 12.

LIST OF FIGURES
Structure of the C/EBPB basic region/leucine zipper domain bound
to DNA. ............................................................................................. 3
Schematic representation of the C/EBP family members .................. 5
Diagram of the major C/EBP isoforrns and mutants used in this
chapter. ........................................................................................... 67

Ectopically expressed C/EBPa, [3 and 6 predominantly form
heterodimers with C/EBPy. ............................................................. 72

Ectopically expressed C/EBPB and 8 predominantly form
heterodimers with C/EBPy .............................................................. 73

A northern blot of RNA samples isolated from a time course of LPS
treatment upon WEHI 231 B cells was successively hybridized for
lL-6 and GAPDH. ............................................................................ 75

EMSA was performed using nuclear extracts of WEHI 231 cells that
were untreated or LPS-treated for 24 hours .................................... 77

C/EBPB :y heterodimers are detected in preference to C/EBPB and
C/EBPy homodimers ....................................................................... 78

C/EBPB192-275 :y heterodimers are detected in preference to
C/EBPB192-276 and C/EBPy homodimers .......................................... 8O

C/EBszfl and C/EBPfizy have similar affinity for the C/EBP binding
site in the lL-6 promoter. ................................................................. 81

C/EBPB is a more potent activator of LPS-induced lL-6 transcription

under conditions of added C/EBPy expression. .............................. 83
C/EBPy drives C/EBPB into C/EBPB:y heterodimers. ...................... 84
C/EBPy promotes formation of C/EBP8:y heterodimers .................. 86

C/EBPy stimulates LPS-induced lL-6 transcription when expressed
with C/EBPB .................................................................................... 87

Figure 13A.

Figure 133.

Figure 14.

Figure 15.

Figure 16.

Figure 17.

Figure 18.

Figure 19.

Figure 20.

Figure 21A.

Figure 21 B.

Figure 21C.

Figure 22A.

Figure 228.

C/EBPy inhibits C/EBPB-induced IL-6 transcription in the absence of
LPS treatment, while that inhibition is reversed by NF-xB p65
expression ....................................................................................... 88

C/EBPy inhibits C/EBPB-induced lL-6 transcription in the absence of
LPS treatment, while that inhibition is reversed by NF-KB p65
expression ....................................................................................... 89

LPS induces NF-KB DNA binding of lL-6 promoter in P388 cells....91
C/EBPy by itself has no stimulatory activity on the lL-6 promoter ...92

C/EBPy stimulates LPS-induced transcription from the lL-8
promoter, but is inactive for the TNFa promoter and a simple
C/EBP-driven promoter. .................................................................. 94

Both the IL-6 and DEI C/EBP binding motifs bound C/EBPy-
containing species. ......................................................................... 95

EMSA was performed using nuclear extracts of P388D1(|L1), IC21,
and ANA-1 cells that were untreated or LPS-treated for 4 hours ....98

A northern blot of RNA samples isolated from untreated and LPS-
treated P38SD1(IL-1), IC21 or ANA-1 cells was successively
hybridized for lL-6 and GAPDH ....................................................... 99

C/EBPy lacks stimulatory activity in P388D1(|L1) macrophages... 1 02

C/EBPy stimulatory activity is dependent upon the formation of
C/EBPfizy heterodimers. The replacement of the C/EBP leucine
zipper in C/EBPB with that of GCN4 blocked C/EBPy activity ....... 103

C/EBPy stimulatory activity is dependent upon the formation of
C/EBszy heterodimers. The replacement of the C/EBP leucine
zipper in C/EBPB with that of GCN4 blocked C/EBPy activity ....... 104

C/EBPy stimulatory activity is dependent upon the formation of
C/EBszy heterodimers. The replacement of the C/EBP leucine
zipper In C/EBPB with that of GCN4 blocked C/EBPy activity ....... 105

The amino-terminal region of C/EBPy is not required for stimulatory
activity ........................................................................................... 107

The amino-terminal region of C/EBPy is not required for stimulatory
activity ........................................................................................... 108

Figure 23A. The formation of a heterodimeric C/EBPfizy leucine zipper is

sufficient for the stimulatory activity of C/EBPy ............................. 109
Figure 238. The formation of a heterodimeric C/EBPB:y leucine zipper is
sufficient for the stimulatory activity of C/EBPy ............................. 111
Figure 230. The formation of a heterodimeric C/EBszy leucine zipper is
sufficient for the stimulatory activity of C/EBPy ............................. 112
Figure 24. C/EBPBYLz is overexpressed in P388 cells. ................................... 115
Figure 25. C/EBPBYLZ confers LPS-inducible expression of lL-6 to P388
Iymphoblasts. ................................................................................ 1 16
CHAPTER 3
Figure 1 LPS induces lL-6 expression in P388-CB cells ............................. 139
Figure 2 LPS induces lL-6 expression in WEHI231 cells ............................ 140
Figure 3 LPS induces C/EBPQ expression in P388-CB cells ....................... 141

Figure 4 LPS induces C/EBPB, C/EBPQ expression in P388-CB cells ........ 143

Figure 5. LPS induces C/EBPB, CIEBPS, and C/EBPQ expression in WEHI231
cells. .............................................................................................. 144

Figure 6. DNA-binding activity of nuclear extract containing C/EBPB
decreased following a time course of LPS treatment in P388-CB
cells ............................................................................................... 146

Figure 7. DNA-binding activity of nuclear extract containing C/EBPB
decreased following a time course of LPS treatment in WEHI231
cells ............................................................................................... 147

Figure 8. C/EBPQ is overexpressed in P388 cells ........................................ 149

Figure 9. Overexpression of C/EBP; reduced DNA-binding activity of nuclear
extract containing C/EBPB ............................................................ 151

Figure 10. Overexpression of C/EBPQ reduced the LPS-induced expression of
IL-6 in P388-CB cells. .................................................................... 153

Figure 11. C/EBPQ inhibits the C/EBPB-conferred lL-6 induction upon LPS
treatment ....................................................................................... 154

xi

Figure 12. LPS induces NF-KB DNA binding of IL-6 promoter in WEHI231
cell ................................................................................. 156

xii

C/EBP
LAP
LIP
bZlP

IL
CHOP

GADD153

TN Fa
LPS

GAPDH
EMSA

Ig/EBP

STAT

LIST OF ABBREVIATIONS

CCAAT/enhancer binding protein
Liver activating protein

Liver inhibitory protein

Basic region-leucine zipper
Interleukin

C/EBP homology protein

Growth arrest and DNA damage-induciblegene
153

Tumor necrosis factor a
Lipopolysaccharide

Glyceraldehyde-3-phospahate dehydrogenase

Electrophoretic mobility shift assay

Immunoglobulin enhancer binding protein

Signal transducer and activator of transcription

xiii

CHAPTER 1

LITERATURE REVIEW

INTRODUCTION

1. CIEBP family of transcription factors

CCAAT/enhancer binding proteins (C/EBPs) form a family of transcription
factors with structural as well as functional homologies. Over eight C/EBP
isoforrns encoded by six genes have been found (reviewed by Lekstrom-Himes
and Xanthopoulos, 1998). The additional isofonns are produced by translation
initiation at different in-frame AUG codons as well as by differential splicing and
use of alternative promoters.

All C/EBP family members possess a highly conserved basic region-leucine
zipper motif (bZlP). The basic region makes direct contact with DNA and
determines sequence-specific binding properties (Agre et al 1989; Johnson et al
1993). The leucine zipper motif mediates dimerization between CIEBP
polypeptides, which is required for DNA binding and for transactivation
(Landschultz et al 1988). Figure 1 shows the structure of the C/EBPB bZIP
region homodimer bound to DNA. According to a model for DNA binding by
bZIP proteins (Vinson et al 1989; Hurst 1995), the dimer forms an inverted Y
shaped structure in which each arm of the Y is made of a basic region, which
binds to one half of a palindrome recognition sequence in the DNA major groove
like a fork or a pair of scissors (Figure 1).

The conserved bZIP domain has several implications. First, all CIEBP

isoforrns with DNA-binding domains are at least potentially capable of binding to

 

Figure 1. Structure of the CIEBPB basic region/leucine zipper
domain bound to DNA. The two a-helical basic regions (bottom)
dimerize through the a-helical leucine zipper domain (top) to form an
inverted Y-shaped structure. Each arm of the Y is formed by a
single at helix, one from each monomer, which binds to one-half of a
palindromic recognition sequence.

a given CIEBP binding site in a promoter, although there is some evidence that
phosphorylation of specific residues in the basic region of individual CIEBP
isoforrns may alter their binding affinity. As a result, different C/EBP isoforrns
may compete for binding to a cognate DNA sequence. Second, the conserved
nature of the leucine zippers makes them compatible, allowing for the formation
of heterodimers (Cao et al 1991). Thus, dimerization between isoforrns has the
potential to increase the variety of transcriptional responses elicited from these
factors.

The amino terminus of C/EBPs carries the transactivation domain (Friedman
et al 1990; Trautwein et al 1995; Williams et al 1995; Figure 2). The amino acid
sequences of the transactivation domains are generally unique for each isofonn,
although some short, conserved domains have been identified in C/EBPa,
C/EBPB, and CIEBP8 that are critical for the transcriptional activity of these
isoforrns (Nerlov et al 1995; Figure 2). These transactivation domains act more
or less independently of the bZIP domain, displaying similar activity when fused
to heterologous DNA-binding domains (Trautwein et al 1995; Williams et al
1995). This modularity has been explored extensively by studying the function of
specific domains and amino acid residues in C/EBP proteins.

Since their discovery, the function of the C/EBP family has been investigated
in detail and pivotal roles of the proteins have been identified in numerous
cellular processes. These include the control of cellular growth and

differentiation, immune and inflammatory processes, and various diseases. The

AD AD RD AD B ZIP

 

 

 

 

 

 

CIEBPa p42
p30
CIEBPB LAP*
LAP
LIP
CIEBPy — IIIIII
CIEBP6
CIEBPe p32
p30
p27 I
p14
CIEBPQ

 

 

 

Figure 2. Schematic representation of the CIEBP family members.
The leucine zipper is shown in light gray, with black vertical lines
indicating the leucine residues, and the basic region is shown in dark gray.
The position of the activation domains (AD) and negative regulatory
domains (RD) are shown in gray. ? Indicates that the N-terminus of
CIEBPQ contains an activation domain although its exact position remains
to be determined.

expression of C/EBPs has also been found to change markedly during a number
of physiological and pathophysiological conditions through the action of
extracellular signals. Here, I will review the structure, function and the regulation
of all six primary C/EBP isoforrns (C/EBPa, B, 8, y, s, and Q) with emphasis on

the dominant negative inhibitors of this family, C/EBPy and C/EBPQ.

1.1 CIEBPa

ClEBPa is the first cloned member of the CIEBP family and also the bZIP
prototype gene. It was isolated from a rat liver cDNA library and originally named
CIEBP (Landschulz et al 1988). Later renamed C/EBPa, homologues have now
been identified from several different species including mouse (Xanthopoulos et
al 1989), human (Antonson et al 1995), chicken (Calkhoven et al 1992) and frogs
(Chen et al 1994 and Xu et al 1992). C/EBPa can be translated into multiple
proteins with different transactivation potentials (Ossipow et al 1993). All these
proteins have the same bZIP domain but different N-terminal amino acid
sequences. A ribosome-scanning mechanism that uses different in-frame AUGs
to initiate translation from the same mRNA has been suggested to explain the
production of multiple C/EBPa proteins (Ossipow et al 1993).

CIEBPa mRNA is most abundant in liver and adipose tissue, but it is also
expressed in other tissues (Antonson et al 1995; Birkenmeier et al 1989; Williams
et al 1991 ). Consistent with its tissue distribution, C/EBPa can transactivate the

promoters of hepatocyte and adipocyte energy metabolism-related genes such

as GLUT4 (Kaestner et al 1990) and PEPCK (Park et al 1990). Therefore, it has

been proposed to be a global regulator of genes involved in energy metabolism
(McKnight et al 1989).

ClEBPa clearly functions in other cellular processes, as well. C/EBPa
regulates adipocyte differentiation. Inhibition of C/EBPa blocks differentiation
while upregulation induces differentiation of adipocytes (Cao et al 1991; Lin et al
1994). C/EBPa also plays a critical role in myelopoiesis. ClEBPa-deficient mice
are completely blocked in the development of neutrophils (Zhang et al 1997).
Conditional expression of C/EBPa in transfected bipotential cells induces
neutrophilic differentiation and blocks monocytic differentiation (Radomska et al
1998)

A number of studies additionally point to a role for C/EBPa in the regulation
of cellular growth. Overexpression of a chimeric C/EBPa-estrogen receptor
fusion protein can cause cessation of mitotic growth (Umek et al 1991). C/EBPa
has been found to interact with several proteins that are involved in the control of
cell cycle progression, thereby indicating the existence of multiple pathways
through which it mediates growth arrest (McKnight 2001; Timchenko et al 1997;
Chen et al 1996; Timchenko et al 1999; Wang et al 2001; Wang et al 2002). For
example, ClEBPa-mediated growth arrest is accompanied by increased
expression of the cell cycle inhibitor, p21. ClEBPa interacts with and stabilizes
the p21 protein (Timchenko et al 1997). Most recently, it was shown that a short
region outside of the C/EBPa DNA binding domain interacts directly with the
cyclin-dependent kinases Cdk2 and Cdk4, and arrests cell proliferation by

inhibiting their activity (Wang et al 2001 ). In the case of cdk4, it has been further

shown that this interaction leads to proteasome-dependent degradation of the
protein (Wang et al 2002).

The lines of research demonstrating an involvement of ClEBPa in the
regulation of both growth and differentiation have come together in some recent
studies. CIEBP has been shown to repress E2F function in the terminal
differentiation of adipocytes and granulocytes (Porse et al 2001). Using standard
molecular biological approaches, Tenen’s group discovered dominant-negative
mutations in the human gene encoding C/EBPa in acute myeloid leukemias that
phenotypically resemble cells blocked in differentiation by knockout of the gene
encoding C/EBPa (Pabst et al 2001). These results led to the conclusion that
C/EBPa is a tumor suppressor gene (McKnight 2001). Collectively, these data
lead to a view of C/EBPa as playing a key role in the linked processes of cell

growth arrest and terminal differentiation.

1.2 CIEBPB

C/EBPB was identified and cloned as NF-IL6, the nuclear factor that bound
to the IL-1 response element of the lL-6 gene (Akira et al 1990). Several other
names for C/EBPB homologues cloned from rat, mouse, chicken and aplysia are
lL-6-DBP (Poli et al 1990), LAP (Descombes et al 1990), CRP2 (Williams et al
1991), AGP/EBP (Chang et al 1990), NF-M (Katz et al 1993) and ApC/EBP
(Alberini et al 1994). C/EBPB is expressed in several tissues with highest
expression in liver and kidney (Williams et al 1991; Cao et al 1991; Descombes

et al1990; and Chang et al 1990). While C/EBPB was originally identified as a

nuclear factor binding to the lL-1 response element of the human lL-6 gene
(Akira et al 1990), many studies have now demonstrated that C/EBPB is
responsible for the regulation of genes encoding other proinflammatory
cytokines, as well as many acute phase proteins (Akira et al 1992). The gene
encoding C/EBPB can generate two proteins: LAP which acts as an activator
and UP which acts as a repressor. LIP shares the same bZIP domain as LAP,
but lacks the N-terminal activation domain (Descombes et al 1991). In contrast
to these findings, results from our lab suggest that LIP functions as an activator
rather than a repressor of the IL-6 promoter in P388 lymphoblast cells upon LPS
and lL-1B treatment. (Hu et al 2000; Spooner et al unpublished data). LIP
seems to act either as an inhibitor of CIEBP transcriptional activity or as a
transcriptional activator of other genes depending on the promoter and the cell
type.

C/EBPB-deficient mice have been produced. The phenotype of C/EBPB-
deficient mice indicates a potential role in the activation and/or differentiation of
macrophages (T anaka et al 1995). On the other hand, CIEBPB appears to play
an important role in promoting proliferation, and its levels are increased in a
number of tumors (Greenbaum et al 1998; Zhu et al 2002; Buck et al 1999; Buck
et al 2001). For example, Zhu et al (2002) have shown that C/EBPB-deficient
mice are completely refractory to skin tumour development induced by a variety
of carcinogens. In v-Ha-ras transgenic mice, C/EBPB deficiency results in a
significant reduction in tumourogenesis, thereby linking the proto-oncogene res

and C/EBPB (Zhu et al 2002).

C/EBPB can be phosphorylated on a number of different residues by several
protein kinases, some of which appear to play a role in the regulation of its
biological functions. For example, phosphorylation has been demonstrated to
alter the intrinsic transactivation ability of C/EBPB (Wegner et al 1992; Trautwein
et al 1993). The phosphorylation status of CIEBPB can also modulate its ability
to bind to DNA. Trautwein et al showed that in vitro phosphorylation of rat
CIEBPB Ser24° by PKA or PKC inhibited its DNA-binding activity (Trautwein et al
1994). Phosphorylation of CIEBPB has also been shown to stimulate
translocation of C/EBPB from the cytosol to the nucleus (Metz et al 1991) and to
be required for TGFa-induced hepatocyte proliferation (Buck et al 1999).
Recently, it was reported that phosphorylation of mouse C/EBPB on serine 239
induced its nuclear export, which, in turn, inhibits transcription from the albumin
gene upon TNF-a treatment (Buck et al 2001). Furthermore, Buck and
colleagues show that RSK—mediated phosphorylation of mouse threonine 217 of
C/EBPB constitutes a critical event allowing stellate cells to evade programmed
cell death upon liver injury (Buck et al 2001). They argue that this modification
creates a functional XEXD caspase substrate inhibitor, thus suggest that C/EBPB

may play a role other than that of a transcription factor.

1.3 CIEBP6
C/EBP6 was originally cloned from the rat (Cao et al 1991). It is also termed

as CRP3 (Williams et al 1991) and NF-IL6B (Kinoshita et al 1992). C/EBPS is

expressed in many tissues but most highly in the lung (Williams et al 1991 and

10

Cao et al 1991). C/EBP5 is induced by LPS, IL-1, or IL-6, as with C/EBPB
(Kinoshita et al 1992), suggesting its role in inflammation. Unlike C/EBPB, the
induction of CIEBPB mainly occurs at the transcriptional level (Ramji et al 1993).
CIEBP5 is a stronger transactivator than C/EBPB, and perhaps acts in a
combinatorial or synergistic manner with C/EBPB to regulate the gene expression
involved in the immune and inflammatory responses (Kinoshita et al 1992). So
far, although no information about regulation of the acute phase response in
C/EBPB and 8 double deficient mice is available, the results from these mice
indeed demonstrated that C/EBPB and C/EBP6 have a synergistic role in
terminal adipocyte differentiation in vivo (Tanaka et al 1997).

Like C/EBPB, C/EBP6 is a phosphoprotein that translocates into the nucleus
following threonine phosphorylation of the MAP kinase site. The phosphorylation
of CIEBPS by casein kinase II increases its binding activity, but does not affect
binding specificity, although the phosphorylation of ClEBPa and C/EBPB
decreased binding affinity (Osada et al 1996). Studies on the regulation of the
a1-acid glycoprotein and the serum amyloid A genes during the acute phase
response have shown that dephosphorylation of C/EBP6 results in an inhibition
of its DNA binding activity (Ray et al 1994). Additionally, the trans-activation
potential of C/EBPS was also found to be increased when hepatocytes were

treated with cellular phosphatase inhibitors, such as okadiac acid and sodium

orthovanadate (Ray et al 1994).

1.4 CIEBPs

ll

The complete gene encoding C/EBPe was first cloned from both human
(Antonson et al 1996; Chumakov et al 1997) and mouse (Yamanaka et al 1997a)
cDNA and genomic libraries. A partial sequence of the rat homologue was
cloned from a rat genomic library and was called CRP1 (Williams et al 1991).
Unlike other CIEBP members, C/EBPs has a very restricted pattern of expression
and is detected in human peripheral blood cells, in the T—cell Jurkat line and in
HL60 promyelocytic cells (Antonson et al 1996). Its expression is normally
limited to organs of the Immune system and bone marrow in humans (Antonson
et al. 1996). C/EBPe is upregulated during in vitro granulocytic differentiation of
human primary CD34+ cells (Yamanaka et al 1997a). Furthermore, there are
functional and maturational defects in the granulocytes of ClEBPe-deficient mice,
as well as impaired T-cell proliferation (Yamanaka et al 1997b; Kawano et al
1999). Additionally, macrophage functional maturation and cytokine production
are impaired in ClEBPe-deficient mice (Tavor et al 2002). Taken together, these
studies implicate CIEBP: as an important transcription factor required for normal
function and/or development of granulocytes, macrophages, and T lymphocytes.
The human C/EBPe gene is transcribed by two alternative promoters, Pa and PB.
Alternative use of promoters and differential splicing generates four mRNA
isoforrns, which encode four proteins of MW 32 kDa, 27 kDa, 20 kDa and 14
kDa. These four proteins contain the identical DNA binding and dimerization
domains. However, they differ in the length of their transactivation domains and

have differing transcriptional activities (Yamanaka et al 1997).

12

1.5 CIEBPy

C/EBPy is also called lg/EBP. It was originally isolated from an expression
library from murine fibroblasts as a protein binding to the immunoglobulin heavy
chain (lgH) enhancer (Roman et al 1990). A human homologue which binds to
the PRE-1 enhancer element of the human interleukin-4 promoter was also
cloned (Davydov et al 1995). C/EBPy is most highly expressed in immature B
cells, although its expression is rather ubiquitous (Roman et al 1990). C/EBPy is
a short gene containing one intron. It encodes a 16.4-kDa protein, which lacks
known activation domains and is essentially a CIEBP bZIP domain (Cooper et al
1995). Consistent with this structure, C/EBPy has been shown to inhibit CIEBP
transcriptional activators and has been proposed to act as a buffer for C/EBP
activators. The predominance of C/EBPy over C/EBPB in early B cells would
prevent transcription of CIEBP-dependent genes, while increased expression of
C/EBPB in mature cells would be permissive for expression (Cooper et al 1995).
A fusion protein containing a TF E3 activation domain and the bZIP domain from
C/EBPy can activate transcription through C/EBP sites, providing additional
evidence that the inability of C/EBPy to induce transcription is due to the absence
of an activation motif (Artandi et al 1994). Contrary to this notion, C/EBPy also
plays some positive roles in the regulation of gene expression. For example,
C/EBPy was found to synergize with Stat6 and NF- B p50/p65 to induce the
gerrnline gamma 3-immunoglobulin promoter in a B cell line (Pan et al 2000).
Another instance of a positive role for C/EBPy is its enhancement of B-globin

gene expression in collaboration with CAAT binding protein CP—1 (Wall et al

13

1996). In addition, C/EBPy has also been implicated to exert a stimulatory effect
in the expression of pp52, a leukocyte-specific phosphoprotein postulated to
regulate cytoskeleton structure (Omori et al 1997). Studies using an in vitro
transcription system have also shown that nuclear extracts depleted of C/EBPy
have reduced CIEBP site-dependent promoter activity (Cooper et al 1992).
Whether CIEBPy functions as an activator or a repressor, both its lack of
expression and overexpression have consequences in vivo. C/EBPy—deficient
mice show a high mortality rate within 48 hours after birth, and have defects in
natural killer cell cytotoxic activity and interferon 7 production (Kaisho et al 1999).
Moderate erythroid overexpression of C/EBPy in transgenic mice increased 7-
globin expression relative to B-globin, while high-level expression blocked
erythropoiesis (Zafarana et al 2000). C/EBPy can form heterodimers with
C/EBPB (Cooper et al 1992; Thomassin et al 1992) and C/EBPa (Roman et al
1990; Thomassin et al 1992), but the function for the heterodimer is not clear.
The occurance of ClEBPB:C/EBPy heterodimers are certainly widespread, having
been observed in glioma, mammary tumor, and hepatoma cell lines, as well as in
liver, brain, pancreas, and ovary (Parkin et al 2002). Furthermore, C/EBPy was
reported to form heterodimers with proteins of other leucine-zipper transcription
factors such as ATF (Nishizawa et al 1992; Vinson et al 1993). In this way it
might promote the binding of other transcriptional activators to DNA. Indeed , it
was observed that human C/EBPy interacts with Fos, a member of the AP-1
family, to form a complex on the positive regulatory element-I site (PRE-l) of

interleukin-4 promoter (Davydov et al 1995). We have found that ClEBPy is

14

ovewvhelmingly present as a heterodimer with conventional activating C/EBP
isoforms in lymphoblasts dependent upon C/EBPB, 6 or on for IL-6 expression. In
these cells, C/EBP y plays an activating role in LPS induction of IL-6. These

results will be described in detail in the second chapter.

1.6 CIEBPQ

C/EBPC, has also been reported as CHOP (Ron et al 1992) and Gadd153
(Luethy et al 1990; Park et al. 1992). Like other CIEBP proteins, CIEBP;
possesses a leucine zipper dimerization domain and DNA-binding region (Ron et
al. 1992). C/EBPQ can form heterodimers with other C/EBPs, but two prolines in
its DNA-binding region disrupt its helical stmcture and prevent the dimer from
binding to the CIEBP consensus motif (Ron et al. 1992). Thus, CIEBPQ functions
as a dominant negative inhibitor of C/EBP transcriptional activator by preventing
heterodimer binding to classic CIEBP enhancer sequences. When expressed in
cells, ClEBPg attenuates the ability of other CIEBP proteins to activate promoters
containing such sequences (Ron et al 1992). However, recent studies have
shown that C/EBPQ-C/EBP heterodimers can activate downstream target genes
although their significance remains unknown (Wang et al 1998; Sok et al 1999).
For example, the C/EBPQ-C/EBPB can specifically activate transcription of the
murine carbonic anhydrase VI gene through a non-consensus binding site (Sok
et al 1999). Furthermore, it was found that C/EBPQ can also interact with
members of the AP-1 transcription factor family, JunD, c-Jun, and c-Fos, to

activate promoter elements in the somatostatin, JunD, and collagenase genes

15

(Ubeda et al. 1999). It was also found that C/EBPQ was recruited to the AP—1
complex by a tethering mechanism rather than by direct binding to DNA,
implicating a novel mechanism by which CIEBP can regulate gene expression
(Ubeda et al 1999).

C/EBPt; was originally identified as a gene induced upon DNA damage and
growth arrest (Fomace et al 1988). However, subsequent studies have
demonstrated a strong correlation between development of endoplasmic
reticulum (ER) stress and induction of C/EBPQ . C/EBPQ expression is
coordingly regulated with the ER chaperone BiP (Brewer et al 1997; Wang et al
1996; Halleck et al 1997) and is inducible by agents that either directly (Bartlett et
al 1992; Chen et al 1992; Price et al 1992; Halleck et al 1997) or indirectly
(Carlson et al 1993; Marten et al 1994; Bruhat etal 1997) lead to impairment of
the ER folding environment (ER stress). However, the mechanism by which ER
stress leads to C/EBPQ gene expression is not known. On the other hand, ER
stress regulates C/EBPQ not only by inducing expression of the gene, but post-
translationally at the level of phosphorylation. For example, C/EBPQ protein
undergoes stress-inducible phosphorylation by stress-inducible members of the
p38-MAP kinase family and this phosphorylation is associated with enhanced
transcriptional activation by CIEBPQ (Wang and Ron 1996).

Most evidence supports the notion that CIEBP; negatively regulates cell
growth and, additionally, may induce apoptosis. Overexpression of C/EBPt; can
lead to cell cycle arrest and apoptosis (Barone et al 1994; Zhan etal 1994).

Disruption of the C/EBPQ gene by a chromosomal translocationt(12:16)(q13:p11)

16

is associated with human myxoid liposarcoma. This translocation results in a
fusion between a novel glycine-rich protein and C/EBPQ (Crozat et al 1993;
Rabbitts et al 1993). Mice with a homozygous deletion in the C/EBPQ gene
displayed reduced apoptosis in the renal epithelium in response to tunicamycin
injection (Zinszner et al 1998). In addition, there is less subsequent tissue
regeneration. These results suggest that CIEBP; may signal death in response to
ER stress and that it may also play a role in cellular regeneration. Furthermore,
CIEBP; -deficient mice are defective in the development of an apoptotic
response to agents that cause destruction of the pancreatic B cells and thereby
cause diabetes (Oyadomari et al 2001; Oyadomari et al 2002). Very recently,
research from Dr. Nakshatri’s group showed that NF-xB could inhibit CIEBPQ
activation in breast cancer cells exposed to nutrient deprived media, tunicamycin
(which blocks protein folding in the ER) or calcium ionopore (which depletes
calcium stores in ER) (Nozaki et al 2001). These results establish a correlation
between repression of pro-apoptotic genes by NF-xB and increased cell survival
during ER stress, and also identify a distinct NF-KB regulated cell survival
pathway. CIEBP; has also been shown to play a role in the programmed
activation of C/EBPB during adipogenesis (Tang et al 2000) and to play a role in
erythropoiesis (Coutts et al 1999). For example, C/EBPQ transiently interacts with
C/EBPB in growth-arrested preadipocytes, delaying acquisition of DNA-binding
activity and activation of the C/EBPu gene until mitotic clonal expansion is
underway (Tang et al 2000). In normal hematopoietic cells, the highest levels of

C/EBPB were found in erythroid cells, with levels peaking during terminal

17

differentiation. Artificial downregulation of C/EBPQ in normal murine bone
marrow cells inhibited colony-forming unit-erythroid-derived colony growth in a
concentration-dependent manner (Coutts et al 1999). These results strongly

suggest that C/EBPg plays a role during erythroid differentiation.

2. Regulation of Interleukin-6 expression
2.1 Introduction to cytokines

The development of an effective immune response involves T cells, B cells,
macrophages, and other hematopoietic cells. The complex interactions among
these cells are mediated by a group of proteins designated cytokines to denote
their role in cell-to-cell communication. Cytokines are a group of low-molecular-
weight regulatory proteins secreted by white blood cells and a variety of other
cells in response to a number of inducing stimuli. Cytokines bind to specific
receptors on the membrane of target cells, triggering signal-transduction
pathways that ultimately alter gene expression in those target cells. Originally,
cytokines were thought to function in a cell-specific manner eliciting a limited
range of effects. Now, it is known that they function in a pleiotropic manner (Paul
1989; Kishimoto et al 1992) eliciting different biological effects on different target
cells. Another feature characteristic of cytokines is that they exert biological
activities in a redundant manner. Many cytokines are referred to as interleukins,
a name indicating that they are secreted by some leukocytes and act upon other
leukocytes. Presently, intedeukins 1 through 17 have been identified. Other

cytokines are known by common names; these include the interferons and tumor

18

necrosis factors (T NF ). A group of low-molecular-weight cytokines, including
interleukin 8, is classified in the chemokine family. Many of these molecules play
an important role in the inflammatory response.

Cytokines are proteins or glycoproteins that generally have a molecular
mass of less than 30 kDa. Many cytokines belong to a family of structurally
related proteins, called the hematopoietins. Although the amino acid sequences
of the various hematopoietins differ considerably, all of them have a high degree
of ct-helical structure and little or no B-sheet structure. Cytokines generally
function as intercellular messenger molecules that evoke particular biological
activities after binding to a receptor on a responsive target cell. Although a
variety of cells can secrete cytokines, the two principal producers in the immune
system are the TH cell and the macrophage. Among the numerous physiologic
responses that require cytokine involvement are development of cellular and
humoral immune responses, induction of the inflammatory response, regulation
of hematopoiesis, control of cellular proliferation and differentiation, and induction
of wound healing. Cytokines rarely act alone in vivo. Instead, a cell is exposed
to an environment having many cytokines. These cytokines may have
synergistic or antagonistic effects. Also, one cytokine can induce the synthesis
of another cytokine.

The structures of the receptors for the various cytokines are quite diverse.
These receptors belong to five families: class I cytokine receptors family, class II
cytokine receptors family, Immunoglobulin superfamily receptors, TNF receptor

family and chemokine receptor family.

19

2.2 Overview of IL-6

lL-6 is produced by many different cell types. The main sources in vivo are
stimulated monocytes, fibroblasts, and endothelial cells. Macrophages, T-cells
and B-lymphocytes, granulocytes, smooth muscle cells, eosinophils,
chondrocytes, osteoblasts, mast cells, glial cells, and keratinocytes also produce
lL-6 after stimulation. Physiological stimuli for the synthesis of lL-6 are lL-1,
bacterial endotoxins, TNF, PDGF, and Oncostatin M. Glucocorticoids inhibit the
synthesis of lL-6 (Braciak et al 1991), as do lL-4 (Donnelly et al 1993 and Zissel
et al 1996) and TGF-beta (Reinhold et al 1994).

lL-6 is a protein of 185 amino acids glycosylated at positions 73 and 172.

It is synthesized as a precursor protein of 212 amino acids. Murine and human
lL-6 show 65% sequence homology at the DNA level and 42% homology at the
protein level (Tanabe et al 1988). lL-6 is a member of a family of cytokines that
also includes lL-11, leukemia inhibitory factor (LlF), ciliary neurotrophic factor
(CNTF), oncostatin M, and cardiotrophin. All known members of the lL-6
cytokine family induce hepatic expression of acute phase proteins. The lL-6
receptor is expressed on T-cells, mitogen-activated B-cells, peripheral
monocytes and some macrophage- and B-cell-derived tumor cells. It is not
expressed in resting B-cells but is expressed in resting T-cells. lL-6 receptor-
complex-mediated signal transduction involves activation of JAK kinases and the
transcription factor Stat3 (Hirano et al 2000). Other signaling pathways including

the Ras/MAP kinase (Boulton et al 1994; Zauberrnan et al 1999) and protein

20

kinase C (Jain et al 1999) pathways are also induced although their functions are
not yet totally understood.

lL-6 is a pleiotropic cytokine. It was originally identified as a factor that
induced immunoglobulin production in activated B cells and was Initially
designated as B cell differentiation factor or B cell stimulatory factor-2. But it now
has also been found to exhibit a wide range of biological functions in cells outside
the B lymphocyte lineage (Akira et al 1993). It is involved in the regulation of
differentiation, proliferation, and survival of many target cells within the
hematopoietic lineage, as well as astrocytes and endothelial cells (Hirano 1998).
Among the hematopoietic lineages, lL-6 acts on (i) myeloma and plasmacytoma
cells to induce proliferation, (ii) hematopoietic progenitors to induce expansion,
(iii) megakaryocyte progenitors to induce proliferation and differentiation, (iv) M1
myeloid leukemia cells to stop proliferation and induce macrophage
differentiation, and (v) T lymphocytes to induce proliferation and differentiation
into cytotoxic T cells. Outside the hematopoietic system, lL-6 functions as a
hepatocyte-stimulating factor serving as a major mediator of the acute-phase
response. This response is characterized by the synthesis and secretion of
acute-phase plasma proteins by the liver, elevated serum glucocorticoid levels,
and fever. Furthermore, lL-6 controls bone turnover and is crucial for liver
regeneration (Poli et al 1994; Cressman et al 1996). lL-6 exerts its effects in an
endocrine, paracrine, and autocrine manner. A detailed list of the pleiotropic

functions of lL-6 is given at Table 1.

21

Table 1. Pleiotropic functions of lL-6

 

Effect on B cells

Effect on T cells

Effect on hematopoietic
progenitor cells

Effect on megakaryocytes

Effect on macrophages

Effect on hepatocytes
Effect on bone metabolism

Effect on blood vessels

Effect on heart muscle cells

Effect on neuronal cells

Effect on placenta

lg production

Proliferation of myeloma cells
Proliferation of Epstein-Barr virus-infected
B cells

Proliferation and differentiation of T cells
Differentiation of cytotoxic T lymphocytes
Induction of lL-2R expression and lL-2
production

Augmentation of NK activities

Enhancement of multipotential hematopoietic
colony formation

Megakaryocyte maturation

Growth inhibition of myeloid leukemic cell lines
and induction of their macrophage
differentiation

Acute-phase protein synthesis

Stimulation of osteoclast formation
Induction of bone resorption

Induction of platelet-derived growth factor
Proliferation of vascular smooth muscle cells

Negative inotropic effect on heart

Neural differentiation of P012 cells
Support of survival of cholinergic neurons
Induction of adrenocorticotropic hormone
synthesis

Secretion of chorionic gonadotropin from
trophoblasts

 

22

The generation of lL-6-deficient mice has provided clearer insight into the
function of lL-6. Their phenotype demonstrates the pivotal role of lL-6 in the
acute phase response (Kopf et al 1994; Fattori et al 1994; Xing et al 1998).
Furthermore, the mice show major defects in inflammatory and immune
responses, exhibiting impaired defense against many types of infections (Fattori
et al 1994; Romani et al 1996). Impaired macrophage and neutrophil responses
have been demonstrated in lL-6-deficient mice, and several studies describe a
shift from T helper cell 1 (T M) to Th2 responses (Ladel et al 1997; Romani et al
1996; Okuda et al 1999). lL-6-deficient mice are also resistant to experimental
autoimmune encephalomyelitis (Okuda et al 1998; Samoilova et al 1998; Mendel
et al 1998) and develop milder forms of experimental arthritis (Alonzi et al 1998).
These results support the notion that lL-6 functions in autoimmune and chronic
inflammatory diseases. Furthermore, IL-6-deficient mice show a reduced
production of chemokines and impaired leukocyte accumulation in local
inflammatory reactions (Romano et al 1997). Consistent with the established
role of lL-6 in plasmacytoma and myeloma growth, lL-6-deficient mice do not
develop pristine-oil-induced plasmacytomas (Lattanzio et al 1997). Conversely,
the generation of monoclonal transplantable plasmacytomas was observed in
transgenic mice overexpressing lL-6 (Suematsu et al 1992). These results

demonstrate a critical role for lL-6 In plasmacytoma development.

2.3 Transcriptional regulation

23

Kishimoto's group isolated the chromosomal genes for both human and
murine lL-6 (T anabe et al 1988; Yasukawa et al 1987). The complete human
and mouse lL-6 genes are approximately 5 kb and 7 kb in length respectively,
and both consist of five exons and four introns. The genes for human and mouse
lL-6 were mapped to chromosomes 7 and 5 respectively. Besides the sequence
similarity in the coding region, the 5’ flanking region and 3’ untranslated region
are highly conserved between the human and mouse lL-6 genes. The 3’
untranslated region contains the ATTTA sequences which are commonly
observed in the 3’ untranlated regions of mRNAs for lymphokines, cytokines and
protooncogenes, and are thought to be involved in mRNA stability (Shaw et al
1986; Conne et al 2000). The region extending about 350 bp upstream of the
transcriptional start site is highly homologous between the human and the mouse
lL-6 genes. Five known functional transcriptional control elements are identified
within this conserved region of the lL-6 promoter. There are two C/EBP binding
sites, one NF-KB binding site, one CAMP response element (CRE) and one AP-1
binding site. Each of these sites contributes differently to lL-6 induction in
response to different stimuli and in different cells. For example, LPS and
lipoarabinomannan (LAM) from the mycobacterial cell wall potently induce lL-6
gene expression in peripheral blood monocytes (Zhang et al 1994). By deletion
analysis and transient transfection assays in the human myelomonocytic
leukemia cell line THP-1, both LPS- and LAM-inducible lL-6 promoter activities
were localized to a DNA fragment at positions -158 to -49 bp, where two CIEBP

and one NF-KB site are located. Site-directed mutagenesis of one or more of

24

these sites within the IL-6 promoter demonstrated that they all have positive
regulatory activity. Deletion of all three sites abolished the inducibility of lL-6
promoter activity by both LPS and LAM, showing that the CIEBP and NF-KB sites
mediate lL-6 induction in response to both LPS and LAM. Similarly,
Liebermann’s group reported that these sites are involved in lL-6 gene activation
by prostaglandin E1, its second messenger CAMP, and by LPS in the mouse
monocytic cell line PU5—1.8 (Dendorfer et al 1994). Mutations within these
regulatory elements (AP-1, CRE, CIEBP, and NF-KB) significantly reduced, but
did not completely abrogate, the inducibility by prostaglandin E1 or its second
messenger CAMP. However, LPS-induced promoter activity was almost
completely abolished by mutations of the NF-KB site. These results suggest that
a single regulatory element is ancial for LPS lnducibility, whereas prostaglandins
and CAMP act through multiple, partially redundant regulatory elements. Thus,
the activity of at least four transcription factors is simultaneously required to
maximally induce IL-6 gene transcription upon stimulation with either CAMP or
LPS, but the contribution of each regulatory element to the transcriptional
activation of IL-6 gene appears to vary depending on the stimulus.

Several studies demonstrated that lL-6 gene expression can also be
negatively regulated at the transcriptional level. Ray et al showed that the
activated glucocorticoid receptor (GR) can bind to the CRE and CIEBP site as
well as to the basal transcription regulatory regions (TATA box and RNA start
site) in the lL-6 promoter (Ray et al 1990). This binding interfered with the

binding of positive-acting inducible and basal transcription factors, resulting in the

25

highly efficient repression of transcription by dexamethasone. Santhanam et al
showed that p53 or RB can also repress the lL-6 promoters in serum-induced
HeLa cells, suggesting that p53 and RB may be involved as transcriptional
repressors in lL-6 gene expression (Santhanam et al 1991). Although it has
been previously shown that the lL-6 KB motif functions as a potent lL-1/tumor
necrosis factor-responsive element in nonlymphoid cells, Yamamoto’s group
found that a lymphoid cell-specific nuclear factor that contains c-Rel but not p50
epitopes, termed lL-6 KB binding factor II, functions as a repressor specific for IL-
6 KB-related KB motifs in lymphoid cells (Nakayama et al 1992). More recently,
Arrnanante showed that in an lL-6-non-expressing cell line, IL-6 repression is
associated with a distinctive modification of chromatin structure, as suggested by
a decreased sensitivity of the lL-6 promoter to DNAase l relative to the lL-6-
expressing cells (Armenante et al 1999). Moreover, they showed that in lL-6-
non-expressing cells, local Chromatin remodelling at the proximal promoter of IL-
6 is inhibited by negative regulators, whose binding is suggested by two specific

footprints of nuclear factor binding that are not observed in lL-6-expressing cells.

2.4 Post-Transcriptional regulation

Although the regulation of lL-6 gene expression occurs mainly at the
transcriptional level, post-transcriptional regulation has also been described
(Elias et al 1990; Roger et al 1998; Garcia et al 1999; Winzen et al 1999;
Neininger et al 2002). The lL-6 bears an AU-rich sequence in its 3'-UTR, which

has been demonstrated to contribute to mRNA stabilization in response to pro-

26

inflammatory cytokines (Winzen et al 1999). Using a tetracycline-controlled
expression system, Winzen et al analyzed the effects of cytokine/stress-induced
signaling pathways on the half-life of lL-6 and lL-8 mRNAs (Winzen et al 1999).
They found that both transcripts were rapidly degraded in unstimulated HeLa
cells, while expression of a constitutively active form of a MAP kinase kinase
kinase (MEKK1) markedly stabilized those transcripts as well as reporter RNAs
containing the 3'-UTR sequences of lL-6 and lL-8. Furthermore, they found that
stabilization was also induced upon activation of p38 MAP kinase by expressing
its selective activator MKK6. Correspondingly, a dominant-negative form of p38
MAP kinase interfered with MKK6-induced and lL-1-induced stabilization. Finally,
an active form of MK2, a substrate kinase of p38 MAP kinase, induced
stabilization, whereas its dominant-negative mutant interfered with MKK6-induced
stabilization. Using a human lung-derived epithelial cell line, H292, Roger et al
showed that Cycloheximide (CHI), which inhibits protein synthesis by 80%, can
cause an 80-fold induction of lL-6 mRNA levels predominantly clue to a
stabilization of IL-6 mRNA (20-fold) (Roger et al 1998). Employing transient
transfection assays, they showed a small positive effect of CHI on transcription
mediated by the proximal and the distal CIEBP sites of the IL-6 promoter and
paralleled by increased CIEBP DNA-binding activity. However, this effect of CHI
on lL-6 gene transcription was transient, supporting the notion that ongoing
protein synthesis is required for CIEBP activity. Rather these findings indicate
that lL-6 mRNA superinduction is regulated predominantly by modulating the

repressive system that ensures a rapid degradation of lL-6 mRNA.

27

2.5 CIEBPs in regulation of lL-6 expression

CIEBP-binding motifs have been identified in the functional regulatory
regions of various genes involved in inflammatory and immunological response
including acute phase protein and cytokine genes (Akira et al 1992). These
include the genes for lL-6, lL-1B, TNF-oi, IL-8, lL-12, IL-4, albumin, a1-acid
glycoprotein, lysozyme, myeloperoxidase, inducible nitric oxide synthase,
neutrophil elastase, G-CSF, the macrophage, granulocyte, and granulocye-
macrophage receptor genes. Among the C/EBP members, C/EBPB has been
assigned a predominant role for the induction of proinflammatory cytokines.
Indeed, C/EBPB (NF-IL6) was originally identified as a DNA-binding protein
responsible for lL-1-stimulated IL-6 induction (lsshiki et al 1990). C/EBPB is
expressed at low or undetectable levels in all normal tissues, but It is significantly
induced by stimulation with LPS, lL-1, TNF, or lL-6. Its expression is also
dramatically induced during the differentiation of macrophages, which are a
major source of proinflammatory cytokines upon activation (Scott et al 1992;
Natsuka et al 1992). While CIEBPB is highly expressed in macrophages, it is not
expressed In lymphoblasts. Thus, lymphoblasts provide a good model system to
study the function of C/EBPB using ectopic expression. Taking advantage of
this, our lab showed that the ectopic expression of CIEBPB conferred LPS-
inducible expression of lL-6 and monocyte Chemoattractant protein 1 (MOP-1) to
lymphoblasts, which normally do not display the LPS induction of these
inflammatory cytokines (Bretz et al 1994). On the other hand, C/EBPB knockout

mice presented normal induction of lL-6 (Tanaka et al 1995; Screpanti et al

28

1995), suggesting that other CIEBP members could compensated for the lack of
C/EBPB. Indeed, Kishimoto’s group showed that C/EBP6 was consistently a
stronger transactivator of the human lL-6 promoter than C/EBPB in transient
transfection assays (Kinoshita et al 1992). In addition, they showed that C/EBP6
had a synergistic transcriptional effect with C/EBPB. Results from our lab have
shown that the ectopic expression of either CIEBPa, B, or 6 is sufficient to confer
the LPS-inducible expression of lL—6 and MOP-1 to lymphoblasts (Hu et al 1998).
These results suggest that C/EBPa, 8, and 6 are redundant in regard to the
expression of lL-6. Furthermore, we have shown that C/EBPy and C/EBPC; also

participate in the regulation of IL-6 in lymphoblasts (Chapter 2 and 3).

2.6 Other cooperating transcription factors

A number of different transcription factors such as NF-KB, AP-1, CREB,
STATs, PU.1, Myb, and Glucocorticoid receptor have been reported to physically
and functionally interact with CIEBP family members, in particular with C/EBPB.
Among those, the interactions with members of the NF-KB family of transcription
factors are well studied (Stein et al 1993; LeClair et al 1992). NF-KB was
originally characterized as a immunoglobulin enhancer DNA-binding protein. It
is a dimer of members of the rel family of proteins (reviewed by Kopp et al 1995
and Verrna et al 1995). So far, six members have been identified in this family.
They are: c-Rel (v-rel), dorsal, p50 (p105), p52 (p100), ReIA (p65) and ReIB.
Each family member contains an N-terminal 300 amino acid conserved region

known as the rel homology domain (RHD). This region is responsible for DNA-

29

binding, dimerization, and interaction with IKB family members. It also contains a
nuclear localization sequence. Although the amino-terminal regions of NF-KB
members are highly conserved and perform similar functions, the carboxy
terminals of these proteins differ significantly. For example, the p50 protein has
very little carboxyl terminal sequence apart from the RHD, and lacks
transcriptional activity. RelA harbors transcription-activating domains in its C-
tenninal portion. Apart from forming homodimers, most NF-KB family members
can form heterodimers with each other, but each individual member or
heterodimer complex may differ in DNA-binding specificity and transcription
activity for a particular KB site (Liou et al 1993). It is now known that NF-KB
preexists in the cytoplasm of most cells in an inactive form bound to the inhibitor,
IKB. Upon receipt of an appropriate signal, NF-KB is released from IKB and
translocates to the nucleus where it can upregulate transcription of specific
genes. NF-KB is involved in the regulation of many genes activated during
inflammatory, immune and acute phase responses. Binding sites for NF-KB have
been identified in the promoter region of several cytokine genes including lL-6
and IL-8, acute phase response genes, and several viral enhancers including
HIV-1. For example, by site-directed mutagenesis, it was shown that the NF-KB
site (positions -173 to -151) was the key lL-1B and TNF-a responsive element on
lL-6 promoter in U-937 monocytic cells and in HeLa cells (Libennann et al 1990).
Employing adenoviral-mediated gene delivery of a nondegradable IKBa, Pope’s
group (Georganas et al 2000) showed that inhibition of NF-KB activation

significantly reduced the spontaneous and IL-1B-induced secretion of lL-6 by

30

rheumatoid arthritis (RA) fibroblast-like synoviocytes (FLS) and human dermal
fibroblasts. In contrast, inhibition of C/EBPB with a dominant negative version of
CIEBP modestly reduced constitutive and lL-1B-induced lL-6 by RA FLS, but not
by human dermal fibroblasts. Inhibition of C-Jun/AP-1 with a dominant negative
had no effect on the production of IL-6. Fibroblasts in which both NF-KB p50/p65
genes were deleted failed to express lL-6 in response to lL-1. These findings
document the dominant role of NF-KB for the regulation of the lL-6 expression by
RA FLS. On the other hand, adjacent C/EBP and NF-KB motifs are found in the
promoters of many AP class I genes that require both lL-1 and lL-6 for their
induction, as well as those of several cytokine genes. These suggest that
cooperative interaction between these two families of transcription factors may
represent a general mechanism of coordinating transcriptional response ro
different stimuli. Indeed, synergistic activation by CIEBP and NF-KB members
has been demonstrated for the genes encoding the acute phase proteins serum
amyloid A1, A2, A3, a1 -acid glycoprotein and C-reactive protein, as well as the
cytokines IL-6, IL-8, lL-12, and the G-CSF (Ray et al 1995; Li et al 1992; Betts et
al 1993; Agrawal et al 2001; Matsusaka et al 1993; Plevy et al 1997; Dunn et al
1994; Lee et al 1996; and Vietor 1996). In regard to IL-6, it has also been shown
that both the C/EBP and NF-KB binding sites are required for synergistic
activation (Matsusaka et al 1993). In contrast, C/EBP and NF-KB interactions
can also lead to antagonistic effects (Stein et al 1993; Braiser et al 1990). For
example, cross-coupling between NF-KB and C/EBPot, C/EBPB, or C/EBP6

results in the inhibition of a promoter with a KB enhancer motif and the

31

synergistic stimulation of promoters with C/EBP binding sites (Stein et al 1993).
This suggests that distinct mechanisms involving synergism and cooperativity as
well as competition between CIEBP and NF-KB may contribute to the regulation
of gene expression. They also suggest that promoter architecture and specific
cell type are likely to play a major role. Although the mechanisms responsible for
cooperative effects have not yet been entirely Clarified, it has been shown that
productive interaction requires the integrity of both the NF-KB rel homology
domain and the CIEBP leucine zipper motif (LeClair et al 1992). Increased
affinity of CIEBP and NF—KB for their respective sites has been demonstrated
(Ruocco et al 1996; Stein et al 1993), and DNA-protein complexes containing
both proteins have been detected using both CIEBP sites and NF-KB sites (Ray
et al 1995; Ruocco et al 1996; Vietor et al 1996). Data from our lab have also
shown that NF-KB DNA binding activity is induced by LPS stimulation (Hu et al
1998), and that ReIA (p65) can replace LPS to cooperate with C/EBPB in
transactivation of IL-6 expression (Gao et al in press). Furthermore, studies in
the Schwartz lab found that although C/EBP activity is essential to lL-6
expression, CIEBP activity is dependent upon an intact NF-KB binding site (Hu et
al 2000). This suggests that C/EBP stimulatory activity is dependent upon
synergy with NF-KB in lymphoblasts. Another example of CIEBP interaction with
other transcription factors is that between C/EBP and the glucocorticoid receptor
(GR) or the estrogen receptor (ER). It has been shown that glucocorticoid
hormones (GHs) and estrogen downregulate the expression of IL-6 and IL-8 by a

direct interaction between C/EBP or NF-KB and the GR or ER (Ray et al 1994a,

32

b; Scheinman et al 1995; Stein et al 1995). It is also demonstrated that the
physical and functional interaction depends on the DNA-binding domain of the
GR or ER and on the RHD of NF-KB or the bZIP region of C/EBPB.

Taken together, these results suggest that the combinatorial effects of
CIEBPs with various other transcription factors are very important in considering
the role of C/EBPs in the regulation of pro-inflammatory cytokine gene

expression.

3. Transcription factors of pre-B and B cells
3.1 B cell development

The developmental process that results in generation of functional plasma
cells can be divided into three stages: generation of mature, immunocompetent
B cells (maturation), activation of mature B cells by interaction with antigen, and
differentiation of activated B cells into plasma cells. B-cell maturation, which
occurs in the bone marrow, involves an orderly sequence of Immunoglobulin (lg)-
gene rearrangements and progresses in the absence of antigen. This stage is
the antigen-independent phase. A mature B cell expressing membrane-bound
immunoglobulin (mlgM and mlgD) leaves the bone marrow to enter the blood
and lymph. When these naive B cells are activated by interacting with the
antigen for which its membrane-bound antibody is specific, they undergo
proliferation and differentiation, generating a population of antibody-secreting
plasma cells and memory B cells. These two stages are the antigen-dependent

phase.

33

A number of transcription factors that regulate expression of various gene
products at different stages of B-cell development have been identified (reviewed
by Glimcher and Singh, 1999). Here, I will briefly summarize the functions or
status of CIEBPs, NF-KB, and AP-1, which in addition to their roles in B

Iymphopoiesis, have been shown to regulate the lL-6 transcription.

3.2 CIEBPs

CIEBP binding sites have been shown to be functionally important in Ig
heavy Chain (lgH) variable region (VH) promoters (Cooper et al 1992), the lgH
intronic enhancer (Tsao et al 1988), the K intronic enhancer (Sen et al 1986), and
the y 1 germ-line promoter (Xu et al 1992). By using B cell lines at various
development stages and normal splenic B cells, Cooper et al showed that
expression of CIEBPs is limited and regulated during B cell development (Cooper
et al 1994). They found that C/EBPB and C/EBPy were the major regulators of
CIEBP site-dependent transcriptional activity in B cells. In early B cells, C/EBPy
was predominantly present. C/EBPB increased in more mature B cells and was
induced by LPS activation of splenic B cells although its RNA was virtually
undetectable in proB and preB lines. These results suggest that the CIEBP motif
functions as an activator site in mature B cells, implying a role in increased lg
expression and regulation of class switching. The significance of high C/EBPy
levels in early B cells where C/EBPB expression is low has remained a puzzle.
The ability of C/EBPy to inhibit C/EBPB activation of artificial promoters in

transient transfections suggested that it may act as a buffer to C/EBPB activity in

34

Immature cells (Cooper et al 1994 and Cooper et al 1995). Our results showed
that ClEBPy can augment C/EBPB stimulatory activity in the LPS induction of IL-6
expression in P388 lymphoblast cells. IL-6 is essential for the B cell
differentiation and C/EBPy may participate in autocrine lL-6 production. This may
be particularly important in the absence of T cell help in T-independent
responses to gram-negative bacteria. The notion that C/EBPB and y may play
more of a role in B cell maturation than in the function of mature cells is
supported by the work of Sun and co-workers, who reported that C/EBPB is a
component of the two major pro-B-celI-specific enhancer (PBE)—binding complex
of the ld1 gene, a gene which encodes a protein that acts as a negative regulator
in early-B-cell differentiation by antagonizing the function of the basic helix-loop-
helix transcription factors (Saisanit and Sun, 1997). In contrast to the situation in
pro-B cells, they found that C/EBPB is bound to CIEBPQ and thus inactivated in
mature B cells. This suggests that C/EBP proteins, by forming a pro-B-cell-
specific active complex or a mature-B-cell-specific inactive complex, may play an
important role in the regulation of B-cell development. More evidence for the
function of C/EBPB in B cell development comes from the analysis of knock-out
mice. The C/EBPB-I- mice show a Iymphoproliferative disorder, similar to
Castleman’s Disease, where high circulating levels of lL-6 lead to expansion of
mature germinal center B cells and splenomegaly and peripheral lymph node
enlargement (Screpanti et al 1995). At the same time there is impaired B cell
differentiation with impaired expansion of bone marrow B lymphocytes and

reduced proliferative responsiveness of B-Cell precursors to lL-7 (Chen et al

35

1997). Thus, while C/EBPB may have a positive role in activated B cells where

its expression is highest, it clearly also has a critical function in B Iymphopoiesis.

NF-KB

B cell differentiation is dependent upon the programmed expression of Ig
heavy (p) and light chain loci (K or k) (eviewed by Gorman and Alt 1998). This
developmental program is regulated primarily at the level of gene expression by
the action of transcription factors, including NF-KB. In most cells including pre-B
cells, NF-KB is maintained in an inactive form bound to the inhibitor, IKB, in
cytoplasm. In contrast, mature B cells constitutively express nuclear NF-KB,
primarily in the form of a c-ReI/p50 heterodimer (Liou et al 1994; Grumont et al
1994). This constitutive NF-KB activity is believed to play a critical role in the
development of B lymphocytes because it controls stage-specific expression of
genes such as IgK (Sen et al 1986; Scherer et al 1996), Oct-2 (Bendall et al
1997) and c—Rel itself (Grumont et al 1993). In addition, NF-KB activity has been
implicated in promoting the survival of splenic B cells (Bendall et al 1999; Wu et
al 1996), as well as the capacity of B cells to proliferate (Kontgen et al 1995; She
et al 1995). Despite these findings, the biochemical mechanisms that lead to
constitutive NF-KB activation in mature B cells remain largely undefined. Several
mechanisms have been suggested, including the enhanced degradation of IKBa
and/or IKBB by the proteasome pathway (Schauer et al 1998; Kistler et al 1998),
and resynthesis of a new hypophosphorylated IKBB which facilitate transport of a

portion of NF-KB to the nucleus in a manner that protects it from cytosolic IKBa

36

(Phillips et al 1997). Recently, a calcium-dependent protease calpain
mechanism has been suggested to cause IKBot degradation (Fields et al 2000).
Analyses of B cells derived from different knock-out animals reveal that NF-KB is
a mediator in numerous pathways that regulate B cell activation and proliferation,
including those pathways responding to Ilipopolysacharride (LPS), CD40 ligand,
and antigen-receptor cross-linking; it is also indispensable in isotype switching

(Reviewed by Gerondakis et al 2000).

3.4 AP-1

AP-1 is a collection of sequence-specific transcriptional activators composed
of members of the Jun and Fos families (Reviewed by Shaulian and Karin 2001).
So far, seven members of AP-1 have been isolated. They are: C-Fos, FosB, Fra-
1, Fra-2, C-Jun, JunB and Jun D. Like CIEBPs, AP-1 members also belong to
the bZIP superfamily of DNA binding proteins. Fos and Jun proteins can form
heterodimers, but only Jun proteins can form homodimers (Angel et al 1991).
Since its discovery, the AP-1 family has been demonstrated to be induced by a
diverse range of stimuli and to play Important roles in many cellular processes,
such as cell proliferation, cell transformation, oncogenesis, and cell differentiation
(Angel et al 1991; Shaulian and Karin 2001). AP-1 has also been shown to be
an important regulator of nuclear gene expression in leukocytes (reviewed by
Foletta et al 1998). In B cells, AP-1 complexes have been shown to transactivate
the kappa light chain promoter (Schanke et al 1994) and the lg heavy Chain gene

(Grant et al 1995), suggesting that AP-1 is involved in immunoglobulin production

37

and class switching (Ruther et al 1988; Grant et al 1995). AP-1 was also shown
to play a role in B cell development by using bone marrow cells from two different
transgenic mice carrying exogenous C-fos genes controlled by either the
promoter of the H-2Kb gene (H2-c-fos) or the interferon alpha/beta (IF N)-
inducible Mx gene (Mx-c-fosD) (lmoto et al 1996). lmoto et al found that
development of B lineage cells was retarded in bone marrow cell cultures from
H2-c-fos mice. Although B lineage cells developed normally in bone marrow cell
cultures from Mx-C-fosD mice in the absence of IFN stimulation, their
development was completely blocked in the Mx-C-fosD culture when transgenic
c-fos was induced in BM cells by IFN stimulation. Furthermore, lL-7—dependent
proliferation of B lineage cells in Mx-C-fosD bone marrow cultures was also
suppressed by the induction of c-Fos. These results suggest that the c-Fos plays
a role as a negative regulator in the early B cell development. Beyond these
studies, the role of AP-1 in B cell development and activation remains to be

determined.

4. Objectives for this thesis

C/EBPB and C/EBP6 have been implicated in the regulation of
proinflammatory cytokines as well as other gene products associated with the
activation of macrophages and the acute phase inflammatory response
(reviewed by Poll 1998). We have previously demonstrated that the stable
expression of C/EBPa, B, 6 and e in a B lymphoblast cell line is sufficient to

confer lipopolysaccharide (LPS) inducibility of IL-6 and monocyte

38

Chemoattractant protein 1 (MCP-l) expression (Bretz et al 1994; Hu et al 1998;
Williams et al 1998). We also found that CIEBPB is overwhelmingly present as a
heterodimer with C/EBPy in B lymphoblasts dependent upon C/EBPB for LPS-
induced lL-6 expression (Hu et al 2000). These observations as well as the
widespread occurrence of C/EBP82y heterodimers (Parkin et al 2002) led us to
explore further the role of C/EBPy in regulating lL-6 transcription. This part of the
study is described in Chapter 2.

C/EBPQ was originally identified as a gene induced upon DNA damage and
growth arrest. It has been shown to be involved in the cellular response to
endoplasmic reticulum stress. Because of sequence divergence from other
CIEBP family members in its DNA binding domain and its consequent inability to
bind the CIEBP consensus-binding motif, C/EBPQ can act as a dominant
negative inhibitor of other CIEBPs. CIEBP transactivators are essential to the
expression of many proinflammatory cytokines and acute phase proteins, but a
role for C/EBPQ in regulating their expression has not been described. We have
found that expression of C/EBPQ is induced in response to LPS treatment of B
cells at both the mRNA and protein levels. Correlating with the highest levels of
C/EBPQ expression at 48 hours after LPS treatment, both the abundance of
C/EBP DNA binding species and lL-6 expression are downregulated. These
results suggest that C/EBPQ functions as negative regulator of IL-6 expression in

B cells. This question was addressed in Chapter 3.

39

References

Agrawal A., H. Cha-Molstad, D. Samols and l. Kushner. 2001. Transactivation of
C-reactive protein by IL-6 requires synergistic interaction of CCAAT/enhancer
binding protein beta (CIEBP beta) and Rel p50. J Immunol. 166: 2378-84.

Agre, P., P. F. Johnson and S. L. McKnight. 1989. Cognate DNA binding
specificity retained after leucine zipper exchange between GCN4 and CIEBP.
Science 234: 922-6.

Akira, S., H. Isshiki, T. Sugita, O. Tanabe, S. Kinoshita, Y. Nishio, T. Nakamima,
T. Hirano and T. Kishimoto. 1990. A nuclear factor for lL-6 expression (NF-IL6) is
a member of a C/EBP family. EMBO J. 9: 1897-906.

Akira, S. and T. Kishimoto. 1992. IL-6 and NF-lL-6 in acute-phase response and
viral infection. Immunol. Rev. 127: 25-50.

Akira, S., T. Taga and T. Kishimoto. 1993. Interleukin-6 in biology and medicine.
Adv. Immunol. 54: 1-78.

Akira, S. and T. Kishimoto. 1998. lL-6 and NF-IL6 in acute-phase response and
viral infection. Immunol. Rev. 127:25-50.

Alberini, C.M., M. Ghirardi, R. Metz and E. R. Kandel. 1994. CIEBP is an
immediate-early gene required for the consolidation of long-term facilitation in
Aplysia. Cell. 76: 1099-114.

Alonzi, T., E. Fattori, D. Lazzaro, P. Costa, L. Probert, G. Kollias, F. De
Benedetti, V. Poli and G. Ciliberto. 1998. Interleukin 6 is required for the
development of collagen-induced arthritis. J. Exp. Med. 187: 461-8.

Angel, P. and M. Karin. 1991. The role of Jun, Fos and the AP-1 complex in cell-
proliferation and transformation. Biochim Biophys Acta. 1072: 129-57.

Antonson, P. and K. G. Xanthopoulos. 1995. Molecular cloning, sequence and
expression patterns of the human gene encoding CCAAT/enhancer binding
protein a (C/EBPoi). Biochem. Biophys. Res. Commun. 215: 106-13.

Antonson, P., B. Stellan, R. Yamanaka and K. G. Xanthopoulos. 1996. A novel
human CCAAT/enhancer binding protrein gene, CIEBP epsilon, is expressed in
cells of lymphoid and myloid lineages and is localized on chromosome 14q11.2
close to the T-Cell receptor alpha/delta locus. Genomics 35: 30-8.

40

Arrnenante, F., M. Merola, A. Furia, M. Tovey and M. Palmleri. 1999. Interleukin-
6 repression is associated with a distinctive chromatin structure of the gene.
Nucleic Acids Res. 27: 4483-90.

Artandi, SE, C. Cooper, A. Shrivastava and K. Calame. 1994. The basic helix-
Ioop-helix-zipper domain of TFE3 mediates enhancer-promoter interaction. Mol.
Cell Biol. 14: 7704-16.

Barone, M.V., A. Crozat, A. Tabaee, L. Philipson and D. Ron. 1994. CHOP
(GADD153) and its oncogenic variant, TLS-CHOP, have opposing effects on the
induction of G1/S arrest. Genes & Dev. 8: 453-64.

Bartlett, J., J. Luethy, S. Carlson, S. Sollott and N. Holbrook. 1992. Calcium
ionophore A23187 induces expression of the growth arrest and DNA damage
inducible CCAAT/enhancer-binding protein (ClEBP)-related gene, gadd153. J
Biol Chem. 267: 20465-70.

Bendall, H. H., D. C. Scherer, C. R. Edson, D. W. Ballard and E. M. Oltz. 1997.
Transcription factor NF'ICB regulates inducible Oct-2 gene expression in
precursor B lymphocytes. J. Biol. Chem. 272: 28826-8.

Bendall, H. H., M. L. Sikes, D. W. Ballard and E. M. Oltz. 1999. An intact NF-nB
signaling pathway is required for maintenance of mature B cell subsets. Mol.
Immunol. 36: 187-95.

Betts, J. C., J. K. Cheshire, S. Akira, T. Kishimoto and P. Woo. 1993. The role of
NF-kappa B and NF-IL6 transactivating factors in the synergistic activation of

human serum amyloid A gene expression by interleukin-1 and interleukin-6. J.
Biol. Chem. 268, 25624-31.

Birkenmeier, E. H., B. Gwynn, S. Howard, J. Jerry, J. l. Gordon, W. H.
Landschulz and S. L. McKnight. 1989. Tissue-specific expression, developmental
regulation, and genetic mapping of the gene encoding CCAAT/enhancer binding
protein. Genes Dev. 3:1146-56.

Boulton, T. G., N. Stahl and G. D. Yancopoulos. 1994. Ciliary neurotrophic
factor/leukemia inhibitory factor/interieukin 6/oncostatin M family of cytokines
induces tyrosine phosphorylation of a common set of proteins overlapping those
induced by other cytokines and growth factors. J Biol Chem. 269: 11648-55.

Braciak, T. A., J. Gauldie, G. H. Fey and W. Northemann. 1991. The expression
of interleukin-6 by a rat macrophage-derived cell line. F EBS Lett. 280: 277-80.

Brasier, A. R., D. Ron, J. E. Tate and J. F. Habener. 1990. A family of
constitutive CIEBP-like DNA binding proteins attenuate the lL-1 alpha induced,

41

NF kappa B mediated trans-activation of the angiotensinogen gene acute-phase
response element. EMBO J. 9: 3933-44.

Bretz, J. D., S. C. Williams, M. Baer, P. F. Johnson and RC. Schwartz. 1994.
CIEBP-related protein 2 confers lipopolysaccharide-inducible expression of
interleukin 6 and monocyte Chemoattractant protein 1 to a lymphoblastic cell line.
Proc. Natl. Acad. Sci. USA 91: 7306-10.

Brewer, J. W., J. L. Cleveland and L. M. Hendershot. 1997. A pathway distinct
from the mammalian unfolded protein response regulates expression of
endoplasmic reticulum chaperones in non-stressed cells. EMBO J. 16: 7207-16.

Bruhat, A., C. Jousse, X. Z. Wang, D. Ron, M. Ferrara and F. Fafoumoux. 1997.
Amino acid limitation induces expression of Chop, a CCAAT/enhancer binding

protein related gene at both transcriptional and post-transcriptional levels. J. Biol.
Chem. 272: 17588-93.

Buck, M., V. Poli, T. Hunter and M. Chojlier. 2001. C/EBPbeta phosphorylation
by RSK creates a functional XEXD caspase inhibitory box critical for cell survival.
Mol. Cell. 8: 807-16.

Buck, M., V. Poli, P. van der Geer, M. Chojkier and T. Hunter. 1999.
Phosphorylation of rat serine 105 or mouse threonine 217 in CIEBP beta is
required for hepatocyte proliferation induced by TGF alpha. Mol Cell. 4: 1087-92.

Buck, M., L. Zhang, N. A. Halasz, T. Hunter and M. Chojkier. 2001. Nuclear

export of phosphorylated C/EBPB mediates the inhibition of albumin expression
by TNF- . EMBO J. 20: 6712-23.

Calkhoven, C. F. and J. Wijnholds. 1992. cC/EBP, a chicken transcription factor
of the leucine-zipper C/EBP family. Nucleic Acids Res. 20: 4093-99.

Cao, Z., R. M. Umek and S. L. McKnight. 1991. Related expression of three
CIEBP isoforrns during adipose conversion of 3T3-L1 cells. Genes Dev. 5: 1538-
52.

Carlson, S. G., T. W. Fawcett, J. D. Bartlett, M. Bernier and N. J. Holbrook. 1993.
Regulation of the CIEBP-related gene, gadd153, by glucose deprivation. Mol.
Cell. Biol. 13: 4736-44.

Chang, C. J., T. T. Chen, H. Y. Lei, D. S. Chen and S. C. Lee. 1990. Molecular
Cloning of a transcription factor, AGP/EBP, that belongs to members of the
CIEBP family. Mol. Cell Biol. 10: 6642-53.

Chen, P. L., D. J. Riley, Y. Chen and W. H. Lee. 1996. Retinoblastoma protein
positively regulates terminal adipocyte differentiation through direct interaction

42

with CIEBPs. Genes Dev. 10: 2794-804.

Chen, 0., K. Yu, N. J. Holbrook and J. L. Stevens. 1992. Activation of the growth
arrest and DNA damage-inducible gene gadd153 by nephrotoxic cysteine
conjugates and dithiothreitol. J. Biol. Chem. 267: 8207-12.

Chen, X., W. Liu, C. Ambrosino, M. R. Ruocco, V. Poli, L. Romani, I. Ouinto, S.
Barbieri, K. L. Holmes, S. Venuta and G. Scala. 1997. Impaired generation of
bone marrow B lymphocytes in mice deficient in C/EBPB. Blood 90: 156-64.

Chen, Y., H. Hu and B. G. Atkinson. 1994. Characterization and expression of
C/EBP-Iike genes in the liver of Rana catesbeiana tadpoles during spontaneous
and thyroid hormone-induced metamorphosis. Dev. Genetics. 15: 366-77.

Chumakov, A. M., Grillier, E. Chumakova, D. Chih, J. Slater, and H. P. Koeffler.
1997. Cloning of the novel human myeloid-ceII-specific CIEBPs transcription
factor. Mol. Cell. Biol. 17: 1375-86.

Conne, B., A. Stutz and J. D. Vassalli. 2000. The 3' untranslated region of
messenger RNA: A molecular 'hotspot' for pathology? Nat. Med. 6: 637-41.

Cooper, C., D. Johnson, C. Romain, N. Avitahl, P. Tucker and K. calame. 1992.
The C/EBP family of transcriptional activators is functionally important for lg VH
promoter activity in vivo and in vitro. J. Immunol. 149: 3225-31.

Cooper, C. L., A. L. Berrier, C. Roman and K. L. Calame. 1994. Limited
expression of CIEBP family proteins during B-lymphocyte development-negative
regulator IG/EBP predominates early and activator NF-lL-6 is induced later. J.
Immunol. 53: 5049-58.

Cooper, 0., A. Henderson, S. Artandi, N. Avitahl and K. Calame. 1995. IgIEBP

(C/EBPy) is a transdominant negative inhibitor of C/EBP family transcriptional
activators. Nucleic Acids Res. 23: 4371-77.

Coutts, M., K. Cui, K. L. Davis, J. C. Keutzer and A. J. Sytkowski. 1999.
Regulated expression and functional role of the transcription factor CHOP
(GADD153) in erythroid growth and differentiation. Blood 93: 3369-78.
Cressman, D. E., L. E. Greenbaum, R. A. DeAngelis, G. Ciliberto. E. E. Furth, V.
Poll and R. Taub. 1996. Liver failure and defective hepatocyte regeneration in
interleukin-6-deficient mice. Science. 274: 1379-83.

Crozat, A., P. Aman, N. Mandahl and D. Ron. 1993. Fusion of CHOP to a novel
RNA-binding protein in human myxoid liposarcoma. Nature 363: 640-4.

Davydov, I. V., D. Bohmann, P. H. Krammer and M. Li-Weber. 1995. Cloning of

43

the cDNA encoding human C/EBP- , a protein binding to the PRE-l enhancer
element of the human interleukin-4 promoter. Gene 161: 271-5.

Dendorfer, U., P. Oettgen and T. A. Liberrnann. 1994. Multiple regulatory
elements in the interleukin-6 gene mediate induction by prostaglandins, cyclic
AMP, and Iipopolysaccharide. Mol Cell Biol. 14: 4443-54.

Descombes, P., M. Chojkier, S. Lichtsteiner, E. Falvey and U. Schibler. 1990.
LAP, a novel member of the C/EBP gene family, encodes a liver-enriched
transcriptional activator protein. Genes Dev. 4: 1541-51.

Descombes, P. and U. Schibler. 1991. A liver-enriched transcriptional activator
protein LAP and a transcriptional inhibitory protein LIP are translated from the
same mRNA. Cell 67: 569-79.

Donnelly, R.P., L. J. Crofford, S. L. Freeman, J. Buras, E. Remmers, R. L. Wilder
and M. J. Fenton. 1993. Tissue-specific regulation of lL-6 production by lL-4.
Differential effects of lL-4 on nuclear factor-kappa B activity in monocytes and
fibroblasts. J Immunol. 151: 5603-12.

Dunn, S. M., L. S. Coles, R. K. Lang, S. Gerondakis, M. A. Vada and M. F.
Shannon. 1994. Requirement for nuclear factor (NF)-kappa B p65 and NF-
interleukin-6 binding elements in the tumor necrosis factor response region of the
granulocyte colony-stimulating factor promoter. Blood 83: 2469-79.

Elias, J. A. and V. Lentz. 1990. lL-1 and tumor necrosis factor synergistically
stimulate fibroblast lL-6 production and stabilize IL-6 messenger RNA. J.
Immunol. 145: 161-6.

Fattori, E., M. Cappelletti, P. Costa, C. Sellitto, L. Cantoni, M. Carelli, R.
Faggioni, G. Fantuzzi, P. Ghezzi and V. Poli. 1994. Defective inflammatory
response in interleukin 6-deficient mice. J. Exp. Med. 180: 1243-50.

Fields, E. R., B. J. Seufzer, E. M. Oltz and S. Miyamoto. 2000. A switch in distinct
I kappa B alpha degradation mechanisms mediates constitutive NF-kappa B
activation in mature B cells. J Immunol. 164: 4762-7.

Foletta, V. C., D. H. Segal and D. R. Cohen. 1998. Transcriptional regulation in
the immune system: all roads lead to AP-1. J LeukoC Biol. 63: 139-52.

Fomace, A. J., Jr., I. Alamo, Jr. and M. C. Hollander. 1988. DNA damage-
inducible transcripts in mammalian cells. Proc. Natl. Acad. Sci. 85: 8800-4.

Friedman, A. D. and S. L. McKnight. 1990. Identification of two polypeptide

segments of CCAAT/enhancer-binding protein required for transcriptional
activation of the serum albumin gene. Gene Dev. 4: 1416-26.

44

Gao, H. W., S. Parkin, P. F. Johnson, and R. C. Schwartz. 2002. C/EBPy has a
stimulatory role on the IL-6 and lL-8 promoters. J. Biol. Chem. in press.

Georganas, C., H. Liu, H. Perlman, A. Hoffmann, B. Thimmapaya and R. M.
Pope. 2000. Regulation of lL-6 and lL-8 expression in rheumatoid arthritis
synovial fibroblasts: the dominant role for NF-kappa B but not C/EBP beta or 0-
Jun. J Immunol. 165: 7199-206.

Gorman, J. R. and F. W. Alt. 1998. Regulation of immunoglobulin light Chain
isotype expression. Adv Immunol. 69: 113-81.

Grant, P. A., C. B. Thompson and S. Pettersson. 1995. lgM receptor-mediated
transactivation of the lgH 3' enhancer couples a novel Elf-1-AP-1 protein complex
to the developmental control of enhancer function. EMBO J. 14: 4501-13.

Greenbaum, L. E., W. Li, D. E. Cressman, Y. Peng, G. Ciliberto. V. Poll and R.
Taub. 1998. CCAAT enhancer-binding protein beta is required for normal

hepatocyte proliferation in mice after partial hepatectomy. J Clin Invest. 102:
996-1007.

Grumont, R. J., I. B. Richardson, C. Gaff and S. Gerondakis. 1993. rel/NF-KB
nuclear complexes that bind «:8 sites in the murine c-rel promoter are required for
constitutive c-rel transcription in B-cells. Cell Growth Differ. 4: 731-43.

Grumont, R. J. and S. Gerondakis. 1994. The subunit composition of NF-kappa B
complexes Changes during B-cell development. Cell Growth Differ. 5: 1321-31.

Gugasyan, R., R. Grumont, M. Grossmann, Y. Nakamura, T. Pohl, D. Nesic and
S. Gerondakis. 2000. Rel/NF-kappaB transcription factors: key mediators of B-
cell activation. Immunol Rev. 176: 134-40.

Halleck, M., N. Holbrook, J. Skinner, H. Liu, and J. Stevens. 1997. The molecular
response to reductive stress in LLC-PK1 renal epithelial cells: Coordinate
transcriptional regulation of gadd153 and grp78 genes by thiols. Cell Stress
Chaperones 2: 31-40.

Hirano, T. 1998. Interleukin 6 and its receptor: ten years later. Int. Rev.
lmmunol.16: 24.

Hu, H.-M., M. Baer, S. C. Williams, P. F. Johnson and R. C. Schwartz. 998.

Redundancy of CIEBPa, -8, and -6 in supporting the Iipopolysaccharide-induced
transcription of lL-6 and monocyte Chemoattractant protein-1. J. Immunol. 160:
2334-42.

45

Hu, H.-M., Q. Tian, M. Baer, C. J. Spooner, S. C. Williams, P. F. Johnson and R.
C. Schwartz. 2000. The C/EBP bZIP domain can mediate Iipopolysaccharide
induction of the proinflammatory cytokines interleukin-6 and monocyte
Chemoattractant protein-1. J. Biol. Chem. 275:16373-81.

Hurst, H. C. 1995. Transcription factors 1: bZIP proteins. Protein profile. 2: 101-
68.

lmoto, S., L. Hu, Y. Tomita, J. Phuchareon, U. Ruther and T. Tokuhisa. 1996. A
regulatory role of c-Fos in the development of precursor B lymphocytes mediated
by interleukin-7. Cell Immunol. 169: 67-74.

Isshiki, H., S. Akira, O. Tanabe, T. Nakajima, T. Shimamoto, T. Hirano and T.
Kishimoto. 1990. Constitutive and interleukin-1 (lL-1)-inducible factors interact
with the IL-1-responsive element in the IL-6 gene. Mol. Cell Biol. 10: 2757-64.

Jain, N., T. Zhang, W .H. Kee, W. Li and X. Cao. 1999. Protein kinase C delta
associates with and phosphorylates Stat3 in an interleukin-6-dependent manner.
J Biol Chem. 274: 24392-400.

Johnson, P. F.. 1993. Identification of basic region residues involved in DNA
sequence recognition and half-site spacing preference. Mol. Cell. Biol.13: 6919-
30.

Kaestner, K. H., Christy, R. J. and Lane, M. D. 1990. Mouse insulin-responsive
glucose transporter gene: Characterization of the gene and trans-activation by
CCAAT/enhancer binding protein. Proc. Natl. Acad. Sci. USA 87: 251-5.

Kaisho, T., H. Tsutsui, T. Tanaka, T. Tsujimura, K. Takeda, T. Kawai, N.
Yoshida, K. Naakanishi and S. Akira. 1999. lmpairrnent of natural killer cytotoxic
activity and interferon production in CCAAT/enhancer binding protein -
deficient mice. J. Exp. Med. 190: 1573-81.

Katz, S., E. Kowenz-Leutz, C. Muller, N. Meese, S. A. Ness and A. Leutz. 1993.
The NF-M transcription factor is related to C/EBPB and plays a role in signal

transduction, differentiation and leukemogenesis of avian myelomonocytic cells.
EMBO J.12: 1321-32.

Kawano, S., A. F. Gombart and Y. Hisatake. 1999. TOR-mediated proliferation of
T-Cells is severely impaired in C/EBP epsilon knockout mice. Blood. 94: 370-80.

Kinoshita, S., S. Akira and T. Kishimoto. 1992. A member of the CIEBP family,
NF-ILGB, forms a heterodimer and transcriptionally synergizes with NF-IL6. Proc.
Natl. Acad. Sci. USA 89: 1473-6.

Kishimoto, T., S. Akira and T. Taga. 1992. Interleukin-6 and its receptor: a

46

paradigm for cytokines. Science 258: 593-7.

Kistler, B., A. Rolink, R. Marienfeld, M. Neumann and T. Wirth. 1998. Induction of
nuclear factor-KB during primary B cell differentiation. J. Immunol. 160: 2308-17.

Kopf, M., H. Baumann, G. Freer, M. Freudenberg, M. Lamers, T. Kishimoto, R.
Zinkemagel, H. Bluethmann and G. Kohler. 1994. Impaired immune and acute-
phase responses in interleukin-6-deficient mice. Nature 368: 339-42.

Kopp, E. and S. Ghosh. 1995. NF- B and rel proteins in innate immunity. Adv.
Immunol. 58: 1-27.

Kontgen, F.. R. J. Grumont, A. Strasser, D. Metcalf, R. Li, D. Tarlinton and S.
Gerondakis. 1995. Mice lacking the c-rel proto-oncogene exhibit defects in

lymphocyte proliferation, humoral immunity, and interleukin-2 expression. Genes
Dev. 9: 1 965-77.

Ladel, C. H., C. Blum, A. Dreher, K. Reifenberg, M. Kopf, S. H. Kaufmann. 1997.
Lethal tuberculosis in interleukin-6-deficient mutant mice. Infect lmmun. 65:
4843-9.

Landschulz, W. H., P. F. Johnson, E. Y. Adashi, B. J. Graves and S. L. McKnight.
1988. Isolation of a recombinant copy of the gene encoding CIEBP. Genes Dev.
2: 786-800.

Landschulz, W. H., P. F. Johnson and S. L. McKnight. 1988. The leucine zipper:
a hypothetical structure common to a new class of DNA binding proteins.
Science 240: 1759-64.

Lattanzio, G, C. Libert, M. Aquilina, M. Cappelletti, G. Ciliberto. P. Musiani and V.
Poli. 1997. Defective development of pristane-oil-induced plasmacytomas in
interleukin-6-deficient BALB/c mice. Am J Pathol. 151: 689-96.

LeClair, K. P., M. A. Blanar and P. A. Sharp. 1992. The p50 subunit of NF-kappa
B associates with the NF-IL6 transcription factor. Proc. Natl. Acad. Sci. USA. 89:
8145-9.

Lee, Y. M., L. H. Miau, C. J. Chang and and S. C. Lee. 1996. Transcriptional
induction of the alpha-1 acid glycoprotein (AGP) gene by synergistic interaction
of two alternative activator forms of AGP/enhancer-binding protein (CIEBP beta)
and NF-kappaB or Nopp140. Mol. Cell. Biol. 16: 4257-63.

Lekstrom-Himes, J and K. G. Xanthopoulos. 1998. Biological role of the CCAAT/

enhancer-binding protein family of transcription favtors. J Biol Chem. 273:
28545-8.

47

Leuthy, J., J. Fargnoli, J. Park, A. Fomace and N. Holbrook. 1990. Isolation and
Characterization of the hamster gadd153 gene. Activation of promoter activity by
agents that damage DNA. J. Biol. Chem. 265: 16521-6.

Li, X. and W. S. L. Liao. 1992. Cooperative effects of CIEBP-like and NF kappa
B-Iike binding sites on rat serum amyloid A1 gene expression in liver cells.
Nucleic Acids Res. 20: 4765-72.

Liberrnann. TA and D. Baltimore. 1990. Activation of interleukin-6 gene
expression through the NF-kappa B transcription factor. Mol Cell Biol. 10: 2327-
34.

Lin, F. T. and M. D. Lane. 1992. Antisense CCAAT/enhancer-binding protein
RNA suppress coordinate gene expression and triglyceride accumulation during
differentiation of 3T3-L1 preadipocytes. Genes Dev. 6: 533.

Liou, H. C., W. C. Sha, M. L. Scott and D. Baltimore. 1994. Sequential induction
of NF-kappa B/Rel family proteins during B-Cell terminal differentiation. Mol Cell
Biol. 14: 5349-59.

Marten, N. W., E. J. Burke, J. M. Hayden, and OS Straus. 1994. Effect of amino
acid limitation on the expression of 19 genes in rat hepatoma cells. FASEB J. 8:
538-544.

Matsusaka, T., K. Fujikawa, Y. Nishio, N. Mukaida, K. Matsushima, T. Kishimoto
and S. Akira. 1993. Transcription Factors NF-IL6 and NF'NB Synergistically
Activate Transcription of the Inflammatory Cytokines, Interleukin 6 and Interleukin
8. Proc. Natl. Acad. Sci. U. S. A. 90: 10193-7.

McKnight, S. L., M. D. Lane and S. GIuecksohn-Waelsch. 1989. Is
CCAAT/enhancer binding protein a central regulator of energy metabolism?
Genes Dev. 3: 2021-4.

McKnight, S. L. 2001. MCBindallua better name for CCAAT/enhancer binding
proteins? Cell 107:259-61.

Mendel, l., A. Katz, N. Kozak, A. Ben-Nun and M. Revel. 1998. lnterIeukin-6
functions in autoimmune encephalomyelitis: a study in gene-targeted mice. Eur J
Immunol. 28: 1727-37.

Nakayama, K., H. Shimizu, K. Mitomo, T. Watanabe, S. Okamoto and K.
Yamamoto. 1992. A lymphoid cell-specific nuclear factor containing C-ReI-like
proteins preferentially interacts with interleukin-6 kappa B-related motifs whose
activities are repressed in lymphoid cells. Mol Cell Biol. 12: 1736-46.

Natsuka, S., S. Akira, Y. Nishio, S. Hashimoto, T. Sugita, H. Isshiki, and T.

48

Kishimoto. 1992. Macrophage differentiation-specific expression of NF-IL6, a
transcription factor for interleukin-6. Blood 79: 460-6.

Nerlov, C and E. B. Ziff. 1995. CCAAT/enhancer binding protein-alpha amino
acid motifs with dual TBP and TFIIB binding ability co-operate to activate
transcription in both yeast and mammalian cells. EMBO J. 14: 4318-28.

Nishizawa, M., N. Wakabayashi-lto and S. Nagata. 1991. Molecular Cloning of
cDNA and a chromosomal gene encoding GPE1-BP, a nuclear protein which
binds to granulocyte colony-stimulating factor promoter element 1. FEBS Lett
282: 95-7.

Nozaki, S., G.W. Sledge and H. Naksshatri. 2001. Repression of
GADD153/CHOP by NF- B: a possible cellular defense against endoplasmic
reticulum stress-induced cell death. Oncogene 20: 2178-85.

Okuda, Y., S. Sakoda, H. Fujimura, Y. Saeki, T. Kishimoto and T.
Yanagihara.1999. lL-6 plays a crucial role in the induction phase of myelin
oligodendrocyte glucoprotein 35-55 induced experimental autoimmune
encephalomyelitis. J Neuroimmunol. 101: 188-96.

Okuda, Y., S. Sakoda, C.C. Bernard, H. Fujimura, Y. Saeki, T. Kishimoto and T.
Yanagihara. 1998. IL-6-deficient mice are resistant to the induction of
experimental autoimmune encephalomyelitis provoked by myelin oligodendrocyte
glycoprotein. Int Immunol. 10: 703-8.

Omori, S.A., S. Smale, A. O’Shea-Greenfield and R. Wall. 1997. Differential
interaction of nuclear factors with the leukocyte-specific pp52 promoter in B and
T cells. J. Immunol. 159: 1800-8.

Osada, S., H. Yamamoto, T. Nishihara and M. lmagawa. 1996. DNA binding
specificity of the CCAAT/enhancer-binding protein transcription factor family. J.
Biol. Chem. 271: 3891-6.

Ossipow, V., P. Descombes and U. Schibler. 1993. CCAAT/enhancer-binding
protein mRNA is translated into multiple proteins with different transcription
activation potentials. Proc. Natl. Acad. Sci. USA. 90:8219-23.

Oyadomari, S., K. Takeda, M. Takiguchi, T. Gotoh, M. Matsumoto, I. Wada, S.
Akira, E. Araki and M. Mori. 2001. Nitric oxide-induced apoptosis in pancreatic

beta cells is mediated by the endoplasmic reticulum stress pathway. Proc Natl
Acad Sci USA. 98: 10845-50.

Oyadomari, S., A. Koizumi, K. Takeda, T. Gotoh, S. Akira, E. Araki and M. Mori.

2002. Targeted disruption of the Chop gene delays endoplasmic reticulum
stress-mediated diabetes. J Clin Invest. 109: 525-32.

49

Pabst, T., B. U. Mueller, P. Zhang, H. S. Radomska, S. Narravula, S. Schnittger,
G. Behre, W. Hiddemann and D. G. Tenen. 2001. Dominant-negative mutations
of CEBPA, encoding CCAAT/enhancer binding protein- (C/EBP ), in acute
myeloid leukemia. Nat. Genet. 27: 263-70.

Pan, 0., C. Petit-Frere, J. Stavnezer and L. Hammarstrom. 2000. Regulation of
the promoter for human immunoglobulin gamma3 germ-line transcription and its
interaction with the 3’alpha enhancer. Eur. J. Immunol. 30:1019-29.

Park, E. A., W. J. Roesler, J. Liu, D. J. Klemm, A. L. Gurney, J. D. Thatcher, J.
Shuman, A. Friedman, and R. W. Hanson RW. 1990. The role of the
CCAAT/enhancer-binding protein in the transcriptional regulation of the gene for
phosphoenolpyruvate carboxykinase (GTP). Mol Cell Biol. 10: 6264-72.

Park, J., J. Luethy, M. Wang, J. Fargnoli, A. Fomace, O. McBride and N.
Holbrook. 1992. Isolation, Characterization and chromosomal localization of the
human GADD153 gene. Gene 116: 259-67.

Paul, W.E. 1989. Pleiotropy and redundancy: T cell-derived Iymphokines in the
immune response. Cell 57: 521-4.

Phillips, R. J. and S. Ghosh. 1997. Regulation of IKBIS in WEHI231 mature B
cells. Mol. Cell. Biol. 17: 4390-6.

Plevy, S. E., J. H. M. Gemberling, S. Hsu, A. J. Domer and S. T. Smale. 1997.
Multiple control elements mediate activation of the murine and human interleukin
12 p40 promoters: evidence of functional synergy between CIEBP and Rel
proteins. Mol. Cell. Biol. 17: 4572-88.

Poli, V., F. P. Mancini and R. Cortese. 1990. lL-6DBP, a nuclear protein involved
in interleukin 6 signal transduction, defines a new family of leucine zipper
proteins related to C/EBP. Cell 63: 643-53.

Poli, V., R. Balena, E. Fattori, A. Markatos, M. Yamamoto, H. Tanaka, G.
Ciliberto. G.A. Rodan and F. Costantini. 1994. Interleukin-6 deficient mice are
protected from bone loss caused by estrogen depletion. EMBO J. 13: 1189-96.

Porse, B. T., T. A. Pedersen, X. Xu, B. Lindberg, U. M. Wewer, L. Friis-Hansen
and C. Nerlov. 2001. E2F repression by C/EBPalpha is required for adipogenesis
and granulopoiesis in vivo. Cell 107: 247-58.

Price, B. and S. Caldenlvood. 1992. Gadd 45 and Gadd 153 messenger RNA

levels are increased during hypoxia and after exposure of cells to agents which
elevate the levels of glucose-regulated proteins. Cancer Res. 52: 3814-7.

50

Rabbitts, T.H., A. Forster, R. Larson, and P. Nathan. 1993. Fusion of the
dominant negative transcription regulator CHOP with a novel gene FUS by
translocation t(12:16) in malignant liposarcoma. Nat. Genet. 4: 175-80.

Radomska, H. S., C. S. Huettner, P. Zhang, T. Cheng, D. T. Scadden and D. G.
Tenen. 1998. CCAAT/Enhancer binding protein is a regulatory switch sufficient
for induction of granulocytic development from bipotential myeloid progenitors.
Mol. Cell. Biol. 18: 4301-14.

Ramji, D. P., A. Vitelli, F. Tronche, R. Cortese and G. Ciliberto. 1993. The two
C/EBP isoforrns, IL-GDBP/NF-ILG and C/EBP6/NF-IL6B, are induced by lL-6 to

promote acute phase gene transcription via different mechanisms. Nucleic Acids
Res. 21: 289-94.

Ray, A., K. S. LaForge and P. B. Sehgal. 1990. On the mechanism for efficient
repression of the interleukin-6 promoter by glucocorticoids: enhancer, TATA box,
and RNA start site (lnr motif) occlusion. Mol Cell Biol. 10: 5736-46.

Ray, A. and K. E. Prefontaine. 1994a. Physical association and functional
antagonism between the p65 subunit of transcription factor NF-kappa B and the
glucocorticoid receptor. Proc Natl Acad Sci U S A. 91: 752-6.

Ray, A., K. E. Prefontaine and P. Ray. 1994b. Down-modulation of interleukin-6
gene expression by 17 beta-estradiol in the absence of high affinity DNA binding
by the estrogen receptor. J. Biol. Chem. 269: 12940-6.

Ray, A. and B. K. Ray. 1994. Serum amyloid A gene expression under acute-
phase conditions involves participation of inducible CIEBP-beta and CIEBP-delta
and their activation by phosphorylation. Mol Cell Biol. 14: 4324-32.

Ray, A., M. Hannink and B. K. Ray. 1995. Concerted Participation of NF-KB and
C/EBP Heteromer in Lipopolysaccharide Induction of Serum Amyloid A Gene
Expression in Liver. J. Biol. Chem. 270: 7365-74.

Reinhold, D., U. Bank, F. Buhling, U. Lendeckel, A. J. Ulmer, H. D. Flad and S.
Ansorge. 1994. Transforming growth factor-beta 1 (TGF-beta 1) inhibits DNA
synthesis of PWM-stimulated PBMC via suppression of lL-2 and IL-6 production.
Cytokine. 6: 382-8.

Roger, T., T. A. Out, H. M. Jansen and R. Lutter. 1998. Superinduction of
interleukin-6 mRNA in lung epithelial H292 cells depends on transiently
increased C/EBP activity and durable increased mRNA stability. Biochim
Biophys Acta. 1398: 275-84.

Roman, C., J. S. Platero, J. Shuman and K. Calame. 1990. lg/EBP—1: a
ubiquitously expressed immunoglobulin enhancer binding protein that is similar to

51

C/EBP and heterodimerization with CIEBP. Genes Dev. 4: 1404-15.

Romani, L., A. Mencacci, E. Cenci, R. Spaccapelo, C. Toniatti, P. Puccetti, F.
Bistoni and V. Poli. 1996. Impaired neutrophil response and CD4+ T helper cell 1
development in interleukin 6-deficient mice infected with Candida albicans. J
Exp Med. 183: 1345-55.

Romano, M., M. Sironi, C. Toniatti, N. Polentarutti, P. Fruscella, P. Ghezzi, R.
Faggioni, W. Luini, V. van Hinsbergh, S. Sozzani, F. Bussolino, V. Poli, G.
Ciliberto and A. Mantovani. 1997. Role of lL-6 and its soluble receptor in
induction of chemokines and leukocyte recruitment. Immunity. 6: 315-25.

Ron, D. and J. F. Habener. 1992. CHOP, a novel developmentally regulated
nuclear protein that dimerized with transcription factors CIEBP and LAP and
functions as a dominant-negative inhibitor of gene transcription. Genes Dev. 6:
439-53.

Ruocco, M. R., X. Chen, C. Ambrosino, E. Dragonetti, W. Liu, M. Mallardo, G. D.
Falco, C. Palmleri. C. Franzoso, G. Quinto, S. Venuta and G. Scala. 1996.
Regulation of HIV-1 Long Terminal Repeats by Interaction of C/EBP(NF—IL6) and
NF- B/Rel Transcription Factors. J. Biol. Chem. 271: 22479-86.

Ruther, U., W. Muller, T. Sumida, T. Tokuhisa, K. Rajewsky and E. F. Wagner.
1988. C-fos expression interferes with thymus development in transgenic mice.
Cell 53: 847-56.

Saisanit, S. and X. H. Sun. 1997. Regulation of the pro-B-celI-speciflc enhancer
of the ld1 gene involves the CIEBP family of proteins. Mol. Cell. Biol. 17: 844-50.

Samoilova, E. B., J. L. Horton, B. Hilliard, T. S. Liu and Y. Chen. 1998. IL-6-
deficient mice are resistant to experimental autoimmune encephalomyelitis: roles
of lL-6 in the activation and differentiation of autoreactive T cells. J Immunol.
161: 6480-6.

Santhanam, U., A. Ray and P. B. Sehgal. 1991. Repression of the interleukin 6
gene promoter by p53 and the retinoblastoma susceptibility gene product. Proc
Natl Acad Sci USA 88: 7605-9.

Schanke, J. T., A. Marcuzzi, R. P. Podzorski and B. Van Ness B. 1994. An AP1
binding site upstream of the kappa immunoglobulin intron enhancer binds
inducible factors and contributes to expression. Nucleic Acids Res. 22: 5425-32.

Schauer, S. L., R. E. Bellas and G. E. Sonenshein. 1998. Dominant signals
leading to inhibitor x3 protein degradation mediate CD40 ligand rescue of WEHI
231 immature B cells from receptor-mediated apoptosis. J. Immunol. 160: 4398-
405.

52

Scheinman, R. l., A. Gualberto, C. M. Jewell, J. A. Cidlowski and Jr. A. S.
Baldwin. 1995. Characterization of mechanisms involved in transrepression of
NF-kappa B by activated glucocorticoid receptors. Mol Cell Biol. 15: 943-53.

Scherer, D. C., J. A. Brockman, H. H. Bendall, G. M. Zhang, D. W. Ballard and E.
M. Oltz. 1996. Corepression of RelA and C-rel inhibits immunoglobulin gene
transcription and rearrangement in precursor B lymphocytes. Immunity 5:563-74.

Scott, L. M., C. I. Civin, P. Rorth and A. D. Friedman. 1992. A novel temporal
expression pattern of three C/EBP family members in differentiating
myelomonocytic cells. Blood 80:1725—35.

Screpanti, l., L. Romani, P. Musiani, A. Modesti, E. Fattori, D. Lazzaro, C.

Sellitto, S. Scarpa, D. Bellavia and G. Lattanzio. 1995. Lymphoproliferative
disorder and imbalanced T-helper response in C/EBP beta-deficient mice.

EMBO J. 14: 1932-41.

Sen, R. and D. Baltimore. 1986. Multiple nuclear factors interact with the
immunoglobulin enhancer sequences. Cell 46: 705-16.

Sha, W.C., H. C. Liou, E. l. Tuomanen and D. Baltimore.1995. Targeted
disruption of the p50 subunit of NF— B leads to multifocal defects in immune
responses. Cell 80: 321-30.

Shaulian, E. and M. Karin. 2001. AP-1 in cell proliferation and survival.
Oncogene. 20: 2390-400.

Shaw, G. and R. Kamen. 1986. A conserved AU sequence from the 3'
untranslated region of GM-CSF mRNA mediates selective mRNA degradation.
Cell 46:659-67.

Sok, J., X. Z. Wang, N. Batchvarova, M. Kuroda, H. Harding and D. Ron. 1999.
CHOP-dependent stress-inducible expression of a novel form of carbonic
anhydrase VI. Mol. Cell. Biol. 19: 495-504.

Stein, B., P.C. Cogswell and Jr. A. S. Baldwin. 1993. Functional and physical
associations between NF-kappa B and CIEBP family members: a Rel domain-
bZlP interaction. Mol. Cell. Biol. 13: 3964-74.

Stein, B. and M. X. Yang. 1995. Repression of the interleukin-6 promoter by
estrogen receptor is mediated by NF-kappa B and C/EBP beta. Mol Cell Biol. 15:
4971-9.

Suematsu, S., T. Matsusaka, T. Matsuda, S. Ohno, J. Miyazaki, K. Yamamura, T.
Hirano and T. Kishimoto. 1992. Generation of plasmacytomas with the

53

chromosomal translocation t(12;15) in intedeukin 6 transgenic mice. Proc Natl
Acad Sci USA 89: 232-5.

Tanabe, O., S. Akira, T. Kamiya, G. G. Wong, T. Hirano and T. Kishimoto. 1988.
Genomic structure of the murine lL-6 gene. High degree conservation of potential
regulatory sequences between mouse and human. J Immunol. 141: 3875-81.

Tanaka, T., N. Yoshida, T. Kishimoto and S. Akira. 1997. Defective adipocyte
differentiation in mice lacking the CIEBPB and/or CIEBP6 gene. EMBO J. 16:
7432-43.

Tanaka, T., S. Akira, K. Yoshida, M. Umemoto, Y. Yoneda, N. Shirafuji, H.
Fujiwara, S. Suematsu, N. Yoshida and T. Kishimoto. 1995. Targeted disruption
of the NF-IL6 gene discloses its essential role in bacteria killing and tumor
cytotoxicity by macrophages. Cell 80: 353-61.

Tang, Q. Q. and M. D. Lane. 2000. Role of CIEBP homologous protein (CHOP-
10) in the programmed activation of CCAAT/enhancer-binding protein-beta
during adipogenesis. Proc Natl Acad Sci USA 97: 12446-50.

Tavor, S., P. T. Vuong, D. J. Park, A. F. Gombart, A. H. Cohen and H. P.
Koeffler. 2002. Macrophage functional maturation and cytokine production are
impaired in C/EBP epsilon-deficient mice. Blood 99: 1794-801.

Thomassin, H., D. Hamel, D. Bernier, M. Guertin and L. Belanger. 1992.
Molecular cloning of two CIEBP-related proteins that bind to the promoter and
the enhancer of the 1-fetoprotein gene. Further analysis of C/EBPB and
CIEBP . Nucleic Acids Res. 20: 3091-8.

Timchenko, N. A., T. E. Harris, M. Wilde, T. A. Bilyeu, B. L. Burgess-Beusse, M.
J. Finegold and G. J. Darlington. 1997. CCAAT/enhancer binding protein alpha
regulates p21 protein and hepatocyte proliferation in newborn mice. Mol Cell
Biol. 17: 7353-61.

Timchenko, N. A., M. Wilde and G. J. Darlington. 1999. C/EBPalpha regulates
formation of S-phase-specific E2F-p107 complexes in livers of newborn mice.
Mol Cell Biol. 19: 2936-45.

Trautwein, C., P. van der Geer, M. Karin, T. Hunter and M. Chojkier. 1994.
Protein kinase A and C site-specific phosphorylations of LAP (NF-IL6) modulate
its binding affinity to DNA recognition elements. J Clin Invest. 93: 2554-61.

Trantwein, C., D. L. Walker, J. Plumpe and M. P. Manns. 1995. Transactvation of

LAP/NF-IL-6 is mediated by an acidic domain in the N-tenninal part of the
protein. J. Biol. Chem. 270: 15130-36.

54

Tsao, B. P., X. F. Wang, C. L. Peterson and K. Calame. 1988. In vivo functional
analysis of in vitro protein binding sites in the immunoglobulin heavy chain
enhancer. Nucleic Acids Res. 16: 3239-53.

Ubeda, M., M. Vallejo and J.F. Habener. 1999. CHOP enhancement of gene
transcription by interactions with Jun/Fos AP-1 complex proteins. Mol. Cell.
Biol.19: 7589-99.

Umek, R., A. Friedman and S. L. McKnight. 1991. CCAAT-enhancer binding
protein: a component of a differentiation switch. Science 251: 288-92.

Verrna, l. M., J.K. Stevenson, E. M. Schwartz, D. Van Antwerp and S. Miyamoto.
1995. Rel/NF- B/l B family: intimate tales of association and dissociation.
Genes Dev. 9: 2723-35.

Vietor, I., I. C. Oliveira and J. Vilcek. 1996. CCAAT box enhancer binding protein
(C/EBP- ) stimulates NF- B element-mediated transcription in transfected cells.
J. Biol. Chem. 271: 5595-602.

Vinson, C. R., P. B. Sigler and S. L. McKnight. 1989. Scissors-grip model for
DNA recognition by a family of leucine zipper proteins. Science 246: 911-6.

Vinson, C. R., T. Hal and S. M. Boyd. 1993. Dimerization specificity of the leucine
zipper-containing bZIP motif on DNA binding: prediction and rational design.
Genes Dev. 7: 1047-58.

Wang, H., P. Lakova, M. Wilde, A. Welm, T. Goode, W. J. Roesler and N. A.
Timchenko. 2001. C/EBPaIpha arrests cell proliferation through direct inhibition
of Cdk2 and Cdk4. Mol. Cell 8: 817-28.

Wang, H., T. Goode, P. Iakova, J. H. Albrecht and N. A. Timchenko. 2002.
C/EBPalpha triggers proteasome-dependent degradation of Cdk4 during growth
arrest. EMBO J. 21: 930-41.

Wang, X. Z. and D. Ron. 1996. Stress-induced phosphorylation and activation of
the transcription factor CHOP (GADD153) by p38 MAP-kinase. Science 272:
1347-9.

Wang, X. Z., M. Kuroda, J. Sok, N. batchvarova, R. Kimmel, P. Chung, H.
Zinszner and D. Ron. 1998. Identification of novel stress-induced genes
downstream of Chop. EMBO J. 17: 3619-30.

Wegner, M., Z. Cao and M. G. Rosenfeld. 1992. Calcium-regulated
phosphorylation within the leucine zipper of C/EBPB. Science. 256: 370-3.

Williams, S. C., C. A. Cantwell and P. F. Johnson. 1991. A family of CIEBP-

55

related proteins capable of forming covalently linked leucine zipper dimers in
vitro. Genes Dev. 5: 1553-67.

Williams, S. C., M. Baer, A. J. Dillner and P. F. Johnson. 1995. CRP2 (C/EBPB)
contains a bipartite regulatory domain that controls transcriptional activation,
DNA binding and cell specificity. EMBO J. 14:3170-83.

Winzen, R., M. Kracht, B. Ritter, A. Wilhelm, N. Xu, A. B. Shyu, M. Miller, M.
Gaestel, K. Resch and H. Holtmann. 1999. The p38 MAP kinase pathway signals
for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase
2 and an AU-riCh region-targeted mechanism. EMBO J. 18: 4969-80.

Wu, M., H. Y. Lee, R. E. Bellas, S. L. Schauer, M. Arsura, D. Katz, M. J.
Fitzgerald, T. L. Rothstein, D. H. Sherr and G. E. Sonenshein. 1996. Inhibition of
NF-icB/Rel induces apoptosis of murine B cells. EMBO J. 15: 4682-90.

Xing, Z., J. Gauldie, G. Cox, H. Baumann, M. Jordana, X. F. Lei and M. K.
Achong. 1998. lL-6 is an anti-inflammatory cytokine required for controlling local
or systemic acute inflammatory responses. J. Clin. Invest. 101: 311-20.

Xu, M2. and J. Stavnezer. 1992. Regulation of transcription of immunoglobulin
gerrn-Iine gamma 1 RNA: analysis of the promoter/enhancer. EMBO J. 11: 145-
55.

Xu, 0. and Tata, JR. 1992. Characterization and developmental expression of
Xenopus CIEBP gene. Mech. Develop. 38: 69-81.

Yamanaka, R., G. D. Kim, H. S. Radomska, J. Lekstrom-Himes, L. T. Smith, P.
Antonson, D. G. Tenen, and K. G. Xanthopoulos. 1997a. CCAAT/Enhancer
binding protein epsilon is preferentially upregulated during granulocytic
differentiation and its functional versatility is determined by alternative use of
promoters and differential splicing. Proc. Natl. Acad. Sci. USA 94: 6462-7.

Yamanaka, R., C. Barlow, J. Lekstrom-Himes, L. H. Castilla, P. P. Liu, M.
Eckhaus, T. Decker, A. Wynshaw-Boris, and K. G. Xanthopoulos. 1997b.
Impaired granulopoiesis, myelodysplasia, and early lethality in CCAAT/enhancer
binding protein epsilon-deficient mice. Proc. Natl. Acad. Sci. USA 94: 13187-92.

Yasukawa, K., T. Hirano, Y. Watanabe, K. Muratani, T. Matsuda and T.
Kishimoto. 1987. Structure and expression of human B cell stimulatory factor 2
(BSF-2) gene. EMBO J. 6: 2939-45.

Zafarana, G., R. Rottier, F. Grosveld and S. Philipsen. 2000. Erythroid

overexpression of C/EBP gamma in transgenic mice affects y-globin expression
and fetal liver erythropoiesis. EMBO J. 19:5856-63.

56

Zauberrnan, A., D. Zipori, M. Krupsky and R. Ben-Levy. 1999. Stress activated
protein kinase p38 is involved in lL-6 induced transcriptional activation of STAT3.
Oncogene. 18: 3886-93.

Zhan, 0., K. A. Lord, I. Alamo, Jr., M. C. Hollander, F. Carrier, D. Ron, K.W.
Kohn, B. Hoffman, D. A. Liebermann and A. J. Fomace, Jr. 1994. The gadd and
MyD genes define a novel set of mammalian genes encoding acidic proteins that
synergistically suppress cell growth. Mol. Cell. Biol. 14: 2361-71.

Zhang, D. E., P. Zhang, N. D. Wang, C. J. Hetherington, G. R. Darlington and D.
G. Tenen. 1997. Absence of granulocyte colony-stimulating factor signaling and

neutrophil development in CCAAT enhancer binding protein alpha-deficient mice.
Proc. Natl. Acad. Sci. USA 94:569-74.

Zhang, Y., M. Broser and W. N. Rom. 1994. Activation of the interleukin 6 gene
by Mycobacterium tuberculosis or Iipopolysaccharide is mediated by nuclear
factors NF-IL6 and NF-kappa B. Proc Natl Acad Sci U S A. 91: 2225-9.

Zhu, S., K. Yoon, E. Sterneck, P. F. Johnson and R. C. Smart. 2002.
CCAAT/enhancer binding protein-beta is a mediator of keratinocyte survival and

skin tumorigenesis involving oncogenic Ras signaling. Proc Natl Acad Sci USA.
99: 207-12.

Zinszner, H., M. Kuroda, X. Wang, N. Batchvarova, R. T. Lightfoot, H. Remotti, J.
L. Stevens and D. Ron. 1998. CHOP is implicated in programmed cell death in
response to impaired function of the endoplasmic reticulum. Genes & Dev. 12:
982-95.

Zissel, G., J. Schlaak, M. Schlaak and J. Muller-Quernheim. 1996. Regulation of

cytokine release by alveolar macrophages treated with interleukin-4, interleukin-
10, or transforming growth factor beta. Eur Cytokine Netw. 7:59-66.

57

CHAPTER 2

CIEBPy HAS A STIMULATORY ROLE ON THE INTERLEUKlN-6 AND

INTERLEUKlN-8 PROMOTERS

58

ABSTRACT

CCAAT/enhancer binding protein y (C/EBPy) is an ubiquitously expressed
member of the CIEBP family of transcription factors that has been shown to be
an inhibitor of CIEBP transcriptional activators and has been proposed to act as
a buffer against CIEBP-mediated activation. We have now unexpectedly found
that ClEBPy dramatically augments the activity of CIEBPB in Iipopolysaccharide
induction of the interleukin-6 and interteukin-8 promoters in a B lymphoblast cell
line. This activating role for C/EBPy is promoter-specific, neither being observed
in the regulation of a simple CIEBP-dependent promoter nor the TNFa promoter.
C/EBPy activity also shows cell-specificity with no activity being observed in a
macrophage cell line. Studies with chimeric CIEBP proteins Implicate the
formation of a heterodimeric leucine zipper between C/EBPB and CIEBPy as the
critical structural feature required for C/EBPy stimulatory activity. These findings
suggest a unique role for C/EBPy in B cell gene regulation and, along with our
previous observation of the ability of C/EBP basic region-leucine zipper domains
to confer Iipopolysaccharide inducibility of interleukin-6, suggest that the CIEBP

leucine zipper domain has a role in C/EBP function beyond allowing dimerization

between CIEBP family members.

59

INTRODUCTION

CCAAT/enhancer binding protein (C/EBP) a, (3, y, 6, s, and C comprise a
family of basic region-leucine zipper (bZIP) transcription factors (reviewed by
Johnson et al 1994). These proteins dimerize through their leucine zippers and
bind to DNA through their adjacent basic regions. C/EBPa, B, 6, and 8 can
activate in vivo transcription from promoters that contain a consensus binding
site: 5’-T(T/G)NNGNAA(T/G)-3’ (Akira etal 1990). At this time, the reported in
vitro functions of ClEBPa, (3, 6, and e are nearly identical, but the variety of
CIEBP isoforrns and their potential for heterodimer formation could provide a
large repertoire of transcription factors with complex in vivo regulatory features.

C/EBPB and CIEBP6 have been implicated in the regulation of
proinfiammatory cytokines as well as other gene products associated with the
activation of macrophages and the acute phase inflammatory response
(reviewed by Poll 1998). For example, the promoter regions of the genes for
interleukin-6 (IL-6), lL-1ot, lL-1I3, lL-8, tumor necrosis factor at (T NFot),
granulocyte-colony stimulating factor, inducible nitric oxide synthase, lysozyme,
hemopexin, haptoglobin, a1-aCICI glycoprotein, serum amyloid A1, A2, A3,
complement C3 and C-reactive protein all contain CIEBP binding motifs (Poli
1998). Furthermore, C/EBPB and CIEBP6 have both been shown to activate a
reporter gene controlled by the lL-6 promoter in transient expression assays
(Akira et al 1990; Kinoshita et al 1992). We have previously demonstrated that

the stable expression of C/EBPot, B, 6 and s in a B lymphoblast cell line is

60

sufficient to confer lipopolysaccharide (LPS) inducibility of IL-6 and monocyte
Chemoattractant protein 1 (MCP-1) expression (Bretz et al 1994; Hu et al 1998;
Williams et al 1998). The basis for this redundancy among C/EBP isoforrns lies
with the requirement of only the well-conserved C/EBP bZIP domain for this
activity (Hu et al 2000).

We have found that C/EBPB is overwhelmingly present as a heterodimer
with C/EBPy in B lymphoblasts dependent upon C/EBPB for LPS-induced lL-6
expression (Hu et al 2000). C/EBPy is most highly expressed in immature B cells,
although its expression is rather ubiquitous (Roman et al 1990). Its binding
specificity is similar to that of other CIEBP family members (Roman et al 1990),
but it has a truncated structure. C/EBPy lacks known activation domains and is
essentially a CIEBP bZIP domain (Cooper et al 1995). Consistent with this
structure, it has been shown to inhibit C/EBP transcriptional activators and has
been proposed to act as a “buffer” for C/EBP activators. C/EBPy would prevent
the activation of CIEBP-dependent gene expression under conditions where the
abundance of Classical CIEBP activators is low. Activation of CIEBP-dependent
genes would occur only when the abundance of C/EBP a, B, 6, and s exceeded a
threshold. It has been proposed that the predominance of C/EBPy over CIEBPB
in early B cells would prevent transcription of CIEBP-dependent genes, while
increased expression of C/EBPB in mature cells, or in cells stimulated by LPS or

proinflammatory cytokines, would be permissive for expression (Cooper et al

1994).

61

Contrary to the notion of ClEBPy as an inhibitor, there have been studies
suggesting an activation function for C/EBPy. An activating role for C/EBPy has
been reported in transcription from immunoglobulin heavy Chain promoters
(Cooper et al 1992; Pan et al 2000). C/EBPy has also been implicated in B-globin
(Wall et al 1996) and pp52 (Omori et al 1998) gene expression. Whether C/EBPy
functions as an activator or an inhibitor, both its lack of expression and
overexpression have consequences in vivo. C/EBPy-deficient mice have defects
in natural killer cell cytotoxic activity and interferon y production (Kaisho et al
1999). Moderate erythroid overexpression of C/EBPy in transgenic mice
increases y-globin expression relative to B-globin, while high-level expression
blocks erythropoiesis (Zafarana et al 2000).

Our observation that heterodimers between C/EBPB and C/EBPy
predominate in lymphoblasts dependent upon C/EBPB for LPS-induced IL-6
expression (Hu et al 2000), as well as the widespread occurrence of C/EBszy
heterodimers (Parkin et al, 2002), led us to further explore the role of C/EBPy in
regulating IL-6 transcription. In this report, we have unexpectedly found that
ClEBPy dramatically augments the activity of C/EBPB in LPS induction of IL-6 in
a B lymphoblast cell line. This activating role for C/EBPy is promoter-specific,
being observed for the IL-6 and lL-8 promoters, but neither for a simple CIEBP-
dependent promoter nor the TNFot promoter. C/EBPy activity also shows cell

type-specificity with stimulatory activity in a B lymphoblast and no effect in a

macrophage cell line. Studies with chimeric CIEBP proteins implicated the

62

formation of a heterodimeric leucine zipper between C/EBPB and C/EBPy as the
critical structural feature required for C/EBPy stimulatory activity. Our current
findings suggest a unique role for C/EBPy in B cell gene regulation and, along
with our previous observation of the ability of C/EBP bZIP domains to confer LPS
inducibility of lL-6, suggest that the C/EBP leucine zipper domain has a role in

CIEBP function beyond allowing dimerization between C/EBP family members.

63

MATERIALS AND METHODS

Cells and cell culture-P388 are murine B lymphoblasts (Bauer et al 1986)
(American Type Culture Collection (ATCC); CCL 46). P388-CB cells and P388-
Neo cells have been described previously by Hu et al. (Hu et al 1998). WEHI-231
are murine B cells (Gutman et al 1981) (ATCC; CRL 1702). P388D1(|L1) are
macrophages (Bauer et al 1986) (ATCC; TIB 63). P388 cells and their derivatives
were cultured in RPMI 1640 medium supplemented with 5% fetal calf serum and
50 pM B-mercaptoethanol. WEHI-231 cells were cultured in RPMI 1640 medium
supplemented with 10% fetal calf serum and 50 pM B-mercaptoethanol.
P388DI(IL1) cells, IC21 cells and ANA-1 cells were cultured in RPMI 1640
medium supplemented with 10% fetal calf serum. All lL-6 inductions were
conducted with LPS derived from Escherichia coli serotype 055:85 (Sigma)

added to 10 pg/ml.

Transfections-Stable transductions of G418-resistant vectors encoding
C/EBPy-[SLZ were carried out by retroviral infection. Retrovirus stocks were
prepared by transient expression in 293T cells. 3 pg of constructs in the
retroviral expression vector pSV(X)Neo were cotransfected with 3 pg pMOV-w
(Mann et al 1983), which is a packaging construct. Transfections were
performed on 60cm plates using DMRlE-C (Life Technologies) on 80% confluent
293 T cells. Virus was harvested 60 hours post-transfection by centrifuging the

supematants at 1500 rpm for 5 min and then filtering the Clear supematants

64

through 0.45-pM-pore-size filters. Retroviral infections were performed by the
addition of 3ml virus stock Viral stock to 2x106 cells in the presence of 8 pglml
polybrene (Sigma). The cells were then incubated at 37°C for 3 hours during
which time the cells were resuspended every 30 min. Then the cells were
resuspended in normal medium. After 24 hours, the cells were split to four 60 cm
plates and neomycin (Sigma) was added into the media at a final concentration
of 670 pglml for about 7 days.

Transient transfections were conducted with 2x106 cells, 4 pg of DNA, and
8 pl of DMRIE-C reagent (Life Technologies) in 1.2 ml of Opti-MEM l medium
(Life Technologies). The DNA was comprised of 1.0pg of a promoter-reporter,
C/EBP expression vector, and pMEX plasmid to total 4 pg. The quantities of
C/EBP expression vectors are as indicated in the figure legends. Cells were
incubated in the transfection mixture for 5 h followed by the addition of RPMI
1640 medium supplemented to 15% with fetal calf serum. After 24 h, the medium
of certain transfections was supplemented with 10 pglml LPS. After 4 h in the
presence or absence of LPS, transfected cells were harvested, lysed, and
analyzed for Iuciferase activity by using the Luciferase Reporter Gene Assay Kit
(Roche) and for B-galactosidase activity by using the Luminescent B-

Galactosidase Genetic Reporter System ll (Clontech).

Expression vectors and promoter-reporters-For transient transfections,
CIEBPs were expressed from pMEX (Williams et al 1991), which utilizes the

Moloney murine sarcoma virus promoter. P65 was expressed from pRC/CMV

65

(Invitrogen), which utilizes the cytomegalovirus promoter (from N. Rice, National
Cancer Institute-Frederick). C/EBPB-GCN4LZ has been described previously
(Williams et al 1995). C/EBPy-ANco was constructed by religating pMEX-ClEBPy
after restriction digestion with Nco I. C/EBPy—BLZ was constructed by introducing
an Xhol site at nucleotide position 283 in the C/EBPy gene by site-directed
mutagenesis. The Xhol-Hindlll fragment bearing the leucine zipper was removed
from this pMEX-CIEBPy plasmid and replaced with an analogous fragment (nt
703-831) from a rat C/EBPB vector in which an Xhol site had been inserted
between the basic region and leucine zipper. The forms of C/EBPII and ClEBPy
used in this project are depicted in Figure 1.

The IL-6 promoter-reporter consists of the murine lL-6 promoter (Tanabe
et al 1988) (-250 to +1) inserted into the Iuciferase vector, pXP2 (Nordeen 1988).
DEI4(-35alb)LUC (Williams et al 1991) is also derived from pXP2 (Nordeen 1988)
and contains four copies of the DEI element upstream of the albumin minimal
promoter. The TNFot promoter-reporter contains sequences extending to —1260
of the TNFa promoter inserted into the Iuciferase vector, pXP1 (T anabe 1988).
The lL-8 promoter-reporter contains sequences extending from +44 to -133
inserted into pGL3—basic (Promega)(Okamoto et al 1994; Murayama et al 1997;
Zhang et al 2001). The SV40 early promoter-reporter is a commercial product,
pBgal-Control (Clontech). where the SV40 early promoter and enhancer

sequences are cloned upstream and downstream, respectively, of the lad gene.

66

Activation Domains Basic Region Leucine Zipper

 

 

 

 

CIEBPB 7//////////////1 W
CIEBPBGCMLZ V///////////// .i —
CIEBP? . ”7”" ;;\\\\\\\\\\\\\\

 

 

CIEBPv-ANco '1’. ”:1 :13 :r W

.. 1 '. 11:“ rW

 

CIEBPy—BLZ

Figure 1. Diagram of the major CIEBP Isofonns and mutants
used in this chapter.

67

RNA isolation and analysis-Total RNA was isolated using TRIzol reagent (Life
Technologies) according to the manufacturer’s directions. RNA’s were
electrophoresed through 1% agarose/formaldehyde gels. Transfers to
membranes were hybridized and washed to high stringency in 40 mM sodium
phosphate/1% SDS/1mM EDTA at 65°C. Hybridization probes were prepared
with a random priming kit (Life Technologies) with the incorporation of 5’-[ -
32P]dATP (3000 Ci/mmol; DuPont-New England Nuclear). The C/EBPy probe
consisted of the murine C/EBPy coding sequence (Cooper et al 1995). The IL-6
probe was a 0.65 kb murine cDNA (from N. Jenkins and N. Copeland, National
Cancer Institute-Frederick). The glyceraldehyde-3-phosphate dehydrogenase

(GAPDH) probe was a 1.3 kb rat cDNA (Fort et al 1985).

Western analysis-Nuclear extracts were prepared as described below.
The extracts (60 pg) were adjusted to 1x Laemmli sample buffer (Laemmli 1970)
and processed by sodium dodecyl sulfate-12% polyacrylamide gel
electrophoresis. Separated proteins were transferred to Protran membrane
(Schleicher and Schuell), and antigen-antibody complexes were visualized with

the Enhanced Chemiluminescence Kit (Amersham).

Electrophoretic mobility shift assa y (EMSA)-Nuclear extracts were
prepared as follows. Cells were washed in phosphate-buffered saline and lysed
in 15 mM KCI, 10 mM HEPES [pH 7.6], 2 mM MgClz, 0.1 mM EDTA, 1 mM

dithiothreitol, 0.1% [vol/vol] NP-40, 0.5 mM phenylmethylsulfonyl fluoride, 2.5

68

pglml Ieupeptin, 5 pglml antipain, and 5 pglml aprotinin for 10 min on ice. Nuclei
were pelleted by centrifugation at 13,000 rpm for 60 sec at 4°C. Proteins were
extracted from nuclei by incubation at 4°C for 20 min with vigorous vortexing in
buffer C (420 mM NaCI, 20 mM HEPES [pH 7.9], 0.2 mM EDTA, 25% [vol/vol]
glycerol, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 2.5 pglml
leupeptin, 5 pglml antipain, and 5 pglml aprotinin). Nuclear debris was pelleted
by centrifugation at 13,000 rpm for 30 min at 4°C and the supernatant extract
was collected and stored at -80°C.

The EMSA probes were double-stranded oligonucleotides containing an
optimal CIEBP binding site (5’-
GATCCTAGATATCCCTGATTGCGCAATAGGCTCAAAGCTG-B’ annealed
with 5’-AATTCAGCTTTGAGCCTATTGCG_CAATCAGGGATATCTAG-3’), a
murine lL-6 CIEBP binding site (5’-
CTAAACGACGTCACA‘ITGTGCAATCTTAATAAGGTT-3’ annealed with 5’-
TGGAAACCTTATTAAGATTGCACAATGTGACGTCGT—3’), and a murine
albumin DEI binding site (5’-TCGACTATGA'I‘I'TTC_5TAATGGGGC—3’ annealed
with 5’-TCGAGCCCCA‘I'I'ACAAAATCATAG-3’). These probes were labeled with
the incorporation of 5’-[ -32P]dATP (3000 Ci/mmol; DuPont-New England
Nuclear) and Klenow DNA polymerase. Underlined sequences correspond to the
CIEBP binding motifs.

DNA binding reactions were performed at room temperature in a 25 pl
reaction mixture containing 6.0pg of nuclear extract (1mg/ml in buffer C)] and 5 pl

of 5x binding buffer (20% [wt/vol] Ficoll, 50 mM HEPES [pH 7.9], 5mM EDTA, 5

69

mM dithiothreitol). The remainder of the reaction mixture contained 1 pg poly(dl-
dC), 200 pg of probe (unless otherwise noted), bromophenol blue to a final
concentration of 0.06% [wt/vol], and water to volume. For supershifts, nuclear
extracts were preincubated with antibodies for 20 min at 4°C prior to the binding
reaction. Samples were electrophoresed through 5.5% polyacrylamide gels in 1x

TBE (90 mM Tris base, 90 mM boric acid, 0.5 mM EDTA) at 160 V.

Antibodies-Rabbit antibodies specific to the carboxyl terminus of C/EBPy
and the amino terminus of C/EBPy were prepared against synthetic peptides
corresponding to these sequences (Parkin et al 2002). Rabbit anti-ClEBPa
(14AA), rabbit anti-CIEBPB specific to the carboxyl terminus (C-19), rabbit anti-
C/EBP6 (C-22), rabbit anti-CIEBPs (C-22) and normal rabbit IgG were purchased
from Santa Cruz Biotechnology. Rabbit anti-CIEBPB specific to the amino

terminus has been described (Williams et al 1991).

70

RESULTS

C/EBPfl heterodimerizes with C/EBPy in B cell lines-Previous work in our
lab has shown that stable expression of C/EBPB, C/EBPot, or C/EBP6 in P388
murine B lymphoblasts confers the ability to induce IL-6 expression with LPS
(Bretz et al 1994; Hu et al 1998). Furthermore, we also found the leucine zipper
possesses critical determinants for the activity of CIEBPs on the lL-6 promoter in
addition to mediating dimerization to known positive effectors of the C/EBP family
(Hu et al 2000). In the course of verifying the DNA binding activity of C/EBPB in
the P388-CB cell line (P388 cell stably transfected by C/EBPB), we surprisingly
found the majority of CIEBPB to be in heterodimers with C/EBPy (Fig. 2). We
have since analyzed nuclear extracts from P388 cells stably transfected for
expression for C/EBPa (P388-Ca), C/EBPB (P388-CB), CIEBP6 (P388-C6) and
found the majority of all three isoforrns to be in heterodimers with C/EBPy. As
shown in Fig. 2, the heterodimerzDNA complexes are supershifted by C/EBPot, [3,
and 6-specific antibodies, as well as by ClEBPy-specific antibody. A gel shift
complex formed with each extract that migrates even more rapidly than the
C/EBP heterodimers was also supershifted by C/EBPy-specific antibody,
suggesting that this species is a C/EBPy homodimer. In addition, we also
performed an electrophoretic mobility shift assay (EMSA) using nuclear extract
from P388 cells stably transduced for both C/EBPB and C/EBP6 expression.
Consistently, we found that most of C/EBPB and C/EBP6 were in the form of

heterodimers with C/EBPy (Fig. 3).

71

P388-Nee P388-CB P388-C6 P388-N90 P388-Ca
N a B 6 y N B y N 6 y

 

 

Figure 2. Ectopically expressed CIEBPot, [3 and 6 predominantly form
heterodimers with ClEBPy. EMSA was performed using nuclear extracts
of P388-Neo, P388-Ca, P388-CB, and P388-C6 cells. Binding reactions
included normal rabbit lgG (N), carboxyl-terminus-specific anti-ClEBPot (a),
anti-CIEBPB ((3), anti-C/EBP6 (6), or anti-ClEBPy (y). Arrows labeled azy,
[3:7, 6:7 and 7:7 indicate the positions of C/EBP:DNA complexes. Arrows on
the right indicate supershifts. The major C/EBPa, [3 or 6 complex is
supershifted by both C/EBPot, B, or 6-specific and C/EBPy-specific
antibodies.

72

P388-CB/6-1 P388-CBI6-2

 

 

N B 5 YI3+513+5+Y N l3 5 Y 3+5l3+5+v

I ‘1 Supershifts

WM

‘ W de- 6:1I6zy

IIIIMI 4' 731

 

I ‘,~I‘III

IIII'“ ‘

   

  
 

illlljtiw‘ lllliiili Il‘l'iili
“I‘M“ “I I" III"

     

I II?
I

    

Figure 3. Ectopically expressed CIEBP6 and 6 predominantly form
heterodimers with ClEBPy. EMSA was performed using nuclear
extracts of P388-CW6 cells. Binding reactions included normal rabbit lgG
(N), carboxyl-terminus—specific anti-CIEBPB (B), anti-CIEBP6 (6), or anti-
C/EBPy (y). Arrows on the right indicate the positions of C/EBPzDNA
complexes and supershifts. The major C/EBPB and 6 complex are
shifted by both C/EBPB, 6-specific and C/EBPy—specific antibodies.

73

Next, we sought to extend our findings to a B cell line commonly used In
studies of lL-6 expression, WEHI 231 (Hobbs et al 1991; Macfarlane et al 1998;
Lee et al 1998; Venkataraman et al 1999). Treatment of WEHI 231 cells with
LPS induced IL-6 mRNA by 2 hours and expression increased through 24 hours
(Fig. 4). Nuclear extracts from LPS stimulated cells were analyzed by EMSA at 0

and 24 hours (Fig. 5). The major induced C/EBPzDNA complex was largely
supershifted by antibody to C/EBPy and partially shifted by antibody to C/EBPB
and CIEBP6. So, C/EBPy is the major CIEBP species observed in LPS-
stimulated WEHI 231 cells that are expressing lL-6, suggesting that induction of
CIEBszy and C/EBP6zy heterodimers was associated with induction of LPS-
induced lL-6 expression. Furthermore, the fact that the major C/EBP species
observed with LPS-stimulation were C/EBszy heterodimers is not consistent

with an inhibitory role for ClEBPy in the LPS induction of lL-6 expression.

C/EBPy is the preferential heterodimeric partner of C/EBPfl-The
observation that C/EBP proteins occur predominantly as heterodimers with
C/EBPy and not as homodimers suggested that they might preferentially
associate with C/EBPy. In order to test the entry of C/EBPB into C/EBPfizy
heterodimers, a C/EBPB expression vector was transiently transfected into P388
cells over a range of quantities including those that effectively transactivated the
lL-6 promoter with LPS stimulation (see Fig. 9). EMSA of nuclear extracts of the
transfected cells revealed that C/EBPB:y heterodimers were the predominant

binding species at all quantities tested (Fig. 6). Apparently, C/EBszy

74

IL..6 l n ‘ ‘

 

 

Figure 4. A northern blot of RNA samples isolated from a time
course of LPS treatment upon WEHI 231 B cells was successively
hybridized for lL-6 and GAPDH

75

Figure 5. EMSA was performed using nuclear extracts of WEHI 231
cells that were untreated or LPS-treated for 24 hours. Binding reactions
included normal rabbit lgG (N), anti-ClEBPa(a), carboxyl-terminus—specific anti-
C/EBPB (B), anti-CIEBP6 (6), anti-CIEBPs (s), carboxyl-terminus—specific anti-
C/EBPy (y), or anti-CIEBPB and anti-CIEBP6 (8+6). Arrows labeled Bty, 6:7, LIP: y
and W indicate the positions of C/EBPzDNA complexes. Arrows on the right
indicate supershifts. The C/EBPB and LIP (a truncated form of C/EBPB consisting
of amino acids 132-276) complexes are supershifted by both C/EBPB-specific
and C/EBPy-specific antibodies. The CIEBP6 complex is supershifted by both
C/EBP6-specific and C/EBPy-specific antibodies.

76

24hr
Na [363 yB+6

0hr
NaB 88 yB+6

 

cit-

4— supershifts

:53

III“ 'l'lll‘

will all"

 

(“‘4“le

mtlu

77

'Y

7! 7:

t

l 4‘11“

III (I ‘
"it“. IIIMNIIIMI ““1

u III
I. .tiIl

II,

, (1‘

a E

 

Ill”
i I‘umi uII

       
 

, ‘ [III
uIIIIIn . tittIIIIlIIIIm‘

lllllllllllll'l‘ "w “ '

Bug C/EBPB
0 C/EBPB N [3 'y

I <— .
‘ ‘ y ‘7 ‘ x , ‘5. \ supershifts

«m a“ “i “I‘m ' ‘
w I I, I l

4— Bw

 

‘1 4— 7:“!

WM m dill-ii -, .y» ‘

Figure 6. CIEBPB: y heterodimers are detected in preference to CIEBPB
and ClEBPy homodimers. EMSA was performed using nuclear extracts of
P388 cells transiently transfected with increasing quantities (0, 0.5, 1, 2, 4, 6, 8,
and 12 pg) of pMEX-CIEBPB. The EMSA of the 12 pg transfectants also was
performed with binding reactions that included normal rabbit lgG (N), carboxyl-
terminus—specific anti-C/EBPB ([3), or carboxyl-terminus—specific anti-C/EBPy
(y). Arrows labeled [5:6, Bzy, and yzy indicate the positions of C/EBPzDNA
complexes. Arrows on the right also indicate supershifts. The C/EBPB:B
complex is supershifted by only C/EBPB-specific antibodies, the C/EBPyzy
complex by only C/EBPy-specific antibodies. and the C/EBPfizy complex by
both C/EBPB-specific and C/EBPy—specific antibodies. A weak, non-specific
background species co-migrating with C/EBPB:y is evident in the 0 pg lane.

78

heterodimers formed at the expense of C/EBPy homodimers at lower quantities
of vector (Fig. 6; 0.5, 1, 2 pg). C/EBPB homodimers were observed only at higher
vector quantities, where C/EBPy homodimers were no longer observable (Fig. 6;
2, 4, 6, 8, 12 pg). In addition, a similar transfection experiment was performed by
using C/EBPB192-276, an expression vector containing leucine zipper domain of
C/EBPB. Consistently, C/EBPB192-275:y heterodimers formed at the expense of
C/EBPy homodimers at lower quantities of vector (Fig. 7; 0.5, 1pg). C/EBPB192-275
homodimers became evident only at higher vector quantities. These results
suggest that the C/EBPB associates preferentially with the C/EBPy as compared
to itself.

To test if C/EBPB:y heterodimers have a greater affinity for the CIEBP
binding site oligonucleotide than CIEBPB homodimers, we performed an EMSA
by incubating different amounts of nuclear extract from P388-CB with a
radiolabeled CIEBP binding site. Both C/EBPfizy heterodimer and CIEBPB
homodimer exist in the NE, and their ability to bind the CIEBP site decreased
when less NE was used (Fig. 8A). But there was no difference in the relative
abundance of ClEBszy heterodimer and CIEBPB homodimer shift species with
decreasing NE (Fig. 83), suggesting that C/EBPy being a preferred
heterodimerization partner for C/EBPB rather than enhanced binding affinity of

the heterodimer.

79

8pg C/EBPB

 

 

   

° N B y
M
' W
supershifts
‘—
MWWWWWW
W“ ‘ w 4 7:7
mm... “I ' . . ‘3192-2767Y
MI I ‘I . " [3192-216
:5192-276

 

thmflw

Figure 7. CIEBPBMWG: y heterodimers are detected in preference
to CIEBPBmms and CIEBP-1 homodimers. EMSA was performed
using nuclear extracts of P388 cells transiently transfected with
increasing quantities (0, 0.5, 1, 2, 4, 6, 8, and 12 pg) of pMEX-
C/EBPB192_276. The EMSA of the 12 pg transfectants also was performed
with binding reactions that included normal rabbit lgG (N), carboxyl-
terminus—specific anti-CIEBP6 (B), or carboxyl-terminus—specific anti-
C/EBPy (y). Arrows labeled [319247633192-275. [3192476134 and 7:7 indicate
the positions of C/EBPzDNA complexes. Arrows on the right also indicate
supershifts. The C/EBPB192_276:[5192_276 complex is supershifted by only
C/EBPB-specific antibodies, the C/EBPyzy complex by only C/EBPy-
specific antibodies, and the CIEBPB192_276:7 complex by both C/EBPB-
specific and C/EBPy-specific antibodies. A weak, non-specific
background species co-migrating with C/EBPB192_276:7 is evident in the 0
pg lane.

80

 

A P388-CB

108642105

 

 

  
 

 

 

 

"-e-ti - ‘B:B

100 +CIBPbeta:gamma
:3 80~
5 +CIBPbetabeta
u we
‘6
*5 40~
§ 20,
it

o

 

 

NE(pg)10 8 6 4 2 0

Figure 8. CIEBPB:8 and CIEBPB:y have similar affinity for the CIEBP
binding site in the IL-6 promoter. A. EMSA was performed using
decreasing quantities (10, 8, 6, 4, 2, 1 and 0.5 pg) of nuclear extracts of
P388-CB and and a labeled oligonucleotide corresponding to the lL-6
promoter CIEBP binding site. Arrows labeled [3:8 and [3:7 indicate the
positions of C/EBPzDNA complexes. B. The radioactivity associated with
C/EBPB homodimers and C/EBPB:y heterodimers were quantitated using a
Storm Phosphorlmager (Molecular Dynamics) when decreasing quantities
of nuclear extracts were used. The change of C/EBPB:y and C/EBP [3:8
binding to lL-6 promoter C/EBP binding site are shown.

81

C/EBPy augments C/EBPfl-stimulated transcription of the IL-6 promoter-
C/EBPy by itself is certainly not an activator of the lL-6 promoter because its
presence in P388 cells is not sufficient to allow LPS induction of lL-6. However,
our observations suggested that C/EBPy—containing heterodimers might activate
the IL-6 promoter in LPS stimulated cells. To test this notion, we performed
transient transfections of increasing quantities of C/EBPB vector with and without
added expression of C/EBPy (Fig. 9). CIEBPy augmented LPS-induced
expression from the IL-6 promoter at all quantities of C/EBPB expression vector
used. This is very surprising for a factor generally believed to be a transdominant
inhibitor of CIEBP activators (Cooper et al 1995). If ClEBPy acted as an inhibitor,
CIEBPB would be expected to induce less Iuciferase expression in the presence
of added C/EBPy, rather than more Iuciferase expression. In fact, 0.5 pg of
C/EBPB vector with 0.5 pg of C/EBPy vector is twice as effective as 1 pg of
C/EBPB vector alone. This is consistent with C/EBPB:y heterodimers being more
effective activators than C/EBPB homodimers. Presumably, overexpression of
C/EBPy drives more C/EBPB into heterodimers than would occur at endogenous
levels of C/EBPy expression. When EMSA was performed upon nuclear extracts
prepared from P388 cells transiently transfected with CIEBPB expression vector
with and without added C/EBPy expression vector, a higher ratio of CIEBPfizy
heterodimer to C/EBPB homodimer is indeed observed in cells transfected with

C/EBPy expression vector (2.2 as opposed to 1.3) (Fig. 10). To further test the

82

120

 

 

 

 

 

 

 

 

 

~100
.5
.30 g
g +-gamma
~60 'g ++gamma
g A control
-40 ’5
3
.20 g
g
A 0
CIEBPB '
LPS " + b

 

Figure 9. CIEBPB is a more potent activator of LPS-induced lL-6
transcription under conditions of added CIEBPy expression.
Transfections were carried out in duplicate with (+gamma) and without (-
gamma) 0.5 pg C/EBPy vector, with the pg quantities of C/EBPB vector and
LPS treatment as indicated. Luminometer values were normalized for
expression from a co-transfected SV40 early promoter B-galactosidase-
reporter. These values were then normalized to a relative value of 1 for cells
receiving neither a CIEBP expression vector nor LPS. The data presented
are the mean of 3 experiments with their standard error.

83

Control CIEBPB CIEBPB+7
N B 7 N B 7 N l3 7

9‘3. an

-- in» ~ a. «i=3
u m M “I” 445:?
- a +v=1

”9‘9“! Q96

Ratio of CIEBPB:y to CIEBPfizfl: 1.3 2.2

Figure 10. CIEBPy drives CIEBPB into CIEBPflzy heterodimers.
EMSA was performed using nuclear extracts of P388 cells transiently
transfected pMEX control vector, 2 pg pMEX-CIEBPB or 2 pg pMEX-
C/EBPB plus 0.5 pg pMEX-ClEBPy. Arrows labeled 8:8, Bzy, and yzy
indicate the positions of CIEBPzDNA complexes. The radioactivity
associated with C/EBPB homodimers and C/EBPB:y heterodimers was
quantitated using a Storm Phosphorlmager (Molecular Dynamics) and
the ratio of C/EBPfizy to CIEBP Bzflis shown.

84

ability of C/EBPy to promote formation of C/EBPB:y heterodimers, a constant
quantity of C/EBPB expression vector and over a range of quantities of the
CIEBPy expression vector including those that effectively transactivated the lL-6
promoter following LPS stimulation was transfected into P388 cells (Fig. 9). An
EMSA of nuclear extracts of the transfected cells revealed that C/EBPB:y
heterodimers became apparent and increased in abundance with increasing
quantities of C/EBPy (Fig. 11).

The stimulatory effects of C/EBPy were also observed in transient
transfections where increasing amounts of C/EBPy expression vector were
added to a constant amount of CIEBPB expression vector. These transfections
were performed with LPS stimulation and the expression vectors were
cotransfected with an IL-6 promoter-reporter. C/EBPy clearly augmented the
ability of C/EBPB to mediate LPS induction of the lL-6 promoter (Fig. 12).
C/EBPy activity was observed even when the C/EBPy vector was transfected at a
8-fold excess over C/EBPB vector, although C/EBPy by itself exhibited no activity
(see Fig. 15). Our results therefore suggest that C/EBPy, rather than functioning
as an inhibitor to lower levels of C/EBPB activity, actually augments that activity
on the IL-6 promoter.

In contrast to the stimulatory effects observed when C/EBPy was
cotransfected with C/EBPB in LPS-induced lL-6 expression, C/EBPy actually
inhibited the limited activation of the lL-6 promoter that can be observed in

transfection of C/EBPB alone (Fig. 13A). This inhibition was reversed by

85

A

CIEBPB o 0.25pg——> N p y
' " ‘ n 4— Supershifts

. 4- l3?!
4- 7:7

 

 

Figure 11. CIEBPy promotes formation of CIEBPflzy heterodimers.
EMSA was performed using nuclear extracts of P388 cells transiently
transfected pMEX control vector, 0.25pg pMEX-CIEBPB, and 0.25pg
pMEX-CIEBPB with increasing quantities (O, 0.1.0.25, 0.5, 1, 2, and 4 pg)
of pMEX-ClEBPy. The EMSA of the 4 pg pMEX-ClEBPy transfectants
also was performed with binding reactions that included normal rabbit
lgG (N), carboxyl-terminus-specific anti-CIEBPB (B), or carboxyl-
terminus-specific anti-C/EBPy (y). Arrows labeled 8:8 and 8:7 indicate the
positions of C/EBP:DNA complexes. Arrows on the right also indicate
supershifts. The C/EBPyzy complex is supershifted by only C/EBPy-
specific antibody and the C/EBPB:y complex by both C/EBPB-specific
and C/EBPy-speciflc antibodies. Two unidentified slower migrating
species that are not modulated by transfection and are reactive with
C/EBPy-specific antibody are evident in control and experimental lanes.

86

2.5

 

 

 

5;
Relative Luciferase Expression

fl
9
(1|

 

 

 

 

[II
9 . . . . .
CIEBP-1 - - 0 0.5 1.0 2.0
CIEBPB - - 0.25 V
LPS - + }

 

 

—I— lL-6
El Il.-6 controls

 

Figure 12. CIEBPy stimulates LPS-induced lL-6 transcription when
expressed with CIEBPB. Transient transfections of P388 cells were
carried out in duplicate with the pg quantities of expression vectors and
LPS treatment as indicated. Luminometer values were normalized for
expression from a cotransfected SV40 early promoter-B-galactosidase
reporter. These values were then normalized to a relative value of 1 for the
cells receiving CIEBPfl expression vector and treated with LPS. The data
presented are the mean of 7 experiments with their standard error.

87

 

 

~1.4

- 1.2

 

—I— beta-l-gamma
a Control

 

 

 

Relative Luciferase Expression

 

 

 

CIEBPy . o 0.5 1.0 2.0

 

CIEBPB - 0.25 >

Figure 13. CIEBPy inhibits CIEBPB-induced IL-6 transcription in the
absence of LPS treatment, while that inhibition is reversed by NF-
KB p65 expression. A. Transient transfections of P388 cells were
carried out in duplicate with the pg quantities of expression vectors as
indicated. Luminometer values were normalized as in Figure 12, except
final values were normalized to a relative value of 1 for the cells receiving
C/EBPB expression vector alone. The data presented are the means of 3
experiments with standard error.

88

l

l

l

l

4'
UI

 

 

 

 

l r 4.5
l “ 4
l
' * 3-5 .5 +0.05 ug p65
l en
l ‘3 g +0.5ug p65
', ~15 3 +1ugp65
Q!

I ~ 2 g o 0.05 09 p65 controls
. 15 :55 o 0.5 ug p65 controls

8 _.

— 1 g A 1ug p65 controls

I D u r 0.5 a

 

 

in
T
«>0
o

 

 

CIEBPy - - - 0 0.5 1.0 2.0
CIEBPB - - 0-25 >
p65 - + - + $

Figure 13. CIEBPy inhibits CIEBPB-induced lL-6 transcription in
the absence of LPS treatment, while that inhibition is reversed by
NF-KB p65 expression. B. Transient transfections of P388 cells were
carried out in duplicate with the pg quantities of expression vectors as
indicated. Luminometer values were normalized as in Figure 12, except
final values were normalized to a relative value of 1 for the cells
receiving both C/EBPB and NF-KB p65 expression vectors. The data
are derived from one experiment carried out at various doses of p65
vector.

89

cotransfection with NF-KB p65, allowing dosage-dependent C/EBPy stimulatory
activity in the absence of LPS stimulation (Fig. 133). The lowest quantity of p65
vector used in the cotransfection (0.05 pg) potentiated robust stimulation by
C/EBPy. These data support the notion that C/EBPy may play a key role in the
synergy between C/EBPB and NF-KB. Indeed, NF-KB was also activated upon
LPS treatment of P388 cells. As shown in Figure 14A, when P388 cells were
treated with LPS over a time course, NF-KB binding to the lL-6 promoter NF-KB
motif was detected at as early as one hour LPS treatment with increased binding
through 24 hours. To test which NF-KB member is activated in this 8 cell by
LPS, a supershift experiment was performed with different NF-xB antibodies. As
shown in Figure 148, p50zp65 heterodimers were the major species induced;
p50:p50 homodimers and p50:c-Rel heterodimers’ DNA binding were also
induced. Thus, NF-KB was translocated to the nucleus upon LPS treatment and
was available to support the expression of IL-6 together with CIEBPs.

It is possible that the C/EBPy expressed from our expression vector
differed from endogenous C/EBPy in its ability to stimulated lL-6 transcription.
Furthermore, other investigators who found that C/EBPy acted as an inhibitor of
CIEBP transactivation performed their studies in the absence of LPS stimulation.
Perhaps, LPS leads to the modification of C/EBPy into a form capable of
transactivation. To test these possibilities, transient transfections were performed
with the C/EBPy expression vector by itself with the lL-6 promoter reporter (Fig.

15). No stimulation of the IL-6 promoter above that induced by LPS stimulation

90

P388
LPS(Hr) o 1 2 4 8 24

 

a...» ,....- in. n“ «v ... .n a! u“ 3“

 

 

B
LPS(Hr) o 4
N p50 p52 p65 ReIB c-Rel N p50 p52 p65 RelB c-Rel
I I ;‘ I :Supershlft
.. a I~ a t. . .i ( p50:p65Ic-Rel
4 950:950

unused iauuii

Figure 14. LPS induces NF-KB DNA binding of IL-6 promoter in
P388 cells. A. EMSA was performed using nuclear extracts of
P388 cells that were untreated or LPS-treated over a time course as
shown and a labeled oligonucleotide corresponding to the IL-6
promoter NF-KB binding site. B. Nuclear extract of untreated P388
cells or LPS-treated P388 cells were incubated with normal rabbit
lgG (N), anti-p50, anti-p52, anti-p65, anti-RelB, or anti-c—Rel. Arrows
labeled p50:p65/c-Rel and p502p50 indicate the positions of NF-
KBIDNA complexes. Arrowheads on the right indicate supershifts.
The NF-KB complexes are supershifted by p50, p65 and c-Rel-
specific antibodies.

91

30

 

l25

 

- 20
+ gamma
~ 15 + beta
A control

 

d
O

 

 

 

 

lblative Luciferase Expression

..

.,

a

.1

..
f
(ll

1D
I
o

 

CIEBPy - - 0 0.5 1.0 2.0

 

LPS - + >

Figure 15. CIEBPy by itself has no stimulatory activity upon
the lL-6 promoter. Transient transfections were carried out in
duplicate with increasing quantities of C/EBPy expression vector
as indicated with LPS stimulation. Transient transfection with
0.25 pg C/EBPB expression vector served as a positive control
for transactivation. Luminometer values were normalized as
described in Figure 9. The data are the mean of 3 experiments
with standard error.

92

alone was observed over a range of C/EBPy expression vector amounts
comparable to that used in the transient transfections where C/EBPy stimulatory
activity was observed. Thus C/EBPy has no stimulatory activity by itself, even in

the presence of LPS treatment.

C/EBPy stimulatory activity shows both promoter and cell-type specificity-In order
to test whether the presence of a CIEBP binding site is sufficient for the
stimulatory activity of C/EBPy, we performed transient transfections with DEI4(-
35alb)LUC, a promoter-reporter that contains four copies of a C/EBP binding site
tandemly arrayed upstream of the albumin minimal promoter (Fig.16). This
simple CIEBP reporter failed to show any stimulation by C/EBPy expression
suggesting that a more complex promoter is required for stimulatory activity. We
then performed transient transfections with the TNFa and lL-8 promoters (Fig.
16). These promoters, like lL-6, are in part regulated by NF-xB and CIEBP. The
TNFa promoter does not display synergy between NF-KB and CIEBPB (Liu et al
2000), while the lL-8 promoter shows strong synergy between these two factors
(Matsuaka et al 1993; Stein et al 1993; Kunsch et al 1994). Consistent with a
possible role in the synergy between NF-xB and C/EBPB, C/EBPy expression
had little effect upon the TNFa promoter, but displayed even more stimulation of
the lL-8 promoter than was observed for the lL-6 promoter. In contrast to the
promoter specificity observed for C/EBPy, C/EBPB was stimulatory for all of the
promoters tested (Fig. 16, compare control cells treated with LPS to cells treated

with LPS and cotransfected with C/EBPB). Furthermore, C/EBPy stimulatory

93

 

 

 

 

 

 

 

 

.. r 4.5
~4 g +lL-6
43.5 .3 +m=alpha
- 3 '5. +DB4
' l 25 '2 —e—lL-8
2 g n lL-6 controls
. 1.5 § 0 ThFalpha controls
..a A DB4controls
' 1 3 0 IL-8 controls
0.5 .‘é
a E . o a

 

 

CIEBPy - - o 0.25 0.5 1.0

 

CIEBPB - - 0.25 p

LPS - + p

 

Figure 16. CIEBPy stimulates LPS-induced transcription from
the lL-8 promoter, but is inactive for the TNFa promoter and a
simple CIEBP-driven promoter. Transient transfections of P388
cells were carried out in duplicate with the pg quantities of
expression vector and LPS treatment as indicated. Luminometer
values were normalized as in Fig. 5. The data presented for the
lL—8, TNFa, and DEI4(-353Ib) promoters are means of 3, 3, and 5
experiments, respectively, with standard error. The data for the IL-
6 promoter from Figure 12 are presented for comparison.

94

Consensus lL-6 DEI

 

Figure 17. Both the IL—6 and DEI CIEBP binding motifs bound
ClEBPy-containing species. EMSA was performed using nuclear
extracts from P388-CB cells and a labeled binding site oligonucleotides
corresponding to the CIEBP consensus binding site, the lL-6 promoter
C/EBP bindin site, and the DEI albumign C/EBP binding site. Binding
reactions included normal rabbit lgG (N), C-terminus-specific anti-
C/EBPB (B), or C-terminus-specific anti-ClEBPy (y). Arrows labeled 8:8,
7:7, and [3:7 indicate the positions of CIEBPzDNA complexes.

95

activity does not appear dependent upon differential binding of C/EBPy to
differing CIEBP binding sites. Both the lL-6 and DEI CIEBP binding motifs bound
C/EBPy-containing species in EMSA performed upon nuclear extracts from P388
cells overexpressing C/EBPB (Fig. 17), while neither the TNFa nor the lL-8
CIEBP binding motifs detectably bound any CIEBP species under the same
conditions (data not shown). The ability of C/EBPy to stimulate transcription does
not seem to correlate with its avidity for specific C/EBP binding motifs, but rather
depends upon more complex aspects of promoter structure such as those that
determine synergy between transcription factors. The stimulatory activity of
C/EBPy is thus promoter specific, requires a complex promoter to be observed,
and may function in the synergistic activation of promoters by NF-KB and CIEBP
family members.

The fact that C/EBPy is most prominently expressed in cells of the B
lymphoid lineage (Cooper et al 1995) led us to ask if its stimulatory activity was
unique to that cell type or could be observed in other cell lineages that display
LPS inducible lL-6 expression. In order to test this, we utilized several
macrophages including P38801(lL-1), IC21, and ANA-1. In these cell lines, only
a relatively low proportion of CIEBPzDNA complexes are supershifted by anti-
C/EBPy in an EMSA (Fig. 18). LPS is a potent inducer of lL-6 expression in these
cell lines (Fig. 19). Then, we utilized P38801(lL-1) to test if C/EBPy has
stimulatory activity in this macrophage cell line. This macrophage cell line is
actually a derivative of the original P388 B lymphoblast tumor (Bauer et al 1986).

Transient transfections were performed where increasing amounts of C/EBPy

96

Figure 18. EMSA was performed using nuclear extracts of
P38801(IL1), IC21, and ANA-1 cells that were untreated or LPS-treated for 4
hours. Binding reactions included normal rabbit lgG (N), anti-CIEBPa (a ),
carboxyl-terminus—specific anti-CIEBP8 (8), anti-CIEBP8 (5), or carboxyl-
terminus—specific anti-CIEBPy (y). Arrows labeled 8:8, 8:7, and Lley indicate the
positions of C/EBPzDNA complexes. “?” denotes an unidentified CIEBP
dimerization partner. Arrows on the right also indicate supershifts.

97

lC21 ANA-1

P38801(lL-1)

 

LPS

 

2 "ti VII ' M ..
. “ \‘II
t . ‘ ' ». ..-..ul\lIl.

E
.:
2
o
a.
:3
CD
VV

>.
MI."Ill“,tl'
'1: I (I ‘ I

.'

“‘ .

“I‘IIIIIIII IIY'IIIP III"; ,‘ \ I

    
 

I' \\\ \‘ AlpflIlIlqu, III M
I

I

W“. t
l . II
P‘ (III

.6 III ,,\~;nl\ll\M\l(((ll.
:1 .III I ‘

with!

98

P388D1IL1 I021 ANA-1

 

LPS - + - + . 4-

IL-6

GAPDH

 

Figure 19. A northern blot of RNA samples isolated from
untreated and LPS-treated P38BD1(IL-1), ICZ1 or ANA-1 cells was
successively hybridized for lL-6 and GAPDH.

99

expression vector were added to a constant amount of C/EBP8 expression
vector. These transfections were performed with LPS stimulation and the
expression vectors were cotransfected with an lL—6 promoter-reporter. In contrast
to P388 B cells where C/EBPy clearly augmented the ability of C/EBP8 to
mediate LPS induction of the lL-6 promoter, C/EBPy had no effect on C/EBP8
stimulation of LPS-induced lL-6 expression in P388D1(|L1) cells (Fig. 20). Thus
in addition to promoter specificity, the stimulatory activity of C/EBPy shows cell

type-specificity.

C/EBPy stimulatory activity requires heterodimerization with C/EBPfl-The
heterodimerization of C/EBP8 with C/EBPy in cells dependent upon C/EBP8 for
LPS induction of IL-6 expression (Fig. 2), the appearance of C/EBP8zy
heterodimers on LPS induction of lL-6 in WEHI 231 cells (Fig. 4, 5), and the
predominance of C/EBP8zy heterodimers over a wide range of C/EBP8
expression in P388 cells (Fig. 6), led us to test whether C/EBPy stimulatory
activity in transfections with C/EBP8 requires heterodimer formation. To that end,
we performed transient transfections with a chimeric C/EBP8 containing the
leucine zipper of yeast GCN4. C/EBP8-GCN4LZ (Fig. 1) can activate transcription
from an albumin DEI site-driven reporter (Williams et al 1995), as well as the lL-6
promoter-reporter in conjunction with LPS treatment (Fig. 210; see controls), and
is unable to heterodimerize with C/EBPy in vitro or in vivo (Parkin et al 2002). The

heterologous leucine zipper prevents heterodimerization, but allows the chimeric

protein to homodimerize. To verify expression, DNA binding, and the

100

heterodimeriztion properties of C/EBP8-GCN4LZ, western blot analysis and
EMSA were performed using nuclear extracts of transiently transfected cells
(Figs. 21A, 21 B). Western analysis of nuclear extracts from P388 cells
transfected with increasing quantities of C/EBP8-GCN4LZ expression vector
detected increasing quantities of a CIEBP-related protein at the expected
molecular weight of approximately 38 kD (Fig. 21A). As can be seen in an EMSA
of the same nuclear extracts, the overexpression of C/EBP8-GCN4LZ fails to
drive C/EBPy into heterodimers (Fig. 21 B), in contrast to C/EBP8 (Fig. 6). The
major EMSA species associated with transfection of the C/EBP8-GCN4LZ
expression vector could be supershifted with antibody specific to the amino
terminus of C/EBP8, but not with antibody specific to the carboxyl terminus of
C/EBP8 as would be expected for replacement of the carboxyl terminus (Fig.

21 B). Furthermore, this EMSA species could not be supershifted with antibody
specific to the carboxyl terminus of C/EBPy, indicating a lack of dimerization with
C/EBPy. Transient transfection of increasing amounts of C/EBPy expression
vector with a constant amount of C/EBP8-GCN4LZ expression vector were
carried out in comparison to increasing amounts of C/EBPy expression vector
with a constant amount of C/EBP8 expression vector (Fig. 210). The ability of
C/EBPy to augment C/EBP8 activity was largely blocked by the GCN4 leucine
zipper. This is consistent with C/EBPy stimulatory activity being dependent on its
ability to dimerize with C/EBP8. The fact that C/EBP8-GCN4LZ by itself supports

LPS induction of the lL-6 promoter indicates that while C/EBPy can augment

101

p.b.--szz-x-re--ie-+-~—erzs

 

»2 +P388 lym phoblasts

 

 

 

 

 

 

 

i
I
I
I
l _,5,§ —s—nnnmun
I g macrophages
I 3' A P388 controls
l —1 a
I g n P38801(|L1)controls
l '5’
1 _l
I Q 05.3
l E
r E o a
CIEBPy - - o 0.5 10
creeps - - 0-25 4
LPS - + >

Figure 20. CIEBPy lacks stimulatory activity in P38801(IL1)
macrophages. Transient transfections of P38801(lL-1) cells were
carried out in duplicate with the pg quantities of expression vectors and
LPS treatment as indicated. Luminometer values were normalized as in
Figure 12. The data presented are the mean of 3 experiments with
standard error. The data for P388 lymphoblasts from Figure12 are
presented for comparison.

102

 

Figure 21. CIEBPy stimulatory activity is dependent upon the
formation of CIEBP8zy heterodimers. The replacement of the
CIEBP leucine zipper in CIEBP8 with that of GCN4 blocked
CIEBPy activity. A, a western blot was performed using nuclear
extracts of P388 cells transiently transfected with increasing
quantities (0, 0.5, 1, 2, 4, 6, 8, and 12 pg) of pMEX-ClEBP8-GCN4LZ.
The primary antibody used in the detection of C/EBP8-GCN4LZ was
amino-terminus—specific anti-CIEBP8. An arrow marks the position
of C/EBP8-GCN4LZ. The positions of protein standards are noted.

103

Transfected Cells

 

0.512468128NBCyC

I, I” H ‘ ‘—
‘ , ‘ supershifts
II (I If ‘ ‘ ‘—

|<- fiifl-GCN‘ILz

   
 

'HM“ Ill ,8" ‘4-7‘7

“(Ill ‘1‘ ‘ -._lI\‘ \‘I IW‘III 'I‘IIIIII

1 I

III“ MW M ”It, . \III".ille llllII“ I'Illllltl I

 

Figure 21. CIEBP-1 stimulatory activity is dependent upon the
formation of CIEBP8:y heterodimers. The replacement of the CIEBP
leucine zipper in CIEBP8 with that of GCN4 blocked CIEBPy activity.
B, EMSA was performed using nuclear extracts of P388 cells transiently
transfected with increasing quantities (0, 0.5, 1, 2, 4, 6, 8, and 12 pg) of
pMEX— C/EBP8-GCN4LZ. The EMSA of the 12 pg transfectants also was
performed with binding reactions that included normal rabbit lgG (N),
amino-terminus-specific anti-CIEBP8 (N8), carboxyl-terminus—specific
anti-CIEBP8 (C8), or carboxyl-terminus—specific anti-C/EBPy (Cy). Arrows
labeled 8—GCN4LZ and yzy indicate the positions of C/EBPzDNA complexes
and supershifts. The C/EBP8-GCN4LZ complex is only supershifted by
amino-terminus-specific anti-C/EBP8.

104

2.5

 

 

+ beta+ganuna

...L
on

lblatlvo Luciferase Activity

-I— beta-GCN4IZ+gamma
A beta+gamma controls

D beta-GCN4ll+gamma controls

 

 

 

 

 

 

 

a ~o.s

Q E.’ . . . . . o
CIEBPy - - o 0.5 1.0 2.0
CIEBPB - - 0.25 >
LPS . + p

 

Figue 21. CIEBPy stimulatory activity is dependent upon the
formation of CIEBszy heterodimers. The replacement of the CIEBP
leucine zipper in CIEBPB with that of GCN4 blocked CIEBPy activity.
C, transient transfections of P388 cells were carried out in duplicate with
the pg quantities of expression vectors and LPS treatment as indicated.
Luminometer values were normalized as in figure 12. The data for
C/EBPB-GCN4LZ+C/EBP (beta-GCN4LZ+gamma) are the mean of 4
experiments with standard error. The data for C/EBPB+C/EBPy
(beta+gamma) from figure 12 are presented for comparison.

105

C/EBPB activity, formation of heterodimers containing C/EBPy is not necessary
for CIEBP activity on the lL-6 promoter.

C/EBPy stimulatory activity resides with its leucine zipper domain-We next
initiated studies to determine the structural components of C/EBPy sufficient for
its stimulatory activity. A form of C/EBPy deleted for the region amino-terminal to
the bZIP domain (Fig. 1; C/EBPy-ANco) was compared to intact ClEBPy in the
same experimental regime as described for Figure 6, where increasing amounts
of CIEBP-y expression vector were added to a constant amount of CIEBPB
expression vector. These transfections were performed with LPS stimulation and
the expression vectors were cotransfected with an IL-6 promoter-reporter.
C/EBPy-ANco, although lacking the 57-residue amino-terminus, had as much
stimulatory activity as wild type C/EBPy (Fig. 22A). An EMSA species that
increased in abundance with increasing quantities of the C/EBPy—ANco vector
further indicated successful expression of C/EBPy—ANco (Fig. 223). Thus the
amino terminus of C/EBPy is unnecessary for its stimulatory activity.

Since C/EBPy homodimers by themselves have no stimulatory activity
(Fig. 15) and the ability of C/EBPy to heterodimerize with CIEBPB appears to be
critical for its stimulatory activity (Fig. 21), we tested whether C/EBPy activity
required the formation of a heterodimeric leucine zipper, a heterodimeric DNA
binding domain, or both. To that end, we performed transient transfections with a
vector expressing a chimeric C/EBP comprised of a ClEBPy amino terminal and

basic region, and a C/EBPB leucine zipper (Fig. 1; ClEBPy-BLZ). As a control for

106

 

 

 

 

 

 

 

l +beta+gamma
; r 2 g
i 3 +beta+gamma-
. — 1.5 " N
4‘ 3- co
i 1 a A beta+gamma
1 b 3 controls
I =3
+ E _ 0.5 3 n beta+gamma-
. Q g Nco controls
IV E l i i T l f o E
:2
CIEBPy - - 0 0.5 1.0
CIEBPB - - 0.25 >
LPS - + >

 

Figure 22. The amino-terminal region of CIEBP-1 is not required for
stimulatory activity. A, transient transfections of P388 cells were
carried out in duplicate with pg quantities of expression vectors and
LPS treatment as indicated. Luminometer values were normalized as
described in figure 12. The data for ClEBPB+ClEBPy—ANco
(beta+gamma-Nco) are the mean of 3 experiments with standard error.

107

4119

 

Cy N Ny Cy
will "é
‘ supershifts
W s

Marlin (ll) ll“ «limit twill

WW" . l

4' 7:7

{my-Nco

   

v ,1:

  

"ll
1‘le ‘~.
.w " ~

»

    

    

Figure 22. The amino-terminal region of CIEBPy is not required for
stimulatory activity. B, EMSA was performed using nuclear extracts of
P388 cells transiently transfected with 0, 2, and 4 pg of pMEX-ClEBPy-
ANco. Binding reactions included normal rabbit IgG (N), amino-terminus-
specific anti-ClEBPy (Ny), or carboxyl-tenninus—specific anti-ClEBPy (Cy).
Arrows labeled yiy -Nco and yty indicate the positions of C/EBP:DNA
complexes. Arrows on the right indicate supershifts. The C/EBPy-ANco
complex is supershifted by both amino and carboxyl terminus-specific
anti-C/EBPy because it is heterodimeric with wild type C/EBPy.

108

: “ll! .‘rm J‘meluw ”I
, W.,... W... W1
91 kD—' 1111 111, .

42.5—'m «in m
33 —

 

"““N— Muv M .m M” “H” m ,W
133 — W W I” W WWI;
7.7 —

Figure 23. The formation of a heterodimeric CIEBPB:y
leucine zipper is sufficient for the stimulatory activity of
CIEBPy. A, a western blot was performed using nuclear
extracts of P388 cells transiently transfected with increasing
quantities (0, 0.5, 1, 2, 4, 6, 8, and 12 pg) of pMEX-ClEBPyBLz.
The primary antibody used in the detection of C/EBPy-BLZ was
carboxyl-terminus—specific anti-C/EBPB. An arrow marks the
position of C/EBPyBLZ. The positions of protein standards are
noted.

109

Figure 23. The formation of a heterodimeric CIEBPB:y leucine zipper
is sufficient for the stimulatory activity of CIEBPy. B, EMSA was performed
using nuclear extracts of P388 cells transiently transfected with increasing
quantities (O, 0.5, 1, 2, 4, 6, 8, and 12 pg) of pMEX- C/EBPy-BLZ. EMSA of P388
cells and the 12 pg transfectants also was performed with binding reactions that
included normal rabbit lgG (N), amino-terminus-specific anti-CIEBPB (NB),
carboxyl-tenninus—specific anti-CIEBP6 (CB), amino-terminus-specific anti-
C/EBPy (Ny) or carboxyl-terminus—specific anti-CIEBPy (Cy). Arrows labeled yzy
and yzy-BLZ indicate the positions of C/EBPzDNA complexes. Arrows on the right
indicate supershifts. The CIEBPY-BLz complex (similar in mobility to the ClEBPy
complex in P388 cells) is supershifted by carboxyl-tenninus-specific anti-
C/EBPB in addition to the C/EBPy-specific antisera.

110

P388+CIEBPy—Bu

P388
N NB CB N1 C7

Transfected Cells

 

 

N "3 CB N'y Cy

2 4 6 3121.9

1

.5

  

supershift

 

I

 

““‘111‘ -11“.
1111111 “‘1 31111111111111 111(1‘11‘. ‘ 1‘
“1 1‘ ‘ 1 1 11» it“)
111111111l\l11111 W 11’ 11111"1 1111115111, 111‘ {‘1‘ 1.11 ,‘11
1“" U1“, “‘1 ‘ \113

11

 

H 1.11 11“" 1‘
111111 111‘ 1 1 1‘ 11
1 1 . 11

‘1K11‘1‘1‘
1 , [~11‘I 11 11,111 (11 1111 1 1
‘ ‘1‘ 3‘1 1111‘111‘11 111‘ ,

”2'11“"

1111“?”
"11111 ,

"1“,?” ,1,,11111

 

1
1
l
I
I
1
1
1
1
l
1
1
1
I
l
1
1
1
8

 

 

 

 

 

 

_25 +gamma-betaLZ
.20 g
g +gamma-
, ~15 1? betalz+gamma
1 10 § 0 control
1 1;
1 r5 -‘
1 . f 0 g
CIEBPv-Bu - o 0.25 0.5 1.0
LPS , + +

 

Figure 23. The formation of a heterodimeric CIEBPB:y leucine
zipper is sufficient for the stimulatory activity of CIEBPy. C,
transient transfections were carried out in duplicate with and without
0.5 pg C/EBPy vector, with the pg quantities of C/EBPy-BLZ expression
vector and LPS treatment as indicated. Luminometer values were
normalized as described in figure 9. The data are the mean of 3
experiments with standard error.

112

C/EBPy-BLZ expression and DNA binding, western blot analysis and EMSA were
performed using nuclear extracts of cells transiently transfected over a range of
quantities of the C/EBPy-BLZ expression vector (Figs. 23A, 23B, 230). Western
analysis with antibody specific to the carboxyl terminus of C/EBPB detected
increasing quantities of a CIEBP-related protein at the expected molecular weight
of approximately 19 kD (Fig. 23A). A major EMSA species was detected in
proportion to the amount of C/EBPy-BLz expression vector (Fig. 238). That
species was supershifted with antibodies specific to the carboxyl terminus of
C/EBPB, the amino terminus of C/EBPy and the carboxyl terminus of ClEBPy, but
not with antibody specific to the amino terminus of C/EBPB (Fig. 230). This is
consistent with a heterodimerization between C/EBPy-BLZ and endogenous
C/EBPy. We tested the ability of C/EBPy-BLZ to support LPS induction of lL-6 with
and without transfection of a vector expressing intact C/EBPy (Fig. 23A).
Surprisingly, in LPS-treated cells, the C/EBPy-BLZ expression vector by itself
could support as much as 10-fold induction of the lL-6 promoter and the addition
of 0.5 pg of C/EBPy expression vector enhanced that stimulatory activity to 20-
fold induction. While the stimulatory activity of C/EBPy-BLZ is less than that of
intact C/EBPB (40-fold for 1 pg of vector without C/EBPy and 100-fold with
C/EBPy; see Fig. 9), the degree to which C/EBPy augmented C/EBPy—BLZ activity
was similar to its enhancement of C/EBPB activity (about 2.5-fold). This suggests
that C/EBPy stimulatory activity resides in formation of a heterodimeric CIEBPfizy

leucine zipper.

113

To further show that C/EBPB leucine-zipper is sufficient to mediate LPS
induction of the lL-6 expression in vivo, we performed stable transduction of
P388 cells with a murine retroviral vector expressing C/EBPy-BLZ. These cells
were compared to P388-CB cells as well as a control cells transfected with the
same vector lacking an expressed insert (P388-Neo). The cells transfected for
C/EBPy-BLZ expression were designated P388-07431 EMSA of nuclear extracts
from two transfected cell pools verified proper expression of the stably
transduced ClEBPy-BLZ genes. In comparison to nuclear extracts from P388-
Neo, nuclear extracts from P388-0743a yielded supershifted DNA-protein
complexes upon incubation with antibody specific for the carboxyl terminus of
C/EBPB and the carboxyl terminus of C/EBPy (Fig. 24). Next, P388-Neo, P388-
CB and P388-Cy-BLZ cells were treated with LPS over a time course of 0, 2, 4, 8,
and 24 h, and RNA was isolated. Northern analyses were performed to detect
IL-6 mRNA. Confirming our transient transfection results, C/EBPy-BLZ itself is
sufficient to confer on P388 cells the ability to induce lL-6 transcription in
response to LPS (Fig. 25), although the lL-6 mRNAs were not induced to as high
a level as with intact C/EBPB. Furthermore, previous work in our lab showed that
C/EBPBGLZ had no activity in stable transfectants (Hu et al 2000). Taken
together, these results suggest that the C/EBPfizy heterodimeric zipper in the

absence of any conventional activation domains is the key determinant to

support LPS induction of the lL-6 promoter.

114

PM EX yBLz1 yBLZZ

 

N CBCy N CBCy N CBCy

a mm “In
. will ., Supershift

 

Figure 24. CIEBPyBu is overexpressed in P388 cells.
EMSA was performed using nuclear extracts of P388-CwLz
cells. Binding reactions included normal rabbit IgG (N). C-
terminus-specific anti-CIEBPB (B) or anti-ClEBPy (y). Arrows
on the right indicate the positions of C/EBPzDNA complex and
supershifts. Themajor C/EBPyBLZ complex are shifted by
C/EBPB-specific antibody. C/EBPy-specific antibody only
shifted part of this complex.

115

PMEX CIEBPyBLz1 CIEBPyBLZZ

LPS(Hrs) 024824024824 024824

IL-6 .. ‘4 "

 

A...» . .u .1
Wfiflwcumwmwr-wu-
1| '. ‘33-! ‘l' -4-'—- 'r- ' . . ‘ .
GAPDH 'W' M a; ..-',; 1; ,f' 9:, 1‘." L;,.-,; "w? '. ‘ '

 

Figure 25. CIEBPyBLz confers LPS-inducible expression of lL-6
to P388 lymphoblasts. A northern blot of RNA samples isolated
fromuntreated and LPS-treated P388-Neo, P388-CyBLZ1 and
P388Cyi3LZ 2 cells was successively hybridized for lL-6 and GAPDH.

116

DISCUSSION

The data presented in this paper demonstrate an activating role for
C/EBPy in transcription from the lL-6 and IL-8 promoters in B lymphoid cells.
C/EBPy, which in other contexts can inhibit activation by C/EBP family members
(Roman et al 1990; Parkin et al 2002), was found to augment the C/EBPB-
dependent LPS stimulation of lL-6 and lL-8 promoter-reporters in P388 B
lymphoblasts. This stimulatory activity of C/EBPy is dependent on its formation of
heterodimers with C/EBPB and, indeed, C/EBPB is largely found in heterodimers
with C/EBPy in P388 B cells that have gained the capacity for LPS-induced lL-6
expression upon transfection of a C/EBPB expression vector. Surprisingly, the
critical structural feature for this stimulatory activity is the formation of a
heterodimeric leucine zipper between C/EBPB and C/EBPy. C/EBPy stimulatory
activity was found to be promoter specific with activity seen on lL-6 and lL-8
promoter—reporters, and not on TNFa and albumin DEI promoter—reporters.
C/EBPy stimulatory activity was also found to be cell-type specific, being
observed in P388 B cells, but not in their P38801(lL-1) macrophage derivatives.

The stimulatory activity of C/EBPy was surprising, since it is generally
accepted as being an inhibitor of C/EBP transcriptional activators (Cooper et al
1995; Cooper et al 1994). However, the same investigators that first
demonstrated the inhibitory activity of C/EBPy found that immunodepletion of
C/EBPy from an in vitro transcription assay inhibited the activity of the BCL1

immunoglobulin heavy chain and the Rous Sarcoma Virus promoters (Cooper et

117

al 1992). Similarly, C/EBPy synergizes with Stat6 and NF-KB p50/p65 to induce
the germline gamma 3-immunoglobulin promoter in a B cell line (Pan et al 2000).
CIEBP has also been found to enhance B-globin gene expression in collaboration
with CP-1 (Wall et al 1996). Another instance of a positive role for C/EBPy has
been found in the expression of pp52, a leukocyte-specific phosphoprotein
postulated to regulate cytoskeleton structure (Omori et al 1998). Thus, the role of
C/EBPy as a transcriptional activator does not seem unusual. It seems neither
inherently an activator nor an inhibitor. Rather, the identity of its promoter context
and dimerization partner may be the overriding features that govern the specific
role of C/EBPy in transcription. Heterodimerization with C/EBPy has two effects
on the ability of C/EBPB to activate the lL-6 promoter: it inhibits C/EBPB activity
in the absence of LPS and enhances C/EBPB transactivation in LPS stimulated
cells. Therefore, we predict that in B cells the net effect of ClEBPy is to greatly
increase the index of LPS inducibility of the lL-6 promoter. This prediction could
be tested in B lineage cells derived from C/EBPy-deficient mice (Kaisho et al
1999).

C/EBPy stimulatory activity was observed with the lL-6 and IL-8 promoter-
reporters, but not with the TNFa or the DEI promoter-reporters. One
distinguishing characteristic of the lL-6 and lL-8 promoters is synergistic
regulation by C/EBPB and NF-KB (Matsuaka et al 1993; Stein et al 1993; Kunsch
et al 1994). It is tempting to propose a specific role for C/EBPy in promoting this
synergy. While the experiments reported here do not provide a direct

demonstration of such a mechanism, the findings that C/EBPy inhibits C/EBPB

118

activation of the lL-6 promoter in the absence of LPS (Fig. 13A) and that this
inhibitory effect is converted to a stimulatory effect by NF-KB p65 expression

(Fig. 138) are consistent with this. Furthermore, our previous studies found that
the activity of C/EBPB on the lL-6 promoter was dependent on an intact NF-KB
site (Hu et al 2000). It is, however, unlikely that the stimulatory role of C/EBPy is
limited to promoters that exhibit synergy between C/EBPB and NF-xB. Other
promoters for which C/EBPy stimulatory activity has been suggested, including
immunoglobulin heavy chain (Cooper et al 1992; Pan et al 2000Wa|l et al 1996),
B-globin (Wall et al 1996), and pp52 (Omori et al 1998), do not display synergistic
regulation by C/EBPB and NF-xB.

C/EBPy stimulatory activity also displays cell-type specificity. This is also
the case for the inhibitory activity of C/EBPy (Parkin et al 2002). Stimulatory
activity was seen in P388 B cells, but not in their macrophage derivatives,
P38801(lL-1) (Fig. 20). C/EBPy is normally a minor component of the CIEBP
family members expressed in these macrophages (Fig. 18), where C/EBPB forms
heterodimers with another as yet unidentified protein (Parkin et al in 2002).
Perhaps, C/EBPy stimulatory activity in P388D1(lL-1) macrophages is precluded
by the heterodimerization of C/EBPB with this other protein. The activity of
C/EBPy in specific cell-types may be dependent upon the availability of an

appropriate partner for heterodimeriztion. Our studies have certainly

demonstrated that heterodimerization is critical for activity (Fig. 21C).

119

 

The promoter and cell-type specificity of C/EBPy activity lead us to
speculate that the ability of C/EBPy to augment LPS stimulation of lL-6
transcription in B cells may provide a mechanism for autocrine lL-6 production to
drive the maturation of B cells, while suppressing or having a neutral effect on
other inflammatory cytokines such as TNFa. This could be particularly important
as a source of lL-6 in a T—independent B cell response. Perhaps C/EBPy-
deficient mice (Kaisho et al 1999) will exhibit slower kinetics in their B cell
response to gram-negative bacteria.

While we have observed ClEBPy stimulatory activity on both the lL-6 and
lL-8 promoters, it is interesting to note that no lL-8 orthologue exists in mouse
and rat (Huang et al 1992; Wuyts et al 1996). In humans, however, both lL-6 and
IL-8 are autocrine factors in myeloma tumor progression (Treon et al 1998;
Shapiro et al 2001). It would be interesting to test whether a functional
association exists between C/EBPy expression and the autocrine production of
these cytokines in myelomas.

Although C/EBPy is most abundantly expressed in immature B cells
(Roman et al 1990), we have found C/EBPfizy and CIEBP8:y heterodimers to be
the predominant form of C/EBP in LPS-stimulated WEHI 231 cells (Fig. 5), a
relatively mature, surface-lgM expressing B cell. The occurrence of CIEBPfizy
heterodimers as a major species has also been observed in glioma, mammary
tumor, and hepatoma cell lines, as well as in brain, pancreas, and ovary (Parkin

et al 2002). It will be worthwhile to evaluate whether C/EBPy can stimulate target

120

 

 

genes that are already known to be positively regulated by C/EBPB in these cell-
types and tissues.

We found that ectopic expression of C/EBPB in P388 cells led to the
formation of C/EBPB2y heterodimers at the expense of C/EBPy homodimers,
while C/EBPB homodimers were observed only at the highest levels of C/EBPB
expression (Fig. 6). This may indicate a preference for heterodimeriztion between
these C/EBP family members. This result cannot be explained by large pools of
either monomeric C/EBPy or unbound ClEBPy dimers being available for
dimerization with C/EBPB. If this were the case, C/EBPy homodimers would not
be eliminated as they are by C/EBPB expression. It is also possible that post-
translational modifications of these CIEBP family members regulate their
dimerization.

Perhaps, the most surprising result reported here is the ability of a
chimeric C/EBP consisting of C/EBPy with the leucine zipper of C/EBPB to
stimulate the lL-6 promoter in cells that express only endogenous C/EBPy (Fig.
23). Since C/EBPy by itself is unable to support LPS induction of the lL—6
promoter (Fig. 15), this result demonstrates that the formation of a C/EBPB:y
heterodimeric zipper in the absence of any conventional activation domains is
sufficient to support LPS induction of the lL-6 promoter. This is consistent with
our earlier finding that expression of the bZIP domains of C/EBPB, 8, or on was
sufficient to confer LPS inducibility to the lL-6 promoter in P388 cells (Hu et al
2000). In those studies, we found that the C/EBPB bZIP domain was largely

dimerized with C/EBPy and that activity required an intact NF-KB binding site. We

121

 

have now found that C/EBPy stimulatory activity is observed on two promoters
that show synergy between C/EBP and NF-KB, and that ClEBPy expression
actually becomes inhibitory in the absence of NF-KB expression (Fig. 13A). Our
findings are consistent with the C/EBP leucine zipper being a critical determinant
in facilitating the synergy between NF-KB and CIEBP family members that is
observed for several genes encoding cytokines and class I acute phase proteins
including IL-6, lL-8, lL-12, granulocyte-colony stimulating factor, lL-1B, serum
amyloid A1, A2, A3, and 1-acid glycoprotein (Poli 1998). Functions other than
dimerization have been demonstrated for leucine zipper domains. In the CIEBP
family, the leucine zipper of C/EBPa mediates cell-type specificity of albumin
promoter activation (Nerlov et al 1994) and phosphorylation of serine 276 in the
leucine zipper of human CIEBPB confers calcium-regulated transcriptional
stimulation to a promoter that contains binding sites for C/EBPB (Wegner et al
1992). Recently, the leucine zipper of transcription factor v-Myb has been found
to regulate the commitment of hematopoietic progenitors (Karafiat et al 2001).
Mutation of the leucine zipper can alter the transforming potential of v-Myb from
the macrophage lineage to the erythroid and granulocytic lineages. It is tempting
to speculate that the leucine zipper of CIEBP family transcription factors interacts
differentially with other transcription factors such as NF-KB or with coactivators of

transcription in manner dependent upon leucine zipper dimerization partners.

122

 

REFERENCES

Akira, S., H. Isshiki, T. Sugita, O. Tanabe, S. Kinoshita, Y. Nishio, T. Nakajima,
T. Hirano and T. Kishimoto. 1990. A nuclear factor for lL-6 expression (NF-IL6)
is a member of a CIEBP family. EMBO J. 9: 1897-906.

Antonson P. and K. G. Xanthopoulos. 1995. Molecular cloning, sequence and
expression patterns of the human gene encoding CCAAT/enhancer binding
protein or (C/EBPa). Biochem. Biophys. Res. Commun. 215: 106-13.

Bauer, S. R., K. L. Holmes, H. C. Morse Ill and M. Potter. 1986. Clonal
relationship of the lymphoblastic cell line P388 to the macrophage cell line
P388D1 as evidenced by immunoglobulin gene rearrangements and expression
of cell surface antigens. J. Immunol. 136: 4695-9.

Bretz, J. D., S. C. Williams, M. Baer, P. F. Johnson and R. C. Schwartz. 1994.
CIEBP-related protein 2 confers lipopolysaccharide-inducible expression of
interleukin 6 and monocyte Chemoattractant protein 1 to a lymphoblastic cell line.
Proc. Natl. Acad. Sci. USA 91: 7306-10.

Cooper, C., D. Johnson, C. Roman, N. Avitahl, P. Tucker and K. L. Calame.
1992. The C/EBP family of transcriptional activators is functionally important for
lg VH promoter activity in vivo and in vitro. J. Immunol. 149: 3225-31.

Cooper, C. L., A. L. Berrier, C. Roman and K. L. Calame. 1994. Limited
expression of CIEBP family proteins during B lymphocyte development. Negative
regulator lg/EBP predominates early and activator NF-lL-6 is induced later. J.
Immunol. 153: 5049-58.

Cooper, C., A. Henderson, S. Artandi, N. Avitahl and K. Calame. 1995. lg/EBP
(C/EBP gamma) is a transdominant negative inhibitor of CIEBP family
transcriptional activators. Nucleic Acids Res. 23: 4371-7.

Fort, P., L. Marty, M. Piechaczyk, S. El Salrouty, C. Dani, J. Jeanteur and J. M.
Blanchard. 1985. Various rat adult tissues express only one major mRNA
species from the glyceraldehyde-3-phosphate-dehydrogenase multigenic family.
Nucleic Acids Res. 13: 1431-42.

Gutman, G. A., N. L. Warner and A. W. Harris. 1981. Immunoglobulin

production by murine B-lymphoma cells. Clin. Immunol. lmmunopathol. 18: 230-
44.

123

 

in

Hobbs, M. V., R. J. McEvilly, R. J. Koch, G. J. Cardenas and D. J. Noonan.
1991. Interleukin-6 production by murine B cells and B cell lines. Cell. Immunol.
132: 442-50.

Hu, H.-M., M. Baer, S. C. Williams, P. F. Johnson and R. C. Schwartz. 1998.
Redundancy of CIEBP alpha, -beta, and -delta in supporting the
Iipopolysaccharide-induced transcription of IL-6 and monocyte Chemoattractant
protein-1. J. Immunol. 160, 2334-42.

Hu, H.-M., Q. Tian, M. Baer, C. J. Spooner, S. C. Williams, P. F. Johnson and R.
C. Schwartz. 2000. The CIEBP bZlP domain can mediate Iipopolysaccharide
induction of the proinflammatory cytokines interleukin-6 and monocyte
Chemoattractant protein-1. J. Biol. Chem. 275: 16373-81.

Huang, 8., J. D. Paulauskis, J. J. Godleski and L. Kobzik. 1992. Expression of
macrophage inflammatory protein-2 and KC mRNA in pulmonary inflammation.
Am. J. Pathol. 141: 981-88.

Johnson, P. F. and S. C. Williams. 1994 in Liver Gene Expression (Yaniv, M.
and Tronche, F., eds.), pp. 231-258, R. G. Landes Company, Austin, TX.

Kaisho, T., H. Tsutsui, T. Tanaka, T. Tsujimura, K. Takeda, T. Kawai, N.
Yoshida,

K. Nakanishi and S. Akira. 1999. Impairment of natural killer cytotoxic activity
and interferon gamma production in CCAAT/enhancer binding protein gamma-
deficient mice. J. Exp. Med. 190: 1573-81.

Karafiat, V., M. Dvorakova, P. Pajer, J. Kralova, Z. Horejsi, V. Cennak, P.
Bartunek, M. Zenke and M. Dvorak. 2001. The leucine zipper region of Myb
oncoprotein regulates the commitment of hematopoietic progenitors. Blood 98:
3668-76.

Kinoshita, S., S. Akira and T. Kishimoto. 1992. A member of the CIEBP family,
NF-IL6 beta, forms a heterodimer and transcriptionally synergizes with NF-IL6.
Proc. Natl. Acad. Sci. USA 89: 1473-6.

Kunsch, C., R. K. Lang, C. A. Rosen and M. F. Shannon. 1994. Synergistic
transcriptional activation of the IL-8 gene by NF-kappa B p65 (RelA) and NF-lL-6.
J. Immunol. 153: 153-64.

Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 227: 680-5.

Lee, J. R. and G. A. Koretzky. 1998. Production of reactive oxygen

intermediates following CD40 ligation correlates with c-Jun N-terminal kinase
activation and lL-6 secretion in murine B lymphocytes. Eur. J. Immunol. 28:

124

 

4188-97.

Liu, H., P. Sidiropoulos, G. Song, L. J. Pagliari, M. J. Birrer, B. Stein, J. Anrather
and R. M. Pope. 2000. Regulation of lL-6 and lL-8 expression in rheumatoid
arthritis synovial fibroblasts: the dominant role for NF-kappa B but not C/EBP
beta or c-Jun. J. Immunol. 164: 4277-85.

Macfarlane, D. E. and L. Manzel. 1998. Antagonism of immunostimulatory CpG-
oligodeoxynucleotides by quinacrine, chloroquine, and structurally related
compounds. J. Immunol. 160: 1122-31.

Matsuaka, T., K. Fujikawa, Y. Nishio, N. Mukaida, K. Matsushima, T. Kishimoto
and S. Akira. 1993. Transcription factors NF-lL6 and NF-kappa B synergistically
activate transcription of the inflammatory cytokines, interleukin 6 and interleukin
8. Proc. Natl. Acad. Sci. USA 90: 10193-7.

Murayama, T., Y. Ohara, M. Obuchi, K. S. A. Khabar, H. Higashi, N. Mukaida
and K. Matsushima. 1997. Human cytomegalovirus induces interteukin-8
production by a human monocytic cell line, THP-1, through acting concurrently
on AP-1- and NF-kappaB-binding sites of the interleukin-8 gene. J. Virol. 71:
5692-5.

Nerlov, C. and E. B. Ziff. 1994. Three levels of functional interaction determine
the activity of CCAAT/enhancer binding protein-alpha on the serum albumin
promoter. Genes Dev. 8: 350-62.

Nordeen, S. K. 1988. Luciferase reporter gene vectors for analysis of promoters
and enhancers. BioTechniques 6: 454-7.

Okamoto, S., N. Mukaida, K. Yasumoto, N. Rice, Y. lshikawa, H. Horiguchi, S.
Murakami and K. Matsushima. 1994. The interleukin-8 AP-1 and kappa B-like
sites are genetic end targets of F K506-sensitive pathway accompanied by
calcium mobilization. J. Biol. Chem. 269: 8582-9.

Omori, S. A., Smale, S., O’Shea-Greenfield, A., and Wall, R. 1998. Differential
interaction of nuclear factors with the leukocyte-specific pp52 promoter in B and
T cells. J. Immunol. 159, 1800-1808

Pan, 0., C. Petit-Frere, J. Stavnezer and L. Hammarstrom. 2000. Regulation of
the promoter for human immunoglobulin gamma3 germ-line transcription and its
interaction with the 3'alpha enhancer. Eur. J. Immunol. 30: 1019-29.

Parkin, S., M. Baer, T. D. Copeland, R. C. Schwartz and P. F. Johnson. 2002.

Regulation of C/EBP activator proteins by heterodimerization with C/EBPgamma
(lg/EBP). J. Biol. Chem. 277: 23563-72.

125

 

Poli, V. 1998. The role of CIEBP isoforms in the control of inflammatory and
native immunity functions. J. Biol. Chem. 273: 29279-82.

Roman, C., J. S. Platero, J. Shuman and K. Calame. 1990. lg/EBP-1: a
ubiquitously expressed immunoglobulin enhancer binding protein that is similar to
C/EBP and heterodimerizes with CIEBP. Genes Dev. 4: 1404-15.

Shapiro, V.S., M. N. Mollenauer and A. Weiss. 2001. Endogenous CD28
expressed on myeloma cells up-regulates interleukin-8 production: implications
for multiple myeloma progression. Blood 98: 187-93.

Stein, B. and A. S. Baldwin. 1993. Distinct mechanisms for regulation of the
interleukin-8 gene involve synergism and cooperativity between C/EBP and NF-
kappa B. Mol. Cell. Biol. 13: 7191-8.

Tanabe, 0., S. Akira, T. Kamiya, G. G. Wong, T. Hirano and T. Kishimoto. 1988.
Genomic structure of the murine lL-6 gene. High degree conservation of potential
regulatory sequences between mouse and human. J. Immunol. 141: 3875-81.

Treon, SP, and K. C. Anderson. 1998. Interleukin-6 in multiple myeloma and
related plasma cell dyscrasias. Curr. Opin. Hematol. 5: 42-8.

Venkataraman, C., G. Shankar, G. Sen and S. Bondada. 1999. Bacterial
Iipopolysaccharide induced B cell activation is mediated via a

phosphatidylinositol 3-kinase dependent signaling pathway. Immunol. Lett. 69:
233-8.

Wall, L., N. Destroimaisons, N. Delvoye and L. G. Guy. 1996. CAAT/enhancer-
binding proteins are involved in beta-globin gene expression and are differentially
expressed in murine erythroleukemia and K562 cells. J. Biol. Chem. 271: 16477-
84.

Wegner, M., Z. Cao and M. G. Rosenfeld. 1992. Calcium-regulated
phosphorylation within the leucine zipper of CIEBP beta. Science 256: 370-3.

Williams, S. C., C. A. Cantwell and P. F. Johnson. 1991. A family of C/EBP-
related proteins capable of forming covalently linked leucine zipper dimers in
vitro. Genes Dev. 5: 1553-67.

Williams, S. C., M. Baer, A. J. Dillner and P. F. Johnson. 1995. CRP2 (CIEBP
beta) contains a bipartite regulatory domain that controls transcriptional
activation, DNA binding and cell specificity. EMBO J. 14: 3170-83.

Williams, S. C., Y. Du, R. C. Schwartz, S. R. Weiler, M. Ortiz, J. R. Keller and P.
F. Johnson. 1998. C/EBPepsilon is a myeloid-specific activator of cytokine,

126

 

chemokine, and macrophage-colony-stimulating factor receptor genes. J. Biol.
Chem. 273: 13493-501.

Wuyts, A, A. Haelens, P. Proost, J. P. Lenaerts, R. Conings, G. Opdenakker and
J. Van Damme. 1996. Identification of mouse granulocyte chemotactic protein-2
from fibroblasts and epithelial cells. Functional comparison with natural KC and
macrophage inflammatory protein-2. J. lmmunol.157: 1736-43.

Zafarana, G., R. Rottier, F. Grosveld and S. Philipsen. 2000. Erythroid
overexpression of C/EBPgamma in transgenic mice affects gamma-globin
expression and fetal liver erythropoiesis. EMBO J. 19: 5856-63.

Zhang, X., J. M. Wang, W. H. Gong, N. Mukaida and H. A. Young. 2001.

Differential regulation of chemokine gene expression by 15-deoxy-delta 12,14
prostaglandin J2. J. Immunol. 166: 7104-11.

127

 

 

CHAPTER 3

CIEBPQ (CHOP/GADD153) IS A NEGATIVE REGULATOR OF LPS-

INDUCED lL-6 EXPRESSION IN 3 CELLS

128

 

'm

 

ABSTRACT

C/EBPQ was originally identified as a gene induced upon DNA damage
and growth arrest. It has been shown to be involved in the cellular response to
endoplasmic reticulum stress. Because of sequence divergence from other
C/EBP family members in its DNA binding domain and its consequent inability to
bind the CIEBP consensus-binding motif, C/EBPQ can act as a dominant
negative inhibitor of other CIEBPs. C/EBP transactivators are essential to the
expression of many proinflammatory cytokines and acute phase proteins, but a
role for C/EBPQ in regulating their expression has not been described. We have
found that expression of C/EBPQ is induced in response to LPS treatment of B
cells at both the mRNA and protein levels. Correlating with the highest levels of
C/EBPQ expression at 48 hours after LPS treatment, both the abundance of
C/EBP DNA binding species and lL-6 expression are downregulated.
Furthermore, ectopic expression of C/EBPQ inhibited C/EBPB-dependent lL-6
expression from both the endogenous lL-6 gene and an IL-6 promoter-reporter.
These results suggest that CIEBP; functions as negative regulator of lL-6

expression in B cells and that it contributes to the transitory expression of lL-6

that is observed after LPS treatment.

129

 

INTRODUCTION

CIEBPs comprise a family of bZIP regulatory proteins containing two
distinct domains: a basic region that binds to DNA, and an adjacent leucine-
zipper region that enables homo- and heterodimerization of C/EBP proteins
(Landschulz et al 1988). In mammalian species, the family consists of six unique
members: C/EBPa, C/EBPB, CIEBP8, CIEBPs, C/EBPy, and C/EBPQ (reviewed
by Lekstrom-Himes and Xanthopoulos 1998). In vitro studies have implicated
both C/EBPB and C/EBPB as participating in the transcriptional activation of
proinflammatory cytokines such as lL-6, as well as many acute phase proteins
(reviewed by Akira 1997). Indeed, the promoter region of IL-6 contains CIEBP
binding sites (Tanabe et al 1988). In addition, both C/EBPB and CIEBPs can
activate an IL-6 promoter-reporter in transient expression assays (Kinoshita et al
1992; Matsuaka et al 1993).

C/EBPt; is a small nuclear protein that readily dimerizes with other
members of the CIEBP family. However, the basic region of C/EBPQ deviates
significantly from the consensus DNA binding domain defined by other members
of the CIEBP family. It contains proline substitutions in two conserved residues,
which are believed to be essential to the interaction of these proteins with
consensus CIEBP DNA binding sites (O’Neil et al 1990; Schuman et al 1990).
Indeed, C/EBPQ-C/EBP heterodimers fail to bind several known CIEBP sites in
vitro. And when expressed in cells, C/EBPQ attenuates the ability of other C/EBP

proteins to activate promoters containing such sites (Ron et al 1992). Based on

130

 

these findings, C/EBPQ was proposed to act as a dominant negative inhibitor of
other CIEBPs (Ron et al 1992). However, recent studies have suggested that
C/EBPQ-C/EBP heterodimers can activate several downstream target genes
(Wang et al 1998) and that C/EBPQ-C/EBPB heterodimers can specifically
activate transcription of the murine carbonic anhydrase VI gene through a non-
consensus binding site (Sok et al 1999).

C/EBPC; is transcriptionally activated and highly expressed following
treatment of cells with a variety of growth arrest and DNA damaging conditions
(Fomace et al 1989; Luethy et al 1990; Choi et al 1992; Carlson 1993). More
generally, CIEBPQ has been shown to be inducible by agents that either directly
(Bartlett et al 1992; Chen et al 1992; Price et al 1992; Halleck et al 1997) or
indirectly (Carlson et al 1993; Marten et al 1994; Bruhat etal 1997) lead to
impairment of the endoplasmic reticulum folding environment (i.e. ER stress).
The CIEBPQ promoter contains a putative CIEBP-binding site suggesting that
CIEBP: itself is regulated by C/EBPs (Park et al 1992). Indeed, overexpression
of CIEBP8 was found to transactivate expression of a C/EBPQ promoter-reporter
in HepG2 hepatoma cells (Sylvester et al 1994).

In our previous studies, we found that the stable expression of CIEBP8 in
a murine B lymphoblast cell line is sufficient to confer Iipopolysaccharide (LPS)-
inducible IL-6 expression, thus establishing an essential role for C/EBP
transcription factors in IL-6 expression (Bretz et al 1994). We also found that
C/EBPa, B, 6, and a are largely redundant to each other in the LPS-induced

expression of IL-6 (Hu et al 1998;Wi|liams et al 1998). Since C/EBPQ, along with

131

various acute phase proteins, is induced in the livers of rats treated with LPS
(Sylvester et al 1994), we wondered whether it might also be induced by LPS in
B cells and thus have a role in the regulation of CEBP-dependent lL-6
expression. Here, we report that C/EBPQ is induced in response to LPS
treatment of B cells and apparently contributes to the downregulation of IL-6
expression that occurs after the initial induction of lL-6 by LPS treatment. The
highest levels of CIEBP; expression at 48 hours after LPS treatment correlated
with a dramatic decrease in the abundance of CIEBP DNA binding species, as
well as the attenuation of lL-6 expression. The levels of nuclear CIEBP8, the
predominant activating C/EBP family member, are maintained and even
modestly increase during the attenuation phase. However, C/EBPQ potently
inhibits C/EBPB-dependent lL-6 expression from both the endogenous lL-6 gene
and an lL-6 promoter-reporter. Thus, C/EBPQ functions as negative regulator of

lL-6 expression in B cells and contributes to the transitory expression of lL-6 that

is observed after LPS treatment.

132

 

 

MATERIALS AND METHODS

Cells and cell culture- WEHI-231 cells are murine B cells (Gutman et al
1981) (American Type Culture Collection; CRL 1702). P388 cells are murine B
lymphoblasts (Bauer et al 1986) (ATCC; CCL46). P388-CB cells and P388-Nco
cells have been described previously (Hu et al 1998). WEHI-231 cells were
cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS)
and 50 pM B-mercaptoethanol. P388 cells and their derivatives were cultured in
RPMI 1640 medium supplemented with 5% FBS and 50 pM B-mercaptoethanol.
Certain cultures were treated with LPS derived from Escherichia coli serotype

055285 (Sigma) added to 10 pglml. All cells were grown at 37 °C in 5% 002.

Transfections-Transductions of P388-CB with a G418-resistant vector
encoding CIEBP6; were carried out by retroviral infection. Retrovirus stocks were
prepared by transient expression of 293T cells (Pear et al 1993) that were
grown in Dulbecco’s modified Eagle’s medium supplemented with 10% FBS. 3 pg
of the C/EBPQ retroviral expression vector were cotransfected with 3 pg of a
packaging construct, pMOV-w (Mann et al 1983). Transfections were performed
using DMRlE-C (Life Technologies) upon 80% confluent 293 T cells on 60 mm
plates. Virus stocks were harvested 60 hours post-transfection by centrifuging
the supernatants at 1500 rpm for 5 min followed by filtration through 0.45-pM-

pore-size filters. Retroviral infections were performed by the addition of 3ml virus

133

 

 

stock to 2x106 cells in the presence of 8 pglml polybrene (Sigma). The cells were
then incubated at 37°C for 3 hours during which time the cells were resuspended
every 30 min. The infected cells were then collected by centrifugation and
resuspended in growth medium. After 24 hours, the cells were split to four 60
mm plates, G418 (Life Technologies) was added to a final concentration of 670
pg/ml, and selection of resistant cells proceeded for 7 to 10 days.

Transient transfections were conducted with 2x106 cells, 6 pg of DNA, and
8 pl of DMRlE-C reagent (Life Technologies) in 1.2 ml of Opti-MEM medium (Life
Technologies). The DNA was comprised of 1 pg of an lL-6 promoter-reporter,
C/EBP expression vector, and pMEX plasmid to total 6 pg. The quantities of
C/EBP expression vectors are as indicated in the figure legends. Cells were
incubated in the transfection mixture for 5 h followed by the addition of RPMI
1640 medium supplemented to 15% with FBS. For the Iuciferase assays, the
medium of certain transfections was supplemented with 10 pglml LPS after 24
hours. After 4 hours in the presence or absence of LPS, transfected cells were
harvested, lysed, and analyzed for luciferase activity by using the Luciferase
Reporter Gene Assay Kit (Roche) and for B-galactosidase activity by using the
Luminescent B-Galactosidase Genetic Reporter System l| (Clontech).
Otherwise, cells were directly harvested for RNA and nuclear extract after 24

hours transfection.

Expression vectors and promoter-reporters-For transient transfections,

C/EBPB was expressed from pMEX (Williams et al 1991), which utilizes the

134

. 1‘

 

 

Moloney murine sarcoma virus promoter. For transient transfections, CIEBP6;
was expressed from pcDNA1 (Invitrogen), which uses the cytomegalovirus
promoter (from Dr. David Ron, NYU School of Medicine). For stable
transductions, a 9E10-myc-tagged CIEBP; was expressed from pSRaMSVtkneo
(Muller et al 1992), a retroviral vector derived from Moloney sarcoma virus (from
Dr. David Ron, NYU School of Medicine).

The lL-6 promoter-reporter consists of the murine lL-6 promoter (Tanabe
et al 1988) (-250 to +1) inserted into the luciferase vector, pXP2 (Nordeen 1988).
The SV40 early promoter-reporter is a commercial product, pBgal-Control
(Clontech). where the SV40 early promoter and enhancer sequences are cloned

upstream and downstream, respectively, of the lacZ gene.

RNA isolation and analysis-Total RNA was isolated using TRIzol reagent
(Life Technologies) according to the manufacturer’s directions. RNA’s were
electrophoresed through 1% agarose/formaldehyde gels. Transfers to
membranes were hybridized and washed to high stringency in 40 mM sodium
phosphate/1% SDS/1mM EDTA at 65°C. Hybridization probes were prepared
with a random priming kit (Life Technologies) with the incorporation of 5’-[ -32P]
dATP (3000 Ci/mmol; DuPont-New England Nuclear). The C/EBPQ probe
consisted of 0.6 kb partial murine cDNA (from David Ron, NYU School of
Medicine). The lL-6 probe was a 0.65 kb murine cDNA (from Drs. N. Jenkins and

N. Copeland, National Cancer Institute-Frederick). The glyceraldehyde-3-

135

 

“‘1

 

phosphate dehydrogenase (GAPDH) probe was a 1.3 kb rat cDNA (Fort et al

1985).

Western analysis-Nuclear extracts were prepared as described below.
The extracts (60 pg) were adjusted to 1x Laemmli sample buffer (Laemmli 1970)
and processed by sodium dodecyl sulfate-12% polyacrylamide gel
electrophoresis. The gel was transferred to Protran membrane (Schleicher and
Schuell), and antigen-antibody complexes were visualized with the Enhanced

Chemiluminescence Kit (Amersham).

Electrophoretic mobility shift assay (EMSA)-Nuclear extracts were
prepared as follows. Cells were washed in phosphate-buffered saline and lysed
in 15 mM KCI, 10 mM HEPES [pH 7.6], 2 mM MgCl2, 0.1 mM EDTA, 1 mM
dithiothreitol, 0.1% [vol/vol] NP-40, 0.5 mM phenylmethylsulfonyl fluoride, 2.5
pglml Ieupeptin, 5 pglml antipain, and 5 pglml aprotinin for 10 min on ice. Nuclei
were pelleted by centrifugation at 13,000 rpm for 60 sec at 4°C. Proteins were
extracted from nuclei by 20 min incubation at 4°C with vigorous vortexing in
buffer C (420 mM NaCl, 20 mM HEPES [pH 7.9], 0.2 mM EDTA, 25% [vol/vol]
glycerol, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 2.5 pglml
leupeptin, 5 pglml antipain, and 5 pglml aprotinin). Nuclear debris was pelleted
by centrifugation at 13,000 rpm for 30 min at 4°C and the supernatant extract
was collected and stored at -80°C. The EMSA probes were double-stranded

oligonucleotides containing a murine lL-6 C/EBP binding site (5’-

136

 

‘r-t

 

CTAAACGACGTCACATI'GTGCAATCTTAATAAGGTT-3’ annealed with 5’-
TGGAAACCT‘I’ATTAAGATI'GCACAATGTGACGTCGT-3’). The probe was
labeled with the incorporation of 5’-[a-32P] dATP (3000 Ci/mmol; DuPont-New
England Nuclear) and Klenow DNA polymerase. Underlined sequences
correspond to the CIEBP binding motifs.

DNA binding reactions were performed at room temperature for 20 min in
a 25 pl reaction mixture containing 6 pl of nuclear extract (1mg/ml in buffer C)
and 5 pl of 5x binding buffer (20% [wt/vol] Ficoll, 50 mM HEPES [pH 7.9], 5mM
EDTA, 5 mM dithiothreitol). The remainder of the reaction mixture contained 1 pg
poly (dl-dC), 200 pg of probe (unless otherwise noted), bromophenol blue to a
final concentration of 0.06% [wt/vol], and water to volume. For supershifts,
nuclear extracts were preincubated with antibodies for 20 min at 4°C prior to the
binding reaction. Samples were electrophoresed through 5.5% polyacrylamide

gels in 1x TBE (90 mM Tris base, 90 mM boric acid, 0.5 mM EDTA) at 160 V.

Antibodies- Rabbit anti-CIEBP8 specific to the carboxyl terminus (C-19),
rabbit anti-CIEBP: specific to the amino terminus (F-168) and normal rabbit IgG
were purchased from Santa Cruz Biotechnology. Rabbit antibody specific to the
carboxyl terminus of ClEBPy was prepared against a synthetic peptide

corresponding to this sequence (Parkin et al 2002).

137

RESULTS

C/EBPQ is induced by LPS treatment in B cells- We previously found that
C/EBPa, B, 5, and a are all capable of conferring LPS-inducible IL-6 transcription
to P388 B lymphoblasts (Bretz et al 1994; Hu et al 1998; Williams et al 1998).
P388 is a murine B lymphoblastic cell line (Bauer et al., 1986) that normally lacks
C/EBPa, C/EBPB, C/EBPS, and CIEBPs expression and has been a useful
system for analyzing CIEBP protein function (Bretz et al., 1994; Hu et al., 1998;
Williams et al 1998; Hu et al. 2000; Gao et al. in press). Although CIEBPs are
expressed from constitutive vectors in this system, lL-6 expression is transitory
with decreasing expression after 24 hours of LPS treatment (Fig. 1). In WEHI 231
B cells, a B cell line that has been used in several studies of lL-6 expression
(Hobbs et al 1991; Macfarlane and Manzel 1998; Lee and Koretzky 1998;
Venkataraman et al 1999), lL-6 induction by LPS is also transitory, decreasing
after 24 hours treatment (Fig. 2).

Since C/EBPQ mRNA is markedly induced by LPS in the livers of rats
during the acute phase response (Sylvester et al 1994), we examined whether
LPS would also induce expression of this inhibitor to C/EBP activity in B cells. To
that end, C/EBPQ expression was examined in RNA from P388-CB cells treated
with LPS. P388-CB cells are P388 cells that have been transfected for C/EBPB
expression (Bretz et al., 1994; Hu et al., 1998). Northern analysis showed that
C/EBPQ mRNA was highly induced in P388-CB cells following 24 hours treatment

with LPS (Fig. 3). As expected, C/EBPB mRNA was readily detected in

138

 

 

Hours of LPS Treatment

 

02482448

to...“
GAPDH ...m

lL-6

 

 

 

 

5
:1
~34-
‘a’
133-
.s
'52: I
211
eoj, ,,
LPS(Hrs) o 2 4 a 24 48

Figure 1. LPS induces lL-6 expression in P388-CB cells.

Total RNA was isolated over time course of LPS treatment as
indicated. Twenty microgram of RNA was analyzed on Northern
blots that were successively hybridized to probes for lL-6 and
GAPDH. Level of lL-6 mRNA (as determined by phosphoimager
analysis) were expressed relative to GAPDH and graphed relative
to control value (receiving no LPS) set at 1.

139

 

 

 

Hours of LPS Treatment

 

0 6 24 36 48

   

IL-6 4 I;

 

Fold of Induction
.5

 

 

LPS (Hrs) o 6 24 36 43

Figure 2. LPS induces lL-6 expression in WEHI231 cells. Total
RNA was isolated over time course of LPS treatment as indicated.
Twenty microgram of RNA was analyzed on Northern blots that
were successively hybridized to probes for IL-6 and GAPDH. Level
of lL-6 mRNA (as determined by phosphoimager analysis) were
expressed relative to GAPDH and graphed relative to control value
(receiving no LPS) set at 1.

140

 

 

 

Hours of LPS Treatment

 

02482448

CIEBPC N O

r ._ ._.
. ‘- .
4
V .1
~v. .
‘1
. ‘ .—
-v' v' r

GAPDH

 

Figure 3. LPS induces CIEBPC expression in P388-CB
cells. Total RNA was isolated over time course of LPS
treatment as indicated. Twenty microgram of RNA was
analyzed on Northern blots that were successively hybridized
to probes for C/EBPQ, CIEBP8 and GAPDH.

141

 

 

untreated cells, and its expression was further elevated in response to LPS
treatment (Fig. 3), presumably due to activation of the retroviral promoter in the
expression vector.

Having observed that C/EBPQ mRNA expression is induced by LPS in

P388-CB cells, we sought to determine whether this induction resulted in

 

increased expression of C/EBPQ protein. We also determined the expression

levels of both C/EBPB and C/EBPy proteins, the other C/EBP proteins expressed

 

by P388-CB cells. We had previously shown that C/EBPy expression is
stimulatory on the IL-6 promoter and that C/EBPB exists largely as a heterodimer
with C/EBPy in these cells (Gao et al. in press). Therefore, the balance of
expression of all three CIEBP proteins is relevant to the role of C/EBP as an
activator of IL-6 expression. A western blot analysis of nuclear extracts isolated
over a time course of LPS treatment of P388-CB cells revealed a time-dependent

increase in both C/EBPQ and C/EBPB proteins, while C/EBPy expression was

 

constant (Fig.4). The minor C/EBPB-specific species may represent a modified
form (e.g. phosphorylation), however both forms appear to be co-modulated.

We also examined the expression of CIEBP proteins in nuclear extracts of WEHI
231 B cells. A western blot of a time course of LPS treatment showed both
C/EBPQ and C/EBPB proteins to be induced over time, while C/EBP8 exhibited a
transitory induction and C/EBPy exhibited a modest decrease in expression (Fig.
5). Two CIEBP8-specific species are apparent at 36 and 48 hours. These likely
represent 34 and 38 kD forms arising from alternative translational initiation. Both

forms are reported to be transcriptional activators (reviewed in Johnson and

142

Hours of LPS Treatment

 

m

0 2 4 8 24 48

CIEBPB - ~"’“ :3: is: L“

CIEBPC ........... a...— ~-~.

0

0

Figure 4. LPS induces CIEBP8 and CIEBPQ expression in P388-
CB cells. Western analysis of nuclear extracts from a time course of
LPS treatment as indicated. Proteins were detected with a carboxyl-
terminal specific C/EBPB, C/EBPC, or C/EBPy antibody.

143

 

Hours of LPS Treatment

 

0 6 24 36 48

l u -.'c “an. 'W"

CIEBP8 “‘ ‘ " m m 4:;-
CIEBP8 .. ,,,, ~ “L...
creepc -- a... W.,... ‘“

CIEBPy "" ----

Figure 5. LPS induces CIEBP8, CIEBP6, and CIEBP; expression
in WEHI231 cells. Western analysis of nuclear extracts from a time
course of LPS treatment as indicated. Proteins were detected with a
carboxyl-terminal specific C/EBPB, C/EBPS, C/EBPQ or C/EBPy
antibody.

144

 

21‘

 

Williams 1994). The data demonstate that increased C/EBPQ expression is
coincident with decreased lL-6 expression in both P388 lymphoblasts and WEHI

231 B cells.

C/EBPQ inhibits C/EBP,B DNA-binding in B cells -C/EBPQ possesses a
leucine zipper dimerization domain and readily heterodimerizes with other
CIEBPs (Ron et al 1992). However, the presence of two prolines in its DNA-
binding domain disrupts its helical structure and prevents dimer binding to the
consensus C/EBP DNA enhancer element (Ron et al 1992). Therefore, the
upregulation of C/ EBPQ expression would be expected to cause the decreased
binding of C/EBPB to DNA. To determine whether this was the case, EMSA was
performed using the same nuclear extracts derived from LPS treated P388-CB
cells that were used for the western blot analysis of Figure 4. The binding of
CIEBszfi and C/EBPfizy to the murine lL-6 C/EBP binding site decreased
dramatically and steadily over time with LPS treatment (Fig. 6), even though the
level of CIEBP8 protein in nuclear extracts increased over the same time course
(Fig. 4). Similar results were obtained with nuclear extracts from WEHI231 cells.
C/EBPflzy and C/EBP5:y binding, at first, increased with LPS treatment (Fig. 7),
consistent with the induction of C/EBPB and C/EBP8 expression observed in
western analysis (Fig. 5). From 36 hours LPS treatment onward, the binding of
C/EBPfizy and C/EBP8:y dramatically decreased, reaching levels below that of
untreated cells (Fig. 7). To further address the ability of C/EBPQ to inhibit

C/EBPB DNA binding, P388 cells were stably transduced with a murine retroviral

145

 

P388-CB P388-CB
LPS(Hrs)0 2 4 a 24 48 N p y

w- w- . Q Q t.
H :Supershifts

48:3
48:7

47:7

 

   

I44.

 

Figure 6. DNA-binding activity of nuclear extract containing CIEBP8
decreased following a time course of LPS treatment in P388-CB cells.
EMSA was performed using nuclear extracts of P388-CB cells that were
treated with LPS over a time course as shown and a labeled
oligonucleotide corresponding to the lL-6 promoter C/EBP binding site.
The EMSA of the no LPS treated P388-CB also was performed with
binding reactions that included normal rabbit lgG (N), carboxyl-terminus
specific anti-CIEBP8 ([3), or carboxyl-terminus—specific anti-ClEBPy (y).
Arrows labeled 8:8, 8:7, and y:y indicate the positions of C/EBPzDNA
complexes. Arrows on the right also indicate supershifts. The C/EBPfizfi
complex is supershifted by only C/EBPB-specific antibodies, the C/EBPy:y
complex by only C/EBPy-specific antibodies, and the C/EBPB:y complex
by both C/EBPB-specific and C/EBPy-specific antibodies.

146

WEHI231

 

 

LPS (Hrs) o e 24 36 48 N p 5 7 [3+5
V ‘ Supershifts
WWW“ 434,54
: ”I“ 1'“; ?. “vfl‘l‘ I '4' -’
m 414” H $1M ‘ ‘ “W {Lleyz-y

 

I v 1 ‘1;
A ‘ ‘1 1.4“
H . '

Figure 7. DNA-binding activity of nuclear extract containing CIEBP8
decreased following a time course of LPS treatment in WEHI231 cells.
EMSA was performed using nuclear extracts of WEHI231 cells that were
treated with LPS over a time course as shown and a labeled oligonucleotide
corresponding to the lL-6 promoter C/EBP binding site. The EMSA of the 24
hours LPS treated WEHI231 also was performed with binding reactions that
included normal rabbit IgG (N), carboxyl-terminus specific anti-CIEBP8 (B),
anti-CIEBP6 (8),carboxyl-terminus—specific anti-C/EBPy (y), or anti-CIEBP8
and anti-CIEBP8 (8+8). Arrows labeled [3:7, 83y, LIP: y and yzy indicate the
positions of C/EBPzDNA complexes. Arrows on the right indicate supershifts.

147

 

vector expressing C/EBPt; and the DNA binding ability of C/EBPB in those
transfectants compared to control transfectants. The population of cells
transduced for C/EBPQ expression was designated P388-CC. Western blot
analyses were used to verify proper expression of the stably transduced C/EBPQ
gene. Anti-CIEBPQ detected two immunoreactive species in the transduced
population (Fig. 8). The slower-migrating band that is absent in the control P388-
Neo population corresponds to the 9E10-myc-tagged CIEBPQ protein, while the
faster-migrating band corresponds to the 29 kDa endogenous C/EBPQ protein.
To assess the impact of C/EBPQ on the DNA-binding ability of CIEBP8, a
C/EBPB-expression vector was transfected into P388-CC and P388-Neo cells,
and EMSA performed on nuclear extracts. CIEBP8 DNA binding was decreased
significantly in P388-Cc transfectants compared to P388-Neo control cells at both
quantities of C/EBPB vector used in the transient transfections (Fig. 9A),
supporting the notion that C/EBPQ is the factor that diminishes CIEBP8 DNA-
binding activity in B cells after lengthy LPS treatment. A western blot analysis
was performed to verify that comparable levels of C/EBPB were expressed in the
transfected cells (Fig. 9B). It is worth noting that the C/EBPB:y heterodimers are

more resistant to the C/EBPQ sequestration than are C/EBPB:B homodimers.

C/EBPQ inhibits C/EBPfl-dependent LPS-induced expression of lL-6-
Having observed that C/EBPQ expression is induced by LPS treatment in B cells

concomitant with attenuation of C/EBP DNA-binding activity and IL-6 expression

148

P388Neo P388-CC

 

Figure 8. CIEBP; is overexpressed in P388 cells. A western
blot using C/EBPQ-specific antibody showed expression of myc-
tagged C/EBPt; in P388 transductants of C/EBP; (P388-Cg) in
comparison to control transductants (P388Neo).

149

Figure 9. Overexpression of CIEBP6; reduced DNA-binding activity of
nuclear extract containing CIEBP8. A. EMSA was performed using nuclear
extracts of P388Neo and P388-Cg cells that were transiently transfected with
increasing amount of CIEBP8 as shown and a labeled oligonucleotide
corresponding to the IL-6 promoter C/EBP binding site. The EMSA of 4pg
CIEBP8 transfected P388Neo also was performed with binding reactions that
included normal rabbit lgG (N), carboxyl-terminus specific anti-CIEBP8 ([3), or
carboxyl-terminus—specific anti-CIEBPy (y). Arrows labeled [5:8, (3:7 , andyzy
indicate the positions of CIEBPzDNA complexes. Arrows on the right also indicate
supershifts. The C/EBPB:B complex is supershifted by only C/EBPB-specific
antibodies, the C/EBPy:y complex by only C/EBPy-specific antibodies, and the
C/EBPB:y complex by both CIEBP8-specific and C/EBPy-specific antibodies.

B. western blot using CIEBP8-specific antibody showed expression of C/EBPB in
P388-Cg cells in comparison to P388Neo cells.

150

fiVillol
Clear
with

P388Neo P388-CC; 4pg CIEBP8
CIEBPB(pg) o 4 8 o 4 8 N p y

 

‘ I
‘Supershrfts

"= 4 13:13
4 8:1
4 7:7

 

 

Change of CIEBP8:B: 1 1.07 0.22 0.34
Change of CIEBPflzy: 1 1.03 0.5 0.65

P388Neo P388-CC,
CIEBPNpg) o 4 8 o 4 8

 

I

an“ anal-I- ‘ 4 CIEBP8

151

 

and that CIEBP6; inhibits C/EBPB DNA-binding, we directly tested whether
increased expression of C/EBPQ downregulates IL-6 expression. In order to
address this question, we transiently transfected the C/EBPQ expression vector
into P388-CB cells and evaluated expression from the endogenous lL-6 gene.
RNAs were isolated from control and C/EBPQ—transfected cells over a time
course of LPS treatment and analyzed by northern blot. Overexpression of
C/EBPQ reduced the extent of lL-6 induction over the course of LPS treatment
(Fig. 10). Rehybridization of the blot with a probe for C/EBPQ verified C/EBPQ
expression (Fig. 10).

To further address the ability of C/EBPQ to attenuate IL-6 expression,
transient transfections where increasing amounts of C/EBPQ expression vector
were added to a constant amount of C/EBPB expression vector were performed
using the lL-6 promoter-reporter. As previously reported, C/EBPB together with
LPS stimulation elicits a robust induction of the IL-6 promoter (Fig. 11).
However, increasing levels of C/EBPC expression inhibited induction of the IL-6
promoter. The data demonstrate that the ability of CIEBP; expression to
attenuate C/EBPB-dependent LPS induction of lL-6 expression from both the

intact, endogenous lL-6 gene and a promoter-reporter construct.

Transitory NF-K‘B activation is not sufficient to explain attenuation of lL-6

expression-Because CIEBP8 and NF-xB act synergistically to induce IL-6

152

 

 

A "H

 

Control CIEBPC
LPS(Hrs) o 2 4 8 24 2 4 8 24

lL-6 , W W W M w m

C/EBPQ

 

GAPDH M W W‘ Ii? If I IIII‘IIIII IMI IW W I

80—

   
 
 
 
   

60—

4o—

20-

Fold of induction

 

 

OI
LPS(Hrs)0 2 4 8 24 2 4 8 24

CIEBP§--...++++

Figure. 10 Overexpression of CIEBPQ reduced the LPS-induced
expression of lL-6 in P388-CB cells. Total RNA from P388-CB cells
infected with a C/EBPQ expressing retrovirus or control vector were
isolated over time course of LPS treatment as indicated. Twenty
microgram of RNA was analyzed on Northern blots that were
successively hybridized to probes for lL-6, C/EBPQ and GAPDH.
Level of lL-6 mRNA (as determined by phosphoimager analysis) were
expressed relative to GAPDH and graphed relative to control value
(receiving no LPS) set at 1.

153

15-
10- w
54
04

 

 

Lps - + + + + + +
CIEBP8 (pg) - - 0.25 p
CIEBP; (pg) - - - 1 2 4 6

 

Figure 11. CIEBP; inhibits the ClEBPB-confered lL-6 induction upon
LPS treatment. Transfections were carried out in duplicate without and
with increasing amounts of CIEBP; vector, with the pg quantities of
C/EBPB vector and LPS treatment as indicated. Luminometer values were
normalized for expression from a co-transfected SV40 early promoter 8-
galactosidase-reporter. These values were then normalized to a relative
value of 1 for cells receiving neither a CIEBP expression vector nor LPS.

154

transcription (Matsuaka et al 1993), it is plausible that the transitory nature of
LPS-induced IL-6 expression is mediated by the transitory activation of NF-KB.
To evaluate this possibility, the levels of NF-xB binding activity were assessed in
WEHI231 cells treated over a time course with LPS. NF-xB binding activity was

indeed transitory, but with more rapid kinetics than that observed for lL-6

expression. EMSA of nuclear extracts from the LPS-treated cells revealed
increased NF-xB DNA-binding activity as early as 15 minutes LPS treatment
(Fig. 12). NF-KB DNA-binding activity increased through 2 hours, and then
declined to basal levels by 48 hours (Fig. 12). It should be noted that at 24 hours
LPS treatment when lL-6 mRNA is at its peak level, NF-KB levels are only slightly
above unstimualted levels. Thus the transitory nature of NF-xB activation is not

likely the mechanism for attenuation of IL-6 induction.

155

WEHI231

 

LPS (hours) 0 0.25 0.5 1 2 4 8 24 48

:.-.I I I III III; III I I

Figure 12. LPS Induces NF-KB DNA binding of IL-6 promoter in
WEHI231 cells. EMSA was performed using nuclear extracts of WEHI231
cells that were untreated or LPS-treated over a time course as shown and
a labeled oligonucleotide corresponding to the IL-6 promoter NF-xB
binding site.

156

 

DISCUSSION

The data presented in this paper suggest that C/EBPQ plays an inhibitory
role in lL-6 expression, where its upregulation with lengthy LPS stimulation
contributes to the transitory nature of LPS-induced lL-6 expression. CIEBP:
expression was found to be upregulated in two B cell lines after LPS stimulation.
The highest levels of C/EBPQ expression correlated with the attenuation of lL-6
induction. The abundance of CIEBP DNA-binding species dramatically
decreased with the induction of CIEBP; expression and ectopic expression of
C/EBPQ was found to suppress IL-6 expression from both the endogenous IL-6
gene, as well as an IL-6 promoter-reporter.

A large body of research supports a role for C/EBPB and CIEBP8 in the
regulation of IL-6 expression, as well as many other genes associated with the
acute phase response (Akira et al 1990; Kinoshita et al 1992; Akira et al 1997;
Poli 1998). Our own work has shown that the stable expression of C/EBPa, [3, 6
or a in a murine B lymphoblast cell line is sufficient to confer LPS inducible IL-6
expression (Bretz et al 1994; Hu et al 1998; Williams et al 1998). More recently,
we have found a stimulatory role for CIEBPy in IL-6 expression (Gao et al in
press). Although it has been demonstrated that expression of C/EBPQ is highly
induced in liver during the acute phase response (Sylvester et al 1994), a role for
C/EBPQ in IL-6 regulation or, more generally in the acute phase response, has

not been described. C/EBPQ can act as a dominant negative inhibitor of other

157

 

 

CIEBPs (Ron et al 1992) and the effects upon lL-6 expression that we describe
here are consistent with C/EBPQ playing an important role in the attenuation of
the acute phase response by inhibiting the expression of CIEBP-regulated
genes.

We have demonstrated that CIEBPQ expression is induced in response
to LPS treatment in B cells. This is consistent with results obtained from LPS
induction of the acute phase response in rat liver (Sylvester et al 1994). These
earlier investigators found that the C/EBPQ promoter contains a putative C/EBP-
binding site, suggesting that classical CIEBP transactivators could mediate LPS-
induced CIEBPQ expression. Indeed, Sylvester et al (1994) showed that CIEBP-
containing complexes bind to this site and that this binding activity increases in
hepatic nuclear extracts from rats treated with LPS. They also showed that at
least C/EBPa and CIEBP8 contribute to these complexes and that the relative
contribution by C/EBPB increases following LPS treatment. Furthermore, they
showed that expression of a reporter plasmid containing the C/EBPC; promoter
could be transactivated in a dose-dependent manner by a CIEBP8 expression
vector in transient transfections into HepG2 cells. In support of the notion that
C/EBP transactivators may induce expression of C/EBPQ, we found that CIEBP8
expression is induced in response to LPS treatment of WEHI231 B cells and that
induction of C/EBPQ is delayed relative to that of CIEBP8 (Fig. 5). These data
are consistent with the notion that the synthesis of C/EBPB is a prerequisite for

C/EBPQ induction. However, P388-CB cells still require LPS treatment for

158

induction of C/EBPQ expression suggesting more complex requirements for
expression.

Regardless of the mechanism by which the C/EBPQ is upregulated by
LPS, we have found that C/EBPQ inhibits the ability of CIEBP8 to bind DNA. The
CIEBP DNA-binding activity of nuclear extracts decreases after an initial increase
following LPS treatment in WEHI231 B cells (Fig. 7) and throughout LPS
treatment of P388-CB cells (Fig. 6), even though western analysis of the same
nuclear extracts shows increasing CIEBP8 expression (Figs. 4 and 5). This
decrease correlates well with the increase in C/EBPQ expression observed in the
same nuclear extracts. Furthermore, forced expression of C/EBP; dramatically
decreased the DNA-binding activity of CIEBP8-containing complexes (Fig 9). It is
interesting to note that the C/EBszy heterodimers appear more resistant to
inhibition of binding than the CIEBPfizfl homodimers (Fig 9). We recently reported
a stimulatory activity for C/EBPy on the IL-6 promoter (Gao et al in press).
C/EBPB in P388-CB cells and both C/EBPB and C/EBP5 in WEHI231 cells are
largely present as heterodimers with C/EBPy (Gao et al in press). At least some
component of the stimulatory of C/EBPy may reflect its ability to protect CIEBP8
from association with C/EBPI;

The fact that forced expression of C/EBPQ inhibits the LPS induction of
both an lL-6 promoter-reporter as well as the endogenous IL-6 gene strongly
supports the model that upregulation of C/EBPQ with lengthy LPS stimulation

attenuates lL-6 induction by directly antagonizing C/EBP binding to the lL—6

159

promoter. While our current study has not provided direct evidence by co-
immune precipitation for the formation of heterodimers between CIEBP; and
C/EBPB or C/EBPS, our findings are totally consistent with this. Multiple
mechanisms may certainly contribute to downregulation of lL-6 expression
following its LPS induction in B cells. We have found that NF-KB activation is
transitory (Fig. 12) and this may also attenuate IL-6 induction. However, NF-xB
activation declines well before the attenuation in lL-6 expression that we observe
suggesting that this is not a sufficient explanation. C/EBPB itself shows transitory
expression in WEHI231 cells and may also contribute to the attenuation of IL-6
induction. However, C/EBP5 is not expressed in P388-CB cells, which show
similar kinetics of IL-6 expression. Therefore, transitory C/EBP8 expression is
also not sufficient to explain attenuation of lL-6 expression. Glucocorticoids can
downregulate the expression of IL-6 and other proinflammatory cytokines by
either occlusion of transactivator binding, competition for limiting co-activators, or
interference with interactions beween transcription factors and the basal
transcription machinery (Ray et al 1990; De Bosscher et al 2000; Karin M 1998;
Adcock et al 2001). Estrogen has also been reported to inhibit lL-6 expression
by direct interaction with NF-KB and C/EBPB (Stein and Yang 1995) and/or
preventing NF-xB binding to the iL-6 promoter (Galien and Garcia 1997). Neither
glucocorticoids nor estrogen are likely operating in the system described here

which lacks the opportunity for endocrine effects.
The induction of C/EBPQ as an attenuator of the LPS induced, CIEBP-

dependent expression of IL-6 suggests the possibility that C/EBPQ expression

160

may serve as a generalized attenuator of the acute phase response, many genes

of which are CIEBP-regulated (Poli 1998). A test of this hypothesis will await a
closer examination of the role of CIEBP: in the regulation of genes such as

hemopexin, haptoglobin, aI-acid glycoprotein, serum amyloid A1, A2, and A3,
complement C3, and C-reactive protein, which figure prominently in the acute

phase response of hepatocytes.

161

 

REFERENCES

Akira, S., H. Isshiki, T. Sugita, O. Tanabe, S. Kinoshita, Y. Nishio, T. Nakamima,
T. Hirano, and T. Kishimoto. 1990. A nuclear factor for lL-6 expression (NF-1L6)
is a member of a CIEBP family. EMBO J. 9:1897-1906.

Akira S and T. Kishimoto. 1997. NF-IL6 and NF-kappa B in cytokine gene
regulation. Adv Immunol. 65: 1-46.

Bartlett, J., J. Luethy, S. Carlson, S. Sollott and N. Holbrook. 1992. Calcium
ionophore A23187 induces expression of the growth arrest and DNA damage
inducible CCAAT/enhancer-binding protein (C/EBP)-related gene, gadd153. J
Biol Chem. 267: 20465-70.

Bauer, S. R., K. L. Holmes, H. C. Morse Ill, and M. Potter. 1986. Clonal
relationship of the lymphoblastic cell line P388 to the macrophage cell line
P388D1 as evidenced by immunoglobulin gene rearrangements and expression
of cell surface antigens. J. Immunol. 136: 4695-4699.

Bretz, J. D., S. C. Williams, M. Baer, P. F. Johnson, and RC. Schwartz. 1994.
CIEBP-related protein 2 confers Iipopolysaccharide-inducible expression of
interleukin 6 and monocyte Chemoattractant protein 1 to a lymphoblastic cell line.
Proc. Natl. Acad. Sci. USA 91: 7306-7310.

Bruhat, A., C. Jousse, X. Z. Wang, D. Ron, M. Ferrara and F. Fafoumoux. 1997.
Amino acid limitation induces expression of chop, a CCAAT/enhancer binding

protein related gene at both transcriptional and post-transcriptional levels. J. Biol.
Chem. 272: 17588-93.

Carlson, S. G., T. W. Fawcett, J. D. Bartlett, M. Bernier and N. J. Holbrook. 1993.
Regulation of the CIEBP-related gene, gadd153, by glucose deprivation. Mol.
Cell. Biol. 13: 4736-44.

Chen, 0., K. Yu, N. J. Holbrook and J. L. Stevens. 1992. Activation of the growth
arrest and DNA damage-inducible gene gadd153 by nephrotoxic cysteine
conjugates and dithiothreitol. J. Biol. Chem. 267: 8207-12.

Choi, A. M., J. Fargnoli, S. G. Carlson and N. J. Holbrook. 1992. Cell growth
inhibition by prostaglandin A2 results in elevated expression of gadd153 mRNA.
Exp Cell Res. 199: 85-9.

De Bosscher, K., W. Vanden Berghe, L. Vermeulen, S. Plaisance, E. Boone, and
G. Haegeman. 2000. Glucocorticoids repress NF-kappaB-driven genes by
disturbing the interaction of p65 with the basal transcription machinery,
irrespective of coactivator levels in the cell. Proc Natl Acad Sci USA.97:3919-24.

162

 

 

Fomace, A.J., Jr., l.Alamo, Jr. and MC. Hollander. 1989. DNA damage-inducible
transcripts in mammalian cells. Proc. Natl. Acad. Sci. 85: 8800-8804.

Fort, P., L. Marty, M. Piechaczyk, S. El Salrouty, C. Dani, J. Jeanteur, and J. M.
Blanchard. 1985. Various rat adult tissues express only one major mRNA
species from the Glyceraldehyde-3-phosphate—dehydrogenase multigenic family.
Nucleic Acids Res. 13:1431-1442.

Gao, H. W., S. Parkin, P. F. Johnson, and R. C. Schwartz. 2002. C/EBPy has a
stimulatory role on the lL-6 and lL-8 promoters. J. Biol. Chem. in press.

 

l

Galien, R., and T. Garcia. 1997. Estrogen receptor impairs interleukin-6
expression by preventing protein binding on the NF-kappaB site.
Nucleic Acids Res. 25: 2424-9.

Gutman, G.A., N. L. Warner, and A. W. Harris. 1981 Immunoglobulin production
by murine B-lymphoma cells. Clin Immunol Immunopathol. 18: 230-44.

Halleck, M., N. Holbrook, J. Skinner, H. Liu, and J. Stevens. 1997. The molecular
response to reductive stress in LLC-PK1 renal epithelial cells: Coordinate
transcriptional regulation of gadd153 and grp78 genes by thiols. Cell Stress
Chaperones 2: 31-40.

Hu, H.-M., M. Baer, S. C. Williams, P. F. Johnson, and R. C. Schwartz. 1998.
Redundancy of C/EBPoc, -B and 5 in supporting the lipopolysaccharide-induced

transcription of IL-6 and monocyte Chemoattractant protein-1. J. Immunol.
160:2334-2342.

 

Hu, H.-M., Q. Tian, M. Baer, C. J. Spooner, S. C. Williams, P. F. Johnson, and R.
C. Schwartz. 2000. The CIEBP bZIP domain can mediate Iipopolysaccharide
induction of the proinflammatory cytokines interleukin-6 and monocyte
Chemoattractant protein-1. J. Biol. Chem. 275:16373-16381.

lto, K., E. Jazrawi, B. Cosio, P. J. Barnes, I. M. Adcock. 2001. p65-activated
histone acetyltransferase activity is repressed by glucocorticoids: mifepristone
fails to recruit HDAC2 to the p65-HAT complex. J Biol Chem. 276:30208-15.

Johnson, PF, and S. C. Williams. 1994. Liver Gene Expression, pp.231-58,
R.G. Landes Company, Austin, TX.

Juan, T. S., D. R. Wilson, M. D. Wilde and G. J. Darlington. 1993. Participation of
the transcription factor C/EBP delta in the acute-phase regulation of the human
gene for complement component C3. Proc Natl Acad Sci U S A. 90: 2584-8.

Karin, M. 1998. New twists in gene regulation by glucocorticoid receptor: is DNA
binding dispensable? Cell: 93:487-90.

163

Kinoshita, S., S. Akira, and T. Kishimoto. 1992. A member of the CIEBP family,
NF-IL6B forms a heterodimer and transcriptionally synergizes with NF-IL6. Proc.
Natl. Acad. Sci. USA 89: 1473-1476.

Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 227: 680-685.

Landschulz, W. H., P. F. Johnson, E. Y. Adashi, B. J. Graves, and S. L.
McKnight. 1988. Isolation of a recombinant copy of the gene encoding CIEBP.
Genes Dev. 2: 786-800.

Lekstrom-Himes J, and K. G. Xanthopoulos. 1998. Biological role of the
CCAAT/enhancer—binding protein family of transcription factors. J Biol Chem. 27:
28545-8.

Leuthy, J., J. Fargnoli, J. Park, A. Fomace and N. Holbrook. 1990. Isolation and
characterization of the hamster gadd153 gene. Activation of promoter activity by
agents that damage DNA. J. Biol. Chem. 265: 16521-26.

Mann, R., R. C. Mulligan and D. Baltimore. 1983. Construction of a retrovirus
packaging mutant and its use to produce helper-free defective retrovirus. Cell
33: 153-9.

Marten, N. W., E. J. Burke, J. M. Hayden, and DS. Straus. 1994. Effect of amino
acid limitation on the expression of 19 genes in rat hepatoma cells. FASEB J. 8:
538-544.

Matsuaka, T., K. Fujikawa, Y. Nishio, N. Mukaida, K. Matsushima, T. Kishimoto,
and S. Akira. 1993. Transcription factors NF-IL6 and NF-KB synergistically
activate transcription of the inflammatory cytokines, interleukin 6 and interleukin
8. Proc. Natl. Acad. Sci. USA 90: 10193-10197.

Metz, R. and E. Ziff. 1991. cAMP stimulates the CIEBP-related transcription
factor rNFlL-6 to trans-locate to the nucleus and induce c-fos transcription.
Genes Dev. 5: 1754-66.

Nordeen, S. K. 1988. Luciferase reporter gene vectors for analysis of promoters
and enhancers. BioTechniques 6: 454-457.

O’Neil, K. T. R. H. Hoess, and W. F. DeGrado. 1990. Design of DNA-binding
peptides based on the leucine zipper motif. Science 249: 774-8.

Park, J., J. Luethy, M. Wang, J. Fargnoli, A. Fomace, O. McBride and N.

Holbrook. 1992. Isolation, characterization and chromosomal localization of the
human GADD153 gene. Gene 116: 259-67.

164

Pear, W. S., G. P. Nolan, M. L. Scott and D. Baltimore. 1993. Production of high-
titer helper-free retroviruses by transient transfection. Proc. Natl. Acad. Sci. USA
90: 8392-6.

Poli, V. 1998. The role of CIEBP isoforms in the control of inflammatory and
native immunity functions. J. Biol. Chem. 273: 29279-82.

Price, B. and S. Caldenlvood. 1992. Gadd 45 and Gadd 153 messenger RNA
levels are increased during hypoxia and after exposure of cells to agents which
elevate the levels of glucose-regulated proteins. Cancer Res. 52: 3814-7.

Ray, A., K. S. LaForge and P. B. Sehgal. 1990. On the mechanism for efficient
repression of the interleukin-6 promoter by glucocorticoids: enhancer, TATA box,
and RNA start site (lnr motif) occlusion. Mol Cell Biol. 10: 5736-46.

Ron, D. and J. F. Habener. 1992. CHOP, a novel developmentally regulated
nuclear protein that dimerized with transcription factors C/EBP and LAP and
functions as a dominant-negative inhibitor of gene transcription. Genes Dev. 6:
439-53.

Schuman, J. D., C. R. Vinson, and S. L. McKnight. 1990. Evidence of changes in
protease sensitivity and subunit exchange rate on DNA-binding by C/EBP.
Science 249: 771-4.

Sok, J., X. Z. Wang, N. Batchvarova, M. Kuroda, H. Harding, and D. Ron. 1999.
CHOP-dependent stress-inducible expression of a novel form of carbonic
anhydrase Vl. Mol. Cell. Biol. 19: 495-504.

Stein, B. and M. X. Yang. 1995. Repression of the interleukin-6 promoter by
estrogen receptor is mediated by NF-kappa B and C/EBP beta. Mol Cell Biol. 15:
4971-9.

Sylvester, S. L., C. M. ap Rhys, J. D. Luethy-Martindale and N. J. Holbrook.
1994. Induction of GADD153, a CCAAT/enhancer-binding protein (CIEBP)-
related gene, during the acute phase response in rats. Evidence for the
involvement of C/EBPs in regulating its expression. J Biol Chem. 269: 20119-25.

Tanabe, O., S. Akira, T. Kamiya, G. G. Wong, T. Hirano, and T. Kishimoto. 1988.
Genomic structure of the murine lL-6 gene. J. Immunol. 141: 3875-3881.

Wang, X. Z., M. Kuroda, J. Sok, N. batchvarova, R. Kimmel, P. Chung, H.

Zinszner and D. Ron. 1998. Identification of novel stress-induced genes
downstream of chop. EMBO J. 17: 3619-30.

165

 

Williams, S. C., C. A. Cantwell, and P. F. Johnson. 1991. A family of C/EBP-
related proteins capable of forming covalently linked leucine zipper dimers in
vitro. Genes & Dev. 5: 1553-1567.

166

 

SUMMARY AND FUTURE DIRECTIONS

In Chapter 2, we have found that CIEBPy dramatically augments the
activity of C/EBPB in LPS induction of lL-6 in a B lymphoblast cell line. This
activating role for C/EBPy is promoter-specific, being observed for the lL-6 and
lL-8 promoters, but neither for a simple CIEBP-dependent promoter nor the
TNFa promoter. C/EBPy activity also shows cell type-specificity with stimulatory
activity in a B lymphoblast and no effect in a macrophage cell line. Studies with
chimeric C/EBP proteins implicated the formation of a heterodimeric leucine
zipper between CIEBP8 and C/EBPy as the critical structural feature required for
C/EBPy stimulatory activity. Our current findings suggest a unique role for
C/EBPy in B cell gene regulation and, along with our previous observation of the
ability of CIEBP bZIP domains to confer LPS inducibility of IL-6, suggest that the
CIEBP leucine zipper domain has a role in C/EBP function beyond allowing
dimerization between C/EBP family members.

To further explore the role of C/EBPy in lL-6 expression by B cells, an
immediate question to be addressed in the future is: what is the mechanism of
C/EBPy stimulatory activity? To answer this, two models are worthy to be tested:
1) enhanced synergy with NF-xB. 2) enhanced recruitment of transcriptional
coactivators.

Our studies show both the lL-6 and IL-8 promoters to be stimulated by
C/EBPy, but a simple promoter consisting of four tandemly arrayed CIEBP

binding sites [(DE-l)4] was not stimulated by C/EBPy. The TNF-a promoter

167

 

which does not display synergy between NF-xB and CIEBP8 was not stimulated
by C/EBPy either. Furthermore, in the absence of LPS treatment, ClEBPy
actually inhibited the limited activation of the lL-6 promoter that can be observed
by transfection with CIEBP8 alone. Cotransfection with NF-KB p65 was sufficient
to reverse the inhibition and allow C/EBPy stimulatory activity to be observed in
the absence of LPS stimulation. These data suggest that C/EBPy plays a key role
in the synergy between CIEBP8 and NF-KB. To test this, an lL-6 NF-xB
consensus site will be inserted into the (DE-l)4 promoter reporter. Whether this
promoter-reporter behaves similarly to the wild-type IL-6 promoter-reporter in
transient transfections or not will be studied. Another approach is to test if there
is a direct physical interaction between ClEBPy and NF-KB by co-
immunoprecipitation and GST pull-down.

While no co-activators have been reported in association with CIEBPy, five
coactivators have been reported in association with CIEBP8: TIF1B, Rb,
Nopp140, p300 and SWl/SNF chromatin-remodeling complex. Cotransfections
will be performed to examine whether overexpression of any these coactivators
augments LPS stimulation of the lL-6 promoter and whether they are more
effective when coexpressed with additional C/EBPy.

Another critical question to be addressed is: What is the physiological
consequence of C/EBPy-deficiency for lL-6 expression. For this point, LPS-
induced lL-6 expression in B cells derived from C/EBPy—deficient animals will be
examined. These animals have normal levels of B lineage cells, although the

function of C/EBPy-deficient B cells has not been assessed (Kaisho et al 1999).

168

Primary splenic B cells, pre-B cells derived from long-term B cell culture of fetal
liver cells, as well as immortalized B cell lines obtained from C/EBPy-deficient
and wild-type animals will be evaluated for their expression of CIEBP family
members and their response to LPS stimulation. Transduction of ectopic C/EBPy
expression into C/EBPy-deficient cell lines will allow a clearer assessment of the
role of C/EBPy expression without the complication of endogenous C/EBPy that
we have in P388 lymphoblasts.

In this report, we have also shown that C/EBPB leucine-zipper is sufficient
to mediate LPS induction of the IL-6 expression in vivo (Chapter 2, Fig 25).
Furthermore, previous work in our lab showed that C/EBPfizGLz has no activity in
stable transfectant (Hu et al 2000). Taken together, these results suggest that
the CIEBszy heterodimeric zipper in the absence of any conventional activation
domains is the key determinant to support LPS induction of the lL-6 promoter.
To further explore the intrinsic activity of the C/EBPB and ClEBPy heterodimer in
our system, it is worthy to investigate the proteins with which the heterodimers
interact. To that end, the proteomic approach can be utilized by using tagged
CIEBPYBLZ expression vector in P388 B cells.

In Chapter 3, we have found that expression of C/EBPQ is induced in
response to LPS treatment of B cells at both the mRNA and protein levels.
Correlating with the highest levels of C/EBPQ expression at 48 hours after LPS
treatment, both the abundance of C/EBP DNA binding species and IL-6
expression are downregulated. Furthermore, ectopic expression of C/EBPQ

inhibited C/EBPB-dependent lL-6 expression from both the endogenous lL-6

169

 

gene and an lL-6 promoter-reporter. These results suggest that C/EBPQ
functions as negative regulator of IL-6 expression in B cells and that it contributes
to the transitory expression of lL-6 that is observed after LPS treatment.

An immediate experiment in the future that will strengthen our results is to
examine the formation of heterodimers between C/EBPQ and C/EBPB or C/EBPS
by co-immune precipitation at different time after LPS treatment. An alternative
approach is to test if C/EBP DNA-binding activity of nuclear extract at 24 hours of

LPS treatment can be inhibited by mixing with a nuclear extract at 48 hours of

LPS treatment.

170

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

IIIIIIIJIIIIIIIIIIIIIIIIIII