 

('.N a . .
an.»

:Vw

 

 

 

.2...»
Away.”
I 9. L.

1.. a:
t... ....:. 34
o!) \.

.1

If
m.

h.

,. w.
a“ a

 

I}: .VJﬂJupz: 1413.451.
swuwru; ﬁ‘ﬁmA bah. was. ..

 

n I V‘ V 4
£934. 4&5th

 

“Tm MICHIGAIg‘g‘A S
. . TE UNIVERSITY
a) EAST LANSING, MICH 48824—1048
( ’\
‘.I' ' I. - r;
paw/(47¢

This is to certify that the
thesis entitled

AN EPIDEMIOLOGICAL REVIEW OF THE SEVERE ACUTE
RESPIRATORY SYNDROME AND HANTAVIRUS PULMONARY
SYNDROME,

A COMPARABLE DISEASE

presented by

Heidi Lorraine Long

has been accepted towards fulﬁllment
of the requirements for the

Masters of degree in Epidemiology
Science

 

 

mlﬂ, (ZZZ; 077D

Major Professor’s Signature
3.2/2, :23] .100 1/
Date

MSU is an Afﬁrmative Action/Equal Opportunity Institution

‘.— - -.w

 

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 c:/C|RC/Date0ue.p65~p.15

AN EPIDEMIOLOGICAL REVIEW OF THE SEVERE ACUTE
RESPIRATORY SYNDROME AND
HANTAVIRUS PULMONARY SYNDROME,

A COMPARABLE DISEASE

By

Heidi Lorraine Long

A THESIS

Submitted to
Michigan State University
in partial fulﬁllment of the requirements
for the degree of

MASTER OF SCIENCE
Department of Epidemiology

2004

ABSTRACT
AN EPIDEMIOLOGICAL REVIEW OF THE SEVERE ACUTE RESPIRATORY
SYNDROME AND HANTAVIRUS PULMONARY SYNDROME,
A COMPARABLE DISEASE
By

Heidi Lorraine Long

The global epidemic severity of SARS contributed to a need for implementation
of public health control and prevention mechanisms in 2003. Though these measures
were ultimately successful in bringing the epidemic to a halt, a re-emergence could bring
new and possibly greater challenges.

Outbreak investigations of emerging diseases from the past may be an important
resource for understanding newly emerging diseases of the future, such as SARS. This
epidemiological review examines a parallel comparison of SARS and HPS in order to
formulate important conclusions for applying the previous experience of HPS public
health responses to future SARS outbreaks. Suggested recommendations include
integration of modern technology, strict biosafety guidelines, prioritizing education to
health professionals, implementing strict travel guidelines, risk reduction, education of
quarantine laws, creating guidelines for virus eradication, implementing occupational
guidelines, and initiating public health education.

These future recommendations suggested for SARS, formulated from the HPS
parallel comparison, may be a means to produce more beneficial outbreak outcomes if
SARS recurs in the future. Furthermore, though every communicable disease is unique,
this comparative approach may be useful in tailoring responses to other such emerging

diseases in the future.

ACKNOWLEDGEMENTS

Completion of this thesis, as well as a clear understanding of epidemiological
concepts, would not have been accomplished without the time and effort of Dr. Michael
Collins. His insight and assistance have been invaluable throughout the process and I
thank him dearly for his support and patience.

I also wish to greatly thank Dr. Michael Kron and Dr. Dorothy Pathak for their
continued support and contributions to the ﬁnal product along with Dr. Dan Murman for

his amazing encouragement and positive attitude.

iii

TABLE OF CONTENTS

LIST OF TABLES ............................................................................................................. vi
LIST OF FIGURES .......................................................................................................... vii
LIST OF SYMBOLS AND ABBREVIATIONS ............................................................... x
INTRODUCTION .............................................................................................................. 1
CHAPTER 1
SEVERE ACUTE RESPIRATORY SYNDROME (SARS) DESCRIPTIVE
EPIDEMIOLOGY .............................................................................................................. 3
1.1 TIME PERIOD OF INTEREST ...................................................................... 3
1.2 GEOGRAPHIC DISTINCTIONS ................................................................... 6
A. China ......................................................................................... 7
China-Hang Kong ..................................................................... 8
C Irina-Beijing .......................................................................... 1 O
C hina- Taiwan ......................................................................... 1 1
B. Canada ..................................................................................... 12
C. Singapore ............... 13
D. Viet Nam ................................................................................. 17
E. United States ........................................................................... 17
1.3 CASE DEFINITION ...................................................................................... 19
1.4 INCUBATION PERIOD ............................................................................... 23
1.5 . PERSONAL CHARACTERISTICS ............................................................. 25
A. Age .......................................................................................... 25
B. Gender ..................................................................................... 27
C. Residence Location ................................................................. 27
D. Other Risk Factors .................................................................. 28
CHAPTER 2
SEVERE ACUTE RESPIRATORY SYNDROME (SARS) ANALYTIC
EPIDEMIOLOGY ............................................................................................................ 30
2.1 EPIDEMIOLOGICAL AGENT .................................................................... 30
2.2 MODE OF COMMUNICATION .................................................................. 35
2.3 TRANSMISSION .......................................................................................... 41
CHAPTER 3
HANTA VIRUS PULMONARY SYNDROME DESCRIPTIVE EPIDEMIOLOGY 50
3.1 TIME PERIOD OF INTEREST .................................................................... 50
3.2 GEOGRAPHIC DISTINCTIONS ................................................................. 54
A. North America ......................................................................... 54
North America- United States .................................................. 54
North America-Canada ........................................................... 55

iv

B. Central America ...................................................................... 56

Central America-Panama ....................................................... 56

C. South America ......................................................................... 56

South America-A rgentina ........................................................ 57

South America-Brazil .............................................................. 58

South America-Chile ............................................................... 58

South America-Paraguay ........................................................ 59

3.3 CASE DEFINITION ...................................................................................... 59

3.4 INCUBATION PERIOD ............................................................................... 61

3.5 PERSONAL CHARACTERISTICS ............................................................. 62

A. Age .......................................................................................... 62

B. Gender/Race ............................................................................ 62

C. Other Risk Factors .................................................................. 63
CHAPTER 4

HANTA VIRUS PULMONARY SYNDROME ANALYTIC EPIDEMIOLOGY ......... 65

4.1 EPIDEMIOLOGICAL AGENT .................................................................... 65

4.2 MODE OF COMMUNICATION .................................................................. 68

4.3 TRANSMISSION .......................................................................................... 70
CHAPTER 5

PARALLEL COMPARISON OF SARS AND HPS ........................................................ 74

5.1 SIMILARITIES ............................................................................................. 74

5.2 DIFFERENCES ............................................................................................. 78

5.3 DISEASE TO HUMAN RESERVOIR CONTACT ...................................... 81
CHAPTER 6

PUBLIC HEALTH OUTBREAK MEASURES .............................................................. 84

6.1 OUTBREAK INVESTIGATIONS ................................................................ 84

6.2 OUTBREAK CONTROL .............................................................................. 94

6.3 PUBLIC HEALTH AWARENESS ............................................................. 103
CHAPTER 7

DEF ICIENCIES IN SARS KNOWLEDGE ................................................................... 107
CHAPTER 8

FUTURE RECOMMENDATIONS FOR SARS FROM HPS UNDERSTANDING... I 12

LIST OF TABLES

Table 1. SARS Chronology of Events ........................................................................... 163
Table 2. Summary Table of SARS by Country, November 1, 2002 through August 7,
2003 ................................................................................................................................. 166
Table 3. Summary of SARS Incubation Period Estimates ............................................. 168
Table 4. Number of Cases and Deaths from HPS (Regions of the Americas),

1993-2004 ....................................................................................................................... 169
Table 5. Hantaviruses ..................................................................................................... 170

vi

LIST OF FIGURES

Figure 1. Worldwide Epidemic Curve of Probable cases of SARS by week Of onset... 122
Figure 2. Worldwide Epidemic Curve of Probable cases of SARS by date of report 123

Figure 3. SARS: Cumulative Number of Probable Cases Worldwide, June 16, 2003. 124

Figure 4. China Epidemic Curve for Probable SARS Cases by Date of Report ........... 125
Figure 5. Probable cases of SARS in selected regions .................................................. 126
Figure 6. Map of China and Provinces .......................................................................... 127

Figure 7. Hong Kong, China Epidemic Curve for Probable SARS Cases by Date of
Onset ............................................................................................................................... 128

Figure 8. Beijing, China Epidemic Curve for Probable SARS Cases by Date of
Hospitalization and Type of Exposure ............................................................................ 129

Figure 9. Taiwan, China Epidemic Curve for Probable SARS Cases by

Date of Onset .................................................................................................................. 130
Figure 10. Taiwan Geographic Distribution of Probable SARS Cases, 2003 ............... 131
Figure 11. Canada Epidemic Curve for Probable SARS Cases by Date of Onset ......... 132

Figure 12. Singapore Epidemic Curve for Probable SARS Cases by Date of Onset 133
Figure 13. Viet Nam Epidemic Curve for Probable SARS Cases by Date of Onset ..... 134

Figure 14. United States Epidemic Curve for Probable SARS Cases by Date of
Onset ............................................................................................................................... 135

Figure 15. Number of Probable SARS Patients Reporting Travel to Areas with
Community Transmission of SARS, by Date of Illness Onset, United States, February 27
- May 7, 2003 .................................................................................................................. 136
Figure 16. Structure of SARS-associated coronavirus (SARS-COV) ............................ 137

Figure 17. SARS-associated coronavirus (SARS-CoV) and associated lesions in
macaque lungs ................................................................................................................. 138

Figure 18. Timing of the Most Recent Common Ancestor of the Hong Kong
SARS-COV ...................................................................................................................... 139

vii

Figure 19. Proposed Mechanism of SARS-COV transition from animals to humans 140

Figure 20. Himalayan palm civet and a Raccoon-dog ................................................... 141
Figure 21. A 29-nuc1eotide deletion in human SARS-COV compared to animals

SARS-CoV ...................................................................................................................... 142
Figure 22. Phylogenetic Analysis of the Nucleotide Acid Sequence of the Spike Gene of
Human and Animal SARS-CoV ..................................................................................... 143
Figure 23. Chain of SARS Transmission for Hotel M in Hong Kong Leading to

International Spread of SARS ......................................................................................... 144
Figure 24. Generational Transmission of SARS ............................................................ 145
Figure 25. Schematic for the new emergence of an infectious disease .......................... 146

Figure 26. Secondary Cases of SARS by days to isolation of the source case, Singapore,

April 15, 2003 ................................................................................................................. 147
Figure 27. Probable Cases of SARS by Source of Transmission in chain of 77 cases in
Beijing, 2003 ................................................................................................................... 148
Figure 28. Hantavirus Pulmonary Syndrome Cases by Region, United States, as of
January 6, 2004 (N=358) ................................................................................................ 149
Figure 29. Geographic Distribution of HPS Cases in the Americas .............................. 150
Figure 30. HPS Cases in North and South America by Country, 1993-2004 ................ 151
Figure 31. Exposure Period in days before onset of 11 case-patients with well-
documented HPS exposures ............................................................................................ 152
Figure 32. Hantavirus Pulmonary Syndrome Cases by State of Residence, United States,
January 6, 2004 ............................................................................................................... 153
Figure 33. New World Hantaviruses Geographic Distribution ...................................... 154
Figure 34. Sin Nombre Virus ......................................................................................... 155

Figure 35. Phylogenetic relation of the Adult Respiratory Distress Syndrome (ARDS)—
associated hantavirus from the Four Comers region to previous characterized
hantaviruses ..................................................................................................................... 156

Figure 36. The Deer Mouse (Peromyscus maniculatus) ................................................ 157

viii

Figure 37.
Figure 38.
Figure 39.
Figure 40.

Figure 41.

Deer Mouse Population Range, United States, June 6, 2002 ....................... 158
White-footed Mouse (Peromyscus leucopus) ............................................... 159
Cotton Rat (Sigmodon hispidus) ................................................................... 160
Rice Rat (Oryzomys palustris) ...................................................................... 161
HPS Transmission Schematic ....................................................................... 162

ix

ARDS

CDC

CFR

CSTE

D.P.I.

ENSO

IHS

MOH

OMI

PAHO

PT -PCR

SARS

SARS-CoV

SARS RUI

SNV

TTSH

VSV

WHO

LIST OF SYMBOLS OR ABBREVIATIONS

Acute Respiratory Distress Syndrome

Center for Disease Control

Case Fatality Rate

Council of State and Territorial Epidemiologists
Days Post Inoculation

E1 Nino-Southern Oscillation

Hanoi French Hospital

Hantavirus Pulmonary Syndrome

Indian Health Service

Ministry of Health

Ofﬁce of Medical Investigations

Pan American Health Organization

Reverse Transcription Polymerase Chain Reaction
Basic Reproductive Rate

Severe Acute Respiratory Syndrome
SARS-associated Coronavirus

SARS report under investigation

Sin Nombre Virus

Tan Tock Seng Hospital

Vesicular Stomatitis Virus

World Health Organization

INTRODUCTION

The Severe Acute Respiratory Syndrome (SARS) is the ﬁrst severe and highly
transmissible new pandemic disease to emerge in the 21St century. SARS is a viral lower
respiratory illness characterized clinically by high fever, headache, body aches, malaise,
and myalgia [1]. The newly emerging disease originated in November 2002 in the
Guangdong Province of China. By the end of August, SARS had spread to Hong Kong
and 32 other countries or regions, infecting around 8,459 known patients with more than
800 deaths [2]. The overall economic cost from the SARS outbreak was estimated at $30
to $140 billion [3]. The global epidemic severity of SARS contributed to a need for
implementation of public health control and prevention mechanisms. Outbreak
investigations of emerging diseases from the past may be an important resource for
understanding those newly emerging diseases of the future, such as SARS.

Hantavirus Pulmonary Syndrome (HPS) was a previously unknown disease until
1993. The newly emerging disease was identiﬁed among residents of the southwestern
Unites States in “The Four Comers” region including Arizona, New Mexico, Colorado,
and Utah. HPS is an acute zoonotic viral disease characterized clinically by fever, body
aches, myalgias, nausea, vomiting, and gastrointestinal complaints [4]. These initial
symptoms are often followed by rapid onset of respiratory distress and hypotension.
From 1993 to 2004 there have been about 1910 cases of HPS reported in the United
States, Canada, South and Central America. The case-fatality rate is approximately 37%
[5], which represents a signiﬁcant public health concern.

By providing an epidemiological overview of both SARS and HPS, the parallel

nature of the disease relationship can be formulated with a sufﬁcient emphasis on the

human to reservoir contact for each disease. From this information, important
conclusions may be used for applying HPS outbreak investigations, outbreak control
measures, and public health awareness to the current newly emerging disease SARS
outbreak situation. With the knowledge developed from the previous emergence of HPS
in 1993, there may be important recommendations to consider for public health initiatives
and prevention of the newly emerging disease of 2003, SARS, along with other not yet

newly emerging diseases.

Chapter 1

SEVERE ACUTE RESPIRATORY SYNDROME (SARS)
DESCRIPTIVE EPIDEMIOLOGY

1.1 TIME PERIOD OF INTEREST

The earliest known cases of SARS originated in the Guangdong Province of
Southern China in November of 2002, when cases of severe pneumonia of unknown
etiology were reported [1]. The ﬁrst ofﬁcial report of an outbreak of atypical pneumonia
in China was received by the World Health Organization on February 11, 2003. At this
point in the disease emergence, there were 305 affected individuals resulting in ﬁve
deaths [1]. The epidemic spread was later linked to a SARS infected 65-year-old
physician from the Guangdong Province of China who had accommodations for the night
of February 21 on the 9th ﬂoor of a Hong Kong hotel. The physician had been ill since
February 15, admitted to a hospital on February 22, and died on March 3, 2003 [6].
Unfortunately, the illness was spread to at least seventeen other hotel guests. Ten of the
SARS patients were in the hotel the same day as the index case and 2 stayed in the hotel
the same time that three other symptomatic patients were guests at the hotel.
Environmental sampling was completed on the carpet outside room 911, the index case’s
room, and the elevator area. The results showed a possible “hot zone” (possible fomites
or respiratory secretions) which were PCR positive for 3 months after the stay of the
index case in the hotel. Interestingly, the index case did not have unusually high viral
loads when tested on days 9 and 11 of illness. This maybe important as to why those on
the airplane were not signiﬁcant in the outbreak of SARS.

This speciﬁc hotel location and time marks the beginning of the international

spread of SARS, which allowed the newly emerging disease to later reach global

epidemic levels. Those guests who became infected carried the virus to hospitals and
homes in Hong Kong, Singapore, Vietnam, while travelers extended the transmission to
Canada and the United States, producing the SARS epidemic of 2003. The World Health
Organization issued a historic global alert on SARS on March 12, 2003 [7]. Global alerts
are used as a global radio-communication network during times of international threat.
The SARS global alert included non-speciﬁc recommendations such as recent SARS
statistics, case deﬁnition and name, case management guidelines through isolation,
infection control recommendations, and general guidance to travelers. Table one
represents a time line of the important events in the SARS outbreak and control. The
chronology of events emphasizes the efﬁcient actions and outbreak investigation
conclusions determined in a relatively minimal time span.

The worldwide epidemic curve produced from the outbreak is an important
reference for understanding the epidemiological time elements. Figure 1 represents the
distribution of probable SARS cases by week of onset covering the entire time interval of
the outbreak from November 2002 to June 2003. It’s important to note that the graph
does not include 2,521 cases of SARS from Beijing, China in which the onset was not
currently available. Figure 2, on the other hand, represents an updated epidemic
distribution of SARS probable cases by date of report for the main time period of interest
in which the outbreak was at the highest levels, from mid-March until the end of May.
This graph does not include 1,190 cases of SARS from November 2002 to the beginning
of April.

The most important characteristic of the distribution of onset dates is the

clustering of SARS cases around a speciﬁc time period, indicating a disease epidemic.

The graphics clearly Show a change in the number of cases of SARS over time. From
January to February 2003 there was a slight increase in probable SARS cases with a
following decline in early March. However, the number of simultaneous cases was
signiﬁcantly higher from mid March to mid May than the previous two months. Also, a
key peak in SARS cases appeared in mid April. After this time, there was a steady
decline till June. The epidemic curve pattern is characteristic of a propagated epidemic
since there is a series of progressively taller peaks. This type of outbreak scenario is
indicative of a person-to-person spread outbreak. The speciﬁc SARS transmission
patterns will be discussed in detail in Chapter 2.
Any tendency toward seasonality of SARS is still undescribed. In December

2003, the ﬁrst suspected case of SARS since June 2003 was reported [8]. Two more
cases were later reported in late December and January. A few months later, on April 23,
2004 the Chinese Ministry of Health (MOH) reported four patients with possible SARS
to the World Health Organization (WHO). Two of the cases were from Beijing and two
were ﬁ'om the Anhui Province, located in east-central China [9]. Only a few days later,
ﬁve more SARS cases were reported. Of the nine China SARS cases reported in 2004,
four were classiﬁed by Chinese health authorities as “conﬁrmed” and ﬁve were listed as
“suspected” [10]. It’s important to note that two of the nine patients worked at the
National Institute of Virology Laboratory of China’s CDC in Beijing. The laboratory is
known for conducting research on SARS-CoV.

The number of newly reported cases is insufﬁcient to accurately determine any

seasonal variation. As we learn and understand more about SARS, a more accurate

understanding of patterns for season may be established if the disease is recurrent in
future years.
1.2 GEOGRAPHIC DISTINCTIONS

SARS is the ﬁrst severe and highly transmissible new pandemic disease to emerge
in the 21St century. The disease is identiﬁed as pandemic since it has occurred in a
geographically widespread location. Figure 3 portrays the number of cumulative
probable SARS cases reported worldwide for various geographic regions from the
beginning of SARS emergence until June 16, 2003. The three areas experiencing the
highest level of SARS cases were China, Singapore, and Canada. Since SARS originated
in China, this would explain the higher number of cases in these regions compared to
other parts of the world. All the cases outside of China resulted from an index case that
had traveled to China, hence creating the international spread of SARS.

The SARS outbreaks occurring before the World Health Organization’s global
alert on March 15, 2003 included the following regions: China, Hong Kong, Viet Nam,
Singapore, and Canada. The only region to experience SARS at an outbreak level after
the March 15 global alert was Taiwan. This distinction is important and clariﬁes that the
control and prevention strategies implemented in concordance with the global alert were
substantial in decreasing the outbreak potential and levels of SARS. It becomes
important to understand the geographic regions where most of the cases of SARS cases
came from and discuss the epidemiological patterns in these areas and details of the

emergence of SARS in these areas.

A. China
The People’s Republic of China experienced the greatest number of SARS cases
in the world and is the region where the emergence of SARS has been located. Figure 4
represents the epidemic curve for Chinese SARS probable cases by date of report from
February to July of 2003. Throughout the graphic distribution there are a few distinct
peaks in the number of cases. This pattern is indicative of multiple cluster outbreaks of
SARS cases during the speciﬁed date of report. All the areas in China can be classiﬁed
into four regions according to the epidemic conditions during this time period including:
1. Local epidemic: Guangdong Province
2. Imported cases leading to a local epidemic: Beijing, Tianjin, Shanxi Province,
Hebei Province, Inner Mongolia Autonomous Region

3. Imported cases NOT leading to a local epidemic: Shanghai, Shandong
Province, Hunan Province, Liaoning Province, and Ningxia Autonomous
Region

4. No cases reported: Hainan Province, Yunnan Province, Guizhou Province,
Qinghai Province, Tibet Autonomous Region, Xinjiang Autonomous Region,
Heilongjang Province [11]

In January 2003, a clustered outbreak of unknown atypical pneumonia was
reported to the Health Bureau of the Guangdong Province in China [1]. By completing a
retrospective study of the atypical pneumonia cases identiﬁed, studies linked the ﬁrst
cases of SARS occurrence to November 2002. It wasn’t until February 2003 that the
World Health Organization received a report from the Chinese Ministry of Health of an

outbreak of an acute respiratory syndrome resulting in 305 cases and 5 deaths in the

Guangdong Province [12]. The ﬁrst distinct peak on Figure 4 represents the reporting of
these cases. The overall pattern of China’s epidemic curve is indicative of a multiple
clustered pattern with a person-to-person transmission distinction. Figure 5 portrays the
number of SARS probable cases per speciﬁc region in China and other key regions of the
world. From this ﬁgure, it is clear that the various regions of China contributed to the
largest number of probable SARS cases. For a visualization of the exact regions in China
that were affected see Figure 6. The map Shows the country of China divided up into the
various Provinces and the key regions within these areas. The geographic areas affected
by SARS in China are greatly dispersed over the country.
China-Hang Kong

Hong Kong, China represented an important location of multiple clusters
contributing to the outbreak. Hong Kong is located in the southeastern portion of China
next to the Guangdong Province (see Figure 6). The two important “superspreading
events” that have been identiﬁed in Hong Kong resulted in over 1000 SARS cases [1].
“Superspreading” refers to one person infecting many other people. The epidemic curve
of SARS cases for Hong Kong by date of onset is represented in Figure 7. Again, a
pattern of person-to-person transmission can be detected with a majority of the SARS
cases occurring around the end of March.

Case 1

The ﬁrst important superspreading event was referred to as the Metropole
Hotel outbreak [1]. This speciﬁc SARS cluster is signiﬁcant as we consider the
severe potential of the international spread of an infectious disease such as SARS.

As mentioned previously, the epidemic spread of SARS was linked to a SARS

infected 65-year-old physician who had accommodations for the night of
February 21 on the 9th ﬂoor of a Hong Kong hotel [6]. The illness was spread to
at least seventeen other hotel guests, marking the beginning of the international
spread of SARS, which allowed the newly emerging disease to later reach global
epidemic levels. The index cases from Toronto, Hong Kong, Singapore, and
Hanoi outbreaks were all associated with the Metropole hotel, as were cases
identiﬁed in the United States and Ireland [1].
Case 2

The second superspreading event was referred to as the Amoy Gardens
outbreak, representing a cluster of SARS cases. The index patient in this outbreak
was a 33-year-old man from Shenzhen who had visited his brother in the Amoy
Gardens, Kowloon Bay, Hong Kong [1]. This individual was being treated for
chronic renal disease at the Prince of Wales Hospital in Hong Kong. The index
case developed SARS symptoms on March 14, 2003. On March 14 and 19, he
had visited his brother, who owned a ﬂat on Block E of Amoy Gardens. At this
time the patient had diarrhea and used the toilet regularly during the visit. From
this initial event, the SARS case’s brother, sister-in-law, and two nurses at the
Prince of Wales hospital developed SARS. Also, person-to-person Spread
contributed to the disease development in other blocks within the Amoy Gardens
complex, creating a cluster of SARS cases within this speciﬁc location.
Aerosolization of fecal waste contamination of the SARS agent has been
proposed to contribute to this cluster of SARS cases [2], although new reports are

questioning this hypothesis. These speciﬁc modes of transmission will be

discussed in more detail in the Chapter 2. From these two important events in
Hong Kong, multiple SARS clusters were generated and the international spread
of SARS was initiated.
China-Beijing
Beijing, China reported the highest number of SARS probable cases during the
outbreak of 2003 (see Figure 5). The SARS outbreak was ﬁrst reported in Beijing in
April 2003 after previous outbreaks were detected in other regions of China. Beijing’s
outbreak involved multiple imported cases in contrast to other outbreak regions such as
Canada that resulted from a single imported case of SARS.
Case 1
The earliest cases of SARS in Beijing occurred from individuals who had
traveled to the Guangdong Province and Hong Kong. The ﬁrst index case of
SARS recognized occurred in a 27-year-old businesswoman who developed
symptoms on February 22, 2003 while traveling in Guangdong [13]. She ﬁrst
went to a hospital in the Shanxi Province for treatment. After returning to
Beijing, She was hospitalized in a military hospital and later transferred to an
infectious disease health care facility. The patient transferred SARS to 10
healthcare workers and 8 family members and friends.
Case 2
The second index case was a 72-year-old man who visited Hong Kong’s
Prince of Wales Hospital after developing symptoms on March 14. The patient
was treated in two Beijing hospitals after ﬂying back from Hong Kong. He later

died on March 20. After thorough contact tracing investigations, there were at

10

least 59 cases of SARS in Beijing traced back to this one patient including family

members and health care workers from both facilities [13]. Figure 8 represents

the epidemic curve produced from the SARS cases in Beijing by date of

hospitalization. A clear pattern of person-to-person transmission is indicated by

the shape of the epidemic curve. Multiple clusters of SARS were recognized in

Beijing particularly in hospital facilities. These exact transmission patterns and

characteristics will be discussed in Chapter 2.
China-Taiwan

Taiwan has extensive business relations with Hong Kong and the mainland of
China where the ﬁrst SARS cases were reported. This distinction is highly related with
the spread of SARS to Taiwan. The ﬁrst known case of SARS in Taiwan was identiﬁed
on March 14 in an individual who had traveled to the Guangdong Province in China [14].
Figure 9 represents the epidemic curve for SARS probable cases in Taiwan by date of
onset. The distribution shows the greatest number of SARS cases occurring between
mid-April to the end of May. For the speciﬁc geographic distribution of SARS cases in
Taiwan see Figure 10. The majority of cases appeared in the Northern region of Taiwan
and in the Southwestern region.

The epidemic in Taiwan had two distinct phases, before and after April 20, 2003.
From March 7 to April 19, 78% of the probable SARS cases were travel related, 6% were
hospital-acquired, and 16% occurred in households and among social contacts of SARS
cases. Interestingly, these proportions of SARS cases changed signiﬁcantly from April

20 to May 16. During the second phase in Taiwan, 89% of SARS cases were hospital-

11

acquired, 9% travel related, and 2% acquired from the community [1]. These statistics
represent an important epidemiological change in transmission of SARS in Taiwan.
B. Canada
Canada’s SARS outbreak resulted from a single imported case resulting in two
distinct epidemiological clusters. Figure 11 represents the epidemic curve of probable
SARS cases produced in Canada in which the two phases of the outbreak are clearly
distinguishable by the two clustered SARS distributions.
Case 1
The initial transmission of SARS into Canada began with an index case
that had traveled to China and spent some time in the Metropole Hotel in Hong
Kong during February 2003. As noted previously, this speciﬁc location has been
linked to the source of the initial international spread of SARS. A family contact
of the individual that traveled to China became ill with symptoms related to
SARS and was treated at a hospital in the Greater Toronto Area (GTA). This
individual transmitted SARS to other patients and staff at the hospital. The ﬁrst
phase of SARS cases as seen in Figure 11 occurred from late February to mid
April creating a cluster of SARS cases in about 100 healthcare workers [1, 15].
Case 2
From Figure 11 the second cluster phase of SARS in Canada distinctly
occurred between mid-May and the beginning of June. The ﬁrst case of SARS
linked to the second phase of SARS in the Ontario outbreak was a 96-year-old
man with a fractured pelvis admitted to an orthopedic hospital ward in the index

hospital on March 22, 2003 [15]. Onset of symptoms occurred on April 2 with

12

the development of respiratory symptoms, fever, diarrhea, and evidence of
atypical pneumonia. From the hospital admission of this SARS case, other
patients close to the SARS patient, visitors, and health care workers who
developed SARS were all later linked to the initial hospital case. Of the SARS
cases reported in Canada to the Toronto Public Health Department, 39% occurred
among healthcare workers, 38% resulted from direct exposure to SARS during
hospitalization, and 23% occurred among those visiting the hospital [I]. Also,
90% of the SARS cases reported from the second outbreak phase of SARS in
Canada resulted from direct exposure in the index hospital [1]. It becomes
important to note the epidemiological clustering of SARS in the hospital setting
and the transmission of SARS into Canada from one distinct international
traveling incident.
C. Singapore
The experience of SARS in Singapore was analogous to that in Hong Kong,
Vietnam, and Canada in which the ﬁrst cases of SARS were associated with a large
number of health-care associated infections. Figure 12 shows the epidemic curve of
probable SARS cases in Singapore by date of onset. Person-to—person transmission is
assumed based upon the distribution of cases with two clearly distinct peaks in the
number of cases reported.
On March 6, 2003 the Singapore Ministry of Health (MOH) was notiﬁed of three
individuals who traveled to Hong Kong during late February and were later admitted to
the hospital with pneumonia [16] before the WHO issued the ﬁrst global alert. The index

case had stayed at the Metrople hotel on February 20 and 21 along with the index SARS

l3

m1". mare-roan:

 

 

case that transmitted the virus to other hotel guests allowing for the international spread
of SARS. During this early phase of the outbreak in Singapore, the original imported
case (described as case 1 below) and a nurse contact was associated with large clusters of
SARS in Singapore.

One important epidemiological component of the SARS outbreak in Singapore
was that ﬁve people with probable SARS accounted for various super spreading events,
deﬁned as infecting 10 or more people with SARS. Those people resulting as secondary
transmission cases included health-care workers, family and social contacts, or visitors to
the health-care facilities where the SARS patients were hospitalized. These ﬁve speciﬁc
probable SARS cases accounted for 103 of the 206 cases reported in Singapore [1]. Each
of these ﬁve important cases is discussed below.

Case 1

The recognized index case was a 22-year-old who had visited Hong Kong
for a shopping trip and had stayed at the Metrople Hotel in Hong Kong. On

February 25, the visitor developed a fever and dry cough and was later admitted

to the Tan Tock Seng Hospital (TTSH) on March 1 [16] for atypical pneumonia.

On March 4, the patient was transferred to the intensive-care unit for a decrease in

blood oxygen saturation. For the ﬁrst six days of admission, the patient was cared

for in Ward 5A of the hospital which was lacking infection control measures.

The patient was then later transferred to Ward 8A in isolation. This speciﬁc

patient was directly linked to three people with suspected SARS and probable

SARS infection in 21 other people including nine health-care workers and 12

family members and visitors [16]. Of those with secondary infections from case

14

one, the patient’s mother, father, and one visitor died from the infection. From
the index case described over 120 cases were linked to the development of SARS,
mainly as a result of the other four cases with SARS reported as super spreading
events.
Case 2

A 27-year-old nurse who attended case one on TTSH Ward 5A, became ill
on March 7 and was admitted to Ward 8A on March 10 with a fever and sore
throat. The patient experienced vomiting, but diarrhea was not present. The
nurse was put into isolation on March 13. This speciﬁc patient was linked to
infecting 23 people with probable SARS including 11 health-care workers and 12
family members and visitors along with 4 people with suspected SARS. [16]
Case 3

A 53-year-old individual with diabetes and ischemic heart disease was
admitted to the TTSH Ward on March 10 for sepsis and diarrhea. The patient was
placed in the same room as case 2. On March 12, the patient developed a fever
requiring mechanical ventilation and transferred to the coronary care unit for
severe congestive heart failure. The patient was later isolated on March 20 and
died on March 29 [16]. This SARS patient was directly linked to 23 people with
probable SARS including 18 health-care workers and ﬁve family members and
visitors along with 18 people with suspected SARS.
Case 4

From March 5 through March 20, a 60-year-old individual was admitted to

the TTSH Ward 5A for chronic kidney disease and diabetes. The patient was

15

later readmitted on March 24 to Singapore General Hospital for gastrointestinal
bleeding. The patient developed high fever, found to be infected with Escherichia
coli bacterium and given an antibiotic for treatment. On April 4, the patient was
isolated as a suspected SARS case after a chest radiograph showed signs of
pneumonia [16]. This Speciﬁc patient was linked to 62 probable or suspected
SARS cases including 25 health-care workers, 20 other patients, and 17 family
and social contacts.
Case 5
A 64-year-old vegetable hawker visited case four in the Singapore General
Hospital on March 31. The individual had a medical history of ischemic heart
disease and leﬁ ventricular failure and developed onset of illness including
myalgia, cough, and fever on April 5. On April 8, the patient was admitted to the
National University Hospital through the emergency department and was
intubated for increased respiratory distress. The patient was transferred to TTSH
on April 9 to be isolated after the patient’s history of visitation to case four was
established. The patient later died on April 12. [16] This patient was directly
linked to SARS infection in 15 other people including ﬁve health-care workers,
two hospital patients, two family members, one visitor, two taxi drivers who
transported the patient, two hawkers from the same wholesale market, and a
visitor to the emergency department.
Unfortunately, it is not understood speciﬁcally whether Singapore’s key
epidemiological super spreading events are due to unique conditions suitable for virus

transmission or too some speciﬁc characteristic of the index case one described. More

16

research is necessary to understand the epidemiological distinctive SARS transmission

characteristics that took place in Singapore during the outbreak time period.

D. Viet Nam
Case 1

The SARS index case in Viet Nam was a business man who stayed in the
Metropole Hotel in Hong Kong between February 21 through February 23,
traveling back to Viet Nam on February 23 [1]. After the patient was admitted to
the Hanoi French Hospital (HFH), an outbreak of SARS occurred among staff,
other patients, and visitors. The epidemic curve for SARS probable cases by date
of onset in Viet Nam can be seen in Figure 13. A surge of SARS cases occurred
at the beginning of March as seen on the epidemic curve and decreased thereafter.
On March 11, the HFH closed the hospital to all new admissions and discharged
all patients without SARS.
Case 2
Two speciﬁc community clusters were identiﬁed in Viet Nam. A doctor

working at the HFH transmitted SARS to three family contacts. The second
cluster resulted from a man who had visited his daughter at the HF H hospital. He
later transmitted SARS to ﬁve close contacts in the town of Hanoi [1]. The total
time span of the outbreak in Viet Nam lasted 43 days from the index case arrival
at HFH to onset of symptoms of the last SARS case patient.

E. United States
The epidemiology of SARS in the United States showed different characteristics

than other countries in being limited to mostly travel related cases with limited spread to

17

close contacts and health-care workers [17-19]. Therefore, local transmission of SARS
was limited in this region compared to the other geographic areas. As a result, the
epidemic curve produced from the United States experience of SARS looks dramatically
different than the other regions discussed previously. Figure 14 shows the probable case
of SARS by date of onset in the United States. The graph does not imply a person-to-
person spread of the disease, but instead with the slight increase in cases in mid-March
and then a fairly continuous pattern of cases thereafter, the graph is more indicative of a
common and continuing exposure to the etiologic agent.

From the epidemiological studies completed in the United States, about 97% of
probable SARS cases were due to a travel exposure [19]. A distribution of the number of
probable SARS cases and those traveling to various SARS affected regions is seen on
Figure 15. The graphic shows the greatest number of SARS probable cases in those who
traveled to mainland China and the Hong Kong Special Administrative Region in China.
This is understandable considering that the outbreak of SARS originated in China.

As addressed previously, the local transmission of SARS in the United States was
limited to health care workers and close contacts of suspected SARS patients who had
traveled outside the United States. Two local transmissions of SARS were observed
during the outbreak and are important to summarize. The ﬁrst local transmission pair
resulted from a 40-year-old United States resident who had traveled to mainland China
and Hanoi during February 23 through March 9 [17]. On March 10, the individual
experienced symptoms including fever, cough, and Shortness of breath. The patient was
hospitalized from March 15-16 after a chest radiograph showed pneumonia. On March

16, the patient’s child began experiencing fever and a cough and was later hospitalized

l8

for observation and evaluation showing no evidence of pneumonia, however, meeting
criteria as a documented SARS case. The described transmission is representative of the
only close contact transmission of SARS documented in the United States.

The second local transmission pair involved a 39-year-old man who traveled to
Hong Kong from March 1 through March 6 with his wife staying in Hotel M, the initial
source of the international spread of SARS. On March 13, the man experienced fever
and respiratory symptoms and was later hospitalized with pneumonia [17]. Later, on
March 19, the wife became ill with similar symptoms and was hospitalized with evidence
of pneumonia. From an epidemiological perspective, the difference in secondary
transmission in the United States was distinctly different from the other geographic
regions discussed, and various levels of surveillance and early detection procedures may
help explain this difference in transmission.
1.3 CASE DEFINITION

During the SARS outbreak of 2003, the CDC and Council of State and Territorial
Epidemiologists (CSTE) developed speciﬁc surveillance procedures for identifying
SARS cases. The case deﬁnition changed throughout the epidemic time frame as a more
thorough understanding of the clinical, laboratory, and transmission characteristics of
SARS developed. On March 15, a preliminary case deﬁnition was issued for suspected
cases of SARS as follows [20]:
Suspected Case
Respiratory illness of unknown etiology with onset Since February 1, 2003, and the
following criteria:

0 Documented temperature >100.4° F (>38.0°C)

l9

0 One or more symptoms of respiratory illness (i.e. cough, shortness of breath,
difficulty breathing, or radiographic ﬁndings of pneumonia or acute respiratory
distress syndrome)

0 Close contact within 10 days of onset of symptoms with a person under
investigation for or suspected of having SARS or travel within 10 days of onset of
symptoms to an area with documented transmission of SARS as deﬁned by the
WHO.

When the following case deﬁnition was determined, there were only approximately 264
cases of SARS that had been reported from 11 countries. The case deﬁnition is limited to
a small amount of clinical and epidemiological criteria. As mentioned, the case
deﬁnition changed considerably as more knowledge developed about SARS. The case
deﬁnition for SARS was updated on December 2003 by the CDC and CSTE. The revised
case deﬁnition is as follows [21]:

Clinical Criteria

Early Illness

0 Presence of two or more of the following features: fever (might be subjective),
chills, rigors, myalgia, headache, diarrhea, sore throat, or rhinorrhea

Mild-to-moderate respiratory illness

0 Temperature of >100° F (>38° C) and

0 One or more clinical ﬁndings of lower respiratory illness (eg. Cough, shortness of
breath, or difﬁculty breathing)

Severe respiratory illness

0 Meets clinical criteria of mild-to-moderate respiratory illness and

20

0 One or more of the following ﬁndings:
0 Radiographic evidence of pneumonia, or
0 Acute respiratory distress syndrome, or
o Autopsy ﬁndings consistent with pneumonia or acute respiratory distress
syndrome without an identiﬁable cause
Epidemiological Criteria
Possible exposure to SARS-associated coronavirus (SARS-CoV)
One or more of the following exposures in the 10 days before onset of symptoms:
0 Travel to a foreign or domestic location with documented or suspected recent
transmission of SARS-CoV or
0 Close contact with a person with mild-to-moderate or sever respiratory illness and
history of travel in the 10 days before onset of symptoms to a foreign or domestic
location with documented or suspected recent transmission of SARS-CoV
Likely exposure to SARS-CoV
One or more of the following exposures in the 10 days before onset of symptoms:
0 Close contact with a person conﬁrmed SARS-COV disease or
0 Close contact with a person with mild-to-moderate or sever respiratory illness for
whom a chain of transmission can be linked to a conﬁrmed case of SARS-CoV
disease in the 10 days before onset of symptoms
Laboratory Criteria
Tests to detect SARS-CoV are being reﬁned and their performance characteristics
assessed; therefore, criteria for laboratory diagnosis of SARS-CoV are changing. The

following are general criteria for laboratory conﬁrmation of SARS—COV:

21

0 Detection of serum anti-body to SARS-COV by a test validated by CDC (e. g.
enzyme immunoassay) or
0 Isolation of cell culture of SARS-CoV from a clinical specimen or
0 Detection of SARS-COV RNA by reverse transcription polymerase chain reaction
test validated by CDC and with subsequent conﬁrmation in a reference laboratory
Exclusion Criteria
A case may be excluded as a SARS report under investigation (SARS RUI), including as
a CDC-deﬁned probable SARS-COV case, if any of the following apply:
0 An alternative diagnosis can explain the illness fully or
o Antibody to SARS-COV is undetectable in a serum specimen obtained >28 days
after onset of illness or
o The case was reported on the basis of contact with a person who excluded
subsequently as a case of SARS-CoV disease, then the reported case also is
excluded, provided other epidemiologic or laboratory criteria are not present.
Case Classiﬁcation
SARS RUI
Reports in persons from areas where SARS is not known to be active
0 SARS RUI-l: Cases compatible with SARS in groups likely to be ﬁrst affected
by SARS-CoV if SARS-COV is introduced from a person without clear
epidemiologic links to known cases of SARS-COV disease or places with known
ongoing transmission of SARS-CoV.

Reports in persons from areas where SA RS activity is occurring

22

o SARS RUl-2: Cases meeting the clinical criteria for mild-to-moderate illness and
the epidemiologic criteria for possible exposure (Spring 2003 CDC deﬁnition for
suspect case)

- SARS RUI-3: Cases meeting the clinical criteria for severe illness and the
epidemiologic criteria for possible exposure (Spring 2003 CDC deﬁnition for
probable cases)

0 SARS RUl-4: Cases meeting the clinical criteria for early or mild-to-moderate
illness and the epidemiologic criteria for likely exposure to SARS-CoV.

SA RS-Co V disease
0 Probable case of SARS-COV disease: meets the clinical criteria for severe
respiratory illness and the epidemiologic criteria for likely exposure to SARS-
CoV
0 Conﬁrmed case of SARS-CoV disease: clinically compatible disease (i.e. early,
mild-to-moderate, or severe) that is laboratory conﬁrmed
As more information was learned about SARS, the case deﬁnition clearly developed to be
more speciﬁc and distinct to include all those individuals that may be a potential SARS
case. The detailed case deﬁnition listed above is credited to the CDC and CSTE.
1.4 INCUBATION PERIOD

The incubation period represents the time interval between the exposure to an
infectious agent and the onset of the ﬁrst signs or symptoms of the disease [22]. The
estimates of the incubation period for SARS began to converge as the outbreak
progressed. Table 3 represents an overview of the incubation period for the countries that

were affected most by SARS. The range for the onset of symptoms after exposure is 1-

23

14 days according to the table. The minimum incubation period of 1 day was reported
from China and Singapore and the maximum of 14 days was reported from China.
However, the majority of SARS cases had an incubation period ranging from 2-7 days
with a median incubation period of 4-5 days and a mean incubation period of 4-6 days [1,
6, 23]. One of the key reasons SARS spread so quickly was the short incubation period.

Currently, the mean incubation period for SARS is estimated to be 6.4 days [1, 6,
7], with a mean time from onset of clinical symptoms to hospital admission between 3-5
days. The disease usually begins with a fever greater than 100.4°, often followed by
chills, myalgia, dry cough, headache, and dizziness [7, 23]. Less common initial
symptoms may include sore throat, sputum production, coryza, nausea or vomiting, and
diarrhea [7]. After 2-7 days, the SARS patient may develop a dry cough that may
progress to an insufﬁcient amount of oxygen getting into the blood. As a result, about
10-20% of SARS cases will likely require mechanical ventilation.

A substantial amount of discussion has been on-going related to the range of the
incubation period and the effect of outliers at the higher end of the incubation period.
Outliers beyond a 10 day incubation period are limited and have not been investigated
thoroughly. However, other mammalian coronavirus infections have shown a long right-
hand tail for incubation periods, therefore this is feasible. Also, it is possible that some
SARS patients have multiple incubation periods due to multiple contact dates with SARS
patients [24]. As a result, a detailed investigation of the outliers is needed before public
health policy is changed to lengthen the incubation period to more than 10 days. If the
incubation were increased to include a wider range of days, this would have a tremendous

effect on public health practices and control techniques

24

The clinical course of the SARS appears to produce a bi- or tri-phasic pattern.
The three phases include the following [7]:
Phase One
0 Period of viral replication associated with an increase in viral load
0 Clinical symptoms include fever, myalgia, and other systematic symptoms
Showing improvement in about 2 days
Phase Two
0 Immunopathological imbalance
o Clinically described as recurrence of fever, oxygen desaturation, and clinical and
radiologic progression of acute pneumonia
0 Decrease in the viral load
0 Almost 80% of SARS patients have abnormal chest radiographs that show
airspace consolidation
0 Majority of patients respond to treatment, but about 20% may progress to phase
three
Phase Three
0 Acute respiratory distress (ARDS) with likely need for mechanical ventilation
1.5 PERSONAL CHARACTERISTICS
A. Age
Patients who developed SARS ranged from 0 to 97 years of age. However, the
majority of SARS patients were young and middle-aged adults. The age group 20 to 60
years accounted for approximately 85% of all SARS cases [11, 25]. Among this group,

about 30% were in their twenties, representing the age group with the highest incidence

25

rate. The incidence rate for the 10 to 15 year old age group was lower than adults, and
those under 9 years old had the lowest age group incidence of SARS [11, 25]. For
example, in Beijing the incidence rate for the age group 20 to 29 was 30.85 per 100,000
population compared to the age group 0 to 14 which had an incidence of 2.54 per 100,000
population [25]. This SARS case age distribution may be indicative of the fact that the
majority of health care workers fall within this speciﬁc age group. The other SARS
affected countries follow similar patterns related to the age distribution.

Table 2 summarizes the median age range of SARS cases by country from
November 2002 through August 2003. The median was likely used instead of the mean
age, because there may have been outlying ages that would not reﬂect the true age groups
at the highest risk of SARS. The table indicates that those countries with the highest
cases of SARS were the countries highlighted in the geographic distribution section of
the paper, including China, Hong Kong, Taiwan, Canada, Singapore, United States, and
Viet Nam. All of these countries show a median age of 35 to 49, which represents the
portion of the group with the most SARS cases reported.

SARS is a condition with substantial morbidity and mortality. The case-fatality
ratio of SARS is estimated to range from 0% to 50% depending upon the age group [1].
The overall case-fatality rate (CFR) is approximately 11 to 15% [1, 26]. The case-fatality
rate of SARS by age group is as follows [12]:

0 S 24 years old = Less than 1%
0 25-44 years old = 6%
0 45-64 years old = 15%

0 Z 65 years old = Greater than 50%

26

These age groups CFR’s represent an overall estimate for all regions affected with
SARS. However, Table 2 shows the case fatality rates for each area with SARS cases
reported. It is important to note the number of cases reported in speciﬁc areas to
determine the CFR. The areas with the highest rates include Taiwan, Hong Kong,
Canada, Singapore, Thailand, South Africa (note only one case of SARS reported), and
Malaysia (note only ﬁve SARS cases reported). The areas with the highest rates are the
key geographic locations discussed previously for the important outbreak regions and
high risk areas.
B. Gender

Of the SARS cases reported throughout the outbreak of the newly emerging
disease, approximately 53% were female [3]. The incidence rates of SARS in males and
females were not statistically signiﬁcant [7]. However, the greater percentage of females
with SARS may be attributed to the fact that more females tend to be involved with direct
health-care positions compared to males, and healthcare workers is a group at high risk of
developing SARS. These ﬁgures will be presented under the other risk factors section
below. One interesting aspect of gender shown in studies is that males are more likely
than females to die from SARS [3]. These results showed statistical signiﬁcance.
Further research is needed to understand the mechanism for these ﬁndings.
C. Residence Location

SARS has been shown to spread more prominently under residence conditions of
high density, greater population ﬂuidity, poor sanitary conditions, or bad health habits
[l 1]. Therefore, it can be understood why the outbreak showed high numbers in big

areas such as Hong Kong and Toronto. There areas represent locations that have high

27

population concentration, high traffic patterns, and sufﬁcient medical resources. All of
these factors are more likely to sustain a SARS outbreak scenario.
D. Other Risk Factors

An essential SARS high risk group to mention is health-care workers, which were
considered the primary risk group in the second generation of SARS transmission [12].
Health-care workers (particularly those involved with procedures that generated aerosols)
accounted for approximately 20% of the SARS cases reported during the outbreak [1, 3,
26]. When discussing the important elements of modes of transmission for SARS, the
health-care worker group will be addressed more speciﬁcally. Other at risk groups for
SARS included those family members of the health-care workers and index cases and
their other contacts.

Other high risk groups include those with co-morbid chronic conditions such as
hypertension, diabetes, cardiac disease, emphysema, and neoplasm’s [3, 11, 27]. Also,
those groups of people whom were involved in the care and slaughter of wildlife for
human consumption in the wet markets of Southern China are also at higher risk for
SARS. This speciﬁc group and will be discussed in more detail in Chapter 2 when
discussing modes of transmission.

A key epidemiological component to SARS risk was directly related to those
whom had traveled to the original SARS infected areas in China. As mentioned
previously, the initial international spread was associated with this speciﬁc geographic
location. Any individual who had traveled to mainland China, had visited the Amoy

Gardens, Prince of Wales Hospital or other hospitals or clinics were at greater risk of

28

transmitting SARS [28]. This component is essential for understanding the transmission

of SARS globally.

29

Chapter 2

SEVERE ACUTE RESPIRATORY SYNDROME (SARS) ANALYTIC
EPIDEMIOLOGY

2.1 EPIDEMIOLOGICAL AGENT

“The terror of the unknown is seldom better displayed than by the response of a
population to the appearance of an epidemic, particularly when the epidemic strikes
without apparent cause [29]”. This 1977 quote by Edward Kass described the feelings
related to the newly emerging Legionnaire’s Disease and can be applied to the public
response to the appearance of SARS and understanding the possible cause of the newly
emerging disease.

The SARS outbreak of 2003 involved a microbial agent now known as SARS-
associated coronavirus (SARS-COV), a novel coronavirus that was not previously
recognized as part of the coronavirus family [1, 30, 31]. The agent was initially
identiﬁed as a coronavirus by thin-section electron microscopic examination of a virus
isolate. The virions identiﬁed from SARS were spherical, 78 nm in mean diameter, and
were composed of a helical nucleopcapsid with an envelope and surface projections [32]
(See Figure 16). This structure noted is representative of the coronavirus family
Coronaviridae, consisting of an enveloped, single-stranded RNA virus group causing
disease in humans and animals [6]. However, in comparison with other human and
animal coronaviruses, SARS-CoV was shown to be distinct and warrants classiﬁcation of
a new group of C oronaviridae.

In humans, coronaviruses are responsible for approximately 20% of common
colds in the wintertime [31]. However, up until the SARS outbreak, the coronaviruses

had never been strongly associated with any serious human illness. The virus family has

30

always been interesting scientiﬁcally, but a relatively unimportant medical virus family to
the human population. On the other hand, coronavirus infection of farm animals is
common and often substantial, justifying routine vaccination administration.
By experimental infection of cynomolgus macaques (monkeys) with the SARS-

CoV, proof was provided that the virus was the aetiological agent of SARS [30, 33] by
fulﬁllment of Koch’s postulates. Based upon Koch’s Postulates (modiﬁed for viral
disease), in order for a virus to be established as the cause of a disease, six criteria are
required including [30]:

1. Isolation of the virus from a diseased host

2. Cultivation in host cells

3. Proof of ﬁlterability

4. Production of comparable disease in the original host species or a related one

5. Re-isolation of the virus

6. Detection of speciﬁc immune response to the virus
The ﬁrst three criteria above have been fulﬁlled from several studies [30, 33] and provide
convincing procedures to support that SARS-COV is linked to SARS. The other three
criteria were tested after more knowledge of SARS was acquired. The procedure used
involved inoculation of two macaques with veto-cell cultured SARS-CoV isolated from a
fatal SARS patient. The macaques were monitored for clinical signs, virus excretion, and
antibody response. Six days after inoculation the animals were killed to complete
histopathological examinations.

Several laboratory tests were used to detect the SARS-COV. A reverse

transcription polymerase chain reaction (PT-PCR) test can detect SARS-COV in clinical

31

specimens, including blood, stool, and nasal secretions [23]. PT-PCR is a laboratory

method for detecting the genetic material of an infectious disease agent and has become a

necessary procedure for the detection of infectious diseases. Serologic testing can also be

used to detect SARS-COV antibodies produced after infection from human serum. A

ﬁnal test involves viral culturing by using a small sample of tissue or ﬂuid. The

specimen is placed in a container along with other cells in order for the virus to grow.

After the virus grows, any changes in the cells can be recognized under a microscope

[23]. The results produced from the study for Koch’s Postulates are as follows [30]:

Clinical Siggs

2 macaques were lethargic 3 days post-inoculation (d.p.i.) with temporary skin
rash
1 macaque had respiratory distress 4 d.p.i
At gross necropsy, 1 macaque had severe pulmonary consolidation

0 SARS-COV was detected in the lung tissue by RT-PCR and virus isolation
2 macaque had interstitial pneumonia
1 macaque had gross lesions with diffuse alveolar damage (See Figure 17b)
Occasional multinucleated cells were present in the lumen of bronchioles and
alveoli (See Figure 17c)

o Lesions were indistinguishable from those in biopsied lung tissue of SARS

patients

Virus Excretion

Macaques excreted virus from nose and throat 2 to 6 d.p.i.

Isolated virus was identical to that inoculated in the macaques (See Figure 17a)

32

0 Virus isolated from feces of 1 macaque
Immune Response

0 Seroconversion to SARS-CoV, determined by using infected Vero cells in 2

macaques at 16 d.p.i.

From the data obtained from the animal experimentation with macaques, Koch’s
Postulates were fulﬁlled, supporting SARS-COV as the primary aetiological agent of
SARS. From this information obtained, scientists concluded that SARS-CoV is a
necessary cause for SARS in humans, but more research is needed to understand if
microbial or other possible cofactors enhance the severity or transmissibility of SARS.

Due to the identiﬁcation of the coronavirus as the etiologic agent of SARS,
research on the coronavirus family C oronaviridae has shown to be stimulating both
research and public interest. There are various characteristics of SARS-CoV worth
mentioning in comparison to previous known coronaviruses. The morphological features
of SARS-CoV isolates were similar to other members of the coronavirus family [32]. For
example, multinucleated cells were present, virions maintained an envelope structure by
budding into the cistemae forming spherical particles, virus particles were observed in
membrane bound vesicles, tubuloreticular structures formed along the cell membrane,
and induction of ﬁbrosis was noted [31, 32]

A notable similarity of SARS-CoV to previous coronaviruses is the genetic
characteristics. The emerging genetics of SARS-COV may be attributed to two important
factors. First, as an RNA virus SARS-COV is likely to undergo mutation at a very high
frequency. The SARS-CoV genome can be expected to accumulate an average of 3

mutations per round of RNA replication [31]. In comparison, measles virus has been

33

estimated to have a genomic mutation rate of 1.43 mutations per round of replication and
vesicular stomatitis virus (V SV), a non-segmented RNA virus, has been estimated
ranging from 2.75 to 4.28 mutations per round of replication [10]. At this point in time,
the main RNA species from the various SARS patients appear to be homogenous
differing by no more than ten amino acids in the entire genome. Further analysis is
needed to conﬁrm the overall patterns of viral spread of SARS-CoV, but the genetic
characteristics implies that the SARS-CoV has likely been circulating for awhile in China
[34].

Using the viral sequences derived from the clinical specimens collected in Hong
Kong from the 139 SARS patients, an estimate of the last common ancestor of the SARS-
CoV was determined. The mutation rate was assumed to be uniform while linear
regression analysis was completed. The divergence was based on the genetic distance
between the isolates and the root of the phylograrn and was plotted as a ﬁmction of
sampling time (See Figure 18). The last appearance of the common ancestor of SARS-
CoV was estimated to be on December 12, 2002 indicating a divergence value of zero
[3 5]. Therefore, the ﬁrst deviation of the ancestral virus may have occurred in late 2002,
which is closely represents the timing of the ﬁrst reports of SARS in China. Additional
samples may be useful for repeating this speciﬁc analysis, but the analysis is interesting
for providing information on the evolution of SARS-COV into the China population.

The second genetic distinction is that coronaviruses have a tendency to evolve
through RNA recombination, occurring at a high frequency [7]. The theory is that
recombination will not only introduce genetic alterations, but also balance the harmful

effects of mutations by removing undesirable traits. In natural infections, both mutation

34

and recombination have contributed to the evolution of coronaviruses and likely to the
emergence of SARS-COV.

In contrast to other coronaviruses, disease due to SARS-COV has both a higher
mortality rate and contagiousness than other known human and animal coronaviruses [7].
Another important difference is that SARS-CoV likely consists of unusual envelope
structures since SARS cases often Show GI symptoms, and the virus is detected in the
stool [7]. Presumably due to the structure of SARS-COV envelope, the virus has been
shown to survive in diarrhea] stool for as long as four days and on a dry surface for 24
hours, indicating the survival potential of the virus outside the host.

2.2 MODE OF COMMUNICATION

The mode of communication for an infectious disease is the phenomenon in the
environment that brings the host and the agent together. The various possible modes of
communication include:

0 Vector- A live organism that serves to communicate disease (i.e. mosquitoes and
arthropods)
0 Vehicle- An inanimate object which serves to communicate disease (i.e. glass of
water containing microbes, or a dirty rag, etc.)
- Reservoir- A location that serves as a continuing source of infection (i.e. water
tower, soil for tetanus, etc.)
In epidemiology, it is sometimes more important to have knowledge of the modes of
communication for an infectious disease than to identify the etiologic agent.
SARS-CoV is understood to almost certainly involve an animal reservoir, which

is one of the most important types of reservoirs for human disease [5, 36]. About 75% of

35

human emerging infectious diseases have a zoonotic (animal species) origin [3 7]. There

are several important factors that may contribute to emerging zoonotic diseases including

[38]:

Transportation of human and animals into new places
Increased contact between animals and humans
Changes in the environment and husbandry practices
A larger immunocompromised population

Increased recognition of diseases as a zoonotic origin

Discovery of new organism not previously recognized

For SARS, an animal origin was considered the most probable explanation in the

outbreak for the following reasons [37]:

The novel nature of the SARS-CoV

The clustered Guangdong outbreak pattern in China

The occupational and spatial association with early cases

The range of wild-caught mammals, birds, and reptiles in Chinese markets
The use of wild animals for food and medicine and China offers an effective
bridge to humans

75% of human emerging infectious disease are zoonotic

The SARS-CoV has been isolated from various animals in China, providing

evidence that an animal reservoir does indeed exist for SARS-COV, but to date the

research ﬁndings are insufﬁcient to permit the identiﬁcation of the natural reservoir of

the disease or the species that may be responsible for the cross-species transmission to

humans. A cross-species transmission of such a virulent and transmissible virus like

36

SARS is likely a rare event; however its frequency can not currently be predicted [36].
Research shows that when SARS was ﬁrst detected it infected only about 3% of the
people it came in contact with. However, within a few months, the virus had evolved
into a huge risk to the human population; causing illness in about 70% of the population
it encountered [39]. The entire evolutionary process of SARS from animals to a virulent
human virus took a little under three months, effectively reinventing and altering itself as
a very potent human virus.

Figure 19 provides a logical mechanism for the process involved for cross-species
transmission. The original coronaviruses found in animals are coated with proteins
speciﬁc for attaching to the tissues of an animal cell. Through mutation, the viral surface
receptors likely changed shape to be compatible with the human cell tissues. After
introduction into the human population, scientists believed the virus to ﬁne-tune itself for
enhancing its access to the new human host cell. Inﬂuenza has shown to resemble the
proposed mechanistic theory making the virus mutation of SARS theory plausible. A
team of virologists in China from several universities reported, after analysis of SARS-
CoV samples taken from China in the early, middle, and late stages of the outbreak, that
the surface spike proteins may optimize their adherence to host cells under selective
pressure. This had the effect of “learning” to spread from person to person, then adapting
to the most effective virulent version of the surface protein structure [39]. These speciﬁc
properties are important for understanding the virulence and future potential of the
SARS-CoV.

The SARS outbreak investigation of the potential animal reservoir of the SARS-

COV was focused around wild mammals served as exotic food in China. This speciﬁc

37

group of animals was targeted after the SARS-CoV was isolated from Himalayan palm
civets found in a live animal market in Guangdong, China [40]. The hypothesis was
further supported when some of the SARS patients in the Guangdong Province reported a
history of occupational exposure to live, caged animals that were used as “game food”, a
culinary delicacy in southern China [6].

As mentioned, researchers focused their investigations on the wild animal market
in China as the potential animal reservoir after the SARS-COV was isolated from the
Himalayan palm civets (See Figure 20) found in a live animal market. Evidence of the
virus infection was also found in other animals, including the raccoon-dog (See Figure
20), and in humans working in the market.

The focus on humans was centered among wild animal traders after studies
showed a higher seroprevalence of SARS-CoV from these traders compared to other
workers in other parts of the market or unrelated controls [6]. Of the 508 animal traders
whose blood was sampled during the outbreak, 13% tested positive for the IgG antibody
to SARS-CoV. The control groups had 1.2% to 2.9% testing positive for these antibodies
[41, 42]. Also, from the ﬁrst market in Guangdong Province in which SARS-COV was
isolated from civet cats, serologic surveillance showed that 40% of the animal traders and
20% of the animal slaughterers had antibodies to SARS-CoV, but none of them had
shown any SARS symptoms in the previous six months before the study was completed
[43]. This ﬁnding led to the idea that the SAR-CoV or a similar virus may have been
prevalent in the human population of Southern China before the SARS outbreak.

Isolation of the virus from the animals in wild animal markets was another

support for the potential source of the outbreak, which initiated the focus of investigation

38

.r‘

\
.‘n_ ._ ., ..-_ 1.. , _

 

 

 

 

acetic
numb,-
of 1116
inClud
Still 3]

51mph

 

on these speciﬁc areas. When the full genome of two Himalayan palm civets and ﬁve
human viruses were compared, the animal virus isolates contained a 29-nucleotide
sequence which was not found in most human isolates (See Figure 21). After completion
of a full-length genome sequence, results showed that there was 99.8% homology
between the human and animal SARS-CoV, indicating that the human and animal SARS-
CoV are closely related [40, 44]. However, phylogenetic analysis of the S gene of both
the human and animal SARS-COV Showed that the animal viruses are separate ﬁ'om the
human virus cluster (See Figure 22). The animal viruses SZ3 and S216 differed by 18
nucleotides, whereas the human viruses differed by only 14 nucleotides. These results
Show that the animal virus S21 3 (raccoon-dog) and the SZ16 virus (palm civet) were
almost genetically identical [40, 44].

In an effort to decrease the spread of SARS to the human population by cutting
off the source, Chinese ofﬁcials ordered a sweep through farms and food markets to
locate and kill all animals that may harbor the SARS virus, including palm civets and
raccoon dogs. The decision to slaughter an estimated 10,000 civets and a much smaller
number of other animals came on the same day that China conﬁrmed the ﬁrst SARS case
of the 2003-2004 winter [45]. Some of the techniques involved to kill the animals
included disinfectant spraying and clubbing. The problem with this decision was that we
still are not sure whether the civet cats are the natural reservoir of the virus or if they are
simply an intermediary carrier [46].

Interestingly, studies have shown that other wild animals were also found to be
carriers of the virus, including foxes and domestic cats [47]. Still other studies have

shown that ferrets and domestic cats are also susceptible to SARS-COV infection and are

39

capable of effectively transmitting the virus to other uninfected animals that are in their
living quarters [48]. Non-inoculated cats were housed with previously inoculated cats
and ferrets and later became infected with the SARS-CoV, as conﬁrmed by an increase in
viral titers 2 days post inoculation. This is an interesting concept for epidemiological
transmission purposes, because the virus is not only capable of a human-to-human threat,
but also animal-to-animal. These results suggest the virus is more promiscuous than
previous considered.

The above ﬁndings could be beneﬁcial for the use of animal models in
experimenting with the SARS-CoV and testing for antiviral drugs and possible vaccines
for SARS if needed. These ﬁndings also help to extend the range of animal species that
are carriers and harbor the SARS-COV. The study results suggest that transmission of the
virus from civets to humans is less efﬁcient than from other animals [47]. From this, can
we say that a large number of animals were slaughtered unjustiﬁably by Chinese
authorities? Unfortunately, until scientists come closer to the origin and natural reservoir
of the SARS-CoV it is difﬁcult to answer this question.

The ﬁndings regarding the animal reservoir thus far suggest that Chinese markets
provide a network for the animal SARS-CoV to alter and transmit to new hosts, including
humans. One thing is not clear, however: It may be possible that one or more of these
animals are the natural reservoir of SARS-CoV in the wild. It is also possible that these
animals investigated including civets, raccoon dogs, and others were infected by another
unknown animal source, representing the “true” reservoir of SARS-CoV. More

investigation and research is needed for assessment of the animal reservoir(s) responsible

40

for SARS before any more extreme measures, such as mass culling of animals, is
initiated.
2.3 TRANSMISSION

The predominant mode of transmission of SARS-CoV appears to be through
direct or indirect contact of mucous membranes (eyes, nose, or mouth) with infectious
respiratory droplets or fomites through close person-to-person contact [1, 2, 6, 23, 49].
The virus laden droplets of SARS-CoV travel only a few meters rather than by lighter
airborne particles. Inﬂuenza and measles are two other examples of diseases that are
transmitted through the air; however, they travel in the lighter particles through a method
called aerosol [1]. Other diseases that spread via airborne droplets include tuberculosis, a
mycobacterial disease causing disability and death in many regions of the world, and
pertussis, an acute bacterial disease involving the respiratory tract [4]. If an individual
coughs while infected with the ﬂu they are likely to infect the entire room, whereas the
transmission of a disease like SARS appears to require closer contact and also may be
reduced by frequent hand washing.

This mode of transmission discussed is consistent with the observation that most
patients can be linked to persons with SARS or places where SARS transmission is
documented or suspected, such as health care settings and households. For example, in
Toronto and Singapore over 94% of the case patients documented contact with a SARS
patient or with a hospital ward where a SARS patient was located [49]. It is important to
understand what close contact represents for the transmission of SARS. Close contact
could occur between people who live in the same household or if someone is providing

care for a SARS patient. Close contact examples include kissing or hugging, sharing

41

eating or drinking utensils, close conversation (within 3 feet), physical examination, and
any other direct physical contact between two people [23]. Close contact does not
include activities such as walking beside a person or being in the same room.

The transmission of SARS is reﬂected in and measured by the pathogen’s basic
reproductive rate (R0). R0 represents the average number of secondary infections arising
from one infected individual in a completely susceptible population in the absence of
speciﬁc control measures [50-52]. The successﬁrl emergence of a pathogen requires that
R0 exceed 1.0 in the new host (See Figure 25). If the R0 of a potential pathogen is greater
than one, this scenario is capable of the occurrence of an epidemic; furthermore, if the
population is large enough and dispersed then the infection may become endemic. By
contrast, if R0 is less than 1.0 the infection will go nowhere. If R0 is equal to 1.0 the
infection will be transmitted from one person to another and likely will eventually die off
by chance with no real epidemic potential. There are various mechanisms that can
increase R0 for a speciﬁc pathogen including [51, 52]:

o Ecological Changes
0 Changes in the host density
0 Changes in human behavior
0 Population size effect- each additional host infected before the infection
dies out provides another opportunity for a mutation that might push Ro
over the epidemic threshold
0 Genetic Changes
0 Neutral drift

0 Co-evolution of the pathogen and its reservoir host

42

0 Adaptive evolution of the pathogen during chains of transmission in
humans

A R0 of almost 3 is consistent with a disease spread by direct contact or larger
virus-laden droplets and is not highly infectious in comparison to a disease such as
inﬂuenza and measles that have 3 R0 of 10 and 15 respectively in a typical community [1,
3, 50]. A number of researchers have estimated R0 for SARS-COV by ﬁtting models to
the initial growth of epidemics in a number of countries [1]. Their observations show
that SARS-COV is less transmissible than initially thought, with an estimate of R0 in the
range of 2-4. For public health purposes, SARS is less transmissible than most other
respiratory infections, which makes it more susceptible to control measures.

As mentioned, healthcare settings have played an essential role in the
epidemiology of SARS. One of the most important means for the spread of SARS-CoV
has been between humans in hospitals. Those working within these facilities were some
of the earliest and most severely affected groups from almost all the SARS outbreaks
reported across the globe. For example, in the Toronto and Singapore outbreaks, 43%
and 41% respectively of the SARS cases were healthcare workers. SARS-CoV has been
estimated to have a R0 of 4 in the hospital setting [49]. Once the patients have been
recognized as having SARS and are isolated, the R0 drops to less than 1.0, a value as
mentioned that is not capable of sustaining an outbreak. Outside the hospital setting and
other situations, the R0 of SARS-COV has shown to be consistently less than one, as
demonstrated by the failure of the virus to establish and maintain itself in the community

[49].

43

1 "an

"m

 

 

 

 

Nosocomial transmission of SARS from critically ill patients to health care
workers has been prominent throughout the outbreak and a worrisome epidemiological
characteristic. Studies have shown the use of aerosol-generating procedures (such as
endotracheal intubation, bronchoscopy, and treatment with aerosolized medication) may
amplify the transmission of SARS-CoV [6]. Those physicians and nurses who performed
endotracheal intubation were at a signiﬁcantly greater risk of developing SARS
(RR=13.29, p=.003) than compared to their respective reference controls [53]. In these
hospital settings, if a cluster is recognized early and the source of the SARS transmission
is identiﬁed and isolated, the outbreak will likely be contained. Such measures would
include closing the hospital ward or clinical area, isolating all SARS patients and contacts
within the ward, and quarantining health care workers and visitors who had visited the
ward. If the outbreak is detected later (beyond 1-2 incubation periods in which secondary
cases have occurred among staff and inpatients and other wards); however, the most
prudent course of control is to close the hospital and place all healthcare workers on work
quarantine immediately [54].

In the SARS epidemiological investigation, there are two key but unusual events
in the transmission patterns of SARS. These events involved the Hotel M in the
Guangdong Province and the Amoy Garden cluster, both of which were discussed in
detail in Chapter 1. The original index case of SARS in Hotel M was the sentinel event
in the evolution of the SARS outbreak, apparently initiating the global spread of SARS
(See Figure 23). From this single event, superspreading of SARS occurred with
successive generations of horizontal spread of SARS, resulting in cases that were mainly

on the same ﬂoor of the hotel as the index case. Figure 24 shows the generational

44

 

 

kl-.. . III. «I .I‘

"4.

transmission of SARS starting with the index case as the ﬁrst source of the infection.
This patient then transmitted the virus to the second generation including close direct
contact with health care workers and others (family, friends, others). The third
generation then represents the family members of the healthcare workers or other direct
contacts. Finally, the fourth generation would consist of infection in other contacts in the
community. Figure 27 gives a schematic of how the spread of SARS appeared in
Beijing. These superspreading events could have proven to be more severe if there had
been a greater number of any generation of cases of SARS, having the potential to
produce a ﬂame of infection throughout society. Fortunately, the control procedures once
administered were successful in eliminating the completion of the four generations of
transmission.

When looking at the infectious period of SARS, the transmission efﬁciency
appeared to be the greatest from severely ill patients or those patients with rapid clinical
deterioration, usually during the second week of illness. Singapore data has shown that
very few secondary generation cases result when symptomatic cases are isolated within 5
days of illness onset (See Figure 26). Laboratory data completed on SARS cases
correlated closely with this idea that the infectivity of the SARS-CoV is linked to the
incubation period and time of isolation. From this knowledge, control measures and
procedures for isolation of SARS cases can be initiated to help eliminate and control the
generational spread of SARS, particularly to potential secondary cases. Interestingly, the
United States showed a lack of transmission of the SARS-CoV to potential secondary
contacts [55, 56]. The ﬁndings support the idea that under certain circumstances, SARS-

CoV is not easily transmitted. These ﬁndings may be explained by the idea that

45

transmission appears to be more likely when the patient is shedding higher amounts of
virus, generally coinciding with their hospitalization. As a result, the degree of exposure
to close contacts was decreased since the time of higher infectiousness occurred in the
hospital setting [55]. This epidemiological distinction is still worth mentioning and more
studies may be needed to thoroughly understand this speciﬁc aspect of the
transmissibility mechanism of SARS-COV.

The second unusual transmission event involved residents in the Amoy Gardens, a
private housing estate in East Kowloon, Hong Kong. When the outbreak ended in April 3
total of 321 residents from 15 blocks had been affected [6, 57]. The initial exposure was
traced to a 33-year-old patient of the Prince of Wales Hospital who had chronic renal
disease. He lived in Shenzhen and visited his brother in unit 7 on a mid-level ﬂoor of
Block E of Amoy Gardens. Studies have shown that residents of Block E had a SARS
attack rate of 38.9%, compared to those in other blocks of the Amoy Gardens (19.6%)
and community controls (18.3%) [58]. These results Show the area of signiﬁcance for the
central location of the outbreak.

In this outbreak, other modes of transmission may have played a key role in the
spread of the infection. Given the point-source nature and the temporal and spatial
progression of the community outbreak in the Amoy Gardens, it is unlikely to have been
caused distinctly only by transmission through respiratory droplets and contacts.

Several hypotheses have been proposed to explain the initial outbreak [5 8]:
1. Contaminated sewage droplets were sucked back into the bathrooms by powerful
bathroom fans through dried-up ﬂoor drains, then escaped through windows and

rose as a plume in a narrow light well

46

2. Passive carriage by pests

3. Faecal-oral contact through contaminated surfaces
The problem is that none of these hypotheses necessarily explains three important
attributes of the Amoy Garden outbreak: dose, timing, and Spatial distribution. In order
for the index patient to have infected those in the Amoy Gardens the individual would
have had to excrete a large amount of the virus into the environment to serve as a static
common source of the epidemic. Also, those ﬂoors above Block E in which the index
case visited were affected more than those ﬂoors below Block E. The introduction of an
infected vector would be sufﬁcient to distribute the infectious material. Infected vectors
can produce live virus for days, providing the large dose required for the outbreak.
Therefore, researchers had concluded in August 2003 that the most likely vector at the
Amoy Gardens was a roof rat. There is various circumstantial evidence for the existence
of a rat vector including [57]:

o Virologists suspect the SARS-COV originated from animals and jumped
species to infect humans. The virus can infect and survive in animals as
well as humans.

0 Viral remnants were detected in four of eight samples of rat dropping
found in the Amoy Gardens and in the throat or rectal swabs of ﬁve
housecats, one dog, and at least one rat from the estate.

0 The location of Amoy Gardens is in one of the most densely populated

areas in Hong Kong, known for poor hygiene and rat infestation.

47

 

. .. Ilia-n 14......97. .

WI}!

 

o Rats are mobile, territorial, and can reach high ﬂoors through external
pipes. The sewage and water pipes are located close to the bathroom
windows allowing easy access of rats into households.

0 Viral footprints were found around toilet bowls, kitchen sinks, and on
kitchen ﬂoors in several households in Block B. These are common points
of use for humans in the household and represent an opportunity for
exposure.

0 The presenting symptoms and clinical course of SARS patients from the
Amoy Gardens was signiﬁcantly different from other SARS patients.
These patients from the Amoy Gardens outbreak had more diarrhea,
higher percentage of admission to intensive care units, and a higher
mortality. The characteristics mentioned above are all indicative of a
different route of infection, mutation of the virus, or both.

0 The diversity of the SARS-COV as an RNA virus to reshufﬂe genes may
have produced a virus that was transmissible to rats and humans.

The rat vector hypothesis for the cause of the Amoy Garden outbreak has recently been
brought under speculation in April 2004 [59] along with the need to consider all possible
modes of communication for the spread of SARS. Some of the criticisms are as follows:
0 No Sign of active disease was found after autopsies were completed on four rats in
the Amoy Gardens. However, “Rats may also be able to transmit SARS without

having overt disease [57].”

48

0 To begin an outbreak infecting such a large number of people, a lot of rats would
have to be infected in a short period of time, and infectiousness of rats would have
to be short-lived for the outbreak to die out [57].

o The role of rats in the Amoy Gardens could have involved mechanical
transmission instead of urine/fecal contamination. For example, a rat may have
crawled or swam out of a SARS-COV previously contaminated toilet and then
tried to exit the toilet facility by means of the ventilation fan opening or by means
of the ventilation shaft [59].

From this information, it becomes important for SARS investigators to explore all
possible SARS reservoirs and transmission mechanisms. Due to the various
epidemiological properties and the past recombination events of the SARS-COV lineage,
the virus proves to have the potential for a rapid unpredictable change. In other words,
what we understand about the transmission of SARS currently may change with later

knowledge and investigation of the transmission and properties of the SARS-CoV.

49

Chapter 3

HANTAVIRUS PULMONARY SYNDROME (HPS) DESCRIPTIVE
EPIDEMIOLOGY

3.1 TIME PERIOD OF INTEREST

In May 1993, an outbreak of an unexplained pulmonary illness occurred in the
Southwestern region of the United States known as “The Four Comers”, which included
Arizona, New Mexico, Colorado, and Utah [60]. The initial suspicion of the disease can
be traced to a young, physically ﬁt Navajo man who suffered shortness of breath, was
rushed to a New Mexico hospital and died shortly thereafter. Through the observations
of an Indian Health Service (IHS) clinician reviewing the results of the case, it was
discovered that the young man’s ﬁancee had died a few days earlier after showing similar
symptoms of disease. This key piece of case information was important in the discovery
of the newly emerging disease, Hantavirus Pulmonary Syndrome (HPS). Dr. James
Cheek of the IHS responds, “I think if it hadn’t been for the initial pair of people that
became sick within a week of one another, we never would have discovered the illness at
all [60].”

The clinician later contacted other practicing physicians and the Ofﬁce of Medical
Investigations (OMI) of the state of New Mexico. An investigation combining the entire
Four Comers regions was initiated at this time for detection of patients with similar case
histories. Within only a few hours, through collaboration of physicians and the OMI,
ﬁve, young, healthy people had been determined to have died after acute respiratory
failure [60, 61]. Laboratory tests proved to be unsuccessﬁrl in implicating any known

disease as the cause of any of the deaths.

50

On May 27, 1993 the IHS and the New Mexico Department of Health requested
the assistance from the CDC, of which four epidenriologists later traveled to the area to
join and assist the outbreak investigations [61]. During the next few weeks, additional
cases of the disease were reported from the Four Comers Area. Investigation of the
initial patients indicated the disease affected healthy young adults and ﬁrst manifested as
fever and muscle aches. Hospitalization occurred shortly after and was prompted by
sudden onset of pulmonary edema rapidly progressing to respiratory failure and in many
cases death.

Physicians and scientiﬁc experts worked intensely to narrow down the possible
cause for the disease. Laboratory studies by the State Health Departments and the
University of New Mexico eliminated the most likely etiologic agents, Yersinia pestis
(cause of pneumonic plague), Legionella, Mycoplasma, and inﬂuenza virus [61]. The
diversity of symptoms and clinical ﬁndings steered researchers away from toxic agents
such as herbicides or a new type of inﬂuenza, and moved toward a possible virus
etiological cause. On June 4, 1993 serologic tests conducted by the Special Pathogens
Branch, Division of Viral and Rickettsial Diseases, National Center for Infectious
Diseases, and CDC showed the pulmonary syndrome to be caused by a new hantavirus
initially called both the Muerto Canyon Virus and the Four Corners virus. However,
these names were not acceptable to the Native American communities of the area and the
virus was eventually called Sin Nombre (unnamed) Virus (SNV) (Discussed in Chapter
4) [60, 62] and the disease was later referred to as Hantavirus Pulmonary Syndrome

(HPS)

During the high proﬁle investigation of HPS, new understanding and emphasis
was focused upon the possibility of new and emerging infectious diseases. However,
HPS later turned out to be a newly identiﬁed disease, but not a “new” disease. By
examination of samples of tissues belonging to people who had died of unexplained adult
respiratory distress syndrome in these areas, the disease origin was traced back several
years. In fact, the earliest case of a serologically conﬁrmed SNV infection was in a 38-
year-old Utah man who developed an HPS-compatible illness in July 1959. The case
patient was shown later to have IgG antibodies in September 1994 [60, 63].

Through March 3, 2004, a total of 363 cases of HPS have been reported in the
United States and a total of about 1910 cases reported in the United States, Canada, and
South America combined [60]. The case count began when the disease was ﬁrst
recognized in 1993. These cases have occurred in a sporadic pattern since the 1993
outbreak in the Four Corners region and about 37% have resulted in death [64].

The epidemic curve produced from HPS in the United States from 1993 to 2004 is
shown in Figure 28. The pattern from the curve is indicative of a point source epidemic
with a peak in the number of cases and a gradual decline, in contrast to a person-to-
person spread or continuous common source outbreak scenario. A point source is often
associated with an animal reservoir for transmission of the virus to humans, as was found
for HPS being related to rodents (discussed in Chapter 4). The graph also Shows seasonal
variation in the HPS cases particularly in the spring and summer time frame.

An interesting weather phenomenon has been suggested as the cause of the
outbreak of HPS in the southwestern United States in 1993. This weather pattern known

as “El Nino”, also called El Nino-Southem Oscillation (ENSO), is a cycling recurring

52

disruption of the oceanic/atmospheric system in the tropical Paciﬁc [65]. The El Nino
phenomenon has consequently affected weather around the world, including an increase
in rainfall across the southern regions of the United States and in Central and South
America. Evidence suggests that a dramatic increase in rodent populations (known
carriers of HPS causing virus) occurred in the Southwestern United States during 1991-
1993 [65]. The increased rainfall may have produced conditions more suitable for the
rodent populations such as a greater food supply, more cover and shelter. A population
density increase in rodents would allow them to encounter each other and potentially
transmit the hantavirus. A dense rodent population would produce scenarios for more
rodents to come in contact with virus infected rodents, hence the possibility of
transmitting the virus. Also, when the rodent density is higher, there is a greater chance
for encounters between rodents and humans. This pattern of spread in the mouse
population was essentially recorded through a population survey of the mouse population
in this speciﬁc area prior to the HPS outbreak in the Four Comers region of the United
States and may have been the factor essential to the outbreak of HPS in this region. The
sporadic nature of cases of HPS may signify an important temporal characteristic that the
infection may disappear from a population of the mouse vector if environmental
conditions and seasons are adequate, only to reoccur sporadically when the conditions
and season change [66]. A more logical explanation is that the disease “remains endemic
within the rodent population with human disease cases occurring sporadically from
unusual contacts. Outbreaks may then result from unusual population surges due to

climatic changes.”

53

7 MK'YV-‘m

It

 

 

3.2 GEOGRAPHIC DISTINCTIONS

HPS was ﬁrst noted in the United States, but Since the emergence HPS has been
documented in other regions as well including Argentina, Brazil, Canada, Paraguay,
Uruguay, Chile, and Panama, making HPS a pan-hemispheric disease [60]. The disease
has only been reported thus far in the Western Hemisphere. The distribution of cases in
these regions can be seen on Figure 29. The ﬁgure shows the cumulative number of HPS
cases reported from 1993 to 2004 in North and South America. Figure 30 presents a
clearer graphic of the distribution of HPS cases per country. The countries with the
largest number of cases reported between 1993 -2004 are Argentina, Brazil, Bolivia, and
the United States. A detailed description of the number of cases and deaths per country
for each year is provided in Table 4. An overview of these countries will be provided for
the epidemiological components of HPS in each of these areas.
A. North America

As of 2004, 450 cases of HPS have been reported in 31 US. states and 3
Canadian Provinces [67]. Three-quarters of the HPS cases have been from rural areas in
the western half of the continent on either side of the Rocky Mountains [64, 68]. No
cases have currently been reported in Mexico; however four cases reported in the United
States have occurred in areas near the border of Mexico. Studies have shown at least four
distinct hantaviruses to be associated with HPS in North America [68]. These speciﬁc
viruses will be discussed in Chapter 4.
North America- United States

As mentioned previously, the initial recognition of HPS in the spring of 1993

stemmed from an epidemic of approximately 27 cases of unknown respiratory disease in

54

the southwestern United States. Since that time period, retrospective analysis of HPS has
determined that cases occurred as far back as 1959. The majority of cases since the
initial outbreak in 1993 have occurred sporadically at a rate of 20 to 40 cases per year
[422] throughout the United States, which suggests an uncommon yet epidemic pattern of
occurrence. A distribution of HPS cases reported per state in the United States is
presented in Figure 32. From this ﬁgure, a majority of the cases of HPS occurred in the
southwestern region of the United States. In the United States, HPS cases have been
documented in all months of the year, bur are less frequent during the winter months of
December, January, and February [68]. The United States case-fatality rate of HPS was
44% at the start of the outbreak. However, this number has steadily declined since the
time of the initial outbreak in 1993. Those cases with an onset of illness after January I,
2004 had a case fatality rate of approximately 35% [68]. The decrease in mortality can
be attributed to improved clinical management rather than changes in the virus or
pharmacological therapies.
North America-Canada

For surveillance purposes, Canada has adopted the HPS case deﬁnition of the
US. CDC (see below). As of 2004, there have been 88 cases of HPS reported [68]. A
majority of the cases occurred in three western provinces including: British Columbia,
Alberta, and Saskatchewan. These areas account for 25% of Canada’s population.
Through retrospective studies, the earliest known cases of HPS in Canada occurred in
Alberta in 1989. Since 1994 when HPS was recognized in Canada, an average of about 5
cases of HPS per year has been reported. However, a signiﬁcant increase in the number

of cases was reported for 2002 (44 cases) and 2003 (14 cases). More than 45% of the

55

HPS cases have occurred during the months of April, May, and June [68]. Studies have
shown that landscape composition in Canada is a more important predictor of rodent
seroprevalence than other factors such as season, viral strain, climate, buildings, or
association with humans [68].
B. Central America
Central America-Panama

No cases of HPS were reported in the Central American region or the Caribbean
from 1993 through 1998. However, in 1999 cases of HPS occurred in this region and to
date there have been 35 HPS cases reported [67]. It is difﬁcult to determine what may
have led to the occurrence of cases during this time period, but the cases may be linked to
changes in the environment and an introduction of various host species for HPS.
C. South America

In South America, the presence of hantavirus infections (not HPS associated) has
been known since the 1980’s. Studies have shown that nearly 56% of captured rats were
seropositive for antibodies reactive to Hantaan virus antigen during that decade [68].
Following the outbreak of HPS in the United States in 1993, HPS was diagnosed in three
people in Brazil. By the third quarter of 1998, 239 cases of HPS were reported from ﬁve
countries in South America. Cases have occurred in an endemic fashion as seen in the
North America. However, several clusters have accounted for more than 25% of all the
cases of HPS on the continent [68]. These clusters have mostly occurred from September
to January in a variety of habitat regions. A few of the highly HPS affected countries are

highlighted below.

56

South America-A rgentina

As of 2004, 592 cases of HPS have been reported in Argentina [67]. They were
predominantly in the Salta and Jujuy provinces in the northwest, Santa Fe and Buenos
Aires provinces in the central part of the country, and Rio Negro, Chubut, and Neuquen
in the south [68]. The prevalence of hantavirus antibodies in the general population in
these areas was about 6.5% [69]. The overall case fatality rate in this region is
approximately 44%.

After the 1993 outbreak in the United States, acute, prospective, and retrospective
surveillance procedures were completed of patients presenting with fever and
unexplained respiratory distress syndrome between 1987 and 1995. In central Argentina,
HPS was detected in patients during surveillance of leptospirosis and Argentine
hemorrhagic fever in which laboratory tests for these agents produced negative results.

In northern Argentina, local physicians in the Salta province had reported case clusters of
acute respiratory distress syndrome of unexplained etiology Since the 1980’s [68]. Due to
serologic testing of cases, results supported hantavirus as the etiologic agent of the
disease. In southern Argentina, a cluster of three family members with HPS were
identiﬁed in the Province of Rio Negro in March 1995. Another cluster of cases occurred
between September and December 1996 in the same region, affecting about 18 people.
Four of the 18 cases were physicians who lived in the area. Epidemiological, molecular,
and ecological data have established person-to-person transmission, primarily after a
physician living in the non-endemic region became infected after having contact with a
HPS patient [68]. The mode of transmission will be discussed more thoroughly in

Chapter 4.

57

South America-Brazil

From 1993 to 2004, Brazil has reported 321 cases of HPS [429]. In December
1993, three brothers from Juquitiba in the Sao Paulo area were diagnosed with HPS, of
which two later died from the illness. The brothers lived together in a rural area that
showed evidence of rodent infestation. 6.1% of the case contacts tested positive for
antibodies reactive to hantavirus antigen, with no symptoms of disease for HPS [68].
South America-Chile

HPS was not recognized in Chile until 1995 when a patient from Cochamo, Los
Lagos was diagnosed with the illness. As of 2003, 331 cases of HPS have been reported
in the country [67]. The majority of cases occurred in the Southern regions and between
October and December. The overall case fatality rate was approximately 61% [68],
which is higher than reported for other regions of the Americas.

Chile had three family clusters which occurred in the Aysen Region. In one
cluster, family members became ill within one to ﬁve days of each other. In another
family cluster, illness occurred in a sequential manner, with a period of 16 to 41 days
between the index case and the onset of illness of the last family member. The third
family cluster included a husband working in a rural area and his wife who stayed at
home in the urban area of Coyhaique. The husband developed symptoms suggesting
HPS 12 days after returning to his urban home, was hospitalized, and died. The wife
became ill 22 days after the initial onset of her husband’s symptoms. No known rodent

exposure was determined [68].

58

 

awn-s“.

 

South America-Paraguay

As of 2004, 99 cases of HPS have been reported in Paraquay [429]. An outbreak
of HPS occurred in an agricultural community in the western Chaco region, affecting
about 17 people in the spring and summer of 1995 through 1996. The case fatality rate
during the initial outbreak period was 12% [68]. This may have been underestimated,
however, since autopsies were completed only infrequently in this region. The human
seroprevalence in asymptomatic groups was 7% and 21% in community residents [68].
These ﬁndings may be indicative of a mild illness in these regions with higher rates of
sub-clinical infection than documented elsewhere.
3.3 CASE DEFINITION

HPS, commonly referred to as hantavirus disease, is a febrile illness characterized
by bilateral interstitial pulmonary inﬁltrates and respiratory compromise usually
requiring supplemental oxygen and clinically resembling acute respiratory disease
syndrome (ARDS). Typical disease onset consists of fever, myalgia, headache, and
gastrointestinal symptoms. The surveillance case deﬁnition in 1993 during the initial
outbreak was as follows [60]:

o A conﬁrmed case is deﬁned as unexplained adult respiratory distress or acute
bilateral pulmonary interstitial inﬁltrates and/or prodromal symptoms in a person
with onset during 1993 having laboratory evidence of recent hantavirus infection.

As more epidemiological and clinical knowledge developed about the newly emerging
disease the case deﬁnition for HPS became more thorough and was revised as follows

[63]:

59

Clinical Case Deﬁnition
0 A febrile illness (T> 38.3 °C [101 °F] oral) requiring supplemental oxygen, plus
0 Bilaterial diffuse inﬁltrates (may resemble adult respiratory distress syndrome
[ARDS]), plus
0 Develops within 72 hours of hospitalization in a previously healthy person, OR
o Unexplained illness resulting in death plus an autopsy examination demonstrating
noncardiogenic pulmonary edema without an identiﬁable speciﬁc cause of death
Laboratory Criteria for Diagnosis
0 Presence of hantavirus-speciﬁc IgG antibodies to a 4-fold or greater increase in
IgG antibody titers OR
0 Positive reverse transcriptase-polymerase chain (RT-PCR) results for hantavirus
RNA OR
0 Positive immunohistochemical results for hantavirus antigens
Case Classification
0 Suspected: Presentation compatible with the clinical case deﬁnition
0 Conﬁrmed: A suspected case that is laboratory conﬁrmed
HPS is divided into four phases: febrile, cardiopulmonary, diuretic, and
convalescent phases [422]. The febrile phase typically lasts 3 to 5 days (range l-12 days)
and is indistinguishable from many other viral diseases. This stage’s symptoms include
fever, myalgia, chills, asthenia, dizziness, headache, anorexia, nausea, abdominal pain,
and diarrhea. Signs of upper respiratory tract infection such as sore throat, rhinorrhea,

sinusitis, and ear pain are usually absent in HPS.

60

The second phase of cardiopulmonary begins with onset of hypotension and
pulmonary edema with rapid progression over a 4-24 hour time period. Pulmonary
edema is indicated by a respiratory rate of about 24/min or by a chest x-ray [68]. At this
phase of the disease, hypoxia is apparent with an oxygen saturation of hemoglobin less
than 95% at sea level and less than 90% at 2000 In or more above sea level.

The third phase is initiated with the occurrence of spontaneous diuresis. This
stage is characterized by a rapid clearance of the pulmonary edema ﬂuid, resolution of
fever, and shock. The convalescence phase extends over the next two week to two
months.

3.4 INCUBATION PERIOD

The incubation period of HPS is not completely deﬁned since few cases have had
clearly deﬁned exposures in time and place. Currently the incubation period for HPS is
thought to be approximately two weeks with a possible range of a few days to six week
[4] The incubation period of other hantavirus disease is typically one to four weeks [68].
However, in the United States, it has often become difﬁcult to determine when and where
the case-patient contracted the virus.

In an effort to determine the incubation period of HPS-causing viruses in the
United States, eleven HPS cases from the national HPS case registry were identiﬁed with
well-deﬁned exposures. Review of these eleven cases suggests the incubation period to
be 9 to 33 days, with a median of 14-17 days [70]. Figure 31 shows an overview of the
exposure periods for these eleven case patients. There are still some gray areas for the
incubation period. About half of the study population used did not note exposure to

rodents or rodent-infested areas. Also, in those patients who did report an exposure to

61

rodents that had carried hantavirus, many had multiple or continuous exposure, especially
those living in rural areas. Other limitations for accessing the incubation period of HPS
include limited recall, a high case-fatality ratio of about 37%, and continuous exposure to
rodents. By reviewing histories of case patients, estimates of the incubation period for
HPS can be suggested. It becomes essential in investigating HPS cases to have an
understanding of the incubation period for public health and clinical outcomes.
3.5 PERSONAL CHARACTERISTICS
A. Age
The age distribution of cases is fairly consistent among the regions affected with

HPS. The overall mean age is around 37 years of age. A summary for some of the
regions’ mean ages are summarized below [68, 71]:

0 United States: Mean age 37 (range 10-75)

0 Canada: Mean age 39.5 (range 15-62)

0 Argentina: Mean age 34.7 (range 4-71)

0 Chile: Mean age 29.7 (range 2-60)
In the United States, HPS is rare in young children under 18 years of age. Roughly, 5.2%
of the HPS cases are from this age group [68]. However, in Argentina and Chile a larger
proportion of pediatric HPS cases have been reported. For example, in Chile,
approximately 21.4% of the cases occur in those less than 17 years of age [68].
B. Gender/Race

All regions affected by HPS show male dominance in the number of cases

reported. This may be representative of the other risk factor behaviors associated with

HPS, which are more commonly utilized by males (see other risk factors). Some region

62

gender percentages with HPS include: United States (61%), Canada (68%), and Chile
(75%) [68, 71]. The majority of case patients are also white in all areas affected by HPS.
For example, in the United States 77% are white, 20% American Indian, 1% are Black
Asian [71].
C. Other Risk Factors
As mentioned previously, about 75% of HPS cases have been residents in rural

areas [64]. The most effective way to decrease the risk of HPS is to limit exposure to
rodents and their excreta [72]. HPS cases have been associated with a variety of
activities including [68, 69]:

o Inhabiting dwellings with indoor rodent populations

- Occupying previously vacant cabins or other dwellings

0 Cleaning barns and other outbuildings

o Disturbing rodent infested areas

0 Residing or visiting in areas in which the rodent population has shown a marked

increase in density

0 Trapping or handling live or dead rodents or their excreta

o Planting or harvesting ﬁeld crops

0 Disturbing rodent-infested areas while hiking or camping
These factors are highly associated with HPS infection. Another risk factor that has been
documented but infrequent is occupational exposure. Among those cases that occurred in
the United States due to occupational circumstances, those patients included grain
farmers, an extension livestock specialist, ﬁeld biologists, and agricultural, mill,

construction, utility, and feedlot workers [63]. Interestingly, travel to HPS infected areas

63

is not considered a risk factor. To date, no restriction on travel to HPS infected areas

have been initiated [63, 72].

Chapter 4

HANTAVIRUS PULMONARY SYNDROME (HPS) ANALYTIC
EPIDEMIOLOGY

4.1 EPIDEMIOLOGICAL AGENT

Within three weeks of the previously unrecognized respiratory disease in the
United States in 1993, the ﬁrst evidence of the etiologic cause of the illness was
determined. Antibodies cross-reactive with recognized hantaviruses were identiﬁed in
sera from patients meeting a provisional case deﬁnition, and the pattern of reactivity was
suggestive of a pathological agent that was not previously recognized [61, 73]. The
investigations led to the identiﬁcation of the Sin Nombre virus (SNV) (originally referred
to as Four Comers or Muerto Canyon Virus), a novel hantavirus, as the causative agent of
the outbreak of HPS in the United States [74].

Since the 1930’s, epidemic and sporadic hantavirus-associated disease has been
described throughout Eurasia, particularly in Scandinavia and northeastern Asia [75].
Hantaviral disease ﬁrst became a US. public concern in the 1950’s [61, 75]. During this
time period, thousands of United Nations military personnel were infected with
hantavirus during the Korean conﬂict. The illness was referred to as Korean hemorrhagic
fever or hemorrhagic fever with renal syndrome (HF RS) [61]. The causative agent called
Hantaan virus was not isolated until the late 1970’s.

Hantaviruses are part of the viral family Bunyavirida, representing a group of
zoonotic viruses that can be transmitted from animals to humans [63, 73, 75, 76] This
particular family of viruses comprises roughly 14 viruses, including those causing HPS

and HF RS as discussed above. Phylogenetic analysis of rodent-bome hantavirus genes

65

has revealed two main lineages. The HFRS-causing viruses are linked to an Old World
lineage of viruses (See Table 5) including [77]:

Hantaan: Asia, Far East Russia

Dobrava: Balkans
Seoul: Worldwide
Puumala: Europe

All HPS-causing viruses share a common New World lineage of viruses (See Table 5)
including [77]:

Sin Nombre: West and Central , US. and Canada
Monongahela: Eastern US. and Canada

New York: Eastern US.

Bayou: Southeastern U.S.

Black Creek Canal: Florida

Andes: Argentina and Chile

Laguna Negra: Paraquay and Bolivia

Bermejo: Northwestern Argentina

Juquitiba: Brazil

Choclo: Panama

A distribution of these various hantavirus strains is presented in Figure 33. The origin of
HPS in the United States, as mentioned previously, was associated with the Sin Nombre
strain of hantavirus. This particular strain is unique from other known hantaviruses in a
few respects. First, the overall effects of the virus are more rapid and lethal, killing
almost two-thirds of those infected in comparison to 5%-20% for the Hantaan strain.
Also, the virus attacks and affects the lungs instead of the kidneys [78]. The
distinctiveness of the clinical manifestations of the disease and the phylogenetic analyses
completed support the idea that the virus is genetically distinct from previously described
hantaviruses (See Figure 35).

Hantaviruses form a separate genus within the family Bunyavirida. They are

primarily rodent borne and are not transmitted by an arthropod vector like the other four

66

genera (Bunyavirus, Phlebovirus, Nairovirus, Tospovirus) in this family of viruses [73,
75, 79, 80]. Hantaviruses are lipid-enveloped, spherical viruses about 80 to 110 nm in
diameter [68, 77, 80]. Figure 34 shows a thin-section electron micrograph of Sin Nombre
Virus isolate, the causative agent of HPS.

Interestingly, unlike humancells, the genetic material of hantaviruses is not
composed of double-stranded DNA. Instead, the viruses are composed of a single strand
of RNA in three segments. The RNA genome tri-segrnents include a large (L) segment
approximately 6500 nucleotides long, a middle (M) segment approximately 3600-3 800
nucleotides long, and a small (S) segment approximately 1700-2100 nucleotides long.
The L segment encodes a viral polymerase, the M segment encodes G1 and G2 envelope
glycoproteins, and the S segment encodes the N nucleocapsid protein [68]. The viruses
are surrounded by a lipid envelope adding ﬁagile characteristics. Like other enveloped
viruses, hantaviruses are readily inactivated by heat, detergents, organic solvents, and
hypochlorite solutions [80]. The lipid envelope can be destroyed and the virus can be
killed by fat solvents such as alcohol, disinfectants, and household bleach [76].
Depending on the environmental conditions, hantaviruses likely survive less than one
week in indoor environments and for shorter periods when exposed to sunlight outdoors.

To date, there has been no evidence of genetic re-assortrnent of the newly
identiﬁed strain with the Old World hantaviruses. All known SNV strains shared almost
90% nucleotide sequence homology and even higher amino acid sequence homologies
[68]. From these ﬁndings, is it unlikely that genetic re-assortrnent with other viruses

accounted for the newly recognized HPS-causing virus in the southwestern United States.

67

A more logical possibility is that HPS and HPS-causing viruses may have existed in the
Western Hemisphere for many years despite only being detected in 1993.
4.2 MODE OF COMMUNICATION

Murid rodents (order Rodentia, family Muridae) are the natural hosts and
reservoirs of hantaviruses. Fossil records have shown that these speciﬁc rodents have
been present for the past 20 million years in North America and 3.5 million years in
South America [68]. Each hantavirus appears to have a single predominant natural
reservoir, showing exceptional concordance of the host and virus through phylogenetic
interrelationships. Findings have shown that hantaviruses do not adapt readily to new
hosts and are closely adapted to be successful in their speciﬁc host [79]. Some scientists
hypothesize that the genus Hantavirus evolved in the Old World and that the viruses may
have been carried by rodents across the Bering land bridge when migration occurred
during the Oligocene period (33.7 to 23.8 million years ago) and into South America in
the Pliocene period (5.3 to 1.8 million years ago) [79].

Rodents belonging to the murid subfamily Sigmodontinae have been implicated as
the hosts of HPS-causing viruses. This subfamily contains around 430 species of mice
and is widespread in North and South America. Each hantavirus is maintained in the
environment by infecting a single rodent species [68, 73]. As a result, the range of the
host species restricts the distribution of any particular virus.

Investigation of the 1993 outbreak of HPS in the southwestern United States
identiﬁed the Sin Nombre virus (SNV) as the causative agent and the implication of the
deer mouse as the principal reservoir (see Figure 36). The deer mouse is one of the most

common small mammals in North America, occupying almost every dry land habitat and

68

widespread among rural areas [74, 81]. Figure 37 shows a distribution of the species
within the United States, showing that a majority of the United States regions have deer
mouse populations. The overall prevalence of these rodents will vary both
geographically and temporally and approximately 10% of the deer mice test positive for
evidence of SNV within the deer mouse population range [81]. More studies are
necessary to determine if this proportion varies regionally.

There have been cases of HPS occurring outside the range of the deer mouse,
implicating other rodents as host to hantaviruses with the potential for causing serious
disease. For example, other hantaviruses associated with rodents known to cause HPS
include the New York Virus, hosted by the white-footed mouse (See Figure 38). A single
case in south Florida led to the isolation of Black Creek Canal virus, hosted by the cotton
rat (See Figure 39). Three initial cases in Louisiana and east Texas implicated the Bayou
virus, hosted by the rice rat (See Figure 40). Most of the land area in the United States
lies within the range of one or more of the host species known to carry hantavirus.

HPS is more common in South America than in North America currently. Andes
virus has been associated with HPS in Argentina and Chile. Other viruses linked to HPS
in Argentina include Berrnejo, Hu39694, Lechiguanas, Maciel, Oran, and Pergarnino
viruses. Bermejo and Laguna Negra virus causes HPS in Bolivia, and Laguna Negra
virus is also linked to HPS in Paraguay. In 1999, an outbreak in Panama began the ﬁrst
cases of HPS in Central America implicating Choclo virus, hosted by the rodent
Oligoryzomysfulvescens. Currently, since the rodents mentioned above are restricted to
the Americas, HPS is restricted to the Americas geographically [81]. Table 5 provides a

summary of the various types of viruses associated with HPS and their known reservoirs.

69

4.3 TRANSMISSION

Hantaviruses do not cause overt disease in their reservoir hosts and the rodents
remain asymptomatic during their lifespan of carrying the virus [68, 81]. The infected
rodents shed the virus in saliva, urine, and feces for many weeks, months, or for life,
however the quantity of virus shed can be much greater approximately 3-8 weeks after
infection. Field data suggests that transmission in the host population occurs horizontally
with a higher frequency among male rodents. Transmission from rodent to rodent is most
likely from weaning and through physical contact. Also, genomic sequencing has
indicated that the virus likely has evolved concurrently with its rodent host over a long
period of time [63]. Biting may be another important mode of transmission among
rodents as demonstrated by the presence of infectious virus in saliva of infected rodents.
Some evidence has shown the infectious virus in a number of other rodent species and
their predators. This is indicative that other mammal species coming in contact with an
infected rodent may become infected.

As mentioned previously, rodent infection is asymptomatic, whereas human
infection is often associated with disease. The main route of transmission to humans is
respiratory via small particle aerosols from rodent excreta, particularly freshly shed urine
[63, 68, 81]. When fresh rodent urine, droppings, or nesting materials are stirred up, tiny
droplets containing the virus get into the air. This process is known as “aerosolization”
[82]. Figure 41 gives a representation of how the virus is transmitted. When humans
breathe these particles of an infected rodent, this begins the possibility of becoming sick
with HPS. High risk exposure has been associated with entering or cleaning rodent

infested structures. Many hantavirus infections have occurred in persons of lower

70

socioeconomic status because poorer housing conditions and agricultural activities favor
close contact between rodents and humans. However, other activities such as
suburbanization, wilderness camping, and outdoor recreational facilities have spread HPS
infection to persons of middle and upper incomes also. Other ways in which rodents
transmit HPS to humans may include the following [60, 79, 81]:

o If an infected rodent bites a human, the virus may be Spread to that person. This
type of transmission is rare.

0 Some researchers think that if humans touch something that has been
contaminated with rodent urine, droppings, or saliva, and then touch their nose
they may become infected with the virus.

0 Researchers also think that if humans eat food contaminated by urine, droppings,
or saliva from an infected rodent they may become sick.

Person-to-person transmission has not been associated with HPS cases in the
United States. However, person-to-person transmission including nosocomial
transmission of Andes virus was well documented in an outbreak in Southern Argentina
in 1996 and suspected to have occurred to a lesser extend in an outbreak in Chile [63,
81]. Suggestion of person-to-person transmission began when there was an increase in
the number of HPS cases from 1995 to the spring of 1996 in an area 150 km around the
El Bolson area in Southern Argentina. During this time period, a few physicians who
were in contact with El Bolson cases of HPS developed the disease during the same
period. Epidemiological analysis suggested person-to-person transmission of the Andes

hantavirus by either nosocomial or household contact.

71

For evaluation of person-to-person transmission in these designated regions,
homologies of PCR-ampliﬁed viral sequences were analyzed from 26 Argentine and
Chilean cases. All hantavirus variants studied were genetically similar, and 16 of the
cases were linked epidemiologically as having close contact through the household,
health caring, marital contact, and/or traveling together in a vehicle [83, 84]. Contact
with rodents was not evident in this speciﬁc outbreak. The direct genetic evidence
provided from these outbreaks strongly supports a person-to-person transmission pattern.

After the Argentinean and Chilean ﬁndings of the possibility of person-to-person
transmission of HPS, the United States initiated epidemiological investigations through
retrospective analysis of the United States HPS registry. During this time period, the
registry had records for 160 HPS patients with clinical and laboratory evidence of HPS.
Household or social contacts (n=320) of 40 of the HPS patients were tested for antibodies
that react with SNV antigen. Of these household or social contacts, 310 had no serologic
evidence of hantaviral infection, three had IgG that reacted with SNV antigen but no
illness, one had SNV-IgG and was diagnosed with HPS retrospectively, and six had IgM
that reacted with SNV antigen [85].

Clearly, these ﬁndings do not provide deﬁnitive evidence of interhuman or
nosocomial spread of HPS. Person-to-person transmission can not be considered as
proven, because the few case clusters that were observed may simply have originated
from a common exposure to rodent-infested living conditions. Currently, it is not known
whether the secondary transmission of HPS observed in Argentina and Chile is a feature

unique to hantaviruses in Southern Argentina or a rare interaction between host and virus.

72

More studies are needed to understand the epidemiological components of transmission

for hantaviruses.

73

Chapter 5

PARALLEL COMPARISON OF SARS AND HPS

In order to provide application of the previous knowledge obtained from HPS to
the recent outbreak of SARS it is essential to address the important similarities and
distinct differences between the two diseases with a thorough emphasis on the nature of
disease to human reservoir contact. With these speciﬁc distinctions, an understanding of
the degree of parallelism between SARS and HPS can be determined and important
recommendations for public health practice can be addressed.

5.1 SIMILARITIES

One important aspect for choosing HPS as the parallel disease comparison to
SARS is the fact that both diseases are recent newly emerging/identiﬁed diseases. HPS
was ﬁrst recognized in the southwestern United States in 1993. Through a high proﬁle
investigation of HPS, the disease was determined to be a newly identiﬁed disease, but not
a new disease. The disease emergence was traced back several years, with the earliest
HPS-comparable illness identiﬁed in July 1959. One decade after the recognition of HPS
in the United States, the SARS outbreak of 2003 began with the earliest known case of
disease originating in the Guangdong Province of China in November 2002. By
comparing these two diseases that were identiﬁed within a short time frame, previous
public health measures for HPS can likely be applied to the more current SARS outbreak
situation.

Interestingly, both diseases are geographically diverse in the cases reported and
are not localized in one speciﬁc area. HPS is now considered a pan-hemispheric disease

with the disease only reported in the Western Hemisphere. SARS, on the other hand, is

74

considered the ﬁrst new pandemic disease to emerge in 2003 in that it sustained a global
spread. The geographic capabilities for both HPS and SARS are important to consider
for ﬁrture public health awareness and recommendations.

When addressing clinical criteria for HPS and SARS, there are three important
parallel conclusions to discuss. First, the laboratory methods of both diseases are largely
consistent since they are both viral diseases. Detection of serum antibodies (IgG) for
both hantaviruses (HPS) and coronaviruses (SARS) is determined by enzyme
immunoassay. Also, a RT-PCR test is the necessary procedure to detect a positive result
for the speciﬁc viral RNA for each virus. Second, the clinical presentation for both HPS
and SARS are remarkably similar. Both diseases present with a high fever deﬁned as a
body temperature of greater than 101°F for HPS and 100° F for SARS. Also, both
diseases resemble ARDS from chest radiographs and the autopsy ﬁndings in both cases
are likely to be consistent with pneumonia and noncardiogenic pulmonary edema. Third,
the clinical courses of the diseases are multi-phasic. HPS has four phases and SARS has
three stages as addressed in previous chapters. The parallel stage descriptions for the
diseases are as follows:

0 Stage one- symptoms including fever, myalgia, and other systemic symptoms

0 Stage two- rapid progression of pulmonary edema and oxygen desaturation
Without the current tests for detecting speciﬁc viral antibodies in patients, the clinical
aspects of HPS and SARS could be indistinguishable in speciﬁc areas, from each other or
from other infectious diseases. Fortunately, science has allowed for lab testing within the
hospital setting along with the clinical presentation of the disease to ensure optimal

diagnosis of disease.

75

HPS and SARS exhibit important epidemiological similarities including
characteristics of the incubation period and age distribution. SARS and HPS research
studies have both addressed the possibility that patients may appear to have unclear
incubation periods due to multiple exposures. As a result, the incubation period for HPS
is not completely deﬁned since few cases have had clearly deﬁned exposures, and the
SARS incubation period deserves more studies devoted to investigating the outlier values
obtained.

The age distribution for both HPS and SARS is also an interesting component of
the parallel comparison. Both diseases exhibit an age distribution with the majority of
cases occurring in young to middle-aged adults. HPS showed an average mean age of
approximately 37 years of age, while the majority of SARS cases were in the age range
of 20-60. Surprisingly, both diseases rarely occurred in children under age 18. These age
distributions are likely directly correlated to other risk factors that contribute to cases of
disease. For example, for HPS those individuals with occupational exposures through
farming, biology, construction, utility service, and other related positions are at a higher
risk of developing HPS since these positions are prone to rat exposure. On the other
hand, a high occupational risk factor group for SARS includes health-care workers. For
both HPS and SARS, the age distribution may be explained since a majority of those
working in these occupations are likely younger and middle-aged adults.

The etiological agents for HPS and SARS show unique similarities. First, both
viruses determined to be the causative agent for the diseases were novel and not
previously recognized as part of their speciﬁc virus family. Phylogenetic analyses have

shown that both causative viruses were genetically distinct from previous types of the

76

virus described. As a result, the virus linked to HPS was labeled as SNV, a new group in
the family of Bunyavirida, and the virus linked to SARS labeled as SARS-CoV was
classiﬁed as a new group in the family of Coronaviridae. Another important possibility
inferred from the genetic analysis of each virus genome is that both causative agents
likely were already circulating within the human population in which the virus was ﬁrst
recognized. These populations include the United States for HPS and mainland China for
SARS.

The structure and virus characteristics for both HPS and SARS are parallel in that
both HPS-causing hantaviruses and SARS-CoV are lipid-enveloped spherical viruses
containing a single strand of RNA. Hantaviruses are larger with a diameter of about 80
to 110 nm compared to approximately 78 nm in diameter for SARS-COV. The main
difference in the structures is the surface projections of the lipid envelope for SARS-
COV.

Two signiﬁcant parallel considerations include the animal reservoir and mode of
transmission for each disease. An important epidemiological component is that HPS and
SARS are both zoonotic diseases, meaning they have an animal reservoir to harbor the
causative agent of the disease. As a result, known contact with animals is a risk factor for
infection with both HPS and SARS. The disease to human reservoir contact will be
discussed in more detail in section 5.3. When accessing the modes of transmission of
HPS and SARS, both diseases are linked by respiratory means as a source of disease.
HPS’S main route of transmission to humans is respiratory from small particle aerosols
from rodent excreta. Similarly, SARS predominant transmission is through respiratory

droplets through close person-to-person contact. Also, the mode of transmission in a

77

southern Argentina HPS outbreak has been suspected to have a person-to-person
transmission pattern. This would directly parallel the mode of transmission for SARS,
which is primarily known to be through person-to-person contact.

5.2 DIFFERENCES

For a thorough assessment of HPS and SARS, the contrasting characteristics are
important to determine to clarify the limitations of using HPS as a parallel disease for
SARS public health understanding. One very important distinction between the two
diseases is the epidemic curve produced from each outbreak situation. HPS’S curve has a
pattern representing a point source epidemic with a peak in number of cases and a
gradual decline (See Figure 31). This type of scenario is often associated with an animal
reservoir for transmission from animals-to-humans. In contrast, the SARS epidemic
curve signiﬁes a prepagated epidemic indicative of a person-to-person mode of
transmission (See Figure 1).

Since HPS has been present a longer time than SARS the seasonality is
understood, with the majority of cases occurring during the spring and summer months.
These seasons are more prone to exposure to rodents with activities such as cleaning,
handling, and hiking around rodent-infested areas. However, the seasonality of SARS is
still undescribed. More knowledge and time is necessary to describe the pattern of SARS
cases related to various seasons.

As mentioned as a similarity, HPS and SARS are both geographically diverse
diseases. However, a key difference in the geographies involves the disease origin and
the potential for diverse spread of disease. HPS was ﬁrst recognized in the United States

while SARS was first recognized in China. Interestingly, HPS appears not to present

78

such a global threat as SARS as a human disease. HPS has currently only been identiﬁed
in the Western Hemisphere, whereas SARS was quickly an international problem. A
likely explanation for this key difference is the mode of transmission necessary for the
spread of disease. Speciﬁc rodents in other regions may not harbor the virus necessary to
produce HPS. Therefore, unless the rodent was introduced to these geographic locations
it is unlikely the disease will be present in these areas since HPS has shown to involve no
or limited person-to-person spread. As a result, there currently has been no restriction on
travel to HPS infected areas. However, a person-to-person spread disease is problematic
primarily due to the international relations and travel the population is accustomed to.
Therefore, the SARS outbreak situation forced a recommended travel restriction to China
since SARS was a problem in these areas. For public health purposes, these restrictions
are likely correlated to fewer cases of SARS in other regions of the world.

Within the speciﬁc regions affected by these diseases, the residence location
reporting the majority of cases is completely different. Approximately 75% of HPS cases
have been reported from rural areas, whereas SARS has spread more prominently under
conditions of high density and greater population ﬂuidity indicative of urban regions.
These differences are likely associated to where the interspecies transition likely occurred
when the disease originated.

HPS and SARS are quite contrasting with regards to the actual incubation period
range and the CFR. The incubation period for HPS ranges from 9-33 days with a median
of 14-17 days. SARS, on the other hand, has a much Shorter incubation period of about
4-5 days with a mean incubation period of 4-6 days. The short incubation period of

SARS may have been a key factor in the quick spread of SARS globally. Interestingly,

79

HPS has a much higher CFR of about 37%, while SARS is approximately 11% to 15%.
From this information, it is clear that HPS is generally more severe than SARS; however
both viruses are more severe than any previous virus in their designated family.

The epidemiological agent and reservoir of disease show some differences
between HPS and SARS. First, the causative agent of HPS is a hantavirus, whereas
SARS causative agent is a coronavirus. Historically, hantaviruses have been documented
as causing human disease, whereas coronaviruses have never been associated with human
disease until the SARS outbreak. Second, the principal reservoir of HPS is known to be
rodents, unlike SARS whose reservoir(s) is still under speculation. Third, HPS is
transmitted to humans via small aerosols primarily from rodent excreta. Only one
outbreak in Southern Argentina has reported the possibility of human-to-human
transmission. In contrast, SARS is predominately transmitted person-to-person through
direct or indirect contact of mucous membranes with infectious respiratory droplets or
fomites. Also, documentation of nosocomial transmission in HPS is rare despite a large
number of cases observed and treated within the hospital setting. In contrast, one of the
most important epidemiological attributes of SARS involved nosocomial transmission.
Finally, from a clinical standpoint, asymptomatic infection is rare for HPS, whereas
asymptomatic infection for SARS is very common. For SARS prevention, this
distinction could be quite detrimental in containing and controlling the virus. As a result,
more drastic measures may need to be considered if someone has been exposed to a
SARS case, but is not showing symptoms. This idea will be discussed in more detail in

Chapter 6. All of these speciﬁc distinctions between HPS and SARS are important

80

contrasting factors to consider when addressing a parallel comparison of diseases for
public health practice.
5.3 DISEASE TO HUMAN RESERVOIR CONTACT
As mentioned previously, the mode of communication for an infectious disease is

the phenomenon in the environment that brings the host and the agent together. The
various modes of communication include vectors, vehicles, and reservoirs. HPS is
clearly understood to involve rodents as the principle reservoir for disease, whereas
SARS-COV is almost certainly understood to involve an animal reservoir. Animals are
one of the most important types of reservoirs for human disease as mentioned in previous
chapters. About 75% of human emerging infectious diseases have a zoonotic (animal
species) origin. As addressed previously, there are several important factors that may
contribute to emerging zoonotic diseases including:

0 Transportation of human and animals into new places

0 Increased contact between animals and humans

0 Changes in the environment and husbandry practices

0 A larger immunocompromised population

0 Increased recognition of diseases as a zoonotic origin

0 Discovery of new organism not previously recognized
Technology has been a key component for helping to eradicate disease, but it can also
contribute to exacerbating disease. Historically, there are numerous examples that
support this philosophy including the following:

0 Modern farming practices, such as feeding livestock remains of other animals,

aided to help spread Creutzfeldt-Jakob disease through England.

81

o Suburban development destroyed predator populations, creating habitats for tick-
carrying mice, which are highly efﬁcient spreaders of Lyme disease.
0 Medical technologies like transfusions and transplants increase the risk of

spreading bloodbome disease such as Hepatitis C.

0 HIV likely passed from chimpanzees to Aﬁican hunters, spreading beyond these
isolated regions when cities began to develop around Africa.
a Live-poultry markets like China’s serve as breeding grounds for viruses that can

Spread to humans like inﬂuenza.

Is there an explanation as to the why an animal virus may cross the interspecies
barrier and develop into a problematic human disease? As mentioned previously, RNA
viruses characteristically have high mutation rates and evolve through RNA
recombination. This fact alone may contribute signiﬁcantly to the evolution of a
hantavirus and coronavirus into the human population. Another logical reason is that the
speciﬁc animal virus genes mutate to allow the surface proteins receptors to change shape
and be compatible with human surface proteins. The ﬁnal result may produce a more
virulent strain of the virus, one that may be asymptomatic in the animal reservoir but fatal
to humans. Hantaviruses do not cause overt disease in their reservoir hosts and the
rodents remain asymptomatic during their lifespan of carrying the virus. However, the
natural reservoir of SARS-COV has not been identiﬁed and the animal that may be
responsible for the cross-species transmission to humans is not known. Once more
knowledge is obtained about SARS and its natural reservoir; more risk factors for
prevention can be initiated. Also, the more research completed on speciﬁc viral

characteristics necessary for crossing the interspecies barrier from animals to humans, the

82

better understanding of various risk factors for disease and prevention measures for both

HPS and SARS.

83

Chapter 6

PUBLIC HEALTH OUTBREAK MEASURES

Determining public health strategies to control disease outbreaks is an essential
component of epidemiology. Human experience with SARS is new, but is likely to recur,
and the strategies used in the ﬁrst outbreak were not optimal. An overview of the more
extensive experience with HPS may help to develop and implement sufﬁcient public
health responses to any future SARS outbreaks.

6.1 OUTBREAK INVESTIGATIONS
Laboratory Handling

As mentioned in Chapter 3, the ﬁrst suspicion of HPS was traced to the
observations of an IHS clinician in the southwestern portion of the United States. After
record of 4 cases of similar unknown respiratory illness, extensive investigations began
involving CDC epidemiologists and local healthcare professionals. During the process of
sending samples to the CDC laboratories for investigation, biosafety became an important
consideration. A biosafety level refers to a speciﬁc combination of work practices, safety
equipment, and facilities which are designed to minimize the exposure of workers and the
environment to infectious agents [86]. The biosafety levels are as follows [87]:

0 Level 1 (no or very low individual or community risk) -— This level applies to
microorganisms that do not ordinarily cause human disease.

0 Level 2 (moderate individual risk, low community risk) -- This level is
appropriate for pathogens that can cause human or animal disease, but is unlikely
to be a serious hazard to laboratory workers, the community, livestock, or the

environment. If laboratory exposure occurred, serious infection may result, but

84

effective treatment and preventive measures are available and the risk of infection

spread is limited.

0 Level 3 (high individual risk, low community risk) -- This level applies to
pathogens that usually cause serious human or animal diseases, but do not
ordinarily spread from one infected individual to another. Effective treatment and
preventive measures are available.

0 Level 4 (high individual and community risk) -- This level applies to pathogens
that usually cause serious human or animal diseases and that can be readily
transmitted from one individual to another, directly or indirectly. Effective
treatment and preventive measures are NOT usually available.

By June 4 2003, the serologic tests that were conducted by the CDC provided the
ﬁrst lead to the disease etiology, showing antibodies cross-reactive with recognized
hantaviruses. The serum used was obtained from a patient meeting the initial case
deﬁnition [61]. In only a few months, the hantaviral etiology of HPS was identiﬁed,
illustrating the potential of the modern molecular biology and epidemiology when
applied within a multidisciplinary approach to a new disease.

Laboratory transmission of hantaviruses from rodents to humans via the aerosol
route is well documented [88]. Viral antigens have been detected in necropsy specimens,
including tracheal aspirates, bronchial washings, blood, and plasma. Therefore, exposure
to fresh necropsy material, rodent excreta, and animal bedding are associated with HPS
risk. Other routes of laboratory infection include ingestion, contact of infectious
materials with mucous membranes or broken skin, and animal bites [88]. Biosafety level

2 facilities are recommended for laboratory handling of sera from persons potentially

85

infected with hantavirus. Any potentially infected tissue is to be handled in level 2
facilities in accordance with level 3 practices. Any large-scale growth of the virus should
be performed in a biosafety level 4 laboratories. For experimental purposes, infected
rodent species known not to excrete the virus can be housed in animal biosafety 2
facilities. Because of the virulent nature of the HPS agent and since animal to human
transmission can occur, persons working with the natural host species should take special
precautions [88]. These recommended guidelines are based on the current knowledge of
HPS. Revisions may be necessary in the future as epidemiologists learn and understand
more Specific components of risk reduction for HPS.

As mentioned in Chapter 1, SARS emerged in the southern province of
Guangdong in November 2002, but the worldwide epidemic was triggered in late
February 2003 when an ill physician infected several other guests at a hotel in Hong
Kong. The WHO implemented biosafety level 2 and level 3 guidelines for the handling
of SARS clinical specimens and materials derived from laboratory investigations [89].
As with the initial HPS outbreak, modern technology in the epidemiological investigation
of SARS became an essential component in rapidly identifying the etiological agent in
less than two weeks and the implementation of control measures that contained the
outbreak within about four months.

Biosafety levels of prevention reinforced for SARS were similar to HPS.
Activities such as routine diagnostic testing of serum and blood samples, examination of
cultures, and packaging of specimens for transport are a few examples of SARS
investigations in biosafety level 2 facilities. Activities that are performed in biosafety

level 3 facilities include viral cell culturing of SARS-CoV, any manipulations involving

86

growth or concentration of SARS-CoV, inoculation of animals for potential recovery of
SARS-COV samples, and any protocol involving animal inoculation for conﬁrmation
and/or characterization of putative SARS agents [89].

The important distinction in laboratory handling between HPS and SARS is in the
level of public health concern if an incident occurred. Effective HPS laboratory
handling beneﬁts the individual by decreasing risk to a pathogen that has a high mortality
rate. In comparison, since SARS is transmitted person-to-person, laboratory handling is
extremely important for the individual, colleagues, and personal contacts. A laboratory
incident case of HPS would not be as problematic to public health as a laboratory
incident case of SARS, thus producing more stringent guidelines. However, both
infectious diseases should be handled with caution and under the strict guidelines of
biosafety implemented by the WHO and CDC.

Professional Education

During the time period of the initial recognition of HPS in 1993, the CDC focused
educational efforts on educating medical and public health professionals. Since the
disease was newly recognized, physicians, nurses, and epidemiologists needed
information about the disease; therefore, the ﬁrst educational material was targeted to this
speciﬁc group of people. Some of the educational programs initiated included [68]:

0 Comprehensive educational/informational videos established

0 Educational activities including training courses for state public health
laboratories on diagnostic testing and an audio conference for health care
workers, epidemiologists, and pathologists

0 Internet site development

87

o HPS educational material provided by request for healthcare facilities

0 Developed and promoted a HPS video in English and Spanish

0 Initiated a telephone hot line to answer general public questions about

HPS
In the case of SARS, which was not publicly announced by the Chinese
government until April 20, 2003 [90], the education of healthcare workers seemed
substantially delayed. Transmission of SARS in the healthcare setting was a major
epidemiological component in the spread of SARS during the 2003 global outbreak,
unlike HPS which has shown rare nosocomial transmission. Despite this fact, it is
important with any newly emerging/recognized disease to prioritize education to
healthcare workers for thorough control and prevention. This speciﬁc aspect of public
health would strongly shadow the education of HPS; however, since SARS represents
person-to-person transmission there would be some clear additional considerations.
SARS education in China did not ofﬁcially begin until April 18,2003 [90], ﬁve

months after the emergence of the new disease. This distinction may be attributed to the
fact that a substantial proportion of SARS cases resulted from delays in clinical
recognition and isolation of patients [91]. Once the education of healthcare workers was
prioritized, training began through in-person course instruction, videotapes, and printed
materials on the management of patients with SARS, infection control, and the use of
personal protective equipment. These speciﬁc educational strategies used for SARS are
comparable to HPS and should be a “gold standar ” for any new disease outbreak

investigation.

88

SARS presented more complications in training than HPS since the mode of

transmission primarily involved person-to-person. Therefore, additional education was

necessary for those healthcare workers involved with the SARS outbreak. For example,

the following are additional educational and preventive measures for healthcare workers

treating SARS patients [90, 91]:

Early detection and isolation of SARS cases through clinical and epidemiological
characteristics. This would include a thorough history of the patient by healthcare
workers to distinguish a SARS case from other respiratory illnesses. Rapid
decision making is essential to eliminate spread.
Educate healthcare workers on the risk of exposure to SARS-COV and the
importance of reporting personal illness or exposure to eliminate spread of disease
to patients and other healthcare workers.

Personal protective equipment required 2 or 3 sets of gowns, gloves, and masks,
in which the outer layer was to be removed and disposed after contact with each
SARS patient. Goggles were also required.

Education on basic infection control practices in the healthcare facility.

Patient education on proper hygiene/cough etiquette practices to help decrease
the transmission of respiratory droplets.

Isolation of possible SARS cases in the healthcare setting on a designated ward

0 Capacity of rooms and units sufﬁcient to house SARS patients
Education on cleaning and disinfecting environmental surfaces within healthcare

settings.

89

0 Education on proper use of ventilators, nebulizers, endotracheal intubation, and
other droplet and aerosol generating devices and procedures to eliminate rate of
transmission of SARS in the hospital setting.

0 Education on special handling of medical waste, textiles, or eating utensils has
not been recommended since the SARS-CoV has not currently been implicated as
spreading by these means.

The use of personal protective equipment (PPE) is an important aspect of SARS
control and prevention, which deserves special attention. From a hospital perspective, it
becomes important to classify respiratory diseases (i.e. airborne, contact, droplet, etc.) in
order to determine the type of PPE necessary to protect healthcare workers and patient
contacts. Looking at the use of PPE from the hospital perspective is very practical since
SARS was important within the healthcare setting.

A case-control study on 458 staff (127 SARS cases and 331 controls) was
completed to evaluate the effectiveness of respiratory and standard precautions in a multi-
centre study in Hong Kong, China. The ﬁndings showed those with an intervention of
only a N95 mask (represents government efﬁciency rating blocking about 95% of
particles 0.3 microns in size or larger) 85.8% of cases were infected compared to 99.4%
of controls. In comparison, those with an intervention of an N95 mask, gloves, gown,
and hand washing showed 40% of cases infected and 81% of controls. These ﬁndings
showed that the risk of infections was associated with the length of stay of patients with
SARS and that infection control, including PPE use, must be used rigorously to prevent

transmission of SARS-COV. Therefore, the use of PPE becomes an important aspect for

90

SARS and more research should be completed to understand the best techniques
necessary for prevention within the hospital setting.

The basic educational strategies initiated for HPS and SARS for healthcare
workers is comparable; however, any disease like SARS that involves person-to-person
transmission naturally requires more thorough standards for educating the healthcare
professionals that will come in contact with these patients. These educational strategies
are important for prevention of disease not only for the healthcare worker and hospital
patients, but also for the surrounding community.

Surveillance

Surveillance is a crucial public health component that aids with understanding the
trends in incidence and distribution of disease, helping to initiate proper planning of
prevention strategies. During the outbreak of HPS in 1993, there was no computerized
surveillance system in existence for reporting cases since the disease was previously
unrecognized. As a result, the CDC initiated a toll-free telephone hotline number for the
public. The purpose of the hotline was to serve as a passive system for reporting
suspected cases of HPS and to provide updated information about HPS [92]. The
national surveillance technique through this passive phone based system was successful
in quickly identifying the widespread sporadic geographic distribution of the newly
identiﬁed HPS throughout the United States. This system emphasized the need for
physicians and other health care workers to include HPS in the differential diagnosis of
unexplained ARDS.

The reports received through the surveillance system helped to identify one third

of all conﬁrmed cases of HPS detected in the United States through December 31, 2003

91

[92]. About 7.5% of suspected HPS cases reported through the system tested positive for
Hantavirus infection [92]. The system also helped identify the earliest conﬁrmed cases of
HPS and allowed for the identiﬁcation of cases of HPS due to variant Hantavirus species.
The surveillance system proved to be quite beneﬁcial; however, a few limitations were
present. For example, the surveillance system may have underestimated the true number
of HPS cases, the system may experience a dependence on news media and overall public
interest, and indirect costs incurred were difficult to estimate [92]. Despite these
limitations, the surveillance system technique may be a useful tool for future outbreak
situations.

In the case of SARS, understanding the geographic diversity of cases becomes
essential in surveillance reporting strategies. Like HPS, a SARS informational 24-hour
hotline was provided [90]. At its peak, the hotline received 11,000 calls per day from
individuals interested in obtaining SARS information. Since SARS presented such a
serious global threat in 2003, it would have been interesting to see a surveillance geared
telephone hotline speciﬁcally initiated for detection of SARS cases. Anyone having
symptoms and epidemiological characteristics as mentioned nationally by the CDC could
have access to call the hotline and report necessary information. At the end of the
outbreak, a comparison of SARS cases reported through the telephone surveillance
system and through general surveillance techniques could have been utilized. This
information would be useful for public health to determine the efﬁciency of reporting
SARS cases through a telephone system. Unfortunately, the previous limitations

involved with the HPS telephone system would likely still exist for SARS case reporting.

The main limitations for a telephone based case reporting system for SARS
would be the quantity of calls since more people overall were affected by SARS than
HPS. SARS also presented more of a global threat than HPS; therefore a number of
people may have been frantic and more likely to falsely report illness and
epidemiological characteristics. Another problem remains in that SARS is very
commonly asymptomatic, unlike HPS in which asymptomatic infection is rare. For
control and prevention of SARS, this distinction warrants consideration since an
individual could still transmit disease if harboring the virus. Recommendations could be
initiated for those calling with likely illness of SARS, but not for those who weren’t even
aware they carried the virus. Despite these limitations, a telephone-based SARS reporting
and informational hotline may be beneﬁcial for future SARS situations.

Travel

Another important distinction between HPS and SARS is the impact on travel.
Since HPS has been shown to involve no or limited person-to-person spread, there
currently has been no restriction on travel to HPS areas. SARS, on the other hand,
creates serious problems for travel and the risk of spread from person-to-person forced a
recommended travel restriction to China during the outbreak. Therefore, the public
health approach for SARS travel surveillance is distinct from HPS. For transit
surveillance, fever checks were instituted at the Beijing airport, major train stations, and
71 roads connecting Beijing to other areas [90]. Infrared thermometers were used to
screen passengers followed by axillary thermometers on those found to be febrile on
screening. Of the approximately 14 million people screened at these sites, 12 probable

cases of SARS were identiﬁed [90]. If control measures had not been implemented

93

SARS would have spread rapidly through international travel, whereas HPS would not
likely spread by similar means since the mode of transmission is from rodents to humans.
6.2 OUTBREAK CONTROL
Risk Reduction
Eradication of the reservoir hosts of hantaviruses is neither feasible nor desirable
because of the wide distribution of sigmodontine rodents in the Americas and their
overall importance in the function of natural ecosystems. Potentially the most effective
approach for disease control and prevention is risk reduction through environmental
modiﬁcation and hygiene practices that deter rodents from colonizing the home and work
environment, along with safe clean up of rodent waste and nesting materials [81].
Initiating rodent control in and around the home environment is the primary
strategy in preventing HPS. CDC has issued recommendations for rodent-prooﬁng urban
and suburban dwellings and reducing rodent populations through habitat modiﬁcation
and sanitation. These speciﬁc recommendations are as follows [68, 69, 81, 93]:
Eliminate rodents and reduce the availability of food sources and nesting sites used by
rodents inside the home.
0 Keep food (including pet food) and water covered and stored in rodent-proof
metal or thick plastic'containers with tight-ﬁtting lids.
0 Store garbage inside homes in rodent-proof metal or thick plastic containers with
tight-ﬁtting lids.
0 Wash dishes and cooking utensils immediately after use and remove all spilled
food.

0 Dispose of trash and clutter.

94

Use spring-loaded rodent traps in the home continuously.

As an adjunct to traps, use rodenticide with bait under a plywood or plastic shelter

(covered bait station) on an ongoing basis inside the house.

Prevent rodents from entering the home. Speciﬁc measures should be adapted to

local circumstances.

Use steel wool or cement to seal, screen, or otherwise cover all openings into the

home that have a diameter _>_ ‘A inch.

Place metal roof ﬂashing as a rodent barrier around the base of wooden, earthen,

or adobe dwellings up to a height of 12 inches and buried in the soil to a depth of
6 inches.

Place 3 inches of gravel under the base of homes or under mobile homes to

discourage rodent burrowing.

Reduce rodent shelter and food sources within 1 00 feet of the home.

Use raised cement foundations in new construction sheds, barns, outbuildings, or
woodpiles.

When possible, place woodpiles 100 feet or more from the house, and elevate
wood at least 12 inches off the ground.

Store grains and animal feed in rodent-proof containers.

Near buildings, remove food sources that might attract rodents, or store food and

water in rodent-proof containers.

Store hay and pallets, and use traps or rodenticide continuously to keep hay free

of rodents.

Do not leave pet food in feeding dishes.

95

o Dispose of garbage and trash in rodent-proof containers that are elevated at least

12 inches off the ground.

0 Haul away trash, abandoned vehicles, discarded tires, and other items that may
serve as rodent nesting sites.

0 Cut grass, brush, and dense shrubbery within 100 feet of the home.

0 Place spring-loaded rodent traps at likely spots for rodent shelter within 100 feet
around the home, and use continuously.

- Use an EPA-registered rodenticide approved for outside use in covered bait
stations at places likely to shelter rodents within 100 feed of the home.

In the case of SARS, the natural reservoir(s) of SARS-CoV or the species
responsible for the cross-species transmission to humans is currently not known. As
mentioned in Chapter 2, investigations of SARS focused around wild animals served as
exotic food in China implicating civet cats and raccoon dogs as SARS-CoV carriers.
However, other animals also were shown to harbor the virus. One of the key
epidemiological components of SARS still lacking is the possible “true” reservoir of the
virus. After the ﬁrst cases in 2004, China slaughtered a number of civet cats and raccoon
dogs with hopes of eliminating the source of exposure. However, until a clear
understanding of the reservoir is known, no extreme public health measures as mentioned
should be an option. Therefore, HPS’s primary prevention of risk reduction through
environmental modiﬁcation and hygiene practices that deter the reservoir ﬁ'om human
contact may not be suitable for a SARS unless the rodent reservoir hypothesis shows
further support. Focus for SARS control and prevention should include SARS

transmission in localized areas such as hospitals or households of SARS patients and

96

preventing global transmission through travel. Again, since SARS is a person-to-person
spread disease stronger public health measures are essential for controlling potential
outbreaks.
Quarantine and Isolation

Two important outbreak control measure essential for the control of the SARS
outbreak in 2003 involved isolation and quarantine of patients and contacts. The goal of
this public health measure was to separate those patients with the disease or those at
increased risk from those at lower risk [90]. Isolation is a commonly used practice in
modern public health and involves the separation of ill persons with a communicable
disease from those who are healthy. Quarantine is the separation or restriction of persons
who are not ill but who are believed to have been exposed to a communicable disease
[90]. Quarantine was developed in the 14th century but has been used rarely on a large
scale in the past century [94]. Quarantine does restrict some personal liberties, but
essentially is a collective action implemented in outbreak situations for the common
good. It is important that federal, state, and local ofﬁcials work closely in coordinating
quarantine actions at all levels of government. Also, it is essential for the government to
ensure that the public understands that quarantine may be a necessary public health
measure to prevent an infectious disease such as SARS, particularly when neither vaccine
nor antibiotics are available for treatment. The use of quarantine in the SARS outbreak
likely was an essential control measure in preventing additional cases. Unlike HPS,
SARS presented a high enough level of severity to justify initiating quarantine in some

areas. Currently, quarantine wouldn’t be considered or necessary for HPS since

97

transmission is from a rodent principal reservoir and is only minimally documented to
spread from person-to-person.
Cleanliness Procedures

Areas with any evidence of rodent activity (i.e. dead rodents, rodent excreta)
should be thoroughly cleaned to help reduce the possibility of exposure to hantavirus-
infected materials. Clean-up procedures should be initiated to help limit the potential for
aerosolization of dirt or dust from all potentially contaminated surfaces and household
materials and goods. Precautions are also necessary in affected HPS areas for cleaning
homes and buildings with rodent infestations. Anyone conducting these speciﬁc
activities should contact a local, state, or federal public health agency for speciﬁc
guidance. Any individual who is involved in the clean up process should have a thorough
orientation from a knowledgeable public health ofﬁcial about hantavirus transmission and
safety requirements. The following recommendations are below [68, 69, 81, 93]:

0 Persons involved in the clean-up should wear rubber or plastic gloves.

0 Spray dead rodents, rodent nests, droppings, or foods or other items that have
been tainted by rodents with a general-purpose household disinfectant. Soak the
material thoroughly, and place in a plastic bag. When clean-up is complete, seal
the bag, then place it into a second plastic bag and seal. Dispose of the bagged
material by burying in a 2 to 3 food deep hole or by burning.

0 After the above items have been removed, mop ﬂoors with a solution of water,
detergent, and disinfectant. Spray dirt ﬂoors with a disinfectant solution. A
second mopping or spraying of ﬂoors with a general purpose household

disinfectant is optional.

98

o Disinfect countertops, cabinets, drawers, and other durable surfaces by washing
them with a solution of detergent, water, and disinfectant, followed by an optional
wiping down with a general purpose household disinfectant.

o Rugs and upholstered furniture should be steamed cleaned or shampooed. If
rodents have nested inside furniture and the nests are not accessible for
decontamination, the furniture should be removed and burned.

- Launder potentially contaminated bedding and clothing with hot water and
detergent. Machine wash dry laundry on a high setting or hang it to air dry in the
sun.

SARS-COV, like HPS-causing viruses, can be inactivated by various chemicals.
Therefore, similar practices could be used for SARS control and prevention in potentially
contaminated areas such as healthcare facilities, apartment complexes implicated in
SARS clusters, and SARS patient households. The SARS-CoV is completely inactivated
by _<_5 minutes of exposure to 75% ethanol, 2% phenol, hypochlorite (500 ppm available
chorine), and household detergent [95]. Since the major mode of transmission of SARS-
CoV is exposure to droplets of respiratory secretions and possible contamination of
inanimate materials or objects by respiratory secretions or body ﬂuids (i.e. saliva, tears,
urine, and feces), it is important to consider implementing speciﬁc disinfecting
procedures for future outbreaks.

Occupational Exposure

Persons who frequently handle or are exposed to wild rodents are likely at a

higher risk of HPS than the general public since they have a higher frequency of

exposure. For example, persons include, but are not limited to, mammalogists, pest-

99

control workers, some farm and domestic workers, and building and ﬁre inspectors [69].

As a result, enhanced precautions as follows are warranted to protect these people against

HPS [68, 69, 81,91]:

A baseline serum sample, preferable drawn at the time of employment, should be
available for all persons whose occupations involve frequent rodent contact. The
serum sample should be stored at -20° C.

Workers in potentially high-risk setting should be informed about the symptoms
of the disease and be given detailed guidance on prevention measures.

Workers who develop a febrile or respiratory illness within 45 days of the last
potential exposure should immediately seek medical attention along with a blood
sample being drawn.

Workers should wear half-face air-purifying respirators when removing rodents
from traps or handling rodents in infected areas.

Workers should wear rubber or plastic gloves when handling rodents or handling
traps containing rodents. Gloves Should be washed and disinfected before
removing them.

Traps contaminated by rodent urine or feces or in which a rodent was captured
should be disinfected with a commercial disinfectant or bleach solution.

Persons removing organs or obtaining blood from rodents in affected areas should
contact the Special Pathogens Branch, Division of Viral and Rickettsial Diseases,
National Center for Infectious Diseases, Centers for Disease Control and

Prevention for detailed safety precautions.

100

Currently, insufﬁcient information is available to allow general recommendations
regarding risks or precautions for persons in the affected areas who work in occupations
with unpredictable or incidental contact with rodents or their habitats. For example,
telephone installers, maintenance workers, plumbers, electricians, and some construction
workers may enter various buildings or sited that have rodent infestations. These
recommendations are likely to be considered case by case after each working
environment has been assessed.

The SARS outbreak initiated an important nosocomial transmission pattern,
unlike HPS. The peak viral loads of SARS-COV were Shown to be reached at 12-14 days
of illness when patients were probably in hospital care, explaining why hospital workers
were more prone to infection [96]. Also, since the initial outbreak of SARS, two
laboratory incidents have occurred in which SARS cases were reported in Singapore and
China. Despite the differences in occupational risk for HPS, some fundamental HPS
prevention measures can be applied to SARS including:

0 Baseline serum samples collected for all employees involved in potential SARS-

CoV or SARS case contact

0 Healthcare workers and laboratory workers should be educated thoroughly about

SARS and be given strict guidance and prevention measures

0 Healthcare workers and laboratory workers developing SARS symptoms (i.e.
fever, respiratory illness, etc) should seek medical attention and inform local
health authorities if SARS is suspected. A blood sample should also be taken and

tested for SARS-CoV

101

Personal protective equipment for SARS will be slightly different than HPS.
During aerosol generating procedures, personal protective equipment is required
including a disposable isolation gown, a full body isolation suit (option), surgical
hoods, disposable gloves, and eye goggles.

Persons completing necropsies of SARS-COV infected animals should follow

detailed safety precautions recommended by the WHO and CDC

Outdoor Activities

Another at risk group for HPS is individuals engaged in outdoor activities such as

camping or hiking. The following are recommendations and precautions to help reduce

the likelihood of rodent exposure [68, 69, 81, 93]:

Avoid coming in contact with rodents, and rodent burrows or disturbing dens
(such as pack rat nests).

Do not use cabins or other enclosed shelters that are rodent infested until they
have been appropriately cleaned and disinfected.

Do not pitch tents or place sleeping bags in areas in proximity to rodent feces or
burrows or near possible rodent shelters.

If possible, do not sleep on the bare ground. Use a cot with sleeping surface at
least 12 inches above the ground.

Keep food in rodent-proof containers.

Promptly bury or burn all garbage and trash, or discard in covered containers.
Use only bottled water or water that has been disinfected by ﬁltration, boiling,
chlorination, or iodination for drinking, cooking, washing dishes, and brushing

teeth.

102

In the case of SARS, these speciﬁc precautions for HPS are not applicable since
the SARS reservoir(s) is currently unknown. Therefore, these activities would only
represent importance if the close contact with which you were hiking or camping had
SARS-COV or if you were exposed to the reservoir(s).

6.3 PUBLIC HEALTH AWARENESS

Surveillance activities are an important component contributing to overall
awareness of disease. There are a few key components that are important for
understanding HPS patterns in a community. First, consistent monitoring of hantavirus
prevalence in rodent populations may indicate warning of expected increases in the
number of human HPS cases [80]. Second, attention to environmental factors which may
indirectly increase the risk of hantavirus exposure may be an important component for
disease prevention [80]. For example, an increase in precipitation in 1992-1993 from El
Nino may have been a key factor for the increase in rodent numbers, hence HPS cases.

With surveillance activities initiated for HPS, general public health awareness of
risk can be determined. Health education programs for the public may be an essential
component to enhance recognition and management of HPS and to prevent cases by
reducing human contact with rodents. There are two key knowledge based areas that are
essential for recognition of HPS risks, involving both health care providers and the
general public.

First, early recognition of an HPS case may improve the patient’s chance of
survival; therefore, physicians and other health care workers play an important role in
early case identiﬁcation [68]. As a result, educational programs should be targeted to all

health care professionals focusing on the clinical features of disease, diagnosis, and

103

patient management and treatment. In order to maintain an active surveillance system
and develop effective community-based programs, other health professionals including
epidemiologists, laboratorians, and public health educators also should be educated on
the latest HPS research. These health professionals should have such information
available for the general public upon request.

Secondly, health education programs for the general public are essential for HPS
awareness and can be divided into two types [68]:
1. Prevention during nonoutbreak situations

Health education programs for the general public should focus on informing the
public about the disease, helping to identify personal risk factors, and providing

prevention recommendations.

2. Rapid response when there is a suspected HPS case

Once the risk factors associated with HPS transmission are determined and
preventative measures have been initiated, the population at risk can be targeted with
education materials and campaigns. Many materials and services can be utilized to
educate the public and health care professionals about HPS, including videotapes, slide
sets, print materials, intemet, mass media news coverage, public service announcements,
national campaigns, audio conferences, seminars, and telephone hot lines.

Public health awareness initiatives for SARS are both unique and parallel to HPS.
Since the recognition of HPS, cases have continued to occur sporadically, allowing for
speciﬁc surveillance procedures. However, since the SARS outbreak of 2003, SARS

cases have only occurred from laboratory incidents and it is not known whether SARS

104

will return in an outbreak pattern. The public health approach for this area of SARS
presents a gray area of understanding; therefore, it is difﬁcult to initiate speciﬁc
procedures. Until more knowledge is obtained about the possible pattern of SARS cases,
case reporting of individuals that present with similar symptoms may be a means to trace
the emergence of SARS in a speciﬁc community and initiate prompt isolation or control
procedures.

Another distinction from HPS is the focus of health education programs for SARS
knowledge. HPS programs focus on reducing human contact with rodents. However,
SARS procedures would include eliminating close contact with possible SARS cases or
known carriers of the SARS-COV. Early recognition of cases becomes an important role
for physicians to potentially break the chain of transmission to close contacts and other
hospital patients.

There are some fundamental parallel public health awareness measures initiated in
HPS that can also be applied directly to SARS if needed in the future. Targeting
educational programs to healthcare professionals, epidemiologists, laboratorians, and
public health educators becomes essential for these individuals to understand the latest
SARS research and features of the disease. The health education programs initiated for
HPS awareness for the general public are also important for SARS by integrating
prevention during nonoutbreak situations and rapid response if a SARS case is suspected.
The many diverse forms of materials and services used to educate the public on HPS
could also be integrated in SARS educational programs. These various strategies and

public health awareness techniques used in HPS in application to SARS in the future may

105

be beneﬁcial mechanisms to educate and motivate healthcare professionals and the public

to protect themselves, their families, and their community from the threat of SARS.

106

Chapter 7

DEF ICIENCIES IN SARS KNOWLEDGE

Despite current epidemiological investigations into the SARS outbreak of 2003,
there are still important deﬁciencies present in the overall SARS knowledge. Three key
epidemiological concepts that are important to understand more thoroughly involve the
possible seasonal pattern of the disease, the study of outlying incubation period values,
and the difference in SARS cases reported in the United States.

Currently, the number of newly reported cases of SARS in 2004 is insufﬁcient to
accurately determine any seasonal variation. The seasonality is important for two
reasons, recurrence of disease and the sporadic nature of cases. It’s important with any
disease to understand if speciﬁc seasons or months are more prone to producing cases of
disease or if the cases are sporadic in nature. With an understanding of seasonality,
public health measures and precautions can be implemented more predominately during
these time periods.

The incubation periods for SARS have produced some outlying values beyond 10
days. Currently, there have not been any thorough investigations addressing these
incubation period outliers. This is problematic since other coronaviruses have shown a
long right-tail incubation range. Therefore, it is feasible that SARS-COV may also Show
a similar pattern for the incubation period. Studies should consider these outlying values
primarily for the fact that if the SARS incubation period indeed includes a wider range,
public health practice and control techniques would change drastically.

The difference in secondary transmission of SARS in the United States is an

important consideration to understand particularly if application of prevention can be

107

utilized in other regions. In the United States, cases were mostly limited to those who
had traveled to SARS infected areas with limited spread to close contacts and health-care
workers. The difference in transmission may be explained by various levels of
surveillance and early detection procedures, however this distinction warrants more
understanding and assessment. If a public health measure was detrimental in decreasing
SARS transmission in the United States, it becomes essential to investigate these
practices and procedures for complete understanding of the possible SARS control
measures. An alternative hypothesis for the difference in SARS cases reported may be
that individual super-spreaders may not have been present in the United States. The role
of individual transmission of SARS in other countries, as mentioned previously, was a
detrimental factor in the transmission of SARS.

An important component lacking in SARS knowledge is related to the causative
agent of SARS. How long has the SARS-CoV been circulating in China and how has the
virus genetically evolved so uniquely from previous coronaviruses? The ﬁrst question is
difﬁcult to answer since the virus may have been present in animals asymptomatically
before it crossed over to develop into a human disease. The second question still
warrants some research and understanding, but one possible explanation is that once the
virus crossed the interspecies barrier to humans the virus may have genetically altered
itself for enhancing negative outcomes in the human host. If an individual is likely to
have symptoms of SARS, they are also at a higher risk of being admitted to the hospital
setting in which SARS transmission is enhanced. This idea may explain why SARS-COV
has a higher mortality rate and contagiousness than any other known human or animal

coronavirus. Is there an explanation why other human coronaviruses such as those that

108

are responsible for the human cold are not as severe? Likely, the transmission of these
viruses seems to depend on mobility of the host in comparison to speciﬁc settings for
SARS. However, more research is needed to fully understand and address these
questions.

The primary deﬁciency in SARS knowledge is the insufﬁcient identiﬁcation of
the natural reservoir of the disease or the species that may be responsible for the cross-
species transmission to humans. To date, a range of species have been shown to harbor
the virus including animals in the wild animal markets of China (Himalayan palm civet
cats, raccoon dogs), wild animals such as foxes, domestic cats, and ferrets. Studies have
also shown the virus to be promiscuous with capabilities not only of human-to-human
transmission, but also an animal-to-animal threat. The problem is that there are other
possibilities to consider related to the natural animal reservoir of SARS. First, one or
more animals in the wild may be the natural reservoir for SARS-COV. Second, the
animals investigated and shown to harbor the virus may simply have been infected from
another unknown animal source, which may be the true reservoir for the virus. With
these considerations, it seems unjustiﬁed that an estimated 10,000 civets were
slaughtered to prevent the spread of SARS, because the Chinese government was
initiating an effort to cut of the source of disease. Again, the question must be asked,
were the animals in China slaughtered without sufficient cause by the Chinese
government? This question can only be answered once knowledge of the true
reservoir(s) is obtained.

Another key distinction for SARS knowledge is the lack of understanding related

to the Amoy Gardens outbreak in China. The point-source nature and temporal and

109

spatial progression of SARS in the community is unlikely to have been distinctly caused
only by respiratory droplet and close contact transmission. There have been both
circumstantial evidence and speculation related to the possibility of a rat vector for this
speciﬁc SARS cluster. It is interesting that this speciﬁc SARS case group was more
severe than others, with more diarrhea, greater ICU admissions, and higher mortality.
For a complete parallel assessment of SARS to HPS, this piece of information is quite
necessary and could be important if the rat vector hypothesis is conﬁrmed through
investigations. However, the key point to this speciﬁc SARS deﬁciency is that SARS
investigators must explore all possible SARS reservoirs and transmission mechanisms to
have a thorough understanding for public health prevention.

A recent deﬁciency in the SARS knowledge stems from the previous SARS cases
reported in 2004. As mentioned in Chapter 1, investigation of the source of the current
SARS cases continues to focus on the National Institute of Virology in Beijing.
Investigations are still ongoing in the laboratory with the institute closed on April 23,
2004 with most of the staff quarantined for medical observation [97]. Interestingly, since
the SARS emergence in 2003, more than 50 laboratories in the United States and
elsewhere around the world have obtained samples of the SARS-COV from the United
States government [98]. This fact has been quite controversial among scientists as to
why the virus is so widely available, since the viral outbreak of 2003 is considered under
control? Concerning this, the CDC remarks that they are not exactly sure who has access
to the virus since it is currently not on the nation’s list of strict security rule organisms,
such as anthrax [98]. The WHO has strongly recommended that any work using the

SARS-COV be conducted in biosafety level 3 facilities. This precaution would help

110

minimize the risk of laboratory-acquired infections. More precise guidelines regarding
possession and handling of SARS Co-V are clearly necessary to prevent any unnecessary
transmission of SARS into the United States population or in any other region of the

world.

111

Chapter 8

FUTURE RECOMMENDATIONS FOR SARS FROM HPS
UNDERSTANDING

By examining both the parallel and the distinct aspects of HPS and SARS,
important conclusions have been formulated for applying the previous experience of HPS
public health responses to future SARS outbreaks. The following provides a summary of
these recommendations with additional comments for future consideration:

Detection of causative agent

0 Integrating the modern technology of molecular biology and epidemiology with a
multidisciplinary approach to a new disease, such as SARS, may be an integral
component for identifying the causative agent of the illness. With this
information, laboratory tests can be used to detect carriers of the virus in those
who are suspect SARS cases.

Laboratory handling/biosafety

0 Following biosafetly level 2 and level 3 guidelines for handling SARS clinical
specimens and any material derived from laboratory investigations may be an
important means for controlling an unexpected laboratory incident of SARS.

0 When a laboratory incident occurs, SARS produces a greater threat to the public
than HPS since it is transmitted from person-to-person. As a result, more
stringent guidelines for eliminating this possibility may be necessary.

For the future it may become important for public health ofﬁcials to restrict
access to SARS-COV. Currently, approximately 50 known laboratories in the United

States and elsewhere around the world have obtained samples of the SARS-CoV from the

United States government. Many ofﬁcials and researchers are questioning why the virus

is so widely available considering its potential global outbreak potential. Since SARS-

CoV is currently not on the list of strict security rule organisms (example: anthrax), the

CDC is not exactly sure who has access to the virus. Based upon this information

provided, it seems clear that there should be more precise guidelines regarding possession

and handling of the SARS-COV to prevent any unnecessary transmission of SARS in the

United State population or in other regions of the world. This statement is purely based

on the current understanding of the level of severity that SARS presents to the population

since spread primarily from person-to-person.

Health Professional Education

Since SARS was a newly emerging disease in 2003, the ﬁrst educational material
should have been targeted to health care professionals and epidemiologists instead
of being delayed for several months.

Education must be prioritized during similar outbreak situations to ensure optimal
control and prevention practices from all those directly or indirectly involved with
the situation.

A “gold standar ” of education for health care professionals and epidemiologists
should be implemented in the emergence or recurrence of an infectious disease
such as SARS. The “gold standar ” would be deﬁned as prioritizing training
beginning with in-person instruction course information, videotapes, printed
materials on the management of patients with the designated infectious disease,

infection control, and the proper use of any necessary protective equipment.

113

0 Since SARS is transmitted from person-to-person, additional education is

necessary, particularly since the healthcare setting presented a major

epidemiological component in the SARS outbreak. Important education for

SARS may include:

0

O

O

O

risk of exposure to SARS-CoV as a healthcare worker

importance of reporting personal illness to eliminate spread to patients and
other healthcare workers

use of personal protective equipment (PPE)

basic infection control procedures

proper hygiene/cough etiquette

quarantine/isolation procedures and practices

cleaning and disinfecting environmental surfaces

use of droplet and aerosol generating devices and proper procedures

communication within the healthcare setting

As mentioned in Chapter 6, addressing professional education practically from a

hospital perspective becomes extremely important for SARS since the healthcare setting

became an important area of risk. Two important additional recommendations to

condense are the use of personal protective equipment and communication within the

healthcare setting.

Creating a distinct classiﬁcation of respiratory diseases is essential for

determining the necessary PPE to use. A surgical mask simply does not provide adequate

respiratory protection to the healthcare worker if the infection is airborne. This is likely

due to the fact that basic surgical masks cover the user’s nose and mouth providing only a

114

physical barrier to ﬂuids and particulates. Within the healthcare setting a N95 mask
along with rigorous use of gloves, gowns, and hand washing seem appropriate for
prevention of SARS transmission. The distinction of the N95 surgical mask is that it is
ﬁtted to the users face, forming a seal that provides a physical barrier to ﬂuids, particulate
matters, and aerosols blocking about 95% of particles 0.3 microns in size or larger. By
following stringent guidelines for the use of PPE, not only is the healthcare worker
reducing risk of SARS infection for themselves, but they are also protecting their
personal contacts by eliminating a second and third generation of spread.

The second key component to address is communication within the hospital
setting. By following a proactive approach through communication between all
specialties and departments within the hospital, overall awareness is produced. For
example, if a physician from the emergency department has drawn blood from a
suspected SARS case, it is important for them to communicate to the laboratory workers
that they are sending such a sample. By addressing this information, the laboratory can
follow the necessary guidelines to protect from SARS-COV transmission. From a
hospital perspective understanding the importance of PPE usage and communication
among workers, one can produce the best possible outcome for prevention and control of
SARS.

Surveillance
o Integrate a passive surveillance system (telephone hotline), like that existing for
HPS, for reporting suspected cases of SARS and provide information to persons

on recommendations to help eliminate transmission among contacts.

115

0 Produce a comparison of passive surveillance system recorded cases to other
surveillance procedures to determine the effectiveness of this type of system for a
disease such as SARS. This technique may provide a means for future public
health measures.

The primary disadvantage of applying a passive surveillance system for SARS is
that the global spread resulted from a sentinel event, which typically wouldn’t be
appropriate for passive surveillance techniques.

Travel

0 Due to the global potential of SARS transmission, strict travel guidelines and
advisories are essential in future outbreaks to eliminate SARS internationally.

0 Transit surveillance may be a means to monitor the SARS situation within a given
region. The cost to beneﬁt ratio may become an important factor if SARS returns
at outbreak levels.

When addressing the issue of continuing transit surveillance for SARS, it
becomes important to develop a cost to beneﬁt perspective. Does the cost of maintaining
a transit surveillance system outweigh the beneﬁts of continuing such a system? From
the cost perspective, one would argue that to continue a system with costs of employees,
equipment, and organization is not practical or economically feasible since of the 14
million people screened at these sites, only 12 probable SARS cases were identiﬁed.
However, on the opposing side, the beneﬁt would be potentially eliminating the
possibility of a sentinel event of SARS producing a global spread as in 2003. It may only
take 12 probable SARS cases for a serious global threat to occur again, so the beneﬁt of a

transit system may outweigh the cost.

116

Both perspectives produce convincing arguments, however, an alternative is to

have a transit system initiated and guidelines to follow if SARS cases recur in the future.

For example, it likely is not cost effective to continue the transit surveillance of SARS

when no cases are being reported. However, if an area reports a single case, initiation of

the proposed transit system and guidelines should be initiated. From these

recommendations, both arguments are recognized and the most efﬁcient scenario

produced.

Risk Reduction

More research is essential to understand fully the natural reservoir(s) of SARS-
CoV and the species responsible for the cross-species transmission to humans.
With a more thorough understanding of the disease to human reservoir contact,
public health measures can be implemented to help break the chain of
transmission.

Limited extreme public health measures, such as killing a large number of civet
cats, should be initiated until more research is completed on the SARS-COV
reservoir(s). Any decisions to do so are likely to be under scrutiny by public
health ofﬁcials and the public since it seems that these actions are currently not
justiﬁed. However, this recommendation could be under scrutiny by those who
think that it is more important to consider all measures when human life is at risk.
Both arguments are essential to consider in this situation.

Using HPS’s primary prevention of risk reduction through environmental

modiﬁcation and hygiene practices may not be applicable to SARS unless the

117

rodent reservoir/carrier hypothesis shows further support or “until an animal
reservoir is clearly identiﬁed”.
Quarantine/Isolation

0 Federal, state, and local governments must work closely in coordinating any
quarantine actions as needed for SARS in the ﬁrture.

- Public education on quarantine is essential to aid with understanding that this
extreme public health measure may be a key component in preventing
transmission of SARS, as proven in the 2003 SARS outbreak.

Virus eradication

o Inactivation of SARS-CoV on environmental surfaces may be a necessary part of
future control and prevention strategies.

0 Guidelines for use of chemicals to inactivate SARS-CoV are important to
eliminate unnecessary contact with the virus.

Occupational exposure

0 Strict guidelines and prevention measures should be required for individuals with
an occupation that may put them at higher risk. Fundamental HPS prevention
measures can be effectively applied to SARS including:

o Requiring baseline serum samples of employees

0 Education and overall risk of SARS within the working environment

0 Blood sample taken if suspected of developing SARS

0 Personal protective equipment is slightly different than HPS, but should be
strictly enforced

Public health awareness

118

SARS public health strategies can strongly follow the lessons of HPS.

Target education programs to healthcare professionals, epidemiologists,
laboratorians, and public health educators in a timely manner providing the most
recent research and information on SARS.

Health education programs for the general public is essential, including
prevention during nonoutbreak situations and rapid response measures needed
when a SARS case is suspected.

Use a diversity of educational material to educate the public (i.e. videotapes, slide
sets, print materials, intemet, mass media coverage, public service
announcements, national campaigns, audio conferences, seminars, telephone
hotlines, billboards, advertisements, red neighborhood banners, etc.).

Provide the most accurate and recent SARS information to the public.

These recommendations include means for control and prevention of SARS in

future outbreak situations based upon the extensive experience of HPS in 1993. By

providing a parallel comparison of HPS and SARS, future knowledge can be acquired

and utilized. The process of examining two diseases in parallel for public health

practices proved to be a beneﬁcial strategy in various areas as reﬂected in the above

summary. However, the main limitation to this speciﬁc parallel comparison is the mode

of transmission associated with both diseases. An infectious disease like HPS transmitted

from a rodent host is clearly distinct from SARS, which is transmitted from person-to-

person. Also, SARS knowledge is still limited particularly with understanding the animal

reservoir(s). If the rat hypothesis produced further scientiﬁc or epidemiological support,

the parallel nature of the two diseases would be strengthened. The overall logic of

119

paralleling two diseases is supported from some of the similar public health control

measures recommended and may be considered as a future public health mechanism for

other newly emerging/identiﬁed diseases.

To summarize, it is important to illustrate some of the important lessons learned

from the SARS outbreak of 2003 [99-101]:

Infectious diseases remain a serious global threat.

An outbreak such as SARS requires attention in advance to clarity, collaboration,
communication, coordination, and capacity.

A global public health system is essential.

The SARS outbreak has likely better prepared the world’s public health
authorities for a major inﬂuenza or other similar pandemic.

The SARS epidemic produced a negative light on the Chinese public health
system and the consequences of suppressing health care information.

Global Operations proved important for containing an infectious disease like
SARS.

SARS reaffirmed the “moral center” [99] of the medical profession, meaning it
conﬁrmed health care worker’s ethical duty and obligation to care for sick
patients at risk of death regardless of their own personal risk.

Prompt use of isolation and quarantine was an integral part of SARS control in
various settings with extensive transmission, and these measures are acceptable if

appropriately explained.

120

0 Public health programs need speciﬁc communicable disease investigational units
and surveillance and technology information systems to ensure optimal outbreak
investigation facilities and technology.

0 Though some clinical features are suggestive of SARS; its signs and symptoms
overlap too much with those of other respiratory pathogens for ﬁrm diagnoses to
be made exclusively on a clinical basis.

0 Risk of exposure is essential to considering the likelihood of SARS as a diagnosis,
since SARS clinical features often overlap other respiratory pathogens.

These lessons learned from SARS may be important considerations if SARS were
to reappear with outbreak potential in the future. Continuing research on SARS and the
virus’s development into a serious human illness are key epidemiological components
that may become instrumental in any future SARS outbreaks.

In summary, there are several likely reasons for the size of the SARS outbreak in
2003 including: multiple imported cases, lack of knowledge about healthcare setting
spread, lack of awareness about proper use of personal protective equipment while
treating SARS cases, delays in hospitalizing patients with symptoms, the population
density of Beijing, and the failure to communicate the SARS problem to the public and
healthcare professionals earlier. With these disadvantages, the efﬁciency of outbreak
resolution was impressive to some extent. However, future recommendations, as listed
above from the parallel comparison of HPS and SARS, may produce even more

beneﬁcial outcomes if SARS recurs in the future.

121

Figure 1. Worldwide Epidemic Curve of Probable cases of SARS by week of onset
111

July 11

June 20

  
  

May 30
May 9
.r:
8
ﬂ .
E Aprrl 18
I!
3‘
o
_9 March 28
E
a Date
5 e
g % March 7
I: 7:
§ .8 s
In or 3 Feb 14
.92 g E
o N
g 3 '
2 January 24
g ‘1

ul

‘1 January3
q

1

'l

4 Dec 13
1

1

Nov 22

 

 

160 140 120 160 so 60' 40' 20' 0
Number of Cases

122

Figure 2. Worldwide Epidemic Curve of Probable cases of SARS by date of report
[102]

July 5

Jun 21

Jun 7

May 24

May 10
Date

Apr 26

 

Apr 12

Mar 29

 

Mar15

. . . . . . . , . Mar 1
400 350 300 250 200 150 100 50 0

 

Number of Cases

123

 

. .2052 up 20.3 839550

I

to, .0... =2... 2 .8.- 3.3550
.. I
«AVE 1. ,
. . . . :2...

3: egg

8 3882..
E «Ema:

_N: 353—. map .326 93$ "—39: nacN .e— 2:... 6232.53 p.030 03.395 he Loan—=2 0355550 "gm .m 0.53..—

124

Figure 4. China Epidemic Curve for Probable SARS Cases by Date of Report [102]

Jul 5

‘Jun 21

’Jun 7

 

May 24

May 10

Apr 26
Date

Apr 12

 

 

’Mar 29

’Mar15

I

Mar 1

Feb 15

 

 

Feb 1

 

600 560 460 360 2j00 160 0

Number of Cases

125

Figure 5. Probable cases of SARS in selected regions [1]

 

 

 

o
0“ Selected Regions

 

126

 

 

 

 

 

 

.8: 82:5; as. 2.50 a. 9.2 e «an:

127

Figure 7. Hong Kong, China Epidemic Curve for Probable SARS Cases by Date of
Onset [102]

~Jul7

’Jun 24

>Jun11

May 29

 

May 16

May 3
Apr 20
Date
Apr 7
Mar 25

Mar 12

Feb 27

 

Feb 14

 

' 'Febl
120 100 80 60 40 20 0

Number of Cases

128

Figure 8. Beijing, China Epidemic Curve for Probable SARS Cases by Date of
Hospitalization and Type of Exposure [13]

May 30

May 21
'May 7
April 30
April 23

Date
April 18

'April 9

.April 2

March 30
March 18
March 12

March 8

 

March 3

200 180 160140 120 100 80 60 40 20 0
Number of Cases
Open bars indicate healthcare workers without contact with a SARS patient; dark

bars indicate non-healthcare workers with contact with a SARS patient; light filled
bars indicate healthcare workers.

129

.
- JJ

 

 

 

Figure 9. Taiwan, China Epidemic Curve for Probable SARS Cases by Date of
Onset [102]

July 7

June 25

June 13

June 1

May 20

May 8
Date

April 26

April 14

 

April 2

March 21

"'f March 9

W Feb 25

' Feb13

 

Feb 1

 

36 2'5 2'0 1'5 1'0 '5

Number of Cases

130

Figure 10. Taiwan Geographic Distribution of Probable SARS Cases, 2003 [14]

 

Taipei . .
I >50 Taoyuan city Ta'Pe'
21—50
I 11—20
[I 1—10
0

Kaohsiung
county

 

Kaohsiung city

 

 

 

131

Figure 11. Canada Epidemic Curve for Probable SARS Cases by Date of Onset
[102]

_ July 7
_ June 24

,Junell

 

May 29

May 16

May 3

Apr 20

Apr 7

Date

Mar 25

Mar 12

Feb 27

 

Feb 14

. . . . . . . . . . .Feb 1
10 9 8 7 6 5 4 3 2 l 0
Number of Cases

132

Figure 12. Singapore Epidemic Curve for Probable SARS Cases by Date of Onset
[102]

July 7
'June 24

’June 11

,May 29
~May 16

_
’May 3

 

Apr 20
Apr 7

Date
Mar 25

Mar12

Feb 27

 

Feb 14

. . . . . . . . Feb 1
14 12 10 8 6 4 2 0
Number of Cases

 

133

Figure 13. Viet Nam Epidemic Curve for Probable SARS Cases by Date of Onset
[102]

' July 1

. June 16

_ Junel

'Mayl7

.May2

_Aprl7

"Apr 2
Date

.Mar18

 

Mar 3

 

 

l v I I 7 l I l I I rFeb 1
10 9 8 7 6 5 4 3 2 1 0
Number of Cases

 

134

Figure 14. United States Epidemic Curve for Probable SARS Cases by Date of
Onset [102]

July 7

June 20

June 3

May 17

April 30

April 13

March 27

Date

March 10

Feb 21

Feb 4

Jan 18

 

4 3 2 1 0
Number of Cases

135

Figure 15. Number of Probable SARS Patients Reporting Travel to Areas with
Community Transmission of SARS, by Date of Illness Onset, United States,
February 27 — May 7, 2003 [19]

 

 

14
12
,_ 10
3 8
§ 6
z 4
2
0
Feb 27- Mar 13- Mar 27- Apr 10-23 Apr 24—
Mar 12 26 Apr 9 May?
Date
I Mailahd China I HongKiong Cl Hanoi, Vietnam
:1 Singapore I Toronto, Canada

 

 

 

 

*N=61. The total number of visits to areas with documented or suspected community
transmission of SARS exceeds the number of probable SARS patients reporting travel
exposure because some patients traveled to two or more of these areas.

136

Figure 16. Structure of SARS-associated coronavirus (SARS-CoV) [ll]

 

137

Figure 17. SARS-associated coronavirus (SARS-CoV) and associated lesions in
macaque lungs [30]

 

Top Left: Virus particles re-isolated from nasal swabs of infected macaques display
typical coronavirus morphology

Top Right: Diffuse alveolar damage in the lung; alveoli are ﬂooded with highly
proteinaceous ﬂuid (arrowhead) that stains dark pink

Bottom: Several synctia (arrowheads) are present in the lumen of bronchiole and
surrounding alveoli

138

 

Figure 18. Timing of the Most Recent Common Ancestor of the Hong Kong SARS-
CoV [35]

2.4 — -
2.2 r
2.0 ‘
1.8

1.6
1.4 ._
Divergence
1.2 _
1.0 —
0.8 ~
0.6 ‘
0.4 ‘

0.2 “

 

 

0.0 1
July Sept

 

*The divergence of the sequence of ancestral sequence was plotted against sampling
time. The middle line represents the best-ﬁt line obtained by linear regression, and the
outside lines indicate the 95% conﬁdence intervals.

139

Figure 19. Proposed Mechanism of SARS-CoV transition from animals to humans
[1041

 

140

Figure 20. Himalayan palm civet and a Raccoon-dog [37]

Raccoon-dog

Himalayan palm civet

 

141

Figure 21. A 29-nucleotide deletion in human SARS-CoV compared to animals
SARS-CoV [44]

ORFIa

-‘-' " .. “Marya”. .7.» ‘. 3:. ,_:. i: .'

 

 

  

 

 

 

ORFlb
lkb 5 kb 10 kb 15 kb 20 kb 25 kb 30 kb
I l l l l l J
I l I l l l l
B
27700 27800 27900 28000 28100 22200
ORF 10 Orf 13
ORF 11
Human
Or! 13

Animal

- ORF 9 - ORF 10’

CCTA ('TTGCTTACCAACCTGAATGGAATAT

A. Genetic organization of SARS-CoV found in humans and animals. ORFs 1a and lb, encoding the
nonstructural polyproteins, and those encoding the S, E,M, and N structural proteins are indicated
(green boxes)

B. Expanded view of the SARS-CoV genomic sequence. ORFs for putative proteins and for N in
human isolates are indicated in brown and green boxes, respectively. An extra 29-nt sequence is
present downstream of the nucleotide of 27868 of the animal SARS-CoV. The presence of this 29-nt
sequence in animals isolates results in fusing the ORFs 10 and 11 (top) into a new ORF (bottom: light

blue box)

142

Figure 22. Phylogenetic Analysis of the Nucleotide Acid Sequence of the Spike Gene
of Human and Animal SARS-CoV [44]

74

63

Hku 65806

_— urbani

 

 

99

 

 

 

— GZOI

I GZ60
39 GZ43

—— SZ3

 

 

 

 

 

100

 

GZSO

 

90

 

5

143

 

_i 3213
9

tor2

Hku 38848
Hku 66078
Cuhk-wl

Hku 38871 Human

 

82]
Animal

 

SZl6

 

 

 

 

83m
use: 2a
8 .239:
Baas _

«350
9 p.295:
83:. N

Hogansm
9 E295.“
caucus m

9 88 .89: v

930 awn:—

moc_>o.i n can m 530

 

E55
8 .299;
cases _

azﬁmﬁ
8 53.5
835 2

a: 92m 2 22% 3:33.35 8 uses.— MS: as: a 2 .85 .e 8:35:29 gm .9 £25 a." as»:

144

Figure 24. Generational Transmission of SARS [12]

Second generation =
Close direct contact with health-care workers
Index case L (HCW) or others (family, visitors)
(ﬁrst generation)

_ Third generation = . Close
\V” Family members of HC W direct
contact
Fourth generation: 0 Environme
Other contacts in ntal
community factor,
Hong
Kong

145

 

 

Figure 25. Schematic for the new emergence of an infectious disease [51]

Introduction
from reservoir

 

. . 6 6 8 8

Transmlssmn 1' 1- 1-

in human

population 1'

f ‘l‘ ‘l’
'l'

Infections by:
Open Circle: Introduced ‘l' ‘l'
Strain (R0 <1)
Dark Circle: Evolved strain Emergence

*Introductions from the reservoir are followed by chains of transmission in the
human population. Infections with the introduced strain (open circles) have a basic
reproductive rate number Ro <1. The infections caused by the evolved strain can go

on to cause an epidemic. Daggers indicate no further transmission.

146

 

 

Figure 26. Secondary Cases of SARS by days to isolation of the source case,
Singapore, April 15, 2003 [l]

 

5-6 7-8 9+

4

 

 

Days from Onset to Isolation
LE Number of cases I Number of secondary cases]

 

 

 

 

147

 

 

Figure 27. Probable Cases of SARS by Source of Transmission in chain of 77 cases
in Beijing, 2003 [105]

Generation

 

 

148

 

 

Figure 28. Hantavirus Pulmonary Syndrome Cases by Region, United States, as of
January 6, 2004 (N=358) [71]

 

_x_L_x
ON-h

Number of Cases
0)

 

ONAO)

1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003
Year

 

 

 

149

 

 

Figure 29. Geographic Distribution of HPS Cases in the Americas [77]

90

  

Number of Cases of
Hantavirus
Pulmonary
Snydrome (HPS)

(North and South Americas,
1993—2004)

C] = No. cases
Total Cases = 1910

'mmmm.

150

 

 

Figure 30. HPS Cases in North and South America by Country, 1993-2004 [62, 67]

 

HPS Cases In the Americas

 

I Argentina
I Bolivia

 

 

1:] Brazil

I: Canada
I Chile

I Panama
I Paraguay
I Uruguay
I USA

 

Number of Deathe

 

 

 

Countries

 

 

 

151

Figure 31. Exposure Period in days before onset of 11 case-patients with well-
documented HPS exposures [70]

 

 

 
  
  

K

J
'5 I E] erio ofNo Exposure
2 H IExposure Period
0 G , .
2
g F
m E
g, D

C

B

A

0 510 15 20 25 30 35 40 45 50
Case Patient

 

 

 

152

Figure 32. Hantavirus Pulmonary Syndrome Cases by State of Residence, United
States, January 6, 2004 [71]

 

 

 

 

 

    
    

0 Cases
1-4 Cases
5-9 Cases
=10 Cases

 

ﬁll]!

153

Figure 33. New World Hantaviruses Geographic Distribution [77]

I .
,9 1? New World Hantavrruses
aﬁfkdx
Sin \mnhrl- A M.“ \ ”'1‘
i" v I’rmpccl Hill
\llrlcslruc

V Blumlluml Luke

ISIZI \Vi\lll ‘ . ' ”il\0ll
‘ g ‘ Iil:|c|\( rock (anal
lul \lurn ( zurum ~

,1
43:; Rio Segundo

(‘alallmlo ‘ _ .
, 3“, .lmlurlrlm
(‘zu‘m l)c|2;ulilo . lugunu \cgru
( hm‘lo ' ‘
Rio \lnmurc f \lzlcicl
()rz'm ;' ~ lluﬁ‘lhll-l
Berlin-[o l.(‘t‘|ll$_’ll:lll;|\

l’crgn mirm

89C

\lltit’\

 

154

Figure 34. Sin Nombre Virus [76]

 

155

Figure 35. Phylogenetic relation of the Adult Respiratory Distress Syndrome
(ARDS)- associated hantavirus from the Four Corners region to previous

 

 

 

 

 

 

characterized hantaviruses [106]

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

7
24 Lee Hojo
3 Hantaan
30
76-1 18
2
Bl
SR-ll
Seoul
R22
4
25
27 CG 1 8-20
15 23 Puumala
36 Solkamo
PHV-l
34 13 Prospect Hill
3 Case H
— Case A Hantavirus
5 Pulmonary
Syndrome

Phylogenetic analysis of the virus sequence differences within 241 bp of the ampliﬁed
fragment was performed by the maximum parsimony method. The horizontal distances
represent the number of nucleotide step differences (indicated adjacent to the lines)
present between branch nodes and taxa (that is, viruses). Bootstrap conﬁdence limits
exceeding 50% are indicated in ovals next to each branch node.

156

 

Figure 36. The Deer Mouse (Peromyscus maniculatus) [107]

 

157

Figure 37. Deer Mouse Population Range, United States, June 6, 2002 [81]

 

 

 

 

 

158

Figure 38. White-footed Mouse (Peromyscus Ieucopus) [107]

 

159

Figure 39. Cotton Rat (Sigmodou hispidus) [107]

 

160

 

 

Figure 40. Rice Rat (Oryzomys palustris) [107]

 

161

. A.

 

 

Figure 41. HPS Transmission Schematic

 

Hantavirus
infected rodent

Horizontal transmission of
infection by aggressive
behavior

   

Hantavirus present _ _

in aerosolized Virus Present 1n

excreta, mainly saliva and feces
urine

Secondary aerosols, mucous
membrane contact, and skin
breaches

 

162

 

 

Table 1. SARS Chronology of Events [6, 12]

 

Date

Key Events

 

Nov 16,
2002

Unusual atypical pneumonia documented in Foshan, Guangdong Province,
China.

 

Jan 2003

Outbreaks of pneumonia in Guanghou (capital ciy of Guangdong Province)

 

Feb 11

WHO receives reports of an outbreak of respiratory disease in Guangdong
Province: 305 cases and 5 deaths

 

Feb 12

WHO is informed that the outbreak in the Guangdong affected 6 municipalities.
Laboratory analysis is neggtive for inﬂuenza.

 

Feb 14

The Chinese Ministry of Health informs the WHO that the outbreak in
Guangdong

is clinically consistent with atypical pneumonia. Investigations rule out
anthrax, pulmonary plagu_e, leptospirosis, and hemorrhagic fever.

 

Feb 20

Fatal Inﬂuenza (H2N1 subtype) identified in family returning to Hong Kong from
Fujian Province, China.

 

Feb 21

65-Year-old Physician for Guangdong Province checks in at "Hotel M" in Hong
Kong (index patient); he has been ill since February 15. His health deteriorates
further; he is admitted to the hospital on February 22. He infects at least 17
other guests and visitors at the hotel, some of whom travel to Vietnam,
Singapore, and Toronto, where they initiate transmission of local clusters of
cases.

 

Feb 26

A Hotel M contact, a 48-year-old businessman, is admitted to a private hospital
in Hanoi and is the source of an outbreak there; 7 health care workers at this
hospital become ill by March 5.

 

Feb 28

Dr. Carlo urbane, a WHO ofﬁcial based in Viet Nam, observes several cases of
atypical pneumonia in the French Hospital, where he has asked to assist.

He informs the WHO Regional Ofﬁce for the Western Paciﬁc.

WHO moves into a heightened state of

alert.

 

March 1

26-Year—old former ﬂight attendant is admitted to a hospital in Singapore with
respiratory symptoms. She was a guest on the 9th ﬂoor of Hotel M in Hong
Kong.

 

March 4

A Hotel M contact, a 26-year-old local Hong Kong resident, is admitted to the
Prince of Wales Hospital in Hong Kong. By March 7, health care workers at this
hospital report a respiratory illness.

 

March 5

A Hotel M contact, an elderly woman, dies in Toronto; 5 family members are
affected.

 

March 7

Health care workers at the Hong Kong Prince of Wales hospital begin
complaints
of respiratory tract infections, promssing to pneumonia

 

 

March 8

 

Fourteen staff at the French hospital in Hanoi are ill with an acute respiratory
syndrome. A WHO team arrives to provide support.

 

163

 

 

 

Table 1 (continued). SARS Chronology of Events

 

March 10

At least 22 staff at the Hanoi hospital are reported ill with respiratory symptoms.
The Chinese Ministry of Health asks WHO to provide technical and laboratory
support to clarify the cause of the Guangdong outbreak.

 

March 12

WHO issues a global alert about cases of severe atypical pneumonia following
numerous reports of cases among staff in the Hanoi and Hong Kong hospitals.

 

March 14

Singapore and Toronto report clusters of atypical pneumonia. In retrospect,
both groups have an epidemiological link to Hotel M. During travel, symptoms
develop in on of the doctors who treated patients in Singapore; he is
quarantined in transit on arrival in Germany.

 

March 15

WHO has received reports of more than 150 cases of the new disease, now
named

Severe Acute Respiratory Syndrome (SARS). A travel advisory is issued.

WHO issues a travel advisory and is declaring SARS a "worldwide health threat".

 

March 17

WHO multicenter laboratory network established for the study of SARS causation
and diagnosis.

 

March 18

A cumulative number of 210 cases with 4 deaths are reported to WHO from
7 countries.

 

March 20

The cumulative total climbs to 306 cases with 10 deaths.

 

March 24

In Hanoi, WHO epidemiologists determine that 63% of SARS cases are in health
care workers. All can be linked to the index case at the French Hospital.

 

March 26

A WHO team reviews the case deﬁnition. The world cumulative total soars to
1323, with 49 deaths

 

March 27

A novel coronavirus is identiﬁed in patients with SARS by scientists from the
WHO.

 

March 28

China joins the WHO collaborative networks. Media reports describe SARS as
ggater threat than the war in Iraq.

 

March 30

Hong Kong health ofﬁcials announce a large and almost simultaneous cluster of
probable cases among residents in a single building in the Amoy Gardens
housing estate, pointing to a possible environmental source of exposure.

The cumulative @bal total reaches 1622 cases and 58 deaths.

 

April 2

WHO recommends persons planning to travel to Hong Kong and the
Guangdong Province considers postponing all but essential travel. Cumulative
total surpasses 2000 cases.

 

April 4

China begins daily electronic reporting of SARS cases and deaths,
nationwide by Province

 

April 9

WHO team in Guangdong Province presents interim report to the Ministry of
Health. Addressed concern of the capacity of some provinces to cope with
the health challenge posed by SARS due to lack of a strong health system.

 

 

April 12

 

Mapping of the full genome of SARS-associated coronavirus (soon called
SARS-CoV) is completed.

 

164

 

 

 

Table 1 (continued). SARS Chronology of Events

 

WHO announces that SARS-Gov is the causative agent of

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

April 16 SARS.

April 20 Chinese authorities announce 339 previously undisclosed cases of SARS,
bringyig the cumulative total of SARS cases in China to 1959.

April 23 WHO advises travelers to Beijing and Shanxi Province, China, and Tomato,
Canada to consider postponingall but essential travel.

Outbreak in Hanoi, Hong Kong, and Toronto show signs of

April 25 peakirLg.

April 28 Viet Nam becomes the ﬁrst country to contain its SARS outbreak. The
cumulative total surpasses 5000.

China, accounting for 3460 probable cases of the global SARS total of 5663,

April 30 now
has more cases than the rest of the world combined. WHO lifts its travel
advisory to Toronto.

May 2 Cumulative total surpasses 6000.

May 3 WHO sends team to Taiwan, which is now reporting a cumulative total of 100
probable cases.

May 7 WHO estimates that the case-fatality ratio of SARS ranges from 0%-50%
dependigg on the agggroup affected, with an overall estimate of 14%-15%.

May 8 Cumulative total of cases surpasses 7000, with cases now reported in 30
countries.

May 13 Outbreaks at the remaining initial sites show signs of coming under control,
indicatingﬂRS can be contained.

May 17 The ﬁrst global consultation of SARS epidemiology concludes its work.
Cumulative total of 7761 probable cases with 623 deaths. Of the total, 5209
cases and 282 deaths are reported from mainland China.

June A virus related to SARS-CoV is isolated from animals.

July 5 The absence of further transmission in Taiwan signals the end of the SARS

 

outbreak.

 

165

 

 

 

 

 

 

 

 

 

 

 

 
 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5.2-5F 5.2.2 o o O Na F F o 5.559.
“5.2-OF .m<-mN o o 0 85-8. 0.. m m o 55.8.
noHEN emu-NN o o o S F F o 255..
5.2.5 nmu-mN v 4F N .2-va F.. F; m w 8... .2...
.m<-ON .N-<-ON o o E F o F .0553 252
.m<-NN 5.2.3 o 04 N 25-835 5 v F 5.9555.
.93 .m<-o. o o o om F o F .533.
.915 5.2-NF o o o as F. n F :91
-va non
.m<-FF .38 o o o 35.3 S N N o 5.889..
5.2.5 .m<-mN o o o amaN N N m o 5.9..
5.2.5 5.2.5 F o 0 5-33 m n F. 55250
.52-». 5.2-FN N 3 F . FQMNO 9. F a F $5...
.925 ..m<-om o o o N F F o 95......
.m<-N .92 o o o 5N F o F 5.98.8
5..-? awn-mN 8 N 2: aN-NV 9. now mFm 95 53.3 5.....0
080.2
5.2.... 5.2-5 o o o N F F o 5.5.0
5.2-Fm emu-9 8.0. F com 39-8 9. mm: at Rm 9.8. 95:
SEN 32-8 NSF F 53. 9.5.55. NNS Eon. 9.2.5“. .555
cue-NF non-5N 8F NF FF. 85-: av FmN 8F FmF 55.50
.m<-m .9.-.” o o o v F F .555.
.m<-F 5.2-N o o o a? 5 5F 5 N F. 5.5.52
some case cognate
e339... New. 632.9... .2: 25: 2330 once: ou<
o
wow—50 3ND wouco san— uo hon—:32 AQLMn—U 53‘532 :2—35 _SOP 03: 22:0". na2<

 

 

5N. mgu K «mam—3. £9.35 «can A aoAEegz $5550 .3 gm he Sash. FEES—5 .N 03.:-

166

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2.2.8. N: 53 New .28

.94-: sou-5N mm m m aN-ONV 8 no N mm :52 ES

54.? .53 F o 0 85-8 8 8 NF 5F 8.9m 8......

.m<-F 5.2F 0 o 0 3-53 an F. N N E892

82.5

32-8 5.2-F F F NN N 82. NF. 5 F. m 95.5.:

5.2-5. 5.2.5 o o o 8 F F o 5.5.58.3

o o o 8 m N F .585

52-8 5.2-8 0 o o 8 F F 0 25mm

5.2-OF a?” 0 R: F No F F o 8...... 58m

SEAN 58-8 3 3 mm 69: mm 8N R FwF 5.2.59.5

25.2-5 32-5 0 o N F F o 5.83m
38 once touoota

22305 New. 0332.. «2... .50: mﬁaoo oacam eo<
O
uwmco 3ND uwmco 300 *0 nan—E32 Ae\ovmu_0 hush—:32 £550: _auoh. 2w: 29:0"— maah<

 

 

SN. 5ch .F .253. 29.8... NSN .F .3532 6.5.5 2.. gm 5 2.5 2.5555 82.230 N 2...;

‘-

m
/

Table 3. Summary of SARS Incubation Period Estimates [1]

 

 

 

 

 

 

 

 

 

Area Min Mean Median Max Comments
Canada 2 4.8 4.2 10 Based on 42 cases with a single
exposure to a source case. The
median
and mean were calculated using a
parametric ﬁt, while the minimum and
maximum are from the data.
People's 1 4 4 12 Based on 70 cases from Guangdong.
Republic 5 cases with an incubation period of
of >10
China days.
14 Beijingand Guangdong.
China, 6.37
Hong * (95% * ’ Based on 57 cases with one exposure
Kon ,
SARg CI to SARS over a limited time scale.
5.29-
7.75 Incubation period of <= 14.22 days in
95% of cases (parametric ﬁt)
China,
10- Based on household transmission
Taiwan * * * 14 studies
Singapore 1 5.3 5 10 Based on 46 cases with a single
exposure.
Viet Nam 5 6-7 * 10 Based on health care associated
exposure to a source case.
WHO 5 7.2 7 10 Based on two episodes (5 cases) with
European a single exposure to a source case.
Region

 

168

 

Table 4. Number of Cases and Deaths from HPS (Regions of the Americas), 1993-

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2004 [62, 67]
Country[93194195196197T98199100101[02103IMITohI
_A_rgentina
Cases 21 10 10 42 51 67 81 68 92 86 52 12 592
Deaths 1 1 1 1
Bolivia
Cases 3 1 1 7 6 2 1 5 8 1 1 4 36
Deaths 17
Brazil
Cases 3 1 3 1 1 26 58 71 73 75 321
Deaths 2 1 3 8 12 20 25 71
Canada
Cases 8 3 3 7 6 2 1 44 14 88
Deaths 0
Chile
Cases 1 3 3O 35 26 31 81 65 59 331
Deaths 18 20 1 1 12 29 17 17 1 24
Panama
Cases 3 21 5 2 4 35
Deaths 1 2 3
Paraguay
Cases 16 1 5 5 4 5 4 1 5 27 4 4 99
Deaths 2 1 1 O 2 2 5 13
Uruguay
Cases 2 3 12 8 4 9 1O 48
Deaths 1 2 1 1 O 3 5 13
USA
Cases 48 32 24 22 23 33 33 34 6 1 1 17 79 362
Deaths 132
Total
Cases 75 66 55 79 124 166 189 237 291 302 246 95 1910
Deaths 2 0 3 4 20 41 26 35 60 20 24 0 384

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

169

 

 

 

 

Table 5. Hantaviruses

 

Hantaviruses in the Old World
Subfamily Murlnae associated viruses

 

 

Virus Host Location Disease
Hantaan Apodemus agrarisu Asia. Far East Russia HF RS
Dobrave Apodemus ﬂavicollis Balkans HFRS
Apodemus agrarius Europe
Seoul Raltus norvegr'cus Worldwide HFRS
Rattus raltus
Subfamily Arvicolinae associated viruses
Virus Host Location Disease
Puumala Clethrionomysglareolus Europe HFRS
Hantaviruses in the New World
Subfamily Sigmodontinae associated viruses
Virus Host Location Disease
Sin Nombre Pemmyscus maniculatus West and Central US HPS
(deer mouse) and Canada
Monongahela Pemmyscus maniculatus Eastern US and Canada HPS
(white-footed mouse)
New York Pemmyscus leucopus Eastern US HPS
Bayou Oryzomys palustn's Southeastern US HPS
(n'ce rat)
Black Creek Canal Sigmodon hispidus Florida HPS
(cotton rat)
Andes Oligoryzomys longicaudatus Argentina and Chile HPS
Oran Oligorozomys longicaudatus Northwestern Argentina
Lechiguanas Oligoryzomys ﬁavescens Central Argentina
Hu39694 Unknown Central Argentina
Laguna Negra Calomys laucha Paraguay and Bolivia HPS
Bermejo Oligoryzomys chacoensis Northwestern Argentina
Juquitiba Unknown Brazil HPS
Choclo Oligongomys fulvescens Panama HPS

 

*other hantavinises have been identiﬁed but not linked to human disease in

these areas

170

 

 

 

10.

ll.

12.

13.

14.

15.

16.

17.

Bibliography

WHO, Consensus document on the epidemiology of severe acute respiratory
syndrome (SARS). 2003: p. 1-44.

Abdullah, A.S., et al., Lessons ﬁom the severe acute respiratory syndrome
outbreak in Hong Kong. Emerg Infect Dis, 2003. 9(9): p. 1042-5.

CDC, Epidemiology of SARS. Current Science of SARS Symposium, National
Microbiology Laboratory Winnipeg, Canada, 2003.

Chin, J ., Control of communicable diseases manual. 2000. 1:1

La Montague, J .R., et al., Severe acute respiratory syndrome: developing a 2
research response. J Infect Dis, 2004. 189(4): p. 634-4].

Peiris, J.S., et al., The severe acute respiratory syndrome. N Engl J Med, 2003.
349(25): p. 243141. U

 

 

Groneberg, D.A., et al., Severe acute respiratory syndrome: global initiatives for
disease diagnosis. Qim, 2003. 96(11): p. 845-52.

ProMed, SARS woldwide: China suspected case. 2003.
CDC, Four possible SARS cases reported in China. 2004.
CDC, China reports ninth possible SARS case. 2004.

CMA, Consensus for the magagment of severe acute respiratory syndrome.
Chinese Medical Journal, 2003. 116(11): p. 1603-1635.

WHO, Severe acute respiratory syndrome (SARS): status of the outbreak and
lessons for the immediate future. 2003: p. 1-10.

Liang, W., et al., Severe acute respiratory syndrome, Beijing, 2003. Emerg Infect
Dis, 2004. 10(1): p. 25-31.

CDC, Severe acute respiratory syndrome: Taiwan, 2003. MMWR, 2003. 52(20):
p. 461-466.

CDC, Severe acute respiratory syndrome: Toronto, Canada 2003. MMWR,
2003. 52(23): p. 547-550.

CDC, Severe acute respiratory syndrome: Singapore, 2003. MMWR, 2003.
52(18): p. 405—41 1.

CDC, Update severe acute respiratory syndrome: United States, 2003. MMWR,
2003. 52(16): p. 357-360.

171

 

 

 

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

CDC, Severe acute respiratory syndrome: United States, 2003. MMWR, 2003.
52(17): p. 388-390.

CDC, Severe Acute Respiratory Syndrome, 2003. MMWR, 2003. 52(18): p. 411-
413.

CDC, Outbreak of severe acute respiratory syndrome: worldwide 2003. MMWR,
2003. 52(11): p. 226-228.

CDC, Revised US surveillance case definition for severe acute respiratory
syndrome (SA RS) and update on SA RS cases: United States and Worldwide,
December 2003. MMWR, 2003. 52(49): p. 1202-1206.

J M, L., A dictionary of epidemiology. International Epidemiological Association,
2001:p.93.

CDC, Severe acute respiratory syndrome. 2003.

Meltzer, M.I., Multiple contact dates and SARS incubation periods. Emerg Infect
Dis, 2004. 10(2): p. 207-9.

Zhonghua LX, X.B., Xue ZZ, Epidemiological features of severe acute
respiratory syndrome in Beijing. Beijing Health Bereau, 2003. 24(12): p. 1096-
1099.

WHO, Summary of probable SARS cases with onset of illness from November I,
2002 to July 2003. 2003.

Lopez, V., K.S. Chan, and Y.C. Wong, Nursing care of patients with severe acute
respiratory syndrome in the intensive care unit: case reports in Hong Kong. Int J
Nurs Stud, 2004. 41(3): p. 263-72.

Lau, J .T., Lau M, Yang X, SARS transmission, risk factors, and prevention in
Hong Kong. Emerg Infect Dis, 2003. 10(4).

Falsey, AR. and BE. Walsh, Novel coronavirus and severe acute respiratory
syndrome. Lancet, 2003. 361(9366): p. 1312-3.

Fouchier, R.A., et al., Aetiology: Koch 's postulates fulﬁlled for SARS virus.
Nature, 2003. 423(6937): p. 240.

Lai, M.M., SARS virus: the beginning of the unraveling of a new coronavirus. J
Biomed Sci, 2003. 10(6 Pt 2): p. 664-75.

Goldsmith, C.S., et al., Ultrastructural characterization of SARS coronavirus.
Emerg Infect Dis, 2004. 10(2): p. 320-6.

172

 

 

 

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.
47.

48.

49.

Kuiken, T., et al., Newly discovered coronavirus as the primary cause of severe
acute respiratory syndrome. Lancet, 2003. 362(93 80): p. 263-70.

Guan, Y., et al., Molecular epidemiology of the navel coronavirus that causes
severe acute respiratory syndrome. Lancet, 2004. 363(9403): p. 99-104.

Zeng, F., K.Y. Chow, and RC. Leung, Estimated timing of the last common
ancestor of the SARS coronavirus. N Engl J Med, 2003. 349(25): p. 2469-70.

Low, DE. and A. McGeer, SARS--ane year later. N Engl J Med, 2003. 349(25):
p. 2381-2.

Field, H., The role of animals in the transmission of SARS. Global Conference on
SARS: Kuala Lumper, Malaysia, 2003.

Hansen, G.R., et al., Emerging zoonotic diseases. Emerg Infect Dis, 2001. 7(3
Suppl): p. 537.

A., B., SARS evolved into human disease 'within months '. Guardian Newspapers
Limited, 2004.

ProMed, SARS worldwide etiology. Science, 2003.

Enserink, M. and D. Normile, Infectious diseases. Search for SARS origins stalls.
Science, 2003. 302(5646): p. 766-7.

CDC, Prevalence ofIgG antibody to SARS: associated coronavirus in animal
traders, Guandang Province China, 2003. MMWR, 2003. 52(41): p. 986-987.

Zheng, B.J., et al., SARS-related virus predating SARS outbreak, Hang Kong.
Emerg Infect Dis, 2004. 10(2): p. 176-8.

Guan, Y., et al., Isolation and characterization of viruses related to the SARS
caronavirusﬁam animals in southern China. Science, 2003. 302(5643): p. 276-8.

Normile, D., Infectious diseases. Viral DNA match spurs China 's civet roundup.
Science, 2004. 303(5656): p. 292.

Parry, J ., WHO queries culling afcivet cats. ij, 2004. 328(7432): p. 128.
ProMed, SARS worldwide animal reservoirs. 2004.

Martina, RB, et al., Virology: SARS virus infection of cats and ferrets. Nature,
2003. 425(6961): p. 915.

Jernigan, J .A., D.E. Low, and R.F. Heﬂand, Combining clinical and
epidemiologic features for early recognition ofSARS. Emerg Infect Dis, 2004.
10(2): p. 327-33.

173

 

 

50.

51.

52.

53.

54.

55.

56.

57.

58.

59.
60.

61.

62.

63.

64.

65.

66.

Low, D.E., Why SARS will not return: a polemic. Cmaj, 2004. 170(1): p. 68-9.

Antia, R., et al., The role of evolution in the emergence of infectious diseases.
Nature, 2003. 426(6967): p. 658-6].

Bull, J. and D. Dykhuizen, Virus evolution: epidemics-in-waiting. Nature, 2003.
426(6967): p. 609-10.

Fowler RA, C.G., Lapinsky SE, Sibbald WJ, Louie M, Tang P, Simor A, Stewert
T, Tranmissian of severe acute respiratory during intubation and mechanical
ventilation. American Thoracic Society, 2004.

Gopalakrishna, G., et al., SARS transmission and hospital containment. Emerg
Infect Dis, 2004. 10(3): p. 395-400.

Isakbaeva, E.T., et al., SARS-associated coronavirus transmission, United States.
Emerg Infect Dis, 2004. 10(2): p. 225-31.

Peck, A.J., et al., Lack of SARS transmission and US. SARS case-patient. Emerg
Infect Dis, 2004. 10(2): p. 217-24.

Ng, S.K., Possible role of an animal vector in the SA RS outbreak at Amoy
Gardens. Lancet, 2003. 362(9383): p. 570-2.

Lau, J .T., eta1., Probable secondary infections in households of SARS patients in
Hong Kong. Emerg Infect Dis, 2004. 10(2): p. 235-43.

ProMed, SARS worldwide: China transmission. N Engl J Med, 2004.
CDC, All about hantaviruses: general information. 2003.

Hughes, J .M., eta1., Hantavirus pulmonary syndrome: an emerging infectious
disease. Science, 1993. 262(5135): p. 850-1.

PAHO, W., Hantavirus. Subcommitee on planning and programming of the
executive committee, 1997. 29th Session: p. 1-14.

CDC, All about hantaviruses: technical information. 2003.

CDC, Case information: Hantavirus pulmonary syndrome case count and
descriptive statistics as of January 6, 2004. 2004.

CDC, El Nino special report: Could El Nino cause an outbreak of hantavirus
disease in the southwestern United State? 2003.

Abramson, G. and V.M. Kenkre, Spatiatemporal patterns in the Hantavirus
infection. Phys Rev E Stat Nonlin Soft Matter Phys, 2002. 66(1 Pt 1): p. 011912.

174

 

llnl‘.1..lm

 

 

 

67.

68.

69.

70.

71.

72.

73.

74.

75.

76.
77.

78.

79.

80.

81.

82.

83.

PAHO, W., Number of cases and deaths from hantavirus pulmonary syndrome.
2004.

PAHO, W., Hantavirus in the Americas: guidelines for diagnosis, treatment,
prevention, and control. Pan American Sanitary Bureau, 1999.

CDC, Hantavirus infection: southwestern United States, interim
recommendations for risk reduction. MMWR, 1993. 42(RR-l 1).

Young, J.C., et al., The incubation period of hantavirus pulmonary syndrome. Am
J Trop Med Hyg, 2000. 62(6): p. 714-7.

CDC, Hantavirus pulmonary syndrome. 2004. 1

CDC, Hantavirus pulmonary syndrome: United States, 1999. MMWR, 1999. ,1
48(24). 1

Butler, J .C. and C]. Peters, Hantaviruses and hantavirus pulmonary syndrome. IL:
Clin Infect Dis, 1994. 19(3): p. 387-94; quiz 395.

Rowe, J .E., et al., Coexistence of several novel hantaviruses in rodents indigenous
to North America. Virology, 1995. 213(1): p. 122-30.

Rand, M.S., Hantavirus: an overview and update. Lab Anim Sci, 1994. 44(4): p.
301-4.

CDC, Hantaviruses. 2003.

CDC, Hantavirus pulmonary syndrome. Special Disease Pathogens Branch, 1998.

Marshall, B., Hantavirus outbreak yields to PCR. Science, 1993. 262(5135): p.
832, 834-6.

Schmaljohn, C. and B. Hjelle, Hantaviruses: a global disease problem. Emerg
Infect Dis, 1997. 3(2): p. 95-104.

 

McCaughey, C. and CA. Han, Hantaviruses. J Med Microbiol, 2000. 49(7): p.
587-99.

CDC, Hantavirus pulmonary syndrome- United States: updated recommendations
for risk reduction. MMWR, 2002. 51(RR-9).

CDC, Transmission details: So how does "aerosolization" really work? 2003.
Padula, P.J., et al., Hantavirus pulmonary syndrome outbreak in Argentina:

molecular evidence for person-ta-person transmission of Andes virus. Virology,
1998. 241(2): p. 323-30.

175

 

84.

85.

86.

87.

88.

89.

90.

91.

92.

93.

94.

95.

96.

97.

98.

99.

100.

Wells, R.M., et al., An unusual hantavirus outbreak in southern Argentina:
person-to-person transmission? Hantavirus Pulmonary Syndrome Study Group
for Patagonia. Emerg Infect Dis, 1997. 3(2): p. 171-4.

Wells, R.M., et al., Hantavirus transmission in the United States. Emerg Infect
Dis, 1997. 3(3): p. 361-5.

Richmond J Y, M., Biosafety in microbiological and biomedical laboratories. 5th
National Symposium on Biosafety, 1998.

WHO, Laboratory Biosafety Manual: 2nd Edition. Global Health Security, 2003.

CDC, Laboratory managment of agents associated with hantavirus pulmonary
syndrome: interim biosafety guidelines. MMWR, 1994. 43(RR-7).

WHO, WHO biosafety guidelines for handling SARS specimens. 2003.

Pang, X., et al., Evaluation of control measures implemented in the severe acute
respiratory syndrome outbreak in Beijing, 2003. Jama, 2003. 290(24): p. 3215-21.

CDC, Severe acute respiratory syndrome: public health guidance for community-
level preparedness and response. 2004.

Tappero, J .W., et al., Utility of emergency, telephone—based national surveillance
for Hantavirus pulmonary syndrome. Hantavirus Task F orce. J ama, 1996. 275(5):
p. 398-400.

CDC, Hantavirus illness in the United States. 1994.

CDC, Use of quarantine to prevent transmission of severe acute respiratory
syndrome: Taiwan, 2003. MMWR, 2003. 52(29): p. 680-683.

Tsang, T., SARS: environmental issues. Department of Health China, 2003.

Cheng, P.K., et al., Viral shedding patterns of coronavirus in patients with
probable severe acute respiratory syndrome. Lancet, 2004. 363(9422): p. 1699-
700.

WHO, SARS in China: investigation continues. 2004.

Regalado, A., McKay, Dozens of labs possess SARS virus, prompting concerns.
Wall Street Journal, 2004.

Emanuel, B.J., The lessons of SARS. Ann Intern Med, 2003. 139(7): p. 589-91.

Naylor, CO, C. Chantler, and S. Griffiths, Learning from SARS in Hong Kong
and Toronto. Jama, 2004. 291(20): p. 2483-7.

176

 

101.

102.
103.

104.

105.

106.

107.

Parashar, U.D. and L.J. Anderson, SARS preparedness and response planning.
Emerg Infect Dis, 2004. 10(2): p. 384-5.

CDC, SARS Case Distribution Curves. 2003.
China, Chinese Province. 2004.

Underwood A, K.A., Rosenberg D, The mystery of SARS. Newsweek Magazine,
2003.

Shen, 2., et al., Superspreading SA RS events, Beijing, 2003. Emerg Infect Dis,
2004. 10(2): p. 256-60.

Nichol, S.T., et al., Genetic identification of a hantavirus associated with an
outbreak of acute respiratory illness. Science, 1993. 262(5135): p. 914-7.

CDC, Rodents that carry the types of hantaviruses which cause HPS in the United
States. 2003.

177

 

   

Ilﬂlﬂ‘ﬂﬂiﬂlﬁﬂﬂlﬂ@111ij