42.32 ”<95 415%»..4. 1.

:13:
.. .13...
.7

 

 

WVSTS‘

This is to certify that the

dissertation entitled

ROLE OF CYCLOOXYGENASE-Z IN
DEOXYNIVALENOL-INDUCED IMMUNOTOXICITY

presented by

Yuseok Moon

has been accepted towards fulfillment
of the requirements for

Ph.D. . Food Science and
degree “1 WW1 Toxicology

 

kaémz. u/Mfé,

Major professor

MS U is an Affirmative Action/Equal Opportunity Institution 0-12771

ROLE OF CYCLOOXYGENASE-Z IN DEOXYNIVALENOL-
INDUCED IMMUNOTOXICITY

By

Yuseok Moon

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Food Science and Human Nutrition

and
Institute for Environmental Toxicology

2003

ABSTRACT
ROLE OF CYCLOOXYGENASE-2 IN DEOXYNIVALENOL-INDUCED
IMMUNOTOXICITY
BY

Yuseok Moon

Deoxynivalenol (DON, vomitoxin or VT), one of the tn'chothecene mycotoxins, has
been recognized to cause immune stimulation or immune suppression in the experimental
animals dependently on close regimes. The purpose of this thesis was to determine whether
DON affects cyclooxygenase-2 (COX-2) expression and its possible contribution to DON-
induced immune dysfunctions. COX-2 was strongly induced in mouse spleens and Peyer’s
patches by the acute exposure to DON. Using the macrophage as a model for COX-2
production, the gene induction mechanism was investigated. Elevated COX-2 production
was found to be due to enhanced transcriptional activation and mRNA stability by DON.
DON-activated extracellular signal regulated protein kinases 1 and 2 (ERKI/Z) and p38
mitogen-activated protein kinase (MAPK) played an evident role in enhancing transcriptional
activity of COX-2 gene. Moreover, p38 MAPK was strongly involved in the DON-mediated
COX-2 mRNA stabilization as well as promoter activation. Type B trichothecenes other
than DON, namely, 15-acetyl DON, 3-acetyl DON and fusarenon-X were also potent
inducers of COX-2 expression whereas Type A and Type D trichothecenes had less effect
on COX-2 expression. Type B trichothecene-induced COX-2 was also regulated via

transcriptional and post-transcriptional control of the gene.

Interleukin-6 (IL-6) is known to play a pivotal role in DON-mediated IgA
nephropathy (IgAN) and the toxin-induced COX-2 was assessed for its effect on IL-6
production. Blocking with COX-2 inhibitors or genetic ablation using COX-2 knockout
mice retarded IL-6 induction by DON. Therefore, DON-mediated IL-6 production was, in
part, due to COX-2 induction and its metabolites.

From a therapeutic perspective, dietary fish oil (F0) suppresses DON-induced IgAN
in the animal model. To determine the pro-inflammatory gene responses and the signaling
molecules related to the disease amelioration by F0, mice were fed with corn oil or fish oil
for 8 weeks and then were acutely exposed to DON. Fish oil-fed mice demonstrated
significantly reduced IL-6, ERKl/Z and JN K1/2 responses to DON as compared to corn oil-
fed mice. However, there was little significant effect of F0 on DON-induced COX-2
activity. Mainly present in fish oil, (n—3) polyunsaturated fatty acids (PUFAs) such as
eicosapentaenoic acid (20:5(n-3), EPA) or docosahexaenoic acid (22:6(n-3), DHA) strongly
decreased DON-mediated IL-6 superinduction in presence of lipopolysaccharide in vitro
using RAW 264.7 cells. Moreover, DON-activated ERKl/2 and JNKl/Z were suppressed
by pretreatment of the cells with (n-3) PUFA. It is thus assumed that fish oil might retard

DON-induced IL-6 production by regulating MAPK signaling pathway.

DEDICATION

“This dissertation is dedicated to the memory of my late father”

ACKNOWLEDGMENTS

I really appreciate Dr. James Pestka’s contribution to this work. He encouraged my
sprits in adverse times and helped me to finish this precious accomplishment in my life.
Furthermore, I thank Dr. John Linz, Dr. Norbert Kaminski, Dr. Jay Shroeder and Dr. Kate
Claycombe so much for their academic advice and concern. It is also my pleasure to share
this God’s grateful present with my lovely mom and sister’s family .who supported my

persistent standing.

TABLE OF CONTENTS

Page

LIST OF TABLES ............................................................................................................ viii
LIST OF FIGURES ............................................................................................................. ix
ABBREVIATION .............................................................................................................. xii
CHAPTER 1. LITERATURE REVIEW ............................................................................. 1
A. Trichothecenes and their mycotoxicoses ................................................. 1

B. Immunotoxicity of deoxynivalenol ......................................................... 2

C. Cellular mode of action of trichothecenes ............................................... 6

D. Cyclooxygenase (COX) ........................................................................... 8

E. N-3 PUFA and its immunomodulation................................................‘.14

RESEARCH RATIONALE .................................................................................... 18
CHAPTER 2. DON-INDUCED COX-2 EXPRESSION VIA MAPK PATHWAY ......... 20
ABSTRACT ............................................................................................................... 21
INTRODUCTION .................................................................................................. 23
MATERIALS AND METHODS ............................................................................ 26
RESULTS ............................................................................................................... 30
DISCUSSION ......................................................................................................... 43
CHAPTER 3. RELATIONSHIP OF TRICHOTHECENE STRUCTURE TO COX-2
INDUCTION ...................................................................................... _ .................... 50
ABSTRACT ............................................................................................................. 51
INTRODUCTION .................................................................................................. 53
MATERIALS AND METHODS ........................................................................... 57
RESULTS ............................................................................................................... 62
DISCUSSION ......................................................................................................... 76
CHAPTER 4. ROLE OF COX-2 IN DON-MEDIATED IL-6 INDUCTION ................... 83
ABSTRACT ........................................................................................................... 84
INTRODUCTION .................................................................................................. 85
MATERIALS AND METHODS ........................................................................... 88
RESULTS ............................................................................................................... 92
DISCUSSION ....................................................................................................... 101

CHAPTER 5. EFFECT OF FISH OIL/(N-3) PUFA ON DON-INDUCED IL-6 AND

COX-2 PRODUCTION ....................................................................................... 106
ABSTRACT ......................................................................................................... 107
INTRODUCTION ................................................................................................ 109
MATERIALS AND METHODS ......................................................................... 112
RESULTS .............................................................................................................. 1 19
DISCUSSION ....................................................................................................... 129
CHAPTER 6. SUMMARY AND PERSPECTIVES ....................................................... 134
REFERENCES ................................................................................................................. 138

vii

LIST OF TABLES

Page
Table 1. Comparison between human COX-1 and COX-2 ............................................... 12
Table 2. Comparative cytotoxicity of trichothecenes ........................................................ 63
Table 3. Fatty acid composition of oils used for experimental diets ............................... 118

viii

LIST OF FIGURES

fig;

Figure 1. Metabolism of arachidonic acid and essential fatty acids ................................... 11
Figure 2. Dose-response effects of DON on PGE2 and COX-2 gene expression in

RAW 264.7 cells. .................................................................................................. 32
Figure 3. Activation of MAPKs by DON in RAW 264.7 cells ......................................... 33
Figure 4. Involvement of MAPK (ERK and p3 8) in DON-induced COX-2

expression. ............................................................................................................ 34
Figure 5. Role of IN K in DON-induced COX-2 expression ........................................... .35
Figure 6. Effect of DON on COX-2 promoter activity. .................................................... 38

Figure 7. Involvement of MAPK in DON-induced activation of COX-2 promoter .......... 39

Figure 8. Effect of DON on COX-2 mRNA stability following LPS induction ............... 41
Figure 9. Role of MAPK in DON-induced COX-2 mRNA stability ................................ 42
Figure 10. Dose response of DON-mediated cytotoxicity in macrophage cells ............... 64
Figure 11. Comparative effects of trichothecenes on COX-2 expression ......................... 65
Figure 12. Effects of trichothecenes-mediated COX-2 promoter activity ......................... 67

Figure 13. Involvement of 3'-UTR in DON-induced COX-2 mRNA stabilization ........... 69
Figure 14. Effects of trichothecene mycotoxins on COX-2 mRNA stability .................... 71
Figure 15. Activation of MAPK by trichothecene mycotoxins ........................................ 73
Figure 16. Effects of MAPK inhibition on Type B trichothecene-induced

COX-2 expression .................................................................................................. 74

ix

Figure 17. Involvement of NF «B signaling in Type B trichothecene-induced
COX-2 expression .................................................................................................. 75
Figure 18. Down-regulation of DON-mediated IL-6 superinduction in RAW 264.7
cells by COX-2 inhibitors, indomethacin and NS-398 .......................................... 93
Figure 19. Dose response of DON-induced COX-2 mRNA expression in
murine Peyer’s patches and spleen ......................................................................... 96
Figure 20. Time response of DON-induced COX-2 and IL-6 mRNA expression in
murine Peyer’s patches and spleen ........................................................................ 97
Figure 21. Suppression of DON-induced serum IL-6 response in mice by COX-2
inhibitors indomethacin and NS-398. 98
Figure 22. Suppression of DON-induced IL-6 mRNA response in spleen
by COX-2 inhibitors, indomethacin and NS-3 98 suppresses .................................. 99
Figure 23. Impaired response of splenic IL-6 mRNA and serum IL-6 to DON
in COX-2 knockout mice ...................................................................................... 100
Figure 24. A. Feeding plan with corn oil or fish oil in B6C3F1 male mice.
B. Effect of F0 diet on plasma IL-6 production in mice acutely
exposed to DON or vehicle ...................................................................... 120
Figure 25. Effects of F0 diet on splenic lL-6 mRNAs of mice exposed to DON
or vehicle (V H) ..................................................................................................... 121
Figure 26. Effect of F0 diet on COX-2 metabolism in mice acutely exposed
to DON or vehicle (VH) ....................................................................................... 123
Figure 27. Effect of F O diet on MAPK phosphorylation in spleens of mice

exposed to DON or vehicle (VH) ........................................................................ 124

Figure 28. PUF As on DON-induced IL-6 production in murine macrophage cells ........ 127
Figure 29. Effect of PUF As on DON-induced MAPK phosphorylation
in macrophage cells .............................................................................................. 128

Figure 30. Proposed mode of COX-2 involvement in DON-induced immunotoxicity...135

xi

ABBREVIATIONS

AA: arachidonic acid

Act-D: actinomycin-D

ARE: AU-rich element

C/EBP: CCAAAT/enhancer-binding protein
CO: corn oil

COX: cyclooxygenase

CREB: CAMP response element binding protein
DHA: docosahexaenoic acid (22:6(n-3))
DON: deoxynivalenol

EET: epoxyeicosatrienoic acid

EPA: eicosapentaenoic acid (20:5(n—3))
ERK: extracellular signal regulated protein kinases
FO: fish oil

IC: immune complex

IgAN: IgA nephropathy

IKBI inhibitory kappa B

IKK: IKB kinase

IL-6: interleukin 6

IND: indomethacin

INK: c-Jun N-terminal kinases

KO: knockout mice

LOX: lipoxygenase

xii

LPS: lipopolysaccharide

LTB: leukotriene B

MAPK: mitogen-activated protein kinases

MHC: major histocompatibility complex

MTT: 3-[4,5-dimethylthiazol-2—yl]-2,5-diphenyltetrazolium bromide
MUFA: momo-unsaturated fatty acids

NF-KBI Nuclear Factor kappa B

NIV: nivalenol

NK: natural killer

PDTC: pyrrolidine dithiocarbamate

PGE: prostaglandin E

PKR: double-stranded RNA-dependent protein kinase
PPAR: proxisome proliferator activating factor
PUFA:poly-unsaturated fatty acids

SF A: saturated fatty acids

TXA: thromboxane A

UTR: untranslated region

VH: vehicle

VT: vomitoxin

xiii

CHAPTER 1

LITERATURE REVIEW

A. Trichothecenes and their mycotoxicoses The trichothecenes are a group of 182
structurally related sesquiterpenoid metabolites produced by F usarium, Myrothecium,
Trichoderma, Cephalosporium, Verticimonosporium, and Stachybonys growing on food,
feed stuff and the environment (U eno, 1985). Trichothecene contamination in agricultural
commodities such as wheat, barley, and corn during fungal colonization has become a
serious problem due to changing climatic patterns or agricultural practice (Peraica et al.,
1999). The trichothecene family is divided into four groups (A through D) based on
modifications of the parent trichothecene ring system (U eno, 1985). Three of these subtypes,
Type A, B, and D, have great potential risk to human and animal health and therefore, will
be the focus of this study. Type A trichothecenes are characterized by a hydroxyl or acyl
moiety at R], R2, R3, or R5 position (Table 1). Type B family possesses a ketone group at R5
in addition to the derivation of Type A trichothecene. Macrocyclic Type D trichothecenes
contain a diester or tn'ester ring structure bridging between R2 and R3 positions (Jarvis,
1991)

Acute exposure to trichothecenes causes dehydration with gastrointestinal (GI)
lesions, hematopoietic and immunosuppressive radiomimetic syndromes in experimental
animals (Ueno et (11., 1984; Ueno, 1985). Notably, leukopenia, granulopenia, and

progressive lymphocytosis can occur in the highly susceptible immune system. CNS toxicity

includes anorexia, lassitude, and nausea and acute vascular effects lead to hypotension and
shock. Longer chronic mycotoxicoses exhibit the petechial rash, intensive ulceration,
gangrenous processes, and high susceptibility to various secondary infections. However,
trichothecene mycotoxins demonstrate neither mutagenic activity nor the capacity to damage
DNA (Busby, et al., 1981).

Trichothecenes have been etiologically related to several human diseases. One such
disease is alimentary toxic aleukia (ATA), which was fatal toxicosis associated With
overwintered moldy millet, wheat, and barley (J offe and Yagen, 1977). Cotton lung disease
is caused by inhalation of cotton dust contaminated with verrucarin-producing Myrothecium
verrucaria (Jarvis, 1991). Red mold disease is a mycotoxicosis caused by eating Fusarium-
infected wheat, rice and barley contaminated with nivalenol, deoxynivalenol, and fusarenon-
X (Li et al. , 1999). Finally, attentions have focused on the contribution of molds to indoor
air illness (Elidemir et al., 1999; Scheel et al., 2001; Trout et al., 2001) and specifically,
Stachybotrys has been associated with water-damaged building syndrome and was isolated
from the bronchoalveolar lavage fluid of one infant with hemosiderosis. The involvement
of Type D trichothecenes in this syndrome was not determined. However, Type A (T-2 toxin,
HT-2 toxin, and diacetoxyscirpenol) and Type D toxins (satratoxins and verrucarins) have
been identified in indoor air samples in which respiratory disease has been reported
(Smoragiewicz et al., 1993; Johanning et al., 1996; Tuomi et al., 1998; Mahmoudi and

Gershwin, 2000).

B. Immunotoxicity of deoxynivalenol DON can be either immunosuppressive or

immunostimulatory, depending on the dose and exposure regime (Bondy and Pestka, 2000).

B.l Immune suppression. Dietary exposure to DON at concentration as low as 2
ppm for several weeks and 5 ppm for 1 wk as well as in vitro exposure to DON depress
mitogen-induced proliferation responses of murine lymphocytes (Forsell et al. , 1985;
Tryphonas et al., 1986; Robbana-Barnat et al., 1988). Deoxynivalenol also is cytotoxic to
macrophages at high dose levels (Yang et al., 2000a). Humoral immunity also can be
impaired by DON. Exposure to DON in diet at a 10 ppm threshold or by gavage at 0.75
mg/kg body weight impairs the murine splenic plaque-forming cell (PFC) response to the
sheep red blood cells (SRBC) (Pestka et al., 1987; Robbana-Barnat et al., 1988).

It is apparent that high doses of trichothecene promote rapid onset of leukocyte
apoptosis and this will be undoubtedly manifested as irnmunosuppression (lhara et al. , 1997;
Shinozuka et al., 1997; Islam et al., 1998a; Islam et al., 1998b; Shinozuka et al., 1998).
Moreover, the tissue damage becomes synergistically severe in presence of endotoxin,
lipopolysaccharide, which have been known to be associated with elevation in pro-
inflammatory cytokines and glucocorticoids (Zhou et al. , 1999; Zhou et al. , 2000; Islam et
al., 2002).

At the molecular level, apoptotic signals can be transduced through caspase-cascades
by trichothecenes and elevation in calcium also has been implicated (Yoshino et a1. , 1996;
Nagase et al. , 2001 ). Ribotoxic stresses such as alterations in 288 rRN A by protein synthesis
inhibition by DON are postulated to be an initiation signal for activation of MAPK such as
JN K1/2 and p38 MAPK which have been known to be associated with apoptotic cell death
(Shifrin and Anderson, 1999; Yang et a1. , 2000a). Interestingly, ERKl/2 is considered to be
an anti-apoptotic signal in DON-mediated programmed cell death (Yang et aI. , 2000a).

B.2 Immune stimulation. Both single gavage and multiple gavage of mice with

DON enhance resistance to the mastitic pathogen, which of immunostimulatory effect may
have been mediated by altered macrophage and T regulatory cell activity (Corrier, 1991).
When isotype-specific effects of DON on the immunoglobulin response are analyzed, there
are dramatic elevations in total serum IgA, IgA immune complexes and polymeric IgA with
concurrent decreases in total IgM and IgG (Pestka et al., 1990a; Pestka et al., 1990b). In
addition to IgA hyperelevation, DON-exposed mice exhibit kidney mesangial IgA deposition
and hematuria, which are hallmarks of human IgA nephropathy (IgAN) (Dong et a1. , 1991).

B3 DON-induced IgAN. Human IgAN is the most common glomerulonephritis
worldwide. Approximately, 150,000 people in the United States have been diagnosed with
IgAN with nearly 4000 new cases occurring each year (Hellegers, 1993). Between 20-40%
of these will develop progressive renal failure over a 25 year period from the time of initial
diagnosis, with 1-2 % of adult patients entering end-stage renal failure yearly and requiring
hemodialysis or kidney transplantation (Emancipator and Lamm, 1989). Several lines of
evidence support the possibility that IgAN is an immune complex (IC) disease. These
include the following: a) the correlation between circulating IgA-1C and disease activities in
IgAN patients; b) high-molecular weight IgA from serum and renal eluates of IgAN patients
that contain dimeric IgA and activated complement; and 0) experimental rodent studies in
which IgAN is induced with injected IgA-1C (Emancipator and Lamm, 1989; Montinaro et
al., 1999). An overly robust IgA response to mucosal infections and dietary antigens in
terms of quantity, size (primarily polymeric) and glycosylation status is believed to contribute
to the amount and pathogenicity of IgA-1C in IgAN. Recurrent accumulation can recruit a
battery of inflammatory events such as activation of alternative complement system, leading

later to glumerulonephritis and kidney failure (Rantala et a1. , 2001 ).

DON-induced IgA nephropathy has also other several common traits with the human
Berger’s disease such as male susceptibility to the disease and polyclonal autoreactive IgA
production as well as mesangial IgA deposition (Greene et al. , 1994; Rasooly et al., 1994;
Rasooly and Pestka, 1994; Greene et al., 1995). It is considered that cytokines,
prostaglandins, and growth factors play the central modulatory role in producing defectively
modified IgA, reactive T cell, and disease progresses in human IgAN (Rantala et al. , 2001).

Whereas DON has little inducible effect on B cells to produce IgA , T cells have
been implicated to affect switching in B cells to produce IgA via a diverse array of cytokines
(Minervini et al., 1993; Warner et al., 1994). Moreover, exposure to low levels of
deoxynivalenol appears to promote expression of several cytokines in vivo and in vitro
(Dong et al., 1994; Zhou et al., 1997) and macrophages are also considered as another
important component to produce cytokines affecting the humoral IgA production (Wong et
al., 1998; Yan et al., 1998). Deoxynivalenol-induced aberrant IgA production may be
mediated through an over-expression of cytokine genes in T helper cells and the
mononuclear phagocyte system transcriptionally or post-transcriptionally (Ouyang et al.,
1996; Li et al., 1997; Wong et al., 1998; Wong et al., 2001). Among these cytokines,
interleukin-6 (IL-6) is widely recognized to be particularly critical to regulation of mucosal
B cell differentiation to IgA secreting plasma cells (Beagley et al., 1989; Beagley et al.,
1991; Fujihashi et al., 1992). Genetic disruption of IL-6 in mice markedly reduces DON-
induced increases in serum IgA as well as kidney IgA deposition in mice suggesting a strong
correlation between IL-6 and these IgA effects (Pestka and Zhou, 2000). In addition to the
role of IL-6 on IgA nephropathy, induction or superinduction of the cytokine is likely to be

associated with the shock-like and cytotoxic responses that occur during acute DON

intoxication in mice, synergistically acting with lipopolyssaccharide (LPS) (Zhou et al.,
1997; Zhou et al., 1999).

The pattern of cytokine induction by deoxynivalenol is so diverse that it may also
contribute to other abnormal pathogenesis such as allergic inflammation or autoimmune
dysfiinctions (Rasooly et al., 1994; Rasooly and Pestka, 1994). Relatedly, prolonged
deoxynivalenol ingestion (6 months) can induce progressive dysregulation of IgE production

in addition to the previously described increase in IgA (Pestka and Dong, 1994).

C. Cellular mode of action of trichothecenes

C.l Target organelles. Although the specific receptors have not yet been identified,
ribotoxic stress and oxidative stress are considered to be the primary factors in the
trichothecene cytotoxicity (Shifiin and Anderson, 1999; Yang et al. , 2000a). Trichothecenes
are very heat-stable molecules that inhibit protein synthesis by specific and high affinity
binding to ribosome. Notably, the primary target, both in vivo and in vitro, of a variety of
trichothecenes is 28S ribosomal RNA, where the peptidyl-transferase activity of the complex
is inhibited by the toxins (Shifrin and Anderson, 1999). These translation-inhibiting toxins
are cytotoxic to the rapidly dividing cells and thus target the immune system and epithelial
tissues. In addition to inhibition of the ribosomal protein synthesis, DON may affect protein
processing such as folding and secretion because the toxin down-regulates endoplasmic
reticulum chaperone (GRP78/BiP) and co-chaperone P58 which have been known to play
critical roles in regulating post-translational modification such as glycosylation and cellular
homeostasis (Yang et al. , 2000b). As another target of the toxins, some trichothecenes can

cause damage cellular membranes. The lipid peroxidation is increased in liver, spleen,

intoxication in mice, synergistically acting with lipopolyssaccharide (LPS) (Zhou et al.,
1997; Zhou et al., 1999).

The pattern of cytokine induction by deoxynivalenol is so diverse that it may also
contribute to other abnormal pathogenesis such as allergic inflammation or autoimmune
dysfunctions (Rasooly et al., 1994; Rasooly and Pestka, 1994). Relatedly, prolonged
deoxynivalenol ingestion (6 months) can induce progressive dysregulation of IgE production

in addition to the previously described increase in IgA (Pestka and Dong, 1994).

C. Cellular mode of action of trichothecenes

C.l Target organelles. Although the specific receptors have not yet been identified,
ribotoxic stress and oxidative stress are considered to be the primary factors in the
trichothecene cytotoxicity (Shifrin and Anderson, 1999; Yang et al. , 2000a). Trichothecenes
are very heat-stable molecules that inhibit protein synthesis by specific and high affinity
binding to ribosome. Notably, the primary target, both in vivo and in vitro, of a variety of
trichothecenes is 28S ribosomal RNA, where the peptidyl-transferase activity of the complex
is inhibited by the toxins (Shifiin and Anderson, 1999). These translation-inhibiting toxins
are cytotoxic to the rapidly dividing cells and thus target the immune system and epithelial
tissues. In addition to inhibition of the ribosomal protein synthesis, DON may affect protein
processing such as folding and secretion because the toxin down-regulates endoplasmic
reticulum chaperone (GRP78/BiP) and co-chaperone P58 which have been known to play
critical roles in regulating post-translational modification such as glycosylation and cellular
homeostasis (Yang et al. , 2000b). As another target of the toxins, some trichothecenes can

cause damage cellular membranes. The lipid peroxidation is increased in liver, spleen,

kidney, thymus, and bone marrow of rat exposed to the trichothecenes (Suneja et al. , 1989).
Trichothecene-stimulated alteration in mitochondrial membranes contributes to the
interference with cellular ATP production from the organelle via damaged electron transport
and high chance of production of free radicals.

C.2 Ribotoxic stress and mitogen-activated protein kinases (MAPKs). The
ribotoxic stress response is the capacity of the ribosomes to sense cellular stress. The
capacity of cellular reaction is notably reflected on MAPK activation by toxicants that
perturb the functioning of the 3'-end of the large 28S rRNA such as aminoacyl-tRNA
binding, peptidyl transferase activity or ribosomal translocation (Iordanov et al., 1997).
Through the inhibition of peptidyltransferase activity, a variety of trichothecenes can cause
the ribotoxic stresses in the cells, which then stimulate mitogen-activated protein kinases
(MAPKs). MAPKs are evolutionally conserved enzymes connecting cell-surface receptors
to critical regulatory targets within cells. They also respond to chemical and physical stresses,
thereby controlling cell survival and adaptation. MAPK activity is regulated through three-
tiered cascades composed of a MAPK, MAPK kinase (MAPKK, MKK or MEK) and a
MAPKK kinase or MEK kinase (MAPKKK or MEKK) (Chang and Karin, 2001). Mammals
express at least four distinctly regulated groups of MAPKs, extracellular signal-related
kinases (ERK)-1/2, Jun amino-terminal kinases (JNK1/2/3), p38 proteins (p38a/b/g) and
ERK5, that are activated by specific MAPKs : MEK1/2 for ERK1/2, MKK3/6 for the p3 8,
MKK4/7 (JNKK1/2) for JNKs, and MEKS for ERKS. Each MAPKK, however, can be
activated by more than one MAPKKK, increasing the complexity and the diversity.

This process can lead to the expression of genes important in cellular homeostasis as

well as in the control of cell survival, proliferation and differentiation (Laskin et al. , 2002).

Interestingly, MAPK signals such as p38 and JN K can mediate trichothecene-induced
apoptotic cell death at high concentrations (Shifrin and Anderson, 1999; Yang et al. , 2000a).
By and large, activation of ERKl/2 has been linked to cell survival, whereas JN K and p38
are to induction of apoptosis (Xia et al. , 1995).

As shown in the dose regimes of the immunotoxicity by trichothecenes, the
compounds at sub-lethal concentrations can potentiate expression of cytokines by elevating
transcription and increasing mRN A stability whereas higher concentrations of trichothecenes
completely shut down translation and induce apoptosis (Ouyang et al. , 1996; Wong et al. ,
2001; Wong et al. , 2002). This paradoxical gene expression can be investigated in terms of
ribotoxic stress events. As mentioned before, the ribotoxic stress-mediated MAPKs can
modulate gene expression transcriptionally or post-transcriptionally and cell survival

pathway (Chang and Karin, 2001; Laskin et al., 2002).

D. Cyclooxygenase. As inducible targets by MAPK signaling cascades, eicosanoid-
producing enzyme systems was investigated in this thesis because eicosanoids have been
known to be involved in diverse inflammatory diseases as well as trichothecne toxicosis
(Shohami and F euerstein, 1986; Shoharni etal., 1987; Naseem et al., 1989).

DJ Production and action of its metabolites : Orthodox process. Products
derived from arachidonic acid metabolism affect a variety of biologic processes including
inflammation and homeostasis (Vane er al., 1998). They can be thought of as short range
hormones that act locally at the site of generation and then rapidly spontaneously decay, or
are enzymatically destroyed. Arachidonic acid is a 20-carbon polyunsaturated fatty acid (4

double bonds) derived primarily from dietary linoleic acid and present in the body only in

the esterified form as a component of cell membrane. It is released via cellular
phospholipases (PLA2, PLC and PLD) from the membrane and further metabolized by three
enzymatic pathways: Cyclooxygenase (COX), Lipoxygenase (LOX), or Cytochrome P450
monooxygenase (Epoxygenases) (Vane et al. , 1998). Final products include
prostaglandins/thromboxanes, leucotrienes/lipoxin, and epoxyeicosatrienoic acid (EET),
respectively (Fig. 1). Prostaglandin production is catalyzed by Prostaglandin Synthetase
(PGS) from arachidonic acid via a two-step process involving distinct cyclooxygenase to
produce PGGZ (rate-limiting) and peroxidase activities to PGH2 (Smith et al. , 2000). Two
isoforms of COX have been identified and characterized. COX-1 is constitutively expressed
in many tissues and cell types and is presumed to be involved in maintaining cell
homeostasis such as hemodynarnics and renal function whereas COX—2 is transiently induced
by mitogenic or inflammatory stimuli in most tissues (Table 1). COX-2 metabolites may be
thus involved in inflammatory responses (Harris et al. , 2002). However, COX-2 is
constitutively expressed in the brain and kideny of the rodent. Although COX-1 and COX-2
are products of different genes and their amino acid identity is only about 61 % overall, their
three-dimensional x-ray crystal structures are virtually superimposable (Serhan and Oliw,
2001). Prostaglandins are ligands for receptor-mediated pathways that may contribute to
prolonged activation of biologic responses such as cell growth and differentiation (Harris et
a1. , 2002; Neurath et al. , 2002). The rapid metabolic breakdown of prostaglandins suggests
that they act in transient autocrine or paracrine fashion to modulate the action and synthesis
of other secondary messengers. Prostaglandin E2 (PGE2) exerts its action by binding to one
(or a combination) of its four receptors subtypes, EPl , EP2, EP3 or EP4. These receptors

are coupled to different G proteins and use several messenger signaling pathways.EP1 is

coupled to Gq/p and ligand binding stimulates protein synthesis through both extracellular
and intracellular Ca 2+ mobilization. EP2 and EP4 are coupled to Gs proteins and induce the

elevation of CAMP, which lead to gene expression. EP3 are primarily coupled to Gi and is
most often inhibitory to CAMP. In addition, some COX-2 metabolites such as
cyclopentanone prostaglandins can bind to a nuclear receptor, peroxisome proliferator-
activated receptor (PPAR)-Y , thus impacting proinflammatory gene transcription (Ricote et
al., 1998; Thieringer et al., 2000).

D.2 Production and action of its metabolites : Unorthodox routes. There are still
uncovered pathways leading to the formation of bioactive prostannoids via COX or non-
enzymatic chemical transformation (Serhan and Oliw, 2001). One of these is prostanoids
found in seminal fluid such as 19R-hydroxy-PGE compounds which is assumed to be
produced by cytochrome P450 such as CYP4F8. Polyunsaturated fatty acids (PUFAs) can
also undergo autooxidation and p450 epoxidation in vivo, generating a complex mixture of
hydroperoxides, epoxides, and cyclic peroxides. Of particular medical interest are the
isoprostanes, which serves as a marker of in vivo lipid peroxidation (Morrow, 2000; Roberts
and Morrow, 2000). Aspirin has been known to block COX-mediated prostanoid
production. However, it was recently reported that aspirin triggers formation of novel series
of lipid mediators, the aspirin-triggered lipoxins (ATLs) (Serhan and Oliw, 2001). Whereas
S-configured lipoxins are generated by initial lipoxygenation by 15-LOX followed by 5-
LOX, R-configured lS-hydroxyeicosatetraenoic (1 S-HETE) is produced by aspirin-triggered
acetylated COX-2 followed by 5-LOX to present ATL. ATLs analogous to lipoxin are
involved in promoting resolution of inflammation by inhibiting neutrophil recruitment and

chemokine production (Levy et al. , 2001; Levy and Serhan, 2002).

10

 

l a-Iinolenic acid (diet)

 

 

 

V

Dietary N-3 PUFA
(EPA, DHA)

\

 

 

 

Linoleic acid
(Diet)

 

 

 

4 Arachidonic acid
.‘Evv‘i “‘ PLC, PLD ;_
PLA2 £+co DAG .Iipas: :4

MAG lipase
Arachidonic acid

/

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Llpoxygenases [ Cyclooxygenases Epoxygenases
. (cytochrome p450)
Leukotrienes Prostaglandins Epoxyeicosatrienoic
Lipoxins Tromboxanes acid (EST)
"-3 family ‘IIIIIIIIII’ N-6 family
of eicosanoids of eicosanoids
eg. PGE2 TXA2

eg. PGE3 TXA3

Fig. 1. Metabolism of arachidonic acid and essential fatty acids.

11

 

 

COX-l COX-2
Gene locus 9q32-q33.3 1q25.2-q25.3
Size of gene 22 kb 8.3 kb
# of exon 11 10
Size of mRNA 2.8 kb (stable) 4.6 kb (unstable)
Coding nucleotides 1797 hp 1812 bp
# of amino acids 576 aa 604 aa
5'-flanking region No TATA box, GC rich (Human: Human: Spl , NF-kB, AP2, -

3'-UTR

Protein locus

Aspirin treatment

Expression

Regulators

 

AP2, Myb, GATA, Spl, NF-IL6)

0.7 kb

ER and nuclear membrane

No metabolites

constitutive in most tissue
Inducible in endothelial, platelet,
renal collecting tubules, seminal

vesicle, gallbladder.

endogenously unknown

 

NF-IL6, CRE, E box, TATA

2 kb AUUUA rich elements
(Conserved region in 100 bp is
critical for mRNA stability)
Mainly nuclear membrane
15R-HETE

Inducible

Constitutive in renal cortex,
thyroid tissue, brain.

PPAR ligands, glucocorticoids

 

Table 1. Comparison between human COX-1 and COX-2

12

D.3 MAPK involvement in COX-2 induction signals Several inflammatory stimuli
which induce COX-2 gene expression also activate the mitogen-activated protein kinases
(MAPKs). Among the MAPKs, c-Jun N-terminal kinase 1 and 2 (JNK1/2), extracellular
signal regulated protein kinase 1 and 2 (ERK1/2), and p38 MAPK have been extensively
studied relative to COX-2 gene expression (Xie and Herschman, 1995; Guan et al., 1998).
The transcriptional activity of COX-2 gene expression is redundantly modulated by MAPKs
(Wadleigh et al., 2000; Mestre et al., 2001). Its promoter contains Notably, p38 MAPK
plays an important role in the signaling pathway for the stability of COX—2 mRNA, which
is dependent on regulatory elements contained within the 3'-UTR of the message (Dean et
al., 1999; Lasa et al., 2000). Post-transcriptional regulation is not limited to changes in
message stability. Sequences within the 3'-UTR of mRNAs have also been shown to be

important for enhancing message translation as well as for translational silencing (Di Liegro

et al., 2000; Mbella et al., 2000; Piecyk et al., 2000).

DA Involvement of Nuclear Factor kappa B (NF-KB)/Rel-re1ated signaling
pathway in COX-2 induction signals The NF-KB/Rel-related signaling pathway has also
been implicated in the induction of COX-2 gene expression in various types of cells (Hwang
et aI. , 1997; Inoue and Tanabe, 1998; Smith et al. , 2000). Most NF-KB/Rel dimers are bound
to [1ch and retained in the cytoplasm. Phosphorylation of Ich by Ich kinase (IKK) complex
lead to the ubiquitination of IKB via a non-lysosomal ATP-dependent 26S proteolytic
complex composed of a 700 kDa proteasome and allow the release of NF-ch/Rel dimers
which translocate to the nucleus for transcriptional regulation of COX-2 gene (Perkins,
2000). The most characterized NF-KB inhibitor is IKBa which binds avidly to the p65

(RelA). It is rapidly and completely degraded following inducible phosphorylation but is

13

quickly resynthesized in an NF-KB dependent manner (J obin and Sartor, 2000). In contrast,

IKBB is slowly degraded and lead to persistent activation of NF-KB.

E. N-3 PUFA and its immunomodulation. When assessed as nutraceutical candidates for
modifying eicosanoid metabolism, n-3 polyunsaturated fatty acids (n-3 PUFAs) like
docosahexaenoic acid (DHA 22:6n-3) and eicosapentaenoic acid (EPA 20:5n-3), which are
plentiful in fish oil (F0) and metabolized from a-linolenic acid, have been known to down-
regulate inflammatory and autoimmune diseases in human clinical trials. One mechanism
is the formation of prostaglandins (PGE3) and thromboxane (TXA3) that counterbalance the
effects of often more inflammatory products (PGE2 or TXA2) derived from arachidonic acid
(Figure 1). N-3 PUFAs can reduce clotting as well as suppress pain and inflammation.
The spectrum of (n-3) PUFA activities is broad and includes suppression of
lymphocyte proliferation, cytotoxic T lymphocyte activity, natural killer cell activity,
macrophage-mediated cytotoxicity, neutrophil/monocyte chemotaxis, major
histocompatibility complex II expression and antigen presentation. Evidence that these
specific cellular effects indeed affect immune firnction in vivo is reflected in the
experimental attenuation of acute inflammation, delayed-type hypersensitivity, graft
rejection, and autoimmune responses (Wu and Meydani, 1998; Kehn and Femandes, 2001).
The mechanistic basis for the immune effects of (n-3) PUFA may relate to their capacity to
modulate cytokine and inflammatory mediators, cell-to-cell communication, and cellular
population via apoptosis (Meydarri et al., 1991; Purasiri et al., 1994; von Schacky, 1996;
Jolly et al., 2001). Speaking of their cellular events, production of diverse immune

mediators is attenuated extensively in tissues from animals and humans fed with (n-3) PUFA.

l4

Fish oil ingestion decreases ex vivo pro-inflammatory cytokine production in human
mononuclear cells (Caughey et al. , 1996), rat blood mononuclear cells (Grimm et al. , 1994),
mouse thioglycolate-elicited macrophages (Yaqoob and Calder, 1995), and rat kupfer cells
(Billiar et al. , 1988). In addition to macrophage cytokines, n-3 PUFA also can modulate the
differential activation of T cell subsets and their cytokines (Arrington et al. , 2001; Jolly et
al., 2001). Finally, FO can regulate cellular viability of autoreactive lymphocytes via
apoptosis (Femandes et al., 1998; Jolly et al., 2001; McCarty, 2001). F0 consumption also
suppress proliferation of carcinoma by apoptotic regulation such as leukemia and colon
cancer (Narayanan et al., 2001; Siddiqui et al., 2001).

El Effect on IgA Nephropathy. The observation that (n-3) PUFA attenuate
untoward immune responses has lead to consideration of their use as therapeutic agents for
human autoimmune and inflammatory disease. Clinically and experimentally, fish oil
reduces the severity of rheumatoid arthritis (Kremer et al., 1990; Ergas et al., 2002),
immune-related skin disease (Mayser et al. , 1998) and systemic lupus erythmatosous (Clark
et al., 1989). One of the promising targets of this nutritional therapy can be human IgA
nephropathy as discussed previously. As an nutritional therapeutic method against this
disease, Donadio proposed that dietary supplementation with fish oil may benefit patients
with immune-related renal diseases including IgAN, lupus nephritis and cyclosporine-
induced nephrotoxicity (Donadio, 1991). In spite of positive data from many randomized
clinical trials evaluating efficacy of fish oil in treating IgAN (Hamazaki et al. , 1984; Donadio
et al., 1999; Donadio et al., 2001), there are still controversies over these findings. Some
clinical trials could not demonstrate definitely alleviating effects of F O or (n-3) PUFA on

progress of the IgAN (Bennett et al. , 1989; Pettersson et al. , 1994). The lack of effect might

15

relate to the inherent problems with population size, time of follow-up, or stage of disease
(Donadio et al., 1999). Thus, although dietary FO supplementation appears to be a
promising therapeutics for IgA nephropathy, further research is warranted both to establish
the mechanistic basis for the effects and to determine the optimum dosing regimens for EPA
and DHA. DON-induced nephropathy in mice is ameliorated with fish oil diet (Pestka et a1. ,
2002) and the cellular mechanism was investigated in this research.

E.2 Cellular mechanisms of (n-3) PUFA. Fish oil has been proposed to act by
several mechanisms. First, it may prevent conversion of arachidonic acid to proinflammatory
eicosanoids by changing endogenous pool of substrates for lipid metabolic enzymes such as
COX or LOX, leading to anti-inflammatory eicosanoids (Serhan and Oliw, 2001). As
another pathway of (n-3) PUFAs metabolism than orthodox routes, (n-3) PUFA can be
converted to 18R- or 15R-hydroxy-eicosapentaenoic acid (HEPE) by acetylated COX-2 in
the presence of aspirin, which can be further metabolized tolSR-lipoxin series by 5-LOX,
countering pro-inflammatory signals (Serhan et al. , 2002).

DHA and EPA inhibit ERK 1/2 activity in human T cells, macrophages and tumor
cells (Lo et al., 2000; Denys et al., 2001a; Denys et al., 2001b; Denys et al., 2002). Fatty
acids are known to modulate activity of signaling molecules such as phospholipase C and
protein kinase C (PKC) (May et al. , 1993; Hwang et al. , 1996). The molecular mechanism
for inhibitory action of (n-3) PUFAs on ERK 1/2 has been previously investigated in relation
to PKC (Denys et al., 2001a; Denys et al., 2001b; Denys et al., 2002). Notably, DHA and
EPA inhibit PKC a and e, which are known to be located at the upstream of MAP kinase
cascade (Clark and Murray, 1995). (n-3) PUFAs inhibit the enzymatic activity of theses

PKC isoforms either via direct interaction with phosphatidylserine binding site of PKC

l6

(N ishizuka, 1995) or indirectly by producing diacylglycerol-containing PUFA (Marignani
et al. , 1996). It should be also noted that (n-3) PUFA have been recently shown to suppress

ERK 1/2 activity through PKC-independent pathway (Denys et al. , 2002).

17

RESEARCH RATIONALE

DON is an unavoidable food toxicant frequently found in usual U.S. human diet and
causes acute and chronic inflammatory diseases such as circulatory shock-like syndrome and
IgA nephropathy in the animal model. The molecular mechanisms about the inflammation-
causing mediators need to be investigated in order to support better risk assessment of DON.
At the cellular level, a variety of trichothecene mycotoxins are known to activate MAPK
cascades via ribotoxic stress by inhibiting peptidyltransferase activity of 3'-end of 28S rRNA.
A question started in order to address the involvement of MAPK activation by DON in the
toxin-induced immunotoxicity. Altered MAPK signaling by ribotoxic stress could modulate
proinflammatory gene induction as well as cell death in response to chemical insults.
Particularly, this study has focused on MAPK-mediated COX-2 gene induction which is
expected to contribute to trichothecene-mediated inflammation. COX-2 is a rate limiting
enzyme in the inducible synthesis of prostaglandin endoperoxides. These lipid mediators are
critical components of the inflammation response such as acute shock and chronic nephritis.

Previous studies demonstrated the central role of pro-inflammatory IL-6 in DON-
induced shock and in IgAN. This thesis assessed the relationship between of DON-induced
COX-2 and IL-6 production. A positive association exists between endogenous COX-2
metabolites and IL-6 synthesis in vitro and in vivo in models of several inflammatory
diseases (Dendorfer et al., 1994; Meyer et al., 1994; Meyer et al., 1995; Anderson et al.,
1996; Hinson et al., 1996; Williams and Shacter, 1997; Zeng et al., 1998; Williams et al.,

2000). Moreover, PGE2 has been considered as one of the pivotal driving factors in the Th2-

l8

dominant immune response by polarizing Th2 cytokines (Betz and Fox, 1991 ; Kozawa et al. ,
1998; Kuroda et al. , 2000).

As an experimental probe, Fish oil was applied to test the hypotheses since PC has
been shown to alter MAPK signaling as well as COX-2 metabolism in several inflammatory
models. In addition, PC as a therapeutic agent is recently known to specifically suppress
DON-induced IgA nephropathy (Pestka et al. , 2002).

The guiding hypothesis for this thesis is that ribotoxic stress-mediated MAPK can
induce COX-2 gene which contributes to immunotoxicity of DON. Four specific aims were

proposed based on the hypotheses.

Aim 1. To test the hypothesis that DON modulates COX-2 gene expression via
ribotoxic-stress-mediated MAPK (Chapter 2).

Aim 2. To test hypothesis that other trichothecene families have similar inducible
effects on COX-2 gene in a global way (Chapter 3).

Aim 3. To test the hypothesis that COX-2 metabolites affect DON-mediated IL-6
production (Chapter 4).

Aim 4. To test the hypothesis that fish oil ameliorates COX-2 and IL-6 responses to

DON via MAPK signaling (Chapter 5).

l9

CHAPTER 2.

DON-INDUCED COX-2 EXPRESSION VIA MAPK PATHWAY '

 

 

1This work was published in the title “Vomitoxin-Induced Cyclooxygenase-2 Gene Expression in
Macrophages Mediated by Activation of ERK and p38 but Not IN K Mitogen-Activated Protein Kinases”
(Moon and Pestka, 2002) and highlighted in the same issue, “The ribotoxic stress response as a potential

mechanism for MAP kinase activation in xenobiotic toxicity” (Laskin et a1. , 2002).

20

ABSTRACT

Deoxynivalenol and other trichothecene mycotoxins mediate a broad range of
immunotoxic effects via the induction of inflammation-associated genes in leukocytes. The
purpose of this study was to test the hypothesis that DON induces cyclooxygenase-2 (COX-
2) gene expression in macrophages and that this is regulated at the level of mitogen-activated
protein kinases (MAPKs). Exposure of the murine macrophage cell line RAW 264.7 to 50
to 250 ng/ml DON for 24 hr markedly enhanced the production of prostaglandin E2 (PGE2),
a major COX-2 metabolite. PGE2 elevation was preceded by increases in COX-2 mRN A (2
hr) and COX-2 protein (15 hr) in DON-treated cells. DON induced rapid (15 min) and
persistent (up to 240 min) phosphorylation of extracellular signal regulated protein kinases
1 and 2 (ERK1/2) and p38 MAPK as well as a rapid (15 min) but transient (up to 60 min)
phosphorylation of c-J un N-terminal kinases l and 2 (JNK1/2). The ERK inhibitor PD98059
and p38 inhibitor 83203580 suppressed DON-induced PGE2 and COX-2 protein expression,
whereas impairment of JN K function by transient transfection with a dominant negative(dn)
JN K vector had no effect of COX-2 protein expression. Relatedly, in cells transfected with
a COX-2 promoter-luciferase construct, PD98059 and 88203580 but not dnJNK treatment
suppressed DON-induced luciferase transcription. DON also increased COX-2 mRN A
stability and this was inhibited by PD98059 but not 88203580. Taken together, these results
indicate that DON induced PGE2 production and COX-2 expression by elevating
transcriptional activity and mRN A stability. Enhanced transcriptional activity was modulated

by ERK and p38 signaling pathways whereas mRN A stability was promoted exclusively by

21

DON-activated p38 phosphorylation. These data provide insight into possible general
mechanisms by which DON and other trichothecenes up—regulate proinflammatory genes and

impart immunotoxicity.

22

INTRODUCTION

The trichothecene mycotoxins are a group of sesquiterpenoid fungal metabolites that
include some of the most potent eukaryotic protein synthesis inhibitors known (U eno, 1983).
Interest in the trichothecene mycotoxins arises from their widespread contamination of
agricultural commodities (Kotsonis etal., 1996), their recalcitrance to degradation during
milling or processing (Scott, 1990) and their adverse effects on human and animal health
(Bhat et al. , 1989; Peraica et al. , 1 999). Deoxynivalenol, a trichothecene mycotoxin produced
by F usarium graminearum and F. culmorum, is frequently found in grain-based agricultural
products, particularly in wheat and barley grown in the Midwestern United States (Abouzied
et al., 1991).

Animals exhibit feed refusal and weight loss upon chronic exposure to low dietary
DON concentrations, whereas acute high level exposure to DON can cause nausea, vomiting,
and leukocytosis in experimental animals (Rotter et al. , 1996). The immune system is
particularly susceptible to DON with macrophages, B cell, and T cells being highly sensitive
to the toxin (Bondy and Pestka, 2000). Notably, mice exposed to DON develop clinical signs
that mimic human IgA nephropathy (Dong et a1. , 1991). The broad spectrum of toxicity
found for DON and other trichothecenes is likely to relate, in part, to their capacity to evoke
production of proinflammatory mediators (Azcona-Olivera et al. , I995a; Azcona-Olivera et
al., 1995b; Zhou et al. , 1997; Ji et al. , 1998; Wong et al. , 1998; Zhou et al. , 1999; Wong et
al,2001)

Metabolites of arachidonic acid are known to play key roles in the proinflammatory

23

responses (Smith et al., 2000). Cyclooxygenase (COX) is the rate-limiting enzyme that
catalyzes the oxygenation of arachidonic acid to prostaglandin endoperoxides. These
metabolites are converted enzymatically into prostaglandins and thromboxane A2 which play
both physiologic and pathologic roles in a diverse array of inflammatory sequelae (Vane et
al., 1998; Smith et a1. , 2000). Two distinct isoforms of COX have been identified.COX-1
is constitutively expressed at low levels in most tissues and may be related with
housekeeping fiinction. In contrast, COX-2, a 70 kd protein, is strongly induced by rrritogenic
and proinflammatory stimuli, superinduced by protein synthesis inhibitors, and can be
regulated at both transcriptional and posttanscriptional levels (Fletcher et al. , 1992; Newton
et al. , 1997a; Newton et al. , 1997b; Newton et al. , 1998; Dixon et al. , 2000; Wadleigh et al. ,
2000)

Several inflammatory stimuli which induce COX-2 gene expression also activate the
mitogen-activated protein kinases (MAPKs). Among the MAPKs, c-Jun N-terminal kinases
1 and 2 (JNK1/2), extracellular signal regulated protein kinases 1 and 2 (ERK1/2), and p38
MAPK have been extensively studied relative to their regulation of COX-2 gene
expression(Xie and Herschman, 1995; Guan et al. , 1998; Ridley et al. , 1998; Scherle et al. ,
1998). Upon exposure to the prototypic inflammagen lipopolysaccharide (LPS),
transcriptional regulation of COX-2 gene expression is redundantly modulated by the three
MAPK families (Wadleigh et al. , 2000; Mestre et a1. , 2001) whereas p38 plays an important
role in the signaling pathway for the stability of COX-2 mRN A (Dean et al., 1999; Lasa et
aL,2000)

Several investigations have suggested that trichothecenes can increase arachidonic

acid metabolism and upregulate prostaglandin production (Shohami and Feuerstein, 1986;

24

 

Nansen
induces
trichotl
(Shifrir
hmoth
regulat
on C O
relate [
of C03
that M.

this ge

Naseem et al., 1989). Recently, we have determined that a single acute exposure to DON
induces COX-2 gene expression in the murine spleen (Islam et al., 2002). Furthermore,
trichothecenes have been suggested to activate MAPKs via a ribotoxic stress response
(Shifrin and Anderson, 1999; Yang et al. , 2000a). Based on these observations, we
hypothesized that DON induces COX-2 expression in macrophages and that this was
regulated at the level of MAPKs. The aim of this study was to (I) assess the effects of DON
on COX-2 mRN A and protein expression in the RAW 264.7 macrophage model and to (_2_)
relate DON-induced MAPK activation to transcriptional and post-transcriptional regulation
of COX-2 gene expression. The results indicate that DON induces COX-2 expression and
that MAPKs play critical roles in both transcriptional and post-transcriptional regulation of

this gene response.

25

MATERIALS AND METHODS

Cell culture. RAW 264.7 murine macrophage cells (American Type Culture
Collection, Rockville, MD) (2.5 x 105 per ml) were cultured in Dulbecco’s Modified Eagle’s
Medium (DMEM, Sigma Chemical Co., St. Louis, MO) supplemented with 10 % (v/v) heat-
inactivated fetal bovine serum (F BS, Atlanta Biologicals Inc, Norcross, GA), 100 Unit/ml
penicillin (Sigma), and 100 ug/ml streptomycin (Sigma, St. Louis, MO) in a 5 % CO2
humidified incubator at 37°C. Macrophage cell number and viability were assessed by trypan

blue (Sigma) dye exclusion using a hematocytometer as described by Strober (1991).

Prostaglandin EZ (PGE2) assay. PGE2 was measured using an EIA kit (Cayman
Chemical Co., Ann Arbor, MI). Cell culture supematants were collected 18 hr after DON
treatment. The aliquots were diluted 10-fold in fresh culture medium and the assays were

conducted according to the instructions of the supplier.

Western blot analysis. At the time of harvest, cells were washed with ice-cold
phosphate buffer, lysed in boiling lysis buffer (1% [w/v] SDS, 1.0 mM sodium ortho-
vanadate, and 10 mM Tris pH 7.4), and sonicated for 5 seconds. The amount of protein was
assayed by Lowry method using Dc protein assay reagent (Bio-Rad, Cambridge, MA).
Extracts (10 pg) were mixed with Laemmli sample buffer (Bio-Rad), and boiled for 5 min
before resolving on a 10 % (w/v) acrylamide gel. Resolved proteins were transferred to

PVDF membrane and blocked with Tris-buffered saline (10 mM Tris-HCl pH 7.5, 100 mM

26

NaCl) containing 0.1 % (v/v) Tween-20 and 1% (w/v) BSA (TBST-BSA). The membrane
was incubated for 1 hr with MAPK antibodies (rabbit IgG, New England Biolab, Beverly,
MA) at 1:1000 dilution or COX-2 antibody (mouse IgGl, Transduction Laboratories,
Lexington, KY) at 1:250 dilution in TBST-BSA, and then were washed three times with
TBST. The membrane was incubated with horseradish peroxidase (HRP)-conjugated anti-
rabbit IgG (Cell Signaling, Beverly, MA) at 1:5000 dilution in TBST-BSA for MAPK
detection or with HRP-conjugated anti-mouse IgG (Sigma, St. Louis, M0) at 1:10,000
dilution for COX-2 detection. After washing three times with TB ST, bound HRP-conj ugated
antibody was detected with Enhanced Chemiluminescence (EC L) kit (Amersham Pharrnacia

Biotech, Piscataway, NJ) according to manufacturer’s instructions.

Reverse transcription-competitive polymerase chain reaction (R T -cPCR). RNA was
extracted with Trizol reagent (Life Technologies, Gaithersburg, MD) according to the
manufacturer’s instructions. RNA (100 ng) from each sample was transcribed to cDNA by
reverse-transcriptase (Riedy et al. , 1995). COX-2 cDNA was amplified competitively with
a truncated COX-2 cDNA internal standard constructed by the bridging-deletion method
(Hall et al. , 1998). The amplification was performed in a 9600 Perkin Elmer Cycler (Perkin-
Elmer Corp., Norwalk, CT) using the following parameters: 30 cycles of reactions of
denaturation at 94 °C for 30 s, annealing at 56 °C for 45 s, and elongation at 72 °C for 45 s.
An aliquot of each PCR product was subjected to 1.5 % (w/v) agarose gel electrophoresis
and visualized by staining with ethidium bromide. Primers were synthesized at Michigan
State University Molecular Structure facility. The 5' forward and 3' reverse-complement PCR

primers for amplification of mouse COX-2 cDNA were ACACTCTATCACTGGCATCC

27

 

1111:
C C

CC

5C
prt

pl;

and GAAGGGACACCC'ITTCACAT, respectively. Sizes of amplified COX-2 cDNA
internal standard cDNA were 584bp and 500 bp, respectively. The densitometric ratio of
COX-2 cDNA / COX-2 internal standard was used to construct a standard curve to calculate

COX-2 cDNA concentrations in RT reaction products.

Plasmids and transfections. The 5‘ upstream segment (-724/ +7) of the mouse COX-2
gene from spleen chromosomal DNA was cloned into pXP2 (ATCC, Manasas, VA) at Hind
III/Xho I restriction sites to construct a mouse COX-2 promoter-luciferase plasmid (pXP-
SCOX2). An expression vector for the dominant negative JN K1 (dnJNK) was kindly
provided by Roger Davis (University of Massachusetts Medical School, Worcester, MA). All
plasmids were purified with Endofree Plasmid Prep Kit (Qiagen, Valencia, CA).

For transfections, RAW 264.7 cells (4x 105/ml) were washed twice in serum-free
DMEM and then incubated for 3 hr with a premixed complex of plasmid and lipopectamine
(Life Technologies, Gaithersburg, MD) according to manufacturer’s instructions. The cells
were then replaced with fresh serum-containing DMEM and incubated for 24 hr prior to

DON exposure. pCMV-B-gal (1 ug) (BD Biosciences Clontech, Palo Alto, CA) was also co-

transfected with 1 pg promoter-luciferase construct to standardize transfection efficiency.

JNK activity assay. For determination of JNK activity, cells (5x105) were washed
once with ice cold PBS and incubated for 5 minutes with 0.5 ml ice-cold lysis buffer (20 mM
Tris [pH 7.4] containing 150 mM NaCl, lmM EDTA, 1 mM EGTA, 1% Triton, 2.5 mM
sodium pyrophosphate, 1 mM B-glycerolphosphate, 1 mM Na3 V04, 1 [Lg/ml leupeptin, and

1 mM PMSF). After incubation, cells were harvested, sonicated, centrifuged at 14,000 rpm

28

in a microcentrifuge for 10 min and the supernatant was collected for the assay. c-Jun fusion
protein beads (20 pg, Cell signaling, Beverly, MA) were added to the supernatant (250 pl)
and the mixture was incubated with gently rocking overnight at 4°C. The bead complex was
collected, suspended and incubated with 100 pM ATP in kinase buffer (25 mM Tris (pH
7.5), 5 mM B-glycerolphosphate, 2 mM DTT, 0.1 mM Na3 V04, 10 mM MgC12) for 30 min
at 30°C. The reaction was terminated by Laemmli sample buffer and centrifuged. The
supernatant was analyzed by Western irnmunoblotting with phospho-c-Jun rabbit antibody

(Cell Signaling, Beverly, MA).

Luciferase and fl-galactosidase assays. Cells were washed with cold PBS, lysed with
lysis buffer (25 mM Tris-H3PO4, pH 7.8, 2 mM EDTA, 2 mM DTT, 10 % [v/v] glycerol, 1%
[v/v] Triton X-l 00) and then centrifuged at 12,000 xg for 2 min. Resultant supernatant was
stored at -80°C until assessment of luciferase activity and b-galactosidase. Luciferase activity
was measured with a luminometer (Model 20c, Turner Designs Co., Sunnyvale, CA) after
briefly mixing the supernatant with an equal volume Luciferase Assay Systems substrate
solution (Promega, Madison, WI). B-galactosidase activity was measured with B-
galactosidase Enzyme Assay Kit (Promega, Madison, WI). Luciferase activity was
normalized against B-galactosidase activity using the following formula: luciferase activity

/ B-galactosidase activity.

Statistics. Data were analyzed using Sigma Stat for Windows (J andel Scientific, San
Rafael, CA). For comparisons of two groups of data, Student’s t test was performed. For
comparisons of multiple groups of data a Kruskal-Wallis One Way Analysis of Variance on
Ranks was performed. Differences were considered significant if p < 0.05. Quantitative

results were expressed as mean 3: SEM.

29

 

I.

n:

RESULTS

Induction of COX-2 activity and gene expression by DON in RA W 264. 7 cells.

Since DON previously has been shown to induce proinflammatory cytokines as well
as nitric oxide and hydrogen peroxide in the RAW 264.7 macrophage cell line (Ji et al.,
1998), it seemed possible that COX-2 might be similarly induced. The effects of DON on
COX-2 activity and expression were therefore assessed in RAW 264.7 cells. Exposure to 50
to 250 ng/ml DON for 24 hr markedly enhanced the production of PGE2, one of the major
COX-2 metabolites (Fig. 2A). The veracity of the assay was confirmed using LPS which is
well known to induce COX-2 in macrophage cells including RAW 264.7 cells. To explain
PGE2 elevation by DON, protein and mRN A levels of COX-2 were measured using Western
blot analysis and RT-competitive PCR, respectively. Treatment with 100 and 250 ng/ml
DON for 15 hr caused dose-dependent increases of COX-2 protein (Fig. 2B). COX-2 mRN A
was also affected by 2 hr DON treatment (Fig 2C), the time point at which the mRN A level
was maximal (data not shown). Ratios of upper band (native cDNA) to lower band (internal
standard cDNA) corresponding to COX-2 mRN A were also increased by 100 and 250 ng/ml
DON treatment (Fig. 2C). Thus, DON markedly up-regulated COX-2 gene expression and

enzyme activity in RAW 264.7 cells.

Relationship of WK activation to DON-induced COX-2 expression.
MAPKs are known to be important signaling modulators in COX-2 expression and

these have been recently shown to be activated by trichothecene mycotoxins (Shifiin and

30

Anderson, 1999; Yang et al., 2000c). Therefore, the involvement of MAPK signaling
pathways in DON-induced COX-2 expression was investigated. When the effects of DON
on phosphorylation of ERK, p3 8, IN K were analyzed by Western blot analysis, the toxin was
found to enhance phosphorylation of all three MAPKs, with maximal effects being observed
15 to 30 min after 250 ng/ml toxin exposure (Fig. 3). ERK and p38 were persistently
activated (up to 240 min) whereas IN K phosphorylation was transient and not detectable
after 60 min. The levels non-phosphorylated MAPKs were unaffected by DON treatment.

Treatment with MAPK signaling inhibitors, PD98059 (an MEK1/2 inhibitor which
inhibits ERK activation) or SB203580 (a p38 MAPK inhibitor), significantly reduced DON-
induced PGE2 production (Fig. 4A). DON-enhanced COX-2 protein expression was also
down-regulated in the presence of these MAPK inhibitors (Fig.4B). Both PD98059 and
83203580 inhibited ERK and p38 activities, respectively, at the concentrations employed
without having cytotoxic effects (data not shown). COX inhibitors such as indomethacin and
NS-398 suppressed PGE2 production to vehicle levels (Fig. 4A). In contrast, indomethacin
did not decrease but rather enhanced COX-2 protein (Fig. 4B) which is consistent with
stabilization effects previously attributed to NSAIDS (Pang and Hoult, 1996; Callejas et al. ,
1999). As expected, the positive control LPS induced PGE2 and COX-2 expression.

JNK is also an important MAPK family that has been shown to influence COX-2
expression in several systems (Subbaramaiah et al. , 1998; Wadleigh et a1. , 2000; Yang et a1. ,
2000c). Inhibition with a dominant negative JN K expression vector (dnJN K) did not reduce
DON-induced COX-2 expression (Fig. 5). The effectiveness of treatment with dominant
negative JNK was verified by observing decreased phosphorylation of substrate c-Jun.

In total, these data suggest that activation of ERK and p38 MAPK but not JN K were

31

    
  

14 ~
12 4
10 q DON (rig/ml)

 

3 . at:

PGE2 (ng/ml)

 

 

DON (nglml) o 10 so 100 250

 

70 KD _.__

 

 

 

C

DON rim/ml o 10 50 100 250

Figure 2. Dose-response effects of DON on PGE2 and COX-2 gene expression in RAW
264.7 cells. Cells (2.5 x105/ml) were incubated for 24 hr (A), 15 hr (B), or 2 hr (C) and
analyzed by ELISA (A), Western blot analysis (B), or RT—competitive PCR (C). ELISA data
are mean +/- SE (n=5). NT and IS refer to native transcript and internal standard,

respectively. Asterisk indicates significant difference (p<0.05) from vehicle group. Results

are representative of at least three experiments.

32

Time 0 15 30 60 120 240 (min)

 

P-ERK1/2
“3“, ............._....... (p42, p44)

 

 

 

 

 

 

 

 

W..........~w-~ w P-p38

 

 

 

 

 

 

 

 

P-JNK‘l/Z

 

 

 

 

, JNK l2

 

 

 

Figure 3. Activation of MAPKs by DON in RAW 264.7 cells. Cells (2.5 x105/ml) were
incubated for each time point (0, 15, 30, 60, 120, and 240 min) with 250 ng/ml DON.
Cellular lysates were analyzed by Western blot analysis. Results are representative of three

experiments.

33

250 ng/ml DON

 

7000 -

 

6000 .
5000 -
4000 .

3000 -

PGEZ (pg/ml)

2000 -

 

1000 « *   f * *

 

 

 

 

 

 

 

 

COX-2

70kD F

DON (250 ng/ml) - + + + + -
P098059 (10 uM) - - + - - -
88203580 (2 pM) - - - + - -
lndomethacin(10 uM) - - - - + -
LPS(200ng/m|) - - - - - +

 

 

 

 

Figure 4. Involvement of MAPK (ERK and p3 8) in DON-induced COX-2 expression. (A)
cells (2.5 x105/ml) were treated with each chemical combination for 24 hr and PGE2 was
measured from the culture supernatant.(B) cells (2.5 X] 05/ml) incubated with each chemical
combination was collected for Western blot analysis of cellular lysate. ELISA data are mean
+/- SE (n=5). Asterisk indicates significant difference (p<0.05) from vehicle group. Results
are representative of three experiments.

34

Vehicle 250nglml DON

 

dnJNK pCMV5 dnJNK pCMV5

 

 

 

 

 

 

 

 

 

p --
p-c-Jun - .-... .-
COX-2 -.

 

 

 

Figure 5. Role of JNK in DON—induced COX-2 expression. After cells (2.5 x10le) were
transiently transfected with empty vector (pCMV5) or dnJNK-containing pCMV5. Cells
were incubated with 250 ng/ml DON for 30 min for p-IN K and p-c-Jun and 15 hr for COX-
2. Cellular lysate was analyzed for p-JNKl/Z and COX-2 by Western blot analysis. For
assessment of JNK activity, the capacity of lysates to catalyze phosphorylation of c-Jun was
assessed by immunoprecipitation in conjunction with Western blot analysis. Results are

representative of three experiments.

35

critical in DON-induced upregulation of COX-2 gene expression. The specific roles of these

MAPKs on COX-2 transcription and mRN A stabilization were therefore examined further.

Role of MAPKs in DON-induced transcriptional activation of COX-2 expression.

To analyze the effect of DON on COX-2 promoter activity, the 5' COX-2 promoter
region was cloned into a luciferase reporter vector (pXP2) system and the resultant plasmid
(pXP-5COX2) was transiently transfected into RAW 264.7 cells. DON at concentrations of
10 to 250 ng/ml significantly increased luciferase expression dose-dependently in the
transfected cells at 12 hr (Fig. 6). LPS (200 ng/ml) was used as the positive control because
it has also been shown to activate COX-2 promoter activity in RAW 264.7 cells (Paul et al. ,
1999; Wadleigh et al., 2000). In contrast, DON had no effect on luciferase activity in cells
transfected with the empty vector, pCMV5 (data not shown).

The involvement of MAPKs in DON-induced transcriptional activation was
investigated. The MAPK inhibitors (SB203580 or PD98059) significantly suppressed
luciferase reporter induction in DON-treated transfected cells (Fig. 7A and 7B). However,
JN K inhibition by dnJN K had no effect on elevated luciferase reporter expression by DON
(Fig. 7C), which was consistent with the above-described lack of effect on COX-2 protein
expression (Fig. 5).

Taken together, the results indicate that ERK and p38 MAPK activation by DON
contributed to transcriptional activation of the COX-2 gene, but JN K did not appear to be
involved in the COX—2 promoter activation by DON.

Role of p3 8 IMAPK in DON-inducedpost-transcriptional regulation of COX-2 expression.

Stability of mRNA is also a potentially important factor in COX-2 gene regulation.

36

d1

The direct effect of DON on the COX-2 mRNA stability was analyzed by measuring the
kinetics of mRNA decay after induction with 200 ng/ml LPS. Cells were collected at
intervals following transcriptional arrest by actinomycin-D (Act-D) with or without DON 3
hr after LPS induction (Fig. 8). Marked decay of COX-2 mRNA was observed after
transcriptional arrest in control cultures, whereas DON markedly delayed COX-2 mRNA
degradation (Fig. 8).

To specifically address the involvement of MAPK in the DON-enhanced mRNA
stability, the effects of MAPK inhibitors (PD98059 and SB203580) were evaluated when
COX-2 induction by DON was maximal (2 hr after DON exposure). After the maximal
induction, cells were arrested with Act-D in absence or presence of MAPK inhibitors.
Inhibition of ERK had no effect on COX-2 mRNA stability with observed half-lives
exceeding 8 hr (Fig. 9A). In contrast, COX-2 mRNA half-life was reduced to only 35 min
in the presence of p38 inhibitor SB 203580 (Fig. 9B). These results suggest that the p38
MAPK signaling pathway may be critical to COX-2 mRNA stability observed in DON-

treated RAW 264.7 cells.

37

A

-600 -400 +1 m ' A

     

MEF-2 NF-KB SP-1 AP-2 C/EBPfi CRE TATA

 

 

 

 

(NF-IL6)
B
120~
*-
100 “L
2:
IE
‘5
<5 80‘
CD
(I)
2
q)
E 60-
2
a:
.2 *
E 40—
0)
t!
20“ * *
* .
0 he. W. H fl
0 10

50 100 250 LPS

DON (ng/ml) + + + + + -
LPS (200ng/ml) - - - - - +

Figure 6. Effect of DON on COX-2 promoter activity. (A) Gross map of murine COX-2
promoter. (B) pXP-5COX2 transfected cells were treated with vehicle or DON for 12 hr and
cell lysates were analyzed for luciferase assay. Data are mean +/- SE (n= 3). Asterisk
indicates significant difference (p<0.05) from vehicle group. Results are representative of

three experiments.

38

Figure 7. Involvement of MAPK in DON-induced activation of COX-2 promoter. Cells
transfected with pXP-5COX2 were treated with or without DON or MAPK inhibitors
(SB203580 [5 pM] or PD98059 [15 pM]) for 12 hr (A and B), respectively. For dominant
negative JN K expression, cells were also co-transfected with pCMV5 or pdnJN K and then
treated with DON for 12 hr (C). All cell lysates were analyzed for luciferase assay. Data are
mean +/- SE (n=3). Asterisk indicates significant difference (p<0.05) from vehicle group.

Results are representative of three experiments.

39

 

 

 

 

A ,3: 120 i
.3 A 100
8s
(D (U 60 4‘
’5 E t
3 “5 40 i -
E V 2° ‘1
‘1’ I .
II 0 ,. _.._
DON (250ng/ml) - + +
SB203580 (5uM) - - +
120
:2: A 100
B 8 E i
s 2 8°
9 ‘>‘< *
:g g 60 \
go: 40 1
i; 20 i
‘1 i
o ,
DON (250ng/ml) - + +
P098059 (20pM) - - +
120 pCMV5 pCMV5-dnJNK
g 100 .
a g ‘
C gg 80
a a 60 <
1:, e
2 “5 40 -
2 s
E " 20 -
(I)
0: o .
DON (250ng/ml) - + - +

Figure 7

 

100 -

 

 

 

+ 10 jig/ml Act-D
“-0-“ 10 ug/ml Act-D
+250ng/ml DON

 

 

 

|og(% of remaining COX-2 mRNA)

 

 

10 I I I I I I
O 2 4 6 8 10 12

 

Figure 8. Effect of DON on COX-2 mRNA stability following LPS induction. Cells (2.5
x105/ml) were treated with 200 ng/ml LPS and then transcription was arrested with 10 pM
actinomycin D in absence or presence of 250 ng/ml DON for specific periods (0, 2, 4, 6, 8,
or 10 hr). After RT-competitive PCR with cellular RNA, cDNA was separated by agarose
electrophoresis and DNA bands were quantified by image analysis. Results are representative

of three experiments.

41

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2
z 100 -
0:
E
N
x
C)
g) 50 - ............................
C»
.E
.E
(U
E
8
° + DON+PD98059
c}: —v— DON
O)
.9
10 f I W I I
0 2 4 6 8
hours after Act-D treatment
2
z
a: 100 ~
E
‘7‘
><
O
O 50 ...........................
O
.5
.5
m
E
9
“5
§ + DON+88203580
or —v— DON
.2
10 fl .

 

 

 

0 20 40 60 80 100 120 140
minutes after Act-D treatment

Figure 9. Role ofMAPK in DON-induced COX-2 mRN A stability. Cells (2.5 x105/ml) were
activated with 250 ng/ml DON for 2 hr and then transcription was arrested with 10 pM
actinomycin D in absence or presence of (A) MEK inhibitor PD98059 (15 pM) or (B) p38
inhibitor SB203580 (5 pM). Samples were analyzed as described in Fig. 8 legend. Results

are representative of two experiments.

42

DISCUSSION

This is the first report that a trichothecene can directly induce COX-2 gene expression
in macrophages. This result is significant because induction ofCOX-2 metabolites including
the prostaglandins and thromboxanes are well-known mediators of various inflammatory
manifestations as well as immunological disorders such as hypersensitivity and autoimmune
diseases (Myers et al., 2000; Pang, 2001; Sarnad et al., 2001). Our findings are consistent
with previous reports that several kinds ofCOX-2 products such as PGE2, TXB2 and 6-keto-
FGFla are elevated following treatment with the trichothecene T-2 toxin, and that these
effects are associated clinical responses which resembled bacterial endotoxenria (Shohami
and F euerstein, 1986; Shoharni et al., 1987). Further critical finding in this study was the
establishment of a definitive link between DON-activated MAPK and DON-induced COX-2
expression at the transcriptional and post-transcriptional levels (Fig. 30). These results are
partially consistent with the observations that, in LPS-stimulated macrophages, MAPKs can
affect COX-2 gene expression by altering both transcriptional activity and mRN A stability
(Smith et al., 2000; Vogel, 2000).

The DON concentrations used here to alter COX-2 or luciferase expression are
consistent with levels of the toxin found in plasma and tissues of mice that had been treated
orally with sufficient DON to upregulate COX-2 expression (Islam et al. , 2002) or
proinflammatory cytokine expression in the spleen (Azcona-Olivera et al., 1995a; Zhou et
al., 1997). In the latter study, concentrations of DON equivalents in spleen 0.5 to 8 hr after

exposure to 5 mg DON/kg body weight were 680 to 106 ng/ml, respectively. Thus, the

43

effective DON concentrations observed here (10 to 250 ng/ml) are physiologically relevant
to previous studies in mice. Since DON carry-over into plasma in people exposed to the
toxin has not been studied to date, it is not possible to directly relate the in vitro
concentrations employed herein to humans. It should be further noted that although DON
is a translational inhibitor, protein synthesis is only partially inhibited by DON at 100-250
ng/ml (Yang et al., 2000a). Thus it appears that the increase in COX-2 mRNA pool is
sufficient to drive increased COX-2 protein translation even in the face of overall depression
in protein translation.

The dose response study on PGE2 production after 24 hr suggests that the effects
were non-linear in that levels of this metabolite were identical at 100 and 250 ng/ml DON
(Fig. 1). This contrasts with the 15 hr COX-2 protein and 2 hr COX-2 mRNA data which
both increased as the DON dose increased from 50 to 250 ng/ml. The PGE2 threshold effect
may relate to the fact that supernatant PGE2 reflects not the only sum total ofCOX-2 mRN A
expression and translational efficiency but also substrate availability, receptor binding and
metabolism by the cells. Another possibility is that this effect is a reflection of DON
cytotoxicity. Using the 3-(4,5-di-methylthizol-2-yl)-2,5 diphenyltetrazolium bromide (MTT)
assay, we have found after 24 hr that while 100 ng/ml of DON or less had no effect, 250
ng/ml typically inhibits the maximal response by 5 to 20 percent (data not shown). The
capacity of DON to partially inhibit cell proliferation and/or reduce viability at the highest
concentration is consistent with this toxin’s inhibitory effects on translation. Thus, it is
possible that even if the amount of COX-2 protein per cell was higher in the 250 ng/ml DON
treatment, the decreased cell number may contribute to the lack of change in PGE2

compared to the lower toxin dose. This effect might not have been observed in COX-2

protein and mRN A measurements because these employed equivalent concentrations of the
respective extracted macromolecules rather than represent a culture aliquot as does the MTT
assay.

Several intestinal tumor studies have suggested mitogen-activated protein
(MAP)/extracellular signal-regulated kinase (ERK) kinase (MEK)1/2 and its downstream
ERK signaling pathway are essential for both increased transcription and stability of COX-2
mRNA of K-Ras-induced COX-2 (Zhang et al., 2000; Sheng et al., 2001). ERK 1/2
activation by DON was clearly involved in the transcriptional regulation of COX-2
expression but did not contribute to the mRNA stability. DON-activated ERK 1/2 may be
critical upstream signals regulating transcription factors rather than contributing to mRNA
stability. Notably, ERK1/2 are crucial upstream kinases of CCAAAT/enhancer-binding
protein-beta (C/EBPB) and CAMP response element binding protein (CREB), which are
major transcriptional factors involved in murine COX-2 expression (Davis et al. , 2000; Hu
et al. , 2001). Consistent with such activity, we have recently observed that C/EBPB binding
activities in RAW 264.7 cells was increased 2 and 8 hr after DON exposure (Wong et al. ,
2002). It is thus possible that DON-induced ERK activity contributes to increased activation
of C/EBPB and other transcription factors.

p38 is also known to mediate xenobiotic- or endogenous factor-induced COX-2
expression by transcriptional and post-transcriptional mechanisms (Fiebich et al., 2000;
Vogel, 2000; Yan et al., 2000). As shown here, p38 contributed to DON-induced COX-2
expression by both mechanisms. DON-induced transactivation of the COX-2 gene may result
fiom p3 8—mediated activation ofNF-KB and AP-l. Activation of these transcription factors

by p38 has been described in LPS-exposed macrophages (Chen et al. , 1999). This possibility

45

is supported by our recent observation that DON exposure also increases AP-l and NF -KB
activation in RAW 264.7 cells (Wong et al., 2002).

Relative to p3 8 and post-transcriptional mechanisms, the presence of multiple copies
of AUUUA pentamer in the 3'-untranslated region (U TR) of COX-2 mRNA suggests the
involvement of mRN A stability in the DON-induced upregulation of the gene. Some proteins
such as AUFl , HuR, or tristetraprolin can differentially regulate COX-2 or cytokine mRN A
stability by binding to the regulatory AU-rich elements (Sirenko et al., 1997; Dixon et al.,
2000; Dixon et al., 2001; Nabors et al., 2001; Zhu et al., 2001). Notably, binding of
tristetraprolin, a member of a family of zinc finger proteins, is suppressed by p3 8-mediated
phosphorylation (Zhu et al., 2001). The observation that COX-2 mRNA stabilization via
DON-activated p38 may be an important clue to global mechanisms of trichothecene-induced
proinflammatory gene expression.

DON also activated JNK, which was transient relative to the other two MAPK
families. Macrophage cells require the activation of JNK/MEKKI in LPS-induced COX-2
transcription (Wadleigh et al. , 2000) and, more specifically, blocking JN K impairs both NF-
KB- and C/EBPB-mediated transcription of COX-2 (Mestre et al., 2001). In contrast, our
results showed that blocking JN K activity with dnJN K did not affect DON-induced COX-2
expression. It is possible that, in the case of DON, the activated MAPK network functions '
redundantly in upregulating COX-2 gene transcription. In this case, impairment of JNK,
might be overcome by alternate pathways involving ERK and p3 8.

Interestingly, trichothecenes are also thought to induce leukocyte apoptosis via the
p38 and JNK signaling pathways (Shifiin and Anderson, 1999; Yang et al., 2000a). The

DON concentrations employed here to induce COX-2 expression were non-cytotoxic to

46

weakly cytotoxic. The possibility exists that trichothecene concentration may selectively
dictate which MAPKs are activated and to what degree. The resultant effects may ultimately
determine whether a cell generates a proinflammatory gene response or undergoes apoptosis.
Further evaluation of how trichothecenes differentially regulate these two responses is
warranted.

The potential exists that eicosanoid production may contribute to acute and chronic
toxic effects associated with acute exposure to DON and other trichothecenes. Sub-chronic
feeding of DON to mice results in a spectrum of immunologic effects including some
manifestations that mimic human IgA nephropathy, an immune complex disease (Dong et
a1. , 1991 ). Relative to the latter, DON enhances polyclonal autoreactive immunoglobulin A
which deposit in the kidney mesangium (Rasooly et al., 1994; Rasooly and Pestka, 1994).
Of critical importance is the capacity of DON elevating IL-6 expression, which is a critical
mediator in the DON-induced IgA production (Zhou et al. , 1999; Pestka and Zhou, 2000).
PGE2 is known to enhance IL-6 in several inflammatory models such as endotoxemia,
airway inflammation, and autoimmune arthritis (Meyer et al. , 1995; Anderson et al. , 1996;
Tavakoli et al. , 2001). In contrast, PGE2 selectively impairs the production of IFNy and Th1
immune function in both human and murine T cell models (Betz and Fox, 1991; Snijdewint
et al. , 1993). PGE2 suppresses interleukin-12 (IL-12) p70 heterodirner, a major Th1 -driving
cytokine, whereas it participates in the induction of IL-12 p40, which can function as
antagonist of biologically active IL-l2p70 thus favoring a Th2 response (Kalinski et al.,
2001). Interestingly, we have previously shown that DON induces IL-12p40 but not IL-12
p35 which would be inherently required for an increase in functionally active IL-12p70

(Zhou et al. , 1997). Thus, it is feasible that DON-induced PGE2 production might alter an

47

optimal balance between Th1 and Th2 and drive increased IgA production that is observed
in the sub-chronic feeding models.

Although COX-2 induction can be related to adverse effects such as tissue damage,
COX-2 also can play protective role in gastrointestinal inflammation (Langenbach et al.,
1999a; Langenbach et al. , 1999b; Morteau, 1999; Morteau et al. , 2000). It has been reported
that COX-2-dependent arachidonic acid metabolites are essential modulators of the intestinal
immune response to dietary antigens by promoting oral tolerance (Morteau, 1999; Newberry
et al. , 1999). Moreover, COX-2 products can be very important in the resolution of late stage
inflammation and may specifically involve an alternate set of prostaglandins such as those
of the cyclopentenone family (Morteau, 1999). Consistent with this observation, COX-2
knockout mice exhibit increased susceptibility to chemical-induced colitis (Morteau et al. ,
2000). Therefore, the up-regulation of COX-2 and its metabolites by DON as described
herein might be interpretable as a protective defensive mechanism or compensatory stress
response.

The mechanisms by which DON induces MAPK phosphorylation are unknown.
Trichothecenes (Shifiin and Anderson, 1999; Yang et al., 2000a) and other translational
inhibitors (Iordanov et al. , 1997) which bind to eukaryotic ribosomes have been previously
shown to activate MAPKs. Iordanov observed that anisomycin and other antibiotics that
bind to 28S rRNA are potent activators of IN K (Iordanov et al. , 1997). Furthermore, two
ribotoxic enzymes, ricin A chain and alpha-sarcin, both of which catalyze sequence-specific
RNA damage in the 28S rRNA, are strong agonists of JNKl and of its activator
SEKl/MKK4. Anisomycin and the ribotoxic enzymes initiate signal transduction from the

damaged 28S rRNA to JNK in active ribosomes but not inactive ribosomes.

48

These investigators described this capacity of the ribosomes to sense cellular stress as the
“ribotoxic stress response”. The possibility exists that DON’s capacity to activate MAPKs
reflects a ribotoxic stress response and that this is manifested in transcriptional and post-
transcriptional upregulation of COX-2 mRN A.

In conclusion, the results presented herein revealed that DON induced PGE2
production and COX-2 expression by elevating transcriptional activity and mRN A stability.
Enhanced transcriptional activity was modulated by ERK and p38 signaling pathways
whereas mRN A stability was promoted exclusively by DON-activated p3 8 phosphorylation.
Future studies will be directed toward identifying MAPK-regulated transcription factors and
stabilizing factors binding to 3'-UTR of DON-induced COX-2 gene. Additional investigation
is needed at the in viva level relative to the role of COX-2 products in DON-induced

immunopathogenic and physiological sequelae.

49

CHAPTER 3.
RELATIONSHIP OF TRICHOTHECENE STRUCTURE
TO COX-2 INDUCTION : SELECTIVE ACTION

OF TYPE B (8-KETO) TRICHOTHECENES‘

 

1 Most part of his work is in press for publication in of the title “Relationship of Trichothecene
Structure to COX-2 Induction in the Macrophage: Selective Action of Type B (8-keto) Trichothecenes” by

Moon, Y., Uzarski, R., and Pestka, J. J. in Journal of Toxicology and Environmental Health (2003).

50

ABSTRACT

The mycotoxin deoxynivalenol (DON, vomitoxin) induces COX-2 expression by
promoting transcriptional activity and mRN A stability via mitogen activated protein kinase
(MAPK) signaling pathways. Based on this model, representative members of the thee major
trichothecene families (A, B, and D) were compared for COX-2 induction using the murine
macrophage RAW 264.7 cell line. When treated with concentrations inhibiting viability
response using 3-[4,5-dimethylthiazol-2—yl]-2,5-diphenyltetrazolium bromide (MTT) by 20%
(mm), Type B trichothecenes including DON, 15-acetyl DON, 3-acetyl DON and fusarenone
X were very effective inducers of COX-2 mRNA expression whereas Type A and Type D
trichothecenes had, markedly less effect. To compare transcriptional effects on COX 2
expression, luciferase reporter vectors containing 5' promoter or 3'-untranslated regions of
the gene, respectively, were transfected into RAW 264.7 cells and the effects of various
trichothecenes on luciferase activities were measured. At equitoxic concentrations, Type B
but not Type A or D toxins typically enhanced luciferase activities indicating preferential.
COX-2 transcriptional activation and mRNA stabilization by this subset. Type B
trichothecenes also activated the three major MAPK families At ID20 concentrations whereas
type A and D did not. Blocking ERK and p38 with chemical inhibitors significantly
suppressed Type B-induced COX-2 expression. Although JNK has been well known to
contribute to COX-2 expression in the other models, transfection with the dominant negative
JNK vector did not diminish COX-2 expression. Additionally, PDTC (pyrrolidine

dithiocarbamate), an inhibitor of nuclear factor-KB (NF-KB) activation, completely

51

suppressed COX-2 induction, suggesting the involvement of the NF-KB signaling pathway
in the trichothecene-induced COX-2 expression. Taken together, the Type B trichothecenes
were strong inducers of inflammatory COX-2 gene and this induction was likely to be due
to both enhanced transcription and stabilization of the gene. Furthermore, the ERK 1/2 and
p38 signaling pathway, as well as NF-KB activation appeared to mediate the trichothecene-
induced COX-2 expression. Selective action on COX-2 is likely to contribute to Type B

trichothecene-mediated immunotoxicity.

52

INTRODUCTION

The trichothecene mycotoxins are a group of over 180 sesquiterpenoid fungal
metabolites produced by various species of F usarium, Myrotecium, Cephalosporium,
Verticimonosporium, and Stachybotrys , which include some of the most potent eukaryotic
protein synthesis inhibitors known (U eno, 1985). These fungal metabolites are characterized
by a tetracyclic scirpenol ring system (Table 2) and categorized into four subtypes based on
the presence or absence of specific functional groups (U eno, 1983). Three of these subtypes,
Type A, B, and D, have great potential risk to human and animal health and therefore, will
be the focus of this study. Type A trichothecenes are characterized by a hydroxyl or acyl
moiety at R,, R2, R3 or R5 position (Table 2). Type B family possesses a ketone group at R5
in addition to the derivation of Type A trichothecene. Macrocyclic Type D trichothecenes
contain a diester or triester ring structure bridging between R2 and R3 positions (Jarvis,

1991).

The structure-activity relationship oftrichothecenes has been broadly investigated in
terms of their toxicity. It is generally considered that Type A trichothecenes tend to be more
toxic than type B with decreasing order of toxicity from isovaleryl > hydrogen > hydroxyl
related to the substitution of the R5 (Rotter et al. , 1996). The translational inhibitory activity
of trichothecenes requires the presence of an intact 9,10-double bond and the C-12,13

epoxide and substitution of both R1 and R2 predominantly inhibit polypeptide chain initiation
(Ehrlich and Daigle, 1987). Moreover, the rank of potency for in vitro inhibition of

lYl‘nphocyte proliferation is macrocyclic type D > type A group > type B group, and the

53

degree of acylation in substituents determines the lyrnphotoxicity of the Type A and B
(Bondy and Pestka, 2000). Interest in the trichothecene mycotoxins arises from their
widespread contamination of agricultural commodities (Kotsonis et al., 1996), association
with water-damaged buildings (Sudakin, 1998), recalcitrance to degradation (Jackson and
Bullerman, 1999), and adverse effects on human and animal health (Peraica et al., 1999).
This family of mycotoxins causes multiorgan effects including emesis and diarrhea, weight
loss, nervous disorders, cardiovascular alterations, immunodepression, hemostatic
derangements, skin toxicity, decreased reproductive capacity, and leukocytosis (Ueno et al. ,
1984; Ueno, 1985; Peraica et al., 1999). Experimentally, acute oral exposure to
trichothecene mycotoxins causes severe damage to actively dividing cells in bone marrows,
lymph nodes, spleen, thymus, and intestinal mucosa. Thus, the immune system might be a
primary target for trichothecenes (Bondy and Pestka, 2000). In general, high doses of
trichothecenes induce apoptotic cell death in lymphoid tissues whereas proinflammatory
mediators such as cytokine, chemokine, and eicosanoids can be up-regulated by low doses
of toxins (Marin at al. , 1996; Shifiin and Anderson, 1999; Yang et al. , 2000a; Sugita-Konishi
and Pestka, 2001; Islam et al., 2002).

Cyclooxygenase (COX) is the rate-limiting enzyme that catalyzes the oxygenation
of arachidonic acid to prostaglandin endoperoxides. These are converted enzymatically into
prostaglandins and thromboxane A2 which play both physiologic and pathologic roles in
diverse inflammatory sites (Vane et al. , 1998; Smith et al. , 2000). Two distinct isoforms of

COX have been identified. COX-l is constitutively expressed at low levels in most tissues
and may be related with housekeeping function. In contrast, COX-2 resembles an early

response gene. It is strongly induced by mitogenic and proinflammatory stimuli,

54

superinduced by protein synthesis inhibitors, and regulated at both transcriptional and post-
transcriptional levels (Fletcher et al., 1992; Newton et al., 1997a; Newton et al., 1997b;
Newton et al., 1998; Dixon et al., 2000; Wadleigh et al., 2000).

Several inflammatory stimuli which induce COX-2 gene expression also activate the
mitogen-activated protein kinases (MAPKs). Among the MAPKs, c-Jun N-terminal kinase
1 and 2 (JNKl/2), extracellular signal regulated protein kinase 1 and 2 (ERKl/2), and p38
MAPK have been extensively studied for COX-2 gene expression (Xie and Herschman,
1995; Guan et al., 1998). The transcriptional activity of COX-2 gene expression is
redundantly modulated by MAPK (Wadleigh et al. , 2000; Mestre et al. , 2001) and typically
p38 MAPK plays an important role in the signaling pathway for the stability of COX-2
mRNA (Dean et al. , 1999; Lasa et al., 2000).

Nuclear Factor kappa B (N F-KB)/Rel-related signaling pathway also has been
implicated in the induction of COX-2 gene expression in various types of cells (Hwang et
al. , 1997; Inoue and Tanabe, 1998; Smith et al. , 2000). Most NF-KB/Rel dimers are bound
to IKBS and retained in the cytoplasm. Phosphorylation of IKB by IKB kinase (IKK) complex
lead to the ubiquitination of [KB and release the NF-KB/Rel dimers which translocate to the
nucleus for transcriptional regulation of COX-2 gene (Perkins, 2000). Deoxynivalenol is
known to activate NF-KB transcription factors, which may contribute to cytokine gene
regulation in T cells (Ouyang et al., 1996; Wong et al. , 2002).

Recently, we determined that the trichothecene deoxynivalenol (vomitioxin, DON)
can induce COX-2 expression and that this was related to activation of MAPKs (Moon and
Pestka, 2002). The purpose of this study was to relate the structure of representative

members of the Type A, B and D trichothecene families to the capacity to induce COX-2

55

gene expression transcriptionally and post-transcriptionally. Furthermore, MAPK and NF-
KB/Rel signaling pathways were related to potential upstream regulation of COX-2 gene

expression.

56

MATERIALS AND METHODS

T richothecenes. Satratoxins F,G and H were obtained from Dr. Bruce Jarvis
(University of Maryland). Acetyl-T-Z, HT-2, 3'-OH T-2, and 3'-OH HT-2 were kindly
supplied by Dr. Takumi Yoshizawa (Kagawa University, Japan). All other trichothecenes
were obtained from Sigma Chemical Co. (St. Louis, MO). Personnel handling concentrated
trichothecenes wore gloves and face masks. Contaminated labware and benchtops were
detoxified in dilute sodium hypochlorite (Thompson and Wannemacher, 1986). Waste
materials were disposed through the toxic waste unit of the MSU Office of Radiation,

Chemical and Biological Safety.

Cell culture. The murine macrophage cells, RAW 264.7 cells (American Type
Culture Collection, Rockville, MD) (2.5 x 105 per ml) were cultured in Dulbecco’s Modified
Eagle’s Medium (DMEM, Sigma Chemical Co., St. Louis, MO) supplemented with 10%
(v/v) heat-inactivated fetal bovine serum (FBS, Atlanta Biologicals Inc, Norcross, GA), 100
unit/ml penicillin (Sigma), and 100 pg/ml streptomycin (Sigma, St. Louis, MO) in 5% CO2
incubator at 37°C. Macrophage cell numbers and viabilities were assessed by trypan blue
(Sigma) dye exclusion using a hematocytometer (American Optical, Buffalo, NY) as

described by Strober (1991).

Cytotoxicity assay (MT T assay). MTT (3-[4,5-dimethylthiazol-2-ylj-2,5-

diphenyltetrazolium bromide) is a pale yellow substrate that is cleaved by living cells to yield

57

a dark blue formazan product. This process requires active mitochondria, and even freshly
dead cells do not cleave significant amounts of MTT. Decrease in MTT reduction reflects
the loss of cell viability. Cells (2x105/ml) were treated with each dose of chemicals for 18
hours in 96 well plates (200 ml medium/well) and then 20 ml of 5 mg/ml MTT was added
to each well. After 3 hour incubation at 37°C, plate was centrifuged at 600 rpm for 10 min,
and the culture medium was removed from the wells. The remaining crystals was dissolved
with 150 pl DMSO and then incubated on the shaker for 5 min to thoroughly solubilize the
formazan product. The absorbance of each well was measured at 540 nm using a plate reader.
ID20 was calculated based on MTT assay, corresponding to the trichothecene dose causing

20% decrease in MTT reduction.

DNA fragmentation analysis Cells (2x10°) were harvested at 500 xg for 5 nrin at
4°C. Pellet was suspended in 100 pl hypotonic lysis buffer (1 OmM Tris-Cl, 10 mM EDTA,
and 0.5% Triton X-100 at pH8) and incubated 10 min at 4°C. The resultant lysate was
centrifuged at 13,000 xg for 30 min at 4°C and supernatant was digested for 1 hr at 37 °C
with 0.4 mg/ml DNase-free RN ase (Boehringer Mannheim, Indianapolis, IN). The mixture
was then incubated an additional hour at the same temperature with 0.4 mg/ml proteinase K
(Boehringer Mannheim, Indianapolis, IN). DNA was precipitated in 50 % (v/v) isopropanol
in 0.5 M NaCl at -20°C overnight. The precipitate was centrifirged at 13,000 xg for 30 min
at 4 °C. The resultant pellet was air-dried and resuspended in 10 mM Tris, pH 7.4, and 1 mM
EDTA, pH8.0. An aliquot equivalent to 2x10° cells was electrophoresed at 70 V for 2 hr in
2% (w/v)agarose gel in 90 mM Tris-borate buffer containing 2 mM EDTA, pH 8.0. After

electrophoresis, the gel was stained with 0.5 mg/ml ethidium bromide, and the nucleic acid

58

were visualized with a UV-transilluminator. A 100 bp DNA ladder (GIBCO-BRL,

Rockville, MD) was used for size marker (SM).

Western blot analysis. At the time of harvest, cells were washed with ice-cold
phosphate buffer, lysed in boiling lysis buffer ( 1% (w/v) SDS, 1.0 mM sodium ortho-
vanadate, and 10 mM Tris pH 7.4), and sonicated for 5 seconds. The amount of protein was
assayed by Lowry method using Dc protein assay reagent (Bio-Rad, Cambridge, MA).
Extracts were mixed with Laemmli sample buffer (Bio-Rad, Cambridge, MA) and boiled for
5 min before resolving on a 10 % (w/v) acrylarnide gel. Resolved proteins were transferred
to PVDF membrane and blocked with Tris-buffered saline with Tween-20 (TBST, 10 mM
Tris-HCl pH 7.5, lOOmM NaCl, 0.1 % (v/v) Tween-20) containing 1% (w/v) BSA. The
membrane was incubated for 1 hour with each MAPK antibody (Rabbit IgG, New England
Biolab, Beverly, MA) at 1:1000 dilution or COX-2 antibody (mouse IgG], Transduction
Laboratories, Lexington, KY) at 1 :250 dilution in TBST containing 1% (w/v) BSA, and then
were washed three times with TBST. The membrane was then incubated with horseradish
peroxidase (HRP)-conjugated anti-rabbit IgG (Cell Signaling, Beverly, MA) at 1:5000
dilution in TBST containing 1% (w/v) BSA for MAPK detection or with HRP-conjugated
anti-mouse IgG (Sigma, St. Louis, M0) at 1:10,000 dilution for COX-2 detection. After
washing three times with TBST, bound HRP-conj ugated antibody was detected with
Enhanced Chemiluminescence (ECL) kit (Amersham Pharrnacia Biotech, Piscataway, NJ)

according to manufacturer’s instructions.

Plasmids. The 5' upstream segment (-724/ +7) of the mouse COX-2 gene from spleen

59

chromosomal DNA was cloned into pXP2 vector at Hind III/Xho I restriction sites to
construct a mouse COX-2 promoter-luciferase plasmid (pXP-SCOXZ). The 3' untranslated
regions (3'-UTR, l/ 1558, 1/338 and 339/1558 from coding terminal sequence) of COX-2
gene were cloned into pGL3 control vector (pGL3 c) at XbaI site to construct pGL3 COX2a,
pGL3COX2b, and pGL3COX2c, respectively. An expression vector for the dominant
negative JN K1 (pdnJN K) was kindly provided by Roger Davis (Unversity of Massachusetts
Medical School, Worcester, MA). All plasmids were purified with Endofree Plasmid Prep

Kit (Qiagen, Valencia, CA).

Transient transfection. Raw 264.7 cells (4x 105/ml) were washed twice in serum-free
DMEM and then incubated for 3 hours with a premixed complex of plasmid, plus reagent
and lipopectamine plus (Life Technologies, Gaithersburg, MD) according to manufacturer’s
instructions. The cells were then replaced with fresh serum-containing DMEM and incubated
for 24 hours and an additional time of DON exposure. pCMV-B-gal (1 pg) as internal
standard was also co-transfected with 1 pg promoter-luciferase construct to standardize

transfection efficiency.

Luciferase assay and fl-galactosidase assay. Cells were washed with cold PBS, lysed
with lysis buffer (25mM Tris-H3PO4, pH 7.8, 2 mM CDTA, 2 mM DTT, 10 % (v/v) glycerol,
1 % (v/v) Triton X-100) and then centrifuged at 12,000 xg for 2 min. The supernatant was
collected isolated and stored at -80°C until assessment of luciferase activity and b-
galactosidase. Luciferase activity was measured with luminometer (Model 20c, Turner

Designs Co., Sunnyvale, CA) after briefly mixing the supernatant with luciferase assay

60

substrate solution (Promega, Madison, WI). For B-galactosidase assay, the supernatant was
mixed with same volume of 2x assay buffer (Promega, Madison, WI) and the mixture was
incubated at 37 °C for 30 min. The reaction was stopped by adding 1 M sodium carbonate
(the equal volume with the assay buffer) and the absorbance of the mixuture was read at 420
nm. The luciferase activity was normalized against B-galactosidase activity using the

following formula: luciferase activity / B-galactosidase activity.

Statistics. Data were analyzed by Student’s T test using the SigmaStat Statistical

Analysis System (Jandel Scientific, San Rafael, CA, USA). A p value of less than 0.05 was

considered statistically significant.

61

RESULTS

Normalized concentration of each trichothecene were used to compare their effects
on COX-2 induction. Each toxin was applied at the dose which does not interfere with
significant cellular viability and we determined each 20 % inhibitory dose (IDzo) of
trichothecenes, based on MTT conversion assay for cytotoxicity (Table 2). Consistent with
previous blastogenesis studies employing 34-thymidine (Pestka and Forsell, 1988), Type D
macrocyclic trichothecenes were most cytotoxic and Type B toxins were relatively less
cytotoxic than other two groups of toxins here. A comparable study reports that the
cytotoxicity of trichothecenes in macrophages occurs through apoptosis process with the
similar rank order among trichothecene groups (Yang et al. , 2000a). In contrast to apoptosis
or cytoxicity at high concentration, exposure to low levels of trichothecenes appears to
promote expression of a diverse array of cytokines in vivo and in vitro (Bondy and Pestka,
2000). In the case of a variety spectrum of deoxynivalenol, it started to induce apoptotic
ladder, which corresponds to about 80 % MTT viability (Fig. 10A and B). Therefore, this
dose criteria might be a critical point to cellular death signals. The ID20 values was
subsequently used to prevent the wide-scale cytotoxicity or apoptosis on the macrophage

cultures.

Comparative effects of trichothecenes on COX-2 protein expression .
As found previously in vitro and in vivo (Islam et al. , 2002; Moon and Pestka, 2002)

DON effectively induced COX-2 protein (Fig. 11). All Type B trichothecenes with the

exception of nivalenol induced COX-2 gene expression.

62

 

 

 

 

 

 

 

 

 

 

R.
H
R:
Trichothecene Abbreviation R1 R2 R3 R4 R5 ID20 by
MTT (ng/ml)

1199A

T-2 A1 OH OAc OAc H OCOCH.‘,CH(CH3)2 1.5
HT-2 A2 OH OH OAc H OCOCHZCH(CH3)2 2.32
Diacetoxyscirpenol A3 OH OAc OAc H H 4.6
Acetyl T-2 A4 OAc OAc OAc H OCOCH2CH(CH:,)2 20.0
3'-OH T-2 A5 OH OAc OAc H OCOCH2C(OH)(CH3)2 17.6
3‘-OH HT-2 A6 OH OH OAc H OCOCH2C(OH)(CH3)2 7.48
Linea

DON (VT) 81 OH H OH OH =O 225
Fusarenon-X 82 OH OAc OH OH =0 208
Nivalenol (NW) 83 OH OH OH OH =O 150
15-acetyl DON 84 OH H OAc OH =O 155
3-acetyl DON 85 OAc H OH OH :0 1511
4,15—diacetyl NIV 86 OH OAc OAc OH =0 51.7
Linen

Vernrcarin 01 H -O-R’-O- H H 12.8
Satratoxin G DZ H -O-R'-O— H H 0.6
Satratoxin H 03 H -O-R’-O- H H 0.92
Satratoxin F D4 H -O-R’-O~ H H 3.14
Roridin A 05 H -O-R'-O- H H 1.8
OAc : -OCOCH3

R’ : macrocyclic ester or ester-ether bridge at the R2 and R3 positions

Table 2. Comparative cytotoxicity oftrichothecenes. Cells (2.5x 1 05/ml) were incubated with
each specific trichothecene for 18 hs. Cell proliferation was measured with MTT assay. ID20
was defined as the dose at which 20% of cellular proliferation was inhibited by each toxin.

Results indicative of mean (n=8) and were representative of three separate experiments.

63

120~
100 l— l.

a i ,
80‘ .1.

MIT cellular viability (%)
8

 

 

 

 

 

 

 

 

 

 

 

 

 

40 . *
20 _
0 I I I I I I I I r I
O 10 50 100 250 500 1000 2000
B DON (no/ml)
DON (ng/ml): 6 hr DON (ng/ml): 24 hr

 

SM 010 1002505001000 SM 0 100 250 5001000

 

Figure 10. Dose response of DON-mediated cytotoxicity in macrophage cells (A) Cellular
viability with increasing dose of DON in RAW 264.7 cells. Cells (2x 1 Os/ml) were incubated
With each dose of DON for 18 hr and viability was analyzed using MTT assay. (3) Cells
(2.5x105/ml) were exposed to DON for 6 or 24 hr and nuclear fragmentation was assessed

on tlle agarose gels.

NA A1 A2 A3 A4 A5 A6 3132

 

.3

 

 

 

33 B4 35 36 D1 DZ D3 D4 D5

 

 

 

 

 

Figure 1 1. Comparative effects oftrichothecenes on COX-2 expression. Cells (2.5x105/ml)
were incubated with ID20 of each specific trichothecene for 18 h. COX-2 was detected with
anti-mouse COX-2 antibody by Western blot analysis. Trichothecenes are identified in Table

2 legend. Results representative of three experiments.

65

In particular, fusarenon-X and acetyl DON derivatives including DON strongly enhanced
COX-2 protein levels. Among the Type A trichothecenes, only diacetoxyscirpenol and acetyl
T-2 toxin induced COX-2. The five macrocyclic Type D toxins had no inductive effect on
COX-2 protein. Thus, when applied at aquitoxic concentrations Type B trichothecenes
including DON, lS-acetyl DON, 3-acetyl DON and fusarenon-X were effective inducers of

COX-2 expression whereas Type A and Type D had little or no effect.

Comparative effects of trichothecenes COX-2 transcriptional activity.

To analyze the effect ofCOX-2-inducing trichothecenes on COX-2 promoter activity,
a 0.7KB COX-2 5'-untranslated region corresponding to the promoter was inserted into a
luciferase vector system. Cells transfected with empty vector (pXP5) did not respond to
trichothecene mycotoxins (Data not shown). All COX-2-inducing type B trichothecenes
significantly promoted transcriptional activity of COX-2 gene in the constructed vector-
transfected cells (Fig. 12). Representative type A (diacetoxyscirpenol and acetyl T-2 toxin)
and Type D (Satratoxin F and roridin A) did not increase COX-2 promoter activity when

present at equitoxic concentrations.

Comparative eflects of trichothecenes COX-2 mRNA stabilization through 3 '- U T R.
Besides promoter-driven effects, DON has been previously shown to regulate COX-2
mRNA stability via p38 MAP kinase (Moon and Pestka, 2002). Modulation of mRNA
stability might be explained by the presence of multiple copies of AUUUA motif in the 3'-
untranslated region (3'-UTR) ofCOX-2 mRN A since AU-rich element (ARE) in the 3'-UTR

of an mRNA targets a transcript for rapid degradation (Dixon et a1. , 2000).

66

 

pXPSCOXZ

 

 

 

(a)
I

N
I

d
I

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

relative luciferase activity (fold increase)

0

 

 

Figure 12. Effects of trichothecenes-mediated COX-2 promoter activity. Transfected cells
with promoter-containing luciferase reporter vector (pXP5COX2) were incubated with
1/21D20 of each specific trichothecene for 12 h. Cell lysates were analyzed for luciferase
activity. Trichothecenes are identified in Table 2 legend. Data are mean 1 SEM (n=4).
Asterisk indicates significantly different from vehicle (p<0.05). Results are representative

of three separate experiments.

67

To test the hypothesis in terms of DON-mediated mRNA stabilization, we constitutively
expressed SV40 promoter-luciferase reporter gene, which was ligated with three different 3'-
UTR sections (1/1558, 1/338 and 339/1558 from coding terminal sequence) ofCOX-2 gene
(Fig. 13A). When reporter-expressing cells were treated with DON to analyze the effect of
the toxin on stability of the reporter transcript via 3'-UTR, the toxin enhanced the products
of pGL3COX2a, pGL3COX2b, but had little effect on reporters of pGL3c and pGL3COX2c
(Fig. 133). Most AUUUA motifs are concentrated in 60 base pairs from the terminal
sequence and, as expected, the reporter without the first 338 base pair 3'-UTR did not
respond to DON. Therefore, DON is likely to enhance COX-2 mRN A stability via AU-rich
elements.

Using the above reporter system Q3GL3COX2a), other trichothecenes were also
compared for their post-transcriptional modulatory efficacy. All COX-Z-inducing type B
trichothecenes showed significantly increased levels of reporter, which can be related to the
stabilization of mRN A transcripts via 3'-UTR (Fig. 14). In contrast, representative Type A
and D trichothecenes had no effect. The regulation of 3'-UTR including AU-rich repeats
might be thus involved in COX-2 mRN A stabilization by COX-2-inducing Type 3
trichothecenes. Taken together, when at equitoxic concentrations, Type 3 but not Type A or
D toxins enhanced luciferase activities reporting COX-2 transcriptional activation and

mRNA stabilization.

68

Figure 13. Involvement of 3'-UTR in DON-induced COX-2 mRNA stabilization (A)
Constructs of luciferase reporter systems (pGL3COX2a, pGL3COX2b, and pGL3COX2c)
containing COX-2 3’-untranslated regions of 1-1558, 1-33 8, and 339-1558 base pairs
respectively from termination codon sequence. # represents the site of AUUUA motif. (3)
Effects of DON on each reporter induction in the RAW 264.7 cells. Transfected cells with
each constructed reporter were incubated with doses of DON for 12 h. Cell lysates were
analyzed with luciferase assay. Data are mean :t SEM (n=3). Asterisk indicates significantly

different from vehicle (p<0.05). Results are representative of three separate experiments.

69

COX-2 3’-UTR

SV40 luciferase

 

pGL3COXZa

 

 

1/1558

 

    

.w
... a]... s. .

  

 

pGLBCOXZb
pGLBCOXZC

 

 

 

339/1 558

 

pGL3COXZa pGL3COX2b pGL3COX20

1/338

 

 

 

 

 

pGL3c

 

 

 

 

 

 

 

 

2 1

names 28 888:. 98.2

 

0 50100 0 50100
ivalenol (rig/rd)

0501(1)

050100

deoxyn

Figure 13

70

 

 

 

 

 

 

 

 

 

 

 

 

A

g a:

(u *

a) :L *
2321 *

.E L,
'0 l
6

b l _‘L
.3

.E

a

s"

E

.43

6

2

.3

:0—0
cW'SOFTIITIITTITI
n: MA3A4818284858604D5

Figure 14. Effects of trichothecene mycotoxins on COX-2 mRNA stability. Transfected cells
with luciferase vector containing COX-2 3’-untranslated region (pGL3COX2a) were
incubated with 1/2 ID20 of each specific trichothecene for 12 h. Cell lysate were analyzed for
luciferase activity. Trichothecenes are identified in Table 2 legend. Data are mean i SEM
(n=4). Asterisk indicates significantly different from vehicle (p<0.05). Results are

representative of three separate experiments.

71

Type B trichothecenes preferentially activate WK.

Trichothecenes and protein synthesis inhibitors have been previously shown to
activate MAP kinases and cause apoptosis via a ribotoxic stress response (Shifrin and
Anderson, 1999; Yang et al. , 2000). Therefore, we examined the effects of equitoxic
concentrations of trichothecenes on phosphorylation of MAPKs. All COX-2-inducing Type
B trichothecenes activated ERK, p38 MAPK, and JNK (Fig. 15). COX-2-inducing type A
trichothecenes (A3 and A4) had no effect on MAP kinase activation. Therefore, the capacity
of acetyl T-2 and diacetoxyscirpenol to induce COX-2 might involve mechanisms other than
MAPK signaling pathway. Macrocyclic type D trichothecenes (D4 and D5) weakly activated
p38 although they had no COX-2 inducibility.

To assess involvement of the three MAPK families in trichothecene-induced COX-2
expression, COX-2 induction was analyzed after blocking MAPK signals with specific ERK
and p38 inhibitors or dominant negative JNK. Inhibition with ERK with PD98059 or p38
with SBZO3580 markedly abrogated Type B trichothecene-induced COX-2 expression (Fig.
16A). However, dominant JN K had no suppressive effect on COX-2 production indicating

that did not contribute to Type 3 toxin-induced COX-2 expression (Fig. 163).

Nuclear factor-x3 (NF -xB) activation is also involved in Type B trichothecene-induced
COX-2 expression.

NF-KB can be activated by ERK1/2 and p38 and this transcription factor enhances
COX-2 transcription (Smith et al., 2000). Thus NF-tcB might be a possible signaling
mediator that is involved in trichothecene-induced COX-2 production. Pyrrolidine

dithiocarbamate (PDTC) used here has been known to prevent degradation of IxBor and thus

72

allow inactivation of nuclear factor—KB (NF-KB) (Liu et al., 1999). PDTC-mediated

blocking of NF-KB signaling pathway completely ablated COX-2 gene expression. This

suggests that the NF-KB signaling pathway is critical to Type 3 trichothecene-induced COX-

2 expression (Fig. 17).

NA A3 A4 B1 32 B4 B5 36 D4 D5

 

As

w...“

 

 

 

NA A3 A4 B1 32 B4 B5 36 D4 D5

 

3:38....3-

 

 

 

NA A3 A4 B1 32 B4 35 36 D4 DS

 

‘OV' _ .. M.

w

 

 

 

P-p38

PJERKfl/Z
(942.944)

P0NKH2
(p46.p54)

Figure 15. Activation of MAPK by trichothecene mycotoxins. RAW 264.7 cells

(2.5x105/ml)were incubated with ID20 of each specific trichothecenes for 30 min. Cellular

lysate were blotted with each anti-phosphorylated MAPK (JN K, ERK, and p3 8) antibodies.

Results are representative of three separate experiments.

73

 

 

 

 

 

 

 

 

 

 

 

 

 

 

”N whmhwm-vw
SBZO3580---+---+--+-_+
(59M)
P098059--+---+--+--+-
(15uM)

B B1 32 B4 35
dnJNK -+- -+__+__,_
Emptyvector - — + - - + - - + - - +

Figure 16. Effects ofMAPK inhibition on Type B trichothecene-induced COX-2 expression.
(A) ERK or p38 were inhibited with PD98059 or 83203580, respectively. Cells (2.5
x105/ml) were treated with each chemical combination for 15 h. VH stands for the vehicle.
(3) JNK was inhibited by expression of dominant negative JN K (dnJN K). Cells transfected
either with dominant negative JNK vector (pdnJNK) or empty vector (pCMV5) was
incubated with ID20 of each trichothecene for 15 h. Cellular lysate was analyzed with anti-
mouse COX-2 antibody. Trichothecenes are identified in Table 2 legend. Results are

representative of three separate experiments.

74

B1 32 B4 35

 

   

 

 

 

thghgfljfienfi
- + + + + + + + + -
DT M
- - + - + - + - + 4-

Figure 17. Involvement of NF-KB signaling in Type B trichothecene-induced COX-2
expression. Cells (2.5x105/ml) were incubated with trichothecene with or without 100 pM
Pyrrolidine dithiocarbamate (PDTC) for 15 h. COX-2 was blotted by anti-mouse COX-2
antibody with Western blot analysis. Trichothecenes are identified in Table 2 legend. Results

are representative of three separate experiments.

75

DISCUSSION

This study is novel because it is the first to report a selective biochemical mode of
action for the Type 3 trichothecene subset. Specifically, these data indicated that, when cells
are exposed to concentrations of equivalent cytotoxicity, the Type B trichothecenes
preferentially target COX-2 gene expression as compared to the Type A and Type D
trichothecenes. Notably, Type B trichothecenes strongly induced COX-2 gene expression by
enhancing promoter activity and 3'-UTR-mediated mRNA stability of the gene and,
furthermore, this involved MAPK and NF-KB/Rel signaling pathways. Thus unique action
on COX-2 might result in a different inflammatory spectrum and pathologic outcome
resulting from trichothecene mycotoxin exposure and must be taken into account in hazard
assessments for these toxins.

Trichothecene mycotoxins have been previously shown to activate MAPK in T cells
and macrophages via a putative ribotoxic stress response, and these findings were firrther
associated with toxin-induced apoptosis depending on the dose regimen employed (Shifiin
and Anderson, 1999; Yang et al., 2000a). A critical finding in this study is the further
establishment of a definitive link between Type 3 trichothecene-activated MAPK and the
toxin-induced COX-2 expression at benign doses to the cells.

Type 3 trichothecenes including DON, its derivatives and fusarenon-X, where
present at equitoxic concentrations were the most effective inducers of inflammatory COX-2
gene and the induction was due to both enhanced transcription and UTR-mediated

stabilization of the gene. Furthermore, MAPK signaling pathway and NF-KB activation

76

mediate the trichothecene-induced COX-2 expression. COX-2 induction may contribute to
the Type B trichothecene-mediated irnmunotOxicity. Induction levels of COX-2 expression
by DON and DON-derivatives agree with the degree of reporter expression in transcription
and mRN A stability, and MAPK activation. However, because levels of MAPK activation,
transcription and post-transcription in fusarenon-X are relevantly low, fusarenon-X-induced
COX-2 expression may involve other mechanisms such as translation level of COX-2.
Nivalenol has very similar chemical structure to DON and is capable of inducing and
superinducing proinflammatory cytokines such as IL-6 and TNF-a and IL-8 at concentrations
similar to that of DON (Sugita-Konishi and Pestka, 2001). Surprisingly, nivalenol did not
induce COX-2 expression. Taken together, COX-2 induction by trichothecenes and MAPK
involvement appears to be most affected by DON and DON-derivatives.

T-2 toxin also has been known to synthesize and release inflammatory eicosanoids
in the circulating blood, alveolar macrophages and brain slices (ShOhami et al., 1987;
Naseem et al., 1989). In support of these findings, acetyl T-2 and diacetoxyscirpenol also
weakly induced COX-2 protein. However, they had little effect on COX-2 promoter activity
and 3'-UTR-mediated mRN A stability. This suggests that the mechanism for COX-2
induction for Type A toxins may differ from Type 3 toxins. It is possible that although only
weak and nonsignificant trends were observed for the transcriptional and post-transcriptional
assays employed here, the combination of both regulatorypathways might be necessary to
observe effects on COX-2 protein. Eicosanoids can be evoked by a variety of inducers such
as cytokines, growth factors (TGF-B), hormones (serotonin), reactive oxygen species, and
nitric oxide which are elicited by T-2 toxin (Plasencia and Rosenstein, 1990; Ouyang et a1. ,

1995; Wang et al. , 1998; Albarenque et al. , 2000; Smith et al. , 2000). Therefore, as a second

77

possible explanation, modest changes in COX-2 protein expression could be due to indirect
effect of Type A trichothecenes mediated by eicasanoid-inducing mediators, whereas Type
B toxins induce COX-2 directly by transcriptional and post-transcriptional mechanisms.

Type A trichothecenes did not activate MAPK in the model described here, which
was inconsistent with the previous reports that Type A trichothecenes such as T-2 toxin, HT-
2, diacetoxyscirpenol, and acetyl T-2 can activate MAPK activity as a prelude to apoptosis
(Shifiin and Anderson, 1999; Yang et al. , 2000a). The critical differences between this study
and the previous reports were the treatment times and toxin doses that were employed.
Shifrin and Anderson (1999) used 10 pM of trichothecenes for 2 h and Yang et al (2001)
treated RAW 264.7 cells with 10 ng/ml toxin for 4 h. Compared with these previous reports,
the doses in this study were normalized as ID20 based on MTT cytotoxicity assay and the
toxin incubation time was 30 min for MAPK activation. Therefore, longer incubation time
and/or higher concentration of Type A toxins may have driven MAPK activation and,
ultimately, apoptosis. Further exploration of the comparative concentration-dependent effects
of trichothecenes on MAPK induction and downstream sequelae is warranted.

The Type D verrucarin A greatly enhances IL-2 and IL-4 mRN A in the murine T cells
even at a concentration as low as 25 pg/ml whereas there is no increase of the secreted
cytokines in the supernatant (Ouyang et al., 1995). The capacity of macrocyclic Type D
trichothecenes such as satratoxin F and roridin A to activate MAPKs without affecting COX-
2 expression were consistent with previous studies, (Shifrin and Anderson, 1999; Yang et
al., 2000). The reason for the lack of COX-2 response may relate to the relatively weak
MAPK responses compared to Type B trichothecenes. MAPK-mediated gene induction

might not be enough to overcome the strong global inhibition of translation by Type D

78

trichothecenes. Alternatively, Type D toxin-activated MAPKs may be associated with
different downstream signaling sets or different MAPK scaffolding complexes from those
shown in Type B group.

Several intestinal tumor studies have suggested MEK and its downstream ERK
signaling pathway are essential for both increased transcription and stability of mRN A ofK-
Ras-induced COX-2 (Zhang et al. , 2000; Sheng et al. , 2001). Type B trichothecene-activated
ERK 1/2 might be also critical upstream signals for regulating transcription factors. In
support of this contention, ERK l/2 can activate CCAAAT/enhancer-binding protein-beta
(C/EBPB) and cAMP response element binding protein (CREB), which are major
transcriptional factors involved in murine COX-2 expression (Fig. 6A) (Davis et al., 2000;
Hu et al., 2001). Consistent with such activity, we have recently observed that C/EBPB
binding activities in RAW 264.7 cells was increased 2 and 8 h after DON exposure (Wong
et al., 2002). It is thus possible that Type B-induced ERK activity contributes to increased
COX-2 transcription.

p38 is known to mediate xenobiotic- or endogenous factor-induced COX-2
expression by regulating transcription or mRNA stability of the gene (Fiebich et al., 2000;
Vogel, 2000; Yan et al., 2000). The findings here that p38 was involved both in
transcriptional activity and mRNA stability of COX-2 gene are consistent with previous
findings for DON (Moon and Pestka, 2002).

It has long been recognized that transcripts that contain AU-rich elements (ARES) are
selectively targeted for rapid degradation (Chen and Shyu, 1995). Most ARES are clustered
within 60 base pairs from the coding terminal sequence and DON was found to enhance

ARE-containing reporter stabilization (Fig. 13). Therefore, it is possible that DON and other

79

Type B trichothecenes mediate mRN A stabilization signals by targeting ARES at 3'-UTR.
Relatedly, p38 is known to mediate COX-2 mRN A stabilization through ARES (Lasa et al. ,
2000) and this is thought to be controlled by ARE-binding proteins. Specifically proteins
such as ARE/poly-(ID-binding/ degradation factor 1 (AUF 1), HuR (a member of the ELAV
family of RNA binding proteins), tristetraprolin, Y box binding factor 1 (YB-1), TIAR, and
CarG box-binding factor-A (CBF-A) can differentially regulate COX-2 or cytokine mRN A
stability by binding to the regulatory AU-rich elements (Sirenko et al., 1997; Dixon et al.,
2001; Nabors et al. , 2001; Zhu et al. , 2001; Dean et al. , 2002). Tristetraprolin, a member of
a family of zinc finger proteins was reported to play a crucial role in maintaining gene
quiescence, and this quenching effect on transcription can be released by p3 8-mediated
phosphorylation of tristetraprolin (Zhu et al., 2001). The presence of multiple copies of
AUUUA pentamer in the 3'-untranslated region (3'-UTR) of COX-2 mRNA further suggests
the mRNA stability in the Type B trichothecene-induced up-regulation of the gene can be
modulated through p38 MAPK signaling pathway.

Type B trichothecenes also activated JN K, which did not appear to contribute to
COX-2 induction. Macrophage cells require the activation ofJNK/MEKKI in LPS-induced
COX-2 transcription and, more specifically, blocking JNK impairs both NF-KB- and
C/EBPji-mediated transcription of COX-2 (Wadleigh et al., 2000). In contrast, our results
differed and showed that blocking JNK activity with dnJN K did not affect DON-induced
COX-2 expression. It is possible that, in the case of Type 3 toxins, the activated MAPK
network firnctions redundantly in upregulating COX-2 gene transcription. In this case,
impairment of JN K, may be overcome by alternate pathways involving ERK and p3 8 (Mestre

et al. , 2001). Interestingly, trichothecenes are thought to induce leukocyte apoptosis via the

80

p38 and JNK signaling pathways (Shifiin and Anderson, 1999; Yang et al., 2000a). The
trichothecene concentrations employed here to induce COX-2 expression were non-cytotoxic
to weakly cytotoxic. The possibility exists that trichothecene concentration may selectively
dictate which MAPKS are activated and to what degree and that these effects ultimately
determine whether a cell generates a proinflammatory gene response or undergoes apoptosis.
Furthermore, evaluation of how trichothecenes differentially regulate these two responses
is warranted.

Our data also implicated NF-KB/Rel signaling in Type B trichothecene-induced
COX-2 expression. COX-2 promoter contains two consensus sequences for the cis-acting
elements recognized by the NF-KB/Rel transcription factor family and it is thus expected that
NF-KB/Rel might modulate COX-2 transcription. DON elevates NF-KB/Rel binding activity
and may be involved mechanistically in DON-induced cytokine expression in both cloned
(EL-4) and primary (CD4+) murine T cells (Ouyang et al. , 1996). Moreover, DON decreases
IxBa levels which bind NF-KB dimers and restrict the dimer from translocating to the
nucleus. Type 3 trichothecene-induced COX-2 expression might be explained by NF-xB/Rel
signaling pathway as well as MAPK Signal transduction. Because multiple signaling
pathways exist for activation of IKK complex that include members of the MAPK kinase
(MAPKK) family such as MAPK/ERK kinase kinase] (MEKKl), 2 and 3 (Perkins, 2000)
and sustained JNK is suppressed by NF-KB Signaling (Tang et al., 2001), there could be
crosstalk among MAPK and NF -ch/Rel signaling pathways.

In summary, Type B trichothecenes that include DON and its closely related
derivatives preferentially induced COX-2 gene expression when compared to equitoxic

concentrations of Type A and Type 3 trichothecenes. These effects were via altered

81

transcriptional and post-transcriptional regulation. Both MAPK and NF-KB/Rel signaling
pathway were involved in the COX-2 induction by Type B trichothecenes. These data are
particularly critical because they suggest that Type B trichothecenes which are found in
grain-based food may cause a different spectrum of toxicity than other trichothecenes found

in food (Type A) or in contaminated indoor air (Type D).

82

CHAPTER 4.

ROLE OF COX-2 IN DON-MEDIATED IL-6 INDUCTION l

 

1 This work was published in the title of “Cyclooxygenase-2 Mediates Interleukin-6 Upregulation by
Vomitoxin (Deoxynivalenol) In Vitro and In Vivo” (Moon and Pestka, 2003).

83

ABSTRACT

Interleukin-6 (IL-6) is a central mediator of immunotoxicity that is associated with
exposure to the trichothecene deoxynivalenol (DON). The purpose of this investigation was
to test the hypothesis that the inducible cyclooxygenase-2 (COX-2) and its metabolites
contribute to DON-induced IL-6 upregulation. DON at 100 to 250 ng/ml readily induced
COX-2 protein expression in the RAW 264.7 murine macrophage cell line. Superinduction
of LPS-mediated IL-6 production by DON in these cells was significantly reduced by the
COX inhibitors indomethacin and NS-398, whereas the inhibitors did not affect direct
induction of IL-6 by LPS alone. Mice that had been gavaged orally with 5 and 25 mg/kg
DON exhibited elevated COX-2 mRN A expression in Peyer’s patches and Spleen with peak
induction occurring 2 hr after DON exposure. IL-6 mRNA was also induced by DON in
vivo, however, peak expression occurred from 2 to 4 hr after toxin exposure suggesting that
maximal COX-2 gene upregulation preceded or was concurrent with that for IL-6. Also
consistent with a putative contributory role for COX-2 was the finding that both induction
of splenic lL-6 mRNA and serum IL-6 by DON were significantly reduced by pretreating
mice with the COX inhibitors indomethacin or NS-398. Finally, COX-2 knockout rrrice
showed significantly reduced splenic IL-6 mRNA and serum IL-6 responses to oral DON
exposure as compared to their parental wild-type. Taken together, these in vitro and in vivo
data suggest that DON-induced COX-2 gene expression and resultant COX-2 metabolites
contributed, in part, to subsequent upregulation of IL-6 gene expression which has been

previously shown to be a hallmark of DON-mediated immunotoxicity.

84

INTRODUCTION

The trichothecenes are sesquiterpenoid fungal mycotoxins that are potent inhibitors
ofeukaryotic protein synthesis and have a wide Spectrum of toxic effects. Trichothecenes are
a safety concern because they (1) widely contaminate agricultural commodities (Abouzied
et al. , 1991), (2) are resistant to degradation during milling or processing (Scott, 1990) and
(3) can adversely affect humans and animals (Ueno et al., 1984; Ueno, 1985; Bhat et al.,
1989). Of particular importance is the trichothecene deoxynivalenol which is produced by
F usarium graminearum and F. culmorum, and is frequently found in grain-based agricultural
commodities such as wheat, barley, and corn (Rotter et al. , 1996).

In experimental animals, acute exposure to high doses of DON causes nausea, emesis,
leukocyte apoptosis, and circulatory shock, whereas effects of low dose DON exposure
include anorexia, decreased nutritional efficiency, and immunotoxicity (Rotter et al. , 1996).
Relative to the latter, our laboratory has observed that, in the mouse, chronic dietary DON
exposure induces elevation of serum IgA, mesangial kidney IgA deposition and hematuria,
all of which are hallmarks of human IgA nephropathy (Forsell et al. , 1986; Dong et al. , 1991 ;
Dong and Pestka, 1993). Aberrant IgA production appears to be mediated through
superinduction of cytokine gene expression in mononuclear phagocytes (Yan et al. , 1997;
Yan et al., 1998) and T helper cells (Warner et al. , 1994). One of these cytokines,
interleukin-6 (IL-6), is widely recognized to be critical to regulation of mucosal B cell
differentiation to IgA-secreting plasma cells (Beagley et al., 1989; Beagley et al., 1991;

Fujihashi et al. , 1992). Genetic disruption of IL-6 in mice markedly reduces DON-induced

85

increases in serum IgA as well as kidney IgA deposition in mice suggesting a strong
correlation between IL-6 and these IgA effects (Pestka and Zhou, 2000). In addition to the
effects on IgA, superinduction of IL-6 by DON in the presence of endotoxin is likely to be
associated with the shock-like and cytotoxic responses that occur during acute DON
intoxication in mice (Zhou et al. , 1999).

The cyclooxygenases (COX) are rate-limiting enzymes that catalyze oxygenation of
arachidonic acid to prostaglandin endoperoxides which are subsequently converted
enzymatically into prostaglandins and thromboxane A2 (Smith et al., 2000). These
metabolites play important physiologic and pathologic roles in diverse inflammatory Sites
(Vane et al., 1998). Two distinct isoforms of COX have been identified. COX-l. is
constitutively expressed at low levels in most tissues and may be related to homeostatic
function. In contrast, COX-2 resembles an early response gene in that it is strongly induced
by mitogenic and proinflammatory stimuli, and superinduced by protein synthesis inhibitors
(Fletcher et al., 1992; Newton et al. , 1997a; Newton et al., 1997b; Newton et al., 1998).
DON has recently been shown by our laboratory to induce COX—2 gene expression in vitro
and in vivo and to enhance the production in vitro of prostaglandin 32 (PGE2), a major
metabolite of COX-2. A positive association exists between endogenous COX-2 metabolites
and IL-6 synthesis in vitro and in vivo in models of several inflammatory diseases (Dendorfer
et al., 1994; Meyer et al., 1994; Meyer et al., 1995; Anderson et al., 1996; Hinson et al.,
1996; Williams and Shacter, 1997; Zeng et al. , 1998; Williams et al. , 2000). PGE2 regulates
production of macrophage and T cell cytokines which impact cell-mediated responses as well
as immunoglobulin induction by B cells (Snijdewint et al., 1993; Fedyk et al., 1997). In

some inflammatory response models, PGEZ inhibits Th1 cytokine expression, whereas

86

production of Th2 cytokines is unaffected or even enhanced by PGEZ (Betz and F ox, 1991;
Kozawa et al. , 1998; Kuroda et al. , 2000). Macrophages are a major source of PGE2 during
inflammation and also have receptors for eicosanoids. Macrophage-generated PGE2 is now
recognized to modulate proinflammatory cytokines such as IL-6 in an autocrine or paracrine
fashion (Arakawa et al., 1996; Williams and Shacter, 1997; Williams et al., 2000).

The aim of this study was to test the hypothesis that COX-2 and its metabolites
contribute to IL-6 induction by DON in vitro and in vivo. The results suggest that DON-
induced COX-2 and COX-2 metabolites mediated up-regulation of IL—6 expression in both
macrophage culture and in mice. COX-2 might, therefore, play a momentous role in

immunological and inflammatory events associated with DON exposure.

87

MATERIALS AND METHODS

Cell culture studies. All cell culture reagents and chemicals were purchased from
Sigma Chemical Co. (St. Louis, MO) unless otherwise noted. The RAW 264.7 murine
macrophage cell line (American Type Culture Collection, Rockville, MD) was cultured at
2.5 x 105 cells per ml in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with
10 % (v/v) heat-inactivated fetal bovine serum (FBS, Atlanta Biologicals Inc, Norcross, GA),
100 units/ml penicillin, and 100 pg/ml streptomycin in 5 % CO2 at 37°C. Macrophage cell
numbers and viabilities were assessed prior to culturing by trypan blue dye exclusion using
a hematocytometer (American Optical, Buffalo, NY). Cells were incubated with DON at
concentrations ranging from O to 250 ng/ml in the presence and absence of selective
inhibitors. and then analyzed for COX-2 and IL-6 induction. To assess the effects of DON
and these inhibitors, the 3-(4,5-di-methylthizol-2-yl)-2,5 diphenyltetrazolium bromide

(MTT) assay (J i et al. , 1998) was used.

Mouse studies. All animal handling was conducted according to the guidelines
established by the NIH. Experiments were designed to minimize numbers of animals
required to adequately test the proposed hypothesis and approved by Michigan State
University Laboratory Animal Committee. For most studies, male B6C3F1 mice (7 wk old)
were obtained from Charles River (Portage, MI) and acclimated for one week in a humidity-
and temperature-controlled room with an alternating 12 hr light and dark cycle. Mice were

fed AIN-76A diet (ICN Nutritional Biochemical, Cleveland, OH) and water ad lib.

88

For COX-2 deficiency studies, COX-2 knockout (KO, homozygous 129P2-ptgs2tml) and
parental wild type(WT, C57BL/6) (Langenbach et al., 1999a) were obtained from Taconic
(Gerrnantown, NY) and treated as described for 36C3Fl mice. Blood was obtained from
retroorbital plexus under metaflurane anesthesia and mice were immediately euthanized by
cervical dislocation. Peyer’s patches and spleen were removed and total RNA extracted for

measurements of gene expression.

Detection of COX-2 protein expression. Cells were washed with ice—cold phosphate
buffer, lysed in boiling lysis buffer (1%[w/v] SDS, 1.0 mM sodium ortho-vanadate, and 10
mM Tris pH 7.4), and sonicated for 5 sec. Resultant extract was then analyzed for COX-2
protein by Western blot. Cell lysates were mixed with Laemmli sample buffer (Bio-Rad,
Cambridge, MA) and boiled for 5 min before electrophoretic separation on a 10 % (w/v)
acrylamide gel. Resolved proteins were transferred to PVDF membrane and blocked with
Tris-buffered saline with Tween-20 (TBST; 10 mM Tris-HCl pH 7.5, 100 mM NaCl, 0.1 %
[v/v] Tween-20) containing 5% (w/v) BSA. The membrane was incubated for 1 hr with
COX-2 antibody (mouse IgG], Transduction Laboratories, Lexington, KY) 1:300 dilution
in TBST containing 5% (w/v) BSA, and then was washed three times with TBST. The
membrane was then incubated with horseradish peroxidase (HRP)-conjugated anti-mouse
IgG (Sigma, St. Louis, MO) (1 : 10,000 dilution) for COX-2 detection. After washing three
times with TBST, bound HRP-conjugated antibody was detected with an Enhanced
Chemiluminescence (ECL) kit (Amersham Pharmacia Biotech, Piscataway, NJ) according

to manufacturer’s instructions.

89

Interleukin 6 (IL-6) ELISA. Cell culture supernatant or serum were diluted and
incubated for 1 hr at 37 °C in Immunolon IV removawell microtiter strips (Dynatech
Laboratories, Chantilly, VA) which were coated with 100 pl of 1 pg/ml purified rat anti-
mouse IL-6 (Pharmingen, San Diego, CA) diluted in coating buffer (0.84 % [w/v] sodium
bicarbonate, pH 8.2). After washing 4 times with PBS containing 0.05 % (v/v) Tween 20
(PBST), wells were incubated with 100 pL of 1.5 pg/ml biotinylated rat anti-mouse-IL-6
(Pharmingen, San Diego, CA) for 1 hr at room temperature. Wells were washed 6 times and
incubated for 1 hr with 100 pl of 1.5 pg/ml horseradish peroxidase (HRP)-conjugated
Streptavidin (Sigma) in PBST at room temperature. After washing 8 times with PBST,
substrate (100 pl) consisting of 3', 3', 5', 5'- tetramethyl benzidine (100 pg/ml, Fluka
Chemical Co. Ronkonkoma, NY) in 0.1 M citric phosphate buffer (pH 5.5) and 0.003 %
(w/v) hydrogen peroxide was added to each well and incubated for 10 min at room
temperature for color development. The reaction was terminated with 100 pl 6 N sulfuric
acid. Absorbance was read at 450 nm with Vmax Kinetic Microplate Reader (Molecular

Devices, Menlo Park, CA ) and IL-6 was quantified using the manufacturer’s software.

Detection of COX-2 and IL-6 mRNA by competitive RT -PCR. Total RNA from
murine tissue was extracted with Trizol reagent (Life Technologies, Gaithersburg, MD)
according to the manufacturer’ 3 instructions. RNA (100 ng) from each sample was converted
to cDNA by reverse-transcriptase (Riedy et al., 1995) and resultant cDNA was amplified
competitively with truncated internal standard ochNA constructed by the bridging-deletion
method (Hall et al., 1998). Amplification was performed in a 9600 Perkin Elmer Cycler

(Perkin-Elmer Corp., Norwalk, CT) using the following parameters: 30 cycles of reactions

90

of denaturation at 94 °C for 30 s, annealing at 55 °C for 45 5 (IL-6) or 56 °C for 45 s (COX-
2), and elongation at 72 °C for 45 s. An aliquot of each PCR product was subjected to 1.5
% agarose gel electrophoresis and visualized by staining with ethidium bromide. Primers
were synthesized at Michigan State University Molecular Structure facility. The 5' forward
(F) and 3' reverse (R)-complement PCR primers for amplification of mouse COX-2 and IL—6
cDNA were ACACTCTATCACTGGCATCC (COX-2 F), GAAGGGACACCCTI'ICACAT
(COX-2 R), TTCACAAGTCCGGAGAGGAG (IL-6 F), and
TGGTCTTGGTCCTTAGCCAC (IL-6 R), respectively. The final end-product of amplified
cDNAS were 584 bp of COX-2 , 500 bp of COX-2 internal standard cDNA, 488 bp of IL-6,
and 400 bp of IL-6 internal standard cDNA. Densitometric ratios of native to internal
standard cDNA were used to make standard curves for COX-2 and IL-6 to calculate cDNA

concentrations in RT reaction products.

Statistics. Data were analyzed using SigmaStat for Windows (J andel Scientific, San
Rafael, CA). For comparison of two groups of data, Student’s T test was performed. For
comparison of multiple groups, data were subjected to one way analysis of variance
(AN OVA) and pairwise comparisons made by Student-Newman-Keuls (SNK) method. Data
not meeting normality assumption were subjected to Kruskal-Wallace AN OVA on Ranks

and then pairwise comparisons made by SNK method.

91

RESULTS

COX-2 contributes to IL-6 superinduction by DON in RA W 264. 7 cells.

Since COX-2 is abundantly expressed in macrophage cells during tissue
inflammation, this enzyme might, through its metabolites, drive autocrine and paracrine
effects on IL-6 expression. Using RAW 264.7 cells as a macrophage model, the interaction
between COX-2 metabolism and DON-induced IL-6 production was investigated. Consistent
with an earlier study (Moon and Pestka, 2002), DON at concentrations of 100 and 250 ng/ml
induced COX-2 protein expression (Fig. 2). Although DON does not directly induce IL-6 in
RAW 264.7 cells, the toxin can superinduce IL-6 production in the presence of
lipopolysaccharide (LPS) (Wong et al., 1998; Wong et al., 2001). Here, LPS at 200 ng/ml
significantly induced IL-6 production and this response was superinduced by co-trcatment
with 100 ng/ml DON (Fig. 18). Co-exposure to the COX inhibitors indomethacin or NS-398
significantly depressed the superinduced IL-6 response in DON + LPS-treated cells. LPS-
mediated IL-6 production was not significantly affected by COX-2 inhibitors (data not
shown). These results suggested that IL-6 superinduction may be mediated by DON-induced
COX-2 metabolites. Since the in vivo response to DON is likely to be much more
complicated than that for the macrophage cell model, subsequent studies were conducted in

intact mice.

92

 

 

|L-6 (ng/ml)

 

 

 

 

 

 

 

 

 

 

Jain)

 

Treatment 1 2 3 4 5 ' 6 7

 

LPS
(200ng/ml) - + + + + + +

DON
(100ng/ml) - - + + + + +

lndomethacin
(ZuM) - - - + - - -
(20pM) - - - - + - -

NS-398
(111M) - - - - - + -
(10pM) - - - - - - +

 

 

Figure 18. Down-regulation of DON-mediated IL-6 superinduction in RAW 264.7 cells by
COX-2 inhibitors, indomethacin and NS-398. Cells (2.5x10 5 /ml) were treated with DON
(100 ng/ml), LPS (200 ng/ml) and indomethacin (2 or 20pM) or NS-398 (l or IOpM) for 24
hr and supernatant was analyzed for IL-6 by ELISA. Data are mean i SD (n=5). Groups with
different letters are significantly different (p<0.05). Results are representative of three

experiments.

93

DON induces COX-2 mRNA expression in mouse lymphoid tissues.

COX-2 gene expression was assessed in lymphoid tissues of mice exposed acutely
to DON. Food and water were withdrawn 3 hr before DON administration. DON, dissolved
in 0.25 ml of endotoxin-free tissue culture-grade water, was administered to 36C3Fl mice
at doses of O, 1, 5, or 25 mg/kg body weight via oral gavage. The 25 mg/kg DON dose
represents approximately 1/3 the LD50 in the B6C3Fl mouse (F orsell et al., 1987). When
spleens and Peyer’s patches were removed for mRN A determination to assess COX-2 gene
expression treatment, 5 and 25 mg/kg of DON were found to significantly enhance COX-2

mRNA levels in both organs, while 1 mg/kg DON had no effect (Fig. 19).

COX-2 mRNA expression precedes or is concurrent with IL-6 mRNA expression in
lymphoid tissue of mice exposed to DON.
To assess the possible relationship between DON-induced COX-2 and

IL-6 expression, the kinetics of COX-2 mRN A appearance was compared with that for IL-6
after exposure to 25 mg/kg DON for 1, 2, 4, 6 and 12 hr. COX-2 mRNA expression was
maximal in both Peyer’s patches (Fig. 20A) and Spleen (Fig. 203) at 2 hr. In Peyer’s patches
and spleen, IL-6 mRNA was also induced by DON, however, peak expression occurred 2 to
4 hr after toxin exposure. These data indicate that maximal COX-2 gene upregulation

preceded or was concurrent with that for IL-6 in vivo.

COX inhibition ablates DON-induced IL-6 mRNA expression in spleen.
To evaluate the effect of COX metabolism on IL-6 production by DON, mice were

pretreated intraperitoneally with the COX inhibitors indomethacin or NS-3 98 30 min before

94

DON gavage. Mice pretreated with idomethacin (Fig. 22A) or NS-398 (Fig. 223) showed
significantly lower DON-induced IL-6 mRN A responses in Spleen than did vehicle-pretreated
mice. Furthermore, DON (12.5 and 25 mg/kg) elevated serum IL-6 at 3 hr and this
enhancement was significantly suppressed by pretreatment with the COX inhibitors (Fig. 21).
Indomethacin or NS-398 controls had no effect on IL-6 mRN A expression (data not shown).
These results suggest a role for COX-2 metabolites in elevated IL-6 mRNA and protein

expression in DON-exposed mice.

COX-2 deficiency ablates DON-induced IL-6 expression in vivo

To further establish a role for COX-2 in DON-induced IL—6 expression, induction.
of IL-6 mRN A and protein following oral DON exposure was compared between COX-2 K0
and COX-2 WT mice. Splenic IL-6 mRN A levels from DON-treated KO mice were 6 times
lower than that for the DON-treated wild type (Fig. 23A). Stimulation indices
(DON/vehicle) for WT and KO mice were 17.7 and 8.3, respectively, indicating that the
response of the WT to DON was at least twice that for the KO. Relatedly, DON-treated
COX-2 KO mice exhibited one-half of the sermn IL-6 response of the DON-treated WT (Fig.
233). These data support the contention that COX-2 is a important mediator in DON-
induced IL—6 expression and further suggest that DON can also induce lL-6 by a Cox-2

independent pathway.

95

- PP

 

 

 

 

A 120 _ 517777:'f‘i"~::_:,; *
g 369. 2.2.4.4; S P
_E 100 .
g 80 ~
:1 60 .
n: 40 -
E
‘t‘ 20 _
X
0 i L
0 o . .
0 1

 

DON (mg/kg)

Figure 19. Dose response of DON-induced COX-2 mRNA expression in murine Peyer’s
patches and spleen. DON was administered via oral gavage and mRNA from Spleen or
Peyer’s patches was analyzed 2 hr later by competitive RT-PCR. Data are mean i SD (n=3).
The symbol * indicates significant difference (p<0.05) from vehicle (0 mg/kg DON). Results

are representative of two experiments.

96

120

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

E
3 100 . + lL-6
.E —o— cox-2
(T; 80 —
E
u— 60 a
O
2\: 40 '1
< \"Ԥ
2 20 a
0:
E o .
6 i l 8 9.12.1?“
Time after gavage (hour)
E 120
3
,g 100 ~
B x
as
E 80 '1
H:—
O 60 N
o\°
V 40 «
<
z 20 .
0:
E o -

 

 

 

0 2 4 6 6 10 12 14

Time after gavage (hour)

Figure 20. Time response of DON-induced COX-2 and IL-6 mRN A expression in murine
Peyer’s patches and spleen. DON (25 mg/kg) was administered via oral gavage and mRNA
from Peyer’s patches (A) or Spleen (B) was analyzed 2 hr later by competitive RT-PCR at
various time intervals. Data are mean :h SD (n=3). Results are representative of two

experiments.

97

-|> N N 00
U'l O 01 O
l

l

.5
C

I

L

 

Serum IL-6 (ng/ml)

 

 

 

 

 

 

 

 

 

Treatment

DON
(12.5mg/kg) - + - - - - -
(25 mg/kg) - - + + + - -

Indomethacin
(20mglkg) - - - + - + -

NS-398
(5mg/kg) - - - - + - +

 

 

Figure 21. Suppression of DON-induced serum IL-6 response in mice by COX-2 iriiius
indomethacin and NS-398. Mice were treated as described in Materials and Methods, and
serum analyzed 3 hr later. Data are mean i SD (n=4). Groups marked with different letters
are significantly different (p<0.05). Results are representative of two experiments.

98

A Vehicle DON DON+|NDO

 

 

70w
60‘
50‘
40~
30‘
20-
10-

|L-6 cDNA (pg/ml)

  

 

 

VH DON DON/INDO

Vehicle DON DON+NS-398

 

 

B: 80
E
C)
3 60
<
z
9, 4o
3 *
— 20 W ‘ m
or .

 

VH DON DON/NS-398

Figure 22. Suppression of DON-induced IL-6 mRNA response in spleen by COX-2
inhibitors, indomethacin and NS-398 suppresses. Mice were pre-exposed to 20 mg/kg
indomethacin (A) or 5 mg/kg NS398 (B) min and then given 25 mg/kg of DON by oral
gavage. Splenic mRNA was isolated 3 hr later and analyzed by RT-competitive-PCR. Data
are mean i SD (n=4). The * indicates significant difference (p<0.05) from DON treatment

group. Results are representative of two experiments.

99

WT WT/DON KO KO/DON

 

 

 

 

 

|L-6 cDNA (pg/ml)
WT 0.17 10.13 *
WT/DON 3.01 10.04
KO 0.06 10.01 *
B KO/DON 0.50 10.07 *
12 ~ '

 

A
O
—1

oo

 

*

Serum intedeUdn-G (ng/mi)
O)

 

 

 

 

 

 

WT WT/DON KO KO/DON

Figure 23. Impaired response of splenic IL-6 mRNA and serum IL-6 to DON in COX-2
knockout mice. COX-2 knockout (K0) and wild type mice (WT) were exposed orally to 25
mg/kg DON. After 3 hr, splenic IL-6 mRN A (A) was analyzed by competitive RT-PCR and
serum IL-6 (B) was measured by ELISA. Data are mean :1: SD (n=5). The * indicates
significant difference (p<0.05) from DON/W T treatment group. ND indicates not detectable.

100

DISCUSSION

Th1/Th2 cell balance and level of proinflammatory cytokine response are key
determinative factors in the pathogenic outcomes and the severity of inflammatory diseases
(Ebihara et al., 2001; Lim et al., 2001). PGE2 plays an important Th2-driving role (Harris
et al., 2002). Notably, PGE2 is known to enhance IL-6, which is considered to be a Th2
cytokine in endotoxemia, airway inflammation, and autoimmune arthritis (Meyer et al.,
1995; Anderson et al. , 1996; Tavakoli et al. , 2001). The results presented herein suggest that
COX-2 metabolism might similarly be involved in upregulating IL-6 in DON-exposed
animals and, thus, contribute to resultant immunotoxic effects.

IL-6 plays a critical role in the DON-induced pathogenesis, particularly relative to
experimental IgA hyperproduction and IgA nephropathy. DON ingestion induces polyclonal
autoreactive IgA production which forms immune complexes and subsequently deposits in
mesangial regions of the kidney glomerulus (Rasooly et al.,. 1994; Rasooly and Pestka,
1994). IL-6 is widely recognized to promote terminal differentiation of Peyer’s patch B cells
to IgA-secreting plasma cells (Beagley et al., 1989; Beagley et al., 1991; McGhee et al.,
1991) and several lines of evidence suggest IL-6 contributes to DON-induced IgA
hyperelevation. First, oral DON exposure rapidly induces IL-6 in spleens and Peyers patches

of mice (Zhou et al., 1997). Second, IL-6-deficient mice are refractory to DON-induced
dysre gulation of IgA production (Pestka and Zhou, 2000). Third, Yan observed that IgA and
IL-6 production are increased in PP cultures from mice orally exposed to DON at 2 hr prior

to termination and, furthermore, addition of anti-IL—6 to these cultures completely ablated

lOl

IgA production (Yan et al., 1997). IgA and IL-6 production in PP cultures derived fi'om
DON-exposed mice are also abrogated when cultures are depleted of macrophages but are
restored upon co-culture with peritoneal macrophage from mice exposed to DON in vivo
(Yan et al. , 1998). This latter evidence suggests that macrophages may be a primary source
of IL-6 in DON-induced IgA dysregulation.

Understanding how trichothecenes dysregulate IL-6 is very important because
aberrant serum IgA accumulation may be specifically deleterious to human health.
Persistently elevated polyclonal serum IgA and IgA immune complexes, increased IgA-
bearing lymphocytes, mesangial IgA accumulation, hematuria and increased susceptibility
of males that is found after DON ingestion by mice. (Pestka et al. , 1989; Dong et al. , 1991;.
Dong and Pestka, 1993; Greene et aI. , 1994; Greene et a1. , 1995) are identical manifestations
to those associated with the human IgA nephropathy (Clarkson et al. , 1987). Although the
etiology of this disease remains unknown, GI/respiratory tract infections (Emancipator and
Lamm, 1989) as well as grain-containing diets (Coppo et al. , 1986) have been suggested to
play roles. IgA nephropathy accounts for 20-40% of all primary glomerular disease
worldwide (D'Amico, 1987). Approximately 150,000 persons in the US. exhibit the clinical
features of IgAN with between 2800 to 4200 entering into end-stage renal failure each year
(Hellegars, 1993). The potential exists for dietary DON to contribute to this disease. In
addition, the novel capacity of chronic oral DON exposure to induce aberrant elevation of
serum IgA and mesangial IgA accumulation provides a model for resolving contributory
factors and potential mechanisms associated with IgAN as well as therapeutic regimens. In
addition to IL-6's effects on IgA production, this cytokine might also promote pathogenic

processes in IgA nephropathy by enhancing mesangial cell proliferation and producing

102

proinflammatory lipid mediators and superoxide anion (Chen et al. , 1995; Taniguchi et al. ,
1999; Harada et al. , 2002).

The mechanisms by which DON induces COX-2 expression have recently been
studied in the RAW 264.7 macrophage models (Moon and Pestka, 2002). DON was found
to increase COX-2 mRNA levels by elevating both transcriptional activity and mRNA
stability. Since DON exposure can result in the phosphorylation of the mitogen activated
protein kinase (MAPKS) ERK 1/2, p38 and JNK 1/2, the role of these kinases in COX-2
expression have also been explored. Enhanced transcriptional activity was modulated by
ERK and p38 signaling pathways whereas mRNA stability was promoted exclusively by
DON-activated p3 8 phosphorylation. In contrast, JN K was not involved in increased COX-2.
transcript and protein expression. The specific upstream mechanisms by which DON
enhances MAPK phosphorylation remain unresolved but appear to involve interaction with
the ribosome via a “ribotoxic stress response” (Laskin et al. , 2002).

The means by which PGE2 , one of representative COX-2 metabolites, modulates
cytokine expression have been well-described (Harris et al. , 2002). Briefly, PGE2 exerts its
action by binding to one (or a combination) of its four receptors subtypes, EP,, EP2, EP3 or
EP4. These receptors are coupled to different G proteins and use several messenger signaling
pathways. EPI is coupled to Gq,p and ligand binding stimulates lL-6 synthesis through both '
extracellular and intracellular Ca2+ mobilization. EP2 and EP4 are coupled to Gs proteins and
induce the expression of cAMP, which lead to IL-6 expression. EP3 are primarily coupled
to Gi and is most often inhibitory to CAMP. In addition, some COX-2 metabolites such as
cyclopentanone prostaglandins can bind to a nuclear receptor, peroxisome proliferator-

activated receptor (thus impacting proinflammatory gene transcription (Ricote et al. , 1998).

103

Since COX-2 metabolites can either potentiate or attenuate proinflammatory cytokine
production, further research on how DON might differentially affect these two modulatory
routes is warranted. PGE2 also selectively impairs IFN—y production and directly promotes
the production of Th2 cytokines in murine and human Th clones (Betz and Fox, 1991;
Snijdewint et al., 1993). It is notable that interleukin-12 (1L-12)p70 heterodimer, a major
Th1 -driving cytokine, is suppressed by PGE2 , whereas PGE2 participates in the induction
of IL-12p40 which can function as an antagonist of biologically active IL-12p70 (Kalinski
et al., 2001). The capacity of DON to drive IL-12 p40 but not IL-12 p35 expression in vivo
(Zhou et al., 1997) may be related to COX-2 and PGE2.

Proinflarnmatory cytokines also have been related to the cellular injury like apoptosis)
during chemical toxicosis such as alcohol and CCl4 (Luster et al. , 2001; Hong et al. , 2002).
DON in the presence of endotoxin synergistically enhance proinflammatory cytokines such
as IL-6 and cause marked cell death with characteristic features of apoptosis (Zhou et al.,
1999). In some aspect, IL-6 production by chemical irritants could be rather one of critical
endogenous defensive mechanism because it rescues tissue from the apoptotic injuries and
promotes the wound healing processes (Rollwagen et al. , 1998; Gallucci et al. , 2000). COX-
2 metabolites also can play protective role in the gastrointestinal inflammation (Langenbach
et al. , 1999a; Langenbach et al., 1999b; Morteau, 1999; Morteau et al., 2000). COX-2
knockout mice developed increased susceptibility to chemical-induced colitis. Moreover,
some COX-2 products might be very important resolving agents during the late stage of
inflammation with alternate set of prostaglandins such as those of the cyclopentenone family
(Morteau, 1999). Therefore, the body exposed to DON has the defensive strategies with the
COX-2 and IL-6 enhanced to some degree. It should be noted that NS-398 did not

completely inhibit IL-6 gene expression and appeared to be equipotent to indomethacin

104

which is a comparatively weaker COX inhibitor. There may be several reasons for this
observation. First, the 5 mg/kg NS-398 dose might not be optimal for complete inhibition
of COX-2 expression. Previous studies reported that NS-398 selectively inhibits COX-2 and
suppresses PGE2 production in inflamed tissue to the level seen in noninflamed tissues at
10-30 mg/kg in vivo (Arai et a1. , 1993; Futaki et al. , 1993; Futaki et al. , 1994; Futaki et al. ,
1997).Second, although both indomethacin and NS-3 98 block COX-2 activity, each can have
different production inhibition efficiency such as diverse prostaglandins and thromboxanes
(Tegeder et al., 2000). If specific COX-2 products are important in IL-6 gene regulation, a
differential alteration of COX-2 products by INDO or NS-3 98 might affect IL-6 production
in different ways. The third and most likely possibility is that a COX-2 independent pathway
was also involved in DON-mediated IL-6 induction. For this reason, COX-2 KO mice were!
adopted in order to confirm the positive regulation of IL-6 gene expression by COX-2
metabolites. Although the IL-6 response to DON was significantly ablated compared to wild-
type mice, COX-2 deficient mice were indeed capable of mounting a significant IL-6
response thus suggesting an COX-2-independent pathway existed in tandem with COX-2
dependent pathway.

Taken together, DON was found to induce COX-2 expression in vitro and in vivo and
this mediated induction of IL-6 gene expression. The capacity of COX-2 metabolites to
induce IL-6 production may be a crucial mechanism for DON-induced IgA nephropathy and
other diverse immunotoxic effects such as shock and defensive role. Further research should
be directed understanding mechanisms for DON-induced COX-2 expression as well as the

relationship between trichothecene structure and such inductive effects.

105

CHAPTER 5.
EFFECT OF FISH OIL/(N-3) PUFA ON DON-INDUCED

IL-6 AND cox-2 PRODUCTION '

 

1 Most part of this work has been submitted for publication in the title “Deoxynivalenol-Induced
Mitogen-Activated Protein Kinase Phosphorylation and IL-6 Expression in Mice Suppressed by Fish Oil” by

Moon, Y.,and Pestka, J. J. in Journal of Nutritional Biochemistry.

106

ABSTRACT

Deoxynivalenol (DON)-induced IgA hyperelevation and mesangial IgA deposition
in mice mimics the early stages of human IgA nephropathy (IgAN). Among potential
mediators in this disease, interleukin-6 (IL-6) is likely to play a particularly critical role in
IgA elevation and disease exacerbation. Based on previous findings that dietary fish oil (FO)
suppresses DON-induced IgAN, we hypothesized that FO inhibits induction of IL-6
expression by this mycotoxin in vivo and in vitro. Mice were fed modified AIN 93G diet
amended with 7% corn oil (CO) or 1% corn oil plus 6% menhaden fish oil (F0) for up to 8
wk and then exposed acutely to DON by oral gavage. DON-induced plasma IL—6 and splenic
mRNA elevation in F O-fed mice were significantly suppressed when compared to the CO-
fed group after 8 wk. The effects of F0 on phosphorylation of mitogen-activated protein
kinases (MAPKS), critical upstream transducers of IL-6 upregulation, were also assessed.
DON-induced phosphorylation of extracellular signal regulated protein kinases 1 and 2
(ERKl/Z) and c-Jun N-terminal kinases 1 and 2 (JNKl/2) by DON was significantly
suppressed in spleens of mice fed with FO, whereas p38 was not. Splenic COX-2 mRNA
expression, which has been previously shown to enhance DON-induced IL-6, was also
significantly decreased by F0, however, plasma levels of the COX-2 metabolite,
prostaglandin E2, were not affected. To confirm in vivo findings, the effects of pretreatment
with the two primary n-3 PUFAs in F0, eicosapentaenoic acid (20:5[n-3]; EPA) and
docosahexaenoic acid, (22:6[n-3]; DHA), on DON-induced IL-6 expression were assessed

in LPS-treated RAW 264.7 macrophage cells. Consistent with the in vivo findings, both EPA

107

 

and DHA significantly suppressed DON-induced IL-6 superinduction by DON, as well as
impaired DON-induced ERK1/2 and IN K1/2 phosphorylation. In contrast, the n-6 PUFA
arachidonic acid (20:4[n-3]) had markedly less effect. Taken together, the capacity of F0 and
its component n-3 PUFAs to suppress IL-6 expression as well as ERK 1/2 and JNK 1/2
activation might explain, in part, the reported suppressive effects of these lipids on DON-

induced IgA nephropathy.

108

INTRODUCTION

Consumption of (n-3) polyunsaturated fatty acids (PUFAs) in fish oil (FO)-containing diets
has been associated with modulation of a diverse array of immunological events that include
suppression of lymphocyte proliferation, antigen presentation, MHC II expression, cytotoxic
T lymphocyte activity, NK cell activity, macrophage-mediated cytotoxicity, and
neutrophil/monocyte chemotaxis (Wu and Meydani, 1998; Kehn and Femandes, 2001 ; Weiss
et al. , 2002). These functional effects have been the rationale for experimental and clinical
attenuation of acute inflammatory, delayed-type hypersensitivity, autoimmune and transplant
rejection responses by (n-3) PUFA (Otto et al. , 1990; Taki et al. , 1992; Harbige and Fisher,
2001; Ergas et al. , 2002; Venkatraman and Meksawan, 2002). The mechanisms for these
effects may be related to the capacity of (n-3) PUFAs to modulate inflammatory mediator
profiles and concentrations, immune cell populations by apoptotic signaling and cell-to-cell
communication (Meydani et al. , 1991; Purasiri et al. , 1994; von Schacky, 1996; Jolly et al. ,
2001)

Human IgA nephropathy (I gAN ), the most common type of glomerulonephritis in the
world, is characterized by the presence of prominent IgA deposits in the mesangial region
as discerned by irnmunofluorescence microscopy (D’Amico, 1987; D'Amico, 2000).
Etiological factors that have been associated with this disease include prior mucosal
infection, genetic predisposition and diet. Dietary supplementation with fish oil has been
suggested to benefit patients with immune-related renal diseases including IgAN, lupus

nephritis and cyclosporine-induced nephrotoxicity (Donadio, 1991). Despite supportive data

109

from several randomized clinical trials evaluating efficacy of fish oil in treating IgAN
(Hamazaki et al., 1984; Donadio et al., 1999; Donadio et al., 2001), there have been
conflicting findings (Bennett et al., 1989; Pettersson et al., 1994). To clarify these issues,
animal models might potentially be used to elucidate mechanisms for intervention in IgAN
with F O or its component (n-3) PUFAs. Several animal models for IgAN have been
developed using approaches that include injection with IgA immune complex, mucosal
immunization, viral infection and use of genetically modified mice prone to mesangial IgA
deposition (Montinaro et al., 1999). Notably, dietary exposure to the mycotoxin
deoxynivalenol (DON or vomitoxin) has been found to cause clinical signs analogous to
early stages of human IgAN (Pestka et al. , 1989; Dong et al. , 1991). DON, a trichothecene.
produced by F usarium graminearum and F. culmorum, is frequently found in grain-based
agricultural commodities from the Midwestern United States such as wheat, barley and corn
(Rotter et al., 1996). The toxin is an potent inhibitor of protein synthesis that can impact
actively dividing tissues with the immune system being particularly susceptible (Rotter et al. ,
1996; Bondy and Pestka, 2000). Acute exposure to high doses of DON can induce rapid
diminution of lymphoid tissues via apoptosis and lymphopenia in experimental animals.
Paradoxically, low dose or chronic DON exposure can be immunostimulatory as evidenced
by its capacity to induce cytokine gene expression in vivo (Zhou et al., 1997; Zhou et al.,
1999). Dietary DON exposure induces elevation of serum IgA, mesangial kidney IgA
deposition and hematuria in the mice which are hallmarks of IgAN (Pestka et al. , 1989; Dong
er a1. , 1991). Recently, we have shown that F O-containing diets impair these
immunopathologic endpoints (Pestka er al. , 2002).

Aberrant IgA production upon DON ingestion appears to be mediated in part by

110

superinduction of cytokine gene expression in mononuclear phagocytes (Yan et al. , 1997;
Yan et al., 1998) and T helper cells (Warner et al. , 1994). Among these cytokines,
interleukin-6 (IL-6) is recognized to be particularly important to the modulation of mucosal
B cell differentiation to IgA-secreting plasma cells (Beagley et al., 1989; McGhee et al.,
1991; F ujihashi et al., 1992; Ramsay et al., 1994). In addition to effects of IL-6 on IgA
production, this cytokine might also promote pathogenic progresses in IgA nephropathy by
enhancing mesangial cell proliferation and producing proinflammatory lipid mediators and
superoxide anion (Chen et al. , 1995; Taniguchi et al. , 1999; Harada et al. , 2002). Therefore,
IL-6 induction by DON might be critical to both early stage IgA production and the later
disease severity of IgA nephropathy. In support of the former possibility, genetic disruption
of IL-6 in mice markedly reduces DON-induced increases in serum IgA as well as kidney
IgA deposition in mice (Pestka and Zhou, 2000). The purpose of this investigation was to test
the hypothesis that dietary F O impairs DON-induced IL-6 gene expression. The results
demonstrated that F O and (n-3) PUF As impair upregulation of IL-6 by DON both in vivo and
in vitro. Furthermore, these ameliorative effects were associated with decreased activation

of mitogen-activated protein kinases (MAPKs).

lll

 

MATERIALS AND METHODS

Animal studies. All animal handling was conducted according to the guidelines
established by the NIH. Experiments were designed to minimize numbers of animals
required to adequately test the proposed hypothesis and approved by Michigan State
University Laboratory Animal Committee. For most studies, male B6C3F1 mice (6 to 7 week
old) were used. These were obtained from Charles River (Portage, MI) and acclimated for
one week in a humidity- and temperature-controlled room with an alternating 12 hr light and
dark cycle. Mice were housed singly in the environmentally protected cages which consisted
of a transparent polycarbonate body with a filter bonnet, stainless steel wire lid and a layer
of heat-treated hardwood chips.

All dietary constituents were purchased from Dyets (Bethlehem, PA). Experimental
diets were based on the AIN-93G formulation (Reeves er al., 1993) and consisted of the
following ingredients (per kg): 35 g AIN-93G mineral mix, 10 g AIN-93 vitamin mix, 200
g casein, 397.49 g cornstarch, 132 g Dyetrose (dextranized cornstarch), 100 g sucrose, 50 g
cellulose, 14 mg t-butylhydroquinone (TBHQ), 3 g L-cystine, and 2.5 g choline bitartrate.
Corn oil (CO) and menhaden fish oil (FO), each of which contained 200 mg/kg of test-butyl
hydroquinone (TBHQ), were used to amend the basal diet to yield two kinds of experimental
diets containing the following (per kg): (1_) 70 g CO (CO group); and (2) 10 g CO plus 60 g
F 0 (PD group). The basal 1% level of CO was included to ensure that minimal (n—6) PUFA
requirements were met. Relative amounts of (n-3) and (n-6) PUFAs are shown in Table 3.

Equivalent amounts of TBHQ were added to both stock oils to prevent confounding effects

112

 

from this antioxidant.

Mice were fed experimental diets for 2, 4, and 8 wk and then orally gavaged with
DON (25mg/kg bw) Following DON treatment, animals were held for 30 min or 3 hr and
then bled retroorbitally under metaflurane anesthesia for plasma IL-6 and PGE2 quantitation.
Mice were immediately euthanized by cervical dislocation and spleens removed for Western

blot analysis and mRNA measurement.

Cell culture studies. RAW 264.7 murine macrophage cells(American Type Culture
Collection, Rockville, MD) were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM,
Sigma Chemical Co., St. Louis, MO) supplemented with 10 % (v/v) heat-inactivated fetal
bovine serum (FBS, Atlanta Biologicals Inc, Norcross, GA), 100 unit/ml penicillin (Sigma),
and 100 mg/ml streptomycin (Sigma, St. Louis, MO) in a 5 % CO2 humidified incubator at
37°C. Macrophage cell number and viability were assessed by trypan blue (Sigma) dye
exclusion using a hematocytometer (Strober, 1991).

Supplementation of media with fatty acids was based on previously published
methods (Lo et al., 1999; Lo et al., 2000). Briefly, fatty acid-free bovine serum albumin
(BSA, Roche, Indianapolis, IN) and fatty acid (eicosapentaenoic acid 20:5[n-3], EPA); or
docosahexaenoic acid, 22:6[n-3], DHA; or arachidonic acid, 20:4[n-6], AA) (Sigma
Chemical Co., St. Louis, M0) were mixed in Ca2+, Mg2+ free PBS at a 3:1 molar ratio under
nitrogen on a rocking shaker for 24 hr at 37 °C. These mixtures were then diluted with
serum-flee DMEM media to desired concentration of fatty acid. Media were freshly prepared
before each experiment. Before adding fatty acid-amended media, adherent RAW 264.7

cells (2.5 x105/ml) were incubated in serum free DMEM medium for 18 hr. Cells were then

113

 

cultured with serum-free fatty acid-amended medium for 24 hr. For IL-6 and COX-2 studies,
cells were cultured with or without DON and/or LPS for an additional 24 hr after replacing
with fresh DMEM medium supplemented with 10 % heat-inactivated F BS. For MAPK
studies, cells were incubated for 48 hr with serum-free fatty acid-amended media and then

exposed to DON or vehicle for 30 min.

Interleukin 6 (IL-6) ELISA. Plasma or cell culture supernatant diluted in 0.1M
phosphate buffered saline (PBS, pH 7.2) and incubated for 1 hr at 37 °C in Immunolon IV
removawell microtiter strips (Dynatech Laboratories, Chantilly, VA) which were coated with
1 pg/ml purified rat anti-mouse IL-6 (Pharmingen, San Diego, CA) diluted in coating buffer
(0.84 % [w/v] sodium bicarbonate, pH 8.2). After washing 4 times with PBS containing 0.05
% (v/v) Tween 20 (PBST), wells were incubated with 100 “L 1.5 pg/ml biotinylated rat anti-
mouse-IL-6 (Pharmingen, San Diego, CA) for 1 hr at room temperature. Wells were washed
6 times and incubated for 1 hr with 100 [1L 1.5 pg/ml horseradish peroxidase (HRP)-
conjugated Streptoavidin (Sigma, St. Louis, MO) in PBST at room temperature. After
washing 8 times with PBST, substrate (100 pl) consisting of 3', 3', 5', 5'- tetramethyl
benzidine (100 pg/ml, F luka Chemical Co. Ronkonkoma, NY) in 0.1 M citric phosphate
buffer (pH 5.5) and 0.003 % (w/v) hydrogen peroxide was added to each well and incubated
for 10 min at room temperature for color development. The reaction was terminated with
100 pl 6N sulfuric acid. Absorbance was read at 450 nm with Vmax Kinetic Microplate
Reader (Molecular Devices, Menlo Park, CA ) and IL-6 was quantified using the

manufacturer’s software.

114

Detection of IL-6 and COX-2 mRNA by RT -competitive PCR. Total RNA from
murine tissue was extracted with Trizol reagent (Life Technologies, Gaithersburg, MD)
according to the manufacturer’s instructions. RNA (100 ng) from each sample was
converted to cDNA by reverse-transcriptase (Riedy et al., 1995) and resultant cDNA was
amplified competitively with truncated internal standard of cDNA constructed by the
bridging—deletion method (Hall et al. , 1998). Amplification was performed in a 9600 Perkin
Elmer Cycler (Perkin-Elmer Corp., Norwalk, CT) using the following parameters: 30 cycles
of reactions of denaturation at 94 °C for 30 s, annealing at 55 °C for 45 8 (IL-6) or 56 °C for
45 s (COX-2), and elongation at 72 °C for 45 s. An aliquot of each PCR product was
subjected to 1.5 % agarose gel electrophoresis and visualized by staining with ethidium
bromide. Primers were synthesized at Michigan State University Molecular Structure
facility. The 5‘ forward (F) and 3' reverse (R)-complement PCR primers for amplification
of mouse COX-2 and IL-6 cDNA were ACACTCTATCACTGGCATCC (COX-2F),
GAAGGGACACCCTITCACAT (COX-2R), TTCACAAGTCCGGAGAGGAG (IL-6F),
and TGGTCTTGGTCC'ITAGCCAC (IL-6R) respectively. The final end-product of
amplified cDNAs were 584 bp of COX-2 , 500 bp of COX-2 internal standard cDNA, 488
bp of IL-6, and 400 bp of IL-6 internal standard cDNA. Densitometric ratios of native cDNA
to each internal standard cDNA were used to make each standard curve for calculating cDNA

concentrations in RT reaction products.

PGE2 assay. Blood was collected in vacutainers containing 1 mM EDTA and 10 M
indomethacin, and centrifuged at 4000 xg for 5min. Plasma supernatant was diluted to 1:5

in 0.1 M phosphate buffer solution. Samples were cleaned up with a PGE2 affinity sorbent

115

 

to remove interfering substances. PGE2 affinity sorbent (50 ml, Cayman Chemical CO., Ann
Arbor, MI) was added to 1 ml of the prepared samples, and the suspension was gently mixed
for 1 hr on the rocker at 25°C. Samples were briefly centrifuged at 1500 x g to sediment the
sorbent and the sediment was then washed once with 1 ml of 0.1 M phosphate buffer.
Sorbent pellets were resuspended in 0.5 ml elution solution (95 % ethanol solution), mixed
by vortexing, and centrifuged briefly at 1500 x g. The supernatant was evaporated, and
residue in dissolved in EIA assay buffer. The solution was then analyzed by ELISA (Cayman

Chemical Co., Ann Arbor, MI) according to manufacturer’s instructions.

Western blot analysis. At the time of harvest, cells were washed with ice-cold
phosphate buffer, lysed in boiling lysis buffer (1% (w/v) SDS, 1.0 mM sodium ortho-
vanadate, and 10 mM Tris pH 7.4), and sonicated for 5 seconds. For spleen samples, frozen
tissue was homogenized in the boiled lysis buffer and sonicated for 10 seconds. Protein was
measured by the Lowry method using Dc protein assay reagent (Bio-Rad, Cambridge, MA).
Extracts (10 pg) were mixed with Laemmli sample buffer (Bio-Rad), and boiled for 5 min
before resolving on a 10 % (w/v) acrylamide gel. Resolved proteins were transferred to
PVDF membrane and blocked with Tris-buffered saline (10 mM Tris-HCl pH 7.5, 100 mM
NaCl) containing 0.1 % (v/v) Tween-20 and 1% (w/v) BSA (TBST-BSA). The membrane
was incubated for 1 hr with MAPK antibodies (rabbit IgG, New England Biolab, Beverly,
MA) at 1:1000 dilution in TBST-BSA, and then were washed three times with TBST. The
membrane was then incubated with horseradish peroxidase (HRP)-conj ugated anti-rabbit IgG

(Cell Signaling, Beverly, MA).

116

 

Statistics. Data were analyzed by test using the SigmaStat Statistical Analysis
System (Jandel Scientific, San Rafael, CA, USA). For comparison of two groups of data,
Student’s T test was performed. For comparison of multiple groups, data were subjected to
one way analysis of variance (ANOVA) and pairwise comparisons made by Student-
Newman-Keuls (SNK) method. Data not meeting normality assumption were subjected to
Kruskal-Wallace AN OVA on Ranks and the pairwise comparisons made by SNK method.

A p value of less than 0.05 was considered statistically significant.

117

 

Table 3. Fatty acid composition of oils used for experimental diets‘.

 

 

Fatty Acid Corn on Diet (%)2 Fish on Diet (%)3
g/ 100 g total fatty acids

14:0 - 7.7

16:0 10.8 16.2
16:1(n17) - 10.8
16:2(n-4) - 1.5
16:3(n-3) - 1.5
16:4(n-l) - 1.5
18:0 2.1 2.7
18:1(n-9) 26.5 13.5
18:2(n-6) 60.0 9.7
18:3(n-3) - 1.5

18:4(n-3) _ - 3.0

20:1(n-9) - 1,4
20:4(n-3) - 1.2
20:4(n-6) - 0.8
20:5(n-3) - 13.3
21 :5(n-3) - 0.7
22:5(n—3) - 2.1
22:6(n-3) - 7.8
2 SFA 12.9 26.7
2 MUFA 26.5 25.6
2 PUFA 60.0 44.5
2 (n-6) PUFA 60.0 10.5
2 (N-3) PUFA 0.6 26.6

 

 

I Only the major fatty acids are shown. SFA, saturated fatty acids; MUFA, monounsaturated fatty acids;
PUFA, polyunsaturated fatty acids.

2 1000 g/L corn oil.
3 857 g/L fish oil and 143 g/L corn oil.

118

mm"; — .3 ‘

 

RESULTS

Fish oil composition was shown in Table 3 based on grouping categories of fatty
acids. Prominent difference between CO and F O was the composition of (n-6) and (n-3)
PUFA. FO contains high amount of (n-3) PUFA, which has been well known to suppress
diverse immune-related diseases and inflarnmations. Other than (n-3) PUFA with
ameliorating action on IgAN model (Chandrasekar and Fernandes, 1994), antioxidant effect
by added TBHQ was excluded because F0 and CO contained the same amount of this
antioxidant. In the diet plan, we also strengthened the basic level of CO to ensure optimal (n~

6) fatty acid intake.

Fish oil feeding suppressed IL-6 production in mice exposed to DON

After feeding with oil-containing diets for 2, 4, and 8 weeks, mice were acutely
exposed to vehicle (water) or 25 mg/kg DON. DON modulates bunches of cytokine array
including proinflammatory mediators such as IL-6 and TNF-a (Zhou et al., 1997; Zhou et
al. , 1999). At 2 and 4 wk, the difference in the DON-enhanced plasma IL-6 between CO-fed
and F O-fed mice was not significant (Data not shown), but FO-fed mice for 8 weeks showed
reduced IL-6 response to the toxin compared to CO-fed mice (Fig. 24). Furthermore, the
induction of IL-6 transcript by DON (25 mg/kg) in the spleen of F O-fed mice was also lower
than that in CO-fed mice and this reduced response was significant from 4 wk feeding (Fig.

25). The IL-6 mRNA level in F0- or CO-fed mice was almost maximal around 3 hr after

119

 

 

Vehicle DON Vehicle DON 3 hr.

 

 

BGC3F1 male
: 6 °/o Fish oil
7 % Corn 0" 1 % Corn oil
5 E 2, 4, 8 wk [-
£ 1 i 1 0.5 or I
1;

 

W
5‘

 

Plasma lL-6 (ng/ml)
o a is 8 i :9 3

 

 

r——-3-——1,._.=__1

I I 1 i 1

CO CO/DON FO FO/DON

 

Figure 24. A. Feeding plan with corn oil or fish oil in B6C3F1 male mice. Details are
described in methods. B. Effect of F0 diet on plasma IL-6 production in mice acutely
exposed to DON or vehicle. CO and F O diets were fed to male B6C3F1 mice for 8 wk and
25 mg/kg DON or vehicle was administered via gavage. Afler 3 hr of the toxin treatment,
blood was collected for IL—6 ELISA analysis. Asterisk indicates significant difference
(P<0.05) of FO/DON group from CO/DON group.

120

 

53‘

 

 

 

 

 

   

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

l 2 wk 4 wk 8 wk

1m‘ i: ' l l
a a) . l , g a:

3% 4°“ { i
S 33 g j 5
‘5 ~ » L3? El :3 __ . 5372}

z z z z z 2
g a s a “g a s a g a E a
0 8 E E 0 8 E E o 8 9. E

Figure 25. Effects of F0 diet on splenic IL-6 mRNAs of mice exposed to DON or vehicle
(V H). CO and F0 diets were fed to male B6C3Fl mice for 2, 4, and 8 wk and 25 mg/kg DON
or VH was administered via gavage. After 3 hr of the toxin treatment, spleens were analyzed

for IL-6 mRN A levels using RT-competitive PCR. Asterisk indicates significant difference

(P<0.05) of F O/DON from CO/DON group at corresponding exposure times.

121

 

DON gavage which was corresponding with IL-6 mRN A kinetics in normal mice exposed

to DON (Zhou et al. , 1997).

Fish oil feeding had suppressive effect on DON-induced COX-2 mRNA level but not on
COX-2 activity

As another important proinflammatory mediator, prostaglandin E2 (PGE2) was
measured because (n-3) PUFA displaces membranous arachidonic acid and reduce PGE2
production (Lo et al., 1999; Tanaka et al., 1999). Moreover, cycloooxygenase-2 (COX-2)
is induced by DON (Moon and Pestka, 2002) and fatty acid feeding can change the pool of
the enzyme substrate. Therefore, PGE2 production by DON is expected to be modulated by
the change of fatty acid composition from different oil diet. However, there was little
significant difference in PGE2 production by DON between CO- and FO-fed mice although
the dietary FO have a trend of efficacy (Fig. 26A). DON-induced COX-2 mRN A level in
FO-fed mice has decreased significantly from the level in CO-fed mice which was exposed

to DON (Fig. 268).

Dietary F0 weakened the MAPK response to DON in mice.

Among diverse signaling pathways, trichothecene mycotoxins including DON have
been previously shown to activate MAPK in T cells and macrophages via a ribotoxic stress
response or oxidative stress response, and these findings were further associated with toxin-
induced apoptosis depending on the dose regimen employed (Shifrin and Anderson, 1999;
Yang et al., 2000a). A critical finding in Figure 27 is a definitive link between DON-

activated MAPK and FO-feeding.

122

400

 

350 —
300 1

250+ T

200 - 5 V ~ g.

 

 

PGEz (pg/ml)

150 -    

100 -

 

CO CO/ DON FO FO/DON

 

 

 

 

 

 

 

 

 

 

 

 

 

Relative COX-2 mRNA
(pg/ml cDNA)
&

 

 

 

 

 

 

 

 

 

 

 

 

 

CO CO/DON FO FO/DON

Figure 26. Effect of F0 diet on COX-2 metabolism in mice acutely exposed to DON or
vehicle (VH). CO or F0 diet was fed to male B6C3F1 mice for 8 wk and 25 mg/kg DON or
VH was administered via gavage. Three hr after toxin treatment, spleens were analyzed for
COX-2 mRN A levels (A) using RT-competitive PCR and for PGE2 measurement by ELISA.

Asterisk indicates significant difference (p<0.05) of FO/DON group fiom CO/DON group
at each exposure time.

123

El

CO F0 CO FO

 

 

VH DON VH DON VH DON VH DON
I"—1| ll ”—1 hi II II I

 

P-ERK1I2 7

 

 

 

 

 

 

 

 

 

 

 

 

 

 

3,, : . . _ g....._,,,
"-t.‘ ~ ‘
P-p38 “if?“
.............. l, . 1
P-JNK1/2 “' '~'~- ’0‘ 3(M, , g M . . ,,,, t...

 

 

 

 

 

Figure 27. Effect of F0 diet on MAPK phosphorylation in spleens of mice exposed to DON
(25mg/kg) or vehicle (V H). Male B6C3F1 mice were fed with oil-containing diet for 8 wk
and DON or VH was administered to mice. Spleens were removed 0.5 and 3.0 hr later and

analyzed for MAPK phosphorylation by Western blotting.

124

Mice fed with CO- or F O-containing diets for 8 weeks were exposed to 25 mg/kg
DON for 0.5 or 3 hr and whole spleen was collected for Western blot analysis (Fig. 27).
When mice were exposed to DON for 30 min, F O-feeding significantly suppressed DON-
induced ERK1/2 and JNK1/2 activation, but there was no suppression in DON-activated p3 8
MAPK in fish oil fed mice, which showed even a little increased activation. After 3 hr
exposure to DON, the effects of MAPK activation by DON were weakened and JN 1(1/2
activation almost disappeared. However, the suppressive effect of F0 on DON-activated
ERKl/Z was persistent and p38 level showed similar trend to 30 min exposure. The
activated MAPK is also involved in the transcriptional or post-transcriptional regulation of
lL-6 gene expression (Beyaert et al. , 1996; Leonard et al. , 1999; Tuyt et al., 1999; Winzen
et al., 1999), and thus FO feeding can affect DON-induced IL-6 expression by regulating

MAPK signaling pathway.

IL-6 superinduction by DON was retarded by (n-3) PUFA preincubation in macrophage
cells

To confirm the results from feeding study, specific (n-3) PUFAs were administered
to check their suppressive action on DON-induced IL-6 production in cell culture model.
DON itself does not induce IL-6 production in macrophage cells which is supposed to be a
main source of this proinflammatory cytokine. However, DON can superinduce IL-6 in the
presence of lipopolysaccharide (LPS) in macrophage cells (RAW 264.7 cells) (Wong et al. ,
1998; Wong et al. , 2001) and this superinduction model was applied for assessing the effects
of (n-3) PUFA on DON-induced IL-6 production in vitro. Before the IL-6 superinduction

with DON and LPS in RAW 264.7 cells, cells were pre-treated with (n-3) PUFA-bovine

125

serum albumin (BSA) complexes, arachidonic acid (AA)-BSA complexes, or vehicle(PBS)-
BSA complexes for 24 hr. Arachidonic acid, one of (n-6) PUFA, was compared with (n-3)
PUFA, eicosapentaenoic acid (20:5(n-3), EPA) or docosahexaenoic acid (22:6(n-3), DHA).
Pre-treatment with EPA or DHA retarded DON-mediated IL-6 superinduction and the
decrease in IL-6 was positively related with the increased concentration of (n-3) PUFA (Fig.
28). PUFA also has been known to induce programmed cell death in several systems
(Latham et al. , 1999; Chen and Istfan, 2000; Fyfe and Abbey, 2000; Arita et al. , 2001;
Latham et al. , 2001) but the PUFA concentrations used here were not significantly cytotoxic
to the cells. Cellular viability was maintained over 85 % with all the treatment of chemical
combinations in the study (Data not shown). Endotoxin-mediated IL-6 production is known
to be down-regulated by dietary FO (Sadeghi et al., 1999). Therefore, the suppressed IL-6
superinduction by (n-3) PUFA might be also due to its effect on LPS action to some degree.
Taken together, (n-3) PUFA as crucial components of fish oil decreased DON-mediated IL-6

production in vitro.

MAPK activation by DON was suppressed in (n-3) PUFA-pretreated macrophage cells
As with the dietary oil feeding study, the direct effect of (n-3) PUFA on
phosphorylation of DON-activated MAPK was analyzed because MAPKS are evidently
involved in IL-6 production. RAW 264.7 cells were preincubated with IOOuM of each fatty
acid for 48 hrs and then exposed to 250 ng/ml DON for 30 min. As consistent with a
previous study (Moon and Pestka, 2002), DON activated three major MAPKS (Fig 29).
Moreover, pretreatment with EPA or DHA caused less ERK1/2 and JNK1/2 activation by
DON than that of vehicle or arachidonic acid. These in vitro results agreed with the MAPK

suppression by F O feeding in DON-exposed mouse model (Fig. 27). Therefore, the reduced

126

levels of ERK1/2 and JNK1/2 activation by (n-3) PUFA might contribute to less IL-6
production in DON-exposed cells.

Interleukin-6 (ng/ml)

 

 

LPS (200nglmi)
DON (100nglml)
AA(1uglm|)

AA(10ug/ml)

EPA(1ug/ml) - - - - - +
EPA (10uglml)
DHA(1ug/ml) - - - - -
DHA(10uglml)

I
+
+

I
I
+
+++
+
+
+
+
+

l
l
I
I
+
r
I
I
I

Figure 28. PUFAs on DON-induced IL-6 production in murine macrophage cells. RAW
264.7 cells were incubated in serum free DMEM medium for 18 hr and then exposed to the
fatty acid AA, EPA, or DHA)-containing serum free DMEM medium for 24 hr. Cells were
further incubated in the presence of DON and/or LPS with fresh DMEM medium
supplemented with 10% (v/v) heat-inactivated F BS combination. IL-6 production in

supernatant was measured by ELISA. Bars with different letters are significantly different
(p<0.05).

127

PUFA: - - AAEPA DHAAAEPA DHA
DON:-++++---

 

P-ERK1I2

 

 

 

 

P-p38

 

 

 

 

7.7.: P-JNK1I2

 

 

 

Figure 29. Effect of PUFAs on DON-induced MAPK phosphorylation in macrophage cells.
RAW 264.7 cells were incubated in serum free DMEM medium for 18 hr. Cells were then
incubated with 1 10 1.1M fatty acid AA, EPA, or DHA-containing serum free DMEM medium
for 48 hr and then exposed to 250 ng/ml DON or vehicle (VH) for 30 min. Cellular lysate

was analyzed for Western blotting.

128

DISCUSSION

Whereas high concentrations of trichothecene completely shut down translation and
induce apoptosis, sub-inhibitory concentrations of these mycotoxins can upregulate cytokine
production by elevating transcription factor activity (Wong et al. , 2002) and increasing
mRNA stability (Li et al., 1997; Wong et al., 2001). Of several cytokines upregulated by
DON in vivo, IL-6 appears to play a pivotal role in promoting polyclonal IgA secretion based
on: (1) prolonged kinetics and magnitude of the IL-6 response relative to other cytokines
(Zhou et al. , 1997; Zhou et al. , 1999) 2) reduced IgA production by neutralization with anti-
IL-6 antibody in ex vivo Peyer’s patch cultures (Yan et al. , 1997); and (3) the resistance of
IL-6 knockout mice to DON-induced IgAN (Pestka and Zhou, 2000). Moreover, induction
of IL-6 might be further associated with the cytotoxic and shock-like responses that occur
during acute DON intoxication in mice (Zhou et al. , 1999). Given the importance of IL-6
production in the DON-induced IgAN model, suppression of this cytokine appears to be a
viable strategy for preventing elevation of IgA as well as IgA-immune complex at serum
level and kidney mesangium.

Dietary fish oil containing (n-3) PUFA has been linked to the amelioration of IL-6-
mediated immunopathogenic sequelae and inflammation including autoimmune nephritis and
cardiovascular diseases (Chandrasekar and F emandes, 1994; McCarty, 1999; Venkatraman
and Chu, 1999). DON-induced IgA nephropathy is also retarded by FO—feeding in the mouse
model (Pestka et al. , 2002). The data presented here suggest that dietary fish oil suppresses

DON-induced IL-6 in vivo. The observations that IL-6 superinduction is suppressed by (n-3)

129

PUFA pre-treatment in the cell culture model is supportive of the in vivo studies. There are
several possible explanations for the decreased IL-6 response to DON by FO-feeding or
pretreatment with (n-3) PUFA.

ERK1/2 and 1N K1/2 are known to be crucial signaling mediators of IL-6 induction
(Leonard et al., 1999; Tuyt et al., 1999) and fish oil components such as DHA and EPA
inhibit ERK 1/2 activity in human T cells, macrophages and tumor cells (Lo et al., 2000;
Denys et al., 2001b; Denys et al., 2002). F0 diets suppressed response in the ERK1/2 and
JNK1/2 to DON in this study and similar effects were found in vitro. Therefore, (n-3) PUFA-
modulated MAPK suppression might contribute to the reduced IL-6 response. Thus one
possible explanation for depression of DON-induced IL-6 is that altered MAPK signaling
by F O or (n-3) PUFA can affect DON-mediated IL-6 gene expression.

Fatty acids are known to modulate activity of signaling molecules such as
phospholipase C and protein kinase C (PKC) (May et al., 1993; Hwang et al., 1996). The
molecular mechanism for inhibitory action of (n-3) PUFAs on ERK “2 has been previously
investigated in relation to PKC (Denys et al., 2001a; Denys et al. , 2001b). Notably, DHA
and EPA inhibit PKC or and e, which are known to be located upstream of MAP kinase
cascade (Clark and Murray, 1995). (n-3) PUFAs inhibit the enzymatic activity of theses
PKC isoforms either via direct interaction with phosphatidylserine binding site of PKC
(N ishizuka, 1995) or indirectly by producing diacylglycerol-containing PUFA (Marignani
et al., 1996). It is thus possible that DON-activated MAPK could be suppressed by PKC
inhibition by (n-3) PUF A. It should be noted that (n-3) PUF A have been recently shown to
suppress ERK 10 activity through PKC-independent pathway (Denys et al., 2002).

The p38 signaling pathway is another possible modulator of promoter activity and

130

mRNA stability of IL-6 gene expression (Beyaert et al., 1996; Winzen et al., 1999).
Interestingly, p3 8 MAPK activation by DON was not reduced but rather was lightly activated
in FO-fed mice. This observation might explain the incomplete reduction of IL-6 production
in F O-fed mice. Relatedly, DHA is known to activate p38 MAP kinase in vascular smooth
muscle to mediate apoptosis (Diep et al., 2000). Furthermore, p38 MAP kinase plays a
critical role in transcription and mRN A stability of COX-2 DON-induced COX-2 (Moon and
Pestka, 2002), which might explain why FO had little effect on PGE2 produced by DON and
partial reduction in DON-induced COX-2 mRN A by dietary F O.

A second possible explanation for impaired DON-induced IL-6 expression is that (n-
3) PUFA might act as ligands for peroxisome proliferator—activated receptor (PPAR), the
steroid-thyroid superfamily of nuclear receptor. Notably, (n-3) PUFA bind to or modulate
PPARor and PPARy, which regulate specific gene transcription by binding to PP response
element (PPRE) via two zinc finger mitifs in DNA-binding domain of PPAR (Krey et al.,
1997; Hihi et al. , 2002). Although PPARy does not mediate the negative regulation of IL-6
(Thieringer et al. , 2000), PUFA—PPARor signaling may play a inhibitory role in the
proinflammatory gene expression (Staels et al., 1998; Yu et al., 2002). However, (n-6)
PUFA can also effect PPAR-mediated signaling. Indeed, high concentrations of AA did
slightly suppress DON-induced IL-6 superinduction in vitro. Thus, further studies are
needed on structure function effects of (n-3) and (n-6) PUFA in suppressing IL-6 gene
expression.

Cross-talk between PPAR and MAPK signaling pathways can also occur (Camp and
Tafuri, 1997; Camp et al. , 1999; Roberts, 2002). Activated MAPKS modulate

phosphorylation of PPAR phosphoprotein, which contribute to the reduction in promoter

131

activation by exogenous ligands. Therefore, ERK1/2 and JNK1/2 suppressed by (n-3)
PUFA-containing fish oil might be related to more active PPAR-mediated function and, thus,
reduced DON-induced IL-6 transcription.

A third explanation for the (n-3) PUF A effects is alteration in profile of
cyclooxygenase (COX) metabolites. It is well established that (n-3) PUFAs lower the level
of PGE2, LTB4, and TXBZ by changing the substrate pool of cyclooxygenase metabolism
(Tanaka et al. , 1999; Venkatraman and Chu, 1999). Dietary (n-3) PUFA such as EPA and
DHA can be metabolized to form prostaglandins (eg PGE3) and thromboxanes (eg TXA3)
that counterbalance the effects of proinflammatory products (PGE2 or TXA2) derived from
arachidonic acid. Although DHA also suppresses LPS-induced COX-2 expression in
macrophage cells (Lee et al. , 2001), thus gene is upregulated via a feedback pathway upon
longer exposure to EPA (Lo et al. , 1999). A positive association exists between endogenous
COX-2 metabolites (particularly PGE2) and IL-6 synthesis in vitro and in vivo models of
several inflammatory diseases (Dendorfer et al. , l 994; Meyer et al. , 1 994; Meyer et al. , 1 995;
Anderson et al., 1996; Hinson et al., 1996; Williams and Shacter, 1997; Zeng et al., 1998;
Williams et al. , 2000). It is thus possible that FO-mediated changes in COX-2 metabolism
might lead to less IL-6 production. Recently, DON was reported to induce COX-2
expression in macrophage cells (Moon and Pestka, 2002) and DON-induced IL-6 is partially
dependent on COX-2 metabolites (Moon et al. , 2001). Consistent with these findings, in this
study, 8 wk FO feeding inhibited COX-2 mRNA and caused inhibitory trends in PGE2 in
DON-treated mice. Longer feeding might possibly be required to demonstrate a more
suppressive effect of F0 on DON-elicited expression. Therefore, the capacity for F O and (n

-3) PUFAs to modulate DON-induced IL-6 via altered eicasanoid production as well as by

132

modified pools of endogenous lipid metabolites requires additional investigation.

In conclusion, FO-feeding diminished IL-6 production in mice exposed to DON, and
this correlated with suppression of DON-activated ERK1/2 and JNKl/Z. Similarly, (n-3)
PUFA, such as DHA or EPA, reduced DON-induced IL-6 as well as ERK 1/2 and JNK 1/2
phosphorylation in LPS-driven macrophage cells. It will be of further interest to investigate
the direct dietary effect of purified (n-3) PUFA on IgA nephropathy and IL-6 production in
vivo. Moreover, studies on the effects of extended F O feeding as well as kinetics of DON-
induced gene expression in F0 fed mice will clarify questions about (n-3) PUFAs on DON-

induced eicosanoid production as well as MAPK-mediated IL-6 induction.

133

CHAPTER 6

SUMMARY AND PERSPECTIVES

Based on all results of the thesis and previous research, one conclusive model can be
derived as the following cartoon about the mechanism of DON-mediated immunotoxicity
(Fig. 30). Trichothecenes binds to 28S rRNA and inhibits its peptidyltransferase activity.
The ribotoxic stress from the arrested translation can activate MAPK cascades of JNK1/2,
p38 and ERK1/2. Stress-induced MAPK signals can be very important modulators in gene
expression as well as cellular death signals. Notably, activated p38 and ERK1/2 had strong
inducible effects on COX-2 transcriptional activity. Moreover, p38 was very critical
modulator in the DON-mediated COX-2 mRN A stability. Differential responses via MAPK
over DON dose regime could determine cellular fates. Sub-lethal dose of the toxin elicited
pro-inflammatory genes, namely COX-2 and IL-6. These mediators have been also known
to have mitogenic effects on cells after chemical insults as a survival response. By and large,
during these inflammatory and mitogenic process, cells are under anti-apoptotic controls
(Tang et al. , 2001). However, MAPK activation with high doses of DON is considered to
be related to apoptotic cell death by stimulating unknown death factors. Yang et al. (2000)
also observed extremely high dose of DON caused MAPK-involved apoptosis.

IL-6 is known to play a pivotal role in DON-mediated IgA nephropathy (IgAN) as

well as circulatory shock by the toxin. From the results of the thesis, DON-mediated IL-6

134

DON dose:
1

Ribotoxic stress :288 rRNA

 

 

 

 

(III-

 

f cox-2 Gene regulation 1
mRNA stability
i I W’CI'IPIIOII. ;2i ; """"

   
 
 
    
 

MAPK:

 

 

 

, IERK I
COX-
metabzolites I JNK l

l I St

lL-6 gene regulation
I

shook
IgAN

 

 

 

 

 

 

 

 

 

 

Cell death: Apoptosis

 

 

F r gure 30. Proposed mode of COX-2 involvement in DON-induced immunotoxicity

135

production was, in part, due to COX-2 induction and its metabolites. Moreover, fish oil was
demonstrated to suppress ERK and JN K, which might contribute to decreased response of
IL-6 to DON.

There are possible perspectives after this research. First, it is necessary to analyze
the specificity of MAPK signals determining either proinflammatory gene induction or
apoptosis over the broad range of DON dose. Different spectrum of toxic results should be
analyzed depending on particular MAPK cascades. Sophisticated mechanisms can be
considered about the specificity mechanism of MAPK cascades (Chang and Karin, 2001).
Scaffold proteins can play a role in organizing a specific cascade and thus can bring about
different toxic effects via a typical MAPK signaling depending on dose regimes. There
could be a specific DON-regulated stakeholder to determine the specific toxic event by
organizing particular sets of MAPK cascades. In addition to this, life evolved its sequential
physical interactions between protein members in a given MAPK cascade (Xia et al. , 1998).
Both mechanisms may operate in parallel, leading to differential activation of MAPKS in
response to distinct stimuli.

Second, we need to confirm the outcome of the final toxicological symptoms in vivo
by suppressing activity or expression of COX-2. Only the intermediating factor such as IL-6
was measured to assess the involvement of COX-2 in DON toxicity. COX-2 metabolites
partially contributed to IL-6 production which has been well known to be critically related
to DON-immunotoxicity (Zhou et al., 1999; Pestka and Zhou, 2000; Zhou et al., 2000).
Using therapeutic COX-2 inhibitors or COX-2 knockout model, the effect on DON-induced
IgA nephropathy and tissue damage need to be assessed. As another aspect, DON-induced

COX-2 expression have a defensive meaning in response to the toxic insult and thus it is also

136

 

possible that the symptoms can be deteriorated by retarding COX-2 metabolism (Langenbach
et al. , 1999a; Langenbach et al. , 1999b; Morteau, 1999; Morteau et al. , 2000). Additionally,
it is also necessary to identify COX-2 metabolites specifically contributing to DON-induced
immune dysfunction. The final toxic events could be thus ameliorated by blocking the
specific array of eicosanoids.

Third, there is an important missing bridge between ribotoxic stress and MAPK
activation. Iordanov et al. (1997) hypothesized that there must be as yet unidentified
intermediate signal transduction steps, presumably mediated by proteins. A number of
proteins bind to the site where trichothecene damage occurs in the ribosome, in particular,
various elongation factors. Some of them are known to be related to MAPK signals (Knebel
et al. , 2001; Patel et al. , 2002). Elongation factor alpha 2 is known to be phosphorylated by
a kinase (the interferon-inducible and double-stranded RNA-dependent protein kinase, PKR)
which must be displaced from the ribosome in order to become activated (Raine et al. , 1998;
Vattem et al., 2001). Moreover, PKR is known to activate p38 and JNKl/2, and LPS-
induced proinflammatory cytokine production is impaired in PKR-null mice (Williams,
1999; Goh et al. , 2000; Iordanov et al. , 2000). PKR is also essential for mRN A stability of
ARE-containing transcripts during stress (Zhao et al. , 2002). Therefore, it can be assumed
that PKR can work both on translational arrest and turning on the proinflammatory cytokines
via transcriptional and post-transcriptional control (Iordanov et al. , 2000). However, it is not
yet known whether the elongation factors themselves, or other related ribosomal binding
factors, interact with MAPK signaling cascade to mediate the trichothecene-induced

ribotoxic stress response.

137

REFERENCES

Abouzied, M. M., Azcona, J. I., Braselton, W. 13., and Pestka, J. J. (1991). Irnmunochemical
assessment of mycotoxins in 1989 grain foods: evidence for deoxynivalenol

(vomitoxin) contamination. Appl Environ Microbiol 57, 672-677.

Albarenque, S. M., Shinozuka, J ., Suzuki, K., Nakayama, H., and Doi, K. (2000). Kinetics
and distribution of transforming growth factor (TGF)-beta l mRN A in the dorsal skin
of hypotrichotic WBN/ILA-Ht rats following topical application of T-2 toxin. Exp
T oxicol Pathol 52, 297-301.

Anderson, G. D., Hauser, S. D., McGarity, K. L., Bremer, M. E., Isakson, P. C., and Gregory,
S. A. (1996). Selective inhibition of cyclooxygenase (COX)-2 reverses inflammation
and expression of COX-2 and interleukin 6 in rat adj uvant arthritis. J Clin Invest 97,
2672-2679.

Arai, I., Harnasaka, Y., Futaki, N., Takahashi, S., Yoshikawa, K., Higuchi, S., and Otomo,
S. (1993). Effect of NS-398, a new nonsteroidal anti-inflammatory agent, on gastric

ulceration and acid secretion in rats. Res C ommun Chem Pathol Pharmacol 81, 259-
270.

Arakawa, T., Laneuville, 0., Miller, C. A., Lakkides, K. M., Wingerd, B. A., DeWitt, D. L.,
and Smith, W. L. (1996). Prostanoid receptors of murine NIH 3T3 and RAW 264.7
cells. Structure and expression of the murine prostaglandin EP4 receptor gene. J Biol

Chem 271, 29569-29575.

Arita, K., Kobuchi, H., Utsumi, T., Takehara, Y., Akiyarna, J ., Horton, A. A., and Utsumi,
K. (2001). Mechanism of apoptosis in HL-60 cells induced by n-3 and n-6
polyunsaturated fatty acids. Biochem Pharmacol 62, 821-828.

Arrington, J. L., Chapkin, R. S., Switzer, K. C., Morris, J. S., and McMurray, D. N. (2001).
Dietary n-3 polyunsaturated fatty acids modulate purified murine T-cell subset
activation. Clin Exp Immunol 125, 499-507.

Azcona-Olivera, J. I., Ouyang, Y., Murtha, J ., Chu, F. S., and Pestka, J. J. (1995a). Induction
of cytokine mRNAs in mice after oral exposure to the trichothecene vomitoxin
(deoxynivalenol): relationship to toxin distribution and protein synthesis inhibition.
Toxicol Appl Pharmacol 133, 109-120.

138

Azcona-Olivera, J. I., Ouyang, Y. L., Warner, R. L., Linz, J. E., and Pestka, J. J. (1995b).
Effects of vomitoxin (deoxynivalenol) and cycloheximide on IL—2, 4, 5 and 6
secretion and mRN A levels in murine CD4+ cells. Food Chem T oxicol 33, 433-441.

Beagley, K. W., Eldridge, J. H., Aicher, W. K., Mestecky, J ., Di Fabio, S., Kiyono, H., and
McGhee, J. R. (1991). Peyer's patch B cells with memory cell characteristics undergo

terminal differentiation within 24 hours in response to interleukin-6. Cytokine 3, 107-
1 l6.

Beagley, K. W., Eldridge, J. H., Lee, R, Kiyono, H., Everson, M. P., Koopman, W. J.,
Hirano, T., Kishimoto, T., and McGhee, J. R. (1989). Interleukins and IgA synthesis.
Human and murine interleukin 6 induce high rate IgA secretion in IgA-committed B
cells. J Exp Med 169, 2133-2148.

Bennett, W. M., Walker, R. G., and Kincaid-Smith, P. (1989). Treatment of IgA nephropathy
with eicosapentanoic acid (EPA): a two-year prospective trial. Clin Nephrol 31, 128-
13 1 .

Betz, M., and Fox, B. S. (1991). Prostaglandin E2 inhibits production of Th1 lymphokines
but not of Th2 lymphokines. J Immunol 146, 108-113. '

Beyaert, R., Cuenda, A., Vanden Berghe, W., Plaisance, S., Lee, J. C., Haegeman, G.,
Cohen, R, and F iers, W. (1996). The p38/RK mitogen-activated protein kinase
pathway regulates interleukin-6 synthesis response to tumor necrosis factor. Embo

J15, 1914-1923.

Bhat, R. V., Beedu, S. R., Ramakrishna, Y., and Munshi, K. L. (1989). Outbreak of
trichothecene mycotoxicosis associated with consumption of mould-darnaged wheat
production in Kashmir Valley, India. Lancet 1, 35-37.

Billiar, T. R., Bankey, P. E., Svingen, B. A., Curran, R. D., West, M. A., Holman, R. T.,
Simmons, R. L., and Cerra, F. B. (1988). Fatty acid intake and Kupffer cell function:

fish oil alters eicosanoid and monokine production to endotoxin stimulation. Surgery
104, 343-349.

lBondy, G. S., and Pestka, J. J. (2000). Irnmunomodulation by fungal toxins. J Toxicol
Environ Health B Crit Rev 3, 109-143.

Busby WF Jr, Wogan GN. Trichothecens. In : Shank RC ed. Mycotoxins and N-Nitroso
compounds: Environmental Risks. V012. Boca Raton, Fla: CRC Press; 1981:29-41

Callejas, N. A., Castrillo, A., Bosca, L., and Martin-Sanz, P. (1999). Inhibition of

prostaglandin synthesis up-regulates cyclooxygenase-2 induced by lipopolysaccharide
and peroxisomal proliferators. J Pharmacol Exp Ther 288, 1235-1241.

139

Camp, H. S., and Tafuri, S. R. (1997). Regulation of peroxisome proliferator-activated
receptor gamma activity by mitogen-activated protein kinase. J Biol Chem 272,
10811-10816.

Camp, H. S., Tafuri, S. R., and Leif, T. (1999). c-Jun N-terminal kinase phosphorylates
peroxisome proliferator-activated receptor-gamma] and negatively regulates its
transcriptional activity. Endocrinology 140, 392-397.

Caughey, G. E., Mantzioris, E., Gibson, R. A., Cleland, L. G., and James, M. J. (1996). The
effect on human tumor necrosis factor alpha and interleukin 1 beta production of
diets enriched in n-3 fatty acids from vegetable oil or fish oil. Am J Clin Nutr 63,
1 16-122.

Chandrasekar, B., and Fernandes, G. (1994). Decreased pro-inflammatory cytokines and
increased antioxidant enzyme gene expression by omega-3 lipids in murine lupus
nephritis. Biochem Biophys Res Commun 200, 893-898.

Chang, L., and Karin, M. (2001). Mammalian MAP kinase signalling cascades. Nature 410,
3740.

Chen, C., Chen, Y. H., and Lin, W. W. (1999). Involvement of p38 mitogen-activated
protein kinase in lipopolysaccharide-induced iNOS and COX-2 expression in J 774
macrophages. Immunology 97, 124-129.

Chen, C. Y., and Shyu, A. B. (1995). AU-rich elements: characterization and importance in
mRNA degradation. Trends Biochem Sci 20, 465-470.

Chen, W. P., Chen, A., and Lin, C. Y. (1995). In vitro effects of interleukins on human
mesangial cells: implications for glomerulonephritis. J Pathol 175, 327-337.

Chen, Z. Y., and Istfan, N. W. (2000). Docosahexaenoic acid is a potent inducer of apoptosis
in HT-29 colon cancer cells. Prostaglandins Leukot Essent Fatty Acids 63, 301-308.

Clark, K. J ., and Murray, A. W. (1995). Evidence that the bradykinin-induced activation of
phospholipase D and of the mitogen-activated protein kinase cascade involve
different protein kinase C isoforms. J Biol Chem 270, 7097-7103.

Clark, W. F., Parbtani, A., Huff, M. W., Reid, B., Holub, B. J ., and Falardeau, P. (1989).
Omega-3 fatty acid dietary supplementation in systemic lupus erythematosus. Kidney
Int 36, 653-660.

Clarkson, A. R., Woodroffe, A. J., Aarons, I., Hiki, Y., and Hale, G. (1987). IgA
nephropathy. Annu Rev Med 38, 157-168.

Coppo, R., Basolo, B., Rollino, C., Roccatello, D., Martina, G., Amore, A., Bongiomo, G.,

140

and Piccoli, G. (1986). Mediterranean diet and primary IgA nephropathy. Clin
Nephrol 26, 72-82.

Corrier, D. E. (1991). Mycotoxicosis: mechanisms of immunosuppression. Vet Immunol
Immunopathol 30, 73-87.

D'Amico, G. (1987). The commonest glomerulonephritis in the world: IgA nephropathy. Q
J Med 64, 709-727.

D'Amico, G. (2000). Natural history of idiopathic IgA nephropathy: role of clinical and
histological prognostic factors. Am J Kidney Dis 36, 227-237.

Davis, S., Vanhoutte, P., Pages, C., Caboche, J ., and Laroche, S. (2000). The MAPK/ERK
cascade targets both Elk-1 and cAMP response element-binding protein to control

long-term potentiation-dependent gene expression in the dentate gyrus in vivo. J
Neurosci 20, 4563-4572.

Dean, J. L., Brook, M., Clark, A. R., and Saklatvala, J. (1999). p38 mitogen-activated protein
kinase regulates cyclooxygenase-2 mRN A stability and transcription in
lipopolysaccharide-treated human monocytes. J Biol Chem 274, 264-269.

Dean, J. L., Sully, G., Wait, R., Rawlinson, L., Clark, A. R., and Saklatvala, J. (2002).
Identification of a novel AU-rich-element-binding protein which is related to AUFl .
Biochem J 366, 709-719.

Dendorfer, U., Oettgen, P., and Liberrnann, T. A. (1994). Multiple regulatory elements in the
interleukin-6 gene mediate induction by prostaglandins, cyclic AMP, and
lipopolysaccharide. Mol Cell Biol 14, 4443-4454.

Denys, A., Hichami, A., and Khan, N. A. (2001a). Eicosapentaenoic acid and
docosahexaenoic acid modulate MAP kinase (ERKl/ERK2) signaling in human T
cells. J Lipid Res 42, 2015-2020.

Denys, A., Hichami, A., and Khan, N. A. (2002). Eicosapentaenoic acid and
docosahexaenoic acid modulate MAP kinase enzyme activity in human T-cells. Mol
Cell Biochem 232, 143-148.

Denys, A., Hichami, A., Maume, B., and Khan, N. A. (2001b). Docosahexaenoic acid
modulates phorbol ester-induced activation of extracellular signal-regulated kinases
l and 2 in NIH/3T3 cells. Lipids 36, 813-818.

Di Liegro, C. M., Bellafiore, M., Izquierdo, J. M., Rantanen, A., and Cuezva, J. M. (2000).

3'-untranslated regions of oxidative phosphorylation mRNAs function in vivo as
enhancers of translation. Biochem J 352 Pt 1, 109-115.

141

Diep, Q. N., Touyz, R. M., and Schiffrin, E. L. (2000). Docosahexaenoic acid, a peroxisome
proliferator-activated receptor-alpha ligand, induces apoptosis in vascular smooth

muscle cells by stimulation of p38 mitogen-activated protein kinase. Hypertension
36, 851-855.

Dixon, D. A., Kaplan, C. D., McIntyre, T. M., Zimmerman, G. A., and Prescott, S. M.
(2000). Post-transcriptional control of cyclooxygenase-2 gene expression. The role
of the 3'-untranslated region. J Biol Chem 275, 11750-11757.

Dixon, D. A., Tolley, N. D., King, P. H., Nabors, L. B., McIntyre, T. M., Zimmerman, G. A.,
and Prescott, S. M. (2001). Altered expression of the mRNA stability factor HuR

promotes cyclooxygenase-2 expression in colon cancer cells. J Clin Invest 108, 1657-
1 665.

Donadio, J. V., Jr. (1991). Omega-3 polyunsaturated fatty acids: a potential new treatment
of immune renal disease. Mayo Clin Proc 66, 1018-1028.

Donadio, J. V., Jr., Grande, J. P., Bergstralh, E. J., Dart, R. A., Larson, T. S., and Spencer,
D. C. (1999). The long-term outcome of patients with IgA nephropathy treated with
fish oil in a controlled trial. Mayo Nephrology Collaborative Group. J Am Soc
Nephrol 10, 1772-1777.

Donadio, J. V., Jr., Larson, T. S., Bergstralh, E. J ., and Grande, J. P. (2001). A randomized
trial of high-dose compared with low-dose omega-3 fatty acids in severe IgA
nephropathy. J Am Soc Nephrol 12, 791-799.

Dong, W., Azcona-Olivera, J. I., Brooks, K. H., Linz, J. E., and Pestka, J. J. (1994). Elevated
gene expression and production of interleukins 2, 4, 5, and 6 during exposure to

vomitoxin (deoxynivalenol) and cycloheximide in the EL-4 thymoma. Toxicol Appl
Pharmacol 127, 282-290.

Dong, W., and Pestka, J. J. (1993). Persistent dysregulation of IgA production and IgA
nephropathy in the B6C3F1 mouse following withdrawal of dietary vomitoxin
(deoxynivalenol). F undam Appl T oxicol 20, 38-47.

Dong, W., Sell, J. E., and Pestka, J. J. (1991). Quantitative assessment of mesangial
immunoglobulin A (IgA) accumulation, elevated circulating IgA immune complexes,
and hematuria during vomitoxin-induced IgA nephropathy. F undam Appl T oxicol 17,
197-207.

Ebihara, 1., Hirayama, K., Yamamoto, S., Muro, K., Yamagata, K., and Koyama, A. (2001).
Th2 predominance at the single-cell level in patients with IgA nephropathy. Nephrol
Dial Transplant 16, 1783-1789.

Ehrlich, K. C., and Daigle, K. W. (1987). Protein synthesis inhibition by 8-oxo-l2,13-

142

 

epoxytrichothecenes. Biochim Biophys Acta 923, 206-213.

Elidemir, O., Colasurdo, G. N., Rossmann, S. N., and Fan, L. L. (1999). Isolation of
Stachybotrys from the lung of a child with pulmonary hemosiderosis. Pediatrics 104,
964-966.

Emancipator, S. N., and Lamm, M. E. (1989). IgA nephropathy: pathogenesis of the most
common form of glomerulonephritis. Lab Invest 60, 168-183.

Ergas, D., Eilat, E., Mendlovic, S., and Sthoeger, Z. M. (2002). n-3 fatty acids and the
immune system in autoimmunity. Isr Med Assoc J 4, 34-38.

Fedyk, E. R., Brown, D. M., and Phipps, R. P. (1997). PGE2 regulation of B lymphocytes
and T helper 1 and T helper 2 cells: induction of inflammatory versus allergic
responses. Adv Exp Med Biol 407, 23 7-242.

Fernandes, G., Troyer, D. A., and Jolly, C. A. (1998). The effects of dietary lipids on gene
expression and apoptosis. Proc Nutr Soc 57, 543-550.

Fiebich, B. L., Mueksch, B., Boehringer, M., and Hull, M. (2000). Interleukin-lbeta induces
cyclooxygenase-2 and prostaglandin E(2) synthesis in human neuroblastoma cells:
involvement of p38 mitogen-activated protein kinase and nuclear factor-kappaB. J
Neurochem 75, 2020-2028.

Fletcher, B. S., Kujubu, D. A., Perrin, D. M., and Herschman, H. R. (1992). Structure of the
mitogen-inducible TIS10 gene and demonstration that the TIS 10-encoded protein is
a functional prostaglandin G/H synthase. J Biol Chem 267, 4338-4344.

Forsell, J. H., Jensen, R., Tai, J. H., Witt, M., Lin, W. S., and Pestka, J. J. (1987).
Comparison of acute toxicities of deoxynivalenol (vomitoxin) and 15-
acetyldeoxynivalenol in the B6C3F 1 mouse. Food Chem Toxic0125, 155-162.

Forsell, J. H., Kateley, J. R., Yoshizawa, T., and Pestka, J. J. (1985). Inhibition of mitogen-
induced blastogenesis in human lymphocytes by T-2 toxin and its metabolites. Appl
Environ Microbiol 49, 1523-1526.

Forsell, J. H., Witt, M. F., Tai, J. H., Jensen, K, and Pestka, J. J. (1986). Effects of 8-week
exposure of the B6C3F 1 mouse to dietary deoxynivalenol (vomitoxin) and
zearalenone. Food Chem T oxicol 24, 213-219.

Fujihashi, K., Kono, Y., and Kiyono, H. (1992). Effects of 1L6 on B cells in mucosal
immune response and inflammation. Res Immunol 143, 744-749.

Futaki, N., Arai, I., Hamasaka, Y., Takahashi, S., Higuchi, S., and Otomo, S. (1993).
Selective inhibition of NS-398 on prostanoid production in inflamed tissue in rat

143

carrageenan-air-pouch inflammation. J Pharm Pharmacol 45, 753-755.

Futaki, N., Takahashi, S., Kitagawa, T., Yarnakawa, Y., Tanaka, M., and Higuchi, S. (1997).
Selective inhibition of cyclooxygenase-2 by NS-3 98 in endotoxin shock rats in vivo.
Inflamm Res 46, 496-502.

Futaki, N., Takahashi, S., Yokoyama, M., Arai, 1., Higuchi, S., and Otomo, S. (1994). NS-
398, a new anti-inflammatory agent, selectively inhibits prostaglandin G/H
synthase/cyclooxygenase (COX-2) activity in vitro. Prostaglandins 47, 55-59.

Fyfe, D. J ., and Abbey, M. (2000). Effects of n-3 fatty acids on growth and survival of J 774
macrophages. Prostaglandins Leukot Essent Fatty Acids 62, 201-207.

Gallucci, R. M., Simeonova, P. P., Matheson, J. M., Kommineni, C., Guriel, J. L., Sugawara,
T., and Luster, M. l. (2000). Impaired cutaneous wound healing in interleukin-6-
deficient and immunosuppressed mice. Faseb J 14, 2525-2531.

Goh, K. C., deVeer, M. J ., and Williams, B. R. (2000). The protein kinase PKR is required
for p38 MAPK activation and the innate immune response to bacterial endotoxin.
Embo J 19, 4292-4297.

Greene, D. M., Azcona-Olivera, J. I., Murtha, J. M., and Pestka, J. J. (1995). Effects of
dihydrotestosterone and estradiol on experimental IgA nephropathy induced by
vomitoxin. F undam Appl Toxicol 26, 107-116.

Greene, D. M., Azcona-Olivera, J. 1., and Pestka, J. J. (1994). Vomitoxin (deoxynivalenol)-
induced IgA nephropathy in the B6C3F 1 mouse: dose response and male

predilection. Toxicology 92, 245-260.

Grimm, H., Tibell, A., Norrlind, B., Blecher, C., Wilker, S., and Schwemmle, K. (1994).
Irnmunoregulation by parenteral lipids: impact of the n-3 to n-6 fatty acid ratio. JPEN
J Parenter Enteral Nutr 18, 417-421.

Guan, Z., Buckrnan, S. Y., Pentland, A. P., Templeton, D. J ., and Morrison, A. R. (1998).
Induction of cyclooxygenase-2 by the activated MEKKI --> SEKl/MKK4 -> p38
mitogen-activated protein kinase pathway. J Biol Chem 273, 12901-12908.

Hall, L. L., Bicknell, G. R., Primrose, L., Pringle, J. H., Shaw, J. A., and Fumess, P. N.
(1998). Reproducibility in the quantification of mRNA levels by RT-PCR-ELISA
and RT competitive-PCR-ELISA. Biotechniques 24, 652-658.

Hamazaki, T., Tateno, S., and Shishido, H. (1984). Eicosapentaenoic acid and IgA
nephropathy. Lancet 1, 1017-1018.

Harada, K., Akai, Y., Kurumatani, N., Iwano, M., and Saito, Y. (2002). Prognostic value of

144

urinary interleukin 6 in patients with IgA nephropathy: an 8-year follow-up study.
Nephron 92, 824-826.

Harbige, L. S., and Fisher, B. A. (2001). Dietary fatty acid modulation of mucosally-induced
tolerogenic immune responses. Proc Nutr Soc 60, 449-456.

Harris, S. G., Padilla, J ., Koumas, L., Ray, D., and Phipps, R. P. (2002). Prostaglandins as
modulators of immunity. Trends Immunol 23, 144-150.

Hellegars, D. (1993). IgA nephropathy. Partners in Prevention (Spring) p.10.

Hihi, A. K., Michalik, L., and Wahli, W. (2002). PPARs: transcriptional effectors of fatty
acids and their derivatives. Cell Mol Life Sci 59, 790-798.

Hinson, R. M., Williams, J. A., and Shacter, E. (1996). Elevated interleukin 6 is induced by
prostaglandin E2 in a murine model of inflammation: possible role of
cyclooxygenase-2. Proc Natl Acad Sci U S A 93, 4885-4890.

Hong, F ., Kim, W. H., Tian, Z., Jaruga, B., Ishac, E., Shen, X., and Gao, B. (2002). Elevated
interleukin-6 during ethanol consumption acts as a potential endogenous protective
cytokine against ethanol-induced apoptosis in the liver: involvement of induction of
Bel-2 and Bcl-x(L) proteins. Oncogene 21, 32-43.

Hu, J ., Roy, S. K., Shapiro, P. S., Rodig, S. R., Reddy, S. P., Platanias, L. C., Schreiber, R.
D., and Kalvakolanu, D. V. (2001). ERK1 and ERK2 activate CCAAAT/enhancer-
binding protein-beta-dependent gene transcription in response to interferon-gamma.
J Biol Chem 276, 287-297.

Hwang, D., Jang, B. C., Yu, G., and Boudreau, M. (1997). Expression of mitogen-inducible
cyclooxygenase induced by lipopolysaccharide: mediation through both mitogen-
activated protein kinase and NF-kappaB signaling pathways in macrophages.
Biochem Pharmacol 54, 87-96.

Hwang, S. C., Jhon, D. Y., Bae, Y. S., Kim, J. H., and Rhee, S. G. (1996). Activation of
phospholipase C-garnma by the concerted action of tau proteins and arachidonic acid.
J Biol Chem 271, 18342-18349.

Ihara, T., Sugarnata, M., Sekijima, M., Okumura, H., Yoshino, N., and Ueno, Y. (1997).
Apoptotic cellular damage in mice after T-2 toxin-induced acute toxicosis. Nat
Toxins 5,141-145.

Inoue, H., and Tanabe, T. (1998). Transcriptional role of the nuclear factor kappa B site in

the induction by lipopolysaccharide and suppression by dexarnethasone of
cyclooxygenase-2 in U937 cells. Biochem Biophys Res Commun 244, 143-148.

145

Iordanov, M. S., Paranjape, J. M., Zhou, A., Wong, J., Williams, B. R., Meurs, E. F.,
Silverrnan, R. H., and Magun, B. E. (2000). Activation of p38 mitogen-activated
protein kinase and c-Jun NH(2)-terminal kinase by double-stranded RNA and
encephalomyocarditis virus: involvement of RNase L, protein kinase R, and
alternative pathways. Mol Cell Biol 20, 617-627.

Iordanov, M. S., Pribnow, D., Magun, J. L., Dinh, T. H., Pearson, J. A., Chen, S. L., and
Magun, B. E. (1997). Ribotoxic stress response: activation of the stress-activated
protein kinase JNK] by inhibitors of the peptidyl transferase reaction and by
sequence-specific RNA damage to the alpha-sarcin/ricin loop in the 28S rRN A. Mol
Cell Biol 17, 3373-3381.

Islam, Z., Moon, Y. S., Zhou, H. R., King, L. E., Fraker, P. J., and Pestka, J. J. (2002).
Endotoxin potentiation of trichothecene-induced lymphocyte apoptosis is mediated
by up-regulation of glucocorticoids. Toxicol Appl Pharmacol 180, 43-55.

Islam, 2., Nagase, M., Ota, A., Ueda, S., Yoshizawa, T., and Sakato, N. (1998a). Structure-
function relationship of T-2 toxin and its metabolites in inducing thyrnic apoptosis
in vivo in mice. Biosci Biotechnol Biochem 62, 1492-1497.

Islam, Z., Nagase, M., Yoshizawa, T., Yamauchi, K., and Sakato, N. (1998b). T-2 toxin
induces thymic apoptosis in vivo in mice. Toxicol Appl Pharmacol 148, 205-214.

Jackson, L. S., and Bullerman, L. B. (1999). Effect of processing on Fusarium mycotoxins.
Adv Exp Med Biol 459, 243-261.

Jarvis, B. B. (1991). Macrocyclic trichothecenes. In Mycotoxins and Phytoalexins (R.
P.Sharma and D. K. Salunkhe, Ed). pp. 361-421. CRC Press, Boca Raton, Fla.

Ji, G. E., Park, S. Y., Wong, S. S., and Pestka, J. J. (1998). Modulation of nitric oxide,
hydrogen peroxide and cytokine production in a clonal macrophage model by the
trichothecene vomitoxin (deoxynivalenol). Toxicology 125, 203-214.

J obin, C., and Sartor, R. B. (2000). The I kappa B/NF-kappa B system: a key determinant of
mucosalinflarnmation and protection. Am J Physiol Cell Physiol 278, C451-462.

Joffe, A. Z., and Yagen, B. (1977). Comparative study of the yield of T-2 toxic produced by
Fusarium poae, F. sporotrichioides and F. sporotrichioides var. tricinctum strains
from different sources. Mycopathologia 60, 93-97.

J ohanning, E., Biagini, R., Hull, D., Morey, P., Jarvis, B., and Landsbergis, P. (1996). Health
and immunology study following exposure to toxigenic fungi (Stachybotrys
chartarum) in a water-darnaged office environment. Int Arch Occup Environ Health
68, 207-218.

146

Jolly, C. A., Muthukumar, A., Reddy Avula, C. P., and F emandes, G. (2001). Maintenance
of NF-kappaB activation in T-lymphocytes and a naive T-cell population in
autoimmune-prone (N ZB/N ZW)F ( 1) mice by feeding a food-restricted diet enriched
with n-3 fatty acids. Cell Immunol 213, 122-133.

Kalinski, P., Vieira, P. L., Schuitemaker, J. H., de Jong, E. C., and Kapsenberg, M. L.
(2001). Prostaglandin E(2) is a selective inducer of interleukin-12 p40 (IL-12p40)
production and an inhibitor of bioactive IL-12p70 heterodimer. Blood 97, 3466-3469.

Kehn, P., and Fernandes, G. (2001). The importance of omega-3 fatty acids in the attenuation
of immune-mediated diseases. J Clin Immunol 21, 99-101.

Knebel, A., Morrice, N., and Cohen, P. (2001). A novel method to identify protein kinase
substrates: eEF 2 kinase is phosphorylated and inhibited by SAPK4/p3 8delta. Embo
J 20, 4360-4369.

Kotsonis, F. N., Buedock, G. A., and Flamm, W. G. (1996). Food toxicology. In Casarett &
Duoll ’s Toxicology The Basic Science of Poisons (C. D. Klaassen, Ed). pp. 909-949.
McGraw-I-Iill, New York.

Kozawa, 0., Suzuki, A., Tokuda, H., Kaida, T., and Uematsu, T. (1998). Interleukin-6
synthesis induced by prostaglandin E2: cross-talk regulation by protein kinase C.
Bone 22, 355-360.

Kremer, J. M., Lawrence, D. A., Jubiz, W., DiGiacomo, R., Rynes, R., Bartholomew, L. E.,
and Sherman, M. (1990). Dietary fish oil and olive oil supplementation in patients
with rheumatoid arthritis. Clinical and immunologic effects. Arthritis Rheum 33, 810-
820.

Krey, G., Braissant, O., L'Horset, F., Kalkhoven, E., Perroud, M., Parker, M. G., and Wahli,
W. (1997). Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands
of peroxisome proliferator-activated receptors by coactivator-dependent receptor
ligand assay. Mol Endocrinol 11, 779-791.

Kuroda, E., Sugiura, T., Zeki, K., Yoshida, Y., and Yarnashita, U. (2000). Sensitivity
difference to the suppressive effect of prostaglandin E2 among mouse strains: a

possible mechanism to polarize Th2 type response in BALB/c mice. J Immunol 164,
23 86-2395.

Langenbach, R., Loftin, C., Lee, C., and Tiano, H. (1999a). Cyclooxygenase knockout mice:
models for elucidating isoforrn-specific functions. Biochem Pharmacol 58, 1237-

1246.

Langenbach, R., Loftin, C. D., Lee, C., and Tiano, H. (1999b). Cyclooxygenase-deficient
mice. A summary of their characteristics and susceptibilities to inflammation and

147

carcinogenesis. Ann N Y Acad Sci 889, 52-61.

Lasa, M., Mahtani, K. R., Finch, A., Brewer, G., Saklatvala, J., and Clark, A. R. (2000).
Regulation of cyclooxygenase 2 mRNA stability by the mitogen-activated protein
kinase p38 signaling cascade. Mol Cell Biol 20, 4265-4274.

Laskin, J. D., Heck, D. E., and Laskin, D. L. (2002). The ribotoxic stress response as a
potential mechanism for MAP kinase activation in xenobiotic toxicity. Toxicol Sci
69, 289-291.

Latham, P., Lund, E. K., Brown, J. C., and Johnson, I. T. (2001). Effects of cellular redox
balance on induction of apoptosis by eicosapentaenoic acid in HT29 colorectal
adenocarcinoma cells and rat colon in vivo. Gut 49, 97-105.

Latham, P., Lund, E. K., and Johnson, I. T. (1999). Dietary n-3 PUFA increases the apoptotic
response to 1,2-dimethylhydrazine, reduces mitosis and suppresses the induction of
carcinogenesis in the rat colon. Carcinogenesis 20, 645-650.

Lee, J. Y., Sohn, K. H., Rhee, S. H., and Hwang, D. (2001). Saturated fatty acids, butnot
unsaturated fatty acids, induce the expression of cyclooxygenase-2 mediated through
Toll-like receptor 4. J Biol Chem 276, 16683-16689.

Leonard, M., Ryan, M. P., Watson, A. J ., Schramek, H., and Healy, E. (1999). Role of MAP
kinase pathways in mediating IL-6 production in human primary mesangial and
proximal tubular cells. Kidney Int 56, 1366-1377.

Levy, B. D., Clish, C. B., Schmidt, B., Gronert, K., and Serhan, C. N. (2001). Lipid mediator
class switching during acute inflammation: signals in resolution. Nat Immunol 2,
612-619.

Levy, B. D., and Serhan, C. N. (2002). Polyisoprenyl phosphates: natural antiinflammatory
lipid signals. Cell Mol Life Sci 59, 729-741.

Li, F. Q., Luo, X. Y., and Yoshizawa, T. (1999). Mycotoxins (trichothecenes, zearalenone
and fumonisins) in cereals associated with human red-mold intoxications stored since
1989 and 1991 in China. Nat Toxins 7, 93-97.

Li, S., Ouyang, Y. L., Dong, W., and Pestka, J. J. (1997). Superinduction of IL-2 gene
expression by vomitoxin (deoxynivalenol) involves increased mRN A stability.
Toxicol Appl Pharmacol 147, 33 1-342.

Lim, C. S., Zheng, S., Kim, Y. S., Ahn, C., Han, J. S., Kim, S., Lee, J. S., Chae, D. W., Koo,
J. R., Chun, R. W., and Noh, J. W. (2001). Thl/Th2 predominance and
proinflammatory cytokines determine the clinicopathological severity of IgA
nephropathy. Nephrol Dial Transplant 16, 269-275.

148

 

Liu, S. F., Ye, X., and Malik, A. B. (1999). Pyrrolidine dithiocarbamate prevents I-kappaB
degradation and reduces microvascular injury induced by lipopolysaccharide in
multiple organs. Mol Pharmacol 55, 658-667.

Lo, C. J., Chiu, K. C., Fu, M., Chu, A., and Helton, S. (2000). Fish oil modulates
macrophage P44/P42 mitogen-activated protein kinase activity induced by
lipopolysaccharide. JPEN J Parenter Enteral Nutr 24, 159-163.

Lo, C. J ., Chiu, K. C., Fu, M., Lo, R., and Helton, S. (1999). Fish oil augments macrophage
cyclooxygenase II (COX-2) gene expression induced by endotoxin. J Surg Res 86,
103-107.

Luster, M. I., Simeonova, P. P., Gallucci, R. M., Bruccoleri, A., Blazka, M. E., and Yucesoy,
B. (2001). Role of inflammation in chemical-induced hepatotoxicity. T oxicol Lett
120, 317-321.

Mahmoudi, M., and Gershwin, M. E. (2000). Sick building syndrome. IH. Stachybotrys
chartarum. J Asthma 37, 191-198.

Marignani, P. A., Epand, R. M., and Sebaldt, R. J. (1996). Acyl chain dependence of
diacylglycerol activation of protein kinase C activity in vitro. Biochem Biophys Res
Commun 225, 469-473.

Marin, M. L., Murtha, J., Dong, W., and Pestka, J. J. (1996). Effects of mycotoxins on
cytokine production and proliferation in EL-4 thymoma cells. J Toxicol Environ
Health 48, 379-396.

May, C. L., Southworth, A. J ., and Calder, P. C. (1993). Inhibition of lymphocyte protein
kinase C by unsaturated fatty acids. Biochem Biophys Res Commun 195, 823-828.

Mayser, P., Mrowietz, U., Arenberger, P., Bartak, P., Buchvald, J ., Christophers, E.,
Jablonska, S., Sahnhofer, W., Schill, W. B., Kramer, H. J ., Schlotzer, E., Mayer, K.,
Seeger, W., and Grimminger, F. (1998). Omega-3 fatty acid-based lipid infusion in
patients with chronic plaque psoriasis: results of a double-blind, randomized,
placebo-controlled, multicenter trial. J Am Acad Dermatol 38, 539-547.

Mbella, E. G., Bertrand, S., Huez, G., and Octave, J. N. (2000). A GG nucleotide sequence
of the 3' untranslated region of arnyloid precursor protein mRN A plays a key role in
the regulation of translation and the binding of proteins. Mol Cell Biol 20, 45 72-45 79.
McCarty, M. F. (1999). Interleukin-6 as a central mediator of cardiovascular risk associated
with chronic inflammation, smoking, diabetes, and visceral obesity: down-regulation

with essential fatty acids, ethanol and pentoxifylline. Med Hypotheses 52, 465-477.

McCarty, M. F. (2001). Upregulation of lymphocyte apoptosis as a strategy for preventing

149

and treating autoimmune disorders: a role for whole-food vegan diets, fish oil and
dopamine agonists. Med Hypotheses 57, 25 8-275.

McGhee, J. R., Fujihashi, K., Beagley, K. W., and Kiyono, H. (1991). Role of interleukin-6
in human and mouse mucosal IgA plasma cell responses. Immunol Res 10, 418-422.

Mestre, J. R., Mackrell, P. J ., Rivadeneira, D. E., Stapleton, P. P., Tanabe, T., and Daly, J.
M. (2001). Redundancy in the signaling pathways and promoter elements regulating
cyclooxygenase-2 gene expression in endotoxin-treated macrophage/monocytic cells.

J Biol Chem 276, 3977-3982.

Meydani, S. N., Endres, S., Woods, M. M., Goldin, B. R., Soo, C., Morrill-Labrode, A.,
Dinarello, C. A., and Gorbach, S. L. (1991). Oral (n-3) fatty acid supplementation
suppresses cytokine production and lymphocyte proliferation: comparison between
young and older women. J Nutr 121, 547-555.

Meyer, T. A., Noguchi, Y., Ogle, C. K., Tiao, G., Wang, J. J ., Fischer, J. E., and Hasselgren,
P. O. (1994). Endotoxin stimulates interleukin-6 production in intestinal epithelial
cells. A synergistic effect with prostaglandin E2. Arch Surg 129, 1290-1294;
discussion 1294-1295.

Meyer, T. A., Wang, J ., Tiao, G. M., Ogle, C. K., Fischer, J. E., and Hasselgren, P. O.
(1995). Sepsis and endotoxemia stimulate intestinal interleukin-6 production.
Surgery 118, 336-342.

Minervini, F., Dong, W., and Pestka, J. (1993). In vitro vomitoxin exposure alters IgA and
IgM secretion by CH12LX B cells. Relationship to proliferation and macromolecular
synthesis. Mycopathologia 121, 33-40.

Montinaro, V., Gesualdo, L., and Schena, F. P. (1999). The relevance of experimental
models in the pathogenetic investigation of primary IgA nephropathy. Ann Med
Interne (Paris) 150, 99-107.

Moon, Y., and Pestka, J. J. (2003). Cycloocygenase-2 mediates interleukin-6 upregulation
by vomitoxin (deoxynivalenol) in vitro and in vivo. Toxicology and Applied
Pharmacology 187, 80-88.

Moon, Y., and Pestka, J. J. (2002). Vomitoxin-Induced Cyclooxygenase-2 Gene Expression
in Macrophages Mediated by Activation of ERK and p38 but Not JNK Mitogen-
Activated Protein Kinases. Toxicol Sci 69, 373-382.

Moon, Y., and Pestka, J .J . (2001). Contribution of cyclooxygenase-2 metabolism to IL-6
induction by vomitoxin in vivo and in vitro. The Toxicologist 50, 1947.

Morrow, J. D. (2000). The isoprostanes: their quantification as an index of oxidant stress

150

status in vivo. Drug Metab Rev 32, 377-385.
Morteau, O. (1999). COX-2: promoting tolerance. Nat Med 5, 867-868.

Morteau, O., Morham, S. G., Sellon, R., Dieleman, L. A., Langenbach, R., Smithies, O., and
Sartor, R. B. (2000). Impaired mucosal defense to acute colonic injury in mice
lacking cyclooxygenase-1 or cyclooxygenase-2. J Clin Invest 105, 469-478.

Myers, L. K., Kang, A. H., Postlethwaite, A. E., Rosloniec, E. F., Morham, S. G., Shlopov,
B. V., Goorha, S., and Ballou, L. R. (2000). The genetic ablation of cyclooxygenase
2 prevents the development of autoimmune arthritis. Arthritis Rheum 43, 2687-2693.

Nabors, L. B., Gillespie, G. Y., Harkins, L., and King, P. H. (2001). HuR, a RNA stability
factor, is expressed in malignant brain tumors and binds to adenine- and uridine-rich
elements within the 3' untranslated regions of cytokine and angiogenic factor
mRNAs. Cancer Res 61, 2154-2161.

Nagase, M., Alarn, M. M., Tsushima, A., Yoshizawa, T., and Sakato, N. (2001). Apoptosis
induction by T-2 toxin: activation of caspase-9, caspase-3, and DFF-40/CAD through

cytosolic release of cytochrome c in HL-60 cells. Biosci Biotechnol Biochem 65,
1741-1747.

Narayanan, B. A., Narayanan, N. K., and Reddy, B. S. (2001). Docosahexaenoic acid
regulated genes and transcription factors inducing apoptosis in human colon cancer
cells. IntJ Oncol 19, 1255-1262.

Naseem, S. M., Hines, H. B., and Creasia, D. A. (1989). Effect of toxins on arachidonic acid
metabolism in rat cultured pulmonary alveolar macrophages. Biochem Int 19, 583-
592.

Neurath, M. F., Finotto, S., and Glimcher, L. H. (2002). The role of Th1/Th2 polarization in
mucosal immunity. Nat Med 8, 567-573.

Newberry, R. D., Stenson, W. F., and Lorenz, R. G. (1999). Cyclooxygenase-Z-dependent
arachidonic acid metabolites are essential modulators of the intestinal immune
response to dietary antigen. Nat Med 5, 900-906.

Newton, R., Seybold, J ., Kuitert, L. M., Bergrnann, M., and Barnes, P. J. (1998). Repression
of cyclooxygenase-2 and prostaglandin E2 release by dexarnethasone occurs by
transcriptional and post-transcriptional mechanisms involving loss of polyadenylated
mRNA. J Biol Chem 273, 32312-32321.

Newton, R., Seybold, J ., Liu, S. F., and Barnes, P. J. (1997a). Alternate COX-2 transcripts

are differentially regulated: implications for post-transcriptional control. Biochem
Biophys Res Commun 234, 85-89.

151

Newton, R., Stevens, D. A., Hart, L. A., Lindsay, M., Adcock, l. M., and Barnes, P. J.
(1997b). Superinduction of COX-2 mRN A by cycloheximide and interleukin-lbeta
involves increased transcription and correlates with increased NF-kappaB and JN K

activation. FEBS Lett 418, 135-138.

Nishizuka, Y. (1995). Protein kinase C and lipid signaling for sustained cellular responses.
Faseb J 9, 484-496.

Otto, D. A., Kahn, D. R., Hamm, M. W., Forrest, D. E., and Wooten, J. T. (1990). Improved
survival of heterotopic cardiac allografts in rats with dietary n-3 polyunsaturated fatty
acids. Transplantation 50, 193-198.

Ouyang, Y. L., Azcona-Olivera, J. I., and Pestka, J. J. (1995). Effects of trichothecene
structure on cytokine secretion and gene expression in murine CD4+ T-cells.
Toxicology 104, 187-202.

Ouyang, Y. L., Li, S., and Pestka, J. J. (1996). Effects of vomitoxin (deoxynivalenol) on
transcription factor NF-kappa B/Rel binding activity in murine EL-4 thymoma and
primary CD4+ T cells. Toxicol Appl Pharmacol 140, 328-336.

Pang, L. (2001). COX-2 expression in asthmatic airways: the story so far. Thorax 56, 335-
336.

Pang, L., and Hoult, J. R. (1996). Induction of cyclooxygenase and nitric oxide synthase in
endotoxin-activated J 774 macrophages is differentially regulated by indomethacin:
enhanced cyclooxygenase-2 protein expression but reduction of inducible nitric oxide
synthase. Eur J Pharmacol 317, 151-155.

Patel, J ., McLeod, L. E., Vries, R. G., Flynn, A., Wang, X., and Proud, C. G. (2002). Cellular
stresses profoundly inhibit protein synthesis and modulate the states of

phosphorylation of multiple translation factors. Eur J Biochem 269, 3076-3085.

Paul, A., Cuenda, A., Bryant, C. E., Murray, J ., Chilvers, E. R., Cohen, R, Gould, G. W.,
and Plevin, R. (1999). Involvement of mitogen-activated protein kinase homologues
in the regulation of lipopolysaccharide-mediated induction of cyclo-oxygenase-2 but
not nitric oxide synthase in RAW 264.7 macrophages. Cell Signal 11, 491-497.

Peraica, M., Radio, 3., Lucie, A., and Pavlovic, M. (1999). Toxic effects of mycotoxins in
humans. Bull World Health Organ 77, 754-766.

Perkins, N. D. (2000). The Rel/N F -kappa B family: friend and foe. Trends Biochem Sci 25,
434-440.

Pestka, J. J ., and Dong, W. (1994). Progressive serum IgE elevation in the B6C3F1 mouse
following withdrawal of dietary vomitoxin (deoxynivalenol). F undam Appl Toxicol
22, 314-316.

152

 

Pestka, J. J., Dong, W., Warner, R. L., Rasooly, L., and Bondy, G. S. (1990a). Effect of
dietary administration of the trichothecene vomitoxin (deoxynivalenol) on IgA and

I gG secretion by Peyer's patch and splenic lymphocytes. Food Chem Toxicol 28, 693-
699.

Pestka, J. J ., and Forsell, J. H. (1988). Inhibition of human lymphocyte transformation by the
macrocyclic trichothecenes roridin A and verrucarin A. Toxicol Lett 41, 215-222.

Pestka, J. J ., Moorman, M. A., and Warner, R. L. (1989). Dysregulation of IgA production
and IgA nephropathy induced by the trichothecene vomitoxin. Food Chem Toxicol
27, 361 -368.

Pestka, J. J., Moorman, M. A., and Warner, R. L. (1990b). Altered serum immunoglobulin
response to model intestinal antigens during dietary exposure to vomitoxin
(deoxynivalenol). Toxicol Lett 50, 75-84.

Pestka, J. J ., Tai, J. H., Witt, M. F., Dixon, D. E., and Forsell, J. H. (1987). Suppression of
immune response in the B6C3F] mouse after dietary exposure to the Fusarium

mycotoxins deoxynivalenol (vomitoxin) and zearalenone. Food Chem Toxicol 25,
297-3 04.

Pestka, J. J ., and Zhou, H. R. (2000). Interleukin-6-deficient mice refractory to IgA
dysregulation but not anorexia induction by vomitoxin (deoxynivalenol) ingestion.
Food Chem Toxicol 38, 565-575.

Pestka, J. J ., Zhou, H. R, Jia, Q., and Timmer, A. M. (2002). Dietary fish oil suppresses
experimental immunoglobulin a nephropathy in mice. J Nutr 132, 261-269. '

Pettersson, E. E., Rekola, S., Berglund, L., Sundqvist, K. G., Angelin, B., Diczfalusy, U.,
Bj orkhem, I., and Bergstrom, J. (1994). Treatment of IgA nephropathy with omega-3-
polyunsaturated fatty acids: a prospective, double-blind, randomized study. Clin

Nephrol 41, 183-190.
Piecyk, M., Wax, 8., Beck, A. R., Kedersha, N., Gupta, M., Maritim, B., Chen, S., Gueydan,

C., Kruys, V., Streuli, M., and Anderson, P. (2000). TIA-1 is a translational silencer
that selectively regulates the expression of TNF-alpha. Embo J 19, 4154-4163.

Plasencia, F. J ., and Rosenstein, Y. (1990). Effect of in vivo administration of T-2 toxin on
peritoneal murine macrophages. T axican 28, 559-567.

Purasiri, P., Murray, A., Richardson, S., Heys, S. D., Horrobin, D., and Eremin, O. (1994).
Modulation of cytokine production in vivo by dietary essential fatty acids in patients
with colorectal cancer. Clin Sci (Land) 87, 711-717.

Raine, D. A., Jeffrey, I. W., and Clemens, M. J. (1998). Inhibition of the double-stranded

153

RNA-dependent protein kinase PKR by mammalian ribosomes. F EBS Lett 436, 343-
348.

Ramsay, A. J ., Husband, A. J ., Ramshaw, I. A., Bao, S., Matthaei, K. I., Koehler, G., and
Kopf, M. (1994). The role of interleukin-6 in mucosal IgA antibody responses in
vivo. Science 264, 561-563.

Rantala, I., Mustonen, J., Hurme, M., Syrjanen, J., and Helin, H. (2001). Pathogenetic
aspects of IgA nephropathy. Nephron 88, 193-198.

Rasooly, L., Abouzied, M. M., Brooks, K. H., and Pestka, J. J. (1994). Polyspecific and
autoreactive IgA secreted by hybridomas derived from Peyer’s patches of vomitoxin-

fed mice: characterization and possible pathogenic role in IgA nephropathy. Food
Chem Toxicol 32, 337-348.

Rasooly, L., and Pestka, J. J. (1994). Polyclonal autoreactive IgA increase and mesangial
deposition during vomitoxin-induced IgA nephropathy in the BALB/c mouse. F aad
Chem T axical 32, 329-336.

Reeves, P. G., Nielsen, F. H., and Fahey, G. C., Jr. (1993). AIN-93 purified diets for
laboratory rodents: final report of the American Institute of Nutrition ad hoc writing
committee on the reformulation of the AIN-76A rodent diet. J Nutr 123, 1939-1951.

Ricote, M., Li, A. C., Willson, T. M., Kelly, C. J ., and Glass, C. K. (1998). The peroxisome
proliferator-activated receptor-gamma is a negative regulator of macrophage
activation. Nature 391, 79-82.

Ridley, S. H., Dean, J. L., Sarsfield, S. J ., Brook, M., Clark, A. R., and Saklatvala, J. (1998).
A p38 MAP kinase inhibitor regulates stability of interleukin-l-induced
cyclooxygenase-2 mRNA. FEBS Lett 439, 75-80.

Riedy, M. C., Tim, B. A., Jr., and Stewart, C. C. (1995). Quantitative RT-PCR for
measuring gene expression. Biotechniques 18, 70-74, 76.

Robbana-Barnat, S., Lafarge-Frayssinet, 0, Cohen, H., Neish, G. A., and Frayssinet, C.
(1988). Irnmunosuppressive properties of deoxynivalenol. Toxicology 48, 155-166.

Roberts, L. J ., and Morrow, J. D. (2000). Measurement of F(2)-isoprostanes as an index of
oxidative stress in vivo. Free Radic Biol Med 28, 505-513.

Roberts, R. A. (2002). Evidence for Cross Talk between PPARalpha and p38 MAP Kinase.
T axical Sci 68, 270-274.

Rollwagen, F. M., Yu, Z. Y., Li, Y. Y., and Pacheco, N. D. (1998). IL-6 rescues enterocytes
from hemorrhage induced apoptosis in vivo and in vitro by a bcl-2 mediated

154

mechanism. Clin Immunol Immunopathol 89, 205-213.

Rotter, B. A., Prelusky, D. B., and Pestka, J. J. (1996). Toxicology of deoxynivalenol
(vomitoxin). J Toxicol Environ Health 48, 1-34.

Sadeghi, S., Wallace, F. A., and Calder, P. C. (1999). Dietary lipids modify the cytokine
response to bacterial lipopolysaccharide in mice. Immunology 96, 404-410.

Samad, T. A., Moore, K. A., Sapirstein, A., Billet, S., Allchorne, A., Poole, S., Bonventre,
J. V., and Woolf, C. J. (2001). Interleukin-lbeta-mediated induction of Cox-2 in the

CNS contributes to inflammatory pain hypersensitivity. Nature 410, 471-475.

Scheel, C. M., Rosing, W. C., and Farone, A. L. (2001). Possible sources of sick building
syndrome in a Tennessee middle school. Arch Environ Health 56, 413-417.

Scherle, P. A., Jones, E. A., Favata, M. F., Daulerio, A. J ., Covington, M. B., Numberg, S.
A., Magolda, R. L., and Trzaskos, J. M. (1998). Inhibition of MAP kinase kinase
prevents cytokine and prostaglandin E2 production in lipopolysaccharide-stirnulated
monocytes. J Immunol 161, 5681-5686.

Scott, P. M. (1990). Trichothecenes in grains. Cereal F aads World 35, 661-666.

Serhan, C. N., Hong, S., Gronert, K., Colgan, S. P., Devchand, P. R., Mirick, G., and
Moussignac, R. L. (2002). Resolvins: a family of bioactive products of omega-3 fatty
acid transformation circuits initiated by aspirin treatment that counter

proinflammation signals. J Exp Med 196, 1025-1037.

Serhan, C. N., and Oliw, E. (2001). Unorthodox routes to prostanoid formation: new twists
in cyclooxygenase-initiated pathways. J Clin Invest 107, 1481-1489.

Sheng, H., Shao, J ., and Dubois, R. N. (2001). K-Ras-mediated increase in cyclooxygenase
2 mRN A stability involves activation of the protein kinase Bl. Cancer Res 61, 2670-
2675.

Shifrin, V. I., and Anderson, P. (1999). Trichothecene mycotoxins trigger a ribotoxic stress
response that activates c-Jun N-terminal kinase and p38 mitogen-activated protein
kinase and induces apoptosis. J Biol Chem 274, 13985-13992.

Shinozuka, J ., Guanmin, L., Uetsuka, K., Nakayama, H., and Doi, K. (1997). Process of the
development of T-2 toxin-induced apoptosis in the lymphoid organs of mice. Exp
Anim 46, 117-126.

Shinozuka, J ., Suzuki, M., Noguchi, N., Sugimoto, T., Uetsuka, K., Nakayama, H., and Doi,

K. (1998). T-2 toxin-induced apoptosis in hematopoietic tissues of mice. Toxicol
Path0126, 674-681.

155

Shoharni, E., and Feuerstein, G. (1986). T-2 toxemia and brain prostaglandins.
Prostaglandins 31, 307-319.

Shoharni, E., Wisotsky, B., Kempski, O., and Feuerstein, G. (1987). Therapeutic effect of
dexamethasone in T-2 toxicosis. Pharm Res 4, 527-530.

Siddiqui, R. A., Jenski, L. J ., Wiesehan, J. D., Hunter, M. V., Kovacs, R. J ., and Stillwell,
W. (2001). Prevention of docosahexaenoic acid-induced cytotoxicity by phosphatidic
acid in Jurkat leukemic cells: the role of protein phosphatase-1. Biochim Biophys
Acta 1541, 188-200.

Sirenko, O. 1., Lofquist, A. K., DeMaria, C. T., Morris, J. S., Brewer, G., and Haskill, J. S.
(1997). Adhesion-dependent regulation of an A+U-rich element-binding activity
associated with AUFl. Mal Cell Biol 17, 3898-3906.

Smith, W. L., DeWitt, D. L., and Garavito, R. M. (2000). Cyclooxygenases: structural,
cellular, and molecular biology. Annu Rev Biochem 69, 145-182.

Smoragiewicz, W., Cossette, B., Boutard, A., and Krzystyniak, K. (1993). Trichothecene
mycotoxins in the dust of ventilation systems in office buildings. Int Arch Occup
Environ Health 65, 113-117.

Snijdewint, F. G., Kalinski, P., Wierenga, E. A., Bos, J. D., and Kapsenberg, M. L. (1993).
Prostaglandin E2 differentially modulates cytokine secretion profiles of human T
helper lymphocytes. J Immunol 150, 5321 -5329.

Staels, B., Koenig, W., Habib, A., Merval, R., Lebret, M., Torra, I. P., Delerive, P., Fadel,
A., Chinetti, G., Fruchart, J. C., Najib, J., Maclouf, J., and Tedgui, A. (1998).
Activation of human aortic smooth-muscle cells is inhibited by PPARalpha but not
by PPARgamma activators. Nature 393, 790-793.

Strober, W. (1991). Trypan blue exclusion test for cell viability. In Current Protocols in
Immunology. (J. E. Coligan, A. M. Kruisbeek, D. H. Marguiles, E. M. Shevach and
W. Strober, Ed). pp. A.3.3-4. Wiley, New York.

Subbaramaiah, K., Chung, W. J ., and Dannenberg, A. J. (1998). Ceramide regulates the
transcription of cyclooxygenase-2. Evidence for involvement of extracellular signal-
regulated kinase/c-Jun N-terminal kinase and p38 mitogen-activated protein kinase
pathways. J Biol Chem 273, 32943-32949.

Sudakin, D. L. (1998). Toxigenic fungi in a water-damaged building: an intervention study.
Am J Ind Med 34, 183-190.

Sugita-Konishi, Y., and Pestka, J. J. (2001). Differential upregulation of TNF-alpha, lL-6,
and IL-8 production by deoxynivalenol (vomitoxin) and other 8-ketotrichothecenes

156

in a human macrophage model. J Toxicol Environ Health A 64, 619-636.

Suneja, S. K., Wagle, D. S., and Ram, G. C. (1989). Effect of oral administration of T-2
toxin on glutathione shuttle enzymes, microsomal reductases and lipid peroxidation

in rat liver. Toxicon 27, 995-1001.

Taki, H., Morinaga, S., Yarnazaki, K., Hamazaki, T., Suzuki, H., and Nakamura, N. (1992).
Reduction of delayed-type hypersensitivity by the injection of n-3 polyunsaturated
fatty acids in mice. Transplantation 54, 511-514.

Tanaka, Y., Otsuji, A., and Amano, F. (1999). Suppression of prostaglandin synthesis by
arachidonic acid or eicosapentaenoic acid in a macrophage-like cell line, RAW
264.7, treated with LPS. Biol Pharm Bull 22, 1052-1057.

Tang, G., Minemoto, Y., Dibling, B., Purcell, N. H., Li, Z., Karin, M., and Lin, A. (2001).
Inhibition of IN K activation through NF-kappaB target genes. Nature 414, 3 13-317.

Taniguchi, Y., Yorioka, N., Kumagai, J ., Katsutani, M., Kuratsune, M., Amimoto, D., and
Yarnakido, M. (1999). Interleukin-6 localization and the prognosis of IgA
nephropathy. Nephron 81, 94-98.

Tavakoli, S., Cowan, M. J ., Benfield, T., Logun, C., and Shelhamer, J. H. (2001).
Prostaglandin E(2)-induced interleukin-6 release by a human airway epithelial cell
line. Am J Physiol Lung Cell Mal Physiol 280, L127-l 33.

Tegeder, I., Neupert, W., Guhring, H., and Geisslinger, G. (2000). Effects of selective and
unselective cyclooxygenase inhibitors on prostanoid release from various rat organs.
J Pharmacol Exp Ther 292, 1 161-1168.

Thieringer, R., Fenyk-Melody, J. E., Le Grand, C. B., Shelton, B. A., Detmers, P. A.,
Somers, E. P., Carbin, L., Moller, D. E., Wright, S. D., and Berger, J. (2000).
Activation of peroxisome proliferator-activated receptor gamma does not inhibit IL-6
or TNF-alpha responses of macrophages to lipopolysaccharide in vitro or in vivo. J

Immunol 164, 1046-1054.

Thompson, W. L., and Wannemacher, R. W., Jr. (1986). Structure-function relationships of
12,13-epoxytrichothecene mycotoxins in cell culture: comparison to whole animal
lethality. Toxicon 24, 985-994.

Trout, D., Bernstein, J ., Martinez, K., Biagini, R., and Wallingford, K. (2001). Bioaerosol
lung damage in a worker with repeated exposure to fungi in a water-damaged
building. Environ Health Perspect 109, 641-644.

Tryphonas, H., lverson, F ., So, Y., Nera, E. A., McGuire, P. F ., O'Grady, L., Clayson, D. B.,
and Scott, P. M. (1986). Effects of deoxynivalenol (vomitoxin) on-the humoral and

157

cellular immunity of mice. Toxicol Lett 30, 137-150.

Tuomi, T., Saarinen, L., and Reijula, K. (1998). Detection of polar and macrocyclic
trichothecene mycotoxins from indoor environments. Analyst 123, 1835-1841.

Tuyt, L. M., Dokter, W. H., Birkenkamp, K., Koopmans, S. B., Lummen, C., Kruijer, W.,
and Vellenga, E. (1999). Extracellular-regulated kinase 1/2, Jun N-terminal kinase,
and c-Jun are involved in NF-kappa B-dependent IL-6 expression in human
monocytes. J Immunol 162, 4893-4902.

Ueno, Y. (1985). The toxicology of mycotoxins. Crit Rev Toxicol 14, 99-132.

Ueno, Y., Muto, A., and Kobayashi, J. (1984). Toxicological properties of T-2 toxin and
related trichothecenes. Arch Belg Suppl, 160-172.

Vane, J. R., Bakhle, Y. S., and Botting, R. M. (1998). Cyclooxygenases 1 and 2. Annu Rev
Pharmacol Toxicol 38, 97-120.

Vattem, K. M., Staschke, K. A., and Wek, R. C. (2001). Mechanism of activation of the
double-stranded-RNA-dependent protein kinase, PKR: role of dimerization and
cellular localization in the stimulation of PKR phosphorylation of eukaryotic
initiation factor-2 (eIF2). Eur J Biochem 268, 3674-3684.

Venkatraman, J ., and Meksawan, K. (2002). Effects of dietary omega3 and omega6 lipids
and vitamin E on chemokine levels in autoimmune-prone MRL/MpJ-lpr/lpr mice. J
Nutr Biochem 13, 479.

Venkatraman, J. T., and Chu, W. C. (1999). Effects of dietary omega-3 and omega-6 lipids
and vitamin E on serum cytokines, lipid mediators and anti-DNA antibodies in a
mouse model for rheumatoid arthritis. J Am Coll Nutr 18, 602-613.

Vogel, C. (2000). Prostaglandin H synthases and their importance in chemical toxicity. Curr
Drug Metab l, 391 -404.

von Schacky, C. (1996). n-3 fatty acids and cell-cell interaction. J Lab Clin Med 128, 5-6.

Wadleigh, D. J., Reddy, S. T., Kopp, E., Ghosh, S., and Herschman, H. R. (2000).
Transcriptional activation of the cyclooxygenase-2 gene in endotoxin-treated RAW
264.7 macrophages. J Biol Chem 275, 6259-6266.

Wang, J., Fitzpatrick, D. W., and Wilson, J. R. (1998). Effects of the trichothecene

mycotoxin T-2 toxin on neurotransmitters and metabolites in discrete areas of the rat
brain. F aad Chem T axical 36, 947-953.

158

Warner, R. L., Brooks, K., and Pestka, J. J. (1994). In vitro effects of vomitoxin
(deoxynivalenol) on T-cell interleukin production and IgA secretion. Food Chem
Toxicol 32, 617-625.

Weiss, G., Meyer, F., Matthies, B., Pross, M., Koenig, W., and Lippert, H. (2002).
Irnmunomodulation by perioperative administration of n-3 fatty acids. Br J Nutr 87
Suppl 1, S89-94.

Williams, B. R. (1999). PKR; a sentinel kinase for cellular stress. Oncogene 18, 61 12-6120.

Williams, J. A., Pontzer, C. H., and Shacter, E. (2000). Regulation of macrophage
interleukin-6 (IL-6) and IL-10 expression by prostaglandin E2: the role of p38
mitogen-activated protein kinase. J Interferon Cytokine Res 20, 291-298.

Williams, J. A., and Shacter, E. (1997). Regulation of macrophage cytokine production by

prostaglandin E2. Distinct roles of cyclooxygenase-1 and -2. J Biol Chem 272,
25693-25699.

Winzen, R., Kracht, M., Ritter, B., Wilhelm, A., Chen, C. Y., Shyu, A. B., Muller, M.,
Gaestel, M., Resch, K., and Holtrnann, H. (1999). The p38 MAP kinase pathway
signals for cytokine-induced mRN A stabilization via MAP kinase-activated protein
kinase 2 and an AU-rich region-targeted mechanism. Embo J 18, 4969-4980.

Wong, 8., Schwartz, R. C., and Pestka, J. J. (2001). Superinduction of TNF-alpha and E-6
in macrophages by vomitoxin (deoxynivalenol) modulated by mRNA stabilization.
T axicalagy 161, 139-149.

Wong, S. 8., Zhou, H. R., Marin-Martinez, M. L., Brooks, K., and Pestka, J. J. (1998).
Modulation of IL- 1 beta, IL-6 and TNF—alpha secretion and mRN A expression by the
trichothecene vomitoxin in the RAW 264.7 murine macrophage cell line. F aad Chem
Toxicol 36, 409-419.

Wong, S. 8., Zhou, H. R., and Pestka, J. J. (2002). EFFECTS OF VOMITOXIN
(DEOXYNIVALENOL) ON THE BINDING OF TRANSCRIPTION FACTORS
AP-l , NF -kappaB, AND NF-IL6 IN RAW 264.7 MACROPHAGE CELLS. J Toxicol
Environ HealthA 65, 1161-1180.

Wu, D., and Meydani, S. N. (1998). n-3 polyunsaturated fatty acids and immune function.
Proc Nutr Soc 57, 503-509.

Xia, Y., Wu, 2., Su, 3., Murray, 3., and Karin, M. (1998). JNKKl organizes a MAP kinase
module through specific and sequential interactions with upstream and downstream

components mediated by its amino-terminal extension. Genes Dev 12, 3369-3381.

Xia, Z., Dickens, M., Raingeaud, J ., Davis, R. J ., and Greenberg, M. E. (1995). Opposing

159

effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270, 1326-1331.

Xie, W., and Herschman, H. R. (1995). v-src induces prostaglandin synthase 2 gene
expression by activation of the c-Jun N-terrninal kinase and the c-Jun transcription
factor. J Biol Chem 270, 27622-27628.

Yan, D., Zhou, H. R., Brooks, K. H., and Pestka, J. J. (1997). Potential role for IL-5 and IL-6
in enhanced IgA secretion by Peyer's patch cells isolated from mice acutely exposed
to vomitoxin. T axicalagy 122, 145-158.

Yan, D., Zhou, H. R., Brooks, K. H., and Pestka, J. J. (1998). Role of macrophages in
elevated IgA and IL-6 production by Peyer's patch cultures following acute oral
vomitoxin exposure. T axical Appl Pharmacol 148, 261-273.

Yan, Z., Subbaramaiah, K., Camilli, T., Zhang, F., Tanabe, T., McCaffrey, T. A.,
Dannenberg, A. J ., and Weksler, B. B. (2000). Benzo[a]pyrene induces the
transcription of cyclooxygenase-2 in vascular smooth muscle cells. Evidence for the
involvement of extracellular signal-regulated kinase and NF-kappaB. J Biol Chem
275, 4949-4955.

Yang, G. H., Jarvis, B. B., Chung, Y. J ., and Pestka, J. J. (2000a). Apoptosis induction by
the satratoxins and other trichothecene mycotoxins: relationship to ERK, p38 MAPK,
and SAPme activation. Toxicol Appl Pharmacol 164, 149-160.

Yang, G. H., Li, S., and Pestka, J. J. (2000b). Down-regulation of the endoplasmic reticulum
chaperone GRP78/BiP by vomitoxin (Deoxynivalenol). T axical Appl Pharmacol 162,
207-217.

Yang, T., Huang, Y., Heasley, L. E., Berl, T., Schnermann, J. B., and Briggs, J. P. (2000c).
MAPK mediation of hypertonicity-stirnulated cyclooxygenase-2 expression in renal
medullary collecting duct cells. J Biol Chem 275, 23281-23286.

Yaqoob, P., and Calder, P. (1995). Effects of dietary lipid manipulation upon inflammatory
mediator production by murine macrophages. Cell Immunol 163, 120-128.

Yoshino, N., Takizawa, M., Akiba, H., Okumura, H., Tashiro, F., Honda, M., and Ueno, Y.
(1996). Transient elevation of intracellular calcium ion levels as an early event in T-2

toxin-induced apoptosis in human promyelotic cell line HL-60. Nat Toxins 4, 234-
241.

Yu, Y., Correll, P. H., and Vanden Heuvel, J. P. (2002). Conjugated linoleic acid decreases
production of pro-inflammatory products in macrophages: evidence for a PPAR

gamma-dependent mechanism. Biochim Biophys Acta 1581, 89-99.

Zeng, L., An, S., and Goetzl, E. J. (1998). EP4/EP2 receptor-specific prostaglandin E2

160

regulation of interleukin-6 generation by human HSB.2 early T cells. J Pharmacol
Exp Ther 286, 1420-1426.

Zhang, Z., Sheng, H., Shao, J., Beauchamp, R. D., and DuBois, R. N. (2000).
Posttranscriptional regulation of cyclooxygenase-2 in rat intestinal epithelial cells.
Neaplasia 2, 523-530.

Zhao, M., Tang, D., Lechparnmer, S., Hoffman, A., Asea, A., Stevenson, M. A., and
Calderwood, S. K. (2002). Double-stranded RNA-dependent Protein Kinase (pkr) Is
Essential for Thermotolerance, Accumulation of HSP70, and Stabilization of ARE-
containing HSP70 mRNA during Stress. J Biol Chem 277, 44539-44547.

Zhou, H. R., Harkema, J. R., Hotchkiss, J. A., Yan, D., Roth, R. A., and Pestka, J. J. (2000).
Lipopolysaccharide and the trichothecene vomitoxin (deoxynivalenol) synergistically
induce apoptosis in murine lymphoid organs. Toxicol Sci 53, 253-263.

Zhou, H. R., Harkema, J. R., Yan, D., and Pestka, J. J. (1999). Amplified proinflammatory
cytokine expression and toxicity in mice coexposed to lipopolysaccharide and the
trichothecene vomitoxin (deoxynivalenol). J T oxical Environ Health A 57, 1 15-136.

Zhou, H. R., Yan, D., and Pestka, J. J. (1997). Differential cytokine mRNA expression in
mice after oral exposure to the trichothecene vomitoxin (deoxynivalenol): dose
response and time course. T axical Appl Pharmacol 144, 294-305.

Zhu, W., Brauchle, M. A., Di Padova, F., Gram, H., New, L., Ono, K., Downey, J. S., and
Han, J. (2001). Gene suppression by tristetraprolin and release by the p38 pathway.
Am J Physiol Lung Cell Mol Physiol 281, L499-508.

161

 

       

M11111

lliliiiliiilllli

3 1293 02365 816