r. as...»
».

wwfiw.

.um.‘

4.3
a.

! Q ,
zmmnu.
.
.r 3v“,

Awizarmua
Lu.» 3. a...

 

"w

\_\
Q)
K.)

This is to certify that the

dissertation entitled

THE ROLE OF TWO RHO GTPASES, CDC42 AND RACl,
IN THE MALIGNANT TRANSFORMATION OF HUMAN FIBROBLASTS

presented by

Kim-Hien T. Dao

has been accepted towards fulfillment
of the requirements for

Ph .D. degree in Biochemistry and
Molecular Biology

kall/M

Major professor

 

 

Date March 12, 2002

 

MS U i: an Affirmatiw Action/Equal Opportunity Institution 0-12771

 

LIBRARY
Michigan State
University

 

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 c:/CIRC/DaleDue.p65—p. 15

THE ROLE OF TWO RHO GTPASES, CDC42 AND RAC1,
IN THE MALIGNANT TRANSFORMATION OF HUMAN FIBROBLASTS
BY

Kim-Hien T. Dao

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Biochemistry and Molecular Biology

2002

ABSTRACT
THE ROLE OF TWO RHO GTPASES, CDC42 AND RAC1,
IN THE MALIGNANT TRANSFORMATION OF HUMAN FIBROBLASTS
By
Kim-Hien T. Dao

It is well established that carcinogenesis is a multistep process involving
repeated selection and clonal expansion of cells that acquire the ability to proliferate
and function uncontrollably as ‘a result of genetic mutations. Increased activation of
Rho GTPases, a subfamily of the Ras superfamily of small G-proteins, has been
shown to confer cells with certain growth properties characteristic of malignant cells.
However, the specific contribution of Rho GTPases to the malignant transformation
of human fibroblasts has not been determined. My research emphasis has been to
investigate the role of two members of the Rho subfamily, Cdc42 and Rac1, in the
malignant transformation of human fibroblasts. Cdc42 and Rac1 were studied in
parallel because they often act in the same pathways to regulate transcription of
genes, cell cycle progression, cell differentiation, survival and apoptosis pathways,
and membrane trafficking. For my studies, I chose two tumor-derived cell lines
generated from the human .fibroblast MSU1 cell lineage that display increased
Cdc42 and Rac1 activity.

To investigate whether Cdc42 and Rac1 act as downstream mediators of
oncogenic H-RAS, dominant-negative Cdc42 and/or Rac1 mutants were expressed
in cells malignantly transformed by oncogenic H-RAS. Expression of dominant-
negative mutant(s) in these cells significantly inhibited growth properties
characteristic of the parental cell line, such as rapid cellular proliferation, focus-

forrning ability in culture, and tumor formation in athymic mice. These results

indicate that intact Cdc42 and Rac1 activity are required for oncogenic H-RAS
transformation of human fibroblasts. Affymetrix GeneChip analysis was carried out
to identify genes regulated by expression of oncogenic H-RAS and dominant-
negative Cdc42 and Rac1 mutants. The mRNA expression of 28 genes was
regulated in this manner. The endothelial PAS domain 1 (EPAS1) gene encodes a
hypoxia-induced transcription factor and is one of nine genes that were dependent
on intact Cdc42 and Rac1 activity for up—regulation by oncogenic H-RAS. Further
analysis showed that secretion of vascular endothelial growth factor, a gene known
to be up-regulated by EPAS1, was dependent upon Cdc42 and Rac1 activity.

To investigate the importance of endogenous, hyperactive Cdc42 and Rac1
in maintenance of growth properties characteristic of malignant cells, dominant-
negative Cdc42 and/or Rac1 mutants were expressed in carcinogen-transformed
cells that display a high level of Cdc42 and Rac1 activity. The activity of Cdc42 and
Rac1 were determined by a p21-activated kinase pull-down assay, which utilizes the
fact that the p21-binding domain only binds to actiVatedl, GTP-bound forms of Cdc42
and Rac1. The cells were infected with retroviruses carrying the cDNA encoding B-
galactosidase, dominant-negative Cdc42, dominant-negative Rac1, or both mutants,
and then selected with puromycin for the drug resistance marker. Three
independent cell populations were generated for each cDNA, and the cells were
injected subcutaneously into athymic mice. In addition, clonalIy-derived cell
populations that express either a low or high level of the mutant(s) were established,
as a more definitive test of the effect of dominant-negative mutant(s) expression on

tumor formation in athymic mice.

ACKNOWLEDGMENTS

I am very privileged that I had Dr. J. Justin McCormick as my major advisor
and Dr. Veronica M. Maher as the co-director of the Carcinogenesis Laboratory. I
am most grateful for their unwavering support and guidance throughout my years in
the Medical Scientist Training Program at Michigan State University. They have
been and will continue to be the strongest influence on my future career as a
scientist. I would also like to thank my guidance committee members, Drs. Maria
Patterson, Leslie Kuhn, and Timothy Zacharewski, for their advice pertaining to my
dissertation work and career aspirations. I acknowledge Dr. Sandra O’Reilly,
Michele Battle, Dr. Susanne Kleff, Dan Appledorn, Ziqiang Li, Kristin McNally, Terry
McManus, Dr. Hongyan Liang, and the rest of the Carcinogenesis Laboratory for
their friendship and helpful scientific discussions. I appreciate the experimental
assistance from two undergraduate Howard Hughes scholars, Tracy Ross and
Edward Marshall. i thank Katherine Bergdolt, Bethany Heinlen, and Suzanne Kohler
for their administrative assistance. The support and encouragement from my family
were enduring; I wish to acknowledge Son Dao, Tinh Nguyen, Binh Dao, Quang
Dao, Oanh Dao, Mai Dao, and Tu Dao. My parents made the pivotal decision to
leave Vietnam when the oppressive rule of the communist regime was no longer
imminent. Their decision to come to the United States has allowed me to pursue
personal and career aspirations without political boundaries. I wish to share all my
aspirations with Fred Robinson, a very special companion that I admire and adore

immensely.

iv

TABLE OF CONTENTS

 

 

 

 

 

LIST OF TABLES VIII
LIST OF FIGURES - IX
LIST OF ABBREVIATIONS - - XI
INTRODUCTION - 1
REFERENCES ................................................................................................................ 6
CHAPTER I: LITERATURE REVIEW 9
A. CURRENT PARADIGM OF CARCINOGENESIS .................................................................. 9

1. Cancer is a genetic disease ................................................................................. 9

2. Classification of cancer-related genes .............................................................. 10

a Dominant-acting proto-oncogenes (e.g., RAS, MYC genes) ....................................... 10

b Recessive-acting tumor suppressor genes (e.g., RB, p53 genes) ............................. 12

c. Genes regulating apoptosis pathways ............................................................................ 15

d Genes regulating DNA repair pathways ......................................................................... 18

e Telomeres and telomerases ............................................................................................. 20

3. Multistep process of carcinogenesis ................................................................. 22

B. RAS SUPERFAMILY OF SMALL GUANlNE-NUCLEOTIDE BINDING PROTEINS ................... 33

I. Ras GTPases and their cellular fimctions ........................................................ 33

2. Multiple pathways regulated by RAS genes ...................................................... 34

a. Ras/RaflMEK/ERK pathway ............................................................................................. 34

b. Pl3K-activated pathways .................................................................................................. 36

c. Ral-GDS/Ral GTPase/RIP1 pathway .............................................................................. 37

3. Contribution of RAS genes to malignant transformation ................................. 40

C. CDC42 AND RAcl, Two MEMBERS or THE RHO SUBFAMILY or GTPASES .................. 45

1. Rho GTPases and their cellular fimctions ........................................................ 45

2. Biochemical and structural features of Cdc42 and Rac1 ................................. 48

a. Guanine nucleotide binding and GTP hydrolysis domains .......................................... 48

b. Effector binding domain .................................................................................................... 49

c. CAAX domain ..................................................................................................................... 50

d. Rho insert domain .............................................................................................................. 50

3. Regulation of Cdc42 and Rac1 activity ............................................................ 53

a. GTPase-activating protein (GAP) .................................................................................... 53

b. Guanine-nucleotide dissociation inhibitor (GDI) ............................................................ 54

c. Guanine-nucleotide exchange factor (GEF) .................................................................. 56

4. Eflector-mediated pathways of Cdc42 and RacI .............................................. 59

a. Organization of the actin cytoskeleton ............................................................................ 60

b. Induction of survival and apoptosis pathways .............................................................. 62

 

c. Regulators of gene expression ............................................................... 63

 

 

 

d. Role in membrane-trafficking processes .. .. ...................... 64

e. Cellular context of Cch2 and Rac1 function .......................................... 64

5. Contribution of CDC42 and RACI genes to malignant transformation ........... 65

a. Constitutively active Cdc42 and Rac1 mutants ............................................................. 65

b. Oncogenic derivatives of the Dbl family of GEFs .......................................................... 66

c. Cch2 and Rac1 as mediators of oncogenic H-RAS transformation ......................... 68

d. PAK as the major effector mediating transformation of cells ....................................... 72

e. Summary - ...... . - .............................. 73
REFERENCES .............................................................................................................. 78

CHAPTER 2: H-RAS-INDUCED TRANSFORMATION OF HUMAN
FIBROBLASTS IS DEPENDENT ON CDC42 AND RACl ACTIVITY, AS IS UP-

 

REGULATION OF EPASl 108
ABSTRACT ................................................................................................................ 110
INTRODUCTION ........................................................................................................ 1 1 1
MATERIALS AND METHODS .................................................................................. 114

' Growth conditions .............................................................................................................. 114
Cell strains/lines ................................................................................................................. 1 14
Cell Iysates and immunoblot analysis ................................................................................ 114
Stable transfection of dominant-negative mutant Cdc42 and Rac1 .................................. 115
Growth assay ..................................................................................................................... 116
Focus reconstruction assay ............................................................................................... 116
Tumorigenicity studies ....................................................................................................... 117
Affymetrix GeneChip expression analysis ......................................................................... 117
Northern blot analysis ........................................................................................................ 118
Electrophoretic mobility shift assay .................................................................................... 119
VEGF secretion .................................................................................................................. 120

RESULTS .................................................................................................................... 121
PH3MT cell strains expressing dominant-negative Cdc42 and Rac1 mutants .................. 121
Rapid proliferation of PH3MT cells requires intact Cdc42 and Rac1 activity .................... 126
The ability of PH3MT cells to form foci depends on Cdc42 and Rac1 activity .................. 128
Expression of dominant-negative mutant(s) in PH3MT cells inhibited tumor formation 131
Identification of H-Ras targets dependent on Cdc42 and Rac1 activity ............................ 133
EPASl is a Ras target dependent on Cdc42 and Rac1 activity for up-regulation ............ 137
DISCUSSION .............................................................................................................. 144
APPENDICES ............................................................................................................. 149
REFERENCES ............................................................................................................ 165

APPENDIX A: INVESTIGATING THE CONTRIBUTION OF ENDOGENOUS,
HYPERACTIVE CDC42 AND RACl TO THE MALIGNANT

 

TRANSFORMATION OF HUMAN FIBROBLASTS - 169
ABSTRACT ................................................................................................................ 170
INTRODUCTION ........................................................................................................ 1 71
MATERIALS AND METHODS .................................................................................. 173

Growth conditions .............................................................................................................. 173

vi

Cell strains/lines ................................................................................................................. 173

Cell lysates and immunoblot analysis ................................................................................ 173
GIutathione-S-transferase—p21-binding domain pull-down assay ...................................... 174
Retroviral infection of cells with dominant-negative Cdc42 and Rac1 cDNAs .................. 175
Tumorigenicity studies ....................................................................................................... 176
RESULTS .................................................................................................................... 177
Identifying fibrosarcoma cell lines that exhibit increased Cdc42 and Rac1 activity .......... 177
Level of H-Ras, p—ERK112, and ERK1/2 in MSU-1.1 and L210-6AISB1 cells .................. 184
L210-6AISB1 cells expressing dominant-negative Cdc42 or Rac1 mutants ..................... 187
DISCUSSION .............................................................................................................. 193
REFERENCES ............................................................................................................ 195

APPENDIX B: IDENTIFYING CANDIDATE CAN CER-RELATED GENES BY
CDNA SUBTRACTION ANALYSIS OF A MALIGNANT CELL LINE WITH
ELEVATED CDC42 AND RACl ACTIVITY AND ITS PARENTAL CELL

 

STRAIN MSU-l.l 197
ABSTRACT ........................................................................................................ 198
INTRODUCTION ........................................................................................................ 199
MATERIALS AND METHODS .................................................................................. 201

PCR-Select subtractive hybridization ................................................................................ 201

Dot blot analysis ................................................................................................................. 202
Northern blot analysis ........................................................................................................ 202
RESULTS/DISCUSSION ............................................................................................ 204
PCR-Select cDNA subtractive hybridization ...................................................................... 204
REFERENCES ............................................................................................................ 215
FUTURE DIRECTIONS- 217

 

vii

LIST OF TABLES

Chapter II

Table 1: Effect of dominant-negative mutant(s) expression on growth of PH3MT
cells. ............................................................................................................... 127

Table 2: Effect of dominant-negative mutant(s) expression on tumor formation by
PH3MT cells. .................................................................................................. 132

Table 3: Proteins encoded by genes up-regulated or down-regulated by H-RAS that
showed dependence on Cdc42 and Rac1 activity. ......................................... 136

Appendix B

Table 1: Genes differentially expressed between MSU-1.1 and L210-6AISB1 cells
, ....................................................................................................................... 214

viii

LIST OF FIGURES

Chapter!
Figure 1: Cell strains/lines of the human fibroblast MSU1 cell lineage. ................... 30

Figure 2: Anchorage independence status of cell strains/lines of the MSU1 cell
fineage. ............................................................................................................. 32

Figure 3: Multiple Ras effector-mediated pathways lead to transcriptional activation
ofgenes. ........................................................................................................... 39

Figure 4: Functional mutants of the Rho subfamily of GTPases .............................. 71
Figure 5: Cdc42 and Racl contribute to malignant transformation of cells by at least

two possible mechanisms. ................................................................................ 77
Chapter I!

Figure 1: PH3MT cellstrains expressing dominant-negative Cdc42 and/or Rac1
mutants. .......................................................................................................... 124

Figure 2: Expression of dominant-negative Cdc42 and/or Rac1 mutants in PH3MT
cells inhibited focus formation. ........................................................................ 130

Figure 3: EPAS1 as a Ras target dependent on Cdc42 and Rac1 activity for up-
‘regulation. ....................................................................................................... 140
Appendix 1: Tet-OFFmammalian expression system. .......................................... 151

Appendix 2: PH3MT cell strains with tetracycline-regulated expression of tTAk
' protein ............................................................................................................ 154

Appendix 3: Focus reconstruction assay. .............................................................. 156

Appendix 4: Summary of role of Cdc42 and Rac1 in oncogenic H—RAS-transformed
rodent and human fibroblasts. ........................................................................ 158

Appendix 5: Preparation of cRNA for Affymetrix GeneChip expression analysis...160

Appendix 6: Optimal time point for polyA+RNA extraction from PH3MT-Double-C15
cells in the presence or absence of tetracycline .............................................. 162

Appendix 7: Expression of oncogenic RAS isoforrns induces VEGF secretion into
the growth medium ......................................................................................... 164

ix

Appendix A
Figure .1: GST-PBD pull-down assay of GTP-bound Cdc42 and Rac1 proteins ....179

Figure 2: Level of GTP-bound Cdc42 and Rac1 proteins in cell strains/lines of the
MSU1 cell lineage ........................................................................................... 181

Figure 3: Endogenous, hyperactive Cdc42 and Rac1 proteins in L210-6AISB1 cells
compared with that in its parental cell strain MSU-1.1 .................................... 183

Figure 4: Comparing level of H-Ras, poERK, and ERK in MSU-1.1 and L210-6A/SB1
cells ................................................................................................................ 186

Figure 5: Cell populations of L210-6A/SB1 that express B-galactosidase, dominant-
negative Cdc42, dominant-negative Rac1, or both mutants ............................ 190

Figure 6: Clonalpopulations of L210-6A/SB1 that express a low or high level of [3-
. galactosidase, dominant—negative Cdc42, dominant-negative Rac1, or both

mutants ........................................................................................................... 192
4 Appendix B.
Figure 1: General strategy of- PCR-Select cDNA subtractive hybridization. ........... 207

Figure 2: Dot blot analysis of 384 subtracted cDNA products from the forward and
reverse subtraction ......................................................................................... 209

Figure 3: Relative signal intensity .of each subtracted cDNA product analyzed by dot
blot analysis. ..................................... ' .............................................................. 21 1

Figure 4: Northern blot analysis to verify differential expression of subtracted cDNA
products .......................................................................................................... 21 3

LIST OF ABBREVIATIONS

BCL-2, B—pell lymphoma 2

BPDE, henzo[a]pyrene giol ppoxide

Cdc42, pell givision pycle 42

CDK, pyclin-gependent hinases

cDNA, pomplementary _DN_A

Dbl, giffuse B—cell Lymphoma

DH, le homology

DNA, geoxyribohucleic pcid

EPAS1, _e_ndothelial PAS domain 1

ERK, gxtracellular signal-[egulated hinase

GAP, GTPase activating protein

GDI, guanine-nucleotide gissociation inhibitor

GDP, guanosine giphosphate

GEF, guanine-nucleotide pxchange factor

G-protein, guanine-nucleotide binding protein
GST-PBD, glutathione-S-transferase-p21~binding gomain
' GTP, guanosine triphosphate

GTPase, guanosine triphosphate hydrolfi

HRE, hypoxia [esponse _e_lement

JNK, c-gun amiho terminal hinase

MAPK, mitogen-pctivated protein hinase

MEK, MAP/ERK _lginase

NER, hucleotide pxcision [epair

PAK, p21-pctivated hinase

PAS, period, pryl hydrocarbon receptor nuclear translocator, and single-minded
PBD, p21-hinding gomain

. PH, pleckstrin homology

‘ Pl3K, phosphatidyljnositol géhinase

PIP3, phosphatidylinositol (3,4,5)-bisphosphate

Rac, figs-related Q3 botulinum toxin substrate
Ral-GDS, _l3_a_l guanine-nucleotide _d_issociation ptimulator
Rb, [etinohlastoma

Rho, Bas hpmology

RlP1, gal-interacting protein 1

SH2, §rc homology region-g

8H3, §rc homology region-3

SCS, pupplemented palf §erum

TBST, Iris-huffered paline containing 0.1% Iween-20
VEGF, yascular gndothelial growth factor

VEGF R, yascular _e_ndothelial growth factor [eceptor

xi

INTRODUCTION

The presence of hallmark genetic defects in certain types of cancers and in
familial cancer syndromes has led to the, recognition that cancer is a genetic
disease. Since then, there has been steady progress in studying genes involved in
the multistep process of carcinogenesis. In the classical genetic description, two
kinds of genes are involved, i.e., proto-oncogenes and tumor suppressor genes.
Proto-oncogenes act as dominant-acting genes whereas tumor suppressor genes
act as recessive-acting genes. Oncogenic activation of one allele of a proto-
oncogene produces a cellular defect despite the presence of the other normal allele.
In contrast, both alleles must be inactivated for a tumor suppressor gene to confer a
cellular defect. Typically, the cellular genes involved in carcinogenesis are those
that. regulate cellular growth and differentiation, apoptosis pathways, DNA repair
pathways, and telomere function (Cotran et al., 1999). Disrupted function of these
genes contributes to the malignant transformation of cells if they confer a selective
growth advantage, such as uncontrolled cellular proliferation, increased resistance to
apoptosis signals, sustained angiogenesis, or enhanced invasive and metastatic
potential (Hanahan and Weinberg, 2000). It has been estimated that 4-7 rate-
limiting genetic defects are necessary. to convert a normal human cell into a
malignant cell (Renan, 1993). Thus, cancer cells have undergone progressive
selection and clonal expansion such that they have acquired all the genetic changes
necessary to confer the malignant phenotype.

Mutations in hundreds of genes could produce cellular defects that confer a
selective growth advantage during the carcinogenesis process. However, only a

small subset of these genes-has widespread dysfunction in various types of human

cancers. An example of such genes is the RAS genes, which contain oncogenic
mutations in approximately 30% of all human tumors (Bos, 1988 and 1989). This
may be a significant underestimate because functional activation of Ras pathways
may occur in the absence of mutations in the RAS genes themselves. Ras proteins
are prototypes of a superfamily of small guanine-nucleotide binding proteins (Hall,
1990 and 1992b). By cycling between active, GTP-bound states and inactive, GDP-
bound states, Ras proteins act as functional switches to regulate downstream
signaling pathways. Activated Ras proteins activate three effector proteins, Raf,
Pl3K, and Ral-GDS, which constitute three major effector-mediated pathways
involved in Ras function (reviewed in Crespo and Leon, 2000). All three pathways
are required for RAS-transfonned cells to exhibit malignant growth properties (Vojtek
and Der, 1998). To gain insight into mechanisms of oncogenic RAS transformation
of cells, many recent studies have focused on understanding the contribution of
specific Ras effector pathways to the malignant transformation process.

Recently, it has been shown that Ras acts upstream of Cdc42 and Rac1
through phosphatidylinositol 3-kinase (Stephens et al., 1996; Aspenstrom, 1999).
Some members .of‘the Rho subfamily of GTPases were identified based on their
biochemical and structural similarities to Ras proteins. However, the cellular
functions of Rho GTPases are unique from that of Ras proteins (Hall, 1990 and
1992b). Cdc42, Rae, and Rho, three prototype members of this subfamily, induce
morphologically distinct cytoskeletal structures in quiescent fibroblasts stimulated
with growth factors (Ridley and Hall, 1992; Ridley et al., 1992; Kozma et al., 1995;
Nobes and Hall, 1995; Machesky and Hall, 1997). Cdc42 induces filopodia, Rac1
induces lamellipodia and membrane ruffles, and Rho induces stress fibers.

Sequential formation of these structures led to the proposal that Cdc42 activates

Rac1, which then activates Rho. The Rho subfamily regulates other cellular
functions including transcription, cell, cycle. progression, differentiation, survival and
apoptosis pathways, and membrane trafficking (Van Aelst and D'Souza Schorey,
1997). Cdc42 and Rac1 act in parallel through p21-activated kinase to regulate
~ some of these cellular processes (Bagrodia and Cerione, 1999). , Three families of
proteins regulate activity of Rho GTPases, the GTPase-activating proteins, the
guanine-nucleotide dissociationinhibitors, and the guanine nucleotide exchange
factors. Evidence that Cdc42 and Rac1 play a role in the malignant transformation
of rodent fibroblasts comes from studies that show the transforming activity of
oncogenic derivatives of guanine nucleotide exchange factors (Cerione and Zheng,
1996), the requirement of Cdc42 and Rac1. activity in oncogenic H-RAS-induced
transformation(Prendergast' et al., 1995; Qiu et al., 1995a, 1995b, and 1997), and
the involvement of p21-activated kinase in the induction of survival pathways (Tang
et al., 2000; Jakobi et al., 2001.). However, the specific contribution of Cdc42 and
Rac1 to the malignant transformation of-human fibroblasts has not been determined.

There are at least two possible mechanisms by which Cdc42 and Rac1
contribute to malignant transformation of cells. In cells that express the DBL
oncogene, i.e., a truncated derivative of the Dbl proto-oncogene (Tang et al., 2000;
‘Jakobi et al., 2001), which is a guanine-nucleotide exchange factor for Rho GTPases
(Hart et al., 1991; Yaku et al., 1994), there is a dramatic increase in GTP-bound
levels of Cdc42 and Rac1 due to an increase in exchange activity. Because the
GTP hydrolysis rate is not concomitantly increased, a steady-state increase or
static increase in Cdc42 and Rac1 activity is observed in these cells. In contrast,
in cells that express the ABR oncogene (Chuang et al.,1995) or the RAS oncogene

(Aspenstrom, 1999), an increase in exchange activity of Cdc42 and Rac1 is coupled

with an increase in GTP hydrolysis rates of these proteins. Therefore, the GTP-
bound level of Cdc42 and Rac1 may not increase because there is rapid conversion
of the GTP-bound states to the GDP-bound states. Thus, there is a dynamic
increase in Cdc42 and Rac1 activity because there is increased cycling of the
proteins between these guanine-nucleotide—bound states. Activation of. Cdc42 and
Rac1 by either of these two mechanisms plays a causal role in the malignant
transformation of cells but the mechanism of activation probably influences their
specific contribution to the malignant phenotype.

My dissertation research has been focused on investigating the role of Cdc42
and Rac1 in the malignant transformation of human fibroblasts. For my studies, I
chose two tumor-derived fibrosarcoma cell lines generated from the non-tumorigenic
MSU-1.1 human fibroblast cell strain. To generate. such fibrosarcoma cell lines,
morphologically 'transfon'ned MSU-1.1 cells were. isolated following expression of an
oncogene or treatment with a carcinogen and then injected subcutaneously into
athymic mice. Tumors fromathymic mice were cultured to establish tumor-derived
fibrosarcoma cell lines. PH3MT, was transformed by overexpression of the H-RAS
oncogene (Hurlin et al., 1989) and is expected to have increased cycling of Cdc42
and Rac1 between active and inactive states. L210-6AISB1, was transformed by
BPDE carcinogen treatment (L. Milam, unpublished studies). These cells exhibit
elevated levels of active, GTP-bound Cdc42 and Rac1 proteins. Dominant-negative
Cdc42 and/or Rac1 mutants were expressed in both these cell lines, and the effect
of these mutant(s) on the transformed phenotype of these cells was investigated.

The conclusions from the study with PH3MT cells are summarized here.
Expression of dominant—negative Cdc42 and/or Rac1 mutants in cells malignantly

transformed by oncogenic H-RAS inhibited rapid cellular proliferation, focus-forming

4

ability, and tumor growth in athymic mice. These results indicate that Cdc42 and
Rac1 activity are required for oncogenic H-RAS-induced transformation of human
fibroblasts. To determine the specific contribution of Cdc42 and Rac1 to oncogenic
H-RAS transformation, Affymetrix GeneChip analysis was used to identify genes that
are dependent on Cdc42 and Rac1 activity for up-regulation or down-regulation by
oncogenic H—RAS. There were 28 genes that exhibited such regulation. One gene
identified was ‘EPAS1, a hypoxia-inducible transcription factor that displayed
dependence on intact Cdc42 and Rac1 activity for up-regulation by oncogenic H-
RAS. In turn, EPAS1 is known to up-regulate the vascular endothelial growth factor
gene (T ian et al., 1997). Further analysis showed that, as expected, secretion of
vascular endothelial growth factor into the growth medium is dependent on Cdc42
and Rac1 activity. These. results reveal a mechanism by which H-RAS induces up-
regulation of vascular endothelial growth factor, a protein that plays a major role in
tumorigenesis and angiogenesis of solid tumors.

The dissertation is organized into three major parts. Chapter 1 is a literature
review of the current paradigm of carcinogenesis, multiple Ras pathways and their
contribution to carcinogenesis, and Rho GTPases as important cellular mediators of
malignant transformation. Chapter 2 is a copy of a manuscript 'to be submitted to
the journal Nature Genetics. It describes the results of research carried outwith the
PH3MT cell line. The title of the paper is “H-RAS-induced transformation of human
fibroblasts is dependent on Cdc42 and Rac1 activity, as is up-regulation of EPAS1.”
This is followed by Appendix A, which describes the resultsiof the research carried
out with the L210-6A/SB1 cell line- Tumor studies for this work is currently in
progress. Appendix B describes the results of PCR-Select cDNA subtractive

hybridization analysis between MSU-1.1 cells and L210-6A/SB1 cells.

REFERENCES

Aspenstrom, P. (1999). The Rho GTPases have multiple effects on the actin
cytoskeleton. Exp Cell Res 246, 20—5.

Bagrodia, S., and Cerione, R. A. (1999). Pak to the future. Trends Cell Biol 9, 350-5.

Bos, J. L. (1988). The ras gene family and human carcinogenesis. Mutat Res 195,
255-71.

Bos, J. L. (1989). ras oncogenes in human cancer: a review. Cancer Res 49, 4682-
9.

Cerione, R. A., and Zheng, Y. (1996). The Dbl family of oncogenes. Curr Opin Cell
Biol 8, 216-22.

Chuang, T. H., Xu, X., Kaartinen, V., Heisterkamp, N., Groffen, J., and Bokoch, G.
M. (1995). Abr and Bcr are multifunctional regulators of the Rho GTP-binding protein
family. Proc Natl Acad SCI U S A 92, 10282-6.

Cotran, R. S., Kumar, V., and Collins, T. (1999). Robbins pathological basis of
disease, 6th Edition (Philadelphia: W.B. SaundersCompany).

Crespo, P., and Leon, J. (2000). Ras proteins in the control of the cell cycle and cell
~ differentiation. Cell Mol Life Sci 57, 1613-36.

Hall, A. (1990). The cellular functions of small GTP-binding proteins. Science 249,
635-40.

Hall, A. (1992). Small GTP- -binding proteins-a new family of biologic regulators. Am
J Respir Cell Mol Biol 6, 245-6.

Hanahan, D., and Weinberg, R. A. (2000). The hallmarks of cancer. Cell 100, 57-70.

Hart, M. J., Eva, A., Evans, T., Aaronson, S. A., and Cerione, R. A. (1991). Catalysis
of guanine nucleotide exchange on the CDC42Hs protein by the dbl oncogene
product. Nature 354,-311-4.

Hurlin, P. J., Maher, V. M., and McCormick, J. J. (1989). Malignant transformation of
human fibroblasts caused by expression of a transfected T24 H-RAS oncogene.
Proc. Natl. Acad. Sci. U S A 86, 187-91.

Jakobi, R... Moertl, E., and Koeppel, M. A. (2001). p21-activated protein kinase
gamma-PAK suppresses programmed cell death of BALB3T3 fibroblasts. J Biol
Chem 276, 16624-34.

Kozma, R., Ahmed, 8., Best, A., and Lim, L. (1995). The Ras-related protein
Cdc42Hs and bradykinin promote formation of peripheral actin microspikes and
filopodia in Swiss 3T3 fibroblasts. Mol Cell Biol 15, 1942-52.

Machesky, L. M., and Hall, A. (1997). Role of actin polymerization and adhesion to
extracellular matrix in Rac- and Rho-induced cytoskeletal reorganization. J Cell Biol
138, 913-26.

Nobes, C. D., and Hall, A; (1995). Rho, rac, and cdc42 GTPases regulate the
assembly of multimolecular focal complexes, associated with actin stress fibers,
lamellipodia, and filopodia. Cell 81, 53-62.

Prendergast, G. C., Khosravi Far, R., Solski, P. A., Kurzawa, H., Lebowitz, P. F., and
Der, C. J. (1995). Critical role of Rho in cell transformation by oncogenic Ras.
Oncogene 10, 2289-96.

Qiu, R. G., Chen, J., Kim, D., McCormick, F., and Symons, M. (1995a). An essential
role for Rac in Ras transformation. Nature 374, 457-9.

Qiu, R. G., Chen, J., McCormick, F., and Symons, M. (1995b). A role for Rho in Ras
transformation. Proc Natl Acad Sci U S A 92, 11781-5.

Qiu, R. G., Abo, A., McCormick, F., and Symons, M. (1997); Cdc42 regulates
anchorage-independent growth and is necessary for Ras transformation. Mol Cell
Biol 17, 3449-58.

Renan, M. J. (1993). How many mutations are required for tumorigenesis?
Implications from human cancer data. Mol. Carcinog. 7, 139-46.

Ridley, A. J., and Hall, A. (1992). The small GTP-binding protein rho regulates the
assembly of focal adhesions and actin stress fibers in response to growth factors.
Cell 70, 389-99.

Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D., and Hall, A. (1992).
The small GTP-binding protein rac regulates growth factor-induced membrane
ruffling. Cell 70, 401-10.

Stephens, L., Hawkins, P. T., Eguinoa, A., and Cooke, F. (1996). A heterotrimeric
GTPase-regulated isoforrn of PI3K and the regulation of its potential effectors. Philos
Trans R Soc Lond B Biol Sci 351, 211-5.

Tang, Y., Zhou, H., Chen, A., Pittman, R. N., and Field, J. (2000). The Akt proto-
oncogene links Ras to Pak and cell survival signals. J Biol Chem 275, 9106-9.

Tian, H., McKnight, S. L., and Russell, D. W. (1997). Endothelial PAS domain protein
1 (EPAS1), a transcription factor selectively expressed in endothelial cells. Genes
Dev 11, 72-82.

Van Aelst, L., and D'Souza Schorey, C. (1997). Rho GTPases and signaling
networks. Genes Dev 11, 2295-322.

Vojtek, A. B., and Der, C. J. (1998). Increasing complexity of the Ras signaling
pathway. J Biol Chem 273, 19925-8.

' Yaku, H., Sasaki, T., and Takai, Y. (1994). The Dbl oncogene product as a
GDP/GTP exchange protein for the Rho family: its properties in comparison with
those of Smg GDS. Biochem Biophys Res Commun 198, 811-7.

CHAPTER I: LITERATURE REVIEW

A. Current paradigm of carcinogenesis

1. Cancer is a genetic disease

In 1914, T. Boveri published his theory that the accumulation of somatic
mutations in cells causes the transformation of normal cells to cancer cells (Boveri,
1914). Support of his theory comes from investigation of hallmark chromosomal
abnormalities present in certain Ieukemias and in Burkitt’s lymphomas. It was
discovered that such chromosomal abnonnalitiesg result in oncogene activation by
balanced translocation (reviewed in Solomon et al., 1991). The finding that defects
in gene structure and function are-consistently present in inheritable forms of
cancers, e.g., gennline mutation of the retinoblastoma gene (Friend et al., 1986),
further supported the theory that cancer originates from cells that harbor genetic
defects. Such defects may result from point mutation, deletion, amplification of
genes, recombination of DNA. sequences, or rearrangement of chromosomes.
These mutational events may be induced by chemical or physical agents or inherited
in the gerrnline. A Since the discovery that cancer is a genetic disease, cancer
research has been largely directed at understanding the genetic and molecular basis
ofcanceL

Under certain cellular contexts, the altered function of mutated genes may
confer cells with a selective growth advantage (Hanahan and Weinberg, 2000).
These genes can be categorized into four groups: genes involved in growth
stimulation (proto-oncogenes), genes involved in growth inhibition (tumor suppressor
genes), genes involved in apoptosis pathways, and genes involved in DNA repair

pathways (Cotran et al., 1999). The intact function of genes that regulate apoptosis

pathways and DNA repair pathways is critical for preventing propagation of cells
containing» genetic damage. A further. simplification can be made by describing
genes in these two categories as proto-oncogenes or tumor suppressor genes
depending on their ultimate gene function. Telomeres and telomerases will also be
discussed. In the classical genetic description, proto-oncogenes have dominant-
acting effects and tumor suppressor genes have recessive-acting effects (Barrett et
al., 1986; Yuspa et al., 1994b). For example, an activating mutation of one allelic
copy of a proto-oncogene, thereby converting it to an oncogene, produces a cellular
defect despite the presence ofthe other normal allelic copy. In contrast, tumor
suppressor genes require inactivating mutations of both allelic copies to produce a
cellular defect. Generally, activating mutations in oncogenes result in a- gain of
function and inactivating mutations in tumor suppressor genes result in a loss of

function.

2. Classification of cancer-related genes

a. Dominant-acting proto-oncogenes (e.g., RAS, MYC genes)

Proto-oncogenes encode proteins that usually promote cell growth and
differentiation such as growth factors, growth factor receptors, proteins involved in
signal transduction, nuclear transcription factors, and cyclins and cyclin-dependent
kinases (reviewed in Dang et al., 1997; Todd and Wong, 1999; Prober and Edgar,
2001). A mutation that converts a proto-oncogene to its oncogenic derivative usually
disrupts regulatory mechanisms in place to limit the protein at a certain level of
activity (Todd and Wong, 1999). As a result, the proteins encoded by these
oncogenes usually assume constitutively active protein conformations (e.g., H-RAS

oncogene) (Feinberg et al., 1983), lose intrinsic domains that normally inhibit its

10

catalytic domains (e.g., DBL oncogene) (Eva and Aaronson, 1985), or lack functional
domains required for negative regulation by other proteins. In other cases, there
may simply be a marked increase in proto-oncogene expression as a result of one of
the mutational events described earlier (e.g., Myc up-regulation) (T aya et al., 1984;
Huber et al., 1985; Koda et al., 1985; Schwab et al., 1985).

The RAS gene is discussed further as an example of a proto-oncogene
because activating mutations of RAS genes are frequently found in human and
experimental tumors (Bos et al., 1987; reviewed in Bos, 1988). Ras is a small
guanine-nucleotide binding protein (G-protein) that cycles between an - inactive,
GDP-bound state and an active, GTP-bound state (Hall, 1990 and 1992b). The
Raf/MEK/ERK pathway, one of several major-pathways stimulated by- GTP-bound
Ras, is a growth factor-stimulated pathway that induces transcription of genes
involved in cell cycle progression and cell differentiation (Robinson and Cobb, 1997;
reviewed in English et al., 1999). This pathway'leads to .up-regulation of cyclins (Fan
and Bertino, 1997) and down-regulation of p27Kim (Rivard et al., 1999), which
cooperatively induce cellular entry into S-phase and DNA synthesis. In cells that
acquire an oncogenic or activating mutation of the RAS gene, there is
overstimulation of Ras pathways without the normal dependence on upstream
stimulatory inputs such asgrowth factor binding to its receptor (Balmain, 1985;
Sekiya et al., 1985; Williams et al., 1985). This results in a gain of function of Ras,
which causes uncontrolled cell growth and differentiation (Balmain, 1985; Sekiya et
al., 1985; Williams et al., 1985). The contribution of the RAS genes to the malignant
transformation of cells will be discussed in section I.B.

Another example of a proto-oncogene is the c-MYC gene, which encodes a

basic-helix-loop-heIix-zipper (bHLHZ) transcription factor (Dang et al., 1992; Torres

11

' et al., 1992; Wechsler and Dang, 1992). It heterodimerizes with another bHLHZ
transcription factor, Myc associated factor 5 (Max), in order to bind to CACGTG sites
(E-boxes) present in the promoter region of genes that promote cell cycle
progression and apoptosis pathways (Blackwood and Eisenman, 1991). The MYC
gene is overexpressed in many human tumors, usually as a result of gene
‘ translocation or amplification (reviewed in Alitalo et al., 1983; Facchini and Penn,
1998). In Burkitt’s lymphoma, the c-MYC gene, which is normally located at 8q24, is
translocated to a chromosome region that contains the immunoglobulin heavy chain
gene (14q32) (McFarlaneet al., 1970; Warrens, 1974; Kaneko et al., 1980). The
chromatin structure in this region favors highly active transcription. Cells with an
increased steady-state level of Myc have sustained up-regulation of target genes
that confer cells with uncontrolled cellular proliferation and differentiation (Koda et
al., 1985; Schwab et al., 1985;“Cole, 1986a and 1986b; Land at al., 1986). Evidence
that the biological activity of Myc is linked to its transcriptional activity comes from
studies that show mutations in the transactivation .domain or in the bHLHZ domain
abrogate the cellular defects induced by Myc overexpression (Kretzner et al., 1992a

and 1992b).

b. Recessive-acting tumor suppressor genes (e.g., RB, p53 genes)

Tumor suppressor genes encode proteins that regulate a variety of cellular
processes but their main regulatory input is to inhibit uncontrolled cell growth and
differentiation (Geiser and. Stanbridge, 1989; Macleod, 2000). The first tumor
suppressor gene identified is the retinoblastoma (Rb) gene (Friend et al., 1986; Fung
et al., 1987; Lee et al., 1987), which encodes a nuclear protein that regulates cell

cycle progression, cell differentiation, and p53-dependent and p53-independent

12

apoptosis pathways (reviewed in Nevins, 2001). Rb function is disrupted in
retinoblastomas and frequently, in other human cancers, including osteosarcomas,
small cell lung cancer, and breast and prostate carcinomas (reviewed in Nevins,
2001). Active, hypophosphorylated Rb binds to the E2F family of transcription
factors and sequesters them from activating transcription (Flemington et al., 1993).
The E2F family of transcription factors up-regulate genes that contain E2F sites in
the promoter region and promote G19 S transition in the cell cycle (Dyson, 1998;
Nevins, 2001). More recent studies show that the Rb-E2F complex also actively
represses transcription (Sellers et al., 1995; Weintraub et al., 1995). Furthermore,
recruitment of histone deacetylase by the Rb-E2F complex promotes nucleosome
assembly on the promoter, which prevents the transcriptosome from having access
to DNA sequences (Brehm et al., 1998; Luo et al., 1998; Magnaghi Jaulin et al.,
1998; Lai et al., 1999; Chen and Wang, 2000). Mutational or functional inactivation
of Rb leads to unrepressed E2F-mediated transcription of genes that contribute to
the malignant phenotype (reviewed in Nevins, 2001). Evidence that Rb acts as a
tumor suppressor gene comes from several Studies. First, re-introducing Rb into Rb-
deficient cells impairs growth characteristics of the malignant phenotype (Huang et
al., 1988). Second, in tumors that lack mutant Rb genes, functional inactivation of
Rb occurs by a different mechanism such as hyperphosphorylation (Sherr, 1996).
Third, transforming DNA viruses have been shown to carry DNA sequences that
encode oncoproteins that bind to and inactivate the Rb protein; these include
adenovirus EIA, SV40 large tumor antigen, and human papillomavirus E7 (DeCaprio
‘ et al., 1988; Dyson et al., 1989).

Retinoblastomas are tumors of retinal cells that contain two mutant copies of

the Rb genes. Knudsen described this phenomenon as a “two-hit” hypothesis

13

(Knudson, 1971). Sporadic cases are the result of two independent mutation events,
one for each allelic copy of the Rb gene, occurring in the same. retinal cell. In familial
cases, the first genetic event is inherited from a parent with a germline mutation of
the Rb gene. The second genetic event occurs spontaneously in cells already
containing a single mutant allelic copy of the Rb gene. Therefore, two mutant copies
of the Rb gene are present in both sporadic and familial cases of retinoblastoma.
However, an important difference between sporadic and familial cases is that familial
cases are nearly always associated with bilateral retinoblastomas and those patients
that do survive this childhood tumor have a much higher risk of developing other
types of cancers later in life, especially bone and soft tissue sarcomas, and
malignant melanomas (reviewed in Nevins, 2001).

. Another example of a tumor suppressor gene is the p53 gene, which is a key
guardian against propagation of cells containing genetic damage. p53 acts as a
~ transcription factor and induces expression of genes involved in cell cycle arrest
(Hicks et al., 1991; Livingstone et al., 1992), apoptosis (Yonish Rouach et al., 1991;
Shaw et al., 1992; el Deiry et al., 1994), and DNA repair (Marx, 1994). Both allelic
copies of the ‘p53 gene contain inactivating mutations in approximately 50% of all
human tumors (Baker et al., 1989; Nigro et al., 1989; Hollstein et al., 1991). The p53
protein is normally expressed at a low level and has a short half-life but its protein
level accumulates rapidly when DNA damage is detected (Jenkins et al., 1985;
Williams and Wynford Thomas, 1989). DNA damage-induced accumulation of p53
occurs as a result of inactivation of murine double minute 2 (mdm2), a protein that
targets p53 for ubiquitin-dependent degradation (Honda et al., 1997; Momand et al.,
2000). Accumulation of p53 leads to up-regulation of p21WAF1 (Li et al., 1994;

Shiohara et al., 1994; Steinman et al., 1994; Candeias et al., 1997; Wilson et al.,

14

.1998), a protein that inhibits cyclin dependent kinase 2 (Chen et al., 1996; Lin et al.,
1996) and cell division cycle 2 (Azzam et al., 1997). The result of such inhibition is .
cell cycle arrest. Depending on the extent of DNA damage, p53 may induce G1
arrest to allow DNA repair processes to take place or apoptosis to prevent
(propagation of cells with extensive damage (Hainaut and Hollstein, 2000). Thus,
p53 is critical for maintaining genomic stability. Accumulation of p53 is also induced
by other cellular signals such as critical shortening of telomeres, increased activation
of oncogenes, and aberrant overexpression of tumor suppressor genes (Hainaut and
Hollstein, 2000). Individuals that have the Li-Fraumeni syndrome inherit a mutant
allelic copy of the p53 gene (Srivastava et al., 1990; Santibanez Koref et al., 1991;
Toguchida et al., 1992). Consequently, they have a much higher predisposition of
acquiring various types of. cancers because the first “hit” is present in all somatic
cells. A second “hit” occurring in the remaining normal allelic copy of the p53 gene
results in loss of heterozygosity and complete loss of p53 function. The role of p53
as a tumor suppressor gene is further supported by the finding that overexpression
.. of Mdm2 has oncogenic potential in human tumors (Momand et al., 1992; Oliner et

aL,1992)

c. Genes regulating apoptosis pathways

Apoptosis, also known as programmed cell death, is a highly regulated
process of cell death, which includes shrinkage of cells, nuclear condensation,
degradation of nucleic acids and proteins, loss of membrane integrity, and cellular
fragmentation (Cotran et al., 1999). The net activity of anti-apoptosis and pro-

apoptosis pathways determines the fate of the cell confronted with extensive DNA

15

damage or unfavorable growth conditions. Disruption of this balance occurs, for
example, if the genes involved in these pathways have mutational defects.

In B-cell lymphomas, up-regulation of the B-pell lymphoma 2 (BCL-2) gene
occurs upon translocation of the gene to the 14q32 chromosome region, i.e., the
same region involved in Burkitt’s lymphoma (Cleary et al., 1986; Tsujimoto and
Croce, 1986). Bel-2 induces anti-apoptosis pathways by forming homodimers that
. displace bax proteins from the mitochondrial membrane (Oltvai et al., 1993; Yin et
al., 1994). Bax, as a homodimer, is a channel-fanning protein in the mitochondrial
membrane that allows cytochrome C to be released into the cytoplasm (Manon et
al., 1997; Jurgensmeier et al., 1998; Rosse et al., 1998). In turn, cytochrome C
activates caspase-9, a protease that degrades cellular proteins as part of the
apoptosis process (Li et al., 1997b). Up—regulating BAX gene expression is one
mechanism by which p53 induces apoptosis (Miyashita et al., 1994; Selvakumaran
et al., 1994; Zhan et al., 1994); Cells that overexpress bcl-2 are resistant to
apoptosis. signals even though there may be significant DNA damage present such
as that caused by irradiation and chemotherapy. Although these BcI-2-expressing
cells are non-tumorigenic, they are more likely than normal cells to accumulate
additional genetic changes that contribute to its malignant transformation. This is an
example of a net gain in activity of anti-apoptosis pathways. Conversely, a net loss
in activity of pro-apoptosis pathways may contribute to the malignant transformation
process, e.g., a loss of bax activity (Hara et al., 1997; Krajewski et al., 1997; Colella
et al., 1998; Gil et al., 1999).

Phosphoinositide 3-kinase (Pl3K) is another gene that induces cell survival
pathways (Kauffmann Zeh. et al., 1997; Khwaja et al., 1997). Many receptor and

soluble tyrosine kinases activate Pl3K, which has both protein and lipid kinase

16

activity (reviewed in Vanhaesebroeck and Waterfield, 1999). PI3K phosphorylates
inositol lipids at the third position in the inositol ring and generates active second
messengers such - as phosphatidylinositol (3,4)-bisphosphate and
phosphatidylinositol (3,4,5)-bisphosphate (PIP3). These lipid products are involved
in regulating signaling pathways that carry out the cellular functions of PI3K,
including cell growth/survival, intracellular trafficking, and cellular motility
(Vanhaesebroeck and Waterfield, 1999). Induction of cell survival is mainly through
PI3K-mediated phosphorylation and activation of Akt (Franke et al., 1995; Datta et
al., 1996; Kulik et al., 1997). Akt phosphorylates and inactivates Bad, which is a
Bax-like protein that induces apoptosis signals (Datta et al., 1997). Thus, cells that
have constitutively activated Pl3K pathways are resistant to apoptosis. The role of
PI3K in the malignant transformation of cells has been reported. Constitutively
active PI3K mutants have beenfound in viral-induced (Aoki et al., 2000) and
radiation-induced (Jimenez et al., 1998) tumors, and amplification and
overexpression of PI3K have been found in ovarian (Shayesteh et al., 1999) and
cervicalicancers (Ma et al., 2000). Furthermore, the phosphatase and ;e_psin
homologue detected on chromosome 10 (PTEN) protein (Li et al., 1997a) is a lipid
phosphatase that removes. a phosphate on the active lipid product, PIP3, and acts
as a negative regulator of Pl3K function (Stambolic et al., 1998). Germline
mutations of PTEN are associated with Cowden’s disease. Individuals with this
disease present with :hamartomas and have an increased risk of developing breast
cancers (Liaw et al., 1997). Mutation of the PTEN gene is frequently found in human
tumors, especially in glioblastomas and cancers of the prostate, endometrium, and

ovary (reviewed in Simpson-and Parsons, 2001).

17

d. Genes regulating (DNA repair pathways

DNA repair genes are essential for maintaining DNA sequence integrity
(Lindahl, 1994; lshikawa et al., 2001). 'DNA damage can result from exposure to
environmental agents as well as from spontaneous errors during DNA replication.
Such damage, if not repaired properly, could result in genetic defects that contribute
to the malignant transformation of cells. Individuals with defective DNA repair genes
have a strong predisposition “of acquiring various types of cancers because the cells
accumulate mutations at a much higher frequency compared with normal, repair-
proficient cells (Lindahl, 1994). Two examples of defective DNA repair genes and
their role in humancancers are discussed.

Defects in DNA mismatch repair genes are responsible for the most common
form of hereditary colon cancer, i.e., hereditary nonpolyposis colon cancer (Fishel et
al., 1993; Aaltonen et al., 1994; Bronner et al., 1994; Jiricny, 1994; Liu et al., 1994;
Peltomaki, 1994). DNA regions containing short tandem repeat sequences are
especially prone to frameshift mutations because of misalignment of repeats in the
template and the newly‘ synthesized strand'during replication (Kim et al., 1994;
Aquilina and Bignami, 2001). Loss: of mismatch repair genes human MutL
homologue 1 and MutS homologue 2 accounts for approximately 50% and 40%,
respectively, of cases of hereditary nonpolyposis colon cancer (reviewed in
Peltomaki, 2001). Individuals with gennline mutations in one of those genes have
increased susceptibility to colon cancer because, as described above, a somatic
mutation or mitotic recombination event in the remaining normal allelic copy can

eliminate the function of the gene,'which results in profound defects in DNA

18

mismatch repair. Such cells are characterized with progressive. accumulation of
mutations throughout the genome (Peltomaki, 2001 ).

Defects in genes involved in nucleotide excision repair (NER) are responsible
for the autosomal recessive disorder gerodenna pigmentosum (XP) (Cleaver, 1990).
Individuals withsuch defects. are extremely susceptible to UV-induced skin cancers
(Robbins et al., 1974). XP patients usually die from highly invasive and metastatic
squamous and basal cell carcinomas, and malignant melanomas (Hashem et al.,
1980; Cleaver et al., 1981). NER-deficient XP patients fall into seven
complementation groups, XPA through XPG (reviewed in Bemeburg and Lehmann,
2001). The genes encode proteins involved in NER, including damage-recognition
proteins, helicases, and nucleases (Bemeburg and Lehmann, 2001). This lack of
repair accounts for the high frequency of sunlight-induced mutation in the cells of XP
patients. In addition to these NER-deficient XP patients, there is one group of
patients, designated as XP variants, whose-cells are completely proficient in NER
(T ung et al., 1996). Nevertheless, the patients are extremely prone to sunlight-
induced skin cancer (Cleaver et al., 1981), and the cells exhibit a frequency of
sunlight-induced mutations as high as other XP patients. The XP variant gene
encodes DNA polymerase eta, which .is capable of error-free DNA synthesis past
UV-induced thymidine dimers (Masutani et al., 1999). Cells with defects in NER or
DNA pol eta display genomic instability, a phenomenon that is known to accelerate
the malignant transformation process (Maher et al.,‘ 1982; Patton et al., 1984;

Tsujimura et al., 1990; Daya Grosjean et al., 1993).

19

e. Telomeres and telomerases

Telomeres are DNA sequences and protein complexes at the ends of
chromosomes: (Blackburn, 1991).- Telomeres shorten with every replication cycle
because the ends. of chromosomes lack sequences preceding it for primed-DNA
synthesis by DNA polymerase a and 6, a phenomenon described as the “end-
replication problem (Levy et al., 1992).” This is an intrinsic mechanism of finite life-
span cells to mark the number of cell divisions. After a finite number of cell divisions,
normal cells undergo a process termed cellular senescence (Hayfiick and Moorhead,
1961) because the telomeres have shortened to a critical length (Preston, 1997;
Scherf and Mattel, 1992; Shayand‘Wright, 2001). . Major chromosomal abnormalities
such as end-to-end chromosome fusions signal the induction of cellular senescence
(Hastie and Allshire, 1989; Ducray et al., 1999). Cells with finite life-span are less
likely to accumulate all the necessary. genetic alterations required to display the
malignant phenotype (Hanahan and Weinberg, 2000).

Telomerase is- a ribonucleoprotein complex, consisting of an RNA template
(Shippen Lentz and Blackburn, .1990) and a catalytic subunit designated as
tplomerase _reverse transcriptase (TERT) (Strahl and Blackburn, 1996; Cech et al.,
1997; Lingner et al., .1997) as the core components. TERT catalyzes addition of
telomeres by reverse transcription synthesis of hexameric TTAGGG repeats using
an RNA template (Meyne et al., 1989; Morin, 1989)." This prevents loss of DNA
sequences that occurs with every DNA synthesis cycle. As expected, expression of
TERT in normal human cells induces telomere elongation and stabilization, and such
cells acquire the phenotype of cellular immortalization (Counter et al., 1994;

Meyerson, 1998). Normal, finite-life span cells do not express telomerase at a high

20

level. In contrast, it has been estimated that 90% of human tumors have up-
regulated telomerase, and that the remaining tumors have activated. other
mechanisms to acquire an extended or an infinite life-span (Ducray et al., 1999;
Klingelhutz, 1999; Hahn and Meyerson, 2001; Kang and Park, 2001).

Some have described the acquisition of an extended or infinite life-span as a
prerequisite or an early step in the multistep process of carcinogenesis (reviewed in
Hanahah and Weinberg, 2000). It is now established that multiple genetic changes
are required for cellular immortalization (Kuroki and Huh, 1993; McCormick and
Maher, 1994). Cells that were infected with the SV40 virus or expressed SV40 T-
antigen displayed extended life-span but eventually senesced after 20-30 doublings
beyond the normal life-span (Wright and Shay, 1992). Within this population, a small
number of cells acquired additional genetic _change(s) that conferred cells with
cellular immortalization but this occurred at a very low frequency. Shay and Wright
estimated this frequency at one in every 30x106 human lung fibroblasts transfected
with the SV40 T-antigen (Shay and Wright, 1989). Human cells can be immortalized
by repeated treatment with carcinogens (e.g., y-irradiation) or by expression of
certain viral or cellular oncogenes (e.g.,.v-Myc) (McCormick and Maher, 1988; Shay
et al., 1991; Bai et al., 1993; Kuroki and Huh, 1993). Hybridization of finite life-span
cells and immortalized cells produces hybrid cells that display finite life-span,
indicating that cellular immortalization is ultimately caused by recessive gene defects
(Pereira Smith and Smith, 1981; Pereira Smith and Smith, 1983; Ryan et al., 1994).
The disrupted function 'of p53iand-Rb proteins is thought to play a causal role in

cellular immortalization of certain cell types (Shay et al., 1991; Vojta ‘and Barrett,

21

1995), and the involvementof telomerase has been noted above (Shay and Wright,

.2001)

3. Multistep process of carcinogenesis

The focus so far has been on categories of genes that play a causal role in
the malignant transformation process. It is important to emphasize that the normal
function of these genes is required for various normal cellular functions. The
aberrant function of these genes, however, may. confer cells with defects that are
selected for in the multistep process of carcinogenesis (Hanahan and Weinberg,
2000). The evolution of anormal cell to a malignant cell is a time-dependent
process because multiple genetic alterations must accumulate in the same cell, i.e.,
cancer cells are typically-monoclonal in origin (Hanahan and Weinberg, 2000). This
is consistent with the observation that most human cancers occur with an age-
associated incidence. Renan (1993) estimated that 4-7 genetic changes are
necessary to transform a normal cell to that of a. malignant cell. At each intermediate
“step” the cell acquires an additional growth characteristic that gives the cell more
cancer-like properties. Many genes, when functioning aberrantly, have the potential
to contribute to the malignant transformation of cells. Although there may be near-
infinite permutations of these affected genes in human cancers, there is. a relatively
limited set of acquired characteristics present in most cancer cells (Hanahan and
Weinberg, 2000). In a review, Hanahan and Weinberg (2000) describe six of these
characteristics: self-sufficiency in. growth signals, insensitivity to growth-inhibitory
signals, evasion of programmed cell death, limitless replicative potential, sustained

angiogenesis, and tissue invasion and metastasis.

22

The first model to consider carcinogenesis as a multistep process. came from
studies that repeatedly treated mouse skin with chemical agents (Boutwell, 1964;
Hennings et al., 1990; Yuspa, 1994a). As a result of these studies, carcinogenesis
was described as a process that occurred in three broadly defined stages: initiation,
promotion, and progression. Initiation occurs by a single treatment with a mutagen,
such as 7,12-dimethylbenz[a]anthracene (Hennings et al., 1990). Some of the
progeny cells display phenotypic changes consistent with heritable genetic defects.
An oncogenic mutation of the H-RAS gene is frequently found in such cells
(Quintanilla et al.,‘1986; Bailleul et al., 1989; Nelson et al., 1992). However, the
mutation spectrum is dependent on the specific target of the active metabolite of the
mutagen. Promotion occurs by repeated stimulation of initiated mouse skin cells,
for example, by wound infliction or 12-O-tetracecanoyphorboI-13-acetate treatment
(Hennings et al., 1990). Papillomas typically appear over a few months, and about
50% of these transform tosquamous cell carcinomas in about a year. Each
papilloma is a clone of initiated cells that acquired an additional genetic event
(Deamant and lannaccone, 1987). The genetic event is thought to occur by
epigenetic mechanisms "because a single gene change is sufficient to produce
papillomas .(Greenhalgh et al., 1993) and tumor-promoting agents are typically not
mutagens (Yuspa and Poirier, 1988). Progression occurs by spontaneous genetic
events but can be accelerated by treatment with mutagens such as cisplatin
(Hennings et al., 1990). Chromosomal aberrations occur frequently in the malignant
transformation of papillomas to carcinomas (Y uspa, 1994a). Other studies show that
loss of heterozygosity of the H-RAS (Yuspa et al.,-1990), p53 (Boukamp et al., 1995;

Dumaz et al., 1997), and transforming growth factor [3 genes (Bailleul et al., 1989;

23

Haddow et al., 1991) is also associated with malignant transformation. These
studies demonstrate that carcinogenesis is multistep process, involving progressive
accumulation of genetic defects that confer cells with more cancer-like properties.

In human cell carcinogenesis, Vogelstein et al. ((1988) and Fearon and
Vogelstein, 1990) proposed a genetic model of colorectal carcinogenesis. The
transformation of normal colorectal epithelial cells to colorectal carcinomas occurs in
well-defined steps. At each intermediate step there is a molecular change that
corresponds to a morphological change that promotes progression toward
malignancy. Several genes that are involved in the process have been identified,
e.g., loss of adenomatous polyposis coli, loss of global DNA methylation, oncogenic
mutation of the RAS gene, and loss of tumor suppressor genes (e.g., p53) (Williams
et al., 1993; reviewed in Baba, 1997). The successful characterization of colorectal
carcinogenesis can be attributed to the fact that colorectal adenomas, the benign
tumors that precede colorectal carcinomas, are more, readily monitored in situ
compared with other types of tumors. Individuals with familial adenomatous
polyposis inherit a mutated APC in their germline and present with thousands of
polyps at various stages of colorectal carcinogenesis (Kinzler et al., 1991).
Examination of samples from these patients greatly facilitated identification of
genetic and morphological changes at each intermediate stage. The pre-malignant
states in most of the other types of common: human cancers, e.g., lung, breast, and
prostate carcinomas, are not as physically accessible or morphologically discrete.
With the development of better detection and isolation strategies, the identification of
genetic abnormalities responsible for other human cancers will become more

feasible.

24

An ideal model for human carcinogenesis of a specific tumor type would
consist of isogenic cell strains for each of the intermediate, pre-malignant states.
However, most commonly, only the cancer cells from an individual are available.
Normal cells of the same cell type, if available, are usually from a different individual,
which introduces an added complication when determining whether the source of
genetic alterations is due to the carcinogenesis process or due to genetic differences
among individuals. The “multistep” part of the carcinogenesis process cannot be
studied because the cells containing the genetic defect at each intermediate stage
are not available. McCormick and colleagues established the human fibroblast
MSU1 cell lineage as a model for carcinogenesis to address some of these
limitations (Morgan et al., 1991).

The human fibroblast MSU1 cell lineage has been a valuable resource for the
characterization of phenotypic and genotypic changes that occur at different stages
of the carcinogenesis process (Figure ‘1). As described in the paper published by
McCormick and colleagues (Morgan et al., 1991), the v-MYC oncogene was
transfected in a normal human fibroblast cell line, LG1, established from the foreskin
tissue of a male newborn. The vector containing the v-MYC oncogene also carried a
neomycin resistance marker, which allowed for selection of cells that stably
integrated the DNA into the genome. Clonally-derived cells that were neomycin
resistant and expressing v-myc were isolated and propagated. All of the cell strains
entered senescent crisis. However, in one flask, some viable cells were found
among nondividing, senescent cells. These viable cells were maintained in cell
culture and designated as MSU-1.0. After further characterization, it was determined
that these cells display infinite life-span. More recently, increased telomerase

activity has been detected in these cells compared with that in the parental cell line

25

LG1 or the v-myc-expressing precursor cells (Morgan et al., 1991).. Since
immortalizedcells arose in only one flask of cells transfected with the v-MYC
oncogene, this indicates that oncogenic v-MYC expression is not sufficient by itself
to induce cellular immortalization. An additional genetic event, e.g., spontaneous
activation of telomerase, is probably the change that allowed these'cells to escape
senescence. The immortalized MSU-1.0 cell strain does not display other
characteristics that are typical of tumorigenic cell strains, such as growth factor
independence and anchorage independence. Furthermore, subcutaneous injection
of MSU-1.0 cells into athymic mice has never produced tumors, and karyotype
analysis shows that MSU-1.0 cells do not contain any gross chromosomal
aberrations. Attempts to malignantly transform this cell strain by treatment with

carcinogens or expression of oncogeneshave been repeatedly unsuccessful.

During the establishment of the MSU-1.0 cell strain a variant clonal derivative
arose spontaneously in cell culture. This variant cell strain, designated as MSU-1.1,
has a more rapid rate of cellular proliferation compared with that of the MSU-1.0 cell
strain (Morgan et al., 1991). Studies show that MSU-1.1 cells display partial growth
factor independence but does not display anchorage independence or form tumors
in athymic mice. Interestingly, karyotype analysis shows that MSU-1.1‘cells have
two marker chromosomes that are products of translocation events as described
(Morgan et al., 1991). It seems highly likely that one or more of these chromosomal
aberrations, and perhaps: other genetic events, represent the additional steps
necessary to convert MSU-1.0 cells toward more advanced states of cellular
transformation. Consistent .with this finding is that, in contrast to MSU-1.0 cells,

MSU-1.1 cells are more readily transformed to tumorigenic cell lines by treatment

26

of MSU-1.1 cells with carcinogens (Yang et al., 1992; O'Reilly et al., 1998) or
- expression of oncogenes in MSU-1.1 cells (Fry et al., 1986; Hurlin et al., 1989; Lin et
al., 1995).” Figure 2 shows that two tumor-derived, fibrosarcoma cell lines
transformed by y—irradiation are capable of forming large colonies in soft agar, a
growth property characteristic of tumorigenic cells. Establishment of tumor-derived,
fibrosarcoma cell lines involves isolation of MSU-1.1 cells that formed foci after
carcinogen treatment or oncogene transfection, followed by injection of these cells
into athymic mice. These findings demonstrate that immortalization is not sufficient
for the malignant transformation of cells. However, cells that acquire additional
genetic changes, such as that which occurred in MSU-1.1 cells, may have increased
potential for progression‘towards malignancy. Taken together, the MSU1 cell
lineage, consisting of LG1 -) MSU-1.0 -) MSU-1.1 -) tumorigenic derivatives,
serves as an excellent model for the multistep process of carcinogenesis.

The advantages of using the MSU1 cell lineage as a model for studying
carcinogenesis of human cells are summarized here (McCormick and Maher, 1994
and 1996). First, cell strains in thislineage are isogenic, i.e., they are sequentially
derived from the original normal human fibroblast cell line, LG1. Direct comparisons
can be made between LG1 and malignant derivatives to investigate genes that are
involved in the malignant transformation of cells. Second, the availability of two pre-
malignant cell strains, MSU-1.0 and MSU-1.1, allows one to address interesting
questions. These include: 1) what genetic change(s) are involved in the acquisition
of the immortalized phenotype (compare LG1 vs. MSU-1.0), 2) what additional
genetic event(s) are necessary to convert immortalized cells to clonally—derived cell

strains that display increased potential towards malignant transformation by

27

treatment with carcinogens or expression of oncogenes (compare MSU-1.0 vs.
MSU-1.1), 3) what is the transforming potential of a carcinogenic agent or a putative
oncogene (test in MSU-1.1)? Third, many tumorigenic derivatives of MSU-1.1
cells have been generated by various strategies, and the gene changes involved in
their malignanttransfonnation can be further characterized as either oncogenes
(gain of function) or tumor suppressor genes (loss of function). Overexpression of
putative tumor suppressor genes in these tumorigenic derivatives may also shed
light on the proposed function of these genes. The relative importance of certain
genetic defects in the carcinogenesis process can be determined by comparing
among large panels of tumorigenic cell lines that have been generated in this
laboratory. Finally, a major overall advantage of the MSU1 cell lineage is the
potential to characterize various phenotypic and genotypic changes that occur
during the malignant transformation of human fibroblasts. Such knowledge may
provide not only valuable insight into the multistep process of carcinogenesis but
also useful phenotypic and genotypic markers for detection of pre-malignant states.
As seen with colorectal carcinogenesis, early detection is key for medical and
surgical prevention of progression of precursor lesions to highly invasive and

metastatic carcinomas.

28

Figure 1: Cell strains/lines of the human fibroblast MSU1 cell lineage. LG1 is a
normal human fibroblast cell line established from the foreskin of a male newborn.
After v-MYC oncogene transfection of LG1 cells, all of the clonal-derivative cell
strains senesced but some viable cells were found in one flask (Morgan et al., 1991).
These cells were isolated and designated as MSU-1.0. The MSU-1.0 cells display
infinite life-span and have activated telomerase. A spontaneous variant, designated
as MSU-1.1, arose in cell culture and grew faster than MSU-1.0 cells. These cells
have two marker chromosomes resulting from translocation events and display
partial growth-factor independence (Morgan et al., 1991). MSU-1.0 and MSU-1.1 do
not form tumors when the cells are injected subcutaneously into athymic mice.
Malignant derivatives of MSU-1.1 are generated by treatment of MSU-1.1 cells
with a carcinogen (e.g., y-irradiation, BPDE) or expression of an oncogene in MSU-
1.1~ cells (e.g., H-RAS), followed by isolation of morphologically transformed cells
and injection of these cells into athymic mice. The tumor-derived cells are
established in cell cultureto generate fibrosarcoma cell lines, e.g., L210-6A/SB1,
MW17.2.4ISB1, and PH3MT. The additional genetic event(s) present in MSU-1.1
cells makes these cells more susceptible to carcinogen- and oncogene-induced
transformation because attempts to transform MSU-1.0 cells by these same agents
have been unsuccessful. As cell strains/lines of the MSU1 cell lineage become
malignantly transformed, the cells acquire additional growth properties that are
characteristic of cancer cells, including: ILS, infinite life-span; GFI, growth factor
independence; FF, focus formation; AI, anchorage independence; Tu, formation of

tumor in athymic mice.

29

 

 

 

 

 

 

 

 

 

 

 

 

 

_IIIHI l I I 3...

_ + I I I _<
+ I I I "....
+ + I I me
+ V . + II .. ME

..meNKESE A.II

c2569?»

hEmIn— III—....-DwEAI al.—.DwEIAII e0.—

mmmi 6 $862.22 PASS

 

..mmZo I.
Noam

_. 2:9".

30

Figure 2: Anchorage independence status of cell strains/lines of the MSU1 cell
lineage. Growth in semi-solid, agarose medium is characteristic of tumorigenic
cells. Cell strains/lines of the MSU1 cell lineage were assayed for their ability to
grow in such medium. As expected, the normal humanfibroblast cell line, LG1, and
its two pre-malignant, non-tumorigenic derivative cell strains, MSU-1.0 and MSU-1.1,
did not form large colonies in medium supplemented with 2% or 10% fetal calf
serum. In contrast, two MSU-1.1-derived, fibrosarcoma cell lines, MW7.2D1 and
MW7.3A2, transformed by y-irradiation (O'Reilly et al., 1998), formed large colonies

in medium supplemented with low or high serum concentration.

31

Figure 2

LG1

MSU-1.0

MSU-1.1

MW7.2D1

MW7.3A2

10% FCS

 

2% FCS

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

32

 

 

B. RAS superfamily of small guanine-nucleotide binding proteins

1. Res GTPases and their cellular functions

Ras is the prototype in the Ras superfamily of small G-proteins (Barbacid,
1987). Members of this superfamily are assigned into one of six subfamilies based
on biochemical and structural characteristics. The six subfamilies include: Ras, Rho,
Rab, Ran, Rad, and Arf (Valencia et al., 1991). G-proteins are guanine-nucleotide
binding proteins. Unlike classic or heterotrimeric G-proteins, however, small G-
proteins lack the regulatory B and y subunits and consist of only the catalytic or
subunit (Grand and Owen, 1991). All G-proteins have the intrinsic capacity to bind
guanine nucleotides and hydrolyze GTP. This latter activity, i.e., the GTPase
activity, is required for cycling between an active, GTP-bound state (ON) and an
inactive, GDP-bound state (OFF). The capacity to cycle between these two states
enables these proteins to function as molecular switches in the pathways they
regulate. In the GTP-bound state, these proteins assume an active conformation
that allows for subsequent binding and activation of various effectors. These
effector-mediated pathways are essential for the cellular functions of G-proteins. At
. the cellular level, the more relevant determination of a G-protein activity is the ratio
of GTP-bound to GDP-bound proteins, and not simply the absolute level of these
guanine-nucleotide bound forms (Grand and Owen, 1991).

The Ras subfamily includes Ras, Rap, R-Ras, Ral, Rheb, and M-Ras (Bos,
1997), but only the Ras isoforrns will be discussed here because of their importance
in carcinogenesis. There are three RAS genes: H-RAS, K-RAS, and N-RAS. All Ras

isoforrns display a ubiquitous pattern of expression. Two families of regulatory

33

proteins regulate Ras activity, guanine-nucleotide exchange factors (GEFs) and
GTPase activating proteins (GAPs) (reviewed in Takai et al., 2001). Ras proteins
transduce signals from cell surface receptors to pathways that activate transcription
of genes involved in regulating cellular growth and differentiation (Barbacid, 1987;
Lowy and Willumsen, 1993). Various stimuli activate these receptors, including
growth factors, cytokines, and hormones. Distinct roles are emerging for specific
Ras isofonns. For example, mouse embryos deficient in K-Ras die in utero
(Johnson et al., 1997; Koera et al., 1997), whereas mouse embryos deficient in N-
Ras or H-Ras develop into phenotypically normal mice (Umanoff et al., 1995).
Others have reported biochemical differences among Ras isofonns such as their
capacity to activate Raf, a. kinase in the Raf/MEK/ERK pathway (Yan et al., 1998;
Voice et al., 1999; Walsh and Bar Sagi, 2001). Nevertheless, all RAS genes have
been shown to play a causal role in the malignant transformation of human cells

(Bos et al.. 1987 and 1988).

2. Multiple pathways regulated by RAS genes

Active, GTP-bound Ras binds to and activates effector proteins through its
effector-binding domain-some flanking residues, and switch II region (reviewed in
» Vojtek and Der, 1998). Three major Ras pathways have been described, these
include the Raf/MEK/ERK pathway, the PI3K pathway, and the RaI-GDS/Ral

GTPase pathway (Figure 3). Each of these will be discussed.

a. . Raisaf/MEK/ERK pathway

The gxtracellular-signal regulated _Iginase (ERK) pathway is the prototype of

the MAPK pathways (Robinson and Cobb, 1997). Briefly, when a ligand such as the

34

platelet-derived growth factor binds to its cell surface receptor, platelet-derived
growth factor receptor, there is a protein conformational change that is transmitted to
the intracellular domain of the receptor. As a result of this activation, the intracellular
domain undergoes autophosphorylation at specific tyrosine residues. Proteins
containing Src homology region-2 domains, which are involved in phospho-tyrosine
recognition, then bind to the intracellular domain of the activated platelet-derived
growth factor receptor. Grb2 is one such Src homology region-2-containing adaptor
protein that fulfills this role for the ERK pathway. Activated Grb2 binds to sons of
sevenless protein, which functions as a GEF specific for Ras (Chardin et al., 1993).
S08 activates Ras by binding to Res and reducing its affinity for GDP, thereby
facilitating GDP- release. Subsequent loading of GTP results in active, GTP-bound
Ras, which then activates a signaling cascade that consists of Raf (MAPKKK level)
-) MEK1 and MEK2 (MAPKK level) -) ERK1 and ERK2 (MAPK level). The
mechanism(s) responsible for Ras activation of Raf is not well understood but
recruitment of Raf to the membrane is thought to be a major mechanism (Leevers et
al., 1994). Activated Raf then activates MEK by phosphorylating specific serine
residues on MEK. Activated MEK is a dual-specificity kinase that increases the
kinase activity of ERK by phosphorylating key threonine and tyrosine residues
(Robinson and Cobb, 1997). At the MAPK level, activated ERK1 and ERK2 then
phosphorylate and activate cytoplasmic (e.g., SOS, MEK, Rsk) and nuclear (e.g.,
- Elk-1, Ets-2, CIEBP, SMADS) targets that carry out the cellular functions of Ras
(reviewed in Crespo and Leon, 2000). Some of these targets are transcription
factors that up-regulate cyclins. Cyclin D1 is one such cyclin that is up-regulated by
the Ras pathway, and one of its activity is to bind to and activate cyclin-dependent

kinase 4/6 complex (Filmus et al., 1994; Arber et al., 1996; Amanatullah et al., 2001).

35

This activated complex then hyperphosphorylates Rb, thereby producing the inactive
form of Rb, which has decreased binding affinity to the E2F family of transcription
factors (Weinberg, 1995; Brehm et al., 1998). Release of E2F from Rb-E2F
complexes promotes E2F-mediated up-regulation of genes involved in cell cycle

progression.

b. PI3K-activated pathways

Active, GTP-bound Ras also activates phosphatidylinositol-3-kinase (PI3K)
(Kodaki et al., 1994; Rodriguez Viciana et al., 1994), a kinase that is active on both
lipid and protein targets. PI3K is composed of a regulatory p85 subunit and a
catalytic p110 subunit. Certain isoforms of the catalytic subunit, i.e., p110a and
p1108, bind to Ras-GTP through the-effector domain of Ras proteins. There is
evidence to support that this binding results 'in in vivo activation of PI3K and that
PI3K mediates some of the transforming potential of oncogenic RAS (Rodriguez
Viciana et al., 1994 and 1996; Fruman et al., 1998). Other upstream signals, such
as receptor tyrosine kinases, soluble tyrosine kinases, and G-protein coupled
receptors, activate Pl3K independent of Ras (reviewed in Fruman et al., 1998). The
lipid kinase activity of PI3K phosphorylates phosphoinositides into active second
messengers, such as phosphatidylinositol (3,4,5)-triphosphate (PIP3). These active
lipid products bind to the Pleckstrin homology (PH) domain present in Rho-specific
GEFs and increase their activity by facilitating membrane localization and relieving
the autoinhibitory effects of the PH domain (reviewed in Martin, 1998; Nimnual et al.,
1998). As will be discussed below, this is one of the major mechanisms by which
Ras acts as an upstream activator of Rho GTPases. The protein kinase activity of

PI3K phosphorylates Akt (also known as protein kinase B), p70 ribosomal protein

36

S6, le kinase, and other proteins (T oker and Cantley, 1997; Downward, 1998).
Collectively, these PI3K targets regulate pathways involved in cell survival, glucose
metabolism, mitogenesis, and cell motility. The best characterized of the PI3K .
pathways is the PI3K/Akt/BAD survival pathway. As noted above, PI3K is known to

play a role in the malignant transformation of cells.

c. Ral-GDS/Ral GTPase/RIP1 pathway

Finally, active, GTP-bound Ras binds to and activates Ral-GDP dissociation
stimulator (Ral-GDS), which acts as a GEF specific for Ral GTPases. Other Ral-
GDS-like. proteins such as Rgl, Rgl2, le, are similarly activated by Ras (Hofer et al.,
1994; Kikuchi et al., 1994; Wolthuis et al., 1996). Thus, Ras activates Ral in
response to various stimuli, and studies have shown that Ral mediates some of the
biological effects of Ras in mouse NIH3T3 fibroblasts (Downward, 1998; Toker and
Cantley, 1997). Expression of dominant-negative Ral mutant in these cells partially
impaired Ras-transfonned characteristics. Ral GTPases, RalA and RaIB, belong to
the Ras subfamily, and regulate vesicle trafficking, cytoskeletal organization, and
gene expression (Takai et al., 2001). . Active, GTP-bound Ral activates
phospholipase D and Ral-interacting protein 1 (RIP1). The latter is a GAP protein
specific for Cdc42 and Rac1 GTPaSes, two members of the Rho subfamily (Cantor
et al., 1995; Park and Weinberg, 1995). In this case, Ras inhibits activity of Cdc42
and Rac1 because the mechanism of regulation involves a GAP, a protein that

stimulates intrinsic GTP hydrolysis rate of G-proteins.

37

”Figure 3: Multiple Ras effector-mediated pathways lead to transcriptional
activation of genes. There at least three major effector proteins activated by GTP-
bound Ras: Raf, phosphatidylinositol 3-kinase (PI3K), and Ral-guanine nucleotide
dissociation stimulator (Ral-GDS) (Vojtek and Der, 1998). The signaling cascades
regulated by these effectors lead to transcriptional activation of genes. The
connection between the Ras pathways andthe Rho GTPases, Cdc42 and Rac1,
occurs by several mechanisms but the two major mechanisms are 1) PI3K-mediated
generation of active lipid products that activate guanine nucleotide exchange factors
(GEFS) specific for Cdc42 and Rac1, and 2) Ral-GDS activation of Ral GTPase,
which binds to Ral interacting protein '1'(RIP1), a GTPase-activating protein specific
for Cdc42 and Rac1. Coordinate regulation of Rho GTPases by these two
mechanisms may induce rapid cycling of these proteins between their active and

inactive states, such as that seen with the F28L functional mutants (Lin et al., 1997).

38

ages 84
:ee 9.
a_@fi@@ 69

 

 

3. Contribution of-RAS genes to malignant transformation

The finding that the RAS genes are mutated in approximately 30% of all
human tumors suggests that the Ras pathways must broadly contribute to the
. malignant transformation process (Bos, 1988 and 1989). In certain cancers, such as
colorectal and pancreatic cancers, this frequency is even higher, 50% and 90%,
respectively. Others have suggested that the Ras pathways may be important for
development of most, or perhaps even all-human cancers because the functional
activation of the Ras pathways may occur in the absence of mutations of the RAS
genes themselves (Hanahan and Weinberg, 2000). The pleiotropic effects of

oncogenic RAS at the cellular level underscore their importance in human cancers.

Constitutively active Ras proteins ~ activate. multiple downstream Ras
pathways independent. of ligand-induced activation of upstream receptors such as
receptor tyrosine kinase, soluble tyrosine kinase, and G-protein coupled receptor.
Cells that express such proteins are self-sufficient in their growth signals, i.e.,
they do not need exogenous growth factors to drive cellular growth (Hanahan and
Weinberg, 2000). Constitutive activation of Raf/MEK/ERK pathway is a major
mechanism by which oncogenic RAS induces rapid cellular proliferation (Marais and
Marshall, 1996). The mechanism involves up-regulation of cyclin D1 (Filmus et al.,
1994), which promotes progression of cells through the G1 phase in the cell cycle
(Liu et al., 1995). Cells that pass the G1IS checkpoint are committed to progress
through S phase. Cyclins, which are up-regulated by growth-promoting stimuli at
specific phases of the cell cycle, phosphorylate and activate constitutively expressed

cyclin-dependent kinases (CDKs). The cyclin/CDK complexes, for example, cyclin

40

DICDK4, cyclin DICDK6, and cyclin E/CDK2, phosphorylate and inactive Rb, and
promotes its release from members of the E2F family of transcription factors (Filmus
et al., 1994). Unbound E2F transcription factors then activate transcription of genes

involved in cell cycle progression such as cyclins.

Interestingly, the. maximal level of cyclin D1 expression occurs during the late
stages of G1 even though the activity of the ERK pathway has significantly
diminished (reviewed in Crespo and Leon, 2000). This implies that other
mechanism(s) may also increase cyclin D1 expression. Gille and Downward (1999)
investigated the activation of PI3K as one such a mechanism, and found that PI3K
activity is indeed required for cyclin D1 up-regulation and for S-phase entry of
quiescent NIH3T3 fibroblasts. They further show that this is mostly dependent on
Akt activation and less so on Rac activation. The Ral-GDS-like factor also strongly
activates cyclin D1 transcription and they suggest that this could be through le-
mediated up-regulation of c-fos-expression. These studies indicate that multiple Ras

pathways cooperate to mediate Ras-induced cell cycle progression.

Expression of oncogenic RAS in cells disrupts the balance between survival
and apoptosis pathways, and in certain cellular contexts, this confers cells with
' increased resistance to apoptosis pathways. Such cells are more likely to
accumulate additional genetic changes because the overstimulated. survival
pathways oppose apoptosis signals that may have been induced by DNA damage
(Hanahan and Weinberg, 2000). . Evidence to date implicates a major role of the
Pl3K/AktlBad pathway in .Ras-induced cell survival signals (Toker and Cantley,
1997; Downward, 1998). This pathway promotes phosphorylation and inactivation of

Bad, a protein that promotes apoptosis. Other lines of evidence further support a

41

role of the Pl3K pathway in promoting cell survival. Expression 4 of the RAS
oncogene in epithelial cells prevents anoikis of cellsupon detachment from cell-cell
and cell-ECM contacts, indicating that Ras pathways are involved in opposing
apoptosis signals (Khwaja et al., 1997). Anoikis is a distinct cellular morphology that
occurs in cells undergoing apoptosis. They further show that the oncogenic RAS
inhibition of anoikis is a PI3K-dependent process. PI3K also activates Rho GTPases
by generating active lipid'products such as PIP3 (Vanhaesebroeck and Waterfield,
1999). Active Cdc42 or Rac1 then activates p21-activated kinase, which regulates
survival and. apoptosis pathways (reviewed in Van Aelst and D'Souza Schorey,
1997). Activation of PAK in certain cellular contexts confers cells with increased
> resistance to apoptosis (Jakobi et al., 2001; Schunnann et al., 2000). Expression of
oncogenic RAS in cells transformed by oncogenic MYC abrogates the well-
documented Myc-induced apoptosis of such cells by activating PI3K survival
pathways (Kauffmann Zeh et al., 1997). Thus, Myc and Ras act cooperatively in

cells to promote resistance to apoptosis signals.

Cells that express oncogenic RAS have increased secretion of vascular
endothelial growth factor (VEGF), which plays a major role in inducing
angiogenesis and promoting tumor growth (Rak et al., 1995). Splice variants of
the VEGF gene show tissue-specific expression and different biological and
biochemical activity (reviewed in Clause, 2000). * When secreted, VEGF acts on
endothelial cells to promote vascular permeability and angiogenesis (Senger et al.,
1993).. There are two VEGF receptor tyrosine kinases, VEGFR-1 (Flt-1) and
VEGFR-Z (KDR/FIk-I), although VEGFR-2 appears to mediate most of the biological

effects of VEGF (Robinson and Stringer,-2001). Several mechanisms are known to

42

modulate activity of VEGF and its receptor, including VEGF binding to VEGFR-1 and
sequestering VEGF from activating VEGFR-2 (Robinson and Stringer, 2001),
neurophilin-1 acting as a co-receptor for VEGF to enhance its binding to VEGFR-2
receptor (Soker et al., 1998; Gluzman Poltorak et al., 2000), and heparan sulphate
proteoglycans binding to certain VEGF isoforms and their receptors (Houck et al.,
1992; Tessler et al., 1994;Gengrinovitch et al., 1999) to modulate their biological
activity. However, the specific Ras signaling pathway(s) involved is only beginning
to be understood. In a recent report, Arbiser et al. (1997) show that Ras induces up-
regulation of VEGF through two distinct pathways, the Raf/MEKIERK pathway and
the PI3K pathway. These pathways lead to the activation and/or up-regulation of
hypoxia-inducible factor 1a (HlF-1a), which is a transcription factor for genes
containing the hypoxia responseelement (HRE). in their promoter region, such as
that present in the VEGF gene (Forsythe et al., 1996; Maxwell et al., 1997).
However, various cell types differ in their dependence onthese two pathways, e.g.,
up-regulation of HlF-1a in fibroblasts is dependent on the ERK pathway whereas in

epithelial cells the PI3K pathway is required (Arbiser et al., 1997).

Cancer cells that express oncogenic RAS have enhanced Invasive and
metastatic potential. Invasion is'a process that requires disruption of cell-cell and
cell-ECM interactions and degradation of barriers such as the basement membrane
(Hernandez Alcoceba et al., 2000). Invasion is a prerequisite of metastasis because
the cells must seed the hematologic or lymphatic circulation to reach distant organs
(Cotran et al., 1999). Once cells extravasate from the circulation, they are
immediately challenged with a tissuemicroenvironment different from the primary

tumor site. Successful establishment of metastases occurs if such cells acquire the

43

ability to adapt to competing growth stimulatory and inhibitoryvsignals, hypoxic
growth conditions, and limited tissue space for tumor growth. The systemic effects
of metastases account for the majority of deaths in human cancers (Hernandez

Alcoceba et al., 2000).

Expression of oncogenic RAS in tumor cells promotes their invasion across
multiple barriers and their establishment as metastases by up-regulating genes that
promote adaptation to a foreign tissue microenvironment. VEGF increases vascular
permeability by acting directly on endothelial barriers and stimulating endothelial
proliferation in a disorderly manner (Dvorak et al., 1991; Kondo et al., 1993; Ellis et
al., 2000). Hepatocyte growth: factor and its receptor, Met, signal through Ras
pathways to increase cellular proliferation, motility, and invasiveness (Ridley et al.,
1995; Webb et al., 1998; erka et al., 2000). Moreover, this is a PI3K-dependent
process (Bardelli et al., 1999; Dong et al., 2001). Oncogenic RAS-transformed cells
adapt to limited tissue space by increasing expression of various proteases, such as
uroklnase and its» receptor uPAR (Brunner et al., 1989; Paciucci et al., 1998),
cathepsins (e.g., cathepsin B, C, and L) (Chambers et al., 1992; Zhang and Schultz,
1992; Silberrnan et al., 1997), and matrix metalloproteinases (e.g., MMP-2, MMP-9)
(Giambemardi et al., 1998; Reddy et al., 1999; Liu et al., 2000; Moon et al., 2000).
Down-regulation of tissue inhibitor of metalloproteinases has also been reported
(Chambers and Tuck, 1993). Thus, the widespread dysfunction of Ras in human
tumors is likely to reflect its ability to confer cells with multiple growth characteristics

of the malignant phenotype.

44

C. Cdc42 and Rac1, two members of the Rho subfamily of GTPases

1. Rho GTPases and their cellular functions

In the mid- to late-1980s, there was a major effort to identify proteins that
function in an analogous manner to that of Ras G-proteins (Aspenstrom, 1999).
RhoA (_R_as hpmology) was one such protein isolated and characterized by
biochemical analyses (Hall, 1990 and 1992b). Although RhoA shares 30% amino
acid homology to Ras, this conservation is predominately in domains involved in
guanine nucleotide binding and GTP hydrolysis. This was the first line of evidence
that Rho is a new prototype of a family of Res-related proteins (Hall, 1990 and
1992b). Multiple isoforms of Rho were subsequently: identified (reviewed in
Aspenstrom, 1999). Two new members ‘of the. Rho subfamily that share
approximately 50-60% amino acid homology with Rho and contain a domain unique
to Rho proteins, the Rho insert, were identified and named Cdc42 (pell givision- pycle
42) and Rac (flags-related Q3 botulinum toxin substrate).

Cdc42 was first isolated in studies that characterized temperature-sensitive
budding defects in mutant strains of Saccharomyces cerevisiae. In one such mutant
strain, the budding defect was due to a non-functional, mutant Cdc42 protein
(Adams et al., 1990). 625K was the first Cdc42 isoforrn isolated from tissues of
higher eukaryotes, i.e., from bovine brain and human placenta tissues (Polakis et al.,
1989; Munemitsu et al., 1990). Subsequently, the human homolog of the yeast
Cdc42 was isolated from a human placenta cDNA library using 625K sequences as
the labeled oligonucleotide probe (Shinjo et al., 1990). G25K expression is relatively

limited to brain tissue whereas Cdc42 is more ubiquitous in its expression pattern.

45

Structural divergence between G25K and Cdc42 proteins is present from amino acid
163 to 191, which suggests that these two isoforms are alternative splicing products
of a single gene (Johnson, 1999).

The Rec isoforms, Rac1 and Rac2, were isolated from a differentiated HL-60
cDNA library using a labeled oligonucleotide probe that hybridizes to a highly
conserved region in all Res-related proteins, for example, the FDTAGQEDYD
sequence in human placenta G25K protein (Didsbury et al., 1989). Simultaneously,
another group purified Rac1 from membrane fractions of human platelets using
columns containing beads cross-linked with GTPyS (a non-hydrolyzable GTP
analog) or a-32P-Iabeled GTP (Polakis et al.,-1989). Rac1 is ubiquitously expressed
in tissues whereas Rac2 displays rather hematopoietic-specific tissue expression.

The most established function of the Rho subfamily is their ability to alter
organization of the actin cytoskeleton (Kozma et al., 1995; Ridley and Hall, 1992;
Ridley et al., 1992; Nobes and Hall, 1995; Machesky and Hall, 1997). Through
microinjection and transfection studies in mouse fibroblasts, it has been shown that
Rho induces formation of stress fibers and clustering of focal adhesion complexes,
Cdc42 induces formation of filopodia or microspikes, and Rac induces formation of
lamellipodial extensions and membrane ruffles. The sequential occurrence of these
cytoskeletal structures formed the basis for early speculation that these proteins act
in a hierarchical pathway (Nobes and Hall, 1995). For example, because treatment
of quiescent fibroblasts with growth factors induces formation of filopodial structures,
followed by lamellipodial structures, Cdc42 has been described as an upstream
activator of Rac. Using similar analyses, it was reported that Cdc42 activates Rac,

which then activates Rho. More recent studies report that this hierarchical

46

arrangement, however, does .not apply to the other cellular functions regulated by
the Rho subfamily (reviewed in Van Aelst and D'Souza Schorey, 1997).

Cdc42 and Rac proteins share more structural homology (70% amino acid
homology) with each other than with Rho proteins (SO-60% amino acid homology).
This finding is consistent with the observation that Cdc42 and Rac1 act in parallel in
Several effector-mediated pathways in which a similar role for Rho has not been
found. Because of their similarity in structure and function, the contribution of Cdc42
and Rac1 to the malignant transformation process should be investigated
simultaneously. My research is directed at understanding the role of Cdc42 and
Rac1 in the malignant transformation of human fibroblasts. Therefore, the remainder
of this literature review will cover topics most relevant to this focus.

In addition to their role in actin cytoskeleton reorganization, Cdc42 and Rac1
regulate diverse cellular functions including transcription, cell cycle progression, cell
differentiation, survival and apoptosis pathways, and membrane trafficking (Van
Aelst and D'Souza Schorey, 1997; Takai et al., 2001). Many reports indicate that
these cellular processes are highly dependent on coordinate rearrangement of the
actin cytoskeleton. Defects in regulation of Cdc42 and Rac1 activity are implicated
in human diseases, for example, in developmental (e.g., Aarskog-Scott Syndrome)
and immunological disorders (e.g., Wiskott-Aldrich Syndrome), and in certain types

of malignancies (e.g., Ieukemias) (Johnson, 1999).

47

2. Biochemical and structural features of Cdc42 and Rac1

Similar to the Ras proteins, Cdc42 and Rac1 proteins cycle between two
states, the inactive, GDP-bound state and the active, GTP-bound state (Hall, 1990
and 1992b). Although the domains required for their biochemical activity are
arranged in a similar configuration to that found in Ras proteins, there are important
differences between Ras proteins and Cdc42 and Rac1 proteins. Presumably, these
differences account for the unique cellular functions of Cdc42 and Rac1, and the
unique contribution of these proteins to malignant transformation. There are four
functional domains required for the biochemical activity of Cdc42 and Rac1 proteins.
These include 1) guanine nucleotide. binding and GTP hydrolysis domains, 2) an
effector binding domain, 3) a CAAX domain, and 4) a Rho insert domain. Each of

these functional domains will be discussed.

a. Guanine nucleotide binding and GTP hydrolysis domains

Small G-proteins and heterotrimeric G-proteins share significant amino acid
homology in domains involved in guanine nucleotide binding and GTP hydrolysis
(Hall, 1990 and 1992b) but there is very low amino acid homology in regions outside
of these domains. This strongly suggests that there are common structural
requirements for effective guanine nucleotide binding and GTP hydrolysis. One of
these structural requirements is the presence of a groove in the protein that is
formed by multiple domains and required for efficient magnesium ion binding
(Menard and Snyderrnan, 1993; Zhang et al., 2000). Tethering of a magnesium ion
by specificresidues in this groove stabilizes the protein conformation such that the

G-protein is locked in a GDP-bound state. Disruption of this protein conformation

48

promotes release of GDP due to decreased GDP binding affinity. GEF, one of three
major families of regulatory proteins, is known to bind to small G-proteins and disrupt
their binding affinity for the magnesium ion (Zhang et al., 2000). This facilitates
passive GTP loading because the cellular concentration of GTP exceeds GDP by
approximately ten-fold. The intrinsic GTPase activity of G-proteins is also another
biochemical activity requiring the same domains involved in guanine nucleotide
binding and GTP hydrolysis. In the GTP-bound state, the GTPase activity is
required to hydrolyze GTP to GDP and inorganic phosphate. This completes the
cycle and the G-protein is returned to an inactive, GDP-bound state. Small G-
proteins are characterized by the rate of their intrinsic GTPase activity, e.g., Ras
isoforms are “slow" GTPases whereas Cdc42 and Rac1 are “fast” GTPases (Hall,

1990 and 1992b).

b. Effector binding domain

The high degree of homology between Cdc42 and Rac1 is consistent with the
finding that they bind to and activate‘some wmmon effector proteins (Bishop and
Hall, 2000; Boettner and Van Aelst, 1999). They do, however, have some structural
differences in their respective effector-binding domains. The effector or switch I
domain region of Cdc42 and Rac1 is an extended BZ-strand/Ioop structure that forms
a significant proportion of one face of the protein (Johnson, 1999). Effectors and
regulators bind to particular subdomains of the extended structure, and in some
cases, multiple effectors and regulators compete for the same subdomains. Effector
proteins are activated by changes in their protein conformation that relieve
autoinhibitory interactions, for example, between the regulatory domain and the

catalytic domain (Bishop and Hall, 2000; Boettner and Van Aelst, 1999). Such

49

protein conformational changes are induced upon binding to GTP-bound forms of

Cdc42 or Rac1.

c. CAAX domain

All small G-proteins contain a CAAX domain (pysteine, aliphatic, aliphatic,
and any residue )_0 at the most distal carboxy-tenninus (C-terminus), which is
essential for post-translational modification and subsequent membrane localization
(Heyworth et al., 1993; Ziman et al., 1993). Post-translational modification in this
case is a sequence of steps that includes prenylation of the cysteine residue,
proteolytic cleavage of the last three amino acids (AAX), and carboxyl methylation of
the cysteine residue. Addition of the lipid moiety to the C-tenninus is required for
insertion of small G-proteins into the inner leaflet of the plasma membrane. As
expected, there is a dramatic shift in the subcellular localization of Cdc42 and Rac1
proteins, from particulate cellular fractions to soluble cellular fractions, when the
CAAX domain is mutated or deleted (Ziman et al., 1993). Proteins lacking a
functional CAAX domain have markedly reduced capacity to activate downstream
pathways involved in their cellular functions. This is largely due to that fact that
stimulators of Cdc42 and Rac1 activity, i.e., GEFs, are localized to the plasma
membrane and require the close proximity of Cdc42 and Rac1 in order to exert their

regulatory effects (reviewed in Whitehead et al., 1997).

d. Rho insert domain

The Rho insert is present in all members of the Rho subfamily (Hall, 1990 and
1992b). The Rho insert forms an a helix and has been shown to be important for

Cdc42 and Rac1 activity in several ways. First, this domain has been shown to be

50

an effector-binding domain for IQGAP, a well-characterized effector for Cdc42
(McCallum et al., 1996). It is possible that other effectors of Cdc42 and Rac1 require
this domain, in addition to the effector-binding domain, for the most efficient binding
and activation. Second, when the Rho insert in Cdc42 was replaced with H-Ras
sequences that are not homologous to the Rho insert, the chimeric protein had
reduced sensitivity to Rho GDI (guanine nucleotide gissociation inhibitor), a regulator
of Cdc42 activity, even though the binding affinity was not altered significantly (Wu et
al., 1997). These results suggest that the Rho insert mediates some of the effects of
Rho GDI and possibly other regulators of Cdc42 and Rac1. Ras proteins, which lack
the equivalent Rho insert domain, do not interact with GDI proteins. Third, in a more
recent study; deletion of the Rho insert abrogated the transforming potential of a
fast-cycling, constitutively active Cdc42 mutant (L28-Cdc42) in NIH3T3 mouse
fibroblasts (Wu et al., 1998). However, activation of two downstream pathways of
Cdc42 and Rac1, the JNK (jun _N-terminal hinase) and PAK (p21-activated hinase)
pathways, was unaffected by this deletion. These results indicate that the activity of
Cdc42 and Rac1 depends on multiple but specific domains in Cdc42 and Rac1.
Finally, some reports have suggested that the Rho insert influences the intrinsic
GTPase rates of Cdc42 and Rac1 (reviewed in Van Aelst and D'Souza Schorey,
1997).

In summary, Cdc42 and Rac1 have functional domains dedicated to its
multiple biochemical activity. In order to function as molecular switches, these
proteins have intrinsic GTPase activity for cycling between active, GTP-bound states
and inactive, GDP-bound states. When bound to GTP, the proteins assume an
active protein conformation, which is conducive for effector binding and activation

and subsequent effector-activation of downstream pathways that carry out the

51

cellular functions of Cdc42 and Rac1. Two other important biochemical
characteristics include the CAAX domain for subcellular localization to the plasma
membrane and the Rho insert domain for its role in modulating effector binding,

action of regulators, and GTPase activity.

52

3. Regulation of Cdc42 and Rac1 activity

Cdc42 and Rac1 are regulated by direct and indirect mechanisms. The direct
mechanisms involve three families of proteins that directly bind to Cdc42 and Rac1
proteins and alter either affinity for guanine nucleotides or intrinsic GTPase activity
(Van Aelst and D'Souza Schorey, 1997). Collectively, these regulatory proteins,
which include GTPase activating protein (GAP), guanine nucleotide dissociation
inhibitor (GDI), and guanine nucleotide exchange factor (GEF), affect the rate of
cycling between active and inactive states. The integrity of this regulation is critical
because the timeliness and appropriateness of Cdc42 and Rac1 activity are
essential for normal cellular function and tissue development. GDI and GAP are
inhibitory proteins, whereas GEF are stimulatory proteins. The molecular
mechanisms by which these-proteins act on Cdc42 and Rac1, thereby regulating
their activity, will be discussed. The indirect mechanisms are not as well defined but
they regulate the overall activity of Cdc42 and Rac1 by exerting their influence on
the direct mechanisms (Kjoller and Hall, 1999). It is well documented that defects in
either of these regulatory mechanisms cause dysfunction of Cdc42 and Rac1 in a

variety of cell types.

a. GTPase-activating protein (GAP)

GAPs enhance intrinsic hydrolysis of GTP to GDP and inorganic phosphate,
i.e., conversion of 'Cdc42 and Rac1 proteins from their active states to their inactive
states. The prototype GAP is p50RhoGAP, which was originally isolated from cell
extracts by affinity purification with recombinant GTP-bound Rho (Lancaster et al.,

1994). This particular GAP has activity towards Rho, Cdc42, and Rac1 proteins.

53

Over13 GAPs have been isolated and characterized, and they differ in their ability to
inactivate various members of the Rho subfamily (Van Aelst and D'Souza Schorey,
1997). GAPs share a highly conserved GAP domain that spans approximately 140
amino acids. Despite their low amino acid sequence homology overall, p50RhoGAP
and Res-GAP have similar three-dimensional structures. Most notable is the
arrangement of key catalytic arginine residues. When these residues were replaced
with alanine residues, such mutant GAP proteins exhibited markedly reduced GAP
activity towards theirtargets (Zhang et al., 1999). The positive charges contributed
by the arginine residues stabilize the negative charges of the transition state, which
is formed upon interaction of a catalytic glutamine residue (e.g., Q61-Cdc42 and
O61-Rac1) with the oxygen atoms of GTP. Thus, GAPs enhance intrinsic GTPase
activity of Cdc42 and Rac1 by binding to these proteins and stabilizing their
transition states. Furthermore, the presence of multiple protein-protein and protein-
lipid binding domains in GAPs suggests that GAPs have additional biochemical
activity (Gamblin and Smerdon, 1998; Zhang and Zheng, 1998; Zalcman et al.,

1 999).

b. Guanine-nucleotide dissociation inhibitor (GDI)

Another family of regulatory proteins that directly inhibits Cdc42 and Rac1
activity is the GDI proteins (Longenecker et al., 1999; Olofsson, 1999; Zalcman et
al., 1999). The first one discovered is the ubiquitously expressed Rho GDI, which is
active on Rho, Cdc42, and Rac1 proteins (Fukumoto et al., 1990; Adra et al., 1993).
At least two other GDIs have been characterized (Lelias et al., 1993; Scherle et al.,
1993). As their name suggests, the GDI proteins inhibit guanine nucleotide

dissociation from Rho GTPases. In theory, these proteins could inhibit GDP or GTP

54

dissociation to maintain the Rho subfamily of proteins in their existing guanine
nucleotide-bound states. However, recent studies show that GDI proteins
preferentially inhibit GDP dissociation from GDP-bound Rho GTPases over GTP
dissociation from GTP-bound Rho GTPases (Longenecker et al., 1999; Read and
Nakamoto, 2000; Scheffzek et al., 2000). This may simply be a direct result of its
preferential binding to GDP-bound and prenylated forms of the Rho GTPases. Thus,
Rho GTPases are stabilized in their inactive, GDP-bound states upon binding to GDI
proteins. By inhibiting dissociation of GDP, exchange for GTP cannot occur. As
noted earlier, there is some evidence to support that the Rho insert domain
modulates the sensitivity of Rho GTPases to the action of GDls.

Some in vitro studies report that weak interactions occur between GDI
proteins and GTP-bound Rho GTPases, and that these interactions inhibit intrinsic
and GAP-stimulated GTPase activity (Hart et al., 1992; Chuang et‘ al., 1993). In this
scenario, the Rho GTPases remain in active, GTP-bound states. It is not clear
whether these weak interactions are significant in vivo. GDI proteins also influence
translocation of Rho GTPases between the cytosol and the plasma membrane. In
unstimulated cells, Rho GTPases exist predominately in the cytosol in their GDP-
bound forms as complexes with GDI proteins (Bilodeau et al., 1999; Hoffman et al.,
2000; Longenecker et al., 1999; Read and Nakamoto, 2000). Stimulation of cell-
surface receptors by certain extracellular factors such as platelet-derived growth
factor, insulin, and bradykinin, induces release of GDI proteins. One mechanism for
this release involves proteins of the ezrin, radaxin, and moesln (ERM) family (Hirao
et al., 1996; Maeda et al., 1999; Menager et al., 1999). When a protein of the ERM
family binds to a GDI complexed with a GDP-bound Rho GTPase, the affinity of the

GDI protein for GDP-bound Rho GTPase is significantly reduced. Finally, there may

55

be significant redundancy of GDI regulatibn of Rho GTPases; for example, deletion
of a GDI gene in embryonic cells produced macrophages with only subtle defects in

superoxide production (Guillemot et al., 1996), a Rae-specific pathway.

c. Guanine-nucleotide exchange factor (GEF)

GEF proteins are the only class of proteins known to activate, as their main
regulatory input, activity of Rho GTPases. It has been reported that their mechanism
of activation involves induction of protein conformational changes that decrease
affinity of Rho GTPases for magnesium ion (Pan and Wessling Resnick, 1998;
Zhang et al., 2000). This results in unloading of GDP and loading of GTP, i.e.,
guanine nucleotide exchange. At least 16 GEF proteins have been identified to date
and they display differentspecificities toward members of the Rho subfamily (Van
Aelst and D'Souza Schorey, 1997). The first one discovered was the giffuse B-cell
lymphoma (Dbl) oncogene. Eva and Aaronson. (1985) isolated the Dbl oncogene
from a human diffuse B-cell lymphoma cDNA library by characterizing genes that
transformed NIH3T3 cells. An interesting historical fact is that the Dbl oncogene was
discovered several years before its target small G-proteins were discovered. The
biochemical activity of the Dbl. oncogene was not realized until sequence
comparisons revealed a high homology to the S. cerevisiae Cdc24 gene, an
exchange factor for Cdc42 (Hart et al., 1991). Biochemical analysis shows that Dbl
has GEF activity on all three Rho GTPases and that the le homology (DH) domain
is responsible for this activity (Aghazadeh et al., 1998). Moreover, this domain is
essential for the oncogenic properties of the Dbl oncogene (Zhu et al., 2000).

The pleckstrin homology (PH) domain isanother domain present in GEF

proteins that are specific for members of the Rho subfamily (Bender et al., 1996;

56

Zheng et al., 1996; Ma and Abrams, 1999). The PH domain is ~100 amino acid
motif originally found in pleckstrin, a substrate for protein kinase C. The PH domain
is frequently found in proteins that are involved in signal transduction or cytoskeletal
organization. Current evidence suggests that the PH domain is involved in two basic
interactions, i.e., protein-lipid and protein-protein interactions. Some of these
interactions account for the observation that diverse extracellular signals activate
Cdc42 and Rac1 pathways. Several reports have shown that overexpression of
GEFs proteins lacking the PH domain in mouse fibroblasts failed to transform such
cells (Zheng et al., 1996; Olson et al., 1997; Qian et al., 1998; Glaven et al., 1999;
Russo et al., 2001). The transforming capacities, however, were restored with the
addition of membrane-targeting domains. This is the most convincing evidence that
the PH domain is required for membrane localization. The PH domain also acts as
an autoinhibitory domain (Bi et al., 2001). Full activation of GEF proteins requires
relief from this autoinhibitory effect, which occurs by inducing conformational
changes of the PH domain. The phosphoinositol lipid, PIP3, is one such signaling
molecule that has this capacity (Van Aelst and D'Souza Schorey, 1997). Therefore,
PIP3 stimulates the catalytic activity of GEF proteins. Other signaling molecules
may also function similarly to relieve PH domain-induced autoinhibition of GEF
activity. The role of the PH domain in protein-protein interaction is not as well
established. Finally, tandem arrangement of the DH domain and PH domain is
generally a signature feature of GEFs specific for the Rho subfamily (Whitehead et
al.1997)

In summary, the GAP, GDI, and GEF families of proteins directly regulate
specific biochemical aspects of Rho GTPases. As noted earlier, these regulatory

proteins generally affect the affinity for guanine nucleotides or the intrinsic GTPase

57

activity, thereby influencing the cellular ratio of GTP-bound to GDP-bound forms.
This ratio dictates activity level of Rho GTPases. One of the most intriguing features
of these regulatory proteins is the significant redundancy observed within each
family of regulatory proteins (Van Aelst and D'Souza Schorey, 1997). It is not clear
why there are so many regulatory proteins within the same family since they fulfill the
same biochemical activity. Furthermore, within each family of regulatory proteins
there are multiple domains involved in protein-protein and protein-lipid interactions,
which increases potential for crosstalk between Rho subfamily pathways and other
signaling pathways (Van Aelst and D'Souza Schorey, 1997). Many have suggested
that these characteristics allow Rho GTPases to regulate diverse cellular processes.
This is further supported by the observation that there is typically low sequence
homology outside of the domains that are characteristic of each family of regulatory
proteins. For example, Dbl and Vav are both members of the Rho-specific GEF
family and are capable of the same basic catalytic activity but Dbl lacks SH2 and
SH3 domains, whereas Vav has one SH2 domain and two SH3 domains (Bustelo,
1996; Aghazadeh et al., 1998). Thus, Dbl and Vav proteins differ not only in their
tissue-specific expression patterns but also in their protein-binding partners. This
suggests that Dbl and Vav proteins are activators of Rho GTPases under specific
cellular contexts.

The indirect mechanisms of regulating Cdc42 and Rac1 activity include
effects of upstream growth factor and cytokine pathways, subcellular localization,
cross-talk and feedback from other signaling pathways, formation of multimolecular
complexes, competition for: effectors and/or regulators, and tissue—specific
expression patterns (Van Aelst and D'Souza Schorey, 1997). These are

mechanisms in which the protein(s) involved do not directly affect the affinity for

58

guanine nucleotides or the intrinsic GTPase activity of Cdc42 and Rac1 proteins.
Nevertheless, they strongly influence the ratio of GTP-bound to GDP-bound Cdc42
and Rac1 levels, usually by exerting their action on the direct mechanisms. It is
beyond the scope of this literature review to discuss each of these regulatory
mechanisms, however, some of the most important examples have been orwill be

highlighted in other sections.

4. Effector-mediated path ways of Cdc42 and Rac1

As noted above, the main cellular functions mediated by Rho GTPases
include regulation of cytoskeleton organization, gene transcription, cell cycle
progression, cell differentiation, survival and apoptosis pathways, and membrane
trafficking (Van Aelst and D'Souza Schorey, 1997). When stimulated by certain
extracellular or intracellular stimuli, Rho GTPases activate various effectors that are
involved in regulating these cellular pathways. In most cases, these effectors act in
signaling cascades to activate further downstream protein components. The cellular
functions of Cdc42 and Rac1 can be simplified into two bifurcating pathways based
on their effector proteins, i.e., those involved in organization of the actin cytoskeleton
and those involved in regulation of transcription pathways. This analysis assumes
that all the other cellular functions rely on the intact function of one or more of these
same effectors. There are both common and unique effectors that mediate the
cellular functions of Cdc42 and Rac1. Some of these effectors share a binding motif,
designated as Cdc42/Rac1 interactive binding (CRIB) motif (Zhang et al., 1997).
Among the effectors that participate in both pathways, the p21-activated l_<_inases
(PAKs), a family of serine/threonine kinases (Knaus and Bokoch, 1998), have

received the most attention recently and will be discussed in some detail. The

59

cellular processes regulated by Cdc42and Rac1 are highly dependent on signaling
through PAK.

a. Organization of the actin cytoskeleton

The first cellular function assigned to members of the Rho subfamily is their
involvement in mediating formation of actin cytoskeletal structures in fibroblasts
(Knaus and Bokoch, 1998). When fibroblasts are treated with a growth factor or
microinjected with the V12-H-Ras oncoprotein, there is rapid formation of
cytoskeletal structures in an order that suggests Cdc42 activates Rac1, which then
activates RhoA. As expected, microinjection of dominant-negative N17-Rac1 protein
prior to the same treatment abolishes sequential formation of these cytoskeletal
structures. The cytoskeletal changes induced by Cdc42 and Rac1 have been linked
to various cellular processes, including protein scaffolding, cell motility, cytokinesis,
cell shape modeling, cell-cell and cell-extracellular matrix contacts, and
microenvironment sensing (Aspenstrom, 1999; Johnson, 1999). Some of these
cellular processes require activation of PAKs (Knaus and Bokoch, 1998).

PAKs participate in signaling cascades that regulate actin cytoskeleton
reorganization (Eby et al., 1998), survival and apoptosis pathways (Tang et al.,
2000), mitogen-activated protein kinase (MAPK) pathways (Bagrodia et al., 1995;
Coso et al., 1995; Minden et al., 1995; Zhang et al., 1995), and NADPH oxidase
pathway (Prigmore et al., 1995; Freeman et al., 1996). Cdc42 and Rac1 act
upstream in these pathways by activating PAKs. Three isoforms of PAK have been
identified, a—PAK (68 kD), B—PAK (65 kD), and y—PAK (62 kD). a-PAK is expressed
in brain and spleen, and B—PAK is expressed only in brain. y—PAK is ubiquitously

expressed in tissues. The Important structural features of PAKs are three proline-

60

rich motifs, a p21-binding domain (PBD), a region rich in acidic residues, and a
catalytic domain (Guo et al., 1998). The regulatory domain is located at the amino-
terrninus (N-tenninus) and consists of the first three structural features. The catalytic
domain is located at the carboxy-terrninus (C-terminus) and is responsible'for the
kinase activity of PAK.

Proline-rich domains are commonly binding sites for SH3 domain-containing
proteins. Most notable of such proteins that interact with PAKs are ch and PIX
proteins (Bokoch et al., 1996; Manser et al., 1998; Kim et al., 2001). ch is an
adaptor protein that contains both SH2 and SH3 domains, thereby directly linking
cell surface receptors and soluble tyrosine kinases to the PAKs. The name PIX
comes from the identification of this protein as a _EAK-lnteracting exchange factor. It
mediates some of the actin cytoskeletal changes induced by Cdc42 and Rac1.

Sequence analysis of the PBD shows that within this domain there is a CRIB
domain, which is the minimal consensus sequence required for Cdc42 and Rac1
binding. Binding of PAK to Cdc42 or Rac1 is most efficient when Cdc42 and Rac1
are in their active, GTP-bound states. Upon binding to GTP-bound Cdc42 or Rac1,
the autoinhibitory protein conformation of PAK is disrupted (Tu and Wigler, 1999).
This ‘opens' the kinase domain or catalytic domain of PAK. Activated PAK then
undergoes autophosphorylation on multiple serine and/or threonine sites present in
the catalytic domain. The specific sites are slightly different among PAK isoforms.
Autophosphorylated PAKs have up to a 300-fold increase in phosphotransferase
(kinase) activity towards their substrates (Manser et al., 1995; Peter et al., 1996).
Some studies show that PAKs are also activated by addition of membrane targeting

domains at the C-terminus (Lu et al., 1997; Daniels et al., 1998; Lu and Mayer,

61

1999). Thus, direct interaction of PAK with ch proteins or specific lipids facilitates

membrane targeting and increased activation of PAK.

b. Induction of survival and apoptosis pathways

Recent reports describe a direct link between y—PAK and caspase-induced
apoptosis. When cells are exposed to various stress stimuli, such as ultraviolet
radiation, caspase-induced proteolytic cleavage of y-PAK result in two protein
fragments, an N-tenninus regulatory fragment (28 kD) and a C-tenninus catalytic
fragment (34 kD) (Bokoch, 1998; Rudel et al., 1998; Walter et al., 1998). Physical
separation of the regulatory domain from the catalytic domain produces a
functionally similar effect when the active, GTP-bound form of Cdc42 or Rac1 binds
to the regulatory domain of PAKs. Proteolytic cleavage of y-PAK and generation of
these fragments parallel the time-course induction of apoptosis in Jurkat cells (Rudel
et al., 1998). Other studies report that PAK is required to stimulate c-Jun amino
terminal kinase (JNK) pathway in these same cells (Bagrodia et al., 1995; Coso et
al., 1995; Minden et al., 1995; Zhang et al., 1995). Expression of dominant-negative
versions of PAK abolishes formation of apoptotic bodies in Jurkat cells and delays
onset of Fas ligation-induced apoptosis (Faure et al., 1997). Thus, PAK induces
apoptosis pathways.

The cellular context, under which PAK functions, however, is critical in
altering its influence on survival and apoptosis pathways. Contradicting cellular
responses have been observed among various cell types and stress stimuli. In
Xenopus oocytes, caspase-induced proteolytic cleavage and activation of PAK result
in stimulation of survival pathways and modulation of cell cycle arrest pathways

(Faure et al., 1997). Other examples of PAK-induction of survival pathways have

62

been reported in studies with mouse fibroblasts. In one study, expression of
dominant-negative versions of PAK in mouse fibroblasts increased its sensitivity to
oncogenic RAS-induced apoptosis (Gallick et al., 2000, Tang et al., 2000). This
indicates that intact PAK pathways are required to subvert oncogenic RAS-induced
apoptosis. In another study,-overexpression of wildtype PAK in mouse fibroblasts
increased survival of such cells when exposed to various stress stimuli, such as
ultraviolet radiation, growth factor deprivation, or interleukin treatment (Jakobi et al.,

2001; Roig and Traugh, 2001).

c. Regulators of gene expression

PAKs are activators of the three MAPK pathways, i.e., ERK, p38, and JNK
pathways. Cdc42 and Rac1 are known to cooperate and enhance proliferative
signals induced by the Raisaf/MEK/ERK pathway (Bagrodia et al., 1995; Coso et
al., 1995; Minden et al., 1995; Zhang et al., 1995). Part of this effect comes from the
stimulatory action of PAKs on two ERK pathway proteins, Raf and MEK. Activated
PAK phosphorylates Raf at specific residues, which increases Raf kinase activity on
MEK1 and MEK2. Activated PAK also phosphorylates specific residues on MEK1
and increases its sensitivity to Rafactivation.

In addition to the ERK pathway, activated PAKs regulate two other MAPK
pathways, the p38 and JNK pathways (Bagrodia et al., 1995; Coso et al., 1995;
Minden et al., 1995; Zhang et al., 1995). The p38 and JNK pathways have
functionally similar upstream kinases at the MAPKKK and MAPKK level, however,
the kinases involved are not as well characterized. Furthermore, the kinase levels at
which PAKs exert their influence on the p38 and JNK signaling cascades have not

been completely determined. Studies so far show that PAKs phosphorylate one or

63

.

   

more upstream signaling components of the p38 and JNK pathways to activate
these pathways. Like the ERK pathway, the final signaling output of the p38 and
JNK pathways is activation of specific transcription factors. The serum response
factor pathway and the nuclear factor KB pathway are two other transcription factor
pathways that are also activated by Cdc42 and Rac1 (Westwick et al., 1997; Foryst

Ludwig and Naumann, 2000).

d. Role in membrane-trafficking processes

Several studies provide evidence of a role for Cdc42 and Rac1 in membrane-
trafficking processes including phagocytosis, endocytosis, and secretory vesicle
transport (reviewed in Van Aelst and D'Souza Schorey, 1997). These cellular
processes require coordinate cytoskeletal rearrangements by Rho GTPases. The

reader is referred to the referenced review paper for further information.

e. Cellular context of Cdc42 and Rac1 function

As briefly discussed, the level of Cdc42 and Rac1 activity and their cellular
functions are also influenced by indirect mechanisms of regulation. Some of these
are apparent in the discussion of PAKs as effectors of Cdc42 and Rac1. Various
stress- or receptor-initiated stimuli give rise to different cellular responses even
though common signaling components may be activated (reviewed in Van Aelst and
D'Souza Schorey, 1997). For example, fibroblasts exposed to UV light had activated
Cdc42 and Rac1 proteins, which induced apoptosis pathways through the activation
of PAKs. However, when fibroblasts were treated with growth factors, PAK was also
activated but there was activation of cell proliferation and survival pathways. Thus,

additional factors must dictate the balance between Cdc42- and Rac1-induced

64

apoptosis and survival pathways in response to various stimuli. Factors that affect
the balance between apoptosis and survival pathways include subcellular
localization of proteins, multimolecular complex formation, tissue-specific expression
patterns, and competing signaling pathways, especially when they involve upstream
or downstream components of these pathways (Van Aelst and D'Souza Schorey,
1997). At a more global level, there may be cross-talk and feedback from other
signaling pathways, e.g., the ERK pathway. Thus, effector-mediated pathways of
Cdc42 and Rac1 are coordinately regulated pathways, rather than distinct pathways

that produce specific cellular responses appropriate for the cellular context.

5. Contribution of CDC42 and RAC1 genes to malignant transformation
a. Constitutively active Cdc42 and Rac1 mutants

Since many parallels exist among Res and Rho GTPases, there was early
speculation that activating mutations of the Rho subfamily of genes could display
similar oncogenic potential to that demonstrated with the RAS genes. However,
overexpression of Rho GTPases carrying mutations analogous to those found in
oncogenic RAS, e.g., G12V and 061L,‘in various cell types had only weak and
inconsistent transforming potential of rodent fibroblasts (Hall, 1990 and 1992b). One
explanation for this difference is that Rho GTPases are regulated more extensively
by inhibitory proteins than Ras GTPases (Van Aelst and D'Souza Schorey, 1997). In
the case of the Rho subfamily, the significant redundancy of negative regulators,
which include members of the GAP and GDI families, may impart an overriding
limitation on the activity level of Rho GTPases (Mackay and Hall, 1998; Van Aelst
and D'Souza Schorey, 1997). In contrast, Ras has only a few GAPs and no

equivalent GDIs, which would act as negative regulators of Ras activity. Thus,

65

oncogenic RAS activity is not modulated to the same extent as Rho GTPases.
Another possible explanation is that Rho GTPases have higher intrinsic GTPase
activity than that demonstrated with Ras GTPases (Hall, 1990 and 1992b). A higher
intrinsic GTPase activity translates to a more rapid conversion of active, GTP-bound
forms to inactive, GDP-bound forms of the Rho subfamily. This results in a relatively
brief and measured activation of downstream Rho subfamily pathways in response
to either upstream activation by various stimuli or constitutively active mutants of
Rho GTPases. In contrast, Ras has been described as a “slow” GTPase because it
remains in the activated, GTP-bound state much longer. Therefore, activating
mutations of RAS genes give rise to more persistent activation of Ras pathways.
Furthermore, unlike RAS genes, which contain an activating mutation in
approximately 30% of all human tumors (Bos, 1988 and 1989), there are no reports
of human tumors containing an activating mutation in RHO genes. For the reasons
described above, cells with constitutively active mutations of RHO genes probably
display only subtle “selectable” phenotypes. The finding that the Rho subfamily is
more extensively regulated, however, does not eliminate the potential of their
effector-mediated pathways as important pathways in the malignant transformation
of cells. Dysfunction of these pathways is more likely to occur by more robust

mechanisms that exceed the influence of negative regulators of Rho GTPases.

b. Oncogenic derivatives of the Dbl family of GEFs

Although constitutively active mutant Cdc42 and Rac1 proteins do not
function as oncoproteins, many studies report that members of the Dbl family of

GEFs, which directly activate Cdc42 and Rac1 activity, mediate oncogenic

66

transformation of cells when expressed as truncated derivatives. Three examples of
oncogenic GEFs will be discussed.

The DBL oncogene was originally isolated from a human diffuse B-cell
lymphoma cDNA library because of its capacity to transform NIH3T3 cells to focus-
fon'ning cells that were tumorigenic in athymic mice (Eva and Aaronson, 1985). The
gene that induced this phenotype was identified as a truncated, oncogenic derivative
of the DBL gene. Other GEFs specific for the Rho subfamily have also been
identified in similar function-based screens (Cerione and Zheng, 1996).

The Ber-Abl fusion protein is a byproduct of the hallmark chromosomal
aberration, the Philadelphia chromosome, found in greater than 90% of chronic
myeloid Ieukemias and in some acute Iymphocytic Ieukemias (Cortez et al., 1995;
Arlinghaus, 1998; Faderl et al., 1999). The hreakpoint pluster legion (Bcr) protein
has domains characteristic of both GEF and GAP proteins, which is an example of a
bifunctional regulatory protein specific for Rho GTPases (Diekmann et al., 1991;
Chuang et al., 1995). Abl protein is a tyrosine kinase. It is not exactly clear why the
fusion of these two proteins is required for leukemogenesis, i.e., generation of
leukemia cells. However, there is evidence to support that the individual biochemical
activity of Bcr and Abl are greatly enhanced as a fusion protein, possibly because of
the partial or complete disruption of autoinhibitory domains from chromosomal
breakage and/or the potential for non-physiological multimolecular complexes
(Chuang et al., 1995). Generation of non-physiological multimolecular protein
complexes could place two proteins in close proximity, allowing one protein to
activate another protein, when normally the proteins do not bind or interact.

The tumor invasion and metastasis-1 oncogene was isolated using a

similar strategy that led to the discovery of the DBL oncogene (Habets et al., 1994).

67

Investigators were looking specifically for genes that conferred an invasive
phenotype when introduced into a non-invasive lymphoma cell line. Other studies
provide further evidence of a role of Cdc42 and Rac1 in increasing motility and
invasiveness of a variety of tumor cell types (Michiels et al., 1995; Keely et al., 1997;
Banyard et al., 2000; Evers et al., 2000; Schmitz et al., 2000).

These three examples illustrate that the Dbl family of GEFs is a family of
proto-oncogenes that promote tumor generation and tumor progression when
converted to oncogenic derivatives, usually by truncation of autoinhibitory domains.
In summary, because members of the Dbl family of GEFs are activators of Cdc42
and Rac1 activity, and their oncogenic potential is well documented, Cdc42 and
Rac1 must regulate effector-mediated pathways that contribute to the malignant

transformation of human cells.

c. Cdc42 and Rac1 as mediators of oncogenic H-RAS transformation

Several studies show that Rho GTPases are required for oncogenic H-RAS
transformation of rodent fibroblasts (Prendergast et al., 1995; Qiu et al., 19953,
1995b, and 1997). In these studies, they overexpressed dominant-negative mutant,
N19-Rho, N17-Cdc42, or N17-Rac1, i.e., mutants analogous to the well-
characterized dominant-negative Ras mutants, to inhibit endogenous activity of the
specific Rho GTPase (Figure 4). Dominant-negative mutants are constitutively in
their inactive, GDP-bound states. However, the mutant proteins retain the ability to
bind to GEF and some effector proteins. Therefore, when a specific mutant is
expressed in cells, they limit or sequester the availability of GEF and effector
proteins from their endogenous counterpart, thereby inhibiting the function of the

specific Rho GTPase in such cells. Expression of these mutants in rodent

68

fibroblasts malignantly transformed by oncogenic RAS differentially impaired various
transformed growth characteristics, including anchorage independence and growth
factor independence (Prendergast et al., 1995; Qiu et al., 1995a, 1995b, and 1997).
For example, expression of N17-Cdc42 in Rat1 fibroblasts only partially inhibited
Res-induced growth factor independence, whereas expression of N17-Rac1 strongly
inhibited this transformed phenotype. Thus, although Cdc42 and Rac1 proteins
share some signaling pathways, it is generally accepted that they contribute uniquely
to oncogenic H-RAS transformation of cells. The most direct evidence that Cdc42
and Rac1 act downstream of Ras pathways comes from studies showing the
involvement of phosphoinositide-3-kinase (Pl3K) (Bi et al., 2001). As discussed
above, Ras activates Pl3K by binding to the catalytic subunit of PI3K. The active
lipid products generated by PI3K bind to the PH domains present in Rho-specific
GEFs and enhance their localization to the plasma membrane. Thus, through lipid
activation of GEFs, Ras acts as an upstream activator of Cdc42 and Rac1 pathways
(Cerione and Zheng, 1996; Whitehead et al., 1997; Aspenstrom, 1999). Activation of
Cdc42 and Rac1 pathways is necessary for the full oncogenic potential of mutant

RAS genes.

69

Figure 4: Functional mutants of the Rho subfamily of GTPases. Multiple
domains are responsible for activity of Rho GTPases: guanine nucleotide binding
and GTP hydrolysis domains, effector binding domain, Rho insert domain, and
membrane localization domain (Johnson, 1999; Takai‘et al., 2001). The Rho insert
is unique to members of the Rho subfamily. Dominant-negative mutants, T17N and
C1888, are defective in GTP-binding and prenylation, respectively, but retain the
ability to bind to GEFs and certain effector proteins. Dominant-active mutants G12V
and QGIL are defective in GDP binding and GTP hydrolysis, whereas dominant-
active mutant F28L (Lin et al., 1997) is defective only in GDP binding. Thus, the
F28L mutant displays rapid cycling between active, GTP-bound state and inactive,

GDP-bound State because the GTPase activity remains intact.

70

5 7mm: om 7va vm Twa 9. TV I. N®-mm oméw 0N-m

cor—«5.30.. ocanEos.
:8... 2.x

9.55m Seem.

£323: .05... 85:5 Eo

E
Z
I
I
F
_

 

 

 

 
  

 

omcmcoxm 6269032 Emma

4mm... IIII

canoniomu

9:853 co=m_>c9n_ Z N _\|_I
m mm F O

 

 

9:06.60 owmdkw @266on owmdko

I__.©OI >Nr0I

 

 

v 2:9".

71

d. PAK as the major effector mediating transformation of cells

The contribution of Cdc42 and Rac1 to the malignant transformation of cells
is thought to be mainly through activation of PAK (Bagrodia and Cerione, 1999;
Gallick, 2000; Roig et al., 2000; Tang et al., 2000). First, cells that express
oncogenic H-RAS have increased sensitivity to apoptosis unless there is additional
modulation of other pathways. PAK has been shown to counteract the apoptosis
signals induced by oncogenic RAS (Tang et al., 2000). One such mechanism is by
PAK-mediated phosphorylation and activation of Bad, a Bax-like protein that
antagonizes apoptosispathways (Schurmann et al., 2000). In such a scenario, the
oncogenic RAS-transformed cells acquire a balance of increased stimulation of Ras
pathways without increased sensitivity to apoptosis signals. These studies suggest
that oncogenic RAS transformation of cells is dependent on PAK activation.

Second, the level of GTP-bound Rac3 protein, as detected by an affinity-
precipitation assay, is elevated in highly proliferative human breast cancer cell lines
(Mira et al., 2000). The assay utilizes the finding that the p21-binding domain (PBD),
located at the N-terminus of PAK, only interacts with GTP-bound Cdc42 and Rac1
isoforms, and not their GDP-bound forms (Benard et al., 1999). Such an assay
allows for estimation of the relative proportion of total Cdc42 and Rac1 in their
active, GTP-bound forms, i.e., the activity level of these proteins. The cell lines
tested in this study were divided into two groups based on the absence or presence
of a rapid rate of cellular proliferation (Mira et al., 2000). The highly proliferative
group of cell lines displayed an elevated level of active, GTP-bound Rac3 protein
compared with normal human breast cell lines. They further identified the PAK

effector pathway as the essential pathway for mediating this transformed phenotype.

72

Third, in a recent report investigators overexpressed wildtype y—PAK in
BALB3T3 mouse fibroblasts and determined the effect on the survival of such cells
exposed to stress stimuli such as serum starvation, UVC exposure, and lL-2
treatment (Jakobi et al., 2001). The cells displayed enhanced survival compared
with the same cells not expressing exogenous y—PAK and increased resistance to
apoptosis signals normally activated by such stress stimuli. Such cells may be more
susceptible to malignant transformation because they have lost a major mechanism

that prevents propagation of cells containing DNA damage.

e. Summary

There are two major themes that summarize the role of Cdc42 and Rac1
pathways in the malignant transformation of cells. First, dysfunction of Cdc42 and
Rac1 pathways is caused by- defective regulation, and not by mutations of
CDC42 and RAC1 genes themselves. In theory, the regulation of Cdc42 and Rac1
activity could be disrupted in several ways to cause an overall increase in Cdc42 and
Rac1 activity. However, increased activity of positive regulators, such as members
of the Dbl family of GEFs, is the only known mechanism that has been documented
in human tumor cells (Cerione and Zheng, 1996; Whitehead et al., 1997).
Conversion of GEF proto-oncogenes to oncogenic derivatives occurs by truncation
of key regulatory domains in GEF proteins. The result is constitutive activation of
Cdc42 and Rac1 and their downstream pathways. A net loss of negative regulators,
such as GAP and GDI proteins, could also cause an overall increase in Cdc42 and
Rac1 activity. Therefore, these genes could be thought of as tumor suppressor

genes because they negatively regulate Cdc42 and Rac1 activity. However,

73

inactivating mutations in neither GAP nor GDI genes have been found in human
tumors.

Second, evidence to date supports that Cdc42 and Rac1 fulfill a permissive
or supporting role, rather than a causal role, in the malignant transformation of
cells. Although expression of constitutively active mutants of Cdc42 or Rac1 in
rodent fibroblasts is only weakly transforming (Hall, 1990 and 1992b), there is a
consistent requirement for Cdc42 and Rac1 activity in maintenance of the malignant
phenotype induced by oncogenic H-RAS (Prendergast et al., 1995; Qiu et al., 1997).
Thus, increased Cdc42 or Rac1 activity alone is not sufficient to induce the
malignant transformation of cells but the pathways regulated by Cdc42 and Rac1 are
required for establishment and maintenance of the malignant phenotype.

Newly characterized mutants of Cdc42 and Rac1, i.e., the F28L mutants, may
shed light on the full transformation potential of Cdc42 and Rac1. G12V and 061L
mutants are constitutively GTP-bound, GTPase-defective mutants. In contrast, F28L
mutants are constitutively GTP-bound, GTPase-competent mutants (Lin et al., 1997;
Johnson, 1999). Because they are GTPase-competent, F28L mutants retain the
ability to return Cdc42 and Rac1 to their GDP-bound states. Reloading of GTP
occurs rapidly because the conformation of such mutants favors GTP binding over
GDP binding. Therefore, F28L mutants of Cdc42 and Rac1 display increased
exchange activity AND increased GTPase activity. Such mutants have been
described as fast-cycling mutants. In contrast, G12V and 061L mutants display a
more static or steady-state increase in Cdc42 and Rac1 activity because they are
locked in their GTP-bound states. Such mutants display only increased exchange
activity. Some studies report that F28L mutants are more effective transforming

agents than G12V and 061 L mutants because of these differences (Johnson, 1999).

74

This led to the speculation that the full oncogenic potential of Cdc42 and Rac1 is
dependent on increased rate of cycling of these proteins and not simply increased
level of GTP-bound forms. Further investigation into the significance of dynamic
(F28L) vs. static (G12V and Q61L) increases in Cdc42 and Rac1 activity could also
offer insight into the mechanistic basis for bifunctional regulators such as the Bcr
protein, which contains both GEF and GAP domains (Chuang et al., 1995) (Figure
5). Bcr has the potential to increase rate of cycling of Cdc42 and Rac1 by exerting
similar biochemical effects to that observed with F28L mutants. Ras activation of
Cdc42 and Rac1 potentially operates through similar mechanisms because the
influence of Ras is through activation of both positive (e.g., GEFs) and negative

regulators (e.g., GAPs) of Cdc42 and Rac1 (Mackay and Hall, 1998).

75

Figure 5: Cdc42 and Rac1 contribute to malignant transformation of cells by at
least two possible mechanisms. A static increase in Cdc42 or Rac1 activity, i.e.,
an increase in exchange activity of Cdc42 or Rac1, occurs when proteins are
activated by truncated, oncogenic derivatives of GEFsspecific for the Rho GTPases
(e.g., Dbl oncogene). A dynamic increase in Cdc42 or Rac1 activity, i.e., an
increase in exchange activity coupled with an increase in GTP hydrolysis rate,
occurs when the proteins are activated by bifunctional regulators such as Abr, which
has both GEF and GAP action on Cdc42 and Rac1, and by Ras proteins, which
activate both GEFs and GAPs for Cdc42 and Rac1. The transforming potential of
increased Cdc42 and Rac1 activity may be greater when occurring by dynamic

mechanisms than by static mechanisms.

76

 

85-5.28 H L.

 

a

953.

 

mm< can :o=m>=om mam ..md

 

IIIL

85-5.28 e t L

a

$566
FPO

9
n50
$96

anocaooco "_mmv ..md

 

 

  

_m

m 2:9...

77

REFERENCES

Aaltonen, L. A., Peltomaki, P., Mecklin, J. P., Jarvinen, H., Jass, J. R., Green, J. S.,
Lynch, H. T. Watson, P., Tallqvist, G., Juhola, M., and et al. (1994). Replication
errors in benign and malignant tumors from hereditary nonpolyposis colorectal
cancer patients. Cancer Res 54,1645-1648.

Adams, A. E., Johnson, D. I., Longnecker, R. M., Sloat, B. F., and Pringle, J. R.
(1990). CDC42 and CDC43, two additional genes involved in budding and the
establishment of cell polarity in the yeast Saccharomyces cerevisiae. J Cell Biol 111,
131-42.

Adra, C. N., Ko, J., Leonard, D., Wirth, L. J., Cerione, R. A., and Lim, B. (1993).
Identification of a novel protein with GDP dissociation inhibitor activity for the ras-like
proteins CDC42Hs and rac I. Genes Chromosomes Cancer 8, 253-61.

Aghazadeh, B. Zhu, K., Kubiseski, T. J., Liu, G. A, Pawson, T, Zheng, Y., and
Rosen, M. K. (1998). Structure and mutagenesis of the Dbl homology domain. Nat
Struct Biol 5,- 1098-107. ‘

Alitalo, K., Schwab, M., Lin, C. C., Vannus, H. E., and Bishop, J. M. (1983).
Homogeneously staining chromosomal regions contain amplified copies of an
abundantly expressed cellular oncogene (c-myc) in malignant neuroendocrine cells
from a human colon carcinoma. Proc Natl Acad Sci U S A 80, 1707-11.

Amanatullah, D. F. Zafonte, B. T., Albanese, C., Fu, M., Messiers, C., Hassell, J.,

and Pestell, R. G. (2001). Ras regulation of cyclin D1 promoter. Methods Enzymol
333,116-27.

Aoki, M., Schetter, C., Himly, M., Batista, 0., Chang, H. W., and Vogt, P. K. (2000).
The catalytic subunit of phosphoinositide 3-kinase: requirements for oncogenicity. J
Biol Chem 275, 6267-75.

Aquilina, G., and Bignami, M. (2001). Mismatch repair in correction of replication
. errors and processing of DNA damage. J Cell Physiol 187, 145-154.

Arber, N., Sutter, T., Miyake, M.,'Kahn, S. M., Venkatraj, V. S., Sobrino, A.,
Warburton, D., Holt, P. R., and Weinstein, I. B. (1996). Increased expression of
cyclin D1 and the Rb tumor suppressor gene in c-K-ras transformed rat enterocytes.
Oncogene 12, 1903-8. .

Arbiser, J. L., Moses, M. A., Fernandez, C. A., Ghiso, N., Cao, Y., Klauber, N.,
Frank, D., Brownlee, M., Flynn, E., Parangi, S., Byers, H. R., and Folkman, J.
(1997). Oncogenic H ras stimulatestumor angiogenesis by two distinct pathways.
Proc Natl Acad Sci U S A 94, 861-6.

78

Arlinghaus, R. B. (1998). The involvement of Bcr in Ieukemias with the Philadelphia
chromosome. Crit Rev Oncog 9, 1-18.

Aspenstrom, P. (1999). The Rho GTPases have multiple effects on the actin
cytoskeleton. Exp Cell Res 246, 20-5.

Azzam, E.‘ I., de Toledo, S. M., Pykett, M. J., Nagasawa, H., and Little, J. B. (1997).
CDC2 is down-regulated by ionizing radiation in a p53-dependent manner. Cell
Growth Differ 8, 1161-9.

Baba, S. (1997). Recent advances in molecular genetics of colorectal cancer. World
J Surg 21, 678-87.

Bagrodia, S., and Cerione, R. A. (1999). Pak to the future. Trends Cell Biol 9, 350-5.

Bagrodia, S., Derijard, B., Davis, R. J., and Cerione, R. A. (1995). Cdc42 and PAK-
mediated signaling leads to Jun kinase and p38 mitogen-activated protein kinase
activation. J Biol Chem 270, 27995-8.

Bai, L., Mihara, K., Kondo, Y.; Honma, M., and Namba, M. (1993). lmmortalization of
normal human fibroblasts by treatment with 4 nitroquinoline 1 oxide. Int. J. Cancer
53, 451-6.

Bailleul, B., Brown, K., Ramsden, M., Akhurst, R. J., Fee, F., and Balmain, A. (1989).
Chemical induction of oncogene mutations and growth factor activity in mouse skin
carcinogenesis. Environ Health Perspect, 8123-7.

Baker, 8. J., Fearon, E. R., Nigro, J. M., Hamilton, S. R., Preisinger, A. C., Jessup, J.
M., vanTuinen, P., Ledbetter, D. H., Barker, D. F., Nakamura, Y., and et al. (1989).
Chromosome 17 deletions and p53 gene mutations in colorectal carcinomas.
Science 244, 217-21.

Balmain, A. (1985). Transforming ras oncogenes and multistage carcinogenesis. Br
J Cancer 51, 1-7.

Banyard, J., Anand Apte, B., Symons, M., and Zetter, B. R. (2000). Motility and
invasion are differentially modulated by Rho family GTPases. Oncogene 19, 580-91.

Barbacid, M. (1987). ras genes. Annu Rev Biochem, 56779-827.

Bardelli, 4A., Basile,-M. L., Audero, E., Giordano, 8., Wennstrom, S., Menard, S.,
Comoglio, P. M., and Ponzetto, C. (1999). Concomitant activation of pathways
downstream of Grb2 and PI-3 kinase is required for MET mediated metastasis.
Oncogene 18, 1139-46.

Barrett, J. C., Oshimura, M., and Koi, M. (1986). Role of oncogenes and tumor
suppressor genes in a multistep model of carcinogenesis. Symp Fundam Cancer
Res, 3945-56.

79

Benard, V., Bohl, B. P., and Bokoch, G. M. (1999). Characterization of rac and cdc42
activation in chemoattractant-stimulated human neutrophils using a novel assay for
active GTPases. J Biol Chem 274, 13198-204. . .,

Bender, L., I Lo, H. S., Lee, H., Kokojan, V., Peterson, V, and—Bender, A. (1996).
Associations among PH and SH3 domain-containing proteins and Rho-type
GTPases' In Yeast. J Cell Biol 133, 879-94.

Bemeburg, M., and Lehmann, A. R. (2001). Xeroderma pigmentosum and related
disorders: defects in DNA repair and transcription. Adv Genet, 4371-102.

Bi, F., Debreceni, B., Zhu, K., Salani, B., Eva, A., and Zheng, Y. (2001).
Autoinhibition mechanism of proto-Dbl. Mol Cell Biol 21 , 1463-74.

Bilodeau, D., Lamy, S., Desrosiers, R. R., Gingras, D., and Beliveau, R. (1999).
Regulation of Rho protein binding to membranes by rhoGDl: inhibition of releasing
activity by physiological ionic conditions. Biochem Cell Biol 77, 59-69. -

Bishop, A. L. and Hall, A. (2000). Rho GTPases and their effector proteins. Biochem
J 1, 2241-55.

Blackburn, E. H. (1991). Structure and function oftelomeres. Nature 350, 569-73.

Blackwood, E. M., and Eisenman, R. N. (1991). Max: a helix loop helix zipper protein
that forms a sequence specific DNA binding complex with Myc. Science 251, 1211-
7.

Boettner, B., and Van Aelst, L. (1999). Rac and Cdc42 effectors. Prog Mol Subcell
Biol, 22135-58.

Bokoch, G. M. (1998). Caspase-mediated activation of IPAK2 during apoptosis:
proteolytic kinase activation as a general mechanism of apoptotic signal
transduction? Cell Death Differ 5, 637-45.

Bokoch, G. M, Wang,Y., Bohl, B. P., Sells, M. A., Quilliam, L. A. and Knaus, U. G.
(1996). Interaction of the ch adapter protein with p21-activated kinase (PAK1). J
Biol Chem 271 , 25746-9.

Bos, J. L. (1997). Ras-Iike GTPases. Biochim Biophys Acta 1333, M19-31.

Bos, J. L. (1988). The ras gene family and human carcinogenesis. Mutat Res 195,
255-71.

Bos, J. L. (1989). ras oncogenes in human cancer: a review. Cancer Res 49, 4682-
9. .

Bos, J. L., Fearon, E. R., Hamilton, S. R., Verlaan de Vries, M., van Boom, J. H., van

der Eb, A. J., and Vogelstein, B. (1987). Prevalence of ras gene mutations in human
colorectal cancers. Nature 327, 293-7.

80

Boukamp, P., Peter, W., Pascheberg, U., Altrneier, S., Fasching, C:, Stanbridge, E.
J., and Fusenig, N. E. (1995). Step-wise progression in human skin carcinogenesis
in vitro involves mutational inactivation of p53, rasH oncogene activation and
additional chromosome loss. Oncogene 1 1, 961 -9.

Boutwell, R. K. (1964). Some biological aspects of skincarcinogenesis. Prog. Exp.
Tumor Res. 4, 207-250.

Boveri, T. (1914). Zur Frage der Entstehung maligner tumoren.(Translation 1929, M.
Boveri The origin of malignant tumors) (Baltimore: Williams 8 Wilkens).

Brehm, A., Miska, E. A., McCance, D. J., Reid, J. L., Bannister, ,A. J., and
Kouzarides, T. (1998). Retinoblastoma protein recruits histone deacetylase to
repress transcription. Nature 391, 597-601.

Bronner, C. E., Baker, S. M., Morrison, P. T., Warren, G., Smith, L. G., Lescoe, M.
*K., Kane, M., Earabino, C., Lipford, J., Lindblom, A., and et al. (1994). Mutation in
the DNA mismatch repair gene homologue hMLH1 is associated with hereditary non
polyposis colon cancer. Nature 368, 258-261.

Brunner, G., Pohl, J., Erkell, L. J., Radler Pohl, A., and Schirnnacher, V. (1989).
Induction of uroklnase activity and malignant phenotype in bladder carcinoma cells
after transfection of the activated Ha-ras oncogene. J Cancer Res Clin Oncol 115,
139-144.

Bustelo, X. R. (1996). The VAV family of signal transduction molecules. Crit Rev
Oncog 7, 65-88.

Candeias, S. M, Durum, S. K., and Muegge, K. (1997). p53-dependent apoptosis
and transcription of p21waflcip1/sdi1 in SCID mice following gamma- -irradiation.
Biochimie 79, 607-12.

Cantor, S. B., Urano, T., and Feig, LA. (.1995). Identification and characterization of

Ral-binding protein 1, a potential downstream target of Ral GTPases. Mol Cell Biol
15, 4578-84.

Cech, T. R., Nakamura, T. M., and Lingner, J. (1997). Telomerase is a true reverse
transcriptase. A review. Biochemistry (Mosc) 62, 1202-5.

Cerione, R. A., and Zheng, Y. (1996). The Dbl family of oncogenes. Curr Opin Cell
Biol 8, 216-22.

Chambers, A. F., Colella, R., Denhardt, D. T., and Wilson, S. M. (1992). Increased
expression of cathepsins L and B and decreased activity of their inhibitors in
metastatic, ras-transfonned NIH 3T3 cells. Mol Carcinog 5, 238-245.

Chambers, A. F., and Tuck, A. B. (1993). Ras-responsive genes and tumor
metastasis. Crit Rev Oncog 4, 95-114.

81

Chardin, P., Camonis, J. H., Gale, N. W., van Aelst, L., SchlesSinger, J., Wigler, M.
H., and Bar Sagi, D. (1993). Human $051: a guanine nucleotide exchange factor for
Ras that binds to GRBZ. Science 260, 1338-43.

Chen, J., Willingham, T., Shuford, M., Bruce, D., Rushing, E., Smith, Y., and Nisen,
P. D. (1996). Effects of ectopic overexpression of p21(WAF1/CIP1) on aneuploidy
and the malignant phenotype of human brain tumor cells. OnCogene 13, 1395-403.

. Chen, T. T., and Wang, J. Y. (2000). Establishment of irreverSible growth arrest in
myogenic differentiation requires the RB LXCXE- -binding function. Mol Cell Biol 20,
5571-80.

Chuang, T. H., Xu, X., Knaus, U. G., Hart, M. J., and Bokoch, G. M. (1993). GDP
dissociation inhibitor prevents intrinsic and GTPase activating protein-stimulated
GTP hydrolysis. by the Rec GTP-binding protein. J Biol Chem 268, 775-8.

Chuang, T. H., Xu, X. Kaartinen, V. Heisterkamp, N., Groffen, J. and Bokoch, G.
M. (1995). Abr and Bcr are multifunctional regulators of the Rho GTP-binding protein
family. Proc Natl Acad Sci U S A 92,10282—6. ‘

Clauss, M. (2000). Molecular biology of the VEGF and the VEGF receptor family.
Semin Thromb Hemost 26, 561-9. -

Cleary, M. L., Smith, S. D., and Sklar, J. (1986). Cloning and structural analysis of
cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the
t(14; 18) translocatron Cell 47, 19-28. ,

Cleaver, J. E. (1990). Do we know the cause of xeroderrna pigmentosum?
Carcinogenesis 11 , 875-82.

Cleaver, J. E., Zelle, B., Hashem, N., El Hefnawi, M. H., and German, J. (1981).
Xeroderrna pigmentosum patients from Egypt: II. Preliminary correlations of
epidemiology, clinical symptoms and molecular biology. J Invest Dermatol 77, 96-
101.

Cole, M. D. (1986a). Activation of the c-myc oncogene. Basic Life Sci. 38, 399-406.

C'ole, M. D. (1986b). The myc oncogene: its role in transformation and differentiation.
Annu. Rev. Genet. 20, 361-384.

Colella, G., Vikhanskaya, F, Codegoni, A. M., Bonazzi C., D'lncalci, M. and
Broggini, M. (1998). hMLH1 and hMSH2 expression and BAX frameshift mutations in
ovarian cancer cell lines and tumors. Carcinogenesis 19, 691 -4

Cortez, D., Kadlec, L. and Pendergast, A. M. (1995). Structural and signaling

requirements for BCR-ABL-mediated transformation and inhibition of apoptosis. Mol
Cell Biol 15, 5531-41.

82

Coso, O. A., Chiariello, M., Yu, J. C., Teramoto, H., Crespo, P., Xu, N., Miki, T., and
Gutkind, J. S. (1995). The small GTP-binding proteins Rac1 and-Cdc42 regulate the
activity of the JNK/SAPK signaling pathway. Cell 81 , 1137-46.

'Cotran, R. S., Kumar, V., and Collins, T. (1999). Robbins pathological basis of
disease, 6th Edition (Philadelphia: W.B. Saunders Company).

Counter, C. M., Botelho, F. M., Wang, P., Harley, C. B., and Bacchetti, S. (1994).
Stabilization of short telomeres and telomerase activity accompany immortalization
of Epstein-Barr virus-transforrned human B lymphocytes. J Virol 68, 3410-4.

Crespo, P., and Leon, J. (2000). Ras proteins in the control of the cell cycle and cell
differentiation. Cell Mol Life Sci 57, 1613-36.

Dang, C. V., Dolde, C., Gillison, M. L., and Kato, G. J. (1992). Discrimination
between related DNA sites by a single amino acid residue of Myc-related basic-helix-
loop-helix proteins. Proc Natl Acad Sci U S A 89, 599-602.

Dang, C. V., Lewis, B. C., Dolde, C., Dang, G., and Shim, H. (1997). Oncogenes in
tumor metabolism, tumorigenesis, and apoptosis. J Bioenerg Biomembr 29, 345-54.

Daniels, R. H., Hall, P. S., and Bdkoch, G. M. (1998). Membrane targeting of p21-
activated kinase 1 (PAK1) induces neurite outgrowth from PC12 cells. EMBO J 17,
754-64.

Datta,-K., Bellacosa, A., Chan, T.-O., and Tsichlis, P. N. (1996). Akt is a direct target
of the phosphatidylinositol 3-kinase. Activation by growth factors, v-src and v-Ha-ras,
in Sf9 and mammalian cells. J Biol Chem 271, 30835-9.

Datta, S. R.,Dudek, H., Tao, X., Masters, 8., Fu, H., Gotoh, Y., and Greenberg, M.
E. (1997). Akt phosphorylation of BAD couples survival signals to the cell-intrinsic
death machinery. Cell 91, 231-41.

Daya Grosjean, L., Robert, C., Drougard, C., Suarez, H., and Sarasin, A. (1993).
High mutation frequency in ras genes of skin tumors isolated from DNA repair
deficient xeroderma pigmentosum patients. Cancer Res 53, 1625-9.

Deamant, F. D., and lannaccone, P. M. (1987). Clonal origin of chemically induced
papillomas: separate analysis of epidermal and dermal components. J. Cell Sci. 88,
305-12.

DeCaprio, J. A., Ludlow, J. W., Figge, J., Shew, J. Y., Huang, C. M., Lee, W. H.,
Marsilio, E., Paucha, E., and Livingston, D. M. (1988). SV40 large tumor antigen
forms a specific complex with the product of the retinoblastoma susceptibility gene.
Cell 54, 275-83.

Didsbury, J., Weber, R. F., Bokoch, G. M., Evans, T., and Snydennan, R. (1989).

rac, a novel ras-related family of proteins that are botulinum toxin substrates. J Biol
Chem 264, 16378-82.

83

Diekmann, D., Brill, 8., Garrett, M. D., Totty, N., Hsuan, J., Monfries, C., Hall, C.,
Lim, L., and Hall, A. (1991). Bcr encodes a GTPase-activating protein for p21rac.
Nature 351 , 400-2.

Dong, G., Chen, Z., Li, Z. Y., Yeh, N.‘ T., Bancroft, C. C., and Van Waes, C. (2001).
Hepatocyte growth factor/scatter factor-induced activation of MEK and PI3K signal
pathways contributes to expression of proangiogenic cytokines interleukin-8 and
vascular endothelial growth factor in head. and neck squamous cell carcinoma.
Cancer Res 61, 5911-8.

Downward, J. (1998). Lipid-regulated kinases: some common themes at last.
Science 279, 673-4.

Ducray, C., Pommier, J. P., Martins, L., Boussin, F. D., and Sabatier, L. (1999).
Telomere dynamics, end-to-end fusions and telomerase activation during the human
fibroblast immortalization process. Oncogene 18, 4211-23.

Dumaz, N., van Kranen, H. J., de Vries, A., Berg, R. J., Wester, P. W., van Kreijl, C.
F, Sarasin, A., Daya Grosjean, L, and de Gruijl, F. R. (1997). The role of UVB light
in skin carcinogenesis through the analysis of p53 mutations in squamous cell
carcinomas of hairless mice. Carcinogenesis 18, 897-904.

Dvorak, H. F., Sioussat, T. M., Brown, L. F., Berse, B., Nagy, J. A., Sotrel, A.,
Manseau, E. J., Van de Water, L., and Senger, D. R. (1991). Distribution of vascular
permeability factor (vascular endothelial growth factor) in tumors: concentration in
tumor blood vessels. J Exp Med 174, 1275-8.

Dyson, N. (1998). The regulation of E2F by pRB family proteins. Genes Dev. 12,
2245-62.

Dyson, N., Howley, P. M., Munger, K. and Harlow, E. (1989). The human papilloma
virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product. Science
243, 934-7.

Eby, J. J., Holly, S. P., van Drogen, F., Grishin, A. V., Peter, M., Drubin, D. G., and
Blumer, K. J. (1998). Actin cytoskeleton organization regulated by the PAK family of
protein kinases. Curr Biol 8, 967-70.

el Deiry, W. S., Harper, J. W, O'Connor, P. M., Velculescu, V. E., Canman, C. E.,
Jackman, J., Pietenpol, J. A., Burrell, M., Hill, D. B, Wang, Y., and et al. (1994).
WAF1/CIP1 is induced in p53-mediated G1 arrest and apoptosis. Cancer Res 54,
1169-74.

Ellis, L. M., Takahashi, Y., Liu, W., and Shaheen, R. M. (2000). Vascular endothelial

growth factor in human colon cancer: biology and therapeutic implications.
Oncologist5,111-5.

84

 

F<\‘lu

English, J., Pearson, G., Wilsbacher, J., Swantek,-J., Karandikar, M., Xu, 8., and
Cobb, M. H. (1999). New insights into the control of MAP kinase pathways. Exp Cell
Res 253, 255-70.

Eva, A., and Aaronson, S. A. (1985). Isolation of a new human oncogene from a
diffuse B-cell lymphoma. Nature 316, 273-5.

Evers, E. E., Zondag, G. C., Malliri, A., Price, L. S., ten Klooster, J. P., van der
Kammen, R. A., and Collard, J. G. (2000). Rho family proteins in cell adhesion and
cell migration. Eur J Cancer 36, 1269-74.

Facchini, L. M., and Penn, L. Z. (1998). The molecular role of Myc-in growth and
transformation: recent discoveries lead to new insights. FASEB J. 12, 633-51.

Faderl, S., Talpaz, M., Estrov, Z., and Kantarjian, H. M. (1999). Chronic
myelogenous leukemia: biology and therapy.- Ann Intern Med 131, 207-19.

Fan, J., and Bertino, J. R. (1997). K-ras modulates the cell cycle via both positive
and negative regulatory pathways. Oncogene 14, 2595-607.

Faure, S., Vigneron, S., Doree, M., and Morin, N. (1997). A member of the
Ste20lPAK family of protein kinases is involved in both arrest of Xenopus oocytes at
GZIprophase of the first meiotic cell cycle and in prevention of apoptosis. EMBO J
16, 5550-61.

Fearon, E. R., and Vogelstein, B. (1990). A genetic model for colorectal
tumorigenesis. Cell 61 , 759-67.

Feinberg, A. P., Vogelstein, B., Droller, M. J., Baylin, S. B., and Nelkin, B. D. (1983).
Mutation affecting the 12th amino acid of the c-Ha-ras oncogene product occurs
infrequently in human cancer. Science 220, 1175-7.

Filmus, J., Robles, A. l., Shi, W., Wong, M. J., Colombo, L. L., and Conti, C. J.
(1994). Induction of cyclin D1 overexpression by activated ras. Oncogene 9, 3627-
33.

Fishel, R., Lescoe, M. K., Rao, M. R., Copeland, N. G., Jenkins, N. A., Garber, J.,
Kane, M., and Kolodner, R. (1993). The human mutator gene homolog MSH2 and its
association with hereditary nonpolyposis colon cancer. Cell 75, 1027-1038.

Flemington, E. K., Speck, ‘S. H., and 'Kaelin, W. G. (1993). E2F-1-mediated
transactivation is inhibited by complex formation with the retinoblastoma
susceptibility gene product. Proc Natl Acad Sci U S A 90, 6914-8.

Forsythe, J. A., Jiang, B. H., lyer, N. V., Agani, F., Leung, S. W., Koos, R. D., and

Semenza, G. L. (1996). Activation of vascular endothelial growth factor gene
transcription by hypoxia-inducible factor 1. Mol Cell Biol 16, 4604-13.

85

Foryst Ludwig, A., and Naumann, M. (2000). p21-activated kinase 1 activates the
nuclear factor kappa B (NF-kappa B)-inducing kinase-Ikappa B kinases NF-kappa B '
- pathway and proinflammatory cytokines in Helicobacter pylori infection. J Biol Chem
275, 39779-85.

Franke, T. F., Yang, S. l., Chan, T. O., Datta, K., Kazlauskas, A., Morrison, D. K.,
Kaplan, D. R., and Tsichlis, P. N. (1995). The protein kinase encoded by the Akt
proto-oncogene is a target of the PDGF-activated phosphatidylinositol 3-kinase. Cell
81, 727-36. '

Freeman, J. L., Abo, A., and Lambeth, J. D. (1996). Rac "insert region" is a novel
effector region that is implicated in the activation of NADPH oxidase, but not PAK65.
J Biol Chem 271, 19794-801.

Friend, S. H., Bernards, R., Rogelj, S., Weinberg, R. A., Rapaport, J. M., Albert, D.
M., and Dryja, T. P. (1986). A human DNA segment with properties of the gene that
predisposes to retinoblastoma and osteosarcoma. Nature 323, 643-6.

Fruman, D. A., Meyers, R. E., and Cantley, L. C. (1998). Phosphoinositide kinases.
Annu Rev Biochem 67, 481-507.

Fry, D. G, Milam, L. D., Maher, V. M, and McCormick, J. J. (1986). Transformation
of diploid human fibroblasts by DNA transfection with the v-sis oncogene. J Cell
Physiol 128, 313-21. .

Fukumoto, Y., Kaibuchi, K, Hori, Y. Fujioka, H., Araki, S. Ueda, T, Kikuchi, A., and
Takai, Y. (1990). Molecular cloning and characterization of a novel type of regulatory
protein (GDI) for the rho proteins, ras p21-like small GTP-binding proteins.
Oncogene 5, 1321-8. '

Fung, Y. K., Murphree, A. L., T'Ang,A., Qian, J, Hinrichs, S. H., and Benedict, W. F.
(1987). Structural evidence for the authenticity of the human retinoblastoma gene.
Science 236,1657-1661.

Gallick, G. E. (2000). Tyrosine kinase inhibitors for suppression of tumorigenic
growth of Ras—transfon'ned cells: PAK-ing in the signals. Cancer J 6, 217-9.

Gamblin, S. J., and Smerdon, S. J. (1998). GTPase-activating proteins and their
complexes. Curr Opin Struct Biol 8, 195-201.

Geiser, A. G., and Stanbridge, E. J. (1989). A review of the evidence for tumor
suppressor genes. Crit Rev Oncog 1, 261-76.

Gengrinovitch, S., Berrnan, 8., David, G., Witte, L., Neufeld, G., and Ron, D. (1999).

Glypican-1 is a VEGF165 binding proteoglycan that acts as an extracellular
chaperone for VEGF165. J Biol Chem 274, 10816-22.

86

Giambemardi, T. A., Grant, G. M., Taylor, G. P., Hay, R. J., Maher, V. M.,
McCormick, J. J., and Klebe, R. J. (1998). Overview of matrix metalloproteinase
expression in cultured human cells. Matrix Biol 16, 483-96.

Gil, J., Yamamoto, H., Zapata, J. M., Reed, J. C., and Perucho, M. (1999).
lmpairrnent of the proapoptotic activity of Bax by missense mutations found in
gastrointestinal cancers. Cancer Res 59, 2034-7.

Gille, H., and Downward, J. (1999). Multiple ras effector pathways contribute to G(1)
cell cycle progression. J Biol Chem 274, 22033-40.

Glaven, J. A., Whitehead, I., Bagrodia, 8., Kay, R., and Cerione, R. A. (1999). The
Dbl-related protein, Lfc, localizes to microtubules and mediates the activation of Rac
signaling pathways in cells. J Biol Chem 274, 2279-85.

Gluzman Poltorak, 2., Cohen, T., Herzog, Y., and Neufeld, G. (2000). Neuropilin-2
and neuropilin-1 are receptors for the 165-amino acid form of vascular endothelial
growth factor (VEGF) and of placenta growth factor-2, but only neuropilin-Z functions
as a receptor for the 145-amino acid form of VEGF. J Biol Chem 275, 18040-5.

Grand, R. J., and Owen, D. (1991). The biochemistry of ras p21. Biochem J 279,
609-31.

Greenhalgh, D. A., Rothnagel, J. A., Quintanilla, M. |., Orengo, C. C., Gagne, T. A.,
Bundman, D. S., Longley, M. A., and Roop, D. R. (1993). Induction of epidermal
hyperplasia, hyperkeratosis, and papillomas in transgenic mice by a targeted v Ha
ras oncogene. Mol. Carcinog. 7, 99-110.

Guillemot, J. C., Kruskal, B. A., Adra, C. N., Zhu, 8., K0, J. L., Burch, P., Nocka, K.,
Seetoo, K., Simons, E., and Lim, B. (1996). Targeted disruption of guanosine
diphosphate-dissociation inhibitor for Rho-related proteins, GDID4: normal
hematopoietic differentiation but subtle defect in superoxide production by
macrophages derived from in vitro embryonal stem cell differentiation. Blood 88,
2722-31.

Guo, W., Sutcliffe,‘M. J., Cerione, R. A., and Oswald, R. E. (1998). Identification of
the binding surface on Cdo42Hs for p21-activated kinase. Biochemistry 37, 14030-7.

Habets, G. G., Scholtes, E. H., Zuydgeest, D., van der Kammen, R. A., Stam, J. C.,
Berns, A., and Collard, J. G. (1994). Identification of an invasion-inducing gene,
Tiam-1, that encodes a protein with homology to GDP-GTP exchangers for Rho-like
proteins. Cell 77, 537-49.

Haddow, S., Fowlis, D. J., Parkinson, K.-, Akhurst, R. J., and Balmain, A. (1991).
Loss of growth control by TGF-beta occurs at a late stage of mouse skin
carcinogenesis and is independent of ras gene activation. Oncogene 6, 1465-70.

Hahn, W. C., and Meyerson, M. (2001). Telomerase activation, cellular
immortalization and cancer. Ann Med 33, 123-9.

87

Hainaut, P., and HollStein, M. (2000). p53 and human cancer: the first ten thousand
mutations. Adv Cancer Res, 7781 -1 37.

Hall, A. (1990). The cellular functions of small GTP-binding proteins. Science 249,
635-40.

Hall, A. (1992a). Ras-related GTPases and the cytoskeleton. Mol Biol Cell 3, 475-9.

Hall, A. (1992b). Small GTP-binding proteinsua new family of biologic regulators. Am
J Respir Cell Mol Biol 6, 245-6.

Hanahan, D., and Weinberg, R. A. (2000). The hallmarks of cancer. Cell 100, 57-70.

Hara, A., Hirose, Y., Yoshimi, N., Tanaka, T., and Mori, H. (1997). Expression of Bax
and bcl-2 proteins, regulators of programmed cell death, in human brain tumors.
Neurol Res 19, 623-8.

Hart, M. J., Eva, A, Evans, T. Aaronson, S. A, and Cerione, R. A. (1991). Catalysis
of guanine nucleotide exchange on the CDC42Hs protein by the dbl oncogene
product. Nature 354, 311-4.

Hart, M. J, Maru, Y., Leonard, D. Witte, O. N., Evans, T, and Cerione, R. A. (1992).
A GDP dissociation inhibitor that serves as a GTPase inhibitor for the Ras-Iike
protein CDC42Hs. Science 258, 812-5.

Hashem, N., Bootsma, D., Keijzer, W., Greene, A., Coriell, L., Thomas, G., and
Cleaver, J. E. (1980). Clinical characteristics, DNA repair, and complementation
groups in xeroderma pigmentosum patients from Egypt. Cancer Res 40,13-8.

Hastie, N. D. and Allshire, R. C. (1989). Human telomeres: fusion and interstitial
sites. Trends Genet 5, 326- 31.

Hayflick, L., and Moorhead, 4P. (1961). The serial cultivation of human diploid cell
strains. Exp. Cell Res. 25, 585.

Hennings,.-H., Shores, R. A., Poirier, M. C., Reed, E., Tarone, R. E., and Yuspa, S.
H. (1990). Enhancedmalignant conversion of benign mouse skin tumors by cisplatin.
J. Natl. Cancer Inst. 82, 836-40.

Hernandez Alcoceba, R., del Peso, L., and Lacal, J. C. (2000). The Ras family of
GTPases in cancer cell invasion. Cell Mol Life Sci 57, 65-76.

Heyworth, P. G., Knaus, U. G., Xu, X., Uhlinger, D. J., Conroy, L., Bokoch, G. M.,
and Curnutte, J. T. (1993). Requirement for posttranslational processing of Rac
. GTP-binding proteins for activation of human neutrophil NADPH oxidase. Mol Biol
Cell 4, 261-9.

88

Hicks, G. G., Egan, S. E., Greenberg, A. H., and Mowat, M. (1991). Mutant p53
tumor suppressor alleles release ras-induced cell cycle growth arrest. Mol Cell Biol
11, 1344-52.

Hirao, M., Sato, M, Kondo, T., Yonemura, S., Monden, M., Sasaki, T., Takai, Y., and
Tsukita, S. (1996). Regulation mechanism of ERM (ezrin/radixin/moesin)
protein/plasma membrane association: possible involvement of phosphatidylinositol
turnover and Rho-dependent signaling pathway. J Cell Biol 135, 37-51.

Hofer, F., Fields, S., Schneider, C., and Martin, G. S. (1994). Activated Ras interacts
with the Ral guanine nucleotide dissociation stimulator. Proc Natl Acad Sci U S A 91,
1 1089-93.

Hoffman, G. R., Nassar, N., and Cerione, R. A. (2000). Structure of the Rho family
GTP-binding protein Cdc42 in complex with the multifunctional regulator RhoGDI.
Cell 100, 345-56.

Hollstein, M.,. Sidransky, D., Vogelstein,- B., and Harris, C. C. (1991). p53 mutations
in human cancers. Science 253, 49-53.

Honda, R., Tanaka,.H., and Yasuda, H. (1997). Oncoprotein MDM2 is a ubiquitin
ligase E3 for tumor suppressor p53. F EBS Lett 420, 25-7.

Houck, K. A., Leung, D. W., Rowland, A. M., Winer, J., and Ferrara, N. (1992). Dual
regulation of vascular. endothelial growth factor bioavailability by genetic and
proteolytic mechanisms. J Biol Chem 267, 26031-7.

Huang, H. J., Yee, J. K., Shew, J. Y., Chen, P..L., Bookstein, R., Friedmann, T., Lee,
E. Y., and Lee, W. H. (1988). Suppression of the neoplastic phenotype by
replacement of the RB gene in human cancer cells. Science 242, 1563-1566.

Huber, B. E., Dearfield, K. L., Williams, J. R., Heilman, C. A., and Thorgeirsson, S.
S. (1985). Tumorigenicity and transcriptional modulation of c-myc and N-ras
oncogenes in a human hepatoma cell line. Cancer Res 45, 4322-9.

Hurlin, P. J., Maher, V. M., and McCormick, J. J. (1989). Malignant transformation of
human fibroblasts caused by expression of a transfected T24 HRAS oncogene. Proc
Natl Acad Sci U S A 86, 187-91.

lshikawa, T., lde, F., Qin, X., Zhang, S., Takahashi, Y., Sekiguchi, M., Tanaka, K.,
and Nakatsuru, Y. (2001). Importance of DNA repair in carcinogenesis: evidence
from transgenic and gene targeting studies. Mutat Res 477, 41-9.

Jakobi, R., Moertl, E., and Koeppel, M. A. (2001). p21-activated protein kinase
gamma-PAK suppresses programmed cell death of BALB3T3 fibroblasts. J Biol
Chem 276. 16624-34.

Jenkins, J. R., Rudge, K., Chumakov, P., and Currie, G. A. (1985). The cellular
oncogene p53 can be activated by mutagenesis. Nature 317, 816-8.

89

Jimenez, C., Jones, D. R, Rodriguez Viciana, P., Gonzalez Garcia, A., Leonardo.
.E., Wennstrom, S.., van Kobbe, C., Toran, J. L., R Borlado, L., Calvo, V., et al.
(1998). Identification and characterization of a new oncogene derived from the
regulatory subunit of phosphoinositide 3-kinase. EMBO J 17, 743-753.

Jiricny, J. (1994). Colon cancer and DNA repair: have mismatches met their match?
Trends Genet 10, 164-168.

Johnson, D. I. (1999). Cdc42: An essential Rho-type GTPase controlling eukaryotic
cell polarity. Microbiol Mol Biol Rev 63, 54-105.

Johnson, L., Greenbaum, D., Cichowski, K., Mercer, K., Murphy, E., Schmitt, E.,
Bronson, R. T., Umanoff, H., Edelmann, W., Kucherlapati, R., and Jacks, T. (1997).
K-ras is an essential gene in the mouse with partial functional overlap with N-ras.
Genes Dev 11 , 2468-81.

Jurgensmeier, J. M, Xie, Z, Deveraux, Q., Ellerby, L, Bredesen, D., and Reed, J.
C. (1998). Bax directly induces release of cytochrome c from isolated mitochondria.
Proc Natl Acad Sci U S A 95, 4997-5002.

Kaneko, Y, Rowley, J. D., Check, l., Variakojis, D., and Moohr, J. W. (1980). The
14q+ chromosome In pre-B-ALL. Blood 56, 782- 5.

Kang, M. K., and Park, N. H. (2001). Conversion of normal to malIgnant phenotype
telomere shortening, telomerase activation, and genomic instability during
immortalization of human oral keratinocytes. Crit Rev Oral Biol Med 12, 38-54.

Kauffmann Zeh,'A., Rodriguez Viciana, P., Ulrich, E., Gilbert, C., Coffer, P.,
Downward, J., and Evan, G. (1997). Suppression of c-Myc-induced apoptosis by
Ras signalling through Pl(3)K and PKB. Nature 385, 544-8.

”Keely, P. J., Westwick, J. K.,‘Whitehead, l. P., Der, C. J., and Parise, L. V. (1997).
Cdc42 and Rac1 induce integrin-mediated cell motility and invasiveness through
Pl(3)K. Nature 390, 632-6.

Khwaja, A., Rodriguez Viciana, P., Wennstrom, S., Warne, P. H., and Downward, J.
(1997). Matrix adhesion and Ras transformation both activate a phosphoinositide 3-
OH kinase and protein kinase B/Akt cellular survival pathway. EMBO J 16, 2783-93.

Kikuchi, A., Demo, S. D., Ye, Z. H., Chen, Y. W., and Williams, L. T. (1994). ralGDS
family members interact with the effector loop of ras p21. Mol Cell Biol 14, 7483-91.

- Kim, H., Jen, J., Vogelstein, B., and Hamilton, S. R. (1994). Clinical and pathological

characteristics of sporadic colorectal carcinomas with DNA replication errors in
microsatellite sequences. Am J Pathol 145, 148-156.

90

Kim, S., Lee, S. H., and Park, D. (2001). Leucine zipper-mediated homodimerization
of the p21-activated kinase-interacting factor, beta Pix. Implication for a role in
cytoskeletal reorganization. J Biol Chem 276, 10581-4.

Kinzler, K. W.,— Nilbert, M. C., Su, L. K., Vogelstein, B., Bryan, T. M., Levy, D. B.,
Smith, K. J., Preisinger, A. C., Hedge, P., McKechnie, D., and et al. (1991).
Identification of PAP locus genes from chromosome 5q21. Science 253, 661-5.

Kjoller, L., and Hall, A. (1999). Signaling to Rho GTPases. Exp Cell Res 253, 166-
79.

Klingelhutz, A. J. (1999). The roles of telomeres and telomerase in cellular
immortalization and the development of cancer. Anticancer Res 19, 4823-30.

Knaus, U. G., and Bokoch, G. M. (1998). The p21Rac/Cdc42-activated kinases
(PAKs). Int J Biochem Cell Biol 30, 857—62.

Knudson, A. 6., Jr. (1971). Mutation and cancer: statistical study of retinoblastoma.
Proc Natl Acad Sci U S A 68, 820-823.

Koda, T., Matsushima, 8., Sasaki, A., Danjo, Y., and Kakinuma, M. (1985). c-myc
Gene amplification in primary stomach cancer. Jpn J Cancer Res 76, 551-4.

Kodaki, T., Woscholski, R., Hallberg, B., Rodriguez Viciana, P., Downward, J., and
Parker, P. J. (1994). The activation of phosphatidylinositol 3-kinase by Ras. Curr Biol
4, 798-806.

Koera, K., Nakamura, K., Nakao, K., Miyoshi, J., Toyoshima, K., Hatta, T., Otani, H.,
Aiba, A., and Katsuki, M. (1997). K-ras is essential for the development of the mouse
embryo. Oncogene 15, 1151-9.

Kondo, S., Asano, M., and Suzuki, H. (1993). Significance of vascular endothelial
growth factor/vascular permeability factor for solid tumor growth, and its inhibition by
the antibody. Biochem Biophys Res Commun 194, 1234-41.

Kozma, R., Ahmed, 8., Best, A., and Lim, L. (1995). The Ras-related protein
Cdc42Hs and bradykinin promote formation of peripheral actin microspikes and
filopodia in Swiss 3T3 fibroblasts. Mol Cell Biol 15, 1942-52.

Krajewski, S., Krajewska, M., Ehrrnann, J., Sikorska, M., Lach, B., ‘Chatten, J., and
Reed, J. C. (1997). Immunohistochemical analysis of Bcl-2, BcI-X, Mcl-1, and Bax in
tumors of central and peripheral nervous system origin. Am J Pathol 150, 805-14.

Kretzner, L., Blackwood, E. M., and Eisenman, R. N. (1992a). Myc and Max proteins
possess distinct transcriptional activities. Nature 359, 426-9.

Kretzner, L., Blackwood, E. M., and Eisenman, R. N. (1992b). Transcriptional

activities of the Myc and Max proteins in mammalian cells. Curr Top Microbiol
Immunol, 182435-43.

91

Kulik, G., Klippel, A., and Weber, M. J. (1997). Antiapoptotic signalling by the insulin-
like growth factor I receptor, phosphatidylinositol 3-kinase, and Akt. Mol Cell Biol 17,
1595-606.

Kuroki, T., and Huh, N. H. (1993). Why are human cells resistant to malignant cell
» transformation in vitro? Jpn J Cancer Res 84, 1091-100.

Lai, A., Lee, J. M., Yang, W. M., DeCaprio, J. A., Kaelin, W. G., Seto, E., and
Branton, P. E. (1999). RBP1 recruits both histone deacetylase-dependent and -
independent repression activities to retinoblastoma family proteins. Mol Cell Biol 19,
6632-41.

Lancaster, C. A., Taylor Harris, P. M., Self, A. J., Brill, S., van Erp, H. E., and Hall, A.
(1994). Characterization of rhoGAP. A GTPase-activating protein for rho-related
small GTPases. J Biol Chem 269, 1137-42.

Land, H., Chen, A. C.,wMorgenstem, J. P., Parada, L. F., and Weinberg, R. A.
(1986). Behavior of myc and ras oncogenes in transformation of rat embryo
fibroblasts. Mol Cell Biol 6, 1917-25.

Lee, W. H., Bookstein, R., Hong, F., Young, L. J., Shew, J. Y., and Lee, E. Y. (1987).
Human retinoblastoma susceptibility gene: Cloning, identification, and sequence.
Science 235, 1394-1-399. .

Leevers, S. J., Paterson, H. F., and Marshall, C. J. (1994). Requirement for Ras in
Raf activation is overcome by targeting Raf to the plasma membrane. Nature 369,
411-4..

Lelias, J. M., Adra, C. N., Wulf, G. M., Guillemot, J. C., Khagad, M., Caput, D., and
Lim, B. (1993). cDNA cloning of a human mRNA preferentially expressed in
hematopoietic cells and with homology to a GDP-dissociation inhibitor for the rho
GTP-binding proteins. Proc Natl Acad Sci U S A 90, 1479-83.

Levy, M. Z., AIIsOpp. R. C., Futcher, A. B., Greider, C. W., and Harley, C. B. (1992).
Telomere end-replication problem and cell aging. J Mol Biol 225, 951-60.

Li, J., Yen, C., Liaw, D., Podsypanina, K., Bose, S., Wang, S. I.,' Puc, J., Miliaresis,
C., Rodgers, L., McCombie, R., Bigner, S. H., Giovanella, B. C., Ittmann, M., Tycko,
B, Hibshoosh, H., Wigler, M. H., and Parsons, R. (1997a). PTEN, a putative protein
tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer.
Science 275, 1943-7.

Li, P., Nijhawan, D., Budihardjo, |., Srinivasula, S. M., Ahmad, M., Alnemri, E. S.,

and Wang, X. (1997b). Cytochrome c and dATP-dependent formation of Apaf-
1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479-89.

92

Li, Y., Jenkins, C. W., Nichols, M. A., and Xiong, Y. (1994). Cell cycle expression
and p53 regulation of the cyclin-dependent kinase inhibitor p21.. Oncogene 9, 2261-
8.

Liaw, D., Marsh, D. J., Li, J., Dahia, P. L., Wang, S. l., Zheng, Z., Bose, 8., Call, K.
M., Tsou, H. C., Peacocke, M., Eng, C., ‘and Parsons, R. (1997). Germline mutations
of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer
syndrome. Nat Genet 16, 64-7.

Lin, C., Maher, V. M., and McCormick, J. J. (1995). Malignant transformation of
human fibroblast strain MSU 1.1 byv fes requires an additional genetic change. Int J
Cancer 63, 140-7.

Lin, J., Reichner, C., Wu, X., and Levine, A. J. (1996). Analysis of wild-type and
mutant p21WAF-1 gene activities. Mol Cell Biol 16, 1786-93.

Lin, R., Bagrodia, S., Cerione, R., and Manor, D. (1997). A novel Cdc42Hs mutant
induces cellular transformation. Curr BIOI'7, 794-7.

Lindahl, T. (1994). DNA repair. DNA surveillance defect in cancer cells. Curr. Biol. 4,
249-51.

Lingner, J.,“Hughes, T. R., Shevchenko, A., Mann, M., Lundblad, V., and Cech, T. R.
(1997). Reverse transcriptase motifs in the catalytic subunit of telomerase. Science
276, 561-7.

Liu, B., Parsons, R. E., Hamilton, S. R., Petersen, G. M., Lynch, H. T., Watson, P.,
Markowitz, S., Willson, J; K., Green, J., de la Chapelle, A., and et al. (1994). hMSH2
mutations in hereditary nonpolyposis colorectal cancer kindreds. Cancer Res 54,
4590-4594.

Liu, E., Thant, A. A., Kikkawa, F., Kurata, H., Tanaka, 8., Nawa, A., Mizutani, S.,
Matsuda, S., Hanafusa, H., and Hamaguchi, M. (2000). The Ras-mitogen-activated
protein kinase pathway is critical for the activation of matrix metalloproteinase
secretion and the invasiveness in v-crk-transforrned 3Y1. Cancer Res 60, 2361-4.

Liu, J. J., Chao, J. R., Jiang, M. C., Ng, S. Y., Yen, J. J., and Yang Yen, H- F. (1995).
Ras transformation results in an elevated levelof cyclin D1 and acceleration of G1
progression in NIH 3T3 cells. Mol Cell Biol 15, 3654-63.

Livingstone, L. R., White, A., Sprouse, J., Livanos, E., Jacks, T., and Tlsty, T. D.
(1992). Altered cell cycle arrest and gene amplification potential accompany loss of
wild-type p53. Cell 70, 923-35.

Longenecker, K., Read, P., Derewenda, U., Dauter, Z., Liu, X., Garrard, S., Walker,
L., Somlyo, A. V., Nakamoto, R. K., Somlyo, A. P., and Derewenda, Z. S. (1999).
How RhoGDl binds Rho. Acta Crystallogr D Biol Crystallogr 55, 1503-15.

93

Lowy, D. R., and Willumsen, B. M. (1993). Function and regulation of ras. Annu Rev
Biochem, 62851-91.

Lu, W., Katz, S., Gupta, R., and Mayer, B. J. (1997). Activation of Pak by membrane
localization mediated by an SH3 domain from the adaptor protein -ch. Curr Biol 7,
85-94.

Lu, W., and Mayer, B. J. (1999). Mechanism of activation of Pak1 kinase by
membrane localization. Oncogene 18, 797-806.

Luo, R. X., Postigo, A. A., and Dean, D. C. (1998). Rb interacts with histone
deacetylase to repress transcription. Cell 92, 463-73.

' Ma, A. D., and Abrams, C. S. (1999). Pleckstrin homology domains and
phospholipid-induced cytoskeletal reorganization. Thromb Haemost 82, 399-406.

Ma, Y. Y, Wei, S. J., Lin, Y. C, Lung, J. C, Chang, T. C, Whang Peng, J., Liu, J.
M., Yang, D. M, Yang, W. K., and Shen, C. Y. (2000). PIK3CA as an oncogene in
cervical cancer. Oncogene 19, 2739-44.

Machesky, L. M, and Hall, A. (1997). Role of actin polymerization and adhesion to
extracellular matrix in Rac— and Rho-induced cytoskeletal reorganization. J Cell Biol
138, 913-26.

Mackay, D. J., and Hall, A. (1998). Rho GTPases. J Biol Chem 273, 20685-8.
Macleod, K. (2000). Tumor suppressor genes. Curr Opin Genet Dev 10, 81-93.

Maeda, M., Matsui, T., Imamura, M., and Tsukita, S. (1999). Expression level,
subcellular distribution and rho-GDI binding affinity of merlin in comparison with
Ezrin/Radixin/Moesin proteins. Oncogene 18, 4788-97.

Magnaghi Jaulin, L., Groisman, R., Naguibneva, I., Robin, P., Lorain, 8., Le Villain,
J. P., Troalen, F., Trouche, D., and Harel Bellan, A. (1998). Retinoblastoma protein
represses transcription by recruiting a histone deacetylase. Nature 391, 601-5.

Maher, V. M., Rowan, L-. A., Silinskas, K. C., KateIey, S. A., and McCormick, J. J.
(1982). Frequency of UV-induced neoplastic transformation of diploid human

fibroblasts is higher in xeroderma pigmentosum cells than in normal cells. Proc Natl
Acad Sci U S A 79, 2613-7.

Manon, S., Chaudhuri, B., and Guerin, M. (1997). Release of cytochrome c and
decrease of cytochrome c oxidase in Bax-expressing yeast cells, and prevention of
these effects by coexpression of BcI-xL. FEBS Lett 415, 29-32.

Manser, E., Chong, C., Zhao, Z. S., Leung, T., Michael, 6., Hall, C., and Lim, L.

(1995). Molecular cloning of a new member of the p21-Cdc42/Rac-activated kinase
(PAK) family. J Biol Chem 270, 25070-8.

94

Manser, E., Loo, T. H., Koh, C. G., Zhao, Z. S., Chen, X. 0., Tan, L., Tan, I., Leung,
T., and Lim, L. (1998). PAK kinases are directly coupled to the PIX family of
nucleotide exchange factors. Mol Cell 1, 183-92.

Marais, R., and Marshall, C. J. (1996). Control of the ERK MAP kinase cascade by
Ras and Raf. Cancer Surv, 27101-25.

Martin, T. F. (1998). Phosphoinositide lipids as signaling molecules: common
themes for signal transduction, cytoskeletal regulation, and membrane trafficking.
Annu Rev Cell Dev Biol, 14231-64.

Marx, J. (1994). New link found between p53 and DNA repair. Science 266, 1321-2.

Masutani, C., Kusumoto, R., Yamada, A., Dohmae, N., Yokoi, M., Yuasa, M., Araki,
M., Iwai, S., Takio, K., and Hanaoka, F. (1999). The XPV (xeroderma pigmentosum
variant) gene encodes human DNA polymerase eta. Nature 399, 700-4.

Maxwell, P. H., Dachs, G. U., Gleadle', J; M., Nicholls, L. G., Harris, A. L., Stratford, I.
J., Hankinson, O., Pugh, C. W., and Ratcliffe, P. J. (1997). Hypoxia-inducible factor-
1 modulates gene expression in solid tumors and influences both angiogenesis and
tumor growth. Proc Natl Acad Sci U S A 94, 8104-9.

McCallum, S. J., Wu, W. J., and Cerione: R. A. (1996). Identification of a putative
effector for Cdc42Hs with high sequence similarity to the RasGAP-related protein
lQGAPl and a Cdc42Hs binding partner with similarity to IQGAP2. J Biol Chem 271 ,
21732-7.

McCormick, J. J., and Maher, V. M. (1988). Towards an understanding of the
malignant transformation of diploid human fibroblasts. Mutat. Res. 199, 273-91.

McCormick, J. J., and Maher, V. M. (1994).-Analysis of the multistep process of
carcinogenesis using human fibroblasts. Risk Anal. 14, 257-63.

McCormick, J. J., and Maher, V. M. (1996). Analysis of the multistep nature of
human carcinogenesis utilizing human fibroblasts. Radiat. Oncol. Invest. 3, 387-391.

McFarlane, H., Ngu, V. A., and Osunkoya, B. O. (1970). lmmunoglobulin deficiencies
in Burkitt's lymphoma. Afr J Med Sci 1, 401 -7.

Menager, C., Vassy, J., Doliger, C., Legrand, Y., and Karniguian, A. (1999).
Subcellular localization of RhoA and ezrin at membrane ruffles of human endothelial
cells: differential role of collagen and fibronectin. Exp Cell Res 249, 221-30.

Menard, L., and Snyden'nan, R. (1993). Role of phosphate-magnesium-binding
regions in the high GTPase activity of rac1 protein. Biochemistry 32, 13357-61.

Meyerson, M. (1998). Telomerase enzyme activation and human cell
immortalization. Toxicol Lett 28, 102-10341.

95

Meyne, J., Ratliff, R.‘ L., and Moyzis, R. K. (1989). Conservation of the human
telomere sequence (1TAGGG)n among vertebrates. Proc Natl Acad Sci U S A 86,
7049-53.

Michiels, F, Habets, G. G, Stam, J. C. van der Kammen, R. A. and Collard, J. G.
(1995). A role for Rac In Tiam1-induced membrane ruffling and invasion. Nature 375,
338-40. .

Minden, A., Lin, A., Claret, F. X., Abo, A., and Karin, M. (1995). Selective activation
of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases
Rac and Cdc42Hs. Cell 81 , 1147-57.

Mira, J. P., Benard, V., Groffen, J., Sanders, L. C., and Knaus, U. G. (2000).
Endogenous, hyperactive Rac3 controls proliferation of breast cancer cells by a p21-
activated kinase-dependent pathway. Proc Natl Acad Sci U S A 97, 185-9.

Miyashita, T., Krajewski, S., Krajewska, M., Wang, H. G., Lin, H. K., Lieberrnann, D.
A, Hoffman, B., and Reed, J. C. (1994). Tumor suppressor p53 is a regulator of bcl-
2 and bax gene expression in vitro and in vivo. Oncogene 9, 1799-805.

Momand, J., Wu, H. H., and Dasgupta, G. (2000). MDM2—master regulator of the
p53 tumor suppressor protein. Gene 242, 15-29.

Momand, J., Zambetti, G. P., Olson, D. C., George, D., and Levine, A. J. (1992). The
mdm-2 oncogene product forms a complex with the p53 protein and inhibits p53-
mediated transactivation. Cell 69, 1237-45.

Moon, A., Kim, M. S., Kim, T. 6., Kim, S. H., Kim, H. E., Chen, Y. Q., and Kim, H. R.
(2000). H-ras, but not N-ras, induces an invasive phenotype in human breast

epithelial cells: a role for MMP-2 in the H-ras-induced invasive phenotype. Int J
Cancer 85, 176-81.

Morgan, T. L., Yang, D. J., Fry, D. G., l-Iurlin, P. J., Kohler, S. K., Maher, V. M., and

McCormick, J. J. (1991). Characteristics ‘of an infinite life span diploid human

fibroblast cell strain and a near-diploid strain arising from a clone of cells expressing
a transfected v-myc oncogene. Exp Cell Res 197, 125-36.

Morin, G. B. (1989). The human telomere terminal transferase enzyme is a
ribonucleoprotein that synthesizes TTAGGG repeats. Cell 59, 521-9.

Munemitsu, S., Innis, M. A., Clark, R., McCormick, F., Ullrich, A., and Polakis, P.
(1990). Molecular cloning and expression of a G25K cDNA, the human homolog of
the yeast cell cycle gene CDC42. Mol Cell Biol 10, 5977-82.

Nelson, M. A., Futscher, B. W., Kinsella, T., Wymer, J., and Bowden, G. T. (1992).
Detection of mutant Ha- ras genes in chemically initiated mouse skin epidermis
before the development of benign tumors. Proc. Natl. Acad. Sci. U S A 89, 6398-
402.

96

Nevins, J. R. (2001). The Rb/E2F pathway and cancer. Hum Mol Genet 10, 699-703.

Nigro, J. M., Baker, S. J., Preisinger, A. C., Jessup, J. M., Hostetter, R., Cleary, K.,
Bigner, S. H., Davidson, N., Baylin, S., Devilee, P., and et al. (1989). Mutations in
the p53 gene occur in diverse human tumour types. Nature 342, 705-8.

Nimnual, A. S., Yatsula, B. A., and Bar Sagi, D. (1998). Coupling of Ras and Rac
guanosine triphosphatases through the Ras exchanger Sos. Science 279, 560-3.

Nobes, C. D., and Hall, A. (1995). Rho, rac, and cdc42 GTPases regulate the
assembly of multimolecular focal complexes associated with actin stress fibers,
lamellipodia, and filopodia. Cell 81 , 53-62.

Oliner, J. D., Kinzler, K. W., Meltzer, P. 8., George, D. L., and Vogelstein, B. (1992).
Amplification of a gene encoding a p53-associated protein in human sarcomas.
Nature 358, 80-3.

Olofsson, B. (1999). Rho guanine dissociation inhibitors: pivotal molecules in cellular
signalling. Cell Signal 11, 545-54.

Olson, M. F., Sterpetti, P., Nagata, K., Toksoz, D., and Hall, A. (1997). Distinct roles
for DH and PH domains in the Lbc oncogene. Oncogene 15, 2827-31.

Oltvai, Z. N., Milliman, C. L., and Korsmeyer, S. J. (1993). Bcl-2 heterodimerizes in
vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell
74, 609-19.

O'Reilly, 8., Walicka, M., Kohler, S. K., Dunstan, R., Maher, V. M., and McCormick,
J. J. (1998). Dose-dependent transformation of cells of human fibroblast cell strain
MSU-1.1 by cobalt-60 gamma. radiation and characterization of the transformed
cells. Radiat Res 150, 577-84.

Paciucci, R., Tora, M., Diaz, V. M., and Real, F. X. (1998). The plasminogen
activator system .in pancreas-cancer: role of t-PA in the invasive potential in vitro.
Oncogene 16, 625-633.

Pan, J. Y., and Wessling Resnick, M. (1998). GEF-mediated GDP/GTP exchange by
monomeric GTPases: a regulatory role for MgZ+? Bioessays 20, 516-21.

Park, S. H., and Weinberg, R. A. (1995). A putative effector of Ral has homology to
Rho/Rac GTPase activating proteins. Oncogene 11, 2349-55.

Patton, J. D., Rowan, L. A., Mendrala, A. L., Howell, J. N., Maher, V. M., and
McCormick, J. J. (1984). Xerodemta pigmentosum fibroblasts including cells from
XP variants are abnormally sensitive to the mutagenic and cytotoxic action of broad
spectrum simulated sunlight. Photochem Photobiol 39, 37-42.

Peltomaki, P. T. (1994). Genetic basis of hereditary nonpolyposis colorectal
carcinoma (HNPCC). Ann Med 26, 215-219.

97

Peltomaki, P. (2001). Deficient DNA mismatch repair: a common etiologic factor for
colon cancer. Hum Mol Genet 10, 735-40.

Pereira Smith, 0. M. and Smith, J. R. (1981). Expression of SV40 T antigen in finite
life-span hybrids of normal and SV40-transformed fibroblasts. Somatic Cell Genet 7,
41 1-21.

Pereira Smith, O. M., and Smith, J. R. (1983). Evidence for the recessive nature of
cellular ImmortalIty Science 221, 964-6.

Peter, M., Neiman, A. M., Park, H. 0., van Lohuizen, M., and Herskowitz, I. (1996).
Functional analysis of the interaction between the small GTP binding protein Cdc42
and the Ste20 protein kinase in yeast. EMBO J 15, 7046-59.

Polakis, P. G., Snyderman, R., and Evans, T. (1989). Characterization of 625K, a
GTP-binding protein containing a novel putative nucleotide binding domain. Biochem
Biophys Res Commun 160, 25-32.

Prendergast, G. C., Khosravi Far, R., Solski, P. A., Kurzawa, H., Lebowitz, P. F., and
Der, C. J. (1995). Critical role of Rho in cell transformation by oncogenic Ras.
Oncogene 10, 2289-96.

Preston, R. J. (1997). Telomeres, telomerase and chromosome stability. Radiat Res
147, 529-34.

Prigmore, E., Ahmed, 8., Best, A., Kozma, R., Manser, E., Segal, A. W., and Lim, L.
(1995). A 68-kDa kinase andNADPH oxidase component p67phox are targets for
Cdc42Hs and Rac1 in neutrophils. J Biol Chem 270, 10717-22.

Prober, D. A., and Edgar, B. A. (2001). Growth regulation by oncogenes—new
insights from model organisms. Curr Opin Genet Dev 11 , 19-26.

Qian, X., Vass, W. C., Papageorge, A. G, Anborgh, P. H., and Lowy, D. R. (1998). N
terminus of 8031 Ras exchange factor: critical roles for the Dbl and pleckstrin
homology domains. Mol Cell Biol 18, 771-8.

Qiu, R. G., Chen, J., Kim, D., McCormick, F., and Symons, M. (1995a). An essential
role for Rac in Ras transformation. Nature 374, 457-9.

Qiu, R. G., Chen, J., McCormick, F., and Symons, M. (1995b). A role for Rho in Ras
transformation. Proc Natl Acad Sci U S A 92, 11781-5.

Qiu, R. G., Abo, A., McCormick, F., and Symons, M. (1997). Cdc42 regulates

anchorage-independent growth and is necessary for Ras transformation. Mol Cell
Biol 17, 3449-58.

98

Quintanilla, M., BroWn, K., Ramsden, M., and Balmain, A. (1986). Carcinogen
specific mutation and amplification of Ha ras-during mouse skin carcinogenesis.
Nature 322, 78-80.

Rak, J., Mitsuhashi, Y., Bayko, L., Filmus, J., Shirasawa, S., Sasazuki, T., and
Kerbel, R. S. (1995). Mutant ras oncogenes upregulate VEGFNPF expression:
implications for induction and inhibition of tumor angiogenesis. Cancer Res 55,
4575-80.

Read, P. W., and Nakamoto, R. K. (2000). Expression and purification of
‘Rho/RhoGDI complexes. Methods Enzymol, 32515-25.

Reddy, K. B., Krueger, J. S., Kondapaka, S. B.,'and Diglio, C. A. (1999). Mitogen-
activated protein kinase (MAPK) regulates the expression of progelatinase B (MMP-
9) in breast epithelial cells. Int J Cancer 82, 268-73.

.Renan, M. J. (1993). How many mutations are required for tumorigenesis?
Implications from human cancer data. Mol. Carcinog. 7, 139-46.

Ridley, A. J., and Hall, A. (1992). The small GTP-binding protein rho regulates the
assembly of focal adhesions and actin stress fibers in response to growth factors.
Cell 70, 389-99.

Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D., and Hall, A. (1992).
The small GTP-binding protein rac regulates growth factor-induced membrane
ruffling. Cell 70, 401-10.

Ridley, A. J., Comoglio, P. M., and Hall, A. (1995). Regulation of scatter
factor/hepatocyte growth factor responses by Ras, Rao, and Rho in MDCK cells. Mol
Cell Biol 15, 1110-22.

Rivard, N., Boucher, M. J., Asselin, C., and L'Allemain, G. (1999). MAP kinase
cascade is required for p27 downregulation and S» phase entry in fibroblasts and
epithelial cells. Am J Physiol 277, C852-64.

Robbins, J. H., Kraemer, K. H., Lutzner, M. A., Festoff, B. W., and Coon, H. G.
(1974). Xeroderma pigmentosum; An inherited diseases with sun sensitivity, multiple
cutaneous neoplasms, and abnormal DNA repair. Ann Intern Med 80, 221-48.

Robinson, M. J., and Cobb, M. H. (1997). Mitogen-activated protein kinase
pathways. Curr Opin Cell Biol 9, 180-6.

Robinson, C. J., and Stringer, S. E. (2001). The splice variants of vascular
endothelial growth factor (VEGF) and their receptors. J Cell Sci 114, 853-65.

Rodriguez Viciana, P., Warne, P. H:,'Dhand, R'., Vanhaesebroeck, B., Gout, I., Fry,

M. J., Waterfield, M. D., and Downward, J. (1994). Phosphatidylinositol 3 OH kinase
as a direct target of Ras. Nature 370, 527-32.

99

Rodriguez \ficiana, P., Warne, P. H., Vanhaesebroeck, B., Waterfield, M. D., and
Downward, J. (1996). Activation of phosphoinositide 3-kinase by interaction with Ras
and by point mutation. EMBO J 15, 2442-51.

Roig, J, and Traugh, J. A. (2001). Cytostatic p21 G protein-activated protein kinase
gamma-PAK. Vitam Horm 62, 167-98. .

Roig. J., Tuazon, P. T., Zipfel, P. A., Pendergast, A. M.. and Traugh, J. A. (2000).
Functional interaction between c-Abl and the p21-activated protein kinase gamma-
PAK. Proc Natl Acad Sci U S A 97, 14346-51.

Rosse, T., Olivier, R, Monney, L.. Rager, M.. Conus, S., Fellay.|., Jansen, B, and
Bomer. C. (1998). Bel-2 prolongs cell survival after Bax-induced release of
cytochrome c. Nature 391, 496-9.

Rudel, T., Zenke, F. T., Chuang, T. H., and Bokoch, G. M. (1998). p21-activated
kinase (PAK) is required for Pas-induced JNK activation in Jurkat cells. J lmmunol
160, 7-11.

Russo, C., Gao, Y., Mancini, P., Vanni, C., Porotto, M., Falasca, M., Torrisi, M. R.,
Zheng, Y., and Eva, A. (2001). Modulation of oncogenic DBL activity by
phosphoinositol phosphate binding to pleckstrin homology domain. J Biol Chem 276,
19524-31.

Ryan, P. A, Maher. V. M, and McCormick, J. J. (1994). Failure of infinite life span
human cells from different immortality complementation groups to yield finite life
span hybrids. J Cell Physiol 159,151-60.

Santibanez Koref, M. F., Birch, J. M., Hartley, A. L., Jones, P. H., Craft. A. W., Eden,
T., Crowther, D., Kelsey, A. M., and Harris, M. (1991). p53 germline mutations in Li-
Fraumeni syndrome. Lancet 338, 1490-1.

Scheffzek, K., Stephan, l., Jensen, 0. N., lllenberger, D., and Gierschik, P. (2000).
The Rac-RhoGDl complex and the structural basis for the regulation of Rho proteins
by RhoGDI. Nat Struct Biol 7, 122-6.

Scherf, A., and Mattei, D. (1992). Cloning and characterization of chromosome
breakpoints of Plasmodium falciparum: breakage and new telomere formation
occurs frequently and randomly 'in subtelomeric genes. Nucleic Acids Res 20, 1491-
6.

Scherle, P., Behrens, T., and Staudt, L. M. (1993). Ly-GDI, a GDP-dissociation
inhibitor of the RhoA GTP-binding protein, is expressed preferentially in
lymphocytes. Proc Natl Acad Sci U S A 90. 7568-72.

Schmitz. A. A., Govek, E. E., Bottner, B., and Van Aelst, L. (2000). Rho GTPases:
signaling, migration. and invasion. Exp Cell Res 261, .1-12.

100

Schunnann. A., Mooney, A. F., Sanders, L. C., Sells, M. A., Wang, H. 6., Reed, J.
C., and Bokoch, G. M. (2000). p21-activated kinase 1 phosphorylates the death
agonist bad and protects cells from apoptosis. Mol Cell Biol 20, 453-61.

Schwab, M.. Varrnus, H. E., and Bishop, J. ,M. (1985). Human N-myc gene
contributes to neoplastic transformation of mammalian cells in culture. Nature 316,
160-2.

Sekiya, T., Prassolov, V. S., Fushimi, M., and Nishimura. S. (1985). Transforming
activity of the c-Ha-ras oncogene having two point mutations in codons 12 and 61.
Jpn J Cancer Res 76, 851-5.

Sellers, W. R., Rodgers. J. W., and Kaelin, W. G. (1995). A potent transrepression
domain in the retinoblastoma protein induces a cell cycle arrest when bound to E2F
sites. Proc Natl Acad Sci U S A 92. 11544-8.

Selvakumaran, M., Lin, H. K., Miyashita, T., Wang, H. G., Krajewski, 8., Reed, J. C.,
Hoffman, B., and Lieberrnann, D. (1994). Immediate early up-regulation of bax
expression by p53 but not TGF beta 1: a paradigm for distinct apoptotic pathways.
Oncogene 9, 1791-8.

Senger, D. R., Van de Water, L., Brown. L. F., NaQY. J. A., Yeo, K. T., Yeo, T. K.,
Berse, B.. Jackman, R. W., Dvorak, A. M.,‘ and Dvorak, H. F. (1993). Vascular
permeability factor (VPF, VEGF) in tumor biology. Cancer Metastasis Rev 12, 303-
24.

Shaw, P., Bovey. R., Tardy,S., Sahli, R., Sordat, B., and Costa, J. (1992). Induction
of apoptosis by wild-type p53 in a human colon tumor-derived cell line. Proc Natl
Acad Sci U S A 89, 4495-9.

Shay, J. W., and Wright, W. E. (1989). . .Quantitation of the frequency of
immortalization of normal human diploid fibroblasts by SV40 large T-antigen. Exp
Cell Res 184, 109-18.

Shay, J. W., Wright, W. E.. and Werbin, .H. (1991). Defining the molecular
mechanisms of human cell immortalization. Biochim. Biophys. Acta 1072. 1-7.

Shay, J. W., and Wright, W. E. (2001). Telomeres and telomerase: implications for
cancer and aging. Radiat Res 155, 188-193.

Shayesteh. L., Lu, Y., Kuo, W. L., Baldocchi, R., Godfrey, T., Collins, C., Pinkel, D.,
Powell. 8., Mills, G. B.. and Gray, J. W. (1999). PIK3CA is implicated as an
oncogene in ovarian cancer. Nat Genet 21 , 99-102.

Sherr, C. J. (1996). Cancer cell cycles. Science 274, 1672-7.

Shinjo, K., Koland, J. G., Hart, M. J., Narasimhan, V., Johnson, D. L, Evans, T., and

Cerione, R. A. (1990). Molecular cloning of the gene for the human placental GTP-
binding protein Gp (G25K): identification of this GTP-binding protein as the human

101

homolog of the yeast cell-division-cycle protein CDC42. Proc Natl Acad Sci U S A
87, 9853-7. ‘

Shiohara, M., el Deiry, W. S., Wada, M., Nakamaki, T., Takeuchi, 8., Yang. R.,
Chen, D. L., Vogelstein, B., and Koeffler, H. P. (1994). Absence of WAF1 mutations
in a variety of human malignancies. Blood 84, 3781-4.

Shippen Lentz. D., and Blackburn, E. H. (1990). Functional evidence for an RNA
template in telomerase. Science 247, 546-52.

Silbennan, S., Janulis, M., and Schultz, R. M. (1997). Characterization of
downstream Ras signals that induce alternative protease-dependent invasive
phenotypes. J Biol Chem 272, 5927-5935.

Simpson, I... and Parsons, R. (2001). PTEN: life as a tumor suppressor. Exp Cell
Res 264, 29-41.

Soker, S., Takashima, S., Miao, H. 0., Neufeld, G., and Klagsbrun, M. (1998).
Neuropilin-1 is expressed by endothelial and tumor cells as an isofonn-specific
receptor for vascular endothelial growth factor. Cell 92, 735-45.

Solomon, E., Borrow. J., and Goddard, A. D. (1991). Chromosome aberrations and
cancer. Science 254, 1153-60.

Srivastava, S., Zou. Z. 0.. Pirollo, K., Blattner, W., and Chang, E. H. (1990). Gerrn-
Iine transmission of a mutated p53 gene in a cancer-prone family with Li-Fraumenl
syndrome. Nature 348, 747-9.

Stambolic, V. Suzuki, A. dela Pompa, J. I... Brothers, G. M. Mirtsos, C, Sasaki, T.,
Ruland, J., Penninger, J. M. Siderovski, D. P. and Mak, T. W. (1998). Negative
regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell
95, 29- 39.

Steinman, R. A., Hoffman, B.. Iro, A., Guillouf, C., Lieben'nann, D. A., and el
Houseini, M. E. (1994). Induction of p21 (WAF-1ICIP1) during differentiation.
Oncogene 9. 3389-96.

Strahl, C., and Blackburn, E. H. (1996). Effects of reverse transcriptase inhibitors on
telomere length and telomerase activity in two immortalized human cell lines. Mol
Cell Biol 16, 53-65. . .

Takai, Y., Sasaki, T., and Matozaki, T. (2001). Small GTP-binding proteins. Physiol
Rev 81, 153-208.

Tang, Y., Zhou, H., Chen, A., Pittman, R. N.. and Field, J. (2000). The Akt proto-
oncogene links Ras to Pak and cell survival signals. J Biol Chem 275, 9106-9.

Taya, Y., Hosogai, K., Hirohashi, S., Shimosato. Y., Tsuchiya, R., Tsuchida, N..
Fushimi, M., Sekiya, T., and Nishimura. S. (1984). A novel combination of K-ras and

102

myc amplification accompanied by point mutational activation of K-ras in a human
lung cancer. EMBO J 3. 2943-6.

Tessler, S., Rockwell, P., Hicklin, D., Cohen, T., Levi, B. Z., Witte, L., Lemischka, I.
R., and Neufeld, G. (1994). Heparin: modulates the interaction of VEGF165 with
soluble and cell associated flk-1 receptors. J Biol Chem 269, 12456-61.

Todd, R., and Wong, D. T. (1999). Oncogenes. Anticancer Res. 19, 4729-46.

Toguchida, J., Yamaguchi, T., Dayton, S. H., Beauchamp, R. L., Herrera, G. E.,
lshizaki, K., Yamamuro, T., Meyers, P. A., Little, J. 8., Sasaki, M. S., and et al.
(1992). Prevalence and spectrum of germline mutations of the p53 gene among
patients with sarcoma. N Engl J Med 326. 1301-8.

Toker, A., and Cantley, L. C. (1997). Signalling through the lipid products of
phosphoinositide-3-OH kinase. Nature 387, 673-6.

Torres, R., Schreiber Agus, N., Morgenbesser, S. D., and DePinho, R. A. (1992).
Myc and Max: a putative transcriptional complex in search of a cellular target. Curr
' Opin Cell Biol 4, 468-74.

Tsujimoto, Y., and Croce, C. M. (1986). Analysis of the structure, transcripts, and
protein products of bcl-2, the gene involved in human follicular lymphoma. Proc Natl
Acad Sci U S A 83, 5214-8.

Tsujimura, T., Maher, V. M., Godwin, A. R., Liskay, R. M., and McCormick, J. J.
(1990). Frequency of intrachromosomal homologous recombination induced by UV
radiation in normally repairing and excision repair-deficient human cells. Proc Natl
Acad Sci U S A 87, 1566-70.

Tu, H., and Wigler, M. (1999). Genetic evidence for Pak1 autoinhibition and its
release by Cdc42. Mol Cell Biol 19, 602-11.

Tung, B. S., McGregor, W. G., Wang, Y. C., Maher, V. M., and McCormick, J. J.
(1996). Comparison of the rate of excision of major UV photoproducts in the strands
of the human HPRT gene of normal and xeroderma pigmentosum variant cells.
Mutat Res 362, 65-74.

erka, Y., Kato, K., Kuriaki, Y., Horiuchi, S., Terao, Y., Nishida, J., Ueno, H., and
Wake, N. (2000). Hepatocyte growth factor modulates motility and invasiveness of
ovarian carcinomas via Ras-mediated pathway. Br J Cancer 82, 891-9.

Umanoff, H., Edelmann, W., Pellicer, A., and Kucherlapati, R. (1995). The murine N-
ras gene is not essential for growth’and development. Proc Natl Acad Sci U S A 92,
1709-13.

Valencia, A., Chardin, P., Wittinghofer, A., and Sander, C. (1991). The ras protein

family: evolutionary tree and role of conserved amino acids. Biochemistry 30, 4637-
48.

103

Van Aelst, L., and D'Souza Schorey, C. (1997). Rho GTPases and signaling
networks. Genes Dev 11, 2295-322. .

Vanhaesebroeck, B., and Waterfield, M. D. (1999). Signaling by distinct classes of
phosphoinositide 3-kinases. Exp Cell Res 253, 239-54.

Vogelstein, B., Fearon, E. R., Hamilton, S. R., Kern, S. E., Preisinger, A. C., Leppert,
-M., Nakamura, Y., White, R., Smits, A. M., and Bos, J. L. (1988). Genetic alterations
during colorectal tumor development. N. Engl. J. Med. 319, 525-32.

Voice, J. K., Klemke, R. L., Le, A., and Jackson, J. H. (1999). Four human ras
homologs differ in their abilities to activate Raf-1, induce transformation, and
stimulate cell motility. J Biol Chem 274, 17164-70.

Vojta, 'P. J., and Barrett, J. C. (1995). Genetic analysis of cellular senescence.
Biochim Biophys Acta 1242, 29-41.

Vojtek, A. B., and Der, C. J. (1998)..Increasing complexity of the Ras signaling
pathway. J Biol Chem 273, 19925-8.

Walsh, A. B.. and Bar Sagi, D. (2001). Differential activation of the Rac pathway by
Ha-Ras and K-Ras. J Biol Chem 276, 15609-15.

Walter, B. N., Huang, 2., Jakobi, R., Tuazon, P. T., Alnemri, E. S., Litwack, G., and
Traugh, J. A. (1998). Cleavage and activation of p21-activated protein kinase
gamma-PAK by CPP32 (caspase 3). Effects of autophosphorylation on activity. J
Biol Chem 273, 28733-9.

Warrens, A. E. (1974). Letter. Burkitt's lymphoma and disordered immunoglobulin
response. Lancet 1, 742.

Webb, C. P., Taylor, G. A., Jeffers, M., Fiscella, M., Oskarsson, M.. Resau, J. H.,
and Vande Woude, G. F. (1998). Evidence for a role of Met HGF/SF during Ras
mediated tumorigenesis/metastasis. Oncogene 17, 2019-25.

Wechsler, D. S., and Dang, C. V. (1992). Opposite orientations of DNA bending by
c-Myc and Max. Proc Natl Acad Sci U S A 89, 7635-9.

Weinberg, R. A. (1995). The retinoblastoma protein and cell cycle control. Cell 81,
323-30.

Weintraub, S. J., Chow, K. N., Luo, R. X., Zhang. S. H., He, 8., and Dean, D. C.
(1995). Mechanism of active transcriptional repression by the retinoblastoma protein.
Nature 375, 812—5.

Westhick, J. K., Lambert, o. T., Clark, G. J., Symons, M., Van Aelst, L., Pestell, R.
G., and Der, C. J. (1997). Rac regulation of transformation, gene expression, and

104

actin organization by multiple, PAK-independent pathways. Mol Cell Biol 17, 1324-
35.

Whitehead, I. P., Campbell, 8., Rossman. K. L., and Der, C. J. (1997). Dbl family
proteins. Biochim Biophys Acta 1332, F1-23.

Williams, A. R., Piris, J., Spandidos, D. A., and Wyllie, A. H. (1985).
Immunohistochemical detection of the ras oncogene p21 product in an experimental
tumour and in human colorectal neoplasms. Br J Cancer 52, 687-93.

Williams, N. W., and Wynford Thomas, D. (1989). Oncoprotein p53 expression in
normal, immortalized, and transformed mouse fibroblasts. Exp Cell Res 184, 316-28.

Williams. A. C., Browne, S. J., Manning. A. M.. Hague, A., van der Stappen. J. W.,
and Paraskeva, C. (1993). Biological consequences of the genetic changes which
occur during human colorectal carcinogenesis. Semin Cancer Biol 4, 153-9.

Wilson, J. W., Pritchard, D. M., Hickman, J. A., and Potten, C. S. (1998). Radiation-
induced p53 and p21WAF-1/CIP1 expression in the murine intestinal epithelium:
apoptosis and cell cycle arrest. Am J Pathol 153, 899-909.

Wolthuis, R. M., Bauer, 8., van't Veer, L. J., de Vries Smits, A. M.. Cool, R. H.,
Spaargaren, M., Wittinghofer, A., Burgering, B. M., and Bos, J. L. (1996). RaIGDS-
like factor (le) is a novel Ras and Rap 1A-associating protein. Oncogene 13, 353-
62.

Wright, W. E., and Shay, J. W. (1992). The two-stage mechanism controlling cellular
senescence andimmortalization. Exp Gerontol 27, 383-9.

Wu. W. J., Leonard, D. A., A Cerione, R., and Manor, D. (1997). Interaction between
Cdc42Hs and RhoGDl is mediated through the Rho insert region. J Biol Chem 272,
26153-8.

Wu, W. J., Lin. R., Cerione, R. A., and Manor. D. (1998). Transformation activity of
Cdc42 requires a region unique to Rho-related proteins. J Biol Chem 273, 16655-8.

Yan. J., Roy, S., Apolloni, A., Lane, A., and Hancock, J. F. (1998). Ras isoforms vary
in their ability to activate Raf-1 and phosphoinositide 3-kinase. J Biol Chem 273,
24052-6.

Yang, D., Louden, C., Reinhold, D. S., Kohler, S. K., Maher, V. M., and McCormick,
J. J. (1992). Malignant transformation of human fibroblast cell strain MSU 1.1 by (+—
)-7 beta,8 alpha-dihydroxy-9 alpha,10 alpha-epoxy-7,8,9,10-tetrahydrobenzo
[a]pyrene. Proc. Natl. Acad. Sci. U S A 89, 2237-41.

Yin, X. M., Oltvai, Z. N., and Korsmeyer, S. J. (1994). BH1 and BH2 domains of Bcl-

2 are required for inhibition of apoptosis and heterodimerization with Bax. Nature
369, 321-3.

105

Yonish Rouach, E., Resnitzky. D., Lotem, J., Sachs, L., Kimchi, A., and Oren, M.
(1991). Wild-type p53 induces apoptosis of myeloid leukaemic cells that is inhibited
by interleukin-6. Nature 352, 345-7.

Yuspa. S. H., and Poirier, M. C. (1988). Chemical carcinogenesisztfrom animal
models to molecular models in one decade. Adv. Cancer Res. 50, 25-70.

Yuspa, S. H., Hennings, H., Roop, D., Strickland, J., and Greenhalgh, D. A. (1990).
The malignant conversion step of mouse skin carcinogenesis. Environ Health
Perspect, 88193-5.

Yuspa, S. H. (1994a). The pathogenesis of squamous cell cancer: Lessons learned
from studies of skin carcinogenesis-Thirty-third G.H.A. Clowes memorial award
lecture. Cancer Res. 54, 1178-1189.

Yuspa, S. H., Dlugosz, A. A., Cheng, C. K., Denning, M. F., Tennenbaum, T., Glick,
A. B., and Weinberg, W. C. (1994b). Role of oncogenes and tumor suppressor
genes in multistage carcinogenesis. J. Invest. Dermatol. 103, 908-958.

Zalcman. G., Dorseuil, O., Garcia Ranea, J. A., Gacon, G., and Camonis, J. (1999).
RhoGAPs and RhoGDls, (His)stories of two families. Prog Mol Subcell Biol, 2285-
113.

Zhan, 0., Fan. 8., Bae, I.. Guillouf, C., Liebermann, D. A., O'Connor. P. M., and
Fornace, A. J. (1994). Induction of bax by genotoxic stress in human cells correlates
with normal p53 status and apoptosis. Oncogene 9, 3743-51.

Zhang. J. Y., and Schultz, R. M. (1992). Fibroblasts transformed by different ras
oncogenes show dissimilar patterns of protease gene expression and regulation.
Cancer Res 52, 6682-6689.

Zhang. 8., Han, J., Sells, M. A., Chemoff, J., Knaus, U. G., UIevitch, R. J., and
Bokoch, G. M. (1995). Rho family GTPases regulate p38 mitogen-activated protein
kinase through the downstream mediator Pak1. J Biol Chem 270, 23934-6.

Zhang, B., Wang, Z. X., and Zheng, Y. (1997). Characterization of the interactions
between the small GTPase Cdc42 and its GTPase-activating proteins and putative
effectors. Comparison of kinetic properties of Cdc42 binding to the Cdc42-interactive
domains. J Biol Chem 272, 21999-2007.

Zhang, B., and Zheng, Y. (1998). Regulation of RhoA GTP hydrolysis by the
GTPase-activating proteins p190, p50RhoGAP, Bcr, and SBP-1. Biochemistry 37,
5249-57.

Zhang, B.. Zhang, Y., Collins, C. C., Johnson, D. I., and Zheng, Y. (1999). A built-in

arginine finger triggers the self-stimulatory GTPase-activating activity of rho family
GTPases. J Biol Chem 274, 2609-12.

106

Zhang, B., Zhang, Y., Wang, Z., and Zheng, Y. (2000). The role of M92+ cofactor in
the guanine nucleotide exchange and GTP hydrolysis reactions of Rho family GTP-
binding proteins. J Biol Chem 275, 25299-307.

Zheng, Y., Zangrilli, D., Cerione, R. A., and Eva, A. (1996). The pleckstrin homology
domain mediates transformation by oncogenic dbl through specific intracellular
targeting. J Biol Chem 271, 19017-20.

Zhu, K., Debreceni, B., Li, R., and Zheng, Y. (2000). Identification of Rho GTPase-
dependent sites in the Dbl homology domain of oncogenic Dbl that are required for
transformation. J Biol Chem 275. 25993-6001.

Ziman, M., Preuss, D., Mulholland, J., O'Brien, J. M., Botstein, D., and Johnson, D. l.

(1993). Subcellular localization of Cdc42p, a Saccharomyces cerevisiae GTP-
binding protein involved in the control of cell polarity. Mol Biol Cell 4, 1307-16.

107

CHAPTER 2: H-RAS-INDUCED TRANSFORMATION OF HUMAN FIBROBLASTS
IS DEPENDENT ON CDC42 AND RAC1 ACTIVITY, AS IS UP-REGULATION OF
EPAS1

108

H-RAS-induced transformation of human fibroblasts is dependent on

Cdc42 and Rac1 activity, as is up-regulation of EPAS1

1Kim-Hien T. Dao, 1Susanne Kleff, .‘Sandra O’Reilly, 1Veronica M. Maher,

and 1J. Justin McCormick

‘Carcinogenesis Laboratory, Department of Microbiology and Molecular Genetics
and Department of Biochemistry and Molecular Biology. Michigan State University,

East Lansing, Michigan 48824-1302.

109

ABSTRACT

Expression of a dominant-negative mutant Cdc42 or Rac1, or both, in human
fibroblasts malignantly transformed by oncogenic H-RAS strongly inhibited the
characteristics of such malignant cells, i.e., substantially reduced their rate bf
proliferation, markedly reduced their ability to form foci, and significantly reduced
their ability to form malignant tumors in athymic mice, indicating that these
transformed characteristics are dependent on functional Cdc42 and Rac1 signaling
pathways. Inhibiting Rac1 prevented focus formation even more effectively than
inhibiting Cdc42. Affymetrix GeneChip analysis revealed 28 genes whose
expression was regulated by oncogenic RAS and dominant-negative Cdc42 and/or
Rac1. Among the genes up-regulated by H-RAS and dependent upon functional
Cdc42 and Rac1 was EPAS1, a transcription factor for VEGF. Indeed, expression of
dominant-negative Cdc42 and Rac1 markedly reduced the level of VEGF secreted

into the growth medium.

110

INTRODUCTION

Ras proteins are small G-proteins that cycle between two forms, an active
GTP-bound state and an inactive GDP-bound state, to regulate‘cellular growth,
differentiation, and survival in response to extracellular stimuli, such as growth
factors and hormones (Grand and Owen, 1991). Intact extracellular-signal regulation
of the Ras pathways is critical for normal cellular responses and processes
(Morrison et al., 1988; Gale et al., 1993). Oncogenic mutations in the RAS genes
disrupt this important regulation, and cells that have acquired such mutations display
growth characteristics typical of cancer cells, e.g., reduced dependence on growth
factors, enhanced angiogenesis, and increased invasive and metastatic potential
(reviewed in Hanahan and Weinberg, 2000).

In approximately 30% of human tumors. the RAS gene contains an oncogenic
mutation. and the frequency is even higher in colorectal (50%) and pancreatic (90%)
cancers (Bos, 1988 and 1989). However, these figures are thought to underestimate
the contribution of aberrant Ras signaling pathways to human cancers because
there may be functional activation of Ras in the absence of a mutation in the RAS
gene itself (Hanahan and Weinberg, 2000). For example, expression of the activated
form of Raf, a mediator in the Ras/Raf/MEK/ERK pathway, is sufficient to induce
some of the growth characteristics that are associated with oncogenic H-RAS
transformation (Oldham et al., 1996). The finding that activated Raf induces only a
partial complement suggests that other Ras—stimulated pathways are required to
achieve the full oncogenic potential of H-RAS (Vojtek and Der, 1998). Several
studies show that oncogenic H-RAS transformation of rodent fibroblasts requires the
activity-of Rho GTPases, a subfamily of the Ras superfamily of small G-proteins

(Prendergast et al., 1995; Qiu et al., 1995a. 1995b, and 1997). When the

111

investigators expressed dominant-negative mutant versions of Rho GTPases to
block activity of their endogenous homologues in H-RAS-transformed rodent
fibroblasts, they found. that various H-Ras—specific growth characteristics were
significantly impaired. These data indicate that Rho GTPases act as downstream
mediators of Ras—induced transformation of rodent fibroblasts.

Rho GTPases activate effectors involved in regulating actin cytoskeleton
reorganization, transcriptional activation, and other signaling pathways (Hall, 1990
and 1998; Van Aelst. and D'Souza Schorey, 1997). Microinjection into rodent
fibroblasts of Cdc42, Rac1. 'or RhoA proteins, representing three prototype members
of the Rho subfamily, induces a sequence of morphological changes, caused by
rapid actin cytoskeleton reorganization that is consistent with a linear hierarchical
pathway, i.e., Cdc42 —> Rac1 —) Rho (Ridley and Hall, 1992; Ridley et al., 1992;
Nobes and Hall, 1995). However. this linear relationship does not hold for the other
cellular processes regulated by Rho GTPases. For example, Cdc42 and Rac1
proteins act in parallel to regulate transcription in the p38 and c-jun N-terrninal
kinase pathways (Coso et al., 1995; Minden et al., 1995), nuclear factor KB pathway
(Sulciner et al., 1996; Perona et al., 1997). and serum-responsive factor pathway
(Hill et al.. 1995). Recent studies indicate that Cdc42 and Rac1 contribute to the
malignant transformation of cells by regulating these pathways (Mackay and Hall.
1998; Van Aelst and D'Souza Schorey, 1997).

The present study shows that Cdc42 and Rac1 act as downstream mediators
of oncogenic H-RAS transformation of human fibroblasts. Expression of either the
dominant-negative Cdc42 or dominant-negative Rac1, or both mutants (Hurlin et al.,

1989), in human fibroblasts malignantly transformed by a transfected H-RAS

112

oncogene impaired several H-RAS-induced growth characteristics including rapid
cellular proliferation, focus-forming ability, and tumor formation in athymic mice.
Affymetrix GeneChip analysis of the non-tumorigenic parental cell strain, MSU-1.1,
and its H-RAS-transforrned derivative cell line expressing both dominant-negative
Cdc42 and dominant-negative Rac1 mutants, under the control of a tetracycline-
regulated promoter. was used to identify a subset of oncogenic H-RAS-induced
genes that require intact Cdc42 and Rac1 signaling pathways. A series of such
genes up-regulated or down-regulated by expression of dominant-negative Cdc42
and Rac1 mutants were identified. One such gene is EPAS1, a transcription factor
specific for genes containing the hypoxia response element in the promoter region,

such as that present in the vascular endothelial growth factor gene.

113

MATERIALS AND METHODS

Growth conditions

Unless otherwise noted, cell strains/lines were routinely grown in Eagle's
minimal essential medium supplemented with 0.2 mM L-aspartic acid, 0.2 mM L-
serine, 1.0 mM sodium pyruvate, 10% supplemented calf serum (808) (Hyclone
Laboratories), 100 units/ml penicillin, and 100 ug/ml streptomycin (defined as growth

medium) and maintained at 37°C in a humidified incubator containing 5% 002 in air.

Cell strains/lines

MSU-1.1, an infinite life span, near-diploid, chromosomally stable non-
tumorigenic cell strain. was transfected with the H-RAS oncogene (a mutant H-RAS
gene encoding constitutively active G12V-H-Ras protein), carried in a vector
designed to greatly increase expression of the oncogene (Hurlin et al., 1989).
CIonally-derived cells that appeared morphologically transformed were injected
subcutaneously into athymic mice. PH3MT is one such MSU-1.1-derived cell line

established from a tumor of an athymic mouse (Hurlin et al., 1987 and 1989).

Cell lysates and lmmunoblot analysis

Cell Iysates were prepared with a lysis buffer consisting of 50 mM Tris-HCI,
pH7.2, 150 mM NaCI. 50 mM NaF, 0.5% NP-40, 1 mM Na3V04, 200 mM
benzamidine, 1 mM PMSF, 25 uglml aprotinin, and 25 pg/ml Ieupeptin. Total protein
concentration was quantified using the Coomassie protein assay reagent (Pierce).
Proteins in the Iysates were denatured in 5X Laemelli sample buffer, separated by
either 10% or 12.5% SDS-PAGE, and transferred to PVDF membrane. The

membrane was blocked for 2 h with Tris-buffered saline containing 0.1% Tween-20

114

(T BST) and 5% (w/v) non-fat milk. Generally. the membrane was probed at room
temperature for 2 h with the primary antibody diluted in 5% milk in TBST and then
probed for 1 h with the appropriate horseradish peroxidase-linked secondary
antibody (Sigma and Santa Cruz Biotechnology) diluted in 5% milk in TBST. The
membrane was incubated with the Supersignal West Pico chemiluminescent
horseradish peroxidase substrate (Pierce) and then exposed to film to detect bands.
The sources for the antibodies were: anti-H-Ras (Santa Cruz Biotechnology), anti-
phospho-ERK1 and -ERK2 and anti-ERK1 and -ERK2 (New England Biolabs), anti-
Cdc42 and anti-Rac1 (Santa Cruz Biotechnology), anti-Flag (Sigma), anti-Myc

(Invitrogen), and anti-VEGF (Santa Cruz Biotechnology).

Stable transfection of dominant-negative mutant Cdc42 and Rac1

The original pTet-tTAk and pTet-splice vectors were obtained from Life
Technologies. This is a TET-OFF system that allows for tetracycline-regulated
expression of genes in mammalian cells. To facilitate selection of cells that have
stably integrated these vectors. a gene encoding a drug resistance protein was
cloned into each of the original vector (histidinol resistance for pTet-tTAk and
puromycin resistance for pTet-splice) as previously described (Zhang et al., 1996).
The Flag-N17Cdc42 and Myc-N17Rac1 cDNAs, obtained by PCR amplification
using PFU polymerase, were separately subcloned into the modified pTet-splice
vector. The cDNA templates used for PCR amplification were obtained from the
vector constructs pRK5-Flag-N17-Cdc42 and pcDNA3—Myc-N17-Rac1, which were
kindly provided by Dr. K. Gallo (Michigan State University, East Lansing, MI) and Dr.
G. Bokoch (Scripps Institute, La Jolla, California), respectively. The resulting pTet-

FIag-N17Cdc42 and pTet-Myc-N17Rac1 vector constructs were verified by

115

automated DNA sequencing (Visible Genetics). Lipofectamine was used to transfect
PH3MT cells with these constructs following the general strategy described by the
manufacturer (Life Technologies). Stable transfectants were selected at 1 mM
histidinol (Sigma) and 0.5 pg/ml puromycin (Sigma). Tetracycline-regulated
expression of dominant-negative FIag-N17Cdc42 and/or Myc-N17Rac1 mutants in
various cell strains was verified by immunoblot analysis using anti-Flag and anti-Myc
antibodies, respectively. Expression of the dominant-negative cDNAs was turned off
by including 1-2 uglml of tetracycline in the growth medium and turned on by

omitting tetracycline from the growth medium.

Growth assay

For each cell strain assayed, 1 x 10‘ cells were plated per 60-mm diameter
dish containing growth medium with 1 ug/ml tetracycline or lacking tetracycline (day
0). On days 1, 3, 5, and 8, cells from three replicate dishes were trypsinized and
counted to determine total number of cells per dish. Cells received fresh medium on
day 4. The time for a population of cells to double (h) was determined from growth

CU NBS.

Focus reconstruction assay

The focus reconstruction assay was performed essentially as described
(Hurlin et al., 1989). Briefly, MSU-1.1 cells were plated at a density of 5 x 10" cells
per 100-mm diameter dish containing growth medium supplemented with 0.5% SCS
and 20 mM HEPES (pH 7.4) in the presence or absence of tetracycline. On the
following day, the cells to be assayed for focus reconstruction were plated (100-200

cells per dish) in these same dishes. Cells received fresh medium every fourth day.

116

After 3 weeks of growth, the-cells were fixed with neutral buffered formalin. stained

with methylene blue. and then examined for quality and quantity of foci.

Tumorigenicity studies

The ability of cells to form tumors was tested in athymic mice (BALB/c). Cells
were injected subcutaneously into the right and left rear flanks of mice (1X106 cells
per site). The mice were provided with 5% sucrose drinking water containing 1
mglml tetracycline or lacking tetracycline. The water was replenished twice weekly.
Tumor dimensions were measured with calipers every week. Tumor volume (in cm?)
was estimated from the equation used to calculate the volume of a sphere: length X
width X height X 0.5236. Tumor latency is defined in these experiments as the time

(in days) required for a tumor to reach a volume of 0.5 cm3.

Affymetrix GeneChip expression analysis

Two independent analyses were carried out using the HU95A human genome
chips for each of these three cell strains: MSU-1.1 cells. PH3MT-DoubIe-C15 cells
assayed in medium supplemented with tetracycline (1 jig/ml), and PH3MT-Double-
C15 cells assayed in medium lacking tetracycline. PolyA+RNA was extracted from
these cells using the Micropure PolyA+RNA extraction kit following the general
instructions provided by the manufacturer (Ambion). The detailed steps to synthesize
cRNA products from 3 ug of polyA-I-RNA were followed as described in the
Affymetrix expression analysis technical manual. Personnel at the on-site Genomics
Technology Sequence Facility carried out the hybridization and washing steps, and

the probed arrays were scanned as described in the manual.

117

The average difference value is reported for each gene assayed on the chip,
and is directly proportional to transcript abundance. Two comparisons were made,
one between MSU-1.1 cells and PH3MT-DoubIe-C15 cells (+) tetracycline (to identify
genes regulated by oncogenic H-RAS) and another between PH3MT-Double-C15
cells (+) tetracycline and (-) tetracycline (to identify genes regulated by dominant-
negative Cdc42 and Rac1 mutants). For each comparison, four ratios were
calculated for each gene, i.e., C1/E1, C1/E2, C2/E1, CZ/EZ, where C and E are two
different cell strains, and 1 and 2 are two different experiments for each of the cell
strains. The average and standard deviation of these ratios were calculated.
Significant fold-differences, i.e., ratios significantly different from a value of 1, were
assessed by Student t-test, p<0.05. Calculation of an average and its standard
deviation from two independent experiments is not a valid statistical analysis. Thus,
the t values were not adjusted for the fact that two independent experiments gave
rise to four ratios and that greater than 12,000 genes were assayed simultaneously
on one chip from the same RNA sample, i.e., the analysis is not made more valid by
adjusting for the experimental design. The statistical analysis was appropriately used
only as a screening analysis to identify genes that warrant further verification by
Northern analysis. In all comparisons. if the difference of the average of the average
difference values between two samples was below an absolute value of 300, the
gene was not considered further. Four gene categories resulted from such analyses

as shown in Table 3.

Northern blot analysis

Total RNA was extracted from cell pellets using the RNAzol reagent as

described by the manufacturer. Total RNA concentration was determined by UV

118

absorbance at A260. RNA samples (20 pg of total RNA or 3 ug of polyA+RNA) were
fractionated on a denaturing formaldehyde agarose gel and transferred to
nitrocellulose membrane. The procedures were carried out as described in Short
Protocols in Molecular Biology (1992). The RNA was UV crosslinked to the
membrane (Stratagene UV Crosslinker). Freshly denatured salmon sperm DNA was
added to prehybridization and hybridization solutions immediately prior to use. In
general, prehybridization was performed at 42°C for 2-4 hrs and hybridization was
performed at 42°C for >12 hrs. The 32P-Iabeled EPAS1 DNA probe was generated
by random oligonucleotide-primed synthesis from either a 5’ 1.0 kb or a 3’ 1.3 kb
template of EPAS1 using Klenow fragment (Short Protocols in Molecular Biology,
1992). The region-specific templates were obtained by Smal digestion of pTRE-
EPAS1, a generous gift from Dr. Y. Kageyama (Tokyo Medical and Dental
University, Japan). The two different probes were used in separate Northern blot
analyses to confirm specificity of bands. Each blot was hybridized with 20X10‘5 cpm
of denatured probe. Bands were visualized and analyzed using the G5-525

phosphorimaging system (Biorad).

Electrophoretic mobility shift assay

The electrophoretic mobility shift assays (EMSA) were carried out as
described (Yoshizumi et al., 1995). Annealed double stranded (ds) oligonucleotides
containing the wildtype (WT) HIF-1 binding site (5’-
CCACAGTGCATACGTGGGCTCCAACAGGTCCTC TT-3’) or the mutant (Gibbs et
al., 1999) HIF-1 binding site (5’-
CCACAGTGCATCTCGAGGCTCCAACAGGTCCTCTT-3’) were used in the assays.

Nuclear extracts were prepared as described (Short Protocols in Molecular Biology,

119

1992). The standard 40 pl DNA binding reaction consisted of 10 pg of nuclear
extract, 200,000 cpm of 32P-Iabeled ds oligonucleotide, 4% glycerol, 1 mM MgCl2,
0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, 10 mM Tris-HCI, pH7.5, and 0.05 mglml
poly(dI-dC). The DNA binding reactions were carried out at room temperature for 30
min. then incubated on ice for 30 min. In addition to the wildtype HIF-1 32P-Iabeled
ds oligonucleotide reaction, three control reactions were performed for each sample.
Substitution of the mutant HIF—1 binding site oligonucleotide for the wildtype HlF-1
binding site oligonucleotide was the mutant reaction. Addition of a 10-fold molar
excess (2 pmol) of unlabeled wildtype HIF-1 binding site oligonucleotide in the
standard DNA binding reaction was the competition reaction. Addition of 4 pl of 0.2
mglml goat polyclonal anti-EPAS1 antibody in the DNA binding reaction after
incubation at room temperature but before incubation on ice was the supershift
reaction. Samples were fractionated under native conditions in a 5% PAGE using
0.5X TBE buffer as described (Short Protocols in Molecular Biology, 1992). The GS-

525 phosphorimager system (Biorad) was used to analyze the data.

VEGF secretion

Conditioned growth medium was harvested 24 or 48 h after changing the
regular growth medium to low-serum (0.5% SCS) growth medium ’with 1 pg/ml
tetracycline or without tetracycline. The cell lysate was collected from the same dish
of cells and quantified for total protein yield. The relative concentration (pg/ml), a
ratio of total protein (pg) to total volume of the conditioned medium (ml). was used to
normalize different samples. The volume of conditioned medium that is equivalent to
100 pg of total protein was assayed for level of VEGF splice variants by immunoblot

analysis.

120

RESULTS

PH3MT cell strains expressing dominant-negative Cdc42 and Rac1 mutants

For these studies, we used a cell line, PH3MT, derived from a malignant
tumor formed in an athymic mouse following injection of MSU-1.1 cells that had been
transformed by transfection of the H-RAS oncogene (Hurlin et al.. 1989). lmmunoblot
analysis shows that PH3MT cells express H-Ras protein at a level five times higher
than that of their parental MSU-1.1 cell strain (Figure 1a). To determine if there was
a corresponding increase in the activation of a major Res-mediated signaling
pathway. i.e., the Ras/Raf/MEK/ERK pathway, we analyzed the level of the I
phosphorylated forms of ERK1 (p44) and ERK2 (p42), which are the activated states
of these kinases, as well as the total amount of ERK1 and ERK2. There was no
difference between MSU-1.1 and PH3MT cells in the total amount of ERK1 and
ERK2, or the phosphorylated ERK1, but the level of phosphorylated ERK2 was
approximately 3 times higher in the malignant cell line than that in the parent cell
strain. Two other independent experiments showed similar results.

To determine if Cdc42 and Rac1 are required for H-Ras-induced malignant
transformation of human fibroblasts, we first generated a clonal population of cells
designated as PH3MT-C1 that expressed the tetracycline transactivator gene
(tTAK). These cells were then transfected with a vector containing an epitope-tagged
dominant-negative Cdc42 (FIag-N17-Cdc42) or an epitope-tagged dominant-
negative Rac1 (Myc-N17-Rac1), or with both vector constructs. Transcription of
genes cloned into this vector is under the regulation of the Tet promoter. A series of
clonalIy-derived cell strains were screened for tetracycline-regulated expression of

the epitope-tagged proteins. The specific cell strains chosen for use in this study

121

were designated as Flag-N17—Cdc42-C21 and -C35, Myc-N17-Rac1-C12 and -C22,
and Double-C15. The vector-control (VC) cell strains, designated as VC-C2 and -C6,
were generated using a similar strategy but the transfected vector contained no
cDNA. Tetracycline-regulated expression of dominant-negative mutant(s) was
observed (Figure 1b). At least three independent experiments showed similar
results. A major advantage of this system is that the same clonal population of cells
expressing the dominant-negative mutant(s) in the absence of tetracycline serves as
the control population for the corresponding cells in medium containing tetracycline

to suppress such expression.

122

Figure 1: PH3MT cell strains expressing dominant-negative Cdc42 andlor
Rac1 mutants. a, Immunoblot analysis of H-Ras, phospho-ERK, and total ERK level
in PH3MT cells compared with that in the non-tumorigenic, parental MSU-1.1 cells.
b, Cell strains expressing either Flag-tagged dominant-negative Cdc42 or Myc-
tagged dominant-negative Rac1, or both mutants (Double), under the regulation of
tetracycline. Expression of the mutant(s) is suppressed in the presence of
tetracycline and induced in the absence of tetracycline. Two vector-control cell
strains were also generated (VC-C2 and VC-C6). Immunoblot analysis was

performed with antibodies reactive to either the Flag or Myc epitope.

123

 

ndloI
l level
cells.

flyc-
lion cl
,ce 1

d 09“

5185

Figure 1a

H-Ras
p-ERK

ERK

MSU-1 .1 PH3MT

 

 

 

_ P44 (ERK1)
— P42 (ERK2)

 

 

 

 

_ P44 (ERK1)
-— P42 (ERK2)

 

 

124

 

one I

 

 

own I

 

 

 

..+..+..+ I+I+I+ ..+

 

m F0 NNO NFC mmo FNO 00 N0

 

2260 82-22-95. «38-2283 6.28.58;

84:22.2

«8852-8:

2:385...

8 2:9".

125

Rapid proliferation of PH3MT cells requires intact Cdc42 and Rac1 activity

Oncogenic H-RAS-transformed cells display rapid cellular proliferation in the
absence of extracellular mitogenic factors (Morrison et al., 1988; Gale et al., 1993).
To determine the importance of Cdc42 and Rac1 activity in mediating this H-RAS-
induced phenotype, we determined the doubling times of the parental cell strain
MSU-1.1, its H-RAS-transfonned derivative cell line, PH3MT, and the PH3MT-
derived cell strains that display tetracycline-regulated expression of Flag-N17-Cdc42
and/or Myc-N17-Rac1 (Table 1). Cells were assayed in growth medium containing
tetracycline or lacking tetracycline. The doubling times were determined from three
or four independent experiments. As expected, PH3MT cells grew much faster than
MSU-1.1 cells, i.e., the doubling times were 19.4 i 0.7 h and 30.0 i 0.7 h,
respectively. and tetracycline had no significant effect on their growth rates. The
doubling times of vector-control cell strains, VC-C2 and ~06, were comparable to
that of the parental cell line PH3MT. In contrast, when tetracycline was omitted from
the grthh medium of the FIag-N17-Cdc42 cells (C21 and C35) and the Myc-N17-
Rac1 cells (C12 and 022) to induce expression of the dominant-negative mutants,
their growth rates were significantly slower than that of the same cells assayed in
growth medium supplemented with tetracycline. The growth inhibitory effect of Myc-
N17-Rac1 expression was slightly greater than FIag-N17-Cdc42 expression.
Expression of both dominant-negative mutants (Double-015) caused a slightly
greater decrease in the growth rate than did either mutant expressed alone. These
results indicate that H-Ras-induced rapid cellular proliferation is dependent on intact

Cdc42 and Rac1 activity.

126

 

..dea 3.2.33.3.

.. $33.9 3.6.08.2 5.? 3.38233 8238 8. 850.6 8.8 083 m... ..o .2. 5.3 3.388 3...;
2.8.68.3. 3.3.3. 8238 2. 8.65 8.8 .o 08.. 9.333 :38 m... c. 338:. .3053..." m 33 92:.
. .8208

80.3053 32.: 5.; 33.33 33 80.6. 3.2.3 .o 363 388 88.83 ..3 6.88-8.09 .0?
.82 Ba 3.: .582. 98-... 0.8825 .3 8822.8. 2.8.8.2902

3333 35 8.3.2.3292 ..o 95.0 m .0 82.3.8. 9.26:2 338 0.8.93 5.... .o 58:. m 82..
33.353 33 9... ..oo ..EmIn. m...- dgmmmm 02m 882. 2.8 :22... 03 3-222 .8333. m m4...
.383. 83.38 .0 3.38..me 2.638."... 9.3.3. 8238 c. .0 .33933 $3.28

.0 80.38..me 05.9683. 5.? 3.380253 83.38 c. 3.33 mm; 58.» ..mo comm 238.393
83:833. 02.... .93. .a 89. 38.83.08 «33 .84.... 5.3.3.. 8336 can 88.. 9.333 :38 3......

 

.38 em... .38 «.2 38.288

.38 v. 8 .38 Pm: sumo-Pommiz
.38 N. 8 .38 2: 86-32-52
.38 0.8 .... 8 ...: ammo-NEuo-tz
.38 28 6.8 P: sac-$80-22
.~.~8 «.2 .N. 8 m? ”8.9

.38 «.8 .38 0.9 uNo-o>

2.93 :8 82$...

.38 I: .38 2: Emma

.38 Pam .38 No... 3.3:

 

zo mzmo - .3 .-.

 

“...-.0 meO - .0... At

 

.368 8:0: :. o8...d:..n=oo :3:

82:35.23 :8 .285.

 

«=3 .52.... .o 525.3 :0 20.3298 3.83:8 3332-83.88 Co «norm . _. 23...

 

127

The ability of PH3MT cells to form foci depends on Cdc42 and Rac1 activity

Human fibroblasts transformed by oncogenic H-Ras acquire the ability to form
dense foci on a confluent monolayer of non-transformed fibroblasts (Hurlin et al.,
1989). To determine the importance of Cdc42 and Rac1 activity as downstream
mediators of H-Ras—induced focus formation, the PH3MT cell line and its derivative
cell strains that display tetracycline-regulated expression 'of dominant-negative
Cdc42 and/or Rac1 mutants were compared in focus reconstruction assays. As
shown in Figure 2, MSU-1.1 cells did not form foci, whereas in the presence or
absence of tetracycline, PH3MT cells formed distinct foci on a confluent monolayer
of MSU-1.1 cells, as did the vector-control cell strain, VC-CG. Under conditions that
suppressed mutant(s) expression, i.e., when tetracycline was included in the growth
medium, the dominant-negative Cdc42 cell strains, C21 and C35, the dominant-
negative Rac1 cell strains, C12 and C22, and the double mutant cell strain, C15,
formed foci that were similar to those of the parental PH3MT and the VC-C6 cells. In
contrast, under conditions that induced mutant(s) expression, i.e., when tetracycline
was omitted from the medium, the mutant cell strains showed a reduced ability to
form dense foci. Note that the cells expressing the dominant-negative Rac1 mutant
as'well as the cells expressing ‘- both dominant-negative mutants formed foci that
were smaller and denser compared with that formed by the cells expressing the
dominant-negative Cdc42 mutant. Similar results were obtained in three independent

experiments.

128

Figure 2: Expression of dominant-negative Cdc42 and/or Rac1 mutants in

PH3MT cells inhibited focus formation. The cells being tested were plated in 100-

mm diameter dishes that contained 5x104 MSU-1.1 cells. Tetracycline was included
in the growth medium to suppress dominant-negative mutant(s) expression or
tetracycline was omitted from the growth medium to induce dominant-negative
mutant(s) expression. Focus formation on a confluent monolayer of background cells
is characteristic of transformed fibroblasts. As expected, background foci were not
observed in dishes that contained only MSU-1.1 cells. In contrast, the parental
PH3MT cells formed distinct foci after 3 weeks, as did the vector-control cell strain
(VC-C6). The ability to form foci was significantly inhibited when the cells were
assayed under growth conditions that induced mutant(s) expression compared with
that of the same cells assayed under growth conditions that suppressed mutant(s)

expression. The inhibition caused by Myc-N17-Rac1 expression was more striking.

129

 

5.82%.. E82: 02.53.2352“.
05.05950...

N 0.59".

130

Expression of dominant-negative mutant(s) in PH3MT cells inhibited tumor
formation

The effect of inhibiting Cdc42 activity, Rac1 activity, or the activity of both
small G-proteins, on the ability of PH3MT cells to form tumors was tested by
subcutaneous injection of cells into athymic mice. To modulate expression of the
dominant-negative mutant(s) in vivo, the drinking water supplied to the mice was
either sucrose water or sucrose water containing tetracycline. Expression of
dominant-negative Cdc42 and/or Rac1 mutants significantly reduced the frequency
of tumor formation and/or increased the latency of tumor growth (Table 2). These
results indicate that the malignant transformation of human fibroblasts by oncogenic

H-RAS relies, in part, on intact Cdc42 and Rac1 activity.

131

 

638.3% .9. .(z .oo_E on. .o m__m._com o... c. 3E5.
92 55o on. 8383 22:3 o3. ES. oosgflg mm; >899... .EoEB 0.9.5:. .0 389m co m. 5:99
o... 69.50. 38:. 95 cm... 90E con; .95.? c. flEu md zoom. o. .oEa. o... .o. 8.509 £60 5 mEF.

 

 

 

 

 

ONP m. _. om an? m ..o.o_o:oo-hs_n:n_
om. 9N or r 9v NNO. Foam... 53232.2“.
<2 06 o3 Qm N 90. rooms w2o>s-...:n:d
8 o: . mm on 8333.. 59:35:“.
9: o. F 9 F Qm ..NoNvoooh EusEéEmE.
om NR 02 oz won—.52...- .853...
«3:23 92:3... 5. «3:93 895.. g.
20 mzmo - .o... 3 “EC mzmo - .8. E

 

«=3 5...... .3 cog—ES 3:5. .8 5.3298 3.23:5 o>=amocécu£Eoo .o .025 . N 03..»

 

132

Identification of H-Ras targets dependent on Cdc42 and Rac1 activity

Affymetrix GeneChip analysis was carried out. to identify H-Ras targets that
are dependent on intact Cdc42 and Rac1 activity. Two independent analyses were
performed on two independent polyA+RNA samples for each of the following: 1)
MSU-1.1 cells, 2) PH3MT-Double-015 cells grown in the presence of tetracycline
(expression of dominant-negative mutants suppressed) and 3) PH3MT-Double-C15
cells grown in the absence of tetracycline (expression of dominant-negative mutants
induced). The fold—difference for each gene assayed on the HU95A chip was
determined for two comparisons. First, we identified those genes that are regulated
by oncogenic H-RAS expression by comparing the data for the MSU-1.1 cells with
that obtained for the PH3MT-Double-C15 cells grown in the presence of tetracycline.
Second, we identified those genes that are regulated by dominant-negative Cdc42
and dominant-negative Rac1 expression by comparing the data for the PH3MT-
Double-C15 cells grown in the presence of tetracycline with that obtained for the
same cells grown in the absence of tetracycline.

Twenty-eight genes displayed transcriptional regulation by both oncogenic H-
RAS and dominant-negative Cdc42 and Rac1 mutants. In table 3, these genes are
organized into four categories: 3A, the 9 genes that were up-regulated by H-RAS
and required Cdc42 and Rac1 activity for this up-regulation, 3C, the14 genes that
were down-regulated by H-RAS and required Cdc42 and Rac1 activity for this down-
regulation, 38, the genes that were up-regulated by H-RAS and down-regulated by
Cdc42 and Rac1 (none of the genes belonged in this category), and 30, the 5 genes
that were down-regulated by H-RAS and up-regulated by Cdc42 and Rac1. Thus,

~80% of these genes, 23 of 28, had expression patterns that indicate cooperative

133

regulation between H-Ras pathways and Cdc42 and Rac1 pathways. Also listed on
this table are functional categories (FC column) of the proteins encoded by the 28
genes, and fold up-regulation (positive value) or down-regulation (negative value) of
the genes resulting from expression of oncogenic H-Ras (H-RAS column) and from
expression of dominant-negative Cdc42“ and Rac1 mutants (C-R column). These
data provide another line of evidence that H-Ras acts as an upstream regulator of
Cdc42 and Rac1 pathways, especially in the pathways that lead to transcriptional

modulation of gene expression.

134

Table 3: Proteins encoded by genes up-regulated or down-regulated by l-l-RAS
that showed dependence on Cdc42 and Rac1 activity. Four categories resulted
from analyzing the microarray data from the following two comparisons, 1) MSU-1.1
versus PH3MT-Double-C15, (+) tetracycline and 2) PH3MT-Double-C15, (+)
tetracycline versus PH3MT-Double-C15, (-) tetracycline. We identified 28 genesthat
were regulated by both oncogenic H-RAS and dominant-negative Cdc42 and Rac1
mutants. Categories 3A and 30 include those genes that displayed cooperative
regulation and categories 38‘ and 30 include those genes that displayed
contradictory regulation. A majority of these genes showed cooperative regulation by
H-Ras pathways and Cdc42 and Rac1 pathways. H-RAS column, fold up-regulated
(+) or down—regulated (-) by oncogenic H-RASE expression. C-R column, fold up-
regulated (+) or down-regulated (-) by dominant-negative Cdc42 and dominant-
negativeRac1 expression. For example, EPAS1 (in category 3A) was up-regulated
by oncogenic H-RAS and down-regulated by the dominant-negative mutants. Thus,
H-RAS-induced up-regulation of EPAS1 is dependent on intact Cdc42 and Rac1
activity. FC, functional category: C, cytoskeletal and structural proteins, cell motility
and adhesion; D, DNA replication, recombination, repair; E, metabolic enzymes,
channels and transporters, lipid metabolism, nucleotide synthesis and modification; I,
immunoglobulins, MHC, immune surface antigen, complement proteins; M, mRNA
processing and translation; R, DNA structure, degradation, and processing; S,
growth factors, receptors, kinases and phosphatases, G-Fproteins; T, transcription

factors and regulators; U, unknown functiOn, ESTs, and hypothetical proteins.

135

 

0...
ad.
0...
m...
m..-

0..
9n
m.n
N.—
a.»
nd
0.0
m.
Wu
0.—
0.—
NA
0..
s...

m. w-
a...
«N.
0.0.
mi.

—.N-
0...
N0-
NN.
m...
..N-
Cd.
0...
—.n-
o...
0...
MN-
mi.
9n.

-llJ-U)‘D(Df—

-Etr.w¢nwm+-i-;.

00w

0

 

m6 mé-.. U...

...N. .28. 5.0.82.2.

to... .22. ....so... .38.... 0.8..
2:... 8.5.0...

0.592. 8.2.3.50... 5.6.0 3.-....3...
30800. N.000:0a>xoo.o>u

8:50.: .00”. 0:0 N300 >0 080.000.0060 On

. .0035. 565.5

8.. 00.0828 8.0.8»: <20...

.033 .a .22.. 8.0:... 28

82:0. 50...... 9.0:... 05580;. 502800.558 ... 2....8
000.08 5.3000 .0 30:09:00 020.000. .00. 3.0.0.350
.0:0.0->.0. 50.0.: 220.000. 3050.00.30.00: 05:00..
.0::.0.>-0. 50.0... E20300. 050500000030: 055::

x... 0:20...

...... 3:05.983... .50... 20......

7S... . 000.0 02.2

310."... 000.250. (oo....o:0.0 02.0.2.

50.0... 00.050 .:0:.0.0 000.055:

N 50.2: 0500.0 c0928

0.2.003 o 000:... £0.20 :0..-0:.:0.0 00.032002:

0203:. p00". 0:0 «0000 >0 00.030015 On

 

0..- 0.0 :
3... 0.0 :
0.0- .0 :
2. ...... »
v.0. a... ..
m..- .... w
0... 0.. 0
0... 3 0
0.0.- 0.... 0
:6 05.4. on.

0:02

3:53: '00: 0:- «0000 >0 00.03020: m”

8.803.... 58......

...—ammo. 565...:

80839... 5.65.5.

$055. — $0.90 0.0800 mg. .0..0:.o0:0

3.29%.. 50.0... 9.0:.0-<zo .09...-050

35.00. ... 0......»

..::0:0 0.00 502300.60 0.3.800

. 000:... 05.60.505.00

.502... <0 ....33 02.38:. 3380. 2.2.88.3»...272

3:50.: .001 0:0 «0000 >0 030.002.0300 (n

 

 

0.5.-.. 020035 >0 080.30.02.00 00:00

m<m-... 0.:0ao0:o >0 00.0.0080: 00:00

3.2.00 .000. 0:0 N300 :o 0050:0000 003000 .0... «<1-.. >0 00.0.:00..-:.so0 3 020.002-...- 00:0u >0 00085 0503... . n 0.00:

 

136

EPAS1 is a Ras target dependent on Cdc42 and Rac1 activity for up-regulation

Genes that are up-regulated by oncogenic H-RAS expression and require
intact Cdc42 or Rac1 activity for this up—regulation may play a causal role in the
malignant transformation of cells. We identified endothelial PAS domain protein 1
(EPAS1), a hypoxia inducible transcription factor, as one such candidate gene. The
mRNA level of EPAS1 was 2.4-fold higher in the PH3MT-Double-C15 cells grown in
medium containing tetracycline, which suppressed expression of the dominant-
negative Cdc42 and Rac1 mutants, than in the parental MSU-1.1 cells. The up-
regulation of EPAS1 by oncogenic H-RAS, however, was reversed upon induced
expression of the dominant-negative Cdc42 and Rac1 mutants by omitting
tetracycline from the growth medium. This was verified by Northern blot analysis,
which showed that EPAS1 mRNA abundance in the PH3MT-DoubIe-C15 cells
assayed in the presence of tetracycline was approximately 2-fold higher than that in
the same cells assayed in the absence of tetracycline (Figure 3a). Two independent
RNA samples were probed in several Northern blots with either a 5’ probe or 3’
probe to EPAS1 mRNA.

In response to hypoxic conditions, EPAS1 induces transcription of genes that
contain the hypoxia response element in their promoter region such as that present
in the VEGF gene (Tian et al., 1997; Xia et al., 2001). To determine if there was a
corresponding increase in DNA binding activity of EPAS1 to the hypoxia response
element, electrophoretic mobility shift assays were performed. The results (Figure
3b) show that expression of dominant-negative Cdc42 and Rac1 mutants (lanes 9
and 11) decreased DNA binding activity in these cells compared with that in the

same cells containing intact Cdc42 and Rac1 activity (lanes 3 and 5). The fold-

137

difference is approximately 1.4 to 1.6-fold. Addition of polyclonal EPAS1 antibody in
the supershift reaction decreased the band intensity but did not shift the band
probably because the antibody disrupted EPAS1 binding to the labeled
oligonucleotide (lanes 4, 6, 10, and ‘12)..The amount of VEGF splice variants
secreted into conditioned growth medium was assayed by immunoblot analysis. The
secreted level of two splice variants of VEGF, 121- and 189-amino acid forms, was
higher in the PH3MT-DoubIe-Ct5 cells assayed under growth conditions that
‘ suppressed expression of the dominant-negative Cdc42 and Rac1 mutants than in
the parental cell strain MSU-1.1 (Figure 3c, lanes 4 and 6 versus lane 2). Expression
of oncogenic H-RAS did not increase the abundance of the 165-amino acid form.
When the expression .of the dominant-negative Cdc42 and Rac1 mutants was
induced in these same cells, by omitting tetracycline from the growth medium, there
was a marked reduction of all three splice variants of VEGF in the conditioned
medium (Figure 3c, lanes 4 and 6 versus lanes 5 and 7). This experiment was

performed three times.

138

v Figure 3: EPAS1 as a Ras target dependent on Cdc42 and Rac1 activity for up-
regulation. a, Northern analysis of EPAS1-mRNA level in PH3MT-Double-C15 cells
grown in the presence (expression of mutants suppressed) or absence of
tetracycline (expression of mutants induced). Shown here is the result of probing
total RNA with a 1.0 kb probe to the 5’ region of EPAS1. Three bands were noted,
however, only the lowest band (arrow) was present in an independent probing of
polyA+RNA with a 1.3 kb probe to the 3’ region of EPASl. The size of this band is
approximately 4.0 kb, which is the expected size of EPAS1 mRNA. GAPDH was
probed as the loading control. The level of EPASl mRNA was indeed higher in cells
containing intact Cdc42 and Raclactivity than in cells with disrupted Cdc42 and
Rac1 activity. b, Electrophoretic mobility shift assay to determine EPAS1 DNA
binding activity. 32P-labeled ds oligonucleotides containing a wildtype or mutant HIF-
1 binding site were used in-these assays. EPASl DNA binding activity was higher in
PH3MT-Double-C15 cells grown in the presence of tetracycline than in the same
cells grown in the absence of tetracycline. c, Comparing amount of VEGF splice
variants secreted into conditioned growth medium by immunoblot analysis.
Conditioned medium was collected at two time. points for the PH3MT-Double-C15
cells (24and 48 h). There was a marked decrease in secretion of all three VEGF
splice variants when the dominant-negative Cdc42 and Rac1 mutants were
expressed (tetracycline absent). M, medium; 1.1, MSU-1.1; 6A, tumorigenic cell line
transformed by BPDE carcinogen. d, Oncogenic H-Ras (*) induces VEGF secretion
in a pathway requiring Cdc42- and Rac1-induced up-regulation of EPASl.
Heterodimerization of EPA81 and aryl hydrocarbon receptor nuclear translocator

(ARNT) results in a complex that activates transcription of the VEGF gene.

139

 

 

Figure 3a

PH3MT-Double—C1 5
Tetracycline + _

)

EPAS1-—> ,

GAPDH —>

 

 

 

 

140

Figure 3b

Dominant-negative

 

 

Cch2 and Rac1 SUPPRESSED INDUCED
expression
MU-HlF-1oligo + _ _ _ - _ + _ _ _ _ _
WT-HIF-1oligo -++ + ++ -+++++
UnlabeledWT-HlF1oligo - + - - - - — + _ _ _ _
Anti-EPAS1 - - - + — + - - - + -+
lane 1 2 3 4 5 6 7 3 9 1o 11 12

Free Probe—>

 

 

 

 

141

 

N. o m w m N _. 0cm—

Al 8 as
Al 8 mm:

Al 8 m2
u0m>

 

 

 

:3 :3 new new new new 1 $022.32:

1 + - + I W
m_.o-o_n:on_-._.§m_._d <0 : _>_

mc__o>om.amh

 

on 959".

142

_‘+

0.30 u0m>

 

 

  
 

 

Emocemoficm use
5255 ..oEB A

Sam .5 .mc.-u.z .me $2.. +

+

+

wwumw *0 :o:m>=om.¥m_n_

h+ moo!
aha

n.

.8 2:9“.

143

DISCUSSION

. Expression of RAS oncogenes in mammalian cells is known to cause critical
changes that are important for tumor formation and tumor progression (Hernandez
Alcoceba. et al., 2000). The results of our study indicate that Cdc42 and Rac1 activity
are required for oncogenic H-RAS malignant transformation of human fibroblasts.
This conclusion is supported by the results of our studies of the effect of inhibiting
such activity, using dominant negative mutants, on the various characteristics of
such malignantly transformed cells, including their ability to form malignant tumors in _
athymic mice (Table 2). This is the first report of such studies involving H-RAS
oncogene-transforrned human fibroblasts. In our study, inhibition of Cdc42 and/or
Rac1 activity by the dominant-negative mutant Cdc42 or dominant negative mutant
Rac1, or both, resulted in cells that had a substantially reduced rate of proliferation
(Table 1)‘, a markedly reduced ability to form foci (Figure 2), and significantly
reduced tumorigenicity (a lower frequency of tumor formation and a longer latency of
tumor growth) (Table 2). Thus, loss of Cdc42 and Rac1 activity negatively affected
each of the characteristics originally shown to be caused in these cells by
overexpression of the H-RAS oncogene (Hurlin et al., 1989).

Dominant-negative mutant studies, carried out with an infinite life span rodent
fibroblast cell line, Rat1, malignantly transformed by oncogenic H-RAS, also showed
that Cdc42 and Rac1 act as essential downstream mediators of oncogenic H-RAS
transformation (Prendergast et al., 1995; Qiu et al., 1997). Qiu et al. (1997) showed
that expression of dominant-negative mutant Cdc42 greatly reduced the frequency of
focus formation and anchorage independence, i.e., the ability of the cells to form
large colonies in semi-solid medium. It also reverted the transformed morphology of

these cells. However, the ability of the cells expressing the dominant-negative

144

mutant Cdc42 to form tumors was not investigated. Expression of dominant-negative
mutant Rac1 in these. H-RAS-transformed Rat1 cells also significantly reduced the
frequency of focus formation and anchorage independence, but unlike dominant-
negative mutant Cdc42, it failed to revert the transformed morphology of the cells.
Again, the effect of dominant-negative mutant Rac1 on the cells’ ability to form
tumors was not studied.

Expression ’of the dominant-negative Cdc42 or dominant-negative Rac1
significantly inhibited the transformed characteristics of our oncogenic H-RAS-
transformed human fibroblast cell line, but did not completely eliminate them. This
could indicate that the level of expression of each dominant-negative mutant protein
was not high enough to block all the activity of the specific endogenous protein(s), or
that the expression was high enough, but the mutant form of the protein was simply
not fully effective in inhibiting its target protein. Mackay and Hall (1998), studying
signaling pathways, suggested that Cdc42 and Rac1 activate similar signal
transduction pathways to activate transcription of genes involved in their cellular
function. If these pathways arecompletely identical, and if dominant-negative mutant
Cdo42 or Rac1 acting alone are not expressed at‘a high enough level or are not
efficient enough to shut down the pathway completely, then use of the double
dominant-negative ought to have exhibited an additive effect. This was not observed
in our studies. The additive effect of expressing both dominant-negative mutants on
oncogenic H-RAS transformation bf human fibroblasts was minimal. Our results
show that inhibition of focus formation by the dominant-negative Rac1 mutant was
much more significant than that- by the dominant-negative Cdc42 mutant (Figure 2)
and that the results of the double mutant were the same as those seen with the

dominant-negative Rac1 mutant, indicating that the dominant-negative Rac1 effect

145

predominates. These data support the hypothesis that there are one or more'rate-
limiting steps downstream of Cdc42 and Rac1.

Oncogenic RAS plays a major role in human cells becoming malignantly
transformed. Because Ras is a central signaling protein from which several
downstream signaling pathways diverge,» any number of Ras mediators could
potentially serve as targets for selective inhibition of Ras function (Bishop and Hall,
2000). Our study indicates that the pathway(s) controlled by Cdc42 and Rac1 and
their downstream effector(s) play a critical role in the downstream pathways of Ras.
Such insight may allow one to develop ways to specifically inhibit pathways that are
most important for Ras—induced malignant transformation.

Investigators. have characterized protein and gene changes induced by
specific Ras pathways in order to identify pathway-specific targets of oncogenic
RAS. The majority of these studies emphasized the contribution of the
RAF/MEK/ERK pathway. For example Lewis et al. (2000) used two-dimensional gel
electrophoresis to identify protein changes resulting from inhibition of MEK, and
Zuber et al. (2000) performed subtractive suppression hybridization to identify
transcriptional changes induced by this same pathway. To determine the global gene
expression changes induced by H-Ras signaling in a pathway-specific manner, we
used Affymetrix GeneChip analysis to identify the transcriptional changes dependent
on Cdc42 and Rac1 activity. We compared cells expressing or not expressing
oncogenic H-RAS and cells expressing oncogenic H-RAS that also expressed or did
not express both dominant-negative Cdc42 andRac1 mutants. We chose to use the
double mutant with the expectation that it would exhibit a greater inhibition of the
transcriptional pathways they control. Expression of genes regulated uniquely by

Cdc42 or Rac1, if they exist, can be determined by Northern Blot analysis of the

146

RNA of the single mutants generated in'our study. A total of 28 genes showed an
expression pattern that indicates they are regulated. by‘the activity of the Ras protein
and the Cdc42 and/or Rac1 proteins. The relative distribution of these genes in each
of the four categories shown in Table 3 suggests that for the most part, the proteins
act in a cooperative manner to regulate gene transcription.

Our data indicate that EPAS1, a newly identified member of the PAS
superfamily of basic helix-loop-helix proteins (T ian et al., 1997), is a Ras target
dependent on functional Cdc42 and Rac1 for up-regulation (Table 3). The activity of
EPAS1 was also partially dependent on Cdc42 and Rac1 activity (Figure 3b). Up-
regulation of EPAS1 by itself is unlikely to result in an equal increase in EPAS1 DNA
binding activity to HlF-1 binding sites because EPAS1 is regulated by at least two
mechanisms such as transcription and phosphorylation. This prompted us to
investigate whether the secretion of vascular endothelial growth factor, a gene that is
known to be up-regulated by EPASl and HlF-1o, is also affected by inhibiting the
activity of Cdc42 and Rac1 in cells malignantly transformed by oncogenic H-RAS.
Cdc42 and Rac1 activity may affect the amount of VEGF secreted by altering the
level of transcription of VEGF through EPAS1 or regulating the organization of the
actin cytoskeleton in secretory processes. It is well established that oncogenic RAS
induces VEGF expression and secretion (Rak et al., 1995; Feldkamp et al., 1999b).
Consistent with this is the finding that famesyltransferase inhibitors block Ras-
induced up-regulation of VEGF (Charvat et al., 1999: Feldkamp et al., 1999a; Gu et
al., 1999). The results of our study show clearly that H-Ras-induced VEGF secretion
into the medium is highly dependent on the intact activity of Cdc42 and Rac1 (Figure
3c). The successful in vivo establishment of tumors is highly dependent on the

induction of angiogenesis (Bouck et al., 1996; Hanahan and Folkman, 1996;

147

Folkman, 1997), and VEGF is known to play a major role in this process. Inhibition of
VEGF activity in tumorigenic cells, by microinjection of anti-VEGF antibodies or
expression of dominant-negative mutants, significantly impairs tumor growth (Kim et
al., 1993; Millauer et al., 1996; Folkman, 1997). In summary, investigating the
downstream effector pathways of oncogenic H-RAS, such as those pathways
involved in VEGF up-regulation, may uncover pathway-specific targets for selective

inhibition of Ras function.

148

APPENDICES

149

Appendix 1: Tet-OFF mammalian expression system. This is a two-vector
system that allows for tetracycline-regulated ~ expression of target genes in
mammalian cells (Life Technologies). Drug resistance genes were cloned into the
original vectors to facilitate selection of stable transfectants as described (Zhang et
al., 1996). In this system, both the tetracycline-regulated transactivator kozak
sequence (tTAk) and the target gene are under the regulation of the Tet promoter,
which consists of the regulatory sequences of the Tet operator (TetO) and the
human minimal CMV promoter sequences (hCMVmin). tTAK is a fusion protein
consisting of the DNA binding domains of the Tet repressor (T etR) and the VP16
activation domain. a, In the absence of tetracycline, tTAk binds to the Tet
promoter and activates transcription of itself and of the target gene. b, In the
presence of tetracycline, tTAk is bound to tetracycline, which prevents tTAk from
binding to the Tet promoter, and the expression of tTAk and the target gene is

suppressed.

150

v2...“

3o...

 

 

30...

 

”cwwnmohanuwun

 

 

 

x<._.un 0...“qu

2. ecu—5&2

151

32..

 

 

seine: ‘

 

gcwmh .........

 

 

 

 

v2.5

 

 

 

 

 

15...
9o...

mama-mocanumun—

 

 

messageese E>

 

smEonusnsgzomwmw ,

5,530: ‘

 

9.0th .........

 

 

 

 

. X

 

 

 

 

 

x<._.u.ma_;«¢un_

8 528.3.

152

Appendix 2: PH3MT cell strains with tetracycline-regulated expression of tTAk
protein. The first vector of the Tet-OFF system, pTet-tTAk, was transfected into
PH3MT cells. Histidinol-resistant cell strains were then screened for tetracycline-
regulated expression of tTAk by immunoblot analysis using an anti-VP16 polyclonal
antibody (lnvitrogen). Cell Iysates were extracted from cells grown in medium
containing 0, 0.5, or 1.0 pglml tetracycline. P, parental cell line PH3MT. Actin was
probed as the loading control. The C1 cell strain was used for subsequent

transfection of the dominant-negative Cdc42 and/or Rac1 mutants.

153

 

 

 

 

 

 

T area

2383 :9.»

T x<._....

 

 

 

 

 

 

 

 

 

F0

om

mm

 

M

2383 9.2

All v3.5

 

/_ /_ [ill I $5655.33

N 5393.?

154

Appendix 3: Focus reconstruction assay. Transformed cells have the capacity to
grow on a confluent monolayer of non-transformed cells. The focus reconstruction
assay involves plating non-transformed cells, such as MSU-1.1 cells, at a cell
density of 50,000 cells per 100-mm diameter dish. The next day, 100-200 cells that
are being tested for focus reconstruction are plated into theSe same dishes. The
growth medium is supplemented with 0.5% SCS and changed every week. After 2
or 3 weeks, foci are examined after fixing the cells with neutral buffered formalin and
staining the cells with methylene blue. In control dishes, i.e., those dishes plated

with only MSU-1.1 cells, there should be no or low background foci as shown here.

155

Appendix 3

Plate 50,000 MSU-1.1 cells

1

Plate 100-200 cells to be tested

1

Feed cells with medium containing 0.5% serum

1

Stain cells with methylene blue

/\

 

 

 

 

 

 

 

Non-transformed cells Transformed cells

 

 

 

 

156

Appendix 4: Summary of role of Cdc42 and Rac1 in oncogenic ‘l-l-RAS-
transformed rodent and human fibroblasts. Several studies established Cdc42
and Rac1 as downstream mediators of oncogenic H-RAS transformation of rodent
fibroblasts (Prendergast et al., 1995; Qiu et al., 1997). In my studies, such a role for
Cdc42 and Rac1 was investigated in a human fibrosarcoma cell line, PH3MT, which
was established from a tumor that formed in an athymic mouse following the
injection of oncogenic—H-RAS-transformed MSU-1.1 cells. The table summarizes
the effect of expressing the dominant-negative Cdc42 and/or Rac1 mutants on

growth properties characteristic of H-RAS-transformed cells (Hurlin et al., 1989).

157

 

gamma 5:023:89 mace”:

E23 $9 5:5 uoEoEmaoom E23?

82% #00 53> umEmEmaoom Eavmzm

62.525 E8586 .3 602555 4 ”manage o: .$ ”noECESou so: .02 ”E32: 9.63:
-EmEEoo .tz ”mangoes: cmEoc .... Tums. ”$3305: .8 .Smm 639905... 339: .m._.m1_z T

 

Sam
on s , oz .3 .3 as
{as E ~38
v.50; >9: 4, DZ {#4. 09A, FUNK
v.3; E. s oz L "3 ~38 F. Toms.
oz _ 3 A oz , ...3 6mm
39 .
..m .m :5 oz 3 .3 «1+ Nvovo :mm
mm?
..m .o 20 02 oz 3 02 8mm 951.2
oocoucooous ooze—Eon Ems—2
oocoompmm PEoEemtoEz... . 399.05. . 260.... .5390 . tz Pm__e0

 

3332a: :uEac ecu «coco. contoumcuofiwéi £23023
5 room one «#30 so 20.. mo meEzm . v 523%?

 

158

Appendix 5: Preparation of cRNA for Affymetrix GeneChip expression
analysis. These are the enzymatic steps involved in converting mRNA, from either
total RNA or polyA+RNA, into cRNA products for use as probes on the HU95A chip.
The steps were performed as recommended by the manufacturer. Incorporation of
oligo-dT(24)-T7 in the first strand synthesis reaction is required to generate
biotinylated cRNA products from double stranded cDNA using T7 RNA polymerase.
The cRNA products were chemically fragmented and heat denatured before use as

probes. SSIIRTase, superscript ll reverse transcriptase.

159

Appendix 5

Cells

1

Total RNA or Poly A+RNA
F lAAAAAAAA

 

 

l First Strand Synthesis

Wm

f JAAAAAAAA
—|||Illlll-T7

1 Second Strand Synthesis
— [:1 W

Illllllll-T7

l T4 DNA Pol

_AAAAAAAA
_lllllllll-T7

 

 

 

i In Vitro Transcript Labeling Reaction

 

cRNA Product

 

160

Appendix 6: Optimal time point for polyA+RNA extraction from PH3MT-
DoubIe-C15 cells in the presence or absence of tetracycline. Cells were plated
in growth medium supplemented with tetracycline. After 24 hr, the cells were
washed once with PBS and the medium was changed with fresh growth medium
containing tetracycline or lacking tetracycline (0 hr). Cell lysates were extracted at
the indicated times, and 50 ugof total protein was subjected to immunoblot analysis
using anti-Flag and anti-Myc antibodies. Actin was probed as the loading control.
The 24 hr time point (boxed) was determined to be the optimal time point to extract
polyA+RNA because there was significant induced-expression of the mutants
(tetracycline absent) without loss of regulation in the control cells (tetracycline

present) or cell death due to near-confluent growth of cells.

161

 

....i 11 so.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

. ,. . . . a so!
" __ . .. 93. w... . Tsommtzis.
, . . . . 11908223:
8 on «N 2 o o 3 on «N 2 o o EIEE
:3 -v .5555me :8 i .228
mxficonnz

.i .1 n.- P... 1.1m ark.» 121-11. km a w
W is F .. mild l . 1- %4 m1)“ a MAW n1
n1: 3 A" d M7 1“. n a .11 v

162

Appendix 7: Expression of oncogenic RAS isoforms induces VEGF secretion
into the growth medium. Six RAS-transformed human fibrosarcoma cell lines,
each expressing the mutant V12 oncoprotein of one of the RAS isoforms, were
compared with their parental cell strain MSU-1.1 for amount of VEGF secretion into
the conditioned growth medium by immunoblot analysis using an anti-VEGF
antibody. The cell lines tested included: H-RAS-2MT and -3MT (referred in paper as
MSU-1.1-T24 cell strain 2 and 3) (Hurlin et al., 1989), K-RAS-ZDT and -3DT
(referred in paper as cell strain 1 and 2) (Fry et al., 1990), and N-RAS-3T and -8T
(referred in paper as cell strain 1 and 2) (Wilson et al., 1989 and 1990). Alternative
splicing of the VEGF gene resulted in at least three splice-variants that were
detected in conditioned growth medium: 121-, 165—, and 189—amino acid forms
(Poltorak et al., 2000). All of the oncogenic RAS-transformed cell lines secreted a

much higher level of VEGF splice variants than the parental MSU-1.1 cell strain.

163

 

Appendix 7

V12-RAS isoform — H-RAS K-RAS N-RAS

 

 

 

VEGF

189 aa —-)
165 aa _)

121aa —)

 

 

 

164

REFERENCES

Short Protocols in Molecular Biology, 2nd Edition, 1992, F. M. Ausubel, R. Brent, R.
E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith and K. Struhl, eds. (New York:
Greene Publishing Associates and John Wiley & Sons).

Bishop, A. L., and Hall, A. (2000). Rho GTPases and their effector proteins. Biochem
J 1, 2241-55.

Bos, J. L. (1988). The ras gene family and human carcinogenesis. Mutat Res 195,
255-71.

Bos, J. L. (1989). ras oncogenes in human cancer: a review. Cancer Res 49, 4682-
9.

Bouck, N., Stellmach, V., and Hsu, S. C. (1996). How tumors become angiogenic.
Adv Cancer Res 69, 135-74.

Charvat, S., Duchesne, M., Parvaz, P., Chignol, M. C., Schmitt, D., and Serres, M.
(1999). The up-regulation of vascular endothelial growth factor in mutated Ha-ras

HaCaT cell lines is reduced by a farnesyl transferase inhibitor. Anticancer Res 19,
557-61.

Coso, O. A., Chiariello, M., Yu, J. C., Teramoto, H., Crespo, P., Xu, N., Miki, T., and
Gutkind, J. S. (1995). The small GTP-binding proteins Rac1 and Cdc42 regulate the
activity of the JNK/SAPK signaling pathway. Cell 81 , 1137-46.

Feldkamp, M. M., Lau, N., and Guha, A. (1999a). Growth inhibition of astrocytoma
cells by farnesyl transferase inhibitors is mediated by a combination of anti-
proliferative, pro-apoptotic and anti-angiogenic effects. Oncogene 18, 7514-26.

Feldkamp, M. M., Lau, N., Rak, J., Kerbel, R. S., and Guha, A. (1999b). Norrnoxic
and hypoxic regulation of vascular endothelial growth factor (VEGF) by astrocytoma
cells is mediated by Ras. Int J Cancer 81 , 118-24.

Folkman, J. (1997). Angiogenesis and angiogenesis inhibition: an overview. EXS 79,
1-8.

Fry, D. G., Milam, L. D., Dillberger, J. E., Maher, V. M., and McCormick, J. J. (1990).
Malignant transformation of an infinite life span human fibroblast cell strain by
transfection with v-Ki-ras. Oncogene 5, 1415-8.

Gale, N. W., Kaplan, S., Lowenstein, E. J., Schlessinger, J., and Bar Sagi, D. (1993).

Grb2 mediates the EGF-dependent activation of guanine nucleotide exchange on
Ras. Nature 363, 88-92.

165

Gibbs, B. S., Zahn, T. J., Mu, Y., Sebolt Leopold, J. S., and Gibbs, R. A. (1999).
Novel farnesol and geranylgeraniol analogues: A potential new class of anticancer
agents directed against protein prenylation. J Med Chem 42, 3800-8.

Grand, R. J., and Owen, D. (1991). The biochemistry of ras p21. Biochem J 279,
609-31.

Gu, W. Z., Tahir, S. K., Wang, Y. C., Zhang, H. C., Cherian, S. P., O'Connor, 8.,
Leal, J. A., Rosenberg, S. H., and N9, S. C. (1999). Effect of novel CAAX
peptidomimetic famesyltransferase inhibitor on angiogenesis in vitro and in vivo. Eur
J Cancer 35, 1394-401.

Hall, A. (1990). The cellular functions of small GTP-binding proteins. Science 249,
635-40.

Hall, A. (1998). Rho GTPases and the actin cytoskeleton. Science 279, 509-14.

Hanahan, D., and Folkman, J. (1996). Patterns and emerging mechanisms of the
angiogenic switch during tumorigenesis. Cell 86, 353-64.

Hanahan, D., and Weinberg, R. A. (2000). The hallmarks of cancer. Cell 100, 57-70.

Hernandez Alcoceba, R., del Peso, L., and Lacal, J. C. (2000). The Ras family of
GTPases in cancer cell invasion. Cell Mol Life Sci 57, 65-76.

Hill, C. S., Wynne, J., and Treisman, R. (1995). The Rho family GTPases RhoA,
Rac1, and CDC42Hs regulate transcriptional activation by SRF. Cell 81 , 1159-70.

Hurlin, P. J., Fry, D. G., Maher, V. M‘., and McCormick, J. J. (1987). Morphological
transformation, focus formation, and anchorage independence induced in diploid
human fibroblasts by expressionof a transfected H-ras oncogene. Cancer Res 47,
5752-7.

Hurlin, P. J., Maher, V. M., and McCormick, J. J. (1989). Malignant transformation of
human fibroblasts caused by expression of a transfected T24 HRAS oncogene. Proc
Natl Acad Sci U S A 86, 187-91.

Kim, K. J., Li, B., Winer, J., Arrnanini, M., Gillett, M, Phillips, H. 8., and Ferrara, N.
(1993). Inhibition of vascular endothelial growth factor induced angiogenesis
suppresses tumour growth in vivo. Nature 362, 841-4.

Lewis, T. 8., Hunt, J. B., Aveline, L. D., Jonscher, K. R., Louie, D. F., Yeh, J. M.,
Nahreini, T. S., Resing, K. A., and Ahn, N. G. (2000). Identification of novel MAP
kinase pathway signaling targets by functional proteomics and mass spectrometry.
Mol Cell 6, 1343-54.

Mackay, D. J., and Hall, A. (1998). Rho GTPases. J Biol Chem 273, 20685-8.

166

Millauer, B., Longhi, M. P., Plate, K. H., Shawver, L. K., Risau, W., Ullrich, A., and
Strawn, L. M. (1996). Dominant negative inhibition of Flk 1 suppresses the growth of
many tumor types in vivo. Cancer Res 56, 1615-20.

Minden, A., Lin, A., Claret, F. X., Abo, A., and Karin, M. (1995). Selective activation
of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases
Rae and Cdc42Hs. Cell 81 , 1147-57.

Morrison, D. K., Kaplan, D. R., Rapp, U., and Roberts, T. M. (1988). Signal
transduction from membrane to cytoplasm: growth factors and membrane-bound
oncogene products increase Raf-1 phosphorylation and associated protein kinase
activity. Proc Natl Acad Sci U S A 85, 8855-9.

Nobes, C. D., and Hall, A. (1995). Rho, rac, and cdc42 GTPases regulate the
assembly of multimolecular focal complexes associated with actin stress fibers,
lamellipodia, and filopodia. Cell 81 , 53-62.

Oldham, S. M., Clark, G. J., Gangarosa, L. M., Coffey, R. J., Jr., and Der, C. J.
(1996). Activation of the Raf 1/MAP kinase cascade is not sufficient for Ras
transformation of RIE 1 epithelial cells. Proc Natl Acad Sci U S A 93, 6924-8.

Perona, R., Montaner, S., Saniger, L., Sanchez Perez, l., Bravo, R., and Lacal, J. C.
(1997). Activation of the nuclear factor-kappaB by Rho, CDC42, and Rac-1 proteins.
Genes Dev 11 , 463-75.

Poltorak, Z., Cohen, T., and Neufeld, G. (2000). The VEGF splice variants:
properties, receptors, and usage for the treatment of ischemic diseases. Herz 25,
126-9. .

Prendergast, G. C., Khosravi Far, R., Solski, P. A., Kurzawa, H., Lebowitz, P. F., and
Der, C. J. (1995). Critical role of Rho in cell transformation by oncogenic Ras.
Oncogene 10, 2289-96.

Qiu, R. G., Abo, A., McCormick, F., and Symons, M. (1997). Cdc42 regulates
anchorage-independent growth and is necessary for Ras transformation. Mol Cell
Biol 17, 3449-58.

Qiu, R. G., Chen, J., Kim, D., McCormick, F., and Symons, M. (1995a). An essential
role for Rac in Ras transformation. Nature 374, 457-9.

Qiu, R. G., Chen, J., McCormick, F., and Symons, M. (1995b). A role for Rho in Ras
transformation. Proc Natl Acad Sci U S A 92, 11781-5.

Rak, J., Mitsuhashi, Y., Bayko, L., Filmus, J., Shirasawa, S., Sasazuki, T., and
Kerbel, R. S. (1995). Mutant ras oncogenes upregulate VEGFNPF expression:
implications for induction and inhibition of tumor angiogenesis. Cancer Res 55,
4575-80.

167

Ridley, A. J., and Hall, A. (1992). The small GTP-binding protein rho regulates the
assembly of focal adhesions and actin stress fibers in response to growth factors.
Cell 70, 389—99.

Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D., and Hall, A. (1992).
The small GTP-binding protein rac regulates growth factor-induced membrane
ruffiing. Cell 70, 401-10.

Sulciner, D. J., Irani, K., Yu, 2. X., Ferrans, V. J., Goldschmidt Clerrnont, P., and
Finkel, T. (1996). rac1 regulates a cytokine-stimulated, redox-dependent pathway
necessary for NF-kappaB activation. Mol Cell Biol 16, 7115-21.

Tian, H., McKnight, S. L., and Russell, D. W. (1997). Endothelial PAS domain protein
1 (EPAS1), a transcription factor selectively expressed in endothelial cells. Genes
Dev 11, 72-82.

Van Aelst, L., and D'Souza Schorey, C. (1997). Rho GTPases and signaling
networks. Genes Dev 11, 2295-322.

Vojtek, A. B., and Der, C. J. (1998). Increasing complexity of the Ras signaling
pathway. J Biol Chem 273, 19925—8.

Wilson, D. M., Fry, D. G., Maher, V. M., and McCormick, J. J. (1989). Transformation
of diploid human fibroblasts by transfection of N-ras-oncogenes. Carcinogenesis 10,
635-40.

Wilson, D. M., Yang, D. J., Dillberger, J. E., Dietrich, S. E., Maher, V. M., and
McCormick, J. J. (1990). Malignant transformation of human fibroblasts by a
transfected N-ras oncogene. Cancer Res 50, 5587-93.

Xia, G., Kageyama, Y., Hayashi, T., Kawakami, S., Yoshida, M, and Kihara, K.
(2001). Regulation of vascular endothelial growth factor transcription by endothelial
PAS domain protein 1 (EPAS1) and possible involvement of EPAS1 in the
angiogenesis of renal cell carcinoma. Cancer 91, 1429-36.

Yoshizumi, M., Hsieh, C. M., Zhou, F., Tsai, J. C., Patterson, C., Perrella, M. A., and
Lee, M. E. (1995). The ATP site mediates downregulation of the cyclin A gene during
contact inhibition in vascular endothelial cells. Mol Cell Biol 15, 3266-72.

Zhang, H., Tsujimura, T., Bhattacharyya, N. P., Maher, V. M., and McCormick, J. J.
(1996). O6-methylguanine induces intrachromosomal homologous recombination in
human cells. Carcinogenesis 17,2229-35.

Zuber, J., Tchernitsa, O. l., Hinzmann, B., Schmitz, A. C., Grips, M., Hellriegel, M.,

Sers, C., Rosenthal, A., and Schafer, R. (2000). A genome-wide survey of RAS
transformation targets. Nat Genet 24, 144-52.

168

APPENDIX A: INVESTIGATING THE CONTRIBUTION OF ENDOGENOUS,
HYPERACTIVE CDC42 AND RAC1 TO THE MALIGNANT TRANSFORMATION
OF HUMAN FIBROBLASTS

169

ABSTRACT

The activity of the Rho GTPases is required for malignant transformation of
cells by oncogenic mutants of RAS and oncogenic derivatives of guanine nucleotide
exchange factors. However, the role of endogenous, hyperactive Cdc42 and Rac1
activity in the maintenance of growth properties characteristic of human
fibrosarcomas has not been investigated. To determine this role, dominant-negative
Cdc42 and Rac1 mutants were expressed in L210-6A/SB1 cells, a cell line derived
from the tumor of an athymic mouse following subcutaneous injection of MSU-1.1
cells that displayed morphological transformation by BPDE carcinogen treatment.
This cell line was chosen because it has an elevated level of GTP-bound Cdc42 and
Rac1 as determined by an affinity-precipitation assay. The L210-6AISB1 cells were
infected with retroviruses carrying the cDNA(s) encoding either B-galactosidase,
dominant-negative Cdc42, dominant-negative Rac1, or both mutants, followed by
selection with puromycin, the selectable marker. Three cell populations were
generated for each of these protein(s), and the cells have been injected
subcutaneously into athymic mice to investigate the effect of dominant-negative
mutant(s) expression on the ability of L210-6A/SB1 cells lacking hyperactive Cdc42
and/or Rac1 to form tumors in athymic mice. Clonally-derived populations
expressing either a low or high level of these protein(s) were also generated to test

directly the effect of dominant-negative mutant(s) expression.

170

INTRODUCTION

The Rho subfamily belongs to the Ras superfamily of small guanine-
nucleotide binding proteins (Hall, 1990 and 1992b). RhoA, Cdc42, and Rac1 are
three main members of this subfamily, and they each have multiple isoforms that
differ in their tissue-specific expression pattern. They were originally identified by
their biochemical and structural similarities to the prototype Ras protein. However,
the Rho GTPases regulate diverse cellular processes, including actin cytoskeleton
reorganization, transcriptional activation pathways, cell cycle progression, cell
differentiation, survival and apoptosis pathways, and membrane trafficking (Van
Aelst and D'Souza Schorey, 1997; Takai et al., 2001). Cdc42 and Rac1 act in
parallel in several pathways, such as the p38, c-jun N-terrninal kinase (Coso et al.,
1995; Minden et al., 1995), nuclear factor x B (Sulciner et al., 1996; Perona et al.,
1997), and serum response factor pathways (Hill et al., 1995), to regulate
transcription of genes.

Like all guanine-nucleotide binding proteins, Cdc42 and Rac1 cycle between
active, GTP-bound states and inactive, GDP-bound states. In their active GTP-
bound states, Cdc42 and Rac1 activate effector proteins that are involved in carrying
out their cellular functions. GTPase-activating proteins stimulate Cdc42 and Rac1
conversion from their active states to their inactive states by enhancing the intrinsic
GTP hydrolysis rates. The guanine-nucleotide dissociation inhibitors and the
guanine-nucleotide exchange factors are two other families of proteins that regulate
the activity of Cdc42 and Rac1 by increasing and decreasing the affinity for GDP,

respectively.

171

Several lines of evidence suggest the involvement of Cdc42 and Rac1 in the
malignant transformation of cells. First, although expression of constitutively active
Cdc42 or Rac1 mutants in rodent fibroblasts only weakly transforms these cells
(Hall, 1990 and 1992b), the guanine-nucleotide exchange factors, the positive
regulators of Cdc42 and Rac1, are fully oncogenic when expressed as truncated
derivatives in certain cell types (Cerione and Zheng, 1996). Second, several studies
show that the Rho GTPases are required for malignant transformation of rodent
fibroblasts by oncogenic H-RAS (Prendergast et al., 1995; Qiu et al., 1995a, 1995b,
and 1997). For example, when dominant-negative Rho GTPases were expressed in
rodent fibroblasts malignantly transformed by oncogenic H-RAS, investigators found
impaired ability of the cells to exhibit growth factor independence, anchorage
independence, focus formation, and tumorigenicity in athymic mice. These studies
indicate that Cdc42 and Rac1 act downstream of H-RAS. Third, Mira et al. (2000)
show that highly proliferative breast carcinoma cell lines have endogenous,
hyperactive Rac3 protein. They also show that this phenotype is dependent on
activation of p21-activated kinase. The role of Cdc42 and Rac1 in maintenance of
transformed characteristics of human fibrosarcomas has not been investigated.
L210-6A/SB1 is a human fibrosarcoma cell line that has hyperactive Cdc42 and
Rac1 proteins. These cells were infected with retroviruses carrying cDNA(s)
encoding the dominant-negative Cdc42 and/or dominant-negative Rac1 to inhibit
endogenous activity of target protein(s). The effect of inhibiting the protein(s) on the

ability of L210-6A/SB1 cells to form tumors in athymic mice is being examined.

172

MATERIALS AND METHODS

Growth conditions

Unless othenrvise noted, cell strains/lines were routinely grown in Eagle's
minimal essential medium (Life Technologies), supplemented with 0.2 mM L-aspartic
acid, 0.2 mM L-serine, 1.0 mM sodium pyruvate, 10% supplemented calf serum
(SCS) (Hyclone Laboratories), 100 units/ml penicillin (Sigma), and 100 ug/ml
streptomycin (sigma) (growth medium) and maintained at 37°C in a humidified
incubator containing 5% CO; in air. The growth medium was supplemented with 0.5

uglml puromycin (Sigma) when cells were selected for the resistance marker.

Cell strains/lines

MSU-1.1, an infinite life span, near-diploid, chromosomally stable non-
tumorigenic human fibroblast cell strain (Morgan et al., 1991), was treated with a
reactive derivative of benzo[a]pyrene. Cells that formed foci were isolated and
injected subcutaneously into athymic mice. L210-6A/SB1 is one such MSU-1.1-
derived cell line established from a tumor of an athymic mouse (L. Milam,
unpublished data). Three other MSU-1.1-derived fibrosarcoma cell lines used in this
study were similarly established from tumors formed in athymic mice but were
transformed by treatment with ethylnitrosourea (MSU-1.1-E32, unpublished studies),
irradiation with cobalt-60 (MSU-1.1-y3-A2) (O'Reilly et al., 1998), or expression of H-

RAS (PH3MT) (Hurlin et al., 1989).

Cell Iysates and lmmunoblot analysis

Cell Iysates were prepared with 50 mM Tris-HCI, pH 7.2, 150 mM NaCl, 50

mM NaF, 0.5% NP-40, 1 mM Na3VO4, 200 mM benzamidine, 1 mM

173

phenylmethylsulfonyl fluoride, 25 ug/ml aprotinin, and 25 ug/ml Ieupeptin. Total
protein concentration was quantified using the Coomassie protein assay reagent
(Pierce). Proteins in the Iysates were denatured in 5X Laemelli sample buffer at
95°C for 5 min., separated by either 10% or 12.5% SDS-PAGE, and transferred to
lmmobilion-P membrane (Millipore). The membrane was blocked for 2 h with Tris-
buffered saline containing 0.1% Tween-20 and 5% (w/v) non-fat milk. The
membrane was probed at room temperature for 2 h with the primary antibody diluted
in 5% milk in Tris-buffered saline containing 0.1% Tween-20 then probed for 1 h with
the appropriate horseradish peroxidase-linked secondary antibody (Sigma and
Santa Cruz Biotechnology) diluted in 5% milk in Tris-buffered saline containing 0.1%
Tween-20. The membrane was incubated with the Supersignal West Pico
chemiluminescent horseradish peroxidase substrate (Pierce) and exposed to film to
detect bands. The sources for the antibodies used in these studies were: anti-H-Ras
(Santa Cruz Biotechnology), anti-phospho-ERK1 and -ERK2 and anti-ERK1 and -
ERK2 (New England Biolabs), anti-Cdc42 and anti-Rac1 (Santa Cruz

Biotechnology), anti-Flag (Sigma), anti-Myc (Invitrogen), and anti-V5 (lnvitrogen).

GIutathione-S-transferase-p21-binding domain pull-down assay

The use of the glutathione-S-transferase-QZ1-binding domain (GST—PBD) as
a strategy for affinity-precipitation of GTP-bound forms of Cdc42 and Rac1 was
recently described (Benard et al., 1999). The cDNA sequence encoding amino acids
67-150 of the p21-activated kinase 1 was obtained by RT-PCR amplification, using
primers that annealed to gene-specific sequences and contained convenient
restriction enzyme sites for cloning into pGEX-KG (Pharrnacia). The sequence

integrity of the vector construct was verified by automated DNA sequencing (Visible

174

Genetics). The pGEX-KG-PBD construct was transformed into Escherichia coli
BL21 (DE3) cells (Promega). Large cultures of bacteria were grown at 37°C with
shaking to a cell density of approximately O.D. 600nm of 0.8. Cultures were then
transferred to a shaker at room temperature and isopropyl-1-thio-B-D-
galactopyranoside (5 mM final concentration) was added to induce GST-PBD
expression, which is under the regulation of a LACZ promoter. GST-PBD fusion
protein was batch-purified from bacteria cells using glutathione-agarose (Sigma).
The GST-PBD assay conditions were carried out as described (Benard et al., 1999).
Two reactions were carried out for each cell strain/line: the unloaded reaction was
assayed for level of GTP-bound Cdc42 and Rac1 and the loaded reaction was
performed as a control after artificially stimulating exchange with 10 mM EDTA in the
presence of 100 pM GTPyS. For each cell strain/line, 250 pg of total protein was
assayed in a standard reaction, and for protein amounts greater than 250 pg, the

standard reaction was scaled-up accordingly.

Retroviral infection of cells with dominant-negative Cdc42 and Rac1 cDNAs

The cDNA of V5-eptiope-tagged B-galactosidase, fi;galactosidase-V5, Flag-
epitope-tagged dominant-negative Cdc42 mutant, Flag-N17-Cdc42, and Myc-
epitope-tagged dominant-negative Rac1 mutant, Myc-N17-Rac1, were separately
cloned into the pBABE-puro vector. The cDNA encoding a puromycin resistance
protein was cloned into the original pBABE vector as a selectable marker for stable
transfectants (H. Zhang, unpublished results). Lipofectamine was used to transfect
these vector constructs into Phoenix-ampho cells using the general strategy
provided by the manufacturer (Life Technologies). Virus-containing medium was

harvested 72 hr post-transfection. After spinning cellular debris down at 1500 rpm

175

for 5 min., the viral supernatant was transferred to a fresh conical tube and sterilized
by 0.2 pm filtration. Polybrene was added to an aliquoted amount of viral
supernatant to a final concentration of 4 uglml. This mixture was then added to
dishes containing cells that were plated the day before. For every dish from which
the viral supernatant was obtained, three equivalent dishes of cells plated at 40-60%
confluence were infected. After 48 hr incubation with viral supernatant, cells were

selected with puromycin or lysed for whole cell lysate.

Tumorigenicity studies

The ability of cells to form tumors was tested in athymic mice (BALB/c). Cells
were injected subcutaneously into the right and left rear flanks of mice (1X10° cells
per site). Tumor dimensions were measured with calipers every week. The tumor
volume (in cm3) was estimated from the equation used to calculate the volume of a
sphere: length X width X height X 0.5236. Tumor latency is defined in these

experiments as the time in days required for a tumor to reach a volume of 0.5 cm3.

176

RESULTS

Identifying fibrosarcoma cell lines that exhibit increased Cdc42 and Rac1
activity

A series of cell strains/lines of the MSU1 cell lineage were assayed for their
level of GTP-bound Cdc42 and Rac1 proteins using a GST-PBD pull-down assay
(Figure 1). The loaded reaction (+) served as a control to determine if the proteins
could be detected if exchange was stimulated by the addition of EDTA in the
presence of GTPyS, a non-hydrolyzable GTP analog. The unloaded reaction (-)
assayed endogenous GTP—bound level of Cdc42 and Rac1. The results are shown
in Figure 2. GTPyS-Cdc42 was detected in all “cell lines tested whereas GTPyS-
Rac1 was detected only in the L210-6A/SB1 cell line (6A). LG1, a normal human
fibroblast, and its two non-tumorigenic, derivative'cell strains, MSU-1.0 and MSU-
1.1, exhibited a very low level of both GTP-boUnd Cdc42 and Rac1 in the unloaded
reaction, as did three of the four MSU-1.1-derived fibrosarcoma cell lines tested
(E32, 3A2, and 3MT). The strategy that was used to establish these fibrosarcoma
cell lines is described in the materials and methods section. The L210-6AISB1 cell
line displayed a very high level of GTP-bound Cdc42 and Rac1. To quantify this
result, the L210-6A/SB1 cell line and its parental cell strain MSU-1.1 were assayed
in at least three independent experiments. The results were similar to that shown in
Figure 3. The level of GTP-bound Cdc42 was on average 5-fold higher in L210-
6A/SB1 cells compared with that in MSU-1.1 cells. The fold-increase in the level of
GTP-bound Rac1 could not be determined because the reference MSU-1.1 cells did

not have a detectable level of GTP-bound Rac1.

177

Figure 1: GST-PBD pull-down assay of GTP-bound Cdc42 and Rac1 proteins.
GIutathione-S-transferase-pz1-binding domain (GST—PBD) is a fusion protein that
was purified from bacteria cells transformed with pGEX-KG-GST—PBD. PBD is a
domain in p21-activated kinase that is necessary and sufficient for binding to active,
GTP-bound forms of Cdc42 and Rac1. The activity level of Cdc42 and Rac1 in cells
is assayed by incubating cell Iysates with GST—PBD and glutathione agarose,
followed by several washes and immunoblot analysis (using anti-Cdc42 and anti-

Rac1 antibodies) (Benard et al., 1999).

178

 

Figure 1

 

....... W GST IJPBDI _I----------

1

 

+
Cell Iysate

1:}

Glutathione- agarose

 

 

Western analysis
anti-Cdc42 or anti-Rac1 Antibody

 

 

 

179

Figure 2: Level of GTP-bound Cdc42 and Rac1 proteins in cell strains/lines of
the MSU1 cell lineage. The GST—PBD pull—down assay was carried out with cell
Iysates from LG1, a normal human fibroblast cell line, its non-tumorigenic derivative
cell strains, MSU-1.0 and MSU-1.1, and four MSU-1.1-derived fibrosarcoma cell
lines. Colleagues in this laboratory generated the fibrosarcoma cell lines by
' transforming MSU-1.1 cells by carcinogen treatment or oncogene expression
including ENU (E32); BPDE (6A), y-irradiation (3A2), and oncogenic H-RAS (3MT).
Two reactions were set-up for each cell strain/line: a loaded reaction (EDTA and
GTPyS included in the cell lysate) and “an unloaded reaction. The latter reaction
assays for the endogenous level'of GTP-bound Cdc42 and Rac1 proteins. As
expected, there was a low level of activated Cdc42 and Rac1 proteins in all the cell
strains/lines tested except in the L210-6A/SB1 (6A) cell line. This cell line had a high
level of such proteins. Furthermore, the Rac1 protein was loaded in this cell line

whereas it was not loaded in all the other cell strains/lines tested.

180

 

Figure 2

GTPyS

Cdc42 —z

LG11.0 1.1 E32 6A 3A2 3MT

 

—+—+ —+—+—+—+—+

 

 

.r..._ "‘I
i‘ . . . ... -
.... a
'

 

 

Rac1 —+-

 

 

181

 

 

Figure 3: Endogenous, hyperactive Cdc42 and Rac1 proteins in L210-6AISB1
cells compared with that in its parental cell strain MSU-1.1. The level of active,
GTP-bound Cdc42 and Rac1 was determined-by the GST—pull—down assay. L210-
6A/SB1 (6A) cells have a 5-fold higher level of GTP-bound Cdc42 than that in MSU-
1.1 cells (1.1). The fold-increase in the level of GTP-bound Rac1 could not be
determined because this form was undetectable in MSU-1.1 cells. The experiment

was repeated several times to quantify the fold-increase.

182

 

Figure 3

1.1 6A
GTPyS "' + "" +

 

 

 

 

 

1.1 BA
GTPyS "' + — +

 

 

Rac1 —>

 

 

 

 

 

183

Level of H-Ras, p-ERK1I2, and ERK1/2 in MSU-1.1 and L210-6AISB1 cells

The level of H-Ras, p-ERK, and ERK in MSU-1.1 and L210-6A/SB1 cells was
determined by immunoblot analysis. The results in Figure 4 are similar to that
obtained in two other experiments. An increase in H-Ras protein level could account
for some of the activation of Cdc42 and Rac1 in L210-6AISB1 cells. The level of H-
Ras was 2-fold higher in L210-6AISB1 cells than that in MSU-1.1 cells (top panel).
However, there was not a corresponding increase in phospho-ERK level, which is
the activated form of the kinase (middle panel). Total ERK level was similar between
MSU-1.1 and L210-6A/SB1 cells, but the p42-ERK2 protein in L210-6A/SB1 cells ran
slightly faster, suggesting that there was a difference in. post-translational
modification of the protein (bottom panel). It is not clear whether this increased level

of H-Ras is sufficient to activate Cdc42 and Rac1.

184

Figure 4: Comparing level of H-Ras, p-ERK, and ERK in MSU-1.1 and L210-
6AISB1 cells. A2-fold increase in H-Ras protein level was observed in L210-
6AISB1 (6A) cells compared with that in MSU-1.1 cells (1.1). Activity of the
Raisaf/MEK/ERK pathway was also determined by immunoblot. analysis.
Phosphorylated ERK1 and ERK2.are activated forms of the‘kinases and their level in
cells should reflect activity of the pathway. Two forms of ERK were detected, a 44
kD ERK1 and a 42 kD ERK2. Although L210-6A/SB1 cells had a higher level of H-
Ras protein than that in MSU-1.1 cells, there was not a corresponding increase in
amount of phospho-ERK1 or -ERK2 in L210-6A/SB1 cells. As expected, the total
amount of ERK, i.e., phosphorylated and unphosphorylated, is the same for both

these cells.

185

 

211-

 

Figure 4

H-Ras

p-ERK

ERK

1.1 6A

 

 

 

 

 

 

 

 

_p42

 

 

186

L210-6AISB1 cells expressing dominant-negative Cdc42 or Rac1 mutants

To test the importance of Cdc42 and Rac1 activity in malignant
transforrnation of L210-6A/SB1 cells, these cells were infected with retroviruses
carrying the cDNA-that encodes either dominant-negative Cdc42 (Flag-N17-Cdc42)
or dominant-negative Rac1 (Myc-N17-Rac1) mutant. As a control population, L210-
6A/SB1 cells were infected with retroviruses carrying the cDNA that encodes B-
galactosidase. lmmunoblot analysis of such population of cells is shown in Figure 5.
Similar results were obtained in another experiment. The retroviral vector containing
the cDNA has a puromycin resistance gene as the selectable marker. Puromycin-
resistant cells infected with retroviruses carrying the cDNA that encodes B-
galactosidase were stained for such expression to evaluate efficiency of retroviral
infection and stable integration of target gene. Approximately 50% of the cells
stained light to dark blue, indicating that cells in the population expressed various
levels of B—galactosidase (Figure 5, inset of L2 population). Since the same retroviral
vector was used for infection of dominant-negative Cdc42 and Rac1 mutants, it is
assumed that expression of these proteins follows a similar pattern to that of the B-
galactosidase papulations. All of these cell populations have been injected
subcutaneously into athymic mice. Tumors will be removed and tumor-derived cells
will be tested for expression level of epitope-tagged dominant-negative mutant(s)
and compared with the same population of cells that were not injected into athymic
mice. If there is an in vivo selection against expression of dominant-negative Cdc42
and/or Rac1 mutants, then the tumor-derived cells should have a low level of

mutant(s) expression. This experiment will provide evidence for or against the

187

hypothesis that activated Cdc42 and Rac1 proteins in L210-6A/SB1 cells play a
causal role in malignant transformation of these cells.

ClonaIIy—derived cells from the L210-6AISB1 cell populations shown in Figure
5 were assayed for level of expression of B-galactosidase, dominant-negative
Cdc42, dominant-negative Rac1, or both mutants, by immunoblot analysis (data not
shown). The analysis was repeated before combining relatively low (L) or high (H)
expressors from each of the cell population type generated (Figure 6). The double
mutant (CR) is a single cell strain that displayed an intermediate expression level of
both Flag-N17-Cdc42 and Myc-N17-Rac1. The clonal populations provide a more
direct approach of investigating effect of Cdc42 and Rac1 inhibition on ability of

L210-6A/SB1 cells to form tumors in athymic mice.

188

Figure 5: Cell populations of L210-6A/SB1 that express B-galactosidase,
dominant-negative Cdc42, dominant-negative Rac1, or both mutants. Cell
populations were generated by infecting L210-6AISB1 cells. with retroviruses
carrying the cDNA encoding either B-galactosidase, dominant-negative Flag-N17-
Cdc42, dominant-negative Myc-N17-Rac1, or both mutants, followed by selection
with puromycin. Three independent cell populations were established for each of
these. Within each cell population, the cells express various levels of protein(s) as
demonstrated by B-galactosidase staining of cells from the L2 population. Overall
expression level of these protein(s) in the cell populations was determined by
immunoblot analysis using anti-Flag or anti-Myc antibody. B-galactosidase-
expressing cell populations were generated as control cell- populations. Actin was
probed as a loading control. L, LacZ; C, Flag-N17-Cdc42, R, Myc-N17-Rac1; CR,

double mutant.

189

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

All czom

1| P842222
1| N88528:.

.m 0.59".

190

Figure 6: Clonal populations of L210-6AISB1 that express a low or high level
of B-galactosidase, dominant-negative Cdc42, dominant-negative Rac1, or both
mutants. Clonally-derived cells from the cell populations shown in Figure 5 were
screened by immunoblot analysis for expression level of Iii-galactosidase, dominant-
negative Flag-N17-Cdc42, dominant-negative Myc-N17-Rac1, or both mutants,
using anti-V5, anti-Flag, or anti-Myc antibody (data not shown). Individual cell
strains that expressed either a low or high level of the specific protein were
combined to form low- and high-expressing clonal populations except in the case of
the double dominant-negative mutant. LL, B—galactosidase, low expressors; LH, B—
galactosidase, high expressors; CL, Flag-N17-Cdc42, low expressors; CH, Flag-
N17-Cdc42, high expressors; RL, Myc-N17-Rac1, low expressors; RH, Myc-N17-
Rac1, high expressors; CR, a single clonally—derived cell strain that expressed an
intermediate level of both mutants. The gel did not resolve Flag-N17-Cdc42 and
Myc-N17-Rac1 proteins in this experiment. Top panel is a short exposure whereas

bottom panel is a long exposure.

191

 

 

Figure 6

LL LH CL CH RL RH CR

 

Flag-N17-Cdc42 ——>
Myc-N17-Rac1 —* - . ‘. -

 

 

Flag-N17-Cdc42 —>
Myc-N17-Rac1 —'*

 

 

 

 

192

DISCUSSION

The malignant transformation of cells by expression of oncogenic mutants of
RAS (Prendergast et al., 1995; Qiu et al., 1995a, 1995b, and 1997) or oncogenic
derivatives of GEFs (Cerione and Zheng, 1996) is dependent on Cdc42 and Rac1
activity. However, the contribution of endogenous, hyperactive Cdc42 and Rac1 to
such transformation has not been studied. In this study, a MSU-1.1-derived
fibrosarcoma cell line, L210-6AISB1, which was transformed by a reactive derivative
of benzo[a]pyrene (L. Milam, unpublished studies), was found to express a much
higher level of GTP-bound Cdc42 and Rac1 than that in its parental cell strain
(Figures 2 and 3). It is highly unlikely that a single treatment of MSU-1.1 cells with a
chemical carcinogen for 1 hr resulted in two independent activating mutations in the
CDC42 and RAC1 genes. Furthermore, a recent analysis showed that the level of
GTP-bound Rac3 is also elevated in L210-6A/SB1 cells (D. Appledorn, unpublished
data). Since these are three related proteins found in their hyperactive states in
L210-6A/SB1 cells, their activation is likely due to an activating mutation of a
common stimulator or an inactivating mutation of a common inhibitor.

In this study, it was also determined that the level of H-Ras protein is 2-fold
higher in L210-6AISB1 cells than that in its parental cell strain MSU-1.1 (Figure 4).
However, it is unlikely that this caused significant activation of Cdc42 and Rac1
because previous studies in our laboratory showed that expression of wildtype H-
RAS even at a level 5-fold higher than that in MSU-1.1 cells was not sufficient to
malignantly transform MSU-1.1 cells (J. McCormick, unpublished studies). In
contrast, it is well established that rodent fibroblasts are more easily transformed by
carcinogen treatment or oncogene expression. lmmortalized rodent fibroblasts that

express constitutively active V12-H-Ras mutant display most characteristics of the

193

malignant phenotype. Recent studies show that intact Cdc42 and Rac1 activity are
required for such malignant transformation (Prendergast et al., 1995; Qiu et al.,
1995a, 1995b, and 1997). When the investigators expressed dominant-negative
Cdc42 or dominant-negative Rac1 in such oncogenic H-RAS-transfon'ned cells,
certain characteristics of the malignant phenotype were suppressed.

To investigate whether hyperactive. Cdc42 and Rac1 proteins are required for
maintaining transformed growth characteristics of L210-6A/SB1 cells, dominant-
negative Cdc42 or dominant-negative Rac1, or both mutants, was expressed in
- these cells. L210-6A/SB1 cells were infected with retroviruses carrying the cDNA(s)
encoding B-galactosidase, Flag-N17-Cdc42, Myc-N17-Rac1, or both mutants. Three
puromycin-resistant cell populations were generated for each. These cells have
been subcutaneously injected into athymic mice. If tumors do form, tumor-derived
cells will be tested for expression level of the respective protein(s) and compared
with the same cell populations that were not injected into athymic mice. Such
analysis should indicate whether there is an in vivo selection against cells that
express dominant-negative mutant(s). If hyperactive Cdc42 and Rac1 proteins are
required for the malignant phenotype of L210-6NSB1 cells, then tumor-derived cells
should express a minimal amount of dominant-negative Cdc42 and/or dominant-
negative Rac1. The effect of dominant-negative mutant(s) expression on other
growth properties characteristic of malignant cells may be tested if the tumor data
indicate that this is of interest. Clonal populations of cells expressing a low or high
level of mutant protein(s) will also be tested for their ability to form tumors in athymic

mice.

194

REFERENCES

Benard, V., Bohl, B. P., and Bokoch, G. M. (1999). Characterization of rac and cdc42
activation in chemoattractant-stimulated human neutrophils using a novel assay for
active GTPases. J Biol Chem 274, 13198-204.

Cerione, R. A., and Zheng, Y. (1996). The Dbl family of oncogenes. Curr Opin Cell
Biol 8, 216-22.

Coso, O. A., Chiariello, M., Yu, J. C., Teramoto, H., Crespo, P., Xu, N., Miki, T., and
Gutkind, J. S. (1995). The small GTP-binding proteins Rac1 and Cdc42 regulate the
activity of the JNK/SAPK signaling pathway. Cell 81, 1137-46.

Hall, A. (1990). The cellular-functions of small GTP-binding proteins. Science 249,
635-40. *

Hall, A. (1992). Ras-related GTPases and the cytoskeleton. Mol Biol Cell 3, 475-9.

Hill, C. S., Wynne, J., and Treisman, R. (1995). The Rho family GTPases RhoA,
Rac1, and CDC42Hs regulate transcriptional activation by SRF. Cell 81, 1159-70.

Hurlin, P. J., Maher, V. M., and McCormick, J. J. (1989). Malignant transformation of
human fibroblasts caused by expression of a transfected T24 HRAS oncogene. Proc
Natl Acad‘Sci U S A 86, 187-91.

Minden, A., Lin, A., Claret, F. X., Abo, A., and Karin, M. (1995). Selective activation
of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases
Rae and Cdc42Hs. Cell 81 , 1147-57.

Mira, J. P., Benard, V., Groffen, J., Sanders, L. C., and Knaus, U. G. (2000).
Endogenous, hyperactive Rac3 controls proliferation of breast cancer cells by a p21-
activated kinase-dependent pathway. Proc Natl Acad Sci U S A 97, 185-9.

Morgan, T. L., Yang, D. J., Fry, D. G., Hurlin, P. J., Kohler, S. K., Maher, V. M., and
McCormick, J. J. (1991). Characteristics of an infinite life span diploid human
fibroblast cell strain and a near diploid strain arising from a clone of cells expressing
a transfected v myc oncogene. Exp. Cell Res. 197, 125-36.

O'Reilly, 8., Walicka, M., Kohler, S. K., Dunstan, R., Maher, V. M., and McCormick,
J. J. (1998). Dose-dependent transformation of cells of human fibroblast cell strain

MSU-1.1 by cobalt-60 gamma radiation and characterization of the transformed
cells. Radiat Res 150, 577-84.

Perona, R., Montaner, S., Saniger, L., Sanchez Perez, l., Bravo, R., and Lacal, J. C.
(1997). Activation of the nuclear factor-kappaB by Rho, CDC42, and Rac-1 proteins.
Genes Dev 11, 463-75.

195

Prendergast, G. C., Khosravi Far, R., Solski, P. A... Kurzawa, H., Lebowitz, P. F ., and
Der, C. J. (1995). Critical role of Rho in cell transformation by oncogenic Ras.
Oncogene 10, 2289-96.

Qiu, R. G., Abo, A., McCormick, F., and Symons, M. (1997). Cdc42 regulates
anchorage-independent growth and is necessary for Ras transformation. Mol Cell
Biol 17, 3449-58.

Qiu, R. G., Chen, J., Kim, D., McCormick, F., and Symons, M. (1995a). An essential
role for Rac in Ras transformation. Nature 374, 457-9.

Qiu, R. G., .Chen, J., McCormick, F., and Symons, M. (1995b). A role for Rho in Ras
transformation. Proc Natl Acad Sci U S A 92, 11781-5.

Sulciner, D. J., Irani, K., Yu, Z. X., Ferrans, V. J., Goldschmidt Clerrnont, P., and
Finkel, T. (1996). met regulates a cytokine-stimulated, redox-dependent pathway
necessary for NF-kappaB activation. Mol Cell Biol 16, 7115-21.

Takai, Y., Sasaki, T., and Matozaki, T. (2001). Small GTP-binding proteins. Physiol
Rev 81 , 153-208.

Van Aelst, L., and D'Souza Schorey, C. (1997). Rho GTPases and signaling
networks. Genes Dev 11, 2295-322.

196

APPENDIX B: IDENTIFYING CANDIDATE CANCER-RELATED GENES BY
CDNA SUBTRACTION ANALYSIS OF A MALIGNANT CELL LINE WITH

ELEVATED CDC42 AND RAC1 ACTIVITY AND ITS PARENTAL CELL STRAIN
MSU-1.1

197

ABSTRACT

The MSU-1.1-derived, human fibrosarcoma cell line, L210-6A/SB1, was
discovered to have a higher than normal level of Cdc42 and Rac1 activity (K-H. Dao,
unpublished studies). This cell line was established in the Carcinogenesis
Laboratory from a tumor formed in an athymic mouse following subcutaneous
injection of a cell strain derived from a focus formed by MSU-1.1 cells that had been
treated with a reactive derivative of benzo[a]pyrene (L. Milam, unpublished studies).
As part of an ongoing study investigating the role of hyperactive Cdc42 and Rac1
proteins in maintenance of the transformed phenotype of these cells, cDNA
expression differences between L210-6AISB1 and its parental cell strain, MSU-1.1,
were analyzed by PCR-Select subtractive hybridization. Sixteen genes were found

differentially expressed.

198

INTRODUCTION

Cdc42and Rac1 act in parallel pathways to activate transcription of genes,
including the p38, c-jun N-tenninal kinase (Coso et al., 1995; Minden et al., 1995),
nuclear factor K B (Sulciner et al., 1996; Perona et al., 1997), and serum response
factor pathways (Hill et al., 1995). Recent studies, mainly with rodent cells, indicate
that Cdc42 and Rac1 contribute to the malignant transformation of cells by regulating
such pathways (Mackay and Hall, 1998; Van Aelst and D'Souza Schorey, 1997). In a
comparative study it was shown that a human cell line, L210-6AISB1, derived from a
fibrosarcoma formed in an athymic mouse following subcutaneous injection of a cell
strain derived from a focus formed by MSU-1.1 cells that had been treated with a
reactive derivative of benzo[a]pyrene, has an elevated level of Cdc42 and Rac1
activity compared with its non-tumorigenic, parental cell strain MSU-1.1 (K-H. Dao,
unpublished studies). The strategy for establishing tumor-derived, fibrosarcoma cell
lines from MSU-1.1 cells (Morgan et al., 1991) following treatment with a carcinogen
(O'Reilly et al., 1998; Yang et al., 1992) or expression of an oncogene has been
described (Hurlin et al., 1989). The activity level of Cdc42 and Rac1 were
determined using a gIutathione-S-transferase—p21-binding domain pull-down assay
described by Benard et al. (1999). Increased activation of Cdc42 and Rac1 may
lead to transcription of genes that are important mediators of malignant
transformation.

To identify genes that may play a role in the malignant transformation of
MSU-1.1 cells treated with a reactive derivative of benzo[a]pyrene, PCR-Select
subtractive cDNA hybridization was performed between the parental cell strain,

MSU-1.1, and its malignant derivative cell line, L210-6A/SB1. The forward

199

subtraction (cDNA from MSU-1.1 cells subtracted by cDNA from L210-6A/SB1 cells)
and the reverse subtraction (cDNA from L210-6A/SB1 cells subtracted by cDNA
from MSU-1.1 cells) were performed. A total of 384 cDNA products were analyzed
by dot blot analysis. Those genes that showed differential expression between
MSU-1.1 and L210-6AISB1 cells by such analysis were analyzed further by Northern
blot analysis. Of the 55 genes analyzed further, 16 genes were verified to be
differentially expressed by this more quantitative analysis of mRNA abundance. The
16 genes were sequenced to facilitate identification of genes that may play a causal

. role in malignant transformation of MSU-1.1 cells.

200

MATERIALS AND METHODS

PCR-Select subtractive hybridization

PCR-Select cDNA subtraction (Clontech) was performed between MSU-1.1
and L210-6AISB1 cells (Figure 1). The detailed steps were followed according to
the manufacturer’s instruction. Briefly, double stranded cDNA was synthesized from
MSU-1.1 (sample #1) and L210-6A/SB1 (sample #2) cells. This was followed by
digestion with Rsal restriction enzyme to generate shorter, blunt-ended products.
Each sample’s digested double stranded cDNAs were ligated to two different
adaptors, adaptor1 and adaptor2R. The first hybridization consisted of two separate
reactions: adaptor1-ligated CDNAs or adaptor2R-ligated cDNAs of sample #1 each
combined with excess non-ligated cDNAs of sample #2. The second hybridization
consisted of a mixture of these two reactions and a fresh addition of excess non-
ligated cDNAs of sample #2. Twice-hybridized cDNA species that were unique or
were expressed at a higher level in sample #1 than in sample #2 contain adaptor1
and 2R at the ends, which facilitates exponential amplification and enrichment by
PCR. This describes the forward subtraction. The subtracted cDNA products were
then cloned into pCMV—SPORT (Life Technologies) and transformed into DH5a
Escherichia coli bacteria for isolation of individual cDNA products. Approximately
1,000 total bacteria colonies _were obtained from the fonrvard and reverse
subtraction. The forward subtraction consisted of MSU-1.1 cDNAs subtracted by
L210-6A/SB1 cDNAs, i.e., genes that are expressed at a higher level in MSU-1.1
cells compared with that in L210-6AISB1 cells. The reverse subtraction consisted of
L210-6AISB1 cDNAs subtracted by MSU-1.1 cDNAs, i.e., genes that are expressed

at a higher level in L210-6A/SB1 cells compared with that in MSU-1.1 cells.

201

Dot blot analysis

Each of the 384 bacteria colonies selected contained a single subtracted
cDNA product cloned into-pCMV—SPORT vector. Plasmid DNA was isolated from a
small bacteria culture, chemically denatured with basic buffer, and then spotted onto
nylon membrane using a dot blot manifold apparatus. Two replicate blots were
spotted, one was probed with forward-subtracted cDNA products and the other was
probed with reverse-subtracted cDNA products. 3zP-labeled cDNA probes were
generated by PCR incorporation of a-azP-dCTP, using primers that annealed to
adaptor1 and 2R sequences ligated to subtracted cDNA products. Approximately
20x106 cpm of 32P-labeled, subtracted cDNA products were denatured at 95°C for 5
min. and then added to hybridization buffer immediately prior to the hybridization
step. The procedures for prehybridization, hybridization, and low- and high-
stringency wash steps were carried out as described in Short Protocols in Molecular
Biology (1992). ' Bands were visualized and analyzed using the G5-525

phosphorimaging system (Biorad).

Northern blot analysis

Total RNA was extracted from cells using the RNAzoI reagent as described
by the manufacturer (T eI-Test). Total RNA concentration was determined by UV
absorbance at A260. A sample of total RNA (5 pg) was fractionated on a denaturing
formaldehyde agarose gel and transferred to nitrocellulose membrane. The
. procedures were carried out as described (Short Protocols in Molecular Biology,
1992). The RNA was immobilized on membrane with a Stratagene UV Crosslinker.
Freshly denatured salmon sperm DNA was added to prehybridization and

hybridization solutions immediately prior to use. Prehybridization was performed at

202

42°C for 2 to 4 hr, and hybridization was performed at 42°C for >12 hr. 32P-labeled
DNA probes were generated by PCR incorporation of a-azP-dCTP, using the T7 and
SP6 priming sites present in the pCMV-SPORT vector. Each strip, containing one
lane of MSU-1.1 RNA and one lane of L210-6A/SB1 RNA, was hybridized with

~1X106 cpm of denatured probe. Bands were visualized and analyzed using the G5-

525 phosphorimaging system (Biorad).

203

- RESULTS/DISCUSSION

PCR-Select cDNA subtractive hybridization

PCR-Select subtractive hybridization was performed between MSU-1.1 and
L210-6A/SB1 cells to identify genes that may play a causal role in transformation of
MSU-1.1 cells to a malignant derivative (Figure 1). Results of dot blot analysis of a
total of 384 cDNA products from the forward and reverse subtraction are shown in
Figure 2. Only one such analysis was performed-since it was used as a- screening
strategy. The “positives” are those genes that were enriched in either direction of
the subtractive hybridization and displayed the'correct pattern of expression between
MSU-1.1 and L210-6A/SB1 cells (Figure 2, panels A and D). Overall, the forward
subtraction proved to be more stringent and specific than the reverse subtraction.
. This judgment is based on a comparison of signals between the top panel and the
bottom panel of each blot. For example, the top panel (A) of the fonivard subtraction
had more positive signals than the bottom panel (B), indicating that positive signals
in panel A are more likely to be truly differentially expressed between MSU-1.1 and
L210-6A/SB1 cells. In contrast, the same comparison for the reverse subtraction,
panel D versus panel C, showed little difference. Thus, subtracted cDNAs obtained
in this subtracted direction (D) were just as likely to be false positives.

Relative signal intensity was determined for each subtracted cDNA product
analyzed by dot blot analysis, and a graphical presentation of these values is shown
in Figure 3. A majority (84%) of the genes, 324 of 384, were expressed at a level
that is approximately equal between MSU-1.1 and L210-6AISB1 cells. Using a 2.5-
fold difference as the minimum, 35 genes were expressed at a higher level in MSU-

1.1 cells than in L210-6A/SB1 cells, and 20 genes were expressed at a higher level

204

in L210-6A/SB1 cells than in MSU-1.1 cells. To verify expression differences of
these 55 genes, Northern analysis was performed using subtracted cDNA products
as probes. Only a select subset of the results is shown in Figure 4 for the reverse
subtraction. Those cDNAs that displayed expression differences by Northern
analysis were sequenced to facilitate identification of genes (Table 1). The sixteen
genes that were sequenced included nine genes expressed at a higher level in
MSU-1.1 cells and seven genes expressed at a higher level in L210-6A/SB1 cells.
Four of nine genes that were expressed at a higher level in MSU-1.1 cells encode
ribosomal proteins, whereas four of seven genes that were expressed at a higher
level in L210-6A/SB1 cells encode glyceraldehyde-3-phosphate dehydrogenase.
These results are interesting, especially the higher laminin expression in L210-
6AlSB1 cells than in MSU-1.1 cells, but the function of these genes in maintaining

the malignant phenotype of L210-6AISB1 cells remains to be investigated.

205

Figure 1: General strategy of PCR-Select cDNA subtractive hybridization. The
procedures were followed as described by the manufacturer. Double stranded
cDNA was synthesized from polyA+RNA extracted from each MSU-1.1 and L210-
6A/SB1 cells. Rsal-digested products were ligated to adaptor1, ligated to adaptor
2R, or non-ligated to act- as driver for- the opposite subtraction. Two reactions were
carried out separately for the forward (F) subtraction and the reverse (R) subtraction.
The various hybridization steps that were performed are shown. RTase, reverse

transcriptase; DNA pol, DNA polymerase I.

206

 

 

Figure 1

 

 

 

polyA+RNA

 

 

First Strand Synthesis
(RTase)

 

 

 

 

Second Strand Synthesis
(DNA pol)

 

 

 

 

 

 

Rsal Digestion

I

 

Reaction 1F Reaction 2F
Forward subtraction (F)
Tester MSU-1.1 adaptor1-ligated products MSU-1.1 adaptor2R-ligated products
Driver 6AISB1 non-ligated products 6A/SBI non-ligated products
Reaction 1R Reaction 2R
Reverse subtraction (R)
Tester 6A/SB1 adaptor1-ligated products 6A/SB1 adaptor2R-ligated products
Driver MSU-1.1 non-ligated products MSU-1.1 non-ligated products

- First hybridization: reaction 1 and 2 for each of the subtracted direction are
hybridized separately in the presence of excess driver

- Second hybridization: reaction 1F and 2F are mixed together and excess
driver is added again; the same is done for reaction 1R and 2R

- PCR amplification using a primer that anneals to both adaptor1 and
adaptor2R (all products containing any combination of these primers are
amplified)

- PCR amplification using two primers, each annealing to adaptor1 or
adaptor2R (only products containing adaptor1 at one end and adpator2R at the
other end are exponentially amplified)

- Digest subtracted, PCR-amplified products with suitable restriction enzymes
and clone into pCMV-sport for isolation of cDNA products and dot blot analysis

207

Figure 2: Dot blot analysis of 384 subtracted cDNA products from the forward
and reverse subtraction. PCR-amplified subtracted cDNAs were spotted onto
nylon membrane and 32P-Iabeled forward- or reverse-subtracted products were used
as probes. A, putative cDNA products expressed at a higher level in MSU-1.1 cells
than in L210-6A/SB1 cells and probed with forward-subtracted products. D, putative
cDNA products expressed at a higher level in L210-6A/SB1 cells than in MSU-1.1
cells and probed with reverse-subtracted products. Panels B (vs. A) and C (vs. D)
should have fewer signals because they were isolated from the subtraction of one

direction but probed with the subtraction of the opposite direction.

208

 

 

 

 

cozombnzm <ZDo
trims. I rmem U052n—

1.185

 

 

—..—.-Dws_ l wmmZm
omho>om

 

wmm<<o I ...—.-Dms—
€9.20".

 

 

cozombbsm <ZDo
mezm I _.._.-Dw_z ”029E

N 2:9"—

IISI‘ 1‘
(III
I

.7
In

209

Figure 3: Relative signal intensity of each subtracted cDNA product analyzed
by dot blot analysis. The relative signal, MSU-1.1 versus L210-6A/SB1, was
determined for each spot using phosphorimager analysis (Biorad). A graphical
presentation of these values for the 384 subtracted cDNA products analyzed is
shown here. Most of the genes had a relative signal intensity between 1 and 2-fold,
which indicates no significant expression difference between MSU-1.1 and L210-
6A/SB1 cells. There were 55 genes that had .a relative signal intensity above 2.5.
Genes that were expressed at a higher level in MSU-1.1 cells have signals toward
the left, whereas those expressed ._ at a higher level in L210-6AISB1 cells have

signals toward the right.

210

 

_mcm_w 02223”.
omen" For-~-n-1m-o.

 

 

 

wocmm

mocom
mm

ON

 

 

 

 

 

 

m 2:9".

211

Figure 4: Northern blot analysis to verify differential expression of subtracted
cDNA products. Northem blot analysis was performed to verify 55 genes that had
greater than 2.5-fold expression difference as determined by dot blot analysis. A
select subset is shown here. A sample of total RNA (5 pg) from each MSU-1.1 (1 .1)
cells and L210-6A/SB1 (6A) cells were probed with PCR-amplified, 32P-labeled
subtracted cDNA. Not all probes resulted in detectable signals. Those genes that
were differentially expressed between MSU-1.1 and L210-6A/SB1 cells, as indicated

by boxes, were sequenced to facilitate identification of the gene.

212

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

_<o F.F <e FF
«Fm am
<mF.F <o F.F 5 - F.F <o F.F 5:
I I E E a a

e 9.39".

213

 

..0_.00 5020.33 c. .0>0. .95.; .0 00000.98 00:03 8:00.530 00.0>0.
05 E0... 00:00 c0>00 9.0 0:00 F.F-Dms. :. .0>0. .050... .0 00000.90 00:09 5:00.530 0.03.0. 05 E9. 00:00
0a.: 0.0 00.0.... 0.0: 00:000. 0. 00.0.20... 00; .05 0:00 05 9.0 20.000 ._.m<..m 0 c. 00.020 0.03 00:02.00 <20

 

.0 00000 com >.0.0E.xo.oom 0.0220 505.02 .3 005E000 00 60000.90 >..0.E0.0t..0 003 .05 (200 ...000 .0”.

214

 

F3 .900. 5.09.0.0 co..0_0c0.. mm<

50.0.0. co..uco..02.E vm<

.20000. c.c.E0_ w Fm . 8 00... 50.0.0 .0E00oo.. Nm<

0.0:o0wwwmmum0mfiuwv002m v _. m :8 .200. 5:09.20 5.0.2.0.. rm<

F3 .200. co..0mco.0 5.6.0.0.. N _‘m 3 00.... 50.0.0 .0E00oo.. om<

50.0.0 c0..uc0..02.E mm 0» 00... 50.0.0 .0E00oo.. ®N<

0.0:00MMMFHMWWMHMMWERE mm 5.00-» . NN<

0.0:00MHNFWMWOMMDMNW0020 vm F3 .200. co..0mco.0 5.0.2.0.. m P<

0.0co0wwwmmmmflmfiww0ga mm mm 50.0... .0E00oo.. o —.<
0:00 5.0.2065. c. .0>0. 6200.0 (200 0:00 ... Yams. c. .0>0. .0300... <200

.03.: 0 .0 00000.90 09.00 0200.530 .020... 0 .0 00000.90 00:06 0200.530

0:8 $020.20.. new F.F-o0sleeezeeo 8083.8 2.0.2506 02.00 . F 2.3

 

REFERENCES

Short Protocols in Molecular Biology. 2nd Edition, 1992, F. M. Ausubel, R. Brent, R.
E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith and K. Struhl, eds. (New York:
Greene Publishing Associates and John Wiley & Sons).

Benard, V., Bohl, B. P., and Bokoch, G. M. (1999). Characterization of rac and cdc42
activation in chemoattractant-stimulated human neutrophils using a novel assay for
active GTPases. J Biol Chem 274, 13198-204.

Coso, O. A., Chiariello, M., Yu, J. C., Teramoto, H., Crespo, P., Xu, N., Miki, T., and
Gutkind, J. S. (1995). The small GTP-binding proteins Rac1 and Cdc42 regulate the
activity of the JNK/SAPK signaling pathway. Cell 81, 1137-46.

Hill, C. S., Wynne, J., and Treisman, R. (1995). The Rho family GTPases RhoA,
Rac1, and CDC42Hs regulate transcriptional activation by SRF. Cell 81, 1159-70.

Hurlin, P. J., Maher, V. M., and McCormick, J. J. (1989). Malignant transformation of
human fibroblasts caused by expression of a transfected T24 H-RAS oncogene.
Proc. Natl. Acad. Sci. U S A 86, 187-91.

Mackay, D. J., and Hall, A. (1998). Rho GTPases. J Biol Chem 273, 20685-8.

Minden, A., Lin, A., Claret, F. X., Abo, A., and Karin, M. (1995). Selective activation
of the JNK signaling cascade and c-Jun transcriptional activity by the small GTPases
Rac and Cdc42Hs. Cell 81 , 1147-57.

Morgan, T. L., Yang, D. J., Fry, D. G., Hurlin, P. J., Kohler, S. K., Maher, V. M., and
McCormick, J. J. (1991). Characteristics of an infinite life span diploid human
fibroblast cell strain and a near diploid strain arising from a clone of cells expressing
a transfected v myc oncogene. Exp. Cell Res. 197, 125-36.

O'Reilly, 8., Walicka, M., Kohler, S. K., Dunstan, R., Maher, V. M., and McCormick,
J. J. (1998). Dose dependent transformation of cells of human fibroblast cell strain
MSU 1.1 by cobalt 60 gamma radiation and characterization of the transformed cells.
Radiat. Res. 150, 577-84.

Perona, R., Montaner, S., Saniger, L., Sanchez Perez, l., Bravo, R., and Lacal, J. C.
(1997). Activation of the nuclear factor-kappaB by Rho, CDC42, and Rac—1 proteins.
Genes Dev 11‘, 463-75.

Sulciner, D. J., Irani, K., Yu, Z. X., Ferrans, V. J., Goldschmidt Clerrnont, P., and
Finkel, T. (1996). rac1 regulates a cytokine-stimulated, redox-dependent pathway
necessary for NF-kappaB activation. Mol Cell Biol 16, 7115-21.

Van Aelst, L., and D'Souza Schorey, C. (1997). Rho GTPases and signaling
networks. Genes Dev 11, 2295-322.

215

Yang, D., Louden, C., Reinhold, D. S., Kohler, S. K., Maher, V. M., and McCormick,
J. J. (1992). Malignant transformation of human fibroblast cell strain MSU 1.1 by (+—
)-7 beta,8 alpha-dihydroxy-9 alpha,10 alpha-epoxy-7,8,9,10-tetrahydrobenzo
[a]pyrene. Proc. Natl. Acad. Sci. US A 89, 2237-41.

216

FUTURE DIRECTIONS

In light of my dissertation research, there are at least four areas of focus that
are worth pursuing. First, very few studies address the effect of inhibiting
endogenous activity of Cdc42 or Rac1, by dominant-negative mutant expression or
by other strategies such as antisense expression or mutant effector protein
expression, on transformed growth characteristics of malignant cell lines. In studies
that have been published, the investigators’ use of rodent fibroblasts should
encourage caution when extrapolating data to apply to human fibroblasts.
Alternatively, similar studies could be investigated in human fibroblasts. My studies
showed that Cdc42 and Rac1 are required for malignant transformation of human
fibroblasts by oncogenic H-RAS. These results are consistent with the results
obtained in similar studies with rodent fibroblasts. It would be important to determine
whethersuch a role for Cdc42 and Rac1 existslin more common types of human
cancers such as lung, colon, breast, and prostate carcinomas. Second, my finding
that EPAS1 is a RAS target dependent on Cdc42 and Rac1 for up-regulation
suggests a possible pathway that oncogenic RAS isoforms induce VEGF secretion,
which is known to promote tumor growth and angiogenesis. The role of EPAS1 in
the malignant transformation of human fibroblasts or other human cell types has not
been investigated. It would be worthwhile to determine the effect of selective
inhibition of EPAS1 in human cancer cell lines on the ability of such cells to form
tumors in athymic mice. Since EPAS1 is a hypoxia-inducible factor, it is highly likely
that members of this family of transcription factors have a critical role in
establishment of solid human tumors. Third, in my studies I identified H-RAS-

induced gene changes that are dependent on Cdc42 and Rac1 activity to investigate

217

the pathway-specific contribution of oncogenic H-RAS to the malignant
transformation of human fibroblasts. As previously reported, this approach should
facilitate identification of potential targets for selective inhibition of RAS function.
Inhibition of only those RAS mediators that contribute to the malignant
transformation of cells is likely to be less cytotoxic than inhibiting Ras directly
because Ras is a central signaling protein that is required for normal cellular
processes. I followed-up on EPAS1 but the other genes listed in Table 3, Chapter II
should also be investigated further. Finally, the reports in the literature suggest that
there are at least two ways that increase Cdc42 and Rac1 activity. In the first
scenario, there is an increase in exchange activity, for example, due to G12V or
061L mutations. or oncogenic GEF activation. In the second scenario, there is a
concomitant increase in GTPase activity with the increase in exchange activity, for
example, due to F28L mutation or ABR or RAS activation. I described these two
scenarios in the literature review (Chapter I) as static versus dynamic mechanisms,
respectively, of increasing Cdc42 and Rac1 activity. The mechanism of activating
Cdc42 and Rac1 is likely to modulate their specific contribution to the malignant

transformation of cells. However, this remains to be investigated.

218

   

IIIIIIljjijljijljjjjil