. . r....rnu....r.n .

m4

 

 

 

hr

. (‘6.
Aw?”

.h§

 

9..&.m,3kfi-w..‘...wnnsi‘ ‘ ‘. .. ‘ .. V .. ‘ ‘ ,, . _ . . .. . ‘ ‘ ‘ ., , ,.......om‘..«mmusqmfi...mm.

 

{‘73 ‘~

49/1474'1

 

LIBRARY
Michigan State
University

 

 

 

This is to certify that the

thesis entitled

Using Labs and Activities to Teach
High School Genetics

presented by

Matthew Richard Withers

has been accepted towards fulfillment
of the requirements for

Master's . Biolo ical Science—
degree in Mrtmental

 

 

 

Major professor

Date/ , gem;

0-7639 MS U is an Affirmative Action/Equal Opportunity Institution

PLACE lN RETURN Box to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

JUHJI a ., 0‘?

 

C"? 0 7 2001'

 

 

 

 

 

 

 

 

 

 

 

 

6/01 cJCIRC/DateDuepss-p. 1 5

USING LABS AND ACTIVITIES To TEACH HIGH SCHOOL GENETICS
By

Matthew Richard Withers

A THESIS

Submitted to
Michigan State University
In partial fulfillment of the requirements
For the degree of

MASTER OF SCIENCE
Division of Mathematics and Science Education

2003

ABSTRACT
USING LABS AND ACTIVITIES TO TEACH HIGH SCHOOL GENETICS
By

Matthew Richard Withers

Nearly all students enjoy learning about the topics of genetics, but few understand
them. Misconceptions created by textbooks, the abstract nature of genetics, and poor
student motivation can all contribute to poor student achievement. This unit was
designed to address specific misconceptions, as well as create hands-on opportunities for
students to make genetics an enjoyable and leamable subject. A good background is
necessary to proceed to advanced genetics topics, so the focus of this redesigied unit is
basic genetics. After using the summer of 2001 to design and create exciting labs and
activities, as well as creating colorful and engaging PowerPoint presentations for notes, I
have made a genetics unit that allows maximum student understanding as measured by
the various assessment tools used in the unit. I began the unit with a pretest to assess
students’ prior knowledge of the subject. Following the unit I gave a posttest, which
scores support the effectiveness of the redesigned unit I have created. Students, after
doing the activities, labs, and other exercises of this unit, are much more prepared to
proceed to an applied genetics unit because they have a stronger background on the
molecular basis of genetics, which is a building block for all other applied genetics

topics.

TABLE OF CONTENTS

LIST OF TABLES... .

LIST OF GRAPHS... .

INTRODUCTION...............

IMPLEMENTATION............... ..

DISCUSSION

APPENDIX A.

1.

Parent Consent Form

APPENDIX B...

1.

2.
3
4

MitosisLab 1..
2. MitosisLabZ.....
3. The Cell Cycle...
4. Dipstick Meiosis
5. Extracting DNA from fruits and Veggies
6.
7
8
9.
1

1.

Unit PreteSt .
Restriction Enzymes Quiz

Fruit Fly Applied Genetics PrOjects . .

Unit Post Test...

Electrophoresis A551 gnment

. Food Color Gel Electrophoresis .. . ..
. Electrophoresis ofLambda DNA... .. ..

Mating Fruit Flies...

iii

Page Number

...iV

...V

...1

...11

...25

...32

...36

”....37

...38

.....39
....42
.....43
...44

...48
...49
..51
...53

.......54
......55

.....59
.....60

..63
.. .67

0. Human Heredity Studies of Families and Populations ............. 69

..73

LIST OFTABLES
PageNumber
Table l—Goals ofexpectedstudentmastery........................12
TableZ—Unitoutline...................................................13
Table3-Pretest GradingRubric 14
Table4-Pretest sample rubric 1 Question2 l4
TableS—Pretestsample rubric2Question8 15
Table6—Pretest samplerubric3Question9 16
Table 7—PostTestGradingRubric 21
Table 8—Post Test sample rubric 1 Question2 .....22
Table9—PostTest samplerubricZQuestionS 23
Table lO—PostTestsamplerubric3Question9 24
Table11—Pretestclassresults.........................................25

Table 12 —Post Test class results ........26

iV

LIST OF GRAPES

Graph 1 -Pretest scores.........
GraphZ—Post test scores...........................
Graph3-Comparison ofmastery ofgoals.................
Graph4~Students Skills on Traits problems......

Graph 5 -— Overall Comparisons of pretest and post test... .

Page Number

...27

.27

29

30

..... 31

INTRODUCTION

Teaching genetics to a classroom of high school students is a challenging task.
There are several obstacles that must be overcome to get students to understand the
science of genetics and apply that knowledge to more advanced genetics topics. The
problem I focused on for this new unit was how to teach genetics to an Advanced
Biology class by overcoming student misconceptions of genetics, and by increasing
student motivation through hands on labs and activities.

The first obstacle that must be overcome is poor background information.
Without a strong background in molecular genetics, application of the information related
to genetics is almost impossible. To the average high school student, “genetics is
something to do with a monk named Mendel who lived in Switzerland in the middle of
the last century who made pea plants grow” (Bradshaw and Darlington, 1963). But
genetics is much more than that. It is a field of science with a variety of information and
as much diversity such as Mitosis, Meiosis, the genetic material, and many forms of
inheritance. Students will often say that Genetics is why we look the way we do, which
is not necessarily wrong but is certainly an oversimplified definition. Misconceptions
about Genetics are perpetuated by every generation of science educators and science
textbooks. The historical approach of genetics is presented in a manner which only
memory can master, with tepics presented by discoverer or by date. Genetics instruction
must be presented, instead, in a functional way that includes a natural order of the
information and how it controls the cell and eventually the organism itself. (Bradshaw

and Darlington, 1963)

To teach genetics you must start with information that provides a foundation for
learning. At the very center of this is the cell itself. The cell is the smallest unit of an
organism that still maintains the function of that organism. We are made of about “100
trillion cells, the result of approximately 50 rounds of cell divisions, starting with one
fertilized egg” (Carlson, 1984). Human cells contain a constant chromosome number, 46.
This means we have 23 pairs of chromosomes or 46 individual chromosomes. The
chromosome carries the information that is coded by the genes and is really how that
information is passed on from generation to generation in organisms, as well as in all
cells. The specific way the information is passed on for all organisms, with the exception
of viruses, is well documented. All cells must divide to reproduce, although they don’t
always do this the same way. The life of a cell can really be described by what is known
as the cell cycle. The cell cycle has no real beginning or ending as it is a circular process.
For sake of this description we will begin with what is known as the 01 phase. This is the
phase where the cell grows and prepares for DNA duplication. It will replicate, or copy
its DNA in the S phase of the cell cycle, so when the cell eventually separates, each
daughter cell will possess its own DNA packaged into chromosomes. Following the S
phase, the cell will enter into G2, where the cell will again grow in anticipation of
splitting. Finally, the cell will undergo the M phase of the cell cycle, mitosis. Mitosis is
the process where non-sex cells split their DNA and cell division is when those cells
divide into two separate daughter cells, each with identical DNA. Mitosis is a process
composed of a series of steps commonly referred to as “IPMA'I'”. Interphase is the first
step, but is not generally considered part of Mitosis. Interphase is a combination of G, S,

and G2 of the cell cycle. The stages of Mitosis are Prophase, Metaphase, Anaphase, and

Telophase. These stages are a doe-si-doe where duplicated chromosomes lineup, split,
and eventually separate to opposite poles of the cell. The cell then separates somewhere
in the middle, allowing each cell to have identical genetic material. It has been my
experience as an instructor that many student misconceptions persist about how the
chromosomes line-up, how they separate, and at what point they are called a chromosome
or chromatid. Another fundamental process for proper understanding of genetics is the
formation of gamete cells or reproductive sex cells, most commonly termed the sperm
and egg. The Sperm and egg are produced via a process called Meiosis. This process is
different from Mitosis in that the Meiotic division of the cell reduces the chromosome
number of that cell by half. The resulting products of meiosis are described as haploid, as
they have only a single set of instructions from one of each of the pairs of chromosomes
present in a diploid cell (Howell, 1998).

Learning about chromosomes is one of the first topics of genetics to be taught
because chromosomes contain the individual instructions for virtually all of the activities
of an organism. Genes, located on chromosomes, encode the information for making
proteins that regulate cell activities and control mechanisms of all cell machinery
(Carlson, 1984). My students seem to struggle with the idea that the genes do not directly
control the cell or organism. Instead, the genes provide the instructions for necessary
amino acids, which in turn are assembled into specific proteins. These proteins are the
real workers of the cell. They are responsible for everything that happens within the cell.

DNA, which stands for Deoxyribonucleic Acid, is the “Genetic Material” for all
living organisms. Swiss physician Friedrich Miescher first discovered DNA in 1869, but

his and other scientists’ belief in its importance was low (Clarke, 2003). They could not

have been further from the truth. It would prove to be the discovery of the most
important molecular structure to all living organisms. They actually believed that
proteins, some of which are larger and more complex than DNA, were the molecules
passing information on from generation to generation. Researchers now know that DNA
is made up of several to thousands of genes, which is variable according to the species.
A single segment of DNA can create tens or even hundreds of thousands of different
proteins, according to how the cell reads its genetic information, and how proteins are
chopped up or chemically modified (Pearson, 2003). Since its discovery, DNA has been
extensively studied by many people. In 1953, perhaps the most important discovery
made in biology in this century was made concerning DNA (Cohen and Portugal, 1977).
On the heels of Chargaffs’ discovery that DNA possesses only four Nitrogenous bases,
James Watson and Francis Crick released details about the physical structure of DNA.
The model Watson and Crick proposed is still accepted today and has since been
supported by visualization with microscopy and numerous chemical and biochemical
experiments. Their model describes DNA as a twisting double helix molecule made of
two complimentary strands. Each side is made of a backbone of alternating sugar and
phosphate molecules (Watson and Crick, 1953). Within the bonds of the backbone lie
nitrogen bases which Chargaff described as complimentary, meaning they can only bond
with a specific base on the opposite side. These chemicals are the treasures of the code
that if put into the correct order can supply life, cause growth, instigate cell death, as well
as control everything that a cell does throughout its life by way of gene products,
proteins, and strings of nucleotides, which control the cell by providing a blue print to

making specific polypeptides and amino acids assembled in a certain order. The so-

called Central Dogma, theorizes that DNA codons, which are a group of 3 nucleotides,
are transcribed to an RNA molecule. This RNA is then a “messenger” molecule, which
can leave the nucleus. The RNA transcript is then translated into a series of amino acids,
or a polypeptide, at the ribosome. Once produced to order, these proteins are shipped
throughout the cell to wherever they are needed

Students often are confused why we study Mitosis and Meiosis before learning
about DNA and proteins. The reason is that it is important for students to see how DNA
is incorporated into the chromosome and the processes of Mitosis and Meiosis. The
DNA, as stated earlier, is located in the nucleus. When it is necessary for the cell to
reproduce, it will prepare for reproduction by replication, or copying, of the DNA. Then
the DNA, which is wrapped around a protein called Histone, will super coil and condense
into a structure called a chromosome. The chromosome is a structure allowing the
division of a cells genetic material to occur. It is easier to divide the chromosomes into
equal portions for each new daughter cell than it would be to do the same thing with
unwound DNA.

Since its discovery almost 150 years ago, the use of DNA technology has grown.
There are countless applications of DNA technology in our past, current, and future
society. One notable technology has changed the way our society studies and solves
crimes. Forensic DNA evidence can be used in many ways to prove or disprove a
suspect’s guilt on a crime. The United Kingdom, who was the first to use DNA
fingerprinting, has a national database that contains over 700,000 profiles and has been
used to link evidence to 75,000 criminals (Davies, 2001). In the United States, the

technology has not been used for as long as in the United Kingdom, but significant

numbers of persons have been linked to evidence, and a national database of the United
States contains some 250,000 profiles. Davies (2001) also says that there seems to be
few limits to the potential applications of DNA fingerprinting. Recently, DNA
fingerprinting has been used to exonerate suspects. The process of DNA profiling is
done based on comparisons and examinations of “three to ten highly variable portions of
our DNA.”(Eckert, 1997) Human beings have about three billion base pairs of DNA
nucleotides in their code. According to Eckert (1997), most of these are identical in most
humans, but some regions are more variable in length or sequence. These are the parts
of the genome used in DNA fingerprinting. Once the DNA is extracted, the copies of the
DNA are made by a process called Polymerase Chain Reaction, or PCR. PCR takes the
gene sequence in question and makes multiple copies of it, all needed for forensic
analysis. Scientists add restriction enzymes to the DNA samples to cut the DNA at
known nucleotide sequences, breaking the DNA into smaller, more usable chunks. The
DNA chunks are now run and separated based on size using electrophoresis. The relative
sizes as well as other more specific information are used to compare suspects’ samples
with evidence.

The future of DNA technology has great potential for all living organisms. There
is a good chance that someday we will be able to examine an organisms’ genome, and be
able to cure diseases before they develop, or alter its genes to make it produce new traits
that may make it better suited for its environment. Technology such as cloning and
genetic engineering are amazing breakthroughs of which we have not even seen a small

part of their potential.

A second obstacle that needs to be overcome to successfiilly teach genetics lies
within the students themselves. One problem that all teachers face is student motivation.
There is an abundance of data to support the claim that student motivation is a key factor
in determining academic success (Griffin, 1993). If a student is motivated, he/she will at
least try harder than with little or no motivation. This effort may not equate directly to
higher test scores, but it may correspond to better grades just by students doing
homework, projects, and labs they may not have been motivated to do in the past. If the
student can be intrinsically motivated, both the teacher and student will benefit because
the student will be doing things because they want to and not necessarily because they
have to. Some research suggests that ultimately, teachers do not truly motivate students,
but can try to affect some of the variables that stimulate students’ motivation to learn
(Ralph, 199 8). Perhaps you cannot directly motivate students but you can influence the
factors they possess to motivate themselves.

There are many tools teachers can use to increase student motivation. Raffini
(1996) states that students are much more apt to be intrinsically motivated if there is a
challenge to the task. Science is a challenging field and genetics is certainly no
exception. The sheer amount of information required to master genetics coupled with the
complexity of the material makes learning a challenge. Stahl (1994) states that learning
only occurs when an individual’s mind is engaged, and that the learning will come only
through trial and error. Genetics labs and activities can be difficult but are certainly not
impossible. Students attempt to solve a problem and if it does not work, they will go
back and try other options to find a solution. This is the essence of trial and error. It also

gives them the opportunity to be actively engaged in their own education.

Another way this unit motivates students is that it gives them the chance to be
successful. Included in the rigors of the unit are several forms of alternate assessment
such as drawings, oral student explanations, essays, and the physical building of models.
The labs in the unit provide a situation where anyone can achieve “high scores”. Griffin
(1993) states that success is an excellent motivational tool. How ofien does failure
provide a motivation to achieve in education? That seems to have a negative impact
more often than a positive one. Students withdraw or get discouraged and wind up
accomplishing less than if they hadn’t received the failing grade from the teacher at all
(Griffin, 1993). By providing students with several chances to be “victorious”, this unit
allows students to celebrate their education by obtaining higher levels of motivation.
Alternatively, teachers should not be in the habit of always giving “good grades” to
students, especially if it is not deserved. Lately, it seems as though many of my students
“expect” good grades even if they are doing poorly in my class. Based on success in
previous materials or even prior classes, students believe they deserve the exception to be
made for them. If students are doing poorly, there are always opportunities to prime
them in meaningful ways with a few chances to get some high scores. By using a variety
of different forms of alternative assessment, this unit provides several opportunities for
students to receive high scores.

There is a huge push in education for alternative assessments that reflect “honest”
work (Bourdillon and Storey, 2002). These kinds of assessments, such as problem based
assessments, and oral assessments, when done correctly can “not only improve levels of
understanding, but also increase acceptance of ownership for their performance, product,

and grade.” (Shepardson, 2001) By not just using traditional paper and pen tests, quizzes,

and assignments, students can be assessed based more on their performance on a specific
task, and not on “how much information they can recite based on memorization. The
hands—on labs, activities, and performance assessments included in this unit do just that.
They allow students to show off what they can do. Traditional tests can also be stifling
for a majority of students. Every year I hear many students tell me the same thing about
tests. They proclaim that they are “poor test takers” and that is the source of their
frustrations in the classroom. According to Putnam (1997), “there is clear evidence that
test scores can provide inappIOpriate and biased information that can be detrimental to
students.” This unit is designed to assess student knowledge and mastery in a way that is
consistent with the way it is presented.

One final component of the unit I have developed to help motivate students is to
make the unit itself interesting and “fun.” Obviously there are different levels of fun, and
fun is a very subjective topic for all people. Being able to work with peers, move about
the classroom, and get your hands dirty is more fun than many teacher-centered learning
techniques. Raffini (1996) states that making a topic fun for your students will help to
intrinsically motivate students, and increase their involvement in the classroom
community.

As a high school science teacher, I strive to provide an educational and nurturing
environment in which students work both cooperatively and individually to learn
scientific concepts. Students in my class can expect to do hands-on labs and activities on
an average of three days per week. Students are undergoing various forms of assessment
ahnost daily. The genetics unit I developed is not unique to these guiding principles of

my teaching methods. In addition to sticking to these beliefs, I also worked diligently to

provide students with a good foundation of basic and molecular genetics and pertinent
background information. Underlying the goals of teaching the subject matter, the unit I
have created also attempts to increase student motivation by engaging students with
challenging tasks and problems that are solvable, and provide students with chances to be
successful throughout the unit through alternative assessments. Students are also
provided the opportunity to have fun with the hands-on cooperative learning style I
employ.

Michigan Center Public School district borders the southeast comer of Jackson,
Michigan, in the village of Michigan Center. It is a small school system with two
elementary schools and a consolidated Jr. and Sr. High School and a total enrollment of
1200 to 1300 students. The village has limited racial and ethnic diversity and the
population is predominantly lower middle to upper lower class blue-collar workers. The
predominant employers in the area are the Jackson State Prison, the largest single
employer in Jackson County, and many automotive parts production facilities. Michigan
Center High School houses 625 students from grades 7 — 12. Approximately 400
students are enrolled in a senior high school curriculum that varies from general to
college prep. The majority of Michigan Center graduates (50 —- 6O %) will enroll in a
college, university, or trade school. Others will enlist in the armed forces (5 — 10 %),
enroll in an apprenticeship (1 —— 5 %), or seek employment (20 — 25 %). Our dropout rate

is between 3 — 5 % and our daily attendance rate is between 93 — 97 %.

10

IMPLEMENTATION

I currently teach Biology, Advanced Biology, and Chemistry, which is one-half of
the science curriculum we have at the high school. All students are required to take
General Biology as sophomores and must average at least a C — on a 4.0 scale to take
Advanced Biology as a junior or senior. I began teaching at Michigan Center six years
ago and the 2001 —- 2002 school year was my first year teaching the Advanced Biology
class. The basis for my MSU research was to design new teaching materials for a unit
that will be taught to my students on the subject of Genetics. I chose the Advanced
Biology class as the target group of my thesis because it was a new class and I was trying
to develop units for the class that were both meaningful and motivational for my students.
I felt the class needed a genetics unit that was both exciting to learn, as well as a
challenge for students to master. 1 also taught all sections of general Biology and I felt
this was a good target group because I have taught all of them before and had a good idea
of what prior knowledge these students had on the subject of genetics. They do have
some materials presented to them as sophomores on the topic, but the depth and scope
were minimal. The class was comprised of 20 students who all read and signed a release
form (Appendix A) to allow me to analyze and report on their work. Also, each had a
parent or guardian do the same.

The unit I developed was based on six clear subject-matter goals (Table 1) for all
students. These goals were to be able to differentiate between DNA, chromosomes, and
genes. Goals two and three were for students to be able to draw Mitosis and Meiosis

respectfully. Goal four was that students know about the process of Gel Electrophoresis.

ll

Goal five was that students can differentiate between gametes and zygotes, and goal six

was that students could do simple Mendelian genetics monohybrid crosses.

 

 

 

 

 

 

 

 

 

 

 

Table 1 - Goals of expected student mastery
Goal Task
1 Students will be able to differentiate between DNA,
chromosomes, and Genes.

2 Students can draw and explain Mitosis.

3 Students can draw and explain Meiosis

4 Students will know what Gel Electrophoresis is, and
restriction enzymes role in this process.

5 Students will know the difference between zygotes and

gametes.

6 Students will be able to do simple Mendelian genetics

problems such as monohybrid crosses.

 

The unit I developed, based on my MSU research experience, is a genetics unit
that required 6 weeks of class time (Table 2). All labs, activities, and assessments were
new to the class and were developed over the course of the summer at Michigan State

University.

12

 

Table 2 - Unit outline

 

 

 

 

 

 

 

 

Week # Topic(s) covered in order Teaching tools used
Consent form &Prior Knowledge Unit Pretest
Mitosis Mitosis Labl
Week 1 Mitosis Lab 2
PowerPoint Notes
Oral assessment
Cell Cycle PowerPoint Notes
Cell Cycle lab
Week 2 Meiosis Dipstick Meiosis
Oral Assessment
DNA Structure and Function PowerPoint Notes
DNA from fruits and veggies
Electrophoresis Assignment
Week 3 What is Gel Electrophoresis Gel Electrophoresis of food coloring
Start Mating Fruit Flies Mating Fruit Flies
Gel Electrophoresis & Electrophoresis of Lambda DNA
Restriction Enzymes Restriction Enzymes Quiz
Week 4 Continue Mating and scoring Fruit Mating Fruit Flies Lab
Flies PowerPoint Notes
Review Mendelian Genetics
Application of unit and review Fruit Fly Applied Genetics Projects
Week 5
Continue scoring Fruit Flies
End of scoring of Fruit Flies Lab report summarizing Lab
Population Genetics and review Human Heredity Studies of Families
Week 6 and populations
Final Assessment Unit Post test

 

 

 

I began the unit with a pretest (Appendix B) to test students for prior knowledge of the

13

 

tepics to be taught. The pre test was graded based on a common rubric (Table 3) based

on a 3-point scale.

 

 

 

 

 

 

Table 3 — Pre test Grading Rubric
Points Rationale
3 Completely Correct
2 At least half Correct
1 Less than half correct
0 Blank

 

 

 

 

The rubric in Table 3 is provided as a guide to how all questions were generally scored.
The nature of the questions themselves affords a great number of possible answers to the
questions. The questions also are different from each other in many ways. I have
provided a few sample rubrics to give readers a feel for what was expected of students’
answers. Question 2 on the pretest (Table 4) is a simple monohybrid cross involving the
trait for height of plants. Students were rewarded based on correct answer as well as

effort in answering the question.

 

Table 4 —- Pretest rubric sample 1
Question 2 - Explain everything you can about the cross Tt x Tt where T = tall
and t= short

Points Expected answer(s) to receive points
awarded

 

 

Tall is dominant trait to shortness. Cross will give 1 TT22 Tt:l tt
3 genotypic ratio and a 3 tallzl short phenotypic ratio. Tt plants will
show tallness but will be carriers of shortness.
Tall is dominant trait in cross. Offspring will be 3 tallzl short.
Some plants will be tall and can produce short offspring.
2 OR
Tall is dominant trait in cross. Offspring will be 1 TT (tall):2 Tt
(tall but carriers of short):1 tt (short)
All but 1 plant is tall (tt)

 

 

 

 

 

 

1 Or
Any response given even if incorrect
0 No response given

 

14

Question 8 on the pretest (Table 5) is a question to see if students can tell the difference
between individual sex cells, called gametes, and fertilized sex cells, called a zygote. It

also is intended to see if students know how these apply to traits on a punnett square.

 

Table 5 - Pretest rubric sample 2
Question 8 —— What is the difference between a gamete and a zygote? What
significance do they have in a punnett square? How much of the possible
amount of information does each one have (Haploid and Diploid)?
Points Expected answer(s) to receive points
awarded

 

 

A gamete is an unfertilized sex cell (egg or sperm) and a zygote is
a fertilized sex cell that becomes an embryo. The traits from each
gamete are placed on the outside of the Punnett square and they

3 possess half the genetic information of an organism and are called
haploid. Inside the Punnett square, the letters are combined,
representing the genotype of a possible zygote. These individuals
possess the full amount of genetic information and are called
diploid.

A gamete is an egg or sperm and a zygote is a fertilized egg. The
egg and sperm possess half the genetic information. Once the
sperm hits the egg, it has all the information.

2 Or
The gamete goes outside the square and the zygote goes inside the
square. They box has all the information. Haploid has something

 

 

 

 

 

 

to do with half.
A punnett square is the box used to see what kids will look like.
1 Or
An) response given even if incorrect
0 No response given

 

As with other questions, students were rewarded for the amount of information they
know as well as the quantity of effort they put into answering the question. If any answer
at all is given, students received at least 1 point. Question 9 (Table 6) is a question
pertaining to Mitosis and Meiosis. Students were asked to differentiate between the two
processes in terms of the individual stages, the end products, and the types of cells that

undergo each process. Students may explain all this information or may draw the

15

individual stages of each process, or a combination of both. Since the drawing is such a

specific task, I don’t, at this point, expect anyone to draw the processes.

 

Table 6 — Pretest rubric sample 3
Question 9 —- What is the difference between Mitosis and Meiosis in terms of
each of the following: Final products, cells undergoing each process, Stages in
each, types of cells or organisms that undergo each can be drawn below.

Points Expected answer(s) to receive points
awarded

 

 

Mitosis is a process to divide diploid cells and give two identical
daughter cells to the parent cell when finished. It is composed of
the stages “IPMAT”. The chromosomes copy themselves, then
split in half and eventually split into 2 separate cells. Each new
cell is also diploid. Cells formed this way may also be referred to
as “clones.” Meiosis is the process where reproductive cells, sperm
3 and egg, are produced. For each diploid cell that divides in this
process, 4 haploid cells are produced. These cells become the
sperm or egg that is used in reproduction of the organism. The
process involves Meiosis I and Meiosis H.
Or
Acceptable student drawings showing complete stages of Mitosis
and Meiosis. May be combined with any of above information.
Mitosis involves the splitting of the chromosomes of a cell and it
goes through stages IPMAT. The new cells look identical to the
parent they came from It gives 2 new cells.
Or
2 Meiosis is the way sex cells reproduce. It forms sperm and egg.
The chromosomes split in half through a bunch of steps called
IPMAT. The cells have half the genetic information than the
parent cells they came from. It gives 4 new cells.
Or
May combine drawings of some stages with above information.
Mitosis provides 2 cells and Meiosis gives 4.

 

 

 

 

 

 

1 Or
Any response given even if incorrect
O No response given

 

Following the pretest, students engaged in three activities to support written text
and lecture material on the topic of Mitosis. The first one, Mitosis Lab 1 (Appendix C),
has students look at and draw prepared slides of plant and animal tissue undergoing

Mitosis and cell division. Various cells are suspended at different stages of Mitosis and
16

can be identified easily by looking at the pre-stained chromosomes. Students used their
textbooks to help them identify cells at the various stages of Mitosis both in plant and
animal tissue. They also looked for the subtle differences between plant and animal
Mitosis. The students turned in completed drawings made during the activity. Mitosis
Lab 2 (Appendix C), “Dipstick Mitosis”, is an activity that uses tongue depressors
painted different colors to represent duplicated Fruit fly chromosomes. Each group of
students received a freezer bag with pre-painted tongue depressors, string to represent
spindle fibers, paperclips to represent the centromere to hold the chromatids together, and
two envelopes to represent the nuclear envelopes that surround the nucleus. Students
used this kit to copy the stages of mitosis to show what the chromosomes / chromatids do
during each stage. When finished, students take an un-graded oral quiz in which they, as
a group, must be able to recreate the steps as well as recite written material about each
stage. The final lab, Mitosis lab 3 (Appendix C), addresses the “cell cycle”, which
describes how much time a typical cell spends undergoing each stage of Mitosis as well
as S, G1 and G2. Students use the prepared slides as before, but this time they are
counting how many cells they observe at each stage of Mitosis. They found the
percentage of each stage the cells based on the entire tissue. Since these are fixed tissue
we correlate these numbers to time spent in each stage. When finished, the class was
polled to see if they have numbers that are reasonable with respect to the whole class.
Anyone with drastically different numbers usually could not differentiate between the
stages. I also used a microscope camera and had students identify stages on a television.

This activity provided a review of the first Mitosis lab as well as an authentic assessment.

17

After covering Mitosis, we did the Dipstick Meiosis Lab (Appendix C), modeled after
Mitosis Lab 2. Students used the same lab materials as Mitosis Lab 2, but modeled the
stages of Meiosis. Students were assessed by reiterating the stages of Meiosis, what
occurred during each stage, and turned in drawings of the entire process made following
the activity. Following this lab, students must be able to differentiate between the stages
of Mitosis and Meiosis, describe what types of cells undergo each process and what the
resulting cells look like in terms of amount of information they each possess. Student
understanding was assessed after all four labs were completed, with students writing an
essay. Instructions were contained at the end of both “Dipstick” labs for the essay. It
was graded as complete / incomplete as the students had a list of topics to address on the
essay.

Following the tOpics of Mitosis and Meiosis, students learned about the nature of
genetic material, specifically, the structure of DNA and how it is packaged into
chromosomes. Students drew the double stranded DNA of at least 12 base pairs long.
They also must show in that drawing how a chromosome is a structure that has all the
cell’s DNA wrapped around proteins and condensed into an x-shaped structure at
Metaphase of Mitosis. The next activity involved students isolating and extracting the
DNA of fruits and vegetables (Appendix C). When finished, we discussed the fact that
all living cells possess DNA as well as why we were able to see more in some foods than
in others. Afier students could correctly identify and draw a picture of a DNA strand and
describe how it condenses to make a chromosome, we shifted to the three activities that
illustrate how pieces of DNA, corresponding to genes, can be separated by gel

electrophoresis of DNA. The first lab, Gel Electrophoresis of Food Coloring Lab

18

(Appendix C), is a lab designed to teach students how to run model gels using proper
technique. Students ran four different colors of food coloring through the gel and a
mixture of all 4 colors to see how the colors separate based on size of the molecules.
Students were now ready to repeat the lab using DNA. Students electrophoresed the
Bacteriophage lambda DNA to determine its size. We also talked about the applications
of electrophoresis technology to society. Students cut DNA using three restriction
enzymes. The assessment for these activities was a written quiz, Restriction Enzymes
Quiz (Appendix B). Students were able to explain the three restriction enzymes we used,
where they cut DNA, and what the relative sizes of gene segments are in terms of base
pairs. All this information can be displayed in a restriction map, which the quiz asked
students to make.

Following all the molecular genetics materials, Mendelian genetics was
introduced based on the genetics of the fruit fly, Drosophila melanogaster. For the
Mating Fruit Flies Lab (Appendix C), my students successfully sexed, mated and
identified flies with different traits. Students had a choice of mutant flies with one of
three different traits to mate with wild-type flies: White eyed, sepia eyed, and vestigial
winged. This activity, in addition to reviewing Mendelian genetics, also was used to
introduce the topics of life cycles, and sex-linked (X-linked) traits. Students had to
document the life cycle of the fruit fly, keep track of the sex and traits of all flies seen
through the F2 generation. Upon completion of the entire project, students were assessed
based on the paper they submitted Students were required to draw and explain all stages
of the fruit fly life cycle, and describe phenotypes and genotypes of the generations of

flies they hatched. They were required to do monohybrid crosses for the flies they mated

l9

for theoretical offspring and support this with their actual findings. This assessment was
very informal and its purposes were for student accountability, and as a means to decide
if the class could move on to the next topic.

The next thing students did was an Applied Genetics Project (Appendix C), to
study some other aspects of the information on Mendelian and molecular genetics. The
purpose of the project was to see how the information learned earlier in the unit is used
by scientists, and why it is important for students to know this information. There are
three parts to this group project. Part one addressed transformation of DNA from
plasmid into fruit fly. Students conducted library and Internet research on fruit fly genes
and were required to apply restriction enzyme technology, as a paper and pen activity, to
these genes. The project also required students to review protein synthesis and gel
electrophoresis in preparation for the impending post test. The second part of the project
was a review of different kinds of point mutations. Students showed the position of each
type of point mutation for the gene sequence they researched on the fruit fly. The third
and final portion of the project was on genetic engineering. In short, students explained
the steps they would follow to clone their chosen gene, and describe how society could
use this cloned gene. That is, where could they stick this gene into foreign DNA to make
a beneficial and possibly unique difference in that genome.

The last activity in this unit was Human Heredity Studies of Families and
Populations (Appendix C), based on easily identifiable dominant and recessive traits of
human beings. It required students to analyze many of their own traits to see what
genotype and phenotype they possessed, such as a widows peak, Darwins’ ear point, or

colorblindness. After analyzing themselves for these traits, students went around the

20

school and polled 100 people for two of the traits contained on the list. They used the
Hardy-Weinberg principle to determine what percent of the population are heterozygous
for a particular trait. Next, students chose two traits to track through their families. In
theory, this would allow students to see from whom they received a few of the traits they
possess. It also provides the carrier frequency of a population, so students can see how
many people are theoretical carriers of a trait that they may not show.

The post test (Appendix A) concluded the unit. The post test is slightly modified
from the pretest. It contains the same main topics, but the questions may have been asked
in a slightly different way or required more application of knowledge of the subject to
answer the questions correctly. This test was used as the overall assessment of how well
my unit was planned, implemented, and most importantly, learned by advanced biology
students at Michigan Center High School. Just as in the pretest, this test was graded on
the same common rubric (Table 7), but contained the same difficulties in using it.
Therefore, I will provide three sample rubrics to clarify how students were assessed.

These three questions correlate directly to the three questions that were discussed

 

 

 

 

 

 

regarding the pretest.
Table 7 — Post test Grading Rubric
Points Rationale
3 Completely Correct
2 Mostly Correct
1 Little to none correct
0 Blank

 

 

 

 

Question 2 on the post test (Table 8) is similar to question 2 on the pretest, which
asks about a monohybrid cross. This problem is a much more advanced version of the

same problem and requires a different rubric for grading. This question deals with a

21

cross between two people and the blood types of their possible children. In addition to
knowing how to cross traits, students must also know the related information on blood
type, which was covered by the population studies activity. Students are rewarded for the

amount and quality of the answers they provide on this question.

 

Table 8 — Post Test rubric sample 1
Question 2 - A man with AB blood marries a woman with O blood. What are
the possible blood types they could have for kids? Explain as much as possible
about blood types, the cross, and the possible children.
Points Expected answer(s) to receive points
awarded

 

 

Blood type is a case of multiple alleles, where both A and B are
dominant to O, and there are 4 blood types: A, B, AB, and O. O
3 has the genotype ii, and AB is the genotype of type AB blood.

Their kids have the possibility of 2 blood types, A and B. The
genotypes are Ai and Bi, which means they are heterozygous for A
and B, possessing recessive O alleles.
There are 4 blood types: Ai, Bi, AB, and O. The kids are A1 and Bi.
2 Or
There are 4 blood types: A, B, AB, and O. The kids are either type
A or B.
The kids are Ai and Bi.
1 Or
Any response given even if incorrect
O No response given

 

 

 

 

 

 

 

Question 8 on the post test (Table 9) asks students to compare the processes of Mitosis
and Meiosis only in terms of the final product of each process. Some of the descriptive
information that should accompany the answer to this question is found on the same
number question on the pretest. The assessment of this question is consistent with other

questions and again, students were rewarded for both quantity and quality of work.

22

 

Table 9 - Post Test rubric sample 2
Question 8 - Using the Pictures of Mitosis and Meiosis below, describe the
final products each process creates in terms of amount of information and
specific names or descriptions of each.
Points Expected answer(s) to receive points
awarded

 

 

Mitosis creates 2 identical daughter cells that are diploid, meaning
they have the full amount of genetic information. Meiosis creates 4
3 haploid cells that only possess ‘/2 the genetic information of an

organism. The original cell would be diploid. The 4 cells
produced are gametes, which are unfertilized sex cells, sperm or
egg. When the sperm and egg meet, they are called a zygote.
2 Mitosis produces 2 cells and Meiosis produces 4. The cells from
Mitosis are diploid and the ones from Meiosis are haploid
Or
Mitosis produces diploid cells and Meiosis makes sperm and eggs,
which have 1/2 the information, and are called gametes.

 

 

 

 

 

 

l Mitosis produces 2 cells and Meiosis produces 4
Or
Any response given even if incorrect
O No response given

 

Question 9 on the post test (Table 10) is almost identical to question 9 on the pretest. On
the pretest, I expected few, if no drawings to explain the stages of Mitosis and Meiosis.
On this question on the post test, I expected nearly everyone to use drawings to describe
these processes. Students were rewarded for effort and quality of answers. One point of
emphasis was the specific number of chromosomes / chromatids that their drawings
contained, as I expected students to overlook this issue or have drawings with too many

or too little numbers of chromosomes / chromatids.

23

 

Table 10 - Post Test rubric sample 3
Question 9 — Draw a generic diagram of Mitosis and Meiosis using fruit fly
chromosomes (4). You only need to label the following on one picture:
Chromosome, Chromatid, Centromere, and Spindle fibers. Make sure you label
the stages.

 

Points Expected answer(s) to receive points
awarded

 

Mitosis is a process to divide diploid cells and give 2 identical
daughter cells to the parent cell when finished. It is composed of
the stages IPMAT. The chromosomes copy themselves, so there
are 4 duplicated pairs, which then split in half and eventually split
into 2 separate cells. Each new cell is also diploid containing 4
individual pairs. Cells formed this way may also be referred to as
“clones.” Meiosis is the process where reproductive cells, sperm
3 and egg, are produced. Each diploid cell duplicates its
chromosomes and contains 4 duplicated pairs that divide in this
process and eventually form 4 haploid cells with 4 corresponding
chromatids/chromosomes. These cells become the sperm or egg
that is used in reproduction of the organism. The process involves
Meiosis I and Meiosis 11.
Or

Acceptable student drawings showing complete stages of Mitosis

and Meiosis showing 4 chromosomes of the correct colors. May be
combined with any of above information.

 

Mitosis involves the splitting of the chromosomes of a cell and it
goes through stages IPMAT. The new cells look identical to the
parent they came from. It gives 2 new cells.

Or
2 Meiosis is the way sex cells reproduce. It forms sperm and egg.
The chromosomes split in half through a bunch of steps called
IPMAT. The cells have half the genetic information than the
parent cells they came from. It gives 4 new cells.

Or
May combine drawings of some stages with above information but
have too many or too little a chromosome number.

 

Mitosis provides 2 cells and Meiosis gives 4.

 

 

 

1 Or
Any response given even if incorrect
0 No response given

 

24

 

RESULTS

Based on the results of the various assessment tools I used for this unit, a pretest,
quiz on restriction enzymes, an applied genetics project, the post test, and several forms
of authentic assessment, I can determine if the new unit I have made is a successful
teaching tool for the' subject matter.

The pretest was designed to determine prior knowledge, to serve as a guide for
meeting outcomes as an instructor, and to help me keep in mind what outcomes I wanted
for my students upon completion of the unit. Scores on the pretest (Graph 1) were based
on a 3-point scale and the rubric, and in general were very low. The average score for

the pretest (Table 11) was 0.9 out of a possible 3 points.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

The scores on the post test (Table 12) were higher. The class average jumped to a

2.3 out of 3 points possible.

25

Table 11 - Pretest class results (N=20)

Problem # Score Problem # Score
1 1.5 7 0.7
2 1.5 8 0.3
3 1.5 9 0.4
4 0.9 10 0.1
5 1.7 l 1 0.1
6 1.0 12 1.6

Average score 0.9

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Table 12 - Post test class results (N=20)

Problem # Score Problem # Score
1 3.0 9 2.4
2 2.3 10 1.7
3 2.4 11 2.3
4 2.5 12 2.6
5 2.2 13 1.0
6 2.0 14 N/A
7 2.4 15 3.0
8 2.3 16 1.9

Average score 2.3

 

 

 

The post test contains four questions at the end of the test that do not correspond to any
questions on the pretest. These questions are advanced trait problems that were included
in the test. The graph of the post test clearly demonstrates higher test scores in every

category. (Graph 2)

26

 

 

 

Average
Score

 

 

 

 

 

123456789101112
Problem Number

Graph 2 - Post Test Results

Average Score

 

12 3 4 5 6 7 8 9101112131516
ProblemNumber

When I taught this unit, I had a set of goals (Graph 3) for all 20 of my students to
achieve. Goal 1 was to be able to differentiate between DNA, chromosomes, and Genes.
Based on the common rubric, nineteen students (95 %) could not do this at the outset of

27

the unit and when asked to do the same thing on the post test, 20 students (100 %) could
correctly draw and define them. Goals 2 and 3 were for students to be able to draw and
differentiate between Mitosis and Meiosis. On the pretest, only 1 student (5 %) could
correctly draw the stages of Mitosis and no students could draw Meiosis. Six students
(30 %) knew there was “something about chromosomes splitting” or “dividing” and
eleven students (55%) did not even attempt the problem. When this question was asked
on the post test the percentage of correct responses was higher. Only 1 student (5 %) did
not attempt the problem and seven students (35 %) could completely draw and define
both processes. The other twelve students (60 %) were at least half correct with one or
the other process or were missing details. Goal 4 was that students would know what Gel
Electrophoresis is, and the role of restriction enzymes in this process. F ifieen students
(75 %) did not even attempt to answer this question on the pretest. For the post test,
twelve students (60%) of the class said “Gel electrophoresis can be used to solve crimes”
and one other student (5 %) could “tell the parent of a child”. Based loosely on labs and
activities we ran on Gel Electrophoresis and the quiz we took on it, eighteen students (90
%) not only knew what a restriction enzyme was, but could name 3 different ones as well
as at what base sequence each one cleaved. Goal 5 was for students to know the
difference between zygotes and gametes. They should also know that gametes are sex
cells and zygotes are fertilized sex cells. The pretest showed only 2 students (10 %) of
students could make this distinction. I gave an alternate assessment orally where all
students had to tell me the difference between Mitosis and Meiosis, as well as describe
gametes and zygotes following the dipstick meiosis lab and all students were able to

correctly walk through the stages of both Mitosis and Meiosis with the aid of tongue

28

depressors and their lab partner. They all were also able to correctly identify at what

point the chromatids / chromosomes represent gametes and zygotes.

Graph 3 - Mastery of goals
I Pretest % Post test %

Score

 

Goals

Goal 6 was that students would be able to do simple Mendelian genetics problems
such as basic monohybrid crosses (Graph 4). On the pretest, thirteen students (65 %)
could make a Punnett square to figure out the possible offspring of two heterozygous tall
parents. On the post test, only twelve students (60 %) got similar problems correct.
There were multiple questions pertaining to this goal and results are a combination of all
of them. On related questions for genetics problems that are more advanced, twelve
students (60 %) got question 16 on the post test, regarding sex-linked traits, correct.
Question 15 on the post test is a family tree containing colorblindness. All twenty
students (100 %) were able to answer this question correctly, while five students (25 %)
were able to discuss other forms of inheritance based on the genotype of the individual in

question 13.

29

Graph 4 - Questions related to different types of inheritance
I Pretest El Post test

Score

    

Simple traits Question 13 Question 15 Question 18

The overall scores of the pretest and post test could not be any more dramatically
difierent. I analyzed these scores in two different ways (Graph 5). The first is based on
score alone. All twenty students (100 %) had a score less than 1.5 on the pre test. The
highest score any student received was 1.4, which 2 students obtained. The average score
was a very low 0.9 for the entire class. The post test results were better. The lowest
score by any student was 1.2, which is not much lower than the high score on the pretest.
Seventeen students (85 %) posted a score of 1.5 or above. The high score was 2.8 and the
average score jumped up to a 2.3 on a 3-point scale.

The second way I compared the pretest to the post test was based on number of
unanswered questions. The pretest had a rate of just over nine students (46 %) per
question leaving blank answers. The post test saw this number drop to less than 1 student

(2 %) leaving questions with no response.

30

Graph 5 - Overall Comparisons of Pretest to Post test
I Pretest El Post test

 

Percent

     

Ave. Score High Score # Blank per #Above
» Question 50%

Students had the option to comment on the unit they had just completed on the
back of the post test. This was an informal invitation to comment on anything they
would like to tell me such as: did the unit improve your knowledge of the areas of
molecular genetics we studied? Of those that replied, 100 percent of them said “yes” and
“I definitely know more than I did a few weeks ago.” I also invited them to comment on
this unit compared to others I have taught to them. Responses I received were “ I thought
it was fun. We did a lot of cool labs” and “It was hard but I learned lots”. I also received
the comment “I didn’t think this was really any different from any of the others we have
done in the past. You always teach this way.” To me this was a real tell tale sign that all
the hard work was worth it. Only one student comment was negative: “It sucked There
was too much work. All the labs were boring except the DNA one”. Several students

replied that “it was pretty hard” which could be viewed as negative or positive feedback.

DISCUSSION

Without a doubt, I feel the new unit I have developed to teach genetics to high
school students was successful. The unit was designed carefully with six explicit goals in
mind (see Table 1). Genetics is a difficult subject for many students to learn. This unit
was designed to help students overcome this difficult material by helping build a strong
foundation on background information, addressing misconceptions both before and after
they become visible to me, and included several tools to provide a motivational push for
students to succeed, such as fun and exciting hands on activities, and several chances for
all students to be successful with authentic assessment methods. Data presented in this
paper clearly supports my claim that the unit successfully improved student knowledge of
genetics. The average score on a pretest was 0.9 out of a possible 3-point scale. Those
same questions were asked on a post test and the student average score increased to 2.3
out of 3. Both tests were graded based on a common rubric. Also, students’ confidence
on the subject of genetics improved. The pretest saw a high incidence of unanswered
questions, at just over nine students out of twenty total per question. This equates to forty
six percent of the class not answering each question each time, suggesting that they
lacked knowledge of the subject and therefore lacked confidence to even attempt the
question. On the post test, the rate of students’ unanswered questions fell to under one in
twenty. I feel the confidence they gained through the unit provided them with the
willingness to try answering questions, even when they did not necessarily know the
correct answer.

I feel that a majority of the unit was successful and worked as planned. The six

major subject matter goals I set at the beginning of the unit were clearly achieved. These

32

were t0pics we spent a lot of time on and prior exposure was limited There is no
surprise then that there were such huge gains in student achievement for these topics.
They really had nowhere to go but up. I expected that the scores would increase on the
post test, but maybe not such a large increase. I also find it interesting that not only were
students scores higher on the post test, but students also left many fewer unanswered
questions. This is interesting because the post test was a more difficult a test than the
pretest. I attribute this to the motivation aspect of the unit. I think students were
compelled to do better and were more confident in themselves, thus were willing to “go
out on a limb” and try answering questions they may not normally have tried I tried to
make this unit about success and victories rather than defeats. The many forms of
authentic assessment that allowed all students a good deal of success throughout the unit
should be mentioned as an integral part of the overall success of the students scores from
pre to post test.

Not all parts of the unit proved to be effective. According to the pretest, scores
show that students came into the unit with good knowledge of using a punnett squares for
predicting the outcomes of simple crosses. The post test saw a five percent drop in
correct responses. Does this mean five percent of the class forgot how to use a punnett
square to make these predictions? I believe the decline in the score is because the post
test question was asked in a more difficult way, and a more difficult cross was the basis
of the question. Proof of this was in the more advanced application crosses on questions
14 -— 16 on the post test. Students’ scores on those problems were consistent with the
easier Mendelian genetics crosses. Students’ post test scores were clearly lower on the

topics taught in the latter portions of the unit. The emphasis of the unit was on the

33

background material and the application was to show that it could indeed be useful. We
moved more quickly through this material, did less work with it, and post test scores
reflect this. Question 13 on the post test is about other forms of inheritance, and students’
scores on this question were the worst on the post test at an average score of 1 out of a
possible 3 points. You cannot always believe test scores, but I did find it interesting that
nine of the twenty students could tell me that a mutation was a mistake in the DNA or
gene of an individual on the pretest, yet they could not correctly differentiate between the
two on the post test. It shows you that sometimes, how a question is asked rather than
what the question is asking can mean all the difference in the score and even
interpretation of the question.

All units a teacher develops have portions that are more effective than others for a
variety of reasons. Anything by poor planning from the teacher to poor execution by
students can be a factor in the success of the unit. There are things that teachers ‘fix for
next time, things they keep as is, and of course, things to throw away and start over. This
1mit is no exception. I worked very hard for six weeks at Michigan State University
planning and creating these labs and activities, as well as countless hours during the
implementation and assessment of the unit In the future, I would break the unit into two
units. The first unit would be all the background information as outlined in this paper.
The second would be an applied genetics unit where application is the emphasis. Two or
three activities that encompass applied genetics, Biotechnology, Cloning, and different
inheritance types, as was the case of this unit, are too few to be effective in the long run.
These topics were not the emphasis of this unit, thus the corresponding scores on the post

test were low as compared to other topics taught in greater detail. The only drawback

34

would be in time constraints. There is very little time for a lot of additions to our Biology
curriculum based on the state benchmarks that must be taught. I also wonder if the Fruit
fly lab is a worthwhile activity. There probably are easier ways to introduce Mendelian
genetics that is both less time consuming and less expensive as well. I would like to
explore short term and inexpensive alternatives for future lessons. The entire exercise
requires about three weeks to successfully complete.

Successes and failures aside, overall, I feel the unit was both effective at teaching
genetics and reaching my goals, as well as successful in attaining higher student
understanding. By using a variety of tools to improve student motivation, such as visual
hands-on activities, cooperative learning, authentic assessment, and colorful and
engaging lecture notes using PowerPoint, I feel I was able to reach a broad spectrum of
students. I think this experience has reminded me of something I had forgotten, that all
students learn differently. The number of students that learn from traditional teacher
centered methods is small. As a teacher, I have to work hard to implement tools for all
units I teach to provide multiple learning styles as well as incorporate multiple methods

to continually increase students’ motivation in my class.

35

APPENDIX - A

36

Consent Form

Date: July 20, 2001

To: Parents, Guardians, and Students
From: Mr. Withers

Re: Collection of data for Master’s thesis

For the past 4 years, I have been working on my Master’s degree at Michigan
State University. Last summer I designed a genetics unit, which focuses more on a
handwn approach with more labs and activities and a tie-in to real world situations. The
unit will take approximately 10 weeks to commete.

In order to evaluate the effectiveness of this unit to your student, I will be utilizing
several different kinds of assessment tools. A pre- and a post-test will show beginning
versus final knowledge of the subject material. Labs, activities, writing samples, and
informal student interviews all will be used to gauge students’ improvements in this unit.
Homework responses also may be gathered. These tools will be required of all students
in the course of the class. With your permission, I would like to use data from the above
mentioned for my Master’s thesis. At no time will any students name be used in or
connected to the thesis.

Please fill out the bottom portion of this letter and return it to me as soon as
possible. For clarification, I am asking to use your student’s data from the Genetics unit
for my thesis. There is no penalty for denying permission to use your data and your
decision will not affect your student’s grade in any way. No students will be exempt
from any of the work, as stated earlier. This just means I cannot use the data in my
thesis. Your privacy will be protected to the maximum extent allowable by law.

Please contact the Internal Review Board chairperson David E. Wright at (517)-
35 5-21 80 for questions about participants’ rights as human subjects for research. Ifyou
have additional questions about this or any other thing involving your student or this class
don’t hesitate to call me (517)-764-1440. Thank you for your time and cooperation.

Yours in education,

Matthew R. Withers

—..‘.l—-Q—Q.*.O‘OD~D.-.‘_‘._h._.-*.._..-.D-.._..-..‘..-..—Q.—..-..‘..-..‘..-CQ—DI—OO

I give Mr. Withers my permission to use my data collected from the
Genetics unit in Advanced Biology. I have been informed that Mr. Withers will not use
my name and that all student data will remain confidential.

I do not wish for Mr. Withers to use my data in his thesis. I have been
informed that I will not be penalized for choosing to withhold my results.

Student Name Student Signature

 

 

Parent/Guardian Signature Date

 

 

37

APPENDIX -— B

38

Genetics Unit Pretest
“What do you know already?”

. Below, draw a picture of each of the following in as much detail as you can.
1. A DNA molecule (10 bases)

2. A gene

3. A chromosome before and after replication

 

l 2 3

 

 

 

 

 

. Explain everything you can about the cross Tt x Tt, where T = tall and t = short

. What is a trait? How are traits passed on from one generation to the next?

. Is there anything wrong with cloned organisms as far as health to that organism
itself?

. Cloning is a huge new topic related to genetics that is constantly in the news.
What can you tell me about cloning? Can you remember anything that has been
cloned?

. Differentiate between Brian and Mike Cram versus Jason and Jenny Craft? How
are they similar? How are they very different (genetically speaking)?

39

7. Last year we talked briefly about Genetic Engineering and its uses in society.
Tell me what Genetic Engineering is and a few places it would or could be
helpful. Examples you make up are ok if applicable. Possible areas of choice are
food, athletics, medicine, conservation, and agriculture.

8. What is the difference between a gamete and a zygote? What significance do they
have in a punnett square? How much of the possible amount of information does
each one have (Haploid and Diploid)?

9. What is the difference between Mitosis and Meiosis in terms of each of the
following: Final products, cells undergoing each process, Stages in each, types of
cells or organisms that undergo each can be drawn below.

 

 

Mitosis Meiosis

 

 

10. What is Gel Electrophoresis? Where could it be used?

40

 

11. What is a restriction endonuclease or restriction enzyme? Name a few.

12. All traits are not inherited according to Mendelian Laws. Below are some other

ways traits can be passed on from generation to generation. Explain each process
and give an example.

Mutations-

Incomplete Dominance-
Codominance-

Selective Breeding in animals-
Genetic Engineering (any type)-

MPPN?

41

Restriction Enzymes Quiz

1. For the “Withers” gene below, draw a restriction map with each enzyme and one
with all three enzymes.

ACGCTTCGATACGACCTAGGTCTAGATCTAGCTAGCTGATTGAATGAATGCTS
AATTCTTCATCTCTTTTCGAGATTCGAATGTCTCGCTCGCTAGTAGCTGATAA
AGCTGCCTGCTCGGCTCGTAGATCCTACGATGCGTACCGAGCQTAGGCGAAA
CTCATATCAGAGAGGAGATCTCGATGTAGCCTTTATATATAGGAGATMC
ATGAGAGAGGGGGCGCGCGCGTGTGTTTTGTGATTAGATGCTGCTACACATC
TCTGTGAGATCTGCTGATCGATGCTAGCTGCTACTGGTAGAGACATCACACCC
ATATC AACTTTGGGAGATTCTCGCTGCTATCGTAAAATTATTATATACTTAAG
CGATAC GAGGGAGATCTAGATCTAGCTAGCTGATTGAATGAATGCTAACTAT
ATTCTTCATCTTCGAACGAGAGATAGATGTCTCGCTCGCCTTAAGCTGATATA
TTCTCGCTGCCTGCTCGGCTCGTAGATCCTACGATGCGTACCGAGGGAGCGC
GACCCTCTCTCTCATATCAGAGAGGAGATCTCGATGTAGCCTTTATATATAGG
AGATGATCGCTGCGACACATGAGAGAGGGGGCGCGCGCGTGTGTTTTGTGAT
TAGATGCTGCCTAGGATCTCT GTGAGATCTGCT GATCGATGCT AGCTGCT ACT
GGTAGAGACATCACACCCATATCAACTTTGGGAGATI‘CTCGCTGCTATCGTGG
GAGAGAGAGAGGTTGTGT’ITATATGCCCCCGCGATAGTGCTATGCTGATCAC
ACAC'I‘T'I'ITCTCTCGCCCTAGGGGCGAGATCTGCTAGCTGCTGTTCGTGCTGT
TCGCGCGTGTTCGCGTGAATATCACCCA

C'ITAAG - EcoRI
CCTAGG - BamHI
TTCGAA —— HindIII

2. For the gene below, show what the gene would look like after the enzyme cuts it

ACGCTTCGATACGACCTAGGTCTAGATCTAGCTAGCTGATTGAATGAATG
CTCAA'I‘TCTTCATCTCTTTTCGAGA

42

Fruit Fly Applied Genetics Projects

1. Transformation of Plasmid DNA into Fruit Fly

3.

b.
c.

.0

Choose one of the following given gene sequences of the fruit fly:
Apterous (2), Clift, Vestigial (2), or Hairless.

Print or write out the base pair sequence for that gene.

Using one of the 3 restriction enzymes (EcoRI, HindIlI, and BamI-II), find
the specific gene sequence the enzyme recognizes. Show what that gene
would look like after the enzyme has cut it into smaller pieces.

Draw a Restriction map of the gene.

Using your base pair rules and an Amino Acid chart, convert the codons to
the Amino Acid sequences for each segment of that gene.

Make your own lab for food colors. You will need to make a set of 3
samples that when run on gel will resemble the Maverick gene cut with
EcoRI, HindIII, and Barn HI. Do this during ElectrOphoresis of food
coloring lab.

2. Mutations

a.

Using the gene you just cut, choose one region (I would choose the
shortest!) Using the sequence of that segment, show how that segment
would look after each of the following point mutations occurs to the
segment: Substitutions, Insertions, and Deletions.

3. Genetic Engineering

3.

Choose a gene from the dipstick chromosomes of Drosophila Explain
what trait you chose and what is appealing socially about that trait. Why
clone it???

Explain the steps you would need to go through to clone the gene in
question Explain this process from beginning to end. You are starting
with 1 specific gene of a fiuit fly. When finished you need to replace that
gene elsewhere. This will involve making a Chimera (remember
transgenic plants and animals?)

43

Genetics Unit Post Test

1. Draw a picture of DNA, genes, and chromosomes.

2. A man with AB blood marries a woman with 0 blood What are the possible
blood types they could have for kids? Explain as much as possible about blood
types, the cross, and the possible children.

3. Clift eyes are autosomal recessive on chromosome # 2. A Clifi eyed male is
crossed with a normal female carrier. What % chance do they have of having a
wild type female?

4. There are all sorts of animals being cloned and even companies advertising for

you to clone your pet. What aren’t scientists telling you about cloned animals

5. Briefly describe the way to clone a sheep.

44

6. Describe a natural way to clone an organism and describe what we commonly call
them.

7. You are the paternity tester for the Jerry Springer show. This particular group of
freaks has a real problem. . . who is the father of little Johnny? Below is the
sequence of all their DNA run before the show. From this data, determine who
the father is.

Mom John Rick

L—r

im Father:
Evidence:

 

 

 

 

 

llllé’.

 

 

 

lllll
lllll

 

 

 

 

 

8. Using the Pictures of Mitosis and Meiosis below, describe the final products each
process creates in terms of amount of information and specific names or
descriptions of each.

45

9. Draw a generic diagram of Mitosis and Meiosis using fruit fly chromosomes (4).
You only need to label the following on one picture: Chromosome, Chromatid,
Centromere, and Spindle fibers. Make sure you label the stages.

MITOSIS MEIOSIS

 

 

 

 

10. You are working for the State Police in the Forensics Unit. What would you use
Gel Electrophoresis for in this job?

1 1. What steps would a scientist use to create the gel plate shown on number 7
above?

12. Where could I find DNA if I wanted to find it? Be very specific in terms of all
organisms as well as food products. I Need both items answered.

46

 

13. How can you explain the following? Hairy wings are dominant to normal wings
in fruit flies. Also hairless is recessive to hair possession. How could a fly with
the dominant hairy wing gene be hairless? Assume no random mutations have
occurred.

14. Below is the pedigree of a family with colorblindness

"l—O

 

 

 

 

36“

B Male 0 Female

were

Male Female
with trait with Trait

     

 

15. What role do women typically play in this scenario?

16. Label the genotype of all individuals of the F2 generation above.

47

APPENDIX - C

48

Mitosis Lab 1
Purpose: Compare Animal Mitosis to Plant Mitosis.
Directions: Look at, compare and Draw Plant Mitosis (Onion or Allium Root Tip) vs.
Animal Mitosis (Whitefish) at each stage of Mitosis. Also, briefly describe what is
happening to those cells at each stage. There are general statements that can be made

about all cells undergoing Mitosis and there are also subtle differences between Plant and
Animal Mitosis. Be sure to note those subtle differences no here as well.

Plant Animal

49

Mitosis Lab 2
“Dipstick Mitosis”

Background: Mitosis, also known as cell division, is a process that diploid cells undergo
to create identical copies of themselves. Nearly all organisms at one point or another
undergo a mitotic division. Refer to your notes for the exact steps for this lab. Fruit Flies
have 4 chromosomes so this activity will use 4 chromosomes undergoing Mitotic
division. Remember the goals of Mitosis so you have cells with the correct amount of
Genetic Material when finished. Also remember that for all organisms V2 of the
information comes from Mom and ‘/2 comes from Pop.

Materials: Pre-made chromosome packages containing: 1 Ziploc bag, 16 tongue
depressors of varying colors (2 light and 2 dark of each color), 8 large paper clips, 2
enve10pes, 16 pieces of string. Note: For this lab we will be using the side without the
genes on the Chromosomes.

Procedure

1. Follow the stages of Mitosis using 4 chromosomes and a paper clip as the
centromere. The light colored chromosomes were from the mother and the dark
colors were from the father. String will represent spindle fibers.

2. Draw, label the phases of Mitosis, and label the structures involved at each phase

of Mitosis in the circles below.

Count the number of chromosomes in each cell at each stage.

You must be able to go through and explain each stage with your kit without

notes before you are finished.

PP

 

 

 

 

51

 

 

 

 

 

F ollow-up: Write a l-page typed essay explaining your lab. Cite specific references
from the lab and the thought questions below.

.O‘MPP’N!"

Explain fully the comparison of the parent to offspring following Mitosis.
What happens to the chromosomes following Telophase?

What cellular events occur during Interphase?

What do the Spindle fibers do for the cell?

Compare and Contrast Human Mitosis to Fruit Fly Mitosis.

Why are there 2 colors for chromosomes?

52

Mitosis Lab 3
The Cell Cycle

Purpose: To determine How Long a cell spends doing certain tasks.

Instructions: Looking at the prepared slides of Mitosis (plant or animal), Choose one of
the tissue samples (there are 3 root tips and 12 Whitefish samples per slide). Count the
number of cells in each stage of Mitosis. Figure out the percent of cells at each stage of
Mitosis. This will be impossible to be 100 % accurate. Do your best!

' . # Cells seen in Percent of total
Stage of MltOSlS this cells in

 

Post Lab Questions
1. Draw and explain the cell cycle

2. Relate your lab results to the cell cycle

3. Why would you not want all cells at the same stage of Mitosis at the same time?

4. Which stage was definitely at the highest percent in your tissue sample? Why is this
so?

53

“Dipstick Meiosis”

Introduction

Gametes are specialized cells that are used in sexual reproduction. It is important that
gametes have half the number of chromosomes as regular body cells. Male gametes,
called sperm, are made by a process called Spermatogenesis, and female gametes, called
egg cells, are made by Oogenesis. When the sperm and egg unite to form a zygote during
fertilization, the resulting cell must have the diploid nmnber of chromosomes. In order to
maintain the proper number of chromosomes in offspring, gametes must undergo a
reduction division called Meiosis.

In this activity you will be simulating the phases of meiosis using models of fruit fly
(Drosophila melanogaster) chromosomes. These chromosome models contain specific
genes that we will be working with later during the fruit fly lab.

Materials

Pre-made chromosomes package containing: 1 Ziploc bag, 16 Pieces of String, 8
Paper Clips, 16 Tongue Depressors of varying colors (8 dark colors and 8 light colors), 4
envelopes, Colored pencils.

Procedure
1. Using the kit provided to you model the stages of Meiosis.
2. Draw and label each of the stages of Meiosis below or on another piece of paper.
Be sure to label the following for each drawing if applicable: Haploid number,
Diploid number, Number of chromosomes, and the stages of Mitosis.
3. You must be able to explain each step without the aid of a book or notes in order
to move on.

Post-Lab -
In a l-page typed essay explain Meiosis. You must cite specific information from the
lab as well as information from the following thought questions.
What is the purpose of Meiosis?
What is a gamete, zygote, haploid, diploid, homologous pair?
Why does Replication occur in Meiosis I but not in Meiosis II?
One of the great advantages of organisms that use Meiosis to reproduce is genetic
diversity. List at least 2 possible sources of genetic diversity besides mutations.
5. What happens to 2 Meiotic cells that unite? How do they progress (grow) into an
organism?

PWNT‘

54

Extracting DNA from fruits and veggies

The purpose of this lab is to extract DNA from several different fruit and
vegetable matter. DNA, which stands for deoxyribonucleic acid, is a double - stranded
polymer molecule loaded with the cells instructions. DNA is made up of genes, the units
of inheritance that convey information within a cell for cellular duties and from parents to
offspring. DNA is found in any cells that are considered living.

In order to extract DNA from different samples we will need a buffer solution. A
buffer is a substance that resists changes in the concentration of II" and OH'. As a result
of a buffer, biological fluids resist change to their pH when acids or bases are introduced.
Buffers work by accepting hydrogen ions from the solution when they are in excess and
donating hydrogen ions to the solution when they have been depleted. Most buffers are
weak acids or weak bases that combine reversibly with hydrogen ions. A buffer is
necessary in this experiment for its ability to break apart the structure of DNA. A buffer
carries with it a negative charge. A strand of DNA gets its structure as result of the
hydrogen bonds between nitrogenous base pairs. Chromosomes also contain histones,
which are electrically charged. The negative charge of the buffer attracts the histones
and breaks apart the bonds. This allows the DNA to be separated and easily extracted.
Baking soda (Na2C03) is also used in this experiment because when placed in an aqueous
solution, the baking soda is converted to 2Na+ + C0321 The negative charge on Cng'
attracts the electrically charged amino acids and If. This helps the buffer solution to
separate the DNA, and at the same time it maintains the pH of the solution. Dishwashing
liquid aids in breaking apart and separating DNA from the proteins.

MATERIALS:

Buffer solution, Distilled water, 2 Fruit or vegetable samples, Mortar and Pestle, 4
clean test tubes, 2 Rubber stoppers, 2 Coffee Filters, 2 wooden sticks, Ice cold ethanol
(95%), Electronic balance, 2 pipettes, 2 pieces of filter paper.

Part 1 — Obtaining DNA from Fruits and Veggies

1) Dice a IO-g sample of the fruit/vegetable matter.

2) Place the diced sample in the pestle.

3) Add 20 ml of warm distilled water to the pestle.

4) Crush the sample with the mortar until all dices are gone and you have a thick
liquid.

5) Four 10 ml of the buffer solution into the test tube.

6) Filter out 10 ml of the sample. If you have lots of chunks of fruit in there, filter
again.

7) Pour the sample in with the buffer.

3) Cap the test tube gently mix for 2 minutes (invert). DO NOT SHAKE THE
TEST TUBE!

55

9) Slightly tilt the test tube and gently pour 10 ml of ice-cold ethanol on top of the
solution.

10) Record your observations on the data table.

11) Insert a narrow wood rod through the alcohol layer -- just below the boundary
of the alcohol and buffer. Gently twist the wood stick and spool the DNA
around the stick.

12) Repeat Steps 1-12 for your second sample.

13) Label both tubes and share with classmates that need them.
Data Table l

 

Fruit or Veggie COLOR TSPOOLABLE?

 

 

 

 

 

 

 

 

 

 

 

 

 

5”!”

9°99.“

Part 2 - A Quantitative look... Which one gave the most DNA?

. You will find the Percent Composition of the DNA from both your

samples.

Mass a piece of filter paper.

Using a disposable pipette, suck up the DNA in the test tube that is
suspended between the ethanol and the buffer/filtrate solution Be sure
you don’t get the filtrate. The ethanol will evaporate off.

Place the filter inside a funnel and squirt the pipette through it into a test
tube.

Wash with ethanol by pouring about 10 mL of ethanol through the filter.
Set your filter somewhere to dry (probably overnight).

Re—mass your filter paper.

Fill in Data Table 2 below.

56

9. Calculate the Percent composition of the DNA collected by:
% comp = Mass sample X 100%

Mass DNA

DATA TABLE 2

 

Conclusion 4 write an essay to explain the lab and its results. Include things to think
about below as well as other stuff from the lab and results.

Which ones seemed to produce the Best DNA? Worst?
Which ones produced the Most DNA? Least?

Why did we wash the sample with more ethanol?

Why does the DNA Spool (or why should it?)

Why did we need to smash up the fruits and veggies?

What is the purpose of the buffer?

. Should this work on animal as well as plants as we have done?

flewewwe

Teacher Reference

Suggested fnrits and veggies
Broccoli (florets)

. Cauliflower (florets)
. Kiwi (peeled)
Onion

. Banana (peeled)
Tomato

. Lemon (peeled)

. Lime (peeled)

ooqoutpwur.

57

To create the buffer solution

120 mL distilled water

1.5 g table salt or NaCl

5 g Baking Soda (N32CO3)

5 mL Ultra Dawn (Blue) dish soap

P939!"

Results

1. I have found that the Broccoli, Cauliflower and Banana work the best. There is as
much DNA in each of the floret’s as other cells however these are smaller and
more numerous cells! The Banana is questionable if it is DNA or RNA but works
just the same.

2. The others don’t work as well due to the size of the plant cells they are found in.
They are large and filled with lots of carbohydrates and water for storage. They
have small nuclei per space compared to above. I found the onion to be the
worst!

Modified from original lab at:
http://biologv.dgmien.edu/biology/apZSmdents/arigalde/labs/DNA Extractionhtml,
and Michael Sampson at Redford Union Schools

58

Electrophoresis Assignment
1. What is a restriction enzyme?
2. Name the 3 enzymes we used to cut Lambda DNA
3. What is a Bacteriophage?

4. What are the specific sequences that BamHI, EcoRI, HindIII cut?

5. Look up the maverick gene on Chromosome 4 of a fi'uit fly. Print the sequence
out and attach to the paper. How many base pairs is it?

Go to: http://wwwncbinlmnih. gov/ggi-bin/Entrez/getff?gi=73 l6093&form=2&db'—'N&
from =12847734&to=12854690

6. Using the 3 restriction enzymes above, show what the maverick gene would look
like when each enzyme is applied to it. And one with all 3.

7. Draw a Restriction Map of the Maverick gene in well 1, HindIII in #2, BamHI in
#3, and EcoRI in #4, and all 3 in #5.

59

Food Color Gel ElectrOphoresis

Gel Electrophoresis is a process that can be used to separate DNA fragments.
Scientists use this process to look at and compare DNA strands. It is used for research
purposes, solving crimes, and determining heredity within families. The process is
similar to chromatography in that molecules are separated based on size. DNA is a
negatively charged molecule and therefore runs toward a positive charge. Heavier
molecules will separate out early and therefore will not move as far through the gel. The
lightest molecules will run the longest distance towards the positive electrode.

Molecules that are not DNA can also be separated using this process with a few
variations, however. Food Coloring is a variety of dyes to give the characteristic “color”
you are looking for. Different dyes will separate similarly according to size. We will be
separating different colors of food coloring based on size. The purpose of doing this
activity is to model the process of Gel Electrophoresis and to practice setting up these
labs.

Materials: 1 Gel Electrophoresis set-up (box, comb, 9 volt batteries, clips, Carbon fibers,
20 ul micropipettes), several samples of food coloring solution (pre-made), Agarose,
distilled water, TBE buffer.

Procedure:
1. Pour enough 3% Agarose gel into your well to cover the bottom but not overflow
the chamber.

2. Place the comb in the well in the appropriate spot. Let this sit until it solidifies.

3. Choose 4 different colors of food coloring. Take those vials back to your seat
with you.

4. On a clear piece of paper, label wells 1-4 with the 4 colors you will use so you
know what was in each well of the gel box.

5. Cut 2 carbon fibers 22 mm x 42 mm. These will be the electrodes to pass the
current through.

6. Place an alligator clip on each carbon fiber (one black and one red).

7. Put the batteries together so three or five are together. The more you use, the
faster the gels will run.

8. Place the other end of the clips on the batteries. Red is positive and Black is
negative.

9. If your gel has solidified, slowly remove the combs, leaving 4 nice deep wells.

10. Pour enough TBE buffer (running buffer) to completely cover the gel and fill the
ends of the well. Don’t be afraid of having too much as more is better than less!

11. Using the given micropipettes put 20 ul food coloring in the corresponding well.
Be careful to not poke a hole in the gel, just fill the well. The liquid is less dense
than the TBE buffer so it should sink to the bottom of the well.

12. Once all 4 wells are full, place the electrodes in the chambers at each end with the
red at the opposite end of the solutions.

13. Let these run until they are almost to the end of the gel box. If you let them go
too long they will run right off the gel to the electrode.

14. When the dyes are finished, dump the liquid down the sink.

60

15. Place your box on the white paper you labeled earlier to see the colors and distinct

Nr—i

519‘?“

Direction of dye running

bands.
Diagram 1

Electrode chambers’\ <-—-Suggested TBE
H Gel Chamber fl level

 

 

 

 

Diagram 2

 

 

 

FJLIL lll

 

 

 

 

 

+

 

Conclusions and analysis —— Answer and explain the following questions
Draw a picture of your results for all four samples.

. Measure the length each color moved from the original well. Add to picture.

Explain each color. Original color, colors now seen, length of movement and
why they moved the length they did.

Based on your data and others, can you guess what the unknown is or what dyes
are in the unknown?

Why is the red clip at the far end of the gel box?

What would the results be if we used thicker gel? Thinner?

Would a strand of human DNA probably run slower or quicker than these dyes?
Why?

61

Teacher Reference

Kool-aide can be substituted for food coloring. The names of the dyes used are on the
back of the package. I found the food coloring to be better for seeing bands than the
Kool-aide.
To make the Food Coloring solutions (Should be enough for the entire class)
1. 50 ml TBE buffer: Can get from Carolina or make it yourself by the following
recipe.
a. 10.8 g Tris Base
b. 5.5 g Boric Acid
c. 20 ml 0.5M EDTA (pH 8.0)
-Disodium salt, dihydrate, crystal, Ethylenedinitrilotetraacetic acid
-3.722 g EDTA in enough distilled water to make 20 ml
d 1 L distilled water

2. Glycerine 5 ml
3. Food coloring 10 drops

The gels used were 1.5 % and 3 % Agarose. The thicker the gel the better the results
seemed to be as the Dye runs slower. To make the gel dissolve 1.5 g Agarose in 100 ml
distilled water for 1.5 %. For 3 % dissolve 3 g Agarose in 100 ml distilled water. You
can heat this up with gas burners or microwave. Make sure no chunks are in the gel.
Cover and this can be re-used until gone.

These run pretty fast as they are pretty small molecules. With 27 volts they were done
afier 1-1/2 hours. You may be able to speed it up with more juice. Also more
concentrated mixtures may help with darker coloration of the bands.

Unknown mixtures can be made by mixing colors. The limitation is that only 3 colors
can be made to separate out.

Gel boxes can be obtained a number of ways. They can be made or purchased I

purchased these from Carolina Biological. Classroom Kit $230.00 each. This gives 5
gel boxes and supplies for at least 10 labs.

62

 

Gel Electrophoresis of Lambda DNA
“Using Restriction Enzymes”

All living organisms share certain characteristics, among which is the possession
of genetic material, DNA. This is not limited to common things such as plants and
animals. Bacteria, and even Viruses have their own DNA

A Bacteriophage is a Virus that invades bacteria (see picture below). They are
like little hypodermic needles that insert their DNA into a host. Once inside the bacteria,
the phage DNA takes over the machinery of the host, or reproduces and kills the host.
The Lambda phage is a well-known Bacteriophage. It has double stranded DNA
wrapped around a protein core. It has a genetic make-up of 48,502 base pairs, of which
location and order are all known.

Bacteria have a defense against invading viruses such as Lambda phage. They
produce enzymes called restriction enzymes or restriction endonucleases. These enzymes
cut DNA into pieces, rendering it useless. These enzymes are site specific as each
recognizes a Specific sequence of bases within a strand of DNA and cuts at that point
There are many types of these enzymes and each recognizes a different sequence. We
will be working with 3 such restriction enzymes called EcoRI, HindlII, and BamHL

Bacteriophage
Lambda

Lambda DNA

 

 

H @ E130“
Preparing the gel

1 We are using a 3 % Agarose gel. Melt your gel using the microwave or a
burner. Make sure there are no clumps in the gel. Careful. ..Very HOT!

2. On a flat surface, pour enough Agarose gel into your box to fill the central

cavity (10 ml?)

Place the comb in the slot provided

Let sit for 20 - 30 min.

Once solid, add 15-20 ml TBE running buffer to the gel. The buffer should

overflow the electrode chambers.

6. Gently pull the comb out of the gel box.

MP.“

63

Prepare the electrodes and batteries

1.
2.
3. Put a red alligator clip on the positive terminal of one battery. Put a black on the

Cut 2 carbon fibers about 22 mm x 42 mm. These will be the electrodes to pass
the current through.
Put 3 9V batteries together.

negative.

Rehydrating the Lambda DNA

1.
2.
3.

Add 100 111 (micro liters) distilled water to the lambda DNA
Cap and allow the tube to stand for 5 minutes.
Mix the tube by flicking the side for 1 minute.

4. Allow the tube to stand 5 minutes.

Cutting DNA

1.

2.

3.

4.

With a new tip for each tube, add 20 ul Lambda DNA to the enzyme solutions.
Make sure you mix each thoroughly by drawing the solution up and down the
micro tip several times. Change tip before next tube.

Place the tips on the foam rack provided. Incubate at 37 °C in a water bath or
incubator for 30 minutes.

Place the tubes in hot water bath at 65 °C for 10 minutes. This breaks down the
enzymes.

If out of time you must either freeze this or run it!

Loading the DNA

1.

.N

NQ‘MPP’

Add 2 ul loading dye to the tube you wish to run first. Mix by drawing both
liquids in the tip several times.

Transfer the contents of the tube into the first well on the gel. Go slowly and
don’t tear the gel.

Repeat for each tube.

Once all 4 wells are filled you are ready to go.

Place one carbon fiber in each electrode tray. They can stick against the glass.
Alligator clip each one. Remember DNA is Negatively charged.

Let these run until finished probably 2 — 3 hours.

Staining the DNA

WNQ‘MFP’N?‘

Unhook the electrodes and batteries (so we can reuse them).

Pour off the buffer into a waste jar.

Pour about 10 ml Carolina BLUTM on the gel.

Let stain sit for 4 minutes on the gel.

Pour this into a waste jar.

Wash off the gel with distilled water.

Put the gel box in a plastic bag overnight.

The next day wash the gel again several times. Try leaving the water in longer.

Analysis and conclusions

1.

5"

Name the 3 enzymes we are using, their purpose and the sequence they each
recognize.

Draw a picture of your gel box with results of the lab. Measure length of band
from well.

Draw a restriction map of Lambda DNA with each enzyme.

Explain your results compared to the restriction map. Why do you not have the
same number of bmds? Which bands represent which parts of the map? Why?
What kind of results would we have if we changed the number of batteries to
utilize different time periods?

This lab was a lot of work for you and me. Also, it is quite expensive. Did you
enjoy it. . . was it worth it? Be brief

65

Teacher Reference

This lab was done using kits purchased from Carolina Biological. . Classroom Kit
$230.00 each This gives 5 gel boxes and supplies for at least 10 labs. There are also
Student guides that are both informative and visual.

4. 50 ml TBE buffer: Can get from Carolina or make it yourself by the following
recipe.

a. 10.8 g Tris Base

b. 5.5 g Boric Acid

c. 20 ml 0.5M EDTA (pH 8.0)
-Disodium salt, dihydrate, crystal, Ethylenedinitrilotetraacetic acid
-3.722 g EDTA in enough distilled water to make 20 ml

(1. 1 L distilled water

5. Glycerine 5 ml
6. Food coloring 10 drops
7. 1.5 % and 3 % Agarose

The thicker the gel the better the results seemed to be as the Dye runs slower. To
make the gel dissolve 1.5 g Agarose in 100 ml distilled water for 1.5 %. For 3 %
dissolve 3 g Agarose in 100 ml distilled water. You can heat this up with gas bumers
or microwave. Make sure no chunks are in the gel. Cover and this can be re-used
unfilgone.

 

 

 

 

 

 

 

 

Restriction Map of Lambda DNA

Uncut Lambda

l - - l

48,502 base pairs

Lambda cut with EcoRI

L ‘ I r r I r 1
21,226 4878 5643 7421 5804 3530

Lambda cut with BamI-II

L I n I l l l l

5505 16,841 5626 6527 7233 6770

Lambda Cut with HindIII

L I l I I II I l
23,130 2027 2322 9416 564 125 6557 4361

66

Mating Fruit Flies

The genetics and heredity of common fruit flies, Drosophila melanogaster, is well
documented Since Thomas Morgan first did his studies on these flies in 1910, fruit flies
have been a model for Mendelian inheritance. We will use the fiuit flies to understand
the basics of heredity and genetics to build off. We will also be taking a closer look at a
few specific genes (traits) such as sepia eyes, white eyes, vestigial wings, and ebony
body. These are all traits that differ from the “wild type” of the trait, which is the normal
trait

Day 1
Get your vial of flies. Note the parental traits already crossed for you You may need to
look up what this means. You will need to do the following tasks.

1. Determine the general differences between males and females. Go to FlyBase

2. Count the flies in the container based on traits.

3. Place an equal amount of males and females in a new vial with fresh media.

Should be between 5 and 7 of each.
4. Let grow for about 10 days or until you see lots of little larvae.
5. Check these daily to keep a good handle on them.

Day 2
1. When larvae are very active take out your F 1 generation.
2. Let sit until F2 generation appears.

Day 3
l. Knock out your F2 flies.
2. Count the trait and sex of each individual in the vial.

Analysis and Conclusions

1. Make a data table listing the results of all 3 generations of flies.

2. Make punnett squares of the crosses that created these different flies.

3. What would happen if your trait was epistatic and those traits were expressed in
your fly at the same time?

4. Which type of inheritance does this trait use? Why did you come to that
conclusion?

5. How do your results compare to another inheritance (x-linked vs. autosomal)?

6. Write an essay to explain the lab you have done. This is inclusive of results,

charts, tables, etc. You may draw pictures or anything you wish to make this look
nice.

67

Teacher Reference

Carolina Biological sells flies of the F1 generation so you don’t have to worry about
virgin flies. The P generation is removed before shipping so you should get your F1 flies
soon after. They also sell a number of different traits to look at. The F1 vials are $16.95

each.

To make nutrient media about (40 vials)
Materials needed

4.0.0.wa?

9 g Bacto-agar

450 ml cold tap water

62.5 ml Unsulphured Molasses

44 g Corn meal

18 g Yeast

125 ml cold tap water

. 12.5 ml 10 % PHBA in 95 % Ethanol

Steps to make media

1.

90519.“?

Add water and agar to a 1 L flask. Stir with a stirring bar and bring to a low
boil. Place a watch glass on top of the flask Watch the agar it boils over
easy.

While waiting for your agar to boil, combine corn meal, yeast, and tap water
ina l Lbeaker. Mixwithastirbar.

Add Unsulphured molasses and bring to a low boil. Keep top on as much as
possible.

Pour beaker to flask. Reduce heat and cook 10 - 15 minutes, stirring often.
Cool 5 minutes then add 10 % PI-IBA in 95 % Ethanol.

Soak plastic vials in 10 % commercial bleach for 2 hours and rinse.

Pour media into sterile vials and plug with sterile cotton

Cool before refiigerating.

68

Human Heredity Studies of Families and populations
Many traits are a result of the variation of only one gene, such as Dominant and
Recessive for one trait. Below is a list of several Human traits we can observe
phenotypically in families. We cannot always determine Genetically what these traits
look like. A dashed line is used to represent an allele not known For example if Purple
flower is dominant to white, a Purple plant could be PP or Pp. If we do not honestly
know the genotype of the plant we would write P- to represent a purple plant.

Attached Earlobes Most people have earlobes that dangle fi'ee. A person homozygous
for recessive allele (e) would have attached earlobes and the genotype (ee). When
looking at other people’s cars you will see much variation in size and appearance, all
separate genes. Only concentrate on lobes for this.

Widow’s Peak Some people’s hairline drops downward and forms a distinct point in
the center of the forehead. It is caused by a dominant allele (W). Unless you are bald,
you should be able to see this phenotype easily.

Tongue Rolling A dominant allele (R) gives about 70 % of the population the ability
to roll their tongues into a U-shape or funnel shape. Others who don’t possess this
gene can do little more than curve the tongue downward slightly.

Hitchhiker’ 5 Thumb Next time you are trying to get a ride home from school try
bending the top of your thumb back as far as possible. Some people can move it to
ahnost a 90 ° angle. The recessive allele (h) is responsible for the ability to do this.

Bent Little Finger A dominant allele (B) causes the last joint of the little finger to
bend inward toward the 4th finger. Lay both hands flat on the table, relax the muscles
and see if you have a bent or straight or bent little finger.

Long Palmar Muscle A homozygous person for the recessive allele (l) has a long
Palmar muscle that can be detected by examination of the tendons of the inside of the
wrists. Clench the fist and flex the hand toward the biceps. Feel the tendons. If there

3 you possess the trait for a long Palmar muscle. Ifthere are 2 you do not have this
muscle and are dominant (L). Check both wrists as it is sometimes present in one but
not the other because of variations in the expression of the genes.

PTC Tasting The ability to taste a chemical known as PTC (phenylcarbamide) is
controlled by a dominant allele (T). Homozygous recessive individuals cannot taste
this chemical in the weak concentrations used for the test If you are a taster you will
know it. Ifyou are wondering what you are supposed to taste you aren’t.

69

Color of the Iris of the Eyes A dominant allele (P) causes the pigment melanin to be
deposited in the front part of the iris, while the recessive allele (p) codes for a lack of
melanin in the iris. The eyes of those without the melanin, (pp) will appear blue
because of the reflection of the blue rays from the deeper layers of the iris, the same
reason that causes deep water to appear blue. The longer the wavelengths are not
reflected as readily as the blue. Those with the pigment may have eyes that range
from green to very dark brown, depending upon the amount of Melanin present. Other
genes determine the amount to be deposited. People with any shades are pigmented
and blue is unpigmented.

Mid-digital Hair Some people have hair on the second, middle, joint of the fingers
while others do not. The complete absence of hairs from all fingers is due to a
recessive allele (m) and its presence is due to a dominant (M). There seems to be a
number of these alleles which determines whether the hair shall grow on 1, 2, 3, or 4
fingers. The hair may be fine you may need a hand lens to check your fingers.

Blood Groups Find out your blood type. There are 4 such types for humans. They
are A, B, AB, and 0. Type A and B blood can be heterozygous with an (i) allele.
Type AB is just as it sounds and O is recessive (ii). The + or -— is due to the Rh factor
which is another set of genes.

Second finger shorter than the Fourth Hold your fingers together and see if you
possess this trait. Many believe this is sex-linked (x-linked). It is dominant in males
and recessive in females. Use the symbol S8 for short-fingered alleles and SL for long

alleles.

Population Heredity assignment

As a class, fill in the chart for your own phenotypes and genotypes based on the
instructions above. Then on the board add your results to the nmning totals for our
“population”. Make sure you answer each column that is applicable to you. When
done with this choose one of the 11 traits of interest. You need to find the same
information (Just for that Trait) for a total population of 100 people. Keep a list of the
people and their phenotypes. Fill this in on Chart 2 for 100 people. Then Use the
Hardy-Weinberg principle, which states the distribution of dominant and recessive
alleles in a population remains constant from one generation to the next as long as no
external factors affect the population. What Would be such external factors?

 

 

. Using the “HWP” will tell us the frequency of the
dominant to recessive alleles in a population. We can compare “expected” data using
HWP to our collected population data. How should they compare???

 

70

Data Chart class

 

Trait

Your
Phenotype

Your
Genotype

Number of each
in class

 

Attached earlobe

 

Free earlobes

 

Widow’s Peak

 

No widow’s Peak

 

Tongue Roller

 

No Tongue Roller

 

Hitchhikers thumb

 

No hitchhikers thumb

 

Bent little finger

 

. Straight little finger

 

Long Palmar muscle

 

Short Palmar muscle

 

Pigmented Iris

 

Blue Iris

 

PTC taster

 

Non Taster

 

No hairy fingers

 

mid digital hair

 

1 finger with hair

 

2 fingers with hair

 

3 fingers with hair

 

4 fingers with hair

 

Type 0 blood

 

Type A blood

 

Type B blood

 

Type AB blood

 

2lad finger shorter than?

male

 

2'1d finger shorter than 4‘11

female

 

2nd finger longer than 43‘

male

 

 

2DJ finger longer than 4th

female

 

 

 

 

71

 

Chart 2
P0pulation 100 people

 

Trait Number expressing trait
Trait
Opposite of trait
Percent of trait
Percent of opposite
Possible Genotypes of
trait
Possible Genotypes of
opposite traits

 

 

 

 

 

 

 

 

 

 

Post Lab
You are required to turn in charts 1 and 2 all filled in with data You also must
turn in a brief explanation of what Hardy-Weinberg is, and what its purpose is, in
addition to your HWP calculations. Please make comparisons to the population of this
class, 100 and possible results of a theoretical population of 200.

Tracking Traits within families assignment
Choose 2 of thell traits below and track them within your family to at least 3
generations (immediate family only). You are the l“t generation and you will work
backwards from there. For each persontell name phenotype and possible genotype. The
goals of this assignment are to see who gave you some quirky traits and to try to figure
out exactly what the genotype of each person is.

72

WORKS CITED

Ames, Carole and Russell Ames. Research on Motivation in Education Volume 3.
1989. San Diego, California Academic Press. Pp. 346

Bourdillon, Hilary and Anne Storey. Aspects of Teaching and Learning in Secondary
Schools. 2002. London, England Routledge Falmer. Pp. 319

Borek, Ernest. The Code of Life. 1965. New York, New York Columbia University
Press. Pp. 226

Bradshaw, AD. and CD. Darlington. Teaching Genetics in School and University.
1963. London, England. Oliver & Boyd. Pp. 121

Burdette, Walter J. Methodology in Basic Genetics. 1963. San Francisco,
California. HoldencDay. Pp. 484

Carlson, Elof Axel. Human Genetics. 1984. Lexington, Kentucky. D.C. Heath and
Company. Pp. 432

Clarke, Torn. A review celebrating 50 years of DNA April 24, 2003. Nature
Science Update. www.nature.com.

Cohen, Jack S. and Franklin H. Portugal. A Century of DNA: A History of the
Discovery of the Structure and Function of the Genetic Substance. 1977. Boston,
Massachusetts. The MIT Press. Pp. 384

Crowder, Norman A. Introduction to Genetics. 1967. New York, New York.
Doubleday & Company. Pp. 270

Davies, Kevin. Cracking the Genome. Inside the Race to Unlock Human DNA.
2001. New York, New York. The Free Press. Pp. 310

Eckert, Wiliarn G. Introduction to Forensic Sciences: Second Edition 1997. Boca
Raton, Florida CRC Press. Pp. 390

Ewens, Warren John Population Genetics. 1969. London, England. Methuen and
Company. Pp. 147

Griffin, Robert. Teaching in a Secondary School. 1993. New Jersey. Iawrence
Erlbaum and Associates. Pp. 248

Howell, Stephen H. Molecular Genetics of Plant Development. 1998. Boston,
Massachusetts. Cambridge University Press. Pp. 365

73

Iatridis, Mary D. Teaching Science to Children. 1986. New York, New York
Garland Publishing. Pp. 110

Lewis, EB. Selected papers of AH Sturtevant: Genetics and Evolution. 1961. San
Francisco, California. W.H. Freeman and Company. Pp. 334

Martinez, Alfonso Arias and Alison Stewart. Molecular Principles of Animal
Development. 2002. Oxford, England. Oxford University Press. Pp. 410

McArthur, Janice and Barbara E. McGuire. Books on wheels: Cooperative Learning
Through Thematic Units. 1998. Denver, Colorado. Libraries Unlimited Pp. 169

McElheny, Victor K. Watson and DNA: Making a Scientific Revolution. 2003.
Boston, Massachusetts. Perseus Publishing. Pp. 365

Pearson, Helen A review of protein regulation in cells. April 24, 2003. Nature
Science Update. wwwnaturecom.

Putnam, JoAnne. Cooperative Learning in Diverse Classrooms. 1997 . Trenton, New
Jersey. Prentice Hall. Pp. 217

Raffini, James P. 150 Ways to Increase Intrinsic Motivation in the Classroom. 1996.
Boston, Massachusetts. Allyn and Bacon. Pp. 288

Ralph, Edwin G. Motivating Teaching in Higher Education: A manual for faculty
development. 1998. Stillwater, Oklahoma. New Forums Press. Pp. 236

Shepmdson, Daniel P. Assessment in Science: A Guide to Professional Development
and Classroom Practice. 2001. The Netherlands. Kluwer Academic Publishers. Pp.
264

Stahl, Robert J. Cooperative Learning in Science; A Handbook for Teachers. 1994.
San Diego, California. Addison Wesley. Pp. 433

Washton, Nathan S. Science Teaching in the Secondary School. 1961. NewYork,
New York. Harper and Brothers. Pp. 328

Watson, JD. and F .H. Crick. A Structure for Deoxyribose Nucleic Acid Nature
Magazine # 171: 737 — 738. 1953

74