.7.
£31.:

an 1“?
Exam“... 5.:

3. Ii:

4.333%”,

W
ﬁqmﬁﬂﬂfﬂ‘lwn.i
: . Abra; ﬁnﬂiﬁﬁ
1157.3}ﬁ. r3...» . ls . u.
dun"; H. “w“:

. ‘12:.
J... i

.
p ‘3‘:
shin}.

 

 

 

 

It'lljlu

1001/

 

LiBRARY
Michigan State
University

 

 

 

This is to certify that the

dissertation entitled

Molecular Mechanism of Fumonisin-induced Kidney Toxicity

\

presented by

Min Sun Kim

has been accepted towards fulﬁllment
of the requirements for

Ph.D Human Nutrition-Environmental

degree in
Toxicology

 

 

I Major professor

Date [/Ll/OZ.

MS U is an Afﬁrmative Ardour/Equal Opportunity Institution 0-12771

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE ' DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 c:/ClRC/DateDue.p65.p.15

MOLECULAR MECHANISM OF FUMONISIN-INDUCED KIDNEY TOXICITY
By

Min Sun Kim

A DISSERTATION

Submitted to
Michigan State University
in partial fulﬁllment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Food Science and Human Nutrition
and
Institute for Environmental Toxicology

2002

ABSTRACT
MOLECULAR MECHANISM OF FUMONISIN-INDUCED KIDNEY TOXICITY
By
Min Sun Kim

F umonisin B, is a toxic and carcinogenic mycotoxin with renal tubular epithelial cells
being the most sensitive target. Due to structural similarities with sphingoid bases,
fumonisin B, inhibits ceramide synthase in the de novo biosynthetic pathway of sphingolipids
causing depletion of complex sphingolipids and accumulation of sphingoid bases. The goals
of this research were to use LLC-PK, renal tubular epithelial cells to: 1) Determine whether
fumonisin B, kills cells by inducing apoptosis and evaluate the role of disruption of
sphingolipid metabolism in fumonisin-induced cell death; 2) Identify genes affected by
fumonisin B, and investigate the molecular mechanism whereby fumonisin B, induces gene
expression; and 3) Determine whether fumonisin B, affects signaling pathways involved in
cell proliferation and cell death.

Fumonisin B, produced morphological changes and time-dependent increases in
fragmented DNA indicative of apoptosis within 16 hours and simultaneously caused
accumulation of sphinganine. To investigate the role of sphinganine in fumonisin B,-
induced apoptosis, B-ﬂuoroalanine (BFA) was used to inhibit serine palmitoyltransferase,
which catalyzes an earlier step in the sphingolipid biosynthetic pathway. BFA blocked
sphinganine accumulation and prevented fumonisin B,-induced DNA fragmentation,
conﬁrming that fumonisin B,-induced apoptosis depends on accumulation of sphinganine.

Fumonisin B, selectively induced several genes including calmodulin; whereas, the

mycotoxin did not affect the bcl-2 family genes bcl-2, bcI-x, and bax. Fumonisin B,

increased both calmodulin mRN A and protein in concentration-dependent manners, and the
calmodulin antagonist W7 blocked fumonisin B,-induced DNA fragmentation, supporting
a role for calmodulin in fumonisin B,-induced apoptosis. F umonisin B, did not inﬂuence
stability of calmodulin mRNA and appears to induce calmodulin by increasing transcription.
BFA added together with fumonisin B, blocked sphinganine accumulation and blunted
induction of calmodulin, suggesting a role for sphinganine or the l-phosphate metabolite.
Exogenous addition of sphinganine had no effect on calmodulin expression, but addition of
the l-phosphate signiﬁcantly increased calmodulin mRNA, indicating sphinganine 1-
phosphate mediates fumonisin B, induction of calmodulin.

To examine signaling pathways involved in fumonisin-induced cell death, LLC-PK,
cells were cultured with either fumonisin B, or sphinganine. Exogenously added D-erythro-
sphinganine acted more rapidly than fumonisin B,, inhibiting growth and causing cell death.
Both fumonisin B, and sphinganine reduced phosphorylation of MEK and ERK without
affecting phosphorylation of Raf. Fumonisin B, and sphinganine also decreased
phosphorylation of Akt (protein kinase B). Furthermore, addition of BFA together with
fumonisin B, blocked fumonisin-induced dephosphorylation, suggesting that sphinganine
mediates the effect of fumonisin B, on phosphorylation of MEK, ERK, and Akt proteins.

Taken together, fumonisin B, appears to cause kidney toxicity by disrupting
sphingolipid metabolism and causing accumulation of sphinganine and sphinganine 1-
phosphate. These sphingolipid metabolites induce selected genes including calmodulin, and
alter signaling through cell proliferation and cell death pathways leading to renal tubular

epithelial cell apoptosis

This dissertation is dedicated to my devoted parents for their love and encouragement.

iv

ACKNOWLEDGEMENTS

First of all, I thank my advisor Dr. Joseph J. Schroeder, without whom I would not
be able to get this far. He provided support, kindness, assistance and friendship in every step
I make. I respect him as a researcher as well as a human being. I will remember him as my
true mentor no matter where I am.

I also would like to thank my guidance committee members, Drs. Dale R. Romsos,
Maurice R. Bennink, and Patricia E. Ganey for their truly valuable advice, criticisms, and
comments which have allowed me to improve as a scientist.

I am also grateﬁJl to Dr. Thomas Wang for his assistance in quantitative RT-PCR,
and to Dr. Doh-Yeel Lee for his technical guidance for differential display RT-PCR. I thank
member of the Food Microbiology research group for their enduring kindness in sharing their
equipments and knowledge.

I would like to thank both present and past lab members Eun-Hyun Ahn, Eun-Hee
Lee, Hong Yang, Chi Zhang, and Jason Weisinger for their technical assistance, helpful
comments and friendship.

My special thanks go to my brothers and sister for their encouragement, patience,
kindness and support for all these years. Without them, I wouldn’t be able to focus on my
studies and research.

To my parents, I can’t say enough to express my gratefulness and appreciation. I

thank them for letting me be who I am and do what I want to do.

TABLE OF CONTENTS

LIST OF FIGURES ...viii
ABBREVIATIONS ...x
INTRODUCTION 1
CHAPTER I. LITERATURE REVIEW 3
A. FUMONISINS ...4
A. 1 . Introduction ...4
A2 Toxicity 5
A3. Carcinogenicity ...6
A4. Structure ...8
A5. Toxicokinetics 10
A6. Metabolism ...1 1
A7. Inhibition of Ceramide Synthase ...11
B. SPHINGOLIPIDS 14
B. 1 . Introduction 14
82. De nova Biosynthesis ...15
B. 3. Turnover ...17
B. 4. Sphingolipid Signaling ...17
B. 5. Disruption of Sphingolipid Metabolism as a Causative Factor in
Fumonisin-induced Toxicity .26
C. LLC-PK, RENAL TUBULAR EPITHELIAL CELLS AS A MODEL ...30
D. HYPOTHESIS AND SPECIFIC AIMS ...31

CHAPTER II. F UMONISIN B, INDUCES APOPTOSIS IN LLC-PK, RENAL
EPITHELIAL CELLS VIA A SPHINGANINE- AND CALMODULIN-

DEPENDENT PATHWAY ...32
A. ABSTRACT ...33
B. INTRODUCTION ...34
C. MATERIALS AND METHODS ...36

C. 1. Reagents and cell culture ...36
C. 2. Analysis of DNA fragmentation by agarose gel electrophoresis" 3.6
C. 3. Flow cytometric analysis of apoptotic cells ...37
C4. Mass measurement of sphinganine ...37
C5. RNA isolation ...38
C. 6. Quantitation of bcl-2, bcI-x, and box mRNA levels ...38
C. 7. Densitometry analysis ...39
C. 8. Differential display reverse transcriptase polymerase chain reaction
(DDRT-PCR) ...39
C9. Northern analysis ...39

C.lO.cDNA cloning ...39

vi

C .1 1. DNA sequencing

C.12. Immunoblot analysis for calmodulin

C. l 3. Cell protein measurement
C.l4. Statistical analyses

D. RESULTS

E. DISCUSSION

...40
...40
...40
...40
...4]
...53

CHAPTER III. SPHINGANINE l-PHOSPHATE MEDIATES CALMODULIN
EXPRESSION INDUCED BY F UMONISIN B, IN LLC-PK, PORCINE RENAL

TUBULAR EPITHELIAL CELLS
A. ABSTRACT
B. INTRODUCTION
C. MATERIALS AND METHODS
C.1. LLC-PK, cell culture
C.2. Materials

C.3. Analysis of DNA fragmentation by agarose gel electrophoresis.
C.4. Differential display reverse transcriptase polymerase chain

reaction (DDRT-PCR)

C.5. Immunoblot analysis for calmodulin

C.6. Northern blot analysis
C.7. Statistical analyses

D. RESULTS

E. DISCUSSION

CHAPTER IV. FUMONISIN B, AND SPHINGANINE REDUCE
PHOSPHORYLATION OF MAPK/ERK AND PKB/AKT IN LLC-PK,
PORCINE RENAL TUBULAR EPITHELIAL CELLS

A. ABSTRACT
B. INTRODUCTION
C. MATERIALS AND METHODS
C. l . Materials
C.2. Cell culture
C.3. Total nucleic acid measurement
C.4. Western blot analysis
C.5. Statistical analyses
D. RESULTS
E. DISCUSSION

CHAPTER V. SUMMARY AND CONCLUSIONS
APPENDICES

LIST OF REFERENCES

vii

...62
...63
...64
...66
...66
..67
.67

...67
...68
...68
...69
...69
...79

...85
...86
...87
...91
...9]
...91
...91
...92
...92
...92
...98

...105
...l 10

...116

Figure 1.1.
Figure 1.2.
Figure 1.3.
Figure 1.4.
Figure 1.5.
Figure 1.6.
Figure 1.7.
Figure 1.8.

Figure 2.1.

Figure 2.2.

Figure 2.3.

Figure 2.4.

Figure 2.5.

Figure 2.6.
Figure 2.7.
Figure 2.8.

Figure 2.9.

Figure 2.10.

LIST OF FIGURES

Structures of fumonisins and related mycotoxins

Structures of fumonisin B, and sphinganine

De nova sphingolipid biosynthesis

Sphingolipid turnover

Sphingolipid signaling and cellular effects

Structures of sphingoid bases

Effects of sphingolipids on cell proliferation signaling pathway
Effects of sphingolipids on apoptotic signaling pathway

Fumonisin B, induces death of LLC-PK, kidney cells

Fumonisin B, causes sphinganine accumulation in LLC-PK, kidney
cells

B—Fluoroalanine blocks sphinganine accumulation and fumonisin
B,-induced DNA fragmentation

B—Fluoroalanine blocks fumonisin B,-induced DNA fragmentation

Fumonisin B, does not affect gene expressions of bax, bc1-2, and
bcl-x

Differential display of cDNAs from kidney cells
Fumonisin-B, induces expression of K3 mRNA
Homology between K3 DNA sequences and human calmodulin

B-Fluoroalanine reduces fumonisin-induced calmodulin
expression

F umonisin B, increases intracellular level of calmodulin protein
in a dose-dependent manner

viii

...12

...16

...18

...20

...22

...24

...29

...42

...43

...45

...48

...49

...50

...51

...52

...54

Figure 2.11.

Figure 3.1.

Figure 3.2.

Figure 3.3.

Figure 3.4.

Figure 3.5.

Figure 3.6.

Figure 3.7.

Figure 3.8.
Figure 4.1.

Figure 4.2.

Figure 4.3.

Figure 4.4.

Figure 4.5.

Figure 4.6.
Figure 4.7.
Figure 4.8.

Figure 5.1

Calmodulin antagonist, W7, blocks fumonisin-induced apoptosis
in LLC-PK, cells

De nova biosynthetic pathway of sphingolipids and inhibition
of ceramide synthase by fumonisin B,

Fumonisin B, increases calmodulin mRNA and calmodulin
protein in a concentration-dependent manners

Fumonisin B, does not affect stability of calmodulin mRNA

Novel gene transcription is required for fumonisin B,-induced
apoptosis

Fumonisin B, selectively induces calmodulin

Depletion of complex sphingolipids does not affect expression of
calmoduolin

Sphingoid bases does not mediate fumonisin-induced calmodulin
expression

Sphinganine l-phosphate induces calmodulin expression

Structures of fumonisin B,, sphinganine, and sphingosine

Fumonisin B, inhibits growth and induces death of LLC-PK, kidney
...93

cells

Sphinganine inhibits growth and induces death of LLC-PK, kidney

cells

Time-dependent changes in the phosphorylation of ERK in control

and fumonisin B,-treated LLC-PK, cells

Fumonisin B, reduces phosphorylated of ERK and MEK, but not
Raf-1

Sphinganine reduces phosphorylated ERK, MEK, but not Raf-l
F umonisin B, reduces phosphorylated Akt.
Sphinganine reduces phosphorylated Akt

Summary of possible molecular mechanism of fumonisin-induced
kidney toxicity

ix

...55

...65

...70

...72

...73

...75

...76

...77

...78

...89

...93

...95

...97

...97

...99

...99

...109

Abbreviations

pg
AGP

BSA
Ca
CAPP
CYP2C1 1
CytoC
EDTA
ERK
F ADD
FBS

g
G3PDH
hrs
IKB
IL

iv

kg
MAPK
MEK
mg
min
ml
NFKB
PCR
PDGF
PI3K
PKB
PKC
pmol
RT

ser

SK

thr
TNF

ABBREVIATIONS

Meaning

Microgram

0t,-acid glycoprotein

Bovine serum albumin

Calcium

Ceramide-activated protein phosphatase
Cytochrome P450 2C 11
Cytochrome C

Ethylenediamine tetraacetic acid
Extracelluar receptor activated kinase
Fas-associated death domain
Fetal bovine serum

Gram

Glyceraldehyde 3-phosphate dehydrogenase
Hours

Inhibitory K B

Interleukin

Intravenous

Kilogram .
Mitogen-activated protein kinase
MAPK kinase

Milligram

Minute

Milliliter

Nuclear factor K B

Polymerase chain reaction
Platelet-derived growth factor
Phosphatidylinositol 3-kinase
Protein kinase B

Protein kinase C

Picomole

Reverse transcriptase

Serine

Sphingosine kinase

Threonine

Tumor necrosis factor

INTRODUCTION

Fumonisins are toxic and carcinogenic mycotoxins produced by F usarium
moniliforme, the most common mold found on corn throughout the world (Marasas, 1996).
Fumonisins cause animal diseases (Wilson et al. , 1990; Harrison et al. , 1990) and have been
associated with esophageal (Marasas et al., 1988), liver (Ueno et al., 1997) and stomach
(Groves et al., 1999) cancers in humans.

The mechanism of action of fumonisins is not clear, but appears to involve disruption
of sphingolipid metabolism. Due to the structural similarity with the sphingoid base
backbones of sphingolipids, fumonisins inhibit ceramide synthase (sphingoid N-
acyltransferase) which acylates sphinganine to form ceramide in the de novo biosynthetic
pathway of sphingolipids. Inhibition by fumonisins results in accumulation of sphinganine
and depletion of complex sphingolipids (Wang et al. , 1991 ; Merrill et al. , 1993a). Complex
sphingolipids mediate cell-cell, cell-substratum, and cell-microbial interactions and serve as
substrates for agonist-induced cell signaling; while, sphingolipid metabolites serve as
bioactive molecules which affect cellular behavior by acting as second messengers for many
growth factors and cytokines. Sphingoid bases, which include sphinganine, have been shown
to arrest cell growth and induce apoptosis, early responses in tissues exposed to fumonisins
(Voss et al. , 2001 ). Apoptosis may mediate fumonisin-induced toxicities in liver and kidney,
the latter being the most sensitive organ (Bondy et al., 1996; Bucci et al., 1998).

Sphingoid bases modulate expression of bcl-2 family genes (Sakakura et al., 1996;
Shirahama et al. , 1997) and decrease activity of MAPK (Raeder et al. , 1999) to suppress cell
proliferation and induce apoptosis, suggesting that these pathways may be affected by

fumonisins. In addition, the PI3K/Akt pathway is a probable target of fumonisins because

 

ceramide (Schubert et al., 2000) and sphingosine (Chang et al., 2001) inactivate Akt to
induce apoptosis.

In the present study, LLC-PK, porcine renal tubular epithelial cells were used as a
model system to examine the type of cell death, the role of disruption of sphingolipid
metabolism and effects on gene expression and cell signaling in the molecular mechanism

of fumonisin-induced kidney toxicity.

CHAPTER 1

LITERATURE REVIEW

A. Fumonisins
A. 1. Introduction

First discovered in 1988 (Gelderblom et al., 1988), the fumonisins are a family of
cytotoxic and carcinogenic mycotoxins produced by F usarium moniliforme and other related
fungi which are common contaminants of corn and other agricultural commodities occurring
in the ﬁeld and during storage in the United States and throughout the world (Marasas,
1996). More than ten types of fumonisins have been isolated and characterized with the ‘B’
series representing the most common of these mycotoxins. Fumonisin B, is the most
prevalent form and has been shown to cause all of the animal diseases associated with
consumption of F. moniliforme culture materials (Riley et al., 1993b); whereas, fumonisin
B2 which is less prevalent exhibited a higher toxicity and more speciﬁc binding to rat
hepatocytes than fumonisin B, (Cawood et al., 1994).

The primary concern about fumonisins is due to the prevalence of Fusarium
moniliforme as a common contaminant of corn. Naturally occurring fumonisins have been
documented in corn (Sydenham et al., 1990) and com-based animal feeds (Plattner et al.,
1991). The extent of contamination of raw corn with fumonisins varies with geographic
location, agronomic and storage practices, and the vulnerability of the plants to fungal
invasion during all phases of growth, storage, and processing. High concentrations of
fumonisins are associated with hot and dry weather followed by periods of high humidity
(Shelby et a1 ., 1994). Numerous studies have reported that fumonisins naturally contaminate
corn at concentrations ranging from <1 to 330 [Lg/g for fumonisin B, and concentrations
ranging from <1 to 48 pg/g for fumonisin B2 which were associated with outbreaks of

porcine pulmonary edema in the United States from 1989 to 1990 (Colvin and Harrison,

1992; Haschek et al., 1992; Osweiler et al., 1992; Ross et al., 1992; Ross et al., 1991).
Furthermore, recent analyses of food-grade corn and com-based food products of United
States origin for human consumption showed that 71% of the samples contained fumonisin
B,, ranging from 43 to 1642 pg/kg (Gutema er al., 2000). The results from this report

suggest that United States consumers are at risk for fumonisin-induced health problems.

A. 2. Toxicity

Fumonisins are associated with a variety of adverse health effects in livestock
animals. Incidence of leukoencephalomalacia in horses has been linked with mold-
contaminated feeds (Wilson et al., 1990) and was reproduced by feeding a horse naturally
contaminated corn screenings (Marasas et al., 1989a) and by orally dosing fumonisin B,
(Kellennan et al., 1990). Fumonisin B, also causes pulmonary edema in pigs (Harrison et
al., 1990; Osweiler et al., 1992). Pulmonary edema which was preceded by respiratory
distress was induced in pigs fed corn screenings containing 155 mg/kg fumonisin B,
(Harrison et al., 1990; Motelin et al., 1994) and in one pig by intravenous injection of 11.3
mg fumonisin B, (Colvin and Harrison, 1992). In addition to lung, both liver and kidney are
target organs of ﬁJmonisin B, in swine (Haschek et al., 1992).

Fumonisins also are toxic for laboratory animals. Progressive toxic hepatitis
characterized by hepatocellular necrosis, bile duct proliferation and ﬁbrosis was observed in
rats treated with fumonisin B, in short-term toxicity tests (Gelderblom etal., 1991). The
chromatin of exposed cells is irregularly condensed and marginated or may be fragmented,
a common feature of apoptotic cells. Also, necrotic hepatocytes are present hours after

exposure to the mycotoxin. Serum chemical indications of hepatocellular injury, including

increased alanine and aspartate transaminase, alkaline phosphatase, and lactate
dehydrogenase activities as well as increased cholesterol and triglyceride concentrations are
routine, early ﬁndings (Voss etal., 2001).

In addition, fumonisin-induced kidney toxicity was reported in rats (Bondy et al.,
1996), lambs (Edrington er al., 1995), and rabbits (Bucci et al., 1998). Whereas
hepatotoxicity was observed with a diet containing 150 mg/kg, renal toxicity was observed
even at concentrations as low as 15-50 mg/kg of fumonisin B, (Voss et al., 1993 ), suggesting
that kidney is more sensitive to fumonisin-induced toxicity than liver (Bondy et al., 1996;
Bucci et al., 1998; Voss et al. , 2001). In Sprague-Dawley and Fischer 344 rats fed fumonisin
B,, males were more sensitive than females (Voss et al. , 2001). As in liver, apoptosis is the
initial microscopic ﬁnding in the kidney and apoptotic cells are initially found exclusively
in tubules of the outer medulla. Mitotic ﬁgures appear and the number of apoptotic cells
increases in the tubule epithelium as tissue injury progresses (Voss etal., 2001). It should
be noted that simultaneous cell loss and replacement has been observed including apoptosis
and mitosis at the cellular level, tubular atrophy and hyperplasia on the histologic level, and
grossly by decreased kidney weight (Voss et al., 2001). The replacement or regeneration
process accompanying apoptosis may mediate, at least in part, fumonisin-induced

carcinogenicity.

A. 3. Carcinogenicity
F umonisin B, is carcinogenic in animals. This mycotoxin causes primary
hepatocellular carcinoma and cholangiocarcinoma in rats at a dietary concentration of 50

mg/kg fed for 18-26 months (Gelderblom et al., 1991). A recent carcinogenicity study by

the National Toxicology Program demonstrated that fumonisin B, induces renal tubule
tumors in male F344 rats and hepatic tumors in female B6C3F mice (Howard et al., 2001).

Fumonisin B, may affect human health in certain areas of the world where corn is a
staple of the diet. Epidemiological studies suggest that there is a strong correlationship
between consumption of fumonisin B, and the incidence of human esophageal cancer in
certain areas of South Africa (Marasas et al., 1988b) and liver and stomach cancers in China
(Ueno et al., 1997; Groves et al., 1999). The high incidence of esophageal cancer in the
Transkei region of South Africa was associated with the consumption of beer brewed with
moldy corn and a nonalcoholic fermented drink made with corn (Rose, 1981). In a sample
of home-grown corn from a high incidence area of esophageal cancer in the Transkei, visibly
healthy kernels contained 44 pg/ g fumonisin B, and F usarium-infected kernels contained 83
[lg/g fumonisin B, (Marasas, 1996). Esophageal basal cell hyperplasia has been
demonstrated in rats by feeding culture material of F. moniliforme (Marasas et al., 1984),
providing a partial explanation for the esophageal cancer epidemic in certain regions of the
world.

The mechanism(s) by which fumonisins cause cancer is not clear. F umonisins were
neither mutagenic in the Salmonella mutagenicity assay (Gelderblom et al., 1991) nor
genotoxic in DNA repair assays using primary rat hepatocytes (Norred et al., 1992).
F umonisin B, was found to be a weak cancer-initiating agent when rats were fed fumonisins
at a level of 100 mg/kg diet for 21 days, for which the intact molecule and the presence of
a free amino group was essential (Gelderblom et al., 1993). In addition, fumonisin B, was
demonstrated to be a strong cancer-promoter for rat liver when diethylnitrosamine was used

as a cancer initiator (Gelderblom et a1 ., 1996b). F umonisin B, exhibited a cancer-promoting

effect in the absence of adverse hepatotoxicity and at dietary levels that did not show any
sign of cancer-initiation. The carcinogenic effects of fumonisins may be due to their
mitogenicity indicated by stimulated DNA synthesis as shown in Swiss 3T3 cells (Schroeder
et al., 1994). Recent advances in the molecular genetics of cancer suggest many
nongenotoxic carcinogens may increase the risk of various types of genetic errors by
stimulating cell division per se (Preston-Martin et al., 1990). For example, cell division is
necessary for conversion of adducts or other single stranded DNA damage to gaps or
mutations (Ames and Gold, 1990; Cohen and Ellwein, 1990). In addition, cell division
allows for mitotic recombinations that result in changes that are more profound than those
from a single mutation (Ramal, 1988). Therefore, it is possible that fumonisins might

promote tumor formation by stimulating cellular proliferation.

A. 4. Structure

F umonisins are categorized as members of either the ‘A’, ‘B’, or ‘C’ series. The ‘B’
series is the most abundant and toxic of the fumonisins. Fumonisin B, is the diester of
propane-1,2,3-tricarboxylic acid and 2-amino-12,16-dimethyl-3,5,10,14,15-
pentahydroxyicosane (Figure 1.1). The propanetricarboxylic acid moieties are esteriﬁed at
the C-14 and C-15 positions of the 20-carbon arninopentol backbone. Less is known about
fumonisins in the ‘A’ and ‘C’ series. Fumonisins in the ‘A’ series have an amino group
which has been acetylated, and they appear to be relatively innocuous (Gelderblom et al.,
1991 ). The ‘C’ series fumonisins lack the l-methyl group. Alternaria alternata lycopersici
(AAL) toxins are structurally related compounds and share similar biological activity with

fumonisin B, (Van Der Westhuizen et al., 1998; Wang et al., 1996).

 

 

cHzcooH
\C-CHZCHCOOH
('3 OH OH H
i 3 Fumonisin B,
oéc-CHZQHCOOH
011200011
on 0” 9“-
Wow” FUMONlSln 32
on 0“ 0H . .
Wow ' Fumomsm A1
on OH OH
W Fumonisin C,
CHa OR 01-13 0H NH2
on 0“ 9”
W Alternaria toxin
cnaoa OH, NH:
‘ [a - cocwcmcoonicnzcooI-q

 

 

 

Figure 1.1. Structures of fumonisins and related mycotoxins.

A. 5. Toxicokinetics

To investigate the distribution and excretion of fumonisins, MC-labeled fumonisin B,
was prepared by the addition of l4C-methionine to a culture of F usarium moniliforme and
used in rats (N orred et al., 1993; Shephard et al., 1994a), swine (Prelusky et al. , 1994), and
laying hens (Vudathala et al., 1994). In rats, fumonisins appear to be absorbed poorly and
excreted rapidly (Norred et al., 1993; Shephard et al., 1994a; Shephard et al., 1995). In
laying hens, fumonisin B, is poorly absorbed and is rapidly eliminated with the level of
residues near negligible (Vudathala et al., 1994). In swine, fumonisin B, is primarily
excreted in feces (~58%) and to a lesser extent in urine (~20%) (Prelusky et al., 1994).
F umonisin B, is rapidly cleared from plasma and showed wide distribution with residues in
liver > kidney > large intestine > brain > lung, heart and adrenal gland (Shephard et al. , 1992;
Prelusky et al., 1994). In bile-cannulated pigs, bile recovery was ~71% with absence of Y
phase, indicating enterohepatic circulation (Prelusky et al. , 1994). Results from both rat and
pig studies indicate the possible enterohepatic circulation of fumonisin B,. Thus, it is
possible that the true bioavailability of fumonisin B, was underestimated because bile
cannulation may have interrupted normal enteroheptatic circulation of fumonisin B, and
increased fecal excretion of the mycotoxin. Importantly, fumonisin residues accumulated
in liver and to a lesser extent in kidney when pigs were fed fumonisins at dietary
concentrations of 2-3 ppm for 24 days (Prelusky et al., 1996). Therefore, consumption of
fumonisin-contaminated diets over extended periods may result in the accumulation of toxic

residues in liver and kidney.

10

t

A. 6. Metabolism

Studies with MC-labeled fumonisin B, also showed that fumonisin B, is not
metabolized by cytochrome P-450 monooxygenase or esterases, and is not a substrate for
hepatic lipases (Cawood et al., 1994). However, partially hydrolyzed (hydrolysis of one of
the ester groups) fumonisin B, was identiﬁed by mass spectrometry and nuclear magnetic
resonance spectroscopy (Shepherd et al. , 1994c). A study focused on the structure-activity
relationships of the fumonisins indicated that the intact molecule is responsible for the toxic
and carcinogenic activity rather than a metabolite (Cawood et al., 1994; Gelderblom et al.,

1993).

A.7. Inhibition of Ceramide Synthase

The chemical structure of fumonisin B, is strikingly similar to that of the sphingolipid
sphinganine including the toxin’s long carbon chain (“backbone”), amine group at the C-2
position, and hydroxyl groups attached to the backbone (Figure1.2). Due to this
relationship, fumonisin B, inhibits sphinganine (sphingosine) N-acyltransferase (ceramide
synthase). Ceramide synthase is responsible for the acylation of sphinganine in the de novo
biosynthetic pathway of sphingolipids as well as the re-acylation of sphingosine that is
released from turnover of complex sphingolipids (Merrill et al., 1993a; Wang et al., 1991).
The ICso for inhibition of ceramide synthase is ~0.1 1.1M and fumonisin B, is competitive
with both sphinganine and the fatty acyl CoA, suggesting that portions of fumonisin B,
occupy both the sphingoid base and the fatty acyl CoA binding sites on ceramide synthase
(Wang et al., 1991).

Inhibition of ceramide synthase by fumonisins causes accumulation of sphingoid

ll

OR Fumonisin B, 0H 0H
CH,

CH3 OR CH, OH NH2
R = cocmcmcoomCHzcoon

Sphinganine OH

WCHZOH

NH2

Figure 1.2. Structures of fumonisin B, and sphinganine.

12

bases, especially, sphinganine. F umonisin-induced sphinganine accumulation was shown
in the tissues of mice (Martinova and Merrill, 1995), rats (Kwon et al., 1997; Riley et al.,
1994a), mink (Restum et al., 1995) and pigs (Riley et al., 1993a). Some of the sphinganine
is metabolized to the l-phosphate and degraded to hexadecanal and ethanolamine phosphate,
the latter being incorporated into phosphatidylethanolamine (Smith and Merrill, 1995).
Sphinganine is also released from cells and appears in the blood and urine of rats (Riley et
al., 1994a), ponies (Wang et al., 1992), mink (Morgan et al., 1997), pigs (Riley et al., 1993a)
and monkeys (Shephard et al., 1996). The sphinganine/sphingosine ratio in blood (Wang et
al., 1992; Riley et al., 1993a) and in urine (Morgan et al., 1997; Riley et al.,1994) has been
proposed as a sensitive indicator of fumonisin exposure.

Inhibition of ceramide synthesis by fumonisins also eventually depletes complex
sphingolipids such as ceramide and sphingomyelin (Riley et al., 1993a; Wang et al., 1992).
However, complex sphingolipids differentially respond to fumonisin B,. For example.
sphingomyelin was more rapidly depleted than glycosphingolipids (Meivar Levy and
Futerman, 1999; Merrill et al., 1993a). The fumonisin B,-induced alterations in complex
sphingolipids may be responsible for various morphological changes seen in cell culture.
Fumonisin B, disrupted axonal growth in cultured hippocampal neurons (Harel and
Futerman, 1993) by affecting the formation or stabilization of axonal branches (Schwarz et
al., 1995). Long-term culture with fumonisin B, affected ﬁbroblast morphology and
proliferation with a concomitant decrease in the synthesis of ganglioside GM3, the major
glycosphingolipid in 3T3 ﬁbroblasts and of sphingomyelin (Meivar Levy et al., 1997). All
of the effects of fumonisin B, on cell morphology were reversed by addition of ganglioside

GM3 even in the presence of fumonisin B, ; whereas, the bioactive intermediates sphinganine,

l3

sphingosine, and ceramide had no effect. These data suggest that disruption of complex

sphingolipid synthesis by fumonisin B, can impair the structural integrity of cells.

B. SPHINGOLIPIDS
B. 1. Introduction

Sphingolipids are characterized by a common structural feature, i.e., a sphingoid base
backbone such as D-erythro-l,3-dihydroxy-2-aminooctadec-4-ene (sphingosine). The
“sphingosine” backbone was named by J. L. W. Thudichum in 1884 for its enigmatic
(“Sphinx-like”) properties while he was studying the chemical constituents of brain
(Thudichum, 1 884). Sphingolipids are found in all eucaryotic cells, where they are especially
rich in the plasma membrane and the membranes of organelles responsible for their synthesis
(endoplasmic reticulum and Golgi) and degradation (endosomes and lysosomes). The
sphingolipids of mammalian tissues, lipoproteins, and milk include ceramides,
sphingomyelins, cerebrosides, gangliosides and sulfatides.

Sphingolipids are constituents of most foods. The sphingolipid content of pork, beef,
and chicken is ~0.3 - 0.5 pmol/g (Blank et al., 1992). Whole milk, butter, and cheese
contain ~0.5 - 1.0 pmol/g (Zeisel et al., 1986; Ahn and Schroeder, 2002). The sphingolipid
content is relatively low in plant foods with the exception of soybean which contains ~2
pmol/g (Ohnishi and Fujino, 1982; Ahn and Schroeder, 2002). Dietary sphingolipids are
hydrolyzed throughout the intestine (N ilsson, 1969; Schmelz et al. , 1994).

Sphingolipids are involved in the signal transduction pathways that mediate cell
growth, differentiation and cell death. Hydrolysis of sphingomyelin by sphingomyelinase

generates ceramide as a cellular second messenger for tumor necrosis factor-0t (TNF-(x), IL-

14

l B, and other cytokines. Subsequently, ceramide can be hydrolyzed by multiple ceramidases
to generate sphingosine in response to IL-IB (N ikolova-Karakashian er al., 1997) and may
be further phosphorylated to form sphingosine l-phosphate in response to PDGF (Olivera
et al., 1999a). Sphingosine and sphingosine l-phosphate modulate a variety of targets,
mobilize cellular calcium, and regulate cell proliferation (Merrill eta]. , 1997a). Perturbation
of sphingolipid metabolism by key enzyme inhibitors such as fumonisins appears to cause

abnormal cell functions and certain diseases.

B. 2. De nova Biosynthesis

Sphingolipids are synthesized de novo from the amino acid serine and palmitoyl CoA
(Figurel .3). In the endoplasmic reticulum, serine palmitoyltransferase condenses the two
molecules to form 3-ketosphinganine which NADPH-dependent reductase rapidly reduces
to form sphinganine, a free sphingoid base. Sphinganine is N—acylated with a long-chain
fatty acid to form N-acyl-sphinganine (dihydroceramide) by ceramide synthase.
Subsequently, a 4,5-trans double bond is introduced to form ceramide (N—acyl-sphingosine)
(Merrill and Wang, 1992; Rother et al. , 1992). Additional reactions take place in the Golgi
apparatus where head groups are added. For example, the transfer of a phosphorylcholine
head group from phosphatidylcholine to the 1 position of ceramide yields sphingomyelin
(Futerrnan and Pagano, 1991). Currently there are more than 300 known sphingolipids with
distinct head groups (Bell et al. , 1993). All contain a long-chain (sphingoid) base backbone
with D-erythra-sphingosine being the most prevalent backbone. However, there are more
than 60 different sphingoid base backbones that vary in lengths of alkyl chain from 14 to 22

carbon atoms, degree of saturation and position of the double bonds, presence of a hydroxyl

15

0

COOH 20H Palmitoyl CoA
Serine X0] + W

H NH2 l SCoA

i OH OH

NH

W

l OH OPO3'CH2CH2N+(CH3) 3

NH

WVWWVY

sphingomyelin 0

Figure 1.3. De nova sphingolipid biosynthesis

16

group at position 4 and branching of the alkyl chain (Karlsson, 1970). Sphinganine and other
intermediates in the de novo biosynthetic pathway of sphingolipids are highly bioactive and,
under normal conditions, the cellular concentrations of these compounds are kept very low

(Merrill et al., 1986).

B. 3. Turnover

The ordinary turnover of sphingolipids involves removal of the head groups such as
phosphorylcholine from sphingomyelin by sphingomyelinases in the lysosomes (F igurel .4).
Ceramidase catalyzes the cleavage of the amide-linked fatty acid of ceramide to form free
sphingosine. Sphingosine can then be either reacylated to form ceramide or phosphorylated
via sphingosine kinase to form sphingosine l-phosphate (Stoffel er al., 1968, 1970).
Subsequently, sphingosine l-phosphate is cleaved to form ethanolamine phosphate and
trans-2-hexadecanal by a pyridoxal phosphate-dependent lyase located in endoplasmic
reticulum (Stoffel et al., 1968). The ethanolamine phosphate may be used for the synthesis
of phosphatidylethanolamine and phosphatidylcholine. Another possibility for the
metabolism of sphingosine has been suggested to involve methylation to form di- and

trimethyl sphingosine (lgarashi et al., 1990; Hakomori and Igarashi, 1993).

B. 4. Sphingolipid Signaling

In addition to the normal turnover of sphingolipids. the metabolism of sphingolipids
has evolved as an important metabolic pathway which plays essential roles in the production
of cellular messengers to regulate cell behavior. That is, complex sphingolipids in

membranes may also serve as substrates for agonist-induced signaling. The resulting

17

OH opo,-CH,CH2N+(CH3) 3

Sphingomyelin NH
OH OH
Ceramide WW
OH OH
Sphingosine kinasel NH2

OH OPO3H,

Sphing°8ine 1W
1 NH,

/\/\/\/\/\/\M + NH,CH,OPO,H,

Hexadecanal O Ethanolamine phosphate

Ether lipids Phosphatidylethanolamine

Figure 1.4. Sphingolipid turnover

18

sphingolipid metabolites mediate a variety of cellular processes (Figure1.5). TNF-0t,
interferon-Y, (Kim et al. , 1991 ) and 1a-25-dihydroxyvitamin D3 (Okazaki et al. , 1989, 1990)
induces sphingomyelin hydrolysis by sphingomyelinase to produce ceramide which triggers
monocytic differentiation of human premyelocytic leukemia HL-60 cells. A number of
studies indicate that ceramide may regulate cell growth, either by inhibiting proliferation of
normal ﬁbroblasts (Hannun, 1994; Venable et al., 1994) or inducing proliferation of
conﬂuent, quiescent 3T3 ﬁbroblasts (Olivera and Spiegel, 1993).

Ceramide is a well-known mediator of programmed cell death or apoptosis, induced
by TNF-oz, F as ligand, and ionizing radiation (Cifone et al., 1994; Haimovitz-Friedman et
al. , 1994; Kolesnick and Golde, 1994; Obeid er al. , 1993; Hannun, 1994). TNF-0t is coupled
to sphingomyelinase to produce ceramide (Kim et al., 1991), but the mechanism is not
clearly understood. Exogenously added ceramide also induces apoptosis in various cell lines
(Bielawska et al., 1997; Charles et al., 2001; Dawson et al., 1998; Hannun and Obeid, 1995;
Jarvis et al., 1996; Saba et al., 1996). However, anti-apoptotic bcl-Z antagonizes ceramide
action and prevents apoptosis (Pinton et al., 2001; Wieder et al., 1997; Zhang et al., 1996).

Ceramide appears to act by affecting signaling molecules involved in the regulation
of cell proliferation and apoptosis. Rafl is phosphorylated by a ceramide-activated protein
kinase, activating the MAPK cascades (Raines et al., 1993; Yao et al., 1995). Also, a
cytosolic ceramide-activated protein phosphatase (CAPP) has been identiﬁed as a molecular
target for the action of ceramide (Dobrowsky and Hannun, 1992; Hannun, 1994). Okadaic
acid, a phosphatase inhibitor, prevented ceramide-induced apoptosis and CAPP activity
correlates with growth inhibition in numerous cell types (Hannun, 1994). Recently, ceramide

was shown to induce dephosphorylation of Akt (protein kinase B) at serine 473, suggesting

l9

Agonist\

   

Receptor

Sphingomyeli
Sphingomyelinase 1 OH OH
_ R Growth inhibitory,
Ceramide R cytotoxic/pro-apoptotic
Ceramidase l O
Sphingosine R OH OH Growth inhibitory.
cytotoxic/pro-apoptotic
Sphingosine l 2
kinase
. . OH OPO H
Sphmgosme 1-P R 3 2 Growth stimulatory.

anti-apoptotic

Figure 1.5. Sphingolipid signaling and cellular effects

20

activation of a phosphatase (Schubert et al. , 2000). Since Akt is involved in the activation
of the cell proliferation pathway and regulation of apoptosis (Krasilnikov, 2000; Zhou et al. ,
2000; Zundel and Giaccia, 1998), inhibition of Akt activity by ceramide-induced
dephosphorylation may be one of the mechanisms by which ceramide inhibits growth and
induces apoptosis.

Some of the actions of ceramide in cellular processes appear to be mediated by
deacylation to sphingosine which also is a putative second messenger. For example, IL-l B
induces the hydrolysis of sphingomyelin to ceramide in primary cultures of rat hepatocytes
and ceramide has been suggested to play a role in the down regulation of cytochrome p450
2C1 1 (CYP2C1 l ) and induction of a,-acid glycoprotein (AGP) (Chen et al. , 1995). Further,
IL-l B increased not only sphingomyelinase activity, but also ceramidase with a concomitant
increase of cellular sphingosine. Sphingosine was more potent than C2-ceramide in down-
regulation of CYP2C1 l (N ikolova-Karakashian et aI. , 1997), suggesting that sphingosine is
a mediator of the regulation of CYP2C 11 by IL-1 B. The sphingoid bases, sphingosine and
sphinganine (Figure1.6), are produced from the metabolism of ceramide by ceramidase and
during the de novo biosynthesis of sphingolipids, respectively (F igurel .3 and 1.4), and have
received signiﬁcant attention due to their inhibitory action on protein kinase C (PKC)
(Hannun et al., 1986; Hannun and Bell, 1987) and PKC-dependent cellular processes in
platelets (Hannun et al., 1986), neutrophils (Wilson et al., 1986), and HL-60 cells (Merrill
et al., 1986). Sphingosine is competitive with diacylglycerol, phorbol dibutyrate, and Ca“,
and also blocks PKC activation by unsaturated fatty acids and other lipids (el Touny et al.,
1990; Oishi et al., 1988; Wilson et al., 1986).

Like ceramide, sphingoid bases have been shown to be growth inhibitory (Merrill et

21

 

 

Sphinganine OH OH

/\/\/\/\/\/\W

NH,
Sphingosine OH OH
WW
NH,

 

Figure 1.6. Structures of sphingoid bases.

22

 

al., 1986; Chao et al., 1992; Dbaibo et al., 1995; Spiegel et al., 1993) and to induce apoptosis
(Smyth et al., 1997; Dawson et al., 1998; Ohta et al., 1995; Shirahama et al., 1997; Jarvis
et al., 1996; Sakakura et al., 1998). Sphingoid bases may cause cell death by affecting key
signaling molecules that are involved in regulating cell growth and apoptosis. In addition
to inhibiting PKC, sphingosine has been shown to inhibit phorbol dibutyrate binding (Merrill
et al., 1986; Hannun et al., 1986), inhibit cell growth by arresting the cell cycle in the Go/G,
phase (Chao et al., 1992; Dbaibo et al., 1995), activate the tumor suppressor, retinoblastoma
protein, by inducing dephosphorylation (Pushkareva er al., 1995), inhibit p42/p44 MAPK
activity (Sakakura et al. , 1998) and induce release of Ca++ from intracellular stores (probably
via conversion to sphingosine 1-phosphate [SPP])(Ghosh et al., 1990). Recently,
sphingosine also has been shown to dephosphorylate Akt during induction of hepatoma cell
apoptosis (Chang et al. , 2001) (Figure 1.7). In addition, sphingosine suppresses expression
of bcl-2 in human leukemic HL-60 cells (Sakakura et al., 1996) and bcl-x in human prostatic
carcinoma DU-145 cells (Shirahama et al., 1997) during apoptosis.

Addition of a phosphate group on sphingoid bases (sphingosine or sphinganine) by
sphingosine kinase produces sphingoid base l-phosphates (SPP), the phosphorylated
metabolites of sphingoid bases. In contrast to sphingoid bases, in most cases, SPP have been
found to be growth stimulatory and anti-apoptotic (Conway et al., 1997; Olivera et al.,
1999b; Spiegel, 1999). Platelet-derived growth factor (PDGF) stimulates sphingosine kinase
activity and SPP acts as a second messenger in cell proliferation induced by PDGF and fetal
calf serum (Olivera et al., 1999a; Olivera and Spiegel, 1993). Rapid activation of the
Raf/ERK pathway (Wu et al., 1995) and increased DNA binding activity of activator protein-

] (AP-l) (Su et al., 1994) also may mediate the mitogenic effects of SPP, resulting in cell

23

 

 

  

Sphingoid bases /| Ras J\

 

lCaspase 9|

 

. * Phosphate Group

Figure 1.7. Effects of sphingolipids on cell proliferation signaling pathways

24

proliferation. SPP mediates nerve growth factor-induced neuronal survival and
differentiation and has been shown to inhibit caspase activation during Fas- and ceramide-
mediated apoptosis in Jurkat T lymphocytes (Cuvillier et al. , 1998). In rat periosteal RP-l 1
cells, SPP mediates the inhibition of apoptosis by forskolin-induced cAMP via stimulation
of sphingosine kinase activity (Machwate et al., 1998). Recent work by Olivera et al.
(1999b) demonstrated that overexpression of sphingosine kinase markedly increased the
concentration of SPP in NIH 3T3 ﬁbroblasts and HEK293 cells and is sufﬁcient to promote
growth in low-serum media, expedite the G,/S transition, and increase DNA synthesis.
Furthermore, overexpression of sphingosine kinase in NIH 3T3 cells protected against
ceramide-induced apoptosis (Olivera et al., 1999b). Since SPP can be produced from the
metabolism of ceramide (Figurel.4), it has been suggested that the balance between
intracellular ceramide and SPP may determine the cell fate (Cuvillier et al. , 1996). It should
be noted, however, SPP inhibits proliferation of human hepatic ’myoﬁbroblasts (Davaille et
al., 2000). Therefore, SPP may be growth inhibitory and/or apoptotic under certain
conditions.

SPP may mediate the mitogenic effects of sphingoid bases. In Swiss 3T3 cells,
sphingosine stimulated cellular proliferation via a protein kinase C-independent pathway
(Zhang et al., 1990). Sphingosine induced a rapid increase in SPP levels in a concentration-
dependent manner and there was a strong correlation with sphingosine’s effect on DNA
synthesis (Zhang et al., 1991). When added together, there was no additive or synergistic
effect, suggesting that sphingosine and SPP modulate cellular proliferation through a
common pathway (Zhang et al., 1991). Both sphingosine and SPP potently mobilize calcium

from internal stores with SPP acting more rapidly than sphingosine (Mattie et al., 1994;

25

Olivera et al., 1994; Zhang et al., 1991) and both activate phospholipase D (Desai et al.,

1992), well known events in the control of cellular proliferation.

B. 5. Disruption of Sphingolipid Metabolism as a Causative Factor in Fumonisin-
induced Toxicity

Fumonisins are cytotoxic and carcinogenic and this appears to be due to their cell-
type speciﬁc effects on cellular behavior. Fumonisin B, is apoptotic in some cells while
being mitogenic in others. The mechanism of action of fumonisins is not clearly understood
but inhibition of ceramide synthase by fumonisins and the consequent depletion of complex
sphingolipids and accumulation of sphinganine and metabolites may mediate the actions of
fumonisins. Inhibition of acylation of sphinganine by fumonisins ultimately depletes
complex sphingolipids and their role in fumonisin-induced toxicity is not clearly understood.
Complex sphingolipids have been suggested to be involved in the regulation of cell growth
and differentiation. Their proﬁles change as cells grow (Hakomori, 1981) and the majority
of the glycosphingolipids and sphingomyelin are located in the external leaﬂet of the plasma
membrane (Miller-Podraza et al., 1982), where they interact with cell surface receptors and
mediate cell-cell, cell substratum, and cell-microbial interactions. This is further supported
by results from in vitro studies which demonstrated that exogenously added gangliosides GM,
or GM, inhibited cell growth by delaying the G, phase of the cell cycle (Laine and Hakomori,
1973) and can make cells refractory to growth stimulation by growth factors (Bremer and
Hakomori, 1982). Also, addition of ganglioside GM3 induced HL-60 cells to differentiate into
monocyte-like cells (Saito et al. , 1985). On the other hand, removal of ganglioside GM, by

adding the B-subunit of cholera toxin or antibody which binds to this ganglioside is

26

mitogenic (Spiegel et al. , 1985) and potentiates the response to the growth factors (Spiegel
and Fishman, 1987). Therefore, complex sphingolipids including gangliosides may play
crucial roles in the regulation of cell growth and differentiation and their depletion during
long-term exposure to fumonisins could contribute to carcinogenicity and other toxicities
caused by fumonisins. Further investigations are needed to determine the role of depletion
of complex sphingolipids in ﬁJmonisin-induced toxicities.

The most well known consequence of fumonisin exposure is the accumulation of
sphingoid bases which have been shown to inhibit cell growth and induce apoptosis
(Figurel .5). Therefore, fumonisins may exert their toxicity via accumulation of sphinganine.
The cytotoxic and apoptotic effects of sphingoid bases could be due to their inhibitory effect
on protein kinase C (PKC), an important regulator of cell proliferation (Hannun and Bell,
1986). One of the major downstream targets of PKC is p44/p42 MAPK (or ERK) of which
phosphorylation leads to phosphorylation and activation of activator protein-1 (AP-1). AP-l
consists of dimers of fas and jun and regulates expression of genes involved in cell growth.
Inhibition of ERK activity by sphingosine has been suggested to be a partial mechanism of
action in sphingosine-induced apoptosis in various tumor cell lines (Sakakura et al., 1998).
Therefore, fumonisin-induced sphinganine accumulation and down-regulation of ERK
activity may contribute to fumonisin-induced cell death.

Apoptosis often accompanies the suppression of anti-apoptotic signals such as
PI3K/Akt (Jarvis et al. , 1997). The P13 K/Akt signaling pathway has been shown to mediate
both Ras- and cytokine-induced protection from apoptosis. Activation of P13K recruits Akt
to the plasma membrane where Akt is phosphorylated at serine 473 and threonine 308

(Stephens et al., 1998; Stokoe et al., 1997). Akt is a serine/threonine kinase involved in the

27

regulation of apoptosis via Bad and caspase-9 (Figure 1.8) (Krasilnikov, 2000; Zhou et al.,
2000; Zundel and Giaccia, 1998). Phosphorylation of Akt activates its kinase function so
that it may add a phosphate group on substrates such as the bcl-2 family protein Bad and
caspase 9 (Krasilnikov, 2000). Phosphorylation of Bad serves as an anti-apoptosis signal
by allowing bcl-x to inhibit release of cytochrome C from the mitochondria into the cytosol,
which is a critical event in apoptosis. Also, phosphorylation of caspase 9 inhibits cleavage
which is an activation process, preventing further activation of caspase 3, the executive
protease protein in apoptosis. Recently, ceramide has been shown to dephosphorylate Akt
and Bad during apoptosis (Basu et a1 ., 1998; Schubert et al., 2000). Inhibition of Akt activity
by ceramide-induced dephosphorylation may be one of the mechanisms of ceramide action
in its effect on growth inhibition and apoptosis induction. Importantly, sphingosine appears
to mediate the action of ceramide on Akt because sphingosine also has been shown to reduce
phosphorylation of Akt with concomitant reduction of its activity during sphingosine-induced
apoptosis in human hepatoma cells (Chang et al., 2001). Moreover, expression of
constitutively active Akt prevented sphingosine-induced apoptosis (Chang et al., 2001).
Thus, fumonisin-induced sphinganine accumulation could induce Akt dephosphorylation and
trigger cascades of molecular events to induce cell death.

Sphingoid bases also may affect expression of genes involved in the regulation of cell
survival and apoptosis. Numerous apoptotic agents depend on gene expression for their
effects. Those genes in which expression has been documented to play a role in the apoptotic
process include p53 tumor suppressor gene (Attardi et al., 1996; Bouvet et al., 1998), bcl-2
family member genes (Bargou et al., 1995a; Bargou et al., 1995b; Bruckheimer et al., 1998;

Ealovega et al., 1996; Kondo et al., 1994), c-myc (Desbarats et al., 1996; Donzelli et al.,

28

 
   
   

Sphingoid
bases

. Cytochrome C

@® 0 Phosphate Group
-B
--11
——» +
-> Apoptosis

Figure 1.8. Effects of sphingolipids on apoptotic signaling pathway

29

1999; Galderisi er al., 1999; Kihara Negishi et al., 1998; Wang et al., 1997), calmodulin
(Dowd et al., 1991), heat-shock protein 70 (Garcia Bermejo et al., 1997), E 1 A (Putzer et al.,
2000), and poly (ADP-ribose) polymerase (Putzer et al., 2000). Sphingoid bases suppress
expression of bcl-2 (Sakakura et al., 1996) and bcl-x (Shirahama et al., 1997) which are
involved in regulating apoptosis (Figure 1.8). Therefore, it is possible that fumonisin-
induced sphinganine accumulation affects expression of these genes to induce apoptosis.
Fumonisin B, was mitogenic and induced DNA synthesis in Swiss 3T3 cells
(Schroeder et al., 1994). Fumonisin-induced mitogenicity was sphinganine-dependent
because prevention of sphinganine accumulation using B-ﬂuoroalanine inhibited fumonisin-
induced DNA synthesis. Also, the exogenous addition of sphingoid bases stimulates DNA
synthesis in Swiss 3T3 cells (Zhang et al., 1990), suggesting that fumonisin-induced DNA
synthesis is due to sphinganine accumulation. Therefore, it appears that fumonisin-induced
sphinganine accumulation has bimodal effects on cell growth depending on cell type. Both
the apoptotic and proliferative processes may be regulated by a similar signaling pathway
(Desbarats et al., 1996) and may involve a similar pattern of early gene responses (Grassilli
et al., 1992). Therefore, fumonisin B, may affect expression of genes that are involved in

both apoptosis and cell proliferation, inducing either cytotoxicity and carcinogenicity.

C. LLC-PK, RENAL TUBULAR EPITHELIAL CELLS AS A MODEL

LLC-PK, renal epithelial cells appear to be a good model system for the study of the
mechanism of action of fumonisins. Kidney is the most sensitive organ to fumonisin-
induced toxicity (Gumprecht et al., 1995; Riley et al., 1994a) with the primary target

appearing to be the renal tubular epithelial cell. Fumonisin B, inhibited growth and

30

increased death in LLC-PK, cells with an early increase of intracellular sphinganine (Yoo et
al., 1996). The dose of fumonisin B, which caused sphinganine accumulation was similar
to the dose which caused toxicity, suggesting a possible relationship between sphinganine

accumulation and fumonisin-induced toxicity (Yoo et al., 1992).

D. HYPOTHESIS AND SPECIFIC AIMS
This study is based on the hypothesis that fumonisin-induced kidney toxicity is
mediated by disruption of sphingolipid metabolism. In this study, B-ﬂuoroalanine, an
inhibitor of serine palmitoyltransferase, will be used to dissect and differentiate the role of
sphinganine accumulation and complex sphingolipid depletion in fumonisin-induced kidney
toxicity. This study with LLC-PK, cells would help to better understand the role of
disruption of sphingolipid metabolism in fumonisin-induced cytotoxicity and carcinogenicity
in kidney and other tissues. The speciﬁc aims are:
(1) Determine whether fumonisin B, kills cells by inducing apoptosis and evaluate the
role of disruption of sphingolipid metabolism in fumonisin-induced cell death
(2) Identify genes affected by fumonisin B, and investigate the molecular mechanism
whereby fumonisin B, induces gene expression
(3) Determine whether fumonisin B, affects signaling pathways involved in cell

proliferation and cell death

31

CHAPTER II

FUMONISIN B, INDUCES APOPTOSIS IN LLC-PK, RENAL EPITHELIAL
CELLS VIA A SPHINGANINE- AND CALMODULIN-DEPENDENT PATHWAY

32

A. ABSTRACT

Fumonisins are a family of mycotoxins produced by F usarium moniliforme, which
is the most common mold found on corn throughout the world. These compounds are both
toxic and carcinogenic for animals, and perhaps humans, with the kidney being the most
sensitive organ to fumonisin toxicity. The molecular mechanism of fumonisin toxicity
appears to involve disruption of de novo biosynthesis of sphingolipids and accumulation of
sphinganine. The goals of this study were to determine whether fumonisin B, kills LLC-PK,
renal kidney epithelial cells by inducing apoptosis and to identify genes affected by
sphinganine that mediate fumonisin B,-induced cell death. F umonisin B, produced
morphological changes (i.e., cell shrinkage, membrane blebbing) and time-dependent
increases in DNA fragmentation demonstrating that the toxin induces apoptosis.
Simultaneously, fumonisin B, blocked sphingolipid biosynthesis and caused accumulation
of sphinganine. To further investigate the role of sphinganine in fumonisin B,-induced
apoptosis, B-ﬂuoroalanine (BFA) was used to inhibit serine palmitoyltransferase, which
catalyzes an earlier step in the sphingolipid biosynthetic pathway. BFA blocked sphinganine
accumulation and prevented fumonisin B,-induced DNA fragmentation, conﬁrming that
apoptosis induced by fumonisin B, is dependent upon accumulation of sphinganine. To
examine gene expression, differential display reverse transcriptase polymerase chain reaction
(DDRT-PCR) was applied to RNA isolated after 16 h of exposure to fumonisin B,.
Differential expression in response to fumonisin B, of a gene identiﬁed as calmodulin has
been veriﬁed by Northern analysis. Sphinganine appears to mediate the effect because BFA
reduces induction of calmodulin mRNA by fumonisin B,. Fumonisin B, also increases

calmodulin protein in a concentration-dependent manner and the calmodulin antagonist W7

33

blocks fumonisin B,-induced DNA fragmentation, supporting a role for calmodulin in
fumonisin B,-induced apoptosis. In contrast, fumonisin B, has no effect on expression of
bcl-2 family genes (box, bcl-Z, and bcl-x). These ﬁndings demonstrate that fumonisin B,
kills LLC-PK, kidney cells by inducing apoptosis. Further, the results establish a sequence
of events for fumonisin B,-induced apoptosis involving initial disruption of sphingolipid
metabolism and accumulation of sphinganine (or a metabolite), which, in turn, induces

expression of calmodulin.

B. INTRODUCTION

Fumonisins are a family of cytotoxic and carcinogenic mycotoxins produced by
F usarium monilifome, one of the most common molds found on corn and other agricultural
commodities in the United States and throughout the world (Marasas, 1996). Interest in the
fumonisin mycotoxins arises, in part, because of their adverse effects on animal health.
Fumonisins cause equine leukoencephalomalacia and hepatotoxicity (Marasas et al., 1988),
porcine pulmonary edema (Harrison et al., 1990), and renal toxicity, hepatotoxicity, and liver
cancer in rats (Gelderblom et al., 1988), with the kidney being the most sensitive organ to
fumonisin toxicity (Bucci et al., 1998; Gumprecht et al., 1995). F umonisins also may pose
a threat to human health, as consumption of contaminated maize has been correlated with
esophageal cancer in areas of southern Aﬁica, China, and other countries (Marasas, 1996).

Fumonisin toxicity appears to be mediated by disruption of sphingolipid metabolism
(Merrill et al., 1 997 a). Fumonisins bear a remarkable structural resemblance to sphingosine
and sphinganine, the long-chain (sphingoid) base backbones of more complex sphingolipids,

and block de navo biosynthesis of sphingolipids by potently inhibiting sphingosine

34

(sphinganine) N—acyltransferase (Norred et al., 1992; Wang et al., 1991; Yoo et al., 1992).
The inhibition causes depletion of more complex sphingolipids and accumulation of
sphinganine (and sometimes sphingosine) in a variety of cultured cells (N orred et al., 1992;
Wang et al.,1991; Yoo et al.,1992; Schroeder et al., 1994; Tolleson et al., 1999) and in the
sera, liver, kidney, and urine of animals fed contaminated grains (Merrill et al., 1997b;
Morgan et al., 1997; Riley et al., 1993a, 1994b; van der Westhuizen et al., 2001; Wang et
al., 1992). Studies using a renal kidney epithelial cell line (LLC-PK,) have demonstrated
a strong association between accumulation of sphinganine caused by fumonisin B, and
inhibition of cell growth. morphological changes, and increased cell death (Y 00 et al., 1992,
1996).

The mode by which fumonisin B, kills LLC-PK, kidney cells is not known; however,
the mycotoxin induces apoptosis in other cell types and in viva (Lim et al., 1996; Tolleson
et al., 1996a, 1996b, 1999; Sharma etal., 1997; Wang et al., 1996). Moreover, Tolleson et
al. (1996a, 1996b, 1999) have shown that exogenous sphinganine induces apoptosis in
human keratinocytes and that addition of B-haloalanine blocks fumonisin B,-induced
sphinganine accumulation and DNA fragmentation, suggesting that accumulation of
sphinganine plays a key role in apoptosis induced by fumonisin B,. Apoptosis induced by
sphingosine in HL-60 cells is accompanied by a decrease in expression of bcl-2, an apoptosis
suppresser gene (Sakakura et al., 1996). In addition, sphingosine induces apoptosis in
androgen-independent human prostatic carcinoma DU-145 cells by down-regulating bcl-xL
(Shirahama et al., 1997). Thus, sphingoid bases may mediate fumonisin-induced cell death
by altering expression of a key gene(s).

This study used LLC-PK, renal kidney epithelial cells as a model system to test the

35

hypothesis that fumonisin B, kills the cells by inducing apoptosis. Further, this study also
tested the hypothesis that sphinganine accumulation caused by fumonisin B, mediates cell
death by altering gene expression. Based on previous ﬁndings that sphingoid bases alter the
expression of bcl-2 family genes, we have examined the effect of fumonisin B, on expression
of members of this gene family. In addition, we have used differential display reverse
transcriptase PCR as an unbiased approach to examine the inﬂuence of fumonisin B, on

expression of other genes.

C. MATERIALS AND METHODS

C.l. Reagents and cell culture a-33P-dCTP was obtained from DuPont NEN and C20-
sphinganine was obtained from Matreya Co. All other reagents were obtained from Sigma
Chemical (St. Louis, MO) unless otherwise noted. Porcine kidney epithelial LLC-PK, cells
were obtained from American Type Culture Collection (ATCC) and cultured in Dulbecco’s
Modiﬁed Eagle Medium/F-12K nutrient solution (Gibco BRL) (1:1) with 5% fetal bovine
serum (FBS), 100 units/ml penicillin, 100 jig/ml streptomycin sulfate, and 100 pM of L-
serine (Gibco BRL). Cells were treated when they were 70-80 % conﬂuent.

C.2. Analysis of DNA fragmentation by agarose gel electrophoresis assay Frﬁrwig
treatments, fragmented DNA from LLC-PKl cells was extracted as described (Sellins and
Cohen, 1987). In brief, cells from 100-mm dish were harvested using rubber policeman and
collected by centrifugation (5 min, 500 g). The medium was removed and the cell pellet was
resuspended in phosphate-buffered saline (PBS). After another centrifuge, the pellet was
suspended in 0.1 ml hypotonic lysis buffer (10 mM Tris, 10 mM EDTA, 0.5% Triton X-100,

pH 8.0). Cells were incubated for 10 min at 4°C and the lysate was centrifuged (30 min,

36

13,000 g, 4 ° C). The supernatant containing fragmented DNA was treated with RNase A (0.4
pg/pl) for 1 h at 37°C and then incubated with proteinase K (0.4 lag/pl) for 1 h at 37°C.
DNA was precipitated overnight by incubation at -20°C in 50% isopropanol and 0.5 M
NaCl. The DNA precipitate was pelleted by centrifugation (30 min, 13,000 g, 4°C),
dissolved in distilled H,O and then electrophoresed in a 2 % agarose gel containing ethidium
bromide (0.5 jig/ml) in 0.5X Tris-borate-EDTA buffer. After electrophoresis, DNA was
visualized with a UV transilluminator and photographs were taken using a Polaroid system.
C.3. Flow cytometric analysis of apoptotic cells. Flow cytometric analysis was
performed as described by Telford et al. (1994) with modiﬁcations. Brieﬂy, treated cells
were collected by trypsinization and resuspended into single cell suspension in culture media
and ﬁxed with 70% ethanol, reaching ﬁnal concentration of 50-53%.. Cells were pelleted
and resuspended in PBS (pH 7.4) containing 0.1% Triton X-100, 0.1 mM EDTA. After
pelleting the cells again, cells were resuspended with DNA staining solution (50 pg/mL
propidium iodide, 0.1% Triton X-100, 100 11M EDTA, and 0.05 mg/mL RNase A) and
analyzed for the percentage of cells in the sub-GO/Gl using a F ACS Vantage Flow
Cytometer (Becton Dickinson, San Jose, CA).

C.4. Mass measurement of sphinganine The cellular concentration of sphinganine was
determined using HPLC method (Merrill er al. , 1988). Brieﬂy, cells were harvested in PBS
and the unnatural sphingoid base, C20-sphinganine, was added as an internal standard. The
sphingoid bases were extracted with chloroform and methanol and treated with base to
remove interfering glycerolipids. After preparation of the o-phthalaldehyde derivatives, the
long-chain bases were separated by reverse-phase HPLC using a C18 column and eluted

isocratically with methanolz5mM potassium phosphate, pH 7.0 (90:10).

37

C.5. RNA isolation Total RNA was isolated by the method of Chomczynski and
Sacchi (1987) using RNA STAT 60 (Tel-Test). The integrity and the equal amount of the
RNA was veriﬁed by examining 28S and 18S bands on 1.0% formaldehyde-agarose gel
containing ethidium bromide (0.5 pg/mL).

C.6. Quantitation of bcl-2, bcl-x and bax mRNA levels Competitive RT-PCR
was used to quantitate bcl-2, bcI-x and box mRNA levels (Wang et al, 1995). This method
is based on a competitive PCR approach using non-homologous internal standards called
PCR MIMICs with the use of the PCR-MIMIC construction kit (C lontech Laboratories, Palo
Alto, CA). MIMICs are DNA fragments constructed for use in competitive PCR
ampliﬁcation for quantitation of target mRNA levels. Each PCR MIMIC consists of a
heterologous DNA fragment with primer templates that are recognized by a pair of gene-
speciﬁc primers. Thus, these templates “mimic” the target and are ampliﬁed during PCR.
The procedure used one set of primers to amplify both target cDNA and an externally added
MIMIC of known concentration. MIMICs for bcI-2. bcl-x and bar quantitation were
constructed following the manufacturer’s direction. The primer pairs used for ampliﬁcation
of bcl-2. bcl-x and box mRNA. 1 pg of RNA was used routinely for cDNA synthesis
(Clontech). After ﬁrst-strand cDNA synthesis reaction, the cDNA was made into 100 pl
ﬁnal volume, and 4 pl were used for PCR. A typical PCR consisted of 0.2 pM dNTP, 2 pl
MIMIC, 4 pl cDNA, 0.2 pM of each primer, PCR buffer, and Taq polymerase. The PCR
proﬁle was 95°C for 45 s, 60°C for 45 s, and 72°C for 2 min for 30 cycles, followed by
72 °C for 7 min. After PC R, aliquots of the reaction were analyzed on 1.8 % agarose gel (0.5
jig/ml ethidium bromide). The amount of mRNA was quantitated by comparing relative

intensities of the ampliﬁed MIMIC and speciﬁc message bands. All results were normalized

38

against glyceraldehyde 3-phosphate dehydrogenase (G3PDH) mRNA quantitated with the
use of identical PCR conditions. Results are expressed as level of expression relative to
G3PDH. The primer pairs and competitor for G3PDH were purchased from Clontech.
C.7. Densitometry Analysis Western and Northern blot images were subjected to
densitometry analysis using Quantity One (Bio-Rad, Hercules, CA).

C.8. Differential Display Reverse Transcription Polymerase Chain Reaction (DD RT-
PCR) Differential display gel kits including RTase (Genhunter Corp., Nashville, TN) were
used for this study. RNA from control and F umonisin B,-treated cells were isolated and
used for RT reaction using poly T primer with A, G or C as outlined by the supplier. RT
products were labeled with 25 pCi (ac-”S dATP and ampliﬁed with 15 different
combinations using 3 different down stream primers and 5 different upstream primers in a
thermocycler (GeneAmp, PCR System 2400, Perkin Elmer Norwalk, CT) in the presence of
DNA polymerase (Perkin Elmer Norwalk, CT). Labeled cDNAs were fractionated by size
on a 6% DNA sequencing gel at a constant 60 W at 50°C for 2 h. Gels were transferred to
Whatman 3 ﬁlter paper and dried at 80°C for 1 h. The dried gel was exposed to X-ray ﬁlm
for 1-2 days to obtain an autoradiograph. The target cDNA was isolated from a dried gel and
rearnpliﬁed in the absence of the radioactive dATP. These cDNAs were used for cloning and
as probes for northern analyses.

C.9. Northern analysis Northern analyses of total RNA was performed as previously
described (Schroeder and Cousins, 1990) using PCR-ampliﬁed partial cDNAs labeled with
50 pCi 0t-32P-dCTP (DuPont NEN) by the random oligolabeling method (Prime-a-Gene
Labeling System from Promega).

C.l0. cDNA cloning After screening for the false positives, the PCR-ampliﬁed partial

39

cDNA was inserted into the pCR2.l-TOPO plasmid vector using TOPO TA Cloning Kit
(Invitrogen). This plasmid was used to transform TOP 10 ONE shotTM Cells with One Shot
kit (Invitrogen).

C .1 1. DNA sequencing The transformed competent cells were propagated in LB-media
and the plasmid was isolated (QIAprep Spin Miniprep Kit, QIAGEN, Germany) for
sequencing at the Michigan State University Core Sequencing Facility. DNA sequences
were obtained and submitted to the GenBank.

C.12. Immunoblot analysis for calmodulin Cellular protein was extracted from
LLC-PK, cells with lysis buffer (20 mM Tris-Cl, pH 8.0, 150 mM NaCl, 10 % glycerol, 1
% Triton X-100, 2 mM EDTA, 1 mM penylmethylsulfonyl ﬂuoride, 10 BM of leupeptin and
aprotinin cocktail solution), sonicated, and centrifuged. The supernatant protein was
denatured by incubating for 5 min at 95 °C in Laemmli buffer. The sample was applied to
15 % SDS-bis acrylamide denaturing gel and transferred onto nitrocellulose membrane. The
protein on the membrane was blocked by overnight incubation in 5 % non—fat dry milk/TBS-
Tween 20 (0.1%), pH 7.4. The membrane was probed with anti—calmoduin antibody (Santa
Cruz) raised against a goat calmodulin for 1 hour at room temperature and treated with anti-
goat IgG conjugated with horseradish peroxidase for additional 1 hour at room temperature.
Chemiluminescence solution from Santa Cruz was used to develop the immunoblot.

C.13. Cell protein measurement. Total cell protein was determined by the method of
Lowry et al. (1995) using bovine serum albumin as a standard.

C.14. Statistical analysis. Data from sphinganine were subjected to ANOVA and
Bonferroni’s all pairwise comparison tests. The Student t test was used to analyze ﬂow

cytometric data. Differences were considered statistically signiﬁcant at p s 0.05

40

D. RESULTS

LLC-PK, renal kidney epithelial cells were used as a model systemfor these studies
because the kidney is the most sensitive organ to fumonisin toxicity (Bucci et al., 1998;
Gumprecht et al., 1995) and Y00 et al. (1992, 1996) have shown a strong association
between death of LLC-PK, cells caused by fumonisin B, and accumulation of sphinganine.

F umonisin B, induces apoptosis and causes sphinganine accumulation in LLC-PK,
cells. Morphological changes characteristic of apoptosis, including cell shrinkage,
membrane blebbing, chromatin condensation, and the formation of apoptotic bodies were
observed in LLC-PK, cells cultured with 50 [1M fumonisin B, (data not shown). To further
investigate the mechanism of death, LLC-PK, cells cultured with fumonisin B, were
examined for the presence of DNA fragmentation, a hallmark of apoptosis. Control cultures
(without toxin) showed no evidence of DNA fragmentation for up to 48 h (data not shown).
In contrast, fumonisin B, produced time-dependent increases in a 200—bp DNA ladder
indicative of apoptosis (Figure 2.1A). DNA fragmentation was detectable within 24 h of
exposure to fumonisin B,, with a maximal response at 48 h. Fumonisin B, increased the
percentage of cells undergoing apoptosis by about ~6.5-fold at 48 b (Figure 2.1B).
Fumonisin B, at 50 11M also produced time-dependent increases in sphinganine. Fumonisin
B, caused sphinganine accumulation within 6 h (Figure 2.2). Maximal accumulation of ~1 .7
nmol/mg protein (~50-fold that of controls) was achieved by 48 h. Thereafter, sphinganine
in fumonisin-treated cultures decreased to ~12 nmol/mg protein by 72 h.

ﬂ-Fluaroalanine blocks sphinganine accumulation caused by fumonisin B,. The
ﬁndings demonstrate that fumonisin B , induces kidney cell apoptosis over a time course that

is consistent with dependence upon accumulation of sphinganine but do not prove a cause

41

-..:S‘JI

rp'm—

Culture Period (h)

 

M 0 3 616243648

 

 

 

 

Apoptotlc Cells
(Fold Increase)
O H N DJ A Ur O\ \l 00

 

Control F B,

Figure 2.1. Fumonisin B, induces internucleosomal DNA fragmentation in LLC-PK,
kidney cells. (A) LLC-PK, cells were cultured in the presence of fumonisin B, at 50 11M for
various lengths of time and DNA fragmentation was assessed by agarose gel electrophoresis
as described under Materials and Methods Results are from a representative experiment.
M: 123—bp DNA markers. (B) LLC-PK, cells were cultured in the absence or presence of
fumonisin B, at 50 11M and the percentage of cells in the sub-GO/Gl apoptotic region was
determined by ﬂow cytometric analysis as described under Materials and Methods.

42

 

2000

 

1500 -

...x
U" o
O O
O O
I

 

+ﬂ

Sphlngamne
(pmol/mg protein)
C

 

 

_500 1 1 1 1 1 1 1 1
0102 304 50607080

Culture Period (h)

 

Figure 2.2. Fumonisin B, causes sphinganine accumulation in LLC-PK, kidney cells.
LLC-PK, cells were cultured either in the absence (0) or presence (0) of fumonisin B, at 50
11M for various lengths of time. Cellular concentrations of sphinganine were determined by
HPLC as described under Materials and Method. Each value is the mean :1: SD (n=3) from
a representative experiment. Error bars that are not visible are hidden by the symbols. *
value is signiﬁcantly different (p 50.05) from corresponding control value.

43

and effect relationship. To obtain more information about the mechanism, studies were
conducted using B-ﬂuoroalanine. B-haloalanines act as mechanism-based irreversible
inhibitors of serine palmitoyltransferase by substituting for the substrate serine during Schiff
base formation (Medlock and Merrill, 1988). B-ﬂuoroalanine is ~1000-fold more potent than
B-chloroalanine for inhibition of serine palmitoyltransferase. Because serine
palmitoyltransferase catalyzes the initial, rate-limiting step of sphingolipid biosynthesis, B-
haloalanines block de navo synthesis of sphingolipids but would not be expected to cause
accumulation of sphinganine.

LLC-PK, cells were cultured with combinations of fumonisin B, (50 11M) and B-
ﬂuoroalanine (50 BM) to determine the effects on sphinganine accumulation and DNA
fragmentation. The addition of fumonisin B, alone increased sphinganine (Figure 2.3) and
stimulated DNA fragmentation (Figure 2.4); whereas, B-ﬂuoroalanine alone had no effect
on sphinganine (Figure 2.3) or DNA fragmentation (Figure 2.4). In contrast, the stimulatory
effects of fumonisin B, on sphinganine accumulation and DNA fragmentation were
completely blocked when B-ﬂuoroalanine was added together with fumonisin B, (Figures
2.3 and 2.4). These results establish that the de nova biosynthesis (and, presumably,
accumulation) of sphinganine or a metabolite such as the l-phosphate is required for the
stimulation of DNA fragmentation by fumonisin B,.

F umonisin B, does not affect expression of box. bc1-2, and bcl-x. Since altered
expression of bcl-2 family genes has been implicated in apoptosis induced by free sphingoid
bases, the effects of fumonisin B, on mRN A of these genes was examined using competitive
RT-PCR. Figure 2.5 shows bax, bcl-Z, and bcI-x mRNA after 16 h of exposure to an

apoptotic concentration of fumonisin B, (50 |J.M). Densitometric analysis indicated the toxin

44

 

1200

 

 

 

 

 

... 1000 . ,
'5. 800 ..

. e i
rte 4"" “ a
\9 200 e b

0 i b b -_J

Control FB, BFA FB,+ BFA

Treatment

Figure 2.3. Inhibition of fumonisin B,-stimu1ated sphinganine accumulation in LLC-
PK, cells by B-ﬂuoroalanine. LLC-PK, cells were cultured in the absence or presence of
fumonisin B, (FB,) at 50 11M and B—ﬂuoroalanine (BFA) at 50 11M as indicated. After 16
hours, cellular concentrations of sphinganine were determined by HPLC as described under
Materials and Methods. Each value is the mean :1: SD from a representative experiment.
Means with differing letters are signiﬁcantly different (p $0.05).

45

 

Figure 2.4. Inhibition of fumonisin B,-induced DNA fragmentation in LLC-PK, cells
by B—ﬂuoroalanine. LLC-PK, cells were cultured in the absence or presence of fumonisin
B, (FB,) at 50 pM and/or B—ﬂuoroalanine (BFA) at 50 uM. After 72 hours, cells were
harvested and DNA fragmentation was assessed by agarose gel electrophoresis as described
under “Materials and Methods”. Results are from a representative experiment. M: 123 base-
pair DNA markers.

46

 

had no effect on expression of these genes. These results suggest that alterations in bcl-2
family gene expression are not necessary for fumonisin B,-induced apoptosis in LLC-PK,
kidney cells.

F umanisin B, induces expression of calmodulin mRNA by a sphinganine-dependent
pathway. As an alternative approach to studying individual mRNAs, we have further
examined RNA isolated after 16 h of culture with 50 BM fumonisin B, using DDRT-PCR.
This method provides an unbiased approach to analyze changes in gene expression associated
with a treatment without DNA sequencing information (Liang and Pardee, 1992). Using
DDRT-PCR we have identiﬁed ~40 cDNAs that are differentially displayed in response to
fumonisin B,. Figure 2.6 shows examples of three up-regulated kidney cell cDNAs (K1 from
control cells and K2 and K3 from cells cultured with fumonisin B,. Northern analysis using
the ampliﬁed cDNAs as probes conﬁrmed differential expression of K3 (Figure 2.7);
whereas, K1 and K2 were false positives (data not shown). The sequence of the K3 insert
was determined and submitted to GenBank. The highest homology corresponds to human
and mouse calmodulin, with 98% base sequence identity and 100% amino acid identity to
human calmodulin (Figure 2.8).

These ﬁndings establish that calmodulin mRNA is increased in LLC-PK, cells after
16 h of exposure to fumonisin B, and are consistent with, but not proven, to be dependent
upon prior accumulation of sphinganine. To obtain information about the role of
sphinganine in fumonisin-induced calmodulin expression, B-ﬂuoroalanine was used to block
sphinganine accumulation. As shown in Figures 2.9A and 2.9B, the addition of fumonisin
B, alone stimulated calmodulin mRNA ~6.5-fold. In contrast, the stimulatory effect of

fumonisin B, on calmodulin expression was reduced by about 50% when B-ﬂuoroalanine

47

 

Figure 2.5. Fumonisin B, does not affect gene expressions of bcl-2 family genes in LLC-
PK, cells. LLC-PK, cells were cultured in the absence (C) or presence (F) of fumonisin B,
at 50 BM. After 16 hr, total RNA were isolated and box. bcl-Z. and bcI-x mRNA was
quantitated by RT-PCR as described under Materials and Methods. G3 PDH, glyceraldehyde
3-phosphate dehydrogenase. Results are from a representative experiment.

48

K3

K1
K2

 

Figure 2.6. Differential display of LLC-PK, kidney cell cDNAs. LLC-PK, cells were
cultured in the absence (C) or in the presence (F) of fumonisin B, at 50 11M. After 16 hours,
total RNA was isolated and used for DDRT-PCR as described under Materials and Methods.
The two primer combinations that were used for this experiment were: 5'-Tl 1-G-3' and 5'-
GCAATCGATG-3’ (lanes 1 and 2) and 5'-T1 1-A-3' and 5'-CCGAAGGAAT-3‘ (lanes 3 and

4).

49

 

Figure 2.7. Fumonisin B, induces expression of K3 mRN A. LLC-PK, cells were cultured
in the absence (C) or presence of fumonisin B, (F B,) at 50 uM. After 16 hr, total RNA was
isolated and examined via Northern analysis as described under Materials and Methods.

50

K3 tgtgtttgataaggatggcaatggctatattagtgcagcagagcttcgccatgtgatgac 60
Human CaM tgtgtttgataaggatggcaatggctatattagtgctgcagaacttcgccatgtgatgac 400
K3 aaaccttggagagaagttaacagatgaagaggttgatgaaatgatcagggaagcagatat 120
Human CaM aaaccttggagagaagttaacagatgaagaagttgatgaaatgatcagggaagcagatat 460
K3 tgatggtgatggtcaagtaaactatgaagagtttgtacaaatgatgacagcaaagtgaag 180
Human CaM tgatggtgatggtcaagtaaactatgaagagtttgtacaaatgatgacagcaaagtgaag 520
K3 acgttgtacagaatgtgttaaatttcttgtacaaaattgtttatttgccttttctttgtt 240

Human CaM accttgtacagaatgtgttaaatttcttgtacaaaattgtttatttgccttttctttgtt 580

Figure 2.8. Sequence homology of K3 DNA insert with human calmodulin. The K3
cDNA insert was cloned and sequenced as described under Materials and Methods and
submitted to GenBank for identiﬁcation. Shown are the K3 cDNA insert and the

corresponding sequence of human calmodulin (human CaM). K3 cDNA bases shown in bold
are different from the corresponding base of human calmodulin.

51

F;-‘_‘ i I-- - J.

    

 

CaM mRNA
(Fold Stimulation)
O r-‘ N DJ A U! ON \1

 

 

 

Con F B, BFA+FB,

Figure 2.9. Inhibition of fumonisin B,-induced calmodulin expression in LLC-PK, cells
by B-ﬂuoroalanine. LLC-PK, cells were cultured in the absence or presence of fumonisin
B, (FB,) at 50 pM and/or B—ﬂuoroalanine (BFA) at 50 11M. After 16 hr, total RNA was
isolated. (A) Northern analysis using K3 cDNA as a probe as described under Materials and
Methods. (B) Densitometric analysis of the Northern blot as described under Materials and
Methods. Results are from a representative experiment.

52

was added together with fumonisin B,. This finding establishes that fumonisin B,-induced
expression ofcalmodulin mRNA is dependent on accumulation of sphinganine.

F umonisin B, increases calmodulin protein in LL C -PK , kidney cells. Additional
studies were conducted to examine the effect of fumonisin B, on calmodulin protein. LLC-
PK, cells were cultured with fumonisin B, for 16 h and calmodulin protein was assessed by
Western analysis. Fumonisin B, produced concentration-dependent increases in calmodulin
protein with a maximun response of ~4-fold at 50 BM (the highest dose tested) (Figures
2.10A and 2.10B)

Calmodulin antagonist bIocksfumonisin-induced DNA fragmentation. T h e
ﬁndings to this point establish that fumonisin B, induces calmodulin expression as well as
apoptosis in LLC-PK, cells via a sphinganine-dependent mechanism. To determine whether
calmodulin plays a causal role in fumonisin-induced apoptosis, studies were conducted using
W7. W7 acts as a calmodulin antagonist by competitively binding to calmodulin at the same
site to which calmodulin-dependent enzymes bind (Osawa et al., 1998). LLC-PK, cells were
cultured with combinations of fumonisin B, and W7 to determine their effects on DNA
fragmentation. The addition of fumonisin B, alone increased DNA fragmentation, while W7
alone at either 10 or 20 BM had no effect (Figure 2.1 1). However, the stimulatory effect of
fumonisin B, on DNA fragmentation was almost completely eliminated when W7 was added
together with fumonisin B,. These results establish that fumonisin B, induces apoptosis in

LLC-PK, kidney cells by a calmodulin-dependent mechanism.

E. DISCUSSION

Fumonisin mycotoxins are of growing concern because of their prevalence in com

53

 

FB, 0 10 25
B c 5 r ~—_——_—~ ~_#_ ..__-____ L l

'32 8 4 _
O '5
a: .2 3

3 __
E .2
e a 2»

"D
g a I -
U v

 

Fumonisin B, (uM)

Figure 2.10. Concentration of fumonisin B, induction of calmodulin protein in LLC-PK,
kidney cells. LLC-PK, cells were cultured with various concentrations of fumonisin B, (F B,).

After 16 hr, cellular protein was isolated. (A) Immunoblot analysis of calmodulin as described
under Materials and Methods. (B) Densitometric analysis of the immunoblot as described

under Materials and Methods. Results are from a representative experiment.

54

 

Figure 2.11. Inhibition of fumonisin-induced DNA fragmentation in LLC-PK, cells by
calmodulin antagonist, W7. LLC-PK, cells were cultured in the absence or presence of
fumonisin B, as indicated. W7 was also added to some cultures 16 hr after the addition of
fumonisin B,. After 48 hr, DNA fragmentation was assessed by agarose gel electrophoresis
as described under Materials and Methods. Results are from a representative experiment.

55

and corn-based products (Shephard et al.. 1996) as well as other agricultural commodities
and because of their toxic and carcinogenic properties for animals and, perhaps, humans
(Marasas, 1996). Across species, the most sensitive organ to fumonisin toxicity is the kidney
(Bucci et al, 1998; Gumprecht et al, 1995). The primary response of kidney to consumption
of feed containing fumonisin B, is tubular epithelial cell apoptosis (Bucci et al., 1998;
Gumprecht et al, 1995). Yoo et al. (1992, 1996) have reported that fumonisin B, is cytotoxic
for LLC-PK, porcine renal tubular epithelial cells, suggesting that this cell line may be an
appropriate model to further investigate the molecular mechanism of renal toxicity caused
by fumonisins. A major ﬁnding of the current study is that fumonisin B, kills LLC-PK, cells
by inducing apoptosis. The concentration of fumonisin necessary to induce apoptosis, 50
pM, is identical to that previously reported to be toxic for these cells (Yoo et al., 1992, 1996)
and is similar to that which induces apoptosis in a variety of other cultured cells, including
human keratinocytes, ﬁbroblasts, esophageal epithelial cells, and hepatoma cells (Tolleson
et al., 1996b).

Numerous studies have demonstrated that the mechanism of action of fumonisins
appears to involve disruption of sphingolipid metabolism via inhibition of sphinganine N-
acyltransferase (Merrill et al., 1997a). The inhibition causes accumulation of sphingoid
bases in a variety of cell types (Norred et al., 1992; Wang et al., 1991; Yoo et al., 1992;
Schroeder et al., 1994; Tolleson et al., 1999) and in the tissues and urine of animals fed
fumonisin-contaminated grain (Merrill et al., 1997b; Morgan et al., 1997; Riley et al., 1993a,
1994; van der Westhuizen et al., 2001; Wang et al., 1992). In the present study, an apoptotic
concentration of fumonisin B, caused cellular sphinganine to increase to ~1.0 nmol/mg of

protein at least 8 h prior to evidence of DNA fragmentation. There are several possible

56

p. - .lﬂ‘hmrl‘

mechanisms whereby disruption of sphingolipid metabolism could cause apoptosis. First,
fumonisin B, might block the formation of a complex sphingolipid(s) that is required for
growth and cell survival. Hanada et al. (1992) showed in mutant Chinese hamster ovary
cells (which can not synthesize complex sphingolipids) that addition of exogenous complex
sphingolipids restored the ability of the cells to proliferate. Moreover, the addition of
ceramide derivative reversed fumonisin inhibition of axonal growth in hippocampal neurons
(Harel and Futtemlan, 1993) and the addition of N-acetylsphinganine partially protected
human keratinocytes from fumonisin B,-induced apoptosis (Tolleson et al., 1999).
Moreover, Yoo et al. (1996) demonstrated that, when B-chloroalanine was used to inhibit
de nova synthesis of sphingolipids in LLC-PK, cells to a similar degree as fumonisin B,, it
both inhibited cell growth and increased cell death. In contrast, when de nova synthesis of
sphingolipids was blocked in the present study using a more speciﬁc inhibitor of serine
palmitoyltransferase, B-ﬂuoroalanine, there was no effect on DNA fragmentation. Thus,
reduced synthesis of complex sphingolipids does not appear to explain the apoptotic effect
of fumonisin B, in LLC-PK, cells.

The second possible mechanism whereby disruption of sphingolipid metabolism
could mediate fumonisin B, induction of apoptosis is by causing accumulation of the
sphingoid base sphinganine (or a metabolite). Free sphingoid bases have been shown to be
both growth inhibitory and cytotoxic for a variety of cell systems (Hannun et al., 1991;
Stevens et al., 1990). Moreover, Yoo et al. (1996) reported that sphingoid base
accumulation was, in part, responsible for fumonisin toxicity in LLC-PK, kidney cells. In
support of a causal relationship between sphinganine accumulation and apoptosis, our study

shows that fumonisin B,-induced DNA fragmentation was virtually eliminated upon the

57

addition of B-ﬂuoroalanine, which blocked sphinganine synthesis and reduced the cellular
sphinganine to a concentration similar to that of control cultures. These results provide
compelling evidence that fumonisin B, induces apoptosis in LLC-PK, kidney cells by a
pathway that involves disruption of sphingolipid metabolism and requires accumulation of
sphinganine.

Sphinganine could mediate the apoptosis induced by fumonisin B, either by a direct
action or via conversion to a metabolite. Exogenous sphingoid bases can be converted to
ceramide, a sphingolipid that induces apoptosis (Obeid et al., 1993). However, a role for
ceramide in mediating fumonisin-induced apoptosis seems unlikely because the conversion
of sphinganine to ceramide is blocked by fumonisins. Another sphinganine metabolite that
could mediate apoptosis is the l-phosphate metabolite. Though sphingoid base l-phosphate
is most often considered to be mitogenic (Zhang et al., 1991), recent studies have
demonstrated that this molecule also has antiproliferative properties (Bomfeldt et al., 1995;
Davaille et al., 2000).

The mechanism by which fumonisins induce apoptosis via sphinganine is not clear;
however, recent studies demonstrate that apoptosis induced by sphingosine in HL-60 cells
is accompanied by a decrease in expression of bcl-2, an apoptosis suppresser gene (Sakakura
et al., 1996). In addition, sphingosine induces apoptosis in androgen-independent human

prostatic carcinoma DU-45 cells by down-regulating bcl-x, (Shirahama et al., 1997).

Therefore, sphingoid bases may mediate fumonisin-induced cell death by regulating
expression of a bcl-2 family gene(s). However, in our study, an apoptotic concentration of
fumonisin B, had no effect on box, bcl-2, or bcI-x mRNA after 16 h of exposure. These

results indicate that apoptosis of LLC-PK, cells is not due to an effect on bcl-Z family gene

58

expression. As an alternative to studying individual mRNAs, the present study used DDRT-
PCR as an unbiased approach to analyze changes in gene expression associated with
fumonisin B, treatment. A major ﬁnding of our study using this technique is that fumonisin
B, induces calmodulin expression. The mycotoxin induces calmodulin expression in a
concentration-dependent manner with maximal effects of ~6.5-fold at the mRN A level and
~4—fold at the protein level with an apoptotic concentration of fumonisin B,. Fumonisin B,
could be envisioned to increase calmodulin expression either via a mechanism that is
independent of its effects on sphingolipid metabolism or by a mechanism that is mediated
via disruption of sphingolipid metabolism. In support of a causal role of sphinganine,
fumonisin B, stimulation of calmodulin expression was reduced by ~50% upon the addition
of B-ﬂuoroalanine, which blocked sphinganine synthesis. This result provides convincing
evidence that fumonisin B, induces calmodulin expression by a pathway that requires
accumulation of sphinganine.

The mechanism by which fumonisins stimulate calmodulin expression via
sphinganine is not known. Transcriptional regulation of calmodulin is still poorly
understood. However, Toutenhoofd et al. (1998) have identiﬁed possible AP-l binding sites
and TATA-like sequences 27 nucleotides upstream of the transcriptional start site in the 5'
ﬂanking sequence of human calmodulin 2 and the sphingoid base sphingosine has been
shown to induce DNA binding activity of AP-l (Su et al., 1994). In addition, Wang et al.
(1996) have hypothesized that fumonisin-induced growth arrest and apoptosis in African
green monkey kidney cells was a result of AP-l repression via inhibition of protein kinase
C. No attempt was made to relate changes to fumonisin disruption of sphingolipid

metabolism; however, the effects on protein kinase C are consistent with fumonisin-induced

59

sphinganine accumulation, since sphingoid bases are well-established inhibitors of protein
kinase C (Hannun et al., 1991).

In support of a causal role of calmodulin induction in apoptosis, another major
ﬁnding of our study is that DNA fragmentation induced by fumonisin B, was virtually
eliminated upon the addition of the calmodulin antagonist W-7. This ﬁnding provides strong
evidence that fumonisin B, induces apoptosis in LLC-PK, kidney cells by a pathway that
requires calmodulin. This discovery is consistent with the results of several recent studies
that indicate a role for calmodulin in apoptosis. For example, Rosenthal et al. (1998) have
reported that W-7 blocked apoptosis induced by sulfur mustard. In addition, Micoli et al.
(2000) have demonstrated that the proapoptotic effect of HIV-1 envelope glycoprotein gp160
is blocked by the calmodulin antagonist triﬂuoroperazine. The mechanism by which
fumonisin induction of calmodulin leads to apoptosis has not been examined but could
involve activation of calcineurin (Stemmer and Klee, 1994), which, in turn, has been shown
to dephosphorylate BAD, a proapoptotic member of the bcl-2 family (Wang et al.,'1999).
Activation of calcineurin by calmodulin is achieved by lowering the threshold concentration
of calcium needed for activation and calcium mobilizing agents such as ionomycin and
A23 1 87 induce dephosphorylation of BAD, indicating activation of calcineurin (Wang et al.,
1999). Since fumonisin B, has been shown to increase sphinganine l-phosphate in some cell
types (Smith and Merrill, 1995) and sphingosine 1-phosphate mobilizes cellular calcium
(Olivera et al., 1994), fumonisins may trigger bimodal regulation of calcineurin to
dephosphorylate BAD and induce apoptosis.

Taken together, the ﬁndings of this study using LLC-PK, cells provide a plausible

molecular mechanism to explain toxicity of fumonisins to kidney renal tubular epithelial

60

cells. Fumonisin B, was found to disrupt sphingolipid metabolism and cause apoptosis by
a pathway that involved initial accumulation of sphinganine, which, in turn, stimulated

induction of calmodulin.

61

CHAPTER III
SPHINGANINE l-PHOSPHATE MEDIATES CALMODULIN EXPRESSION

INDUCED BY FUMONISIN B, IN LLC-PK, PORCINE RENAL TUBULAR
EPITHELIAL CELLS

62

A. ABSTRACT

Fumonisins are a family of mycotoxins produced by F usarium moniliforme, which
is the most common mold found on corn throughout the world. These compounds are both
toxic and carcinogenic for animals, and perhaps humans, with the kidney being the most
sensitive organ to fumonisin toxicity. Fumonisin B, , the most prevalent of these mycotoxins,
induces calmodulin expression in LLC-PK, porcine kidney epithelial cells and causes
apoptosis via a calmodulin-dependent pathway (Kim et al., 2001). The molecular
mechanism of calmodulin induction by fumonisin B, is not known, but appears to involve
disruption of sphingolipid metabolism. Fumonisin B, inhibits ceramide synthase in the de
nova biosynthetic pathway of sphingolipids and causes depletion of complex sphingolipids
and accumulation of sphingoid bases. In the present study, LLC-PK, porcine renal tubular
epithelial cells were used to assess the inﬂuence of fumonisin B, on calmodulin mRNA
stability and to determine whether induction of calmodulin by fumonisin B, is mediated by
the depletion of complex sphingolipids or accumulation of the sphingoid base sphinganine
or the l-phosphate metabolite. Fumonisin B, increased both calmodulin mRNA and
calmodulin protein in concentration-dependent manners, but did not inﬂuence stability of
calmodulin mRNA, suggesting that fumonisin B, induces calmodulin by increasing
transcription. Moreover, the transcription inhibitor actinomycin D blocked fumonisin-
induced apoptosis. Neither the addition of exogenous sphinganine nor B-ﬂuoroalanine (an
inhibitor of serine palmitoyltransferase which depletes complex sphingolipids without
causing sphinganine accumulation) induced calmodulin expression; whereas, sphinganine
1-phosphate increased calmodulin mRNA. Taken together, these ﬁndings suggest that

fumonisin B, induces calmodulin in LLC-PK, kidney cells by disrupting sphingolipid

63

metabolism and causing accumulation of the sphinganine metabolite sphinganine 1-

phosphate which, in turn, increases transcription of the calmodulin gene.

B. INTRODUCTION

Fumonisins are toxic and carcinogenic toxins produced by F usarium moniliforme,
the most common mold found on corn in the United States and throughout the world
(Marasas, 1996). F umonisin B, is the most abundant of these mycotoxins and has been
correlated with several animal diseases with kidney being the most sensitive organ (Bondy
et al., 1996; Bucci et al., 1998). In rats, consumption of feed contaminated with fumonisin
B, causes apoptosis in renal tubular epithelial cells within 48 hr (Voss et al, 2001) and renal
tubular adenomas and carcinomas within two years (Howard et al., 2001). In addition to
kidney carcinogenicity, fumonisin B, consumption has been linked to esophageal (Marasas
et al. , 1988), liver (Ueno et al. , 1997) and stomach (Groves et al. , 1999) cancers in humans.
The molecular mechanism of fumonisin-induced apoptosis is not clear, but appears to
involve calmodulin induction (Kim et al. , 2001). In LLC-PK, renal tubular epithelial cells,
fumonisin B, induces calmodulin expression and calmodulin activity is required for
fumonisin B,-induced apoptosis (Kim et al., 2001).

The mechanism by which fumonisin B, induces calmodulin is not clear. Due to

structural similarity with sphingoid bases, fumonisin B, inhibits ceramide synthase

(sphinganine N-acyltransferase) (Figure 3.1). The inhibition causes depletion of complex
sphingolipids as well as accumulation of sphingoid bases and/or the l-phosphate metabolite
(Smith and Merrill, 1995; Norred et al., 1992; Wang et al., 1991; Yoo et al., 1992; Schroeder

et al., 1994; Tolleson et al., 1999) and in the tissues and urine of animals fed fumonisin-

64

Serine + Palmitoyl CoA
B—ﬂuoroalanine ——-llSerine palmitoyltransferase

3-ketosphinganine

Sphinganine —> Sphinganine l-phosphate
Fumonisin Bl ll Ceramide synthase
Ceramide

Complex Sphingolipids

Figure 3.1. Be nova biosynthetic pathway of sphingolipids and inhibition of
ceramide synthase by fumonisin B,

65

contaminated grain (Merrill et al.. 1997b; Morgan et al., 1997; Riley et al., 1993a, 1994; van
der Westhuizen et al., 2001; Wang et al., 1992). Fumonisin-induced toxicities both in vitro
and in viva are dependent on disruption of sphingolipid metabolism (Martinova and Merrill,
1995; Restum et al., 1995; Yoo et al., 1996; Yoo et al., 1992) and fumonisin-induced
calmodulin expression in LLC-PK, porcine renal epithelial cells was blunted by B-
ﬂuoroalanine, an inhibitor of de novo biosynthesis of sphingolipids which blocks at an earlier
step than fumonisins and prevents sphinganine accumulation (Kim et al., 2001). Therefore,
fumonisin-induced calmodulin expression is, at least in part, dependent on accumulation of
sphinganine and/or a metabolite such as the l-phosphate (Kim et al., 2001).

In the present study, LLC-PK, porcine renal tubular epithelial cells were used to test
the hypothesis that the induction of calmodulin mRNA by fumonisin B, is mediated by the
depletion of complex sphingolipids or accumulation of sphinganine and/or sphinganine 1-
phosphate. In addition, the transcription inhibitor actinomycin D was used to examine the
effect of fumonisin B, on the stability of calmodulin mRNA as well as the requirement for

novel gene transcription in fumonisin-induced apoptosis.

C. MATERIALS AND METHODS

C.1. LLC-PK, cell culture Porcine kidney epithelial LLC-PK, cells were obtained
from American Type Culture Collection (ATCC) and cultured in Dulbecco’s Modiﬁed Eagle
Medium/F -12K nutrient solution (Gibco BRL) (1:1) containing 5% (v/v) fetal bovine serum
(FBS), 100 units/ml penicillin, 100 [lg/ml streptomycin sulfate, and 100 11M of L-serine
(Gibco BRL) in a 5 % CO, incubator at 37°C. Cells (~8 x 105) were plated on 100-mm

diameter tissue culture dishes (Corning, NY) and cultured for ~48 hr before addition of

66

treatments.

C.2. Materials Fumonisin B, used in this study was purchased from PROMEC
(South Africa) and actinomycin D (4 ng/ml) was obtained from Sigma (St. Louis, MO).
Sphinganine and sphinganine l-phosphate were purchased from Biomol (Plymouth Meeting,
PA). Sphinganine was prepared by forming a 1 :1 complex with Bovine Serum Albumin (cell
culture grade, GibcoBRL). Sphinganine l-phosphate was dissolved in
methanolztetrahydroﬁrranzwater (60:30: 1 0) at 65 °C, evaporated, and dissolved in 0.4% BSA
solution. RNA Stat-60 was from Tel-Test, Inc (Friendswood, TX).

C.3. Analysis of DNA fragmentation by agarose gel electrophoresis assay mg
treatments, fragmented DNA from LLC-PK] cells was extracted as described (Sellins and
Cohen, 1987). In brief, cells from IOO-mm dish were harvested using rubber policeman and
collected by centrifugation (5 min, 500 g). The medium was removed and the cell pellet was
resuspended in phosphate-buffered saline (PBS). After another centrifuge, the pellet was
suspended in 0.1 m1 hypotonic lysis buffer (10 mM Tris, 10 mM EDTA, 0.5% Triton X—100,
pH 8.0). Cells were incubated for 10 min at 4°C and the lysate was centrifuged (30 min,
13,000 g, 4 ° C). The supernatant containing fragmented DNA was treated with RNase A (0.4
pg/pl) for 1 hr at 37°C and then incubated with proteinase K (0.4 [lg/pl) for 1 h at 37°C.
DNA was precipitated overnight by incubation at -20°C in 50% isopropanol and 0.5 M
NaCl. The DNA precipitate was pelleted by centrifugation (30 min, 13,000 g, 4°C),
dissolved in distilled H,O and then electrophoresed in a 2 % agarose gel containing ethidium
bromide (0.5 [lg/ml) in 0.5X Tris-borate-EDTA buffer. After electrophoresis, DNA was
visualized with a UV transilluminator and photographs were taken using a Polaroid system.

C.4. Differential display reverse transcription polymerase chain reaction (DDRT-

67

PCR) Differential display gel kits including RTase (Genhunter Corp., Nashville, TN) were
used for this study as described previously (Kim et al., 2001).

CS. Immunoblot analysis for calmodulin Cellular protein was extracted from
LLC-PK, cells with lysis buffer (20 mM Tris-Cl, pH 8.0, 150 mM NaCl, 10 % glycerol, 1
% Triton X-100, 2 mM EDTA, 1 mM penylmethylsulfonyl ﬂuoride, 10 BM of leupeptin and
aprotinin cocktail solution), sonicated, and centrifuged. The supernatant protein was
denatured by incubating for 5 min at 95 °C in Laemmli buffer. The sample was applied to
15 % SDS-bis acrylamide denaturing gel and transferred onto nitrocellulose membrane. The
protein on the membrane was blocked by overnight incubation in 5 % non-fat dry milk/TBS-
Tween 20 (0.1%), pH 7.4. The membrane was probed with anti-calmoduin antibody (Santa
Cruz) raised against a goat calmodulin for 1 hour at room temperature and treated with anti-
goat IgG conjugated with horseradish peroxidase for additional 1 hour at room temperature.
Chemiluminescence solution from Santa Cruz was used to develop the immunoblot.

C.6. Northern blot analysis Total cellular RNA was extracted from LLC-PK, cells
by the modiﬁcation of the one-step method (Chomczynski and Sacchi, 1987) using RNA
Stat-60 reagent (Tel-test “B” Inc., Friendswood, TX). 20 pg of total RNA was separated by
electrophoresis on a 1 .2% (wt/vol) agarose gel (Gibco BRL) containing 0.6 M formaldehyde
(Sigma), 0.02 M MOPS (Gibco BRL) at 80 Volt for ~3 hr. The gel was stained with
ethidium bromide to verify the integrity and equal RNA loading, and the RNA was
transferred to a nylon membrane (NEN, Boston, MA) with 20X SSC. PCR-ampliﬁed
calmodulin cDNAs (Kim et al. , 2001) labeled with 50 pCi a-32P-dCTP (DuPont NEN) were
prepared by random oligo-labeling method (Prime-a-Gene Labeling System, Promega).

Aﬁer cross-linking, the membrane was pre-hybridized at 42°C in Denhardt’s hybridization

68

buffer (Kingston, 1997) for 2 hr. Blots were hybridized at the same temperature overnight
in a hybridization bag containing radio-labeled cDNA probe described earlier. The
membrane was then washed in low and high stringency washing buffer and exposed to the
K-screen (Kodak, Rochester, NY) for phospho-imager analysis. Density of each band was
quantiﬁed using the FX software program after background was subtracted.

C.7. Statistical Analysis The statistical analysis was performed by using Sigma-Stat
Analysis system (Jandel Scientiﬁc, San Rafael, CA). The half lives for the calmodulin
mRNAs were calculated using regression analysis. The student t-test was used to analyze
calmodulin mRNA for statistical signiﬁcance. Differences were considered statistically

signiﬁcant at p .<_ 0.05.

D. RESULTS

LLC-PK, renal kidney epithelial cells were used as a model system for these studies
because the kidney is the most sensitive organ to fumonisin toxicity (Bucci et al., 1998;
Gumprecht et al., 1995). Furthermore, fumonisin B, induced expression of calmodulin in
LLC-PK, cells and apoptosis induced by the mycotoxin was dependent on calmodulin (Kim
et al., 2001).

F umonisin B, increases calmodul in mRNA and calmodulinpratein in concentration-
dependent manners. Fumonisin B, induces calmodulin protein in a concentration-
dependent manner (Kim et al. , 2001). To compare the response of calmodulin mRNA to that
of calmodulin protein, kidney cells were cultured with various concentrations of fumonisin
B,. Fumonisin B, induced both calmodulin mRNA (Figure 3.2A) and calmodulin protein

(Figure 3.28) in concentration-dependent manners. At 25 pM, fumonisin B, induced

69

A CaM mRNA9 ! ﬂ 8

 

 

 

 

 

 

 

 

a 700
e 600
E
8 500
.5, 400
g 300
200
E 100
E, 0
0 . 5 50
Fumonrszrn B, (11M)
B ,3 250
g 200
U
8\: 150
.E 100
8
e 50
ad 0
E: o _25 50
U Fumomsrn B, (PM)

Figure 3. 2. Fumonisin B, increases calmodulin mRNA and calmodulin protein in

‘ ..tL...‘ ‘ manners. 106 LLC- PK, kidney cells were plated 1n 100 mm
dishes and grown for 48 hrs. Cells were then added with fumonisin B, at 0, 10, 25, and 50
11M 1n 3 fresh culture medium and cultured for 16 hr. At the end of the culture period, RNA
(A) and cellular protein (B) were harvested and Northern and Western analysis were
performed respectively as described under “Materials and Methods”.

70

calmodulin mRNA ~3-fold, while increasing calmodulin protein ~70%. At 50 uM,
fumonisin B, increased calmodulin mRNA ~5-fold and caused a corresponding increase in
calmodulin protein of ~2.4 fold.

F umanisin B, does not affect stability of calmodulin mRNA. I n c r e a s e d
abundance of calmodulin mRNA by fumonisin B, could be either due to increased gene
transcription or increased mRNA stability. To examine the effect of the mycotoxin on
stability of calmodulin mRNA, the transcription inhibitor actinomycin D was used to prevent
transcription. In the absence of the mycotoxin, the concentration of calmodulin mRNA was
initially increased up to 6 hr and then decreased steadily until 36 hr (Figure 3.3). Regression
analysis applied to the data from 6 to 36 hour indicates that calmodulin mRN A has a half life
of ~30 hr. A similar pattern of calmodulin mRNA was observed in response to fumonisin
B, with an mRN A half life of ~36 hr; however, regression analysis indicates that the slopes
are not signiﬁcantly different between the two groups, indicating that fumonisin B, does not
affect the stability of calmodulin mRN A.

Novel gene transcription is required for fumonisin B ,-induced apoptosis. Since
fumonisin B, appears to increase calmodulin expression by increasing transcription rather
than by increasing mRN A stability and apoptosis is dependent on calmodulin, dependence
of fumonisin-induced apoptosis on novel gene transcription was examined using actinomycin
D. Fumonisin B, alone at 50 BM caused DNA fragmentation (Figure 3.4); whereas,
actinomycin D at 2 ng/ml has no effect. However, addition of actinomycin D in the presence
of fumonisin B, prevented fumonisin-induced DNA fragmentation.

F umanisin B, selectively induces calmodulin. To determine whether fumonisin

B, induces calmodulin in a selective manner, DDRT-PCR was conducted as previously

71

0 6

--....r Wax... '4‘ -.,,.
vb- : ~ - . _“‘“".W
V hi 1 I ' ‘ ’ ‘ ‘
i . "f" V'mmgt" L... _ 1:: “a. . ,1 .

  
  
  

 

‘ l
‘7 - . - ‘
_ - _ . ,_ > , . .. . _ y
7”” :7" “’7‘ ’5" \W- “a 3' ‘21:" """ I‘ " , .‘n L
. .. _,
r.‘ " . ,
I, r ..
2 ’ ’ . .
1’ . . ~
. . ‘
r. ' " ‘1 " . . . . ,
‘1 "-'-"'W-. t 5* We’mJYIC- ‘ - an". “I. t‘ I

300000 ‘
250000

 

 

150000

 

 

100000 ~ +Com, |
50000 ,. "O—Fumonrsm B1

 

 

 

 

l I 1 1 1 1

0 510.15 20 25 30 35 40
Hours

 

CaM mRNA (CNT*mm2)

Figure 3.3. Fumonisin B, does not affect stability of calmodulin mRNA. 10‘5 LLC-PK,
kidney cells were plated in 100 mm dishes and grown for 48 hrs. Actinomycin D (4 ng/ml)
was then added to culture media in the presence or absence of fumonisin B, and kidney cells
were cultured at various hours. At the end of the culture, total RNA was harvested and
Northern analysis was performed as described under “Materials and Methods”.

72

ActD — + + (2 ng/mL)
FB, + - + (5011M)

 

Figure 3.4. Novel gene transcription is required for fumonisin B,-induced apoptosis
10" LLC-PK, kidney cells were plated in 100 mm dishes and grown for 48 hrs. Cells were
then added with 50 11M fumonisin B, (F B,) and/or 2 ng/ml actinomycin D (ActD) in a fresh
culture medium and cultured for ~48 hr. At the end of the culture, fragmented DNA was
harvested and analyzed by agarose gel electrophoresis as described under “Materials and
Methods”.

73

described (Kim et al., 2001). The results demonstrate that an apoptotic concentration of
fumonisin B, affected expression of only a few genes in LLC-PK, cells (Figure 3.5). Those
genes include calmodulin (CaM).

Depletion of complex sphingolipids does not affect expression of calmodulin. Since
fumonisin-induced kidney cell apoptosis requires calmodulin activity (Kim et al., 2001) and
appears to be partially dependent on depletion of complex sphingolipids (Yoo et al., 1996;
Riley et al., 1999), the effect of depletion of complex sphingolipids on calmodulin mRN A
was examined by using B-ﬂuoroalanine. B-ﬂuoroalanine blocks de novo sphingolipid
biosynthesis similar to fumonisin B, but without causing accumulation ofsphinganine (3.1).
The concentration of calmodulin mRNA was not altered by B-ﬂuoroalanine (Figure 3.6),
suggesting that depletion of complex sphingolipids does not play a role in fumonisin-induced
calmodulin expression.

Sphinganine does not mediate fumonisin-induced calmodulin expression. [3-
ﬂuoroalanine blocks sphinganine accumulation caused by fumonisin B, and partially
prevents calmodulin expression (Kim et al., 2001). To determine whether sphinganine acts
directly to induce calmodulin expression, exogenous sphinganine at 10 pras added to
LLC-PK, cultures. As shown in Figure 3.7, addition of an apoptotic concentration of
exogenous sphinganine had no effect on calmodulin mRNA.

Sphinganine I-phosphate induces calmodulin expression. Since sphinganine 1-
phosphate accumulates in the presence of fumonisin B, (Smith and Merrill, 1995), the effect
of this sphinganine metabolite on calmodulin expression was also examined. Sphinganine

l-phosphate at 2 11M increased the concentration of calmodulin mRNA ~50% in LLC-PK,

kidney cells (Figure 3.8).

74

 

Figure 3.5. Fumonisin B, selectively induces calmodulin. Cells were cultured in
the absence (C) or presence (F) of 50 11M fumonisin B, for 16 hr and DD RT-PCR was
performed as described under “Materials and Methods”. Arrows indicate differential
expression caused by fumonisin B, (CaM=calmoduIin). The primers used for this ﬁgure
were 5'-T12-A-3' and 5'-TAGCAAGTGC-3'.

75

Control BFA

W

CaMmRNA-) ' “ * *

16000 ‘ “‘"" """'”
14000
12000
10000
8000
6000
4000
2000

0

 

 

CaM mRNA (CNT *mm2)

 

 

   

Control BFA
Treatment

Figure 3.6. Depletion of complex sphingolipids does not affect expression of
calmoduolin. LLC-PKI cells were cultured in the presence of 50 |J.M B-ﬂuoroalanine (BF A)
for 16 hr. At the end of 16 hr culture, total RNA was harvested and Northern analysis was
performed as described under “Materials and Methods”.

76

Control

m

Sphinganine

   

CaM mRNA-)

 

1 6000
14000
1 2000
l 0000
8000
6000
4000
2000
0

 

CaM mRNA (CNT *mm2)

 

 

 

Control Sphinganine

Treatment

Figure 3.7. Sphingoid bases does not mediate fumonisin-induced calmodulin
expression. LLC-PK, cells were cultured in the presence of 10 pM sphinganine. At the end
of culture, total RNA was harvested and Northern analysis was performed as described under
“Materials and Methods”.

77

Control

CaM mRNA->145 ‘
2000
1 800
1 600
1400
1200
1 000
800
600
400
200
0

   

 

CaM mRNA (CNT*mm2)

 

 

 

Control SA— 1 -P

Treatment

Figure 3.8. Sphinganine l-phosphate induces calmodulin expression. LLC-PK, cells
were cultured in the presence of 2 1.1M sphinganine l-phosphate(SA-1-P) for 3 hr. At the
end of culture, total RNA was harvested and Northern analysis was performed as described
under “Materials and Methods”.

78

E. DISCUSSION

The mechanism of toxicity of fumonisins has not been well elucidated, but an
apoptotic concentration of fumonisin B, was shown to induce calmodulin expression in LLC-
PK, renal tubular epithelial cells (Kim et al., 2001). Moreover, fumonisin-induced kidney
cell apoptosis was dependent on calmodulin activity (Kim et al., 2001). Calmodulin is the
major Ca” sensor protein and plays an essential role in regulating many cellular processes
including cell proliferation (Rasmussen and Means, 1987; Rasmussen and Means, 1989),
cell-cycle progression (Chafouleas et al., 1982; Chafouleas et al., 1984; Rasmussen et al.,
1992), transformation (Chafouleas et al., 1981) and apoptosis (Dowd et al., 1991; Kim et al.,
2001; Rosenthal et al., 1998). Calmodulin is ubiquitous and structurally conserved across
species and regulates more than 30 enzymes in mammalian cells via the Caiilcalmodulin
complex (Stoclet et al., 1987). The activity of calmodulin was long thought to be regulated
primarily by changes in the net ﬂux or distribution of Ca” rather than by changes in the
cellular concentration of the protein because expression of calmodulin is tightly regulated
(Chafouleas et al., 1981 ). Results of the present study show that fumonisin B, induces both
calmodulin mRNA and calmodulin protein in LLC-PK, kidney cells in concentration-
dependent manners. Furthermore, DDRT-PCR clearly demonstrates that fumonisin B,
causes differential expression of calmodulin and only a few other genes. This is consistent
with our previous ﬁndings indicating speciﬁcity in response to fumonisin B, (Kim et al.,
2001) and with studies showing early induction of calmodulin gene expression in
lymphocytes undergoing glucocorticoid-mediated apoptosis (Dowd et a1 ., 1991). In addition,
changes in the concentration of calmodulin have been reported in differentiated BC3H-1

mouse myoblast cells (Epstein et al., 1989), in NGF-induced differentiation of neuronal cells

79

(Bai and Weiss, 1991), in CHO-K1 cells released from stationary phase to re-enter into the
cell cycle (Chafouleas et al., 1984), in transformed chicken embryo ﬁbroblasts (Watterson
et al., 1976), and in several malignancies including those of liver (Wei et al., 1982), lung
(Liu et al., 1996) and breast (Singer et al., 1976; Tuccari et al., 1993). Increased
concentrations of calmodulin caused by fumonisin B, may stimulate a variety of calmodulin-
dependent enzymes (Heist and Schulman, 1998; Van Eldik et al, 1979) which could, in turn,
mediate the kidney toxicity of fumonisins by causing renal tubular cell apoptosis.

Increases in calmodulin mRNA caused by fumonisin B, could be due to either
increased transcription of the gene or increased stability of the mRNA. The present study
supports a role for fumonisin B, in increasing calmodulin transcription since fumonisin B,
did not alter the stability of calmodulin mRNA. The half life of calmodulin mRNA in LLC-
PK, cells is ~30 hr and is not signiﬁcantly altered by fumonisin B,. Bai and Weiss (1991)
have reported comparable calmodulin mRNA half lives in PC 12 neuronal cells ranging from
~10 to 29 hr depending on the size of the transcripts. This is consistent with the results of
other studies which suggest that the steady state level of cellular calmodulin is increased by
a higher rate of transcription rather than changes in mRNA stability (Chafouleas et al., 1981 ;
Epstein et al., 1989). The mechanism by which fumonisin B, increases calmodulin
transcription may involve disruption of sphingolipids. Numerous studies both in viva and
using a variety of cell types have demonstrated that the mechanism of toxicity of fumonisins
requires disruption of sphingolipid metabolism via inhibition of sphinganine N-
acyltransferase (Merrill et al., 1997a).

There are several possible mechanisms by which disruption of sphingolipid

metabolism could cause induction of calmodulin. First, fumonisin B, could increase

80

 

 

calmodulin expression by depleting complex sphingolipids. Several studies have
demonstrated that depletion of complex sphingolipids mediate, at least in part, fumonisin-
induced toxicities (Yoo et al. , 1996; Riley et al. , 1999). When B-chloroalanine was used to
inhibit serine palmitoyltransferase and block de nova synthesis of sphingolipids in LLC-PK,
cells to a similar degree as fumonisin B,, it both inhibited cell growth and increased cell
death (Yoo et al., 1996). Also, the addition of ceramide derivative reversed fumonisin
inhibition of axonal growth in hippocampal neurons (Harel and F uterman, 1993) and the
addition of N—acetylsphinganine partially protected human keratinocytes from fumonisin B,-
induced apoptosis (Tolleson et al., 1999). Riley et al (1999) demonstrated that prevention
of fumonisin-induced sphinganine accumulation by inhibitors of serine palmitoyltransferase
blocks fumonisin-induced apoptosis but does not abolish the morphological changes caused
by the mycotoxin, suggesting that depletion of sphingolipids could play a role in fumonisin
toxicity. To examine the role of depletion of complex sphingolipids in fumonisin—induced
calmodulin induction, B-ﬂuoroalanine was used to block de novo sphingolipid biosynthesis.
However, the ﬁndings demonstrate no effect of B-ﬂuoroalanine on calmodulin mRNA and,
therefore, suggest that depletion of complex sphingolipids does not mediate fumonisin-
induced calmodulin expression in LLC-PK, kidney cells.

A second possible mechanism whereby disruption of sphingolipid metabolism could
mediate fumonisin-induced calmodulin expression is by causing accumulation of the
sphingoid base sphinganine. B-ﬂuoroalanine together with fumonisin B, blocks fumonisin-
induced sphinganine accumulation and partially prevents fumonisin-induced calmodulin
expression in LLC-PK, kidney cells (Kim et al., 2001). However, the addition of exogenous

sphinganine did not affect calmodulin mRNA. Therefore, sphinganine does not appear to

81

directly mediate fumonisin-induced calmodulin expression.

Another possible mechanism by which disruption of sphingolipid metabolism could
mediate fumonisin-induced calmodulin expression is via the sphinganine metabolite,
sphinganine l-phosphate. Smith and Merrill (1995) showed that in the presence of
fumonisin B,, sphinganine is converted to the l-phosphate metabolite by sphingosine
(sphinganine) kinase. The present study demonstrates that exogenous sphinganine 1-
phosphate induces calmodulin expression and suggests that increased formation of
sphinganine l-phosphate in the presence of fumonisin B, in kidney cells, at least in part,
mediates stimulation of calmodulin expression. Studies have demonstrated that
intracellularly generated sphingoid base l-phosphate can be released into extracellular space
in a variety of cells (Goetzl and An, 1998; Hla, 2001; Spiegel and Merrill, 1996). Therefore,
it is possible that both endogenously produced sphinganine l-phosphate as a result of
fumonisin B, exposure as well as exogenously added sphinganine l-phosphate may act
through interaction with G-protein coupled sphingoid base l-phosphate receptor EDG family
members to induce calmodulin expression. The lower effect of exogenous sphinganine 1-
phosphate on calmodulin expression than fumonisin B, may be due to complete degradation
of exogenously added sphinganine l-phosphate to hexadecanal and ethanolamine phosphate
(Merrill et al., 1996); whereas, in the presence of fumonisin B,, endogenously generated
sphinganine l-phosphate would continue to be produced.

The mechanism by which sphinganine l-phosphate increases calmodulin expression
is not known, but may involve mobilization of intracellular Ca“. Changes in intracellular
Ca’+ have been shown to affect changes in nuclear functions including gene expression (Bito

et al., 1997). Sphingoid base l-phosphate has been shown to increase cytosolic Ca++ by

82

mobilizing Ca” from internal stores (Ghosh et al., 1994; Mattie et al., 1994; Tomquist et al.,
1997). Elevated cytosolic Ca” is accompanied by signiﬁcant elevation of nuclear Ca”,
producing a signal which may directly activate Caii-dependent proteins within the nucleus
(Heist and Schulman, 1998; Himpens et al., 1994). However, Ca” mobilization by
sphinganine l-phosphate is not likely to be the mechanism of calmodulin induction by
fumonisin B, because addition of intracellular Ca“ chelator BAPTA AM did not affect
fumonisin-induced calmodulin increase (data not shown).

Another possible mechanism by which sphinganine l-phosphate might induce
calmodulin is via activation of the MAPK pathway and transcription factor Sp-l.
Toutenhoofd et al (1998) demonstrated that human calmodulin is regulated at the
transcriptional level, that the 5' untranslated region of the calmodulin gene was necessary,
and that it contains multiple Sp-l sites (Toutenhoofd et al., 1998). The Sp transcription
factor family is necessary for basal calmodulin gene transcription and for regulation of
calmodulin expression (Pan et al., 2000; Solomon et al., 1997). Furthermore, Zhang et al
(1999) demonstrated that fumonisin B, activates transcription of CDK inhibitor p21 via Sp-
lbinding sites. It is not clear if sphingoid base l-phosphate activate Sp—l binding to DNA;
however, the l-phosphate has been shown to activate mitogen-activated protein kinase
(MAPK) which, in turn, activates a variety of transcription factors including Sp-l (Davis et
al., 1996). Therefore, it is plausible that fumonisin B, causes elevated sphinganine 1-
phosphate which, in turn, activates the MAPK pathway and transcription factors such as Sp-
1, resulting in stimulation of calmodulin transcription.

In the cell, the Caii/calmodulin complex plays a wide variety of roles and several

studies reported evidence relating calmodulin to apoptosis, especially those induced by

83

sustained increases in cellular calcium concentration (Kim et al. , 2001; Bellomo et al., 1992;
Dowd et al., 1991). Inhibition of calmodulin activity by W7 protects LLC-PK, cells ﬁ'om
fumonisin-induced apoptosis (Kim et al. , 2001). In addition, treatment of certain lymphoma
cell lines and thymocytes with glucocorticoid activates a programmed cell death pathway
(McConkey et al., 1989) and calmodulin inhibitors also protected lymphocytes from
glucocorticoid-induced apoptosis (Dowd et al., 1991). Also, calmodulin antagonists
inhibited F as-mediated apoptosis of CD4+ T-cells from patients with AIDS (Pan et al., 1998)
and sulfur mustard-induced apoptosis of keratinocytes (Rosenthal et al., 1998). Despite these
ﬁndings, the mechanism by which calmodulin is involved in the signaling of the cell-death
pathway is not understood. A recent study discovered a new calcium/calmodulin-dependent
protein kinase called death-associated protein kinase 2 that is believed to signal apoptosis
through its catalytic activity (Kawai et al., 1999). Further studies are needed to determine
if this novel protein kinase is involved in fumonisin-induced kidney cell apoptosis.

Taken together, the ﬁndings of the present study provide a possible mechanism by
which fumonisin B, induces calmodulin expression in LLC-PK, porcine renal tubular
epithelial cells. Fumonisin B, disrupts sphingolipid metabolism and causes accumulation
of sphinganine l-phosphate which activates transcription of calmodulin. Further studies are
necessary to elucidate the underlying mechanism of calmodulin induction by sphinganine 1-
phosphate and the role of increased concentration of calmodulin in fumonisin-induced

toxicity.

84

 

CHAPTER IV
FUMONISIN B, AND SPHINGANINE REDUCE PHOSPHORYLATION OF
MAPK/ERK AND PKB/AKT IN LLC-PK, PORCINE RENAL TUBULAR
EPITHELIAL CELLS

85

A. ABSTRACT

Fumonisins are a family of mycotoxins produced by F usarium moniliforme which
is the most common mold found on corn throughout the world. These compounds are both
toxic and carcinogenic for animals, and perhaps humans, with the kidney being the most
sensitive organ to ﬁrmonisins. F umonisin B,, the most prevalent of these mycotoxins,
induces apoptosis in LLC-PK, renal tubular epithelial cells (Kim et al., 2001). The
molecular mechanism of fumonisin toxicity is not clear, but appears to involve disruption
of de nova biosynthesis of sphingolipids. Fumonisin B, inhibits ceramide synthase causing
depletion of complex sphingolipids and accumulation of the bioactive sphingoid base,
sphinganine. In the present study, LLC-PK, cells were used to examine the effects of
disruption of sphingolipid metabolism on signaling pathways responsible for determining
cell survival and cell death. The studies used B-ﬂuoroalanine as a tool to dissect the relative
contribution of depletion of complex sphingolipids and accumulation of sphinganine. B-
ﬂuoroalanine is an inhibitor of serine palmitoyltransferase which, when added alone, blocks
complex sphingolipid biosynthesis to a similar degree as ﬁrmonisin B, , but without causing
accumulation of sphinganine. When added together with fumonisin B,, B-ﬂuoroalanine
blocks sphinganine accumulation. F umonisin B, alone had no apparent effect on kidney cell
growth or death within the ﬁrst 16 hrs of culture, but inhibited kidney cell growth and caused
cell death with 24-36 hrs of culture, consistent with dependence on disruption of sphingolipid
metabolism. Similarly, the exogenous addition of sphinganine inhibited growth and caused
death, but within only 1-2 hrs of culture. F umonisin B, had no effect on ERK
phosphorylation at 2 hrs of culture, but reduced phosphorylation of MEK and ERK at 16 hrs.

In contrast, B-ﬂuoroalanine did not decrease phosphorylation of MEK or ERK together with

86

 

err-‘91

fumonisin B,. Similar to fumonisin B,, sphinganine alone and in the presence of a sub-
optimal concentration of fumonisin B, reduced phosphorylation of both MEK and ERK.
Neither fumonisin B,, B-ﬂuoroalanine, nor sphinganine affected either total ERK or
phosphorylation of Raf-1. Both fumonisin B, and sphinganine decreased phosphorylation
of Akt at both serine 473 and threonine 308; whereas, B-ﬂuoroalanine did not decrease
phosphorylation of Akt and blocked the effect of fumonisin B,. The ﬁndings indicate that
growth arrest and apoptosis induced by fumonisin B, in LLC-PK, porcine renal tubular
epithelial cells is mediated by sphinganine which inhibits phosphorylation of Akt and of

ERK by a Raf-l independent pathway.

B. INTRODUCTION

Fumonisins are cytotoxic and carcinogenic mycotoxins produced by F usarium
moniliforme, the most common mold contaminant of corn and other agricultural
commodities in the United States and throughout the world (Marasas, 1996). Fumonisin B,,
the major fumonisin, causes several animal diseases including equine leukoencephalomalacia
(Marasas et al. , 1988a) and porcine pulmonary edema (Osweiler et al. , 1992). Early studies
with impure culture material containing fumonisins indicated that the mycotoxins cause liver
tumors (Gelderblom et al., 1996a; Gelderblom et al., 1996b). The National Toxicology
Program has conﬁrmed the carcinogenicity of fumonisin B, with a two year study which
demonstrated that fumonisin B, induces hepatic tumors in female B6C3F mice and renal
tubule tumors in male F 344 rats (Howard et al., 2001). In addition, consumption of
F usarium-contaminated corn has been associated with human esophageal cancer in certain

areas of the world (Marasas et al. , 1988b). F umonisin B, is wide spread in variable amounts

87

among food-grade corn and com-based food products of US. origin (Gutema et al., 2000)
suggesting that human populations are at signiﬁcant risk of exposure to fumonisin B, through
their normal diet. This raises concerns regarding possible health implications that can be
caused by chronic exposure to these mycotoxins.

The toxicity caused by fumonisin B, is mediated by disruption of sphingolipid
metabolism. Due to its structural similarity with sphingolipids (Figure 4.1), fumonisin B,
potently and competitively (with both sphinganine and acyl CoA) inhibits sphinganine
(sphingosine) N-acyltransferase (ceramide synthase), the enzyme that acylates sphinganine
to form ceramide in the de novo biosynthetic pathway of sphingolipids (Merrill et al. , 1993a;
Wang et al. , 1991). Inhibition of ceramide synthase causes accumulation of sphinganine and
simultaneous depletion of complex sphingolipids including sphingomyelin as shown in mice
(Martinova and Merrill, 1995), rats (Kwon et al., 1997; Riley et al., 1994), mink (Restum et
al., 1995), ponies (Wang et al. , 1992) and pigs (Riley et al., 1993a). Since sphingolipids are
bioactive compounds that regulate cellular behavior, i.e., cell proliferation, terminal
differentiation, and apoptosis (Hannun and Bell, 1989; Spiegel et al., 1994; Zhang et al.,
1991), ﬁrmonisin-induced disturbance of the balance among these lipid molecules has
signiﬁcant impact on the fate of cells, leading to degenerative diseases. Sphingoid bases like
sphinganine are growth-inhibitory and apoptotic (Jarvis et al., 1996; Ohta et al., 1994, 1995)
and accumulation of sphinganine and its l-phosphate metabolite appear, at least in part, to
be responsible for fumonisin-induced toxicity (Kim et a1. , 2001; Kim and Schroeder, 2002).
F umonisin B, induces apoptosis in LLC-PK, porcine renal tubular epithelial cells in a
sphinganine-dependent manner (Kim et al. , 2001).

The growth inhibitory and apoptotic effects of fumonisin B, could be mediated by

88

0% CH,COO(-)
\\c- -CH,CHCOO(-)

Fumonisin B, 0 OH OH
CH3
CH3 (I) CH3 0H NH,
C-CH,CHCOO(-)
/, l
O CH,COO(-)
OH OH
Sphinganine AA/VWVW
NH,
OH OH
Sphingosine WW
NH,

Figure 4.1. Structures of fumonisin B,, sphinganine, and sphingosine.

89

sphinganine via inhibition of the mitogen-activated protein kinase (ERK) pathway, a crucial
regulator of growth, survival, and maintenance of various kidney cells (di Mari et al., 1999;
Dudley et al., 1995; Ishizuka et al., 1999; Kinane et al., 1997; Schramek et al., 1997).
Fumonisin B, (Huang et al., 1995) and sphingoid bases (Hannun and Bell, 1986; Smith et
al., 2000) potently inhibit protein kinase C (PKC), an important activator of MEK and
p44/p42 MAPK (or ERK), via either Raf-1 or MEK kinase. Inhibition of ERK activity by
sphingoid bases has been suggested to be a partial mechanism of action in sphingoid base-
induced growth arrest and apoptosis in various tumor cell lines (Sakakura et al., 1998; Jarvis
et al. , 1997). F umonisin-induced sphinganine accumulation may suppress ERK activity and
contribute to fumonisin-induced growth inhibition and cell death via inhibition of PKC.

Alternatively, the growth inhibitory and apoptotic effects of fumonisin B, may be
mediated by sphinganine via suppression of P13 K/Akt signaling, an important anti-apoptotic
pathway (Krasilnikov, 2000; Zhou et al., 2000). PI3K/Akt signaling has been shown to
mediate both Ras- and cytokine-induced protection from apoptosis. Activation of PI3K
phosphorylates Akt (Stephens et al., 1998; Stokoe et al., 1997), a serine/threonine kinase
which, in turn, suppresses apoptosis by phosphorylating Bad and caspase-9 (Krasilnikov,
2000; Zhou et al., 2000; Zundel and Giaccia, 1998). The sphingoid base sphingosine has
been shown to reduce phosphorylated Akt with concomitant reduction of Akt activity during
sphingosine-induced apoptosis in human hepatoma cells (Chang et al., 2001). Also,
constitutively active Akt prevents sphingosine-induced apoptosis (Chang et al., 2001). Thus,
sphinganine accumulation caused by fumonisin B, may suppress Akt phosphorylation and
trigger a molecular cascade leading to growth inhibition and apoptosis.

The present study used LLC-PK, renal tubular epithelial cells to examine the effects of

90

disruption of sphingolipid metabolism on ERK and PI3K/Akt phosphorylation cascades
leading to LLC-PK, kidney cell growth arrest and apoptosis. To determine the relative
contributions of depletion of complex sphingolipids and accumulation of sphinganine on
ERK and Akt phosphorylation, B-ﬂuoroalanine, an inhibitor of an earlier step in de nova
sphingolipid biosynthesis than fumonisin B,, was used both alone and together with

fumonisin B,.

C. MATERIALS AND METHODS

C]. Materials. Fumonisin B, was purchased from Sigma and dissolved in phosphate
buffered saline (PBS). D-erythra-sphinganine was purchased from Biomol Research
Laboratories, Inc. and prepared for cell culture treatment as previously described (Schroeder
et al., 1994). Rabbit antibodies against ERK, pERK, Akt, and pAkt proteins were obtained
from New England BioLabs (Beverly, MA) and anti-rabbit IgG was obtained from Santa
Cruz.

C.2. Cell Culture. Porcine kidney tubular epithelial LLC-PK, cells were obtained from
American Type Culture Collection and cultured in Dulbecco’s Modiﬁed Eagle Medium/F-
12K nutrient solution (Gibco BRL) (1:1) with 5% fetal bovine serum (F BS) and 100 pM L-
serine (Gibco BRL) until they reach the appropriate conﬂuency for chemical treatments in
each experiment.

C.3. Total Nucleic Acid Measurement. Brieﬂy, 105 cells were cultured in 6-well plates
for 24 hr and treated for appropriate times. Then, cells were washed with ice-cold PBS twice
and air-dried. Cellular nucleic acid was harvested by lysing cells with 0.1 N NaOH and

quantitated by measuring absorbance at 260 nm.

91

C.4. Western blot Analysis. After treatment as indicated in the ﬁgure legend, cells were
washed in ice-cold PBS once and cellular protein was extracted from LLC-PK, cells with
lysis buffer (20 mM Tris-Cl, pH 8.0, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 2 mM
EDTA, 1 mM phenylmethylsulfonyl ﬂuoride, 10 11M of leupeptin and aprotinin cocktail
solution) and sonicated for 15-20 sec followed by centrifuge. The protein extract was
denatured by incubating for 5 min at 95°C in Laemmli buffer. The sample was applied to
SDS-bisacrylamide denaturing gel and transferred onto PVDF membrane (NEN Life
Sciences). The proteins on the membrane were blocked for an hour in 5% non-fat dry
milk/TBS-0.1% Tween 20 solution. The membrane was incubated in 3% BSA/TBS-T
containing primary antibody by overnight followed by 1 hr incubation in blocking solution
containing anti-rabbit IgG conjugated with horseradish peroxidase and developed with
chemiluminescence solution from Santa Cruz.

C.5. Statistical Analysis. The statistical analysis was performed by using Sigma-Stat
Analysis system (Jandel Scientiﬁc, San Rafael, CA). The student t-test was used to analyze
data for total nucleic acids for statistical signiﬁcance. Differences were considered

statistically signiﬁcant at p s 0.05.

D. RESULTS

F umonisin B, inhibits LLC-PK, cell growth and induces apoptosis. To investigate the
effect of fumonisin B, on proliferation, LLC-PK, cells were cultured in the absence or
presence of 50 |J.M fumonisin B, for 48 hr and total nucleic acids were measured as an index
of cell number (Figure 4.2). In control cultures, total nucleic acids increased at a consistent

rate throughout the entire 48 hr culture period with a doubling time of ~1 8 hr. Fumonisin

92

on
O

 

NWAUIO‘Q
OOOOOO

Total Nucleic Acids (pg/well)
S

 

 

O 6 12 18 24 30 36 42 48
Hours

0

 

Figure 4.2. Fumonisin B, inhibits growth and induces death of LLC-PK, kidney cells.

~105 LLC-PK, cells per well were cultured in a six-well plate in the absence (E1) or
presence of 50 11M fumonisin B, (I) at various times up to 48 hrs. At each time point, cells
were harvested and total nucleic acids were measured as described under “Materials and
Methods”. * indicates statistical difference between two groups (P<0.0001).

 

 

 

 

 

:20
T)

E

315-

U)

2

310_ .

U

1.,

3 5*

2 ~55

“a

60 1 1 1 A 1

‘- 0 2 6 8 10

Figure 4.3. Sphinganine inhibits growth and induces death of LLC-PK, kidney cells.
~105 LLC-PK, cells per well were cultured in a six-well plate in the absence (0) or presence
of 20 11M D-erythro-sphinganine (O) at various times. At each time point, cells were
harvested and total nucleic acids were measured as described under “Materials and
Methods”. * indicates statistical difference between two groups (P<0.0001).

93

B, produced morphological changes characteristic of apoptosis within 16-24 hr, including
chromatin condensation, cell shrinkage, membrane blebbing, and formation of apoptotic
bodies (data not shown). Total nucleic acids in cells cultured with fumonisin B, increased
at a similar rate to that of control cultures up to 24 hr. Thereafter, total nucleic acids did not
change during the ﬁnal 24 hr of culture.

Sphinganine inhibits LLC—PK, cell growth and induces apoptosis. To determine if
sphinganine causes similar effects on kidney cell growth to that of fumonisin B,, LLC-PK,
cells were cultured in the presence of 20 1.1M sphinganine and total nucleic acids were
measured as an index of cell number. In the presence of sphinganine, LLC-PK, cells showed
morphological changes characteristic of apoptosis similar to those of the cells cultured with
fumonisin B,, but as early as 1 hr after addition of the sphingoid base (data not shown).
Simultaneously, sphinganine signiﬁcantly decreased total nucleic acids within 1-2 hrs and
killed 70% of the cells within 4 hr (Figure 4.3).

F umonisin B, inhibits ERK and MEK phosphorylation in a sphinganine-dependent
manner. Fumonisin B, does not cause signiﬁcant sphinganine accumulation in LLC-
PK, cells until 6 hr of culture (Kim et al., 2001). To determine the effect of fumonisin B,
on ERK phosphorylation prior to sphinganine accumulation, LLC-PK, kidney cells were
cultured in the presence of 50 |.1.M fumonisin B, for various times up to 2 hr and cellular
protein was lysed and used for Western blot analysis with an antibody speciﬁc for
phosphorylated ERK @ERK). Fumonisin B, increased pERK rapidly with maximum
phosphorylation at 10 min. Thereafter, phosphorylation decreased to the basal level within
30 min (Figure 4.4A). To determine if the effect was speciﬁcally caused by fumonisin B,,

pERK of cells cultured with fumonisin B, was compared to that of control cultures. Time-

94

O 5 10 30 60 120min

        

 

Figure 4.4. Time-dependent changes in the phosphorylation of ERK in control and
fumonisin B,-treated LLC-PK, cells. LLC-PK, cells were grown in DMEM/F12-K
growth medium containing 5% Fumonisin B, for 48 hours in 100 mm dishes. A. Kidney cells
were treated with 50 BM of fumonisin B, for 5, 10, 30, 60 and 120 minutes and harvested
for western blot analysis against phosphorylated form of ERK (pERK) protein as described
under “Materials and Methods”. B. Comparison between control (C) and fumonisin B, (F)
at 0, 10, and 30 min.

95

 

 

dependent changes in phosphorylation of ERK (pERK) were similar for both control cultures
and fumonisin-treated cultures (Figure 4.48).

To further examine the effect of fumonisin B, on ERK phosphorylation and the role of
sphinganine accumulation, additional studies were conducted for 16 hr. This is the point at
which cellular sphinganine increases to ~1 nmol/mg protein and DNA fragmentation is
evident (Kim et al. , 2001). B-ﬂuoroalanine, which inhibits the ﬁrst step of de nova
sphingolipid biosynthesis catalyzed by serine palmitoyltransferase and prevents fumonisin-
induced sphinganine accumulation, was used as a tool to further dissect the roles of complex
sphingolipid depletion and of sphinganine accumulation on the ERK pathway. As shown in
Figure 4.5, the total amount of ERK protein was not affected by any treatments (A).
However, phosphorylation of ERK and MEK (B and C, respectively) was reduced in cells
cultured with 50 1.1M fumonisin B, for 16 hr. Importantly, addition of 50 1.1M B-
ﬂuoroalanine alone did not reduce phosphorylation of ERK or MEK and B-ﬂuoroalanine
added together with 50 BM fumonisin B, for 16 hr restored phosphorylated ERK and MEK.
Phosphorylation of Raf-1 (D) was not affected by any of the treatments.

Sphinganine signiﬁcantly reduces phosphorylation of ERK and MEK, but not Raf-1.
To further investigate the possibility that sphinganine mediates the fumonisin-induced
decrease in ERK phosphorylation, LLC-PK, cells were cultured in the absence or presence
of a growth inhibitory and apoptotic concentration of D-erythro-sphinganine. Since
ceramide is also growth inhibitory and apoptotic, a subtoxic and non-apoptotic dose of
fumonisin B, (10 pM) was used to prevent acylation of sphinganine to form ceramide. As
shown in Figure 4.6, 10 1.1M fumonisin B, alone had no effect; whereas, 20 |.1.M sphinganine,

either alone or in the presence of 10 BM fumonisin B, potently reduced phosphorylation of

96

BF A - - + +
HF "‘- a, ”m???- an. nuns-w-

Figure 4.5. Fumonisin B, reduces phosphorylated ERK and MEK, but not Raf-l.
LLC-PK, cells were cultured in the absence or presence of fumonisin B, (FB,) at 50 pM
and/or B—ﬂuoroalanine (BFA) at 50 uM. After 16 hr, cellular protein was isolated and used
for Western blot analysis as described under “Materials and Methods”. Above blots are
probed against total ERK (A), phosphorylated ERK (B), phosphorylated MEK (C) and
phosphorylated Raf-l (D).

5min 30min

Con SA FB SA/FB Con SA FB SA/FB

A ERK if “'3 M ff? E“? P”: rim-s ems .‘ r3

ﬁh—‘ﬂm

 

 

 

  

 

 

B pERK «...-33223;

C pMEK -‘*~-mm~m

“*mﬁwww“

D pRaf --------

Figure 4.6. Sphinganine reduces phosphorylated ERK and MEK, but not Raf-1.

LLC-PK, cells were cultured in the presence of vehicle (Con), sphinganine at 20 pM (SA),
ﬁrmonisin B, at 10 uM (PB), and sphinganine (20 11M) together with fumonisin B, (10
pM)(SA/FB). After 5 or 30 min, cellular protein was isolated and used for Western blot
analysis as described under “Materials and Methods”. Above blots are probed against total
ERK (A), phosphorylated ERK (B), phosphorylated MEK (C) and phosphorylated Raf-1 (D)

97

ERK (B) and MEK (C) without affecting the total amount of ERK (A). The effects of
sphinganine persisted ~30 min, and subsided by ~l hr (data not shown). Raf-1 was not
affected by any treatment.

F umanisin B, suppresses Akt phosphorylation. To determine the effect of fumonisin
B, on the Akt pathway and to dissect the role of sphinganine accumulation, Western blot
analysis was conducted using antibodies to total Akt and to Akt phosphorylated at thr3 08 and
at ser473. As shown in Figure 4.7, total Akt (C) was not affected by any treatment.
However, culture with 50 BM fumonisin B, for 16 hr reduced both pAkt (ser473) (A) and
pAkt (thr308) (B). Culture with B-ﬂuoroalanine alone had no effect and addition of B-
ﬂuoroalanine together with alone or in the presence of fumonisin B, restored pAkt (thr308)
and pAkt (ser473) to that of controls.

Sphinganine significantly reduces phosphorylation of A kt. T o d e t e r m i n e i f
sphinganine has similar effects as fumonisin B, on Akt phosphorylation, LLC-PK, cells were
cultured in the absence or presence of sphinganine. Again, a subtoxic and non-apoptotic
concentration of fumonisin B, (10 1.1M) was used to prevent acylation of sphinganine to form
ceramide. Cultures of LLC-PK, cells with 10 11M fumonisin B, had no effect; whereas,
culture with 20 |J.M sphinganine both alone and in the presence of 10 BM fumonisin B,
reduced the phosphorylation of Akt at both thr308 (A) and ser473 (B) at both 5 or 30 min of

culture (Figure 4.8).

E. DISCUSSION
Inhibition of ceramide synthase by fumonisin B, causes accumulation of sphingoid bases

and depletion of complex sphingolipids (Norred et al., 1992; Wang et al., 1991; Schroeder

98

FB, - + - +
[SPA - - + +

A pAkt-ser473 ...... ...... “ms-ml

gm. --v----. ,.

B pAkt-thr308 ' ...... W .. ......

4 mm —— ‘i

C Akt ----i

Figure 4. 7. Fumonisin B, reduces phosphorylated Akt. LLC-PK, cells were cultured
in the absence or presence of fumonisin B, (F B,) at 50 11M and/or B—ﬂuoroalanine (BFA) at
50 11M. After 16 hr, cellular protein was isolated and used for Western blot analysis as
described under “Materials and Methods”. Above blots are probed against phosphorylated
Akt at serine 473 mAkt-ser473) (A) and threonine 308 (pAkt-thr308)(B), and total Akt (C).

5 min 30 rnin

Con SA FB SA/FB Con SA FB SA/FB

 

 

A pAkt‘tIlr308 a" “ “'4 m we»

B pAkt-ser473 " "'"' '- "'"""' - ...-... ‘ ~—-'

Figure 4.8. Sphinganine reduces phosphorylated Akt. LLC-PK, cells were cultured in
the presence of vehicle (Con), sphinganine at 20 uM (SA), fumonisin B, at 10 11M (PB), and
sphinganine (20 uM) together with fumonisin B, (10 pM)(SA/FB). After 5 or 30 min,
cellular protein was isolated and used for Western blot analysis as described under “Materials
and Methods”. Above blots are probed against phosphorylated Akt at serine 473 (pAkt-
ser473) (A) and threonine 308 (pAkt-thr308) (B).

99

et al., 1994). Sphingoid bases are growth inhibitory and cytotoxic for many cell types
(Merrill et al., 1993b) and complex sphingolipids also have been implicated in the regulation
of cell growth and differentiation (Hakomori and I garashi, 1993; Laine and Hakomori, 1973;
Bremer and Hakomori, 1982; Saito et al. , 1985). Consistent with previous ﬁndings (Kim et
al., 2001), fumonisin B, caused morphological changes indicative of apoptosis within 16 hr
and inhibited growth of LLC-PK, cells within 24 hr of culture. This coincides with the time
when endogenous sphinganine reaches a concentration of ~1 nmol/mg protein which is
growth inhibitory and apoptotic (Kim et al., 2001). The potent anti-proliferative effect and
concomitant morphological changes characteristic of apoptosis in LLC-PK, cells as early as
1 hr after the addition of exogenous sphinganine support a mechanism of fumonisin toxicity
involving sphinganine accumulation. The ability of sphinganine to diffuse rapidly through
cell membranes (Hannun et al. , 1991) explains the more rapid action of exogenously added
sphinganine. This cytotoxicity of sphinganine in kidney cells is consistent with other reports
where sphingoid bases inhibited cell growth and induced apoptosis (Ohta et al. , 1995, 1994;
Stevens et al., 1990). The growth inhibitory and cytotoxic effects of sphinganine in LLC-
PK, cells explain fumonisin’s interruption of regeneration after mechanical injury and
enlargement of swiped area in renal proximal tubule cell culture (Counts et al. , 1995) as well
as the apoptotic features shown in the tubular epithelial region of the kidney (Voss et al.,
2001; Tolleson et al., 1996a; Bondy et al., 1996; Bucci et al., 1998).

In various cell lines including LLC-PK, cells, the ERK pathway plays a critical role in
determining cellular growth (di Mari et al., 1999; Dudley et al., 1995; Kinane et al., 1997;
Schramek et al., 1997). Phosphorylation and activation of ERK activates transcription

factors such as NF -KB and AP-l via a series of signaling events and leads to transcription

100

of genes involved in cell proliferation (Cowley et al., 1994; Hunter, 1995; Marshall, 1995).
Previously, fumonisin B, was reported to activate ERK at ~10 min after addition of
fumonisin B, to cultures of human bronchial epithelial cells (Pinelli et al., 1999) and Swiss
3T3 cells (Wattenberg et al., 1996). However, in the present study, ERK phosphorylation
increased as early as 5-10 min for both control and fumonisin B, cultures and then decreased
to the initial level by 30 min, indicating ERK phosphorylation is not rapidly altered in
response to fumonisin B ,. The reason for the disparity in results may be because appropriate
controls were not included in the previous studies (Pinelli et al., 1999; Wattenberg et al.,
1996). Alternatively, the discrepancy in results may be due to distinct metabolic responses
to sphingoid bases of different cell types.

In contrast to the lack of an early response to fumonisin B,, the present study
demonstrates that the ERK pathway was down-regulated within 16 hr of culture with
fumonisin B,. Again, this is the point at which endogenous sphinganine has increased to ~l
nmol/mg protein (Kim et al, 2001). To our knowledge, this is the ﬁrst study demonstrating
down-regulation of ERK by fumonisin B,. Fumonisin B, also produced similar effects when
ERK was stimulated by insulin or inhibited by PD98059, a MEK inhibitor (data not shown).
These observations indicate that fumonisin B, inhibits kidney cell proliferation, at least in
part, by suppressing the ERK pathway. Further, the time-dependence for inhibition of ERK
phosphorylation by fumonisin B, suggests a possible role of sphinganine accumulation.

Exogenously added sphinganine also signiﬁcantly decreased phosphorylation of ERK and
MEK, but even more rapidly than fumonisin B,. This is consistent with previous studies
which demonstrated that potent inhibition of ERK plays an important role in sphingoid base-

mediated death of U937 human monoblastic leukemia cells (Jarvis et al., 1997). A causal

101

role for sphinganine in mediating suppression of the ERK pathway by fumonisin B, is further
supported by the ﬁnding that addition of B-ﬂuoroalanine (which prevents sphinganine
accumulation caused by fumonisin B,) abolished the inhibiting effect of fumonisin B, on
phosphorylation of ERK and MEK. The possibility of complex sphingolipid depletion as a
cause for ﬁrmonisin’s effect on the ERK pathway is unlikely because B-ﬂuoroalanine alone,
which depletes complex sphingolipid such as sphingomyelin to a similar degree as fumonisin
B, (Merrill et al. , 1993a), did not decrease ERK or MEK phosphorylation. ERK and MEK
phosphorylation were inhibited to a similar extent by both sphinganine alone or sphinganine
together with a suboptimal concentration of fumonisin B, (which prevents formation of
ceramide from exogenous sphinganine), indicating that sphinganine, not ceramide, inhibits
phosphorylation of ERK and MEK. Furthermore, neither fumonisin B, nor sphinganine
altered phosphorylation of Raf-1 , a serine threonine kinase which mediates signaling from
Ras to MEK (Dent et al., 1992; Howe et al., 1992; Kyriakis et al., 1992). These ﬁndings
demonstrate that down-regulation of ERK phosphorylation by fumonisin B, is mediated by
sphinganine accumulation via a mechanism which is independent of Raf-l and which may
involve MEK kinase, the other MEK activator.

Fumonisin B, and sphinganine may regulate MEK and ERK via MEK kinase by either
inhibiting PKC or by affecting heterodimeric G-protein-coupled receptors. PKC regulates
the ERK pathway via either MEK kinase or Raf-1 (Hill et al., 1993; Nishida and Gotoh,
1993; Pelech et al., 1993). Furthermore, sphingoid bases are potent inhibitors of PKC
(Hannun and Bell, 1986) and fumonisin B, has been shown to inhibit PKC activity in a
concentration-dependent manner (Huang et al., 1995). Alternatively, fumonisin B, and

sphingoid bases also interact with G-protein-coupled receptors (Ho et al., 1996) and G-

102

protein-coupled receptors regulate ERK activity via MEK kinase, rather than Raf-1 (Cobb
and Goldsmith, 1995; Lavoie et al., 1996). Moreover, in LLC-PK, cells Ga,_, has been
shown to mediate growth via Raf-independent activation of ERK (Kinane et al., 1997).
Fumonisin B, and sphinganine may regulate MEK and ERK via MEK kinase by either
inhibiting PKC or by affecting heterotrimeric G protein-coupled receptors.

Akt (also known as protein kinase B), a serine/threonine kinase activated by P13 K, plays
an important role in the regulation of cell death (Krasilnikov, 2000; Zhou et al., 2000). Akt
kinase protects cells from apoptosis induced by a variety of extracellular stresses including
loss of cell adhesion, serum withdrawal, and UV-B irradiation (Kennedy et al. , l 997; Khwaja
et al., 1997; Kulik et al., 1997). Further, increased activity of Akt contributes to
carcinogenesis in various tissues (Graff et al., 2000; Krasilnikov, 2000; Tsatsanis and
Spandidos, 2000; Yuan et al., 2000). Recently, Ramljak et al. (2000) showed Akt was
activated in a neoplastic liver specimen obtained from a long-term feeding study of
fumonisin B, in rats and suggested that fumonisin-induced Akt activation may be a
mechanism by which fumonisin B, acts as a carcinogen. In contrast, the present study
demonstrates down-regulation of Akt phosphorylation by fumonisin B,. The disparity in
results could be due to differences in species (rat vs pig), organ (liver vs kidney), model
system (in viva vs. in vitra), and/or study period (chronic vs. acute). Treatment of LLC-PK,
cells with PI3K inhibitor LY294002 signiﬁcantly reduced Akt phosphorylation and the
metabolic capacity (data not shown), indicating the importance of Akt in normal LLC-PK,
cellular metabolism. F umonisin-induced decreases in Akt phosphorylation may suppress the
cell survival signal and shift the balance toward cell death, providing an additional

mechanism by which fumonisin B, inhibits cell growth and induces apoptosis.

103

Similar to the ERK pathway, the mechanism by which fumonisin B, down-regulates Akt
phosphorylation appears to involve sphinganine accumulation rather than complex
sphingolipid depletion. Exogenously added sphinganine signiﬁcantly reduced
phosphorylated Akt on both ser473 and thr308 and B-ﬂuoroalanine prevented the fumonisin-
induced decreases in Akt phosphorylation. The possibility that complex sphingolipid
depletion mediates the effect of fumonisin B, on Akt phosphorylation is unlikely because B-
ﬂuoroalanine alone, which depletes complex sphingolipids but without causing sphinganine
accumulation, did not decrease Akt phosphorylation at either ser 473 nor thr308. Down-
regulation of Akt and induction of cell death by sphinganine are consistent with those of
Chang et al. (2001) who demonstrated that sphingosine, another sphingoid base, induces
dephosphorylation of Akt during apoptosis in human hepatoma (Hep3B) cells. Sphingosine
also caused cytochrome C release and caspase-3 activation (Chang et al., 2001) which are
critical events in the regulation of apoptosis (Kluck et al., 1997). Attenuation of
sphingosine-induced cytochrome C release and caspase 3 activation by overexpression of
activated Akt kinase (Chang et al. , 2001) implies that suppression of Akt by sphingoid bases
could cause cell death. Thus, the cytotoxic effect of sphinganine in the present study is, at
least in part, due to the suppression of signals via the PI3K/Akt pathway and this property
appears to contribute to the growth-inhibitory and cytotoxic effects of fumonisin B, in LLC-
PK, cells, leading to fumonisin-induced kidney cell death.

Taken together, the ﬁndings of this study suggest that fumonisin-induced growth
inhibition and cell death in LLC-PK, porcine renal tubular epithelial cells is mediated by
sphinganine which suppresses ERK and Akt signaling. Moreover, down-regulation of the

ERK phosphorylation cascade is independent of Raf-1.

104

CHAPTER V

SUMMARY AND CONCLUSIONS

105

The present study investigated how fumonisin B,, the most common contaminant of
corn, can cause toxicity in the kidney, the most sensitive target organ, using an in vitro
culture system with LLC-PK, porcine renal tubular epithelial cells. LLC-PK, cells cultured
with fumonisin B, underwent growth arrest and exhibited increased DNA fragmentation, cell
shrinkage, and membrane blebbing indicative of apoptosis similar to renal tubular epithelial
cells in viva. Flow cytometric analysis revealed that fumonisin B, produced a 7-fold increase
in the number of cells in the sub-Go/G, range which represents apoptotic cells. Therefore,
LLC-PK, cells appear to be an excellent model to study the molecular mechanism of toxicity
caused by fumonisins.

Studies which examined the role of disruption of sphingolipid metabolism in
fumonisin-induced apoptosis demonstrated that apoptosis was highly dependent on
sphinganine accumulation. Since sphinganine accumulation is also evident in kidney and
other tissues of animals fed fumonisins, in viva examination of known targets of sphingoid
bases and their l-phosphate metabolites may provide insight into the mechanism of action
of these mycotoxins.

Fumonisin B, also increased calmodulin mRNA and calmodulin protein, apparently
by increasing calmodulin gene transcription via sphinganine l-phosphate. Fumonisin B, and
sphinganine l-phosphate are the ﬁrst two examples of chemical inducers of calmodulin.
Thus, both fumonisin B, and sphinganine l-phosphate provide novel tools to study
transcriptional regulation of calmodulin genes.

Since apoptosis induced by fumonisin B, was dependent on calmodulin activity,
overexpression of the calmodulin gene either by activating the calmodulin gene promoter or

via calmodulin gene transfection may lead to a better understanding of the mechanism of

106

action of fumonisins. In addition, calmodulin antisense cDNA and calmodulin antagonists
as well as calmodulin knockout animals may be useful tools to further elucidate the
mechanism of fumonisin toxicity. Calmodulin antisense cDNA and calmodulin antagonists
also may serve as drugs to treat animals and/or humans exposed to fumonisins. Moreover,
calmodulin mRN A and calmodulin protein may provide sensitive biomarkers for exposure
to the mycotoxin.

Sphinganine l-phosphate appears to mediate fumonisin-induced calmodulin
induction and, thereby, contributes to fumonisin-induced apoptosis. This observation is
contradictory to dogma which contends that sphinganine l-phosphate is “mitogenic” as
opposed to “apoptotic.” The full growth inhibitory and apoptotic response to fumonisin B,
appears to be dependent not only on sphinganine l-phosphate and calmodulin, but also on
sphinganine and regulation of key signaling pathways. The results underscore that changes
in cellular behavior (in this case apoptosis) are the result of a number of mediators acting on
a variety of targets rather than a single mediator acting on only one or very few targets.

Fumonisin B, decreased phosphorylation of both ERK and Akt proteins via
sphinganine accumulation. The more potent effects on ERK and Akt of exogenous
sphinganine than fumonisin B, may be due to accumulation of a different proﬁle of
mediators. Exogenous sphinganine causes accumulation of sphinganine and sphinganine 1-
phosphate as well as ceramide; whereas, fumonisin B, prevents formation of ceramide and
causes accumulation of sphinganine and sphinganine l-phosphate. Ceramide has been
shown to inhibit ERK and Akt, while sphinganine l-phosphate has been reported to activate
ERK and the effect on Akt is not know.

The molecular mechanism by which fumonisin B, suppresses ERK and Akt signalng

107

may involve sphinganine inhibition of protein kinase C (PKC). Though the effects of
sphinganine and the mycotoxin on PKC were not measured in this study, PKC is an upstream
regulator of ERK and sphingoid bases potently inhibit PKC. Future studies should examine
the role of PKC in fumonisin-induced suppression of ERK. If inhibition of PKC does play
a role, activators of PKC may serve as drugs to counteract the action of fumonisin B, and/or
sphinganine

There are interconnections between sphinganine l-phosphate and calmodulin which
implicate these molecules not only in fumonisin-induced apoptosis, but also in
carcinogenesis caused by fumonisins. Sphinganine l-phosphate induces calmodulin
expression and mobilizes intracellular calcium and calmodulin is dependent on calcium for
some regulatory activities. In addition, the concentration of both sphinganine 1-phosphate
and calmodulin appear to be increased by common stimuli including serum and neural
growth factor and both have been shown to stimulate DNA synthesis, expedite cell cycle
progression through G,/S, and play roles in activation of cyclin-dependent kinases.
Moreover, calmodulin is elevated in various forms of tumors. These facts suggest that
sphinganine l-phosphate and calmodulin may be key not only in the initial acute response
to fumonisin exposure which is apoptosis, but also in carcinogenesis which is the result of
chronic exposure to fumonisins. Therefore, future studies should examine the roles of
sphinganine l-phosphate and calmodulin in regenerative growth of surviving cells
surrounding tissue initially killed by fumonisin exposure, which could contribute to
fumonisin-induced carcinogenesis in various tissues including kidney and liver.

The ﬁndings of this study, taken together with the results of other investigations,

provide a plausible molecular mechanism for renal toxicity caused by fumonisins (Figure

108

5.1). Under conditions of exposure to fumonisins via the diet, ceramide synthase is inhibited
causing depletion of complex sphingolipids and accumulation of sphinganine and
sphinganine l-phosphate. The speciﬁc contributions of depletion of complex sphingolipids
to fumonisin-induced apoptosis are not clear. Accumulation of sphinganine inhibits P13K
and blocks ERK signaling probably by inhibiting protein kinase. Accumulation of
sphinganine l-phosphate stimulates calmodulin gene transcription and calcium mobilization
which act to increase CaH/CAM and activate the phosphatase calcineurin. Inactivation of
ERK and Akt and activation of calcineurin converge to cause dephosphorylation of Bad

which triggers apoptosis.

Kidney Cell Fumonisin B, /spi?$:lj?;jdsl
5 Ceramide

)phinganinA-D Sphinganine 1 Pf
Serine + 5 ‘ ‘

     
 

 

V E
Palmitoyl CoA . CaM mRNA1 v
ea'M [Ca’tlf
‘ 2",; I
Ca”ICaM
3‘ Other
Enzymes?
poptosrs

Cell Proliferation I

 

Figure 5.1. Summary of possible molecular mechanism of fumonisin-induced kidney
toxicity. (Solid line with arrow, conversion; dotted line with perpendicular line, inhibition;
and dotted line with arrow, activation/stimulation)

109

APPENDIX

110

Appendix 1. Primer pairs for ampliﬁcation of bcl-2. bcl-x and box mRN A (Chapter II)

 

bcl—2 mRNA
Forward
5'-ACTTGTGGCCCAGATAGGCACCCAG-3’
Reverse
5'-CGACTTCGCCGAGATGTCCAGCCAG-3'

bax mRNA
Forward

5'-CAGCTCTGAGCAGATCATGAAGACA-3'
Reverse
5’-GCCCATCTTCTTCCAGATGGTGAGC-3'

bcl-x mRN A
Forward

5'-AATGTCTCAGAGCAACCGGGAGCTG-3'
Reverse
5'-TCATITCCTACTGAAGAGTGAGCCCA-3'

lll

Appendix 2. Differential display RT-PCR.

 

C F
R: : 5;”
”I, L'— i-‘t' <-K18
K14 —>‘--»~5°~
K15—>...... ‘
K16—"'""“
:’*~ r;- TAIO
K17--"
TA6

C, Control; F, 50 uM fumonisin B,
Primers: TA6; 5'-T12-A-3' and 5'-GCAATCGATC-3'
TA10; 5'-T12-A-3' and 5'-TAGCAAGTGC-3'

112

Sequences of cDNAs
K 12

l GAATCNCCNT NGCTTGGGTA CCGAGCTCGG ATCCACTAGT
AACGGGCCGC CAGTGTGCTG

61 GAATTCGCCC TTGCAATCGA TGTAACATTA TTATTGCCAC
ACACATTTTT ATACTAGATC

121 CTAACACTTC GTCTACATTG CTTTTAAATA ATGTTCGTAT
GTCACTGTGT GTTATAAATC

181 TGCATCAATT TCCGTTTTAA TACCAGTATC CTTTTTCCTC
TATACGAATC CCTTGAATCT

241 TAGGGTAATG TACCTTACAA AATTTTAGGT TCTACAGATG
CCATATTGTC TGAATCTCAC AAGGATTTCA ATATGGCTAT

7!
'63

1 ATTGGGCCCT CTAGATGCAT GCTCGAGCGG CCGCCAGTGT
GATGGATATC TGCAGAATTC

61 GNCCTTGCAA TCGATGACGG CAAAGAGCAT TGTGATCAAA
TCCACATGAG TAAAGTAACA

121 TTTGGAGCCC AGCAGGGGAT AAAAAGGAAG GTATTGTTGC
TCGGAGTGCC ACAGTATTGT

181 CCTTTACCAT TTTAGGATGT ATTGAAATGC ATAAGTAATA
GTTGTAATTG CATATATGAG

241 AAAGCACCAA GCAAGCCCTA GCTCCTTTGA AAAGGCCGGG '
CTGGGAGGTG AAAATCATAA

301 ATCTGGGCGC CTTGAAACAG CATTCTITAG GGAAGGAGAC
TATGTGATCG CTGTGCAGCA

361 GGTTCGAATC CATAATAAGA CAGATCAGAA TCTGAGCCAC
TTGAGATGGA TAGGCTCACT

421 TGTGCATACT ACATCGATTG CAAGGGCGAA TTCCAGCACA
CTGGCGGCCG TACTAGTGGA

7!
Z

l CGGGCGAATT GGGCCCTCTA GATGCATGCT CGAGCGGCCG
CCAGTGTGAT GGATATCTGC

61 AGAATTCGTC CTTGCAATCG ATGGAAATCT GAATGATGGA
TGTCAAAGAG CACTGCAGGC

121 AACGGGGGAC AATTATTTAC CTAGAAAATA TCTACAGTAG
ACACGTTCGT CTGTAGTATC

181 TAAAGGTCTT AATTCTGCTG CCGCTCTGCC ACTTACTGCA
TGAATCTGTG TGGGTTGAAT

241 TCATTGCTCT GAGGTTTCAT TTGTCCATTT AAAATGCATG
ATCTGCATTA TCCACCTCAG

113

7!
u-

7:
ex

7':
\1

301 GAGCTTGTAT TGAAGCTCAA GTGTCAAAAA TGCATCAAAA
TGCTAAAGCG TTACCATTAT
361 AAAATGACTG AAATTGTTAC TCATCGATTG CAAGGGCGAA
TTCCAGCACA CTGGCGGCCG

1 ACCCTTNGCT TGGTACCCGA GCTCGGATCC ACTAGTAACG
GGCCGCCAGT GTGCTGGAA

61 TTCGCCCTT GCAATCGATG TATAAAGACA NTTTTAATAC
TCTGCAAATT CAGGGAGTTT

121 TTTCTCCTAT CTCTAGTATC TTTTCACTAT CCAATTACAT
CAAAGCCACC CCTGAGCACT

181 GCTCCCTTCA TATTGNCATT GTGGTAACTT ACTTTAAAAC
TTCTTTAGAA TAAAGAGGTG

241 ATATGTGTGC AAATTAGCTT TCATCTGGAC CTCAAGGGAG

1 ACNCTTNCTA CTATCCGGCG AATTGNGCCC TCTAGATGCA
TGCTCGAGCG GCCGCCAGTG

61 TGATGGATAT CTGCAGAATT CGCCNTTGCA ATCGATGGGC
AGGCACGCCA GCCAGACTTC

121 TTAAGAATCC TGGCAAGAGT TAATACAACA GAAGAAACTG
AGAACCATAA CTAGCAGCTG

181 TGTCTTTCCT GATTTGTTTG GGTTTTTTAG TAGCCGGCAT
ATAATTATGT CTTCATCTTT

241 CAAGAACTGT CATTTTGTCA GTTGCCCAGT TTGATTTATG
TGATAAAGNT GAGGATTTGG

301 AAACATACAA TTCAGTTCTA TTITTATCAT GTCAAAGAAT
TAAATTAATT AAAACAATTG

l CCGGGCGAAT TGGGCCCTCT AGATGCATGC TCGAGCGGCC
GCCAGTGTGA TGGATATCTG

61 CAGAATTCGN CCTTGCAATC GATGCAGATC CACAGGCTAA
TGCTACCTCT GGTTTAGGAA

121 TAGAGGAAGT AAATTATTCT ACCTATAATC TATTGGAGCA
CAGTGCAGAT GTGAAAGATT

181 GTATCCAGAA AACTTCTTCT CCAAATTTAG ACCTTGTACC
TTCTCATATT GATTTGGTAG

241 CAGCGGAAAT TGAGTTAGTA GACCGTGACA AGAGAGAATA
TATGCTTAAA AAAGCATTAG

301 AAGAGGTGAA ATCTGAGTAT GACTACATCA TCATCGATTG
CAAGGGCGAA TTCCAGCACA

114

7\'
co

1 TTGGGCCCTC TAGATGCATG CTCGAGCGGC CGCCAGTGTG

ATGGATATCT GCAGAATTCG
61 TCCTTTAGCA AGTGCTGCAG CTGACAAAAT CCCCGGGTTG

TTAGGTGTCT TTCAGAAGCT
121 GATTGCATCC AAAGCCAATG ACCACCAAGG TI I I IATCTT

CTAAACAGTA TAATAGAGCA
181 CATGCCTCCT GAGTCAGTTG ACCAGTCAGG AAGCAAATCT

TCATTCTGCT ATTCCAAAGA
241 CTTCAGAATT CCAAAACAAC CAAGTTTATC AAGAGI 1 ICT

TAGTCTTTAT TAATTTGNAT
301 TGCATAAAAT ACGGGGCACT AGCACTGCAA GAAATAI I IG

ACGGTATACA ACCAAAAATG
361 GTTGGAATGG GI I IGGAAAA AATCATTATT CCTGGAATTC

AGAAAGTATC TGGGAATGTA

115

REFERENCES

116

REFERENCES

Ahn, E-H, and Schroeder, H. (2002) Bioactive sphingolipids are constituents of soy and
dairy products. J. Food Sci. (in press)

Ames, B. N., and Gold, L. S. (1990) Too many rodent carcinogens: mitogenesis increases
mutagenesis. Science 249,970-1

Attardi, L. D., Lowe, S. W., Brugarolas, J ., and Jacks, T. (1996) Transcriptional activation
by p53, but not induction of the p21 gene, is essential for oncogene-mediated apoptosis.
EMBOJ 15,3693-701

Bai, G., and Weiss, B. (1991) The increase of calmodulin in PC 12 cells induced by NGF is
caused by differential expression of multiple mRNAs for calmodulin. J Cell Physiol
149,414-21.

Bargou, R. C., Daniel, P. T., Mapara, M. Y., Bommert, K., Wagener, C., Kallinich, B.,
Royer, H. D., and Dorken, B. (1995b) Expression of the bcl-2 gene family in normal and
malignant breast tissue: low bax-alpha expression in tumor cells correlates with resistance
towards apoptosis. Int J Cancer 60,854-9

Bargou, R. C., Bommert, K., Weinmann, P., Daniel, P. T., Wagener, C., Mapara, M. Y., and
Dorken, B. (19953) Induction of Bax-alpha precedes apoptosis in a human B lymphoma cell
line: potential role of the bcl-2 gene family in surface IgM-mediated apoptosis. Eur J
Immunol 25,770-5

Basu, S., Bayoumy, S., Zhang, Y., Lozano, J., and Kolesnick, R. (1998) BAD enables
ceramide to signal apoptosis via Ras and Raf-1. J Biol Chem 273,30419-26.

Bell, R.M., Hannun, Y.A., and Merrill, A.H., Jr. (Eds) (1993) Advances in Lipid Research.“
Sphingolipids and Their Metabolites, Vols. 25 and 26. Academic Press, Orlando, FL.

Bellomo, G., Perotti, M., Taddei, F., Mirabelli, F., Finardi, G., Nicotera, P., and Orrenius,
S. (1992) Tumor necrosis factor alpha induces apoptosis in mammary adenocarcinoma cells
by an increase in intranuclear free Ca2+ concentration and DNA fragmentation. Cancer Res
52,1342-6.

Bielawska, A. E., Shapiro, J. P., Jiang, L., Melkonyan, H. S., Piot, C., Wolfe, C. L., Tomei,
L. D., Hannun, Y. A., and Umansky, S. R. (1997) Ceramide is involved in triggering of
cardiomyocyte apoptosis induced by ischemia and reperfusion. Am J Pathol 151,1257-63
Bito, H., Deisseroth, K., and Tsien, R. W. (1997) Cay-dependent regulation in neuronal gene
expression. Curr Opin Neurobiol 7,419-29.

117

Blank, M. L., Cress, E. A., Smith, Z. L., and Snyder, F. (1992) Meats and ﬁsh consumed in
the American diet contain substantial amounts of ether-linked phospholipids. J Nutr
122,1656-61.

Bondy, G., Barker, M., Mueller, R., Fernie, S., Miller, J. D., Armstrong, C., Hierlihy, S. L.,
Rowsell, P., and Suzuki, C. (1996) F umonisin B, toxicity in male Sprague-Dawley rats. Adv
Exp Med Biol 392,251-64.

Bomfeldt, K. E., Graves, L. M., Raines, E. W., Igarashi, Y., Wayman, G., Yamamura, S.,
Yatomi, Y., Sidhu, J. S., Krebs, E. G., Hakomori, S., and et al. (1995) Sphingosine-l-
phosphate inhibits PDGF-induced chemotaxis of human arterial smooth muscle cells: spatial
and temporal modulation of PDGF chemotactic signal transduction. J C ell Biol 130,193-206

Bouvet, M., Bold, R. J., Lee, J ., Evans, D. B., Abbruzzese, J. L., Chiao, P. J., McConkey, D.
J., Chandra, J ., Chada, S., Fang, B., and Roth, J. A. (1998) Adenovirus-mediated wild-type
p53 tumor suppressor gene therapy induces apoptosis and suppresses growth of human
pancreatic cancer. Ann Surg Oncol 5,681 -8

Bremer, E. G., and Hakomori, S. (1982) GM3 ganglioside induces hamster ﬁbroblast growth
inhibition in chemically-deﬁned medium: ganglioside may regulate growth factor receptor
function. Biochem Biophys Res Commun 106,711-8.

Bruckheimer, E. M., Cho, S. H., Sarkiss, M., Hemnann, J ., and McDonnell, T. J. (1998) The
Bcl-2 gene family and apoptosis. Adv Biochem Eng Biotechnal 62,75-105

Bucci, T. J., Howard, P. C., Tolleson, W. H., Laborde, J. B., and Hansen, D. K. (1998) Renal
effects of fumonisin mycotoxins in animals. Toxicol Pathol 26,160-4

Cawood, M. E., Gelderblom, W. C., Alberts, J. F., and Snyman, S. D. (1994) Interaction of
l4C-labelled fumonisin B mycotoxins with primary rat hepatocyte cultures. Food Chem
Toxicol 32,627-32.

Chafouleas, J. G., Lagace, L., Bolton, W. E., Boyd, A. E., 3rd, and Means, A. R. (1984)
Changes in calmodulin and its mRNA accompany reentry of quiescent (G0) cells into the cell
cycle. Cell 36,73-81.

Chafouleas, J. G., Bolton, W. E., Hidaka, H., Boyd, A. E., 3rd, and Means, A. R. (1982)
Calmodulin and the cell cycle: involvement in regulation of cell-cycle progression. Cell
28,41-50.

Chafouleas, J. G., Pardue, R. L., Brinkley, B. R., Dedman, J. R., and Means, A. R. (1981)
Regulation of intracellular levels of calmodulin and tubulin in normal and transformed cells.
Prac Natl Acad Sci U S A 78,996-1000.

Chang, H. C., Tsai, L. H., Chuang, L. Y., and Hung, W. C. (2001) Role of AKT kinase in
sphingosine-induced apoptosis in human hepatoma cells. J Cell Physiol 188,188-93.

118

Chao, R., Khan, W., and Hannun, Y. A. (1992) Retinoblastoma protein dephosphorylation
induced by D-erythro-sphingosine. J Biol Chem 267,23459-62

Charles, A. G., Han, T. Y., Liu, Y. Y., Hansen, N., Giuliano, A. E., and Cabot, M. C. (2001)
Taxol-induced ceramide generation and apoptosis in human breast cancer cells. Cancer
C hemather Pharmacol 47 ,444-50.

Chen, J ., Nikolova-Karakashian, M., Menill, A. H., Jr., and Morgan, E. T. (1995) Regulation
of cytochrome P450 2C11 (CYP2C11) gene expression by interleukin-1, sphingomyelin
hydrolysis, and ceramides in rat hepatocytes. J Biol Chem 270,25233-8.

Chomczynski, P., and Sacchi, N. (1987) Single-step method of RNA isolation by acid
guanidinium thiocyanate-phenol-chloroforrn extraction. Anal Biochem 162,156-9

Ciacci Zanella, J. R., and Jones, C. (1999) F umonisin B,, a mycotoxin contaminant of cereal
grains, and inducer of apoptosis via the tumour necrosis factor pathway and caspase
activation. F aad Chem T axicol 37,703-12

Cifone, M. G., De Maria, R., Roncaioli, P., Rippo, M. R., Azuma, M., Lanier, L. L., Santoni,
A., and Testi, R. (1994) Apoptotic signaling through CD95 (Fas/Apo-l) activates an acidic
sphingomyelinase. J Exp Med 180,1547-52.

Cobb, M. H., and Goldsmith, E. J. (1995) How MAP kinases are regulated. J Biol Chem
270, 14843- 6.

Cohen, S. M., and Ellwein, L. B. (1990) Cell proliferation in carcinogenesis [see comments].
Science 249,1007-1 l

Colvin, B. M., and Harrison, L. R. (1992) Fumonisin-induced pulmonary edema and
hydrothorax in swine. Mycapathologia 117,79-82

Conway, A. M., Pyne, N. J ., and Pyne, S. (1997) Sphingosine l-phosphate activation of MAP
kinase--involvement of P1 3-kinase and protein kinase C. Biochem Soc Trans 25,S585

Counts, R. S., Nowak, G., Wyatt, R. D., and Schnellmann, R. G. (1995) Nephrotoxicant
inhibition of renal proximal tubule cell regeneration. Am J Physiol 269,F274-8l.

Cowley, S., Paterson, H., Kemp, P., and Marshall, C. J. (1994) Activation of MAP kinase
kinase is necessary and sufﬁcient for PC 12 differentiation and for transformation of NIH 3T3
cells. Cell 77,841-52.

Cuvillier, O., Rosenthal, D. S., Smulson, M. E., and Spiegel, S. (1998) Sphingosine 1-
phosphate inhibits activation of caspases that cleave poly(ADP-ribose) polymerase and
larnins during Fas- and ceramide-mediated apoptosis in Jurkat T lymphocytes. J Biol Chem
273,2910-6

119

Cuvillier, O., Pirianov, G., Kleuser, B., Vanek, P. G., C080, 0. A., Gutkind, S., and Spiegel,
S. (1996) Suppression of ceramide-mediated programmed cell death by sphingosine-1-
phosphate. Nature 381 ,800-3.

Davaille, J., Gallois, C., Habib, A., Li, L., Mallat, A., Tao, J., Levade, T., and Lotersztajn,
S. (2000) Antiproliferative properties of sphingosine l-phosphate in human hepatic
myoﬁbroblasts. J Biol Chem 275, 34628-34633

Davis, B. H., Chen, A., and Beno, D. W. (1996) Raf and mitogen-activated protein kinase
regulate stellate cell collagen gene expression. J Biol Chem 271,11039-42.

Dawson, G., Goswami, R., Kilkus, J ., Wiesner, D., and Dawson, S. (1998) The formation
of ceramide from sphingomyelin is associated with cellular apoptosis. Acta Biochim Pol
45,287-97

Dbaibo, G. S., Wolff, R. A., Obeid, L. M., and Hannun, Y. A. (1995) Activation of a
retinoblastoma-protein-dependent pathway by sphingosine. Biochem J 310,453-9

De Jonghe, S., Van Overrneire, 1., Poulton, S., Hendrix, C ., Busson, R., Van Calenbergh, S.,
De Keukeleire, D., Spiegel, S., and Herdewijn, P. (1999) Structure-activity relationship of
short-chain sphingoid bases as inhibitors of sphingosine kinase. Bioorg Med Chem Lett
9,3175-80.

Dent, P., Haser, W., Haystead, T. A., Vincent, L. A., Roberts, T. M., and Sturgill, T. W.
(1992) Activation of mitogen-activated protein kinase kinase by v-Raf in NIH 3T3 cells and
in vitro. Science 257,1404-7.

Desai, N. N., Zhang, H., Olivera, A., Mattie, M. E., and Spiegel, S. (1992) Sphingosine-1-
phosphate, a metabolite of sphingosine, increases phosphatidic acid levels by phospholipase
D activation. J Biol Chem 267,23122-8

Desbarats, L., Schneider, A., Muller, D., Burgin, A., and Eilers, M. (1996) Myc: a single
gene controls both proliferation and apoptosis in mammalian cells. Experientia 52,1123-9

di Mari, J. E, Davis, R., and Saﬁrstein, R. L. (1999) MAPK activation determines renal
epithelial cell survival during oxidative injury. Am J Physiol 277,F195-203

Dobrowsky, R. T., and Hannun, Y. A. (1992) Ceramide stimulates a cytosolic protein
phosphatase. J Biol Chem 267,5048-51.

Donzelli, M., Bemardi, R., Negri, C., Prosperi, E., Padovan, L., Lavialle, C., Brison, O., and
Scovassi, A. I. (1999) Apoptosis-prone phenotype of human colon carcinoma cells with a
high level ampliﬁcation of the c-myc gene. Oncogene 18,439-48

Dowd, D. R., MacDonald, P. N., Komm, B. S., Haussler, M. R., and Miesfeld, R. (1991)
Evidence for early induction of calmodulin gene expression in lymphocytes undergoing

120

glucocorticoid-mediated apoptosis. J Biol Chem 266,18423-6.

Dudley, D. T., Pang, L., Decker, S. J., Bridges, A. J ., and Saltiel, A. R. (1995) A synthetic
inhibitor of the mitogen-activated protein kinase cascade. Proc Natl Acad Sci USA 92,7686-
9

Ealovega, M. W., McGinnis, P. K., Sumantran, V. N., Clarke, M. F., and Wicha, M. S.
(1996) bcl-x, gene therapy induces apoptosis of human mammary tumors in nude mice.
Cancer Res 56,1965-9

Edrington, T. S., Kamps-Holtzapple, C. A., Harvey, R. B., Kubena, L. F., Elissalde, M. H.,
and Rottinghaus, G. E. (1995) Acute hepatic and renal toxicity in lambs dosed with
fumonisin-containing culture material. J Anim Sci 73,508-15.

Edsall, L. C., Pirianov, G. G., and Spiegel, S. (1997) Involvement of sphingosine 1-
phosphate in nerve growth factor-mediated neuronal survival and differentiation. J Neurosci
17,6952-60

el Touny, S., Khan, W., and Hannun, Y. (1990) Regulation of platelet protein kinase C by
oleic acid. Kinetic analysis of allosteric regulation and effects on autophosphorylation,
phorbol ester binding, and susceptibility to inhibition. J Biol Chem 265,16437-43

Epstein, P. N., Christenson, M. A., and Means, A. R. (1989) Chicken calmodulin promoter
activity in proliferating and differentiated cells. Mol Endocrinol 3,193-202.

Evain, D., Klee, C., and Anderson, W. B. (1979) Chinese hamster ovary cell population
density affects intracellular concentrations of calcium-dependent regulator and ability of
regulator to inhibit adenylate cyclase activity. Prac Natl Acad Sci U S A 76,3962-6.

F raga, C. G., Shigenaga, M. K., Park, J. W., Degan, P., and Ames, B. N. (1990) Oxidative
damage to DNA during aging: 8-hydroxy-2'-deoxyguanosine in rat organ DNA and urine.
Prac Natl Acad Sci U S A 87,4533-7.

Futerman, A. H., and Pagano, R. E. (1991) Determination of the intracellular sites and
topology of glucosylceramide synthesis in rat liver. Biochem J 280,295-302.

Galderisi, U., Di Bernardo, G., Cipollaro, M., Peluso, G., Cascino, A., Cotrufo, R., and
Melone, M. A. (1999) Differentiation and apoptosis of neuroblastoma cells: role of N-myc
gene product. J Cell Biochem 73,97-105

Garcia Bermejo, L., Vilaboa, N. E., Perez, C., Galan, A., De Blas, E., and Aller, P. (1997)
Modulation of heat-shock protein 70 (HSP70) gene expression by sodium butyrate in U-937

promonocytic cells: relationships with differentiation and apoptosis. Exp Cell Res 236,268-
74

Gelderblom, W. C., Snyman, S. D., Abel, S., Lebepe-Mazur, S., Smuts, C. M., Van der

121

Westhuizen, L., Marasas, W. F., Victor, T. C., Knasmuller, S., and Huber, W. (1996a)
Hepatotoxicity and carcinogenicity of the fumonisins in rats. A review regarding mechanistic
implications for establishing risk in humans. Adv Exp Med Biol 392,279-96.

Gelderblom, W. C., Cawood, M. E., Snyman, S. D., Vleggaar, R., and Marasas, W. F. (1993)
Structure-activity relationships of fumonisins in short-terrn carcinogenesis and cytotoxicity
assays. F oad Chem Toxicol 31,407-14

Gelderblom, W. C., Kriek, N. P., Marasas, W. F., and Thiel, P. G. (1991) Toxicity and
carcinogenicity of the F usarium moniliforme metabolite, fumonisin B,, in rats.
Carcinogenesis 12,1247-5 1

Gelderblom, W. C., Snyman, S. D., Lebepe-Mazur, S., van der Westhuizen, L., Kriek, N. P.,
and Marasas, W. F. (1996b) The cancer-promoting potential of fumonisin B, in rat liver
using diethylnitrosamine as a cancer initiator. Cancer Lett 109,101-8.

Gelderblom, W. C., Jaskiewicz, K., Marasas, W. F., Thiel, P. G., Horak, R. M., Vleggaar,
R., and Kriek, N. P. (1988) Fumonisins--novel mycotoxins with cancer-promoting activity
produced by Fusarium moniliforme. Appl Environ Microbiol 54,1806-11.

Ghosh, T. K., Bian, J., and Gill, D. L. (1994) Sphingosine l-phosphate generated in the
endoplasmic reticulum membrane activates release of stored calcium. J Biol Chem
269,22628-35

Ghosh, T. K., Bian, J., and Gill, D. L. (1990) Intracellular calcium release mediated by
sphingosine derivatives generated in cells. Science 248,1653-6

Goetzl, E. J., and An, S. (1998) Diversity of cellular receptors and functions for the
lysophospholipid growth factors lysophosphatidic acid and sphingosine l-phosphate. FASEB
J 12,1589-98

Graff, J. R., Konicek, B. W., McNulty, A. M., Wang, Z., Houck, K., Allen, S., Paul, J. D.,
Hbaiu, A., Goode, R. G., Sandusky, G. E., Vessella, R. L., and Neubauer, B. L. (2000)
Increased AKT activity contributes to prostate cancer progression by dramatically
accelerating prostate tumor growth and diminishing p27Kip1 expression. J Biol Chem
275,24500-5.

Grassilli, E., Carcereri de Prati, A., Monti, D., Troiano, L., Menegazzi, M., Barbieri, D.,
Franceschi, C ., and Suzuki, H. (1992) Studies of the relationship between cell proliferation
and cell death. 11. Early gene expression during concanavalin A-induced proliferation or
dexamethasone-induced apoptosis of rat thymocytes. Biochem Biophys Res Commun
188,1261-6

Groves, F. D., Zhang, L., Chang, Y. S., Ross, P. F., Casper, H., Norred, W. P., You, W. C.,
and Fraumeni, J. F. (1999) F usarium mycotoxins in corn and corn products in a high-risk
area for gastric cancer in Shandong Province, China. J AOAC Int 82,657-62.

122

Gumprecht, L. A., Marcucci, A., Weigel, R. M., Vesonder, R. F ., Riley, R. T., Showker, J.
L., Beasley, V. R., and Haschek, W. M. (1995) Effects of intravenous fumonisin B, in
rabbits: nephrotoxicity and sphingolipid alterations. Nat Toxins 3,3 95-403

Gutema, T., Munimbazi, C., and Bullerrnan, L. B. (2000) Occurrence of fumonisins and
moniliforrnin in corn and com-based food products of US. origin. J Food Prat 63,1 732-7.

Haimovitz-Friedman, A., Kan, C. C., Ehleiter, D., Persaud, R. S., McLoughlin, M., Fuks, Z.,
and Kolesnick, R. N. (1994) Ionizing radiation acts on cellular membranes to generate
ceramide and initiate apoptosis. J Exp Med 180,525-35.

Hakomori, S., and Igarashi, Y. (1993) Gangliosides and glycosphingolipids as modulators
of cell growth, adhesion, and transmembrane signaling. Adv Lipid Res 25,147-62.

Hakomori, S. (1981) Glycosphingolipids in cellular interaction, differentiation, and
oncogenesis. Annu Rev Biochem 50,733-64.

Hanada, K., Nishijima, M., Kiso, M., Hasegawa, A., Fujita, S., Ogawa, T., and Akamatsu,
Y. (1992) Sphingolipids are essential for the growth of Chinese hamster ovary cells.
Restoration of the growth of a mutant defective in sphingoid base biosynthesis by exogenous
sphingolipids. J Biol Chem 267,23527-33

Hannun, Y. A. (1994) The sphingomyelin cycle and the second messenger function of
ceramide. J Biol Chem 269,3125-8

Hannun, Y. A., and Bell, R. M. (1989) Regulation of protein kinase C by sphingosine and
lysosphingolipids. Clin Chim Acta 185,333-45

Hannun, Y. A., and Bell, R. M. (1986) Phorbol ester binding and activation of protein kinase
C on triton X-100 mixed micelles containing phosphatidylserine. J Biol Chem 261,9341-7.

Hannun, Y. A., and Bell, R. M. (1987) Mechanism of activation of protein kinase C: role of
diacylglycerol and calcium second messengers. Sac Gen Physiol Ser 42,229-40

Hannun, Y. A., and Obeid, L. M. (1995) Ceramide: an intracellular signal for apOptosis.
Trends Biochem Sci 20,73-7

Hannun, Y. A., Loomis, C. R., Merrill, A. H., Jr., and Bell, R. M. (1986) Sphingosine
inhibition of protein kinase C activity and of phorbol dibutyrate binding in vitro and in
human platelets. J Biol Chem 261,12604-9

Hannun, Y. A., Merrill, A. H., Jr., and Bell, R. M. (1991) Use of sphingosine as inhibitor of
protein kinase C. Methods Enzymal 201,316-28.

Harel, R., and Futerman, A. H. (1993) Inhibition of sphingolipid synthesis affects axonal

123

outgrowth in cultured hippocampal neurons. J Biol Chem 268,14476-81

Harrison, L. R., Colvin, B. M., Greene, J. T., Newman, L. E., and Cole, J. R. (1990)
Pulmonary edema and hydrothorax in swine produced by fumonisin B,, a toxic metabolite
of Fusarium moniliforme. J Vet Diagn Invest 2,217-21.

Haschek, W. M., Motelin, G., Ness, D. K., Harlin, K. S., Hall, W. F ., Vesonder, R. F .,
Peterson, R. E., and Beasley, V. R. (1992) Characterization of fumonisin toxicity in orally
and intravenously dosed swine. Mycopathologia 117,83-96

Heist, E. K., and Schulman, H. (1998) The role of Ca 2+/calmodulin-dependent protein
kinases within the nucleus. Cell Calcium 23,103-14.

Hill, C. S., Marais, R., John, S., Wynne, J ., Dalton, S., and Treisman, R. (1993) Functional
analysis of a growth factor-responsive transcription factor complex. Cell 73,395-406.

Himpens, B., De Smedt, H., and Casteels, R. (1994) Relationship between [Ca2+] changes
in nucleus and cytosol. Cell Calcium 16,239-46.

Hla, T. (2001) Sphingosine l-phosphate receptors. Prastaglandins Other Lipid Mediat
64,135-42.

Ho, A. K., Peng, R., Ho, A. A., Dufﬁeld, R., and Dombrink-Kurtzrnan, M. A. (1996)
Interactions of fumonisins and sphingoid bases with GTP-binding proteins. Biochem Arch
12, 249-260.

Howard, P. C., Eppley, R. M., Stack, M. E., Warbritton, A., Voss, K. A., Lorentzen, R. J.,
Kovach, R. M., and Bucci, T. J. (2001) Fumonisin B, carcinogenicity in a two-year feeding
study using F344 rats and b6c3f1 mice. Environ Health Perspect 109,277-82.

Howe, L. R., Leevers, S. J ., Gomez, N., Nakielny, S., Cohen, R, and Marshall, C. J. (1992)
Activation of the MAP kinase pathway by the protein kinase raf. Cell 71,335-42.

Huang, C., Dickman, M., Henderson, G., and Jones, C. (1995) Repression of protein kinase
C and stimulation of cyclic AMP response elements by fumonisin, a fungal encoded toxin
which is a carcinogen. Cancer Res 55,1655-9.

Hunter, T. (1995) Protein kinases and phosphatases: the yin and yang of protein
phosphorylation and signaling. Cell 80,225-36.

Igarashi, Y., Kitamura, K., Toyokuni, T., Dean, 3., F enderson, B., Ogawass, T., and
Hakomori, S. (1990) A speciﬁc enhancing effect of N,N-dimethylsphingosine on epidermal
growth factor receptor autophosphorylation. Demonstration of its endogenous occurrence
(and the virtual absence of unsubstituted sphingosine) in human epiderrnoid carcinoma A43 1
cells. J Biol Chem 265,53 85-9.

124

Ishizuka, S., Yano, T., Hagiwara, K., Sone, M., Nihei, H., Ozasa, H., and Horikawa, S.
(1999) Extracellular signal-regulated kinase mediates renal regeneration in rats with
myoglobinuric acute renal injury. Biochem Biophys Res Commun 254,88-92

Jarvis, W. D., Fomari, F. A., Jr., Auer, K. L., Freemerrnan, A. J., Szabo, E., Birrer, M. J., _
Johnson, C. R., Barbour, S. 13., Dent, P., and Grant, S. (1997) Coordinate regulation of stress-
and mitogen-activated protein kinases in the apoptotic actions ofceramide and sphingosine.
Mol Pharmacol 52,93 5-47.

Jarvis, W. D., Fomari, F. A., Traylor, R. S., Martin, H. A., Kramer, L. B., Erukulla, R. K.,
Bittman, R., and Grant, S. (1996) Induction of apoptosis and potentiation of ceramide-
mediated cytotoxicity by sphingoid bases in human myeloid leukemia cells. J Biol Chem
271,8275-84

Karlsson, K. A. (1970) On the chemistry and occurrence of sphingolipid long-chain bases.
Chem Phys Lipids 5,6-43.

Kawai, T., Nomura, F., Hoshino, K., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., and
Akira, S. (1999) Death-associated protein kinase 2 is a new calcium/calmodulin-dependent
protein kinase that signals apoptosis through its catalytic activity. Oncogene 18,3471-80.

Kellerman, T. S., Marasas, W. F., Thiel, P. G., Gelderblom, W. C., Cawood, M., and
Coetzer, J. A. (1990) Leukoencephalomalacia in two horses induced by oral dosing of
fumonisin B1. Onderstepaart J Vet Res 57,269-75.

Kennedy, S. G., Wagner, A. J ., Conzen, S. D., Jordan, J ., Bellacosa, A., Tsichlis, P. N., and
Hay, N. (1997) The PI 3-kinase/Akt signaling pathway delivers an anti-apoptotic signal.
Genes Dev 11,701-13.

Khwaja, A., Rodriguez-Viciana, P., Wennstrom, S., Wame, P. H., and Downward, J. (1997)
Matrix adhesion and Ras transformation both activate a phosphoinositide 3-OH kinase and
protein kinase B/Akt cellular survival pathway. EMBO J 16,2783-93.

Kihara Negishi, F ., Yamada, T., Kubota, Y., Kondoh, N., Yamamoto, H., Abe, M., Shirai,
T., Hashimoto, Y., and Oikawa, T. (1998) Down-regulation of c-myc and bcl-2 gene
expression in PU. 1 -induced apoptosis in murine erythroleukemia cells. lntJ Cancer 76,523-
30

Kim, M. Y., Linardic, C., Obeid, L., and Hannun, Y. (1991) Identiﬁcation of sphingomyelin
turnover as an effector mechanism for the action of tumor necrosis factor alpha and gamma-
interferon. Speciﬁc role in cell differentiation. J Biol Chem 266,484-9

Kim, M. S., Lee, D. Y., Wang, T., and Schroeder, J. J. (2001) Fumonisin B, induces

apoptosis in LLC-PK, renal epithelial cells via a sphinganine- and calmodulin-dependent
pathway. Toxicol Appl Pharmacol 176,118-26.

125

Kim, M. S., and Schroeder, J. J. (2002) Sphinganine l-phosphate mediates calmodulin
expression induced by fumonisin B, in LLC-PK, porcine renal tubular epithelial cells. (In
preparation)

Kinane, T. B., Kang, 1., Chu, A., Chin, S. H., and Ercolani, L. (1997) G alpha(i-Z) mediates
renal LLC-PK, growth by a Raf-independent activation of p42/p44 MAP kinase. Am J
Physiol 272,F273-82.

Kluck, R. M., Bossy-Wetzel, E., Green, D. R., and Newrneyer, D. D. (1997) The release of
cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis. Science
275,1132-6.

Kolesnick, R., and Golde, D. W. (1994) The sphingomyelin pathway in tumor necrosis factor
and interleukin-1 signaling. Cell 77,325-8.

Kondo, S., Yin, D., Aoki, T., Takahashi, J. A., Morimura, T., and Takeuchi, J. (1994) bcl-2
gene prevents apoptosis of basic ﬁbroblast growth factor-deprived murine aortic endothelial
cells. Exp Cell Res 213,428-32

Krasilnikov, M. A. (2000) Phosphatidylinositol-3 kinase dependent pathways: the role in
control of cell growth, survival, and malignant transformation. Biochemistry (Mosc) 65,59-
67. '

Kulik, G., Klippel, A., and Weber, M. J. (1997) Antiapoptotic signalling by the insulin-like
growth factor I receptor, phosphatidylinositol 3-kinase, and Akt. Mol Cell Biol 17,1 595-606.

Kwon, O. S., Schmued, L. C., and Slikker, W. (1997) Fumonisin B, in developing rats alters
brain sphinganine levels and myelination. Neurotaxicology 18,571-79.

Kyriakis, J. M., App, H., Zhang, X. F ., Banerjee, P., Brautigan, D. L., Rapp, U. R., and
Avruch, J. (1992) Raf-1 activates MAP kinase-kinase. Nature 358,417-21.

Laine, R. A., and Hakomori, S. (1973) Incorporation of exogenous glycosphingolipids in
plasma membranes of cultured hamster cells and concurrent change of growth behavior.
Biochem Biophys Res Commun 54,1039-45.

Lange-Carter, C. A., Pleiman, C. M., Gardner, A. M., Blumer, K. J., and Johnson, G. L.
(1993) A divergence in the MAP kinase regulatory network deﬁned by MEK kinase and Raf.
Science 260,315-9.

Lavoie, J. N., Rivard, N., L'Allemain, G., and Pouyssegur, J. (1996) A temporal and
biochemical link between growth factor-activated MAP kinases, cyclin D1 induction and cell

cycle entry. Prog Cell Cycle Res 2,49-58.

Lim, C. W., Parker, H. M., Vesonder, R. F., and Haschek, W. M. (1996) Intravenous

126

fumonisin B, induces cell proliferation and apoptosis in the rat. Nat Toxins 4,34-41.

Liu, G. X., Sheng, H. F., and Wu, S. (1996) A study on the levels of calmodulin and DNA
in human lung cancer cells. Br J Cancer 73,899-901.

Machwate, M., Rodan, S. B., Rodan, G. A., and Harada, S. I. (1998) Sphingosine kinase
mediates cyclic AMP suppression of apoptosis in rat periosteal cells. Mol Pharmacol 54,70-7

Marasas, W. F. O., Kellerman, T. S., Gelderblom, W. C. A., Coetzer, J. A. W., Thiel, P. G.,
and Van Der Lugt, J. J. (1988a) Leukoencephalomalacia in a horse induced by fumonisin B,
isolated from F usarium moniliforme. Onderstepaart J Vet Res 55, 197-203.

Marasas, W. F. (1996) F umonisins: history, world-wide occurrence and impact. Adv Exp
Med Biol 392,1 -1 7.

Marasas, W. F., Jaskiewicz, K., Venter, F. S., and Van Schalkwyk, D. J. (1988b) F usarium
moniliforme contamination of maize in oesophageal cancer areas in Transkei. S A )9 Med J
74,110-4

Marasas, W. F., Kriek, N. P., F incham, J. E., and van Rensburg, S. J. (1984) Primary liver
cancer and oesophageal basal cell hyperplasia in rats caused by F usarium moniliforme. Int
J Cancer 34,3 83-7

Marshall, C. J. (1995) Speciﬁcity of receptor tyrosine kinase signaling: transient versus
sustained extracellular signal-regulated kinase activation. Cell 80,179-85.

Martinova, E. A., and Merrill, A. H., Jr. (1995) Fumonisin B, alters sphingolipid metabolism
and immune function in BALB/c mice: immunological responses to fumonisin B,.
Mycopathologia 130,1 63-70.

Mattie, M., Brooker, G., and Spiegel, S. (1994) Sphingosine- 1 -phosphate, a putative second
messenger, mobilizes calcium from internal stores via an inositol trisphosphate-independent
pathway. J Biol Chem 269,3181-8

McConkey, D. J., Nicotera, P., Hartzell, P., Bellomo, G., Wyllie, A. H., and Orrenius, S.
(1989) Glucocorticoids activate a suicide process in thymocytes through an elevation of
cytosolic Ca 2‘ concentration. Arch Biochem Biophys 269,365-70.

Meivar Levy, 1., and Futerman, A. H. (1999) Up-regulation of neutral glycosphingolipid
synthesis upon long term inhibition of ceramide synthesis by ﬁlmonisin B,. J Biol Chem
274,4607-12

Meivar Levy, 1., Sabanay, H., Bershadsky, A. D., and Futerman, A. H. (1997) The role of

sphingolipids in the maintenance of ﬁbroblast morphology. The inhibition of protrusional
activity, cell spreading, and cytokinesis induced by fumonisin B, can be reversed by

127

ganglioside GM3. J Biol Chem 272,1558-64

Merrill, A. H., Jr., Wang, E., Mullins, R. E., Jamison, W. C., Nimkar, S., and Liotta, D. C.
(1988) Quantitation of free sphingosine in liver by hi gh-performance liquid chromatography.
Anal Biochem 171,373-81

Merrill, A. H., Jr., Schmeiz, E. M., Dillehay, D. L., Spiegel, S., Shayaman, J. A., Schroeder,
J. J., Riley, R. T. Voss, K. A., and Wang, E. (1997a) Sphingolipids--the enigmatic lipid
class: biochemistry, physiology, and pathophysiology. T axtcol appl pharmacal. Orlando,
Fla” Academic Press Inc. Jan 208- 225

Menill, A. H., Jr., Schmelz, E. M., Wang, E., Dillehay, D. L., Rice, L. G., Meredith, F., and
Riley, R. T. (1997b) Importance of sphingolipids and inhibitors of sphingolipid metabolism
as components of animal diets. J Nutr 127,830s

Merrill, A. H., Jr., Nimkar, S., Menaldino, D., Hannun, Y. A., Loomis, C., Bell, R. M.,
Tyagi, S. R., Lambeth, J. D., Stevens, V. L., Hunter, R., and et al. ( 1989) Structural
requirements for long-chain (sphingoid) base inhibition of protein kinase C in vitro and for
the cellular effects of these compounds. Biochemistry 28,3138-45

Merrill, A. H., Jr., van Echten, G., Wang, E., and Sandhoff, K. (1993a) Fumonisin B, inhibits
sphingosine (sphinganine) N-acyltransferase and de nova sphingolipid biosynthesis in
cultured neurons in situ. J Biol Chem 268,27299-306.

Merrill, A. H., Jr., and Wang, E. (1986) Biosynthesis of long-chain (sphingoid) bases from
serine by LM cells. Evidence for introduction of the 4-trans-double bond after de novo
biosynthesis of N-acylsphinganine(s). J Biol Chem 261,3764-9.

Menill, A. H., Jr., Hannun, Y. A., and Bell, R. M. (1993b) Introduction: sphingolipids and
their metabolites in cell regulation. Adv Lipid Res 25,1 -24.

Merrill, A. H., Jr., Sereni, A. M., Stevens, V. L., Hannun, Y. A., Bell, R. M., and Kinkade,
J. M., Jr. (1986) Inhibition of phorbol ester-dependent differentiation of human
promyelocytic leukemic (HL-60) cells by sphinganine and other long-chain bases. J Biol
Chem 261,12610-5

Merrill, A. H., Jr., and Wang, E. (1992) Enzymes of ceramide biosynthesis. Methods
Enzymal 209,427-3 7.

Merrill, A. H., Jr., Wang, E., Vales, T. R., Smith, E. R., Schroeder, J. J ., Menaldino, D. 8.,
Alexander, C., Crane, H. M., Xia, J ., Liotta, D. C., Meredith, F. 1., and Riley, R. T. (1996)
F umonisin toxicity and sphingolipid biosynthesis. Adv Exp Med Biol 392,297-306

Micoli, K. J., Pan, G., Wu, Y., Williams, J. P., Cook, W. J., and McDonald, J. M. (2000)
Requirement of calmodulin binding by HIV-1 gp160 for enhanced F AS-mediated apoptosis.
J Biol Chem 275,123 3-40

128

Miller-Podraza, H., Bradley, R. M., and F ishman, P. H. (1982) Biosynthesis and localization
of gangliosides in cultured cells. Biochemistry 21,3260-5.

Morgan, M. K., Schroeder, J. J., Rottinghaus, G. E., Powell, D. C., Bursian, S. J., and
Aulerich, R. J. (1997) Dietary fumonisins disrupt sphingolipid metabolism in mink and
increase the free sphinganine to sphingosine ratio in urine but not in hair. Vet Hum Toxicol
39,334-6

Motelin, G. K., Haschek, W. M., Ness, D. K., Hall, W. F., Harlin, K. S., Schaeffer, D. J ., and
Beasley, V. R. (1994) Temporal and dose-response features in swine fed corn screenings
contaminated with fumonisin mycotoxins. Mycopathologia 126,27-40

Nikolova—Karakashian, M., Morgan, E. T., Alexander, C., Liotta, D. C., and Merrill, A. H.,
Jr. (1997) Bimodal regulation of ceramidase by interleukin-1 beta. Implications for the
regulation of cytochrome p450 2C1 1. J Biol Chem 272,18718-24.

Nilsson, A. (1969) The presence of spingomyelin- and ceramide-cleaving enzymes in the
small intestinal tract. Biochim Biophys Acta 176,339-47.

Nishida, E., and Gotoh, Y. (1993) The MAP kinase cascade is essential for diverse signal
transduction pathways. Trends Biochem Sci 18,128-31.

Norred, W. P., Plattner, R. D., Vesonder, R. F., Bacon, C. W., and Voss, K. A. (1992) Effects
of selected secondary metabolites of Fusarium moniliforme on unscheduled synthesis of
DNA by rat primary hepatocytes. Food Chem Toxicol 30,233-7

Norred, W. P., Plattner, R. D., and Chamberlain, W. J. (1993) Distribution and excretion of
[14C] fumonisin B1 in male Sprague-Dawley rats. Nat toxins. New York, NY: Wiley Liss,
Inc 341-346

Norred, W. P., Plattner, R. D., Vesonder, R. F., Bacon, C. W., and Voss, K. A. (1992) Effects
of selected secondary metabolites of Fusarium moniliforme on unscheduled synthesis of
DNA by rat primary hepatocytes. F aod Chem Toxicol 30,233-7.

Obeid, L. M., Linardic, C. M., Karolak, L. A., and Hannun, Y. A. (1993) Programmed cell
death induced by ceramide. Science 259,1769-71

Ohnishi, M., and Fujino, Y. (1982) Sphingolipids in immature and mature soybeans. Lipids
17, 803-810

Ohta, H., Sweeney, E. A., Masamune, A., Yatomi, Y., Hakomori, S., and Igarashi, Y. (1995)
Induction of apoptosis by sphingosine in human leukemic HL-60 cells: a possible
endogenous modulator of apoptotic DNA fragmentation occurring during phorbol ester-
induced differentiation. Cancer Res 55, 691-7

Ohta, H., Yatomi, Y., Sweeney, E. A., Hakomori, S., and Igarashi, Y. (1994) A possible role

129

of sphingosine in induction of apoptosis by tumor necrosis factor-alpha in human
neutrophils. F EBS Lett 355,267-70.

Oishi, K., Raynor, R. L., Charp, P. A., and Kuo, J. F. (1988) Regulation of protein kinase C
by lysophospholipids. Potential role in signal transduction. J Biol Chem 263,6865-71.

Okazaki, T., Bielawska, A., Bell, R. M., and Hannun, Y. A. (1990) Role of ceramide as a
lipid mediator of 1 alpha,25-dihydroxyvitamin D3-induced HL-60 cell differentiation. J Biol
Chem 265,15823-31

Okazaki, T., Bell, R. M., and Hannun, Y. A. (1989) Sphingomyelin turnover induced by
vitamin D3 in HL-60 cells. Role in cell differentiation. J Biol Chem 264,19076-80

Olivera, A., Edsall, L., Poulton, S., Kazlauskas, A., and Spiegel, S. (1999a) Platelet-derived
growth factor-induced activation of sphingosine kinase requires phosphorylation of the
PDGF receptor tyrosine residue responsible for binding of PLCgamma. FASEB J 13,1593-
600

Olivera, A., Kohama, T., Edsall, L., Nava, V., Cuvillier, O., Poulton, S., and Spiegel, S.
(1999b) Sphingosine kinase expression increases intracellular sphingosine- 1 -phosphate and
promotes cell growth and survival. J Cell Biol 147,545-58

Olivera, A., Zhang, H., Carlson, R. O., Mattie, M. E., Schmidt, R. R., and Spiegel, S. (1994)
Stereospeciﬁcity of sphingosine-induced intracellular calcium mobilization and cellular
proliferation. J Biol Chem 269,17924-30

Olivera, A., and Spiegel, S. (1993) Sphingosine-l-phosphate as second messenger in cell
proliferation induced by PDGF and FCS mitogens. Nature 365,557-60

Osawa M, Swindells MB, Tanikawa 1, Tanaka T, Mase T, Furuya T, Ikura M (1998)
Solution structure of calmodulin-W-7 complex: the basis of diversity in molecular
recognition. J. Mol. Biol. 276, 165-76

Osweiler, G. D., Ross, P. F., Wilson, T. M., Nelson, P. E., Witte, S. T., Carson, T. L., Rice,
L. G., and Nelson, H. A. (1992) Characterization of an epizootic of pulmonary edema in
swine associated with fumonisin in corn screenings. J Vet Diagn Invest 4,53-9.

Pan, G., Zhou, T., Radding, W., Saag, M. S., Mountz, J. D., and McDonald, J. M. (1998)
Calmodulin antagonists inhibit apoptosis of CD4+ T-cells from patients with AIDS.
Immunopharmacology 40,91 -1 03.

Pan, X., Solomon, S. S., Shah, R. J ., Palazzolo, M. R., and Raghow, R. S. (2000) Members
of the Sp transcription factor family regulate rat calmodulin gene expression. J Lab C [in Med
136,157-63.

130

i‘eL-um .ﬁ
1‘. A

I
1‘

 

Pelech, S. L., Charest, D. L., Mordret, G. P., Siow, Y. L., Palaty, C., Campbell, D., Charlton,
L., Samiei, M., and Sanghera, J. S. (1993) Networking with mitogen-activated protein
kinases. Mol Cell Biochem 127-128,157-69.

Pinelli, E., Poux, N., Garren, L., Pipy, B., Castegnaro, M., Miller, D. J., and Pfohl-
Leszkowicz, A. (1999) Activation of mitogen-activated protein kinase by fumonisin B,
stimulates cPLA2 phosphorylation, the arachidonic acid cascade and cAMP production.
Carcinogenesis 20,1683-8.

Pinton, P., Ferrari, D., Rapizzi, E., Di Virgilio, F. D., Pozzan, T., and Rizzuto, R. (2001) The
Ca 2* concentration of the endoplasmic reticulum is a key determinant of ceramide-induced
apoptosis: signiﬁcance for the molecular mechanism of Bcl-2 action. Embo J 20,2690-701.

Plattner, R. D., Ross, P. F ., Reagor, J ., Stedelin, J ., and Rice, L. G. (1991) Analysis of corn
and cultured corn for fumonisin B, by HPLC and GC/MS by four laboratories. J Vet Diagn
Invest 3,357-8

Prelusky, D. B., Miller, J. D., and Trenholm, H. L. (1996) Disposition of 14C-derived
residues in tissues of pigs fed radiolabeled fumonisin B,. Food Addit Contam 13,155-62

Prelusky, D. B,, Trenholm, H. L., and Savard, M. E. (1994) Pharmacokinetic fate of 14C-
labelled fumonisin B, in swine. Nat T axins 2,73-80

Preston Martin, 8., Pike, M. C., Ross, R. K., Jones, P. A., and Henderson, B. E. (1990)
Increased cell division as a cause of human cancer. Cancer Res 50,7415-21

Pushkareva, M., Chao, R., Bielawska, A., Merrill, A. H., Crane, H. M., Lagu, B., Liotta, D.,
and Hannun, Y. A. (1995) Stereoselectivity of induction of the retinoblastoma gene product
(pr) dephosphorylation by D-erythro-sphingosine supports a role for pr in growth
suppression by sphingosine. Biochemistry 34,1885-92.

Putzer, B. M., Stiewe, T., Parssanedjad, K., Rega, S., and Esche, H. (2000)E1A is sufﬁcient
by itself to induce apoptosis independent of p53 and other adenoviral gene products. Cell
Death Differ 7,177-88

Raeder, E. M., Mansﬁeld, P. J., Hinkovska-Galcheva, V., Kjeldsen, L., Shayman, J. A., and
Boxer, L. A. (1999) Sphingosine blocks human polymorphonuclear leukocyte phagocytosis
through inhibition of mitogen-activated protein kinase activation. Blood 93,686-93.

Raines, M. A., Kolesnick, R. N., and Golde, D. W. (1993) Sphingomyelinase and ceramide
activate mitogen-activated protein kinase in myeloid HL-60 cells. J Biol Chem 268,145 72-5

Ramljak, D., Calvert, R. J ., Wiesenfeld, P. W., Diwan, B. A., Catipovic, B., Marasas, W. F .,
Victor, T. C., Anderson, L. M., and Gelderblom, W. C. (2000) A potential mechanism for
fumonisin Bl-mediated hepatocarcinogenesis: cyclin D1 stabilization associated with
activation of Akt and inhibition of GSK-3beta activity. Carcinogenesis 21,1537-46

131

Rasmussen, C. D., Lu, K. P., Means, R. L., and Means, A. R. (1992) Calmodulin and cell
cycle control. J Physiol Paris 86,83-8.

Rasmussen, C. D., and Means, A. R. (1989) Calmodulin, cell growth and gene expression.
Trends Neurosci 12,433-8.

Rasmussen, C. D., and Means, A. R. (1987) Calmodulin is involved in regulation of cell
proliferation. Embo J 6,3961 -8.

Restum, J. C., Bursian, S. J., Millerick, M., Render, J. A., Merrill, A. H., Wang, E.,
Rottinghaus, G. E., and Aulerich, R. J. (1995) Chronic toxicity of fumonisins from F usarium
moniliforme culture material (M-l325) to mink. Arch Environ Contam T oxicol 29,545-50.

Riley, R. T., Hinton, D. M., Chamberlain, W. J ., Bacon, C. W., Wang, E., Merrill, A. H., Jr.,
and Voss, K. A. (1994) Dietary fumonisin B, induces disruption of sphingolipid metabolism
in Sprague-Dawley rats: a new mechanism of nephrotoxicity. J Nutr 124,594-603

Riley, R. T., An, N. H., Showker, J. L., Yoo, H. S., Norred, W. P., Chamberlain, W. J.,
Wang, E., Menill, A. H., Motelin, G., Beasley, V. R., and et al. (1993a) Alteration of tissue
and serum sphinganine to sphingosine ratio: an early biomarker of exposure to fumonisin-
containing feeds in pigs. T axical Appl Pharmacol 118,105-12.

Riley, R. T., Norred, W. P., and Bacon, C. W. (1993b) Fungal toxins in foods: recent
concerns. Annu Rev Nutr 13,167-89

Riley, R. T., Voss, K. A., Norred, W. P., Bacon, C. W., Meredith, F. 1., and Shanna, RP.
(1999) Serine palmitoyltransferase inhibition reverses anti-proliferative effects of ceramide
synthase inhibition in cultured renal cells and suppresses free sphingoid base accumulation
in kidney of BALBc mice. Environ T axical Pharmacol 7,109-118

Riley, R. T., Voss, K. A., Yoo, H. S., Gelderblom, W. C. A., and Merrill, A. H., Jr. (1994b)
Mechanism of fumonisin toxicity and carcinogenesis. J food prot. Des Moines, Iowa .'
International Association of Milk, Food and Environmental Sanitarians. July 63 8-645

Rose, E. F. (1981) A review of factors associated with cancer of the esophagus in Transkei.
Prog Clin Biol Res 53,67-75.

Rosenthal, D. S., Simbulan Rosenthal, C. M., Iyer, S., Spoonde, A., Smith, W., Ray, R., and
Smulson, M. E. (1998) Sulfur mustard induces markers of terminal differentiation and
apoptosis in keratinocytes via a Cay-calmodulin and caspase-dependent pathway. J Invest
Dermatol 1 1 1 ,64-7 1

Ross, P. F ., Rice, L. G., Osweiler, G. D., Nelson, P. E., Richard, J. L., and Wilson, T. M.

(1992) A review and update of animal toxicoses associated with fumonisin-contaminated
feeds and production of fumonisins by Fusarium isolates. Mycopathologia 117,109-14

132

 

Ross, P. F., Rice, L. G., Plattner, R. D., Osweiler, G. D., Wilson, T. M., Owens, D. L.,
Nelson, H. A., and Richard, J. L. (1991) Concentrations of fumonisin B, in feeds associated
with animal health problems. Mycopathologia 114,129-35

Rother, J., van Echten, G., Schwarzrnann, G., and Sandhoff, K. (1992) Biosynthesis of
sphingolipids: dihydroceramide and not sphinganine is desaturated by cultured cells.
Biochem Biophys Res Commun 189,14-20.

Saba, J. D., Obeid, L. M., and Hannun, Y. A. (1996) Ceramide: an intracellular mediator of
apoptosis and growth suppression. Philos Trans R Soc Land B Biol Sci 351,233-40

Saito, M., Terui, Y., and Nojiri, H. (1985) An acidic glycosphingolipid, monosialo-
ganglioside GM3, is a potent physiological inducer for monocytic differentiation of human
promyelocytic leukemia cell line HL-60 cells. Biochem Biophys Res Commun 132,223-31.

Sakakura, C., Sweeney, E. A., Shirahama, T., Hakomori, S., and Igarashi, Y. (1996)
Suppression of bcl-2 gene expression by sphingosine in the apoptosis of human leukemic
HL-60 cells during phorbol ester-induced terminal differentiation. F EBS Lett 379,177-80

Sakakura, C., Sweeney, E. A., Shirahama, T., Hagiwara, A., Yamaguchi, T., Takahashi, T.,
Hakomori, S., and Igarashi, Y. (1998) Selectivity of sphingosine-induced apoptosis. Lack of
activity of DL-erythyro-dihydrosphingosine. Biochem Biophys Res C ommun 246,827-30

Schmelz, E. M., Crall, K. J., Larocque, R., Dillehay, D. L., and Merrill, A. H., Jr. (1994)
Uptake and metabolism of sphingolipids in isolated intestinal loops of mice. J Nutr 124,702-
12.

Schrarnek, H., Feifel, E., Healy, E., and Pollack, V. (1997) Constitutively active mutant of
the mitogen-activated protein kinase kinase MEKl induces epithelial dedifferentiation and
growth inhibition in madin-darby canine kidney-C7 cells. J Biol Chem 272,11426-33.

Schroeder, J. J., Crane, H. M., Xia, J., Liotta, D. C., and Merrill, A. H. (1994) Disruption of
sphingolipid metabolism and stimulation of DNA synthesis by fumonisin B,. A molecular
mechanism for carcinogenesis associated with Fusarium moniliforme. J Biol Chem
269,3475-81.

Schroeder, J. J., and Cousins, R. J. (1990) Interleukin 6 regulates metallothionein gene
expression and zinc metabolism in hepatocyte monolayer cultures. Proc Natl Acad Sci U S
A 87,3137-41

Schubert, K. M., Scheid, M. P., and Duronio, V. (2000) Ceramide inhibits protein kinase
B/Akt by promoting dephosphorylation of serine 473. J Biol Chem 275,13330-5.

Schwarz, A., Rapaport, E., Hirschberg, K., and F uterrnan, A. H. (1995) A regulatory role for
sphingolipids in neuronal growth. Inhibition of sphingolipid synthesis and degradation have
opposite effects on axonal branching. J Biol Chem 270,10990-8

133

 

 

Sellins, KS, and Cohen, J .J . (1995) Nuclear changes in the cytotoxic T lymphocyte-induced
model of apoptosis. Immunol. Rev. 146, 241-66

Shelby, R. A., White, D. G., and Bauske, E. M. (1994) Differential fumonisin production in
maize hybrids. Plant dis. [St Paul, Minn, American Phytopathological Society]. June 582-
584

Shephard, G. S., Thiel, P. G., Sydenham, E. W., and Savard, M. E. (1995) Fate of a single
dose of l‘lC-labelled fumonisin B, in vervet monkeys. Nat Toxins 3,145-50

Shephard, G. S., Van Der Westhuizen, L., Thiel, P. G., Gelderblom, W. C. A., Marasas, W.
F. O., and Van Schalkwyk, D. J. (1996) Disruption of sphingolipid metabolism in non-
human primates consuming diets of fumonisin-containing Fusarium moniliforme culture
material. Toxicon. Oxford: Elsevier Science Ltd. May 527-534

Shephard, G. S., Thiel, P. G., Sydenham, E. W., Vleggaar, R., and Alberts, J. F. (1994c)
Determination of the mycotoxin fumonisin B, and identiﬁcation of its partially hydrolysed
metabolites in the faeces of non-human primates. Food Chem Toxicol 32,23-9

Shephard, G. S., Thiel, P. G., Sydenham, E. W., Alberts, J. F., and Cawood, M. E. (1994b)
Distribution and excretion of a single dose of the mycotoxin fumonisin B, in a non-human
primate. T axican 32,73 5-41

Shephard, G. S., Thiel, P. G., Sydenham, E. W., and Alberts, J. F. (1994a) Biliary excretion
of the mycotoxin fumonisin B, in rats. F oad Chem Toxicol 32,489-91

Shirahama, T., Sakakura, C., Sweeney, E. A., Ozawa, M., Takemoto, M., Nishiyama, K.,
Ohi, Y., and Igarashi, Y. (1997) Sphingosine induces apoptosis in androgen-independent
human prostatic carcinoma DU-l45 cells by suppression of bcl-X, gene expression. FEBS
Lett 407,97-100

Singer, A. L., Sherwin, R. P., Dunn, A. S., and Appleman, M. M. (1976) Cyclic nucleotide
phosphodiesterases in neoplastic and nonneoplastic human mammary tissues. Cancer Res
36,60-6.

Smith, E. R., Menill, A. H., Obeid, L. M., and Hannun, Y. A. (2000) Effects of sphingosine
and other sphingolipids on protein kinase C. Methods Enzymol 312,361-73.

Smith, E. R., and Merrill, A. H., Jr. (1995) Differential roles of de nova sphingolipid
biosynthesis and turnover in the "burst" of free sphingosine and sphinganine, and their 1-
phosphates and N-acyl-derivatives, that occurs upon changing the medium of cells in culture.
J Biol Chem 270,18749-58

Smyth, M. J., Obeid, L. M., and Hannun, Y. A. (1997) Ceramide: a novel lipid mediator of
apoptosis. Adv Pharmacol 41,133-54

134

Solomon, S. S., Palazzolo, M. R., Takahashi, T., and Raghow, R. (1997) Transcription factor
Spl is necessary for basal calmodulin gene transcription and for its selective stimulation by
insulin. Endocrinology 138,5052-4.

Spiegel, S., and Merrill, A. H., Jr. (1996) Sphingolipid metabolism and cell growth
regulation. FASEB J 10,1388-97

Spiegel, S., Olivera, A., and Carlson, R. O. (1993) The role of sphingosine in cell growth
regulation and transmembrane signaling. Adv Lipid Res 25,105-29

Spiegel, S., and F ishman, P. H. (1987) Gangliosides as bimodal regulators of cell growth.
Prac Natl Acad Sci USA 84,141-5.

Spiegel, S., Fishman, P. H., and Weber, R. J. (1985) Direct evidence that endogenous GMl
ganglioside can mediate thymocyte proliferation. Science 230,1285-7.

Spiegel, S. (1999) Sphingosine l-phosphate: a prototype of a new class of second
messengers. J Leukoc Biol 65,341-4

Spiegel, S., Olivera, A., Zhang, H., Thompson, E. W., Su, Y., and Berger, A. (1994)
Sphingosine-1 -phosphate, 3 novel second messenger involved in cell growth regulation and
signal transduction, affects growth and invasiveness of human breast cancer cells. Breast
Cancer Res Treat 31,337-48

Stemmer, P. M., and Klee, C. B. (1994) Dual calcium ion regulation of calcineurin by
calmodulin and calcineurin B. Biochemistry 33,6859-66.

Stephens, L., Anderson, K., Stokoe, D., Erdjument Bromage, H., Painter, G. F., Holmes, A.
B., Gaffney, P. R., Reese, C. B., McCormick, F ., Tempst, P., Coadwell, J ., and Hawkins, P.
T. (1998) Protein kinase B kinases that mediate phosphatidylinositol 3,4,5-trisphosphate-
dependent activation of protein kinase B. Science 279,710-4.

Stevens, V. L., Nimkar, S., Jamison, W. C., Liotta, D. C., and Merrill, A. H., Jr. (1990)
Characteristics of the growth inhibition and cytotoxicity of long-chain (sphingoid) bases for
Chinese hamster ovary cells: evidence for an involvement of protein kinase C. Biochim
Biophys Acta 1051,3 7-45.

Stoclet, J. C., Gerard, D., Kilhoffer, M. C., Lugnier, C., Miller, R., and Schaeffer, P. (1987)
Calmodulin and its role in intracellular calcium regulation. Prog Neurobiol 29,321-64.

Stoffel, W., Sticht, G., and LeKim, D. (1968) Metabolism of sphingosine bases. IX.
Degradation in vitro of dihydrospingosine and dihydrospingosine phosphate to
palmitaldehyde and ethanolamine phosphate. Hoppe Seylers Z Physiol Chem 349,1745-8.

Stoffel, W., and Assmann, G. (1970) Metabolism of sphingosine bases. XV. Enzymatic
degradation of 4t-sphingenine l-phosphate (sphingosine l-phosphate) to 2t-hexadecen-1 -al

135

 

and ethanolamine phosphate. Hoppe Seylers Z Physiol Chem 351,1041-9.

Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R., Reese, C. B., Painter, G. F .,
Holmes, A. B., McCormick, F., and Hawkins, P. T. (1997) Dual role of phosphatidylinositol-
3,4,5-trisphosphate in the activation of protein kinase B. Science 277,567-70.

Su, Y., Rosenthal, D., Smulson, M., and Spiegel, S. (1994) Sphingosine l-phosphate, a novel
signaling molecule, stimulates DNA binding activity of AP-l in quiescent Swiss 3T3
ﬁbroblasts. J Biol Chem 269,16512-7

Sydenham, E. W., Gelderblom, W. C. A., Thiel, P. G., and Marasas, W. F. O. (1990)
Evidence for the natural occurrence of fumonisin B,, a mycotoxin produced by Fusarium
moniliforme, in corn. J A gric Food Chem. Washington, D. C. .' American Chemical Society.
Jan 285-290

Telford, W. G., King, L. E., and F raker, P. J. (1994) Rapid quantitation of apoptosis in pure
and heterogeneous cell populations using ﬂow cytometry. J Immunol Methods 172,1 -16

Tolleson, W. H., Dooley, K. L., Sheldon, W. G., Thurman, J. D., Bucci, T. J., and Howard,
P. C. (1996a) The mycotoxin fumonisin induces apoptosis in cultured human cells and in
livers and kidneys of rats. Adv Exp Med Biol 392,23 7-50

Tolleson, W. H., Melchior, W. B., Morris, S. M., McGarrity, L. J., Domon, O. E.,
Muskhelishvili, L., James, S. J ., and Howard, P. C. (1996b) Apoptotic and anti-proliferative
effects of fumonisin B, in human keratinocytes, ﬁbroblasts, esophageal epithelial cells and
hepatoma cells. Carcinogenesis 17,239-49.

Tolleson, W. H., Couch, L. H., Melchior, W. B., Jenkins, G. R., Muskhelishvili, M.,
Muskhelishvili, L., McGarrity, L. J., Domon, 0., Morris, S. M., and Howard, P. C. (1999)
Fumonisin B, induces apoptosis in cultured human keratinocytes through sphinganine
accumulation and ceramide depletion. Int J Oncol 14,833-43.

Tomquist, K., Saarinen, P., Vainio, M., and Ahlstrom, M. (1997) Sphingosine l-phosphate
mobilizes sequestered calcium, activates calcium entry, and stimulates deoxyribonucleic acid
synthesis in thyroid F RTL-5 cells. Endocrinology 138,4049-57

Toutenhoofd, S. L., Foletti, D., Wicki, R., Rhyner, J. A., Garcia, F., Tolon, R., and Strehler,
E. E. (1998) Characterization of the human CALM2 calmodulin gene and comparison of the
transcriptional activity of CALM], CALM2 and CALM3. Cell Calcium 23,323-38.

Tsatsanis, C., and Spandidos, D. A. (2000) The role of oncogenic kinases in human cancer.
Int J Mol Med 5,5 83-90.

Tuccari, G., Rizzo, A., and Barresi, G. (1993) Immunocytochemical demonstration of
calmodulin and its activated forms in normal and carcinomatous human mammary tissue.
Eur J Histachem 37,59-64.

136

Ueno, Y., Iijima, K., Wang, S. D., Sugiura, Y., Sekijima, M., Tanaka, T., Chen, C., and Yu,
S. Z. (1997) F umonisins as a possible contributory risk factor for primary liver cancer: a 3-
year study of corn harvested in Haimen, China, by HPLC and ELISA. Food Chem Toxicol
35,1143-50.

Van Der Westhuizen, L., Shephard, G. S., Snyman, S. D., Abel, S., Swanevelder, S., and
Gelderblom, W. C. A. (1998) Inhibition of sphingolipid biosynthesis in rat primary
hepatocyte cultures by fumonisin B, and other structurally related compounds. Food chem
toxicol. Oxford, UK. .' Elsevier Science Ltd. June 497-503

Van Eldik, L. J ., and Burgess, W. H. (1983) Analytical subcellular distribution of calmodulin
and calmodulin-binding proteins in normal and virus-transforrned ﬁbroblasts. J Biol Chem
258,4539-47.

Venable, M. E., Blobe, G. C., and Obeid, L. M. (1994) Identiﬁcation of a defect in the
phospholipase D/diacylglycerol pathway in cellular senescence. J Biol Chem 269,26040-4.

Veigl, M. L., Sedwick, W. D., and Vanaman, T. C. (1982) Calmodulin and Ca 2* in normal
and transformed cells. Fed Proc 41,2283-8.

Voss, K. A., Riley, R. T., Norred, W. P., Bacon, C. W., Meredith, F. 1., Howard, P. C.,
Plattner, R. D., Collins, T. F., Hansen, D. K., and Porter, J. K. (2001) An overview of rodent
toxicities: liver and kidney effects of fumonisins and F usarium moniliforme. Environ Health
Perspect 109,259-66.

Voss, K. A., Chamberlain, W. J., Bacon, C. W., and Norred, W. P. (1993) A preliminary
investigation on renal and hepatic toxicity in rats fed puriﬁed fumonisin B,. Nat Toxins
1,222-8

Voss, K. A., Riley, R. T., Norred, W. P., Bacon, C. W., Meredith, F. 1., Howard, P. C.,
Plattner, R. D., Collins, T. F ., Hansen, D. K., and Porter, J. K. (2001) An overview of rodent
toxicities: liver and kidney effects of ﬁrmonisins and F usarium moniliforme. Environ Health
Perspect 109,259-66.

Vudathala, D. K., Prelusky, D. B., Ayroud, M., Trenholm, H. L., and Miller, J. D. (1994)
Pharrnacokinetic fate and pathological effects of l“C-fumonisin B, in laying hens. Nat Toxins
2,81-8

Wang, H. G., Pathan, N., Ethell, I. M., Krajewski, S., Yamaguchi, Y., Shibasaki, F.,
McKeon, F., Bobo, T., F ranke, T. F ., and Reed, J. C. (1999) Ca2+-induced apoptosis through
calcineurin dephosphorylation of BAD. Science 284,339-43

Wang, W., Jones, C., Ciacci-Zanella, J., Holt, T., Gilchrist, D. G., and Dickman, M. B.

(1996) F umonisins and Alternaria alternata lycapersici toxins: sphinganine analog
mycotoxins induce apoptosis in monkey kidney cells. Proc Natl Acad Sci U S A 93,3461-5.

137

Wang, D. G., Johnston, C. F., Marley, J. J., Phenix, K. V., Atkinson, A. 8., Russell, C. F .,
and Buchanan, K. D. (1997) Expression of the apoptosis-suppressing gene BCL-2 in
pheochromocytoma is associated with the expression of C-MYC. J Clin Endocrinol Metab
82,1949-52

Wang, E., Ross, P. F., Wilson, T. M., Riley, R. T., and Merrill, A. H., Jr. (1992) Increases
in serum sphingosine and sphinganine and decreases in complex sphingolipids in ponies
given feed containing fumonisins, mycotoxins produced by Fusarium moniliforme. J Nutr
122,1706-16.

Wang, T. T., and Phang, J. M. (1995) Effects of estrogen on apoptotic pathways in human
breast cancer cell line MCF-7. Cancer Res 55,2487-9

Wang, E., Norred, W. P., Bacon, C. W., Riley, R. T., and Merrill, A. H., Jr. (1991) Inhibition
of sphingolipid biosynthesis by fumonisins. Implications for diseases associated with
Fusarium moniliforme. J Biol Chem. 266,14486-14490

Wattenberg, E. V., Badria, F. A., and Shier, W. T. (1996) Activation of mitogen-activated
protein kinase by the carcinogenic mycotoxin fumonisin B,. Biochem Biophys Res Commun
227,622-7.

Wei, J. W., Morris, H. P., and Hickie, R. A. (1982) Positive correlation between calmodulin
content and hepatoma growth rates. Cancer Res 42,2571-4.

Wieder, T., Geilen, C. C., Kolter, T., Sadeghlar, F ., Sandhoff, K., Brossmer, R., Ihrig, P.,
Perry, D., Orfanos, C. E., and Hannun, Y. A. (1997) Bel-2 antagonizes apoptotic cell death
induced by two new ceramide analogues. FEBS Lett 411,260-4

Wilson, E., Olcott, M. C., Bell, R. M., Merrill, A. H., Jr., and Lambeth, J. D. (1986)
Inhibition of the oxidative burst in human neutrophils by sphingoid long-chain bases. Role
of protein kinase C in activation of the burst. J Biol Chem 261,12616-23.

Wilson, T. M., Ross, P. F., Rice, L. G., Osweiler, G. D., Nelson, H. A., Owens, D. L.,
Plattner, R. D., Reggiardo, C., Noon, T. H., and Pickrell, J. W. (1990) Fumonisin B, levels
associated with an epizootic of equine leukoencephalomalacia. J Vet Diagn Invest 2,213-6

Wu, J ., Spiegel, S., and Sturgill, T. W. (1995) Sphingosine l-phosphate rapidly activates the
mitogen-activated protein kinase pathway by a G protein-dependent mechanism. J Biol Chem
270,1 1484-8

Yao, B., Zhang, Y., Delikat, S., Mathias, S., Basu, S., and Kolesnick, R. (1995)
Phosphorylation of Raf by ceramide-activated protein kinase. Nature 378,307-10

Yoo, H. S., Norred, W. P., Showker, J ., and Riley, R. T. (1996) Elevated sphingoid bases and
complex sphingolipid depletion as contributing factors in fumonisin-induced cytotoxicity.
Toxicol Appl Pharmacol 138,21 1-8

138

Yoo, H. S., Norred, W. P., Wang, E., Merrill, A. H., Jr., and Riley, R. T. (1992) Fumonisin
inhibition of de novo sphingolipid biosynthesis and cytotoxicity are correlated in LLC-PK,
cells. Toxicol Appl Pharmacol. 114, 9-15

Yuan, Z. Q., Sun, M., F eldman, R. 1., Wang, G., Ma, X., Jiang, C., Coppola, D., Nicosia, S.
V., and Cheng, J. Q. (2000) Frequent activation of AKT2 and induction of apoptosis by
inhibition of phosphoinositide-B-OH kinase/Akt pathway in human ovarian cancer.
Oncogene 19,2324-30.

Zeisel, S. H., Char, D., and Sheard, N. F. (1986) Choline, phosphatidylcholine and
sphingomyelin in human and bovine milk and infant formulas. J Nutr 116,50-8.

Zhang, H., Buckley, N. E., Gibson, K., and Spiegel, S. (1990) Sphingosine stimulates cellular
proliferation via a protein kinase C-independent pathway. J Biol Chem 265,76-81

Zhang, H., Desai, N. N., Olivera, A., Seki, T., Brooker, G., and Spiegel, S. (1991)
Sphingosine-l-phosphate, a novel lipid, involved in cellular proliferation. J Cell Biol
114,155-67

Zhang, Y., Dickman, M. B., and Jones, C. (1999) The mycotoxin fumonisin B1
transcriptionally activates the p21 promoter through a cis-acting element containing two Spl
binding sites. J Biol Chem 274,12367-71

Zhang, J ., Alter, N., Reed, J. C., Bomer, C., Obeid, L. M., and Hannun, Y. A. (1996) Bel-2
interrupts the ceramide-mediated pathway of cell death. Prac Natl Acad Sci U S A 93,5325-8

Zhou, H., Li, X. M., Meinkoth, J., and Pittman, R. N. (2000) Akt regulates cell survival and
apoptosis at a postrnitochondrial level. J Cell Biol 151,483-94.

Zundel, W., and Giaccia, A. (1998) Inhibition of the anti-apoptotic PI3K/Akt/Bad pathway
by stress. Genes Dev 12,1941-6.

139