. afiwwm kw,

61%“

.5.
M

A“

.. l A. i

,

k . .5.

‘D .u . y
‘33....

g 2..
a. AM»...

iuill. ,
((132...

 

m5..3‘;§.

“3 ,. f. Ll‘B‘fiARY

5 9" 7 “’7 MiChiga. State
Universnty

 

 

 

 

 

This is to certify that the

dissertation entitled

In vitro and in vivo evaluation of the potential
estrogenic effects of pblycyclic aromatic hydrocarbons

presented by

Kirsten Cecilia Fertuck

has been accepted towards fulfillment
of the requirements for

PhD degreein Biochemistry and Molecular

Biology

, .. _ ~ /
’L“)//’/7 I / ,/"/
/’ 7
\V/ f: \‘i (1::

I
Yfé/[C’C r( k g x
/ Major professor

Date 57%.?

,
,
I
/

MSU is an Affirmative Action/Equal Opportunity Institution 0-12771

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 c-JCIRCIDnteDmpBS-sz

 

IN VITRO AND IN V1 V0 EVALUATION OF THE POTENTIAL ESTROGENIC
EFFECTS OF POLYCYCLIC AROMATIC HYDROCARBON S

By

Kirsten Cecilia Fertuck

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Biochemistry and Molecular Biology

2003

ABSTRACT

IN VITRO AND IN V1 V0 EVALUATION OF THE POTENTIAL ESTROGENIC
EFFECTS OF POLYCYCLIC AROMATIC HYDROCARBONS

By

Kirsten Cecilia Fertuck

A large number of exogenous compounds have been found to possess the ability to bind
to the 0: and B isoforrns of the estrogen receptor (ER). The identification and
characterization of these compounds is typically achieved through in vitro assays and,
when concern is warranted, by assessing the ability of the compound to stimulate uterine
proliferation in the rodent uterus. Benzo[a]pyrene (B[a]P) is a ubiquitous pollutant and
shares some structural similarity with endogenous estrogens, particularly when hydroxyl
groups are introduced during metabolism. Specific B[a]P metabolites, as well as other
compounds of interest, were identified that were able to bind to ERa and ERB in vitro,
and to induce EROL- and ERB-mediated reporter gene expression in MCF-7 breast cancer
cells. B[a]P was also shown to interact in an additive manner in vitro when cotreated with
estrogen. However, administration of B[a]P or of its most active metabolites to immature,
ovariectomized mice was not sufficient to stimulate uterine proliferation or induction of
uterine lactoferrin mRNA expression. Because the transcriptional targets of estrogen in
the uterus are numerous and many are still undiscovered, a GeneChip microarray
approach was used in order to characterize the temporal transcriptional responses to
estrogen in the uterus. This approach was able to confirm previously characterized effects

as well as to identify novel responses. For example, the arginine and omithine utilization

pathway was found to be particularly highly regulated in the uterus in response to
estrogen, and while induction of some of these enzymes had been shown previously, this
provided the first evidence that numerous aspects of this pathway could be monitored at
the transcription level in the estrogen-stimulated uterus. Expression of arginase ] was
found to be particularly high in response to prolonged estrogen exposure. The ability of
B[a]P to alter the expression of arginase 1 and other chosen genes was then assessed in
the rodent uterus. While B[a]P was recently reported to antagonize the ability of estrogen
to stimulate the proliferation of MCF—7 breast cancer cells in vitro, we showed that B[a]P
was not able to interfere with estrogen-induced uterine proliferation or with expression of
estrogen-regulated genes including arginase 1. Finally, the extensive literature searching
required in the analysis of the microarray data made it clear that the lack of a
comprehensive review of previously characterized estrogen-responsive genes is a great
impediment to the analysis of new large-scale transcriptional profiling studies.
Accordingly, a comprehensive review of estrogen-regulated transcription in the uterus is

provided.

ACKNOWLEDGEMENTS

My advisor, Tim Zacharewski, deserves my heartfelt thanks for both professional and
personal guidance, and for providing me with countless opportunities that I never
expected to have. It is largely due to his mentorship that this experience has been so

much more rewarding than I could ever have predicted.

The members of the Zacharewski lab have been very generous in providing patient
advice, sympathetic assistance, and plenty of comic relief. I have learned a great deal
from everyone that I have come in contact with, including numerous postdocs and
undergraduate students, and have received particular support and empathy from the
graduate students, Jason Matthews, Mark Fielden, Lyle Burgoon, Darrell Boverhof, and
Cora Fong. The Zacharewski family naturally counts among the lab members, since

afternoons are always best when Jana, Lara, and Nick make a surprise appearance.

My experience here has been shaped very much by the energy and kindness of numerous
other members of the department over these years. I would like to thank my first friends
here, Craig Seaver, Janet Filek, and Matt Larson, who helped me to get started. I was sad
to see them move on, but through that, met Anu Kumar and Beth Strunk, who were my
favorite neighbors. Then as they were leaving, I became friends with Dawn Greensides,
who was an endless source of energy and treats, not to mention new friends. I would
particularly like to thank Francisco Herrera for making me laugh so much, Soren Ottosen

for giving me the best photo that I have ever seen, Joe Graber for being funny, Brandon

iv

Hespenheide for being on my team, Rich Gray for all of the etiquette lessons, Pete
Davidson and Yu-wen Chung for the Shakespeare, Heather Hirsch and Jim Mann for the
baking support, Sheldon Leung for having his own special sense of humor, Nikki
LeBrasseur for standing up for me, Bryan Schmidt and Josh Edwards for inviting us all
over so generously and often, Setsuko Wakao for being my great new neighbor, and Dean

Shooltz for being willing to juggle just about anything.

My committee members also receive my deep thanks for the guidance that they have
provided, in addition to countless reference letters over the years. I am very grateful also
for the help of the departmental staff, and in particular that of Julie Oesterle, whom I have

relied on repeatedly.

My parents have been extremely helpful over the years in many ways, and their phone
calls while I have been here have been especially appreciated. My brother and sister are
extremely skilled at making me laugh, and their energy is always welcome. And finally,
Chris has been an immense source of support from far away, and talking to him is my
favorite part of every day. His steady help during difficult times has been critical, as has
his sharing of the many good time, and all of it has been an enormous part of my time

here.

TABLE OF CONTENTS

LIST OF TABLES ............................................................................................................ ix
LIST OF FIGURES .......................................................................................................... xi
ABBREVIATIONSM-u - XIV

 

CHAPTER 1: Review of the literature: transcriptional responses to estrogen in the

uterus ................................................................................................................................... 1
INTRODUCTION ................................................................................................................ 1
OVERVIEW: ESTROGENS, THEIR RECEPTORS, AND THEIR RESPONSE ELEMENTS
............................................................................................................................................. 2
Estrogens ..................................................................................................................................... 2
Estrogen receptors ....................................................................................................................... 3
Estrogen response elements ........................................................................................................ 4
Coactivators ................................................................................................................................. 4
Nonclassical ER signaling ........................................................................................................... 5
OVERVIEW OF ESTROGEN EFFECTS IN THE UTERUS ............................................... 6
Uterine cell types ......................................................................................................................... 7
The reproductive cycle ................................................................................................................ 8
Circulating hormone levels ....................................................................................................... 11
Overview of responses to exogenous estrogen administration .................................................. 12
Nuclear receptor signaling ........................................................................................................ I4
TRANSCRIPTIONAL EFFECTS OF ESTROGEN IN THE UTERUS .............................. 22
DNA, RNA, and protein synthesis ............................................................................................ 22
Proliferation ............................................................................................................................... 28
Energy utilization and storage ................................................................................................... 47
Structural ................................................................................................................................... 50
Blood flow and angiogenesis .................................................................................................... 6]
Erythropoiesis and coagulation ................................................................................................. 64
Oxidative stress ......................................................................................................................... 65
Solute and fluid regulation ........................................................................................................ 66

vi

Immunologic responses ............................................................................................................. 70

Intercellular communication ..................................................................................................... 75
Apoptosis ................................................................................................................................... 77
Neurotransmitters ...................................................................................................................... 78
Other .......................................................................................................................................... 79
CONCLUSIONS ................................................................................................................ 80

CHAPTER 2: Hydroxylated benzola]pyrene metabolites are responsible for in vitro

estrogen receptor-mediated gene expression induced by benzo[a]pyrene, but do not

 

elicit uterotrophic effects .............................. - ....... -- 82
ABSTRACT ........................................................................................................................ 82
INTRODUCTION .............................................................................................................. 84
MATERIALS AND METHODS ......................................................................................... 86
RESULTS ........................................................................................................................... 92
DISCUSSION .................................................................................................................... 94

CHAPTER 3: Interaction of PAH-related compounds with the a and B isoforms of

 

the estrogen receptor ........ - - 109
ABSTRACT ...................................................................................................................... 109
INTRODUCTION ............................................................................................................ l 10
MATERIALS AND METHODS ....................................................................................... I 1 1
RESULTS ......................................................................................................................... [13
DISCUSSION .................................................................................................................. 1 I 5

CHAPTER 4: Identification of temporal patterns of gene expression in the uteri of

immature, ovariectomized mice following exposure to ethynyl

 

estradioL- 123
ABSTRACT ...................................................................................................................... 123
INTRODUCTION ............................................................................................................ [25
MATERIALS AND METHODS ....................................................................................... I 28
RESULTS ......................................................................................................................... I35

vii

DISCUSSION .................................................................................................................. 144

CHAPTER 5: Benzo[a]pyrene does not elicit estrogenic or antiestrogenic actions in

 

the rodent uterus ..................................................................................... 170
ABSTRACT ...................................................................................................................... 170
INTRODUCTION ............................................................................................................ 1 7]
RESULTS ......................................................................................................................... I75
DISCUSSION .................................................................................................................. 1 77
CHAPTER 6: Summary and future perspectives - .......... 186
REFERENCES _ - -- - _ ........ 188

 

viii

LIST OF TABLES

CHAPTER 2
1. In vitro competitive binding IC50 and gene expression EC50 values for E2, B[a]P,
and B[a]P metabolites .......................................................................................... 101
2. Effect of orally administered ethynyl estradiol (EE) or benzo[a]pyrene (B[a]P) on
blotted uterine wet weight (UW) in ovariectomized DBA/2 and C57BL/6
mice ...................................................................................................................... 102
3. Effect of subcutaneously administered ethynyl estradiol (EE) or 3- or 9-hydroxy-
benzo[a]pyrene (OH-B[a]P) on blotted uterine weight (UW) in ovariectomized

DBA/2 and C57BL/6 mice ................................................................................... 103

CHAPTER3
1. In vitro competitive binding IC50 and gene expression ECSO values for 178-

estradiol (E2) and test compounds ....................................................................... 1 l9

ix

CHAPTER 4

H

. Primer sequences used in real-time QRT-PCR verification ................................ 163

2. Summary of K-means clustering of the entire Mul lKSubA dataset. For clarity,

probe sets corresponding both to unnamed UniGene clusters and those not

represented within UniGene are denoted ‘ESTs’ in this table ............................. 164

3. Comparison of microarray data with corresponding QRT-PCR data .................. 165

4. Summary of K-means clustering of the active subset of gene responses ............ 166
CHAPTER 5

1. Primer sequences used in real-time QRT-PCR verification ........................... 181

LIST OF FIGURES

CHAPTER 2

1. Chemical structures of 17B-estradiol (E2) and benzo[a]pyrene (B[a]P), with
position numbers labeled ..................................................................................... 104
2. Competitive displacement curves for E2, B[a]P, and B[a]P metabolites displacing

2.5 nM [3H]E2 from (A) GST-hERadef and (B) hERB ...................................... 105

3. Induction of (A) Gal4-hERocdef— and (B) Gal4-mERBdef—mediated reporter gene
expression in transiently transfected MCF-7 cells treated for 24 hrs with E2,
B[a]P, or B[a]P metabolites ................................................................................. 106

4. Results of cotreatment of E2 and B[a]P on hEROL—mediated reporter gene
expression in MCF-7 cells ................................................................................... 107

5. Representative gel showing uterine lactoferrin (LF) and actin (A) expression in

ovariectomized D2 and C57 mice treated with vehicle, EE, or 20 mg/kg 3- or 9-

OH-B [a]P ............................................................................................................. 108

CHAPTER 3
1. Chemical structures of select polycyclic aromatic compounds under study.
Position numbers are labeled for compounds possessing functional groups ....... 120
2. Competitive binding curves for chrysene derivatives and benzo[c]phenanthrene
and benzothiophene derivatives displacing 2.5 nM [3H]E2 from GST-hEROLdef

and hERB ............................................................................................................. 121

xi

3. Induction of Gal4-hERordef- and Gal4-mERBdef-mediated reporter gene
expression in transiently transfected MCF-7 cells treated for 24 h with (A) PAHs,
(B) heterocyclic PAHs, (C) chrysene derivatives, and (D) benzo[c]phenanthrene

and benzothiophene derivatives ........................................................................... 122

CHAPTER 4

1. Probe sets represented on the Mul lKSubA array were categorized according to
the gene name available in UniGene and whether the response passed the two
statistical screening steps described in the text. A heavy outline indicates those
probe set responses which passed both screening steps based on the defined
threshold criteria, and which were subsequently subjected to K-means clustering

and response element searching ........................................................................... 167

2. Responses passing the empirical Bayes and AN OVA screening steps, categorized
into seven K-means clusters labeled I-O, as described in the text and in Table 4. A
pseudogene line is drawn in bold to illustrate a representative response for each

cluster ................................................................................................................... 168

3. A model for the estrogen-induced promotion of uterine growth through regulation

of specific urea cycle product levels .................................................................... 169

xii

CHAPTER 5

l. Uterine weights normalized by body weights at the end of the treatment

period ................................................................................................................... 1 82

2. Hepatic expression of CypIaI measured by QRT-PCR. Benzo[a]pyrene (A) and

TCDD (B) are presented separately due to large differences in

inducibility ........................................................................................................... 1 83
3. (A) Uterine expression of Ltf measured by QRT-PCR ........................................ 184
(B) Uterine expression of Argl measured by QRT-PCR ..................................... 185

xiii

AhR:

ANOVA:

AP-l:

ATP:
B[a]P:
CTGF:
DBD:
E2:
EE:
EGF:
EST:
ER:
ERE:
FGF:
FSH:
GAG:
GnRH:
GR:
HSP:
IGF:
IL:
LBD:
LH:
MASS:
MMP:
PAH:
PDGF:
PR'

RT-PCR:

SD:
TCDD:
TNF:
TGF:
TR:
VEGF:

ABBREVIATIONS

Aryl hydrocarbon receptor
Analysis of variance

Activation protein 1

Androgen receptor

Adenosine triphosphate
Benzo[a]pyrene

Connective tissue growth factor
DNA binding domain
l7B-Estradiol

170t-Ethynyl estradiol

Epidermal growth factor
Expressed sequence tag
Estrogen receptor

Estrogen responsive element
Fibroblast growth factor

Follicle stimulating hormone
Glycosaminoglycan
Gonadotropin releasing hormone
Glucocorticoid receptor

Heat shock protein

Insulin-like growth factor
Interleukin

Ligand binding domain
Luteinizing hormone

Affymetrix MicroArray Suite version 5.0
Matrix metalloproteinase
Polycyclic aromatic hydrocarbon
Platelet-derived growth factor
Progesterone receptor

Reverse transcriptase-polymerase chain reaction
Standard deviation
Tetrachlorodibenzo-p-dioxin
Tumor necrosis factor
Transforming growth factor
Thyroid hormone receptor
Vascular endothelial growth factor

xiv

CHAPTER 1

REVIEW OF THE LITERATURE: TRANSCRIPTIONAL RESPONSES TO

ESTROGEN IN THE UTERUS

INTRODUCTION

The profound actions of estrogens on the uterus were first described in detail in
the 19205, and great advances in understanding the nature of these effects were made in
the following decades. In the 19603, the first studies characterizing the transcriptional
responses in the estrogen-stimulated uterus were initiated, and in the years since then,
thousands of additional studies have used humans, various model species, and cultured
cells to further refine our understanding of these processes. Many uterine responses to
estrogen have a transcriptional component, and therefore microarrays have become an
appealing tool for further characterizing these immensely complex effects, an endeavour
that is of great interest to pharrnacologic and toxicologic researchers. A difficulty in this
approach however is in the data interpretation, since this body of published information
has not been comprehensively reviewed, and it is therefore difficult to discern novel
responses from those that have been previously reported, and laborious to associate these
responses with known associated physiological effects. Furthermore, many of the
affected transcripts are associated with numerous gene names, further hampering data
analysis.

The following review addresses the deficiency in the organization of this
information by discussing the known estrogen-induced changes in levels of specific

transcripts in the uterus of humans and of common model organisms, as well as their

relevance to uterine biology. Citations of pertinent reviews are provided. As well, recent
research that has greatly expanded the understanding of mechanisms of estrogen
signaling is discussed. Transcripts here are identified by their italicized official mouse
gene abbreviation, as identified in the National Center for Biotechnology Information

database (http://www.ncbi.nlm.nih.gov/LocusLink/).

OVERVIEW: ESTROGENS, THEIR RECEPTORS, AND THEIR RESPONSE

ELEMENTS

Estrogens

Estrogens are steroid hormones that are formed by the aromatization
hydroxylation of the A ring of androgens. 17B-Estradiol and its weaker estrogen
metabolites are the predominant form of circulating estrogen, though endogenous non-
aromatized steroids, including testosterone and several of its precursors and derivatives,
have also been shown to possess direct estrogen receptor-mediated transcriptional activity
and cell proliferation (l, 2). Biosynthesis of steroid estrogens occurs in all vertebrates and
in protochordates (3), and estrogen availability is controlled by associations with sex
hormone binding globulins (4, 5).

In premenopausal women, the ovaries are the primary source of estrogen, which is
secreted and acts in an endocrine manner on target tissues. In postmenopausal women
and in men, estrogen is produced in extragonadal sites, including specific cell types
within fat, bone, blood vessels, and brain, where it can act locally as a paracrine or

intracrine factor (6). Aromatase is encoded by a single gene with a complex promoter,

 

and gonadal aromatase expression is regulated by CAMP and gonadotropins (7), while at
other sites it can be regulated by prostaglandins and cytokines (8).

Estrogens are oxidatively metabolized by specific cytochrome P4505, and the
metabolites retain varying levels of estrogenic activity depending on the oxygenation
position within the steroid ring (9). Certain unstable metabolites also possess mutagenic
activity and are implicated in carcinogenesis in estrogen target tissues (10). Cytochrome
P450 polymorphisms that affect the formation of reactive metabolites have also been

associated with cancer risk (1 1).

Estrogen receptors

The ER was first cloned in a human breast cancer cell line (MCF-7) more than 15
years ago (12). ERs were cloned soon after from numerous species, and phylogenetic
analysis of these sequences suggested that the ER is the ancestral steroid receptor, found
in all vertebrates, from which the other members (progesterone, androgen, glucocorticoid,
and minerallocorticoid) subsequently evolved (13). Moreover, the ERs from different
species were found to be highly similar in the ligand binding and DNA binding regions,
consistent with the critical importance of both ligand and DNA binding to the mechanism
of ER action.

The ER was renamed EROt following the discovery a decade later of a second
isoforrn, denoted ERB (14). The sequence similarity is quite high in the ligand and DNA
binding domains, and at the dimerization interface, and differs mainly in the N and C
terminal regions. A third receptor, ERy, has also been identified in fish (15), although no
homologous sequence has been identified in the human or mouse genome (16). The

length of EROt is well established (595 amino acids), whereas the extent of the ERB

protein sequence has been revised several times, and is now believed to most commonly
contain 530 residues (17).

ER crystal structures and predictions indicate that the ERs, as well as the ancestral
steroid receptor, all possess the critical binding pocket residues that accept estrogen and
discriminate against the 3-keto group of all other steroid hormones as well as the 17-
methylketo group of progesterone and corticoids (18—20). In the classic mechanism,
cytoplasmic ligand binding promotes a conformational change that exposes the
dimerization surface, and the liganded dimer can bind to specific response elements to

modulate transcription of target genes in the nucleus.

Estrogen response elements

The ancestral steroid receptor activated genes by binding to the same motif as
does the modern estrogen receptor, the estrogen responsive element (EREs; an inverted
repeat of the sequence AGGTCA separated by three unspecified residues), while the
other steroid receptors later evolved to interact with a distinct motif (a direct or inverted
repeat of AGAACA). The repeated sequence in nuclear receptor response elements is

important for the binding of the liganded receptor dimer (21).

Coactivators

A rapidly expanding area of research in the action of ERs and other nuclear
receptors has been in determining the identity and nature of key coactivators and
corepressors, which modulate the transactivational activity of the ligand-receptor dimer
complexes. The existence of coactivators was first suggested after a ‘squelching,’ or

damped response was observed when estrogen and progesterone receptors were

concurrently activated, suggesting that shared factors, present in limiting amounts, were
required for their action (22). Corepressors were first identified during efforts to explain
the repression of thyroid hormone transcription in the absence of ligand (23).

The specific nature of the assembled modulatory proteins that are recruited by the
ER is tissue-, ligand-, and receptor isoform-specific, and this area has been reviewed
extensively (e.g. (24, 25)). Since nuclear receptors act primarily as transcription factors,
corepressors typically act in the absence of ligand to block receptor-mediated
transcription. Certain coactivators, by contrast, can potentiate nuclear receptor-mediated
transcription by promoting chromatin accessibility and interactions with the basal
transcriptional machinery. In vitro methods such as yeast two-hybrid studies have been
instrumental in identifying numerous novel nuclear receptor-interacting cofactors (24,
26). Interestingly, ERa has recently been shown to be much more effective than ERB at
activating transcription on ERR-containing chromatin templates, which has been

attributed to the N ~terminal activation function (AF-1) of EROL (17).

Nonclassical ER signaling

A rapidly expanding area of study is broadly termed nonclassical nuclear receptor
signaling. ERs, like the other family members, have been reported to stimulate signaling
by numerous pathways that diverge from the classical ER-ERE-mediated signaling
pathway. For example, a subclass of non-nuclear, membrane-localized receptors has been
identified, which are believed to be responsible for many of the effects of estrogen that
are too rapid to be consistent with de novo transcript and protein synthesis. Ligand-
independent activation of nuclear ERs has also been described, as well as the ability of

ERs to influence transcription at non-ERE sites in association with other transcription

factors such as AP-l and Spl. This rapidly expanding area of research has been the
subject of numerous reviews (e.g. (27, 28)).

To contribute to the understanding of nontraditional modes of estrogen signaling,
a nonclassical ER knock-in (NERKI) mouse strain was developed. The NERKI mice
contain an ER that bears a mutation in the DNA binding domain that specifically
abolishes ER binding to DNA, therefore ablating the classical ER-ERE signaling but
retaining all other ER functions (29). Homozygotes do not survive, and heterozygote
females are viable but infertile. The uteri are enlarged and hyperplastic, with greatly
enlarged endometrial glands filled with secretory material, and uteri are in constant
diestrus and progesterone levels were reduced, though LH signaling is normal. Estrogen
is still able to induce epithelial proliferation and hyperemia. The severity of the
phenotype in the heterozygote, in particular compared to the EROLKO heterozygote (30),
is surprising. It indicates that nonclassical estrogen signaling is crucial to female
reproductive physiology, though uterine estrogen responsiveness is still preserved, and

that the classical and nonclassical pathways may interact in a complex manner.

OVERVIEW OF ESTROGEN EFFECTS IN THE UTERUS

Estrogen acts as an important regulator in numerous tissues, of which the uterus is
a prime example. Influences of circulating, ovarian-derived estrogen in the uterus of the
intact animal are difficult to discern, however, because of the confounding presence of
numerous other hormones and growth factors. As a result, a multitude of studies have
examined uterine responses to exogenous estrogens in rodent models possessing low
circulating estrogen levels either due to prepubertal age or to ovariectomy. These widely

used models have a dual purpose, being aimed at further elucidating the basic

understanding estrogen action or at evaluating the estrogen-like activity of other ligands
of interest (31).

In placental mammals, the embryo (trophoblast) implants in the maternal uterus
and is protected there until it is capable of surviving independently. Successful
implantation is therefore critical to reproductive success, and the carefully coordinated
uterine changes, stimulated by cycling and carefully controlled levels of ovarian estrogen
and progesterone, allow the trophoblast to penetrate the uterine epithelium into the
stroma (32).

Cyclic changes in the rodent uterus were first described in detail more than 80
years ago (33, 34), and in the decades since then, the understanding of these changes in
response to oscillating levels of circulating hormones has been greatly refined, though

many uncertainties still remain.

Uterine cell types

The uterus is a complex and highly specialized organ, composed of numerous
diverse cell types. Although there are some differences in structural organization between
primates and rodents, such as the dual uterine horns and multiple implantation sites in
rodents, and the menstrual shedding phase in primates, the cell types and compartments
overall are comparable between the species, and the utility of using rodents to model
human uterine responses is well established (35). Similarities and differences between
species have been reviewed extensively (36).

The intrauterine space, or lumen, is physically defined by the luminal epithelial
monolayer. Below this, underneath a basement membrane, lies the supporting stromal

layer, which is composed of fibroblast-like stromal cells as well as various lymphoid

 

cells. Numerous tubular glands lined with a specialized glandular epithelial layer
penetrate the stromal layer. Adjacent to the stroma, the outer region is the myometrial
region, composed of inner circular and outer longitudinal smooth muscle layers, which
together support uterine contractility. The outermost uterine lining is the serosal layer,
formed from a thin layer of fibroblast—derived mesothelial cells. As well the uterus is
highly vascularized, and therefore also contains numerous endothelial cells (36).

The endometrium, comprised of the epithelial and stromal layers, is functionally
distinct from the surrounding muscular myometrium. Within the endometrium, the
luminal epithelial cells regulate the capacity of the luminal walls to act as either a barrier
or as a receptive surface for embryonic implantation, the glands formed by invaginations
of the lumen into the stroma develop progressively during the uterine cycle and secrete
factors that are critical in promoting uterine receptivity and embryonic implantation (37),
and the stromal layer provides other crucial functions including structural support, growth
factor production, and immune protection (36). During estrogen-stimulated uterine
growth, the cell type composition remains relatively constant by volume, approximately
70% stroma, 10% luminal epithelium, 15% glandular epithelium, 5% endothelium, and a
small proportion occupied by uterine, glandular, and vascular lumens, as well as

interstitial space (38).

The reproductive cycle

The uterine cycle here refers to the menstrual cycle in primates as well as to the
estrous cycle in rodents. An overview of the nature of cyclic uterine changes is useful to

the understanding of the role that estrogen plays in uterine biology.

The uterus undergoes extensive cyclic changes in preparation for containing and
nurturing the developing fetus in the event of conception and implantation. Changes
involved in promoting uterine receptivity include proliferation and differentiation of
specific cell types, extracellular matrix (ECM) alterations, cell surface changes. and
immunological changes, and must occur in synchrony with the development of the
preimplantation embryo. Essential stimuli in these events are cyclic changes in estrogen
and progesterone levels, and their absence causes uterine regression and infertility (39).
An important role of estrogen is to stimulate proliferation of the epithelium of the lumen
and glands, while stromal proliferation requires the carefully timed and sequential

presence of both estrogen and progesterone.

The menstrual cycle

During the proliferative phase, rising estrogen levels stimulate intensive
endometrial cell proliferation and postmenstrual structural repair. At ovulation, ovarian
steroid production switches from estrogen to progesterone predominance. Progesterone
action is mediated through PRs in epithelial, stromal, and vascular cells, and induces
numerous changes in preparation for pregnancy, including stromal thickening and
differentiation to decidual cells, flattening of the luminal surface, and glandular secretion
of specific products. In the absence of conception and implantation, the outer endometrial
layers are shed and the endometrium then regenerates in preparation for a new cycle (40-

42).

The estrous cycle

The rodent estrous cycle has many features in common with the primate
menstrual cycle, though key differences in the rodent are the short duration (4-5 days)
and the lack of endometrial shedding. Analogous to the proliferative phase in humans,
proestrus and estrus are Characterized by rising estrogen levels and epithelial
proliferation, while progesterone dominates during the diestrus phase, inducing stromal
differentiation (35). As a result the physiological and biochemical features of the rodent
estrous cycle have been carefully studied, providing key insights into the responses to
estrogen exposure (43).

In the rodent, proestrus is marked by maximal LH levels, followed shortly after
by maximum estrogen levels in mid-proestrus, while FSH levels rise slightly and
progesterone levels are at their minimum. During this time, the luminal epithelial surface
is smooth and densely covered with microvilli. Glands are plentiful and protrude into the
uterine lumen, but the glandular openings are poorly developed and often blocked, and so
glandular secretions are scarce.

At estrus, the LH level is at its minimum and FSH briefly reaches its maximum.
Estrogen reaches a minimum in mid—estrus and then begins to increase, while
progesterone is low. The epithelium is proliferating maximally, and the epithelial cells
have reached maximal size and an elongated shape. The epithelial surface is no longer
smooth, and instead is characterized by deep folds and ridges. Microvilli and secretions
cover the epithelial surface, and pseudoglands, which are depressions caused by necrosis
or apoptosis of one or two cells beneath, and are not connected by a glandular duct to the

underlying stroma, are much more numerous than are fully formed glands.

10

 

 

In early diestrus, LH and FSH levels are low, estrogen again declines, and
progesterone reaches a maximum and then rapidly begins to decline. The epithelial cells
are diminished in size and the epithelial surface is nearly flat, and glands and
pseudoglands are becoming fewer and smaller. Microvilli are less dense. In late diestrus,
LH and FSH are at their minimum, estrogen is at a minimum and then begins to increase,
and progesterone decreases to a minimum. The epithelial surface is very flat, secretory
products are scarce, pseudoglands are regenerating into normal surface epithelium, and
glands are decreased in size. Epithelial cell height is minimal, microvilli are scarce, and

the overall appearance resembles a resting stage.

Circulating hormone levels

Ovarian steroids are produced primarily in the ovary, and ovariectomized mice
have undetectable levels of circulating estrogens and androgens. Although a basic
understanding of gonadotropin and estrogen synthesis is well established, recent studies
employing EROL, ERB, and double knockouts have allowed further refinement (Couse
2003). Hypothalamic gonadotropin-releasing hormone (GnRH) stimulates the anterior
pituitary to secrete luteinizing hormone (LH) and follicle stimulating hormone (FSH),
which act on the ovarian theca and granulosa cells respectively to promote estrogen (17B-
estradiol) synthesis from cholesterol and through several intermediates including
testosterone. Estrogen from the ovaries, in addition to acting on its numerous other
targets, negatively regulates further GnRH release. EROt was shown to be critical in
negatively regulating circulating levels of estrogen, testosterone, and LH, while FSH

levels are instead influenced by activin and inhibin levels. The role of ERB in regulating

ll

 

these hormone levels is minor, however ERB is implicated in the control of GnRH
secretion and of granulosa cell function.

Although uterine cells have been reported to express aromatase and to possess the
capability to synthesize estrogens (44), estrogen predominantly acts on the uterus in an
endocrine manner following secretion from the ovaries (16). Estrogen is very potent, and
serum levels are measured in pg/ml, compared with ng/ml levels of progesterone. Serum
estrogen levels vary from approximately 10 pg/ml at metestrus to 60 pg/ml at proestrus.
The peak at proestrus stimulates the LH surge, which is accompanied by FSH secretion.
and is rapidly followed by a surge in progesterone levels.

Although a major surge in estrogen levels during the uterine cycle is well
documented in numerous species, other aspects of estrogen secretion show distinct
variability between species. For example in humans, a sharp peak in estrogen release
immediately prior to ovulation is followed by a second peak in the middle of the luteal
phase, while in the rodent an estrogen surge is associated with late proestrus but other

spikes of estrogen secretion throughout the cycle are also observed (45).

Overview of responses to exogenous estrogen administration

Because of the confounding effects of the fluctuations of numerous hormones in
the intact animal, the responses modulated by estrogen in the uterus have typically been
studied using estrogen-treated noncycling (immature and/or ovariectomized) animal
models. 17B-estradiol and 170t-ethynyl estradiol are commonly used, and their responses
have been shown to be highly similar (46). The effects modulated by a single dose of
estrogen have been shown to encompass a large number of physiological processes, but

are roughly divided into two phases (47, 48). Phase I responses include increased uterine

12

vascular permeability and edema, as well as increased blood flow, CAMP production,
changes in electrolyte levels which drive water imbibition, and histamine release that are
evident by 6 hr after estrogen exposure. Phase 11 responses occur at approximately 24 to
30 hr after estrogen exposure and are particularly associated with dramatic increases in
epithelial and stromal cell size (hypertrophy) and cell number (hyperplasia) (48-50). The
phase II response is also characterized by large uterine glands containing secretory
products, by accumulation of uterine luminal fluid, by large interstitial spaces between
the stromal cells, by increased metabolic activity and increased RNA and protein
synthesis, by increased cytoplasmic volume and RER, and by immune cell recruitment
(38, 51-53). The volume fraction occupied by the epithelium, stroma, endothelium, and
extracellular space is unchanged, indicating that all endometrial compartments increase in
size uniformly during phase II (38). Interestingly, the stromal proliferative response is
greatly reduced as animals reach maturity, indicating that choice of model is important to
the results that will be generated (54). The mitotic response is maximal at approximately
24 hr after estrogen administration, and has returned to baseline levels by 36-48 hr (50,
55), while apoptosis in response to estrogen withdrawal has become prominent (56).
Continuous and unopposed estrogen exposure, by contrast, is associated with neoplasia,
with prolonged estrus in the cycling rodent, and in the developing rodent is associated
with abnormal uterine gland development, possibly due to an inability of glandular
epithelial differentiation and gland invagination into the stroma to keep pace with luminal
epithelial proliferation (36).

Many of the effects mentioned above have been studied for several decades, and

many are known to be mediated by the estrogen-ER signaling pathway. However, some

13

 

extremely rapid and likely nongenomic effects have also been observed, such as an
increase in the number of luminal surface microvilli within 30 s after estrogen injection,
and great increase in their number and density within approximately 5 min (57).
Although differences in uterine responses to estrogen can occur even between
different mouse strains (58), overall, the responses described above, including
proliferation (59), stromal edema (60), and immune cell recruitment, have also been
observed in estrogen-exposed humans, confirming the merit of the estrogen-treated

rodent model in discerning estrogen effects.

Nuclear receptor signaling

Estrogen receptor

EROt and ERB exhibit distinct tissue distributions, which have been well
characterized. Overall, EROL is predominantly expressed in the uterus, mammary gland,
liver, kidney, and heart, while ERB expression which is highest in the ovary and prostate,
but is also present in other tissues such as uterus (16).

Within the uterus, EROt (Eer) and ERB (Eer) are both expressed in the
epithelial, stroma], and vascular cells in a menstrual cycle-dependent manner that is
distinct for each isoform and has been recently described in detail (61). Estrogen has
recently been shown to affect Eer expression in a compartment-specific manner. In the
epithelium, estrogen administration causes a rapid (3-6 hr) decrease in Eer expression
that is not blocked by cycloheximide, and then an increase at 24 hr (62). By contrast,
Eer was rapidly upregulated in the stroma, while another report indicated that stromal

and endometrial Esrl levels were unchanged (63)

 

The specifics of the interregulation between EROL and ERB are not currently well
understood, though differences in the isoform ratio have been reported in uterine disease
(64). Furthermore, despite high sequence similarity between the two isoforms,
differences in their ability to activate transcription at specific response elements and in
complex with particular ligands have been reported (65). As well, in vitro ERB has been
shown to repress ERa—induced transcriptional activity (66, 67).

There are few documented cases of humans possessing mutations in the EROt or
aromatase genes, recently reviewed (8), and therefore targeted disruptions of the ER and
aromatase genes in mice have been particularly valuable in understanding the specific
role of these genes in estrogen action (16). The uterus of the EROtKO mouse is highly
hypoplastic, although it appears normal at the histological level (68). A marked aspect of
the EROtKO uterine phenotype is the absence of the uterine edema and increased uterine
weight that is normally observed in the early and late phase responses to three
consecutive daily estrogen doses (68), though after ten daily treatments a detectable but
submaximal induction of uterine weight has been observed (69). Heterozygotes
responded normally (68). Estrogen-induced mitogenic activity in the EROtKO uterus is
also much lower than in the wild-type, though still detectable (70).

Tissue recombination experiments, in which the uterine epithelium and stroma
from WT and EROtKO mice were recombined, showed that that luminal and glandular
epithelium proliferation depended on the presence of EROL in the stroma, suggesting that
the binding of estrogen to stromal EROt stimulates the production and release of factors
that stimulate mitogenesis of the adjacent epithelium (71, 72), which had been suggested

by much earlier in vitro studies (73). A similar study showed that estrogen stimulation of

 

stromal EROt results in downregulation of epithelial progesterone receptor expression
(74).

The uterus of the ERBKO mouse displays an exaggerated response to estrogen,
including hyperstimulated secretion and higher progesterone receptor and Ki67 levels,
suggesting that ERB normally acts to oppose some of the effects of EROL (75).

The similarity in uterine phenotype between the EROtBKO and EROLKO mouse
was expected, given the much higher levels of the or isoform normally present in that
tissue (76). The uterine phenotype of the aromatase knockout mouse, ArKO, was also
similar to that of the EROLKO mouse (77), consistent with the belief that estrogen is
required for uterine proliferation and differentiation.

Estrogen receptor-related orphan receptor ocl (ERROt; EsrraI) is a transcription
factor that can bind DNA at SF-l response elements (SFREs). Though it shares sequence
similarity with the ER, it does not bind estrogen (78). The transcript has been found to be
upregulated after 3x24 hr (three consecutive daily doses) estrogen exposure in the uterus
(79). Several downstream targets have been identified, including lactoferrin, osteopontin,
medium-chain acyl coenzyme A dehydrogenase (MCAD) and thyroid hormone receptor
(80), however specific ligands and roles are not currently known. Importantly, though,
ERRa has been found to also bind to EREs and to compete with ERs for coactivators,

which could profoundly alter ER-mediated signaling (81).

Progesterone receptor

Estrogen and progesterone signaling pathways interact in crucial and complex

ways to regulate uterine function. A key function of progesterone, however, is to modify

l6

 

the action of estrogen on the uterus by redirecting the proliferative response from the
epithelia to the stroma. Progesterone also antagonizes the inflammatory action of
estrogen by preventing the recruitment of leukocytes that is induced by estrogen (82).

Progesterone has been called the hormone of pregnancy, since maternal
production is crucial in all mammals for conceptus survival and development (83).
Progesterone acts primarily through the progesterone receptors PR-B and its shorter form
PR-A, which are transcribed from the same gene. PR-B is believed to be the dominant PR
isoform in the uterus, similar to how EROt is believed to be the dominant uterine ER
isoform, and furthermore the ratio of PR-BzPR-A can be associated with uterine
pathologies in the same way that alterations to EROtzERB levels can (64, 84).
Progesterone is widely considered to oppose the effects of estrogen, and in support of
this, the uteri of Pgr null mice show an exaggerated response to estrogen believed to be
due to the lack of progesterone signaling to depress the effects of estrogen. It is believed
that progesterone is able to repress the estrogen-stimulated epithelial response through a
mode that depends on stromal PR, and involves the repression of estrogen-inducible
stromal growth factor production (74).

Estrogen induction of PR (Pgr) expression is believed to be mediated by the
binding of both AP-l and E2-ER to a promoter region containing an adjacent AP-l site
and in imperfect ERE half-site (85). Stromal cells require progesterone in order to divide
(86, 87) and progesterone accelerates stromal transit through G1 to S. Progesterone in
conjunction with FGF induces stromal cyclin D1, comparable to the actions of estrogen

on the epithelial cells (88).

17

 

 

Interestingly, estrogen is required to prime the uterus for progesterone action in
the ovariectomized animal, since PR content is low until induced by estrogen. Estrogen
exerts both direct and indirect effects on Pgr expression, since estrogen has been shown
to directly induce Pgr in the stroma while indirectly downregulating epithelial Pgr by
means of stromal EROt (74). Furthermore, during pregnancy, the epithelium manufactures
numerous secretory products in response to progesterone despite a lack of epithelial PRs
during much of the gestation period, and paracrine signaling from the PR-positive stroma
in the form of progesterone-induced HGF, FGF7, and FGFlO, for which the epithelium
has receptors, has been suggested (83).

Pgr is expressed in the uterine epithelium in the absence of estrogen, while
estrogen has been shown to abrogate Pgr expression in the LE and upregulate it in the
stroma (89), which primes the uterus to respond to progesterone. PR-dependent actions of
progesterone in the uterus are described as opposing estrogen, since progesterone can
induce stromal cell proliferation, inhibit edema, and affect infiltration of immune cells in
various ways. Studies in PR null (PRKO) mice confirmed that PR is required for most
aspects of female reproduction, and the PRKO uterus is highly inflamed in response to

estrogen exposure.

Androgen receptor

Induction of the rodent uterotrophic response by androgens, which could be
inhibited by antiandrogens, was first reported several decades ago (90, 91). Estrogen-
induced uterotrophy could be blocked by antiestrogens but not antiandrogens, indicating
that the AR may be one of several downstream effectors of the ER that mediate uterine

growth.

18

A specific mechanism defining the importance of uterine androgens and androgen
receptor (AR) has recently been proposed (63). It was recently demonstrated that
estrogen exposure stimulates Ar expression in the uterine stroma and myometrium, and
this is believed to be achieved by the interaction of ER and AP-l at AP-l response
elements (63, 92). AR in turn induces IGF-I secretion, which stimulates epithelial cell
proliferation in a paracrine manner (63, 93). Furthermore, it was shown that estrogen-
induced luminal epithelial cell proliferation could be prevented not only by antiestrogen
administration but also by antiandrogen administration (63). Also androgens are able to
induce phase H uterotrophy in a manner similar to estrogen, although at high doses they
inhibit estrogen-induced phase I uterine edema and eosinophilia (94).

AR induces gene expression by binding to a specific response element (95),
however many genes have multiple response elements and in particular, some target
genes are common to estrogen and androgen. For example Igfl (93) and thioredoxin

(TxnI) (96) are each inducible through both ER and AR, with different kinetics.

Glucocorticoid receptor

Glucocorticoids are associated with growth repression, and their ability to inhibit
estrogen-induced uterine proliferation and function is believed to promote energy
conservation in stressful environments. Glucocorticoids appear to have little effect when
administered alone (97), but can prevent estrogen-induced uterine proliferation (97-101),
which may be due to its ability to decrease vascular permeability (102) and to the
attenuation of estrogen-stimulated induction of growth factors such as IGF-I (103). The

glucocorticoid receptor (GR) is expressed exclusively in the uterine stroma, particularly

l9

in fibroblasts and uNK cells, as well as in endothelial cells, suggesting its role in

decidualization (104, 105).

Retinoic acid receptor

Retinoic acid (RA) synthesis is stimulated at estrus in the uterine epithelium, and
is also observed following exogenous estrogen exposure (106). As a result, it is believed
that, since proliferation of the uterine epithelium is required only in the event of
pregnancy, the estrogen-induced stimulation of RA at estrus is to be prepared for
epithelial proliferation in the event of conception and pregnancy (107). Furthermore, in
other tissues retinoids have been found to promote epithelial cells to differentiate to
secretory phenotypes (108).

Retinoid signaling is controlled at several levels. Serum transport is effected by
retinol-binding protein (Rbp4), while cellular carriers include cellular retinol-binding
protein (CRBP; Rpr) and two cellular retinoic acid-binding proteins, CRABP-I and
CRABP-II. RA induces transcription primarily by heterodimers of the receptors RAR and
the multifunctional RXR, which transactivate genes after binding to RA-responsive
element sequences (109).

Levels of RAR and RXR have been shown to fluctuate only slightly in epithelial
and stromal cells during the uterine cycle (110), and therefore it is believed that
regulation takes place primarily at the levels of RA availability and metabolism. Crabpl
in the uterine stroma is induced transiently by estrogen (4-24 hr), while Crapr
expression in the luminal epithelium is sustained to 48 hr (1 l 1). Stromal Rbpl and Rbp4
expression, as well as retinol levels, are reduced following estrogen exposure (111).

Differences in regulation and function between Crabpl and Crapr have been studied

20

(106, 112), and only Crabp2 induction has been associated with acquisition of the ability
to synthesize RA from retinol (113). Transcripts for proteins involved in RA action,
including the cellular RA binding protein Crabp2, the retinol binding protein Rbp], the
RA biosynthetic enzyme Rdhl, and possibly the retinaldehyde dehydrogenase AldIzIaZ,

have also been reported to be induced at estrus (107).

Thyroid hormone receptor

It was first reported 25 years ago that estrogen-induced phase 11 responses could
be diminished in hypothyroid rats, and that the late responses could be restored by
thyroid hormone or iodide replacement (114, 115). It was further observed that thyroid
hormones were able to repress estrogen-induced edema and eosinophilia phase 1
responses (116). Although there have not been further studies concerning thyroid actions

in the uterus, crosstalk between ER and TR signaling has been recently reviewed (1 17).

Vitamin D receptor

There is little information available about vitamin D signaling in the uterus,
though estrogen has been reported to increase vitamin D receptor levels concurrently with
estrogen-induced uterine growth (118, 119). Though the significance is not well
understood, the estrogen-mediated control of calcium homeostasis has been suggested.
Vitamin D has also been reported to induce endometrial cell proliferation (120) and to

potentiate the estrogen-stimulated increase in alkaline phosphatase activity in vitro (121).

21

TRANSCRIPTIONAL EFFECTS OF ESTROGEN IN THE UTERUS

The numerous uterine changes in response to estrogen that are described above
are achieved in a variety of ways, but many are associated with changes in gene
expression either directly in response to estrogen-ER acting as a transcription factor or
indirectly due to an estrogen-induced changes in the levels or activity of other
transcription and growth factors. While a multitude of studies have identified and
examined transcriptional responses to estrogen in the uterus, the data have not been well
reviewed and summarized. Given the recent interest in using large-scale microarray
studies to examine estrogen-induced changes in uterine gene expression (122-125),
subsequent attempts at the biological interpretation of these large data sets is extremely
challenging, and a review of knowledge to date in this area is timely. This review is of
benefit both to those seeking to appreciate the effects of estrogen action in the uterus, and
to serve as a baseline for those aiming to evaluate the estrogen-like properties of

exogenous compounds.

DNA, RNA, and protein synthesis

The remarkable extent of the estrogen-induced uterine proliferative response must
be supported by the rapid induction of mitosis and of proteins that physically direct and
support growth. Consequently, a swift and coordinated increase in available precursors

for DNA, RNA, and protein synthesis must be mounted.

DNA synthesis

Estrogen stimulates DNA polymerase activity in the uterus (126), and DNA

polymerase 0t (Pola) expression levels have been shown to be estrogen inducible by 6 hr

22

 

in MCF—7 cells, by the interaction of Spl and liganded ER at an upstream Spl site (127).
Recent microarray studies have identified numerous other estrogen-regulated genes that
are involved in the DNA replication machinery (128). DNA synthesis has been shown to
be stimulated only by long-acting estrogens that are retained for at least 15 hr, such as E2.
A short—acting estrogen such as the metabolite estriol is not able to potently induce
uterine DNA synthesis unless it is administered again during a critical period 9-15 hr
after the initial exposure (49, 129). This long period of stimulation required to induce
uterine DNA synthesis, an important effect of estrogen, may be crucial in explaining the
apparent disparity with some rapidly inactivated ligands in their ability to rapidly induce
ER-mediated gene expression in vitro but their inability to induce uterine growth in vivo.
Maintenance of a nucleotide pool for DNA and RNA synthesis is critical to cell
growth, and while not all associated transcripts have been studied in the estrogen-
stimulated uterus, they are believed to be characteristic features of that and other
proliferative events. For example thymidine availability is essential for cell proliferation,
and its removal in cultured breast cancer cells causes cell cycle arrest that can be relieved
by the addition of estrogen (130). Thymidine kinase is critical in the pyrimidine salvage
pathway, catalyzing formation of dTMP from deoxythymidine. High levels of activity are
associated with rapidly proliferating tissues, and increased thymidine kinase activity and
increased thymidine incorporation in response to estrogen are concurrent and well
established responses to estrogen in the uterus (131). Activity of the cytosolic isozyme
(Tkl) is highly induced 24-36 hr after estrogen exposure, while induction of the
mitochondrial form (Tk2) is slight during the same period (132). At the transcriptional

level, the induction of Tkl (133) and adenosine deaminase (Ada) (134) by estrogen is

23

well established in MCF-7 cells, and the involvement of EREs and of ER-Spl
interactions, respectively, have been established. Thymidine phosphorylase (platelet-
derived endothelial cell growth factor; Ecgfl) expression, which is associated with cell
cycle arrest and angiogenesis (135, 136), was reported to be inversely correlated with
estrogen levels (135, 137). Several other responses may also be associated with
transcriptional changes in the uterus that have not yet been studied. The activity of
aspartate carbamoyltransferase (Cad), a multifunctional enzyme of de novo pyrimidine
synthesis, is also induced after estrogen exposure, while uridine kinase activity is
unaffected and is believed to be present in excess in the unstimulated uterus (138).
Estrogen has long been known to stimulate the covalent modification of histones
(139), which can facilitate transcription (140). Estrogen also rapidly stimulates protein
synthesis of histones and high mobility group chromatin proteins, and maximal levels (9
hr) are reached several hours before DNA synthesis begins (14]). Histone transcript
levels, by contrast, lag behind protein levels, beginning to increase at 9 hr and reaching
maximal levels at 18 hr (142). While the mechanism by which estrogen stimulates uterine
histone transcription is not known, the increased transcript levels just prior to the
beginning of S phase is comparable to that observed in HeLa cells in vitro (143).

Unfortunately, the specific histone transcripts remain to be identified.

RNA synthesis

An early observation in the estrogen-stimulated uterus was the selective synthesis
of numerous distinct transcripts (144). In the uterus, estrogen administration is associated
with a burst in RNA PolII activity within all uterine cell types, and a subsequent increase

in the ratio of RNA to DNA in all major uterine cell types ( 145). In the classical mode of

24

 

estrogen action, the estrogen-ER complex acts as a transcription factor to induce the
expression of numerous key ERE-containing genes. While this mechanism of action has
been highly studied and reviewed, some important recent advances in this area have
focused on alternate modes, such as through associations with AP—l and Spl and with
alternative response elements (28). In addition, intensive efforts have been focused on
identifying the nature and consequences of coactivator and corepressor interactions with
the transcriptional complex recruited by estrogen-ER. Alterations in the expression of
relevant coactivators and corepressors in the estrogen-stimulated uterus are not yet well
characterized, although their levels and localization during the uterine cycle have recently
been shown to be complex. For example, mRNA levels of the coactivator SRCl and the
corepressors SMRT and NCoR have been shown to vary during the human and rodent
uterine cycle in a cell type—specific manner, while CBP/p300 levels were found to be
constant (146, 147).

The estrogen-induced uterine expression of transcription factors, which can in
turn act as effectors of estrogen action by modulating the expression of numerous target
genes, has been highly studied (148-153). Results suggest that these gene products play
key roles in the early phase uterine growth promotion induced by estrogen (154), though
short-acting estrogens are able to induce immediate early gene expression (Fos, Jun,

Myc) without being able to stimulate later DNA synthesis ( 129, 155).

AP- 1

Members of the F05, Jun, Jun dimerization partner (JDP), activating transcription
factor (ATP), and Maf families can homo- or heterodimerize in specific ways to form the

AP-l transcription factor, which activates gene expression at response elements that

25

 

depend on the components of the dimer. AP-l components are transcriptionally induced
by numerous diverse stimuli, including several growth factors and cytokines, and the
complex nature of their regulation and roles in cell cycle progression have been recently
reviewed (156).

Fos can be upregulated by a downstream ERE sequence (157), and shows rapid
and well-characterized transcriptional inducibility and short half-life in the uterus (150,
158). Estrogen rapidly induces Fos expression specifically in the luminal and glandular
epithelia (155), while other fos-related genes (fra—l, fra-2, and fos B) have not been
detected (158). Transcriptional regulation of Jun family members by estrogen is also
complex and cell type-specific. For example, estrogen induces a rapid increase in jun-B
(Junb) and jun-D (Jund) expression mainly in the epithelial cells, while inducing cvjun
(Jun) expression in the myometrium and repressing it in the epithelium (159). Temporal
expression is also subtype specific, with Jun being induced most rapidly (within 30 min),
followed shortly after by Jund and then Junb (160). In addition to inducing the
expression of Fos and Jun family members, the ER can affect AP-l mediated signaling

by interacting directly the Jun or Junb subunit of AP-l (161).

mg

Myc plays a central and highly complex role in pathways regulating G]
progression, differentiation, and apoptosis, with many features that are currently not
understood (162, 163). The heterodimeric transcription factor Myc/Max typically binds to
motifs termed E-boxes (5’-CACGTG-3’), and regulates transcription of numerous target
genes involved in cell proliferation, while alternate Max binding partners (e. g. Mad, Mxi)

block these responses, though the mechanism is now believed to be more complex (164).

26

 

Direct targets have recently been shown to include cyclins and cyclin-dependent kinases
(165), and numerous other well characterized responses of importance to estrogen
proliferation include Myc-mediated induction of Cch5a (166), omithine decarboxylase
(0dc1) (167), and the E2F transcription factors, and repression of growth arrest gene
Gas] and of cell cycle inhibitors such as p15, p21, p27 (168). Microarray studies are now
identifying numerous other targets (169 , 170 , 171).

Myc transcription is upregulated by numerous mitogens, and in the uterus rapid
upregulation in response to estrogen is specifically associated with the cell types that
have been stimulated to divide (172). Uterine N-myc (Mycn) expression can be observed
within minutes after estrogen administration, while Myc expression increases after 2-4 hr

exposure and then again after 28 hr (148, 173 ).

ELF

Transcriptional regulation of E2F genes has not been reported to date in the
estrogen-stimulated uterus. However these factors have been shown to be critical to Gl/S
progression (174, 175), and E2f1 has been shown to be estrogen inducible in vitro by a

mechanism dependent on ER and Spl (176).

Protein synthesis

Estrogen not only promotes protein synthesis indirectly by inducing the
transcription of genes involved in estrogen action, but has several other actions as well.
Activation of numerous tRNA synthetases in the estrogen-exposed uterus is almost
immediate (177), and is followed by a very rapidly (1-2 hr) induced rate of mRNA

translation (178, 179). In addition, later accelerated formation of ribosomes and increased

27

amounts of tRNAs (178) have been observed. All of these factors contribute to an
enhanced capability of the stimulated uterus to synthesize proteins, and it is believed that
the mRNA, rather than translational components, is the rate limiting component in uterine
growth responses following estrogen stimulation (178).

Heat shock proteins (HSPs) can act as chaperones to promote correct protein
folding. They also associate with unliganded ER and are believed to repress transcription
while promoting ligand binding (180). A recent model describes the association of
unliganded ER with a ‘foldosome’ complex composed of a specific arrangement of HSPs
40, 60, 70, and 90 (181). The expression of several HSPs in response to estrogen
stimulation in the uterus have been described. HSP70 and HSP90 have been found to be
upregulated in the myometrium during the proliferative phase (182), while expression of
an HSP70 (183), of the HSP90 isoforms Hsp86-I and Hspcb, and of the glucose
regulated chaperones GRP94 (TraI) (184) and GRP78 (BiP; Hspa5) (185) have been
shown to be upregulated in the rodent uterus within 4-18 hr after estrogen exposure.
Induction of HSP expression is typically achieved by stimulation of the heat shock
transcription factors (HSFs), and Hst and Hsf2 have themselves been shown to be
upregulated in the uterus by estrogen within 6 hr after administration (186). Regulation
by estrogen of Hsp27 has not been well studied in the uterus to date, however protein
levels have been shown to be induced by estrogen in glandular epithelial cells (187), and

to be induced by estrogen through cooperative binding of ER and Spl (188).

Proliferation

It is been established for several decades that estrogen is able to rapidly recruit

quiescent uterine cells to enter the cell cycle (189), with 50% of cells in the luminal

28

 

epithelium in mitosis by 24 hr after estrogen exposure (38), similar to the proportion of
MCF—7 cells in S phase after 24 hr estrogen treatment (190). As a result, the estrogen-
stimulated uterus has been used by some investigators as a model system to examine cell
cycle entry and progression in an intact system. Current understanding of the mechanisms
by which estrogen stimulates cell cycle entry and progression is based on a variety of
systems, particularly estrogen-treated cultured cells. Research on the molecular
mechanisms governing cell cycle control continues to be extensive, and to be supported
and extended by large-scale microarray studies (e.g. (191—196)), and while many
pathways have been clarified, differences clearly exist in different cell types and
environments.

Uterine cell proliferation (hyperplasia) is a classic response to estrogen exposure,
and excessive stimulation by estrogen has also been implicated in uterine abnormalities,
infertility, and cancer (99). Abnormal uterine gland development in response to chronic
estrogen stimulation is believed to be due to the rapid rate of epithelial proliferation
outpacing and physically preventing the normal formation of glandular invaginations, as
well as a reorientation of mitosis to be perpendicular to the basement membrane, which
promotes the formation of glandular growths that are associated with precancerous
changes (99). Furthermore, hyperplasticity itself can be associated with an increased risk
of dysplasia (abnormal growth and cancer). Interestingly, expression of proliferating cell
nuclear antigen (Pcna), which is a DNA polymerase processivity factor essential for
DNA replication and which is induced approximately 24 hr after estrogen exposure, has
been found to be an ineffective indicator of uterine proliferation, since it is also highly

expressed during estrogen withdrawal-induced apoptosis ( 197).

29

 

Estrogen stimulation is known to be required throughout G. (198), while in vitro
it has also been demonstrated that late G], Gl/S, and G2 are refractory to estrogen
exposure (130). A key effect of estrogen exposure is the dramatic shortening of G1, which
decreases from approximately 100 hr to 15 hr in the immature mouse (54). While earlier
models suggested that estrogen-induced uterine mitogenesis is mediated solely or
primarily by autocrine growth factor secretion, it has now been shown that estrogens can
also promote G1 progression directly by activating cell cycle genes or indirectly by
activation of the ras-MAPK pathway. Consequently, a growing number of pathways by
which estrogens can promote G. are being identified, which may serve to potentiate the

estrogen induction of cell cycle progression.

Cell cycle progression

It has been shown in vitro that estrogen treatment causes a rapid activation of
responses associated with preparation for the GI/S transition. These include activation of
Cdk4 and Cyclin E-Cdk2, hyperphosphorylation of pRB, and increased cyclin D1
(CcndI) and Myc transcript and protein levels within the first 3-6 hr (190, 199). Cyclin
D1 and Myc by different mechanisms activate cyclin E—Cdk2, which then associates with
hyperphosphroylated p130 (199). Numerous other recent studies have identified direct
actions of the ER, in the presence or absence of ligand, on the activity of integral
mediators of cell cycle progression (e. g. (200-203)).

Many of the complex responses stimulated by estrogen that promote uterine
proliferation are reflective of transcriptional changes. In particular, the cyclins act as the
regulatory subunits of the cyclin-Cdk complexes, and are transcriptionally regulated by

numerous stimuli. Cyclin levels are closely linked to cell cycle progression, and they

30

 

therefore have short half-lives and are rapidly degraded by a ubiquitin-dependent
pathway. A highly studied example is Ccndl, which is expressed in most cell types and is
induced rapidly during G by stimuli such as estrogen (204). Estrogen induces Cyclin D1
expression and activity by numerous diverse pathways (205). Interestingly, in addition to
interactions with Cdks, Cyclin D1 has also been shown to potentiate ER-induced
transcription in vitro by directly binding to at least one ER coactivator (206).

In the estrogen-stimulated rodent uterus, Ccnd2 was found to be induced most
highly and rapidly, at 1—8 hr after exposure, while Ccnd3 was also induced at
approximately 2-8 hr, and CcndI was only slightly induced, at approximately 8-24hr. The
functional significance of the differential regulation of the D-type cyclins is not currently
known, though the existence of single and double knockouts is assisting in this (207).
Cyclin E (which could be Care] or Ccne2) was induced slightly at 8-24hr, while cyclin A
(which could be Ccnal or Ccna2) was highly induced at 24hr, and more modestly at
other times in the 16-28hr range (208).

Estrogen-responsive finger protein (Efp; Zinc finger protein 147; Trim25) is a
ubiquitin ligase of the tripartite motif (TRIM) family, and is able to degrade 14-3-30'
(an; also known as Stratifin or Tyrosine 3-monooxygenase/tryptophan 5-
monooxygenase activation protein 0'), a factor that promotes cell cycle arrest in G2 (209).
Trim25 is expressed in the uterine luminal epithelium (210), is rapidly induced by
estrogen exposure, and is critical to estrogen-induced endometrial proliferation and water
imbibition responses (211). EROt and Trim25 have been shown to colocalize, and the
Trim25 genomic sequence contains an ERE motif (210). Targeted TrimZ5 disruption

results in underdeveloped uteri, decreased response to estrogen, and decreased proportion

31

 

of uterine cells reaching S phase and beyond (211), although the phenotype is not as
severe as in the EROt null mouse.

Importantly, estrogen is concurrently able to suppress transcription of cell cycle
inhibitors. For example, the growth arrest specific gene Gas], which blocks S-phase
entry and is actively transcribed in the unstimulated uterus, is suppressed in a rapid and
prolonged manner following estrogen exposure (212). However, the cell cyclin inhibitor
p27 is localized to the uterine stroma in the adult rodent, which may help to explain why
stromal cells to not proliferate extensively in the adult in response to estrogen (213).

Telomerase (Tert) is a ribonucleoprotein polymerase containing a short RNA
template (Terc) that directs synthesis of telomeric repeats at chromosomal ends to prevent
telomere shortening. While most normal somatic cells are not associated with telomerase
activity, those with high regenerative potential, including the late proliferative phase
endometrium, can express high levels. In the cycling uterus, Terc expression was found
to be highest in proliferating glandular epithelial cells (214). Although Terc was not
induced by estrogen in uterine epithelial cells in vitro, expression of the catalytic subunit
Tert has been shown to be stimulated in MCF-7 cells by estrogen both directly at ERE

and ERE/Spl elements, and indirectly by estrogen-induced Myc (215).

Peptide growth factors

The importance of growth factors in uterine growth and the crosstalk in signaling
between growth factors and the ER is well established, but many aspects remain poorly
understood. It has long been established that growth factor overexpression can stimulate
uterine growth and reciprocally that defects in growth factors signaling can result in

hypoplasia, as will be described below.

32

 

It was long believed that all or most of the actions of estrogen on the uterine
epithelium were mediated by the direct action of estrogen in this cell type. However,
recent evidence indicates that many vital actions of estrogen on the epithelium are
mediated by stromally derived paracrine factors. First, it was observed that estrogen was
still able to induce uterine epithelial proliferation in neonatal mice, which lack epithelial
ERs (216), and a paracrine growth response emanating from within the ER-positive
stroma was suggested. Another important advance in this area came with the
development of uterine tissue recombinants differentially possessing epithelium and
stromal from wild-type or EROt knockout mice (71). Using these recombinant tissues it
was possible to differentiate between responses mediated through epithelial vs. stromal
ERs, and it was demonstrated that induction of epithelial proliferation was a paracrine
event requiring EROt-positive stroma, whereas epithelial EROL was not necessary or
sufficient to permit estrogen-induced epithelial proliferation. Epithelial-stromal
interactions have also been shown to be critical to growth in uterine cells in vitro (217,)
and in other tissues in vivo (218-220).

It has now been demonstrated that numerous secreted factors can induce epithelial
cell proliferation, and their involvement is discussed in the following sections. While
the roles of growth factors in the uterine response to estrogen are not fully understood,
factors such as EGF, FGFs, and PDGFs have been termed ‘competence factors‘ due to
their ability to stimulate quiescent cells to enter G1 (221, 222), while IGF—l has been

characterized as a G2/M progression factor (223).

33

 

EGF and TGFOt

Epidermal growth factor is a member of the EGF family of ligands, which also
includes TGFoc, HB-EGF (heparin-binding EGF; DTR), amphiregulin, epiregulin, and
heregulins. EGF functions as a progression factor, and can act as a potent mitogen in
certain cell types. Like other growth factors, EGF binding to its membrane receptor
(EGFR; ErbBl) induces dimerization and intrinsic receptor tyrosine kinase activity,
which in turn induces phosphorylation cascades involving PLCy, MAPK, and the Ras
GTPase-activating protein (GAP). These signaling pathways can then induce expression
of immediate early genes such as Fos, Jun, and Myc (206), Card] (224), and other genes
involved in further transcription and in adhesion, such as actin (225) and tyrosine
hydroxylase (Th) (226). Heterodimerization to other EGFR family members (ErbB2-4)
may produce other distinct actions (227).

EGF rapidly induces DNA synthesis in all major uterine compartments, and
estrogen-induced uterine proliferation can be repressed by coadministration of an EGF
antibody (228). Furthermore, proliferation induced by either EGF or estrogen can be
blocked by coadministration with antiestrogen (229), and is absent in the EROtKO mouse
(230). Experiments in ngr null mice were able to demonstrate the paracrine signaling of
EGF (231). This study revealed that the epithelium was not a direct target for EGFR
ligands, in contrast to previous findings in vitro (232). ngr is induced rapidly in the
uterus (233, 234), in particular in the stroma and myometrium (235), and deficiency is
associated with severe hypoplasia due to an inability of estrogen to elicit growth of the
stromal cells. The predominant localization of ng itself to the epithelium (236), suggests

that in response to estrogen, newly synthesized ng in the epithelium either translocates to

34

the stroma to induce EGFR-mediated stromal growth, or else may interact with epithelial
ErbB2. Erbb2 expression is induced in the epithelium in response to estrogen and may be
involved in epithelial proliferation (237).

Recent research has shown crosstalk between estrogen and EGF signaling to be
highly complex, which has been recently reviewed (238). In addition to estrogen
stimulating expression of ng and its receptor, estrogen and EGF interact in other ways.
In particular, the EGF pathway can induce phosphorylation of ER or its coregulators to
alter its activity, and in the nucleus has even recently been shown to be directly
associated with the CcndI promoter (239). As well, the estrogen signaling pathway can
induce specific matrix metalloproteinases by a nongenomic mechanism, and these can
activate HB-EGF, which then binds to and activates EGFR (240).

Transforming growth factor 0t is a member of the EGF ligand family, and is able
to bind to EGFR (241). Tgfa transcript levels in the epithelial and mast cells are
stimulated in the uterine epithelium by 6 hr following estrogen exposure, and the protein
is secreted in the uterine luminal fluid at much higher levels than is EGF (242).
Overexpression of Tgfa in vitro is associated with enhanced proliferation (243), while
transgenic mice overexpressing Tgfa exhibit increases in estrogen-induced uterine
hyperplasia (244) and delayed implantation (245). Furthermore, administration of
antibodies to TGFOL significantly reduces estrogen-induced uterine growth (242). The
significance of the estrogen-mediated induction of two EGFR ligands (i.e. EGF and
TGFOL) is not clear, although TGFOL has been reported to be more potent, and both are

able to induce Tgfa expression in vitro (246). This overlapping function is consistent with

35

the lack of severe reproductive phenotype in the Tgfa null mouse (247). TGFOL is also

associated with stromal decidualization and embryo implantation during pregnancy (248).

IGFs

The role of insulin-like growth factors and their binding proteins in female
reproductive function have received much attention (249). IGF-I is believed to be the
dominant IGF in the reproductive tract, and to exert most of its effects through the
membrane type I receptor (IGFlR). Strong evidence also suggests that IGF-I acts a
paracrine factor produced in the stroma and acting on IGFlR in the epithelium to induce
mitogenesis, though recent data suggests that systemic IGF-I levels are sufficient and that
local synthesis is not required (250). The importance of IGF-I in uterine function was
strongly suggested by numerous lines of evidence, including the colocalization of
estrogen-induced Igfl expression and cellular proliferation (251) and the hypoplastic uteri
of the Igfl null mouse (252). The known roles of IGF-I in uterine function have been
recently reviewed (253).

The single IGF-I protein can be encoded by different transcripts that are subjected
to complex differential regulation (249). IgfI has been shown to be regulated by
numerous pathways, including directly by estrogen—ER in the uterus (253, 254). Uterine
expression of Igfl is induced by estrogen primarily in the epithelium, while it is induced
by progesterone and androgen primarily in the stroma (255).

Targeted disruption of the mouse Igfl gene has demonstrated that IGF-I plays a
critical role in G2 progression, consistent with the observed reduction in cell size in the
null mouse. In addition, the lack of apoptotic response to uterine estrogen withdrawal in

the IgfI null mouse has been proposed to be due in some way to a lack of completion of

36

 

the mitotic cycle (223). Furthermore, it was then shown that IGF-I, like estrogen, can
elicit a uterine proliferative response that depends on the presence of EROt expression,
and that these two pathways crosstalk in vivo, since IGF-I can induce ER-mediated
transcription in the absence of estrogen. It has been proposed that activation of EROt by
either E2 or IGF-I is essential for uterine proliferation (256). However, IGF-I is not
required for the induction of epithelial cell height or expression of lactoferrin (Ltf) or Pgr
(250).

IGF-I is considered to be one of several estromedins (i.e. mediators of estrogen
signal) during the proliferative phase, acting as a mitogenic stimulus to effect rapid
endometrial growth, while IGF-H is highly expressed in the mid-secretory phase, and is
suggested to be a progestomedin acting on the stroma. IGFlR is expressed primarily in
the glandular epithelium with lower amounts in stroma; since IGFs are expressed by
stroma, they are believed to participate in both stromal proliferation (by autocrine
mechanisms) and in epithelial proliferation (by paracrine mechanisms) (42). IGF-II is
believed to be involved in stromal differentiation, and to be induced by progesterone
(253).

The receptors IgfIr and Igf2r are both expressed in the endometrium,
predominantly in the LE and GE, although IGFlR is believed to be the isoform that
mediates IGF-I signaling (253). Receptor levels do not appear to fluctuate in the uterine
cycle, indicating that control is at the level of the IGFs and IGF binding proteins
(IGFBPs).

The actions of IGFs can be modulated by interactions with a diverse class of high

affinity insulin-like growth factor binding proteins (IGFBPs). By competing with the IGF

37

receptors for IGF binding, they are able to influence IGF availability and thus its
signaling potential, while their proteolysis reduces their ability to sequester IGF (249).
The subcellular localization of the IGFBPs during the uterine cycle has been recently
reviewed (249), and their patterns of expression and regulation appear to be very
divergent. Igfbp] has been shown to be repressed by estrogen and induced by
progesterone, and estrogen exposure is associated with decreased Ig/bp3 and increased
Igfbp4 expression (257). Progesterone, by contrast, has been shown to induce stromal
Ig/bpl production and decrease IGF receptor levels during the secretory phase, which
then decreases IGF-I bioactivity to inhibit stromal growth and promote differentiation
and decidualization (249). Furthermore, mice overexpressing Igfbpl, which localizes to
the epithelium and to luminal secretions, exhibit an impaired uterotrophic response to

estrogen, IGF-I, and EGF, attributed to a reduction in the availability of free IGF-l (258).

TGFB

The three transforming growth factor B isoforms are involved in a highly complex
array of distinct and overlapping biological effects, including effects on regulation of cell
growth and differentiation, apoptosis, angiogenesis, immunomodulation, and ECM
formation, and the numerous null mutants that have been generated are greatly furthering
this knowledge (259). TGFBs have been recently shown to have numerous direct effects
on cell cycle regulatory components (206).

Transduction of TGFB signaling, following receptor binding and phosphorylation,
is mediated by Smad cascades, which act to regulate expression of numerous target genes
(260). Several modulators of TGFB signaling have also been shown to have altered

expression in the uterus in response to estrogen. For example, repression of Ski

38

expression by estrogen in the uterine epithelium has been observed as early as 2-6 hr after
exposure (261). Ski has been identified as a corepressor of Smad signaling, stabilizing the
association of other corepressors and histone deacetylases in the absence of the
TGFB signal (262, 263). Jun has also been shown to cooperate in this mechanism,
following activation of the JNK signaling pathway. Furthermore, Myc has been shown to
bind to Spl-Smad complexes thereby preventing transcription of Spl and TGFB targets,
such as the cell cycle inhibitor p15 (264).

Tgfb2 is rapidly induced in the estrogen—stimulated rodent uterus, either
transiently (265, 266) or in a sustained manner, and the protein is also detected in the
uterine luminal fluid (267). Tgfb] shows a similar pattern of expression to Tgbe (265).
Tgfb3 was found to be unaffected in the uterus, although it has been shown to be induced
by ERor in a ras-dependent manner (266, 268). Protein levels of all three are induced in a
sustained manner following estrogen exposure (265).

Estrogen withdrawal in the mouse is associated with epithelial apoptosis and
markedly increased expression of the TGFB receptor Tgfer. Epithelial apoptosis can be

alternatively induced by stromal administration of exogenous TGFB] (269).

FGFS

Fibroblast growth factors are a large family of polypeptides with roles in cell
proliferation, migration, implantation, and other processes. They bind heparan sulfate
proteoglycans with high affinity, which assists in their activation of surface FGF receptor
tyrosine kinases, a receptor family with complex patterns of altemativeisplicing that yield

specificity for specific FGF family members (270).

39

F gf9 expression has been studied in detail, and is localized mainly in the stroma.
along with its high-affinity receptors (271). FGF9 was also shown be necessary in the
induction of stromal proliferation and be induced by estrogen, implicating FGF9 as an
important effector in linking the rising levels of estrogen signal in the late proliferative
phase to the subsequent rapid endometrial proliferation (271). Similarly, the stromally
associated keratinocyte growth factor (KGF; Fgf7) in the uterus can be induced by
estrogen (272), and has been shown to highly induce uterine epithelial proliferation and
surface changes (273), although the role is not critical since Fgf7 null mice are
reproductively normal (274). Basic FGF (Fgf2) expression has also been shown to be
elevated rapidly following estrogen exposure, although induction by progesterone was
more pronounced (275). In the sheep uterus, Fgf2 expression has been localized to the
endometrial glands in response to estrogen (8-24 hr), and is thought to be involved in the

uterine angiogenic response (276, 277).

VEGF

Vascular endothelial growth factor A was first discovered as a vascular
permeability agent, but is also recognized as an important inducer of endothelial cell
proliferation, migration, and differentiation. Vegfa has multiple splice variants that give
rise to different isoforms, but in most species VEGF165 is the more potent endothelial cell
mitogen and the dominant variant in the uterus (278). Most VEGF isoforms can bind to
the ECM through heparin-binding domains (278). The VEGF glycoprotein is active when
associated with dimerized surface receptor tyrosine kinases, Flt-1 and Flk-l, which are
localized on endothelial cell surfaces. These activated receptors activate signal

transduction pathways to stimulate cellular migration and endothelial cell mitosis

40

respectively. Recently VEGF165 has also been shown to bind to the neuropilins NRPl and
NRP2, surface receptors that are differentially expressed in the uterine endothelial and
glandular epithelial cells (278). The functional significance of VEGF associations with
neuropilins is not yet well understood, but it has been suggested that neuropilins act as
coreceptors along with Flt-1 or Flk-l to enhance their action (279).

Vegfa is expressed in cells lining the endometrial and myometrial vessels as well
as in neutrophils and macrophages, as reviewed in (276, 280). Other angiogenic factors,
including Vegfc, are expressed in uNK cells. In vitro, Vegfa induction by estrogen has
been shown to be mediated by both ERoc and ERB, while Vegfc is repressed. Many
aspects of the control of VEGF family expression in the uterus are not currently well
understood, although there appear to be great cell type-specific differences (281). In
whole uterine studies, the rapid induction of Vegfa expression in response to estrogen is
very well studied (282). Recent comprehensive studies with knockouts including EROt
and PR null mice, however have given rise to the suggestion that Vegfa is primarily
progesterone-induced, since stromal expression of Vegfa and its receptor VEGF receptor
2 (Flkl) is inducible by progesterone alone, and is preserved in the PRKO and abrogated
in the EROtKO (282). Additional studies with an F [k] null mouse indicated that estrogen
inhibits, while progesterone stimulates, uterine angiogenesis, and that estrogen is able to
inhibit the effect of progesterone, furthermore that these responses could be eliminated by
specific ER and PR inhibitors respectively (282). Similarly, estrogen inhibits while

progesterone stimulates uterine Nrpl and Nrp2 expression (278).

41

 

 

PDGF

Platelet—derived growth factor consists of homo- or heterodimers of PDGF
isoforms that display distinct functional properties and affinities for the PDGF receptors.
Estrogen rapidly induces expression of Pdgfa and Pdgfb, as well as of the receptors
Pdgfra and Pdgfrb, in the uterine epithelium and stroma (283). PDGF has also been
shown to stimulate stromal and myometrial cell proliferation in vitro (284 , 285). The
important role of PDGF in uteine leiomyoma cell cycle progression has also been well

characterized (286).

TNFOL

 

Tumor necrosis factor or is a pleiotropic cytokine produced by numerous cell
types, and with many important roles in reproduction that are modulated by interaction
with two TNFRSFl receptor isoforms (287). Tnfa is expressed in many cell types,
including all uterine leukocyte types, although estrogen regulation has particularly been
studied in uterine mast as well as myometrial cells (288, 289). TNFOt is also a component
of secreted uterine fluid (290). In MCF—7 cells, TNFOL administration inhibits estrogen-
induced G1/S phase progression (291).

Transcriptional regulation of Tnfa appears to be complex. Tnfa expression in the
mouse uterus is rapidly induced (1—6 hr) by estrogen in the epithelium, and then later is
localized to both the epithelium and stroma (72 hr) (292). Estrogen withdrawal is also
associated with induced epithelial Tnfa expression in vitro, and TNFOt can also induce its
own synthesis (293). Epithelial and stromal transcript levels of the receptor Tnfrsfla have
also been shown to be elevated 24 hr after estrogen exposure or after prolonged

progesterone exposure (294).

42

 

In addition, uterine transcript levels of the TNFor-induced protein 6 (Tnfaip6)
have been shown to be highly elevated at 8 hr after estrogen stimulation (183). Tnfaip6 is
a member of a secretory hyaluronan binding protein family that can be rapidly
transcribed in response to TNFOL or ILlB, which can potentiate the binding of AP-l to its
response element, and by the active isoform of NF-IL6 (CCAAT/enhancer binding
protein B) (295). It has been shown to be involved in cell migration, proteoglycan
synthesis, and ECM stability, and it can bind to and promote the activity of a serine

protease inhibitor involved in inflammation.

CCN family

The ctgf/cyrl/nov (CCN) family is currently composed of six structurally related
members, all of which contain an IGF binding domain as well as a cell attachment
domain. Numerous functions have been ascribed to the CCN family, although CTGF and
Cyr61 have been most often associated with promoting cell growth and the others with
growth inhibition (296), and have also been associated with estrogen-stimulated uterine
growth (below). Wisp2 is also a member of the CTGF family, although it lacks the
heparin binding domain that the others possess, and is believed to be a secreted protein
(297). Estrogen regulation of Wisp2 expression has not yet been reported in the uterus,
although it has been recently identified as a robust estrogen-inducible gene in breast
cancer cells (298).

Connective tissue growth factor CTGF is the best studied member of the CCN
family, and was first isolated as a peptide growth factor capable of stimulating
endothelial cell DNA synthesis and chemotaxis, and as an immediate early gene that

could be transcriptionally induced by serum or TGFB in fibroblasts. While CTGF was

43

 

named for these actions, its roles are now known to be very complex, and its involvement
in numerous other cell types including epithelial, endothelial, and vascular smooth
muscle cells, have been recently reviewed (296). CTGF has numerous aliases, including
IGFBP8, although its interaction with the IGF signaling system is not currently well
understood. CTGF can bind to cell surface integrins to promote adhesion of numerous
cell types, and can also bind heparin, and consequently interactions with the ECM are
believed to regulate CTGF bioavailability. In addition, heparin has been implicated in the
regulation of CTGF-mediated mitogenic activity.

Ctgf expression has been shown to be strongly stimulated by TGFB or serum, but
to also be induced in a weaker manner by other growth factors (PDGF, EGF, and FGF).
The Ctgf gene contains an unusual TGFB response element that has not been found in
other CCN family members or TGFB-inducible genes. It has also been shown to be
induced directly by factor VIIa, factor Xa, or thrombin in fibroblasts in a TGFB-
independent manner. CTGF can then induce transcription of numerous ECM
components, but other targets have been found to include cyclin A and Bel-2. Ctgf
expression in uterine epithelial cells is decreased at implantation, consistent with the
degradation of subepithelial ECM that is coincident with the establishment of
neovascularization of maternal stromal tissues during placentation. Furthermore, Ctgf is
expressed at relatively high levels in the epithelial cells of the uterus, and expression
levels change during the estrous cycle, suggesting that it plays a dynamic role as a
function of reproductive status, possibly in regulating subepithelial ECM stability. CTGF

is also present in uterine secretory fluid.

CTGF can stimulate the synthesis of numerous ECM components, including
fibronectin, collagen, integrins, lysyl oxidase, and CTGF itself in fibroblasts, and Tgfb
stimulation of these CTGF-mediated processes is implicated in both normal tissue
remodeling as well as in fibrotic lesions. CTGF has also been shown to be critical to the
G1/S phase transition in fibroblasts (299). Little is known, by contrast, about the role of
CTGF in epithelial cells, but it has been implicated in epithelial cell adhesion.

Ctgf is weakly expressed in the unstimulated uterine epithelium, and is transiently
further induced by estrogen treatment and to a lesser extent by progesterone, in a manner
that has been proposed to be both TGFB] dependent and independent (300).

The cysteine-rich protein Cyr61, also identified as IGFBPlO, was first identified
as a serum-activated immediate-early gene in fibroblasts (301). Cyr61 was later reported
to be highly induced at 4-8 hr in the estrogen—stimulated rodent uterus (183). Recently, it
has also been shown to be an estrogen-inducible factor required for cell cycle progression
in MCF-7 cells, and also to be induced by EGF treatment (302). Secreted Cyr61
associates with cell surfaces and ECM and acts as an adhesion substrate for integrin
receptors, and promotes angiogenesis by regulating expression of specific genes (303,
304). The importance of Cyr61 was further demonstrated when the null mouse was found

to be embryonic lethal due to impaired vascular development (305).

Polyamine utilization

The endogenous polyamines, which consist of spermine, spermidine, and
putrescine, are ubiquitous small aliphatic amines that are critical for mitotic spindle
formation and chromosome condensation, and that serve numerous other roles in cell

growth, differentiation, and apoptosis that have been extensively reviewed (306, 307). A

45

 

highly regulated group of enzymes act to constantly modify the intracellular polyamine
pool to meet current cellular needs, which is believed to be a universal requirement of
proliferating cells.

Omithine decarboxylase (ODC), a rate limiting enzyme, converts the TCA cycle
intermediate omithine to putrescine, which can be further converted to spermine and
spermidine. ODC activity is controlled at the transcriptional, translational, and
posttranslational levels and is under strict negative feedback control by its polyamine
products. Rapid and dramatic regulation of Ode] expression is possible because of its
extremely short half-life of several minutes to 1 hr (the shortest half-life of any known
enzyme). Its degradation is regulated by a unique regulatory protein named antizyme,
which binds reversibly to ODC monomers and promotes its proteolytic degradation by
the 26S proteasome. Antizyme also downregulates polyamine uptake by cells. Activity of
antizyme is regulated by another unique protein, the antizyme inhibitor, which is highly
homologous to ODC but lacks its activity completely and is believed to prevent ODC
degradation by trapping the antizyme (308).

Och expression is very low in quiescent cells, and expression can be induced as
an early response to numerous stimuli, being maximal in mid-GI, and decreasing as the
cells enter S phase (309). Sustained Och expression involves Myc/Max—induced
transcription (310), whereas expression of the Myc/Max inhibitor Mxi is inversely

correlated with proliferative activity (31 1).

46

 

Energy utilization and storage

ATP

The predominant component of a rapidly inducible protein originally designated
estrogen-induced uterine protein (IP) was later identified as brain-type creatine kinase
(CKB), while the second component was identified as brain-type gamma enolase (Eno2)
(312). Estrogen induction of uterine activity of CKB and the glycolytic enzymes En02,
phosphoglycerate kinase (PGK), and pyruvate kinase (PK), but not phosphoglycerate
mutase (PGM), was then confirmed (313).

Creatine kinase can reversibly catalyze ATP production, using creatine phosphate
as a phosphate donor. It has been shown that creatine phosphate, and to a lesser extent
ATP levels in the rodent uterus begin to be depleted within the first two hours after
estrogen stimulation, and that initial levels are reestablished at approximately 6-12 hr,
then increasing to maximal levels at 24 hr (314, 315).

Ckb transcript levels are rapidly and highly induced in the uterus and other tissues
following estrogen exposure (316), particularly in the uterine smooth muscle (317). The
Ckb promoter has been extensively studied, and while numerous transcription factor
binding sites have been identified, of particular interest to uterine responses is that the
transcript has been found to be upregulated by binding of ER to an imperfect ERE and an
Spl site in certain cell types (318). Upregulation of the ubiquitous mitochondrial creatine
kinase, CkmtI, has also been demonstrated in the presence of estrogen in vitro (319), and

it is believed to be regulated coordinately with Ckb in the uterus (320).

47

Glucose

An early effect of estrogen exposure observed in the rodent uterus is the rapid
uptake of glucose, which is an important component of numerous vital pathways. It has
been shown that estrogen stimulates uterine glucose utilization for the pathways of
protein, lipid, GABA, lactate, and carbon dioxide formation (321). In conjunction with
this, the levels of intermediates of glycolysis, TCA cycle, and pentose phosphate pathway
were measured, and many were found to be elevated in the uterus at 4-16 hr after
estrogen administration (32]).

It was recently shown that uterine increases in glucose uptake, which are already
detectable at 15 minutes after estrogen injection and begin to plateau at 4-8 hr, are
partially attributable to increased transcription of the glucose transporter GLUTl
(Slc2a1), while other glucose transporters were found to be unaffected or undetectable
(322). Since increases in Glut] transcript and protein levels are not induced before the
observed stimulation of glucose uptake, however, it is believed that other mechanisms, as
yet undefined, also contribute to this response (322).

Rapid induction of glucose utilization is accompanied by stimulation of lactate
production and glycogen and glutamate synthesis (323). Numerous studies have shown
that fructose-2,6-bisphosphate and other glycolytic intermediates are upregulated in the
uterus after estrogen exposure, paralleled by gradually increased activity in glycolytic and
pentose phosphate pathway enzymes (321). The rate of glycolysis has been shown to

increase within 3 hr (324).

48

 

Lipoproteins and fatty acids

A widely studied effect of estrogen administration in humans is the beneficial
lowering of total and LDL cholesterol, while increasing HDL and VLDL levels. However
several important differences in response are observed in rodents, such as the lowering of
both LDL and HDL, indicating that some results of this type of study in rodents may be
difficult to extrapolate to humans (325). In addition to transiently depressing food intake,
estrogen causes a sustained repression of lipoprotein lipase (LPL) activity in adipose
tissue, thus inhibiting LPL-mediated free fatty acid uptake and triglyceride deposition,
and also stimulates fatty acid synthase and acetyl CoA carboxylase activities (326).
However in the uterus, estrogen promotes an increase in its activity (327), which may
cause a local increase in free fatty acids and monoacylglycerols and in triglyceride
deposition, although the effects of this local stimulation are not fully understood.

Further evidence of the tissue-specific regulation of lipoprotein levels by estrogen
is that the mechanism of induction of apoVLDLII induction by estrogen has been well
studied, but is believed to be specific to the liver (328). The high-density lipoprotein
scavenging receptor (Scarbl) has also been found to induced in a complex ERE-
dependent manner (329), and although its regulation in the uterus is not well defined, it is
believed to be both the selective transfer of cholesteryl ester into cells and cholesterol
efflux from cells, and has been detected in the endometrium (330). As well, estrogen has
been found to induce uterine expression of a high density lipoprotein binding protein
(Hdlbp; vigilin), which becomes localized predominantly to the epithelial cells (331).

The periimplantation uterus contains high levels of the cannabinoid anandamide

(ANA), and its availability is modulated by its metabolism by fatty acide amide hydrolase

49

 

(FAAH), which produces arachidonic acid and ethanolamine. Cannabinoids have been
associated with trophoblast differentiation and implantation, while arachadonic acid can
then be converted to vasodilatory eicosanoids to cause vasorelaxation. While
downregulation of FAAH activity by both estrogen and progesterone has been reported,
Faah transcription has been shown to be induced by 24 hr estrogen exposure in rat
uterine epithelial cells, and to be maximally expressed at estrus in the epithelium and

circular myometrium (332).

Structural

Structural components are critical to organ shape and volume. Epithelial and
stromal cell layers are separated by a basement membrane (BM), and the stroma also
contains an extensive extracellular matrix (ECM). The BM and ECM are composed of
numerous proteins and modified proteins, including fibrillar proteins such as collagens
and elastin, proteoglycans, and large multidomain glycoproteins such as laminin and
fibronectin (333).

The structural composition of the uterus is remodeled cyclically as a component
of the menstrual cycle, with proteolytic degradation being a major feature of menses,
followed by regrowth during the proliferative phase. These changes involve rapid and
extensive remodeling of the ECM and connective tissue in response to changes in ovarian
hormone levels. Importantly, due to the nature of the differences between uterine
structural changes in menstruating and nonmenstruating species, close concordance
between changes in remodeling enzymes in humans and in rodent models is not expected

or observed (334, 335). Furthermore, the extent of the remodeling necessary in primates

50

has been postulated to be linked to the occurrence of endometriosis only in menstruating
species (334).

In addition to the structural changes associated with menstrual shedding, prior
structural changes to the luminal surface are critical for implantation. These include both
acquisition of adhesion ligands as well as the loss of inhibitory barrier structures, and
these are more highly conserved between primates and rodents.

The ECM acts both as a scaffold and as a dynamic regulator of alterations in cell
shape, proliferation, differentiation, and apoptosis (336). For example, ECM alterations
or degradation can release growth factors that can impact cell proliferation (337). As
well, glycosaminoglycan (GAG) oligosaccharides can function by regulating access of
growth factors and other signals to cell surface receptors. During glandular growth
(adenogenesis), nonsulfated GAGs, such as hyaluronic acid, are localized to proliferating
regions of the glands, while sulfated GAGs such as heparans and chondroitins are

localized at inactive sites (36).

Structural components

Glycosaminoglycans

Glycosaminoglycans (GAGs) are the carboxyhydrate side chains of glycoproteins.
Estrogen stimulates an increase in chondroitin 4- and 6-sulfates while decreasing
hyaluronic acid and dermatan sulfate levels (338), so that in the estrogen-stimulated
uterus GAGs consist predominantly of chondroitin sulfates (A and C; 40%), dermatan
sulfate (25%), heparan sulfate (19%), hyaluronic acid (13%), and sialoglycoprotein (4%)

(339, 340). Sulfation of sulfated glycoconjugates is also stimulated by estrogen (341 ).

51

 

Collagens

Estrogen has been shown to rapidly stimulate both the formation and breakdown
of collagen in the rodent uterus, and the types of collagen synthesized in the estrogen-
stimulated uterus have been identified as types I, III, and V (342-344). The effect of
estrogen on collagen content and organization is biphasic and associated with uterine
hypertrophy (345), with early effects including a loosening and fragmenting of collagen
bundles resulting in large spaces opening in the ECM and increased spacing between
stromal cells, while late effects include reappearance of collagen bundles in close
association with stromal cell membranes (346). Estrogen is also able to reverse the
collagen degradation associated with uterine atrophy (347).

Increased transcription of specific type I, III, and V procollagens, Col/a],
Colla2, Col3a], and ColSaZ has been reported both early (2-4 hr) and late (18—36 hr) in

the estrogen-stimulated uterus (348, 349).

Derm;at_an sulfate proteoglycans

Dermatan sulfate proteoglycans are small proteoglycans that bind to collagen
fibrils and other ECM proteins in connective tissue to influence matrix assembly. This
family includes decorin, biglycan, and heparan sulfate proteoglycans 3. Of these, decorin

(Dcn) mRNA has been shown to be upregulated by estrogen in the sheep uterus (350).

N-linked glycoproteins

Estrogen has been reported to rapidly increase the rate of synthesis of N-linked
glycoproteins such as laminins, fibronectin, and E-cadherin. An analysis of transcript and

protein levels in response to estrogen exposure, however, showed that levels of these

52

 

 

transcripts were unaffected. However, an increase in transcription of
mannosylphosphoryldolichol synthase (meI), which is involved in N-linked
glycoprotein assembly, was increased by estrogen stimulation, indicating that N-linked
glycoprotein synthesis in response to estrogen is induced by increased levels of a key
glycosylating enzyme (351).

Fibronectin and laminins are N-linked glycoproteins associated with stromal
differentiation (351). No production is associated with stromal differentiation (352), and
no evidence has been reported that estrogen increases uterine fibronectin production,

although it has been reported to be posttranscriptionally repressed by estrogen in vitro

(353).

Keratins

The presence of sufficient retinoid levels in the uterus prevents squamous
differentiation of the epithelium, and induced expression of gene products involved in

keratinization and comification is not normally observed in response to estrogen (354).

Syndecans

Syndecans, also known as heparin sulfate proteoglycans (HSPGs), are small
membrane-anchored proteins with extensive glycosaminoglycans modifications that
facilitate binding of growth factors such as VEGF and FGF2 to their receptors, as well as
providing binding sites for ECM adhesion proteins such as laminin and fibronectin to
facilitate their action. Syndecans are implicated in cell adhesion and morphogenesis, and

it is believed that their downregulation is important for uterine receptivity (355).

53

Estrogen treatment induces endocytosis of uterine membrane-associated
syndecans, particularly from the basolateral epithelial surface, and this is followed by
their cleavage and degradation (356). The syndecan Sdcl was not found to be altered by
estrogen exposure (357), while Sdc3 was observed to be induced in the uterus at 4-12 hr
after E2 exposure (355). Interestingly, surface Sdc3 protein was dramatically
redistributed away from the apical surface of the luminal epithelial cells following E2
treatment, which may be involved in altering epithelial cell morphology (355). Estrogen-
induced syndecan expression is believed to involve paracrine signaling from the

underlying stroma (358).

Mucins, cadherins and catenins in the regulation of adhesion

Maintenance and regulation of cell-matrix and cell-cell adhesion connections are
critical to tissue architecture and remodeling. For example, in the uterine epithelium,
cadherins are localized to the lateral surfaces and mediate cell-cell adhesion, integrins are
basally located and mediate cell-substrate binding, and different integrins are exposed at
the luminal surface during the receptive period to facilitate embryo attachment (359). The
cytoplasmic domains of cadherins and integrins can interact with specific linker proteins
that attach to cytoskeletal actin or intermediate filaments.

Mucin glycoproteins are bulky, highly hydrated structures that serve as a barrier
layer at many apical epithelial cell surfaces, extending much farther into the luminal
spaces than most other membrane components. Mucins contain numerous tandem repeat
sequences containing many serine and threonine residues which are very highly modified
by O-linked oligosaccharides (50—90% by weight), and many proline residues

contributing to their nonlinearity, making them very resistant to proteolysis and inhibiting

54

adhesion of foreign cells to the tissue surface. These glycocalyx linings are believed to
provide a steric block to microbial attack in the female reproductive tract, as an initial
mechanism of defense against infections while a host defense is being mounted in order
to protect the tissue from infections that can threaten reproductive success. Furthermore,
it also appears that bacterial proteins termed adhesins act as receptors for the mucin
carbohydrate chains, to promote specific binding and trapping of the invading bacteria. In
this way, bacteria can be trapped in the mucosal layer, after which the immune system
can promote neutralization and expulsion from the body (360, 361 ).

Luminal surface mucins are associated with blocking of uterine receptivity, by
obstructing integrin- and cadherin-mediated interactions (362). In particular, expression
of the predominantly membrane—associated mucin episialin (Mucl) is associated with the
non-receptive stages of the uterine cycle in rodents (363), while the marked
downregulation during the brief receptive period is associated with permitting embryo
attachment to the luminal surface (364). In humans, the regulation of Mucl expression
appears to be more complex, with focal changes in expression at the implantation site, as
well as decreased levels of associated keratan sulfates that are believed to promote
embryo implantation (40). Mac] transcript expression in response to steroid
administration has been extensively studied. Muc] induction by estrogen can be blocked
by antiestrogen or by progesterone (365). Mucl however, accounts for less than 10% of
the total mucin composition in mouse uterine epithelia (364). As well, expression of the
sialomucin complex, encoded by the Cd164 gene, has been shown to be similarly
upregulated in the uterine luminal epithelium in response to estrogen (366), although the

direct reason for the stimulation is believed to be due to downregulation by stromally

55

derived TGFBl (362). Since estrogen induction of Mac] has been shown to be ER-
dependent but no evidence was found for direct binding of ER to the Mac] promoter, it
has been suggested that Mac] expression is similarly mediated by stromal factors (367).

Integrins are a class of heterodimeric cell adhesion molecules expressed as
glycoproteins at cell surfaces. They promote cell-cell and cell—matrix interactions and
thus play a critical role both in normal cell architecture and polarity and in the receptivity
of the uterine luminal surface to trophoblast implantation, and have additionally been
implicated in the promotion of signal transduction pathways that induce transcription of
other genes necessary to implantation, which has been recently reviewed (359). In the
uterus, integrins anchor the epithelial cells to the basement membrane and promote
trophoblast attachment, and also promote cell-cell interactions in the stroma. Complex,
isoform-specific regulation of integrin expression in the uterus has been shown to be
mediated by numerous paracrine factors including ILl, EGF, TGFor, TGFBl, and TNFa,
recently reviewed (359). In addition, estrogen and progesterone have both been shown to
be associated with repressed expression of B3 integrin (Itgb3) in endometrial cells in
vitro, whereas EGF and FGF2 are highly stimulatory (359, 368).

Cadherins are transmembrane glycoproteins that mediate cell-cell adhesion in a
calcium—dependent manner, while catenins act as a bridge between cadherins and the
actin cytoskeleton. The estrogen-stimulated prevention of uterine surface adhesion was
prevented by inactivation of E-cadherin (thl), and estrogen promotes E-cadherin
cleavage and inactivation, while inhibition of this process permits adhesion (369).

Estrogen is also associated with decreased expression of 0t- (which could be Cama] or

Catna2) and B—catenin (Catnb) as well as thI (370), however overall, Mucl is believed

56

to be able to disrupt cell-cell and cell-matrix interactions by providing steric hindrance to
integrin access (371) and by inhibiting the formation of thl-Catnb complexes (372).

Another adhesion molecule important to uterine function is cellCAM-105
(Ceacaml; also known as biliary glycoprotein), an integral membrane glycoprotein and
member of the immunoglobulin superfamily. Ceacam] is localized to the apical surface
of the uterine epithelium, and is induced by estrogen in the luminal epithelium and by
progesterone in the glandular epithelium (373), and its involvement in embryo attachment
has been proposed (374). Recently, Ceacam] has also been localized to endometrial
blood vessels, and identified as a chemotactic and angiogenic factor that is inducible by
VEGF and that may act as an effector of VEGF to promote blood vessel maturation
(375).

Modifications to luminal surface carbohydrate chains, including fucosylation and
sialylation, have been observed to be regulated during the reproductive cycle also,
reviewed in (32). Transcriptionally, al-2fucosyltransferase (FutI), which catalyzes the
final step in the formation of the H-type-l oligosaccharide, is implicated as an epithelial
attachment site for the blastocyst and has been shown to be induced by estrogen and
repressed by progesterone in uterine epithelial cells (376, 377). By contrast, no
sialyltransferases examined to date have been shown to be modulated by estrogen,

reviewed in (32).

Proteases and inhibitors

Structural remodeling of the uterus is an intrinsic feature of the uterine cycle, and
as with normal growth and differentiation processes, involves extensive and controlled

proteolysis events. In addition, embryo implantation requires the highly controlled

57

invasion of uterine stroma by the trophoblast, and this complex event is also supported by
the secretion and activation of numerous proteases, which degrade the ECM. Important
proteinase families involved in this include the serine and cysteine proteinases, and the
matrix metalloproteinases. Normal tissue functioning requires fine control over these
processes, and these degradative enzymes are controlled at several levels of regulation,
including transcriptional regulation, proenzyme activation, and regulation of enzyme
inhibitor levels, in response to estrogen signaling.

An early observation in the estrogen-stimulated uterus was a marked induction of
peroxidase activity (378). The properties of this peroxidase activity have been avidly
studied, and this activity, referred to as estrogen-induced peroxidase (EIP) and found at
high levels in the estrogen-stimulated epithelium and luminal fluid, was found to have
several components (379). EIP is localized to the epithelial microvilli and uterine fluid
(380) and is distinct from eosinophil peroxidase, which is concurrently induced but is
localized to the stroma and myometrium (381). A recent report then indicated that
cathepsin B and complement C3 were major components of EIP (382).

The cathepsins B, H, K, L, and S are lysosomal proteases involved in degradation
of ECM and other proteolytic processes. They are secreted as proenzymes that are
activated either autocatalytically or by MMPs or other cathepsins. They are active in
acidic environments, and are able to degrade matrix molecules such as collagens.
laminin, fibronectin, and proteoglycans. Cathepsins and other proteases have been found
to be interregulated in a complex manner, since certain cathepsins can activate matrix
metalloproteases (MMPs) and urokinase plasminogen activator (uPA), while they in turn

can be activated by MMPs. As a result, they can digest matrix proteins and activate other

58

proteases involved in matrix degradation. The cathepsins have been found to be localized
in both epithelial and stromal cells, particularly at the apical the luminal epithelium and
in lymphoid cells in the stroma. The details of their isoform-specific localization and
variation with menstrual phase have been reported in detail, and their localization
suggests that they act within the uterine tissue and are also secreted into the lumen, where
they may act to modify surface adhesion molecules on the luminal surface (383).

Cathepsin D (Ctsd), an aspartyl protease, is present in higher levels in the
secretory than in the proliferative endometrium. Initially its production in the uterus was
thought to be controlled only by progesterone, but weak induction by estrogen has more
recently been reported (384). ERE-dependent estrogen responsiveness of Ctsd has been
studied extensively in MCF-7 cells, and analysis of its responsiveness in different cell
types has led to the proposal that in the uterus a local factor interferes with access to the
ERE (385). Ctsb has also been shown to be weakly inducible by estrogen in the rodent
uterus (124). Cathepsins can be inhibited by cystatins, however there are no reports to
date of their regulation by estrogen.

Secretory leukocyte protease inhibitor (Antileukoproteinase; SLPI) is a serine
proteinase inhibitor of the chelonianin class. SLPI can inhibit trypsin, chymorypsin,
elastases, cathepsin G, and mast cell chymase, and in addition to antiprotease activity it
has anti-inflammatory, antibacterial, and antifungal activities, and has been implicated in
suppressing MMP activation and in fertility. More recently it has been described as a
uterine epithelial growth factor, associated with uterine epithelial cell proliferation, with
induction of DNA synthesis and direct induction of cyclin D1 expression, and concurrent

suppression of genes involved in growth suppression, which together favor epithelial cell

59

growth (386). Slpi is predominantly expressed in glandular epithelial cells in various
tissues. It is typically localized in the ECM, and is considered to be a contributing but
nonessential growth factor, since Slpi null mice appear normal (387). Uterine Slpi
expression to date has been investigated only in pigs, and has been found to be induced
by estrogen as well as by progesterone (388).

Matrix metalloproteases (MMPs) are a large family of locally secreted zinc-
dependent enzymes that play a major role in tissue turnover, primarily by degrading ECM
and BM components. They are divided into several subgroups with distinct specificities
based on similarities in sequence and in specificity for various substrates, a complex
system which has been recently reviewed (334). Generally, however, the MMPs can be
subdivided into collagenases, gelatinases, stromelysins, and membrane-type enzymes,
and the substrates include collagens as well as fibronectin, elastin, laminin, and aggrecan,
though stromelysins are also active towards other MMPs as well as growth factors and
cytokines such as IGFBPs and TNFor (334).

Because of their actions in the degradation of the extracellular architecture,
MMPs have been implicated in numerous processes such as angiogenesis, wound
healing, and tumor infiltration and metastasis (334). In addition, because of their tightly
regulated expression and their potent effects on the ECM, they have been intensively
studied in the cycling and pregnant uterus. In the reproductive organs, MMPs are
typically synthesized by stromal connective tissue cells, including resident fibroblasts,
endothelial cells, and infiltrating macrophages and neutrophils, and their importance in
female and male reproductive function have been extensively reviewed (333, 334). While

estrogen does not appear to influence MMP expression directly, certain estrogen-

60

stimulated growth factors such as EGF and cytokines do influence MMP expression
(389). Progesterone also exerts strong influences, being associated with potent repression
of MMP expression both directly and by repressing cytokine action (39).

Tissue MMP activity is controlled at many levels, including transcription,
activation, and levels of specific inhibitors. To date, there is no evidence for regulation of

these inhibitors by estrogen.

Blood flow and angiogenesis

Estrogen has been found to possess both rapid and delayed effects on the
vasculature, which have been recently reviewed (390). It is currently believed that the
delayed effects are due to ER-mediated induction of specific genes such as prostacyclin
cycloogenases and synthases, nitric oxide synthases, endothelin, VEGF, BCAM, and
elastin. By contrast, the rapid vasodilatory effects are believed to be mediated by
endothelial nitric oxide synthase (NOS3) activation by signal transduction pathways
downstream of membrane ERs. Specifically, both MAPK and PI3K/Akt signal
transduction cascades are believed to stimulate Nos3 in the vascular caveolae to produce
nitric oxide, a signaling molecule which induces cGMP-mediated VSMC relaxation by
(390).

Expression of the PTH-like peptide Pthlh is induced rapidly in the uterus after
estrogen administration, declining by 24 hr (391), a response which can be inhibited by
either glucocorticoids or vitamin D3 (392). Interestingly, expression of its receptor.
which also serves as the parathyroid hormone (PT H) receptor (Pthrl), was found to be
concurrently downregulated (392). PTHLH is believed to stimulate uterine blood flow

(393) and possibly prevent uterine smooth muscle contractions (394).

61

 

Adrenomedullin (Adm) is a peptide with many known functions, including an
ability to potently induce vasodilation, as well as to promote angiogenesis and reduce
blood pressure, in part through the generation of nitric oxide. The proadrenomedullin
gene also codes for an alternate peptide, PAMP, which is also able to reduce arterial
pressure. Although Adm is known to act through the receptor Admr, it has been shown to
also interact with calcitonin gene-related peptide (CGRP) receptors (395). In addition to
stimulation of endometrial vasodilation and angiogenesis, a role for Adm in attenuating
myometrial contractility induced by galanin has also been suggested (45). Adm
transcription can be induced by various hormones, growth factors, and cytokines, as well
as oxidative stress. In the uterus, Adm is highly expressed in the female reproductive
tract, with cyclic variation during the uterine cycle, and is induced following estrogen
administration. TGFB] has been proposed as a mediator of the estrogen-induced Adm
transcription, although this regulatory pathway is not yet well defined (45).

Angiogenesis is the process in which new blood vessels are derived from
preexisting ones, and can occur by several distinct mechanisms that have been recently
reviewed (396). In the adult, angiogenesis primarily occurs in the uterus and ovary as a
necessary component of the reproductive cycle and during pregnancy, as well as in
pathologic processes such as wound healing, chronic inflammatory disorders, and
malignant tumor growth (397). The role of angiogenesis in the female reproductive tract
is critical, however, since the endometrium is one of the most dynamic adult tissues, and
the rapid increase in endometrial thickness depends critically on the efficient
establishment of vascularization. Angiogenesis is also critical to placentation during

pregnancy. The cyclical regrowth of the endometrium is dependent on its ability to

62

rapidly and efficiently regenerate a vascular capillary network to accompany and support
the proliferation and differentiation of the endometrial lining. This neovascularization,
involving the formation of new capillaries from preexisting blood vessels, is stimulated
by both endocrine and paracrine pathways, and requires proteolytic dissolution of
endometrial extracellular matrix, proliferation and migration of endothelial cells,
permitting the formation of new capillary tubules to supply the growing endometrial
tissue (398). Blood vessel growth and regression in the human endometrium differs both
temporally and spatially during the menstrual cycle in response to changes in the needs of
the other cell types within the tissue. Specifically, it occurs in the functionalis to support
the rapid four-fold increase in endometrial thickness during the proliferative phase (399),
during the growth and coiling of spiral arterioles in the functionalis in the secretory
phase, and during repair of the vascular bed in the superficial layer of the remaining
basalis in the menstrual phase (396). During the menstrual cycle a capillary plexus also
develops just below the luminal epithelial surface, and blood flow through this plexus is
maximal during the early and mid-secretory phases in preparation for implantation (400)
Estrogen has long been implicated in the promotion of increased uterine blood
flow caused by angiogenesis and associated increases in vasodilation and in vascular
permeability to water, small molecules, and proteins, but its role is not fully understood
(69). Evidence has recently been provided, however, that estrogen, through the induction
of factors such as VEGF, is involved in the promotion of vascular permeability and
inhibition of angiogenesis, while progesterone conversely stimulates angiogenesis though
has little effect on vascular permeability (282). Furthermore, both EROt and ERB are

expressed in vascular smooth muscle and endothelial cells in a uterine cycle-dependent

63

manner. In particular, EROL expression is increased in the late proliferative and early

secretory phases (401 ).

Erythropoiesis and coagulation

The soluble factor erythropoietin (Epo) is the primary stimulator of proliferation
and differentiation of erythroid precursors, after binding to its receptor (EPOR), although
additional roles have been proposed. For example, the epithelial and stromal localization
of Epo and Epor in the uterus, and the glandular increases in both proteins in the late
proliferative phase, suggest additional roles for these proteins that have not yet been
discovered (402). Epo expression is typically induced by the hypoxia inducible factor
HIF-la in response to hypoxia, and the stimulation of red blood cell formation results in
improved oxygen supply, which then acts negatively on Epo expression (403).

Reports of estrogen regulation of Epo synthesis under hypoxic conditions have
been controversial over the last several decades. Recently it was shown the estrogen
inhibits Epo expression during hypoxia (404), although uterine Epo is also reported to be
inducible by estrogen in the uterus (403, 405).

Tissue factor (F3) is a cell surface glycoprotein receptor for coagulation factor VII
(F7), which as a complex initiate the extrinsic coagulation protease cascade. In this
cascade, prothrombin (F2) is activated, stimulating fibrin formation. In addition,
thrombin can act as a mitogen in numerous cell types including fibroblasts, VSMCs, and
immune cells, as well as in cultured uterine stromal cells (406), and its function as an
estrogen-regulated uterine growth factor has been proposed (407).

At the protein level, estrogen rapidly induces both F3 and F2 levels. F3 is found

in both epithelial and stromal cells within 3 hr in the uterus, with F2 being localized to

64

the basement membrane that separates the epithelium and stroma, and to the apical
surface of the epithelium (407). F3 is rapidly synthesized in the uterus following estrogen
exposure (408), while thrombin levels are increased due to infiltration into the uterus
through capillaries that are made hyperpermeable following estrogen exposure, similar to
albumin, plasminogen, and alpha-l-protease inhibitor (409). Thrombin has also been

shown in vitro to stimulate uterine stromal cell proliferation (406).

Oxidative stress

During normal metabolic activity the cells of all aerobic organisms produce
reactive oxygen species, which include superoxide, hydrogen peroxide, and hydroxyl
radical, and the toxicity of these compounds is regulated by various antioxidant
mechanisms. Moreover, estrogen can further induce oxidative stress through its
metabolism to reactive quinines, semiquinones, and free radicals (410, 41 1). In addition,
reactive oxygen species or their lipid peroxide products can stimulate prostaglandin F20t
synthesis, which is involved in uterine contraction and endometrial breakdown (412).
Estrogen has been shown to promote oxidative stress in uterine tissues (413).

Superoxide levels have been shown to vary during the rodent uterine cycle, with
NADPH oxidase-dependent superoxide levels highest at proestrus and lowest at estrus
(414), while in humans they are increased in the endometrium in the late secretory phase
just before menstruation (415). Superoxide levels and NADPH oxidase activity was also
shown to be highly induced by estrogen treatment, whereas SOD activity was slightly
repressed (416). Furthermore, hydride and dienyl radical levels were elevated following
estrogen treatment, and cell membrane fluidity was enhanced, possibly due to

perturbations associated with the partitioning of the estrogens into the cells membranes

65

(416). In addition, estrogen treatment is associated with increased membrane lipid
peroxidation, decreased progesterone concentration, and enhanced catalase activity (413).
It has been proposed that the enhanced catalase activity partially mutes the extent of lipid
peroxidation, which would otherwise be greater following estrogen exposure (41 1).

At the transcript level, mitochondrial manganese SOD (Sod2), has been shown to
be upregulated at estrus in the luminal epithelium and at proestrus in the leukocytes
(417), and both Sod2 and the cytosolic Cu,Zn-SOD (Sod3) in human endometrial cells at
the time of decidualization or by combined estrogen and progesterone administration
(418). Regulation is isoform-specific, and although the functional significance of these
changing levels is not fully clear, it has been suggested that Sod3 controls PGF20t
production by preventing cytosolic accumulation of oxygen radicals (419), while Sod2
promotes successful decidualization by protecting the epithelium from free radical-
induced damage (415). Specific transcriptional regulation by estrogen has not yet been
established, however estrogen and progesterone have been shown to induce both enzymes
by CAMP-mediated mechanisms (415), and promoter analyses also indicate potential

direct regulation by numerous factors, including AP-l, Spl, and progesterone (420, 421).

Solute and fluid regulation

Estrogen induces a rapid increase in uterine microvascular permeability, and this,
in conjunction with estrogen-induced increases in uterine blood flow, leads to stromal
edema. This effect is believed to promote an environment supportive of the endometrial
growth and remodeling that is necessary for implantation and pregnancy, and that is

similar to the edema observed in the rodent proestrus stage and human midproliferative

66

and midsecretory stages. In addition, it has been proposed that uterine edema promotes
blastocyst attachment by decreasing the size of the luminal space (422).

This edema response is associated with increased VEGF production. In the
rodent, the inactivation of Vegfa with a specific antibody or with an Flt-1 inhibitor has
confirmed that VEGF is the dominant mediator of the estrogen-induced changes in
vascular permeability, and that the VEGF-induced edema is essential for successful
implantation (38, 422).

An important function of the endometrial epithelium is the production and
secretion of uterine fluid into the lumen. Cyclic variations in solute levels, including K+
and Ca2+ levels have been observed (423). In addition, Na+ levels are critical modulators
of fluid balance, and the depression in fluid Na+ levels and consequently of uterine fluid
volume directly prior to implantation are believed to promote luminal closure, a
flattening of the epithelial surface that is important to implantation (424). IGF-I has been

shown to induce many of these parameters in a manner similar to estrogen (425).

Sodium and Chloride

The regulation of water intake and export is dependent on the regulation of
specific solute levels. In the uterus, recent studies indicate that fluid accumulation is due
to estrogen-induced increases in the Cl' channel CFT R coupled with downregulation of
the ENaC (Scnnl) Na+ channel isoforms (426). It is believed that when Cl‘ channel
expression is favored, active Cl' secretion drives Na+ and fluid from the plasma into the
uterine lumen, while the reverse is true under conditions that favor Na+ channel
expression. This model is consistent with the patterns of CFTR and ENaC expression as

well as fluid dynamics that are observed during the estrous cycle (426). The upregulation

67

of Cftr 12 hr after estrogen administration has been reported (427), and indirect evidence

strongly supports the upregulation of Scnnla, Scnn] b, and Scnn] g also (426).

Potassium

Large—conductance Ca2+/voltage-activated K+ channels, also known as Kcnm or
maxi-K channels, are important in regulating myometrial contractility (428). They are
known to be regulated at various levels, including transcriptionally. For example.
estrogen has been shown to induce expression of a specific splice variant of a pore—
forming 0t Kcnm subunit, Kcnma], with reduced sensitivity to Ca2+ and voltage, though
total transcript levels and channel density remain relatively constant (429). This is
believed to attenuate K“ current and possibly allow increased uterine excitability and
contractility, contributing to changes in conductance observed during the estrous cycle.
The regulatory B subunits Kcnmb3 and Kcnmb4 have been shown to be activated by E2
(430), but their transcriptional regulation is not currently known, while E2-induced
increases in myometrial Kcnmb] expression have been recently reported (431).
Furthermore, Kcnd3, and specifically the long transcript isoform, has recently been
shown to be the dominant isoform of the Kcnd, or Kv4, voltage-gated K+ channel family
in the uterine myometrium, and E2 was shown to be associated with transcriptional

downregulation of Kcnd3, in addition to altering its delivery to the cell membrane (432).

Aquaporins and NHE proton pumps

Proton transporters play important roles in regulating intracellular pH. cell
volume, and osmolarity. In addition, exit of HCO3- requires that H+ also be pumped out

of the epithelial cells to maintain intracellular pH. It is believed that basolateral Na+/H)“

68

exchangers (NHEs) in the uterine epithelium may be involved in allowing HCO3-
secretion, while apical NHEs may mediate luminal Na+ absorption in a manner similar to
the Scnnl channels. In the mouse endometrium, three NHEs, Slc9al, Slc9a2, and Slc9a4,
have been identified, though the specific contributions of each are not presently known.
During HCO3- secretion, basolateral NHE activity is high while apical NHE activity is
low (433)

Aquaporins are vasopressin-insensitive water channels. The aquaporin AQPl, or
CHIP28, has been detected in the human uterus (434), and qul transcript levels are
induced in the rat uterus approximately 9 hr after estrogen exposure (435). Details of its
regulation and action in the uterus are currently unknown, however AQP1 is known to be
expressed in secretory tissues, and has been shown to be an important component of fluid
regulation in the male reproductive tract, secondary to export by the sodium/hydrogen
exchanger NHE3 (Slc9a3) of protons formed by the carbonic anhydrase Car2 (436). A
similar mechanism may act in the female reproductive tract. Slc9a3 expression in the
efferent ductules of the male reproductive tract was shown to be dependent on EROL in
that system, and the promoter sequence was reported to contain EREs (436‘).
Furthermore, the expression of Slc9a3rl (NHE-RFl; EBPSO), which is believed to
function as a regulatory component or scaffold for many transporters including Slc9a3,
CFTR, and a sodium bicarbonate cotransporter, has been shown to be strongly expressed
in nearly all epithelial cells of the human proliferative phase uterus, and to be highly
abundant in cells rich in microvilli (437). The human Slc9a3r] promoter has been shown

to contain a high number of functional half ERE sites, through which ER upregulates

69

Slc9a3r] transcription through a complex mechanism, and participation of Slc9a3r1 in

modulating uterine cell ultrastructure has been proposed (438).

Immunologic responses

Estrogen has been described as a proinflammatory mediator, since it promotes
leukocyte influx, uterine edema, and epithelial proliferation. A characteristic feature of
the uterus is the cyclic changes in levels of immune cells, which play roles in
phagocytosis of apoptotic cells and in combating infections introduced during mating
(439, 440), as well as numerous critical functions during pregnancy (441).

Uterine leukocytes consist predominantly of lymphocytes, macrophages, and mast
cells, as well as a uterine-specific type of natural killer cell (uNK). These cells have been
shown to have distinct localizations, with mast cells associated predominantly with the
inner myometrium, and macrophages and uNK cells throughout the endometrium and
myometrium (289, 442). Immune cells are also detected cyclically in the uterine luminal
fluid (443).

Macrophages and neutrophils are an important component of the stromal mass
and function, and macrophages alone, which are normal components of all connective
tissue, constitute as much as 10% of uterine mass (444). Macrophages and neutrophils are
able to phagocytize invading organisms, and macrophages can also present processed
antigens to lymphocytes to initiate the immune response (289). Macrophages bear a wide
range of receptors, including ERs, which make them highly susceptible to numerous
stimuli including estrogen (35). Myometrial mast cells are believed to be involved in

proliferation, vasodilation, and edema through the release of mediators such as nitric

70

 

oxide, TNFOL, and histamine (289). uNK cells, which have been shown to express ERB,

have been implicated in both implantation and in initiating endometrial breakdown (104).

Eosinophils contain potent peroxidase granules, and the estrogen-induced
recruitment of eosinophilic leukocytes has been shown to contribute substantially to the
peroxidase activity that is characteristic of the estrogen-stimulated uterus (445).
Eosinophils can express Fe and C3b receptors, allowing them to bind to lg and C3b-
presenting invading cells, and can initiate complement and coagulation cascades. Eotaxin
(SCYAI l; Ccll 1) has recently been shown to be the signal stimulating eosinophil
recruitment to the uterine stroma, and Cell] expression is highly upregulated following
several consecutive days of estrogen treatment (446). It has been suggested that eotaxin
may be the uterine eosinophil chemotactic factor referred to as ECF-U (447). Eosinophil
recruitment is not required for estrogen-stimulated uterine growth (445), and Ccl]] null
mice display delayed onset of estrous cycling but possess normal fertility (446).

Secreted immunoglobulins provide an important early defense against pathogen
attack at the uterine luminal surface. An association between estrogen stimulation of the
uterus and increased immunoglobulin (IgA and IgG) content in the uterine luminal fluid
is well established (448). IgA, unlike IgG was found to be secreted against its
concentration gradient, and the involvement of an active carrier that transports IgA from
the uterine epithelium into the lumen was postulated (449). This carrier was then found to
be a protein called secretory component (SC), which was later identified as a domain of
the polymeric IgA receptor (Pigr), a transmembrane glycoprotein which is essential for
normal mucosal barrier function (450). Uterine Pigr expression follows a similar pattern

to IgA levels, and is highly induced by estrogen after 3x24 hr (451). Direct regulation of

71

Pigr expression in the uterus is not well established, but in vitro studies indicate direct
induction of Pigr expression by numerous cytokines, including interferon y, TNFOt, [L] B,
and IL4, as well as the involvement of numerous factors in its basal transcription (452).
Interleukin 4 receptor (114m) has been shown be induced at 4—8 hr after estrogen
exposure in the uterus (183), while expression of the interferon-inducible gene HEM45
(Isg20), which has recently been shown to be an antiviral RNase (453), was upregulated

3-15 hr after estrogen treatment in the uterus (454).

Cytokines and Chemokines

Cytokines stimulate the proliferation and differentiation of numerous cell types.
The unstimulated uterus contains little cytokine activity (455), while cytokines known to
be induced by estrogen in the uterus, and further increased by cotreatment with
progesterone, include TNFor and the interleukins IL] and IL6 (455).

Chemokines are a subclass of chemotactic cytokines, and are expressed in
leukocytes as well as in other endometrial cells and in the trophoblast. In addition,
however, Chemokines can mediate vital cyclic changes within the uterus, including
changes associated with proliferation, differentiation, angiogenesis, apoptosis, and
structural changes. Chemokine expression is induced by cytokines or by other local
growth factors, and their dysregulation is associated with cancer and other pathologies.
The complex nature of Chemokine regulation and signaling has been recently reviewed
(456).

Chemokines known to be expressed in the uterus include macrophage colony
stimulating factor (M-CSF; Csfl), monocyte chemotactic protein 1 (MCPl; JE; Ccl2),

and the granulocyte chemotactic protein 1L8 (GCPl, for which no rodent homolog has

72

been found) (457). Induction of Csf] appears to be directly by estrogen (458), while C ch
induction by estrogen is believed to be mediated by [LIB (459), and increased estrogen
appears to be associated with 118 repression (457). Interestingly, in Csf] null mice the

cyclic estrogen surge is impaired, and is associated with abnormal estrous cycles and

reduced fertility (460).

Complement

Complement plays numerous roles in immune and inflammatory responses,
including in the recruitment of phagocytes as well as direct involvement in phagocytosis
and other roles that have been recently reviewed (461). The alternative pathway of
complement activation is induced in the estrogen-treated uterus, although the exact role is
not currently known. Cleavage of complement component C3 and factor B (Bf) yields
C3b and Bb, which form a complex that acts as a C3 convertase to promote the formation
of the membrane attack complex on the surface of invading cells.

C3 and Bf are highly and concurrently expressed in the uterine epithelium and
secreted into the lumen in proestrus and estrus or after estrogen exposure, where they are
believed to defend against microbial invasion (462). The induction of C3 by estrogen has
been particularly well studied. It is generally considered to be a late phase response and
has been shown to be highly induced at 24 hr (463), although it was also identified in a

screen for transcripts that are induced by estrogen at 4 hr (183).

Iron sequestration

Lactoferrin is a glycoprotein of the serum transferrin family, and its many

functions described to date have been the subject of numerous reviews (e.g. (464)). In

73

tissues such as the uterus, these include multiple roles in defense against infection and
inflammation. Its multifunctional antimicrobial activity is directed towards bacteria,
viruses, and fungi, and is attributed to its ability to sequester iron away from iron-
requiring bacteria, to its potently bactericidal lactoferricin domain, to its serine protease
activity which is able to degrade bacterial-host adhesion proteins, and to its pH-
dependent ability to donate the iron atoms used in catalysis of hydroxyl radical
production within neutrophils (464). Furthermore, lactoferrin is able to modulate the
proliferation and differentiation of immune cells, suppress inflammation, and
downregulate the production of specific cytokines (464). In the uterus, lactoferrin is
found in both the luminal and glandular epithelium and in neutrophil granules, and is
secreted during the estrus cycle concurrently with immunoglobulins.

Ltf had already been examined in many other tissues before it was identified in
1987 as the major component of uterine fluid (465, 466). The induction of Ltf mRN A and
protein expression by estrogen has been studied extensively, and complex species and
strain differences have been observed. For example, Ltf has been shown to be highly
inducible by estrogen in many mouse strains, induced variably in the rat, limited to the
uterine stromal neutrophils and vaginal epithelium in the hamster, and has not been
detected at all in the pig (467, 468).

While lactoferrin has been used extensively as a biomarker of estrogenic effect in
the uterus, the Ltf gene has a highly complex promoter, and lactoferrin transcription
occurs in response to many stimuli, as has been recently reviewed (468). Lactoferrin

expression can also be induced by EGF, independent of the ovary, adrenal gland, or

74

hypothalamus, and in vitro can also be induced by RA or by changes in cell shape and

actin cytoskeleton.

Intercellular communication

Gap junctions

Gap junctions, first identified in the 19705, act as a type of intercellular channel
that permits direct communication between the plasma membranes of adjacent cells,
allowing them to share a common pool of small (<1 kDa) regulatory molecules, such as
inorganic ions and second messengers. Each channel is composed of one connexon
(hemi—channel) from each cell, which in turn is composed of a circular hexameric
arrangement of transmembrane connexin subunits to form a pore, and the specific
connexin subtypes influences pore size and thus permeability to specific signaling
molecules (469). Expression of these connexons has been identified in numerous cell
types, and in the uterus, they are found in all of the major cell types, and allow
communication between the epithelial, stromal, and myometrial compartments (51, 470),
as well as allowing synchronization of contractions within the myometrial smooth muscle
cells (470). Many tumors have been found to have lowered connexin expression, and
connexins have been implicated as tumor suppressors (471). The roles and importance of
various connexins has been recently reviewed (472).

The control of certain connexins by ovarian steroids in the uterus has been studied
for more than a decade (470), and although they are a highly homologous family, their
regulation has been shown to be very different. The cell type-specific localization of the

connexin proteins Cx26, Cx32, and Cx43 in the uterus has been studied in estrogen-

75

treated immature rats. A marked increase of Cx43 in the stroma and myometrium was
observed after a 4x24 hr exposure, which was abrogated by cotreatment with
progesterone, whereas increases in connexins 26 and 32 were highly induced by
progesterone in the luminal epithelium (51). In the human endometrium, Cx43 protein
levels were lowest on days 12-14 of the cycle (i.e. time of implantation), which they think
may be due to inhibition by LH, they think that this may reduce cell-to-cell
communication, possibly facilitating the invasion of the trophectoderm through the
stromal cells (473).

When levels of endometrial transcripts were measured, Cx26 and Cx43 were
found to be highly induced by estrogen by 14 hr as well as at 3x24 hr, while levels of
Cx32 were low and unchanged (474, 475).

The promoter of the Cx43 gene has been well studied, and many motifs have been
identified. By contrast, the regulation of Cx26 and Cx32 are not well understood,
although predominant regulation by posttranscriptional mechanisms in the uterus has
been suggested (51). Furthermore, there is increasing evidence that induction by estrogen
is not mediated by classical ER-ERE binding. Cx43 induction is believed to be mediated
at least in part by AP-l (476, 477), while regulation of Cx26 expression has been shown

to involve Spl and Sp3 (478).

Tight junctions

Reciprocal effects of ovarian steroids on tight junctions have been reported in the
uterine luminal epithelium, with estrogen decreasing and progesterone increasing their
size and complexity (479, 480). This pattern of regulation appears to mirror the increase

in gap junction protein expression that was described above. Transcriptional regulation of

76

tight junction components (e.g. ZO-l, claudin-l and occludin) by estrogen in the uterus
has not been described to date, but altered protein levels at the apical epithelial membrane

during pregnancy have been recently described (481).

Apoptosis

Sex steroid hormones control cell proliferation and differentiation in endometrial
epithelia, and removal of estrogen, for example by ovariectomy, is associated with
uterine epithelial apoptosis, which can be restored by the readministration of estrogen, or
alternatively with progesterone or androgen exposure (269). Further evidence for the
involvement of progesterone in the proliferative reaction is that cotreatment of rodents
with estrogen and a PR antagonist induces apoptosis (482). Nevertheless, endometrial
proliferation in the proliferative phase has been generally related to estrogen action, while
progesterone is thought to divert cells into the differentiation pathway.

In humans, apoptotic cells are detected mainly in the glandular epithelium of the
endometrium. Very little apoptosis is observed in the stroma at any stage, or in the glands
in the late proliferative phase, while the number of glandular apoptotic cells increased
during the secretory phase and reached a maximum at menstruation and still high in the
early proliferative phase. This is consistent with a possible role of apoptosis in regulating
cell turnover and the number of glandular cells that survive to the next menstrual cycle
(483). Overall, the pattern of apoptosis and its negative correlation to serum E2
concentrations in the proliferative phase indicated that, in contrast to many other cell
types, proliferating endometrial cells do not undergo significant apoptosis. This study

found an inverse correlation between apoptosis and Ki-67 (i.e. proliferation), suggesting

77

that apoptosis in hormone-dependent cells may not be dependent on cell cycle entry

(483), in support of previous findings in the human endometrium (484).

Neurotransmitters

The reproductive tract contains an extensive network of nerve fibers, which
highly express gastrin-releasing peptide (GRP). GRP is one of several neural signals
involved in the control of uterine motor activity, and can stimulate uterine contractions
that can be potentiated by estrogen coadministration (485). GRP is also secreted from the
glandular epithelium, suggesting a possible endocrine function. In sheep, estrogen was
found to dramatically inhibit uterine Grp expression and secretion (486).

Galanin (Gal) is a neuropeptide that can directly induce myometrial contractions
by modulating calcium levels and by increasing the calcium sensitivity of the contractile
apparatus (487). Stromal Gal expression is rapidly induced following estrogen
administration (488). Galanin acts through the Galr2 receptor isoform, which is localized
to the myometrium, suggesting that galanin modulates myometrial contractility in a
paracrine manner (487). Galanin protein has been identified in a subset of CGRP-positive
myometrial nerve fibers, and CGRP is able to antagonize galanin-stimulated uterine

contraction (489).

Prostaglandins

Prostaglandins are able to stimulate myometrial contraction. Myometrial
expression of the contractile prostaglandin F receptor (Ptgfr) was induced after 24 hr
estrogen administration, while the relaxant prostaglandin E receptor isoform PtgerZ was

induced by progesterone (490).

78

Other

Other transcriptional responses in the estrogen-stimulated uterus have been
described for which the biological function is not yet clearly understood, and these

responses are summarized below.

Frizzled/Wm

The uterus of the Wnt7a null mouse lacks glands and has a stratified rather than
columnar luminal epithelium, as well as a thickened myometrium (491). Estrogen has
been reported to inhibit Wnt7a expression, as reviewed in (492). The importance of
Wnt7a levels are believed to involve its role in maintaining WntSa, HoxalO, and Hoxal 1

levels.

Calbindins

Calbindins are calcium binding proteins with highly estrogen inducibility in the
uterus, although their precise functions in the uterus are unclear. Calbindins display well
characterized estrogen inducibility. The 9 kD calbindin (Ca1b3) has two splice variants
that are expressed in an ERE-dependent manner (493), while expression of the 28 kD
isoform (CalbI) is regulated through multiple imperfect ERE half—sites (494). Calb3 is
induced at 4-24 hr in the estrogen-stimulated uterus (183), while Calb] appears to be

repressed (495).

Lipocalins

The lipocalin Lcn2 was originally described as 24p3, or neutrophil-gelatinase—

associated lipocalin. Lcn2 is involved in the delivery of iron to the cytoplasm, thereby

79

influencing the transcription of critical iron-responsive genes as well as providing the
iron needed for the catalytic mechanism of specific enzymes (496). Lcn2 has been shown
to be complementary, but not redundant, to the iron transporter Transferrin. Lcn2, like
Ltf, has been detected in endosomes, where the acidic environment is believed to
promote iron unloading. Lcn2 expression is induced in the epithelial cells in response to
three consecutive estrogen doses (497) and the glycoprotein is secreted into the luminal
fluid (498). Placental protein PP14, a lipocalin also known as glycodelin-A or
progestagen-associated endometrial protein (PAEP), by contrast, has recently been shown

to not be inducible by estrogen in human endometrial cells in culture (499),

CONCLUSIONS

A vast array of transcriptional responses to estrogen have been described over the
past few decades. Although the experimental systems differ with respect to many
variables including species, strain, age, treatment regimen, many commonalities have
been observed between the different models, and they continue to be employed
effectively in the study of uterine responses to endogenous, pharmaceutical, and pollutant
estrogens. A rapid increase in the use of microarrays to further characterize uterine
responses to estrogen has underscored the need for the vast body of previously published
information to be summarized. The preceding review, which discusses the transcriptional
regulation of over a hundred transcripts in the estrogen-stimulated uterus, is of benefit to
researchers in this area seeking to analyze new data and compare it to previously
published work. Furthermore, numerous other researchers who use a single gene response
as a marker of estrogen action can address current concerns that this does not incorporate

recent information about nonclassical mechanisms of action by readily choosing markers

80

that represent several different estrogen-induced responses (e.g. cell proliferation.

angiogenesis, solute transport, energy production, immune responses).

81

 

1111

All

I.)

CHAPTER 2

HYDROXYLATED BENZO[A]PYRENE METABOLITES ARE RESPONSIBLE FOR
IN VITRO ESTROGEN RECEPTOR-MEDIATED GENE EXPRESSION INDUCED

BY BENZO[A]PYRENE, BUT DO NOT ELICIT UTEROTROPHIC EFFECTS

\BSTRACT

fhe estrogenic activities of benzo[a]pyrene (B[a]P) and 10 metabolites (l, 3-, 7-, and 9-
iydroxy-B[a]P; 4,5-, 7,8-, and 9,l0-dihydrodihydroxy-B[a]P; and 1,6-, 3,6-, and 6,12-
3[a]P-dione) were investigated. In vitro, B[a]P did not displace tritiated l7B-estradiol
[3H]E2) from either a bacterially expressed fusion protein consisting of glutathione-S-
ransferase linked to the D, E, and F domains of human EROt (GST-hERadef), or from
'ull-length human ERB (hERB) at concentrations as high as 60 11M. However, 10 BM
B[a]P demonstrated partial agonist activity in human Gal4-EROtdef and mouse Gal4-
SRBdef reporter gene assays in transiently transfected MCF-7 cells, relative to 10 nM E2.
-, 3-, 7-, and 9-hydroxy-B[a]P were found to bind to both receptor isoforms, each
howing a higher affinity for the B isoform. At 10 M the four monohydroxylated
netabolites were able to induce Gal4-hEROtdef- and Gal4-mERBdef-mediated reporter
;ene expression to levels 20-100% of that caused by 10 nM E2, suggesting that these
netabolites, and not the parent compound, induced reporter gene expression following
l[a]P treatment of transiently transfected MCF-7 cells. In addition, the effect of B[a]P on
wo estrogen-inducible endpoints, uterine weight and lactoferrin mRNA levels. was

letermined in ovariectomized DBA/2 and C57BIJ6 mice. Neither orally administered

82

‘ \I \.
l\1\ ii

If

B[a]P at doses as high as 10 mg/kg body weight nor subcutaneously injected 3- or 9—
hydroxy-B[a]P at doses as high as 20 mg/kg induced uterine wet weight or uterine
lactoferrin mRNA levels in either strain. These data suggest that B[a]P metabolites that
are estrogenic at high concentrations in vitro do not induce estrogenic effects in the

mouse UICI'US.

83

INTRODUCTION

Interest in identifying natural and synthetic xenobiotic compounds that are able to
elicit ER-mediated adverse effects has increased in recent years. It has been suggested
that exposure to estrogenic substances at critical times during development may disrupt
normal structural and functional development of estrogen-responsive tissues, including
the reproductive tract, mammary glands, central nervous system, cardiovascular system.
and bone (500, 501). This has resulted in heightened concern that exposure to natural and
synthetic estrogenic chemicals may adversely affect human and wildlife health.

Compounds of diverse structure have the ability to bind to the estrogen receptor
isoforms EROt and ERB, though they often share some general structural features with E2
and other endogenous estrogens. Recent crystallization of the LED of both EROt and ERB
in the presence of agonist or antagonist has revealed the nature of the binding pocket,
which is both lined with hydrophobic amino acids and contains specific residues for
hydrogen-bonding with the hydroxyl groups of the ligand (18, 502). Interestingly, some
4- or 5-ring carcinogenic polycyclic aromatic hydrocarbons (PAHs), such as
benzo[a]pyrene (B[a]P), are isosteric to sex steroids (see Figure 1) and are able to induce
tumor formation in estrogen-responsive tissues such as the mammary gland, ovary, and
uterus (503-505). Furthermore, B[a]P has been reported to adversely affect ovarian
follicle growth, ovulation, and corpora lutea formation (506, 507) and to produce a weak
estrus-like response in the rodent uterus (508).

PAHs are a class of environmental pollutants that are formed during the
incomplete combustion of organic matter. As a result, they may be released into the

environment during vehicle use, incineration, forest fires, and many other human

84

activities and natural processes. Although B[a]P and other PAHs can be detected in
water, soil, sediments, and adsorbed to air particulates, it has been estimated that 97% of
human exposure to B[a]P occurs though ingestion of food, primarily meat, dairy, and
produce (509). Human daily intake of B[a]P is estimated to be approximately 1.1 to 2.2
ug/adult/day, with much higher exposure levels occurring in smoking and occupationally
exposed individuals (509, 510).

The majority of B[a]P studies to date have examined the mutagenicity and
carcinogenicity of B[a]P metabolites. B[a]P is known to be biotransfonned to polar
metabolites by a subset of the cytochrome P450 metabolizing enzymes. It is
predominantly metabolized by the CYP1A1 isozyme, but 1A2, 2A1, 3A4, and 181 can
also contribute, with at least 4 other isozymes playing minor roles (511-515). The
specific metabolites formed in many in vitro and in vivo systems have been identified,
and while there are quantitative differences in the amount of each metabolite formed in
cells from different sources, the identities of the metabolites remain essentially constant
regardless of the species or tissue type: 1-, 3-, 7-, and 9-OH-B[a]P, 4,5-, 7,8-, and 9,10-
diOH-B[a]P, and 1,6-, 3,6-, and 6,12-B[a]P-dione (516-518).

B[a]P has recently been shown to induce in vitro gene expression mediated
though the D, E, and F domains of human EROt (Gal4-hERadef) (519), whereas it
reportedly acts in an antiestrogenic manner in other in vitro systems (520, 521). In this
study the possible in vitro and in vivo estrogenic activity of B[a]P and its major

metabolites was further examined.

85

MATERIALS AND METHODS

Chemicals and biochemicals

B[a]P (97% purity) was obtained from Aldrich (Milwaukee, WI). 4,5-diOH-
B[a]P, 7,8-diOH-B[a]P, 9,10-diOH-B[a]P, B[a]P—1,6-dione, B[a]P-3,6-dione, B[a]P 6,12-
dione, 3-OH-B[a]P, and 9-OH-B[a]P (all _>_ 98% purity) were obtained from NCl
Chemical Carcinogen Reference Standard Repository (Kansas City, MO). l-OH—B[a]P

and 7-OH-B[a]P were kindly provided by Dr. Harish Sikka (SUNY Buffalo, NY). 170t-

Ethynyl estradiol (EE), 17B-estradiol (E2), and dimethyl sulfoxide (DMSO) were
obtained from Sigma Chemical Co. (St. Louis, MO). [2,4,6,7,l6,17-3H]-E2 ([3H]E2; 123
Ci/mmol) and [732P]dATP (3000 Ci/mmol) were obtained from NEN Life Science
Products (Boston, MA). Fetal bovine serum (FBS) was obtained from Intergen (Purchase,
NY). Phenol red-free Dulbecco's Modified Eagle Medium (DMEM), antibiotics,
Superscript II reverse transcriptase, and Taq DNA polymerase were purchased from Life
Technologies (Rockville, MD). T4 polynucleotide kinase (PNK) was obtained from New
England Biolabs (Beverly, MA). RNAse inhibitor was obtained from Promega (Madison,
WI). Restriction enzymes and dNTPs were obtained from Boerhinger Mannheim
(Indianapolis, IN). D-luciferin was purchased from Molecular Probes (Eugene, OR). All

other chemicals were of the highest quality available from commercial sources.

Construction of Plasmids.

The plasmid pGEX-hERordef was constructed by PCR amplification of the human

EROt (Dr. P. Chambon, IGBMC, Illkirch, France) DEF domains (amino acids 264-595) as

86

previously described (522). The pGal4-mERBdef was constructed by PCR amplification
of amino acids 159-485 of the mERB (kindly provided by Dr. V. Giguére, Montreal,
Quebec, Canada), using forward primer (5’-aaaagaattcctcgagcctgcgacttcgcaagtgttacgaa-
3’) and reverse primer (5 ’-aaaagcggccgcagatcttcactgtgaatggaggttctggga-3’). The
fragment was digested with XhoI and ClaI and ligated into the similarly digested
eukaryotic expression vector containing the DNA binding domain of the yeast
transcription factor Gal4, pG4MpolyII. PCR amplification was performed essentially as
previously described (523) using Vent DNA polymerase in a reaction mixture containing
Therrnopol buffer, 200 ttM dNTPs, 1 mM MgSO4, 500 nM primer and 1.25 IU of
polymerase. The mixture was heated to 94°C for 5 min followed by 35 rounds of 94°C for
45 s, 60°C for 45 s and 72°C for l min 45 s. The sequence of each construct was
confirmed by restriction enzyme digest and ABI/Prism automated sequencing (Perkin

Elmer Applied Biosystems; Foster City, CA).

Competitive Ligand Binding Assay

The method used for the competitive binding assays has recently been described
in detail (522), but is outlined briefly as follows. Experiments were performed using
either a bacterially expressed fusion protein consisting of glutathione-S-transferase and
the D, E, and F domains of human EROL (GST-hERordef, >85% purity (522)) or full
length human ERB (hERB, >80% purity, Panvera, Madison, WI). The receptor was first
diluted in TEGD buffer (10 mM Tris pH 7.6, 1.5 mM EDTA, 1 mM DTT, and 10% (v/v)
glycerol) containing 1 mg/ml BSA as a carrier protein. An aliquot (240 pl) was incubated

at 4°C for 2 h with 5 pl of 2.5 nM [3H]E2 and 5 [J] of unlabeled competitor (1 pM to l

87

uM final concentration of E2, or 60 nM to 20 uM final concentration of B[a]P or
metabolite). The [3H]E2 and all competitor compounds were dissolved in DMSO, with
the DMSO concentration in the final mixture not exceeding 4%. The fusion protein
preparation was diluted in order to ensure 10,000 dpm of total binding in each tube.

Each concentration was tested in quadruplicate and at least 3 independent
experiments were performed. Results are expressed as percent specific binding of [3H]E2
versus log of competitor concentration. Analysis was performed using nonlinear
regression with the single site competitive binding option of GraphPad Prism 3.0
(GraphPad Software Inc., San Diego, CA). Reported IC50 values denote the calculated
concentration of test compound required to displace 50% of the [3H]E2 from the fusion

protein.

Cell Culture

MCF-7 human breast cancer cells were kindly provided by Dr. L. Murphy
(University of Manitoba, Winnipeg, Manitoba, Canada). Cells were maintained in
DMEM supplemented with 10% FBS, and with 20 mM HEPES, 2 mM L-glutamine, 100
IU/ml penicillin, 100 ug/ml streptomycin, 2.5 jig/ml amphotericin B, and 50 ug/ml
gentamicin. Cells were grown at 37°C in a 4% CO2 humidified environment.

Transfection and Reporter Gene Assay

Transfections were performed essentially as previously described (519). MCF-7
cells were plated in 6-well culture dishes at approximately 50% confluency, in 2 ml of
media supplemented with 6% FBS than had been stripped with dextran-coated charcoal,
and allowed to attach for 6 h. Cells were then transiently transfected with three plasmids,

using the calcium phosphate co-precipitation method (524): 1) 1.5 ug 17m5-G-Luc

88

(provided by Dr. P. Chambon), 2) 0.2 pg Gal4-hEROtdef (Gal4 linked to D, E, and F
domains of hERa; also known as Gal4-HEGO) or Gal4-mERBdef (Gal4 linked to D, E,
and F domains of mouse ERB, and 3) 0.2 u g pCMV-lacZ, a B-galactosidase expression
vector used for normalizing transfection efficiency across wells (Amersham Pharmacia).
After 18 h cells were rinsed twice with sterile phosphate-buffered saline and fresh media
was added. Cells were then treated by adding 2 ul of test compound dissolved in DMSO
to 2 ml of media, so that the total concentration of DMSO did not exceed 0.1% unless
otherwise noted. The cells were harvested after 24 h of treatment, and luciferase and B-
galactosidase activity was measured using standard protocols (524, 525).

Each treatment was performed in duplicate, and two aliquots were assayed from
each well, so that means and standard deviations were calculated using four
measurements. Independent experiments were performed at least three times, and results
are expressed as fold induction, representing luciferase activity of treated cells divided by
that of solvent-treated cells, normalized for B—galactosidase activity. GraphPad Prism 3.0
was used for graphical analyses, including EC50 values, which denote the concentration

of test compound required to cause 50% of the maximal response induced by E2.

Uterotrophic Assay

C57BL/6 and DBA/2 mice ovariectomized by the vendor on postnatal day 20
were obtained from Charles River Laboratories (Raleigh, NC). The mice were kept in
cages containing cellulose fiber chips (Aspen Chip Laboratory Bedding, Northeastern
Products, Warrensberg, NY) in a 23°C HEPA-filtered environment with 30-40%

humidity and a 12 h light/dark cycle. Animals were allowed free access to deionized

89

water and Harlen Teklad 22/5 Rodent Diet 8640 (Madison, WI). Mice were acclimatized
for four days prior to dosing. On the fourth day, animals were weighed, and doses of EB
and B[a]P were prepared in sesame oil (Loriva, Ronkonkoma, NY) based on the average
weight of the animals. Beginning the following day, each mouse was gavaged with a 0.1
c.c. dose of 0.1 mg/kg/day EE, or 0.1, 1, or 10 mg/kg/day B[a]P for three consecutive
days. At 24 h following the third treatment, animals were sacrificed by cervical
dislocation, and uteri were excised, separated from attached connective tissue, blotted,
weighed, and stored in RNAlater storage solution (Ambion Inc., Austin, TX) at -80°C
until further use. Studies with 3- and 9—OH-B[a]P were performed as described above for
B[a]P, except that solutions were injected subcutaneously with a 25-gauge needle at a
dose level of 1, 5, 10, or 20 mg/kg/day.

RT-PCR of lactoferrin mRNA

Uteri were thawed in the storage solution, transferred to a tube containing 0.5 ml
Trizol (Life Technologies), minced with sterile scissors, and homogenized using a
Polytron tissue homogenizer (Kinematica, Lucerne, Switzerland) for three pulses of 15 s
each at 85% output. Total RNA extraction was performed by the Trizol method according
to the manufacturer’s instructions.

Samples were reverse transcribed and then PCR-amplified using specific primers
for lactoferrin (LF) or for B-actin (A) in separate tubes. The primers used were as
follows, with restriction enzyme sites (to allow subcloning and sequencing to verify the
identity of the amplified product) underlined and indicated in brackets: LF forward 5'-
aaaagaattcggatccgggacacttcgtccatacctgaa-3' (EcoRI, BamHI); LF reverse 5'-

aaaactcgaggcggccgcgctatcacatcctgctgctttttat-3' (Xhol, NotI); A forward 5'-

90

aaaaggatccaagcttctgaagtaccattgaacatggca-3' (BamHl, HindIII); A reverse 5'-
aaaactcgaggcggccgctgtcacgcacgatttccctctcag—3' (XhoI, NotI).

The lactoferrin primer pair was designed to amplify a 632 bp product from nt 436
to 1067 of the cDNA, and the actin primer pair was designed to amplify a 436 bp product
from nt 121 to 556. A 1 pg aliquot of RNA was incubated with 20 pmol reverse primer
for 12 minutes at 70°C, cooled quickly on ice, and then mixed with First Strand Buffer,
200 IU SuperScript II reverse transcriptase, 10 nmol each dNTP, 200 nmol DTT, and 20
IU RNase inhibitor, in a 20 pl final reaction volume. The mixture was then incubated for
50 min at 42°C followed by 15 min at 70°C using a RoboCycler Gradient 96 PCR
machine (Stratagene, La Jolla, CA).

Lactoferrin and actin forward primers were end—labeled with [y3zP]dATP to
facilitate quantitation of PCR products. A mixture of PNK buffer, 75 IU PNK, 50 nmol of
primer, and 5 pl [y32P]dATP in DEPC-treated water was incubated at 37°C for 30 min, an
additional 50 IU of PNK was added, and the mixture was incubated another 30 min. Final
reaction volume was 300 pl. Unincorporated nucleotides were removed using a
MicroSpin G-25 spin column (Amersham/Pharmacia) according to the manufacturer’s
directions.

A 2 pl aliquot (10%) of the cDNA product was then combined with PCR Buffer,
2.5 TU Taq DNA polymerase, 75 nmol MgCl2, 10 nmol each dNT P, 20 pmol reverse
primer, 5 pmol labeled forward primer, and 15 pmol unlabeled forward primer. The 50 pl
reaction mixture was subjected to the following cycling temperature program: 3 min at
94°C; 24 cycles of: 30 sec at 94°C, 30 sec at 67°C, 60 sec at 72°C; 10 min at 72°C.

Samples were run on a 5% acrylamide gel, which was dried and exposed to a Molecular

91

 

 

Dynamics (Sunnyvale, CA) storage phosphor screen for 16 hr. The signals were
quantitated using a Molecular Dynamics Storm 820 scanner and ImageQuaNT v. 4.2a
software. Lactoferrin levels were normalized using B-actin mRNA levels, which were

assumed to be unaffected by treatment.

Statistical Analyses

Increases in uterine weight above that of vehicle-treated controls were determined
using an analysis of covariance with body weight at time of sacrifice as a covariate.
followed by the Fischer’s multiple pairwise comparison procedure of Systat v. 5.04
(Systat, Inc., Evanston, IL). A log transformation was performed if group variances (body

weight or uterine weight) had p<0.01 using Bartlett’s test for homogeneity.

RESULTS

Competitive binding to GST-hERadef and full-length hERB

Table 1 and Figure 2 summarize the results of the competitive binding assay for
E2, B[a]P, and the 10 B[a]P metabolites. E2 exhibited ICSO values of approximately 5.5
nM for both ERor and ERB. Studies of B[a]P and its metabolites showed that only the
monohydroxylated B[a]P metabolites possessed any affinity for either receptor isoform
over the range of concentrations tested. 10 pM 3-OH-B[a]P caused approximately 60%

displacement of [3H]E2 from hEchdef, while 1-, 7-, and 9-OH—B[a]P caused 20-40%

displacement. These four compounds all showed higher binding affinity for hERB, and

92

ICSO values were calculated for l-, 3-, and 9-OH-B[a]P (2.6 pM, 49 nM, and 1.0 pM

respectively), which each caused ~ 100% displacement of [3H]E2.

Gal4-hEROtdef- and Gal4-mERBdef-mediated gene expression

The results of the reporter gene expression assays are summarized in Table 1 and
Figure 3. As shown in Figure 3A, 3- and 9—OH-B[a]P caused higher induction of Gal4-
hERor-mediated gene expression than did comparable concentrations of parent B[a]P. In
particular, at a concentration of 10 pM the two metabolites induced luciferase activity
comparable to that obtained with 10 nM E2, while B[a]P itself caused only 30-50% of
that level of response. 1- and 7-OH-B[a]P caused a low level of induction, while no other
metabolites yielded any detectable response at the concentrations used. When cells were
treated simultaneously with E2 and B[a]P, Gal4-hEROtdef-mediated induction of reporter
activity appeared to be additive, as shown in Figure 4.

Figure 3B shows that, in contrast to results with Gal4-hEROtdef, B[a]P and all
four monohydroxylated metabolites highly induced Gal4-mERBdef-mediated reporter
gene expression. B[a]P and 3-, 7-, and 9-OH-B[a]P all displayed EC50 values in the 200—
450 nM range, approximately 103-fold higher than that of E2 (Table 1). Again, no
dihydrodiol or dione metabolites showed any appreciable activity. Interestingly, Gal4-
mERBdef consistently did not show as strong an additive response as Gal4-hEROtdef

when cotreated with B[a]P and 0.1 nM E2 (Figure 48). Furthermore, no additive
response was observed when B[a]P was cotreated with 1 nM E2.

Uterotrophic assay and expression of uterine lactoferrin mRNA

93

Mice were dosed with B[a]P by oral gavage, in order to simulate dietary
exposure. While EE (0.1 mg/kg) caused a statistically significant increase in uterine wet
weight (6-fold; p<0.001) in both the DBA/2 and C57BL/6 strains, B[a]P was not found to
cause an increase in uterine wet weight or uterine lactoferrin mRNA expression at any of
the concentrations studied (Table 2 and Figure 5). Similarly, when EE or 3— or 9-OH-
B[a]P were administered to mice by subcutaneous injection, in order to bypass first-pass
metabolic effects, EE caused a 6-fold and lO-fold increase in uterine weight in DEA/2
and C57BL/6 mice respectively (p<0.05), while no response was seen in 3- and 9-OH-
B[a]P-treated mice, as summarized in Table 3. This lack of response was also reflected in
the absence of changes in uterine lactoferrin mRNA in either mouse strain, as shown in
Figure 5. EE, B[a]P, and B[a]P metabolites were not found to adversely affect body
weight during the dosing periods (data not shown), and body weight was not found to be

a significant covariate in any of the experiments at the p<0.02 level of significance.

DISCUSSION

The ability of B[a]P to induce Gal4-hEROtdef-mediated gene expression in
transiently transfected MCF-7 cells has been previously reported (519). Since patterns of
PAH metabolism can vary by gender, species, tissue, individual, dosing route, and
duration (526-530), determining whether a compound itself or certain metabolites are
responsible for observed effects may help to identify potentially sensitive tissues and
organs. Numerous studies have measured the extent of B[a]P metabolism in a variety of
tissues and organisms, and although different cell types exhibit characteristic metabolic

profiles, the identity of the metabolites formed remains generally constant: l-, 3—, 7-, and

94

9-OH-B[a]P; 4,5-, 7,8-, and 9,10—diOH-B[a]P; and B[a]P-l,6-, 3.6-, and 6,12-dione have
been repeatedly identified in a number of cell-free and cultured cell systems, and in
whole animal metabolism studies. Of these compounds, only l-, 3-, 7- and 9-OH-B[a]P
were found to effectively compete with [3H]E2 for binding to either ER isoform and to
cause ER-mediated gene expression in MCF-7 cells. Previous studies have reported that
l-, 2-, 5-, 6-, 11-, and 12-OH-B[a]P partially displace [3H]E2 from the ER in rat uterine
cytosol (531), but the affinity of these compounds was very weak compared to the
monohydroxylated metabolites examined in the present study.

B[a]P itself was not able to bind to either receptor isoform, but induced hERa-
and mERB-mediated luciferase reporter expression in MCF-7 cells. The ability of
monohydroxylated B[a]P metabolites to bind and induce gene expression mediated
through both ER isoforms suggests that these metabolites are responsible for the increase
in reporter gene expression observed in MCF-7 cells treated with B[a]P. This is
consistent with previous studies reporting that B[a]P is not able to compete appreciably
with [3H]E2 for binding to recombinant full—length hERot (521), but is able to compete
for ER binding in an MCF-7 whole-cell binding assay (520). Similar results would be
expected using hERB rather than mERB, since these two receptors share a high degree of
similarity (89% amino acid identity in the DEF region).

Though it is known that the P450 content of cultured cells may differ greatly from
that of the cells of an intact organism (532), MCF-7 cells are known to express several
P450 isozymes, including 1A1, 1A2, and 181 (533, 534), and to exhibit aryl hydrocarbon
hydroxylase and ethoxyresorufin-O-deethylase activity (535). The data presented here

suggest that B[a]P-exposed MCF-7 cells are biotransforming the compound to estrogenic

95

metabolites. It has recently been shown that MCF-7 cells leave much of the B[a]P
unmetabolized, but also produce several hydroxylated metabolites including 3- and 9-
OH-B[a]P, and that Gal4—hEROLdef-mediated induction of reporter gene expression
caused by these two metabolites is abrogated by treatment with or—naphthoflavone, a P450
inhibitor (536). Dihydrodiol and dione metabolites were ineffective at either binding or
inducing ER-mediated gene expression. The finding that monohydroxylated B[a]P
metabolites act as weak ER agonists is consistent with studies showing that high-affinity
ER ligands such as E2 and the hydroxylated PAH 3,9-dihydroxy-benz[a]anthracene tend
to possess a hydroxyl group at each end of the molecule (537), while the removal of
either hydroxyl group from E2 results in detectable but greatly reduced estrogenic
activity (31, 538).

The effects of B[a]P were also examined in vivo, in order to evaluate its ER-
mediated effects in the context of an intact organism, which includes serum binding
proteins and a full complement of oxidative and conjugative enzymes of metabolism.
Increased uterine weight, which is considered to be a hallmark of E2 activity, and
increased lactoferrin mRNA expression are both accepted, sensitive markers of estrogen
action (31, 539, 540). Orally administered B[a]P did not cause a detectable increase in
uterine weight or lactoferrin mRNA levels in ovariectomized immature C57BL/6 (‘PAH-
responsive’) or DBAl2 (‘PAH-nonresponsive’) mouse strains at the doses used. The use
of differentially responsive mouse strains is reflective of the heterogeneity of metabolic
pathways in the human population (541), where responsiveness refers to ability of ligand-
aryl hydrocarbon receptor (AhR) complexes to induce the expression of specific P450

isozymes. The resulting increased P450 activity induces metabolism of a variety of PAHs

96

that are ligands for the AhR, including B[a]P (542, 543). As a result, these compounds
are able to induce their own metabolism, particularly in animals possessing highly
inducible CYP1A1, such as the C57BL/6 strain (544, 545).

B[a]P is known to be distributed rapidly within the body (546), and its metabolites
can readily penetrate cell membranes (518, 547). Although a large proportion of
administered B[a]P remains unmetabolized (548), 3- and 9—OH-B[a]P are known to be
major metabolites in CS7BL/6 and DBA/2 mouse strains, whether B[a]P is given as a
single dose or is able to cause induction of P450 enzymes by treatment over a period of
several days (528, 549). The lack of uterotrophic or lactoferrin mRNA induction effect
observed in B[a]P-treated mice in the present study therefore suggests that either 1)
monohydroxylated B[a]P metabolites are not formed by these mice at levels sufficiently
high to induce an estrogenic response, 2) the weakly estrogenic B[a]P metabolites are
acting as antiestrogens overall in vivo by displacing stronger endogenous estrogens from
the binding sites, 3) the metabolites are conjugated and excreted before reaching the
target tissue, or 4) monohydroxylated B[a]P metabolites exhibit tissue-specific gene
expression activities that do not lead to an increase in uterine wet weight or lactoferrin
mRNA expression. The lack of response following s.c. injection of up to 20 mg/kg of 3-
or 9—OH-B[a]P is evidence against the first possibility, and suggests that the metabolites
are excreted quickly or are not acting as estrogens on the specific uterine endpoints
examined.

These results Show that ER binding and ER-mediated gene expression studies of
B[a]P did not accurately predict the lack of observed in vivo estrogenicity in the C57BU6

or DBA/2 mouse uterus. Moreover, though the present study provided little evidence of

97

 

non-additive interactions between B[a]P metabolites and E2 in MCF-7 cells, other
researchers have reported contrasting findings. For example it has been reported that
B[a]P can antagonize the estrogenic activities of E2 in yeast expressing hERa (521) and
cause a decrease in E2-induced MCF-7 cell proliferation (520) and nuclear ER levels
(550). It has been hypothesized that many of the antiestrogenic effects observed with
PAHs are mediated through the AhR. B[a]P and many other PAHs exhibit high binding
affinity for the AhR (542, 543), a ligand—dependent transcription factor that modulates the
expression of specific genes by binding to the xenobiotic response element (XRE, also
known as DRE). Binding of a PAH or other ligand to the AhR could produce an
antiestrogenic response by increasing the rate at which E2 is transformed to less active
metabolites, or by allowing the AhR-ligand complex to alter the transcription rate of E2-
inducible genes by binding to XRE sequences in the promoters of these genes (551-553).
Importantly, the published reports demonstrating an antiestrogenic effect of B[a]P
do not account for interactions of B[a]P metabolites with ERB, which has been shown to
be absent or nearly absent in MCF-7 cells (554). hERa and hERB are fairly well
conserved in the regions of the LBD forming the ligand binding pocket, and while some
studies have reported that many compounds display a similar affinity for each isoform,
others have demonstrated significant differences with certain ligands (502, 554, 555). In
addition, ERB has been found to have a slightly lower affinity for the ERE, as well as for
E2, compared with EROt, though their abilities to transactivate reporter genes when bound
to E2 are very similar (556). The in vitro preference of monohydroxylated B[a]P
metabolites for ERB over EROt in the present study, as well as the distinct behavior of the

two isoforms in the cotreatment experiments is therefore of particular interest, since the

98

extent to which these two isoforms have overlapping or distinct roles is currently an area
of intense research. Interestingly, in this study individual metabolites showed distinct
behaviors that emphasize the importance of hydroxyl group placement, as illustrated, for
example, by the greater EC50 value for 3-OH-B[a]P relative to its IC50 in the ERB test
systems, while the reverse was true for 7- and 9-OH-B[a]P. The lack of correlation
between relative binding affinity and the level of reporter gene induction may be due, in
part, to ligand-induced allosteric changes that affect ER complexzDNA interactions (557).
The ligand may also induce conformational changes that affect interactions with
coactivators (558), which could influence the induction of gene expression. For example,
genistein has been found to exhibit a 30—fold greater affinity for hERB relative to hERa,
but induced comparable levels of hERa- and hERB-mediated reporter gene expression
(554, 559). This may partially explain the lack of correlation between relative binding
affinity and gene expression observed for some B[a]P metabolites.

Moreover, the heightened combined ability of B[a]P (through its metabolites) and
E2 to induce reporter gene expression in the ERa compared to the ERB test system was
surprising. B[a]P affects a number of cellular processes, and therefore the apparent
synergistic effects may be due to cross-talk between mechanisms that converge at EROt
but not ERB. Although both receptors have a similar structure, hERB shares only 58%
amino acid sequence identity with hERor in the ligand binding domain (Domain E) (560).
This difference may partially account for the enhanced activity with EROt but not ERB.

No evidence of estrogenic effects of B[a]P was found in the mouse uterus,
suggesting that in vitro studies of estrogenic activity should be interpreted with caution.

Furthermore, these findings suggest that as further information is gained regarding the

99

biological properties of ERB, appropriate in vivo studies should be designed that examine
effects in tissues such as the ovaries and bone, which, unlike the uterus, express high
levels of ERB. Future studies will be designed to clarify these issues, with the aim of

developing in vitro assays that accurately predict in vivo estrogenic responses.

 

 

100

 

Table 1. In vitro competitive binding ICSO and gene expression EC50 values for E2, B[a]P.
and B[a]P metabolites.

 

Compound GST-hERadef hERB ICso Gal4-hERadef Gal4-mERBdef

 

ICso ECso ECSO
E2 5.5 x 1.2 nM 5.6: 1.1 nM 350:240 pM 130:24 pM
B[a]P nbb nb wie 330 a 49 nM
l-OH-B[a]P nb 3.3 r 0.2 pM wi 3.2 x 1.0 pM
3-OH-B[a]P >10 pMC 90 i 57 nM 3.2 x 3.3 pM 210 i 110 nM
7-OH-B[a]P nb >10 pM wi 430 i 10 nM
9-OH-B[a]P wb° 2.0 1 1.0 pM 1.2 i 3.3 pM 430 i 110 nM
4,5-diOH-B[a]P nb nb nif ni
7,8-diOH-B[a]P nb nb ni ni
9,10-diOH-B[a]P nb nb ni ni
B [a]P- 1 ,6-dione" nb nb ni ni
B[a]P-3,6-dionea nb nb ni ni
B[a]P-6,12-dione" nb nb ni ni

 

amaximum concentration tested was 2.5 pM due to solubility limitations

bnon-binder, defined as a compound that, at 10 pM, causes <10% displacement of [3H]E2
°3>10 pM denotes a compound that, at 10 pM, causes >50% but not full displacement of

[ H]E2

dwb denotes a weak binder, defined as a compound that, at 10 pM, causes 10-50%
displacement of [3H]E2

cwi denotes a compound that, at 10 pM, induces reporter gene expression at <50% of
maximal induction caused by 10 nM E2

fni denotes a compound that, at 10 pM, induces reporter gene expression at <10% of
maximal induction caused by 10 nM E2

101

Table 2. Effect of orally administered ethynyl estradiol (EE) or benzo[a]pyrene (B[a]P)
on blotted uterine wet weight (UW) in ovariectomized DBA/2 and C57BU6 mice.

 

 

Strain Treatment Dose BW UW UW/BW
(mg/kg) (g) (mg) (mg/g)

DBA/2 Sesame oil - 12.9 1 1.9 5.9 1 2.4 0.45 1 0.15

EE 0.1 13.3 1 1.5 33.3 1 6.6** 2.5 1 0.44

B[a]P 0.1 12.9 1 2.3 6.3 1 2.5 0.48 1 0.14

1 13.1 1 2.1 4.8 1 1.9 0.36 1 0.09

10 11.8 1 2.5 5.6 1 2.3 0.53 1 0.32

C57BL/6 Sesame oil - 11.8 1 1.7 3.7 1 2.0 0.31 1 0.14

EE 0.1 10.0 1 3.6 20.6 1 3.5** 1.44 1 0.82

B[a]P 1 11.3 1 1.2 3.5 1 0.8 0.30 1 0.06

10 10.8 1 2.0 3.6 1 1.2 0.33 1 0.09

 

** denotes significant increases in uterine weight above vehicle-treated controls
(p<0.001, n=5).

102

Table 3. Effect of subcutaneously administered ethynyl estradiol (EE) or 3- or 9-hydroxy-
benzo[a]pyrene (OH-B[a]P) on blotted uterine weight (UW) in ovariectomized DBA/2
and C57BL/6 mice.

 

 

 

Strain Treatment Dose BW UW UW/BW
(Imus) (it) (no (mag)

DBA/2 Sesame oil - 16.1 1 0.4 4.7 1 1.5 0.29 1 0.10
EE 0.1 17.4 1 0.7 28.0 1 8.4** 1.62 1 0.53
3-OH-B[a]P 1 15.7 1 0.7 4.6 1 2.2 0.25 1 0.18

5 15.4 1 0.9 5.8 1 1.3 0.38 1 0.09

10 15.9109 4611.9 02910.12

20 16.0 11.1 5.7 1 2.7 0.35 1 0.17

9-OH-B[a]P 1 15.9 1 1.6 3.8 1 1.2 0.24 1 0.07

5 16.0 1 0.7 5.8 11.4 0.36 1 0.08

10 15.6103 6.1121 03910.13

20 15.8 11.1 6.6 11.5 0.411 0.07

C57BL/6 Sesame oil - 16.9 1 0.7 2.2 1 1.0 0.06 1 0.06
EE 0.1 16.7 1 0.6 22.2 1 3.9** 1.33 1 0.26
3-OH-B[a]P 1 16.1 1 1.6 4.4 1 3.4 0.28 1 0.24

5 16.6 1 2.0 5.5 1 3.9 0.35 1 0.27

10 16.7 1 0.6 4.3 1 2.4 0.21 1 0.17

20 15.5 10.9 3.3 10.9 0.171011

9-OH—B[a]P 1 16.2 1 1.8 7.9 1 5.1* 0.50 1 0.34

5 16.3 1 0.6 9.2 1 8.7* 0.57 1 0.54

10 16.6 1 0.8 4.0 1 1.3 0.24 1 0.07

20 171114 5.7 11.9* 0.34 1 0.13

 

** denotes significant increases in uterine weight above vehicle-treated controls
(p<0.001, n=5); * denotes increases at the level p<0.05 level.

103

Figure 1. Chemical structures of l7B-estradiol (E2) and benzo[a]pyrene (B[a]P), with
position numbers labeled.

12 1

 

17j3-Estradiol Benzo[a]pyrene

104

Figure 2. Competitive displacement curves for E2, B[a]P, and B[a]P metabolites
displacing 2.5 nM [3H]E2 from (A) GST-hERadef and (B) hERB.

A
120-

 

1 00-

E2

B[a]P
1-OH-B[a]P
3-OH-B[a]P
7-OH-B[a]P
9-OH-B[a]P

80-

% [3H]E2 Bound
$
[3 O O 4 F I

 

  

 

 

 

 

I I

4'0 -9 -8 -'7 -6 -5 -4
Log [Competitor] (M)

 

1 20-

100-

80-

60-

404

°/. [311152 Bound

20-

 

 

' I l U
-12 -11 -1O -9 -8 -7 -6 -5 -4

Log [Competitor] (M)

105

Figure 3. Induction of (A) Gal4-hERocdef— and (B) Gal4—mERBdef-mediated reporter
gene expression in transiently transfected MCF-7 cells treated for 24 hrs with E2, B[a]P.

or B[a]P metabolites.

 

A
3 .
a, 100
.2
E 80-
g x
a l E2

5 NE °°l A B[a]P
.3 in v 1-OH-B[a]P
3 40‘ o 3-OH-B[a]P
'2 o 7-OH-B[a]P
-; 20- CI 9—OH-B[a]P
o\

o

 

 

 

-1'2 -1'1 -1'0 :9
Log Concentration (M)

% Induction Relative to
Ezmax

 

 

 

 

-12 -1'1 -1'0 :9 -8 -!I -6 -5
Log Concentration (M)

106

Figure 4. Results of cotreatment of E2 and B[a]P on hERa—mediated reporter gene
expression in MCF—7 cells.

A

Fold lnduction relative to 10 nM E2

Fold lnductlon relatlve to 10 nM E2

300 -

250 -

200 -

150-

100-

 

DMSO 0.1nM1nM 10nM 0.1pM lpM lOpM 0.1pM 1pM lOpM 0.1pM 1pM 10pM

 

£2 B[a]P B[a]P + 0.1 nM B[a]P + 1 nM
52 52

120-
100-
80-
60s
40-

20-

 

 

DMSO 0.1nM 1nM 10 nM 0.1pM 1pM 10 pM 0.1pM lpM lOpM 0.1pM 1pM 10 pM

 

52 B[a]P B[a]P + 0.1 nM B[a]P ,. 1 nM
52 52

107

Figure 5. Representative gel showing uterine lactoferrin (LF) and actin (A) expression in
ovariectomized D2 and C57 mice treated with vehicle, EE, or 20 mg/kg 3- or 9-OH-

B[a]P.

DEA/2 strain

 

 

 

 

 

vehicle EE 0.1mg/kg 1mglkg 10 mglkg

B[a]P B[a]P B[a]P

CS'IBLIS strain

Y _ w ..
‘ ~ ‘ ‘.,-\'. ‘
w I m
l {- "LL..\-AV ‘v
,1}. in ' .
l 4' i
. ‘.‘ “ 4A N- .
. - j
V. w
b r
<- n 1 ~
v .f ’
L1 .

vehicle EE

 

 

   

10mglkg B[a]P

108

 

.VT. .

 

W
vehicle EE 20mglkg 20mglkg

3-OH-B[e]P 9-Oi-l-B[a]P

 

..

 

vehicle BE 20 mglkg 20 mglkg

3-OH-B[a]P 9-OH-B[a]P

CHAPTER 3

INTERACTION OF PAH-RELATED COMPOUNDS WITH THE 0t AND B

ISOFORMS OF THE ESTROGEN RECEPTOR

ABSTRACT

The ability of several 4- and 5-ring polycyclic aromatic hydrocarbons (PAHs),
heterocyclic PAHs, and their monohydroxy derivatives to interact with the estrogen
receptor (ER) alpha and beta isoforms was examined. Only compounds possessing a
hydroxyl group were able to compete with 3H—labeled l7B-estradiol (E2) for binding to
either a glutathione-S-transferase and human EROL D, E, and F domain fusion protein
(GST-hERocdef) or to the full-length human ERB. Competitive binding was comparable
for both isoforms, with IC50 values ranging from 20-300 nM (E2 IC50 approximately 3
nM). However, several compounds were able to induce reporter gene expression
preferentially through mERB, using MCF-7 cells transiently transfected with either a
Gal4-human EROLdef or Gal4-mouse ERBdef construct, as well as a Gal4-regulated
reporter. These data extend the number and type of PAH-related compounds capable of
interacting with ERa and ERB, and provides additional evidence that even though some

compounds may possess a similar affinity for both ER isoforms, the capacity for

transcriptional activation can still be isoform—specific.

109

 

INTRODUCTION

The impact of polycyclic aromatic hydrocarbons (PAHs) on health is of great
interest because these compounds are widely dispersed in the environment. While the
mutagenicity and carcinogenicity of this class of compounds has been studied extensively
(561, 562), more recent reports have also suggested that certain 4- and 5-ring PAHs can
interact with the estrogen receptor (ER) 0t and B signaling pathways in a variety of test
systems (519-521, 550, 563), potentially interfering with estrogen signaling in important
developmental and reproductive processes. Though the specific roles of the 01 and B
isoforms of the ER are not yet completely understood, they are currently being explored
using binding and gene transactivation studies (554, 555), and by examining the tissue
localization of the isoforms (500, 554, 564) and the effects of targeted disruption of the
ER genes (76, 501, 565).

While reported interactions between PAHs and the ER are weak, the large size of
this class of chemicals and the extent of their environmental distribution suggests that
further research into potential health effects is merited. In particular, there are a large
number of other polycyclic aromatic compounds (PACs), including heterocyclic PAHs,
which contain an N, S, or O in one of the rings, as well as PAHs with alkyl and other
substituents. Many of these have been reported to have mutagenic and carcinogenic
activity (566-569), but remain poorly characterized with respect to ER interactions. These
compounds are formed during the incomplete combustion of organic matter, and are
found as a complex mixture in coal furnace and vehicle emissions and cigarette smoke

(570, 571), and have been detected at high levels in the air, water, and soil near sites of

110

emissions or fuel spills (572-575). Because of the large number of PACs isosteric to 4-
and 5-ring PAHs, and their ubiquitous distribution in the environment, the possibility of
these compounds interacting with ERs is of interest.

In the present study, the ability of several PAHs, heterocyclic PAHs, and their
monohydroxy derivatives, to interact with the (it and B isoforms of the ER was examined,

using in vitro competitive binding and reporter gene expression assays.

MATERIALS AND METHODS

Chemicals

Benz[a]anthracene (B[a]A), chrysene (CR), and benzo[b]naphtho[2,3-d]thiophene
(B[b]N[2,3-d]T) were obtained from Aldrich Chemical Co. (Milwaukee, WI).
Benzo[bjfluorene (B[b]F) was obtained from Accustandard (New Haven, CT).
Benzo[c]phenanthrene (B[c]PH) was obtained from the NCI Chemical Carcinogen
Reference Standard Repository (Kansas City, MO). Benzo[a]carbazole (B[a]C) and
benzo[c]carbazole (B[c]C) were obtained from Chemsyn Science Laboratories (Lenexa,
Kansas). Benzo[b]naphtho[2,l-d]thiophene (B[b]N[2,1-d]T) was obtained from Fisher
(Pittsburgh, PA). 3-Hydroxybenzo[c]phenanthrene (3-OH-B[c]PH) was synthesized as
previously described (Kumar, 1997). S—Methylchrysene (S-MeCR) and various
hydroxylated derivatives of chrysene and 5-methylchrysene were prepared according to
published procedures (576, 577). 3—Hydroxybenzo[b]naphtho[2,l-d]thiophene (3-OH-

B[b]N[2,1-d]T and 3-hydroxybenzo[b]phenanthro[2,3-d]thiophene (3-OH-B[b]PH[2.3-

lll

d]T) were synthesized as described (578); Kumar, submitted). Structures of test
compounds are shown in Figure 1.

17B-estradiol (E2) and dimethyl sulfoxide (DMSO) were obtained from Sigma
Chemical Co. (St. Louis, MO), and [2,4,6,7,16,17-3H]-E2 ([3H]E2; 123 Ci/mmol) was
obtained from NEN Life Science Products (Boston, MA). Fetal bovine serum (FBS) was
obtained from Intergen (Purchase, NY). Phenol red-free Dulbecco's Modified Eagle
Medium (DMEM) and antibiotics were purchased from Life Technologies (Rockville,
MD), and D-luciferin was purchased from Molecular Probes (Eugene, OR). All other

chemicals were of the highest quality available from commercial sources.

Competitive Ligand Binding Assay

The method used for the competitive binding assays has recently been described
in detail (522, 563), but is outlined briefly as follows. Experiments were performed using
either a bacterially expressed fusion protein consisting of glutathione-S-transferase and
the D, E, and F domains of human EROL (GST-hEROtdef, >85% purity (522)) or full
length human ERB (hERB, >80% purity, Panvera, Madison, WI). The receptor was
incubated with [3H]E2 (2.5 nM final concentration) and with 10 pM to 1 pM final
concentration of E2, or 60 nM to 20 pM final concentration of test compound. Following
a 24 hr incubation at 4°C, bound radioactivity was measured using a scintillation counter.
The [3H]E2 and all competitor compounds were dissolved in DMSO, with the DMSO
concentration in the final mixture not exceeding 4%.

Cell Culture

112

MCF—7 human breast cancer cells were kindly provided by Dr. L. Murphy
(University of Manitoba, Winnipeg, Manitoba, Canada) and maintained as described in

(579).

Transfection and Reporter Gene Assay

Transfections were performed as previously described (579), using the following
three plasmids: 1) 1.5 pg 17m5-G-Luc (provided by Dr. P.Chambon IGBMC CNRS-
LGME, Illkirch Cedex C.U. de Strasbourg, France), 2) 0.2 pg Gal4-hERadef (Gal4
linked to D, E, and F domains of hEROt; also known as Gal4-HEGO) or Gal4-mERBdef
(Gal4 linked to D, E, and F domains of mouse ERB, and 3) 0.2 pg pCMV-lacZ, a B-
galactosidase expression vector used for normalizing transfection efficiency across wells
(Amersham Pharmacia). After 18 h cells were treated with test compound dissolved in
DMSO so that the total solvent concentration did not exceed 0.1%. The cells were
harvested after 24 h of treatment, and luciferase and B-galactosidase activity was

measured using standard protocols (524, 525).

RESULTS

Preliminary studies indicated that most PAHs with 2-6 rings (naphthalene.
acenaphthene, acenaphthylene, anthracene, fluorene, phenanthrene, fluoranthene.
cyclopenta[c,d]pyrene, benzo[b]fluoranthene, dibenzo[a,h]anthracene, perylene,
benzo[g,h,i]perylene, dibenzo[a,l]pyrene, dibenzo[a,e]fluoranthene, and indeno[l,2,3-
cd]pyrene) were not able to bind to GST-hERocdef or to induce hERadef—mediated gene

expression. However, certain 4- and 5-ring compounds, e.g. benzo[a]pyrene (B[a]P)

113

(579), B[a]A, B[b]F, and B[c]PH (this study) displayed weak agonistic interactions in the
EROL test system, and therefore these compounds were also tested in the ERB assays. All
of the PAHs mentioned above were also tested for antiestrogenicity by cotreatment with
0.1 or 1 nM E2, though only additive effects or no effect were observed.

None of the parent PAHs and their heterocyclic analogs listed in Table 1 were
able to displace [3H]E2 from either receptor isoform (data not shown). By contrast, the
monohydroxylated compounds were able to compete for binding to both receptor
isoforms, to varying degrees (Figure 2 and Table 1). For example, chrysene was unable to
compete for binding, while the hydroxylated derivatives competed in the order 2-OH-
5MeCR > 2-OH-CR > 8-OH—5MeCR, showing similar ability to compete for binding to
each receptor isoform. By comparison, the competitive binding ability of 2-OH-B[c]PH,
3—OH-B[b]N[2,1-d]T, and 3-OH-B[b]PH[2,3-d]T was somewhat weaker, but again
comparable between the two receptor isoforms.

As shown in Figure 3 and summarized in Table 1, all test compounds were able to
induce some degree of ER-mediated reporter gene response with each isoform (10 pM
inducing a response 20-60% of that of 132nm). with the exception of CR and B[c]PH.
B[a]A and B[b]F induced a level of reporter gene expression comparable to that of B[a]C
and B[c]C, but below that of B[b]N[2,l-d]T and B[b]N[2,3-d]T. Furthermore, B[a]A,
B[b]F, B[b]N[2,1-d]T, and B[b]N[2,3-d]T showed induction of reporter gene expression
that appeared to be preferentially mediated through the B isoform of the ER.

All of the monohydroxylated compounds studied, with the exception of 3-OH-
B[b]PH[2,3-d]T (parent compound not available), exhibited much higher reporter gene

induction than did the respective parent compounds. Some preference for the B isoform

114

of the receptor was seen, particularly in the chrysene-related compounds. The only
compounds to achieve a 100% induction relative to that of E2max were 2- and 8-OH-
5MeCR, which was seen exclusively in the ERB test system. All compounds in the gene
expression studies were tested at doses of up to 10 pM, but many caused cytotoxicity at
the highest concentrations, as evidenced by reduced cell number upon microscopic
examination, as well as significantly reduced B-galactosidase activity. Those
concentrations that significantly reduced B-galactosidase activity were not included in the

graphs (Fig. 3). The most cytotoxic compounds appeared to be 2-OH-5MeCR and 3-OH-

B[b]PH[2,3-d]T.

DISCUSSION

In the present study, chrysene was not found to interact with the either ER
isoform, though a previous study had reported an agonistic interaction with hERocdef
(519). GC-MS analysis of the chrysene samples used in each study revealed that the CR
sample used by Clemons et a]. (1998) was contaminated with B[b]N[2,l-d]T, B[b]N[2,3-
d]T, B[a]C, and B[c]C (Dr. B. McCarry, McMaster University, Hamilton, ON, Canada,
unpublished data). These findings stimulated interest in determining possible interactions
of the ER isoforms with benzonaphthothiophenes and benzocarbazoles, the results of
which are discussed below.

The finding that nonhydroxylated compounds were unable to compete for ER
binding but were able to induce significant ER-mediated responses agrees with previous
studies concerning the estrogenicity of monohydroxylated B[a]P metabolites (536, 579).

B[a]P was unable to compete for ER binding but caused a moderate level of gene

115

expression, comparable to that of B[a]A and B[b]F in the present study, while
monohydroxylated derivatives of B[a]P were able to bind and induce gene expression to
a much higher degree, with preference for ERB. Isoform-specific interactions are of
particular interest in light of recent information regarding the different roles of EROL and
ERB. For example, EROt has been shown to be critical for maintaining fertility and
maternal behavior (501, 580), while ERB may be more important in the maintenance of
bone mineral density (581).

Given the general structural similarity of B[a]P to compounds in the present
study, it is likely that the response seen in MCF-7 cells is due to metabolites produced by
PAH-inducible cytochrome P450 isozymes (535), which are known to produce
monohydroxylated and other metabolites of B[a]P in these cells (515, 536, 582). For
example several PACs, including B[a]A, CR, B[b]F, benz[a]acridine, and 10-aza-B[a]P
have been found to induce P450 activity following interaction with the Ah receptor,
thereby inducing their own metabolism (542, 543, 575). Furthermore, B[a]A has also
been shown to cause a decrease in nuclear ER levels suggestive of an antiestrogenic
response (550).

In addition to the PACs examined in this study, other PAH and heterocyclic PAH
compounds in environmental matrices share some structural similarity with the E2 steroid
nucleus, including some furan derivatives and nitro- and amino-PAHs. While the
metabolite profiles are likely to be similar to those of the isosteric PAHs, the heterocyclic
compounds can also be oxidized at the heteroatom, which may alter the overall activity of
the compound (583, 584). However, clear patterns of heteroatom influencing reporter

gene expression levels were not observed in the present study. For example, CR is

116

structurally related to the S—containing B[b]N[2,1-d]T and N-containing B[a]C, but CR
did not induce reporter gene activity and B[a]C exhibited little activity, while B[b]N[2,1-
d]T caused a modest induction (10 pM caused induction to 40-50% of E2max). By
contrast, isosteric B[b]F and B[b]N[2,3-d]T exhibited comparable activity (the highest
dose in each case causing 30-50% of E2max induction). Unfortunately, the isosteric N-
containing PAH, benzo[b]carbazole, was not available for comparison.

For many of the heterocyclic compounds in the present study there is little or no
metabolism data available. B[b]N[2,l-d]T is one of the best-studied, with seven
monohydroxylated metabolites and two dihydrodiols, as well as oxidation at the
heteroatom being reported using the S9 fraction of rat liver homogenate (585). The ratio
of metabolites produced, as is true for PAHs, was found to be strongly affected by
pretreatment with P450 inducers. Overall, the metabolite pattern produced from
B[b]N[2,1-d]T was similar to that of benzo[b]fluorene, with the formation of phenolic
metabolites primarily at the benzene ring and dihydrodiols in the naphthalene portion. A
separate study on the metabolism of nine thiaarenes, including B[b]N[2,1-d]T and
B[b]N[2,3-d]T, concluded that the position of the thiophene ring within the molecule
strongly influences whether phenols, dihydrodiols, or S-oxidation products are
predominantly formed (573). This is important because to date only monohydroxylated
PAHs have been found to interact with the ER (531, 579).

A comparison of the metabolism of chrysene (586) and its isoster B[b]N[2,l-d]T
(573, 585) shows that dihydrodiols are the major metabolites of CR, whereas B[b]N[2,1-
d]T produces significant amounts of phenolic metabolites. This may explain why

B[b]N[2,l-d]T, but not chrysene, is able to induce ER-mediated gene expression.

117

Similarly, the predominance of dihydrodiol metabolites formed from B[c]PH incubated
with rat liver microsomes (574) is consistent with the present finding that B[c]PH shows
only a weak reporter gene response in MCF-7 cells.

This is the first report of the agonistic interaction of several PAHs, heterocyclic
PAHs, and their monohydroxy derivatives with the ER, though the antiestrogenicity of
some B[a]C, benzo[b]thiophene, and benzo[b]furan derivatives has been explored (587,
588). Other investigators have reported antiestrogenic effects of some PAHs, including
B[a]P, B[a]A, B[b]F, and 6-OH-CR, in other in vitro test systems (520, 521). Since all of
these systems, including assays used in the present study, are highly artificial,
extrapolation to specific in vivo responses is challenging. For example, hydroxylated
B[a]P metabolites that were ER agonists in vitro were not found to affect mouse uterine
weight and uterine lactoferrin mRNA expression, two E2-inducible endpoints (579).
Instead, the present data suggest that several commonly occurring PAHs potentially can
interact, positively or negatively, with ER signaling in vivo, likely in a cell-specific
manner, and that other PACs are likely to act similarly. Therefore, due to the widespread
and continuous emission of this large group of compounds into natural, domestic, and
occupational environments, as well as their potential to bioaccumulate in lipid-rich
tissues (574, 589, 590), concern regarding potential health effects of these weak estrogens

is warranted.

118

Table 1. In vitro competitive binding IC50 and gene expression EC50 values for 17B-
estradiol (E2) and test compounds.

 

Compound GS T-hER cdef hERfl I C50 Gal4-hER alef mERfldef E C 50

 

IC50 EC50
E2 5.511.2nM 5.611.1nM 3501240 pM 130124 pM
B[a]A nb“ nb wi” wi
B[b]F nb nb wi wi
B[c]PH nb nb nic ni
CR nb nb ni ni
B[b]N[2,l-d]T nb nb wi wi
B[b]N[2,3-d]T nb nb wi wi
B[a]C nb nb wi wi
B[c]C nb nb wi wi
2-OH-CR 95 1 44 nM 42 1 14 nM wi wi
2-OH-5MeCR 28 1 12 nM 29 1 5 nM wi 63 1 35 nM
8-OH-5MeCR 180 1 26 nM 180 1 32 nM wi 320 1 230 nM
2-OH-B[c]PH 250 1 4 nM 180 1 100 nM wi wi
3—OH- 300 1 74 nM 220 1 82 nM 160 1 110 nM 40 1 22 nM
B[b]N[2,l-d]T
3-OH- 230 1 10 nM 110 1 38 nM wi wi

B[b]PH[2,3-d]T

 

° nb denotes a non-binder, which is defined as a compound that, at 10 pM, causes <10%
displacement of [3H]E2

b wi denotes a compound that, at 10 pM, induces reporter gene expression at <50% of
maximal induction caused by 10 nM E2

C ni denotes a compound that, at 10 pM, induces reporter gene expression at <10% of
maximal induction caused by 10 nM E2

119

Figure 1. Chemical structures of select polycyclic aromatic compounds under study.
Position numbers are labeled for compounds possessing functional groups.

 

17B-Estradiol (E2) 3—OH-Benzo[b]phenanthro[2,3-d]thiophene
(3-OH-B[b]N[2,3—d]T)

0000

 

Benz[a]anthracene (B[a]A) Chrysene (CR) Benzo[c]phefianthrene
(B[c]PH)
Benzotblfluorene (B[b]F) Benzo[a]carbazole (B[a]C)

Benzo[c]carbazole (B[c]C)

s 11 1 2
O 0 ‘° 0"
O 90 Q 4
Benzo[b]naphtho[2,3-d]thiophene Benzo[b]naphtho[2,1-d]thiophene
(B[b]N[2,3—d]T) (B[b]N[2,1-d]T)

120

Figure 2. Competitive binding curves for (A) chrysene derivatives and (B)
benzo[c]phenanthrene and benzothiophene derivatives displacing 2.5 nM [3H]E2 from

GST-hEROtdef and hERB.

 

 

   

  

 

 

 

 

 

A
GST-hERordef hERB
. _ I E2

3100‘ \ - A 2-OI-l-CR u ‘°°'

g eo- . o 2-Ol-l-5Mecn g 80-
rn ~ - m
N 60« . o 8-01-1 5MeCR N so-
.‘i‘. ”j E.‘
a: . . a: 40-
33 20. ° 0 a! 20.

M I I I fi 0 I I I I I
-11 -1o -9 -e -7 -6 -5 -11 -1o -9 -e -7 -6 -5
Log Concentration of Competitor (M) Log Concentration of Competitor (M)
B _ 122
A 2—OH-B[c]Pl-l 1004

100‘ e 3-OH-B[b]N[2,1-d]T '2
E o 3-OH-B[b]PH[2,3-d]‘r 3 co-
‘ig" eo- E 601
g 60- E 404
I ‘L.
”1.. 40" 3!
.\° 20. 20«

0 I I I

-11 -1o -9 -e -7 -6 -5

 

 

 

T
-8

4'1 4'0 :9 -7 -6 -5
Log Concentration of Competitor (M)

 

Log Concentration of Competitor (M)

121

Figure 3. Induction of Gal4-hERocdef- and Gal4-mERBdef-mediated reporter gene
expression in transiently transfected MCF—7 cells treated for 24 h with (A) PAHs, (B)
heterocyclic PAHs, (C) chrysene derivatives, and (D) benzo[c]phenanthrene and

benzothiophene derivatives.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

GST-hERadef mERB
A 3100‘ ' E2 8 too-
.. o B[a]A ..
g 80- A B[b]F 3 oo-
_ v B[c]PH
so- _
ill 0 ca 31 ‘°‘
3‘“ = .. .
OJ 5
a! 2 a! 20-
.. '1'? '1" '1'0 '3 ‘3 '7 '5 '5 3 4'2 4'1 4'0 F -e -7 -e -5
L09 Concentration ("1 Log Concentration (M)
B 5100- ' 52 3100-
.. O BN[2,1-d]T E
g 80- A auras-arr u '0‘
_ v B[a]C s
60‘ 004
lg o B[c]C lg
40- 40-
2 3
a! 20- a! 20-
' .1'2 .1? In .3 .3 3 .3 Jr. ' .1'2 .1'1 4'0 .3 -e .7 -s -5
Log Concentration (M) Log Concentration (M)
I 52
C 8 100. o 2-on-cn 5 100-
.§ A 2-OH-5thR g
2 ‘°‘ v eon-sneer: 2 ’°‘
- eo-i ' 60‘
Si 3
5 40: W
a 3
a! 20- ;! zo-l
' .17-1T-io .T; .3 .3 .3 .'5 .. .1'2 31 are -9 -'e 3 35 -'5
Log Concentration (M) Log Concentration (M)
I E2
0 2-OH-BlclPH 100‘
D 8 m. A 3-OH-B[b]N[2,1-d]1' §
_ v 3-OH-B[b]PH[2,3-dIT§ 80-1
g 804
- 60-1 fi 60-‘
1... 3‘“
3 a! 20-
a! 20-
o.
3 I I I I I I I I 42 -11 '10 '9 '8 '7 '5 -5
.12 .11 .10 -e .0 -7 -e -5 Log c tration (M)
Log Concentration (M)

122

CHAPTER 4

IDENTIFICATION OF TEMPORAL PATTERNS OF GENE EXPRESSION IN THE
UTERI OF IMMATURE, OVARIECTOMIZED MICE FOLLOWING EXPOSURE TO

ETHYNYL ESTRADIOL

ABSTRACT

The induction of uterine wet weight provides an excellent model to investigate
global gene expression effects elicited by estrogens. In this study, time course microarray
GeneChip data were analyzed using a novel approach to identify temporal changes in
uterine gene expression following treatment of immature ovariectomized C57BL/6 mice
with 0.1 mg/kg 170t-ethynyl estradiol. Functional gene annotation information from
public databases facilitated the association of changes in gene expression with
physiological outcomes, which allowed detailed mechanistic inferences to be drawn
regarding cell cycle control and proliferation, transcription and translation, structural
remodeling, and immunological responses. An in silico search for estrogen response
element motifs within the genomic sequence of responsive probe sets provided
complementary evidence of primary estrogen-regulated responses. These systematic
approaches were able to confirm previously established responses, identify novel
estrogen-regulated transcriptional effects, and disclose the coordinated activation of
multiple modes of action that support the uterotrophic response elicited by estrogen. For
example, it was possible to elucidate the physiological significance of the dramatic

induction of arginase, a classical estrogenic response, by elucidating its mechanistic

123

relevance and delineating the role of arginine and omithine utilization in the estrogen-

stimulated induction of uterine wet weight.

124

INTRODUCTION

Although estrogens are among the most widely prescribed pharmacological
agents (591), many aspects of their action following receptor binding remain unresolved.
In the classic model, the estrogen 17B—estradiol (E2) binds to the estrogen receptor (ER),
causing displacement of chaperone proteins. Dimers of the estrogen-ER complexes can
then act as transcription factors by binding to specific estrogen response element (ERE)
sequences in the promoters of target genes, evoking a wide range of transcriptional
responses. Recent research has revealed a vast spectrum of roles for estrogen, which, in
addition to important roles in female reproduction (592, 593), include regulation of bone
growth and mineral density (594), food intake and weight gain (595), vascular function
(390), immunological responses (596), various neurological roles (597, 598), and even in
male reproductive capacities (599). These divergent actions are mediated through two ER
isoforms, each with distinct differences in tissue distribution, coactivator and corepressor
interactions, and resulting target responses (600-604). Furthermore, rapid nongenomic
responses mediated by short-lived membrane ERs have been recently shown to stimulate
a variety of signal transduction pathways (605, 606). In addition to endogenous estrogens
and pharmacological agents, an increasing number of natural products, industrial
chemicals, and environmental contaminants have also been identified as ligands for ERs,
with varying affinities and activities (607-609), but the potential for many of these to
cause beneficial or adverse health effects is poorly understood.

Despite these diverse functions, the uterus continues to be a preferred model for
investigations aimed at elucidating the effects of estrogenic compounds. The timing of

the changes in circulating estrogen levels is critical to the normal progression of the

125

menstrual cycle, referred to as the estrus cycle in rodents, and stimulates uterine events
associated with implantation in the event of ovum fertilization. These changes are
numerous, and include the stimulation of cell cycle progression, transcription and
translation of specific proteins, cellular water intake (imbibition), vascularization.
recruitment of immune cells, and modifications in cell and tissue architecture. The EROt
isoform is the predominant isoform in the uterus, while ERB is detected only at low levels
(610). Studies in mice with targeted ER disruptions have confirmed that EROt is required
for the early hyperemia and water imbibition responses induced by estrogen, as well as
later stimulation of DNA synthesis, induction of specific estrogen-inducible transcripts,
and uterine growth and morphogenesis (611).

The profound complexity of estrogen signaling underscores the limitations of
current assays aimed at the detection and characterization of exogenous estrogens. Due to
the major role of the estrogen-ER complex as a transcriptional activator and proliferative
stimulus, current commonly used in vitro assays are limited and do not adequately
address the consequences of ER binding and subsequent gene expression (612). Typical
in vivo assays, by contrast, are based on the ability of estrogen to stimulate proliferation
of the uterine cell populations, and often consist of the standard rodent uterotrophic
assay, in which estrogen markedly induces uterine weight in an immature and/or
ovariectomized animal that is typically treated daily for 3-4 days (613). Although this
protocol has been used for decades (614), a lack of specificity to estrogens has been
observed (615), despite the incorporation of complementary uterine endpoints (i.e.
epithelial cell height and number, gland number) (553, 613, 616). Therefore, in vitro tests

have some clear advantages, however they underrepresent the sophisticated processes

126

intrinsic to an intact animal, and conversely in vivo studies offer enhanced ability to
extrapolate responses to humans as well as to other animals of interest, but frequently
focus only on a limited number of uterine-based endpoints (617).

In an attempt to address these weaknesses, several recent studies have examined
uterine responses to estrogen using microarrays (122-125). However, the studies vary
substantially in design and conditions used, as well as in the specific transcripts under
consideration. Furthermore, since the dosing protocol for measuring increased uterine
weight (i.e. several consecutive daily doses) may not be optimal for capturing
transcriptional responses, a time course experiment examining estrogen response is
desired. In the present study, a GeneChip oligonucleotide array experiment was
performed using the standardized uterotrophic assay protocol (i.e. three consecutive daily
doses) to determine the temporal effects on gene expression responses elicited by 170t—
ethynyl estradiol (EE). EE is a pharmaceutical estrogen that has been shown to induce a
transcriptional profile similar to that of the endogenous estrogen E2 (46), but has an
ethynyl substitution that enhances its oral bioavailability (618). Rigorous statistical
approaches were used to identify the most active treatment-induced gene expression
responses while accounting for variability between replicates. Significant responses were
clustered and then associated with functional annotations extracted from public databases
to identify critical pathways involved in the uterotrophic response. In addition,
corresponding gene sequences were searched in silico to identify possible estrogen
response element motifs, providing indirect support for the role of ER in the elicited

TCSpOI'ISCS .

127

MATERIALS AND METHODS

Uterine time course of ethynyl estradiol treatment

C57BU6 mice, ovariectomized by the vendor on postnatal day 20 and all having
body weights within 10% of the average body weight, were obtained from Charles River
Laboratories (Raleigh, NC) on postnatal day 26. The mice were kept in cages containing
cellulose fiber chips (Aspen Chip Laboratory Bedding, Northeastern Products,
Warrensberg, NY) in a 23°C HEPA-filtered environment with 30-40% humidity and a 12
h light/dark cycle. Animals were allowed free access to deionized water and Harlan
Teklad 22/5 Rodent Diet 8640 (Madison, WI). Mice were acclimatized for four days
prior to dosing. On the fourth day, animals were weighed, and Wet-ethynyl estradiol
(Sigma Chemical Co., St. Louis, MO) was dissolved in sesame oil (Loriva, Ronkonkoma,
NY) to achieve the desired concentration based on the average weight of the animals
(13.6 1 1.3 g). Animal groups for each dose and time point were housed in separate
cages. Beginning the following day, each mouse was closed by gavage with either a 0.1
ml dose of 0.1 mg/kg EE or with 0.1 ml sesame oil alone. An untreated animal was
sacrificed at time zero, the time at which the other animals were dosed. Duplicate animals
from both the treated and vehicle-treated groups were then sacrificed at 2, 8, 12, and 24
hr. Additional pairs of animals were treated for three consecutive days with 0.1
mg/kg/day EE or vehicle and then sacrificed 24hr following the final dose, and referred
to as the 3x24hr dose time point. In total 21 animals were used. Doses were staggered to
ensure that the time of exposure was within 5% of the reported dose length. Animals
were sacrificed by cervical dislocation, and uteri were excised, separated from attached

connective tissue, blotted, weighed, and stored in RNAlater storage solution (Ambion

128

Inc., Austin, TX) at -80°C until further use. All procedures were performed with the
approval of the Michigan State University All-University Committee on Animal Use and

Care.

RNA extraction, sample labeling and GeneChip hybridization

Uteri were homogenized individually as previously described (579), and total
RNA was extracted with Trizol (Life Technologies, Rockville, MD) according to the
manufacturer’s instructions, with yields of approximately 3.0 pg RNng uterine tissue.
RNA was further purified using RNeasy spin columns (Qiagen, Valencia, CA) according
to the manufacturer’s instructions, and eluted in 20 pl water. RNA yield and purity were
assessed by spectrophotometer and denaturing gel electrophoresis. Ten pg total RNA
from each uterus was then separately reverse transcribed, then transcribed in vitro in the
presence of biotinylated nucleotides, fragmented, and hybridized to either Test2 or Test3
GeneChip arrays (Affymetrix, Santa Clara, CA) to verify target quality, according to the
manufacturer’s protocols. The samples were then hybridized to Mul lKSubA
oligonucleotide GeneChip arrays, which contain 6,523 probe sets of 25-mer

oligonucletides directed at murine targets.

GeneChip data acquisition and clustering

Signal values and detection confidence levels were obtained using MicroArray
Suite 5.0 (MASS; Affymetrix) using the default settings. In accordance with MASS
absolute call default parameters, a transcript was considered to be ‘Present’ (P;
expressed) within a sample if the detection p-value for the corresponding probe set was

below 0.04, and to be ‘Marginal’ (M) if the p-value fell between 0.04 and 0.06, with all

129

other observations being considered to be ‘Absent’ (A). Hierarchical and K-means

clustering were performed using GeneSpring 4.2 (Silicon Genetics, Redwood City, CA).

Obtaining updated gene annotation information for probe set accession

identifiers

A gene name for each probe set was obtained by using the GenBank accession
identifier (GenBank ID) associated with the Affymetrix probe set identifier (probe set ID)
to query a local copy of the National Center for Biotechnology Information (NCBI;
htfi/wwwncbi.nlm.nih.gov) mouse UniGene database information (build 118), using a
Perl script that returned and saved the corresponding cluster name (UniGene name),
cluster identifier (UniGene ID), and gene abbreviation. mRNA RefSeq accession IDs
were also saved where available. For GenBank IDs not found within UniGene, the probe
set exemplar sequence was obtained from NetAffx (httpzllwwwaffymetrix.com), a
BLAST search was performed against all other mouse sequences in GenBank, and a
probable gene identity was assigned in cases where the five closest sequence matches all
had an expect value of e_<_10’20 and were representative of a single UniGene cluster. Probe
sets are referred to in the following text by their official gene abbreviation as obtained
from NCBI.

RefSeq IDs were then used by another Perl script to query a local copy of the
NCBI LocusLink database information, returning information of interest including
LocusLink ID, RefSeq category, chromosomal location, Gene Ontology IDs and
descriptions, and relevant NCBI PubMed references. The LocusLink ID of the NCBI-
MGD human homolog was also noted from the mouse LocusLink record, which in turn

provided a link to additional public functional information available in the Online

130

Mendelian Inheritance in Man (OMIM; NCBI) and GeneCards (Weizmann Institute)
databases. For probe sets with a UniGene name but lacking a RefSeq ID, a modified
version of the Perl script used the gene name to query the LocusLink database
information, and records were inspected manually to verify that the desired record had
been returned. As well, additional sequence and annotation information about each probe
set was obtained from NetAffx. All Perl scripts are available upon request, in accordance
with software availability guidelines proposed by the International Society for
Computational Biology (http://www.iscb.org/pr.shtml#software).

Several cases also existed in which two different probe sets interrogated the same
GenBank ID (referred to here as a probe set double). Microsoft Excel was used to
identify probe set doubles and to determine the concordance of absolute calls on each
array between probe set doubles and to examine links between these results and the probe
set suffix flags (defined in Supplemental Table A; all supplemental tables are accessible
at httgflwwwbch.msu.edu/~zacharet/data/kfdiss.html) of the probe set double members.

Raw GeneChip data is available in the NCBI Gene Expression Omnibus
(http://www.ncbi.nlm.nih.gov/geo) as time course experiment GSE280 and sample files
GSM3870-90. Probe set IDs, gene names and abbreviations, K-means cluster
assignments, fold change calculations, and other supplemental information is available in

Supplemental Table B.

Quantitative RT-PCR

RNA was isolated from uteri obtained from two additional replicates of the time
course experiment described above. Verification by SYBR Green quantitative real-time

PCR (QRT-PCR) of each replicate used samples consisting of equal amounts of uterine

131

RNA pooled from five identically treated animals. Data for each time point were
collected separately from each of the two pools and then averaged.

For each pool, total RNA was reverse transcribed using SuperScript II
(Invitrogen, Carlsbad, CA) and an anchored oligo-dT primer as described by the
manufacturer. Then 1.6 pl of cDNA was added to a 30 pl PCR reaction containing 0.1
pM each of forward and reverse gene-specific primer, 3 mM Mg“, 0.33 mM dNTPs, 0.5
IU AmpliTaq Gold, and 1x SYBR Green PCR buffer (Applied Biosystems, Foster City,
CA). Primers (Table 1) were selected using Primer3 (619) to obtain an amplicon of
approximately 125 bp length with Tm of 60°C. Amplicons were selected from within the
Affymetrix exemplar sequence region, and were compared by BLAST to all other
sequences in GenBank to ensure specificity. Default cycling parameters were employed,

using an ABI7000 Prism Sequence Detection System (Applied Biosystems).

Response element search

NCBI RefSeq IDs were used to query the February 2002 mouse assembly of the
University of California Santa Cruz (UCSC) Genome Browser Gateway
(httflQenomeucscedu). Corresponding gene promoter and transcript sequences were
downloaded, and Java applications (available on request) were developed to identify
sequence motifs of interest. Each genomic sequence was searched for exact matches to
the 13 bp perfect ERE motif (pERE; GGTCAnnnTGACC), to imperfect verified EREs
with verified functionality (ivEREs; Supplemental Table C), and to other predicted single
bp mismatch imperfect EREs (imEREs). In addition, potential ERE-Spl composite sites
consisting of one of the two ERE half-sites (GGTCA or TGACC), and an Spl site

(CCCGCC or GGCGGG) (1/2ERE-Sp1) were identified. A 1-50bp spacer was used in

132

order to limit the search in accordance with an analysis of spacers present in published
ERE-Spl composite sites.

EREs can be functional over long distances from the gene promoter region either
in the 5’ promoter region (620) or the transcribed (621) or 3’ untranscribed region (622),
however no consensus exists regarding the appropriate distance range in either direction
from the transcriptional start site (TSS) for ERE searching. Therefore, all perfect and
imperfect EREs located within the 10,000 bp upstream of the TSS, as specified in the
UCSC database, and within the transcribed region (i.e. exons, introns, and 3’ untranslated
region), were identified. In the case of 1/2ERE-Sp1 elements, the search included 1,200
bp in each direction from the location of the TSS, since an initial search of the -2,000 to
+2,000 bp range showed a predominance of these sites in relatively close proximity to the
TSS, in agreement with previously reported findings (28). Sequence matches were
categorized by their location in the upstream region (UR), 5’ untranslated region

(S’UTR), coding sequence (CD8), or 3’ untranslated region (3’UTR).

Statistical analyses

Uterine weights were assessed via a two-way ANOVA model to test for
differences in weight both across treatments and across time. If the treatment-by-time
interaction was found to be significant, the time effect relationship was tested at fixed
levels of the treatment effect.

For the GeneChip data, an empirical Bayes model (623) modified to account for
an experimental design with multiple comparative variables, was used as a screening tool
to identify genes that have the highest probability of being regulated due to treatment

and/or time. This approach reduces the dimensionality of the data to a single summary

133

statistic per gene while simultaneously accounting for multiple testing issues. The
empirical Bayes model estimates the a posteriori probability of being active (called plz)
with respect to treatment and/or time for each gene. In other words, the plz value is a
single summary statistic for each probe set, in which a high plz value is indicative of a
high level of response (either induction or repression) of a probe set relative to the
variability in the response. The false positive rate for a given rejection region was
estimated using Benjamini and Hochberg’s false discovery rate (FDR) (624), and was
found to be 0.52% at using plz>0.99 as the selected threshold.

An ANOVA model was then fit to the genes with p122 0.99 and each response
was classified as being active due to either a treatment effect, a time effect, or a
treatment-by-time interaction. Responses with a significant (p<0.01) treatment-by-time
interaction were considered to be of interest, as were gene responses with only a
significant treatment effect. Conversely, gene responses with only a significant time
effect (indicative of strong vehicle-dependent or circadian responses), or responses in
which the treatment and the time effects were separately significant but their interaction
was not, were rejected.

For the QRT-PCR data, B-actin-norrnalized responses were standardized to the
average response at the vehicle 2hr time point for each gene to adjust for gene—specific
differences in expression level. An ANOVA model was fit to the data using the logarithm
transformed standardized response, and gene responses were also classified has having a
treatment effect, a time effect, or a treatment-by-time interaction. In addition, the Pearson
correlation between the temporal responses observed by QRT-PCR and microarray prior

to time-matched normalization for each gene was calculated using Microsoft Excel. A

134

technical paper describing the details of these statistical methods is available at

http://www.bch.msu.edu/~zacharet.

 

RESULTS

Uterine weights

Blotted uterine weight was induced approximately 4-fold after 3x24 hr exposure
to EE, while no significant increase was observed at any other time. Comparable results

were obtained when unblotted uterine weights were considered.

GeneChip summary statistics

The proportion of probe sets with an absolute call by MASS of either Present (P)
or Marginal (M) was relatively uniform among the arrays (45.4 1 7.9% and 2.8 1 0.4%,
respectively). In addition, 17.3% of probe sets were called P on all 21 arrays, while
28.9% were called Absent (A) on every array. Hierarchical clustering of all of the
GeneChip data in GeneSpring using default settings indicated that the untreated sample,
the 24 hr EE-treated samples, and the 3x24 hr EE-treated samples formed three distinct
groups, while the 8 hr and 12 hr EE-treated samples together formed an additional group,
and the 2 hr EE-treated samples could not be distinguished from the vehicle-treated
samples (not shown).

A gene name and associated publicly available gene annotation were linked to
each probe set where possible by submitting the GenBank ID for the probe set to the
NCBI mouse UniGene database. In UniGene Build 118 (December 2002; Figure 1),
57.2% of the probe sets had an associated gene name, while 36.7% were denoted as ESTs

in UniGene. The remaining 6.1% were no longer represented in the UniGene database.

135

but for those which were retained by subsequent screening steps, a tentative gene identity
was assigned based on BLAST searching of the GenBank database. In some cases several
probe sets were associated with the same UniGene identifier, and as a result, 6261 unique

UniGene IDs were found to be represented on the GeneChip (i.e. 4.0% redundancy).

Assessing performance of pairs of probes interrogating the same GenBank

accession

Following the GenBank ID, Affymetrix probe set IDs have an appended
abbreviation (referred to here as a suffix flag, see Supplemental Table A) which indicates
the selection rules used in determining the probe sequences comprising the probe set
(625) and therefore can significantly affect data interpretation. Only 31.7% of the probe
sets had no suffix flag (‘none’) and therefore were selected using the optimal set of rules.
A majority (55.1%) belonged to the ‘5’ (similar) suffix flag, in which the probe set
interrogates a region shared by more than one transcript, while the remaining probe sets
were mainly members of the ‘f’ (family; 6.3%) and ‘g’ (group; 5.8%) cases.

GeneChips often have GenBank IDs represented by multiple probe sets, with each
of the multiple probe sets associated with a different suffix flag. On the Mul lKSubA
array, 433 GenBank IDs are represented by two different probe sets (referred to here as
probe set doubles), which facilitates a comparison of results obtained by different probe
sets within doubles or triplets. All ‘g’ probes have a corresponding ‘none’ probe, and this
comprises the majority of the probe set doubles (87.8%). The remaining pairs were ‘f-i’
(5.8%), ‘i-s’ (2.5%), ‘r-s’ (2.3%), ‘f-r’ (1.4%), and ‘i-r’ (0.2%).

Absolute calls were used to evaluate the performance of probe pair doubles, in

which ‘Present’ (P) and ‘Marginal’ (M) calls were grouped together and then the absolute

136

call (i.e. either PM or ‘Absent’ (A)) for each probe set within a double was compared
across the 21 arrays. At the extremes, 29.1% of probe set doubles had at least 20 identical
absolute calls, while 5.1% of doubles had only one or zero identical calls. Upon further
examination, no association between the proportion of identical calls within the double
and the specific pair of suffix flags within the double was evident (not shown).
Interestingly in 22 cases, one probe set within the double was called PM on all 21 arrays
while the other probe set was called A on every array (i.e. all—P/M-all-A probe set
doubles). In 16 of the 17 cases (94.1%) of a ‘none-g’ double, the ‘none’ array was all-A
while the ‘g’ array was all-P/M. Similarly, for the 34 doubles in which there were
between 16 and 19 differences in absolute call across the arrays, there were 20 doubles
(58.9%) with a highly-A ‘none’ probe and a highly-P/M ‘g’ probe, but only two doubles
(5.9%) with the reverse pattern. Overall, this suggests that the ‘none’ probe set, which
was designed using the ideal probe set design rules, is not able to detect the presence of
the corresponding transcript, while the permissive ‘g’ probe set interrogates a transcript

which may be similar but not identical to that indicated by the probe set ID.

Cluster analysis - complete dataset

To initially describe temporal patterns of gene expression within the data, K-
means clustering was performed on the entire dataset for the five time points using the
average of the duplicate responses at each time point divided by the average of the
corresponding duplicate vehicle responses (i.e. time-matched normalization). Eight K-
means clusters, denoted clusters A-H, appeared to best describe the main temporal
patterns in the data based on visual inspection (Table 2). Cluster H, the largest cluster,

contained the least responsive probe sets, and had the lowest proportion of all-A probe

137

sets (17.8%). All clusters had a majority of probe sets corresponding to named genes in
UniGene (53.6-59.5%), with the exception of cluster D (46.6%), which had a majority of
probe sets being represented by ESTs.

For comparison, the gene expression patterns in each cluster were also viewed in
a non-time-norrnalized form, in which the averages of the duplicate EE-treated responses
were graphed separately from the averages of the duplicate vehicle-treated responses.
Overall the patterns appeared as expected, with, for example, cluster A being composed
mainly of genes that were relatively unchanged over time in the vehicle-treated samples
while being highly induced at 2 hr in the EE-treated samples. Importantly, however, other
responses were also seen, such as essentially flat responses with slight differences at one
time point that were greatly amplified by the ratio calculation during the process of time-

matched normalization.

Screening to identify most active gene responses

To eliminate negligible or confounding responses, a reduced dataset was desired
in which probe sets with little or highly variable response were removed. The empirical
Bayes approach was employed to objectively provide a single summary statistic (denoted
the plz value, ranging from 0 to 1) for each probe set, indicative of the degree of the
response relative to its reproducibility. After retaining a subset of probe sets with plz
values greater than a threshold level of interest, and thus having low variability relative to
their level of responsiveness, a subsequent ANOVA was performed to identify and
remove responses likely due to vehicle or circadian effects.

At a chosen threshold of 0.99, 881 probe sets were retained, of which nearly 500

were associated with a plz of 0.999, indicative of a robust response with low variability

138

between replicates. Of the 881 significant probe sets, 537 (62.2%) had a gene name in
UniGene, a percentage slightly higher than the proportion of named probe sets
represented on the array as a whole (57.2%), suggesting that probe sets found in the
present experiment to be significantly regulated were not much more likely to be
annotated than randomly selected probe sets on the array.

The second screening step, an ANOVA, was designed to identify probe set
responses for which the treatment effect or the treatment-by-time interaction were
significant (p<0.01), thereby eliminating vehicle or circadian effects for which only the
time effect would be significant. Of the 392 that were considered to have a significant
treatment effect or treatment-by-time interaction, 257 (63.0%) had an associated UniGene
gene name (Figure 1), again indicating that the proportion of uncharacterized ESTs
among the highly responsive final probe set list was no less than the proportion in the
entire probe set population on the Mul lKSubA arrays. The complete list of 392 highly

responsive probe sets is available in Supplemental Table B.

Quantitative RT-PCR

QRT-PCR was used to verify selected response patterns in uteri collected from
experiments using the same protocol. Due to the limited sample size and the number of
identified robust responses, it was not feasible to verify all affected genes, and a subset of
26 probe sets was randomly selected for verification that spanned the range of plz values.
Overall, while correlation between the GeneChip and QRT-PCR response was high when
the response was high, correlation was low in cases where no response was evident, since
values then tended to fluctuate without pattern by both methods. Furthermore, in a few

cases no transcript was detectable by QRT-PCR, and in these cases no correlation value

139

was calculated. Therefore, responses by both methods were also compared by careful
visual inspection, and a qualitative assessment was provided (Table 3).

Results for Argl, Egrl, and for a sequence formerly classified in UniGene as
isopentenyl-diphosphate delta-isomerase (Ippi; Table 3), all of which passed both
GeneChip screening tests, were associated with significantly treatment-affected QRT-
PCR results. The magnitude of induction of a classical estrogen induced response, Argl,
at the 3x24 hr treatment was strikingly similar for the GeneChip and QRT-PCR data
(228- and 233-fold, respectively). Egrl was induced 2-3.5-fold at 2-12 hr by both
measures, while Iddi was induced up to7-fold at 8-3x24 hr by microarray but up to 12-
fold at 8-24 hr as measured by QRT-PCR.

At the other extreme, Saa4, chrl, and Krtap8-2 were all undetectable in every
sample when measured by both techniques, and in agreement with this, no change was
observed in the GeneChip intensity data that is calculated by MASS regardless of the
Presence/Absence determination. Nxfl was also absent or nearly absent in all samples,
consistent with the microarray data. By contrast, only QRT-PCR was able to detect Tbx6,
C2ta, and Crygs. A treatment effect at or near p=0.05 was observed for all three,
corresponding to 8- and 25-fold EE-induced repression at 8-3x24 hr for Tbx6 and C2ta
respectively, as well as an approximately 2-fold repression of Crygs, while these
responses were muted or not evident in the GeneChip data. Mapkl was also absent or
nearly absent in all samples by microarray, whereas slight induction at 12 hr was
measured by QRT-PCR.

Repression of Tgfb3, Lepr, CapnlO, and Ltbr was found to be more pronounced

in QRT-PCR measurements, and statistical correlation between the two measures was

140

moderate, although qualitatively there was good agreement between the platforms. Pdi2
responses for the two measures were highly correlated but more pronounced in the
GeneChip data, with induction at l2-3x24 hr of 7-17-fold by microarray but 6—9-fold by
QRT-PCR. Comparable results were observed with Sftpd and C3 induction at 3x24 hr.
Induction of Farsi of approximately 2.5-fold at 8-12 hr was consistent and the response
was highly correlated between the two methods, while Idb3 and Vegfb were similarly and
slightly repressed at 8-24 hr. Ccnbl was similarly induced approximately 2-fold at 24 and
3x24 hr, though one 12 hr sample was also highly induced as measured by QRT-PCR,
and statistical correlation was low. Csf 1, S100a6, Idh2, and FkbplO were detectable by
both methods but not greatly affected by treatment. Overall, responses were qualitatively
similar, while statistical differences appeared to be due to variation between the duplicate
measurements in isolated cases, or to the higher sensitivity of QRT-PCR in detecting

some transcripts.

Cluster analysis — reduced dataset

K-means clustering requires that the number of clusters be specified a priori.
Visual inspection of two to fifteen K-means clusters indicated that the time-normalized
data for the reduced list of probe sets could be best described using seven K-means
clusters (Table 4 and Figure 2). Viewing the corresponding non-time-norrnalized data
revealed, as expected, that overall these probe sets were very responsive to estrogen
treatment but showed little response to vehicle alone. Attempts to further stratify the data
into subclusters confirmed the clustering of only a single temporal gene expression
pattern. While cluster I and cluster L both contained some responses that were induced at

both 8 and 12 hr, seven K-means clusters categorized the observed temporal responses

141

more completely than did six K—means clusters. Clusters corresponding to late responses
(i.e. clusters M, N, and 0) had the highest proportion of probe sets with UniGene

annotation information (72.0-78.6%; Table 4).

Responses not observed

Numerous responses were observed that agree well with published data, as
described in the discussion. However, there were also several established estrogen
regulated responses that were not observed in this study. These included CdkS
(plz=0130) (208), Ccnd3 (plz=0.997) (208, 626), estrogen-responsive finger protein
(Trim25; plz=0.999) (210), Rbl (plz=0559) (627), and syndecan 3 (Sdc3; plz=0248)
(355). In several cases, these responses in the present study were associated with low plz
values or were associated with a lack of significance for the treatment—by-time interaction
ANOVA term, and in some cases, considered Absent by the MASS software. The lack of
concordance between these results and published data may also be due to differences in
experimental protocols, sensitivity of the methods and specificity of the probe sets,
including the possibility that ‘s’ and ‘f’ probe sets are interrogating transcript variants
that were not detected in previous reports. As a result, it is expected that reporting the full
probe set name, including the suffix flags in this study (Supplemental Table B), will
facilitate and enhance the validity of comparing the results presented here with future
studies. The well characterized estrogen inducible transcripts lactoferrin (540) and

progesterone receptor (89) were not represented on the Mul lKSubA array.

142

Response element search

Genomic actions of estrogens can be mediated by the ER and response elements
such as EREs, l/2ERE-Spl composite sites, and APl and Spl sites. In order to provide
supporting evidence for the role of ER/ERE-mediated gene regulation for genes affected
by BE in this study, genomic sequence (i.e. 10,000 bp upstream of the TSS as well as the
transcribed region) was searched in silico for pEREs, ivERE, imEREs and 1/2ERE-Spl
motifs. Within the UCSC database, 8060 mouse RefSeq IDs were unambiguously
associated with single chromosomal locations. Of the 236 unique probe sets which passed
the empirical Bayes and ANOVA filtering criteria, 205 genes were associated with a
RefSeq ID and a corresponding genomic sequence which was then computationally
searched for EREs. EREs were identified in 162 of the 205 genes including 10 pEREs
(2%), 110 ivEREs (44%), 111 imEREs (32%) and 64 half ERE/Spl composite sites
(22%). As many as 12 EREs were found in one gene (the glycerol phosphate
dehydrogenase deI) while 57 genes contained one ERE, 39 had two EREs and the
remaining 66 had more that two ERE sites. The complete set of results, including the
locations of the matching sequences relative to the transcriptional start site, is available in
Supplemental Tables D and E. However, when a similar number of ‘unresponsive’ probe
sets (i.e. plz<0.25 and >095 correlation to a flat response) were searched a comparable
number of EREs were identified, indicating an inability to identify functional EREs based

only on GeneChip and in silico approaches.

143

DISCUSSION

Uterine weight induction

The marked induction of rodent uterine hypertrophy and hyperplasia following a
3x24 hr estrogen dose is well documented with a variety of estrogens and routes of
exposure (31). An earlier and more modest induction of uterine weight due to water
imbibition has also been reported at 4-6 hr after estrogen exposure, but is not required for
the pronounced late phase uterine weight induction (628), and was not assessed in the

present study.

Two-step screening method

In comprehensive resource-intensive microarray experiments, it is desirable to
maximize the number of dose levels or durations examined, while ensuring sufficient
replication to enable meaningful statistical analysis that accounts for biological and
technical variability. In the present study, a modified empirical Bayes screening approach
(623) was used to identify a subset of active responses, followed by an ANOVA to
remove vehicle-induced and circadian effects. This approach reduces the data to single
summary statistic (plz value) for each probe set that is indicative of the overall level of
the response relative to its variability, and is comparable to a signal-to-noise ratio
calculation. Consequently the plz value represents the responsiveness and reproducibility
of a change in gene expression over time. In the current study, plz values were used to
rank responsive genes in order to reduce the dataset to a smaller subset that would serve
as the focus for detailed results interpretation. A threshold value of plz>0.99 was initially

chosen to identify a subset of genes for further functional investigation, resulting in the

144

selection of approximately 15% of the probe set results. The false discovery rate (FDR),
or false positive rate, was calculated and reported in order to address multiple testing
issues, and indicated that approximately 0.5% of probe sets passing the threshold, or
approximately 4 of the nearly 900 responses, may falsely be classified as a significant
response when a threshold of plz>0.99 was used. The ANOVA was subsequently applied
to identify treatment-induced responses while removing vehicle or circadian effects on
gene expression. Multiple testing was not taken into consideration in the ANOVA, and
therefore a stringent threshold of p<0.01 was used. This two-step approach can be readily
modified to accommodate a variety of experimental designs, and provides additional

flexibility by allowing the user to specify separate thresholds at each screening step.

Specific responses

Responses passing both screening steps were annotated using public databases
with functional information for the mouse gene and the human ortholog, where available.
Although responses that failed the screening steps were not clustered, certain responses
were included in the discussion if they approached the selection criteria and contributed
mechanistic information consistent with the EE-induced uterotrophic effect. In addition,
estrogen regulation of some transcripts has been reported in other studies, and while the
specific design employed (species, strain, age, route of exposure, dose level, type of
estrogen and platform used,) may influence the reported results, concordance is seen in

many cases, and therefore their inclusion is warranted (122-125).

145

Cell cycle

It is well established that estrogen treatment of rodents with low circulating
estrogen levels (due to sexual immaturity or ovariectomy) causes a synchronized
stimulation of uterine cell proliferation (629). Specifically, estrogen exposure causes
quiescent (Go) cells to enter the G1 growth phase, followed by DNA synthesis (S phase),
a second phase of growth (G2), and finally mitosis (M), after which the daughter cells
start a new G1 phase. Though many cell cycle-related changes are non-transcriptional
events, others are wholly or partially regulated at the mRNA level, and are the object of
consideration in the present study.

Several of the gene responses that passed the two step screening process serve
important roles in cell cycle control (Supplemental Table F). Transcripts upregulated
early (2-12 hr) tended to correspond to proteins with essential roles in the (31/8 phase
transition, while those directly involved in DNA synthesis or in the G2/M or M/ G
transitions were upregulated at 24 hr and possibly sustained after the 3x24 hr treatment.
This is consistent with the finding that in mice injected with E2, only 3% of cells were in
S phase at the time of dosing while 75% had progressed to S phase by 15 hr after
treatment (629). Moreover the rate of DNA synthesis in immature rats was also found to
be highest 24 hr following exposure to E2 (142, 630). Few responses involved in cell
cycle control or DNA synthesis were regulated as rapidly as 2 hr (i.e. were members of
cluster I) or after maximal uterine proliferation was achieved at 3x24 hr (i.e. were
members of cluster 0).

Gadd45a (cluster I) induction is an early cell cycle response, providing a crucial

link between the p53-dependent cell cycle checkpoint and DNA repair. Its levels are

146

known to be highest in the G1 phase of the cell cycle, with a sharp drop during S phase.
Gadd45a was also reported to be upregulated following estrogen treatment in other rodent
studies (122, 123, 125). Similarly, cyclin D2 (Ccnd2; cluster J), which was upregulated in
the GI/S transition, and is highly induced at both the mRNA and protein level in the early
proliferative stage of the human endometrium (631). A time course study has also shown
that cyclin D2 is highly induced at 2-8 hr after estrogen injection and returns to baseline
levels by 12 hr after exposure (208). As well, the cdc2 activator cyclin B1 (Ccnbl;
plz=0.964), which was previously reported to be upregulated at 16-24 hr as a
downstream effect of E2 treatment in rats and is known to be highly upregulated during
G2/M (632), was found here to be upregulated at 24 and 3x24 hr respectively. The Cdc2a
transcript itself (cluster N) was found to be upregulated 4.5-fold at the later time points,
though it has been reported not to be regulated by estrogen at the protein level (633).
Moreover, cyclin G2 (Ccng2; plz=0.999), which is upregulated in various cell types in
late S phase (634), was found to be repressed as much as lO-fold at all treatments
between 8-3x24 hr. To our knowledge the other cell cycle-related transcripts listed in
Supplemental Table F have not been previously reported to be affected by estrogen.
Chromosome replication is an integral part of the cell cycle, and several of the
EE-regulated genes are known to be involved in DNA synthesis. For example, Nmel
(cluster L), a nucleoside diphosphate kinase important in dNTP synthesis, was
upregulated 2.5-fold at 8-12 after treatment, consistent with another report (123). The two
subunits of ribonucleotide reductase, Rrrnl (cluster K) and er2 (cluster M), were
induced at 24 and 3x24 hr, consistent with findings that ribonucleotide reductase is

essential for deoxyribonucleotide production prior to DNA synthesis while it is

147

undetectable in quiescent cells (635). Ribonucleotide reductase is one of the substrates
for thioredoxin, which is implicated in many processes including cell growth and uterine
function (636), and a thioredoxin-like transcript, Txnl2 (cluster J), was upregulated at 8-
12 hr. The activity of thymidine kinase Tkl(cluster M), for which the transcript was
found to be upregulated approximately 14- and 4-fold at 24 and 3x24 hr respectively, is
well known to be associated with proliferating cells, and serves as a marker for the onset
of S phase (132). Tkl transcript has been reported to be induced at 18-24 hr (626), and at
3x24 hr (125) in other studies, and pronounced induction of enzyme activity from newly
synthesized enzyme has been observed at 24-36 hr after estrogen treatment (131, 132). In
untreated cycling rats, thymidine kinase enzyme activity is highest in the proestrus stage
of the estrus cycle, coincident with the peak in glandular mitosis (138).

Several protooncogenes show rapid and well-characterized estrogen inducibility
in the uterus but were not represented on the array, including Fos and several Jun and
Myc family members (reviewed in (637)). Myb (cluster N), however, is known to be
upregulated at the G1/S phase transition during cell proliferation (638), and in the present
study was upregulated nearly ll-fold at 3x24 hr. In addition, the Myb binding protein
Mybbpla (cluster J) was also upregulated at 8—12 hr, possibly to assist Myb in its actions,
which may include a critical role in cell proliferation and development.

Several genes involved in apoptosis were also found to be transcriptionally
regulated following EE treatment. These include the early growth response factor Egrl
(cluster J), which was highly upregulated at 2-12 hr, peaking at 8 hr, and repressed below
control levels at 3x24 hr. Egrl has been implicated in growth suppression and induction

of apoptosis, and is down regulated in tumor cells. Uterine induction of Egrl transcript

148

has been reported at 2 hr in rats (639), and at 6 hr in mice (123). Upregulation of a probe

sequence with high similarity (96% identity; expect value e'175

) to rat Egrl in
gestationally exposed fetal rats has also been reported (122). As well, the transcription
factor Klf4 (cluster L), a suppressor of cell growth that can be activated by p53 to in turn
induce p21, was upregulated at all time points. In the present study induction of p53
(Trp53; plz=0.678) was equivocal, while p21 (Cdknla; plz=0.980) appeared to be
induced up to 9-fold at 2-12 hr. Furthermore p21 was considered to be Absent on 19/21
arrays, in agreement with a report in which it was undetectable in the uteri of E2-injected
mice (640). Other transcripts involved in apoptosis included the upregulation of
lymphotoxin B receptor (Ltbr; cluster J) at 8-12 hr which can trigger apoptosis following
activation, Pea15 (cluster K), which was repressed 2-fold at all time points and is
associated with anti-apoptotic function and overexpression in breast cancer cells, and
Tial (cluster L), which was induced 2-3-fold at 2-24 hr and is thought to be involved in
the induction of apoptosis. The upregulation of these proapoptotic genes at 2-24 hr after
estrogen exposure may contribute to the attenuation of cell proliferation as maximal
growth is achieved, similar to the apoptotic phase that follows endometrial proliferation
in the cycling uterus (440, 641). However, the possible significance of apparent, though
below threshold, repression of other apoptotic inducers during the same period, such as
Bc12-like 11 (Bcl2lll; plz=0807; also known as Bim), caspase 2 (Casp2; plz=0.984),
caspase 6 (Casp6; plz=0.722), and Bok (plz=0.9l9) is not known, but possibly

indicating complex interactions between cell types within the proliferated uterus.

149

RNA and protein synthesis and modification

The overall rate of uterine transcription increases 6-8 hr after estrogen exposure
(642, 643). In the present study, several transcripts with roles in RNA synthesis were
found to be altered significantly following estrogen treatment (Supplemental Table G),
few of which have been previously reported to our knowledge. For example, several
novel induced responses were identified in cluster J (8-12 hr), including upregulation of
arginine methyltransferase (Hrmtll2), which specifically methylates H4 histones and may
be essential to pre—mRNA processing (644). Also observed were upregulation of small
nuclear ribonucleoprotein Snmpa, which functions as a spliceosome component to excise
introns from pre-mRNA, EBNAl binding protein Ebp2, which plays a role in pre-rRNA
processing, and poly(A) binding protein Pabpnl, which is required for efficient poly(A)
tail formation and control of tail length. Paf53 (plz=0.973), an activating subunit of RNA
polymerase I, was induced at 8-12 hr, consistent with published results (123).

Many genes involved in amino acid synthesis and transfer were also within cluster
I. Cysteinyl-tRNA synthetase (Cars), alanyl-tRNA synthetase (Aars), and asparagine
synthetase (Asns) all exhibited comparable patterns of induction at 8-12 hr, while
asparaginyl-tRNA synthetase (Nars; cluster L) showed an expression pattern that was
similar but still elevated at 24 hr. Phenylalanine-tRNA synthetase (Farsl, plz=0.678),
seryl-tRNA synthetase l (Sarsl; plz=0.248), and arginyl-tRNA synthetase (Rars;
plz=0.846) transcripts displayed nearly identical patterns of induction at 8-12 hr but with
greater variability. No response was observed for a probe set with similarity to aspartyl-
tRNA synthetase (Dars; plz=0.938), or for seryl-tRNA synthetase 2 (Sars2; plz=0504

and Absent on all 21 arrays), tyrosyl-tRNA synthetase (Yars; plz=0.900 and absent on

150

20/21 arrays), or lysyl-tRNA synthetase (Kars; plz=0131 and absent on 20 of 21 arrays).
EE induction of histidyl-, glutamyl-, lysyl-, phenylalanine-like—, and seryl-tRNA
synthetases as well as asparagine synthetase at 6 hr were also reported previously (123),
while the activity of tRNA synthetases was reported to be upregulated as early as 1-2 hr
(177). In addition, the dehydrogenase Mthfd2 (cluster M), was upregulated at 8-24 hr in
the present study, and reported to be induced at 6 hr (123), which may provide the
formyltetrahydrofolate for formylmethionyl-tRNA synthesis.

Protein synthesis genes, including the translation initiation factors Eif2a, Eif232,
Eif4a1, and Itgb4bp (also known as eIF6) were also induced at 8-12 hr (cluster J), while
Eifla and Eif2bl were classified to the closely related cluster L. Several chaperonin
transcripts, which code for proteins that aid in the correct folding and assembly of
nascent proteins, were also upregulated at the intermediate time points. These included
the heat shock proteins Hspa8 (cluster J), induced in the rat uterus 4 hr after treatment
with 30 pg/kg BB (183), as well as Hspa4 (cluster L) and HspaS (also known as BiP;
cluster K), which is upregulated as a primary transcriptional response in mice at 1-24 hr
after exposure (645).

Several genes involved in protein modification or degradation were also induced.
Peptidyl arginine deiminase Pdi2 (cluster M), which converts arginine to citrulline
residues in proteins, was upregulated 17- and lO-fold during the 24 and 3x24 hr time
points respectively, while the transglutaminase Tgm2 (cluster N), which is involved in
linking proteins through peptide bond formation and is also implicated in the packaging
of apoptotic bodies during apoptosis, was upregulated 6-fold at 3x24 hr. Protease

inhibitors such as cystatin B (Cstb; cluster J), an inhibitor of the cathepsin family of thiol

151

proteases, were also upregulated. Cystatin B is thought to be involved in the prevention
of apoptosis, and is upregulated after 3x24 hr exposure to E2 (124). Interestingly one of
its target cathepsins (Ctsb; cluster L) was also upregulated 2—fold at 8-12 hr as well as at
3x24 hr. Meanwhile Spil-3 and Spil-S (cluster 0), which belong to a family of serine
protease inhibitors with similarity to orl-antitrypsin, exhibited significant upregulation at
3x24 hr. Several proteasome subunits were also members of the related clusters J and L
based on their induction at 8-12 hr, including Psmb3, Psmd2, Psma3, Psmb6, and Psmb7.

The matrix metalloproteinase Mmp7 (cluster 0) was induced 26-fold at 3x24 hr,
and contains numerous (how many?) estrogen response motifs within its genomic
sequence. Mmp7 degrades proteoglycans, fibronectin, elastin, casein, and gelatins. It is
upregulated in processes involved in the breakdown of extracellular matrix, such as
during reproduction and tissue remodeling. The importance of numerous MMP family
members in the context of structural changes in the cycling human endometrium has been
well described (646). Other members of the MMP family including 2, 12, 14, 15, and 24
were unaffected by EB treatment. None of the tissue inhibitor of metalloproteases (TIMP)

isoforms were represented on the array.

Immune and complement activation

Early uterine responses to estrogen exhibit traits characteristic of a classical
inflammatory response which can be blocked by anti-inflammatory steroids (647). These
include edema, enhanced vascular permeability, eosinophil infiltration, and subsequent
production of inflammatory mediators (648). Eosinophil infiltration is also greatly
stimulated at estrus, with the eosinophils undergoing degranulation at the time of

ovulation, and releasing large quantities of eosinophil peroxidase that are characteristic

152

following estrogen exposure (649, 650). The exact role of the recruited eosinophils is not
known. They are not required for induction of uterine wet weight, protein synthesis, or
epithelial complement C3 synthesis, although it is believed that they may play a role in
endometrial stromal remodeling (445).

The process of menstruation has also been similarly compared to an inflammatory
process (651). It is thought that the decline in progesterone levels, rather than direct
action of estrogen, may stimulate a cascade of events including the release of uterine
cytokines, attraction of eosinophils, release of the degradative MMPs, vasoconstriction,
and hypoxia. Hypoxia in turn induces mediators such as vascular endothelial growth
factor (Vegf), which is angiogenic and may promote edema by enhancing vascular
permeability (648). However, the 15- to 20-fold increase in uterine neutrophil and
macrophage content in the uterus of the ovariectomized mouse in response to 4x24 hr E2,
independent of progesterone or its receptor, confirms that estrogen also plays a critical
role (82). Moreover, the chemokine responsible for estrogen-induced eosinophil
infiltration was recently identified as eotaxin (446).

The chemokine orphan receptor kaorl (cluster I) was highly induced at 2 hr,
with sustained induction at 8-12 hr (Supplemental Table H), consistent with a previous
report of upregulation at 6 hr (123). In addition, two members of the suppressor of
cytokine signaling (SOCS) family were highly induced, Socs3 (cluster I) at 2-8 hr, and
Socsl (cluster J) at 2-24 hr. In the interleukin family, 1125 (cluster L) was induced at 8-24
hr, while [117 (cluster M) appeared to be induced S-fold at 24 hr, but the signal intensities
were low and the probe set was classified as Absent on all 21 arrays. The interleukin-4

receptor Il4ra (plz=0.999) was upregulated at 24 and 3x24 hr, while previously reported

153

to be upregulated following 4-8 hr of exposure to BB (183). In addition, the monocyte
chemotactic protein Cc12, also known as MCPl or JE (cluster L), was highly induced at
all time points, similar to a previous report (158). A probe set highly similar to
macrophage migration inhibitory factor (Mif; cluster L), a lymphokine that stimulates
immune cell activation and cytokine production, was induced in the present study at 8-
3x24 hr, consistent with a previous report (125), while the protooncogene tyrosine kinase
Lyn (cluster N), which was induced at 24 hr and 3x24 hr, is required in immunoglobulin-
mediated signaling. In addition, the well-characterized estrogen-inducible transcript for
polymeric immunoglobulin receptor (Pigr; plz=0.952), formerly referred to as secretory
component (45], 652), was found to be induced at 3x24 hr.

Complement component factor H2-Bf (cluster N), a precursor also known as
Factor B in the signaling pathway that stimulates the proliferation of activated B-cells,
was induced at the later time points. H2-Fb is expressed at high levels in the luteal phase
of the uterine cycle in humans and rodents (653). An active cleavage product of H2-Fb
associates with complement C3 degradation product C3b to form the C3 convertase of
the alternative complement pathway. However, complement component factor Cfi
(cluster 0), which inactivates complement components including C3b, was also
upregulated 23-fold at 3x24 hr. Complement component C3 itself, though associated with
a low plz value (plz=0.l3l) due to variability in its response, was upregulated 5 to 9-
fold at 3x24 hr. C3 is a well characterized estrogen-inducible transcript and protein (183,
654) regulated by EREs in the human and mouse upstream regulatory region
(Supplemental Table C) (462, 655). C3 is involved in phagocytic and immunoregulatory

processes, but the significance of the concurrent upregulation here of C3 itself as well as

154

both an activator (H2-Fb) and an inactivator (Cfi) of C3 activity is confounding.
Furthermore, the antigen Cd59a, or protectin (cluster I), which inhibits the terminal step
of the complement activation cascade and is expressed on many types of immune cells, as
well as the complement component Clr (cluster I), which is involved in activation of the
first step of the classical complement system, were significantly repressed at 8-3x24 hr
following estrogen exposure. Overall, the complex and concurrent transcriptional
regulation of several members of the alternative and classical complement pathways in
the uterine response to estrogen is readily detected but poorly understood and requires
further examination to determine if changes in gene expression translate into changes in

protein levels and in situ studies to identify the cell types involved.

Other responses

Several genes representing a multitude of pathways and functions further illustrate
the complex and diverse transcriptional effects of estrogens on the uterus. In general, all
of these responses are consistent with the physiology that is experienced by the uterus.
For example several genes involved in ion transport, which is critical to uterine fluid
balance and therefore to the physiological response to estrogen, were upregulated
following estrogen exposure (Supplemental Table I). The amiloride binding protein
Abpl , or diamine oxidase (cluster 0), is known to both bind the diuretic amiloride which
is involved in sodium channel closure and to catalyze the degradation of polyamines, and
is thereby implicated in numerous responses including cell proliferation, tissue
differentiation, tumor formation, and possibly apoptosis. Abpl was induced over 100-
fold at 3x24 hr, suggesting its importance in the estrogen response, although confirmation

would require assessing the effects at the protein level. As well, the cystic fibrosis

155

transmembrane conductance regulator (Cftr; plz=0.812), a CAMP-activated chloride
channel, was upregulated 7-fold at 3x24 hr. An important role of Cftr and the epithelial
sodium channel (ENaC, or Scnnl; not represented on the Mul lKSubA array) isoforms in
the regulation of uterine chloride and sodium balance, respectively, has been recently
clarified (426), and E2-induced upregulation of Cftr mRNA has been reported in the rat
uterus (427). Furthermore, the ion channel nydS (cluster J), was induced 3-fold at 8 hr,
and though its ion transport capacity has not been well characterized, it has been recently
identified as being the homolog of human dysadherin, which inhibits the function of E-
cadherin (thI; not represented on the array), an important component of epithelial cell
adhesion (656). Interestingly the mucin Mucl (cluster N), another inhibitor of E-
cadherin, increased steadily beginning at 8 hr to greater than 7-fold at 3x24 hr. Mucl has
been described as an anti-adhesion molecule induced by estrogen through an ERE-
independent mechanism (367), and has been shown to be important in the structure and
function of the uterine luminal epithelial layer (361).

The hypoxia-inducible factor Hifla (cluster K), which is implicated in
angiogenesis, apoptosis, and energy metabolism, was upregulated at 2-8 hr, in agreement
with a previous report of upregulation at approximately 6-12 hr (657), while the poorly
characterized hypoxia-induced gene Higl (cluster K) was also upregulated at 8 hr. The
regulation of Hifla in the uterus is not well understood, but a direct role of hypoxia in
inducing Hif 1a in the estrogen-stimulated uterus has been questioned (657). By contrast,
the rapid induction of the ERE-containing (Supplemental Table C) vascular endothelial
growth factor, Vegf, in the uterus by estrogen is well characterized (621, 657), though in

the present study Vegfa was highly induced at 2 hr in only one of the two samples,

156

resulting in high variability (plz=0.052). The critical role of Vegf in the induction of
vascular permeability has been established, and furthermore Vegf inhibition has been
shown to abrogate the estrogen-induced uterine edema response (422). In addition,
protein Sat (Prosl; cluster I), which inhibits blood clotting, and the tissue plasminogen
activator Plat (Plat; cluster I), a serine protease that activates the fibrinolytic enzyme
plasmin, were both highly repressed beyond 8 hr. No change was observed in the
plasminogen activator inhibitor known as Pail or Serpinel (plz=0.846), while probe sets
for two other transcripts with important roles in the cycling uterine endometrium, the
urokinase plasminogen activator Plan and the potent vasoconstricting endothelin Ednl
(646), were not represented on the array.

The dramatic changes undergone in the rapidly proliferating uterus are associated
with an extensive energy requirement. Responses observed included the late upregulation
of the carbonic anhydrase Car2 (cluster M), which is involved in many biological
processes due to its role in the reversible hydration of carbon dioxide. The creatine kinase
Ckb (cluster J), which has well-characterized rapid estrogen inducibility (316) and plays
an important role in generating ATP in tissues with high and fluctuating energy demands,
was also upregulated at 8 hr in the present study, consistent with other studies in
immature ovariectomized rats (46), and in estrogen-exposed fetal rat uteri (122). In
addition, two probe sets representing an important ATP transporter known as Slc25a5 or
ANT2 were shown to be induced 3-fold at 8-3x24 hr (cluster L), which may also
facilitate the supply of ATP needed for uterine growth (125, 658).

Other responses were observed for which their roles in the uterotrophic response

are not well understood. For example alkaline phosphatase (Akp2; cluster 0), a well-

157

characterized estrogen-responsive gene (659) for which the exact physiological role is
unknown, was upregulated 86-fold at 3x24 hr. Also galanin (Gal; cluster J), which
regulates growth hormone and insulin release, was upregulated ll-fold at 8 hr, and the
retinoic acid binding protein Crabp2 (cluster N), normally induced by retinoic acid but
also reportedly induced by estrogen in rats after 24-48 hr (111) was upregulated at 24 hr
and 3x24 hr. The angiotensin II receptor Agtr2 (cluster N), which is the isoform
implicated in the induction of apoptosis (660) and is induced by estrogen during the
human menstrual cycle (661, 662), was also found to be induced at 3x24 hr in the present
study. In addition, the importance in cell cycle progression and the direct inducibility by
estrogen of heparin-binding epidermal growth factor-like growth factor (Hegfl;
plz=0.846) has been reported at 2-4 hr as well as at 24 hr, (663). In the present study
Hegfl was upregulated nearly 6-fold at 8 hr, though variability between replicates at 2 hr
likely prevented it from passing the plz screening step. In addition, the ras-related gene
Rasdl (cluster I), which is implicated in altering cell morphology, growth, and
interactions between the extracellular matrix and the cell, as well as in nitric oxide
signaling, was upregulated S-fold at 2 hr.

Several diverse responses were also repressed, such as the guanine nucleotide
exchange factor Arhgef3 (cluster I), and the receptor activity modifying protein Rampl
(cluster 1) involved in the calcitonin receptor-like receptor signaling pathway which were
both repressed after 2 hr. Secreted frizzled-related protein Sfrp2 (cluster I) was also
downregulated, and though its function is poorly defined, it appears to function as a Wnt

receptor, and may have a role in apoptosis (645). In addition, insulin-like growth factor

158

receptor Igf2r (cluster N), which functions as a suppressor of cell growth, was repressed

at 8—12 hr, and similarly was repressed in mice (123).

A proposed model

When the information presented above is integrated with results from previous
studies, compelling evidence suggests the convergence of multiple pathways regulated by
estrogens that support the uterotrophic response. Although not fully elucidated, Figure 3
provides a model depicting the estrogen regulation of arginine and omithine utilization
and their roles in the promotion and subsequent mitigation of uterine proliferation.

In this model, the Myc/Max heterodimer induces omithine decarboxylase
expression (Odc; plz=0.999 and ANOVA p-values near significance threshold) (664,
665), elevating Odc transcript levels at 8-24 hr, a response previously demonstrated in the
estrogen-stimulated uterus (627, 666, 667). Odc catalyzes the first and rate limiting step
in the tightly regulated synthesis of polyamines, proline, creatine, and GABA (668),
which are involved in mitotic spindle formation and chromatin condensation, and plays
an essential role in cell proliferation and differentiation (669). Meanwhile the Myc/Max
inhibitor Mxil (311) (plz=0.999, and near significance in the ANOVA screening) is
concurrently repressed 10—fold to nearly undetectable levels at 8-24 hr. Further, the Ode
antizyme (670) OazZ (plz=0.937) is consistently repressed 2-fold from 2-3x24 hr, while
transcript levels of the Oaz inhibitor (671) Oazi (plz=0.242) are nearly undetectable.
These conditions (i.e. repression of inhibitors of Odc expression) provide an environment
in which Odc transcription is favored, and polyamine synthesis progresses during G1
(309). Meanwhile, the key multifunctional substrate arginine is being used in protein

synthesis by arginyl-tRNA synthetase (Rars). As well, nitric oxide, the potent and

159

multifunctional signaling molecule formed from arginine by nitric oxide synthase (Nos)
is known to be elevated in mice after 24 hr estrogen exposure. This has been shown to be
due to induction of Nos3 (672), which was not represented on the microarray, but which
was found by QRT-PCR to be induced 2-fold at 2-8 hr (not shown). Though the roles of
nitric oxide in uterine function are complex, its critical importance has been established,
since a Nos inhibitor prevented estrogen-induced uterine edema and growth, while
pretreatment with exogenous arginine restored the response (673).

Activation of these pathways promotes uterine growth and remodeling. When
maximal uterine growth is achieved, marked induction of the polyamine acetyltransferase
Sat (plz=0.952) and the arginase Argl (cluster 0) at 3x24 hr reduce omithine and
arginine availability to slow uterine proliferation. Sat is the rate limiting enzyme in the
polyamine degradation pathway, and the involvement of Sat in uterotrophy has been
previously demonstrated by the uterine hypoplasia in mice overexpressing Sat (674).
Induction of uterine arginase activity is well established and a classical biomarker for
estrogen (675). In silico analysis of the Argl genomic sequence identified three ivEREs
(Supplemental Table D), however it has also been reported to be induced by Tgfbl (not
represented on the array), which itself is known to be induced rapidly in the uterus
following estrogen exposure (265). Although the biological significance of Argl
transcript (230—fold in the present study at 3x24 hr) and enzyme induction has not been
previously characterized, results from this study indicate that a stimulus may be depletion
of omithine due to Ode induction as maximum induction of uterine weight is realized. In

addition, Argl induction, mediated by decreased omithine levels or by the transcriptional

160

activator c/EBPB or the growth factor Tgfbl (not measured in the present study), is also

believed to play a key role in curtailing macrophage nitric oxide synthesis (676, 677).

Estrogen responsive elements

Numerous motifs with either perfect or near-perfect sequence identity to the
consensus ERE sequence were identified in the promoters of many of the genes that were
the focus of the present study. While the presence of these motifs suggests possible
transcriptional regulation by the classical ER-mediated mechanism of estrogen action, the
presence of many such elements in the promoters and transcribed regions of genes found
to be unresponsive in the present study underscores to the limitation of identifying
estrogen responsiveness by in silica motif searches and gene expression data alone.
Future studies may reveal the estrogen responsiveness of some of these genes in other
estrogen-sensitive tissues, while our understanding of non-classical mechanisms of ER-
mediated signaling increases (e.g. Apl, Spl) (176, 318, 678, 679). Furthermore, the
induction by estrogen of many secondary transcription and growth factors in the uterus
results in a complex network of transcriptional and posttranscriptional interactions that
are difficult to predict based on sequence analysis alone. Complementary approaches that
integrate gene expression, transcriptional regulator- response element interaction and in
silica motif identification data are required in order to fully elucidate the ER uterine

regulon.

General conclusions

Estrogen elicits a myriad of gene responses from a multitude of pathways that are

exquisitely orchestrated to culminate in the uterotrophic response. This study provides

161

statistically rigorous gene expression data that support decades of molecular and
physiological research into uterine function and the uterine response to estrogens. In
silica analysis of genomic sequence suggests that many of these responses are estrogen
regulated, however more direct functional approaches (e.g. chromatin
immunoprecipitation assays) in combination with gene expression data are required in
order to distinguish primary and secondary ER-mediated effects as well as to identify
actively exploited response elements. Despite the comprehensive nature of microarray
technology, many important genes were not represented on the GeneChip, and therefore
it was not possible to place all responses into the appropriate mechanistic or biological
context. Moreover, a lack of information regarding RNA stability, timing of translation,
post-translational modification, and protein-protein interactions, as well as the limited
amounted of gene annotation information also confounded the interpretation of the
temporal pattern of groups of genes that may share a pathway relationship. Overall, the
uterus of the ovariectomized immature mouse provides an ideal model for systematic
assessment of the biological effects of estrogens at multiple levels of organization, while

also being a key target of estrogen action with numerous physiological implications.

162

Table 1. Primer sequences used in real-time QRT-PCR verification.

 

 

Probe set ID Abbrev. Forward Reverse
US l 805_s_at Argl tcacctgagctttgatgtcg ctgaaaggagccctgtcttg
D l 65 80_s_at Pdi2 g gaagtgagcacctcccata agtgagatgggacaggcagt
L40156_s_at Sftpd caacaacaatggtggagcag cctccagtggctcagaactc
u29173_s_at Ltbr acacaaggaaggctcgtgac gaaggtagggatgagcacca
aa267683_s_at Ippi-like ggagtagggctgaggaaaca tgacacacctgtggcaagtt
m22326-2_s_at Egrl cttttgtgtgacacgccttg ccctcttcctcgtttttgct
m21952_s_at Csf 1 atttgccccttggtctcttt gacagggct gat g gagctta
US733 1_s__at Tbx6 ggcagctccatctgtaccat accgaggctcagtacattgg
AA4269 1 7_s_at Ccnb 1 gtctaaggcc gt gacaaagg tcacaacctttattgaagagcaa
m3776l_s_at SlOOa6 aaggctgatggatgatctgg catctcaacggtcccatttt
u42467_s_at Lepr gtggatcagatgctgagctg tgtgtccgacagaacctttg
aa6 l 6877_s_at Capn10 gt ggaccttggggctaaaat ctcctggccttcactaagga
U60653_s_at C2ta atccctccatcgagacagtg ctctagcccagctcccactt
M32745_s_at Tgfb3 ctcctcctgccttccttctt aacggggtctagggtaggag
aa154688_s_at Farsl caaagcattgggaagctagg gggacactcagagaccaacc
u02554_s_at Saa4 gggcttctctgaaaagtgga aacagagaccggttgtgacc
M60523_s_at Idb3 gcatggatgagcttcgatct accagcgtgtgctagctctt
aa270881_g_at Nxfl ttctgagcatgattcagagca cagtagtggcatcctccaca
AF032995_g_at Crygs cggtcagatgtacgaaacca ctgccacggtagttgggtag
d10939_s_at Mapkl cagtttgtccccttccattg agggctgccactttatttca
U5 1 l67_s_at Idh2 acatggtagagggtgcctca atgtccaccgtgaggaaaat
k02782_s_at C3 gaaaagcccaacaccagcta ctgtgaatgccccaagttct
L07063_s_at FkbplO cagatccagttcagggagga tgggaaagtgaaggaccaag
u43836_s_at Vegfb ggcttagagctcaacccaga cctgtgctccactcttctcc
M3 13 l4_s_at chrl tctgagcagggaaagaaagc cactgagcttcgaggtccat
D86422_s_at Krtap8-2 gcacgaggcaaaccataact ccacagccatagccataacc

 

163

Table 2. Summary of K-means clustering of the entire Mul lKSubA dataset. For clarity,
probe sets corresponding both to unnamed UniGene clusters and those not represented
within UniGene are denoted ‘ESTs’ in this table.

 

 

K-means general pattern # in cluster # all- % all- # with % with
cluster A1 A gene gene
ID name2 name
A induced at 2hr 597 286 47.9 324 54.3
B induced at 2hr and 1023 412 40.3 604 59.0
24hr
C induced at 8hr 912 197 21.6 498 54.6
D induced at 12hr 266 144 54.1 124 46.6
E induced at 8hr and 1025 245 23.9 604 58.9
24hr
F induced at 24hr 262 144 55.0 156 59.5
G induced at 3x24hr 272 84 30.9 153 56.3
H no change 2227 397 17.8 1194 53.6

 

1 Number of probe sets classified as Absent on every array by MASS analysis software.
” Number of probe sets with an associated gene name in UniGene (build 118).

164

.3 Son 5 .ii 26869: .Ai mach.» 66 San £09.55 95 9:06:60 68355 28:82? Le EuEmmommw 3:61:50 n
60:63:06 683a wccmofifi _ 55, 66660662 .6595. momémo can 3:06:60 wESQEoQ EoBEooo 5:30:06 5269* ~
.2561: new E 68 _oqu Co 20:68.: 6 was: .57: Emocewfiég co Amv EaucEwE ma 6:662 <>OZ< 65 Co .CmEEzm < _

 

165

 

~
+ $2 92 Q2 Q2 92 6 6 -685.
+ <2 92 Q2 Q2 92 486 _ :woa
+ :66 m c~m6 E6 686 266 M: ewo>
+ 6:6 62 $66 :66 ~86 666 z Seem
+ ~86 62 ~26 _6 ca .6 56 _~ 8
+ 83 62 § .6 m~6 666 3.6 _~ ~12
+ 866 m 66.6 3.46 686 62 .6 m 3%:
+ 3.6- 62 366 366 $66 _ :6 6 are
+ 8~6 62 5.6 686 6646 5.6 ~_ :42
+ 63.6 m 62 .6 e _6 866 84.6 6~ 22
+ $2 Q2 92 Q2 Q2 v~66 6 126
+ t 66 m :66 636 :66 656 _~ and
+ 366 m _26 E .6 86 ~26 ~_ mews
- 66~6 m _66 :66 6 ~56 6 38
+ 6666 m 63.6 83 ~56 ~36 M: 6:56
+ ~36 m 366 $66 566 6666 6 as.
+ ~86 mz 866 .86 866 :66 _~ 6.66;
-1 9: .6 .62 83 65.6 $3 $66 6 356
+ 666 m E _6 ~2 .6 6 ~86 6 65:.
+ 6R6 mz 666 R66 _6 62 _ 6 :6
+ E6 6 86 83 ~86 m 866 866 .666 866 _~ :66
-\+ 6666 6 $66 _ _66 6 m 686 6~ _66 6 6666 6. a&
+ 83 62 m-6 6466 6666 m 626 46~6 c666 6666 _~ 5:
+ 6666 62 ~E6 6666 36 m 6 6 6 _ _~ 6666
+ ~86 62 4646 5.6 6: .6 m 6 6 6 _ 6 ~61
+ 666.. m 6 .666 6 m 6 6 6 _ m as.
85.2. 2.5 E 2.5.3 can 2. 2a .555.
$153— mar—.80 E330 2:37; 2:57“— o:_a>.a 39.30 2:57.— o=_a>.n 2:91.: n1. a 0:90
5.155 .8 <>oz< 6664:. caused 3. <>oz<

 

.366 MUm-HmO wcficoamotoo 53, 866 3586:: «o cemcamEoU .m 636,—.

Table 4. Summary of K-means clustering of the active subset of gene responses.

 

 

K-means General Pattern # in # all- % all- # with % with
cluster cluster A1 A gene gene
1]) name2 name
1 induced at 2hr 59 6 10.2 35 59.3
J induced at 8hr 77 3 3.9 47 61.0
K induced at 8hr and 3x24 47 2 4.3 25 53.2
hr
L induced at 12hr 101 1 1.0 59 58.4
M induced at 24hr 69 12 17.4 50 72.5
N induced at 24hr and 3x24 25 1 4.0 18 72.0
hr
0 induced at 72hr 14 0 0.0 11 78.6

 

1 Number of probe sets classified as Absent on every array by MASS analysis software.
2 Number of probe sets with an associated gene name in UniGene (build 118).

166

Figure 1. Probe sets represented on the Mul lKSubA array were categorized according to
the gene name available in UniGene and whether the response passed the two statistical
screening steps described in the text. A heavy outline indicates those probe set responses
which passed both screening steps based on the defined threshold criteria, and which
were subsequently subjected to K-means clustering and response element searching.

 

6584 probe sets on
MullKSubA

l

 

 

l

 

 

 

 

 

 

 

 

 

 

 

  

 

 

 

 

 

 

 

 

2779
3744 known genes EST/not in UniGene
r 3186 (48 87) 2456 (37 7‘7)
. 0 o 0
558 plz>0.99 p lz<0.99 323 plz>0.99 plz<0.99
k . .
1A
257 (3.8%) trt*tm or trt -. 135 (2.2%) trt*tm or trt
term signif. term signif.
76 (1.2%) time term ' 45 (0.7%) time term
signif. only signif. only
225 (3.4%) no term 143 (2.2%) no term

 

 

signif. signif.

 

 

167

Figure 2. Responses passing the empirical Bayes and ANOVA screening steps,
categorized into seven K-means clusters labeled I-O, as described in the text and in Table
4. A pseudogene line is drawn in bold to illustrate a representative response for each
cluster.

Fold change relative to vehicle

 

 

 

 

treatment duration (hrs)

168

Figure 3. A model for the estrogen-induced promotion of uterine growth through
regulation of specific urea cycle product levels.

 

     
 
  

polyamine
depletion

Sat Abpl
At3x24 hr T3x24 hr tissue
proliferation
polyamines
I hdyc/ hdxil
_neg 8-24111.

I Odc
8-24 hr
T Oaz2 Oazi
I -neg i2-3X24 hl' -neg N.D.
_[ omithine ]
-neg I

_+ Argl I
T3x24 hr 7 TgRlazrshr |——.[ proteins }__
l

  

 

 
   

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

[ arginine
l . JEEh }____4;6mmme]
Nos3 T x r ,
Tzshr
1 Many roles, including vasodilation,
r nitric oxide macrophage and monocyte activation, and
l inhibition of smooth muscle cell growth

 

 

169

CHAPTER 5

BENZO[A]PYRENE DOES NOT ELICIT ESTROGENIC OR ANTIESTROGENIC

ACTIONS IN THE RODENT UTERUS

ABSTRACT

Numerous methods have been employed in attempts to assess the (anti)estrogenic
potential of benzo[a]pyrene (B[a]P), a widely dispersed pollutant with a steroid-like
structure. These studies have produced conflicting results which appear to be highly
dependent on the nature of the assay being used. A previous study showed that B[a]P was
not able to stimulate an increase in uterine weight, a hallmark of estrogen action, however
its possible antiestrogenic effects were not evaluated. In the present study, the ability of
B[a]P to antagonize an estrogen-induced uterotrophic response was evaluated. In
addition, its ability to alter transcription of several known and suspected estrogen-
regulated genes representative of diverse estrogen-induced physiological responses was
assessed. The results presented here indicate that B[a]P does not possess either estrogenic
or antiestrogenic effects in the rodent uterus, and demonstrate the utility of monitoring

arginase 1 expression, in addition to other well characterized transcriptional responses.

170

INTRODUCTION

Benzo[a]pyrene (B[a]P) is a ubiquitous environmental pollutant of the polycyclic
aromatic hydrocarbon (PAH) class, and concerns have been raised over the potential of
this compound to interact with the estrogen receptor and modulate estrogen signaling
either positively or negatively. Hydroxylated metabolites of B[a]P possess a flat
hydrophobic core with one or more hydroxyl groups, reminiscent of the chemical
structure of endogenous estrogens. Numerous assays can be commonly employed in the
assessment of the potential (anti)estrogenic activity of a compound of interest, and
although these have been employed with B[a]P, conflicting results have been obtained.
These assays assess the ability of a compound to mimic the behavior of estrogen by either
binding to the nuclear estrogen receptor (ER) and inducing ER-mediated transcription, or
by stimulating proliferation of estrogen-responsive cells.

B[a]P was first isolated in 1932 from coal tar, and its potent carcinogenic activity
was described (680). A brief report of its estrogenic activity followed soon after (508), in
which an injection of 100 mg B[a]P into ovariectomized rats (corresponding to a dose of
over 500 mg/kg in a 175 g animal) was found to greatly prolong estrus in three of ten
animals. Several decades later, B[a]P was found to lack estrogenic activity and to
somewhat inhibit the activity of 17B-estradiol (E2) in yeast expressing human estrogen
receptor 0t (EROL) and an ERG-mediated reporter gene (521). Next, an in vitro study
demonstrated the ability of B[a]P to induce ERa-mediated reporter gene expression in
the MCF-7 breast cancer cell line (519). This was followed by the identification of
specific monohydroxylated metabolites as the compounds that are able to bind to both

EROL and ERB in vitro, and to induce EROL- and ERB-mediated reporter gene expression

171

(536, 579). In addition, cotreatment of B[a]P with the estrogen 17B—estradiol (E2) was
found to produce an additive response (579). However around the same time, B[a]P in a
metabolically competent system was shown to bind to endogenous MCF-7 ER but to lack
proliferative activity in the MCF—7 cell proliferation assay, whereas it antagonized cell
proliferation induced by E2 (520). B[a]P was also found to stimulate E2 metabolism in
MCF-7 cells somewhat, which was suggested to be a mechanism for its observed
antiestrogenic action (520). In vivo, B[a]P was not found to stimulate classical estrogen-
inducible endpoints of increased uterine weight (uterotrophy) and uterine lactoferrin
expression (579), although its ability to directly affect these parameters in estrogen-
treated mice was not evaluated.

The uterotrophic assay has long been considered to be the ‘gold standard’ for
assessing estrogenic effects (553), however more recently its sensitivity and specificity
have been questioned (681, 682). Moreover, recent advances in the understanding of
estrogen signaling have revealed numerous unexpected deviations from the classical
mode of estrogen action. These include ER action in the absence of ligand, ER action at
response elements that deviate substantially from the consensus estrogen responsive
element (ERE), ER activation by phosphorylation, activation of membrane-bound ER,
different effects mediated by ERa versus ERB, and dependence on the nature and levels
of coactivators and corepressors in the cellular system under consideration (28, 602, 606).

In the present study, we examine the possible estrogenic or antiestrogenic activity
of B[a]P and TCDD, another AhR ligand, in the rodent uterus. These effects were
evaluated by monitoring the uterine weight and the expression of several well

characterized estrogen-inducible gene responses representative of diverse pathways that

172

are modulated by estrogen in the uterus. The animals used in this study were also used for
a concurrent study by Darrell Boverhof, in which the objective was to characterize the
transcriptional effects of estrogen and of tetrachlorodibenzo-p-dioxin (TCDD) in the liver
and spleen. As a result, uteri from TCDD-treated mice were available, and were also used

in the present study.

173

MATERIALS AND METHODS

Immature ovariectomized C57BL/6 mice (Charles River Laboratories, Raleigh,
NC) were housed in groups of four, with one treatment group per cage. Animals were
administered the test compounds by oral gavage in a total 0.1 ml of sesame oil. 170(-
ethynyl estradiol (EE) was administered at 0.01 mg/kg, and benzo[a]pyrene (B[a]P) and
tetrachlorodibenzo-p-dioxin (TCDD) were administered at 10 mg/kg. Animals received
one dose for either 12 or 24 hr, or else three consecutive daily doses (3x24 hr) followed
by sacrifice on the fourth day. An exception was the TCDD multi-dose group, which
received one TCDD treatment, followed by two daily doses of vehicle. The TCDD
cotreatment group received initial treatment with EB and TCDD, followed by two daily
doses of EB alone, although for simplicity this is referred to as 3x24 hr EE+TCDD.

Uteri were weighed, blotted, reweighed, and stored in RNALater (Ambion) at —
80°C until use. Separate RNA isolations, reverse transcription, and quantitative real-time
PCR (QRT-PCR) reactions for each tissue sample were performed as previously
described (Chapter 4). Primer sequences are listed in Table 1. Each measurement was
normalized to its corresponding measured value for B-actin, and then at each time point
groups were compared to the vehicle control using a two-tailed Student’s t-test (p<0.05),
This procedure was also used to analyze the uterine weight data. One sample from the
3x24 hr vehicle group and one from the 3x24 hr EE+TCDD group had very low actin
values and inflated actin-normalized responses for the other transcripts, compared to the

other members of their groups, and were removed from consideration.

174

 

RESULTS

Uterine weight

A slight increase in unblotted uterine weight was observed in several of the
treatment groups after the 12 hr exposure period, which was not evident in the 24 hr
group (Figure 1). After the 3x24 hr exposure regimen, however, unblotted uterine weight
relative to the vehicle group was induced approximately 3.5-fold by 3x24 hr EE
treatment, and this response was comparable when B[a]P or TCDD were coadministered
with EB. After blotting to expel the luminal fluid, the induction of uterine tissue weight
was slightly lower, approximately 2-fold (not shown). Treatment with B[a]P or TCDD

alone did not stimulate an increase in uterine weight.

Hepatic induction of Cyplal

Induction of Cyplal transcript levels were was determined in the liver (data
provided by Darrell Boverhof). None of the EB treatment regimens caused a significant
alteration in Cyplal mRNA levels. B[a]P stimulated Cyplal transcript levels only after
12 hr treatment, and the induction was high (BO-fold), although much more modest than
that induced by TCDD (Figure 2A). Cotreatment with EB reduced the 12 hr response to
40—fold. At 24 and 3x24 hr, however, cotreatment of EB and B[a]P caused a slight but
nonsignificant increase in Cyplal transcript levels, and the single treatments did not
cause a significant response.

TCDD induced Cyplal transcript levels approximately 2810-, 4060—, and 13630-
fold after 12, 24, and 3x24 hr treatments, respectively, which were somewhat reduced (to

2360-, 2050-, and 4390-fold respectively) by cotreatment with EB (Figure 2B).

175

 

Uterine induction of Cyplal

No changes in uterine CypI a] transcript levels reached significance in the present
study (not shown), although the lowest Cyplal levels were consistently observed in the
EB and EE+B[a]P treated groups. Cyplal levels in the 3x24 hr vehicle and TCDD
groups were variable but readily detectable, whereas it was expressed at extremely low

levels in the other groups.

Uterine induction of other transcripts

Ltf was significantly induced by 3x24 hr EE (132-fold) and EE+B[a]P (91-fold),
while no effect was observed at earlier times (Figure 3A). In addition, induction by 3x24
hr EE+TCDD (37-fold) was nearly significant (p<0.07).

Similarly, Argl was induced by 3x24 hr EE (IO-fold) and EE+B[a]P (7-fold),
while the 8-fold increase in the EE+TCDD group was nearly significant (p<0.08) (Figure
3B).

C3 induction was significant only in the 3x24 hr EE treatment group (8-fold),
while the increase in the EE+B[a]P group (6-fold) was not significant due to variability.
Sftpd induction was not significant in any group, although increases of 4-fold and 3-fold
were observed in the 3x24 hr EE and EE+B[a]P groups respectively (not shown).

No significant changes were observed in the levels of Rars, Mucl, Ccnb], or

Socsl.

176

DISCUSSION

Uterine weight

The 3.5-fold stimulation of uterine weight in response to a 3x24 hr EE treatment
is comparable to previous findings (e.g. Chapter 2; (31)). These experiments suggest that
B[a]P and TCDD do not exert positive or negative effects on EE-stimulated increases in
unblotted or blotted uterine weight, and thus did not affect uterine tissue proliferation or
fluid accumulation. By contrast, the slight increase at 12 hr by several treatments was not

previously observed in our studies.

Cyplal expression

Induction of hepatic Cyplal transcript and protein levels by PAHs and dioxins
such as B[a]P and TCDD is very well characterized. TCDD is the ligand with the highest
known affinity for the aryl hydrocarbon receptor (AhR), and readily stimulates
expression of AhR-inducible genes such as Cyplal. Although CYP1A1 is a metabolizing
enzyme that can readily hydroxylate a wide variety of hydrophobic compounds including
many of its own inducers, TCDD is extremely refractory to degradation. As a result, in
experiments longer than 24 hr, it is rare to administer repeat daily doses, and in the
present study the 3x24 hr dose regimen is in fact one dose of TCDD followed by two
daily doses of vehicle, as described in the Materials and Methods. Because of the single
TCDD dose, it is then particularly interesting that hepatic CypI a1 expression was highest
at 72 hr, and may be indicative of continual release during the three days of TCDD that
had partitioned into body fat. Cotreatment with EB, interestingly, appeared to cause a

depression in TCDD-induced CypI a] at the later time points.

177

B[a]P, in contrast, is a somewhat weaker ligand for the AhR, and is also readily
metabolized by P450 enzymes including CYP1A1. It is likely that both of these factors
contribute to the decline in CypIaI expression by 24 hr after the first exposure.
Interestingly, however, cotreatment of B[a]P and EE at the later time points appeared to

potentiate Cyplal expression.

Expression of other transcripts

An EE dose of 0.01 mg/kg was chosen since previous dose response experiments
within the lab (Dr. Yan Sun) had indicated that this dose stimulated a submaximal
induction of estrogen-regulated gene expression. This was important so that either an
induction or a repression of expression in cotreatment groups relative to the EB group
could be detected.

Transcripts were examined that were representative of numerous processes that
are known to be regulated by estrogen in the uterus: cell cycle regulation, tRNA
synthetase production, cell surface antiadhesion, and immune responses. In the present
study, the only transcripts that were highly upregulated by estrogen were lactoferrin and
arginase, which are observed as late phase responses in the uterine proliferative process,
and complement component C3 and surfactant associated protein D were upregulated in a
similar manner. These transcripts were highly upregulated in the 3x24 hr group and little
repressive effect was observed in the EE+B[a]P and EE+TCDD groups. Moreover, no
significant increase in these transcript levels was observed when B[a]P or TCDD were

administered alone.

178

Selection of specific transcripts as markers of estrogen action

These transcripts, because of their high inducibility, provide a sensitive means of
evaluating estrogenic action. By contrast, the other transcripts that were monitored were
not as successful in demonstrating robust upregulation in response to an estrogenic
stimulus. Although they were chosen because their inducibility has been reported or
suspected, they may not be suitable for studies with relatively small numbers of replicates
and widely spaced time points, since biological variability in magnitude and timing of
response becomes a very important factor.

Because of the rapidly expanding number of mechanisms by which estrogen
and/or its receptor can effect its responses, it seems prudent to monitor estrogen-inducible
transcripts that are involved in several diverse uterine responses to estrogen. While many
additional transcripts involving other aspects of estrogen-induced uterine response (e.g.
vasodilation, electrolyte regulation, energy production, proteolysis, and many others)
have been identified (Chapter 1), some of these transcripts have been shown to be altered
in only one uterine compartment by in situ hybridization, and therefore may not be
detectable in a whole uterine homogenate. Species and strain differences may also
contribute to a lack of concordance between reported and observed responses. Again, the
identification of several estrogen-induced responses that are representative of diverse
estrogen-regulated physiological events in the uterus will be of great benefit. In the
present study, lactoferrin was found, as has been shown previously, to be extremely
highly inducible in estrogen-stimulated uterus, however since it is known to be regulated
by different mechanisms in mice and in humans (683), the use of additional markers is

particularly warranted. Complement component C3 is another well accepted estrogen-

179

regulated gene in the uterus (463), however like lactoferrin, it is also an immune-related
response. Arginase 1, which was long ago shown to be an estrogen-inducible enzyme in
the uterus (675), was shown (Chapter 4) to be highly inducible at the transcript level as
well, and its utility as an estrogenic marker is confirmed in the present study. Arginase is
a key multifunctional enzyme with numerous roles including providing omithine for the
synthesis of polyamines, and polyamine ability is closely linked to cell proliferation
(669).

While it is possible to continue measuring additional transcripts indefinitely, the
results presented here suggest that B[a]P is not able to initiate a uterotrophic response or
to significantly induce the expression of key estrogen-regulated genes (684), in
confirmation of results presented earlier (Chapter 2). Moreover, this study addresses
previous in vitro findings suggesting that B[a]P might possess antiestrogenic activity
(520, 521), showing that in the rodent uterus B[a]P is unable to antagonize these
estrogen-induced responses, despite it being administered at a lOOO-fold excess compared
to EE. Overall, these findings highlight the fact that the various in vitro assays that are
available to assess estrogenic action can not always be reflective of the biological
responses in a complex tissue, and that caution is warranted in the extrapolation from in

vitro results to in vivo predictions.

180

Table 1. Primer sequences used in real-time QRT-PCR verification.

 

 

mRNA Abbrev. Forward Reverse Product

RefSeq size
N M_007482 Argl tcacctgagctttgatgtc g ctgaaaggagccctgtcttg 1 34
NM_009160 Sftpd caacaacaatggtggagcag cctccagtggctcagaactc 1 l4
NM_025936 Rars ttgatgaggc gatgctacag ggt gtggagaaacaggtc gt 140
N M_01 3605 Mucl ccaccagagctcctgaagac agctgaagaggtgccactgt 1 85
NM_172301 Ccnb 1 gtctaaggcc gt gacaaagg tcacaacctttattgaagagcaa 123
N M_009896 Socsl acttctggctggagacctca cccagacacaagctgctaca 100
NM_009992 Cyp 1 a1 aagtgcagatgcggtcttct aaagtaggaggcaggcacaa 140
N M_0085 22 Ltf gagaagatgctggcttcacc atttgcaggatctggtctgg 126
NM_009778 C3 gaaaagcccaacaccagcta ctgtgaatgccccaagttct 121
N M_007393 Actb gctacagcttcaccaccaca tctccagggaggaagaggat 123

 

181

Figure l. Uterine weights normalized by body weights at the end of the treatment period.

3"
c

5"
u:

E"
c

 

y—s
C

uterine weight/body weight (mg/g)
i Z.

   

P
a

If]
F!
+
+
+
+
+
+
+
+
+

TCDD + + + + + +
B[a]P + + + + + +

 

 

 

12 hr 24 hr 3x24 hr

* indicates significant increases (p<0.05) relative to the vehicle group for each exposure
duration

182

Figure 2. Hepatic expression of Cyp] a] measured by QRT-PCR. Benzo[a]pyrene (A) and
TCDD (B) are presented separately due to large differences in inducibility.

90-
80‘ *
70¢
60"
50‘
40"
>.30-
20"

10-l

0..

EE + + + + + +
B[a]P + + + + -l- +

A

C plal/fl-actin

 

   

 

 

 

12 hr 24 hr 3x24 hr

B 25000 -

20000 "

15000 ' *

 

10000 '

Cyplal/fi-actin

 

 

5000 ‘ «k * h
0 .J
EB + + + + + +
TCDD + + + + + +

 

 

 

12 hr 24 hr 3x24 hr

* indicates significant increases (p<0.05) relative to the vehicle group for each exposure
duration

183

Figure 3A. Uterine expression of Ltf measured by QRT-PCR.

250 '

200 '

150 ‘

 

Ltflfi-actin

100 '

50"

 

 

0-

EE
TCDD + + +
B[a]P +

12 hr

+ ++ + ++ +

 

24 hr 3x24 hr

* indicates significant increases (p<0.05) relative to the vehicle group for each exposure

duration

184

Figure 3B. Uterine expression of Arg] measured by QRT-PCR.

181
164
14‘
12-
10-

8.

Arg 1/ B -actin

6‘

 

TCDD + + + +
B[a]P + + + +

 

 

12 hr 24 hr

 

 

 

 

+ +
+ +
+ +
3x24 hr

* indicates significant increases (p<0.05) relative to the vehicle group for each exposure

duration

185

CHAPTER 6

SUMMARY AND FUTURE PERSPECTIVES

The preceding studies have used B[a]P as a model to examine the activity of a
compound with suspected weak estrogenic or antiestrogenic activity. The results of these
studies have underscored several critical principles that are emerging in the context of
estrogenicity tests: (1) the importance of using systems with defined metabolic potential,
since metabolites may be either more or less active than, and moreover species
differences and polymorphisms can make an individual or a population more sensitive to
a particular metabolite; (2) the lack of agreement that can exist between assays that are
designed to measure the same outcome but that are biologically very different; (3) the
importance of designing an estrogenicity experiment that will be able to evaluate both
additive and antagonistic effects; (4) the necessity, particularly in microarray data
analysis, of identifying each gene by one single gene name; and (5) the need to adapt
existing assays to accommodate new mechanistic information.

Different in vitro estrogenicity tests of B[a]P activity yielded opposite results (i.e.
estrogenic or antiestrogenic), however in vivo studies using anestrogenic (i.e. immature,
ovariectomized) mice indicated that B[a]P displayed neither estrogenic nor antiestrogenic
activity in the uterus at the dose level that was examined. While induction of uterine
weight and uterine lactoferrin expression are considered to be hallmarks of the estrogenic
response, it is must be remembered that B[a]P metabolites, as well as other PAH
metabolites, were found to interact preferentially with theB isoform of the ER, and

therefore could still possess (anti)estrogenic activity in a tissue such as ovary, which

186

 

expresses ERB much more highly than does the uterus. An examination of ovarian
responses would involve abandoning the ovariectomized model animal, which is
important for ensuring a lack of background circulating estrogen, however other lab
members are continuing related studies examining the transcriptional effects of estrogen
in different tissues. Other lab members are addressing the important issue of dose level,
in order to characterize the dose of estrogen needed to provide a robust but submaximal
transcriptional response following estrogen administration. The further characterization
of transcriptional responses to endogenous estrogens and to both weak and strong
exogenous estrogens remains a lab research focus. This, in conjunction with the projects
ongoing in other institutions to characterize the transcriptional profiles induced by
estrogen exposure, will be important in contributing both to the understanding of the role
of estrogen in uterine biology, and to the knowledge of which changes that should be

most closely monitored following exposure to suspected (anti)estrogens.

187

REFERENCES

1.

10.

11.

12.

Maggiolini M, Donze O, Jeannin E, Ando S, Picard D 1999 Adrenal androgens

stimulate the proliferation of breast cancer cells as direct activators of estrogen
receptor alpha. Cancer Res 59:4864-9

Poulin R, Labrie F 1986 Stimulation of cell proliferation and estrogenic response
by adrenal C19-delta 5-steroids in the ZR-75-1 human breast cancer cell line.
Cancer Res 46:4933-7

Callard GV, Petro Z, Ryan KJ 1978 Phylogenetic distribution of aromatase and

other androgen-converting enzymes in the central nervous system. Endocrinology
103:2283-90

Philip A, Murphy BE 1984 Does sex hormone-binding globulin play a role in
the transport of estradiol in vivo? Am J Obstet Gynecol 148:643-8

Puig-Duran E, Greenstein BD, MacKinnon PC 1979 The effects of serum
oestrogen-bindin g components on the unbound oestradiol-l7 beta fraction in the
serum of developing female rats and on inhibition of [3H]oestradiol uptake by
uterine tissue in vitro. J Reprod Fertil 56:707-14

Simpson E, Rubin G, Clyne C, et al. 2000 The role of local estrogen
biosynthesis in males and females. Trends Endocrinol Metab 11:184-8

Michael MD, Kilgore MW, Morohashi K, Simpson ER 1995 Ad4BP/SF-1
regulates cyclic AMP-induced transcription from the proximal promoter (PII) of
the human aromatase P450 (CYP19) gene in the ovary. J Biol Chem 270: 13561 -6

Simpson ER, Davis SR 2001 Minireview: Aromatase and the Regulation of
Estrogen Biosynthesis--Some New Perspectives. Endocrinology 142:4589-4594

Martucci CP, Fishman J 1993 P450 enzymes of estrogen metabolism.
Pharmacol Ther 572237-57

Jefcoate CR, Liehr JG, Santen RJ, et al. 2000 Tissue-specific synthesis and
oxidative metabolism of estrogens. J Natl Cancer Inst Monogrz95-1 12

Hanna IH, Dawling S, Roodi N, Guengerich FP, Parl FF 2000 Cytochrome
P450 1B1 (CYPlBl) Pharmacogenetics: Association of Polymorphisms with

Functional Differences in Estrogen Hydroxylation Activity. Cancer Res 6023440-
3444

Green S, Walter P, Kumar V, et al. 1986 Human oestrogen receptor cDN A:
sequence, expression and homology to v-erb-A. Nature 320: 134-9

188

 

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

Thornton JW 2001 Evolution of vertebrate steroid receptors from an ancestral
estrogen receptor by ligand exploitation and serial genome expansions. PNAS
98:5671-5676

Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA 1996
Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad
Sci U S A 93:5925-30

Hawkins MB, Thornton J W, Crews D, Skipper J K, Dotte A, Thomas P 2000
Identification of a third distinct estrogen receptor and reclassification of estrogen
receptors in teleosts. Proc Natl Acad Sci U S A 97: 10751-6.

aromatase-deficient mice provide insight into the roles of estrogen within the

Rosenfeld CS, Roberts RM, Lubahn DB 2001 Estrogen receptor— and [
ovary and uterus. Mol Reprod Dev 59:336-46 h

Cheung E, Schwabish MA, Kraus WL 2003 Chromatin exposes intrinsic
differences in the transcriptional activities of estrogen receptors {alpha} and
{beta}. EMBO J. 222600-611

Brzozowski AM, Pike ACW, Dauter Z, et a1. 1997 Molecular basis of agonism
and antagonism in the oestrogen receptor. Nature 389:753-758

Williams SP, Sigler PB 1998 Atomic structure of progesterone complexed with
its receptor. Nature 393:392-6

Tanenbaum DM, Wang Y, Williams SP, Sigler PB 1998 Crystallographic
comparison of the estrogen and progesterone receptor‘s ligand binding domains.
Proc Natl Acad Sci U S A 95:5998-6003

Klinge CM 2001 Estrogen receptor interaction with estrogen response elements.
Nucl. Acids. Res. 29:2905-2919

Meyer ME, Gronemeyer H, Turcotte B, Bocquel MT, Tasset D, Chambon P
1989 Steroid hormone receptors compete for factors that mediate their enhancer
function. Cell 57:433—42

Baniahmad A, Leng X, Burris T, Tsai S, Tsai M, O'Malley B 1995 The tau 4
activation domain of the thyroid hormone receptor is required for release of a

putative corepressor(s) necessary for transcriptional silencing. Mol. Cell. Biol.
15:76-86

Ratajczak T 2001 Protein coregulators that mediate estrogen receptor function.
Reprod Fertil Dev 13:221-9

189

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

Jordan VC 2002 The secrets of selective estrogen receptor modulation: cell-
specific coregulation. Cancer Cell 1:215-7

Nishikawa J -i, Saito K, Goto J, Dakeyama F, Matsuo M, Nishihara T 1999
New screening methods for chemicals with hormonal activities using interaction
of nuclear hormone receptor with coactivator. Toxicol Appl Pharmacol 154276—83

Levin ER 2001 Cell localization, physiology, and nongenomic actions of
estrogen receptors. J Appl Physiol 91 : 1860-7

Sanchez R, Nguyen D, Rocha W, White JH, Mader S 2002 Diversity in the
mechanisms of gene regulation by estrogen receptors. Bioessays 242244-54

J akacka M, Ito M, Martinson F, Ishikawa T, Lee EJ, Jameson J L 2002 An
Estrogen Receptor (ER){alpha} Deoxyribonucleic Acid-Binding Domain Knock-
In Mutation Provides Evidence for Nonclassical ER Pathway Signaling in Vivo.
Mol Endocrinol 16:2188-2201

Couse JF, Korach KS 1999 Estrogen receptor null mice: what have we learned
and where will they lead us? [published erratum appears in Endocr Rev 1999
Aug;20(4):459]. Endocr Rev 20:358-417

Odum J, Lefevre PA, Tittensor S, et al. 1997 The rodent uterotrophic assay:
critical protocol features, studies with nonyl phenols, and comparison with a yeast
estrogenicity assay. Regul Toxicol Pharmacol 25: 176-88

Kimber SJ, Stones RE, Sidhu SS 2001 Glycosylation changes during
differentiation of the murine uterine epithelium. Biochem Soc Trans 29: 156-62

Allen E 1922 The estrous cycle in the mouse. Am J Anat 302297-371

Long J, Evans H 1922 The estrous cycle in the rat and its associated phenomena.
Mem Univ California 6: 1-128

Hunt JS, Miller L, Platt JS 1998 Hormonal regulation of uterine macrophages.
Dev Immunol 6: 105-10

Gray CA, Bartol FF, Tarleton B], et al. 2001 Developmental biology of uterine
glands. Biol Reprod 65: 131 1-23

Gray CA, Taylor KM, Ramsey WS, et al. 2001 Endometrial glands are required
for preimplantation conceptus elongation and survival. Biol Reprod 64: 1608-1613

Hastings JM, Licence DR, Burton GJ, Charnock-Jones DS, Smith SK 2003
Soluble Vascular Endothelial Growth Factor Receptor 1 Inhibits Edema and

190

 

 

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

49.

Epithelial Proliferation Induced by l7{beta}-Estradiol in the Mouse Uterus.
Endocrinology 144:326-334

Osteen KG, Bruner-Tran KL, Keller NR, Eisenberg E 2002 Progesterone-
Mediated Endometrial Maturation Limits Matrix Metalloproteinase (MMP)

Expression in an Inflammatory-like Environment: A Regulatory System Altered
in Endometriosis. Ann NY Acad Sci 955:37-47

Aplin JD, Meseguer M, Simon C, Ortiz ME, Croxatto H, Jones CJ 2001
MUCl, glycans and the cell-surface barrier to embryo implantation. Biochem Soc
Trans 29:153-6

Png FY, Murphy CR 2000 Closure of the uterine lumen and the plasma

membrane transformation do not require blastocyst implantation. Eur J Morphol
38: 122-7

Giudice LC, Mark SP, Irwin J C 1998 Paracrine actions of insulin-like growth
factors and IGF binding protein-1 in non—pregnant human endometrium and at the
decidual—trophoblast interface. J Reprod Immunol 39: 133-48

Spornitz UM, Socin CD, Dravid AA 1999 Estrous stage determination in rats by
means of scanning electron microscopic images of uterine surface epithelium.
Anat Rec 254:116-26

Tseng L 1984 Estrogen synthesis in human endometrial epithelial glands and
stromal cells. J Steroid Biochem 20:877-81

Cameron VA, Autelitano DJ, Evans JJ, et al. 2002 Adrenomedullin expression
in rat uterus is correlated with plasma estradiol. Am J Physiol Endocrinol Metab
282:E139-146

Hyder SM, Chiappetta C, Stancel GM 1999 Synthetic estrogen 17alpha-ethiny1
estradiol induces pattern of uterine gene expression similar to endogenous
estrogen 17beta-estradiol. J Pharmacol Exp Ther 290:740-7

Astwood EB 1939 Changes in the weight and water content of the uterus of the
normal adult rat. Am J Physiol 126:162-170

Huet YM, Dey SK 1987 Role of early and late oestrogenic effects on
implantation in the mouse. J Reprod Fertil 81:453-8

Harris J, Gorski J 1978 Evidence for a discontinuous requirement for estrogen
in stimulation of deoxyribonucleic acid synthesis in the immature rat uterus.
Endocrinology 103:240-5

191

50.

51.

52.

53.

54.

55.

56.

57.

58.

59.

60.

61.

62.

Kaye AM, Sheratzky D, Lindner HR 1971 Kinetics of DNA synthesis in
immature rat uterus: age dependence and estradiol stimulation. Biochim Biophys
Acta 261 :475-86

Risek B, Klier F, Phillips A, Hahn D, Gilula N 1995 Gap junction regulation in
the uterus and ovaries of immature rats by estrogen and progesterone. J Cell Sci
108: 1017-1032

De M, Wood GW 1990 Influence of oestrogen and progesterone on macrophage
distribution in the mouse uterus. J Endocrinol 126:417-24

Williams T, Rogers AW 1972 Morphological changes in the luminal epithelium
of the rat uterus in response to progesterone and oestradiol. J Anat 111:515

Quarmby VE, Korach KS 1984 The influence of 17 beta-estradiol on patterns of
cell division in the uterus. Endocrinology 114:694-702

Mendoza-Rodriguez CA, Merchant-Larios H, Segura-Valdez ML, et al. 2003
c-fos and estrogen receptor gene expression pattern in the rat uterine epithelium
during the estrous cycle. Mol Reprod Dev 64:379-88

Rotello R, Lieberman R, Lepoff R, Gerschenson L 1992 Characterization of

uterine epithelium apoptotic cell death kinetics and regulation by progesterone
and RU 486. Am J Pathol 140:449-456

Rambo CO, Szego CM 1983 Estrogen action at endometrial membranes:
alterations in luminal surface detectable within seconds. J Cell Biol 972679-85

Greenman DL, Dooley K, Breeden CR 1977 Strain differences in the response
of the mouse to diethylstilbestrol. J Toxicol Environ Health 3:589—97

Friedrich ER, Meyer J S 1982 Estrogen-progestin pharmacodynarnics of the
postmenopausal endometrium studied by thymidine labeling. Am J Obstet
Gynecol 143:352-9

Klebe U, Moltz L, Pickartz H 1983 Effects of cyproterone acetate and
ethinylestradiol on endometrial histology. Arch Gynecol 234:113-20

Lecce G, Meduri G, Ancelin M, Bergeron C, Perrot-Applanat M 2001
Presence of Estrogen Receptor {beta} in the Human Endometrium through the

Cycle: Expression in Glandular, Stromal, and Vascular Cells. J Clin Endocrinol
Metab 86:1379-1386

Nephew KP, Long X, Osborne E, Burke KA, Ahluwalia A, Bigsby RM 2000

Effect of estradiol on estrogen receptor expression in rat uterine cell types. Biol
Reprod 62: 168-77

192

 

 

63.

64.

65.

66.

67.

68.

69.

70.

71.

72.

73.

74.

Weihua Z, Ekman J, Almkvist A, et al. 2002 Involvement of Androgen
Receptor in l7{beta}-Estradiol-Induced Cell Proliferation in Rat Uterus. Biol
Reprod 672616-623

Brandenberger AW, Lebovic DI, Tee MK, et a1. 1999 Oestrogen receptor
(ER)-alpha and ER-beta isoforms in normal endometrial and endometriosis-
derived stromal cells. Mol Hum Reprod 5:651-5

Paech K, Webb P, Kuiper GG, et al. 1997 Differential ligand activation of
estrogen receptors ERalpha and ERbeta at AP1 sites. Science 277: 1508-10

Pettersson K, Delaunay F, Gustafsson JA 2000 Estrogen receptor beta acts as a
dominant regulator of estrogen signaling. Oncogene 19:4970-8

Hall JM, McDonnell DP 1999 The Estrogen Receptor {beta}-Isoform
(ER{beta}) of the Human Estrogen Receptor Modulates ER{ alpha}
Transcriptional Activity and Is a Key Regulator of the Cellular Response to
Estrogens and Antiestrogens. Endocrinology 14025566-5578

Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O 1993
Alteration of reproductive function but not prenatal sexual development after

insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci U
S A 90:11162-6

Johns A, Freay AD, Fraser W, Korach KS, Rubanyi GM 1996 Disruption of
estrogen receptor gene prevents 17 beta estradiol-induced angiogenesis in
transgenic mice. Endocrinology 137:451 1-3

Couse JF, Curtis SW, Washbum TF, et al. 1995 Analysis of transcription and
estrogen insensitivity in the female mouse after targeted disruption of the estrogen
receptor gene. Molecular Endocrinology 9: 1441-1454

Cooke PS, Buchanan DL, Young P, et al. 1997 Stromal estrogen receptors
mediate mitogenic effects of estradiol on uterine epithelium. Proc Natl Acad Sci
U S A 94:6535-40

Buchanan DL, Setiawan T, Lubahn DB, et al. 1999 Tissue Compartment-
Specific Estrogen Receptor-{alpha} Participation in the Mouse Uterine Epithelial
Secretory Response. Endocrinology 140:484-491

Cunha GR, Lung B 1979 The importance of stroma in morphogenesis and
functional activity of urogenital epithelium. In Vitro 15:50-71

Kurita T, Lee K-j, Cooke PS, Taylor JA, Lubahn DB, Cunha GR 2000

Paracrine Regulation of Epithelial Progesterone Receptor by Estradiol in the
Mouse Female Reproductive Tract. Biol Reprod 622821-830

193

 

 

75.

76.

77.

78.

79.

80.

81.

82.

83.

84.

85.

86.

Weihua Z, Saji S, Makinen S, et al. 2000 Estrogen receptor (ER) beta, a
modulator of ERalpha in the uterus. Proc Natl Acad Sci U S A 97:5936-41.

Couse JF, Hewitt SC, Bunch DO, et al. 1999 Postnatal sex reversal of the
ovaries in mice lacking estrogen receptors alpha and beta. Science 286:2328-31

Fisher CR, Graves KH, Parlow AF, Simpson ER 1998 Characterization of
mice deficient in aromatase (ArKO) because of targeted disruption of the cyp19
gene. Proc Natl Acad Sci U S A 95:6965-70

Vanacker J -M, Bonnelye E, Chopin-Delaunay S, Delmarre C, Cavailles V,
Laudet V 1999 Transcriptional Activities of the Orphan Nuclear Receptor
ERR{alpha} (Estrogen Receptor-Related Receptor-{alpha}). Mol Endocrinol
132764-773

Shigeta H, Zuo W, Yang N, DiAugustine R, Teng CT 1997 The mouse
estrogen receptor-related orphan receptor alpha 1: molecular cloning and estrogen
responsiveness. J Mol Endocrinol 19:299-309

Sladek R, Bader J, Giguere V 1997 The orphan nuclear receptor estrogen-
related receptor alpha is a transcriptional regulator of the human medium-chain
acyl coenzyme A dehydrogenase gene. Mol. Cell. Biol. 17:5400-5409

Zhang Z, Teng CT 2001 Estrogen receptor [alpha] and estrogen receptor-related
receptor [alphall compete for binding and coactivator. Molecular and Cellular
Endocrinology 172:223-233

Tibbetts TA, Conneely OM, O'Malley BW 1999 Progesterone via Its Receptor
Antagonizes the Pro-Inflammatory Activity of Estrogen in the Mouse Uterus. Biol
Reprod 60:1158-1165

Spencer TE, Bazer FW 2002 Biology of progesterone action during pregnancy
recognition and maintenance of pregnancy. Front Biosci 7:d1879-98

Attia GR, Zeitoun K, Edwards D, Johns A, Carr BR, Bulun SE 2000
Progesterone Receptor Isoforrn A But Not B Is Expressed in Endometriosis. J
Clin Endocrinol Metab 85:2897-2902

Petz LN, Ziegler YS, Loven MA, Nardulli AM 2002 Estrogen Receptor {alpha}
and Activating Protein-1 Mediate Estrogen Responsiveness of the Progesterone
Receptor Gene in MCF-7 Breast Cancer Cells. Endocrinology 143:4583-4591

Rider V, Wang MY, Finn C, Heap RB, Feinstein A 1986 Anti-fertility effect of

passive immunization against progesterone is influenced by genotype. J
Endocrinol 108:117-21

194

 

 

87.

88.

89.

90.

91.

92.

93.

94.

95.

96.

97.

Moulton BC 1979 Effect of progesterone on DNA, RNA and protein synthesis of

deciduoma cell fractions separated by velocity sedimentation. Biol Reprod
21 :667-72

Jones SR, Kimler BF, Justice WM, Rider V 2000 Transit of normal rat uterine
stromal cells through Gl phase of the cell cycle requires progesterone-growth
factor interactions. Endocrinology 141 :637-48

Tibbetts TA, Mendoza-Meneses M, O'Malley BW, Conneely OM 1998
Mutual and intercompartmental regulation of estrogen receptor and progesterone
receptor expression in the mouse uterus. Biol Reprod 59:1 143-1152

Armstrong DT, Moon YS, Leung PC 1976 Uterotrophic effects of testosterone
and Salpha-dihydrotestosterone in intact and ovariectomized immature female
rats. Biol Reprod 15: 107-14

Schmidt WN, Katzenellenbogen BS 1979 Androgen-uterine interactions: an
assessment of androgen interaction with the testosterone- and estrogen-receptor
systems and stimulation of uterine growth and progesterone-receptor synthesis.
Mol Cell Endocrinol 15:91-108

Klocker H, Culig Z, Eder IE, et al. 1999 Mechanism of androgen receptor
activation and possible implications for chemoprevention trials. Eur Urol 35:413-
9

Sahlin L, Norstedt G, Eriksson H 1994 Androgen regulation of the insulin-like
growth factor-1 and the estrogen receptor in rat uterus and liver. J Steroid
Biochem Mol Biol 51:57-66

Mena MA, Grunert G, Mansilla MS, et al. 1985 Inhibition of non-genomic
responses to oestrogen in the rat uterus by testosterone propionate. J Reprod Fertil
74: 1-7

Roy AK, Chatterjee B 1995 Androgen action. Crit Rev Eukaryot Gene Expr
5:157-76

Sahlin L, Wang H, Masironi B, Holmgren A, Eriksson H 1999 Regulation of
thioredoxin mRNA in the rat uterus by gonadal steroids. J Steroid Biochem Mol
Biol 68:203-9

Gunin AG, Emelianov VU, Tolmachev AS 2003 Expression of estrogen
receptor-alpha, glucocorticoid receptor, beta-catenin and glycogen synthase
kinase-3beta in the uterus of mice following long-term treatment with estrogen
and glucocorticoid hormones. Eur J Obstet Gynecol Reprod Biol 107:62-7

195

 

98.

99.

100.

101.

102.

103.

104.

105.

106.

107.

108.

109.

Rabin DS, Johnson E0, Brandon DD, Liapi C, Chrousos GP 1990
Glucocorticoids inhibit estradiol-mediated uterine growth: possible role of the
uterine estradiol receptor. Biol Reprod 42:74-80

Gunin AG, Mashin IN, Zakharov DA 2001 Proliferation, mitosis orientation
and morphogenetic changes in the uterus of mice following chronic treatment
with both estrogen and glucocorticoid hormones. J Endocrinol 169:23-31.

Bigsby RM, Young PC 1993 Progesterone and dexamethasone inhibition of
uterine epithelial cell proliferation: studies with antiprogesterone compounds in
the neonatal mouse. J Steroid Biochem Mol Biol 46:253-7

Bigsby RM, Cunha GR 1985 Effects of progestins and glucocorticoids on

deoxyribonucleic acid synthesis in the uterus of the neonatal mouse.
Endocrinology 117:2520—6

Campbell PS 1978 The mechanism of the inhibition of uterotrophic responses by
acute dexamethasone pretreatment. Endocrinology 103:716—23

Sahlin L 1995 Dexamethasone attenuates the estradiol-induced increase of IGF-I
mRNA in the rat uterus. J Steroid Biochem Mol Biol 55:9-15

Henderson TA, Saunders PTK, Moffett-King A, Groome NP, Critchley HOD
2003 Steroid Receptor Expression in Uterine Natural Killer Cells. J Clin
Endocrinol Metab 88:440-449

Bamberger A-M, Milde-Langosch K, Loning T, Bamberger CM 2001 The
Glucocorticoid Receptor Is Specifically Expressed in the Stromal Compartment of
the Human Endometrium. J Clin Endocrinol Metab 86:5071-

Bucco RA, Zheng WL, Davis JT, et al. 1997 Cellular retinoic acid-binding
protein(II) presence in rat uterine epithelial cells correlates with their synthesis of
retinoic acid. Biochemistry 36:4009-14

Rexer BN, Ong DE 2002 A novel short-chain alcohol dehydrogenase from rats
with retinol dehydrogenase activity, cyclically expressed in uterine epithelium.
Biol Reprod 67: 1555-1564

Marill J, Idres N, Capron CC, Nguyen E, Chabot GG 2003 Retinoic acid
metabolism and mechanism of action: a review. Curr Drug Metab 4: 1-10

Chambon P 1996 A decade of molecular biology of retinoic acid receptors.
Faseb J 102940-54

196

110.

111.

112.

113.

114.

115.

116.

117.

118.

119.

120.

121.

Kumarendran MK, Loughney AD, Prentice A, Thomas EJ, Redfern CP 1996
Nuclear retinoid receptor expression in normal human endometrium throughout
the menstrual cycle. Mol Hum Reprod 2: 123-9

Bucco RA, Zheng WL, Wardlaw SA, et a1. 1996 Regulation and localization of

cellular retinol-binding protein, retinol-binding protein, cellular retinoic acid-
binding protein (CRABP), and CRABP II in the uterus of the pseudopregnant rat.
Endocrinology 137:31 1 1-22

Dong D, Ruuska SE, Levinthal DJ, Noy N 1999 Distinct roles for cellular
retinoic acid-binding proteins I and H in regulating signaling by retinoic acid. J.
Biol. Chem. 274223695-23698

Zheng WL, Sierra-Rivera E, Luan J, Osteen KG, Ong DE 2000 Retinoic Acid
Synthesis and Expression of Cellular Retinol-Binding Protein and Cellular
Retinoic Acid-Binding Protein Type H Are Concurrent with Decidualization of
Rat Uterine Stromal Cells. Endocrinology 141:802-808

Gardner RM, Kirkland J L, Ireland JS, Stancel GM 1978 Regulation of the
uterine response to estrogen by thyroid hormone. Endocrinology 103:1164-72

Keeping HS, Newcombe AM, Jellinck PH 1982 Modulation of estrogen-
induced peroxidase activity in the rat uterus by thyroid hormones. J Steroid
Biochem 16245-9

Steinsapir J, Rojas AM, Mena M, Tchernitchin AN 1982 Effects of thyroid
hormone on some uterine responses to estrogen. Endocrinology 11021773-9

Vasudevan N, Ogawa S, Pfaff D 2002 Estrogen and Thyroid Hormone Receptor
Interactions: Physiological Flexibility by Molecular Specificity. Physiol. Rev.
82:923-944

Levy J, Zuili I, Yankowitz N, Shany S 1984 Induction of cytosolic receptors for
1 alpha, 25-dihydroxyvitamin D3 in the immature rat uterus by oestradiol. J
Endocrinol 100:265-9

Walters MR, Cuneo DL, Jamison AP 1983 Possible significance of new target
tissues for 1,25-dihydroxyvitamin D3. J Steroid Biochem 192913-20

Delissalde F, Hernandez MA, Barron A, et a1. 1998 [Vitamin D induces
proliferation in rat endometrium cultured cells]. Rev Invest Clin 50:113-8

Lieberherr M, Acker GM, Grosse B, Pesty A, Balsan S 1984 Rat endometrial

cells in primary culture: effects and interaction of sex hormones and vitamin D3
metabolite on alkaline phosphatase. Endocrinology 115:824-9

197

 

 

 

122.

123.

124.

125.

126.

127.

128.

129.

130.

131.

132.

133.

Naciff J M, Jump ML, Torontali SM, et a1. 2002 Gene expression profile
induced by 17a1pha-ethynyl estradiol, bisphenol a, and genistein in the developing
female reproductive system of the rat. Toxicol Sci 68: 184-99

Watanabe H, Suzuki A, Mizutani T, et al. 2002 Genome-wide analysis of
changes in early gene expression induced by oestrogen. Genes Cells 72497-507

Waters KM, Safe S, Gaido KW 2001 Differential gene expression in response to
methoxychlor and estradiol through ERalpha, ERbeta, and AR in reproductive
tissues of female mice. Toxicol Sci 63:47-56.

Rockett J C, Kavlock RJ, Lambright CR, et al. 2002 DNA Arrays to Monitor
Gene Expression in Rat Blood and Uterus following 17beta-Estradiol Exposure:
Biomonitoring Environmental Effects Using Surrogate Tissues. Toxicol Sci
69:49-59

Harris JN, Gorski J 1978 Estrogen stimulation of DNA-dependent DNA
polymerase activity in immature rat uterus. Mol Cell Endocrinol 102293-305

Samudio I, Vyhlidal C, Wang F, et a1. 2001 Transcriptional Activation of
Deoxyribonucleic Acid Polymerase {{alpha}} Gene Expression in MCF-7 Cells
by 17{ {beta} }-Estradiol. Endocrinology 142: 1000- 1008

Lobenhofer EK, Bennett L, Cable PL, Li L, Bushel PR, Afshari CA 2002
Regulation of DNA Replication Fork Genes by 17{beta}-Estradiol. Mol
Endocrinol 16:1215-1229

Persico E, Scalona M, Cicatiello L, Sica V, Bresciani F, Weisz A 1990
Activation of 'immediate-early' genes by estrogen is not sufficient to achieve

stimulation of DNA synthesis in rat uterus. Biochem Biophys Res Commun
171:287-92

Leung BS, Potter AH 1987 Mode of estrogen action on cell proliferation in
CAMA-l cells: II. Sensitivity of G] phase population. J Cell Biochem 342213-25

Bourtourault M, Mahoudo H, Haras D, Samperez S, Jouan P 1984
Stimulation by estradiol-17 beta of thymidine kinase activity in the rat uterus. J
Steroid Biochem 212613-20

Sakamoto S, Sawasaki Y, Kudo H, Suzuki S, Sawaki K, Nagasawa H 1992
Effects of oestrogen on mitochondrial thymidine kinase activity in the immature
rat uterus. In Vivo 6: 157-60

Kasid A, Davidson NE, Gelmann EP, Lippman ME 1986 Transcriptional

control of thymidine kinase gene expression by estrogen and antiestrogens in
MCF-7 human breast cancer cells. J Biol Chem 261:5562-7

198

 

 

134.

135.

136.

137.

138.

139.

140.

141.

142.

143.

144.

145.

146.

Xie W, Duan R, Safe S 1999 Estrogen induces adenosine deaminase gene
expression in MCF—7 human breast cancer cells: role of estrogen receptor-Spl
interactions. Endocrinology 140:219-27

Sivridis E, Giatromanolaki A, Koukourakis MI, Bicknell R, Harris AL,
Gatter KC 2000 Thymidine phosphorylase expression in normal and hyperplastic
endometrium. J Clin Pathol 532704-708

 

Rees M, Hague S, Oehler MK, Bicknell R 1999 Regulation of endometrial
angiogenesis. Climacteric 2252-8

platelet-derived endothelial cell growth factor and its mRN A in uterine

Fujimoto J, Ichigo S, Sakaguchi H, Hirose R, Tamaya T 1998 Expression of l.
endometrium during the menstrual cycle. Mol Hum Reprod 42509-13 L

DiBattista WJ, Nishikawara MT, Leung YF 1978 Activity of enzymes
involved in pyrimidine nucleotide synthesis during uterine growth in cyclic rats. J
Reprod Fertil 542249-53

Guo J Z, Gorski J 1989 Estrogen effects on modifications of chromatin proteins
in the rat uterus. J Steroid Biochem 32:13-20

Cavailles V 2002 Estrogens and receptors: an evolving concept. Climacteric 5
Suppl 2220-6

Guo JZ, Gorski J 1988 Differential stimulation of histone and high mobility
group chromatin protein synthesis in the rat uterus by estrogen. Mol Endocrinol
22686-92

Guo JZ, Gorski J 1988 Estrogen effects on histone messenger ribonucleic acid
levels in the rat uterus. Mol Endocrinol 22693-700

Plumb M, Stein J, Stein G 1983 Coordinate regulation of multiple histone
mRNAs during the cell cycle in HeLa cells. Nucleic Acids Res 11:2391-410 -

Trachewsky D, Segal SJ 1967 Selective stimulation of ribonucleic acid synthesis
in uterine nuclei by estradiol—17-beta. Biochem Biophys Res Commun 272588-94

McCormack SA, Glasser SR 1980 Differential response of individual uterine
cell types from immature rats treated with estradiol. Endocrinology 10621634-49

Shiozawa T, Shih H-C, Miyamoto T, et al. 2003 Cyclic Changes in the

Expression of Steroid Receptor Coactivators and Corepressors in the Normal
Human Endometrium. J Clin Endocrinol Metab 882871-878

199

147.

148.

149.

150.

151.

152.

153.

154.

155.

156.

157.

158.

159.

Wieser F, Schneeberger C, Hudelist G, et a1. 2002 Endometrial nuclear
receptor co-factors SRC-l and N-CoR are increased in human endometrium
during menstruation. Mol Hum Reprod 82644-50

Travers MT, Knowler JT 1987 Oestrogen-induced expression of oncogenes in
the immature rat uterus. FEBS Lett 211227-30

 

Murphy LJ, Murphy LC, Friesen HG 1987 Estrogen induces insulin-like
growth factor-I expression in the rat uterus. Mol Endocrinol 12445-50

Weisz A, Bresciani F 1988 Estrogen induces expression of c-fos and c-myc
protooncogenes in rat uterus. Mol Endocrinol 22816-24 [
1!

Zheng X, Hendry WJ, 3rd 1997 Neonatal diethylstilbestrol treatment alters the
estrogen-regulated expression of both cell proliferation and apoptosis-related
proto-oncogenes (c-jun, c-fos, c-myc, bax, bcl-2, and bcl—x) in the hamster uterus.
Cell Growth Differ 82425-34

Weisz A, Cicatiello L, Persico E, Scalona M, Bresciani F 1990 Estrogen
stimulates transcription of c-jun protooncogene. Mol Endocrinol 421041-50

Webb DK, Moulton BC, Khan SA 1990 Estrogen induced expression of the C-
jun proto-oncogene in the immature and mature rat uterus. Biochem Biophys Res
Commun 168:721-6

Chiappetta C, Kirkland JL, Loose-Mitchell DS, Murthy L, Stancel GM 1992
Estrogen regulates expression of the jun family of protooncogenes in the uterus. J
Steroid Biochem Mol Biol 412113-23

Nephew KP, Peters GA, Khan SA 1995 Cellular localization of estradiol-
induced c-fos messenger ribonucleic acid in the rat uterus: c-fos expression and
uterine cell proliferation do not correlate strictly. Endocrinology 136:3007-15

Shaulian E, Karin M 2001 AP-l in cell proliferation and survival. Oncogene
2022390-400

Hyder SM, Stancel GM, Nawaz Z, McDonnell DP, Loose-Mitchell DS 1992
Identification of an estrogen response element in the 3'-flankin g region of the
murine c-fos protooncogene. J Biol Chem 267:18047-54

Cicatiello L, Sica V, Bresciani F, Weisz A 1993 Identification of a specific
pattern of "immediate-early" gene activation induced by estrogen during
mitogenic stimulation of rat uterine cells. Receptor 3:17-30

Nephew KP, Tang M, Khan SA 1994 Estrogen differentially affects c—jun

expression in uterine tissue compartments. Endocrinology 134: 1827-34

200

160.

161.

162.

163.

164.

165.

166.

167.

168.

169.

170.

171.

172.

I —-Iu-II-III

Cicatiello L, Ambrosino C, Coletta B, et a1. 1992 Transcriptional activation of
jun and actin genes by estrogen during mitogenic stimulation of rat uterine cells. J
Steroid Biochem Mol Biol 41:523-8

Teyssier C, Belguise K, Galtier F, Chalbos D 2001 Characterization of the
Physical Interaction between Estrogen Receptor alpha and JUN Proteins. J. Biol.
Chem. 276:36361-36369

Schorl C, Sedivy JM 2003 Loss of Protooncogene c-Myc Function Impedes Gl
Phase Progression Both before and after the Restriction Point. Mol. Biol. Cell
142823-835

Levens D 2002 Disentangling the MYC web. PNAS 99:5757-5759

O'Hagan RC, Schreiber-Agus N, Chen K, et al. 2000 Gene-target recognition

among members of the myc superfamily and implications for oncogenesis. Nat
Genet 2421 13-9

Menssen A, Hermeking H 2002 From the Cover: Characterization of the c-
MYC-regulated transcriptome by SAGE: Identification and analysis of c-MYC
target genes. PNAS 99:6274-6279

Galaktionov K, Chen X, Beach D 1996 Cdc25 cell-cycle phosphatase as a target
of c-myc. Nature 382:511-7

Auvinen M, Jarvinen K, Hotti A, et al. 2003 Transcriptional regulation of the
omithine decarboxylase gene by c-Myc/Max/Mad network and retinoblastoma
protein interacting with c-Myc. The International Journal of Biochemistry & Cell
Biology 352496-521

Gartel AL, Shchors K 2003 Mechanisms of c-myc-mediated transcriptional
repression of growth arrest genes. Experimental Cell Research 283217-21

Guo QM, Malek RL, Kim S, et al. 2000 Identification of c-Myc Responsive
Genes Using Rat cDNA Microarray. Cancer Res 60:5922-5928

Coller HA, Grandori C, Tamaya P, et al. 2000 Expression analysis with
oligonucleotide microarrays reveals that MYC regulates genes involved in
growth, cell cycle, signaling, and adhesion. Proc Natl Acad Sci U S A 97:3260-5.

Schuhmacher M, Kohlhuber F, Holzel M, et al. 2001 The transcriptional
program of a human B cell line in response to Myc. Nucl. Acids. Res. 292397-406

Huet-Hudson YM, Andrews GK, Dey SK 1989 Cell type-specific localization

of c-myc protein in the mouse uterus: modulation by steroid hormones and
analysis of the periimplantation period. Endocrinology 125:1683-90

201

 

173.

174.

175.

176.

177.

178.

179.

180.

181.

182.

183.

184.

Murphy LJ, Murphy LC, Friesen HG 1987 Estrogen induction of N-myc and
c—myc proto-oncogene expression in the rat uterus. Endocrinology 12021882-8

Wu L, Timmers C, Maiti B, et al. 2001 The E2F1-3 transcription factors are
essential for cellular proliferation. Nature 414:457-62

Stanelle J, Stiewe T, Theseling CC, Peter M, Putzer BM 2002 Gene expression
changes in response to E2F] activation. Nucl. Acids. Res. 30:1859-1867

Safe 8 2001 Transcriptional activation of genes by 17 beta-estradiol through
estrogen receptor-Spl interactions. Vitam Horrn 622231-52

Berg BH 1977 The early influence of 17-beta-oestradiol on 17 aminoacyl-tRN A
synthetases of mouse uterus and liver. Phosphorylation as a regulation
mechanism. Biochim Biophys Acta 479:152-71

Lutz WH, Barker KL 1986 Effect of estradiol on the amino acid-accepting

activity of uterine tRNAs and their participation in protein synthesis. J Biol Chem
261:11230—5

Whelly SM, Barker KL 1985 Inhibition of the aminoacylation of selected tRNA
molecules by an estrogen-regulated factor on uterine ribosomes. Regulation of
aminoacylation of tRNA by estrogens. Eur J Biochem 146:245-53

Pratt W 1998 The hsp90-based chaperone system: involvement in signal
transduction from a variety of hormone and growth factor receptors. Proc Soc Exp
Biol Med 217:420-434

Knoblauch R, Garabedian MJ 1999 Role for Hsp90—Associated Cochaperone
p23 in Estrogen Receptor Signal Transduction. Mol. Cell. Biol. 19:3748-3759

Komatsu T, Konishi I, Fukumoto M, et al. 1997 Messenger Ribonucleic Acid
Expression of Heat Shock Proteins HSP70 and HSP90 in Human Endometrium
and Myometrium during the Menstrual Cycle. J Clin Endocrinol Metab 8221385-
1389

Rivera-Gonzalez R, Petersen DN, Tkalcevic G, Thompson DD, Brown TA
1998 Estrogen-induced genes in the uterus of ovariectomized rats and their
regulation by droloxifene and tamoxifen. J Steroid Biochem Mol Biol 64:13-24

Shyamala G, Gauthier Y, Moore SK, Catelli MG, Ullrich SJ 1989 Estrogenic

regulation of murine uterine 90-kilodalton heat shock protein gene expression.
Mol Cell Biol 923567-70

202

 

185.

186.

187.

188.

189.

190.

191.

192.

193.

194.

195.

Simmons DG, Kennedy TG 2000 Induction of Glucose-Regulated Protein 78 in
Rat Uterine Glandular Epithelium During Uterine Sensitization for the Decidual
Cell Reaction. Biol Reprod 6221 168-1 176

Yang X, Dale EC, Diaz J, Shyamala G 1995 Estrogen dependent expression of
heat shock transcription factor: implications for uterine synthesis of heat shock
proteins. J Steroid Biochem Mol Biol 52:415-9

Padwick ML, Whitehead M, King RJ 1994 Hormonal regulation of HSP27
expression in human endometrial epithelial and stromal cells. Mol Cell
Endocrinol 10229-14

Porter W, Saville B, Hoivik D, Safe S 1997 Functional Synergy between the
Transcription Factor Spl and the Estrogen Receptor. Mol Endocrinol 1121569-
1580

Clark BF 1971 The effects of oestrogen and progesterone on uterine cell division
and epithelial morphology in spayed, adrenalectomized rats. J Endocrinol 50:527-
8

Prall OW, Sarcevic B, Musgrove EA, Watts CK, Sutherland RL 1997
Estrogen-induced activation of Cdk4 and Cdk2 during Gl-S phase progression is
accompanied by increased cyclin D1 expression and decreased cyclin-dependent
kinase inhibitor association with cyclin E-Cdk2. J Biol Chem 272: 10882-94

Whitfield ML, Sherlock G, Saldanha AJ, et a1. 2002 Identification of Genes
Periodically Expressed in the Human Cell Cycle and Their Expression in Tumors.
Mol. Biol. Cell 13: 1977-2000

van der Meijden CMJ, Lapointe DS, Luong MX, et al. 2002 Gene Profiling of
Cell Cycle Progression through S-Phase Reveals Sequential Expression of Genes

Required for DNA Replication and Nucleosome Assembly. Cancer Res 6223233-
3243

Cho RJ, Huang M, Campbell MJ, et al. 2001 Transcriptional regulation and
function during the human cell cycle. Nat Genet 27:48—54

Polager S, Kalma Y, Berkovich E, Ginsberg D 2002 E2Fs up-regulate
expression of genes involved in DNA replication, DNA repair and mitosis.
Oncogene 212437-46

Ishida S, Huang E, Zuzan H, et al. 2001 Role for E2F in Control of Both DNA

Replication and Mitotic Functions as Revealed from DNA Microarray Analysis.
Mol. Cell. Biol. 21:4684-4699

203

196.

197.

198.

199.

200.

201.

202.

203.

204.

205.

206.

207.

Muller H, Bracken AP, Vemell R, et al. 2001 E2Fs regulate the expression of
genes involved in differentiation, development, proliferation, and apoptosis.
Genes Dev. 152267-285

Lai MD, Lee LR, Cheng KS, Wing LY 2000 Expression of proliferating cell
nuclear antigen in luminal epithelium during the growth and regression of rat
uterus. J Endocrinol 166:87-93

Stack G, Gorski J 1985 Estrogen-stimulated deoxyribonucleic acid synthesis: a
ratchet model for the prereplicative period. Endocrinology 11722017-23

Prall OWJ, Rogan EM, Musgrove EA, Watts CKW, Sutherland RL 1998 c-
Myc or Cyclin D1 Mimics Estrogen Effects on Cyclin E-Cdk2 Activation and
Cell Cycle Reentry. Mol. Cell. Biol. 1824499-4508

Trowbridge JM, Rogatsky I, Garabedian MJ 1997 Regulation of estrogen
receptor transcriptional enhancement by the cyclin A/Cdk2 complex. PNAS
94210132-10137

Fero ML, Rivkin M, Tasch M, et al. 1996 A syndrome of multiorgan
hyperplasia with features of gigantism, tumorigenesis, and female sterility in
p27(Kip1)-deficient mice. Cell 852733-44

Zhao J, Dynlacht B, Imai T, Hori T-a, Harlow E 1998 Expression of NPAT, a
novel substrate of cyclin E-CDK2, promotes S-phase entry. Genes Dev. 12:456-
461

Krek W, Xu G, Livingston DM 1995 Cyclin A-kinase regulation of E2F-1 DNA
binding function underlies suppression of an S phase checkpoint. Cell 83:1149-58

Motokura T, Arnold A 1993 PRADl/cyclin D1 proto-oncogene: genomic
organization, 5' DNA sequence, and sequence of a tumor-specific rearrangement
breakpoint. Genes Chromosomes Cancer 7:89-95

Marino M, Acconcia F, Bresciani F, Weisz A, Trentalance A 2002 Distinct
Nongenomic Signal Transduction Pathways Controlled by 17beta -Estradiol
Regulate DNA Synthesis and Cyclin D1 Gene Transcription in HepG2 Cells.
Mol. Biol. Cell 13:3720-3729

Pestell RG, Albanese C, Reutens AT, Segall JE, Lee RJ, Arnold A 1999 The
Cyclins and Cyclin-Dependent Kinase Inhibitors in Hormonal Regulation of
Proliferation and Differentiation. Endocr Rev 202501-534

Ciemerych MA, Kenney AM, Sicinska E, et al. 2002 Development of mice
expressing a single D-type cyclin. Genes Dev. 16:3277-3289

204

 

208.

209.

210.

211.

212.

213.

214.

215.

216.

217.

218.

Altucci L, Addeo R, Cicatiello L, et al. 1997 Estrogen induces early and timed
activation of cyclin-dependent kinases 4, 5, and 6 and increases cyclin messenger
ribonucleic acid expression in rat uterus. Endocrinology 138:978-84

Hermeking H, Lengauer C, Polyak K, et al. 1997 14-3-3 sigma is a p53-
regulated inhibitor of GZ/M progression. Mol Cell 123-11

Orimo A, Inoue S, Ikeda K, Noji S, Muramatsu M 1995 Molecular cloning,
structure, and expression of mouse estrogen-responsive finger protein Efp. Co-

localization with estrogen receptor mRNA in target organs. J Biol Chem
270:24406-13

Orimo A, Inoue S, Minowa O, et al. 1999 Underdeveloped uterus and reduced
estrogen responsiveness in mice with disruption of the estrogen-responsive finger
protein gene, which is a direct target of estrogen receptor alpha. Proc Natl Acad
Sci U S A 96: 12027-32

Ferrero M, Cairo G 1993 Estrogen-regulated expression of a growth arrest
specific gene (gas-1) in rat uterus. Cell Biology International 172857-862

Zhuang Y-H, Sarca D, Weisz A, et al. 2001 Cell type-specific induction of
cyclin D and cyclin-dependent kinase inhibitor p27kip1 expression by estrogen in

rat endometrium. The Journal of Steroid Biochemistry and Molecular Biology
782193-199

Tanaka M, Kyo S, Takakura M, et al. 1998 Expression of Telomerase Activity
in Human Endometrium Is Localized to Epithelial Glandular Cells and Regulated
in a Menstrual Phase-Dependent Manner Correlated with Cell Proliferation. Am J
Pathol 15321985-1991

Kyo S, Takakura M, Kanaya T, et al. 1999 Estrogen Activates Telomerase.
Cancer Res 59:5917-5921

Bigsby RM, Cunha GR 1986 Estrogen stimulation of deoxyribonucleic acid
synthesis in uterine epithelial cells which lack estrogen receptors. Endocrinology
1192390-6

Pierro E, Minici F, Alesiani O, et a1. 2001 Stromal-Epithelial Interactions
Modulate Estrogen Responsiveness in Normal Human Endometrium. Biol Reprod

642831-838

Cunha GR, Young P 1992 Role of stroma in oestrogen-induced epithelial
proliferation. Epithelial Cell Biol 1218-31

205

 

219.

220.

221.

222.

223.

224.

225.

226.

227.

228.

229.

230.

Wiesen J, Young P, Werb Z, Cunha G 1999 Signaling through the stromal
epidermal growth factor receptor is necessary for mammary ductal development.
Development 126:335-344

Bigsby RM 2002 Control of Growth and Differentiation of the Endometrium:
The Role of Tissue Interactions. Ann NY Acad Sci 955:1 10-1 17

Stiles CD, Capone GT, Scher CD, Antoniades HN, Van Wyk JJ, Pledger WJ
1979 Dual control of cell growth by somatomedins and platelet-derived growth
factor. Proc Natl Acad Sci U S A 76:1279-83

Pardee AB 1989 G1 events and regulation of cell proliferation. Science 2462603-
8

Adesanya 00, Zhou J, Samathanam C, Powell-Braxton L, Bondy CA 1999
Insulin-like growth factor 1 is required for G2 progression in the estradiol-
induced mitotic cycle. PNAS 96:3287-3291

Won K, Xiong Y, Beach D, Gilman M 1992 Growth-Regulated Expression of
D-Type Cyclin Genes in Human Diploid Fibroblasts. PNAS 89:9910-9914

Elder PK, Schmidt LJ, Ono T, Getz MJ 1984 Specific stimulation of actin gene
transcription by epidermal growth factor and cycloheximide. Proc Natl Acad Sci
U S A 81:7476—80

Lewis EJ, Chikaraishi DM 1987 Regulated expression of the tyrosine
hydroxylase gene by epidermal growth factor. Mol Cell Biol 7:3332-6

Earp HS, Dawson TL, Li X, Yu H 1995 Heterodimerization and functional
interaction between EGF receptor family members: a new signaling paradigm
with implications for breast cancer research. Breast Cancer Res Treat 3521 15-32

Nelson KG, Takahashi T, Bossert NL, Walmer DK 1991 Epidermal growth
factor replaces estrogen in the stimulation of female genital-tract growth factor
and differentiation. Proceedings of the National Academy of Science 88:21-25

Ignar-Trowbridge D, Nelson K, Bidwell M, et al. 1992 Coupling of Dual
Signaling Pathways: Epidermal Growth Factor Action Involves the Estrogen
Receptor. PNAS 89:4658-4662

Curtis SW, Washburn T, Sewall C, et al. 1996 Physiological coupling of
growth factor and steroid receptor signaling pathways: estrogen receptor knockout

mice lack estrogen-like response to epidermal growth factor. Proc Natl Acad Sci
U S A 93: 12626-30

206

231.

232.

233.

234.

235.

236.

237.

238.

239.

240.

241.

242.

Hom YK, Young P, Wiesen JF, et al. 1998 Uterine and Vaginal Organ Growth
Requires Epidermal Growth Factor Receptor Signaling from Stroma.
Endocrinology 1392913-921

Tomooka Y, DiAugustine RP, McLachlan JA 1986 Proliferation of mouse
uterine epithelial cells in vitro. Endocrinology 118:1011-8

Lingham RB, Stancel GM, Loose-Mitchell DS 1988 Estrogen regulation of
epidermal growth factor receptor messenger ribonucleic acid. Mol Endocrinol
22230-5

Mukku VR, Stancel GM 1985 Regulation of epidermal growth factor receptor
by estrogen. J Biol Chem 260:9820-4

Tong BJ, Das SK, Threadgill D, Magnuson T, Dey SK 1996 Differential
expression of the full-length and truncated forms of the epidermal growth factor

receptor in the preimplantation mouse uterus and blastocyst. Endocrinology
137:1492-6

DiAugustine RP, Petrusz P, Bell GI, et a1. 1988 Influence of estrogens on
mouse uterine epidermal growth factor precursor protein and messenger
ribonucleic acid. Endocrinology 12222355-63

Lim H, Dey SK, Das SK 1997 Differential Expression of the erbB2 Gene in the
Periimplantation Mouse Uterus: Potential Mediator of Signaling by Epidermal
Growth Factor-Like Growth Factors. Endocrinology 138: 1328-1337

Levin ER 2003 Bidirectional Signaling between the Estrogen Receptor and the
Epidermal Growth Factor Receptor. Mol Endocrinol 172309-317

Lin SY, Makino K, Xia W, et al. 2001 Nuclear localization of EGF receptor and
its potential new role as a transcription factor. Nat Cell Biol 32802-8

Prenzel N, Zwick E, Daub H, et a1. 1999 EGF receptor transactivation by G-

protein-coupled receptors requires metalloproteinase cleavage of proHB-EGF.
Nature 402:884-8

Brissenden JE, Derynck R, Francke U 1985 Mapping of transforming growth
factor alpha gene on human chromosome 2 close to the breakpoint of the Burkitt's
lymphoma t(2;8) variant translocation. Cancer Res 45:5593-7

Nelson KG, Takahashi T, Lee DC, et al. 1992 Transforming growth factor-

alpha is a potential mediator of estrogen action in the mouse uterus.
Endocrinology 131 2 1657-64

207

243.

244.

245.

246.

247.

248.

249.

250.

251.

252.

253.

254.

Clarke R, Brunner N, Katz D, et al. 1989 The effects of a constitutive
expression of transforming growth factor-alpha on the growth of MCF-7 human
breast cancer cells in vitro and in vivo. Mol Endocrinol 32372-80

Gray K, Bullock B, Dickson R, et al. 1996 Potentiation of diethylstilbestrol-
induced alterations in the female mouse reproductive tract by transforming growth
factor-alpha transgene expression. Mol Carcinog 172163-73

Das SK, Lim H, Wang J, Paria BC, BazDresch M, Dey SK 1997 Inappropriate
expression of human transforming growth factor (TGF)-alpha in the uterus of
transgenic mouse causes downregulation of TGF-beta receptors and delays the
blastocyst—attachment reaction. J Mol Endocrinol 182243-57

Coffey RJ, J r., Derynck R, Wilcox J N, et al. 1987 Production and auto-
induction of transforming growth factor-alpha in human keratinocytes. Nature
328:817-20

Luetteke NC, Qiu TH, Peiffer RL, Oliver P, Smithies 0, Lee DC 1993 TOP
alpha deficiency results in hair follicle and eye abnormalities in targeted and
waved-1 mice. Cell 732263-78

Tamada H, Das SK, Andrews GK, Dey SK 1991 Cell-type-specific expression
of transforming growth factor-alpha in the mouse uterus during the peri-
implantation period. Biol Reprod 452365-72

Wang HS, Chard T 1999 IGFs and IGF-binding proteins in the regulation of
human ovarian and endometrial function. J Endocrinol 161 : 1-1 3

Sato T, Wang G, Hardy MP, Kurita T, Cunha GR, Cooke PS 2002 Role of
Systemic and Local IGF-I in the Effects of Estrogen on Growth and Epithelial
Proliferation of Mouse Uterus. Endocrinology 14322673-2679

Adesanya 0, Zhou J, Bondy C 1996 Sex steroid regulation of insulin-like
growth factor system gene expression and proliferation in primate myometrium. J
Clin Endocrinol Metab 81 2 1967-1974

Baker J, Hardy MP, Zhou J, et al. 1996 Effects of an Igfl gene null mutation
on mouse reproduction. Mol Endocrinol 102903-18

Rutanen EM 1998 Insulin-like growth factors in endometrial function. Gynecol
Endocrinol 122399-406

Klotz DM, Hewitt SC, Korach KS, Diaugustine RP 2000 Activation of a
uterine insulin-like growth factor I signaling pathway by clinical and

environmental estrogens: requirement of estrogen receptor-alpha. Endocrinology
141:3430-9

208

 

 

255.

256.

257.

258.

259.

260.

261.

262.

263.

264.

265.

266.

Kapur S, Tamada H, Dey S, Andrews G 1992 Expression of insulin-like growth
factor-1(IGF-I) and its receptor in the pen-implantation mouse uterus, and cell-

specific regulation of IGF- I gene expression by estradiol and progesterone. Biol
Reprod 462208-219

Klotz DM, Hewitt SC, Ciana P, et a1. 2002 Requirement of estrogen receptor-
alpha in insulin-like growth factor-1 (IGF-1)-induced uterine responses and in
vivo evidence for IGF-I/estrogen receptor cross-talk. J Biol Chem 277:8531-7

Molnar P, Murphy LJ 1994 Effects of oestrogen on rat uterine expression of
insulin-like growth factor-binding proteins. J Mol Endocrinol 13:59-67

Rajkumar K, Dheen T, Krsek M, Murphy LJ 1996 Impaired estrogen action in
the uterus of insulin-like growth factor binding protein-1 transgenic mice.
Endocrinology 137:1258-64

Elma-ml

Letterio JJ, Bottinger EP 1998 TGF-beta knockout and dominant-negative
receptor transgenic mice. Miner Electrolyte Metab 24:161-7

Lutz M, Knaus P 2002 Integration of the TGF-[beta] pathway into the cellular
signalling network. Cellular Signalling 142977-988

Yamanouchi K, Soeta C, Harada R, Naito K, Tojo H 1999 Endometrial
expression of cellular protooncogene c-ski and its regulation by estradiol-17beta.
FEBS Lett 449:273-6

Pessah M, Marais J, Prunier C, et al. 2002 c-Jun Associates with the

Oncoprotein Ski and Suppresses Smad2 Transcriptional Activity. J. Biol. Chem.
277 : 29094-29 100

Sun Y, Liu X, Eaton EN, Lane WS, Lodish HF, Weinberg RA 1999
Interaction of the Ski oncoprotein with Smad3 regulates TGF-beta signaling. Mol
Cell 42499-509

F eng XH, Liang YY, Liang M, Zhai W, Lin X 2002 Direct interaction of c-Myc
with Smad2 and Smad3 to inhibit TGF-beta-mediated induction of the CDK
inhibitor p15(Ink4B). Mol Cell 92133-43

Takahashi T, Eitzman B, Bossert NL, et a1. 1994 Transforming growth factors
beta 1, beta 2, and beta 3 messenger RNA and protein expression in mouse uterus

and vagina during estrogen-induced growth: a comparison to other estrogen-
regulated genes. Cell Growth Differ 52919-35

Das SK, Flanders KC, Andrews GK, Dey SK 1992 Expression of transforming
growth factor-beta isoforms (beta 2 and beta 3) in the mouse uterus: analysis of

209

267.

268.

269.

270.

271.

272.

273.

274.

275.

276.

277.

the periimplantation period and effects of ovarian steroids. Endocrinology
13023459-66

Schneider SL, Gollnick SO, Grande C, Pazik JE, Tomasi TB 1996 Differential
regulation of TGF—[beta]2 by hormones in rat uterus and mammary gland. Journal
of Reproductive Immunology 322125-144

Lu D, Giguere V 2001 Requirement of Ras-Dependent Pathways for Activation
of the Transforming Growth Factor {beta}3 Promoter by Estradiol.
Endocrinology 1422751-759

Wada K, Nomura S, Morii E, et al. 1996 Changes in levels of mRNAs of
transforming growth factor (TGF)-beta1, -beta2, -beta3, TGF-beta type H receptor

and sulfated glycoprotein-2 during apoptosis of mouse uterine epithelium. J
Steroid Biochem Mol Biol 592367-75

Ornitz DM, Itoh N 2001 Fibroblast growth factors. Genome Biol
22REVIEWS3005

Tsai S-J, Wu M-H, Chen H-M, Chuang P-C, Wing L-YC 2002 Fibroblast
Growth Factor-9 Is an Endometrial Stromal Growth Factor. Endocrinology
143:2715-2721

Ka H, Jaeger LA, Johnson GA, Spencer TE, Bazer FW 2001 Keratinocyte
Growth Factor Is Up-Regulated by Estrogen in the Porcine Uterine Endometrium

and Functions in Trophectoderrn Cell Proliferation and Differentiation.
Endocrinology 14222303-2310

Hom YK, Young P, Thomson AA, Cunha GR 1998 Keratinocyte Growth
Factor Injected into Female Mouse Neonates Stimulates Uterine and Vaginal
Epithelial Growth. Endocrinology 139:3772-3779

Guo L, Degenstein L, Fuchs E 1996 Keratinocyte growth factor is required for
hair development but not for wound healing. Genes Dev 102165-75

Rider V, Carlone DL, Foster RT 1997 Oestrogen and progesterone control basic
fibroblast growth factor mRN A in the rat uterus. J Endocrinol 154275-84

Reynolds LP, Kirsch JD, Kraft KC, Redmer DA 1998 Time-course of the
uterine response to estradiol-17B in ovariectomized ewes: expression of
angiogenic factors. Biol Reprod 592613-620

Fujimoto J, Hori M, Ichigo S, Tamaya T 1997 Ovarian steroids regulate the

expression of basic fibroblast growth factor and its mRN A in fibroblasts derived
from uterine endometrium. Ann Clin Biochem 34 ( Pt 1):91-6

210

278.

279.

280.

281.

282.

283.

284.

285.

286.

287.

288.

Pavelock K, Braas KM, Ouafik LH, Osol G, May V 2001 Differential
Expression and Regulation of the Vascular Endothelial Growth Factor Receptors
Neuropilin-l and Neuropilin-2 in Rat Uterus. Endocrinology 142:613-622

Soker S, Takashima S, Miao HQ, Neufeld G, Klagsbrun M 1998 Neuropilin-l
is expressed by endothelial and tumor cells as an isoform-specific receptor for

vascular endothelial growth factor. Cell 922735-45

Mueller MD, Lebovic DI, Garrett E, Taylor RN 2000 Neutrophils infiltrating
the endometrium express vascular endothelial growth factor: potential role in
endometrial angiogenesis. Fertility and Sterility 742107-112

Hyder SM 2002 The Role of Steroid Hormones on the Regulation of Vascular
Endothelial Growth Factor. Am J Pathol 161:345-346

Ma W, Tan J, Matsumoto H, et al. 2001 Adult tissue angiogenesis: evidence for
negative regulation by estrogen in the uterus. Mol Endocrinol 1521983-92

Gray K, Eitzman B, Raszmann K, et al. 1995 Coordinate regulation by
diethylstilbestrol of the platelet-derived growth factor-A (PDGF-A) and -B chains
and the PDGF receptor alpha- and beta-subunits in the mouse uterus and vagina:
potential mediators of estrogen action. Endocrinology 136:2325-40

Chegini N, Rossi MJ, Masterson BJ 1992 Platelet-derived growth factor
(PDGF), epidermal growth factor (EGF), and EGF and PDGF beta-receptors in

human endometrial tissue: localization and in vitro action. Endocrinology
130:2373-85

Rossi MJ, Chegini N, Masterson BJ 1992 Presence of epidermal growth factor,
platelet-derived growth factor, and their receptors in human myometrial tissue and

smooth muscle cells: their action in smooth muscle cells in vitro. Endocrinology
13021716-27

Barbarisi A, Petillo 0, Di Lieto A, et al. 2001 17-beta estradiol elicits an
autocrine leiomyoma cell proliferation: evidence for a stimulation of protein
kinase-dependent pathway. J Cell Physiol 1862414-24

Terranova PF, Hunter VJ, Roby KF, Hunt JS 1995 Tumor necrosis factor-
alpha in the female reproductive tract. Proc Soc Exp Biol Med 209:325-42

Roby KF, Hunt JS 1995 Myometrial tumor necrosis factor alpha: cellular

localization and regulation by estradiol and progesterone in the mouse. Biol
Reprod 522509-15

211

289.

290.

291.

292.

293.

294.

295.

296.

297.

298.

299.

300.

Hunt J S, Miller L, Roby KF, Huang J, Platt JS, DeBrot BL 1997 Female
steroid hormones regulate production of pro-inflammatory molecules in uterine
leukocytes. J Reprod Immunol 35:87-99

von Wolff M, Classen-Linke I, Heid D, et al. 1999 Tumour necrosis factor-
alpha(TNF-a1pha) in human endometrium and uterine secretion: an evaluation by

immunohistochemistry, ELISA and semiquantitative RT-PCR. Mol Hum Reprod
52146-52

Danforth DN, J r., Sgagias MK 1993 Tumour necrosis factor-alpha modulates

oestradiol responsiveness of MCF—7 breast cancer cells in vitro. J Endocrinol
138:517-28

Roby KF, Hunt JS 1994 Mouse endometrial tumor necrosis factor-alpha
messenger ribonucleic acid and protein: localization and regulation by estradiol
and progesterone. Endocrinology 13522780—9

Tabibzadeh S, Satyaswaroop PG, von Wolff M, Strowitzki T 1999 Regulation
of TNF—alpha mRNA expression in endometrial cells by TNF—alpha and by
oestrogen withdrawal. Mol Hum Reprod 521141-9

Roby KF, Laham N, Hunt JS 1996 Cellular localization and steroid hormone
regulation of mRNA encoding tumour necrosis factor receptor I in mouse uterus.
J Reprod Fertil 106:285-90

Klampfer L, Lee TH, Hsu W, Vilcek J, Chen-Kiang S 1994 NF-IL6 and AP-l
cooperatively modulate the activation of the TSG-6 gene by tumor necrosis factor
alpha and interleukin-1. Mol Cell Biol 14:6561-9

Moussad EE-DA, Brigstock DR 2000 Connective Tissue Growth Factor: What's
in a Name? Molecular Genetics and Metabolism 712276-292

lnadera H, Dong H-Y, Matsushima K 2002 WISP-2 is a secreted protein and
can be a marker of estrogen exposure in MCF-7 cells. Biochemical and
Biophysical Research Communications 2942602-608

lnadera H, Hashimoto S-i, Dong H-Y, et a1. 2000 WISP-2 as a Novel Estrogen-
Responsive Gene in Human Breast Cancer Cells. Biochemical and Biophysical
Research Communications 275:108-114

Kothapalli D, Grotendorst GR 2000 CTGF modulates cell cycle progression in
CAMP-arrested NRK fibroblasts. J Cell Physiol 1822119-26

Rageh MA, Moussad EE, Wilson AK, Brigstock DR 2001 Steroidal regulation

of connective tissue growth factor (CCN2; CTGF) synthesis in the mouse uterus.
Mol Pathol 542338-46

212

 

 

 

301.

302.

303.

304.

305.

306.

307.

308.

309.

310.

311.

312.

Lau L, Nathans D 1985 Identification of a set of genes expressed during the
G0/G1 transition of cultured mouse cells. EMBO J. 423145-3151

Sampath D, Winneker RC, Zhang Z 2001 Cyr61, a Member of the CCN
Family, Is Required for MCF—7 Cell Proliferation: Regulation by l7{beta}-

Estradiol and Overexpression in Human Breast Cancer. Endocrinology 14222540-
2548

Chen C-C, Mo F -E, Lau LF 2001 The Angiogenic Factor Cyr61 Activates a
Genetic Program for Wound Healing in Human Skin Fibroblasts. J. Biol. Chem.
276:47329-47337

Babic AM, Kireeva ML, Kolesnikova TV, Lau LF 1998 CYR61, a product of a
growth factor-inducible immediate early gene, promotes angiogenesis and tumor
growth. PNAS 95:6355-6360

Mo F-E, Muntean AG, Chen C-C, Stolz DB, Watkins SC, Lau LF 2002
CYR61 (CCNl) Is Essential for Placental Development and Vascular Integrity.
Mol. Cell. Biol. 2228709-8720

Schipper RG, Penning LC, Verhofstad AA 2000 Involvement of polyamines in
apoptosis. Facts and controversies: effectors or protectors? Semin Cancer Biol
10:55-68

Pegg AE 1986 Recent advances in the biochemistry of polyamines in eukaryotes.
Biochem J 234:249-62

Schipper RG, Verhofstad AAJ 2002 Distribution Patterns of Omithine
Decarboxylase in Cells and Tissues: Facts, Problems, and Postulates. J.
Histochem. Cytochem. 5021 143-1160

Kaczmarek L, Calabretta B, Ferrari S, de Riel J K 1987 Cell-cycle-dependent
expression of human omithine decarboxylase. J Cell Physiol 132:545-51

Packham G, Cleveland JL 1997 Induction of omithine decarboxylase by IL-3 is
mediated by sequential c-Myc-independent and c-Myc-dependent pathways.
Oncogene 15:1219-32

Wu S, Pena A, Korcz A, Soprano DR, Soprano KJ 1996 Overexpression of
Mxil inhibits the induction of the human omithine decarboxylase gene by the
Myc/Max protein complex. Oncogene 12:621-9

Reiss NA, Kaye AM 1981 Identification of the major component of the estrogen-
induced protein of rat uterus as the BB isozyme of creatine kinase. J Biol Chem
256:5741-9

213

 

 

313.

314.

315.

316.

317.

318.

319.

320.

321.

322.

323.

324.

Reiss NA 1988 Ontogeny and estrogen responsiveness of creatine kinase and
glycolytic enzymes in brain and uterus of rat. Neurosci Lett 842197-202

Degani H, Victor TA, Kaye AM 1988 Effects of 17 beta-estradiol on high
energy phosphate concentrations and the flux catalyzed by creatine kinase in

immature rat uteri: 31P nuclear magnetic resonance studies. Endocrinology
122:1631-8

Degani H, Shaer A, Victor TA, Kaye AM 1984 Estrogen-induced changes in
high-energy phosphate metabolism in rat uterus: 31P NMR studies. Biochemistry
23:2572-7

Kaye AM 1983 Enzyme induction by estrogen. J Steroid Biochem 19233-40

Bergen HT, Pentecost BT, Dickerman HW, Pfaff DW 1993 In situ
hybridization for creatine kinase-B messenger RNA in rat uterus and brain. Mol
Cell Endocrinol 92:11 1-9

Wang F, Samudio 1, Safe S 2001 Transcriptional activation of rat creatine kinase
B by 17beta-estradiol in MCF—7 cells involves an estrogen responsive element
and GC-rich sites. J Cell Biochem 842156-72

Payne RM, Friedman DL, Grant JW, Perryman MB, Strauss AW 1993
Creatine kinase isoenzymes are highly regulated during pregnancy in rat uterus
and placenta. Am J Physiol 2652E624-35

Payne RM, Strauss AW 1994 Expression of the mitochondrial creatine kinase
genes. Mol Cell Biochem 133-134:235-43

Baquer NZ, Sochor M, Kuniara S, McLean P 1993 Effect of oestradiol on the
carbohydrate metabolism of immature rat uterus: the role of fructose-2, 6-bis-

phosphate and of phosphoribosyl pyrophosphate. Biochem Mol Biol Int 31:509-
19

Welch RD, Gorski J 1999 Regulation of glucose transporters by estradiol in the
immature rat uterus. Endocrinology 14023602-3608

Shinkarenko L, Kaye AM, Degani H 1994 13C NMR kinetic studies of the
rapid stimulation of glucose metabolism by estrogen in immature rat uterus. NMR
Biomed 72209-17

Kaye AM, Shinkarenko L, Waisman A, Victor T, Degani H 1989 Estradiol

induction of accelerated energy metabolism in prepuberal rat uteri in vitro:
mRNA hybridization and [13C]NMR studies. J Steroid Biochem 342289-92

214

F .

325.

326.

327.

328.

329.

330.

331.

332.

333.

334.

335.

336.

337.

Lundeen SG, Carver J M, McKean M-L, Winneker RC 1997 Characterization
of the Ovariectomized Rat Model for the Evaluation of Estrogen Effects on
Plasma Cholesterol Levels. Endocrinology 138: 1552-1558

Gray J M, Greenwood MR 1982 Time course of effects of ovarian hormones on
food intake and metabolism. Am J Physiol 2432E407-12

Gray J M, Greenwood MR 1983 Uterine and adipose lipoprotein lipase activity
in hormone-treated and pregnant rats. Am J Physiol 2452El32-7

Wiinholds J, Muller E, Ab G 1991 Oestrogen facilitates the binding of
ubiquitous and liver-enriched nuclear proteins to the apoVLDL H promoter in
vivo. Nucleic Acids Res 19233-41

Lopez D, Sanchez MD, Shea-Eaton W, McLean MP 2002 Estrogen Activates
the High-Density Lipoprotein Receptor Gene via Binding to Estrogen Response

Elements and Interaction with Sterol Regulatory Element Binding Protein-1A.
Endocrinology 143:2155-2168

Ramachandran S, Song M, Murphy AA, Parthasarathy S 2001 Expression of
Scavenger Receptor Class B1 in Endometrium and Endometriosis. J Clin
Endocrinol Metab 86:3924-3928

Rumpel E, Kruse C, Muller PK, Kuhnel W 1996 Expression of vigilin in the
uterus of ovariectomized steroid-treated rats and during the estrous cycle. Anat
Anz 1782337-44

Xiao AZ, Zhao YG, Duan EK 2002 Expression and regulation of the fatty acid
amide hydrolase gene in the rat uterus during the estrous cycle and peri-
implantation period. Mol Hum Reprod 82651-8

Hulboy D, Rudolph L, Matrisian L 1997 Matrix metalloproteinases as
mediators of reproductive function. Mol. Hum. Reprod. 3:27-45

Curry TE, Jr, Osteen KG 2001 Cyclic Changes in the Matrix Metalloproteinase
System in the Ovary and Uterus. Biol Reprod 64: 1285-1296

Osteen KG, Bruner-Tran KL, Ong D, Eisenberg E 2002 Paracrine Mediators
of Endometrial Matrix Metalloproteinase Expression: Potential Targets for

Progestin-Based Treatment of Endometriosis. Ann NY Acad Sci 955:139-146

Lukashev ME, Werb Z 1998 ECM signalling: orchestrating cell behaviour and
misbehaviour. Trends in Cell Biology 82437-441

Werb Z 1997 ECM and cell surface proteolysis: regulating cellular ecology. Cell
912439-42

215

 

 

338.

339.

340.

341.

342.

343.

344.

345.

346.

347.

348.

349.

Munakata H, Isemura M, Aikawa J, Kodama C, Yosizawa Z 1985 Changes of
glycosaminoglycan composition of uterine myometrium of rabbit induced by
female sex steroids. Tohoku J Exp Med 147277-81

Endo M, Shimizu T, Munakata H, Yosizawa Z 1978 Composition of acidic
glycoconjugates (glycosaminoglycans and glycoprotein) in myometrium of rabbit
uterus under estrogenic condition. Tohoku J Exp Med 126:103-10

Takata K, Terayama H 1977 Hormonal effect on glycosaminoglycans and
glycoproteins in uteri of ovariectomized rats. Biochim Biophys Acta 500:333-43

Munakata H, Isemura M, Yosizawa Z 1981 Hormonal effects on the sulfation
of sulfated glycoconjugates in the uterine endometrium of non-ovariectomized
rabbit. Tohoku J Exp Med 135:275-9

Henneman DH 1971 Effect of estradiol-17 on collagen biosynthesis, degradation
and re—utilization in vivo. Biochem Biophys Res Commun 442326-32

Dyer RF, Sodek J, Heersche J N 1980 The effect of 17 beta-estradiol on collagen
and noncollagenous protein synthesis in the uterus and some periodontal tissues.
Endocrinology 107:1014-21

Mandell MS, Sodek J 1982 Metabolism of collagen types I, III, and V in the
estradiol-stimulated uterus. J Biol Chem 25725268-73

Pastore GN, Dicola LP, Dollahon NR, Gardner RM 1992 Effect of estriol on
the structure and organization of collagen in the lamina propria of the immature
rat uterus. Biol Reprod 47:83-91

Pastore GN, diCola LP, Dollahon NR, Gardner RM 1989 The effect of
estradiol on collagen structure and organization in the immature rat uterus. Proc
Soc Exp Biol Med 191269-77

Woessner JF, Jr. 1969 Inhibition by oestrogen of collagen breakdown in the
involuting rat uterus. Biochem J 112:637-45

Komm BS, Frankel FR, Myers JC, Lyttle CR 1987 Estrogen regulation of
alpha l(I)-procollagen messenger ribonucleic acid in the rat uterus.
Endocrinology 120: 1403-10

Frankel FR, Hsu CY, Myers JC, et al. 1988 Regulation of alpha 2(1), alpha

1(III), and alpha 2(V) collagen mRN As by estradiol in the immature rat uterus.
DNA 72347-54

216

 

350.

351.

352.

353.

354.

355.

356.

357.

358.

359.

360.

361.

Wu WX, Zhang Q, Unno N, Derks JB, Nathanielsz PW 2000 Characterization
of decorin mRN A in pregnant intrauterine tissues of the ewe and regulation by
steroids. Am J Physiol Cell Physiol 2782C199-206

Carson DD, Farrar JD, Laidlaw J, Wright DA 1990 Selective activation of the
N-glycosylation apparatus in uteri by estrogen. J Biol Chem 265:2947-55

Irwin J C, Utian WH, Eckert RL 1991 Sex steroids and growth factors
differentially regulate the growth and differentiation of cultured human
endometrial stromal cells. Endocrinology 12922385-92

Vollmer G, Hopert AC, Ellerbrake N, Wunsche W, Knuppen R 1995
Fibronectin is an estrogen-repressed protein in RUCA-I rat endometrial
adenocarcinoma cells. J Steroid Biochem Mol Biol 54:131-9

Jetten AM, De Luca LM, Nelson K, Schroeder W, Burlingame S, Fujimoto
W 1996 Regulation of comifin [alpha] expression in the vaginal and uterine

epithelium by estrogen and retinoic acid. Molecular and Cellular Endocrinology
12327-15

Russo LA, Calabro SP, Filler TA, Carey DJ, Gardner RM 2001 In vivo
regulation of syndecan-3 expression in the rat uterus by 17 beta-estradiol. J Biol
Chem 2762686-92

Morris J, Potter 8, Gaza-Bulseco G 1988 Estradiol-stimulated turnover of

heparan sulfate proteoglycan in mouse uterine epithelium. J. Biol. Chem.
263:4712-4718

Inki P 1997 Expression of syndecan-1 in female reproductive tract tissues and
cultured keratinocytes. Mol Hum Reprod 32299-305

Boutin EL, Sanderson RD, Bernfield M, Cunha GR 1991 Epithelial-
mesenchymal interactions in uterus and vagina alter the expression of the cell
surface proteoglycan, syndecan. Dev Biol 148263-74

Lessey BA, Arnold JT 1998 Paracrine signaling in the endometrium: integrins
and the establishment of uterine receptivity. J Reprod Immunol 392105-16

DeSouza MM, Lagow E, Carson DD 1998 Mucin functions and expression in
mammalian reproductive tract tissues. Biochem Biophys Res Commun 24721-6

Carson DD, DeSouza MM, Kardon R, Zhou X, Lagow E, Julian J 1998
Mucin expression and function in the female reproductive tract. Hum Reprod
Update 42459-64

217

 

362.

363.

364.

365.

366.

367.

368.

369.

370.

371.

372.

373.

Carraway KL, Idris N 2001 Regulation of sialomucin complex/Muc4 in the
female rat reproductive tract. Biochem Soc Trans 292162-6

Braga V, Gendler S 1993 Modulation of Muc-l mucin expression in the mouse

uterus during the estrus cycle, early pregnancy and placentation. J Cell Sci
1052397-405

Pimental RA, Julian J, Gendler SJ, Carson DD 1996 Synthesis and
intracellular trafficking of Muc-l and mucins by polarized mouse uterine
epithelial cells. J Biol Chem 271:28128-37

Surveyor GA, Gendler SJ, Pemberton L, et al. 1995 Expression and steroid
hormonal control of Muc-l in the mouse uterus. Endocrinology 136:3639-47

McNeer RR, Carraway CA, Fregien NL, Carraway KL 1998 Characterization
of the expression and steroid hormone control of sialomucin complex in the rat
uterus: implications for uterine receptivity. J Cell Physiol 1762110-9

Zhou X, DeSouza MM, Julian J, Gendler SJ, Carson DD 1998 Estrogen
receptor does not directly regulate the murine Muc-l promoter. Mol Cell
Endocrinol 143265-78

Somkuti SG, Yuan L, Fritz MA, Lessey BA 1997 Epidermal Growth Factor and
Sex Steroids Dynamically Regulate a Marker of Endometrial Receptivity in
Ishikawa Cells. J Clin Endocrinol Metab 82:2192-2197

Potter SW, Gaza G, Morris JE 1996 Estradiol induces E-cadherin degradation
in mouse uterine epithelium during the estrous cycle and early pregnancy. J Cell
Physiol 16921-14

Fujimoto J, Ichigo S, Hori M, Tamaya T 1996 Alteration of E-cadherin, alpha-
and beta-catenin mRN A expression in human uterine endometrium during the
menstrual cycle. Gynecol Endocrinol 102187-91

Wesseling J, van der Valk SW, Hilkens J 1996 A mechanism for inhibition of
E-cadherin-mediated cell-cell adhesion by the membrane-associated mucin
episialin/MUCI. Mol Biol Cell 72565-77

Sivridis E, Giatromanolaki A, Koukourakis MI, Georgiou L, Anastasiadis P
2002 Patterns of episialin/MUCl expression in endometrial carcinomas and
prognostic relevance. Histopathology 40292-100

Svalander PC, Odin P, Nilsson BO, Obrink B 1990 Expression of cellCAM-

105 in the apical surface of rat uterine epithelium is controlled by ovarian steroid
hormones. J Reprod Fertil 882213-21

218

 

 

374.

375.

376.

377.

378.

379.

380.

381.

382.

383.

384.

Bamberger A-M, Sudahl S, Loning T, et al. 2000 The Adhesion Molecule
CEACAMl (CD66a, C-CAM, BGP) Is Specifically Expressed by the Extravillous
Intermediate Trophoblast. Am J Pathol 15621165-1170

Wagener C, Ergun S 2000 Angiogenic Properties of the Carcinoembryonic
Antigen-Related Cell Adhesion Molecule 1. Experimental Cell Research 261219-
24

Sidhu SS, Kimber SJ 1999 Hormonal Control of H-Type {alpha}( 1-
2)Fucosyltransferase Messenger Ribonucleic Acid in the Mouse Uterus. Biol
Reprod 602147-157

White S, Kimber SJ 1994 Changes in alpha (l-2)-fucosyltransferase activity in
the murine endometrial epithelium during the estrous cycle, early pregnancy, and
after ovariectomy and hormone replacement. Biol Reprod 50:73-81

Brokelmann J, Fawcett DW 1969 The localization of endogenous peroxidase in
the rat uterus and its induction by estradiol. Biol Reprod 1259-71

Gabriel BW, Eckberg WR, Wyche J H, Meones H, Hanker JS, Anderson WA
1986 Peroxidases induced in rat uterus by estrogen administration. 1. Synthesis,

secretion and immunofluorescent demonstration of fluid enzymes. J Submicrosc
Cytol 182673-82

Wang G, Bhattacharyya N, Wilkerson C, Ramsammy RA, Eatman E,
Anderson WA 1994 Estrogen induced peroxidase secretion from the endometrial

epithelium: a possible function for the luminal enzyme. J Submicrosc Cytol
Pathol 262405-14

Anderson WA, Gabriel BW, Nerurkar SG, Wyche J H, Yates PE, Hanker JS
1986 Peroxidases induced in rat uterus by estrogen administration. 11.
Cytochemical and biochemical heterogeneity. J Submicrosc Cytol 182683-90

Balan KV, Hollis VW, Eckberg WR, et al. 2001 Cathepsin B and complement
C3 are major comigrants in the estrogen-induced peroxidase fraction of rat uterine
fluid. J Submicrosc Cytol Pathol 332221-30

Jokimaa V, Oksjoki S, Kujari H, Vuorio E, Anttila L 2001 Expression patterns

of cathepsins B, H, K, L and S in the human endometrium. Mol Hum Reprod
7273-8

Moulton BC, Khan SA 1992 Progestin and estrogen control of cathepsin D
expression and processing in rat uterine luminal epithelium and stroma-
myometrium. Proc Soc Exp Biol Med 201298-105

219

 

 

385.

386.

387.

388.

389.

390.

391.

392.

393.

394.

395.

Miralles F, Gaudelet C, Cavailles V, Rochefort H, Augereau P 1994
Insensitivity of Cathepsin D Gene to Estradiol in Endometrial Cells Is Determined
by the Sequence of Its Estrogen Responsive Element. Biochemical and
Biophysical Research Communications 203271 1-718

Zhang D, Simmen RCM, Michel FJ, Zhao G, Vale-Cruz D, Simmen FA 2002
Secretory Leukocyte Protease Inhibitor Mediates Proliferation of Human
Endometrial Epithelial Cells by Positive and Negative Regulation of Growth-
associated Genes. J. Biol. Chem. 277229999-30009

Ashcroft GS, Lei K, Jin W, et al. 2000 Secretory leukocyte protease inhibitor
mediates non-redundant functions necessary for normal wound healing. Nat Med
621147-53

Farmer SJ, Fliss AE, Simmen RC 1990 Complementary DNA cloning and
regulation of expression of the messenger RNA encoding a pregnancy-associated

porcine uterine protein related to human antileukoproteinase. Mol Endocrinol
421095-104

Osteen K, Rodgers W, Gaire M, Hargrove J, Gorstein F, Matrisian L 1994
Stromal-Epithelial Interaction Mediates Steroidal Regulation of Metalloproteinase
Expression in Human Endometrium. PNAS 91:10129-10133

Mendelsohn ME 2002 Genomic and nongenomic effects of estrogen in the
vasculature. Am J Cardiol 90:3F-6F

Thiede MA, Harm SC, Hasson DM, Gardner RM 1991 In vivo regulation of
parathyroid hormone-related peptide messenger ribonucleic acid in the rat uterus
by 17 beta-estradiol. Endocrinology 128:2317-23

Paspaliaris V, Petersen DN, Thiede MA 1995 Steroid regulation of parathyroid

hormone-related protein expression and action in the rat uterus. J Steroid Biochem
Mol Biol 532259-65

Shenberger JS, Dixon PS, Choate J, Helal K, Shew RL, Barth W 2001
Pregnancy and labor increase the capacity of human myometrial cells to secrete
parathyroid hormone-related protein. Life Sciences 68:1557-1566

Morimoto T, Devora GA, Mibe M, Casey ML, MacDonald PC 1997
Parathyroid hormone-related protein and human myometrial cells: action and

regulation. Mol Cell Endocrinol 129:91-9

Hinson JP, Kapas S, Smith DM 2000 Adrenomedullin, a Multifunctional
Regulatory Peptide. Endocr Rev 212138-167

220

 

 

396.

397.

398.

399.

400.

401.

402.

403.

404.

405.

406.

407.

Gargett CE, Rogers PA 2001 Human endometrial angiogenesis. Reproduction
1212181-6

Folkman J 1995 Angiogenesis in cancer, vascular, rheumatoid and other disease.
Nat Med 1:27-31

Taylor RN, Lebovic DI, Hornung D, Mueller MD 2001 Endocrine and
Paracrine Regulation of Endometrial Angiogenesis. Ann NY Acad Sci 9432109-
121

Rogers PA, Gargett CE 1998 Endometrial angiogenesis. Angiogenesis 22287-
294

Gannon BJ, Carati CJ, Verco CJ 1997 Endometrial perfusion across the normal

human menstrual cycle assessed by laser Doppler fluxmetry. Hum Reprod
12:132-9

Perrot-Applanat M, Deng M, Fernandez H, Lelaidier C, Meduri G,
Bouchard P 1994 Irnmunohistochemical localization of estradiol and
progesterone receptors in human uterus throughout pregnancy: expression in
endometrial blood vessels. J Clin Endocrinol Metab 782216-24

Yokomizo R, Matsuzaki S, Uehara S, Murakami T, Yaegashi N, Okamura K
2002 Erythropoietin and erythropoietin receptor expression in human
endometrium throughout the menstrual cycle. Mol Hum Reprod 82441-6

Sasaki R, Masuda S, Nagao M 2001 Pleiotropic Functions and Tissue-Specific
Expression of Erythropoietin. News Physiol Sci 162110-113

Mukundan H, Resta TC, Kanagy NL 2002 17beta -Estradiol decreases hypoxic
induction of erythropoietin gene expression. Am J Physiol Regul Integr Comp
Physiol 2832R496-504

Yasuda Y, Masuda S, Chikuma M, Inoue K, Nagao M, Sasaki R 1998
Estrogen-dependent Production of Erythropoietin in Uterus and Its Implication in
Uterine Angiogenesis. J. Biol. Chem. 273:25381-25387

Arena CS, Quirk SM, Zhang YQ, Henrikson KP 1996 Rat uterine stromal
cells: thrombin receptor and growth stimulation by thrombin. Endocrinology

137:3744-9

Henrikson KP, Hall ES, Lin Y 1994 Cellular localization of tissue factor and
prothrombin in the estrogen-treated immature rat uterus. Biol Reprod 5021 145-50

221

 

 

408.

409.

410.

411.

412.

413.

414.

415.

416.

417.

418.

419.

Henrikson KP, Greenwood JA, Pentecost BT, Jazin EE, Dickerman HW
1992 Estrogen control of uterine tissue factor messenger ribonucleic acid levels.
Endocrinology 130:2669-74

Finlay TH, Katz J, Kirsch L, Levitz M, Nathoo SA, Seiler S 1983 Estrogen-
stimulated uptake of plasminogen by the mouse uterus. Endocrinology 1122856-
61

Liehr JG, Ulubelen AA, Strobe! HW 1986 Cytochrome P-450-mediated redox
cycling of estrogens. J Biol Chem 261:16865-70

Gomez-Zubeldia MA, Hinchado G, Arbues JJ, Nogales AG, Millan J C 2001
Influence of Estradiol on Oxidative Stress in the Castrated Rat Uterus.
Gynecologic Oncology 802227-232

Baird DT, Cameron ST, Critchley HO, et al. 1996 Prostaglandins and
menstruation. Eur J Obstet Gynecol Reprod Biol 70215-7

Gomez-Zubeldia MA, Corrales S, Arbues J, Nogales AG, Millan J C 2002
Influence of estradiol and gestagens on oxidative stress in the rat uterus. Gynecol
Oncol 86:250—8

Jain S, Saxena D, Kumar GP, Laloraya M 2000 NADPH dependent superoxide
generation in the ovary and uterus of mice during estrous cycle and early
pregnancy. Life Sci 6621139-46

Sugino N, Karube-Harada A, Sakata A, Takiguchi S, Kato H 2002 Different
mechanisms for the induction of copper-zinc superoxide dismutase and

manganese superoxide dismutase by progesterone in human endometrial stromal
cells. Hum Reprod 17: 1709- 14

Jain S, Saxena D, Kumar PG, Koide SS, Laloraya M 1999 Effect of estradiol
and selected antiestrogens on pro- and antioxidant pathways in mammalian
uterus. Contraception 6021 11-8

Nomura T, Sasaki J, Mori H, et al. 1996 Expression of manganese superoxide
dismutase mRN A in reproductive organs during the ovulatory process and the
estrous cycle of the rat. Histochem Cell Biol 10521-6

Sugino N, Kashida S, Takiguchi S, Nakamura Y, Kato H 2000 Induction of
superoxide dismutase by decidualization in human endometrial stromal cells. Mol
Hum Reprod 62178-84

Sugino N, Karube-Harada A, Kashida S, Takiguchi S, Kato H 2001 Reactive

oxygen species stimulate prostaglandin F2{alpha} production in human
endometrial stromal cells in vitro. Hum. Reprod. 16: 1797-1801

222

 

 

 

420.

421.

422.

423.

424.

425.

426.

427.

428.

429.

430.

Kim HT, Kim YH, Nam JW, Lee HJ, Rho HM, Jung GH 1994 Study of 5'-
flanking region of human Cu/Zn superoxide dismutase. Biochemical and
Biophysical Research Communications 2012 1526- 1 533

Wan XS, Devalaraja MN, St Clair DK 1994 Molecular structure and
organization of the human manganese superoxide dismutase gene. DNA Cell Biol
13:1127-36

Rockwell LC, Pillai S, Olson CE, Koos RD 2002 Inhibition of Vascular
Endothelial Growth FactorNascular Permeability Factor Action Blocks Estrogen-
Induced Uterine Edema and Implantation in Rodents. Biol Reprod 67:1804-1810

Casslen B, Nilsson B 1984 Human uterine fluid, examined in undiluted samples
for osmolarity and the concentrations of inorganic ions, albumin, glucose, and
urea. Am J Obstet Gynecol 1502877-81

Van Winkle LJ, Campione AL, Webster DP 1983 Sodium ion concentrations

in uterine flushings from "implanting" and "delayed implanting" mice. J Exp Zool
226:321-4

Katagiri S, Ma S, Yuen BH, Moon YS 1997 Role for insulin-like growth factor
I in the regulation of electrolyte composition of uterine luminal fluid. J Reprod
Fertil 1092115-20

Chan LN, Tsang LL, Rowlands DK, et al. 2002 Distribution and regulation of
EN aC subunit and CFI‘R mRNA expression in murine female reproductive tract.
J Membr Biol 1852165-76

Rochwerger L, Buchwald M 1993 Stimulation of the cystic fibrosis

transmembrane regulator expression by estrogen in vivo. Endocrinology 1332921-
30

Anwer K, Oberti C, Perez GJ, et a1. 1993 Calcium-activated K+ channels as
modulators of human myometrial contractile activity. Am J Physiol 2652C976-85

Holdiman AJ, Fergus DJ, England SK 2002 17[beta]-Estradiol upregulates
distinct maxi-K channel transcripts in mouse uterus. Molecular and Cellular
Endocrinology 19221-6

Behrens R, Nolting A, Reimann F, Sehwarz M, Waldschutz R, Pongs O 2000
hKCNMB3 and hKCNMB4, cloning and characterization of two members of the

large-conductance calcium-activated potassium channel [beta] subunit family.
FEBS Letters 474299-106

223

 

431.

432.

433.

434.

435.

436.

437.

438.

439.

440.

441.

442.

Benkusky NA, Korovkina VP, Brainard AM, England SK 2002 Myometrial
maxi-K channel [beta]1 subunit modulation during pregnancy and after 17[beta]-
estradiol stimulation. FEBS Letters 524297-102

Song M, Helguera G, Eghbali M, et al. 2001 Remodeling of Kv4.3 potassium
channel gene expression under the control of sex hormones. The Journal of
Biological Chemistry 276:31883-31890

Wang XF, Yu MK, Lam SY, et al. 2003 Expression, Irnmunolocalization, and
Functional Activity of Na+/11+ Exchanger Isoforms in Mouse Endometrial
Epithelium. Biol Reprod 682302-308

Li X, Yu H, Koide SS 1994 The water channel gene in human uterus. Biochem
Mol Biol Int 32:371-7

Li XJ, Yu HM, Koide SS 1997 Regulation of water channel gene (AQP-CHIP)
expression by estradiol and anordiol in rat uterus. Yao Xue Xue Bao 322586-92

Zhou Q, Clarke L, Nie R, et al. 2001 Estrogen action and male fertility: Roles of
the sodium/hydrogen exchanger-3 and fluid reabsorption in reproductive tract
function. PNAS 98: 14132-14137

Stemmer-Rachamimov A0, Wiederhold T, Nielsen GP, et al. 2001 NHE-RF, a
Merlin-Interacting Protein, Is Primarily Expressed in Luminal Epithelia,

Proliferative Endometrium, and Estrogen Receptor-Positive Breast Carcinomas.
Am J Pathol 158257-62

Ediger TR, Park S-E, Katzenellenbogen BS 2002 Estrogen receptor inducibility
of the human Na+/11+ Exchanger Regulatory Factor/Ezrin—Radixin-Moesin
Binding Protein 50 (NHE-RF/EBPSO) gene involving multiple half-estrogen
response elements. Mol Endocrinol 16: 1828-1839

McMaster MT, Newton RC, Dey SK, Andrews GK 1992 Activation and
distribution of inflammatory cells in the mouse uterus during the preimplantation
period. J Immunol 148:1699-705

Sato T, Fukazawa Y, Kojima H, Enari M, Iguchi T, Ohta Y 1997 Apoptotic
cell death during the estrous cycle in the rat uterus and vagina. Anat Rec 248276-
83

Hunt JS, Petroff MG, Burnett TG 2000 Uterine leukocytes: key players in
pregnancy. Seminars in Cell and Developmental Biology 112127-137

Mori A, Zhai YL, Toki T, Nikaido T, Fujii S 1997 Distribution and
heterogeneity of mast cells in the human uterus. Hum Reprod 122368-72

224

443.

445.

446.

447.

448.

449.

450.

451.

452.

453.

454.

Casslen B, Kobayashi TK, Stormby N 1982 Cyclic variation of the cellular
components in human uterine fluid. J Reprod Fertil 66:213-8

Wood GW, Hausmann E, Choudhuri R 1997 Relative role of CSF-l, MCP-
1/JE, and RANT BS in macrophage recruitment during successful pregnancy. M01
Reprod Dev 46262-9; discussion 69-70

Perez MC, Furth EE, Matzumura PD, Lyttle CR 1996 Role of eosinophils in
uterine responses to estrogen. Biol Reprod 542249-54

Gouon-Evans V, Pollard JW 2001 Eotaxin is required for eosinophil homing
into the stroma of the pubertal and cycling uterus. Endocrinology 142:4515-21

Lee YH, Howe RS, Sha SJ, Teuscher C, Sheehan DM, Lyttle CR 1989

Estrogen regulation of an eosinophil chemotactic factor in the immature rat
uterus. Endocrinology 125:3022-8

Wira CR, Sandoe CP 1977 Sex steroid hormone regulation of IgA and IgG in rat
uterine secretions. Nature 2682534-6

Wira CR, Sullivan DA, Sandoe CP 1983 Epithelial cell involvement in the
estradiol-stimulated accumulation of IgA in the rat uterus. J Steroid Biochem
192469-74

Johansen F-E, Pekna M, Norderhaug IN, et al. 1999 Absence of Epithelial
Immunoglobulin A Transport, with Increased Mucosal Leakiness, in Polymeric

Immunoglobulin Receptor/Secretory Component—deficient Mice. J. Exp. Med.
19029 1 5-922

Kaushic C, Richardson JM, Wira CR 1995 Regulation of polymeric
immunoglobulin A receptor messenger ribonucleic acid expression in rodent
uteri: effect of sex hormones. Endocrinology 136:2836-44

Hempen PM, Phillips KM, Conway PS, et al. 2002 Transcriptional Regulation
of the Human Polymeric Ig Receptor Gene: Analysis of Basal Promoter Elements.
J Immunol 169:1912-1921

Espert L, Degols G, Gongora C, et al. 2003 ISG20, a new interferon-induced
RNase specific for single-stranded RNA, defines an alternative antiviral pathway

against RNA genomic viruses. J. Biol. Chem.:M209628200

Pentecost BT 1998 Expression and estrogen regulation of the HEM45 MRN A in
human tumor lines and in the rat uterus. J Steroid Biochem Mol Biol 64:25-33

225

 

455.

456.

457.

458.

459.

460.

461.

462.

463.

464.

465.

466.

De M, Sanford TR, Wood GW 1992 Interleukin-1, interleukin-6, and tumor
necrosis factor alpha are produced in the mouse uterus during the estrous cycle
and are induced by estrogen and progesterone. Dev Biol 1512297-305

Kayisli UA, Mahutte NG, Arici A 2002 Uterine chemokines in reproductive
physiology and pathology. Am J Reprod Immunol 472213-21

DeLoia JA, Stewart-Akers AM, Brekosky J, Kubik CJ 2002 Effects of
exogenous estrogen on uterine leukocyte recruitment. Fertility and Sterility
772548-554

Wood GW, De M, Sanford T, Choudhuri R 1992 Macrophage colony
stimulating factor controls macrophage recruitment to the cycling mouse uterus.
Dev Biol 152:336-43

Boucher A, Mourad W, Mailloux J, Lemay A, Akoum A 2000 Ovarian T
hormones modulate monocyte chemotactic protein-1 expression in endometrial
cells of women with endometriosis. Mol Hum Reprod 62618-26

Cohen PE, Zhu L, Pollard JW 1997 Absence of colony stimulating factor-1 in
osteopetrotic (csfmop/csfmop) mice disrupts estrous cycles and ovulation. Biol
Reprod 56:110-8

Nielsen CH, Leslie RGQ 2002 Complement's participation in acquired
immunity. J Leukoc Biol 722249-261

Li S-H, Huang H-L, Chen Y-H 2002 Ovarian steroid-regulated synthesis and
secretion of complement C3 and factor B in mouse endometrium during the
natural estrous cycle and pregnancy period. Biol Reprod 662322-332

Sundstrom SA, Komm BS, Ponce-de-Leon H, Yi Z, Teuscher C, Lyttle CR
1989 Estrogen regulation of tissue-specific expression of complement C3. J Biol
Chem 264216941-7

Ward PP, Uribe-Luna S, Conneely OM 2002 Lactoferrin and host defense.
Biochem Cell Biol 80295-102

Teng CT, Walker MP, Bhattacharyya SN, Klapper DG, diAugustine RP,
McLachlan JA 1986 Purification and properties of an oestrogen-stimulated
mouse uterine glycoprotein (approx. 70 kDa). Biochemical Journal 2402413-322

Pentecost BT, Teng CT 1987 Lactotransferrin is the major estrogen inducible
protein of mouse uterine secretions. Journal of Biological Chemistry 262210134-
10139

 

226

467.

468.

469.

470.

471.

472.

473.

474.

475.

476.

477.

Teng CT, Beard C, Gladwell W 2002 Differential Expression and Estrogen
Response of Lactoferrin Gene in the Female Reproductive Tract of Mouse, Rat,
and Hamster. Biol Reprod 67:1439-1449

Teng CT 2002 Lactoferrin gene expression and regulation: an overview.
Biochem Cell Biol 8027-16

Bevans CG, Kordel M, Rhee SK, Harris AL 1998 Isoforrn composition of
connexin channels determines selectivity among second messengers and
uncharged molecules. J Biol Chem 273:2808-16

Garfield RE, Blennerhassett MG, Miller SM 1988 Control of myometrial
contractility: role and regulation of gap junctions. Oxf Rev Reprod Biol 102436-
90

Yamasaki H, Omori Y, Zaidan-Dagli ML, Mironov N, Mesnil M,
Krutovskikh V 1999 Genetic and epigenetic changes of intercellular

communication genes during multistage carcinogenesis. Cancer Detect Prev
23:273-9

White TW, Paul DL 1999 GENETIC DISEASES AND GENE KNOCKOUTS
REVEAL DIVERSE CONNEXIN FUNCTIONS. Annu. Rev. Physiol. 61:283-
310

Granot I, Dekel N, Bechor E, Segal I, Fieldust S, Barash A 2000 Temporal
analysis of connexin43 protein and gene expression throughout the menstrual
cycle in human endometrium. Fertility and Sterility 732381-386

Grummer R, Traub O, Winterhager E 1999 Gap Junction Connexin Genes
cx26 and cx43 Are Differentially Regulated by Ovarian Steroid Hormones in Rat
Endometrium. Endocrinology 140:2509-2516

Petrocelli T, Lye S 1993 Regulation of transcripts encoding the myometrial gap
junction protein, connexin-43, by estrogen and progesterone. Endocrinology
133:284-290

Piersanti M, Lye S 1995 Increase in messenger ribonucleic acid encoding the
myometrial gap junction protein, connexin-43, requires protein synthesis and is
associated with increased expression of the activator protein-1, c-fos.
Endocrinology 13623571-3578

Geimonen E, Boylston E, Royek A, Andersen J 1998 Elevated Connexin-43
Expression in Term Human Myometrium Correlates with Elevated c-Jun

Expression and Is Independent of Myometrial Estrogen Receptors. J Clin
Endocrinol Metab 8321 177-1 185

227

 

478.

479.

480.

481.

482.

483.

484.

485.

486.

487.

488.

Tu ZJ, Kollander R, Kiang DT 1998 Differential Up-Regulation of Gap
Junction Connexin 26 Gene in Mammary and Uterine Tissues: The Role of Sp
Transcription Factors. Mol Endocrinol 12: 1931-1938

Murphy CR, Swift JG, Mukherjee TM, Rogers AW 1979 Effects of ovarian
hormones on cell membranes in the rat uterus. 1. Freeze fracture studies of the
apical membrane of the liminal epithelium. Cell Biophys 12181-93

Murphy CR, Swift JG, Mukherjee TM, Rogers AW 1981 Effects of ovarian
hormones on cell membranes in the rat uterus. II. Freeze-fracture studies on tight

junctions of the lateral plasma membrane of the luminal epithelium. Cell Biophys
3:57-69

Orchard MD, Murphy CR 2002 Alterations in tight junction molecules of

uterine epithelial cells during early pregnancy in the rat. Acta Histochem 1042149-
55

Vinatier D, Dufour P, Subtil D 1996 Apoptosis: A programmed cell death
involved in ovarian and uterine physiology. European Journal of Obstetrics &
Gynecology and Reproductive Biology 67285-102

Vaskivuo TE, Stenback F, Karhumaa P, Risteli J, Dunkel L, Tapanainen J S
2000 Apoptosis and apoptosis-related proteins in human endometrium. Mol Cell
Endocrinol 165275-83

Coates PJ, Hales SA, Hall PA 1996 The association between cell proliferation
and apoptosis: studies using the cell cycle-associated proteins K167 and DNA
polymerase alpha. J Pathol 178271-7

Stjernquist M, Ekblad E, mean C, Sundler F 1986 Neuronal localization and
motor effects of gastrin-releasing peptide (GRP) in rat uterus. Regul Pept 132197-
205

Whitley J C, Giraud AS, Mahoney A0, Clarke IJ, Shulkes A 2000 Tissue-
specific regulation of gastrin-releasing peptide synthesis, storage and secretion by
oestrogen and progesterone. J Endocrinol 1662649—58

Niiro N, Nishimura J, Hirano K, Nakano H, Kanaide H 1998 Mechanisms of

galanin-induced contraction in the rat myometrium. Br. J. Pharmacol. 12421623-
1632

Vrontakis M, Schroedter I, Leite V, Friesen HG 1993 Estrogen regulation and
localization of galanin gene expression in the rat uterus. Biol Reprod 49:1245-50

228

 

 

489.

490.

491.

492.

493.

494.

495.

496.

497.

498.

499.

500.

501.

Shew RL, Papka RE, McNeil] DL 1992 Galanin and calcitonin gene-related
peptide immunoreactivity in nerves of the rat uterus: localization, colocalization,
and effects on uterine contractility. Peptides 13:273-9

Dong Y-L, Yallampalli C 2000 Pregnancy and exogenous steroid treatments
modulate the expression of relaxant EP2 and contractile FP receptors in the rat
uterus. Biol Reprod 622533-539

Miller C, Sassoon D 1998 Wnt-7a maintains appropriate uterine patterning

during the development of the mouse female reproductive tract. Development
12523201-3211

Sassoon D 1999 Wnt genes and endocrine disruption of the female reproductive
tract: a genetic approach. Mol Cell Endocrinol 15821-5

L'Horset F, Blin C, Colnot S, Lambert M, Thomasset M, Perret C 1994
Calbindin-D9k gene expression in the uterus: study of the two messenger
ribonucleic acid species and analysis of an imperfect estrogen-responsive element.
Endocrinology 134211-8

Gill RK, Christakos S 1995 Regulation by estrogen through the 5'-flankin g
region of the mouse calbindin-D28k gene. Mol Endocrinol 92319-26

Opperman LA, Saunders TJ, Bruns DE, Boyd J C, Mills SE, Bruns ME 1992
Estrogen inhibits calbindin-D28k expression in mouse uterus. Endocrinology
130: 1728-35

Yang J, Goetz D, Li J Y, et al. 2002 An iron delivery pathway mediated by a
lipocalin. Mol Cell 10:1045-56

Huang HL, Chu ST, Chen YH 1999 Ovarian steroids regulate 24p3 expression
in mouse uterus during the natural estrous cycle and the preimplantation period. J
Endocrinol 162211-9

Chu ST, Huang HL, Chen JM, Chen YH 1996 Demonstration of a glycoprotein
derived from the 24p3 gene in mouse uterine luminal fluid. Biochem J 316 ( Pt

2):545-50

Mueller MD, Vigne JL, Vaisse C, Taylor RN 2000 Glycodelin: a pane in the
implantation window. Semin Reprod Med 182289-98

Giguere V, Tremblay A, Tremblay GB 1998 Estrogen receptor beta: re-
evaluation of estrogen and antiestrogen signaling. Steroids 632335-9

Korach KS 1994 Insights from the study of animals lacking functional estrogen
receptor. Science 26621524-27

229

 

 

502.

503.

504.

505.

506.

507.

508.

509.

510.

511.

512.

513.

Pike AC, Brzozowski AM, Hubbard RE, et al. 1999 Structure of the li gand-
binding domain of oestrogen receptor beta in the presence of a partial agonist and
a full antagonist. Embo J. 18:4608-4618

Grover PL, MacNicoll AD, Sims P, Easty GC, Neville AM 1980 Polycyclic
hydrocarbon activation and metabolism in epithelial cell aggregates prepared
from human mammary tissue. Int J Cancer 262467-75

Huggins CB, Pataki J, Harvey RG 1967 Geometry of carcinogenic polycyclic
aromatic hydrocarbons. Proc Natl Acad Sci U S A 58:2253-60

Yang NC, Castro AJ, Lewis M, Wong T-W 1961 Polynuclear aromatic
hydrocarbons, steroids and carcinogenesis. Science 1342386

Mattison D, Thorgeirsson SS 1979 Ovarian aryl hydrocarbon hydroxylase
activity and primordial oocyte toxicity of polycyclic aromatic hydrocarbons in
mice. Cancer research 3923471-3475

Swartz WJ, Mattison DR 1985 Benzo(a)pyrene inhibits ovulation in C57BL/6N
mice. Anat Rec 212:268-76

Cook JW, Dodds EC 1933 Sex hormones and cancer-producing compounds.
Nature 131:205-6

Hattemer-Frey HA, Travis CC 1991 Benzo[a]pyrene: environmental
partitioning and human exposure. Toxicol and Ind Health 72141-157

Jacob J, Grimmer G 1996 Metabolism and excretion of polycyclic aromatic
hydrocarbons in rat and in human. Central European Journal of Public Health
4233-9

Hall M, Forrester LM, Parker DK, Grover PL, Wolf CR 1989 Relative
contribution of various forms of cytochrome P450 to the metabolism of
benzo[a]pyrene by human liver microsomes. Carcinogenesis 1021815-21

Kim J H, Stansbury KH, Walker NJ, Trush MA, Strickland PT, Sutter TR
1998 Metabolism of benzo[a]pyrene and benzo[a]pyrene-7,8-diol by human
cytochrome P450 1B1 [published erratum appears in Carcinogenesis 1999
Mar;20(3)2515]. Carcinogenesis 19: 1847-53

Larsen MC, Angus WG, Brake PB, Eltom SE, Sukow KA, Jefcoate CR 1998
Characterization of CYPlBl and CYP1A1 expression in human mammary
epithelial cells: role of the aryl hydrocarbon receptor in polycyclic aromatic
hydrocarbon metabolism. Cancer Res 5822366—74

230

 

 

514.

515.

516.

517.

518.

519.

520.

521.

522.

523.

524.

525.

Parke DV, Ioannides C 1990 The role of metabolism studies in the safety
evaluation of new chemicals. Acta Pharrn. Jugosl. 402363-82

Shou M, Korzekwa KR, Crespi CL, Gonzalez FJ, Gelboin HV 1994
Metabolism of benzo[a]pyrene by seven cDNA expressed human cytochromes
P450. Polycyclic Aromatic Compounds 721-9

Estabrook RW, Saeki Y, Chacos N, Capdevila J, Prough RA 1980 Polycyclic
hydrocarbon metabolism: a plethora of phenomena. Adv Enzyme Regul 1923-17

Gelboin HV 1980 Benzo[alpha]pyrene metabolism, activation and
carcinogenesis: role and regulation of mixed-function oxidases and related
enzymes. Physiol Rev 60:1107-66

Pelkonen O, Nebert DW 1982 Metabolism of polycyclic aromatic hydrocarbons:
etiologic role in carcinogenesis. Pharmacol Rev 342189-222

Clemons JH, Allan LM, Marvin CH, et al. 1998 Evidence of estrogen- and
TCDD-like activities in crude and fractionated extracts of PM10 air particulate

material using in vitro gene expression assays. Environ. Sci. and Techno].
3221853-1860

Arcaro KF, O'Keefe PW, Yang Y, Clayton W, Gierthy JF 1999
Antiestrogenicity of environmental polycyclic aromatic hydrocarbons in human
breast cancer cells. Toxicology 13321 15-27

Tran DQ, Ide CF, McLachlan JA, Arnold SF 1996 The anti-estrogenic activity
of selected polynuclear aromatic hydrocarbons in yeast expressing human
estrogen receptor. Biochem. Biophys. Res. Commun. 229:102-108

Matthews J, Zacharewski T 1999 Differential binding affinities of PCBs, HO-
PCBs and aroclors with recombinant human, rainbow trout (Onchorhynkiss
mykiss) and green anole (Anolis carolinensis) estrogen receptors, using a semi-
high throughput competitive binding assay. Toxicol. Sci. 532326-39

Gillesby BE, Zacharewski TR 1999 pS2 (TFF2) mRNA levels in human breast
tumor samples: correlation with clinical and histological prognostic markers.
Breast Cancer Res Treat 562253-265

Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A Laboratory
Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Plainview, New York

Brasier AR, Tate JE, Habener JF 1989 Optimized use of the firefly luciferase
assay as a reporter gene in mammalian cell lines. Biotechniques 721116-1122

231

 

 

526.

527.

528.

529.

530.

531.

532.

533.

534.

535.

536.

Grimmer G, Brune H, Dettbam G, et a1. 1988 Urinary and faecal excretion of
chrysene and chrysene metabolites by rats after oral, intraperitoneal, intratracheal
or intrapulmonary application. Archives of Toxicology 622401-405

Jacob J, Doehmer J, Grimmer G, et al. 1996 Metabolism of phenanthrene,
benz[a]anthracene, benzo[a]pyrene, chrysene and benzo[c]phenanthrene by eight
cDNA-expressed human and rat cytochromes P450. Polycyclic Aromatic
Compounds 1021-9

Legraverend C, Guenthner TM, Nebert DW 1984 Importance of the route of
administration for genetic differences in benzo[a]pyrene-induced in utero toxicity
and teratogenicity. Teratology 29235-47

Selkirk J K, MacLeod MC, Mansfield BK, Nikbakht PA, Dearstone KC 1983
Species heterogeneity in the metabolic processing of benzo[a]pyrene. Basic Life
Sci 242283-94

van Schooten FJ, Moonen EJ C, van der Wal L, Levels P, Kleinjans JCS 1997
Determination of polycyclic aromatic hydrocarbons (PAH) and their metabolites
in blood, feces, and urine of rats orally exposed to PAH contaminated soils.
Archives of Environmental Contamination and Toxicology 332317-22

Ebright RH, Wong JR, Chen LB 1986 Binding of 2-hydroxybenzo[a]pyrene to
estrogen receptors in rat cytosol. Cancer Res. 46:2349-51

Dipple A, Bigger CAH 1983 Metabolic properties of in vitro systems. Ann N Y
Acad Sci 407226-33

Li W, Harper PA, Tang BK, Okey AB 1998 Regulation of cytochrome P450
enzymes by aryl hydrocarbon receptor in human cells: CYP1A2 expression in the
LS 180 colon carcinoma cell line after treatment with 2,3,7,8-tetrachlorodibenzo-
p-dioxin or 3- methylcholanthrene. Biochem Pharmacol 562599-612

Spink DC, Spink BC, Cao JQ, et al. 1998 Differential expression of CYP1A1
and CYPlBl in human breast epithelial cells and breast tumor cells.
Carcinogenesis 19:291-8

Harris M, Piskorska-Pliszczynska J, Zacharewski T, Romkes M, Safe S 1989
Structure-dependent induction of aryl hydrocarbon hydroxylase in human breast
cancer cell lines and characterization of the Ah receptor. Cancer Res. 4924531-5

Charles GD, Bartels MJ, Zacharewski TR, Gollapudi BB, Freshour NL,
Carney EW 2000 Activity of benzo[a]pyrene and its hydroxylated metabolites in
an ERa reporter gene assay. Toxicol. Sci. 552320—6

232

 

 

537.

538.

539.

540.

541.

542.

543.

544.

545.

546.

547.

Schneider SL, Alks V, Morreal CE, Sinha DK, Dao TL 1976 Estrogenic
properties of 3,9-dihydroxybenz[a]anthracene, a potential metabolite of
benz[a]anthracene. Journal of the National Cancer Institute 57:1351-4

Chernayaev GA, Barkova TI, Egorova W, et al. 1975 A series of Optical
structural and isomeric analogs of estradiol: a comparative study of the biological
activity and affinity to cytosol receptor of rabbit uterus. J Steroid Biochem

62 1483-8

Korach KS, McLachlan JA 1995 Techniques for detection of estrogenicity.
Environmental Health Perspectives 10325-8

Teng CT, Pentecost BT, Chen YH, Newbold RR, Eddy EM, McLachlan JA
1989 Lactotransferrin gene expression in the mouse uterus and mammary gland.
Endocrinology 1242992-9

 

Camus A-M, Aitio A, Sabadie N, Wahrendorf J, Bartsch H 1984 Metabolism
and urinary excretion of mutagenic metabolites of benzo[a]pyrene in C57 and
DBA mice strains. Carcinogenesis 5235-9

Bigelow SW, Nebert DW 1982 The Ah regulatory gene product. Survey of
nineteen polycyclic aromatic compounds' and fifteen benzo[a]pyrene metabolites'
capacity to bind to the cytosolic receptor. Toxicol. Lett. 102109-18

Piskorska-Pliszczynska J, Keys B, Safe S, Newman MS 1986 The cytosolic
receptor binding affinities and AHH induction potencies of 29 polynuclear
aromatic hydrocarbons. Toxicol. Lett. 34:67-74

Harper PA, Golas CL, Okey AB 1991 Ah receptor in mice genetically
"nonresponsive" for cytochrome P4501A1 induction: cytosolic Ah receptor,
transformation to the nuclear binding state, and induction of aryl hydrocarbon
hydroxylase by halogenated and nonhalogenated aromatic hydrocarbons in
embryonic tissues and cells. Mol Pharmacol 402818-26

Niwa A, Kumaki K, Nebert DW, Poland AP 1975 Genetic expression of aryl
hydrocarbon hydroxylase activity in the mouse. Distinction between the

"responsive" homozygote and heterozygote at the Ah locus. Arch Biochem
Biophys 166:559-64

Moir D, Viau A, Chu I, Withey J, McMullen E 1998 Pharmacokinetics of
benzo[a]pyrene in the rat. J Toxicol Environ Health 532507-30

Brown S, Chee CTY 1992 Benzopyrene metabolism and transport by cells in
culture. Biochem Soc Trans 202279S

233

 

548.

549.

550.

551.

552.

553.

554.

555.

556.

557.

558.

559.

Moore CJ, Gould MN 1984 Differences in mediated mutagenesis and polycyclic
aromatic hydrocarbon metabolism in mammary cells from pregnant and virgin
rats. Carcinogenesis 52103-108

Wang IY, Rasmussen RE, Petrakis NL, Wang A-C 1976 Enzyme induction
and the difference in the metabolite patterns of benzo[a]pyrene produced by
various strains of mice. Raven Press, New York

Chaloupka K, Krishnan V, Safe S 1992 Polynuclear aromatic hydrocarbon
carcinogens as antiestrogens in MCF—7 human breast cancer cells: role of the Ah
receptor. Carcinogenesis 13:2233-9

Duan R, Porter W, Samudio I, Vyhlidal C, Kladde M, Safe S 1999

Transcriptional activation of c-fos protooncogene by 17B-estradiol: mechanism of
aryl hydrocarbon receptor-mediated inhibition. Molecular Endocrinology
1321511-21

Gillesby BE, Zacharewski TR 1998 Exoestrogens: mechanisms of action and
strategies for identification and assessment. Environ Tox and Chem 1723- 14

Zacharewski T 1998 Identification and assessment of endocrine disruptors:
limitations of in vivo and in vitro assays. Environ Health Perspect 106 Suppl
22577-82

Kuiper GG, Carlsson B, Grandien K, et al. 1997 Comparison of the ligand
binding specificity and transcript tissue distribution of estrogen receptors alpha
and beta. Endocrinology 1382863-70

Barkhem T, Carlsson B, Nilsson Y, Enmark 1E, Gustafsson J -A, Nilsson S
1998 Differential response of estrogen receptor alpha and estrogen receptor beta
to partial estrogen agonists/antagonists. Mol. Pharmacol. 542105-12

MacGregor JI, Jordan VC 1998 Basic guide to the mechanisms of antiestrogen
action. Pharmacol Rev 502 151-96

Christman JK, Nehls S, Polin L, Brooks SC 1995 Relationship between
estrogen structure and conformational changes in estrogen receptor/DNA
complexes. J Steroid Biochem Mol Biol 542201-10

Paige LA, Christensen DJ, Gron H, et al. 1999 Estrogen receptor (ER)
modulators each induce distinct conformational changes in ER alpha and ER beta.
Proc Natl Acad Sci U S A 96:3999-4004

Kuiper GG, Lemmen JG, Carlsson B, et al. 1998 Interaction of estrogenic

chemicals and phytoestrogens with estrogen receptor beta. Endocrinology
13924252-63

234

 

 

560.

561.

562.

563.

564.

565.

566.

567.

568.

569.

570.

571.

Pace P, Taylor J, Suntharalingam S, Coombes RC, Ali S 1997 Human
estrogen receptor beta binds DNA in a manner similar to and dimerizes with
estrogen receptor alpha. J Biol Chem 272:25832-8

Phillips DH 1983 Fifty years of benzo(a)pyrene. Nature 3032468-72

Warshawsky D 1999 Polycyclic aromatic hydrocarbons in carcinogenesis.
Environ. Health. Perspect. 107:317-9

Diamond ML, Gingrich SE, Fertuck K, et al. 2000 Evidence for organic film
on an impervious urban surface: characterization and potential teratogenic effects.
Environ. Sci. Technol. 3422900-2908

Tremblay GB, Tremblay A, Copeland NG, et al. 1997 Cloning, chromosomal
localization, and functional analysis of the murine estrogen receptor beta. Mol.
Endocrinol. 112353-65

Krege J H, Hodgin JB, Couse JF, et a1. 1998 Generation and reproductive
phenotypes of mice lacking estrogen receptor beta. Proc. Natl. Acad. Sci.
95215677—82

Grimmer G, Jacob J, Dettbarn G, Naujack K-W 1985 Determination of
polycyclic aromatic hydrocarbons, azaarenes, and thiaarenes emitted from coal-

fired residential furnaces by gas chromatography/mass spectrometry. Fresenius
Zeitschrift Fur Analytische Chemie 3222595-602

Pelroy RA, Stewart DL, Tominaga Y, Iwao M, Castle RN, Lee ML 1983
Microbial mutagenicity of 3-ring and 4-ring polycyclic aromatic sulfur
heterocycles. Mutat. Res. 1 17:31-40

Croisy A, Mispelter J, Lhoste J -M, Zajdela F, Jacquignon P 1984 Thiophene
analogues of carcinogenic polycyclic hydrocarbons: Elbs pyrolysis of various
aroylmethylbenzo[b]thiophenes. J. of Heterocyclic Chem. 212353-359

Rasmussen K, Booth GM, Lee ML 1991 Mutagenicities of hydroxy-substituted
carbazoles and dibenzothiophenes using the CHO/HGPRT assay. Environ. Tox.
Chem. 10:1133-7

Loquet C, Engelhardt U, Schaefer-Ridder M 1985 Differentiated genotoxic
response of carcinogenic and non-carcinogenic benzacridines and metabolites in
rat hepatoma cells. Carcinogenesis 62455-7

Wright DJ, Robinson HK, Holder GM, Ryan AJ, Bonin AM, Baker RS 1985
Metabolism of the carcinogen 7-methylbenz[c]-acridine in the rat. Xenobiotica
152825-34

235

 

572.

573.

574.

575.

576.

577.

578.

579.

580.

581.

582.

West WR, Smith PA, Booth GM, Lee MM 1986 Determination and
genotoxicity of nitrogen heterocycles in a sediment from the Black River.
Environ. Tox. Chem. 5251 1-519

Jacob J, Schmoldt A, Augustin C, Raab G, Grimmer G 1991 Rat liver
microsomal ring- and S-oxidation of thiaarenes with central or peripheral
thiophene rings. Toxicology 682181-194

Kropp KG, Fedorak PM 1998 A review of the occurrence, toxicity, and

biodegradation of condensed thiophenes found in petroleum. Can. J. Microbiol.
442605-22

Jung DKJ, Klaus T, Fent K 2001 Cytochrome P450 induction by nitrated
polycyclic aromatic hydrocarbons, azaarenes, and binary mixtures in fish
hepatoma cell line PLHC-l. Environ. Toxicol. Chem. 202149-59

Kumar S 1995 A new abbreviated synthesis of 5-methylchrysene and its 2-
hydroxy and 8-hydroxy derivatives. Tetrahedron Lett. 37:6271-4

Kumar S 1998 A new efficient route to the phenolic derivatives of chrysene and
5-methylchrysene, precursors to dihydrodiol and diol epoxide metabolites of
chrysene and 5-methylchrysene, through Suzuki cross coupling reaction. J. Chem.
Soc. Perkin Trans. J. 19:3157-60

Kumar S, Kim TY 2000 An improved and regiospecific synthesis of trans-3,4-
dihydrodiol metabolite of benzobnaphtho2,1-dthiophene. J. Org. Chem. 6523883-
4

Fertuck KC, Matthews JB, Zacharewski TR 2001 Hydroxylated
benzo[a]pyrene metabolites are responsible for in vitro estrogen receptor-
mediated gene expression induced by benzo[a]pyrene, but do not elicit
uterotrophic effects in viva. Toxicol. Sci. 592231-240

Ogawa S, Taylor JA, Lubahn DB, Korach KS, Pfaff DW 1996 Reversal of sex
roles in genetic female mice by disruption of estrogen receptor gene.
Neuroendocrinology 642467-70

Windahl SH, Vidal O, Andersson G, Gustafsson JA, Ohlsson C 1999
Increased cortical bone mineral content but unchanged trabecular bone mineral
density in female ERbeta -/- mice. J. Clin. Invest. 1042895-901

Bauer E, Guo Z, Ueng Y-F, Bell LC, Zeldin D, Guengerich FP 1995 Oxidation

of benzo[a]pyrene by recombinant human cytochrome P450 enzymes. Chem. Res.
Toxicol. 82136-42

236

 

 

583.

584.

585.

586.

587.

588.

589.

590.

591.

592.

593.

594.

Jacob J, Schmoldt A, Kohbrok W, Raab G, Grimmer G 1982 On the

metabolic activation of benz[a]acridine and benz[c]acridine by rat liver and lung
microsomes. Cancer Lett. 162297-306

Jacob J, Schmoldt A, Grimmer G 1986 The predominant role of S-oxidation in
rat liver metabolism of thiaarenes. Cancer Lett. 322107-1 16

Murphy SE, Amin S, Coletta K, Hoffman D 1992 Rat liver metabolism of
benzo[b]naphtho[2,1-d]thiophene. Chem. Res. Toxicol. 52491-5

Nordqvist M, Thakker DR, Vyas KP, et al. 1981 Metabolism of chrysene and
phenanthrene to bay-region diol epoxides by rat liver enzymes. Mol. Pharmacol.
192168-78

von Angerer E, Biberger C, Leichtl S 1995 Studies on heterocycle-based pure
estrogen antagonists. Ann. N. Y. Acad. Sci. 122176-91

Golob T, Biberger C, Walter G, von Angerer E 2000 Antiestrogenic activities
of 3,8-dihydroxy-6,11-dihydrobenzo[a]carbazoles with sulfur-containing side
chains. Arch. Pharm. (Weinheim) 333:305-11

Southworth GR, Keffer CC, Beauchamp JJ 1981 The accumulation and
disposition of benz[a]acridine in the fathead minnow, Pimephales promelas.
Arch. Environ. Contam. Tox. 102561-9

Modica R, Fiume M, Guaitani A, Bartosekl 1983 Comparative kinetics of
benz(a)anthracene, chrysene and triphenylene in rats after oral administration. 1.
Study with single compounds. Toxicol. Lett. 182103-9

Williams CL, Stancel GM 1996 Estrogens and Progestins. In: Hardman JG,
Limbird LE, Molinoff PB, Ruddon RW, Gilman AG (eds) The Pharmacological
Basis of Therapeutics, 9 ed. McGraw-Hill, New York, pp 141 1-1440

DeMayo FJ, Zhao B, Takamoto N, Tsai SY 2002 Mechanisms of action of
estrogen and progesterone. Ann N Y Acad Sci 955248-59; discussion 86-8, 396-
406

Couse JF, Korach KS 2001 Contrasting phenotypes in reproductive tissues of
female estrogen receptor null mice. Ann N Y Acad Sci 94821-8

Lindberg MK, Alatalo SL, Halleen JM, Mohan S, Gustafsson J A, Ohlsson C
2001 Estrogen receptor specificity in the regulation of the skeleton in female
mice. J Endocrinol 1712229-36

237

 

 

595.

596.

597.

598.

599.

600.

601.

602.

603.

604.

605.

606.

607.

Geary N, Asarian L, Korach KS, Pfafi' DW, Ogawa S 2001 Deficits in E2-
dependent control of feeding, weight gain, and cholecystokinin satiation in ER-
alpha null mice. Endocrinology 142:4751-7

Erlandsson MC, Ohlsson C, Gustafsson JA, Carlsten H 2001 Role of
oestrogen receptors alpha and beta in immune organ development and in
oestrogen-mediated effects on thymus. Immunology 103217-25

Shughrue PJ, Lubahn DB, Negro-Vilar A, Korach KS, Merchenthaler I 1997
Responses in the brain of estrogen receptor alpha—disrupted mice. Proc Natl Acad
Sci U S A 94:11008-12

Wang L, Andersson S, Warner M, Gustafsson JA 2001 Morphological
abnormalities in the brains of estrogen receptor beta knockout mice. Proc Natl
Acad Sci U S A 98:2792-6

Lee KH, Hess RA, Bahr J M, Lubahn DB, Taylor J, Bunick D 2000 Estrogen
receptor alpha has a functional role in the mouse rete testis and efferent ductules.
Biol Reprod 63: 1873-80

Reid G, Denger S, Kos M, Gannon F 2002 Human estrogen receptor-alpha:
regulation by synthesis, modification and degradation. Cell Mol Life Sci 59:821-
31

Moggs JG, Orphanides G 2001 Estrogen receptors: orchestrators of pleiotropic
cellular responses. EMBO Rep 22775-81

Diel P 2002 Tissue-specific estrogenic response and molecular mechanisms.
Toxicol Lett 1272217-24

McDonnell DP, Norris JD 2002 Connections and regulation of the human
estrogen receptor. Science 29621642-4

Lonard DM, Smith CL 2002 Molecular perspectives on selective estrogen
receptor modulators (SERMs): progress in understanding their tissue-specific
agonist and antagonist actions. Steroids 67215-24

Watson CS, Campbell CH, Gametchu B 2002 The dynamic and elusive
membrane estrogen receptor-alpha. Steroids 672429-37

Levin ER 2002 Cellular functions of plasma membrane estrogen receptors.
Steroids 67:471-5

Matthews J, Celius T, Halgren R, Zacharewski T 2000 Differential estrogen

receptor binding of estrogenic substances: a species comparison. J Steroid
Biochem Mol Biol 742223-34.

238

 

 

608.

609.

610.

611.

612.

613.

614.

615.

616.

617.

618.

619.

Matthews JB, F ertuck KC, Celius T, Huang YW, F ong CJ, Zacharewski TR
2002 Ability of structurally diverse natural products and synthetic chemicals to
induce gene expression mediated by estrogen receptors from various species. J
Steroid Biochem Mol Biol 822181-94

Blair RM, Fang H, Branham WS, et a1. 2000 The estrogen receptor relative
binding affinities of 188 natural and xenochemicals: structural diversity of
ligands. Toxicol Sci 542138-53

Wang H, Masironi B, Eriksson H, Sahlin L 1999 A comparative study of
estrogen receptors alpha and beta in the rat uterus. Biol Reprod 612955-64

Emmen JM, Korach KS 2001 Developing animal models for analyzing SERM
activity. Ann N Y Acad Sci 949236-43

Zacharewski T 1997 In vitro bioassays for assessing estrogenic substances.
Environ Sci Technol 312613-623

Reel JR, Lamb U C, Neal BH 1996 Survey and assessment of mammalian
estrogen biological assays for hazard characterization. Fundam Appl Toxicol
342288-305

Lauson HD, Heller CG, Golden JB, Sevringhaus EL 1939 The immature rat
uterus in the assay of estrogenic substances, and a comparison of estradiol,
estrone and estriol. Endocrinology 24:35-44

Jones RC, Edgren RA 1973 The effects of various steroids on the vaginal
histology in the rat. Fertility and Sterility 242284-91

Newbold RR, Jefferson WN, Padilla-Banks E 2001 The mouse uterotrophic
assay: other end points. Environ Health Perspect 1092A569-70

Zacharewski TR, F ertuck KC, Fielden MR, Matthews JB 2002
Mechanistically-based assays for the identification and characterization of
endocrine disruptors. In: Vanden Heuvel JP, Greenlee WF, Perdew GH, Mattes
W, Sipes IG, McQueen CA, Gandolfi A] (eds) Cellular and Molecular
Toxicology. Elsevier Science, Amsterdam, pp 559-582

Bolt HM 1979 Metabolism of estrogens--natural and synthetic. Pharmacol Ther
42155-81

Rozen S, Skaletsky H 2000 Primer3 on the W for general users and for
biologist programmers. Methods Mol Biol 1322365-86

239

620. Shapiro RA, Xu C, Dorsa DM 2000 Differential transcriptional regulation of rat
vasopressin gene expression by estrogen receptor alpha and beta. Endocrinology
14124056-64

621. Hyder SM, Nawaz Z, Chiappetta C, Stancel GM 2000 Identification of
functional estrogen response elements in the gene coding for the potent
angiogenic factor vascular endothelial growth factor. Cancer Res 60:3183-90

622. Ikeda K, Orimo A, Higashi Y, Muramatsu M, Inoue S 2000 Efp as a primary
estrogen-responsive gene in human breast cancer. FEBS Lett 47229-13

623. Efron B, Tibshirani R, Storey JD, Tusher V 2001 Empirical Bayes analysis of
a microarray experiment. J. Am. Stat. Assoc. 9621 151-1160

 

624. Benjamini Y, Hochberg Y 1995 Controlling the False Discovery Rate: A

Practical and Powerful Approach to Multiple Testing. Journal of The Royal
Statistical Society BS72289-300

625. Affymetrix 2002 GeneChip Expression Analysis: Data Analysis Fundamentals.

626. Geum D, Sun W, Paik SK, Lee CC, Kim K 1997 Estrogen-induced cyclin D1
and D3 gene expressions during mouse uterine cell proliferation in vivo:
differential induction mechanism of cyclin D1 and D3. Mol Reprod Dev 462450-8

627. Green AR, Parrott EL, Butterworth M, Jones PS, Greaves P, White IN 2001
Comparisons of the effects of tamoxifen, toremifene and raloxifene on enzyme

induction and gene expression in the ovariectomised rat uterus. J Endocrinol
170:555-64

628. Anderson JN, Peck EJ, Jr., Clark JH 1975 Estrogen-induced uterine responses
and growth: relationship to receptor estrogen binding by uterine nuclei.
Endocrinology 96:160-7

629. Cheng SV, MacDonald BS, Clark BF, Pollard J W 1985 Cell growth and cell
proliferation may be dissociated in the mouse uterine luminal epithelium treated
with female sex steroids. Exp Cell Res 1602459-70

 

630. Lan NC, Katzenellenbogen BS 1976 Temporal relationships between hormone
receptor binding and biological responses in the uterus: studies with short- and
long-acting derivatives of estriol. Endocrinology 98:220-7

631. Choi D, Yoon S, Lee E, et a1. 2002 Characterization of cyclin D2 expression in

human endometrium. Journal of the Society for Gynecologic Investigation 9241-
46

240

632.

633.

634.

635.

636.

637.

638.

639.

640.

641.

642.

643.

644.

Zhang Z, Laping J, Glasser S, Day P, Mulholland J 1998 Mediators of
estradiol-stimulated mitosis in the rat uterine luminal epithelium. Endocrinology
1392961-6

Yang LS, Marshall A, Koide SS 1994 Differential effect of estrogen on the
production of cyclin B], cdc2 p34 and c-fos protein in rat uterus. Endocr Res
202377-86

Horne MC, Goolsby GL, Donaldson KL, Tran D, Neubauer M, Wahl AF

1996 Cyclin G] and cyclin G2 comprise a new family of cyclins with contrasting

tissue-specific and cell cycle-regulated expression. J Biol Chem 271:6050-61 r
1

Parker NJ, Begley CG, Fox RM 1994 Human R1 subunit of ribonucleotide
reductase (RRMl): 5' flanking region of the gene. Genomics 19291-6

Maruyama T, Kitaoka Y, Sachi Y, et a]. 1997 Thioredoxin expression in the i -
human endometrium during the menstrual cycle. Mol. Hum. Reprod. 32989-993

 

Weisz A, Bresciani F 1993 Estrogen regulation of proto-oncogenes coding for
nuclear proteins. Crit Rev Oncog 42361-88

Thompson CB, Challoner PB, Neiman PE, Groudine M 1986 Expression of
the c-myb proto-oncogene during cellular proliferation. Nature 3192374-80

Suva LJ, Harm SC, Gardner RM, Thiede MA 1991 In vivo regulation of
Zif268 messenger RNA expression by 17 beta-estradiol in the rat uterus. Mol
Endocrinol 52829-35

Tong W, Pollard JW 1999 Progesterone inhibits estrogen-induced cyclin D1 and
cdk4 nuclear translocation, cyclin E- and cyclin A-cdk2 kinase activation, and cell
proliferation in uterine epithelial cells in mice. Mol Cell Biol 19:2251-64

 

Hopwood D, Levison DA 1976 Atrophy and apoptosis in the cyclical human
endometrium. J Pathol 1 192159-66

Billing RJ, Barbiroli B, Smellie RM 1969 The effect of oestradiol-17beta on the
rate of synthesis of ribonucleic acid in rat uterus. Biochem J 114237P-38P

Tchernitchin A, Tchernitchin X, Galand P 1975 Correlation of estrogen-
induced uterine eosinophilia with other parameters of estrogen stimulation.

produced with estradiol-17beta and estriol. Experientia 31:993-4

McBride AE, Silver PA 2001 State of the arg: protein methylation at arginine
comes of age. Cell 10625-8

24]

645.

646.

647.

648.

649.

650.

651.

652.

653.

654.

655.

656.

657.

Das SK, Tan J, Raja S, Halder J, Paria BC, Dey SK 2000 Estrogen targets
genes involved in protein processing, calcium homeostasis, and Wnt signaling in
the mouse uterus independent of estrogen receptor-alpha and -beta. J Biol Chem
275:28834-42.

Salamonsen LA, Woolley DE 1999 Menstruation: induction by matrix
metalloproteinases and inflammatory cells. J Reprod Immunol 4421-27

Stewart PJ, Zaloudek CJ, Inman MM, Webster RA 1983 Effects of
dexamethasone and indomethacin on estrogen-induced uterine growth. Life Sci
3322349-56

Critchley HO, Kelly RW, Brenner RM, Baird DT 2001 The endocrinology of
menstruation--a role for the immune system. Clin Endocrinol (Oxf) 55:701- 10

Paul KG, Kumlien A, Jakobsson S, Brody S 1967 Eosinophil granulocytes. 1.
Identification of the uterus peroxidase. Scand J Clin Lab Invest 20211-6

Ross R, Klebanoff SJ 1966 The eosinophilic leukocyte. Fine structure studies of
changes in the uterus during the estrous cycle. J Exp Med 124:653-60

Finn CA 1986 Implantation, menstruation and inflammation. Biol Rev Camb
Philos Soc 612313-28

Sullivan DA, Wira CR 1981 Estradiol regulation of secretory component in the
female reproductive tract. J Steroid Biochem 152439-44

Hasty LA, Lambris JD, Lessey BA, Pruksananonda K, Lyttle CR 1994
Hormonal regulation of complement components and receptors throughout the
menstrual cycle. Am J Obstet Gynecol 1702168-75

Padilla-Banks E, Jefferson WN, Newbold RR 2001 The immature mouse is a
suitable model for detection of estrogenicity in the uterotropic bioassay. Environ
Health Perspect 1092821-6

Fan JD, Wagner BL, McDonnell DP 1996 Identification of the sequences
within the human complement 3 promoter required for estrogen responsiveness

provides insight into the mechanism of tamoxifen mixed agonist activity. Mol
Endocrinol 10:1605-16

Ino Y, Gotoh M, Sakamoto M, Tsukagoshi K, Hirohashi S 2002 Dysadherin, a
cancer-associated cell membrane glycoprotein, down-regulates E-cadherin and

promotes metastasis. Proc Natl Acad Sci U S A 992365-370

Daikoku T, Matsumoto H, G'upta RA, et a1. 2003 Expression of Hypoxia-
inducible Factors in the Peri-implantation Mouse Uterus Is Regulated in a Cell-

242

 

 

658.

659.

660.

661.

662.

663.

664.

665.

666.

667.

668.

669.

specific and Ovarian Steroid Hormone-dependent Manner. Evidence for
differential function of HIFs during early pregnancy. J. Biol. Chem. 27827683-
7691

Aaronson SA, Natori Y, Tarver H 1965 Effect of estrogen on uterine ATP
levels. Proc Soc Exp Biol Med 12029-10

Steplewski Z 1966 Effect of actinomycin D on alkaline phosphatase induction by
estrogen in uterine epithelium of spayed mice. Bull Acad Pol Sci Biol 142387-90

Yamada T, Horiuchi M, Dzau VJ 1996 Angiotensin 11 type 2 receptor mediates
programmed cell death. Proc Natl Acad Sci U S A 932156-60

Li XF, Ahmed A 1996 Dual role of angiotensin II in the human endometrium.
Hum Reprod 11 Suppl 2295-108

Mancina R, Susini T, Renzetti A, et al. 1996 Sex steroid modulation of AT2
receptors in human myometrium. J Clin Endocrinol Metab 81:1753-7

Zhang Z, Funk C, Roy D, Glasser S, Mulholland J 1994 Heparin-bindin g
epidermal growth factor-like growth factor is differentially regulated by

progesterone and estradiol in rat uterine epithelial and stromal cells.
Endocrinology 1342 1089-94

Pena A, Reddy CD, Wu S, et al. 1993 Regulation of human omithine
decarboxylase expression by the c-Myc.Max protein complex. J Biol Chem
268:27277-85

Tobias KE, Shor J, Kahana C 1995 c-Myc and Max transregulate the mouse

omithine decarboxylase promoter through interaction with two downstream
CACGTG motifs. Oncogene 1 1: 1721-7

Levy C, Glikman P, Vegh I, Mester J, Baulieu E, Soto R 1984 Estradiol,
progesterone and tamoxifen regulation of omithine decarboxylase (ODC) in rat
uterus and chick oviducts. Prog Clin Biol Res 1422133-44

Curtis SW, Shi H, Teng C, Korach KS 1997 Promoter and species specific
differential estrogen-mediated gene transcription in the uterus and cultured cells
using structurally altered agonists. J Mol Endocrinol 182203-11

Iyer R, Jenkinson CP, Vockley JG, Kern RM, Grody WW, Cederbaum S
1998 The human arginases and arginase deficiency. J Inherit Metab Dis 21 Suppl
1286-100

Tabor CW, Tabor H 1984 Polyamines. Annu Rev Biochem 532749-90

243

 

670.

671.

672.

673.

674.

675.

676.

677.

678.

679.

680.

681.

Heller JS, Fong WF, Canellakis ES 1976 Induction of a protein inhibitor to
omithine decarboxylase by the end products of its reaction. Proc Natl Acad Sci U
S A 73: 1858-62

Hayashi S, F ujita K 1983 Antizyme and antizyme inhibitor of omithine
decarboxylase (rat liver). Methods Enzymol 942185-93

Yallampalli C, Dong Y-L 2000 Estradiol-l7{beta} inhibits nitric oxide synthase
(NOS)-II and stimulates NOS-III gene expression in the rat uterus. Biol Reprod
63:34-41

Rao VS, Chaves MC, Ribeiro RA 1995 Nitric oxide synthase inhibition and the
uterotrophic response to oestrogen in immature rats. J Reprod Fertil 105:303-6

Pietila M, Alhonen L, Halmekyto M, Kanter P, J anne J, Porter CW 1997
Activation of Polyamine Catabolism Profoundly Alters Tissue Polyamine Pools
and Affects Hair Growth and Female Fertility in Transgenic Mice Overexpressing
Spermidine/Spermine N 1 -Acetyltransferase. J. Biol. Chem. 272: 18746-18751

Freeman JJ, Williams MA 1971 Estrogenic induction of uterine arginase
activity. Horm Metab Res 32352

Sonoki T, Nagasaki A, Gotoh T, et al. 1997 Coinduction of Nitric-oxide
Synthase and Arginase I in Cultured Rat Peritoneal Macrophages and Rat Tissues
in Vivo by Lipopolysaccharide. J. Biol. Chem. 27223689-3693

Durante W, Liao L, Reyna SV, Peyton KJ, Schafer A1 2001 Transforming
Growth Factor-{beta}1 Stimulates L-Arginine Transport and Metabolism in

Vascular Smooth Muscle Cells 2 Role in Polyamine and Collagen Synthesis.
Circulation 103:1121-1 127

Kushner PJ, Agard DA, Greene GL, et a]. 2000 Estrogen receptor pathways to
AP-l. J Steroid Biochem Mol Biol 742311-7.

Duan R, Porter W, Safe S 1998 Estrogen-induced c-fos protooncogene
expression in MCF-7 human breast cancer cells: role of estrogen receptor Spl
complex formation. Endocrinology 139:1981-90

Cook J W, Hewett C, Hieger I 1932 Coal tar constituents and cancer. Nature
1302926

Markey CM, Michaelson CL, Veson EC, Sonnenschein C, Soto AM 2001 The

mouse uterotrophic assay: a reevaluation of its validity in assessing the
estrogenicity of bisphenol A. Environ Health Perspect 109255-60.

244

 

682.

683.

684.

Ashby J 2001 Increasing the sensitivity of the rodent uterotrophic assay to
estrogens, with particular reference to bisphenol A. Environ Health Perspect
1092 1091-4

Teng CT, Liu Y, Yang N, Walmer D, Panella T 1992 Differential molecular
mechanism of the estrogen action that regulates lactoferrin gene in human and
mouse. Mol Endocrinol 621969-81

Klinge CM, Bowers JL, Kulakosky PC, Kamboj KK, Swanson HI 1999 The
aryl hydrocarbon receptor (AHR)/AHR nuclear translocator (ARNT) heterodimer

interacts with naturally occurring estrogen response elements. Mol Cell
Endocrinol 157:105—19

245

t
Jul

—— _. _flilu 1]

AN STATE UNIVERSITY LIBRARIE

MICHIG
‘1 ‘11‘11 1111
, .1
l ‘1‘ M“ 1 11‘ ““
1 11.1 1 ‘. 1111 1

3 1293 02470 0399

 

l
S
‘l

.L..__------—