..i.............!...u. 3.!
ghadifi.

£553.}.
...}... .5...?
1:04....

I}! [\A’Y. J

fihmyvvh'zl

.fid.» g
.3

 

l...

...! . 2 31

mi nix...

. 0133."?!

a!!!) . I!"

, ..‘ngfv.v

. ..u. no.3...

, ’31

Luna...

«.5.;

{PH

 

 

. 51....
If- vi A1.
. --lr. ; :
......hgdfn. .
.I a. «#3535:
: Jsgow 3 #25550. unfl15.!.t;
v 113......” .. .... . .
av x.

 

 

{518315

0760 3
5‘1'5-53‘i20

 

LIBRARY
Michigan State

’U n'Ve rS'tY This is to certify that the
dissertation entitled

 

 

 

THE USE OF Th2 CYTOKINE GENE EXPRESSION IN THE
NASAL AND PULMONARY AIRWAYS OF MICE TO
IDENTIFY HUMAN CHEMICAL RESPIRATORY ALLERGENS

presented by
AIMEN KHADER FARRAJ

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Pharmacology and Toxicology
and Environmental Toxicology

, / C. ¢
L. / A
.42 / %/f . {44.231 A

Major Professor’s Signature

'S/ZZ/OE

 

 

 

 

Date

MSU is an Afiirmativo Action/Equal Opportunity Institution

-_qu—‘r « ’— fi 4“, «m 7 —

_. fifi . ._ ‘4 v _. ~— ..j. I, _.

v-r

PLACE IN RETURN Box to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 cJCIRC/DateDuo.p85-p.15

THE USE OF Th2 CYTOKINE GENE EXPRESSION IN THE NASAL AND
PULMONARY AIRWAYS OF MICE TO IDENTIFY HUMAN CHEMICAL
RESPIRATORY ALLERGENS '

By

Aimen Khader Farraj

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Pharmacology and Toxicology and the
Institute of Environmental Toxicology

2003

ABSTRACT
THE USE OF Th2 CYTOKINE GENE EXPRESSION IN THE NASAL AND
PULMONARY AIRWAYS OF MICE To IDENTIFY HUMAN CHEMICAL
RESPIRATORY ALLERGENS '
By

Aimen Khader Farraj

Exposure to low molecular weight (LMW) chemical allergens is the leading
cause of occupational respiratory diseases such as asthma and allergic rhinitis.
There are currently no well-validated and widely accepted methods for identifying
chemical respiratory allergens due in part to the uncertainty in mechanism(s) and
the variability across animal models in the route of exposure, the endpoints
assessed and the tissues from which the endpoints are measured. Nonetheless,
LMW chemical-induced allergic airway diseases share many pathologic and
immunologic features with allergic ainivay diseases induced by larger proteins,
including enhanced Th2 cytokines within the ainivays. An in vivo murine model of
allergic ainivay disease was used to study the pathologic and immunologic
responses to known chemical respiratory sensitizers and non-sensitizers after
intra-ainivay instillation. l hypothesized that Th2 cytokine gene expression in the
nasal and/or pulmonary airways of mice may be used to identify chemicals with
the potential to elicit allergic responses in the respiratory tract.

lntranasal (IN) sensitization and challenge with adjuvant-free ovalbumin in
NJ mice elicited mucous cell metaplasia and lymphocytic/eosinophilic infiltration

in pulmonary airways that correlated with increased lung-derived Th2 cytokine

mRNA and serum lgE, characteristic of allergic airway disease. Cannabinol,
(CBN), an inhibitor of Th2 cytokine expression, administered via intraperitoneal
(IP) injection, suppressed the ovalbumin-induced increase in intraepithelial
mucus (IM) in the pulmonary airways, serum lgE, and lung-derived lL-4 mRNA.
IN delivery of CBN inhibited the ovalbumin-induced increase in serum lgE, the
inflammatory cells in the lung, and lung-derived lL-13 mRNA levels, but not the
IM in the pulmonary airways or the lung-derived increase in other Th2 cytokines.

IN sensitization and challenge with the Chemical respiratory allergens
toluene diisocyanate (T DI) and trimellitic anhydride (T MA) elicited some of the
characteristic pathologic features of LMW chemical-induced allergic rhinitis and
TMA caused increased nasal airway-derived Th2 cytokine gene expression.
Neither TDI nor TMA exposed mice had pulmonary lesions, but had increased
lung-derived Th2 cytokine mRNA and serum lgE. The contact allergens
dinitrochlorobenzene (DNCB) and oxazolone (OXA) did not induce any nasal or
pulmonary ainIvay lesions or increases in Th2 cytokine mRNA in the lung, but
DNCB did elicit an increase in semm lgE.

The results suggest that IN sensitization and challenge may be effective in
eliciting the characteristic features of protein- or chemical-induced allergic airway
disease. CBN inhibited some features of the ovalbumin-induced allergic airway
response highlighting the importance of Th2 cytokines in the pathogenesis of the
allergic airway response in this murine model and the potential therapeutic utility
of CBN. Airway Th2 cytokine mRNA expression and/or serum lgE levels may be

used to identify protein or Chemical respiratory allergens.

ACKNOWLEDGEMENTS

In the name of Allah (Arabic word for God), the MOst Beneficent, the Most
Merciful. All praise and thanks are due to Allah, the sole Creator and Sustainer
of this universe and who alone we worship, for facilitating the completion of this
work. Our Lord, may the mention of Muhammad (last of a series of Messengers
including Adam, Abraham, Noah, Moses and Jesus sent by Allah to guide
humankind) and all the other true Prophets and Messengers be exalted in the
heavens. I ask Allah to make this humble effort beneficial to all humankind and
to forgive my shortcomings.

I would not be here if it hadn’t been for Dr. Jack Harkema and Dr. Norb
Kaminski. No words can adequately describe my gratitude and appreciation for
their countless and tireless efforts in my scientific and professional development.
I thank them for allowing me to join their laboratories and having the privilege to
be mentored by them. I thank them for allowing me to work on an incredibly
interesting and relevant project. I thank them for providing financial support
during my graduate training. I also thank them for being personable and
considerate, which helped make graduate training a joy.

I sincerely thank my committee members Dr. Mike Holsapple, Dr. Larry
Fischer, and Dr. Patty Ganey for their guidance, advice, and hard work in
directing me towards a successful dissertation project. I especially thank Dr. Jon
Hotchkiss for his efforts as my committee member and his tutelage early on in

my graduate training.

iv

I thank Dr. James Wagner for all his help and advice during my graduate
training. I also thank Dr. Tony Jan for his help and direction early on in my
graduate training. In addition, I thank Bob Craward, Lori Bramble, Kim
Townsend, Steve van Dyken, Jonelle Golding, and Jamie Simon for their
assistance along the way. I also thank the entire Department of Pharmacology
and Toxicology and especially Dr. Ken Moore, Diane Hummel, Faye Spencer, Dr.
J.R. Haywood, Dr. Jay Goodman, and Dr. James Galligan of the Department of
Pharmacology and Toxicology.

I also thank the Institute of Environmental Toxicology for their support and
the American Chemistry Council who funded part of this work (Grant # 0051 ).

I thank my wife, brothers, sisters, and friends for their patience, love,
support and encouragement. Last but certainly not least, I especially thank my
parents for their hard work over the years and for providing the nurturing that was

essential to my development.

TABLE OF CONTENTS

Page
LIST OF TABLES ' viii
LIST OFFIGURES ix
LIST OF ABBREVIATIONS xiv
CHAPTER 1
INTRODUCTION 1
Occupational Respiratory Diseases 2
Hallmark Features of Allergic Airway Disease of the Lung 3
Mechanisms of Allergic AinIvay Diseases of the Lung 4
Pathogenesis of Allergic Ainivay Disease of the Lung 6
Allergic AinIvay Disease of the Nose 10
Occupational Asthma Definition and Pathophysiology 11
Occupational Allergic Rhinitis Pathophysiology 13
Agents Linked to Occupational Asthma and Allergic Rhinitis 14
Mechanisms of LMW Chemical-Induced Occupational
Asthma and Allergic Rhinitis 15
Serum lgE in LMW Chemical-Induced Occupational
Allergic Airway Diseases 19
Irritant Asthma as an Alternative Mechanism ‘ 21
ThZCytokines in LMW Chemical-Induced
Allergic Ainivay Disease 22
Need for an Animal Model of LMW Chemical-Induced
Allergic Airway Disease 24
A Comparison of the Routes of Exposure in Animal Models 26
A Comparison of Endpoints Measured in Animal Models 27
A Comparison of Toxic and Immune Effects of Chemicals
In Animal Models 29
NJ Mouse Used to Model Human Allergic Ainivay Disease 30
Goals of the Dissertation 32
CHAPTER 2
IMMUNE RESPONSES IN THE LUNG AND LOCAL LYMPH NODE OF AN
MICE TO INTRANASAL SENSITIZATION AND CHALLENGE WITH
ADJUVANT-FREE OVALBUMIN 35
Abstract 36
Introduction 38
Materials and Methods 40
Results 52

Discussion 69

vi

CHAPTER 3
SUPPRESSION OF THE OVALBUMIN-INDUCED ALLERGIC AIRWAY
RESPONSE INA/J MICE BY INTRANASAL OR INTRAPERITONEAL
ADMINISTRATION OF CANNABINOL

Abstract

Introduction

Materials and Methods

Results

Discussion

CHAPTER 4
PATHOLOGIC AND CYTOKINE RESPONSES IN THE RESPIRATORY
TRACT OF NJ MICE AFTER INTRANASAL SENSITIZATION AND
CHALLENGE WITH TOLUENE DIISOCYANATE

Abstract

Introduction

Materials and Methods

Results

Discussion

CHAPTER 5
PATHOLOGIC AND CYTOKINE RESPONSES WITHIN THE NASAL
AND PULMONARY AIRWAYS OF AN MICE AFTER INTRANASAL
SENSITIZATION AND CHALLENGE WITH TRIMELLITIC ANHYDRIDE,
DINITROCHLOROBENZENE, OR OXAZOLONE

Abstract

Introduction

Materials and Methods

Results

Discussion

CHAPTER 6
SUMMARY AND CONCLUSIONS

BIBLIOGRAPHY

vii

77
78
80
85
96
1 08

115
116
118
121
131
145

151
152
154
158
168
184

193
203

Table 4.1

Table 5.1

Table 5.2

LIST OF TABLES

' Page
Summary of Th2 and Th1 cytokine mRNA
expression changes within the right lung lobes
after TDI sensitization and challenge 144
Summary of the morphologic changes in the
nasal aiwvays, pulmonary aiwvays, small intestine,
or gut after sensitization and challenge with TMA,
DNCB, or OXA 172

Summary of cytokine mRNA expression changes

in the nasal airway, lung, small intestine, and spleen

after sensitization and challenge with TMA, DNCB,

or OXA 183

viii

LIST OF FIGURES

Images in this dissertation are presented in color

Figure 1.1:

Figure 1.2:

Figure 1.3:

Figure 1.4:

Figure 2.1:

Figure 2.2:

Figure 2.3:

Figure 2.4:

Figure 2.5:

Figure 2.6:

Figure 2.7:

Primary exposure to a high molecular weight protein
allergen (> 1kDa)

Secondary exposure to a high molecular weight protein
allergen (> 1kDa)

Chemical structures of low molecular weight chemicals
linked to allergic airway disease

Toluene diisocyanate reacts with the amino terminus
of a protein

Timeline of the exposure regimen used to sensitize
and challenge A/J mice with ovalbumin or saline

Sites of airway tissue selection for morphometric analysis

Light photomicrographs of conducting airways of the left
lung from mice intranasally sensitized and challenged
twice with saline (A,B) or 0.5 % ovalbumin (CD) and
sacrificed 96 hr after challenge

Morphometric quantification of AB/PAS-stained material

in the surface epithelium lining mouse pulmonary ainrvays
at generations 5 (proximal) and 11 (distal) 48 hr after single
challenge or 96 hr after double challenge with ovalbumin

Quantification of mucous and epithelial (total) cell density
in the surface epithelium lining mouse pulmonary airways
(generation 5) 96 hr after double Challenge with ovalbumin

Morphometric quantification of eosinophils
immunohistochemically stained for major basic protein
in mouse ainivay interstitium (generations 5 and 11) 96
hr after double challenge with ovalbumin

Light photomicrographs of the distal region of the nasal
cavity at the level of the second palatal ridge of mice 96
hr after sensitization and two challenges with saline
(left panels) or ovalbumin (right panels)

ix

16

18

41

53

55

57

59

60

m.
‘1?”

Hg

is

Fig

Figure 2.8:

Figure 2.9:

Figure 2.10:

Figure 2.11:

Figure 2.12:

Figure 2.13:

Figure 3.1:

Figure 3.2:

Figure 3.3:

Figure 3.4:

Morphometric quantification of AB/PAS-stained
material in the surface epithelium lining the
nasopharyngeal meatus of mice 96 hr after double
challenge with ovalbumin or saline

Ovalbumin-specific (upper panel) and Total lgE
(upper panel) levels in mouse semm isolated 96
hr after double challenge with ovalbumin

Autoradiograph of electrophoretic gel depicting
cytokine mRNA expression from RNase Protection
Assay performed using RNA isolated from the cranial
and medial right lung lobes of mice 24, 48, or 96 hr
after double challenge with ovalbumin

Quantification of IL-4 mRNA in cranial and medial
right lung lobes 24 or 48 hr after single Challenge with
ovalbumin using RT-PCR

Quantification of lL-4 mRNA in cranial and medial
right lung lobes 24, 48, or 96 hr after double challenge
with ovalbumin using RT-PCR

Quantification of IL-4 mRNA in tracheobronchial
lymph node 24 or 96 hr after double challenge with
ovalbumin using RT-PCR

Timeline of the exposure regimen used to sensitize and
challenge A/J mice with ovalbumin or saline and co-treated
with either lP CBN or IN CBN

Sites of airway tissue selection for morphometric analysis

Light photomicrographs of the main axial airway of the left
lung from mice intranasally sensitized and challenged twice
with saline (A, D), 0.5% ovalbumin (B, E), or 0.5% ovalbumin
and co-treated with IP CBN (C, F) and sacrificed 48 hr after
challenge

Morphometric quantification of AB/PAS-stained material in
surface epithelium lining the main axial ainrvay of the left

lung lobe 48 hr after double Challenge with saline, ovalbumin,
or ovalbumin plus co-treatment with IP CBN

62

63

66

67

68

86

90

97

99

Figure 3.5:

Figure 3.6:

Figure 3.7:

Figure 3.8:

Figure 3.9:

Figure 4.1:

Figure 4.2:

Figure 4.3:

Figure 4.4:

Total number of macrophages, lymphocytes, eosinophils,
and neutrophils in BALF from the left lung lobes of mice
treated with IN instillations of EA/OO vehicle and instilled
with saline, mice treated with IN instillations of EA/OO
vehicle and instilled with ovalbumin, mice treated with IN
instillations of CBN and instilled with saline, or mice treated
with IN instillations of CBN and instilled with ovalbumin

Ovalbumin-specific (upper panel) and Total IgE levels
(lower panel) in mouse serum isolated 48 hr after double
challenge with saline, ovalbumin, or ovalbumin plus
co-treatment with IP CBN

Ovalbumin-specific (upper panel) and Total lgE
(lower panel) levels in mouse serum isolated 48 hr
after mice were treated with IN instillations of EA/OO
vehicle and instilled with saline, IN instillations of
EA/OO vehicle and instilled with ovalbumin,

IN instillations of CBN and instilled with saline, or IN
instillations of CBN and instilled with ovalbumin

Quantification of IL-4 mRNA in right lung lobes 48 hr after
double challenge with saline, ovalbumin, or ovalbumin plus
co-treatment with IP CBN using semi-quantitative RT-PCR

Relative quantification using real-time PCR of lL-4, lL-5,
lL-10, lL-13 and lFN-y mRNA in right lung lobes 48 hr after
mice were treated with IN instillations of EA/OO vehicle

and instilled with saline, IN instillations of EA/OO vehicle and
Instilled with ovalbumin, IN instillations of CBN and instilled
with saline, or IN lnstillations of CBN and instilled with
ovalbumin

Timeline of the exposure regimen used to sensitize and
challenge NJ mice with 0.1 % TDI in 1:1 ethyl acetate/olive
oil vehicle

Sites of ainivay tissue selection for morphometric analysis
Light photomicrographs of the lateral wall from the proximal
nasal ainIvays of mice intranasally instilled with ethyl
acetate or 1:1 ethyl acetate and olive oil

Total number of inflammatory cells in the BALF from

the left lung lobes of mice intranasally instilled 5 times
with 1 :1 ethyl acetate/olive oil, 10 % toluene diisocyanate

xi

101

102

103

105

106

124

127

132

Figure 4.5:

Figure 4.6:

Figure 4.7:

Figure 4.8:

Figure 4.9:

Figure 4.10:

Figure 5.1:

Figure 5.2:

(T DI) in 1:1 ethyl acetate/olive oil, ethyl acetate alone,
or 10 % TDI in ethyl acetate alone and sacrificed
24 hr after the final instillation

Light photomicrographs of the proximal nasal airway of
mice intranasally instilled with ethyl acetate alone
or 10 % toluene diisocyanate (T DI) in ethyl acetate

Light photomicrographs of the main axial ainrvay of

the left lung lobe of mice intranasally instilled with ethyl
acetate alone or 10 % toluene diisocyanate

(T DI) in ethyl acetate

Total number of inflammatory cells in the BALF from
the left lung lobes of mice intranasally instilled 5 times
with ethyl acetate/olive oil, 10 % toluene diisocyanate
(TDI) in ethyl acetate/olive oil, ethyl acetate alone,

or 10 % TDI in ethyl acetate alone and sacrificed

24 hr after the final instillation

Light photomicrographs of the maxilloturbinates from the
proximal nasal always of naive mice (A), mice sensitized
and challenged with 1:1 ethyl acetate/olive oil vehicle (B),
mice sensitized with 0.1 % TDI in vehicle and challenged
with vehicle (C), mice that were sensitized with vehicle and
challenged the first time with vehicle and the second time
with 0.1 % TDI (D), and mice sensitized and challenged
with 0.1% TDI (E)

Total lgE levels in mouse serum isolated 48 hr or 2 weeks
after double challenge with 0.1 % TDI
Relative quantification of IL-4, IL-5, lL-10, lL-13, and IFN-y

mRNA in right lung lobes 48 hr after double challenge with
0.1 % TDI

Timeline of the exposure regimen used to sensitize and
challenge NJ mice with 0.125 % TMA, 0.5 °/o DNCB, or
0.1% OXA in 1:4 ethyl acetate/olive oil vehicle

Sites of airway tissue selection for morphometric analysis

xii

133

134

135

137

138

142

143

160
163

Figure 5.3:

Figure 5.4:

Figure 5.5:

Figure 5.6:

Figure 5.7:

Figure 5.8:

Figure 5.9:

Light photomicrographs of the maxilloturbinates from the
proximal nasal airways of mice sensitized and challenged
with vehicle alone (A) or TMA in vehicle (B) 169

Light photomicrographs of the nasal mucosa lining the
mid-septum from the proximal nasal airways of mice exposed
to vehicle alone (control, A & B), or TMA in vehicle (C & D) 171

Morphometric quantification of AB/PAS-stained material in the
surface epithelium lining the midseptum in nasal ainivay region
T1 of mice 96 hr after double challenge with TMA 174

Total number of macrophages in BALF from the left lung lobes
of mice sensitized and challenged with TMA 175

Total lgE levels in mouse serum isolated 24 or 96 hr after
double challenge with TMA (A), DNCB (B), or OXA (C) 177-8

Relative quantification of IL-4, lL-5, lL-10, IL-13, and lFN-y
mRNA in right lung lobes 24 hr after double challenge with
TMA (A), DNCB (B), or OXA (C) using real-time RT-PCR 179-80

Relative quantification of lL-4, IL-5, IL-10, lL-13, and IFN-ty

mRNA in nasal airway tissue 24 hr after double challenge
with TMA using real-time RT-PCR ' 182

xiii

 

Ell...

AB/PAS
APC
BALF
BSA
CBN
CD4
CT
DMSO
DNA
DNCB
A9-THC
ENOO
ECP
GM-CSF
GSH
HDI
IFN

'9

IL

IM

lN

lP

IS

kDa
LMW
MBP
MCM
MINT
mRNA
MTB
OXA
PAF
PEL
RADS
rcRNA
RNA
RPA
RT
RT-PCR
SEM
TB

TDI

LIST OF ABBREVIATIONS

alcian blue/Periodic acid Schiff's reagent
antigen presenting cell
bronchoalveolar lavage fliud
bovine serum albumin
cannabinol

cluster of differentiation 4
cycle threshold

dimethyl sulfoxide
deoxyribonucleic acid
dinitrochlorobenzene

A9 -tetrahyd rocannabinol

ethyl acetate/olive oil
eosinophilic cationic protein
granulocyte macrophage-colony stimulating factor
glutathione

hexamethylene diisocyanate
interferon

immunoglobulin

interleukin

intraepithelial mucosubstances
lntranasal

intraperitoneal

internal standard

kiloDaIton

low molecular weight

major basic protein

mucous cell metaplasia

mouse lntranasal test
messenger ribonucleic acid
mycobacterium tuberculosis
oxazolone

platelet activating factor
permissible exposure limits
reactive airway dysfunction syndrome
recombinant RNA

ribonucleic acid

RNase Protection Assay
reverse transcriptase

reverse transcriptase-polymerase chain reaction
standard error of the mean
tracheobronchial

toluene diisocyanate

xiv

TM;
TIII
VCI
Vs

Th

TMA
TMB
VCAM-1
Vs

T-helper

trimellitic anhydride

tetramethyl benzidine

vascular cell adhesion molecule 1
Volume Density

XV

CHAPTER 1

INTRODUCTION

Occupational Respiratory Diseases

There are a variety of respiratory illnesses that result from occupational
exposure. Some of the most frequent diagnoses include acute pulmonary
edema, mesothelioma, and diseases that result from allergic sensitization of the
respiratory tract such as allergic alveolitis, allergic rhinitis, and asthma (Kimber et
al, 1997). Occupational asthma and allergic rhinitis are the most frequently
diagnosed occupational respiratory illnesses (Beach et al, 2000). Epidemiologic
studies suggest that 10 to 25 % of adult asthma is linked to workplace exposure
(Petsonk, 2002). The Surveillance of Work and Occupational Respiratory
Disease (SWORD) program in the United Kingdom found that 26 % of all work-
related respiratory illness was due to occupational asthma (Lombardo and
Balmes, 2000). The incidence of occupational asthma amongst workers in the
United States ranges from 29 to 710 cases per million workers (Petsonk, 2002).
There was a 70 "/0 increase in cases of occupational asthma in Finland from
1986 to 1993 (Petsonk, 2002). Allergic rhinitis resulting from occupational
exposure is less well documented than occupational asthma partly because of
inadequate diagnostic methods (WHO, 1999). Hypersensitivity of the upper
respiratory tract, however, often coexists with occupational asthma. Several
studies suggest that allergic rhinitis due to workplace exposure to chemicals
precedes and may be more common than occupational asthma (Bernstein, 1993;

Grammer et al, 2002).

Ha

res
em
daf
Ier.
Alli
by
Asl

DIE

an:
all“)

Hal

8th
370:

"to:

It

Hallmark features of Allergic Airway Disease of the Lung

Allergic ainrvay diseases such as asthma result from inappropriate immune
responses to commonly inhaled foreign agents such as those found in the
environment (e.g., pollen or cockroach antigen) or in occupational settings (e.g.,
dander from laboratory animals or isocyanates). The offending agent is usually
termed an antigen or allergen in reference to the allergic reaction it provokes.
Allergy consists of an initial generally symptom-free sensitization phase followed
by an effector phase that produces the symptoms characteristic of allergy.
Asthma is a chronic inflammatory disease of the lung that has increased in
prevalence, morbidity, and mortality in recent years. The main physiological
abnormalities of asthma are airflow obstruction and airway hyper-responsiveness
(Wills-Karp, 1999). The airways of asthmatics are characterized by the presence
of chronic inflammation with infiltration of the bronchial mucosa by lymphocytes,
eosinophils, neutrophils, and mast cells, along with increased mucus production
and epithelial desquamation, and airway remodeling such as hyperplasia of the
airway epithelium, smooth muscle hypertrophy and fibrosis (Wills-Karp, 1999:
Holgate, 2000).

Many factors contribute to the development of asthma. Nonetheless, the
single-most identifiable predisposing factor for the development of asthma is
atopy (Kay, 2001). Individuals with atopy have a hereditary predisposition to
produce an lgE-mediated response against common allergens and have one or
more atopic diseases such as allergic rhinitis, asthma, and eczema (Kay, 2001).

In general, adults and children without atopy mount a low-grade immunologic

response to allergen exposure characterized by IgG1 and IgG4 antibodies (Kay,
2001 ). After repeated low-dose exposure to allergens, atopic individuals develop
specific lgE antibodies to the allergens. Subsequent eXposure to the allergen(s)
initiates a secondary humoral response. Immediately after re-exposure, the
response is characterized by rapid onset of mucosal edema, increases in airway
smooth muscle tone and ainrvay narrowing associated with mast cell
degranulation. A few hours later and persisting for several days, a late-phase
response takes place that is identified by airway narrowing associated with the
migration of eosinophils, lymphocytes, and neutrophils from the blood into the
lung parenchyma and ainrvay (Wills-Karp, 1999). This type of response
characterizes Type I hypersensitivity responses that take place rapidly (within

hours) after re-exposure to a particular allergen.

Mechanisms of Allergic Airway Diseases of the Lung

The mechanism(s) underlying the pathogenesis of allergic airway disease
are being elucidated. There are many lines of evidence that implicate the T
lymphocyte and specifically the CD4+ T cell in the orchestration of this aberrant
response. Evidence for the participation of T lymphocytes includes increased
numbers of CD4+ T cells in bronchoalveolar lavage fluid (BALF) and a
concurrent decrease in the number of CD4+ T cells in peripheral blood following
allergen challenge (Wills-Karp, 1999). The Th2 subset of CD4+ T cells and the
cytokine profile associated with it have been consistently found in both BALF and

biopsies of allergic asthmatics (Wills-Karp, 1999). CD4+ T cells are classified

into functionally distinct Th1 or Th2 subsets based on the restricted cytokine
profiles expressed by in vitro murine T cell clones (Bruijnzeel-Koomen et al,
2000). Th1 cells produce IFN-y and IL-2 promoting the development of a cell-
mediated immune response involving cytotoxic T cells and macrophages. Th2
cells produced lL-4, lL-5, lL-9, lL-10, and lL-13 involved in promoting humoral
immune responses, typical of atopy and parasitic infections. A similar functional
dichotomy has been found in human T cells (Andersson et al, 2001). In allergic
ainNay disease, Th2 cell activity predominates, while Th1 activity is nominal.
Several factors are involved in the development of CD4+ Th2 cells in allergic
processes including the local cytokine environment, the level and type of antigen,
the antigen presenting cell, and the delivery of co-stimulatory signals form the
antigen presenting cell. The paracrine release of lL-12 derived from antigen
presenting cells promotes the development of Th1 responses, while the autocrine
production of IL-4 by Th2 cells promotes the development of Th2-type responses
(Wills-Karp, 2001). Several lines of evidence support the role of Th2 cytokines in
the pathophysiologic features of allergic ainrvay diseases such as asthma. The
differentiation of uncommitted T cell precursors into Th2 cells is largely driven by
lL-4 as demonstrated by the abrogation of airway hyperreactivity after
administration of a monoclonal antibody against IL-4 during the period of
immunization in a murine model of asthma (Corry et al, 1996). IL-4 is also a
growth factor for mast cells and up-regulates vascular cell adhesion molecule-1
(VCAM-1) expression which leads to preferential migration of eosinophils into

tissues (Wills-Karp, 1999). lL-4 and lL-13 are required for B cells to undergo

class switching to go from producing lgM to producing lgE (Frew, 1996). lL-5
regulates the maturation and activation of eosinophils. IL-5.deficient mice have
markedly fewer eosinophils in the lamina propria of ainrvays than normal mice
after provocation and antibody blockade inhibits antigen-induced eosinophilia
and late-phase hyperresponsiveness (Foster et al, 2000 and Karras et al, 2000).
Hypersecretion of mucus and mucous cell metaplasia (MCM) are
important features of allergic airway disease. lL-9 plays a large role in the
stimulation of mucin (a mucus protein found within a mucous cell) production in
airways as demonstrated by the inhibition of mucin production in respiratory
epithelial cells via treatment with antibodies against IL-9 in dogs (Longphre et al,
1999). lL-4 and IL-13 also induce mucin gene expression in airway epithelium
(Shim et al, 2001). lL-13 has also been proven to be necessary for the
expression of allergic airway hyperresponsiveness and sufficient to induce it.
Administration of recombinant lL-13 conferred an asthma-like phenotype to non-

immunized mice (Grunig et al, 1998).

Pathogenesis of Allergic Airway Disease of the lung

The pathogenesis of allergic ainivay disease may be summed up by a
proposed series of events beginning with the Inhalation of the antigen. After
inhalation, the antigen is believed to interact with the follicular dendritic cell found
above the basement membrane of the airway epithelium throughout most of the
respiratory tract (Wills-Karp, 1999). Dendritic cells are antigen-presenting cells

that recognize and process the antigen and migrate to the local draining lymph

 

IIC

V3 5

nodes of the lung, up-regulate expression of co-stimulatory ligands on their
surfaces (i.e., B7), and interact with resting T lymphocytes, initiating a primary
immune response (Figure 1.1). Uncommitted T cell preCursors (Th0) differentiate
into one of two subtypes depending on the nature and dose of the antigen and
the local cytokine microenvironment. In the presence of lL-4, Th0 cells
differentiate into Th2 cells (Wills-Karp, 1999). lL-12 primes CD4+ T cells for Th1
differentiation, which later secretes IFN-y, critical for cell-mediated immunity and
an inhibitor of Th2 differentiation (Warbrick et al, 1999). Newly differentiated
armed Th2 cells secrete a unique pattern of cytokines that includes lL-4, IL-5, IL-
6, lL-9, lL-10 and lL-13. Initial contact with the antigen causes B cells to
differentiate into memory B cells. The Th2 cell then interacts with the B cell that
has already made initial contact with the antigen; Th2 cells secrete lL-4 and lL-13
that drive ‘Class switching’ in B cells that convert from IgM-prodUcing naive B
cells to lgE-producing memory B cells (BruijnzeeI-Koomen et al, 2000). IgE
molecules secreted by the B cell bind Fcch receptors on the surface of mast
cells in the bronchial mucosa. Subsequent exposure to the allergen causes the
IgE producing memory B cells to proliferate and differentiate into lgE-secreting
plasma cells (Figure 1.2). The allergen then ‘cross-links’ two IgE molecules on
the surface of the mast cell causing degranulation of mast cell mediators. The
mast cell contains several potent mediators of inflammation including histamine,
platelet activating factor (PAF) and leukotrienes which contribute to the

vasodilation, increased vascular permeability, and ainrvay narrowing associated

 

.5.-.-gnu- '
r1 ' -.

 

 

 

 

 

Mucosa
lgE
Y_.

B Cell /'f @525:

Lmdph @ ‘

e M 6) \ {kfi
T Cell filnflammatory

Cytokines

 

 

 

 

 

 

 

Figure 1.1: Primary exposure to a high molecular weight protein allergen (>1
kDa).

 

Airway {1’ § {5
Lumen #4)} '2} Antigen

Mucus Overproduction

/

Ainrvay Inflammatory Cell
Mucosa @ MastCeII @ ® Influx into Aimay

TNF, lL-1 End Oman Resmnses
Activation of 1

E d h ' Edema
n at eium Bronchoconstn'ction
' Th2 0°” Mucus Hyper-secretion

Airway Hyper-reactivity
\
® Eosinophil

 

   

 

 

 

 

 

Figure 1.2: Secondary Exposure to a high molecular weight protein allergen
(>1kDa).

 

bar
nar
SBI
ba:

aIrI

fell

OVI

Sm
Th.

59"

with asthma (Frew, 1996). Re-exposure to the allergen also causes the
infiltration of plasma cells and Th2 cells into the bronchial mucosa. Th2 cells
also release lL-5, which promotes the growth and reCrUitment of eosinophils.
Eosinophils release leukotrienes, eosinophil cationic protein (ECP) and major
basic protein (MBP) that cause epithelial cytotoxicity, airway hyperreactivity and
narrowing, and increased mucus production. Bare epithelium exposes the
sensory afferents, which makes them more reactive to noxious stimuli. Major
basic protein binds and inhibits M2 receptors located on the nerve terminals of
airway parasympathetic nerves that limit acetylcholine release; this contributes to
the ainrvay hyperreactivity (Adamko et al, 1999). lL-4, lL-9, and lL-13, also
released by the Th2 cell contribute to airway hyperreactivity and mucus

overproduction.

Allergic Airway Disease of the Nose

Allergic rhinitis is an inflammatory disease of the nasal mucosa affecting
10 to 20 % of the world’s population (Andersson et al, 2000). It is frequently
caused by exposure to perennial or seasonal allergens present indoors and
outdoors (Andersson et al, 2000). Pollens, house dust mites and animal dander
are major causes of allergic rhinitis (Andersson et al, 2000). Itching, followed by
sneezing occurs very rapidly after allergen deposition in the nasal mucosa.
These symptoms then abate followed by an onset of nasal watery secretion a
few minutes after nasal provocation. This may last for a few hours if the

provocative dose is sufficiently strong. Nasal obstruction, due in part to

10

”It

as:

Dre

0c.

hypersecretion of mucus is also generated within minutes and may continue for
hours (Andersson et al, 2000). Sensory nerve stimulation is also a feature of
allergic rhinitis (WHO, 1999). The mucosal exudation 'of plasma to the airway
lumen is also a fast process. Like asthma, the main predisposing factor for
allergic rhinitis is atopy. IgE antibodies are known to play a key role by triggering
the release of mediators that are responsible for the allergic symptoms
(Andersson et al, 2000). The histologic features are characteristic of Type I
immediate hypersensitivity. The nasal mucosa shows large numbers of T- and B-
lymphocytes, mast cells, neutrophils, plasma cells and dendritic cells and mucus
overproduction (Andersson et al, 2000). The nasal mucosa in allergic rhinitis is
also characterized by the infiltration of large amounts of eosinophils (van de Rijn
et al, 1999). Th2 cytokines, similar to allergic asthma, have been shown to play
a role in allergic rhinitis. Nasal biopsies taken 24 hours after nasal allergen
challenge demonstrated an increased number of cells expressing mRNA
hybridization signals for lL-3, IL-4, IL-5 and GM-CSF in patients with allergic
rhinitis (Andersson et al, 2000). Nasal allergen provocation, followed by nasal
mucosa biopsy 24 hours after challenge in patients with allergic rhinitis is
associated with a cellular infiltrate where CD4+ T cells and eosinophils are

prominent (Andersson et al, 2000).
Occupational Asthma Definition and Pathophysiology

Occupational asthma may be defined as a condition that is characterized

by variable airflow limitation and/or ainrvay hyperresponsiveness due to causes

11

and conditions attributable to a particular occupational environment and not to
stimuli encountered outside the workplace (Bernstein et al, 1993). There are two
types of occupational asthma that are distinguished by Whether they appear after
a latency period. One is the immunologic type where there is a latency period for
most high and some low molecular weight agents. It is characterized by an
asymptomatic period during which sensitization to a substance in the work
environment occurs. The clinical expression of asthma symptoms is then elicited
by low concentrations of the causative agent. Asthma may persist for years even
after removal from further exposure. The reason for this is unclear, but may
perhaps be due to the immunologic response, which is initially very specific, but
gradually becomes more nonspecific as the inflammatory response in the ainrvay
becomes more established (Beach et al, 2000). The prolonged morbidity
correlates directly with the length of time the worker is exposed to the causative
agent prior to diagnosis and removal from further exposure (Kimber et al, 1997).
The nonimmunologic type, also known as ‘irritant asthma’ or reactive ainrvays
dysfunction syndrome (RADS), may occur after a single or multiple exposures to
nonspecific chemicals at high concentrations (Malo and Chan-Yeung, 2001).
The term ‘irritant’ is commonly used by investigators studying the mechanisms of
occupational allergic ainrvay diseases to refer to chemicals that cause a
nonspecific immune response at the site of contact, either the airway mucosa or
the skin, without the requirement for prior exposure or sensitization to the

chemical (Ban and Hettich, 2001).

12

Pathologic features in the ainrvays of patients with occupational asthma
are similar to those found in individuals with non-occupational asthma. They
include airway smooth muscle hypertrophy, mucosal edema, increased mucus
production, deposition of collagen beneath the basement membrane, and
epithelial desquamation (Beach et al, 2000). A cellular infiltrate of inflammatory
cells consisting of lymphocytes, eosinophils, and neutrophils is present in the
airway and bronchial mucosa. The impact on pulmonary function includes non-

specific airway hyperreactivity and bronchoconstriction (Beach et al, 2000).

Occupational Allergic Rhinitis Pathophysiology

Upper respiratory tract hypersensitivity involving the nose often coexists
with asthma in the occupational setting (WHO, 1999). Similar to occupational
asthma, the causes and conditions of occupational allergic rhinitis are attributable
to a particular occupational environment and not to stimuli encountered outside
the workplace. The pathophysiology of LMW chemical-induced allergic rhinitis is
similar to that induced by proteins. With occupational agents, rhinitis is a more
common manifestation than asthma because the nasal mucosa is more
accessible to deposition of dusts and vapors (e.g., baker’s flour, isocyanates,
wood dusts, and animal dander) (Holgate et al, 2000). Some studies suggest
that allergic rhinitis due to workplace exposure to chemicals precedes
occupational asthma (Bernstein, 1993; Leynaert et al; 2000, Crammer et al,
2002). The symptoms include itching, sneezing, nasal congestion. They are

accompanied by afferent nerve stimulation and the release of neuropeptides

13

such as substance P and tachykinins (WHO, 1999). There is a local
accumulation of CD4+ T-Iymphocytes, eosinophils, neutrophils and mast cells.
Allergies, however, have to be differentiated from toxic and irritative mechanisms.
Allergenic chemicals are often also irritants. Strongly toxic chemicals may elicit
the characteristic symptoms of allergic rhinitis by directly damaging the mucosa
after single contact (WHO, 1999). Milder irritants such as solvents may cause

hyperreactivity after repeated contact (WHO, 1999).

Agents Linked to Occupational Asthma and Allergic Rhinitis

There are many occupations associated with asthma and allergic rhinitis
including health care, animal handling, farms, bakeries, laboratory work,
detergent manufacture, work with paints, plastics, and adhesives, work with
jewelry making, work with metal salts, nickel plating, and the tanning industry
(Petsonk, 2002). There are over 200 documented organic and inorganic agents
that have been linked to the development of occupational asthma (Petsonk,
2002). These include high molecular weight agents including organic dusts,
plant and animal proteins and proteins existing in natural rubber latex (Petsonk,
2002). The Occupational Safety and Health Administration (OSHA) has set
Permissible Exposure Limits (PEL) for some of the agents associated with
occupational asthma such as platinum salts, and certain isoycanates, but many
agents that cause asthma in the workplace still lack PELs.. Among the most
important classes of agents are low molecular weight (LMW) chemicals that have

a molecular weight less than 1X103 kDa (Kimber et al, 1997). Several

14

epidemiologic studies have found that highly reactive LMW chemicals are the
leading cause of occupational asthma and allergic rhinitis. These include the
Sentinel Event Notification System for OccupatiOnal Risks (SENSOR)
surveillance system sponsored by the National Institute for Occupational Safety
and Health (NIOSH) of the United States (Jajosky et al, 1999) and the SWORD
surveillance program of the United Kingdom (Meyer et al, 1999). LMW
chemicals linked to occupational asthma include flour and grain dusts, proteins
from laboratory animals, glutaraldehyde, wood dusts, isocyanates and acid
anhydrides (Kimber et al, 1997). Toluene diisocyanate (TDI) and trimellitic
anhydride (TMA) are leading causes of occupational asthma and allergic rhinitis
(Figure 1.3). TDI is used in polyurethane, plastics, and varnish industries, while

TMA is a main component of epoxy resins.

Mechanisms of LMWC-induced Occupational Asthma and Allergic Rhinitis
The underlying mechanisms associated with the induction of asthma and
allergic rhinitis by LMW chemicals have not been full elucidated. The
pathophysiologic Changes in the airways of patients with LMW chemical- induced
asthma and rhinitis resemble those of allergy to larger agents such as pollens
and animal dander. LMW chemical respiratory allergens, unlike most of the
larger allergenic proteins, are either inherently chemically reactive or are
metabolized in vivo into chemically reactive species (Karol et al, 2001). The
physicochemical characteristics of LMW chemicals that are most closely

associated with their allergenicity are transport and reactivity (Karol, 2001). In

15

TolgeneQiisocvanate Trimellitic Anhydride

O

 

Figure 1.3: Chemical structures of Low Molecular Weight Chemicals Linked to
Allergic Airway Disease

16

SE

order to elicit their biologic or toxic activity, the LMW chemical must reach its
appropriate target. The internal regions of the nasal airways and lung are
separated from the external environment by the airway epithelium. There is data
that suggests that the airway epithelium is the critical target of inhaled LMW
chemical allergens. LMW chemical allergens are typically electrophiles or
proelectrophiles capable of reacting with hydroxyl, amino, and thiol groups on
endogenous proteins (Figure 1.4) (Karol et al, 2001). LMW chemicals conjugate
with endogenous proteins including human serum albumin, tubulin, keratin,
glucose-regulated protein, trans-1,2 dihydrobenzene-1,2 diol dehydrogenase,
actin, and glutathione (GSH) in the respiratory tract (Beach et al, 2000; Lange et
al, 1999; Day et al, 1997; Wisnewski et al, 2000). TDI colocalizes with tubulin on
the cilia of differentiated human epithelial cells in vitro (Lange et al, 1999).
Following inhalation of hexamethylene diisocyanate, keratin 18 was identified as
the predominant diisocyanate-conjugated protein in human endobronchial biopsy
samples, whereas albumin was the predominant diisocyanate-conjugated protein
in BALF (Wisnewski et al, 2000). Low molecular weight agents are unique in that
they only acquire immunogenicity after linkage with an endogenous protein
carrier. The new multi-valent hapten-protein conjugates are then capable of
inducing and eliciting an immune response, the specificity of which may be
directed against the hapten carrier protein or new antigenic determinants in the
conjugate, either singly or In combination (Kimber et al, 1997). Another
mechanism by which LMW chemicals can lead to the production of new antigenic

Sites is by inducing cross-linking of endogenous proteins such as albumin. A

17

Toluene diisocyanate Hapten-Protein Coniugate

 

 

 

CH3
N=C=O
+NH2

a, O

:u I I

g NH--C-NH

rn :

2 3r
3
I11
'2'

Figure 1.4: Toluene diisocyanate reacts with the amino terminus of a protein.

18

nun
hav

glut

Ser

sar
ant
ind
Spa
me

DIE

number of patients suffering from glutaraldehyde-induced occupational asthma
have exhibited antibodies against antigenic sites resulting from the

glutaraldehyde-induced cross-linking of endogenous prOteins (Beach et al, 2000).

Serum lgE in LMW Chemical-induced Occupational Allergic Airway Disease

The development of new antigenic sites as a result of conjugation of a
chemical with human protein or endogenous protein cross-linkage may, in
susceptible individuals, result in the production of lgE antibodies to the site in the
same way as to large molecular weight substances, thus resulting in asthma
and/or allergic rhinitis. In general, however, only 20 % of the subjects with TDI-
induced occupational asthma demonstrate an increased level of serum TDI-
specific lgE antibodies (Tee et al, 1998). The classic atopic response to allergen
mediated by lgE antibodies (Type I hypersensitivity) accounts for only a small
proportion of the total cases of occupational asthma induced by isocyanates.
Similarly, lgE antibodies to acid anhydrides have been detected in individuals
with occupational asthma from these substances, and the presence of these
antibodies has been associated with the presence of disease (Beach et al, 2000).
But like TDI, the development of specific lgE antibodies to TMA is inconsistent.
In LMW chemical-induced allergic rhinitis, eliciting agents such as anhydrides,
metallic salts, and diisocyanates only occasionally have been shown to induce
lgE production (WHO, 1999). Thus, the available data suggest that an lgE-
mediated mechanism is not the predominant manner by which individuals

become sensitized to LMW chemicals. There is some controversy, however, in

19

 

II

at

the value of lgE levels due, as some investigators suggest, to the methods used
to detect the antibodies. Some groups have suggested that the methods used to
measure serum lgE were inadequate and that the used more optimal detection
methods to measure lgE levels will reveal a stronger association between IgE
and LMW chemical-induced allergic airway disease (Kimber and Dearman,
2002). In most of the assays used to detect serum lgE against specific chemical
allergens in humans or in animal models, the antigen substrate used is in the
form of a hapten-protein conjugate. The most prevalent protein used to prepare
such conjugates has been albumin (Kimber and Dearman, 2002). Tests for
specific lgE that make use of hapten-protein conjugates are likely to identify only
those patients in which binding to albumin has stimulated lgE production, not
those in which lgE may have been stimulated by other conjugates (Griffin et al,
2001). This may have led to the underestimation of lgE levels and possibly false
diagnosis. The recent development of an antibody specific for TMA and not a
particular conjugate by one group of investigators (Griffin et al, 2001) may help
clarify the role of lgE in LMW chemical-induced allergic airway disease.

Some individuals exposed to TDI or TMA develop specific lgG antibodies
(Beach et al, 2000). Less is known, however, about how the presence of lgG
antibodies is translated into symptomatic disease than is known about lgE-
mediated asthma and allergic rhinitis. It is also unclear whether a specific
subclass of lgG antibody is particularly relevant in the causation of asthma or

allergic minitis (Beach et al, 2000).

20

de
ch
if
3P

86

Oil

YE

air

as
as
me

Ch

Irritant Asthma as an Alternative Mechanism

A toxicologic mechanism exists apart from immune-mediated effects in
LMW chemical-induced asthma-like symptoms. Individuals exposed to high
concentrations of irritants may develop a syndrome known as Reactive Airways
Dysfunction Syndrome (RADS) (Beach et al, 2000). RADS or irritant asthma was
described in a number of reports following exposure to agents as diverse as
chlorine, glacial acetic acid, sulfuric acid, hydrochloric acid, perchloroethylene,
TDI, ethylene oxide and smoke (Beach et al, 2000). It is characterized by the
apparent lack of a period of significant symptom-free exposure during which
sensitization might occur, a relatively high level of exposure to the agent in
question, onset of symptoms within a few minutes or hours of exposure, and
ongoing symptoms and ainrvay hyperresponsiveness persisting for months or
years afterwards (Beach et al, 2000). Some of the pathologic features in the
airways Of patients with irritant-induced asthma include inflammation consisting
of lymphocytes, epithelial shedding, and subepithelial fibrosis, similar to immune-
mediated asthma (Beach et al, 2000). There is little evidence, however, of any
eosinophils in the ainrvays of patients with RADS (Beach et al, 2000). Although
there is considerable overlap in the clinical features of RADS and allergic
asthma, the mechanisms underlying RADS are less clearly understood than
asthma arising from immunologic mechanisms. The changes in cytokines that
may underlie this type of inflammatory response have not been fully
characterized (Beach et al, 2000). Data from the SWORD study in the United

Kingdom showed that less than 10 % of inhalation injuries that resulted from high

21

III

exposure to a chemical were followed by persistent asthma (Lombardo and
Balmes, 2000). The predominant mechanism of LMW chemical-induced allergic

ainrvay disease thus appears to be immunologic.

Th2 Cytoklnes in LMW Chemical-Induced Allergic Airway Disease

Despite the apparent irregularity in mechanism and presence of specific
antibodies, many lines of evidence implicate the T lymphocyte and specifically
the preferential expression of the Th2 phenotype in LMW chemical-induced
occupational asthma. For example, the production of lL-4 and lL-5 proteins was
increased in bronchial biopsies of patients with TDI-induced asthma (Maestrelli et
al, 1997). In addition, the selective enhancement of Th2 cytokines was detected
in several murine models of TMA-induced asthma (Betts et al, 2002; Dearman et
al, 2002; Vandebriel et al, 2000). One group reported that not only does
treatment with a LMW chemical allergen, i.e., hexamethylene diisocyanate (HDI),
lead to an enhancement of Th2 cytokines but that the HDI-induced ainrvay
inflammation in the lung was dependent on the presence of Th2 cytokines in a
murine model (Herrick et al, 2002). Stimulation of isolated lymph node cells in
culture in mice was uSed to demonstrate that the respiratory sensitizers TMA,
TDI and phthalic anhydride led to preferential Th2 induction indicated by
increased lL-4 expression, while the contact allergen dinitrochlorobenzene,
induced the expression of the Th1 cytokine, lFNq (Vanderbriel et al, 2000).
Dearman and colleagues demonstrated that TDI exposure induced high levels of

IL-4 and IL-10, but low levels of IFN- 7 in local draining lymph nodes (Dearman et

22

al, 1996). In another report, investigators distinguished five acid anhydrides as
respiratory sensitizers based on their capacity to induce Th2 cytokine secretion
(Dearman et al, 2000). Glutaraldehyde-stimulated’ lymph node cells also
displayed the Th2 pattern of cytokine secretion (Dearman et al, 1999).

There has been no report in the literature that has linked local Th2
cytokine gene expression in the nose with the induction of LMW chemical-
induced allergic rhinitis.

While in asthma caused by diisocyanates specific antibodies are unusual,
an increase in activated T lymphocytes, mast cells, and eosinophils has been
observed, Similar to the appearance in allergic asthma. An alternative
mechanism by which preferential Th2 expression may take place may involve the
interaction of the chemical with glutathione (GSH). In vitro studies have shown
that TDI avidly forms bis adducts with GSH and these adducts transfer
monoisocyanato-monoglutathionyl-TDI to a sulfhydryI-containing peptide (Lange
et al, 1999). This may lead to the depletion of GSH; recent evidence has
implicated a lowered cellular GSH content in promoting the Th2 phenotype that is
characteristic of allergy. Antigen presenting cells (APC) help regulate the
balance between Th1 and Th2 response patterns, e.g., APCs secrete lL-12,
which drives IFN-y production, and the Th2-associated cytokine lL-10 inhibits
APC lL-12 production and thereby drives IL-4 production (Peterson et al, 1998).
GSH-depletion is accompanied by a loss of lL-12 production, which leads to loss
of IFN-y production (Peterson et al, 1998). APC depleted of GSH, however, still

produce lL-4 similar to the levels of normal APC (Peterson et al, 1998). GSH-

23

depletion may thus be an additional mechanism by which LMW chemicals

preferentially induce the Th2 pattern of cytokine expression.

Need for an Animal Model of LMW Chemical-Induced Allergic Airway
Disease

Occupational asthma and allergic rhinitis due to exposure to LMW
chemicals are increasing in morbidity and associated with decreased worker
productivity and the loss of billions of dollars annually (Lombardo and Balmes,
2000). Knowledge of the potential of a chemical to sensitize the respiratory tract
will help to establish thresholds of exposure and/or permissible exposure limits.
There are currently fewer than 400 chemicals with known PELs for inhalation
exposure of the many thousands of chemicals used in industry (OSHA, 1993).
The identification of potential chemical allergens used in industry will also serve
to restrict their use. It may also enhance precautionary measures to limit
exposure to chemical allergens such as improved ventilation, the placement of
monitors to gauge the level of the chemical concentration in the air, and the use
of personal respirators. The need to further elucidate the mechanism(s) of LMW
chemical-induced allergic ainrvay disease and to develop a reliable method of
identifying chemicals that have the potential to elicit allergic airway disease in
humans, especially in the workplace, has led to the development of animal
models.

Many groups have attempted to model LMW chemical-induced allergic

airway disease in animals using guinea pigs, rats, or mice to further understand

24

the mechanism(s) of LMW chemical-induced allergic ainrvay disease and to
identify potential human allergens. These models have been used to
demonstrate the irritant/toxic and/or immunologic effects of LMW chemicals.
Murine models are increasing in popularity because of the advantages they offer
relative to other species including the availability of genetically manipulated
strains and a vast array of diagnostic reagents. Also, the allergen-induced
changes in murine airways are similar to the pathologic sequelae that take place
in the airways of sensitized individuals after allergen challenge (Gelfand, 2002).
Some murine models have induced several of the hallmark pathologic features of
LMW Chemical-induced allergic airway disease in the pulmonary ainrvays with
HDI (Herrick et al, 2002), TDI (Lee et al, 2002) and TMA (Regal et al, 2001).
Increased Th2 cytokines has also been demonstrated in murine models of
allergic ainrvay disease induced by TMA (Betts et al, 2002), HDI (Herrick et al,
2002), and TDI (Matheson et al, 2001). Still other murine models have
demonstrated elevated serum lgE levels with LMW chemical exposure in mice
(Ban and Hettich, 2001; Matheson et al, 2001; Scheerens et al, 1999)

Despite the multitude of murine models, there remains a lack of a well
validated and widely accepted animal model of LMW chemical-induced allergic
airway disease. The failure to establish such an animal model is due in part to
the variability across existing animal models in a number of respects including
the route of exposure, the endpoints that are analyzed, the tissues from which
the endpoints are measured, and whether it models irritant-induced asthma or

immune-mediated asthma.

25

IE

in

ma

ffor

aim
”IICI

flatu

A Comparison of the Routes of Exposure in Animal Models
Animal models differ, for example, in the route of exposure used to
sensitize the animals. Although inhalation is the mOst common and relevant
route of exposure to LMW chemicals, there is a growing belief that the dermal
route of exposure is sufficient to induce sensitization of the respiratory tract to
LMW chemicals. In fact, some animal models have been able to elicit some of
the characteristic features of LMW chemical-induced allergic airway disease
including ainrvay inflammation using dermal sensitization followed by intra-ainrvay
challenge (Herrick et al, 2002, Regal et al, 2002). However, a recent study
showed that dermal sensitization followed by infra-airway challenge w/ TMA in
rats resulted in a qualitatively different complement of immunocompetent cells in
BALF than intra-airway sensitization and challenge (Vohr et al, 2002). That is,
intra-airway induction followed by airway challenge with TMA caused an influx of
macrophages, granulocytes and dendritic cells into the lung that dermal
sensitization and intra-airway Challenge with TMA failed to do. This suggests
that the route of exposure influences the response within the respiratory tract and
raises the possibility that dermal exposure to LMW chemicals in animal models
may not adequately model human allergic ainrvay disease that results exclusively
from inhalation exposure to LMW chemicals.
The animal model described in this thesis project used a method of intra-
ainrvay administration, is. lntranasal instillation, to both sensitize and challenge
mice to LMW chemicals. lntranasal instillation more closely resembles the

natural route of exposure to airborne allergens than dermal application. It also

26

of

ad

I65
ITIC

of

AI

tiss
sur
Ser

I95

offers a number of advantages compared to other methods of intra-airway
administration, including aerosol exposure. Aerosolized LMW chemical exposure
in animal models requires aerosol generation devices and exposure chambers,
which are costly, complicated, and may pose a health risk to the person
conducting these exposures because of chemical leak (Ebino et al, 1999).
lntranasal instillation, in contrast, is a simple, inexpensive, safe and noninvasive
method of exposing both the upper and lower respiratory tract of laboratory
rodents to potential allergens. In addition, the urgent need to assess the
respiratory allergenicity of numerous chemicals necessitates that the animal
model rapidly and efficiently screen LMW chemicals. The ease and practicality

of intranasal instillation may facilitate such screening.

A Comparison of Endpoints Measured in Animal Models

Related to the route of exposure is the type of endpoint measured and the
tissue in which the endpoint is measured. Some animal models have
successfully distinguished known sensitizers of the respiratory tract from non-
sensitizers based upon the ability of the chemical to elicit a Th2 cytokine
response in lymph nodes draining the site of dermal application (Betts et al,
2002; Dearman et al, 2002). These studies usually only consist of an induction
phase and do not examine the respiratory tract to limit the time it takes to screen
a chemical. The aforementioned evidence that dermal sensitization elicits a
different pulmonary airway response than intra-airway sensitization suggests that

changes in lymph nodes draining the site of dermal application may not fully

27

represent changes that take place in the human respiratory tract after inhalation
exposure. In addition, although Th2 cytokine expression has been a valuable
endpoint in discriminating between sensitizers and non-sensitizers of the
respiratory tract, the site where these measurements are made may influence the
value and reliability of Th2 cytokine expression as a discriminator. In some
studies, Th2 cytokine expression in skin draining lymph nodes was used to
distinguish chemical respiratory allergens such as TMA from non-sensitizers of
the respiratory tract such as the contact sensitizer DNCB (Betts et al, 2002;
Dearman et al, 2002). This was based on the belief that contact sensitizers that
don’t sensitize the respiratory tract elicit an exclusive Th1 cytokine response in
the skin. However, recent studies have demonstrated that contact sensitizers
such as DNCB and OXAZ elicit Th2 cytokine increases in the skin and that this
increase may play a role in the hypersensitivity responses in the skin that they
induce (Urlich et al, 2001; Traidl et al, 1999). This suggests that Th2 cytokine
induction in the skin is not unique to respiratory sensitizers and diminishes its
value as a potential discriminator when such measurements are made in lymph
nodes draining the site of dermal application. Also, non-respiratory sensitizing
chemical contact allergens have never been shown to elicit a Th2 response in
the respiratory tract, unlike respiratory sensitizers. In addition, exposure to
contact allergens has never been linked to hypersensitivity-type responses in the
respiratory tract of humans and current murine models of airway exposure to
contact allergens have elicited only hypersensitivity reactions in pulmonary

airways that are not mediated by Th2 cytokines (van Houweligan et al, 2002;

28

Si:
88
35

the

Al

"Tit.
Che
I61“

Wit;

Kraneveld et al, 2002). It appears, therefore, that the tissue in which the cytokine
measurements are made is as relevant as the endpoint being measured when
attempting to distinguish sensitizers from non-sensitizers of the respiratory tract.
Measurements within the respiratory tract in an animal model may thus be a
more reliable indicator of human disease resulting from inhalation exposure than
similar measurements made in the skin. In the murine model of intranasal
sensitization and challenge to LMW chemicals described in this thesis project,
assessments were made of local Th2 and Th1 cytokine gene expression within

the nasal ainrvay and lungs.

A Comparison of Toxic and Immune Effects of Chemicals in Animal Models

Another concern of current murine models is that many do not distinguish
irritant effects of a LMW chemical from its immune effects. The dose of the LMW
chemical required to elicit allergic airway disease is known to be less than that
required to induce sensitization and is likely less than that required to elicit
irritation/toxicity of the respiratory tract (Beach et al, 2000). Only very low doses
of a chemical respiratory allergen are required for elicitation of allergic symptoms
in a sensitized individual. Many epidemiologic studies have found that most
individuals who developed asthma-like symptoms were exposed to low
concentrations of the chemical respiratory allergen and that irritant-induced
asthma due to exposure to high concentrations of the chemical represent only a
small minority of cases of LMW Chemical-induced asthma (Beach et al, 2000).

Despite such data, most experimental models of LMW chemical-induced allergic

29

airway challenge sensitized animals with high concentrations of the chemical
leading to the induction of both a toxic and an immune response within the
respiratory tract. They are thus modeling irritant-induCed and immune-mediated
mechanisms of asthma. The activation of both mechanisms simultaneously may
lead to the under or over-valuing of certain pathways when extrapolating to
human disease. Given that irritant-induced asthma and rhinitis account for only a
small percentage of all cases of occupational asthma and rhinitis, it seems
prudent that immune-mediated asthma and allergic rhinitis are more selectively
modeled in experimental conditions. In the murine model of LMW chemical-
induced allergic ainrvay disease described in this thesis project, pilot studies were
performed to select doses of the chemicals that did not cause irritation/toxicity
within the respiratory tract before sensitizing and challenging mice with a
particular chemical. This was done for the purpose of focusing on immune-

mediated mechanisms of LMW chemicals exclusively.

NJ Mouse Used to Model Human Allergic Airway Disease

Many different strains of mice have been used in murine models of LMW
chemical-induced allergic ainrvay disease. The most commonly used strain in
murine models is the BALB/c strain. The BALB/c strain is a high Th2-responding
strain making it very sensitive to aeroallergens and thus ideal for assessing the
allergenic effects of chemicals or proteins. NJ mice are similar to BALB/c mice
in that they are naturally high Th2 responders and weak Th1 responders (VVIIIS-

Karp and Ewart, 1997). Some have postulated that the high Th2 response and

30

weak Th1 response in NJ mice is due to a deficiency in complement component
5 (C5) (Jagganath et al, 2000). CS is required for macrophage-mediated killing
(Jagganath et al, 2000). NJ mice exposed to mycobacterium tuberculosis
(MTB), for example, demonstrate an enhanced growth of MTB accompanied by
reduced secretion of several cytokines including lL-12 in comparison to CS
competent strains (Jagganth et al, 2000). lL-12, secreted by antigen presenting
cells is required for differentiation of Th1 cells that in turn help orchestrate a cell-
mediated immune response to combat such infections (Peterson et al, 1998). C5
may be an important factor in the secretion of lL-12 from APCs and thus the Th1
response. This may partially explain why NJ mice have increased susceptibility
to MTB and Plasmodium infections and preferentially express the Th2
phenotype. In addition, Wills-Karp and Ewart, 1997, determined that the NJ
strain is genetically predisposed to ainrvay hyperresponsiveness. They also used
genetic linkage studies to map airway hyperresponsiveness genes to murine
chromosome 6 in the NJ strain. Th2 cytokines are linked to the pathogenesis of
airway hyperresponsiveness. The NJ strain may thus react strongly to
respiratory allergens and serve as a suitable model for determining whether or
not an agent elicits a Th2-mediated response. In a study by Tony Jan and
colleagues, 2003, in NJ mice, intraperitoneal sensitization followed by aerosol
Challenge with ovalbumin elicited many of the Characteristic pathologic and
immunologic features of allergic airway disease in humans. In the murine model

of LMW chemical-induced allergic ainrvay disease described in this thesis project,

31

NJ mice were selected to model human allergic airway disease due to LMW

chemical exposure.

Goals of the Dissertation

This dissertation project tests the overall hypothesis that local Th2
cytokine gene expression in the nasal and pulmonary ainrvays of the NJ mouse
is an accurate predictor of the potential of chemicals to elicit allergic airway
diseases such as occupational asthma and allergic rhinitis. In order to test this
hypothesis, my first objective, discussed in chapter 2, was to develop an animal
model of allergic airway disease using NJ mice that are sensitized and
challenged via intranasal instillation with the protein allergen ovalbumin in a
saline vehicle. Ovalbumin, known to elicit the hallmark features of allergic airway
disease in many experimental models, served as the model allergen. The
characteristic pathologic and immunologic profile of allergic ainIvay disease
elicited by ovalbumin was used as a ’positive control’ of allergic responses with
which to compare the effects of chemical respiratory sensitizers and non-
sensitizers in later studies. The primary endpoints included pathologic responses
within the respiratory tract and the assessment of serum lgE. In addition, an
assessment of lung-derived Th2 and Th1 cytokine mRNA expression was made.

Before assessing the effects of LMW chemicals, this animal model of
ovalbumin-induced allergic ainrvay disease was used to study the mechanisms of
allergic ainrvay disease by testing potential therapeutic agents for the purpose of

combating allergic airway disease. Cannabinol is a known inhibitor of Th2

32

cytokine production and may thus provide additional evidence in this model for
the link between Th2 cytokines and protein or chemical-induced allergic airway
disease. The second objective, discussed in chapter 3' tested the hypothesis that
cannabinol, a natural agent known for its immunosuppressive actions, will
suppress the pathologic, cytokine and serum lgE responses within the respiratory
tract that take place after intranasal sensitization and challenge with ovalbumin.
Cannabinol was administered by one of two routes, systemically or via the
ainrvays before and during intranasal sensitization and Challenge with ovalbumin.
The primary endpoints included pathologic responses within the respiratory tract
and the assessment of serum lgE. In addition, an assessment of lung-derived
Th2 and Th1 cytokine mRNA expression was made. This was done to examine
the utility of cannabinol as a potential therapeutic in allergic airway disease.

The third objective, discussed in chapter 4, tested the-hypothesis that
intranasal sensitization and challenge with the known low molecular weight
chemical allergen, toluene diisocyanate (TDI), in an ethyl acetate/olive oil vehicle
will elicit the characteristic pathologic and cytokine responses within the
respiratory tract of LMW chemical-induced allergic airway disease. TDI is a LMW
chemical known to elicit allergic responses of the respiratory tract. The goal was
to determine if TDI caused similar pathologic changes Characteristic of allergic
airway disease to ovalbumin and whether or not the pathologic changes were
accompanied by a local up-regulation of Th2 cytokines within the respiratory
tract. The primary endpoints included pathologic responses within the respiratory

tract and the assessment of serum lgE. In addition, an assessment of lung-

33

derived Th2 and Th1 cytokine mRNA expression was made. This study would
help determine if TDI sensitization and challenge in this model was associated
with the production of the Th2 pattern of cytokines speC'Ifically.

The fourth and final objective, discussed in chapter 5, tested the
hypothesis that intranasal sensitization and challenge with the known chemical
respiratory allergen, trimellitic anhydride (TMA), but not the non-respiratory
sensitizers, dinitrochlorobenzene (DNCB) and oxazolone (OXAZ), will induce the
characteristic features of LMWC-induced allergic ainNay disease in the nasal and
pulmonary airways. The comparison with known non-sensitizers of the
respiratory tract was done to determine if such agents will elicit similar responses
to the known respiratory allergens. The primary endpoints included pathologic
responses within the nasal and pulmonary ainrvays and the assessment of semm
lgE. In addition to the assessment of lung-derived Th2 and Th1 cytokine mRNA
expression, a similar assessment was made of tissue derived from the nasal
ainrvay in this study in mice treated with TMA. The absence of pathologic and
cytokine changes in the respiratory tract after intranasal sensitization and
challenge with known non-sensitizers will serve to validate this method as one
with the capacity to distinguish chemical respiratory sensitizers from non-
sensitizers based on their ability to elicit allergic airway pathology and enhanced

Th2 cytokine mRNA expression within the respiratory tract.

34

CHAPTER 2
IMMUNE RESPONSES IN THE LUNG AND LOCAL LYMPH NODE OF AIJ

MICE TO INTRANASAL SENSITIZATION AND CHALLENGE WITH
ADJUVANT-FREE OVALBUMIN

35

ABSTRACT

Pathologic features of lgE-mediated allergic airway diseases include
ainrvay infiltration of inflammatory cells (e.g., lymphocytes, plasma cells, and
eosinophils) and mucous cell metaplasia (MCM) in airway epithelium. CD4+ T
lymphocytes, specifically those producing a type 2 (Th2) cytokine profile, are
necessary for the induction of lgE-mediated allergic ainNay responses. Most
experimental models of lgE-mediated allergic airway disease use systemic (e.g.,
intraperitoneal) administration of an allergen coupled with an adjuvant to
sensitize animals. Cytokine changes are measured in a number of ways
including in bronchoalveolar lavage fluid (BALF) or lymph node cells stimulated
ex vivo. The primary objective of this study was to test the hypothesis that
intranasal sensitization and challenge of mice with ovalbumin in the absence of
an adjuvant will induce the pathologic features that are characteristic of lgE-
mediated allergic ainrvay disease. Another objective was to determine if
intranasal delivery of this allergen will result in the induction of a profile of
cytokine gene expression in the lung and tracheobronchial (TB) lymph node that
is typical of immunologic changes associated with lgE-mediated allergic airway
disease. Only mice that were intranasally sensitized and challenged with
ovalbumin had pulmonary lesions that included marked MCM in the respiratory
epithelium lining the nasal and pulmonary airways, and an associated mixed
inflammatory cell influx consisting of lymphocytes, plasma cells and eosinophils.
Ovalbumin-treated mice also had enhanced expression of the Th2 cytokine

mRNAs lL-4, IL-5, lL-10, and IL-13 in the lung and IL-4 in the TB lymph node,

36

and concurrent increases in ovalbumin-specific lgE in the serum. The results of
this study indicate that NJ mice intranasally instilled with ovalbumin without
adjuvant have the hallmark histopathologic and immunologic features of lgE-

mediated allergic airway disease of humans.

37

INTRODUCTION

Ovalbumin is a protein allergen widely used in experimental models of
lgE-mediated allergic ainIvay disease that use Systemic administration to
sensitize animals. Though it is well known that systemic ovalbumin sensitization
followed by intranasal challenge will induce features characteristic of lgE-
mediated allergic ainrvay disease, it is not Clear whether a similar response can
be induced by intranasal sensitization and challenge to ovalbumin. The impetus
for intranasal administration is that it more closely resembles the natural route of
exposure to airborne allergens, i.e., inhalation. It is also a simple, inexpensive,
and noninvasive method of exposing both the upper and lower respiratory tract of
laboratory rodents to allergens. Most experimental models also include an
adjuvant (e.g., alum) along with the allergen. Adjuvants, like alum, are not part of
the natural airborne exposure of allergens and may artificially influence Th1 or
Th2 responses in the animal. This is evidenced by the production of various
immunoglobulin subclasses that may skew the immune response
(Rajananthanan et al, 1999).

A large body of evidence supports the critical role of Th2 cytokines in the
development and maintenance of lgE-mediated allergic airway disease. For
example, interleukin-4 (IL-4) and IL-13 are required for B cells to undergo “class-
switching” (i.e., from lgM-producing to lgE-producing B cells) (Frew, 1996) and
the inhibition of lL-5 prevents antigen-induced airway eosinophilia and late-phase
hyperresponsiveness (Foster et al, 2000; Karras et al., 2000). Most experimental

models of lgE-mediated allergic ainrvay disease assess Changes in cytokine

38

expression by measuring the secreted product of stimulated local draining lymph
node cells or by analyzing bronchoalveolar lavage fluid (BALF) for protein or cell
associated mRNA expression. An alternative method, described in this report, is
the measurement of cytokine gene expression in RNA isolated from the lung
tissue or from a local draining lymph node.

The primary objective of this study was to determine if intranasal
sensitization and challenge of mice with ovalbumin without an adjuvant would
effectively sensitize the animals by inducing features characteristic of lgE-
mediated allergic ainrvay disease. The second objective of this study was to
assess the temporal changes in the expression of multiple cytokine genes in
RNA derived from lung tissue and its local draining lymph node using such an
exposure regimen. Allergen-induced changes in cytokine gene expression,
along with pulmonary and nasal histopathology, and serum lgE levels were
assessed in each mouse. This was done to examine the utility of measuring
local cytokine gene expression as a biomarker for screening potential respiratory

allergens.

39

MATERIALS AND METHODS
Animals and Allergen Sensitization and Challenge

Ninety male NJ mice (Jackson Laboratories, Bar Harbor, Maine), 6 weeks
of age, were randomly assigned to one of eighteen experimental groups (n=5).
Mice were free of pathogens and respiratory disease, and used in accordance
with guidelines set forth by the All University Committee on Animal Use and Care
at Michigan State University. Animals were housed five per cage in
polycarbonate boxes, on Cell-Sorb Plus bedding (A&W Products, Cincinnati, OH)
covered with filtered lids, and had free access to water and food. Room lights
were set on a 12 hr light/dark cycle beginning at 6:00 am, and temperature and
relative humidity were maintained between 21-24°C and 40-55 % humidity,
respectively. Figure 2.1 depicts the exposure regimen utilized for intranasal
sensitization and challenge of mice. The timeline of the exposure regimen used
is a modification of that used by Wills-Karp et al. (Wills-Karp et al, 1998) who
used systemic sensitization and intratracheal challenge.

Mice were anesthetized with 4% halothane and 96% oxygen.
Anesthetized mice were treated by intranasal instillation with 30 ul of 0.5%
ovalbumin (Sigma Chemical, St. Louis, MO) in sterile, pyrogen-free saline or 30
pl of saline alone divided evenly between each naris. The sensitization phase
consisted of a single instillation once per day for 5 consecutive days. The
animals were challenged once, 14 days after the fifth instillation of the

sensitization phase via a single instillation of the same volume and

40

Exposure Regimen

 

 

Days 1 - 5 Day 19 Day 29
1st 2nd
Sensitization Challenge Challenge
I i i i I i i
A
A A A A A I I A I I 1
24h 48h 24h 48h 96h

 

 

 

Figure 2.1: Timeline of the exposure regimen used to sensitize and challenge NJ
mice with ovalbumin or saline. Mice were sensitized with five consecutive daily
intranasal instillations of 30 pl of 0.5% ovalbumin in saline or saline alone. Mice
were then challenged two weeks later with a similar volume and sacrificed 24 or
48 hr after challenge or challenged a second time 10 days later followed by
sacrifice 24, 48, or 96 hr after double challenge. A = intranasal instillation of 30ul
of 0.5% ovalbumin in saline or saline alone. I = time after challenge when mice
were sacrificed.

41

concentration as the instillations during the sensitization phase. Mice were
sacrificed 24 or48 hr after challenge. There were three different treatment
groups for each sacrifice time. One was sensitized and challenged with saline
and a second group was sensitized with ovalbumin and challenged with saline.
The last group was sensitized and challenged with ovalbumin. Other mice
received a second challenge 10 days after the first challenge again with the
same volume and concentration as in the first challenge. These mice were
sacrificed 24, 48, or 96 hr after the final challenge. There were four different
treatment groups for each sacrifice time: 1) sensitization and Challenge with
saline, 2) sensitization with ovalbumin and challenge with saline; 3) sensitization
with saline and first challenge with saline and second Challenge with ovalbumin;

and 4) both sensitization and challenge with ovalbumin.

Necropsy, Blood Sample Collection, and Tissue Preparation

Before sacrifice, mice were deeply anesthetized via intraperitoneal
injection of 0.1 ml of 12% pentobarbital in saline. Blood samples (0.1 to 0.5 ml)
were taken from the brachial artery and collected in Beckton Dickinson
vacutainers. Serum samples were collected after the blood samples were
centrifuged to remove cells and the supematants were frozen and stored at -
20°C. The abdominal aorta and renal artery were then severed to exsanguinate
the animals. Immediately after death, the trachea was cannulated and the
heart/lung block removed. The tracheobronchial (TB) lymph node was removed

and placed in 1 ml Tri reagent (Molecular Research Center, Cincinnati, OH).

42

Lymph nodes were pooled 2 or 3 per 1 ml Tri reagent within each group. The
lymph nodes were then homogenized and stored at -80°C. The right bronchus
was clamped using suture thread. Caudal and medial right lung lobes were
placed in 2 ml Tri reagent, homogenized and stored at -80°C.

After removal of the right lung lobes, the left lung lobe was intratracheally
perfused with 10% neutral buffered formalin at a constant pressure of 30 cm of
fixative. After 1 hr, the trachea was ligated, and the inflated left lung lobe was
immersed in a large volume of the same fixative for 24 hr. After fixation, the left
lung lobe was microdissected along the main axial airway, and two sections were
then excised at the level of the fifth (proximal) and eleventh (distal) airway
generation (Figure 2.2), as has been described previously in detail (Steiger et al,
1995). Paraffin sections (5 pm) were stained with Alcian blue (pH 2.5) and
periodic acid Schiff’s (AB/PAS) reagent, which stain neutral and acidic
mucosubstances, respectively. Other paraffin sections were stained separately
for eosinophilic major basic protein (MBP, described below).

The head of each mouse was removed from the carcass, and the lower
jaw and skin were removed. The heads were then immersed in 10% neutral
buffered formalin for 24 hr. After fixation, the heads were decalcified in 13%
formic acid for 7 days and then rinsed in tap water for at least 4 hr. The nasal
cavity of each mouse was transversely sectioned at three specific anatomic
locations according to a modified method of Young, 1981, and processed for light
microscopy and image analysis. The most proximal nasal section was taken

immediately posterior to the upper incisor teeth (proximal); the middle section

43

 
 

' " 3’) a“, _

 

I . Proximal nasal airway

 

2. Middle nasal airway

 

3. Distal nasal airway

”may“.

4. Proximal axial airway

5. Distal axial airway

“m.

   
  

\ .

Hem -"* I". Left Lung Lobe

Figure 2.2: Sites of ainrvay tissue selection for morphometric analysis. The
cartoon depicts the lateral wall of one nasal passage with the septum removed of
the murine respiratory tract and the main axial ainrvay of the left lung lobe.
Transverse sections of the nasal cavity were taken 1) immediately posterior to
the upper incisor teeth (proximal), 2) at the level of the incisive papilla of the hard
palate (middle), and 3) at the level of the second palatal ridge (distal). The left
lung lobe was microdissected along the axial ainrvays, and two sections were
then excised at the level of the fifth (proximal airway) and eleventh (distal ainrvay)

ainrvay generation.

44

was taken at the level of the incisive papilla of the hard palate (middle); the most
distal nasal section was taken at the level of the second palatal ridge (distal)
(Figure 2). Tissue sections were embedded in paraffin, at a thickness of 5
microns, and stained with hematoxylin and eosin for histopathologic assessment.
Paraffin sections were also stained with AB/PAS to identify intraepithelial

mucosubstances (IM).

lmmunocytochemistry in the Lung

Unstained hydrated paraffin sections of the left lung lobe were incubated
with the blocking solution, Vectastain ABC-AP Kit Normal Goat Serum (Vector,
Burlingame, CA). The sections were then incubated with a polyclonal rabbit anti-
mouse antibody against eosinophilic MBP generously provided by Drs. Borchers
and Lee of the Mayo Clinic of Scottsdale (Scottsdale, Arizona). ‘ Treatment with
.the secondary antibody Vectastain ABC-AP Kit Anti-rabbit IgG followed. Some
slides were incubated without the secondary antibody to check for nonspecific
binding. lmmunoreactive MBP was visualized after treatment with the Vectastain
ABC-AP Complex followed by the Vector Red AP Substrate Solution (Denzeler et
al, 2000). Nasal tissue sections which contained turbinate bone with bone
marrow were also stained for MBP. Eosinophils and their cellular precursors
within the bone marrow served as positive controls for the MBP

immunohistochemistry.

45

Morphometry of stored intraepithelial mucosubstances in nasal and pulmonary
airways.

The amount of stored mucosubstances in the respiratory epithelium lining
the nasopharyngeal meatus in the most distal nasal section and the respiratory
epithelium lining the axial pulmonary airway (airway generation 5) in the left lung
lobe was estimated by quantifying the volume density of AB/PAS-stained
mucosubstances using computerized image analysis and standard morphometric
techniques. The area of AB/PAS-stained mucosubstances was calculated by
circumscribing the perimeter of the stained material using the Scion Image
program (Scion Corporation, Frederick, MD). The length of the basal lamina
underlying the surface epithelium was calculated from the contour length of the
digitized image of the basal lamina. The volume of stored mucosubstances
(volume density, Vs) per unit of surface area was estimated using the method
described in detail by Harkema et al, 1987, and was expressed as nl of IM per

square mm of basal lamina.

Epithelial and Inflammatory Cell Densities.

Numeric cell density of the surface epithelium lining the proximal axial
ainrvay (fifth generation) was determined by counting the total number of
epithelial cell nuclei in the surface epithelium and dividing by the length of the
underlying basal lamina. The length of the basal lamina was determined as
described above. Mucous cell density was also expressed as the number of

cells per mm of basal lamina. Eosinophil influx was measured by dividing the

46

total number of eosinophils in the subepithelial interstitium of the airway wall by
the length of the corresponding basal lamina. EosinOphils were identified by their
morphologic features (i.e., slightly larger than neutrophils with bilobed nuclei) and
by the positive immunohistochemical staining for MBP in the large cytoplasmic

granules (dark pink-red granules).

ELISA for Total and Ovalbumin-specific serum lgE

Total serum lgE was measured using a 96-well lmmulon ELISA plate
(Dynex, Technologies, Chantilly, Virginia) coated with 2 pg/ml anti-mouse lgE
(Purified Rat Anti-Mouse lgE Monoclonal Ab, Pharmingen, San Diego, CA) and
incubated overnight at 4°C. For measurement of ovalbumin-specific lgE, a
second ELISA plate was coated with 0.5% ovalbumin and incubated overnight at
4°C. After washing, the plates were incubated in 3 % Bovine Serum Albumin (3
% BSA) at 37°C for 1 hr. (BSA, CALBIOCHEM, La Jolla, CA). Serum samples at
1:10 dilution were then added followed by incubation at 37°C for 1 hr. After
washing, biotinylated anti-mouse lgE (Biotin-conjugated Rat Anti-Mouse lgE
Monoclonal Ab, Pharmingen, San Diego, CA) was then added at 2 pg/ml and
allowed to incubate at 25°C for 1 hr. After washing, 1.5 ug/ml of streptavidin
peroxidase was added followed by incubation at 25°C for 1 hr. After washing,
TMB substrate (12.5ml citric-phosphate buffer + 200 pl of TMB stock solution
(6mglml in DMSO)) was added to produce a color reaction. The reaction was

terminated by the addition of 6 N H2SO4_ Optical density was determined at 450

47

nm using an EL-808 microplate reader (Bio-Tek instruments, Winooski,

Vermont).

The RNase Protection Assay

Total RNA was isolated from lung tissues and the TB lymph node using
the TRI REAGENT method (Molecular Research Center, Cincinnati, OH)
following the manufacturer’s protocol and the integrity of the RNA was checked
by performing an ethidium bromide diagnostic gel to Check for degradation of
RNA. The mCK-1 Rionuant Mouse Cytokine MUIti-Probe Template Set
(Pharmingen, San Diego, CA) was used to assay mRNA expressions of IL-4, IL-
5, lL-10, IL-13, lL-15, lL-9, lL-2, lL-6, and IFN-y. The housekeeping genes L32
and GAPDH are included as loading controls. The probes were generated by
transcribing with T7 RNA polymerase in the presence of [or-32F] UTP (3000
Cmeol). The probe set was hybridized in excess to RNA isolated from the right
lung lobe (50 pg) or from the TB lymph node (75 pg) (56°C for 16 hr). Free
probe and non-hybridized RNA was then digested with single-stranded RNases
using the Rionuant RNase Protection Assay (RPA) Kit. The remaining RNase-
protected probes (only those that have hybridized to target tissue—derived mRNA)
were resolved by electrophoresis (3500 V for 1 h) through a 7M urea - 7%
acrylamide gel. The gel was dried and specific RNAs were visualized by

autoradiography.

48

Preparation of internal standard for IL-4 quantitative RT-PCR.

A recombinant internal standard (IS) was prepared to quantify lL-4 mRNA
expression by quantitative/competitive reverse transCriptase polymerase chain
reaction (RT-PCR) as previously described (Condie et al, 1996). Briefly, an
artificial/recombinant RNA (rcRNA) was used as an IS containing Specific PCR
primer sequences for lL-4 that were added to RNA samples in a series of
dilutions. A rat B-globin sequence was used as the spacer gene for the IL-4 IS.
This method, developed by Vanden Heuvel et al, 1993, avoids sample-to-sample
variation of reference gene expression (e.g., B-actin) as well as gene-to—gene
differences in amplification efficiency. The IL-4 forward and reverse primer
sequences were 5’ AAC GAG GTC ACA GGA GAA G 3’ and 5’ GCT TAT CGA
TGA ATC CAG GC 3', respectively. The following was the IS forward primer
design from 5’ to 3’: T7 promoter (TAATACGACTCACTATAGG), IL-4 fonrvard
primer (as above), and rat B-globin forward primer
(AAGCCTGATGCTGTAGAGCC). The IS reverse primer design from 5’ to 3’
was: (dTIIS . IL-4 reverse primer (as above), and rat B-globin reverse primer
(AACCTGGATACCAACCTGCC). PCR reaction conditions were performed
using 100 ng of rat tailed-genomic DNA. PCR-amplified products were purified
using the Wizard PCR Prep DNA Purification System (Promega, Madison, WI)
and transcribed into RNA using Promega’s Gemini II In vitro Transcription
System. The rcRNA was subsequently treated with RNase-free DNase to
remove the DNA template. After quantifying, calculations were made to

determine the number of molecules/pl of IL-4 IS.

49

Quantitative IL-4 RT-PCR.

Quantitative RT-PCR was performed as described by Gilliland et al, 1990,
except that rcRNA was used as an IS instead of genomic DNA with 10 aliquots of
rcRNA from 104 to 108 molecules. Briefly, total RNA (right lung lobe or TB lymph
node) and IS rcRNA of known amounts were reverse transcribed into cDNA
using oligo(dT)15 as primers using reverse transcriptase (RT) (Promega, Madison
WI). To ensure that there was no genomic DNA contamination in the RNA
isolates, no-RT controls were employed for all samples. A PCR master mixture
consisting of PCR buffer, 4 mM MgClz, 6 pmol each of IL-4 forward and reverse
primers, and 2.5 U of Taq DNA polymerase was added to the cDNA samples.
Samples were then heated to 94°C for 3 min and cycled 40 times at (1) 95°C (30
sec), (2) 58°C (30 sec), and (3) 72°C (45 sec). After the completion of 40 cycles,
a final elongation step at 72°C (5 min) was carried out. PCR products were
resolved by electrophoresis in 3% NUSieve 3:1 gel (FMC Bioproducts, Rockland
ME) and visualized by ethidium bromide staining. The IL-4 primers produced a
228 bp product from the cellular RNA and a 346 bp product from the IS rcRNA.
Quantification was performed using Gel Doc 1000 (BioRad Laboratories, Inc.,
Hercules, CA) and Multi Analyst Software. The amount of lL-4 mRNA present
was determined as described by Gilliland et al, 1990. Briefly, the ratio of the
density of the IS rcRNA to lL-4 mRNA was plotted against the amount of IS
rcRNA (in molecules) added to each reaction. The point at which the ratio of IS
(rcRNA) to lL-4 mRNA was equal to 1 signified the “cross-over point” which

represented the amount of lL-4 molecules present in the initial RNA sample.

50

Statistics

The data obtained from each experimental group were expressed as a
mean group value i the standard error of the mean (SEM). The differences
among groups were determined by one way or two-way analysis of variance
(ANOVA) and an All Pairwise Comparison Test (T Ukey), using SigmaStat

software from Jandel Scientific Co. (San Rafael, CA).

51

RESULTS

Pulmonary Histopatholog y

The exposure regimen used to sensitize and challenge mice with
ovalbumin resulted in distinct pulmonary lesions that were restricted to mice that
were intranasally sensitized and challenged with ovalbumin. The principal
morphologic alterations in the lungs of these mice were marked MCM in the
surface epithelium lining the conducting ainrvays and an associated mixed
inflammatory cell influx consisting of eosinophils and mononuclear cells (mainly
lymphocytes and plasma cells) in the interstitial tissue surrounding the ainrvays
(Figure 2.3). Airway lesions were more severe in the main axial ainrvays and
pre-terminal bronchioles, but were also present to a lesser degree in the terminal
bronchioles. The interstitial tissue surrounding large blood vessels in the alveolar
parenchyma (pulmonary veins) and along the conducting airways (pulmonary
arteries) exhibited a similar inflammatory response. Ovalbumin-sensitized mice
that received two intranasal challenges of ovalbumin had more severe ainrvay
epithelial and inflammatory lesions than ovalbumin-sensitized mice that received
only one intranasal challenge of ovalbumin. The inflammatory responses in all of
these mice were principally present in the pulmonary ainrvays and large vessels
of the lung. No significant ovalbumin-induced inflammatory responses were
evident in the alveolar parenchyma.

Treatment-associated changes were absent in the lungs of the control

mice that received intranasal sensitization and challenges of saline. The only

52

 

Figure 2.3: Light photomicrographs of conducting airways of the left lung from
mice intranasally sensitized and challenged twice with saline (A, B) or 0.5%
ovalbumin (C, D) and sacrificed 96 hr after challenge. Tissues were stained with
hematoxylin and eosin (A, C) for morphological assessment and Alcian plue (pH
= 2.5)/periodic acid Schift’s sequence (AB/PAS) for mucosubstances in the
ainNay epithelium (B, D). Numerous mucous cells (arrow) with ABIPAS-stained
mucosubstances are present only in the ainrvay epithelium (e) of the ovalbumin-
sensitized and challenged mouse (C, D). A marked inflammatory cell influx
consisting primarily of lymphocytes, plasma cells and eosinophils is also present
in the interstitial tissue surrounding the airway of this mouse (C). v = blood
vessel; L = airway lumen; Bars = 50 microns.

53

IE

int
or
se
ch
he

he
8.":

Ilia

U

histologic change in the ainrvays of mice that were sensitized with ovalbumin and
received saline during the Challenge phase was a minimal MCM limited to the
proximal axial airways. This airway epithelial change was more conspicuous in
mice that received two saline challenges rather than one saline challenge. No
ainrvay inflammation was associated with this minimal epithelial change.

The effect of the sensitization phase was examined by sacrificing mice
after the sensitization phase alone. Five consecutive one-day instillations of
ovalbumin caused a small increase in IM with no accompanying airway
inflammation as assessed on Day 6, indicating that the animals developed the

described Changes only after Challenge.

Stored Intraepithelial Mucosubstances in Pulmonary Ainrvays

The amount of AB/PAS-stained IM in the epithelium lining the main axial
airway at the fifth (proximal ainrvay) and eleventh generations (distal ainrvay)
increased most in mice that were intranasally sensitized and challenged with
ovalbumin (Figure 2.4). Mice that were instilled with saline during the
sensitization phase and for the first challenge and with ovalbumin for the second
challenge exhibited a 10-fold increase in IM at the fifth generation. This increase,
however, was markedly lower than that exhibited by the lungs of mice that were
sensitized and challenged with ovalbumin. The mice had a 42-fold increase in
the amount of IM compared to the saline-instilled controls. It is notable that
although a single ovalbumin challenge was sufficient to induce a significant

increase in IM in ovalbumin-sensitized mice, two ovalbumin challenges resulted

54

 

*0

7‘ _GS
—G11

 

 

 

Mucous Vs (nllmm2 basal lamina)

     

 

. 1
. t

5 day Seneltlzatlon: Saline Ovalbumin Ovalbumin Saline Ovalbumin Saline Ovalbumin

 

l l I l I l I
First Challenge: Saline Saline Ovalbumin Saline Saline Saline Ovalbumin
I I I l
Second Challenge: Saline Saline Ovalbumin Ovalbumin

 

 

48 h after single challenge 96 h after double challenge

Figure 2.4: Morphometric quantification of AB/PAS-stained material in the
surface epithelium lining mouse pulmonary ainrvays at generations 5 (proximal)
and 11 (distal)) 48 hr after single challenge or 96 hr after double challenge with
ovalbumin. Mice were sensitized with five consecutive daily intranasal
instillations of 30pl of 0.5% ovalbumin in saline or saline alone. Mice were then
challenged two weeks later with a similar volume and sacrificed 48 hr after
challenge or challenged a second time 10 days later followed by sacrifice 96 h
after double challenge. Bars represent the Volume Density (Vs) of intraepithelial
mucosubstances :1: standard error of the mean ( n = 5/ group). * = significantly
greater than groups challenged similarly (p<0.05). # = significantly greater than
groups instilled with saline at same ainrvay generation (p<0.05). @ = significantly
greater than similar group challenged once (p<0.05).

55

in a doubling of the amount of IM as compared to the lungs of mice that received
a single challenge (Figure 2.4). Also, the increase in IM was greater in the axial
ainrvay at the fifth generation (proximal ainrvay) than at the eleventh generation

(distal ainrvay).

Numeric Cell Densities of Epithelial Cells in Pulmonary Ainrvays

A morphometric analysis of the surface epithelium lining the proximal axial
airway was performed in mice that were sensitized and challenged twice to
estimate the metaplastic transformation of epithelial cells from non-secretory to
mucus-secreting goblet cells (Figure 2.5). A 28-fold increase in mucous cell
density was observed in mice that received ovalbumin during both sensitization
and challenge phases as compared to the Saline-only control group. No effect
was observed in mice that received ovalbumin only during the sensitization
phase or only as the second challenge. It is also notable that there was no
evidence of hyperplasia in the main axial airway of the left lung lobe in any of the
treatment groups as evidenced by the absence of changes in total epithelial cell

density between the various treatment groups.

Pulmonary Airway Eosinophilia

As described above, recruitment of inflammatory cells, specifically
eosinophils, into and around subepithelial ainrvay tissues is a hallmark of the
allergen-induced ainrvay response. Eosinophils per mm basal lamina were

enumerated in the interstitium of the fifth (proximal) and eleventh generation

56

2n

Bars

 

 

 

 

 

 

 

 

120 w
- mucous cells
C: epithelial cells
(0 100 -
.E
E ~1—
3 so - , .
_ . (L ‘3‘:- _;- , ‘
g ;-‘ if}; ’ i j
8 so a I": " T
E [in ’ g -‘
B ~91 *9
0 2° ‘ “3:23: 1
..':"-::~~ g9; .
. 5 ‘.'. T ~ .
o I-._ r
Sensitization Saline Ovalbumln Sallne Ovalbumln
I I l l
1st Challenge Saline Saline Saline Ovalbumln
l l l
2nd Challenge Saline Saline Ovalbumln Ovalbumln

Figure 2.5: Quantification of mucous and epithelial (total) cell density in the
surface epithelium lining mouse pulmonary ainrvays (generation 5) 96 hr after
double challenge with ovalbumin. Mice were sensitized with five consecutive
daily intranasal instillations of 30pl of 0.5% ovalbumin in saline or saline alone.
Mice were then challenged two weeks later with a similar volume and challenged
a second time 10 days later followed by sacrifice 96 hr after double challenge.
Bars represent the number of cells per mm basal lamina 1 standard error of the
mean (n = 5/group). * = significantly greater than all other groups of this cell type
(p<0.05).

N.

0).

int

SL

int

(distal) axial airway of mice that were sensitized and then challenged twice with
either saline or ovalbumin. Mice that were sensitized and challenged with
ovalbumin showed a 27-fold and 24-fold increase in the number of eosinophils
present in the proximal (generation 5) and distal (generation 11) axial airways of

the lung lobe, respectively, as compared to the saline controls (Figure 2.6).

Nasal Histopathology

The exposure regimen used to sensitize and challenge mice with
ovalbumin resulted in distinct nasal lesions that were restricted to mice that were
intranasally sensitized and challenged with ovalbumin. The principal
morphologic alterations in the nasal airways of these mice were MCM in the
surface epithelium lining the nasal pharyngeal meatus and an associated mild
inflammatory cell influx consisting of eosinophils, lymphocytes and plasma cells

in the interstitial tissue surrounding the ainrvays (Figure 2.7).

Stored Intraepithelial Mucosubstances in Nasal Aimays

The amount of IM in the ainIvay epithelium lining the nasopharyngeal meatus was
also estimated using image analysis and standard morphometric techniques.
Ovalbumin sensitization and challenge resulted in an increase in the amount of
IM in the respiratory epithelium that lines the nasopharyngeal meatus as

compared to the saline controls (Figure 2.8).

58

()1

(I)

 

 

 

 

 

   

 

30 -
(I
5 ’5 ‘ — GS
E 8:53 G11
3
'6 20:
In
a
.9
E 15 -
.E
D
'5. 1o-
0
.E
m
If, s.
o _ . - .. .
5 day Sensitization: Saline Ovalbumin Saline Ovalbumin
I l l I
First Challenge: Saline Saline Saline Ovalbumin
l I l I
Second Challenge: Saline Saline Ovalbumin Ovalbumin

Figure 2.6: Morphometric quantification of eosinophils immunohistochemically
stained for major basic protein in mouse airway interstitium (generations 5 and
11) 96 hr after double challenge with ovalbumin. Mice were sensitized with five
consecutive daily intranasal instillations of 30pl of 0.5% ovalbumin in saline or
saline alone. Mice were then challenged two weeks later with a similar volume
and challenged a second time 10 days later followed by sacrifice 96 hr after
double challenge. Bars represent the number of eosinophils per mm basal
lamina 1: standard error of the mean (n = 4/ group). * = significantly greater than
all groups at similar ainrvay region (p<0.05).

59

 

Figure 2.7: Light photomicrographs of the distal region of the nasal cavity at the
level of the second palatal ridge of mice 96 hr after sensitization and two
challenges with saline (left panels) or ovalbumin (right panels). Tissue sections
were histochemically stained with ABIPAS for identification of stored
mucosubstances (arrows) in the epithelium lining the nasopharyngeal meatus.
The lower panels are enlargements of the boxed regions in the panels shown
above. S -— nasal septum, HP— hard palate, LW - lateral wall, a - respiratory
epithelium.

 

 

InI

TB

Serum lgE

None of the treatment groups resulted in a significant increase in serum
levels of total lgE (Figure 2.9). Conversely, mice sensitized and challenged with
ovalbumin exhibited a marked increase, Le, a 10-fold increase in ovalbumin-
specific serum lgE as compared to saline only controls (Figure 9). Mice that
received only ovalbumin sensitizations or only an ovalbumin challenge did not

exhibit significant increases in ovalbumin-specific serum lgE.

Cytokine Gene Expression

RNase Protection Assay. Mice that were intranasally sensitized and
challenged twice with ovalbumin exhibited an increase in the expression of the
Th2 cytokine mRNAs lL-4, lL-5, and lL-13, and the cytokine mRNA of IL-10 in the
lung that, with time after challenge, decreased in magnitude as evidenced by less
intense bands (Figure 2.10, lanes 6, 10 and 14). The saline controls exhibited no
such increase in Th2 cytokine mRNA expression (Figure 2.10, lanes 3-5, 7-9 and
11-13). It is notable that IL-15 and lL-9 mRNA and the Th1 cytokine mRNA IFN-y
were constitutively expressed and that neither ovalbumin nor saline treatments
influenced the expression of these cytokine mRNAs in the lung tissue.

There were no differences in cytokine mRNA expression in RNA from the

TB lymph node as detected using the RPA (data not shown).

61

 

Fig
SUII
cha
Iwic
Inlre

 

 

  

 

 

 

 

 

 

 

 

7g *
-- T
E 4 _
re
Tu
m
err
.o 3 -
N
E
E I
5 2 " 3. .5.-3, c
U) m: "4.. f 5
> -.
a, . Fray“ ‘ ‘ -:
3 «53.. -.
o 1 - "is: ”'
0 5' :-
3 “If , . ..f— 3
E r "" ...... 1.1.-
0 _ ’ LII: L.
5 day Sensitizatlon Saline Ovalbumln Saline Ovalbumln
l l |
First Challenge saline Saline Saline Ovalbumln
l I I
Second Challenge Sallne Saline Ovalbumln Ovalbumln

Figure 2.8: Morphometric quantification of ABIPAS-stained material in the
surface epithelium lining the nasopharyngeal meatus of mice 96 hr after double
challenge with ovalbumin or saline. Mice were sensitized and then challenged
twice with ovalbumin or saline. Bars represent the volumetric density (Vs) of
intraepithelial mucosubstances +/- the standard error of the mean (n = 5/group).
" - significantly greater than all other groups (p<0.05).

62

Ovalbumin-specific lgE

0.14 1

~——Iar-

0.12 1

 

0.10 a

0.08 a

0.06 ‘

Optical Density

0.04 4

0.02 '-

      
     

. .
’h ‘5‘. '1 . -

h. i-‘
r _.

 

 

 

0. . . . ._
5 day Sensltlzatlon: Saline Ovalbumin Saline Ovalbumln
l l I I
First Challenge: Saline Saline Saline Ovalbumin
l l I 1
Second Challenge: Saline Saline Ovalbumln Ovalbumln

 

 

Total lgE

0.08 1 --

 

0.00 't

 

Optical Density

0.04 -

 

0.02 i

  

‘l
- a.

4 .‘r. ‘-
0.” » ‘ _~' ‘
I \I ‘c
.‘gugt .‘f.
’70..“'.‘

ks

p“ ‘ 0 .ar "
11:95.1 hf}?-

l .' I - I. - \I'

 

 

 

 

 

 

5 day Senslt?i£goh: Saline Ovalbumin Saline Ovalbumin
l I I I

First Challenge: Saline Saline Saline Ovalbumln
| I I I

Second Chan-nee: Saline Saline Ovalbumln Ovalbumln

Figure 2.9: Ovalbumin-specific (upper panel) and Total lgE (lower panel) levels in
mouse serum isolated 96 h after double challenge with ovalbumin. Mice were
sensitized with five consecutive daily intranasal instillations of 30pl of 0.5%
ovalbumin in saline or saline alone. Mice were then challenged two weeks later
with a similar volume and challenged a second time 10 days later followed by
sacrifice 96 hr after double challenge. Bars represent average optical density i
standard error of the mean (n = 5/group). * = significantly greater than all other
groups.

63

 

Flgul
eprr
cram.
with

Instill;
Were

cIIaIIe.
2, Its
comma
their Q
Small 5
double

Challen:

animals

 

    

24hr 48hr 96hr
If I r I F _ I
SensifilafiOIHSSOOSSOOSSOO
lstChallenge: S S S O S S S O S S S O
2ndChallenge:SOSOSOSOSOSOV
"f4, ' ~ .. x g «I .. - -.; <IL-4
lL-5>
IL-lO» <IL-5
11,13» <IL-10
rL-lsr ‘11-‘13
IL-9> <IL-15
IL-ZV <[L-9
IL-ti>

123456 7891011121314

Figure 2.10: Autoradiograph of electrophoretic gel depicting cytokine mRNA
expression from RNase Protection Assay performed using RNA Isolated from the
cranial and medial right lung lobes of mice 24, 48, or 96 hr after double challenge
with ovalbumin. Mice were sensitized with five consecutive daily intranasal
instillations of 30p| of 0.5% ovalbumin in saline (0) or saline alone (S). Mice
were then challenged two weeks later with a similar volume and challenged a
second time 10 days later followed by sacrifice 24, 48, or 96 hr after double
challenge. Lane 1 = undigested probes for lL-4, lL-5, IL-10, lL-13, lL-15, lL-9, IL-
2, lL-6, INF-y, and the house keeping genes L32 and GAPDH. Lane 2 = mouse
control RNA IL-4, lL-10, lL-2, IFN-y, L32, and GAPDH that each hybridized with
their corresponding probe followed by digestion with RNase thus resulting in the
small shift in migration. Lanes 3 - 6 = RNA from animals sacrificed 24 hr after
double challenge. Lanes 7 - 10 = RNA from animals sacrificed 48 hr after double
challenge. Lanes 11 - 14 = RNA from animals sacrificed 96 hr after double
challenge. The last lane of each time-point (6, 10, and 14) depicts RNA from
animals that were sensitized and challenged with ovalbumin.

MB. After establishing the profile of Th2 cytokine mRNAs that were
expressed using the RPA, RT-PCR was performed on right lung lobe RNA from
mice that were sensitized and then challenged once or twice with either
ovalbumin or saline. This was done to determine the quantitative differences in
the expression of the critical Th2 cytokine mRNA lL-4. Mice that were sensitized
and then challenged once with ovalbumin exhibited an approximate 5-fold
increase in lL-4 mRNA expression 24 hr after challenge as compared to the
saline-instilled controls (Figure 2.11). The magnitude of this increase persisted
at that level for at least 48 hr after single challenge. Ovalbumin-sensitized mice
that received two ovalbumin challenges exhibited an approximate 40-fold
increase in IL-4 mRNA expression 24 hr after the second challenge as compared
to controls (Figure 2.12). IL-4 mRNA levels after double challenge were similar
48 hr after exposure but waned in magnitude by 96 hr post exposure, i.e., lL-4
mRNA levels decreased to approximately 16-times those of the saline controls.
Mice that received only ovalbumin sensitizations or only an ovalbumin challenge
did not exhibit significant increases in IL-4 mRNA expression in the lung.

lL-4 RT-PCR was also performed on RNA isolated from the TB lymph
node from mice that were sensitized and then challenged twice with ovalbumin.
Ovalbumin-sensitized and challenged mice exhibited a 4-fold increase in lL-4
mRNA expression at 24 hr after challenge compared to saline controls that

persisted at that level at least until 96 hr (Figure 2.13).

65

1.8045 1

 

1.6e+5 4 - 24"

 

 

 

1.4e+5 .
1.2e+5 ~
1.0e+5 1
8.0e+4 .
6.0e+4 -

4.0044 4

     

      

lL-4 mRNA (Molecules lL-4 mRNAI100ng Total RNA)

 

' .' -~.'
- ' ml,
«aamr..

0.0 _ “_ ., ._ . . _ ._ ~.

5 day Sensitization: SaIIIne Ovalbumin Ovalbumin
l I

First Challenge: Saline Saline Ovalbumin

Figure 2.11: Quantification of IL-4 mRNA in cranial and medial right lung lobes 24
or 48 hr after single challenge with ovalbumin using RT-PCR. Mice were
sensitized with five consecutive daily intranasal instillations of 30pl of 0.5%
ovalbumin in saline or saline alone. Mice were then challenged two weeks later
with a similar volume and sacrificed 24 or 48 hr after challenge. Bars represent
molecules of lL-4 mRNA per 100 ng of total RNA isolated i standard error of the
mean (n = Slgroup). * = significantly greater than all other groups at similar time-
point (p<0.05).

66

F“

1M

1.2“ 1

 

-24h
63.34811
”0*“: — 96h

 

 

 

4.0.05 *

lL-4 mRNA (Molecules/100 ng Total RNA)

 

 

no i i i i

5 day Sensitization: Saline Ovalbumin Saline Ovalbumin
| I I
First Challenge: Saline Saline Saline Ovalbumin
I I l

Second Challenge: Saline Saline Ovalbumin Ovalbumin

Figure 2.12: Quantification of lL-4 mRNA in cranial and medial right lung lobes
24, 48 or 96 hr after double challenge with ovalbumin using RT-PCR. Mice were
sensitized with five consecutive daily intranasal instillations of 30pl of 0.5%
ovalbumin in saline or saline alone. Mice were then challenged two weeks later
with a similar volume and challenged a second time 10 days later followed by
sacrifice 24, 48, or 96 hr after double challenge. Bars represent molecules of lL-4
mRNA per 100 ng of total RNA isolated i standard error of the mean (n =
Slgroup). ' = significantly greater than all other groups at same time-point
(p<0.05). @ = significantly greater than similarly-challenged group sacrificed 96
h after challenge (p<0.05).

67

6e+6~

-24h
5%. -96h

484-6—

2e+6 .

1e+6 -

lL-4 mRNA (Molecules/100 ng Total RNA)

     

 

 

5...”: . k 'I'

0 -

Sensitizatio Saline Ovalbumin
l I I
1st Challenge Saline Ovalbumin
l l
2nd Challenge Saline Ovalbumin

Figure 2.13: Quantification of IL-4 mRNA in tracheobronchial lymph node 24 or
96 hr after double challenge with ovalbumin using RT-PCR. Mice were sensitized
with five consecutive daily intranasal instillations of 30pl of 0.5% ovalbumin in
saline or saline alone. Mice were then challenged two weeks later with a similar
volume and challenged a second time 10 days later followed by sacrifice 24 or 96
hr after double challenge. Bars represent molecules of IL-4 mRNA per 100 ng of
total RNA isolated : standard error of the mean (n = Slgroup). * = significantly
greater than all other groups at same time-point (p<0.05).

68

DISCUSSION

The primary objective of this study was to determine if the pathologic and
immunologic features of lgE-mediated allergic airway disease could be induced
in mice by intranasal sensitization and challenge with adjuvant-free ovalbumin.
Morphologic changes in the pulmonary ainrvays were correlated with changes in
cytokine gene expression in the lung and the TB lymph node after ovalbumin
treatment to determine if local cytokine gene expression may be used as a
biomarker for the respiratory allergenicity of selected proteins. lntranasal
sensitization and challenge with ovalbumin in the absence of an adjuvant elicited
the characteristic histopathologic and immunologic features of lgE-mediated
allergic airway disease in murine lung. Our results suggest that cytokine gene
expression in lung tissue and in a locally draining lymph node of the lung may be
a sensitive biomarker for identifying respiratory allergens. In addition, similar
histopathologic changes were detected in the nasal airway suggesting that this
intranasal exposure method may be used to study allergic rhinitis.

The most common methods typically used to sensitize mice to protein
allergens in murine models of lgE-mediated allergic airway disease include
intraperitoneal and intra-airway administration. After sensitization, the animals
are then challenged via the ainrvays to induce features of lgE-mediated allergic
airway disease such as airway hyperresponsiveness and airway inflammation.
The intraperitoneal administration of protein allergens is an unnatural route of
exposure to aeroallergens. Also, when antigens are intraperitoneally

administered in experimental models, they are often coupled with an adjuvant.

69

ar
be

Ch

Int.

43

An adjuvant, used to potentiate an immune response, can influence the Th1/Th2
cytokine profile and therefore may artificially alter downstream immunologic
responses (e.g., immunoglobulin isotypes secreted by B cells) (Rajananthanan et
al, 1999).

Mice may also be sensitized to allergens via intra-ainrvay administration.
One method of intra-ainrvay administration used to sensitize mice to protein
allergens is intratracheal instillation. lntratracheal sensitization of various protein
allergens including keyhole limpet hemocyanin (Shen et al, 2002) and latex
proteins (Woolhiser et al, 2000) has been shown to successfully induce lgE-
mediated allergic ainrvay disease. In addition to intratracheal instillation, some
models of lgE-mediated allergic ainrvay disease use aerosolized antigen to
sensitize mice to a specific antigen. There are conflicting reports regarding the
effectiveness of aerosolized antigen as a method of sensitization. While
successful sensitization has been demonstrated with some experimental models
(Hamelman et al, 1997), in others, the development of ainrvay inflammation after
Challenge was not observed (Stampfli et al, 1998).

Very few reported models, however, have used intranasal instillation of
antigen as a method of intra-ainrvay administration to sensitize animals. It has
been unclear whether a strong immunologic and pathologic response
characteristic of lgE-mediated allergic airway disease in the pulmonary airways
can be induced by intranasal sensitization (and challenge) to ovalbumin. The
intranasal instillation of allergens (i.e., Schistosoma mansoni egg antigen,

Aspergillus fumigatus) has been used to successfully induce features of allergic

70

rhinitis (Okano et al, 1999; van de Rijn et al, 1998). In addition, the intranasal
instillation of allergens has been used to elicit antibody responses for the
identification of the respiratory sensitization potential of detergent enzymes in the
mouse intranasal test (MINT) (Blakie et al, 1999; Robinson et al, 1996). Our
exposure regimen differed from the MINT protocol in the schedule and duration
of allergen dosing. The MINT protocol includes instillations on Days 1, 3 and 10
followed by sacrifice on Day 15 (Blakie et al, 1999; Robinson et al, 1996). Our
study consisted of five intranasal instillations during a distinct sensitization phase
followed by the first challenge (single intranasal instillation) two weeks later and a
second challenge 10 days after the first challenge followed by sacrifice from 24 to
96 h after final instillation.

We found that the intranasal instillation of ovalbumin was a simple,
inexpensive, and noninvasive method of inducing lgE-mediated allergic airway
disease in the upper and lower respiratory tract of the NJ mouse. Adjuvant was
not necessary to effectively sensitize the nasal or pulmonary ainrvays to the
allergen. Not all of the intranasally inhaled allergen was delivered to the
respiratory tract. Some of it was undoubtedly delivered to the esophagus and
Upper gastrointestinal tract. Our experimental design, however, did not allow us
to determine the amount of instillate that was delivered to the gut. In addition,
our study was not designed to determine the contribution of the gastrointestinal
tract to the overall sensitization of the mouse to ovalbumin.

Many animal models of lgE-mediated allergic ainrvay disease employ

continuous administration of the allergen by various routes without any significant

71

(A

(n

\I

lag period between initial sensitization and subsequent challenge to the allergen.
This may increase the risk of making the animal tolerant to the antigen. The
exposure regimen used in the present study included a distinct sensitization
phase after which no significant immune effect was observed, and a challenge
phase that consisted of one or two intranasal instillations. This regimen is
somewhat similar to human exposures to many proteins and low molecular
weight chemicals in the workplace that Ultimately result in occupational asthma.
Sensitization to a specific allergen in such cases of occupational asthma usually
takes place some time before re-exposure and the subsequent elicitation phase
(Beach et al, 2000).

The airways of asthmatics are characterized by the presence of chronic
inflammation with infiltration of lymphocytes, plasma cells, eosinophils, and mast
cells in the bronchial mucosa and epithelial changes that include MCM (Holgate,
2000; Wills-Karp, 1999). The lung lesions resulting from intranasal sensitization
and challenge of mice with ovalbumin included marked MCM in the surface
epithelium lining the conducting ainrvays and an associated mixed inflammatory
cell influx consisting of eosinophils, lymphocytes, and plasma cells in the
interstitial tissue surrounding the ainrvays. Two ovalbumin challenges in
sensitized mice induced a more substantial increase in the number of mucus-
secreting cells than a single challenge indicating that the two-challenge model
elicited a more robust response. There was also a modest increase in the
amount of IM in the absence of a cellular or cytokine immune response observed

in mice that received ovalbumin only once before sacrifice. These minimal

72

changes in IM may have been due to some irritating properties of the ovalbumin
solution rather than an immune-mediated response. The effect of the
sensitization phase was also examined by sacrificing mice after the sensitization
phase alone. Five consecutive one—day instillations of ovalbumin caused a
similar minimal increase in IM with no accompanying airway inflammation. This
minor increase in lM was also likely due to some irritating effect of the inhaled
solution on the ainrvay epithelium that resulted in a minimal increase in IM. This
response was nowhere near the severity of the MCM induced in the mice that
were also challenged with the ovalbumin solution. In addition, only the mice that
were both sensitized and challenged with ovalbumin had an inflammatory cell
infiltrate accompanying the marked MCM indicating an immune-mediated
response. These histologic features were not present in mice that received only
ovalbumin sensitization or only ovalbumin Challenge.

The single-most predisposing factor for the development of asthma in
humans is atopy (Kay, 2001). Individuals with atopy have a hereditary
predisposition to produce an lgE-mediated response against common
environmental allergens (Kay, 2001). The primary immunoglobulin isotype
associated with immediate-type hypersensitivity responses in mice is also lgE
(Kimber and Dearman, 1997). Determinations of antigen-specific lgE in the
serum of mice that were intranasally sensitized and challenged with ovalbumin
showed an increase in ovalbumin-specific lgE. In our study, there appeared to
be a requirement for an elicitation phase in order to induce an increase in

ovalbumin-specific lgE.

73

the

Th

an

of

El

01

In

The Th2 subtype of the CD4+ T cell produces a unique profile of cytokines
that has been linked to the pathogenesis of lgE-mediated allergic airway disease.
Th2 cells produce lL-4, lL-5, and lL-13 (Yssel and Groux, 2000). This Th2
cytokine profile has been consistently found in both bronchoalveolar lavage fluid
and biopsies of allergic asthmatics (Wills-Karp, 1999). There are many models
of lgE-mediated allergic airway disease that vary in the method used for cytokine
analysis with some focusing on changes in BALF-derived cytokine content while
others analyze local draining lymph node cells that have been re-stimulated with
a mitogen in vitro. In the present study, we determined the kinetics of Th2
cytokine gene expression in RNA isolated from the lung and the TB lymph node.
lntranasal sensitization and challenge of mice with ovalbumin increased lung-
derived mRNA expression of the Th2 cytokines lL-4, lL-S, and lL-13. In addition,
there was an increase in lL-10 mRNA. The magnitude of the increases peaked
at the earliest measured time, Le, 24 h after double challenge, and quickly
decreased in magnitude by 96 h after double Challenge. The kinetics suggests
that cytokine gene expression peaks soon after allergen re-exposure and wanes
in a short period of time thereafter. The magnitude of IL-4 mRNA expression
was several-fold greater after two ovalbumin challenges than after a single
challenge. Thus, two ovalbumin challenges produce a more robust cytokine
mRNA response than a single challenge. Also, once lL-4 mRNA expression was
elevated, it remained elevated for at least 48 h after challenge. lntranasal
sensitization and challenge of mice with ovalbumin also increased TB lymph

node-derived mRNA expression of lL-4 24 h after Challenge and persisted at that

74

IE)

8U

Iil<

th

level at least until 96 h. Interestingly, the RNase Protection Assay was not
sufficiently sensitive to detect this difference in IL-4 mRNA expression in the TB
lymph node. The lack of sensitivity in detecting the increase in IL-4 mRNA is
likely due to the high background expression of IL-4 mRNA in the lymph node
that may have prevented the detection of an increase in expression in the treated
groups. In addition, the fold-increase in IL—4 mRNA expression in the lymph
node as determined by PCR was much smaller than that exhibited by the lungs
of these animals and suggests that this assay may be unable to detect small
increases in expression.

The increase in lL-10 mRNA in this model coincides with the development
of the airway pathology suggesting that it may play a role in the induction of the
pathologic changes as some murine models suggest (Lee et al, 2002; Makela et
al, 2000; Yang et al, 2000). However, the role of IL-10 induction has been
somewhat controversial leading some to speculate that its primary role is
inhibitory, serving to mitigate the severity of the immune response (Bellinghausen
et al, 2001). The exact role of lL-10 in this model is unclear.

Individuals afflicted with asthma often suffer from concurrent lgE-
mediated allergic ainrvay diseases of the upper airways such as lgE-mediated
allergic rhinitis. The main symptoms of lgE-mediated allergic rhinitis are itching,
sneezing, watery discharge and obstructed nose (Andersson et al, 2000). The
pathologic features of this nasal ainrvay disease include plasma exudation,
hypersecretion of mucus, and cellular infiltrates consisting of T- and B-

lymphocytes, mast cells, eosinophils, and plasma cells in the nasal airway

75

his
Int

IIU

ITIII
the
me
the
det
anc
afte

Drc

(Andersson et al, 2000). The mechanism of lgE-mediated allergic rhinitis, like
asthma, is dependent on Th2 cytokines (Andersson et al, 2000). In the present
study, we found that intranasal sensitization and challenge to ovalbumin induced
in NJ mice features similar to that of lgE-mediated allergic rhinitis in people. A
histopathologic assessment of the nasal cavity of our NJ mice revealed that
intranasal sensitization and challenge to ovalbumin caused an increase in the
number of mucus-secreting cells in the respiratory epithelium that lines the nasal
cavity. This epithelial change was associated with an inflammatory influx
consisting of eosinophils and lymphocytes similar to that observed in the lung.
Therefore, our exposure regimen elicited some of the Characteristic features of
lgE-mediated allergic rhinitis and may be used to study allergic rhinitis.

The present study illustrated that intranasal sensitization and challenge of
mice to ovalbumin in the absence of an adjuvant successfully induced many of
the histopathologic, morphologic and immunologic features associated with lgE-
mediated allergic airway disease. In addition, the assessment of local cytokine
changes in the lung and its draining lymph node is an effective method for
determining changes in cytokine gene expression after intranasal sensitization
and challenge to an allergen. The analysis of local cytokine gene expression
after intranasal exposure may prove useful in the identification of other allergenic

proteins and low molecular weight chemicals.

76

CHAPTER 3
SUPPRESSION OF THE OVALBUMIN-INDUCED ALLERGIC AIRWAY

RESPONSE IN AIJ MICE BY INTRANASAL OR INTRAPERITONEAL
ADMINISTRATION OF CANNABINOL

77

ABSTRACT

The pathophysiology of allergic airway diseases such as asthma has been
linked to a specific subtype of CD4+ T cells, Th2 cells, and the cytokines they
release. A number of studies have shown that cannabinoids inhibit expression of
Th2 cytokines and may thus influence Th2 cytokine-dependent allergic airway
responses. The present study was designed to test the hypothesis that
cannabinol (CBN) administered either via intraperitoneal (IP) injection or
intranasal (IN) instillation would suppress the characteristic pathologic and
immunologic features of allergic ainrvay disease elicited by intranasal
sensitization and challenge with ovalbumin in NJ mice. Morphologic changes in
the pulmonary ainrvays were assessed in addition to changes in cytokine gene
expression in the lung after ovalbumin and/or CBN treatment. IN sensitization
and challenge with ovalbumin elicited marked mucous cell metaplasia (MCM) in
the respiratory epithelium lining the pulmonary ainrvays, and an associated mixed
inflammatory cell influx consisting of lymphocytes, plasma cells neutrophils, and
eosinophils. Ovalbumin-treated mice also had enhanced expression of the Th2
cytokine mRNAs IL-4, IL-5, IL-10, and lL-13 in the lung, and concurrent increases
in ovalbumin-specific and total serum lgE. IP administration of CBN attenuated
the ovalbumin-induced Increase In IM, serum lgE, and lung-derived lL-4 mRNA
expression. IN instillation of CBN suppressed the OVA-induced increase in total
and antigen-specific serum lgE, the total number of lymphocytes, eosinophils and
neutrophils in BALF, and lung-derived lL-13 mRNA expression. lntranasal

instillation of CBN had no effect, however, on the increase in IM in the pulmonary

78

thII

The

oft

CBI

the

airways and the increase in lung-derived lL-4, lL-5, and lL-10 mRNA expression.
The intranasal instillation of CBN, although not as effective as IP administration
of CBN, did inhibit some features of the allergic airway response suggesting that
CBN may have some utility as a therapeutic/prophylactic when administered via

the airways.

79

INTRODUCTION

In a previous study using a murine model of allergic airway disease, Jan
and colleagues, 2003, demonstrated that two ' separate plant-derived
cannabinoids, cannabinol (CBN), and A9-tetrahydrocannabinol (Ag-THC),
attenuated several of the pathologic and immunologic features of allergic ainrvay
disease resulting from IP sensitization and aerosol challenge with ovalbumin (Jan
et al, 2003). Subsequently, I developed a murine model of allergic airway
disease that more closely resembled the human route of exposure to
aeroallergens, i.e., inhalation. This model used intranasal instillations of
ovalbumin to both sensitize and challenge mice (refer to Chapter 2 of
dissertation, Farraj et al, 2003). Although IP administration of cannabinoids
inhibited the allergic airway response resulting from systemic sensitization and
ainrvay challenge with ovalbumin, it is not clear whether IP administration of
cannabinoids will suppress the allergic response elicited by IN sensitization and
Challenge with ovalbumin. In addition, the systemic administration of drugs (eg,
oral) in humans often results in a multitude of side effects (Hardman et al, 1995).
For this reason, in the development of potential therapeutics/prophylactic to be
used by patients for the treatment of allergic airways disease, airway delivery of
the drug is preferred to avoid such side effects. One major obstacle in the use of
intra-airway administration of cannabinol in experimental models of allergic
airway disease has been the poor aqueous solubility of both CBN and Ag-THC

and the lack of a suitable vehicle for airway delivery. Thus, it is unclear whether

80

cannabinol administered via the ainrvay would lead to suppression of the OVA-
induced allergic ainrvay response in NJ mice.

Asthma is an allergic airway disease of the lung that is characterized by
the presence of chronic inflammation of the pulmonary airways with infiltration of
the bronchial mucosa by lymphocytes, eosinophils, and neutrophils, along with
increased mucus production (Wills-Karp, 1999). Asthma is also associated with
increased serum lgE levels and physiological abnormalities including airflow
obstruction and ainrvay hyper-responsiveness (Wills-Karp, 1999). The
mechanism(s) underlying the pathogenesis of allergic airway disease are
currently being elucidated. There are many lines of evidence, however, that
implicate the T lymphocyte and specifically the CD4+ T cell. Evidence for the
participation of T lymphocytes includes increased numbers of CD4+ T cells in
bronchoalveolar lavage fluid (BALF) and a concurrent decrease in the number of
CD4+ T cells in peripheral blood following allergen challenge (Wills-Karp, 1999).
A specific subtype of the CD4+ T cell, T helper 2 (T h2), produces a unique
pattern of cytokine expression. This Th2 pattern has been consistently found in
both BALF and biopsies of allergic asthmatics and includes the cytokines lL-4, IL-
5, lL-10, and lL-13 (Wills-Karp, 1999). The differentiation of uncommitted T cell
precursors into Th2 cells is largely driven by lL-4 as demonstrated by the
abrogation of airway hyperreactivity after administration of a monoclonal antibody
against IL-4 during the period of immunization in a murine model of asthma
(Corry et al, 1996). lL-4 and IL-13 are required for B cells to undergo class
switching to go from producing lgM to producing lgE (Frew, 1996). lL-4 and IL-

81

ef

8y

lei
ex
of
in
the
Ca
of

to

13 also induce mucin gene expression in airway epithelium (Shim et al, 2001).
lL-13 has also been proven to be necessary for the expression of allergic ainNay
hyperresponsiveness and sufficient to induce it. Administration of recombinant
lL-13 conferred an asthma-like phenotype to non-immunized mice (Grunig et al,
1998). lL-S regulates the maturation and activation of eosinophils. IL-S-deficient
mice have markedly fewer eosinophils in the lamina propria of their ainrvays than
normal mice after provocation and antibody blockade inhibits antigen-induced
eosinophilia and late-phase hyperresponsiveness (Foster et al, 2000; Karras et
al, 2000).

Cannabinoids are a structurally-related family of compounds produced by
the cannabis sativa plant. Cannabinoids exert a broad range of physiologic
effects; the most extensively studied being those in the CNS and the immune
system. Suppression of the immune system by cannabinoids is thought to be
mediated, at least in part, through cannabinoid receptors (CB) expressed by
leukocytes (Herring et al, 1999). CB1 is the predominant cannabinoid receptor
expressed in rat brain (Matsuda et al, 1990), whereas CB2 is expressed by cells
of the immune system (Munro et al, 1993; Schatz et al, 1997). Several reported
findings suggest that cannabinoids exert inhibitory effects on various aspects of
the allergic airway response, thus supporting investigation of the effects of
cannabinoids on allergic ainrvay disease. For example, in one study, the smoking
of marijuana or ingestion of Ag-THC by subjects with chronic asthma of minimal
to moderate severity partially reversed asthma-induced bronchoconstriction

(T ahskin et al, 1974; Tashkin et al, 1975). Another specific immune effect of

82

cannabinoids that is relevant to the current study is the effect cannabinoids have
on the expression of Th2 cytokines, which mediate the allergic airway response.
Cannabinoids inhibit the nuclear factor of activated T' cells (NFAT), which is a
critical regulator of a number of T cell cytokines including IL-2, lL-4 and lL-S, from
binding DNA (Yea et al, 2000; Jan et al, 2002). In addition, in a previous study,
IP injections of cannabinoids attenuated the increase in lung-derived Th2
cytokine expression elicited by IP sensitization followed by aerosol challenge with
ovablumin (Jan et al, 2003). The effect of cannabinoids on Th2 cytokine
expression may underlie the suppression of the asthma pathophysiology.
Inhibition of the allergic airway response by CBN would demonstrate the
necessity of Th2 cytokines in the pathogenesis of allergic ainrvay disease in this
model. This would further support the findings described in Chapter 2 that
showed a link between the pathologic changes and the increase in lung-derived
Th2 cytokine mRNA expression. CBN-mediated inhibition of the allergic airway
response would also suggest that a LMW chemical-induced increase in airway
Th2 cytokine expression may be a strong indicator of the allergenic potential of
the chemical.

The primary objective of this study was to determine if the cannabinoid,
CBN, administered IP or via IN instillation, would attenuate the pathologic and
immunologic features of the allergic ainrvay response in NJ mice elicited by IN
sensitization and challenge with OVA. In one study, mice sensitized and
challenged with ovalbumin were co-treated with IP injections of CBN. In a

separate study, mice sensitized and challenged with ovalbumin were co-treated

83

with IN instillations of CBN. CBN was dissolved in a 1:4 ethyl acetate/olive oil
vehicle (EA/00) when administered via IN instillation. The rationale for using
CBN and not Ag-THC in the present study is CBN exhibits lower affinity for the
CB1 receptor, despite its structural similarity, and thus possesses decreased
psychotropic activity, while maintaining its immunomodulatory activity (Jan et al,
2003). Morphologic changes in the pulmonary airways were assessed in
addition to changes in cytokine gene expression in the lung after OVA and/or

CBN treatment.

84

MATERIALS AND METHODS
Animals and Allergen Sensitization and Challenge

Forty-four male A/J mice (Jackson Laboratories, Bar Harbor, Maine), 6
weeks of age, were randomly assigned to one of 8 experimental groups in two
different studies (n = 5 or 6). Mice were free of pathogens and respiratory
disease, and used in accordance with guidelines set forth by the All University
Committee on Animal Use and Care at Michigan State University. Animals were
housed five per cage in polycarbonate boxes, on Cell-Sorb Plus bedding (A&W
Products, Cincinnati, OH) covered with filtered lids, and had free access to water
and food. Room lights were set on a 12 hr light/dark cycle beginning at 6:00 am,
and temperature and relative humidity were maintained between 21-24°C and
40-55 % humidity, respectively. The exposure regimen used to sensitize and
challenge the mice was previously described in detail (refer to Chapter 2 of the
dissertation, Farraj et al, 2003). The exposure regimen, outlined in Figure 3.1, is
briefly described as follows.

Mice were anesthetized with 4% halothane and 96% oxygen.
Anesthetized mice were treated by intranasal instillation with 30 pl of 0.5%
ovalbumin (Sigma Chemical, St. Louis, MO) in sterile, pyrogen-free saline or 30
pl of saline alone divided evenly between each naris. The sensitization phase
consisted of a single instillation once per day for 5 consecutive days. The mice
were challenged once, 14 days after the fifth instillation of the sensitization phase
via a single instillation of the same volume and concentration as the instillations

during the sensitization phase. The mice were challenged a second time 10

8S

Exposure Regimen for Ovalbumin/Cannabinol Co-Exposure Study

 

 

AM
******* *altal: an“:
DAYSHOHH H18 H28
AAAAA A A
PM Sacrifice

48hPE

Figure 3.1: Timeline of the exposure regimen used to sensitize and challenge AIJ
mice with ovalbumin or saline and co-treat with either IP CBN or W CBN. Mice
were co-treated with single IP injections (50 mg/kg) or intranasal instillations (500
pM) beginning 2 days before sensitization and challenge with ovalbumin/saline
and the morning of each ovalbumin/saline instillation. Mice were sensitized with
five consecutive daily intranasal instillations of 30 pl of 0.5% ovalbumin in saline
or saline alone, then challenged once two weeks later with a similar volume, and
then challenged again a second time 10 days later followed by sacrifice 48 hr
after double challenge. Ovalbumin/saline instillations were administered in the
evenings of the CBN administrations. * = lP injection of CBN or IN instillation of
CBN. " = intranasal instillation of 30pl of 0.5% ovalbumin in saline or saline
alone.

86

days after the first challenge again with the same volume and concentration as in
the first challenge. Mice were then sacrificed 48 hr after the second challenge.
There were three different treatment groups: 1) sensitization and challenge with
saline, 2) sensitization and challenge with ovalbumin; and 3) mice that were co-
treated with CBN before, during, and after sensitization and each challenge with
ovalbumin. Animals that were exposed to CBN were given IP injections of CBN
(50 mg/kg in 200 pl of 5% ethanol and 0.5 °/o Tween 20 in saline) once per day
the two days before ovalbumin/saline sensitization and then once in the mornings
before each intranasal instillation of ovalbumin/saline that was administered in
the evenings during the sensitization phase. CBN -treated mice also received lP
injections once per day of the same concentration the two days before each of
the challenges and once the morning of each intranasal challenge with
ovalbumin/saline. A group exposed to CBN alone or with saline was excluded
from this study because the effect of CBN alone was determined in one of our
previous studies (Jan et al, 2003). It was determined from that study that mice
treated with CBN alone in did not have any pathologic or immunologic
differences within the respiratory tract relative to na'ive untreated mice.

A second set of animals was set aside to determine how intra-airway
administration of the same formulation of CBN would compare to IP injection in
ovalbumin-induced allergic airway disease. The CBN in this set of animals was
administered via intranasal instillation. The animals were sensitized and
challenged with ovalbumin in the same manner as in the first set of animals.

There were four treatments groups (n = 6 or 8): 1) sensitization and challenge

87

ox

ph

the

50f
CB!
oil '
diss
instil
eacf

oval:

llVecrc

”View.

”(Ere

VaCUlaj

with saline, 2) sensitization and challenge with ovalbumin, 3) mice that were co-
treated with CBN before, during, and after sensitization and each challenge with
saline and 4) mice that were co-treated with CBN before, during, and after
sensitization and each challenge with ovalbumin. Animals that were exposed to
CBN were given 60 pl intranasal instillations of 500 pM CBN in 1:4 ethyl
acetate/olive oil vehicle per day the two days before ovalbumin/saline
sensitization and then once in the mornings before each intranasal instillation of
ovalbumin/saline that was administered in the evenings during the sensitization
phase. A pilot study was performed that tested for the irritating effects of CBN on
the airway epithelium in the nasal airway after intranasal instillation. A dose of
500 pM was selected from a range of doses because it was the highest dose of
CBN that was not irritating to the airway epithelium. The 1:4 ethyl acetate/olive
oil vehicle has no irritating effects on the respiratory epitheliUm and allows
dissolution of the lipid soluble CBN. CBN-treated mice also received intranasal
instillations of CBN once per day of the same concentration the two days before
each of the challenges and once the morning of each intranasal challenge with

ovalbumin/saline.

Necropsy, Blood Sample Collection, and Tissue Preparation

Before sacrifice, mice were deeply anesthetized via intraperitoneal
injection of 0.1 ml of 12% pentobarbital in saline. Blood samples (0.1 to 0.5 ml)
were taken from the brachial artery and collected in Beckton Dickinson

vacutainers. Serum samples were collected after the blood samples were

88

centrifuged to remove cells and the supematants were frozen and stored at -
20°C. The abdominal aorta and renal artery were then severed to exsanguinate
the mice. Immediately after death, the trachea was cannulated and the
heart/lung block removed. Bronchoalveolar lavage fluid (BALF) was collected
from the set of animals that received intranasal instillations of CBN. In order to
collect BALF, a syringe was then attached to the cannula and BALF was
collected from the whole lung via two sequential changes of 1 ml saline.
Differential cell counts were determined by cytocentrifuging cells onto glass
slides and then staining with Diff-Quik (DADE Behring, Newark, DE).
Neutrophils, macrophages, eosinophils and other cell types were microscopically
identified and their numbers were determined by multiplying the percentage of
each cell type from a total of 200 cells by the total number of cells per ml of
lavage fluid. All four right lung lobes were placed in 2 ml Tri reagent,
homogenized and stored at -80°C.

After removal of the right lung lobes, the left lung lobe was
intratracheally perfused with 10% neutral buffered formalin at a constant
pressure of 30 cm of fixative. After 1 hr, the trachea was ligated, and the inflated
left lung lobe was immersed in a large volume of the same fixative for 24 hr.
After fixation, the left lung lobe was microdissected along the main axial ainlvay,
and two sections were then excised at the level of the fifth (proximal) and
eleventh (distal) airway generation (Figure 3.2), as has been described

previously in detail (Steiger et al, 1995). Paraffin sections (5 pm) were stained

89

SITES FOR LIGHT MICROSCOPIC ANALYSIS

 
  
 
 

4. Proximal axial airway

 

1. Proximal nasal airway

 

 

2. Middle nasal airway Hear, '. I 8 Left Lung Lobe

3. Distal nasal airway

Figure 3.2: Sites of airway tissue selection for morphometric analysis. The
cartoon depicts the main axial airway of the left lung lobe. The left lung lobe was
microdissected along the axial airways, and two sections were then excised at
the level of the fifth (proximal airway) and eleventh (distal ainIvay) airway
generation.

90

pr
un
dlc
(v0
des

squ.

EUS

with Alcian blue (pH 2.5) and periodic acid Schiff's (AB/PAS) reagent, which stain
neutral and acidic mucosubstances, respectively. Other paraffin sections were

stained separately for eosinophilic major basic protein (MBP, described below).

Morphometry of stored intraepithelial mucosubstances in pulmonary airways.

The amount of stored mucosubstances in the surface epithelium lining the
pulmonary axial ainIvay (airway generation 5, proximal airway) in the left lung
lobe was estimated by quantifying the volume density of ABIPAS-stained
mucosubstances using computerized image analysis and standard morphometric
techniques. The area of ABIPAS-stained mucosubstances was calculated by
circumscribing the perimeter of the stained material using the Scion Image
program (Scion Corporation, Frederick, MD). The length of the basal lamina
underlying the surface epithelium was calculated from the contour length of the
digitized image of the basal lamina. The volume of stored mucosubstances
(volume density, Vs) per unit of surfacearea was estimated using the method
described in detail by Harkema et al., 1987, and was expressed as nl of IM per

square mm of basal lamina.

ELISA for Total and Ovalbumin-specific serum lgE

Total serum lgE was measured using a 96-well lmmulon ELISA plate
(Dynex, Technologies, Chantilly, Virginia) coated with 2 pg/ml anti-mouse lgE
(Purified Rat Anti-Mouse lgE Monoclonal Ab, Pharmingen, San Diego, CA) and

incubated overnight at 4°C. For measurement of ovalbumin-specific lgE, a

91

second ELISA plate was coated with 0.5% ovalbumin and incubated overnight at
4°C. After washing, the plates were incubated in 3 % Bovine Serum Albumin (3
% BSA) at 37°C for 1 hr. (BSA, CALBIOCHEM, La Jolla, CA). Serum samples at
1:10 dilution were then added followed by incubation at 37°C for 1 hr. After
washing, biotinylated anti-mouse lgE (Biotin-conjugated Rat Anti-Mouse lgE
Monoclonal Ab, Pharmingen, San Diego, CA) was then added at 2 pglml and
allowed to incubate at 25°C for 1 hr. After washing, 1.5 pg/ml of streptavidin
peroxidase was added followed by incubation at 25°C for 1 hr. After washing,
TMB substrate (12.5ml citric-phosphate buffer + 200 pl of TMB stock solution
(6mg/ml in DMSO)) was added to produce a color reaction. The reaction was
terminated by the addition of 6 N H2804, Optical density was determined at 450
nm using an EL-808 microplate reader (Bio-Tek instruments, Winooski,

Vermont).

Quantitative IL-4 Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR).
Total RNA was isolated from lung tissues using the TRI REAGENT
method (Molecular Research Center, Cincinnati, OH) following the
manufacturer’s protocol and the integrity of the RNA was checked by performing
an ethidium bromide diagnostic gel to check for degradation of RNA.
Quantitative RT-PCR was performed on RNA collected from the first set of
animals that received lP injections of CBN. Quantitative RT-PCR was performed
as described by Gilliland et al, 1990, except that rcRNA was used as an IS

instead of genomic DNA with 10 aliquots of rcRNA from 104 to 10° molecules.

92

39
hr:
Rh
usi
Sof

Gilli

reac
Slgnf‘

WBSE

Briefly, total RNA (right lung lobe or TB lymph node) and IS rcRNA of known
amounts were reverse transcribed into cDNA using oligo(dT)15 as primers using
reverse transcriptase (RT) (Promega, Madison WI). To ensure that there was no
genomic DNA contamination in the RNA isolates, no-RT controls were employed
for all samples. A PCR master mixture consisting of PCR buffer, 4 mM MgCl2, 6
pmol each of lL-4 fonIvard and reverse primers, and 2.5 U of Taq DNA
polymerase was added to the cDNA samples. Samples were then heated to
94°C for 3 min and cycled 40 times at (1) 95°C (30 sec), (2) 58°C (30 sec), and
(3) 72°C (45 sec). After the completion of 40 cycles, a final elongation step at
72°C (5 min) was carried out. PCR products were resolved by electrophoresis in
3% NuSieve 3:1 gel (FMC Bioproducts, Rockland ME) and visualized by ethidium
bromide staining. The lL-4 primers produced a 228 bp product from the cellular
RNA and a 346 bp product from the IS rcRNA. Quantification was performed
using Gel Doc 1000 (BioRad Laboratories, Inc., Hercules, CA) and Multi Analyst
Software. The amount of IL-4 mRNA present was determined as described by
Gilliland et al, 1990. Briefly, the ratio of the density of the IS rcRNA to lL-4
mRNA was plotted against the amount of IS rcRNA (in molecules) added to each
reaction. The point at which the ratio of IS (rcRNA) to lL-4 mRNA was equal to 1
signified the “cross-over point” which represented the amount of lL-4 molecules

present in the initial RNA sample.

93

 

Re

an
flu
thI
tar
ea
arr
su!

Re

Real-time RT—PCR

The evaluation of the relative expression levels of the cytokines lL-4, lL-5,
lL-10, IL-13, and IFN-y mRNA in the lungs of the second set of mice treated with
intranasal instillations of CBN was determined using a one-step real-time
multiplex RT-PCR using the manufacturer’s protocol (Applied Biosystems, Foster
City, CA). Briefly, aliquots of isolated tissue RNA (100 ng total RNA) were added
to the RT—PCR reaction mixture, which included the target gene (IL-4, IL-5, lL-10,
IL-13, or IFN-y) primers and probe, endogenous reference primers and probe
(188 ribosomal RNA), AmpliTaq DNA polymerase and Multiscribe reverse
transcriptase (MuLV). The probes are designed to exclude detection of genomic
DNA. RNA samples were first reverse transcribed and then immediately
amplified by PCR. Following the PCR, amplification plots (change in dye
fluorescence versus cycle number) were examined and a dye fluorescence
threshold within the exponential phase of the reaction was set separately for the
target gene and the endogenous reference (188). The cycle number at which
each amplified product crosses the set threshold represents the CT value. The
amount of target gene normalized to its endogenous reference was calculated by
subtracting the endogenous reference CT from the target gene CT (ACT).
Relative mRNA expression was calculated by subtracting the mean ACT of the
control samples from the ACT of the treated samples (AACT). The amount of
target mRNA, normalized to the endogenous reference and relative to the

calibrator (i.e., RNA from control) is calculated by using the formula 2‘MCT.

94

Statistics

The data obtained from each experimental group were expressed as a
mean group value i the standard error of the mean- (SEM). The differences
among groups were determined by one way or two-way analysis of variance
(ANOVA) and an All Painlvise Comparison Test (Tukey), using SigmaStat

software from Jandel Scientific Co. (San Rafael, CA).

95

pr
brc
Dal
am
in a
Ves.
Wen
abse

Chall

i”ram
00nd:

'eSs s.

RESULTS
Pulmonary Histopathology

lntranasal sensitization and challenge with ovalbumin resulted in distinct
pulmonary lesions in the ainrvays of NJ mice. The principal morphologic
alterations in the lungs of these mice were marked MCM in the surface
epithelium lining the conducting airways and an associated mixed inflammatory
cell influx consisting of eosinophils, neutrophils and mononuclear cells (mainly
lymphocytes and plasma cells) in the interstitial tissue surrounding the ainIvays
(Figure 3.3). Airway lesions were more severe in the main axial airways and
pre-terminal bronchioles, but were also present to a lesser degree in the terminal
bronchioles. The interstitial tissue surrounding large blood vessels in the alveolar
parenchyma (pulmonary veins) and along the conducting airways (pulmonary
arteries) exhibited a similar inflammatory response. The inflammatory responses
in all of these mice were principally present in the pulmonary ainrvays and large
vessels of the lung. No significant ovalbumin-induced inflammatory responses
were evident in the alveolar parenchyma. Treatment-associated changes were
absent in the lungs of control mice that received intranasal sensitization and
challenges of saline.

Mice sensitized and challenged with ovalbumin and co-treated with IP
injections of CBN also had undergone MCM in the surface epithelium lining the
concluding airways and an associated mixed inflammatory cell influx consisting
of eosinophils, neutrophils and mononuclear cells. The lesion, however, was

less severe. The MCM in mice co-treated with IP CBN was less severe than in

96

 

 

 

 

 

 

 

Figure 3.3: Light photomicrographs of the main axial airway of the left lung from
mice intranasally sensitized and challenged twice with saline (A. D), 0.5%
ovalbumin (B. E), or 0.5 % ovalbumin and co-treated with IP CBN (C, F) and
sacrificed 48 hr after challenge. TIssues were stained with hematoxylin and
eosin (A, B, C) for morphologic assessment and Alcian blue (pH = 2.5)/periodic
acid Schiff’s sequence (ABIPAS) for mucosubstances in the airway epithelium
(D, E, F). p = alveolar parenchyma, e = airway epithelium, v = blood vessel; L =
airway lumen.

 

O\

Sic

ma?
IP I
0V8

rela

Ova.
insti

OVal

ovalbumin-exposed mice that were not treated with IP CBN (Figure 3.3).

Mice sensitized and challenged with ovalbumin and co-treated with IN
instillations of CBN, however, had an ovalbumin-induced pulmonary airway
lesion that was of similar severity to ovalbumin-exposed mice not treated with IN

instillations of CBN (see Figure 3.38 and E).

Stored Intraepr'thelial Mucosubstances (IM) in Pulmonary Airways

The amount of ABIPAS-stained lM in the surface epithelium lining the
main axial airway at the fifth (proximal airway) airway generation was determined
in mice that were sacrificed 48 hr after sensitization and challenge with
ovalbumin and co-treatment with IP CBN. Mice sensitized and challenged with
ovalbumin in the IP CBN study had a 42-fold increase in the amount of IM in the
main axial airway relative to saline-instilled mice (Figure 3.4). Co-treatment with
IP CBN Significantly reduced the ovalbumin-induced increase by 1.4-fold; i.e.,
ovalbumin-exposed mice treated with IP CBN had a 29-fold increase in IM
relative to saline-instilled controls.

There was no Significant difference in the amount of IM between untreated
ovalbumin-exposed mice and ovalbumin-exposed mice treated with IN
instillations of CBN (amounts were not significantly different from the Vs in the

ovalbumin instilled group not treated with IP CBN in Figure 3.4).

98

EISIGCII-

Mucus Vs (nllmm2 basal lamina)
u

     

 

 

 

 

   

 

0 L fii’; r Z359 Arum --
Sallne Ovalbumin Ovalbumln

Cannabinol

Figure 3.4: Morphometric quantification of ABIPAS-stained material in the
surface epithelium lining the main axial airway of the left lung lobe 48 hr after
double challenge with saline, ovalbumin, or ovalbumin plus co-treatment with IP
CBN. Bars represent the Volume Density (Vs) of intraepithelial mucosubstances
1: standard error of the mean (n = 5 or 6/ group). * = significantly greater than
saline-instilled group(p<0.05). @ = significantly greater than IP CBN-treated
group (p<0.05).

99

Bronchoalveolar lavage fluid (BALF)

The total number of cells in the BALF was determined at 48 hr after the
second challenge in ovalbumin-exposed mice that were co-treated with IN CBN.
Ovalbumin-exposed mice had a 145-fold increase in the number of lymphocytes,
an 83-fold increase in the number of eosinophils, and a 26-fold increase in the
number of neutrophils in the BALF compared to saline-treated mice (Figure 3.5).
The predominant cell type in the BALF of ovalbumin-exposed mice was the
neutrophil. lN instillations of CBN markedly attenuated the ovalbumin-induced
increase in all three cell types. IN CBN caused a 7.5-fold decrease in the
number of lymphocytes, a 5.5-fold decrease in the number of eosinophils, and a

2.7-fold decrease in the number of neutrophils in the BALF.

Total Semm lgE

Total serum IgE levels were determined at 48 hr after the second
challenge in ovalbumin-exposed mice that were co-treated with IP injections of
CBN and in mice co-treated with IN instillations of CBN. Mice sensitized and
challenged with ovalbumin in the IP CBN study had a 1.7—fold increase in
ovalbumin-Specific serum lgE (Figure 3.6A) and no change in total serum lgE
(Figure 3.63) relative to the saline-exposed mice. IP CBN Significantly reduced
the ovalbumin-induced increase in ovalbumin-specific lgE by 1.7-fold. Mice
sensitized and challenged to ovalbumin in the IN CBN study had a 16-fold

increase in ovalbumin-specific serum lgE (Figure 3.7A) and a 1.9-fold

100

1.2e+5 -

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

macrophages
1.0e+5- 2 333.1333? 1“?
IIIIIHJ neutrophils TL
2 8.0e+4 -I
2
E + . 7/
‘3? 6.0a 4 g
a % *
'2 4.0e+4 . Z
/
2.0e+4 « Z
/
0.0 - - ml % . .—
Saline Ovalbumln Sallne Ovalbumln
Vehicle Vehicle Cannabinol Cannabinol

Figure 3.5: Total number of macrophages, lymphocytes, eosinophils, and
neutrophils in BALF from the left lung lobes of mice treated with IN instillations of
EA/OO vehicle and instilled with saline, mice treated with IN instillations of
EA/OO vehicle and instilled with ovalbumin, mice treated with IN instillations of
CBN and instilled with saline, or mice treated with IN instillations of CBN and
instilled with ovalbumin. Bars represent mean number of cells per ml BALF :1:
standard error of the mean (n = 6/group). * = significantly greater than saline-
instilled controls (p<0.05). @ = Significantly greater than ovalbumin-instilled
group treated with IN CBN (p<0.05).

101

0.14 -

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

0.12 ~ T
g 0.10~ . _ ..
0
I: * .
g 0.00 - L a“
5 V.:-i- ' fps
OI! ., ' " ‘ V
8 0'06 - T . E“; 8 ~.
I: i ,, - w
8 r-v 1': f . ’fi _. *3, '
2 0-04 ~ ‘ _‘ 51 ,9.
.Qt' j :4 ”4 Jr;
0.02 - :5“; a ..c a ’
, ._‘ .- g
0.00 1'” " "
Sallne Ovalbumln Ovalbumln
Cannabinol
0.20 -
0.15 -
5‘
g T
3
,2 0.10 1
‘5.
O
C
N
E
0.05 -
0.00 ,,_. "f '4 ' "
Sallne Ovalbumln Ovalbumln
Cannabinol

Figure 3.6: Ovalbumin-specific (upper panel) and Total lgE (lower panel) levels in
mouse serum isolated 48 h hr after double challenge with saline, ovalbumin, or
ovalbumin plus co-treatment with IP CBN. Bars represent average optical
density at standard error of the mean (n = 5 or 6/group). * = significantly greater
than all other groups.

102

0.25 *

 

    

 

 

 

 

 

 

 

 

 
        

 

 

 

 

 

 

 

 

 

*
0.20 «
5‘
0
C .. i.» ,.
a 0.154 (f , v}
a K . . , _
2
‘15.
0 0.10-
C
a
O
E
0.05 ~ .
0.00 E ’I‘ 3' ‘ LI w‘.'- "7‘ . 4 '
Sallne Ovalbumln Sallne Ovalbumln
Vehicle Vehicle Cannabinol Cannabinol
0.5 -
04 *
z- . I
3 9:“ .95. 1 l
c .. . ,
3 0.3 -
:1 .2; T
a .. .
a. ,. .,
0 021 T - - M
C " :"' ~12: " ‘ If ”cat‘»--.
«I ‘ '
g H .L’ ”f ,V» '7 "'
f" .513. ..i,. i. 7“"? ,I
0.1 - . .. ,' ' _ . .-
. '. a", t1 ‘
J. 3'... r. T;— \
» anal Eta- ’1 , ; ,
00 SI); 1,731.“ A; L .- . . A _, . fin "(5
Sallne Ovalbumln Sallne Ovalbumln
Vehicle Vehicle Cannablnol Cannablnol

Figure 3.7: Ovalbumin-specific (upper panel) and Total lgE (lower panel) levels in
mouse serum isolated 48 hr after mice were treated with IN instillations of EA/OO
vehicle and instilled with saline, IN instillations of EA/OO vehicle and instilled with
ovalbumin, IN instillations of CBN and instilled with saline, IN instillations of CBN
and instilled with ovalbumin. Bars represent average optical density :t standard
error of the mean (n = 6/group). * = significantly greater than all other groups.

103

increase in total serum lgE (Figure 3.78) relative to saline-exposed control mice.
IN CBNreduced the ovalbumin-induced increase in ovalbumin-specific serum lgE

by 2.8-fold and the increase in total serum lgE by 1.7-fold.

Cytokine Gene Expression

Quantitative RT-PCR: Semi-quantitative RT-PCR for the cytokine lL-4 was

 

performed on right lung lobe RNA from mice 48 hr after they were sensitized and
then challenged with ovalbumin and co-treated with IP CBN. Mice sensitized and
challenged with ovalbumin had an 11.4-fold increase in lL-4 mRNA expression
within the lung relative to saline-exposed control mice (Figure 3.8). lP CBN co-
treatment Significantly reduced the ovalbumin-induced increase in IL-4 mRNA by
2.5-fold.

Real-Time RT-PCR: Real-Time RT-PCR was performed for the Th2
cytokines IL-4, lL-5, lL-10, IL-13, and the Th1 cytokine IFN-y on RNA isolated
from the right lung lobes of mice 48 hrs after they were sensitized and challenged
with ovalbumin and co-treated with intranasal instillations of CBN. Mice
sensitized and challenged with ovalbumin had a 4.5-fold increase in lung-derived
lL-4 mRNA expression relative to saline-exposed controls (Figure 3.9). IN CBN
co—treatment in ovalbumin-exposed mice had no significant effect on the
ovalbumin-induced increase in IL-4. Mice sensitized and challenged with
ovalbumin had a 7.7-fold increase in lung-derived IL-5 mRNA expression relative
to saline-exposed controls. IN CBN co-treatment reduced the ovalbumin-induced

increase in lL-5 mRNA by 1.5-fold, although

104

1.2946 -

8.0945 1

6.0045 -

4.0e+5 -

2.0e+5 1

         

‘35:; 1.4 J ;.. . .1,

IL-4 mRNA (Molecules IL-4/ 100 ng Total RNA)

 

 

 

 

r45? 1 " 1*

Sallne Ovalbumin Ovalbumin
Cannabinol

 

Figure 3.8: Quantification of IL-4 mRNA in right lung lobes 48 hr after double
challenge with saline, ovalbumin, or ovalbumin plus co-treatment with IP CBN
using semi-quantitative RT-PCR. Bars represent molecules of lL-4 mRNA per
100 ng of total RNA isolated :t standard error of the mean (n = 5 or 6/group). * =
significantly greater saline-instilled control (p<0.05). @ - significantly greater
than ovalbumin instilled group treated with IN CBN (p<0.05).

105

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

'2' 35-

‘g' lL-4

o m lL-5 *

5 3°“ E lL-10

2 mm lL-13

.E

'5

‘0 20 ~

0

fl

3 25@

E 15 0

Ir."

< 10 . *

E *

E

.3 5 -

x

o

g m

U o _
Saline Ovalbumin Saline Ovalbumln
Vehicle Vehicle Cannabinol Cannabinol

Figure 3.9: Relative quantification using real-time PCR of lL-4, lL-5, lL-10, lL-13,
and IFN-y mRNA in right lung lobes 48 hr after mice were treated with IN
instillations of EA/OO vehicle and instilled with saline, IN instillations of EA/OO
vehicle and instilled with ovalbumin, IN instillations of CBN and instilled with
saline, IN instillations of CBN and instilled with ovalbumin. Bars represent
cytokine mRNA relative to the saline/vehicle control 1 standard error of the mean
(n = 6/group). * = Significantly greater than saline-instilled controls (p<0.05). @
= significantly greater than lL-13 levels in the ovalbumin-instilled group treated
with IN CBN (p<0.05).

106

this difference was not deemed statistically Significant. Mice sensitized and
challenged with ovalbumin had a 23.8-fold increase in lung-derived IL-10 mRNA
expression relative to saline-exposed controls. IN CBN co-treatment reduced the
ovalbumin-induced increase in lL-1O mRNA by 1.4-fold, although this difference
was also not statistically significant. Mice sensitized and challenged with
ovalbumin had a 10.1-fold increase in lung-derived IL-13 mRNA expression
relative to saline-exposed controls. IN CBN co-treatment Significantly reduced
the ovalbumin-induced increase in lL-13 mRNA by 2.3-fold. Ovalbumin and/or IN

CBN did not have any effect on the expression of IFN-y within the lung.

107

 

et I
inh

alle

exp
With
Cam
thus
CElnr

0f al

DISCUSSION

The primary objective of this study was to determine if CBN administered
either via IP injection or IN instillation would suppress the hallmark pathologic
and immunologic features of allergic airway disease in the pulmonary airways of
mice sensitized and challenged via IN instillation of ovalbumin. Another objective
was to demonstrate a strong link between Th2 cytokine expression and the
ovalbumin-induced allergic airway response in this model by co—treating with
CBN, an inhibitor of Th2 cytokine expression. Morphologic changes in the
pulmonary ainrvays were correlated with changes in cytokine gene expression in
the lung after ovalbumin and/or CBN treatment.

Several reports describe the effects of cannabinoids on T cell cytokine
gene expression. Cannabinoids have been shown to inhibit the expression of the
T cell cytokines lL-2, IL-4 and IL-5 using in vitro T cell cultures systems (Condie
et al, 1996; Herring et al, 1998; Berdyshev, 2000; Jan and Kaminski. 2000). The
inhibitory effects of cannabinoids were also demonstrated in an in vivo model of
allergic airway disease. In a previous study, Jan et al, 2003, demonstrated that
IP cannabinoid treatment suppressed the ovalbumin-induced increase in IL-2
expression and the expression of the Th2 cytokines lL-4, IL-5, IL-10 and lL-13
within the lungs of NJ mice (Jan et al, 2003). These findings suggest that
cannabinoids may inhibit Th2 cytokine-mediated allergic ainIvay diseases and
thus possess potential therapeutic/prophylactic utility. The development of
cannabinoids as a class of potential therapeutics/prophylactics for the treatment

of allergic ainIvay disease must be done in parallel with the development of a

108

35
Im

lnl

method of intra-ainrvay delivery of these drugs in order to produce a high local
concentration of the drug in the lungs, the site of inflammation in asthma, and
minimize systemic toxicity. A method of intra-airway delivery of CBN was
achieved in the present study by intranasal instillation. CBN was dissolved in an
EA/OO vehicle and then administered via intranasal instillation before each
intranasal ovalbumin instillation during both sensitization and challenge.

The airways of asthmatics are characterized by the presence of chronic
inflammation with infiltration of lymphocytes, plasma cells, eosinophils, and mast
cells in the bronchial mucosa and epithelial changes that include MCM (Holgate,
2000, Wills-Karp, 1999). These effects are mediated, in part, by Th2 cytokines
including IL-4, IL-5, and IL-13. A histopathologic assessment of the pulmonary
airways of ovalbumin-exposed mice co-treated with IP injections or IN instillations
of CBN was made to determine if CBN inhibited some of the characteristic
features of allergic airway disease. IP CBN co—treatment significantly reduced
the ovalbumin-induced increase in IM in the surface epithelium lining the main
axial airway of the left lung lobe. The inhibition of these pathologic features is
consistent with our previous findings that Showed that IP CBN attenuated many
of the pathologic features in the airways of NJ mice that resulted from IP
sensitization and airway challenge with ovalbumin. In the IN CBN study, an
assessment of the BALF was made. Ovalbumin-exposed mice had a large
increase in the number of eosinophils, lymphocytes, and neutrophils in the BALF.
Interestingly, the neutrophil was by far the most numerous cell type in the BALF.

IN CBN Significantly reduced the ovalbumin-induced increase in eosinophils,

109

WC
sens

oval?

date
9pr
km»
W.
pro;
com

with

app

limit
SiLIc
"tire
and

and

lymphocytes, and neutrophils in the BALF. IN CBN co-treatment in mice
sensitized and challenged with ovalbumin, however, did not Significantly alter the
ovalbumin-induced increase in intraepithelial mucus. BALF cellularity may thus
be more sensitive to the effects of CBN than changes in IM. The lack of an
inhibition on the ovalbumin-induced increase in IM by IN instillations of CBN may
be due to the dose of CBN that was used and/or the vehicle that CBN was
dissolved in. The exact amount of CBN that entered the lungs after either route
of administration is unknown as no pharrnacokinetic studies were conducted to
determine the amount of CBN that entered the target tissue. The route of CBN
exposure that led to a higher local concentration of CBN in the lung was thus not
known. Although the dose of CBN that was administered via IN instillation, 500
pM, was much less than that administered via lP injection, Le, 50 mg/kg, the
proportion of each dose that entered the lung iS not known and thus the
conclusion that the dose may partly explain the differences in response observed
with the two routes of administration cannot be made.

The effect of intranasal CBN instillations on the allergic airway response in
appears to have been largely influenced by the vehicle that was used to dissolve
it. The viscous nature of EAIOO likely limited access of the lung to CBN, thus
limiting the effect of CBN on the inflammatory response within the lung. In pilot
studies designed to assess the distribution of the EAIOO after IN instillation, I
intranasally instilled the dye Sudan Black dissolved in EAIOO (refer to Chapter 4)
and determined that most of the instilled volume ended up in the nasal airways

and gut and very little in the lung. One method that can be potentially used to

110

improve CBN distribution with intranasal instillation is the development of a less
viscous vehicle that is also non-volatile and non-irritating to the ainrvay
epithelium. An alternative method to improve distribution with intranasal
instillation of CBN is the development of a water-soluble formulation of CBN with
equal immune-modulating potency. This would allow the dissolution of CBN in
an aqueous vehicle, which when intranasally instilled, distributes to the lung, thus
increasing the local concentration of CBN in the lung. Methods of intra-airway
delivery other than intranasal instillation may alternatively be used to determine if
intra-airway delivery of CBN will inhibit the allergic airway response. They
include aerosol delivery of CBN or intratracheal instillation.

The preponderance of evidence suggests that Th2 cytokines play a crucial
role in the pathogenesis of allergic airway diseases such as asthma. Lung tissue
from mice sensitized and challenged with ovalbumin and co-treated with IP
injections of CBN or IN instillations of CBN was assessed for Th2 cytokine mRNA
expression to determine if CBN influenced the ovalbumin-induced expression of
these cytokines. Mice sensitized and challenged to ovalbumin in the IP CBN
study had a large increase in lung-derived lL-4 mRNA expression, the only
cytokine measured in that study. IP CBN co-treatment Significantly attenuated
the ovalbumin-induced increase in lL-4 mRNA. This data is consistent with the
inhibitory effects of cannabinoids on cytokine gene expression demonstrated
using in vitro models (Condie et al, 1996; Herring et al, 1998; Berdyshev, 2000;
Jan and Kaminski. 2000) and an in vivo model (Jan et al, 2003). IP CBN-

mediated inhibition of the lung-derived increase in IL-4 expression further

111

supports the data presented in Chapter 2 linking the ovalbumin-induced
pathologic changes to enhanced Th2 cytokine expression and suggests that Th2
cytokines are required for the elicitation of the pathologic changes in this model.
This finding also suggests that a chemical that causes a local increase in Th2
cytokine expression within the always, as in the studies described in Chapters 4
and 5 of this dissertation, may have allergenic potential in the respiratory tract.
The requirement of Th2 cytokines in the allergic airway response in this model
may have alternatively been tested by treatment with antibodies against specific
Th2 cytokines or using mice of the same strain that had one of their Th2 cytokine
genes such as IL-4 “knocked out.’ The rationale for using CBN was that its
therapeutic/prophylactic potential was also tested.

In the IN CBN study, the expression of the cytokines IL-4, IL-5, IL-10, IL-
13 and IFN-y mRNA was assessed. Mice sensitized and challenged with
ovalbumin in the IN CBN study had significant increases in the expression of the
Th2 cytokines lL-4, lL-5, lL-10, and lL-13 but no change in the expression of the
Th1 cytokine IFN-y. IN CBN did not affect the ovalbumin-induced increase in
lung-derived lL-4 mRNA expression. IN instillation of CBN did reduce the
ovalbumin-induced increase in IL-5 and lL-10, although these differences were
not statistically significant. IN CBN Significantly reduced the ovalbumin-induced
increase in lung—derived IL-13 mRNA expression, which may be more sensitive
to CBN-mediated effects. CBN, therefore, had a partial effect on the expression
of Th2 cytokines within the lung, but the CBN-induced inhibition of Th2 cytokine

expression was less than that resulting from IP CBN administration in this study

112

and in our previous study where CBN inhibited the ovalbumin-induced increase
in all the Th2 cytokines measured. The less pronounced effect on Th2 cytokine
expression by IN instillation of CBN may also be due to the ineffectiveness of the
vehicle EA/OO in distributing the drug to the lower airways.

lgE antibodies are critical effector molecules in the pathogenesis of
allergic airway disease that are largely controlled by the Th2 cytokines IL-4 and
IL-13. lgE molecules bind receptors on the surface of mast cells in sensitized
individuals and upon re-exposure to the offending allergen bind the allergen
triggering release of a number of mediators from the mast cell. Mast cell
mediators contribute to the vasodilation, bronchoconstriction and mucus
hypersecretion common in allergic airway diseases such as asthma. Total and
antigen-specific serum lgE levels were measured in mice sensitized and
challenged with ovalbumin and co-treated with IP CBN or IN CBN to determine if
CBN influenced the allergen-induced increase in IgE levels. Mice sensitized and
challenged with ovalbumin in the IP CBN study had a significant increase in
ovalbumin-Specific serum lgE but no increase in total serum lgE. IP CBN co-
treatment Significantly reduced the ovalbumin-induced increase in ovalbumin-
spec'rflc serum lgE. Mice sensitized and challenged with ovalbumin in the IN
CBN study had Significant increases in both ovalbumin-Specific IgE and total
serum lgE. IN CBN significantly reduced the ovalbumin-induced increase in both
ovalbumin-specific and total serum lgE. This is consistent with data from our
previous study that showed that IP CBN administration attenuated the

ovalbumin-induced increases in both ovalbumin-specific and total serum lgE (Jan

113

et al, 2003). Thus, IN CBN iS at least as effective in inhibiting allergen-induced
increases in lgE as IP CBN administration. The fact that both routes of CBN
administration similarly affected IgE levels and not cytokine levels or mucus
production may be related to the fact that serum lgE levels is a systemic
response that is in turn more sensitive than other more local aspects of the
allergic response.

The present study illustrated that CBN administered IP attenuated the
increase in IM, serum lgE, and lung-derived lL-4 mRNA expression elicited after
intranasal sensitization and challenge with ovalbumin. In addition, CBN
administered via IN instillation with an EAIOO vehicle attenuated the ovalbumin-
induced increase in total and antigen-specific serum lgE, the number of
inflammatory cells in BALF, and lung-derived lL-13 mRNA expression. lntranasal
CBN did not, however, affect the ovalbumin-induced mucus response in the
pulmonary airways, or lung-derived IL-4, lL-5, and lL-1O mRNA expression. The
failure to influence the ovalbumin-induced ainrvay mucus response and the
expression of the other Th2 cytokines by intranasal instillation of CBN may be
due to the failure of the CBN to distribute into the lung using an EAIOO vehicle.
This suggests that improved distribution of CBN into the lung by intranasal
instillation may lead to more significant attenuation of the allergen-induced airway
pathology and the Th2 cytokine increase. Nevertheless, the suppression of
some features of the ovalbumin-induced allergic airway response by intranasal

instillation of CBN supports further investigation of the intranasal delivery of CBN.

114

CHAPTER 4
PATHOLOGIC AND CYTOKINE RESPONSES IN THE RESPIRATORY TRACT

OF AIJ MICE AFTER INTRANASAL SENSTIZATION AND CHALLENGE WITH
TOLUENE DIISOCYANATE

115

ABSTRACT

Occupational asthma is the most frequently diagnosed respiratory disease
in the workplace and is often linked to low molecular weight (LMW) chemicals
such as toluene diisocyanate (T DI) that sensitize the respiratory tract.
Occupational asthma is characterized by smooth muscle hypertrophy, mucus
hypersecretion, epithelial desquamation and an inflammatory influx consisting of
lymphocytes, eosinophils, and neutrophils in the airways. Many experimental
models have linked the Th2 cytokine phenotype to LMW chemical-induced
occupational asthma. Most murine models of occupational asthma, however,
use systemic administration (e.g., dermal) to sensitize mice. The present study
was designed to test the hypothesis that intranasal sensitization and challenge to
TDI will induce the immunologic and pathologic responses in the lung that are
characteristic of LMW chemical-induced occupational asthma. A major obstacle
in the intranasal instillation of TDI is the selection of an appropriate vehicle to
dissolve the chemical in. TDI was intranasally instilled in a 1:1 ethyl acetate/olive
oil vehicle. Only TDI sensitized and challenged mice had an infiltration of
lymphocytes and plasma cells in the nasal airway, an increase in lung-derived IL-
4, lL-5, and IL-13 mRNA 48 hr after the final TDI instillation, and an increase in
total serum lgE 48 h after the final TDI instillation that persisted at that level 2
weeks after final TDI instillation. No pulmonary lesions were found in mice of any
group. This study is the first to demonstrate that intranasal administration of an

LMW chemical is an effective method of sensitization and results in an up-

116

regulation of critical mediators of allergic ainrvay disease, IL-4, lL-5, and lL-13

within the lung and serum lgE after challenge.

117

INTRODUCTION

Toluene diisocyanate (T DI) is a leading cause of occupational asthma and
allergic rhinitis (Petsonk, 2002; WHO, 1999). TDI is used to manufacture a
variety of different products including polyurethanes and varnishes and is a part
of a class of highly reactive LMW chemicals with a molecular weight of less than
1 kDa that sensitize the respiratory tract (Petsonk, 2002). Murine models have
been developed to assess the allergenic effects of LMW chemicals. Some
murine models of LMW chemical-induced allergic airway disease sensitize the
animals by dermal application and successfully induce features characteristic of
LMW chemical-induced allergic airway disease after intra-ainrvay challenge.
However, inhalation and not dermal exposure, is the most common and natural
route of exposure to LMW chemical respiratory allergens in occupational
settings. lntranasal instillation is a method of administration-that more closely
resembles inhalation than dermal exposure. In a previous study, I found that
intranasal sensitization and challenge with the protein ovalbumin in a saline
vehicle was a Simple, inexpensive, and noninvasive method of inducing lgE-
mediated allergic airway disease in the upper and lower respiratory tract of the
NJ mouse (refer to Chapter 3 of this dissertation, Farraj et al, 2003). It is not
clear, however, whether intranasal sensitization and challenge with known LMW
chemical respiratory allergens will induce the characteristic features of LMW
chemical-induced allergic airway disease.

One of the difficulties associated with the intranasal instillation of LMW

chemicals is the selection of a suitable, nontoxic vehicle in which to deliver these

118

We
2C
C11

ind

chemicals to the ainrvays. Most LMW chemicals linked to occupational asthma
and allergic rhinitis are lipophilic and hydrolyze in aqueous solutions, which
precludes the use of aqueous vehicles (Ebino et al, 1999). Also, many organic
solvents such as ethyl acetate and acetone are very irritating to the airway
mucosa. Ideally, a vehicle Should allow complete dissolution of the chemical and
should not induce cytotoxicity and/or inflammation in the respiratory tract. In the
present study, two vehicles, one consisting of ethyl acetate alone and the second
consisting of ethyl acetate and olive oil in a 1:1 combination, were tested for their
abilities to dissolve the chemical TDI and to distribute to the lower airways with
minimal induction of a cytotoxic/inflammatory response in the airway mucosa.
Ethyl acetate has been used in other models of LMW chemical-induced allergic
ainrvay disease that used intranasal instillation to challenge dermalIy-sensitized
mice to TDI (Scheerens et al, 1999).

The mechanism(s) of LMW chemical-induced allergic airway disease are
currently being elucidated. Th2 cytokines, however, have been implicated in
LMW chemical-induced allergic airway disease both in humans and in
experimental animal models. For example, the production of lL-4 and IL-5
proteins was increased in bronchial biopsies of patients with TDI-induced asthma
(Maestrelli et al, 1997). In addition, the selective enhancement of Th2 cytokines
was detected in several murine models of TDI-induced asthma (Herrick et al,
2002; Hayashi et al, 2001; Dearman et al, 1996). The methods by which
cytokine measurements are made vary in murine models of LMW chemical-

induced allergic ainrvay disease. They include the assessment of changes in

119

Cl
dr
br
pr.

rig

or
of '
ser
ind
disr
nas
wilt
cha
mes

alley

cytokine expression by measuring the secreted product of stimulated local
draining lymph nodes draining the site of dermal application or by analyzing
bronchoalveolar lavage fluid (BALF) for protein or mRNA expression. In the
present study, the local mRNA expression of Th2 cytokines was assessed in the
right lung lobe.

One objective of this study was to determine whether ethyl acetate alone
or 1:1 ethyl acetate and olive oil are suitable vehicles for the intranasal instillation
of TDI. A second objective of this study was to test the hypothesis that intranasal
sensitization and challenge with the known chemical respiratory allergen TDI will
induce the characteristic features of LMW chemical-induced allergic airway
disease in the nasal and pulmonary ainrvays. The pathologic changes in the
nasal and pulmonary ainrvays of mice after intranasal sensitization and challenge
with TDI were assessed. In addition, the right lung lobes were assessed for
changes in cytokine mRNA expression. This was done to examine the utility of
measuring local cytokine gene expression as a biomarker for the respiratory

allergenicity of LMW chemicals.

120

in:

Of

wr
inf
eitl
daj
dis:

C0n

MATERIALS AND METHODS

Animals and Chemical Sensitization and Challenge

A total of 54 male A/J mice (Jackson Laboratories, Bar Harbor, Maine), six
weeks of age, were randomly assigned to one of nine experimental groups. Mice
were free of pathogens and respiratory disease, and used in accordance with
guidelines set forth by the All University Committee on Animal Use and Care at
Michigan State University. Animals were housed six per cage in polycarbonate
boxes, on Cell-Sorb Plus bedding (A&W Products, Cincinnati, OH) covered with
filtered lids, and had free access to water and food. Room lights were set on a
12 hr light/dark cycle beginning at 6:00 am, and temperature and relative
humidity were maintained between 21-24°C and 40-55 % humidity, respectively.

Selection of Vehicle: A pilot study was performed to select a vehicle for
the purpose of sensitizing and challenging mice with TDI by the intranasal route.
Mice were anesthetized with 4% halothane and 96% oxygen and then
intranasally instilled with 30 pl of ethyl acetate alone or 1:1 ethyl acetate/olive oil
once per day for 5 consecutive days and sacrificed 24 h after the final instillation.
Nasal and pulmonary airways were examined histopathologically to determine
whether either vehicle caused any irritant effects (cytotoxicity and/or
inflammation). Mice were also intranasally instilled with 30 pl of 10 % TDI in
either ethyl acetate or 1:1 ethyl acetate/olive oil once per day for 5 consecutive
days and sacrificed 24 h after the final instillation to determine if the chemical
dissolved in either vehicle would distribute to the lung. The 10 % TDI

concentration was adapted from the work of Sugawara et al, 1993 who

121

 

n1

oil

Wit

administered 10 % TDI by aerosol exposure. A vehicle was selected after
examining nasal and pulmonary tissue sections for any histologic change and
assessing the BALF for changes in lung cellularity (procedures described below).

SelectiLon of TDI Concentration: A pilot study was also performed to select
a concentration of TDI with which to use for the intranasal sensitization and
challenge of mice. The 10 % concentration of TDI that was used to determine
the distribution of the chemical in the selection of vehicle study caused severe
toxicity to the airway epithelium. A second pilot study was performed in which
mice were anesthetized with 4% halothane and 96% oxygen and then
intranasally instilled with 30 pl of ethyl acetate alone or TDI dissolved in ethyl
acetate alone at concentrations of 0.05, 0.1, or 0.5 % once per day for 5
consecutive days and sacrificed 24 h after the final instillation. Nasal and
pulmonary airways were examined histopathologically to determine whether
either TDI concentration caused any irritant effects. The dose that was least
irritating to the ainrvay after 5 intranasal instillations was selected. This was done
to distinguish the irritating effects of the chemical from any potential adaptive
immune response normally associated with TDI-induced allergic airway disease.
A concentration of 0.1 % was selected after examining nasal and pulmonary
tissue sections for any histologic change and assessing the BALF for changes in
lung cellularity (procedures described below).

Sensitization and challenge wim: The vehicle 1:1 ethyl acetate/olive
oil was used to dissolve TDI at a concentration of 0.1 %. Mice were anesthetized

with 4% halothane and 96% oxygen. The mice were then exposed to toluene

122

(n

in
al,
rol

Sac

diisocyanate (T DI) (Sigma-Aldrich, St. Louis, M0) at a concentration of 0.1 %
that was dissolved in a 1:1 ethyl acetate to olive oil vehicle. The animals were
treated by intranasal instillations consisting of a volume of 30 pl. Figure 4.1
depicts the exposure regimen utilized for intranasal sensitization and challenge of
mice with TDI. The mice were sensitized by a Single intranasal instillation on
Days 1 and 3. This sensitization regimen differed slightly from that used in the
ovalbumin studies described in Chapters 2 and 3 of this dissertation in terms of
the number of instillations. In the ovalbumin studies, five instillations were used
to sensitize the mice; in the present study only two instillations given one day
apart were used to sensitize the mice to TDI. This was because even with the
dose of 0.1 %, two animals died after just two consecutive one-day instillations.
The mice were then challenged with a single intranasal instillation on Days 17
and 27. There were 5 different treatment groups; 1) an untreated naive group; 2)
mice sensitized and challenged with the vehicle alone; 3) mice sensitized with
the vehicle alone and then challenged the first time with the vehicle and then the
second time ten days later with TDI in vehicle; 4) mice sensitized with TDI in
vehicle and then challenged with the vehicle alone; and 5) mice sensitized and
challenged with TDI in vehicle. Mice were sacrificed 48 h or 2 wk (Day 29 or Day
41) after the final instillation. One set of animals was sacrificed 48 hr after the
final challenge because in a previous study (refer to Chapters 2 and 3, Farraj et
al, 2003), we determined that in this period of time after challenge there was a
robust cytokine and morphologic response to ovalbumin. The second set was

sacrificed 2 weeks after the final challenge to histopathologically assess the

123

 

lat
tin

Exposure Regimen

 

 

 

 

1st 2nd
Sensitization challenge challenge
i i i i I
Day 1 3 17 27
A A A A 1 1
48h 2wksI

 

Figure 4.1: Timeline of the exposure regimen used to sensitize and challenge A/J
mice with 0.1 % TDl in 1:1 ethyl acetate/olive oil vehicle. Mice were sensitized
on days 1 and 3 with intranasal instillations of 30 pl of TDI in 1:1 ethyl
acetate/olive oil vehicle or vehicle alone. Mice were then challenged two weeks
later on day 17 with a Similar volume of TDI in vehicle and challenged a second
time 10 days later on day 27 followed by sacrifice 48 hr or 2 weeks after double
challenge. A = 30 pl of TDI in 1:1 ethyl acetate/olive oil vehicle or vehicle alone.
I = time after challenge when animals were sacrificed.

124

f0I

Cir

Per,

longer-term remodeling that takes place in the nasal airway in response to the

irritant and/or adaptive immune effects of TDI.

Necropsy, Blood Sample Collection and Tissue Preparation

Before sacrifice, mice were deeply anesthetized via intraperitoneal
injection of 0.1 ml of 12% pentobarbital in saline. Blood samples (0.1 to 0.5 ml)
were taken from the abdominal aorta and collected in Beckton Dickinson
vacutainers. Serum samples were collected after the blood samples were
centrifuged to remove cells and the supematants were frozen and stored at -
20°C. The abdominal aorta and renal artery were then severed to exsanguinate
the animals. Immediately after death, the trachea was cannulated and the
heart/lung block removed. A syringe was then attached to the cannula and BALF
was collected from the whole lung via two sequential changes of 1 ml saline.
Differential cell counts were determined by cytocentrifuging cells onto glass
slides and then staining with Diff-Quik (DADE Behring, Newark, DE).
Neutrophils, macrophages, eosinophils, lymphocytes other cell types were
microscopically identified and their numbers were determined by multiplying the
percentage of each cell type from a total of 200 cells by the total number of cells
per ml of lavage fluid. The right bronchus was clamped using suture thread. All
four right lung lobes were placed in 2 ml Tri reagent (Molecular Research Center,
Cincinnati, OH), homogenized and stored at -80°C.

After removal of the right lung lobes, the left lung lobe was intratracheally

perfused with 10% neutral buffered formalin at a constant pressure of 30 cm of

125

fixative. After 1 hr, the trachea was ligated, and the inflated left lung lobe was
immersed in a large volume of the same fixative for 24 hr. After fixation, the left
lung lobe was microdissected along the axial aimays, and two sections were
then excised at the level of the fifth (proximal airway) and eleventh (distal airway)
airway generation (Figure 4.2), as has been described previously in detail
(Steiger et al, 1995). Tissue sections were embedded in paraffin, at a thickness
of 5 microns, and stained with hematoxylin and eosin for histopathologic
assessment or with Alcian blue (pH 2.5) and periodic acid Schiff's (AB/PAS)
reagent, which stains neutral and acidic mucosubstances.

The head of each mouse was removed from the carcass, and the lower
jaw and skin were removed. The heads were then immersed in 10% neutral
buffered formalin for 24 hr. After fixation, the heads were decalcified in 13%
formic acid for 7 days and then rinsed in tap water for at least 4 hr. The nasal
cavity of each mouse was transversely sectioned at three specific anatomic
locations according to a modified method of Young (1981) and processed for
light microscopy and image analysis. The most proximal nasal section was taken
immediately posterior to the upper incisor teeth (proximal); the middle section
was taken at the level of the incisive papilla of the hard palate (middle); the most
distal nasal section was taken at the level of the second palatal ridge (distal)
(Figure 4.2). Tissue sections were embedded in paraffin, at a thickness of 5
microns, and stained with hematoxylin and eosin for histopathologic assessment.
Paraffin sections were also stained with ABIPAS to identify intraepithelial

mucosubstances (IM).

126

SITES FOR LIGHT MICROSCOPIC ANALYSIS

 
  
  

4. Proximal axial airway

 

1. Proximal nasal airway

 

 

2. Middle nasal airway Heart Left Lung Lobe

3. Distal nasal airway

Figure 4.2: Sites of airway tissue selection for morphometric analysis. The
cartoon depicts the lateral wall of one nasal passage with the septum removed of
the murine respiratory tract and the main axial ainrvay of the left lung lobe.
Transverse sections of the nasal cavity were taken 1) immediately posterior to
the upper incisor teeth (T1), 2) at the level of the incisive papilla of the hard
palate (T2), and 3) at the level of the second palatal ridge (T3). The left lung lobe
was microdissected along the axial airways, and two sections were then excised
at the level of the fifth (proximal airway) and eleventh (distal ainlvay) airway
generation.

127

ELISA for Total semm lgE

Total serum lgE was measured using a 96-well lmmulon ELISA plate
(Dynex, Technologies, Chantilly, Virginia) coated with 2 Dg/ml anti-mouse lgE
(Purified Rat Anti-Mouse lgE Monoclonal Ab, Pharmingen, San Diego, CA) and
incubated overnight at 4°C. After washing, the plates were incubated in 3 %
Bovine Serum Albumin (3 % BSA) at 37°C for 1 hr. (BSA, CALBIOCHEM, La
Jolla, CA). Serum samples at 1:10 dilution were then added followed by
incubation at 37°C for 1 hr. After washing, biotinylated anti-mouse lgE (Biotin-
conjugated Rat Anti-Mouse lgE Monoclonal Ab, Pharmingen, San Diego, CA)
was then added at 2 pglml and allowed to incubate at 25°C for 1 hr. After
washing, 1.5 pglml of streptavidin peroxidase was added followed by incubation
at 25°C for 1 hr. After washing, TMB substrate (12.5ml citric-phosphate buffer 1-
200 pl of TMB stock solution (6mg/ml in DMSO)) was addedto produce a color
reaction. The reaction was terminated by the addition of 6 N H2804, Optical
density was determined at 450 nm using an EL-808 microplate reader (Bio-Tek

instruments, Winooski, Vermont).

Real-time RT-PCR

Total RNA was isolated from the right lung lobes using the TRI REAGENT
method (Molecular Research Center, Cincinnati, OH) following the
manufacturer’s protocol. The evaluation of the relative expression levels of the
cytokines IL-4, IL-5, lL-10, IL-13, and IFN-ry mRNA was determined using the

TaqMan one-step real-time multiplex RT-PCR with TaqMan pre-developed

128

primers and probe using the manufacturer's recommended protocol (Applied
Biosystems, Foster City, CA). Briefly, aliquots of isolated tissue RNA (100 ng
total RNA) were added to the RT-PCR reaction mixture, which included the target
gene (IL—4, lL-5, lL-10, IL-13, or IFN-y) primers and probe, endogenous reference
primers and probe (188 ribosomal RNA), AmpliTaq DNA polymerase and
Multiscribe reverse transcriptase (MuLV). The probes are designed to exclude
detection of genomic DNA. RNA samples were first reverse transcribed and then
immediately amplified by PCR. Following the PCR, amplification plots (change in
dye fluorescence versus cycle number) were examined and a dye fluorescence
threshold within the exponential phase of the reaction was set separately for the
target gene and the endogenous reference (188). The cycle number at which
each amplified product crosses the set threshold represents the CT value. The
amount of target gene normalized to its endogenous reference was calculated by
subtracting the endogenous reference CT from the target gene CT (ACT).
Relative mRNA expression was calculated by subtracting the mean ACT of the
control samples from the ACT of the treated samples (AACT). The amount of
target mRNA, normalized to the endogenous reference and relative to the

calibrator (i.e., RNA from control) is calculated by using the formula 2'MCT.

Statistics
The data obtained from each experimental group were expressed as a
mean group value i the standard error of the mean (SEM). The differences

among groups were determined by one way or two-way analysis of variance

129

Sig

(ANOVA) and an All Painrvise Post-hoc Comparison Test (Tukey). using

SigmaStat software from Jandel Scientific Co. (San Rafael, CA).

130

Sho

Airw

and
elite
muc
infill
irrite
inlrz
IGSI
to I
vet
cor
rhir
Drc
I03
the
the

infi

Wa

RESULTS

Short-term Pilot Studies
Airway pathology and BALF data

A pilot study was performed to assess the irritant effects of ethyl acetate
and 1:1 ethyl acetate/olive oil and their abilities to distribute TDI into the lungs
after intranasal instillation. Ethyl acetate was irritating to the nasal airway
mucosa indicated by mild epithelial necrosis accompanied by a mild neutrophilic
infiltrate (Figure 4.3). Ethyl acetate when combined with olive oil was less
irritating to the nasal ainrvay epithelium than ethyl acetate alone (Figure 4.3). The
intranasal instillation of 10 % TDI in ethyl acetate and or 1:1 ethyl acetate/olive oil
resulted in Similar increases in neutrophils and macrophages in the BALF relative
to either vehicle alone indicating that intranasal instillation of TDI with either
vehicle resulted in distribution of TDI into the lung (Figure 4.4). TDI at a
concentration of 10 % in either vehicle caused an acute to severe necrotizing
rhinitis characterized by tremendous neutrophilic infiltration and light pink
proteinacious exudates that almost entirely occluded the nasal passages and
loss of turbinate bone (Figure 4.5). Additional evidence that TDI distributed into
the lung was the presence of necrosis and Sloughing of the ainrvay epithelium
that lined the main axial ainlvay of the left lung lobe accompanied by neutrophilic
infiltration (Figure 4.6).

A second pilot study was performed to select a concentration of TDI that

was minimally irritating to the airway mucosa. A much lower range of

131

 

FiQUre
nasal
and Q.
Blithe

 

Ethyl

acetate

 

 

Ethyl
acetate!
Olive oil

 

 

 

 

 

 

Figure 4.3: Light photomicrographs of the proximal septum from the proximal
nasal airways of mice intranasally instilled with ethyl acetate or 1:1 ethyl acetate
and olive oil. Trssues stained with hematoxylin and eosin. Arrow = Sloughed off
epithelial cells and neutrophils. Star = basal lamina with epithelium Stripped off.

132

I‘nII—IHI D AI (-

Flgu
10136:
10106
°/. Tl
lepre
the r

1e+5 .

 

7/////. lymphocytes

 

 

 

m neutrophils *
E macrophages
89"“ ‘ 833333 eosinophils *
L".
< 6e+4 ‘
a:
E
2
E 4e+4 -
0
2e+4 -

       

 

 

E f; :1 7 I;2;.;.;I
Ethyl acetate 10% TDI Ethyl 10% TDI
Olive Oil EAIOO Acetate EA
(EAIOO) (EA)

Figure 4.4: Total number of inflammatory cells in the BALF from the left lung
lobes of mice intranasally instilled 5 times with 1:1 ethyl acetate/olive oil, 10 %
toluene diisocyanate (T DI) in 1:1 ethyl acetate/olive oil, ethyl acetate alone, or 10
% TDI in ethyl acetate alone and sacrificed 24 hr after the final instillation. Bars
represent mean number of inflammatory cells per ml BALF 1 standard error of
the mean (n = 5/group).

133

Fl.
inl

 

 

10% TDI
in EA

 

 

 

 

Figure 4.5: Light photomicrographs of the proximal nasal ainrvay of mice
intranasally instilled with ethyl acetate alone or 10 % toluene diisocyanate (T DI)
in ethyl acetate. Trssues stained with hematoxylin and eosin. S = nasal septum,
N = nasoturbinate, e = surface epithelium.

Flgl
of

(11181
e =

 

Ethyl
Acetate ‘

10% TDI
in EA

 

 

Figure 4.6: Light photomicrographs of the main axial airway of the left lung lobe
of mice intranasally instilled with ethyl acetate alone or 10 % toluene
diisocyanate (T DI) in ethyl acetate. Tissues stained with hematoxylin and eosin.
e = ainNay epithelium, L = airway lumen.

135

concentrations of TDI were selected in order to minimize toxicity to the airway
mucosa caused by 10% TDI. lntranasal instillation of 0.05, 0.1 and 0.5 % TDI in
ethyl acetate all led to an acute necrotizing rhinitis characterized by epithelial
necrosis and neutrophilic infiltration with 0.5 % resulting in the most severe lesion
(Similar to Figure 4.8E). These lesions were much less severe than that caused
by the intranasal instillation of 10 % TDI. No pulmonary lesions resulted,
however, with any of the concentrations of TDI (similar to the pulmonary always
of mice exposed to ethyl acetate alone as in Figure 4.6). There was an increase
in the number of macrophages in the BALF with all three concentrations of TDI

(Figure 4.7).

Mice Sensitized and Challenged with TDI
Airway Pathology

The vehicle 1:1 ethyl acetate/olive oil was selected for use in the
intranasal instillation of TDI because of its less irritating effects on the nasal
airway mucosa than ethyl acetate alone. The concentration of 0.1 % TDI was
selected to intranasally sensitize and challenge the mice with because of its less
toxic effects on the nasal ainrvay mucosa than 0.5 %.

Mice that were intranasally instilled with TDI in vehicle had an acute,
necrotizing rhinitis at 48 hr post instillation. At 48 hr post-instillation, there was
extensive necrosis of the transitional and respiratory mucosa lining the medial
and lateral meatus in the proximal nasal passages (Figure 4.8). Though the

airway injury was bilateral, often the nasal passage was more severely affected.

136

 

lol
tol

Te;
the

2.50'0-5 -

 

 

 

 

 

 

   

 

 

Eosinophils
Lymphocytes
2 094,5 _ E Neutrophils *
' m Macrophages
u.
a’
m 1.5e-I-5 -
'5'
I-
8
L” 1.0e+5 ~
TI
0
5.0e+4 - ::::
0.0 a an I::: ;::: :§;§;§_;§;;
Naive Ethyl 0.05 % TDI 0.1% TDI 0.5 /0 TDI
Acetate .

Figure 4.7: Total number of inflammatory cells in the BALF from the left lung
lobes of mice intranasally instilled 5 times with ethyl acetate/olive oil, 10 %
toluene diisocyanate (TDI) in ethyl acetate/olive oil, ethyl acetate alone, or 10 %
TDI in ethyl acetate alone and sacrificed 24 hr after the final instillation. Bars
represent mean number of inflammatory cells per ml BALF :1: standard error of
the mean (n = Slgroup). *-Significantly greater than na'I've group (p<0.05).

137

int

 

 

 

 

Figure 4.8: Light photomicrographs of the maxilloturbinates from the proximal
nasal airways of naive mice (A), mice sensitized and challenged with 1:1 ethyl
acetate/olive oil vehicle (B), mice sensitized with 0.1 % TDI in vehicle and
challenged with vehicle (C), mice that were sensitized with vehicle and
challenged the first time with vehicle and the second time with 0.1 % TDI (D), and
mice sensitized and challenged with 0.1 % TDI (E). Trssues stained with
hematoxylin & eosin. e = surface epithelium; b = turbinate bone; v = blood vessel
in the lamina propria of the nasal mucosa.

138

SI

Surface epithelium lining the mid-septum, maxilloturbinates and lateral wall were
most severely affected with extensive exfoliation. An attenuated regenerative
cuboidal epithelium (one or two cells thick) replaced some of the affected ainIvay
surfaces. Degeneration and necrosis of the underlying lamina propria was
present in some areas (full thickness necrosis). A marked influx of neutrophils
was associated with the mucosal injury. Aggregates of neutrophils were present
in the nasal lumen and throughout the nasal mucosa in the affected regions.

Mice that were instilled with TDI and sacrificed 48 hr after instillation also
had locally extensive areas of necrosis and degeneration of the olfactory mucosa
lining the nasal septum and ethmoturbinates in the middle and distal nasal
passages. Unlike the TDI-induced lesions in the transitional and respiratory
mucosa, no inflammatory cell influx was associated with these lesions in the
olfactory mucosa.

Mice that were sacrificed 2 weeks after the last TDI instillation irrespective
of whether they were sensitized with TDI or vehicle had a mild to moderate
rhinitis with minimal mucosal degeneration. The surface epithelium lining the

middle and lateral meatus was a regenerative stratified cuboidal epithelium with
few ciliated cells. The epithelium covering some of these areas was moderately
to markedly hyperplastic.
In addition, conspicuous changes were found in the ethmoturbinates of
mice sacrificed 2 weeks after the last TDI instillation irrespective of whether they
Were sensitized with TDI or vehicle. There was a marked remodeling of

ethmoturbinates characterized by loss and fusion of turbinates, proliferation of

139

the turbinate bone, interstitial fibrosis of mucosal tissue, loss of subepithelial
glands and nerve bundles, and marked respiratory metaplasia (i.e., replacement
of normal olfactory epithelium by ciliated respiratory epithelium). Often, large
accumulations of PAS-positive mucoid partially filled the luminal airspaces in the
affected ethmoid region of the nose.

Sensitization and challenge with TDI did not cause a marked increase of
lymphoid cells or eosinophils in the nasal mucosa. However, there were small
aggregates of plasma cells and Russel bodies in the areas of the lamina propria,
in the areas of ethmoturbinate 48 h after the final TDI instillation (data not
Shown).

Interestingly, no conspicuous pulmonary changes suggestive of airway
injury or an allergic immune response were microscopically detected in the lungs
of TDI-treated mice (similar to the pulmonary always in mice instilled with ethyl

acetate alone as in Figure 4.6).

BALF
The total number of cells in the BALF was determined at 48 hr and 2
weeks after the second challenge. There were no statistically significant
differences in the total number of cells in the lavage fluid in any of the treatment
groups relative to the untreated naive control at either 48 hr or 2 weeks after the
Second challenge (levels similar to the levels in the lungs of the naive mice
depicted in Figure 4.7). The predominant cell type in all of the groups including

the untreated naive group was the macrophage.

140

Total Serum lgE

Mice sensitized and then challenged twice with TDI had a Significant
increase in serum lgE that was approximately 6-fold the level of the naive control
mice at 48 hr after the final challenge and persisted at that level at least until 2
weeks after the final challenge (Figure 4.9). Mice in all of the control groups
exhibited comparable levels of total serum lgE that were not statistically different

from the naive untreated mice.

Cytokine Gene Expression

Mice intranasally sensitized and challenged with TDI had significant
increases in the lung-derived mRNA expression of IL-4, IL-5, and IL-13 48 h after
the final TDI instillation relative to the naive controls. TDI sensitized and
challenged mice had a 6.7-fold increase in lL-4 mRNA expression, a 5.9-fold
increaSe in IL-5 mRNA expression, and an 119-fold increase in IL-13 expression
compared to the untreated naive group (Figure 4.10). TDI sensitized and
challenged mice also had a 15.3-fold increase in IL-10 mRNA expression within
the lung but this was not deemed statistically significant. There was no increase
in the mRNA expression of the Th1 cytokine IFN-y in mice sensitized and
challenged with TDI. There were also no significant increases in the mRNA
expression of any of the Th2 cytokines or IFN-y in any of the other treatment
groups relative to the untreated naive group. No significant changes in the
expression of any of the Th2 cytokines or IFN-y were detected in the lungs of any

mice 2 weeks after the second challenge (T able 4.1).

141

1.0 -

 

 

 

 

 

 

 

 

2.5
0
g - 48 h
_ 0 s , 2 wks *
u .
O
'8
O
5 0.6 -
O
s
X
o
“g 0.4 J
c
o
3
:I 0.2 -
.§
0.0 _ . _ .. ,- 931-: ,
Sensltlzatlon Naive Vehlcle. Vehicle 0.1% TDI 0.1% TDI
I l I I I
1st Challenge Vehlcle Vehicle Vehicle 0.1% TDI
I I I l l
2nd Challenge Vehlcle 0.1 96 TDI Vehicle 0.1% TDI

Figure 4.9: Total lgE levels in mouse serum isolated 48 hr or 2 weeks after
double challenge with 0.1 % TDI. Mice were sensitized with intranasal
instillations of 30 pl of 0.1 % TDI in 1:1 ethyl acetate/olive oil vehicle. Mice were
then challenged two weeks later with a similar volume and challenged a second
time 10 days later followed by sacrifice 48 hr or 2 weeks after double challenge.
Bars represent average optical density i standard error of the mean (n =
Slgroup). * = significantly greater than all other groups sacrificed at same time
after challenge.

142

 

 

 

 

 

   

    
   

 

 

_ 30 .1

g - lL-4

g m lL-5 _

o 25‘ — IL-10 “

.5 [2:3 lL-13

g 20- _ IFN-y

g *

L' 15--

O

0:

<

g 10-

E

O

..E

x s—

3.-

o

,_ . I .. I _
Sensltlzatlon Naive Vehicle Vehicle TDI ‘ TDI
l I I I I
18' Challe'nge Vehlcle Vehlcle Vehlcle TDI
l I I I

2"“ °"'"°"9° Vehlcle TDI Vehlcle TDI

Figure 4.10: Relative quantification of lL-4, lL-5, IL-10, lL-13, and IFN-y mRNA in
right lung lobes 48 hr after double challenge with 0.1 % TDI. Mice were
sensitized with intranasal instillations of 30 pl of 0.1 % TDI in 1:1 ethyl
acetate/olive oil vehicle. Mice were then challenged two weeks later with a
similar volume and challenged a second time 10 days later followed by sacrifice
48 hr after double challenge. Bars represent cytokine mRNA relative to the
naive control i standard error of the mean (n = 6/group). * = significantly greater
than all other groups at Similar time-point (p<0.05).

143

Table 4.1: Summary of Th2 and Th1 cytokine mRNA expression changes within
the right lung lobes after TDI sensitization and challenge.

 

 

 

 

 

Cytokine Change 48 h post TDI Change 2 wk post TDI
sensitization/challenge sensitization/challenge
lL-4 Significant Increase No Significant change
lL-5 Significant Increase No significant change
IL-10 Increase not significant No Significant change
IL-13 Significant Increase No significant change

 

 

IFN-y

 

No Significant change

 

No Significant change

 

144

 

DISCUSSION

One objective of this study was to determine whether or not ethyl acetate
alone or 1:1 ethyl acetate and olive oil are suitable vehicles for the intranasal
instillation of the known chemical respiratory allergen, TDI. A second objective
was to test the hypothesis that intranasal sensitization and challenge with TDI will
induce the characteristic features of LMW chemical-induced allergic airway
disease in the nasal and pulmonary airways. Morphologic changes in the nasal
and pulmonary airways were assessed in addition to changes in cytokine gene
expression in the lung after TDI treatment to determine if local cytokine gene
expression may be used as a biomarker for the respiratory allergenicity of
selected LMW chemicals.

One major obstacle in the intranasal instillation of LMW chemicals has
been the selection of an appr0priate vehicle that is not irritating to the airway
epithelium and that allows distribution of the chemical into the lower ainrvays. In
the present study, the vehicles ethyl acetate and 1:1 ethyl acetate/olive oil were
compared to determine which vehicle was most suitable for use in the intranasal
sensitization and challenge of mice with TDI. The vehicle ethyl acetate alone
when intranasally instilled caused more stripping of the ainrvay epithelium and
neutrophilic inflammation in the nasal airways than the vehicle 1:1 ethyl
acetate/olive olive. The addition of olive oil to ethyl acetate limited the irritant
effects of ethyl acetate. Ethyl acetate has been documented as an irritant to the
eyes and the mucous membrane of the respiratory passages of humans

(Mackison et al, 1981). Ethyl acetate has also been shown to cause toxicity in

145

the nasal ainrvays of Sprague Dawley rats with the lesions being most severe in
the olfactory epithelium (Hardisty et al, 1999). In addition, both vehicles
appeared equally capable of distributing 10 % TDI into the lungs after intranasal
instillation indicated by the induction of similar increases in inflammatory cells in
BALF. Ethyl acetate/olive oil in a 1:1 combination was thus selected as a vehicle
to dissolve TDI in this study because of the less irritating effects on the ainNay
epithelium. A concentration of 0.1 % TDI was selected to sensitize and
challenge the mice because it caused less ainrvay irritation than 0.5 %.

Individuals afflicted with occupational asthma often suffer from concurrent
allergic rhinitis. Some studies suggest that allergic rhinitis due to workplace
exposure to LMW chemicals usually coexists with occupational asthma (Leynaert
et al, 2002). The pathologic features of TDI-induced allergic rhinitis are Similar to
non-occupational allergic rhinitis and include plasma exudation, hyper-secretion
of mucus, and cellular infiltrates consisting of T- and B-lymphocytes, eosinophils,
and plasma cells in the nasal airway (WHO, 1999). The nasal airways of mice
intranasally sensitized and challenged to TDI were examined histologically to
determine if the ainIvay response was Similar to TDI-induced allergic rhinitis in
humans. Both TDI-sensitized and non-sensitized mice had an acute rhinitis,
which indicates that they were caused by the irritating effects of the chemical and
were not immune-mediated. However, only mice that were intranasally
sensitized and challenged with TDI had small aggregates of plasma cells and
Russel bodies in the lamina propria of the ethmoturbinate 48 h after the final TDI

instillation, indicative of an immune-mediated effect.

146

The Th2 subtype of the CD4‘ T lymphocyte produces a unique profile of
cytokines that has been linked to the pathogenesis of LMW chemical-induced
allergic ainrvay disease (Maestrelli et al, 1997; Herricket al, 2002; Hayashi et al,
2001; Dearman et al, 1996). Th2 cells produce IL-4, IL-5, lL-10, and lL-13 (Yssel
and Groux, 2000). lL-4 promotes T cell activation and differentiation into the Th2
subtype while both lL-4 and lL-13 promote lgE production in B cells and mucus
production in the airways (Shim et al, 2001; Frew, 1996). lL-5 is a chemotactic
factor for eosinophils (Frew, 1996). Various methodologies for cytokine analysis
are used in murine models of LMW chemical-induced allergic airway disease
including the assessment of changes in BALF-derived cytokine content and the
analysis of local draining lymph node cells that have been re-stimulated with a
mitogen in vitro. In the present study, I assessed Th2 or Th1 cytokine mRNA
expression in RNA isolated from the lungs of mice intranasally instilled with TDI.
Only TDI sensitized and challenged mice had significant increases in lung-
derived lL-4, lL-5, and IL-13 mRNA expression 48 h after final TDI instillation.
There was no Significant change in the expression of the Th1 cytokine IFNJY in
any of the treatment groups. These findings support the possibility that LMW
chemicals linked to occupational asthma selectively express Th2 cytokines and
that Th2 cytokine expression within the lung may be used to identify chemical
respiratory allergens.

The role of IgE antibodies in the pathogenesis of LMW chemical-induced
occupational asthma and allergic rhinitis is unclear and controversial. Only 10 to

30 % of all cases of TDI-induced occupational asthma, for example, exhibit

147

increases in lgE antibodies (Weissman and Lewis, 2000). Investigators have
suggested that the failure to establish a consistent link between high circulating
IgE levels and LMW chemical-induced allergic ainrvay disease is due to the
deficiencies in lgE detection methods (Kimber et al, 2002) while others have
demonstrated that non-IgE-dependent mechanisms of LMW chemical-induced
allergic airway disease may exist (Herrick et al, 2002; Larsen et al, 2001;
Bernstein, 2002). Nevertheless, we found that mice intranasally sensitized and
challenged with TDI exhibited increases in total serum lgE suggesting that lgE
may play a role in TDI-induced allergic airway disease.

In the present study, no pulmonary lesions were found in any group
instilled with TDI. The absence of pathologic changes, whether irritant-induced
or immune-mediated in the pulmonary ainIvayS, suggests that there may have
been poor distribution of the chemical into the lung or that the airway mucosa of
the pulmonary airways is less sensitive to the effects of TDI. The viscosity of
ethyl acetate and olive oil as a vehicle may have prevented effective aspiration of
the chemical and distribution of the chemical into the lower airways. The
distribution of ethyl acetate and 1:1 ethyl acetate/olive oil into the lower ainIvayS
was also determined after the intranasal instillation of the dye Sudan black in
either vehicle and it was found that most of the solution distributed to nasal
airways and gut. In addition, the inherent high reactivity of the chemical may
have played a role in limiting the distribution of the chemical to the lower airways.
A majority of the chemical administered via intranasal instillation may have

reacted with proteins in the upper airways of these mice thus serving to limit

148

distribution of the chemical into the lower airways. Greenberg et al, 1994,
reported that after aerosolized toluene diisocyanate exposure in guinea pigs, the
vast majority of the chemical remained in the nasal airway.

The source of the TDI-induced increase in lung-derived Th2 cytokine
mRNA expression is unknown given the absence of pulmonary airway
inflammation with an associated lymphocyte infiltrate in the regions of the lung
examined. Several possibilities exist that may explain this increase. One is that
the increase originated from infiltrating lymphocytes in areas of the lung not
examined histologically such as the right lung lobes or more proximal regions of
the left lung lobe. Another possibility is that the source of the cytokines was the
bronchial-associated lymphoid tissue or the ainNay epithelium. Or perhaps a
systemic immune response was elicited that originated in some other region of
the respiratory tract that caused an increase in lymphocytes in the circulation and
likewise the pulmonary vasculature. Further studies are required to determine
the exact source.

The vehicle used in this study, 1:1 ethyl acetate/olive oil, although less
irritating to the nasal ainrvay epithelium than ethyl acetate alone, did irritate the
ainrvay epithelium. The vehicle, in some instances, caused stripping of the nasal
ainrvay epithelium, which was accompanied by a mild neutrophilic infiltrate. The
toxicity of the vehicle made it difficult, in some cases, to distinguish between
vehicle-induced effects from TDI-induced effects. In addition, a Single intranasal
instillation of TDI at a concentration of 0.1 % elicited substantial toxicity to the

nasal ainIvay that was not immune-mediated. The severity of the toxic response

149

made it difficult to distinguish irritant-induced effects from immune-mediated
effects of TDI. Most cases of LMW chemical-induced asthma result from
immune-mediated mechanisms (Beach et al, 2000). The use of lower
concentrations of the chemical will limit the irritant/toxic effects of the chemical
and facilitate the discernment of the immune-mediated effects.

The present study illustrated that the intranasal instillation of TDI resulted
in some of the characteristic pathologic and immunologic features of TDI-induced
allergic airway disease. TDI sensitization and challenge caused lymphocyte and
plasma cell infiltration in the nasal airway, an increase in lung-derived Th2
cytokine mRNA expression, and an increase In serum lgE suggesting that the
analysis of local cytokine gene expression in the respiratory tract after intranasal
exposure may prove useful in the identification of other allergenic chemicals.
However, the vehicle-induced ainrvay toxicity, the likely insufficient distribution of
the chemical into the lower ainrvays after intranasal instillation, and the irritant
effects of TDI on the ainrvay epithelium are all major obstacles that must be
overcome before this approach can be used to evaluate the allergenic potential

of LMW chemicals in the respiratory tract.

150

CHAPTER 5

PATHOLOGIC AND CYTOKINE RESPONSES WITHIN THE NASAL AND
PULMONARY AIRWAYS OF AIJ MICE AFTER INTRANASAL SENSITIZATION
AND CHALLENGE WITH TRIMELLITIC ANHYDRIDE,
DINITROCHLOROBENZENE, OR OXAZOLONE

151

ABSTRACT

Sensitization of the respiratory tract to low molecular weight (LMW)
chemicals including trimellitic anhydride (TMA) is a leading cause of occupational
asthma and allergic rhinitis in industrial settings. Mucus hypersecretion and
airway inflammation consisting of lymphocytes and eosinophils are pathologic
features of allergic airway diseases. Many experimental models have linked
LMW chemical-induced allergic airway disease to Th2 cytokine expression. Most
murine models, however, use systemic administration (e.g., dermal) to sensitize
mice. The present study tests the hypothesis that intranasal sensitization and
challenge with TMA will induce the immunologic and pathologic responses
characteristic of LMW chemical-induced allergic airway disease in the nasal and
pulmonary airways. NJ mice were intranasally sensitized and then intranasally
challenged twice with TMA in a 1:4 ethyl acetate/olive oil vehicle or vehicle alone.
The response to TMA was compared to the responses after intranasal
sensitization and challenge to the contact sensitizers, dinitrochlorobenzene
(DNCB) and oxazolone (OXA), chemicals not known to elicit occupational
asthma or allergic rhinitis. Only mice that were intranasally sensitized and
challenged with TMA had a marked allergic rhinitis characterized by an influx of
eosinophils, lymphocytes and plasma cells, 24 hr after the final challenge. By 96
hr, the nasal ainIvay epithelium exhibited increases in stored mucus and a
regenerative hyperplasia. No nasal lesions were found in the airways of mice
sensitized and challenged to DNCB or OXA. TMA sensitized and challenged

mice exhibited an increase in lung-derived lL-5 mRNA expression. There were

152

no changes in the mRNA expression of any of the cytokines measured in the
lungs of DNCB or OXA treated mice. TMA sensitized and challenged mice
exhibited an increase in total serum lgE. However, mice sensitized and
challenged to DNCB also exhibited an increase in total serum lgE, whereas OXA
treated mice did not. No pulmonary lesions were found in mice treated with
TMA, DNCB, or OXA. A subsequent assessment of cytokine mRNA expression
in the nasal ainrvay of TMA treated mice revealed that TMA sensitization and
challenge increased nasal airway-derived mRNA expression of the Th2 cytokines
IL-4, IL-5 and lL-13 but caused no change in the expression of the Th1 cytokine
IFN-y. This study is the first to demonstrate that intranasal administration of a
known chemical respiratory allergen is an effective method of sensitization
resulting in the hallmark features of allergic rhinitis with a concomitant increase in
Th2 cytokine mRNA expression in the nasal airway and an increase in lung-
derived IL-5 mRNA and total serum lgE after intranasal challenge. This is in
contrast to the chemicals DNCB and OXA, which failed to elicit the pathologic
changes in the nasal and pulmonary airways and cytokine changes in the lung,
that are characteristic of allergic airway disease. This model may be useful for

identifying other chemical respiratory allergens.

153

INTRODUCTION

The inhalation of LMW chemicals iS a leading cause of occupational
asthma and allergic rhinitis (Petsonk, 2002; WHO, 1999). LMW chemicals that
sensitize the respiratory tract are highly reactive chemicals that have a molecular
weight of less than 1 kDa (Petsonk, 2002). An example of a LMW chemical
associated with occupational asthma and allergic rhinitis in industrial settings is
trimellitic anhydride (TMA). TMA is used to make plasticizers, resins, polymers,
dyes, and printing inks. Murine models have been developed to assess the
allergenic effects of LMW chemicals. Some murine models of LMW chemical-
induced allergic airway disease sensitize the animals by dermal application and
successfully induce features characteristic of LMW chemical-induced allergic
ainrvay disease after intra-ainrvay challenge. Although the skin may represent an
actual route of exposure to chemical respiratory allergens, the most common
route of human exposure to such chemicals is inhalation (Lovik et al, 1996;
Kimber et al, 1996). Also, there is recent evidence that the route of sensitization
may affect the quality of the immune response in the lung after allergen
challenge. Vohr and coworkers, 2002, showed in rats that topical induction
followed by intra-airway challenge led to a qualitatively different complement of
immunocompetent cells in bronchoalveolar lavage fluid (BALF) than aerosol
induction followed by aerosol challenge. Another method of intra-ainrvay
administration that more closely resembles inhalation is intranasal instillation. In
a previous study, we found that intranasal sensitization and challenge with the

protein ovalbumin in a saline vehicle was a simple, inexpensive, and noninvasive

154

method of inducing lgE-mediated allergic airway disease in the upper and lower
respiratory tract of the NJ mouse (refer to Chapter 2 of this dissertation, Farraj et
al, 2003). It is not clear, however, whether intranasal sensitization and challenge
with known LMW chemical respiratory allergens will induce the characteristic
features of LMW chemical-induced allergic airway disease.

The study presented in Chapter 4 of this dissertation described an attempt
to elicit the characteristic immunologic and pathologic features of TDI-induced
allergic airway disease by intranasal sensitization and challenge with TDI.
Although some features of TDI-induced allergic airway disease were elicited with
intranasal instillation of TDI (i.e., lymphocytic influx in the nasal airways,
increased lung—derived Th2 cytokine mRNA, and increased serum lgE), several
problems remained regarding the intranasal instillation of TDI. Principal among
them was the toxicity of the vehicle. Ethyl acetate and olive oil in a 1:1
combination when intranasally instilled caused toxicity to the nasal ainIIray
mucosa. In the present study, the irritant effects of 1:1 ethyl acetate/olive oil and
1:4 ethyl acetate/olive oil were compared for the purpose of selecting a
minimally-irritating vehicle for intranasally sensitizing and challenging mice with
TMA. An additional problem with the TDI study was the failure to elicit any
pathologic changes in the pulmonary airways after intranasal instillation, which
may have been due to insufficient distribution of TDI into the lung. Southam et
al, 2002, determined that by increasing the volume of an intranasally instilled

saline solution in mice (up to 75 pl), the distribution to the lung increases. In the

155

present study, the volume of the solution that was intranasally instilled was
increased from 30 pl to 60 pl in an attempt to improve distribution into the lung.

Th2 cytokines have been implicated in LMW chemical-induced allergic
airway disease both in humans and in experimental animal models. For
example, the production of IL-4 and IL-5 proteins was increased in bronchial
biopsies of patients with TDI-induced asthma (Maestrelli et al, 1997). In addition,
the selective enhancement of Th2 cytokines was detected in several murine
models of TMA-induced asthma (Betts et al, 2002; Dearman et al, 2002,
Vandebriel et al, 2000). The methods by which cytokine measurements are
made vary in murine models of LMW chemical-induced allergic airway disease.
They include the assessment of changes in cytokine expression by measuring
the secreted product of stimulated local draining lymph node cells that drain the
site of dermal application or by analyzing bronchoalveolar lavage fluid (BALF) for
cytokine protein or mRNA expression. In the present study, I examined the local
mRNA expression of Th2 cytokines in both pulmonary and nasal tissue after
intranasal administration of TMA.

One objective of this study was to determine whether 1:4 ethyl
acetate/olive oil was a more suitable vehicle for intranasal delivery of TMA than
1:1 ethyl acetate/olive oil. The second objective of this study was to test the
hypothesis that intranasal sensitization and challenge with the known chemical
respiratory allergen TMA but not the non-respiratory sensitizers DNCB and OXA
will induce the characteristic features of LMW chemical-induced allergic ainrvay

disease in the nasal and pulmonary always of mice. DNCB and OXA are known

156

LMW chemical contact allergens that elicit contact hypersensitivity in the Skin
mediated by Th1 cytokines such as IFN-y and do not cause occupational asthma
or allergic rhinitis (Dearman et al, 2001). The pathologic changes in the nasal
and pulmonary ainrvays of mice after intranasal sensitization and challenge with
TMA were compared to the responses after intranasal sensitization and
challenge to DNCB or OXA. In addition, the right lung lobes were assessed for
any changes in Th2 and Th1 cytokine mRNA expression. The nasal airways of
mice exposed to TMA alone were also assessed for changes in Th2 and Th1
cytokine mRNA expression. This was done to examine the utility of measuring
local cytokine gene expression as a biomarker for the respiratory allergenicity of

low molecular weight chemicals.

157

MATERIALS AND METHODS
Animals and Chemical Sensitization and Challenge

Male A/J mice (Jackson Laboratories, Bar Harbor, Maine), six weeks of
age, were randomly assigned to one of 27 experimental groups (n = 6). Mice
were free of pathogens and respiratory disease, and used in accordance with
guidelines set forth by the All University Committee on Animal Use and Care at
Michigan State University. Animals were housed six per cage in polycarbonate
boxes, on Cell-Sorb Plus bedding (A&W Products, Cincinnati, OH) covered with
filtered lids, and had free access to water and food. Room lights were set on a
12 hr light/dark cycle beginning at 6:00 am, and temperature and relative
humidity were maintained between 21-24°C and 40-55 % humidity, respectively.
Figure 5.1 depicts the exposure regimen used for the intranasal sensitization and
challenge of the mice.

Pilot study for select_ion of vehicle: The irritating effects of the vehicles 1:4
ethyl acetate/olive oil and 1:1 ethyl acetate/olive oil in the nasal airway mucosa
were compared for the purpose of selecting a vehicle for use in the intranasal
sensitization and challenge of mice with TMA. Mice were anesthetized with 4%
halothane and 96% oxygen and then intranasally instilled with 60 pl of 1:4 ethyl
acetate/olive oil once per day for three consecutive days and then sacrificed 24
hr after the final instillation. The nasal and pulmonary ainrvays were
histopathologically examined for any evidence of airway irritation.

Sensitization ancL challenge: Mice were anesthetized with 4% halothane

and 96% oxygen and then exposed to one of three chemicals: trimellitic

158

anhydride (TMA) (Sigma-Aldrich, St. Louis, MO), 2,4—dinitro-1-chlorobenzene
(DNCB) (Sigma-Aldrich, St. Louis, MO) or 4-ethoxymetherne-2-phenyl-2-
oxazolin-5-one (oxazolone, OXA) (Fisher Scientific-Acros Organics, Pittsburgh,
PA). The chemicals were dissolved in a 1:4 ethyl acetate to olive oil vehicle that
was non-irritating to the nasal and pulmonary airways. The mice were sensitized
via single intranasal instillations of 60 pl of each chemical separately on Days 1
and 3 and then challenged with Single intranasal instillations on Days 17 and 27.
The concentrations of the chemicals used were 0.125 % TMA, 0.5 % DNCB, or
0.1 % OXA. The concentrations of each of these chemicals were selected after
performing a pilot study that screened a range of concentrations of the test
chemical for airway irritation. The highest dose that was not irritating to the
aimay (determined histologically) after 3 intranasal instillations, was selected.
This was done to distinguish the irritating effects of the chemical from any
potential adaptive immune effect. For each chemical, there were 5 different
treatment groups: 1) untreated naive group; 2) mice sensitized and challenged
with the vehicle alone; 3) mice sensitized with the vehicle alone and then
challenged once with vehicle and then the second time with the LMW chemical in
vehicle; 4) mice sensitized with the LMW chemical in vehicle and then challenged
with the vehicle alone; and 5) mice sensitized and challenged with the LMW
chemical in vehicle. Mice were sacrificed 24 or 96 h (Day 28 or Day 31) after the '
final instillation.

An additional set of mice was obtained for the purpose of assessing

cytokine mRNA expression in the nasal airway of mice sensitized and challenged

159

Exposure Regimen

 

 

18t 2nd
Sensitization Challenge Challenge
‘r‘ri i i
Day1 3 17 27
A A A A + *
24h 96h

 

 

 

Figure 5.1: Timeline of the exposure regimen used to sensitize and challenge NJ
mice with 0.125 % TMA, 0.5 % DNCB, or 0.1 % OXA in a 1:4 ethyl acetate/olive
oil vehicle. Mice were sensitized on days 1 and 3 with intranasal instillations of
60 pl of TMA, DNCB, or OXA in a 1:4 ethyl acetate/olive oil vehicle or vehicle
alone. Mice were then challenged two weeks later on day 17 with a Similar
volume of TMA, DNCB, or OXA and challenged a second time 10 days later on
day 27 followed by sacrifice 24 or 96 hr after double challenge. " = 60 pl of TMA,
DNCB, or OXA in 1:4 ethyl acetate/olive oil vehicle or vehicle alone. l = time
after challenge when animals were sacrificed.

160

with TMA alone. The mice were sensitized and challenged with TMA as

described above but were sacrificed 48 h after the final instillation.

Necropsy, Blood Sample Collection and Tissue Preparation

At the designated sacrifice times, mice were deeply anesthetized via
intraperitoneal injection of 0.1 ml of 12% pentobarbital in saline. Blood samples
(0.1 to 0.5 ml) were taken from the abdominal aorta and collected in Beckton
Dickinson vacutainers. Serum samples were collected and stored at -20°C after
the blood samples were centrifuged to remove cells. The abdominal aorta and
renal artery were then severed to exsanguinate the animals. Immediately after
death, the trachea was cannulated and the heart/lung block removed. A syringe
was then attached to the cannula and brochoalveolar lavage fluid was collected
from the whole lung via two sequential changes of 1 ml saline. Differential cell
counts were determined by cytocentrifuging cells onto glass slides and then
staining with Diff-Quik (DADE Behring, Newark, DE). Neutrophils, macrophages,
eosinophils and other cell types were microscopically identified and their
numbers were determined by multiplying the percentage of each cell type from a
total of 200 cells by the total number of cells per ml of lavage fluid. The right
bronchus was then clamped using suture thread. All four right lung lobes were
placed in 2 ml Tri reagent (Molecular Research Center, Cincinnati, OH),
homogenized and stored at -80°C.

After removal of the right lung lobes, the left lung lobe was intratracheally

perfused with 10% neutral buffered formalin at a constant intra-airway pressure

161

of 30 cm of fixative. After 1 hr, the trachea was ligated, and the inflated left lung
lobe was immersed in a large volume of the same fixative for 24 hr. After
fixation, the left lung lobe was microdissected along the axial airways, and two
sections were then excised at the level of the fifth (proximal airway) and eleventh
(distal ainIvay) airway generation (Figure 5.2), as has been described previously
in detail (Steiger et al, 1995). Paraffin sections (5 pm) were stained with Alcian
blue (pH 2.5) and periodic acid Schiff’s (AB/PAS) reagent, which stains both
neutral and acidic mucosubstances within airway moucous (goblet) cells.

The head of each mouse was excised from the carcass, and the eyes,
skin, skeletal muscle, and lower jaw were removed from the head. The heads
were then immersed in 10% neutral buffered formalin for 24 hr. After fixation, the
heads were decalcified in 13% formic acid for 7 days and then rinsed in tap water
for at least 4 hr. The nasal cavity of each mouse was transversely sectioned at
three specific anatomic locations according to a modified method of Young
(1981 ). The most proximal nasal section was taken immediately posterior to the
upper incisor teeth (proximal, T1); the middle section was taken at the level of the
incisive papilla of the hard palate (middle, T2); the most distal nasal section was
taken at the level of the second palatal ridge (distal, T3) (Figure 5.2). These
tissue blocks were embedded in paraffin, sectioned at a thickness of 5 microns,
and then stained with hematoxylin and eosin for light microscopic examination.
Other paraffin sections were stained with ABIPAS to identify intraepithelial

mucosubstances (IM).

162

 

SITES FOR LIGHT MICROSCOPIC ANALYSIS

Section I.

Proxlmd nosd drwoy

Section 2.

Midde nosd oirwoy
Section 3.

Distal nosol oirwoy

Transverse Sections of Nasal Airways Selected for Microscopic
Analysis

  

 

 

   

S 8 septum; NT = nasoturblnate; MT I

maxilloturbinate; MS = maxillary sinus; ET
I ethmoturblnates; D nasolacrlmal duct;
T = root of Inclsor tooth; HP 8 hard palate

 

 

 

 

 

Figure 5.2: Sites of airway tissue selection for morphometric analysis. The
cartoon depicts the lateral wall of one nasal passage with the septum removed of
the murine respiratory tract and the main axial ainrvay of the left lung lobe. The
left lung lobe was microdissected along the axial ainrvays, and two sections were
then excised at the level of the fifth (proximal ainNay) and eleventh (distal ainlvay)
airway generation. Transverse sections of the nasal cavity (cartoon on bottom)
were taken 1) immediately posterior to the upper incisor teeth (T 1 ), 2) at the level
of the incisive papilla of the hard palate (T2), and 3) at the level of the second

palatal ridge (T 3).

163

Sections of the spleen, jejunum and duodenum were also fixed in formalin
or placed in TRI Reagent to determine if the LMW chemical treatment elicited
any pathologic or cytokine responses in these tissues. .

For the analysis of cytokine mRNA expression in the nasal mucosa, the
heads of mice were split in a sagittal plane adjacent to the midline exposing the
mucosal surfaces lining the nasal lateral wall and septum. The nasoturbinate
and maxilloturbinate from each nasal ainIvay and the proximal septum were
micro-dissected. The excised tissues from each animal were placed in 1 ml Tri

Reagent, homogenized, and stored at -80°C.

Morphometry of Stored lntraepithelial Mucosubstances in Nasal Airways

The amount of stored mucosubstances in the respiratory epithelium lining
the mid-septum in the most proximal nasal section was estimated by quantifying
the volume density of ABIPAS-stained mucosubstances using computerized
image analysis and standard morphometric techniques. The area of ABIPAS-
stained mucosubstances was calculated by circumscribing the perimeter of the
stained material using the Scion Image program (Scion Corporation, Frederick,
MD). The length of the basal lamina underlying the surface epithelium was
calculated from the contour length of the digitized image of the basal lamina.
The volume of stored mucosubstances (volume density, VS) per unit of surface
area was estimated using the method described in detail by Harkema et al
(Harkema et al, 1987) and is expressed as nanoliters of IM per square millimeter

basal lamina.

164

ELISA for Total serum lgE

Total serum lgE was measured using a 96-well lmmulon ELISA plate
(Dynex, Technologies, Chantilly, Virginia) coated with 2 pglml anti-mouse lgE
(Purified Rat Anti-Mouse lgE Monoclonal Ab, Pharmingen, San Diego, CA) and
incubated overnight at 4°C. After washing, the plates were incubated in 3 %
Bovine Serum Albumin (3 % BSA) at 37°C for 1 hr. (BSA, CALBIOCHEM, La
Jolla, CA). Serum samples at 1:10 dilution were then added followed by
incubation at 37°C for 1 hr. After washing, biotinylated anti-mouse lgE (Biotin-
conjugated Rat Anti-Mouse lgE Monoclonal Ab, Pharmingen, San Diego, CA)
was then added at 2 pglml and allowed to incubate at 25°C for 1 hr. After
washing, 1.5 pglml of streptavidin peroxidase was added followed by incubation
at 25°C for 1 hr. After washing, TMB substrate (12.5 ml citric-phosphate buffer 1-
200 pl of tetramethylbenzidine (T MB) stock solution (6mglml in DMSO) + 100 pl
1 % H202 (Fluka Chemical Co., Ronkonkoma, NY)) was added to produce a
color reaction. The reaction was terminated by the addition of 6 N H2804,
Optical density was determined at 450 nm using an EL—808 microplate reader

(Bio-Tek instruments, Winooski, Vermont).

Real-time RT—PCR

Total RNA was isolated from lung, nasal ainrvay tissue, small intestine, or
spleen using the TRI REAGENT method (Molecular Research Center, Cincinnati,
OH) following the manufacturer's protocol. The evaluation of the relative

expression levels of the cytokines lL-4, IL-5, IL-10, IL-13, and IFN-y mRNA was

165

determined using the TaqMan one-step real-time multiplex RT-PCR with TaqMan
preodeveloped primers and probe using the manufacturer's recommended
protocol (Applied Biosystems, Foster City, CA). Briefly, aliquots of isolated
tissue RNA (100 ng total RNA) were added to the RT-PCR reaction mixture,
which included the target gene (IL-4, lL-5, IL-10, IL-13, or IFN-y) primers and
probe, endogenous reference primers and probe (18S ribosomal RNA),
AmplITaq DNA polymerase and Multiscribe reverse transcriptase (MuLV). The
probes are designed to exclude detection of genomic DNA. RNA samples were
first reverse transcribed and then immediately amplified by PCR. Following the
PCR, amplification plots (change in dye fluorescence versus cycle number) were
examined and a dye fluorescence threshold within the exponential phase of the
reaction was set separately for the target gene and the endogenous reference
(188). The cycle number at which each amplified product crosses the set
threshold represents the CT value. The amount of target gene normalized to its
endogenous reference was calculated by subtracting the endogenous reference
CT from the target gene CT (ACT). Relative mRNA expression was calculated by
subtracting the mean ACT of the control samples from the ACT of the treated
samples (AAC-r). The amount of target mRNA, normalized to the endogenous
reference and relative to the calibrator (i.e., RNA from control) is calculated by

using the formula Z'MCT.

166

Statistics

The data obtained from each experimental group were expressed as a
mean group value :I: the standard error of the mean (SEM). The differences
among groups were determined by one way or two-way analysis of variance
(ANOVA) and an All Pairwise Comparison Test (Tukey), using SigmaStat

software from Jandel Scientific (San Rafael, CA).

167

RESULTS
Selection of Vehicle Study
The vehicle 1:4 ethyl acetate/olive oil did notcause any airway irritation
including epithelial necrosis and neutrophilic inflammation in the nasal airway
(Figure 5.3A) unlike the vehicle 1:1 ethyl acetate/olive oil (see Chapter 4). The
vehicle 1:4 ethyl acetate/olive oil was thus selected for use in the intranasal

sensitization and challenge of mice to TMA, DNCB, and OXA.

Airway Pathology

Only mice sensitized and challenged with TMA had ainrvay lesions
associated with intranasal instillations. TMA-induced airway alterations in these
animals were restricted to the nasal ainIvays. No exposure-related alterations
were microscopically evident in the lungs of any of these mice. The principal
morphologic alteration in the mice sensitized and challenged with TMA and
sacrificed 24 hr after the last instillation was a moderate-marked allergic rhinitis
characterized by a conspicuous influx of mixed inflammatory cells predominated
by eosinophils and accompanied by lesser numbers of mononuclear cells
(lymphocytes and plasma cells) (Figure 5.3). The inflammatory cell influx was
bilateral and most severe in the nasal mucosa lining the proximal lateral meatus
and the midseptum in T1. Accompanying the nasal inflammation was a
moderate to marked regenerative hyperplasia with areas of degeneration and
individual cell necrosis of the nasal transitional epithelium in these proximal nasal

airways.

168

 

Nasal Section 1
Maxilloturbinates

 

 

 

 

 

Figure 5.3: Light photomcrographs of the maxillotubinates from the proximal
nasal airways of mice sensitized and challenged with vehicle alone (A) or TMA in
vehicle (B). Numerous eosinophils present only in the lamina propria of the
maxillotubinate from the TMA-exposed mouse (star in B). Trssues stained with
hematoxylin & eosin. e = surface epithelium; b = turbinate bone; v = blood vessel
in the lamina propria of the nasal mucosa.

169

Similar but less severe mucosal inflammation was present in the more
distal nasal ain/vays in T2 and T3. In these latter two sections the inflammation
was restricted to the respiratory mucosa lining the middle and lateral meatus in
T2 and the nasopharyngeal meatus in T3. In addition, there was moderate
lymphoid hyperplasia of the nasal associated lymphoid tissue (NALT) in T3 of
these mice.

In mice Similarly instilled with TMA but sacrificed 96 hr after the last
instillation, the nasal inflammatory response was similar in character and
distribution but considerably attenuated from that in the mice that were sacrificed
earlier at 24 h post-instillation. These mice also had mild lymphoid hyperplasia of
the NALT. In addition, the respiratory epithelium lining the mid-septum in T1
underwent mucous cell metaplasia (Figure 5.4). No exposure-related alterations
were microscopically evident in the nasal or pulmonary airways of DNCB or
OXA-instilled mice (Table 5.1). In addition, there were no morphologic
alterations in the gut or spleen of all treated mice relative to the naive controls

(Table 5.1).

Stored lntraepithelial Mucosubstances in Nasal Airways

The amount of IM in the airway epithelium lining the proximal septum was
estimated in mice sensitized and challenged with TMA and sacrificed 96 hr after
the final challenge using image analysis and standard morphometric techniques.
lntranasal sensitization and challenge with TMA in vehicle resulted in slightly

more than a 2-fold increase in the amount of IM in the respiratory epithelium

170

 

 
    

Nasal Section 1
Respiratory Epithelium
Lining Mid-Septum

 

 

 

 

Figure 5.4: Light photomicrographs of the nasal mucosa lining the mid-septum
from the proximal nasal airways of mice exposed to vehicle alone (control, A & B)
or TMA in vehicle (C & D). Nasal tissues were stained with hematoxylin & eosin
(A 8. C) or Nolan blue (pH 2.5)/periodic acid Schiff (ABIPAS; B & D). More
mucous goblet cells with ABIPAS-stained mucosubstances (arrows) are present
in the surface epithelium (e) in the TMA-exposed mice (C 8 D) compared to the
vehicle-control mouse (A & B). G = subepithelial glands in the nasal mucosa; C
= septal cartilage.

171

 

Table 5.1: Summary of the morphologic changes in the nasal airways, pulmonary

ainNays, small intestine, or gut after sensitization and challenge with TMA,
DNCB, or OXA.

 

Chemical Nasal Airway Pulmonary Small
Airway Intestine
TMA Eosinophils/lymphocytes No change No change No change
Increased intraepithelial

Spleen

 

 

 

 

 

 

 

 

mucus
DNCB No change No change No change No changg
OXA No change No change No charge No chang_e_

 

172

lining the proximal septum in the proximal nasal airway as compared to the
vehicle controls (Figure 5.5). There were no such increases evident in mice

intranasally instilled with DNCB or OXA (Table 5.1).

Bronchoalveolar Lavage Fluid (BALF)

The total number of cells in the BALF was determined at 24 and 96 hr
after the second challenge. A modest but statistically significant increase (2-fold)
in macrophages in the BALF was observed in TMA-sensitized and challenged
mice that were sacrificed 24 hr after the second challenge relative to the naive
control (Figure 5.6). A Similar trend in macrophages recovered from the BALF (~
2-fold increase) was observed in the group that was sensitized with vehicle,
received a first vehicle challenge and a second challenge with TMA. Mice that
received only TMA sensitizations or only a TMA challenge did not exhibit
Significant increases in macrophages recovered from the BALF. There were no
increases detected at 96 hr in any of the treatment groups. Mice sensitized and
challenged with DNCB or OXA did not exhibit any Significant increases in

macrophages recovered from the BALF (data not shown).

Total Serum lgE
Total serum lgE levels were determined both at 24 and 96 hr after the final
challenge. Mice sensitized and challenged with TMA exhibited a significant

increase in total serum lgE (5-fold) relative to naive controls both 24 and 96 hr

173

   

Mucus Vs (nllmm2 Basal lamina)

        

 

 

 

 

. .-,l _ ,: .
'3" 4'18“

 

'1. .a l .L Li .,.' e» 13;: , e ‘ g". ‘
0 Vehicle Veh cle TMA TMA
I I I
Vehicle Vehicle Vehicle TMA
l I
Vehicle TMA Vehicle TMA

Figure 5.5: Morphometric quantification of ABIPAS-stained material in the
surface epithelium lining the mid-septum in nasal ainrvay region T1 of mice 96 hr
after double challenge with TMA. Mice were sensitized and then challenged
twice with TMA in vehicle or vehicle alone. Bars represent the volumetric density
(Vs) of intraepithelial mucosubstances +/- the standard error of the mean (n =
6/group). * - Significantly greater than all other groups (p<0.05).

174

100x10a -

 

—24h
1:196h

 

 

 

80x103 —

60x10a ~

40x10a -

20x103 -

Macrophages/ml Bronchoalveolar Lavage Fluid

    

    

 

   

 

 

TM '

 

0 - " ‘

Sensitization Naive Vehlcle

l I

1st Challelnge Vehicle Vehicle Vehicle TMA
l

l I I
2nd Challenge Vehlcle TMA Vehic|e TMA

Vehicle
I

Figure 5.6: Total number of macrophages in BALF from the left lung lobes of
mice sensitized and challenged with TMA. Mice were sensitized with intranasal
instillations of 60 pl of 0.125% TMA in a 1:4 ethyl acetate/olive oil vehicle. Mice
were then challenged two weeks later with a similar volume and challenged a
second time 10 days later followed by sacrifice 24 or 96 hr after double
challenge. Bars represent mean number of macrophages per ml BALF 1
standard error of the mean (n = 6/group). * = significantly greater than the naive
group (p<0.05).

17S

after the final challenge (Figure 5.7A). No Significant increase in total senIm lgE
was observed in the vehicle control group relative to the naive control. Mice that
received only TMA sensitizations or only a TMA challenge did not exhibit
Significant increases in total serum lgE. Mice sensitized and challenged with
DNCB also exhibited a significant increase in total serum lgE (8-fold) relative to
the naive control both 24 and 96 hr after the final challenge (Figure 5.7B).
Conversely, mice sensitized and challenged with OXA did not exhibit a Significant
increase in total serum lgE relative to naive controls both at 24 and 96 hr after

the final challenge (Figure 5.7C).

Cytokine Gene Expression

Lung: Real-time RT-PCR was performed on right lung lobe-derived RNA
from mice that were sensitized and then challenged twice with TMA, DNCB, or
OXA. TMA sensitized and challenged mice had a 30-fold increase in lL-5 mRNA
expression 24 hr after the second challenge as compared to the vehicle controls
that returned to control levels by 96 hr after challenge (Figure 5.8A). There were
no Significant increases in the mRNA expression of any of the other Th2
cytokines measured or the Th1 cytokine IFN-y at 24 or 96 hr after the final
challenge. Mice that received only TMA sensitizations or only a TMA challenge
did not exhibit significant increases in the mRNA expression of any of the
measured cytokines within the lung. lntranasal instillation with DNCB or OXA did
not result in any significant increase in the expression of any cytokine measured

within the lung tissue (Figures 588 and 5.8C).

176

Figure 5.7A

0.7 -

 

05‘ _24h *
—96h

 

 

 

05 _
C

0.4 ~

0.3 -

0.2 a

0.1 1

-.
..4 000

 

Stimulation Index (Mean Optical Density)

 

‘ . t

0.0 - . i ..
Sansltlzatlon Nalve Vehlcle Vehlcle TMA TMA
I l l I I
1st Challelnge Vehlcle Vehlcle Vehlcle TMA
l I l I
2"“ c""'°"9° Vehlcle TMA Vehlcle TMA

Figure 5.7: Total IgE levels in mouse serum isolated 24 or 96 h after double
challenge with TMA (A), DNCB (B), or OXA (C). Mice were sensitized with
intranasal instillations of 60 pl of 0.125% TMA, 0.5 % DNCB, or 0.1 % OXA in a
1:4 ethyl acetate/olive oil vehicle. Mice were then challenged two weeks later
with a Similar volume and challenged a second time 10 days later followed by
sacrifice 24 or 96 hr after double challenge. Bars represent average optical

density 1: standard error of the mean (n = 6/group). * = significantly greater than
all other groups.

177

Figure 5.78

0.8
0.6
0.4 .

0.2

Stimulation Index (Mean Optical Density)

 

 

0’0 — _ — 'I
Sansltlzatlon Nalva Vehicle Vehicle DNCB DNCB
I I
1st Challenge Vehlcle Vehlcle Vehlcle DNCB
I l
2“ Challenge Vehlcle DNCB Vehlcle DNCB

Figure 5.7C

0.6 ‘

0.4 -

Sitmulatlon Index (Mean Optical Density)

 

 

0.0 J ‘ ‘1

Sensitizatlon Nalve Vehicle Vehicle OXAZ OXAZ
l I

1“ Challelnge Vehlcle Vehlcle Vehlcle OXAZ

2"“ °""'°"9° Vehlcle OXAZ Vehlcle OXAZ

178

Figure 5.8A

 

 

 

 

 

 

 

_ so -
.9.
5 IL-4
‘3 ”T m IL-5 2‘;
.5 E lL-10
z IL-13
2 ‘° W IFN-y
0
.2
3 so 4
'5 .
a: {:3
g
m 20 1 :3:
E to:
e >30;
.5 .,.,
s
S. to:
o vzo:
Sensitization Naive Vehicle Vehicle TMA TMA
I I I I ‘ I
18* Cha"°"9° Vehicle Vehicle Vehicle TMA

I
I l l I
2"“ “"8"”9" Vehicle TMA Vehicle TMA

Figure 5.8: Relative quantification of lL-4, lL-5, lL-10, IL-13, and IFN-7 mRNA in
right lung lobes 24 hr after double challenge with TMA (A), DNCB (B), or OXA
(C) using real-time RT-PCR. Mice were sensitized with intranasal instillations of
60 pl of 0.125% TMA, DNCB, or OXA in 1:4 ethyl acetate/olive oil vehicle or
vehicle alone. Mice were then challenged two weeks later with a similar volume
and challenged a second time 10 days later followed by sacrifice 24 hr after
double challenge. Bars represent cytokine mRNA relative to the naive control :I:
standard error of the mean (n = Slgroup). * = significantly greater than all other
groups at similar time-point (p<0.05).

179

............
...........
eeeeeeeeeeee
...........

\\\\\\\\\\\\\ CI
_=====_.=.=_N

    

DNCB
DNCB

    

  

/DNCB

0 0.0 00. 0.00.0. 0A
V0’0’0’0’0’0’0u

/////////////

 

l
Vehlcle
I
Vehicle

 

Figure 5.88

.....
oooooo

.....
......
eeeee

eeeeeeeeeeeeeeeee
ee‘ee-eee
eeeee

eeeeeeee

e
ee

:0”!

 

L4
L-5
L-1 0
L-1 3
FN-iy

///////
8222
E
m

 

 

 

..............
eeeeeeeeeeeeeee
eeeee

v.
........

 

e
e

 

. . .
0 8 a 4 2
1

.228 2%: 2 e253. (2%.. 832:0

Sensitization

Vehicle Vehicle

Naive

Vehicle

Vehicle

1st Challenge

DNCB

I
Vehicle

2nd Challenge

Figure 5.80

 

 

|'fll

m
E

m IFN-q

 

 

 

10*

toacoo ozuz 8 023.0”. <21:— 25.030

 

Vehicle

Vehicle

/Nalve

Sensltization

1st Challenge

2nd Challenge

180

Nasal Airway: Real-time RT-PCR was also performed on nasal airway
tissue RNA from mice that were sensitized and then challenged twice with TMA.
TMA sensitized and challenged mice exhibited a 4.5-fold increase in lL-4 mRNA
expression, a 3-fold increase in lL-5 mRNA expression, and a 7-fold increase in
IL-13 mRNA expression, 48 hr after the second challenge as compared to the
vehicle controls (Figure 5.9). There were no significant increases in the mRNA
expression of IL-10 or the Th1 cytokine IFN-y. Mice that received only TMA
sensitizations or only a TMA challenge did not exhibit significant increases in the
mRNA expression of any of the measured cytokines within the nasal ainIvay
fissue.

No assessment of cytokine mRNA expression was made in the nasal
airways of mice instilled with DNCB or OXA because of the lack of DNCB or
OXA-induced nasal airway histopathology.

Spleen and Small Intestine: There were no increases in the mRNA
expression of any of the Th2 cytokines or the Th1 cytokine IFN-y in the gut or
spleen of any TMA, DNCB, or OXA treated mice relative to the na'ive controls

(Table 5.2).

181

10c

 

 

 

 

 

 

 

   

E *
c — IL-4
8 m lL-5
5 8 1 _ IL-10
.2- [2:1 IL-13
8 - IFN-y
i ”
g
5 “
a:
E
8
3 2‘
g I
o_ E I it I e I
Sensitization Nalve Vehicle Vehicle TMA TMA
I I I I I
“WWW” Vehlcle Vehlcle Vehlcle TMA

I
I I I I
2nd Challenge Vehlcle TMA VglflcI. TMA

Figure 5.9: Relative quantification of IL-4, lL-5, lL-10, lL-13, and IFN-y mRNA in
nasal airway tissue 24 hr after double challenge with TMA using real-time RT-
PCR. Mice were sensitized with intranasal instillations of 60 pl of 0.125% TMA in
a 1:4 ethyl acetate/olive oil vehicle or vehicle alone. Mice were then challenged
two weeks later with a similar volume and challenged a second time 10 days
later followed by sacrifice 24 hr after double challenge. Bars represent cytokine
mRNA relative to the naive control i standard error of the mean (n = 6/group). *
= significantly greater than all other groups at similar time-point (p<0.05).

182

 

Table 5.2: Summary of cytokine mRNA expression changes in the nasal airway,

lung, small intestine, and spleen after sensitization and challenge with TMA,
DNCB, or OXA.

 

 

 

 

 

Chemical Nasal Airway Pulmonary Small Spleen
Airway Intestine
TMA Increased Increased No change No change
lL-4, lL-5, and IL-5 mRNA
lL-13 mRNA
DNCB No change No change No change No change
OXA No change No change No change No change

 

 

 

 

183

 

DISCUSSION

One objective of this study was to determine whether 1:4 ethyl
acetate/olive oil was a more suitable vehicle for intranasal delivery of TMA than
1:1 ethyl acetate/olive oil. The second objective of this study was to test the
hypothesis that intranasal sensitization and challenge with the known chemical
respiratory allergen TMA but not the non-respiratory sensitizers DNCB and OXA
will induce the characteristic features of LMW chemical-induced allergic airway
disease in the nasal and pulmonary airways of mice. Morphologic changes in the
nasal and pulmonary airways of TMA-sensitized and challenged mice were
compared with the nasal and pulmonary airways of mice sensitized and
challenged with the contact sensitizers DNCB and OXA. In addition, the right
lung lobes of TMA, DNCB, and OXA exposed mice were assessed for any
changes in Th2 and Th1 cytokine mRNA expression. The nasal airways of mice
exposed to TMA alone were also assessed for changes in Th2 and Th1 cytokine
mRNA expression. This was done to examine the utility of measuring local
cytokine gene expression as a biomarker for the respiratory allergenicity of low
molecular weight chemicals.

Individuals afflicted with occupational asthma often suffer from concurrent
allergic rhinitis (Leynaert et al, 2000). Some studies suggest that allergic rhinitis
due to workplace exposure to TMA precedes and may be more common than
occupational asthma (Bernstein, 1993; Grammer et al, 2002). The main
symptoms of TMA-induced allergic rhinitis are itching, sneezing, watery

discharge, and obstructed nose (WHO, 1999). The pathologic features of TMA-

184

induced allergic rhinitis are similar to non-occupational allergic rhinitis and
include plasma exudation, hypersecretion of mucus, and cellular infiltrates
consisting of T- and B-lymphocytes, eosinophils, and plasma cells in the nasal
airway (WHO, 1999). In the present study, only mice that were intranasally
sensitized and challenged with TMA had a marked allergic rhinitis characterized
by an influx of eosinophils, lymphocytes and plasma cells, 24 h after the final
challenge. The predominant cell type was the eosinophil with fewer numbers of
lymphocytes. This is slightly different from the inflammatory infiltrate in humans
which also consists of mast cells and neutrophils and more lymphocytes (WHO,
1999). The reason for this difference may have to do with the species
differences between humans and mice and the level of exposure. The TMA
exposure in humans may have elicited an irritant/adaptive immune response in
the nasal airway. In the present study, the concentrations of the LMW chemicals
used were not irritating to the nasal ainNay mucosa. By 96 h, the nasal airway
epithelium exhibited increases in stored mucus and a regenerative hyperplasia.
This is similar to human studies that report increased mucus production. In
contrast, intranasal sensitization and challenge with DNCB or OXA did not result
in any lesions within the nasal airways.

Th2 cells produce lL-4, lL-5, lL-10, and lL-13 (Yssel and Groux, 2000). IL-
4 promotes T cell activation and differentiation into the Th2 subtype while both lL-
4 and lL-13 promote lgE production in B cells and mucus production in the
airways (Shim et al, 2001; Frew, 1996). The mechanism of non-occupational

allergic rhinitis is dependent on Th2 cytokines (Andersson et al, 2000). Th2

185

cytokines have also been linked to the pathogenesis of LMW chemical-induced
asthma. Several groups have shown that lymph node cells draining the site of
dermal application in murine models of TMA-induced asthma preferentially
secrete Th2 cytokines including lL-4, lL-10, and IL-13 (Dearman et al, 2003,
Plitnick et al, 2002). Limited evidence exists, however, that demonstrates a link
between LMWC-induced allergic rhinitis and the up-regulation of Th2 cytokines.
Nevertheless, the similarity in pathogenesis between LMW chemical-induced
allergic rhinitis and non-occupational allergic rhinitis and the evidence that Th2
cytokines are up-regulated in TMA-induced asthma suggests a critical role for
Th2 cytokines in LMW chemical-induced allergic rhinitis. There are many murine
models of LMW chemical-induced allergic ainlvay disease that vary in the method
used for cytokine analysis with some focusing on changes in BALF-derived
cytokine content while others analyze local draining lymph node cells that have
been re-stimulated with a mitogen in vitro. In the present study, RNA isolated
from nasal airway tissue of TMA sensitized and challenged mice was assessed
for changes in Th2 and Th1 cytokine mRNA expression to determine if the TMA-
induced allergic rhinitis is accompanied by local changes in cytokine mRNA
expression within the nasal airway. TMA-sensitized and challenged mice had an
increase in the nasal airway-derived mRNA expression of the Th2 cytokines lL-4,
lL-5, and IL-13 and no change in the expression of the Th1 cytokine IFN-y. This
is the first report that demonstrates, in a murine model, a link between TMA-
induced allergic rhinitis and the selective enhancement of Th2 cytokines within

the nasal airway. The nasal airways of DNCB or OXA treated mice were not

186

assessed for Th2 cytokine expression. Although the rationale for not doing so
was the lack of any DNCB- or OXA-induced nasal airway histopathology, an
assessment of the expression levels of Th2 and Th1 cytokines in mice treated
with DNCB or OXA would have been appropriate to confirm the selectivity of Th2
cytokine expression with known chemical respiratory allergens.

In the present study, no pulmonary lesions were found in any group
instilled with TMA, DNCB, or OXA. The lack of any airway pathology suggests
that the amount of chemical that entered the lung may not have been sufficient to
elicit an irritant/adaptive immune response in the lung. This may have been due
to the Viscosity of the ethyl acetate and olive oil vehicle, which may have
prevented effective aspiration of the chemical and distribution of the chemical
into the lower airways. The increase in the volume intranasally instilled did not
result in any pathology. In addition, the inherent high reactivity of these
chemicals may have played a role in limiting the distribution of these chemicals to
the lower aiwvays. It is likely that a large portion of the chemical reacted with
proteins in the nasal airways of these mice. Greenberg et al, 1994, reported that
after aerosolized toluene diisocyanate exposure in guinea pigs, the vast majority
of the chemical remained in the nasal airway. The small increase in
macrophages in the BALF after sensitization and challenge with TMA, however,
suggests that there was some distribution of the chemical into the lung. This
increase was not an immune-mediated effect as it also took place after just a
single instillation of the chemical and may be due to the inherent irritating

properties of the chemical.

187

The lipophilic and highly reactive characteristics of LMW chemicals hinder
sufficient distribution of such chemicals into the lung via IN instillation. Increasing
the concentration of the chemical instilled is one method of increasing distribution
into the lung Via IN instillation. The direct acute toxicity in the airway that
subsequently results, as in the study described in Chapter 4 of this dissertatation,
precludes the use of such high concentrations. This remains a tremendous
obstacle in the elicitation of features characteristic of LMW chemical-induced
asthma when administered via IN instillation. An alternative to IN instillation is
intratracheal instillation of LMW chemicals using the same non-irritating vehicle
1:4 EA/OO.

I attempted to determine if any potential airway pathology in the
pulmonary airways after instillation of the chemicals was accompanied by an
increase in local Th2 or Th1 cytokine gene expression within the lung. Despite
the lack of any pathologic changes in the lungs of mice sensitized and
challenged to TMA, TMA sensitized and challenged mice had a 30-fold increase
in lung-derived lL-5 mRNA expression 24 hr after the final TMA instillation.
There was no increase in the expression of any other Th2 cytokine or the Th1
cytokine IFN-y. In contrast, intranasal sensitization and challenge with DNCB or
OXA did not result in a significant change in the expression of any of the
measured cytokines including IFN-y. These findings support other reports that
link LMW chemical-induced occupational asthma with the selective expression of
Th2 cytokines while known non-sensitizers of the respiratory tract do not.

Several possibilities exist that may explain the TMA-induced increase in lung-

I88

derived lL-5 expression in the absence of pulmonary airway inflammation. One
is that the increase originated from infiltrating lymphocytes in areas of the lung
not examined histologically such as the right lung lobes or more proximal regions
of the left lung lobe. Another possibility is that the source of the cytokines was
the bronchial-associated lymphoid tissue or the ainivay epithelium. Or perhaps a
systemic immune response was elicited that originated in some other region of
the respiratory tract that caused an increase in lymphocytes in the circulation and
likewise the pulmonary vasculature. Further studies are required to determine
the exact source.

The role of lgE antibodies in the pathogenesis of LMW chemical-induced
occupational asthma and allergic rhinitis is unclear and controversial. Only 10 to
30 % of all cases of TDI-induced occupational asthma, for example, exhibit
increases in lgE antibodies (Weissman and Lewis, 2000). There is a stronger
link between lgE antibodies and TMA-induced allergic airway disease (Dearman,
2002), but not wholly consistent. Some investigators have suggested that the
failure to establish a consistent link between high circulating lgE levels and LMW
chemical-induced allergic airway disease is due to the deficiencies in lgE
detection methods (Kimber et al, 2002) while others have demonstrated that non-
lgE-dependent mechanisms of LMW chemical-induced allergic airway disease
may exist (Herrick et al, 2002; Larsen et al, 2001; Bernstein, 2002).
Nevertheless, we found that mice intranasally sensitized and challenged with
TMA exhibited increases in total serum lgE. The increase in serum lgE,

however, was not restricted to mice exposed to chemical respiratory allergens as

189

DNCB sensitized and challenged mice exhibited a similar increase in total serum
lgE. This was despite the fact that DNCB failed to elicit any pathologic response
in the nasal and pulmonary airways and did not elicita cytokine response in the
lung. Our report is not the first to demonstrate that DNCB elicits an lgE
response. Others have shoWn that DNCB elicits an increase in senim lgE while
failing to sensitize the respiratory tract (Ban et al, 2001). The lgE data from this
study has two opposing implications. One is that serum lgE levels is not a good
biomarker of LMW chemical-induced allergic ainlvay disease as non-sensitizers
of the respiratory tract (i.e., DNCB) induce increases in serum lgE. There is data
that supports this possibility. One group showed that lgE levels are inversely
correlated with LMW chemical-induced ainlvay inflammation in a murine model of
LMW chemical-induced asthma (Herrick et al, 2002). Another implication is that
DNCB, unlike most non-sensitizers of the respiratory tract, has a unique capacity
to elicit an lgE response despite its inability to induce airway inflammation. This
possibility is supported by the finding that intranasal sensitization and challenge
with another non-sensitizer of the respiratory tract, OXA, failed to induce an
increase in serum lgE. The exact role of lgE antibodies in this study is unclear.
Further studies with other LMW chemical respiratory sensitizers and non-
sensitizers need to be conducted in order to determine the relevance of
enhanced circulating lgE levels in LMW chemical-induced allergic airway
disease.

Despite the fact that a pathologic response was not elicited in the

pulmonary airways after intranasal instillation, this model of allergen-induced

190

effects in the nasal airway may be used to assess the allergenic effects of a
chemical agent on the entire respiratory tract, including the pulmonary airways.
Allergic rhinitis and asthma used to be thought of as separate disease entities,
but there is increasing support for the concept of “one airway, one disease,” i.e.,
that both these diseases are really a “continuum of inflammation within one
airway (Grossman, 1997).” Several lines of evidence support this theory and the
use of this model of nasal airway changes as a concurrent model to assess the
allergenic effects of chemicals in the lower airways. Epidemiologic data suggests
that allergic rhinitis and asthma coexist. In one study, it was found that 92 % of
subjects with occupational asthma experienced symptoms of rhinitis (Leynaert et
al, 2000). In addition to their association, allergic rhinitis and asthma share
pathologic characteristics including the fact that they are both immediate type
hypersensitivity reactions characterized by the infiltration of mast cells,
eosinophils, and lymphocytes into the airways and mucus hypersecretion and
both are elicited by the same inflammatory mediators such as histamine (WHO,
1999). In addition, the airway epithelia lining the nasal and pulmonary airways
are similar. Both the nasal and pulmonary airways contain respiratory epithelium
that includes ciliated cells and mucous cells that respond similarly to allergen
exposure (Harkema et al, 2000). Also, a common therapeutic approach is used
in the treatment of both diseases. For example, inhaled corticosteroids are used
to ameliorate symptoms of both allergic rhinitis and asthma (Grossman, 1997).
The present study illustrated that intranasal sensitization and challenge

with TMA, but not DNCB or OXA, was effective in generating some of the

191

hallmark pathologic features of allergic ainlvay disease in the nasal airways of
mice. In addition, the TMA-induced allergic rhinitis was accompanied by local
increases in Th2-specific cytokine mRNA within the nasal airway. The analysis
of local cytokine gene expression in the nasal airway after intranasal exposure

may prove useful in the identification of other allergenic chemicals.

192

CHAPTER 6
SUMMARY AND CONCLUSIONS

193

The driving hypothesis for this dissertation was that local Th2 cytokine
gene expression in the nasal and/or pulmonary airways may be used to identify
chemicals with the potential to elicit a Type I allergic response in the respiratory
tract of humans. This main hypothesis was tested with a number of studies that
used an in vivo approach utilizing a murine model of allergic ainlvay disease to
examine the histopathologic and immunologic responses to known chemical
respiratory sensitizers and non-sensitizers after intra-airway administration.

Results from Chapter 2 defined a novel murine model of human allergic
airway disease that resembled human exposure to aeroallergens and was the
first to demonstrate that intranasal instillation is an effective method of
sensitization to aeroallergens. lntranasal sensitization and challenge with
adjuvant-free ovalbumin in NJ mice elicited many of the hallmark pathologic and
immunologic features of lgE-mediated allergic rhinitis and asthma in humans.
The pathologic changes in the pulmonary airways including mucous cell
metaplasia and a lymphocytic and eosinophilic inflammatory infiltrate correlated
with an increase in lung-derived Th2 cytokine gene expression and increased
serum lgE. Taken together, the data support the hypothesis that intranasal
sensitization and challenge is effective in exposing the upper and lower
respiratory tract of mice to protein agents and generating the characteristic
features of allergic airway disease. Also, the pathologic response was likely
mediated by increased Th2 cytokine gene expression. Increased Th2 cytokine

gene expression may be used to predict the respiratory allergenicity of other

194

proteins and chemicals in this model. This murine model is a sensitive model for
determining the allergenicity of protein agents.

One of the benefits of having a sensitive murine model of allergic airway
disease that responds robustly to aeroallergen exposure is that the effects of
pharamacologic agents on the allergic response can be readily determined. Prior
murine studies demonstrated successful attenuation of several features of the
allergic airway response by IP injection of CBN, but no study has reported
inhibition by intra-airway delivery of CBN. lntra-aiiway delivery of CBN would
minimize systemic toxicity and ensure a high local concentration of CBN in the
respiratory tract, which would likely increase its effectiveness. In Chapter 3, I
designed a study that tested the hypothesis that both IP and intranasal
administration of CBN in NJ mice would attenuate the hallmark pathologic and
immunologic features of allergic airway disease. Results from Chapter 3, support
the hypothesis that the systemic administration of CBN attenuates the
characteristic pathologic and immunologic features of allergic ainlvay disease
elicited by intranasal sensitization and challenge with ovalbumin in NJ mice. lP
injection of CBN suppressed the OVA-induced increase in intraepithelial mucus
(IM) in the pulmonary airways, serum lgE, and lung-derived lL-4 mRNA
expression. The intranasal delivery of CBN, however, wasn’t as effective as IP
CBN in attenuating the allergic airway response. Despite inhibition of total and
antigen-specific lgE, the number of inflammatory cells in the BALF, and lung-
derived lL-13 mRNA expression, intranasal CBN did not affect the ovalbumin-

induced increase in IM in the pulmonary airways or the lung-derived increase in

195

lL-4, lL-5, and lL-IO mRNA expression. The failure to affect the IM and cytokine
responses in the lung may have been due to the inability of the intranasal route
of administration to result in sufficient distribution of CBN into the lung. This
suggests that improved lung distribution using intranasal instillation will enhance
intranasal CBN instillation as a method of inhibiting the pulmonary allergic
response.

IP CBN-mediated inhibition of the lung-derived increase in IL-4 expression
further supports the data presented in Chapter 2 linking the ovalbumin-induced
pathologic changes to enhanced Th2 cytokine expression and suggests that Th2
cytokines are required for the elicitation of the pathologic changes in this model.
This finding also suggests that a chemical that causes a local increase in Th2
cytokine expression within the airways, as in the studies described in Chapters 4
and 5 of this dissertation, may have allergenic potential in the respiratory tract.

CBN has potential therapeutic/prophylactic utility for allergic diseases of
the respiratory tract because of its immunosuppressive effects and data from
human and animal studies that suggest an inhibition of some features of the
allergic airway response. The development of CBN as a therapeutic/prophylactic
to be used by humans requires that CBN be delivered via the intra-airway route
to avoid the debilitating side effects that may result from systemic administration.
Despite the failure to inhibit the ovalbumin-induced pathologic and cytokine
responses in the lung, this is the first study to demonstrate successful inhibition
of some features of the allergic airway response by intra-airway delivery of CBN.

This study has thus narrowed the gap in the development of CBN as a

196

therapeutic by demonstrating that intra-airway delivery of CBN may potentially be
a viable alternative to systemic administration of CBN. Improved distribution of
CBN to the lower respiratory tract by intra—ainlvay delivery and the corresponding
inhibition of the pulmonary allergic airway response will further enhance the
development of CBN as a human therapeutic to combat allergic airway disease.

Although, CBN appeared not to distribute effectively into the lung using an
EAIOO vehicle, it likely distributed in a sufficient amount to the upper airways
including the nasal airway. This finding suggests that intranasal instillation of
CBN may be an effective method of attenuating the pathologic and immunologic
features of allergic rhinitis. The studies with TMA demonstrated that intranasal
sensitization and challenge with TMA was effective in generating the
characteristic features of allergic rhinitis. The co-treatment of TMA sensitized
and challenge mice with intranasal instillations of CBN would be a good way of
determining whether CBN is effective in the inhibition of allergic rhinitis.

The results described in Chapter 2, i.e., successful induction of features of
allergic airway disease with intranasal instillation of a protein allergen, presented
a model with which to determine the effects of LMW chemicals on the respiratory
tract of NJ mice. This study is the first to demonstrate that intranasal
administration of an LMW chemical is an effective method of sensitization and
results in an up-regulation of critical mediators of allergic airway disease, IL-4, IL-
5, and lL-13 within the lung after challenge. The study described in Chapter 4
was designed to test the hypothesis that intranasal sensitization and challenge

with TDI will induce the immunologic and pathologic responses in the lung that

197

are characteristic of LMW chemical-induced occupational asthma. lntranasal
sensitization and challenge with TDI elicited some of the characteristic pathologic
features of TDI-induced allergic rhinitis, thus supporting the hypothesis. TDI
sensitized and challenged mice had an infiltration of plasma cells in the nasal
airway, a characteristic pathologic feature of immune-mediated TDI-induced
rhinitis. The tremendous irritant effects of the chemical were more conspicuous,
however, as all TDI-exposed mice, whether TDI-sensitized or not, had an acute
rhinitis with associated epithelial necrosis and exfoliation. This hampered the
discernment of the immune-mediated effects suggesting that a less irritating dose
of TDI should have been used. The irritant effect was also due to the vehicle 1:1
EAIOO, suggesting that a less irritating vehicle such as 1:4 EAIOO would have
been more suitable. In addition, no pulmonary lesions were found in mice of any
group. The absence of pulmonary lesions does not support the hypothesis as
intranasal instillation with TDI failed to elicit the pathologic features of allergic
airway disease in the lung. The absence of pulmonary lesions is likely due to the
limited lung distribution of the chemical due to the viscosity of the vehicle, as in
the intranasal CBN study and the high reactivity of the chemical, which may have
predominantly bound to proteins in the upper ainrvays. Also, only mice that were
intranasally sensitized and challenged to TDI had an increase in lung-derived IL-
4, lL-5, and lL-13 mRNA and total serum lgE. The lung-derived increase in Th2
cytokine gene expression could not be correlated with a pathologic response in
the lung as intranasal instillation of TDI did not result in any pulmonary lesions

leaving uncertainty about the source of these cytokines within the lung. .

198

The results from the study described in Chapter 4 with TDI led me to
change the vehicle combination that was used to dissolve the low molecular
weight chemicals that were used in the study described in Chapter 5. EAIOO
was modified from a 1:1 combination that was irritating to the airway epithelium
to a non-irritating 1:4 EAIOO combination. In addition, the volume that was
instilled was doubled from 30 to 60 pl in an attempt to improve lung distribution of
the chemical and concentrations of the chemicals used in the study were not
irritating to the airway epithelium as in the TDI study. The study in Chapter 5
compared the effects of a known chemical respiratory allergen TMA to two
contact allergens. The study tested the hypothesis that intranasal sensitization
and challenge with TMA, but not the contact allergens DNCB and OXA, will
induce the immunologic and pathologic responses characteristic of LMW
chemical-induced allergic airway disease in the nasal and pulmonary ainlvays.
The strong nasal airway response with TDI in the study described in Chapter 4
convinced me to assess the nasal airway after TMA, DNCB, and OXA exposure
for Th2 and Th1 cytokine expression. The study described in Chapter 5 is the
first to demonstrate that the intranasal administration of the known chemical
respiratory allergen TMA, but not the chemical contact allergens DNCB and
OXA, was an effective method of sensitization resulting in the hallmark
pathologic features of allergic rhinitis with a concomitant increase in Th2 cytokine
mRNA expression within the nasal airway, thus supporting the hypothesis. The
absence of an airway response to DNCB and OXA is consistent with other

experimental models of allergic airway disease. Only mice that were intranasally

199

sensitized and challenged with TMA had a marked allergic rhinitis characterized
by an influx of eosinophils, lymphocytes and plasma cells and increased stored
mucus. The TMA-induced nasal airway pathology correlated with a local
increase in Th2 cytokines and not Th1 cytokine expression and an increase in
serum lgE. This is consistent with data from the study described in Chapter 2
where the ovalbumin-induced pathologic changes in the lung correlated with a
local increase in lung-derived Th2 cytokine gene expression. The results from
both studies support the use of Th2 cytokine gene expression as a predictor of
the potential of chemicals to elicit allergic airway disease. However, no
pulmonary lesions were found in any group treated with TMA. This does not
support the hypothesis as intranasal instillation with TMA failed to elicit the
pathologic features of allergic airway disease in the lung. The absence of
pulmonary lesions is likely due to the limited lung distribution of the chemical due
to the viscosity of the vehicle, as in the CBN and TDI studies, and the high
reactivity of the chemical. DNCB and OXA did not induce any nasal or
pulmonary airway lesions or increases in Th2 cytokine gene expression in the
pulmonary airways. DNCB sensitization and challenge did, however, elicit an
increase in serum lgE. The importance of the increase in serum lgE with DNCB
remains to be determined, and may undervalue the use of serum lgE levels to
identify chemical respiratory allergens. TMA sensitized and challenged mice
exhibited an increase in lung-derived lL-5 mRNA expression. There were no
changes in the mRNA expression of any of the cytokines measured in the lungs

of DNCB or OXA treated mice. The lung-derived increase in Th2 cytokine gene

200

expression could not be correlated with a pathologic response in the lung as the
intranasal instillation of TMA did not result in any pulmonary lesions leaving
uncertainty about the source of these cytokines within the lung, as in the TDI
study.

Despite the fact that a pathologic response was not elicited in the
pulmonary airways after intranasal instillation, this model of allergen-induced
effects in the nasal airway may be used to assess the allergenic effects of a
chemical agent on the entire respiratory tract, including the pulmonary airways.
A number of facts support the use of chemical-induced nasal airway effects as a
surrogate for and accurate predictor of the allergenic effects of the chemical in
the pulmonary airways. For example, Individuals afflicted with asthma usually
suffer from concurrent allergic rhinitis, especially in occupational settings.
Allergic rhinitis and asthma also share similar pathologic features and are
initiated by similar inflammatory mediators. In addition, the nasal airway and
pulmonary airways share similar structural features including similar respiratory
epithelium.

There is a need for identifying LMW chemical respiratory sensitizers.
There is currently no well validated and widely accepted method for identifying
LMWC respiratory allergens. Such a method would ideally be analogous to the
murine Local Lymph Node Assay (LLNA) developed by Kimber and colleagues,
1997, which is a reliable method for the identification of chemicals that have the
ability to cause skin sensitization and allergic contact dermatitis. The LLNA is

considered a ‘stand-alone method’ for skin sensitization hazard identification.

201

The studies presented in this dissertation collectively provide two major findings.
The first is that intranasal sensitization and challenge of protein or chemical
allergens successfully induces many of the characteristic features of allergic
airway disease. The second is that Th2 cytokine gene expression and potentially
serum IgE levels may be used to predict the potential of protein or chemical
agents to elicit allergic airway disease. These findings may facilitate the
identification of LMW chemical respiratory allergens.

The data from this dissertation show that the intranasal administration of
LMW chemicals is a viable route of exposure for testing the allergenicity of LMW
chemicals in the upper and lower airways if coupled with measurements within
the nasal ainNays including the analysis of Th2 cytokine gene expression and
histopathology. These measurements should be combined with the use of a
murine strain sensitive to aeroallergens such as the NJ strain to provide a
reliable and sensitive method for identifying LMW chemical respiratory allergens.
This method uses a simple and inexpensive method of allergen administration,
i.e., intranasal instillation, which is a relevant route of administration. It also
focuses on changes within the respiratory tract and assesses a very sensitive
endpoint, i.e., cytokine gene expression, which is critical to the development of
allergic airway disease. These facts make this method a practical, inexpensive,
safe, and reliable alternative for identifying LMW chemical respiratory allergens
that may be used by chemical and pharmaceutical manufacturers and others to
facilitate the screening of chemical agents with unknown potential for inducing

allergic airway responses such as asthma and allergic rhinitis.

202

 

BIBLIOGRAPHY

203

Adamko DJ, Yost BY, Gleich GJ, Fryer AD, and Jacoby DB (1999). Ovalbumin
Sensitization Changes the Inflammatory Response to Subsequent Parainfluenza
Infection: Eosinophils Mediate Airway Hyperresponsiveness, M2 Muscarinic
Receptor Dysfunction, and Antiviral Effects. J Exp Med. 190(10):1465—77.

Andersson M, Greiff L, Svensson C and Persson CGA (2000). Allergic and non-
allergic rhinitis. In: Busse WW and Holgate ST: Asthma and Rhinitis, Volume 1
Second Edition. Blackwell Science Ltd., Osney Meade, Oxford, pp. 232-244.

Arts JH, Kuper CF, Spoor SM, and Bloksma N (1998). Ainivay morphology and
function of rats following dermal sensitization and respiratory challenge with low
molecular weight chemicals. Toxicol Appl Pharmacol. 152(1):66-76.

Ban M, and Hettich D (2001). Relationship between lgE positive cell numbers
and serum total lgE levels in mice treated with trimellitic anhydride and
dinitrochlorobenzene. ToxicolLett. 118:129-137.

Beach JR (2000). Immunologic Versus Toxicologic Mechanisms in Ainlvay
Responses. In: Occupational Medicine: State of the Art Reviews, Volume 15
No. 2 Hanley and Belfus, Inc., Philadelphia, pp. 455-469.

Bellinghausen l, Knop J, and Saloga J (2001). The Role of Interleukin 10 in the
Regulation of Allergic Immune Responses. Int. Arch. Allergy Immunol. 126:97-
101.

Berdyshev EV (2000). Cannabinoid receptors and the regulation of immune
response. Chem Phys Lipids. 108:169-190.

Bernstein DI, Cartier A, Cote J, Malo J-L, Boulet L-P, Wanner M, Milot J,
L’Archeveque J, Trudeau C, and Lummus Z (2002). Diisocyanate Antigen-
stimulated Monocyte Chemoattractant Protein-1 Synthesis Has Greater Test
Efficiency then Specific Antibodies for Identification of Diisocyanate Asthma. Am
J Respir Crit Care Med. 166:445-450.

Bernstein IL, and Brooks SM (1993). Metals, in Bernstein IL, Chan-Yeung M,
Malo JL, & Bemstien DI (Eds) Asthma in the Workplace, New York: Marcel
Dekker, pp.459—479.

Betts CJ, Dearman RJ, Flanagan BF, and Kimber l (2002). Temporal Changes
in cytokine gene expression profiles induced in mice by trimellitic anhydride.
Toxicol Lett. 136:121-1 32.

Blaikie L, and Basketter DA (1999). Experience with a Mouse lntranasal Test for
the Predictive Identification of Respiratory Sensitization Potential of Proteins.
Food and Chemical Toxicology. 37: 889-896.

204

Bmijnzeel-Koomen CA, Geert M and Holt P (2000). Antigen Presentation and
lgE Synthesis, in Holgate ST, Church MK, and Lichtenstein LM (2"d Ed) Allergy,
LondonzMosby, pp. 265-281.

Condie R, Herring A, Koh WS, Lee M, and Kaminski NE (1996). Cannabinoid
inhibition of adenylate cyclase-mediated signal transduction and interleukin 2 (IL-
2) expression in the murine T-cell line, EL4.lL-2. J. Biol. Chem. 271(22): 13175.
83.

Corry DB, Folkesson HG, Wamock ML, Erle DJ, Matthay MA, Wiener-Kronish
JP, and Locksley RM (1996). Interleukin-4, but not Interleukin-5 or eoinophils, is
required in a murine model of acute airway hyperreactivity. J Exp Med. 183:109-
17.

Day BW, Jin R, Basalyga DM, Kramarik JA, and Karol MH (1997). Formation,
Solvolysis, and Transcarbamoylation Reactions of Bis(S-glutathionyl) Adducts of
2,4- and 2,6-Diisocyanatotoluene. Chem Res Toxicol. 10:424-431.

Dearman RJ, Betts CJ, Humphreys N, Flanagan BF, Gilmour NJ, Basketter DA,
and Kimber I (2003). Chemical Allergy: Considerations for the Practical
Application of Cytokine Profiling. Toxicol Sci. 71:137-145.

Dearman RJ, Basketter DA, Evans P and Kimber l (1999). Comparison of
cytokine secretion profiles provoked in mice by glutaraldehyde and
formaldehyde. Clin Exp Allergy. 29(1):124-32.

Dearman RJ, Basketter DA and Kimber I (1996). Characterization of Chemical
Allergens as a Function of Divergent Cytokine Secretion Profiles Induced in Mice.
Toxicol Appl Pharmacol. 138:308-16.

Dearman RJ, Filby A, Humphreys IR, and Kimber I (2002). Interleukins 5 and 13
Characterize Immune Responses to Respiratory Sensitizing Ahydn'des. J Appl
Toxicol. 22:317-325.

Dearman RJ and Kimber I (2001). Cytokine Fingerprinting and Hazard
Assessment of Chemical Respiratory Allergy. J Appl Toxicol. 21 :153-163.

Dearman RJ, Warbrick EV, Humphreys IR, and Kimber l (2000).
Characterization in mice of the immunological properties of five allergenic acid
anhydrides. JAppI Toxicol. 20(3):221-30.

Denzeler KL, Farmer SC, Crosby JR, Borchers M, Cieslewicz G, Larson KA,
Connier-Regard S, Lee NA, and Lee JJ (2000). Eosinophil Major Basic Protein-1
Does Not Contribute to Allergen-Induced Airway Pathologies in Mouse Models of
Asthma. J. Immunol. 165: 5509-5517.

205

Deschamps F, Prevost A, Lavauds F, and Kochman S (1998). Mechanisms of
Occupational Asthma Induced by Isocyanates. Ann Occup Hyg. 42(1): 33-36.

Ebino K, Lemus R, and Karol M (1999). The Importance of the Diluent For
Airway Transport of Toluene Diisocyanate following lntranasal Dosing of Mice.
Inhalation Toxicology. 1 1 :171-185.

Foster PS, Ming Y, Matthei Kl, Young IG, Temelkovski J, and Kumar RK (2000).
Dissociation of Inflammatory and Epithelial Responses in a Murine Model of
Chronic Asthma. Lab Invest. 80:655-62.

Farraj AK, Harkema JR, Jan T-R, and Kaminski NE (2003). Immune Responses
in the Lung and Local Lymph Node of NJ Mice to lntranasal Sensitization and
Challenge with Adjuvant-Free Ovalbumin. Toxicol Path. 31 :5.

Foster PS, Ming Y, Matthei Kl, Young IG, Temelkovski J, and Kumar RK (2000).
Dissociation of Inflammatory and Epithelial Responses in a Murine Model of
Chronic Asthma. Lab. Invest. 80: 655-62.

Frew AJ (1996). The immunology of respiratory allergies. Toxicol Lett. 86:65-72.

Gelfand EW (2002). Mice are a Good Model of Human AinNay Disease. Am J
Respir Crit Care Med. 166:5-8.

Gilliland G, Perrin S, Blanchard K, and Bunn HF (1990). Analysis of cytokine
mRNA and DNA: detection and quantitation by competitive polymerase chain
reaction. Proc Natl Acad Sci USA. 87(7): 2725-9.

Grammer LC, Ditto AM, Tripathi A, and Harris KE (2002). Prevalence and onset
of rhinitis in subjects with occupational asthma caused by trimellitic anhydride. J
Occup Environ Med. 44(12):1179-81.

Greenberg, MM (1994). lsocyanates and nasal toxicity: Risk assessment issues.
Inhalation Toxicology. 6(Suppl):458-464.

Griffin P, Allan L, Beckett P, Elms J and Curran AD (2001). The development of
antibodyto trimellitic anhydride. Clin Exp Allergy. 31 :453-457.

GrossmanJ (1997). One Aiwvay, One Disease. Chest. 111:11S-168.
Grunig G, Wamock M, Wakil AE, Venkayaa R, Brombacher F, Rennick DM,
Sheppard D, Mohrs M, Donaldson DD, Locksley RM, Corry DB (1998).

Requirement of lL-13 Independently of lL-4 in Experimental Asthma. Science
282:2261-62.

206

Hamelman E, Oshiba A, Loader J, Larsen GL, Gleich G, Lee J, and Gelfand EW
(1997). Antiinterleukin-5 Antibody Prevents Ainivay Hyperresponsiveness in a
Murine Model of Airway Sensitization. Am J. Respir Crit Care Med. 155:819-825.

Hardisty JF, Garman RH, Harkema JR, Lomax LG and Morgan KT (1999).
Histopathology of Nasal Olfactory Mucosa from Selected Inhalation Toxicity
Studies Conducted with Volatile Chemicals. Toxic Pathology. 27(6):618-627.

Harkema JR, Plopper CG, Hyde DM, St. George JA, and Dungworth DL (1987).
Effects of an ambient level of ozone on primate nasal epithelial mucosubstances.
Quantitative histochemistry. Am J Pathol. 127: 90-96.

Harkema JR, Plopper CG and Pinkerton KE (2000). Comparative Structure of
The Respiratory Tract: Airway Architecture in Humans and Animals. In: Cohen
MD, Zelikoff JT and Schlesinger RB, Pulmonary lmmunotoxicology, Kluner
Academic Press Publishers, Boston. Chapter 1:1-59.

Hayashi M, Higashi K, Kato H, and Kaneko H (2001). Assessment of preferential
Th1 or Th2 induction by low-molecular-weight compounds using a reverse
transcription-polymerase chain reaction method: comparison of two mouse
strains, CS7BU6 and BALB/c. ToxicoIApplPharmacoI. 177(1):38—45.

Herrick CA, Xu L, Wisnewski AV, Das J, Redlich CA, and Bottomly K (2002). A
novel mouse model of diisocyanate-induced asthma showing allergic-type

inflammation in the lung after inhaled antigen challenge. .J Allergy and Clin
Immunol. 109:873-8.

Hern‘ng AC and Kaminski NE (1999). Cannabinol-Mediated Inhibition of Nuclear

Factor-KB, CAMP Response Element-Binding Protein, and Interleukin-2 Secretion
by Activated Thymocytes. J Pharrnacol Exp Ther. 291 (3):1 156-1 163.

Herring AC, Koh WS, and Kaminski NE (1998). Inhibition of the Cyclic AMP
Signaling Cascade and Nuclear Factor Binding to CRE and ch Elements by

Cannabinol, a Minimally CNS-Active Cannabinoid. Biochemical Pharrnacol.
55:1013-1023.

Holgate ST (2000). Inflammatory and structural changes in the airways of
patients with asthma. Resp Med. 94(Suppl D):S3-86.

Jagannath C, Hoffman H, Sepulveda E, Actor JK, Wetsel RA, and Hunter JR RL
(2000). Hypersusceptibility of NJ Mice to Tuberculosis is in Part Due to a
Deficiency of the Fifth Complement Component (C5). Scand J Immunol.
52:369-379.

Jajosky RA, Harrison R, Reinisch F, Flattery J, Chan J, Tumpowsky C, Davis L,
Reilly MJ, Rosenman KD, Kalinowski D, Stanbury M, Schill DP, and Wood J

207

(1999). Surveillance of work-related asthma in selected US. states using
surveillance guidelines for state health departments—Califomia, Massachusetts,
Michigan, and New Jersey, 1993-1995. Morb Mortal Wkly Rep Surveill Summer.
48(3):1-20 (1999).

Jan T-R, and Kaminski NE (2002). Cannabinol Inhibition of interleukin-4
expression in EL4.lL-2 cells is mediated through down-regulation of NF-AT.
Toxicologist. 54:57.

Jan T-R, Farraj AK, Harkema JR, and Kaminski NE (2003). Attenuation of the
ovalbumin-induced allergic airway response by cannabinoid treatment in NJ
mice. ToxicolAppI Pharmacol. 188:24-35.

Jan T-R, Rao GK and Kaminski NE (2002). Cannabinol Enhancement of
Interleukin-2 (IL-2) Expression by T Cells is Associated with an Increase in lL-2
distal Nuclear Factor of Activated T Cell Activity. Molec Pharmacol. 61(2):446-
454.

Karol MH (2001). Bonding and transfer: do epithelial conjugates have a role in
chemical asthma? Clin Exp Allergy. 31:357-360.

Karol MH, Macina OT, and Cunningham A (2001). Cell and Molecular biology of
chemical allergy. Ann Allergy Asthma Immunol. 87(Suppl):28-32.

Karras JG, McGraw K, McKay, Cooper SR, Lerner D, Lu T, Walker C, Dean NM,
and Monia BP (2000). Inhibition of antigen-induced eosinophilia and late phase
hyperresponsiveness by an lL-5 antisense oligonucleotide in mouse models of
asthma. J. Immunol. 164: 5409-15.

Kay AB (2001). Allergy and Allergic Diseases. N Engl J Med. 344(1): 30-37.

Kimber l (1996). The role of the skin in the development of chemical respiratory
hypersensitivity. Toxicol Lett. 86:89-92.

Kimber l and Dearman R (1997). Predicitve Assessment of Respiratory
Sensitizing Potential of Chemicals in Mice. In: Kimber I and Dearman RJ,
Toxicology of Chemical Respiratory Hypersensitivity. Taylor and Francis Limited,
Bristol, PA, pp. 121-134.

Kimber I, and Dearman RJ (2002). Chemical Respiratory Allergy: role of IgE
antibody and relevance of route of exposure. Toxicology. 181-1822311-315.

Kraneveld AD, van der Kleij HPM, Kool M, van Houwelingen AH, Weitenberg

ACD, Redegeld FAM, and Nijkamp PP (2002). Key Role for Mast Cells in
Nonatopic Asthma. J Immunol. 169:2044-2053.

208

Lange RW, Day BW, Lemus R, Tyurin VA, Kagan VE, and Karol MH (1999)
Intracellular S-Glutathionyl Adducts in Murine Lung and Human Bronchoepithelial
Cells after Exposure to Diisocyanatotoluene. Chem Res Toxicol. 12:931-936.

Lange RW, Lantz RC, Stolz DB, Watkins SC, Sundareshan P, Lemus R and
Karol MH (1999). Toluene Diisocyanate Colocalizes with Tubulin on Cilia of
Differentiated Human Airway Epithelial Cells. Toxicol Sci. 50:64-71.

Larsen CP, Regal RR, and Regal JF (2001). Trimellitic Anhydride-Induced
Allergic Response in the Guinea Pig Involves Antibody-Dependent and -
Independent Complement System Activation. J Pharm Exper Ther. 296(2):284-
292.

Lee CG, Homer RJ, Cohn L, Link H, Jung S, Craft JE, Graham BS, Johnson TR,
and Elias JA (2002). Transgenic Overexpression of Interleukin (lL)-10 in the Lung
Causes Mucus Metaplasia, Tissue inflammation, and Airway Remodeling via IL-
13-dependent and —independent Pathways. J. Biol Chemistry. 277(38):35466-
35474.

Leynaert B, Neukirch F, Demoly P, and Bousquet J (2000). Epidemiologic
evidence for asthma and rhinitis comorbidity. J Allergy Clin Immunol.
106:8201-5.

Lombardo LJ and Balmes JR (2000). Occupational Asthma: A Review. Environ
Health Persp. 108(S4):697-704. .

Longphre M, Li D, Gallup M, Drori E, Ordonez CL, Redman T, Wenzel S, Bice
DE, Fahy JV, and Basbaum C (1999). Allergen-induced lL-9 directly stimulates
mucin transcription in respiratory epithelial cells. J Clin Invest. 104(10):1375-82.

Lovik M, Dybing E, and Smith E (1996). Environmental Chemicals and
respiratory hypersensitization: A synopsis. Toxicology Letters. 86:211-222.

Mackison FW, Stricoff RS and Partridge Jr. LJ (1981). NlOSH/OSHA
Occupational Health Guidelines for Chemical Hazards. DHHS (NIOSH)
Publication No. 81-123 (3 Vols). Washington, DC: US. Government Printing
Office.

Maestrelli P, Occari P, Turato G, Papiris SA, Di Stefano A, Mapp CE, Milani GF,
Fabbri LM, and Saetta M (1997). Expression of interleukin (lL)-4 and lL-5
proteins in asthma induced by toluene diisocyanate (TDI). Clin Exp Allergy.
27(11)1292-8.

Makela MJ, Kanehiro A, Borish L, Dakhama A, Loader, J, Joetham A, Xing Z,
Jordana M, LarsenGL, and Gelfand EW (2000). lL-10 is necessary for the

209

expression of airway hyperresponsiveness but not pulmonary inflammation after
allergic sensitization. Proc Natl Acad Sci USA. 97(11): 6007-6012.

Malo J- L and Chan-Yeung M (2001). Occupational asthma. J Allergy and Clin
Immunol. 108: 317-328.

Matheson JM, Lange RW, Lemus R, Karol MH, and Luster MI (2001).
Importance of inflammatory and immune components in a mouse model of
airway reactivity to toluene diisocyanate (TDI). Clin Exp Allergy. 31 :1067-1076.

Matsuda LA, Lolait SJ, Brownstein MJ, Young AC, and Bonner TI (1990).
Structure of a cannabinoid receptor and functional expression of the cloned
cDNA. Nature. 346:561-564.

Meyer JD, Holt DL, Chen Y, Cherry NM, and McDonald JC (2001). Sword
’99zsurveillance of work-related and occupational respiratory disease in the UK.
Occup Med (Land). 51 (3):204-208.

Munro S, Thomas KL, and Abu-Shaar M (1993). Molecular characterization of a
peripheral receptor for cannabinoids. Nature. 365:61-65.

Occupational Safety and Health Administration (1993). OSHA General Industry
Standard (29 CFR 1910.1000). Tables Z-1, Z-2 and Z-3.

Okano M, Nishizaki K, Abe M, Wang M-M, Yoshino T, Satoskar AR, Masuda Y,
and Ham Jr. DA (1999). Strain-dependent induction of allergic rhinitis without
adjuvant in mice. Allergy. 54: 593-60.

Peterson JD, Herzenberg LA, Vasquez K, Waltenbaugh C (1998). Glutathione
levels in antigen-presenting cells modulate Th1 versus Th2 response patterns.
Proc Natl Acad Sci USA. 95:3071-3076.

Petsonk EL (2002). Work-Related Asthma and Implications for the General
Public. Environ Health Perspect. 110 Suppl 4:569-72.

Plitnick LM, Loveless SE, Ladics GS, Holsapple MP, Selgrade MJ, Sailstad DM,
and Smialowicz RJ (2002). Cytokine Profiling for Chemical Sensitizers:
Application of the Ribonuclease Protection Assay and Effect of Dose. Toxicol
Appl Phann. 179:145-154.

Rajananthanan P, Attard GS, Sheikh NA, and Morrow WJW (1999). Evaluation of

novel aggregate stnictures as adjuvants: composition, toxicity studies and
humoral responses. Vaccine. 17: 715-30.

210

Regal JF, Mohrrnan ME, and Sailstad DM (2001). Trimellitic Anhydride-lnduced
Eosinophilia in a Mouse Model of Occupational Asthma. Toxicol Appl Pharrn.
175:234-242.

Robinson MK, Babcock LS, Horn PA, and Kawabata “IT (1996). Specific
Antibody Responses to Subtilisin Carslberg (Alcalase) in Mice: Development of
an lntranasal Exposure Model. Fundam Appl Toxicol. 34:15-24.

Satoh T, Kramarik JA, Tollerud DJ, and Karol MH (1995). A murine model fro
assessing the respiratory hypersensitivity potential of chemical allergens. Toxicol
Lett. 78(1):57-66.

Schatz AR, Lee M, Condie RB, Pulaski JT and Kaminksi NE (1997).
Cannabinoid receptors CB1 and CB2: A Characterization of Expression and
Adenylate Cyclase Modulation within the Immune System. Toxicol Appl
Pharmacol. 142:278—287.

Scheerens H, Buckley TL, Muis TL, Garssen J, Dormans J, Nijkamp FF and Van
Loveren H (1999). Long-term Topical Exposure to Toluene Diisocyanate in Mice
Leads to Antibody Production and In Vivo Airway Hyper-responsiveness Three
Hours after lntranasal Challenge. Am J Respir Crit Care Med. 159(4) 1074-80.

Serafin WE (1996). Drugs Used In The Treatment of Ashtma, in Hardman JG
and Limbird LE (9th Ed) Goodman and Gilman’s The Pharmacological Basis of
Therapeutics, New York: McGraw-Hill, pp. 6 ‘

Shen H, Liu J, Liu F, Wang X, Lin X, Xu 2 2, Huang G, and Yuan S (2002). The
observation of local immune response in the lungs from antigen-sensitized and
challenged mice. (article in Chinese) Zhonghua Jie He HE Hu Xi Za Zhi.
25(3): 1 56-1 58

Shim JJ, Dabbagh K, Ueki IF, Dao-Pick T, Burgel P-R, Takeyama K, Tam DC-W,
and Nadel JA (2001). lL-13 induces mucin production by stimulating epidermal
growth factor receptors and by activating neutrophils. Am J Physiol Lung Cell
Mol Physiol. 280:L134-L140.

Southam DS, Dolovich M, O’Byme PM and lnman MD (2002). Distribution of
intranasal instillations in mice: effects of volume, time, body position, and
anesthesia. Am J Physiol Lung Cell Mol Physiol. 282:L833-L839.

Stampfli MR, Wiley RE, Neigh GS, Gajewska BU, Lei X-F, Snider DP, Xing Z,
and Jordana M (1998). GM-CSF Transgene Expression in the Airways Allows
Aerosolized Ovalbumin to Induce Allergic Sensitization in Mice. J Clin Invest.
102(9): 1704-1714.

Steiger D, Hotchkiss J, Baja L, Harkema J, and Basbaum C (1995). Concurrent
increases in the storage and release of mucin-like molecules by rat airway

211

epithelial cells in response to bacterial endotoxin. Am J Respir Cell Mol Biol. 12:
307-314.

Sugawara Y, Okamoto Y, Sawahata T and Tanaka K (1993). An Asthma Model
Developed in the Guinea Pig by lntranasal . Application of 2,4-Toluene
Diisocyanate. Int Arch Allergy Immunol. 101:95-101.

Tashkin DP, Shapiro BJ and Frank IM (1974). Acute effects of smoked
marijuana and oral delta9-tetrahydrocannabinol on specific ainlvay conductance
in asthmatic subjects. Am Rev Respir Dis. 109:420-428.

Tashkin DP, Shapiro BJ, Lee YE, and Harper CE (1975). Effects of smoked
marijuana in experimentally induced asthma. Am Rev Respir Dis. 112:377-386.

Tee RD, Cullinan P, Welch J, Burge PS, and Newman-Taylor AJ (1998).
Specific lgE to isocyanates: A useful diagnostic role in occupational asthma. J
Allergy Clin Immunol. 101:709-15.

Traidl C, Jugert F, Kn'eg T, Merk H and Hunzelmann N (1999). Inhibition of
Allergic Contact Dermatitis to DNCB But Not to Oxazolone in Interleukin-4
Deficient Mice. J Invest Dermatol. 112:476-482.

Ulrich P, Grenet O, Bluemel J, and Vohr HW (2001). Cytokine expression
profiles during murine contact allergy: T helper 2 cytokines are expressed
irrespective of the type of contact allergen. Arch Toxicol. 75:470-479.

van Houwelingen AH, Kool M, de Jager SCA, Redegeld FAM, van Heuven-
Nolson D, Kraneveld AD and Nijkamp FP (2002). Mast Cell-Derived TNF-or
Primes Sensory Nerve Endings in a Pulmonary Hypersensitivity Reaction. J
Immunol. 168:5297-5302.

Vandebriel R, De Jong WH, Spiekstra SW, Van Dijk M, Fluitman A, Garssen J,
and Van Loveren H (2000). Assessment of Preferential T-Helper 1 or T-Helper 2
Induction by Low Molecular Weight Compounds Using the Local Lymph Node
Assay in Conjunction with RT-PCR and ELISA for Interferon-y and Interleukin-4.
Toxicol Appl Phann. 162:77-85.

Vanden Heuvel JP, Clark 60, Thompson CL, McCoy 2, Miller CR, Lucie GW,
and Bell DA (1993). CYP1A1 mRNA levels as a human exposure biomarker". use
of quantitative polymerase chain reaction to measure CYP1A1 expression in
human peripheral blood lymphocytes. Carcinogenesis. 14(10): 2003-6.

van de Rijn M, Mehlhop PD, Judkins A, Rothenberg ME, Luster AD, and Oettgen
HC (1998). A murine model of allergic rhinitis: Studies on the role of lgE in
pathogenesis and analysis of the eosinophil influx elicited by allergen and
eotaxin. J Allergy Clin Immunol. 102: 65-74.

212

 

Vohr H-W, Pauluhn J, and Ahr HJ (2002). Respiratory hypersensitivity to
trimellitic anhydride in Brown Norway rats: evidence for different activation
pattern of immune cells following topical and respiratory induction. Arch Toxicol.
76:538-544. .

Warbrick EV, Dearman RJ, Basketter DA and Kimber l (1999). Analysis of
interleukin 12 protein production and mRNA expression in mice exposed topically
to chemical allergens. Toxicology. 132(1):57-66.

Weissman DN, and Lewis DM. Is Specific Antibody Determination Diagnostic
For Asthma Attributable to Low-Molecular-Weight Agents? Occupational
Medicine: State of the Art Reviews. Vol. 15, No. 2, April-June, 2000, pp. 385-
397. Philadelphia, Hanley, & Belfus, Inc.

Wills-Karp M (1999). Immunologic Basis of Antigen-Induced Airway Hyper-
responsiveness. Annu. Rev. Immunol. 17: 255-81.

Wills-Karp M (1999). Immunologic Basis of Antigen-Induced Airway Hyper-
responsiveness. Annu Rev Immunol. 172255-81.

Wills-Karp M, and Ewart SL (1997). The genetics of allergen-induced airway
hyperresponsiveness in mice. Am J Respir Crit Care Med. 154(4 Pt 2)2889-96.

Wills-Karp M, Luyimbazi J, Xu X, Schofield B, Neben TY, Karp CL, and
Donaldson DD (1998). Interleukin-13: Central Mediator of Allergic Asthma.
Science. 282:2258-2261.

Wisnewski AV, Sirvastava R, Herick C, Xu L, Lemus R, Cain H, Magoski NM,
Karol MH, Bottomly K, and Redlich CA (2000). Identification of Human Lung and
Skin Proteins Conjugated with Hexamethylene Diisocyanate In Vitro and In Vivo.
Am J Respir Crit Care Med. I62z2230-36.

Woolhiser MR, Munson AE, and Meade BJ (2000). Immunological Responses of
Mice Following Administration of Natural Rubber Latex Proteins by Different
Routes of Exposure. Toxicological Sciences. 55:343-351.

World Health Organization (1999). Clinical Aspects of the Most Important
Allergic Diseases: Allergic Rhinitis and Conjunctivitis. Principles and Methods for
Assessing Allergic Hypersensitization Associated with Exposure to Chemicals,
International Program on Chemical Safety, Environmental Health Criteria 212,
pp. 181-186. Geneva.

Yang X, Wang S, Fan Y, and Han X (2000). lL-10 deficiency prevents IL-5

overproduction and eosinophilic inflammation in a murine model of asthma-like
reaction. Eur J. Immunol. 30(2): 382-91.

213

Yea SS, Yang KH and Kaminski NE (2000). Role of nuclear factor of activated
T-cells and activator protein-1 in the inhibition of Interleukin-2 gene transcription
by cannabinol in EL4 T-cells. J Pharmacol Exp Ther. 292:597-605.

Young JT (1981). Histopathologic examination of the rat nasal cavity. Fundam
Appl Toxicol. 1: 309-312.

Yssel H, and Groux H (2000). Characterization of T Cell Subpopulations
Involved in the Pathogenesis of Asthma and Allergic Diseases. Int Arch Allergy
Immunol. 121:10-18.

Zhou C, Crocker C, Koenig G, Romero,FA, Townley RG (1997). Anti-interleukin-

4 Inhibits lmmunoglobulin E Production in a Murine Model of Atoplc Asthma. J
Asthma. 34(3):195-201.

214

lllllllllllllllll