 

*v}.l.

you

is? E. .i

s
. .2 .K‘
is:

It

\ .5
Pat???
2». ~
2.... 2x .. a .e :

..Z......... 5: :
..

‘.
.i .. viii...
ixmﬁuhhvu . . .:.ﬂ§‘suflrnhu

~51 .n’.u‘l

an?!
, IJ.
“I. 33!. t I» .b....-v.¢uv.\
.a- 3": 55.53.... .h:
I'D: 22":“ \i :
:‘ITI‘VI .5535) 11":
“:33: x. 3.3%.... u
$23.1}...
lire .34....
at: .3

2.
. x
.43.:

: 3 i1

:3 I... (:3 . : , . : , .b‘.ll¢l..5f|v‘v

.t.;£...r.‘ .33. (2 W11!

’21....... ’aCI‘V

 

 

 

4
“TBS“

’Z 00?

 

This is to certify that the

dissertation entitled

BIOCHEMICAL AND GENETIC INVESTIGATION OF THE
CHLOROPLASTIC PROTEIN IMPORT APPARATUS

presented by

Diane Therese Jackson Constan

has been accepted towards fulﬁllment
of the requirements for

Ph.D. Genetics

degree in

w Kain

Major professor!

 

 

Du M 700;

MS U i: an Afﬁrmative Action/Equal Opportunity Institution 0-12771

 

 

 

 

 

 

 

LIBRARY
Michwan State
University

 

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE ' DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 cJCIRC/DateDuepBSpts

BIOCHEMICAL AND GENETIC INVESTIGATION OF THE
CHLOROPLASTIC PROTEIN IMPORT APPARATUS

By

Diane Therese Jackson Constan

A DISSERTATION

Submitted to
Michigan State University
in partial fulﬁllment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Genetics Program

2001

ABSTRACT

BIOCHEMICAL AND GENETIC INVESTIGATION OF THE
CHLOROPLASTIC PROTEIN IMPORT APPARATUS

By

Diane Therese Jackson Constan

Although plastids contain their own genome, almost all of the proteins needed
within the organelle are encoded in the nuclear genome, synthesized on cytoplasmic
ribosomes, and imported into the plastid posttranslationally. Protein import into
chloroplasts is mediated by a proteinaceous complex localized within the two membranes
of the plastid envelope. Several components of this translocation machinery have been
identiﬁed from pea (Pisum sativum) chloroplasts, but little evidence exists concerning the
individual functions of these proteins during the import process. Thus, the goal of this
dissertation research has been to study the function of three import complex subunits
(Ticl 10, Toc34, and Hsp93) in more detail. By means of experiments designed to
elucidate the topology of pea Ticl 10 within the chloroplast inner envelope membrane, we
have determined that the large C-terminal domain of Tie] 10, which contains the
functional residues of this protein, is localized within the chloroplast stroma. Thus,

Ticl 10 is likely involved in recruiting stromal factors, such as molecular chaperones, to
the site of precursor protein translocation. The availability of the genome sequence for
Arabidopsis thaliana allowed us to establish that all of the known components of the
chloroplastic import apparatus are present in this species. Most of the import components
have multiple homologs in Arabidopsis, suggesting that import complex composition

may vary within Arabidopsis plastids. Having identiﬁed Arabidopsis homologs for the

subunits of the translocation apparatus, we isolated knockout mutant lines for two
putative Arabidopsis import components: AtToc34 and AtHsp93-V. Plants lacking
expression of the gene encoding AtToc34 appear similar to wild-type plants, both
visually and at the level of chloroplast structure and composition. In addition, in vitro
import of precursor proteins is not impaired for chloroplasts isolated from the AtToc34
mutant line. Overall, we could detect no signiﬁcant differences between wild-type and
mutant plants. However, double mutants that lack both AtToc34 and AtToc33, a
homolog of AtToc34, were not viable, indicating that AtToc33/AtToc34 ﬁmction may be
essential within Arabidopsis chloroplasts. A knockout mutant line for AtHsp93-V, on the
other hand, is viable but much smaller and paler than wild-type plants. Chloroplasts
isolated from these mutant plants contain less thylakoid membrane than do wild-type
chloroplasts. These results suggest that AtHsp93-V function is necessary for normal
chloroplast development. Experiments addressing whether chloroplast protein import is
altered in the AtHsp93-V mutant line have given equivocal results. The rate of import of
at least one precursor into isolated chloroplasts in vitro is signiﬁcantly decreased in the
mutant line. However, the levels of endogenous chloroplastic proteins appear to be
unaffected in AtHsp93-V knockout mutant plants, suggesting that import may not be
signiﬁcantly impaired in viva. This dissertation research has provided insight into the
possible ﬁmctions of three subunits of the chloroplastic import complex, although much
still remains to be learned. It is anticipated that the tools developed during this research,
especially the knockout mutant lines for AtToc34 and AtHsp93-V, will be useful for

future investigations of the plastid protein import process.

ACKNOWLEDGMENTS

First and foremost, I would like to thank my advisor, Kenneth Keegstra. I
honestly cannot imagine having had a better person to serve as my major professor. He
has challenged me in my work yet has always shown a willingness to help at any time
and with any problem, no matter how trivial. Most importantly, he has constantly served
as an example of what a successful scientist is and should be. Working in his lab over the
past ﬁve years has been a rewarding experience.

My time in the Keegstra lab has been greatly enriched by the fact that I shared it
with a group of outstanding individuals: Mitsuru Akita, Jenny Davila-Aponte, Amy
DeRocher, Ahmed Faik, Lynda Fitzpatrick, John Froehlich, Kentaro Inoue, Erik Nielsen,
Robyn Perrin, Sigrun Reumann, and Weiqing Zeng. They have always assisted me in my
work, providing me with solutions to whatever scientiﬁc problem I was facing. In
addition, they have been a source of entertainment and companionship, one that I truly
appreciate. I would especially like to thank John F roehlich, who patiently guided me
through my early years in the lab. Also, I would like to thank Ana Kelly, an
undergraduate who provided me with skilled assistance in screening for T-DNA
insertional mutants.

I would also like to thank the entire Plant Research Lab at Michigan State
University. I could not even begin to name all the people who have helped me over the
years. The support staff of both the Plant Research Lab and the Genetics Program
deserve a special mention for all of their assistance. They have taken care of many a

crisis for me, and I am very grateful for their efforts.

iv

Finally, I would like to thank my family for their support during my graduate
studies, especially my parents, Jim and Sharon Jackson, who have never questioned my
decision to become a scientiﬁc researcher. No matter what choices I have made in my
life, they have supported me and allowed me to do what I want without interference. In
addition, I would like to acknowledge my husband, Zachary Constan, who has been a
great source of comfort to me. Thanks for doing all the “dirty work” whenever I asked

you to!

TABLE OF CONTENTS

LIST OF TABLES ................................................................................. viii
LIST OF FIGURES ................................................................................. ix
CHAPTER 1
INTRODUCTION .................................................................................... 1
Transport of precursor proteins across the two membranes of the chloroplast
envelope .............................................................................. 6
Proteinaceous components of the chloroplast protein import machinery ........... ll
Comparisons to posttranslational protein import into other organelles ............. 16
Experimental investigation of protein transport systems .............................. 24
The use of reverse genetics to study chloroplast protein import ..................... 28
Statement of problem and attribution ................................................... 37
References ................................................................................... 40
CHAPTER 2

THE HYDROPHILIC DOMAIN OF TICl 10, AN INNER ENVELOPE MEMBRANE
COMPONENT OF THE CHLOROPLASTIC PROTEIN TRANSLOCATION

APPARATUS, FACES THE STROMAL COMPARTMENT ............................... 49
Abstract ...................................................................................... 50
Introduction ................................................................................. 51
Materials and Methods ..................................................................... 54
Results ....................................................................................... 58

Ticl 10 is resistant to digestion by adequately quenched trypsin. . . . . .. . . “.58
Ticl 10 is degraded by insufﬁciently quenched trypsin only after

chloroplast lysis .......................................................... 59
Trypsin degrades proteins exposed to the intermembrane space but
not Tie] 10 ................................................................. 62
Ticl 10 is exposed on the same face of inner envelope membrane
vesicles as ClpC, a stroma-facing protein ............................. 70
Discussion ................................................................................... 73
References ................................................................................... 78
CHAPTER 3
ARABIDOPSIS GENES ENCODING COMPONENTS OF THE CHLOROPLASTIC
PROTEIN IMPORT APPARATUS .............................................................. 81
Abstract ...................................................................................... 82
Introduction ................................................................................. 83
Materials and Methods ..................................................................... 86
Results and Discussion .................................................................... 88
Outer envelope membrane proteins ............................................. 88
Inner envelope membrane proteins ............................................. 95

vi

Soluble factors ..................................................................... 98

Conclusions ................................................................................ 103
References ................................................................................. 107
CHAPTER 4
AN OUTER ENVELOPE MEMBRANE COMPONENT OF THE CHLOROPLASTIC
PROTEIN IMPORT APPARATUS IS ESSENTIAL IN ARABIDOPSIS ................. 112
Abstract ................................................................................... .113
Introduction ................................................................................ l 14
Materials and Methods ................................................................... 117
Results ...................................................................................... 124
Isolation of a knockout mutant line for AtToc34 ............................ 124
Chloroplasts of ppi3 plants are similar to wild-type chloroplasts ......... 127
ppiI/ppi3 double homozygous mutants are not viable ...................... 145
Discussion ................................................................................. 152
References ................................................................................. 157
CHAPTER 5
AN HSPlOO CHAPERONE IS REQUIRED FOR NORMAL CHLOROPLAST
DEVELOPMENT AND FUNCTION IN ARABIDOPSIS ................................... 160
Abstract .................................................................................... 161
Introduction ................................................................................ 162
Materials and Methods ................................................................... 166
Results ...................................................................................... 172
AtHsp93-V knockout mutant plants are much smaller and paler
than wild-type plants .................................................. .172
Chloroplast structure and composition in the AtHsp93-V knockout
mutant line .............................................................. . 176
Import into AtHsp93-V knockout mutant chlorOplasts is impaired. . . . . , .186
Discussion ................................................................................ . 195
References ................................................................................ , 201
CHAPTER 6
CONCLUSIONS AND FUTURE DIRECTIONS ............................................ 205
References ................................................................................. 216
APPENDIX ......................................................................................... 219
Introduction ................................................................................ 220
Materials and Methods ................................................................... 221
Results ...................................................................................... 223
Discussion ................................................................................. 229
References ................................................................................. 23 1

vii

LIST OF TABLES

Table 3-1. Putative Arabidopsis homologs for the components of the pea chloroplast
protein import machinery ........................................................................... 89

Table 3-11. Comparison of the acidic properties of various members of the outer
envelope membrane import complex ................................................................................. 90

viii

 

LIST OF FIGURES

Figure 1.1. Schematic representation of pathways involved in protein targeting to

chloroplasts ............................................................................................ 4
Figure 1.2. Current model describing the process of protein import into pea

chloroplasts ............................................................................................ 7
Figure 1.3. Summary of the strategy used for PCR screening of T-DNA mutagenized
Arabidopsis populations ........................................................................... 31
Figure 2.1. Ticl 10 is not degraded by trypsin as long as the protease is adequately
quenched ............................................................................................. 60
Figure 2.2. Ticl 10 is degraded by insufﬁciently quenched trypsin only after chloroplast
lysis ................................................................................................... 63
Figure 2.3. The trypsin sensitivity of newly imported Ticl 10 constructs does not mimic
that of an interrnembrane space marker protein ................................................. 66
Figure 2.4. Trypsin digestion of inner envelope membrane vesicles ........................ 71

Figure 3.1. Multiple sequence alignment for the putative chloroplast-localized

Arabidopsis Hsp70 isoforms .................................................................... .100
Figure 4.1. Characteristics of the ppi3 mutation ............................................ . 125
Figure 4.2. Visible phenotype of the ppi3 mutant line ....................................... 128
Figure 4.3. Chlorophyll levels present in ppi3 plants do not differ signiﬁcantly from

those present in wild-type plants ................................................................. 130
Figure 4.4. Chloroplast ultrastructure in the ppi3 mutant line .............................. 133
Figure 4.5. Endogenous levels of various chloroplastic proteins are not decreased in the
1103 mutant ......................................................................................... 135
Figure 4.6. Total protein proﬁles of wild-type and ppi3 mutant plants ................... 138

Figure 4.7. Chloroplasts isolated from ppi3 mutant plants are able to import precursor
proteins representing a variety of chloroplastic subcompartments .......................... 141

Fig"! e 4-8- The rate of import of prSS into chloroplasts isolated from the ppi3 mutant
me rs not signiﬁcantly impaired ................................................................. 143

ix

 

Figure 4.9. Plants that are homozygous for a T-DNA insert in the gene encoding

AtToc33 and heterozygous for an insert in the gene encoding AtToc34 are much smaller
and paler than either ppi3 or ppz' 1 mutant plants ............................................... 147

Figure 4.10. Siliques of ppi 1/ppi1/PPI3/ppi3 plants contain signiﬁcantly more failed
ovules than do wild-type Siliques ................................................................ 149

Figure 5.1. AtHsp93-V knockout mutant plants express a truncated mRNA from the
AtHSP93-V gene and may produce a truncated AtHsp93-V protein ........................ 174

Figure 5.2. AtHsp93-V knockout mutant plants are much smaller and paler than wild-
type plants .......................................................................................... 177

Figure 5.3. Chlorophyll levels are reduced in the AtHsp93-V knockout mutant line...l79

Figure 5.4. Chloroplasts isolated from AtHsp93-V mutant plants are slightly smaller and

contain less thylakoid membrane in comparison to wild-type chloroplasts. . ............. 182
Figure 5.5. Endogenous levels of various chloroplastic proteins are unaffected in the

AtHsp93-V knockout line ........................................................................ 184
Figure 5.6. Total protein proﬁles of wild-type and AtHsp93-V mutant plants ,,,,,,, i ...187

Figure 5.7. Chloroplasts isolated from AtHsp93-V mutant plants are able to import a
variety of precursor proteins, although not as efﬁciently as do wild-type chloroplasts. 190

Figure 5.8. The rate of import of prSS into AtHsp93-V mutant chloroplasts is decreased
in comparison to import into chloroplasts isolated from wild-type plants ................ . 192

Figure A.l. Ticl 10 is not labeled by Sulfo—NHS-Biotin, a membrane-impermeable
biotinylation reagent, as long as chloroplasts remain intact ................................ .225

Figure A.2. Sulfo—NHS-Biotin can cross the chloroplast inner envelope membrane and
label stromal proteins .............................................................................. 227

CHAPTER 1

Introduction

One of the characteristic features of higher plants is the presence, within virtually
every cell, of plastids. These plastids exist in a variety of forms, including proplastids,
leucoplasts, chloroplasts, and chromoplasts. In most instances, the function of a
particular plant tissue is determined by the type of plastid that it contains (i.e. chloroplasts
in photosynthetic tissues, amyloplasts in starch-storing organs; Kirk and Tilney-Bassett,

1978). Plastids carry out several essential metabolic processes within plant cells,
including photosynthesis, starch formation and breakdown, amino acid and fatty acid
biosynthesis, and nutrient assimilation. However, although plastids contain a genome
that encodes approximately 100 polypeptides, relatively few of the enzymes needed to
catalyze these processes are encoded or synthesized within the plastid itself (Sugiura,
1989; Abdallah et al., 2000). Instead, the vast majority of plastid proteins are encoded in
the nuclear genome, synthesized on cytoplasmic ribosomes, and imported into the
organelle posttranslationally (reviewed in Chen and Schnell, 1999; Keegstra and Cline,
1999; Keegstra and Froehlich, 1999; May and S011, 1999; Schleiff and $011, 2000;
Vothknecht and 8011, 2000).

Most nuclear-encoded plastid proteins are initially synthesized as higher
m01eCUIar weight precursors, containing an N-terminal transit peptide that is both
necessary and sufﬁcient for their import into the organelle (reviewed in Keegstra and
Cline, 1999; Bruce, 2000; Schleiff and 8011, 2000; Vothknecht and 8011, 2000). These
presequences range in size from relatively small (~30 amino acids) to quite large (>100
reSidu'ﬁs; Keegstra and Cline, 1999; Schleiff and Soil, 2000). Transit peptides from a

Variety of precursor proteins appear to share a few general features, such as a

Predominance of serine and threonine residues and a lack of acidic amino acids, which

result in the transit peptide having an overall basic p1 and net positive charge (Keegstra et
al., 1989). However, no consensus sequence for plastid protein transit peptides has yet
been recognized (von Heijne et al., 1989). A similar situation exists for the targeting
sequences of mitochondrial precursor proteins. Instead of a conserved primary structure,
mitochondrial targeting sequences appear to display a common secondary structure: an
amphipathic helix (von Heijne, 1986; Roise et al., 1988). While the transit peptides of
most plastid proteins are predicted to form random coils instead of any regular secondary
structure (von Heijne and Nishikawa, 1991), it is possible that there might be some

shared structural feature by which proteins destined for the plastid are specifically

selected to complete the import process.

Despite their apparent lack of conservation, transit peptides from various
chloroplastic proteins can be functionally substituted for one another in in vitro import
reactions (Keegstra et al., 1995). In addition, all chloroplastic precursor proteins that
have been tested appear to compete for the same proteinaceous import apparatus
(Keegstra et al., 1995). These observations have led to the proposal that there is a general
translocation machinery within the chloroplast envelope that all preproteins utilize to
enter the organelle (Figure 1.1; Keegstra and Cline, 1999). However, it should be noted
that only a relatively small number of chloroplastic precursors have been tested in this
manner so it is possible that additional pathways into the plastid interior may exist.

Once a precursor protein has been imported into the plastid stroma, the transit
Peptide is cleaved off by the stromal processing peptidase, 311d the protein is fOIded and
assembled into its mature form (Oblong and Lamppa, 1992; VanderVere et al., 1995;

Richter and Lamppa, 1998). Some imported proteins are further sorted to compartments

 

Figure 1.1. Schematic representation of pathways involved in protein targeting to
chloroplasts. Most chloroplastic proteins are synthesized within the cytoplasm as higher
molecular weight precursors containing an N-terrninal transit peptide that targets them to
the general import machinery of the Chloroplast envelope. Translocation of precursor
proteins into the plastid stroma is assisted by molecular chaperones (MC) and requires
hydI'OIYSiS of stromal ATP. Once the protein has been imported, the transit peptide is
r emoved- Proteins without additional targeting information remain in the chloroplast
stroma (path 1). If a protein has transmembrane domains, it can be inserted into either
the thylakOid membrane (path 2) or the inner envelope membrane (not shown).
Precursors destined for the thylakoid lumen contain a second targeting sequence, which is
activated upon cleavage of the stromal-targeting transit peptide. Following import of the
PI‘Otein into the thylakoid lumen (path 3), this second targeting domain is also removed.
MOSt outer envelope membrane proteins do not have transit peptides. Instead, these
proteins are inserted directly into the outer membrane from the cytoplasm, without the

assistance of additional factors (path 4). [Figure adapted from Keegstra and Cline

(1999).]

3W.»

J mature
J transit peptide

 

‘ 1' E 1. f ‘1“! "n-
i r ﬂamers

 

Stroma
ATP

a g 1
e57) m
Thylakoid @

membrane ‘3 @

Figure 1.1

‘t!

H

‘71

~. 1’
1:15:11!
“d! \h\

(I .‘H’.
x . “7'
‘u\)

other than the stroma: the inner envelope membrane, or in chloroplasts, the thylakoid
lumen or thylakoid membrane (Figure 1.1). At least one outer envelope membrane
protein also utilizes the general import apparatus (although the vast majority of outer
membrane proteins are inserted into this membrane directly from the cytoplasm [Figure
l.l]), but it is unlikely that the protein completely enters the stroma before being targeted
to the outer membrane (Tranel and Keegstra, 1996; Keegstra and Cline, 1999;
Vothknecht and $011, 2000). A sixth compartment, the interrnembrane space between the
two envelope membranes, also exists; however, it is not clear what the targeting

mechanism to this compartment might be.

Transport of precursor proteins across the two membranes of the chloroplast envelope
Studies on the mechanism of protein import into plastids have primarily utilized
isolated pea (Pisum sativum) chloroplasts as a model system. With this system, it is
possible to import precursor proteins into the organelle in vitro, presumably with similar
kinetics and molecular requirements as in vivo import. Results from these investigations
suggest that precursor proteins initially interact with a proteinaceous complex located
within the chloroplast outer envelope membrane (Figure 1.2, step b; Ma et al., 1996;
Akita et al., 1997; Nielsen et al., 1997). These early events involve the hydrolysis of
GTP, most likely mediated by two GTP-binding proteins present in the outer membrane
import complex (Olsen and Keegstra, 1992; Kessler et al., 1994; Seedorf et al., 1995).
Subsequent transport of the preprotein into the chloroplast can be further
subdivided into two distinct stages, based on their differing nucleoside triphosphate

requirements (Olsen et al., 1989). The ﬁrst stage, referred to as the “binding” or

 

 

 

 

Figure l .2. Current model describing the process of protein import into pea
chloroplasts. Nuclear-encoded chloroplastic proteins are initially synthesized in the
cytoplasm With a transit peptide (teal) that targets them to the plastid surface (a). In a
process stimulated by GTP, the precursor protein associates with the components (blue)
of the outer envelope membrane “3115100011 (b). Hydrolysis of ATP in the cytoplasm
and/or interrnembrane space causes the precursor to interact with the components (green)

of the inner membrane translocon as well (c). It is postulated that this step may be
assisted by chaperones residing in the interrnembrane space (purple). Hydrolysis of
stromal ATP results in the complete translocation of the precursor protein into the
chloroplast interior, where the transit peptide is removed ((1). This ﬁnal step is mediated
at least in part by stromal factors (red). The numbers within the components of the outef
and inner membrane translocons refer to the calculated molecular mass of each subunit -

0M = outer membrane; IM = inner membrane. Images in this dissertation are presented

in color.

 

iated
)uter
nit.

lied

ATP ADP+Pi c

   
 

Figure 1.2

. WU

\

A ~
QC

“docking” stage of import, requires low concentrations (0.1 mM) of ATP to be present
within the interrnembrane space of the chloroplast envelope (Figure 1.2, step 0; Olsen et
al., 1989; Olsen and Keegstra, 1992). Hydrolysis of ATP at this stage results in the
irreversible association of a precursor protein with the translocation machinery of both
the outer and inner envelope membranes (Olsen et al., 1989; Schnell and Blobel, 1993;
Nielsen et al., 1997). The second import stage is distinguished from the ﬁrst by a
requirement for high levels (>1 mM) of ATP within the chloroplast stroma (Theg et al.,
1989). Stroma] ATP hydrolysis permits the complete translocation of the preprotein into
the interior of the organelle (Figure 1.2, step (1), leading this stage to be termed the
“translocation” phase of import (Theg et al., 1989; Chen and Schnell, 1999; Keegstra and
Cline, 1999; Vothknecht and 3011, 2000). ATP hydrolysis at this stage is presumably
mediated by molecular chaperones, similar to the situation known for the mitochondrial
and endoplasmic reticulum (ER) posttranslational protein import systems (reviewed in
Jensen and Johnson, 1999; Pilon and Schekman, 1999; Rapoport et al., 1999; Herrmann
and Neupert, 2000; Strub et al., 2000).

Analysis of protein import into mitochondria, in which precursors must cross a
double membrane system similar to that found in plastids, has revealed that ATP
hydrolysis and a membrane potential are required for translocation into the interior of the
organelle (Pfanner et al., 1997; Herrmann and Neupert, 2000). A corresponding A
requirement for a membrane potential at the chloroplast envelope is not present (Theg et
al., 1989). However, as mentioned above, there is evidence to indicate that ATP may not
be the sole energy source for the plastid protein import process. Studies into the effects

of nucleoside triphosphates on precursor import have shown that GTP, by itself or in

 

 

cooperation with ATP, can stimulate binding of precursor proteins to the chloroplast
envelope (Olsen and Keegstra, 1992). GTP-7S can inhibit both binding and translocation,
even in the presence of high concentrations of ATP (Olsen and Keegstra, 1992; Young et
al., 1999). Furthermore, it has been demonstrated that the stimulation of precursor
binding by GTP is not the result of conversion of the nucleotide to ATP (Olsen and
Keegstra, 1992). Thus, it appears that GTP hydrolysis may be important for the binding
of preproteins to chloroplasts (Olsen and Keegstra, 1992; Young et al., 1999).

Recently, work in our lab has further explored the role of GTP during the import
process. In addition to conﬁrming that GTP stimulates and GTP-yS inhibits precursor
binding, it has been demonstrated that GDP and GDP-BS do not signiﬁcantly affect the
binding of preproteins to the chloroplast surface in the presence of ATP (Young et al.,
1999). These observations indicate that it is GTP hydrolysis, rather than merely binding
of the nucleotide, that is important during the binding stage of import (Young et al.,
1999). I

While it is apparent from the above discussion that, at least in the in vitro system,
GTP is playing a role in chloroplast protein import, the molecular nature of its function
during the import process is still unclear. Current speculation revolves around the
possibility that GTP hydrolysis has a regulatory role while ATP hydrolysis is responsible
for providing the driving force for protein import to occur (Chen and Schnell, 1999;
Keegstra and Froehlich, 1999; Vothknecht and 8011, 2000). It is known that GTP can
regulate protein import in other systems, speciﬁcally in the cotranslational insertion of
proteins into the ER (Rapoport et al., 1996). Durihg import of proteins into the ER

lumen, binding of GTP is linked with a transfer of the precursor protein-ribosome

10

 

 

complex to the translocation channel (Connolly and Gilmore, 1989). It is possible that
GTP may be playing a similar regulatory role during chloroplast protein import, perhaps
signaling the import channel to open and translocation to commence or controlling the
formation of contact sites between the translocation machineries of the outer and inner
envelope membranes (Chen and Schnell, 1999; Keegstra and Froehlich, 1999). Further

experiments will be necessary to test these hypotheses in detail.

Proteinaceous components of the chloroplast protein import machinery

A signiﬁcant amount of work in the ﬁeld of plastid protein import has focused on
the identiﬁcation and characterization of the membrane-bound components that mediate
the transport process (Figure 1.2). The ﬁrst members of the import apparatus to be
extensively studied, Toc159 (_translocon at the guter envelope membrane of ghloroplasts,
159 kD), Toc75, and Toc34, form a complex in the chloroplast outer envelope membrane
(Waegemann and S011, 1991; Hirsch et al., 1994; Kessler et al., 1994; Perry and Keegstra,
1994; Schnell et al., 1994; Seedorf et al., 1995; Tranel et al., 1995; Ma et al., 1996). All
three of these components are integral proteins of the outer membrane (Hirsch et al.,
1994; Kessler et al., 1994; Schnell et al., 1994; Seedorf et al., 1995; Tranel et al., 1995).
Chemical crosslinking experiments have demonstrated that Toc159 is in close association
with precursor proteins even in the absence of added nucleotides (i.e. GTP, ATP; Perry
and Keegstra, 1994; Ma et al., 1996). In addition, antibodies against Toc159 are able to
inhibit the binding of preproteins to the chloroplast surface (Hirsch et al., 1994). These

data indicate that Toc159 is the ﬁrst of the known translocation components encountered

11

 

 

by a preprotein, likely acting as the receplOI' for proteins that are to be imported (Hiﬂeh
et al., 1994; Perry and Keegstra, 1994).

In the presence of low levels of ATP, preproteins are crosslinked predominantly
to Toc75 (Perry and Keegstra, 1994; Ma et al., 1996). Antibodies against Toc75 have
been found to block protein translocation (Tranel et al., 1995). Also, Toc75 is predicted
to form a porin-like structure within the outer envelope membrane (Schnell et al., 1994),
and Escherichia coIi-overexpressed Toc75 has been observed to form a channel in an
artiﬁcial lipid bilayer (Hinnah et al., 1997). These results have led to the hypothesis that
Toc75 may form the channel through which a precursor protein passes as it crosses the
outer membrane (Schnell et al., 1994; Tranel et al., 1995; Hinnah et al., 1997). The
presence of a channel in the outer membrane that is involved in protein import-has been
established (van den Wijngaard and Vredehberg, 1997). What still remains to be

deﬁnitively shown, however, is that this observed import channel is composed of Toc75
Subunits.

Recently, it has been shown that Toc34. can be crosslinked to a precursor protein
in a manner that is regulated by the binding, but not hydrolysis, of GTP (Kouranov and
Scllnell, 1997). Both Toc34 and Toc159 contain GTP-binding domains that are exposed
t0 the cytoplasm and have been shown to bind and hydrolyze GTP in vitro (Kessler et al.,

1994; Seedorf et al., 1995). The signiﬁcance of these results in vivo, though, is unknown.
It is likely, however, that these two GTP-binding proteins are responsible for the
observed GTP-mediated stimulation of preprotein binding to the chloroplast surface (see

above; Olsen and Keegstra, 1992; Young et al., 1999). Further experiments need to be

12

 

done in order to conﬁrm this hypothesis and to determine the exact ﬁrnction that GTP
binding and/or hydrolysis by Toc159 and Toc34 may have during the import process.
, A recent report by Sohrt and $011 (2000) has implicated a fourth component,
Toc64, as being a member of the outer membrane import machinery. The amino acid
sequence for this subunit contains an amidase domain, but the protein itself has no
measurable amidase activity (Sohrt and S011, 2000). In addition, Toc64 contains three
tetratricopeptide repeats (TPR), which are predicted to be involved in protein-protein
interactions with cytosolic factors complexed with a precursor protein and/or with the
precursor itself, perhaps serving as a docking site for the incoming protein (Sohrt and
8011, 2000).
Five proteins have been identiﬁed as components of the inner membrane import
apparatus based on their ability to interact with both a translocating precursor and the Toc
Complex (Schnell et al., 1994; Wu et al., 1994; Kessler and Blobel, 1996; Liibeck et al.,
1996; Ma et al., 1996; Caliebe et al., 1997; Kouranov and Schnell, 1997). Ticl 10
(.tl'anslocon at the inner envelope membrane of ghloroplasts, M kD), the ﬁrst of these
Proteins to be cloned and characterized, is an integral protein of the inner envelope
Inet'nbrane, containing a large hydrophilic domain that is oriented toward the chloroplast
Stroma (Kessler and Blobel, 1996; Liibeck et al., 1996). Based on this topology, it has
been proposed that Ticl 10 may be involved in recruiting stromal factors, in particular
molecular chaperones, to the site of protein import (Kessler and Blobel, 1996).
Preliminary evidence suggests that Ticl 10 may indeed physically interact with at least

one stromal molecular chaperone (M. Akita and K. Keegstra, unpublished observations).

13

 

 

Less evidence exists concerning the function of the other four inner membrane
import complex components (Tic20, Tic22, Tic40, and TicSS). Tic20, an integral protein
of the inner envelope membrane, is believed to form at least a portion of the channel
through which chloroplastic precursors traverse the inner membrane (Kouranov and
Schnell, 1997; Kouranov et al., 1998). Tic22 is localized within the interrnembrane space
of the chloroplast envelope and appears to be only peripherally associated with the inner
envelope membrane (Kouranov et al., 1998). Due to its localization, it has been proposed
that Tic22 may be involved in the formation of contact sites between the import
complexes of the outer and inner envelope membranes (Kouranov and Schnell, 1997;
Kouranov et al., 1998). Tic55 is an iron-sulfur protein that may play a regulatory role
during chloroplast protein import (Caliebe et al., 1997). Tic40 is hypothesized to recruit
chaperones to the site of precursor protein translocation, based on the presence of an
HSp70-interacting domain within its amino acid sequence (Stahl et al., 1999).-

It 'is thought that molecular chaperones within the chloroplast provide the driving
fOree, through the hydrolysis of ATP, for the translocation of precursor proteins into the
or ganelle (Chen and Schnell, 1999; Keegstra and Cline, 1999; Keegstra and Froehlich,
l999), analogous to the mitochondrial and ER posttranslational protein import systems
(Jensen and Johnson, 1999; Pilon and Schekman, 1999; Rapoport etal., 1999; Herrmann
and Neupert, 2000; Strub et al., 2000). To date, only one stromal molecular chaperone
has been conclusively demonstrated, via its association with both translocating precursor
molecules and the Toe/Tic complex throughout all stages of preprotein transport, to be
i1'W'olved in chloroplast protein import (Akita et al., 1997; Nielsen et al., 1997; Kouranov

et al., 1998). Heat shock protein 93 (Hsp93), a stromal Hsp100 homolog, is primarily a

14

soluble protein. However, a small, but signiﬁcant, percentage of Hsp93 proteins can be
found in tight association with the import complex at the inner envelope membrane,
presumably through an interaction with an integral membrane protein, such as Ticl 10
(Moore andKeegstra, 1993; Nielsen, 1997; M. Akita and K. Keegstra, submitted). It has
been proposed that Hsp93, which contains two ATP-binding domains within its amino
acid sequence (Schirmer et al., 1996), may mediate the stromal requirement for ATP
hydrolysis during preprotein translocation (Akita et al., 1997 ; M. Akita and K. Keegstra,
submitted). This chaperone may “pull” the precursor protein into the organelle, thus
providing the driving force for import.

It has been reported that two additional molecular chaperones localized at the
outer envelope membrane of pea chloroplasts are necessary to assist the import process
(Schnell et al., 1994; Wu et al., 1994; Kourtz and Ko, 1997). One of them, chloroplast
outer membrane protein 70 (Com70), is exposed on the cytoplasmic side of the

membrane (Ko et al., 1992; Kourtz and Ko, 1997). The other, Hsp70-import associated
PTOtein (Hsp70-IAP), faces the intermembrane space between the outer and inner
envelope membranes (Marshall et al., 1990; Schnell et al., 1994). Based on its .
10titalization, it is possible that Hsp70-IAP mediates the observed requirement for ATP
hYdrolysis within the interrnembrane space during the early stages of precursor protein
trElnsport (Olsen et al., 1989; Olsen and Keegstra, 1992). To date, however, neither of
these chaperones has been deﬁnitively shown to be part of the translocation complex. In
addition, cytoplasmic chaperones may be required to guide precursor proteins to the

chloroplast surface and maintain them in an unfolded state prior to their transport across

15

 

the plastid envelope (Schatz and Dobberstein, 1996), although this hypothesis is still

under debate.

Comparisons to posttranslational protein import into other organelles
As is apparent from the above discussion, identiﬁcation of components of the
chloroplastic translocation apparatus has not, in most cases, been accompanied by an
experimental determination of the molecular functions of these proteins. Proposals for
the roles of various components during the import process have relied mostly on
knowledge of the topology of these factors in relation to the envelope membranes and of
the sequence motifs contained within the proteins themselves. In contrast to the relative
uncertainty concerning the function of the chloroplastic import components, several
pieces of evidence exist concerning the functions of the factors involved in the
posttranslational import of preproteins into mitochondria and the ER. (Although
cOtranslational import of proteins into the ER is well known (Rapoport etal., 1996) and
may also occur, in some cases, for transport into mitochondria (Lithgow, 2000),
cOttanslational import across the plastid envelope membranes has not been observed.)
Chloroplast protein import shares several general features with both the ‘
mitochondrial and ER posttranslational transport systems. First of all, all three systems
utilize cleavable, N—terminally localized amino acid sequences to target precursor
Proteins to the relevant organelle: transit peptides for chloroplastic precursors, targeting
Sequences for mitochondrial preproteins, and signal sequences for proteins destined for
the ER (Schatz and Dobberstein, 1996). ER signal sequences, which are quite similar to

the protein export signal sequences of Gram-negative bacteria, consist of a recognizable

 

sequence motif containing a hydrophobic core region (Emanuelsson etal., 2000). No
consensus sequence, on the other hand, has been detected for the targeting signals of
either chloroplastic or mitochondrial precursor proteins (von Heijne etal., 1989), making
targeting to these organelles much more difﬁcult to predict. At the primary sequence
level, chloroplastic transit peptides and mitochondrial targeting sequences are similar.
Both lack acidic amino acids, resulting in a net positive charge (Keegstra et al., 1989;
Pfanner etal., 1997). Thus, an interesting question in the ﬁeld of protein targeting
concerns how plant cells, which contain both chloroplasts and mitochondria, are able to
differentiate between precursors destined to one or the other of these two organelles and
target them to their proper destination.

Second, like import into mitochondria and (in some cases) the ER, protein import
into chloroplasts occurs aﬁer precursors have been completely translated in the
cytoplasm. Thus, as is true for the mitochondrial and ER posttranslational tranSport

SYStems, it has been predicted that newly-synthesized, chloroplast-targeted proteins need
to be maintained, by molecular chaperones, in an import-competent, partially unfolded
State aﬁer emerging from the ribosome (Schatz and Dobberstein, 1996). Both ER and
mitochondrial precursor proteins are guided to their respective organelles by cytoplasmic
HSp70 proteins (Schatz and Dobberstein, 1996). Mitochondrial preproteins also utilize a
cYtoplasmicl4-3-3 protein, mitochondrial import stimulating factor, to assist in precursor
targeting (Hachiya et al., 1993; Komiya et al., 1994). It is possible that chloroplastic
Precursor proteins are targeted to the plastid envelope via similar factors, and
accordingly, both Hsp70 proteins and 14-3-3 proteins have been reported to bind at least

One chloroplastic precursor in vitro (May and 8011, 2000).

17

 

Even though it has been predicted that chloroplastic preproteins must be
maintained within the cytoplasm in an unfolded state, there is evidence that suggests that
precursors in a native, enzymatically-active conformation can still be imported into
plastids. For example, della-Cioppa and co-workers (1986) demonstrated that the
precursor form of 5-enolpyruvylshikimate-3-phosphate synthase had enzymatic activity,
but was still capable of being imported into chloroplasts. Similarly, it has been shown
that a chimeric precursor containing dihydrofolate reductase was properly folded and
capable of binding methotrexate, yet was also still able to be imported into chloroplasts
(Guéra et al., 1993; America et al., 1994). One possible explanation of these results is
that the import apparatus of chloroplasts generates sufﬁcient pulling force that it is
capable of causing the unfolding of precursors that have already been folded in the
cytoplasm (Guéra et al., 1993; America et al., 1994).

Finally, the posttranslational protein import systems of chloroplasts,

mitochondria, and the ER all involve proteinaceous, membrane-bound complexes,
cOnsisting of, at a minimum, a receptor for the incoming preproteins, a channel through
Which precursors enter the organelle, and an ATPase motor that provides the driving
f()rce for protein translocation to occur (Schatz and Dobberstein, 1996). The receptor for
Signal sequences during the posttranslational import of precursors into the ER has not
been identiﬁed, although the leading candidates for this role are the members of the
Stec62/63p tetrameric complex (Sec62p, Sec63p, Sec7lp, and Sec72p) or the Sec61p
channel complex (Ogg et al., 1992; Jungnickel and Rapoport, 1995; Schatz and
I)obberstein, 1996). The mitochondrial outer membrane import complex contains four

l“eceptor subunits, arranged as a Tom37-Tom70 heterodimer and a Tom20-Tom22

l8

 

heterodimer (Torn = translocase of the guter membrane; Pfanner et al., 1997; Herrmann
and Neupert, 2000). However, only one of these proteins, Tom22, is essential for cell
viability in the yeast Saccharomyces cerevisiae, suggesting that this subunit is the major
receptor to which all or most precursor proteins must bind prior to being imported into
the mitochondrial matrix (Pfanner et al., 1997). In chloroplasts, the best candidate to
serve as the receptor for incoming transit peptides is Toc159 (discussed above). This
hypothesis is based on the fact that precursor proteins can be crosslinked to Toc159 even
in the absence of ATP, suggesting that Toc159 interacts with precursors before they have
become committed to the import pathway, as would be expected for a receptor
component G’erry and Keegstra, 1994; Ma et al., 1996).

Early in the study of membrane transport, it was not known whether precursor
proteins spontaneously inserted across the lipid bilayer or whether channels existed
Within the membranes through which these proteins could pass. Due to the hydrophilic

nature of most precursors, however, it was believed that the latter situation would turn out
t0 be true, and subsequent investigation conﬁrmed this hypothesis (Schatz and
Dobberstein, 1996). The protein-conducting channel across the single ER membrane is
C301nposed of three subunits: Sec61p, Ssslp, and Sbhlp (Rapoport et al., 1999). The same
channel complex is likely utilized for the transport of proteins via either the
Desttranslational or the cotranslational import pathway (Rapoport et al., 1996; Rapoport
et al., 1999). The two membranes of the mitochondrial envelope each contain a
multimeric protein-conducting channel. The outer envelope membrane import channel is
Composed of four subunits: Tom40, Tom22, Tom7, and Tom6 (Herrmann and Neupert,

2000). Tom40 crosses the outer membrane of the mitochondrial envelope via a series of

19

B-strands, similar to the structure known for bacterial porins (Mannella et al., 1996).
Since Tom40 is also an essential component of the yeast mitochondrial import
machinery, it is likely that it is the main constituent of the protein-conducting channel
within the outer membrane (Pfanner et al., 1997; Hill et al., 1998; Herrmann and Neupert,
2000). The translocation pore of the mitochondrial inner envelope membrane contains at
least two subunits: Tim23 and Tim17 (Pfanner et al., 1997; Herrmann and Neupert,
2000). Interestingly, it has been observed that the translocation channels of the'outer and
inner mitochondrial membranes can act independently of one another (Segui-Real et al.,
1993; Pfanner et al., 1997). It is not known whether this is the case for the import
channels of the chloroplast envelope as well. The major subunit of the plastid outer
envelope membrane protein-conducting channel is Toc75 (discussed above). Like
Tom40, Toc75 crosses the membrane via a series of B-strands (Schnell et al., 1994). In
addition, Toc75 has been shown to form a voltage-gated, peptide-sensitive channel in
artiﬁcial lipid bilayers (Hinnah et al., 1997). Within the inner envelope membrane of
Chloroplasts, Tic20 is believed to form part of the translocation pore (Kouranov and
SClinell, 1997; Kouranov et al., 1998), although there is no direct experimental evidence
to support this hypothesis. It is also still unknown whether additional proteins interact
With TicZO to create the inner membrane import channel.

ATP hydrolysis is the major energy source for the movement of precursor
proteins into the ER, mitochondria, and chloroplasts (Pfanner et al., 1997; Chen and
Schnell, 1999; Keegstra and Cline, 1999; May and 8011, 1999; Rapoport etal., 1999;
I‘Ierrmann and Neupert, 2000; Vothknecht and $011, 2000). Mitochondria also utilize a

Second major energy source, an electrical potential [NY], to power translocation across

20

the inner envelope membrane (Pfanner et al., 1997; Herrmann and Neupert, 2000).
ChlorOplasts and the ER, however, appear to require only ATP hydrolysis to drive
precursor import (Theg et al., 1989; Rapoport et al., 1999). In all three of these systems,
ATP hydrolysis is mediated by molecular chaperones within the organelle interior.
Kar2p, 3150 known as BiP, a member of the Hsp70 family of chaperones, is located
within the ER lumen (Rapoport et al., 1999). It is localized to the site of precursor
translocation via its interaction with Sec63p, a component of the import complex of the
ER membrane (Sanders et al., 1992; Brodsky and Schekman, 1993). In mitochondria,
Preprotein translocation is driven by the action of mitochondrial Hsp70 (mt-Hsp70), a
mah‘ix protein (Herrmann and Neupert, 2000). Like Kar2p, mt-Hsp70 interacts with a
member of the membrane-bound import complex, in this case Tim44 (Kronidou et al.,
1994; Rassow et al., 1994; Schneider et al., 1994). As discussed above, all evidence
Currently points to Hsp93, a stromal member of the HsplOO chaperone family, as the
mediator of ATP hydrolysis for protein import into chloroplasts (Akita et al., 1997;
Nielsen et al., 1997; Kouranov et al., 1998). It is most likely localized to the site of
Precursor translocation through its interaction with Ticl 10 (Kouranov et al., 1998; M.
Akita and K. Keegstra, submitted).

Two models have been proposed to describe how molecular chaperones act to
import proteins into either the ER or mitochondria (reviewed in Jensen and Johnson,
1999; Pilon and Schekman, 1999; Strub et al., 2000). The ﬁrst, knOwn as the molecular
ratchet or “trapping” model, proposes that precursor proteins move through protein-
con<11.lcting channels within the membrane via random Brownian motion, capable of

moVernent either into or out of the organelle (Neupert et al., 1990; Simon et al., 1992).

21

 

 

 

However, as a portion of the preprotein enters the organelle interior, a molecular
chaperone binds to the emerging section, preventing the backwards motion of the
precursor. Thus, the random motion of the precursor protein is transformed into a
unidirectional movement into the organelle. This model assumes that proteins presented
to the organelle for import are either kept in a completely unfolded state within the
cytoplasm or are capable of spontaneously unfolding once they arrive at the organelle
surface. However, since it has been observed that mitochondria can import folded
proteins more rapidly than these proteins could spontaneously unfold (Gambill et al.,
1993; Glick et al., 1993; Stuart et al., 1994), the molecular ratchet model likely does not
Provide a complete explanation of the translocation process. The second model
describing chaperone function during preprotein import is known as the translocation
I.TIOtor or “pulling” model (Glick, 1995; Pfanner and Meijer, 1995). This model states
that once a chaperone binds an incoming precursor protein, the ATP hydrolyzing ability
0f the chaperone is stimulated. ATP hydrolysis results in a conformational change within
the chaperone, which causes it to pull a portion of the precursor further into the organelle
interior. In this scenario, the pulling force produced by the chaperone would actively
unfold highly folded proteins. It is still not known which of these two models best
explains how chaperones work during protein translocation in viva. It is possible that
ho“! are true, depending on the protein being imported. Loosely folded or unfolded
proteins may enter the organelle through the mechanism proposed by the molecular
ratchet model while more tightly folded proteins would require the mechanism described
by the translocation motor model (Schatz and Dobberstein, 1996; Jensen and Johnson,

1999; Pilon and Schekman, 1999; Strub et al., 2000). Although this matter has been

22

 

extensively investigated for the ER and mitochondrial protein import systems, no
experiments have been reported that address this question for protein transport into
chloroplasts. .

One aspect of chaperone function in which chloroplasts appear to be unique is
their predicted use of an HsplOO protein, rather than an Hsp70 protein, to drive
translocation into the organelle interior. As mentioned above, in both the ER and
mitochondria, Hsp70 chaperones are thought to assist in “pulling in” incoming precursors

(Rapoport et al., 1999; Herrmann and Neupert, 2000). However, most of the evidence for
the chloroplastic import system indicates that Hsp93, rather than one of the stromal '
HSD708, is accomplishing this task (Akita et al., 1997; Nielsen et al., 1997; Kouranov et
31-, 1998). In the bacterial protein export system, the energy for protein translocation is
Provided by SecA (Manting and Driessen, 2000), a protein that shares some features with
HSp93 (M. Akita and K. Keegstra, submitted). Thus, Hsp93, and perhaps the entire
Chl oroplastic import machinery, may be more similar in function, but working in the
Opposite direction, to the bacterial export system than to either the ER or mitochondrial
import systems.
Besides this difference, more chaperones seem to be involved during chloroplast
Protein import than in either of the other two systems, perhaps because ATP hydrolysis is
the only energy source driving import across the two membranes of the chloroplast.
envelope (Theg et al., 1989). In the ER and mitochondrial import systems, chaperones
are needed both in the cytoplasm to guide precursors to the organelle and in the organelle
interior to drive translocation (Rapoport et al., 1999; Herrmann and Neupert, 2000).

Within chloroplastic import complexes, however, two additional chaperones have been

23

l‘
l
l

 

found in association with the outer eereIOpe membrane (Marshall at al., 1990; K0 et 31,
1992; Schnell et al., 1994; Wu et al., 1994). Apparently, there is a need for chaperone
function during a step at this membrane that is either not required or is mediated by a

non-chaperone factor during transport across the mitochondrial outer membrane or the

ER membrane.

Experimental investigation of protein transport systems

As mentioned, the study of precursor protein translocation into the ER and
mitochondria has led to a better understanding of these systems than is the case for the
Plastid protein import system. Application of the results obtained from the investigation
of ER and mitochondrial protein transport to the analysis of chloroplast protein import is
harnpered by the fact that virtually all the known components of the chloroplastic
translocation apparatus show no signiﬁcant homology to the comparable
ER/mitochondrial proteins (Reumann and Keegstra, 1999). In fact, with the exception of
the molecular chaperone, the subunits of the chloroplastic import complex are not

homologous to any proteins of known function outside of common motif regions, such as

nucleotide-binding domains (Reumann and Keegstra, 1999).

For the most part, the results described above have taken advantage of the fact
that both ER and mitochondrial protein import can be studied in yeast. This organism
PI‘OVides a relatively simple system in which knockout mutations of various import
components can be generated and analyzed. For the ER protein transport system, several

0f the essential components of the import complex, including Sec61p, Sec62p, and

Sec63p, were ﬁrst identiﬁed using a temperature-sensitive mutant screen that searched

24

 

for individuals that accumulated ER precursor proteins within the cytoplasm when the

cells were shifted to the non-permissive temperature (Rothblatt et al., 1989). Sirnﬂar

strategies have been employed to identify the essential components of the mitochondrial

import complex (Y affe and Schatz, 1984). Proteins isolated in these screens compose the

non-redundant “core” of their respective import pathways (Baker and Schatz, 1991).

Interestingly, in the mitochondrial protein import system, which is composed of two
separate but interconnected import complexes (similar to the chloroplastic protein
transpon system), the inner membrane import complex has more essential components
than does the outer membrane complex (Pfanner et al., 1997). Within the outer
membrane import complex, only two of the eight subunits are indispensable: Tom22,
Which is assumed to be the receptor that all incoming precursor proteins must bind, and
T011140, the core constituent of the translocation channel (Pfanner et al., 1997). For the
ifiner membrane complex, however, four of the ﬁve components are necessary, including
the two channel subunits, Tim23 and Tim17, and the protein that serves as the interaction
Site for mt-Hsp70, Tim44 (Pfanner et al., 1997).

At the time this dissertation was begun, a comparable genetic system for in vivo
analysis of the chloroplastic transport machinery, which is primarily studied in
multicellular plants, was not yet developed. Consequently, the primary method to study
Plastid protein import was biochemical experimentation. Such experiments have also
been widely used to investigate the ER and mitochondrial transport systems, in particular
for l”Ion-essential proteins that would not be detected by the genetic screens described
abOVe (Baker and Schatz, 1991). One of the major techniques used to isolate components

Of the import machinery is chemical crosslinking. A precursor protein is halted, via a

25

 

 

variety of methods, while it is undergeing import into the organelle and covalently linked

to any proteins in close physical contact with it. The crosslinked complex can then be

separated from other organellar proteins and analyzed to determine the subunits it

contains. Using this method, several components of the chloroplastic import apparatus

were identiﬁed, including Toc159, Toc75, Ticl 10, and Hsp93 (Perry and Keegstra, 1 994;

Wu et al., 1994; Liibeck et al., 1996; Akita etal., 1997; Kouranov and Schnell, 1997;
501111 and $011, 2000). A similar method involves the immunoprecipitation of import
complexes that contain a halted preprotein (Schnell etal., 1994; Wu et al., 1994; Seedorf
etal,, 1995; Liibeck et al., 1996; Nielsen et al., 1997).

Chemical crosslinking and immunoprecipitation techniques have been successful
n0t only in the identiﬁcation of components of the chloroplastic import complex, but also
in providing clues to the functions of these proteins during precursor transport. For
example, insight can be gained into when during import various subunits are needed by
halting precursor proteins at different stages of the transport process (i.e. binding stage,
translocation stage) and determining which proteins are complexed with the preprotein at
each of these stages. From such experiments, it has been predicted that Toc159 is the
1' eceptor for incoming chloroplastic proteins because it is the ﬁrst import component to be
crosslinked to precursors (Perry and Keegstra, 1994; Ma et al., 1996). Antibody
inhibition experiments have been used to support these hypotheses. Experiments
ShovVing that antibodies against Toc159 inhibit the initial binding of preproteins to the
ChloI‘oplast surface again suggest that Toc 1 59 may be the receptor for the outer
mE’Ilerane import complex (Hirsch et al., 1994). Other biochemical methods that have

been used to investigate possible functions for the subunits of the chloroplastic transport

26

 

machinery include topology determination and in vitro recons titution ofoverexpressed
proteins into artiﬁcial lipid bilayers.

While all of these biochemical investigations have been crucial for the
development of the current model of chloroplast protein import (Figure 1.2), they have
only indirectly addressed the question of component function. During the course of this
dissertation, however, another method for addressing import complex component

function became available: genome analysis. Prior to the publication of the genome
sequence for Synechocystis sp. PCC6803, a cyanobacterium, no proteins with signiﬁcant
homology to the chloroplastic import components could be detected (Reumann and
Keegstra, 1999). Following sequencing of this cyanobacterial genome (Kaneko eta1.,
1996), however, a homolog for Toc75, the predicted chloroplast outer envelope
membrane import channel, was found (Bolter et al., 1998; Reumann and Keegstra, 1999;
Reumann et al., 1999). Identiﬁcation of this homolog, designated SynToc75, permitted
the study of Toc75 function in a simple genetic system. These investigations established
that SynToc75 is an essential protein of Synechocystis (Reumann et al., 1999). It is
localized to the cyanobacterial outer membrane (Bolter et al., 1998; Reumann et al.,
1999), which is believed to have evolved into the outer membrane of the chloroplast
envelope (Keegstra et al., 1984; Cavalier-Smith, 1987; Joyard etal., 1991). Interestingly,
SynToc75 has been found to form a cation-selective channel within artiﬁcial lipid
bilaYers, giving support to the hypothesis that pea Toc75 is a channel-forming protein
that permits the translocation of positively-charged transit peptides (Bolter et al., 1998).
Homology searches using SynToc75 as the query have shown that this cyanobacterial

prOtein is related to proteins that secrete proteinaceous virulence factors in other Gram-

27

 

negative bacteria, again lending support to the prediction that ChloropIaStic Toe 75 is a
protein-conducting channel (Reumann and Keegstra, 1999; Reumann et al., 1999), k
The Synechocystis genome also contains clear homologs for Tic55, TicZZ, and
TiCZO, three components of the chloroplast inner envelope membrane import machinery
(Reumann and Keegstra, 1999). Homology searches using the cyanobacterial homolog
of Tic20, $111 73 7, reveal that this protein has sequence similarity to branched amino acid
transporters of other bacterial species (Reumann and Keegstra, 1999). This ﬁnding
bolsters the prediction that Tic20 may be the protein-conducting channel of the inner
membrane (Kouranov and Schnell, 1997; Kouranov et al., 1998). Signiﬁcantly, Tim23
and Timl7, the two subunits of the mitochondrial inner membrane import channel, are
also similar to bacterial branched amino acid transporters (Rassow et al., 1999),
Suggesting that Tic20 may be playing the same role as Tim23/Tim” in the chloroplastic
transport system (Reumann and Keegstra, 1999). The cyanobacterial homologs of TicSS
and Tic22 have not yet been investigated in detail, but the continued publication of
genomes from a variety of species should assist in the prediction of functions for these
tWo components, in addition to the other members of the chloroplastic import complex,

as well.

The use of reverse genetics to study chloroplast protein import

One of the most recent genome sequences to be published is that of Arabidopsis
thaliczna (The Arabidopsis Genome Initiative, 2000), a model system for genetic studies
in plants. This has allowed the identiﬁcation of Arabidopsis homologs for a variety of

pIOteins that have been studied in other systems. In conjunction with the publication of

28

 

its genome, a technique has been developed by Which an Arablb’opszs “knockout” mutant

line for any gene of interest can be isolated and studied in detail (McKinney et al., 1995;

Krysan et al., 1996; Krysan et al., 1999). This reverse genetic technique is based upon a

T-DNA insertional mutagenesis strategy. T-DNA is derived from the Ti (tumor-

inducing) plasmid of the bacterial species Agrobacterium tumefaciens (Zambryski, 1 98 8).
In nature, this bacterium infects several plant species, transferring the T-DNA into a
plant’s cells. Within the plant cell, the T-DNA inserts randomly into the genome, and the
genes contained within it are expressed, providing the invading bacteria with nutrients
(Zambryski, 1988).

The T-DNA is ﬂanked by border regions of known nucleotide sequence
(Zambryski, 1988). Any genes that are placed in between these border sequences are
transferred into a plant cell and integrated into its genome. Consequently, this system has
been utilized to introduce foreign genes, including selectable markers, into plant tissues
(Koncz etal., 1992). In addition, the T-DNA can be used as an effective, random

insertional mutagen (Feldmann et al., 1994; Krysan et al., 1999). Since the T-DNA is
Very large, approximately 5-25 kilobases (kb), any genes into which it inserts are
generally either no longer able to be expressed or are expressed but non-functional
(Krysan et al., 1999). These gene disruptions are often recessive; thus, heterozygous
km)Ckouts of essential genes are viable and can be propogated (Krysan et al., 1996).

Recently, populations of several thousand T-DNA mutagenized Arabidopsis lines

have been generated (Forsthoefel etal., 1992; Krysan et al., 1999). The mutant screening
Strategy for these populations is based on the fact that the sequences are known for both

the T—DNA border regions and for the gene in which an insertional mutation is desired.

29

 

 

PCR primers based on these sequences are used to amplify fragments from the DNA of
plants that contain a T-DNA insert within the gene of interest (Figure 13; McKinney et
al., 1995 ; Krysan et al., 1996; Krysan et at, 1999). Because performing several
thousand, individual PCR reactions would be prohibitive, PCR is done “Sing genomic
DNA from pools of plants rather than from individual plantS. For example, initial
screening of a mutagenized population containing 100,000 lines, with a primer to one of
the T-DNA border sequences and a gene—speciﬁc primer, would be done on pools of
genomic DNA from 1500 plants, a total of about sixty-fiVe PCR reactions. Usually, a
fragment will be ampliﬁed from only a single pool 0f DNA; the identity of this fragment
can be continued by Southern blot analysis using the Wild-type gene as a probe
(McKinney et al., 1995; Krysan et al., 1996; Krysan et al., 1999). The pool of 1500‘
plants that contained the fragment of interest is then separated into ﬁfteen pools of100
plants each, which can then be screened in a similar fashion. This prOCess is repeated
until the individual line containing a T-DNA insert within the desired gene is Obtained,
This Screening procedure is very sensitive, able to detect a single, T-DNA tagged line in a
background of several hundred lines containing other T-DNA inserts, and reproq "eible
(McKinney et al., 1995; Krysan et al., 1996; Krysan et al., 1999). Thus, it is possible to
detect virtually any T-DN A insertional mutation of interest, if it is present in the
mutagenized population (Krysan et al., 1996; Krysan et al., 1999).
This method has several advantages over other common procedures to obtain
knockout mutations in Arabidopsis. A similar method is based on transposon insertion
rather than T-DN A insertion (Martienssen, 1998; Wisman et al., 1998). Because these

transPosons are Qﬁen still active, however, stable mutants are not necessarily obtainable

30

 

 

 

Figure 13' Summary Of the strategy used for PCR screening of T-DNA
mutagenized Arabidopsis populations. The ﬁlled boxes represent the gene into which
the T-DNA has inserted; the T-DNA is depicted as a thin line. Screening For a T-DNA
insert within any particular gene is accomplished by performing a PCR reaction on
genomic DNA from a mutagenized Arabidopsis line. The primers used tor such a
reaction include one specific for one of the T—DN A border sequences (L or R) and one
Spaciﬁc for the gene of interest (5 , or 3’). In the scenario depicted, PCR products could
possibly be generated when the 5’ and R primers are used in comb i nation and/ or when

the 3 9 and L primers are used in combination. [Figure adapted 30111 Krysan e! a].
(1996)]

31

5’ L

 

 

     

 

 

—> ——>
T-DNA (5-25 kb)
ll
/ l
k
‘—
R 3 ,

Figure 1.3

3?.

 

 

 

(Krysan et al., 1999). In addition, not as many transposon-tagged lines are currently
available as exist for T-DNA tagged lines. Thus, the probability of obtaining an
insertional mutation in the gene of interest is higher for the T—DNA tagged lines. Amulet
common strategy for obtaining knockOUt mutants is based on antisense technology.
Inhibition of wild—type gene expression by antisense RNA has been demonstrated in
several cases (F lavell, 1994). However, this “1611109 is “Qt compkiew effective, possibiy
resulting in a downregulation rather than a complete suppression of gene expression.
Consequently, the likelihood of obtaining a knockout is lower than for the T—DNA
insertion procedure.

During the time this dissertation research was being done, reverse genetic
techniques were used successfully to isolate knockout mutant lines for the two GT?-
binding components of the chloroplastic protein import machinery, Toc34 and Toc159

(Jarvis et al., 1998', Bauer et al., 2000). The knockout mutant line for one of the W0
Arabidopsis Toc34 homologs, AtToc33, was originally isolated fmm a mutant Sereen
looking for genes affecting the expression of photosynthetic proteins (Jarvis et a1 -, 1998).
This recessive mutant is known as ppiI (plastid protein import l). The T-DNA ins
within the gene encoding AtTOC3 3 completely disrupts expression of the gene, as
detected by RT-PCR (Jarvis et al., 1998). The knockout mutant plants are very Dal e early
in deVelopment, Containing between ten and twenty percent of the chlorophyll 18Ve1s
observed for Wild-type plants (Jarvis et al., 1 998). Later in development, leaves of the

pp i1 mutant appear similar in color to the Wild type (Jarvis et 31-, 1998)- This PhenOtYDe

is Paralleled at the level of plastid UltrastrUCture. Chloroplasts isolated from young ppiI

l“’aVeS are smaller and contain fewer thylakoids than do chloroplasts isolated from wild-

33

 

type leaves (Jarvis et al., 1998). Chloroplasts from older ppi] leaves, however, appear
more like wild—type chloroplasts (Jarvis et al., 1998). These results suggest that AtToc33
is involved early in chloroplast develOpment; its function may be less important in more
mature plastids (Jarvis et al., 1998). In addition, chloroplasts isolated from young PP”
plants are impaired in their ability to import a Variety of precursor proteins (Jarvis et 3‘"
1998), lending support to the assignment of AtToc33 (and thus, pea Toc34) as a
component of the chloroplastic protein import apparatus.

There are two homologs of pea Toc34 in ArabidOpsis chloroplasts, AtToc33 and
AtToc34, both of which are expressed (Jarvis et al., 1998 ; Gutensohn et al., 2000). These
two proteins share >60% sequence identity With one another (Jarvis et al., 1998)-
Accordingly, the phenotype of ppi 1 plants can be complemented by the gene for either
protein (Jarvis et al., 1998). This result indicates that the two homologs perform] similar,

if not identical, functions (Jarvis et al., 1 998). However, endogenous AtToc34 camet
completely substitute for AtToc33 function in the PPi 1 mutant. One explanation for this
observation may be related to the relative expression levels of AtToc33 and AtTQe34.
Both are expressed at their highest levels early in Arabidopsis development, and their
expression levels decrease rapidly approximately one week after germination (Jarvis et
al., 1998). However, AtToc34 is expressed at relatively low levels at all ages, Whil e
AtToc33 is expressed at much higher levels (Jarvis et al., 1998). Thus, in the ppi1 mUtant
line, the low endogenous levels of AtT0C3 4 gene expression may not be enough to
compensate for the lack of AtToc33.

The second import component to be studied via reverse genetic techniques was

Toc159, the predicted transit peptide receptor protein. In the recessive mutant, ppiZ, the

34

 

 

gene for one of the Arabidopsis homologs of pea T oc159, AtToc159, has been disrupted
by a T-DNA insert (Bauer etal., 2000). This disruption results in the absence of both the
mRNA and the protein for AtToclS 9 within mutant plants (Bauer et al., 2000). The ppi2
mutant has an albino, seedling-1ethal phenotype (Bauer et al., 2000). Plastids of mutant
plants do not differentiate past the proplastid stage, the earliest stage 0f plastid
development (Bauer et al., 2000). The levels 0f PhOtosyrxthetiC, plastid-imported
proteins, and their corresponding mRNASa are greatly reduced in 131317 plants (Bauer et
al., 2000). Interestingly, however, these proteins are Still present in ppi2 protein extraCisa
and they are correctly localized to the plastid (Bauer et al., 2000). Thus, plastid protein
import is still occurring in the mutant cells, but the overall levels of import have been
greatly reduced. Surprisingly, the mRN A and protein levels of nonphotosynthetica
plastid-imported proteins are unaffected in ppi2 plants (Bauer et 31-, 2000). (The
exception being AtT oc34, which has increased mRN A levels in the mutant [Bauer et al.,
2000] .) Thus, the defect in the ppi2 mutant line appears to be Speciﬁc for photo synthetic
proteins.
ArabidOpsis has three homologs of pea Toc159, designated AtToc159, A tToc13
2,
and AtToclzo based on their predicted molecular masses (Bauer et al., 2000). The“:
homologs are «40% identical to each other at the amino acid level, most of which is
concentrated in the C-terminal halves of the proteins (~65% sequence identity in this
region; Bauer et al., 2000). All three of these proteins are expressed and localized to the
outer envelope membrane import complex of ArabidOpsis chloroplasts (Bauer et al.,
2000). However, AtToc159 is expressed ﬁve to ten times more abundantly than either

AtT00132 01' AtToc 1 20 (Bauer et al., 2000). All three are expressed twice as highly in

35

“—

 

light-grown plants, in which proplastids would be differentiating into chloroplastS, than
in dark-grown seedlings, which would be forming etioplasts (Bauer et al., 2000)-
Based on the phenotype of the ppi2 mutant, it is obvious that AtToc159 plays an
essential role early in Arabidopsis plastid deveIOpment, and that AtTocl32 and AtToc120
are unable to compensate for its loss in mutant plants. As for the pp” mutant discussed
above, it is possible that, in ppi2 plants, the low endogenous levels of the two homologs,
AtTocl32 and AtToc 1 20, are not high enough to compensate for the absence of
AtToc159. Another interesting possibility is that AtTOC l 59 may be the import receptor
speciﬁc for photosynthetic proteins (Bauer et al., 2000). In this model, AtTocl32 and
AtToc 120 would be receptors speciﬁc for non-photosynthetic proteins that are normally
localized to plastids (Bauer et al., 2000). Thus, in the ppi2 mutant line, AtToc 132 and
AtToc 120 are unable to substitute for AtToc159 because of their different speciﬁciues for
incoming precursor proteins. Because these three proteins are highly divergent from one
another in the N-terminal halves of their amino acid sequences, it is likely that this region
is responsible for the predicted differences in substrate speciﬁcity (Bauer et al., 2000).
The application of reverse genetics to the process of chloroplast protein in: ort
has already led to several conclusions regarding the possible roles of AtToc33 and
AtToc159 during precursor transport. Continuing investigations on these mutant lines
will likely lead to even more insights regarding component function. In addition, Work is
oug0ing in several laboratories to isolate and characterize knockout mutants for virtually
all of the other known subunits of the cthI'OplaStiC protein transport machinery 0" Jarvis,

Personal communication; D. Schnell, personal communication). Thus, the hypotheses

36

 

 

 

 

concerning import component f“1100011 Should receive more evidence, either for or

against, in the near future.

Statement of problem and attribution
Almost all chloroplast-localized proteins are encoded in the nuclear genome,
synthesized on] cytoplasmic ribosomes, and imported into the organelle
posttranslationally. The process of transporting proteins into the chloroplast interior is
mediated, with the assistance of several molecular chaperones, by a proteinaceous
complex located within the two membranes of the plaStid envelope. When this
dissertation research was begun, ﬁve subunits of the pea chloroplastic import comp16x
had been identiﬁed: Toc159, T0075, T0034, Ticl 10, and Hsp93. Several hypotheses
concerning the role of these proteins during precursor transport had been proposed, based
mainly on chemical crosslinking, antibody inhibition, and t0p010gy determination
experiments. KnOWledge of the motifs, such as nucleotide-binding domains, Contai n ed
within the amino acid sequences of these components had led to additional hypothes
regarding subunit function. However, most of these techniques were unable to 6' es
test the functional predict' Th the l f thi d' ' ”may
lonS- us, goa o s issertatron research has be en to
utilize the experimental tools available to further expand our knowledge of the mOIecui
functions of a few of these components, speciﬁcally Ticl 10, Toc34, and Hsp93. Initialar
experimentation Was limited to the same types of biochemical investigation that had been
done by previous researchers, but during the course of this dissertation, additional tools,
including genome analysis and reverse genetic techniques, became available and were

pIOyed. Identiﬁcation of the fUnctions of the 1nd1v1dual subunits of the chloroplastic

3'7

 

 

 

import complex will undoubtedly provide a deeper understanding of the overall process
of plastid protein import.

Chapter 2 describes work done on Ticl 10, the ﬁrst component of the chloroplaSt
inner envelope membrane import complex to be identiﬁed (Kessler and BlObCL 1996;
Lﬁbeck et al., 1996). The experiments presented in this chapter were Perfumed m “d“
to determine the topology of Ticl 10 within the inner envelope membrane. All of the
work described has been published (Jackson DT, Froehlich JE, Keegstra K [1998] J Biol
Chem 4273: 16583-165 88). The experiment presented in Figure 2.3 was performed in
collaboration with John Froehlich. I performed all the other experiments and wrote the
manuscript.

Chapter 3 presents an analysis of the genome of ArabidOpsis Malia n a, which was
completed in December 2000 (The Arabidopsis Genome Initiative, 2000), for h omologs
of the pea chloroplastic protein import apparatus. This work has also been published
(Jackson-Constan D, KeegstraK [2001] Plant Physiol 125: 1567-1575). I wrote the
manuscript and performed all the work reported in this chapter.

Chapter 4 describes the isolation and characterization of a knockout mutant 1'
for AtT0034, one of the two Arabidopsis homologs of pea Toc34, a GTP-bindiug me
component of the chlorOplast outer envelope membrane import complex. This Work is
being submitted to the journal Plant Cell for publication. The experiments describing the
generation and characterization of a double mutant in which the genes encoding both
AtToc33 and AtToc34 have been disrupted were performed by Paul Jarvis and Ramesh

P ' -
atel of the University of Leicester, England. I performed all the other experiments

res
p ented and WI‘ote the manuscript-

3%

 

 

Chapter 5 describes the isolation and characterization ofa knockout mutant/m.
for AtHsp93-V, one of the two Arabidopsis homologs of pea Hsp93, the predicted
translocation motor for chloroplast protein import. The isolation of the AtHsp93-V
knockout mutant was done in collaboration with Ana Kelly, an undergraduate who
worked under my supervision. I performed all the other experiments presented. This

work has “0t Yet been submitted for publication.

ConClusions based on this dissertation research and possible directions for further

investigation are discussed in Chapter 6.

39

 

 

REFERENCES

Abdallah F, Salamini F, Leister D (2000) A prediction ofthe size and evolutionary 0,731},
of the proteome of chloroplasts of A rabidopsis. Trends Plant Sci 5: I 41 -142

Akita M, Nielsen E, Keegstra K (1997) Identiﬁcation of protein transport complexes in

the chloroplastic envelope membranes via chemical cross-linking. J Cell Biol 136: 983-
994

America T, Hageman J, Gue'ra A, Rook F, Archer K, Keegstra K, Weisbeek p (1994)

Methotrexate does not block import of a DHFR fusion protein into chlorOplasts. Plant
Mol Biol 24: 283-294

ArabidOpSiS Genome Initiative, The (2000) Analysis of the genome sequence of the
flowering plant A rabidopsis thaliana. Nature 408: 796- 815

Baker KP, Schatz G (1991) Mitochondrial proteins essential foi- viability mediate protein
import into yeast mitochondria. Nature 349: 205-208

Bauer J, Chen K, Hiltbunner A, Wehrli E, Eugster M, Schnell D, K 683 lef P (2.000) The

. . . e
major protein import receptor of plastids lS essential for cthI‘OpIast biogenCS‘S' plan“
403: 203—207

Bolter B, 8011 J, Schulz A, Hinnah S, Wagner R (1998) Origin ofa chloroplaSt piotel“
importer. Proc Natl Acad Sci USA 95: 15831-15836

Brodsky JL, Schekman R (1993) A Sec63p-BiP complex from yeast is required for
protein translocation in a reconstimted PTOtBOIiPOSOme- J C611 3101 1 23; 1 3 55‘ 1 363

Bruce BD (2000) Chloroplast tranSit peptides: stI'UCture, function and eVqutio
Cell Biol 10: 440-447 Q

‘ Trends

Caliebe A, Grimm R, Kaiser G, Liibeck J, 8011 J , Heins L (1997) The ChIOI'OpIaSt -
protein import machinery contains a Rieske-type iron—sulfur cluster and a monor1 1°
iron-binding protein. EMBO J 16: 7342-7350 “’6‘"

Cavalier-Smith T (1987) The simultaneous symbiotic origin of mitochondria,
chlorOplasts, and microbodies. Ann NY Acad SCi 5033 55-71

Chen X, Schnell DJ (1999) Protein import into chloroplasts. Trends Cell Biol 9: 222_227
((3131011): T, Gilmore R (1989) The signal recognition particle receptor mediates the

"dependent displacement of SRP from the signal sequence of the nascent
Polymptide. Cell 57: 599-610

40

 

 

d

della—Cioppa G, Bauer SC, Klein BK, Shah DM, Fraley RT, Kishore GM (1986)

Translocation of the precursor of 5 -enolpyruvylshikimate-B-phosphate synthase into
cmoroplasts of higher plants in vitro. Proc Natl Acad Sci USA 83: 6 8 73-6877

Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular

localization of proteins based on their N-terminal amino acid sequence. J Mol Biol 300:
1005-10 1 6

Feldmann KA, Malmberg RL, Dean C (1994) Mutagenesis in Arabidopsis. In

Meyerowitz EM, Sommerville CR, eds, Arabidopsis; Cold Spring Harbor Press,
Plainview, NY, pp 137-172

Flavell RB (1994) Inactivation of gene expression in plants as a consequence of speciﬁc
sequence duplication. Proc Natl Acad Sci USA 91: 3490-3496

Forsthoefel NR, Wu Y, Schulz B, Bennett MJ, Feldmann KA (1 992) T-DN A insertion

mutagenesis in Arabidopsis: prospects and perspectives- Aust J Plant Physi 01 19: 3-
366

Gambill BD, Voos w, Kang PJ, Miao B, Larrger T , Craig EA, Pfanner N 0993) A 9w
role for mitochondrial heat shock proteln 70 1n membrane trans locatio of orepTO‘ems°
Cell Biol 123: 109-117 “

Glick BS (1995) Can Hsp70 proteins act as force-generating motors? Cell 80: ll'\

Glick BS, Wachter C, Reid GA, Schatz G (1993) Iinport of cytochrome b to the
mitochondrial intermembrane space: the tightly folded heme-binding domzain
import dependent upon matrix ATP. Protein Sci 2: 1 901-1917 makes

Guéra A, America T, van Waas M, Weisbeek PJ (1993) A strong protein

activity is associated with the binding of precursor chloroplast proteins to Efoldlhg
envelopes. Plant Mol Biol 23; 309-3 24 °"°p1asr

Gutensohn M, Schulz B, Nicolay P, F lﬁgge U-1 (2000) Functional analysis of

Arabidopsis homologues of Toc34, a component of the chloroplast protein im

the ,w
apparatus. Plant J 23: 771-783 port

0

Hachiya N, Alam R, Sakasegawa Y, Sakaguchi M, Mihara K, Omura T (1993) A
mitochondrial import factor puriﬁed from rat liver cytosol is an ATP-dependent
conformational modulator for precursor proteins. EMBO J 12: 1579-1586

Herrmann JM, Neupert W (2000) Protein transport into mitochondria. Curr Opin
Mlcrobiol 3: 210-214

41

 

Hill K, Model K, Ryan MT, Dietrneier K, Martin F, Wagner R, PfannerN (1998) 703,40

fol-ins the hydrophilic channel of the mitochondrial import pore for preproteins. News
3 9 5 : 5 16-521

Hinnah SC, Hill K, Wagner R. Schlicher T, 3011 J (1997) Reconstitution ofa chloroplast
protein import channel. EMBO J 16: 7351-7360

Hirsch S, Muckel E, Heemeyer F, von Heijne G, Soll J (1994) A receptor component of
the chloroplast protein translocation machinery. Science 266'. 1989-1992

jarvis P, Chen L-J, Li H-M, Peto CA, Fankhauser C, Chory J (1998) AnArabidopsis
mutant defective in the plastid general protein import apparatus. Science 282: 100-103

Jensen RE, Johnson AE (1999) Protein translocation: is Hsp70 pulling my chain? Curr
Biol 9: R779-R782

Joyard J, Block MA, Douce R (1991) Molecular aspects of plastid envelope
biochemistry, Eur J Biochem 199: 489-509

Jungnickel B, Rapoport TA (1995) A posttargeting signal seQUence recognition event in
the endoplasmic reticulum membrane. Cell 82: 261-270

, . “osawa
Kaneko T, Sato s, Kotani H, Tanaka A, Asamlzu E, Nakamura y, Mi ajimaN’ B

M, Sugiura M, Sasamoto S, et al- (1996) Sequence analysis of the genDome of the
unicellular cyanobacterium SyneChOCyStiS sp. strain PCC6803. II.

. . . . . Se=quence ,
determination of the entire genolne and asmgnment 0f POtentlal prote iii-coding regions-
DNA Res 3: 109-136

Keegstra K, Werner-Washbume M, Cline K, ADdreWS J (1984) The ch 1

. , Oro
is it homologous with the double membranes of mitochondria and p138

Grahame - t envelope:
bacteria? J Cell Biochem 24: 55-68 gar, Ve

Keegstra K, Bruce B, Hurley M, Li H-M, Perry 3 (1 995) Targeting Ofprotei

'ns °
chloroplasts. Physiol Plant 93: 157-162 "no

Keegstra K, Cline K (1999) Protein import and routing systems of chlorOplasts,

1)
Cell 11: 557-570 lam
12(eegstra K, Froehlich JE (1999) Protein import into chloroplasts. Curr Opin Plant 13101
: 47 1-476

KeegStra K, Olsen LJ, Theg SM (1989) Chloroplastic precursors and their transport
across the envelope membranes. Annu Rev Plant Physiol Plant Mol Biol 40: 471-501

tIlfesslller F, Blobel G (1996) Interaction of the protein import and folding machineries in

e c IOroplast. Proc Natl Acad Sci USA 93: 7684-7689

42

 

 

w"

Kessler F, Blobel G, Patel HA, Schnell DJ ( 1994) Identiﬁcation oftvvo GTP-bindjﬁg
proteins in the chloroplast protein import machinery. Science 266: 1 035-1039

Kirk ITO, Tilney-Bassett RAE (1978) The plastids: their chemistry, structure, growth and
inheritance. Elsevier Press, Amsterdam

K0 K, Bornemisza O, Kourtz L, Ko ZW, Plaxton WC, Cashmore AR (1992) Isolation

and characterization of a cDNA clone encoding a cognate 70-kDa heat shock protein of
the chloroplast envelope. J Biol Chem 267: 2986-2993

Komiya T, Hachiya N, Sakaguchi M, Omura T, Mlhara K (1994) Recognition of

mitOChondria-targeting signals by a cytosolic import stimulation factor, MSF. 13101
Chem 269: 30893-30897

Koncz C, Németh K, Rédei GP, Schell J (1992) T-DNA insertional mutagenesis in
Arabidopsis. Plant Mol Biol 20: 963-976 .

Kouranov A, Chen X, F uks B, Schnell DJ (1998) TicZO and Tic22 are new components

of the protein import apparatus at the chloroplast inner enveIOpe membrane- ] Cell Biol
143: 991- 1002

Kouranov A, Schnell DJ (1997) Analysis Of the interactions of

. . . . prep roteins will) mi”:
import machinery over the course of protein import into chloroplasts J Cell BlO\
1677-1685 ‘

Kourtz L, Ko K (1997) The early Stage of chloroplast protein import - “170 J
Biol Chem 272: 2808-2813 Involves C0

Kronidou NG, Oppliger W, Bolliger L, Hannavy K, GliCk BS, SChatz G, Ho
Dynamic interaction between Isp45 and mitochondrial hsp70 in the protein jrst M (1994)
of the yeast mitochondrial inner membrane. Proc Natl Acad Sci USA 9 1 ; 1281112 011 system

~ 12822
Krysan PJ, Young JC, Sussman MR (1999) T-DNA as an insertional mutagen ,-
Arabidopsis. Plant Cell 11: 2283-2290 ’1

Krysan P], Young J C, Tax F, Sussman MR (1996) Identiﬁcation of transferred

. _ D
insertions within Arabidopsis genes involved in Signal transduction 311d ion “31181312:
Proc Natl Acad Sci USA 93: 8145-8150 '

Lithgow T (2000) Targeting of proteins to mitochondria. F EBS Lett 476: 22—26

Liibeek J, 8011 J, Akita M, Nielsen E, Keegstra K (1996) Topology of IEPl 10, a
component of the chloroplastic protein import machinery present in the inner envelope
membrane. EMBO J 15: 4230-4238

43

 

_

Ma Y, Kouranov A, LaSala SE, Schnell DJ (1996) Two components ofth e 01110“)
' ° - . . p/ast
protein import apparatus, IAP86 and IAP75, interact With the tranSit sequence dun}, [be

. . . . g
recognition and translocation of precursor protems at the outer enveIOpe. J CelI Biol 134:
315-327

Mannella CA, Neuwald AF, Lawrence CE (1996) Detection of likely transmembrane

beta strand regions in sequences of mitochondrial pore proteins using the Gibbs sampler.
J Bioenerg Biomembr 28: 163-169

Manting EH, Driessen AJM (2000) Escherichia coli translocase: the unravelling of a
molecular machine. Mol Microbiol 37: 226-238

Marshall 15, DeRocher AE, Keegstra K, Vierling E (l 990) Identiﬁcation of heat shock
protein hsp70 homologues in chloroplasts. Proc Natl Acad Sci USA 87: 374-378

Martienssen RA (1998) Functional genomics: probing plant gene function and expression
with transposons. Proc Natl Acad Sci USA 95: 2021-2026

May T, 8011 J (1999) Chloroplast precursor protein translocon. FEBS Le“ 452; 52-56

' - or
May T, 8011 J (2000) 14-3-3 proteins form a guidance Complex With chloroplas‘ p‘eeurs
Proteins in plants. Plant Cell 12: 53-63

. . Cl
McKinney EC, All N, Traut A, Feldmann KA, Belostotsky DA, McDowell M, New» ,
RB (1995) Sequence-based identiﬁcation of T-DNA insertion mutations in Ara bidOPSIS'
actin mutants act2-1 and act4—I . Plant J 8: 613-622

Moore T, Keegstra K (1993) Characterization of a cDNA clone enchin g a h
targeted Clp homologue. Plant Mol Biol 21: 525-537 c Ioroplast-

Neupert W, Hartl F-U, Craig EA, Pfanner N (1990) HOW d0 POIYPePtides Cro
mitochondrial membranes? Cell 63: 447-450 88

Nielsen EE (1997) The role of stromal molecular chaperones in chloroplastic

- . . . . r .
translocation. Ph.D. Dissertation, Michigan State UniverSity, East Lansmg, p C)tein

MI
Nielsen E, Akita M, Davila-Aponte J, Keegstra K (1997) Stable association of
chloroplastic precursors with protein translocation complexes that contain protei 11$ ﬁo
32g) envelope membranes and a stromal HSp100 molecular chaperone. EMBO J 16: 91:5

.Oblong 113, mepa GK (1992) Identiﬁcation of two structurally related proteins
Involved

in proteolytic processing of precursors targeted to the chlorOplast. EMBO J 1 l'
440 1.4409 -

44

 

 

Olsen LJ, Keegstra K (1992) The binding of precursor proteins to chlorOplasts regime,-
nucleoside triphosphates in the intermembrane space. J Biol Chem 26 7: 433-439

Olsen LJ, Theg SM, Selman BR, Keegstra K ( 198 9) ATP is required for the binding of
precursor proteins to chloroplasts. J Biol Chem 264: 6724-6729

0 SC Poritz MA, Walter P (1992) Signal recognition particle receptor is important for
cegllggrovvth and protein secretion in Saccharomyces cerevisiae. Mol Biol Cell 3: 895-911

Perry SE, Keegstra K (1994) Envelope membrane proteins that interact with chloroplastic
precursor PFOteins. Plant Cell 6: 93- l 05

Pfal’mer N, Craig EA, Honlinger A (1997) Mitochondrial Prepfotein translocase. Annu
Rev Cell Dev Biol 13: 25-51

Pfanner N, Meijer M (1995) Protein sorting: pulling in the proteins_ Curr Biol 5: 132—135

- - . . 79..
Pilon M, Schekman R (1999) Protein translocation. how Hsp70 pulls .1, off- Cell 97. 6
682

' ' ’ tial
RaImport TA, Matlack KES, Plath K, MlsseIWltz B, Staeck 0 (1999) Posméns‘atoem
protein translocation across the membrane of the endoplasmic reticul . BlOl C
380: 1143-1150 U!“

Rapoport TA, Rolls MM, JungniCkel B (1996) Approaching the mechanism of prom“
transport across the ER membrane. Curr Opin Cell Biol 8: 499-504

Rassow J, Maarse AC, Krainer E, Kiibrich M, Miiller H, Meijer M, Craig E A Pf N
(1994) Mitochondrial protein import: biochemical and genetic evidence fol. in’t 31106!
matrix hsp70 and the inner membrane protein MIM44. J Cell Biol 127; 1547‘ elactlon of

556
Rassow J, Dekker PJT, van Wilpe S, Meijer M, 5011 J (1999) The Preprotein

. tr
of the mitochondrial inner membrane: function and evolution. J Mol Bio] 286:3":8100ase

05-120
Reumann S, Davila-Aponte J, Keegstra K (1999) The evolutionary origin ofth

e .
translocating channel of chloroplastic envelope membranes: identiﬁcation of a Proteim
cyanobacterial homolog. Proc Natl Acad Sci USA 96: 784-789

Reumann S, Keegstra K (1999) The endosymbiotic origin of the protein import
machinery of chloroplastic envelope membranes. Trends Plant SCI 4: 302-307

Richter S, Lamppa GK (1998) A chloroplast processing enzyme ﬁmctions as the genera]
Stroma] processing peptidase. Proc Natl Acad Sci USA 95: 7463-7468

ROiSe I), Theiler F, Horvath SJ, Tomich JM, Richards JH, Allison D5, Schatz G (1988)
AmPhiDhilicity is essential for mitochondrial presequence function. EMBO J 73 649-65 3

45

 

Rothblatt 3A, Deshaies R]. Sanders SL, Daum G, Schekman R (1989) Multiple genes,”
required for the proper insertion of secretory protel 118 into the endoplasmic reticulum in
yeast J Cell Biol 109: 2641-2652

anglers SL, Whitﬁeld KM, Vogel JP, Rose MD, Schekman RW (1992) Sec61p and BiP

directly facilitate polypeptide translocation into the ER. Cell 69: 353-365

Schatz G, DObberstein B (1996) Common principles of protein translocation across
membranes. Science 271: 1519-1526

Schirmer EC, Glover JR, Singer MA,

Lindquist S (1996) HSP100
common mechanism explains diverse

lClp proteins: a
functions. Trends Biochem Sci 21 1 289-296

Schleiff E, Sol] J (2000) Travelling of proteins through membranes; translocation into
chloroplasts. Planta 211: 449-456

Schneider H-C, Berthold J, Bauer MF, Dietmeier K, Guiard B, Brunner M, Neupert W
(1994) Mitochondrial Hsp70/MIM44 complex faCilitates protein import. Nature 37 1:
768-774

Schnell DJ, Blobel G (1993) Identiﬁcation of intermediates in the Paulon 0 totem

° ‘ . o . . 20..
import into chloroplasts and their localization to envelope contact Sites Cell Biol 1
103-115 .

Schnell DJ, Kessler F, Blob

e G 994 a 'on o tein
1 (1 )lsol ti f components of‘ th 1 \agtvlo

2 2 h oro

import machinery. Science 66: 1007-101 e C P

Seedorf M, Waegemann K, Soll J (1995) A con

stituent of the chloroplast im
represents a new type of GTP-binding protein. Plant] 7: 401-411 Don complex

Segui-Real B, Kispal G, Lill R, Neupert W

(1993) Functional independen Ce
protein translocation machineries in mitochondria 0

1 outer and inner membrane 1" the
of preproteins through the intermembrane space. EMBO J 12: 2211-2218 S: Passage
Simon SM, Peskin CS, Oster GF (1992) What drives the translocation ofprotein
Natl Acad Sci USA 89: 3770-3774 S? P 1'00

Sohrt K, Soil J (2000) Toc64, a new component of the protein translocon of ch10r0 l
J Cell Biol 148: 1213-1221 " aStS-

Stahl T, Glockmann C, 8011 J , Heins L (1999) Tic40, a new “old” subunit of the
Chl0r0plast protein import translocon. J Biol Chem 274: 37467-37472

ISBt‘rub A, Lim JH, Pfanner N, Voos W (2000) The mitochondrial protein impOI't motor
101 Chem 381: 943-949 .

46

Stuart RA, Gnihler A, van der Klei I, Guiard B, [(011 H, Neupert w ( 1994) 77m

requirement of matrix ATP for the import .of precursm proteins into the mitochondna/
matrix and intermembrane space. Eur J Biochem 220,- 9- 13

Sugiura M (1989) The chloroplast chromosomes in land plants. Annu Rev Cell Biol 5:
51—70 '

Theg SM, Bauerle C, Olsen LJ, Selman BR, Keegstra K (1989) Internal ATP is the only

energy requirement for the translocation of precursor proteins across chloroplastic
membranes. J Biol Chem 264: 6730-67 36

Tranel Pl, Froehlich J, Goya] A, Keegstra K (1995) A component of the chloroplastic

protein import apparatus is targeted to the outer envelope membrane via a novel pathway .
EMBO J 14: 243 6-2446

Tranel PJ, Keegstra K (1996) A novel, bipartite transit peptide targets 0131375 to the outer
membrane of the chloroplastic envelope. Plant Cell 8: 2093-2104

van den Wijngaard PWJ, Vredenberg WJ (1997) A 501~picosiem en 8 anion channel of the

chloroplast envelope is involved in chloroplast protein import. J Biol Chem '12. 29
29433

sing
VanderV ere PS, Bennett TM, Oblong .JE, Lamppa GK (1995) A chloroplast piecesW
enzyme involved in precursor maturation Shares a zinc-binding motif with a tee-e“

recognized family of metalloendOPeptidases. Proc Natl Acad Sci US A 92: 71 7 . ‘8‘

von Heijne G (1986) Mitochondrial targeting sequences may form phi hil . . CS.
EMBO J 5:1335-1342 “‘1 P 1c hellc

von Heijne G, Nishikawa K (1991) Chloroplast transit peptides: the perfe
FEBS Lett 278: 1-3

ct
“dam coil?

von Heijne G, Steppuhn J, Herrmann RG (1989) [30111211n Structure Of mitochon ,
chloroplast targeting peptides. Eur J Biochem 180: 535-545 dual and

Vothknecht UC, 8011 J (2000) Protein import: the hitchhikers guide into chlorop lasts
Biol Chem 381: 887-897 '

Waegemann K, 8011 J (1991) Characterization of the protein import apparatus in isolated
outer envelopes of chloroplasts. Plant J l: 149-158

gisman E, Hartmann U, Sagasser M, Baumann E, Palme K: Hahlbrock K: Saedler H

Gisshaar B (1998) Knock-out mutants from an Ell-1 mutagenized Ar abidoPSiS walking

PODUIation generate phenylpropanoid biosyntheSiS phenotypes. P 1'00 Natl Acad Sci USA
95: 1243242437 .

47

 

 

Wu C, Seibert FS, Ko K (1994) Identiﬁcation of chloroplast envelope proteins in close

physical proximity to a partially translocated chimeric precursor protein. J Biol Chem
269: 32264-32271

Yaffe MP, Schatz G (1984) Two nuclear mutations that block mitochondrial protein
import 1n yeast. Proc Natl Acad Sci USA 81: 4819-4823

Young ME, Keegstra K, Froehlich J E (1999) GTP promotes the formation of early-

import intermediates but is not required during the translocation step of protein import
into chloroplasts. Plant Physiol 121: 237-243

2ambl‘jysld P (1988) Basic processes underlying Agrobacterium-mediated DNA transfer
toplant cells. Annu Rev Genet 22: 1-30

48

CHAPTER 2

The by drophilic domain of Tic110, an inner envelope membrane component of the
chloroplastic protein translocation apparatus, faces

the stromal compartment

The work presented in this chapter has been published:

Jackson DT, Froehlich JE, Keegstra K (1998) J Biol Chem 273: 16583-16588

The eXperiment presented in Figure 2.3 was done in collaboration with John Froehlich.

49

ABSTRACT

It has previously been found that Tic110, an integral protein of the chloroplast
inner envelope membrane, is a component of the chloroplastic protein import apparatus.
However, conﬂicting reports exist concerning the topology of this protein within the
inner envelope membrane. In this report, we provide evidence that indicates that the
large (>90 kD) hydrophilic domain of Ticl 10 is localized within the chloroplast stroma.
TWPSin, a protease that cannot penetrate the permeability barrier of the inner envelope
membrane, degrades neither Ticl 10 nor other proteins exposed to the stromal
compartment but is able to digest proteins exposed to the interrnembrane space between
the W0 envelope membranes. Previous reports indicating that trypsin is able to degrade
Ticl 1 0 were inﬂuenced by incomplete quenching of protease activity. When trypsin is
not SL1fficiently quenched, it is able to digest Tic110, but only after chloroplasts have
been I‘Iaptured. It is therefore necessary to employ adequate quenching protocols, such as
the one reported here, whenever trypsin is utilized as an analytical tool. Based on a
strorr1 a1 localization for the majority of Tic110, we propose that this protein may be
i“vol\’ed in the recruitment of stromal factors, possibly molecular chaperones, to the

translocation apparatus during protein import.

50

INTRODUCTION
The majority of chloroplastic proteins are encoded within the nuclei of plant cells
and are Synthesized on cytoplasmic ribosomes. As a result, these proteins must be
imported into the chloroplast posttranslationally, usually via an unfolded, higher
molecular weight precursor form containing a N-terminal transit peptide (Chua and
Schmidt, 1978; Highﬁeld and Ellis, 1978; Schmidt et al., 1979; Kouranov and Schnell,
1995) - Once a precursor protein has entered the chloroplast stroma, the transit peptide is
cleaved off by the stromal processing peptidase, and the protein is folded into its mature
form (Kouranov and Schnell, 1996). Protein import into chlorOplasts is mediated by 3
pr otei naceous translocation apparatus that spans both the outer and inner envelope
membranes of this organelle. Several components of the translocation apparatus have
been identiﬁed, including the outer membrane components Toc86 (translocon at the Quter
(ml/810133 membrane of ghloroplasts, §_6_ kD), Toc75, and Toc34; an inner membrane
component, Tic110 (translocon at the inner envelope membrane of ghloroplasts, _l_1_Q kD);
and a primarily stromal component, ClpC, a heat shock protein 100 (Hsp100)homolog
(Waegemann and $011, 1991; Hirsch et al., 1994; Kessler et al., 1994; Perry and Keegstra,
1994 ; Schnell et al., 1994; Wu et al., 1994; Seedorf et al., 1995; Tranel et al., 1995;
Kessler and Blobel, 1996; Liibeck et al., 1996; Akita et al., 1997; Nielsen etal., 1997).
The ﬁrst component of the inner envelope membrane translocation apparatus to
be celoned was Tic110. Using chemical crosslinking and coimmunoprecipitation
techIliques, two separate laboratories have found Ticl 10 in a complex with both a
t1eulslocating precursor and components of the outer membrane translocation apparatus

(Kessler and Blobel, 1996; Liibeck et al., 1996). Tic110 is an integral protein of the inner

51

envelope membrane of chloroplasts, with either one or two putative, hydrophobic,
transmembrane domains located near its N-terminus (Kessler and Blobel, 1996; Liibeck
et al., 1 996). The overall topology of Ticl 10 within the inner envelope membrane,
however, remains a point of debate. Liibeck et al. (1996) reported that Tie] 10 spans the
membrane once and that its large (>90 kD) hydrophilic domain is oriented toward the
interrnembrane space between the outer and inner envelope membranes. On the other
hand, Kessler and Blobel (1996) proposed that Tic110 spans the membrane twice and that
its hYdl‘ophiliC domain is contained within the chloroplast stroma. To date, no evidence
has been presented that satisfactorily resolves this controversy.
Knowing the topology of Ticl 10 will be important in assigning a putative
functi 011 to this protein. For instance, if Ticl 10 is oriented towards the chloroplast
intern—1 embrane space, then it may function by interacting with the outer membrane
t1"‘mslocation apparatus, promoting the formation of contact sites between the two
en“lope membranes (Liibeck et al., 1996). However, if Ticl 10 is instead exposed to the
StrOkla] compartment, then it is more likely that the protein acts by recruiting stromal
prote ins, for example molecular chaperones, to the protein import apparatus (Kessler and
Blobel, 1996).

In previous studies, the topology of Tic110 was investigated by analyzing the
protease sensitivity of the protein within intact chloroplasts, a technique that has been
used for other chloroplastic membrane proteins and for membrane proteins of other
01.gallelles (Etemadi, 1980; Kessler et al., 1994; Seedorf et al., 1995 ; Kessler and Blobel,

1996; Liibeck et al., 1996; Tranel and Keegstra, 1996). Two of the most widely used

proteases in such studies are therrnolysin and trypsin. Therrnolysin has been used to

52

selectively degrade outer envelope membrane proteins exposed on the surface of
chloroplasts, since this protease, at moderate concentrations, does not penetrate the outer
membrane (Cline et al., 1984). Trypsin, however, does penetrate the chloroplast outer
envelope membrane, but it does not, at moderate concentrations, destroy the permeability
barrier of the inner membrane (Cline et al., 1981; Cline et al., 1984; Marshall et al.,
1990). Thus, trypsin is useful in deﬁning the topology of inner envelope membrane
proteins and in localizing soluble proteins to the intermembrane space of the chloroplast.
In this paper, we report on the topology of Ticl 10, attempting to resolve the
controversy that currently exists concerning the orientation of this protein within the
chloroplast inner envelope membrane. When steps are taken to adequately quench
proteases, Tic110 is degraded by neither trypsin nor thermolysin, indicating that the large
hydrophilic domain of Ticl 10 is contained within the chloroplast stromal compartment.
In addition, when trypsin is insufﬁciently quenched, Tic110 is degraded, but only aﬂer
chloroplasts are broken open. Comparison of the protease sensitivity of Ticl 10 with
those of proteins of established topology lends further support to the conclusion that

Tic110 is indeed oriented toward the chloroplast stroma.

53

MATERIALS AND METHODS
Materials
Pea seeds (Pisum sativum var. little marvel) were supplied by the Olds Seed
Company (Madison, Wisconsin, USA). Percoll silica gel, trypsin (from bovine
pancreas), Na-p-tosyl-L-lysine chloromethyl ketone (TLCK), soybean trypsin inhibitor,
and Mg-ATP were obtained from Sigma (St. Louis, Missouri, USA).

Phenylmethanesulfonyl ﬂuoride (PMSF) and aprotinin were purchased from Boehringer

Mannheim (Indianapolis, Indiana, USA). 35S-methionine was obtained from NEN Life

Science Products (Boston, Massachusetts, USA).

Isolation of chloroplasts

Chloroplasts were isolated from 8 to 12-day-old pea seedlings over Percoll
gradients as described previously (Bruce et al., 1994). Final resuspension was in import
buffer (50 mM HEPES-KOH [pH 7.7], 0.33 M sorbitol) at a concentration of 1 mg

chlorophyll/mL.

Trypsin digestion of intact chloroplasts

Puriﬁed intact chloroplasts (50 pg chlorophyll) were incubated with trypsin (6300
BABE U/mg; 10 to 1000 pg trypsin/mg chlorophyll) in import buffer containing calcium
chloride at a ﬁnal concentration of 0.1 mM. The ﬁnal reaction volume for these
digestions was 300 pL. After incubation with the protease for either 10 minutes or 60
minutes at room temperature, trypsin activity was quenched by adding either PMSF at a

ﬁnal concentration of 1 mM or by adding a mixture of protease inhibitors to a ﬁnal

54

concentration of 1 mM PMSF, 0.05 mg/mL TLCK, 0.1 mg/mL soybean trypsin inhibitor,
and 2 pg/mL aprotinin. Chloroplasts were incubated with the quenching reagents for 10
minutes on ice.

After quenching, intact chloroplasts were reisolated over a 40% (v/v) Percoll
cushion. The recovered chloroplasts were lysed hypotonically and fractionated into crude
membrane and soluble fractions as described previously (Bruce et al., 1994), except that
the lysis buffer contained either PMSF at a ﬁnal concentration of 1 mM or a protease
inhibitor mixture at ﬁnal concentrations of 5 mM PMSF, 0.05 mg/mL TLCK, and 0.1
mg/mL soybean trypsin inhibitor. Fractions were analyzed by SDS-PAGE and
immunoblotting with either Ticl 10 or Toc75 antibodies essentially as described by

Tranel et a1. (1995). Variations to this protocol are given in the ﬁgure legends.

Protease digestion of newly imported precursor proteins

Precursor proteins were synthesized in the presence of 35S-methionine using the
TNT®-coupled translation system from Promega (Madison, Wisconsin, USA). Rabbit
reticulocyte lysate-translated 35S-pr'l‘oc75 (Tranel et al., 1995), 358-th 10-1 ION
(Liibeck et al., 1997), 3SS-tpss-110N (Lﬁbeck et al., 1997), 3SS-tp'roe75-rnss (Tranel

and Keegstra, 1996), or 35S-prSS (Olsen and Keegstra, 1992) was imported into puriﬁed
chloroplasts (100 pg chlorophyll) essentially as previously reported (Bruce et al., 1994).
After import, intact chloroplasts were reisolated over a 40% (v/v) Percoll cushion and
resuspended in 600 11L import buffer. Each import reaction was then split into four equal

samples for further analysis.

55

One sample from each import reaction was lysed hypotonically, as described
previously (Bruce et al., 1994), without any further treatment. A second sample was
incubated on ice for 30 minutes with 0.2 mg/mL thermolysin. Protease activity was
quenched by adding EDTA to a ﬁnal concentration of 5 mM. Intact chloroplasts were
then reisolated over a 40% (v/v) Percoll cushion containing 5 mM EDTA and lysed
hypotonically. The remaining two samples from each import reaction were incubated in
the presence of trypsin (6000 BAEE U/mg) at a concentration of 500 pg trypsin/mg
chlorophyll for 60 minutes at room temperature. Trypsin activity was quenched for 10
minutes on ice either with PMSF at a ﬁnal concentration of 1 mM or with a mixture of
protease inhibitors at ﬁnal concentrations of 1 mM PMSF, 0.05 mg/mL TLCK, 0.1
mg/mL soybean trypsin inhibitor, and 2 pg/mL aprotinin. Intact chloroplasts from the
two trypsin treatments were then reisolated and lysed as described above. Lysed
chloroplasts from all four treatments were fractionated into crude membrane and soluble
fractions as described by Bruce et al. (1994). The protein concentration of each fraction
was determined by the Lowry protein assay (Lowry et al., 1951). Equal amounts of
protein from each fraction were analyzed by SDS-PAGE and ﬂuorography or

immunoblotting (Tranel et al., 1995).

Trypsin digestion of purified inner envelope membrane vesicles
Inner envelope membranes were puriﬁed from intact chloroplasts essentially as
described by Keegstra and Yousif (1986), except that the puriﬁed inner membranes were

resuspended in lysis buffer (25 mM HEPES-KOH [pH 8.0], 4 mM MgC12) at a

concentration of 0.5 mg/mL. Protein concentration was determined by the Bradford

56

protein assay (Bio-Rad, Hercules, California, USA). Puriﬁed inner envelope membranes
(20 pg protein) were incubated with trypsin (6000 BAEE U/mg; 1 to 10000 ng
trypsin/mg protein) in the presence of 0.1 mM calcium chloride for 10 minutes at room
temperature. The ﬁnal reaction volume for these digestions was 200 pL. Trypsin
activity was quenched by the addition of a mixture of protease inhibitors at ﬁnal
concentrations of 1 mM PMSF, 0.05 mg/mL TLCK, 0.1 mg/mL trypsin inhibitor, and 2
pg/mL aprotinin. The quenched reactions were incubated for 10 minutes on ice. Inner
envelope membranes were then recovered by centrifuging the samples at 250000 g for 10
minutes. Samples were analyzed by SDS-PAGE and immunoblotting with antibodies

against either Ticl 10 or ClpC as described previously (Tranel et al., 1995).

Antibodies

All antibodies used in this investigation were polyclonal and raised in rabbits.
Antiserum to Ticl 10 was generated as described by Akita et al. (1997). Antiserum
against Toc75 was raised as discussed by Tranel et al. (1995). Antiserum to Toc34
(Schnell etal., 1994) was a gift from D. Schnell. Afﬁnity-puriﬁed anti-ClpC antibodies

(Shanklin et al., 1995) were a giﬁ from J. Shanklin.

57

RESULTS
T id] 0 is resistant to digestion by adequately quenched trypsin

It has been reported that certain proteases, most notably trypsin, are able to
destroy the permeability barrier of the outer envelope membrane of chloroplasts and
thereby degrade outer membrane proteins, as well as inner envelope membrane proteins
exposed to the intermembrane space, while leaving stromally exposed proteins
undigested (Cline etal., 1981; Cline et al., 1984; Marshall et al., 1990). Consequently,
this method can be used to selectively degrade inner envelope membrane proteins that are
oriented towards the intermembrane space while leaving stromally exposed inner
membrane proteins intact. Such selective proteolysis techniques have previously been
utilized to analyze the location and topology of various chloroplast envelope membrane
proteins, including Ticl lO (Kessler and Blobel, 1996; Liibeck et al., 1996; Tranel and
Keegstra, 1996).

During efforts to repeat and extend these previous studies, we observed that
Tic110 was resistant to degradation when intact chloroplasts were incubated with a range
of trypsin concentrations (data not shown), indicating that this protein was not exposed to
the chloroplast interrnembrane space. These results were in direct contrast with the
trypsin sensitivity of Ticl 10 reported by Liibeck et al. (1996). However, several
differences in protocol existed between the two experiments, including the length of time
used for trypsin digestion and the reagents used to quench trypsin activity. Consequently,
we sought to determine whether these protocol differences could explain the contrasting

results.

58

Intact chloroplasts were incubated with trypsin for either 10 minutes (Figure 2.1,
lanes 1-3 and lanes 7-9) or for 60 minutes (Figure 2.1, lanes 4-5 and lanes 10-11), as
described by Liibeck et al. (1996). After digestion for the speciﬁed period of time,
trypsin activity was quenched either with a mixture of protease inhibitors (Figure 2.1,
lanes 1-5) or with 1 mM PMSF (Figure 2.1, lanes 7-11), as reported by Liibeck et al.
(1996). Degradation of Ticl 10 was not signiﬁcantly affected by the duration of
incubation with the protease (Figure 2.1, compare lanes 2-3 with lanes 4-5). On the other
hand, the quench protocol had a dramatic effect on Ticl 10 digestion (Figure 2.1, compare
lanes 2-5 and lanes 8-11). Ticl 10 remained undigested when trypsin was quenched with
the mixture of protease inhibitors but was completely degraded when 1 mM PMSF was
used to quench trypsin activity. These observations indicated that 1 mM PMSF was
insufﬁcient to quench protease activity. This result was supported by the ﬁnding that
when chloroplasts were incubated with 1 mM PMSF prior to trypsin addition, Ticl 10 was
still completely degraded (Figure 2.1, lane 12). Other differences (i.e. number of washes)
between our protease digestion protocol and that of Lﬁbeck et al. (1996) were also tested
for their effects on Tic110 degradation. However, none affected the pattern of Ticl 10
digestion (data not shown). We concluded, therefore, that the difference in results could

be completely explained by differences in the methods used to quench trypsin activity.

Tic110 is degraded by insufficiently quenched trypsin only after chloroplast lysis
We next sought to determine at what stage of the protease digestion protocol
trypsin degraded Ticl 10 when 1 mM PMSF was used as the quenching reagent.

Speciﬁcally, we wanted to determine whether Ticl 10 was degraded before chloroplast

59

Figure 2.1. Tic110 is not degraded by trypsin as long as the protease is adequately
quenched. Intact chloroplasts were incubated for the times indicated without (lanes 1
and 7) or with (lanes 2-6 and 8-12) trypsin. Protease concentrations used are indicated.
The concentration of trypsin used in the lanes marked "Q" (lanes 6 and 12) was 500 pg
protease/mg chlorophyll. Trypsin activity was quenched as indicated either after (lanes
2-5 and 8-11) or before (lanes 6 and 12) trypsin addition. Intact chloroplasts were
reisolated, lysed, and separated into membrane and soluble protein fractions. Equivalent
volumes of each membrane protein fraction were analyzed by SDS-PAGE and

immunoblotting with antibodies against either Ticl 10 or Toc75.

60

digest time Quench Cocktail PMSF

(minutes) r 10 60 10 ll 10 60 10 I

“ngW F_ 50 500”50 soo'rQ IF_ 50 500'150 soolrQI
mg chlorophyll . , . _ ,

 

 

a.

Tic110 rennin—chuc- '

Toc75 ‘ """ W" ‘~

Figure 2.1

61

lysis, when the permeability barrier of the inner membrane was still intact, or after lysis,
when the inner membrane had been ruptured. There were three stages during our
protocol in which degradation of Ticl 10 by trypsin could occur: before chloroplasts were
broken open (incubation of chloroplasts with trypsin, quenching of protease activity, and
reisolation of intact chloroplasts), during chloroplast lysis, or during post-lysis steps
(membrane sedimentation and incubation of the membranes in SDS-PAGE sample
buffer). To distinguish among these possibilities, we quenched trypsin-treated
chloroplasts with the mixture of protease inhibitors before lysis, during lysis, and/or aﬁer
lysis. During those steps when the protease inhibitor mixture was not added, 1 mM
PMSF was added in its place.

Figure 2.2 shows the results from this experimental approach. When the quench
mixture was added at all three stages or just during and after lysis, Tic110 was not
signiﬁcantly degraded (Figure 2.2A, lanes 1-2). Ticl 10 was completely digested only
when the quenching mixture was added just during the post-lysis stage (Figure 2.2A, lane
3), indicating that it was most likely degraded by active trypsin during chloroplast lysis.
In addition, as long as the protease inhibitor mixture was added before and/or during
chloroplast lysis, Tic110 was not digested by trypsin (Figure 2.28). Thus, it appeared
that unless trypsin was adequately quenched before or at the time of lysis, Tic110 was

digested by the protease once chloroplasts were broken open.

T typsin degrades proteins exposed to the interrnembrane space but not Tic110

Recently, several investigators have utilized protease digestion techniques to

analyze the location and topology of newly imported chloroplastic proteins (Tranel and

62

Figure 2.2. Tic110 is degraded by insufficiently quenched trypsin only after
chloroplast lysis. (A,B) Intact chloroplasts (50 pg chlorophyll) were incubated for 10
minutes with trypsin (500 pg protease/mg chlorophyll). Protease activity was quenched
either with a mixture of protease inhibitors (+) or with 1 mM PMSF (-) at the stages
indicated above and as outlined in “Results.” Intact chloroplasts were reisolated, lysed,
and separated into membrane and soluble protein fractions. Half of each membrane
fraction was analyzed by SDS-PAGE and immunoblotting with antiserum against

Tic110.

63

1 2 3

+ _ - pre-lysis

+ + - lysis

+ + + post-lysis
l 2 3

1"" -- III-“Tic110

+ + + pre-lysis
- + + lysis
- - + post-lysis

Figure 2.2

64

Keegstra, 1996; Liibeck et al., 1997). We obtained these precursor constructs in order to
determine whether the quenching protocol used had an effect on the results and to
compare the protease sensitivity of constructs with known topology to that of Ticl 10
constructs. Intact chloroplasts were subjected to an import assay with one of ﬁve
different precursor proteins: prToc75 (Tranel et al., 1995); tp110-110N, a truncated
version of prTicl 10 containing the putative transmembrane domain(s) and approximately
one-ﬁﬁh (<20 kD) of the hydrophilic domain (Liibeck et al., 1997); tpSS-l 10N, a
chimeric precursor containing the transit peptide of the small subunit of ribulose 1,5-
bisphosphate carboxylase (SS) attached to the truncated version of mature Tic110
(Liibeck et al., 1997); tpToc75-mSS, a chimeric precursor consisting of the transit peptide
of Toc75 attached to the mature form of SS (Tranel and Keegstra, 1996); and prSS (Olsen
and Keegstra, 1992). After import, intact chloroplasts were reisolated and digested with
either thermolysin or trypsin. Trypsin-treated chloroplasts were quenched with either the
protease inhibitor mixture (trypsin I protocol) or 1 mM PMSF (trypsin II protocol).
Following protease digestion, intact chloroplasts were reisolated, lysed, and separated
into membrane and soluble protein fractions. The proteins from these fractions were then
analyzed by SDS-PAGE and ﬂuorography to detect the newly imported, radiolabeled
proteins (Figure 2.3A) or immunoblotting to detect endogenous proteins (Figure 2.38).
The processed forms of prToc75 (mToc75 and iToc75), which were used as
markers for the outer envelope membrane, were degraded by trypsin but not by
thermolysin (Figure 2.3A, row 1). Because Toc75 is deeply embedded in the chloroplast
outer envelope membrane, thermolysin could not access the protein. However, because

trypsin is able to penetrate the outer membrane, it was able to completely digest Toc75

65

Figure 2.3. The trypsin sensitivity of newly imported Tic110 constructs does not

mimic that of an intermembrane space marker protein. 3’55-labeled prToc75 (row 1),
tp110-110N (row 2), tpSS-l 10N (row 3), tpToc75-mSS (row 4), and prSS (row 5) were
imported into isolated chloroplasts (100 pg chlorophyll). Intact chloroplasts were
reisolated and divided into four equal samples. The four samples from each import
reaction were protease-treated as indicated above and as outlined in “Materials and
Methods.” Trypsin-treated samples were quenched either with a mixture of protease
inhibitors (Trypsin I) or with 1 mM PMSF (Trypsin II). Intact chloroplasts were
reisolated from each sample, lysed, and separated into membrane (P) and soluble (S)
protein ﬁactions. Equivalent protein from each fraction was analyzed by SDS-PAGE and
either ﬂuorography (A) or immunoblotting (B) with antibodies against Tic110, Toc75,

and Toc34.

66

A

Therrnolysin

Trypsin I

Trypsin II

prToc75 i

iToc75

mToc75 ,1

tpllO—llON
m110N

tpSS-llON
m110N

tpToc75-mSS

mSS

prSS

mSS

Figure 2.3

 

..........

 

67

Anti-Tic110 Anti-Toc75
- + - - - + -

“I Llama. reverts-tum»: , nut-r- axe-«.- .:-,

l. 1 r if .1 V I

lie . ‘ ' -'

thi" . m nae .....
V k1,"! _: ’

i _ .. ‘. 1" f -

'54.: , .. _ ‘ . _

x * it . . ,- t I.
M¥75 :_“,‘.f.‘ say}; "i": .. ~a

     

l 2 3 4 5 6 7

Figure 2.3 (continued)

68

I - - - I
,,.... .‘. 1. ~‘-_.._,2,.. >. r~-p-_H;\,~ m u. a‘

Anti-Toc34
- - + - - lTherrnolysin
- - - + - TrypsinI
Trypsin II

i’.‘
, "1

8 9101112

(as in Figure 2.1). In contrast, because neither thermolysin nor trypsin can penetrate the
inner envelope membrane, prSS, a stromal marker, was not digested by either protease
(Figure 2.3A, row 5).

It has previously been reported that when tpToc75-mSS is imported into
chloroplasts, the processed product is exposed to the chloroplast intermembrane space in
both soluble and membrane-bound forms (Tranel and Keegstra, 1996). Thus, we utilized
this construct as a marker for the intermembrane space. Accordingly, we found that both
the soluble and membrane-bound products generated from tpToc75-mSS were degraded
by trypsin but not by thermolysin (Figure 2.3A, row 4). If Ticl 10 was also exposed to
the interrnembrane space, we would have expected it to have a protease sensitivity similar
to tpToc75-mSS. However, neither of the Tic110 constructs, tpl 10-1 10N and tpSS-
110N, which were expected to have the same topology as Tic110 itself (Liibeck et al.,
1997), were degraded by trypsin as long as protease activity was sufﬁciently quenched by
the protease inhibitor mixture (Figure 2.3A, rows 2 and 3, compare trypsin I and trypsin
II protocols). We interpreted these results to indicate that these Tic110 constructs were
not exposed to the intermembrane space. Since it has been previously demonstrated that
these two constructs are inserted in the inner envelope membrane (Liibeck et al., 1997),
we concluded that they must be oriented towards the chloroplast stroma.

We also examined the protease sensitivity of three endogenous proteins in these
chloroplasts (Figure 2.38). Tic110 was not signiﬁcantly degraded by either thermolysin
or trypsin as long as trypsin was adequately quenched (Figure 2.3B, lanes 1-4). This is
similar to the results obtained in our previous experiments and those seen for the

imported Tic110 constructs. Toc75 was degraded by trypsin but not by thermolysin

69

(Figure 2.3B, lanes 5-8), consistent with the results obtained for imported Toc75. On the
other hand, Toc34 was degraded by both proteases (Figure 2.38, lanes 9-12). These
results are consistent with the fact that the cytosolic domain of Toc34 is exposed on the

outer surface of chloroplasts (Kessler et al., 1994; Seedorf et al., 1995).

Tic110 is exposed on the same face of inner envelope membrane vesicles as ClpC, a
stroma-facing protein

The results presented above suggest that within intact chloroplasts, Tic110 is
oriented toward the stromal compartment. In order to extend and conﬁrm this
conclusion, we analyzed the topology of Ticl 10 in a second system, isolated inner
envelope membrane vesicles. Speciﬁcally, we compared the trypsin sensitivity of Ticl 10
to that of ClpC, a stromal Hsp100 homolog. ClpC is primarily a soluble protein;
however, it is known that a signiﬁcant portion of the ClpC molecules in the chloroplast
are associated with the stromal side of the inner envelope membrane (Moore and
Keegstra, 1993; Nielsen, 1997). Therefore, if Ticl 10 is indeed exposed on the stromal
face of the inner envelope membrane, it should display the same trypsin sensitivity as
ClpC. This indeed was what we observed upon analysis of inner membrane vesicles
(Figure 2.4). Both Tic110 and ClpC were resistant to degradation at low protease
concentrations and susceptible at higher levels of trypsin. In addition, both proteins
began to be signiﬁcantly degraded at the same trypsin concentration (Figure 2.4A, lane 5
and 2.4B, lane 5), indicating that Ticl 10 and ClpC were exposed on the same side of the
vesicles. Consequently, we concluded that Ticl 10, like ClpC, was oriented toward the

chloroplast stroma.

70

Figure 2.4. Trypsin digestion of inner envelope membrane vesicles. (A,B) Inner
envelope vesicles (20 pg protein) were incubated for 10 minutes without (lane 1) or with
(lanes 2-7) trypsin. Trypsin concentrations used are indicated. The concentration of
trypsin used in the lane marked "Q" (lane 7) was 1000 ng protease/mg inner envelope
membrane protein. Trypsin activity was quenched with a mixture of protease inhibitors
as described in “Materials and Methods” either after (lanes 2-6) or before (lane 7)
incubation with the protease. Half of each sample was analyzed by SDS-PAGE and
immunoblotting with antibodies against Ticl 10 (A) or ClpC (B). The position of an

apparent trypsin degradation product of Ticl 10 is indicated by an asterisk (*).

ng trypsin/
mg protein
- Him?"

.5 an
it.

 

Tic110

 

 

e ng trypsin/
® Q mg protein

 

 

Figure 2.4

72

DISCUSSION

To investigate the process of protein import into chloroplasts in detail, it will be
necessary to study the translocation machineries of the outer and inner envelope
membranes separately, as has been done for the mitochondrial protein import system
(Pfanner et al., 1994). Mitochondria, like chloroplasts, are surrounded by an envelope
composed of two separate membranes. Techniques have been developed to physically
remove the mitochondrial outer envelope membrane so that inner envelope membrane
proteins can be speciﬁcally analyzed (Daum et al., 1982; Hartl et al., 1986). Mitoplasts,
mitochondria in which the outer membrane has been selectively ruptured and/or
dissolved, can be generated either by subjecting intact mitochondria to osmotic shock
treatment (Daum et al., 1982) or by treating them with digitonin (Hartl et al., 1986).
These two methods have been used successfully to study the location and topology of
mitochondrial inner envelope membrane proteins and the mechanism of mitochondrial
protein import (for example, see Ohba and Schatz, 1987; Hwang et al., 1991; Glick et al.,
1992; Beasley et al., 1993; Rospert et al., 1994; Horst et al., 1995).

Similar techniques to selectively remove the outer membrane of chloroplast
envelopes are not yet available. In lieu of such approaches, investigations on chloroplast
inner envelope membrane proteins have relied on the ability of certain proteases,
speciﬁcally trypsin, to selectively destroy the permeability barrier of the outer membrane
and degrade inner membrane proteins that are exposed to the interrnembrane space while
leaving stromally exposed proteins intact (Cline et al., 1981; Cline et al., 1984; Marshall
et al., 1990). This technique can thus be used to differentiate between an interrnembrane

space and a stromal localization for both soluble and membrane proteins (Kessler and

73

Blobel, 1996; Liibeck etal., 1996; Tranel and Keegstra, 1996; Liibeck et al., 1997), as we
have done in this study.

Two independent investigations have provided evidence indicating that Tic110 is
a component of the chloroplast protein translocation apparatus localized in the inner
envelope membrane (Kessler and Blobel, 1996; Liibeck et al., 1996). However, no
function for Tic110 during protein translocation has been clearly established. Elucidating
the topology of Ticl 10, about which the original reports disagreed (Kessler and Blobel,
1996; Liibeck et al., 1996), will be an important ﬁrst step toward understanding the role
of this protein in the import process. In this investigation, we have provided evidence
indicating that the large (>90 kD) hydrophilic domain of Tic110 was oriented toward the
stromal compartment. Because the one or two predicted transmembrane domains of
Tic110 are near the N-terminus (within the ﬁrst 10% of the mature protein), it is likely
that the regions of Tic110 that are important for its function reside within the large
hydrophilic domain, which we have localized.

Previous investigations have proposed that Ticl 10 may be involved in mediating
the interaction between outer and inner envelope membrane translocation components
during protein import (Liibeck et al., 1996). However, our evidence does not support this
view. The stromal orientation of the major portion of Tic110 would probably not allow
this protein to interact with outer envelope membrane proteins. Instead, it is more likely
that Ticl 10 interacts with stromal components of the translocation apparatus. For
instance, Tic110 may be involved in the recruitment of molecular chaperones, including

ClpC, to the site of protein import.

74

This study has demonstrated that Tic110 is degraded by trypsin only when
trypsin-treated chloroplasts are insufﬁciently quenched. Incomplete quenching of trypsin
activity with PMSF is the most likely explanation for previous reports concluding, based
on trypsin analysis, that Ticl 10 is degraded by the protease and thus is oriented toward
the intermembrane space (Liibeck et al., 1996). An investigation reported by Kessler and
Blobel (1996) on the topology of Tic110 also utilized trypsin digestion data to analyze
this problem. These investigators, who found that trypsin does not degrade Tic110,
quenched protease activity with a combination of inhibitors. Their results support our
claim that when trypsin is adequately quenched, Tic110 remains largely undigested after
protease treatment of intact chloroplasts and provide further evidence for the conclusion
that the large hydrophilic domain of Ticl 10 is exposed to the chloroplast stroma rather
than the interrnembrane space.

In the case where trypsin was insufﬁciently quenched, it is possible that active
trypsin either bound to the chloroplast envelope membranes or was trapped in the
intermembrane space and, consequently, was retained during reisolation of intact
chloroplasts. Then, during or after chloroplast lysis, trypsin was able to gain access to
proteins exposed on the stromal face of the inner envelope membrane and digest them. In
this investigation, we analyzed the protease sensitivity of newly imported, radiolabeled
SS, a stromally localized protein. This protein did not seem to be signiﬁcantly degraded
by trypsin, regardless of the method used to quench protease activity. To explain these
observations, we propose that incompletely quenched trypsin is "trapped" inside enve10pe
vesicles that form upon chloroplast lysis and is thus unable to signiﬁcantly degrade

soluble proteins, including SS. During separation of membrane and soluble proteins, the

75

protease would be sedimented with the membrane vesicles away from soluble molecules,
including any quenching reagents added during or after the lysis stage. When membrane
proteins are subsequently solubilized in SDS-PAGE sample buffer, active trypsin can be
released from the vesicles and degrade Tic110 and perhaps other membrane proteins as
well. It is thus necessary to adequately quench trypsin either before or at the time of
chloroplast lysis in order to prevent active protease from being released after chloroplasts
have been ruptured (Figure 2.2).

It should be noted that in this investigation we did not completely repeat the
results of Liibeck et al. (1997). During the trypsin digestion of the newly imported,
radiolabeled precursor constructs, we utilized a lower trypsin concentration (500 pg
trypsin/mg chlorophyll vs. 1000 pg trypsin/mg chlorophyll) and a different quenching
protocol (protease inhibitor mixture or PMSF vs. PMSF and trypsin inhibitor). The
protocol we utilized during these import experiments was the same used in all of the
other experiments presented in this report. Although we did not completely repeat the
protocol of Liibeck et al. (1997), we do not believe this signiﬁcantly affected our results
or the conclusions we have drawn from them, since all other observations indicate that
Tic110 does indeed face the chloroplast stroma.

During the course of this investigation, we also attempted to speciﬁcally label
proteins exposed to the interrnembrane space with biotinylation reagents that supposedly
could not permeate the inner envelope membrane. However, we observed that these
reagents were able to enter the chloroplast stroma in small but signiﬁcant quantities, and
we were unable to develop reaction conditions to prevent labeling of stromal proteins.

Thus, it appears that at the current time, trypsin digestion analysis is the most reliable

76

method to analyze the topology of inner envelope membrane proteins. Our experiments
have revealed that the protocol used to quench trypsin activity during such studies can
have a major effect on the results of experiments, and thus, the conclusions drawn from
these results (Figure 2.1). Consequently, it is important that measures be taken to ensure
that trypsin is adequately quenched whenever this protease is used as an analytical too].
When our quench mixture is added to intact chloroplasts prior to trypsin addition, Tic110
and Toc75 (an outer envelope membrane protein normally susceptible to trypsin action)
are left largely intact (Figure 2.1). Thus, we concluded that the protease inhibitor mixture
used in this investigation was sufﬁcient to quench trypsin activity. Such a mixture of
inhibitors should be useful in studying the topology of membrane proteins or in any other

investigations where analysis by trypsin digestion plays a pivotal role.

77

REFERENCES

Akita M, Nielsen E, Keegstra K (1997) Identiﬁcation of protein transport complexes in
the chloroplastic envelope membranes via chemical crosslinking. J Cell Biol 136: 983-
994

Beasley EM, Miiller S, Schatz G (1993) The signal that sorts yeast cytochrome b2 to the

mitochondrial intermembrane space contains three distinct functional regions. EMBO J
12: 2303-2311

Bruce BD, Perry S, Froehlich J, Keegstra K (1994) In vitro import of proteins into
chloroplasts. Plant Mol Biol Manual J 1: 1-15

Chua N-H, Schmidt GW (1978) Post-translational transport into intact chloroplasts of a

precursor to the small subunit of ribulose- 1 ,5-bisphosphate carboxylase. Proc Natl Acad
Sci USA 75: 6110-6114

Cline K, Andrews J, Mersey B, Newcomb EH, Keegstra K (1981) Separation and
characterization of inner and outer envelope membranes of pea chloroplasts. Proc Natl
Acad Sci USA 78: 3595-3599

Cline K, Werner-Washbume M, Andrews J, Keegstra K (1984) Therrnolysin is a suitable
protease for probing the surface of intact pea chloroplasts. Plant Physiol 7 5: 675-678

Daum G, Behni PC, Schatz G (1982) Import of proteins into mitochondria: cytochrome
b 2 and cytochrome c peroxidase are located in the interrnembrane space of yeast
mitochondria. J Biol Chem 257: 13028-13033

Etemadi AH ( 1980) Membrane asymmetry. A survey and critical appraisal of the
methodology. 1. Methods for assessing the asymmetric orientation and distribution of
proteins. Biochim Biophys Acta 604: 347-422

Glick BS, Brandt A, Cunningham K, Miiller S, Hallberg RL, Schatz G (1992)
Cytochromes c, and b 2 are sorted to the intermembrane space of yeast mitochondria by a
stop-transfer mechanism. Cell 69: 809-822

Hartl F-U, Schmidt B, Wachter E, Weiss H, Neupert W (1986) Transport into
mitochondria and intramitochondrial sorting of the Fe/ S protein of ubiquinol-cytochrome
c reductase. Cell 47: 939-951

Highﬁeld PE, Ellis RJ (1978) Synthesis and transport of the small subunit of chloroplast
ribulose bisphosphate carboxylase. Nature 271: 420-424

Hirsch S, Muckel E, Heemeyer F, von Heijne G, 8011 J (1994) A receptor component of
the chloroplast protein translocation machinery. Science 266: 1989-1992

78

Horst M, Hilﬁker-Rothenﬂuh S, Oppliger W, Schatz G (1995) Dynamic interaction of the
protein translocation systems in the inner and outer membranes of yeast mitochondria.
EMBO J 14: 2293-2297

Hwang ST, Wachter C, Schatz G (1991) Protein import into the yeast mitochondrial

matrix: a new translocation intermediate between the two mitochondrial membranes. J
Biol Chem 266: 21083-21089

Keegstra K, Yousif AE (1986) Isolation and characterization of chloroplast enve10pe
membranes. Methods Enzymol 118: 316-325

Kessler F, Blobel G (1996) Interaction of the protein import and folding machineries in
the chloroplast. Proc Natl Acad Sci USA 93: 7684-7689

Kessler F, Blobel G, Patel HA, Schnell DJ (1994) Identiﬁcation of two GTP-binding
proteins in the chloroplast protein import machinery. Science 266: 1035-1039

Kouranov A, Schnell DJ (1996) Protein translocation at the envelope and thylakoid
membranes of chloroplasts. J Biol Chem 271: 31009-31012

Lowry OH, Rosebrough NJ, Farr AL, Randall R] (1951) Protein measurement with the
folin phenol reagent. J Biol Chem 193: 265-275

Liibeck J, Heins L, 8011 J (1997) A nuclear-coded chloroplastic inner envelope membrane
protein uses a soluble sorting intermediate upon import into the organelle. J Cell Biol
137: 1279-1286

Liibeck J, 8011 J, Akita M, Nielsen E, Keegstra K (1996) Topology of IEPl 10, a
component of the chloroplastic protein import machinery present in the inner enve10pe
membrane. EMBO J 15: 4230-4238

Marshall J S, DeRocher AE, Keegstra K, Vierling E (1990) Identiﬁcation of heat shock
protein hsp70 homologues in chloroplasts. Proc Natl Acad Sci USA 87: 374-378

Moore T, Keegstra K (1993) Characterization of a cDNA clone encoding a chloroplast-
targeted Clp homologue. Plant Mol Biol 21: 525-537

Nielsen EE (1997) The role of stromal molecular chaperones in chloroplastic protein
translocation. Ph.D. Dissertation, Michigan State University, East Lansing, MI

Nielsen E, Akita M, Davila-Aponte J, Keegstra K (1997) Stable association of
chloroplastic precursors with protein translocation complexes that contain proteins from

both envelope membranes and a stromal Hsp100 molecular chaperone. EMBO J 16: 935-
946

79

Ohba M, Schatz G (1987) Disruption of the outer membrane restores protein import to
trypsin-treated yeast mitochondria. EMBO J 6: 2117-2122

Olsen LJ, Keegstra K (1992) The binding of precursor proteins to chloroplasts requires
nucleoside triphosphates in the interrnembrane space. J Biol Chem 267: 433-439

Perry SE, Keegstra K (1994) Envelope membrane proteins that interact with chloroplastic
precursor proteins. Plant Cell 6: 93-105

Pfanner N, Craig EA, Meijer M (1994) The protein import machinery of the
mitochondrial inner membrane. Trends Biochem Sci 19: 368-372

Rospert S, Miiller S, Schatz G, Glick BS (1994) Fusion proteins containing the
cytochrome b 2 presequence are sorted to the mitochondrial intermembrane space
independently of hsp60. J Biol Chem 269: 17279-17288

Schmidt GW, Devillers-Thiery A, Desruisseaux H, Blobel G, Chua N-H (1979) NH;-
terminal amino acid sequences of precursor and mature forms of the ribulose-1,5-
bisphosphate carboxylase small subunit from Chlamydomonas reinhardtii. J Cell Biol

83: 615-622

Schnell DJ , Kessler F, Blobel G (1994) Isolation of components of the chloroplast protein
import machinery. Science 266: 1007-1012

Seedorf M, Waegemann K, 8011 J (1995) A constituent of the chloroplast import complex
represents a new type of GTP-binding protein. Plant J 7: 401-411

Shanklin J, DeWitt ND, Flanagan JM (1995) The stroma of higher plant plastids contain
ClpP and ClpC, functional homologs of Escherichia coli ClpP and ClpA: an archetypal
two-component ATP-dependent protease. Plant Cell 7: 1713-1722

Tranel PJ, Froehlich J, Goyal A, Keegstra K (1995) A component of the chloroplastic
protein import apparatus is targeted to the outer envelope membrane via a novel pathway.
EMBO J 14: 2436-2446

Tranel PJ, Keegstra K (1996) A novel, bipartite transit peptide targets OEP75 to the outer
membrane of the chloroplastic envelope. Plant Cell 8: 2093-2104

Waegemann K, 8011 J (1991) Characterization of the protein import apparatus in isolated
outer envelopes of chloroplasts. Plant J 1: 149-158

Wu C, Seibert FS, Ko K (1994) Identiﬁcation of chloroplast envelope proteins in close

physical proximity to a partially translocated chimeric precursor protein. J Biol Chem
269: 32264-32271

80

CHAPTER 3

Arabidopsis Genes Encoding Components of the Chloroplastic

Protein Import Apparatus

The work presented in this chapter has been published:

Jackson-Constan D, Keegstra K (2001) Plant Physiol 125: 1567-1576

81

ABSTRACT

The process of protein import into plastids has been studied extensively using
isolated pea (Pisum sativum) chloroplasts. As a consequence, virtually all of the known
components of the proteinaceous apparatus that mediates import were originally cloned
from pea. With the recent completion of the Arabidopsis thaliana genome sequencing
project, it is now possible to identify putative homologs of the import components in this
species. Our analysis has revealed that Arabidopsis homologs with high sequence
similarity exist for all of the pea import complex subunits, making Arabidopsis a valid
model for further study of this system. Multiple homologs can be identiﬁed for over one-
half of the components. In all but one case, it is known that more than one of the putative
isoforms for a particular subunit are expressed. Thus, it is possible that multiple types of
import complexes are present within the same cell, each having a unique afﬁnity for
different chloroplastic precursor proteins, depending upon the exact mix of isoforms it
contains. Sequence analysis of the putative Arabidopsis homologs for the chloroplast
protein import apparatus has revealed many questions concerning subunit function and
evolution. It should now be possible to use the genetic tools available in Arabidopsis,
including the generation of knockout mutants and antisense technology, to address these
questions and learn more about the molecular functions of each of the components during

the import process.

82

INTRODUCTION

The availability of the sequence for the entire genome of Arabidopsis thaliana
allows a detailed analysis of all the genes involved in a particular biological process,
regardless of the plant species in which the system was ﬁrst identiﬁed. One such process
is the import of cytoplasmically synthesized precursor proteins into chloroplasts. Most of
the current information regarding this process, including the identiﬁcation of components
of the import apparatus that mediates it, has come from biochemical studies in pea
(Pisum sativum; see Figure 1.2; Chen and Schnell, 1999; Keegstra and Cline, 1999;
Keegstra and Froehlich, 1999; May and $011, 1999; Schleiff and 8011, 2000). From these
studies, it has been determined that nuclear-encoded, chloroplast-localized enzymes are
synthesized in the cytoplasm as precursors containing an N-terrninal transit peptide not
seen in the mature protein within the chloroplast (for review, see Bruce, 2000). A
precursor protein initially interacts with a complex located within the outer membrane of
the chloroplast envelope that consists of at least three subunits: Toc159 (translocon at the
guter envelope membrane of ghloroplasts, 1_5_9_ kD), Toc75, and Toc34 (Waegemann and
8011, 1991; Hirsch et al., 1994; Kessler et al., 1994; Perry and Keegstra, 1994; Schnell et
al., 1994; Seedorf et al., 1995; Tranel et al., 1995). These early events involve the
hydrolysis of GTP, presumably by Toc159 and Toc34, which are known to be GTP-
binding proteins (Kessler et al., 1994; Seedorf et al., 1995). A recent report by Sohrt and
$011 (2000) has also implicated a fourth component, Toc64, as being a member of the
outer membrane import machinery. Hydrolysis of low concentrations of ATP in the
cytoplasm or intermembrane space results in the irreversible association of precursor

proteins with the translocation machinery of both the outer and inner envelope

83

membranes (Olsen et al., 1989; Olsen and Keegstra, 1992). The import complex of the
chloroplastic inner envelope membrane also consists of at least three subunits: Tic110
(translocon at the inner envelope membrane of ghloroplasts, M kD), TicZO, and Tic22
(Kessler and Blobel, 1996; Liibeck et al., 1996; Kouranov and Schnell, 1997; Kouranov
et al., 1998). Two additional components, Tic55 and Tic40, have also been reported to be
a part of this translocon, but their inclusion is more controversial (Wu et al., 1994; K0 et
al., 1995; Caliebe et al., 1997; Stahl et al., 1999). Complete translocation of precursor
proteins into the chloroplast interior is accomplished via the hydrolysis of ATP within the
stroma (Theg et al., 1989). This ATP hydrolysis is presumably mediated by stromal
molecular chaperones, at least one of which, heat shock protein 93 (Hsp93; a member of
the Hsp100 family of molecular chaperones), has been found to interact with the import
complex (Akita et al., 1997; Nielsen et al., 1997). As the precursor enters the chloroplast,
the transit peptide is cleaved off by the stromal processing peptidase (SPP), and the
mature protein begins the process of folding and assembly (Oblong and Lamppa, 1992;
VanderVere et al., 1995; Richter and Lamppa, 1998).

Although virtually all of the conclusions described above were derived from work
done with pea chloroplasts, expressed sequence tags (ESTs) for homologs of the various
import components can be identiﬁed in the databases for a variety of monocots and
dicots, including maize, tomato, and Arabidopsis. More importantly, the recent
completion of the Arabidopsis genome sequencing project (The Arabidopsis Genome
Initiative, 2000) has made it possible to ﬁnd, in this species, homologs of those
components for which no ESTs exist. In addition to establishing the general signiﬁcance

of the components of the import apparatus, identiﬁcation of Arabidopsis homologs for

84

the subunits of the pea import complex will allow the use of this species to perform
molecular work that is not practical and/or possible with pea, including isolation of
“knockout” mutants and generation of transgenic plants expressing sense or antisense
copies of the genes encoding one or more of these components.

In this paper, we analyze the Arabidopsis genomic, cDNA, and EST information
currently available in GenBank concerning each of the known and putative subunits of
the chloroplast protein import machinery. All of these components have homologs of
high sequence identity within the Arabidopsis genome that are expressed and likely act as
functional counterparts to the pea proteins. For several of these translocation
components, multiple putative homologs are present in the Arabidopsis genome.
However, in most cases, it is unclear whether all copies are expressed, or if they are,
whether they are all acting as functional homologs within Arabidopsis chloroplasts. The
information revealed by this analysis will allow important new questions to be raised, and

further experimental work can then be designed to answer them in the near future.

85

MATERIALS AND METHODS

All sequence comparisons were done using the BLASTN, BLASTP, and
TBLASTN programs (versions 2.0) available from the National Center for Biotechnology
Information (http://www.ncbi.nlm.nih.gov/BLAST; Altschul et al., 1990; Altschul et al.,
1997). The weight matrix used was the blosum62 matrix, and no settings were changed
from the default. The database searched was the Arabidopsis thaliana Database Project,
found at The Arabidopsis Information Resource (http://www.arabidopsis.org/blast),
which contains genomic and EST sequences. This database was checked for the ﬁnal
time between October 30, 2000 and November 5, 2000, just before manuscript
submission. During manuscript revision, a recheck of the database between January 11,
2001 and January 18, 2001 found no additional homologs.

A sequence was considered a homolog only if the following conditions were met,
unless otherwise noted: (1) using the pea (Pisum sativum) sequence as the query, one of
the BLAST programs used detected this sequence with an expect value of less than or
equal to 0.0001; (2) using the putative Arabidopsis homolog as the query, one of the
BLAST programs used detected the pea sequence and other Arabidopsis isoforms with an
expect value of less than or equal to 0.0001; (3) the region of similarity between the pea
protein and the putative Arabidopsis homolog extended for approximately 50% or more
of the sequence lengths; (4) the region of similarity to the pea protein extended beyond
common motifs (i.e. nucleotide-binding domains) and (5) the putative Arabidopsis
homolog was not already annotated as being more similar to another protein of known
function. Levels of identity between different amino acid sequences were calculated with

the MegAlign program (Lipman-Pearson algorithm; ktuple = 2, gap penalty = 4, gap

86

length penalty = 12) of the Lasergene software package (DNASTAR, Inc., Madison,
Wisconsin, USA). Predictions concerning chloroplast targeting were made using the
TargetP program (version 1.01), available at http://www.cbs.dtu.dk/services/TargetP

(Emanuelsson et al., 2000).

87

RESULTS AND DISCUSSION
Outer envelope membrane proteins

Toc159, a GTP-binding protein, is postulated to be the ﬁrst subunit of the import
complex with which an incoming precursor protein interacts, serving as the receptor for
transit peptides (Waegemann and 8011, 1991; Hirsch et al., 1994; Kessler et al., 1994;
Perry and Keegstra, 1994; Ma et al., 1996). There are three homologs of this protein in
Arabidopsis (Table 3-I), designated AtToc159, AtTocl32, and AtToc120 based on their
predicted molecular masses (Bauer et al., 2000). All three are expressed, as demonstrated
by the presence of at least one Arabidopsis EST for each and by RT-PCR experiments
(Bauer et al., 2000).

The pea Toc159 protein is composed of three domains: an N-terrninal acidic
region, a central domain encompassing the GTP-binding motifs, and a C-terrninal domain
containing the membrane-spanning regions (Chen et al., 2000a). AtToc159 shares ~48%
identity with the pea protein, most of which is concentrated in the central and C-terminal
domains (~69% identity in these regions). Both pea ToclS9 and AtToclS9 are highly
acidic, especially in their N-terrninal regions (Belter et al., 1998a; Bauer et al., 2000;
Chen et al., 2000a). Approximately 30% and 27%, respectively, of the amino acids in
this domain are either aspartate or glutamate (Table 3-II). This is in contrast to the other
members of the outer membrane import complex (Toc75, Toc34, Toc64) in which the
percentage of acidic residues ranges from 9% to 11% for the Arabidopsis isoforms. One
of the deﬁning features of transit peptides is that they lack acidic amino acids, resulting in
an overall basic p1 and net positive charge (Keegstra et al., 1989). Thus, it is interesting

to speculate that the N-terminal acidic domain of Too 1 59, which is localized on the

88

Table 3-1. Putative Arabidopsis homologs for the components of the pea chloroplast
protein import machinery

 

 

Pea Import Arabidopsis Chromosome” GenBank EST in Number of
Component Homologs'I Designationc Database Introns‘l

Toc159 AtToc159 IV T 14P8.24 Yes 1
AtToc l 32 II At2 g l 6640 Yes 0
AtToc l 20 Ill MGL6.8 Yes 0
Toc75 AtToc75-III III T6H20.230 Yes 6

AtToc75-I I F 1005.4 No ND°
AtToc75-IV 1V At4g09080 No 5
Toc34 AtToc34 V MUG 13. 14 Yes 6
AtTocB3 1 T7123.l 1 Yes 6
Toc64 AtToc64-lll 111 MEBS.17 Yes 12
AtToc64-V V T5E8_220 Yes 12

AtToc64-I I F7G 19. 15 Yes ND‘
Tic110 AtTicl 10 1 F10K1.33 Yes 14

and F4H5. 1 I

Tic20 AtTic20-I l F13M7.7 Yes NDc
AtTic20-IV 1V F4C21 .25 Yes 2
Tic22 AtTic22-IV IV F 17M5.1 10 Yes 7
AtTic22-III III MYM9.5 Yes 7
Tic55 AtTicSS 11 At2g24820 Yes 2
Tic40 AtTic40 V MTGl3.6 Yes 13
Hsp93g’h AtHsp93-V v K3K7.7 Yes 8
AtHsp93-III III T2 1J1 8_14O Yes 8
SPP (CPE) AtCPE V MDH9.8 Yes 23
Hsp708 AtHsp70-V V K9P8.5 Yes 7
AtHsp70-IVa 1v At4g24280 Yes 7
AtHsp70-IVb IV At4g37910 Yes 5

 

aSee “Materials and Methods” for an explanation of the criteria used in designating a sequence as
a homolog of the pea import apparatus. t’l‘he chromosomal location for the genes encoding each
of the putative Arabidopsis chloroplast protein import components is indicated. 0The entries in
this column refer to the bacterial artiﬁcial chromosome (BAC) or P1 clone designation in
GenBank for each of the putative homologs. dGene structure predictions are based on the
annotations given in the GenBank entry indicated in this table, unless otherwise noted. ND, not
determined. The current annotations given in the database for these homologs are predicted to be
incorrect because the regions of sequence identity to the pea proteins are very different from the
predicted boundaries of the open reading frame. fThis coding region is split between two BACs,
which overlap by 200 bp. gArabidopsis homologs given for these components are only those
predicted to have a chloroplastic targeting sequence (see “Materials and Methods” for an
explanation of how this was determined). hA rabidopsis homologs given for this protein are only
those predicted to belong to the ClpC class of the HsplOO family of chaperones.

89

Table 3-11. Comparison of the acidic properties of various members of the outer envelope

membrane import complex

 

 

 

Import % acidic pl of whole % acidic pI of

Component residues in whole protein residues in N-terminal

protein' N-terminal domain
domain'

Pea Toc159 20 4.2 30 3.6
AtToc159 19 4.3 27 3.8
AtTocl32 17 4.7 28 3.8
AtToc120 16 4.9 26 3.9

AtToc75-III 10 8.8 N/A N/A

AtToc34 10 9.4 N/A N/A

AtToc64-III 10 8.2 N/A N/A

N/A, not applicable.

alAcidic residues are aspartate (D) and glutamate (E).

90

cytoplasmic face of the chloroplast, is involved in an electrostatic interaction with
positively charged transit peptides, increasing the overall efﬁciency of precursor protein
binding (Bélter et al., 1998a). This is similar to the situation described by the acid chain
hypothesis for the early interaction of basic mitochondrial targeting sequences with their
acidic receptors (Komiya et al., 1998).

AtTocl32 and AtToc120 Show less overall identity with pea Toc159 (~3 7% and
~39%, respectively), the majority of which is again concentrated in the central and C-
terminal domains (~50% for each). In addition, their levels of identity to AtToc159 are
also relatively low (~3 7% and ~3 8%, respectively). On the other hand, the two proteins
share ~70% amino acid identity with each other. This suggests that AtTocl32 and
AtToc120 share a common ancestor that diverged from AtToc159 before these two
proteins diverged from one another.

AtTocl32 and AtToc120 are also highly acidic in their N-terrninal regions
(approximately 28% and 26% acidic residues, respectively). In fact, this is the main
feature shared between the Arabidopsis homologs at their N-termini. There is very little
conservation of primary structure between the three proteins before the GTP-binding
domain (Bauer et al., 2000). However, despite a maintenance of the overall percentage of
acidic residues within the N-terminal domains, the pI of the N-termini and the whole
proteins differs between the three isoforms (Table 3-11). Thus, the question arises of
whether these subtle changes in size and overall charge between the Arabidopsis Toc159
homologs reﬂect differences in the types of precursors with which these proteins interact
(Bauer et al., 2000). It is interesting to note that mutant Arabidopsis plants that lack

AtToc159 are still able to import some, but not all, chloroplastic proteins, suggesting that

91

some other factor, perhaps AtTocl32 and/or AtToc120, is substituting for AtToclS9 in
the import of some precursors (Bauer et al., 2000).

Toc75 has been shown to form a voltage-gated, peptide-sensitive channel in
artiﬁcial lipid bilayers (Hinnah et al., 1997). Thus, it is hypothesized that this protein
forms the channel through which precursor proteins cross the outer envelope membrane
(Perry and Keegstra, 1994; Schnell et al., 1994; Tranel et al., 1995; Hinnah et al., 1997).
Analysis of the Arabidopsis genome sequence reveals at least three coding regions that
have strong similarity to pea T 0C 75 : AtTOC75-III, AtT 0C 75-1, and AtT 0C 75-1 V, named
according to their chromosomal location. Only one of these genes, AtTOC 75-111, is
represented by an EST. More than 10 ESTs for this gene can be found, but none
currently exist for the other two homologs. In addition, of the three, AtToc75-III shows
the highest levels of identity with the pea protein (~74%). Consequently, it is likely that
AtToc75-III is the major Toc75 isoform in Arabidopsis cells.

AtToc75-III and AtToc75-I are quite similar to one another in size and amino acid
sequence, sharing >60% identity throughout their lengths. On the other hand, AtToc75-
IV displays some striking differences from its two homologs. First of all, the protein
encoded by AtT 0C 75-I V is much smaller at 407 amino acids in length versus 818 amino
acids for the protein encoded by AtTOC 75-111. Furthermore, the region of similarity
between AtToc75-IV and the other two Arabidopsis homologs is conﬁned to the C-
termini of the larger proteins. It appears that AtT 0C 75-1 V may represent just the last six
exons of AtTOC75-III. In fact, this gene seems to be an extreme case of a more common
phenomenon. For a few components, including Toc75 and Toc159, BLAST searches

reveal several small regions with high levels of sequence similarity to these subunits

92

throughout the genome. Although these putative open reading frames do show similarity
to the import components outside of commonly found motifs (i.e. nucleotide-binding
domains), the regions of similarity are not extensive. In general, they constitute less than
one-quarter of the total length of the queried import component, not enough to really be
considered a possible functional homolog. One possible explanation for the occurrence
of these presumably unexpressed regions of similarity is that these short open reading
frames are an example of the evolutionary process of exon shufﬂing in progress.

In the case of AtToc75-IV, the region of similarity extends for ~50% of the length
of the larger Toc75 homologs. It is possible that this may be enough for the protein made
by AtT 0C 75-1 V to be functional. Future research should address this problem, but some
observations suggest that it may indeed be needed in Arabidopsis cells. First of all, it is
interesting to note that the levels of identity between this coding region and its “parent”
are quite high, both at the amino acid level (~65% with AtToc7S-III) and the nucleotide
level. Moreover, the predicted splicing pattern of AtT 0C 75-1 V is identical to that seen in
the 3 ’ region of AtT 0C 75-III, implying that selection pressure on AtT 0C 75-1 V may still
be relatively high.

Toc34, another GTP-binding protein of the translocation apparatus, is
hypothesized to have a regulatory function during precursor import (Kessler et al., 1994;
Seedorf et al., 1995; Kouranov and Schnell, 1997). This subunit has two homologs in
Arabidopsis, named AtToc34 and AtToc33 based on their predicted molecular masses
(Jarvis et al., 1998). ESTs are present for both of these homologs within the Arabidopsis
database, and their expression has been veriﬁed via Northern and Western blot analysis

(Jarvis et al., 1998; Gutensohn et al., 2000). It appears that the two proteins, which are

93

>60% identical to each other and to the pea protein, can at least partially substitute for
one another within plant cells. Arabidopsis mutants that lack AtToc33 display a delayed
greening phenotype and reduced levels of chloroplast protein import early in their
development, but are otherwise normal (Jarvis et al., 1998; Gutensohn et al., 2000).

The genes for AtToc34 and AtToc33 provide an example of the evolutionary
process of gene duplication. Each coding region consists of six introns and seven exons;
ﬁve of the seven exons are exactly the same size between the two genes. In addition, in
every case, the exon-intron junctions occur at homologous positions within the
sequences. Thus, it appears that these two coding regions have diverged from one
another only relatively recently after the duplication of a common ancestral gene.

A fourth putative subunit of the outer envelope membrane import apparatus,
Toc64, was recently isolated (Sohrt and $011, 2000). The amino acid sequence for this
component contains an amidase domain, but the protein itself has no measurable amidase
activity (Sohrt and 8011, 2000). In addition, Toc64 contains three tetratricopeptide
repeats (TPR), which are hypothesized to be involved in protein-protein interactions with
cytosolic factors complexed with a precursor protein and/or with the precursor itself,
perhaps serving as a docking site for the incoming protein (Sohrt and $011, 2000). Within
the Arabidopsis genome, there are three coding regions that display extensive similarity
with the pea protein outside of the amidase domain and/or the TPR motifs. These
homologs have been designated AtToc64-III, AtToc64-V, and AtToc64-I. For all three
isoforms, cognate ESTs have been isolated. However, only AtToc64-III and AtToc64-V
contain regions similar to both the amidase domain and the TPR motifs of pea Toc64

(~67% and ~50% identical, respectively). Thus, although it is likely that the proteins

94

encoded by AtT 0C 64-111 and AtTOC64- V could serve as functional homologs of pea
Toc64 within Arabidopsis cells, further experiments will need to be done to determine

whether AtToc64-I, which lacks the TPR motifs, is playing a similar role.

Inner envelope membrane proteins

The ﬁrst component of the inner membrane import complex to be cloned and
characterized was Tic110 (Kessler and Blobel, 1996; Liibeck et al., 1996). This subunit
consists of a large globular domain localized in the chloroplast stroma and anchored to
the envelope by a membrane-spanning (it-helix at the N-terminus (Kessler and Blobel,
1996; Jackson et al., 1998). Based on this topology, it has been proposed that Tic110 acts
as an anchor for stromal molecular chaperones involved in precursor protein import
(Kessler and Blobel, 1996; Jackson et al., 1998). Preliminary evidence suggests that
Ticl 10 may indeed physically interact with at least one molecular chaperone (M. Akita
and K. Keegstra, unpublished observations). BLAST searches on the Arabidopsis
genome sequence reveal only one coding region, AtT [CI 1 0, similar to the pea gene
(Table 3-I). The protein encoded by AtTICI 10 is expressed and displays high levels of
identity (~68%) to pea Tic110. In addition, it appears to have the same overall structure
as the pea protein, with a predicted transmembrane helix at the N-terminus followed by a
large hydrophilic domain. Thus, it is reasonable to conclude that AtTicl 10 acts as a
functional homolog of pea Tic110 within Arabidopsis cells.

The gene structure for AtT 1C] 10 is quite complicated; the coding region consists
of 15 exons and 14 introns. Overall, the coding region is 5261 bp in length, with 42% of

this length comprising the introns. This complexity is in contrast to the genes encoding

95

the Arabidopsis Toc159 isoforms. The coding regions for these proteins are also quite
long, ranging from 3270 bp (AtTOC120) to 4595 bp (AtTOC159) in length. However,
they contain only one small intron (83 bp; AtTOC159) or none at all (AtTOC132 and
AtTOC120). This diversity in gene structure is seen for the other components of the
import complex as well. The genes encoding the Arabidopsis homologs of Tic20 and
Tic55 are relatively simple (two or fewer introns), whereas the genes for the remaining
subunits are more complicated, containing between six and 23 introns (Table 3-1).
Tic20, an integral protein of the inner envelope membrane, is believed to form at
least a portion of the channel through which chloroplast precursors traverse the inner
membrane (Kouranov and Schnell, 1997; Kouranov et al., 1998). The Arabidopsis
genome contains two genes encoding proteins, AtTic20-I and AtTic20-IV (designated
according to the chromosomal locations of the genes), that are similar to pea Tic20. Both
of these genes have corresponding ESTs within the Arabidopsis database. AtTic20-I is
highly similar to the pea protein, sharing >60% identity with pea Tic20. As a
consequence, it is likely to act as the functional counterpart to the pea protein in
Arabidopsis chloroplasts. On the other hand, AtTic20-IV is only ~33% identical to pea
Tic20 and ~40% identical to AtTic20-I. Although these levels of identity are relatively
high, it is quite low for this system; most of the putative Arabidopsis homologs for the
other import components show much higher levels of identity to their pea counterparts
and related Arabidopsis isoforms. Thus, it appears that these two Tic20 isoforms may
have diverged from one another earlier in evolution than is the case for isoforms of some

of the other subunits of the import complex.

96

BLAST searches for Arabidopsis homologs of pea Tic20 reveal a third putative
isoform on chromosome II. However, this protein is much smaller (by ~70 amino acids)
than the other two Arabidopsis homologs. More importantly, BLAST searches using this
putative isoform as the query sequence fail to detect either AtTic20-I or AtTic20-IV.
Thus, it was concluded that this coding region, despite sharing ~26% identity with pea
Tic20 at the amino acid level, Should not be considered an Arabidopsis homolog of the
pea protein.

Tic22 is localized in the intermembrane space of the chloroplast envelope and
appears to be peripherally associated with the inner envelope membrane (Kouranov and
Schnell, 1997; Kouranov et al., 1998). Due to its localization, it has been proposed that
Tic22 may be involved in the formation of contact sites between the import complexes of
the outer and inner membranes (Kouranov and Schnell, 1997; Kouranov et al., 1998).
Within the Arabidopsis genome, there are at least two coding regions, AtT IC22-I V and
AtTIC22-III, of high similarity to pea T 1C22. These genes are expressed, as determined
by the presence of several ESTs for each in the database. The encoded proteins share
~62% and ~41% identity, respectively, with pea Tic22.

Tic55, an iron-sulfur protein believed to play a regulatory role during chloroplast
protein import (Caliebe et al., 1997), and Tic40, which is proposed to recruit chaperones
to the site of precursor protein import (Wu et al., 1994; K0 et al., 1995; Stahl et al.,
1999), each have one clear homolog of high similarity in Arabidopsis. ESTs exist for
both AtTic55 and AtTic40. The proteins display ~78% identity and ~52% identity,
respectively, with their pea counterparts. Thus, it is likely that they serve as functional

homologs to the corresponding pea proteins.

97

Soluble factors

It is thought that molecular chaperones within the chloroplast stroma provide the
driving force, through the hydrolysis of ATP, for the translocation of precursor proteins
into the chloroplast interior (Chen and Schnell, 1999; Keegstra and Cline, 1999; Keegstra
and F roehlich, 1999). At the present time, the best candidate for this role is Hsp93, a
member of the HsplOO family of chaperones that is consistently found in import
complexes isolated from pea chloroplasts (Akita et al., 1997; Nielsen et al., 1997;
Kouranov et al., 1998). This chaperone has at least two homologs (Table 3-I) predicted
to be present in Arabidopsis chloroplasts, AtHsp93 -V (~88% identity to pea Hsp93) and
AtHsp93-III (~83% identity to the pea protein; Nakabayashi et al., 1999). These two
proteins, along with pea Hsp93, belong to the ClpC class of HsplOO chaperones. HsplOO
proteins of other classes, speciﬁcally the ClpB and ClpD classes, that are predicted to be
chloroplast-localized can also be detected in the Arabidopsis genome, as can potentially
chloroplastic members of the Hsp70 and Hsp60 chaperone families. This diversity of
stromally localized chaperones raises the question of whether Hsp93 is the only
chaperone that interacts with the protein import complex or whether other types of
chaperones could substitute for it in different species. Further work will be needed to
conﬁrm that the AtHsp93 homologs directly interact with the import complex in
Arabidopsis chloroplasts as Hsp93 does in pea chloroplasts.

Although no stromal Hsp70 proteins have been found to interact with import
complexes (Akita et al., 1997 ; Nielsen et al., 1997), there is evidence to suggest that
Hsp70 molecules do bind to precursor proteins before and/or during envelope

translocation (Schnell et al., 1994; Wu et al., 1994; Kourtz and [(0, 1997; Ivey et al.,

98

2000; May and 8011, 2000). Furthermore, an outer membrane-associated Hsp70 protein,
which faces the interrnembrane space of the chloroplast envelope, is believed to interact
with precursor proteins as they move between the outer and inner membrane translocons
(Marshall et al., 1990; Schnell et al., 1994). Within the Arabidopsis genome, there are
several coding regions that encode proteins similar to known Hsp7O molecules from other
species. These Arabidopsis Hsp70 proteins can be classiﬁed into one of four groups: (1)
proteins of approximately 650 residues that likely represent cytosolic Hsp70 molecules,
(2) proteins that are 668 or 669 residues long and contain an obvious signal peptide at
their N-termini, (3) molecules with clear chloroplastic (two proteins) or mitochondrial
(one protein) targeting motifs, and (4) proteins that do not ﬁt into any of the previous
three groups. Of the proteins within the last group, only one shows some characteristics
of a chloroplast transit peptide at its N-terminus. Sequence alignment between this
protein (AtHsp70-IVb) and the two obvious chloroplast-targeted Hsp70 molecules
(AtHsp70-V and AtHsp70-IVa) is shown in Figure 3.1.

The only known interrnembrane space protein that has been cloned is Tic22
(Kouranov et al., 1998). An analysis of the transit peptide for pea TicZZ reveals that it
has a relatively high incidence of acidic amino acids: three within the 50 residues of its
length (Kouranov et al., 1998). AtTic22 has ﬁve acidic residues within the same region.
The paradigm for chloroplast transit peptides is that they are deﬁcient in acidic amino
acids, having no more than two over their length (Keegstra et al., 1989). Thus, the transit
peptides for both pea and Arabidopsis Tic22 are somewhat unusual, and this fact may
account for why these proteins are targeted to the interrnembrane space of the chloroplast

envelope rather than the stroma, although this has not been experimentally veriﬁed. We

99

Figure 3.1. Multiple sequence alignment for the putative chloroplast-localized
Arabidopsis Hsp70 isoforms. Shaded residues designate sequence identities between
two or more of the proteins. The predicted transit peptide is indicated (>). The predicted
cleavage site is based on sequence identity to a pea chloroplastic Hsp70 (accession
number L03299) and has not been experimentally veriﬁed. The alignment was created
using the PileUp program from the Wisconsin package of sequence analysis tools

(Genetics Computer Group, Madison, Wisconsin, USA).

100

Its-p70-V
Atlcp70-1Va
Atlap70-IVD

Ataapvo-v
AtBIpTO-IVa
AtHsp70-1Vb

Atlcp7o-v
Atlnp70-IV3
Atlcp70-1Vb

Atlcp70-v
AtHsp70-1Va
Atnop70-1Vb

aux-pvo-v
ltlap70-IV1
AtlchO-IVB

AtHsp70—v
AtHsp70-IV:
AtHsp70-1Vb

Atﬂcp70-V
AtHsp70-IVI
AtHsp70-1Vb

Atncp70-v
AtHsp70-IV|
AtHsp70-1Vb

Atlap70-v
ltlapTO-IVa
Atlap70-1Vb

Atllp70-v
Atlap7o-IVI
Atﬂcp70-1Vb

O. I. I.

Figure 3.1

Tranel: P.Pt1d.>>)>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

Wﬁrﬁizc‘iprsﬁsiﬁrxﬁoums- drivﬁniisﬁrmu -IRE- 4m
6

wmwm--mswcrcchncnsmwx-uu- m

~o~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~nsvwsvsu supbcw I

>>>>>>>
It. '1 I“! "an m

Wuiiﬁ‘iﬁc'iﬁﬁciﬁsivﬁﬁboiﬁiﬁium 'nima ﬁfmmmmr‘u'ﬁ:
m--nvmxweronsrrusavmooxnrmumﬂrswarrxscnnvaomnoamnu z

«crewmanmrrucummmxsmasuﬂmoxmrwrmmnr =

Mal.“ Wamarn‘upumoeﬁ'm‘ " " ” ‘e’x'a‘am‘ We” “m“
Marmara--unnamvsxammmmmMIMWmmn :
GaggLxeagrnororoxlu‘ugpgxrlgarusnanvi--|Nﬂoxlspsogcguggriuxlrixar'cxsIu|giv :

WWWMﬁﬁﬁMﬁ’mﬁhﬂsﬁ - » . . ‘
TVPA!IIDBQRTATKDAGRIAGLRVLBIII!PrllﬂbhtatolﬂhlﬂrILVEDLGGGTIDVSVLIYGDGVI!’rs :

mammammxtmmnmnwmlim-Wuwmwur8mm 3

 

a. C - ’

fumedomansrmamummouWaan :
gzﬁbfnlcﬁDDIDlgvyplLIA’IIKDIGIDLLRD‘QALORLftlAltllIILBSLTQTIISLPII212100! :
MFEQQBNWTLHYWWBWMFHNWWMTW"ﬂuvial 3

humadﬁncsmwamnmmﬁammxmmmommsm
nurmmsmmavnnnnsmomsno;nxvnvccsrarravouvmrcnmrnpnm
3"”HESHIGEVGKDIBITQSPCQHCBKE‘G"IPVDHLEVPFEVFMIISH'lec‘at'ﬂll

O. I. C.

mmvdRMSMDmnnmuwurmMHmﬂnmmmhﬁW :
mmvoacvncnvsoxvunvnurcurmmunurnnsuzvrsrmcmmmom :
mayuse:pnenvxouuwvnsmrzrmgrrxrIrmnrpxmwarwmogchm :

WIMnMNmmormmmnnsmmanm
mnurssmocnnnevmnmormansvsavdnrmonnnaeuunxvyopo

ﬁ_ , 1,53gngvaxeamgognrgnrwrrwwmpunssccpogrnw

u———.-. -- -—_._- ._-_-—

WWmemomnmﬂpmmnﬁnumnﬁﬁamﬂ
gunman:mmmmxxomnuxrmmmmoucmrmr _- _ :
LaloxgoqxonmmlsgmIgsvnsnsuamugnaupavs ognrmﬁsxnvngaxv :

 

Wﬁﬁﬁéﬁor «EliispiéiiasiisnrissuadiNWW : 713
tantrum Pmpimmmrmsucj- ionymnnogo : m
sxxenanusxasjsspsﬂcq-smgcuornpnnsgsu~~~~~~~~ : 666

101

70
70
26

1‘3
143
101

216
216
17‘

291
291
2‘8

366
366
323

441
(I1
390

516
516
473

591
591
5‘8

666
666
623

analyzed the transit peptides of the possible chloroplastic Hsp70 proteins to see if we
could detect, based on what is observed from the transit peptide of Tic22, which one (or
ones) might be targeted to the intermembrane space. However, all three of these proteins
display a low incidence of acidic amino acids within their presumed transit peptides
(Figure 3.1). Thus, either the presence of acidic amino acids within the transit peptide is
not the determining factor for intermembrane space targeting or Arabidopsis may not
contain an intermembrane space-localized Hsp70 protein as has been suggested for pea
(Marshall et al., 1990; Schnell et al., 1994). Further experimental work will be needed to
differentiate between these possibilities.

The SPP (also known as the chloroplast processing enzyme [CPE]) is a
metalloendopeptidase that cleaves transit peptides off precursor proteins as they enter the
chloroplast stroma (Oblong and Lamppa, 1992; VanderVere et al., 1995; Richter and
Lamppa, 1998). This component has one homolog in Arabidopsis, named AtCPE, which
shares ~75% identity with the pea protein (Richter and Lamppa, 1998). Currently, the
SPP is the only constituent of the import machinery whose molecular function has been
studied in enough detail to be unequivocally assigned (Richter and Lamppa, 1998;

Richter and Lamppa, 1999).

102

CONCLUSIONS

Analysis of the Arabidopsis sequence database has revealed that homologs of
high sequence similarity can be found for each of the chloroplast protein import
components that were originally identiﬁed in pea. This suggests that the protein import
system is conserved between pea and Arabidopsis, making Arabidopsis a valid model for
its study. It is likely that the import complex is conserved in other plant species as well.
EST sequences similar to the known import components can be found in many species,
including maize, soybean, and rice. In addition, antibody cross-reactivity studies on
species as diverse as mosses and tomato have suggested that at least some of the subunits
of the import machinery can be found in all chloroplast-containing eukaryotes (J. Davila-
Aponte and K. Keegstra, unpublished observations). Various lines of evidence have also
indicated that cyanobacteria contain homologs of at least some of the import components
(Bolter et al., 1998b; Reumann and Keegstra, 1999; Reumann et al., 1999). Thus, the
chloroplast protein import system is likely to be conserved, at least in part, in all plant
(and related) species.

For at least seven (Toc159, Toc75, Toc34, Toc64, Tic20, Ti022, and Hsp93) of
the 11 known import components, multiple homologs can be found within the
Arabidopsis genome. In all but one of these cases, it is known that more than one of
these homologs is expressed within Arabidopsis cells (Jarvis et al., 1998; Bauer et al.,
2000; Gutensohn et al., 2000). This observation immediately suggests that multiple
isoforms of the same subunit may be present in the same cells at the same time (Jarvis et
al., 1998; Bauer et al., 2000; Chen et al., 2000b; Gutensohn et al., 2000). If this is the

case, then one may imagine the existence of multiple types of import complexes within

103

the chloroplast envelope, each with their own particular precursor speciﬁcity. For
example, if all three Arabidopsis ToclS9 homologs are expressed within the same cell,
then the chloroplasts within that cell may have a mixture of import complexes: some
containing AtToc159, others containing AtTocl32, and still others containing AtTochO.
However, because the stoichiometry of the subunits within the outer membrane
translocon is not known, it is also possible that all three may exist within the same import
complex. Obviously, such questions cannot be answered by sequence analysis alone, and
further experiments will be needed to address these issues.

The possibility of multiple isoforms for some of the protein import components
within Arabidopsis chloroplasts also raises the question of whether the same situation is
present in pea plants. Is Arabidopsis “unusual” in having multiple genes for at least some
of the subunits of the import complex or is this the case in pea as well? So far, only one
isoform has been identiﬁed for each component of the pea import apparatus. However,
this fact does not mean that additional homologs do not exist within the pea genome.
Since the pea import components were all initially isolated via biochemical means, it is
possible that isoforms not present at high concentrations or at the particular stage of
development studied would be missed. At this time, there is not enough pea sequence
information in GenBank to determine if multiple genes for the import components may
indeed also be found in this species.

It is interesting to note that none of the coding regions for the Arabidopsis import
components are found close to one another within the genome. Even for the components
that have multiple putative isoforms, the genes encoding these proteins are located on

separate chromosomes (see Table 3-1). This is in contrast to the situation known for

104

several other gene families (Lin et al., 1999; Mayer et al., 1999; The Arabidopsis
Genome Initiative, 2000). Often, homologs of a particular coding region can be found
nearby in the genome, if not in tandem (Lin et al., 1999; Mayer et al., 1999; The
Arabidopsis Genome Initiative, 2000). In the case of the chloroplast protein import
complex, however, the genes encoding the various subunits are found scattered
throughout the genome. The explanation for this observation is not clear. Perhaps
recombination in the areas immediately surrounding the genes for the import components
is suppressed due to the essential nature of either the import complex genes themselves or
other genes in their local environment. Additional work will be needed to test this
hypothesis.

It has been known for many years that the components of the pea chloroplast
protein import complex show little sequence similarity to proteins of known function
from other organisms (with the exception of the molecular chaperones and the SPP),
including the subunits of the protein import systems of other organelles (Reumann and
Keegstra, 1999; Reumann et al., 1999). Thus, it has not been possible to use information
gained from the genetic study of other protein import systems to learn more about the
functions of the individual subunits in the chloroplast import complex. Identiﬁcation of
the Arabidopsis homologs for the pea import components has now made it practical to
analyze the functions of these proteins genetically, especially through the use of knockout
mutants and antisense technology. Such experiments are already being carried out in
several laboratories, and three reports have recently emerged from these investigations
(Jarvis et al., 1998; Bauer et al., 2000; Gutensohn et al., 2000). The study of knockout

mutants and antisense plants for each of the import components should lead to a better

105

understanding of their molecular functions. Cross-complementation studies in knockout
mutants will also be useful in determining whether the putative Arabidopsis import
complex isoforms are the functional homologs of the corresponding pea proteins, as is
predicted. However, it should be noted that since several of these proteins appear to have
multiple isoforms within Arabidopsis cells, double and triple mutants may need to be
constructed in some cases before component function can be analyzed in detail. Despite
this limitation, the genetic study of chloroplast protein import in Arabidopsis should

provide a great deal of information concerning this system in the coming years.

106

REFERENCES

Akita M, Nielsen E, Keegstra K (1997) Identiﬁcation of protein transport complexes in

the chloroplastic envelope membranes via chemical cross-linking. J Cell Biol 136: 983-
994

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment
search tool. .1 Mol Biol 215: 403-410

Altschul SF, Madden TL, Schéiffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997)
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res 25: 3389-3402

Arabidopsis Genome Initiative, The (2000) Analysis of the genome sequence of the
ﬂowering plant Arabidopsis thaliana. Nature 408: 796-815

Bauer J, Chen K, Hiltbunner A, Wehrli E, Eugster M, Schnell D, Kessler F (2000) The
major protein import receptor of plastids is essential for chloroplast biogenesis. Nature
403: 203-207

Bélter B, May T, Soll J (1998a) A protein import receptor in pea chloroplasts, T0086, is
only a proteolytic fragment of a larger polypeptide. FEBS Lett 441: 59-62

Bolter B, Soll J, Schulz A, Hinnah S, Wagner R (1998b) Origin of a chloroplast protein
importer. Proc Natl Acad Sci USA 95: 15831-15836

Bruce BD (2000) Chloroplast transit peptides: structure, function and evolution. Trends
Cell Biol 10: 440-447

Caliebe A, Grimm R, Kaiser G, Liibeck J, 8011 J, Heins L (1997) The chloroplastic
protein import machinery contains a Rieske-type iron-sulfur cluster and a mononuclear
iron-binding protein. EMBO J 16: 7342-7350

Chen K, Chen X, Schnell DJ (2000a) Initial binding of preproteins involving the Tool 59
receptor can be bypassed during protein import into chloroplasts. Plant Physiol 122: 813-
822

Chen K, Chen X, Schnell DJ (2000b) Mechanism of protein import across the chloroplast
envelope. Biochem Soc Trans 28: 485-491

Chen X, Schnell DJ (1999) Protein import into chloroplasts. Trends Cell Biol 9: 222-227
Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular

localization of proteins based on their N-terrninal amino acid sequence. J Mol Biol 300:
1005-1016

107

Gutensohn M, Schulz B, Nicolay P, F liigge U-I (2000) Functional analysis of the two
Arabidopsis homologues of Toc34, a component of the chloroplast protein import
apparatus. Plant J 23: 771-783

Hinnah SC, Hill K, Wagner R, Schlicher T, Soll J (1997) Reconstitution of a chloroplast
protein import channel. EMBO J 16: 7351-7360

Hirsch S, Muckel E, Heemeyer F, von Heijne G, Soll J (1994) A receptor component of
the chloroplast protein translocation machinery. Science 266: 1989-1992

Ivey RA, Subramanian C, Bruce BD (2000) Identiﬁcation of a Hsp70 recognition domain
within the Rubisco small subunit transit peptide. Plant Physiol 122: 1289-1299

Jackson DT, Froehlich JE, Keegstra K (1998) The hydrophilic domain of Ticl 10, an
inner envelope membrane component of the chloroplastic protein translocation apparatus,
faces the stromal compartment. J Biol Chem 273: 16583-16588

Jarvis P, Chen L-J, Li H-M, Peto CA, F ankhauser C, Chory J (1998) An Arabidopsis
mutant defective in the plastid general protein import apparatus. Science 282: 100-103

Keegstra K, Cline K (1999) Protein import and routing systems of chloroplasts. Plant
Cell 11: 557-570

Keegstra K, F roehlich JE (1999) Protein import into chloroplasts. Curr Opin Plant Biol
2: 471-476

Keegstra K, Olsen LJ, Theg SM (1989) Chloroplastic precursors and their transport
across the envelope membranes. Annu Rev Plant Physiol Plant Mol Biol 40: 471-501

Kessler F, Blobel G (1996) Interaction of the protein import and folding machineries in
the chloroplast. Proc Natl Acad Sci USA 93: 7684-7689

Kessler F, Blobel G, Patel HA, Schnell DJ (1994) Identiﬁcation of two GTP-binding
proteins in the chloroplast protein import machinery. Science 266: 1035-1039

Ko K, Budd D, Wu C, Seibert F, Kourtz L, Ko ZW (1995) Isolation and characterization
of a cDNA clone encoding a member of the Com44/Cim44 envelope components of the

chloroplast protein import apparatus. J Biol Chem 270: 28601-28608

Komiya T, Rospert S, Koehler C, Looser R, Schatz G, Mihara K (1998) Interaction of
mitochondrial targeting signals with acidic receptor domains along the protein import
pathway: evidence for the ‘acid chain’ hypothesis. EMBO J 17: 3886-3898

Kouranov A, Chen X, Fuks B, Schnell DJ (1998) Tic20 and Tic22 are new components

of the protein import apparatus at the chloroplast inner envelope membrane. J Cell Biol
143: 991-1002

108

Kouranov A, Schnell DJ (1997) Analysis of the interactions of preproteins with the
import machinery over the course of protein import into chloroplasts. J Cell Biol 139:
1677-1685

Kourtz L, Ko K (1997) The early stage of chloroplast protein import involves Com70. J
Biol Chem 272: 2808-2813

Lin X, Kaul S, Rounsley S, Shea TP, Benito M-I, Town CD, Fujii CY, Mason T,
Bowman CL, Barnstead M, et al. (1999) Sequence and analysis of chromosome 2 of the
plant Arabidopsis thaliana. Nature 402: 761-768

Liibeck J, 8011 J, Akita M, Nielsen E, Keegstra K (1996) Topology of IEPl 10, a
component of the chloroplastic protein import machinery present in the inner envelope
membrane. EMBO J 15: 4230-4238

Ma Y, Kouranov A, LaSala SE, Schnell DJ (1996) Two components of the chloroplast
protein import apparatus, IAP86 and IAP75, interact with the transit sequence during the

recognition and translocation of precursor proteins at the outer envelope. J Cell Biol 134:
315-327

Marshall J S, DeRocher AE, Keegstra K, Vierling E (1990) Identiﬁcation of heat shock
protein hsp70 homologues in chloroplasts. Proc Natl Acad Sci USA 87: 374-378

May T, Soll J (1999) Chloroplast precursor protein translocon. FEBS Lett 452: 52-56

May T, Soll J (2000) 14-3-3 proteins form a guidance complex with chloroplast precursor
proteins in plants. Plant Cell 12: 53-63

Mayer K, Schiiller C, Wambutt R, Murphy G, Volckaert G, Pohl T, Diisterhoft A,
Stiekema W, Entian K-D, Terryn N, et al. (1999) Sequence and analysis of chromosome
4 of the plant Arabidopsis thaliana. Nature 402: 769-777

Nakabayashi K, Ito M, Kiyosue T, Shinozaki K, Watanabe A (1999) Identiﬁcation of clp
genes expressed in senescing Arabidopsis leaves. Plant Cell Physiol 40: 504-514

Nielsen E, Akita M, Davila-Aponte J, Keegstra K (1997) Stable association of
chloroplastic precursors with protein translocation complexes that contain proteins from

both envelope membranes and a stromal Hsp100 molecular chaperone. EMBO J 16: 935-
946

Oblong JE, Lamppa GK (1992) Identiﬁcation of two structurally related proteins
involved in proteolytic processing of precursors targeted to the chloroplast. EMBO J 11:
4401-4409

Olsen LJ, Keegstra K (1992) The binding of precursor proteins to chloroplasts requires
nucleoside triphosphates in the interrnembrane space. J Biol Chem 267: 433-439

109

Olsen LJ, Theg SM, Selman BR, Keegstra K (1989) ATP is required for the binding of
precursor proteins to chloroplasts. J Biol Chem 264: 6724-6729

Perry SE, Keegstra K (1994) Envelope membrane proteins that interact with chloroplastic
precursor proteins. Plant Cell 6: 93-105

Reumann S, Davila-Aponte J, Keegstra K (1999) The evolutionary origin of the protein-
translocating channel of chloroplastic envelope membranes: identiﬁcation of a
cyanobacterial homolog. Proc Natl Acad Sci USA 96: 784-789

Reumann S, Keegstra K (1999) The endosymbiotic origin of the protein import
machinery of chloroplastic envelope membranes. Trends Plant Sci 4: 302-307

Richter S, Lamppa GK (1998) A chloroplast processing enzyme functions as the general
stromal processing peptidase. Proc Natl Acad Sci USA 95: 7463-7468

Richter S, Lamppa GK (1999) Stromal processing peptidase binds transit peptides and
initiates their ATP-dependent turnover in chloroplasts. J Cell Biol 147: 33-43

Schleiff E, 8011 J (2000) Travelling of proteins through membranes: translocation into
chloroplasts. Planta 211: 449-456

Schnell DJ, Kessler F, Blobel G (1994) Isolation of components of the chloroplast protein
import machinery. Science 266: 1007-1012

Seedorf M, Waegemann K, Soll J (1995) A constituent of the chloroplast import complex
represents a new type of GTP-binding protein. Plant J 7: 401-411

Sohrt K, Soll J (2000) Toc64, a new component of the protein translocon of chloroplasts.
J Cell Biol 148: 1213-1221

Stahl T, Glockmann C, Soll J, Heins L (1999) Tic40, a new “old” subunit of the
chloroplast protein import translocon. J Biol Chem 274: 37467-37472

Theg SM, Bauerle C, Olsen LJ, Selman BR, Keegstra K (1989) Internal ATP is the only
energy requirement for the translocation of precursor proteins across chloroplastic
membranes. J Biol Chem 264: 6730-6736

Tranel PJ, Froehlich J, Goyal A, Keegstra K (1995) A component of the chloroplastic
protein import apparatus is targeted to the outer envelope membrane via a novel pathway.
EMBO J 14: 2436-2446

VanderVere PS, Bennett TM, Oblong JE, Lamppa GK (1995) A chloroplast processing

enzyme involved in precursor maturation shares a zinc-binding motif with a recently
recognized family of metalloendopeptidases. Proc Natl Acad Sci USA 92: 7177-7181

110

Waegemann K, Soll J (1991) Characterization of the protein import apparatus in isolated
outer envelopes of chloroplasts. Plant J 1: 149-158

Wu C, Seibert FS, Ko K (1994) Identiﬁcation of chloroplast envelope proteins in close

physical proximity to a partially translocated chimeric precursor protein. J Biol Chem
269: 32264-32271

111

CHAPTER4

An outer envelope membrane component of the chloroplastic

protein import apparatus is essential in Arabidopsis

112

ABSTRACT

Toc34 is a GTP-binding component of the plastid protein import apparatus
located within the chloroplast outer envelope membrane. Arabidopsis chloroplasts
contain two homologs of Toc34, designated AtToc34 and AtToc33. In this report, we
describe the isolation and characterization of a knockout mutant line, ppi3, that no longer
expresses the gene encoding AtToc34. ppi3 plants appear similar to wild-type plants
throughout their development. In addition, no signiﬁcant differences from the wild type
can be detected when chloroplast ultrastructure, endogenous levels of various plastid
proteins, or in vitro import kinetics are examined in the mutant line. Overall, ppi3 plants
do not appear to be signiﬁcantly affected by the loss of AtT 0C34 expression, presumably
because AtToc33 can substitute for AtToc34 in the mutant line. Attempts to generate a
double homozygous mutant lacking both AtToc34 and AtToc33 by crossing ppi3 and
ppi 1, a knockout mutant line that does not express the gene encoding AtToc33, were
unsuccessful, indicating that the function provided by AtToc34 and AtToc33 is essential

in A rabidopsis.

113

INTRODUCTION

The recent development of reverse genetic techniques for Arabidopsis thaliana, in
particular the wide availability of T-DNA mutagenized populations, has permitted the
genetic study of a variety of proteins that are speciﬁc to plant systems, such as the factors
involved in protein import into chloroplasts. Plastids must import the vast majority of
their resident proteins posttranslationally from the cytoplasm (Chen and Schnell, 1999;
Keegstra and Cline, 1999; Keegstra and Froehlich, 1999; May and Soll, 1999; Schleiff
and Soll, 2000; Vothknecht and Soll, 2000). The process of plastid protein transport is
mediated by a proteinaceous machinery located within the two membranes of the
organellar envelope. Several components of this import complex have been identiﬁed in
recent years from pea chloroplasts, including four proteins localized to the outer envelope
membrane, ﬁve inner envelope membrane proteins, and at least one stromal molecular
chaperone (Chen and Schnell, 1999; Keegstra and Cline, 1999; Keegstra and Froehlich,
1999; May and Soll, 1999; Schleiff and Soll, 2000; Vothknecht and Soll, 2000).

GTP hydrolysis has been found to stimulate the initial binding of precursor
proteins to the chloroplast surface (Olsen and Keegstra, 1992; Kessler et al., 1994; Young
etal., 1999). This observation is particularly interesting because two components of the
outer membrane import complex, ToclS9 (translocon at the Quter envelope membrane of
chloroplasts, 1_5_9 kD) and Toc34, contain GTP-binding motifs within their amino acid
sequences and have been shown to both bind and hydrolyze this nucleotide (Kessler et
al., 1994; Seedorf et al., 1995). Toc159 is predicted to be the receptor for chloroplastic
precursor proteins (Hirsch et al., 1994; Perry and Keegstra, 1994). The possible role of

Toc34 during the import process is less clear, however. Current speculation suggests that

114

this component may regulate the efﬁciency of precursor protein transport via GTP
binding and/or hydrolysis (Kessler et al., 1994; Seedorf et al., 1995).

Toc34 was ﬁrst identiﬁed as a member of the pea chloroplastic protein import
complex through its ability to immunoprecipitate, and be immunoprecipitated by, a
translocating precursor protein (Schnell et al., 1994; Seedorf et al., 1995). It is an integral
protein of the chloroplast outer envelope membrane, anchored in the lipid bilayer by a
transmembrane domain near the C-terrninus (Kessler et al., 1994; Seedorf et al., 1995).
The soluble N-terminus of Toc34, which contains the GTP-binding domain, is localized
within the cytoplasm (Kessler et al., 1994; Seedorf et al., 1995). Toc34 forms a stable
complex in the outer membrane with at least two other components of the import
machinery: Toc159 and Toc75 (Ma et al., 1996). This trimeric complex forms both in the
absence and in the presence of precursors (Ma et al., 1996; Akita et al., 1997; Nielsen et
al., 1997). Crosslinking of a translocating preprotein to Toc34 can only be observed in
the presence of apyrase, suggesting that the Toc34-precursor interaction is very sensitive
to nucleotides, in particular the binding of GTP (Kouranov and Schnell, 1997).

There are two homologs of pea Toc34 in Arabidopsis, designated AtToc33 and
AtToc34 based on their predicted molecular masses (Jarvis et al., 1998). The genes for
both AtToc33 and AtToc34 are expressed throughout development and in all tissues,
although they are expressed at higher levels in seedlings and young tissues than in older
parts of the plant (Jarvis et al., 1998; Gutensohn et al., 2000). Recently, a mutant, in
which both copies of the gene encoding AtToc33 are disrupted by a T-DNA insert, was
isolated (Jarvis et al., 1998). This mutant displays several defects in young leaves: a pale

phenotype, smaller chloroplasts with fewer thylakoids, and reduced levels of import into

115

isolated chloroplasts (Jarvis et al., 1998). Older leaves, however, are more similar to
those of wild-type plants (Jarvis et al., 1998). Antisense plants for AtToc33 also have a
pale phenotype that is restricted to the early stages of development (Gutensohn et al.,
2000)

Based on the results obtained with the knockout and antisense lines for AtToc33,
it is apparent that AtToc34 cannot completely compensate for the loss of its homolog.
However, when overexpressed in the AtToc33 knockout line, AtToc34 can complement
the mutant phenotype, indicating that the two proteins are functionally similar (Jarvis et
al., 1998). It is possible that AtToc33 and AtToc34 have overlapping, but nonidentical,
roles within Arabidopsis chloroplasts. This hypothesis is supported by the fact that the
genes for these two proteins appear to be differentially expressed when analyzed via in
situ hybridization and promoter-reporter fusions (Gutensohn et al., 2000). In addition, it
has been observed that AtToc33 and AtToc34 may have different afﬁnities for a
precursor protein substrate (Gutensohn et al., 2000).

In order to learn more about the function of AtToc34 within Arabidopsis
chloroplasts, we have isolated a mutant line in which both copies of the gene for this
protein have been disrupted by a T-DNA insert. Mutant plants appear similar to wild-
type plants, both visually and at the level of chloroplast structure and composition. In
addition, chloroplasts isolated from the knockout mutant are able to import a variety of
precursor proteins with efﬁciencies similar to those measured for wild-type chloroplasts.
Double homozygous mutants lacking both AtToc33 and AtToc34, however, are not
viable, indicating that the function provided by these two homologs is essential in

Arabidopsis chloroplasts.

116

MATERIALS AND METHODS

Plant material

Arabidopsis thaliana plants, both wild type and mutant, used in this study were of
the Wassilewskija (Ws) ecotype, except as noted otherwise. Seeds were surface-
sterilized in 30% (v/v) bleach, 0.02% (v/v) Triton-X 100 for 30 minutes, washed three
times with water, and imbibed overnight at 4°C. After imbibition, seeds were either sown
on soil or plated on 1X MS salt and vitamin mixture (Gibco BRL, Grand Island, New
York, USA), 1% (w/v) sucrose, 0.8% (w/v) phytagar (Gibco BRL, Grand Island, New
York, USA). Soil-grown plants were then grown in 12-hour days (12 hours light: 12
hours dark) at 20°C. Plate-grown plants were incubated in long days (16 hours light:8

hours dark) at 22°C.

Screening of T-DNA mutagenized Arabidopsis populations

Two T-DNA mutagenized Arabidopsis populations, available at the Arabidopsis
Functional Genomics Consortium Arabidopsis Knockout Facility at the University of
Wisconsin-Madison (Krysan et al., 1999), were screened. A PCR-based screening
strategy was employed to analyze a total of 133,440 mutagenized lines, as described
previously (Krysan et al., 1996; Krysan et al., 1999). The following PCR primers were
used: AtTOC34 (PPI3) 5’, aaagaaactaatggagacaacggcaaatg; AtTOC34 (PPI3) 3’, gcttcgc-
aaatatcctcaccactgtcttc; T—DNA leﬁ border, cattttataataacgctgcggacatctac; T-DNA right
border, tgggaaaacctggcgttacccaacttaat. The AtTOC34 5’ and AtTOC34 3’ primers were
used in combination with the T-DNA left border primer to screen all 133,440 lines

available in both mutagenized populations. Only one population, containing 60,480

117

mutagenized lines, was screened with the AtTOC34 5’ and AtTOC34 3’ primers in
Combination with the T-DNA right border primer. PCR products generated by positive
hits in the screening reactions were sequenced to determine the location of the T-DNA
insert within or near the coding region for AtToc34. Aﬁer a line containing a T-DNA
within the coding region for AtToc34 was isolated, plants homozygous for the insertion
were generated and used for further study. Homozygosity of the T-DNA insert was
conﬁrmed by the inability of the AtTOC34 5’ and AtTOC34 3’ primers to amplify the

wild-type gene from genomic DNA isolated from the mutant line.

mRNA isolation and RT -PCR

Ground tissue (~1 g) from four-week-old wild-type or ppi3 mutant plants grown
on soil was added to warm (65°C) extraction buffer (5 mL; 2% [w/v] hexadecyltrimethyl-
ammonium bromide, 2% [w/v] polyvinylpyrrolidone K 30, 100 mM Tris-HCl [pH 8.0],
25 mM EDTA, 2 M NaCl, 0.5 g/L sperrnidine, 2% [v/v] B-mercaptoethanol). This
solution was extracted twice with an equal volume of chloroform, and the upper phase
was precipitated overnight at 40C with one-quarter volume 10 M LiCl. After
centrifugation at ~6000 g for 20 minutes, the pellet was resuspended in 1.5 mL 10 mM
Tris-HCl (pH 7.5), 1 mM EDTA, 0.5% SDS. This solution was then extracted once in an
equal volume of phenolzchloroform:isoamyl-alcohol (25:24: 1). The upper phase was
again precipitated overnight at 4°C with one-quarter volume 10 M LiCl, and the pellet
was recovered by centrifugation at ~6000 g for 20 minutes. The pellet was resuspended
in 400 uL distilled water and then reprecipitated by the addition of one-tenth volume

sodium acetate and 2.5 volumes 100% ethanol. Following recovery by centrifugation at

118

~6000 g for 15 minutes, the ﬁnal pellet was resuspended in 100 uL distilled water and
quantitated. The PolyATract mRNA Isolation System (Promega, Madison, Wisconsin,
USA) was then used to isolate mRNA from ~150 ug of total RNA.

RT-PCR was performed with the Titan One Tube RT-PCR System (Roche
Molecular Biochemicals, Mannheim, Germany). 10 uL of mRNA isolated from wild-
type or ppi3 plants was used as the template. The following primers speciﬁc for the gene
encoding AtToc34 were used: 5’, gttgtcggtgctataactgatg; 3’, acttgctaaaccggagtctcg.
Primers speciﬁc for the gene encoding AtToc33 were also used: 5’, acaatgggagggttcacta-
tc; 3’, tcttctccttgtaatttgctcac. Gene-speciﬁcity of the primers was conﬁrmed by using
plasmids containing cDNA versions of the AtTOC34 and AtTOC33 genes (Arabidopsis
Biological Resource Center, Columbus, Ohio, USA) as templates in control PCR

experiments.

Chlorophyll isolation and quantitation

Wild-type or ppi3 seedlings at four, seven, eleven, fourteen, seventeen, or twenty
days after planting were weighed and then ground, with sand, in 80% acetone. Ground
tissue was centrifuged at ~2000 g for 5 minutes to pellet any insoluble material. The
absorbance of the extracted chlorophyll, at 645 nm and 663 nm, was then determined.
Each sample was measured twice at these two wavelengths. The chlorophyll levels
present (ug/mL) in each sample were calculated using the equation given in Amon

(1949).

119

Transmission electron microscopy

Leaf tissue from soil-grown wild-type or ppi3 mutant plants was ﬁxed in 2%
paraformaldehyde, 2.5% glutaraldehyde, 0.1 M sodium phosphate (pH 7.4) for 90
minutes at room temperature under vacuum, followed by 24 hours at 4°C. A second
ﬁxation in 1% osmium tetroxide, 0.1 M sodium phosphate (pH 7.4) for two hours was
then performed. The samples were dehydrated in acetone and embedded in Spurr resin.
Thin sections (~70 nm) of each sample were then stained with uranium and lead and
examined in a J EOL 100CX electron microscope (JEOL USA, Peabody, Massachusetts,
USA). All of these procedures were carried out by the Center for Advanced Microscopy,

Michigan State University.

Protein extraction and immunoblotting

Ground tissue (~1 g) from two-week-old or four-week-old soil-grown wild-type
or ppi3 plants was extracted by boiling for 5 minutes in 0.15 M Tris-HCl (pH 6.8), 7.5%
B-mercaptoethanol, 3% SDS, 0.2 mM phenylmethylsulfonyl ﬂuoride (PMSF). Insoluble
material was pelleted by centrifugation at ~20,000 g for 20 minutes, and the soluble
extract was used for further study.

SDS-PAGE was performed as described previously (Laemmli, 1970). Total
protein extracts were loaded on the basis of equal amounts of starting tissue fresh weight;
chloroplast protein samples were loaded according to equal amounts of total chlorophyll.
Following SDS-PAGE, the separated proteins were either stained with Coomassie
Brilliant Blue R250 or transferred overnight to lmmobilon-P PVDF membranes

(Millipore, Bedford, Massachusetts, USA). Membranes were incubated in blocking

120

buffer (0.1% TBS, 1% Tween 20, 5% non-fat dry milk) prior to incubation in 0.1% TBS,
1% Tween 20, 1% non-fat dry milk supplemented with antiserum. Washings were
performed with 0.1% TBS, 1% Tween 20. Primary antibody, against all proteins tested
except biotin carboxyl carrier protein (BCCP) and plastocyanin (PC), was detected with
horseradish peroxidase-conjugated goat anti-rabbit antibodies (Kirkegaard and Perry
Laboratories, Gaithersburg, Maryland, USA). Secondary antibody was detected using the
SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, Illinois, USA).
Anti-biotin antibodies directly conjugated to alkaline phosphatase (Kirkegaard and Perry
Laboratories, Gaithersburg, Maryland, USA) were used to visualize BCCP; alkaline
phosphatase-conjugated goat anti-chicken antibodies were used to detect the primary
antibody against PC. These antibodies were then detected with nitro blue tetrazoliurn and
5-bromo-4-chloro-3-indolyl phosphate.

Antibodies against Toc75 were raised as discussed by Tranel et al. (1995).
Antiserum to Tic110 was generated as described by Akita et al. (1997). Antibodies to
Hsp93 were made as described by Akita and Keegstra (submitted). Antiserum against
S78 was generated as discussed in Nielsen et al. (1997). Antibodies to Tic22 and IEP35
were a gift from D. Schnell (Schnell etal., 1994; Kouranov et al., 1998). Antiserum
against allene oxide synthase (AOS) was a gift from G. Howe (Howe et al., 2000).

Antiserum to F tle was a gift from K. Osteryoung (Stokes et al., 2000).

Isolation of chloroplasts

Chloroplasts were isolated from four-week-old plate-grown Arabidopsis plants, as

described previously (Fitzpatrick and Keegstra, 2001). Final resuspension of chloroplasts

121

was in import buffer (330 mM sorbitol, 50 mM HEPES-KOH, pH 8.0) at a concentration

of 1 mg chlorophyll/mL.

In vitro import assays

The precursor proteins used in this study were the precursor to the small subunit
of Rubisco (prSS) from pea, the precursor to the light harvesting chlorophyll a/b binding
protein (prLHCP) from pea, the precursor to plastocyanin (prPC) from Silene pratensis,
and a truncated version of the precursor to Ticl 10 (tp110-110N) from pea (Bauerle and
Keegstra, 1991; Liibeck et al., 1997). All precursors were generated with a TNT®-
coupled transcription and translation system (Promega, Madison, Wisconsin, USA)
containing 35S-methionine and either SP6 RNA polymerase (prSS, prLHCP, and prPC) or
T7 RNA polymerase (tpl 10-1 10N).

Import reactions were carried out essentially as described previously (Bruce et al.,
1994). In brief, chloroplasts (25 pg chlorophyll) were incubated with rabbit reticulocyte
lysate-translated precursor in 150 uL import buffer (330 mM sorbitol, 50 mM HEPES-
KOH, pH 8.0) supplemented with 4 mM ATP. At the times indicated in the ﬁgures,
import was stopped by sedimenting intact chloroplasts through a 40% (v/v) Percoll
cushion. Pellets were then resuspended in SDS-PAGE sample buffer and analyzed by
electrophoresis and ﬂuorography. Results were quantiﬁed using a phosphoimager
(Molecular Imager FX, Bio-Rad, Hercules, California, USA). Import rates were
calculated by determining the slope of the line generated by plotting time after reaction

initiation versus % maximum level of import achieved (see Figure 4.8B).

122

Generation of ppiI/ppi3 double mutants

All of the following work was done by Paul Jarvis and Ramesh Patel at the
University of Leicester, England. ppi3 mutant plants were crossed to the ppiI knockout
line, which is in the Columbia background. F2 individuals were grown on 1X MS media,
supplemented with 0.5% sucrose, under long day conditions (16 hours light:8 hours
dark). After seven days, plants were visually examined and classiﬁed into one of three
phenotypic classes: green, pale, or bleached. Aﬁer several more days of growth, genomic
DNA was extracted (Edwards et al., 1991) from 15 pale individuals and 15 bleached
individuals and genotyped. PCR primers used for genotyping were as follows: AtTOC33
(PPII) 5’, ggtctctcgttcgtgaatgg; AtTOC33 (PPII) 3’, ctgagcgcctatgataagag; AtTOC34
(PPI3) 5’, taatttgatacgaggtcagcgaatccggc; AtTOC34 (PPI3) 3’, tccctgagatcgatcaagggtagc-
ttcac; T-DNA left border, ataacgctgcggacatctac; T—DNA right border, tgggaaaacctggcgtt-
acccaacttaat. Each DNA sample was tested using four primer combinations:
(1) AtTOC33 5’ and AtTOC33 3’ primers, (2) AtTOC33 5’ and T-DNA leﬁ border
primers, (3) AtTOC34 5’ and AtTOC34 3’ primers, and (4) AtTOC34 5’ and T-DNA right
border primers.

ppiI/ppiI/PPI3/ppi3 individuals were backcrossed, as either the male or the
female parent, to Columbia wild-type plants. DNA was isolated (Edwards etal., 1991)
from 45 F1 individuals (male =ppi1/ppi1/PPI3/ppi3) or 40 F1 individuals (female =

ppiI/ppi 1/PPI3/ppi3) and genotyped as described above.

123

RESULTS
Isolation of a knockout mutant line for AtToc34

In order to investigate the possible role of AtToc34 during protein import into
chloroplasts, we isolated a mutant line in which both copies of the gene encoding
AtToc34 have been disrupted by a T-DNA insert. This mutant was designated ppi3 (for
plastid protein import 3), according to the nomenclature previously used for mutants of
the chloroplast protein import complex (Jarvis et al., 1998; Bauer et al., 2000). ppi3 was
found by screening the T-DNA mutagenized Arabidopsis populations housed at the
University of Wisconsin-Madison as part of the Arabidopsis Functional Genomics
Consortium (AF GC; Krysan et al., 1999). Using the PCR-based screening strategy
developed by the AF GC (Krysan etal., 1996; Krysan et al., 1999), a total of 133,440
mutagenized lines were screened using a primer to the left border of the T-DNA along
with primers speciﬁc for the gene encoding AtToc34. 60,480 of these lines were also
screened using a primer to the T-DNA right border in combination with the AtToc34-
speciﬁc primers. A total of three insertions within or near the gene encoding AtToc34
were found: two were slightly downstream of the coding region and one was within the
coding region itself. The last of these mutant lines was chosen for further study.

The T-DNA insert in ppi3 plants was located within the next to last exon of the
gene for AtToc34 (Figure 4.1A). This insertion abolished the expression of the full-
length mRNA in mutant plants, as determined by RT-PCR (Figure 4.1B). The gene
encoding AtToc33, a homolog of AtToc34, was still expressed, however, in ppi3 plants
(Figure 4.1C). The visible phenotype of the knockout mutant did not differ signiﬁcantly

from that of wild-type plants of the same ecotype. At various stages throughout

124

Figure 4.1. Characteristics of the ppi3 mutation. (A) Schematic depicting the
structure of the AtTOC34 gene. Exons are represented by ﬁlled boxes; introns are
symbolized by thin lines. The approximate location of the T-DNA insert within the
AtTOC34 gene in the ppi3 mutant line is indicated. (B,C) RT-PCR analysis for the gene
encoding AtToc34 (B) and the gene encoding AtToc33 (C), using mRNA isolated from
either wild-type or ppi3 mutant plants as a template. Expression of the AtTOC34 gene is

undetectable in the ppi3 mutant line.

125

he

.16 £313

d from

1

96

A

11

C

‘.
1)

 

 

 

 

,--... ._.,—.
~a

‘ -' ‘ ‘ﬂC'rua - T1,“! 5‘!

 

 

Figure 4.1

126

r area-4.35mi.—

 

 

T-DNA

 

 

 

development, soil-grown ppi3 plants were approximately the same size and color as wild-
type plants (Figure 4.2). In addition, mutant plants appeared to reach various
developmental milestones, such as the emergence of true leaves and bolting, at
approximately the same age as wild-type plants grown under the same conditions
(compare Figures 4.2E and 4.2F).

It has been reported that plants expressing antisense copies of the gene for
AtToc34 are slightly paler than the wild type at four days of age (Gutensohn et al., 2000).
However, we did not notice a pale phenotype for four-day-old ppi3 plants. We quantiﬁed
chlorophyll levels in soil-grown plants of various ages in order to determine whether
there were differences in chlorophyll content between wild-type and ppi3 mutant lines
(Figure 4.3A). On average, ppi3 plants contained less chlorophyll per gram fresh weight
than the wild type during the ﬁrst week after planting, having ~70% of the chlorophyll
levels of wild-type plants grown under the same conditions (Figure 4.3B). However,
measurements of the chlorophyll content of four-day-old wild-type plants included a
large amount of variation so differences seen at this age are unlikely to be signiﬁcant.
After one week, ppi3 plants contained at least as much chlorophyll per gram ﬁ'esh weight

as the wild type (Figure 4.3B).

C hloroplasts of ppi3 plants are similar to wild-type chloroplasts

AtToc34 is an integral protein of the plastid outer envelope membrane
(Gutensohn et al., 2000). Consequently, ppi3 mutant plants, which no longer express the
gene encoding AtToc34, could possibly have altered chloroplast structure and/or

function. In order to determine whether chloroplasts of ppi3 plants differ from wild-type

127

Figure 4.2. Visible phenotype of the ppi3 mutant line. Wild-type (panels A, C, and E)
and ppi3 (panels B, D, and F) plants were grown on soil in 12-hour days (12 hours

light: 12 hours dark). Individual plants were photographed at two weeks (panels A and
B), three weeks (panels C and D), and four weeks (panels E and F) after planting. Note
the emergence of ﬂower buds at three weeks and bolting at four weeks. Images in this

dissertation are presented in color.

128

 

 

Figure 4.2

Figure 4.3. Chlorophyll levels present in ppi3 plants do not differ significantly from
those present in wild-type plants. (A) Chlorophyll was extracted in 80% acetone from
wild-type (square) and ppi3 mutant (triangle) lines and quantiﬁed as described in
“Materials and Methods.” Values shown are the average of a minimum of three
measurements. (B) Average chlorophyll levels present in the ppi3 mutant, expressed as a

percentage of the chlorophyll levels measured for wild-type plants of the same age.

130

fill

an

mg chlorophyll/ g fresh weight

("/0 Wild-W)

ppi3 chlorophyll levels

Figure 4.3

 

age (days)

 

age (days)

131

chloroplasts, we looked at three aspects of plastid biology: (1) chloroplast ultrastructure,
(2) endogenous levels of various plastid proteins, and (3) kinetics of in vitro import into
isolated chloroplasts.

Transmission electron micrographs were prepared from leaf tissue of soil-grown
wild-type and ppi3 plants at various ages (Figure 4.4). At six days after planting,
chloroplasts of wild-type plants were not yet mature (Figure 4.4A). Thylakoid
membranes had developed, but the granal stacking was not as extensive as that seen in
older chloroplasts. In addition, few starch grains could be observed within the six-day-
old chloroplasts. Chloroplasts from two- and four-week-old wild-type plants, however,
were fully mature, containing several starch grains and extensive granal stacking (Figures
4.4C and 4.4E). At all ages examined, chloroplasts from ppi3 mutant plants appeared
similar in structure to wild-type chloroplasts of the same ecotype (Figures 4.4B, 4.4D,
and 4.4F). ppi3 chloroplasts were approximately the same size and shape as wild-type
chloroplasts. Additionally, they contained about the same amount of thylakoid
membranes, granal stacking, and starch grain accumulation as did chloroplasts from wild-
type plants.

Endogenous levels of chloroplastic proteins present in wild-type and ppi3 mutant
plants were examined via immunoblotting. Three different tissue samples were analyzed:
total protein extract from two-week-old soil-grown plants, total protein extract from four-
week-old soil-grown plants, and total chloroplast protein from four-week-old plate-grown
plants. All three of these samples gave similar results. Representative data ﬁ'om the
chloroplast protein samples are shown in Figure 4.5. For all proteins tested, no

signiﬁcant differences in protein levels were observed between samples isolated from

132

Figure 4.4. Chloroplast ultrastructure in the ppi3 mutant line. Leaf tissue was
isolated from soil-grown wild-type (panels A, C, and E) and ppi3 (panels B, D, and F)
plants and prepared for transmission electron microscopy by the Center for Advanced
Microscopy, Michigan State University. Representative chloroplasts from six- day-old

(panels A and B), two-week-old anels C and D), and four-week-old (panels E and F)

plants are shown. Scale bar, 1 pm.

133

 

 

 

Figure 4.4

134

Figure 4.5. Endogenous levels of various chloroplastic proteins are not decreased in
the ppi3 mutant. Chloroplasts were isolated from four-week-old plate-grown wild-type
and ppi3 mutant seedlings. Total chloroplast protein equivalent to 10 pg chlorophyll was
separated by SDS-PAGE and analyzed by immunoblotting, using antibodies against the
proteins listed. Toc = translocon at the Quter envelope membrane of chloroplasts;

Tic = translocon at the inner envelope membrane of chloroplasts. The number following
the T00 or Tic designation refers to the molecular mass of the speciﬁed component.
Hsp93 = a stromal Hsp100 molecular chaperone; S78 = a stromal Hsp70 molecular
chaperone; AOS = allene oxide synthase, an enzyme in the jasmonic acid biosynthetic
pathway; F tle = a plastid division protein; IEP35 = an integral protein of the chloroplast
inner envelope membrane; BCCP = biotin carboxyl carrier protein, a protein involved in

lipid biosynthesis; PC = plastocyanin, a thylakoid lumen protein.

135

 

Toc75

TicllO

 

Hsp93

S78

Figure 4.5

 

I
h“. I.l .'.‘IL )LV ‘l _i-?. mun“: W.'df¥\wt'xrl‘. I 5,. M. “.~,r,‘ >n-v-H'9 .-
f ,. t
w e
, .
1' “ ..
.\ s
.. .
:i‘ I
g. .
x. _
t c l
‘* t
v . .

 

'1 I'J.u‘~.

 

. - .jé,

 

’5. '- . ”i ‘ -, '5 ‘ ‘ ”He,- '1'»? , ".41.?! .H’ tiff-29‘“

 

 

“ .. ‘ ‘ ._- . ; . - M
.‘ IL
.1 i
It
. (
' r
t.‘
.
I
L l

 

(a
<29.

   

'. \'.'-j 4. '3. ' . ‘1 :FT“: . ~,".?.‘t?ngﬁi‘." ‘. u}
Mexmamx‘mmgammﬂmzu—Iﬂ
'i I .
E
1':-
‘.‘ t
it '-
.;‘
t ..
I. ‘
1‘ . r
h. . r
'3“ .
l. -.
z. 2'
.h q.
Have.- urb-

 

 

 

I

-

fer-v.5

" 1.1 #1.; m- . .r': 7:

 

136

AOS

Fle

IEP35

BCCP

 

wild-type and ppi3 plants. Interestingly, the protein levels of several components of the
chloroplast protein import complex, including Toc75, Tic110, and Hsp93, appeared to be
unaffected by the loss of AtToc34 in ppi3 plants (Figure 4.5). Several other plastid-
localized proteins, representing a variety of metabolic pathways, including allene oxide
synthase (AOS; an enzyme in the jasmonic acid biosynthetic pathway), Ftle (a plastid
division protein), biotin carboxyl carrier protein (BCCP; a protein involved in fatty acid
biosynthesis), and plastocyanin (PC; a component of the chloroplastic electron transport
chain), also appeared to be present at normal levels within mutant chloroplasts (Figure
4.5).

A comparison of total protein proﬁles from wild-type and ppi3 mutant plants was
also conducted. The same three samples that were examined by immunoblotting were
subjected to Coomassie staining after separation by SDS-PAGE in order to determine
whether any major changes in total leaf or chloroplast protein composition could be
observed. As shown in Figure 4.6, no signiﬁcant differences between the protein proﬁles
of wild-type and ppi3 plants were detected for total protein extract from two-week-old
soil-grown plants or for total chloroplast protein from four-week-old plate-grown plants.
Total protein extract from four-week-old soil-grown plants gave similar results (data not
shown).

Toc34 has been established to be a component of the outer envelope membrane
import complex of pea chloroplasts (Kessler et al., 1994; Schnell et al., 1994; Seedorf et
al., 1995). It is assumed that AtToc34, a homolog of pea Toc34, is also a member of this
complex within Arabidopsis chloroplasts (Jarvis et al., 1998). Therefore, we attempted to

determine whether the loss of AtToc34 had any effect on the ability of ppi3 chloroplasts

137

Figure 4.6. Total protein proﬁles of wild-type and ppi3 mutant plants. Total leaf
protein from two-week-old soil-grown plants (wild-type and ppi3 mutant lines) was
extracted by boiling tissue samples in SDS and [i-mercaptoethanol. Protein extract
equivalent to equal amounts of starting fresh mass was separated by SDS-PAGE and
stained with Coomassie Brilliant Blue R250 (lanes 1 and 2). Intact chloroplasts were
isolated from four-week-old wild-type and ppi3 plants that had been grown on plates.
Total chloroplasts equivalent to 15 pg chlorophyll were separated by electrophoresis,

followed by staining with Coomassie Brilliant Blue R250 (lanes 3 and 4).

138

 

Figure 4.6

139

to import precursor proteins. Four different precursors were tested: (1) the precursor to
the small subunit of Rubisco (prSS), a stromal protein, (2) the precursor to the light
harvesting chlorophyll a/b binding protein (prLHCP), a thylakoid membrane protein
involved in photosynthesis, (3) the precursor to plastocyanin (prPC), a photosynthetic
protein located within the thylakoid lumen, and (4) a truncated version of the precursor to
Tic110 (tpl 10-1 10N), a component of the inner envelope membrane import complex.
Chloroplasts isolated from ppi3 mutant plants were able to import all of these precursors
within ten minutes during in vitro import assays (data not shown). Indeed, ppi3
chloroplasts could import these proteins at least as well as wild-type chloroplasts under
the same reaction conditions (Figure 4.7). In some cases, it appeared that ppi3
chloroplasts imported more of the tested precursor than did wild-type chloroplasts.
However, due to the variation in import efﬁciency observed between chloroplast samples
prepared on different days, it is not known whether any increase in import efﬁciency seen
for ppi3 chloroplasts is signiﬁcant.

Having determined that ppi3 chloroplasts were able to import a variety of
precursor proteins, we decided to examine in detail the import of one precursor, prSS,
into chloroplasts isolated from mutant plants. Speciﬁcally, we compared the rate of prSS
import into wild-type and ppi3 chloroplasts over the course of a twenty-minute in vitro
import assay. Chloroplasts isolated from wild-type plants were able to rapidly import
prSS (Figure 4.8). Processing of prSS to SS, an indication that the precursor has at least
partially entered the plastid stroma, could be observed at even very early time points.
Maximal levels of prSS import were seen within ten minutes. ppi3 chloroplasts were also

able to rapidly import prSS into the organelle (Figure 4.8). Overall, the rate of prSS

140

111.115. of. . Elfin-t

 

Figure 4.7. Chloroplasts isolated from ppi3 mutant plants are able to import
precursor proteins representing a variety of chloroplastic subcompartments. 358-
labeled prSS (precursor to the small subunit of Rubisco, a stromal protein), 35S-labeled
prLHCP (precursor to the light harvesting chlorophyll a/b binding protein, a thylakoid
membrane protein), 35S-labeled prPC (precursor to plastocyanin, a thylakoid lumen-
localized protein), and 35S-labeled tpl 10-1 10N (a truncated version of the precursor to
Ticl 10, an inner membrane-localized import component) were imported into chloroplasts
(25 pg chlorophyll) isolated from wild-type or ppi3 knockout mutant plants. Plants had
been plate-grown for approximately four weeks prior to chloroplast isolation. After ten
or twenty minutes at room temperature in the light, import was stopped, and intact
chloroplasts were recovered, by centrifuging the reactions through a 40% Percoll
cushion. Equivalent amounts of chlorophyll from each sample were analyzed by SDS-
PAGE and ﬂuorography. The amount of radiolabeled precursor proteins imported into
the chloroplasts was quantiﬁed using a phosphoimager. Values presented depict the
amount of precursor imported into ppi3 mutant chloroplasts as a percentage of the
amount imported into wild-type chloroplasts and are the average of at least two

independent experiments.

141

°/oWl‘

 

prSS prLHCP prPC tpl lO-l 10N

Figure 4.7

142

Figure 4.8. The rate of import of prSS into chloroplasts isolated from the ppi3
mutant line is not signiﬁcantly impaired. (A) 35S—labeled prSS (precursor to the small
subunit of Rubisco) was imported into chloroplasts isolated from wild-type or ppi3
mutant plants. Plants had been plate-grown for approximately four weeks prior to
chloroplast isolation. At the times indicated, aliquots equivalent to 25 pg chlorophyll
were removed from the import reactions. Import was stopped, and intact chloroplasts
were recovered, by centrifuging the aliquots through a 40% Percoll cushion. Equivalent
amounts of chlorophyll from each sample were analyzed by SDS-PAGE and
fluorography. TP = 1/ 10 volume of radioactive translation product added to each sample.
SS = mature form of prSS. (B) Results from panel A (wild type = square; ppi3 =
triangle) were quantiﬁed using a phosphoimager. Values depicted are the average of four

independent import reactions.

143

 

 

 

 

ppi3

mport achieved

%max

Figure 4.8

144

 

minutes

prSS

SS

 

 

import into chloroplasts isolated from ppi3 plants did not appear to lag signiﬁcantly
behind the rate of import into wild-type chloroplasts. On average, the rate into ppi3
chloroplasts was ~80% the rate observed for chloroplasts from wild-type plants, although
the variation observed between experiments indicates that this difference is not

signiﬁcant (Figure 4.88).

ppiI/ppi3 double homozygous mutants are not viable

Toc34 has two homologs in Arabidopsis: AtToc34 and AtToc33 (Jarvis et al.,
1998). A T-DNA insertional mutant line for AtToc33, known as ppiI, has been
described previously (Jarvis et al., 1998). Our collaborators at the University of Leicester
in England, Paul Jarvis and Ramesh Patel, crossed the knockout mutant line for AtToc34
described in this report, ppi3, with ppiI plants in order to determine the effect of
removing both isoforms of T0034 from Arabidopsis chloroplasts. F2 progeny from this
cross could be classiﬁed into one of three phenotypic classes: green individuals, which
appeared wild type in their coloration, pale individuals, which looked similar to ppiI
mutant plants, and bleached plants, which were extremely pale overall. A total of 985
green plants, 91 pale plants, and 96 bleached plants were observed in the F2 generation.

Our collaborators determined the genotype of several pale and bleached
individuals within the F2 generation by PCR analysis using both gene-speciﬁc primers
and primers to the T-DNA insert. All of the pale plants examined were homozygous for
an insert in the gene encoding AtTocB3, but did not contain a T-DNA insert within the
gene encoding AtToc34. Thus, these individuals were identical, genotypically and

phenotypically, to the ppil mutant line, which lacks AtToc33. Bleached individuals, on

145

the other hand, were homozygous for a T-DNA insert in the gene encoding AtToc33
(PPII) and hemizygous for an insert within the gene encoding AtToc34 (PPI3), having a
genotype of ppi I/ppi 1/PP13/ppi3 . These plants, consequently, were expressing only one
copy of the PPI3 gene, likely producing lower than the normal amount of AtToc34 and
no AtToc33. Accordingly, ppi I/ppi 1/PPI3/ppi3 plants were much smaller in size and
paler in color than either the ppiI or ppi3 knockout mutant lines (Figure 4.9). Assuming
that double homozygous mutants would not be found among the green individuals, these
results indicate that no ppi 1/ppi3 double homozygous mutants were present among the
1172 F2 progeny screened (X2 = 390.67, p = <0.001). Thus, it appears that removing
both AtToc33 and AtToc34 from Arabidopsis chloroplasts may be lethal.

Overall, the phenotypic results (985 green p1ants:91 pale plantsz96 bleached
plants) approximate a 10: 1:1 ratio (X2 = 0.62, p = >0.5). Since pale and bleached
individuals are both homozygous for an insert in PPII but differ in their insertion status
for PPI3, this would be the expected ratio if gametes containing a T-DNA insert within
both the PP]! gene and the PPI3 gene could be transmitted through either the male or the
female parent, but not both. In order to explore this possibility in more detail, our
collaborators analyzed siliques generated from the self-fertilization of
ppi I/ppi 1/PPI3/ppi3 plants. In contrast to siliques from self-fertilized wild-type
individuals, which contained many seeds, siliques from self-fertilized
ppi 1/ppi 1/PPI3/ppi3 plants contained very few seeds (Figure 4.10A). The scarcity of
seed within these mutant siliques apparently resulted, at least partially, from a failure of
ovules to develop into seeds (Figure 4.10B). While failed ovules were relatively rare in

wild-type siliques (two out of 201 ovules examined in two siliques), approximately half

146

Figure 4.9. Plants that are homozygous for a T-DNA insert in the gene encoding
AtToc33 and heterozygous for an insert in the gene encoding AtToc34 are much
smaller and paler than either ppi3 or ppiI mutant plants. Plants were grown on 1X
MS media, supplemented with 0.5% sucrose, in long days (16 hours light:8 hours dark).
Individual plants were photographed on the days indicated. The ppi3 knockout (KO)
mutant has a genotype of PPII/PPII/ppi3/ppi3; the ppil KO mutant has a genotype of

ppiI/ppiI/PPI3/PPI3. Images in this dissertation are presented in color.

147

 

 

ppi3 ppiI ppiI/ppil
KO mutant KO mutant PPI3/ppi3

9 days

21 days

 

Figure 4.9

148

Figure 4.10. Siliques of ppiI/ppiI/PPI3/ppi3 plants contain significantly more failed
ovules than do wild-type siliques. (A) Mature siliques from wild-type (left) and

ppi I/ppi 1/PPI3/ppi3 (right) plants that have been self-fertilized. The silique from a
ppz'I/ppi 1/PP13/ppi3 individual is shown at a higher magniﬁcation. (B) Close-up of a
silique from a ppiI/ppi 1/PPI3/ppi3 plant, showing a failed ovule (arrow). (C) Siliques
from wild-type and ppi I/ppi 1/PPI3/ppi3 plants were analyzed to determine the number of
ovules that had developed into seeds. Two wild-type siliques and ten siliques from

ppi I/ppi 1/PPI3/ppi3 individuals were examined. N = normal seed; FO = failed ovule;

AS = aborted seed. Images in this dissertation are presented in color.

149

 

ppiI/ppi] B ppiI/ppi]
WT PPI3/ppi3 PPI3/ppi3

 

ppiI/ppi]
PPI3/ppi3

%

   

N F0 AS

Figure 4.10

150

of the ovules in siliques from ppi I/ppi 1/PPI3/ppi3 individuals did not develop properly:
173 failed ovules were observed in ten siliques containing a total of 335 ovules (Figure
4.10C).

Reciprocal backcrosses to wild-type plants of the Columbia ecotype, using
ppi I/ppi 1/PPI3/ppi3 plants as either the male or the female parent, were performed to
determine which parent was unable to transmit gametes having a T-DNA insert within
the genes encoding both AtToc33 and AtToc34. 18 of 40 F1 progeny from a backcross
in which a ppi I/ppi 1/PP13/ppi3 individual was the female parent received a T-DNA
insert in both the PP]! and the PPI3 genes. However, no progeny, out of 45 screened,
received both inserts when a ppiI/ppi 1/PPI3/ppi3 plant was used as the male parent.
These results would suggest that AtToc33 and AtToc34 may be essential for the proper

development and/or function of the male gametophyte.

151

DISCUSSION

We have isolated a knockout mutant line, ppi3, for the gene encoding AtToc34,
one of the components of the outer envelope membrane protein import complex of
Arabidopsis chloroplasts (Kessler et al., 1994; Schnell et al., 1994; Seedorf et al., 1995;
Jarvis et al., 1998; Gutensohn et al., 2000). Overall, this mutant did not appear to be
signiﬁcantly altered when compared to wild-type plants of the same ecotype. Analysis of
visible phenotype, chloroplast ultrastructure, endogenous levels of plastid proteins, and in
vitro import of various precursors revealed no major differences between wild-type and
ppi3 plants (Figures 4.2-4.8). Thus, loss of AtToc34 function in the ppi3 mutant line did
not appear to have a signiﬁcant effect on the development of chloroplasts or the plant as a
whole.

The most likely explanation for these results is that AtToc33, a homolog of
AtToc34, is able to substitute for the loss of AtTOC34 expression in ppi3 mutant plants.
It has been determined that these two homologs perform similar, if not identical,
functions within Arabidopsis plants; both are able to complement the AtToc33 knockout
mutant line, ppi] (Jarvis et al., 1998). Thus, although the two homologs likely display
subtle differences in their individual functions, it is likely that AtToc33 could provide
functions normally carried out by AtToc34. In addition, because AtTOC33 is expressed
at higher levels than AtT 0C 34 throughout Arabidopsis development (Jarvis et al., 1998),
it is likely to be present at high enough levels to compensate for the absence of AtToc34
in ppi3 plants. However, it has also been reported that AtTOC34 and AtTOC33 are
differentially expressed within various organs of Arabidopsis (Gutensohn et al., 2000).

Thus, if the plastids of individual organs were analyzed in more detail, then more

152

signiﬁcant differences between the phenotypes of wild-type and ppi3 plants may be
observed, especially in those organs, such as roots, where expression of AtTOC34 is
normally higher than AtTOC33 expression (Gutensohn et al., 2000).

Antisense plants for AtToc34 have recently been generated (Gutensohn et al.,
2000). These plants appear similar to wild-type plants, except at very early stages of
development when they are slightly paler than the wild type (Gutensohn et al., 2000).
These results are similar to those we observed for the AtToc34 knockout mutant line,
with the exception of plants at four days of age. The visible phenotype of ppi3 plants was
indistinguishable from that of wild-type plants of the same ecotype at all ages examined
(Figure 4.2 and data not shown). Quantitation of chlorophyll concentration in wild-type
and mutant plants indicated that the ppi3 mutant contained chlorophyll levels similar to
those observed for wild-type plants throughout development (Figure 4.3). The reason for
the differences in phenotype between AtToc34 antisense and knockout mutant lines at
four days of age is unknown.

In this investigation, we attempted to construct double mutants between ppi3, the
AtToc34 knockout mutant line described in this report, and ppil, an AtToc33 knockout
mutant line (Jarvis et al., 1998). However, we were unable to recover any individuals
that were homozygous for T-DNA disruptions in the genes for both of these proteins. On
the other hand, we were able to obtain plants that were homozygous for a disruption in
the gene encoding AtToc33 and heterozygous for a disruption in the gene encoding
AtToc34. These plants have only one functional copy of a gene encoding a Toc34

homolog, speciﬁcally one for AtToc34, the lesser expressed of the two homologs.

153

Accordingly, this mutant has a more severe phenotype than either ppi3 or ppi] plants
alone (Figure 4.9).

Interestingly, there appears to be a progression in severity of phenotype as the
number of functional genes encoding Toc34 homologs is decreased. ppi] plants, which
have both copies of the gene encoding AtToc33 disrupted by a T-DNA insert, are small
and pale, especially early in their development (Jarvis et al., 1998). When one copy of
the gene encoding AtToc34 was subsequently disrupted, the resulting plants were even
smaller and paler (Figure 4.9). This phenotype was also no longer restricted to younger
tissues. Attempts to additionally disrupt the second copy of the gene for AtToc34,
producing ppi 1/ppi3 double homozygous mutants, have so far yielded no viable plants.
Thus, there is an absolute requirement for the function of the Toc34 homologs in
Arabidopsis plants. At this time, the minimum amount of Toc34 homologs needed for
normal development appears to be represented by the expression levels achieved by
having at least one functional copy of the gene encoding AtToc33, the more highly
expressed of the two Arabidopsis Toc34 homologs. ppi3 plants, which lack AtToc34
expression but have normal expression of AtToc33, were visually indistinguishable from
wild-type plants.

The inability to obtain ppi 1/ppi3 double homozygous mutant plants indicates that
the function provided by AtToc33 and AtToc34 is essential in Arabidopsis, possibly for
male gametophyte development and/or function in particular, as no transmission of
gametes containing a disruption in the genes for both AtToc33 and AtToc34 from the
male parent could be observed. Several components of the mitochondrial protein import

machinery have been found to be essential for yeast grth (Pfanner et al., 1997). These

154

subunits are considered to be part of a core protein import complex, the minimum set of
factors required for precursor transport (Baker and Schatz, 1991; Pfanner et al., 1997).
Thus, AtToc33/AtToc34 may be a subunit of the core import complex required for the
movement of proteins into chloroplasts, or possibly plastids in general.

Current hypotheses concerning AtToc33/AtToc34 function suggest that these
proteins play a regulatory role during precursor import (Kessler et al., 1994; Seedorf et
al., 1995). Their ﬁrnction is probably controlled by their GTP-binding and hydrolysis
abilities, as indicated by the ﬁnding that crosslinking between pea Toc34 and an
incoming precursor protein can only be observed in the absence of added nucleotides
(Kouranov and Schnell, 1997). The essential nature of AtToc33/AtToc34 in Arabidopsis
would argue that if AtToc33/AtToc34 are indeed regulating an aspect of precursor
import, they are more likely affecting an essential process, such as channel formation,
rather than simply modulating the efﬁciency of transport. Alternatively,
AtToc33/AtToc34 may be controlling the transfer of precursor proteins from a receptor
component to the protein-conducting channel (Kessler et al., 1994; Seedorf et al., 1995).
A recent report suggesting that the receptor for precursor proteins, ToclS9, actually binds
preproteins in the cytoplasm and subsequently inserts with the bound precursor into the
chloroplast outer envelope membrane presents an interesting possibility (Hiltbrunner et
al., 2001). It is possible that AtToc33/AtToc34 function is required for the recognition of
the Toc159-precursor complex at the chloroplast surface and/or for its insertion into the
membrane, either of which would likely be essential processes (Hiltbrunner et al., 2001).

The development of the knockout mutant line for AtToc34 described in this

report, along with the AtToc33 knockout line (Jarvis et al., 1998) and the antisense lines

155

for both AtToc34 and AtToc33 (Gutensohn et al., 2000) that are already available, should
provide useful tools in the future for exploring hypotheses regarding the role of
AtToc33/AtToc34 during precursor transport into chloroplasts. In particular, the function
of the GTP-binding domains of AtToc33 and AtToc34 in the import process should be

investigated in more detail.

156

REFERENCES

Akita M, Nielsen E, Keegstra K (1997) Identiﬁcation of protein transport complexes in

the chloroplastic envelope membranes via chemical cross-linking. J Cell Biol 136: 983-
994

Arnon D1 (1949) Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta
vulgaris. Plant Physiol 24: l-15

Baker KP, Schatz G (1991) Mitochondrial proteins essential for viability mediate protein
import into yeast mitochondria. Nature 349: 205-208

Bauer J, Chen K, Hiltbunner A, Wehrli E, Eugster M, Schnell D, Kessler F (2000) The
major protein import receptor of plastids is essential for chloroplast biogenesis. Nature
403: 203-207

Bauerle C, Keegstra K (1991) Full-length plastocyanin precursor is translocated across
isolated thylakoid membranes. J Biol Chem 266: 5876-5883

Bruce BD, Perry S, Froehlich J, Keegstra K (1994) In vitro import of proteins into
chloroplasts. Plant Mol Biol Manual J1: 1-15

Chen X, Schnell DJ (1999) Protein import into chloroplasts. Trends Cell Biol 9: 222-227

Edwards K, J ohnstone C, Thompson C (1991) A simple and rapid method for the
preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res 19: 1349

Fitzpatrick LM, Keegstra K (2001) A method for isolating a high yield of Arabidopsis
chloroplasts capable of efﬁcient import of precursor proteins. Plant J 27: 59-65

Gutensohn M, Schulz B, Nicolay P, Fliigge U-I (2000) Functional analysis of the two
Arabidopsis homologues of Toc34, a component of the chloroplast protein import
apparatus. Plant J 23: 771-783

Hiltbrunner A, Bauer J, Vidi P-A, Infanger S, Weibel P, Hohwy M, Kessler F (2001)
Targeting of an abundant cytosolic form of the protein import receptor atToclS9 to the
outer chloroplast membrane. J Cell Biol 154: 309-316

Hirsch S, Muckel E, Heemeyer F, von Heijne G, Soll J (1994) A receptor component of
the chloroplast protein translocation machinery. Science 266: 1989-1992

Howe GA, Lee GI, Itoh A, Li L, DeRocher AE (2000) Cytochrome P450-dependent

metabolism of oxylipins in tomato. Cloning and expression of allene oxide synthase and
fatty acid hydroperoxide lyase. Plant Physiol 123: 711-724

157

Jarvis P, Chen L-J, Li H-M, Peto CA, F ankhauser C, Chory J (1998) An Arabidopsis
mutant defective in the plastid general protein import apparatus. Science 282: 100-103

Keegstra K, Cline K (1999) Protein import and routing systems of chloroplasts. Plant
Cell 11: 557-570

Keegstra K, Froehlich J E (1999) Protein import into chloroplasts. Curr Opin Plant Biol
2: 471-476

Kessler F, Blobel G, Patel HA, Schnell DJ (1994) Identiﬁcation of two GTP-binding
proteins in the chloroplast protein import machinery. Science 266: 1035-1039

Kouranov A, Chen X, Fuks B, Schnell DJ (1998) TicZO and Tic22 are new components
of the protein import apparatus at the chloroplast inner envelope membrane. J Cell Biol
143: 991-1002

Kouranov A, Schnell DJ (1997) Analysis of the interactions of preproteins with the
import machinery over the course of protein import into chloroplasts. J Cell Biol 139:
1677-1685

Krysan PJ, Young JC, Sussman MR (1999) T-DNA as an insertional mutagen in
Arabidopsis. Plant Cell 11: 2283-2290

Krysan PJ, Young JC, Tax F, Sussman MR (1996) Identiﬁcation of transferred DNA
insertions within Arabidopsis genes involved in signal transduction and ion transport.
Proc Natl Acad Sci USA 93: 8145-8150

Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227: 680-685

Liibeck J, Heins L, Soll J (1997) A nuclear-coded chloroplastic inner envelope membrane
protein uses a soluble sorting intermediate upon import into the organelle. J Cell Biol
137: 1279-1286

Ma Y, Kouranov A, LaSala SE, Schnell DJ (1996) Two components of the chloroplast
protein import apparatus, IAP86 and IAP75, interact with the transit sequence during the
recognition and translocation of precursor proteins at the outer envelope. J Cell Biol 134:

315-327

May T, Soll J (1999) Chloroplast precursor protein translocon. FEBS Lett 452: 52-56
Nielsen E, Akita M, Davila-Aponte J, Keegstra K (1997) Stable association of
chloroplastic precursors with protein translocation complexes that contain proteins from

both envelope membranes and a stromal Hsp100 molecular chaperone. EMBO J 16: 935-
946

158

Olsen LJ, Keegstra K ( 1992) The binding of precursor proteins to chloroplasts requires
nucleoside triphosphates in the interrnembrane space. J Biol Chem 267: 433-439

Perry SE, Keegstra K (1994) Envelope membrane proteins that interact with chloroplastic
precursor proteins. Plant Cell 6: 93-105

Pfanner N, Craig EA, Honlinger A (1997) Mitochondrial preprotein translocase. Annu
Rev Cell Dev Biol 13: 25-51

Schleiff E, Soll J (2000) Travelling of proteins through membranes: translocation into
chloroplasts. Planta 211: 449-456

Schnell DJ, Kessler F, Blobel G (1994) Isolation of components of the chloroplast protein
import machinery. Science 266: 1007-1012

Seedorf M, Waegemann K, Soll J (1995) A constituent of the chloroplast import complex
represents a new type of GTP-binding protein. Plant J 7: 401-411

Stokes KD, McAndrew RS, Figueroa R, Vitha S, Osteryoung KW (2000) Chloroplast
division and morphology are differentially affected by overexpression of F ml] and F tsZZ
genes in Arabidopsis. Plant Physiol 124: 1668-1677

Tranel PJ, Froehlich J, Goyal A, Keegstra K (1995) A component of the chloroplastic
protein import apparatus is targeted to the outer envelope membrane via a novel pathway.
EMBO J 14: 2436-2446

Vothknecht UC, Soll J (2000) Protein import: the hitchhikers guide into chloroplasts.
Biol Chem 381: 887-897

Young ME, Keegstra K, Froehlich J E (1999) GTP promotes the formation of early-

import intermediates but is not required during the translocation step of protein import
into chloroplasts. Plant Physiol 121: 237-243

159

CHAPTER 5

An Hsp100 chaperone is required for normal chloroplast development

and function in Arabidopsis

160

ABSTRACT

Molecular chaperones are required for the posttranslational import of proteins into
mitochondria and the ER, providing the driving force for the translocation of precursor
proteins into the organelle. In the chloroplast protein import system, an Hsp100 protein,
known as Hsp93, is hypothesized to be the factor providing the energy for precursor
movement, although there is little direct evidence for this hypothesis. In order to learn
more about the possible function of Hsp93 during protein import into chloroplasts, we
isolated a knockout mutant line that has both copies of AtHSP93— V, which encodes one of
the two Arabidopsis homologs of Hsp93, disrupted by a T-DNA insert. Mutant plants are
much smaller and paler than wild-type plants. In addition, mutant chloroplasts contain
less thylakoid membrane when compared to the wild type. Plastid protein composition,
however, seems to be largely unaffected in AtHsp93-V knockout plants. Chloroplasts
isolated from the AtHsp93-V knockout mutant line are still able to import a variety of
precursor proteins, but the rate of import of some of these precursors appears to be
signiﬁcantly impaired. These results indicate that AtHsp93-V has an important, but not

essential, role in Arabidopsis chloroplasts.

161

INTRODUCTION

The vast majority of plastid proteins are encoded within the nucleus, rather than in
the plastid genome. As a consequence, these proteins must be imported into the organelle
following their synthesis on cytoplasmic ribosomes (Chen and Schnell, 1999; Keegstra
and Cline, 1999; Keegstra and Froehlich, 1999; May and Soll, 1999; Schleiff and S011,
2000; Vothknecht and 8011, 2000). The process of plastid protein import has been studied
extensively using isolated pea chloroplasts as a model system. From these studies, it has
been determined that protein import is mediated by a proteinaceous transport machinery
located within the two membranes of the chloroplast envelope (Chen and Schnell, 1999;
Keegstra and Cline, 1999; Keegstra and Froehlich, 1999; May and Soll, 1999; Schleiff
and Soll, 2000; Vothknecht and S011, 2000).

The energy for precursor protein translocation is provided by ATP hydrolysis
within the chloroplast stroma (Theg et al., 1989). ATP hydrolysis has also been
implicated in providing the driving force for the posttranslational import of proteins into
the endoplasmic reticulum (ER) and mitochondria (Rapoport et al., 1999; Herrmann and
Neupert, 2000). The major factors mediating ATP hydrolysis in the ER and
mitochondrial protein transport systems are heat shock protein 705 (Hsp70s; Jensen and
Johnson, 1999; Pilon and Schekman, 1999; Strub et al., 2000). Thus, it was believed that
a stromal Hsp70 would be found to drive protein translocation into chloroplasts as well.
However, when isolated import complexes from pea chloroplasts were probed for the
presence of stromal molecular chaperones, a member of the Hsp100 family of chaperones

was found instead (Akita et al., 1997; Nielsen etal., 1997; Kouranov et al., 1998).

162

Hsp100 proteins (also known as Clp [gaseinolytic protease] proteins) are a diverse
class of molecular chaperones involved in a wide variety of essential metabolic processes
throughout prokaryotic and eukaryotic phylogenies (Schirmer et al., 1996). They were
ﬁrst identiﬁed as the regulatory component of the Clp proteolytic complex in Escherichia
coli (Hwang et al., 1987; Katayama et al., 1988). Subsequently, they have been found to
be involved in regulating the DNA-binding activity of several proteins (Mhammedi-
Alaoui etal., 1994; Wickner et al., 1994; Lazazzera and Grossman, 1997) and in
providing tolerance to a variety of environmental stresses, including heat (Sanchez and
Lindquist, 1990; Squires et al., 1991) and salt (Kriiger etal., 1994), among other
functions. In general, Hsp100 proteins operate by disassembling protein aggregates or
oligomers via the energy provided by ATP hydrolysis (Schirmer et al., 1996).

Two classes of Hsp100 proteins exist. HspIOOS of the ClpA, ClpB, ClpC, ClpD,
and ClpE subfamilies are Class 1 proteins (Schirmer et al., 1996; Derré et al., 1999).
These proteins have two ATP-binding domains within their amino acid sequences
(Schirmer et al., 1996). Higher plants contain homologs of the ClpB, ClpC, and ClpD
subfamilies (Schirmer et al., 1996). The plant ClpB proteins are primarily cytoplasmic
(Boston et al., 1996) while the plant ClpC and ClpD homologs are found within
chloroplasts (Moore and Keegstra, 1993; Shanklin et al., 1995; Boston et al., 1996;
Nakashima et al., 1997; Nakabayashi et al., 1999). The molecular chaperone that was
found in association with the pea chloroplastic protein import apparatus is a member of
the ClpC subfamily and is known as Hsp93, reﬂecting its calculated molecular mass of
93 kD for the mature form of the protein (Akita et al., 1997; Nielsen et al., 1997;

Kouranov et al., 1998; M. Akita and K. Keegstra, submitted). While the majority of

163

Hsp93 molecules are present in soluble form in the chloroplast stroma, a signiﬁcant
proportion of Hsp93 proteins are found in association with the inner envelope membrane,
presumably through their interaction with the import complex (Moore and Keegstra,
1993; Nielsen, 1997; M. Akita and K. Keegstra, submitted). A similar situation exists for
the mitochondrial import-associated Hsp70 chaperone, which is mostly soluble in the
matrix, but can be found in a membrane-bound form via an interaction with the inner
membrane import complex component, Tim44 (Pfanner et al., 1997; Herrmann and
Neupert, 2000).

Hsp93 was found to be a component of chloroplastic import complexes regardless
of whether precursor proteins were also present (Nielsen et al., 1997; Kouranov etal.,
1998). Several lines of evidence indicate that this association of Hsp93 with isolated
import complexes is relevant to the process of precursor transport. First, Hsp93
coimmunoprecipitates the precursor to the small subunit of Rubisco (prSS) only under
conditions that support either binding or translocation of the preprotein (Nielsen et al.,
1997). Secondly, Hsp93 is able to coimmunoprecipitate several precursor proteins that
utilize the general import apparatus of the chloroplast envelope but not plastid proteins
that do not use this import machinery (Nielsen et al., 1997). The association of Hsp93
with prSS is disrupted by the addition of ATP, but not GTP, to an import reaction
(Nielsen et al., 1997). Because Hsp100 chaperones interact with their substrates in an
ATP-sensitive manner (W ickner et al., 1994; Wawrzynow et al., 1995), this ATP-
dependence suggests that the association between Hsp93 and prSS is physiologically
relevant (Nielsen etal., 1997). Finally, the interaction between Hsp93 and prSS

decreases with time during an import reaction (Nielsen et al., 1997). This observation

164

indicates that prSS proteins associated with Hsp93 are functional import intermediates
(Nielsen et al., 1997).

Arabidopsis thaliana has two Hsp93 (ClpC) homologs, which we have designated
AtHsp93-V and AtHsp93-III according to the chromosomal locations of the genes
encoding the proteins, that are ~8 8% identical to one another at the amino acid level (see
Chapter 3). Both homologs contain predicted chloroplastic transit peptides at their N-
terrnini, and antibodies made against AtHsp93-III recognize a protein localized to the
chloroplast stroma (N akabayashi et al., 1999). RNA and protein levels for AtHsp93-III,
and ClpC homologs in other species, have been shown to be relatively stable under a
variety of environmental conditions (Shanklin et al., 1995 ; Clarke and Eriksson, 1996;
Ostersetzer and Adam, 1996; Nakabayashi et al., 1999). This has led to the hypothesis
that the ClpC protein in plants may play a housekeeping role within chloroplasts
(Shanklin et al., 1995; Nakabayashi etal., 1999).

In order to learn more about the possible role of Hsp93 during protein import into
chloroplasts, we utilized the reverse genetic resources now available for Arabidopsis to
study this protein genetically. At the time this study was undertaken, the genomic
sequence of AtHSP93- V was available while that of AtHSP93-III was still unknown.
Thus, we were able to obtain a knockout mutant line that had both copies of the gene for
AtHsp93-V disrupted by a T-DNA insert. Characterization of the visible and
chloroplastic phenotype of this AtHsp93-V knockout mutant line is described in this

report.

165

MATERIALS AND METHODS

Plant material

Wild-type Arabidopsis thaliana plants used in this study were of the
Wassilewskija (Ws) ecotype. AtHsp93-V knockout mutant plants were in the Ws
background. For soil-grown plants, seeds were surface-sterilized in 30% (v/v) bleach for
30 minutes, washed three times with water, and imbibed overnight at 4°C before being
sown on soil. Plants were then grown in 12-hour days (12 hours light: 12 hours dark) at
20°C. For plate-grown seedlings, seeds were surface-sterilized in 30% bleach (v/v),
0.02% (v/v) Triton-X 100 for 30 minutes, washed three times with water, and imbibed
overnight at 4°C. After imbibition, seeds were plated on 1X MS salt and vitamin mixture
(Gibco BRL, Grand Island, New York, USA), 1% (w/v) sucrose, 0.8% (w/v) phytagar
(Gibco BRL, Grand Island, New York, USA) and incubated in long days (16 hours

light:8 hours dark) at 22°C.

Screening of a T-DNA mutagenized Arabidopsis population

A T—DNA mutagenized Arabidopsis population, containing a total of 60,480
mutagenized lines, was screened. This population is available at the Arabidopsis
Functional Genomics Consortium Arabidopsis Knockout Facility at the University of
Wisconsin-Madison (Krysan et al., 1999). A PCR-based screening strategy was
employed, as described previously (Krysan et al., 1996; Krysan et al., 1999). The
following PCR primers were utilized: AtHSP93-V 5’, attcggattcttcgttggtttctgttgtt;
AtHSP93- V 3 ’, tctgccatactatcctctaaaagcctcat; T-DNA left border, cattttataataacgctgcggac-

atctac. The location of the T-DNA insert within or near the coding region for AtHsp93-V

166

was determined by sequencing PCR products produced from positive hits detected in the
screening reactions. After a single line containing a T-DNA insert within the coding
region for AtHsp93-V was identiﬁed, plants homozygous for the insertion were made and
used for further study. The homozygous state of the T-DNA insert was conﬁrmed by the
inability of the AtHSP93- V 5’ and AtHSP93- V 3 ’ primers to produce a product when used

in combination on genomic DNA isolated from the mutant line.

mRNA isolation and RT -PCR

Extraction buffer (5 mL; 2% [w/v] hexadecyltrimethylammonium bromide, 2%
[w/v] polyvinylpyrrolidone K 30, 100 mM Tris-HCl [pH 8.0], 25 mM EDTA, 2 M NaCl,
0.5 g/L sperrnidine, 2% [v/v] B-mercaptoethanol) was warmed to 650C in a centrifuge
tube. Ground tissue (~1 g) from four-week-old soil-grown wild-type or AtHsp93-V
mutant plants was added, and the tube was vortexed. The solution was extracted twice
with an equal volume of chloroform. The upper phase was then precipitated overnight at
4°C with one-quarter volume 10 M LiCl. The pellet was recovered by centrifugation at
~6000 g for 20 minutes and resuspended in 1.5 mL 10 mM Tris-HCl (pH 7.5), 1 mM
EDTA, 0.5% SDS. This solution was then extracted once in an equal volume of
phenolzchloroform:isoamyl-alcohol (25:24: 1). The upper phase was precipitated
overnight at 4°C with one-quarter volume 10 M LiCl, and the pellet was recovered by
centrifugation at ~6000 g for 20 minutes. The pellet was then resuspended in 400 pL
distilled water and reprecipitated by the addition of one-tenth volume sodium acetate and
2.5 volumes 100% ethanol. The ﬁnal pellet was recovered by centrifugation at ~6000 g

for 15 minutes and resuspended in 100 pL distilled water. Total RNA was then

167

quantitated. ~150 pg of each total RNA sample was used to isolate mRNA using the
PolyATract mRNA Isolation System (Promega, Madison, Wisconsin, USA).

RT-PCR was done using the Titan One Tube RT-PCR System (Roche Molecular
Biochemicals, Mannheim, Germany). 10 pL of mRNA from wild-type or AtHsp93-V
knockout mutant plants was used as the template. The following primers speciﬁc for
AtHSP93-Vwere used: 5’ forward, tcggtgaaaatgatgtgtagtc; 5’ reverse, gggttgttcttggttctcc-
tg; 3’ forward, attgaaaaagcccatcca; 3’ reverse, tgccacttccaccatttag. Primers speciﬁc for
AtHSP93—III were also employed: forward, gggcccccagtgcattagattatt; reverse, tccaagacac-

gagctgccacac.

Chlorophyll isolation and quantitation

Whole wild-type or AtHsp93-V knockout mutant plants at four, seven, eleven,
fourteen, seventeen, or twenty days after planting were weighed and then ground with
sand in 80% acetone. Ground tissue was spun at ~2000 g for 5 minutes to remove the
sand and other debris from the extracted chlorophyll. The supernatant was then
spectrophotometrically measured at 645 nm and 663 nm. Each sample was measured
twice at these two wavelengths. The amount of chlorophyll (pg/mL) in each sample was

determined using the equation given in Arnon (1949).

Transmission electron microscopy
Leaf tissue isolated from soil-grown wild-type and AtHsp93-V knockout mutant
plants at six days, two weeks, or four weeks after planting was ﬁxed, under vacuum, for

90 minutes at room temperature in 2% paraformaldehyde, 2.5% glutaraldehyde, 0.1 M

168

sodium phosphate (pH 7.4). Fixation was then continued for an additional 24 hours at
4°C, followed by a second ﬁxation in 1% osmium tetroxide, 0.1 M sodium phosphate
(pH 7.4) for two hours. After the second ﬁxation, samples were dehydrated in acetone,
embedded in Spurr resin, and sectioned. The thin sections (~70 nm) were stained with
uranium and lead prior to examination in a JEOL 100CX electron microscope (JEOL
USA, Peabody, Massachusetts, USA). This work was performed by the Center for

Advanced Microscopy, Michigan State University.

Protein extraction and immunoblotting

Whole two-week-old or four-week-old wild-type or AtHsp93-V knockout plants
grown on soil were ground and then extracted in 0.15 M Tris-HCl (pH 6.8), 7.5% B-
mercaptoethanol, 3% SDS, 0.2 mM phenylmethylsulfonyl ﬂuoride (PMSF) for ﬁve
minutes at 1000C. Following centrifugation at ~20,000 g for 20 minutes to pellet
insoluble material, the soluble extract was used for further study.

SDS-PAGE was performed as described previously (Laemmli, 1970).
Chloroplast protein samples were loaded according to equal amounts of total chlorophyll;
total protein extracts were loaded on the basis of equal amounts of starting tissue ﬁ'esh
weight. After separation by SDS-PAGE, the proteins were either stained with Coomassie
Brilliant Blue R250 or transferred overnight to Immobilon-P PVDF membranes
(Millipore, Bedford, Massachusetts, USA). Membranes were incubated in blocking
buffer (0.1% TBS, 1% Tween 20, 5% non-fat dry milk) for 30 minutes, followed by
incubation in 0.1% TBS, 1% Tween 20, 1% non-fat dry milk supplemented with

antiserum. Washings were done in 0.1% TBS, 1% Tween 20. Primary antibody, against

169

all proteins examined except biotin carboxyl carrier protein (BCCP) and plastocyanin
(PC), was detected with horseradish peroxidase-conjugated goat anti-rabbit antibodies
(Kirkegaard and Perry Laboratories, Gaithersburg, Maryland, USA). Secondary antibody
was visualized with the SuperSignal West Pico Chemiluminescent Substrate (Pierce,
Rockford, Illinois, USA). Primary antibody against PC was detected with alkaline
phosphatase-conjugated goat anti-chicken antibodies; anti-biotin antibodies directly
conjugated to alkaline phosphatase (Kirkegaard and Perry Laboratories, Gaithersburg,
Maryland, USA) were used to detect BCCP. These antibodies were then visualized using
nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate.

Antibodies to Toc75 were raised as described by Tranel et al. (1995). Antibodies
against Tic110 were generated as discussed by Akita et al. (1997). Antibodies to Hsp93
were made as described by Akita and Keegstra (submitted). Antiserum to S78 was made
as discussed in Nielsen et al. (1997). Antiserum against Tic22 and IEP35 was a gilt from
D. Schnell (Schnell et al., 1994; Kouranov et al., 1998). Antiserum to allene oxide
synthase (AOS) was a gilt from G. Howe (Howe et al., 2000). Antibodies against Ftle
were a gift ﬁom K. Osteryoung (Stokes et al., 2000). The generation of antiserum

against Tic40 is discussed elsewhere (L. Fitzpatrick et al., manuscript in preparation).

Isolation of chloroplasts

Chloroplasts were isolated from four-week-old Arabidopsis plants that had been
grown on plates, as described previously (Fitzpatrick and Keegstra, 2001). Final
resuspension of chloroplasts, at a concentration of 1 mg chlorophyll/mL, was in import

buffer (330 mM sorbitol, 50 mM HEPES-KOH, pH 8.0).

170

In vitro import assays

Precursor proteins used in this investigation were prSS ﬁ'om pea, the precursor to
the light harvesting chlorophyll a/b binding protein (prLHCP) from pea, the precursor to
plastocyanin (prPC) from Silene pratensis, and a truncated version of the precursor to
Ticl 10 (tp110-110N) from pea (Bauerle and Keegstra, 1991; Liibeck et al., 1997). All
precursors were made using the TNT®-coupled transcription and translation system
(Promega, Madison, Wisconsin, USA) containing 35S-methionine and either SP6 RNA
polymerase (prSS, prLHCP, and prPC) or T7 RNA polymerase (tp110-110N).

Import reactions were performed essentially as described previously (Bruce et al.,
1994). In brief, chloroplasts (25 pg chlorophyll) were incubated with radiolabeled
precursor in 150 pL import buffer (330 mM sorbitol, 50 mM HEPES-KOH, pH 8.0)
supplemented with 4 mM ATP. Import was halted, at the times indicated in the ﬁgures,
by sedimenting intact chloroplasts through a 40% (v/v) Percoll cushion. Pellets were
then resuspended in SDS-PAGE sample buffer and analyzed by electrophoresis and
ﬂuorography. Quantiﬁcation of the amount of radiolabeled precursor imported was done
using a phosphoimager (Molecular Imager FX, Bio-Rad, Hercules, California, USA).
Import rates were determined by measuring the slope of the line generated when time
after reaction initiation versus % maximum level of import achieved was plotted (see

Figure 5.8).

171

RESULTS

AtHsp93- V knockout mutant plants are much smaller and paler than wild-type plants

Molecular chaperones are essential for posttranslational protein import into
mitochondria and the ER, providing, among other functions, the driving force for the
movement of precursor proteins into the organelle interior (Jensen and Johnson, 1999;
Pilon and Schekman, 1999; Rapoport et al., 1999; Herrmann and Neupert, 2000; Strub et
al., 2000). In chloroplast protein import, most of the evidence currently points to Hsp93,
a stromal Hsp100 protein, as the molecular chaperone assisting in “pulling in” incoming
precursors (Akita et al., 1997; Nielsen et al., 1997; Kouranov et al., 1998). However,
there is no direct experimental evidence to support this hypothesis. In order to learn more
about the function of Hsp93 during protein import into plastids, we isolated a knockout
mutant line that has a T-DNA inserted into both copies of the gene encoding AtHsp93-V,
one of the two Hsp93 homologs present in Arabidopsis chloroplasts. This mutant was
obtained from a T-DNA mutagenized Arabidopsis population, containing 60,480
mutagenized lines, administered by the Arabidopsis Functional Genomics Consortium at
the University of Wisconsin-Madison (Krysan etal., 1999). Using an established PCR
screening strategy (Krysan et al., 1996; Krysan et al., 1999), this population was screened
using AtHSP93- V gene-speciﬁc primers in combination with a primer to the T-DNA left
border. Three T-DNA inserts within or near the coding region for AtHsp93-V were
detected. Two were more than three kilobases downstream of the stop codon.
Consequently, it was concluded that these two inserts would have no effect on the
expression of the AtHSP93- V gene. The third insert that was found was located within

the coding region for AtHsp93-V, making it likely that this T-DNA insert would result in

172

a disruption of AtHSP93- V expression. As a consequence, this mutant line was chosen
for further study.

The T-DNA insert in the knockout mutant line was located within the last exon of
the AtHSP93— V gene (Figure 5.1A). The presence of this insert resulted in a truncated
mRNA being produced from the AtHSP93- V gene (Figure 5.1B). Primers speciﬁc to the
5’ end of AtHSP93- Vwere able to amplify a product from mRN A isolated from mutant
plants, but primers speciﬁc to the 3’ end of the gene were not. Thus, accumulation of the
full-length mRNA for AtHSP93- V is abolished in the mutant line. The gene encoding
AtHsp93-III, a homolog of AtHsp93-V, was still expressed in mutant plants (Figure
5.1C). Because AtHsp93-V and AtHsp93-III are almost 90% identical to one another at
the amino acid level, it is unlikely that antibodies generated against the whole protein,
such as those used in this study, would be speciﬁc. Thus, when either total protein
extract or chloroplast protein from four-week-old AtHsp93-V knockout plants was
probed for the presence of Hsp93 proteins, an immunoreactive band was detected (Figure
5. 1 D). The overall amount of Hsp93 proteins did appear to be slightly reduced in the
mutant, however. Interestingly, a smaller immunoreactive band, approximately 32 kD in
size, was detectable in protein isolated from the mutant line but not in protein from the
wild type. Thus, as is suggested by the RT-PCR results, it is likely that a truncated
version of AtHsp93 -V is in fact being produced in the knockout plants. This truncated
version would likely not be functional, however, because the protein would lack several
important regions of AtHsp93 -V, including the second nucleotide-binding domain.
Similar results were obtained when total protein extract from two-week-old plants was

probed with antibodies against Hsp93 proteins (data not shown).

173

Figure 5.1. AtHsp93-V knockout mutant plants express a truncated mRNA from
the AtHSP93-Vgene and may produce a truncated AtHsp93-V protein.

(A) Schematic depicting the structure of the AtHSP93- V gene. Exons are represented by
ﬁlled boxes; introns are symbolized by thin lines. The approximate location of the
T-DNA insert within the AtHSP93- V gene in the knockout mutant line is indicated.

(B) RT-PCR analysis for the gene encoding AtHsp93-V. Primers speciﬁc to the 5’ end of
the AtHSP93- V gene, upstream of the T-DNA insert (lanes 1 and 2), or the 3’ end of the
gene, downstream of the T-DNA insert (lanes 3 and 4), were used on mRNA isolated
from wild-type and AtHsp93-V knockout (KO) mutant plants. (C) RT-PCR analysis for
the gene encoding AtHsp93-III, using mRNA isolated from either wild-type or
AtHsp93-V mutant plants as a template. (D) Immunoblot analysis for Hsp93 proteins.
Total leaf protein from four-week-old soil-grown plants (wild type [lane 1] and
AtHsp93-V knockout [KO] mutant [lane 2] lines) was extracted by boiling tissue samples
in SDS and B—mercaptoethanol. Protein extract equivalent to equal amounts of starting
fresh mass was separated by SDS-PAGE and analyzed by immunoblotting with
antibodies to Hsp93 proteins. Intact chloroplasts were isolated from four-week-old wild-
type (lane 3) and AtHsp93-V mutant (lane 4) plants that had been grown on plates. Total
chloroplasts equivalent to 10 pg chlorophyll were separated by electrophoresis and
immunoblotted with antiserum against Hsp93 proteins. A possible truncated protein

produced by the AtHSP93- V gene in mutant plants is indicated (*).

174

 

 

 

A from

settled:

"the

c 5' alt

nd oft:

elated

this it

{01615-

16 33395

.old “If

res. W“

01511

 

   

AtHSP93-V
B AtHsp93-V AtHsp93-V
WT KO WT KO
AtHSP93- V ‘
C AtHsp93-V

WT KO

AtHSP93—III “ “

 

   

Figure 5.1

175

AtHsp93-V mutant plants were much smaller and paler than wild-type plants of
the same ecotype (Figure 5.2). These differences could be observed throughout
development, although the size difference in very young seedlings was minor (data not
shown). As the plants grew, however, the disparity in size between wild-type and mutant
seedlings became more pronounced and was quite apparent by two weeks after planting
(compare Figures 5.2A and 5.28). Despite the alterations in overall size and color,
AtHsp93-V mutant plants appeared to reach major developmental milestones, such as the
emergence of ﬂower buds and bolting, at approximately the same age as did wild-type
plants (compare Figures 5.2C, 5.2D, 5.2E, and 5.2F).

We quantiﬁed the chlorophyll levels present in wild-type and AtHsp93-V mutant
plants at various ages (Figure 5.3A). Average chlorophyll levels for the wild type ranged
from ~1.5 mg chlorophyll/g fresh weight during the ﬁrst ten days after planting to ~10
mg chlorophyll/g fresh weight at later ages. Chlorophyll levels in the AtHsp93-V
knockout mutant line were signiﬁcantly lower. Average values were between ~0.6 and
~0.8 mg chlorophyll/g fresh weight at all ages tested. Overall, the AtHsp93-V mutant
plants had ~50-60% of the chlorophyll levels, on a per gram fresh weight basis, observed

for wild-type plants throughout development (Figure 5.33).

Chloroplast structure and composition in the AtHsp93- V knockout mutant line
Disruption of both copies of the AtHSP93-V gene by a T-DNA insert resulted in a

signiﬁcant reduction in overall chlorophyll levels in mutant plants. These plants,

therefore, could possibly have other aspects of chloroplast physiology altered as well. In

order to examine this possibility in more detail, transmission electron microscopy was

176

Figure 5.2. AtHsp93-V knockout mutant plants are much smaller and paler than
wild-type plants. Wild-type (panels A, C, and E) and AtHsp93-V knockout mutant
(panels B, D, and F) plants were grown on soil in 12-hour days (12 hours light: 12 hours
dark). Individual plants were photographed at two weeks (panels A and B), three weeks
(panels C and D), and four weeks (panels E and F) after planting. Note the emergence of
ﬂower buds at three weeks and bolting at four weeks. Images in this dissertation are

presented in color.

177

 

Figure 5.2

178

Figure 5.3. Chlorophyll levels are reduced in the AtHsp93-V knockout mutant line.
(A) Chlorophyll was extracted in 80% acetone from wild-type (square) and AtHsp93-V
mutant (triangle) plants and quantiﬁed as described in “Materials and Methods.” Values
shown are the average of four measurements. (B) Average chlorophyll levels present in
the AtHsp93 -V knockout mutant line, expressed as a percentage of the chlorophyll levels

measured for wild-type plants of the same age.

179

2
E
.29
0
t
I? 1.5
a:
30
=>.
.5
g I
I-
O
E
U
0.5
o
E
2
i
i. A
E E
O
t i
o E
E s
R
a
E
<
Figure 5.3

180

 

 

age (days)

performed on leaf tissue isolated from wild-type and AtHsp93-V knockout mutant plants
(Figure 5.4). Tissue for these experiments was taken from six-day-old, two-week-old,
and four-week-old soil-grown individuals. At six days after planting, chloroplasts from
the mutant line were slightly smaller than wild-type chloroplasts (compare Figures 5.4A
and 5.4B). In addition, there appeared to be less thylakoid membrane present in mutant
chloroplasts than in chloroplasts from wild-type tissue. A comparison of chloroplasts
isolated from older tissues showed similar differences between the wild type and the
knockout mutant line (Figures 5.4C to 5.4F). These results may explain the decrease in
chlorophyll levels observed for the AtHsp93-V mutant plants. A reduction in the amount
of thylakoid membrane would mean less surface area for chlorophyll incorporation and
thus, a paler phenotype.

Having determined that AtHsp93-V knockout mutant plants have decreased
amounts of thylakoid membrane within their chloroplasts, we wanted to determine
whether endogenous plastid protein levels were also affected in the mutant line. To do
this, we analyzed, by immunoblotting, total protein extracted from two-week-old and
four-week-old soil-grown plants and total chloroplast protein isolated from four-week-old
plate-grown plants. Figure 5.5 shows representative results from the chloroplast protein
samples; total protein extracts from soil-grown plants gave similar results. Overall, no
signiﬁcant differences were observed when samples from wild-type and AtHsp93-V
mutant plants were compared. The protein levels of various components of the
chloroplastic protein import machinery appeared to be largely unaffected by the loss of
AtHsp93-V. In addition, several stromal enzymes, from a variety of metabolic pathways,

appeared to be present in mutant chloroplasts at levels comparable to those seen for wild-

181

Figure 5.4. Chloroplasts isolated from AtHsp93-V mutant plants are slightly
smaller and contain less thylakoid membrane in comparison to wild-type
chloroplasts. Leaf tissue was isolated from soil-grown wild-type (panels A, C, and E)
and AtHsp93-V mutant (panels B, D, and F) plants at six days (panels A and B), two
weeks (panels C and D), and four weeks (panels E and F) after planting and prepared for
transmission electron microscopy by the Center for Advanced Microscopy, Michigan

State University. Scale bar, 1 pm.

182

 

Figure 5.4

183

Figure 5.5. Endogenous levels of various chloroplastic proteins are unaffected in the
AtHsp93-V knockout line. Chloroplasts were isolated from four-week-old plate-grown
wild-type and AtHsp93-V knockout (KO) mutant seedlings. Total chloroplast protein
equivalent to 10 pg chlorophyll was separated by SDS-PAGE and analyzed by
immunoblotting, using antibodies against the proteins listed. Toc = translocon at the
guter envelope membrane of chloroplasts; Tic = translocon at the inner envelope
membrane of ghloroplasts. The number following the Toc or Tic designation refers to the
molecular mass of the speciﬁed component. S78 = a stromal Hsp70 molecular
chaperone; AOS = allene oxide synthase, an enzyme in the jasmonic acid biosynthetic
pathway; Ftle = a plastid division protein; IEP35 = an integral protein of the chloroplast
inner envelope membrane; BCCP = biotin carboxyl carrier protein, a protein involved in

lipid biosynthesis; PC = plastocyanin, a thylakoid lumen protein.

184

st crater

A

b\'

on at ‘36
we
uk- r

. .g {-31
In r6165 1"“
1
1131
05%?“

,7‘iAz

he :lLiC-‘il"

n intoi‘tw

Toc75

TicllO

Tic40

Tic22

S78

Figure 5.5

.
. -;- - ‘r

‘ t

- —_ ‘ tut-"g
.ﬂﬁ:\‘ if. w‘gI‘Q‘A

 

3: I" .H.-,,‘_,
hwouwmm

 

»

,‘4". ‘ .. . .
Yr'l" ov?t_“ 7'1- |‘-‘-“‘ y ‘v‘vi‘v‘ -q- , , ..,(.1.

 

185

7 , im- e ' , .
’- wtuwctugé-smrmmw:

 

 

 

.1;
(d

.‘—-‘.U=.-y’..

\
t

‘9‘: R .1953"

. . . .‘2 ,_ -‘ -.v4 a. '. 'Ju :1
. - . , wry-- ‘ n. .
. - ' - ,., . q 4 .‘
. . . -: *1 «ch. - «3%- 3‘5-
;"\ . . "V.‘4.<. n r'u‘;;.
, , _ . .f .... . .»..
“v ‘ "u C ’ Q o

~:fm.-u,‘a._f.f.:.m

w
u

r
M

“PIT? -'~\'§'. 7‘ ‘3‘". .3251”! 337—33 03' File ’o" '43'33 “W3 N ‘ $791“)? '

'

 

3*

Q53 fan‘s-sullyr‘fd . , ‘
.. ~

8

N
3.
C.
’.
’1;- .
K

1'
I

Fl
l
i

.9, ,. t- “19:19?

~ 3
‘.,.~ ) 3‘}3\"2~;‘34".‘-8‘ s‘tibtt—ts'oix‘li‘

I.
\
I
’r
'
,
4"

AOS

FtsZ 1

IEP35

BCCP

PC

 

type chloroplasts. It is interesting to note that no reduction in protein levels for F
plastocyanin (PC), a thylakoid lumen protein, and light harvesting chlorophyll afb
binding protein (LHCP), a protein localized to the thylakoid membrane, was observed in
AtHsp93-V knockout plants despite the fact that mutant chloroplasts had less thylakoid
membrane (Figure 5.5 and data not shown). The one exception to these results was S78,
a stromal Hsp70, whose protein levels were slightly increased in samples from the mutant
line. Thus, it is possible that the absence of AtHsp93-V from mutant chloroplasts
resulted in an upregulation of the protein levels for this molecular chaperone.

The same samples that were analyzed via immunoblotting were also examined by
Coomassie staining in order to compare total protein proﬁles between wild-type and
AtHsp93-V knockout mutant lines. No signiﬁcant differences could be observed when
total protein extracts from two-week-old soil-grown wild-type or mutant plants were
compared (Figure 5.6). Similar results were obtained when extract from four-week-old
soil-grown plants was used for comparison (data not shown). Analysis of chloroplast
protein from four-week-old plate-grown plants also revealed no major disparities between
the wild type and the AtHsp93-V mutant (Figure 5.6). Again, no reduction in various
thylakoid proteins was observed despite the overall decrease in thylakoid membrane

within mutant chloroplasts.

Import into AtHsp93- anockout mutant chloroplasts is impaired
In the pea chloroplast protein import system, an Hsp100 protein, Hsp93, is
predicted to be the factor responsible for driving precursor translocation (Akita et al.,

1997; Nielsen et al., 1997; Kouranov et al., 1998). Therefore, we analyzed AtHsp93-V

186

Figure 5.6. Total protein proﬁles of wild-type and AtHsp93-V mutant plants. Total
leaf protein from two-week-old soil-grown plants (wild-type and AtHsp93-V knockout
[KO] mutant lines) was extracted by boiling tissue samples in SDS and
B-mercaptoethanol. Protein extract equivalent to equal amounts of starting fresh mass
was separated by SDS-PAGE and stained with Coomassie Brilliant Blue R250 (lanes 1
and 2). Intact chloroplasts were isolated from four-week-old wild-type and AtHsp93-V
mutant plants that had been grown on plates. Total chloroplasts equivalent to 15 pg
chlorophyll were separated by electrophoresis, followed by staining with Coomassie

Brilliant Blue R250 (lanes 3 and 4).

187

   

Figure 5.6

188

knockout plants, which lack one of the two Arabidopsis chloroplastic Hsp93 isoforms, to
determine whether loss of the chaperone had any effect on import into mutant
chloroplasts. First, we determined whether chloroplasts isolated from AtHsp93-V mutant
plants were able to import a variety of precursor proteins during an in vitro assay. The
precursors that were used represent four distinct subcompartments within the chloroplast:
the precursor to the small subunit of Rubisco (prSS), a stromal protein; the precursor to
light harvesting chlorophyll a/b binding protein (prLHCP), a thylakoid membrane
protein; the precursor to plastocyanin (prPC), which is localized to the thylakoid lumen;
and a truncated version of the precursor to Tic110 (tpl lO-l 10N), an integral protein of
the inner envelope membrane. Mutant chloroplasts are able to import all of these
precursors, as indicated by the appearance of the mature-sized protein, within ten minutes
(data not shown). On average, the efﬁciency of precursor import into chloroplasts
isolated from AtHsp93-V knockout plants was only 65% to 75% of that observed for
chloroplasts isolated from the wild type, with the exception of prPC, which was imported
with approximately the same efﬁciency as for wild-type chloroplasts (Figure 5.7). Thus,
mutant chloroplasts appear to be impaired in the transport of some, but not all, precursor
proteins.

Next, to investigate the import of precursor proteins into chloroplasts isolated
from AtHsp93-V mutant plants in more detail, we compared the rate of prSS transport
into either wild-type or mutant chloroplasts. prSS was very rapidly imported into
chloroplasts isolated from wild-type plants. Conversion of prSS to SS, indicating that the
precursor had been at least partially translocated across the chloroplast envelope, was

observed even at the very earliest time points tested (Figure 5.8A). The import of prSS

189

 

Figure 5.7. Chloroplasts isolated from AtHsp93-V mutant plants are able to import
a variety of precursor proteins, although not as efﬁciently as do wild-type
chlorOplasts. 35S-labeled prSS (precursor to the small subunit of Rubisco, a stromal
protein), 35S-labeled prLHCP (precursor to the light harvesting chlorophyll a/b binding
protein, a thylakoid membrane protein), 35S-labeled prPC (precru'sor to plastocyanin, a
thylakoid lumen-localized protein), and 35S-labeled tpl 10-110N (a truncated version of
the precursor to Ticl 10, an inner membrane-localized import component) were imported
into chloroplasts (25 pg chlorophyll) isolated from wild-type or AtHsp93-V mutant
plants. Plants had been plate-grown for approximately four weeks prior to chloroplast
isolation. After ten or twenty minutes at room temperature in the light, import was
stopped, and intact chloroplasts were recovered, by centrifuging the reactions through a
40% Percoll cushion. Equivalent amounts of chlorophyll from each sample were
analyzed by SDS-PAGE and ﬂuorography. The amount of radiolabeled precursor
proteins imported into the chloroplasts was quantiﬁed using a phosphoimager. Values
presented depict the amount of precursor imported into AtHsp93-V mutant chloroplasts
as a percentage of the amount imported into wild-type chloroplasts and are the average of

at least two independent experiments.

190

 

 

% WI‘

 

prSS prLHCP prPC tpl 10—1 10N

Figure 5.7

191

Figure 5.8. The rate of import of prSS into AtHsp93-V mutant chloroplasts is
decreased in comparison to import into chloroplasts isolated from wild-type plants.
(A) 35S-labeled prSS (precursor to the small subunit of Rubisco) was imported into
chloroplasts isolated from wild-type or AtHsp93-V knockout (KO) mutant plants. Plants
had been plate-grown for approximately four weeks prior to chloroplast isolation. At the
times indicated, aliquots equivalent to 25 pg chlorophyll were removed from the import
reactions. Import was stopped, and intact chloroplasts were recovered, by centrifuging
the aliquots through a 40% Percoll cushion. Equivalent amounts of chlorophyll from
each sample were analyzed by SDS-PAGE and ﬂuorography. TP = 1/10 volume of
radioactive translation product added to each sample. SS = mature form of prSS.

(B) Results from panel A (wild type = square; AtHsp93-V knockout = triangle) were
quantiﬁed using a phosphoimager. Values depicted are the average of three independent

import reactions.

192

AtHsp93-V
KO

r

 

rt achieved

ximum impo

°/oma

 

Figure 5.8

193

into wild-type chloroplasts was saturated within ten minutes (Figure 5.8B). Import of
prSS into chloroplasts isolated from AtHsp93-V knockout mutant plants, however,
proceeded at a signiﬁcantly slower rate. Processing of prSS to SS was not apparent until
two minutes after reaction initiation (Figure 5.8A). As for wild-type chloroplasts, prSS
import into mutant chloroplasts achieved maximal levels after ten minutes, although the
levels obtained were not as high as those seen for the wild type (Figure 5.8B). On
average, the rate of prSS import into chloroplasts isolated from AtHsp93-V mutant plants

was ~50% of that measured for chloroplasts isolated from wild-type plants.

194

DISCUSSION

At least two possibilities exist for the role of Hsp93, an Hsp100 protein of the
ClpC subfamily, within chloroplasts. Hsp1003 were ﬁrst identiﬁed in E. coli as a
component of an ATP-dependent protease complex (Hwang et al., 1987; Katayama et al.,
1988). The Hsp100 identiﬁed, ClpA, in this two-subunit complex acts as a regulatory
factor, controlling the action of the proteolytic component, ClpP (Hwang et al., 1987;
Katayama et al., 1988). Chloroplasts of higher plants encode a homolog of the ClpP
protein within the organellar genome (Shanklin et al., 1995; Boston et al., 1996). It is
hypothesized that plastid-localized ClpC proteins, which are homologous to bacterial
ClpA, may substitute for the function of ClpA in the plastid Clp proteolytic complex
(Shanklin et al., 1995; Boston et al., 1996). Immunological experiments have
demonstrated a possible interaction of ClpP and ClpC proteins within barley chloroplasts
(Desimone et al., 1997). In addition, Hsp93 (a ClpC protein) isolated from pea
chloroplasts has been found to stimulate the in vitro activity of bacterial ClpP, although it
had no effect on the in vitro activity of recombinant pea ClpP (Shanklin et al., 1995).

Hsp93 has also been identiﬁed as a component of the protein import apparatus of
pea chloroplasts (Akita et al., 1997; Nielsen et al., 1997; Kouranov et al., 1998). It is
known that molecular chaperones are essential components of the posttranslational
protein import systems of the mitochondria and the ER, providing the driving force to
pull the incoming precursor proteins into the organelle (Jensen and Johnson, 1999; Pilon
and Schekman, 1999; Rapoport et al., 1999; Herrmann and Neupert, 2000; Strub et al.,
2000). Thus, it is predicted that a similar role for a chaperone exists within the

chloroplastic protein transport machinery. As Hsp93 is the only chaperone consistently

195

 

found to be present within import complexes isolated from chloroplasts, it is currently the
best candidate to provide the energy needed for precursor translocation (Akita et al.,
1997; Nielsen et al., 1997; Kouranov et al., 1998).

In order to investigate the possible role of Hsp93 within chloroplasts in more
detail, we isolated an Arabidopsis knockout line containing a disruption in both copies of
AtHSP93- V, which encodes one of the two Arabidopsis chloroplast-localized Hsp93
homologs. The AtHsp93-V mutant line was distinctly paler than wild-type plants of the
same ecotype (Figures 5.2 and 5.3). Thus, some aspect of chloroplast development is
affected in the mutant plants. This impairment may be related to thylakoid development
as AtHsp93—V mutant chloroplasts appeared to contain less thylakoid membrane than did
wild-type chloroplasts (Figure 5.4). Interestingly, RNAi plants for AtHsp93-V display a
similar phenotype (P. Jarvis, personal communication), conﬁrming that the phenotype
observed for the knockout mutant line is indeed due to the disruption in AtHSP93-V gene
expression.

A reduction in the amount of thylakoid membrane could result from a defect of
chloroplast protein import. Many proteins necessary for the development of thylakoids
are encoded in the nucleus and must be imported into the organelle (Keegstra and Cline,
1999). Thus, if import into chloroplasts were impaired, thylakoid development would
likely be inﬂuenced. AtHsp93-V mutant plants may indeed be altered in their capacity to
import precursors into chloroplasts. When the rate of import of prSS, a stromal protein,
was examined, a decrease of ~50% in the overall translocation rate into mutant
chloroplasts was observed (Figure 5.8), suggesting that AtHsp93-V may indeed be

important for the movement of precursors into the organelle. The translocation of two

196

additional chloroplastic proteins, prLHCP and tp110-110N, which also utilize the general
import machinery, seemed to be impaired in the AtHsp93-V knockout line as well
(Figure 5.7). However, the import of a fourth protein, prPC, into mutant chloroplasts was
largely unaffected, indicating that AtHsp93-V function may not be needed for the
transport of all precursor proteins. Additional experiments addressing the rate of import
of a variety of precursors will be necessary to determine the exact effect the loss of
AtHsp93-V function has on the chloroplast protein import process.

The endogenous levels of most plastid proteins were similar within wild-type and
AtHsp93-V mutant plants, as measured by immunoblotting and Coomassie staining
(Figures 5.5 and 5.6). Therefore, the import of proteins into chloroplasts in vivo may not
be signiﬁcantly affected in the mutant line, suggesting that an import defect may not be
the cause of the pale phenotype observed for mutant plants. The reduction in import rate
by one-half that was measured in this investigation would also probably be insufﬁcient to
explain the severity of the visible phenotype. These results would instead suggest that
AtHsp93-V has a function unrelated to import in vivo, perhaps as part of the Clp
proteolytic complex or in assisting imported proteins to achieve their native conformation
and suborganellar location. A role for AtHsp93-V in protein import is not ruled out by
these results, however. It is possible that this molecular chaperone normally performs
multiple functions within Arabidopsis chloroplasts.

Molecular chaperones, including the Hsp70 proteins involved in the
mitochondrial and ER protein import systems, have been found to be essential in many
species (Baker and Schatz, 1991; Boston etal., 1996; Pfanner et al., 1997). Disrupting

the gene for AtHsp93-V, a chloroplastic Hsp100 in Arabidopsis, however, is not lethal.

197

 

One explanation of these results is that the putative truncated version of AtHsp93-V that
can be observed on Western blots is at least partially functional in the mutant line.
Alternatively, another chaperone, most likely AtHsp93-III, a homolog of AtHsp93-V, is
partly substituting for the loss of AtHsp93-V function in mutant plants. Interestingly,
although AtHsp93-V and AtHsp93-III are almost 90% identical to one another at the
amino acid level, AtHsp93-III cannot completely compensate for the disruption in
AtHSP93- V gene expression. It is possible that the gene encoding AtHsp93-III is not
expressed at the same developmental stages as AtHSP93- V, preventing the protein from
being present at sufﬁcient levels at the times when AtHsp93-V function is needed within
Arabidopsis chloroplasts. Northern blots investigating the expression patterns of
AtHSP93- V and AtHSP93-III throughout development are needed to test this hypothesis.
On the other hand, AtHsp93-V and AtHsp93-III, despite their overall similarity, could
actually perform specialized functions within chloroplasts. Thus, AtHsp93-III may be
only able to partially compensate for the loss of functional AtHsp93-V because it can
only inefﬁciently accomplish the task normally done by AtHsp93-V. We have isolated a
knockout mutant line for the gene encoding AtHsp93-III in order to learn more about the
function of this Hsp93 isoform within chloroplasts. Future work with the AtHsp93-III
mutant line will involve characterizing its phenotype in a manner similar to what has
been done for the AtHsp93-V mutant and crossing these two mutant lines to determine
the effect of disrupting the expression of all Hsp93/ClpC isoforms normally present in
Arabidopsis chloroplasts.

It is also possible that chaperones of other families, such as Hsp70s, could

substitute for AtHsp93-V in mutant plants. This may indeed be the case if the role of

198

AtHsp93-V is to drive precursor protein translocation. Hsp70 proteins are known to
perform this function in other posttranslational import systems (Jensen and Johnson,
1999; Pilon and Schekman, 1999; Rapoport et al., 1999; Herrmann and Neupert, 2000;
Strub et al., 2000). In addition, a stromal Hsp70, S78, has been found in import
complexes isolated ﬁom pea chloroplasts, although not under all conditions as Hsp93 is
(Nielsen et al., 1997). Thus, the physiological relevance of the association of S78 with
the import machinery is still a matter of debate. In AtHsp93-V knockout mutant plants,
the protein levels of S78 appeared to be elevated (Figure 5.5), suggesting there may be a
greater need for S78 in the absence of a functional AtHsp93-V protein. More
experiments will be necessary to investigate this hypothesis.

Previous studies on the Arabidopsis chloroplast-localized Hsp100 proteins have
indicated that these factors likely play a housekeeping role within the plastid, although
the exact nature of this role has yet to be determined (Shanklin et al., 1995; Nakabayashi
et al., 1999). We obtained AtHsp93-V knockout mutant plants in order to learn more
about the possible functions of this molecular chaperone. Based on our current results, it
is apparent that AtHsp93-V is important, but not essential, for normal chloroplast
development and function. Additional work on the AtHsp93-V mutant line will attempt
to further address what the role of this chaperone within chloroplasts may be, especially
whether it directly or indirectly impacts the process of chloroplast protein import. In
addition to the experiments mentioned in the above discussion, we plan to complement
AtHsp93-V mutant plants with both wild-type and mutated versions of AtHsp93-V and
AtHsp93-III. This work should give insight into whether various regions of these

proteins, such as the nucleotide-binding domains, are necessary for their function and

199

 

whether these two isoforms are indeed functionally equivalent. In combination with the
planned studies on the AtHsp93-III mutant line, it is hoped that these experiments will
provide evidence regarding the hypothesis that an Hsp100 protein, rather than an Hsp70,

provides the energy for protein import into chloroplasts.

200

 

REFERENCES

Akita M, Nielsen E, Keegstra K (1997) Identiﬁcation of protein transport complexes in
the chloroplastic envelope membranes via chemical cross-linking. J Cell Biol 136: 983-
994

Arnon D1 (1949) Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta
vulgaris. Plant Physiol 24: 1-15

Baker KP, Schatz G (1991) Mitochondrial proteins essential for viability mediate protein
import into yeast mitochondria. Nature 349: 205-208

Bauerle C, Keegstra K (1991) F ull-length plastocyanin precursor is translocated across
isolated thylakoid membranes. J Biol Chem 266: 5876-5883

Boston RS, Viitanen PV, Vierling E (1996) Molecular chaperones and protein folding in
plants. Plant Mol Biol 32: 191-222

Bruce BD, Perry S, Froehlich J, Keegstra K (1994) In vitro import of proteins into
chloroplasts. Plant Mol Biol Manual J1: l-lS

Chen X, Schnell DJ (1999) Protein import into chloroplasts. Trends Cell Biol 9: 222-227

Clarke AK, Eriksson M-J (1996) The cyanobacterium Synechococcus sp. PCC 7942
possesses a close homologue to the chloroplast ClpC protein of higher plants. Plant Mol
Biol 31: 721-730

Derré I, Rapoport G, Devine K, Rose M, Msadek T (1999) ClpE, a novel type of HSPlOO
ATPase, is part of the CtsR heat shock regulon of Bacillus subtilis. Mol Microbiol 32:
581-593

Desimone M, BeiB-Wichert C, Wagner E, Altenfeld U, Johanningmeier U (1997)
Immunological studies on the Clp-protease in chloroplasts: evidence for the formation of
a ClpC/P complex. Bot Acta 110: 234-239

Fitzpatrick LM, Keegstra K (2001) A method for isolating a high yield of Arabidopsis
chloroplasts capable of efﬁcient import of precursor proteins. Plant J 27: 59-65

Herrmann JM, Neupert W (2000) Protein transport into mitochondria. Curr Opin
Microbiol 3: 210-214

Howe GA, Lee GI, Itoh A, Li L, DeRocher AE (2000) Cytochrome P450-dependent

metabolism of oxylipins in tomato. Cloning and expression of allene oxide synthase and
fatty acid hydroperoxide lyase. Plant Physiol 123: 711-724

201

 

Hwang BJ, Park WJ, Chung CH, Goldberg AL (1987) Escherichia coli contains a soluble
ATP-dependent protease (Ti) distinct from protease La. Proc Natl Acad Sci USA 84:
5550-5554

Jensen RE, Johnson AE (1999) Protein translocation: is Hsp70 pulling my chain? Curr
Biol 9: R779-R782

Katayama Y, Gottesman S, Pumphrey J, Rudikoff S, Clark WP, Maurizi MR (1988) The
two-component, ATP-dependent Clp protease of Escherichia coli: puriﬁcation, cloning,
and mutational analysis of the ATP-binding component. J Biol Chem 263: 15226-15236

Keegstra K, Cline K (1999) Protein import and routing systems of chloroplasts. Plant
Cell 11: 557-570

Keegstra K, Froehlich J E (1999) Protein import into chloroplasts. Curr Opin Plant Biol
2: 471-476

Kouranov A, Chen X, Fuks B, Schnell DJ (1998) Tic20 and Tic22 are new components
of the protein import apparatus at the chloroplast inner envelope membrane. J Cell Biol
143: 991-1002

Kruger E, Volker U, Hecker M (1994) Stress induction of clpC in Bacillus subtilis and its
involvement in stress tolerance. J Bacteriol 176: 3360-3367

Krysan PJ, Young JC, Sussman MR (1999) T-DNA as an insertional mutagen in
Arabidopsis. Plant Cell 11: 2283-2290

Krysan PJ, Young JC, Tax F, Sussman MR (1996) Identiﬁcation of transferred DNA
insertions within Arabidopsis genes involved in signal transduction and ion transport.
Proc Natl Acad Sci USA 93: 8145-8150

Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227: 680-685

Lazazzera BA, Grossman AD (1997) A regulatory switch involving a Clp ATPase.
BioEssays 19: 455-458

Liibeck J, Heins L, Soll J (1997) A nuclear-coded chloroplastic inner envelope membrane
protein uses a soluble sorting intermediate upon import into the organelle. J Cell Biol
137: 1279-1286

May T, Soll J (1999) Chloroplast precursor protein translocon. FEBS Lett 452: 52-56
Mhammedi-Alaoui A, Pato M, Gama M-J, Toussaint A (1994) A new component of

bacteriophage Mu replicative transposition machinery: the Escherichia coli Cle protein.
Mol Microbiol 11: 1109-1116

202

Moore T, Keegstra K (1993) Characterization of a cDNA clone encoding a chloroplast-
targeted Clp homologue. Plant Mol Biol 21: 525-537

Nakabayashi K, Ito M, Kiyosue T, Shinozaki K, Watanabe A (1999) Identiﬁcation of clp
genes expressed in senescing Arabidopsis leaves. Plant Cell Physiol 40: 504-514

Nakashima K, Kiyosue T, Yamaguchi-Shinozaki K, Shinozaki K (1997) A nuclear gene,
erd], encoding a chloroplast-targeted Clp protease regulatory subunit homolog is not

only induced by water stress but also developmentally up-regulated during senescence in
Arabidopsis thaliana. Plant J 12: 851-861

Nielsen EE (1997) The role of stromal molecular chaperones in chloroplastic protein
translocation. Ph.D. Dissertation, Michigan State University, East Lansing, MI

Nielsen E, Akita M, Davila-Aponte J, Keegstra K (1997) Stable association of
chloroplastic precursors with protein translocation complexes that contain proteins from
both envelope membranes and a stromal Hsp100 molecular chaperone. EMBO J 16: 935-
946

Ostersetzer 0, Adam Z (1996) Effects of light and temperature on expression of ClpC,

the regulatory subunit of chloroplastic Clp protease, in pea seedlings. Plant Mol Biol 31:
673-676

Pfanner N, Craig EA, Honlinger A (1997) Mitochondrial preprotein translocase. Annu
Rev Cell Dev Biol 13: 25-51

Pilon M, Schekman R (1999) Protein translocation: how Hsp70 pulls it off. Cell 97: 679-
682

Rapoport TA, Matlack KES, Plath K, Misselwitz B, Staeck O (1999) Posttranslational
protein translocation across the membrane of the endoplasmic reticulum. Biol Chem
380: 1143-1150

Sanchez Y, Lindquist S (1990) HSP104 required for induced therrnotolerance. Science
248: 1112-1115

Schirmer EC, Glover JR, Singer MA, Lindquist S (1996) HSPIOO/Clp proteins: a
common mechanism explains diverse functions. Trends Biochem Sci 21: 289-296

Schleiff E, Soll J (2000) Travelling of proteins through membranes: translocation into
chloroplasts. Planta 211: 449-456

Schnell DJ, Kessler F, Blobel G (1994) Isolation of components of the chloroplast protein
import machinery. Science 266: 1007-1012

203

Shanklin J, DeWitt ND, Flanagan JM (1995) The stroma of higher plant plastids contain
ClpP and ClpC, functional homologs of Escherichia coli ClpP and ClpA: an archetypal
two-component ATP-dependent protease. Plant Cell 7: 1713-1722

Squires CL, Pedersen S, Ross BM, Squires C (1991) ClpB is the Escherichia coli heat
shock protein F 84.1. J Bacteriol 173: 4254-4262

Stokes KD, McAndrew RS, Figueroa R, Vitha S, Osteryoung KW (2000) Chloroplast
division and morphology are differentially affected by overexpression of F tle and F tsZ2
genes in Arabidopsis. Plant Physiol 124: 1668-1677

Strub A, Lim JH, Pfanner N, Voos W (2000) The mitochondrial protein import motor.
Biol Chem 381: 943-949

Theg SM, Bauerle C, Olsen LJ, Selman BR, Keegstra K (1989) Internal ATP is the only
energy requirement for the translocation of precursor proteins across chloroplastic
membranes. J Biol Chem 264: 6730-6736

Tranel PJ, Froehlich J, Goyal A, Keegstra K (1995) A component of the chloroplastic
protein import apparatus is targeted to the outer envelope membrane via a novel pathway.
EMBO J 14: 2436-2446

Vothknecht UC, Soll J (2000) Protein import: the hitchhikers guide into chloroplasts.
Biol Chem 381: 887-897

Wawrzynow A, Wojtkowiak D, Marszalek J, Banecki B, Jonsen M, Graves B,
Georgopoulos C, Zylicz M (1995) The Cle heat-shock protein of Escherichia coli, the

ATP-dependent substrate speciﬁcity component of the ClpP-Cle protease, is a novel
molecular chaperone. EMBO J 14: 1867-1877

Wickner S, Gottesman S, Skowyra D, Hoskins J, McKenney K, Maurizi MR (1994) A

molecular chaperone, ClpA, functions like DnaK and DnaJ. Proc Natl Acad Sci USA 91:
12218- 12222

204

 

CHAPTER 6

Conclusions and future directions

205

When this dissertation research was begun, only ﬁve components of the
chloroplastic protein import machinery had been identiﬁed: Toc159, Toc75, Toc34,
Tic110, and Hsp93 (Waegemann and Soll, 1991; Hirsch et al., 1994; Kessler et al., 1994;
Perry and Keegstra, 1994; Schnell et al., 1994; Seedorf et al., 1995; Tranel et al., 1995;
Kessler and Blobel, 1996; Liibeck et al., 1996; Akita et al., 1997; Nielsen et al., 1997).
Two of these proteins, Toc159 and Toc75, had been studied in some detail, and several
lines of experimental evidence were emerging to support hypotheses concerning their
molecular function (Hirsch et al., 1994; Perry and Keegstra, 1994; Tranel et al., 1995; Ma
et al., 1996; Hinnah et al., 1997). Less was known about the remaining three proteins, on
the other hand, and all of those have been a focus of this dissertation research. More
recently, ﬁve additional proteins have been found within isolated import complexes, and
it is predicted that other, as yet unidentiﬁed, subunits are present as well (Caliebe et al.,
1997; Kouranov and Schnell, 1997; Kouranov et al., 1998; Stahl et al., 1999; Sohrt and
Soll, 2000). Overall, the focus of research in the ﬁeld of chloroplast protein import,
however, has been moving away from identiﬁcation of components of the import
apparatus to studies addressing the possible functions of these proteins during precursor
transport. Thus, the goal of this dissertation research has been to use the experimental
tools currently available, both biochemical and genetic, to investigate subunit function in
more detail.

Initially, we took a biochemical approach to study pea Tic110, which had only
recently been identiﬁed (Kessler and Blobel, 1996; Lﬁbeck et al., 1996). Our
investigation into the topology of this protein within the chloroplast inner envelope

membrane conﬁrmed that the large, hydrophilic C-terrninal domain of Ticl 10 faces the

206

interior of the chloroplast (Chapter 2). Because this C-terminal domain is preceded only
by a transmembrane domain and a very short N-terminal hydrophilic region (Kessler and
Blobel, 1996; Liibeck et al., 1996), it is likely that the functional residues of Ticl 10 are
localized within the plastid stroma. Current speculation regarding the function of Ticl 10
during chloroplast protein import assumes that this large C-terminal domain is involved
in protein-protein interactions with other members of the import complex (Chen and
Schnell, 1999; Keegstra and Cline, 1999; Keegstra and Froehlich, 1999; May and Soll,
1999; Schleiff and Soll, 2000; Vothknecht and Soll, 2000). Speciﬁcally, it is believed
that Ticl 10 may be involved in recruiting molecular chaperones to the site of precursor
import, similar to the role played by Tim44 in the mitochondrial protein import system
(Kessler and Blobel, 1996; Nielsen et al., 1997; Kouranov et al., 1998). Tim44 serves as
an anchor for the import associated-mitochondrial Hsp70 protein, which is involved both
in providing the energy for precursor translocation and in assisting with the proper
folding of newly-irnported proteins (Pfanner et al., 1997; Herrmann and Neupert, 2000).
Tic110 may interact with chaperones performing either or both of these functions. In a
study by Kessler and Blobel (1996), it was found that chaperonin (cpn) 60, a member of
the Hsp60 family of chaperones, was the major protein coimmunoprecipitated by Tic110.
The Tic110-cpn60 complex is localized in the vicinity of contact sites formed between
the outer and inner membranes of the chloroplast envelope, which are presumed to be the
sites of precursor protein import (Kouranov et al., 1998). The mature form of the small
subunit of Rubisco (mSS) associates with this Tic110-cpn60 complex in a transient,
ATP-sensitive manner, suggesting that cpn60 is interacting with mSS in order to assist it

in achieving its native conformation as it emerges from the translocation channel (Kessler

207

and Blobel, 1996). Additional studies have found that Hsp93, which is predicted to be
the motor for protein import into chloroplasts, can also associate with Tic110 (Nielsen et
al., 1997; Kouranov et al., 1998). This Ticl 10-Hsp93 association is not dependent on
contact site formation (Nielsen et al., 1997; Kouranov et al., 1998).

Future work on the role of Ticl 10 during chloroplast protein import should focus
ﬁrst on determining whether this protein directly or indirectly interacts with either cpn60
or Hsp93. If the interaction between Ticl 10 and one or both of these chaperones is
indeed direct, this would provide strong evidence for the hypothesis that the function of
Tic110 is to recruit chaperones to the protein import complex. Both
coimmunoprecipitation and direct binding assays are being conducted in our lab in order
to address the nature of the association between Tic110 and Hsp93 (M. Akita and K.
Keegstra, unpublished observations). If neither Hsp93 nor cpn60 are found to directly
bind to Tic110, then additional studies will be necessary to determine with what proteins
the hydrophilic domain of Tic110 can interact. Once the putative partner or partners of
Ticl 10 have been determined, investigations addressing the regions of Ticl 10 that are
important for this protein-protein interaction can be conducted.

Shortly after this dissertation research was initiated, reverse genetic resources in
Arabidopsis thaliana started to become widely available. As a consequence, a decision
was made to shift our research efforts from pea to Arabidopsis. In order to do this, we
ﬁrst needed to establish that homologs of the chloroplastic protein import complex
components were indeed present in Arabidopsis (Chapter 3). Our analysis of the
Arabidopsis genome sequence revealed that at least one expressed homolog for each of

the known members of the pea import machinery was present in this species. Thus, it

208

was concluded that Arabidopsis could indeed serve as a model for the genetic study of
chloroplast protein import.

Most of the import components have multiple homologs in Arabidopsis. In all but
one case, all of these homologs are known to be expressed. Therefore, it is possible that
multiple types of import complexes exist within Arabidopsis plastids, each containing a
speciﬁc combination of the various isoforms for each subunit (Jarvis et al., 1998; Bauer
et al., 2000; Gutensohn et al., 2000; Yu and Li, 2001). It would be interesting to
investigate this phenomenon in more detail, studying whether there is tissue or
developmental-speciﬁc expression of the homologs for a particular import component.
Such experiments have already been carried out for two subunits of the outer envelope
membrane import complex, Toe] 59 and Toc34 (Jarvis et al., 1998; Bauer etal., 2000;
Gutensohn et al., 2000; Yu and Li, 2001). Toc159 has three homologs in Arabidopsis:
AtToc159, AtTocl32, and AtToc120. The gene for AtToc159 is most highly expressed
in aboveground, light-grown tissue (Bauer et al., 2000; Yu and Li, 2001), supporting the
hypothesis that AtToc159 may be the primary receptor for photosynthesis-related
proteins, which would be the major group of proteins being imported into chloroplasts
present in the aboveground tissues. AtToc 1 32 and AtTochO, on the other hand, could be
the primary receptors for nonphotosynthetic proteins imported into all plastid types
(Bauer et al., 2000). In contrast to Toc159, Toc34 only has two homologs in ArabidOpsis
chloroplasts, known as AtToc34 and AtToc33. The genes for these two proteins also
appear to be differentially expressed, with the gene for AtToc33 being elevated in some
tissues while the gene for AtToc34 being upregulated in others (Gutensohn et al., 2000;

Yu and Li, 2001). These results, like those for the Tool 59 homologs, suggest that there

209

 

 

are in fact multiple types of import complexes present in Arabidopsis plastids, some
containing primarily one isoform of an import component and others containing primarily
a different isoform. Additional work should now be done to see if other components of
the import apparatus give similar results and to determine the signiﬁcance of these
observations to the process of chloroplast protein import. One possibility is that each
combination of speciﬁc isoforms is specialized for the transport of a subset of precursor
proteins (Bauer et al., 2000; Gutensohn et al., 2000; Yu and Li, 2001). Different plastid
types, such as amyloplasts, chloroplasts, or chromoplasts, would contain one or more
isoforms for each subunit depending on the types of precursor proteins that are required
within the plastid.

As more genomic and EST sequence information becomes available for species
other than Arabidopsis, it would be useful to determine whether multiple isoforms for the
components of the import machinery exist in these species as well. An analysis of the
EST sequence database for homologs of Toc75 and Tic110 has indicated that multiple
isoforms of these proteins are present in some higher plant species (J. Davila-Aponte et
al., submitted). This work needs to be extended to examine all of the known members of
the chloroplastic protein import apparatus. These results can then be used in combination
with the expression analysis done in Arabidopsis to investigate whether particular
isoforms do indeed provide speciﬁcity to the process of precursor translocation.

Having established that Arabidopsis can indeed serve as a model system for the
study of protein import into chloroplasts, we isolated knockout mutant lines for two
putative import components: AtToc34 and AtHsp93-V (Chapters 4 and 5). Initial studies

with these mutant lines have already allowed us to gain some insight into the possible

210

 

 

functions of these proteins. For example, attempts to generate a double homozygous
mutant line that lacks both AtToc34 and its homolog, AtToc33, indicate that
AtToc33/AtToc34 function is essential in Arabidopsis. This was somewhat surprising
because we believed AtToc33/AtToc34 to be regulatory components that modulate the
efﬁciency of the import process. These results would suggest, however, that
AtToc33/AtToc34 play a much more important role in chloroplasts. If they are indeed
regulatory factors, then the process that they are controlling must be essential for plastid
protein import to occur.

One possibility for the function of AtToc33/AtToc34 in Arabidopsis chloroplasts
is that they could act as docking sites within the outer envelope membrane for
cytoplasmic Toc 159 (Hiltbrunner et al., 2001). Toc159 is predicted to be the receptor for
precursor proteins (Hirsch et al., 1994; Perry and Keegstra, 1994). Originally, it was
believed that the recognition of transit peptides by Toc159 occurred at the chloroplast
surface. Recent evidence, however, suggests that Toc159 may actually interact with
precursor proteins within the cytoplasm and then insert, with the bound preprotein, into
the outer membrane of the chloroplast envelope (Hiltbrunner et al., 2001). This putative
mechanism is similar to the method used by signal recognition particle (SRP) to bring
precursors to the cotranslational import complex of the ER (Rapoport et al., 1996;
Hiltbrunner et al., 2001). It is possible that the regulatory function of AtToc33/AtToc34
involves recognizing the Toc159-precursor complex and/or assisting in its insertion into
the outer membrane (Hiltbrunner et al., 2001). One way to test this prediction would be
to analyze Toc159 localization in the AtToc33 knockout mutant, ppil, which is impaired

in the import of proteins into chloroplasts (Jarvis etal., 1998). If, in the mutant, more

211

Toc159 is found in the cytoplasm and less in the outer envelope membrane than is the
case in wild-type plants, this would support the hypothesis that AtToc33, and AtToc34, is
important for Toc159 insertion into the chloroplast envelope.

AtToc33 and AtToc34 are both GTP-binding proteins (Kessler et al., 1994;
Seedorf et al., 1995; Jarvis et al., 1998). Consequently, it is believed that GTP binding
and hydrolysis are important for the function of AtToc33/AtToc34 during chloroplast
protein import (Kessler et al., 1994; Seedorf et al., 1995). It would be interesting to
explore this hypothesis in more detail with mutated versions of AtToc33 and AtTocB4
that have altered GTP-binding domains. These mutated forms of AtToc33 and AtToc34
could be used to attempt to complement the pale phenotype of ppi 1 plants. ppi3 mutant
plants, which lack AtToc34, would not be useful in these studies because they have
neither an obvious visible phenotype nor a measurable import defect. Mutations that
disrupt normal AtToc33/AtToc34 function would prevent the introduced proteins from
complementing the ppiI phenotype. Proteins containing mutations that had no effect on
AtToc33/AtToc34 function, however, would restore the wild-type phenotype to the
mutant plants. In this manner, it could be determined what residues are important for
AtToc33/AtToc34 to function properly in Arabidopsis. In particular, residues known to
be essential for GTP binding and hydrolysis in other GTP-binding proteins could be
tested for their effect on AtToc33/AtToc34 function.

Results obtained from studies of the AtHsp93-V knockout mutant line suggest
that this protein is important for normal chloroplast development. Mutant plants are paler
than wild-type plants, and their growth is severely inhibited. In addition, chloroplasts

isolated from the mutant seem to contain less thylakoid membrane than do wild-type

212

 

chloroplasts. This decrease in thylakoid membrane content could explain both the pale
phenotype and the growth defect of mutant plants. Surprisingly, the function of
AtHsp93-V seems to be somewhat unique in Arabidopsis because other stromal
molecular chaperones, including a homolog, AtHsp93-111, that is almost 90% identical to
AtHsp93-V, cannot completely compensate for the disruption in AtHSP93-V gene
expression. However, because it is assumed that a complete loss of the chaperone
function provided by AtHsp93-V would be lethal in Arabidopsis, we hypothesize that
other chaperones are able to at least partially substitute for AtHsp93-V in the mutant
plants. It is possible that an Hsp70 protein, S78, may be performing a task normally done
by AtHsp93-V, as the protein levels of S78 are elevated in the mutant. Investigations are
ongoing in our lab to address this question as well as to determine possible reasons for
the inability of AtHsp93-III to substitute for its homolog.

Unfortunately, the experiments done on the AtHsp93-V knockout mutant line
have not allowed us to differentiate between possible functions for this molecular
chaperone within chloroplasts. We believe that AtHsp93-V is the translocation motor for
chloroplast protein import (Akita et al., 1997; Nielsen et al., 1997). However, at this
time, our results with the mutant neither support nor refute this hypothesis. Chloroplasts
isolated from AtHsp93-V knockout plants do show an import defect in vitro, at least for
some precursors. However, analysis of endogenous chloroplastic protein levels in mutant
plants suggests that import is unaffected in vivo. Thus, it is possible that the in vivo
phenotype is caused not by a defect in chloroplast protein import. Instead, the phenotype
could be related to other putative roles of AtHsp93-V, including as a component of the

Clp (paseinoljtic protease) proteolytic complex or as a factor assisting protein folding.

213

Future work on the AtHsp93-V mutant line will attempt to differentiate between these
possible functions.

As previously mentioned, there are two chloroplastic Hsp100 homologs in
Arabidopsis: AtHsp93-V and AtHsp93-III. Thus, it is possible that AtHsp93-V is not the
stromal Hsp100 protein required for chloroplast protein import. AtHsp93-III may be
involved in precursor protein import, while AtHsp93-V is needed for other tasks within
the plastid, such as protein degradation. In order to address this hypothesis, we plan to
characterize mutant plants disrupted in the gene encoding AtHsp93-III. Our initial
studies of this knockout mutant line will be similar to what has been done for the
AtHsp93-V mutant line. In particular, it will be interesting to see if the AtHsp93-III
mutant plants have either an in vivo or an in vitro import defect and if they do, whether
that defect is more or less severe than that observed for the AtHsp93-V knockout mutant.

Finally, the AtHsp93-V mutant line, due to its obvious pale phenotype visible
even in very young plants, will be a useful tool to study site-directed mutants of Hsp93
proteins. As described above for the AtToc33 and AtToc34 proteins, AtHsp93-V or
AtHsp93-III proteins disrupted in their nucleotide-binding domains can be used to
attempt to complement the AtHsp93-V phenotype. ATPase assays using mutant pea
Hsp93 proteins indicate that the ﬁrst nucleotide-binding domain of this molecular
chaperone is required for ATP hydrolysis (M. Akita and K. Keegstra, submitted). The
second nucleotide-binding domain may be important for the interaction of Hsp93 proteins
with the chloroplast inner envelope membrane (M. Akita and K. Keegstra, submitted).

By transforming AtHsp93-V knockout mutant plants with mutant versions of

214

AtHsp93-V/AtHsp93-III disrupted in one of these nucleotide-binding regions, we may be
able to determine whether ATPase activity and/or membrane association are necessary
for the normal function of AtHsp93-V/AtHsp93-III.

Much remains to be learned about the individual roles of the import complex
components during the transport of precursor proteins into chloroplasts. This dissertation
research has addressed this question in detail for three members of the import machinery:
Tic110, Toc34 and Hsp93. In addition, we have analyzed the translocation apparatus on
a more global scale by looking at the complete complement of known import components
in Arabidopsis. Through this research, several important ﬁndings regarding component
function have been made, including that the putative functional domain of Ticl 10 is
localized within the chloroplast stroma and that AtToc33/AtToc34 function is essential in
Arabidopsis. In addition, many questions and hypotheses have been generated that will
need to be investigated. It is hoped that the tools developed during this research,
especially the isolation of T-DNA insertional mutants for AtToc34 and AtHsp93-V, will

be useful in future studies addressing the mechanism of protein import into plastids.

215

 

REFERENCES

Akita M, Nielsen E, Keegstra K (1997) Identiﬁcation of protein transport complexes in

the chloroplastic envelope membranes via chemical cross-linking. J Cell Biol 136: 983-
994

Bauer J, Chen K, Hiltbunner A, Wehrli E, Eugster M, Schnell D, Kessler F (2000) The
major protein import receptor of plastids is essential for chloroplast biogenesis. Nature
403: 203-207

Caliebe A, Grimm R, Kaiser G, Liibeck J, Soll J, Heins L (1997) The chloroplastic
protein import machinery contains a Rieske-type iron-sulfur cluster and a mononuclear
iron-binding protein. EMBO J 16: 7342-7350

Chen X, Schnell DJ (1999) Protein import into chloroplasts. Trends Cell Biol 9: 222-227

Gutensohn M, Schulz B, Nicolay P, Flﬁgge U-I (2000) Functional analysis of the two
Arabidopsis homologues of Toc34, a component of the chloroplast protein import
apparatus. Plant J 23: 771-783

Herrmann JM, Neupert W (2000) Protein transport into mitochondria. Curr Opin
Microbiol 3: 210-214

Hiltbrunner A, Bauer J, Vidi P-A, Infanger S, Weibel P, Hohwy M, Kessler F (2001)
Targeting of an abundant cytosolic form of the protein import receptor atToc159 to the
outer chloroplast membrane. J Cell Biol 154: 309-316

Hinnah SC, Hill K, Wagner R, Schlicher T, Soll J (1997) Reconstitution of a chloroplast
protein import channel. EMBO J 16: 7351-7360

Hirsch S, Muckel E, Heemeyer F, von Heijne G, Soll J (1994) A receptor component of
the chloroplast protein translocation machinery. Science 266: 1989-1992

Jarvis P, Chen L-J, Li H-M, Peto CA, Fankhauser C, Chory J (1998) An Arabidopsis
mutant defective in the plastid general protein import apparatus. Science 282: 100-103

Keegstra K, Cline K (1999) Protein import and routing systems of chloroplasts. Plant
Cell 11: 557-570

Keegstra K, Froehlich JE (1999) Protein import into chloroplasts. Curr Opin Plant Biol
2: 471-476

Kessler F, Blobel G (1996) Interaction of the protein import and folding machineries in
the chloroplast. Proc Natl Acad Sci USA 93: 7684-7689

216

Kessler F, Blobel G, Patel HA, Schnell DJ (1994) Identiﬁcation of two GTP-binding
proteins in the chloroplast protein import machinery. Science 266: 1035-1039

Kouranov A, Chen X, Fuks B, Schnell DJ (1998) Tic20 and Ti022 are new components
of the protein import apparatus at the chloroplast inner envelope membrane. J Cell Biol
143: 991-1002

Kouranov A, Schnell DJ (1997) Analysis of the interactions of preproteins with the
import machinery over the course of protein import into chloroplasts. J Cell Biol 139:
1677-1685

Liibeck J, Soll J, Akita M, Nielsen E, Keegstra K (1996) Topology of IEPl 10, a
component of the chloroplastic protein import machinery present in the inner envelope
membrane. EMBO J 15: 4230-4238

Ma Y, Kouranov A, LaSala SE, Schnell DJ (1996) Two components of the chloroplast
protein import apparatus, IAP86 and IAP75, interact with the transit sequence during the

recognition and translocation of precursor proteins at the outer envelope. J Cell Biol 134:
315-327

May T, Soll J (1999) Chloroplast precursor protein translocon. F EBS Lett 452: 52-56
Nielsen E, Akita M, Davila-Aponte J, Keegstra K (1997) Stable association of
chloroplastic precursors with protein translocation complexes that contain proteins from
both envelope membranes and a stromal Hsp100 molecular chaperone. EMBO J 16: 935-
946

Perry SE, Keegstra K (1994) Envelope membrane proteins that interact with chloroplastic
precursor proteins. Plant Cell 6: 93-105

Pfanner N, Craig EA, Honlinger A (1997) Mitochondrial preprotein translocase. Annu
Rev Cell Dev Biol 13: 25-51

Rapoport TA, Rolls MM, Jungnickel B (1996) Approaching the mechanism of protein
transport across the ER membrane. Curr Opin Cell Biol 8: 499-504

Schleiff E, Soll J (2000) Travelling of proteins through membranes: translocation into
chloroplasts. Planta 211: 449-456

Schnell DJ, Kessler F, Blobel G (1994) Isolation of components of the chloroplast protein
import machinery. Science 266: 1007-1012

Seedorf M, Waegemann K, Soll J (1995) A constituent of the chloroplast import complex
represents a new type of GTP-binding protein. Plant J 7: 401-411

217

Sohrt K, Soll J (2000) Toc64, a new component of the protein translocon of chloroplasts.
JCell Biol 148: 1213-1221

Stahl T, Glockmann C, Soll J, Heins L (1999) Tic40, a new “old” subunit of the
chloroplast protein import translocon. J Biol Chem 274: 37467-37472

Tranel PJ, Froehlich J, Goyal A, Keegstra K (1995) A component of the chloroplastic

protein import apparatus is targeted to the outer envelope membrane via a novel pathway.
EMBOJ 14: 2436-2446

Vothknecht UC, Soll J (2000) Protein import: the hitchhikers guide into chloroplasts.
Biol Chem 381: 887-897

Waegemann K, Soll J (1991) Characterization of the protein import apparatus in isolated
outer envelopes of chloroplasts. Plant] 1: 149-158

Yu T-S, Li H-M (2001) Chloroplast protein translocon components atToc159 and

atToc33 are not essential for chloroplast biogenesis in guard cells and root cells. Plant
Physiol 127: 90-96

218

 

APPENDIX

219

INTRODUCTION
Chapter 2 describes our efforts to deﬁne the topology of Ticl 10, a component of

the chloroplastic protein import apparatus, within the inner envelope membrane of pea
chloroplasts. The experiments reported in Chapter 2, all of which have been published
previously (Jackson DT, Froehlich JE, Keegstra K [1998] J Biol Chem 273: 16583-
16588), utilize protease digestion techniques to ascertain Tic110 topology. However,
during the course of this investigation, we also used a variety of other reagents in an
attempt to establish the orientation of Ticl 10 within the inner membrane. That work,

which has never been submitted for publication, is presented here.

220

 

MATERIALS AND METHODS

Chloroplasts were isolated from 8 to 12-day-old pea seedlings as described
previously (Bruce et al., 1994). Intact chloroplasts were incubated, at room temperature,
with Sulfo-NHS-Biotin (Pierce, Rockford, Illinois, USA) at a ﬁnal concentration of
40 pM. At the times indicated in the ﬁgures, the biotinylation reactions were quenched
with Tris-HCl (pH 7.5) at a ﬁnal concentration of 100 mM. Quenched samples were
incubated for 10 minutes at room temperature. Intact chloroplasts ﬁom each sample were
then reisolated by centrifugation through a 40% Percoll cushion and lysed hypotonically,
as described previously (Bruce et al., 1994). After a 10 minute incubation on ice, lysed
chloroplasts were separated into crude membrane and soluble fractions as described by
Bruce et al. (1994).

For immunoprecipitation, membrane proteins were solubilized in 25 mM HEPES-
KOH (pH 7.5), 50 mM NaCl, 1 mM EDTA, 1 mM phenylmethanesulfonyl ﬂuoride
(PMSF), 1% decylmaltoside prior to the addition of antibodies against either Tic110
(Akita et al., 1997) or Toc75 (Tranel et al., 1995). Sepharose beads conjugated to
protein A were also included in the immunoprecipitation reactions. After 2 hours at 4°C,
the protein A-sepharose beads were recovered from each sample and washed three times
in 25 mM HEPES-KOH (pH 7.5), 50 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1%
decylmaltoside and once in the same buffer without decylmaltoside. Proteins bound to
the beads were eluted by boiling the reactions in SDS-PAGE sample buffer for 5 minutes.

SDS-PAGE was performed essentially as described previously (Laemmli, 1970);
samples were loaded on the basis of equal amounts of starting chlorophyll. After SDS-

PAGE, the separated proteins were transferred overnight to Immobilon-P PVDF

221

membranes (Millipore, Bedford, Massachusetts, USA). Biotinylated proteins were
detected with avidin conjugated to alkaline phosphatase (Pierce, Rockford, Illinois,
USA). The presence of avidin was visualized with nitro blue tetrazolium and 5-bromo-4-

chloro-3-indolyl phosphate.

222

RESULTS

Our initial efforts to investigate the topology of Ticl 10 within the chloroplast
inner envelope membrane focused not on the sensitivity of the protein to various
proteases, as reported in Chapter 2, but rather on our ability to label Tic110 with
membrane-impermeable reagents. For this work, we utilized Sulfo-NHS-Biotin, a
biotinylation reagent that reportedly cannot cross lipid bilayers (Cole et al., 1987). Sulfo-
NHS-Biotin reacts covalently with primary amine groups, thus labeling macromolecules,
including proteins, with the biotin moiety. The presence of biotin on a protein can then
be detected with various avidin reagents, which bind speciﬁcally to the biotin molecules.

Based on the fact that Sulfo-NHS-Biotin is sold as a membrane-impermeable
reagent, we believed that it would be unable to cross the inner envelope membrane of
chloroplasts. Because the chloroplast outer envelope membrane contains pores that allow
the passage of small molecules (Keegstra et al., 1984), however, Sulfo-NHS-Biotin,
which has a mass of 443 Daltons, should be able to pass through the outer membrane and
gain access to the intermembrane space of the chloroplast envelope. Thus, this
biotinylation reagent should be able to react with inner envelope membrane proteins that
are exposed to the interrnembrane space, but not with those that are largely facing the
chloroplast stroma. Our earlier results had indicated that the large hydrophilic domain of
Ticl 10 was oriented toward the interrnembrane space (Liibeck et al., 1996). As a
consequence, we predicted that Tic110 would be labeled by Sulfo-NHS-Biotin.

In order to determine whether Ticl 10 was indeed speciﬁcally labeled by Sulfo-
NHS-Biotin, we incubated intact chloroplasts with this biotinylation reagent. After the

biotinylation reaction, we reisolated intact chloroplasts, solubilized membrane proteins in

223

detergent, and immunoprecipitated Tic110. As can be seen in Figure A. 1, Tic110 was
not labeled by Sulfo-NHS-Biotin during these reactions. These results would suggest
that the large hydrophilic domain of Ticl 10 is oriented toward the interior of the
chloroplast, contrary to our initial prediction. Toc75, an integral protein of the
chloroplast outer envelope membrane, was labeled by Sulfo-NHS-Biotin, as expected
(Figure A. 1).

In order to establish whether Sulfo-NHS-Biotin was in fact unable to cross the
chloroplast inner envelope membrane, we analyzed the biotinylation of total chloroplast
protein fractions. Following incubation with Sulfo-NHS-Biotin, intact chloroplasts were
recovered and separated into membrane and soluble fractions. The biotinylation status of
proteins within these fractions was detected with avidin conjugated to alkaline
phosphatase. At even the earliest time points, biotin labeling of soluble chloroplastic
proteins could be observed (Figure A.2). Because the vast majority of soluble proteins
within the chloroplast are localized in the stroma, this result indicated that Sulfo-NHS-
Biotin was able to cross the inner envelope membrane, even though it has been reported
to be a membrane-impermeable reagent (Cole et al., 1987).

In addition to the experiments described above, we attempted to speciﬁcally label
inner membrane proteins exposed to the interrnembrane space of the chloroplast envelope
with other reagents, such as biotin-BMCC, iodoacetyl-LC-biotin, and 3H-iodoacetic acid.
However, in all cases, we observed rapid labeling of stromal proteins as well (data not
shown). Therefore, we were unable to ﬁnd a labeling reagent that could not cross the

inner membrane of the chloroplast envelope.

224

Figure A.l. Tic110 is not labeled by Sulfo-NHS-Biotin, a membrane-impermeable
biotinylation reagent, as long as chloroplasts remain intact. Intact chloroplasts (50 pg
chlorophyll) were incubated with Sulfo-NHS-Biotin at a ﬁnal concentration of 40 pM
(lanes 2-4). As a control for the ability of proteins to be labeled by the biotinylation
reagent, one aliquot of chloroplasts was lysed hypotonically prior to incubation with
Sulfo-NHS-Biotin (lane 1). At the times indicated, the biotinylation reactions were
stopped by the addition of Tris-HCI (pH 7.5) at a ﬁnal concentration of 100 mM. Intact
chloroplasts were then recovered by centrifugation through a 40% Percoll cushion and
lysed hypotonically. Following lysis, each sample was separated into crude membrane
and soluble fractions. Membrane proteins equivalent to 25 pg starting chlorophyll were
immunoprecipitated with antiserum against either Ticl 10 or Toc75. After
immunoprecipitation, the samples were analyzed by SDS-PAGE. The presence of a
biotin moiety on the proteins was detected with avidin conjugated to alkaline

phosphatase.

225

 

rrmeﬁ
'13.“ 1:21.

{4011

Tic110

thi] “3
T0075

3 011

 

Figure A.1

226

Figure A.2. Sulfo-NHS-Biotin can cross the chloroplast inner envelope membrane
and label stromal proteins. Intact chloroplasts (50 pg chlorophyll) were incubated with
Sulfo-NHS-Biotin at a ﬁnal concentration of 40 pM (lanes 3-12). As a control for the
ability of chloroplastic proteins to be labeled by the biotinylation reagent, one aliquot of
chloroplasts was lysed hypotonically prior to incubation with Sulfo-NHS-Biotin (lanes
1-2). At the times indicated, the biotinylation reactions were stopped by the addition of
Tris-HCl (pH 7.5) at a ﬁnal concentration of 100 mM. Intact chloroplasts were then
recovered by centrifugation through a 40% Percoll cushion and lysed hypotonically.
Following lysis, each sample was separated into crude membrane (P) and soluble (S)
fractions and analyzed by SDS-PAGE. Biotinylated proteins were detected with avidin

conjugated to alkaline phosphatase.

227

 

membnr
16115813159
:01 fat:
at align:
lotin (ﬂ
3 3&1th
ere d35-
OWE?
glublé 15)

l with mi

 

Figure A.2

228

 

DISCUSSION

Attempts to label Tic110 with a biotinylation reagent, Sulfo-NHS-Biotin, that
supposedly could not cross the chloroplast inner envelope membrane indicated that
Tic110 was not accessible to this chemical (Figure A. 1). These results suggest that the
soluble domain of Tic110 that we were aiming to localize was exposed within the
chloroplast stroma. However, soluble proteins of the chloroplast stroma were also
labeled during these experiments, indicating that Sulfo-NHS-Biotin was in fact crossing
the inner membrane (Figure A.2). Because Sulfo—NHS-Biotin, and several other labeling
reagents that we tested, were not acting as membrane-impermeable reagents in our
system, we decided that it was not possible for us to conclusively establish the topology
of Ticl 10 within the inner envelope membrane using these chemicals. Other methods,
such as the protease digestions experiments described in Chapter 2, were needed instead.

The results of this investigation emphasize the need to conﬁrm the relevant
properties of any chemicals that are used for experimental purposes. We were using
Sulfo-NHS-Biotin speciﬁcally because it was sold as a membrane-impermeable reagent
(Cole et al., 1987). Although this is likely true for the membranes on which Sulfo-NHS-
Biotin was initially tested, it does not appear to be the case for the chloroplast inner
envelope membrane. In our experiments, the inner membrane of pea chloroplasts was
permeable to reagents that reportedly cannot cross other lipid bilayers. Thus, it is
important to establish whether reagents being employed are working as expected prior to
making conclusions based on results obtained with the use of those chemicals.

This conclusion is supported by the experiments described in Chapter 2. We

decided to investigate the topology of Ticl 10 within the chloroplast inner envelope

229

 

membrane primarily because there was disagreement in the literature regarding the
orientation of this protein (Kessler and Blobel, 1996; Liibeck et al., 1996). We
determined the reason for the disparity was that one research group did not adequately
quench the protease they were using in their experiments. As a consequence, they falsely
concluded that the large hydrophilic domain of Ticl 10 was contained within the
intermembrane space of the chloroplast envelope (Liibeck et al., 1996). Because their
reagent was not working the way they assumed it was, they were misled by their results.
Once again, this emphasizes the need to do adequate controls to insure all aspects of an

experiment are working properly.

230

REFERENCES

Akita M, Nielsen E, Keegstra K (1997) Identiﬁcation of protein transport complexes in

the chloroplastic envelope membranes via chemical crosslinking. J Cell Biol 136: 983-
994

Bruce BD, Perry S, Froehlich J, Keegstra K (1994) In vitro import of proteins into
chloroplasts. Plant Mol Biol Manual J1: l-15

Cole SR, Ashman LK, Ey PL (1987) Biotinylation: an alternative to radioiodination for

the identiﬁcation of cell surface antigens in immunoprecipitates. Mol Immunol 24: 699-
705

Keegstra K, Wemer-Washbume M, Cline K, Andrews J (1984) The chloroplast envelope:
is it homologous with the double membranes of mitochondria and Gram-negative
bacteria? J Cell Biochem 24: 55-68

Kessler F, Blobel G (1996) Interaction of the protein import and folding machineries in
the chloroplast. Proc Natl Acad Sci USA 93: 7684-7689

Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227: 680-685

Liibeck J, Soll J, Akita M, Nielsen E, Keegstra K (1996) Topology of IEPl 10, a
component of the chloroplastic protein import machinery present in the inner envelope
membrane. EMBO J 15: 4230-4238

Tranel PJ, Froehlich J, Goyal A, Keegstra K (1995) A component of the chloroplastic

protein import apparatus is targeted to the outer envelope membrane via a novel pathway.
EMBO J 14: 2436-2446

231

' II1111111gliljﬂlljﬁﬂlll]