< 4..

«a»...

{any
2% .

,. ‘, ”a.
. 2rd,

5..

 

”run!

a. \E:

 

51
N'

z

I. .
it? \s in...
.5 ‘ .

 

1" .Uth)’

 

       

    

 

IA - . , . . . ‘ , . V1. ._ V
‘1‘ Wu. ”AKIN“ : . . v .21.. 214:. ..J.i.r..\.dﬁ‘.w at...“ 1.313!» . .113”. { . 5'44"?» .7. s.
‘0 . ‘32] .H .o If 1... . . .

 
 

 

,
“ﬁﬁéﬂuuk” l: .. ~04

 

2
3003
s‘lfsBD‘b‘N

 

 

Lie-WHY
Michigan State
University

 

 

This is to certify that the

 

dissertation entitled

AGROBACTERIUM-MEDIATED TRANSFORMATION OF BASMATI
RICE AND SYSTEM DEVELOPMENT FOR TRANSFORMATION
OF WHEAT VIA MULTIPLE MERISTEM BOMBARDMENT

presented by

ANWAAR AHMAD

has been accepted towards fulfillment
of the requirements for the

Ph. D degree in Crop and Soil Sciences

Major Professor’s Signature
8, ~ I? - of;

Date

MSU is an Affirmative Action/Equal Opportunity Institution

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 cJClFlC/DataDmpGS-pds

AGROBA CTERIUM-MEDIATED TRANSFORMATION OF BASMATI RICE
AND SYSTEM DEVELOPMENT FOR TRANSFORMATION OF WHEAT
VIA MULTIPLE MERISTEM BOMBARDMENT

By

Anwaar Ahmad

A DISSERTATION

Submitted to
Michigan State University
in partial fulﬁllment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Crop and Soil Sciences

2003

ABSTRACT
AGROBA C TERI UM-MEDIATED TRANSFORMATION OF BASMATI RICE AND
SYSTEM DEVELOPMENT FOR TRANSFORMATION OF WHEAT VIA MULTIPLE
MERISTEM BOMBARDMENT
By
Anwaar Ahmad

The research presented in this dissertation includes transformation of Basmatic
Variety 370 of indica rice via the Agrobactrium system, conﬁrmation of insect resistance
of second-generation transgenic rice, and system development for transformation of
wheat using the biolistic bombardment.

A lepidopteran/dipteran—speciﬁc synthetic gene, cryZA, from Bacillus
thuringiensis (Bt) was sub-cloned under the control of the CaMV promoter.
Agrobacterium-mediated transformation method was used to transfer two different Bt
genes (cryIAb and cryIAc) in Basmatic rice. Conditions for transformation of rice were
optimized using the B-glucoronidase (gus) reporter gene system. A total of 64 transgenic
plants were produced from 15 hygromycin-resistant calli. Molecular analysis of R0 and
R1 progeny plants conﬁrmed integration, transcription and translation of all transgenes
with a 100% cointegration of linked genes. The expression of CrylAb and CrylAc was
estimated up to 0.1% of total soluble proteins. Inheritance of the introduced genes to R1
progeny was found to be in agreement with Mendelian segregation in most of the
transgenic lines. Further, Real-Time PCR was used to conﬁrm the transgene copy
numbers. Since it is illegal to bring rice pests from outside of the US, European corn

borer (Ostrinia nubilalis) was used to bioassay non-transgenic and transgenic rice plants.

plants were used in feeding assays. Signiﬁcant (P<0.0001) differences compared to non-
transgenic plants were observed in all bioassys conducted.

Efforts were also made to develop a less genotype dependent in vitro regeneration
system as a pre-step toward genetic transformation of wheat (T ritcum aestivum L.).
Among different concentrations of phytohormones, 2 and 4 mg/l of BA (8.8 and 17.7
uM) in combination with 0.5 mg/l 2,4-D (2.26 uM) produced the best results that were
signiﬁcantly (P: 0.05) different from other hormone combinations. The system
developed here is capable of producing multiple shoot clumps and whole plants in four
different wheat genotypes tested. Scanning electron microscopy of cultures showed a
proliferating budding state that gave rise to adventitious shoots, as well as, somatic
embryos on further multiplication. These shoot clumps regenerated normally and
produced fertile plants containing viable seeds. This in vitro regeneration system was
tested for its usefulness for the production of transgenic wheat using bioslistie
bombardment (PDS-lOOO/He) system. Different bombardment parameters were studied
for transient expression of gus. Among parameters used, 0.6-0.9 um tungsten particles,
13 cm distance of the target tissue and point of bombardment and pressure of 1100 and
1550 psi gave maximum transient expression of gus (i.e. 43.5 to 45%). Gold particles
were also used in comparisons with tungsten particles but did not yield signiﬁcant (P:

0.05) increase in transient expression of gus.

ACKNOWLEDGEMENTS

I would like to extend my appreciation and gratitude to Dr. Mariam B. Sticklen,
my major professor, for her encouragement, valuable advice and support during the
course of my Ph. D studies at Michigan State University.

I am thankful to my guidance committee members: Dr. James Kelly, Dr. David
Douches and Dr. Rebecca Grumet for valuable suggestions in the preparation of this
manuscript.

I am also thankﬁJI to the following for all their valuable help and contributions:

Dr. Shahina Maqbool for help with the molecular analysis of transgenic plants.

Dr. Illimar Altosaar for providing plasmid constructs.

Dr. Heng Zhong for providing crylAb antibody and help with meristem cultures
of wheat.

Dr. Syed Hashsham and Dr. Jeff Landgraf for help in Real Time PCR.

Dr. Sasha Kravchenko for assistance with statistical analysis of data.

Dr. Chris Difonzo for help during insect bioassays.

Dr. Zakir Ullah for his support encouragement and valuable suggestions.

Umar Farooq for his help in formatting of this manuscript.

Thanks are also extended to my laboratory members and colleagues Robab
Sabzikar, Dr. Farzaneh Teymouri, Dr. Benli Chai, Dr. Don Warkentin, Callista Ransom,
Dr. Yahia-El-Maghraby and Hesham Orabi for their support and encouragement during
' the course of this study.

Special thanks are extended to Dr. S. Riazuddin for his help for endorsing my

application to Michigan State University.

1v

All friends and members of Pakistan Students Association are highly recognized
for making East Lansing “a home away from home”.

Financial support form Ministry of Science and Technology, Government of
Pakistan, Plant Breeding and Genetics program at Michigan State University and Ofﬁce
of International students and scholars is highly acknowledged.

Finally I would like to thank my family for their support, patience and

encouragement during the course of this study.

TABLE OF CONTENTS

LIST OF TABLES ............................................................................................................ VIII
LIST OF FIGURES .............................................................................................................. x
CHAPTER 1: LITERATURE REVIEW ......................................................................... l
1.1. IN VITRO CULTURE OF RICE .......................................................................... I
1.1.1. Rice Cell Suspension Culture and its Cryopreservation ............................... 1
1.1.2. Somatic Embryogensis and Regeneration ..................................................... 2
1.1.3. Genotype Specificity ..................................................................................... 3
1.2. GENETIC TRANSFORMATION OF RICE .......................................................... 3
1.2.1. Particle Bombardment Technology for Gene Transfer ................................. 4
1.2.2. Biolistic Transformation of Rice ................................................................... 4
1.2.3. Agrobacterium-mediated Transformation ..................................................... 6
1.2.4. Other Methods of Rice Genetic Transformation ........................................... 7
1.3. BT AS A BIOLOGICAL CONTROL AGENT FOR INSECT PESTS .................... 8
1.4. IN VITRO CULTURE OF WHEAT ...................................................................... 9
1.4.1. In vitro culture and regeneration from various wheat explants of somatic
tissues .................................................................................................................... 12
1.4.2. Cell suspension and Protoplast culture ........................................................ 14
1.4.3. Genotype Effect ........................................................................................... 15
1.5. GENETIC TRANSFORMATION STUDIES ON WHEAT .................................. 15
1.5.1. Use of Particle Bombardment ..................................................................... 16
1.5.2. Agrobacterium-mediated transformation in wheat ..................................... 17
CHAPTER H : TRANSFORMATION OF INDICA RICE VARIETY BASMATI 370
VIA AGROBAC TERI UM-MEDIATED TRANSFORMATION .................................. 19
2.1. ABSTRACT ......................................................................................................... 19
2.2. INTRODUCTION ............................................................................................... 21
2.3. MATERIAL AND METHODS ............................................................................ 26
2.3.1. Cloning of cry2A in plant expression vector ............................................... 26
2.3.2. Plasmid constructs used for rice transformation ......................................... 29
2.3.3. Plant transformation .................................................................................... 31
2.3.4. Southern and northern blot analyses ........................................................... 32
2.3.5. Gus assay ..................................................................................................... 34
2.3.6. Western blot analysis of CrylAb and CrylAc ............................................ 34
2.3.7. Progeny analysis .......................................................................................... 34
2.3.8. Optimization of Real Time PCR ................................................................. 35
2.4. RESULTS ............................................................................................................ 38
2.4.1. Cloning of cry2A in a plant expression vector ............................................ 38
2.4.2. Plant transformation .................................................................................... 38
2.4.3. Molecular analysis of plants in R0 and R1 progeny ................................... 42
2.4.4. Expression of crylAb and cryIAc ............................................................... 47
2.4.5. GUS expression ........................................................................................... 47
2.4.6. Segregation of transgenes ............................................................................ 47
2.4.7. Optimization of Real Time PCR ................................................................. 52
2.5. DISCUSSION ..................................................................................................... 56

vi

CHAPTER III : INSECT FEEDING ASSAYS ON TRANSGENTC BASMATI RICE

PLANTS ........................................................................................................................ 60
3.1. ABSTRACT ......................................................................................................... 60
3.2. INTRODUCTION ............................................................................................... 62
3.3. MATERIALS AND METHODS .......................................................................... 66

3.3.1. Plant material ............................................................................................... 66
3.3.2. Test insect .................................................................................................... 66
3.3.3. Laboratory feeding bioassays ...................................................................... 66
3.4. RESULTS ............................................................................................................ 69
3.4.1. Excised—leaf assays ...................................................................................... 69
3.4.2. Two-week—old whole plant assays .............................................................. 69
3.4.3. Whole-plant assays at tillering stage ........................................................... 73
3.4.3. Artiﬁcial diet assays .................................................................................... 75
3.5. DISCUSSION ..................................................................................................... 78

CHAPTER IV : SHOOT APICAL MERISTEM: IN VITRO MORPHOGENESIS AND

TRANSFORMATION STUDIES IN WHEAT (TRITICUM AESTIVUM L.) ..................................... 80
4.1. ABSTRACT ......................................................................................................... 80
4.2. INTRODUCTION ............................................................................................... 82
4.3. MATERIALS AND METHODS .......................................................................... 85

4.3.1. Explant ........................................................................................................ 85
4.3.2. In vitro regeneration .................................................................................... 86
4.3.3. Electron Microscopy ................................................................................... 86
4.3.4. Optimization of transformation conditions ................................................. 87
4.4. RESULTS ............................................................................................................ 91
4.4.1. In vitro morphogenesis of shoot apical meristems and the effect of different
growth regulators ................................................................................................... 91
4.4.3. Plant regeneration from multiplied shoot clumps ....................................... 95
4.4.4. Optimization of transformation conditions for gas expression ................... 95
4.5. DISCUSSION ................................................................................................... 100
CHAPTER V: SUMMARY AND FUTURE WORK ................................................ 104
REFERENCES ............................................................................................................ 109

vii

List of Tables

Table 1.1 - Bt transgenic rice plants recovered Via Biolistic gun and Agrobacteiium-
mediated transformation method and insects used for the bioassays ........................ 10

Table 2.1 - Media used for rice tissue culture ................................................................... 33
Table 2.2 - Co-cultivation experiments for optimization of conditions for Agrobacterium-

mediated transformation of Basmati rice 370. Twenty calli were used in each
experiment and experiments were repeated twice. Gus positive calli are shown under

levels of acetosyringone. ........................................................................................... 41
Table 2.3 - Summary of transformation experiments ....................................................... 43
Table 2.4 - Segregation of hygromycin resistance in R1 progeny .................................... 51

Table 2.5: Determination of transgene (crylAb/crylAc) copy number in tmagenic
Basmati 370 lines and the correlation of Real Time PCR results with Southern blots.
................................................................................................................................... 53

Table 3.1a - O. nubilalis feeding assays on excised-leaves from tillering stage transgenic
Bt (crylAb and crylAc) rice plants. 10 O. nubilalis neonate larvae were used per
replicate and each assay consists of four replicates. This table shows Mean number
of surviving O. nubilalis larvae and percent leaf area damage on rice seedlings three
and five days after infestation (DAI) ......................................................................... 71

Table 3.1b — Mean increase in the length (cm) and weight (mg) of O. nubilalis larvae
feeding on non-transgenic control rice plants in cut-leaf assays. .............................. 71

Table 3.2a - O. nubilalis feeding assays on two-week-old transgenic Bt (crylAb and
crylAc) rice plants. 10 O. nubilalis neonate larvae were used per replicate and each
assay consists of four replicates. This table shows mean number of surviving O.
nubilalis larvae and percent leaf area damage on rice seedlings three and ﬁve days
after infestation (DAI). .............................................................................................. 72

Table 3.2b - Mean increase in the length (cm) and weight (mg) of O. nubilalis larvae
feeding on non-transgenic control rice plants in two weeks old plant assays. .......... 72

Table 3.2c - Mean decrease in the weight (g) of non-transgenic control rice plants in two
weeks old plant assays ............................................................................................... 72

Table 3.3 - Whole-plant O. nubilalis feeding assays on transgenic Bt (crylAb and
cryIAc) rice plants. Twenty O. nubilalis neonate larvae were used per plant (four
plants per assay). This table shows status of larvae recovered and un-recovered on
rice plants seven and 25-days after infestation (DAI). .............................................. 74

viii

Table 4.1 - The effect of two phytohormones (BA and 2,4-D) on the relative frequency of
shoot multiplication in four different genotypes of wheat. ....................................... 94

Table 4.2 - The effect of two phytohormones (BA and 2,4-D) on relative efficiency of
shoot multiplication in four different genotypes of wheat. ....................................... 94

Table 4.3 - Percent transient expression of gus gene in shoot meristematic cultures 48
hours after bombardment. ......................................................................................... 98

ix

List Of Figures

Figure 2.1. Coding sequence of cry2A gene. —> indicate the restriction sites of HindIII
and BamI-H; — represent start and stop codons (See text for detail). ....................... 27

Figure 2.2. Cloning scheme of cry2A in a plant expression vector pROBS ..................... 28

Figure 2.3. Restriction map pTOK233 and T-DNA of plasmid KUB and KUC. BR. T-
DNA right border; BL. T-DN A left border; crylAb and crylAc. synthetic insecticidal
genes from B. thun'ngiensis; Hpt. Hygromycin phosphotransferase gene; gus. b-
glucuronidase gene; NptH. Neomycin phosphotransferase gene; 358. CaMV3SS
promoter; Ubi. Maize ubiquitin promoter; Nos. Nopaline synthase promoter; Nos. 3’
termination signal of nopaline synthase .................................................................... 30

Figure 2.4. Colony hybridization of cry2A. Dots in the ﬁlters (a-c) represent bacterial
colonies containing cry2A gene. ............................................................................... 39

Figure 2.5. Conﬁrmation of ligation and orientation of cry2A. M. Lambda HindIII
marker; 1. pAAl; 2. HindIII digested pAAl; 3. SalI digested pAAl; 4. PstI digested
pAA ........................................................................................................................... 40

Figure 2.6. Selection and regeneration of Basmati 370 transgenic rice plants. a.
Untransformed calli on Hygromycin containing medium; b. Hygromycin resistant
clumps growing on selection medium; c. Regenerating Hygromycin resistant calli; d.
Regenerated plants on Hygromycin containing MS medium; 6. Transgenic Bt
containing rice plants in the greenhouse bearing seeds ............................................. 44

Figure 2.7. Southern blot analysis of Basmati 370 transgenic rice plants in R0 and R1
generation. The DNA was digested with BamIII and probed with gus coding
sequences. Lanes 1-7 in a: Basmati 370 transgenic lines 370-ub-1 to 370-ub-7 for
crylAb; lanes 1-7 in b: Basmati 370 transgenic lines 370-uc-1 to 370-uc-7 for
crylAc. P, plasmid DNA of cry lAb and crylAc; C, DNA from non-transgenic
plant. .......................................................................................................................... 45

Figure 2.8. Southern blot analysis of Basmati 370 transgenic rice plants in R0 generation
showing integration of crylAc and crylAb cassette. The DNA was digested with
HindIII and probed with crylAb and crylAc coding sequences. Lanes 1-6 in a:
Basmati 370 transgenic lines 370-ub—1 to 370-ub-6 for crylAb; lanes 1-5 in b:
Basmati 370 transgenic lines 370-uc-l to 370-uc-5 for crylAc. P, plasmid DNA of
cry 1Aba nd crylAc; C, DNA from non-transgenic plant. ....................................... 46

Figure 2.9. Western blot analysis of CrylAb and CrylAc in Basmati 370 R0 transgenic
rice plants. Lane M. Molecular weight standards; C. Protein from an untransformed

rice plant; Lane 1-3. crylAb expressing rice plants; Lane 4-6 crylAc expressing rice
plants; Lane P. Puriﬁed CrylAb protein. .................................................................. 48

Figure 2.10. Northern and Western blot analysis of CrylAb and CrylAc in Basmati 370
R1 transgenic rice plants. a. Northern blot of R1 rice plants. Lane 1-6. Lane 1-3.
CrylAb expressing Rl rice plants; Lane 4-6. CrylAc expressing rice plants; Lane C.
RNA from an untransformed rice plant b. Western blot of R1 rice plants. Lane C.
Protein from an untransformed rice plant; Lane 1-3. CrylAb expressing R1 rice
plants; Lane 46. CrylAc expressing rice plants; Lane P. Puriﬁed CrylAb protein:
Lane M. Molecular weight standards. ....................................................................... 49

Figure 2.11. Transient and stable expression of GUS in callus (a & b) and leaves (c) of
Basmati 370. .............................................................................................................. 50

Figure 2.12. crylAb/crylAc PCR product detection in Real Time PCR. (a) Ampliﬁcation
plot generated using known amounts of pKUC. (b) Standard curve for the data
presented in a. (c) an overlay of melting curve derivative proﬁles following Real
Time PCR showing peaks for known amounts of pKUC and crylAb/crylAc
transformed plants. .................................................................................................... 54

Figure 3.1. Effect of insecticidal activity of transgenic rice plants expressing CrylAb and
CrylAc on O. nubilalis utilizing (a) cut-leaf (b) two-week-old and (c) whole-plants
in bioassays. Plants were photographed 5 (a & b) and 25- (c) DAI. NT: non-
transgenie rice plant; T: transgenic rice; Tc: crylAc expressing transgenic rice plant;
T: crylAb expressing transgenic rice plant. Arrows show zoom area with alive and
dead 0. nubilalis larvae on the NT and T plants ....................................................... 70

Figure 3.2. O. nubilalis larvae 5-d after feeding on artiﬁcial diet containing total soluble
protein isolated from transgenic (expressing CrylAb and CrylAc) and non-
transgenic rice plants. ................................................................................................ 76

Figure 4.1. Plasmids used for transformation studies of wheat (Triticum aestivum L.). Pin
2 5’. 5’upstream sequence of potato proteinase inhibitor 11 (pin2) gene; pin2. coding
sequence of pin2gene; A5’I. Rice actin 1 5’ intron; Pin 2 3’. 3’termination sequence
of pin2 gene; 35S. Cauliﬂower mosaic virus promoter; bar. Phosphinothricin acetyl
transferase gene; N. Nopaline synthase terminator; A 5’ FS. 5’upstream sequence of
rice actin 1 gene; A5’I. Actin I intron; gus. B-glueoronidase enzyme gene; hpt.
Hygromycin phosphotransferase gene. ..................................................................... 88

Figure 4.2. Differentiation of multiple shoots from Shoot apical meristem and production
of fertile wheat plants from meristematic cultures of wheat (Triticum aestivum L.).
a. Shoots differentiated from a Shoot apex after two weeks of culture; b. A multiple
shoot clump regenerated from a shoot apex one month after initiation; c. Formation
of tissue stratum from a shoot apical dome; d. Scanning electron micrograph of a
multiples shoot clump; e. A scanning electron micrograph Showing the beginning of
direct somatic embryogenesis from the tissue stratums (arrows indicate the budding

xi

and folding process); f. A scanning electron micrograph showing the regeneration of
leafy scutella and tubular coleoptiles from the tissue stratum; g. Development of
shoots from MSC; h. Regenerated shoots in Magenta box for root development; i.
Fertile regenerated wheat plants in greenhouse. CL, coleoptile; H, leaf hairs; L, leaf;
LP, Leaf primordium; SC, scutellum; ST, shoot tip; TS, tissue stratum ................... 92

Figure 4.3. Transient expression of GUS in wheat (Triticum aestivum L.) shoot meristem
cultures. ..................................................................................................................... 97

Figure 4.4: Kill curve for shoot meristem cultures of wheat. a) Hygromycin b)
Glufosinate ammonium ............................................................................................. 99

xii

CHAPTER 1: LITERATURE REVIEW
1.1. IN VITRO CULTURE OF RICE

For the last three decades, the applications of plant in vitro culture techniques
such as in vitro regeneration, somaclonal variation and in vitro mutagenesis led to new
avenues in improvement of certain crops (Larkin and Scowcroft, 1981). The success in
these applications depended on the totipotency [i.e. ability of the plant cells to produce
any type of tissue and eventually whole plants (Steward et a1. 1970)] of the cell or tissue
explants used. The totipotant cells or tissues have capability of regenerating into whole
plants via somatic embryogenesis or through organogenesis. The phenomenon of
totipotency was later used to genetically transform cells and regenerate whole plants.
1.1.1. Rice Cell Suspension Culture and its Cryopreservation

The overall maintenance of embryogenic cell suspension culture is a labor—
intensive and time-consuming process. Embryogenic cell suspension culture has been
used for reproducible rice regeneration (Abe and Futsuhara, 1986b; Ozawa and
Kamamine, 1989). The standard methods for regeneration of cell suspension cultures of
japonica varieties were developed before indica varieties due to poor in vitro response of
indica rice (Bajaj and Rajah, 1995). The frequency of fertile regeneration from cell
suspension was signiﬁcantly increased by increasing the osmoticum of the in vitro culture
media for two commercially cultivated aromatic indica rice varieties Basmati 385 and
Pusa Basmati 1 (Jain et a1. 1996), meaning that maltose and a high concentration of
agarose were used in the regeneration media in order to obtain a high frequency of

regeneration.

Cryopreservation (-196 0C) of embryogenic suspension cultures provides a mean
of ensuring a constant supply of competent totipotant cells (Lynch et a1. 1991; Shillito et
al. 1989). Rice cells have been recovered aﬁer over a year of cryopreservation and used
to re-initiate suspension, from which protoplast-derived plants have been produced
(Meijer et a1. 1990). It is important to rapidly re-establish cell suspensions aﬁer cryogenic
storage before the deleterious effects of prolonged culture appear. Lynch et al. (1994)
regenerated protoplast derived plants from embryogenic suspension cultures of the
japonica rice cultivar Taipei 309 of frequencies comparable to those of the original non-
frozen cultures by optimizing the method of subculturing of cells after thawing and the
nitrogen status of the recovery medium.

1.1.2. Somatic Embryogensis and Regeneration

Plants respond remarkably to external stimuli, and an inclination toward
vegetative propagation, when cells or tissues are cultured in vitro. Regeneration can be
accomplished through somatic embryogenesis (formation of bipolar structures with

cotyledons and roots) or organogenesis (formation of shoots or roots).

Organogenesis (Kawata and Ishihira, 1968) and embryogenesis (Abe and
Futsuhara, 1986b) are two processes of regeneration in rice. Embryogenesis is preferred
to organogenesis because embryos arise from a single cell and produce plants at higher
frequencies (Vasil, 1988). Regeneration in rice has been achieved from embryogenic calli
induced from different tissue explant sources such as leaves (Wemick et al. 1981), roots
(Abe and Futsuhara, 1985; Kishore and Reddy, 1986), young inflorescences (Chen et al.

1985), rice pollen grains (Kim and Raghvan, 1988), microspores (Datta et al. 1990),

meristem (Bobak et al. 1995) immature embryos (Lai and Liu, 1982), scutellum (Ghosh

Biswas et al. 1994) and mature seeds (Rueb et al. 1994).

1.1.3. Genotype Specificity

Despite several reports of regeneration of fertile plants of rice, literature shows
considerable variations in the in vitro response of different rice strains indicative of
genotypic dependency for successful regeneration. Mukherjee (1973) studied and
reported great genotypic differences in the embryoid formation from pollen of different
rice varieties. Abe and Futsuhara (1986a) tested 66 rice varieties and reported large
differences between indica and japonica rice in the in vitro manipulation. The japonica
rice showed higher response in culture as compared to indica varieties (Abe and
Sasahara, 1982; Abe and Futsuhara, 1984). A comprehensive study of 500 rice varieties
showed that both callus formation and plant regeneration were highly genotype
dependent (Peng and Hodges, 1989). Peng and Hodges (1989) genetically analyzed the
phenomenon of regeneration in rice and concluded cytoplasmic factors affect
regeneration response in rice. Studies carried out on the requirements of rice cells in
culture medium (Schmitz and Lorz, 1990) also indicated the involvement of genotypic
factors in rice tissue culture.
1.2. GENETIC TRANSFORMATION OF RICE

Plant genetic transformation is a technique by which functional genes are inserted
into a genome and can be deﬁned as delivery, integration and expression of genes into

plant cells, which ultimately regenerate into whole plants.

1.2.1. Particle Bombardment Technology for Gene Transfer

The principle underlying the use of particle bombardment for gene transfer is to
utilize high velocity microprojectiles (DNA-coated gold or tungsten particles) to
penetrate cell layers. This procedure introduces genes into living cells, which can either
express them transiently or stably. Historically, plant virologists used high velocity Virus
particles as microprojectiles to wound plant cells and facilitate entry of particles or
nucleic acids (Mackenzie et al. 1966). After the pioneering research by Sanford et al.
(1987) and Klein et al. (1987) who used gun powder charge, other devices were also
developed. These include electric discharge particle acceleration (ACCELLTM, Agracetus,
Middleton, WI) gene gun that used input voltage (Christou et al. 1988), a pneumatic
particle gun that used compressed nitrogen gas (Morikawa et al. 1989), and biolistic guns
that used high voltage electric discharge (McCabe et al. 1988), compressed air (Card,
1990) and helium (Johnston et al. 1990). The PBS 1000 He, available commercially, uses

high-pressure helium as the source of propulsion.

1.2.2. Biolistic Transformation of Rice

Christou et al. (1991) successfully developed transgenic rice plants from both
indica and japonica varieties. Transgenic plants expressing agronomic traits such as
herbicide resistance were tested in the ﬁeld. This accomplishment was only possible after
development of a variety of independent gene transfer methods for rice capable of
introducing any gene into any variety at high frequency (Christou, 1992). Koziel et al.
(1993) introduced a synthetic gene encoding a truncated version of the CrylAb protein
derived from Bacillus thuringiensis (Bt) into immature embryos of an elite rice cultivar

using particle bombardment. Transgenic fertile plants were also obtained using herbicide

resistance bar (phosphinothricin acetyltransferase) gene (Cao et al 1992) and hygromycin
resistance, hpt (hygromycin phosphotransferase) gene (Li et al. 1993) as the selective
agent. Zhang et al. (1996a) used embryogenic suspension to transform indica rice
varieties IR24, IR64, IR72 by optimizing osmotium conditions for biolistic
transformation. Wunn et al. (1996) introduced a synthetic crylAb gene of B.
thuringenesis under the control of the CaMV3SS promoter, producing transgenic indica
rice IR58 plants showing 100 % mortality against yellow stem borer and striped stem
borer. Ghareyazie et a1 (1997) reported enhanced resistance to two stem borers in an
aromatic rice cultivar of isozyrne group V, Tarom Molaii, containing a synthetic crylAb
gene. Other than Bt, potato proteinase II gene was introduced in rice by biolistic
bombardment of cell suspension culture by Duan et al. (1996). Procedures for biolistic
transformation of rice have been improved by using embryogenic callus or suspension
cell aggregates, optimizing the age of the tissue at the time of gene transfer, giving an
osmotic pre- and post-transformation treatment of 0.6 M carbohydrate and by applying an
improved selection procedure (Chen et a1. 1998; Breitler et a1. 2002). Rice has also been
used for different aspects of molecular biological studies (Fu et al. 2000; Srivastava and
Ow 2001).

The utilization of this technology paves the way for transformation of species that
are recalcitrant to genetic modiﬁcation using other techniques. However, the conversion
frequency of transient to stable transformation events using the biolistic gun is
challenging. There is a need to identify ways to make the cells competent for stable DNA
uptake. Optimization of biological factors and interactions between physical parameters

and target tissues need to be better studied and understood.

1.2.3. Agrobacterium-mediated Transformation

Agrobacterium tumefaciens induces tumorous proliferations on dicotyledons
plants by transferring a speciﬁc region (T-DNA) of its tumor inducing (Ti) plasmid into
wound activated plant cells. The foreign genes on T-DNA thus become integrated into
nuclear DNA (Kahl, 1982) and expressed normally. The vir region of the Ti plasmid is
essential for T-DNA transfer and is induced by speciﬁc wound substances from plants.
Agrobacterium is therefore a powerful tool for gene transfer to plants however, cereals
lack wound response and hence considered outside the host range of Agrobacterium.

Initial reports suggested limited success in Agrobacterium-mediated
transformation in monocots such as corn (Gould et al. 1991), asparagus (Byterbier et a1.
1987), and carnation (Firozabedy et a1. 1995). Raineri et a1. (1990) reported transfer of
T-DNA in japonica rice Via Agrobacterium, however they could not regenerate plants.
These reports indicate that graminaceous species possess the potential for infection by
Agrobacterium. Several factors relate to the potential improvement of the efﬁciency of
Agrobacterium infection. It has been observed that the transfer of T-DNA depends on the
age and physiological state of plant tissues (Chang and Chan, 1991; Gould et a1. 1991).
Further, octopine type and nopaline type strains of Agrobacterium were found to be
associated with different efﬁciencies of transformation (McCormick et al. 1986).
Acetosyringone, a wound induced phenolic compound, has been reported to increase the
frequency of Agrobacterium-mediated transformation in Arabidopsis and soybean
(Chang and Chan, 1991). A potato suspension culture (PSC), used for transformation of
soybean (Chang and Chan, 1991) and rice (Chan et al. 1993) was found to improve

transformation frequency up to 37.5 % when included in the infection medium, though it

was highly genotype dependent. Hiei et al. (1994) also achieved the Agrobacterium-
mediated transformation of different japonica cultivars. Transformation frequencies of
japonica rice were obtained as high as that of dicots and demonstrated the Mendelian
transmission of introduced DNA into the progeny.

Aldemita and Hodges (1996) transformed two japonica and two indica rice
varieties with Agrobacterium. The key factors facilitating the transformation appeared to
be the use of embryos as the explant, the use of hygromycin as the selection agent, the
presence of extra copies of certain vir genes on the binary vector and maintaining high
concentrations of aeetosyringone for induction of vir genes during co-cultivation of
embryos with Agrobacterium.

The Agrobacterium-mediated method was also used by Cheng et a1 (1998) to
produce transgenic rice plants with agronomically important genes. They produced a
large number of rice plants carrying the modiﬁed Bt insecticidal protein genes cryIAb
and crjyIAc in nine rice strains by using a modiﬁed Agrobacterium transformation
procedure. A major development took place when Ye et al. (2000) produced enzyme
responsible for the production of vitamin A in rice using Agrobacterium. Research
presented in this dissertation has also been published (Ahmad et al. 2002a). These reports
suggest that success of Agrobacterium-mediated transformation can provide a simpliﬁed
procedure for transformation of rice.

1.2.4. Other Methods of Rice Genetic Transformation

Direct DNA transfer involving electroporation of cells and/or polyethylene
glycol-mediated DNA uptake require the use of protoplasts. The production of

regenerable protoplast, however, is considered technically difﬁcult (Luckett et al. 1991).

Therefore electroporation and/or polyethylene glycol-mediated transformation is not one

of the best methods of choice.

The initial success in polyethylene glycol (PEG) mediated transformation of
japonica varieties was reported by Uchimiya et al. (1986) and Shimamoto et a1. (1989).
McElorry et al. (1990) reported transgenic plants harboring antibiotic and agronomically
important genes using the PEG transformation method. Electroporation was ﬁrst used in
rice by Lee et al. (1986), followed by Toriyama et a1. (1988), Shimamoto et al. (1989)
and Xu and Li (1994). The mechanical introduction of plasmid DNA into cellular
organelles using microscopic needles, i.e. microinjection, is not subjected to host range

limitations, but protoplasts are a requirement.

1.3. BT AS A BIOLOGICAL CONTROL AGENT FOR INSECT PESTS

Bacillus thuringiensis (Bt), a sporulating gram-positive bacterium, was ﬁrst used
as an insecticide in the early 19305, primarily against the Ostrinia nubilalis (European
corn borer) in South East Europe. Although ﬁrst commercial product (spreine) was
available in 1938, in France (Weiser, 1986) for the control of the ﬂour moth (Jacobs,
1951), it was not before 1960 when interest in Bt insecticides was re—developed. It was
stimulated by the growing concern over the use of chemical insecticides and the ﬁrst Bt
strain was commercialized and marketed as “Thuricide”.

Upon sporulation Bt produces protein crystals. The crystals are aggregates of a
large protein, 130-140 kDa that is actually a protoxin that must be activated before it has
any effect. The crystal protein is highly insoluble in normal conditions, so it is entirely

safe to humans, higher animals and most insects. However, it is solubilized in reducing

conditions of high pH (above about pH 9.5) the conditions commonly found in the mid-
gut of lepidopteran larvae. For this reason, Bt is a highly speciﬁc insecticidal agent. Once
it has been solubilized in the insect gut, the protoxin is cleaved by a gut protease to
produce an active toxin of about 60kD, termed delta-endotoxin. It binds to the midgut
epithelial cells, creating pores in the cell membranes and leading to imbalance of ions. As
a result, the gut is rapidly immobilized, the epithelial cells lyse, the larva stops feeding,
leading to the death of the larvae (Hoﬁe and Whiteley, 1989).

Bt produces the best-known insect toxin that has a great potential for the control
of various lepidopteran, dipteran and coleopteran insects (Bulla et a1. 1980; Aronson et a1.
1986; Hofte and Whiteley, 1989). The effectiveness of Bt has also been demonstrated for
other classes of pests such as nematodes, aphids and sheep ﬂeas (Drummond et al. 1991;
Feitelson et a1. 1992; Payne and Connon, 1993). More than 200 crystal protein genes
have been identiﬁed and still the Bt pesticidal activity range is not exhausted
(http://www.biols.susx.ac.uk/home/Neil_Crickmore/Bt/). The cry toxins have tremendous
commercial value as safe, biodegradable pesticides. Also the speciﬁcity of Bt toxicity is
highly desirable in integrated pest management programs, particularly in sensitive aquatic
and forest ecosystems where other beneﬁcial and non-target insect must be conserved
(May, 1993). Table 1.1 describes rice genotypes transformed with cryIAb, cryIAc and
cry2A genes from B. thureingensis and the target insecst tested for bioassays.

1.4. IN VITRO CULTURE OF WHEAT
As the leading cereal crop of the world, wheat (T riticum aestivum L.) has derived

constant attention of plant scientists. For decades, plant breeders improved wheat

Table 1.1 - Bt transgenic rice plants recovered via Biolistic gun and Agrobacterium-

mediated transformation method and insects used for the bioassays

 

 

 

 

 

 

 

Rice Bt gene Target insect Transformation Reference
Genotypes used method
IR-64, Pusa cry/Ac Yellow stem borer Agobacterium Khanna and
Basmati, Kama] (Scimophaga Raina (2002)
Local (indica) incertulas)
Basmati 370 cry/Ab European corn borer Agrobacterium Ahmad et al.
(indica) and (Ostrinia nubilalis) (2002a)
cry/Ac
Basmati 370 cry/Ac Rice leaf folder Biolistic gun Maqbool et al.
(indica) and cry2A (Cnaphalocrocis (2001a)
medinalis), Yellow stem
borer
Minghui 63 and cry/Ab Rice leaf folder, yellow Biolistic gun JuMin et al.
Shanyou 63 and stem borer (2000)
(japonica) crylAc
IR68899B (indica) cry/Ab Yellow stem borer Biolistic gun Alam et al.
(1999)

 

 

 

 

 

10

 

Table 1.1 (cont’d).

 

 

 

 

 

 

 

Nipponbare. 93VA, crylAb Striped stem borer Agrobacterium Cheng et al.
ZAU16, 9lRM, and (Chilo suppressalis) and (1998)
T8340, Pin92-528, crylAc yellow stem borer
T90502, Kaybonnet
(japonica)
Vaidehi(indica) crylAb Yellow stem borer Biolistic gun Alam et al.
(1998)
IR-72, IR-64, IR- cry/Ab Yellow stem borer Biolistic gun Datta et al.
51500 (indica), CB (1998)
II, Taipei 309
(japonica)
IR-64(indica) crylAc Yellow stem borer Biolistic gun Nayak et al.
(1997)
IR-58(indica) crylAb Yellow stem borer, the Biolistic gun Wunn et al.
striped stem borer. two (1996)
leaffolder species C.
medinalis and Marasmia
patnalr's
Nipponbare cry/Ab Striped stemborer and C. Biolistic gun Fujimoto et al.
(Japonica) medinalis ( 1993)

 

 

 

 

 

ll

 

extensively, but their efforts may be reaching a plateau, especially with respect to grain
yield. Recently, the potential of recombinant DNA technology has opened up new ways
to tailor crops according to speciﬁc needs. However key to this technology for plant
improvement using DNA manipulation are in vitro culture techniques. Although these
techniques have been practiced for many years, they are now acquiring a central role in
genetic transformation of plants that requires the ability to regenerate plants from in vitro

cultured cells or tissues.

1.4.1. In vitro culture and regeneration from various wheat explants of somatic
tissues

Historically dicotyledonous plant species were the focus of in vitro culture
research and most protocols and procedures were optimized for the in vitro culture needs
of dicots. For many years monocotyledonous plants were classiﬁed as recalcitrant
because of their resistance towards the protocols that worked well with dicots. However
over the years, the situation changed and research ﬁndings on in vitro culture in cereal
started surfacing in literature (Lorz et al. 1988; Vasil and Vasil 1986). At present
immature embryos are the target tissue for regeneration, suspension and protoplast
cultures, and genetic transformation of wheat. However, other explant tissues of wheat
have been used for regeneration into whole plants.

Caryopses or seeds provide an easy source for in vitro culture application due to
availability throughout the year as opposed to immature embryos. Callus has been
induced from scutellum and the embryonal axis within a few weeks when provided with
suitable combination of phytohormones (Cure and Mott 1978; Eapen and Rao 1985;

Heyser et al. 1985). Embryogenic cultures from seed showed three types of calli: smooth

12

embryogenic, nodular embryogenic, and non-embryogenic using high levels of 2,4-D
(2,4-dichlorophenoxyacetic acid) (Heyser et al. 1985). As anticipated, only the
embryogenic calli regenerated into plants.

Notable successes in regeneration of plants from leaf explants have been reported
in the literature (Zaghmout and Trolinder 1993; Zamora and Scott 1983). Older leaves
produced callus at a higher rate compared with their younger counterparts in soil-grown
plants (Zamora and Scott 1983). There was no difference in response due to age of leaf
tissue in in vitro cultures (Wemicke and Milkovits 1984).

Apical meristems of wheat have proved to be superior explants for both callus
yield and plant regeneration (Ishii 1982). Regeneration Via somatic embryogenesis was
accomplished from shoot meristem cultures although a strong genotype-speciﬁcity effect
was observed (Wemicke and Milkovits 1984). Simmonds et a1. (1992) also succeeded in
regeneration of apical shoot explants up to formation of fertile plants. More recently,
wheat shoot apical meristem was found to be capable of multiplying and regenerating
fertile plants (Ahmad et al. 2002b).

Although success to regenerate roots into plants was inconsistent (Shimada et al.
1969), inclusion of asparagines enhanced regeneration of plantlets from root explant
(Bhojwani and Hayward 1977). Nabors et al. (1983) obtained more invariable

regeneration from root-derived cultures.

Immature inﬂorescences generate comparatively more morphogenic cultures than
those derived from other explants due to a number of suppressed meristematic regions.
Successful regeneration of plants has been reported using immature inflorescences

(Ozias-Akins and Vasil 1982; Maddock et al. 1983; Rajayalaksmi et al. 1988).

13

Immature embryos are the explant of choice for in vitro regeneration and genetic
transformation of wheat. After initial reports of successful regeneration (Shimada 1978;
Shimada and Yamada 1979) immature embryos are frequently used for genetic
transformation studies (see section 1.5.1 and 1.5.2).

1.4.2. Cell suspension and Protoplast culture

Cell suspension cultures were initially developed in the 19605 (Trione et al 1968;
Gamborg and Eveligh 1968) and have been reported for wheat by several workers
(Redway et al. 1990; Wang and Nguyen 1990). These cultures can be cryopreserved and
still maintain the ability to regenerate into whole plants after thawing. However it is
difﬁcult to establish and maintain cryopresevation, and there is evidence of chromosome
loss (Karp et al. 1987; Luckett et al. 1991) and chromosomal aberrations when preserved

as suspension cultures (Shang and Wang 1991).

Protoplast culture in monocots is another challenge. There are several reports
describing the range of success in regenerating complete plants from protoplasts obtained
from suspension cultures of different explants including anthers (Harris et al. 1988),
mature embryos (Wang et al. 1990), young inﬂorescences (Li et al. 1992), and immature
embryos (Ahmed and Sagi 1993; Li et al. 1992). Vasil et al. (1990) successfully
demonstrated that older calli produced embryogenic suspensions more effectively and
established protoplast cultures that regenerated into plants. However major problems
such as low regeneration frequency and infertility existed in the regenerated plants of

wheat from protoplast that derived from old calli.

l4

1.4.3. Genotype Effect

In vitro regeneration of plants is highly dependent on the genotype. Reports show
that nuclear genes as well as certain cytoplasmic factors are involved in different stages
of in vitro plant regeneration such as callus induction and somatic embryogenesis
(Cararnan et al. 1987; Mathias and Simpson 1986; Wang and Nguyen 1990; Lu et a1.
1991)
1.5. GENETIC TRANSFORMATION STUDIES ON WHEAT

Genetic transformation studies on wheat lagged behind other plants due to the
non-availability of an efﬁcient plant regeneration system, and transformation was
restricted to transient gene expression and/or production of transgenic undifferentiated
cell lines. The wheat transformation technology has changed over the last decade and
fertile transgenic plants were obtained (Vasil et a1. 1993; Weeks et al. 1993), however, in
a genotype-speciﬁc manner. Therefore, there is still a need for the improvement of the

protocols for genotype non-speciﬁc genetic transformation of wheat.

Initial reports on the transformation of wheat protoplast employed different
protocols. These included the use of PEG (Lorz et al. 1985; Werr and Lorz 1988),
electroporation (Hautpmann et a1. 1987) and combinations of both (Oard et al. 1989).
Successful genetic transformation of plants also depends on the choice of selectable
markers and the choice of regulatory sequences (i.e. promoters, introns, etc) in addition to
methOdology used for producing transgenic plants. Nevertheless, the most popular
method for producing genetically modiﬁed wheat plants is the use of the particle gun and

Agrobacterium-mediated transformation.

15

1.5.1. Use of Particle Bombardment

Overall, wheat is a difﬁcult plant to genetically transform due to serious problems
associated with regeneration of explants used for transformation (Batty and Evans 1992).
Wang et a1. (1988) studied transient expression of gus and cat genes by bombarding
DNA in suspension cells of a T. monococcum cell line. Transient expression of these
reporter genes was also obtained by microprojectile bombardment when immature
zygotic embryos were used as target explants (Chibbar et al. 1991). Chibbar et al. (1991)
also emphasized the importance of the use of intron because the maximum transient
expression of both genes was achieved if the Ath intron 1 was present between
promoter and coding regions of the gene. Embryogenic wheat callus also showed
transient expression of gus using microprojectile bombardment (Weeks et al. 1993).

Altpeter et al. (1996) reported efﬁcient production of transgenic wheat using bar
as a selectable marker gene. Witrzens et al. (1998) transformed three different selectable
marker genes utilizing immature embryos of wheat as target tissue via the biolistic
approach. Transformed wheat plants were recovered using the bar gene with resistance to
bialaphos, and the neomycin phosphotransferase (aphA) gene with resistance to geneticin
or paromomycin. Southern analysis revealed single copy as well as multiple copy
insertions of bar and aphA transgene and inheritance of these selectable marker genes
was demonstrated in wheat R1 progeny. Although bar and aphA were shown to work in
selection of transgenic wheat, hpt gene is not a good selectable marker gene for
transformation of this crop (Witrzens et al. 1998).

Folling and Olesen (2001) have observed that when biolistic bombardment was

used as the method of choice, the size of the microprojectile particles (1 pm) used for the

16

transformation of microspores signiﬁcantly affected transient expression of the gus gene.
Pellegrineschi et al. (2002) analyzed the transformation efﬁciency of 129 wheat sister
lines generically called 'Bobwhite'. They studied factors inﬂuencing the transformation
such as the ability to produce embryogenic callus, regeneration in selection medium, and
overall transformation performance. Of the 129 genotypes evaluated, eight demonstrated
transformation efﬁciencies above 60% (60 independent transgenic events per 100
immature embryos bombarded). Other studies on biolistic transformation of wheat
include expression of maize glutathione S-transferase gene showing tolerance to
chloroacetanilide herbicide alachlor (Milligan et al. 2001), the study of structural analysis
of transgene integration into the genome of wheat (Jackson et al. 2001) and the
production of wheat with streak mosaic virus resistance (Sivamani et al. 2002).
1.5.2. Agrobacterium-mediated transformation in wheat

Earlier studies used a technique called agroinfection, where the whole Viral cDNA
is incorporated into the Agrobacterium and then plants are infected by this engineered
Agrobacterium. In this case, the virus is used to amplify the transferred DNA that
ultimately results in the infection of all plant cells. Woolston et al (1988) demonstrated
that cloned wheat dwarf virus DNA infected wheat seedlings effectively via
agroinfection. However agroinfection has not produced any stable transgenic plants.

There has also been success in the development of stable transgenic wheat by
Agrobacterium-mediated method without the use of viral DNA. Pukhal et al. (1996)
reported that Agrobacterium tumefaciens strain C158 containing co-integrated plasmids,
pCV2260 and pSIR42, transformed ﬂower pistils following artiﬁcial pollination. In this

experiment, the F2 plants obtained from the transformed plants also contained foreign

17

DNA. Cheng et al. (1997) utilized immature embryos and callus derived from immature
embryos to develop transgenic plants expressing gas and nptII. The introduced genes
were transferred in Mendalian fashion in the offspring. Trick et al. (1997) employed
sonication-assisted Agrobacterium-mediated transformation in wheat and expressed the
gus gene in plants. McCormac et al. (1998) used A. tumefaciens and A. rhizogenes and
transformed cells of wheat derived from immature embryos to express leLc
anthocyanin-biosynthesis regulatory genes, the gusA (uidA) gene and the synthetic green
ﬂuorescent protein gene (sgfp-S65T).

More recently Amoah et a1. (2001) studied the factors inﬂuencing Agrobacterium-
mediated transient expression of uidA in wheat inﬂorescence tissues. They found that
increasing Agrobacterium cell density, the duration of inoculation/co-cultivation, and .
vacuum pressure up to a threshold increased uidA expression. Sawahel and Hassan
(2002) delivered Vigna aconitifolia, delta (l)-pyrroline-5-carboxylate synthetase 'P5CS'
cDNA that encodes enzymes required for the biosynthesis of proline, into wheat plants
using Agrobacterium-mediated gene transfer via indirect pollen system. Salinity tests
indicated that proline acted as an osmoprotectant and its overproduction in transgenic

wheat plants resulted in the increased tolerance to salt.

18

CHAPTER II : TRANSFORMATION OF INDICA RICE VARIETY BASMATI
370 VIA A GROBA C TERI UM-MEDIATED TRANSFORMATION

2.1. ABSTRACT

Bacillus thuringiensis genes that confer resistance to different orders of insects
are considered important for integrated pest management program of crop plants. In this
study, a lepidopteran- and dipteran-speciﬁc synthetic gene, cryZA, from B. thuringiensis
was cloned under the control of the CaMV 35S promoter. The resulting plasmid
construct, pAAl was used in transformation studies of Basmati 370 via biolistic
transformation. Indica rice, one of the world’s most important food crops especially in
south Asia, is attacked by several insect pests. To develop insect resistant indica rice, an
Agrobacterium-mediated transformation method was used because of the advantages that
it offers over other genetic transformation systems. Conditions for transformation of
Basmati rice were optimized using the B-glucoronidase (gus) reporter gene and
hygromycin resistance gene (hpt) as selectable marker gene. Results on the expression of
gus varied considerably depending on transformation conditions. Addition of sugars,
aeetosyringone, and time of co-cultivation were studied for transient gus assays. Among
these parameters, addition of sugars and aeetosyringone were found to be most critical for
the expression of gus. Indica rice Basmati 370 variety was then genetically engineered
using these optimized conditions and stable expression of crylAb, crylAc, hpt and gus
was achieved. A total of 64 transgenic plants were produced from 15 independent
hygromycin-resistant calli lines. Molecular analyses of R0 and R1 progeny plants

conﬁrmed integration, transcription and translation of all transgenes, with a 100% co—

l9

integration of linked genes. Southem blot analysis revealed the integration of transgenes
ranging from one to three copy numbers. The expression of CrylAb and CrylAc was
estimated up to 0.1% of total soluble protein. Inheritance of the introduced genes to R1
progeny was found to be in agreement with Mendelian segregation in most of the
transgenic lines. Further, a simple Real Time PCR procedure was developed for
determination of transgene integration and copy numbers. The assay was carried out
using the ABI Prism 7700 sequence detection system with Syber Green I as the
ﬂuorescence indicator. Using Real Time PCR, 1-3 copies of transgenes (crylAb/crylAc)
were calculated in selected transgenic rice lines. The accuracy of Real Time PCR results

was determined with results obtained after Southern blot analyses.

20

2.2. INTRODUCTION

Over the last several decades, conventional breeding has made signiﬁcant
advances in producing agronomically useful rice varieties. However, introduction of
desirable genes into rice (Oryza sativa) from plants that are not sexually compatible with
rice has not been possible. With the advent of genetic engineering and biotechnology,
introduction of useful foreign genes into rice from any source, including microorganisms
can be accomplished in principle. The aim is to produce superior transgenic plants with
novel properties.

Rice is a staple food for more than one third of the world’s population (David,
1991). It is one of the most important food crops, second only to wheat, feeding over 2
billion people in developing countries in Asia (FAO, 1995). The world population was 6
billion in the year 2000 and projections indicate that number will increase to 10 billion by
2025 (Khush and Toenniessen, 1991), hence there is a need to increase the yield of rice.
Rice is grown world wide under a wide range of agroclimatic conditions. The indica rice
which accounts for approximately 80 % of the cultivated rice is a long grain rice
cultivated in mostly tropical and sub-tropical areas (Swaminathan, 1982 and Wu et al.
1990). Basmati rice varieties, which belong to the sub-species indica are important
economically due to the high quality of the grain and constitute an important source of
revenue for a number of rice-growing countries in Asia (e. g. Pakistan, India, Bangladesh,
Thailand, etc.). There are high yielding varieties of Basmati rice in Pakistan, having
excellent cooking quality, including long grain and favorable aroma. Due to these
characteristics, the international market for Basmati rice has been three times or more

than that of the other rice varieties.

21

Rice improvement with conventional breeding has met with considerable success.
Because of consistent efforts by plant breeders, rice production has doubled between
1966 and 1990, but it must increase further by 60 % by 2025 in order to feed the
additional rice consumers (Khush, 1997). Over the last 15 years, international attention
has been focused on developing techniques for rice genetic engineering because of the
global importance of this crop, and because efﬁcient regeneration systems for several of
rice varieties had already been developed. The in vitro regeneration and genetic
transformation are intended to supplement the conventional breeding programs aimed at
rice improvement by way of cross breeding of transgenic rice with other elite rice
genotypes.

Rockefeller Foundation has been the major agency supporting rice genetic
engineering research. Several priority areas of genetic engineering research have been
considered by Rockefeller Foundation including resistance against insect pests,
pathogens, salinity and drought and also the improvement of the nutritional quality of
rice. The ﬁrst transformed rice plantlets, were reported in 1988 by three independent
groups (Toriyama et al. Zhang et a1. Zhang and Wu). Since then, other reports showed
gene delivery and recovery of transgenic rice plants (Ayres and Park, 1994; Christou,
1996). The development of genetic transformation techniques in rice not only provides a
valuable method for the introduction of useful genes but also presents new approaches to
address various fundamental problems in plant biology such as elucidation of various
principles of gene regulation in monocots (McElroy and Brettell, 1994). Because of its

small genome, rice has been proposed the model plant for studies of regulation of gene

22

expression in cereals similar to Arabidopsis used in dicots (Izawa and Shimamoto, 1996;
Datta, 1998).

In dicots, Agrobacterium-mediated transformation remains the most popular
technique to obtain transgenic plants. This technique offers the potential to generate
transgenic plants at relatively high efﬁciency not showing any major DNA
rearrangements. When Agrobacterium system is used, usually 1-3 copies of transgenes
are integrated in plant genome. Agrobacterium-mediated gene transfer has been less
successful in cereals and other monocots. However, in recent years, signiﬁcant progress
has been achieved in Agrobacterium-mediated gene transfer in cereal crops (Smith and
Hood, 1995; Hiei et al. 1994). Earlier success in this ﬁeld came through the use of
embryo-derived callus of japonica rice and infecting them with a wide range of super
virulent strains of Agrobacterium (Raineri et a1 1990). Later on, regeneration of
Agrobacterium-infected calli from root explants (Chan et a1. 1993) was achieved.
However, skepticism still prevailed over the effectiveness of Agrobacterium as a suitable
method of gene delivery in rice. This controversy was resolved by a convincing report of
Hiei et al. (1994), who achieved transformation in japonica rice using various explants.
Of the various explants tested, scutella-derived calli were the most suitable explants,
while an ordinary strain of Agrobacterium, LBA 4404 (pTOK 233) was found to be the
most effective strain. Since then, several reports have described successful
Agrobacterium-mediated transformation of rice in indica, japonica, as well as javanica
varieties (Aldemita and Hodges, 1996; Datta et al. 1996; Dong et al. 1996; Cheng et al

1998).

23

Most reports describing successful Agrobacterium-mediated transformation of
rice employ the japonica species of rice. Indica rice and more speciﬁcally Basmati rice
are limited to few reports with marker genes only (Rashid et al. 1996; Mohanty et a1
1999). Indica species of rice are considered relatively difﬁcult in their response to in vitro
tissue culture. However, biolistic transformation of Basmati rice with useﬁrl genes has
been described (Maqbool et al. 1998; Nayak et a1. 1997).

Real Time PCR has become a popular technique since developed by Higuchi et al.
(1992). Real Time PCR was developed to quantify the template DNA or to determine the
transcribed RNA copies via continuous monitoring of the ﬂuorescent signal. Two basic
chemistries that have been used in Real Time PCR. One is the probe-based system, which
requires a sequence-speciﬁc probe for quantitation of the template of interest (Lee at al.
1993). The second method utilizes intercalating ﬂuorescence dyes that ﬂuoresce only
when bound to the double stranded ampliﬁed products (Higuchi et a1. 1992). Intercalating
ﬂuorescence dyes such as SYBR Green I provide a simple generic method for the
detection of ampliﬁcation product. SYBR green is a minor-groove DNA binding dye that
exhibits enhanced ﬂuorescence when it binds to a dsDNA (Witter et al. 1997). Real Time
PCR depends on the identiﬁcation of the ﬁrst cycle that generates a signal over the
background level, which is calculated as the threshold cycle (Ct). The identiﬁcation of the
C, value makes quantitation of DNA template during the PCR reaction more accurate
than measuring at the end of the reaction (Inghum et a1. 2001). This dissertation also
reports on the use of use of Real Time PCR for the analysis of transgenic rice plants.

In the present study, the following objectives were addressed to examine the

expression of foreign genes in rice (a) establishment of an Agrobacterium-mediated

24

transformation system for of Basmati rice using gus and hygromycin resistance genes (b)
transformation of rice with Bacillus thuringz'ensis (crylAb and crylAc) insecticidal genes
(c) study of the integration and expression of foreign genes in transformed plants and ((1)
study of the inheritance of introduced genes in the progeny. In addition construction of a
plant expression vector for genetic engineering of plants for insect resistance is also

described.

25

2.3. MATERIAL AND METHODS
2.3.1. Cloning of cry2A in plant expression vector

A synthetic cry2A gene from Bacillus thuringiensis was provided by Dr. Luke
Masson, (Biotechnology Research Institute, Montreal, QC, Canada H4P 2R2,) in pUC 18
based vector (pLM2A). DNA was transformed in bacterial strains DH5a or JMlOl by a
electroporation device (Hoefer Scientiﬁc Instruments, San Francisco CA 94107 USA)
according to manufacturer’s instructions. Restriction site analysis of vector and coding
sequence of cry2A was done using PC/GENE soﬁware (PC/GENE, Intelligenetics, Inc.
Campbell, CA 95008, USA). The total sequence of pLM2A is 4571 bp and the cry2A
start and stop Sites are at 256 and 2155 bp, respectively. The total size of the cryZA
coding sequence is thus 1899 bp (Figure 2.1). Restriction enzymes HindIII, which
restricts pLM2A at position 233, and BamHI, which restricts at position 2158, were
selected for excising the cry2A coding sequence.

A plant expression vector pROBS (Bilang et a1 1991; Figure 2.2) was selected for
cloning the cryZA coding sequence. This vector has a hygromycin resistant gene (hpt)
under the control of the CAMV 358 promoter and the nos terminator. The hygromycin
coding sequence was excised with BamHI, thus leaving the promoter and terminator for
harboring the cry2A coding sequence.

The 1.925 Kb insert (cry2A coding sequence and ﬂanking vector sequences) and
3.3 Kb vector (pROBS), which retains the promoter and terminator, were puriﬁed after
restriction digestion. The puriﬁcation was done by a modiﬁed protocol that uses low

melting agarose and phenol (Sambrook et a1 1989).

26

61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221

Figure 2.1. Coding sequence of cry2A gene. —) indicate the restriction sites of

GCGCCCAATA
CGACAGGTTT
CACTCATTAG
TGTGAGCGGA
TCTAGAGTCG
TACAACGTGG
AAGGAGTGGA
ACCGTGTCCT
GAGCTCTGGG
GAGACCGAGC
GAGCTCATCG
AACCCGACCC
CTCTTCCTCA
CTCTTCGCCC
GACGAGTGGG
ACCAGGGACT
ACCAGGCTCC
GTGTCCATCT
TACGCCTCCG
CTCTACTCCC
CTCTCCATCA
AACTCGGCCA
CTCAACCATA
TCCTGGCTCG
GAGTCCTTCC
AACTACTTCC
GAGGACCTCA
ACCCCGGGCG
GCCGCCAACG
ATCTCCCCGA
TTCGGCAACC
CTCAGGGGCA
ACCATCAGGG
AACAACGACG
GTGGCCTCCG
CCGTTCGACC
TCCATTTTGA
ACCCAACTTA

CGCAAACCGC
CCCGACTGGA
GCACCCCAGG
TAACAATTTC
ACAAGngAA
TGGCCCATGA
TGGAGTGGAA
CCTTCCTCCT
GCATCATCTT
AGTTCCTCAA
GCCTGCAGGC
AGAACCCGGT
ACAGGCTCCC
AGGCCGCCAA
GCATCTCCGC
ACTCGAACTA
ATGACATGCT
GGTCCCTCTT
GCTCCGGCCC
TCTTCCAGGT
CCTTCCCGAA
GGGTGAACTA
ACTTCAACTG
ACTCCGGCAC
AGACCACCCT
CGGACTACTT
CCAGGCCGCT
GCGCCAGGGC
AGAACGGCAC
TCCATGCCAC
AGGGCGACTC
ACGGCAACTC
TGACCATCAA
GCGTGAACGA
ACAACACCAA
TCATGAACAT
ATTCACTGGC
ATCGCCTTGC

CTCTCCCCGC
AAGCGGGCAG
CTTTACACTT
ACACAGGAAA
CAACGTGCTC
CCCGTTCTCC
GAGGACCGAC
CAAGAAGGTG
CCCGTCCGGC
CCAGAGGCTC
CAACATCAGG
GCCGCTGTCG
GCAGTTCCAG
CATGCACCTC
CGCCACCCTC
CTGCATCAAC
CGAGTTCAGG
CAAGTACCAG
GCAGCAGACC
GAACTCGAAC
CATCGGCGGC
CTCCGGCGGC
CTCCACCGTG
CGACAGGGAG
CTCCCTCAGG
CATCCGTAAC
CCATTACAAC
CTACCTCGTG
CATGATCCAT
CCAGGTGAAC
CCTCAGGTTC
CTACAACCTC
CGGCAGGGTG
CAACGGCGCC
CGTCACTCTG
CATGTTCGTG
CGTCGTTTTA
AGCACATCCC

GCGTTGGCCG
TGAGCGCAAC
TATGCTTCCG
CAGCTATGAC
AACTCCGGCA
TTCGAGCATA
CATTCCCTCT
GGCTCCCTCA
AGCACCAACC
AACACCGACA
GAGTTCAACC
ATCACCTCCT
ATCCAGGGCT
TCCTTCATCA
CGTACCTACA
ACCTACCAGA
ACCTACATGT
TCCCTCATGG
CAGTCCTTCA
TACATCCTCT
CTCCCGGGCT
GTGTCCTCCG
CTCCCGCCCT
GGCGTGGCCA
TGCGGCGCCT
ATCTCCGGCG
CAGATCAGGA
TCCGTGCATA
CTCGCCCCGG
AACCAGACGC
GAGCAGTCCA
TACCTCAGGG
TACACCGTGT
AGGTTCTCCG
GACATCAACG
CCGACCAACC
CAACGTCGTG
CCTTTCGCCA

ATTCATTAAT
GCAATTAATG
GCTCGTATGT
CATGATTACG
GGACCACCAT
AGTCCCTCGA
ACGTGGCACC
TCGGCAAGAG
TGATGCAGGA
CCCTCGCCCG
AGCAGGTGGA
CCGTGAACAC
ACCAGCTCCT
GGGACGTGAT
GGGACTACCT
CCGCCTTCAG
TCCTCAACGT
TCTCCAGCGG
CCGCCCAGAA
CCGGCATCTC
CCACCACCAC
GCCTCATCGG
TAAGCACCCC
CCTCCACCAA
TCTCCGCCAG
TGCCGCTCGT
ACATCGAGTC
ACAGGAAGAA
AGGACTACAC
GTACCTTCAT
ACACCACCGC
TGTCATCGAT
CCAACGTGAA
ACATCAACAT
TCACCCTCAA
TCCCGCCGCT
ACTGGGAAAA
GCTGGCGTAA

GCAGCTGGCA
TGAGTTAGCT
ToinGGAAT
CCAAGCTTGT
CTGCGATGCA
CACCATCCAG
GGTGGTGGGC
GATTCTCTCC
CATCCTCAGG
TGTGAACGCC
CAACTTCCTC
CATGCAGCAG
CCTCCTCCCG
CCTCAACGCC
CAGGAACTAC
GGGCCTCAAC
GTTCGAGTAC
CGCCAACCTC
CTGGCCGTTC
CGGCACCAGG
CCATTCGCTG
CGCCACCAAC
GTTCGTGAGG
CTGGCAGACC
GGGCAACTCC
GATCAGGAAC
CCCGTCCGGC
CAACATCTAC
CGGCTTCACC
CTCCGAGAAG
CAGGTACACC
CGGCAACTCC
CACCACCACC
CGGCAACATC
CTCCGG C
CTACEAA A
CCCTGGCGTT
TAGCGAAGAG

HindIII and BamHI; — represent start and stop codons (See text for detail).

27

Ban“ TAA(2155) fwﬂmsg)
N10,, --
is \Q/ ' -.\
-. , ATG (256)
pROBS 3 (233) (4571bp)

 

 

 

 

Puriﬁcation, blunt end fonration and dephosphorylatim

Vectcr(3422 bp) I 11186110925 hp)

Ligation, mfmratim in E coli, colony hybridization, identiﬁcation of positive clmes and determ'mtion of orientation

{it \"Q’/

 

 

pAAl
(5347113)

Figure 2.2. Cloning scheme of cryZA in a plant expression vector pROBS

28

Since one end generated in insert is not compatible with vector, blunt end ligation was
carried out for cloning cry2A. For this, cohesive ends of DNA were ﬁrst made blunt using
E. coli DNA polymerase I large sub unit (Klenow) and then vector DNA was
dephosphorylated using calf intestinal phosphatase (CIP) to prevent self ligation. Ligation
of both DNA fragments was performed using T4 DNA ligase as described (Sambrook et
al. 1989).

The ligation mix was then transformed in a suitable E. coli strain and plated on
LB agar plates containing 100 mg/L ampicillin. The ampicillin-resistant colonies of
bacteria containing cry2A were identiﬁed by colony hybridization using the GeniusTM
system (Boehringer Mannheim Biochemical, Indianapolis, IN 46250, USA) according to
manufacturer’s instructions by using Digoxigenin (DIG) labeled crijA probe. The
positive colonies were then picked up and their DNA was conﬁrmed for correct
orientation of cry2A as described in results.

All enzymatic manipulations of DNA were carried out using the conditions
speciﬁed by the enzyme manufacturer (New England Biolabs, Inc. Beverly, MA,
USA) and all DNA extraction procedures were either standard (Sambrook et a1 1989) or
modiﬁed.

2.3.2. Plasmid constructs used for rice transformation

A binary vector pTOK 233 (Fig 2.3) was provided by Japan Tobacco Inc. in
Agrobacterium strain LBA 4404. This vector contains hygromycin resistance gene (hpt)
and a B-glucuronidase (gus) gene, each under the control of CaMV3SS promoter and the
nos polyadenylation signal. The gus gene also contains the catalase I intron, thus

minimizing its expression in the bacterium.

29

 

 

 

 

 

 

 

 

 

Nos N 358 N 358 -Int N
a "1"” I“ 8": IT;

HindIII BamHI EcoRI BamHI,HindlII BwnHI SstI

KUB I I | | | |
p ER—jNos nptH noslUbil crylAb I Nl3ss hp! N3sslgm lNI-E—
0.3 kb 1.09kb 0.281(b2.0kb 1.871(1) 0.281(1) 0.7kb1.5kb0.28kb 0.7kb 1.7kb 0.28kb

 

 

 

 

 

 

 

 

HindIII BamHI £er BamHI. Hmdﬂl BamHI Sstl

 

 

 

 

 

 

 

 

 

 

 

 

 

pKUC . *
._|Nos my nosUbI crylAc N 358 hpt N35S gus N|__
BR BL

0.3ld) 1.09kb 0.28kb2.01<b 1.87kb 0.28kb0.7kb1.5kb0.28kb 0.7kb 1.7kb 0.28kb

Figure 2.3. Restriction map pTOK233 and T-DNA of plasmid KUB and KUC. BR.
T-DNA right border; BL. T-DNA left border; crylAb and crylAc. synthetic
insecticidal genes from B. thuringiensis; Hpt. Hygromycin phosphotransferase gene;
gus. b-glucuronidase gene; NptII. Neomycin phosphotransferase gene; 358.
CaMV3SS promoter; Ubi. Maize ubiquitin promoter; Nos. Nopaline synthase
promoter; Nos. 3’ termination signal of nopaline synthase

30

Two plasmids (binary vectors) pKUB and pKUC (Figure 2.3) were used in all
transformation experiments to generate insect resistant rice plants. Plasmid KUB contains
a synthetic crylAb gene while pKUC contains a synthetic crylAc gene from B.
thuringiensis, under the control of the ubiquitin promoter and nos terminator. Plasmid
KUB and pKUC also contain a hygromycin resistance gene (hpt) and a B-glucuronidase
(gus) gene, each under the control of CaMV3SS promoter and the nos polyadenylation
signal. Both plasmids KUB and KUC were transformed in Agrobacterium strain LBA
4404.

2.3.3. Plant transformation

Seeds of Oryza sativa L. subsp. indica variety Basmati 370 were used in
transformation studies. A modiﬁed transformation method based on Hiei and co workers
(1994) was used to transform embryogenic calli obtained from mature rice seeds.
Agrobacterium strain LBA 4404 containing each of the above plasmids was grown from
single colony in 5 ml YEP medium (Table 2.1) supplemented with 50 mgl'I hygromycin
and 50 mgl'l kanamycin. The cultures were incubated at 28 °C and 250 rpm (revolutions
per minute) for 24 h. Then, the cultures were transferred to 45 m1 MS-AS medium (Table
2.1) and incubated under the same conditions for another 24 h. The bacterial cells were
then harvested by centrifugation and resuspended in 1015 ml of MS-AS (Table 2.1).
Three weeks old embryogenic rice calli developed from mature seeds on GM medium
(Table 2.1) were then infected with Agrobacterium cells under a vacuum for 15 min. The
excess medium was removed from the calli using sterile ﬁlter papers. Calli were cultured

on solid MS-AS medium (Table 2.1) and maintained at 28 °C under dark conditions.

31

Three days later, calli were washed with autoclaved distilled water containing 250 mgl'l
of cefotaxime, and cultured on GM-S medium (Table 2.1). Hygromycin resistant calli
were then transferred to a R-S medium (Table 2.1) for regeneration. The regenerated
plants were rooted on MS-S medium (Table 2.1). Each resistant callus was considered
one line, and all resistant callus lines selected were considered independent
transformation events.

The protocol described above was optimized on the basis of transient expression
of gus in the co-cultivated calli. For this purpose different concentrations of
acetosyringone (0, 100 and 200), days of co-cultivation (2, 3 and 5) and addition of
sugars (sucrose and glucose) were tested for gus expression in the calli.

2.3.4. Southern and northern blot analyses

Genomic DNA from leaves of transgenic and non-transgenic rice plants was
isolated using phytopure plant DNA extraction kit (Amersham-Pharmacia Biotech). For
Southern blots, 10 pg of genomic DNA from R0 and R1 transgenic rice plants was
digested with BamHI or HindIII restriction enzymes, and fractionated on a 0.8 % agarose
gel. Gels were denatured, neutralized and blotted onto Hybond-M membranes
(Amersham-Pharmacia Biotech). Membranes were hybridized with a 32P labeled gus
probe and the coding sequences of crylAb and crylAc (BamHI and EcoRI excised 1.8 kb
fragment from pKUB and pKUC) according to standard procedures (Sambrook et al.
1989).

For northern blots, total RNA was isolated from the leaves of transgenic and non-

32

Table 2.1 - Media used for rice tissue culture

 

Medium

Composition

 

YEP

GM

MS-AS

GM-S

MS-S

10 gl'1 Bacto-peptone, 10 gl'1 Bacto-yeast extract, 5 gl'l NaCl, 15 gl'1
agar, pH 7.2.

MS salts and vitamins (Murashige and Skoog 1962), 3 % sucrose, 2
mgl'l 2, 4-D, 300 mgl'l Casein enzymatic hydrolysate, 500 mgl'l
Proline, 2.5 g1" Phytagel, pH 5.8.

MS salts and Vitamins, 3 % sucrose, 1 % glucose, 500 mgl'1 cassamino
acids 2 g1"l Phytagel, 100 uM aeetosyringone, pH 5.2.

GM plus 50 mgl'l hygromycin, 500 mgl’1 cefotaxime

MS salts and vitamins, 3 % sucrose, 3 % sorbitol, 3 mgl’1 BAP, 1 mgl'l
NAA 1 gl'1 cassamino acids, 4 gl'l phytagel, 50 mgl'l hygromycin, pH
5.8.

‘/2 strength MS salts and vitamins, 2.5 gl" phytagel, 50 mgl'1 L
hygromycin, pH 5.7.

 

33

transgenic rice using Extract-A-PlantTM RNA isolation Kit (Clontech Laboratories, Inc.,
Palo Alto, CA, USA). Aliquots of RNA (10 pg) were fractionated in 1.2 % agarose-
formaldehyde denaturing gels and blotted on to Hybond-N nylon membranes
(Amersham-Pharmacia Biotech). Transcripts for crylAb and crylAc were analyzed with
the standard northern blotting method (Sambrook et al. 1989) using 32P labeled crylAb
and crylAc coding sequences as probes.
2.3.5. Gus assay

Expression of gus gene was analyzed as described elsewhere (Jefferson et al.
1987)
2.3.6. Western blot analysis of CrylAb and CrylAc

Total protein was isolated from Basmati 370 non-transgenic control and
transgenic rice lines. The isolated proteins were analyzed by western blot analysis using
antiserum raised against Cryl Ab using standard protocols (Koziel et a1. 1993). Brieﬂy,
100 pg of total protein fractionated on a 10 % SDS polyacrylarnide gel and transferred to
a nitrocellulose membrane, which was then subjected to detection with antisera. The
amount of Bt protein in transgenic samples was quantiﬁed by comparing to a known
amount of puriﬁed Bt protein (positive control) in the same blot.
2.3.7. Progeny analysis

Selfed seeds (R1 progeny) of the transfonnants were sown in solidiﬁed half-
strength MS medium containing 50 mgl'l hygromycin. Hygromycin resistance was
scored 10-d aﬁer sowing. Experiments were laid out in a completely randomized design

with three replications. Data were analyzed by analysis of variance (PROC ANOVA,

34

SAS Institute 1985). Means were separated using Tukey’s Studentized range test at the
95 % conﬁdence level.
2.3.8. Optimization of Real Time PCR
2. 3. 8. I . Plant materials

Five independent Agrobacterium-mediated crylAb and crylAc transformed
Basmati 370 indica rice lines (Table 1) (Ahmad et al. 2002a) were used to determine
transgene copy numbers. Transgene copy number was also determined Via Southern
blotting. An untransformed wild type indica rice plant was used as a negative control.
2.3.8.2. DNA isolation

Genomic DNA was isolated from transgenic rice lines and untransformed wild
type indica rice using the Phytopure Plant DNA Extraction Kit (Amersham-Pharmacia
Biotech, Piscataway, NJ). DNA was quantiﬁed spectrophotometrically and also
ﬂourometrically using Pico Green (R) double stranded DNA quantitation kit (Molecular
Probes, Inc., Eugene, OR).
2.3.8.3. Real Time PCR

Experiments were conducted using the ABI Prism 7700 Sequence Detection
System (Perkin Elmer/Applied Biosystem, Foster City, CA) using 96 well microtiter
plates. The ampliﬁcation reactions were prepared in a total volume of 25 pl using
Advantage-GC Genomic PCR kit (Clonetech Laboratories, Inc., Palo Alto, CA)
containing template DNA (0-100 ng), 100 nM of each primer and 1: 40,000 dilution of
SYBR(R) Green I (Molecular Probes, Inc. Eugene, OR). The PCR was initiated with a
denaturation step at 94°C for 2 min, and then followed by 40 cycles of denaturation at

94°C for 1 min, annealing at 52°C for 45 sec and extension at 72°C for 1 min.

35

The primer sequences used in the reactions for the ampliﬁcation of 542 bp and
606 bp coding region of crjyIAb and crylAc are as follows:
cryIAb/cryIAc Forward primer: 5’ACAGAAGACCCTTCAATATC 3’
crylAb Reverse primer: 5’GTTACCCTGATTGATAGGC 3’
crylAc Reverse primer: 5’GTTACCGAGTGAAGATGTAA 3’

A standard curve for transgene copy number was generated using pKUC (Figure
1) at 0, 10, 102, 104, 106 and 108 copies. Analysis of data and threshold cycle (Ct)
determination were accomplished using the ABI Prism 7700 Sequence Detection
Software. The ﬂuorescence of the SYBR Green I was monitored at the end of the
denaturation and the elongation step of each PCR cycle. Data represent mean of three
replicates.

After ampliﬁcation, a melting curve was acquired by heating at 95°C for 20 sec
and then cooling to 52°C for 20 sec and then slowly heating (0.01°C/sec) to 95°C for 20
min with ﬂuorescence data collection at 02°C intervals, using ABI Prism 7700’s
software.
2.3.8.4. Calculation of transgene copy number

Transgene copy number was calculated using Southern blotting by digesting rice
genomic DNA with HindIII. Since, HindHI does not restrict within the gus cassette in the
constructs pKUB and PKUC (Figure 2.3), the number of bands observed after
hybridization with gus probe should reﬂect the number of copies inserted into the rice
genome.

Calculation of transgene copy number using the Real-Time RCR took place by

using the software accompanying the ABI Prism 7700 instrument that detects the

36

accumulation of PCR product by the increase in ﬂuorescence. The accumulated
ﬂuorescence after normalization relative to established base line levels (delta Rn) was
plotted against cycle number. The delta Rn values produce a Real-Time ampliﬁcation
plot for each well. The threshold was set at 10 times the standard deviation of the mean
base line emission calculated between the 3rd and 10th cycles. The cycle at which the
ampliﬁcation plot crosses the threshold is deﬁned as Ct, which reﬂects a positive result.
The amount of DNA or transgene copy number in an unknown sample was calculated by
interpolation from a standard curve of Ct values generated using a known amount of
starting DNA concentrations. Since one copy of the rice genome contains 0.5 pg DNA
(Bennett & Leitch 1995), total rice genome copies (Y) in template DNA (50-100 ng) used
in Real Time PCR are 1-2 X 105 copies. Thus, the copies corresponding to each Ct value
of transgenic event (Z) was calculated as the ratio of amount calculated using standard

curve (X) to the total amount of target DNA (Y) used in the Real Time PCR (Z= X/Y).

37

2.4. RESULTS
2.4.1. Cloning of cry2A in a plant expression vector

After ligation and transformation of bacterial cells with the ligation mix, positive
clones were identiﬁed by colony hybridization. Colony hybridization is a very useful
approach, especially when working with blunt-end ligation cloning because self-ligation
of the vector gives colonies without inserts. Several positive colonies containing cryZA
coding sequence were identiﬁed (Fig 2.4). These colonies were picked up and DNA was
analyzed for the correct orientation of 1.925 kb cryZA fragment in the vector. The
enzymes selected for this purpose were SalI and PstI, which cut adjacent to the 3’ end of
the terminator sequence in the vector and at positions 15 and 381 in the insert,
respectively. Thus restriction of DNA would release fragments of 1.9 and 3.5 Kb in case
of Sal] and 1.3 and 4.0 Kb in case of PstI digestion. The results shown in Figure 2.5
indicate that the expected bands were obtained. Therefore it is concluded that cry2A is
now under the control of CaMV 35S promoter with poladenylation signals of nopaline
synthase. An overview of the cloning scheme is shown in Figure 2.2.
2.4.2. Plant transformation

The results of transient expression of gus in the co-cultivated calli are presented in
Table 2.2. Different parameters, like addition of acetsyringone, time of co-cultivation and
addition of sugars, were tested for the most efﬁcient entry of T-DNA. The T-DNA entry
was determined by the number of calli showing gus expression. Results show that
addition of aeetosyringone and sugars were critical factors for the increase in transient

expression of gus.

38

Control a

 

Figure 2.4. Colony hybridization of cry2A. Dots in the filters (a-c) represent
bacterial colonies containing cry2A gene.

39

 

Figure 2.5. Confirmation of ligation and orientation of cryzA. M. Lambda Hindlll
marker; 1. pAA]; 2. Hindlll digested pAA]; 3. SaII digested pAAl; 4. PstI digested
pAA

4O

Table 2.2 - Co-cultivation experiments for optimization of conditions for
Agrobacterium-mediated transformation of Basmati rice 370. Twenty calli were used
in each experiment and experiments were repeated twice. Gus positive calli are
shown under levels of aeetosyringone.

 

 

 

 

 

Levels of aeetosyringone
Days of co— 0 100 200
cultivation
Without sugars 2 0 ' 0 0

3 0 1a 1a

5 0 1a 1a

With sugars 2 0 0.5a 1a
(3% sucrose + 1% 3 0 5.5c 4.50
glucose) 5 0 2.5b 1 .5ab

 

 

 

 

 

Values followed by different letters show signiﬁcant differences between means as determined by Tukey’s
Studentized Range test, P: 0.05

41

 

Omission of sugars resulted in a decrease in the production of gus-expressing calli. The
most optimum time for co-cultivation was found to be three days. Taken together, the
results show that addition of aeetosyringone at a concentration of 100 or 200 pM, the
combination of 30 g sucrose and 10 g glucose, and three days of co-cultivation gave the
highest number of gas expressing calli (30%). This observation was signiﬁcantly (P:
0.05) different than other parameters tested.

The results of transformation and selection of resistant calli are presented in Table
2.3. A total of 64 plants were regenerated from 15 hygromycin resistant calli, which on
average were 4.2 plants per callus. Among those plants, 39 were transformed with pKUB
and 25 were with pKUC. Table 2.3 gives summary of transformation experiments.
Regenerated plants were grown in the greenhouse for molecular analysis, insect bioassay
and seed collection (Figure 2.6a-e).
2.4.3. Molecular analysis of plants in R0 and R1 progeny

Southern analysis of transgenic plants revealed a unique hybridization-banding
pattern for each of the lines analyzed, indicating integration of transgenes and conﬁrming
that each line resulted from an independent transformation event. The blots Shown in
Figure 2.7a and b conﬁrm the integration of 1-3 copies of gus in R0 transgenic plants.
Figures 2.7 a and b also conﬁrm the presence of gus in R1 progeny of independent
transgenic lines 370-ub-3, 370-ub-4, 370-uc-l, 370-uc-3 and 370-uc-5). Further Southern
analysis on R0 positive plants conﬁrmed the presence of the complete cassette for crylAb
and crylAc with ubiquitin promoter and terminator (4.1 kb ﬁagment) within the plant

genomic DNA (Figure 2.83 & b).

42

Table 2.3 - Summary of transformation experiments

 

 

No of A grobacterium strain Weight of # of # of
obs. co-cultured Hygromycin Regenerated

calli (grams) resistant calli calli

1 LBA 4404 (pKUB) 4.2 4 4

2 LBA 4404 (pKUB) 6.0 2 2

3 LBA 4404 (pKUB) 4.5 3 3

4 LBA 4404 (pKUC) 2.5 1 1

5 LBA 4404 (pKUC) 2.8 3 3

6 LBA 4404 (pKUC) 2.4 2 2

 

43

.4"! 1’
1“]..1 -—
nr 0." ..‘3'

-§

 

Figure 2.6. Selection and regeneration of Basmati 370 transgenic rice plants. a.
Untransformed calli on Hygromycin containing medium; b. Hygromycin resistant
clumps growing on selection medium; c. Regenerating Hygromycin resistant calli; d.
Regenerated plants on Hygromycin containing MS medium; e. Transgenic Bt
containing rice plants in the greenhouse bearing seeds.

 

 

 

 

 

 

 

P1234567C34

6.2kb ,. . we a

 

 

 

Figure 2.7. Southern blot analysis of Basmati 370 transgenic rice plants in R0 and
R1 generation. The DNA was digested with BamIII and probed with gus coding
sequences. Lanes 1-7 in a: Basmati 370 transgenic lines 370—ub-1 to 370—ub—7 for
crylAb; lanes 1-7 in b: Basmati 370 transgenic lines 370—uc-l to 370—uc-7 for crylAc.
P, plasmid DNA of cry lAb and crylAc; C, DNA from non-transgenic plant.

45

CIyIAc - R0
P 1 2 3 4 5 6 C

 

 

 

 

 

 

 

3 C ..
a *
.’
1.8 kb
‘ ‘r C- - <—
cryIAb - R0
P 1 2 3 4 5 C
b
1.8 kb
‘ - : :— - ﬂ ‘—

 

 

 

Figure 2.8. Southern blot analysis of Basmati 370 transgenic rice plants in R0
generation showing integration of crylAc and crylAb cassette. The DNA was
digested with Hindlll and probed with crylAb and crylAc coding sequences. Lanes
1-6 in a: Basmati 370 transgenic lines 370—ub-1 to 370-ub-6 for crylAb; lanes 1-5 in
b: Basmati 370 transgenic lines 370-uc-1 to 370—uc-5 for crylAc. P, plasmid DNA of
cry 1Aba nd crylAc; C, DNA from non-transgenic plant.

46

2.4.4. Expression of crylAb and cryIAc

Expression of cryIAb and cry/Ac in the transgenic plants was examined using
northern blot and western blot analyses. Northern blot analysis of Southern positive
cryIAb and cryIAc transformed rice plants showed the presence of corresponding
transcripts in the leaf tissues at detectable levels (Figure 2.10a). Western blot analysis
using a polyclonal antibody against CrylAb, which also cross-reacts with CrylAc
conﬁrmed the expression of 65 kDa protein corresponding to the puriﬁed Bt toxin
(CrylAb and CrylAc) in R0 and R1 trangenic rice plants (Figures 2.9 & 2.10b). There
were no such bands detected in the western blots of non-transgenic control rice plants. A
total of 25 plants were analyzed in R0 and R1 progeny, and the level of protein
expression was found in the range of 001-01 % of total soluble protein.
2.4.5. GUS expression

Histochemical analysis showed GUS expression in transformed calli at transient
as well as stable level. Leaves from transgenic rice plants also conﬁrmed the expression
of GUS in R0 and R1 progeny. Overnight incubation of leaf tissues at 37 °C in the X-
gluc (5-bromo-4-chloro-3-indolyl glucuronide) solution showed intense GUS staining in
all transgenic leaf tissue analyzed (Figure 2.11).
2.4.6. Segregation of transgenes

R1 progeny plants were analyzed for segregation pattern of hpt, gus, crylAb and

crylAc genes. Results presented in Table 2.4 show Mendelian inheritance (3:1) for hpt in

47

kDa

68:

R0 43 _-

26

 

 

 

 

"7" 9‘1 (19:31 4" Ming -1

O
’r‘ ‘1‘ _. r, i ' " .. r. " rs it
it: 2:11? r; - V
L" r} n. .1. .. T _ __: ,. , . :- .J
: .‘ ‘
s I - I ‘ ‘
. ‘ L g .3
§ . a» “ ~‘r' 1‘. J O ; .
. . .. t. t l

 

 

‘_C_rylAb
65 kD

Figure 2.9. Western blot analysis of CrylAb and CrylAc in Basmati 370 R0
transgenic rice plants. Lane M. Molecular weight standards; C. Protein from an
untransformed rice plant; Lane 1-3. crylAb expressing rice plants; Lane 4-6 crylAc
expressing rice plants; Lane P. Purified CrylAb protein.

Note: The same polyclonal antisera recognizes both Cry lAb and Cry lAc. Furthermore, the nature of
polyclonal antisera has caused two sets of non-speciﬁc bands that are smaller than the Cry lAb and Cry

1Ac bands.

48

R1

68

43

26

 

 

 

 

 

CglAb
C 1 2 3

 

 

a

la

 

 

Figure 2.10. Northern and Western blot analysis of CrylAb and CrylAc in Basmati
370 R1 transgenic rice plants. a. Northern blot of R1 rice plants. Lane 1-6. Lane 1-
3. CrylAb expressing R1 rice plants; Lane 4-6. CrylAc expressing rice plants; Lane
C. RNA from an untransformed rice plant b. Western blot of R1 rice plants. Lane
C. Protein from an untransformed rice plant; Lane 1-3. CrylAb expressing R1 rice
plants; Lane 4-6. CrylAc expressing rice plants; Lane P. Purified CrylAb protein;

Lane M. Molecular weight standards.

49

 

 

 

 

 

 

Figure 2.11. Transient and stable expression of GUS in callus (a & b) and leaves (c)
of Basmati 370.

50

Table 2.4 - Segregation of hygromycin resistance in R1 progeny

 

 

 

Line Hyg. Hyg. Ratio X2 P
Resistant Sensitive
seeds seeds
370-ub-1 15 10 3:1 3.0 0.083
370-ub-2 11 10 1 :1 0.047 0.82
370-uc-1 14 6 3:1 0.266 0.60
370-uc-1-a 17 5 3:1 0.060 0.80
370-uc-2 17 7 3:1 0.221 0.63

 

51

 

most of the transgenic lines analyzed. However, a non-Mendelian segregation (1:1) was
observed in one of the transgenic lines (370—ub-2). Hygromycin resistant R1 plants were
also positive for gus as determined by gus expression in the leaves.
2.4.7. Optimization of Real Time PCR
2. 4. 7. 1. Development of standard curve for BI using S YBR Green 1

After optimization of primers and PCR conditions, experiments were performed
with a known amount of diluted DNA from 10 tolO8 copies of Bt gene (cryIAc/cryIAb)
to generate a standard curve (Figure 2.12a &b). The Ct values ranged from 12-40 cycles
with a deviation of a maximum of 0.4 (Figure 2.12a). The Ct values were reproducible in
replicated experiments. The calculated R2 value was 0.9993 (Figure 2.12b). There was a
linear correlation between the amount of DNA used as template in the beginning of PCR
reaction and the Ct values during ampliﬁcation. Therefore, this standard curve was used
to calculate the amount of DNA in the unknown transgenic samples.
2. 4. 7. 2. Copy number ofcrylAc and crylAb

The Ct values and the calculated copy numbers using standard curve is given in
Table 2.5. Using the Real Time PCR, one to three copies of the crylAb and crylAc were
calculated in transgenic rice plants (Table 2.5). No ampliﬁcation was shown in the case

of wild type (non-transgenic) plants.

52

Table 2.5: Determination of transgene(ciy1Ab/cty1Ac) copy number in trnagenic
Basmati 370 lines and the correlation of Real Time PCR results with Southern blots.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Transgenic DNA Copies Ct Transgene Transgene Transgene Segregatiori
lines taken of rice copies copy # copy # ratio

genome based on based on based on

ng per Ct=X RLT=Z Southern

DNA blot

taken

=Y
370-ub-7 50 1on5 2054:034 3on5 3 3 ND
370-ub-2 100 2on5 21.62i0.4 1.5x105 0.75 1 1:1
370-uc-1 50 1x105 22.130.42 1on5 1 1 3:1
370-uc-2 50 1on5 223335074 0.9on5 1 1 3:1
370-uc-3 100 2x105 205530.13 3.1x105 1.6 2 ND
Non- 100 2 x105 N/A 0 0 0 N/A
Transgenic
Control

 

 

Note: Copy numbers are calculated based on Z=X/Y

Ct = ﬁrst cycle that generates a signal over the background level

ND= Not determined
N/A= Not applicable

53

 

 

 

 

 

 

O 5 1O 15 Z) 25 I!) 5 4)

Cycle threshold (Ct)

 

y = -3.3087x + 38.724
R2 = 0.9993

   

 

(b) C. :21
l

 

 

 

 

 

 

 

 

 

90
(C) ,0
Derivative
30
0
60 70 80 90
Temperature (°C)

Figure 2.12. crylAb/crylAc PCR product detection in Real Time PCR. (a)
Ampliﬁcation plot generated using known amounts of pKUC. (b) Standard curve
for the data presented in a. (c) an overlay of melting curve derivative profiles

following Real Time PCR showing peaks for known amounts of pKUC and
crylAb/crylAc transformed plants.

54

2.4.7. 3. SYBR Green I copy number assay

The dissociation curves (Figure 2.12c) analyses enabled to assess the speciﬁcity
of the Real Time PCR reaction. A single curve for each reaction was observed as the
result of a single consistent melting temperature (Tm= 81.2 °C) except in the no template
control and the wild type (non-transgenic) rice DNA samples. Further, Real Time PCR
results were compared with results obtained after Southern blot analysis (Table 2.5) and
both results match to a high degree. The only difference was that the Real Time PCR
gave results in a few hours and the Southern blot took several days.

These results show that conditions were optimized for a Real Time PCR
procedure using SYBR Green I for speciﬁc target genes (crylAb and crylAc). Increasing
the length of the amplicon reduces the non-speciﬁc ampliﬁcation, which may be a
problem for 50-200 bp amplicons in Real Time PCR. It was also possible to characterize
the transgene speciﬁcally and accurately in a short interval of time and with little effort. It
does not require any post-PCR manipulations because the Ct values reﬂect an exact

picture of PCR products.

55

2.5. DISCUSSION

The crystal protein genes from Bacillus thuringiensis have proven to be a valuable
and relatively safe for use in transgenic crops (Koziel et a1 1993; Wunn et al. 1996;
Nayak et a1 1997.). Various genes from this environmentally friendly bacterium have
been cloned and expressed in different plants (examples: rice, cotton and com). The
crylAb, crylAc and cryZA are effective against lepidopteran and dipteran (Hofte and
Whitely 1989) insect pests. Biochemical evidence suggests that the presence of high-
afﬁnity binding sites on the mid-gut epithelium may differ between susceptible and
resistant insects (Feitelson et al. 1992). Moreover binding sites for cry2A and
crylAb/crylAc are different (Brousseau et al. 1999), therefore these genes can be used for
gene pyrarniding. The construct containing cryZA gene, developed in this study was
successfully used by other researchers (Maqbool et a1 1998) to develop insect resistant
plants through pyramiding with other genes. Results from the use of plasmid constructed
in this dissertation is published elsewhere (Maqbool et al. 1998).

Success in terms of recovery of fertile transgenic plants at reasonable frequencies
from elite varieties should be a key criterion for evaluating the effectiveness of a speciﬁc
method for engineering recalcitrant species. A number of protocols for development of
transgenic plants have been used utilizing electric current in the form of electroporation
(Xu and Li 1994), microinjection (Morikawa and Yamada, 1985), Polyethylene glycol
(PEG) method (McElrroy et al. 1990), different versions of guns (McCabe et al. 1998;
Card, 1990; Johnston et al. 1990) and Agrobacterium—mediated method (Hiei et al. 1994,
Aldemita and Hodges 1996). Of all methods the Agrobacterium-mediated method is the

most economical and reliable technique used. As the number of reports utilizing this

56

method with previously recalcitrant Species are becoming available making it a potential
tool for genetic engineering of all plant species. One advantage of Agrobacterium-
mediated system over biolistic microprojectile bombardment and other methods is the
integration of low copy numbers of the transferred DNA, which may minimize gene
silencing (Kumpatla and Hall, 1998). The biolistic system may also result in
fragmentation and rearrangement of genes, a high frequency of sterile plants (Finnegan
and McElroy, 1994; Flavell, 1994), and some times non-Mendelian inheritance of the
transgenes (Peng et al. 1995). The Agrobacterium-mediated system, on the other hand, is
less prone to these problems and less dependant on invention royalties as compared to the
biolistic system.

Here, I have described the use of Agrobacterium for the production of transgenic
rice plants expressing cryIAb and cryIAc conferring insect resistance in indica rice
variety Basmati 370. Although several reports have been published describing the
production of Agrobacterium-mediated transgenic rice (Hiei et al. 1994; Dong et al.
1996; Cheng et al. 1998), the transformation of Basmati rice is limited to few reports
(Rashid et al. 1996; Mohanty et al. 1999) because of its poor in vitro response. The
optimization of expression of gus in japonica and indica rice has been described (Hiei et
a1 1994; Aldemitta and Hodges 1996). In this study Basmati 370 was used to optimize
conditions for the most efﬁcient entry of T—DNA in rice genome and to produce
transgenic insect resistant plants. The result showed that gus expression was highest
using aeetosyringone, high amount of sugar, and three days of co-cultivation. These
results are in agreement with the report on j aponica rice (Hiei et a1 1994). The importance

of addition of aeetosyringone also conﬁrms the reports of Aldemitta and Hodges ( 1996)

57

who singled out the use of aeetosyringone as the most important factor for successful
transformation of rice. However in this dissertation research a low level of expression
(30%) of gus was recorded, which may be attributed to the recalcitrant nature of Basmati
rice in response to tissue culture conditions, as has been reported previously (Mohanty et
a1 1999).

Hygromycin resistance gene has been used for the selection of a number of
transgenic tissues in different crop species. In this study hygromycin was found to be a
very reliable selection agent at a concentration of 50 mg/L. All hygromycin resistance
plants were also positive for the presence of crylAb and crylAc showing a 100% co-
integration of the selectable marker and the Bt genes in transgenic plants. Furthermore,
hygromycin resistant calli also expessed GUS as shown in Figure 2.12. Our transgenes
expression also agrees with reports indicating that Agrobacterium-mediated method of
transformation produces plants with low copies of transgenes and less gene silencing. For
example, 1-3 copies of transgenes (hpt and gus) were observed in transgenic lines
produced in this study. All plants that survived hygromycin selection also showed GUS,
Cryl Ab and CrylAc expression.

The amount of Bt protein detected in the independent transgenic lines was in the
range of 001-0.] %. This level of Bt proteins did not affect the overall apparent
phenotype of the transgenic lines, as was reported for higher levels (21 % of total soluble
protein) of Bt expression in rice (Maqbool et al. 1998). Analysis of R1 progeny for the
gus, cryIAb and crylAc further conﬁrmed the stability of T-DNA in the rice genome. In

all lines tested, Bt expression was detected along with gus and hygromycin resistance.

58

In the results section of this document, I have reported a SYBR Green I copy
number assay for Real Time PCR using gene speciﬁc primers for the ampliﬁcation of a
relatively long ampliﬁed product (as opposed to a conventional short amplicon) (Table
2.5, Figure 2.12 a, b and c). This assay allowed the screening of transgenic plants with
enhanced sensitivity and accuracy in a short time period and at signiﬁcant labor savings
compared to conventional Southern blotting procedure. TaqMam(R) is widely used in Real
Time PCR. TaqMam‘R) requires two primers and a speciﬁc probe while SYBR Green I
requires two primers only. We used the SYBR Green I to avoid design and syntheses of
probes. In this study, SYBR Green I gave consistent results for transgene copy number
Calculation that was in agreement with results obtained after southern blots. Overall, the
SYBR Green I procedure used for copy number calculation in transgenic plants is simple,
quick and easy over other Real Time PCR procedures (Ingham 2001), and as compared to
Southern blotting.

Global food situation is precarious. Despite the success of the green revolution in
increasing food, there are millions of people in the world today who are chronically
undernourished (Conway, 1998). Rice constitutes daily diet of most of these people.
Indica rice feeds more than two billion poor, predominantly in less developed countries.
Population is expected to increase in coming few decades, especially in Asia and Aﬁica
where rice constitute a major source of calories. This means additional rice needs to be
grown with considerably fewer inputs of agrochemicals and under sustainable conditions.
This immense task will require that traditional rice breeding and production be supported

by every possible contribution from science, including genetic engineering.

59

CHAPTER III : INSECT FEEDING ASSAYS ON TRANSGENIC BASMATI
RICE PLANTS

3.1. ABSTRACT

Rice grown under ﬁeld conditions suffers heavy losses due to pest attack from
Lepidopteran insects including rice stem borers and rice leaf folder. Production of
transgenic plants expressing insect resistance genes is one approach to control these
losses. Although molecular analysis of the transgenic plants conﬁrms the expression of
the introduced genes, feeding of transgenic tissue to the target insect is the ultimate test to
determine the expression and stability of the toxic protein. Ostrinia nubilalis (European
corn borer) a major pest of corn was found to severely damage rice tissue in the
laboratory bioassays. Bioassays of non-transgenic and transgenic plants of indica rice
(Oryza sativa) variety Basmati 370 were conducted against 0. nubilalis to determine a)
whether 0. nubilalis can feed and survive on rice plants, and b) test the effectiveness of
the second generation transgenic (R1) plants expressing CrylAb and CrylAc to control
0. nubilalis predation. Excised-leaves of plants at tillering stage, two-week-old whole-
plants and whole-plants at tillering stage were used in feeding assays. Signiﬁcant
(P<0.0001) differences were observed in insect mortalilty after feeding for ﬁve days on
excised young leaves or on two-week-old plantlets from transgenic versus non-transgenic
plants. Also, there were signiﬁcant (P<0.0001) differences in insect mortalilty after
feeding for seven or twenty ﬁve days on 40 days old whole plants of transgenic versus
non-transgenic plants. In addition, incorporation of total proteins (containing Bt) of
transgenic plants versus the total proteins of non-transgenic plants into insect artiﬁcial

diet showed that total protein extract from transgenic plants resulted in signiﬁcant

60

differences in mortality of insects fed on these artiﬁcial diets. Although O. nubilalis is not
presently a rice insect pest, it is illegal to bring Lepidoptem rice insects [stripped stem
borer (Chilo suppressalis; SSB), yellow stem borer (Scirpophaga insertulas;YSB) and
rice leaf folder (Cnaphalocrocis medinalis; RLF)] to the US, and also it is possible that

O. nubilalis may become a rice pest under certain circumstances.

61

3.2. INTRODUCTION

In 1909, Berliner received some diseased Mediteranean ﬂour moth larvae from a
mill in Thuringen. From these larvae he was able to isolate a sporulating bacterium and
he named the bacterium Bacillus thuringiensis (Bt). Bt was ﬁrst used as an insecticide in
the early 1930 primarily against the Ostrinia nubilalis (European corn borer) in south east
Europe. The ﬁrst commercial product (spreine) was available in 1938 in France (Weiser,
1986) for the control of the ﬂour moth (Jacobs, 1951). In 1960, stimulated by the
growing concern over the use of chemical insecticides, the ﬁrst Bt strain was
commercialized and was marketed as “Thuricide.”

Bt produces the best-known insecticidal toxin, which has a great potential for the
control of various Lepidopteran, Dipteran and Coleopteran insects (Bulla et al. 1980,
Aronson et al. 1986; Hofte and Whiteley, 1989). Recent ﬁndings have demonstrated the
toxicity of Bt to a number of other classes of pests such as nematodes (Rhabditida),
aphids (Homoptera) and ﬂeas (Siphonaptera) (Drummond et al. 1991; Feitelson et al.
1992; Payne and Connon, 1993). Among over 200 classes of Bt proteins, there are at
least 89 distinct crystal protein genes (de Maagd et al. 2001). The increasing importance
of integrated pest management, largely as result of concerns over environmental quality
and food safety, plus the failure of conventional chemicals due to an increasing number
of biotypes developed that were resistant to insecticides, a major niche was found for
deploying the potential of Bt in protection against insects (Dent, 1993). The Cry toxins
have enormous commercial value as safe biodegradable pesticides. Also the speciﬁcity
of Bt toxicity is highly desirable in integrated pest management programs, particularly

because it does not harm most other living organisms (May, 1993).

62

The use of Bt in insect control program accounts for only less than 1% of
insecticides used worldwide each year (Bauer, 1995). The comparative high production
cost of Bt based insecticides is a primary impediment to more wide spread usage. The
major advantages of Bt as an insecticide are its rapid environmental degradation and
vertebrate safety (Meadows, 1993). Bt does not pose a signiﬁcant risk to mammals and
can be used safely in environment with human exposure (Siegal et al. 1988). The insect
resistance against chemical pesticides is rigorous to the extent that more than 500 species
of insects have developed pesticidal resistance (Tabashnik, 1994). However, the
development of resistance of insects to Bt could be reduced by using different Bt proteins
with different modes of actions.

Advances in biotechnology and genetic engineering, as well as the proteinaceous
nature of the Cry toxins, has led to the selection of my genes as primary insect resistance
genes for expression in plants and microbes such as endophytes (Adang, 1991; Ely, 1993;
Peferoen, 1992; Gelemtner and Schwab, 1993; Cannon, 1996). Bt transgenic plant
strategy will also solve the problem of limited ﬁeld stability of commercial Bt protein
product because protein remains active in the plant and losses activity outside the living
organism system.

The O. nubilalis signiﬁcantly affects production of Zea mays L. (ﬁeld corn,
popcorn, seed com, and sweet corn) as well as other crops, including sorghum, cotton and
many vegetables. In maize, it has been calculated that the yield losses and pest (O.
nubilalis) control management costs to farmers is over $1 billion annually (Mason et al.
1996). Management strategies for O. nubilalis and other insect pests are changing with

the use of Bt-transformed plants. Transgenic maize plants expressing Bt genes have been

63

shown to be highly resistant to O. nubilalis (Snow and Palrna 1997; Pilcher and Rice
2001). Presently, O. nubilalis is not a major pest of rice. However, I used this
Lepidoperan insect since rice stem borer could not be used in the United States. Common
insect pest of rice in the United States include the rice water weevil (Lissoroptus
oryzophilus), the tadpole Shrimp (T riops longicaudatus), rice leafminer (Hydrellia
griseola), rice seed midges (family Chironomide), armywonn (Pseudaletia unipuncta)
and rice stink bug (Oebalus pugnax) (htt://agronomy.ucdavis.edu/uccerice/product/rpic08.htrn).

Rice, one of the most important food crops, is highly vulnerable to insects. At the
global level, the average yield losses to insect pests are estimated to be about 9 million
metric tons. These losses are caused primarily by Lepidoperan insects including striped
stem borer (C. suppressalis; SSB), yellow stem borer (S. insertulas;YSB) and rice leaf
folder (C. medinalis; RLF) (Herdt, 1991). Chemical sprays used for the control of these
insects increase the production cost and cause deterioration in rice ﬁeld environment
(Pingali and Rogers, 1995). Since 1993, many reports have been published on rice
transformation and several genes from Bt have been transferred into various genotypes of
rice (Fujimoto, et al. 1993; Ghareyazie, et a1. 1997; Nayak, at al. 1997 ; Wu, et al. 1997;
Cheng, at al. 1998; Maqbool, et al. 1998; Xiang, et al. 1999; Ahmad, et al. 2002a). These
reports also describe the efﬁcacy of Bt transgenic rice towards their major insect pests i.e.
SSB, YSB and RLF.

In the present study, using Bt transgenic rice plants attempts were made to
determine the possibility of O. nubilalis feeding on rice plants. Here, I report on the

efﬁcacy of transgenic indica rice variety Basmati 370 lines produced via an

64

Agrobacterium-mediated system with B. thuringiensis crylAb and crylAc genes in

laboratory and greenhouse insect bioassays utilizing O. nubilalis.

65

3.3. MATERIALS AND METHODS
3.3.1. Plant material

Indica rice variety Basmati 370, genetically engineered via an Agrobacterium-
mediated transformation system (Ahmad, et al. 2002a), expressing B. thuringiensis
CrylAb and CrylAc at the level of 001-01 % of total soluble protein were used in this
study. Four independently transformed second-generation (R1) lines (3 70-ub-1, 370-ub-2,
370-uc-1 and 370-uc-2); two each from CrylAb- and CrylAc-expressing plants were
included in the O. nubilalisfeeding bioassays.
3.3.2. Test insect

O. nubilalis egg masses were purchased from French Agricultural Research Inc,
Larnberton, MN, USA. The egg masses were kept at 27°C and 70 % humidity until they
hatched. To test whether 0. nubilalis larvae could feed on untransformed rice leaf tissue,
tillering stage leaves were cut into 6 x 1.4 cm sections and placed on moist ﬁlter papers
inside Petri dishes. Newly hatched larvae were allowed to feed on excised-leaves for ﬁve
days. Severe damage of rice leaves was observed after three to ﬁve days of feeding. We
tested the feeding capability of O. nubilalis in our studies because it is a Lepidopteran
insect, as are most rice insect pests, and because it was illegal to bring Lepidopteran rice
insects to the USA.
3.3.3. Laboratory feeding bioassays

Feeding assays were performed on excised-leaf removed from tillering stage
plants, two-week-old whole-plant and whole-plant at tillering stage to assess the

insecticidal activity of transgenic plants against 0. nubilalis.

66

Excised-leaﬁassays: Three leaf pieces (6 x 1.4 cm) were excised from greenhouse grown
tillering plants (30-40 day-old) placed on moist ﬁlter papers within Petri dishes (100 x 15
mm). Ten neonate larvae were allowed to feed on the excised-leaf pieces for three to ﬁve
days. Petri dishes were maintained at 25 °C under 14 hours light and 10 hours dark
conditions.

T wo-week—old plant assays: Two-week-old rice seedlings were placed in small vials (5 x
1 cm) containing 3 ml of liquid MS salts (Murashige and Skoog, 1962) medium.
Seedlings were then transferred into test tubes (20 x 2 cm). Ten neonate O. nubilalis
larvae were placed on young leaves of each rice seedling. The test tubes were maintained
at 25°C under 14 hours light and 10 hours dark conditions. Assays were conducted for
three to ﬁve days.

Whole-plant assays: Tillering stage greenhouse grown rice plants (4 tillers per plant; 30-
40 day-old) were employed for whole-plant bioassays. Twenty neonate larvae were
distributed on leaves of each plant. Plants were maintained under a contained
environment in the greenhouse with 14 hours light and 10 hours dark conditions.

Data were recorded at three and ﬁve days after infestation (DAI) for the excised-
leaf and the two-week-old whole-plant experiments, and at seven and 25 DAI for the
whole-plant assays. All experiments were laid out in a randomized complete block design
with four replications to minimize experimental errors due to uncertain conditions of light
or water in the tissue culture rooms and green house. Non-transgenic plants, of the same
stage as that of transgenic plants, were used as controls in each experiment. Data were

analyzed by analysis of variance (PROC ANOVA, SAS Institute 1985). Means were

67

separated using Tukey’s Studentized range test at the 95 % conﬁdence level. Percent leaf
area damage was calculated following the method of Maqbool et al. (1998).

Artiﬁcial diet assays: Insect feeding assays on artiﬁcial diet containing total soluble
protein from R1 transgenic and non-transgenic control lines were conducted. 0. nubilalis
artiﬁcial diet was purchased (Southland products, Inc. Lake Village, AR 71653, USA)
and prepared according to manufacturer’s instruction. Three ml of the diet was poured in
each 4 x 3 cm plastic containers. Total soluble proteins from transgenic and non-
transgenic rice plants were extracted as described for western analysis (Page-41).
Concentration (ng/pg) of Bt protein in extracted total soluble protein samples from each
transgenic line (370-ub-1 and 370-uc-1) was estimated based western blots. Different
dilutions (0.001, 0.01, 0.1 and 0.5 %) of each of the two Bt proteins were prepared from
the total protein extracts in total volume of 100 pl. Each dilution was spread on top of
each insect diet container. Five neonate larvae were placed in each container and the

assay was conducted for ﬁve days. The experiment was replicated four times.

68

3.4. RESULTS
3.4.1. Excised-leaf assays

Transgenic plants expressing CrylAb and CrylAc were highly resistant to
feeding by O. nubilalis (table-3.1a). The highest rate of mortality (i.e. 100 %) was
observed ﬁve DAI in all tested transgenic lines. The 60 % survival of the 0. nubilalis
larvae, observed ﬁve DAI using non-transgenic plant leaves, was signiﬁcantly different
(P<0.0001) from that on transgenic plant leaves (0 % survival). Similarly, the total leaf
damage (82.5 %) caused by the O. nubilalis larvae feeding on the non-transgenic leaves
was signiﬁcantly different (P<0.0001) compared to 4-16 % damage to the transgenic
lines (Table 3.1a; Figure 3.1a). Only one line, 370-ub-2, showed more than 10 % leaf
damage (i.e. 16.25 %) among all four tested lines.

Data on the O. nubilalis larvae feeding on non-transgenic rice plants established
294 % increase in length and 220 % increase in weight when compared with larvae
feeding on transgenic rice plants (Table 3.1b).
3.4.2. Two-week-old whole plant assays

Insect feeding assays with two-week-old whole plants also showed high mortality
i.e. 100 % of the O. nubilalis larvae ﬁve DAI (Table 3.2a). Almost 60 % of the larvae
survived ﬁve DAI on non-transgenic rice plants and causing 82.2 % plant damage.
Whereas, only 6-12 % plant damage was sustained by the transgenic plants because of O.

nubilalis feeding (Figure 3.1b; Table 3.2a).

69

 

Figure 3.1. Effect of insecticidal activity of transgenic rice plants expressing
CrylAb and CrylAc on 0. nubilalis utilizing (a) cut-leaf (b) two-week-old and (c)
whole-plants in bioassays. Plants were photographed 5 (a & b) and 25- (c) DAL NT:
non-transgenic rice plant; T: transgenic rice; Tc: crylAc expressing transgenic rice
plant; T: crylAb expressing transgenic rice plant. Arrows show zoom area with alive
and dead 0. nubilalis larvae on the NT and T plants

70

Table 3.1a - 0. nubilalis feeding assays on excised-leaves from tillering stage
transgenic Bt(cry1Ab and crylAc) rice plants. 10 0. nubilalis neonate larvae were
used per replicate and each assay consists of four replicates. This table shows Mean
number of surviving 0. nubilalis larvae and percent leaf area damage on rice
seedlings three and ﬁve days after infestation (DAI).

 

 

 

Plant material Surviving larvae Surviving larvae % ' Leaf area damage
3-DAI*‘ 5-DAI *2 5-DAI*3

Control 7.00a (i 0.815) 6.00a (i 0.705) 82.5a (i 4.78)

370-ub-1 1.50b (i 0.645) 0b 4.25b (i 0.75)

370-ub-2 1.25b (i 0.447) 0b 16.25b (i 5.54)

370-uc-1 0.75b (: 0.447) 0b 6.25b (i 1.25)

370-uc-2 0.50b (i 0.5) 0b 7.5b (i 1.44)

 

 

*Values followed by different letters show signiﬁcant differences between means as determined by
Tukey’s Studentized Range test, P= 0.05.

l; F=20.53, P<0.0001, df=4, 2; F=72.00, P<0.0001, df=4, 3; F=96.31, P<0.0001, df=4

Values in parenthesis show standard error.

Table 3.1b - Mean increase in the length (cm) and weight (mg) of 0. nubilalis larvae
feeding on non-transgenic control rice plants in cut-leaf assays.

 

Mean initial Mean length

 

 

% Increase Mean initial Mean weight 5- % Increase
length 5-DAI in length weight DAI in weight
1 i 0 3.94 i 0.01 294 0.03 i- O 0.96 i 0.014 220

 

71

 

Table 3.2a - 0. nubilalis feeding assays on two-week-old transgenic Bt (crylAb and
crylAc) rice plants. 10 0. nubilalis neonate larvae were used per replicate and each
assay consists of four replicates. This table shows mean number of surviving 0.
nubilalis larvae and percent leaf area damage on rice seedlings three and five days
after infestation (DAI).

 

 

 

Plant material Surviving larvae Surviving larvae % Leaf area damage
3-DAI='=1 5-DAI *2 5-DAI*3

Control 6.75a (i 0.25) 5.75a (i 0.625) 82.5a (: 2.5)

370-ub-1 1.50b (i 0.75) 0b 6.25b (d: 1.25)

370-ub-2 1.75b (i 0.625) 0b 12.5b (i 2.5)

370-uc-1 1.75b (i 0.475) 0b 8.75b (i 1.25)

370-uc-2 1.5b (i 0.475) 0b 8.75b (i 1.25)

 

 

*Values followed by different letters show signiﬁcant differences between means as determined by
Tukey’s Studentized Range test, P= 0.05.

1; F=l8.56, P<0.0001, df=4, 2; F=83.53, P<0.0001, df=4, 3; F=315.23, P<0.0001, df=4

Values in parenthesis show standard error.

Table 3.2b - Mean increase in the length (cm) and weight (mg) of O. nubilalis larvae
feeding on non-transgenic control rice plants in two weeks old plant assays.

 

 

 

Mean Mean % Increase Mean Mean % Increase
initial length 5- in length initial weight 5- in weight
length DAI weight DAI
1 j: 0 3.91 i 0.34 291 0.03 i 0 0.98 i 226

0.012

 

 

Table 3.2c - Mean decrease in the weight (g) of non-transgenic control rice plants in
two weeks old plant assays.

 

Mean initial weight Mean weight 5-DAI % Increase in weight

 

 

0.211 i 0.0095 0.16 i 0.008 23

 

 

72

O. nubilalis larvae grown on non-transgenic plants showed 291 % and 226 % increase in
their length and weight, respectively (Table 3.2b), consistent with the observations made
in excised-leaf assays. Data collected on plant weight ﬁve DAI showed a 23 % decrease
in the fresh weight of the non-transgenic plants whereas, there was an increase of 5-10 %
in the fresh weight of transgenic plants.
3.4.3. Whole-plant assays at tillering stage

Whole-plant assays showed survival of O. nubilalis larvae seven and 25 DAI on
non—transgenic plants, which were signiﬁcantly different (P<0.0001) from transgenic
lines (Table 3.3). Figure 3.1 shows the damage to the leaves of non-transgenic plants as
compared to the leaves of transgenic plants as observed after 25 days of bioassay. I found
high percentage of un-recovered insects in the case of whole plant tillering stage assays in
the greenhouse. There was 6 % mortality of O. nubilalis larvae on non transgenic
compared with almost 50-60 % mortality on transgenic plants (Table 3.3) seven DAI.
One hundred percent insect mortality was recorded on transgenic plants seven DAI, while
20 % of the insects were found alive on non-transgenic plants seven DAI. No dead heart
formation (characteristic damage of rice stem borers feeding on rice) was observed in
either transgenic or non-transgenic plants during the course of this experiment.
Furthermore, no living insects were recorded 25 DAI on transgenic or non-transgenic

plants.

73

Table 3.3 - Whole-plant 0. nubilalis feeding assays on transgenic Bt(cry1Ab and
cryIAc) rice plants. Twenty 0. nubilalis neonate larvae were used per plant (four
plants per assay). This table shows status of larvae recovered and un-recovered on
rice plants seven and 25—days after infestation (DAI).

 

Plant Status of larvae

material recovered dead

Status of larvae

un-recovered

Status of larvae

recovered alive

Status of larvae

recovered alive

 

 

7—DAI*‘ 7-DAI*2 7-DAI*3 25-DAI*4
Control 1.25a (i 0.75) 14.75a (i 0.75) 4.00a (i 0.43) 0.75a (i 0.9)
370-ub-1 10.25b (i 0.85) 9.75a (i 0.85) 0.00b 0.00b
370-ub-2 10.50b (i 2.32) 9.5a (i 2.32) 0.00b 0.00b
370-uc-1 11.75b (i 2.05) 8.25a (i 2.05) 0.00b 0.00b
370-uc-2 11.75b (i 1.18) 8.25a (i 1.18) 0.00b 0.00b

 

*Values followed by different letters show signiﬁcant differences between means as determined by
Tukey’s Studentized Range test, P= 0.05.
l; F=8.00, P=0.0012, df=4, 2; F=2.03, P=0.0562, df=4, 3; F=96.00, P<0.0001, df=4, 4; F=9.00, P=0.0006,

df=4

Values in parenthesis show standard error

74

 

3.4.3. Artificial diet assays

Data on feeding assay on artiﬁcial diet containing total soluble protein from
transgenic plants also showed effectiveness of different levels of Bt expressing plants
(Table 3.4; Figure 3.2). Complete mortality of the insects was observed ﬁve DAI using
0.1 and 0.5 % Bt protein dilution. Even using low level i.e. 0.01 % of Bt protein, 60 %
mortality was observed. However, no mortality was observed, when 0.001 % Bt protein
in total soluble plant protein was used. Whereas, results obtained using protein from non-
transgenic rice plants showed only 0-10 % mortality, signiﬁcantly (P < 0.05) different

than the experimental lines.

75

 

Figure 3.2. 0. nubilalis larvae 5—d after feeding on artiﬁcial diet containing total
soluble protein isolated from transgenic (expressing CrylAb and CrylAc) and non-
transgenic rice plants.

76

Table 3.4: Mean percent mortality of 0. nubilalis on artiﬁcial diet containing total
soluble protein from control and transgenic lines with different concentrations of Bt
protein ﬁve days after the assay

 

Lines % Insect Mortality

 

% Bt protein in total soluble proteins of rice leaves calculated

based on western blotting of transgenic lines

 

0.0013:1 001*2 0.1%3 0.5%4
Control 0a 0a 1 0a 0a
370-ub-1 0a 60b 10% 100b
370-uc-1 0a 60b 10% 10%

 

*Values followed by different letters show signiﬁcant differences between means as determined by
Tukey’s Studentized Range test, P= 0.05.

1; F=inﬁnity, P<0.0001, df=2, 2; F=243, P<0.0001, df=2, 3; F=9.00, P<0.007, df=2,

4; F= 0, df=2;

Note: Bt concentrations in each extract was determined based on the percentage of Bt present as total
soluble proteins in transgenic lines (i.e. 370-ub-1 contained 0.1% and 370-uc-l contained 0.1% and 0.05%
of total soluble proteins respectively).

77

3.5. DISCUSSION

The major objective of this study was to test the functionality of the heterologous
Bt proteins in different rice transgenic events. My insect bioassays also showed that the
Bt proteins could control a non-pest of rice.

Genetic transformation of crops can serve as a component of integrated pest
management (Sticklen, 1990). Some types of Bt (cryIAb, crylAc or cry9C) com have
proven to control 0. nubilalis dramatically. Chemical insecticides, if timed well, typically
provide control from 60-95 % (Ostlie, et al. 1997). In ﬁeld tests against natural and
supplemented O. nubilalis infestations, Bt (crylAb, crylAc or cry9C) corn hybrids
control over 99 % of O. nubilalis larvae (Ostlie, et al. 1997). In this study, I was
interested in assessing the feeding behavior of O. nubilalis towards rice plants and
whether Bt transgenic Basmati 370 lines expressing CrylAb and CrylAc will be
effective against 0. nubilalis. Because 0. nubilalis is not a pest for rice, I ﬁrst conﬁrmed
that O. nubilalis larvae could obtain enough nutrition on rice so that later stages of insect
development are achieved. Bioassays were performed at different stages of transgenic
rice plants to assure the resistance to O. nubilalis larvae. Findings reported here suggest
that O. nubilalis can feed and survive on rice plants, and Bt transgenic rice plants can
become resistant to O. nubilalis larvae.

Excised-leaf and two-week-old whole-plant assays of transgenic rice provided
complete mortality of O. nubilalis larvae at ﬁve DAI (Table 3.1a and Table 3.2a). Using
similar assays, up to 72.5 % mortality has been reported for rice yellow stem borer on

transgenic rice expressing CrylAc (Maqbool, et al. 2001). Moreover, 10 to 50 %

78

mortality for rice striped stem borer with CrylAb (Fujimoto, et al. 1993) and 76 to 92 %
mortality for rice yellow stem borer has been reported three DAI with Cryl Ac expressing
rice plants (Nayak,et a1. 1997). I also recorded mortality of O. nubilalis larvae on non-
transgenic rice plants (Table 3.2a). This could be due to experimental errors or injuries
associated with handling of neonate larvae. It is also possible that some of the mortality
that occurred is because rice is not typical food of O. nubilalis. However, observations
regarding leaf area damage (82.2 %) in non-transgenic leaves and 6-12 % in transgenic
leaves indicates that restricting these insects to a rice diet is not the only reason for high
mortality of O. nubilalis in bioassays utilizing Bt transgenic rice plants.

In case of whole-plant assays, seven DAI, there was signiﬁcant difference in the
mortality of O. nubilalis feeding on non-transgenic and transgenic plants. Consistent with
this observation, signiﬁcant difference between transgenic and non-transgenic plants also
occurred 25 DAI but the number of surviving larvae on average were only 3.75%.
Finally, feeding assays with neonate larvae showed signiﬁcant differences on artiﬁcial
diet assays containing total soluble proteins of transgenic and non-transgenic control
plants. The observed mortality ranged up to 100% with total soluble protein extractions
containing 0.01, 0.1 or 0.5% Bt in total soluble proteins. This is in agreement with that
observed for other Lepidopteran insects (Olsen and Daly 2000). This conﬁrms the

toxicity of transgenic lines developed in this study toward 0. nubilalis.

79

CHAPTER IV : Shoot apical meristem: In vitro morphogenesis and transformation
studies in wheat (T riticum aestivum L.)

4.1. ABSTRACT

Wheat (T riticum aestivum L.) is one of the most important cereal crops of the
world. However, there are biotic and abiotic problems associated with this crop that
reduce its yield and quality. In vitro techniques of wheat could lead to enhanced
productivity and thus help in solving global food problem, which is a major concern as
population is growing at extremely high rate. Although there have been attempts to
regenerate and transform wheat, wheat transformation has been genotype-dependant
meaning that their transformation is limited to few genotypes that primarily regenerate
through immature embryo culture. In this study efforts were made to develop a less
genotype dependent in vitro regeneration system as a pre-step toward genetic
transformation. The system developed here is capable of producing multiple shoot
clumps and whole plants in all four different wheat genotypes tested. Shoot apical
meristems from seven-days-old seedlings produced axillary and adventitious shoots and
somatic embryos on media containing N6-Benzyladenine (BA) and 2,4-
Dichlorophenoxyacetic acid (2,4-D). All four genotypes responded positively to shoot
multiplication depending upon media composition. Scanning electron microscopy of
cultures showed a proliferating budding state that gave rise to adventitious shoots and
somatic embryos on further multiplication. The survival and multiplication of shoot
apical meristems, as explants, was 80-90 %, and the average number of multiple shoot

meristems per shoot meristem clump was 40-50 in all genotypes. Among different

80

concentrations of phytohormones, 2 and 4 mg/l of BA (8.8 and 17 .7 pM) in combination
with 0.5 mg/l 2,4-D (2.26 pM) produced the best results that were signiﬁcantly (P: 0.05)
different from other hormone combinations. Actively multiplying Shoot clumps were
recovered with high frequency among three month-old cultures. These shoot clumps
regenerated normally and produced fertile plants containing Viable seeds. This in vitro
regeneration system was also tested for its usefulness for the production of transgenic
plants using bioslistie bombardment (PDS-lOOO/He) system. Different parameters like
particle size, type of particle, distance of target tissue and pressure of the rupture disc
were studied for transient expression of gus. Although transient expression of gas was
observed using all parameters, 0.6-0.9 pm tungsten particles, 13 cm distance of the target
tissue and point of bombardment and pressure of 1100 and 1550 psi gave maximum
transient expression of gus (i.e. 43.5 to 45%). Gold particles were also used in
comparisons with tungsten particles but did not yield signiﬁcant (P: 0.05) increase in
transient transformation of gus. More research is needed in order to recover stably

transformed wheat after biolistic bombardment of multi-meristems.

81

4.2. INTRODUCTION

Wheat the world’s most important food crop, covers the maximum cultivated land
at the global level, more than that of any other crop (F A0, 2000). Wheat is a member of
the family Poaceae, which includes major cereal crops of the world such as maize, wheat,
and rice. Among the cereal crops, wheat is one of the most abundant sources of energy
and proteins for the world population. Ninety-ﬁve percent of wheat grown today is of the
hexaploid type, used for the preparation of bread and other baked products. Nearly all of
the remaining 5% is Durum (tetraploid) wheat, which is mainly used for making pasta,
macaroni and biscuits. Wheat is characterized by a large genome size (approximately
17,000 Mb, Arumuganathan and Earle, 1991), thus making its genetic transformation

challenging (Lagudah et al. 2001).

Scientiﬁc approaches to crop improvement have their history in the rediscovery of
Mendel’s law at the beginning of the last century. Consistently since then, breeders have
been searching for technologies to improve crop varieties. Wheat breeders have been able
to introduce desirable traits that increased the grain yield and minimized the crop losses.
However, conventional breeding techniques that are based on processes of crossing, back
crossing and selection could hardly keep pace with the rapid co-evolution of pathogenic
micro-organisms and pests. In vitro technologies have the potential to complement the
conventional methods of wheat breeding in generating genetic variabilities that may

create novel cultivars with desirable traits.

The genetic improvement of wheat through breeding has received considerable

attention over the years, especially when breeding was used for the purpose of increasing

82

the grain yield and to minimize crop losses. In the early 60’s, conventional breeding
coupled with improved farm management practices led to a signiﬁcant increase in world
wheat production what we now know as the green revolution. Subsequently, the targets
of genetic improvement shifted to reducing yield caused by various biotic and abiotic
stresses and increasing the input-use efﬁciency (Pingali and Rajaram, 1999). With this
change, biotechnology (mainly genetic engineering) offered a possible solution by

making plants resistant to various abiotic and biotic stresses.

Plant genetic transformation is not only expected to improve qualitative traits (and
quantitative traits, theoretically at least) in wheat but is also a vital technique in the area
of functional genomics (Lagudah et al. 2001). In vitro regeneration and production of
transgenic wheat using microprojectile bombardment and Agrobacterium-mediated
transformation systems has been reported (Kee et al. 2002; Huber et al. 2002; Brinch et
al. 2000; Cheng et al. 1997). However, the work is slow and reports are limited to certain
wheat genotypes only.

Most of the published wheat transformation systems rely on the recovery of
transgenic plants from callus-derived from immature or mature embryos, or from
protoplasts. In the application of these technologies for wheat improvement, however,
major problems exist: availability of limited gerrnplasm amenable to these methods of
transformation, possibility of somaclonal variations and instability of gene expression
(Zhang et al. 1999). These problems are directly or indirectly related to the in vitro
culture processes used in transformation.

In vitro regeneration of wheat has been reported to be irreproducible, infrequent

and inconsistent (Bhojwani and Hayward, 1977; O’Hara, 1978; Ozias-Akins and Vasil,

83

1982). Genetic variations have been observed among different experiments utilizing
different wheat genotypes. There is no satisfactory explanation available so far that can
describe the recalcitrant behavior of wheat in vitro cultures. Wheat shoot meristem was
used as a source of explant because I assumed that this explant has less of the above
problems.

When multiple shoot meristems from maize, barley and oat were used as explants,
high regeneration and transformation efﬁciency was reported in a relatively genotype
independent manner (Zhong et al. 1992; Zhong et al. 1996; Zhang et al. 1999). The in
vitro multiple shoot system has also been used to regenerate plants from non-regenerable
cotton varieties (Kumar at al. 1998). The shoot meristem system offers advantages to all
other published in vitro regeneration procedures because it could be used from
germinated dry seeds. Also, efﬁcient regeneration and multiplication characteristics of
shoot meristematic cultures and high fertility of regenerated plants (Zhang et al. 1999).
Therefore, attempts were made to elucidate the difﬁculties in wheat tissue cultures and to
develop a more predictable genotype-independent shoot/plant regeneration system that
can be used successfully for plant transformation.

In this chapter, a highly efﬁcient in vitro plant regeneration system from shoot
apices of four wheat genotypes is reported. In addition, feasibility of this system for

transformation of wheat is also discussed.

84

4.3. MATERIALS AND METHODS
4.3.1. Explant

Four winter wheat genotypes, Lowell, Harus, AC Ron and Caledonia, were tested
in experiments reported here. Seeds were obtained from Michigan Crop Improvement
Association, Lansing, Michigan. After removing the lemma and paleas, the caryopses
were surface-sterilized in 70 % ethanol for 2 min, washed with sterilized water and then
sterilized with 20 % Clorox bleach and 0.1 % mercury chloride for 10 min. The surface-
sterilized caryopses were washed 5 times with sterilized water and germinated on MS
basal medium (Murashige and Skoog, 1962) solidiﬁed with 0.3 % phytagel (Sigma) in
the dark at 25 °C.

A cylindrical segment of shoot apex containing apical meristems, two to three leaf
primordial (rudimentary leaf), and three to ﬁve mm long leaf bases was excised by two
transverse cuts made through the shoots with a scalpel blade after removing the remnants
of coleoptile. The dissections were made under a dissecting microscope. The isolated
shoot apices were cultured on shoot multiplication (SM) medium [MS basal medium
containing 500 mg/l casein enzymatic hydrolysate (CH) and with various combinations
of 2,4-dichlorophenoxyacetic acid (2,4-D: 0 and 0.5 mg/l) and N6-benzyladenine (BA: 0,
1.0, 2.0 and 4.0 mg/l)]. Five to seven shoot apices were cultured horizontally in each Petri
dish (10 mm x 6 cm). About 100 explants were tested for each experiment with four
replications. Experiments were laid out in a completely randomized design. Data were
analyzed by analysis of variance (PROC ANOVA, SAS Institute 1985) and means were

separated using Tukey’s Studentized range test at the 95 % conﬁdence level.

85

4.3.2. In vitro regeneration

Every week within the ﬁrst month, each of the cultured shoot apices was exposed
by physically removing the leaves, coleoptile and elongating stem from the explant and
maintained separately on SM medium. The multiple shoot clumps (MSC) arising from
shoot apices were divided and subcultured every two weeks for two months. After three
months in culture, the relative frequency of multiple shoot formation was calculated as
the percentage of multiplied shoot apices that produced multiple shoots in total cultured
shoot apices on each medium for different genotypes.

To test the regenerative response, a portion of multiplied shoot apex cultures
initiated from a single shoot meristem was transferred to regeneration medium [MS basal
medium with 3 % sucrose and 0.3 % phytagel with 0.5 mg/l BA and 0.5 mg/l IBA
(Indole-3-butyric acid)]. Regenerated plantlets of 1-2 cm length were transferred to
rooting medium (half strength MS basal medium containing 0.1% sucrose, 0.3 %
phytagel and with no growth hormones). The plantlets at 5-10 cm length were
transferred to soil and grown in greenhouse until maturity.

4.3.3. Electron Microscopy

Samples of in vitro multiple Shoot clumps (MSC) were ﬁxed, dehydrated, and
dried as described by Klomparens et al. (1986). The samples were mounted, sputter-
coated with gold particles and examined with a J EOL J SM 31 (Tokyo, Japan) scanning

electron microscope.

86

4.3.4. Optimization of transformation conditions
4.3.4.1. Plasmid constructs used in transformation studies of wheat

Three plasmids were employed to study the competence of shoot meristem
cultures of wheat for transformation. These include pTW-a, pActl-F and pROBS (Figure
4.1 and 2.3).

The plasmid pTW-a (7.4 kb) contained bar gene from Streptomyces
hygroscopicus (Thompson et al. 1987) and the gene pin2 (Keil et al. 1986) in the pUC 19
vector. The bar coding region was driven by the CaMV 35S promoter and was
terminated with the nos 3’ region (Bevan et al. 1983). The pin 2 coding region was driven
by the wound —inducible pin2 promoter and rice actin 1 (Actl) 5’ intron and terminated
with the pin2 3’ region. The plasmid pActl-F (6.5kb; McElroy et al. 1990) contained the
Escherichia coli uidaA gene (gus) (Jefferson, 1987) driven by a region 1.3 kb upstream of
the rice Actl translation codon and followed by the nos 3’ terminator in the pBluescript
KS vector. The plasmid pROBS has been described in Chapter 2.

4. 3. 4. 2. Microprojectile Bombardment

Plasmid DNA was precipitated onto gold particles (1.0 pm in diameter; Bio-rad)
or tungsten particles (0.6-0.9 and 09-12 pm in diameter; GTE Sylvania, Townada, PA)
following a modiﬁcation of the original protocol described by Bio-Rad. Brieﬂy, 60 mg of
particles were sterilized in 0.5 mL of 100% ethanol in a microcentrifuge with vortexing
for 30 min. The particles were then centrifuges and washed with sterile distilled water
three times. Finally the particles were resuspended in 0.5 mL of sterile distilled water.
Then, 50 pL aliquot of the particles was pipetted into microcentrifuge tube while

vortexing continuously. A total of 6 pL of plasmid DNA (6 pg), 50 pL of 2.5M CaC12

87

pTW-a

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Pin2 5’ A5’ pin2 Pin2 3’ 35 S bar N

Actl-F
A5’ FS’ AF’I gus N

pROBS
35 S hpt N

 

 

 

 

Figure 4.1. Plasmids used for transformation studies of wheat (Triticum aestivum
L.). Pin 2 5’. 5’upstream sequence of potato proteinase inhibitor 11 (pin2) gene; pin2.
coding sequence of pin2gene; AS’I. Rice actin 1 5’ intron; Pin 2 3’. 3’termination
358. Cauliﬂower mosaic virus
Phosphinothricin acetyl transferase gene; N. N opaline synthase terminator; A 5’ FS.
5’upstream sequence of rice actin 1 gene; A5’I. Actin I intron; gus. B-glucoronidase

sequence of pin2 gene;

enzyme gene; hpt. Hygromycin phosphotransferase gene.

88

promoter;

 

 

 

and 20 pL of 0.1M spermidine were successively added and continuously vortexed for 5
min at room temperature. The mixture was then incubated on ice for 10 min. The DNA
coated particles were pelleted by centrifuging at 13,000 rpm for I min. After discarding
the supernatant, the particles were washed with 500 pL of absolute ethanol by vortexing
for 30 s, centrifuging for 1 min, and removing the supernatant and were ﬁnally
resuspended in 60 pL of absolute ethanol. For each bombardment, 10 pL of the particle
suspension was pipetted onto the center of the macrocarriers (a biolistic gun accessory
that carries the mixture of DNA and tungsten or gold particles for bombardment). The
prepared macrocarriers were used for bombardment as soon as the ethanol evaporated.

Prior to bombardment, shoot tips or shoot-tip clumps ﬁom cultures were
physically exposed by removal of coleoptile and leaves, if necessary. The shoot tips
(placed in a circular area of about 1.5 cm diameter) were positioned on an osmoticum
medium (SM 2.5 containing 0.2M mannitol, 2% sorbitol solidiﬁed with 4% Phytagel) in
a Petri dish below the microprojectile stopping screen. The shoot tips were cultured on
osmoticum medium for four-hour prior and 16 hours after bombardment.

Bombardments were carried out using a biolistic particle acceleration device
(PDS 1000/He, Bio-Rad) under a chamber pressure of 28 mm of Hg with two shots/plate.
The number of bombarded shoot mersitem cultures varied from 20-30 and experiments
were replicated three times. Control bombardment experiments were also done without
any DNA and using same conditions for particle preparation and bombarded as described

above.

89

4.3.4.3. Parameters studied for transient expression of Gus
Size of the particles: Two sizes of the tungsten particles were used i.e. 0.9-1.2 um and
0.6-0.9 um.
Type of particles: Two types of particles i.e. Tungsten particles as described above and
Gold particles of 1 um in size were used for transient gus expression studies.
Pressure of helium gas: The multiple shoots were bombarded at 1100 psi and 1550 psi.
Bombardment distance: The bombardment distances used were 6.5 and 13 cm.
Experiments were laid out in a completely randomized design with three
replications. Data were analyzed by analysis of variance (PROC ANOVA, SAS Institute
1985). Means were separated using Tukey’s Studentized range test at the 95 %
conﬁdence level.
4.3.4.4. Gus assay
Expression of gus gene was analyzed as described elsewhere (Jefferson et al.

1987)

90

4.4. RESULTS
4.4.]. In vitro morphogenesis of shoot apical meristems and the effect of different
growth regulators

During the ﬁrst month of culture, shoot apices that were continuing to form leaves
and elongating shoots were cut to the leaf base each week. After that period, the grth
of the primary shoots started to retard and several axillary shoots were induced from each
shoot apex (Figure 4.2a). Shoot clumps were not visible until the leaf sheath of the
explant was removed. The elongation of the axillary shoots took place after cutting to the
leaf base at a two-week interval.

After about ten weeks of in vitro culture, the shoot apices had multiplied and leaf
elongation was retarded. Shoot apical domes were enlarged inside the primary shoots,
and folding was observed from enlarged apical dome. Axillary buds with little elongated
intemodes followed by differentiation of adventitious shoots were developed from shoot
meristems after continuous culturing in the medium (Figure 4.2b). The compact,
organized tissue, called “tissue stratum” (Wemicke and Milkovits, 1986; Zhong et al.
1992, 1998) was formed from each shoot apical dome after further subculturing (Figure
4.2c). Scanning electron micrographs showed crowded shoot clumps and the formation of
trichomes (hair) on the leaves (Figure 4.2d). Direct embryogenesis occurred on the
organized apical domes through folding and budding process with differentiation of leafy
scutella and tubular coleoptiles (Figure 4.26, f). The newly formed embryos or

adventitious shoots varied based on growth regulators included in the study.

91

 

Figure 4.2. Differentiation of multiple shoots from shoot apical meristem and
production of fertile wheat plants from meristematic cultures of wheat (Triticum
aestivum L.). a. Shoots differentiated from a shoot apex after two weeks of culture;
b. A multiple shoot clump regenerated from a shoot apex one month after initiation;
c. Formation of tissue stratum from a shoot apical dome; (1. Scanning electron
micrograph of a multiples shoot clump; e. A scanning electron micrograph showing
the beginning of direct somatic embryogenesis from the tissue stratums (arrows
indicate the budding and folding process); 1'. A scanning electron micrograph
showing the regeneration of leafy scutella and tubular coleoptiles from the tissue
stratum; g. Development of shoots from MSC; h. Regenerated shoots in Magenta
box for root development; i. Fertile regenerated wheat plants in greenhouse. CL,
coleoptile; H, leaf hairs; L, leaf; LP, Leaf primordium; SC, scutellum; ST, shoot tip;
TS, tissue stratum.

92

Seven different combinations of shoot multiplication medium were used for the
production of multiple shoot clumps in four wheat genotypes. The relative frequency of
shoot multiplication and average number of shoot meristems per multiplied shoot in
wheat genotypes using different media is given in Table 4.1 & 4.2. Shoot apices on the
medium without 2,4-D and BA did not show any multiplication. The results showed that
BA alone in various concentrations was able to multiply the shoots in all genotypes.
However, the number of multiplied Shoot meristems increased in the combination of BA
with 0.5 mg/l 2,4-D. The increase in the concentrations of BA beyond 2 mg/l did not
result in signiﬁcant (P= 0.05) increase of shoot multiplication or number of multiplied
shoots (Table 4.1 & 4.2). The combination of the two phytoharmones that was best able
to generate the highest multiplication of shoot apices and maximum number of shoot
meristems appeared to be SM 2.5 medium (Table 4.1 & 4.2).

The multiplication of the shoot meristems in all wheat genotypes was slow in the
beginning but increased gradually and reached at its peak after 3 months of culture on
medium SM 2.5 and SM 4.5. Subculturing on a biweekly basis was critical for efﬁcient
multiplication of shoot meristems. Delay in subculturing resulted in the release of
phenolic compounds observed as dark rusty color of media around the explants. The
cultures on SM medium were kept under continuous light, which showed better

multiplication of shoot meristems compared to those kept in the dark. Some of the

93

Table 4.1 - The effect of two phytohormones (BA and 2,4-D) on the relative

frequency of shoot multiplication in four different genotypes of wheat.

 

 

 

Medium BA mg/l 2,4-D % Relative frequency of differentiation of
mg/l multiple shoots*

Lowell Harus Caledonia AC Ron
SM 0.0 0 0 0 0 0 0
SM 1.0 1.0 0 70 a 80 a 75 a 75 3
SM 2.0 2.0 0 75 a 85 a 80 ab 85 b
SM 4.0 4.0 0 80 a 75 a 80 ab 80 ab
SM 1.5 1.0 0.5 85 b 80 a 85 b 85 b
SM 2.5 2.0 0.5 90 b 95 b 85 b 90 b
SM 4.5 4.0 0.5 85 b 90 b 80 ab 90 b

 

 

 

 

 

 

 

 

 

* The data was collected three months after the initiation of shoot apices and is the average of four

replicates.
Values followed by different letters show signiﬁcant differences between means as determined by Tukey’s

Studentized Range test, P= 0.05.

Table 4.2 - The effect of two phytohormones (BA and 2,4-D) on relative efﬁciency of

shoot multiplication in four different genotypes of wheat.

 

 

 

Medium BA mg/l 2,4-D Average no. of shoot mersitems/multiplied
mg/l shoot*
Lowell Harus Caledonia AC Ron

SM 0.0 0 0 0 0 0 0

SM 1.0 1.0 0 20+ a 25+ a 20+ a 18+ a
SM 2.0 2.0 0 35+ b 30+ b 30+ b 30+ b
SM 4.0 4.0 0 40+ c 40+ c 35+ b 30+ b
SM 1.5 1.0 0.5 50+ (1 50+ (1 40+ c 40+ c
SM 2.5 2.0 0.5 50+ (1 50+ (1 45+ (1 45+ d
SM 4.5 4.0 0.5 50+ (1 50+ d 40+ d 45+ (1

 

 

 

 

 

 

 

 

 

* The data was collected three months after the initiation of shoot apices and is the average of four

replicates.
Values followed by different letters show signiﬁcant differences between means as determined by Tukey’s

Studentized Range test, P: 0.05.

94

cultures had been kept for more than four months and still showed continuous
multiplication as has been reported previously for maize and sorghum (Zhong et al. 1992,
1998).

All four genotypes tested for shoot meristem multiplication responded positively on
different combinations of SM medium (Table 4.1). Although Harus and Lowell produced
more shoot meristems than Caledonia and AC Ron genotypes, however, the number was
not signiﬁcantly (P= 0.05) different. Caledonia showed the lowest percentage of relative
frequency of shoot multiplication i.e. 85 % on SM 2.5 (Table 4.1).

These experiments were repeated with different time intervals, and each time,
adequate and reproducible results were observed that showed the consistency in the
developed system.

4.4.3. Plant regeneration from multiplied shoot clumps

Vigorous regeneration of plants was obtained when the multiplied shoot clumps
from all four genotypes were transferred to MS basal medium with or without 0.5 mg/l
BA and 0.5 mg/l IBA (Figure 4.2g). About 10-20 plantlets regenerated from a multiplied
shoot clump (5 mm in size). The plantlets were rooted in Magenta boxes containing MS
medium (Figure 4.2h). The rooted plantlets were transferred to soil in the greenhouse.
These in vitro regenerated plants grew normally as the seed-derived control plants. These
plants ﬂowered normally and produced Viable seeds (Figure 4.2i).
4.4.4. Optimization of transformation conditions for gas expression

The data for transient expression of gus (Figure 4.3) is presented in Table 4.3.
Several factors like particle type, particle size, pressure of rupture disc and distance of the

target tissue from rupture disc were studied. A considerable variation was observed in

95

obtaining gus expression. However particle size of 0.6-0.9 pm gave signiﬁcant (P= 0.05)
increase in gus expression at a distance of 13 cm and at a pressure of 1100 and 1550 psi
compared to most other parameters. Gold particles did not give any signiﬁcant (P= 0.05)
difference in producing gus positive shoot multiple clumps.

Several hundred shoot multiple meristems were bombarded with both hph and
gus, and bar and gus to get stable transformants. However, no transgenic plant with hph,
bar or gas was recovered. Although the kill curve (Figure 4.4) for the shoot meristem
was found to be 30 mg L'1 in case of hygromycin and 5 mg L"1 in case of glufosinate
ammonium, concentration of both of the chemicals less than the kill curve were also
tried. However, these conditions gave non-transgenic escapes as determined by gas assay
and survival of control shoot multiple meristems on same low hygromycin (20 mg/L) or
glufosinate ammonium (3 mg/L) concentrations. The use of glufosinate ammonium as

selectable agent was found to be ineffective in some of the cultures even at 5 mg L".

96

Bombardcd r

 

Figure 4.3. Transient expression of GUS in wheat (Triticum aativum L.) shoot
meristem cultures.

97

Table 4.3 - Percent transient expression of gus gene in shoot meristematic cultures
48 hours after bombardment.

 

 

 

 

 

 

 

 

 

Particle and size Distance Genotypes Pressure of rupture disc
IIOsti 1550 psi
Tungsten 6.5 cm Harus 38b 38b
0.6-0.9 pm Caledonia 27ab 26ab
AC Ron 38b 27ab
13 cm Harus 45b 44b
Caledonia 41b 40b
AC Ron 43b 39b
Tungsten 6.5 cm Harus 27ab 27ab
09-12 pm Caledonia 24a 228
AC Ron 28ab 26ab
13 cm Harus 27ab 18a
Caledonia 33ab 25a
AC Ron 22a 25a
Gold 6.5 cm Harus 27ab 22a
1 pm Caledonia 22a 30ab
AC Ron 24a 23a
13 cm Harus 32ab 34b
Caledonia 36b 34b
AC Ron 36b 34b

 

 

 

 

 

Values followed by different letters show signiﬁcant differences between means as determined by Tukey’s
Studentized Range test, P= 0.05.

98

 

 

Kill Curve for Hygromycin
120

100‘ >
80~
60—
40~
20+
0 r r r r

o 10 20 30 4o 50
a HygronvcinlnulL)

 

 

 

% of SMC bleached

 

 

 

 

 

Kill Curve for Glufosinate Ammonium

120
100+ i
80 -
60 ~
40+
20 — .

0 r r r

 

% of SMC bleached

 

 

 

 

 

0 5 10 15
b GlufosInate Armronium (mg/L)

 

Figure 4.4: Kill curve for shoot meristem cultures of wheat. a) Hygromycin b)
Glufosinate ammonium

99

4.5. DISCUSSION

Shoot apical meristem is a very important tissue in the developmental biology of
plants due to its totipotency, and because it has a very high regeneration potential
(Potrykus, 1990). Meristem is a very tiny structure containing the leaf primordia and the
young leaves. As a tissue, it may consist of a complicated pattern of cells each of which
may differ in physiology due to their unique position and role (Medford, 1992).

Here I report, a reproducible regeneration system via multiple shoot
differentiation from vegetative shoot apical meristem of wheat. Overall, plant
regeneration through somatic embryogenesis has previously been achieved in different
wheat genotypes (Ozgen et al. 1996; Afshar-Sterle et al. 1996; Viertal et al. 1996). The
present approach reveals that shoot apical meristem can be induced to form clumps of
multiple shoots in vitro, originating through somatic embryogenesis and organogenesis,
by manipulating the concentrations of BA and 2,4-D. Previously, it was shown that
maize (Zhong, 1992), oat (Zhang et al. 1996b), sorghum (Zhong et al. 1998) and millet
(Devi et al. 2000) could be led to multiple shoot formation by manipulating the
concentrations of BA and 2,4-D in cultures. Results indicate that the same grth
regulators (phytohormones) but at different concentrations are required for the
development of multiple shoots in wheat. The similarities in requirement of these
phytohormones for wheat morphogenesis responses may be due to the close phylogenetic
relationship of the cereals. The phytohormones, BA and 2,4-D, have also been
implicated for tobacco (Stolarz et al. 1991) and ryegrass (Dale 1980) shoot tip cultures. It
appears that these phytohormones may have an important role in the development of

shoot apex multiplication. The results presented here indicated that the high concentration

100

of BA (2—4 mg/l) is capable of stimulating the differentiation of adventitious buds from
shoot apices. It has previously been reported that the presence of 2,4-D in culture medium
triggers the proliferation of tissues in a suppressed primordial states like microtillering.
Furthermore, 2,4-D alone is reported to inhibit normal cell differentiation and
morphogenesis from shoot meristems (Wemicke and Milkovits, 1986). The addition of
high concentration of 2,4-D (2 mg/l) in culture medium slowed down the division of
meristematic cells and enhanced the expansion of sub-apical parenchyma cells in an
unorganized fashion (Wemicke and Milkovits, 1986). The 2,4-D also caused the
production of root type tissues from proliferating cells depending on the genotype or
delay in subculture (Wemicke and Milkovits, 1984). Data showed that the addition of a
low level of 2,4-D (0.5 mg/l) with combination of BA in the culture medium triggered the
high frequency of adventitious shoot formation (Table 4.1). These results are consistent
with previous observations (Zhong et al. 1992, 1998).

Wheat shoot meristem multiplication system that was established here is
relatively genotype independent as were reported earlier for millet (Devi et al. 2000), oat
(Zhang et al. 1996b), sorghum (Zhong et a1. 1998) and maize (Zhong et al. 1992). It is
therefore, concluded that shoot apical meristem grow normally and gives rise to whole
plants when excised and multiplied in vitro.

The meristem has been frequently used for production of disease-free plants, and
also for asexual propagation purposes (Smith and Drew, 1990). Therefore shoot
multiplication system described here can be utilized for producing disease free plants and
may be more valuable due to its vigorous nature. This system may also prove useful for

the study of physiology and development of wheat.

101

Several parameters (see Materials and Methods and Table 4.3) that are considered
important in plant transformation using the biolistic gun (Christou et al 1990) were
studied in this research. Intense blue staining of the tissues was observed 48 hours after
bombardment indicative of GUS expression. Data shown in Table-4.3 reveal that all
bombardment conditions produced GUS expression, however certain conditions were
more effective. Bombardment distance and particle size appeared to play a critical role in
percentage of GUS expression (Christou et al. 1990). As evident from the Table-4.3,
tungsten particles (0.6-0.9 um) were effective in producing maximum GUS expression at
a distance of 13 cm. The level of gene expression appeared to be more when 1100 psi
was used as compared to the use of 1550 psi. Humara et al. (1999) has also reported that
low velocity (pressure) produced the best results for GUS expression. Gold particles,
which are generally considered superior to tungsten (Hunold et al. 1994), did not perform
better than tungsten in this work. This observation is in agreement with Zhong et al.
(1996) who observed similar results using corn meristems as target tissues. Osmoticum
treatment (presence of high amount of sugars in the bombardment medium, see Material
and Methods) is considered important for high efﬁciency of transformation (Vain et al.
1993), therefore it was included for all conditions studied for transient expression of gus
gene.

Stable transgenic plants have been produced in maize (Zhong et al. 1996), oat and
barley (Zhang et al. 1999) using this system. Despite several attempts, obtaining stable
transgenic wheat plants was not successful. This may be in part due to the high genome
size of wheat, which makes it challenging to manipulate genetically. It has been

suggested that large genomes or species with high ploidy level are more difﬁcult to

102

transform than related diploid species with smaller genomes (Elomma et al. 1993;
Robinson and Firoozabady 1993). Probable reasons for poor genetic transformation
response of such species might be presence of functionally inactive sites in the genome
leading to gene silencing of the transgene. Other reasons for not getting stable transgenic
plants may include are the competence of layers of meristems for genetic transformation.
It has been proposed that cells in the L2 layer of meristem in wheat are valid targets for
transformation (Simmonds 1997). Therefore it is important to place target gene in L2
layer of meristem. However to optimize this more time is needed. In summary this
system of shoot meristem multiplication may prove useful if future studies to address the

issues discussed above.

103

CHAPTER V: SUMMARY AND FUTURE WORK

In this dissertation, attempts were made to improve and develop procedures for
genetic transformation of rice and wheat with an emphasis on those varieties that are
recalcitrant to genetic manipulation. A plant expression vector was constructed with an
insect resistance gene, cry2A from Bacillus thuringiensis. Insect resistance was
incorporated in rice lines using crylAb and crylAc genes from Bt (Ahmad et al. 2002b).
The resistance of transgenic rice lines was conﬁrmed at DNA, RNA and protein levels, as
well as against a lepidopteron insect, O. nubilalis. A method employing Real Time PCR
was also optimized to determine transgene copy number.

Basmati rice, an important cash crop of south Asia, has been shown to be
recalcitrant to in vitro culture (Mohantay et al. 1999). A key question in this dissertation
research was that Basmati variety 370, the most exported rice variety of Pakistan, could
be transformed using Agrobacterium tumefaciens. A couple of reports on the use of A.
tumefaciens on transfer of marker genes have been described on Basmati rice, however
the reproducibility of transformation system has been the key question (Rashid et al.
1996, Mohanty et al. 1999). Experiments reported in this dissertation conﬁrm the
reproducibility of the system and extends beyond marker gene by incorporating crylAb
and crylAc genes from Bt in Basmati rice. Although transformation efﬁciency of rice in
this dissertation is not comparable to transformation of most dicotyledonous plants, it has
been high enough to recover transgenic plants routinely (up to 4 transgenic calli/4.2g,
each callus produced several plantlets). Addition of aeetosyringone, a phenolic compound
found useful in dicotyledonous plants, and sugars in the media used for infection of rice

calli with A. tumefaciens proved to be critical parameters for increasing the

104

transformation efﬁciency in rice.

In this work, the integration and expression of Bt genes in rice genome was
conﬁrmed using Southern, northern and western blot analyses. The transgenic lines
generated using optimized conditions were ultimately tested at the laboratory and
greenhouse levels for bioassays of O. nubilalis, that is not a rice pest, however was used
to conﬁrm the Bt protein functionality of transgenic lines. One hundred percent mortality
of neonate larvae of O. nubilalis on transgenic lines further conﬁrmed that the
heterologous Bt was indeed functional in transgenic rice plants.

Although O. nubilalis is not a major pest of rice, in this research, it was found that
it could survive on non-transgenic rice at the laboratory level up to 25 days. Therefore
should this polyphagous insect not ﬁnd any com plant on which to feed, it may feed on
rice should rice be planted in the vicinity (personal communication with Dr. Mike Cohen
of IRRI). This could become an issue in rice growing countries (example; Thailand,
Philippines, etc.) that grow sweet corn as well.

In another set of studies, wheat was chosen for in vitro shoot apical meristem
morphogenesis (Ahmad 2002a), and this system was used for transformation of this plant.
The hypothesis tested was that shoot multiple meristems of wheat will be a suitable
system for the morphogenesis and transformation in wheat. Shoot meristem
multiplication system developed showed that different wheat genotypes could be rapidly
regenerated into whole plants. A key factor for successful morphogenesis and
regeneration was a balance between auxin and cytokinin concentrations (BA 2 mg/l and
2, 4-D 0.5 mg/L), which produced maximum number of multiplied shoots per apical

meristem, and their further multiplication. Transformation of multimersitems has shown

105

to be genotype independent in maize (Zhong et al 1996). Therefore, another hypothesis
that was tested here was that shoot meristem is a good candidate for genetic
transformation of wheat. In this experiment, transient expression of gus gene was studied
under different parameters that are considered important for the particle bombardment
(Christou et al. 1990). Using different parameters, it was concluded that transient
expression (i.e. 43.5% to 45% shoot clumps bombarded) of gus could be achieved using
0.6-0.9 pm tungsten particles, 13 cm distance between the target tissue and point of
bombardment, and pressure of 1100 and 1550 psi. Several experiments were conducted
using the herbicide resistance gene, bar, and the hygromycin resistance gene, hpt, in
combination with gus to produce stable transgenic wheat plants. However, no stable
transgenic plant has been recovered in this work.

There could be a follow-up of this dissertation research by others. There has been
a concern about the silencing of transgenes. Generally it has been assumed that
Agrobacterium system is less prone to gene silencing as compared to particle delivery
system due to the low copy number of transgenes transferred via the Agrobacterium
(Kumpatla and Hall, 1998). This issue could be investigated using the transgenic lines
produced in this study to ﬁnd out whether any of transgenes were silenced.

Insect bioassays of transgenic rice lines produced in this study against 0.
nubilalis show that cry/Ab and crylAc protein is functional. However, rice insects
(Yellow stem borer, the striped stem borer, two leaffolder species C. medinalis and
Marasmia patnalis) should be tested to see how well transgenic lines in this study protect
against the insect damage. Another important study could be to conduct a ﬁeld evaluation

of rice lines and assess how these lines perform for insect resistance as compared with

l 06

non-transgenic lines in the ﬁeld. A key study in the ﬁeld might also be how long it will
take for the rice insects to develop resistance against the Bt gene products. It will be
interesting to ﬁnd any difference between two Bt proteins used (crylAb and crylAc), as
well as, different transgenic events for development of insect resistance. Since the two
Bts used here have different modes of actions (i.e. recognizing different receptors in
insect gut), transgenic lines expressing crylAb and cryIAc could be combined in a single
line by cross breeding, or these two lines with other Bt transgenic lines for extending the
development of insect resistance.

Future studies are also necessary to develop transgenic wheat plants using
transient expression parameters optimized in this work. Another important area to follow
up on the work presented here would be to study the competence of different layers of
wheat meristems for genetic transformation. It has been proposed that cells in the L2
layer of meristem in wheat are valid targets for transformation (Simmonds 1997).
Therefore it is important to choose parameters to speciﬁcally place target genes in L2
layer of meristem. Shoot meristem system developed for wheat here has been used for
maize (Zhong et al. 1992), oat (Zhang et al. 1996b), sorghum (Zhong et al. 1998) and
millet (Devi et al. 2000). Therefore, the multiple shoot transformation system may have
broader applications for genotype non-speciﬁcity among plant genera, which are
considered recalcitrant to in vitro manipulation and transformation.

In summary, Basmati rice 370 was stably transformed with cryIAb and crylAc
genes, and all transgenic plants were resistant to O. nubilalis. Furthermore, wheat shoot
apical meristem morphogenesis was developed, and this system was optimized for

transient expression of gus Via the particle bombardment. However more investigations

107

are needed to develop stable transgenic wheat as indicated above.

108

REFERENCES

Abe, T. and Futsuhara, Y. 1985. Efﬁcient plant regeneration by somatic embryogenesis
from root callus tissues of rice (Oryza sativa L.) Plant Physiol. 121:111-118.

Abe, T. and Futsuhara, Y. 1986a. Genotypic variability for callus formation and plant
regeneration in rice. Theor. Appl. Genet. 72: 5-10.

Abe, T. and Futsuhara, Y. 1986b. Plant regeneration from suspension cultures of rice
(Oryza sativa L.). Jpn. J. Breed. 36: 1-6.

Abe, T. and Futsuhara, Y. 1984. Varietal difference of plant regeneration from root callus
tissue in rice. Jpn. J. Breed. 34: 147-155.

Abe, T. and Sasahara, T. 1982.Variation in callus formation from seed in japonca, indica,
and large grain varieties in rice. Jpn. J. Breed. 32: 53-60.

Adang, M. J. 1991. Bacillus thuringiensis insecticidal crystal proteins: gene structure,
action, and utilization. In: Biotechnology for biological control of pests and
vectors (Edited by K. Maramorosch). CRC Press, London. pp: 3-23.

Afshar-Sterle, S., Peng, E. C. K., Brown, J. S. and Kolhnorgen, J. F. 1996. Embryogenic
callus induction and plant regeneration in T riticum tauschii, the diploid D-genome
donor for bread wheat. Aust. J. Bot. 44: 489-497.

Ahmad, A., Maqbool, S. B. and Sticklen, M. B. 2002a. Expression of synthetic cryIAb
and crylAc genes in Basmati rice (Oryza sativa L.) via Agrobacterium-mediated
transformation for the control of European corn borer (Ostrinia nubilalis). In
Vitro Cell and Develop. Biol.-Plant 38: 213-220.

Ahmad, A., Zhong, H., Wang, W. and Sticklen, M. B. 2002b. Shoot apical meristem: In
vitro regeneration and morphogenesis in wheat (T riticum aestivum L.). In vitro
Cell. and Develop. Biol.-Plant. 38: 163-167.

Ahmed, K. Z. and Sagi, F. 1993. Culture of and fertile plant regeneration from
regenerable embryogenic suspension cell-derived protoplasts of wheat (T riticum
aestivum L.). Plant Cell Rep. 12: 175-179.

Aldemita, R. R. and Hodges, T. K. 1996. Agrobacterium tumefaciens-mediated
transformation of japonica and indica rice varieties. Planta 199: 612-617.

Altpeter, F., Vasil, V., Srivastava, V., Stdger, E. and Vasil, I. K. 1996. Accelerated

production of transgenic wheat (T riticum aestivum L.) plants. Plant Cell Rep. 16:
12-17.

109

Amoah, B. K., Wu, H., Sparks, C. and Jones, H. D. 2001. Factors inﬂuencing
Agrobacterium-mediated transient expression of uidA in wheat inﬂorescence
tissue. J. Exp. Bot. 52: 1135-1142.

Aronson, A. I., Beckman, W. and Dunn, P. 1986. Bacillus thuringiensis and related
insect pathogens. Microbiol. Rev. 50: 1-24.

Arumuganathan, K. and Earle, D. 1991. Nuclear DNA content of some important plant
species. Plant Mol. Biol. Rep. 9: 208—218.

Ayers, N. M., and Park, W. D. 1994. Genetic transformation of rice. Crit. Rev. Plant Sci.
13: 219-239.

Bajaj, S. and Rajam, M. V. 1995. Efﬁcient plant regeneration from long term callus
culture of rice by spermidine. Plant Cell Rep. 14: 717-720.

Batty, N. P. and Evans, J. M. 1992. Biological ballistics- no longer a shot in the dark.
Transgen. Res. 1: 107-111.

Bauer, L. S. and Malvar, T. 1995. Regulation of insecticidal crystal protein production in
Bacillus thuringiensis. Molecular Biol. 18: 1-12.

Bennett, M. D. and Leitch, I. J. 1995. Nuclear DNA amounts in angiosperrns. Ann. Bot.
76: 113-176.

Bevan, M., Barnes, W. M. and Chilton, M. 1983. Structure and transcription of the
nopaline synthase region of T-DNA. Nucleic Acids Res. 11: 369-385.

Bhojwani, S. S. and Hayward, C. 1977. Some observations and comments on tissue
culture of wheat. Z. Pﬂanzenphysiol. 85: 341-346.

Bilang, R., Lida, S., Peterhans, A., Potrykus, I. and Paszkowski, J. 1991. The 3'-terminal
region of the hygromycin-B resistance gene is important for its activity in
Escherichia coli and Nicotiana tabaccum. Gene 100: 247-250.

Bobak, M., Blehova, A., Kristin, J., Ovecka, M. and Samay, J. 1995. Direct plant
regeneration from leaf explants of Drosera rotundifolia cultured in vitro. Plant
Cell Tiss. and Organ Cult. 43: 43-49.

Breitler, J. C., Labeyrie, A., Meynard, D., Legavre, T. and Guiderdoni, E. 2002. Efﬁcient
microprojectile bombardment-mediated transformation of rice using gene
cassettes. Theo. Appl. Genet. 104: 709-719.

Brinch-Pedersen, H., Olesen, A., Rasmussen, S. K. and Holm, P. B. 2000. Generation of

transgenic wheat (T riticum aestivum L.) for constitutive accumulation of an
Aspergillus phytase. Mol. Breed. 6: 195-206.

110

Brousseau, R., Mason, L. and Hegedus, D. 1999. Insecticidal transgenic plants: are they
irresistible? AgBiotechNet 1: 1-10.

Bulla, L. A., Davidson, L. I., Kramer, K. J. and Jones, B. L. 1980. Puriﬁcation of the
insecticidal toxin from the parasporal crystal of Bacillus thuringiensis subsp.
Kurstaki. Biochem. Biophysic. Res. Comm. 91: 1 123-1 130.

Bytebier, B., Deboeck, F., DeGreve, H., Van Montagu, M. and Hemalsteen, J. O. 1987.
T-DNA organization in tumor cultures and transgenic plants of the
monocotyledons Asparagus ofﬁcinalis. Proc. Natl. Acad. Sci. USA 84: 5345-
5349.

Cannon, R. J. C. Bacillus thuringiensis use in agriculture. 1996. A molecular perspective.
Biol. Rev. 71: 561-636.

Cao, J ., Duan, X., McElroy, D. and Wu, R. 1992. Regeneration of herbicide resistant
transgenic rice plants following microprojectile-mediated transformation of
suspension culture cells. Plant Cell Rep. 11: 586-591.

Caraman, J. G., Jefferson, N. E. and Carnbell, W. F. 1987. Induction of embryogenenic
T riticum aestivum calli. I. Quantiﬁcation of genotype and culture medium effects.
Plant Cell Tiss. Organ Cult. 10: 101-116.

Chan, M. T., Chang, H. H., Ho, S. L., Tong, W. F. and Yu, S. M. 1993. Agrobacterium-
mediated production of transgenic rice plants expressing a chimeric alpha-
amylase promoter/Beta—glucuronidase gene. Plant Mol. Biol. 22: 491-506.

Chang, H. H. and Chan, M. T. 1991. Agrobacterium tumefciens-mediated transformation
of soybean (Glycine max L. Merr.) is promoted by the inclusion of potato
suspension culture. Bot. Bull. Acad. Sin. 32: 171-178.

Chen, L., Zhang, S., Beachy, R. N. and Fauquet, C. M. 1998. A protocol for consistent,
large-scale production of fertile transgenic rice plants. Plant Cell Rep. 18: 25-31.

Chen, T. H., Lam, L. and Chen, S. C. 1985. Somatic embryogenesis and plant
regeneration from cultured young inﬂorescence of Oryza sativa. Plant Cell Tiss.
& Org. Cult. 4: 51-54.

Cheng, M., Fry, J. E., Pang, S. 2., Zhou, H. P., Hironaka, C. M., Duncan, D. R., Comer,
T. W., Wan, Y. C., Cheng, M., Pang, S. Z., Zhou, H. P. and Wan, Y. C. 1997.

Genetic transformation of wheat mediated by Agrobacterium tumefaciens. Plant
Physiol. 115: 971-980.

Cheng, X. Y., Sardana, R., Kaplan, H. and Altosaar, l. 1998. Agrobacterium-transfonned

rice plants expressing synthetic crylAb and crylAc genes are highly toxic to
striped stem borer and yellow stem borer. Proc. Natl. Acad. Sci. 95: 2767-2772.

111

Chibbar , R. N., Kartha, K. K., Leung, N., Qureshi, J. and Caswell, K. 1991. Transient
expression of marker genes in immature zygotic embryos of spring wheat
(T riticum aestivum). Genome. 34: 453-460.

Christou, P. 1992. Genetic transformation of crop plants using microprojectile
bombardment. Plant J. 2: 275-281.

Christou, P. 1996. Transformation technology. Trends Plant Sci. 1: 423-431.

Christou, R, Ford, T. L. and Kofron, M. 1991. Production of transgenic rice (Oryza
sativa L.) plants from agronomically important Indica and J aponica varieties via

electric discharge particle acceleration of exogenous DNA into immature zygotic
embryos. Bio/Techno]. 9: 957-962.

Christou, P., McCabe, D. E., Martinell, B. J. and Swain, W. F. 1990. Soybean genetic
engineering commercial production of transgenic plants. Trends In Biotech. 8:
145-151.

Christou, P., McCabe, D. E. and Swain, W. F. 1988. Stable transformation of soybean
callus by DNA-coated gold particles. Plant Physiol. 87: 671-674.

Conway, G. R. The 1998. Doubly Green Revolution: Food for All in the let Century.
Ithaca, N.Y.: Cornell University Press.

Cure, W. W. and Mott, R. L. 1978. A comparative anatomical study of organogenesis in
cultured tissues of maize, wheat and oats. Physiol. Plant. 42: 91-94.

Dale, P. J. 1980. Embryoids from cultured immature embryos of Lolium multifoliium. Z.
Pﬂanzenphysiol. 100: 73-77.

Datta, K. A., Vasquez, J., Tonizo, L., Alam, M. F., Oliva, N., Abrigo, E., Khush, G. S.
and Datta, S. K. 1998. Constitutive and tissue speciﬁc expression of crylAb gene
in transgenic rice plants conferring resistance to rice insect pest. Theor. Appl.
Genet. 97: 20-30.

Datta, K., Oliva N., Torrizo, L., Abrigo, E., Khush, G. S. and Datta, S. K. 1996. Genetic
transformation of indica and japonica rice by Agrobacterium tumefaciens. Rice
Genetic News Letter 13: 236-139.

Datta, S. K., Datta, K. and Potrykus, I. 1990. Embryogenesis and plant regeneration from
microspores of both indica and japonica rice. Plant Cell Rep. 9: 253-256.

David, CC. 1991. The world rice economy: challenges ahead in rice biotechnology.

Biotechnology in Agriculture No. 6, Khush G. S. and Toenniessen G. H., Eds,
CAB International, Wallingford, UK.

112

de Maagd, R. A., Bravo, A. and Crickmore, N. 2001. How Bacillus thuringiensis has
evolved speciﬁc toxins to colonize the insect world. Trends Genet. 17: 193-99.

Dent, DR. 1993. The use of Bacillus thuringiensis as an insecticide. In exploitation of
microorganisms (ed. D. Gareth Jones), pp. 19-44. Champan and Hall, London.

Devi, P., Zhong, H. and Sticklen, M. B. 2000. In vitro morphogenesis of pear millet
(Pennisetum glaucum (L.) R.Br.): Efﬁcient production of multiple shoots and
inﬂorescences from shoot apices. Plant Cell Rep. 19: 546-550.

Dong, J., Tng, W., Buchhloz, W. G. and Hall, TC. 1996. Agrobacterium-mediated
transformation of javanica rice. Mol. Breed. 2: 267-276.

Drummond, J., Miller, D. K. and Pinnock, D. E. 1991. Control of Damalinia ovis
(Phthiraptera: Mallophaga) by Bacillus thuringiensis var. Kurstaki. In
proceedings and abstracts, 24th Annual Meeting, Society of Invertebrate
Pathology, Flagstaff, Arizona, USA, 4-9 August, pp. 90.

Duan, X., Li, X., Xue, Q., Abo, E. 1., Sad, M., Xu, D. and Wu, R. 1996. Transgenic rice
plants harboring an introduced potato proteinase inhibitor H gene are insect
resistant. Nature Biotechnol. 14: 494-498.

Eapen, S. and Rao, P. S. 1985. Factors controlling callus initiation, grth and plant
regeneration in bread wheat (T riticum aestivum L.), Proc. Ind. Acad. Sci. 94: 33-
35.

Elomma, P., Honkanen, J ., Puska, R., Seppanen, P., Helaruita, Y., Mehto, M., Kotilainin,
M., Nevalainin, L. and Teeri, T. H. 1993. Agrobacterium-mediated transformation
of antisense chalcone synthase cDNA to Gerbera hybrida inhibits ﬂower
pigmentation. Bio/Technol. 11: 598-511.

Ely, S. 1993. The engineering of plants to express Bacillus thuringiensis 8-endotoxins,
pp. 105-124 P.F. Entwistle, J.S. Cory, M. J. Bailey and S. Higgs [eds] Bacillus
thuringiensis, an environmental biopesticide: theory and practice. New York
Wiley, pp. 311.

FAQ 2000. http://apps.fao.org/page/collections?subset=agriculture

Feitelson, J. S., Payne, J., Kim, L. 1992. Bacillus thuringiensis: insects and beyond.
Bio/techno]. 10: 271 - 275.

Feitelson, J. S., Payne, J. and Kim, L. 1992. Bacillus thuringiensis: Insects and beyond,
Bio/Techno]. 10: 271-275.

113

Finnegan, J. and McElroy, D. 1994. Transgene inactivation: Plants ﬁght back!
Biotechnol. 12: 883-888.

Firoozabody, E., Moy, Y., Tucker, W. and Robinson, K. 1995. Gutterson, N. Efﬁcient
transformation and regeneration of comation cultivars using Agrobacterium.
Mol. Breed. 1: 283-293.

Flavell, R. B. 1994. Inactivation of gene expression in plants as a consequence of speciﬁc
sequence duplication. Proc. Natl. Acad. Sci. USA. 91: 3490-3496.

Folling, L and Olesen, A. 2001. Transfermation of wheat (Triticum aestivum L.)
microspore—derived callus and microspores by particle bombardment. Plant Cell
Rep. 20: 629-636.

Food and Agriculture Organization of the United Nations. 1995. F AO quarterly bulletin
of statistics 8: (1/2).

Fu, X., Fu, X., Due, L. T., Fontana, S., Bong, B. B., Tinjuangjun, P., Sudhakar, D.,
Twyman, R. M., Christou, P. and Kohli, A. 2000. Linear transgene constructs
lacking vector backbone sequences generate low-copy-number transgenic plants
with simple integration patterns. Transgen. Res. 9: 1 1-19.

Fujimoto, H., Itoh, K., Yarnamoto, M., Kyozuka, J. and Shimamoto, K. 1993. Insect
resistant rice generated by introduction of a modiﬁed endotoxin gene Bacillus
thuringiensis. Bio/Technol. 11: 1151-1155.

Gamborg, O. L. and Eveleigh, D. E. 1968. Culture methods and detection of glucanases
in suspension cultures of wheat and barley, Can. J. Biochem. 416: 417-421.

Gelemter, W. and Schwab, G. E. 1993. Transgenic bacteria viruses, algae and other
microorganisms as Bacillus thuringiensis toxin delivery systems. In Bacillus
thuringiensis an environmental biopesticide: theory and practice (ed. Entwistle, P.
F., Cory, J. S., Bailey M. J. and Higgs, 8.), pp 89-104. John Wiley and Sons, P.F.
Chichester, UK.

Ghareyazie, B., Alinia, F., Menguito, C. A., Rubia, L. G., De Palma, J. M., Liwanag, E.
A., Cohen, M. B., Khush, G. S. and Bennett, J. 1997. Enhanced resistance to two
stem borers in an aromatic rice containing a synthetic crylAb gene. Mol. Breed 3:
401-414.

Ghosh Biswas, G. C., Burkhardt. P. K., Wunn, J., Klotti, A. and Potrykus, I. 1994.

Fertile indica rice plants regenerated from scutellar tissue of immature embryos.
Plant Cell Rep. 13: 528-532.

114

Gould, J., Devey, M., Hasegawa, O., Ulian, C. E., Peterson, G. and Smith, H. R. 1991.
Transformation of Zea mays L. using Agrobacterium tumefaciens and the shoot
apex. Plant Physiol. 95: 426-434.

Harris, R., Wright, M., Byme, M., Vamum, J., Brightwell, B. and Schubert, K. 1988.
Callus formation and plantlet regeneration from protoplast derived suspension
cultures of wheat (T riticum aestivum L.). Plant Cell Rep. 7: 737-739.

Hautpmann, R. M., Ozais-Akins, P., Vasil, V., Tabaeizadeh, Z., Rogers, S. G., Horsch, R.
B., Vasil, I. K. and Fraley, R. T. 1987. Transient expression of electroporated

DNA in monocotyledonous and dicotyledenous species. Plant Cell Rep. 6: 265-
270.

Herdt, R.W. 1991. Research priorities for rice biotechnology. In: Khush G. S. and
Toenniessen G. H. (eds.) Rice biotechnology. CAB International, Wallingford,
UK, pp. 19-5.

Heyser, J. W., Nabors, M. W., MacKinnon, C., Dykes, T. A., DeMott, K. J ., Kautzman,
D. C. and Mujeeb, K. A. 1985. Long-term, high-frequency plant regeneration and
the induction of somatic embryogenesis in callus cultures of wheat (T riticum
aestivum L.), Z. Pﬂanzenzuecht. 94: 218-225.

Hiei, Y., Ohta, S., Komari, T. and Kumashiro, T. 1994. Efﬁcient transformation of rice
(Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the
boundaries of the T-DNA. Plant J. 6: 271-282.

Higuchi, R., Dollinger G., Walsh, PS. and Grifﬁth. R. 1992. Simultaneous ampliﬁcation
and detection of speciﬁc DNA sequences. Bio/Techno] 10: 413-417.

Hofte, H. and Whitely, H. R. 1989. Insecticidal crystal proteins of Bacillus thuringiensis.
Microbiol Rev. 53: 242-255.

Huber, M., Hahn, R. and Hess, D. 2002. High transformation frequencies obtained from a
commercial wheat (T riticum aestivum L. cv. 'Combi') by microbombardment of
immature embryos followed by GFP screening combined with PPT selection.

Mol. Breed. 10: 1-2.
Humara, J. M., Lopez, M. and OrdaS, R. J. 1999. Transient expression of the uidA gene in
Pinus pinea cotyledons: a study of heterologous promoter sequences. Plant Cell

Tiss. Organ Cult. 56: 2, 69-78.

Hunold, R., Bronner, R. and Hahne, G. 1994. Early events in microprojectile
bombardment: cell viability and particle location. Plant J. 5: 593-604.

Ingham, D. J. 2001. Quantitative Real Time PCR Assay for determining Transgene copy
number in transformed Plants. BioTechniques 31: 132-141.

115

Ishii, C. 1982. Callus induction and shoot differentiation of wheat, oat and barley, Proc.
5th IntI. Congr. Plant Tissue Cell Culture. pp: 185.

Izawa, T. and Shimamoto, K. 1996. Becoming a model plant: the importance of rice to
plant science. Trends plant Sci. 1: 95-99.

Jackson, S. A., Zhang, R, Chen, W. P., Phillips, R. L., Friebe, B., Muthukrishnan, S. and
Gill, B. S. 2001. High-resolution structural analysis of biolistic transgene
intergration into the genome of wheat. TAG 103: 56—62.

Jacobs, S. E. 1951. Bacterial control of the ﬂour moth, Ephestia kuehniella. Proc. Soc.
Appl. Bacteriol. 13: 83—91.

Jain, R. K., Iain, S. and Wu, R. 1996. Stimulatory effect of water stress on plant
regeneration in aromatic indica rice varieties. Plant Cell Rep. 15: 449-454.

Jefferson, R. A., Kavvanagh, T. A. and Bevan, M. W. 1987. GUS fusions: B-
glucoronidase as a sensitive and versatile gene ﬁrsion marker in higher plants.
EMBO J. 6: 3901-3907.

Johnston, S. A., Riedy, M., Devit, M. J., Sanford, J. C., McElligott, S. and Williams, R.
S. 1991 Biolistic transformation of animal tissue. In vitro Cell Rev. Biol. 27: 11-
14.

Kahl, G. 1982. Molecular Biology of wound healing. The conditioning phenomenon. In:
Kahl G. Schell, J. (eds.). Molecular Biology of Plant Tumors. pp. 207-221.
Academic Press New York.

Karp, A., Wu, Q. S., Steele, S. H. and Jones, M. G. K. 1987. Chromosome variation in
dividing protoplasts and cell suspensions of wheat. Theor. Appl. Genet. 74: 140-
146.

Kawata, S. and Ishihara A. 1968. The regeneration of rice plant, Oryza sativa L., in the
callus derived from the seminal root. Proc. Jpn. Acad 44: 549-553.

Kawata, S. and Ishihara, A. 1968. The regeneration of rice plant, Oryza sativa L. in the
callus derived from a seminal root. Proc. Jpn. Acad. 44: 549-556.

Ke, X. Y., McCormac, A. C., Harvey, A., Lonsdale, D., Chen, D. F. and Elliott, M. C.
2001. Manipulation of discriminatory T-DNA delivery by Agrobacterium into
cells of immature embryos of barley and wheat. Euphytica 126: 333-343.

Keil, M., Sanchez-Serrano, J., Schell, J. and Willrnitzer, L. 1986. Primary structure of a

proteinase inhibitor H gene from potato (Solanum tuberosum). Nucleic Acids Res.
14: 5641-5650.

116

Khush, G. S. 1997. Origin, dispersal, cultivation and variation of rice. Plant Mol. Biol.
35: 25-34. '

Khush, G. S. and Toenniessen, G. H. 1991. Rice Biotechnology. International Rice
Research Institute 6: 7-8.

Kim, M. Z. and Raghavan, V. 1988. Induction of pollen plantlets in rice by spikelet
culture. Plant Cell Rep. 7: 560-563.

Kishore, P. B. K. and Reddy, G. M. 1986. Regeneration of plants from long term cultures
of rice (Oryza sativa). Plant Cell Rep. 5: 391-393.

Klein, T. M., Wolf, E. D., Wu, R. and Sanford, J. C. 1987. High activity microprojectiles
for delivering nucleic acids into liming cells. Nature 327: 70-73.

Klomparens, K. S., Flegler, S. and Hooper, G. R. 1986. Procedures for transmission and
scanning electron microscopy for biological and medical sciences — a laboratory
manual. Burlington, Vt., USA: Ladd Research Industries.

Koziel, M. G., Belang, G. L., Bowman, C., Carazzi, N. B., Crenshaw, R., Crassland, L.,
Dawson, J ., Desai, N., Hill, M., Kadwell, S., Launis, K., Lewis, K., Maddox, D.,
Mcpherson, K., Meghji, M. R., Merlin, E., Rhodes, R., Warren, G. W., Wright,
M. and Evola, S. V. 1993. Field performance of elite transgenic maize plants

expressing an insecticidal protein derived from Bacillus thuringiensis.
Bio/Technol. 11: 194-200.

Kumar, S., Sharma, P. and Pental, D. 1998. A genetic approach to in vitro regeneration
of non-regenerating cotton (Gossypium hirsutum L.) cultivars. Plant Cell Rep. 18:
59-63.

Kumpatla, S. P. and Hall, T. C. 1998. Recurrent onset of epigenetic silencing in rice
harboring a multi-copy transgene. Plant J. 14: 129-13.

Lagudah, E. S., Dubcovsky, J. and Powell, W. 2001. Wheat genomics. Plant Physiol. &
Biochem. 39: 335-344.

Lai, K. L. and Liu, L. F. 1982. Induction and plant regeneration of callus from immature
embryos of rice plants (Oryza sativa L.). Jpn. J. Crop. Sci. 51: 70-74.

Larkin, P. J. and Scowcroft, W. R. 1981. Somaclonal variation a novel source of
variability from cell culture for plant improvement. Theor. Appl. Genet. 60: 197-
214.

Lee, L. G., Connell, C. R. and Bloch, W. 1993. Allelic discrimination by nick-translation
PCR with ﬂuorogenic probes. Nucl. Acid Res. 21: 3761-3766.

117

Lee, Qu T. M., Turgeon, R. and Wu, R. 1986. Expression of foreign gene linked to either
a plant virus or a Drosophila promoter after electroporation of protoplasts of rice,
wheat and sorghum. Proc. Natl. Acad. Sci. 83: 6815-6819.

Li, L., Qu, R., De Kochko, A., Fauquet, C. and Beachy, R. N. 1993. An improved rice
transformation system using the biolistic method. Plant Cell Rep. 12: 250-255.

Li, Z. Y., Xia, G. M. and Chen, H. M. 1992a. Somatic embryogenesis and plant
regeneration from protoplasts isolated from embryogenic cell suspension of wheat
(T riticum aestivum L.). Plant Cell Tiss. Organ Cult. 28: 7982.

Li, Z. Y., Xia, G. M., Chen, H. M. and Guo, C. Q. 1992b. Plant regeneration from
protoplasts derived from embrogenic suspension cultures of wheat (T riticum
aestivum L.). J. Plant Physiol. 139: 714-717.

Lorz, H., Baker, B. and Schell, J. 1985. Gene transfer to cereal cells mediated by
protoplast transformation, Mol. Gen. Genet. 199: 178-182.

Lorz, H., GobeI, E. and Brown, P. 1988. Advances in tissue culture and progress towards
genetic transformation of cereals. Plant Breed. 100: 1-6.

Lu, C. S., Sharma, H. C. and Ohm, H. W. 1991. Wheat anther culture: effect of genotype
and environmental conditions. Plant Cell Tiss. Organ Cult. 24: 233-238.

Luckett, D. J ., Venkatnagappa, S., Darvey, N. L. and Smithard, R. A. 1991. Anther
culture of Australian wheat germplasm using modiﬁed C17 medium and
membrane rafts. Aust. J. Plant Physiol. 18: 357-367.

Lynch, P. T., Benson, E. E., Jones, J., Cocking, E. C., Power, J. B. and Davey, M. R.
1994. Rice cell cryopreservation. The inﬂuence of culture methods and the
embryogenic potential of cell suspension on post-thaw recovery. Plant Sci. 98:
185-192.

Lynch, P. T., Finch, R .P., Davey, M. R. and Cocking, E. C. 1991. Rice tissue culture and
its application. In: Khush, G. S. Toenniessen, G. H., Ed. Biotechnology in
agriculture, Vol. 6: Rice Biotechnology, Wallingford: CAB International, 135-
155.

Mackenzie, D. R., Anderson, P. M. and Wemharn, C. C. 1966. A mobile air blast
incoulator for plot experiments with maize dwarf mosaic virus. Plant Dis. Rep.
50: 363-367.

Maddock, S. E., Lancaster, V. A., Risiott, R. and Franklin, J. 1983. Plant regeneration

from cultured immature embryos and inﬂorescences of 25 cultivars of wheat
(T riticum aestivum). Ind. J. Exp. Bot. 34: 915-919.

118

Maqbool, S. B., Husnain, T., Riazuddin, S., Mason, L. and Christou, P. 1998. Effective
control of yellow stem borer and rice leaf folder in transgenic rice indica varieties
Basmati 370 and M 7 using the novel delta-endotoxin cryZA Bacillus
thuringiensis gene. Mol. Breed. 4: 501-507.

Maqbool, S. B., Riazuddin, S., Loc, N. T., Gatehouse, A. M. R., Gatehouse, J. A. and
Christou, P. 2001. Expression of multiple insecticidal genes confers broad
resistance against a range of different rice pests. Mol. Breed. 7: 85-93.

Mason, C. E., Rice, M. E., Calvin, D. D., Van Duyn, J. W., Showers, W. B., Hutchison,
W. D., Witkowski, J. F ., Higgins, R. A. and Onstad, D. W. 1996. European corn
borer ecology and management. North Central Regional Extension Publication
No. 327. Iowa State University, Ames.

Mathias, R. J. and Simpson, E. S. 1986. The interaction of genotype and culture medium
on the tissue culture responses of wheat (T riticum aestivum L. em. Thell) callus.
Plant Cell Tiss. Organ Cult. 7: 31-37.

May, RM. 1993. Resisting resistance. Nature 361: 593-594.

McCabe, D. E., Swain, W. F., Martinell, B. J ., Christou. P. 1988. Stable transformation of
soybean (Glycine max) by particle acceleration. Bio/Techno]. 6: 923- 926.

McCormac, A. C., Wu, H. X., Bao, M. Z., Wang, Y. B., Xu, R. J., Elliott, M. C., Chen,
D. F., Wu, H. X., Bao, M. Z., Wang, Y. B., Xu, R. J. and Chen, D. F. 1998. The
use of visual marker genes as cell-speciﬁc reporters of Agrobacterium-mediated
T-DNA delivery to wheat (T riticum aestivum L.) and barley (Hordeum vulgare

L.). Euphytica. 99: 17-25.

McCormick, S., Niedermeyer J., Fry J ., Barnanson A., Horsch R. and Fraley R. 1986.
Leaf disc transformation of cultivated tomato (L. esculentum) using
Agrobacterium tumefaciens. Plant Cell Rep. 5: 81-84.

McElroy, D. and Bretell, R. I. S. 1994. Foreign gene expression in transgenic cereals.
Trends Biotech. 12: 62-68.

McElroy, D., Zhang, W., Cao, J. and Wu, R. 1990. Isolation of an efﬁcient actin
promoter for use in rice transformation. Plant Cell 2: 163-171.

Meadows, M. P. 1993. Bacillus thuringiensis in the environment: ecology and risk
assessment. In Bacillus thuringiensis, an environmental biopesticide: theory and
practice (Ed. Entwistle, P. F., Cory, J. G., Bailey M. J. and Higgs, S.) pp. 193-
220. John Wiley and Sons, Chichester, England.

Medford, J. 1992. Vegetative apical meristems. Plant Cell 4: 1029-1039.

119

Meijer, E. G. M., Iren, F. V., Schrijnemakers, E., Hensgens, L. A. M., Zijderveld, M. V.
and Schilperoot, R. A. 1990. Retention of the capacity to produce plants from
protoplasts in cryopreserved lines of rice (Oryza sativa L.). Plant Cell Rep. 10:
171-174.

Mendel, R. R. and Teeri, T. H. 1993. Barley, wheat, rye, oats and other small grain cereal
crops, In Transformation of Plants and Soil microorganism, Edited by Wang, K.,
Herrera-Estrella, A., Van Montagu, M. Eds. Cambridge University Press, New
York.

Milligan, A. S., Daly, A., Parry, M. A. J., Lazzeri, P. A. and Jepson, I. 2001. The
expression of a maize glutathione S-transferase gene in transgenic wheat confers
herbicide tolerance, both in planta and in vitro. Mol. Breed. 7: 301-315.

Mohanty, A., Sharma, N. P. and Tyagi, A. K. 1999. Agrobacterium-mediated high
frequency transformation of an elite indica rice variety Pusa Basmati and
transformation of the transgenes to R2 progeny. Plant Sci. 147: 127-137.

Morikawa, H., Lida, A. and Yamada, Y. 1989. Transient expression of foreign genes in
plant cells and tissues obtained by a simple biolistic device. Appl. Microbiol.
Biotechnol.31: 320-322.

Morikawa, H. and Yamada, Y. 1985. Capillary microinjection into protoplasts and
intranuclear localization of injected materials. Plant Cell Physiol. 26: 229-236.

Mukherjee, G. S. 1973. Genotypic differences in the in vitro formation of embryoids
from rice pollen. J. Exp. Bot. 21: 139-144.

Murashige, T. and Skoog, F. 1962. A revised medium for rapid growth and bioassay with
tobacco tissue culture. Physiol. Plant. 15: 47 3-497.

Nabors, M. W., Heyser, J. W., Dykes, T. A. and DeMott, K. J. 1983. Long-duration,
high-frequency plant regeneration from cereal tissue cultures. Planta 157: 385-
390,

Nayak, P., Basu, D., Das, S., Basu, A., Ghosh, D., Rarnkrishnan, N. A., Ghosh, M. and
Sen, S. K. 1997. Transgenic elite indica rice plants expressing CrylAc delta

endotoxin of Bacillus thuringiensis are resistant against yellow stem borer
(Scirpophaga insertulas). Proc. Natl. Acad. Sci. USA 94: 2111-2116.

O’Hara, J. F. and Street, H. E. 1978. Wheat callus cultures: The initiation, grth and

organogenesis of callus derived from various explants sources. Ann. Bot. 42:
1029-1038.

120

Oard, J. H., Paige, D. F., Simmonds, J. A. and Gradziel, T. M. 1990. Transient gene
expression in maize, rice and wheat cells using an air gun apparatus. Plant
Physiol. 92: 334-339.

Oard, J. H., Paige, D. F., Simmonds, J. A. and Gradziel, T. M. 1990. Transient gene
expression in maize, rice and wheat cells using an air gun apparatus. Plant
Physiol. 92: 334-339.

Olson, K. M. and Daly, J. C. 2000. Plant-Toxin interaction in transgenic Bt cotton and
their effect on mortality of Helicoverpa armigera (Lepidoptera: Noctuidae). J. of
Econ. Entomol. 93: 1293-1299.

Ostlie, K. R., Hutchison, W. D., Hellmich, R. L. 1997. Bt corn & European corn borer:
Long-term success through resistance management. University of Minnesota
extension Service.

Ozawa, K. and Komamine, A. 1989. Establishment of a system of high frequency
embryogenesis from long term cell suspension cultures of rice (Oryza sativa).
Theor. Appl. Genet. 77: 205-211.

Ozgen, M., Turet, M., Ozcan, S. and Sancak, C. 1996. Callus induction and plant
regeneration from immature and mature embryos of durum wheat genotypes.
Plant Breed. 115: 455-458.

Ozias-Akins, P. and Vasil, I. K. 1982. Plant regeneration from cultured immature
inﬂorescences of T riticum aestivum L. (wheat): Evidence for somatic
embryogenesis. Protoplasma 1 10: 95-105.

Payne, J. M. Cannon, R. J. C. 1993. Use of Bacillus thuringiensis isolates for controlling
pests in the family aphididae. U. S. Patent No.5: 262-269.

Peferoen, M. 1992. Engineering of insect-resistant plants Bacillus thuringiensis crystal
protein genes. In: Biotechnology in Agriculture N 7: Plant genetic manipulation
for crop protection. CAB International, London, pp. 135-153.

Pellegrineschi, A., Noguera, L. M., Skovmand, B., Brito, R. M., Velazquez, L., Salgado,
M. M., Hernandez, R, Warburton, M. and Hoisington, D. 2002. Identiﬁcation of
highly transforrnable wheat genotypes for mass production of fertile transgenic
plants. Genome 45: 421-430.

Peng, J. and Hodges, T. K. 1989. Genetic analysis of plant regeneration in rice (Oryza
sativa). In Vitro Cell. Devel. Biol. 25: 91-94.

Peng, J ., Wen, F., Lister, R. and Hodges, T. K. 1995. Inheritance of gusA and neo genes
in transgenic rice. Plant Mol. Biol. 27: 91-104.

121

Pilcher, C. D. and Rice, M. E. 2001. Effect of planting dates and Bacillus thuringiensis
corn on the population dynamics of European corn borer (Lepidoptera:
Crambidae). J. Econ. Entomol. 94: 730-742.

Pingali, P. L. and Roger, P. A. 1995. Impact of pesticides on farmer health and the rice
environment. IRRI, Manila Philippines.

Pingali, P. L. and Rajaram, S. 1999. Global wheat research in a changing world: Options
for sustaining growth in wheat productivity. In: CHVIMYT. World Wheat Facts
and Trends. D. F., Mexico. pp. 1-18.

Potrykus, I. 1990. Gene transfer to cereals: an assessment. Bio/Technol. 8: 535-542.

Pukhal' skii, V. A., Smimov, S. P., Korostyleva, T. V., Bilinskaya, E. N. and Eliseeva, A.
A. 1996. Genetic transformation of wheat (T riticum aestivum L.) by
Agrobacterium tumefaciens. Genetika—Moskva. 32: 11, 1596-1600.

Raineri, D. M., Bottino, R, Gordon, M. P. and Nester, E. W. 1990. Agrobacterium-
mediated transformation of rice (Oryza sativa L.). Bio/Techno]. 8: 33-38.

Rashid, H., Yokoi, S., Toriyama, K. and Hinata, K. 1996. Transgenic plant production
mediated by Agrobacterium in indica rice. Plant Cell Rep. 15: 727-730.

Redway, F. A., Vasil, V. and Vasil, I. K. 1990. Characterization and regeneration of
wheat (T riticum aestivum L.) embryogenic cell suspension cultures, Plant Cell
Rep. 8: 714-720.

Robinson, K. and Firoozabady, E. 1993. Transformation of ﬂoriculture crops. Scientia
Horticulturae. 55: 83-99.

Rueb, S., Leneman, M., Schilperoort, R. A. and Hensgens, A. M. 1994. Efﬁcient plant
regeneration through somatic embryogenesis from callus induced on mature rice
embryos (Oryza sativa L.) Plant Cell Tissue Org. Cult. 36: 259-264.

Sambrook, J., Fritsch E. F. and Maniatis T. Molecular Cloning. 1989. A laboratory
Manual. Second edition. Cold Spring Harbor Laboratory Press.

Sanford, J. G, Klein, T. M., Wolf, E. D. and Allen, N. 1987. Delivery of substances into
cells and tissues using a particle bombardment process. J. Particulate Sci. and
Tech. 6: 559-563.

SAS Institute. 1985. SAS user’s guide: statistics, 5’h ed. SAS institute, Cary, NC.
Sawahel, W. A. and Hassan, A. H. 2002. Generation of transgenic wheat plants

producing high levels of the osmoprotectant proline. Biotech. Letters. 24: 721-
725.

122

Schmitz, U. and Lorz, H. 1990. Nutrient uptake in suspension cultures of gramineae H.
Suspension cultures of rice anther culture. Theor. Appl. Genet. 67: 383-3 89.

Shang, X. M. and Wang, W. C. 1991. DNA ampliﬁcation, chromatin variations and
polytene chromosomes in differentiating cells of common bread wheat in vitro
and roots of regenerated plants in vivo. Genome 34: 799-804.

Shillito, R. D., Carswell, G. K., Johnson, C. M., DiMaio, J. J. and Harms, C. T. 1989.
Methods for conservation of plant genetic resources. Can. J. Bot. 53: 1097-1102.

Shimada, T. 1978. Plant regeneration from the callus induced from wheat embryo. Jpn. J.
Genet. 53: 371-375.

Shimada, T., Sasakuma, T. and Tsunewaki, K. 1969. In vitro culture of wheat tissues. 1.
Callus formation, organ redifferentiation, and single cell culture, Can. J. Genet.
Cytol. 11. 294-296.

Shimada, T. and Yamada, Y. 1979. Wheat plants regenerated from embryo cell cultures.
Jpn. J. Genet. 54: 379-382.

Shimamoto, K., Teda, R., Izawa, T. and Fujimoto, H. 1989. Fertile transgenic rice plants
regenerated from transformed protoplasts. Nature. 338: 274-277.

Siege], J. P. and Shadduck, J. A. 1988. Mammalian safety of Bacillus thuringiensis
israelensis. In de Barjac, H. and Sutherland, D. J. (ed) Bacterial control of
mosquitoes & black ﬂies: Biochemistry, genetics & applications of Bacillus
thuringiensis israelensis and Bacillus sphaericus. New Brunswick, NJ: Rutgers
University Press.

Simmonds, J. A. 1997. Mitotic activity in wheat shoot apical meristems: effect of
dissection to expose the apical dome. Plant Sci. Limerick. 130: 217-225.

Simmonds, J ., Stewart, P. and Simmonds, D. 1992. Regeneration of T riticum aestivum
apical explants after microinjection of germ line progenitor cells with DNA.
Physiol. Plant. 85: 197-202.

Sivamani, E., Brey, C. W., Talbert, L. E., Young, M. A., Dyer, W.E., Kaniewski, W. K.
and Qu, R. 2002. Resistance to wheat streak mosaic virus in transgenic wheat

engineered with the viral coat protein gene. Transgenic Res. 11: 31-41.

Smith, M. K. and Drew, R. A. 1990. Current applications of tissue culture in plant
propagation and improvement. Aust. J. Plant Physiol. 17: 267-289.

Smith, R. H. and Hood, E. E. 1995. Agrobacterium tumefaciens transformation of
monocotyledons. Crop Sci. 35: 301-309.

123

Snow, A. A. and Palma, P. M. 1997. Commercialization of transgenic plants: potential
ecological risks. Biosci. 47: 86-96.

Srivastava, V. and Ow, D. W. 2002. Biolistic mediated site-speciﬁc integration in rice.
Mol. Breed. 8: 345-349.

Steward F. C., Arnmirato P. V. and Mapes M. O. 1970. Growth and development of
totipotent cells: some problems procedures and perspectives. Ann. Bot. 34 761-
788.

Sticklen, M. B. 1990. Genetic engineering of plants: An alternative to pesticides and a
new component of Integrated Pest Management. In: Proceedings of the third
National research conference on pesticides. Virginia water resources research
center, Virginia polytechnic institute & State University.

Stolarz, A., Macewicz, K. J. and Lorz, H. 1991. Direct somatic embryogenesis and plant
regeneration from leaf explants of Nicotiana tabacum L. Plant Physiol. 37: 347-
357.

Swaminathan, M. S. 1982. Biotechnology research and third world agriculture. Sci. 218:
967-972.

Tabashnik, E. 1994. Evaluation of resistance to Bacillus thuringiensis. Ann. Rev.
Entomol. 39: 47-79.

Thompson, C. J ., Novva, N. R., Tizard, R., Crameri, R., Davies, J. E., Lauwereys, M. and
Botterrnan, J. 1987. Characterization of the herbicide-resistance gene bar from
Streptomycis hygroscopicus. EMBO 6: 2519-2523.

Toriyama, K., Arimoto, Y., Uchimiya, H., and Hinata, K. 1988. Transgenic rice plants
after direct gene transfer into protoplasts. Bio/Techno]. 6: 1072-1074.

Trick, H. N. and Finer, J. J. 1997. SAAT: Sonication-assisted Agrobacterium-mediated
transformation. Transgenic Research. 6: 5, 329-336.

Trione, E. J., Jones, L. E. and Metzger, R. J. 1968. In vitro culture of somatic wheat
callus tissue, Am. J. Bot. 55: 529-533.

Uchimiya, H., Hirochika, H., Hashimoto, H., Hara, A., Masuda, T., Kasumimoto, T.,
Harada, H., Keda, J. E. and Yoshika, M. 1986. Co-expression and inheritance of
foreign genes in transformants obtained by direct DNA transformation of tobacco
protoplasts. Mol. Gen. Genet. 205: 1-8.

124

Vain, P., McCullen, M. D. and Finer, J. J. 1993. Osmotic treatment enhances particle
bombardment-mediated transient and stable transformation of maize. Plant Cell
Rep. 12: 84-88.

Vasil, I. K. 1988. Progress in the regeneration and genetic manipulation of cereal crops.
Bio/Techno]. 6: 397-403.

Vasil, I. K. and Vasil, V. 1986. Regeneration in cereal and other grass species. In Cell
Culture and Somatic Cell Genetic Variability. Vasil, I. K., Ed., Academic Press,
Orlando, FL.

Vasil, V., Redway, F. and Vasil, I. K., 1990. Regeneration of plants from embryogenic
suspension culture protoplasts of wheat (T riticum aestivum L.), Bio/Technol. 8:
429-432.

Vasil, V., Srivastava, V., Castillo, A. M., Fromm, M. E. and Vasil, I. K. 1993. Rapid
production of transgenic wheat plants by direct bombardment of cultured
immature embryos. Bio/Technol. 11: 1553-1558.

Viertel, K. and Hess, D. 1996. Shoot tips of wheat an alternative source for regenerable
embryogenic callus cultures. Plant cell, tissue and organ cult. 44: 183-188.

Wang, H. 8., Li, X. H., Sun, Y. R., Chen, J., Zhu, Z., Fang, R., Wang, P. and Wel, J. Q.
1990. Culture of wheat protoplast. Sci. Sin. Ser. B. 33: 294-299.

Wang, W. C. and Nguyen, H. T. 1990. A novel approach for efﬁcient plant regeneration
from long-term suspension culture of wheat. Plant Cell Rep. 8: 639-643.

Wang, Y. G, Klein, T. M., Fromm, M., Cao, J., Sanford, J. C. and Wu, R. 1988.
Transient expression of foreign genes in rice, wheat and soybean cells following
particle bombardment. Plant Mol. Biol. 11: 433-440.

Weeks, J. T., Anderson, 0. D. and Blechl, A. E. 1993. Rapid production of multiple
independent lines of fertile transgenic wheat (T ritcum aestivum). Plant Physiol.
102: 1077-1084.

Weiser, J. 1986. Impact of Bacillus thuringiensis on applied entomology on Eastern
Europe and in the Soviet Union. In: Mitteilungen aus der biologischen
Bundesanstalt fur land-und Forstwirtschaft BerlinDahlem (Eds. A. Krieg and
AM. Huger), Heft 233, pp. 37-50, Paul Parey, Berlin.

Wemicke, W., Brettell, R., Wakizura, T. and Potrykus, I. 1981. Adventitious embryoid
and root formation from rice leaves. Z. Pﬂanzenphysiol. 103: 361-365.

125

Wemicke, W. and Milkovits, L. 1986. The regeneration potential of wheat shoot
meristems in the presence and absence of 2,4-dichlorophenoxyacetic acid.
Protoplasma 131: 131-136.

Wemicke, W. and Milkovits, L. 1984. Developmental gradients in wheat leaves response
of leaf segments in different genotypes cultured in vitro. J. Plant Physiol. 115: 49-
55. ‘

Werr, W. and Lorz, H., 1986. Transient gene expression in a Grarmineae cell line. A
rapid procedure for studying plant promoters. Mol. Gen. Genet. 202: 471-478.

Witrzens, B., Brettell, R. I. S., Murray, F. R., McElroy, D., Li, Z. Y. and Dennis, E. S.
1998. Comparison of three selectable marker genes for transformation of wheat
by microproj ectile bombardment. Aust. J. Plant Physiol. 25: 39-44.

Witter, C. T., Herrmann, M. G., Moss, A. A. and Rasmussen, R. P. 1997. Continuous
ﬂuorescence monitoring of rapid cycle DNA ampliﬁcation. BioTechniques 22:
130-138.

Woolston, C. J., Barker, R., Gunn, H., Boulton, M. I. and Mullineaux, P. M. 1988.
Agroinfection and nucleotide sequence of cloned wheat dwarf virus DNA. Plant
Mol. Biol. 11: 35-39.

Wu, C., Fan, Y., Zhang, C., Oliva, N. and Datta, S. K. 1997. Transgenic fertile japonica
rice plants expressing modiﬁed crylAb gene resistant to yellow stem borer. Plant
Cell Rep. 17: 129-132.

Wu, R., Kemmerer, E. and McElory, D. 1990. Transformation and regeneration of
important crop plants: rice as the model system for monocots. Gustafson, J. P.
(ed). Gene manipulation in plant improvement H: 251-263.

Wunn, J., Kloti, A., Burkhardt, P. K., Ghosh, B. C. G., Launis, K., Iglesias, V. A. and
Potrykus, I. 1996. Transgenic Indica Rice breeding line IR 58 expressing a
synthetic crylAb gene from Bacillus thuringiensis provides effective insect pest
control. Bio/Techno]. 14: 171-176.

Xiang, Y. 3., Cheng, X., Liang, Z., Shu, Q. Y., Ye, G. Y., Gao, M. and Altosaar, I. 1999.
Agrobacterium-mediated transformation of insecticidal Bacillus thuringiensis
cryIAb and cryIAc genes and their expression in rice. Chin. J. Biotechnol. 15:
494-500.

Xu, X. and Li, B. 1994. Fertile transgenic indica rice plants obtained by electroporation
of seed embryo cells. Plant Cells 13: 237-242.

126

Ye, X., Al-Babili, S., Klbti, A., Zhang, J., Lucca, P., Beyer, P. and Potrykus, I. 2000.
Engineering the Provitamin A (IS-Carotene) Biosynthetic Pathway into
(Carotenoid-Free) Rice Endosperrn. Sci. 287: 303-305,

Zaghmout, O. M. and Trolinder, N. L. 1993. Simple and efﬁcient method for directly
electroporating Agrobacterium plasmid DNA into wheat callus cells, Nucl. Acid.
Res. 21: 1048-1053.

Zamora, A. B. and Scott, K. J. 1983. Callus formation and plant regeneration from wheat
leaves. Plant Sci. Lett. 29: 183-185.

Zhang, H. M., Yang, H., Rech, E. L., Golds, T. J ., Davis, A. S., Mulligan, B. J ., Cocking,
E. C. and Davey, M. R. 1988. Transgenic rice plants produced by electroporation-
mediated plasmid uptake into protoplasts. Plant Cell Rep.7: 379-384.

Zhang, S., Chao, M. J., Koprek, T., Yun, R. B. and Lemaux, P. G. 1999. Genetic
transformation of commercial cultivars of oat (Avena sativa L.) and barley
(Hordeum vulgare L.) using in vitro shoot meristematic cultures derived from
germinated seedlings. Plant Cell Rep. 18: 850-966.

Zhang, S., Chen, L., Qu, R., Narmey, P., Beachy, R. and Fauquet, C. 1996a.
Regeneration of fertile transgenic indica (group 1) rice plants following
microprojectile transformation of embryogenic suspension culture cell. Plant Cell
Rep. 15: 465-469.

Zhang, S., Zhong, H. and Sticklen, M. B. 1996b. Production of multiple shoots from
shoot apical meristems of oat (Avena sativa L.). J. Plant Physiol. 148: 667-671.

Zhang, W. and Wu, R. 1988. Efﬁcient regeneration of transgenic plants from rice
protoplasts and correctly regulated expression of the foreign gene in the plants.
Theor. Appl. Genet. 76: 835-840.

Zhong, H., Srinivasan, C. and Sticklen, M. B. 1992. In vitro mophogenesis of corn (Zea
mays L.) Planta. 187: 483-489.

Zhong, H., Sun, B., Warkentin, D., Zhang, S., Wu, R., Wu, T. and Sticklen, M. B. 1996.
The competence of maize shoot meristem for integrative transformation and
inherited expression of transgenes. Plant Physiol. 110: 1097-1107.

Zhong, H., Wang, W. and Sticklen, M. B. 1998. In vitro morphogenesis of Sorghum

bicolor (L.) Moench: Efﬁcient plant regeneration from shoot apices. J. Plant
Physiol. 153: 719-726.

127

IllIllllIllllllllllIllIlllllllllllllllllll
.. 3 1293 02470 0209 I