.   ..r _ , 7‘ ‘4“.3 ”fl“
-- , .w. ‘~, ‘ . ‘ . «7* _ .3339; H ”-2: J:
. , .. . ' . , ‘5 -, {a ‘ ‘. > u}!-
‘ ‘ ' ' “3‘ V 3 . ' - V . 7 hi! ‘ -1, '
I . {x - 3) L ' ' ‘ '. ‘ . . ,‘N. i _ 5

a. aw? ’

 

     

“
:l
3

v

?

"’5“
I
‘.
3

5
J
r
?
1

-.;. .u 3”! v. .11

4-9:.”

4‘

in

 

This is to certify that the
dissertation entitled

QTL ANALYSIS OF RESISTANCE TO FUSARIUM ROOT ROT
IN ANDEAN BEAN POPULATIONS AND THE INFLUENCE OF
ROOT ARCHITECTURE ON DISEASE DEVELOPMENT

presented by
BELINDA ROMAN AVILES

has been accepted towards fulfillment
of the requirements for the

Ph.D. degree in Plant Breeding and Genetics-
Crop and Soil Sciences

QM; lap/a

/ Major Professor’s Signature /
a, [q 30 £009
/ ’ r

Date

 

MSU is an Affinnative Action/Equal Opportunity Institution

 

 

LIBRARY
Michigan State
University

 

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 c1ClRC/DateDuo.p65-p.15

 

QTL ANALYSIS OF RESISTANCE TO F USARI UM ROOT ROT
IN ANDEAN BEAN POPULATIONS AND THE INFLUENCE OF ROOT
ARCHITECTURE ON DISEASE DEVELOPMENT

By

Belinda Roman AviIés

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Crop and Soil Sciences

2004

ABSTRACT
QTL ANALYSIS OF RESISTANCE TO F USARI UM ROOT ROT

IN ANDEAN BEAN POPULATIONS AND THE INFLUENCE OF ROOT
ARCHITECTURE ON DISEASE DEVELOPMENT

By
Belinda Roman Avilés

Root rot, caused by the soil-borne fungus F usarium solani f. sp. phaseoli, is a
serious root disease of common bean (Phaseolus vulgaris L.). In the absence of effective
control methods, the use of resistant bean cultivars is the preferred strategy for the
management of root rot. The objectives of this study were: i) to characterize genetic
variation of root architecture in contrasting bean classes and identify root system
characteristics that may be related to root rot resistance; ii) to transfer F usarium root rot
resistance from small seeded black bean into highly susceptible large seeded Andean
kidney and cranberry bean; and iii) to identify QTL-marker associated with F usarium
root rot resistance in common bean.

Genetic variation in root architecture among common bean classes was highly
significant under field conditions compared to the greenhouse environment where
variation in root traits was minimal. Bean breeders interested in enhancing root rot
resistance and over all root health should focus on selecting for more lateral and
adventitious roots since these traits are relatively easy to quantify under field conditions
and for greater root dry weight in the greenhouse.

Two inbred backcross line (IBL) populations from crosses between small seeded

resistant and large seeded susceptible genotypes were developed. Continuous variation in

root rot frequency distribution was observed for both kidney and cranberry IBL
populations but a broader range of root rot scores were observed for the cranberry
population. Data suggest that root rot resistance in bean is under polygenic control and is
highly influenced by the environment. Heritability estimates ranged from 0.10 to 0.51 for
the kidney and from 0.30 to 0.82 for the cranberry IBL populations. Nine QTL,
significantly associated with F usarium root rot resistance in the field and greenhouse,
explained from 5 to 53% of the total phenotypic variability. QTL associated with root rot
resistance were located on linkage group B2 and B5 of the integrated bean map close to
previously identified QTL for resistance. Using a linear regression model a combination
of five markers accounted for 73% of the phenotypic variation for root rot resistance.
Data from the current study should provide breeders the opportunity to combine, through
marker assisted backcrossing, large effect QTL (R2>50) identified on different linkage

groups to enhance root rot resistance in common bean.

To my mother Josefina, my sister Isabel, and my two brothers,

Felipe and Heriberto for their love, support, patience, kindness, and understanding

iv

ACKNOWLEDGMENTS

I would like to acknowledge the many people who have contributed to this project
and my program. I would first like to acknowledge my family who are the most beautifiil
gifi God gave me and have supported me, unconditionally, thought all my college
education. To my best friends (Omayra, Kelrnadys, Carlos G., Maricelis, Carmen,
Leyda, Luis C., Luis D., Lorimar, Yanalyz, Jose, Marisol, Goran, Valera, and Meralis) I
would like to express my deep appreciation for their personal and intellectual support,
love, help, suggestions, and most important for not forgetting about me even though I’m
so far away from them.

To Dr. James D. Kelly, my major advisor, I would like to express my gratitude for
his guidance and patience. He has played an instrumental role in the development of my
professional career and will always be remembered as a great scientist. His
conceptualization of ‘Plant Breeding’ and his fine example as a continuous learner and
actively involved researcher are qualities that I greatly admire. I would like to express
my overwhelming gratitude to other members of my committee, Dr. Sieglinde Snapp, Dr.
Kenneth Poff, and Dr. William Kirk for their encouragement of my development as an
independent thinker, their thorough and constructive criticism of my work, their
generosity, understanding, trust, friendship, kind support and for being such wonderful
human beings. And, I am extremely grateful to Dr. Leigh A. White and Ramiro M.
Gonzales, two great professionals that had help me succeed and that without their
counseling and professional help I would have probably not made it through my graduate

program.

To Irvin and Romelia Widders, my deepest gratitude for their love and
unconditional support. Linda and James S. Beaver who had always been there for me
and are more than just role models and friends; the challenging discussions that we
always had, their encouragement of my independent thinking and deep honesty, will
always be with me deep in my heart.

To the bean group, Gerardine Mukeshimana, Veronica Vallejo, Norman Blakely,
Jerry Taylor, Bryan Long, Emmalea Ernest, Marcio Ender, Pat O’Boyle, and Halima
Awale, I would like to express my appreciation for your help. To Natalia de Leon there
are no words in this world that can express how grateful I am for all of what you have
done for me. Also the soybean breeding group and Dr. D. Wang, I would like to extend
my appreciation for all of their assistance in the analyses of my data. Last but most
important, my deepest love and gratitude to God for his unconditional love and for being
there for me when I needed him the most, for giving me the opportunity to fulfill one of
two dreams I’ve had in life, for the challenging trials that made me grow even more as an

individual, and for all the beautiful people that were put on my way to success.

vi

TABLE OF CONTENTS

LIST OF TABLES .................................................................................................... ix
LIST OF FIGURES ................................................................................................... xii
LIST OF ABBREVIATIONS .................................................................................... xv
CHAPTER 1
ROOT ROT CAUSED BY FUSARIUM SOLANI F. SP. PHASEOLI IN BEANS
(PHASEOL US VULGARIS L.): LITERATURE REVIEW ............................... 1
Introduction .................................................................................................... 1
Disease biology .............................................................................................. 3
Root traits as an approach for root rot resistance ........................................... 11
Breeding for F usarium root rot resistance (past and present) ........................ 14
Problems associated with inter-gene pool crossing ....................................... 19
Types of genetic markers ............................................................................... 23
Application of molecular markers to the study of quantitative traits ............. 28
Conclusion ..................................................................................................... 37
References ...................................................................................................... 41
CHAPTER 2
ASSESSING ROOT TRAITS ASSOCIATED WITH FUSARI UM ROOT ROT
RESISTANCE IN COMMON BEAN ..................................................... 57
Introduction .................................................................................................... 57
Materials and methods ................................................................................... 59
Results and discussion ................................................................................... 6S
' Conclusion ..................................................................................................... 76
References. ..................................................................................................... 77
CHAPTER 3
EFFECT OF DIFFERENT TEMPERATURE EXPOSURES OVER TIME ON
MYCELIA GROWTH OF F USARI UM SOLANI F .SP. PHASEOLI ................ 81
Introduction .................................................................................................... 81
Materials and methods ................................................................................... 83
Results and discussion ................................................................................... 86
Conclusion ............................................................................. 96
References ...................................................................................................... 99

vii

CHAPTER 4
INTROGRESSION OF FUSARIUM ROOT ROT RESISTANCE INTO LARGE
SEEDED BEAN AND THE IDENTIFICATION OF QTL ASSOCIATED WITH

RESISTANCE ................................................................................. 102
Introduction .................................................................................................... 102
Materials and methods ................................................................................... 105
Results and discussion ................................................................................... 120
Conclusion ..................................................................................................... 161
References ...................................................................................................... 169

GENERAL SUMMARY ..................................................................... 177

APPENDICES ........................................................................................................... 180

viii

LIST OF TABLES

Table 2.1. Characteristics of the common bean genotypes used to characterize bean roots
during the Summer 2002 ........................................................................ 60

Table 2.2. Bean class means for different root traits measured under greenhouse and field
conditions at Entrican, Montcalm County, MI during the summer 2002. ................... . 69

Table 2.3. F-values for kidney bean class in contrast with black, snap, and cranberry
bean classes for different root traits measured under greenhouse and field conditions at
Entrican, Montcalm County, MI during the summer 2002 .......................................... . 70

Table 2.4. Correlation coefficients (r) for root classes grouped in three categories,
average diameter, and total root dry weight for greenhouse study and one field trial
conducted during the summer, 2002 in Montcalm, MI ..................................... 74

Table 3.1. Analyses of variance for the dependent variable mycelia growth with two
factors (time and temperature), F-values and their respective level of significance. 87

Table 3.2. Radial grth means for F usarium solani f.sp. phaseoli within temperature
treatments at different exposure times ......................................................................... . 89

Table 3.3. Results fiom the pathogenicity test performed using the susceptible genotype
Montcalm and the genotype FR266 with partial resistance to F usarium root rot for
comparison purpose .............................................................................. 94

Table 4.1. Phenotypic description of the root vigor scale developed for the evaluation of
the genetic populations .............................................................................................. 113

Table 4.2. Analysis of variance for root rot ratings for the inbred backcross populations,
Red Hawk *2/ Negro San Luis (Kidney inbred backcross line population) and C97407
*2/ Negro San Luis (Cranberry inbred backcross line population) ..................... 122

ix

Table 4.3. Analysis of variance for root vigor ratings for the inbred backcross
populations, Red Hawk *2/ Negro San Luis (Kidney inbred backcross line population)
and C97407 *2/ Negro San Luis (Cranberry inbred backcross line population). . 123

Table 4.4. Means of the five lowest and five highest root rot scoring inbred backcross
lines for C97407 *2/ NSL population during the summer of 2002 and 2003 . . . . . 125

Table 4.5. Means of the five lowest and five highest root rot scoring inbred backcross
lines for Red Hawk *2/ NSL population during the summer of 2002 and 2003 ...... 126

Table 4.6. Heritability estimates :t standard errors of F usarium root rot ratings (scale 1 to
7) and root vigor ratings (scale 1 to 5)for Red Hawk *2/Negro San Luis (Kidney inbred
backcross line population) and C97407 *2/Negro San Luis (Cranberry inbred backcross
line population) populations evaluated during the 2002 and 2003 field trials... . 128

Table 4.7. Pearson rank correlation coefficients for means of F usarium root rot ratings
for the kidney inbred backcross line population for field (MRF and NYSAES) and
greenhouse experiments, days to flower, and root architecture ratings. The 2002 r values
are presented in normal print in the upper right-hand diagonal whereas the 2003 r values
are printed in bold in the lower lefl-hand diagonal......... 134

Table 4.8. Pearson rank correlation coefficients between means of Fusarium root rot
ratings for cranberry inbred backcross line population for field (MRF) and greenhouse
experiments, days to flower, and root architecture ratings. The 2002 r values are
presented in normal print in the upper right-hand diagonal whereas the 2003 r values are
printed in bold in the lower left-hand diagonal ............................................ 135

Table 4.9. QTL for resistance to root rot and agronomic traits, including phenotypic
variability associated with the QTL, marker interval, LOD score, and R values identified
on the Red Hawk *2/NSL population ...................................................... 143

Table 4.10. QTL for resistance to root rot and agronomic traits, including phenotypic
variability associated with the QTL, marker interval, LOD score, and R2 values identified
on the C97407 *2/NSL population ............................................................................ 144

Table A1. Root characteristics of bean genotypes harvested during the vegetative stage
of development .............................................................................. 181

Table A2. Mean values for length of root classes obtained under greenhouse
environment. ............................................................................................................ i. 183

Table B1. Root rot scoring and agronomic traits means of BC2F4 derived IBLs for the
C97407 *2/ NSL population at Montcalm, MI, during the summer of 2002.......... 185

Table BZ. Root rot scoring and agronomic traits means of BC2F4 derived IBLs for the
C97407 *2/ NSL population at Montcalm, MI, during the summer of 2003. ........... 189

Table B3. Root rot scoring and agronomic traits means of BC2F4 derived IBLs for the
Red Hawk *2/ NSL population at Montcalm, MI, during the summer of 2002. ....... 193

Table B4. Root rot scoring and agronomic traits means of BC2F4 derived IBLs for the
Red Hawk *2/ NSL population at Montcalm, MI, during the summer of 2003. Root rot
data collected at Geneva, NY. for the kidney IBL is also included for comparison. 198

Table D1. Illustration of the PCR amplification conditions for the DNA fragment of the
SCAR marker developed ...................................................................... 221

Table D2. SCAR marker developed from the Al 4 RAPD marker .................... 222

xi

LIST OF FIGURES

Figure 2.1. Illustration of differences between genotypes 30 days after planting under
field and greenhouse conditions for root traits. (Different letters on columns represent
statistical differences at P<0.05) ................................................................................. 66

Figure 3.1. Radial growth rate (mm/ day) at 20°C incubation temperature of F usarium
solam‘ f. sp. phaseoli after exposure to different temperatures for a range of durations; 24,
48, 72, 96 and 172 h. Mean values and standard error for each exposure duration within
each temperature were plotted .................................................................................... 88

Figure 3.2. Relationship between radial grth (mm) and exposure time (24 to 172 h)
for temperature treatments (10 to 30°C) on an isolate of F usarium solam' f. sp. phaseoli
on PDA agar. A summary of the regression analysis is shown on the table .......... 91

Figure 3.3. Illustration of the susceptible genotype Montcahn after two weeks of
inoculation with cultures of F usarium solani f. sp. phaseoli exposed to 10°C (left), 15 and
20°C (center), and 25 and 30°C (right ...................................................... 93

Figure 3.4. The graph shows: (A) the mean and range of daily temperatures over the
evaluation periods in 2002 and 2003 field trials at MRF and (B) shows the rainfall. The
inset graph is the difference in temperature between 2002 and 2003- 2002 had warmer
soil temperatures on equivalent days after planting. ................................................. 97

Figure 4.1. Diagram depicting development of inbred backcross line populations using
Red Hawk and C97407 as the recurrent parents and Negro San Luis as the donor
parent ............................................................................................ 107

Figure 4.2. Visual representation of the Fusarium root rot rating scale of 1 to 7, where
1= healthy root system with no discoloration of root or hypocotyl tissue and no reduction
in root mass and 7= pithy hypocotyl with much extended lesions, root mass is severely
reduced and is functionally dead ............................................................ 112

Figure 4.3. Visual representation of the root vigor rating scale previously described in
Table 4.1. ..................................................................................................................... 114

xii

Figure 4.4. Schematic of genetic expectations of inbred backcross line populations.
Although root rot is a quantitative character and our interest is to look at whole genome
the above diagram is represented as a single locus to illustrate the effect .............. 121

Figure 4.5. F usarium root rot score inbred backcross line population distribution for field
experiments conducted at Montcalm County: A. Kidney IBL population 2002, B.
Kidney IBL population 2003, C. Cranberry IBL population 2002, D. Cranberry IBL
population 2003 ................................................................................ 127

Figure 4.6. Illustration of partial linkage groups possessing selectively mapped QTL
conditioning resistance to F usarium root rot for the Red Hawk *2/NSL and C97407
*2/NSL inbred backcross line populations; with partial linkage groups co-integrated with
the integrated bean

map .............................................................................................. 138

Figure 4.7. Illustration of partial linkage groups possessing selectively mapped QTL
conditioning resistance to F usarium root rot for the Red Hawk *2/NSL and C97407
*2/NSL inbred backcross line populations; with partial linkage groups co-integrated with
the integrated bean map ....................................................................... 139

Figure 4.8. Illustration of partial linkage groups possessing selectively mapped QTL
conditioning resistance to F usarium root rot for the Red Hawk *2/NSL and C97407
*2/NSL inbred backcross line populations; both partial linkage groups remained
unassigned to the integrated bean map ..................................................... . 140

Figure 4.9. QTL identified using composite interval mapping on B5 for F usarium root rot
resistance in the kidney IBL population found in the A)-NYSAES2003 and B)-
Greenhouse—l environments. QTL position is shown with an arrow ................... 145

Figure 4.10. QTL identified using composite interval mapping on B5 for F usarium root
rot resistance in the kidney IBL population found in the A)-MRF2002 and B)-MRF2003
environments. QTL position is shown with an arrow ................................... 146

Figure 4.11. QTL identified using composite interval mapping for F usarium root rot
resistance in the cranberry IBL population found in the A)-MRF2002 (B5) and B)-
Greenhouse-2 (unassigned partial LG) environments. QTL position is shown with an
arrow ............................................................................................. 147

xiii

Figure 4.12. QTL identified using composite interval mapping for F usarium root rot
resistance in the kidney IBL population found in the A)-NYSAE82003 (B2) and B)-
Greenhouse-2 (unassigned partial LG) environments. QTL position is shown with an
arrow ............................................................................................ 150

Figure 4.13. QTL identified using composite interval mapping for F usarium root rot
resistance in the cranberry IBL population found in the Greenhouse-1 (unassigned partial
LG) environment. QTL position is shown with an arrow ............................... 153

Figure A1. Illustration of partial linkage groups generated in the current genetic study for
the cranberry and the kidney IBL populations for the QTL analysis ................... 184

Figure C1. Chinook 2000 is a light red kidney bean genotype released developed at
Michigan State University. This genotype was segregating for a very vigorous root
system and had a significant higher level of root rot resistance ......................... 208

Figure C2. FR266 is a bush snap bean developed by USDA/ARS. This genotype was
breed for root rot resistance with a determinate grth habit ........................... 209

Figure D1. Illustration of : (A). RAPD fragment amplification for the AJ4.350 that was
used for cloning, (numbers on columns indicate: 1= DNA 100bp ladder, 2 and 3 are lines
from the kidney IBL population, 4=Red Hawk, 5=Negro San Luis, 6=JaloEEP558; and
7=Bat93; white arrow shows the DNA fragment that was cloned from Red Hawk). (B).
The amplified fragment using the specific SCAR primer developed from the AJ4.350
RAPD, (numbers on columns indicate: 1: DNA 100bp ladder; 2,3,4, and 5 correspond to
Red Hawk, Negro San Luis, J aloEEP55 8, and Bat93 respectively) .................... 223

Figure E1. Breeding Plan for the marker-assisted backcrossing of Co-42 and I genes into
‘Tebo’ .............................................................................................. 230

xiv

 

AF LPs
AN OVA
AVG

BC
BJ

BSA

C:N
CA
CBB
CFU
ChS
cM
CV
DAP
DH
DL
DNA
DRK
DTF
DTM
f.sp.
GH 1
GH2

HW
IBLs

LG
LOD
LRK
LSD
MAS

MSU

“8

LIST OF ABBREVIATIONS

Amplified fragment length polymorphism
Analysis of variance
Average

Black bean

Backcross

BAT93 x J aloEEP558 RIL population
base pair

Bulk segregant analysis
Cranberry bean

Carbon to nitrogen ratio
California

Common bacterial blight
Colony F orming Units
Chalcone Synthase
Centimorgan

Coeficient of variation
Days after planting
Double haploid

Dwarf lethal
Deoxyribosenucleic acid
Dark red kidney

Days to flower

Days to maturity

Forrna speciales
Greenhouse evaluation 1
Greenhouse evaluation 2
Heritability estimate
Hybrid weakness

Inbred backcross lines
Kidney bean

Linkage group

Likelihood of the odds ratio
Light red kidney

Least significant difference
Marker assisted selection
Michigan

Minnesota

Montcalm Research Farm
Michigan State University
Nitrogen

nanograms

XV

NSL
NYSAES
PCR
PDA

PR
PvPRl
PvPR2
QTL

R2, :2
RAPD
RFLP’s

RILs

SCAR
SRAP
SSR
SW
TRAP

Near isogenic lines

Negro San Luis

New York State Agricultural Experiment Station
Polymerase chain reaction

Potato dextrose agar

Pathogenesis-related protein

Phaseolus vulgaris pathogenesis-related protein 1
Phaseolus vulgaris pathogenesis-related protein 2
Quantitative trait loci

Correlation coefficient

Coefficient of determination

Randomly amplified polymorphic DNA
Restriction fragment length polymorphisms

Red Hawk

Recombinant inbred lines

Snap bean

Sequence characterized amplified region
Sequence-related amplified polymorphism
Simple sequence repeat

100 seed weight

Target region amplification polymorphism

xvi

Chapter I

ROOT ROT CAUSED BY F USARI UM SOLANI F. SP. PHASE 0L1 IN BEANS
(PHASEOLUS VULGARIS L.): LITERATURE REVIEW

Introduction

Common bean is the most important grain legume used for direct human
consumption in Africa, the Caribbean, and Latin America where it provides a cheap
source of protein, calories, vitamins, fiber, and minerals for low-income populations
(Maiti, 1997; Jacobsen, 1999; Broughton et al., 2003). The demand for beans as a staple
protein diet has been growing, while the yield of this crop has plateaued in recent years
due to several biotic and abiotic stresses. Bean diseases constitute the most important
constraint to bean production around the world (Beebe and Pastor-Corrales, 1991; Tan
and Tu, 1994). Root rot has been reported to reduce bean yield in North America to up to
80% (Burke and Miller, 1983; Burke and Silbernagel, 1965; Burke and Nelson, 1967;
Steadman et al., 1975; Keenan et al., 1974; Sippell and Hall, 1982; Dryden and Van
Alfen, 1984; Burke and Hall, 1991; Tu and Park, 1993; Schneider et al., 1998; Estevez de
Jensen et al., 1998 and 1999; Schneider and Kelly, 2000; Park and Rupert, 2000). The
disease has also been reported in Japan and several European countries (Kovachevsky,
1931; Ruokola and Vestberg, 1978; Pastor-Corrales and Schwartz, 1994; Furuya et al.,
1999). Root rot caused by F usarium spp. has been identified in Brazil, Colombia, Peru,
Venezuela, Costa Rica, México, and other Latin America countries (Crispin-Medina and

Campos-Avila, 1976; Beebe, 1981; Pastor-Corrales and Schwartz, 1994).

Large seeded dry bean cultivars widely grown in Michigan are highly susceptible
to root rot caused by the soil-borne fungus F usarz'um solani (Mart) Sacc. f sp. phaseoli
(Burkholder) W.C. Snyder and H. N. Hans. F usarium root rot is a major problem for
bean growers and is present in all production areas of Michigan causing more yield loss
than other diseases (Robertson and Frazier, 1982), especially in the central north east
(Presque Isle County), north east (Isabella county) and west (Montcalm county) where
sandy or sandy loam soils predominate. Kidney beans planted commercially in similar
soil types in central Wisconsin and north central Minnesota are forcing farmers to limit
their planting as problems with root rot reduce productivity. The market potential of
Michigan dark red kidney bean cultivars in all three states has been limited due to root
rot. A root rot resistant kidney cultivar would give bean growers the opportunity to
expand and maintain production in Michigan and elsewhere.

Genetic resistance to F usarium root rot has been difficult to incorporate into
market-acceptable cultivars of snap bean and large seeded Andean dry beans (Estevez de
Jensen et al., 1998). An emphasis on quality traits appears to have significantly reduced
the genetic variability in these two bean types, which may contribute to their extreme
susceptibility to root rot (Gepts, 1998; Schneider et al., 2001). As plant breeding
programs become more sophisticated and modern agricultural techniques require higher
degrees of crop uniformity, the genetic diversity within crop varieties is reduced and such
varieties may become highly vulnerable to many natural hazards such as diseases (Welch,

1981).

Disease biology

Root rot in common bean is caused by a complex of pathogens that include:

F usarium solam' f. sp. phaseoli, F usarium oxysporum Schlecht f. sp. phaseoli,
Rhizoctom'a solam' Kuhn, Pythium spp., Thielaviopsis basicola (Berk. & Br.) F em, and
Aphanomyces eufeches f. sp. phaseoli Drechs. The widespread nature and importance of
F. solam’ as a predominant root rot pathogen in bean emphasizes the need for effective
control against this disease. Control can be achieved through a combination of
appropriate cultural management practices and through the development of resistant
cultivars.

Root rot caused by the fungus F. solani is concentrated on the roots of the plants;
however, symptoms often extend up the main root and hypocotyl to the soil surface. If
soil moisture levels are excessive or too low, the above ground parts may be stunted and
turn yellow, wilt, and die before the plants mature. Unlike other root rotting diseases
F usarium root rot does not cause seed rot or damping-off of seedlings or wilt. Symptoms
do not appear until two or three weeks afier planting. The first symptoms are narrow,
long, red to brown lesions in the stems where fissures often develop lengthwise which in
many cases can destroy the taproot. Small lateral roots, which normally develop from the
taproot, can be killed. Such lateral and taproot destruction is then followed by
proliferation of fibrous adventitious roots near the soil surface (Pastor—Corrales and
Schwartz, 1994; Singh, 1999; Mulligan, 1983). These fibrous roots enhance survival of
the plant if they are not disturbed. Under ideal soil and growing conditions, few above
ground symptoms will be visible. The root rot complex affecting beans is more

important in its influence upon the lateral root system than upon the hypocotyls and

taproot (Burke and Barker, 1966). Plants may be stunted, have an unhealthy appearance,
and grow more slowly than healthy plants. Poor root function deprives plants of nutrients

and water, which can result in uneven plant, stands and reduced productivity.

Other root rot pathogens

F usarium oxysporum Schlecht f. sp. phaseoli Kendrick & Snyder: F usarium yellows or
wilt which usually appears on older plants and begin as a yellowing and wilting of the
lower leaves (Beebe, 1981; Abawi, 1994). The wilting and yellowing progress up the
plant until the entire plant turns yellow. This is readily observed in the field. Plants also
may be stunted, particularly if infected at an early stage. In this disease roots and stem
show few external symptoms in contrast to F. solani. Discoloration of the vascular
system is a diagnostic symptom of F usarium yellows, and damage can be readily seen by
cutting into the lower stem and looking for a red-brown streaking in the vascular tissues.
The discoloration is usually present in plants showing foliar symptoms and is particularly
evident in the lower stem and at stem and petiole nodes. Severely infected plants become
yellowed, wilted and die prematurely, which may cause yield reduction or total crop loss
(Schwartz et al., 2001).

Rhizoctonia solani Kuhn: The pathogen exists primarily as mycelium that is colorless
when young and becomes tan to light brown with age (Abawi, 1994). The perfect
basidial state is less common, forming blackish, barrel-shaped spores on a thin layer of
mycelium at or near the soil level under conditions of high humidity. Rhizoctonia root
rot can cause seedling death, root and stem rot, stem cankers, and pod rot. The first

symptoms appear on the stems or roots as linear or circular reddish, sunken lesions with a

brown to reddish-brown border (Beebe, 1981). The cankers enlarge with age, and retard
normal plant growth. Pods may also develop lesions and rot if in contact with moist soil.
This pathogen can survive in infected plant residue and continuous cropping with
susceptible crops such as beans can increase pathogen population levels in soils.
Irrigation water and soil movement spreads spores of Rhizoctom'a, and moderate to high
soil moisture and low soil temperatures favors seedling disease development.

Pythium spp.: Pythium species may infect planted seeds prior to germination,
germinating seedlings, young plants, or older plants during blossoming and pod
formation (Abawi, 1994). This pathogen can cause seed decay and seedling death.
Damage is most common in wet soils and initial root rot symptoms appear as elongated
water soaked areas on the hypocotyl and roots, within one to three weeks afler planting.
The pathogen will extensively prune roots, reduce overall plant growth, and destroy much
of the hypocotyl and main root system. Roots infected by Pythium are typically light
brown in color and soft and watery to the touch. This infected region will eventually dry
out, become somewhat sunken, and tan to brown in color. Disease development late in
the season results when pods in contact with the soil become infected. Pythium root rot
and wilt is favored by high moisture and moderate to high temperature (Beebe, 1981).
Pathogen survival and inoculum buildup are favored by soils with high organic matter
and poor drainage. The pseudo-fungus can be transported within and between fields by
contaminated irrigation water and is also favored by limited crop rotation and by root
damage during cultivation, or by other soil related problems.

Threlaviopsis basicola (Berk. and Br.) Ferr. (Syn. Chalara elegans Nag Raj and

Kendrick): Thielavz'opsis black root rot, caused by Thielaviopsis basicola is characterized

by a dark brown to black necrotic tissue that develops on the below ground stems and
root (Abawi, 1994). F issures often develop in necrotic cortical tissue. Low temperatures
(15-20°C) as well as high humidity seem to favor fungal development. T hielavr‘opsis can
be identified in diseased tissue by the production of black chlamydospores, which survive
for over a year in soil. This disease occurs on blackeye cowpea (Vigna unguiculata) as
well as on other bean types.

Aphanomyces euteiches f. sp. phaseolz‘ Drechs: Symptoms caused by this pathogen can
easily be confused with those of Pythium spp. Initial root rot symptoms appear as
elongated water soaked areas on the hypocotyl and root, and under favorable conditions,
these lesions will rapidly extend leading to a sofi rot of the tissue, which looks brown in
color. Infected plants exhibit dwarfing, chlorosis, and premature defoliation (Abawi,
1994). The disease is favored by temperatures of 24-28°C and high humidity. This
pathogen can cause severe damage to beans when combined with Pythium. A. euteiches
f. sp. phaseoli, does not infect peas (Pisum sativum L.), but is pathogenic to alfalfa

(Medicago sativa L.; Pfender and Hagedorn, 1982).

Persistence and Transmission of F usarium root rot

The pathogen F. solam' usually survives as thick-walled chlamydospores in the
soil (Nash et al., 1961; Hall and Phillips, 1992 and 2004b; Cardona et al., 1995; Mondal
et al., 1996) but is not disseminated by seed (Nash and Snyder, 1964). The
chlamydospores germinate when stimulated by nutrients exuded by germinating seeds
and root tips, which proceeds the fungus mycelium penetration of the plant tissue. The

fungus also produces chlamydospores within the cortical tissue of infected bean roots

(Burkholder, 1919). Chlamydospores of F. solani can germinate and reproduce near seed
and roots of many non-host plants and also in organic matter. As a consequence the
pathogen can survive in the field for over a year (Schroth and Cook, 1964; Pastor-
Corrales and Schwartz, 1994). The mycelial form of the pathogen predominates in the
soil and is more tolerant of residues, antibiotics, and possibly crop rotations (Maloy,
1960); although both chlamydospores and mycelium forms grew well on root exudates
from a number of non-host plants (Maloy and Burkholder 1959).

When host tissue is not available, F. solani has been reported to have a limited
saprophytic growth and can perpetuate itself in a soil environment (Nash et al.1961;
Schroth and Hendix, 1962). The observation was suggested by Schroth and Snyder
(1961) and Cook and Schroth (1965a) who reported that F. solani chlamydospores
germinated when various amino acids and sugars were added to the soil. Common amino
acids and sugars were added to stimulate non-host root exudates, which may be capable
of providing limited nutrients for saprophytic growth. Chlamydospores germinated when
placed near root tips or germinating seeds; however, root exudates from mature bean
roots did not stimulate germination. Around 60% of the chlamydospores germinated
when adjacent to seeds of P. vulgaris (Cook and Snyder, 1965b). The germ tubes were
lysed quickly by other microorganisms unless susceptible host tissue was available,
which suggests that limited saprophytic grth is not a major factor in inoculum
production.

Many reports are available on the mode of penetration and host-parasite relations
of F. solani (Burkeholder, 1919; Christou and Snyder, 1962; Chatterjee, 1958; Bywater,

1959). Most researchers agree that initial infections occur through stomata in the

hypocotyl. The hyphae may also penetrate the roots and infect either directly through the
epidermis or through mechanical or natural wounds. Wounds formed by the emergence
of the lateral roots are a common site for penetration. lnfrequently, hyphae can enter
through the bases of damaged bean root hairs.

The pathogen typically forms a thallus on the host surface before penetrating host
tissue (Christou and Snyder, 1962). Glucose was essential for hypocotyl penetration and
nitrogen stimulated pathogenesis and penetration (Toussoun et al., 1960). Organic
nitrogen was more effective then inorganic nitrogen in stimulating both the development
of the thallus on the hypocotyls and the expression of symptoms (Maurer and Barker,
1965). Further, the ability of the nitrogen form to influence root rot depended on the soil
type and pH (Papavizas et al., 1968).

F. solani is moved around the field by wind and rain, irrigation water, farm
implements, and any other agent or process capable of moving soil. With each
successive crop of beans, pathogen population increase and the disease becomes more
severe (Kraft et al., 1981).

Plant damage is usually increased under environmental conditions that stress
plants on maximized plant densities. These conditions include deep planting and plant
spacing, soil compaction, hardpan layers, cool temperature, high or low pH, low fertility,
pesticide or fertilizer injury, and flooding or extended drought (Burke et al., 1972b and
1980; Burke, 1965a, b, and c; Burke and Nelson, 1965; Burke and Barker, 1966; Burke,
1968 and 1969; Cook and Papendick, 1972; Cook and Schroth, 1965a; Huber, 1963).

Soil compaction, occurring as a result of seasonal tillage, seems to be an

important factor in the F usarium root rot problem. Plants have limited root grth as a

result of compaction and experience water stress in years when rainfall is deficient
(Schumacher and Smucker, 1981). In addition, excessive water, or flooding, often causes
compacted soils to become oxygen deficient (Miller and Burke, 1977). Low oxygen
supply causes the development of anaerobic respiration and is associated with the activity
of certain plant diseases such as root rot (Henry, 1962; Miller and Burke, 1977). As
moisture is removed by the transpiring surfaces of the plants, a potential gradient is
established from the leaf to the root and into the soil. Since water moves in the soil by
bulk or mass flow, and depends on pore size, changes in the soil moisture content have
marked changes on the hydraulic conductivity of water. Water which remains in the
smaller pores and as thin films around the soil particles is largely unavailable to plants.
Excessive tillage decreases the large pores in the soil and results in an increase of tiny
pores which cause water to drain faster possibly favoring the pathogen. Matrix potentials
influence the amount of bean seed exudation and hence the activity of F. solani and

Pythium ultimum (Stanghellini and Hancock, 1970; Reid, 1979).

Control

When putting root rot control measures into practice, growers must remember that
the pathogen is not seed borne, but is strictly a soil borne organism. F usarium root rot of
bean can be controlled in several ways. The best control measure is to plant into a warm
temperature (minimum temperature >15°C), well-prepared, well-drained, and well-
fertilized seed bed capable of supporting rapid bean growth. Conditions that promote

plant health and growth will reduce losses associated with F usarium root rot of common

bean (Pastor-Corrales and Schwartz, 1994; Singh, 1999; Tan and Tu, 1994; Snapp et al.,
2003; Roman-Avile's, 2004;).

Irrigation should be managed to provide enough water to the developing plant
without causing moisture stress or excess. By manipulating water supply, growers can
achieve maximum yield with minimal root rot (Tu et al., 1992). Plants may be
predisposed to infection after being stressed by moisture or temperature extreme.
Rotation of beans with non-host crops such as corn (Zea mays L.), wheat (T ritz’cum
aestivum L.), barley (Hordeum vulgare L.), or alfalfa will usually reduce root ror severity
(Pastor-Corrales and Schwartz, 1994). Soil solarization can be effective in sterilizing the
soil when environmental conditions are favorable. In production systems where
polyethylene film is used as mulch, pre—plant application of chemical fumigants is the
principal method employed for control of soil borne pathogens, but is too expensive for
most bean production systems (Chellemi and Olson, 1994).

Plants should be widely spaced within the row to reduce competition for water
(Burke, 1965a). Widely spaced plants have been associated with less root rot than those
growing closer together. The beneficial effects of wide spacing are thought to be due to
high plant growth rate and limited plant competition; however, this decrease in disease
severity is nullified if soil temperatures are low (Burke, 1965a). Less than optimal soil
temperatures will reduce the ability of bean roots to penetrate compacted soils.

Fungicides are generally not effective in controlling F usarr'um root rot. Chemicals
such as Thiram and Benlate used as seed treatments are recommended to reduce the
severity of root rot in several countries (Pastor-Corrales and Schwartz, 1994), but

chemical control may be too expensive for some farmers. Captan 400 + Streptomycin +

10

Lorsban 50 is the standard seed treatment used in the United States but it has failed to
effectively control the disease where resistant cultivars are unavailable (Kirk and Snapp,
unpublished data). The application of Igacillus subtilis strain GBO3 (Kodiak) with
Rhizobr'um as a seed treatment is a promising new approach to enhance root rot control in
beans (Estevez et al., 2002).

In some countries of Latin America bean straw is fed to animals which can result
in serious disease problems if that straw is infected by F. solani. Bean straw, carrying the
pathogen, should never be fed to animals, as the manure will carry the organism and
serve as a source of infection in the future (Pastor-Corrales and Schwartz, 1994). One
recommendation is that the bean residues should be removed from the field, to areas
where beans probably will not be grown. Any diseased bean residue left on the field
should be turned under deeply by fall plowing (Pastor-Corrales and Schwartz, 1994;

Snyder et al., 1959).

Root traits as an approach for root rot resistance

Factors such as the ability of a bean seed to germinate in the cold, ability of the
plant to develop a large, vigorous root system, and the presence of inhibitory substances
in the seed coat and hypocotyls, would increase the level of resistance to root rot in
common bean (Statler, 1970). Quantitative information on root system traits associated
with root rot tolerance would improve selection criteria for root vigor.

Root rot resistance is expected to be related in part to root system traits. Limited
knowledge on the relative importance and function of various root classes complicates

the prospects of breeding for specific root traits in common bean (Lynch and van Beem,

ll

1993). Field studies suggest that root system traits play a role in resistance to root rot
(Burke and Barker, 1966). The effect of root rot on yield was not ameliorated by
complete protection of hypocotyls and taproot, where beans were grown in raised beds of
pathogen-free soil compared to infested raised beds, from which most of the root system
extended into F usarium infested soil (Burke and Miller, 1983). Vigorous, unrestricted
roots outgrew and overcame local hypocotyl and taproot infections in this study. These
results indicate that this fungus seems to have limited effect on plants with vigorously
growing roots. A field study comparing raised and flat beds showed that root vigor of
commercial snap bean cultivars was relatively high (>0.2cm'3) and root rot caused by F.
solani was less in the raised beds compared to flat beds (Snapp et al., 2003). These
results suggested that integrated management practices can improve root vigor and as a
result reduce root rot severity.

In a study conducted with peas large-rooted lines regenerated more roots when
one-third or two-thirds of the root system was removed or when one cotyledon was
removed from 5-day-old plants. These same large rooted lines produced more roots and
had more root surface area when exposed to a compacted layer (1.6 g cm'3 bulk density)
infected with F usarium root rot (F usarium solani f. sp. pisr') pathogen (Kraft and Boege,
2001). In conclusion, large-rooted pea lines should have an advantage over other line
under adverse growing conditions of compaction and the presence of F usarium root rot
(Kraft and Boege, 1996 and 2001).

The physiological, architecture, and morphological features of individual root
systems affect many processes such as the composition of soil organisms, turnover of soil

organic matter, plant anchorage, acquisition of water, and nutrients by plants. These

12

features will also affect the establishment, growth, reproduction and mortality of plant
populations (Bledsoe et al., 1999). Root systems are difficult to study, primarily because
they are spatially and temporally complex and because available methods for their study
are labor-intensive and destructive. The evaluation of roots for F usarium root rot has
been difficult due to the large number of intermediates in levels of susceptibility for traits
strongly influenced by environmental factors (Schneider etal., 2001). A complex
genotype by environment interaction has made it difficult to make progress in controlling
this disease through resistance breeding.

Root damage is a more accurate indicator of yield reductions caused by F usarium
root rot, than the conventional rating of hypocotyl lesions (Beebe et al., 1981; Schneider
et al., 2001). Root architecture traits, such as secondary and tertiary root branches,
adventitious roots, basal roots (arising from the basal region of the hypocotyl), angles,
and radii, should also be considered in evaluating root systems. Adventitious roots
appear to play an important role in water and nutrient transport and can ameliorate
multiple interacting stresses of the field environment (Stoffella et al., 1979; Leskovar and
Stoffella, 1995).

Detecting differences in root architecture and growth patterns among bean
genotypes may provide unique selection criteria for genetic resistance to F usarrum root
rot. Genetic variation existed in root architecture among common bean classes and was
highly significant under field conditions (Roman- Avilés et al., 2004), indicating the
value of screening in the field environment. It appears that the introgression of root traits
or root vigor from small seeded to large seeded bean genotypes could be effective. Large

seeded bean genotypes, such as Chinook 2000 and FR266 that possess a vigorous root

l3

system suggests that breeders have been effective in introgressing desirable rooting traits
from small seeded genotypes (Roman- Avilés et al., 2004).

Root and shoot weights have been used to determine root rot resistance in edible
beans (Hall and Phillips, 2004a). Since shoot weight is easier and quicker to measure
than root weight, resistance to F usarium root rot can be expressed as percentage
reduction in fresh shoot weight of plants inoculated afier emergence compared to
uninoculated plants. This relationship of shoot to root grth has been studied in
climbing bean genotype HAB 229 possessing a more taproot dominant root system, when
compared to the prostrate genotype Carioca with a highly branched, non-tap root
dominant system with large number of root meristems (Lynch and van Beem, 1993).

Moreover, knowledge of the genetic determinants of root traits and how they
influence yield would allow for a more targeted breeding approach utilizing technologies
such as QTL analysis. In general developing a vigorous root system could help improve

root rot resistance in large seeded bean genotypes.

Breeding for F usarium root rot resistance (past and present)

Long recognized as a problem in the U. S., Fusarium root rot is the most serious
root rot disease of common bean. Breeding for resistance to root rot caused by F. solani
in common bean has been challenging (Wallace and Wilkinson, 1965; Nelson, 1973).
Unlike some other fungi, there is no-clear indication from present distribution of the
origin for F usarium based on the diversity, distribution of species, and telemorphs
(Backhouse et al., 2001). The diversity of F usarium species and their telemorphs suggest

that the species is an ancient group, probably appearing fairly early in the evolution of the

14

Ascomycetes. However there is no fossil record to substantiate this fact, and no
calculations exist on the rate of molecular evolution.

F usarium root rot of bean was first recorded in 1916 by Burkholder, in the state of
New York, (Burkholder, 1916 and 1919) and is one of the most prevalent diseases in the
world (Boomstra et a1. 1977; Wallace and Wilkinson, 1965; Wallace and Wilkinson,
1973; Pastor-Corrales and Schwartz, 1994). McRostie (1921) reported that susceptibility
to F usarium root rot was dominant over resistance and that two factors were involved in
the inheritance in common bean. Conflicting reports exist in the literature on the number
of genes involved in resistancce and levels of dominance, depending on the parental
genotypes used in the different genetic studies. Resistance is usually associated with late
maturity, small seeds, and large, indeterminate vine grth habit (Kraft et al., 1981).
Tolerance was recessive in crosses between P. vulgaris and P. coccineus and probably
controlled by three major genes or two genes with modifying factors. Results from this
study also indicated no relation between root vigor and resistance (Azzam, 1958).

Earlier studies indicated that resistance to root rots existed in P. coccineus (Yerkes
and Freytag, 1956) and in a black seeded P. vulgaris accession, N203 (PI 203958),
introduced from Mexico by Oliver Norwell of the Carnegie Institute of Washington and
later assigned the accession number PI 203958 (Azzam, 1958; Wallace and Wilkinson,
1965; Singh, 1999; Wallace and Wilkinson, 1973). Genetic studies with the dry bean
lines PI 165435 and PI 203958 showed that resistance to F usarium root rot in P. vulgaris
was controlled by one dominant gene and one recessive gene independently inherited (F1
all susceptible and F2 showed a ratio of 13 susceptible: 3 resistant; Smith and Houston,

1960). Resistance derived from P. coccineus crosses showed nearly complete

15

dominance, and only a few genes were responsible for its expression (Wallace and
Wilkinson, 1965). Data collected from the P. coccineus (Scarlet Runner) crosses showed
a high degree of resistance, but higher resistance was observed in P1 20395 8, and other
breeding lines; and extreme susceptibility in existed yellow-eye and red kidney Andean
genotypes. Scarlet Runner is highly resistant, but not as resistant as PI 20395 8. This
resistance whether derived from P1 203958 or Scarlet Runner, is incompletely dominant
(Bravo et al., 1969). Additive gene effects are larger than dominant gene effects. In
1949 Dr. T.L. York at Cornell University, Ithaca, NY. crossed Scarlet Runner with
common red kidney beans (after subsequently backcrossing to common bean) and he
obtained a common bean line (NY 21 14-12) with slightly improved resistance over
Scarlet Runner (Wallace and Wilkinson, 1973). Estimates of the number of genes
controlling resistance ranged from three to seven, and the effect of individual genes could
not be distinguished (Nelson, 1973). Using NY2114-12 as a source of resistance,
quantitative inheritance of resistance to F usarium was observed, which was inherited
independently from genes conferring resistance to other root rots (Dickson and Boettger,
1977)

Resistance to F usarium root rot has been identified in tropically adapted bean lines
(Boomstra and Bliss, 1977, Hassan et al., 1971). The widely used source of F usarium
root rot resistance, PI 203958 (N203), bean from México is a wild, black-seeded, and
semi vine with short, flat stringy pods (Dickson, 1973). N203 has the highest level of
resistance among all known accessions of the common bean, Phaseolus vulgaris.
Resistance in both the Scarlet Runner and PI 203958 sources was inherited quantitatively

(Boomstra and Bliss, 1977; Hassan et al., 1971). Support for this theory is indicated by

16

numerous distinct degrees of resistance in the breeding lines and varieties studied as well
as by the large environmental variation (Wallace and Wilkinson, 1965; Schneider et al.,
2001)

Resistance genes fi'om PI 203958 have been incorporated into pink, pinto, and
small red cultivars such as: USWA 19, Rosa, Viva, Gloria, Rufus, NW 59, NW 63,
Cahone, NW 410, NW 590, Pindak, and Holberg (Burke, 1975; Burke and Miller, 1983;
Burke, 1982; Schneiter et al., 1982 and 1983; Silbemagel and Hang, 1997; Wood et al.,
1983). A bush snap bean (P. vulgaris) breeding line (FR266- F usarium Resistant 266),
was developed with resistant to F usarium root rot caused by F. solani (Silbemagel,
1987). FR266 possesses a large root system, white seed, and the source of F usarium root
rot resistance was PI 203958.

Middle American bean gennplasm has higher levels of root rot resistance
compared to the highly susceptible large seeded beans of Andean origin (Beebe, 1981).
Field experiments conducted by Schneider et al. (1998) demonstrated that dark red
kidney seed types were the most susceptible and that F R266 and PI 203958 were among
the most resistant genotypes. Moderate to high heritability (0.48 to 0.66) estimates for
lines derived from P1 203958 and low to high heritability estimates (0.13 to 0.85) for
lines derived from crosses between Montcahn x FR266 indicated that F usarium root rot
resistance can be controlled through genetic resistance (Schneider and Kelly, 1999).
Previous work shows that adequate levels of root rot resistance in beans has been limited
(especially in large seeded kidney beans and snap beans). The evaluation for root rot

requires more appropriate experimental designs for the analysis of quantitative traits with

17

replicated trials and different locations (Smith and Houston, 1960; Wallace and
Wilkinson, 1965; Schneider et al., 2001).

Bean breeders have attempted to transfer the resistance from the Middle American
gene pool to current commercial kidney bean cultivars from the Andean gene pool, but
gene transfer across gene pools takes time and success is not guaranteed. Previous
studies in resistance breeding exhibit partial resistance to F usarium root rot, large
differences in levels of susceptibility and large genotype by environment interaction.
Both of these facts support the proposed quantitative inheritance of Fusarium resistance
(Tan and Tu, 1994; Schneider et al., 2001). Quantitatively inherited traits result from a
genetic component that under normal conditions of measurement cannot be controlled by
individually recognizable quantitative trait loci. The inability to recognize individual loci
depend on the reliability of scoring phenotypes which can be challenging. Since the traits
of interest are, by nature, genetically complex, environmental factors and genetic
background potentially have a major impact on their expression.

Due to the complex inheritance of resistance to F. solani in common bean breeders
must use only crosses with highly resistant selections. One breeding method for
improving resistance to F usarium root rot is by backcrossing to commercial types which
is essential for the development of acceptable root rot resistant varieties. Advanced
backcross quantitative trait loci (QTL) analysis has been proposed as a method of
introgressing QTL from wild species into a cultivated genetic background (Tanksley and
Nelson, 1996). The advantage of such a method for the development of populations is
that the genetic background is largely identical and the influence of other negative genes

on the analysis is limited.

18

The polygenic inheritance along with strong environmental effects has limited the
improvement of root rot resistance under field conditions (Wallace and Wilkinson, 1965;
Bravo et al., 1969; Hassan et al., 1971; Boomstra et al., 1977; Beebe et al., 1981;
Sibemagel, 1990; Tu and Park, 1993; Schneider and Kelly, 1999). Narrow sense
heritability of 26% to 44% with crosses using PI 203958 and Scarlet Runner are high
enough to suggest that selection can be effective but low enough to imply that effective
selection requires progeny testing, and evaluation of root rot as a quantitative character
(Hassan et al., 1971). Intermediate to high levels of root rot resistance were reported in
Middle American gerrnplasm in small-seeded genotypes (Beebe et al., 1981). Resistance
may have resulted from natural selection during repeated exposure to soil-home

pathogens.

Problems associated with intergene-pool crossing

Transfening F usarium root rot resistance from Middle American gene pool into
Andean gene pool results in a major challenge. Evidence of divergence between Middle
American and Andean cultivated gene pools is provided by observed hybrid weakness or
dwarf lethality in the F1 generation of certain crosses between these two cultivated
genotypes (Gepts and Bliss, 1985). Crosses showing F1 dwarf lethals always involved a
small-seeded genotype showing an ‘S’ phaseolin type (of Middle American origin) and a
medium to large seeded genotype with a ‘T’ (Tendergreen) or ‘C’ (Contender) phaseolin
type (of Andean origin). Genetics of dwarf lethals based on results of a backcrossing
experiment were described by Shii et a1. (1980). Their results indicate that the phenotype

is controlled by complementary gene loci, one expressed in the root (DLl or Dosage

19

dependent Lethal 1) and the other in the shoot (DL2). Also the incompatibility was due
to nuclear and not to cytoplasmic effects, and the lethality increases with increasing
dosage of dominant alleles of DL2 in the scion and of DLl in the root stock. Small
seeded bean genotypes fiom Middle American gene pool carried DLl and the medium to
large seeded genotypes from Andean gene pool carried DL2. In addition, high
temperatures (30°C/25°C, day/ night) regime are responsible for hybrid weakness, which
restricted root growth and could be overcome by the addition of cytokinin (Shii et al.,
1980 and 1981). This suggested that the DLl and DL2 might be related to the regulation
of hormonal function or metabolism. Symptoms included decrease leaf and root growth,
leaf chlorosis, the developmental of adventitious roots on the stems, eventual death. The
recessive gene [or causes trifoliate leaf crippling in the presence of either DLl or DL2
gene (Singh and Molina, 1996). When both DLl and DL2 are present in F1 from inter-
gene pool crosses, a dwarf-lethal or semi-lethal phenotype is produced, irrespective of the
alleles at the icr locus. For example the genotypes of the recombinant inbreed lines
(RILs) used to study this [or gene are, for WA7807-305: DLI DL2d12d121crIcr, and for
TY5578-220: dlIdIIDLZDLZicr icr.

Dwarfism of F1 hybrids was observed in over 100 diallel crosses derived by
crossing between entries within gerrnplasm groups of various geographical origins of dry
beans at the International Center of Tropical Agriculture (CIAT), Cali, Colombia (Singh
and Gutierrez, 1984). Upon close examination of the characteristics of the parents of all
dwarf F1 hybrids, it was found that, in each case, one of the parents had small seed (100
seed weight 25g or less) and the other medium (26 to 40g) or large seeded (>40g) seeds.

All F1 hybrids within small seeded and between medium and large seeded types were

20

normal. Dwarfism only occurred when the small seeded was crossed with a medium or
large seeded type. The incompatibility barrier would have served as a partial or complete
isolation mechanism and has limited genetic incompatibility between these two distinct
bean gene pools.

To determine if the DLl and DL2 were present in the wild P. vulgaris gene pool
and whether they exhibit the same geographical distribution as in their cultivated
counterparts, wild accessions chosen for their geographical range distribution and
phaseolin and allozyme diversity were crossed to two testers known to have genes
controlling dwarf lethality (Koinange and Gepts, 1992). Results fi'om test crosses
showed that the DL genes were present in the wild beans and that they followed the same
geographical distribution pattern as in the cultivated, whereas previously they had only
been reported in cultivated P. vulgaris. Possible origin of the DL genes may have been
by introduction into the cultivated gene pool from the wild ancestor of P. vulgaris,
presumably through domestication, although outcrossing subsequent to domestication
cannot be excluded (Koinange and Gepts, 1992).

Reiber and Neuman (1999a) found that abnormal growth and development of F 1
bean hybrids might involve interruption of the regulation of cytokinin allocation, thereby
disrupting the root-shoot feedback loop between root-sourced cytokinins and shoot- .
produced factors. Although zeatin ribose concentrations are reduced in roots and leaves
of the F1 hybrids, stems had very high concentrations of zeatin ribose, suggesting that
there is a breakdown in the transport or allocation of this cytokinin instead of a deficiency
of cytokinins. To better understand the mechanisms regulating the integration between

roots and shoots in dwarf lethality changes in the concentrations of zeatin ribose in two

21

cultivars, Redkloud and Batt and F 1 crosses carrying the DL phenotypes were studied
(Reiber and Neuman, 1999b). Applications of benzylaminopurine (BAP) to roots of F1
hybrids increased the number of root tips and leaves. Estimates of the transport of zeatin
ribose type cytokinin from roots of F1 hybrids indicated that transport out of hybrid roots
was reduced compared with those transported out of Middle American or Andean roots.
This suggested that zeatin ribose type cytokinins are involved in hormonal integration
between roots and shoots of common bean and that one of the barriers to hybridization
between Andean and Mesoamerican landraces is related to hormone transport.

Deleterious effects of gene pool crossing (crosses between Middle American and
Andean gene pool) were circumvented through careful management of the F1 (hybrid)
root system as described by Beaver (1993), who successfully harvested F 2 seeds from F1
plants which were expected to be all dwarf lethal, F1=DL1/DL2 (Shii et al., 1981 and
1980). With the application of ‘hormex’ (0.24% l-napthaleneacetic acid and 0.013% 3-
indolebutyric acid) to the soil before planting, F1 plants began to grow and recover a
healthy appearance (Beaver, 1993).

The transfer of quantitative traits between gene pools has had limited success as a
result of dwarf lethality (Kelly, 1988). Not all bean types carry the dwarf lethal genes
and an inventory of bean lines known to carry the null (dl) genes was proposed by Kelly
(1989). The purpose of the inventory was to facilitate researchers in their selection of

parents to use as a bridge between gene pools.

22

Types of genetic markers

Genetic markers can be classified into morphological, biochemical, and DNA-
based markers. Morphological traits controlled by a single locus can be used as genetic
markers provided their expression is reproducible over a range of environments.
Morphological trait markers have had limited application in plant breeding when used for
indirect selection of a trait, because they may result in an altered phenotype that conflicts
with growers needs, unfavorable pleiotrophic interactions, late expression, rare
polymorphisms, and the potential negative effect on fitness or desirability of an
individual, dominant inheritance, and they can be influenced by environmental and
genetic factors (Staub et al., 1996; Weber and Wricke, 1994; Hospital et al., 1992; Singh
et al., 1991b). The limitations to the application of morphological markers can be
overcome however by the application of more abundant biochemical (enzyme and protein
markers) and DNA markers (RF LP’s, AF LP’s, RAPD’s, and SSR).

The use of genetic markers for indirect selection was first realized with the
discovery of simple inherited, structural variation present in isozymes and the phaseolin
seed storage proteins in common bean. Isozymes are differently charged protein
molecules that can be separated using electrophoretic procedures (Staub et al., 1996;
Singh et al., 1991a; Weber and Wricke, 1994). Allozymes are conditioned by genes that
affect subtle secondary characteristics of the enzyme with little or no effect on enzymatic
properties and they do not impair the viability of the mutant organism. Isozymes, as
opposed to molecular markers, are restricted by a limited number of markers available
and by the number of diverse biochemical assays needed to detect enzyme activity, which

limits the number of genes able to be assessed (Stuber, 1991).

23

The construction of linkage maps based on DNA markers has been completed for
a number of crop species including common bean (Vallejos et al., 1992). Restriction
fragment length polymorphisms (RFLP’s) methodology is based upon the availability of
cloned sequences, which can be used to probe homologous regions of specific genomes
for the presence of variation at the DNA level. This variation is monitored as
polymorphisms in the length of the defined DNA fragments, caused by deletion and
insertions that are produced by digestion of the DNA with restriction endonucleases
(Weber and Wricke, 1994; Staub et al., 1996). However, this methodology is expensive,
laborious, and requires the use of radioactivity, and thus is not readily adapted as a
selection tool by most breeders working with large populations (Young, 1995; Kelly and
Miklas, 1998; Nienhuis et al., 1994). RFLP markers, however, are critical in anchoring
the linkage groups in the integrated bean map and combining linkage maps.

Amplified fragment length polymorphism (AFLPs) methodology is based on PCR
and selective amplification of restriction enzymes digested DNA fragments (Savelkoul et
al., 1999). Specific adapter molecules are ligated to the restriction fragments (Staub et
al., 1996). AF LPs have been shown to detect low levels of polymorphism in many
different organisms including bean (Tohme et al., 1996). Selection can be facilitated
using molecular marker methodologies to identify unique parental gerrnplasm within the
wild gene pools.

More recently, sequence-related amplified polymorphism (SRAP) markers have
been developed for the amplification of genomic regions associated with defined open
reading frames (Li and Quiros, 2001). These markers target coding sequences in the

genome and results in moderate numbers of co—dominant markers. The SRAP technique

24

is a PCR based marker system with two-primers, a forward (17 bases) and a reverse
primer (18 bases), run on acrylamide gels. SRAP as well as AF LPs and RAPDs
techniques make use of no specific sequence information, and the markers generated are
randomly distributed across the genome. Another marker technique known as target
region amplification polymorphism (TRAP) was derived from the SRAP technique.
Contrary to the SRAP technique, TRAP markers are developed using bioinformatics tools
and expressed sequence tag database information to generate polymorphic markers
around targeted candidate gene sequences (Hu and Vick, 2003). TRAP techniques are
useful for the screening of gennplasm collections and for tagging genes controlling
desirable traits such as disease resistance.

Microsatellites or simple sequence repeats (SSR) are PCR based markers that
have been developed for a wide range of plant species. SSR use known DNA sequence
information to produce highly polymorphic and allele specific markers. These markers
detect length polymorphisms at genetic loci that exhibit SSRs that are highly variable
(Morgante and Olivieri, 1993). A genetic map for common bean based on microsatellites
was developed at CIAT to facilitate marker-assited selection (MAS) and genetic studies
(Blair et al., 2003). Tandem repetitive DNA sequences on microsatellites occur as di-,
tri-, and tetra-nucleotide microsatellites (Ma et al., 1996). The repeat is called a

dinucleotide microsatellite because the sequence that is repeated multiple times is only

two bases long (e. g. AGGTCACACACACAGCG), a trinucleotide is only three bases

 

long (e. g. GTTACTACTACTACTACAGT), and the tetranucleotide microsatellite is four

 

bases long (e. g. GGTGGCAGGCAGGCATT) and is repeated multiple times. The

number of times the microsatellite sequence is repeated is unique to individual genotypes.

25

When studying the frequency of di-, tri-, and tetra-nucleotides in wheat AC-SSR occurred
every 292 kb whereas AG-SSR occurred every 212 kb (Ma et al., 1996). Trinucleotide
repeats were about ten times less common than the dinucleotide tandem repeats, and
tetranucleotide repeats were rare in wheat and most crops (Ma et al., 1996). In addition
dinucleotide repeats tend to be fairly long. On average, dinucleotides SSRs have a higher
number of repeats than trinucleotides (Gaitan-Solis et al., 2002).

Random amplified polymorphic DNA (RAPDs), is a PCR-based assay
amplification of random genomic DNA segments with single short oligodeoxynucleotide
of arbitrary sequence that detects nucleotide sequence polymorphisms. The reaction
products are separated on agarose gels and then visualized by ethidium bromide staining.
RAPDs have been used widely for map construction and linkage analysis in many crops
(Staub et al., 1996). They are usually dominant markers with polymorphisms between
individuals defined as presence or absence of a particular RAPD band (Staub et al.,
1996). RAPDs are quick and simple to perform, have no requirement of DNA sequence
information but have problems with reproducibility between different laboratories, use
fluorescence instead of radioactivity, and small quantities of DNA are required.

Application of RAPD technology is highly suitable for detecting polymorphism
between related gerrnplasm and between bean genotypes of the same market class (Haley
et al., 1994). Although their potential usefulness is limited because of their dominant
nature, RAPDs are suitable for analysis involving RIL populations in which progeny are
near homozygous. Marker assisted selection, used to select indirectly for resistant
genotypes, may facilitate improvement of disease resistance when field selection is

laborious and destructive.

26

RAPD markers associated with QTL for field resistance to ashy stem blight
(Macrophomina phaseolina) in common bean were identified by Miklas et al. (1998).
These QTL-linked RAPD’s and the Mp-I and Mp-2 resistance genes and linked RAPD
markers from breeding line BAT 477 identified by Olaya et al. (1996) for ashy stem
blight, would provide initial tools for testing MAS for control of ashy stem blight in
common bean. Achenbach and Patrick (1996) used RAPD markers as a diagnostic tool
for the identification of F. solani isolates that cause sudden death in soybean (Glycine
max (L.) Merr.). Schneider et al. (2001) identified RAPD markers associated with QTL
controlling F usarium root rot in common bean that can be used to select progeny
possessing complementary QTL for intennatting.

The advantage provided by molecular markers over classical genetic markers is
the ability to identify and utilize information on naturally occurring polymorphisms
within populations. The identification of individuals, which have accumulated a number
of desirable agronomic characteristics during the breeding process, constitutes the most
important activity of a plant breeder. Low heritability, epistasis, undesirable linkages,
pleiotropic effects, and inadequate screening procedures are a few of several factors that
may interfere with the successful incorporation of important traits into new cultivars
(Nienhuis et al., 1994; Staub et al., 1996).

The identification of molecular markers closely linked to and preferentially
flanking the gene(s) of interest would allow selection to be carried out based on the
molecular marker genotypes (Simpson, 1999). Genetic markers allow the detection of
polymorphisms due to small changes in DNA sequence, and have proven extremely

efficient in the discrimination of individuals. In addition, developmental, tissue specific

27

and environmental factors do not influence the detection of these polymorphisms, making
them excellent markers (Simpson, 1999; Staub et al., 1996). Since root rot disease
ratings require destructive evaluation and are often confounded by climatic factors,
indirect selection using linked markers would improve the efficiency of breeding for
resistance.

In general development and advancement in genetic marker technology have been
central in the search for QTL. Until the discovery of DNA-based genetic markers,
allozymes used initially as biochemical markers had insufficient protein variation for
high-resolution mapping. The discovery of DNA-based markers has largely replaced
allozymes in mapping studies as DNA-based markers are unlimited in terms of their

genetic location or number.

Application of molecular markers to the study of quantitative traits
Quantitative traits loci ( QT L) for disease resistance

Traits controlled by more than one gene are complexly inherited and highly
affected by the environment. A quantitative trait loci (QTL) is an area of the genome that
is associated with the control of quantitative trait (e. g. root rot resistance). QTL analysis
is a valuable tool for genome exploration and the investigation of complexly inherited
traits (Young, 1996). QTL analysis has enhanced the breeders understanding of
quantitative resistance by revealing the location and size of loci controlling complex
disease resistance. An example of how QTL analysis the breeders understanding would
be by confirming the interaction between resistance traits that control physiological and

those influencing plant morphological and phenology traits that influence disease

28

avoidance and escape mechanism for white mold (Sclerotinia sclerotiorum) of bean in a
field environment (Kolkman and Kelly, 2002 and 2003). Markers associated with a QTL
could assist in the understanding of quantitative disease resistance by identifying loci that
influence resistance to more than one disease (Ariyarathne et al., 1999). The possible
function of a QTL can be assumed due to co-localization of the QTL with defense
response genes (Lozovaya et al., 2004; Kolkman and Kelly, 2003; Schneider et al., 2001;
Geffroy et al., 2000; Mohr et al., 1998). The possible co-localization of QTL with major
genes for resistance suggested that these QTL might be allelic versions of qualitative
resistance genes (Geffroy et al., 2000).

One major objective when conducting QTL analysis is the identification of the
location of genes which account for high levels of genetic variation (R2) of agriculturally
important phenotypes and the use of QTL in MAS in plant improvement. The use of
MAS in breeding for quantitative resistance would have greater impact when breeding for
root rot resistance and white mold resistance in common bean as screening for resistance
is highly influenced by plant morphological traits that can contribute to disease avoidance
or escape (e. g. for white mold) which complicates selection procedure (Tanksley et al.,
1989). In the case of F usarium root rot selection can be complicated by the interaction of
other soil pathogens. By using MAS breeders can accelerate progress toward breeding
objectives since breeders will know what they are selecting for (Asins, 2002). A second
objective of QTL analysis is to answer basic questions about evolutionary processes. A
third objective would be to provide breeders with information on the uniqueness of
resistance sources not previously known. QTL analysis is accomplished by estimating

the probability that a QTL is present at a position on the genome over the chance that a

29

QTL is absent. QTL mapping experiments involve a common basic procedure in many
taxa. The analysis has two essential stages: the association of the trait with the marker
and the mapping of the marker (Kearsey and F arquhar, 1998).

QT L mapping attempts to locate areas on the genome that affect the trait in
question, given the measurable phenotypes (trait values), the individual genotypes
(genetic markers), and population structure. Many QTL mapping protocols are time
consuming as one evaluates the association of a QTL with a marker or marker interval
while ignoring the effects of other segregating QTL in the mapping population (Mackay,
2001). A very important consideration in the analysis and interpretation of QTL data is
the threshold LOD (log of odds) employed, for inferring that a QTL is statistically
significant (Paterson, 1995; Lindhout, 2002; Kearsey and Farquhar, 1998). If the QTL
peak is above the established threshold than the QTL is consider being statistically
significant.

Three approaches can be taken to map QTL: selective genotyping, comparative
QTL mapping, and DNA pooling. Selective genotyping is an excellent approach for
efficiently mapping QTL that influence a single phenotype only. Specifically selective
genotyping involves the identification of a subset of individuals from a genetic mapping
population, which represent the most extreme phenotypes in the population. By
phenotyping a large population, and then selecting only the most extreme individuals
(bulking both top and bottom extremes) for genotyping, one can obtain equal or greater
information about QTL. Since the use of selective genotyping for complex traits may be
hindered by the limitation of a set of DNA bulks based on disease reaction alone, single

and multi-trait bulking strategy have been used for disease such as white mold) of

30

common bean (Kolkman and Kelly, 2003). Multiple trait bulking was used to identify
QTL conditioning resistance in an agronomically acceptable plant type, by avoiding the
detection of QTL associated with undesirable avoidance mechanisms such as early
flowering or maturity or short dwarf plants that restrain disease development but limit
yield potential (Kolkman and Kelly, 2002). Comparative QTL mapping is based on the
finding that diverse taxas within common taxonomic families that often share similar
gene order over large chromosomes of different taxa based on common reference loci
(Paterson, 1995). The comparative maps of rice (Oriza sativa L.) and maize provide a
basis for interpreting molecular, genetics, and breeding information between these two
important species and establish a framework for ultimately connecting the genetics of all
grass species (Ahn and Tanksley, 1993).

Bulked segregant analysis (BSA) is similar to selective genotyping, in that it
consists of DNA bulks (resistant and susceptible bulks) but with the exception that
resistant and susceptible bulks are based on actual extreme genotypes. BSA is the
pooling of DNA from individuals sharing a particular characteristic and is used on single
gene analysis. BSA was proposed as a strategy to overcome some of the disadvantages
of developing near isogenic lines (NILs; Michelmore et al., 1991). This technique uses a
segregating population, F2, F3, or backcross, where segregants are characterized for the
trait of interest and separated into groups or bulks (Michelmore etal., 1991). Within each
pool or bulk (resistant and susceptible bulks), the individuals are identical for the trait or
gene of interest but are arbitrary for all other genes. Bulk segregant analysis has been
used to find RAPD markers linked to disease resistance genes and tagging disease

resistant genes in lettuce (Lactuca sativa L.; Michelmore et al., 1991), common bean

31

(Haley et al., 1991; Miklas et al., 1993 and 1996) and other crops (Quarrie et al., 1999;
Tabor et al., 2000).

Selective genotyping and BSA are often combined in QTL studies as have been
the case in studies of root rot and white mold resistance in dry bean (Schneider et al.,
2001; Miklas et al., 2001; Park et al., 2001; Kolkman and Kelly, 2003). The method of
selective genotyping is a powerful method to detect association for a quantitative trait
(Van Gestel et al., 2000). Selective genotyping of individuals, on the basis of both
single-trait and multiple trait DNA pooling strategies, was utilized to create several sets
of bulks in their breeding populations. Selective genotyping combined with BSA have
been used to study F usarium head blight in wheat, Shen et al., 2002); for agronomic traits
in oilseed rape (Brassica napus L., Butruille et al., 1999); molecular mapping of
chromosome segments introgressed from wild nightshade (Solanum lycopersicoides) in
cultivated tomato (Lycopersicon esculentum, Chetelat and Meglic, 2000); Alternaria
solani resistance in tomato (Zhang et al., 2003); and for Cercospora maydis resistance in
corn (Gordon et al., 2004).

Sixteen QTL for F usarium root rot resistance were identified using a F 4; 5 RIL
population derived from a cross between the susceptible large red kidney Montcalm and
the root rot resistant snap bean breeding line FR266 (Schneider et al., 2001). QTL for
resistance to root rot had also been identified in linkage group B2 and B3 of the bean core
map (Schneider et al., 2001), close to the PvPR-I and PvPR-Z, pathogenicity related
proteins, which are thought to be involved in the defense response mechanism against
these pathogens. Interval mapping of QTL revealed two QTL for F usarium root rot

resistance using an F26 RIL populations derived from a cross between A.C. Compass,

32

highly susceptible to F usarium root rot, and NY2114-12, a gerrnplasm highly resistant to
F usarium root rot (Chowdbury et al., 2002). Six QTL for F usarium root rot resistance
were identified using a RIL population derived from a cross between the root rot
susceptible snap bean ‘Eagle’ and ‘Puebla 152’ a root rot resistant, black seeded dry bean

(Navarro et al., 2003).

Unbalanced populations an approach for studying quantitatively inherited traits

Experimental designs have been categorized according to the type of population
used to generate disequilibrium and the unit of marker analysis. In the classification of
experimental designs, some basic fundamental assumptions made. The primary
assumption is that the putative QTL is genetically linked to a marker with recombination
fraction (r) and based on this primary assumption other minor assumptions are made.
Within the minor assumptions one would find: the underlying distribution of the trait is
normal, no selection for either marker or QTL; only a single segregating QTL is linked to
each marker or marker pair; genetic markers do not have pleiotropic effects on the
quantitative traits; and no interaction between the QTL and other loci (epistasis); no
interaction between the QTL and other non-genetic factors.

When studying complexly inherited traits a different approach in terms of
population structure or experimental design is needed compared to simple inherited traits.
For low heritable traits more advanced type populations are needed where the trait of
interest is more or less fixed in a homozygous background. In contrast simple inherited
traits are of high heritability, not influenced by the environment, and can be evaluated in

early generation populations (e. g. F2, BCl). QTL studies for complex traits have used

33

balanced populations in which both parental alleles are in high frequency, for example
RILs, F2 populations, backcross (BCl), and double haploid populations (Brassica napus,
Butruille, et al., 1999). Backcross populations, however, are more informative (at low
marker saturation) when compared to RIL populations as the distance between linked loci
increases in RILs. By using balanced populations the position of the QTL on the
chromosome is determined efficiently, estimation of numbers of QTL affecting a trait of
interest is possible, and this allows for the estimation of the relative contribution of each
QTL to the expression of the trait of interest.

Alternative to the balanced population is the unbalanced population such as the
advanced backcross populations or inbred backcross lines (IBLs), also known as
backcross RILs, where the alleles of one parent are present at a much lower frequency
(Doganlar et al., 2002). IBLs population was first described when studying quantitative
characters in wheat, facilitating isolation and identification of the genes involved in the
inheritance of quantitative traits (Wehrhahn and Allard, 1965). IBLs are generated by
backcrossing multiple times to the recurrent parent and then the backcross F1 lines are
advanced by single seed descent to fix any segregating loci and reach the desired level of
homozygosity, in the same manner as is used to develop RILs. No selection pressure is
applied during IBL development. IBL are evaluated in replicated trials to identify those
lines that deviate significantly from the recurrent parent for the trait of interest.

Unbalanced populations have been used in QTL mapping to determine the
number of genes controlling a trait and for the introgression of desirable QTL from
unadapted to more adapted gerrnplasm (Fulton et al., 2000; Chetelat and Meglic, 2000;

Doganlar et al., 2002; Tanksley and Nelson, 1996). When using unbalanced populations

34

for mapping and identifying QTL there is a loss of resolution and efficiency (Butruille et
al., 1999; Tanksley and Nelson, 1996), but IBL have the advantage of being more
genetically and phenotypically similar to the recurrent parent, which generally has
market-desirable traits.

The advanced-backcross QTL (AB-QTL) analysis was proposed by Tanksley and
Nelson (1996) to transfer genetic variability for a quantitative trait from unadapted into
adapted pure line or inbred line cultivars using inbred-backcross line method combined
with QTL mapping of traits from the unadapted wild parent. This method allows a subset
of alleles from the unadapted parent to be examined in the genetic background of elite
adapted line. AB-QTL analysis was used successfully to identify alleles for yield,
soluble solids, and color from Lycopersicon hirstum (wild relative) in a L. esculentum
(cultivated species) background (Tanksley and McCouch, 1997). Increases in traits
ranged from 48% in yield, 22% in soluble solids, and 33% in color. Results also showed
that many of the traits were masked in the wild background e. g. L. hirstum is green in
color. In addition to the above study, using AB-QTL method, two QTL were found in
wild species of rice (Oryza rufipogon) which increased yield in cultivated rice (0. sativa)
by 17% (Xiao et al., 1997). A major objective of the AB-QTL population analysis has
been to create NILs by genotypic selection that will carry a specific targeted region of the
donor parent (Tanksley and Nelson, 1996). With the NILs any phenotypic difference
between the recurrent parent and the NIL was attributed to the existence of a specific
QTL. On the contrary, an IBL contains several segments fiom the donor parent. IBLs
and AB-QTL differ in the population development but are similar in that they both

resemble the recurrent parent of the cross. Results from Tanksley and Nelson (1996)

35

studies showed that compared with IBLs, the AB-QTL populations may be more efficient
in mapping and precisely estimating QTL effects.

A similar approach to the AB-QTL can be use when introgressing resistance from
one gene pool into another gene pool in common bean. Unbalanced populations are
useful when crossing between common bean gene pools (Middle-American and Andean
gene pools) to reduce the frequency of phenotypically inferior genetic material that
results from wide crosses. There is a reduction in power for the detection of QTL due to
the unequal allele frequency inherited in the inbred backcross populations (Butruille et
al., 1999), but the method can provide linkage information to enrich genetic maps
(Doganlar et al., 2002). The advantage of using such populations is the recovery of
material that resemble the recurrent parent but with the addition of desirable alleles from
the donor parent and the influence of other genes on the bioassays is limited (Lindhout,
2002)

When comparing classical F2 mapping strategy and IBLs to study downy mildew
resistance genes in lettuce several advantages for IBL versus F2 populations were given
(J euken and Lindhout, 2003). Genes that go unnoticed in the F2 population may be
detected in IBLs, due to effects that can be caused by several mechanisms. First, the
homogeneous genetic background found in IBL compared to F2 populations, will enhance
the detection power for single genes. Second, certain genotypes may be underrepresented
or over represented in an F2 population, so that other genes easily mask their effect.
Finally, epistatic interaction between unlinked genes may mask the main effect of single
genes in an F2, whereas in an IBL such interactions are absent. One disadvantage of IBL

populations could occur when a trait is expressed as a result of genetic interactions from

36

not closely linked genes the trait is not detectable in IBLs. In general, the IBL strategy
seem more efficient for the introgression of quantitative traits and to reveal QTL that are
not involved in genetic interactions making the introgression of the trait of interest

simpler in commercial cultivars (J euken and Lindhout, 2003).

Conclusion

Pathogens such as F. solani predominate and limit bean production not only in the
US. but elsewhere in the world where beans are planted. Chemical seed control is
ineffective and expensive, whereas the extreme susceptibility of snap bean and dry bean
genotypes to F usarium root rot disease combined with severe yield loss has led to strong
interest in developing resistant bean genotypes. Maintaining a vigorous plant by
management practices that promote healthy root development can only alleviate initial
infection by the pathogen. Stresses that reduce root growth may injure the plant by
reducing the volume and extent of soil exploration; water and nutrient acquisition, with a
subsequent reduction in shoot growth. In general, stress caused to the root-by-root rot
can affect whole plant growth leading to reduced yield in common bean.

Genetic resistance to F usarium root rot has been difficult to incorporate into
acceptable cultivars of the large seeded type Andean market classes. Excellent sources of
resistance have been identified in small seeded genotypes such as, N203 (PI 203958) and
NY2114-12 and several attempts have been made to transfer resistance to other bean
classes. Regardless of efforts made to transfer resistance, root rot resistance in large
seeded beans has been limited due to the difficulty of crossing between gene pools and

the type of populations used. Low to moderate heritabilities indicate that breeding and

37

selecting for root rot resistance in the field enviromnent is possible but low enough to
imply that effective selection requires progeny testing and evaluation of root rot as a
quantitative character. Identifying molecular markers linked to QTL associated with
resistance to root rot could provide the opportunity to indirectly select for QTL linked to
resistance in susceptible genotypes using a marker assisted selection approach. Marker
assisted selection, used to select indirectly for resistant genotypes, may facilitate
improvement of disease resistance, where field selection is laborious and destructive.

The pathogen species that dominates and limits production differ across bean
growing regions (Singh, 1999). F usarium root caused by F. solani is one of the most
prevalent bean diseases to cause severe yield losses world wide (Pastor-Corrales and
Schwartz, 1994) and is a major problem for Michigan growers, causing severe yield loss.
Resistance to root rot had been identified in tropically adapted lines, however there is a
need to characterize and incorporate that resistance into locally adapted red kidney bean
cultivars.

The physiological, architecture, and morphological features of individual root
systems affect many processes such as the composition of soil organisms, turnover of soil
organic matter, plant anchorage, acquisition of water and nutrients for plant growth.
These features will also affect the establishment, growth, reproduction and mortality of
plant populations (Bledsoe et al., 1999). Unfortunately, root systems are difficult to
study, primarily because they are spatially and temporally complex and because available
methods for their study are labor-intensive and destructive. The evaluation of roots for
F usarium root rot has been difficult since a score based on an ordinal scale instead of a

quantitative scale for a particular genotype is required for traits strongly influenced by

38

environmental factors (Schneider et al., 2001). A complex genotype by environment
interaction has made resistance breeding difficult so progress in controlling this disease
has been limited.

Detecting differences in root growth patterns and architecture between bean
genotypes may offer unique genetic selection criteria for enhancing tolerance to root
diseases and pests, lodging, drought, flooding, stressful root zone temperatures, or
edaphic adaptations (Leskovar and Stoffella, 1995). At present there are no models to
determine the relative importance of the various root classes to the total root system
function in beans, which complicates the prospects for breeding for root traits (Lynch and
van Beem, 1993; Kelly, 1998).

The introgression of F usarium root rot resistance into large-seeded kidney
gerrnplasm will require the use of resistance sources from other market classes
(Schneider et al., 2001). Such introgression should be possible by using the inbred
backcross line method to introgress resistance from the Middle American gene pool into
the Andean gene pool, in order to reduce the frequency of phenotypically inferior genetic
material that results from wide crosses and more rapidly obtain inbred lines that are
agronomically acceptable. The study of genetic resistance to root rot in dry beans,
especially in kidney beans, will give Michigan bean growers more choices when

selecting the most suitable bean types to produce.

General objectives: (1). Characterize genetic variation of root architecture in contrasting

bean types exhibited in different bean genotypes. (2). Determine if root architecture is

associated with F usarium root rot incidence in kidney bean populations. (3) Study the

39

effect of temperature on F. solani mycelium growth. (4). Use inbred backcross method
to transfer F usarium root rot resistance into large-seeded kidney and cranberry bean
populations using a small seeded as root rot resistant cultivar from Mexico as the donor
parent. (5). Identify and map QTL associated with F usarium root rot resistance in two

IBL populations.

40

References

Abawi, G. S. 1994. Pudriciones radiculares. p. 121-184. In: Pastor-Corrales, M. and H.
F. Schwartz, (eds.). Problemas de produccion de fiijol en los tropicos. Centro
Intl. Agri. Trop. (CIAT) Publication No. 230, Cali, Colombia.

Abbott, E.V. 1929. Diseases of economic plants in Peru. Phytopathology 19:645-656.

Achenbach, L. A. and J. Patrick. 1996. Use of RAPD markers as a diagnostic tool for
the identification of F usarium solani isolates that cause soybean sudden death
syndrome. Plant Dis. 80: 1228-1232.

Adam-Blondon, A. F., M. Sevignac, M. Dron, and H. Bannerot. 1994a. A genetic map
of common bean to localize specific resistance gene against anthracnose.
Genome 37:915-924.

Adam-Blondon, A. F ., M. Sevignac, H. Bannerot and M. Dron. 1994b. SCAR, RAPD
and RFLP markers linked to a dominant gene (Are) confening resistance to
anthracnose in common bean. Theor. Appl. Genet. 88:865-870.

Ahn, S. and S. D. Tanksley. 1993. Comparative linkage maps of the rice and maize
genomes. Genetics 90:7980-7984.

Ariyarathne, H. M., D. P. Coyne, G. Jung, P. W. Skroch, A. K. Vidaver, J. R. Steadman,
P. N. Miklas, and M. J. Bassett. 1999. Molecular mapping of disease resistance
genes for halo blight, common bacterial blight, and bean common mosaic virus in
a segregating population of common bean. J. Am. Soc. Hortic. Sci. 124:654-662.

Asins, M. J. 2002. Present and fiiture of quantitative trait locus analysis in plant
breeding. Plant Breeding 121:281-291

Azzam, H. A. 1958. Inheritance of resistance to Fusarium root rot in Phaseolus vulgaris
L. and Phaseolus coccineus L. Dis. Abstr. 18: 32-33.

Backhouse, D., L. W. Burgess, and B. A. Summerell. 2001. Biogeography of F usarium.
p. 122-137. In: Summerell, B. A., J. F. Leslie, D. Backhouse, W. L. Dryden, and
L. W. Burgess (eds.). Fusarium: Paul E. Nelson Memorial Symposium. The
American Phytopathological Society (APS) Press. St. Paul, Minnesota.

Beaver, J. S. 1993. A simple method for producing seed from hybrid dwarfs derived
from crosses between Middle American and Andean gene pools. Annu. Rpt.
Bean Improv. Coop. 36: 28-29.

Beebe, S. 1981. Pudriciones radiculares del frijol y su control: guia de estudio. Centro
Intl. Agri. Trop. (CIAT), Cali, Colombia. p.52

41

Beebe SE, and M. A Pastor-Corrales. 1991. Breeding for disease resistance. p. 561-
617. In: van Schoonhoven, A. and O. Voysest (eds). Common beans: research
for crop improvement. CAB. International. Wallington, UK.

Beebe, S. E., F. A. Bliss, and H. F. Schwartz. 1981. Root rot resistance in common bean
gerrnplasm of Latin American origin. Plant Dis. 65: 485-489.

Beebe, S., Skroch, J. Tohme, M.C. Duque, F. Pedraza, and J. Nienhuis. 2000. Structure
of genetic diversity among common bean landrace of Middle American origin
based on correspondence analysis of RAPD. Crop Sci. 40: 264-273.

Beebe, S., J. Rengifo, E. Gaitan, M.C. Duque and J. Tohme. 2001. Diversity and origin
of Andean landraces of common bean. Crop Sci. 41:854-862.

Blair, M. W., F. Pedraza, H. F. Buendia, E. Gaitan-Solis, S. E. Beebe, P. Gepts, and J.
Tohme. 2003. Development of a genome-wide anchored microsatellite map for
common bean (Phaseolus vulgaris L.). Theor. Appl. Genet. 107:1362-1374.

Bledsoe, C. S., T. Fahey, F. Day and R. Ruess. 1999 Measurement of static root
parameters -- biomass, length and distribution in the soil profile, pp. 413-436. In:
Standard Soils Methods for Long-Tenn Ecological Research (LTER) Sites (G.P.
Robertson, D.C. Coleman, C.S. Bledsoe, and P. Sollins, Eds.). Oxford Press,
London.

Boomstra, A. G. and F. A. Bliss. 1977. Inheritance of resistance to Fusarium solani f.

sp. phaseoli in beans (Phaseolus vulgaris L.) and breeding strategy to transfer
resistance. J. Amer. Soc. Hort. Sci. 102: 186-188.

Boomstra, A. G., F. A. Bliss, and S. E. Beebe. 1977. New sources of Fusarium root
rot resistance in beans, Phaseolus vulgaris L. J. Amer. Soc. Hort. Sci.

1021182-185.

Bravo, A., D. H. Wallace, and R. E. Wilkinson. 1969. Inheritance of resistance to
F usarium root rot of beans. Phytopathology 59: 1930-1933.

Broughton, W. J., G. Hernandez, M. Blair, S. Beebe, P. Gepts, and J. Vanderleyden.
2003. Beans (Phaseolus spp)- model food legumes. Plant and Soil 252: 55-128.

Burke, D. W. 1965a. Plant spacing and Fusarium root rot of beans. Phytopathology
55: 757-759.

Burke, D. W. 1965b. F usarium root rot of beans and behavior of the pathogen in
different soils. Phytopathology 55:1122-1126.

42

Burke, D. W. 1965c. The near immobility of F usarium solani f. phaseoli in natural
soils. Phytopathology 55:1 188-1190.

Burke, D. W. 1968. Root growth obstructions and Fusarium root rot of beans.
Phytopathology 58:1575-1576.

Burke, D. W. 1969. Significance of the plowed soil layer in Fusarium root rot of bean.
Phytopathology 59:1020.

Burke, D. W. 1975. New red and pink beans resistant to Fusarium root rot. Annu. Rpt.
Bean Improv. Coop. 18: 19-20.

Burke, D.W. 1982. Registration of red Mexican beans Rufus, NW-59 and NW-63. Crop
Sci. 22: 685-686.

Burke, D. W. and C. E. Nelson. 1965. Effects of row and plant spacing on yields of dry
beans. Wash. Agric. Exp. Stn. Tech. Bull. 664. 6p.

Burke D. W. and M. J. Silbemagel. 1965. Testing beans for field tolerance to F usarium
root rot. Phytopathology 55: 1045-1046.

Burke, D. W., and A. W. Barker. 1966. Importance of lateral roots in Fusarium root rot
of beans. Phytopathology 56:292-294.

Burke, D. W. and C. E. Nelson. 1967. Response of field beans to nitrogen fertilization
on F usarium-infested and no infested land. Wash. Agric. Exp. Stn. Bull. 687.5p.

Burke, D. W. and D. E. Miller. 1983. Control of Fusarium root rot with resistant beans
and cultural management. Plant Dis. 67: 1312-1317.

Burke, D. W. and R. Hall. 1991. Fusarium root rot, p. 9-10. In: Compendium of bean
diseases. R. Hall (ed.). APS Press, St. Paul, Minn.

Burke, D. W., L. D. Holmes, and A. W. Barker. 1972a. Distribution of F usarium solani
f. sp. phaseoli and bean roots in relation to tillage and soil compaction.
Phytopathology 62: 550-554.

Burke, D. W., D. E. Miller, L. D. Holmes, and AW. Barker. 1972b. Counteracting bean
root rot by loosening the soil. Phytopathology 62:306-309.

Burke, D. W., D. E. Miller and A. W. Barker. 1980. Effects of soil temperature on
growth of beans in relation to soil compaction and Fusarium root rot.

Phytopathology 70: 1047-1049.

Burkholder, W. H. 1916. Some root diseases of the bean. Phytopathology 6:104.
(Abstr.)

43

Burkholder, W. H. 1919. The dry root rot of the bean. N.Y. (Cornell) Agric. Exp. Stn.
Mem. 291999-1033.

Butruille, D. V., R. P. Guries, and T. C. Osborn. 1999. Linkage analysis of molecular
markers and quantitative trait loci in populations of inbred backcross lines of
Brassica napus L. Genetics 153:949-964.

Bywater, J. 1959. Infection of peas by Fusarium solani var. martii forrna 2 and the
spread of the pathogen. Brit. Mycol. Soc. Trans. 42:201-212.

Cardona, C., C. A. Flor, F. J. Morales, and M. A. Pastor-Corrales. 1995. Problemas de
campo en los cultivos de fiijol en el tropico. CIAT publicacion no. 241, Cali,
Colombia. 220p:illus.

Castanheira, A. L. M., J. B. dos Santos, D. F. Ferreira and L. C. Melo. 1999.
Identification of common bean alleles resistant to anthracnose using RAPD.
Genetics and Molecular Biology 22: 565-569.

Chatterjee, P. 1958. The bean root rot complex in Idaho. Phytopathology 48:197-200.

Chellemi, D. O. and S. M. Olson. 1994. Effects of soil solarization and fumigation on
survival of soil borne pathogens of tomato in northern Florida. Plant Dis.
78:1167-1172.

Chetelat, R. T. and V. Meglic. 2000. Molecular mapping of chromosome segments
introgressed from Solanum lycopersicoides into cultivated tomato (Lycopersicon
esculentum). Theor. Appl. Genet. 100:232-241.

Chowdbury, M. A., K. Yu, and S. J. Park. 2002. Molecular mapping of root rot
resistance in common beans. Annu. Rept. Bean Improv. Coop. 45:96-97.

Christou, T. and W. C. Snyder. 1962. Penetration and host-parasite relationships of
F usarium solani f. phaseoli in the bean plant. Phytopathology 52:219-226.

Crispin-Medina, A. and J. Campos-Avila. 1976. Bean diseases of importance in Mexico
in 1975. Plant Dis. Rep. 60: 534-535.

Cook, R. J. and M. N. Schroth. 1965a. Carbon and nitrogen compounds and germination
of chlamydospores of F usarium solani f. phaseoli. Phytopathology 55:254-256.

Cook, R. J. and W. C. Snyder. 1965b. Influence of host exudates on grth and survival

of germlings of Fusarium solani f. phaseoli in soil. Phytopathology 55:1021-
1025.

44

Cook, R. J. and R. I. Papendick. 1972. Influence of water potential of soils and plants on
root disease. Annu. Rev. Phytopathology 10:349-374.

Dickson, M. H. 1973. Selecting for root rot tolerance in snap beans. Annu.Rpt. Bean
Improv. Coop. 16:46-47.

Dickson, M. H. and M. A. Boettger. 1977. Breeding for multiple root rot resistance in
snap beans. J. Amer. Soc. Hort. Sci. 102: 373—377.

Doerge, R. W., Z-B. Zeng, and B. S. Weir. 1997. Statistical issues in the search for

genes affecting quantitative traits in experimental population. Stat. Sci.
12:195-219.

Dryden, P. and N. K. Van Alfen. 1984. Soil moisture, root system density, and infection
of roots of pinto beans by Fusarium solani f. sp. phaseoli under dryland
conditions. Phytopathology 74: 132-135.

Estevez de Jensen, C., R. Meronuck, and J. A. Percich. 1998. Etiology and control of
kidney bean root rot in Minnesota. Annu. Rpt. Bean Improv. Coop. 41 :55-56.

Estévez de Jensen, C., R. Meronuck, J. A. Percich, and K. Grafton. 1999. Control of
kidney bean root rot in Minnesota. Annu. Rept. Bean Improv. Coop. 42:63-64.

Estevez de Jensen, C., J. A. Percich, and P. H. Graham. 2002. Integrated management
strategies of bean root rot with Bacillus subtilis and Rhizobium in Minnesota.
Field Crops Research 74:107-115.

Furuya, H., T. Takahashi, and T. Matsumoto. 1999. Suppression of Fusarium solani f.
sp. phaseoli on bean by aluminum in acidic soils. Phytopathology 89: 47-52.

Gaitan-Solis, E., M. C. Duque, K. J. Edwards, and J. Tohme. 2002. Microsatellite repeat
in common bean (Phaseolus vulgaris): isolation, characterization, and cross-
species amplification in Phaseolus ssp. Crop Sci. 42:2128-2136.

Geffroy, V., M. Sevignac, J.C.F. De Oliveira, G. Fouilloux, P.Skroch, P. Tlroquet, P.
Gepts, T. Langin, and M. Dron. 2000. Inheritance of partial resistance against
Colletotrichum lindemuthianum in Phaseolus vulgaris and co-localization of

quantitative trait loci with genes involved in specific resistance. Mol. Plant-
Microb. Interact. 13:287-296.

Gepts, P. 1998. Origin and evolution of common bean: past events and recent trends.
HortScience 33: 1124-1130.

Gepts, P. and F. A. Bliss. 1985. Geographic distribution of F 1 hybrid weakness

inducing genes suggesting the existence of gene pools in cultivated common bean.
Annu. Rep. Bean Improv. Coop. 28:62-63.

45

Gordon, S. G., M. Bartsch, I. Matthies, H. O. Gevers, P. E. Lipps, and R. C. Pratt. 2004.
Linkage of Molecular Markers to Cercospora zeae-maydis Resistance in Maize.
Crop Sci. 44:628-636.

Haley, S. D., L. K. Afanador, P. N. Miklas, J. R. Stavely, and J. D. Kelly. 1994c.
Heterogeneous inbred populations are useful as sources of near isogenic lines for
RAPD marker localization. Theor. Appl. Genet. 88: 337-342.

Hall, R. and L. G. Phillips. 1992. Effect of crop sequence and rainfall on population
dynamics of F usarium solani f. sp. phaseoli in soil. Can. J. Bot. 70: 2005-2008.

Hall, R. and L. G. Phillips. 2004a. Methods for determining resistance of edible beans to
F usarium root rot. Annu. Rep. Bean Improv. Coop. 47:275-276.

Hall, R. and L. G. Phillips. 2004b. Dynamics of resistance of edible beans to F usarium
root rot. Annu. Rep. Bean Improv. Coop. 47:277-278.

Hassan, A. A., D. H. Wallace, and R. E. Wilkinson. 1971. Genetics and heritability of
resistance to Fusarium solani f. phaseoli in beans. J. Amer. Soc. Hort. Sci. 96:
623-627.

Henry, A. S. 1962. The effect of oxygen supply on the growth and the incidence of
root rot in beans. M.S. Michigan State University, East Lansing. 34p.

Hospital, F., C. Chevalet, and P. Mulsant. 1992. Using markers in gene introgression
breeding programs. Genetics 132: 1199-1210.

Hu, J. and B. A. Vick. 2003. Target region amplification polymorphism: a novel marker
technique for plant genotyping. Plt. Mol. Biol.Rep. 21 :289-294.

Huber, Don M. 1963. Investigations on root rot of beans caused by F usarium solani
f. phaseoli. Ph.D. Michigan State University, East Lansing. 97p.

J acobsen, H. J. 1999. Genetic transformation In: Singh, S.P. (Ed.), Development in plant

breeding. Common bean improvement in the Twenty-First Century. Kluwer
academic Publisher, Dordrecht, The Netherlands, pp 125-132.

J euken, M. J. W. and P. Lindhout. 2003. Future perspective of backcross inbred lines for
exploitation of wild germplasm: a case study on Lactuca saligna as a donor for

quantitative resistance to lettuce downy mildew. In: Th. J. L. van hintum, A.
Lebeda, D. Pink, and J. W. Schut, Eucarpia Leaf Vegetables p.69-74.

Kearsey, M. J. and A. G. L. Farquhar. 1998. QTL analysis in plants; where are we
now? Heredity 80: 137-142.

46

Keenan, J. G., H. D. Moore, N. Oshima, and LE. Jenkins. 1974. Effect of bean root rot

on dryland pinto bean production in southwestern Colorado. Plant Dis. Rep.
58: 890-892.

Kelly, J. D. 1988. The impact of the dwarf lethal (DL) genes on bean breeding programs
at MSU. Annu. Rept. Bean Improv. Coop. 31:192-193.

Kelly, J. D. 1989. The presence of dwarf lethal DL genes in Phaseolus gerrnplasm, lines,
and cultivars. . Annu. Rept. Bean Improv. Coop. 32:73-74.

Kelly, J. D. 1995. Use of random amplified polymorphic DNA markers in breeding for
major resistance to plant pathogens. HortScience 30:461-465.

Kelly, J. D. 1998. Bean roots- 3 plant breeder’s prospective. Annu. Rept. Bean Improv.
Coop. 41:214-215.

Kelly, J. D. and P. N. Miklas. 1998. The role of RAPD markers in breeding for disease
resistance in common bean. Molecular Breeding 4: 1-11.

Kelly, J. D., S. D. Haley, L. Afanador, P. N. Miklas and J. R. Stavely. 1994. Application
of RAPD markers for disease resistance breeding in beans. Annu. Rept. Bean
Improv. Coop. 37:15-16.

Kelly, J. D., P. Gepts, P. N. Miklas, and D. P. Coyne. 2003. Tagging and mapping of
genes and QTL and molecular marker-assisted selection for traits of economic
importance in bean and cowpea. Field Crop Res. 82:135-154.

Knapp, S. J. and W. C. Bridge. 1990. Using molecular markers to estimate quantitative
trait locus parameters: power and genetic variances for unreplicated and replicated
progeny. Genetics 126:769-777.

Kolkman, J. M. and J. D. Kelly. 2002. Agronomic traits affecting resistance to white
mold in common bean. Crop Sci. 42:693-699.

Kolkman, J. M. and J. D. Kelly. 2003. QTL conferring resistance and avoidance to
white mold in common bean. Crop Sci. 43:539-548.

Koinange, E. M. K. and P. Gepts. 1992. Hybrid weakness in wild Phaseolus vulgaris L.
JHered. 83:135-139.

Kovachevsky, I. 1931. French bean diseases in Bulgaria. Rev. Appl. Mycol. 10:151-
152.

47

Kraft, J. M., D. W. Burke, and W. A. Haglund. 1981. Fusarium diseases of beans, peas,
and lentils, p. 142-156. In: Nelson, P. E., T.A. Toussoun, and R. J. Cook (eds.).

F usarium; diseases, biology, and taxonomy. Pennsylvania State University Press,
University Park, PA, E.U.

Kraft, J. M. and W. Boege. 1996. Identification of characteristics associated with

resistance to root rot caused by Aphanomyces euteiches in pea. Plant Dis.
80:1383-1386.

Kraft, J. M. and W. Boege. 2001. Root characteristics in pea in relation to compaction
and Fusarium root rot. Plant Dis. 85:936—940.

Leskovar, D. L. and P. J. Stoffella. 1995. Vegetable seedling root systems: morphology,
development, and importance. HortScience 30:1153-1159.

Li, G., and C. F. Quiros. 2001. Sequence-related amplified polymorphism (SRAP), a
new marker system based on a simple PCR reaction: its application to mapping

and gene tagging in Brassica. Theor. Appl. Genet. 103:455-461.

Lindhout, P. 2002. The perspective of polygenic resistance in breeding for durable
disease resistance. Euphytica 1242217-226.

Lockwood, J. L. 1986. Soil borne plant pathogens: concepts and connections.
Phytopathology 76:20-27.

Lozovaya, V. V., A. V. Lygin, S. Li, G. L. Hartman, and J. M. Widholrn. 2004.
Biochemical response of soybean roots to F usarium solani f. sp. glycine infection.

Crop Sci. 44:819-826.

Lynch, J. and J. J. van Beem. 1993. Growth and architecture of seedling roots of
common bean genotypes. Crop Sci. 33: 1253-1257.

Ma, Z.Q., Roder, M. and Sorrells, ME. (1996) Frequencies and sequence characteristics
of di-, tri-, and tetra-nucleotide microsatellites in wheat. Genome 39, 123—30.

Mackay, T. F. C. 2001. The genetic architecture of quantitative traits. Annu. Rev.
Genet. 35:303-39.

Maiti, R. 1997. Phaseolus Spp. - bean science. Science Publishers, Inc. USA. 534p.

Maloy, O. C., and W. H. Burkholder. 1959. Some effects of crop rotation on the
F usarium root rot of bean. Phytopathology 49:583-587.

Maloy, O. C. Jr. 1960. Physiology of Fusarium solani f. phaseoli in relation to
saprophytic survival in soil. Phytopathology 50:56-61.

48

Maurer, C. L. and R. Barker. 1965. Ecology of plant pathogens in soil. II. Influence of
glucose, cellulose, and inorganic nitrogen amendments on the development of
bean root rot. Phytopathology 55:69-72.

McRostie, G. P. 1921. Inheritance of disease resistance in the common bean. J. Am.
Soc. Agron. 13:15-32.

Michelmore, R. W., I. Paran, and R. V. Kesseli. 1991. Identification of markers linked
to disease resistance genes by bulked segregant analysis: A rapid method to

detect markers in specific genomic regions using segregating populations. Proc.
Natl. Acad. Sci. USA 88:9828-9832.

Miklas, P. N., J. R. Stavely, and J. D. Kelly. 1993. Identification and potential use of a
molecular marker for rust resistance in common bean. Theor. Appl. Genet.
85:745-749.

Miklas, P. N., E. Johnson, V. Stone, J. S. Beaver, C. Montoya, and M. Zapata. 1996.
Selective mapping of QTL conditioning disease resistance in common bean. Crop
Sci. 36:1344-1351.

Miklas, P. N., V. Stone, C. A. Urrea, E. Johnson, and J. S. Beaver. 1998. Inheritance
and QTL analysis of field resistance to ashy stem blight in common bean. Crop
Sci. 38:916-921.

Miklas, P. N., J. R. Smith, R. Riley, K. F. Grafton, S. P. Singh, G. Jung, and D. P. Coyne.
2000. Marker-assisted breeding for pyramided resistance to common bacterial
blight in common bean. Ann. Rep. Bean Improv. Coop. 43:39-40.

Miklas, P. N., R. Delorme, W. C. Johnson, and P. Gepts. 2001. QTL conditioning
physiological resistance to white mold in dry eban. Crop Sci. 41 :309-315.

Miller, D. E. and D. W. Burke. 1974. Influence of soil bulk density and water potential
on F usarium root rot of beans. Phytopathology 64:526-529.

Miller, D. E. and D. W. Burke. 1975. Effect of soil aeration on F usarium root rot of
beans. Phytopathology 65:519-523.

Miller, D. E. and D. W. Burke. 1977. Effect of temporary excessive wetting on soil
aeration and F usarium root rot of beans. Plant Dis. Reptr. 61:175-179.

Mohr, U., J. Lange, T. Boller, A. Wiemken and R. Vogeli-Lange. 1998. Plant defense
genes are induced in the pathogenic interaction between bean roots and F usarium
solani, but not in the symbiotic interaction with the arbuscular nycorrhizal fungus
Glomus mosseae. New Phytol. 138:589-598.

49

Mondal, S. N., K. Kageyarna, and M. Hyakumachi. 1996. Chlamydospore formation in
F usarium solani f. sp. phaseoli in root extracts of crop plants and their virulence
to kidney beans (Phaseolus vulgaris L.). Soil. Biol. Biochem. 28:539-543.

Morgante, M. and A. M. Olivieri. 1993. PCR-amplified microsatellites as markers in
plant genetics. Plant J. 3:175-182.

Mulligan, M. F . 1983. The role of soil-borne fungi in the dry bean root rot complex.
M.S. Michigan State University, East Lansing. 87p.

Nash, S. M., T. Christou, and W. C. Snyder. 1961. Existence of Fusarium solani f.
phaseoli as chlamydospores in soil. Phytopathology 51:308-312.

Nash, S. M. and W. C. Snyder. 1964. Dissemination of the root rot F usarium with
bean seed. Phytopathology 54:880.

Navarro, F., M. Sass, and J. Nienhuis. 2003. Identification and mapping bean root rot
resistance in a population of Mesoamerican x Andean origin. Annu. Rept. Bean
Improv. Coop. 46:213-214.

Nelson, R. R. 1973. Breeding plants for disease resistance: concepts and applications.
The Pennsylvania State University Press University Park and London. p. 401

Nielsen, K. L., J. P. Lynch, and H. N. Weiss. 1997. Fractal geometry of bean root
systems: correlations between spatial and fractal dimension. Amer. J. of
Bot. 84:26-33.

Nienhuis, J ., J. Tivang, and P. Skroch. 1995. Analysis of genetic relationships among
genotypes based on molecular marker data, p. 8-14. In: Analysis of molecular
marker data. Corvallis, Oregon, 1994. Proceedings. Corvallis, American Society
for Horticultural Science and Crop Science Society of America, 1994.

Olaya, G., G. S. Abawi, and N. F. Weeden. 1996. Inheritance of the resistance to
Macrophomina phaseolina and identification of RAPD markers linked to the
resistance genes in beans. Phytopathology 86:674-679.

Papavizas, G. C., J. A. Lewis and P. B. Adams. 1968. Survival of root infecting fungi in
soil. 11. Influence of amendment and soil carbon to nitrogen balance on F usarium
root rot of beans. Phytopathology 58:365-372.

Park, S. J. and T. Rupert. 2000. Breeding for root rot resistance in common bean
(Phaseolus vulgaris L.). Annu. Rept. Bean Improv. Coop. 44: 41-42.

Park, S. 0., D. P. Coyne, J. R. Steadman, and P. W. Skroch. 2001. Mapping of QTL

for resistance to white mold disease in common bean. Theor. Appl. Genet.
85 :5 13-520.

50

Pastor-Corrales, M. P. and H. F. Schwartz. 1994. Problemas de produccion de frijol en
los trépicos. Centro Intemacional de Agricultura tropical (CIAT) Cali, Colombia.
805p.

Paterson, A. H. 1995. Molecular dissection of quantitative traits: progress and prospects.
Genome 5: 321-333.

Pfender, W. F. and D. J. Hagedom. 1982. Aphanomyces euteiches f. sp. phaseoli, a
causal agent of bean root and hypocotyls rot. Phytopathology 722306-310.

Pieczarka, D. J. and G. S. Abawi. 1978. Effect of interaction between Fusarium,
Pythium, and Rhizoctonia on severity of bean root rot. Phytopathology 68:403-
408.

Quarrie, S.A, V. Lazié-Jancié, D. Kovacevié, A. Steed, and S. Pekié. Bulk segregant
analysis with molecular markers and its use for improving drought resistance in
maize. J. Exp. Bot. 50:1299-1306.

Reiber, J. M. and D. S. Neuman. 1999a. Hybrid weakness in Phaseolus vulgaris L. I.
Disruption of development and hormonal allocation. J. Plant. Growth. Regul.
1 8: 101-106.

Reiber, J. M. and D. S. Neuman. 1999b. Hybrid weakness in Phaseolus vulgaris L. II.
Disruption of root-shoot integration. J. Plant. Growth. Regul. 18:107-112.

Reid, C. P. 1979. Mycorrhizae and water stress, pp.392-408. In A. Riedacker and J.
Gagnaire-Michard (eds.), Root Physiology and Symbiosis, Vol. 6. CNRF, Nancy,
France.

Robertson, L. S. and R. D. Frazier. 1982. Dry bean production— principal and practices.
Coop. Extension Service Michigan State University, Extension Bulletin E-1251
225p.

Rojas, M., S. Beebe, F. Pedraza, F. Mufioz, D. Beck, J. Lynch, S. Snapp, and J. Tohme.
1998. Mapping of genes for root rot characters in common bean. Annu. Rpt.
Bean Improv. Coop. 41 :59-60.

Roman-Avilés, B., S. S. Snapp, and J. D. Kelly. 2004. Assessing root traits associated
with root rot resistance in common bean. Field Crops Res. 86: 147-1 56.

Ruokola, A. L., M. Vestberg. 1978. Fungus diseases of field bean in Finland during
1975-1977. J. Sci. Ag. Soc. of Finland 50:455-467.

Savelkoul, P. H. M., H. J. M. Aarts, J. De Hass, L. Dijkshoom, B. Duim, M Otsen, J. L.

W. Rademaker, L. Schouls, and J. A. Lenstra. 1999. Amplified-fragment length
polymorphism analysis: the state of an art. J. Clinical Microb. 37 :3083-3091.

51

Schneider, K. A. and J. D. Kelly. 1999. Heritability estimates for resistance F usarium
root rot in common bean. Annu. Rept. Bean Improv. Coop. 42:65-66.

Schneider, K. A. and J. D. Kelly. 2000. A greenhouse screening protocol for F usarium
root rot in bean. HortScience 35:1095-1098.

Schneider, K., J. Kelly and K. Grafton. 1998. Evaluation and identification of root rot

resistance to Fusarium solani f. sp. phaseoli in common bean. Annu. Rpt. Bean
Improv. Coop. 41:57-58.

Schneider, K. A., K. F. Grafton, and J. D. Kelly. 2001. QTL analysis of resistance to
F usarium root rot in bean. Crop Sci. 41 :535-542.

Schneiter, A. A., D. W. Burke and J. R. Venette. 1982. Registration of ‘Pindak’ pinto
bean. Crop Sci. 22:157.

Schneiter, A. A., K. F. Grafton, D. W. Burke and G. C. Weiser. 1983. Registration of
‘Holberg’ pinto bean. Crop Sci. 23:1219.

Schroth M. N. and W. C. Snyder. 1961. Effects of host exudates on Chlamydospore
germination of the bean root rot firngus, Fusarium solani f. phaseoli.
Phytopathology 51:389-393.

Schroth M. N. and F. F. Jr., Hendrix. 1962. Influence of non-susceptible plants on the
survival of Fusarium solani f. phaseoli in soil. Phytopathology 52:906-909.

Schroth, M. N. and R. J. Cook. 1964. Seed exudation and its influence on pre-
emergence damping-off of bean, Phytopathology 54:670-673.

Schumacher, T. E. and A. J. M. Smucker. 1981. Mechanical impedance effects on
oxygen uptake and porosity of dry bean roots. Agronomy J. 73:51-55.

Schumacher, T. E. and A. J. M. Smucker. 1984. Effect of localized anoxia on Phaseolus
vulgaris L. root growth. J. Exp. Bot. 35:1039-1047.

Scott, M. E., and T. E. Michaels. 1992. Xanthomonas resistance of Phaseolus

interspecific cross selections confirmed by field performance. HortScience
27:348-350.

Shii, C. T., M. C. Mok, S. R. Temple, and D. W. S. Mok. 1980. Expression of
developmental abnormalities in hybrids of Phaseolus vulgaris L. J. Hered.
71:218-222.

Shii, C. T., M. C. Mok, and D. W. S. Mok. 1981. Developmental controls of

morphological mutants of Phaseolus vulgaris L.: differential expression of mutant
loci in plant organs. Develop. Genet. 2:279-290.

52

Silbemagel, M. J. 1987. F usarium root rot-resistance snap bean breeding line FR-266.
HortScience 22:1337-1338.

Silbemagel, M. J. 1990. Genetics and cultural control of F usarium root rot in bush snap
beans. Plant Dis. 74:61-66.

Silbemagel, M. J. and A. N. Hang. 1997. Release of pinto dry bean gerrnplasm lines
USWA-19 and USWA-20 with virus and root rot resistance. Annu. Rprt. Bean
Improv. Coop. 40:153-154.

Simpson, J. 1999. Molecular markers for crop improvement. p. 275-299. In: Molecular
Biotechnology for plant food production Technomic Publishing Company, Inc.
Lancaster, Pennsylvania.

Singh, S. P. 1999. Common bean improvement in the twenty-first century. Klumer
Academic Publishers Dordrecht, Boston. 405p.

Singh, S. P. and J. A. Gutierrez. 1984. Geographical distribution of the DU and DL2
genes causing hybrid dwarfism in Phaseolus vulgaris L., their association with
seed size, and their significance to breeding. Euphytica 33:337-345.

Singh, S. P. and A. Molina. 1996. Brief communication. Inheritance of crippled
trifoliate leaves occurring in interracial crosses of common bean and its
relationship with hybrid dwarfism. J. Hered. 87:464-469.

Singh, S. P., R. Nodari, and P. Gepts. 1991a. Genetic diversity in cultivated common
bean: I. Allozymes. Crop Sci. 31 :19—23.

Singh, S. P., J. A. Gutiérrez, A. Molina, C. Urrea, and P. Gepts. 1991b. Genetic
diversity in cultivated common bean. H. Marker-based analysis of morphological
and agronomic traits. Crop Sci. 31:23—29.

Sippell, D. W. and R. Hall. 1982. Effect of Fusarium solani phaseoli, Pythium ultimum,
and F. Oxysporum on yield components of white bean. Can. J. Plant Pathol.
4:54-58.

Smith, F. L. and B. R. Houston. 1960. Root rot resistance in common beans sought in
plant breeding program. Calif. Agr. Sept, p. 8.

Snapp, S. S., W. Kirk, B. Roman-Avilés, and J. Kelly. 2003. Root traits play a role in
integrated management of F usarium root rot in snap beans. HortScience 38: 187-
191.

Snyder, W. C., M. N. Schroth, and T. Christou. 1959. Effect of plant residues on root rot
of beans. Phytopathology 49:755-756.

53

Stanghellini, M. E and J. G. A. Hancock. 1970. A quantitative method for the isolation
of Phythium ultimum from soil. Phytopathology 60:551-552.

Statler, G. D. 1970. Resistance of bean plants to F usarium solani f. sp. phaseoli. Plant
Dis. Reptr. 54:698-699.

Staub, J. E., F. C. Serquen and M. Gupta. 1996. Genetic markers, map construction, and
their application in plant breeding. Hort Science 31:729-741.

Steadman, J. R., E. D. Kerr, and R. F. Mumm. 1975. Root rot of bean in Nebraska:
primary pathogen and yield loss appraisal. Plant Dis. Rprt. 59:305-308.

Stoffella P. J., R. F. Sandsted, R. W. Zobel, and W. L. Hymes. 1979. Root
characteristics of black beans- 11: Morphological differences among genotypes.
Crop Sci. 19: 826-830.

Stuber, C. W. 1991. Biochemical and Molecular markers in plant breeding. Plant
Breeding Rev. 9:37-61.

Schwartz, H., L. W. Panella, M. A. Brick, and P. F. Byme. 2001. Fusarium wilt and
yellows of sugar beet and dry Bean. Colorado State University Cooperative

Extension. Extension Bulletin No. 2.950, 4p.

Tabor, G. M., T. L. Kubisiak, N. B. Klopfenstein, R. B. Hall, and S. McNabb Jr. 2000.
Bulk segregant analysis identifies molecular markers linked to Melampsora
medusae resistance in Populus deltoids. Phytopathology 90:1039-1042.

Tan, C. S. and J. C. Tu. 1994. Tillage effect on root rot severity, growth and yield of
beans. Can. J. Plant Sci. 75:183-186.

Tanksley, S. D. and J. C. Nelson. 1996. Advanced backcross QTL analysis: a method
for the simultaneous discovery and transfer of valuable QTLs from unadapted
gerrnplasm into elite breeding lines. Theor. Appl. Genet. 92:191-203.

Tanksley, S. D. and S. R. McCouch. 1997. Seed banks and molecular maps: unlocking
genetic potential from the wild. Science 277:1063-1066.

Tanksley, S. D., N. D. Young, A. H. Paterson, and M. W. Bonierbale. 1989. RFLP
mapping in plant breeding- new tools for an old science. Biotechnology 7:275-
264.

Tohme, J., D. O. Gonzales, S. Beebe, and M. C. Duque. 1996. AFLP analysis of gene
pools of a wild bean core collection. Crop Sci. 36:1375-1384.

54

Toussoun, T. A., M. Nash and W. C. Snyder. 1960. The effect of nitrogen source and

glucose on the pathogenesis of Fusarium solani f. phaseoli. Phytopathology
50:137-140.

Tu, J. C. and S. C. Tan. 1988. Soil compaction effect on photosynthesis, root rot
severity, and growth of white beans. Can. J. Soil Sci. 68:455-459.

Tu, J. C. and S. J. Park. 1993. Root rot resistance in common bean. Ca. J. Plant Sci. 73:
365-367. .

Tu, J. C., C. S. Tan, and S. J. Park. 1992. Effect of soil moisture in root rot soil on plant
growth and root rot severity of susceptible and resistant bean cultivars. Med. Fac.
Landbouw. Rijksuniv. Gent. 57:381-386.

Vallejos, C. E., N. S. Sakiyama, and C. D. Chase. 1992. A molecular marker based
linkage map of Phaseolus vulgaris L. Genetics 131:733-740.

van Gestel, S., J .J . Houwing-Duistennaat, R . Adolfsson, C.M. van Duijn, and C. Van
Broeckhoven. 2000. Power of selective genotyping in genetic association
analysis of quantitative traits. Behav. Genet. 30:141-146.

Vleeshouwers, V., W. van Dooijeweert, F. Govers, S. Kamoun, and L. T. Colon. 2000.
the hypersensitive response is associated with host and nonhost resistance to
Phytophthora infestans. Planta 210:853-864.

Wallace, D. H. and R. E. Wilkinson. 1965 . Breeding for F usarium root rot resistance in
beans. Phytopathology 55:1227-1231.

Wallace, D. H., and R. E. Wilkinson. 1973. Cornell’s fifty-year search for root rot
resistance in dry beans. NY. Food Life Sci. 6:18-19.

Weber, W. E. and G. Wricke. 1994. Genetic markers in plant breeding. Paul Parey
Scientific Publishers Berlin and Hamburg. p. 3-26.

Weeden, N. F ., G. M. Timmerrnan, M. Hemmat, B. E. Kneen, and M. A. Lodhi. 1992.
Inheritance and reliability of RAPD markers, p.12-17. In: Applications of RAPD
technology to plant breeding. Crop Sci. Soc. Amer. Madison, Wis.

Welsh, J. R. 1981. Fundamentals of plant genetics and breeding. John Wiley and Sons,
Inc. New York. p.162-197.

Wood, D. R., A. G. Fisher, and M. Ballarin. 1983. Registration of Cahone bean. Crop
Sci. 23:399.

55

Xiao, J ., J. Li, S. Grandillo, S. N. Ahn, L. Yuan, S. D. Tanksley, and S. R. McCouch.
1997. Identification of heterosis-enhancing QTL alleles from wild rice relative,
Oryza rufipogon. Plant Genome V Abstract, p.147.

Yang, J. and P. D. Kharbanda. 1996. Characterization, virulence, and genetic variation
of Rhizoctonia solani AG-9 in Alberta. Plant Dis. 80:513-518.

Yerkes, W. D. and G. F. Freytag. 1956. Phaseolus coccineus as a source of root rot
resistance for the common bean. Phytopathology 46:32 (Abstr).

Young, R. A. 1995. Inheritance studies and development of RAPD markers for major
anthracnose resistance genes in common bean. Ph.D. thesis. Michigan State
University, East Lansing.

Young, N. D. 1996. QTL mapping and quantitative disease resistance in plants. Annu.
Rev. Phytopathol. 34:479-501.

Young, R. A. and J. D. Kelly. 1996a. Characterization of the genetic resistance to
Colletotrichum lindemutheanum in common bean. Plant Dis. 80:650-654.

Young, R. A. and J. D. Kelly. 1996b. RAPD markers flanking the Are gene for
anthracnose resistance in common bean. J. Amer. Soc. Hort. Sci. 121:37-41.

Young, R. A. and J. D. Kelly. 1997. RAPD markers linked to three major anthracnose
resistance genes in common bean. Crop Sci. 37:940-946.

Zhang, L.P., G.Y. Lin, D. Nifio-Liu, and MR. Foolad. 2003. Mapping QTLs conferring
early blight (Alternaria solani) resistance in a Lycopersicon esculcntumXL.
lzirsurum cross by selective genotyping. Mol. Breeding 12:3-19.

56

Chapter II

ASSESSING ROOT TRAITS ASSOCIATED WITH FUSARIUM ROOT ROT
RESISTANCE IN COMMON BEAN

Introduction

A number of soil-home, fungal pathogens are widespread throughout common
bean (Phaseolus vulgaris L.) production areas. One such pathogen is F usarium root rot
[caused by F usarium solani (Mart) Sacc. f. sp. phaseoli (Burk) W. C. Snyder & H. M.
Hans] which infect and colonizes common bean roots (Burke and Hall, 1991). Pathogen
infection acts to reduce root density by killing roots and may attenuate the functional
efficiency of the remaining infected roots. Seed yield losses from root rots in susceptible
kidney beans can be greater than 50% (Estevez de Jensen et al., 2002). The evaluation of
root traits and root rot tolerance mechanisms is particularly challenging, due to high root
plasticity in response to environmental factors (Snapp et al., 1995).

Root disease becomes more severe when bean roots are unable to escape the
pathogen due to edaphic factors. Low temperatures, drought, flooded or water logged
conditions and soil compaction can hamper root growth and predispose bean plants to
severe F usarium root rot infection (Thung and Rao, 1999). Seed yield loss is especially
severe when the disease occurs during flowering and pod-fill (Schneider et al., 2001).
When the primary root dies due to infection, its function could be replaced by roots that
arise from the shoot-root transition zone and generally adopt a horizontal rather than a
vertical orientation (Jackson, 1955). These basal roots are frequently referred to as

adventitious roots, although, by definition, adventitious roots arise only from hypocotyl

57

tissue (Leskovar and Stoffella, 1995). A root system with many horizontal roots has been
termed top-soil foraging architecture with competitive advantage for phosphorus-
acquisition in the topsoil (Rubio et al., 2003). Promoting lateral and adventitious roots
may also contribute to plant survival in the presence of root rot organisms (Burke and
Barker, 1966; Snapp et al., 2003). Integrated management strategies that combine
vigorous rooting systems with bio-control seed treatments may be the most profitable and
environmentally-appropriate approach to controlling root rot in bean (Estevez de Jensen
et al., 2002).

Limited knowledge on the relative importance and function of various root classes
complicates the prospects of breeding for root traits in common bean (Lynch and van
Beem, 1993; Kelly, 1998). Differences in root elongation and branching rate exist among
different plant genera, among species within a genus, and among cultivars within a
species (Gabehnan et al., 1986; Gallardo et al., 1996; Leskovar and Stoffella, 1995;
Lynch and van Beem, 1993; Jackson, 1995; Vercambre et al., 2003; Bingham and
Bengough, 2003; Zobel, 1995). Field studies suggest that root system traits play a role in
resistance of root rot (Burke and Barker, 1966; Snapp et al., 2003). Detecting genetic
differences in root growth patterns and architecture between genotypes may offer a
unique selection criteria for tolerance to root diseases enhanced by drought, flooding, and
stressful root zone temperatures (Leskovar and Stoffella, 1995).

Understanding mechanisms of F usarium root rot resistance in common bean,
especially kidney beans, is a major goal of breeding programs. Breeding for resistance
has been hampered by the high variability and scorer-bias associated with conventional

rating systems, whether using hypocotyl lesion scoring or whole root system scoring

58

(Beebe et al., 1981; Schneider et al., 2001). Root architecture traits, such as secondary
and tertiary root branches, adventitious roots, basal roots (arising from the basal region of
the hypocotyl), root angles, and radii, should also be considered in evaluating root
systems. Quantitative information on root system traits associated with root rot tolerance
would improve selection criteria. Moreover knowledge of the genetic determinants of
root traits and how they influence yield would allow for a more targeted breeding
approach utilizing technologies such as QTL analysis.

The objectives of this study were to: 1) characterize genetic variation of root
architecture in contrasting bean classes under field and greenhouse environments; and 2)
identify root system characteristics that may be related to root rot resistance in common

bean.

Materials and Methods
Bean genotypes

Ten genotypes representing, four bean seed classes (kidney, cranberry, blacks,
and snap beans), were evaluated for reaction to F usarium root rot and root system traits.
The characteristics and origin of genotypes chosen in each bean class are described in
Table 2.1. Shoot grth habit of the germplasm was characterized according to Singh
(1982). The bean genotypes included commercial genotypes grown by Midwestern
farmers, recent variety releases (Kelly et al., 1998; Kelly et al., 1999a, b) and black bean
genotypes from Mexico, Colombia and Michigan with known resistance to root rot. An
exception is FR266 (F usarium Resistant 266), which is a non-commercial snap bean line

that is closely related to kidney bean genotypes. FR266 was included as one of the few

59

Table 2.1. Characteristics of the common bean genotypes used to characterize bean roots

 

 

 

 

 

 

 

during the Summer 2002.
Growthl . . 11 SeedI Root Rot
Class Genotypes Habit Origin Size Reaction
Andean Gene Pool
Kidneys Red Hawk Type I MSU 63.8 Susceptible
Montcalm Type I MSU 61.3 Susceptible
Beluga Type I MSU 64.0 Susceptible
. Moderately§
Chinook 2000 Type I MSU 60.6 Resistant
Cranberries C97407 Type I MSU 54.5 Susceptible
Taylor Hort Type I Michigan 56.8 Susceptible
Snap bean FR266 Type I ARSQU‘EDA’ 30.7 Resistant
Middle American
Gene Pool
Blacks Negro San Luis Type III Mexico 38.5 Resistant
TLP 19 Type III CIAT 28.1 Susceptible
Moderately
B98311 Type II MSU 29.8 Resistant

 

1] = MSU= Michigan State University; ARS= Agricultural Research Service; USDA= US. Department of
Agriculture; CIAT= International Center for Tropical Agriculture;

1' = Singh, 1982;

I = Seed size is expressed as weight in grams 100 seed-1;

§ = Indicates those genotypes that had intermediate symptoms of F usarium root rot compared to the
resistant and susceptible genotypes.

60

examples of a genotype with reported resistance to F usarium root rot (Silbemagel, 1987).
Earlier findings indicate that the FR266 root system is highly branched (Snapp et al.,

2003)

Plant growth and management
a. Greenhouse experiments

Plant material was planted on June 30, 2002 and harvested on August 9, 2002 in a
greenhouse at Michigan State University in East Lansing, MI. Greenhouse temperature
was set to 25°C at day and 20°C at night. WatchdogTM temperature monitoring system
(Spectrum Technologies, Inc., 23839 West Andrew Rd. Plainfield, Illinois 60544) was
used to monitor soil temperature at 3 cm of depth in the containers. Soil temperatures
over the 30 days the experiment was conducted ranged from a low of 18° C to a high of
22° C during the first repetition and from 18 to 25° C during the second repetition.

Genotypes were planted under greenhouse conditions in TreepotsTM 40.6 cm in
depth and 15.2 cm in width. The potting media consist of a mixture of coconut coir and
perlite (1 :2). Earlier research indicated the mixture produced representative root systems
and root rot symptoms, and simplified root extraction to permit analysis of root growth
patterns in the potting media (Snapp et al., 2003). Seeds were germinated 5 days prior to
the initiation of the experiment to ensure uniform germination of all genotypes. A
modified, low phosphorus half-strength Hoagland’s solution was applied at planting and
once a week thereafter as needed. Harvesting was conducted once, 30 days after planting

(DAP) to minimize concern regarding restriction of root development in the containers.

61

The greenhouse experiment was arranged in a randomized complete block design.
Two repetitions of the greenhouse experiments were conducted, one initiated June 30,
2002 and the other initiated July 8, 2002. There were three replications of each genotype
per experiment. Each replication had ten homogeneous experimental units, each
consisting of three treepots and a single seedling was transplanted per pot. One way
analysis of variance using SAS was performed, evaluating genotype effect (SAS Inst,
Inc., Cary, NC). Where genotype was significant a means comparison was conducted
using a preplanned non-orthogonal comparison by bean class. Pearson correlation

coefficients were computed for all data collected.

b. Field experiment

The ten genotypes were evaluated under field conditions at the Montcahn
Research Farm located near Entrican, MI (43°20’N; 85°01 ’W), with an alfisol soil, series
name Montcalm/ McBride loamy sand. Plots were planted on June 20, 2002 and
harvested on July 27, 2002. The Montcalm location was chosen, as the soil type is
representative of bean producing areas in Michigan and the Upper Midwest where
F usarium root rot is a major problem, particularly for irrigated bean production sites. F.
solani. is endemic to the Montcalm site.

The experimental design was a lattice design with three replications. Each
experimental unit consisted of 20 plants per row (length of row was 5.0 m, 50 cm
between rows and 20 cm between plants within rows). Harvests were conducted at 30
and 60 DAP. At each harvest, nine plants per genotype were randomly chosen fiom each

experimental unit, making sure not to include border plants. Temperature for the field

62

trial varied fi'om 20° C to 26° C. Precipitation at Montcahn from the time of planting
until the time of harvest was 23 mm during the month of June and 28 mm during the

month of July. Irrigation provided an additional 41 mm H20 during the month of July.

Root system quantification
a. Greenhouse

Roots were harvested in the greenhouse as carefully as possible to assure the
removal of the whole root system and minimize error due to loss at harvest. Roots were
transferred to ice to prevent dehydration and taken to the laboratory where they were
processed for analysis.

Roots were washed to remove excess coconut coir and perlite that was attached to
the root system. Root architectural traits were analyzed following a slightly modified
procedure of Yabba and Foster (2003) and F rahm et a1. (2003) using the software
WinRHIZOTM (WinRHIZO, Regents Instruments Inc. (2001) Quebec, Canada).
Individual root systems were transferred for scanning to a 30 cm x 20 cm plexi-glass
plate where they floated in clear water and were carefully dispersed into individual lateral
roots and secondary roots with forceps as far as practicable to prevent overlapping
(Harris and Campbell, 1989). Care was taken to exclude the sides of the tray from the
window area to avoid erroneous counts. Each root was scanned independently twice
(front and back) to assure scanning of all roots and the average of two measurements
were taken. Although root systems develop a three-dimensional form in the soil, roots
were measured in two dimensions in this study. Dry weight (dried at 60° C for 72 hours
for dry weight determination) of above ground (vegetative area) and below ground (root

system) sections of the plants were taken. The following root morphology parameters

63

were measured: total root system length (cm), root system surface area (cmz), root system
projected area (cmz), average root diameter (mm), total root volume (cm3), crossings,
number of meristems (tips), and fractal dimension. Manual counting was conducted to
determine the number of adventitious roots. Roots were divided into ten classes, based
upon root length and diameter [class A (0-0.5 cm), class B (0.51-1.0 cm), class C (1 .01-
1.5 cm), class D (1.51-2.0 cm), class E (2.01-2.5 cm), class F (25130 cm), class G
(3.01-3.5 cm), class H (3.51-4.0 cm), class I (401-4.5 cm), and class J (> 4.5 cm)],
previously described by Yabba and Foster (2003) and Frahm et al. (2003), with slight
modification. The ten root length classes classified as A-J respectively were grouped in
three root diameter classes: fine roots or secondary roots (A-C), intermediate roots or
laterals (D-G), and taproots (H-J). In this study lateral roots were defined as a major root

axis originating at the taproot.

b. Field

Because, field root harvesting is challenging, special care was taken to ensure that
roots were dug up carefully and that root systems were as intact as was possible. These
roots were harvested to an approximate depth of 0.31 m. After removing roots fi'om the
soil they were immediately put in a cooler with water and ice to prevent dehydration. At
time of harvest, roots were rated in the field for F usarium root rot symptoms using the
root rating scale of 1 to 7, where 1= root system completely free of disease and 7: root
system severely affected by disease (Schneider and Kelly, 2000). The roots were taken to
the laboratory and cleaned of excess soil. They were processed for image analysis

following the procedures described for the greenhouse study.

Results and Discussion
Root system variation: genotypes

There were marked differences in adventitious rooting of genotypes, which varied
from 4 to 43 adventitious roots per plant among the bean genotypes screened in the field,
and from 0 to 8 adventitious roots per plant under greenhouse conditions (Figure 2.1A).
The root rot resistant genotype Negro San Luis (N SL) exhibited a root system that
accumulated biomass rapidly and had many adventitious roots, as did the moderately
resistant genotypes B98311 and Chinook 2000. Under greenhouse conditions, Chinook
2000 had the highest number of adventitious roots followed by the susceptible TLP19
and the most resistant line, NSL, whereas some of the resistant genotypes had large
diameter roots (Figure 2.1A). B98311 had the highest number of adventitious roots
under field conditions followed by TLP19, NSL, and Chinook 2000. B98311 is a
drought resistant line that has been reported as having a vigorous, deep-penetrating
taproot (F rahm et al., 2003). Although shallow adventitious roots are more susceptible to
drought, adventitious roots are likely to persist under irrigation, and continue to function
and contribute to the long-term development of the root system in soils infested with soil
borne pathogens (Johnson et al., 2000).

Fractal dimension provides a measure of root system size and density of root
branching. Since research has shown that ontogeny is closely related to fractal dimension
(Bemtson et al., 1995), comparisons of genotypes should be at the same state of

development. Fractal dimension values observed ranged from 1.40 to 1.55 (Figure 2.1D)

65

 

38¢ Best—535V no 62

 

2:83.52 .3 .oz

 

Any 2.335 in .com

non

am
am

:H-wm
m _
can
no
non

 

535E:— .398...—

Greenhouse

Field

D

 

tom 833.
5350
ems—om
39E

8:00:82

:5: 8m
88 8820

Genotypes

£34 new Ewoz
mad.

fl Swom

Illustration of differences between genotypes 30 days after planting under

Figure 2.1.

(Different letters on columns represent

field and greenhouse conditions for root traits.

statistical differences at P< 0.05)

66

and were similar to the range in fractal dimension reported in an earlier study of bean root
systems (Lynch and van Beem, 1993). In our study, the most root rot susceptible
genotype, Montcalm, had a notably weak root system as characterized by limited
branching which was reflected in the lowest level of fractal dimension observed for the
field environment (Figure 2.1D) and the limited amount of dry weight accumulated in the
root system (Figure 2.1C).

Plants were evaluated 30 DAP in both the field and greenhouse and
developmental stage was similar in both environments, yet the genotype by environment
interaction was substantial. Adventitious rooting was greatly enhanced under field
conditions compared to greenhouse grown plants (Figure 2.1A), whereas meristem
number was high in the greenhouse trial (Figure 2.1B). Chinook 2000 had the largest
number of meristems compared to other kidney bean genotypes (F igure2.1B). Chinook
2000 was a plant selection made within ‘Chinook’ light red kidney cultivar (Kelly et al.,
1999a), which was derived from crosses that included a black bean in its genetic
background; black bean root systems may be associated with greater branchiness or root
system meristem number (Kelly et al., 1992).

The reason for this phenomenon is not well understood, but the large number of
lateral adventitious roots in the field may be related to the greater level of stress in the
field environment, where nutrient and water supply is dynamic. In the greenhouse
screen, root systems had many meristems, which may be related to proliferation of fine
roots in low bulk density container systems or the disease stress in the field environment

may have reduced the survival of fine roots. Roots in the field interact with indigenous

67

soil-borne diseases and other soil microorganisms, which could potentially enhance
initiation of adventitious roots by attacking the main tap root.

A large number of root meristems have been associated with acquisition of
immobile nutrients such as phosphorus (Rubio et al., 2003). In both the greenhouse and
field-based screens conducted here no significant difference was observed for number of
meristems between Chinook 2000 and the resistant genotype NSL, and between B98311,
TLP19, C97407, and Red Hawk (Figure 2.1B). TLP19 was previously selected as
tolerant to low phosphorus, thus we hypothesized it would have multiple branched, top-
foraging root architecture; however, this was not observed. These traits have been
observed in lines resistant to low phosphorus (Bosner et al., 1996; Lynch and Beebe,
1995; Frahm et al., 2003). Other mechanisms such as root plasticity and rhizosphere
acidification may contribute to low-phosphorus tolerance in TLP19 (Snapp ct al., 1995;

Yan et al., 1996).

Root system variation: bean classes

The four bean classes in this study varied significantly in plant growth habit and
root system architecture (Table 2.2 and 2.3). Significant differences among bean classes
were observed for all traits except root diameter in the field, whereas only root surface
area, root volume, root dry weight, and fractal dimension were different in the
greenhouse (Appendix A- Table A.1). Large differences between field and greenhouse
data were observed for most traits except root diameter, and fractal dimension. Selection
for root dry weight would appear to be useful in the greenhouse, but should be delayed to

flowering around 45 DAP. The later harvest date would prevent the measurement of

68

.86 v& 3 moooocobfi 33393 88898 8828 :0 B88— EEobE

.3350 .8925 288 .2: $5ng Seemed .ONHEMEBV .9838 ONHEB mam: coca—c806 Bo? moumtofifimfi H

638% one coca—o5 mmflo anon

anew um 28 .mombozow 3H5 woe—:2: mam—o anon Jon—m Hm .mogoaow o>c vows—2: $30 53 E2580 HO .momboaow 58 pupa—o5 mam—o 503 >263 NM 5.

 

 

 

a flow a wmm n v: e 32 a mad a 3: m owd a mg a ohm m
an oém e ms nu mmm e we; a cmd pm IN a mwd an mda an Rm O
a 3K a BMW a 3w 9 $4 a fine a 3N e mwd e wdfi a 3v m
n 3% m mow n :v m «an; 0 Cd 9 ow.“ e mwd a 9mm a RN M
20E
e oémm m wmmm a 30m a 91 9 Sam n ooé m end a o.w~m a 32 m
a o4? a Emm a Son m 34 9 Sam an mo;V a mod as wfimm m 3 I O
m memv e vwmm m comm a mm; on Sam pm N: a mod n odvm e mm: m
a imam a 3mm e swam m m; a mod a med a mud n w.mm~ a v2: M
850:5on
58585 @ Emmy? AME: AEEV $83 A £83 88
+ $585 + 3:. H atom . . DD oE£o> 53:85 82 _ momma—O
.. + “:3an “co m ”fiwcoq
m mood he Bo>< Maugham
.88 568% 2: mesa H2

.3550 £8282 .cmoficm S 32558 Bow use 8:055on Home: @0582: $8.5 “ooh “seesaw—o com $808 mmfio :mom .N.N 2an

69

538038 22,2 basses 33. .86 .86 as a Banana 2... .: ._.

.386 .0826 28$ .05 3883...: sense .oammsi eases canes? was: 35.52% as; 85:28.26 H

638% 28 39:2: mam—o anon

98m um can .3305» 086 cows—2: awe—o :33 Mona um .mogoaom 9.2 vows—2: mmflo anon BREED HO .mogoaow Bo.“ wove—o5 mmflo anon >262 HM +

 

 

 

EM omd $6 :6 1.3.: mod mod Ed 86 O .m> M
1.8.3 End 3%.: 3.2.x 3.30.3 3.3.2 9.6 ssmmefi 1.2.: m .m> M
3.». mm; wvd ow; .........NN. M m Exam Ed ...ow.w .436 m .m> M
22m
mud mod 5d 36 *Nwé Sum owd mod 26 O .m> M
Nvd mod wmd 7nd wwd 2V.— th 86 m M .o m .m> M
8.9 wmd Q: .506. *Nm.m same no; somm Ned m .m> M
own—0:580
mosque—Q @ Ems? AME“; 925 $63 A Ema Eov
wSmmBO was. .. mfiom . . DO o§_o> c2255 32 _ momma—O
H . a . + ”38$ . numcoq .2
Boom lmooM Homeco>< ”Sufism H

 

.Noom .6853 2: merge H2 .bSSO E8302 mnmogam we 283980 Bow EB 832.38% .895
@8338 $85 Book Epcot? com momma—o :39 E358 BB .925 £83 59> “webs—co E awe—o neon >263 com mos—gm .mN 038.

70

other root length, area and volume traits for which variability was limited in the
greenhouse. Taproots contributed more than 1% of the total root length of kidney bean
class in the greenhouse, whereas taproot length was less than 1% in cranberry, snap bean,
and black bean classes. Across all bean classes, 95% of the final root length was
contributed by the fine roots and ~ 4% by intermediate roots (Appendix A- Table A2).

Significant major contrasts for root dry weight were observed between kidney
bean and all other classes (Table 2.3). Differences by bean market class appeared to be
related to shoot growth habit and growth rate, as kidney beans (Type I shoot growth
habit) exhibit a relatively shallow root system with lateral roots arising from the taproot
at the base of the stem. This is similar to earlier observations of related bean root systems
(Kelly, 1998; Stoffella et al., 1979), and the relationship of shoot to root growth habit in
bean genotypes studied by Lynch and van Beem (1993). Similar to kidney bean,
cranberry bean root systems (Type I shoot growth habit) tended to be shallow (length)
and with limited branching (forks, crossing; Tables 2.2 and 2.3). In contrast, root
systems of the black bean class (Type II and III shoot grth habit) tended to have many
adventitious roots and a dominant tap root system (Figure 2.1A). The black bean class
exhibits basal roots similar to those described by Stoffella et al. (1979) in beans and by
Zobel (1995) in tomatoes. The black bean B98311 exhibits a deeper root system as
described by Frahm et al. (2003) compared to TLP19 and NSL, although the root rot
resistant genotype NSL has a highly branched root system similar to B98311.

The snap bean class had only one representative, FR266 genotype, which is a root
rot resistant breeding line with a determinate bush grth habit (Silbemagel, 1987) and

may not be typical of the level of root rot resistance of this class. Thus no generalizations

71

can be made about snap beans. It was interesting to note, however, that FR266 exhibits a
root system similar to Chinook 2000 at 30 DAP. The root system is highly branched in
the upper 12 cm and has a corresponding higher root dry weight (Figure 2.1C). FR266 is
also similar to B98311 in possessing deep laterals, but with less secondary root branching
in the lower portion of the roots toward the root tips. The source of F usarium root rot
resistance in FR266 was derived from P1 203958 (N203), an indeterminate prostrate vine
black bean-seeded line from Mexico that was used multiple times as a parent during the
crossing process (Sibemagel, 1987). A possible explanation for the similarity in root
systems between FR266, Chinook 2000 and B98311, which represent different market
classes (Table 2.1), is that FR266 and Chinook 2000 both possess a black bean in their
genetic background and B98311 is a black bean genotype.

Similar to the findings of Lynch and van Beem (1993), the indeterminate Type II
and type III black bean lines, tended to have more adventitious roots and a deeper, more
extensive root system. In our study a larger number of genotypes were compared than in
previous research, and it appeared that beyond extensive (deep, many laterals) and
intensive (highly branched, shallow) types of root systems we also observed a vigorous,
highly branched intensive root system with a large number of extensive laterals. This
observation is consistent with it being possible to combine an intensive and extensive
root system type from diverse genetic backgrounds. This combination occurred in the

black bean class, or in genotypes with black bean parentage.

72

Root system screening methodology

Substantial differences in adventitious rooting and other root traits were observed
at 30 DAP in the field compared to the greenhouse (Figure 2.1). Genotypes with smaller
seed size are distinct and appear to generally have a larger number of adventitious roots
under field conditions compared to the greenhouse environment. Data collected in our
greenhouse studies exhibited no significant differences between bean classes for most of
the characteristics studied, perhaps due to root restrictions imposed in a non-stressful
enviromnent in the pots, or to differences in growth media (Tables 2.2 and 2.3; Appendix
A- Table A.1 and A.2). Laboratory screening systems for root grth response in rice
have also found limited correlation with field performance (Clark et al., 2002). Plasticity
may be enhanced in a heterogeneous field environment where a range of signals induce
branching and root morphological changes (Wraith and Wright, 1998). Root plasticity is
an adaptive variable that enhances resource acquisition and anchorage in a heterogeneous
environment (Campbell et al., 1991). Investigation of plasticity to a specific constraint
may require a controlled environment, whereas testing for general plasticity and ability to
overcome realistic stress encountered in the field environment may require field-based
evaluations.

Total root dry weight was significantly correlated to fine (r=O.744; P<0.001) and
intermediate (r=0.657; P<0.01) root classes under field conditions, but was not
significantly correlated with average diameter under greenhouse or field conditions
(Table 2.4). No significant correlation was observed for average diameter and total root
dry weight under greenhouse conditions. The smaller taproot diameter in comparison

with the diameter of the intermediate roots is a result of severe disease development and

73

Table 2.4. Correlation coefficients (r) for root classes grouped in three categories,
average diameter, and total root dry weight for greenhouse study and one field trial

conducted during the summer, 2002 in Montcalm, MI.
Root Diameter Classes "

 

 

Average
Diameter -----------------------------------------
Fine Intermediate Taproots
Greenhouse
Total root dry weight 0.524 -0.251 0.390 0.465
Average Diameter -0.361 0.795** 0.809**
Field
Total root dry weight 0.292 0.745*** 0.657** -0.009
0.156 0.605" 0502*

Average Diameter
*, **, *** Significant at the 0.05, 0.01, and 0.001 probability levels, respectively

’r Root classes were grouped in three major classes: fine roots (included A, B, and C root length in diameter

classes) intermediate roots (included D, E, F, and G root length in diameter classes), taproots (included H,

 

I, and J root length in diameter classes).

74

environmental factors in the field. Average root diameter was highly and significantly
correlated with intermediate and taproots root classes both under greenhouse (r=O.795
and r=0.809; P<0.01, respectively) and field conditions (1=O.605 and 0.502; P<0.01 and
P<0.05, respectively). The thickening of intermediate roots and taproots appears to be
associated with dry weight accumulation of these root classes, for screening conducted in
both field and greenhouse environments.

There was a trend towards a greater number of adventitious roots in plants with
lower root rot scores in the field environment although variation was high (r=-0.06;
P<0.05). Root systems with many adventitious roots may avoid some negative effects of
disease through replacement of the function of disease-infected roots (Miller, 1986;
Stoffella et al., 1979). However, B98311, NSL, and FR266 varied greatly in number of
adventitious roots (Figure 2.1A). Our results are consistent with the partial replacement
by adventitious roots of roots eliminated by F usarium root rot in susceptible common
bean genotypes. A similar association of adventitious rooting with F usarium root rot
tolerance was observed in an earlier study Involving inbred bean lines (Snapp et al.,
2003). High root plasticity may enhance plant growth and survival through continuous
alteration of the root system in response to a varied soil environment (Smucker, 1993).
To eliminate the interference of genetic differences among bean classes, a more effective
method to study root plasticity would be to generate genetic populations consisting of
recombinant inbred lines developed from parents contrasting only in root characteristics.
These populations would provide the best opportunity to study root plasticity and the role
of adventitious roots and root dry weight in root rot resistance given the wide genetic

differences observed between the bean genotypes in this study.

75

Conclusions

Our results show that genetic variation for root architecture exists among different
bean genotypes, and between common bean market classes. Results from this and
previous research indicate that root traits such as adventitious roots (Snapp et al., 2003),
total root dry weight (Kmiecik and Bliss, 1986), and lateral roots (Burke and Barker,
1966; Schneider and Kelly, 2000) can be quantified as part of a selection process by plant
breeders interested in enhanced root rot resistance and over all root health of common
bean. Classical methods for studying root systems involve excavation of whole root
systems. This poses challenges in keeping root systems intact and extracting fine roots,
yet it provides a realistic view of architectural changes that occur as root systems respond
to environmental conditions and biotic stress caused by soil borne pathogens. In this
study, a field-based screen markedly enhanced adventitious rooting response compared to
greenhouse screens. Greenhouse studies can be effective in understanding root system
traits, but may be problematic in terms of container restrictions to growth and potentially
providing a less stressed, unrealistic environment. Our study indicates that the potential
exists to improve rooting characteristics of common bean and despite the genotypic
differences between market classes, it would appear that breeders have been effective in
introgressing desirable rooting traits from black bean into kidney and snap bean. These
introgressed lines such as Chinook 2000 and FR266 would be valuable as parental lines
to further enhance the root rot resistance of susceptible commercial kidney and snap bean

varieties.

76

References

Beebe, S. E. and F. A. Bliss. 1981. Root rot resistance in common bean gerrnplasm of
Latin American origin. Plant Dis. 65:485—489.

Bemtson, G. M., J. Lynch, and S. S. Snapp. 1995. Fractal geometry and plant root
systems: Current perspectives and future applications. In: Baveye, P., Parlange,
J .Y., Stewart, B.A. (Eds), Fractals in Soil Science. Lewis Pub., New York, pp.
113-152.

Bingham, I. J. and A. G. Bengough. 2003. Morphological plasticity of wheat and barley
roots in response to spatial variation in soil strength. Plant Soil 250:273-282.

Bosner, A. M., J. Lynch, and S. Snapp. 1996. Effect of phosphorus deficiency on growth
angle of basal roots in Phaseolus vulgaris. New Phytol. 132:281-288.

Burke, D. W. and A. W. Barker. 1966. Importance of lateral roots in Fusarium root rot
of beans. Phytopathology 56:292-294.

Burke, D. W. and R. Hall. 1991. Fusarium root rot. In: R. Hall (Ed.), Compendium of
Bean Disease. APS Press, Minnesota, USA. pp. 9-10.

Campbell, B. D., J. P. Grime, and J. M. Mackey. 1991. A trade off between scale and
precision in resource foraging. Oecologia 87:532-538.

Clark, L. J., R. E. Cope, W. R. Whalley, P. B. Barraclough, and L. J. Wade. 2002. Root
penetration of strong soil in rainfed lowland rice: comparison of laboratory
screens with field performance. Field Crops Res. 76:189-198.

Estevez de Jensen, C., J. A. Perchcich, and P. H. Graham. 2002. Integrated management
strategies of bean root rot with Bacillus subtilis and Rhizobium in Minnesota.
Field Crops Res. 74:107-115.

Frahm, M. A., E. F. Foster, and J. D. Kelly. 2003. Indirect screening techniques for
drought resistance in dry bean. Annu. Rep. Bean Improv. Coop. 46:87-88.

Gabelman, W. H., G. C. Gerloff, T. Schettini, and R. Coltman. 1986. Genetic variability
in root systems associated with nutrient acquisition and use. HortScience
21:971-973.

Gallardo, M., L. E. Jackson, and R. B. Thompson. 1996. Shoot and root physiological

responses to localized zones of soil moisture in cultivated and wild lettuce
(Lactuca spp.). Plant, Cell and Environ. 19:1169-1178.

77

Harris, G. A. and G. S. Campbell. 1989. Automated quantification of roots using a
simple image analyzer. Agron. J. 81:935-938.

Jackson, L. E. 1995. Root architecture in cultivated and wild lettuce (Lactuca spp.).
Plant Cell and Environ. 18:885-894.

Jackson, W. T. 1955. The role of adventitious roots in recovery of shoots following
flooding of the original root system. Amer. J. Bot. 42:816-819.

Johnson, W. C., L. E. Jackson, 0. Ochoa, R. van Wijk, J. Peleman, D. A. St. Clair, and R.
W. Michelmore. 2000. Lettuce, a shallow-rooted crop, and Lactuca serriola, its
wild progenitor, differ at QTL determining root architecture and deep soil water
exploitation. Theor. Appl. Genet. 101 :1066-1073.

Kelly, J. D. 1998. Bean roots- a plant breeder’s prospective. Annu. Rep. Bean Improv.
Coop. 41:214-215.

Kelly, J. D., M. W. Adams, A. W. Saettler, G. L. Hosfield, G. V. Varner, M. A.
Uebersax, A. Ghaderi, and J. Taylor. 1992. Registration of ‘Chinook’ light red
kidney bean. Crop Sci. 32:492-493.

Kelly, J. D., G. L. Hosfield, G. V. Varner, M. A. Uebersax, R. A. Long, and J. Taylor.
1998. Registration of ‘Red Hawk’ dark red kidney bean. Crop Sci. 38:280-281.

Kelly, J. D., G. L. Hosfield, G. V. Varner, M. A. Uebersax, and J. Taylor. 1999a.
Registration of ‘Chinook 2000' light red kidney bean. Crop Sci. 39:293.

Kelly, J. D., G. L. Hosfield, G. V. Varner, M. A. Uebersax, and J. Taylor. 1999b.
Registration of ‘Beluga’ alubia bean. Crop Sci. 39:294.

Kmiecik, K. A. and F. A. Bliss. 1986. Field resistance of snap beans to root rot
determined by root dry mass. Annu. Rep. Bean Improv. Coop. 29:85-86.

Leskovar, D. I. and P. T. Stoffella. 1995. Vegetable seedling root systems: morphology,
development, and importance. HortScience 30:1153-1159.

Lynch, J. P. and J. J. van Beem. 1993. Growth and architecture of seedling roots of
common bean cultivars. Crop Sci. 33:1253-1257.

Lynch, J. P. and S. E. Beebe. 1995. Adaptation of beans (Phaseolus vulgaris L.) to low
phosphorus availability. Crop Sci. 30:1165-1171.

Miller, D. E. 1986. Root systems in relation to stress tolerance. HortScience 21 :963-
970.

78

Rubio, G., H. Liao, X. Yan and J. P. Lynch. 2003. Topsoil foraging and its role in plant
competitiveness for phosphorus in common bean. Crop Sci. 43:598-607.

Schneider, K. A. and J. D. Kelly. 2000. A greenhouse screening protocol for F usarium
root rot in bean. HortScience 35:1095-1098.

Schneider, K. A., K. F. Grafton, and J. D. Kelly. 2001. QTL analysis of resistance to
fusarium root rot in bean. Crop Sci. 41:535-542.

Silbemagel, M. J. 1987. Fusarium root rot-resistance snap bean breeding line FR-266.
HortScience 22:1337-1338.

Smucker, A. J. M. 1993. Soil environmental modifications of root dynamics and
measurements. Annu. Rev. Phytopathol. 31 2191-216.

Singh, S. P. 1982. A key for identification of different growth habits of Phaseolus
vulgaris L. Annu. Rep. Bean Improv. Coop. 25:92-94.

Snapp, S. S., R. Koide, and J. P. Lynch. 1995. Exploitation of localized P-patches by
common bean roots. Plant Soil 177:211-218.

Snapp, S. S., W. Kirk, B. Roman-Avilés, and J. Kelly. 2003. Root traits play a role in
integrated management of F usarium root rot in snap beans. HortScience 38:187-
191.

Stoffella, P. J., R. F. Sandsted, R. W. Zobel, and W. L. Hymes. 1979. Root
characteristics of black beans- 11: Morphological differences among cultivars.
Crop Sci. 19:826-830.

Thung, M., and I. M. Rao. 1999. Integrated management of abiotic stresses. In: SF.
Singh (Ed.), Common Bean Improvement in the Twenty-First Century Klumer
Academic Publishers Dordrecht, Boston. pp. 331-370.

Sercombe, G. and L. Pages, C. Doussan and R. Habib. 2003. Architecture analysis and
synthesis of the plum tree root system in an orchard using a quantitative modeling

approach. Plant Soil 251:1-11.

Wraith J. M. and C. K. Wright. 1998. Soil water and root growth. HortScience
33:951-959.

Yabba, M. D. and E. F. Foster, E. F. 2003. Common bean root response to abscisic acid
treatment. Annu. Rep. Bean Improv. Coop. 46:85-86.

Yan, X., J. P. Lynch, and S. E. Beebe. 1996. Utilization of phosphorus substrates by
contrasting common bean genotypes. Crop Sci. 36:936-941.

79

Zobel, R. W. 1995. Genetic and environmental aspects of roots and seedling stress.
HortScience 30:1 189-1 192.

80

Chapter III

EFFECT OF DIFFERENT TEMPERATURE AND EXPOSURE TIMES ON
MYCELIUM GROWTH OF F USARI UM SOLANI F. SP. PHASEOLI

Introduction

F usarium root rot of common bean (Phaseolus vulgaris L.) caused by the soil-
bome fungus F usarium solani f. sp. phaseoli (refer to as F. solani here after) is wide
spread throughout bean production areas in Michigan causing severe yield loss. The
pathogen can survive in the soil in the form of soil resting spores called chlamydospores
for a long period of time. The first symptoms are narrow, long, red to brown lesions on
the hypocotyl where fissures ofien develop lengthwise that in many cases can destroy the

taproot.

The severity of root rot will depend on factors such as cropping history, plant
spacing, moisture and temperature stresses, and soil compaction (Burke et al., 1972;
Singh, 1999; Burke and Miller, 1983; Lockwood, 1986). In general, any factor that
contributes to a reduced rate of root grth increases the plants susceptibility to
F usarz'um root rot (Pastor-Corrales and Schwartz, 1994; Singh, 1999). In dry land
production areas the disease can be more severe, especially in years of severe drought.
High plant populations also increase plants stress and favor infection (Burke, 1965;
Dryden and Van Alfen, 1984). Improper cultivation resulting in hard-pan formation,
favors other soil borne pathogens such as: F usarium oxysporum, Pythium spp.,

Rhizoctonia solani, Thielaviopsis basicola, and Aphanomyces eutiches. Various

81

herbicides are also known to induce injury of young roots and aggravate F usarium root
rot damage.

Temperature has been reported to have a direct effect on the abundance of
F usarz'um species in soil relative to each other. Many Investigators have studied optimal
and lethal temperatures for growth of soil borne pathogens using in vitro and greenhouse
soil assays (Zentrnyer, 1981; Coelho et al., 2000; Pullman et al., 1981; Campbell and Lin;
1976; Bollen, 1985; Pfender and Hagedom, 1982; Hargreaves and Fox, 1978; De Boer ct
al., 1985; Marin et al., 1995). When evaluating kidney and cranberry inbred backcross
line populations at the Montcalm Research F arm for F usarium root rot resistance more
severe disease symptoms were observed during the 2002 field trial compared to the 2003
field trial (Chapter IV of this manuscript). Moreover while evaluating common bean
genotypes for F usarium root rot resistance during the spring of 2003 it was observed that
after three weeks of inoculation under greenhouse conditions at 12°C no disease
development was observed. After the greenhouse temperature increased to 26°C bean
plant roots were covered with lesions. These observations lead us to question if this
response was due to an effect of temperature on the pathogen. The objective of this study
was to study the effect of different temperatures and exposure times on growth of
mycelium of F. solani in artificial media (PDA). A retrospective analysis on soil

temperature conditions and rainfall for the 2002 and 2003 field trials was conducted.

82

Materials and Methods
Isolate description

The Hawks 2b isolate of F. solani used in this study was collected by Schneider
and Kelly (2000) in Presque Isle County, MI. This isolate was recovered from roots of
field grown bean plants with F usarium root rot symptoms. The isolate was maintained in

cold storage in sterile potting soil at 4°C.

Pathogen isolation and pathogenicity test

For the current study the isolate was re-isolated from the long term cold storage
stock and pathogenicity was tested by inoculating several plants (susceptible kidney bean
genotypes: ‘Red Hawk’ and ‘Montcalm’) with the Hawks 2b isolate and re-isolating the
fungus following the procedure of Schneider and Kelly (2000). For this pathogenicity
test 72-well greenhouse flats were filled with perlite and a single seed was germinated in
each well, using no fewer than 24 seedlings per susceptible genotype and the remaining
24 wells were planted with two resistant genotypes ‘Negro San Luis’ (small black bean
from Mexico) and ‘FR266’ (F usarium resistant snap bean from ARS/USDA, WA) as
checks. Greenhouse temperature ranged from 20 to 25°C. The perlite was saturated with
nutrient solution at planting and weekly thereafter. Plants were inoculated with 10 ml of
2 x105 spore suspension of F. solani ten days after planting. The inoculum was applied
over the base of the hypocotyl using a 4-1iter polyethylene hand sprayer. The inoculum
was prepared by scraping PDA plates of the Hawks 2b isolate into distilled water,
strained through two layers of cheesecloth, quantified using a hemocytometer and

adjusted to the proper spore concentration (2 x 105).

83

Substrate for growth of F. solani mycelium

The basic medium used in this study was Potato dextrose agar (PDA, 39 g/ L
water) at pH 5.7. Inoculum discs of 4 mm diameter were cut with a sterile cork borer
from the colony margins of 4-day old cultures of the Hawks-2b isolate grown on PDA
(Invitrogen TM, Life Technologies, MD) and transferred mycelia side down, to the centre

of individual Petri plates (15 mm diameter) containing 25 ml of PDA.

Determination of mycelium growth after transfer from parent cultures

To determine the effect of temperature on mycelium growth (mm) and exposure
times, the Petri dishes were expose to seven different temperature treatments (5, 10, 15,
20, 25, 30, and 35°C) and radial growth data was collected at five exposure times (24, 48,
72, 96, and 172 hours after the set temperature exposure). Radial growth for all
replications was measured after each exposure time along two lines intersecting at right
angles at the centre of the inoculum disc, subtracted the inoculum disc radius and
averaged over four radial measurements. The experiment was repeated: the first
experiment from March 17 to March 24, 2003 and the second experiment from March 29
to April 5, 2004.

Each temperature treatment per exposure time consisted of four replications of
inoculated plates and one non-inoculated plate as a control and transferred to a PTC-l
Peltier-effect temperature control chamber (Sable Systems, Henderson, NV). The
chamber was set for equilibration 3h prior to the start of the experiment following the

procedure of Kirk (2003) with slight modification. Temperature equilibration was

84

measured after the door of the chamber was opened, and at 5°C set temperature,
temperature rose quickly to ~9.2°C but then dropped to 49°C in about 1.3 h. At 10, 15 ,
20, 25, 30, 35°C set temperatures, temperature rose to 14.3, 19.4, 24.3, 35.2, and 392°C
and recovered in 1.2, 1.2, 1.3, 1.4, and 1.5 h, respectively. After removing the plates
from the chamber and measuring radial growth, they were placed under constant light at
20°C temperature for four days. After four days a pathogenicity test was performed using
Montcalm as the susceptible genotype and FR266 as the resistant control, following the

procedure mentioned above. “Images in this dissertation are presented in color.”

Data analyses

All data was analyzed using SAS, (SAS Inst., Cary, NC, 1995) statistical
program. Radial growth was analyzed by two-way analysis of variance so that the effects
of two factors (temperature and exposure times) could be assessed for statistically
significant differences using PROC GLM. The relation between the exposure time,
temperature and radial growth was determined by linear regression analysis using PROC
REG.

Field climatic variables at the Montcalm Research Farm (MRF) located at
Entrican, M1, were measured with a CR1 0X measurement and control system (Campbell
Scientific Instruments, Logan, Utah) equipped with precipitation, soil (6 cm depth) and

air temperature and humidity sensors (45 cm aboce soil).

85

Results and Discussion
Temperature and exposure time effect on F. solani growth

The effects of temperature and exposure time and their interactions on mycelia
growth were significant at P<0.001 (Table 3.1). Responses of F usarium solani on PDA
to temperature from 5 to 35°C over 24 to 172 exposure hours are shown in Figure 3.1.
When contrasting the slope increase between the temperature treatments, significant
differences were observed for 10°C vs. all the other exposures (15, 20 25, and 30°C) as
well as 15°C vs. 20 and 30°C (Table 3.1). No significant difference was observed for
15°C vs. 25°C. Growth of F. solani increased as temperature increased up to 30°C. No
growth was observed at 5 and 35°C. Once grth began, however, it continued at a
normal rate. Two temperature treatments (5 and 35°) were excluded from further
analyses to eliminate skewed data points since these exposures did not contribute to the
results on radial growth obtained. When studying lethal temperature of soil borne
pathogens, Bollen (1985) reported temperatures in the range of 45 and 50°C as lethal
temperatures for F. solani. Under the conditions of the current study, F. solani grew
optimally between 20 and 30°C (Figure 3.1).

Significant time by temperature interaction was observed (Table 3.1). Lower
temperature initially caused a greater delay in time before mycelia on agar disk began
radial growth at 10°C (Figure 3.1, Table 3.2). The data showed the possibility of the
fungi going through acclimation perhaps as a mean of survival. There was no difference
in radial growth between 25 and 30°C (Table 3.2). Time within temperatures showed

significant difference between exposure times.

86

Table 3.1. Analyses of variance for the dependent variable mycelia growth with two
factors (time and temperature), F -values and their respective level of significance.

 

 

Source DF Mean Squares F -values
Time 4 14.12 410.59***
Temperature 6 10.13 294.49***
Contrast 10°C vs. 15°C 1 1.18 93.30***
Contrast 10°C vs. 20°C 1 2.16 170.24***
Contrast 10°C vs. 25°C 1 1.47 116.13***
Contrast 10°C vs. 30°C 1 3.4 268.22***
Contrast 15°C vs. 20°C 1 0.15 11.48**
Contrast 15°C vs. 25°C 1 0.02 1.25
Contrast 15°C vs. 30°C 1 0.57 45.13***
Contrast 20°C vs. 25°C 1 0.07 5.16*
Contrast 20°C vs. 30°C 1 0.14 11.09
Contrast 25°C vs. 30°C 1 0.40 31.37***
Repetition l 0. 12 3 .46
Replications 3 0.02 0.65
Replications (Time) 12 0.01 1.14
Time * Temperature 16 0.27 25.29***
Error 187 0.03
Total 229

 

*, **, *** Significant at P<0.05, P<0.01 and P<0.001, respectively

87

.3303 803 obdmcomfiou some
55; c0383 83098 :03 .8.“ Hobo @8985 can 839 :32 .5 NS 98 ca .Nh .mV .3 ”30¢ch mo owafi a .89 858388
Echotmc 8 8:895 Sam £03.33 .% u .339. Eatemak mo 333383 coumnzofi Doom 3 3% >85 88 538m 3me .mm oSwE

NEVA 8D QAV 3X .80

GOV 9298.:8.
mm om mm om m _.

L

m
p

x 952
O.
O

m

I
“2
O

on
a
fi l
to 0.

U
[H
I

o.
N
(Rep/tum) emu mime Iaipeu

 

88

Table 3.2. Radial growth means for F usarium solani f.sp. phaseoli within temperature
treatments at different exposure times

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Temperature (°C) Exposure Time (hours) Radial Growth
5 24 0.00
48 0.00
72 0.00
96 0.00
172 0.00
10 24 0.00
48 0.18
72 0.59
96 0.69
172 0.79
15 24 0.19
48 0.68
72 0.83
96 1.26
172 1.73
20 24 0.59
48 0.93
72 1.28
96 1.67
172 2.33
25 24 0.80
48 1.26
72 1.61
96 1.96
172 2.42
30 24 0.74
48 1.16
72 1.57
96 1.98
172 2.74
35 24 0.00
48 0.00
72 0.00
96 0.00
172 0.00
C.V. 11.21
LSD (P<0.05; within temperature) 0.35

 

 

 

 

89

Regression analysis showed that there was a linear response between time and
temperature for radial growth at all temperatures (Figure 3.2). The slopes of the
regression lines were less than 1, but the intercepts were greater than 0. Regression
analysis of the radial growth data points again showed highly significant correlation, r2
ranged from 0.73 to 0.95, p<0.001, which supports that radial growth does measure
effects contributed by temperature.

Systematic study requires that independent variables are controlled. It would
have been interesting to evaluate a third factor (water or humidity) to see if there is any
difference in response or if the relation between temperature and time still holds with this
third factor. As Hallsworth and Magan (1996) pointed out, “there is a tendency to treat
each factor separately but this approach is doomed because it implies acceptance of
independently acting factors... an appreciation of the interaction of such factors is
essential for the full understanding of fungal growth”. Field observations have shown
that F usarium root rot disease incidence on bean (Phaseolus vulgaris L) seem to be more
severe under drought or flooding conditions implying that water also plays an important
role in the field environment.

A study conducted by Saremi et al. (1999) indicated that temperature was a major
factor affecting structure of communities of F usarium species in soil, where F. solani
was favored by the highest temperatures (ZS-30°C). While it was true in this study
conducted in Australia and also in studies conducted in South Afi‘ica (Sangalang et al.,
1995a and 1995b; J eschke et al., 1990) the opposite effect occurs in the highlands of
Mexico where F. solani both severity (F-064) and incidence (r=-084) were negatively

related to maximum temperature (N avarrete-Maya et al., 2002). In the same study

90

4.0.
3.5-
3.0.
2.5-
2.0-
1.54
1.0-
0.5-
0.0

Radial Growth (mm)

 

0

4.0-
3.5-
3.0.
2.5-
2.0-
1.5-
1.0.
0.5.
0.0

Radial Growth (mm)

 

Temperature I 0°C

y = 0.0055x + 0.0008

/lJ/'/'

A
W F F

25 49 7 98 123147 172

Exposure Time (hours)
Temperature 20 "C

y= 0.0116x+ 0.4417

 

0

4.0.
3.51
3.0.
2.5-
2.0.
1.5-
1.0.
0.5.
0.0

Radial Growth (mm)

 

25 49 74 98 123147172

Exposure Time (hours)

Temperature 30°C

y = 0.015x + 0.5235

 

0

I T I I 1

25 49 74 9 12314717

Exposure Time (hours)

 

Temperature I 5 "C

 

 

 

 

 

 

 

 

 

 

 

 

4.0.
3.5.
7'5 3‘0“ =00102 +01191
E 2.5. y ' x '
.C
"3‘ 2.0.
O
5 1.5. '
g 1.0.
M
ed 0.5.
0.0 a 1 7 . . tfi
0 25 49 74 98 123147172
Exposure Time (hours)
Temperature 25 "C
4.0.
A 3.5-
g 3.0. y=0.0098x+0.839
g 2.5..
e 2.0- .
g 1.5.
E 1.0-
a:
0.5.
0.0 T . . . . i u
0 25 49 74 98 123147172
Exposure Time (hours)
Temperature F-values R2
(°C)
10 llO.73*** 0.73
15 300.15*** 0.82
20 876.05*** 0.95
25 345.81*** 0.87
30 $21.27*" 0.93
*** Significant at P<0.001

 

 

Figure 3.2. Relationship between radial growth (mm) and exposure time (24 to 172 h)
for temperature treatments (10 to 30°C) on an isolate of Fusarium solani f. sp. phaseoli
on PDA agar. A summary of the regression analysis is shown on the table.

91

 

Rhizoctonia solani severity was strongly related to average (r=0.84) and maximum
(r=0.92) temperature during the growing cycle, and F. solani severity was positively
related to rainfall (r=0.76). Therefore care must be taken when interpreting the
information given in the current study, since it could change with the interaction of

availability of water.

Pathogenicity test

Four days after the removal of culture plates from the temperature control
chambers, two-week old bean plants of the susceptible genotype Montcalm and a
resistant genotype FR266 were inoculated under greenhouse conditions. The genotypes
were planted using perlite and the greenhouse temperature ranged from 20 to 25°C.
Characteristic symptoms of F. solani were observed, long, red to brown lesions in
hypocotyls and discoloration of the root (Figure 3.3). Two weeks after inoculation the
susceptible genotype Montcalm was severely diseased (Table 3.3). Interestingly plants
inoculated with those culture plates exposed from 15 to 30°C showed more severe root
rot disease at 14 days after inoculation compared to plants inoculated with 5 and 10°C
temperature exposure culture plates which showed less disease symptoms (Figure 3.3,
Table 3.3). Plants inoculated with cultures from plates exposed to 5 and 35°C showed a
delay in root rot symptoms of about 5 to 6 days more than the other temperature
exposures. Virulence did not seem to be affected at temperatures between 10 and 30°C.
After temperature treatments the pathogen seems to have virulence, although disease

severity varied between culture plates of different temperature treatments.

92

'l.‘

o>'

o-
...
at
If;
.Q
9
’.
A

.g.

 

 

Figure 3.3. Illustration of the susceptible genotype Montcalm after two weeks of
inoculation with cultures of Fusarium solani f. sp. phaseoli exposed to 10°C (left), 15 and
20°C (center), and 25 and 30°C (right).

93

Table 3.3. Results from the pathogenicity test performed using the susceptible genotype
Montcalm and the genotype FR266 with partial resistance to Fusarium root rot for
comparison purpose.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Root Rot Scoring"t
Temperature (°C))r 14. - Days after 29‘ Days flfief
inoculation 1noculatlon
Montcalm
5 3.5 4.5
10 4.5 5.0
15 5.0 6.0
20 5.5 6,5
25 6.5 7.0
30 6.5 7.0
35 3.5 5.0
FR266
5 1.0 1.5
10 1.0 2.0
15 1.5 2_0
20 2.0 2.5
25 2.0 2,5
30 2-5 2.5
35 1.0 1.5
Coefficient of
Variation (°/o) ”'75 “-35
LSD 1.26 1.10

 

 

 

 

 

1 Root rot scoring was done using a l to 7 scale developed by Schneider and Kelly, 2000 where 1=no
disease and 7 severely diseased .
T Temperature at which the F- 5010’" cultured Petri dishes were exposed

94

As Pulhnan et al. (1981) concluded “the longer a propagule was heated and still
survived, the longer it required to germinate... indicating that heat damage accumulated
gradually to a point beyond which the propagule can not recover... but if heat treatments
are stopped before this point, recovery may occur”. Since these observations were under
controlled conditions, probably under soil environment the propagules would not recover
because of surrounding microbial antagonists and additional stress factors (Pullman et al.,
1 98 1).

Field studies in Michigan have indicated disease severity in P. vulgaris is usually
more apparent during flowering and early pod set when the plant and its pod load are
most sensitive to stress (Schneider et al., 2001; Roman-Avilés et al., 2004; Snapp et al.,
2003), although, root rot was observed to occur during the whole cycle and no genotype
was immune to the pathogen. In these field studies temperature ranged from 20 to 28°C
from the time plants started flowering, July, to the time of pod fill, August. Moreover a
significant reduction in root density was observed in severely affected plants.
Proportions of F. solani in the community of F usarium species increased as the
temperature increased, ranging from 12.9 cfu g '1 (13-18°C), 21.4 Cfil g '1 (20-24°C), to
29.0 cfu g " (ZS-30°C; Saremi et al., 1999).

Experiments for more precise determination of the effect of temperature, and
water potential on F. solani in soil environments would probably require experiments that
measure the effect of these two factors in specific aspects of the fungi life cycle, over
time, as well as its interaction with its legume hosts (e.g. Glycine max). It is clear that

temperature have an effect on mycelium growth which was observed under controlled

95

conditions in artificial media (PDA). Observations in this study could vary under a field

environment where water can alter the environment for mycelium growth.

Field temperature and rainfall data analysis

When evaluating kidney and cranberry IBL populations for F usarium root rot
resistance during the 2002 and 2003 field trials at MRF it was observed that during 2003
lesions developed sooner than in the 2002 summer trail where disease was more severe
latter in the season. The analysis of soil temperature conditions and rainfall revealed that
in 2003 soil temperatures were cooler over the period when root rot developed sooner,
during anthesis where 2002 had warmer soil temperatures G‘igure 3.4 A). No major
difference in precipitation except for the accumulation rate (Figure 3.4 B), which was
evident, and it was hypothesized that cooler soil temperatures might favor expression of
F usarium symptoms. Probably the rapid accumulation of rainfall during 2002 compared
to 2003 along with the high temperature caused the high disease severity for the 2002

field evaluations of the kidney and cranberry IBL populations.

Conclusions

Temperature has an effect on disease development. Interestingly, the pathogen
seems to be acclimating within exposure times between the different temperatures (5°C to
35°C). The pathogenicity test revealed that plants inoculated with those culture plates
exposed from 15 to 30°C showed more severe root rot disease at 14 days after inoculation
compared to plants inoculated with 5 and 10°C temperature exposure culture plates which

showed less disease symptoms. While there was a delay in F usarium root rot symptoms

96

Average soil temperature
and range from maximum to minimfflu

Figure 3.4. The graph shows: (A) the mean and range of daily temperatures over the
evaluation periods in 2002 and 2003 field trials at MRF and (B) shows the rainfall. The
inset graph is the difference in temperature between 2002 and 2003- 2002 had warmer

Precipitation (mm)

35

30

25

20

15

10

50

40

30

20

 

 

A _ , 1 1 o 2002
j. _ f e 2003
,l'ijrllH-mW'il'W‘Tlllllillllll ‘1 , vii:

Hi " “9:1" ‘ 111‘! I ll ll'll
._s%(a 8,, I ‘ ': . ”’"l ii!

A 2.93.3...tiafsts 'M l l l '

few ' 1 WW it ill
‘Hlil 113,11“ ll“ 1%" l;i ”1 l “

 

lll ii

 

Difference in average daily soul
temperature (°C) between 2002
and 2003 from 170 - 210 J day
5 after planting

 

 

 

 

 

B Sum of precipitation from planting ‘ .
to assessment date in 2003:
2002 =f108.7 mm ‘ q
2003 = 96.7 mm .

 

 

220

240

Julian days after planting

soil temperatures on equivalent days after planting.

97

on plants inoculated with cultures from plates exposed to 5 and 35°C of about 5 to 6 days
more. Virulence did not seem to be affected at temperatures between 10 and 30°C,
although disease severity varied between culture plates of different temperature
treatments. It was hypothesized that under field conditions cooler soil temperatures

might favor expression of F usarium symptoms.

98

References

Bollen, G.J. 1985. Lethal temperatures of soil fungi, p. 191-193. In: C. A. Parker, A.D.
Rovira, K.J. Moore, P.T.W. Wong, and J.F. Kollmorgen, (eds), Ecology and

management of soil borne plant pathogens. The American Phytopathological
Society, St. Paul, MN.

Burke, D.W. 1965. Plant spacing and Fusarium root rot of beans. Phytopathology
55: 757-759.

Burke, D.W. and DE. Miller. 1983. Control of Fusarium root rot with resistant beans
and cultural management. Plant Dis. 67: 1312-1317.

Burke, D.W., L.D. Holmes, and A.W. Barker. 1972. Distribution of Fusarium solani f.
sp. phaseoli and bean roots in relation to tillage and soil compaction.
Phytopathology 62: 550-554.

Campbell, R. N. and M. T. Lin. 1976. Morphology and thermal death point of Olpidium
brassicae. Amer. J. Bot. 63:826-832.

Coelho, L., D.J. Mitchell, and DO. Chellemi. 2000. Thermal inactivation of
Phytophthora nicotianae. Phytopathology 90:1089-1097.

De Boer, R.F., P.A. Taylor, S.P. Flett, and RR. Merriman. 1985. Effects of soil
temperature, moisture, and timing of inigation on powdery scab of potatoes, p.
197-198. In: C. A. Parker, A.D. Rovira, K.J. Moore, P.T.W. Wong, and IF.
Kollrnorgen, (eds), Ecology and management of soil borne plant pathogens.
The American Phytopathological Society, St. Paul, MN.

Dryden, P. and N.K. Van Alfen. 1984. Soil moisture, root system density, and infection
of roots of pinto beans by Fusarium solani f. sp. phaseoli under dryland
conditions. Phytopathology 74: 132-135.

Hallsworth, J. E. and N. Magan. 1996. Cultures age, temperature, and pH affect the
polyol and trehalose contents of fungal propagules. Appl. and Environ.
Microbiol. 62:2435-2442.

Hargreaves, A.J., and RA. Fox. 1978. Some factors affecting survival of Fusarium
avenaceum in soil. Trans. Br. Mycol. Soc. 70:209-212.

Jeschke, N., P.E. Nelson, and W.F.O. Marasas. 1990. Fusarium species isolated from

soil samples collected at different altitudes in the Transkei, southern Afiica.
Mycologia 82:727-733.

99

Kirk, W. W. 2003. Tolerance of mycelium of different genotypes of Phytophthora

infestans to freezing temperatures for extended periods. Phytopathology
93: 1400- 1406.

Lockwood, J. L. 1986. Soil borne plant pathogens: concepts and connections.
Phytopathology 76:20-27.

Marin, S., V. Sanchis, and N. Magan. 1995. Water activity, temperature, and pH. Effects
on growth of Fusarium moniliforme and Fusarium proliferatum isolates from
maize. Can. J. Microbiol. 41:1063-1070.

Mondal, S. N. and H. Hyakumachi. 1998. Carbon loss and germinability, viability, and
virulence of chlamydospores of F usarium solani f. sp. phaseoli after exposure to
soil at different pH levels, temperatures, and matric potentials. Phytopathology
88:148-155.

Navarrete-Maya, R., E. Trejo-Albarran, J. Navarrete-Maya, J. M. Prudencio Sains, and J.
A. Acosta-Gallegos. 2002. Reaction of bean genotypes to Fusarium spp. and
Rhizoctonia solani in central Mexico. Annu. Rep. Bean Improv. Coop. 45:154-
155.

Pastor-Corrales, MP. and HF. Schwartz. 1994. Problemas de produccién de frijol en los
trépicos Centro Intemacional de Agricultura tropical (CIAT) Cali, Colombia.
805p.

Pfender, W. F. and D. J. Hagedom. 1982. Aphanomyces euteiches f .sp. phaseoli, a
causal agent of bean root and hypocotyls rot. Phytopathology 721306-310.

Pullman, G.S., J .E. De Vay, and RH. Garber. 1981. Soil Solarization and thermal death:
a logarithmic relationship between time and temperature for four soil borne plant
pathogens. Phytopathology 71:959-964.

Roman-Avilés, B., S. S. Snapp, and J .D. Kelly. 2004. Assessing root traits associated
with root rot resistance in common bean. Field Crops Res. 86:147-156.

Sangalang, A.E., D. Backhouse, and L.W. Burgess. 1995a. Mycogeography of Fusarium
species in soils from tropical, arid and Mediterranean regions of Australia.
Mycol. Res. 99:523-528.

Sangalang, A.E., D. Backhouse, and L.W. Burgess. 1995b. Survival and growth in
culture of four Fusarium species in relation to occurrence in soils from hot
climatic regions. Mycol. Res. 99:529-533.

Saremi, H., L.W. Burgess, and D. Backhouse. 1999. Temperature effects on the relative
abundance of Fusarium species in a model plant-soil ecosystem. Soil Biology and
Biochemestry 31:941-947.

100

SAS Institute. 1995. The SAS system for Windows. Release 6.10. SAS Inst., Cary,
NC.

Schneider, K.A. and J .D. Kelly. 2000. A greenhouse screening protocol for Fusarium
root rot in bean. HortScience 35: 1095-1098.

Schneider, K.A., K.F. Grafton, and JD. Kelly. 2001. QTL analysis of resrstance to
F usarium root rot in bean. Crop Sci. 41:535-542.

Singh, SP. 1999. Common bean improvement in the twenty-first century. Klumer
Academic Publishers Dordrecht, Boston. 405p.

Snapp, S.S., Kirk, W., Roman-Avilés, B., Kelly, J., 2003. Root traits play a role in
integrated management of F usarium root rot in snap beans. HortScience 38: 187-
191.

Zentrnyer, GA. 1981. The effect of temperature on growth and pathogenesis of
Phytophthora cinnarnoni and on growth of its avocado host. Phytopathology
71 :925-928.

101

Chapter IV
INTROGRESSION OF FUSARIUM ROOT ROT RESISTANCE INTO LARGE

SEEDED BEANS AND THE IDENTIFICATION OF QTL ASSOCIATED WITH
RESISTANCE

Introduction

Breeding for root rot [caused by F usarium solani (Mart) Appel & Wr. f. sp.
phaseoli (Burk) Snyd. & Hans] (F. solani) resistance in common bean (Phaseolus
vulgaris L.) has been a formidable challenge for breeders for many years. Little progress
has been made in improving root rot resistance particularly in large seeded Andean
genotypes. The polygenic inheritance combined with the strong environmental effects
have limited efforts to improve root rot resistance (Beebe et al., 1981; Boomstra et al.,
1977; Bravo et al., 1969; Hassan et al., 1971; Schneider and Kelly, 2000; Silbemagel,
1990; Tu and Park, 1993; Wallace and Wilkinson, 1965).

The importance of F usarium root rot disease in bean production was first
recognized by Burkholder (1916) in western New York. Having recognized this problem
he and his colleagues began a search for a genotype resistant to root rot that could be
crossed with cultivars with acceptable seed types. Although Dr. Burkholder and
colleagues did find some low levels of root rot resistance, they were unsuccessful in
breeding for resistance. Their search continued for many years leading to a uniformly,
highly infested seed site resulting in an extremely valuable screening site for root rot
resistance breeding programs (Wallace and Wilkinson, 1973).

In Michigan, large seeded beans are highly susceptible to root rot caused by the

soil-borne fungus F. solani resulting in high yield loss. This fungus is present in all

102

production areas of Michigan, especially in the central northeast (Presque Isle County),
north east (Isabella county) and west (Montcalm county) where sandy or sandy loam soils
predominate and where large seeded kidney beans are grown (Schneider et al., 2000).
Compounding this problem, stresses such as soil compaction and drought conditions,

. aggravated by the sandy soils, inhibit root grth and vigor and may ultimately lead to
increased susceptibility to root rot disease. An additional problem is that genetic
resistance to F usarium root rot has been difficult to incorporate into snap bean and large
seeded Andean bean cultivars with acceptable market traits (Estevez de Jensen et al.,
1998). An emphasis on quality traits appears to have significantly reduced the genetic
variability in these two bean types (Gepts, 1998), which mayhave contributed to severe
susceptibility to F. solani (Schneider et al., 2001).

Resistance had been identified in tropically adapted small seeded bean lines,
however there is a need to characterize and incorporate that resistance into locally
adapted red kidney cultivars. Breeders had attempted to transfer the resistance to current
commercial kidney bean cultivars, but breeding is time consuming and success is not
guaranteed. Gains to date represent partial resistance to F. solani in P. vulgaris, with
large differences in levels of susceptibility (Schneider et al., 2001).

QTL analysis has gained the attention of breeders, since the analysis can
overcome some of the common limitations encountered by conventional selection for
quantitative traits. A QTL associated with resistance would allow researchers to
indirectly select beans for resistance based on the presence of linked markers Breeders
would not have to introduce the disease pathogen and delay evaluation until crop is

affected by disease. QTL controlling quantitative traits have been reported for Fusarium

103

root rot in common bean (Schneider et al., 2001; Navarro et al., 2003; Chowdbury et al.,
2002). Most of these QTL are located on linkage groups B2 and B3 of the integrated
map close to a region where defense response genes PvPR-I and PvPR-Z pathogenicity
proteins, Pgip, and ChS have been identified. Indirect selection for root rot resistance
based on markers linked to the resistance QTL may facilitate improvement of disease
resistance, while field selection is laborious and destructive sampling is needed to
identify resistance.

QTL studies for root rot resistance have used balanced populations such as
recombinant inbred lines (RILs), F 2 populations, backcross (BC,), and double haploid
populations in which both parental alleles are present in high frequencies (Butruille, et
al., 1999). By using balanced populations, the estimation of the number of QTL and the
relative contribution and position of each QTL to the expression of a trait of interest is
determined more efficiently. An alternative to the balanced population is the unbalanced
population such as the advanced backcross populations where the alleles of one parent
are present at a much lower frequency (Tanksley and Nelson, 1996). Unbalanced
populations have been used to determine the number of genes controlling a quantitative
trait and to introgress desirable QTL from unadapted to more adapted gerrnplasm, in
addition to QTL mapping (Fulton et al., 2000; Chetelat and Meglic, 2000; Doganlar et al.,
2002; Tanksley and Nelson, 1996). When using unbalanced populations for mapping and
identifying QTL there is a loss of resolution and efficiency (Butruille et al., 1999;
Tanksley and Nelson, 1996), but unbalanced populations have the advantage of being
more genetically and phenotypically similar to the recurrent parent. There is a reduction

in power of detection of QTL due to the unequal allele frequency inherited in inbred

104

backcross populations (Butruille et al., 1999), but inbred backcross lines (IBLs) can
provide linkage information to enhance genetic maps (Doganlar et al., 2002). In crosses
between Middle-American and Andean gene pools, unbalanced populations are more
usefiil to reduce the frequency of phenotypically inferior genetic material that results
from such wide crosses between gene pools. The advantage of using such populations is
the recovery of material that resemble the recurrent parent but with the addition of
desirable alleles from the donor parent. An example of an unbalanced population is a
population of IBLs, also known as backcross RILs (Doganlar et al., 2002). IBLs are
generated by backcrossing multiple times without selection to the recurrent parent and the
final backcross F1 lines are advanced by single seed descent to fix any segregating loci
and reach the desired level of homozygosity for testing.

The objectives of this study were to i) introgress F usarium root rot resistance into
the large-seeded Andean kidney and cranberry bean populations from a small-seeded
black bean from Middle American gene pool; ii) define the inheritance of F usarium root
rot resistance in P. vulgaris; and iii) identify significant QTL-marker associations which
could be used to facilitate indirect selection of F usarium root rot resistance in common

bean.

Materials and Methods
Plant Genetic Material

Two populations, one with 91 IBL individuals from a cross of Red Hawk
*2/Negro San Luis and the other with 78 IBL individuals from a cross of C97407

*2/Negro San Luis were developed using inbred backcross procedure similar to method

105

described by Owen et al. (1985a, b) in cucumber (Cucumis sativa) and Sullivan and Bliss
(1983) in common bean, respectively (Figure 4.1). For this study two backcrosses were
made to the recurrent parents Red Hawk and C97407 of Andean origin (Race Nueva
Granada). Red Hawk (RH) is a dark red kidney bean developed and released by the
Michigan Agricultural Experiment Station and the USDA-ARS as a full season cultivar
with excellent processing quality (Kelly et al., 1998). Red Hawk exhibits the Type I
upright determinate bush growth habit, is resistant to bean common mosaic virus
(BCMV), rust and anthracnose, but RH is highly susceptible to Michigan isolates of root
rot, primarily F. solani. C97407 is a cranberry bean breeding line (Taylor Hort */
Cardinal) that also exhibits the Type I growth habit but is susceptible to F usarium root
rot. This line was derived from Taylor Hort, a commercial cultivar susceptible to BCMV
that exhibits good yield. C97407 was derived from a backcross between ‘Taylor Hort’
and ‘Cardinal’, which has the single dominant hypersensitive I gene resistance to BCMV,
but C97407 was never released due to a lack of yield potential. The small-seeded black
bean cultivar Negro San Luis (N SL) of Middle American gene pool (Race Durango)
commonly planted in the semi-arid highlands of central Mexico was used as the donor
parent. Negro San Luis is a late maturing photoperiod sensitive cultivar with an
indeterminate type III growth habit and prostrate vine plant structure. Negro San Luis
exhibits drought tolerance and because it also exhibits high levels of root rot resistance it

was used as the donor parent for root rot resistance in the inter-gene pool crosses.

106

Sx*R
9 d‘

*le S

BC|F1 X S

BCzFI

BC2F2

BCzF 3

BC2F3:4 ‘8

BC2F4:5 ®

Symbols description:

Initial parental crosses under greenhouse
conditions

First backcross initiation

Second backcross initiated. Atempts were made
to use more than five BClFl individuals were use
to produce BCz generation

Planted for increase at Montcalm County,
single F. plants were harvested and bulked.

Seed increased in greenhouse and advanced
by single seed descent

Seed increased in greenhouse and lines
harvested as individual lines

Lines planted at Montcalm County and
single F 4 plant selections were harvested

Seed increase and population advance during
winter nursery at University of Puerto Rico
Experimental Station

* = Flowering was induced because of photoperiod sensitivity,

® = Self-pollination,

S = Susceptible to Fusarium root rot (Andean gene pool): Red Hawk and C97407,
R = Resistant to Fusarium root rot (Middle American gene pool): Negro San Luis

Figure 4.1. Diagram depicting development of inbred backcross line populations using
Red Hawk and C97407 as the recurrent parents and Negro San Luis as the donor parent.

107

The original crosses were made during spring 1999 between NSL and the Andean
cultivars RH and C97407 (Figure 4.1). To initiate the parental crosses, flowering had to
be induced in NSL 30 days after planting due to photoperiod sensitivity. The NSL plants
were grown under short days using approximately 10 hours of daylight to induce
flowering. Flowering was induced within 14 days in all plants. The F1 generation was
planted during fall of 1999 under greenhouse conditions and flowering was also induced
since photoperiod sensitivity is expressed as a dominant trait. Because crosses were
made between gene pools, a reaction known as dwarf lethality (stunted growth, chlorosis,
and formation of adventitious root on the hypocotyl) was expected and observed in the
later segregating populations. Dwarf lethality is a temperature dependent interaction
(enhanced at temperatures above 30°C) that occurs at early stages of plant development.
Deleterious effects of inter-gene pool crossing can be circumvented through careful
management of F1 hybrids following the procedure described by Beaver (1993). F1 seed,
from the kidney and cranberry crosses, was planted in such a way that the tap roots were
not allowed to develop since they produce deleterious hormonal effects (results from
expression of DL genes) on the development of the F1 plant. Adventitious roots were
enhance by adding horrnex to form on the hypocotyl and soil was added as the stem
elongated to promote the development of more adventitious roots. When the F 1 plants
flowered successive backcrosses were then made to RH and C97407, followed by four
generations of selfing to produce BC2F3;4 generation IBLs for study and QTL analysis
(Figure 4.1).

After the first backcross, eight BCIF 1 plants were chosen from the kidney IBL

population and six BCIFI from the cranberry IBL population to generate the second

108

backcross. No selection was applied in any generation other than to maintain diversity
based on pedigree, and plants were chosen randomly for additional backcrossing.
Nevertheless, some lines were lost in subsequent generations due to lethality and
photoperiod sensitivity. A total of 91 kidney and 78 cranberry BCz F14 lines were
harvested as single plant selections for each population during the summer of 2001 in the
field at the Montcalm Research F arm (MRF) located near Entrican, MI (43°20’N;
85°01’W) and the inbred backcross lines were advanced an additional generation (BC;

F 4; 5) at the Isabela, P.R. Sub-station of the University of Puerto Rico during the winter of
2001/2002. Both IBL populations were treated independently and were considered as

two separate experiments in order to reduce error variance.

Population evaluation for F usarium root rot
a. Field

Inbred backcross line populations, parents and additional checks of known root
rot reaction were evaluated for F usarium root rot resistance at flowering stage in four
field experiments. Four field experiments were conducted at the MRF, in an alfisol soil,
series name Montcalm/McBride loamy sand, which is naturally infected with F. solani.
In addition to the four experiments at the MRF location a fifth experiment was conducted
at the New York State Agricultural Experiment Station (NY SAES) Research Farm on
Ontario County near Geneva, NY. The soil type at this farm was a lime silt loam, with
fairly rocky and a history of bean production and root rot diseases. The experiment was
arranged in a 100 entry randomized block design (91 IBLs from kidney IBL population

plus nine checks) with three replications and planting at NYSAES was June 10-16, 2003.

109

Samples were dug and rated for root rot on July 22 and August 18, 2003 (G. S. Abawi,
personal communication).

Two experiments were planted at MRF on June 20, 2002 and both the kidney and
cranberry IBL populations were evaluated separately. The kidney population experiment
was arranged in a 10 x 10 square lattice design (91 IBL of kidney IBL population plus
nine checks) and the cranberry experiment was arranged in a 9 x 9 square lattice design
(78 IBL of cranberry IBL population plus three checks). Each experimental unit
consisted of 20 plants per row (row length 5.0 m, row width 50 cm and plant spacing 20
cm within rows). The third and fourth experiments were planted at MRF on June 17,
2003 similar to the design of the previous two experiments. The kidney population
experiment was arranged in a 10 x 10 square lattice design (91 IBL of kidney IBL
population plus nine checks) and the cranberry experiment was arranged in an 8 x 9
rectangular lattice design (64 IBL of cranberry IBL population plus eight checks). The
number of IBLs for the cranberry experiment was reduced in the 2003 season due to lost
of IBLs to a heavy infection with common bacterial blight (CBB). Each experimental
unit of the 2003 trials consisted of 80 plants per row (row length 5.0 m, row width 50 cm
and plant spacing 7.6 cm). Standard agronomic practices for tillage, fertilization, insect,
and weed control were applied to ensure adequate plant growth and development. All
plots received supplemental irrigation. During the 2002 season, plots were irrigated
twice, for a total of 41 mm, whereas in the 2003 season the plots were irrigated 3 times
for a total of 48 mm of supplemental water.

Three random plants from each row were carefully removed from soil and rated for

F usarium root rot symptoms at maturity in the 2002 trial and at flowering stage for the

110

2003 trial. Plants were rated using the root rating scale of l to 7 (Schneider and Kelly,
2000), where 1= healthy root system with no discoloration of root or hypocotyl tissue and
no reduction in root mass and 7= pithy or hollow hypocotyl with much extended lesions,
root mass is severely reduced and is functionally dead (Figure 4.2). The MRF data was
collected by B. Roman Avilés from Michigan State University during the 2002 and 2003
field and greenhouse trials and for the NYSAES experiment the data was collected by G.
S. Abawi from Cornell University. “Images in this dissertation are presented in color.”
Field root rot evaluations were averaged over the two ratings for each genotype, for
ANOVA analysis using SAS PROC GLM (SAS, 1995). Pearson correlations were
conducted among agronomic traits and root rot scores using SAS PROC CORR.
Agronomic data such as days to flower (DTF), days to maturity (DTM), desirability score
(DS), height and growth habit was collected. Roots were visually evaluated for root
vigor based on a 1 to 5 scale where 1 = strong and vigorous root system and 5 = a root
' system with some adventitious roots or no roots at all (Table 4.1). To provide objectively
to the evaluation, the root vigor rating scale was photographed to provide a permanent
record (Figure 4.3). This root vigor scale is different from the root rot evaluation scale
(Figure 4.2).

Narrow sense heritability was calculated using the analysis of variance components,
of the expected mean squares, corresponding to a lattice design with three replications as
the source of variation. The additive genetic variance (02A) and the estimates of
heritability were calculated using the variability between BC2F4;5 lines of the population
(02F4;5). Heritability was adjusted taking into consideration the selfing generation

(Hallauer and Miranda, 1988). The 02,, estimate between BC2F4;5 were calculated using

111

.38. b88288.“ mm 8.8 80.68
.3838 mm made 88 .2862 8888 :88 583 #38082 >88 Mn 88 828 88 E 88.88 on 88 05mm: 38893 8 88
.8 888888 0: £5. 88?? 88 >580: n“ 80:3 K 8 fl .8 28m $88 88 88 558ka 06 .8 8888898 385 .Né oBmE

:L

 

112

Table 4.1. Phenotypic description of the root vigor scale developed for the evaluation of
the genetic populations.

 

Score Phenotypic Description

 

Vigorous, deep tap root, with few secondary roots. Roots appear to be
1 resistant to root rot, seem to be healthy, and have high biomass
accumulation.

Vigorous root, highly branched, with thinner roots compared to No.1 in
this scale. Taproot is missing and is being replaced by secondary roots.

2 The root system appears to be slightly affected by root rot but the
symptoms are superficial and localized mostly on the hypocotyls. High
biomass accumulation is observed.

Very shallow root system less branched and with thinner roots compared
to No.2 in this scale. Taproot is missing. The root system appears to be

susceptible to root rot but the symptoms are superficial and adventitious

roots are observed.

Weak root system, very shallow, and poor branching pattern. Roots
appear highly affected by root rot. Taproot is missing. Root biomass is
reduced by around 30% compared to No.3 in this scale and adventitious
roots are observed.

Very weak root system, highly affected by root rot, root biomass is
reduced more than 80% compared to No.1 in this scale and the taproot is
replaced by numerous adventitious roots arising from the hypocotyl.
Taproot is missing.

 

113

 

 

  

 

    

l 3 4 -. 1 , gig

ii};

 

Figure 4.3. Visual representation of the root vigor rating scale previously described in
Table 4.1.

114

the formula ozF4;5/0.9375 (Warner, 1952). Narrow sense heritability was calculated as
oZA/ 02p. Phenotypic variance was determined utilizing the formula 62A+ (025/3). The

standard error for the narrow sense heritability was calculated as follow:

 

 

 

2 2 2
(if)+(o.2A) 3 dfm d];
3

b. Greenhouse

Both IBL populations and checks of known disease reaction was evaluated for root
rot reaction in the greenhouse using a perlite-based protocol (Schneider and Kelly, 2000).
Seventy-two-well greenhouse flats were filled with perlite and a single seed was
germinated in each well, using no fewer than three seedlings per line per replication for
each individual IBL population. A randomized complete block design with three
replications was used and each experiment was evaluated twice. The perlite was
saturated with nutrient solution at planting and at weekly intervals. When plants were ten
days old, they were inoculated with 10 ml of 2 x105 spore suspension of F. solani. The
inoculum was applied over the base of the hypocotyl using a 4-L polyethylene hand
sprayer. The inoculum was prepared by scraping PDA plates of F. solani into distilled
water quantifying using a hemocytometer and adjusting to the spore concentration of 2 x
105.

The Hawks 2b isolate of F. solani collected by Schneider and Kelly (2000) in
Presque Isle County, MI was used for all inoculations. Two weeks after inoculations,

seedlings were removed from the flats, and roots were cleaned for excess perlite and

115

rated using the scale described previously. The fimgus was cultured continuously and its
pathogenicity was tested by inoculating several susceptible plants of Red Hawk with the
Hawks 2b isolate and re-isolating the fungus following the procedure of Schneider and

Kelly (2000). Data collected was analyzed as described above for the field experiments.

Marker Analysis
a. DNA extraction and amplification

DNA was extracted using the miniprep procedure proposed by Afanador et al.,
(1993) with slight modifications. Prior to inoculation with F usarium, tissue from BC2F4;5
IBL populations and parent genotypes was collected for DNA extraction using very
young leaves from a trifoliate leaf or 3 discs of leaf tissue (using the lid of a 1.5 ml sterile
Eppendorf tube) from greenhouse grown plants, lyophilized, and ground. Ground tissue
was stored at -80°C. RAPDs fragments greater in size than 700 bp were amplified using
InvitrogenTM brand Taq DNA polymerase (Life Technologies, MD) and those bands
smaller in size than 700 bp were amplified by AmpliTaq ® DNA polymerase, Stoffel
Fragment (Perkin Ehner, CT).

The extracted DNA was standardized to uniform concentration (lOng pl") using
DNA fluorometry (Hoefer® DyNA Quant® 200, Hoefer Pharmacia Biotech, San
Francisco, CA). DNA was amplified using a Perkin Elmer Cetus DNA Thermal Cycler
480 (Perkin Elmer, Cetus, Norwalk, CT). The Polymerase Chain Reaction (PCR) cycling
profile consisted of the following cycles: 3 cycles of 1 min at 94 °C, 1 min at 35 °C, and 2
min at 72 °C, 34 cycles of 1 min at 94 °C, 1 min at 40 °C, and 2 min at 72 0C (final step

extended by 1 sec for each of the 34 cycles), and a final extension cycle of 5 min at 72°C.

116

Approximately 20 ul of amplified DNA from each sample was run on a 1.4% agarose gel
containing 0.5 pg ' ml'l, 40 mM Tris-acetate, and lmM EDTA. DNA was viewed under
ultraviolet light and photographed for permanent record. Polymorphisms were recorded

as either presence or absence of bands.

b. Identification of RAPD markers linked to resistance gene (s)

The combined selective mapping strategy composed of bulked segregant analysis
(BSA) technique (Michelmore et al., 1991) and selective genotyping (Lander and
Botstein, 1989) was used to identify RAPD markers linked to the genomic regions
conditioning resistance to F usarium root rot. The homozygosity of BC2F4_5 IBL’s, to be
used in the selected bulks, was determined by inoculating both populations (note: IBL
populations will be considered as two separate experiments) under greenhouse
environment. Inoculation conditions and symptom evaluation was performed as
previously described. Based on these results, a contrasting pair of R and S DNA bulks
was developed for each population. One of the bulks represented a pool of DNA from
the four most resistant (R) IBLs. Likewise, the second bulk was a pool of DNA from the
four most susceptible (S) IBLs. The identification of markers followed a five step
process for combined selective mapping used by Miklas et al. (1996) where:

(1 )- RAPD markers polymorphic between parents of the mapping populations were

identified from a large group of randomly chosen lO-mer primers from selected

Operon kits (Operon Technology, CA) and from the University of British

Columbia (UBC). A total of 2,500 RAPD primers were screened. A large

ll7

number of RAPDs were screened because of the narrow genetic base of the IBL
populations developed through backcrossing.

(2)- The DNA bulks were tested with only those primers known to generate
polymorphisms between the parents. Among the 2500 RAPD primers only 350
were polymorphic either between parents of the kidney and cranberry
populations.

(3)— Only RAPD primers polymorphic between bulks and parents were
subsequently screened against the individuals constituting each bulk.

(4)- If the RAPD continued to co segregate with disease reaction in at least seven
of the eight (90%) lines composing both DNA bulks, then those primers were used
to genotype the entire population.

(5)— Selectively mapped markers and mean disease scores for each IBL were
statistically regressed to ascertain RAPD-QTL association.

Additional polymorphic markers previously identified as associated to F usarium

root rot resistance (Schneider et al., 2001) were also included in the analysis to establish

more genome coverage (Shen et al., 2003) and determine if the same QTL were present

in the IBL population derived from different resistant parent.

c. Linkage map construction and QTL analyses

None of the genetic mapping software commonly used would perform multipoint

analysis and mapping of the IBL populations. However, mapping programs such as

MAPMAKER and J oinMap accept two point information to built genetic maps, and this

two point information provides an estimation of recombination frequency and its

corresponding LOD score. The mapping program J oinMap was chosen to construct

118

linkage groups based on a minimum LOD score of 4 (Stam, 1993; van Ooij en and
Voorrips, 2001). The graphical presentation of each individual linkage group was
developed using MapChart v2.0 (Voorrips, 2001; Voorrips, 2002). The addition of
previously identified markers for root rot resistance in F4 derived RILs served as the
required accurate starting point not only for the linkage group construction but also for
co-integration with the integrated bean linkage map (Freyre et al., 1998). All RAPD’s
from each resulting linkage group were analyzed in a multiple regression analysis using
SAS’s PROC GLM (SAS, 1995) and significance was set at P< 0.05. WinQTL-
Cartographer v2.0 software package was used to map QTL using composite interval
mapping (CIM) which has the power of identifying and positioning individual QTL
(Basten et. al., 2003) and single marker analyses (SMA) was used to confirm the QTL
identified by CIM. Permutation analysis was performed (1000 permutations) for
individual traits in order to identify a significance threshold of the test statistic for
individual QTL (Edwards et al., 1987; McMullen et al., 2001; Doerge et al., 1997).
MAPMAKER/ EXP 3.0 (Lincoln et al., 1987) was used to anchor the linkage groups
identified in this study to the integrated bean map by screening the BAT93 x J alo
EEP558 RIL population (here after refered to as BJ) with those markers that were
polymorphic between the BAT and J alo parents. RAPD markers are identified by the
name of the operon primer, followed by the size of the polymorphic fragment.

RAPD data for each IBL was tested for significant associations between root rot
resistance and marker genotype by QTL-cartographer SMA and CIM, to detect
significant loci and epistatic interactions as described by McMullen et a1. (2001).

Marker-QTL associations were determined by F-tests with significance at P<0.05. SAS

119

analysis helped complement results from CIM. The presence of a putative QTL was
declared significant whenever its LOD-score exceeded the determined threshold level by
the permutation analysis. The estimated position of the QTL was the point where the
maximum LOD-score was found in the region under consideration. The position of a
QTL was always described in relationship to the nearest marker to the left of where the

LOD-score peak was located.

Results and Discussion
Inheritance of root rot resistance

The inbred-backcross method of breeding was used to transfer F usarium root rot
resistance from NSL to Michigan dark red kidney, Red Hawk and the cranberry breeding
line C97407. Using this method to develop the BC2F4;5 populations, the expected mean
progeny would be 87% RH or C97407, and 13% donor (N SL) genotype (Figure 4.4) and
each line would be expected to be approximately 97% homozygous. The expectation
existed that an average donor genotype of 13% was adequate to ensure the infrequent
transfer of desired genes to the recurrent parent. The 87% recurrent parent genotype
ensures the general similarity of all lines to the recurrent parents for critical agronomic,
seed and adaptation traits. The 97% level of homozygosity ensures a homogeneous
response of plants within each line to the external factor being tested.

Significant variation for root rot scores and root vigor ratings was observed in all
field tests of the kidney IBL and cranberry IBL populations except in the NYSAES field
test (Table 4.2, Table 4.3). Significant genetic variation for root rot scores was observed

for all four GH experiments (Table 4.2). Genetic variation for combined

120

P1’r x P2
aa AA
(Recurrent) J, (Donor)

F1 (100% Aa)

P1 (aay

BCIFI (50% Aa: 50% aa)
P1 (aa) x

BC2F1 (25% Aa: 75% aa)

1

BCze (6.25% AA: 12.5%Aa: 81.25% aa)

BC2F334® (9.375% AA: 6.25% Aa: 84.375% aa)

1

BC2F4;5® (10.94% AA: 3.125 Aa: 85.94% aa)

Symbols description:
T Pl= Red Hawk and C97407; P2= the resistant parent to Fusarium root rot: Negro San Luis
®= Selfing.

Figure 4.4. Schematic of genetic expectations of inbred backcross line populations.

Although root rot is a quantitative character and our interest is to look at whole genome
the above diagram is represented as a single locus to illustrate the effect.

121

Table 4.2. Analysis of variance for root rot ratings for the inbred backcross populations,
Red Hawk *2/ Negro San Luis (Kidney inbred backcross line population) and C97407
*2/ Negro San Luis (Cranberry inbred backcross line population).

 

Source DF EMS F-test

Source DF EMS F-test

 

—Kidney IBL GH-li—

 

Rep T 2 1.104
Trt 90 0.750 1.97***

Error 180 0.382
—— Kidney IBL GH-2——

 

Rep 2 0.405
Trt 90 0.625 1.73***

Error 180 0.361
— Kidney IBL MRF§-2002—

 

Rep 2 1.789
Trt 99 2.818 2.85***

Error 198 0.135
—— Kidney IBL MRF-2003—

 

Rep 2 5.730
Trt 99 2.530 1.69***

Error 198 1.501
—— Kidney IBL NYSAES-2003—

 

Rep 2 0.601
Trt 88 0.900 0.94

Error 176 0.95 8
——- Kidney IBL- COMBINED——

 

Loc 2 190.613
Trt 107 3.709 4.36***
Rep 2 1.435
Rep(Loc) 4 3.597 423“
Loc * Trt 190 1.349 1.59***
Error 594 0.850

 

— Cranberry IBL GH-l—

Rep 2 1.764
Trt 77 1.063 1.49*
Error 154 0.71 1
—— Cranberry IBL GH-2—
Rep 2 4.855
Trt 77 1.743 1.98***
Error 154 0.882
— Cranberry IBL MRF-2002—
Rep 2 3.223
Trt 80 3.483 6.73***
Error 160 0.173
—Cranberry IBL MRF-2003—
Rep 2 0.01 1
Trt 71 2.326 168*“
Error 142 1.380

 

 

 

 

— Cranberry IBL COMBINED—

Loc 1 69.176
Trt 84 3.885 4.21***
Rep 2 1.333
Rep(Loc) 2 1.713 1.76
Loc * Trt 67 1.752 1.90***
Error 302 0.923

 

 

T Four experiments are presented for each individual population: a combined analysis over two locations
for both of the field experiments at Montcahn County. An additional experiment at NYSAES was
conducted for the kidney IBL population during the summer of 2003 and is presented. Rep = replication;
Trt = treatments represented by the genotypes; Loc = locations

I Kidney IBL GH and Cranberry IBL GH refer to greenhouse experiments in kidney IBL population and

cranberry IBL population, respectively.

§ MRF and NYSAES refer to field trial conducted at Michigan State University Research Station located at
Montcalm County, MI and New York State Agricultural Experiment Station Geneva, N.Y., respectively.
*, **, *** Significant at the P<0.05, 0.01, 0.001 probability levels, respectively

Table 4.3.

Analysis of variance for root vigor ratings for the inbred backcross

populations, Red Hawk *2/ Negro San Luis (Kidney inbred backcross line population)
and C97407 *2/ Negro San Luis (Cranberry inbred backcross line population).

 

 

 

 

 

 

 

 

Source DF EMS F -test Source DF EMS F-test
—— Kidney IBL Root Vigor-02— — Cranberry IBL Root Vigor-03—
Rep 1 2 0.004 Rep 2 0.276
Trt 99 1.382 lll.9l*** Trt 80 1.541 8.52***
Error 198 0.012 Error 160 0.181
—-— Kidney IBL Root Vigor-03— -— Cranberry IBL Root Vi gor-03——
Rep 2 0.014 Rep 2 0.542
Trt 88 0.885 89.56*** Trt 71 1.191 5.40***
Error 176 0.010 Error 142 0.221
— Kidney IBL -COMBINED— — Cranberry IBL -COMBINED—
Loc 1 0.015 Loc 1 0.001
Trt 101 2.381 181.19*** Trt 84 2.475 12.40***
Rep 2 0.014 Rep 2 0.803
Rep(Loc) 2 0.001 0.06 Rep(Loc) 2 0.310 0.16
Loc * Trt 97 0.336 25.54*** Loc * Trt 67 0.011 020’”
Error 396 0.013 Error 302 0.199

 

 

TTwo experiments are presented for each individual population. A combined analysis over two locations
for both of the field experiments at Montcalm County. Rep = replication; Trt = treatments represented by

the genotypes; Loc = locations

*, **, *** Significant at the P<0.05, 0.01, 0.001 probability levels, respectively

123

field trials over two environments (summer 2002 and 2003) was significant for both the
kidney and cranberry IBL population. Highly significant treatment-by-environment
interactions were found for the combined analyses of variance over two environments in
the cranberry IBL population. Significant variation for combined field trials over three
environments (summer 2002 and 2003 at MRF and 2003 at NYSAES field trials) was
highly significant for the kidney IBL population. Means, LSD, and CV (Coefficient of
Variation) are presented for agronomic data, root rot and root vigor scores for all
experiments conducted with both populations (Appendix B- Tables BI and B2). A
summary of the five most resistant and five most susceptible IBLs and checks are
presented for comparison purpose in Tables 4.4 and 4.5. The 2003 field trials were
chosen to establish the ranked order due to the broader distribution of disease scores. The
CVs remained relatively constant for each population and ranged from 6.3 to 23.0% for
the kidney IBL population and from 12.3 to 23.6% for the cranberry IBL population
(Table 4.4 and 4.5). In general the mean root rot scores for the kidney IBL population
was higher than the mean root rot score for the cranberry IBL population, and the
cranberry IBL population had a wider distribution of scores (Figure 4.5).

Narrow sense heritability (th) estimates for root rot rating for the greenhouse
trials was intermediate for the kidney and cranberry IBL populations (Table 4.6). HZN
estimates of field trial for root rot ratings of kidney IBL population was low (10 to 20%)
and for cranberry IBL population ranged from intermediate to high (30 to 80%). The
intermediate th estimates indicate that it should be possible to indirectly select for root

rot resistance under the greenhouse environment.

124

Table 4.4. Means of the five lowest and five highest root rot scoring inbred backcross
lines for C97407 *2/ NSL population during the summer of 2002 and 2003.

 

+

 

 

IBL number MRF“ Greenhouse
24 2.8 (25)T 5.8 (65)
26 3.3 (3) 5.4 (59)
65 3.6 (9) 5.1 (41)
49 3.6 (61) 6.0 (63)
52 3.8 (39) 6.7 (77)
13 6.2 (70) 5.1(15)
15 6.3 (22) 5.7 (39)
4 6.4 (64) 3.7 (4)
39 6.7 (74) 4.0 (45)
11 6.8 (32) 6.6 (67)
Negro San Luis 1.1 2.5
C97407 4.1 5.7
Taylor Hort 4.0 5.9
C99833 6.1 -
Montcalm 5.2 6.2
FR266 4.5 3.1
B98311 3.2 -
Test Mean 4.9 5.1
LSD (P=0.05) 1.9 1.5
Coefficient of Variation (%) 23.6 18.3

 

I The field trial from 2003 was used for ranking due to better distribution of 1' “30" ium root rot scores
compared to the 2002 trial. Numbers in parenthesis represents ranking for the 2002 field trial (ranking was
established as l to 78). MRF= Montcalm Research Farm

1‘ Root rot score based on a scale 1 to 7 where l=healthy root system with no discoloration of root or
hypocotyls tissue and no reaction in root mass and 7= pithy hypocotyls with much extended root rot
lesions, root mass is severely reduced.

125

Table 4.5. Means of the five lowest and five highest root rot scoring inbred backcross
lines for Red Hawk *2/ NSL population during the summer of 2002 and 2003.

 

 

 

IBL number MRF: Greenhouse NYSAES§
153 3.0 (80) 1 7.0 (75) 3.5 —_

169 3.1 (12) 7.0 (70) 4.9

149 3.4 (77) 3.6(1) 5.9

116 4.0 (17) 6.0 (17) 4.5

138 4.0 (31) 6.1 (21) 5.2

102 6.4 (42) 7.0 (90) 3.7

108 6.6 (64) 7.0 (84) 4.9

164 6.7 (26) 6.9 (41) 2.9

175 6.8 (91) 6.9 (49) 4.5

131 6.9 (73) 6.8 (30) 5.1

Negro San Luis 1.1 2.3 1.9

Red Hawk 5.6 5.8 4.9

FR266 2.4 3.1 3.5

Montcahn 5.8 6.2 6.4

Chinook2000 4.8 5.8 4.3
Beluga 4.9 6.0 -
Taylor Hort 5.8 5.9 -
B98311 3.7 - -
TLP-19 4.8 - -

Test Mean 5.3 6.7 4.8

LSD (P=0.05) 1.9 1.0 1.5

Coefficient of Variation (%) 23.0 9.0 4.5

 

I The field trial from 2003 was used for ranking due to better distribution of 1‘ “30’ mm root rot scores
compared to the 2002 trial. Numbers in parenthesis represents ranking for the 2002 field trial (ranking was
established as 1 to 100). MRF= Montcalm Research Farm

’r Root rot score based on a scale 1 to 7 where l=healthy root system with no discoloration of root or
hypocotyls tissue and no reaction in root mass and 7= pithy hypocotyls with much extended root rot
lesions, root mass is severely reduced.

§ NYSAES= New York State Agricultural Experiment Station

126

.moON soaflsnoa

Am: 93:80 .Q NOON coaxing Am: Eonguo .U 88 coca—smog 4e >269 .m 88 sauna—mom 48 No.69 .< .3550
83852 S 385:8 mucofitomxo Bow 8m c2355? seaming on: 38833 8.55 208 we 88 Sarawak .m. v 053m

8430 ea 635: Ba ".6. as 5m 832 u .x.
«Boom “om «00¢ «9.3m .01 «com
5 me o 3 m we a. an .6. man N m; P 5 mac 0 no m 3. 4 an a raw N m; P

 

    

 

 

 

 

 

 

 

 

 

 

 

 

 

x _ a x .o
in n:
6 New
8 m
.8»
..m~
1%
on
Q 0
«200m «om «com 3.3.» «cm «com
kmeomemmeennmmdmm;w .
itdfl ., dd+ _ nulllfllo hmimmmmmmvvmnnmmmfr
u a .2
i + or .:
._, Law
L _ 3 x :8 m
,a x a ow :9. .u.
_ -. mN 0 1 CO .A
_e r a P on .. +8
I Il {-161 111.11 lill: mm - E

127

Table 4.6. Heritability estimates i standard errors of F usarium root rot ratings (scale 1 to
7) and root vigor ratings (scale 1 to 5)for Red Hawk *2/Negro San Luis (Kidney inbred
backcross line population) and C97407 *2/Negro San Luis (Cranberry inbred backcross
line population) populations evaluated during the 2002 and 2003 field trials .

h2 i SE§

 

 

Experiment Root Rot Ratings Root Vigor Ratings

 

 

Kidney IBL Population

GH-l " 0.51 i: 0.20 -

GH-2 0.44 d: 0.22 -
2002 MRF 1 0.20 :t 0.28 0.98 d: 0.15
2003 MRF 0.10 d: 0.31 0.99 a 0.12

2003 NYSAES 0.16 i 0.30 -

Cranberry IBL Population

GH-l 0.51 :1: 0.24 -

GH-2 0.35 i 0.28 -
2002 MRF 0.82 a: 0.17 0.85 i 0.16
2003 MRF 0.30 :1: 0.29 0.83 i 0.18

 

1' GH refer to greenhouse experiments in Kidney inbred backcross line and Cranberry inbred backcross line
populations, respectively.

I MRF and NYSAES refer to field trial conducted at Michigan State University Research Station located at
Montcalm County, MI and New York State Agricultural Experiment Station Geneva, N.Y., respectively.

§ SE = standard errors

128

Low th estimates requires selection based on progeny performance in advanced
generations evaluated in replicated trials, in different locations and/or environments

(F ehr, 1993). Similar intermediate to high th estimates (48 to 71%) for root rot ratings
were observed when evaluating F4; 5 RILs of the Montcalm x FR266 and Isles x FR266
populations (Schneider et al., 2001).

In the current study the th of 30% and 82% observed in the cranberry IBL
population are high (82%) enough estimates to indicate that selection can be effective but
low (30%) enough to imply that effective selection requires progeny testing, and
evaluation of root rot as a quantitative character. The higher th observed in the 2002
trials is believed to be due to the difficulty in classifying plants late in the season. The
roots and hypocotyls, regardless of the degree of resistance, were covered with lesions
and it was necessary to score on the depth of F usarz'um root rot lession rather than
percentage of infected surface area. The difficulty in classifying plants late in the season
in terms of degree of resistance is observed in the increase of root rot rating mean score
for 2002 compared to the 2003 trials (Table 4.4; Table 4.5). When evaluating F2
progenies from crosses between Redkote x 2114-12 (R2) and Redkote x N203 (RN203),
high th for cross R2 (44.3%) compared with RN203 (25.9%) were observed, indicating
a higher probability of selecting true breeding root rot resistant segregants from the R2
cross (Hassan et al., 1971). Evaluating for root rot at 13-week old field grown plants,
Hassan et a1. (1971) obtained high heritability estimates (77.9% for R2 and 79.7% for
RN203) compared to 5-week old field grown plants which had much lower and dissimi ar
heritability estimates (33.6 and 10.0%). Due to the differences in root rot evaluations,

results obtained in the current study and previous studies suggest that the inheritance

129

pattern for root rot was influenced by the testing procedures employed, age of plants, and
the parents involved (Boomstra and Bliss, 1977; Hassan et al., 1971). Time course
changes (e. g. anthesis, pod fill, and maturity) in plant development should be considered
in evaluating F usarium root rot resistance of common bean (Hall and Phillips, 2004b).
Cultivars that appeared to have similar levels of resistance at week four differed
dramatically at week six and eight indicating that resistance of seedlings may not reflect
resistance of older plants (Hall and Phillips, 2004b). Evaluating earlier in the season
during anthesis would make the evaluation for root rot resistance more effective in
differentiating between lines in a population. Moreover, evaluating all lines in the
population late in the season would be affected by disease to some degree making it
difficult to evaluate and would most probably result in an increase in experimental error.

The low to high heritability estimates for root rot resistance obtained in the
greenhouse and field evaluations, indicate that improvement of genetic resistance to
F usarium root rot is possible although it may be time consuming due to the time needed
to evaluate for root rot resistance (Table 4.6). However quantitative inheritance is highly
influenced by the environment and breeding for improved resistance to F usarium root rot
could protect the bean plant by providing certain levels of general resistance against other
soil borne pathogens. This level of general resistance can cease to function with stress
caused by an inadequate oxygen supply to the host due to flooding or even drought stress,
which can aggravate severe disease pressure.

Heritability estimates for root vigor rating scores were high for both populations
evaluated at MRF during 2002 and 2003. Estimates ranged from 83 to 85% in the

cranberry IBL population and from 98 to 99% in the kidney IBL population. The

130

development of IBLs by using genotypes contrasting only in root characteristics would be
the most effective method to study root plasticity (Roman Avilés et al., 2004).

Narrow sense heritability estimates for root traits in other crops are similar to
those obtained in the current study. Intermediate heritability estimates (43 to 52%) based
progeny means values were observed for number of seminal roots on F3 progeny of wheat
(Richards and Passioura, 1981). In breeding rain-fed drought resistant cultivars of rice
(Oryza sativa L.) using F1 plants, th estimates ranged from intermediate to high (33 to
77%) for traits such as root length, root thickness, root volume, and root dry weight
(Ekanayake et al., 1985). Selection should be successful in early segregating generations
if selection is practiced for these root characters. Only limited heritability values for
these types of traits are found in the literature due mainly to the root by environment
interaction or root plasticity and root harvesting which. makes the evaluation of large
populations challenging.

Representative frequency distributions for root rot ratings are illustrated in Figure
4.5. Continuous variation was observed for both populations, but there was a broader
range of root rot scores for the cranberry IBL population. The susceptible parents
C97407 and RH always scored above 4.0 which is a significantly higher score than that
values observed for NSL, the resistant parent. Transgressive segregation towards
susceptibility was observed in both populations which is not unexpected given the
population structure and the susceptible recurrent parents used in the development of the
IBL populations.

Under severe disease pressure root rot resistance can be overcome as it is evident

by the range in root rot ratings (2.4 to 6.2) for the resistant check, FR266, and a small, but

131

less significant increase in root rot rating (1.1 to 2.5) for the resistant parent NSL (Table
4.4 and 4.5). However, the susceptible genotypes (e.g. Red Hawk, Montcalm, and
C97407) were consistently higher with scores above five (5.6 to 6.2). This supports the
conclusion that the resistant genotypes have a substantial reduction of disease incidence
and that the environment plays a vital role in disease severity as observed in Figure 4.5.
This same pattern of results was observed by Schneider et al. (2001) when evaluating
root rot resistance in Montcalm x FR266 F4 derived population, where FR266 ranged
from 2.0 to 4.5 and the susceptible parent Montcahn scored 1 to 2 points more than
FR266 in all experiments. F. solani has the ability to detoxify phaseolin, a phytoalexin
produced by bean plants in response to infection by this fungus (Van Etten and Smith,
1975). This detoxification which involves conversion of phaseolin to la-
hydroxyphaseollone may explain why this fungus is not being affected by phaseolin.
Such a reaction is enzymatic and therefore under genetic control, but no genetic study of
this system has been made to confirm the reaction and gain a fuller understanding of the
effect of this reaction on disease development in common bean.

Pearson correlations were performed between the experimental trials in the field
and greenhouse among root rot ratings and DTF and root vigor ratings (Table 4.7; Table
4.8). Greenhouse evaluations for root rot resistance were positively and significantly
correlated with the field evaluations and correlation coefficients (r) ranged fi'om 0.36
(P<0.001) to 0.40 (P<0.001). A significant but small correlation was observed for the
kidney IBL population evaluated at MRF and NYSAES for root rot scores (r= 0.14;
P<0.01). Root vigor evaluations were positively and significantly correlated with the

kidney IBL population at MRF evaluations during 2002 and 2003 (r=0.82; P<0.001 and

132

0.06; P<0.05) and also with the kidney IBL population in the greenhouse evaluation (r=-
0.26; P<0.001 and 0.05; P<0.05). Negative but significant correlations were observed
between DTF and root rot ratings for the kidney population at MRF during 2002 and
2003 (r=-0.19; P<0.001 and -0.11; P<0.05) and between DTF and root vigor evaluation
for MRF 2003 (r= -0.12; P<0.05).

A negative correlation between root rot ratings with DTF is more or less expected
especially when considering genotypes with a more determinate growth habit.
Vegetative and root growth of determinate genotypes usually ceases at flowering and the
plant partitions all resources to seed development which results in less available energy
for host defense response. Furthermore, root death may tend to stimulate damage caused
by the pathogen through the release of nitrogenous compounds which can stimulate
pathogen growth (Toussoun, 197 0). Damage caused by severe root rot disease could
result in negative correlations with maturity and as a consequence reduced yield. Root
vigor evaluations were significantly and positively correlated with root rot ratings of the
cranberry IBL population at MRF during both years, r values ranged from 0.24 (P<0.001)
to 0.81 (P<0.001; Table 4.7 and 4.8). Similar results were observed for the kidney IBL
population. Significant correlations in the cranberry IBL population were not observed
between the greenhouse, root vigor evaluations and DTF. Greenhouse root rot
evaluations for cranberry IBL population was positively and significantly correlated with
field evaluations during 2002 (1:021; P<0.01). Negative correlations were observed
between root vigor and DTF for both years and r values ranged from -0.09 (NS) to -0.15

(P<0.05). Similar results for correlations values between DTF and greenhouse and field

133

Table 4.7. Pearson rank correlation coefficients for means of F usarium root rot ratings
for the kidney inbred backcross line population for field (MRF and NYSAES) and
greenhouse experiments, days to flower, and root architecture ratings. The 2002 r values
are presented in normal print in the upper right-hand diagonal whereas the 2003 r values
are printed in bold in the lower left-hand diagonal.

 

 

Days to flower Root vigor ratings Greenhouse MRF
Days to flower - -0.07 -0.03 -0.19***
R091 “30’ -0.12* - -0.26*** 0.82***
ratings
Greenhouse 0.15** 0.05* - 0.40***
MRFT 011* 0.06* 0.36*** -
NYSAES 0.11 0.20*** 0.01 -0.14**

 

T MRF, and NYSAES refers field trial conducted at Michigan State University Montcalm Research Farm
during 2002 and 2003, and New York State Agricultural Experiment Station Geneva, NY during 2003,
respectively.

*, **, *** Significant at the P<0.5, 0.01, 0.001 significance level, respectively.

134

Table 4.8. Pearson rank correlation coefficients between means of F usarium root rot
ratings for cranberry inbred backcross line population for field (MRF) and greenhouse
experiments, days to flower, and root architecture ratings. The 2002 r values are
presented in normal print in the upper right-hand diagonal whereas the 2003 r values are
printed in bold in the lower left-hand diagonal.

 

 

Days to flower Root vigor rating Greenhouse MRF
Days to flower _ -0. 15* -0.05 -0.15
R091 “g“ -o.09 - 0.1 1 0.81***
ratlng
Greenhouse -0.01 -0.03 _ 0.21 **
T _ * skirt -
MRF 0.14 0.24 _0.07

 

T MRF refer to field trial conducted at Michigan State University Montcalm Research Farm during 2002
and 2003.

*, **, *** Significant at the P<0.5, 0.01, 0.001 significance level, respectively.

135

evaluations were observed by Schneider et al. (2001) where r values ranged from -0.11 to
-0.13 (NS) between GH experiment 2 and 3 and DTF; -0.27 (P<0.05) from GH
experiment 1 and DTF; between -0.40 (P<0.01) to -0.53 (P<0.001) between field

experiments and DTF.

Linkage map construction

Twenty-five hundred decamer primers (Operon Technology, CA) were screened
against the parents of both genetic populations. A total of 350 primers generated
polymorphisms between both sets of parents and were analyzed against the four
individuals constituting the R and S bulks. A total of 85 primers produced polymorphism
between the parental and bulks and were subsequently analyzed against the entire
populations. Linkage map construction, using JoinMap (Stam, 1993), placed 33 RAPD
markers on ten partial linkage groups (LG) for a total of 183 cM (Appendix A, Table
A3), LG 1 to 6 were generated for the cranberry IBL population and LG7 to 10
corresponded to the kidney IBL population. The remaining 52 RAPD markers remained
unassigned and could not be used for the QTL analysis. The partial LGs were compared
against the integrated bean map (F reyre et al., 1998) and five LGs possessing QTL
associated with root rot resistance co-integrated with B2 and B5 linkage groups of the
integrated map (Figure 4.6 and 4.7). The partial LGs were anchored to the integrated
bean map by genotyping the B] RIL population with markers identified as linked to QTL
for root rot resistance that were previously mapped to the integrated map. In addition,
there were two partial LGs possessing QTL associated with root rot resistance that

remained unassigned (Figure 4.8).

136

Fewer QTL were expected to be detected in the IBL populations because at least
87% of the loci were fixed for either RH or C97407 alleles and the population was
segregating for fewer loci compared to a single cross F2 population. Thus, most QT L
detected in previous studies were not identified in the current work probably due to the
different genetic material and thus different QTL were identitified. The inability to detect
QTL previously identified by Schneider et al. (2001) could also be due to the unbalanced
population structure or to missing markers flanking the QTL region. The low level of
polymorphism identified in this study is mainly due to the population structure. IBL
populations are skewed towards the recurrent parent where undesirable variability is
eliminated in addition to potential desirable variability from the donor parent. The DNA
bulks further reduce variability as they are developed to eliminate all background
differences not associated with the trait of interest. In a QTL mapping study using IBLs
of Lycopersicon pimpinellifolium, more QTL than expected were detected among the IBL
populations but most QTL identified in previous studies with tomato (L. esculentum)
were not identified because they were not segregating in the IBLs (Doganlar et al., 2002).
These same IBL populations with L. pimpinellifolium were segregating for fewer loci
than the advanced backcross-QTL populations (AB-QTL) from the same parental cross.
Despite the drawbacks of IBLs, the unbalanced population structure seems to be as
polymorphic as the AB-QTL population and can be considered a permanent mapping
resource where new markers can be added to the map as they become available and used

for molecular analyses of quantitative traits (Doganlar et al., 2002).

137

82

Integrated Bean Map
DROSBb

I
we19.2 Red Hawk *2/NSL Red Hawk *2/NSL

X32072
D1367 0.0 X32072 .0 AJ4.350

01287
7 WP07.3
' AT14.1000
00166 \5-0
‘_ DROGSa

 

 

     
  
 

 

AM .A
“.0!" N N
was mu

moguamwaoouummmmmwAub

\\

 

 

 

A

  

7407 *2/NSL
0.0 V6.1500

 

AJ4.350
ChS
WJ20.4
DROS3c
002520
DROSl3b 14.0 P101500

DROG19b

-IIII| Illll-Il-II-—-ID
a:
:3
(O
—I
‘1
#

 

 

 

—I
WWVFPQNNwa‘QwNN99999Nf“

0|

X33054

 

22.0

01619 230

 

AN19.800
42.6 —‘

 

 

 

 

D Montcalm research farm 2003 I New York State Agriculture experiment Station
Graphical presentation created using MapChart v2.0 (V oorrips, 2001).

Figure 4.6. Illustration of partial linkage groups possessing selectively mapped QTL
conditioning resistance to F usarium root rot for the Red Hawk *2/NSL and C97407
*2/NSL inbred backcross line populations; with partial linkage groups co-integrated with
the integrated bean map.

138

B5

Integrated Bean Map
9 C97407 *2/NSL Red Hawk *2/NSL

— D1080

0.0 X7700 0.0 A120.700

4-8—4 Dd 6.0 012.800
‘ — iap.1
2'8 FDRODZOb
3"” (wwms
fi-S:z/D1198wuo1.1
' , ~w008.3
1-4 \WP01.2
33, \WA017.2
39_ \ALzosoo 18.0 AL20.850
' »—WH13.3
113:: \AL20.850
4'7 —Daco.2

4.4—‘

 

 

'I

I

 

 

4.0 66.2000

I

I

I

I I

 

9.0 617.900

N

on
\
I

I’ll!!!

I

 

I I

I’ll! III/II

I

 

15.0 *\L20.350

 

— WS18.5 26.0 AL20.500
— WAD14.2

 

17.0 AL20.850

J4

5.4-—
3.8—
2.9—-
5.9—‘

2.2—
3.0“

—-D1157

- D1301
~- WAL08.1a

I

I

... D1251
\ WAH17.2
~— 809162

8.2 "r 26.0 AJ4.3000
*- DROC183 45.0 G8.1400

I I

IIIIIIIIIIIIIII
—

J

 

 

 

 

 

 

 

 

(I

Montcalm research farm 2002 I Montcalm research farm 2003

E New York State Agriculture experiment Station I Greenhouse
Graphical presentation created using MapChart v2.0 (V oorrips, 2001).

Figure 4.7. Illustration of partial linkage groups possessing selectively mapped QTL
conditioning resistance to F usarium root rot for the Red Hawk *2/NSL and C97407
*2/NSL inbred backcross line populations; with partial linkage groups co-integrated with
the integrated bean map.

139

Red Hawk *2/NSL

 

 

 

 

 

 

0.0 AN19.1300
5.0 G3.1400
C97407 *2/NSL
0.0 519.1000
10° “4'1200 110 819.1100

 

 

 

I Greenhouse
Graphical presentation created using MapChart v2.0 (Voorrips, 2001).

Figure 4.8. Illustration of partial linkage groups possessing selectively mapped QTL
conditioning resistance to F usarium root rot for the Red Hawk *2/NSL and C97407
*2/NSL inbred backcross line populations; both partial linkage groups remained
unassigned to the integrated bean map.

140

QT L analysis for root rot resistance

In the current study, QTL associated with F usarium root rot resistance in bean
were identified using a combination of selective genotyping and BSA. The parental
genotypes Red Hawk, C97407, and NSL react differently to F usarium root rot and
exhibit variation in other agronomic traits in the environments tested. Disease pressure
was adequate to separate genotypic differences in both years, but the environmental
variation resulted in variation in the level of root rot detected between the two years and
locations (Figures 4.5). QTL associated with root rot resistance and agronomic traits
were detected through CIM and SMA. QTL analysis was conducted for each year of the
study separately due to the high genotype by environment interaction obtained when
combining data for both 2002 and 2003 field trials. The different QTL detected across
two environments (2002 and 2003) can be explained in part by differences in
environmental conditions between the two years of study. During the 2002 planting
season higher soil temperatures (24°C/ 30°C min/max) were recorded compared to the
2003 planting season (20°C/25°C min/max). Temperature has proved to be an important
factor in mycelia growth of the pathogen where higher mycelium growth was observed as
temperature increased (see Chapter III of this manuscript). Precipitation during the 2003
planting season was constant and accumulated slower (347 mm), compared to 2002
which accumulated rapidly and was not as constant (354 mm). The two factors
(temperature and precipitation) could have caused sufficient stress to the plant, resulting

in an increase in disease severity for the 2002 field season.

141

Coefficients of determination (R2) which reflect the amount of variation
explained by a given marker ranged from 1.2 to 53.3% for root rot resistance detected in
different environments (Table 4.9, 4.10). One QTL between AL20.850 and AJ4.3000
markers was identified on B5 in the kidney IBL population that explained 27% (Figure
4.9 A) and 9.8% (Figure 4.9 B) of the phenotypic variation for resistance to F usarium
root rot in the NYSAES and greenhouse trials, respectively. The same QTL on B5 was .
identified in the cranberry IBL population which explained 53.3% (AL20.850-G8. 1400;
Figure 4.11 A) of the phenotypic variability for root rot resistance. The possibility exists
that the QTL on B5 could be the same QTL detected in the kidney IBL population, since
both QTL had a common flanking marker (AL20.850). The QTL appears to belong to
the same linkage group, and could have remained separated in the analysis due to low
marker density of the bean map. QTL in the current study identified on B5, mapped
close to a previously identified QTL for root rot resistance from a different resistant
source (Navarro et al., 2003). One QTL was identified in the kidney IBL population
which explained 1.2% (AL20.700-G6.2000; Figure 4.10 A) of the variation for root rot
resistance in the 2002 field trial and the same QTL explained 33.0% (Figure 4.10 B) of
the phenotypic variation in the 2003 field trial. The QTL with the very small effect
( 1.2%) was not significant but was highly significant in 2003. Most of the QTL
discussed above could be considered major QTL due to their large effect supported by the
high LOD values (relative to the QT L peak) greater than the threshold values determined
by the permutation analyses. A very significant effect is shown for a QTL for resistance
in the cranberry IBL population, spanning a distance of ~25 cM on B5 between

AL20.850 and G8.1400 (R2=53.3%; Figure 4.11 A) with a LOD score of over 15 (a LOD

142

0093062 08 “ooh 83» 0030800 APO 9 0003: mm SON in .0 002055 .3 Bugs“: 3303009 0000—38 as 0 mm 80.va »

35 new 0&02 "Amz .0363 00% HEM 0%.2 £5006 aonfim “cogenxm 303305.... 086 .>.Z 8 00:03.05 20m 2 0.8000 momm<m>z 506000000 030 was
0:0 0:052:05 omsoncoocw 8 00%: NEG 05 ~30 50.600qu .mOON can NoON 008830 05 mag. 0:093:30 .0550 8:00:82 9 00.30 8% 98 No; H
5030000000 .m_0>0_ 603d 0:0 o\o_.c xx.— .o\om 05 an 00:00cEw_m 1...... can .1... .1. ._.. F ”000—005 020 a2 05 mo Ewt 05 8 xaoa APO 05 mo nogmom .P

$03 in 00 05005 908 003$an 05 :0 000108 .«0 02300— 9 098000060 08050000; .380 30:50 5 0800000 museum omega m

 

 

143

2.: .2 SE: 3; mm 4300“ -832 sue a .0582 a 8.0.0
8.3 ............o.% 8.82 3: mm
3.8 :3 8.22 odm mm
5.? 1.8.3 8.2: 2: mm 482x -832 £6 a 05%. £320
. . . . - . A 08682.3
on 0 .5 am Sum: o s .52 8.: no 82 22¢ w .85 Bow
Ga 1.5.3 8.3: o.~ mm 8. 32.2 .3000“ Ge 2 3:00: 22>
omdfi *...**o.m momgmé o.o~ EM #3de 10mm.3.< Ammv a
mad artwodm N30 fin. Amz A5362 693.3% w
0....” 5.3 8.502 3 .52 82394 -8880 N.
8.... $3.2 SHE: ca .52 86.20 -8880 6
a... toe... 8.22 9: dz 808.2 -8650 4 s
flwfi ***o.mm MOE: 0.0 Amz
Rs S 8.22 3 $2 8880 -8230. Ge 5
one .2.on 8mm<m>z 3N 00.2
. . . . - . waved 8m 80d
ow N. *w a NEO o N :52 coon v2 omw ONA< Ammv n
93 do 22:. 2: 9.80
DOA FAQ.» NM ”Bogobém no motion wwwmwmc BEBE 000102 mowmxafi :05.

 

doze—anon AmZN... x30: 00% 05 no 005603 002? NM 93 .0600 D04 .3285
08:08 {2.0 05 5E 082000.00 3:305.» 330.00% $20205 .38: 038:8?“ EB 80 «08 3 00530600 00.“ 15.0 dd 033.

0000 00m 00002 "Am Z .novgouv 0000000000 000 0000 55 0000000000 HBO 00 00000:: 00 Son £020.55 .3 000.3002 30003000 000—008 0 00 80.20 04

5030000000 030 0000

0:0 00000020000 0000:0000w 0. 00.000 «E0 000 :00 ”305000000 .82” 000 Noon 008800 05 wage 00000303 .0850 05000002 00 00.000 3% 0000 No.32 #

5030000000 .0_0>0_ filed 0:0 81.0 0x; 68% 05 00 000000.08me . 2...... 0:0 .1... ...:.. .... F ”000—008 020 t3 05 .00 Ewt 05 00 M000 HBO 0:0 .«0 00300.0 0.
. .Awoa .00 00 0800.5 008 00003020 08 00 0000008 .00 00000000 00 0000000800 00005000020 $030 0000.50 5 00000000 000.0% 030—005 a

 

 

144

8.0 3.0.2 80002 8.00 80.80 88.00 -8880... 800 0
80 .88 8.0002 8.8 002 808:2 80.20 N
8.00 8.2 8002 8.0 002 8022 82.20
80 1.0.0 8082 8.2 002 80.20 82.20 N
80 0.0 8.002 8.8 002 88.22 82.20 0000 N
80 .08 ~88: 8.3. 002 82.00 -8080... $8 0 08: 8380
0: .00 8002 8.0 8380 82.8: 820$ 88 0. 0:80 80$ 080
Nos—u ***©.mm N30 :06 50360
00.0 :38 :00 8.8 80.80 82 0.20 880.20 0
8.00 ...........0.00 8.002 8.8 002 83.00 -8080... $00 0 0:80 80 830
08.0 3...? 8002 8.2 002 80.800. -8005 Lt .
202m 05
GOA 02.5 mm 00008000305 “WMWWWMW mwfimw 00.0.0005 0000002 mwwfiwq 20.5.

 

0000000000 x575... 3030 05 00 0050002 0020> mm 000 .00000 DOA 002005
0000.88 $5.0 05 58» 0000000000 3:50.20.» 0300000000 wcmwfiofi .0088 3800003 000 00.0 0000 00 0000000000 000 4H0 .20 030B

.305 5 £5 56% fl :oEmom 4H0

 

 

95:8835 TogonaooHGAm EB moommm<m>ZA< 05 E 988 scum—smog
Am: >263 2: E 85668 “8 38 Sarawak .8.“ mm 9.8» owe—c: do 9:95: 3:85 26388 wfims 35:82 480 d4» oSwE

 

008( .U

.IlZE'Sglas

h

.Zl

 

ghrosn

O§X(

U'SZ

 

.I.
pin.

 

. dm

 

 

 

8g‘ 5...

 

000860

9!

Ogre 6]

3351‘“?

SSNJ (.

8Z9

 

wi’
U'QZ

 

. (I01

 

 

145

.265 SW 5MB 850% fl "Summon APO .manaoEEO moommMEAm was ~8N§A< 05 E 253 5:233
Am: >262 05 E 89?.me H8 88 Eatuwak .8.“ mm 3on 0933: no wEQQmE BEBE Emma—boo mam: 85:82 APO .3 .v 95me

 

 

I’ll
UIpZEVSDuILA-usnlzm 0 7.. 7 9 on m a
h... h h p n P

.l
OOBNJ‘] h P n P n n n n 8 ‘n 0
.E m .I.
w h. All:
E. El

 

 

002.056

A g. T
V T 8256;. A“

an a. U T
383(m#\ 888<m+ _\

 

 

 

 

 

 

 

 

 

 

ooaoN..< v ammo”; v
min-1 ml.
Val V81
w: / w: <
8001.4 ? .3 8001.4 y W
W0 WU

 

 

 

146

.265 an 53, 852%
mm :oEmom APO .mfioficohéo Ann—Em omega: Eta woqwmmmmfio N-om:oncoo.5Am can Gm anew owmxfic NcommvuzA/x 05 E
288 :ouflsmoq AB 90258 2: E 028668 8“ 88 £3.23an Sm @392: 328.: 9:89:00 mama: couscoE APO .— 3V 8&5

 

 

 

 

 

 

 

0 Ir 7.. E 5V 9 g I. Du 6 m ..| 0 7.. .7 g 8 m H... H!» m m m .I
OOOvOrWn - p r n p - p p p n n w Ssh-van - p p p n n p P h n b m
Z .E
J a E
El.
OSNPO V
7L.-
nlU»:
E. T
Plan...
VI.
883‘ V A
Can m ml
91
Uh:
00834 V
I... T
m1
BI.
a:
6|
m1
nlle
00:er VJ .H '00 VJ mud
W0 W0

 

 

 

 

 

 

147

value 2 3.58 is considered highly significant for this particular QTL). A large-effect QTL
might be due to a series of linked QTL, each of small effect (Flint and Mott, 2001).
When two QTL are very close together, there is little chance that recombination will
separate them, so at a larger window distance in the analysis e. g. 100cM (less stringent),
their effects on the LOD score accumulate, appearing as one large effect, whereas at
shorter window distance e. g. 20 cM, the effects cancel out and no QTL is detected.
WinQTL Cartographer blocks out a region of the many centimorgans (CM) on either side
of the markers flanking the test position when picking background markers. This region
is called the window size and it is set at 10 cM by default. Window size is important to
consider, if the size is set too stringent it becomes hard to detect a QTL, especially when
there is low marker saturation of the linkage group. The direction of linked QTL effects
and the mapping method (e. g. CIM) are important factors to consider when chosing the
window size.

Two QTL identified in the kidney IBL population in 2002 and 2003 trials,
explained 19.0% (G6.2000-G17.900; Figure 4.10 B) and 30.0 % (G17.900-AL20.350;
Figure 4.10 A) of the phenotypic variation for root rot resistance, respectively. Both of
these QTL have a common flanking marker suggesting that they may be sharing a
common region on the genome. A QTL for root rot resistance was previously a identified
linked to the G17.9OO marker by Schneider et al. (2001). A QTL for root rot resistance in
the kidney IBL population was detected in the same general region spanning ~13.0 cM
between G6.2000 and AL20.350 on B5 that explained 29% of the phenotypic variability
in the 2002 experiment (Figure 4.10 A). This QTL also shares a common marker

(G6.2000) with the previously described QTL between G6.2000 and (317.900

148

(19.0%; Figure 4.10 B). The QTL displayed large effects (R2=29 and 30%) and was
highly significant supported by the LOD value of ~9.0 (relative to the QTL peak) that is
greater than the threshold value (LOD: 7.57). The G6.2000 marker is 4.0 cM from
G17.9OO anchored to BS, confirming linkage of these two markers and increasing the
possibility of being the same QTL identified between the different environments or at

least the same genome regions associated with G6.2000.

A QTL (AJ4.350- X33054) significantly associated with NYSAESO3 explained
15% (R2) of variation for root rot resistance (Figure 4.12 A). This marker (AJ4.350) was
anchored to 82 of the integrated map, and was, located in the vicinity of the locus for
chalcone synthase (C hS), polygalacturonase-inhibiting protein (Pgip), and the
pathogenicity related protein (PvPR-2). ChS is an enzyme required for isoflavonoid
phytoalexins biosynthesis (Ryder et al. 1987) and may be associated with general
resistance to F. solani. The expression of plant defense response-related genes, such as
chitinase genes, and genes of the phytoalexin biosynthesis pathway (ChS) have been
demonstrated, where the pathogen rapidly induce plant defense responses at the mRN A
level when bean plants were inoculated with F. solani (Mohr et al., 1998). In vitro
studies with F. solani showed that chitinases are necessary to inhibit fungal growth, but
upon prolonged exposure to these enzymes, the fungus was able to resume growth
(Ludwig and Boller, 1990). The proteolyc processing of chitinase may be part of the
pathogen’s strategy to inactivate the plant’s defense. Another suggested way of
counteracting plant defense responses is the inactivation of phytoalexins by F. solani.
Very virulent strains of the pathogen constitutively produced kievitone hydratase, an

enzyme that converts phytoalexin kievitone to a less toxic metabolite.

149

5588 an 55 c265
mm .8388 APO 8685:0238 3:on owmxaz 3th Bcwmmmmgv N-om=o€oouOAm 98 Gm 9.on ammo—EC moommm<m>2A< 85
E 958 scum—smog Am: >263 9: E 828888 “8 88 Eztumak Sm 33me .9685 88888 wfims 35:82 APO .2 .v oSwE

 

 

 

 

 

 

 

 

 

 

 

 

 

SPOFZ(U hi r h I I F b F L in I I . h P I P C
Nu. a
'01
El
ll
gl
E1
61
'1
“.1
Ogrflo 51V
Plan:
91
mm;
’51
Upon
81
gx V
O§PZ( V
6|. WV.
convex f N Swap) NJ W...
W WU

 

 

150

The PvPR-Z is a low molecular weight acidic protein induced during fungal
elicitation (Walter et al., 1990) and may imply a role in root rot resistance in common
bean. The Pgip is a polygalacturonase-inhibiting protein (Toubart et al., 1992; De
Lorenzo et al., 2002) that has previously been reported as associated with resistance to
anthracnose (caused by Colletotrichum lindemuthianum). Plant defense response is a
very complex mechanism that is triggered by pathogen attack. Several defense response
genes co-localize with QTL reflecting a functional relationship between the QTL and the
defense response genes (Geffroy et al., 2000). Other QTL for root rot resistance and for
white mold have been previously mapped to regions close to ChS, Pgip, and the PV-PR-Z
on B2 and B3 of the common bean integrated map suggesting that physiological
resistance to F usarium root rot and white mold is associated with a generalized host
defense response (Schneider et al., 2001; Kolkman and Kelly, 2003). A study of the
biochemical response of soybean to F. solani f. sp. glycine infection showed that
inoculation of soybean roots in soil induced PAL the first enzyme in the phenylpropanoid
biosynthetic pathway, the phytoalexin glyceollin, and lignin, indicating that these defense
response compounds may be involved in the partial resistance response to F usarium
(Lozovaya et al., 2004).

One QTL (V6.1500-P10.1600) was detected that explained only 1.8% of the
phenotypic variation for root vigor evaluation of the cranberry [BL population for 2003
(Figure 4.6). The small effect QTL was significant as it was supported by a maximum
LOD value of 7.78 above the LOD threshold value (6.5) determined for CIM. Root vigor
was significantly and positively correlated with root rot scores for MRF during 2003 for

both the kidney IBL (r=0.06; P<0.05) and cranberry IBL (r=0.24; P<0.001) populations

151

(Table 4.7 and 4.8). A QTL (X3.2072-AT14.1100) was identified as significantly
associated with yield in 2003 and explained 22.0% of the phenotypic variation (Figure
4.6). Both QTL are also located in the vicinity of the locus for the pathogenicity related
protein PvPR-Z protein on B2. All the markers anchored to B2 of the integrated map
were located close to markers previously identified by Schneider et al. (2001) and
Navarro et al. (2003) for root rot resistance in common bean. Both researchers used
different root rot resistance sources N203 and FR266 (Schneider et al., 2001) and Puebla
152 (N avarro et al., 2003). There is the possibility that different root rot resistance
sources carry the same QTL which could explain resistance due to a more generalized
response than that conditioned by a major resistance gene which is a more specific
specialized response.

A QTL in the cranberry IBL population explaining 10.7% (Figure 4.13) of the
phenotypic variability for root rot resistance in the first greenhouse evaluation and 33.6%
(Figure 4.11 B) of phenotypic variability in the second greenhouse evaluation was
detected in the same region of an unassigned linkage group (Figure 4.8). The QTL
spanned a distance of ~1 ch between 819.1000 and 819.1100; however C97407 not
NSL parent contributed to the favorable allele for this QTL. One last QTL was identified
in the kidney IBL population between AN 19.1300-H4.1200 that explaining up to 39.0%
of the phenotypic variability for the second greenhouse evaluation (Figure 4.12 B).
Insufficient polymorphisms in B] RIL population prevented mapping of markers of the
unassigned partial linkage groups on Figure 4.8 to the P. vulgaris integrated map. These

QTL can still be use in MAS breeding and can later be mapped in a more saturated map

152

 

110
,pM

5191100

if)

——>

2.27

 

 

 

:3 5191000

 

 

rx
ol 1 I l l I l I T 1
_JD as to rs to In 1: m N v— o

 

Figure 4.13. QTL identified using composite interval mapping for Fusarium root rot
resistance in the cranberry IBL population found in the Greenhouse-1 (unassigned partial
LG) environment. QTL position is shown with an arrow.

153

when the marker has a greater possibility of being assigned to a specific linkage group of
the common bean integrated map.

Multiple regression analysis using combinations of significant markers linked to
root rot QTL and their interactions revealed that epistatic interactions were not
significant. Up to 7.6% and 73.8% of phenotypic variation for greenhouse and field
ratings, respectively, was explained by a set of QTL flanking markers that included
AL20.850, (317.900, AJ4.350, 012.800, and V6.1500. The differences in size of the
QTL in the greenhouse compared to the field most probably due to the environment
effect which may have affected the full expression of the QTL. In another study
conducted for root rot resistance in common bean, total phenotypic variation explained
by two QTL was about 50% indicating major effect of these two QTL on root rot
resistance (Chowdbury et al., 2002). Only 29% of the phenotypic variation for root rot
ratings was accounted by a subset of four markers in a study conducted by Schneider et
al. (2001). Large effect QTL (those QTL that explained 15% of phenotypic variability or
more) associated with resistance to root rot are useful starting points for marker assisted
selection. The regions to which a QTL is localized can be quite large and such regions

may contain more than one minor QTL.

Soil borne pathogens such as F. solani seem to have a life cycle highly influenced
by the environment. The large amount of environmental variation that affects grth of
F. solani and other soil borne pathogens makes the quantification of root rot diseases
difficult and may be a reason why QTL associated with these traits are difficult to
identify. In the current and previous root rot studies, markers significantly associated

with field root rot ratings were not significantly associated with greenhouse root rot

154

ratings and vice versa, with the exception of AL20.850 which was significantly
associated with the second greenhouse screening and field. It was not surprising that the
QTL associated with field evaluations were not the same QTL associated with
greenhouse evaluations. This anomaly could result from masking of genetic variation for
physiological resistance present in the field by strong environmental factors such as
temperature and moisture and other root rot pathogens in the field environment, which
are absent in the greenhouse environment.

Differences in environmental conditions may have made the identification of QTL
associated with environmental factors (temperature and moisture) difficult to identify
under the greenhouse environment. An example of a trait affected by the environment
present in the field and not in the greenhouse is DTF. The greenhouse evaluations were
conducted prior to anthesis while the field evaluations were conducted post—anthesis.
This same observation could explain the negative but significant correlation observed
between DTF and field and greenhouse evaluations which could correspond to the
different developmental stages at which plants were rated for disease reaction (Tables
4.7, 4.8). No QTL was identified for DTF but a small effect QTL for DTM was
identified between AJ4.350-X33054 that only explained 1.5% of the variability. All the
IBLs in the populations were evaluated in the field at the same time regardless of the
developmental stage so those plants that where more advanced in maturity also exhibited
more severe symptoms or more disease. Similar associations of DTF and other
pathogens have been previously observed where the effect of DTF may be a result of the
timing of disease initiation and the subsequent severity of infection through the entire

season (Abawi, 1989; Miklas et al., 1996; Pilet et al. 1998; Kolkman and Kelly, 2002 and

155

2003). In the case of root rot this association is also valid due to the significant
correlations between DTF and field root rot ratings observed in this and other studies
(Schneider et al., 2001). Bean plants seem to be more affected by root rot during
flowering and later stages of development when the plant isundergoing reproductive
growth and is more susceptible to abiotic and biotic stresses.

Alternatively, QTL associated with resistance to root rot can be used to select
progeny possessing complementary QTL for interrnating. The 617.900 and 012.800
markers are linked to QTL previously identified by Schneider et a1. (2001) and the same
QTL was confirmed in the cranberry IBL populations of the current study on B5. The
previous QTL have proven to be a large effect QTL that were identified in both the 2002
and 2003 environment and could be combined in one genotype (Figure 4.7). No
corresponding specific regions represented by these markers were found on the integrated
map in the current study or in the study conducted by Schneider et al. (2001). Based on
their proximity to other markers that co-integrated with the bean-integrated map these
QTL appear to reside on linkage group BS. Although a QTL between 012.800 and
68.1400 was not identified in the kidney IBL population, the RAPD marker showed the
desired size polymorphic fragment between RH and NSL and segregated in the IBL
population but these markers remained unassigned when creating partial linkage groups
for the kidney IBL population. The QTL on linkage group B5 between 66.2000 and
617.900 explained up to 19% of the phenotypic variability for resistance to root rot in the
kidney IBL in the 2003 environment and up to 30% (617.900-AL20.350) of the

variability in the 2002 environment.

156

QTL linked to AL20.850 and AL20.500 could be combined with those linked to
617.900 and 012.800. AL20.850 is on B5 and was linked to a large effect QTL (R2: 27
and 53.3) in both the kidney and cranberry IBL populations as well as in the greenhouse
environment (R2=9.8). The QTL linked to AL20.500 in the cranberry IBL population
was also polymorphic in the kidney IBL population. Although the later QTL were not
identified in both populations the markers linked to this QTL associated with resistance
can be utilized to enhance conventional breeding approaches by providing information
that the breeder can use to make educated decisions and choices of which putatively
linked resistance loci, with large effect to combine into a single genotype (Figure 4.6 and

4.7).

Growth habit QT L

In this study AJ4.350 and AL20.500 were closely linked to QTL associated with
root rot resistance and determinate grth habit in the kidney and cranberry IBL
population, respectively. The QTL between AL20.500 and 68.1400 explained up to
16.5% of the phenotypic variability while the QTL between AJ4.350-X33054 explained
up to 52% of the phenotypic variability for F usarium root rot resistance. Both of these
QTL seem to have a large effect on determinate growth habit. Growth habit in the IBL
populations was scored as a phenotypic marker since the progeny were either determinate
(Type I) or indeterminate (Type H and Type 111). Growth habit was unexpectedly,
significantly associated with two markers that mapped to two different linkage groups BZ

and B5 implying that two genes may control this trait.

157

The growth habit QTL with the largest effect was located at the end of partial
L69 (B2 on the integrated bean map) between the AJ4.350 and X33054 markers
separated by 22cM (Figure 4.6); Red Hawk contributed the determinate allele for this
QTL. The gene for determinate growth habit, fin, had previously been mapped to linkage
group B1 (Freyre et al., 1998; linkage group D1, Koinange et al., 1996). The fin gene
occurs at high frequency in the Andean gene pool of common bean compared with the
Middle American gene pool. The discrepancy on the location of determinate gene on BZ
vs. B1 may be explained by specific technical difficulties associated with RAPD markers.
The fragment amplified by AJ4.350 in the B] mapping population may not be the same
fragment originally shown to be linked to growth habit in the kidney IBL population
leading to an error locating this QTL on B2. Amplification of a DNA fragment in RAPD
reactions will occur only if the primer binds to both ends of the fragment on opposite
DNA strands. Because of the short primers used (only 10 bp) the reannealing
temperature in the PCR must be low (35-40°C) for the primer to bind. At such low
temperatures, however, binding is not very specific, which means that primers will bind

also to sequences, which are not completely complementary, and a mismatch will occur.

Wide crosses, using the Andean gene pool as the source for the determinate
growth habit, were previously used to map fin gene, which is a prominent single gene
trait in Andean gerrnplasm (Koinange et al., 1996). Similar findings have been reported
where QTL associated with determinate grth were identified in different linkage
groups other than B1. For example, Bassett, (1997) showed tight linkage between the Z
locus controlling partly colored seedcoats in common bean and the Fin gene, but the Z

locus was later mapped to B3 (McClean et al., 2002). The Z locus does not appear to be

158

linked to the Fin gene, but linked to another determinate factor not previously known.
The disagreement may have resulted from the assumption made by Bassett (1997) that he
was working with the Fin and now it would appear that he was working with another
determinancy factor linked to Z. Once Z and Fin were mapped it became clear that there
must be at least two different loci affecting growth habit since Fin is on BI and Z is on
B3. The locus controlling grth habit linked to the 2861 allele from ‘Steuben Yellow
Eye’ (Race Nueva Granada from Andean gene pool) was linked at 1.03 cM to a dominant
gene conferring indeterminate grth habit (Bassett, 1997). In crosses between seed coat
pattern testers and the dark red kidney cultivar Red Hawk (used as recurrent parent in the
kidney IBL population), using the marker closely linked to Z (OAM10.490; Brady et al.,
1998) showed that Red Hawk carries the recessive 2 allele (Emmalea Ernest, personal
communication). It is believed that Red Hawk carries a recessive allele conferring
determinancy at the unnamed locus linked to 2, since Ernest crossed Red Hawk and
Yellow Eye and observed linkage between indeterminancy and the Yellow Eye seed coat
pattern (Ernest and Kelly, 2004). These results may suggest the possibility that the
AJ4.350 marker in the current study may be mapped to the wrong linkage group (B2),
since Red Hawk carries the recessive 2 allele indicating that Red Hawk could also carry
the unnamed growth habit locus tightly linked to Z on B3; or alternatively Z was

incorrectly mapped to B3 by McClean et al., 2002.

In contrast to the source of indeterminancy used by Bassett (1997) to find the
linkage between Z and grth habit, 612873 was used by Koinange et al. (1996) as a
source of indeterminancy to map Fin to Bl. The 612873 is a small seeded wild bean

from the Middle American gene pool. Both sources of indeterminancy were homozygous

159

dominant at only one grth habit locus. These results suggest that if growth habit
evolved separately in each gene pool as suggested by Singh et al. (1991), the two
determinate grth habit loci mapped in these two distinctly different crosses would not

necessarily be located on the same linkage group (Bassett, 1997).

The determinate growth habit in genotypes of the Middle American gene pool
exists mainly in cultivated gerrnplasm of the navy bean market class (Kelly, 2000), which
was introduced by mutagenesis since the transfer of determinancy from the Andean gene
pool through breeding was unsuccessful. The first determinate navy bean cultivar,
Sanilac (released in 195 6) was the most widely used source of the determinate growth
habit in navy been breeding programs worldwide (Kelly, 2000). It is possible that the
determinate grth habit trait in the navy bean gerrnplasm is controlled by a different
locus than that of the fin gene in Andean gene pool. Support of the possible unique genes
for determinate grth habit in Middle American gene pool is based on mapping studies
conducted by Tar’ran et a1. (2002) and Kolkman and Kelly (2003). A second gene for
determinate grth habit mapped to B9 of the integrated map and was identified in a
population developed from a cross between navy bean cultivars OAC Seaforth and
OAC95-4 from Middle American gene pool (Tar’ran et al., 2002). The determinancy
growth habit gene was placed on a distal end of the linkage group, 32.3 cM from the
nearest marker. More recently from a population developed from a cross between Bunsi
and Newport, two small seeded navy bean cultivars from Middle American gene pool,
the determinate growth habit mapped to B7, and represented a novel source of
determinancy in navy bean (Kolkman and Kelly, 2003). The possibility of two loci

conditioning determinancy in navy bean is unlikely due to the origins of determinancy in

160

navy bean introducde through mutation breeding. Given the extensive distance (32.3 cM)
between marker and grth habit on B9 (Tar’ran et al., 2002), data on actual location of

the determinancy gene in the Middle American gene pool needs additional confirmation.

In the current study a QTL (AL20.2000-68. 1400) associated with determinate
growth habit (R2=16.5, P<0.05) in the cranberry IBL population also mapped to B9 of the
integrated bean map, with the difference that this growth habit QTL is in a large seeded
background (Andean) and not in a Middle American background. In addition to the two
QTL associated with growth habit, other small effect QTL for growth habit were
identified such as: QTL between S13.l700 and M10900 (MRF02; R2=1.4; P<0.01), and
the same QTL at MRF03 explained up to 19.2% of variability, and Gl7.800-M10.1500

(18:15.4; P<0.05).

An expected pleiotropic effect or linked QTL was observed between growth habit
and DTM. QTL for both of these traits were identified between the same marker interval
(AJ4.350-X33054) on B2, although the QTL for DTM was small (R2=1.5) compared to
3.0% to 52.0% for growth habit (Table 4.9). The determinancy gene is known to exhibit
multiple pleiotropic effects on growth habit and life cycle as it affects DTF, DTM,
number of nodes, and number of pods (Koinange et al., 1996) indicating that the effect

observed in the current study may be due to pleiotropic effect and not linked QTL.

Conclusions

One of the most important traits to consider in plant breeding programs is

resistance to pathogens. Pedigree selection, single cross, and backcross breeding have

161

been used extensively to transfer disease resistance into desirable cultivars (Boomstra and
Bliss, 1977; Schneider et al., 2001; Kolkman and Kelly, 2003). However, complex
inheritance combined with low heritability have limited attempts to incorporate F usarium
root rot resistance into bean cultivars, despite that known sources of resistance have
existed for more than 60 years (Wallace and Wilkinson, 1975). Root rot from N203 and
NY2114-12 have been shown to be quantitatively inherited (Wallace and Wilkinson,
1965; Schneider et al., 2001). Complexly inherited traits are highly affected by the
environment and controlled by many minor genes, as resistance is usually characterized
by a continuous distribution, that is under polygenic control (Kearsey, 1998, Parlevliet,
2002)

Some traits such as root rot resistance are genetically very complex and difficult
to evaluate, and therefore the efficiency of phenotypic selection is low. The inability to
classify root rot scores from either greenhouse or field evaluations into discrete categories
suggests that root rot resistance in bean is under polygenic control and as a result should
be treated as a quantitative trait (Figure 4.5).

There are some aspects of the plant-pathogen interaction that complicate the
dissection of resistance to certain diseases into QTL. One example is that root rot
severity is rated on an ordinal scale (scale 1 to 7 by Schneider and Kelly, 2000), rather
than a truly quantitative evaluation that would have a normal distribution required for
most if not all-statistical analyses. Genetic differences between isolates of the pathogen
could also result in different QTL profiles (Asins, 2002). In addition the time and
method of inoculation can alter the detection of QTL, as well as the root rot complex in

the field and make the evaluation more challenging.

162

Several regions and QTL significantly associated with field and greenhouse root
rot evaluations were identified in the current study. These QTL explained from 1.2 to
53% of the phenotypic variability for root rot trait (Table 4.9; Table 4.10). A single QTL
between AL20.850 and 68.1400 on B5 accounted for up to 53% of the phenotypic
variation for F usarium root rot resistance in the field environment. Interestingly a QTL
that explained up to 30% of the phenotypic variation for root rot, between 617.900 and
AL20.350, was linked to 617.900 marker previously identified as associated to 1root rot
resistance (Schneider et al. 2001). Alternatively, genotypes possessing the 617.900
marker associated with QTL controlling F usarium root rot resistance could be
recombined with other genotypes possessing the 012.800, AL20.850, and AL20.500
linked markers with the ultimate goal of combining different resistance QTL into a single
genotype that should exhibit higher levels of resistance than either genotype alone. When
conducted multiple regression analyses, up to 73.3% of the phenotypic variation could be

accounted by a combination of five markers that fit the linear regression model.

QTL effects may be environmentally sensitive (Gurganus et al., 1998; Asins,
2002). QTL analyses have revealed that the gene effects are not equally distributed
among QTL. Often a substantial portion of the genetic variation in a population can be
explained by a few QTL of moderately large effect or several QTL with small effect.
Another important observation from QTL analyses is that ‘useful’ alleles that enhance the
trait value are present not only in the ‘resistant’ parent but also in the ‘susceptible’ parent
(referred to as transgressive segregation). Therefore, using phenotypic evaluation to
determine the breeding value of the resistant breeding gerrnplasm is likely to be

misleading with respect to quantitative traits.

163

In general, QTL analyses have some limitations in estimating the number of
important genomic regions controlling any particular trait. First, the ability to detect
small effect QTL may be restricted by the number of progeny evaluated, and if the
progeny number is low, false negatives are likely (Beavis, 1998). Second, recombination
between molecular markers and the genomic region of interest may limit the ability to
detect QTL, particularly in a situation where portions of the genome remain unmapped
(also applies to unbalanced populations such as the IBL populations). Third, several
closely linked QTL still cannot be distinguished from a single factor with large effect
(Lynch and Walsh, 1998), even using the CIM approach. Fourth the use of unbalanced
populations, such as IBL populations, is less efficient for mapping and precisely
estimating QTL effects (Doganlar et al., 2002). Overall, these limitations would result in
an under estimation of the number of genomic regions affecting any trait. Therefore, it is
fair to assume that the number of QTL detected in the current study represents a minimal
estimate of the true number of factors affecting a given trait. Nine QTL were identified
in the current study which are directly associated with root rot and around eight QTL
associated with agronomic traits such as growth habit, seed size, maturity, and yield. The
current study shows that molecular marker data for IBL populations can be used to
perform linkage analysis and test marker-trait associations for the identification of QTL.
Moreover mapping QTL and at the same time introgressing them into genotypic
background with a desirable phenotype, such as that of the recurrent parent, makes IBLs
attractive for the study of quantitative traits such as root rot resistance and to enhance the
breeding of quantitatively inherited traits by regenerating the recurrent parent more

quickly.

164

Future Research

Absolute field resistance to root rot does not exist in common bean but genotypes
with high levels of resistance, from Middle-American gene pool are available that can be
used to introgress resistance into large seeded Andean bean. The goal of this research
was to enhance resistance of Michigan dark red kidney (Red Hawk) and cranberry bean
(C97407) by introgressing resistance from a small seeded black bean from Mexico which
is highly resistant and identify QTL associated with resistance for use in MAS. QTL
associated with resistance were identified in linkage group B2, close to PvPR-2
(pathogenicity related protein), Pgip, and ChS which may be associated with general
resistance to root rot caused by F. solani.

Resistance to F usarium root rot is a quantitatively inherited trait, challenging to
measure, and highly influenced by the environment. Due to the complexity of this trait
(root rot resistance) exhibiting low to moderate heritability make MAS an important
approach to enhance resistance to root rot. By identifying different QTL the breeder
would have the opportunity to combine through MAS those QTL identified in different
genotypes regardless of their function in root rot resistance. Pyramiding of different QTL
is necessary to significantly improve genetic gain in complexly inherited traits such as
root rot reistance.

The introgression of F usarium root rot resistance into large seeded bean
gerrnplasm will require the utilization of resistance sources from other gene pools.
Obviously previous studies have demonstrated that root rot resistance and agronomically
acceptable dark red kidney genotypes will not be achieved through single cross breeding

approaches and most likely a modified backcross breeding method is a better alternative.

165

Using molecular markers and greenhouse screening evaluations could be a useful
approach when making educated decisions about which progeny to be intermated or
backcrossed before performing the actual crosses thus saving time and resources. The
markers closely linked to QTL associated with resistance to F usarium root rot identified
in this study and previous studies provide a method to genotypically select for resistant
progeny that can later be used for backcrossing experiments. The resistance levels of the
backcross progeny can than be tested in the greenhouse before the lines are taken to the
field and for more laborious field trials and testing.

Future work on root rot resistance would involve the selection of IBL from both
populations with the best marker combination associated with resistance to F usarium root
rot and test in different environments to verify their performance. Once the best marker
combination associated with resistance is tested, proved efficient, and are consistent in
different environments, an approach can be made to convert those markers into SCAR
markers. The reproducibility of RAPD markers is a problem and SCARs are more
specific and easier to score. In addition a SCAR marker for AJ 4.350 which is associated
with the determinate grth habit QTL could assist in determining the correct location of
this QTL on the integrated bean map.

One strategy to transfer resistance to root rot caused by F. solani would be to
backcross QTL with large effect into susceptible kidney and cranberry genotypes.
Researchers can simultaneously backcross QTL associated with resistance by MAS and
obtain genotypes which are similar to the recurrent parent but with the desired QTL
introgressed. The researcher can identify genotypes that have vigorous roots combined

with root rot resistance and use these genotypes as resistance donor parents. By

166

combining both QTL associated with resistance and a vigorous root system one can study
in depth the relation between resistance to root rot and root traits in a RIL population.
Genotypes that combine both traits exist (e. g. Chinook 2000) and could be used in a
backcross program to improve root rot resistance of large seeded beans in combination
with MAS using markers linked to QTL that are associated with resistance in the other
gene pool.

To overcome problems associated with mapping RAPD markers, parents of the
IBL populations may be screened with microsatellites (SSR markers) previously mapped
on linkage groups where QTL have been located (B2, B3, B5, and B7). If polymorphic
SSR markers exist between the parents of the populations the entire populations can be
screened with the polymorphic SSRs. Once IBL populations are screened withthose
SSRs linked to root rot resistance the mapping position of the previously identified
markers linked to QTL associated to root rot resistance in the B] population could be
confiremed.

It is important to develop other root rot mapping populations with different
resistance sources to continue the search for new QTL associated with resistance that
could be transfered into large seeded bean gerrnplasm. N203 is the most resistant source
available and perhaps could be used in a backcross program similar to the one used in this
study with NSL resistance source. Both NSL and N203 might be related since they both
are small black seeded beans from Mexico with root rot resistance. Both of these
resistance source result to have some QTL in common. Despite the genetic similarity,
N203 may still contribute novel QTL for root rot resistance due to its high level of

resistance that has been maintained for many years in many locations. Whether all QTL

167

in NSSL were identified is still in question since the size of the IBL populations used in
the current study were not sufficiently large for a QTL study but they were large enough
for a breeding populations. Very important the BC| population used as parents was

probably large enough to transfer sufficient genetic variability from the donor NSL.

168

References

Abawi, G. S. 1989. Root rots. p. 105-107. In: H .F. Schwartz and P. Corrales (eds),
Bean production problems in the tropics, 2nd ed. Centro Intemacional de
Agricultura Tropical (CIAT), Cali, Colombia.

Afanador, L. K. S.D. Haley, and JD. Kelly. 1993. Adoption of a “miniprep” DNA
extraction method for RAPD marker analysis in common bean (Phaseolus
vulgaris L.). Annu. Rpt. Bean Improv. Coop. 36:10-11.

Asins, M.J. 2002. Present and future of quantitative trait locus analysis in plant
breeding. 2002. Plant Breeding 121:281-191.

Bassett, M. J. 1997. Tight linkage between the Fin locus for plant habit and the Z locus
for partly colored seedcoat patterns in common bean. J. Amer. Soc. Hort. Sci.
122:656-658.

Basten, C. J., B. S. Weir, and Z. B. Zeng. 2003. WinQTL Cartographer, Version 2.0.
Dept. of Statistics, North Carolina State University, Raleigh, NC.

Beaver, J. S. 1993. A simple method for producing seed from hybrid dwarfs derived
from crosses between Middle American and Andean gene pools. Annu. Rpt.
Bean Improv. Coop. 36:28-29.

Beavis, W. D. 1998. QTL analyses: power, precision, and accuracy. In: A. H. Patterson
(ed.) Molecular dissection of complex traits. CRC Press. Boca Raton, FL.

Beebe, S. E and F. A. Bliss. 1981. Root rot resistance in common bean gerrnplasm of
Latin American origin. Plant Dis. 65: 485-489.

Boomstra, A. G. and F. A. Bliss. 1977. Inheritance of resistance to Fusarium solani f.

sp. phaseoli in beans (Phaseolus vulgaris L.) and breeding strategy to transfer
resistance. J. Amer. Soc. Hort. Sci. 102: 186-188.

Boomstra, A. 6., F. A. Bliss, and S. E. Beebe. 1977. New sources of Fusarium root
rot resistance in beans, Phaseolus vulgaris L. J. Amer. Soc. Hort. Sci. 102:
182-185.

Brady, L., M. J. Bassett, and P. E. McClean. 1998. Molecular markers associated with T
and Z, two genes controlling partly colored seed coat pattern in conunon bean.

Crop Sci. 38:1073-1075.

Bravo, A., D. H. Wallace, and RE. Wilkinson. 1969. Inheritance of resistance to
Fusarium root rot of beans. Phytopathology 59: 1930-1933.

169

Burke, D. W. 1965. The near immobility of F usarium solani f. phaseoli in natural soils.
Phytopathology 55:1188-1190.

Burke, D. W., D. E. Miller and A. W. Barker. 1980. Effects of soil temperature on
growth of beans in relation to soil compaction and Fusarium root rot.
Phytopathology 70: 1047-1049.

Burkholder, W. H. 1916. Some root diseases of the bean. Phytopathology 6:104.
(Abstr.)

Butruille, D. V., R. P. Guries, and T. C. Osborn. 1999. Linkage analysis of molecular
markers and quantitative trait loci in populations of inbred backcross lines of
Brassica napus L. Genetics 153:949-964.

Chetelat, R. T. and V. Meglic. 2000. Molecular mapping of chromosome segments
introgressed from Solanum lycopersicoides into cultivated tomato (Lycopersicon
esculentum). Theor. Appl. Genet. 100:232-241.

Chowdbury, M. A., K. Yu, and S. J. Park. 2002. Molecular mapping of root rot
resistance in common bean. Annu. Rept. Bean Improv. Coop. 45:96-97.

De Lorenzo, 6., C. Capodicasa, C. Caprari, L. Federico, S. Ferrari, B. Mattei, A. raiola,
F. Sicilia, D. Vairo, A. Devoto, and F. Cervone. 2002. Structure-function and
molecular studies on fungal polygalacturonase and their inhibitor PGIPs, p. 46-51.
In: S.A. Leong, C. Allen, and E.W. Triplett (eds.), Biology of plant-microbe
interactions vol.3. International Society for Mo]. Plant-Microbe Interactions St.
Paul, Minnesota, USA.

Doerge, R. W., Z-B. Zeng, and B. S. Weir. 1997. Statistical issues in the search for

genes affecting quantitative traits in experimental population. Stat. Sci.
12:195-219.

Doganlar, S., A. Frary, H-M. Ku, and S. D. Tanksley. 2002. Mapping quantitative trait
loci in inbred backcross lines of Lycopersicon pimpinellifolium (LA1589).
Genome 45:1189-1202.

Edwards, M. D., C. W. Stuber, and J. F. Wendel. 1987. Molecular-marker—facilitate
investigations of quantitative-trait loci in maize: 1. Numbers, genomic distribution
and types of gene action. Genetics 116:113-125.

Ekanayake, I. J., J. C. O’Toole, D. P. Garrity, and T. M. Masajo. 1985. Inheritance of

root characteristics and their relations to drought resistance. Crop Sci. 25:927-
933.

170

Ernest, E. G. and J. D. Kelly. 2004. A spontaneous mutation at a seedcoat pattern
locus in the dark red kidney bean 'Red Hawk,‘ which changes seed from self-
colored to the partially colored virgarcus pattern. HortScience (submitted).

Estevez de Jensen, 6, R. Meronuck, and J. A. Percich. 1998. Etiology and control of
kidney bean root rot in Minnesota. Annu. Rpt. Bean Improv. Coop. 41:55-56.

Fehr, W. R. 1993. Principles of cultivar development vol.1: Theory and technique.
McGraw Hill Company, Macmillan, Inc. New York, N.Y., p. 95-105.

Freyre, R., P. W. Scroch, V. Geggroy, A. F. Adam-Blondon, A. Shinnohamadali, W. C.
Johnson, V. Llaca, R. O. Nodari, P. A. Pereira, S. M. Tsai, J. Tohme, M. Dron, J.
Nienhuis, C. E. Vallejos, and P. Gepts. 1998. Towards an integrated linkage map
of common bean. 4. Development of a core linkage map and alignment of RF LP
maps. Theor. Appl. Genet. 97:847-856.

Fulton, T. M., S. Grandillo, T. Beck-Bunn, E. Fridman, A. Frarnptom, J. Lopez, V.
Petiard, J. Uhlig, D. Zamir, and S. D. Tanksley. 2000. Advanced backcross QTL
analysis of Lycopersicon esculentum x Lycopersicon parviflorum cross. Theor.
Appl. Genet. 100:1025-1042.

Geffroy, V., M. Sevignac, J.C.F. De Oliveira, G. Fouilloux, P.Skroch, P. Thoquet, P.
Gepts, T. Langin, and M. Dron. 2000. Inheritance of partial resistance against
Colletotrichum lindemuthianum in Phaseolus vulgaris and co-localization of
quantitative trait loci with genes involved in specific resistance. Mol. Plant-
Microb. Interact. 132287-296.

Gepts, P. 1998. Origin and evolution of common bean: past events and recent trends.
HortScience 33: 1 124-1 130.

Gurganus, M. C., J. D. Fry, S. V. Nuzhhdin, E. G. Pastukova, R. F. Lyman, and T. F. C.
Mackey. 1998. Genotype-environment interaction at quantitative trait loci
affecting sensory bristle number in D. melanogaster. Genetics 149:1883-1898.

Hallauer, A. R. and J. B. Miranda. 1988. Quantitative genetics in maize breeding. Iowa
State University Press, Ames, Iowa, p. 21-36.

Hassan, A. A., D. H. Wallace, and R. E. Wilkinson. 1971. Genetics and heritability of
resistance to Fusarium solani f. phaseoli in beans. J. Amer. Soc. Hort. Sci.
96:623-627.

Kearsey, M. J. 1998. The principles of QTL analysis (a minimal mathematics approach).
J. Exp. Bot. 49:1619-1623.

171

Keenan, J. 6., H. D. Moore, N. Oshima, and LE. Jenkins. 1974. Effect of bean root rot

on dryland pinto bean production in southwestern Colorado. Plant Dis. Rep.
58: 890-892.

Kelly, J. D. 2000. Remaking bean plant architecture for efficient production. Adv.
Agronomy 71:109-143.

Kelly, J. D., G. L. Hosfield, G. V. Varner, M. A. Uebersax, R. A. Long, and J. Taylor.
1998. Registration of ‘Red Hawk’ dark red kidney bean. 38:280—281.

Koinange, E. M. K., S. P. Singh, and P. Gepts. 1996. Genetic control of the
domestication syndrome in common bean. Crop Sci. 36: 1037-1045.

Kolkman, J. M. and J. D. Kelly. 2002. Agronomic traits affecting resistance to white
mold in common bean. Crop Sci. 42:693-699.

Kolkman, J. M. and J. D. Kelly. 2003. QTL conferring resistance and avoidance to
white mold in common bean. Crop Sci. 43:539-548.

Lander, E. S. and D. Botstein. 1989. Mapping Mendelian factors underlying quantitative
traits using RFLP linkage maps. Genetics 121:185-199

Lincoln, S., M. Daly, and E. Lander. 1987. Constructing genetic maps with
MAPMAKER/ EXP 30. Whitehead Institute Technical Report: 3erd ed.
Whitehead Institute, Cambridge, MA.

Lozovaya, V. V., A. V. Lygin, S. Li, G. L. Hartman, and J. M. Widholm. 2004.
Biochemical response of soybean roots to Fusarium solani f. sp. glycines
infection. Crop Sci. 44:819-826.

Ludwig A. and T. Boller. 1990. A method for the study of fungal grth inhibition by
plant proteins. FEMS Microbiology Letters 69:61-66.

Lynch, M. and B. Walsh. 1998. Inbred line crosses, p.431-489. In: Genetics and
analysis of quantitative traits. Sinauer Associates, Inc., Sunderland, MA.

Maier, C. R. 1961. Effects of soil temperature and selected crop residues on the
development and severity of Fusarium root rot of beans. Plant Dis. Rep.
45:960-964.

Miller, D. E. and D. W. Burke. 1975. Effect of soil aeration on F usarium root rot of
beans. Phytopathology 652519-523.

Miller, D. E. and D. W. Burke. 1977. Effect of temporary excessive wetting on soil
aeration and Fusarium root rot of beans. Plant Dis. Reptr. 61:175-179.

172

McClean, P. E., R. K. Lee, C. Otto, P. Gepts, and M. J. Bassett. 2002. Molecular and
phenotypic mapping of genes controlling seed coat pattern and color in common
bean (Phaseolus vulgaris L.). J. Hered. 93:148-152.

McDonald, B. A. and C. Lande. 2002. The population genetics of plant pathogens and
breeding for durable resistance. Euphytica 124:163-180.

McMullen, M. D., M. Snook, E. A. Lee, P. F. Byme, H. Kross, T. A. Musket, K.
Houchins, and E. H. Coe, Jr. 2001. The biological basis of epistasis between

quantitative trait loci for flavone and 3-deoxyanthocyanin synthesis in maize
(Zea mays L.). Genome 44:667-676.

Michelmore, R. W., I. Paran, and R. V. Kesseli. 1991. Identification of markers linked
to disease resistance genes by bulked segregant analysis: A rapid method to

detect markers in specific genomic regions using segregating populations. Proc.
Natl. Acad. Sci. USA 88: 9828-9832.

Miklas, P. N., E. Johnson, V. Stone, J. S. Beaver, C. Montoya, and M. Zapata. 1996.
Selective mapping of QTL conditioning disease resistance in common bean.
Crop Sci. 36:1344-1351.

Mohr, U., J. Lange, T. Boller, A. Wiemken and R. Vogeli-Lange. 1998. Plant defense
genes are induced in the pathogenic interaction between bean roots and F usarium

solani, but not in the symbiotic interaction with the arbuscular mycorrhizal fungus
Glomus mosseae. New Phytol. 138:589-598.

Navarro, F ., M. Sass, and J. Nienhuis. 2003. Identification and mapping bean root rot
resistance in a population of Mesoamerican x Andean origin. Annu. Rept. Bean
Improv. Coop. 46:213-214.

Owen, K. W., F. A. Bliss, and C. E. Peterson. 1985a. Genetic analysis of fruit length
and weight in two cucumber populations using the inbred backcross line method.
J. Amer. Soc. Hort. Sci. 110: 431-436.

Owen, K. W., F. A. Bliss, and C. E. Peterson. 1985b. Genetic variation within and

between two cucumber populations derived via the inbred backcross line method.
J. Amer. Soc. Hort. Sci. 110: 437-441.

Parlevliet, J. E. 2002. Durability of resistance against fungal, bacterial, and viral
pathogens; present situation. Euphytica 124: 147-156.

Pilet, M. L., R. Delourrne, N. Foisset, and M. Renard. 1998. Identification of QTL
involved in field resistance to light leaf spot (Pyrenopeziza brassicae) and

blackleg resistance (Leptosphaeria maculans) in winter rapeseed (Brassica napus
L.). Theor. Appl. Genet. 97:398-406.

173

Richards, R. A. and J. B. Passioura. 1981. Seminal root morphology and water use of
wheat 1. Environmental effects. Crop Sci. 21:249-252.

Robertson, L. S. and R. D. Frazier. 1982. Dry bean production- principal and practices.
Coop. Extension Service Michigan State University, Extension Bulletin E-1251
225p.

Roman-Avilés, B. and J. S. Beaver. 2004. Inheritance of heat tolerance in common bean
of Andean origin. J. Agric. Univ. P.R. (In press)

Roman-Aviles, B., S. S. Snapp, and J. D. Kelly. 2004. Assessing root traits associated
with root rot resistance in common bean. Field Crops Res. 86:147-156.

Ryder, T. B., S. A. Hedrick, J. N. Bell, X. Liang, S. D. Clouse, and C. J. lamb. 1987.
Organization and differential activation of a gene family encoding the plant

defense enzyme chalcone synthase in Phaseolus vulgaris. Mol. Gen. Genet.
210:219-233.

SAS Institute. 1995. The SAS system for Windows. Release 6.12. SAS Inst., Cary,
NC.

Schneider, K. A. and J. D. Kelly. 2000. A greenhouse screening protocol for F usarium
root rot in bean. HortScience 35: 1095-1098.

Schneider, K. A., K. F. Grafton, and J. D. Kelly. 2001. QTL analysis of resistance to
F usarium root rot in bean. Crop Sci. 41 :535-542.

Shen, X., M. Zhou, W. Lu, and H. Ohm. 2003. Detection of Fusarium head blight
resistance QTL in a wheat population using bulked segregant analysis. Theor.
Appl. Genet. 10621041-1047.

Shii, C. T., M. C. Mok, S.R. Temple, and D.W.S. Mok. 1980. Expression of
developmental abnormalities in hybrids of Phaseolus vulgaris L. J. Hered.
71:218-222.

Shii, C. T., M. C. Mok, and D. W. S. Mok. 1981. Developmental controls of
morphological mutants of Phaseolus vulgaris L.: differential expression of mutant

loci in plant organs. Develop. Genet. 2:279-290.

Silbemagel, M. J. 1990. Genetics and cultural control of F usarium root rot in bush snap
beans. Plant Dis. 74: 61-66.

Singh, S. P., P. Gepts, and D. DeBouck. 1991. Races of common bean (Phaseolus
vulgaris, Fabaceae). Econ Bot 45:379-396.

I74

Snapp, S. S., W. Kirk, B. Roman-Avilés, and J. Kelly. 2003. Root traits play a role in

integrated management of F usarium root rot in snap beans. HortScience 38:187-
1 91 .

Stam, P. 1993. Construction of integrated genetic linkage maps by means of new
computer package: JoinMap. Plant J. 32739-744.

Sullivan, J. G. and F. A. Bliss. 1983. Expression of enhanced seed protein content in
inbred backcross lines of common bean. J. Amer. Soc. Hort. Sci. 108: 787-791.

Tan, C. S. and J. C. Tu. 1994. Tillage effect on root rot severity, growth and yield of
beans. Can. J. Plant Sci. 75: 183-186.

Tanksley, S. D. and J. C. Nelson. 1996. Advanced backcross QTL analysis: a method
for the simultaneous discovery and transfer of valuable QTL from unadapted
gerrnplasm into elite breeding lines. Theor. Appl. Genet. 92:191-203.

Tar’an, B., T. E. Michaels, and K. P. Pauls. 2002. Genetic mapping of agronomic traits
in common bean. Crop Sci. 42:544-556.

Toubart, P., A. Desiderio, G. Salvi, F. Cervone, L. Daroda, and G. De Lorenzo. 1992.
Cloning and characterization of the gene encoding the endopolygalacturonase-
inhibiting protein (PGIP) of Phaseolus vulgaris L. Plant J. 2:367-373.

Toussoun, T. A. 1970. Nutrition and pathogenesis of Fusarium solani f.sp. phaseoli, p.
95-98. In: T.A. Toussoun, R.V. Bega, and RE. Nelson (eds.), Root Diseases and
soil-borne pathogens. University of California Press, Berkeley, Los Angeles,
London.

Tu, J. C. and S. J. Park. 1993. Root rot resistance in common bean. Can. J. Plant Sci.
73: 365-367.

Van Etten, H. D., and D. A. Smith. 1975. Accumulation of anti-fungal isoflavonoids and
la-hydroxyphaseollone, a phaseollin metabolite, in bean tissue infected with
Fusarium solani f. sp. phaseoli. Physiol. Plant Pathol. 52225-237.

Van Ooijen, J. W. and R. E. Voorrips. 2001. JoinMap ® 3.0 Software for the calculation
of genetic linkage maps. Biometris, Wageningen University, Plant Research
International B.V.

Voorrips, R. E. 2001. "MapChart version 2.0: Windows sofiware for the graphical
presentation of linkage maps and QTLs", Plant Research International,
Wageningen, Netherlands.

Voorrips, R. E. 2002. MapChart: software for the graphical presentation of linkage maps
and QTLs. J. Hered., 93:77-78.

175

Wallace, D. H. and R. E. Wilkinson. 1965. Breeding for F usarium root rot resistance in
beans. Phytopathology 55: 1227-1231.

Wallace, D. H. and R. E. Wilkinson. 1973. Cornell’s Fifiy-year search for root rot
resistant dry beans. New York’s Food and Life Sciences 6:18-19.

Wallace, D. H. and R. E. Wilkinson. 1975. Breeding for resistance in dicotyledonous
plants to root rot fungi. In: G. W. Bruehll (ed.), Biology and control of soil-borne
plant pathogens. American Phytopathological Society. St. Paul, Minn.

Walter, M. H., J. Liu, C. Grand, C. J. Lamb, and D. Hess. 1990. Bean-pathogenesis-
related proteins deduced from elicitor-induced transcripts are members of a

ubiquitous new class of conserved PR proteins including pollen allergens. Mol.
Gen. Genet. 222:353-360.

Warner, J. N. 1952. A method for estimating heritability. Agron. J. 44:427-430.

176

GENERAL SUMMARY

Genetic variation exists among different bean genotypes, and between market
classes for root traits such as root length, root diameter, root surface area, fractal

dimension, root dry weight, number of meristem, and adventitious roots.

Selection for root dry weight appears to be useful in the greenhouse, but should be
delayed to 45 days afier planting (anthesis) to allow greater expression of root

traits.

Plant breeders interested in enhancing root rot resistance and overall root health
under field conditions should focus on evaluating adventitious roots, root dry

weight, and lateral roots in a breeding population.

The potential for improving root characteristics in common bean exists and
breeders have been successful in transferring root traits from the black Middle
American bean into the large seeded Andean such as the light red kidney Chinook
2000 and the snap bean breeding line F R266. Both of these large seeded bean
genotypes can serve as parents to enhance root traits of future commercial kidney

and snap bean varieties.

It is clear that temperature has an effect on F. solani mycelium grth and

interestingly, the pathogen seems to be acclimating as a means of surviving the

177

exposure times (24, 48, 72, 96, 172 hours) to the different temperatures (5°C to

35°C).

It was hypothesized that under field conditions cooler soil temperatures might

favor expression of F usarium symptoms.

Using kidney and cranberry inbred backcross line (IBL) populations nine QTL
significantly associated with F usarium root rot resistance in field and greenhouse
were identified that explained from 5 to 53% of the total phenotypic variability.
QTL sharing flanking markers (66.2000, 617.900, AL20.850 and AL20.350)
were identified in multiple locations and in both the kidney and cranberry IBL

populations.

QTL associated with F usarium root rot resistance identified in the current study
were located on B2 and BS of the integrated bean map close to previously

identified QTL for other resistant sources.

Using a linear regression model a combination of five markers accounted for 73%

of the phenotypic variation.

Large effect QTL (R2>50) identified on different linkage groups could be

combine to enhance genetic resistance to F usarz'um root rot in common bean for

178

root rot resistance and provide the opportunity for marker assisted backcrossing to

avoid problems with inter-gene pool crosses.

179

APPENDICES

180

APPENDIX A

Table A1. Root characteristics of bean genotypes harvested during the vegetative stage
of development.

 

 

 

GenotypesT
Root Characteristics -

Red Hawk Montcahn Beluga 0331;; k F R266
Total Root Length 1227.3 1 127.4
(cm plant") 978.9 (ab) 1089.0 (ab) 1079.3 (ab) (a) (ab)
Fine (A-C) 902.8 1017.4 1018.3 1164.6 1066.1
Intermediate (D-G) 67.6 66.7 56.7 58.5 56.8
Taproots (H-J) 8.5 4.87 4.30 4.12 4.4
Surface Area (cm‘) 241.95 (ab) 2:58 242.7 (ab) 2:36 240.6 (ab)
Projected Area (cmz) 77.0 (ab) 80.1 (a) 77.2 (ab) 82.3 (a) 76.6 (ab)

Average Diameter (mm) 0.8 (a) 0.7 (ab) 0.7 (ab) 0.6 (b) 0.6 (b)

Total Root Volume (cm3) 4.9 (a) 4.7 (a) 4.4 (ab) 4.3 (ab) 4.1 (ab)

Density (g/cm3) 7.9 (a) 6.8 (ab) 5.4 (b) 5.6 (b) 5.9 (ab)
(Leg/flier “mm" 979.0 (ab) 1089.0 (ab) 1079.4 (ab) ”(221:3 1127.4 (ab)
Fractal Dimension 1.54 (a) 1.54 (a) 1.50 (ab) 1.51 (ab) 1.51 (ab)
No. of Meristems or Tips 3101.4 (b) 3244.8 (ab) 3486.8 (ab) 4226.2 (a) 3583.6 (ab)
Forks 2759.6 (a) 2996.8 (a) 2741.3 (a) 3438.1 (a) 3205.5(a)
Crossings

342.3 (a) 393.3 (a) 363.3 (a) 494.8 (a) 450.1 (a)
Vegetative Weight (g)
Fresh 6.87 (a) 5.1 (be) 4.6 (cd) 4.8 (bcd) 3.8 (e1)
Dry 1.1 (a) 0.7 (b) 0.6 (b) 0.7 (b) 0.5 (be)
Root Weight (g)
Fresh 7.8 (a) 7.5 (a) 5.8 (ab) 6.7 (ab) 6.5 (ab)

Dry 2.9 (a) 2.5 (b) 2.5 (b) 2.5 (b) 2.5 (b)

 

181

Continuation of Table A1.

 

Genotypes)r

 

Root Characteristics

 

C97407 Taylor Hort Nei’l‘l’issa" TLP19 B98311
Total Root Length
(cm plant") 1174.1 (ab) 1057.9 (ab) 1106.7 (ab) 1117.6 (ab) 906.0 (b)
Fine (A—C) 1115.3 1003.4 1048.4 1053.2 855.4
Intermediate (D-G) 55.5 51.2 54.7 60.2 47.1
Taproots (H-J) 3.3 3.3 3.6 4.2 3.5
Surface Area (cmz) 246.5 (ab) 229.4 (ab) 237.4 (ab) 255.2 (a) 198.7 (b)

Projected Area (cmz) 78.4 (ab) 73.0 (ab) 75.5 (ab) 81.2 (a) 63.2 (b)
Average Diameter (mm) 0.6 (b) 0.7 (ab) 0.6 (b) 0.7 (ab) 0.7 (ab)

Total Root Volume

(cm 4.1 (ab) 4.0 (ab) 4.2 (ab) 4.8 (a) 3.6 (b)
Density (g/cm3) 4.9 (b) 5.8 (b) 6.1 (ab) 5.9 (ab) 5.3 (b)
1

a???“ V" “m 1174.1(ab) 1057.9 (ab) 1106.8 (ab) 1117.6 (ab) 906.1 (b)
Fractal Dimension 1.5 (ab) 1.5 (ab) 1.5 (ab) 1.5 (ab) 1.3 (b)
$8“ Me’iS‘emS or 3212.6 (ab) 3218.8 (ab) 3721.4 (ab) 3066.4 (b) 2871.4 (b)
Forks 3301.5 (a) 2726.9 (a) 2907.1(a) 2633.2 (a) 2353.5 (a)
Crossings

513.4 (a) 388.6 (a) 390.3 (a) 347.0 (a) 308.3 (a)
Vegetative Weight (g)
Fresh 5.6 (b) 5.2 (be) 4.3 (de) 3.1 (I) 2.2 (g)
Dry 0.7 (b) 0.6 (b) 0.7 (b) 0.2 (d) 0.3 (cd)
Root Weight (g)
Fresh 5.8 (ab) 5.9 (ab) 6.5 (ab) 6.7 (ab) 4.9 (b)
Dry 2.5 (b) 2.5 (b) 2.5 (b) 2.5 (b) 2.4 (b)

 

‘1 Each value is the mean of three replications (three pots per genotype per replication). Pair-wise
comparisons are shown in parenthesis.

182

Table A2. Mean values of length of root classes obtained under greenhouse environment.

 

I
Bean Root Classes (cm)

 

 

 

 

ClassesT Genotypes Fine Intermediate Taproots

A B C D E F G H I J
K Beluga 463.8 450.0 104.5 29.7 16.3 7.4 3.4 1.9 1.1 1.3
C333?“ 594.3 474.6 95.7 29.7 17.1 8.1 3.7 1.9 0.9 1.3
Montcalm 465.4 445.1 106.9 33.6197 9.0 4.5 2.4 1.0 1.5
RedHawk 392.5 410.7 99.6 31.8 19.9 10.1 5.9 3.3 2. 3.0
(3 (397407 569.1 445.5 100.7 30.0 15.6 6.8 3.1 1.6 0.8 0.9
Taylor 477.8 428.9 96.8 27.0 14.7 6.5 3.0 1.6 0.8 0.9

Hort
s FR266 542.3 428.9 95.0 28.9 16.2 7.9 3.9 2.1 1.1 1.2
13 1393311 404.9 375.7 74.8 24.8133 6.0 3.0 1.5 0.9 1.1
“€0,321“ 517.3 441.0 90.2 28.8155 6.8 3.6 1.8 0.8 1.0

1118
TLP19 449.1 496.8 107.3 32.0 17.4 7.5 3.4 1.9 0.9 1.3
GrandMean 487.7 439.8 97.1 29.6166 7.6 3.8 1.9 1.1 1.41
LSD(0,05) 191.7 78.9 20.1 8.5 5.6 3.1 1.9 1.2 0.8 1.3
coeffifi’f’m“ 33.2 15.1 17.5 24.1 28.5 34.2 42.8 50.5 66.2 83.3

Variation

 

T K= Kidney, C= Cranberry, S= Snap, and B= Black beans

1 Roots were divided into ten classes, based upon root length and diameter [class A (0-0.5 cm), class B
(0.51-1.0 cm), class C (l.01-1.5 cm), class D (1.51-2.0 cm), class E (2.01-2.5 cm), class F (151-3.0 cm),
class 6 (301-35 cm), class H (3.51-4.0 cm), class I (401-4.5 cm), and class I (> 4.5 cm)]

183

 

 

C97407 *2/ NSL IBL population

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

L61 L62 L63 L04 L65 L66
0 O X7700 0.0 813.1700 0 0 AL20.2000 0.0 V6.1500 0.0 319.1000 00 j: 63 800
2.0 V12 1100
6 0 012.800
11.0 819.1100
1 M10 900 68 500
30 130 140 P101600
16 0 6171800
18 O AL20 850
20 0 M10 1500
26.0 AL20.500
30 O M10850
Red Hawk *2/ NSL IBL population
450 68.1400
L67 L68 L69 L610
00 —Q'— Al20 700 0 0 AN19.1300 0.0 AJ4.350 0 0 X32072
4,0 -——'- 662000
5.0—“*— 63.1400 50 AT14.11OO
9.0 —’-‘— 617.900
10.0—d— H4.1200
15 0 ‘Ht— AL20 350
17.0 -‘ — AL20 850
22 0 X33054
23.0 AN19 800
26 O AJ4.3000
27.0 V121100

 

 

 

Figure A1. Illustration of partial linkage groups generated in the current genetic study for
the cranberry and the kidney IBL populations for the QTL analysis.

184

 

 

 

A m ode o.m :8 9mm 0.? 9m QM AmZRsPovaU R
A 6 59 2 5mm me Aw? A.m QM AmZRKovPoU MA
A m 03 men oi: 3% Q: m.m Qm Amzmrgvgo 0A
A m one o.~ 0.8 9mm wdv m.m w.m AmZRLomeU WP
A m o.~v m.m 99: mdm m.mm oé PM. AmZRsPovPao Ac
m m odv o.m 99: man v.3. m.m Em AmZRrbovaU co
m w 534 PM o.moA adv A.Pm we Em AmZRePovSU on
m m 0.24 o.~ oda me PAv m.m Pd AmZRLovSO mm
A A. - - o.moA Anon - m6 Nam AmZRKovSU om
A m 0.3 ed oda me wdv A6 ed AmZANLonU E.
A m ode o.~ 9.8 fiwm 6.2. N.m 9m AmZNKovSU mm
A v ode o.~ oda me adv A.m 9m Amzmenovgu m
A v 53 mA oda 03 man we Axm AmZNrPovSU mm
A A4 fine o.m méa fiwm Adv N6 in AmZRrPowSO m
m.A m 53 m.~ oPa odm Woo A.m m.m AmZRrPovSU mm
A m of. m.m 5mm fiwm 9mm 3‘ o.m AmZANKoVPmU cm
A m 5? o.~ o.moA own mam PA. o.m AmZANePovPoU mm
A A. Q? 2 38 OAK osm we Em AmZRrPchmU E
A N 6? mm odo odv mom o.m Em AmZRrPovPaU om
m m WPV m.m o.voA mdm 0.? EN EN AmZNLovaU E.
m - Qwv o.m - - - 9N 0A 65 saw 832 AmZ
SE 83 8 6% 88m 88m .
65380 ED 2on: ewEonoA EPQ ”APO mAcoom ”New “WWW 282 88.882 39
doom .6 8883. 2AA macaw

ASA 6:88:02 8 63238 AmZ \N... P330 85 SA mAmAA A8386 56m .6 8:88 38: oAEockom A38 @858 A8 83A .Am 2am P

m— X—QZm—hmd.

185

 

 

186

m m odv m.m o.voA man A., Av m.m me AmZRKoEoU co
m m mow o.m moo fiov A9. v6 mé AmZANKovRU me
A v 5? 5m Ema own mew 5m me \AmZELoEoO S
m m of» o.m o.ooA Anon o.wm no mé AmZRLovEU mm
A m mow 5m mom o.mm wAm no me ‘AmZRKoEbU mm
A m 5.9 o.~ Amoo o.wm m. Av 5m mew ‘AmZRLoS‘oU ow
A m 5.? o.~ oooA mom m.mm ox mé 49695330 Av
A m 03 o.~ Ammo own w.mv Ann 3» ‘AmZRtovnoo Am
A m - - n. Ao fiwm - no m4. 1623,5330 mm
A v - - o.~o o.wm - mo me AmAémlovSU on
A m 03 EA m. Ao fiwm wém o6 mo ‘AmZNLoEoU 8
A m oov o.~ o.moA o.wm osm 5m Ad AmZRKoEmU AA
m m 0? o.m odo o.ov wAm ow AAV \AmZRLoEoU no
m m odv m.m o.moA o.wm osm o.m oé .AmZRLoE‘oU AA.
A m 3% m.A m.mo Amwm fiAv m.m o.v \AmZRLoEoU S
A v 93 o.m odo mom 0? 9m o.v ‘Amgmfiovgu mm
A v o.mv o.m méo owm now o6 oé \AmZANLovSU mm
A m oov o.N o.ooA odm «Am Nd oé AmZRRoEmU wm
m m 5.? EN o.moA o.ov 5% Wm oé AmZRLovSU Va
A v - - o.~o owm - no oé 49695330 Am
A v Q? o.~ o.mo mom v. A m ow o6 ‘AmZNLoE‘oU 0A
A v 03 o.m 5. Am 3% now Ao ad 49698330 on
SE Es 3:5 2% 28m .
@5580 wmm EonAA «wfiwooq Fab Eb mooom ”owe” MMWM oEmZ oEwAAVom mum:

 

.Am 2an .3 5:96:80

 

 

A v 5.3 ON mOw O.wm O.Am «.6 O6 AMENEOVBOU mm
A m fimv ON ONO fiwm A.Am mo O6 AmZ\N*thfiOU AV
A m O.mv ON O.AuOA O.wm OOAV 0.0 wé AMENLOVBOU w
A O u - O.mOA O.wm - OK We. AmZNLOEOU mm
A m O.mv ON ONO O.wm Wow no 5v AmZNLOEOU OV
A m m.mv ON O.VOA O.wm NS? 5.0 5v AmZNiOthU wv.
A m O.mv ON héO O.wm N66 m.m 5v QmZNsfiovnOU NV
A m 53“ MA ONO O.mm mdm ON 5v AmgNi‘OE‘OU OAV
A v va 5N O.AVOA fiwm Ofim O.A. 5v AmZNLOEOU mm
A v th ON O.AuO O.wm ON? ON 5.? AmgghOVBOU mm
A m O.A;u h. A ONO Own v. A.» m6 5v AmA/QNLOE‘OU mN
A v u - WOO O.wm . O.A. We AmZ\N*hO§.OU NN
A v ONV h. A ONO O.wm WOV Nam 5v AmZNLOEOU NA
A m O.mv ON m.mO O.wm ANAu 5.0 5v AmZNilOvnOU NA
A m O.Av ON ONO 0.0m Tom 0.0 5v AmgyhOVBOU A
A N ONV ON h.OOA O.wm - m6 0.? Am7<N*hOv\lOU 3
A m 03 ON mNO O.wm ANm w.m Oé AmZ\N*hOE‘OU ON
A v O.mv 5A ONO O.wm O. A m m.m WV HMOE mogaa. wOOAwU
A v O.mv O.A ONO O.wm O.Av mo m6 HMOEHROANOU bOE‘OU
A m - - ONOA O.wm - m.m m6 AmZNLOE‘OU no
A v th mN m.mO O.wm NOV N6 m6 AmZNiOE‘OU OO
m m va 5m O.mOA 5.me wfim Nam may Am7A\N*hOvnOD we
Boom. 88m
oflwaomo mma gammy mama: Eb PE Awwwwwm WM» “MAMA oeaz .023qu SB

 

.Am 2an ‘Ao coca—5:80

187

.AAAE Eva NooN 08 A8 380:8 £3 53 20A» 07A .880qu 0886 £33 3883 88an 228m .Ao 8332A A8805:

8a 803 88 $53 8 26 Saw wfimmAE 8 €88 .-. .ANwOA .AAwAAAmO A53 83ko 88:383.: n m 98 N 45.3 538w oAanAEABoAvuA A. 65883 0.88 988
2AA AoAAmAAA 2AA .0336 .3 383a can 55$: .3 53:88: .8586 25ko 8 Avon oANASoZO .32 Avon 623882 wEwAvoA 4:on: mm A88 385 aouSoAVAmAAoo
25 838 38:88 8 53m O 8 A 808 bAABEAmoQ an m .wEwAvoA 0338me ES wEwAqu oquA 20:? m3 A oAaom A. .5559: 8 93¢ NEG A38 833A

8 9:6 ”EKG .A-A88ooA .w 3 3:582 N .88 MaoBum EB 88 mAAeowA>nA 08:3 m 9 A 39% N .380on 38381. 98 038% ofA 20:? A. 9 A 28m A

 

 

 

188

NN 3 2 2A NA NA 3A O.A: NA 3 SEES 320880

NA 3 S 8 AN A.A 3A 3 NA Amodnao a3

NA A; 0.? MN ANN EN 3* NA» 3 232
N N 52 N 32 3% 3m 3 mm AmzANLSBo on
A N - - 0.2: gm - S A: AmZANLoEmo Q
A A“ - - NNN Nam .. 3 ca AmZANLoan NN
A N 3% oN 32 EN. 3m 3 A: AmzANLoEau %
A N - - 32 SAN - O.A. ow AmZANLoEmo Am
A m oNAq oN E 33 «an no A: 87:98:30 3
A AV - - 98 SAN - A: ow AmZN..SA§o 9.
A N 99 oN 2: SAN now A: A: AmAeNLoEoo mm
A v oNv AN 23 N? as. E A: AmzANLoan cm
A v a? oN oNo SAN N? 3 A: 839.3880 2
A N o? N 58 SAN N? no A: AmZANtofimu A;
A N we. MN 98 can a? A: A: AmzANLoES NA
A N 3% oN NNN EN nNm A: A; 875...;an a
A m a? 3 32 3m 3m 8 AR AmZANLoEoo N
A N NNAV NN oNa SAN NR 3 ed AmzANLoEmo o
A N - - NNN 98 - A: ow AmzANLoENo N

AAAANAA A83 Amo 9% 28m 28m .

©53vo mma Ems: AMENUS SEA ”Fa mwoom “WWW AAAMWAM 0:52 okoAAquA mAmA

 

.Am 0:3 A0 8:33:50

 

 

A Ne A3 0N 0.; EN N.NN NNAN N.N 3 ANzANLoENu NN
A N.N N.NN NA 0.3 0.8 BAN oNNN N.N N.N ANZANLAAENU NN
N oN ANN ANN 0.8 oNv v. A N NNNN N.N N.N ANZANLAAENQ A0
A oN N.NN oN oNN oNN N.oN ANON ANN N.N ANA/SEES N
A oN 0N0 0N 0.8 QNN N.NA. NNNN N.N N.N $39838 NN
A AAN N.NN AN 9% SAN N.NN NNAVN A; N.N ANZANEAES AN
N N.N N.NN oN 0.3 0.3 oNv NSN N.N N.N ANA/SEES N
A 3 0.3 NA 0.3 oNN 3N EA 3 A.AV $39838 N
A 3 N3 A.A O.AN oNN N3 NNNA N.N A.A“ ,SAOAAHASANS 838
N N.N N.NAA N.N 0.8 oNN N.NN NNNN 0+ 3 ANZANEAENU AN
A 0N 3% A: N.NN oNN N.NN NNNN A; 3 50m 00653 828
N 0N A}; oN O.AN oNN N.NN NNAN N.N N.N ANZANKAAES NN
N N.N N.NN N.N 35 SN N.NN NNNN N.N N.N ANA/SEES N0
A oN ANNA“ NA 0.3 oNN ANN NNNA 3. N.N ANzANLSSu NN
A N.N N.NN N.N N.NN QNN N. A N NONN N.N N.N ANZANKSSU NN
A N.N ANNA“ 0N N.NN oNv NdN NNNA S. N.N ANZANEAENU 3
A N.N N.NN 0A 93 ON NAAN :AN AN 0N ANA/3:830 NN
A A: N: AN 93 0. AV N.NN ANON N.N N.N ANZANLOENU 0N
N 0N NS oN QNN AA. AA» N.oN SN 3 N.N .ANzANLoENo AN
N oN BAN 0N 0.3 3% N. A N oNA N N.N N.N Zm>$AANoANNx A ANNNNA
w 080 080
A303 mQ A83 wSmcoA EEO “Aha 0WAVm €3th AowANw Saw 0802 .00AwAA00NA quA
05380 N Ewfim v . NAA0.0m E0; NAomyA AAooyA .

 

.mOON .Ao A0883 05 9:50
A: .8338: AN 8:233 dz 5 8:8 2AA 5A 38 0250 £60 No 538 as: 28880.“ Ea 05.88. A2 33A .8 0:5

189

 

m4» v.93 o.~ 9mm odm 0.53 mag Qm fin AmZRLoE‘oU N.N

 

~
~ 3 33 2 3m 33 :3 82 3 3 328.838 mm
m 3 33 3 33 33 Non £3 3 3 3753330 3
_ 3 33 3 3m 3m 33 8M: 3 3 3753380 3
_ 3 :3 3 3m 3m 33 $2 3 3 3753380 on
_ 3 33 3 3m 3m 33 Ron 3 3 3753358 2
fl 3 33 3 3m 3m 3 8: 3 3 3753an a
fi 3 33 2 3w 3 33 $8 3 3 37:98:30 S
m 3 33 3 3m 33 33 a2 3 3 3753380 8
m 3 33 3 3m 33 33 $8 3 3 37:98an S
# 3 33 3 3m 3m 33 8: 3 3 325.8380 %
H 3 33 3 9; 3m 33 $8 3 3 339.8330 3
fl 3 33 3. 3m 33 :3 N32 3 3 3598330 2
_ 3 33 3 3m 3m 33 am: 3 3 339.8330 on
fl 3 33 3 3m 33 3.2 t: 3 3 gngofiou E
m 3 33 3 :5 33 gm 8: 3 3 3753330 8
m 3 33 3 Q8 33 33 Son 3 3 3393330 8
m 3 33 3 3m 33 33 an 3 3 37:98:30 8
H 3 33 3 3» 3m 33 $8 3 3 3398330 M:
H 3 33 3 <8 33 33 £8 3 3 3753380 on

w Boo Boo
Bun mm 33 mama: 23 Eb owwm 3th 3% 8mm 0:32 336$ 3m:
EEG m imam 3 . 30m 22> N63 zoom

 

.Nm 23H «0 5:253:00

190

 

o6 v.33 o; mdw me 5mm 52 5N 5m AmZRKovnmU we

 

_
_ 3 33 3 3m 33 3.8 $8 3 3 3733380 2
_ 3 33 3 3m 33 33 £2 3 3 3733330 3
_ 3 33 3 33 33 33 a: 3 3 339,838 3
fl 3 33 3 Ex 33 33 3: 3 3 323.8380 3
_ 3 33 3 3” 33 33 3.2 3 3 373338 w
fl 3 33 S 33 33 33 N3 3 3 373338 3
fl 3 33 3 33 33 33 83 3 3 3733330 S
# 3 33 3 3w 33 33 m3 3 3 3733330 3
fl 3 33 3 33 33 a: $8 3 3 323338 e
_ 3 33 3 33 3 33 2M: 3 3 323338 2
_ 3 33 3 33 3 33 82 3 3 3733380 3
_ 3 33 3 33 33 33 m3 3 3 323338 3
_ 3 33 3 3m 33 33 33 3 3 339838 3
fl 3 33 3 3m 33 33 82 3 3 325838 03
fl 3 33 2 n? 33 33 mm: 3 3 323338 3
fl 3 33 3 33 33 33 E: 3 3 230502 3833
~ 3 3.3 3 3m 33 3.: 32 3 3 3258330 3
fl 3 33 3 33 33 33 88 3 3 373338 E
m; 3 33 3 3m 33 30 33 3 3 3258an 3

0.80m 20an

LWMWO “ma $me .mequ SE ”Fa WWW AMWMV “mum WW“ 832 .0368 38

N _

 

.Nm 2an mo song—5:00

191

ABUSE 038% :35 30303 005800 80>8 .«0 80300 00803:

000 803 35 8:20 8 020 800 wfimmg 0a 3008 .-. Ame .359 “Ban 538m 8380?: n m 03 N J53 €303 0§EEB00H~ 0 038800 808 0.88
05 00.33 05 .0386 .«0 00083 03 5938 m0 3:59:50 6003.86 950% 0a .000 05893.“ .32 000 600838 30va Jaws: mm :08 3mg 0208028000
BE .0003 stS: 8 00>mw a 8 _ 808 baoahmRH m .9:va 03800me 03 wEqu 00““ 000:? m0“ _ 030m 3 5508 0a 930 "ED can “030$

8 9:6 .1.th $00802 .w 3 005302 3 .0000 303nm can “000 maouowgu— 80:? m 9 _ 030m N 00386 30H0>8n> 03 038% oar; 80:3 N. 8 _ 0309

 

 

 

3; mi 3 0.: 3 3 3_ 3— 3.: 33 $0 SEEiBBBEBu
3 S S 3 3 to 3“ 3 3 3 @3an 03
E 3 33 3 33 33 33 $8 3 3 882
_ 3 $3 3 33 33 33 $8 3 3 8733380 :
fl 3 33 3 33 33 33 22 3 3 8258380 3
fl 3 33 3 9; 33 $3 03 3 3 8238330 3
fl 3 33 3 3m 33 33 3: 3 3 8398380 2
fl 3 33 3 3m 33 33 E: 3 3 8258330 2
0 3 33 3 3MW 33 33 on: 3 3 8733330 0
fl 3 ~03 3 3m 33 33 8: 3 33 SSE £83
_ 3 33 3 33 3 33 82 3 3 8233330 mm
_ 3 33 3 3MW 33 33 33 3 3 833337030 330
_ 3 33 3 3MW 33 33 a: 3 3 8733380 2
0 3 33 3 3 33 33 38 3 3 8703830 3
. m 3 33 3 3 33 33 33 3 3 87098330 E
E Boom 0.80m
thmo 80 “WNW E380 ES 30 9% AMNWV 83> 8m 0:32 .033 39
o . M000m . N000m Loom

 

.Nm 2an .«0 003003000

192

 

 

0 3 m3 3 0.8 53 33 3 3 $0300 .28338858200 88am
0 3. m3 3 38 SM 33 3 E 823... 052m 03 a:
_ 3 33 3 98 0.3 83 3 2 875.... 052m 00¢ E
m 3 m3 3 5.8 >3 0.: 3 3 825 .0330 00m 0:
m 3 33 3 n; 33 m3 3 3 823... 052: 03 m:
m 3 0.8 3 38 33 N3 3 E 82?. 0.5/<0 0mm 0:
S 3 53 Z 38 9% m3 3 3 875... 0320 03 we
0 3 3 3 0.8 0% 3m 3 mm 825 0320 03 o:
_ 3 33 2 38 33 3 3 8 82a... 0530 03 m2
_ 3 m3 3 3w 3». 3 3 8 875.... 052: 00¢ t;
0 3 Q? 3 98 0.3 38 3 mm 0520 03 8830
m 3 33 3 98 m3 3% 3 2 828.. 032: 03 32
_ 3. 3 3 3a 3.3 3.; 3 3 825. 052: 8a m:
_ 3. 03 3 3” 2m Em 3 3 80350250 833
_ 3 33 2 3o :3 2m 3 3 828.. 0520 0mm w:
0 3 m3 3. Ex 33 m3 3 3 82$. 09?: 0mm 9:
m 3 3 3 gm Q? NE 3 3 5:8 2-50 5me
0 3 b3 3 3a 9? 3m 3. 2 3va 82m 88%
N 3 o: 3 3o 33 8.2 N.N 3. 2033853 :30
m - 3 3 - - - 2 Z 82 :32
:33 A83 3 080m 080m .
2380 “mo 2%: «mama: 25 "in 0% H80> 8m 2&2 838m 3m:

mw00m mood zoom

.88 00 588% 2: 386 .02
#530282 3 moaning Am Z \~* 0333 “00¢ 05 Sm mum: @0386 vaUm (Ho 8306 33: 0:05:83 93 wato8 02 «com .mm 0339

193

 

 

fl 3 33 3 3m 3m 3.; 3 3 5S... EBB 92 Q:
g 3 33 3 3m 3m 3m 3 3 dz? 3% 8m E
_ 3 33 3 3m 3m 33 3 3 d3... 3% 9,2 5
_ 3 E3 3 3m 3m 33 3 3 238202 885
_ 3 33 3 3a 33 e. _ m 3 3 dz? 53: ea mm:
fl 3 3 3 3a 33 33 3 3 d3... V535 93 a:
fi 3 33 3 30 o. 3 0.3 3 3 dz? 2.55 92 ca
fl 3 33 3 3a 33 33 3 3 $23.. 53: R2 a:
fi 3 33 3 3a 33 3m 3 3 $75”... V535 a”; ma
_ 3 33 3 3a 33 $3 3 3 $25 v32: 92 3Q
fl 3 33 3 3a 33 3.9. 3 3 1525 33.: RE «2
_ 3 33 3 3m 33 33 3 3 $25 E55 92 32
_ 3 33 3 3o 33 3m 3 3 dz? M33 Ra E
_ 3 33 3 3m 33 3.8 3 3 dz? E35 82 o:
_ 3 33 3 3a 33 3m 3 3 dz? 3% Ba o2
fl 3 33 5 3m 33 33 3 3 dz? v52: 92 32
_ 3 33 2 3a 33 can 3 3 $25 52% Ba 32
m 3 33 3 33 33 33 3 3 $23... :3 92 §
_ 3 33 3 33 3». 3m 3 3 $23.. v52: 93 . w:
_ 3 33 S 33 33 3m 3 3 dz? 3% 92 3
fl 3 33 3 3a 0% 33 3 3 $73.... 3% a3 2:
_ 3 33 3 3o 2:“ N3 3 3 $25 3% n3 §

:85 A58 Amv Boom 88m .
2320 m3 2%: ”mama: 25 Eb Em 83> 8m 3:2 858m 3m:

MBum wood 18%
.mm 23% mo counsczcoo

194

 

 

m 3 33 3 33 33 Ed. 3 3 dz? v52: 93 we
3 3 33 3 33 33 33 3 3 dz? 3% ea 2:

m 3 33 3 3m 33 ed 3 3 dz? 3% 9,2 m:

z 3 33 3 98 33 3 3 3 dz? V535 9,2 32

z 3 33 3 ed 33 33 3 3 dz? 3% a3 3:

_ 3 33 3 o? 33 33 3 3 dz? 3% mm: a?

_ 3 33 S Qd 33 3d 3 3 dz? VEE 93 w:

z 3 33 3 3m 33 33 3 3 dz? 335 a3 :2

m 3 33 3 So 33 2d 3 3 dz? 335 RE 32

z 3 33 3 3a m. 3 33 3 3 dz? 3% 82 E

_ 3 33 3 33 33 33 3 3 . dz? 3:: a3 a:

z 3 o. 3 3 3a 33 33 3 3 dz? 53: ea c:

z 3 33 3 33 33 33 3 3 dz? 3% BE 3:

_ 3 33 3 33 33 33 3 3 dz? 3% ea 3:

_ 3 33 3 33 33 33 3 3 dz? 3:: n3 5

_ 3 33 3 ed 33 33 3 3 dz? 3% n3 3?

_ 3 33 3 39 o. 3 33 3 3 dz? 3% RE a:

m 3 m. z. 3 3o 33 33 3 3 dz? 3:: 8m 32

_ 3 m. 3 3 3m 33 33 3 3 dz? V535 RE 33

z 3 33 3 33 33 33 3 3 dz? V355 a3 a

_ 3 33 3 3o 33 .33 3 3 dz? 33$ 93 N?

m 3 33 3 ed 33 33 3 3 dz? EEE ea N:
“Bum A88 Amy Boom Boom . 39

3.380 m8 3%.: ,3qu 2,5 ”in 3d 83> 8m Eaz 8de.“

nfioom N“Goa Loom

 

.mm 2an mo 5:35:30

195

 

 

'—

o..m 0.3 Na— hww Own adv ow o4. 4mg? M3<mamd m8

 

z 3 33 3 38 33 9% 3 3 dz? 3:: 0mm 32
3 3 33 2 98 93 3.; 3 3 dz? 3% 03 3

z 3 33 E 98 98 33 3 3 dz? 052: 0mm 3
S 3 33 3 98 33 9d 3 3 dz? 052: 0mm 5
m 3 33 3 Ed 98 33 3 3 dz? 3?: 0mm 32

m 3 33 3 38 93 33 3 3 dz? 3% 0mm 32

z 3 33 3 38 33 33 3 3 dz? 052m 03 NS

_ 3 33 3 98 98 93 3 3 dz? .33 03 E

z 3 33 2 33 93 33 3 3 dz? 03:5 03 8:

z 3 33 3 98 98 98 3 3 dz? V52: 03 o:

z 3 33 3 38 33 9d 3 3 dz? 052: RE 32

z 3 33 3 98 33 9d 3 3 dz? 032: RE 8_

z 3 33 3 9d 33 9d 3 3 dz? 05?: 03 E

z 3 98 3 98 33 33 3 3 dz? Maé 0mm 32

_ 3 33 3 98 33 3 3 3 dz? 0:3: 82 we

_ 3 33 3 38 33 33 3 3 dz? V32: 03 32

z 3 33 3 98 33 33 3 3 dz? ESE 0mm 2:

_ 3 33 5 33 98 dd 3 3 dz? V52: 03 m:

m 3 33 3 38 98 98 3 3 dz? :3 0mm 3:

m 3 33 3 38 33 9d 3 3 dz? v32: 03 z:

z 3 33 3 98 33 33 3 3 dz? $3: 82 82

:33 A88 @ Boom Boom .

3.320 “m0 330 .833 2,5 Eb ad 35 8m oemz 833m 38

”Bow mood ~zoom
.mm 2an mo Gomumssnflcoo

196

.Eb Boa Sam 05 Ho.“ 380:8 33 83 203 oz dogma: 9336 Emma Huang .8888 838 go 3583 c8832

8: 203 85 83E 8 26 Saw madman 9 8&8 .-. Ammo" Awfimv “Ba: 63on 88:38qu N m 98 N J53 8963 ofiflgouovu— c 63283 808 Bod
05 Emmi 05 .88me mo 358% can 5958: mo bgomas .3386 938w 9 909 ofifigfl .32 con 628882 9:va Jaws: 3 :03 $93 533388
95 mow—S @538 8 53w a 9 _ Bod 325363 3 .8:ch— ozmmooxoum v5 8:va cal 80:? m9 ~ 28m 3 .358: 9 939 MED can 826:

9 9:6 "Eb ._buomo3.w 8 33302 n .88 xaoBum 95 88 85.8me" 223, m 8 — 28m N .3336 $8381. 98 88va 8.1.— 223 N. 9 d 339

 

 

 

9M: 9w 3 9: 9_ 3 3 3 3 9% 8:353 mo 620880
3 9o 3 9o 93 3 3 9o 90 $93: dq
E 3 93 3 28 98 98 3. 3 2302
z 3 98 93 98 93 98 3 3 dz? 3% 82 :2
_ 3 98 3 38 98 98 3 3 dz? v52: 82 ca
z 3 93 3 98 98 98 3 3 dz? 33$ 82 8:
_ 3 98 3 98 98 98 3 3 dz? E3: 82 n:
z 3 98 3 38 9.8 93 3 3 dz? 3% 88 9:
z 3 93 3 98 98 98 3 3 dz? 3?: 82 m:
z 98 93. 93 98 33 98 3 3 dz? 33m 88 a:
z 3 9S 3 38 33 98 3 3 dz? v32: 88 E
z 3 33 9_ 98 98 98 3 3 dz? 33$ 82 m:
_ 3 33 3 98 33 98 3 3 dz? 53$ 82 E
9_ 3 93 3 38 33 9S 3 3 dz? 33$ 88 N:
_ 3 98 9_ 38 9 z. 98 3 3 dz? E2: 82 8:
_ 9m 98 9_ 98 33 98 3 3 dz? v52: 8: E
:33 A88 @ Boom Boom .
05.320 “mm 23% 8583 SE Eb 8d 85 8m 252 8868 38

”Bow N80% 200%
.mm 038; m0 :oumsczcou

197

 

o6 Fmv o.m 5mm me 9mm vb: - w.m wé .553 £065; woofiwo
m.m 5.3 Cd mums own 0. :V oamm 0...» WV wen AmZR... M22: Dmm >3
0% 5.33 o.N béw me Ném meg mé 5v wé AmZR... M335 de a:
men ode o.m Wow me odm avg N6 o.m We ‘52:”... M3<m 9mm #2

nv—I vI-i F-I v—O

 

m fl 3 33 3 3m 3m :3 383 3 3 3 ES... V52: 92 E
m 3 m3 3 3m 3m 3m 82 S 3 3 dz? v52: 92 ca
_ 3 33 3 3w o. 3 3m 8: - 3 3 $25 VSEm 9mm 32
fl 3 33 3 3m 3m 33m 38m 3 3 3 $25, 3E amm E
_ 3 33 3 3m 3m 3a 023 3 3 3 $3... 3% QB. 32
H 3 33 3 3m 3m 3m 53 3 3 3 dz? V52: 92 a:
g 3 33 3 35 3 3m 22 3 3 3 d3... v52: 82 5:
~ 3 33 3 «.2 3m 3m 88 3 3 3 $25 32: 82 2;
fl 3 33 3 3m 33 33 8mm 3 3 3 dz? V52: 92 w:
H 3 33 3. 3m 33 3.8 3: an 3 3 dz? VEE 9mm 3
m 3 33 3 3m 33 0.2 a: 3 3 3 1575... E55 m5. 0:
N 3 3m 3 3w 33 SN 82 - 3 3 zm>$<8§x :mwam
_ 3 33 2 3m 33 33 $3 3 3 3 SS... 3E 92 a:
_ 3 33 2 3m 33 33 ONE 3 3. 3 $25 3% a3 a:
m 3 33 3 3m 33 33 m3 3 3 3 $23... 3% RE 3
_ 3 33 3 3m 33 33 SS 3 3 3 £28 83% 28%
m 3 33 3 - - - - M: 3 2 $2 :33

.>.z 28m "22
onwaomo “ma “WWW @584 25 in “my, AMMWW 8m .5m5 8m 282 623$ 3m:

uoom N83H zoom

 

dOmthEoo you 32:95 83 mm Am: >263 05 .8.“ .>.Z 65:00 8 380:8 9% “8 80m .83. mo 5883 05 wctsc 42
«83352 E noun—smog Am Z hr, xkam tom 05 go.“ 3m: 835% 3m~0m mo 3on 385 2828me can @508 “8 80m .wm 2an

198

 

 

O.v mév ON New Ogv O6m :3 we m6 m6 AmZR... MOS/x: 9mm 51
mé 56v ON 0.0w O.wm 0.3» RC wé O6 m6 AmZN... Mafia de v3
Oé O.3V ON mfib 0.0v flan NwON O6 Ev m6 AmZN... M235 de MN~
O.v 5.3 56 O.mw ONv 08m VONN O6 5% m6 AmZN... M3<m 9mm #2
O.v Oév ON 56w Odm «awn 3B _6 O6 m6 AmZN... M3<m 0mm O2

O6 56v ON m.mm Odm v.3 mEN m6 56 m6 AmZN... Mgé Qmm OO~
m4“ O6v O6 O6w O6v wfim OVON O6 Ev m6 AmZN... Mag Ema m3
m6 5.3V ON m.mw 0.0v Own O63 O4» O6 N6 4mg? Mag 3mm mm~
m4» Know N.N ONO ONv 0.0m SN _6 5% N6 AmZN... 2235 9mm Nwfi
O6 56¢ 54 Oéw O.wm 6.; mug 5v O6 N6 AmZN... v5.2: Dmm mg
O6 va ON ONO O.wm v.3” $6— O6 mé N6 AmZN... MOS/OE QmM O6_
m4» m6v ON ONO Odm N.N.m thN O6 O6 N6 AmZN... MOS/w: de ONO

 

3 . 53 3 3m 98 93 28 mm 3 mm OWEN... v52: ea 2:

O 3 n: 3 OS 3:. EN :2 3 an 3 Omza... 535 82 2O

O SH 3% 3 2% can EH 8: mm 3 O.m Omza... EEO Bx 3O

3 2 ZOO 5. 3% can 9% we: 3. S. ow dz? 5:: QBO 5

O 3 new 3. 2w Q: in a: - 3 3 <03mm 88am

.mO 3 3% 3 3m 3m wOm 82 mm 3 3 OszN... EEO Ba N:

O 3 2O“ 3 3w 9: SA :8 3 on 3 dz? EEO BE SO

m 3 o: 3. 3w 9% Sn OOON ow E 3 625 E55 92 n:

O 2 a? 3 new 3; Oam $: 3 on 3. $2? $55 ea 9:

m 3 2:. 9m 3w 9? v.2 Nam - NO 3 $382.39 832
Em: O83 9% EEO .>.z 28m mm:

mma vwanOOS ES Eb OSO 83> OBO oemz .oewOBnO 3E

EmOoOO Bow 22>
m OOocm NSod OOooM

05320

 

.vm 2an («o coumscucoo

199

 

 

O 3 33 3 33 o. O3 33 3O 3 3 3 33... VOBSO a3 2 O
m 3 33 3 3m 33 O3 2: 3 3 3 33... v52: 92 R:
O 3 33 3 33 3 33 33 O3 3 3 33.. EEO 82 w:
O 3 33 3 3m 3 3m 33 3 3 3 33.. VOBSO BB SO
O 3 33 3 3w 3 33 O3 3 3 3 33.. 32: a3 O:
O 3 33 5 3m 33 33 3O 3 3 3 33... SEE a3 2 O
O 3 33 3 3m 33 won 82 3 3 3 33... 53: a3 3:
O 3 33 3 3» 0. O3 O3 33 3 3 3 33... 3% 92 SO
O 3 33 5 3m 33 33 am: 3 3 3 33... E55 92 3O
O 3 33 3 33 3 3m 82 3 3 3 325 V52: 92 SO
O 3 33 O: 35 33 In a: 3 3 3 33.. 33: 92 MMO
O 3 33 3 3m 3m 33 N38 3 3 3 VOBSO ER 583
O 3 33 3 3m 33 wOm 3:: 3 3 3 33.. 53m 92 3O
O 3 33 3 3” 33 33 $2 3 3 3 325 VEfiO 92 8O
3 3 33 3 3w 0.; 33 £2 3 3 3 33.. VE<OO a3 33
O 3 33 3 3 33 33 33 3 3 3 33* E3: 92 3:
m 3 33 3 3m 3m 3m 38 O3 3 3 33... M22: 92 3O
O 3 33 3 OS 33 33 £3 3 3 3 325" V52: 82 2O
3 3 33 3 3m 3m Sm 82 3 3 3 33., v32: 93 O OO
O 3 33 3 3m 33 33 38 3 3 3 33.. EOEOO a3 OOOO
O 3 33 3 3m 33 Em 3O 3 3 3 33.. v52: n3 2:
O 3 33 3 3m 33 3 5O 3 3 3 325 VOBSO 93 a:
3 3 33 3 3m 3m 33 m3 3 3 3 323... 3% a3 a:
.>.z 88m 32
OOHOOMNOO “ma OOOOMOOMW ,waOmOVoO O25 Eb ”New mm”: 3 33> OSO 252 SEE 3m:

OOooM $00M O80m

 

.vm 23H .3 coszOEOcoU

200

 

 

201

m Em 93 9m 93 93 5.3 OVON m6 3. N6 Omzfi. MOO/SO meO OO O
m 93 93 9m SK 9am NOM OOON O3 93 O6 OOO/3... MOO/SO meO N O O
O 33 5.3 9m 9% 93. 93 RN N6 5m O6 O93... M335 9mm OOO
m 33 93 9m SO 9:V 93 NmON O6 93 O6 OOO/3... #235 meO OOO
O 93 93 5O 93 9mm 9cm 3 ON 3. 9v 9O 373... MOO/SO omm OOO
O 93 93 9N 93 9mm 93 mm: 36 o6 9o OOO/3... M335 de nNO
O 33 93 9m 9mm 93 3.3 83 N6 9m 9w OOO/3... M335 meO NNO
O 96 :3 9m 92. 93 93m NOON v6 :3 9o OOO/3... MOO/SO mmm ONO
O MN 93 EN 9% 90m 93 363 N6 :3 9m OOO/3... M235 nOmM OaO
O 96 E3 9N SO E3 93 603 3. 5m 9m OOO/3... M22: Qmm OKO
O 5.6 3% 9m 93 9mm 9mm NmON 3.3 93 96 OmZR... MOO/(OOO de omO
m m.m 5.3 9m 3% 93. 3.3 $3 6.6 9m 9m ‘Omzh... MBSO 0mm 2:
O 93 93. 9N 9% 9mm 93 O63 9m :3 O6 323... E55 0mm OOO
O 9N N.Nv ON O.mO mOm OOO OmNO 9v 9v O6 OOO/ON... M335 QmMO O6O
O 96 5.33 9m 93 93 5.3 NOON O3 3» O3 OOO/3... MOO/OE meO N:
O 9m 93 9N 3% 9mm 3.3 33 m6 :3 O6 OOO/3* VO>2<OO 9mm mmO
O 3m 93 9O 9mm 93 6.3 OOOO O3 93 O6 OOO/3... OBOE ROM OO O
O 96 93 9m 3O 93 O.3 mOaO - N.N O6 2128.202 NOOORM
O 96 3% 9m OOO 90m 93. OOON m.m 9m Ow OOO/3... MOO/«OOO Qmm VNO
O 93 93 9N 9NO 93 O3 OSN 5m :3 O6 373... M22: QmMO ONO
. . 28
Os“: .8 Es 333 25 "OS cum 3&wa mum/O 83M ”MONO 252 .ooOmOBO m‘OmO
05380 n OOOOOom 3 330m. 22> OOooyO NOOooyO OOooyO

 

.Oum 2an .3 8335300

 

.OOoOOuoOOOO ammomOOv OOOwOOnO 18803 .8888 826m .3 3:82— uoOmoEaOO O0: 803 35 $53 9 26 Saw mama: 9 “OBOE .-. .ANwaO .OOmOOOmV OBOE 526%
83:58qu N m 98 N 453 538w 858$qu e .oOnaOOmoc 088 208 ofi HERE 08 633% .3 35QO was SE39: .Oo banana: .8936 958w 3
won oOnOmOoZd #32 won .quOSmOmoO wEwOVoO .233: mm :25. mag downswing SE v.83 bias: 3 82m o 8 O 38m “$5ng o>Ommooxoum O28 wEwauO oan
20:...» m8 O 03% O. .3959: 9 9.9% "SOHO 28 3:25 9 “$8 "Eb .OboomooO.w ma 3:6on mace anoBum can 88 mOOoOowO>HO 20:? m 3 O 28m N .35
moow aorfim OSEEOOonOxm oOOOOOOOoOOw< 28m “OOO; 3oz n.>.Z OuOOm 83m OOoanmBO EOnoOOOoSO ":2 "common? OOOuOo>omub v5 038% oOOuO EEO? b 9 O 03% _

 

0.2 92 vd v.2 9N 0.0 9m O v.wO Ném N.N 9mm AOXOV counts/mo EoOoObooU

 

 

3 OS MOO OS OOO S no 3 ON 3 mO OBOE: a3

3 3 3% N.N 9mm 9% a? E: O3 3V 3 23: oweoé

O E a? 2 2% 3m may. 32 O6 3 S Omza... VEOOOO 9mm 5
O E 9? O: 3% 3:. «.3 E: 3 3 3 dz? VESO BOO n:
O 3 o? MO 53 2m 5% 82 mm 3 3 OszN. 33$ BOO v2
m 2 :3 3 a: 9qu 9% 88 ow 9m 3 $25. 2.3/E 9,2 OOO:
O 3 5.3 O: E” qwm NS ~me 05 3 to Osz? “OBOE 92 8O
O 3 o? o.~ new 0.? 9% 3O: 3 ow 8 dz? VSSO 9: 8O
O ow Ev 2 3% ed. m.~m EON 3 ca 3 $25 EEO HE E
O 3 5% o.~ mam 9w», mmm 32 nm 3 3 dz? MBSO 82 a2
O 3 3 3 now cam «an m3: 3 on 3 OszN... VESO amm 3O
O 2 93 2 9mm in non omON 3 O: 3 Omza... Mas; BOO 2O
O E 3% O: 3% 3% gm 3: 3 3 3 .525. E2: 92 at
O 3 5% 5 3% 3m m.mm 8: we on 3 Osz? VESO BE SO
O 3 5.3 5 new q? 9% on: 3 3 3 1525. 535 Ba 3
O O; 0.3 3 OS Q? 9% 8: we 2 3 dz? OBOE Ra Ova?

.>.z 28m "ONO:
ohmmomo mmn OOOOMMWO OmanOvoO 25 “OS "WNW OMOMWOO 8m 2&5 8m 0:32 683$ 3m:

OOooyO NOooyO OOoom

 

.vm 2an .8 22:35:50

202

APPENDIX C
THE POSSIBLE ASSOCIATION BETWEEN A VIGOROUS ROOT SYSTEM

AND GROWTH HABIT IN BEAN (PHASEOLUS VULGARIS L.) AS AN
INDICATOR OF F USARI UM ROOT ROT RESISTANCE

To better understand the relationship of vigorous root system to growth habit
described in this discussion it is important to understand the concept of growth habit in
common bean. Bean architecture is a complex character whose importance is evident due
to its association with productivity. Although the architecture of bean plants has been
extensively studied precise information about the genetics underlying the different
phenotypes is lacking.

Growth habit in common bean is known to be genetically controlled (Koinange et
al., 1996). Architecture could be divided in different characters; the presence or absence
of terminal flower is a qualitative character with two alternatives (determinate growth
habit vs. indeterminate grth habit). For example in P. vulgaris, a single gene
difference separates the determinate (fin fin) from the indeterminate growth habit, Fin Fin
and F in_ (Rudorf, 1958; Lamprecht, 1935). Fin is a dominant gene and the expression of
a recessive fin produces a determinate growth habit (Norton, 1915). Determinancy,
which is defined as the early transition from a vegetative terminal meristem to a
reproductive one, and has multiple effects on growth habit and the life cycle as it causes
the appearance of a terminal inflorescence, a reduction in the number of nodes and pods
on the main stem and branches, and a shortening of the life cycle (Koinange et al., 1996).
The fin gene has pleiotropic effects on the number of nodes on the main stem, the number

of pods, and the number of days to flower and maturity. Control of twining has been

203

 

attributed previously to the gene Tor, distinct from the fin gene (Norton, 1915). Twining
was correlated later with fin suggesting that either fin had a pleiotropic effect on twining
or that T or was tightly linked to fin (Koinange et al., 1996). Other characters related with
architecture of the bean plant are: the ability to climb or the rotation capacity of the stem
controlled by the T or gene (Norton, 1915; Kretchmer and Wallace, 1978; Lamprecht,
1947); number and length of intemodes, controlled by [CO gene (Lamprecht, 1961);
presence of vines; plant height and length; number of branching, and others (Coyne,
1980)

The Z locus controlling partly colored seedcoats in common bean was previously
thought to be tightly linked to the Fin gene on Bl, based on a tight linkage with a
determinancy gene in an Andean population (Bassett, 1997). Later the Z locus was
mapped by McClean et al. (2002) to linkage group B3 of the integrated bean map,
invalidating the tight linkage between the Z locus with the Fin gene and suggesting the
existence of multiple grth habit genes in the Andean gene pool. In general results
from these previous studies suggest that a second gene for determinate growth habit
tightly linked to the Z locus (different than the Fin) exists in common bean. This gene
has not yet been named. Tar’an et al. (2002) using a population of Middle American
origin suggested that a second gene for determinate growth habit (GH unnamed locus)
exists in bean, and the second gene is located in a different linkage group (B9) than the
fin gene (Bl). More recently from a population developed from a cross between Bunsi
and Newport, two small seeded navy bean cultivars from Middle American gene pool,
the determinate growth habit mapped to B7, and represented a novel source of

determinancy in navy bean (Kolkman and Kelly, 2003). The likelihood of two loci

204

conditioning determinate growth habit in navy bean is unlikely. Given the extensive
distance (32.3 cM) between marker and grth habit on B9 (Tar’an et al., 2002), data on

actual location needs additional confirmation in Middle American gerrnplasm.

There are also examples of environment dependent changes of the growth habit in
some plant species. Determinate cowpea (Vigna unguiculata) elongated and became
indeterminate under night temperatures of 24°C under 3 12h photoperiod (Summerfield
and Wien, 1980). This same phenomenon was observed in lines of P. vulgaris, which
were found to be unstable for plant growth habit, and changed from an indeterminate
bush to climbing type in some specific environments (Kretchmer et al., 1977). The
instability of plant growth habit was due to a photoperiod response, which was due to a
photomorphic response under the control of the phytochrome. Photoperiod sensitivity
(de) is linked to the fin locus in common bean (de; Wallace et al., 1993; Koinange et
al., 1996). The major gene controlling the photoperiod response in common bean was
different from the gene controlling the change from indeterminate bush to climbing
grth habit (Kretchmer et al., 1977). Judging from the plasticity observed one could
hypothesize that the branching of indeterminate plants is in fact a determinate type from
which lateral shoot grows vigorously assuming a terminal position and the initially
terminal reproductive meristem appears in a lateral position. Therefore the indeterminate
growth is only an outward appearance due to strong vigor of lateral growth and is only a
morphological variation derived from the determinate growth.

Dry bean breeding has focused on modifying architecture to increase yield,
standability, pest resistance (e. g. modification of trichomes of leaves to reduce population

of leafhoppers), and disease avoidance associated with white mold resistance (Coyne,

205

1980; Kelly, 2000). Breeders have focused for many years on the vegetative portion of
the bean plant when breeding for disease resistance. Limited attention, however, has
been given to the root system. Plants vary enormously in the morphology and physiology
of their roots and these roots are directly affected by the environment. Researchers have
only begun to understand the diversity in root form and function as well as the major role
they play when a plant is under stress (Eissenstat et al., 2000). Casson and Lindsey
(2003) stated that “plants are polar structures. . ..the shoot apical meristem represents a
source of undifferentiated cells that divide and contribute to the new leaf primordial
during vegetative growth, and to influorescence and floral meristem during the
reproductive phase. . ..the root also produces lateral structures, but these are not the direct
products of the primary root meristem”. So, when breeding for resistance to root rot
caused by F. solani, breeders should examine more closely the possibility of breeding for
specificroot characters or overall root health.

Field studies have demonstrated that there are differences between bean classes
for root characters that contribute to root rot resistance (Snapp et al., 2003; Roman-
Avilés et al., 2004). Many of these characters appear to act as a mechanism of survival
when the pathogens take over the root system, e. g. adventitious root formation thought to
be for anchoring, water, and nutrient acquisition. Other characters such as root dry
weight have proved to be good indicators of root rot resistance and more reliable
(quantitative measure) than the conventional rating scale commonly used in the field
evaluations (Kmiecik and Bliss, 1986; Roman- Avilés et al., 2004; Hall and Phillips,

2004)

206

 

Dry beans with a determinate growth habit exhibit a shallower root system (Kelly,
1998), whereas plants with an indeterminate growth habit exhibit a more dominant
deeper taproot. Similarly the indeterminate type II and type III black bean lines, tended
to have more adventitious roots and a deeper, more extensive root system (Lynch and van
Beem, 1993). Also a tight relationship between shoot and root growth habit in bean
genotypes has been identified by Lynch and van Beem (1993). Experiments using
grafled bean plants have shown that differences in seed yield have been associated with

the genotypes of rootstock, but not with that of the shoot (White and Castillo, 1989).

‘fl.

These results agree with the extensive grafting work conducted to improve root system of
fruits, nuts, and ornamental plants (Hartman and Kester, 1968). More recently, White
and Castillo (1992) found that among bean genotypes of similar grth habit and
phenology, variation exist in shoot characteristics that affected harvest index, phenology,
and yield under water deficit stress. However, this variation appeared to be much less
important than variation in characteristics of the root system.

Field observations on the light red kidney bean genotype Chinook 2000 (Kelly et
al., 1992; Kelly et al., 1999) showed that this large seeded bean had variability for a very

vigorous root system. Plants of Chinook 2000 with a vigorous root showed a significant

 

higher level of root rot resistance, although they exhibited a determinate growth habit
(Figure C. 1). This observation lead to re-selection of Chinook 2000 for root rot
resistance based on the vigorous root system observed during the summer of 2002 and
2003 and the selected plants are currently being evaluated for root rot resistance and

yield. This same observation was observed in the genotype FR266 with a

207

 

Figure C1. Chgok 2000 is adightrrecfitiaefiyfiaeangemotypereleased developed at
Michigan State University. This genotype was segregating for a very vigorous root
system and had a significant higher level of root rot resistance.

208

 

 

Figure C2. FR266 is a bush snap bean developed by USDA/ARS. This genotype was
breed for root rot resistance with a determinate growth habit.

209

determinate growth habit (Silbemagel, 1987) which was breed as a root rot resistant
genotype (Figure C2). Interestingly both of these genotypes have black bean parents in
their genetic background and it is thought that the vigorous root system came from their
respective black bean parents. CN49-242 which is an indeterminate black bean that is
used as an anthracnose [caused by Colletotrichum Iindemuthianum] differential was used
as a parent of Chinook (Kelly et al., 1992). PI 203958, which is a wild, small-seeded
vine black bean from Mexico, was used multiple times as a donor in crossings that lead to
the development of FR266 (Silbemagel, 1987). The two bean genotypes with
determinate growth habit and vigorous root system are examples that the tight
relationship between shoot and root suggested by Lynch and vanBeem (1993) was
broken.

The uncoupling of these two characters suggests the occurrence of pleiotropic
effect. A gene can influence many phenotypes and when one gene affects several aspects
of the phenotype, it is said to be pleiotropic. There is clear pleiotrophic effect of Fin
gene on shoot characteristics other than roots (Koinange et al., 1996), but these two
determinate growth habit genotypes possess a vigorous root system, a characteristic
normally found in plants with the indeterminate grth habit.

Although Chinook 2000 and FR266 have a very vigorous root system similar to a
root system of genotypes with the indeterminate grth habit, these genotypes still lacks
root vigor of an indeterminate plant. It appears that the vigorous root system character
was not fully transferred to these determinate growth habit genotypes. A possible

explanation for this observation could be the same possible pleiotropic effect of

210

determinate growth on other characters related with the architecture system of the bean
plant. Other characters affected by pleiotrophic Fin gene are number and length of
intemodes, presence of vines, plant height and length, and number of branches. The
grth habit genes may also have an effect on the development of the root system, but
the association might not be as direct as that proposed by Lynch and van Beem (1993).
Although this vigorous root system is composed of many other characters such as
primary root, secondary and tertiary roots, root hairs, angles and radii, all of these
characters will have an effect on overall root architecture.

A second possibility is that there may be a gene(s) in the indeterminate growth
habit that is responsible for the full development of the vigorous root system and that the
determinate growth habit is either lacking this gene(s) or if present it is not being fully
expressed. This gene might require another gene for its full expression (e. g.
complementary gene(s) or a non-specific gene(s)) that is only present in the indeterminate
growth habit, or this gene(s) may be masked by another gene present in the determinate
growth habit. An example would be that intergene pool crosses may result in dwarfing
which results from the dosage dependent effect of the dominant alleles of two
complementary genes, DH and DI-2 (White et al., 1992). Grafting studies by Shii et al.
(1981) demonstrated that DI-l acts in the root system while DI-2 acts in the shoot,
making the D1 system a unique example of where two genes have been demonstrated to
control a strong root-shoot interaction. When a plant is heterozygous at both loci, growth
is severely reduced, and when a plant is homozygous dominant, lethal dwarfing occurs.
DH is found in gerrnplasm of Mesoamerican origin, while DI-2 occurs mainly in Andean

gerrnplasm (Singh, 1989), and has a strong influence on growth. There still needs to be

211

additional research to determine whether additional alleles or genes affect the dwarfing
response. When studying seedling roots of common bean some association of shoot habit
and root architecture was observed, as the climbing genotype HAB 229 had a more
dominant tap-root system whereas the prostrate genotype Carioca had a large number of
root meristems (Lynch and van Beem, 1993).

Regardless of whether the vigorous root from the indeterminate growth habit bean
was or not fully transferred to the determinate growth habit bean, ‘Chinook 2000’,
exhibits partial resistance to F usarium root rot. Breeders have been successful in
transferring root traits that lead to a vigorous root in ‘Chinook 2000’. In the attempt to
transfer resistance to root rot, breeders have indirectly selected for root traits. An
extensive breeding effort would therefore, be required to introgress the desired root
developmental or morphological characteristics from a small seeded cultivars of Middle
American gene pool to the large seeded cultivars of the Andean gene pool, in such a way
that agronomically satisfactory breeding material is obtained. This introgression has been
to be proven partially possible with ‘Chinook 2000’ and ‘FR266’. Transfering the
vigorous root system found in these large seeded bean into other large seeded market
classes by using these two genotypes as donor parents for the vigorous root system,
should hasten efforts in breeding of other root rot resistant genotypes. Root genetic
studies have received limited attention, but has much promise when it comes to
improving root rot resistance in common bean.

In an attempt to introgress the desired root vigor from the small seeded bean to
the large seeded bean class, breeders could employ an inbred-backcross method of

breeding or by single cross using either one of these two large seeded bean genotypes as

212

parents and selecting for the desirable phenotype. The advantage of using the inbred
backcross method is that no selection is conducted during the breeding process and
breeders are able to recover the desired phenotype and seed size of the recurrent parent
faster than by single crosses. Usually three backcrosses to the recurrent parent should be
enough to obtain IBLs, which are agronomically acceptable with the desired seed size,
desired root vigor, and a determinate growth habit and can be advanced by using single
seed descent. The inbred-backcross method of breeding was used successfully to transfer
the beneficial root growth of an exotic bean for phosphorus efficiency, into the adapted
cultivar Sanilac (Gabelman et al., 1986).

Another alternative would be the phenotypic recurrent selection scheme used by
Brothers and Kelly (1993) and Kelly and Adams (1987) to combine the architectured
characteristics of the small navy bean ideotype with seed size, shape, and color of the
pinto bean. Breeders could employ phenotypic recurrent selection to combine the
determinate growth habit of the large seeded with the vigorous root architecture of the
indeterminate genotype. This alternative would require more work than single crosses
and backcross methods, but it have been successfully used to combine traits from distant
genetic backgrounds (e. g. different gene pools). This breeding system may not be the
most adequate for root rot resistance since it involves single selection. Breeding for
quantitative traits involve replicated trials in different years and locations (multisite
testing) that should be perform during the breeding process until the desired level of
homozygosity is obtained not only to prevent loss of desirable alleles with selection but

also to fix the desired alleles in a more homozygous background.

213

References

Ali, M. A. 1950. Genetics of resistance to the common bean mosaic virus in the bean
(Phaseolus vulgaris L.). Phytopathology 40:69-79.

Brothers, M. E. and J. D. Kelly. 1993. Interrelationship of plant architecture and yield
components in the pinto bean ideotype. Crop Sci. 33:1234-1238.

Casson, S. A. and K. Lindsey. 2003. Genes and signaling in root development. New
Phytol. 158:11-38.

Coyne, D. P. 1980. Modification of plant architecture and crop yield by breeding.
HortScience 15:244-247.

Dritjhout, E., M. J. Silbemagel, and D. W. Burke. 1978. Differentiation of strains of
bean common mosaic virus. Neth. J. Plant Pathol. 84:13-26.

Eissenstat, D. M., C. E. Wells, R. D. Yanai, and J. L. Whitbeck. 2000. Building roots in
a changing environment: implications for root longevity. New Phytol. 147:33-
42.

Freyre, R., P. W. Scroch, V. Geggroy, A. F. Adam-Blondon, A. Shirmohamadali, W. C.
Johnson, V. Llaca, R. O. Nodari, P. A. Pereira, S. M. Tsai, J. Tohme, M. Dron, J.
Nienhuis, C. E. Vallejos, and P. Gepts. 1998. Towards an integrated linkage map
of common bean. 4. Development of a core linkage map and alignment of RFLP
maps. Theor. Appl. Genet. 97:847-856.

Gabelman, W. H. and G. C. Gerloff. 1986. Genetic variability in root system associated
with nutrient acquisition and use. HortScience 21 :971-973.

Hall, R. and LG. Phillips. 2004. Methods for determining resistance of edible beans to
F usarium root rot. Annu. Rep. Bean Improv. Coop. 47:275-276.

Hartman, H. T. and D. E. Kester. 1968. Plant propagation: Principles and practices. 2nd
ed. Prentice Hall, Englewood Cliffs, N. J.

Kelly, J .D. 1998. Bean roots- a plant breeder’s prospective. Annu. Rept. Bean Improv.
Coop. 41:214-215.

Kelly, J. D. 2000. Remaking bean plant architecture for efficient production. Adv.
Agronomy 71:109-143.

Kelly, J. D. and M. W. Adams. 1987. Phenotypic recurrent selection in ideotype
breeding of pinto beans. Euphytica 36:69-80.

214

Kelly, J. D., M. W. Adams, A. W. Saettler, G. L. Hosfield, G. V. Varner, M. A.
Uebersax, A. Ghaderi, and J. Taylor. 1992. Registration of ‘Chinook’ light red
kidney bean. Crop Sci. 32:492-493.

Kelly, J. D., L. Afanador, and S. D. Haley. 1995. Pyramiding genes for resistance to
bean common mosaic virus. Euphytica 82:207-212.

Kelly, J. D., G. L. Hosfield, G. V. Varner, M. A. Uebersax, and J. Taylor. 1999.
Registration of ‘Chinook 2000' light red kidney bean. Crop Sci. 39:293.

Kmiecik, K. A. and F. A. Bliss. 1986. Field resistance of snap beans to root rot
determined by root dry mass. Annu. Rep. Bean Improv. Coop. 29:85-86.

Koinange, E. M. K., S. P. Singh, and P. Gepts. 1996. Genetic control of the
domestication syndrome in common bean. Crop Sci. 36:1037-1045.

Kretchmer, P. J. and D. H. Wallace. 1978. Genetics of climbing in indeterminate lines
of Phaseolus vulgaris L. HortScience 13:39.

Kretchmer, P. J., J. L. Ozbun, S. L. Kaplan, D. R. Laing, and D. H. Wallace. 1977. Red
and far red light effects on climbing in Phaseolus vulgaris. Crop Sci. 17:797-799.

Lamprecht, H. 1935. Zur Genetik von Phaseolus vulgaris. X. Uber Infloreszenz typen
und ihre vererbung. Hereditas 20:71-93.

Lamprecht, H. 1947. The inheritance of the slender-type pf Phaseolus vulgaris L. and
some other results. Agri. Hort. Genet. 5:72-82.

Lamprecht, H. 1961. Die vererbung eines Phaseolus-typs mit drei kotyledonen. Sowie
fiber die Wirkung von drei neuen Genen. Agri. Hort. Genet. 22:256-271.

Lynch, J. and J.J. van Beem. 1993. Growth and architecture of seedling roots of
common bean genotypes. Crop Sci. 33: 1253-1257.

Norton, J. B. 1915. Inheritance of habit in common bean. Am. Nat. 49:547-561.

Roman-Aviles, B., S. S. Snapp, and J. D. Kelly. 2004. Assessing root traits associated
with root rot resistance in common bean. Field Crops Res. 862147-156.

Rudorf, W. 1958. Genetics of Phaseolus aborigineus Burkart. Proc. X. Intern. Cong.
Genet. 2:243 (Abstr.).

Shii, C. T., M. C. Mok, and D. W. S. Mok. 1981. Developmental controls of

morphological mutants of Phaseolus vulgaris L.: differential expression of mutant
loci in plant organs. Develop. Genet. 2:279-290.

215

Silbemagel, M. J. 1987. Fusarium root rot-resistance snap bean breeding line FR-266.
HortScience 22:1337-1338.

Singh, S. P. 1989. Patterns of variation in cultivated common bean (Phaseolus vulgaris
L.). Econ. Bot. 43:39-57. '

Snapp, S.S., W. Kirk, B. Roman-Avilés, and J. Kelly. 2003. Root traits play a role in
integrated management of F usarium root rot in snap beans. HortScience 38:187-
191.

Summerfield, R. J. and H. C. Wien. 1980. Effects of photoperiod air temperature on
grth and yield of economic legumes, p. 7-36. In: Summerfield, R]. and A. H.
Bunting (eds), Advances in legume science. H.M.S.O., London.

Tar’an, B., T. E. Michaels, and K. P. Pauls. 2002. Genetic mapping of agronomic traits
in common bean. Crop Sci. 42:544-556.

Wallace, D. H., K. S. Yourstone, P. N. Masaya, and R. W. Zobel. 1993. Photoperiod
gene control over partitioning between reproductive and vegetative growth.
Theor. Appl. Genet. 86:6-16.

White, J. W. and J. A. Castillo. 1989. Relative effect of root and shoot genotypes on
yield of common bean under drought stress. Crop Sci. 29:360-362.

White, J. W. and J. A. Castillo. 1992. Evaluation of diverse shoot genotypes on selected
root genotypes of common bean under soil water deficits. Crop Sci. 32:762-765.

White, J. W., C. Montes, and L. Y. Mendoza. 1992. Use of grafting to characterize and
alleviate hybrid dwarfness in common bean. Euphitica 59:19-25.

216

APPENDIX D

DEVELOPMENT OF A SCAR MARKER LINKED TO A QTL ASSOCIATED
WITH DETERMINATE GROWTH HABIT

Introduction

Growth habit is an important trait in common bean controlled by the fin gene
(Lamprecht, 1935). The fin gene, which conditions the early transformation of terminal
meristems from vegetative to a reproductive state (determinate growth habit is a
prominent gene trait present in the Andean gene pool) has been mapped to B1 of the
integrated bean map (Koinange et al., 1996; Freyre et al., 1998). Moreover, the fin gene
has pleitropic effects on the number of nodes on the main stem, the number of pods, and
the number of days to flower and maturity (Koinange et al., 1996). The probable
existence of multiple genes controlling grth habit in common bean has been previously
discussed (McClean etal., 2002; Bassett, 1997).

Additional controversy regarding the deterrninacy gene in Andean bean
gerrnplasm, centers on the Z locus controlling partly colored seedcoats in common bean.
The Z locus is tightly linked to a determinancy gene, previously thought to be Fin
(Bassett, 1997). The Z locus was mapped by McClean et a1. (2002) to linkage group B3
of the integrated bean map, disputing the tight linkage of the Z locus with the F in gene
and suggesting the existence of multiple genes controlling growth habit. Results from
these previous studies suggest that an second unknown gene for determinate grth habit
in Andean gerrnplasm tightly linked to the Z locus (different than the Fin) exists in

common bean.

217

Red Hawk, a dark red kidney bean highly susceptible to F usarium root rot was
used as the recurrent parent in the development of kidney inbred backcross lines (IBL)
population to study the QTL for resistance to root rot. Resistance was being introgressed
from an indeterminate small black bean (Negro San Luis) from the Middle American
gene pool, highly resistant to F usarium root rot, into the large seeded determinate Red
Hawk from Andean gene pool. Red Hawk was screened with the OAM10.490 RAPD
marker tightly linked to the Z locus (Brady et al., 1998) and crossed with seed coat
pattern testers which reveal segregation for the recessive 2 allele (Emmalea Ernest,
personal communication). It is believed that Red Hawk carries a recessive allele
conferring determinancy at the unnamed locus linked to 2, since crosses between Red
Hawk and the partially-colored Yellow Eye revealed tight linkage between

indeterminancy and the Yellow Eye seed coat pattern (Ernest and Kelly, 2004).

The AJ4.350 RAPD marker was found to be linked to a QTL associated with
growth habit that accounted for up to 52% (P<0.0001) of phenotypic variability in the
current study (see Chapter IV of current manuscript). Interestingly the QTL was located
on linkage group B2 of the integrated bean map. Results from crosses between Red
Hawk and Yellow Eye suggested the possibility that the AJ4.350 marker may not reside
on 182 since Red Hawk carries the recessive 2 allele indicating that Red Hawk could also
carry the unnamed growth habit locus tightly linked to Z locus on B3. It is possible that
the DNA fragment amplified in the BAT93 x J alo EEP558 (BJ) mapping population was
not the same fragment tightly linked to a QTL associated with growth habit originally

shown to be present in the kidney IBL population.

218

The use of RAPD markers in mapping is restricted because they are very sensitive
to variations in reaction conditions making them non reproducible across laboratories. A
precise match between the RAPD and the template DNA depends on the choice of the
heat-stable DNA polymerase and thermal cycler, the concentration of magnesium, and
the annealing temperature (Gu et al., 1995; Melotto et al., 1996). To confirm the
mapping position of the AJ 4.350 on B2 the RAPD marker was converted into a sequence
characterized amplified region (SCAR) DNA marker to determine its true location in
comparison with determinate grth habit genes that have been previously mapped.
SCAR markers are relatively easy to score (appear as a single easy to score band) and are
designed for specific PCR amplifications of polymorphic fragments. These markers are
longer than RAPD markers (over 20 nucleotides) and require a highly stringent annealing
temperature that prevents mismatching in an the priming site during DNA amplification
(Paran and Michelmore, 1993).

The objectives of this study were i) to clone and sequence the DNA fragment
amplified by RAPD marker AJ4.350, ii) to develop a SCAR marker with more specificity
than the RAPD AJ4.350 and iii) to map the SCAR marker in the kidney IBL and the BJ

RIL populations.

Materials and Methods
RAPD analysis

A QTL associated with determinate growth habit was identified by the combined
mapping strategy composed of BSA technique (Michelmore et al., 1991) and selective

genotyping (Lander and Botstein, 1989) in inbred backcross line (BC2F425) kidney

219

 

population. Development of this population and its evaluation for resistance to root rot
and growth habit have been described previously in Chapter IV of the current manuscript
and complete data collected for the kidney IBL population can be found in Appendix B3

and B4.

Cloning and Sequencing of the RAPD fragment
The AJ4.350 RAPD amplification product (Figure D1) linked to the QTL

kTM Gel Extraction Kit

associated with growth habit was purified by using the QIAquic
for cutting and purifying the DNA fragment (Quigen, Chatsworth, Calif), cloned by
means of the TOPO TA Cloning® Kit (Invitrogen Carlsbad, CA) and the Wizard® Plus
SV Minipreps DNA Purification System from Promega for plasmid extraction. Cloned
amplification products were sequenced by the Michigan State University sequencing
facilities following the procedure described by Melotto et al., (1996). The plasmid vector

used was pCR®4-TOPO® which was transformed into the competent E. coli cells. Double

stranded DNA sequencing was carried out using M13 fluorescently labeled primer.

SCAR analysis

SCAR marker for the AJ 4.350 RAPD marker were generated and tested initially
in the parents of the kidney IBL population (Red Hawk and Negro San Luis) and BAT93
and JaloEEP558 RIL population. Amplification of the DNA fragment by the SCAR
primer was carried out utilizing the PCR procedures on Table D1. Various Mg++
magnesium concentrations and annealing temperatures were tested. The presence or

absence of DNA amplification in the parental genotypes and in selected samples from the

220

 

IBL population was confirmed for the AJ4.350 RAPD and its derived SCAR marker

SAJ4 using T aq DNA polymerase (InvitrogenTM Life Technologies, MD).

Table D1. Illustration of the PCR amplification conditions for the DNA fragment of the
SCAR marker developed.
Amplification Standard and initial"
conditions PCR conditions
Mng 4 mM, dNTPs mix 02 The following concentrations were
mM each, 30ng ofprimer mix, tested 4.8mM, 4.0mM, 3.75mM,
30ng of template DNA, 1.25 3.5mM, 2531M, 2.0mM and
Reaction units of T aq DNA polymerase, 1.5mM; the difference in Mg” was
and PCR buffer minus Mg 1x; added to the final water volume
total of 30111 which were
completed with water

 

Modified PCR conditionsI

 

(34 cycles) 303 at 59°C
(34 cycles) 30s at 64°C
Traditional 34 cycles 2 min at 94°C/ 303 at (34 cycles) 303 at 65°C
3-step PCR 94°C/ 303 at 65°C/ 308 at 72°C, (34 cycles) 30s at 66°C
procedure and 4°C soak (34 cycles) 305 at 67°C
(34 cycles) 308 at 69°C
(40 cycles) 305 at 66°C

(11 cycles) 303 at 64°C; (l7cycles)

11 cycles 2 mm at 94 C/ 305 at 308 at 52°C

94°C / 305 at 64°C (l°/ cycle)/
305 at 72°C/ then 17 cycles 308
at 94°C/ 305 at 52°C/ 308 at
72°C and 4°C soak

Touch down§
PCR procedure (12 cycles) 30s at 67°C; (22

cycles) 305 at 54°C

 

1' Underlined sections correspond to the portion of the reaction that was changed.

I Modified PCR reactions and annealing temperatures and cycles

§ Touchdown PCR involves decreasing the annealing temperature by 1°C/ cycle to a 'touchdown' annealing
temperature which is then used for 10 or so cycles

Results and Discussion
The specific SCAR primers were synthesized based on the DNA fragment
sequence amplified by the RAPD marker and contained the original 10 bp of the RAPD

marker plus an additional internal 14 bp (Table D2).

221

The SCAR marker SAJ4 amplified DNA fragment of the expected size (350 bp)
and appeared as a single monomorphic band in agarose gel (Figure D2). It is considered
monomorphic due to the presence of the expected fragment size in both the determinate
(Red Hawk) and the indeterminate (Negro San Luis) genotypes. Due to the
monomorphic amplification several different approaches were taken to produce the
desired polymorphism. Modified PCR conditions, including various Mg” concentrations
and annealing temperatures (Table D1), did not produce polymorphic SCAR products
between the respective genotypes. An additional SCAR primer was developed but no
primer produced a clear polymorphic fragment with the expected size as the one shown in
Table D2. The SCAR primer on the table below gave the best amplification with the

correct fragment size 350 bp of the original RAPD marker.

Table D2. SCAR marker developed from the AJ 4 RAPD marker.

 

 

SCAR . t
Marker Primer Sequence
SAJ4 SAJ4.3FP 5’-CAC CAT TCC AAC CAC TTA CGC TGG -3’

 

SAJ4.3RP 5’- GAA TGC GAC CGA AGA TAT TTA TC -3’

 

 

T Underlined sequence correspond to the original RAPD marker sequence.

RAPD polymorphisms presumably result from differences in nucleotide sequence
at priming sites. In converting RAPD to SCARs markers, Paran and Michelmore (1993)
found that six of nine RAPD polymorphisms were derived from mismatches in one or a
few nucleotides in the priming sites. These nucleotides mismatches in the priming site

were tolerated by extended SCAR primers producing undifferentiated amplification

222

 

Figure D1. Illustration of: (A). RAPD fi'agment amplification for the AJ4.350 that was
used for cloning, (numbers on columns indicate: l= DNA 100bp ladder, 2 and 3 are lines
from the kidney inbred backcross line population, 4=Red Hawk, 5=Negro San Luis,
6=JaloEEP558; and 7=BAT93; white arrow shows the DNA fragment that was cloned
from Red Hawk). (B). The amplified fragment using the specific SCAR primer
developed from the AJ4.350 RAPD, (numbers on columns indicate: 1= DNA 100bp
ladder; 2, 3, 4, and 5 correspond to Red Hawk, Negro San Luis, JaloEEP558, and BAT93
respectively).

223

products from both parents. Likewise, the original SCAR primers for the growth habit
QTL amplified a single monomorphic PCR product. When optimizing PCR parameters,
modification of annealing temperatures and Mg"+ concentrations are generally considered
to be most effective (Horejsi et al., 1999; Paran and Michelmore, 1993; Zhang and
Stommel, 2001). Increased annealing temperature most of the times can eliminate
amplification of the allele from one of the parents by taking advantage of differing
amounts of mismatches within a primer sequence.

In the present study, a number of PCR conditions including various annealing
temperatures and Mg” concentrations were tested but failed to differentiate parental
genotypes with these primers tested (Table D1). SCAR primers can also be redesigned
to generate polymorphism but in this case they also failed to produce polymorphic
fragments in the present study.

SCARs have several advantages over RAPD markers in marker-assisted selection
(MAS). Because more stringent reaction conditions are used, the SCAR markers are
generally more allele specific. The SCAR amplifications are more stable and reliable, and
more easily reproduced in different laboratories with various thermal cyclers. It was
unfortunate that the desired polymorphic fragment was not amplified with the SCAR
primer since the information provided could have helped in confirming the precise
location of the growth habit QTL which unexpectedly mapped to B2 instead of B1 or B3
where the Andean determinancy grth habit genes (fin and un named determinancy
gene tightly linked to the Z locus) were previously mapped (Freyre et al., 1998; McClean

et al., 2002).

224

 

References

Bassett, M. J. 1997. Tight linkage between the Fin locus for plant habit and the Z locus
for partly colored seedcoat patterns in common bean. J. Amer. Soc. Hort. Sci.
122:656-658.

Brady, L., M. J. Bassett, and P. E. McClean. 1998. Molecular markers associated with T
and Z, two genes controlling partly colored seed coat pattern in common bean.
Crop Sci. 38:1073-1075.

Ernest, E. G. and J. D. Kelly. 2004. A Spontaneous Mutation at a Seedcoat Pattern
Locus in the Dark Red Kidney Bean 'Red Hawk,’ which Changes Seed from Self-
colored to the Partially Colored Virgarcus Pattern. HortScience (submitted).

Freyre, R., P. W. Scroch, V. Geggroy, A. F. Adam-Blondon, A. Shirmohamadali, W. C.
Johnson, V. Llaca, R. O. Nodari, P. A. Pereira, S. M. Tsai, J. Tohme, M. Dron, J.
Nienhuis, C. E. Vallejos, and P. Gepts. 1998. Towards an integrated linkage map
of common bean. 4. Development of a core linkage map and alignment of RFLP
maps. Theor. Appl. Genet. 97:847-856.

Gu, K. W., N. F. Weeden, J. Yu, and D. H. Wallace. 1995. Large scale, cost-effective
screening of PCR products in marker-assisted selection applications. Theor.
Appl. Genet. 91:465-470.

Horejsi, T., J .M. Box, and J .E. Staub. 1999. Efficiency of randomly amplified
polymorphic DNA to sequence characterized amplified region marker conversion
and their comparative polymerase chain reaction sensitivity in cucumber. J. Am.

Soc. Hort. Sci. 124:128—135.

Koinange, E. M. K., S. P. Singh, and P. Gepts. 1996. Genetic control of the
domestication syndrome in common bean. Crop Sci. 36:1037-1045.

Lamprecht, H. 1935. Zur genetik von Phaseolus vulgaris. X. Uber infloreszenztype and
ihre vererbung. Hereditas 20:71-93.

Lander, E. S. and D. Botstein. 1989. Mapping Mendelian factors underlying quantitative
traits using RFLP linkage maps. Genetics 121:185-199.

McClean, P. E., R. K. Lee, C. Otto, P. Gepts, and M. J. Bassett. 2002. Molecular and

phenotypic mapping of genes controlling seed coat pattern and color in common
bean (Phaseolus vulgaris L.). J. Hered. 93:148-152.

225

 

Michelmore, R. W., I. Paran, and R. V. Kesseli. 1991. Identification of markers linked
to disease resistance genes by bulked segregant analysis: A rapid method to

detect markers in specific genomic regions using segregating populations. Proc.
Natl. Acad. Sci. USA 88: 9828-9832.

Melotto, M., L. Afanador, and J. D. Kelly. 1996. Development of a SCAR marker
linked to the I gene in common bean. Genome 39: 1216-1219.

Paran, I., and R.W. Michelmore. 1993. Development of reliable PCR-based markers
linked to downy mildew resistance genes in lettuce. Theor. Appl. Genet. 85:985—
993.

Zhang, Y. and J. R. Stommel. 2001. Development of SCAR and CAPS Markers Linked
to the Beta Gene in Tomato. Crop Sci. 41 :1602-1608.

226

 

APPENDIX E
MARKER ASSISTED BACKCROSS AS A STRATEGY FOR THE

SIMULTANEOUS INTROGRESSION OF I AND C0-42 RESISTANCE
GENES INTO “TEBO”

Introduction

‘Tebo’ is a specialty bean (Phaseolus vulgaris L.) class from Japan with small to
medium white seed (30 g/ lOOSeed) and a determinate (Type 1) growth habit. This bean
class is highly susceptible to bean common mosaic virus (BCMV) and anthracnose
(caused by the fungus Colletotrichum lindemuthianum). In 2001 all production fields of
‘Tebo’ in Michigan were infected with BCMV. The virus observed in ‘Tebo’ seed
imported from the state of Washington appears to be a new strain, NL—4 type of BCMV.
The virus problem could threaten bean production in Michigan and developing virus
resistant cultivars of Tebo would provide a solution.

Anthracnose and BCMV are two of the most widespread and economically
important diseases of common bean. Anthracnose is a seed-transmitted pathogen that
exhibits extensive physiological variability, which causes genetic resistance to be less
durable (Balardin and Kelly, 1998). Although once a severe problem for Michigan bean
growers, development of resistance, improved seed production, and certification
programs has reduced the threat of anthracnose. However, the disease still exists and is
present in susceptible varieties every year and occasionally causes severe losses.
Resistance provided by I gene is being used frequently in the development of new bean
varieties because it provides resistance to all strains of BCMV. The systemic necrosis

symptom (black root reaction) caused by BCMNV and top necrosis caused by BCMV

227

 

occurs in bean varieties with the I gene. One of the main efforts of the dry bean breeding
program is the immediate incorporation of the I gene into all susceptible varieties. The
second step would be protection of the I gene resistance to BCMNV and pyramiding of
the I gene and recessive resistance genes to provide durable resistance in ‘Tebo’. Seeds
infected with anthracnose and BCMV, when planted, serve as the source of infection for
succeeding crops. Even a low percentage of infected seed can result in the introduction
and buildup of new strains of anthracnose and BCMV in Michigan. Genetic resistance is
the only economically and effective strategy to control these two seed borne diseases.
The development of molecular markers linked to major disease resistance genes
provide an opportunity to indirectly select for resistance. SCAR-markers tightly linked to
the I gene and Co-42 gene have been developed (Melotto et al., 1996; Young etal., 1998)
and shown to be effective across a wide range of gerrnplasm in both gene pools (Middle
American and Andean). These markers are increasingly valuable for indirect selection of
resistance genes when introgressing these two major genes into susceptible genotypes.
Introgression is the process of incorporating a small amount of genetic material from one
species to another or among same species. This can be accomplished by repeated
backcrossing of the interspecific F 1 to one of the parents, in this case ‘Tebo’. The
backcrossing is followed by marker assisted selection (MAS) which will advance the
selection process for the genes of interest during early generations of the breeding
process (Knapp, 1998; Kelly and Miklas, 1998). The Co-42 gene exhibit the broadest
resistance to anthracnose in common bean, whereas the I gene has been employed to

provide effective resistance to all strains of BCMV.

228

For the development of the population, parents that possessed the C0-42 and I
genes were used. The major objective was to introduce by MAS-backcrossing the I gene
into ‘Tebo’ but since there is a possibility to transfer resistance to anthracnose (at the
same time) an attempt was made to transfer both genes simultaneously using MAS. We
hypothesized that with effective genetic sources of resistance for these two diseases, the
marker-assisted backcrossing technique would enable us to transfer resistance to ‘Tebo’

in a relatively short time frame.

Materials and Methods
Genetic Material

The genetic material was developed following a breeding plan similar to the
Breeding Plan B presented by Frisch and Melchinger (2001), with some modifications
(Figure E.l). Initial crosses were made between ‘Matterhorn’ and SEL 1308 and G99750
to merge the two target genes into one individual. SEL 1308 obtained from the
International Center for Tropical Agriculture (CIAT) carries the Co-4‘2 gene and was used
as the source of resistance to anthracnose (Melotto and Kelly, 2001). ‘Matterhorn’ and
the Great Northern breeding line, G99750 possess the I gene and bc-3 gene for BCMV
resistance. Three BC1F1 lines from a backcross to ‘Matterhorn’ were selected and
crossed to ‘Tebo’ during fall, 2001. The first backcross to ‘Tebo’ was made during
winter of 2001 and the second backcross was made during spring of 2002

(Tebo//G99750/A810, Tebo/Matterhom*2/ A81 5, Tebo//Matterhom*2/ A814 where:

229

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

C D“ x DB

C D ): DA

C [in x R

B H1) x R

B ERIE] x R

B {HI} x R

S Bar-"3:45 u “(Racine
Symbol description:

DA and DB are ‘Matterhorn’ and SEL 1308 respectively with the target genes

D = donor lines with the target genes (A814, A815, A818)

R = recipient line or genotype (‘Tebo’)

1: no selection

11 = marker-assisted selection only for the presence of the target genes

x = crossing

e = selfmg

C,B,S inside boxes: generations with crossing, backcrossing, and selfmg, respectively

Figure E1. Breeding Plan for the marker-assisted backcrossing of C0-42 and I genes into
‘Tebo’.

230

A810=Red Hawk/ SEL 1308, A814: Matterhorn/ SEL 1308, and A815: Matterhorn/
SEL 1308). There was a possibility of transferring bc-3 gene to ‘Tebo’ since the gene
was present in the G99750 parent. Kelly (1997) explained that plants carrying the I and
bc-3 suggested gene combination, when inoculated with NL-3 strain of BCMNV shows
no reaction or symptoms and no virus can be recovered from these plants after back
inoculation. The bc—3 gene is very effective in preventing the virus replication in the
plant tissue so the I gene is not induced to cause a hypersensitive resistance reaction.
Since there is no effective marker for bc—3 gene we proceeded to inoculate with the NL-3
strain those plants that resulted from the Tebo//G99750/A810 initial crosses. Seeds free
of anthracnose and BCMV will prevent the spread of both diseases; reduce yield loss and

maturity delay due to BCMV, and loss of seed quality due to anthracnose.

Marker assisted selection (MAS) using SCAR markers

SCAR markers (DNA molecular markers) tightly linked to the I gene and Co-42
gene have been identified and were used after each backcross to indirectly select for
resistance to BCMV and anthracnose (Melotto et al., 1996; Young et al., 1998). SCAR-
marker assisted selection was employed starting in BC] to Tebo and subsequent
backcrosses for selection only for the target genes (1 gene and C0-42 gene). DNA
extraction was performed following the mini-prep procedure proposed by Afanador et al.,
(1993). SAS13 and SW13 SCAR markers linked to C0-42 and I gene, respectively, were
used to screen the segregating populations assumed to carry the target genes. The PCR
profiles were as follows (Young et al., 1998; Melotto et al., 1996): (1). SW13 (expected

size 690-bp) - 34 cycles of 105 at 94°C/ 405 at 67°C and 2 min at 72°C/ followed by one

231

cycle of 5 min at 72°C; (2). SASl3 (expected size 950-bp) - 34 cycles of 105 at 94°C/ 2.4
min at 72°C/ followed by one cycle of 5 min at 72°C

The presence or absence of DNA amplification in SEL1308, Black Magic,
RWKlO, and the individuals of the population were confirmed using T aq DNA
polymerase (Invitrogen ®, Life Technologies). Those lines that showed the amplification
of the single band of the predicted size (Young et al., 1998; Melotto et al., 1996; Melotto

and Kelly, 2001) for both SCAR markers were used for further backcrossing to Tebo.

Results and Discussion
Transfer of resistance genes by screening during each successive backcross

Screening of the Tebo//G99750/A810 crosses for the presence of the bc-3 gene by
inoculating with NL-3 strain resulted in plants being affected by mosaic. These plants
were all eliminated and only the Tebo //Matterhorn*2/ A815 and Tebo //Matterhom*2/
A814 crosses were used in this study. When screening the BC1F1 individuals only one
plant out of 70 BCIF. individuals showed a clear distinct band for both the SASl3 and
SW13 markers. This single plant (Tebo //Matterhom*2/ A814-4) was used as male
parent for producing the BCzFl individuals. Backcrossing selection was performed only
for the presence of the target genes. The SW13 and SASl3 marker amplified DNA
fragments of the expected size and appeared as a single polymorphic band in agarose gel
electrophoresis (Melotto et al., 1996; Young et al., 1998).

When screening the resulting 75 BC2F1 individuals, from 25 different crosses, 14
plants showed a clear band of the expected size similar to the positive control, RWKl 0

for the SW13 marker and 18 plants showed a clear band of the expected size similar to

232

the positive control SEL1308 for SASl3 marker. Twelve plants that showed a clear band
for the I gene and a weak band for the C0-42 gene originated from nine different crosses.
The marker band for the Co-42 gene was lost after producing the BC; generation. All
BC2F1 individuals that exhibited the SW13 marker band were considered as donor
parents of the I gene and used to produce the BC3F1 individuals.

After the third backcross several selfing generations (advanced to the BC3F2;3)
were performed during fall, winter, and spring, under greenhouse conditions, in order to
create homozygous lines with the target genes. A fourth backcross was made using three
random individuals from the BC3 population. Both populations were taken to the field
during the summer of 2003 to advance to BC3 F14 and BC4F3 generations. It is important
that both target genes are recovered in each cross and backcross generation, and that a
homozygous individual with both target genes (1 gene and C0-42 gene) is present in the
progeny of the selfing generation.

MAS was used to rapidly advance the selection process of backcross work during
early generations of the backcross breeding. Marker-assisted backcrossing for disease
resistance will most likely have little or no effect in reducing the need for replicated field
trials and testing (Y 11 et al., 2000). This means that plant breeding expertise and decision
making ability will remain important for future genetic improvement. For this reason
final testing of breeding lines for disease resistance, by greenhouse screening and field
evaluation, is always required regardless of how tightly a marker might be linked to a
gene. For example, in the current work SASl3 is tightly linked to C0-42 but the fragment
amplified by this SCAR marker was lost. This doesn’t necessarily mean that the

resistance gene is not there but will need to be verified through direct inoculation.

233

Alternatively, the absence of SASl3 fragment during the development of the population
could have resulted from the loss of the marker due to a recombination (cross-over)
between the marker and the gene. Loss of the marker due to recombination could be
possible since the SASl3 marker was found to be 3.5 cM from the Co-42 gene (Young et

al., 1998), although 4.5cM is considered a very tight linkage for MAS.

Greenhouse population screening with BCM V

Direct greenhouse screening of 385 BC3 F34 and 46 BC4F 3 individuals for BCMN
was performed using the NL-3 strain of BCMV. The susceptible class comprises plants
with mosaic indicating the absence of resistance genes while those plants that exhibit top
necrosis suggested the presence of the single I gene. In the BC3 (Tebo/3/Matterhorn *2/
A814) and BC; (Tebo/4/Matterhorn *2/ A814) populations, the cross was successful in
producing plants that showed top necrosis indicating that the I gene was inherited and
was present in successive generations. After the greenhouse screening, the resistant
plants were sent to the Puerto Rico winter nursery for seed increase and generation
advance. Resistant lines carrying the I gene will be inoculated with Race 7 of C.
lindemuthianum cultures, since ‘Tebo’ was susceptible to this race and there is still a
chance of identifying progeny carrying the C0-42 gene for anthracnose resistance. These
resistant ‘Tebo’ plants will be included in preliminary yield trials during the summer of
2004. The final step will be to combine I gene with other strain specific recessive
resistance genes to give complete resistance against BCMV and provide more durable
virus resistance in ‘Tebo’. If resistant individuals in the population are not identified

after screening with Race 7 for anthracnose resistance the Co-42 gene will have to be re-

234

 

 

introduced into new virus resistant ‘Tebo’ cultivars with the I gene using other markers

linked to the Co-42 gene such as SH18 and SBB14 (Awale and Kelly, 2001).

235

 

References

Afanador, L. K., S. D. Haley, and J. D. Kelly. 1993. Adoption of a “mini-prep” DNA
extraction method for RAPD marker analysis in common bean. (Phaseolus
vulgaris L.). Ann. Rep. Bean Improv. Coop. 36:10-11.

Awale, HE, and J .D. Kelly. 2001. Development of SCAR markers linked to Co-42 gene
in common bean. Annu. Rept. Bean Improv. Coop. 44:119-120.

Balardin, R. S. and J. D. Kelly. 1998. Interaction between Colletotrichum
lindemuthianum races and gene pool diversity in Phaseolus vulgaris. J. Amer.
Soc. Hort. Sci. 23(6):1038-1047.

F risch M. and A. E. Melchinger. 2001. Marker-assisted backcrossing for simultaneous
introgression of two genes. Crop Sci. 41:1716-1725.

Kelly, J. D. 1997. A review of varietal response to bean common potyvirus in Phaseolus
vulgaris. Plant Varieties and Seeds 10:1-6.

Kelly, J. D. and P. N. Miklas. 1998. The role of RAPD markers in breeding for disease
resistance in common bean. Mol. Breed. 4:1-11.

Knapp, S. J. 1998. Marker-assisted selection as a strategy for increasing the probability
of selecting superior genotypes. Crop Sci. 38:1164-1174.

Melotto, M, L. Afanador, and J .D. Kelly. 1996. Development of a SCAR marker linked
to the I gene in common bean. Genome 39:1216-1219.

Melotto, M and J. D. Kelly. 2001. Fine mapping of the Co-4 locus of common bean
reveals a resistance gene candidate, COK-4, that encodes for a protein kinase.
Theor. Appl. Genet. 103:508-517.

Young, R. A., M. Melotto, R. O. Nodari, and J. D. Kelly. 1998. Marker-assisted
dissection of the oligogenic anthracnose resistance in the common bean cultivar,
‘G2333’. Theor. Appl. Genet. 96:87-94.

Yu, K., S. J. Park, and V. Poysa. 2000. Marker-assisted selection of common beans for
resistance to common bacterial blight: efficiency and economics. Plant Breeding
119:411-415.

236