. 3M..V..J.z...fl

s” 1.»:

.6»... .
Wx‘uhxmmf
c . ..

a H ..

a.
5.2%,

.0. .
3t.)

 

. Lu.
0.2 19.

p.

.2. u I» . if? .
t... :........QH..C.§..U.
- .2..... 2. , .

r).
IIII|

A... Eva‘s... .

. :4:
I... n. 1...“... 1 .2 «y...
.. Stout IA» A . k \l

 

 

THESE

\

.. \V

r

/

5%;025;

\

This is to certify that the
dissertation entitled

RETINOPATHY, GLOBE ENLARGED

presented by
Fabiano Montiani-Ferreira

has been accepted towards fulfillment
of the requirements for the

PhD degree in Comparative Medicine &
Integrative Biology

 

 

 

 

7 ' ’ Simon Wsen-Jones
3/ 3/09

Date

MSU is an Affirmative Action/Equal Opportunity Institution

--.—.—.—.-._ ~.-.—-'--

”.r. ""'““V'-T-'—

4. ‘-—

’ a"~—o .— wfi

 

_ LIBRARY l
Michigan State

University

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 c;/CIRC/DateDue.p65-p. 15

RETINOPATHY, GLOBE ENLARGED
By

Fabiano Montiani-Ferreira

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Comparative Medicine Integrative Biology
College of Veterinary Medicine

2004

ABSTRACT

RETINOPATHY, GLOBE ENLARGED
By

Fabiano Montiani—Ferreira

The purpose of this study was to perform a detailed characterization of the
clinical, electroretinographic and morphological aspects and a preliminary molecular
characterization of the autosomal recessive retinopathy, globe enlarged (rge) phenotype
in chickens. Rge affected, carrier and normal birds were examined in detail
ophthalmoscopically. A morphometric assessment of the eye globe and vision testing
with an optokinetic device were performed. Scotopic and photopic electroretinography
(ERG) and visually evoked potentials (VEPs) were recorded. Pharmacological
investigation of abnormal ERG responses of rge birds was carried out. Morphological
features were examined by light and electron microscopy. Retinal cell counting and
measurement of the thickness of retinal layers were performed. Immunohistochemical
staining with a panel of several antibodies was also investigated. Rge chicks lose vision
over the first few weeks of life and are functionally blind by 30 days of age. They
develop thicker corneas with a larger radius of curvature, hyperopia, and enlarged globes
both radially and axially. At 1 day of age they have an elevated photopic and scotopic
ERG response threshold, lower ampli/tude for a-wave and a substantial decrease of both
oscillatory responses (CPS) and c-waves. With bright flash intensities, a supernormal b-
wave response is present during the first weeks of life. All ERG responses decrease with

increasing age. Naka-Rushton analysis of the ERG shows it is clearly abnormal from 1

day of age. After the rge chicks are functionally blind, optokinetic and cortical responses
suggest some degree of vision (judged by the optokinetic performance) remains, although
very reduced. Failure to block the b-wave responses with intravitreal injections of
glutamate analogues (PDA and APB) provides strong evidence that the cells that
normally generate this response in normal chicks do not originate the b-wave of rge
chicks. Intravitreal injections of BaClz enhanced the supemormal b-wave response and
ornithine nearly abolished it. Early morphological changes observed in rge retinas were
disorganization of the outer plexiforrn layer and abnormal location of the smooth
endoplasmic reticulum of the photoreceptors. In rge retinas, photoreceptor pedicles were
abnormally shaped, usually containing multivesicular bodies. Furthermore, synaptic
ribbons were less numerous and large glycogen deposits progressively accumulated in the
perinuclear cytoplasm. Retinal thickness and numbers of rod outer segments (088) and
inner nuclear layer nuclei decreased with age. A decrease in tyrosine hydroxylase-
positive neurites, mislocalization, disorganization and a decrease in number of opsin-
positive rod 088, with activation of glial cells were all present in rge birds. The rge
defect results in a severe visual deficit with a major effect on photoreceptors.
Morphological changes consistent with retinal stretch due to excessive ocular growth and
with progressive photoreceptor degeneration were present. A microsatellite marker
(MCW0318) co-segregated with the rge locus, indicating that human chromosome region
12 p1 1-13 is the most likely region to contain the human homolog of the rge gene. Future
identification of the causal gene mutation should help explain the morphological and
ERG abnormalities of the rge phenotype and account for the rapid development of vision

deficits.

ACKNOWLEDGMENTS

I am deeply grateful for the guidance and friendship that Dr. Simon Petersen-
Jones has given me during this past period of my life. His participation was
indispensable for the progress and completion of this project. I truly value his never-
ending patience, British humor and willingness to help during the countless times I have
knocked at his door, whether it was his office or his home. I also must thank him for his
power of persuasion, making sure that I kept my focus on this project by keeping me
from going astray and thus basically saving me from “myself”. However, I also would
like to express gratitude for the few times that he pretended he did not see me going
astray so I could work in other related endeavors during these four years. That was
perhaps an attempt to save me from “himself”. An old academic saying (possibly a
Brazilian one) goes like this: From the advisor standpoint, the worst types of graduate
students that can exist are: 1) the ones that do not do anfling you say and 2) the ones
that do evefl'ng you say. I am pretty sure I was not the latter type.

Furthermore, I really would like to apologize to my wife, Larissa Reifur, and my
close friends for my chronic grumpiness, which started since I left my teaching position.
Thank you, Larissa, for all the encouragement and the bravery that was to move to
another country with me. Special thanks and acknowledgement go to my family as well.

Several collaborators, students, technicians and friends were crucial for the
completion of this project. To appropriately thank them all it would take up a lot of space.
Some of these exceptional people include: Rafael Cernuda, Andy Fischer, Kathleen

Gustafson, Paul Sieving, Matti Kiupel, Vilma Yuzbasiyan-Gurkan, Andrew Geller, Hans

Cheng, David Sherry, Howard Howland, Tong Li, Wim DeGrip, Michelle Curcio, Mark
Evans (and the great people at Pfizer), Michael Lavagnino and Fernando Cardoso.

Furthermore, I also would like to acknowledge the fantastic people from the
Comparative Ophthalmology lab (past and present) and the staff of both graduate
programs, Comparative Medicine and Integrative Biology (CMIB) and Pathobiology and
Diagnostic Investigation (DPDI). I particularly would like to thank Denise Harrison,
Victoria Hoelzer-Maddox and Sherrie Lenneman.

I cannot forget to express my gratitude to Paul Hocking for “saving” the rge birds
in the UK, to Lisa Allen for being so competent in her job at MSU’s Vivarium, and to
Theodore C. Sieving for helping with the “automation” of the optokinetic device.

At last, I would like to acknowledge all the help, suggestions and encouragement
that I received from my committee members: Mark Evans, John C. Fyfe, Jon Patterson,
Ben Yamini, and Mary Rheuben. A special recognition goes to Jon Patterson for

conducting all the committee meetings.

Obrigado !

TABLE OF CONTENTS

LIST OF TABLES ............................................................................................................ xii
LIST OF FIGURES ......................................................................................................... xiii
CHAPTER 1 - INTRODUCTION ...................................................................................... 1
1.1. Development of the vertebrate retina ....................................................................... 1

1. 2. Structure of the adult chicken (Gallus gallus) eye .................................................. 6
1.2.1. Pecten ................................................................................................................ 7
1.2.2. Retina ................................................................................................................. 8
1.2.2. i. Retinal pigment epithelium (RPE) ............................................................. 11
I.2.2.ii. Photoreceptors .......................................................................................... 12

1.2.2. iii. Outer plexiform layer (OPL) ................................................................... 14

1.2.2. iv. Inner nuclear layer (INL) ......................................................................... 17

1.2.2. iv.a. Horizontal and amacrine cells .......................................................... 17

1.2.2. iv.b. Bipolar cells ...................................................................................... 18

1.2.2. iv. c. Miiller cells ........................................................................................ 18

1.2.2. v. Inner plexiform layer (IPL) ....................................................................... 19

1.2.2. vi. Ganglion cell and nerve fiber layer ( GCL+NFL) .................................... 19

1.3. Central visual pathways ......................................................................................... 20
1.4. The visual transduction pathway ............................................................................ 21
1.5. Electroretinogram (ERG) ....................................................................................... 25
1.6. Inherited retinal dystrophies ................................................................................... 31
1.6.1. Globe enlargement in chicks with retinal disease ........................................... 35

vi

1.7. Position of the field when the work started ........................................................... 35

CHAPTER 2 - CLINICAL FEATURES OF THE RETINOPATHY, GLOBE

ENLARGED (rge) PHENOTYPE ........................................................... 37
2.1. Introduction ............................................................................................................ 37
2.2. Material & Methods .............................................................................................. 37

2.2.1. General examination, observation of behavior, ophthalmic examination and

necropsy and preliminary histological examination .................................................. 38
2.2.2. Vision testing with an optokinetic device ....................................................... 39

2.2.3. Tonometry, central corneal pachymetry and eye dimension measurements 39

2.2.4. Refraction and measurement of corneal curvature .......................................... 40
2.2.5. Statistical Analyses .......................................................................................... 41
2.3. Results .................................................................................................................... 41

2.3.1. Physical examination, post mortem and preliminary histopathologic

examinations .............................................................................................................. 43
2.3.2. Vision testing ................................................................................................... 44
2.3.3. Ophthalmic examination and globe biometry findings ................................... 46
2.4. Discussion .............................................................................................................. 53

CHAPTER 3 - ELECTRORETINOGRAPHIC FEATURES OF THE rge CHICK

PHENOTYPE .......................................................................................... 57

3.1. Introduction ............................................................................................................ 57
3.2. Material & Methods ............................................................................................... 58
3.2.1. Animals ............................................................................................................ 58
3.2.2. ERG recording ................................................................................................. 58

vii

3.2.3. Electrophysiological test protocols .................................................................. 59

3.2.4. Data analysis .................................................................................................... 61
3.3. Results .................................................................................................................... 64
3.3.1. A-wave responses ............................................................................................ 68
3.3.1 .i. A-wave threshold ....................................................................................... 69
3.3.1 .ii. A-wave amplitudes .................................................................................... 69
3.3.1 .iii. Slope of the a-wave leading edge ............................................................ 70
3.3.1 .iv. A-wave implicit times ............................................................................... 71

3.3.1 .v.Subtraction of intensity matched photopic a-wave from scotopic a-wave to

reveal rod-mediated a-wave response ................................................................... 74
3.3.2. B-wave responses ............................................................................................ 75
3.3.2. i. B-wave threshold (Figure 3.4) ................................................................... 76
3.3.2.ii. Naka—Rushton fitting of the first limb of the I:R curves (Figure 3.8) .......... 76

3.3.2.iii. Maximal amplitude of the b-wave - second limb of the intensityzresponse

plot (BM) (Figure 3.9) .............................................................................................. 79
3.3.2. iv. B-wave implicit times ............................................................................... 80
3.3.2.v. Ratio of b-wave to a-wave amplitudes ......................................................... 81
3.3.3. ERG response using color filters ..................................................................... 81
3.3.4. 30Hz flicker ERG comparison (Figure 3.11) .................................................. 84
3.3.5. VEPs (Figure 3.12) ........................................................ ' .................................. 8 4
3.4. Discussion .............................................................................................................. 86

CHAPTER 4 - PHARMACOLOGICAL DISSECTION OF THE rge

viii

ELECTRORETINOGRAM ..................................................................... 92

4.1. Introduction ............................................................................................................ 92
4.2. Materials & Methods .............................................................................................. 95
4.2.1. Animals ............................................................................................................ 95
4.2.2. Pharmacological agents ................................................................................... 95
4.2.3. Intravitreal injection ........................................................................................ 95
4.2.4. ERG recording ................................................................................................. 96
4.2.5. Statistical Analysis .......................................................................................... 97
4.3. Results .................................................................................................................... 98
4.3.1. Results after the intravitreal injection of PDA (Figure 4.1) ............................ 98
4.3.2. Results after the intravitreal injection of APB (Figure 4.2.) ......................... 101
4.3.3. Results after the intravitreal injection of APB+PDA (Figure 4.3) ................ 103
4.3.4. Results after the intravitreal injection of barium (Figure 4.4) ....................... 105
4.3.5. Results after the intravitreal injection of ornithine (Figure 4.5) .................... 108
4.4 Discussion ............................................................................................................. 1 11

CHAPTER 5 - DETAILED HISTOPATHOLOGIC CHARACTERIZATION OF THE

rge CHICK PHENOTYPE ..................................................................... 116

5.1. Introduction .......................................................................................................... 116
5.2. Material & Methods ............................................................................................. 117
5.2.1. Morphometric analysis .................................................................................. 117
5.2.2. Conventional morphologic analysis of semi-thin and ultra-thin sections ..... 120
5.2.3. Immunocytochemistry studies on paraffin—embedded material .................... 121
5.2.4. Immunocytochemistry studies on frozen sections ......................................... 122

5.2.5. Terminal Deoxynucleotidyl Transferase-mediated dUTP Nick End Labeling

(TUNEL) Staining ................................................................................................... 125

5.2.6. Detailed examination of the linear fundus lesions in semi-thin and ultra-thin

sections .................................................................................................................... 125
5.3. Results .................................................................................................................. 126
5.3.1. Morphological measurements of the retina ................................................... 126

5.3.2. Observations on semi-thin and ultra-thin sections, light and electron

microscopy .............................................................................................................. 130
5.3.2. i. Retinal sections at 1 day of age ............................................................... 130
5.3.2. ii. Retinal sections at 7 days of age ............................................................. 132
5.3.2. iii. Retinal sections at 60 to 90 days of age ................................................ 136
5. 3.2. iv. Retinal sections at 270 days of age ........................................................ 136

5.3.3. Immunohistochemistry results (paraffin-embedded and frozen sections) ..... 140

5.3.4. TUNEL Staining ............................................................................................ 149

5.3.5. Detailed examination of the linear fundus lesions in semi-thin and ultra-thin

sections .................................................................................................................... 150

5.4. Discussion ............................................................................................................ 154

CHAPTER 6 - CONTRIBUTIONS TO THE MOLECULAR CHARACTERIZATION

OF THE rge DEFECT ........................................................................... 161
6.1. Introduction .......................................................................................................... 161
6.2. Material & Methods ............................................................................................. 162

6.2.1. Testing the rge chicken for the deletion of the guanylate cyclase gene present

in the rd chicken ...................................................................................................... 162

6.2.2. Mapping of the rge region ............................................................................. 165

6.2.3. Mapping and sequencing of candidate genes ................................................ 168

6.3. Results .................................................................................................................. 173

6.3.1. Testing the rge chicken for the deletion of the guanylate cyclase gene present

in the rd chicken ...................................................................................................... 173

6.3.2. Mapping of the rge region ............................................................................. 174

6. 3. 2. i. Selection of candidate genes .................................................................... 176

6.3.2. i.a. Cyclin-dependent kinase inhibitor (Kipl) ........................................ 176

6.3.2.i.b. Synaptobrevin (Vampl) .................................................................... 177

6.3.3. Mapping and sequencing of candidate genes ................................................ 177

6. 3.3.i. Radiation-hybrid (RH) mapping .............................................................. 177

6. 3.3. ii. Sequencing of candidate genes ............................................................... 178

6.4. Discussion ............................................................................................................ 1 81
CHAPTER 7 - CONCLUSIONS & FUTURE STUDIES .............................................. 183
BIBLIOGRAPHY ........................................................................................................... 188

xi

LIST OF TABLES

Table 2.1 - Summary of the main clinical features observed in chicks presenting the

rge phenotype. ** P<0.05; *** P<0.001; **** P<0.0001. ....................................... 42

xii

LIST OF FIGURES

Images in this dissertation are presented in color

Figure 1.1- Scanning electron micrographs of embryos at different stages of
development ................................................................................................................. 3
Figure 1.2 - Histological and structural characteristics of the chicken eye. ............... 7

Figure 1.3 - Plastic-embedded retinal section of a normal chicken at 270 days of

age .............................................................................................................................. 10
Figure 1.4 - Ultrastructural aspect of the chick OPL ................................................ 16
Figure 1.5 - Diagram of rod phototransduction cascade ........................................... 25

Figure 1.6 - Diagrammatic representation of the Granit waveforms (I, H and H)
which make up the electroretinogram (ERG). ........................................................... 28
Figure 2.1 — Results from vision testing with an optokinetic device ........................ 45
Figure 2.2 - Series of age-matched gross ophthalmic photographs from
representative rge and control birds. ......................................................................... 47
Figure 2.3 - Series of micrographs of the anterior segment of the eye of
representative rge and control birds at different ages ................................................ 48
Figure 2.4 - Gross photograph showing the detail of a hypermature cataract in an rge
chick at 270 days of age. ........................................................................................... 49
Figure 2.5 - Radial globe diameter of rge and control eyes at each time-point
evaluated ..................................................................... 50
Figure 2.6 - Mean axial globe length of rge and control eyes at each time-point

evaluated .................................................................................................................... 50

xiii

Figure 2.7 - Mean central corneal thicknesses (CCT) of rge and control eyes at each
time-point evaluated .................................................................................................. 52
Figure 3.1 - Representative scotopic and photopic ERG recordings from a control
bird at 7 days of age ................................................................................................... 66
Figure 3.2 - Representative scotopic and photopic ERG recordings from a control
bird at 270 days of age ............................................................................................... 67
Figure 3.3 - Representative scotopic isolated oscillatory potentials (OPs) of an ERG
recording from a control bird at 1 day of age ............................................................ 68
Figure 3.4 - Scotopic and photopic threshold using 5 uV-criterion. Mean scotopic
threshold for a—wave and for b-wave for all the age groups studied ......................... 72
Figure 3.5 — Scotopic and photopic intensity: response (I:R) plot at 7 days of age in
dark-adapted rge and control birds. ........................................................................... 73
Figure 3.6 - Mean scotopic Arnax at all the age groups studied. ................................ 74
Figure 3.7 - Intensity matched (2.8 log cdS/mz) a-wave tracings from a control and
an rge chick at 160 days of age ................................................................................. 75
Figure 3.8 - Naka-Rushton fit parameters. Scotopic b-wave intensity:response
function from rge and control chicks at 56 days of age. ........................................... 78
Figure 3.9- Mean scotopic B...m of all the age groups studied. ................................. 80
Figure 3.10 - Mean a-wave amplitudes, photopically matched, using stimuli of 3
different peak spectral transmittances ....................................................................... 83
Figure 3.11 - A comparison of 30 Hz flicker tracings using flash-light intensity of

0.4 log cdS/m2 at 1 day of age. .................................................................................. 85

xiv

Figure 3.12- Comparison of the VEP response at 1 day of age in a rge and a control
chick ........................................................................................................................... 86
Figure 4.1 - Representative ERGs performed before and after the intravitreal
application of PDA .................................................................................................. 100
Figure 4.2 - Representative ERGs performed before and after the intravitreal
application of APB .................................................................................................. 102
Figure 4.3 - Representative ERGs performed before and after the intravitreal
application of PDA + APB ...................................................................................... 104
Figure 4.4 - Representative ERGs performed before and after the intravitreal
application of barium chloride ................................................................................. 107
Figure 4.5 - Representative ERGs performed before and after the intravitreal
application of ornithine ............................................................................................ 110
Figure 5.1 - Graphic representation of the method used for determining the retinal
regions used for retinal thickness measurement ...................................................... 118
Figure 5.2 - Total retinal thickness of rge and control birds at 2, 14, 28, 56, 180,
270 and 420 days of age .......................................................................................... 127
Figure 5.3 - Mean retinal thickness of each of the different retinal layers from rge
and control birds at two representative age groups. ................................................ 128
Figure 5.4 - Number of rod 08s and ganglion cells per unit length and number of
rows in the INL in cross sections in cross sections at 14, 21, 90, 180, 270 and 720
days of age. ............................................................................... . .............................. 129
Figure 5.5 - Semi-thin and ultra-thin retinal sections of a control and of an rge chick

atlandat60daysofage ........................................................................................ 131

 

Figure 5.6 - Ultrastructural features of the ONL/IS interface of an rge chick, at 1 day
of age ....................................................................................................................... 132
Figure 5.7 - Semi-thin and ultra-thin sections of rge and control retina at 7 days of
age ............................................................................................................................ 134
Figure 5.8 - Synaptic terminal of a cone pedicle of a control chick at 7 days of age
and a typical example of a synaptic terminal of a cone pedicle of an rge chick at 7
days of age. .............................................................................................................. 135
Figure 5.9 - Ultra-thin sections of retinal samples from rge birds at 60 days of age
................................................................................................................................. 138
Figure 5.10 - Semi-thin sections of retinal samples from rge and control birds at 270
days of age ............................................................................................................... 139
Figure 5.12 - Fluorescence photomicrographs and conventional photomicrograph
using brown chromogen from irnmunocytochemistry sections using anti-opsin
antibodies. ................................................................................................................ 142
Figure 5.13 - Immunocytochemical stained retinal sections using RCA-l antibody of
control and rge chicks at 13, 33, and 92 days of age .............................................. 145
Figure 5.14 - Immunocytochemistry of retinal sections using LEP-IOO antibody. 146
Figure 5.15 - Immunocytochemistry of retinal sections using anti-glycine antibody
................................................................................................................................. 147
Figure 5.16 - Immunocytochemistry of retinal sections using anti-GFAP antibody.
................................................................................................................................. 148
Figure 5.17 - Photograph of the posterior eyecup from a 49-day-old rge bird

showing lacquer cracks ............................................................................................ 152

Figure 5.18 — Plastic and resin-embedded retinal sections from rge birds
demonstrating morphologic details of the lacquer crack lesions typical of early stage
changes observed in the rge phenotype. .................................................................. 153
Figure 5.19 — Ultra-thin section from the eye of an rge bird at 336 days of age... 154
Figure 6.1 - Result of RT-PCR from retinal tissue from a normal, a carrier and an
rge bird on 1.5% agarose electrophoresis gel. ......................................................... 174
Figure 6.2 - Genetic map for the rge region. .......................................................... 175
Figure 6.3 - Interspecies comparative genetic map (chicken, human and mouse) for
the rge region. .......................................................................................................... 176
Figure 6.4 - RH correlation for several microsatellite markers linked to the rge
region ....................................................................................................................... 178

Figure 6.5 - Chicken Vampl nucleotide sequence ................................................. 180

xvii

6:!

be
A

CHAPTER 1

INTRODUCTION

1.1. Development of the vertebrate retina

The vertebrate eye (bulbus oculi) develops from several embryonic tissues
including neural crest cells (ocular mesenchyme), neuroectoderm (retina and
neuroepithelium of the iris and ciliary body), surface ectoderm (epithelial structures and
the lens), and mesoderm (extraocular muscles and vascular endothelium).

In the embryo, with the formation of the primitive streak, the classic ectoderm,
mesoderm and endoderrn subdivisions appear. In response to the formation of the
notochord, ectoderm thickens (neural plate), and forms elevations called the neural folds
(Barishak, 2001, Cook, 1995, Cook, 1999).

A specialized population of mesenchymal cells, the neural crest, emigrates from
the neural ectoderm at its junction with surface ectoderm. Neural crest cells spread
beneath the surface ectoderm and populate several regions of the embryo including the
region around the optic vesicle, ultimately giving rise to nearly all of the ocular
connective tissue structures including internal structures of the palpebra. In the eye,
mesenchyme originating from the regular mesoderm (middle embryonic layer) only gives
rise to the striated myocites (muscle cells) of the extraocular muscles and the vascular
endothelium (Barishak, 2001, Cook, 1995, Cook, 1999).

To generate the neural tube, the neural folds elevate and approach each other until
they actually touch and fuse. Once the tube is closed, the exterior of the embryo is

completely covered by surface ectoderm. The tube is lined by neural ectoderm. Neural

segmentation then occurs to form the prosencephalon (forebrain), mesencephalon
(midbrain) and rhombencephalon (hindbrain) (Barishak, 2001, Cook, 1999).

Paired evaginations of neurectoderm from the developing diencephalic portion of
the prosencephalon (Figure 1.1A) develop to form the optic vesicles, which are connected
to the forebrain by optic stalks (Barishak, 2001). The formation of the optic vesicles
occurs between chick embryonic days 1.5 and 3 (E1.5/E3) (Pittack, Grunwald & Reh,
1997). Anteriorly, the optic vesicle induces the overlying surface ectoderm to thicken,
forming the lens placode (Figure 1.1 B). The optic vesicle then induces the lens placode
to invaginate (Figure 1.1 C). Once the lens placode invagination is induced by the optic
vesicle, the lens placode in turn induces the optic vesicle to invaginate, concurrently, to
form the optic cup (this process is called reciprocal induction). As the optic cup is being
formed the invaginating lens placode then detaches from the surface to form the lens
vesicle (E3) . The lens vesicles are lined by a monolayer of epithelium and are
completely surrounded by a basal lamina, which will become the lens capsule in the adult
bird. The ocular mesenchyme invades the anterior portion of the globe (anterior segment)
between the lens and the corneal epithelium. Portions of the cornea (stroma and
endothelium), iridal stroma and structures of the iridocomeal angle are all formed from
these invading cells of the ocular mesenchyma (formerly neural crest cells). A portion of
this ocular mesenchyme forms a vascular bridge across the future pupil (pupillary
membrane) . The formation of all the neural crest-derived structures, in the anterior

segment of the chick eye, is regulated by signals from the lens .

 

 

 

 

 

Figure 1.1- Scanning electron micrographs of embryos at different stages of development.

A) Paired evaginations of neurectoderm (selected area) from the developing diencephalic

portion of the prosencephalon, forming the optic vesicles - mouse embryo at 8.5 days of

gestation. B) Optic vesicle induces the overlying surface ectoderm to thicken, forming the

lens placode (arrow) - mouse embryo at 29 days of gestation. The invaginating lens placode

also induces the invagination of the optic vesicle (reciprocal induction) to form the optic

cup. C) Note that the formation of the lens vesicle (arrow) and optic cup (arrowhead) are

nearly completed - mouse embryo at 36 days of gestation. Source: University of North

Carolina - Chapel Hill Medical School, available at
http://www.med.unc.edu/embryo_images

The optic cup then collapses to close a potential space (subretinal space) between

the two layers of neural epithelium that are destined to form the neural retina and the

retinal pigment epithelium (RPE) . The neuroepithelial cells at the rostral margin of the

optic cup form two layers of iridal epithelium (inner and outer), which are continuous

with two layers of ciliary epithelium. The outer iridal epithelium gives rise to

musculature of the iris. The outer ciliary epithelium is continuous with the RPE, and the

inner ciliary epithelium is continuous with the neurosensory retina at the ora serrata . At

E 6.5, pigment granules can be seen in the inner epithelium at the root of the iris. As

development proceeds, the pigmentation of both epithelial layers progresses from the root

of the iris to the pupillary margin. Early features of the development of the sphincter

muscle can first be recognized by E7. Both smooth muscle and striated muscle are

present in the iris of the chick embryo. The smooth musculature originates by E10 from a
laminar invagination (iridial lamella) of the outer iridal epithelium. The striated
musculature appears slightly later than the smooth musculature and originates from
undifferentiated cells, which are regarded as mesenchymal .

As the retina develops, the outer-pigmented layer becomes relatively thinner
while the neural portion thickens . As with the ciliary epithelium, invagination of the
optic vesicle causes the apices of the inner nonpigmented layer to be directed outward, to
face the apices of the outer pigmented layer. The retina basically is a peripherally
developed portion of the central nervous system . The outer-pigmented layer develops
into the RPE and Bruch’s membrane. In the inner nonpigmented layer, the neuroblastic
cellular differentiation proceeds in an inner-to-outer, central-to-peripheral fashion . The
innermost neuroblastic layer develops into ganglion cells, Miiller cells, horizontal cells
and amacrine cells; while the outermost layer forms the bipolar cells and photoreceptors .
As in mammals, avian retinal ganglion cells are the first cells to differentiate. In chicks,
during E4 ganglion cell genesis is near its peak . The ganglion cell fibers leave the
eyeball and, grow along the optic stalk, reaching the chiasm around E4 arriving at the
optic tectum at E6 . In E7 embryos, the eyes are approximately 0.5 cm in diameter . At
this time a developing pecten structure becomes evident . Branching patterns of the
ganglion cell dendrites become relatively uniform on E8 . The inner and outer plexiform
layers appear during E8 to E15 . Non-specific phagocytic activity is observable in the
RPE as early as E9 and continues through the rest of the developmental period and
throughout adult life . Miiller cells finish developing at about E11 . The bipolar cells and

photoreceptors are the last retinal cells to mature. The rods and cones start to differentiate

during E12 . The long-wavelength cone opsins, red and green, are first detected in chicks
at embryonic day E14. The first rhodopsin transcripts are seen at E15 in the inferior
retina. In contrast, the short-wavelength cone opsins, blue and violet, were not detected
until E16 . By E16 pecten development is completed . The embryonic electroretinogram
(ERG) starts to be recordable by E18 , reflecting retinal function. By hatch (E21) the

chick eyes have increased to 1 cm in diameter .

1. 2. Structure of the adult chicken (Gallus gallus) eye

The avian eye follows the basic structure of the mammalian eye, consisting of three
concentric tunics and the lens. The outermost tunic is divided into cornea and sclera, the
middle one is the uveal tract and the innermost is the retina. The avian cornea has a
microscopically evident Bowman’s layer, which is also present in primates. Another
anatomic feature of the avian eye globe is the presence of two specialized structures
within the sclera: a bony ring and a cartilage cup. The bony ring is comprised of a
variable number of thin scleral ossicles that can vary from 10 to 18 in number. The
majority of birds have 15 scleral ossicles. The ossicle ring determines the shape of the
anterior segment of the globe and the scleral cartilage cup maintains the structure of the
posterior segment of the globe . The avian eye is large relative to the size of the head and
brain. For example, human eyes make up about 1% of the total mass of the head; in birds

the eyes make up about 15% of the mass of the head .

 

   

    
   
   
   
    

sclera
I

r

anterior uvea

- lens

. retina
retina

k pecten

 

 

 

Figure 1.2 - Histological and structural characteristics of the chicken eye. A) Paraffin-
embedded cross retinal section of a chicken eye at 7 days of age, the names of the main
structures are indicated in the figure. Note the comb-like appearance of the pecten, located
anteriorly, on top of the optic nerve head. Stain = hematoxylin/eosin. Bar - 2.5 mm. B) Gross
photograph of the posterior eyecup of a 60-day-old chicken eye after removal of the anterior
segment, lens and vitreous. The retina is the transparent layer covering the eyecup. Note that
the pecten projects into the inferior portion of the posterior chamber. The dorsal part of the
pecten is always tilted to the temporal aspect of the eye. Thus, B shows a retinal cup from a
right eye. Bar - 5 mm.

1.2.1. Pecten

The pecten (pecten oculi) is a unique structure present within the posterior
segment of the avian eye. It is a highly vascular and pigmented comb-like structure that
overlies the optic disc and projects into the vitreous humor (Figure 1.2 A & B). Light and
electron microscope studies have shown that the pecten is a manifoldly pleated structure
that consists almost exclusively of blood vessels, extravascular pigmented cells and a
superficial covering membrane; it lacks both muscular and nervous tissues . Its

physiological function(s) have been debated for a long time. Possible functions cited by

different authors include increasing the sensory detection of small moving objects ,
intraocular pressure regulation , reduction of intraocular reflection , intraocular pH
regulation , magnetic sensor , blood—retinal barrier and as a source of supplemental
nutrition to the retina that probably equates to the inner retinal vasculature present in
many mammalian species . The latter hypothesized function has been widely accepted by
contemporary researchers, since the avian retina is avascular. Thus, the avian retina has

two nutrient sources: the pecten and the choroidal vasculatures.

1.2.2. Retina

The retina consists of two primary layers, an inner neurosensory retina and an
outer simple epithelium, the RPE. The neurosensory retina is firmly attached only at its
anterior termination, the ora serrata, and at the margins of optic nerve head.

Eight histological layers are recognized in the neurosensory retina: photoreceptor
outer segments (OSs), photoreceptor inner segments (ISs), outer nuclear cells (ONL),
outer plexiform (OPL), inner nuclear cells (INL), inner plexiform (IPL), ganglion cell
and nerve fiber layer (GCL+NFL) (see Figure 1.3). Some alternative histological
descriptions include two additional layers: the outer and inner limiting membrane.
However, the idea of an outer and inner limiting membranes as actual membranes per se
is incorrect; the dense “membrane” seen at this level with the light microscope simply
consists of a line of closely opposed terminal bars joining distal processes of the Miiller
cells to adjacent photoreceptors. Miiller cells’ endfeet also are responsible for the inner

limiting membrane (Won, Kang et a1. 2000).

The synaptic contact areas in the retina are named outer plexiform layer (OPL)
and inner plexiform layer (IPL) (Figure 1.3 and Figure 1.4). These two areas have
conventional vesicular and ribbon vesicular synapses. Transmitter release at vesicular
synapses is an exocytotic process mediated by a cascade of interactions involving
proteins in the synaptic vesicle membrane, presynaptic plasma membrane and
presynaptic cytoplasm. Neuronal exocytosis is triggered by calcium and requires 3
SNARE proteins: synaptobrevin on the synaptic vesicle, syntaxin and SNAP25 on the
plasma membrane .

By means of many complex nerve synaptic contacts within the neurosensory
retina, electrical impulses generated by light reaching the photoreceptors are processed

and transmitted to the nerve fiber layer and, subsequently, to the optic nerve and brain.

 

 

 

 

 

Figure 1.3 - Plastic-embedded retinal section of a normal chicken at 270 days of age. All
cell and fiber layers found in the mammalian retina are present. The oil droplets, present in
some of the cone photoreceptor inner segments can be seen adjacent to the RPE (arrows).
The hyperboloid and the paraboloid (arrowheads) with their characteristic metachromatic
appearance in toluidine blue can also be seen. Stain - toluidine blue; Bar - 20 um. Key: BM
- Briich’s Membrane; RPE+OS — Retinal Pigment Epithelium + Outer Segment; IS- Inner
Segment; OLM — Outer Limiting Membrane; ONL- Outer Nuclear Layer; OPL- Outer
Plexifomi Layer; INL- Inner Nuclear Layer; IPL - Inner Plexiforrn Layer; GCL+NFL -
Ganglion Cell Layer + Nerve Fiber Layer; ILM- Inner Limiting Membrane.

10

"1

is

at

1.2.2. i. Retinal pigment epithelium (RPE)

The RPE is a single layer of cuboidal cells resting on a basal lamina (Bruch's
membrane), which is adjacent to the choroid. Because of its high melanin pigment
content, the RPE is opaque to light (Figure 1.3). It lies adjacent to the photoreceptor cells
and performs a number of functions that are critical for the viability and activity of the
retina . Microvilli from the apical portion of the RPE cells usually project during the day,
or in well-illuminated environments, and envelope the distal ends of the photoreceptor
OSs. The microvilli are especially well developed in the avian eye and can envelope
more of the photoreceptors than in the mammalian eye. At night, or after a long period of
dark adaptation, they retract, and if the eye is harvested at this stage the RPE
histologically looks very compact. The principal pathway by which the retina takes up
nutrients and other small molecules from serum is from the choroidal circulation, via
transepithelial transport, across the RPE. The RPE also engulfs, digests, and recycles
approximately 10% of the mass of each OS per day , mediates the isomerization of retinal
from all-trans to ll-cis retinal , and stores retinoid precursors for visual pigment
regeneration . Phagocytosis of the OSs occurs on a diurnal schedule, with the peak of rod
OS shedding occurring at dawn and the peak of cone OS disc shedding occurring at dusk
. In conjunction with the retina, the RPE contributes to the generation of a standing
electrical potential across the eye and to the c-wave of the electroretinogram (ERG), a
voltage response to illumination that occurs on a time scale of several seconds . The
isolated RPE shows an electrical response to illumination only at intensities that are well

above the physiological range; this response appears to be mediated by melanin .

11

1.2.2. ii. Photoreceptors

As in mammals, the avian photoreceptor complex is arranged in a highly regular
pattern, called a “retinal mosaic” . Although the avian retina has a duplex nature (i.e.,
containing both rods and cones) similar to that of primates, it also possesses (along with
reptiles, many fish, and amphibians) photoreceptors known as double cones. Rods and
cones both have four distinct functional zones: the 088, the 183, the cell bodies and the
synaptic termini. Within the chicken retina, cone photoreceptors outnumber rod cells by
six to one in the central retina and by three to one in the peripheral retina . The cone-
dominant character of the avian retina contrasts with the typical mammalian retina in
which rods outnumber cones. Rod 085 are packed with parallel bilaminar discs, which
are separated from the cell membrane and are positioned 90° to the long axis of the cell.
Rods mediate vision at low light levels and cones in bright light . Cone 085 are packed
with lamellae, which, unlike the rod discs, remain continuous with the cell membrane. In
both cells OS material is shed in packages from the distal end of the OS. The double cone
consists of a principle cone (similar in structure to a normal single cone) and an accessory
cone, which curves around the IS of the principle cone. The rod IS displays an ellipsoid
of mitochondria, much rough endoplasmic reticulum (RER), numerous polysomes and a
prominent hyperboloid of glycogen (Figure 1.3). The rods have no oil droplets. Single
cones show a tapered OS, a large ellipsoid and a paraboloid of glycogen and an oil
droplet at the apical end of the 185. The principal cone of double cones displays a single
large oil droplet and no paraboloid. The accessory cone has no oil droplet and a large
paraboloid. All cones have a large ellipsoid, plentiful polysomes, RER, Golgi zones and

autophagic vacuoles . Oil droplets are a common feature of the cones in many vertebrate

12

retinas (e. g. birds, reptiles and amphibians), but are rarely found in rods. The oil dr0p1ets
consist of lipids in which carotenoid pigments are dissolved; they can appear transparent
or clear, pale yellow, green, orange, or red. They are positioned at the distal end of the
inner cone segments, spanning the entire width of the receptor (Figure 1.3). Light passes
through the droplet before entering the photosensitive OS . Several functions have been
attributed to the oil droplets. These include an ability to reduce blur, fine-tune the
sensitivity spectrum of the different types of cone photoreceptors and act as an ultra-
violet radiation shield . It is now believed that colored oil droplets increase the number of
colors that can be discriminated, and thus are beneficial for color vision . Hence, whereas
initial color processing occurs at the ganglion cell level in primates, the avian visual
system may perform color-processing steps within the photoreceptors themselves.
Despite the differences inherent in these retinal systems, they appear to achieve
comparable color abilities. Birds appear to have excellent color vision, which may be
based on as many as four or five different cone cell photopigments. Iodopsin, for
instance, is a cone cell photopigment that is found exclusively in the chick retina . Not all
of the other photopigments have been completely characterized. Chickens have four types
of single-cone photoreceptors sensitive to ultraviolet, short-, medium- or long-
wavelength light, with peak sensitivity at around 400, 475, 540 and 615 nm, respectively.
The principal and accessory OSs of the double cone contain different visual pigments.
The double cone has its spectral peak of sensitivity at around 575 nm. It is believed that
the double cones serve luminance-based tasks, such as motion detection, and are not so
important for vision . Evidence for tetra- or pentachromatic vision in birds comes from

analysis of the absortion spectra of visual pigments and from behavioral discriminations .

13

This contrasts with the three cone pigments identified in primates and with the two cone
pigments identified in ungulates and in dogs .

High densities of cones are typically correlated with high densities of their
associated ganglion cells. These densities, in turn, are assumed to equate with areas of
high visual acuity. There are retinal regions in which the cones are more densely packed
at the expense of rods. These regions can either be circular, described as an area centralis,
or elongated, called a visual streak. Some species of birds have a pit within the area of
greater cone density, called a fovea, which is formed by the lateral displacement of the
proximal neurons and fibers. Foveal pits tend to be more pronounced and deeper in
diurnal birds in comparison to primates (including humans). Most birds have a single
fovea near the center, slightly above and nasal to the optic disc. The chicken does not
have a fovea and the lack of a fovea is generally regarded as a consequence of
domestication. The area of densely packed cones in the chicken retina is called an

afoveate area centralis .

1.2.2. iii. Outer plexfiorm layerJOPL)

The most external area of synaptic contact in the retina is the OPL, where
connections between rod and cones, vertically running bipolar cells and the horizontally
oriented horizontal cells occur. In brief, photoreceptors catch light in the visual pigment-
containing membranes of the OS and pass a message, concerning numbers of quanta of
light and sensitivities to the different wavelengths, to the OPL where a certain degree of
integration and processing of the stimulus occurs before the visual message is transmitted

to the inner retina. In the bird retina, rods and double cones terminate in the outer

14

sublayer of the OPL, and the single cones terminate in the inner sublayer (Figure 1.4),
forming a well-organized bilayered arrangement of photoreceptor terminals. The
inforrnation-transmitting end of the cone cell is known as the pedicle and of the rod cell
as the spherule. The cone pedicles and rod spherules make synaptic contacts with various
bipolar cell and horizontal cell types. Also, cone pedicles pass electrical messages
between each other and between rod spherules, so that a small amount of rod and cone
signal mixing occurs at this layer . Cone pedicles are large and flat end-feet shaped. The
rod spherules, in contrast, are small round enlargements of the axon or even extensions of
the cell body. The synaptic endings of both photoreceptor types are filled with synaptic
vesicles. At their synapses to second-order neurons (bipolar and horizontal cells), both
rod spherules and cone pedicles exhibit dense structures known as synaptic ribbons
pointing to the postsynaptic invaginated processes. The ribbon synapses are the principal
vesicular synapses of the OPL, which tonically release the transmitter glutamate . Rod
spherules have only two synaptic ribbons associated with two lateral elements that are
horizontal cell axon terminals and two central invaginating dendrites of rod bipolar cells .
Cones contain multiple ribbons at each area of synaptic contact. These areas are named
triads. The cone triad of invaginated second-order processes consists typically of a central
element, which is a dendritic terminal of an invaginating bipolar cell, and two lateral

elements, which are dendritic terminals of horizontal cells.

15

 

Figure 1.4 - Ultrastructural aspect of the chick OPL. Note that the rod spherule and the double
cone pedicles terminate in the outer sublayer of the OPL (arrows), whereas the single cone
pedicle terminates in the inner sublayer (arrowheads). Key: SCP - Single Cone Pedicle; DCPs -
Double Cone Pedicles; RS — Rod Spherule. Bar — 3 pm.

16

1Q iv. Inner nuclear layer (INL)

The INL is composed of various nuclei and cell bodies of second order neurons

such as horizontal, bipolar, amacrine and Miiller cells (Figure 1.3).

1.2.2.iv.a. HoriZontal and amacrine cells

The horizontal and amacrine cells serve to mediate the lateral spread of visual
activation in the retina. Horizontal cells perform this modulation in the OPL. The
anatorrrist Ramon Cajal distinguished two types of horizontal cells common to birds and
reptiles; brush-shaped and stellate (summarized by Rodieck, 1973). The number of
horizontal cells is similar among fish, reptiles, birds, and mammals. However, Cajal
noted a correlation of rod structure and density to the size of the horizontal cells
(summarized by Rodieck, 1973). In mammals and teleost fishes, the rods are somewhat
thin and associated with large horizontal cells, while in birds and reptiles the rods are
wide and tend to be associated with smaller horizontal cells . Amacrine cells function
similarly to horizontal cells in transferring information laterally across the retina mainly
at the inner plexiform layer. Historically, they were not considered neurons. By the
middle of the 20th century, their neuronal nature was confirmed, and their enormous
diversity established. Amacrine cells have been most successfully subdivided into
morphological categories based on two parameters: diameter of the dendritic field and
ramification pattern in the inner plexiform layer. There are over 20 morphological types
of amacrine cells already identified in the vertebrate retina, which use several different

neurotransmitters, such as glucagon, substance P, glutamate, dopanrine, gamma-

17

arrrinobutyric acid (GABA), serotonin and glycine . Works combining anatomy,
physiology, and neurochemistry of these cells are scarce, therefore the exact functions of

all the different amacrine cell subtypes are not completely understood .

1.2. 2.iv. b. Bipolar cells

Bipolar cells exist in the retinas of all vertebrates. The bipolar cells of birds,
reptiles, and amphibians are very similar, consisting of two types as first recognized by
Cajal (summarized by Rodieck, 1973): outer (or large) and inner (or small) bipolar cells.
The defining characteristic of bipolar cells is their dendritic contact with the

photoreceptors.

I.2.2.iv.c. Miiller cells

The Miiller cell is often referred to as the radial glial cell, it is spread out radially
between the external and internal limiting membrane of the retina, which are formed by
the proximal and distal endfeet of the cells. The avian retina is completely devoid of
astrocytes. Thus, Miiller cells constitute the only astrocyte-like cell population in avian
retinae, whereas mammalian retinae also contain astrocytes in close association with
blood vessels . Miiller cells are key mediators of nerve cell protection, especially via
release of basic fibroblast growth factor, via uptake and degradation of the excitotoxin
glutamate, and via secretion of the antioxidant glutathione . Like other glial cells of the
CNS, Miiller cells undergo reactive gliosis following acute retinal injury or chronic
neuronal stress. Virtually every disease of the retina is associated with a reactive Miiller

cell gliosis. Miiller cell gliosis is characterized by proliferation, changes in cell shape due

18

r.)

(’14

(If)

r')

A»

n)

to alterations in intermediate filament production, changes in ion transport properties, and

secretion of signaling molecules such as vascular endothelial growth factor .

1.2.2.v. Inner plexfiorm layer {IPQ

The more internal area of synaptic contact of the retina is the IPL, and it functions
as a relay station for the vertical-information-carrying nerve cells, the bipolar cells, to
connect to ganglion cells (Figure 1.3). The IPL of birds is very thick compared to the
other vertebrates . It contains numerous conventional vesicular synapses made primarily
by amacrine cell terminals that phasically release the inhibitory neurotransmitters
gamma-anrinobutyric acid (GABA) or glycine , and ribbon synapses made by bipolar cell
terminals, which rapidly release glutamate , to the synaptic terminals of the ganglion

cells.

I.2.2.vi. ngglion cell and nerve fiber layer (GCL+NFL)

Retinal ganglion cells are the output neurons that encode and transmit information
from the eye to the brain. The axons of ganglion cells form the optic nerve, which is the
anatomical link between the eye and the brain. The signals transmitted via the optic nerve
represent the integration of all retinal processing that is then conveyed to higher centers
along the visual pathways.

In birds, it has long been known that the intraretinal portions of ganglion cell
axons are myelinated . Oligodendrocytes (a form of macroglial cell) are absent in most

mammalian retinas, except in the rabbit. The bird retina, however, contains a large

19

rumbe
respon
arian

distrib-

O.\l.. '

cones.
man Cl
in gun
Were l

Pill-{arr

13. c.

number of Oligodendrocytes. These latter cells, along with Miiller cells, are believed to be
responsible for the myelination of the ganglion cell axons and optic nerve head in the
avian retina . However, rnicroglia in the bird retina show a very similar pattern of
distribution to that of mammalian counterparts . Microglia are distributed in the OPL,
ONL, IPL, GCL and NFL.

There is a great difference in the number, types, and distribution of retinal
ganglion cells between birds and mammalian species. As mentioned previously, high
densities of ganglion cells are typically correlated with high densities of their associated
cones. There are about 1 million ganglion cells in the retina of the rhesus monkey and in
man compared to 2 million or more in chick, pigeon, and quail . The large variations seen
in ganglion cells make them challenging to classify. However, accepted classifications
were performed in the past on the basis of soma size, dendritic field size and branching

patterns within the inner plexiform layer.

1.3. Central visual pathways

The basic route that information from photoreceptors is conveyed to the optic
nerve is as follows: the photoreceptor synapses with bipolar cells which in turn synapse
with ganglion cells, the axons of which form the optic nerve. Modification of the signal
within the retina occurs via the action of horizontal and amacrine cells. The former cells
synapse with photoreceptors and the latter with bipolar cells.

As in mammals, 100% of the optic nerve axons of the chick are myelinated. In
humans the total axon count of the optic nerve is about 101-102 million, whereas in the

chick it is 423,000 . In the chicken, optic nerve fiber decussation in the chiasm is

20

complete . There are two major visual pathways in the nervous system of reptiles, birds,
and mammals, which show a high degree of anatomical similarity. These two pathways
arise from retinal efferent fibers, which travel to either the optic tectum in birds
(equivalent to the superior colliculus in mammals) or the optic thalarnic complex in birds
(equivalent to the dorsal lateral geniculate nucleus in mammals). The retino-collicular
pathway of mammals is known as the tectofugal pathway or collothalarnic pathway in
birds. From the tectum, there are efferents to the thalamus (nucleus rotundus in birds and
pulvinar in mammals). The thalarrric nuclei send projections to different areas of the
telencephalon: the visual wulst in birds (striate cortex in mammals), which is the primary
visual pathway, or to the entopallium (previously called the ectostriatum) in birds
(extrastriate in mammals), which is a secondary visual pathway. This retino-thalamo-
striate pathway of primates has been called a thalamofugal or lemnothalamic pathway in
birds . In the avian visual system, the temporal (posterior) retina is connected to the
rostral (anterior) optic tectum, nasal (anterior) retina to the caudal (posterior) tectum, and
likewise dorsal and ventral retina are connected to the ventral and dorsal tectum,

respectively.

1.4. The visual transduction pathway

Photoreceptor cells are highly specialized for the capture of light and for
phototransduction, the conversion of light into a biochemical signal. Phototransduction
takes place in a series of membranous discs comprising a unique structure: the
photoreceptor OS. Basically, phototransduction is the process by which a photon of light

captured by a molecule of visual pigment generates an electrical response in a

21

photoreceptor cell. The stimulated photoreceptor increases its potential difference across
the cell membrane (hyperpolarizes), reducing the amount of neurotransmitter released at
the synaptic cleft. The photoreceptor potential produces a graded potential (not an action
potential) in the bipolar cells with which it synapses. As discussed above, rods, which
comprise the majority of photoreceptors in rodents and in humans, and the minority in
chickens, are the most light-sensitive photoreceptor cell type. Cone photoreceptors, which
comprise the majority of photoreceptors in chickens, are much less sensitive to light, but
are active in the light intensities typical of daylight (natural or artificial). Many types of
birds have a need for high-acuity vision during the day . Retinal rods and cones share a
similar phototransduction pathway involving cyclic guanosine monophosphate (cGMP).
Some differences are known, such as that cones are typically 100 times less
photosensitive than rods and their response kinetics are several times faster, but the fine
underlying mechanisms of cone phototransduction still remain largely unknown. It is
generally accepted that the process in both cells is similar but almost all proteins involved
in phototransduction have distinct rod and cone variants. Specific differences in
properties between rod and cone pigments have been described, such as a 10-fold shorter
lifetime of the meta-II state (active conformation) of cone pigment and its higher rate of
spontaneous isomerization, but their contributions to the functional differences between
rods and cones remain speculative .

Since vertebrate rod phototransduction is one of the best-studied G protein
signaling pathways, it is described here in detail to serve as a model for studying the
general phototransduction mechanism. In this pathway the photoreceptor-specific G

protein, transducin, mediates the relation between the visual pigment, rhodopsin, and the

22

effector enzyme, cGMP phosphodiesterase. Rhodopsin is a visual pigment
(photopigment) specifically localized in the rod OS. Visual pigments are members of the
superfamily of G protein-coupled receptors (GPCRs) whose natural ligand, the small-
molecular-weight chromophore ll-cis retinal, is already covalently attached in darkness
(in its inactive conformation) . The ll-cis isomer acts as a powerful antagonist, and it is
only when a photon of light isomerizes the chromophore to its all—trans form, which acts
as a powerful agonist, that the visual pigment becomes active . The active form of the
photopigment rhodopsin is called metarhodopsin II or Rh* , and it is this form of the
pigment that activates the G protein transducin. This triggers the transduction cascade.
Transducin consists of or, [3 and 7 subunits. Upon activation transducin releases a GDP
and combines with GTP. The combined or subunit of transducin and GTP split from B
and 7 subunits . Two or transducin subunits interact with the phosphodiesterase (PDE)
complex (which consists of excitatory or and [3 subunits and two inhibitory 7 subunits) to
release the inhibitory 7 subunits of the holoenzyme. Activated PDE a and [3 subunits
catalyzes the hydrolysis of cGMP to 5’ GMP. In darkness, cGMP keeps a small
proportion of the cationic channels, present in the plasma membrane of the OS, open .
The decrease in intracellular cGMP concentration causes the cGMP-gated channel in the
cell membrane to close and the rod cell hyperpolarizes. Intracellular Ca2+ levels decrease
as the Na/Ca-K exchanger continues to extrude Ca2+ from the OS .

Rh* is inactivated by two sequential processes: first the phosphorylation of
rhodopsin by rhodopsin kinase, reducing its affinity to transducin , and then the binding

of arrestin to the phosphorylated photopigment.

23

The inactivation of the entire visual cascade requires hydrolysis of the GTP on the
a-subunit of transducin to GDP, a reaction activated by a protein named regulator of G-
protein signaling (RGS). PDE also returns to its inactive state as a result of this reaction.
Additionally, to complete the inactivation of the visual cascade reassociation of the or-
subunit of transducin with its B and 7 subunits is required to form the inactive transducin
heterodimer. Low intracellular Ca2+ concentration results in 1) the activation of guanylate
cyclase, a process mediated by the calcium-binding protein GCAP; and 2) an increase in
the sensitivity of the cGMP-gated channel to cGMP as a result of the dissociation of
calmodulin from the channel. As cGMP concentration increases, the cGMP-gated
channels reopen and the cell is returned to its resting depolarized state. The increase in
Ca2+ also converts guanylate cyclase to its inactive or basal level of activity . See Figure

1.5 for a simplified diagram of the visual transduction cascade.

24

 

 

   
  

 

Cyclase/ ' ‘
Dlek Membrane
GDP

 

Plasma Membrane

 

 

 

Figure 1.5 - Diagram of rod phototransduction cascade. Key: GCAP-Guanylate Cyclase
Activating Protein; PDE — cGMP Phosphodiesterase; or, B and ‘y - subunits of transducin; RK -
Rhodopsin Kinase; RGS - Regulator of G-protein Signaling; Cam - Calmodulin

1.5. Electroretinogram (ERG)

Electroretinography, a technique in which light-induced trans-retinal voltage
response is measured, is an extensively used and widely accepted method that is
reasonably sensitive and quantitative for the assessment of retinal function. Its clinical
value has been clearly established, not merely for the diagnosis of hereditary
degenerative diseases, but also for evaluation of their progression and prognosis . The
bioelectrical potential of the retina originates from its various cellular layers, and
represents a compounded mass response . A flash ERG is a recording of the transient
change in the standing potential of the eye in response to light stimulation induced by a

brief illumination of the eye. A Ganzfeld sphere is often used to deliver the flash

25

stimulus. The term ganzfeld, meaning “full field” in German, implies that the stimulus
reaches practically all parts of the retina and its intensity is approximately equal across
that area . Full-field illumination is more advantageous for electroretinographic studies
than a simple strobe-light stimulus because the former allows for an assessment of the
homogeneous summation of electrical activities from the entire retina while the latter
stimulus does not evenly illuminate the retina. Recording of a single flash intensity, full-
field electroretinogram may not be sensitive enough to allow detection of early changes
in retinal function such as those that occur in the early stages of some forms of retinal
dystrophy. Therefore stimulus of different intensities, different wavelengths and under
retinal dark- or light adaptation are commonly used to gather more information about
retinal function.

The first widely accepted analysis of the ERG stems from the investigations of
Ragnar Granit (1933). Granit studied the ERG components in a cat retina using corneal
recording electrodes. He observed that as the level of ether anesthesia was deepened,
different components, named P (process) components of the ERG disappeared. Granit
termed the different components or processes in sequence of their disappearance: P-I, P-
H and P—HI. The P-I component is a slow comea-positive wave. P-H is also a comeal-
positive wave that rises relatively fast to a peak amplitude and then recovers to an
intermediate potential while the light stimulus is still on. The last component, P—HI,
which was the most resistant to the level of ether anesthesia, is a comea-negative wave
that develops faster than the other two and remains as a negative potential for as long as
the light stimulus is present. He noticed that the magnitude of P-H altered the magnitude

of P-I. Additionally, another positive waveform, sometimes called the d-wave, is

26

generated at stimulus offset . The component analysis of Granit has been modified
slightly over the years but remains the basis for our understanding of the ERG. For his
work on the ERG, Ragnar Granit won the Nobel Prize for Physiology and Medicine in
1954. See Figure 1.6 A for a diagrammatic representation of the different components of

the ERG.

27

 

 

 

 

Lights on Lights off

 

I 1 r mi ‘fi 1 - . I . l r

0 50 1 00 1 50 200 250
mSec

l-Tlfi I r‘l- I]

 

 

 

Figure 1.6 - A) Diagrammatic representation of the Granit waveforms (I, II and III) which
make up the electroretinogram (ERG). Note the superimposed representation of a-, b- and c-
waves correlating with the waveforms HI, H and 1, respectively. B) An actual ERG from a
90- day-old chicken. The arrow indicates the timepoint at which the eye was stimulated by a
flash. Note the chicken ERG has the same basic components of a mammalian ERG. The a-,
b- and c-waves are marked.

28

The use of chemicals and rnicroelectrodes has contributed greatly to an
understanding of the cellular origin of the various components of the ERG. The evidence
from such studies has shown that the negative a-wave is produced by the photoreceptors
(rods and cones). It is visible until overwhelmed by a larger positive response from the
Miiller and bipolar cells. The Miiller cell component is induced by changes in
extracellular potassium ion concentration as the electrical response is conveyed to the
inner retina. This corneal positive response contributes the majority of the b-wave.
Furthermore, drugs that block transmission from photoreceptors to bipolar cells, almost
completely remove the b-wave . Noell (1953) showed that systemic injection of sodium
azide elicited an electrical potential from the retina similar to the ERG c-wave. The
azide-induced potential was not influenced by iodoacetic acid, which is known to destroy
photoreceptors, or by cutting the optic nerve, which causes degeneration of the ganglion
cells. This interpretation of the c-wave origin was proven directly when intracellular
recordings were made from pigment epithelial cells in response to light stimuli (identical
in shape and temporal properties to the ERG c-wave) . When the retina is separated from
the sclera and pigment epithelium, the ERG response consists of only the a- and b-waves
. There is an additional layer of complexity in the formation of the c-wave of the ERG.
The RPE basal membrane (choroidal side) is less permeable to potassium ions than the
apical membrane (retinal side). This asymmetry causes a constant potential difference
between the retina and the choroid. The retinal side is more positively charged relative to
the choroidal side. This is also called the standing potential of the eye. A reduction in the

extracellular concentration of potassium ions near the apical membrane of the pigment

29

epithelial occurs due to light-induced electrical activity in the photoreceptors. This is
expressed as an increase in the trans-epithelial potential with the retinal side becoming
even more positive relative to the choroidal side. There is a high correlation between
peak amplitude of the c-wave and peak reduction in extracellular potassium
concentration. This is the ERG c-wave when recorded with a corneal electrode . See
Figure 1.6 A for a diagrammatic representation of an electoretinogram and a comparison
with Granit waveforms (I, II and Ill).

As mentioned previously, a single intensity flash-ERG provides limited
information about retinal function. Nevertheless, it is possible to utilize the different
physiological features of rods and cones to differentially stimulate them. Methods used
include varying the intensity of the light stimulus, altering stimulus wavelength with
color filters, dark or light adapting the patient, or using a flickering light of differing
frequencies. Additionally, carefully measured intensity-response functions combined
with explicit models, such as the Naka-Rushton function for ERG analysis, can provide
the possibility of identifying sites and mechanisms of disease action for specific diseases
and individual patients .

In chicks, the ERG waveform is comparable to an adult one already at hatch.
However, a- and b-wave amplitudes increase as the bird matures. Most of this increase in
amplitude occurs during the first 14 days . See Figure 1.6 B for an example of a typical

chicken electoretinogram.

30

1.6. Inherited retinal dystrophies

Retinal dystrophies are the major causes of incurable blindness in the Western
world, currently affecting about 1.5 million individuals. Our insight into their etiology
has improved remarkably over the past decade and a number of key genes important for
retinal function have been identified . In fact, more than 80 genes associated with human
photoreceptor degenerations have been identified .

Phenotypically, the inherited retinal dystrophies can be divided into different
categories. For example, in some forms there is a failure in phototransduction resulting in
a lack of development of normal retinal function, as assessed by ERG, followed by rapid
loss of photoreceptors (e.g. rdI mouse, rch dog and rcd3 dog) . Other gene mutations
result in a progressive loss of photoreceptors, which up until their death, function
relatively normally. Photoreceptor loss is reflected in a progressive reduction in ERG
amplitudes (e. g. prcd dog) .

Some gene mutations result in a profound abnormality in retinal function as
shown by vision testing and ERG testing and yet they cause either no obvious retinal
degeneration or merely a slow retinal degeneration. Examples include the congenital
stationary night blindnesses where rod function is severely affected and yet the retina
does not degenerate (e. g. nob mouse) and mutations in RPE65 where rod and cone vision
is severely affected and the ERG responses grossly abnormal and yet there is only a slow
degeneration of the retina .

A unique form of inherited retinal degeneration is the enhanced S-cone syndrome

(ESCS) in humans and rd7 in mice. ESCS patients and rd7 mice lack rod photoreceptor

31

function, like other inherited retinal degenerations such as retinitis pigmentosa, but are
unique because their S (blue) cones, normally the least numerous cone type, are greatly
increased in numbers. ESCS and rd7 are caused by a mutation in a transcription factor
named NRZE3, which plays an important role in differentiation of photoreceptors. Lack
of NR2E3 function leads to a reduction in the number of rod cells and a twofold increase
in the total number of cone cells. It is speculated that when photoreceptor progenitor cells
normally fated to become rods lack the normal signal to become rods they end up
differentiating into S-cones. Besides the abnormally high number of S-cone cells, rd7
retinas have Miiller cell gliosis, and RPE migration to the inner retina. Despite evidence
of slow degeneration there is a lack of cells undergoing apoptosis, which is the common
pathway for photoreceptor loss in retinal dystrophies .

Growing evidence indicates that a mutation expressed in a particular retinal cell
type may affect not only these cells autonomously, but also may affect retinal cells that
do not express the mutated gene . A clear example of non-cell-autonomous effects is that
mutations of genes expressed uniquely in rods also result in cone and RPE degeneration .
The mechanisms underlying these non—cell-autonomous degenerations remain unknown.
However, they may involve trophic or toxic interactions mediated either by diffusible
factors or by contact-mediated cell interactions .

Several forms of retinal degenerations have been reported and characterized in the
chicken (Gallus gallus). These include the followingconditions: retinal dysplasia and
degeneration (rdd strain) , retinal degeneration (rd strain) , blindness, enlarged globe
(beg strain) , and finally the delayed amelanotic (dam strain) . Histological and ERG

changes are reported for the rdd , rd and dam chicken strains . The rdd chicken

32

phenotype is sex-linked and characterized by a progressive degeneration of the retina,
culminating in blindness. Morphologically, the condition is recognizable by
abnormalities in both the RPE and the neural retina. Gaps in the RPE which are first
detected macroscopically at nine days of incubation become larger and more numerous at
the time of hatching, then disappear during the subsequent week. After hatching, the
thickness of the retina decreases with age, primarily due to loss of photoreceptors and
cells from the INL. Detachment of the atrophic retinas generally occurs in adults, and is
followed in some adult birds by granulation and ossification of the posterior segment . At
three weeks of age, homozygotes have a flat ERG indicating severe loss of visual
function. Linkage analysis mapped the rdd locus to a small region of the chicken Z
chromosome with homologies to human chromosomes Sq and 9p .

The rd phenotype is caused by a null mutation in the photoreceptor guanylate
cyclase (Gucy1*b) gene and is therefore a model of Leber Congenital Amaurosis type 1
in humans . The photoreceptor cells of rd birds undergo degenerative changes after about
7 days of age. A decrease in the number of OSs, spaces between ISs and large spaces in
the ONL occur by 10 days of age. By 21 days of age, most of the ISs appeared swollen
and there is a decrease in the abundance of OS3 and photoreceptor nuclei. By 60 days of
age, no OSs remain and the majority of identifiable 18s are from cones with many of the
surviving cones being double cones. By six months of age, very few photoreceptor ISs
and nuclei remain. ERGs are not recordable either under 1i ght- or dark-adapted conditions
in affected chicks from the time of hatch .

The dam chicken is characterized by a postnatal, spontaneous cutaneous

arnelanosis and a high incidence of blindness. Cutaneous pigment loss is accompanied by

33

a destruction of the choroidal melanocytes. The presence of blindness correlates with the
histopathologic finding of severe degenerative changes in the RPE and neural retina first
seen near the base of the pecten and progressing radially in irregular patterns . The main
ERG change observed in this phenotype is a generalized decrease in a- and b-wave
amplitudes .

Only preliminary observations are available for the beg phenotype . The beg
chicks are blind at hatch, have vestibular abnormalities and develop globe enlargement .

The GSN/ 1 chicken, recently described, also presents a hereditary form of visual
impairment. Nevertheless, the histopathological findings suggest that the visual
impairment observed in GSN/l affected individuals is related to developmental defects in
the visual pathways, especially in the optic tectum, which, in affected birds, show a

pronounced atrophy .

1.6.1. Globe enlargement in chicks with retinal disease

The eyes of chicks have been extensively used for research into ametropies since
they are large, compensate for defocus rapidly, and are capable of color vision .
Alterations in chick globe dimensions are readily induced by alterations in the retinal
image, including vision deprivation, defocus and constant light exposure . For instance,
myopia or hyperopia can be experimentally produced in chicks by defocusing the eye
using goggles fitted with negative or positive diopter lenses, respectively , and both can
alter the axial or radial globe length, respectively, in a matter of days . It is well
established that the signaling mechanism for globe growth and, thus, the resulting
changes in the refractive state of chicks are restricted to the retina itself . It has been
shown that experimentally induced globe growth occurs despite optic nerve section and
destruction of the Edinger-Westphal nucleus, responsible for accommodation in the

central nervous system .

1.7. Position of the field when the work started

A unique phenotype, caused by an autosomal recessive mutation, was identified
as causing blindness and globe enlargement in some birds in flocks of commercial layer
chickens in the UK. A retinal origin for the blindness was suspected on the basis of
preliminary electroretinographic investigations. The name retinopathy, globe

enlargement (rge) was selected to reflect the characteristics of the disorder. All the

35

available information about rge chicks was derived from two published papers written by
a veterinary ophthalmologist named Roger Curtis from England, who first recognized the
condition . In these papers he described that impaired vision was present usually by eight
weeks of age and that the condition had an autosomal recessive hereditary basis. He
noted that affected birds developed globe enlargement and were unable to perceive food
particles on a flat surface, although apparently able to discern large objects and to
respond to bright light. Curtis performed preliminary ERGs in two affected birds and
observed that they were abnormally low in amplitude. In addition, he noticed that some
affected birds developed linear fundus lesions that correlated with abrupt thinning of the

retina histologically.

36

CHAPTER 2
CLINICAL FEATURES OF THE RETINOPATHY, GLOBE ENLARGED (rge)

PHENOTYPE

2.1. Introduction

A flock of rge chickens was established at Roslin Institute (Edinburgh) by
crossing a single carrier bird from Dr. Roger Curtis’ original flock with a white leghom.
Subsequently a second flock was established at Michigan State University from hatching
eggs imported from the Roslin Institute. This chapter reports the initial clinical
characterization of the rge phenotype by general physical examination and necropsy.
Assessment of vision and detailed eye exarrrination, including ophthalmoscopy,

tonometry, corneal pachymetry and globe dimension measurements, were performed.

2.2. Material & Methods

Breeding was performed to produce homozygous affected (rge/rge), heterozygous
carrier (rge/+) and homozygous normal (+/+) chicks. Birds were group housed under 12
hour light/dark cycles and fed a commercial chicken diet (Home Fresh Poultry Feed,
Kent Feeds, Inc.).

All procedures using chicks were conducted in accordance with the ARVO
Statement for the Use of Animals in Ophthalmic and Vision Research and approved by

the Institutional Animal Use Committee.

37

2.2.1. General examination, observation of behavior, ophthalmic examination and

necropsy and preliminary histological examination

Twenty one birds, of which 9 (6 males and 3 females) were rge and 12 were
carriers (4 males and 8 females), were examined at hatch, then at 7, 14, 21, 28, 42, 49, 70,
77, 84, 98, 280, 308, 336 days of age. A general physical examination was performed at
the time intervals listed. The ability of the birds to locate and peck at food particles on the
floor was evaluated. An ophthalmic examination was performed using a transilluminator,
hand-held slit lamp (Kowa SL—l4) and indirect ophthalmoscope (Heine). Comparative
gross necropsies and histopathological examination were performed on rge and control
birds at hatch, 14, 60 and 180 days of age. A minimum of 2 rge and 2 control birds, per
age group were analyzed. Tissue samples from the central nervous system (CNS), liver,
muscle and heart were collected, fixed in 10% buffered formalin, embedded in paraffin,
processed routinely for histologic slide preparation, and stained with hematoxylin-eosin.
Sections from the liver, heart and muscle were also stained with periodic acid-Schiff
(PAS). CNS sections were stained with PAS and with Weil and luxol fast blue stains, for
myelin. Eyes from 2 rge and 2 control birds at 13, 90 and 270 days of age were routinely
processed for histology. In brief, immediately after euthanasia the globes were enucleated
and injected with 10% buffered formalin, then plunged into the same fixative for 48

hours, embedded in paraffin, processed routinely and stained with hematoxylin-eosin.

38

2.2.2. Vision testing with an optokinetic device

Visual acuity was assessed by the use of an optokinetic device. This consisted of a
drum with a diameter of 38 cm, which could be lined with different sets of alternating
black and white vertical stripes, and could be rotated, in alternating directions around the
bird at a velocity of 48 degrees/second. The widths of black and white stripes stimulus
used in this study were 4.5, 7, 13 and 25 mm with a spatial frequency of 0.37, 0.23, 0.13
and 0.06 cycles per degree, respectively. The head of the test bird was approximately 19
cm from the stripes. Vision was assessed under both dim and bright light, 0.22 and 24.5
cd/m2 respectively, as measured by a photometer (Research Radiometer H. 1700 with
SED033 silicon light detector, International Light, Inc.). Birds were tested at 1, 14, 30,
60, 150 and 270 days of age. The response of the chick was observed and classified as
positive response (head and neck turned to follow rotating stripes), partial response (head
sometimes followed the rotation of the stripes but not every time) or negative response

(the head never turned to follow the rotating stripes).

2.2.3. Tonometry, central corneal pachymetry and eye dimension measurements

Central corneal thickness (CCT), intraocular pressure, and axial globe length were
measured following application of a topical anesthetic (proparacaine hydrochloride 0.5%
ophthalmic solution USP — Alcon Laboratories). In each case three readings were taken

and averaged for each eye of each bird. These measurements were repeated on the same

39

21 birds, of which 9 (6 males and 3 females) were rge and 12 were carriers (4 males and
8 females).

Central corneal thickness (CCT) was measured using an ultrasonic pachymeter
(Pachettem, Ultrasonic Pachymeter Model DGH 500) with the speed of sound in the
cornea pre-set at 1,640 m/sec. The axial globe length was measured by A-mode
ultrasonography (Humphrey - A/B Scan System 835).

Intraocular pressure (IOP) was measured by applanation tonometry using a
Tonopen (Mentor). Additionally, more detailed A-mode ultrasonographic measurements
of the eyeball, including lens thickness, anterior and vitreous chamber depth were
performed in another group of 16 rge and 17 carrier chicks at 13 days of age (6 rge and 5
carriers), 33 days of age (7 rge and 9 carriers) and 92 days of age (3 rge and 3 carriers),
using an ophthalmic A-mode ultrasonic biometer (Echorule - Phakosystems Inc.).
Following euthanasia of these birds the weight of the enucleated globe trimmed of
extraocular tissues was recorded.

The radial globe diameter (dorsal equator to ventral equator) of both eyes was
measured using Castroviejo calipers immediately following enucleation of 15 rge and 15

carrier birds terminally anesthetized at 13, 33, 92, 200 and 270 days of age.

2.2.4. Refraction and measurement of corneal curvature

Infrared photoretinoscopy and photokeratometry were performed at 13 days of
age (6 rge and 5 carriers), 33 days of age (7 rge and 9 carriers) and 92 days of age (3 rge

and 3 carrier). The infrared photoretinoscopy technique was calibrated against

40

conventional retinoscopy in chickens and agrees with the results of the latter within a
fraction of a diopter, the difference being due to the difference in wavelengths employed

and the chromatic aberration of the chick eye (Howland, personal communication, 2003).

2.2.5. Statistical Analyses

Statistical analyses of the clinical measurement results were performed by
repeated measures analysis of variance (ANOVA), one-way ANOVA (radial globe
diameter) and t-test (when comparing any one time-point data between two groups). Data
from the vision testing using the optokinetic device was analyzed using an ordinal model
for multinomial data. The tests were all run in two different statistical analysis softwares
(StatView and SAS 2001 - version 8.2. SAS Institute Inc.). If any statistically significant
difference was found the data were further analyzed using post hoc comparisons with

Fisher’s or Tukey-Kramer tests. Data were deemed significant when P<0.05.

2.3. Results

A summary of the statistically significant differences in ocular dimensions,
refraction and intraocular pressure of rge chicks compared to controls is shown in Table
1. There was no significant difference between carrier and normal birds for any of the

morphological measurements (data not shown).

41

Table 2.1 — Summary of the main clinical features observed in chicks
presenting the rge phenotype. ** P<0.05; *** P<0.001; **** P<0.0001.

 

 

Mean Mean
rgeflnrotype MudSDtorrge/rge RestituflSDforrge/«r»
Cordearlm Increasedat 33 days ofage“" 4.68 :tO.l7mrn 3.90:0.19mm
Cami Cor-mi Helm Increased at 42 days of age" 258.75 1: 10.50 um 243.83 1 3.55 um
AxHGlobeLagth lncreasedat92days ofage”** 14.41 1: 0.16m 12.55 10.97mm
WbeeDl-mter lncreasedat33daysofage“ 1.62 10.96cm 1.38 1 0.12cm
Art-1hr Quilter Depth Decreased at 13 days of age"" 0.858 :t 0.68 m 0.980 1 0.42 rrrrn
V'rtrm Oldies- Depth Increased at 33 days of age”* 7.56 :t 0.32 nun 6.58 :1: 0.34 mm
Eyebleetght Increasedat33 daysofagem 1.42 10.10g 1.14 10.90g
Hypaopia (highs at 33 days of
Mutton age)": 12.00 1 2.30 D 4.44 :1: 1.60 D
M Pram-e Decreased at 49 days of age“ 17.60 t 1.26 mmHg 20.25 1 1.57 mmHg

 

42

2.3.1. Physical examination, postmortem and preliminary histopathologic examinations

Rge chicks appeared less active than carrier and normal chicks immediately after
hatch, although this was not quantified. The rge birds sporadically exhibited a
characteristic slight lateral nodding movement of the head and some “pecking at the air”
behavior starting at 2 weeks of age. This characteristic behavior continued for the
duration of the study. Affected and control birds responded similarly to sound stimuli
produced by hand clapping.

It was noticed from the histological examination of eye globes that the anterior
chamber appeared progressively shallower in rge globes than in controls (Figure 2.3).
Cataracts were a common finding in rge birds by 270 days of age. Thinning of retinal
layers was evident in the sections from the 90 and 270 day-old birds. Additionally,
ossification of the posterior segment was noticed in one bird at the same age. A detailed
characterization of the retinal histopathological changes is described in Chapter 5.
Neither gross lesions nor any non-ocular abnormalities were observed in rge birds on
necropsy or light microscopy histopathologic exanrination of liver, muscle and heart. No
specific differences could be detected among the six brains that were processed regarding

the structure or myelination of the components of the visual system.

43

2.3.2. Vision testing

From hatch rge chicks were less efficient than carrier and normal chicks at
pecking food particles placed on the floor, spending an average of 3 attempts before
actually picking up the particle. By 30 days of age the rge chicks did not attempt to peek
at food particles placed on the floor. Once the rge chicks were familiar with their
environment they were able to consistently locate feed and water containers. From
approximately 30 days of age rge chicks failed to show an “escape response” to the
visual stimulus produced by the approach of a person, making the rge chicks easier to
catch than the carrier and normal chicks. Visual menace response was absent in the rge
chicks by about 30 days of age but present in all the age-matched carrier and normal
chicks.

An assessment of visual acuity using the optokinetic device showed that the
percentage of rge chicks showing a response (partial or complete) to the rotating stripes
decreased with age (Figure 2.1). At each time-point, and for each width of stripe, the
percentage of chicks showing any response was lower under the dimmer room lighting.
Although at 150 days of age 60% of rge chicks showed some response to the widest
stripe under bright lighting conditions (Figure 2.1) they were not able to peck at food
particles, and lacked the menace and “escape” responses.

The reduction in response to stripes of smaller widths, with increasing age and
with lower light levels in comparison to carrier or normal chicks was statistically

significant (P<0.001).

4.

 

 

,
_ ,
_ l1

mmmmmlmwmmm

03:88: Etna + 025.com up

.. l)

 

0

controls
ewe/'99
°¢ 5

 

4.5 7 13 25

m .eoQGnvnvw
n 8%
um
m.
M MW
3 am
. Wm
H mm
m mm
5 mm
4m) as.
. m-..
mmmmm
mm ”mm
M- 83
m mm
Wm.
. Mm
- mm
5 may»
an
. m.

 

 

 

     

T

i/ /////// f/fé/éf/«Zfil
lil|4ll
It'll ,7////////// ///////////////4./// ////l

       

 

 

   

l
llW/.7////// //////////// /4.///////////7/// ///7////// All

i //////////////////////////////////7///////////////////////////////fil
Ill
Illvélé 47////// ///4,//4./4. 4747“.
U
.I//:/.////l///l//7/V///////.//.///.///.//

”47W////////////////////////////////////////All/474712I
illitlll..llll.lll.ll
ll y//////////////4¢4./////////|
ill-1.0411111. .
:fi/ ///4.//// /|

///4../..//. // 4447/4... 4474/4

  
      

  

4.5 7 13 25

     

 

 

 

 

   

 

 

    

          

4.5 7 13 25

       
   

    

./l/l./// ////////|A
Inlllillll lllll
//l////////// ////é%///// ///ll|l

ll. .llxlil:
ill/
I 4%??? //////>/|
i.
///

llllilrilllllllll'll I
l//.///////////AI./////////////// 1'

7/////////// 4747/1747. //lA|u
ggégé/zay/fl/élb

i..n2.:ll......l....l....il.i
IV/IV/ /////// //V//// //////|

 

/

    
    

 

     
     

 

   

4.5 7 13 25

  
  

 

   
   

 

   

 

4.5 7 13 25

1

wwwm

 

4.5 71325

4.5 71325

as
QQQQMWVQVW
.§~\\\
m
am
MN.
m mm
mm
. ”m
Mime
mm.
mum. Wm
. .
mm
m mm
%%
In

 

=4

Figure 2.1 - Results from vision testing with an optokinetic device. Comparison of the
percentages of control and rge birds that responded positively or partially to the optokinetic

device, under two different light intensities, (A) 0.22 cd/m2 and (B) 24.5 cd/mz. 1 day of age it
controls and 8 rge; 14 days of age n= 7 controls and 8 rge; 30 days of age n= 6 controls and 8

270 days of

9

6 controls and 6 rge; 150 days of age n= 6 controls and 8 rge

age n= 2 controls and 3 rge.

rge; 60 days of age n

45

2.3.3. Ophthalmic examination and globe biometry findings

Globe enlargement developed in the rge chicks (Figure 2.2 A & B) resulted in a
mild lateral strabismus causing a characteristic exposure of the sclera at the medial
canthus region, bilaterally. The area exposed increased with age to some extent. Clinical
examination showed that the cornea was flatter and the anterior chamber shallower in the
older rge chicks compared to carrier and normal chicks (compare Figure 2.2 C with D
and see Figure 2.3). In the older rge birds the anterior surface of the lens was almost in
contact with the posterior corneal surface (Figure 2.2 D and 2.3 D). The pupillary light
reflex became increasingly sluggish in the rge chicks, although it did not disappear
completely during the time of the study. Fundoscopy revealed that about half the rge
chicks, at approximately 45 to 49 days of age, had a number of white to gray linear
fundus lesions, typically extending from the pecten to the periphery. By approximately 70
days of age, most of the fundi of the rge chicks that were originally pigmented had some
reduction in pigmentation. In all fundi the pecten appeared to atrophy to a certain extent
as the disease progressed. Rge birds commonly developed anterior subcapsular and
cortical cataracts by 4 to 6 months of age (Figure 2.4). The development of cataracts in

some birds interfered with visualization of the fundus.

46

 

control ‘
“and,

Figure 2.2 - Series of age-matched gross ophthalmic photographs from representative rge
and control birds. A) Appearance of freshly enucleated eye globes of a control and an
affected (rge) chick, at 180 days of age. Note the difference in radial diameter of the globes.
B) Freshly enucleated eye globes of a control and an rge chick, at 270 days of age. Note the
difference in axial length of the globes. Profile view of the cornea and anterior chamber of a
control (C) and an rge chick (D), at 180 days of age. Note the flatter cornea and very
shallow anterior chamber of the rge eye. E) Detail of the eye position inside the orbit of a
control and an rge bird at 45 days of age. Note the mild lateral strabismus causing greater
exposure of the sclera at the medial canthus in the rge chick.

47

 

control

 

 

 

 

' ".33 ifir‘K‘lWhfimflfiFé " ;.- l

 

 

 

Figure 2.3 - Series of micrographs of the anterior segment of the eye of representative rge
and control birds at different ages. A) A control chick, at 13 days of age. B) An rge chick, at
13 days of age. C) An rge bird, at 90 days of age. D) An rge bird at 270 days of age. Stain —
hematoxylin/eosin. Note the progressive flattening of the cornea, and shallower anterior
chamber that develops in rge birds with age. By 270 days of age (D) the anterior lens
capsule is adjacent to the corneal endothelium surface. Key: C = cornea; I = iris; L = lens.
Bar — 2 mm.

48

 

 

 

 

 

Figure 2.4 - Gross photograph showing the detail of a hypermature cataract in an rge chick,
at 270 days of age. Note the presence rubeosis iridis, which is most likely indicative of a
lens-induced uveitis.

Morphometric measurements of the globe confirmed the clinical impression of a
progressive globe enlargement both in the radial globe diameter (Figure 2.5 - as measured
on enucleated globes) and in the axial direction (Figure 2.6 — measured by A-mode
ultrasound in the living bird). The mean radial diameter of the globe of rge chicks was
significantly greater than carrier and normal chicks by 33 days of age (P<0.05) (Figure
2.5) and the axial globe length by 92 days of age (P<0.0001) (Figure 2.6). Globe mass
increased in parallel with globe enlargement and by 33 days of age rge globes were

significantly heavier than the carriers (P<0.001).

49

 

 

 

 

T l I T I

0 30 60 90 120 150 180 210 240 270 300.

DAYS l

 

Figure 2.5 - Radial globe diameter of rge (solid line) and control (dashed line) eyes, with
respective standard error bars on each time-point evaluated. Note that the mean radial globe
diameter of the rge eyes became significantly different (greater) than the controls at 33 days
of age (this is before the axial length was significantly greater). 13 days of age (n= 3 rge and
4 control), 33 days of age (n= 4 rge and 4 control), 92 days of age (n= 3 rge and 2 control),
200 (n= 3 rge and 2 control) and 270 days of age (n= 2 rge and 3 control).

 

 

I ’ J

l 18 7 l

l ,6 _, .

l l r 1 {—41 l
I’ I"""""'"""“""""""""I ..... I ..... I

 

 

 

l
’ o 3060901201501230210240270300330360i
I DAYS 1

1

Figure 2.6 - Mean axial globe length of rge (solid line) and control (dashed line) eyes with
respective standard error bars on each time-point evaluated. Note that the mean axial globe
length of the rge eyes became significantly greater than the controls at 92 days of age. n= 21
birds, 9 were rge and 12 were controls. Examined at 1, 7, 14, 21, 28, 42, 49, 70, 77, 84, 92,
98, 280, 308, 336 days of age.

50

To investigate the possibility that globe enlargement was secondary to an increase
in intraocular pressure (IOP) tonometry was performed. There was no significant
difference in IOP between rge, carrier and normal chicks until 49 days of age, at which
time the IOP of rge chicks was lower than carrier and normal chicks (P<0.05) (Table 2.1)
and remained lower for the duration of the study (data not shown). Furthermore, no
morphological abnormalities of the iridocomeal drainage angles were detected
histologically in the rge birds at any age.

A detailed ultrasound study of axial globe measurements showed that the anterior
chamber of rge chicks was significantly shallower than that of carriers from the first time
point measured (13 days of age, P<0.05) and continued to become shallower with age
(P<0.001), confirming the slit-lamp observations. This feature is also shown in the
histological sections (Figure 2.3). The increase in axial globe length in rge chicks was
due primarily to an increase in the vitreous chamber depth, which was significantly
different from the carriers by 33 days of age (P<0.001). The axial thickness of the lens
was not significantly different from carrier and normal chicks at any time-point measured
(P = 0.34).

Pachymetry revealed that CCT development occurs in two phases. The first phase
corresponds to an initial decrease in CCT with the lowest point being reached at around
12.5 days of age. The second phase of corneal maturation is characterized by a gradual
increase in thickness. CCT in control chicks reaches a plateau at 70 days of age and does
not continue to increase. Conversely, CCT in rge chicks was significantly thicker than
controls by 42 days of age (P<0.05) (Figure 2.7), this statistical difference between the 2

groups was maintained for the duration of the study.

51

Corneal curvature (radius) was measured by infrared photokeratometry to
investigate the change in radius detected by ophthalmoscopic and biomicroscopic
examination. The mean corneal curvature (corneal radius) of rge and carrier chicks was
not significantly different at 13 days of age (3.4 i 0.1 and 3.4 i 0.08 mm, respectively,
P=0.79), but by 33 days of age the cornea of rge chicks had flattened resulting in a
significantly greater corneal radius than that of the carrier chicks (4.68 i 0.17 and 3.9 i
0.19 mm, respectively, P<0.0001). By 92 days of age there was further flattening of the

cornea in the rge chicks (corneal radius in rge 6.8 i 0.4, and in carrier chicks 4.8 i 0.2

 

 

 

 

 

 

 

mm,P=0.0015).

280 1
270 ~ T Lyl’i
260 +

E 250 ~ .

1240 4 . "LI-"IE1 -------------------------------- I----I----I
230 —
220 W

o 30 60 90 120 150180 210 240 270 300 330 360
DAYS

 

 

 

Figure 2.7 - Mean central corneal thicknesses (CCT) of rge (solid line) and control (dashed line)
eyes with respective standard error bars on each time-point evaluated. Note that the mean CCT of
the rge eyes became significantly different (thicker) than the controls at 42 days of age. n= 21
birds, 9 were rge and 12 were controls. Examined at l, 7, 14, 21, 28, 42, 49, 70, 77, 84, 98, 280,
308, 336 days of age.

Infrared photoretinoscopy was performed to investigate the effects of the

abnormal globe morphology of rge chicks on refraction. The rge and control chicks had

52

a similar degree of hyperopia at 13 days of age (10.8 i 2.5 and 10.4 i 1.7 diopters,
respectively), by 33 days of age the degree of hyperopia of carrier chicks had decreased
to 4.4 i 1.6 diopters (P<0.001) while that of rge chicks remained significantly greater at
12.0 i 2.3 diopters (P<0.001). Measurements taken at 92 days of age showed that the
degree of hyperopia of control chicks was 4.3 :1: 0.57, while that of rge chicks was 9.8 i

7.4 diopters.

2.4. Discussion

The results obtained in this clinical study confirm that the rge phenotype differs
from those of previously described chick retinal dystrophies such as rd, rdd and beg . The
vision of rge chicks deteriorates over the first few weeks after hatch and is worse under
lower lighting conditions. They become unable to peek at small crumbs of food and lose
vision related responses such as menace and escape responses progressively during the
first month of life. Some rge birds have no visual responses as assessed by the
optokinetic device at one day after hatch, whereas others retain some optokinetic
responses for several weeks. However, even those that retain some optokinetic responses
did not have sufficient vision to allow them to peck at food particles beyond about 30
days of age. The use of the optokinetic device for vision testing has shown to be a
valuable method for vision testing and was used to assess the progressive loss of vision in
the dam chicken

The rge chicks, in addition to vision loss, develop marked changes in globe
morphology. The dimensions of the globe of rge chicks are not different from control or

normal chicks at 1 day of age but they subsequently develop a marked increase in globe

53

size not associated with a change in IOP. A decrease in anterior chamber depth was the
earliest morphological change detected. The increased globe size is primarily due to an
increase in the vitreous cavity volume, initially, causing an increase in radial globe
diameter and then in axial globe length. A flattening of the cornea (increased corneal
radius), and an increase in corneal thickness also developed in the rge chicks. The same
biochemical mediators that are responsible for the globe enlargement may induce the
abnormal pattern of development of CCT observed in rge chicks.

It was possible to document the CCT development in control chicks over the first
year of life. The first phase of CCT development corresponds to an initial decrease with
the lowest point being reached at around 12.5 days of age in both groups of birds.
Maturation of corneal endothelial function may account for the initial decrease in corneal
thickness seen in newly hatched chicks. A similar initial pattern of corneal thickness
development is observed in humans and dogs . The second phase of corneal maturation
was characterized by a gradual increase in thickness. This increase in CCT is probably
due to general growth of the eye as the chick matures. However, unlike in dogs whose
corneal thickness continues to increase into adulthood , CCT in the control group of
chicks reaches a plateau at 70 days of age and does not continue to increase significantly.

The rge chicks had a significantly greater degree of hyperopia than controls by 33
days of age. The refractive errors of rge and control chicks were similar at 13 days of age
(the first time point at which they were refracted), with both groups exhibiting hyperopia.

Normal chicks have previously been shown to be hyperopic at hatch and with
differential ocular growth they then tend towards emmetropia . In this study the

refraction of control chicks examined changed towards emmetropia as expected while the

54

globe of rge chicks failed to undergo normal emmetropization. Although the mean degree
of hyperopia of rge chicks decreases with age, the range of refractive errors within the
rge group appears to increase. The increase in vitreous chamber size and decrease in
anterior chamber depth tend to reduce the degree of hyperopia. It is conceivable that
these latter changes develop as a compensatory mechanism for the hyperopia. The early
increase in the radial diameter of the globe may be responsible for the flattening of the
cornea. The resulting defocus Glyperopia) would be expected to induce a compensatory
increase in axial length.

In experimental ametropies the following biochemical changes take place in the
retina: fall of the level of 3,4-dihydroxyphenylalanine, dopamine and 3,4-
dihydroxyphenylacetic acid; rise of the level of vasoactive intestinal polypeptide (VIP);
rise of the amount of VIP-specific mRNA in amacrine cells within the inner retina and,
lastly, rise of the amount of transforming growth factor [32 . An imbalance of one or some
of these mediators, secondary to the initial retinal dysfunction, might be responsible for
the abnormal eye growth in the rge chick.

In both, mammals and birds, dopamine and melatonin play an important role in
regulating eye growth . Retinal melatonin levels are higher at night in chicks and other
vertebrates and are decreased following light adaptation . Melatonin levels were also
shown to be decreased in the constant light exposure chick . A reduced antagonistic effect
of melatonin on dopamine-induced scleral growth is believed to account for the increase
in globe size in the constant light exposure chick. Further evidence to support this theory
was provided by the finding that intramuscular injections of melatonin partially prevented

changes in globe size in chicks exposed to constant light . The morphological globe

55

abnormalities that develop in rge chicks are similar to those seen in constant light
exposure chicks (e.g. increased corneal thickness, hypempia, radial globe enlargement
and linear fundus lesions) . It is therefore conceivable that melatonin might also play a

role in the morphological globe changes in the rge chick.

56

CHAPTER 3

ELECTRORETINOGRAPHIC FEATURES OF THE rge CHICK PHENOTYPE

3.1. Introduction

The electroretinographic abnormalities of some of the chicken models of retinal
dystrophy have been characterized. The rd chicken phenotype is of a congenital blindness
reflected by a lack of ERG tracings at hatch . The rdd affected birds have an extinguished
(“flat”) ERG by three weeks of age indicating severe vision loss . The main ERG
changes observed in dam chickens are a generalized decrease in waveform amplitudes. It
affects c-waves more than a—waves, and a-waves more than b-waves. Dark-adapted
responses are affected more than light—adapted responses. Data from the intensity
response series of several dam chickens were fitted using the Naka-Rushton equation, as
a result decreased retinal sensitivity and decreased V,W could be observed for a- and b-
waves .

As previously described in Chapter 2, the rge mutation is a naturally occurring
autosomal recessive form of blindness. The affected birds lose functional vision over the
first few weeks of life and then develop secondary morphological eye globe changes.

The present work characterizes the ERG abnormalities of the rge chicken in more
detail and shows that the rge ERG waveforms are abnormal from batch, showing initial

supemormal b-wave responses and then a gradual loss of amplitudes with age.

57

3.2. Material & Methods

3.2.1. Animals

A breeding flock of rge chicks were maintained at the Vivarium of the College of
Veterinary Medicine, Michigan State University under 12 hour light-dark cycles.
Breedings were arranged to produce homozygous affected (rge), heterozygous carriers
and homozygous normal birds. All procedures were conducted in accordance with the
ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and
approved by the Michigan State University All-University Committee on Animal Use

and Care.

3.2.2. ERG recording

To avoid circadian rhythm-induced differences all ERGs were recorded between
9:30 AM and 5:30 PM. Scotopic and photopic white light intensity series ERGs were
recorded from 36 rge, 44 rge-carriers and 6 wild type birds. Different numbers of birds
(minimum of 3 and maximum of 10 birds per group) were studied at different age groups,
ranging from 1 to 500 days of age. The left eye was used for ERG recording. One drop of
1% vecuronium bromide (ESI Lederle, Philadelphia, PA) was administered topically 20
minutes before the experiment to fully dilate the pupil. General anesthesia was induced

and maintained with isofluorane delivered in 1 ml of oxygen per gram of body weight. A

58

pulse-oximeter (Vet/Ox 4400, Heska Inc) was used to record pulse rate and the oxygen
saturation for the duration of the recording. Body temperature was maintained using a
heated pad.

Conjunctival stay sutures of 4-0 silk (Ethicon, Inc) were used to stably position
the eye in primary gaze. A Burian-Allen bipolar corneal contact lens electrode (Hansen
Labs) was lubricated with 2.5% hydroxypropyl methylcellylose (Goniosol, Alcon Inc.)
and placed on the cornea. A ground electrode was placed subcutaneously in the hind
limb.

Full-field (Ganzfeld) flash intensity-series ERGs were recorded with a UTAS-E
3000 Electrophysiology unit (LKC Technologies Inc, Gaithersburg, MD), with the
bandpass set between 1 and 500 Hz and to isolate oscillatory potentials between 100 and

300 Hz.

3.2.3. Electrophysiological test protocols

Scotopic intensity series ERG: Birds were dark-adapted for 20 minutes. Responses from
a series of 12 white flash stimuli (-2.4, -2, -1.42, -1.194, -0.79, -0.39, -0.002, 0.394, 0.85,
1.4, 2.3, 2.8 log cdS/mz) were recorded. For intensities between -2.4 to -0.79 log cdS/m2
10 flashes were averaged and from -0.39 to 2.8 log cdS/m2 3 flashes were averaged.
Inter-stimulus intervals were increased from 1 second at low intensities to 3 minutes at

higher intensities to avoid light adapting the rods.

59

Photopic inten_sity series ERG: Following the scotopic intensity series the birds were light
adapted to a background light of 30 cd/mz, for 10 minutes. The same intensities used for

the scotopic ERG were repeated to record the photopic responses.

30Hz flicker ERG: 30Hz flicker ERGs were recorded using white flash stimuli of 0.4

 

cdS/m2 superimposed on a background light of 30 cd/mz. The flicker response was
evaluated at 1, 7, 14, 28, 80, 130, 160 and 500 days of age in rge and control birds. The
number of rge birds used on each time-point was 5, 8, 4, 4, 2, 2, 2, 2 and 4, respectively.
The number of rge-carrier birds used on each time-point was 4, 9, 4, 5, 2, 3, 2, 2 and 3,
respectively. Additionally, wild type birds were evaluated at 14, 28, 160 and 210 days of
age. The number of wild type birds for each time-point evaluated was: 7, 2, 4 and 5,

respectively.

Evaluation of response to photopically matched colored flashes: In view of the
supernormal responses observed in a preliminary ERG study on the rge chicks, a finding
shared with enhanced S-cone syndrome , we wanted to evaluate whether or not there
were differential responses to different wavelengths of light. Three different gelatin color
filters (Eastman Kodak Company, Rochester, NY) were used with the following peak
spectral transmittances: 400-500 (blue), 540 — 560 nm (green) and 600 - 1100 nm (red)
(Kodak Wratten Filter numbers 58, 29 and 47A, respectively). In order to photopically
match the stimuli in control chicks, intensities of 2.4 log cdS/m2 for the blue filter, 2.6 log

cdS/m2 for the green and 2.8 log cdS/m2 for the red filter were used to record ERGs with

60

a background white light of 30 cd/mz. Control and rge chicks were studied at 2, 14, 30

and 150 days of age.

Visually evoked potentials (VEPs): VEPs were recorded using an exploring needle
electrode inserted into the skin and anchored in the skull above the region of the right
optic lobe. A piece of black tape covered the right eye and the left eyelids were sutured
opened using stay sutures of 4-0 silk (Ethicon, Inc). The reference electrode was inserted
in the Chick’s crown and the common ground electrode was placed on the same position
as for the ERG recordings. 20 flashes at 0.4 log cdS/m2 with a frequency of 2 Hz was
used as the light stimulus. The test was performed in 4 rge and 5 control chicks at 1 and

45 days of age.

3.2.4. Data analysis

The a- and b—wave amplitude and implicit time were measured for each averaged
response. The a-wave amplitude was measured from the onset of stimulus to the trough
of the a-wave; b-wave amplitude from the trough of the a-wave to the peak of the b-
wave. A-wave implicit time was the time measured from the onset of the stimulus to the
time when the maximal a-wave trough occurred and b-wave implicit time from the onset
of the stimulus to the time when the peak b-wave was present. B-wave amplitude as a
function of log stimulus luminance of each individual within a genotype and at each age

was fit by non-linear regression with the 3-parameter Hill equation (Naka-Rushton

61

function). The 3 independent parameters are: the maximum response (Vm), slope (n)

and half-saturation constant (K). This function is as follows:

v = (metn) / (In + Kn),

where V denotes the b-wave amplitude for a given flash intensity I, Vmax is the upper
asymptote of the amplitude versus intensity function, K, the flash intensity yielding a
response amplitude of 1/2 Vm, and n, an exponent affecting slope. In some cases, n is
restricted to 1; n was allowed to vary freely in these curve-fits. K is often considered to
reflect retinal sensitivity since it represents a constant criterion (‘/2 Vm) that determines
where the amplitude versus intensity function is located along the flash intensity axis.
The curves were fit using SigmaPlot 2001, version 7.101 (SPSS, Inc), which employs a

Marquardt-Levenberg algorithm to perform least-squares fits.

An inverse prediction technique was used to obtain the mean b-wave threshold
(defined as the log retinal illuminance necessary to elicit a 5 uV response), i.e. a value of
I that is required to attain a correspondent fixed value of V. Let I(x) be a value such that
V = x. From the 3-parameter Hill equation above this value can be obtained by back-

solving the equation for I as follows:

I(x) = K (x / (Vm — x))l/n

62

Similarly, a 95% confidence interval (CI) on I(x) was obtained from the limits of
the 95% CI on V. Let x195 and xu95 be, respectively, the lower and upper limits of 95%

CI on V, then lower limit of 95% CI on I(x), say I(x,l95) is given by:

I(x,l95) = K (x195 / (Vmx — xl95))1/n

The upper limit I(x,u95) was calculated by replacing x195 by xu95 in the equation

above. Finally an approximate standard error on I(x) was obtained by:

SE(I(x)) = (I(x,u95)- I(x,l95))/4

To compare the maximum response obtained for a- and b-wave amplitude in the
rge group of birds and compare to controls, scotopic maximum a-wave (Am) and b-
wave (BM) response were obtained using the MAX function of numeric entries
(Microsoft Excel version 2000).

These parameters, together with a- and b-wave amplitudes and implicit times for
all flash intensities used, were compared between control and rge birds. Repeated
measures ANOVA was performed to determine statistical significance of the difference
of mean amplitude and latency between genotypes at a given fixed age and intensity, and
between ages for the same genotype at a fixed intensity. If any statistically significant
difference was found the data were further analyzed (P values adjusted) using post hoc

comparisons with Fisher’s or Tukey-Kramer tests. Data were deemed significant when

63

P<0.05. This analysis was performed using statistics computer software (SAS 2001 -
version 8.2, SAS Institute Inc., Cary, NC, USA).

The relationship between the amplitudes of the b- and a-wave was used as an
index for evaluating the electroretinogram according to the technique suggested by
Perlman (1983).

Additionally, in an attempt to investigate whether the rge chicks had any rod-
mediated activity, subtractions of intensity-matched photopic from scotopic a-wave
responses were performed at 1, 7 and 160 days of age and compared between rge and
control chicks using Hood and Birch’s isolated rod a-wave response technique (Hood &

Birch, 1997).

3.3. Results

There were no significant differences between the ERGs recorded from rge-
carriers and wild type birds for any of the parameters examined. Therefore the results
from both rge-carriers and wild type birds were combined and considered as controls.

A comparison of the raw scotopic and photopic intensity series waveforms
(Figures 3.1 and 3.2) shows that the rge birds have an elevated response threshold,
increased a- and b-wave implicit times and a grossly abnormal waveform compared to
the control birds. In particular the rge birds have an apparent absence of oscillatory
potentials (OPS) and c-waves (Figures 3.1 and 3.2). Although OPS were not apparent on
the raw waveforms narrowing the bandpass revealed the presence of markedly reduced
OPs in the younger chicks (Figure 3.3). These changes are maintained at all ages tested,

with a gradual deterioration in amplitudes with age (compare Figures 3.1 and 3.2). In

64

addition to having an abnormal waveform both the scotopic and photopic b-waves of the
younger rge chicks have greater amplitudes than those of age-matched control birds in
response to flashes of light brighter than 0.9 log cds/m2 (Figure 3.1).

These differences are further analyzed, quantified, averaged and statistically

compared below.

65

4.42 l - . . _ _ . . . . , ,,,, ,
-1.19 > , " : * , _ . ~ ' ,. .. — ~~ -
0.79 . ’ _ - . a.
0.39 ‘ "

 

 

. ® .' 100uV \/ 100 UV
U

.24 ‘ _..., .-...

.1_42 a. -,.. .. . .. fl .. .. A ...- . _ . . M, ..
“9 p a , .. , .. .. .. ,. ,.
0.79 " ‘

0.39

)

Intensity (log cdS/mz)
\
l
l
i
l

 

 

 

' ® ‘00 av

0 50 100 150 200 250 0 50 100 150 200 250

. © 100 .v
l

 

 

 

 

Figure 3.1 - Representative scotopic (A) and photopic (B) ERG recordings from a control bird at
7 days of age. Light intensities (log cdS/mz) are indicated in the figure. Note the high a-wave
amplitude, reduced latencies of a-wave and b-wave, high CPS and the presence of the c-wave
with stronger flashes. The c-wave becomes faster with light adaptation. In the control bird there
is an increase in threshold between scotopic (A) and photopic (B), which is normally observed in
other species as well. C) Representative scotopic ERG recordings from an rge bird at 7 days of
age. Light intensities as for 3.1 A & B. Note the low a-wave amplitude, increased latencies of a-
wave and b-wave, low CPS and absence of a c-wave with any flash intensity. Also note the high
threshold for eliciting an ERG response. D) On the photopic ERG recordings from the same rge
bird it is possible to observe similar wave amplitudes and that apparently the ERG threshold does
not change from the scotopic series. Also note the high overall threshold for eliciting an ERG
response on C and D compared to the rge bird on A and B.

66

 

Intensity (log cdS/mz)

 

 

 

Figure 3.2 - Representative scotopic (A) and photopic (B) ERG recordings from a control bird at
270 days of age. Light intensities (log cdS/mz) are indicated in the figure. The same features
observed in the control bird on Figure 3.1 are observed here. Comparing Figure 3.1 A and B with
Figure 3.2 A and B it is possible to note that even higher a-wave amplitudes are observed as the
birds get older. Also even more reduced latencies of a-wave and b-wave with higher OPs are
noted at this age. C) Representative ERG recordings from an rge bird at 270 days of age.
Comparing Figure 3.2 C and D with Figure 3.1 C and D, it is possible to observe the deterioration
of the ERG response with even lower a-wave amplitudes, even more increased latencies of a-
wave and b-wave, very low CPS and absence of a c-wave with any flash intensity. The b-wave
amplitude is no longer supemorrnal but actually lower than the controls at this age. Note the

 

 

 

 

N\
/ ‘1 ‘ ..
I’ ‘x
- ’I ' ‘ \k a/
1i ' \IWMVNM’
1,
@ mouv ‘ WOW
0 50 100 150 200 250 0 50 '00 150 200 250
i
._.. i, s l i
l
l
1
1m ‘ I
W i . IWuV
f fifi fii‘,.... ..... -._._ .VW...
° 5° 10) ‘53 2m 2!) 0 so ‘00 150 200 250

l
l
i
i

 

 

 

 

higher threshold for eliciting an ERG response.

67

t'nom

-1o ‘
-15 “L 4 _
'20 i

-25 _'_T_’__" _.._., ..__ ,_.. _~__.___._. V—v-~_,__.__,__,_ H..__,__._,__v~___.___... ,-.._ -

0 50 1 00 150 200 250 300

Time (msec)

Amplitude (uV)

 

 

 

 

 

Amplitude (uV)
c'n Oi

-25‘ a T flq+ws__

' O 50 1 00 1 50 200 250 300 '

Time (meec)

 

Figure 3.3 - A) Representative scotopic isolated oscillatory potentials (OPS) of an ERG
recording from a control bird at 1 day of age, using the light intensity of 2.8 log cdS/mz. B)
Representative scotopic isolated OPS of an ERG recording from an rge bird at 1 day of age,
using the light intensity of 2.8 log cdS/mz. Bandpass 100 and 300 Hz. Note the obvious
difference in the amplitude of the OPS. This difference was observed in all the ages studied
in all light intensities. On Figures 3.1 and 3.2 it is possible to observe the same difference
using different light intensities.

3.3.1. A-wave responses

The a-wave responses were analyzed in a number of different ways: the a-wave
threshold was investigated using a 5 [1V threshold criterion; the slope of the leading edge
of the a-waves were compared; the maximal a-wave amplitudes were calculated; and a-
wave implicit times were compared; finally a subtraction of intensity matched scotopic

and photopic a-waves was performed.

68

3.3. I.i. A-wave threshold

The scotopic a-wave threshold (Figure 3.4) of rge birds was significantly elevated
from the earliest time point (1 day of age: -0.32 :t 0.12 log cdS/m2 for rge birds and -1.28
i 0.14 log cdS/m2 for control birds, P=0.0164). It became further elevated over the first
two weeks of age and then reached a plateau, over the same time period the scotopic a-
wave threshold of controls decreased. The overall scotopic 5 uV—criterion a-wave
threshold in rge birds considering all time points was 0.16 i 0.37 log cdS/m2 whereas
that of controls was -1.28 :1: 0.14 log cdS/m2 (P<0.0001).

At one day of age the photopic a-wave SuV-criteria threshold of rge birds was
greater than controls, although the difference was not significant. The photopic a-wave
threshold of the control birds decreased with retinal maturation while that of the rge birds
increased. By 7 days of age the photopic a-wave threshold of rge birds was significantly
greater than that of controls (0.15 :t 0.04 log cdS/mz, and -0.71 i 0.11 log cdS/m2
respectively, P=0.0354) and remained significantly elevated for the rest of the study.

Interestingly the mean overall photopic a-wave SuV-criteria threshold of rge birds

was not significantly different from the scotopic a-wave threshold of rge birds.

3. 3. 1. ii. A-wave amlitudes

The mean a-wave intensity: response curve of young rge chicks was shifted to the
right. At the brightest intensities the a-wave of controls had reached a plateau, whereas it

appeared that the a-wave responses from the affected birds was still increasing at the

69

brightest flash and might have increased further had brighter flashes been available
(Figure 3.5).

The overall (considering a-wave amplitude at all intensities) scotopic and
photopic mean a-wave amplitudes of the rge birds compared to controls were
significantly decreased at all age points (P<0.0001). However, the mean of the individual
maximum a-wave amplitudes recorded from the scotopic and photopic intensity series
studies (Am) was not different between the rge and control group during the first 2
weeks of life (a plot of the scotopic Amax is shown in Figure 3.6). The control chicks
showed a maturation of the mean (of all intensities) scotopic and photopic a-wave
amplitude and scotopic Amax over the first few weeks of life; whereas the rge chicks
showed an initial increase in the mean a-wave amplitude, but not Amax from 1 to 7 days of
age (P=0.0145) after which, further maturation was halted and a slow deterioration
occurred in the mean a-wave amplitude and in Am (from 14 to 500 days of age, P<0.05.

Figure 3.6).

3.3.1.iii. SlQpe of the a-wave leading edge

The slope of the leading edge of the a-wave of rge chicks was consistently
shallower than that recorded from control birds at the same flash intensity and this

difference became more apparent with age (Figures 3.1 and 3.2).

70

3.3.1 .iv. A-wave implicit times

The scotopic a—wave implicit time was increased compared to controls at 1 day of
age (Figure 3.5) whereas the photopic a-wave implicit time was increased mostly at the
higher intensities. However, when the overall mean a-wave implicit times were
compared at 1 day of age the rge chicks were shown to have a greater overall mean
scotopic implicit time than controls (16.66 i 1.65 mSec and 12.12 i 1.55 mSec,
respectively, P<0.0001). The a-wave implicit times of rge birds became greater with age

(data not shown).

71

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

F j
1 1.9 7
' 77 A 1.9
E 1.4 J (é
‘ if) a 1.4
'U 0.9 i '0 09
o r._ o .
- 0,4 ,, __ ”Mud-
I390 01 i‘fi’” {I I “l g” 0.4
V . v
\ '0.1 f\v”"£"'~\_““~‘
. E‘ 0.6 ”3: fi% NH“:
2 m 0.6
1::
I 2 .11 ® 8 -11
c: __ z: .
1— 4.6%... :1. __ .1- ”-16
l -21 {L ‘L T .- ‘i -- I T *r T T
1 ’ l ‘ .. 4.1%? T1 1 T
-26 L ,L .L -
. T Y 7 I Y Y fl -2.6 I f ‘ j Y t fi
0 100 200 300 400 500 6G) 0 100 XX) 3m m 5m 6m
Timudm)
l Them-p)
l
L * rge . control + rge + control
If 1 9 ' 1.9
‘ (1‘ 14 /l‘/_/{ a? 1"
E ’’’’’’’’’ E
l :J} 0'9 H . .~—~“”““‘I""{ «h 0.9 /;
. '8 0.4 ' '8 0.4 A {wax/f
1 co m I x‘ ’1’",
l .2 -0.1 © 2 .01 \I @
a 7' _ v .
! Q -O.6 1% , b 06‘ T
1]) " ou— . ,
l S -1.1 l g 1: l l
l E 1' E -1.1T l
I— .16 L I -1.6« I
I T
! .201 l ~21«
’1 '26 f Y I l v f fi -26 fir , r I Y ‘
} 0 100 200 300 400 500 600 0 1m m an ‘m w) EX)
l Time (days) (m)
+ rge + control + rge + control

 

 

 

 

 

 

 

 

Figure 3.4 — Scotopic and photopic threshold using a 5 uV-criterion. Mean scotopic threshold for
a-wave (A) and for b-wave (B) with respective standard error bars (1x :t SEM) for all the age
groups studied. The black continuous line with triangles represents the mean threshold intensity
(log cdS/mz) for the rge birds. The gray dashed line with circles represents the mean threshold
intensity (log cdS/mz) for control birds. The mean photopic threshold, using a 5 uV-criterion, for
a-wave (C) and for b—wave (D) with respective standard error bars (1x :t SEM) for all the age
groups studied is also shown. The black continuous line with triangles represents the mean
threshold intensity (log cdS/mz) for the rge birds. The gray dashed line with circles represents the
mean threshold intensity (log cdS/mz) for control birds. Note the difference in threshold between
the rge and the control group. In the rge group the threshold is always higher. Also, note that in
the rge group the mean overall difference between photopic and scotopic thresholds is not
significant (P>0.05). When the age groups were analyzed separately, this difference was only
significant (P<0.05) in one age group (500 days of age) (*).

72

 

 

 

 

 

 

 

 

 

 

 

        

 

 

 

 

 

 

 

 

‘00 330 2110 ~ —— — «to
.m b so
2110

.mt
am “’° .-
t'. ‘50 J»

E
3 no mo» .2..
2. +100 E

00“ u—
< m E

mo» 50

g- . . . ..... . . 1 00 00
20 -1.4 -12 08 04 oo 04 09 1.4 1.9 24 28
Intensity - cdS/m2
.mor— m a h w --_s fl...“ zno. —- —_-- _.
410 EX)
>50

4&0» an.

400» :no 1001 no 8
2% m E
.3 no so mo an E
g n—
.z:: no no» I:
'3'. loo 1 mo 32
E no mo» -
< , .3

4m- 50 0° < no

.m. mo.

00- . . . . . . . .fi 00 oo ees—r . . . g - . . . 00

120 4.4 ~12 08 04 oo 04 09 1.4 1.9 24 28 20 4.4 -12 08 04 (I) 04 09 1.4 1.9 24 28
Intensity - cdS/m2 Intensity - cdS/m2

 

Figure 3.5 — Scotopic and photopic intensity: response (I:R) plot. Mean scotopic (A) and
photopic (C) a-wave amplitude and latency, with standard error bars (1x 1 SEM) at 7 days of age,
using an intensity-series of flashes in dark-adapted rge and control birds. The black solid line
represents the mean a-wave amplitude curve of the rge birds. The black dashed line represents the
a-wave amplitude curve of controls. The gray solid line represents the a-wave latency curve of the
rge birds. Gray dashed lines represent the a-wave latency curve from controls. Note the increased
latencies between rge and controls. Additionally, note the increased threshold and difference in a-
wave amplitude with increasing intensities between the rge and control birds (n=7 control and 7
rge birds). The mean scotopic (B) and photopic (D) b-wave amplitude and latency, with standard
error bars (1x + and - SEM, respectively) at 7 days of age, are also shown, using an intensity
series of flashes in dark-adapted rge and control birds. The black dashed line with markings
represents the mean b-wave amplitude curve of the rge birds. The black solid line represents the
b-wave amplitude curve of controls. The gray solid line represents the b-wave latency curve of
the rge birds. The gray dashed line represents the b-wave latency curve from controls. Note
increased latencies in the rge birds. Additionally, with higher light intensities (1.4, 1.9 and 2.4 log
cdS/m2) b-wave amplitude is higher in rge than controls (n=7 control and 7 rge birds) (* =
P<0.05).

73

 

 

 

 

I '20 J g ,M: l
' We: """"""""""" W , l
401 M1 ....1 _. 1 » r .
. i 6° 1 1E“~1'--"’i\r/ 1
I .8 -80 1 " i 1
l 3 -100 «1 ** *
l ‘5" \ * l
1 < ‘120 7 \;\ |
. -.... m , * f/gfl1 .
l -160 1 “ 'Kr—iwwm‘I/f 1
1 180 4—1' v , w w r v v ' 1 7 r v -—r T v r r v fl v T v v r rfi . Y r r a 1 Y E
1 O 50 100 150 200 250 300 350 400 450 500 550 1

 

l ,-_

I «meantime + rge/rge ‘

1
As- (days) 1
l
l

 

 

Figure 3.6 - Mean scotopic Am, with respective standard error bars (1x :1: SEM) of all the age
groups studied. The black solid line represents the mean Am amplitude of the rge birds. The gray
dashed line represents the Am of the control birds. Note the decay of the A“, response in the rge
group from 14 to 500 days of age. (n=6 control and 5 rge birds) (* P<0.05).

3. 3.1.v. Subtraction of intensity matched photopic a-wave from scotopic g-wave to

reveal rod-mediated a-wave response

Subtraction of intensity matched photopic and scotopic a-waves revealed that at 7
days of age the rge chicks had a very low amplitude subtracted a—wave (data not shown).
The amplitude of the subtracted a-wave further decreased with age until it had ahnost

disappeared by 160 days of age (Figure 3.7).

74

 

 

 

 

-100
43)
440
Jm

 

-140 .
.1m -

 

Amplitude (uV)

 

 

 

 

180. .1801

- + w- - “. -_,-.- u -__ amo~~ie _ M_fi—_~.~_g F ,_
mo , a. , 3011

o 5 o 15 253011 0 5 10 15 20 a; 30

Time Qnsec [Time (msec)|
IH—photopic a-wave-I-I-I— scotopic a-wave -. . subtracted: data

 

——_——_l

_ "A Amplitude (pV) ‘ _
-mmrflr

 

 

 

 

 

 

 

Figure 3.7 - Intensity matched (2.8 log cdS/mz) a-wave tracings from a control (A) and an rge
chick (B) at 160 days of age. The subtraction technique was applied. The continuous gray line
represents the scotopic a—wave and the continuous black line represents the photopic a—wave. The
dashed line was obtained by subtracting the photopic a-wave data from the scotopic one. This
results in a rod-derived hypothetical (subtracted) a-wave. Note the difference in amplitude of the
subtracted a-wave between the control (A) and the rge chick (B). The subtracted data from the
rge chick has very low amplitude, appearing almost like a straight line. This indicates clearly that
the ERG a-wave of the rge chicks is mostly derived from cones.

3.3.2. B-wave responses

The b-waves of the rge birds were analyzed and compared with controls in
several different ways: the scotopic and photopic b-wave thresholds were investigated
using a 5 uV-threshold criterion; b-wave amplitude intensity:response (I:R) curves were
plotted and the first limb of the curve analyzed using the Naka-Ruston formula, and the
maximal b-wave amplitude of the second limb of the I:R curve investigated, and the b-

wave implicit times were compared.

75

3.3.2. 1'. B-wave threshold (Figure 3.4)

The combined scotopic SuV-criterion b-wave threshold of all ages of rge birds
tested (0.92 i 1.20 log cdS/mz) was significantly increased compared to control birds
(0.13 i 0.15 log cdS/mz) (P<0.0001). There was a significant difference in the 511V-
criterion scotopic b-wave threshold of rge birds (-0.316 :1: 0.223 log cdS/mz) compared to
controls (-1.69 t 0.33 log cdS/mz) at 1 day of age (P=0.0017).

In a similar manner, the overall photopic b—wave threshold (SuV-criterion) in rge
birds (0.36 :t 0.35 log cdS/mz) was also significantly greater than controls (-0.74 :1: 0.58
log cdS/mz) (P<0.0001). There was a significant difference in the SuV-criterion
photopic b-wave threshold of rge birds (0.69 :t 0.30 log cdS/mz) compared to controls (-
0.49 3: 0.18 log cdS/mz) at 1 day of age (P=0.0395).

Interestingly, the overall mean threshold tested was not significantly different

within the rge birds between scotopic and photopic 5 uV-criterion for b-wave.

3.3.42. ii. Naka-Rushton fitting of the first limb of the I:R curves (Figure 3. 8)

The Naka-Rushton equation successfully fitted the data points below a light
intensity of 0.9 log cdS/mz, and thus below the "second limb" of the response function in
both rge and control birds. Cone activity is thought to contribute to the second limb of the
response function after the response plateau. Therefore, only b-wave amplitude data

below a flash intensity 0.9 log cdS/m2 were used for fitting the Naka-Rushton function.

76

Thus, the data points representing the second limb of the intensity:response function were
excluded.

A correlation coefficient is a number between -1 and l, which measures the
degree to which two variables are linearly related. In the regression analysis performed
the correlation coefficient (R2), which is a measure of the goodness of fit, resulting from
the selected data for each individual was kept as close as possible to 1. This was
successfully accomplished for the majority of the data of the control birds, with resulting
R2 values around 0.96 to 0.99. However, for the rge birds the correlation coefficient of
the fit was still positive but usually lower, with Rz-values around 0.69 to 0.80.

Vmax values correspond to the mean maximal amplitudes of the b-wave at the first
limb of the intensity:response plot. Vmax was significantly lower in the rge chicks
compared to controls at all age points (e.g. at one day of age Vmax was 20.75 i 13.86 11V
and 82.33 :1: 24.62 uV, for rge and control chicks respectively, P<0.001). The V"m
values in control chicks increased by a magnitude of 2.75 times with age over the time-
points studied (P=0.0001); whereas the Vm of rge birds decreased with age and by 14
days of age was significantly lower than at 1 day of age (P=0.007).

The mean K parameter value (the intensity required to elicit a b-wave of l/2Vm,,,,)
when considering all of the age points in the rge birds was elevated (1.05 i 0.25 log
cdS/mz, for rge birds and 0.21 i 0.14 log cdS/m2 for controls. P<0.0001). The first age
group studied in which the difference in K parameter value between rge and control birds
was statistically significant was 56 days of age (P=0.0053) (Figure 3.8). At this age the K
parameter was -0.79 :1: 0.30 log cdS/m2 for control chicks and -0.26 :l: 0.13 rge chicks.

The K parameter of rge birds further increased after this age (data not shown).

77

The overall n parameter, which is an exponent that affects the slope of the "first
limb" component of the b-wave intensity/response function curve, in the present study
was 10.78 i 1.07 in the rge group, whereas the control group was 1.38 i 0.69, P=0.0001.
The n parameter was statistically different between rge and controls at 1 day of age, when
the mean n value was 20.38 i 9.94 for the rge group, 1.38 i 0.69 for the control group,

P=0.0004.

 

 

 

 

   

1

1

1 '1K 1 1 + 1 . 1
-2 -1.42 -1.19 -0.8 -O.4 O 0.394 0.857 1.362 1.903 2.386 2.823

1

l

1

 

 

Intensity (cdS/m?)

 

Figure 3.8 - Naka-Rushton fit parameters. Scotopic b-wave intensity:response function from rge
and control chicks at 56 days of age (rge = black open triangles; controls = gray open circles).
The superimposed curves (continuous lines) represent the predicted the rod—b-wave derived from
a Naka-Rushton model (rge = black with triangles; controls = gray with circles). Vrm = maximal
rod b-wave amplitude (dashed circles); K = log intensity at half maximal rod response (1/2 me)
(open arrow) (n=6 rge and 9 control birds).

78

3.3.2. iii. Maximal amplitude of the b-wave - second limb of the intensity:response
plot (BM) ( Figure 3. 9)

The second limb of the b—wave intensity:response plot of younger rge birds
(responses to flashes greater than 0.9 log cdS/mz) shows a substantial increase in
amplitudes compared to the first limb, whereas the responses of control birds plateau
after the first limb (Figure 3.5). At the higher intensities in younger rge birds this leads to
a supernormal b-wave. A plot of the mean maximum b-wave response (BM) against age
(Figure 3.9) reflects this supernormal b-wave response. The value of 13mm‘ of rge birds is
significantly greater than controls from 7 days of age (192.19 :t 53.75 uV and 77.81 i
15.93 11V, respectively, P=0.0079) to 28 days of age (196.80 i 22.56 “V and 114.47 :1:
28.89 1.1V, respectively, P<0.0001). After that age the mean scotopic Bmax values of rge
birds decrease progressively until the last age group evaluated and is significantly lower
than controls by 130 days of age (118.50 i 33.23 uV and 190.60 i 42.86 uV

respectively, P=0.0376).

79

 

 

 

l
l
l
l 300 “l
l .
l 25°1 I
I A * at I
' 3 2°° l1?“ 1 1 l
l g 150 Js' I q. I
3 E' I II _

9: g i ' ’ ,
t .5. 100 J I f I i - i *
l E ii I ‘ t- I.
I < 50 -; ‘1- — _ _. t
l 1
‘ 0 50 100 150 200 250 300 350 400 450 500 550 I

 

 

 

 

Figure 3.9— Mean scotopic BM, with respective standard error bars (1x i SEM) of all the age
groups studied. The black solid line represents the mean Bmax amplitude of the rge birds. The gray
dashed line represents the Bum of the control birds. Note the supernormal B,m in the rge group
from 7 to 28 days of age. Additionally, note the deterioration of the Bu,“ in the rge group (* =
P<0.05).

3.34. iv. B-wave implicit times

A plot of b-wave implicit time against flash intensity in young chicks shows that
at lower intensities the implicit time is similar to controls but becomes increased in
parallel with the development of supernormal amplitudes in response to higher flash
intensities (figure 3.5). However, the mean implicit time of the b-waves of rge chicks
when combining the results from all light intensities used was significantly greater than
controls from 1 day of age (52.73 i 6.98 mSec and 37.33 i 8.66 mSec, respectively,
P=0.0001). The b-wave implicit times of rge chicks further increased with age (data not

shown).

80

3.3.2.v. Ratio of b-wave to a-wave amplitudes

The overall ratio of b- to a-wave amplitudes was greater in the rge birds compared

to controls group (2.28 i 0.60 compared to 1.08 i 0.20).

3.3.3. ERG response using color filters

The a- and b-wave ERG amplitudes generated with the use of different color
filters were analyzed. Control birds showed no statistically significant difference in a- or
b-wave amplitudes in response to any of the different filters that had been photopically
matched at any of the age groups studied (P>0.05).

However, at 14 days of age the mean a-wave amplitude of the rge chicks captured
with the use of the red filter, -75.30 i 6.64 uV (wavelength of 600-1100 nm), was
significantly greater than the mean a-wave produced with the green filter, -57.92 i 6.08
uV (wavelength of 540-560 nm) (P=0.046). The mean a—wave amplitude obtained with
the red filter at this age was also significantly greater than the one obtained with the blue
- 49.26 i 12.70 ”V (wavelength of 400-500) (P=0.0127) (See Figure 3.10).

A similar result was observed at 30 days of age. The mean a-wave amplitude of
the rge chicks with the use of the red filter, -92.01 i 16.97 11V (wavelength of 600—1100
nm), was significantly greater than the mean a-wave produced. with the green filter, -
55 .65 :1: 5.02 uV (wavelength of 540 — 560 nm) (P=0.0414). The mean a-wave amplitude

obtained with the red filter, at 30 days of age, was also significantly greater than the one

81

obtained with the blue -56.3 i 4.80 1.1V (wavelength of 400-500) (P=0.0434) (See Figure
3.10)

At 150 days, the difference observed in the results for the red filter in the rge
group was no longer significantly different (P>0.05).

The ERG mean b-wave amplitudes were not significantly different within the rge

group for any of the wavelengths tested. The same was observed in the control group

(P>0.05).

82

J -140- ®

 

.120,

l 100 " t
. 3‘ - ..

5

l '8 303

1 §
l 3 6°}
l S 40,.
l
l E] E
l OIL
‘ ‘1 blue green red lblue green re ‘ blue green red )blue green red

2 l 14 30 . 150

 

Amplltude (w)

'blue green red blue green red blue green red blue green red

1 2 14 30 150

 

Figure 3.10 - Mean a—wave amplitudes (1x i SEM), photopically matched using stimuli of 3
different peak spectral transmittances: 400-500 (blue), 540 - 560 nm (green) and 600 - 1100 nm
(red). Note that the control birds (B) showed no statistically significant difference between any of
the different filters studied (P>0.05). Within the rge group (A), however, the a-wave amplitude
obtained with the red filter was significantly higher than the remaining filters at 14 and 30 days of
age (P<0.05) (n = 3 rge; 5 control chicks).

83

film ll ll

3.3.4. 30Hz flicker ERG comparison (Figure 3.11)

The mean amplitude of 30 Hz flicker of rge chicks was considerably lower than
controls at 1 day of age (rge = 9.32 2': 3.25 uV and control birds 2 39.72 i 10.68 uV,
P=0.0003). The amplitude of response in the rge birds deteriorated with age. The
overall mean amplitude of the 30Hz flicker ERG response in rge chicks was -5.60 i 4.20
uV compared to 90.14 i 11.13 uV for controls (P<0.0001).

The overall 30Hz flicker ERG implicit time of the rge group was also abnormally
increased as compared to controls, 18.86 i 11.44 mSec and 14.92 i 2.23 mSec,
respectively (P=0.0498). The difference in mean implicit time of rge chicks was
significant from 7 days of age (rge chicks 19.68 :t 1.73 mSec control chicks 16.78 i 1.74

mSec, P=0 .0037). This difference only increased after that age.

3.3.5. VEPs (Figure 3.12)

In the control chicks, the waveforms of the VEPs were composed of an initial
positive wave, followed by a second negative wave followed by a few small additional
wavelets (Figure 3.12) and are similar to those of a previously described study using
chicks . The responses of the VEPs in the rge chicks were similar to those in the controls

in shape but with very small amplitudes from 1 day of age (Figure 3.12). The amplitude

of the VEPs further deteriorated with increasing age, although cortical activity could still

be recorded at 45 days of age (data not shown).

 

 

 

 

  

 

 

 

 

l
I 20 j x :
5 l a" ‘5‘ i
5 'i\ iv“ 1 a". i
1 o a --"-l. a ‘ '
v _; 3 i .
l 8 -2o - .5, E5 .5. l
l e l i g ,
5 < 4° 5 g .5; .5 l
5 £5 53 55 l
l 5%; ' l
-60 1 ‘53? 5
I
-80 . a , , . . 1
0 50 100 150 200 250 300

Tlme (mace)

l + rge —%— control

 

 

 

 

Figure 3.11 - A comparison of 30 Hz flicker tracings using the flash light intensity of 0.4 log
(.‘dS/m2 at 1 day of age. The rge chicks are represented in black solid lines and the control birds in
gray solid lines. The comparison reveals that rge chicks have lower amplitudes than the control
group (n = 5 rge; 4 control chicks).

85

r_____i_~____ ,M,____f____. ‘ __ -_.____ _hi A-_______._

a, m
o C
1

4o -
20 ,

 

 

 

Amplitude (uV)

lb
0 o
l 1

 

 

0 50 1 00 1 50 200 250 300 _

I

l .o 5.“... s
l

1 Time (msee)

l

 

 

Amplitude (uV)
N
o

 

l
o 50 100 150 200 250 300 5
|
1

“me (meec)

 

 

Figure 3.12— A comparison of the VEP response at 1 day of age in a rge (A) and a control
(B) chick. The recording electrode was placed at the region of the right optic lobe. Note that
the VEP response in the rge chick had very small amplitudes at that early age.

3.4. Discussion

The rge chick has unusual ERG changes, with an abnormal shape of ERG
Waveform from hatch that slowly deteriorates with age but is maintained until well after

tlhe age at which vision loss occurs. These changes are very different from those

86

described in other chicken models of retinal dystrophy such as rd, rdd and dam and
appear different to those reported in retinal dystrophies in other species.

The waveform of the ERG of rge chicks from hatch has very reduced CPS and a
lack of c-waves from both photopic and scotopic responses. The slope of the leading
edge of the a-wave is reduced and at lower intensities the a-wave has an increased
implicit time. The normal chick a-wave intensity:response (I:R) plot shows a typical
sigmoid curve, whereas the a-wave I:R plot of the rge chick is shifted to the right,
reflecting an elevated response threshold and shows a rising phase but no plateau even
with the highest intensities tested. It seems likely that brighter flashes would be required
to fully saturate the a-wave in the rge birds reflecting the reduced photoreceptor
sensitivity compared to controls. The peak recorded a—wave amplitude of the rge birds is
not different from controls in the first week after hatch, but by 14 days of age the
maximum a-wave recorded at the light intensities used is significantly lower than controls
and continues to deteriorate with age. Scotopic and photopic a-wave thresholds of
affected birds are very similar. Subtraction of photopic a—wave from scotopic a-wave
suggests that the younger birds may have some rod-mediated responses, although these
are markedly lower than controls and disappear with age. Application of the Naka-
Rushton formula to the first phase of the b-wave response, which is intended to model the
retinal rod driven responses, showed that Van“ was markedly reduced in the rge birds.
The K value, a reflection of retinal sensitivity, was not significantly different from
controls initially. These results show that the rge chicks have an initial loss of rod
responses. The initial maintenance of the K value suggests that this may be due to a loss

of function in the majority of rod photoreceptors with the remaining functional rods

87

having a relatively normal sensitivity. Modeling the first phase of the b-wave I:R plot
has usually been applied to rod-dominated retinas. The validity of using this technique in
a retina with a higher ratio of cones to rods, such as the chick retina, has not been
established. Additionally, modeling scotopic b-wave responses from rge birds is
complicated by the low amplitudes of the first phase of the I:R plot. Attempts to compare
the slope of normalized photopically subtracted scotopic a-waves using the method
suggested by Hood and Birch (1996), were not considered valid because of the very low
amplitude of the resulting subtracted a-wave in the rge bird prior to normalization
compared to that obtained in controls. The initial reduction in rod photoreceptor
responses correlates with the results from vision testing of the rge birds, which showed
that they have a more severe loss of visual function in the early stages of the disease
under lower lighting intensities (Chapter 2).

The rge b-wave has a smoother and broader waveform than normal, partly
accounted for by the reduction in OPs. The normal chick scotopic and photopic b-wave
I:R plots have a typical sigmoid curve. In the rge chicks both scotopic and photopic b-
wave I:R curves are sigmoid-shaped but are shifted to the right and, in the younger
chicks, show an abnormally elevated b-wave amplitude with flash intensities above 0.9
log cdS/mz. However, this elevated b-wave amplitude significantly deteriorates with age.
Investigation of the b-wave to a-wave ratio using the method of Perlman (1983) shows
that the ratio for control chicks is 1.08 which is within the normal range of 0.8 to 1.2
reported for other species. The b-wave : a-wave ratio of the rge birds in the first two
weeks of age was abnormally high (2.28) and is a reflection of the supernormal b-wave.

There are several reports in the literature of human patients having similarly abnormally

88

enhanced ERG waveforms . The ERGs of these patients typically had delayed b—waves
that were supernormal in amplitude to brighter flashes but lower in amplitude and
markedly delayed in response to weaker flashes. Further studies of some patients with
supernormal b-waves and animal models showed that this can result from an alteration in
the ratios of photoreceptor types. Examples include humans and animals with mutations
of genes coding for transcription factors important in determining the fate of
photoreceptor progenitor cells, such as mutations of the NR2E3 and er genes. The
former is responsible for enhanced S-cone syndrome in humans and the rd7 mouse
phenotype . Affected humans and mice have increased numbers of S-cones and reduced
rod function . Other inherited diseases such as Best's macular dystrophy , cystinsosis ,
albinism , and non-inherited conditions such as hyperthyroidism , corticosteroid
administration , optic atrophy , optic nerve hypoplasia and central retinal vein occlusion
can cause supernormal b-waves. To investigate whether the rge chick had an alteration in
the ratio of different cone types, as seen in animals with NR2E3 and er gene mutations,
ERGs were performed using a series of different colored flashes that were photopically
matched in normal control chicks. None of the responses to colored light flashes showed
increased amplitudes compared to controls and the only difference seen was that flashes
of long wavelength light produced differentially larger a-wave amplitudes than the other
colors in young rge chicks, but this effect was lost with increased age. As the short-
wavelength flashes of light did not result in increased amplitudes that would be typical of
NR2E3 and er mutations this suggests that the rge phenotype has a different
pathogenesis. The differential response to the long wavelength flashes of light may be

due to slower loss of function from the long wavelength cones compared to other cone

89

types rather than a developmental abnormality in ratios of cone types. The responses of
the rge chicks to brighter flashes decrease with age showing loss of cone photoreceptor
mediated function as well as rod responses. However, marked reduction in responses
does not coincide with the clinical loss of vision that was previously shown (Chapter 2).
Investigations of the VEPs of rge chicks showed that transmission to the visual cortex
was markedly reduced from an early age even though the ERG responses to bright lights
are well maintained in the early stages of the disease. The VEP changes appeared to
more closely correlate our previous study of vision loss using an optokinetic device
(Chapter 2). Reduced inner retinal function is reflected by the markedly reduced CPS and
the very reduced amplitude and increased implicit time of the 30Hz flicker responses.
Thus the ERG changes in the rge chick suggest that from an early age there are markedly
abnormal responses from all retinal layers.

The obvious absence of c-waves may reflect an abnormality in retinal pigment
epithelium-generated electrical fields. The photoreceptor responses are abnormal, with
rods being more severely affected than cones initially. The abnormal b-wave shape may
reflect abnormal transmission from photoreceptors to the second order neurons or
abnormalities in the cells responsible for generation of the b-wave. Additional evidence
of inner retinal dysfunction is provided by the lack of CPS and abnormal flicker responses
and lack of central transmission of visual information.

Previous histopathological examination of the central visual pathways of rge
chicks did not reveal any abnormalities. This observation supports a retinal origin for the
blindness (Chapter 2). Further studies to investigate the abnormally shaped and

supernormal b-wave in the rge chick would require pharmacological dissection studies to

90

 

 

SC

see which cells are responsible for the generation of the abnormal waveform in the rge
chick. Such investigations may shed light on the pathogenesis of this apparently unique

retinal dystrophy.

91

CHAPTER 4

PHARMACOLOGICAL DISSECTION OF THE rge ELECTRORETINOGRAM

4.1. Introduction

As discussed in Chapter 1, the electroretinogram (ERG) is widely used to assess
sensory retinal function. Its clinical value has been clearly established, not merely for the
diagnosis of hereditary degenerative diseases of the retina, but also for evaluation of their
progression and prognosis . This has been further enhanced by greater knowledge of the
retinal processes underlying the different components of the ERG, mainly when different
techniques, such as the use of drugs (pharmacological dissection) and intracellular
recordings, were introduced. Since then, it has been commonly assumed that cells in the
distal part of the sensory retina (photoreceptors, bipolar cells and Miiller cells), are the
main contributors to the ERG, while proximal processes contribute less to the response .
The pharmacological dissection approach also has been used to investigate the ERG of
animal models of inherited retinal disease .

APB (2—amino-4-phosphonobutyric acid), is a glutamatergic receptor agonist that
has been shown to selectively block transmission from photoreceptors to ON bipolar cells
in several species of animals . It also selectively blocks ON ERG responses in amacrine
cells and ganglion cells , thus, removing the light responses of these cells and ON-
depolarizing responses of all third-order neurons, and leaving OFF-hyperpolarizing

responses intact. The effect in several different species, including the chicken , is to

92

remove the b-wave of the ERG. These results are consistent with the notion that activity
in ON-depolarizing bipolar cells makes a significant contribution to the ERG b-wave.

The action of PDA (cis-2,3-piperidinedicarboxylic acid), a glutamatergic receptor
antagonist, is less selective than that of APB. Application of PDA is associated with
blockade of transmission from photoreceptors to OFF-hyperpolarizing bipolar cells and
horizontal cells but not to ON-depolarizing bipolar cells . However, PDA also blocks
transmission from both ON-depolarizing and OFF-hyperpolarizing bipolar cells to
amacrine cells and ganglion cells . Thus, application of PDA results in relative isolation
of activity in photoreceptors and ON-depolarizing bipolar cells. In the monkey,
application of PDA has been shown to reduce a-wave amplitude and enhance b-wave
amplitude of the photopic ERG response . These results led the investigators to propose
that the b-wave represents an interaction of opposing field potentials driven by activity in
ON-depolarizing and OFF-hyperpolarizing pathway cells and that the a-wave contains a
significant contribution from activity in post-receptoral retinal cells.

Barium (Ba2+) reduces K+ conductance of Miiller cells. Miiller cells have been
shown to contribute to the ERG b-wave , but attempts to understand the extent of their
contribution in different species by using barium as a blocking agent have been
inconsistent. Some studies have found that barium depresses the b—wave to about 35% of
its control amplitude [e.g. in frogs: (Griff, 1985), whereas others find no change [e.g. in
tiger salamanders: (Coleman, 1987) or an increase [e.g. in rabbits: (Lei, 1999).
Regardless of whether there is an increase or a decrease in b-wave amplitude in response
to intravitreal barium, the response is believed to be generated by the effect of the drug

on Miiller cells.

93

Ornithine aminotransferase deficiency and the consequent accumulation of
ornithine results in atrophy of the choroid and retina of man. The acute effects of high
levels of ornithine in the retina have been shown in the cat and in the rat . In cats
ornithine is reported to cause a decrease in the c-wave but does not alter the b-wave
amplitude . However, in rats, ornithine reduces the maximum amplitude of the b—wave by
half . The selective toxic action of ornithine and consequently its effects on the ERG
seems to depend upon the levels of activity of ornithine aminotransferase in the different
retinal cells. Cells with higher ornithine aminotransferase activity appear to be more
affected by an overwhelming dose of ornithine due to a higher affinity for the compound .

Very little information is available about ornithine aminotransferase activity
levels in specific retinal neurons. From studies in bovine and murine retinas it is known
that retinal pigment epithelium and the neuroretina, as a whole, show high specific
activity for this enzyme . One immunohistochemical study in humans showed that
ganglion cells, amacrine cells and photoreceptors are irnmunoreactive to an antibody
raised against ornithine aminotransferase . Another immunohistochemical study,
performed on rat retinas, localized ornithine aminotransferase to Miiller cells and pigment
epithelium of the retina . In chickens, the levels of enzyme activity in the retina are 80%
of that found in the liver . These observations suggest strongly that ornithine
aminotransferase activity might be important in maintaining the structure and/or function
of the retina.

In the present study, in an effort to determine the origin of the abnormal
waveforms observed in the ERG of rge birds, we have attempted to separate the

contribution of different retinal neurons to the ERG of rge birds by means of

94

pharmacological alterations of the retinal network with glutamate analogues (APB and

PDA), ornithine and barium chloride.

4.2. Materials & Methods

4.2.1. Animals

For the APB and PDA injections 6 rge birds and 6 control 120 day-old chickens
(rge/+) were used in the experiment. For the ornithine injections 3 rge and 3 control
chickens at 120 days of age were used. In addition, in order to see if the effect of the
drugs would be the same on the supernormal b-waves, observed in younger rge chicks,
ornithine, APB and PDA injections were performed in two 14 day-old rge and one 14-
day-old control chick. For the barium chloride injections, 2 rge and 2 control chickens, at

14 days of age were used.

4.2.2. Pharmacological agents

APB (2-amino—4-phosphonobutyric acid); PDA (cis-2, 3-
piperidinedicarboxylicacid); ornithine hydrochloride and barium chloride- Sigma (St.

Louis, MO, USA).

4.2.3. Intravitreal injection

95

A single dose of PDA, APB, ornithine, and barium were injected into the vitreous
chamber of one or both eyer using a Hamilton syringe equipped with a 30 G disposable
needle. Additionally, the effect of a combinations of drugs, APB + PDA, was also tested.
The maximum volume injected for any drug was 0.02 ml. The target concentration was
calculated using the mean vitreous volume as a parameter to achieve an effective
intravitreal concentration, as previously described , of 0.1 mM APB and 5 mM PDA. The
final intravitreal concentration of ornithine was 0.5 M and was based on previously
described ERG studies performed in other species . The final intravitreal concentration
used for barium chloride was 1 mM, which had previously been used to investigate the
ERGs of frogs and salamanders .

For the calculation of the amount of drug that had to be injected to achieve the
desired final vitreal concentration, the volume of the vitreous body was measured. The
vitreous body was aspired into a lml—syringe in freshly enucleated eye globes from age

matched control and rge birds.

4.2.4. ERG recording

All ERG recordings were performed from 9:30 AM to 5:30 PM on all occasions
to avoid diurnal variations. Scotopic white light intensity series ERGs were recorded as
described in Chapter 3.

Birds were dark-adapted for 20 minutes, and then the responses from a series of 7
white flash stimuli (-0.4, -0.002, 0.4, 0.85, 1.4, 2.3, 2.8 log cdS/mz) were recorded. Three

flashes were averaged from -0.4 to 2.8 log cdS/mz. Inter-stimulus intervals were

96

increased from 30 seconds (-0.4, -0.002, 0.4 and 0.85 log cdS/mz) at low intensities to 3
minutes at higher intensities (1.4, 2.3 and 2.8 log cdS/mz) to avoid light adapting the rods.
The same protocol was repeated 1 hour after the intravitreal injections of APB and PDA,

2 hours after barium and 5 hours after ornithine injections.

4.2.5. Statistical Analysis

Statistical analysis to compare the ERG data between pre and post intravitreal
injection of each drug was performed by paired t-tests, (StatView - SAS Institute Inc.,
Cary, NC, USA). If any statistically significant difference was found the data were
further analyzed using post hoc comparisons with Fisher’s or Tukey-Kramer tests. Data

were deemed significant when P<0.05.

97

4.3. Results

4.3. 1. Results after the intravitreal injection of PDA (Figure 4.1)

In the control group, after the intravitreal injection of PDA, the ERG showed
significantly smaller mean overall a-wave amplitude (pre-injection = -87.94 i 43.15 11V;
post-injection = -46.18 i 19.44 uV, P=0.0001) with a higher but not significantly
different mean implicit time (pre-injection = 12.66 1 2.3 mSec; post-injection = 13.22 x
2.4 11V, P=0.38). However, the slope of the second half of the a-wave was consistently
less steep after the injection. The mean overall b-wave amplitude tended to be slightly
lower after the injection but was not significantly different (pre-injection = 137.37 i
20.18 uV; post-injection = 124.20 :1: 33.84 1.1V, P=0.106). It was also possible to observe
a change in shape of the b-wave, which became broader (wider). The mean overall
implicit time for the peak of the b-wave was not significantly different after the injection
(pre-injection = 34.19 t 7.1 mSec; post-injection = 31.26 :t 4.6 uV, P=0.052).

Subtle results were observed in the rge group after the injection of PDA. There
was no statistically significant change in the mean a-wave amplitude or implicit time. The
overall pre-injection mean for a-wave amplitude was -26.33 i 32.45 11V whereas the
post-injection mean was -22.32 at 20.35 uV, (P=0.49). The overall pre-injection mean
for a-wave implicit time was 15.43 i 3.1 mSec whereas the post-injection mean was
18.07 i 4.5 mSec, (P=0.13). The mean overall amplitude of the b-wave was not

significantly different (pre-injection = 56.62 :1: 48.39 uV; post-injection = 45.96 :1: 37.77

98

uV, P=0.257). The overall mean b-wave implicit time also was not significantly different
(pre-injection = 35.98 :t 4.0 mSec; post—injection = 37.70 i 5.8 mSec, P=0.36).

Comparable results were also observed in younger control and rge chicks.

99

 

-0.4 l p 1

-0.002 .

0.4

 

Intensity:

 

 

l
1

“”5 W W_- WW, 1, H .. W
l

1 gen We 5 . .—

10 50 100 150 200 250110 so 100 150 200 sol

 

 

 

 

[Log cdS/m2

Intensity:

Figure 4.1 - Representative ERGs performed before, (A) & (C), and after, (B) & (D), the
intravitreal application of PDA. A & B are ERGs from a control bird while C & D are from an
rge bird. Note that after the intravitreal injection, in the control bird (B), the a-wave became
truncated, the b-wave implicit time increased and the c-wave became absent. The application of
PDA in the rge group resulted in no changes in a— or b—wave amplitude or implicit times (D).
Horizontal axis = mSec.

100

4.3.2. Results after the intravitreal injection of APB (Figure 4.2.)

In the control group, after the intravitreal injection of APB, a complete
elimination of the b-wave was observed, unmasking the a- and c-waves. The mean
amplitude of the a-wave was not significantly different (pre-injection mean = -106.90 :1:
36.89 uV; post-injection = -104.16 :1: 31.08 uV, P=0.76). The mean implicit time of the
a—wave, on the other hand became significantly increased after the injection (pre-injection
mean = 9.57 :t 1.12 mSec; post-injection = 16.75 :L- 2.03 mSec, P<0.0001).

In the rge group, no significant difference in the mean overall a-wave amplitude
(pre-injection mean = -19.43 : 16.56 “V; post-injection =-22.07 :1: 17.92 “V, P=0.49)
and implicit time were observed (pre-injection mean = 15.42 :t 2.71 mSec; post-injection
= 14.92 :1: 1.90 mSec, P=0.33). Additionally, no difference was encountered between pre-
and post-injection mean overall b-wave amplitudes (pre-injection mean: 64.86 1 52.92
uV; post-injection = 71.27 :1: 57.51 uV, P=0.59) and implicit time (pre-injection = 35.65
:t 4.4 mSec; post-injection = 36.97 :t 3.1 mSec, P=0.70) in this group.

Comparable results were also observed in younger control and rge chicks.

101

 

0.85

1.4

 

 

100

 

 

Intens1ty
l logcdS/m2 g 5:
° 1
l
8
al
1
il
8 l
l
é l
,1
51
l

 

 

 

-o.4‘ ' ‘ l

l
0.4 ‘ -., " \. ._ V. . ,_ .....-.....-..AA.~. « w ’ _ _ \. ., .. ,. .- _ _.-_ —
‘1

K

I

l
l
l

2

© 100uV

0 so 100 150 200 ‘5‘ 0 so 100 150 200

 

Intensity:
log cdS/m2

 

 

 

Figure 4.2 - Representative ERGs performed before, (A) & (C), and after, (B) & (D), the
inu'avitreal application of APB. A & B are ERGs from a control bird while C & D are from an
rge bird. Note that in the control bird, after the intravitreal injection (B), the b-wave was
eliminated and the implicit time of the a-wave increased. The remaining waveforms consisted of
the a-wave and the positive c-wave. In contrast, the application of APB in the rge bird had no
significant effect. No significant changes in a- or b—wave amplitude and implicit time (D).
Horizontal axis = mSec.

102

4.3.3. Results after the intravitreal injection of APB+PDA (Figure 4.3)

In the control group, when the combination of APB + PDA was used, all the ERG
waveform components were eliminated but the a-wave and c-wave. The a-wave
amplitude was not significantly different after the injection (pre-injection = -105.32 :1:
31.84 uV; post-injection = -102.16 i 37.19 ”V, P=0.48). The a-wave implicit time,
however, was increased (pre-injection = 9.12 i 2.20 mSec; post-injection = 17.54 i 2.31
mSec, P<0.0001).

In the rge group, no significant effects in the ERG waveforms were observed after
a combination of APB + PDA was used. The a- wave remained present in the ERG after
the injection and was not different in amplitude (overall pre-injection mean = -20.25 :t
13.42 uV; post-injection =-2l.19 :1: 15.14 uV, P=0.08) and implicit time (overall pre-
injection mean = 14.94 :t 2.16 mSec; post-injection = 15.01 :t 2.02 mSec, P=0.31). The
b-wave also remained present after the injection and was not different in amplitude
(overall pre-injection mean = 67.32 1 50.22 “V; post-injection = 63.42 :t 59.10 “V,
P=0.16) and implicit time (overall pre-injection mean = 36.52 :t 5.1 mSec; post-injection

= 37.74 :1: 4.6 mSec, P=0.24).

103

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1’ I
l l
l l J
F“ :l
|
41.4 . ” M M ~ g - - -, -
_W - _ g } _
1 . -.. l ‘‘‘‘ u I W - W
-o.ooz :
; l 1 - _
0.4 , " W. - - ' " l } » “a.
._ ‘ I 7,. M
t - .- -« - l ,
. V;V . irki " W _m i‘ , I 1’ ‘
1.4 p _ , _ 'K'x,‘ ,7 m - " \ i W . .. ‘ _,.- m -\
. ' ’ [‘ Ill-.I' ' - .-
r ’
,5 ll _ .J N H. ,, ~
; . M ‘ “ J ‘ ‘ ‘ l l
, .. | 1 #1,,- l
a a 1 ® W H W ~
g a l l
8 «8 ‘ '—' 1' , Y " Y r l’ VVVVVVV f I ’i r Tfi—Y fi—r—r r - r 7 Y . f 7+1 I
5 go , 0 so 100 150 200 250 { o a) 100 150 an 250 ‘
" _ _ .l n
f _— ——— —“ r— _‘
a * ‘
! I l
-0.4 l l
l ___- ,"WW_)__ y.._a.,fi. -....,._i. am W- w -fl.W.. +77 l _ _._l .. _, _ W W___ ._ cm, _v |
1 ll
. ~ __ ~ , w l W .-____ _"W W
-o.ooz I l l
l 1 l
1 l l
0.4 u 1,- ~ ~~ « -~ * ~—~ 1.. ‘l W‘- ~ A ~
I ‘ +
0.85 l , ‘ El x“ _ - _. ..... _ M -
l L ’”‘ l -
1.4 l i ., .mewm W - ,- .. t j g WWW , W- ”W
l r g
1
l
2.8 ’ x,“ M, I l
l 1‘ ‘ ‘ ~ ~ “ ' i '“ - ~ T
l i i ‘
"5‘ E ‘ © 1 ' ' © wow 1
t: 58 2.2 W... -fi l .,.fi..
3 o l .
5 8° ' 0 5) 1(1) 150 am 250 l i 0 5) 1m 15) an 250 ‘
l . i i

 

 

 

 

 

 

Figure 4.3 - Representative ERGs performed before, (A) & (C), and after, (B) & (D), the
intravitreal application of PDA + APB. A & B are ERGs from a control bird while C & D are
from an rge bird. Note that in the control bird, after the intravitreal injection (B), all responses
were eliminated except for the a- and c-wave. The application of APB + PDA had no significant
effect on the ERG of the rge chicks (D). Horizontal axis = mSec.

104

4.3.4. Results after the intravitreal injection of barium (Figure 4.4)

After the intravitreal injection of barium chloride in the control birds the overall
amplitude of the a-wave when flash intensities above 1.4 log cdS/m2 were used
significantly decreased (pre-injection mean = -146.18 1 32.42 1.1V; post-injection = -
102.61 :1: 20.36 11V, P=0.006). The mean overall b-wave also significantly decreased
(pre-injection mean = 153.03 :1: 7.68 uV; post-injection = 79.87 i 50.08 11V, P=0.0039).
The overall implicit time of the a-wave significantly increased (pre-injection mean = 9.13
i 0.51 mSec; post-injection = 14.00 t 2.90 mSec, P=0.015). The overall implicit time of
the b-wave also significantly increased (pre-injection mean = 23.78 :1: 2.19 mSec; post-
injection = 35.05 i 11.06 mSec, P=0.03).

The c-wave amplitude was not significantly different in the control group after the
injection when flash intensities above 1.4 log cdS/m2 were used. However, with lower
intensities, the mean overall c-wave had significantly higher amplitudes (for instance, at
0.85 log cdS/m2 pre-injection mean = 60.30 i 3.81 uV; post-injection = 85.30 1 37.94
uV, P=0.044). The overall c-wave implicit time was also significantly increased (pre-
injection mean = 168.93 :1: 32.08 mSec; post-injection = 264.70 :1: 38.79 mSec,
P=0.0002).

In contrast, after application of barium to the rge retina mean overall a-wave
amplitude increased significantly (pre-injection mean = -63.06 :1: 22.12 uV; post-injection
= -103.11 1 50.84 11V, P=0.01) without a significant increase in the overall a-wave

implicit time (pre-injection mean = 13.81 i 1.89 mSec; post-injection = 17.25 x 3.90

105

mSec, P=0.08). The mean overall b-wave also significantly increased (pre-injection mean
= 209.95 :1: 66.45 uV; post-injection = 368.96 i 110.80 uV, P=0.013) without a
significant increase in b-wave implicit time (pre-injection mean = 39.05 :1: 4.71 1.1V; post-

injection = 46.06 :1: 10.98 11V, P=0.18).

106

 

 

 

 

 

 

1 ”W \
.o_4 '\ ~ "c an“ ~~v~~~~7u2~m.ww 7“ J J W ”A ‘7 “ "“"‘ “-'*-‘g'
0.002 1 «\JHAMMCWMW#Y wwwvfl l \ 9x, , m: a ‘ HM .-
”a“ “_H _H 1 \na A, H"‘~ » v ‘7‘ ‘7
0.4 ‘ , A " '7‘ ‘ * r” 7-2 - ~ , \ x ““xx 7
. - x- “mm 1 ,1 a *1», __ we
0 85 I: L. j." r ‘k-‘VNHTVK J '1“ . \ \ u “‘I‘
1.4 J, l ‘1 \ / 7
“xxx x 1 m \
2.3 1 1 g f. 7 ‘ a WVL #7 “~_ aw# 1 x \
1 {f N 1
11.: 1 “.‘4' .
2.8 _\ 1 r
3‘ «35 r x ~ ® ““x w m- 1 1 ,»
fl .v’
‘0 x A
s: a 100 1.1V l ‘ 100 11V
8 B I" '—" Y—T‘ fi— Y‘flfi—VW"r—V *Y—r— fi—r' r—r—r- 1 ‘ r—r—r * fl —r*— r—f'“ r“ -"'——* t‘"‘r——r v '-
5 I 8” o 100 200 300 400 500 o 100 200 300 400 500

 

 

 

 

 

 

 

 

 

 

 

-04 -—~ ~w~v _, “*‘m ““‘r 1 \,/~~- v ewe“ e” ~~ ~~~~~ ~7
- ~"\ k‘ ,. ,«WV‘ A—“r’ ‘M Vb“ MM ‘¢ m \ [-4 \Kaa _..__ ~__.._,——-—- A—v‘ 4 7m f - «¥ ~ v
-0.002 E
r’."-\
0 4 "1 I" 1‘“ \.,.~ _ .- - ”r “‘1‘”- ._..+.,...-—- TA‘ _-._--w. ‘M‘Atu‘ “Ip'h‘r‘T—TW“ ‘\ '/"1Il/‘\\V‘ \ N... W~*-~~_‘~\‘ “MA _ _‘_ fl fl _ fl
' ' y 17 \J‘»
7“ (1 I, ‘ 1. 1“ \
-. .' \--..‘-.._r.- r..-w4_----~« ~-~-+~fi w—fia-w" H-..-..._.._i -\ :1; :1 1 , ~. _fl _-.-,,- ..... , ~ -
0.85 1 1, 1 Mam“.--— w
1' .1 1’ ‘-. N
\ _ fl WMM * " \ 1‘ l \ .‘\\ kkkkkk k vrflw ~
\ 1' l 11 mM,“.‘fl m «A- #“fi
1.4 t 1 ,1 1
1' Hz 1" 1' , ‘
\ J K H am“ V7 '- “ “__. V__v __ 7 7 *2 “v _ \ I J r V
2.3 ‘1 '1 1 1‘ l\ 2 I f w” '
1 1 1 \ _ c_ ~
.1 1 1 1 ,
: , , _H, P»
'>" 2.8 . 1' = ,_ 1 3‘ f- f
‘ ‘ _..JA ,_.._...._ .2..... - 1 1 RI _..VJ’A
... .. z , - www— 1 .w , f.
l l 1 I
\ , 1 ‘ J
5 % ~ 100 1.1V I | ‘00 “V I
E o 1"" "——r VAF‘V ~Y—r—T—fir—T +7—Y—v - r v . —r' -' -7 “—T—‘r—j 1 V T"‘Y“-"_'—Y""' v fi"‘!" 7 v r w -v —v—-' -~—+—'~' 1 7 - 7-
"" go o 100 200 300 400 500 o 100 200 300 400 500
—

 

 

 

Figure 4.4 - Representative ERGs performed before, (A) & (C), and after, (B) & (D), the
intravitreal application of barium chloride. A & B are ERGs from a control bird while C & D are
from an rge bird. Note in the control bird that after the intravitreal injection of barium (B) the
amplitude of the a- and b-wave decreased. The implicit times of the a- and b-wave also increased.
The c-wave amplitudes were higher when flash intensities below 1.4 log cdS/m2 were used. In
contrast, after application of barium to the rge birds (D), both a- and b-wave amplitudes
increased, without an increase in a- and b-wave implicit times. Horizontal axis = mSec.

107

4.3.5. Results after the intravitreal injection of ornithine (Figure 4.5)

After application of ornithine in the control group, the leading edge of the b-wave
is depressed, resulting in a reduction in the mean overall b-wave amplitude (pre-injection
mean = 93.14 i 9.32 11V; post-injection = 22.30 :1; 27.85 11V, P=0.0001). The overall
implicit time of the b-wave significantly increased (pre-injection mean = 25.89 :t 0.95
mSec; post-injection = 30.58 :t 3.60 mSec, P=0.0006).

Ornithine did not significantly impact the mean overall a-wave amplitude of the
control group (pre-injection mean = -70.15 :9: 15.24 uV; post-injection = -55.60 :1: 31.98
1.1V, P=0.19) but, as expected when the b-wave is blocked or delayed, the a-wave implicit
time is increased (pre-injection mean = 8.20 :t 0.84 mSec; post-injection = 20.93 :t 7.12
mSec, P=0.0001). Ornithine also had no significant effect on c-wave amplitude (pre-
injection mean = 31.25 :l: 11.52 11V; post-injection = 55.40 :1: 27.29 11V, P=0.36) or
implicit time (pre-injection mean = 209.00 :1: 1.41 mSec; post-injection = 190.05 1 39.52
mSec, P=0.56).

In the rge group, the mean overall a-wave amplitude measured after the ornithine
injection was numerically smaller compared to the pre-injection mean but was not
significantly different (pre-injection mean = -28.07 :t 19.83 1.1V; post-injection = -24.09 i
19.53 11V, P=0.6417). The mean overall a-wave implicit was significantly increased (pre-
injection mean = 13.60 :1: 1.08 mSec; post-injection = 18.46 :1: 1.65 mSec, P=0.0001). The
slope of the a-wave was also less steep after the injection. The mean overall amplitude of

the b-wave was significantly decreased (pre-injection mean = 79.25 :1: 14.77 11V; post-

108

injection = 42.50 :t 5.65 uV, P<0.0001) and the implicit time significantly increased (pre—
injection mean = 34.25 t 5.05 mSec; post-injection = 44.35 i 1.78 mSec, P=0.0001) after
the injection.

Comparable results were also observed in younger control and rge chicks.

109

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1 ,r—v" W\‘
\a J" fiI‘MV—_'
m 1 1 1 \ /11/' w- —\_.___‘V «w
1 1 .1 1r,
1 1 1 xxx-AL.
1 _ - ._,\. .4 __. 1 / MmG“
. " VVV “4 1x ._ F NM "'
I r W... 1 1 / I, HRH“ 1
B 1 m “fly " ‘ WE 1 1 \, 1,.V/V—l W-
. K J,
1 A 1 1 1 1;\.,/"j 1
. fl 7 1 1 1;:
u 1 /‘ ‘ 1 1 _/ /_r ”I. w ‘1
1 v ”‘4 fl/J“ fix 1 W \ 1
1 1 1 / 1
o o {-x j”
z.» 1 1 1
2' E 1 ‘09” , ‘1. 10cm! '
m 1 ’
8 '8 1 '—V . r 7—r fj’ . , r r r Y"—"— j T f 1' 1 Y , Y Y 1 —Y—Y‘ Y T Y —Y V . Y V‘ V 1 Y‘ Y ’Y Y 1|
C:
I-II °° 1 O 50 KB 150 an 50 1 0 50 1CD 150 am 23) 1
2 1 ,
L ___._._ ______________ L_
1' l
1
M M. M L... JI/‘MWHee— MM— ‘ WWW..- Lamwmm 1
i
I
m W-J‘K\_4W MWAWW- WW WMM'V‘ A!“ .14 WM‘MIWW

 

1
r. ‘ 1 W 1
w m \I If, \A‘w/FM<‘NWLMr-\ MAVWM 1 X _ WMWMW“
/"~\‘\ 1
l ‘.
/ J \ -.H_....,...._M
u ‘5‘ / 1) \\ JI-‘PHW‘ W 1 \ W A"
RV, I 1', 1 \Vghl—‘rvflm 1 \m 1M” V ' N
J 1x 1 1
1 K ,1 .
I \ \ J
u \\ (I A \ ”M a ‘ \ 1* fl 1
k / \ ,1 f -4” l f/
l r l 1 \ _ f N 1
\_/ \WJNJI' 1

 

 

 

 

11 l
2.8 ., 1 1. “WW... 1 1

~ \ ex 1 \1/“W 1

:3" E U W/ 1 k 1
,5 a 10mv 1 wow ,
1 .

§§1 . .L..-.1..,.....L g ....... 41
5 3 O 5) 1CD 15) Z!) 3310 50 100 150 200 2501

 

 

 

 

 

 

 

 

 

 

Figure 4.5 - Representative ERGs performed before, (A) & (C), and after, (B) & (D), the
intravitreal application of ornithine. A & B are ERGs from a control bird while C & D are from
an rge bird. Note that in the control bird, after the intravitreal injection (B), the leading edge of
the b-wave is depressed, resulting in reduced b—wave amplitude. Omithine did not impact a-wave
amplitude but, as expected when the b-wave is blocked or delayed, the a-wave implicit time was
increased. In rge birds, the b-wave was nearly abolished after the application of ornithine (D).
The mean a-wave was numerically smaller compared to the pre-injection values but was not
statistically different. Horizontal axis = mSec. A younger rge chick (14 days of age) is depicted
(C and D).

110

4.4 Discussion

Previous ERG studies (see Chapter 3) showed that rge chicks have an elevated
response threshold, slower waveforms that are abnormal in shape, a decrease in
oscillatory potentials and a lack of c-waves. Interestingly, a unique electroretinographic
abnormality of young rge chicks is the presence of abnormally elevated b-wave
amplitude when flash intensities above 0.9 log cdS/m2 are used. The supernormal b-wave
amplitude decreases with increasing age in the rge group, eventually becoming smaller in
amplitude than the control b-wave. The results of the pharmacological dissection of the
ERG show that the positive b-wave of rge birds is very different from the normal chick b-
wave and is probably not generated from the same cells.

The intravitreal injection of PDA resulted in ERG changes in the control group
that were similar to those previously described . PDA blocks negative—going horizontal
cell and OFF-hyperpolarizing bipolar cell responses, which normally counteract the
positive-going depolarizing bipolar cell response. The early depolarizing bipolar cell
response is unmasked and alters the shape of the latter part of the a-wave and truncates it.
This results in lower a-wave amplitudes. Due to the absence of horizontal cell and
hyperpolarizing bipolar cell components, the unopposed depolarizing bipolar cell
component results in a broader b-wave peak. The c-wave was abolished in the control
group after the injection. A possible explanation is that when PDA is used, the b-wave is
not pulled in a negative direction by horizontal cells and hyperpolarizing bipolar cells, the
c-wave component might have been masked by the longer lasting b-wave peak.

Alternatively, the implicit time of the c-wave might have increased to a degree that the c-

111

wave was not visualized within the recording time. The intravitreal injection of PDA in
the rge group resulted in no significant changes in a- or b-wave amplitude or implicit
time. Suggesting that the horizontal cell and hyperpolarizing bipolar cell responses do not
play a significant role in generation of the ERG in the rge birds or, perhaps, these cells
did not respond normally to the drugs.

As previously reported , intravitreal injection of APB to the control chick retina
eliminated the depolarizing bipolar cell positive b-wave, which allowed the a-wave to
continue its time course, resulting in an increased a-wave implicit time. The remaining
waveform consisted of the photoreceptor-generated a-wave; horizontal cell and
hyperpolarizing bipolar cell negative-going components and the positive c-wave. In
contrast, the intravitreal injection of APB in the rge group had no significant effect. There
were no significant differences in a— or b-wave amplitude and implicit time. Blocking
with APB did not uncover an underlying c-wave component. This suggests that
depolarizing bipolar cells in rge birds do not contribute significantly to the ERG
waveform or for some reason are not blocked by APB.

Curiously, the c-wave could still be observed in the control group after the
injections of PDA + APB. Perhaps the apparent c-wave present in the control after the
PDA + APB injection is not a true c-wave (i.e. generated from RPE) but an exaggerated
positive after-potential. Alternatively, the combined action of PDA + APB liberates the c-
wave generator.

The intravitreal injection of both APB + PDA theoretically should eliminate
contributions from depolarizing bipolar cells, horizontal cells and hyperpolarizing bipolar

cell. After intravitreal injection of a combination of both agents in the control group, all

112

responses were eliminated as expected except for the photoreceptor-derived a-wave and
the positive-going c-wave. The combination APB + PDA, however, had no significant
effect on the ERG of the rge chicks. These results suggest that the large positive going b-
wave present following the photoreceptor-derived a-wave in the rge chick does not have
significant contributions from horizontal cells, hyperpolarizing bipolar cells or
depolarizing bipolar cells because it is insensitive to agents that normally abolish the b-
wave. As these agents act by mimicking the neurotransmitter that stimulate the second
order neurons of the retina, it seems likely that these neurons are not activated in the rge
retina after stimulation of the photoreceptors. An alternative and less likely hypothesis
would be that these cells actually participate in the formation of the supernormal b-wave
of the rge chicks but their glutamate receptors are somehow abnormal and are not
blocked by the drugs used.

After the intravitreal injection of barium in the control birds, the amplitude of the
a- and b-wave decreased and the implicit times of the a— and b-wave increased. Inversely,
when K+ conductance of Miiller cells is blocked by barium in rge birds; both a- and b-
waves were dramatically increased in amplitude suggesting that the response is inhibited
by K+ conductance.

Ornithine attenuated the b-wave in control chicks but had a much more dramatic
effect in rge chicks, nearly completely blocking the positive-going b-wave response. This
“Ornithine Sensitive Component” (OSC) of the b-wave, however, was not exclusive to
the rge chick. Application of ornithine in the control birds resulted in a smaller reduction
of the b-wave amplitude. However, the magnitude of the response of the OSC in the rge

group seems to be very unique indeed. Ornithine must have some action to block b-wave

113

generators. However, in the rge mutant where most of the normal b-wave generators
(horizontal and bipolar cells) make no contribution to the positive-going response the
drug must have an effect on another cell type, perhaps the photoreceptor cells. The
hypothesis that rge photoreceptors are affected by ornithine is partially substantiated by
the observed change in slope of the a-wave and the smaller, even though not significantly
different, mean a-wave amplitude.

The only two agents that affected a change in the rge ERG were barium and
ornithine. Barium enhanced the response and ornithine nearly abolished it. Although
ornithine might have an effect on amacrine cells, it seems unlikely that these cells are the
origin of the supernormal rge b-waves because the normal electrophysiological response
of amacrine cells tend to oscillate and the abnormal b-wave response in the rge birds is
much greater than the usual amacrine responses and is consistently depolarizing.
Therefore, possible sources of this large depolarization in rge chicks are the
photoreceptors or RPE. It seems, however, that the supernormal b-wave of the rge chicks
are too fast to be coming from the RPE. Additionally, the normal RPE response, the c-
wave is a much slower response than the supernormal b-wave.

The idea that the normal b-wave generators are not involved in the formation of
the rge b-wave is in keeping with the finding that the organization of the rod terminals
and cone triads (dendritic terminals of bipolar cells and horizontal cells) and the
corresponding ribbons is severely disrupted in the rge birds. Furthermore, the synaptic
ribbons also appeared to be less numerous in the rge birds. Therefore, is not surprising to

find abnormal transmission between photoreceptors and second order neurons.

114

Only exuberant Miiller cell processes are abundant at the OPUONL level in the
rge retinas. In fact, abnormal OPL morphology is the first recognizable ultrastructural
abnormality observed in the affected chicks at the first time-point evaluated (at hatch).
Miiller cells could be involved with the abnormal b-wave waveform of the rge chicks,
since the b-wave amplitude was greatly reduced by ornithine and this cell type has shown
to express high levels of ornithine aminotransferase . Abnormal sprouting of Miiller cells
and re-wiring of retinal neurons at the OPL in rge retinas might underlie the reason for
the different responses observed in the controls versus rge when K+ conductance of these
cells is blocked with the application of barium.

Further studies to explain the abnormal ERG waveforms in the rge bird are

discussed in Chapter 7.

115

CHAPTER 5
DETAII.ED MORPHOLOGIC CHARACTERIZATION OF THE rge CHICK

PHENOTYPE

S .1. Introduction

As discussed in Chapter 2, there is a variable degree of vision loss in rge chicks at

I day of age with deterioration in vision over the next few weeks until all chicks are
unable to see food particles on the floor and behaviorally act as if they are blind.
However, optokinetic responses can still be induced in some birds until about several
months of age. The affected birds develop a globe enlargement, apparently secondary to
the vision deterioration. The rge chicken phenotype is unusual in that the ERG, although
abnormal from initial development, only slowly deteriorates and is maintained for several
months after functional vision loss (see Chapter 3). Therefore, in rge chicks loss of vision
does not appear to correlate directly with a loss of photoreceptor function (as assessed by

the ERG). Another unusual feature is that no outstanding light microscopic structural
abnormalities of the retina were apparent initially and there was only a slow progressive
thinning of retinal layers apparent after the age of functional vision loss. Thus, in order to
understand the underlying structural changes of the rge phenotype, a .detailed
characterization of the histological changes was necessary. The purpose of the study
reported in this chapter was to examine the histopathological changes in the retina of the

rge birds in more detail by light microscopy (LM), immunocytochemistry (IHC) and

electron microscopy (EM).

116

 

5.2. Material & Methods

A flock of rge birds was maintained at MSU and bred to produce homozygous
affected (rge/rge), heterozygous carrier (rge/+) and homozygous normal (+/+) chicks.
Progeny from rge/rge crossed with rge/+ birds were phenotyped by ERG, as described
previously (Chapter 3). All experiments and procedures were carried out in accordance
with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research
and approved by the Institutional Animal Use Committee.

Immediately following euthanasia using a C02 chamber, bilateral enucleation was
performed. The eyes were hemisected at the equator, the vitreous body removed and the
posterior segment of the eye immersed into one of the different types of fixatives used

(see below). Samples from control and rge birds were studied at several different ages.

5.2. 1. Morphometric analysis

Retinal thickness was measured on plastic-embedded histological sections at 6
consistent locations across the retina (Figure 5.1). The retinal regions analyzed were
defined by measuring the ventral and dorsal retinal lengths from pecten to am serrata
under 10x magnification (Figure 5.1 A) using the software SPOT version 3.5 for
windows (Visitron Systems, Gmbh). The distance from pecten to ora serrata was divided
by 3 (ventral) or 5 (dorsal) (Figure 5.1 B) to give the 6 locations for measurement of

retinal thickness (Figure 5.1 C). Digital images were acquired under 400x magnification

117

and stored using the same software. Subsequently, Image Pro Plus version 4 (1P4)
software (Media Cybernetics) was used to measure the histological thickness of 7 retinal
layers defined as: nerve fiber layer + ganglion cell layer (NFL+GCL); inner plexiform
layer (IPL); inner nuclear layer (INL); outer plexiform layer (OPL); outer nuclear layer
(ONL); photoreceptor inner and outer segment layer (IS+OS) and retinal pigment
epithelium (RPE). For each layer 5 replicate measurements were performed. Total retinal
thickness was also measured at each of the six points. Care was taken to ensure that the

sections were oriented perpendicular to the retinal surface.

 

 

/V

 

 

 

 

 

 

Figure 5.1 — Graphic representation of the method used for determining the retinal regions used
for retinal thickness measurement. A) Measurements were made of retinal length from the ora
serrata (D and V - dorsal and ventral) to the pecten/optic nerve (PCT+ON). B) The value D was
divided by 5, resulting in x and the value V was divided by 3, resulting in y. Starting at the center
of PCT+ON, x and y values (dorsally and ventrally, respectively) were consecutively applied to
determine the regions to be evaluated for retinal thickness. C) Cross section of a chick eye globe
showing the 6 positions at which retinal thickness measurements were made.

118

Using paraffin embedded sections labeled with rhodopsin antibody (see details of
the staining technique below), rod 085 were manually counted in 200 um segments of
retinal length, using the same 6 regions described above. Additionally, the numbers of
rows of cells in the INL, at each region, as well as the number of ganglion cells per 200
pm at each of the same 6 retinal regions were measured. The number of rows of nuclei in
the ONL is commonly used as a parameter of photoreceptor cell density in histological
studies of retinal degeneration in other species . In the case of birds, the ONL is a bi-
layered nuclei row, with rod nuclei located more internally than cone nuclei and therefore
counting the number of rows of nuclei would not be a sensitive measure of photoreceptor
density.

Statistical analyses for retinal thickness measurements, number of rod outer
segments and ganglion cells per unit length as well as for the number of rows in the INL
were performed by one-way ANOVA and t-test (when comparing one time-point
between two groups). The tests were run in two different types of statistical analysis
software (StatView and SAS 2001 - version 8.2. SAS Institute). If any statistically
significant difference was found the data were further analyzed using post hoc
comparisons with Fisher’s or Tukey-Kramer tests. Differences between means were

deemed significant when P<0.05.

119

5 .2.2. Conventional morphologic analysis of semi-thin and ultra-thin sections

The eyecups were fixed in phosphate buffered (0.1 M, pH 7.3) 3%
paraforrnaldehyde + 2% glutaraldehyde solution for 3 hours at room temperature. A

square shaped tissue sample (about 2 x 2 mm) per eye was collected from the central
retina, subsequently post-fixed in 1% 0504 at 4°C for 2 hours, washed in distilled water,

then dehydrated in acetone and finally embedded in an Araldite-based resin (Durcupan,
Fluka). Semi-thin (0.5-1 mm) and ultra-thin (80 nm) sections were cut using a Reichert
Jung ULTRACUT ultra-microtome, using glass and diamond knives, respectively. Semi-
thin sections were stained with toluidine blue solution and examined by light microscopy
and images recorded with a Polaroid DMC digital camera mounted on a Nikon Eclipse
E400 Microscope. Ultra-thin sections were mounted on copper grids, stained with lead
citrate and uranyl acetate, and examined and photographed in a Zeiss EM 109
transmission electron microscope (TEM). TEM photographic negative films were
digitalized using a Polaroid SprintScan 35 Plus scanner.
A search for possible apoptotic nuclei was conducted using standard
morphological criteria utilizing both semi-thin and ultra-thin sections.
Dr. Rafael Cemuda at the Institute of Cellular Signaling (University of Nijmegen,

Netherlands), performed part of the TEM analysis.

120

 

 

5.2.3. Immunocytochemistry studies on paraffin-embedded material

For conventional staining as well as for IHC analyses at the light microscopic (LM)

level, retinal samples were fixed in 4% paraformaldehyde, 3% sucrose in 0.1 M

phosphate buffer for 48 hours at 4°C and then dehydrated in ethanol and embedded in
paraffin blocks prior to sectioning. Eight-um thick sections were cut and mounted on
double-gelatinized glass slides. After deparaffination in xylene, sections were rehydrated
gradually in ethanol and, finally in distilled water. IHC analysis was carried out by single

labeling with the following antisera:

0 Mouse opsin monoclonal antibody at 1:1000 (Lab Vision)

0 Rabbit anti-glial fibrilliary acidic protein (GFAP) at 1:2000 (Dako)

0 Tyrosine hydroxylase at 1:1000 (Chemicon International)

0 Guanylate cyclase-activating protein (GCAPl) at 1:400 (a gift from Dr.

Palczewski, University of Washington)

The peroxidase-conjugated Vectastain ABC (avidin-biotin complex) kit (Vector)
was employed as a detection system. Labeled sections were dehydrated in ethanol,
cleared in xylene, mounted in a hydrophobic medium (Entellan, Merck) and examined by

LM.

121

5.2.4. Immunocytochemistry studies on frozen sections

The retinal samples were immersed in 4% paraformaldehyde plus 3% sucrose in
0.1 M phosphate buffer, pH 7.4 or Carnoy fixative (for RCA-1) for 30 minutes at room
temperature (for RCA-1). Fixed tissues were washed three times in phosphate-buffered
saline plus 0.05 M phosphate buffer and 195 mM NaCl, pH 7.4, (PBS), and cryoprotected
in PBS plus 30% sucrose overnight, at 4°C. Cryoprotected tissues were soaked in
embedding medium (O.C.T.-compound; Tissue-Tek) for 30 minutes and freeze-mounted
onto sectioning blocks. Vertical 14 pm thick sections were cut on a Reichart-Jung
Fridgocutmu 2500 and thaw-mounted onto Super-Frosttm slides (Fisher Scientific).
Sections from control and rge eyes were placed together in pairs on each slide to ensure
equal exposure to reagents. Sections were air-dried and stored at -20°C until use.

Sections were thawed at room temperature, ringed with lubricant, and washed two
times in PBS. They were then covered with primary antibody solution (150 1.11 of
antibody diluted in PBS, plus 0.3% Triton X-100 and 0.01% NaN3) and incubated for
about 24 hours at room temperature in a humidified chamber. The slides were washed
two times in PBS, covered with the secondary antibody solution and incubated for at least
1 hour at room temperature in a humidified chamber. Finally, they were washed three
times in PBS and a coverslip was applied in 4:1 (v/v) glycerol to water.

Working dilutions and sources of antibodies used in this study included the

following:

122

Mouse anti-lysosomal glycoprotein at 1:80 (LISP-100; Developmental Studies
Hybridoma Bank (DSHB)

Rat anti-glycine at 1:1000 (a gift from Dr. D. Pow, University of Queensland)
Rabbit anti-tyrosine kinase A (T rkA) at 1:5000 (a gift from Dr. F. Lefcort,
Montana State University)

Mouse anti-neurofilament at 1:2000 (RMO270; Zymed)

Mouse anti-vimentin 1:50 (H5; (DSHB))

Mouse anti—Islet] at 1:50 (39.4D5; DSHB)

Mouse anti-Hu at 1:200 (Monoclonal Antibody Facility, University of Oregon)
Mouse anti-rhodopsin at 1:800 (rho4D2; a gift from Dr. R. Molday, University of
British Columbia)

Mouse anti-tyrosine hydroxylase at 1:100 (DSHB)

Rabbit anti-glial fibrilliary acidic protein (GFAP) at 1:2000 (Dako)

Mouse anti-visinin at 1:100 (DSHB)

Ricinus communis agglutinin-l (RCA-1) (produced by one of the authors SSC)
bep-transferrin binding protein (TfBP) (produced by SSC)

Mouse anti-B3 tubulin at 1:2000 (TUJ -1; Babco)

Calbindin D28 at 1:1000 (Sigma-Aldrich)

Mouse anti-glucagon at 1:400 (a gift from Dr. M. Gregor, University of
Tuebingen, Germany)

Rabbit anti-caspase-3 at 1:1000 (R&D Systems)

Rabbit anti-synaptobrevin (anti-VAMP-l) at 1:400-1:800 (Synaptic Systems)

123

0 Mouse anti-synaptic vesicle protein 2 (SV2) at 1:25 (a gift from Dr. Kathleen
Buckley, Harvard Medical School)
0 Mouse anti-GABA-A receptor Beta subunit at 1:100-1:500 (clone 62-3G1 -

Upstate Biologicals).

The same detection method described above for the paraffin embedded sections
was used for the frozen sections. Secondary antibodies used for both (paraffin and frozen
sections) included goat-anti-rabbit—Alexa568, goat-anti-mouse-Alexa568, goat-anti-
mouse-Alexa488, goat-anti-rat-Alexa488 (Molecular Probes) and goat anti-mouse-Cy3,
diluted to 1:500 in PBS plus 0.3% Triton X-100.

Fluorescence photomicrographs were taken by using a Ziess Axioplan II
microscope equipped with epifluorescence, FITC and rhodamine filter combinations, and

a SpotTM Slider-RT digital camera (Diagnostic). Images were optimized for color,

brightness and contrast by using Adobe Photoshopm6.0.

Dr. Andy Fischer (Department of Neuroscience, The Ohio State University,
Columbus, Ohio), performed the fluorescence photomicrographs on the
immunocytochemical analysis of frozen retinal sections. Dr. Sa Sun Cho (Department of
Anatomy, Seoul National University College of Medicine, Seoul, Korea), performed the

immunocytochemical stainings using RCA-1 and TfBP antibodies.

124

5.2.5. Terminal Deoxynucleotidyl Transferase-mediated dUTP Nick End Labeling

(TUNEL) Staining

TUNEL staining was performed to identify cells undergoing apoptosis, following
previously described techniques in retinal sections from rge and control birds at 13 and
30 days of age. In brief, slides were warmed to 20°C and washed once in PBS, followed
by one wash in PBS plus 0.3% Triton X-100, and two more washes in normal PBS.
Sections were then covered with 100 pl of incubation medium (0.5 nmol Cy3-conjugated
dCT P, 20 units of 38-terminal deoxynucleo-tidyl transferase, 100 mM sodium
cacodylate, 2 mM C002, and 0.25 mM beta-mercaptoethanol in sterile saline, pH 7.2)
and incubated for 1 hour in a humidified chamber at 37°C. The sections were then
washed three times in PBS, mounted in 4:1 (v/v) glycerol to water, and coverslips were

added for observation by epifluorescence with a rhodamine filter combination.

5.2.6. Detailed examination of the linear fundus lesions in semi-thin and ultra-thin

sections

In their preliminary description of the rge phenotype noted the presence of white
streaks extending from the base of the pecten in some affected birds. In our detailed
description of the phenotype (Chapter 2) we also noted the development of these lesions

in some of the affected birds. With the objective of better characterizing these lesions, a

125

more detailed histopathological study focusing only on the retinal portions displaying
these lesions was performed using the same LM and EM techniques described above.
Selected rge birds identified with fundus lesions were sacrificed at the following ages: 2
birds at 49 days of age, 1 at 84 days of age and 1 at 336 days of age. The globes were
processed for histological examination as described above. Histological changes in the

retina, Bruch’s membrane, and choroid were examined by LM and EM.

5.3. Results

No significant differences were observed between heterozygous carrier (rge/+)
and homozygous normal (+/+) chicks on light and electron microscopy analysis as well
as by immunocytochemistry techniques using several cell type-specific markers. Thus

these two groups were treated as one single control group in the study.

5.3.1. Morphological measurements of the retina

At 2 days of age there was no difference in retinal thickness of rge chicks
compared to controls but by 14 days of age the retina had significantly thinned (P<0.05)
(574.51 i 13.47 tun compared to 672.81 i 11.35 pm) (Figure 5.2). From this age point
onwards, a slow thinning of the retina continued in the rge birds. There was a geographic
difference in the rate of thinning. The ventral regions (#1 and #2) and the far dorsal
peripheral region (#6) were the ones that presented the greatest initial reduction in

thickness (Figure 5.3 B). At 14 days of age the thickness (mean of all 6 retinal regions

126

measured) of the NFL+GCL (109.84 :t 48.71 um versus 175.23 i 9.40 pm), IPL (193.24
i 3.80 um versus 202.61 i 3.80 pm) and INL (177.48 i 3.60 um versus 190.34 .4: 3.80
urn) layers of the retina were significantly lower (P<0.0001) in rge birds than in controls.
By 56 days of age, most retinal layers became significantly thinner (P<0.001) in the rge
birds, except the OPL, ONL and RPE. The difference in the above mentioned layers
became even greater in older birds (Figures 5.2 & 5.3). By 270 days of age all retinal
layers with exception of the RPE of all six retinal regions became significantly thinner

compared to controls (P<0.0001) (Figure 5.3 C & D).

 

 

 

 

 

800 ”
6°° M
g 500 1 t .
400 1 I ~1-
300 l
100 l . T . . , T 7 1
o 50 100 150 200 250 300 350 400 450

‘93 (“H
+ rge —®- control

 

 

 

 

 

 

 

Figure 5.2 - Total retinal thickness of rge (continuous black line with triangles) and control birds
(continuous gray line with circles) at 2, 14, 28, 56, 180, 270 and 420 days of age. Note that the
mean retinal thickness decreases with age in the rge group. The retinal thickness of rge chicks
(574.51 i 13.47 pm) was significantly thinner (P<0.05) than controls (672.81 i 11.35) pm by 14
days of age (n = 4 for each group; * = P<0.05).

127

    

 

1W ‘W
9°" ® 9‘”
‘ k
mo , _“ a»
mo ‘ . 700 e
o f\ -N‘ , 0
6CD . . , \ _ . an
E ,1 . [I \O E. O 7. g \ .
:1. 500‘ '// i,’ 5a), / "1 .
I t‘ '/ . “ yo
too \‘i ‘y’ . ‘ b I ‘
v‘ , 400 , 1. ‘ . a
A \ . .r/ .1 .
:m ‘ ‘ ‘l/ k ‘ 3m . ‘\_ ‘
‘ ;' r§ \ g/ ,7 . 1 ‘ ‘ 1 <\ ’ 5 z =
”a .3- . / reek“ 2» ; we? . .
o~ 7* , - ,g, o‘ .7 Y _
Region: M #2 PCT 0'3 #4 #5 06 Region: “1 .2 PCT 33 '4 ’5 ’6
10m 1000
.. .. * @
3m . 800
700 700
6C!)
S E 6‘”
5m 1 500
can ‘00
300 . 300
200 200
100 '00
0 ' . ' t ‘7 7 '7 ,. o W N, , N :’ , . , , g
Region: #1 H2 PCT '93 #4 "5 #6 Region: #1 l2 PCT 03 d4 05 '6
+ NFL+GCL + IPL INL * OPL -*- ONL + IS+OS -— RPE ‘

 

Figure 5.3 — Mean retinal thickness of each of the different retinal layers from rge (B & D) and
control (A & C) birds at two representative age groups. By 56 days of age (A & B), mean
thickness of NFL+GCL, IPL, INL and also OS+IS layer were already decreased. Note that the
ventral regions (#1 and #2) as well as the far dorsal peripheral region (#6) were the ones that
presented the greatest reduction in thickness. In retinas from birds at 270 days of age (C& D), the
thickness of the NFL+GCL, IPL and IS+OS retinal layers were remarkably smaller. At 56 days of
age n = 6 rge, 4 controls at 270 days of age n = 4 rge and 5 controls. Key: RPE — retinal pigment
epithelium; IS+OS — inner segments + outer segments; ONL — outer nuclear layer; OPL- outer
plexiform layer; INL — inner nuclear layer; IPL — inner plexiform layer; NFL+GCL — nerve fiber
layer + ganglion cell layer.

A progressive and significant (P<0.01) overall decrease in the number of rod 085
per 200 mm length of retina occurred in the rge birds with age. By 21 days of age the
overall mean rod OS number in rge retinas (26.30 :t 5.14) became significantly lower

(P<0.05) than controls (33.25 :t 5.91) (Figure 5.4).

128

Additionally, the mean number of nuclei rows of the INL in the rge group
decreased with age but only became significantly lower at 270 days of age (P=0.0058).
At this age the mean number of nuclei rows in the INL was 2.95 :t 0.94 and for controls it
was 6.67 :l: 1.59 (Figure 5.4).

The mean number of ganglion cells per 200nm of retinal length of both rge and
controls tended to decrease with age, however there was no significant difference

between rge and control groups at the ages assessed (up to 720 days of age) (Figure 5.4).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

14

 

l

i

,1

i r45

+40

| \\ " L35 1
‘ ‘\\ _Control >
= " ‘T‘ Lao oer. I
I J’ on ... g awry ‘
, #25 o GCL 2
l , a -—+-—Control I!
| *1“ 7 - .20 2 06 i
. .17.. , _ _ 15 '3 ~~+-~ rge/r99 i i
i I i ‘ A ~ 10% in"; 3i
I! . ‘ s... -“ _ P} , rm

‘ ' [5 5 IN. ’
f , f o

l

l

 

Figure 5.4 - Number of rod OS5 and ganglion cells per unit length and number of rows in the
INL in cross sections (average of all retinal regions) in cross sections at 14, 21, 90, 180, 270 and
720 days of age. Note the progressive and significant (P<0.01) overall decrease in number of rod
085 per 200 pm of retina tissue length in the rge retinas. At 21 days of age the difference is
already significant. Additionally, the mean number of INL cells per column in the rge group
became significantly smaller at 270 days of age (P<0.0001) (n = 4 rge, 3 controls). The mean
number of ganglion cells per 200 um of retinal length was not statistically significant between the
two groups. A mean number of 4 retinal samples from rge and control birds were analyzed from
each age group. Asterisks indicate significance: *=P<0.01, **=P<0.001 and ***=P<0.0001. Key:
OS — mean number of rod outer segments (irnmunocytochemicaly labeled for rhodopsin) per 200
um length of retina; INL - mean number of nuclei rows of inner nuclear layer; GCL — mean
number of ganglion cells per 200 um length of retina.

129

5.3.2. Observations on semi-thin and ultra-thin sections, light and electron microscopy

No ultrastructural evidence for apoptotic nuclei was found in rge sections using
the standard morphological criteria in semi-thin or ultra-thin sections in any of the age

groups studied.

5.3.2.11 Retinal sections at 1 da 0 e

Semi-thin sections from rge chicks at 1 day of age (Figure 5.5 B) revealed that the
basic morphological retinal features were similar to the controls (Figure 5.5 A). However,
the cell bodies within the ONL of the rge sections appeared consistently somewhat
dilated and less fusiform shaped compared to the controls. The most striking difference
was observed in the OPL. In the control chicks the photoreceptor terminals formed two
distinct layers (Figures 5.5 A & C). This regular stratification was not present in the rge
retinas (Figure 5.5 B & D). Furthermore, the photoreceptor pedicles appeared distorted in
rge sections (compare Figure 5.5 D with 5.5 C). There also appeared to be an abnormal
positioning of the smooth endoplasmic reticulum (SER) in some cone photoreceptor cells
of rge birds. In the accessory cones of control birds SER containing some glycogen
granules was present in the ISs of rods (as part of the hyperboloid) and accessory cones
(as part of the paraboloid) whereas in the rge retinas the SER of the accessory cones were

located internal to the outer limiting membrane, close to the nucleus (Figure 5.6).

130

 

 

Figure 5.5 - Semi-thin (A & B) and ultra-thin (C & D) retinal sections of a control (A & C) and
of an rge chick (B & D), respectively, at 1 day of age. E & F are ultra-thin sections of a control
(E) and an rge chick (F) at 60 days of age. A) Semi-thin section of a control chick demonstrating
the detail of the well organized outer OPL. Stain = Toluidine blue (A & B). Bar = 10 um. C) The
typical 2-layer arrangement of the photoreceptor pedicles is clearly shown here. Bar = 5 pm. B)
Note the dilated photoreceptor cell bodies and the disorganization of the OPL architecture in the
sample from an rge bird. Bar = 10 um. D) Note the disruption of the photoreceptor pedicles and
spherules. The 2-layer arrangement of the photoreceptor pedicles is lost. Bar = 5 um. Note that
there are fewer synaptic ribbons in the rge section (F) compared to control (E). The 2-layer
arrangement of the photoreceptor pedicles and spherules is even further disorganized in the rge
section at this age. Bar = 5 pm.

131

 

Figure 5.6 - Ultrastructural features of the ONL/IS interface of an rge chick, at 1 day of age.
Note the displacement of the SER (marked as SER), which in this sample, appear to be located at
the perinuclear cytoplasm of an accessory cone, internal to the level of the outer limiting
membrane (dashed line). At this age accumulation of glycogen is not apparent (compare with
Figures 5.7 & 5.10). Miiller cells microvilli are marked as “mv”. Bar = 5 pm.

5.3.2.ii. Retinal sections at 7da s o a e

By 7 days of age the OPL of the rge chicks was more disorganized than at 1 day
of age (Figure 5.7 A). Cone pedicles were increased in size compared to controls (Figure
5.8 A). These abnormally wide terminals were not as electron-dense as those of controls

and often contained sets of numerous flattened (tubuliform) small vesicles, and

132

multivesicular bodies (Figure 5.8 C). The number of synaptic ribbons observed in the
cone pedicles and rod spherules also appeared to be reduced in all sections from rge birds
examined. At the IPL, however, no apparent difference in ribbon numbers between rge
and controls could be appreciated. Additionally, exuberant electron-dense glial processes
were observed around the photoreceptors. The organelles of the rge photoreceptors also
showed further changes. In control retinas the 188 of the accessory cells had well-
arranged SER, with small glycogen granules present among the cisterns. There was a
geometrical arrangement of the cistemae, as well as a close relationship with the rough
endoplasmic reticulum (RER). By comparison, rge retinas had larger glycogen deposits
in the 183 of the accessory cells of double cones and a displacement of these deposits
toward the nucleus in some cases (Figure 5.7). Large glycogen deposits were also found
in BM sections at abnormal locations in the accessory cells of double cones, i.e. ISs,
supranuclear cytoplasm (Figure 5.7 A & B), and in the subnuclear cytoplasm, close to the

synaptic regions and associated with SER and RER (Figure 5.7 C & D).

133

 

Figure 5.7 - Semi-thin (A) and ultra-thin (B, C & D) sections of rge (A, B & D) and control (C)
retinas at 7 days of age. A) Semi-thin section showing the detail of a large glycogen deposit
(dashed white square) in the perinuclear cytoplasm. Note the disrupted OPL. Bar = 20 um. B)
Ultrastructural detail of a deposit in the perinuclear cytoplasm of an accessory cell of double cone
of an rge bird where it is possible to observe the abnormal accumulation of glycogen (dashed
white square). Bar = 5 pm. C) Control retina showing evenly-arranged SER in the IS
(paraboloid). Small glycogen granules can be seen among the cistemae. Bar = 1 pm. D)
Abnormal glycogen accumulation associated with SER & RER in an rge retina at 7 days of age
(same as in Figure B). Bar = 1 pm.

134

 

Figure 5.8 - A) Synaptic terminal of a cone pedicle of a control chick at 7 days of age. B) A
typical example of a synaptic terminal of a cone pedicle of an rge chick at 7 days of age. The
cytoplasm is less densely stained. Note the disruption in the architecture of the synaptic terminals
(small black arrows). Also note the presence of electron-dense glial processes separating the
photoreceptors (white arrowheads). C) Higher power detail of an rge retinal section at 7 days of
age demonstrating one of the sets of numerous flattened (tubuliform) small vesicles. and
multivesicular bodies (wide white arrow) in a cone pedicle. Bars = 1 pm.

5.3.2.iii. Retinal sections at 60 to 90 da s o a e

At 60-90 days of age there was further disruption of the OPL of rge birds
compared to younger age groups. Large Miiller cell processes were present in the OPL
and occasionally separated the somata of the photoreceptor cells in rge retinas. Abundant
Miiller cell processes and microvilli could also be seen among the 153 of the
photoreceptor cells (Figure 5.9 A). The numbers of discernible ribbons at the OPL was
also even more decreased (see Figures 5 .5 E & F).

As observed in previous age groups, glycogen deposits were often displaced from
the normal position in the 18 towards the cytoplasmic perinuclear areas of the accessory
cells of double cones, as well as of the rod cells (Figure 5.9 B). The glycogen deposits in
rods of rge birds were larger than those that could occasionally be seen in the rod ISs of
control retinas. Some occasional whorls of membranes (myelinoid figures) could be seen

in the rod cells, most commonly in the subnuclear cytoplasm (Figure 5.9 C).

5.3.2.iv. Retinal sections at 2 70 days at age

By this age the retinal thickness of rge birds was markedly decreased compared to
controls (Figure 5.2, also compare Figure 5.3 C with D and 5.10 A with B). Both rod and
cone photoreceptors could still be readily identified, although the OSs were considerably

shorter (Figure 5.10 B & C). The spaces occupied by Miiller cell processes were

136

progressively wider and the photoreceptor cells seem to be further separated at this age
(Figure 5.10 D). In addition, cone OSs appeared disorganized, shorter than controls with
disruption of the discs (Figure 5.10 C). The abnormal photoreceptor glycogen deposits
were larger than in the other stages and often displaced internal to the outer limiting
membrane (in the perinuclear cytoplasm) in many of the accessory cells and rod cells
(Figure 5.10 B & D). As they were larger, they appeared more metachromatic (pink in
color) in toluidine blue—stained semi-thin sections (Figure 5.10 B). In contrast, control
retinas only had glycogen deposits in the 185 of the accessory cones and rod cells, as
normally expected (Figure 5.10 A). In rge sections, photoreceptor synapses in the OPL
were even more disorganized than at earlier ages. The numbers of discernible ribbons at
the OPL in the rge sections were also even more reduced compared to the younger rge
birds but a few could still be observed, sometimes very close to the displaced glycogen

deposits.

137

 

Figure 5.9 - Ultra-thin sections of retinal samples from rge birds at 60 days of age. Cone
cell nuclei (‘) and rod cell nuclei C”) are labeled. A) Gaps between photoreceptor cell
bodies were occupied by Muller cell processes (MC). Abundant long microvilli (mv) of
Muller cells were present between the ISs of the photoreceptor cells. B) Large glycogen
deposits can be observed in abnormal locations (arrow). Normally, glycogen can only be
found in the 183. C) Occasionally whorls of membranes forming densely packed stacks of
coaxial cylindrical bilayers (myelinoid figures) (arrow) were observed in rod cell bodies in
the ONL of rge birds. Bars = 5 pm.

138

 

Figure 5.10 - Semi-thin sections of retinal samples from rge and control birds at 270 days of age.
A) Control retinas show glycogen deposits only in the ISs, external to the outer limiting
membrane, associated with the rod hyperboloid (white arrowheads) and with the cone accessory
cell paraboloid (black arrowheads). Bar = 20 um. B) Larger glycogen deposits were observed at
this age in retinas from rge birds, that quite often were displaced internal to the outer limiting
membrane of the accessory cells of the double cones (arrow). These glycogen deposits are
metachromatic in toluidine bluestained semi-thin sections, appearing pink in color. The 08s are
shorter and the total retinal thickness is obviously decreased. Bar = 20 um. C) Ultra-thin section
of a retinal sample from an rge bird demonstrating finer detail of the very short and disorganized
cone 0Ss (arrow). Bar = 1 pm. D) Ultrastructural detail of glycogen deposits (arrows), present in
the supranuclear cytoplasm of an accessory cone cell (’) and in the subnuclear cytoplasm of a rod
cell C") of an rge bird. Long microvilli (mv) of Muller cells were abundant between the [$3 of

the photoreceptor cells of this age group. Bar = 5 run.

139

5.3.3. Immunohistochemistry results (paraffin-embedded and frozen sections)

Tyrosine hydroxylase (TH) Staining of control retinas was similar to previous
reports . With TH-positive neurites being concentrated at the distal border of the IPL and
at lesser density at 30% and 70% from the IPL—INL interface. In rge retinas, the basic
amacrine cell morphology revealed by TH staining was intact at all ages examined (up to
730 days of age). However, in older rge birds there was an obvious decrease in the
density of TH-positive dendrites (Figure 5.11 E, F & G).

Staining using the monoclonal antibody against mouse opsin (Lab Vision) or the
mouse anti-rhodopsin antibody (rho4D2) was specific for rod photoreceptors and weakly
stained the ISs and strongly stained the 085 in rge and control birds (Figure 5.12). The
pattern of rhodopsin labeling, however, was abnormal in rge birds. An increased amount
of rhodopsin-immunoreactivity was present in the ISs of rge sections, compared to
controls since 13 days of age (Figure 5.12 A versus B). This pattern of labeling was more
pronounced in peripheral regions of the retina. In sections from older rge birds (e. g. 180
and 270 days of age) rod OSs appeared swollen, with loss of the normal architecture and
organization, this was also more pronounced in the periphery of the retina.
Irnmunoreactivity to both these antibodies was localized (abnormally) to the ONL/OPL

region in retinal sections from older rge birds (Figure 5.12 D & F).

140

 

Figure 5.11 - Immunocytochemistry sections using tyrosine hydoxylase (TH) antibody
performed on samples from rge and control birds at 30, 180 and 730 days of age. Bar = 50 um.
Sections from the following retinal samples are shown: A) control bird at 30 days of age; B)
Control bird at 180 days of age; C) rge bird at 30 days of age; D) rge bird at I80 days of age; E)
rge bird at 730 days of age -— central retina, F) peripheral retinal and G) far peripheral retina.
Note that in control retinas TH-positive neurites are found concentrated at the outer border of the
IPL and at lesser density at 30% and 70% IPL-depth. At later stages of development (180 and 730
days of age) there is an obvious decrease in the density of TH-positive neurites in retinal samples
from rge birds (compare A & B with C & D - arrows). However, no loss of TH-positive somata
was observed even at very late stages of the disease (E, F & G - arrowheads). Key: ONL - outer
nuclear layer; INL — inner nuclear layer; IPL — inner plexiform layer; GCL — ganglion cell layer.

141

 

 

 

 

 

Figure 5.12 - Fluorescence photomicrographs (A to D) and conventional photomicrograph using
brown chromogen (E & F) from immunocytochemistry sections using mouse anti-rhodopsin (A to
D) (rho4D2; a gift from Dr. R. Molday, University of British Columbia) and monoclonal
antibody against mouse opsin (E & F) (Lab Vision), respectively. Bars = 50 um. Sections from
the mid- -periphery of the retina from a control (A) and an rge bird (B) at 13 days of age, from a
control (C) and rge bird (D), at l80 days of age and from a control (E) and rge bird (F), at 270
days of age Note the presence of 1ncreasing amounts of- ‘ .ty in the 185 of
the rge samples (white arrows). Note that the opsin labeling in the 185 of control samples is
minimal (A, C & E). Also, note that, compared to controls (C & E), the rod 085 1n the rge retinas
of older birds (D & F) appear swollen, with loss of the normal architecture and organization. The
085 of rge chicks also appeared more widely spaced in comparison to the controls.
Mislocalization of opsin was present in rge retinas samples at the ONIJOPL level (arrowheads).
Key: ONL — outer nuclear layer; INL — inner nuclear layer.

 

142

RCA-1 is a lectin that labels activated microglia in the avian retina. The
distribution and morphology of nricroglia positive for RCA-1 observed in the retina of
control birds was similar to that previously described (Navascues et al. 1994; Won et al
2000). In brief, the majority of RCA—l positive nricroglia in the normal retina is present
in the IPL and OPL, although some microglia] bodies were also seen in the NFL, and
GCL. In the case of the NFL, microglia appeared more often in the area adjacent to the
optic disc. Microglia were ramified through the width of these layers, bearing radial and
horizontal processes (Figure 5.13 A). No microglia were found in the photoreceptor layer
(Figure 5.13 A). There was no detectable morphological change in the microglia at 13
days of age in rge retinas (Figure 5.13 B). However, by 33 days of age, there were
activated microglia present in the IPL and OPL. They were amoeboid-shaped cells with
enlarged somata (Figure 5.13 C). By 92 days of age, many somata of amoeboid nricroglia
were present in the NFL and INL. These cells had short, stout processes extending from
the somata, suggesting that they were highly activated at this time. Furthermore, RCA-l-
labeled cells, similar to microglia or macrophages, were seen in the photoreceptor layer
of rge birds at 92 days of age, suggesting that rrricroglia were highly activated in most
retinal layers at this age (Figures 5.15 D, E & F).

Staining using the LEP-lOO antibody showed differences between rge and control
retinas. The LEP-100 antibody recognizes a lysosomal glycoprotein that is only present
in cells that are actively phagocytic. In rge retinas only, activated phagocytes were
detected in all layers of the retina at 180 days of age, while these cells were not detected

at other ages (Figure 5.14).

143

Glycine-immunoreactive “blobs” were detected mainly in the ISs of some
photoreceptors in the rge retinas (Figure 5.15). Miiller cells appeared to have increased
levels of expression of GFAP in rge retinas by 30 days of age, indicating that these glial
cells were reactive (Figure 5.16). However, by 730 days of age no difference was
observed between rge and control retinas for GFAP-positive cells.

Transferrin binding protein (TfBP) is expressed by Oligodendrocytes in the avian
retina. These latter cells, along with Miiller cells, are believed to be responsible for the
myelination of the intraretinal portions of the ganglion cell axons and the optic nerve
head in the avian retina . No difference in the amount of TfBP-positive Oligodendrocytes

was seen in the rge samples, compared to controls, at any age examined.

144

 

 

 

 

 

 

Figure 5.13 - Immunocytochemical stained retinal sections using RCA-l antibody of control
(A) and rge chicks at 13 (B), 33 (C), and 92 days (D, E & F) of age. A) Most ramified
microglia are located in the nerve fiber layer (NFL) inner plexiform layer (IPL), and outer
plexiform layer (OPL). There was no significant difference in microglia] morphology
between control and rge retinas at 13 days of age. C) In rge retinas from chicks at 33 days of
age, some microglia in IPL and OPL showed amoeboid-shape indicating activation of these
cells. D, E & F) retinal samples from rge birds at 92 days of age. Note many amoeboid
microglia with stout processes are seen in INL and NFL (D) and RCA—l-labeled cells similar
to macrophages (E) or microglia (F) were present in the photoreceptor layer. Bar = 50 um.
Key: PRL — photoreceptor layer; ONL — outer nuclear layer; OPL- outer plexiform layer;
INL — inner nuclear layer; IPL — inner plexiform layer; GCL — ganglion cell layer; NFL -
nerve fiber layer.

145

 

0 6

Figure 5.14 - Immunocytochemistry of retinal sections using LEP-lOO antibody. Sections from
the following retinal samples are shown: A) retinal section from a control bird at 180 days of age;
B) control chick at 30 days of age; C) rge chick at 30 days of age; D) mid-peripheral retinal
section of an rge bird at 180 days of age; E) far-peripheral retina of an rge bird at 180 days of age
and F) central retinal section of an rge bird at 730 days of age. Note the difference between rge
(C, D & E) and control (A & B) samples. Several retinal layers of the rge retinas, mainly ONL,
OPL, INL, IPL and GCL at 30 and 60 days of age were positively stained for this antibody. At
730 days of age no difference could be detected between rge and control samples. Bar = 50 pm.
Key: ONL - outer nuclear layer; INL — inner nuclear layer; IPL - inner plexiform layer; GCL —
ganglion cell layer.

146

 

Figure 5.15 - Immunocytochemistry of retinal sections using anti-glycine antibody. Sections
from the following retinal samples are shown: A) control bird at 180 days of age; B) control chick
at 30 days of age; C) rge bird at 180 days of age; D) rge chick at 30 days of age; E) retinal section
from an rge bird at 730 days of age F) peripheral retina of an rge bird at 730 days of age. Note the
glycine-immunureactive “blobs"(arrows) detected in the ISs of some photoreceptors in retinas
from older rge birds (D & E). Bar = 50 um. Key: ONL — outer nuclear layer; INL — inner nuclear
layer; IPL — inner plexiform layer; GCL — ganglion cell layer.

147

 

 

Figure 5.16 - Immunocytochemistry of retinal sections using anti-GFAP antibody. Sections

from the following retinal samples are shown: A) control bird at 30 days of age; B) rge chick

at 30 days of age; C) peripheral retina of an rge chick at 30 days of age; D) control bird at

180 days of age; E) rge bird at 180 days of age F) peripheral retina of an rge bird at 180 days

of age. Note the rge retinas appear to have a progressive increase of GFAP expression.

indicating that glial cells (Miiller cells) are reactive. Bar = 50 um. Key: ONL - outer nuclear
layer; INL - inner nuclear layer; IPL — inner plexiform layer; GCL - ganglion cell layer.

The anti-calbindin and GCAPl antibodies stained the numerous cone cells in both

rge and control retinal samples. No difference between rge and control samples was

observed between the amounts of positive cone cells for both these antibodies at any age

examined. Furthermore, no obvious differences in labeling patterns for Vampl, GABA-A

receptor and SV2, were seen between control and rge birds or between sections of the

two different ages of rge bird studied (7 and 14 days of age). The pattern observed with

VAMP-l staining was similar to the one described in mice . The antibody against the [3

subunit of the GABA—A receptor stained both, rge and control chick retinas in a similar

148

pattern, comparable to that previously described in normal chicken retinas . No
differences in labeling pattern for caspase 3 were observed, comparing retinal sections
from controls and rge birds.

The staining for synaptic vesicle protein 2, a ubiquitously expressed synaptic
vesicle protein, revealed abnormalities in the stratification of the OPL in the rge birds
compared to controls, substantiating the results observed ultrastructurally. Analyzing
samples that were irnmunocytocherrrically stained for visinin, only a mild distortion in the
normal arrangement as well as a mild loss of reactivity could be observed at 180 and 730
days of age in rge retinas (data not shown).

Additionally, no differences could be noted when comparing retinal samples from
rge chicks with controls labeled with antibodies against B3-tubulin and glucagon. Also,
there was no obvious difference between rge chicks and controls in the distribution of
retinal neurons that express the neurofilament, virnentin, Hu, Isletl, or TrkA (horizontal

cells).

5.3.4. TUNEL Staining

No TUNEL-positive cells were detected in retinal sections from rge or control

birds.

149

5.3.5. Detailed examination of the linear fundus lesions in semi-thin and ultra-thin

sections

The fundic lesions present in the retinal cups from 2 rge chicks at 49 days, 1 at 84
days and 1 at 336 days of age were examined macroscopically in enucleated eye globes.
Similar lesions were present in all four birds. They occurred bilaterally and were linear,
pale-colored (white to gray) and sometimes branching. They ranged from approximately
0.5 mm to 1 mm in width and from 2.5 to 12 mm in length (Figure 5.17). The number of
lesions found in the retinal cups varied from one to 8. The linear lesions most commonly
had a vertical orientation, however, horizontal branches were also found occasionally.
Linear lesions appeared to radiate from the pecten and optic nerve area.

Microscopically, the retina of the rge birds adjacent to the lesions had a relatively
normal retinal architecture with a normal appearing and continuous Bruch's membrane-
retinal pigment epithelium-choriocapillaris complex and normal photoreceptor-retinal
pigment epithelium interface (Figure 5.18 A). Sections through the fundic lesions
showed that there was a mild focal fibrosis at the level of the inner choroid and a focal
absence of the retinal pigment epithelium and an accumulation of eosinophilic, hyaline
material in the subretinal space. The overlying photoreceptor inner and outer segments
were disorganized and there was thinning and displacement of the inner and outer nuclear
layers (Figure 5.18 B).

Semi-thin sections from the retina adjacent to the lesions showed a normal
Bruch’s membrane lined on the retinal side by retinal pigment epithelium and on the

choroidal surface by choriocapillaris (Figure 5.18 C). Semi-thin sections of the lesion

150

itself revealed a focal absence of the retinal pigment epithelium layer, rupture of Bruch’s
membrane with scar formation, deposition of collagen fibers and abnormal presence of
retinal pigment epithelium cell melanosomes external to the ruptured Bruch’s membrane
(Figure 5.18 D).

Ultrastructural examination of the Bruch's membrane- retinal pigment epithelium-
choriocapillaris complex from an area adjacent to the retinal lesions showed a normal
intact Bruch’s membrane with normal relationship to the retinal pigment epithelium
(Figure 5.19 A). The affected area had a loss of the normal architecture of the Bruch’s
membrane- retinal pigment epithelium-choriocapillaris complex. There was a complete
rupture of Bruch’s membrane and along the inner surface fibroblasts formed an ahnost
continuous layer that separated the outer retina from the choroid. The choriocapillaris
was replaced with a pronounced deposition of collagen, debris from retinal pigment
epithelium (necrotic cells containing dispersed melanosomes) and photoreceptor cells

(Figure 5.19 B).

151

 

 

 

 

 

Figure 5.17 — Photograph of the posterior eyecup from a 49—day-old rge bird showing lacquer
cracks. The lacquer crack lesions appear as multiple white to gray linear lesions (white arrows).
extending from the pecten to the periphery. Additionally, an area of subretinal hemorrhage (white
arrowheads) is present.

152

 

 

Figure 5.18 — Plastic and resin-embedded retinal sections from rge birds demonstrating
morphologic details of the lacquer crack lesions. A) Eye of an rge bird at 49 days of age. Cross
section through a region of retina adjacent to the lesion shown in B. The retinal architecture is
relatively normal with a normal retinal pigment epithelium layer and normal photoreceptor-
retinal pigment epithelium interface. However, there is a mild dilation of the photoreceptor inner
and outer segments, which is typical of early stage changes observed in the rge phenotype. B)
Cross section through one of the lesions shown in Figure 5.17 from the central retina. Note the
mild focal fibrosis at the level of the inner choroid (black arrowheads) and the absence of retinal
pigment epithelium (white arrowheads). There is an accumulation of eosinophilic material in the
subretinal space. The overlying photoreceptor inner and outer segments are disorganized and
there is thinning and displacement of the outer and inner nuclear layers (black arrow). Stained
with H&E. Size bar = 150 pm. C & D) Eye of an rge bird at 336 days of age. C) This shows the
region adjacent to the lesion that is shown in D. Bruch’s membrane is intact (arrow) and is lined
by the RPE layer on one side and the choriocapillaris on the choroidal side. D) Details of a linear
lesion showing an absence of the normal retinal pigment epithelium layer, rupture of Bruch’s
membrane (arrow), scar formation with deposition of collagen fibers and the abnormal presence
of retinal pigment epithelium cell melanosomes on the choroidal side of Bruch’s membrane.
Stained with toluidine blue. Size bar = 20 11m.

153

 

Figure 5.19 — Ultra-thin section from the eye of an rge bird at 336 days of age. A) This section
shows the Bruch’s membrane- retinal pigment epithelium interface from a region adjacent to the
lesion shown in B. Notice the detail of a normal retinal pigment epithelial cell and the integrity of
the Bruch’s membrane (arrows). Transmission electron microscopy. Size bar = 2.5 pm. B)
Section through a LCL. Bruch’s membrane in the lesion is ruptured (arrow), there is absence of
retinal pigment epithelium, and there is collagen fiber deposition between the retina and choroid,
forming a scar (arrowheads). Transmission electron microscopy. Size bar = 5 pm.

5.4. Discussion

The vision of rge chicks deteriorates over the first few weeks after hatch and is
worse under lower lighting conditions and by approximately 30 days after hatch vision
has deteriorated to such an extent that they are functionally blind. Intriguingly, under
light microscopy examination, retinal morphology in the rge retinal sections is
remarkably preserved despite of the loss of vision.

The results from this study, including a detailed morphological examination,
ultrastructural analysis, and immunocytochemistry, revealed several abnormalities in
different retinal regions of the rge birds, particularly the OPL where the earliest
morphological changes were noted. The photoreceptor pedicle arrangement in the rge

birds appeared disorganized with loss of the normal regular bi-layered structuring seen in

control birds. The photoreceptor pedicles and spherules themselves were also clearly
distorted and became more severely distorted as the disease progressed. They also
appeared to have fewer synaptic ribbons and were usually larger, more electrolucent and
contained abnormally shaped synaptic vesicles. The smooth endoplasmic reticulum
(SER) could frequently been seen within the photoreceptor cell bodies rather than the
inner segments. This was particularly apparent in accessory cells of the double cones.

The morphological abnormalities in the photoreceptor synaptic terminals may
indicate abnormal physiological function and could underlie the vision loss that occurs in
the rge birds in the absence of marked photoreceptor cell loss. The vesicular changes
observed in the synapses, along with the apparently less numerous ribbons, might suggest
a defect in the vesicle formation machinery or a defect in the endo- or exocytosis
mechanisms.

The presence of abnormal synaptic vesicles along with the morphological changes
observed in the photoreceptor pedicles of rge birds are somewhat similar to the ones
observed in the photoreceptor synapses of synaptophysin knockout mouse and in the
rdgE (Drosophila retinal degeneration E) . Both exhibited a number of synaptic and
vesicular defects. Some of these defects are similar to the ones observed in rge chicks
such as a buildup of very large multivesicular bodies and an increased amount of rough
endoplasmic reticulum.

Previous optokinetic and ERG studies showed that the rge birds had reduced visual
function under low-lighting conditions suggesting that rod dysfunction preceded loss of
cone-mediated vision; see Chapter 2 and 3. As the disease progressed a generalized

shortening and disorganization of all photoreceptor OSs developed. Opsin

155

imrnunohistochemistry showed abnormalities in rods from 12 to 13 days of age. Initially
there was increased opsin-immunoreactivity in the ISS and later nrislocalization to the
ONL. Furthermore there was a progressive decrease in the number of rod 055 per unit
length of retina. Mis-routing of opsin is typical of damaged or abnormal rods and has
been observed in other forms of inherited retinal degenerations, such as in people
suffering from retinitis pigmentosa and in the tulpl-/- mice .

Abnormal localization and progressive accumulation of glycogen occurred in the
photoreceptor perinuclear region associated with the abnormally located RER resulting in
large glycogen deposits in older rge birds very close to the nucleus and synaptic area.
This glycogen accumulation and mislocalization was not associated with lysosomal
membranes as is the case with glycogen accumulation observed in retinal glycogenosis
(Pompe disease), where the glycogen accumulation is present in most cell types in the
retina and always associated with lysosomes . Other types of glycogenosis were ruled out
by the fact that liver, heart, brain and skeletal muscle did not show any sign of glycogen
accumulation, as assesd by PAS staining, at any age group of rge birds. Additionally in
the older affected birds myelinoid bodies developed in the photoreceptors between the
nucleus and the synaptic terminal. One suggestion for the development of myelinoid
bodies is degeneration of ER , however the link between the myelinoid bodies and
abnormal location of RER with associated glycogen accumulation is not clear. The
glycine-positive "blobs", present in the rge retinas, were glycine accumulations in the ISs
of some photoreceptors. This may indicate abnormal photoreceptor metabolism.

The results from retinal thickness measurements confirm the previous initial

impression of progressive retinal thinning. Initially, the ventral regions and far dorsal

156

peripheral regions of the retina were the ones that presented the greatest reduction in
thickness. This is possibly a direct consequence of globe stretch caused by the globe
enlargement that occurs mainly at the equator of the globe. At later stages a generalized
thinning occurs. In the early stages of the disease, the greatest decrease in thickness
occurrs in the inner retina. Ganglion cells, however, do not seem to be decreased in
numbers despite the retinal stretch. Markers used for amacrine and horizontal cells also
showed no significant loss in these two cell populations. The decrease in TH-positive
dendrites from amacrine cells likely resulted from retinal stretch caused by the increased
globe enlargement. This is consistent with previous findings that the density of TH-
positive amacrine cells decreases while total cell numbers within the retina remain
constant with the increased ocular growth and passive retinal stretch . In retinas from rge
birds, the TH-positive cells do not appear to sprout additional neurites to maintain a
constant density of dendrites during the retinal stretch that occurs. By contrast, the
density of TH-positive dendrites is maintained in experimentally induced retinal stretch .
This finding suggests that the rge phenotype includes the inability of some types of
amacrine cells to sprout dendrites. It has previously been shown that amacrine cell death
is one cause of globe enlargement and that TH and glucagon-containing amacrine cells
have been implicated in regulating the overall growth of the eye . However these cell
types are present in affected birds showing that globe enlargement is not secondary to
their complete loss .

In the later stages of the disease marked gliosis develops. Glial processes occupy
spaces in the OPL where pedicles and spherules normally would have been located, and

they also fill gaps between the somata of photoreceptor cells. This glial activation is

157

substantiated by increased GFAP and RCA-1 staining (indicating activated glial and
nricroglial cells). It is not clear whether the gliosis develops in response to the
development of gaps between cells, triggered by the progressive retinal stretch, or due to
spaces caused by a disease associated injury and loss of retinal cells. The increased
immunoreactivity to LEP-100 in the rge retina suggests the presence of activated
phagocytes. These phagocytes may have been activated by growth factors and cytokines
that might be somehow elevated in the retinas from rge birds. Judging by the different
sizes and morphology of some of the LEP-lOO-positive cells, these cells appear to be
macrophages that have migrated into the retina, while others might be activated resident
nricroglia. Despite this activation, no morphological (LM or EM), immunocytochemical
(caspase 3) or molecular (TUNEL) evidence of apoptosis could be detected. It seems
likely that cell loss in the rge retina occurs very gradually during several months. By 730
days of age no difference could be detected between rge and control sections for GFAP
and LEP-lOO immuno-staining, indicating that most of the glial activation and, perhaps,
phagocytosis has been terminated at that time point.

The linear retinal lesions examined in this study are similar to the lesions
experimentally produced by when inducing form-deprivation myopia in chicks, by in
constant light exposure chicks, and lacquer crack lesion (LCL) in humans with pathologic
myopia . All of these linear retinal lesions share the following characteristic histologic
features: loss of retinal pigment epithelium, rupture of Bruch’s membrane and disruption
of the choriocapillaris. LCLs are a well-characterized pale coloured (white to gray), linear
lesions of the ocular fundus that deve10ps in human patients as a secondary manifestation

of a severe form of myopia, called pathological myopia . LCLs are thought to represent

158

mechanical breaks in the Bruch's membrane- retinal pigment epithelium-choriocapillaris
complex due to progressive posterior segment elongation . LCL is also thought to be an
extremely important predisposing factor in the formation of choroidal neovascularization,
which is a severe fundus alteration found in patients with advanced pathological myopia .
In a recent study of human patients with pathological myopia, 29.4% of eyes with LCL
developed myopic choroidal neovascularization during the follow-up period . The
reported prevalence of LCL in humans with pathological myopia varies between 0.6% ,
4% and 15.7% . As a general rule, the presence of these lesions implies a guarded
prognosis for the retention of central vision of human patients suffering from pathological
myopia .

A limited number of publications are available describing the histopathological
features of human LCL, probably due to its early occurrence in the course of myopic
macular degeneration . Understandably, myopia by itself is not a major cause of
enucleation and consequently, represents a small percentage of samples submitted to
ocular pathology laboratories.

It appears that the exaggerated internal cartilaginous layer growth in the rge
chicks forces the remodelling or stretching of the fibrous layer of the sclera and Bruch’s
membrane to the point of rupture of the latter. This additionally induces mechanical
breaks in the retinal pigment epithelium and choriocapillaris complex, all of which
characterize classical LCLs. Posterior segment enlargement in the rge chick causes
lesions that are histologically identical to LCL.

To our knowledge, there are no reports of other spontaneously occurring animal

models of globe enlargement with LCL formation. A laboratory animal model of

159

spontaneously occurring LCLs, such as the rge chick, would greatly facilitate future
research toward the complete understanding of the pathological mechanism underlying its
manifestation in human patients with severe myopia.

The rge phenotype appears unique with morphological features quite unlike those
described in the other forms of chicken retinal dystrophies such as rd, rdd, dam and beg .
ERG responses in young rge chicks show supernormal b-wave amplitudes to brighter
light stimuli (Chapter 3). A similar ERG abnormality can be seen in mice and humans
with NR2E3 gene mutations ; however, morphologically the diseases are quite different.
Unlike the NR2E3 mutant mice and humans in which S-cone photoreceptors are present
at greatly increased numbers, in the rge chicken there were no obvious changes in
photoreceptor populations. Molecular genetic studies to identify the causal gene
mutation should help explain why the morphological features of the rge phenotype
develop and clarify the association with the vision loss and the electroretinographic

abnormalities.

160

CHAPTER 6
CONTRIBUTIONS TO THE MOLECULAR CHARACTERIZATION OF THE

rge DEFECT

6.1. Introduction

Prior research showed that the rge phenotype is inherited in an autosomal
recessive fashion , but the specific gene mutation had not been characterized The gene
mutation underlying one other autosomal recessive retinal dystrophy in chickens, the rd
chicken, had been identified however . The same mutation was also shown to be the
cause of retinal dystrophy in another strain of chickens that had been thought not to be
related to the rd strain . It was considered prudent, therefore, to ensure that the rge chick
was not just an additional strain in which the rd mutation was present before spending
time investigating the rge phenotype.

The rd chicken has a null mutation in the photoreceptor guanylate cyclase gene
(GUCY1*B) caused by a deletion of approximately 22 kb which spans exons 4 to 7 .
Thus, our first experiment was to use an RT-PCR assay to show that the rd mutation was
not present in the strain of chickens we were planning to study.

Once the rd mutation had been excluded we planned to map the rge locus. At the time
that we had performed the breedings to produce a pedigree for mapping and were
collecting the necessary DNA samples, researchers from the Roslin Institute (Edinburgh)
reported they had mapped the rge defect to chicken chromosome 1 . We, therefore,
changed our plans to build on that mapping and to try to narrow the chromosomal

interval to which rge mapped. Once the rge confidence interval was narrowed we aimed

161

to use comparative mapping and the information from the human genome project to

identify positional candidate genes for further studies.

6.2. Material & Methods

6.2.1. Testing the rge chicken for the deletion of the guanylate cyclase gene present in the

rd chicken

a) Isolation of total RNA

Immediately following euthanasia the globes were enucleated and retinas were
dissected from 3 rge/rge, 3 rge/+ and 2 +/+ birds and immediately frozen in liquid
nitrogen.

RNA was prepared using sterile, disposable, RNase free plasticware and solutions
prepared with 0.1% diethylpyrocarbonate (DEPC, Sigma) to minimize RNase activity.
Items such as rrricropestles and spectrophotometer chambers were soaked overnight in
50:50 (v/v) rrrixture of methanol and concentrated HCl and then rinsed repeatedly with
DEPC treated water.

Total retinal RNA was extracted using trizol (Invitrogen) reagent method. In brief:

0 Retinal tissues were placed in 1.0 ml of ice-cold trizol in a 5 ml rrricropestle

tube (Kontes Glass Co. Duall ® 22) and homogenized

0 The homogenized retina was further sheared by several passes through a 22

gauge needle. For each 1 ml of trizol used 0.2 ml chloroform was added

162

0 The solution was mixed by repeatedly inverting the nricrocentrifuge tube for 5
seconds and then incubated for 3 rrrinutes at room temperature. The solution
was then centrifuged for 15 rrrin at 8500 rpm

0 The aqueous layer was then transferred to a clean-RNase free tube and 0.5 ml
isopropanol was added

0 The tube was incubated at room temp for 10 rrrin, then spun for 10 rrrin at
8500 rpm. The RNA pellet could then be seen

0 The isopropanol was removed and the pellet washed with 1 ml (per ml of
Trizol) of 75% ethanol then spun for 5 nrin at 8500 rpm

0 The ethanol was then carefully removed leaving the pellet inside the tube

0 The tube was air dried for 10 rrrinutes and 50 it] of RNase free water was then
added

0 The presence and quality of the RNA was checked by running the product on
a 1.5% agarose gel and judged by the presence of 18S and 288 ribosomal
RNA bands and a lack of RNA degradation products

The concentration and degree of contamination of the RNA was checked by

spectrophotometry at wavelengths of 260 nm and 280 nm. The reading at 260 nm
allowed calculation of RNA in the sample. An OD of 1 corresponds to ~ 40 rig/ml for
single stranded RNA. The ratio of the readings at 260nm and 280 nm (ODzm: Ongo)
provides an estimate of the purity of the RNA. Pure preparations of RNA have OD260:
Ongo ratio value of 2. In this protocol, lower ratio values were considered as suggestive
of significant contamination with protein or phenol.

0 The extracted total RNA was stored at -80 °C until used.

163

b) First strand cDNA synthesis
0 First strand cDNA was synthesized using a First Strand cDNA Synthesis Kit
(MBI Ferrnentas). The kit relies on a cloned enzyme, Moloney Murine
Leukemia Virus (M-MuLV) reverse transcriptase. In brief, the protocol is as
follows:
The following reagents were placed in an RN ase-free microcentrifuge tube:
0 Total RNA 511g
0 Primer: oligo(dT)13 0.511 g
0 deionized water (nuclease free) to 111.11.
The solution was incubated at 70°C for 5 minutes and chilled on ice. The
following reagents were added in the following order:
0 5X reaction buffer (250 mM Tris-HCl, pH 8.3 at 25°C, 250 mM KCl, 20
mM MgC12, 50 mM DTT) 4111
o 10mM 4 dNTP mix 2p] (1.0mM - final concentration)
0 ribonuclease inhibitor 20 units
0 deionized water (nuclease free) to 19111.
The solution was then incubated at 37°C for 5 rrrinutes and 40 units of M-MuLV
reverse transcriptase were added. The reaction mixture containing oligo(dT)1g was then
incubated at 37°C for 60 rrrinutes. The reaction was stopped by heating to 70°C for 10

minutes.

c) PCR amplification of a portion of the chicken guanylate cyclase and rhodopsin cDNAs

164

Amplification of a portion of the chicken guanylate cyclase gene spanning the site
of the rd mutation was performed using a forward primer flanking the deletion site within
exon 4 (SPJ 342 -S' - CCTTCCCCCTGCCCTACCAC) and a reverse primer flanking
exon 7 (SPJ 343 -5’ - TAATGATGCCGATGCCGTAAACGT) with total retinal cDNA
as a template. PCR amplification of rhodopsin as a positive control was also performed
(forward primer: Rho-1 -5’ — CATCATGGGGGTCGCGTT‘CTCCT and reverse primer:
Rho-2 - 5' - CCATGCGGGTCACT'I‘CCT'I‘CTC). The PCR mixtures were as follows: 50
til reaction volume containing 200 mM Tris-HCl, pH 8.4; 50 mM KCl; 1.5 mM Mg C12;
1% bovine serum albumin and 0.1 mM each of dATP, dCTP, dGTP and dT'I'P; 0.5 M of
each primer; and 1 unit of Taq DNA polymerase (Invitrogen, Life Technologies). The
cycling conditions were: denaturing at 95°C for 3 nrinutes, followed by 45 cycles of
denaturing at 95°C, 30 seconds; annealing at 60°C, 30 seconds; extension at 72°C, 30
seconds and a final cycle of extension at 72°C for 5 rrrinutes.

The PCR products were analyzed by electrophoresis of an aliquot on 1.5%
agarose in TAE buffer. For visualization of the bands, ethidium bromide was added in the
concentration of 0.5 rig/ml before the gel solidified. PCR products were mixed with
loading buffer (0.25% bromophenol blue; 40% (w/v) sucrose in water), in a 1:6 dilution.
The gels were run with 1x TAE buffer (40 mM Tris-acetate; 2 mM EDTA, pH 8.0) at 80
V/cm. A commercial DNA size marker (1 kb DNA Ladder BioLabs) was run in adjacent

lanes and used to estimate the size of the PCR product.

6.2.2. Mapping of the rge region

165

 

 

A group at the Roslin Institute found that nricrosatellite marker LE10071 on
chromosome 1 was linked to the rge phenotype . The LE10071 region on chicken
chromosome 1 is a region with poor comparative synteny to man. The region is
equivalent to the following portions of the human genome: 12p13, 7q35, 22p13.31 and
lp13.1. The Roslin group also investigated positional candidate genes: ABCA4, mutated
in Stargardt macular dystrophy in humans ; IMPDHl, the gene underlying the RP10
retinal dystrophy in humans; and TIMP3, a gene mutated in humans with Sorsby's
Fundus Dystrophy . Their studies excluded those genes . In order to refine the Roslin
Institute group mapping, rge affected sires were mated to clinically normal carrier hens to
produce a population with approximately 50% rge and 50% carrier progeny. These were
typed using markers that mapped to chicken chromosome 1.

Blood was collected for DNA isolation from the jugular vein using a 1 ml syringe
with a 30-gauge needle. Blood was then transferred to EDTA tubes and placed on ice if
extraction was to be performed immediately, or stored at -20°C until processed. Frozen
blood was thawed on ice and processed in 5 ml aliquots. A typical method for
mammalian DNA extraction was used:

0 The blood sample was gently mixed with an equal volume of 2x red blood
cell lysis solution (0.65 M sucrose; 20 mM Tris-HCl, pH 7.8; 10 mM
MgC12; 2% triton X-100 WV)

0 Following incubation on ice for 15 rrrinutes the solution was centrifuged at
2,360 rpm for 12 minutes at 4°C and the supernatant was discarded. If
heavy contamination with hemoglobin remained, a further volume of 2x

lysis buffer was added and the centrifugation repeated

166

The red blood cell nuclei and leukocyte pellet was resuspended in 2 ml of
75 mM NaCl; 24 mM EDTA by pipetting and the suspension transferred
to a Phase Lock gel light tube (Brikmann Eppendorf) and 100 pl of 10
mg/ml proteinase K (in 50 mM Tris-HCl, pH 8.5; 5 mM CaClz) added and
then sodium lauryl sulfate (SDS) added to a final concentration of 1% w/v
and the mixture incubated overnight at 37°C, rrrixing gently. This results
in liberation of DNA and digestion of protein

A phenol extraction was then performed. 4 ml of phenol was added to the
mixture followed by gentle shaking to mix the two phases. The suspension
was centrifuged at 3000 rpm for 5 rrrinutes to separate the phenol and
aqueous phases

The aqueous phase was decanted into a fresh Phase Lock gel light tube
and an extraction performed as above but using 4 ml of a 50/50 (v/v)
phenol chloroform mixture

The DNA was precipitated by adding 100 pl of 2 M KCl, mixing and then
overlaying with 5 ml of 95% ethanol. The two phases were mixed by
gently swirling the tube and the precipitated DNA strands removed with a
glass pipette, washed in 70% ethanol and after the excess ethanol had
dripped off placed in 200 ll] of TE (10 mM Tris-HCl, pH 7.8; 1 mM
EDTA)

The DNA was allowed to dissolve by leaving it overnight at 4 °C

Since the avian blood has nucleated red blood cells, and the extraction

protocol was designed for mammalian blood, the resulting concentration

167

 

of DNA was typically higher and had to be further diluted. The DNA was
further diluted prior to PCR reactions.

The quantity and purity DNA was checked by spectrophotometry at wavelengths
of 260 nm and 280 nm. The reading at 260 nm allowed calculation of RNA in the sample.
An OD of 1 corresponds to ~ 50 pig/ml for double stranded DNA. The ratio between the
readings at 260nm and 280 nm (OD260: Ongo) provides an estimate of the purity of the
DNA. Pure preparations of DNA have OD260: Ongo ratio value of 1.8. Lower values
were considered as suggestive of significant contamination with protein or phenol.

To identify linked markers to rge, selected rrricrosatellite markers from the region
of chicken chromosome 1 were screened and the allelic patterns compared between DNA
pools from 32 carrier (heterozygous) and 31 affected (homozygous) chicks. Informative
microsatellite markers were genotyped on all the progeny; primers were fluorescently-
labeled for use on ABI automated sequencers. Linkage analysis was performed using
Map Manager 7, which is a program that determines marker order by pairwise
comparisons . This portion of the work was performed at Dr. Hans Cheng’s laboratory at

the USDA’s Avian Disease and Oncology Laboratory in East Lansing, MI.

6.2.3. Mapping and sequencing of candidate genes

Positional candidate genes were selected based on the refined mapping of the rge
locus. The region of the human genome (12 p11-13) that was the equivalent to the refined
confidence interval chicken chromosome 1 was scanned for genes involved in retinal

function using the Human Genome Browser (http://genome.ucsc.edu/). Particular

168

attention was given to genes expressed in structures of the outer plexiform layer, for
example those involved in synaptogenesis, synaptic vesicle formation and synaptic
ribbon formation (see Chapter 5). If the chicken homologue of the candidate gene had not
been sequenced, then the coding sequence of the gene (for human) was screened against
chicken trace sequences and expressed sequence tags (ESTs) (400,000+ and growing) by
BLAST, via NCBI website (http://www.ncbi.nlm.nih.gov/blast/tracemb.shtml/). If a
gene was not represented in the chicken trace sequences or ESTs, primers were designed
from well-conserved regions of the gene that were identified by comparing the gene
sequence in other species (typically human and mouse). We have found that
approximately 50% of primer pairs designed by such a technique yield the correct
product.

Primers were designed using the program PrimerQuest
(http:llbiotools.idtdna.com/primerquestl), to generate small exonic products (200 ro 500
bp) for Radiation Hybrid mapping. PCRs were performed using DNA from homozygous
normal and rge chicks as template. The conditions for most of the PCR reactions were:
denaturing at 95°C for 3 rrrinutes, followed by 35 cycles at denaturing at 95°C, 30
seconds; annealing at 60°C, 30 seconds; and extending at 72°C, 30 seconds with a final
extension of 72°C for 5 minutes. To confirm that the selected candidate gene was mapped
to the same region of chicken chromosome 1 as the rge locus, they were mapped using a
chicken radiation hybrid panel. A 6,000 rad chicken radiation hybrid (RH) panel
developed by Alain Vignal and co-workers was used (INRA, France; ). The DNA from
90 pools of chicken-hamster hybrid cells were used in PCR reactions using the gene

specific primer pairs that had previously been shown to amplify the correct product. The

169

results from the PCR reactions using the DNA of each hybrid cell were submitted to
Alain Vignal and co-workers and a correlation analysis was performed in order to map
the chromosomal location of the gene being investigated. In brief, the closer the gene is
to the nricrosatellite marker on a chromosome, the less likely it is that an x-ray induced
break will occur between them; as a result, two genes in physical proximity are retained
in many of the same hybrids, whereas genes that are not close together usually reside on
different chromosome fragments and therefore are usually not present in the same
hybrids. The statistical analysis will indicate how often two genes are concordant in
radiation hybrid clones provides a measure of distance between the genes . The RH work
was performed at Dr. Jerry Dodgson’s laboratory, at Michigan State University.

Positional candidate genes that were confirmed as candidates by RH mapping
underwent sequencing. Primers were designed to PCR-arnplify (as described above) the
exonic and exonic/intronic boundaries of the gene. The primers were designed in such a
way that the expected sizes of the products were always around 500 to 700 bp.

The products of the PCR reactions were analyzed by electmphoresis on 1.5% agarose
gel (as described above).

When the PCR product produced a visible band of the expected size, the DNA
fragment band was excised the from the agarose gel with a scalpel blade and its DNA
content was extracted using a QIAquick Gel Extraction Kit (Qiagen) as follows:

0 The gel slice was weighted and placed in a colorless 1.5 nrl tube. Three
volumes of Buffer QG (solubilization and binding buffer, which contains the

chaotropic salt guanidine thiocyanate) were added to one volume of gel

170

 

o The tube was then incubated at 50°C for 10 rrrin (or until the gel slice has
completely dissolved). The tube was then vortexed every 3 rrrinutes during the
incubation

0 One gel volume of isopropanol was added to the solution and mixed by
vortexing. The solution was then placed in a spin column inside a 2 ml
collection tube and centrifuged at 13,000 rpm for 1 min

0 The flow-tlrrough was discarded and the spin column was placed back in the
same collection tube. 0.75 ml of Buffer PE (wash buffer in which the basic
component is ethanol) was added to the spin column and centrifuged at 13,000
rpm for l rrrinute

o The flow-through was again discarded and the spin column was centrifuged at
13,000 rpm for an additional 1 rrrinute

0 The spin-column was placed into a clean 1.5 ml nricrocentrifuge tube and to
elute the bound DNA 30 pl of Buffer EB (10 mM Tris-Cl, pH 8.5) was added
to the center of the spin column membrane

0 The column was left at room temperature for 1 rrrin, and then centrifuged one
more time at 13,000 rpm for l nrinute. The flow-through contained the
purified DNA.

The amount of DNA in the purified product was evaluated by comparative
analysis on an agarose gel using DNA weight markers of a known loading (DNA Ladder
BioLabs). Each gel-purified product (containing a minimum concentration of 20 ng of
DNA) was then submitted for sequencing in two tubes, containing 30 pmoles of the

forward or reverse primer (two separate reactions) in a total reaction volume of 12 pl.

171

Sequencing was then performed using an ABI PRISM® 3100 Genetic Analyzer, which is
a multi-color fluorescence-based DNA analysis system, at MSU’s Genomics Technology
Support Facility (httpzllgenomics.msu.edu/GTSF/DNA_Sequencing.html/).

Sequences were analyzed with BioEdit Sequence Alignment Editor for Windows

software (http://www.mbio.ncsu.edu/BioEdit/bioedit.htrnl).

172

 

6.3. Results

6.3.1. Testing the rge chicken for the deletion of the guanylate cyclase gene present in the

rd chicken

Primers designed to amplify the region corresponding to exons 4 to 7 of the
chicken guanylate cyclase resulted in two products (Figure 6.1) that corresponded to the
expected sizes (1416 and 1329 bp). The smaller fragment corresponded to a splice variant
87-bp shorter, which is unique to avian species . Amplification of rge and carrier retinal

cDNA also produced two products of the same size as the normal control.

173

 

 

Normal Carrier rge
t

1 1‘ Inn-debt

 

1636 hp
1018 bp

517 bp

298 bp

 

Control Rho Control Rho Control Rho

Figure 6.1 - Result of RT—PCR from retinal tissue from a normal, a carrier and an rge bird
on 1.5% agarose electrophoresis gel. All samples showed the correct expected fi‘agment
(around 1500 hp with a 87bp shorter fragment produced by alternative splicing) indicating
the absence of the rd-chicken mutation (a deletion on the guanylate cyclase gene). A known
rhodopsin product (around 300 bp) served as the positive control for each test. A reaction in
which no cDNA template was added served as a negative control. Key = GC = guanylate
cyclase.

6.3.2. Mapping of the rge region

It was confirmed that microsatellite marker LEIOO71 on chromosome 1 is linked to
the rge defect . This linkage to rge was confirmed by individual genotyping of all
progeny using LEIOO71 and MCW0058, another microsatellite that co-segregates with
LEIOO71 on the East Lansing genetic map (see Figure 6.2). One recombinant was
revealed, a single carrier (chick #683C) was homozygous instead of the expected
heterozygous genotype for both markers. Assuming complete penetrance of the rge trait,

this would indicate that LEIOO71 and MCW0058 are approximately 2 cM or less from the

174

rge locus. Another microsatellite marker, MCW0318, however, was found to absolutely

co-segregate with rge, showing no recombination.

 

 

 

200.1 ‘3 ALVEl 11010319 LDHB MSU0463

299.7 + 145110317

213.5 3: ROS a3 39

217.4 + ADLazsz GAPD 11510071 MCW0058 LMALIOY

221 3 'il' CD4 “0318

223 4 1; 1510137
229.2 -P LEImOl

235.9 -- ADL0010

 

 

Figure 6.2 - Genetic map for the rge region. East Lansing genetic map with the marker

(MCW0318) tightly linked to rge (highlighted).

Unlike most regions of the chicken genome, the rge region does not show a single

conserved synteny to the human genome. However, human 12p1 1-13, which contains

GAPD and CD4 (Figure 6.3), is the region that exhibits the highest amount of

conservation for that map region. Therefore, this was the region from which potential

candidate genes were selected.

175

 

 

 

 

 

 

 

 

Chicken Human Mouse
Locus Position Chr. Band Chr. Position
ASCLl 160 12 q22-qZ3 10
lGF l 172 12 q22-qZ3 10 48.00
TM] 174 12 q22-q23 10 49.00
ITPRZ S 12 pl 1 6 S
LDHB 204 12 p12.2-p12.1 6 62.00
CCND2 230 12 pl 3 6 60.00
GAPD/CD4 241 12 p13 6 56.00
TCRB 230 7 q35 6 20.50
PPARA 240 22 q13.31 15 48.80
HSD3BI 254 1 pl 3.1 3 49.10
EPHA3 274 3 pl 1 .2 | 16 S

 

 

Figure 6.3 - lnterspecies comparative genetic map (chicken, human and mouse) for the rge
region. Note that the human GAPD gene is located at the chromosome 12p13. This region is
analogous to mouse chromosome 6. Key — S = chromosomal location obtained with somatic cell
hybrids.

6. 3. 2. i. Selection at candidate genes

6.3.2. i.a. Cyclin-dependent kinase inhibitor (Kip l)

The cyclin-dependent kinase inhibitor p27kipl, or Kipl, maps to human
chromosome 12 pl3.2. This gene product has an important role in determining cell fate
during retinogenesis and more specifically regulates cell cycle withdrawal of late
multipotent progenitor cells in the retina . Kipl was chosen because mutations in other
genes involved in retinal cell fate (NR2E3 and NrI), cause retinal dystrophies. Namely
NR2E3 mutations cause enhanced S-cone syndrome in humans and the rd7 degeneration

in mice. NrI mutations cause a similar phenotype .

176

6.3.2.i.b. Synaptobrevin (Vampl)

Vesicle associated membrane protein (Vampl; also known as synaptobrevin)
maps to the human chromosome 12p13.31. Vampl is part of the SNARE protein
complex . These proteins have critical functions during regulated vesicular release of
retinal neurotransmitter. In addition, Vampl also plays a critical role during neurite
outgrowth and synaptogenesis in the mammalian retina . Since it was possible to observe
abnormally shaped photoreceptor pedicles and spherules with abnormally shaped vesicles

ultrastructurally, Vampl was a natural candidate gene.

6.3.3. Mapping and sequencing of candidate genes

6.3.3. i. Rfliation-hvaid (RH) magging

Kipl and Vampl were mapped using the chicken RH panel. A correlation
analysis of the results indicates that Kipl and Vampl are indeed located at chromosome
1. The correlation scores from Vampl and the microsatellite marker MCW0318 were

higher (closer to 1) than Kipl (see Figure 6.4).

177

 

 

 

[Correlations I

Variable 1.510071 moose W318 1.1510137 rm 17090795 new 8974
1.510071 1.0000 0.4818 0.3187 0.3416 02835 05897 0.5897
rrcvoosa 0.4818 1 13000 0.4919 05237 03067 0.7429 0.7429
r-rcvo318 0.3187 0.4919 1.0000 0.6928 0.3668 0.5026 0.5828
1.510137 0.3416 0.5237 0.6928 10000 02971 05514 0.6380
Kl't 0.2835 0.3067 0.3668 0.2971 1.0000 0.3380 0.4916
new 0795 0.5897 0.7429 0.5026 05514 0.3380 1.0000 0.8253
wrap 8974 0.5897 0.7429 0.5828 06380 0.4916 0.8253 1.0000

 

 

 

Figure 6.4 - RH correlation for several microsatellite markers linked to the rge region. Note
that Vampl markers (V AMP 0795 and VAMP 87974) show higher scores than KIPl .

6.3.3. ii. Seguencing at candidate genes

Since Vamp l was the candidate gene showing the best correlation with the
microsatellite MCW0318, the gene was sequenced from affected and control DNA using

the following sequencing primers:

0 VAMP l. 6 Forward: 5' — TTTGGAATACGTATGCTGGAGAGGCGC,
Reverse: 5' - AAGCTCTGACAGTTTCTGGTCT CG

0 SPJ VAMP l. 8 Forward: 5' - T‘TAGCAGTGTGCTAGGGTCTTTCC,
Reverse: 5' - GGAACTAGTGTTCCAACGCTACCA

o SPJ VAMP l. 9 Forward: 5' - TCAGCATCTGCCTTATGTTCCCTC,
Reverse: 5' - TGGATTCAGGCAAGAAGAGACAGG

o SPJ VAMP 1. 13 Forward: 5' - TGT'TACGT'TCTCTCTGCCCTTGTG,
Reverse: 5' - GCCTCTCCAGCATACGTAT'I‘CCAA

0 SP1 VAMP 1. 14 Forward: 5' - CCGAGGGAGGGACTGGATTTATTT,

Reverse: 5' - AATCTAGCAGGTCTGCTCCCTAGA

178

 

No difference was found in the sequence of Vampl from the DNA of rge
and control chicks. When the first exon of the human Vampl gene was
screened for chicken trace sequences and ESTs, no match was found.
Therefore, primers could not be designed to amplify that region of the
chicken Vampl gene. However, human exon 1 contains the AT coding
nucleotides of the ATG start codon. The chicken sequence obtained for

the Vampl gene is shown below:

179

51

101

151

201

251

301

351

401

451

501

551

601

651

801

851

901

951

1001

1051

1101

1151

1201

1251

1301

1351

1401

1451

1501

1551

1601

1651

1701

1751

1801

1851

1901

1951

2001

2051

2101

2151

Figure 6.5 - Chicken Vampl sequence derived from chicken trace sequences. Underlined = exon 2 to
5. The AT of the start codon is on exon 1. The end of the start codon is marked ( ] ). The stop codon is

GTAGGTGGAA
GCGCTGCATA
1111106666
GAATGCCTGC
GGTTGTTGCC
TGTCC11TCA
GT1CCCATAG
GGGGGAGCCC
TAACCGTCGG
GTGCTGCTTC
GTGCTCTTGT
GTAIGCTGGA
AAACGGGCAG
T11TGGTTAT
TATGACACGA
TTAATCCCTG
AACATTICCT
GCAGCAACAC

TGTGATTGCA

TTACTTTCAA
C1GCAGGTGG
AGACCAGAAA

GTGCCTCAGT

ACAACCCCCG AGGGAGGGAC TCGATTTATT TATTATGTTC (SPJ VAMP 1.

GGGCGACATA GTGGGCGGCT GT11GGT1CC C11CCTCCCC

GGGGGGCGGG GGCGGGGGCC CGGCCGGGCC CCGACCCGCA

AGCCGCTCCG GGAGCAGCTA AGGGGGGATT TGGCACGGGG

CTCCTCTCAC CTTCAGCGCT GGTAGCTCGG GGGGGGCATC

CAGCTGAGGG CGTCATGHTD.CGTTCTCTCT GCCCTTGTGT (SPJ VAMP 1.

OITTTGAACCA GCTCAGCAGC CTGCTCCTGG GGCCCCGGAA

CTGCCGGGGG

CTGCAGCAGA

CCTTGGGCTG

TAAGTGTATG

GAGGCGCTAA

GAGCTGAGAT

GACATCTAGG

GTATCATAGA

CCGGGTGAAC

GACTTCGCAG

GTAGCTCTAA

GGGGTAGAGG

CAAGTGAGAG

GCTTTIGCAG

TGAAAGCTGT

TACTTGTTAG

CCCTGT1GAA

TTGATATAAT

CTGTCAGAGC

CCCCCCGGGG

CGCAGGCCCA

TATGGGCGCT

TTGCTGAAGG

TAATCAATGC

GAAATAGCTT

GAGCAGACCT

AATAAACCTC

AGTTRGAGTG

AGTGCAGTAA

GTTGTC111G

GGGTTGCTCT

TAGTGTCC1G

TGEOCTAGGO

111111311“

TAGTATCTTA

CCGCTATGAC

GCGTCTIAAT

TTGATGACCG

_—

A11TGAAAGT

TGGAAGAACT

AGGGAATTTG
AATAACTATT
GTCTTTGAGG
CATTGTCATG
TGACAATCTC
TTGTGGTGGT
TGAAGAAGCC
TGATCTGGAG
GGGAAGTGGT
GCTTTACAGA
AGACATTTTA
CCT1GAAGTG
GGTCTCTGGG
TTCCCTCTTA
AAAGGCTGCA

GAATCCACCC

GTAAGGTGAG

ATTAGTTTTC

ATAACAATTT

CCTCAGCTGT

GAAAC1GTGA

TC11111AGA

GGTCATTGTA

GTAACACCAG

GGTCT1GTTT

AGCGTTGGAA

GCAAGGAAAG

TTACCAGGTC

GGTGGGTTTG

GGACCTT1GA

AGGTAJGTCC

ACCTGCTGTC

ACATCAGTAC

AGTGCAGCAA

TTTCCTEGTG

TTCAGGGCTT

CAAATGCTTA

CCTGCCTTCA

ACTCAGCAGT

TGITGATCAT

AGTAAGTACT

AGTACTTTAA

GCATAAGTGG

CACTIGTTCC

GAAGTGGGGG

AAATAAACCT

CAAGCCCCTT

TGTAACT1GC

AGTCTACPTT

CCCTGTCACC

TCCCAAAAAA

ccaccccccx
Gorecxgcac
rccocrccrr
ccrccxrccr
haccxcxcro
rarxrrrxaa
Gcraoarrcc
raroccarcc
ccccrrcaar
crcccrrarc
casrrxrcrr
aarccrcxrc
cxacrorxcx
rcaarcccca
crcrcarcrr
occraecrcr
rxcrecrxcr
orcoxcaacc
Gccxgarccx
AACTCAAAAG
cccnearrrc
rcrsaccarx
ccxrrxrrrc
ccaacrcccr
cacnaaneac
Garcccacre
Gaaaaccccx
AAC1111GCT
TAACTTCTTT
acrracrors
reoccxrcxx
Graaxrarcx
rccrccrccc
ccrrcrcrrc
innemnreax
ricccrsrcr

A

highlighted in hold. The primers used are shaded in gray.

180

arcrcxccxg
Grcxcrxccr
rccrocacro
rarcoaarxc
rerearcrcr
accacreraa
iacracrrcx
asaacrxcrc
crxaaacorc
ccrcccaccc
cccrrcacca
excrroccha
rrxxrrarxc
rrrrcoacrx
rxrrccrrcr
orrxcrecrc
crrrraccrr
racrecaaco
Circgpccro
cxxcracroo
111cxaaaca
Gracccacar
acrerecxxx
rascarcccr
rxrmunmrc
AT11GTGCCA
chrracacc
T111GGTTTA
CCTTGGGAAA
GAAATAGTAT
rcrachxcro
cccxcacara
ocxrrrrccx
inaccrrrrr
rcrxcccccr

CTTCTTGCCT

14 FORWARD)

13 FORWARD)

13 REVERSE)

6 FORWARD)

14 REVERSE)

8 FORWARD)

6 REVERSED)

9 FORWARD)

8 REVERSE)

9 REVERSE)

 

6.4. Discussion

We were able to demonstrate that the mutation present in the rge chicken is not
the same present in the rd chicken.

The early research efforts to identify potential candidate genes through
comparative mapping were slightly confounded by the fact that the initial rge confidence
interval did not show a single conserved synteny to the human genome.

The more refined mapping of the rge defect on chromosome 1 indicated that
human chromosome region 12 p11-13 is the most likely region to contain the human
homolog of the rge gene. Among the investigated genes in the study, Vampl had the best
correlation to the microsatellite marker that absolutely co-segregated with the rge locus
(MCW0318). However, sequence analysis revealed no differences in the coding regions
and splice sites of the gene in rge birds compared to controls. Sequence differences in the
first exon, which contains 2 of the start codon nucleotides, however, could not be
analyzed because no matching chicken sequences were found for that exon. A possible
future plan for the completion of the analysis of the Vampl sequence would be using the
5' Rapid Amplification of cDNA Ends (5' RACE) technique to obtain the 5' end of the
chicken Vampl cDNA for sequencing. Nevertheless, immunohistochemically stained

retinal sections using an anti-Vampl antibody revealed no differences in labeling patterns
between control and rge birds (Chapter 5). Therefore, it seems unlikely that this gene
contains the rge-causing mutation.

Most autosomal recessive inherited retinal diseases are reportedly due to nonsense

mutations. These ofien result from the introduction of a premature stop codon. It is much

181

less likely that recessive diseases are caused by misense mutations that cause a change in
protein sequence and thus protein firnction or localization. Therefore we anticipate
finding the causative mutation in the coding region or exon/intron splice sites. This would
be expected to show a lack of expression in irnmunohistochemistry studies.

Alternatively, it is conceivable that the causal mutation lies outside the coding
region or the splice site of the gene involved (e.g., in a promoter or regulatory region) or
in a gene that has not previously been identified and fails to support the comparative map
(e. g., translocation). Micro-rearrangements will hopefully become apparent when the

Chicken Genome Project is concluded.

182

 

CHAPTER 7

CONCLUSIONS & FUTURE STUDIES

The results of this work show that the rge chick has an unusual form of retinal
dystrophy with electroretinographic and morphological changes quite unlike the
previously described retinal dystrophies in any species.

The electroretinographic changes observed in rge birds progressively deteriorated
with age and were characterized initially by a reduction in photoreceptor sensitivity,
marked decrease in oscillatory potentials, an increase in b-wave amplitudes (supernormal
b-waves) and delayed implicit times of a- and b-waves (Chapter 3). The results obtained
with the intravitreal injection of APB, PDA, barium and ornithine (Chapter 4) also
suggest an abnormal transmission from the photoreceptors to the second order neurons in
the rge retinas. Application of drugs that block the generation of the b-wave in normal
birds has little effect on the ERG in the rge chick. This suggests that normal transmission
to the inner retina of rge birds does not occur. Furthermore the processes that occur in
the normal retina do not generate the b-wave in rge birds. The only two agents used that
caused a change in the rge ERG were barium and ornithine. The supernormal component
of the rge ERG was blocked by ornithine, a known pharmacological RPE blocker that
might also affect photoreceptors. The amplitude of the supernormal b-waves was even
further elevated after intravitreal injections of barium chloride, a known potassium
channel blocker of Mtiller cells. The specific cellular origin of the supernormal b-wave,
however, remains uncertain. RPE and photoreceptors, and less likely Milller cells, still

remain as candidates. Future ERG studies with additional drugs are planned to further

183

 

 

33..

dissect the components of the rge ERG, such as the use of sodium iodate to destroy the
RPE- cells and cobalt, which may act directly on the photoreceptors . Intraretinal ERG
YecQI‘ding might also be used to identify which retinal layer is responsible for the
a‘brlormal components of the rge ERG. However it is also conceivable that identification
of the underlying gene defect may be required to fully explain the ERG abnormalities.
The apparent absence of inner retinal components of the ERG in the rge bird is in
l(eeping with ultrastructural studies showing abnormalities in the synapses between the
photoreceptors and second order retinal neurons. This abnormal signaling of
photoreceptors to inner retinal cells and the resultant loss of visual acuity may be
functionally equivalent to form-deprivation, and thereby, as in this environmentally
induced ametropia, result in excessive ocular growth. It is likely that functional coupling
of photoreceptor responses to the growth-regulating mechanisms of the inner retina are
disrupted in rge birds. The fact that the marked morphological globe changes that
deve10p in the rge chick occur afier electrophysiological and ultrastructural evidence of
retinal abnormality supports the supposition that they are most likely secondary to retinal
dysfunction. However, in turn they are likely to account for some of the retinal changes
in the later stages of the disease. These morphological changes are similar to those that
develop in constant light exposure chicks (e.g. increased corneal thickness, low IOP,
hyperopia, radial globe enlargement and linear fundus lesions) . There is evidence to
Show that melatonin plays a role in these changes in the constant light exposure chick and
might, therefore also play a role in the rge chick. To address this possibility, a future
Collaborative effort with Drs. Howard Howland and Tong Li from Cornell University, to

II‘aeasure retinal levels of melatonin in rge chicks, is planned.

184

The recent mapping of the rge locus to chicken chromosome 1 and our refined

mapp ing results suggest a number of candidate genes to investigate as candidates for the

genetic basis of the rge defect (Chapter 6). Vampl, among the investigated genes in the

study, had the best correlation to the microsatellite marker with which rge cosegregated

Completely. However, sequence analysis revealed no differences in the rge birds
c()mpared to controls.

The most pressing future work will be to try to identify the causal gene mutation
for the rge defect. Further candidate genes are discussed below:

Calcium channel L-type alpha 1 subunit maps to human chromosome 12p13.33.
'This gene was chosen as a positional candidate for the rge defect because calcium (Ca2+)

L-type channels are closely associated with synaptic ribbons of photoreceptor pedicles
and spherules. Ca2+ influx through voltage-gated channels stimulates a variety of neural
activities, including process outgrowth, neurotransmission, and synaptic plasticity. In
general, L-type channels control Caz+ influx into the soma and dendrites of the cells of
the nervous system, whereas other Ca2+ channel types control presynaptic activities.
Neurons that make ribbon synapses, however, are among a select group of nerve cells
whose presynaptic Ca2+ -dependent secretion is linked to L-type channels .

GABA(A) receptor-associated protein like 1 maps to human
chromosome12p13.2. This gene was also chosen as a positional candidate for the rge
defect because of the remarkable increase in globe size observed in the rge chicks

(Chapter 2). It is known that GABA(A), GABA(M), and GABA(B) receptors modulate
eye growth and refractive development. Additionally, GABA(A) receptors occur in both

OPL and IPL and distinct types of amacrine cell somata. GABA(AOr) receptors also

185

10031.1 2e to both plexiform layers and to the processes of bipolar cells. Due to the
involvement in the control of eye globe size and for the localization of GABA receptors
1“ the retina, a gene related to the GABA receptor family is a potential candidate for the

r g e defect.

The gene responsible for dynarnin-l like protein, isoforms 1 to 3, maps to human
chromosome 12p1 1.21. This gene is another positional candidate for the rge defect
because several lines of evidence indicate that dynarnin 1, a very similar gene, is required
to separate synaptic vesicles attached to the photoreceptor presynaptic membrane during

endocytosis .

The above candidate genes should first be RH mapped in order to confirm them as
good positional candidate genes for the rge defect prior to sequencing them.

The upcoming release of the complete chicken genome sequence will serve as an
invaluable resource to enhance our ability to select and screen other positional candidate
genes for potential causative mutations. The complete genome sequence may also
provide additional markers to fill marker gaps.

An avian model of retinal dystrophy such as the rge demonstrates some
advantages over other animal models such as those in mice and dogs. Mice are popular
for the study of different types of inherited retinal disease, with both spontaneously
occurring models and engineered ones. Mice have some advantages as a research model

over others species; they reproduce quickly and are relatively inexpensive to maintain
and have a highly investigated genome. Disadvantages are that mice have a rod-

d ominated retina and small sized eyes.

186

A breeding colony of chickens also is relatively inexpensive to establish and
maint ain. Genetic abnormalities progress rapidly compared to those in other models such
as A0 gs, since adult chickens are sexually mature in 4-5 months.

Normal retinal function in humans relies heavily on cone firnction. The cone-rich

mJLInan macula is the most important area in the human retina, with the highest acuity for
Color and daylight vision. Since chickens have a cone-dominated retina, models of retinal
dystrophy in this species are valuable research model for cone development and function
i n human vision. Birds, similarly to humans and unlike mice and dogs, are diurnal
Species. Human and chick eyes grow significantly over their lives and have optics of
good quality. These are the main reasons that the chicken eye has become a widely used
model for refraction studies. Additionally, human and chicken eyes are closer in size than
human and mice eyes. This feature of the avian eye permits surgical manipulations (such
as delivery of intravitreal drugs and/or gene therapy vectors) using techniques
comparable to those used in humans. Whereas in the mouse the small size of the eye and
certain anatomical features such as the large lens and small vitreal cavity size mean that it
is not a good model for procedures that are ultimately aimed for use in humans.

In conclusion, the rge chick is not only a unique model of retinal dystrophy,

understanding of which may improve our knowledge of retinal function and also of the
generation of the ERG, but it is also valuable for arnetropy studies and is the only

Spontaneous model of the complications of globe enlargement such as the formation of

1 acquer crack lesions.

187

BIBLIOGRAPHY

Adler, R., C. Curcio, et al. (1999). "Cell death in age-related macular degeneration." M91
lig S: 31.

Aguirre, G., J. Alligood, et al. (1982). "Pathogenesis of progressive rod-cone
degeneration in miniature poodles." Invest Ophthalmol Vis Sci 23(5): 610-30.

Akhmedov, N. B., N. I. Piriev, et al. (2000). "A deletion in a photoreceptor-specific

nuclear receptor mRN A causes retinal degeneration in the rd7 mouse." Proc Natl
Acad Sci U S A 97(10): 5551-6.

Allikmets, R., N. F. Shroyer, et al. (1997). "Mutation of the Stargardt disease gene
(ABCR) in age-related macular degeneration." Science 277(5333): 1805-7.

 

Araki, M., Y. Fukada, et al. (1990). "Localization of iodopsin in the chick retina during in
vivo and in vitro cone differentiation." Invest Onhth_almol Vis Sci 31(8): 1466-73.

Arshavsky, V. Y., T. D. Lamb, et al. (2002). "G proteins and phototransduction." Annu
Rev Physiol 64: 153-87.

Arushanian, E. B. and K. B. Ovanesov (1999). "Melatonin lowers the threshold of light
sensitivity of the human retina." Eksp Klin Farmakol 62(2): 58-60.

Autzen, T. and L. Bjomstrom (1989). "Central corneal thickness in full-term newborns."
Acta Ophtfllmol (Copenm 67(6): 719-20.

Baich, A. and K. Ratzlaff (1980). "Ornithine aminotransferase in chick embryo tissues."
Invest Ophthalmol Vis Sci 19(4): 411-4.

Ballesta, J ., G. Terenghi, et al. (1984). "Putative dopamine-containing cells in the retina

of seven species demonstrated by tyrosine hydroxylase immunocytochemistry."
Neuroscience 12(4): 1147-56.

Barishak, Y. R. (2001). Embryology of the eve gd its gdnexa, Basel, NY, Karger.

B arlow, H. B. and T. J. Ostwald (1972). "Pecten of the pigeon’s eye as an inter-ocular eye
shade." Nat New Biol 236(64): 88-90.

188

Bauerfeind, R., T. Galli, et al. (1996). "Molecular mechanisms in synaptic vesicle
recycling." J Neurocvtol 25(12): 701-15.

Beeb e, D. C. and J. M. Coats (2000). "The lens organizes the anterior segment:
specification of neural crest cell differentiation in the avian eye." Dev Biol
220(2): 424-31.

3 eresford, J. A., S. G. Crewther, et al. (2001). "Comparison of refractive state and
circumferential morphology of retina, choroid, and sclera in chick models of
experimentally induced arnetropia." Ontom Vis Sci 78(1): 40-9.

Bergmann, M., D. Grabs, et al. (1999). "Developmental expression of dynamin in the
chick retinotectal system." J Histochem Cytochem 47(10): 1297-306.

Berson, E. L. (1993). "Retinitis pigmentosa. The Friedenwald Lecture." Invest
Ophth_almol Vis Sci 34(5): 1659-76.

Bessant, D. A., G. E. Holder, et al. (2003). "Phenotype of retinitis pigmentosa associated
with the Ser50Thr mutation in the NRL gene." Arch Ophthglmol 121(6): 793-802.

Birch, D. G. and J. L. Anderson (1992). "Standardized firll-field electroretinography.
Normal values and their variation with age." Arch Qphthalmol 110(11): 1571-6.

Bok, D. and R. W. Young (1979). Phagocytic Properties of the Retinal Pigment
Epithelium. The Retingl Pigment Epithelium. K. M. Zinn and M. F. Marmor.
Cambridge, MA, Harvard University Press: 148-174.

Bowmaker, J. K. and A. Knowles (1977). "The visual pigments and oil droplets of the
chicken retina." Vision Res 17(7): 755-64.

Bownds, D., J. Dawes, et al. (1972). "Phosphorylation of frog photoreceptor membranes
induced by light." Nat New Biol 237(73): 125-7.

Bowne, S. J ., L. S. Sullivan, et al. (2002). "Mutations in the inosine monophosphate
dehydrogenase 1 gene (IMPDHl) cause the RP10 form of autosomal dominant
retinitis pigmentosa." Hum Mol Genet 11(5): 559-68.

189

Braeh, V. (1975). "The effect of intraocular ablation of the pecten oculi of the chicken."
Invest Ophtflmol 14(2): 166-8.

Erin gmann, A. and A. Reichenbach (2001). "Role of Muller cells in retinal
degenerations." Front Biosci 6: E72-92.

Brown, K. T. (1968). "The eclectroretinogram: its components and their origins." Vision
13$ 8(6): 633-77.

Bruesch, S. and L. Arey (1942). "The number of myelinated and unmyelinated fibers in
the optic nerve of vertebrates." J oumgl of Comna_rgtive Neurology 77: 631-665.

Bruhn, S. L. and C. L. Cepko (1996). "Development of the pattern of photoreceptors in
the chick retina." J Neurosci 16(4): 1430-9.

Burt, D. W., D. R. Morrice, et al. (2003). "Analysis of the rdd locus in chicken: 8 model
for human retinitis pigmentosa." Mol Vis 9: 164-70.

Bush, R. A. and P. A. Sieving (1994). "A proximal retinal component in the primate
photopic ERG a-wave." Invest Ophthglmol Vis Sci 35(2): 635-45.

Butler, A. B. and W. Hodos (1996). Comparative Vertebrate Neuroanatomv: Evolution
grid Adaptagtion. New York, NY, Wiley-Liss.

Carroll, J ., C. J. Murphy, et al. (2001). "Photopigment basis for dichromatic color vision
in the horse." J Vis 1(2): 80-7.

Chen, Y., M. Hu, et al. (2003). "Changes in somal growth and dendritic patterns of the

retinal ganglion cells in the chicks and chick embryos." J Vet Med Sci 65(10):
1135-7.

Cherqui, S., C. Sevin, et al. (2002). "Intralysosomal cystine accumulation in mice lacking
cystinosin, the protein defective in cystinosis." Mol Cell Biol 22(21): 7622-32.

Coleman, P. A., P. L. Carras, et al. (1987). "Barium reverses the transretinal potassium
gradient of the amphibian retina." Neurosci Lett 80(1): 61-5.

190

 

Cook, C. S. (1995). "Embryogenesis of congenital eye malformations." Veterinary &
Comparative Ophthalmology 5: 109-23.

 

Cook, C. S. (1999). Ocular embryology and congenital malformations. Veteringg
ODhthglmology. K. N. Gelatt. Philadelphia, PA, Lippincott Williams & Wilkins:
3-1 7.

Coulombre, A. J. (1955). "Correlations of structural and biochemical changes in the
developing retina of the chick." Am J Anat 96(1): 153-89.

Cremona, O. and P. De Camilli (1997). "Synaptic vesicle endocytosis." Curr Qpin
Neurobiol 7(3): 323-30.

Crewther, D. P., S. G. Crewther, et al. (1996). "Changes in eye growth produced by drugs
which affect retinal ON or OFF responses to light." J Ocul Pharmacol Ther 12(2):
193-208.

Crozier, W. J. and E. Wolf (1944). "Flicker response contours for the sparrow and the
theory of the avian pecten." Joum_al of General Physiology 27: 315-24.

Curtin, B. J. (1985). Ocular findings and complications. The Mvonigs: Basic Science and
Clinical Management. B. J. Curtin. Philadephia, PA, Harper and Row: 277-347.

Curtis, P. E., J. R. Baker, et al. (1987). "Impaired vision in chickens associated with
retinal defects." Vet Rec 120(5): 113-4.

Curtis, R., J. R. Baker, et al. (1988). "An inherited retinopathy in commercial breeding
chickens." Avian Pathology 17: 87-99.

 

Czepita, D. (2002). "Myopia - epidemiology, pathogenesis, present and coming
possibilities of treatment." Clinical Prgctice Review 3: 294-300.

De Camilli, P. (1995). "Neurotransmission. Keeping synapses up to speed." Nature
375(6531): 450-1.

Dowling, J. E. (1960). "Chemistry of visual adaptation in the rat." Nature 188: 114-8.

Duke-Elder, S. (1958). System of Ophthglmology. London, Henry Kimpton.

191

Dyer, M. A. and C. L. Cepko (2000). "Control of Muller glial cell proliferation and
activation following retinal injury." Nat Neurosci 3(9): 873-80.

Emeis, D., H. Kuhn, et al. (1982). "Complex formation between metarhodopsin II and
GTP-binding protein in bovine photoreceptor membranes leads to a shift of the
photoproduct equilibrium." FEBS Lett 143(1): 29-34.

Emmerton, J. and J. D. Delius (1980). "Wavelength discrimination in the 'visible' and
ultraviolet spectrum in pigeons." Journal of Comparative Physiology 141: 47-52.

Evans, L. S., N. S. Peachey, et al. (1993). "Comparison of three methods of estimating
the parameters of the Naka-Rushton equation." Doc Ophthglmol 84(1): 19-30.

Farahbakhsh, Z. T., K. Hideg, et al. (1993). "Photoactivated conformational changes in
rhodopsin: a time-resolved spin label study." Science 262(5138): 1416-9.

 

Ferrari, P. A. and W. E. Koch (1984). "Development of the iris in the chicken embryo. I.
A study of growth and histodifferentiation utilizing immunocytochemistry for
muscle differentiation." J Embrvol Exp Morphol 81: 153-67.

Ferrari, P. A. and W. E. Koch (1984). "Development of the iris in the chicken embryo. II.
Differentiation of the irideal muscles in vitro." J Embryol Exp Morphol 81: 169-
83.

Fischer, A. J ., J. J. McGuire, et al. (1999). "Light- and focus-dependent expression of the
transcription factor ZENK in the chick retina. " Nat Neurosci 2(8): 706-12.

Fischer, A. J ., R. L. Seltner, et al. (1998). "Irnmunocytochenrical characterization of
quisqualic acid- and N-methyl-D-aspartate-induced excitotoxicity in the retina of
chicks." J Comp Neurol 393(1): 1-15.

Fischer, A. J ., R. L. Seltner, et al. (1997). "N-methyl-D-aspartate-induced excitotoxicity
causes myopia in hatched chicks." Can J Ophthglmol 32(6): 373-7.

Fulton, A. B., K. V. F ite, et al. (1982). "Retinal degeneration in the delayed amelanotic
(DAM) chicken: an electroretinographic study." Curr Eye Res 2(11): 757-63.

192

Gabella, G. and E. Clarke (1983). "Embryonic development of the smooth and striated
musculatures of the chicken iris." Cell Tissue Res 229(1): 37-59.

Gallemore, R. P. and R. H. Steinberg (1991). "Cobalt increases photoreceptor—dependent
responses of the chick retinal pigment epithelium." Invest Ophthalmol Vis Sci
32(12): 3041-52.

Garamszegi, L. 2., A. P. Moller, et al. (2002). "Coevolving avian eye size and brain size
in relation to prey capture and noctumality." Proc R Soc Lond B Biol Sci
269(1494): 961-7.

Gilger, B. C., R. D. Whitley, et al. (1991). "Canine corneal thickness measured by
ultrasonic pachymetry." Am J Vet Res 52(10): 1570-2.

Goebel, H. H., A. Kohlschutter, et al. (1978). "Ultrastructural observations on the retina
in type II glycogenosis (Pompe's disease)" Ophthalmologica 176(2): 61-8.

Goldsmith, T. H. (1980). "Hummingbirds see near ultraviolet light." Science 207(4432):
786-8.

 

Goldsmith, T. H., J. S. Collins, et al. (1984). "The cone oil droplets of avian retinas."
Vision Res 24(11): 1661-71.

Gomez, A., J. Cedano, et al. (2001). "The gene causing the Best's macular dystrophy
(BMD) encodes a putative ion exchanger." DNA Seq 12(5-6): 431-5.

Gouras, P., H. M. Eggers, et al. (1983). "Cone dystrophy, nyctalopia, and supernormal
rod responses. A new retinal degeneration." Arch Ophthglmol 101(5): 718-24.

Gouras, P. and C. J. MacKay (1992). "Supemormal cone electroretinograrns in central
retinal vein occlusion." Invest Ophth_almol Vis Sci 33(3): 508-15.

Granit, R. (1933). "The components of the retinal action potential in mammals and their
relation to the discharge in the optic nerve." J oumgl of Physiology 77 : 207-39.

Greenlee, M. H., C. B. Roosevelt, et al. (2001). "Differential localization of SNARE
complex proteins SNAP-25, syntaxin, and VAMP during development of the
mammalian retina." J Comp Neurol 430(3): 306-20.

193

Griff, E. R., Y. Shirao, et al. (1985). "Ba2+ unmasks K+ modulation of the Na+-K+
pump in the frog retinal pigment epithelium." J Gen Physiol 86(6): 853-76.

Grossniklaus, H. E. and W. R. Green (1992). "Pathologic findings in pathologic myopia."
Retina 12(2): 127-33.

Hacker, G. (2000). "The morphology of apoptosis." Cell Tissue Res 301(1): 5-17.

Hagerman, G. S. and L. V. Johnson (1991). The photoreceptor-retinal pigmented
epithelium interface. Principles and Pragtice of Clinical Electrophysiolggy of
Vision. J. R. Heckenlively and G. B. Arden. St. Louis, Mosby Year Book: 53-68.

Haider, N. B., S. G. Jacobson, et al. (2000). "Mutation of a nuclear receptor gene,
NR2E3, causes enhanced S cone syndrome, a disorder of retinal cell fate." Nit
Genet 24(2): 127-31.

Haider, N. B., J. K. Naggert, et al. (2001). "Excess cone cell proliferation due to lack of a
firnctional NR2E3 causes retinal dysplasia and degeneration in rd7/rd7 mice."
Hum Mol Genet 10(16): 1619-26.

Hamm, H. E. and M. Menaker (1980). "Retinal rhythms in chicks: circadian variation in
melantonin and serotonin N-acetyltransferase activity." Proc Natl Acad Sci U S A
77(8): 4998-5002.

Hayasaka, S., T. Shiono, et al. (1980). "Ornithine ketoacid aminotransferase in the bovine
eye." Invest Ophthglmol Vis Sci 19(12): 1457-60.

Heidelberger, R. and G. Matthews (1992). "Calcium influx and calcium current in single
synaptic terminals of goldfish retinal bipolar neurons." J Physiol 447: 235-56.

H irata, A. and A. Negi (1998). "Lacquer crack lesions in experimental chick myopia."
Graefes Arch Clin Exp Ophthglrn01236(2): 138-45.

Hiroi, K., F. Yamarnoto, et al. (1995). "Effects of ornithine on the electroretinogram in
cat retina." Invest Ophthalmol Vis Sci 36(8): 1732-7.

Hong, F. T. (1995). "Magnetic field effects on biomolecules, cells, and living organisms."
Biosystems 36(3): 187-229.

194

Hood, D. C. (1990). The ERG and sites and mechanisms of retinal disease, adaptation
and development. Adyances in Photoreception: Proceedings of 1 Symposium on
Frontiers of Visual Science. Washington, DC, The National Academies Press: 41-
58.

Hood, D. C. and D. G. Birch (1996). "Assessing abnormal rod photoreceptor activity with
the a-wave of the electroretinogram: applications and methods." Doc Ophthglmol
92(4): 253-67.

Howland, H. C. and F. Schaeffel (1989). Development of accommodation and refractive
state in the eyes of humans and chickens. Development of the Vertebrate Reting.
B. L. Finlay and D. R. Sengelaub. New York, Plenum: 267-282.

Humayun, M. S., M. Prince, et al. (1999). "Morphometric analysis of the extrarnacular
retina from postmortem eyes with retinitis pigmentosa." Invest Ophthglmol Vis
S_c_i 40(1): 143-8.

lngleheam, C. F., D. R. Morrice, et al. (2003). "Genetic, ophthalmic, morphometric and
histopathological analysis of the Retinopathy Globe Enlarged (rge) chicken." M_ol
_\Li§ 9: 295-300.

Inoue, Y., Y. Sugihara, et al. (1980). "Atypical neural sheaths formed by Muller cells in
chicken retina." Okajimas Folia Anat Jpn 57(2-3): 79-88.

Kandel, E. R., J. H. Schwartz, et al. (1991). Principles of Neural Science.
Norwalk,Connecticut, Appleton & Lange.

Karten, H. J. and W. J. H. Nauta (1968). "Organization of retinothalamic projections in
the pigeon and owl." Anatomical Record 160: 373.

Karten, H. J. and A. M. Revzin (1966). "The afferent connections of the nucleus rotundus
in the pigeon." Brain Res 2(4): 368-77.

Kasahara, M., T. Matsuzawa, et al. (1986). "Irnmunohistochemical localization of
ornithine aminotransferase in normal rat tissues by Fab'-horseradish peroxidase
conjugates." J Histochem Cytochem 34(11): 1385-8.

Keep, J. M. (1972). "Clinical aspects of progressive retinal atrophy in the Cardigan
Welsh Corgi." Aust Vet J 48(4): 197-9.

195

Kefalov, V., Y. Fu, et al. (2003). "Role of visual pigment properties in rod and cone
phototransduction." Nature 425(6957): 526-31.

 

Kirschfeld, K. (1982). "Carotenoid pigments: their possible role in protecting against

photooxidation in eyes and photoreceptor cells." Proc R Soc Lond B Biol Sci
216(1202): 71-85.

Klein, R. M. and B. J. Curtin (1975). "Lacquer crack lesions in pathologic myopia." Am J
Qphthalmol 79(3): 386-92.

Klein, R. M. and S. Green (1988). "The development of lacquer cracks in pathologic
myopia." Am J Ophth_almol 106(3): 282-5.

Kolb, H. (1991). The neural organization of the human retina. Principles and Prgctices of
Clinical Electrophysiolggy of Vim. J. R. Heckenlively and G. B. Arden. St.
Louis, Mosby Year Book Inc. 6: 25-52.

Kolb, 1H. and L. E. Lipetz (1991). The anatomical basis for colour vision in the vertebrate
retina. Vision and Visual Dysfunction. The Perception of Colour. London, UK,
Macmillan Press Ltd. 6: 128-45.

Komenda, J. K. and K. V. F ite ( 1983). "Optokinetic nystagmus in progressive retinal
degeneration." Behav Neurosci 97(6): 928-36.

Koutalos, Y. and T. G. Ebrey (1986). "Recent progress in vertebrate photoreception."
Photochem Photobiol 44(6): 809-17.

Krill, A. E. and G. B. Lee (1963). "The electroretinogram in albinos and carriers of the
ocular albino trait." Arch Ophthglmol 69: 32-8.

Kuwabara, T. (1979). Photic and photo-thermal effects on the retinal pigment epithelium.
The Retinal Pigment Epithelium. K. M. Zinn and M. F. Marmor. Cambridge, MA,
Harvard University Press: 293-313.

Lahiri, D. and C. F. Bailey (1993). "A comparison of phagocytosis by the retinal pigment
epithelium in normal and delayed amelanotic chickens." Exp Eye Res 56(6): 625-
34.

196

Lam, K. W., J. Zwaan, et al. (1993). "Detection of ascorbic acid in the eye of the early
chicken embryo by silver staining." Exp Eye Res 56(5): 601-4.

LaVail, M. M. (1976). "Rod outer segment disk shedding in rat retina: relationship to
cyclic lighting." Science 194(4269): 1071-4.

 

Lei, B. and I. Perlman (1999). "The contributions of voltage- and time-dependent
potassium conductances to the electroretinogram in rabbits." Vis Neurosci 16(4):
743-54.

Levine, E. M., J. Close, et al. (2000). "p27(Kip1) regulates cell cycle withdrawal of late
multipotent progenitor cells in the mammalian retina." Dev Biol 219(2): 299-314.

Li, T. and H. C. Howland (1999). "The effect of melatonin on eye growth in chicks raised
under constant light." Investigative Ophthglmology_and Visual Science [ARVO
Abstractl 40: S847.

Li, T., H. C. Howland, et al. (2000). "Diurnal illumination patterns affect the
development of the chick eye." Vision Res 40(18): 2387-93.

Li, T., D. Troilo, et al. (1995). "Constant light produces severe corneal flattening and
hyperopia in chickens." Vision Res 35(9): 1203-9.

Li, Z. Y., I. J. Kljavin, et al. (1995). "Rod photoreceptor neurite sprouting in retinitis
pigmentosa." J Neurosci 15(8): 5429-38.

Liebner, S., H. Gerhardt, et al. (1997). "Maturation of the blood-retina barrier in the
developing pecten oculi of the chicken." gain Res Dev Brgin Res 100(2): 205-
19.

Lythgoe, J. N. (1979). The ecology of vision. Oxford, UK, Clarendon Press.

Manly, K. F. and J. M. Olson (1999). "Overview of QTL mapping software and
introduction to map manager QT." Mamm Genome 10(4): 327-34.

Massey, S. C., D. A. Redbum, et a1. (1983). "The effects of 2-amino-4-phosphonobutyric
acid (APB) on the ERG and ganglion cell discharge of rabbit retina." Vision Res
23(12): 1607-13.

197

McCall, M. A., R. G. Gregg, et al. (1996). "Morphological and physiological
consequences of the selective elimination of rod photoreceptors in transgenic
mice." Exp Eye Res 63(1): 35-50.

Mears, A. J ., M. Kondo, et al. (2001). "er is required for rod photoreceptor
development." Nat Genet 29(4): 447-52.

Meyer, D. B. (1977). The avian eye. _H_andbool_<gf Sensory Physiology. The Visual
System in Vertebrat_e_s_. F. Crescitelli. Berlin, Springer: 549-612.

Milam, A. H., L. Rose, et al. (2002). "The nuclear receptor NR2E3 plays a role in human
retinal photoreceptor differentiation and degeneration." Proc Natl Acad Sci U S A
99(1): 473-8.

Mito, T., T. Shiono, et al. (1989). "Irnmunocytocherrrical localization of ornithine
aminotransferase in human ocular tissues." Arch Ophthglmol 107(9): 1372-4.

Mizota, A., E. Sato, et al. (2001). "Facilitatory and neurotoxic effects of intravitreal
ornithine on the electroretinographic responses of albino rats." Ophthghnic Res
33(2): 91-7.

Molday, R. S. (1998). "Photoreceptor membrane proteins, phototransduction, and retinal
degenerative diseases. The Friedenwald Lecture." Invest Ophthgmol Vis Sci
39(13): 2491-513.

Montiani-Ferreira, F., S. Petersen-J ones, et a1. (2003). "Early postnatal development of
central corneal thickness in dogs." Vet Ophth_almol 6(1): 19-22.

Morgan, 1. G. (1983). "The organization of amacrine cell types which use different
transmitters in chicken retina." Prog Brain Res 58: 191-9.

Morisson, M., A. Lemiere, et al. (2002). "ChickRH6: a chicken whole-genome radiation
hybrid panel." Genet Sel Evol 34(4): 521-33.

Morris, V. B. (1970). "Symmetry in a receptor mosaic demonstrated in the chick from the
frequencies, spacing and arrangement of the types of retinal receptor." J Comp
Neurol 140(3): 359-98.

198

Morris, V. B. (1982). "An afoveate area centralis in the chick retina. " J Comp Neurol
210(2): 198-203.

 

Morris, V. B. and C. D. Shorey (1967). "An electron microscope study of types of
receptor in the chick retina." J Comp Neurol 129(4): 313-40.

Murphy, C. J. (1993). Raptor ophthalmology. Zoogand Wildlife Medicine. M. E. Fowler.
Philadelphia, PA, W.B. Saunders: 21 1-21.

Nachman-Clewner, M., R. St Jules, et al. (1999). "L-type calcium channels in the

photoreceptor ribbon synapse: localization and role in plasticity." J Comp Neurol
415(1): 1-16.

Narfstrom, K., A. Wrigstad, et al. (1989). "The Briard dog: a new animal model of
congenital stationary night blindness." Br J Ophthglmol 73(9): 750-6.

Nussbaum, R. L., R. E. Mclnnes, et a1. (2001). Thompson & Thompson Genetics in
Medicine. Philadelphia, PA, W B Saunders.

Oakley, B., 2nd and D. G. Green (1976). "Correlation of light-induced changes in retinal
extracellular potassium concentration with c-wave of the electroretinogram." J
Neurophysiol 39(5): 11 17-33.

Ohno-Matsui, K., M. Ito, et al. (1996). "Subretinal bleeding without choroidal
neovascularization in pathologic myopia. A sign of new lacquer crack formation."
Retina 16(3): 196-202.

Ohno-Matsui, K., T. Yoshida, et al. (2003). "Patchy atrophy and lacquer cracks
predispose to the development of choroidal neovascularisation in pathological
myopia." Br J Ophthglmol 87(5): 570-3.

Ookawa, T. (1971). "Further studies on the ontogenetic development of the chick
electroretinogram." Poult Sci 50(4): 1185-90.

Ookawa, T. (1971). "On the ontogenetic study of the chick ERG." Nippon Seirigaku
Zasshi 33(5): 317-8.

199

Ookawa, T. (1971). "The onset and development of the chick electroretinogram: the A-
and B-waves." Poult Sci 50(2): 601-8.

Ookawa, T. and K. Takahashi (1971). "The ontogenetic development of the c-wave in the
chick ERG." Experientia 27(4): 407-9.

Osorio, D., M. Vorobyev, et al. (1999). "Colour vision of domestic chicks." J .ExpBiol.
202 ( Pt 21): 2951-9.

Pacione, L. R., M. J. Szego, et al. (2003). "Progress toward understanding the genetic and
biochemical mechanisms of inherited photoreceptor degenerations." Annu Rev
Neurosci 26: 657-700.

Pardue, M. T., M. A. McCall, et al. (1998). "A naturally occurring mouse model of X-
linked congenital stationary night blindness." Invest Ophthglmol Vis Sci 39(12):
2443-9.

Paton, I. R., J. Smith, et al. (2003). "Mapping the ABCA4, IMPDH2 and TIMP3 genes in
chicken." Anim Genet 34(5): 395-6.

Pearlman, J. T. and H. M. Burian (1964). " Electroretinographic findings in thyroid
dysfunction." American J oum_2_rl of Ophthalmology 58: 216-25.

Pepperberg, D. R., P. K. Brown, et al. (1978). "Visual pigment and photoreceptor
sensitivity in the isolated skate retina." J Gen Physiol 71 (4): 369-96.

Petters, R. M., C. A. Alexander, et al. (1997). "Genetically engineered large animal
model for studying cone photoreceptor survival and degeneration in retinitis
pigmentosa." l_\l_at Biotechnol 15(10): 965-70.

Pittack, C., G. B. Grunwald, et al. (1997). "Fibroblast growth factors are necessary for
neural retina but not pigmented epithelium differentiation in chick embryos."
Development 124(4): 805-16.

Pleyer, U. (2001). "Gene therapy in hereditary retinal degeneration and the tower of
Babel." Br J Ophthalmol 85(3): 255.

200

Pollock, B. J ., M. A. Wilson, et al. (1982). Preliminary observations of a new blind chick
mutant (beg). Problemg of normal and genetically abnormgl retings. R. M.

Clayton, H. W. Reading, J. Haywood and A. Wright. London, UK, Academic
Press: 241-7.

Prada, C ., J. Puga, et al. (1991). "Spatial and Temporal Patterns of Neurogenesis in the
Chick Retina." Eur J Neurosci 3(6): 559-69.

Pugh, E. N. J. and T. D. Lamb (2000). Phototransduction in Vertebrate Rods and Cones:
Molecular Mechanisms of Amplification, Recovery and Light Adaptation.
Handbook of Biological Physics. D. G. Stavenga, W. J. DeGrip and E. N. J. Pugh.
Amsterdam, Elsevier. 3: 183-254.

Qiu, H., E. Fujiwara, et al. (2002). "Evidence that a-wave latency of the
electroretinogram is determined solely by photoreceptors." Jpn J Ophthalmol
46(4): 426-32.

Rager, G. (1979). "The cellular origin of the b-wave in the electroretinogram -- a
developmental approach." J Comp Neurol 188(2): 225-44.

Randall, C. J ., M. A. Wilson, et al. (1983). "Partial retinal dysplasia and subsequent

degeneration in a mutant strain of domestic fowl (rdd)" Exp Eye Res 37(4): 337-
47.

Rando, R. R. (1990). "The Chemistry of Vitamin A and Vision." Angewandte Chemie
International Edition 29: 461-80.

Rao-Mirotznik, R., A. B. Harkins, et al. (1995). "Mammalian rod terminal: architecture
of a binary synapse." Neuron 14(3): 561-9.

Rodieck, R. W. p. S. F., CA: Freeman. (1973). The vertebrgte reting: Principles of
structure gm function. San Francisco, CA, Freeman.

Romanoff, A. L. (1960). The Avign Embryo: Structural and Functional Development.
New York, NY, The Macmillan Company.

Rothman, J. E. (1994). "Mechanisms of intracellular protein transport." Nature
372(6501): 55-63.

201

Schaeffel, F. and H. C. Howland (1987). "Corneal accommodation in chick and pigeon."
J .Comp Physiol [A] 160(3): 375-384.

Schaeffel, F ., D. Troilo, et al. (1990). "Developing eyes that lack accommodation grow to
compensate for imposed defocus." Vis Neurosci 4(2): 177-83.

Scher, J ., E. Wankiewicz, et al. (2002). "MT(l) melatonin receptor in the human retina:
expression and localization." Invest Ophthalimol Vis Sci 43(3): 889-97.

Schmid, K. L. and C. F. Wildsoet (1996). "Effects on the compensatory responses to

positive and negative lenses of intermittent lens wear and ciliary nerve section in
chicks." Vision Res 36(7): 1023-36.

Semple-Rowland, S. L. and K. M. Cheng (1999). "rd and re chickens carry the same GCl
null allele (GUCY1*)." Exp Eye Res 69(5): 579-81.

Semple-Rowland, S. L. and N. R. Lee (2000). "Avian models of inherited retinal
disease." Methods Enzymol 316: 526-36.

Semple-Rowland, S. L., N. R. Lee, et al. (1998). "A null mutation in the photoreceptor

guanylate cyclase gene causes the retinal degeneration chicken phenotype." Proc
Natl Acgd Sci U S A 95(3): 1271-6.

Sherry, D. M., M. M. Wang, et al. (2003). "Differential distribution of vesicle associated
membrane protein isoforms in the mouse retina." Molecular Vision 9: 673-688.

Sherry, D. M., M. M. Wang, et a1. (2003). "Differential distribution of vesicle associated
membrane protein isoforms in the mouse retina." Mol Vis 9: 673-88.

Sherry, D. M., H. Yang, et al. (2001). "Vesicle-associated membrane protein isoforms in
the tiger salamander retina." J Cong) Neurol 431(4): 424-36.

Shibuya, K., H. Yarnazaki, et al. (2002). "Hereditary visual impairment in a new mutant
strain of chicken, GSN/l ." Acta Nemomgthol (Berl) 103(2): 137-44.

Sillman, A. J. (1973). Avian vision. Avian Biology. D. S. F amer and J. R. King. New
York, NY, Academic Press. 3: 349-83.

202

Slaughter, M. M. and R. F. Miller (1981). "2-amino-4-phosphonobutyric acid: a new
pharmacological tool for retina research." Science 211(4478): 182-5.

 

Slaughter, M. M. and R. F. Miller (1983). "An excitatory amino acid antagonist blocks

cone input to sign-conserving second-order retinal neurons." Science 219(45 89):
1230-2.

 

Slaughter, M. M. and R. F. Miller (1983). "The role of excitatory amino acid transmitters
in the mudpuppy retina: an analysis with kainic acid and N-methyl aspartate." J
Neurosci 3(8): 1701-11.

Smyth, J. R., J r., R. E. Boissy, et al. (1981). "The DAM chicken: 8 model for spontaneous
postnatal cutaneous and ocular arnelanosis." J Hered 72(3): 150-6.

 

Smyth, J. R., J r., R. E. Boissy, et al. (1981). "Retinal dystrophy associated with a
postnatal amelanosis in the chicken." Invest Ophthgmol Vis Sci 20(6): 799-803.

Spence, S. G. and J. A. Robson (1989). "An autoradiographic analysis of neurogenesis in
the chick retina in vitro and in vivo." Neuroscience 32(3): 801-12.

Spiwoks-Becker, I., L. Vollrath, et al. (2001). "Synaptic vesicle alterations in rod
photoreceptors of synaptophysin-deficient nrice." Neuroscience 107(1): 127-42.

Sprague, J. B. and W. B. Wilson (1981). "Electrophysiologic findings in bilateral optic
nerve hypoplasia." Arch Ophthalgmol 99(6): 1028-9.

Steinberg, R. H., R. Schmidt, et al. (1970). "Intracellular responses to light from cat
pigment epithelium: origin of the electroretinogram c-wave." Nature 227(259):
728-30.

 

Stevenson, G. W., M. Kiupel, et al. (1999). "Ultrastructure of porcine circovirus in
persistently infected PK-15 cells." Vet Pathol 36(5): 368-78.

Stone, R. A., T. Lin, et al. (1989). "Retinal dopamine and form-deprivation myopia."
Proc Natl Acgd Sci U S A 86(2): 704-6.

203

Stone, S. and P. Witkovsky (1984). "The actions of garnma-arrrinobutyric acid, glycine
and their antagonists upon horizontal cells of the Xenopus retina. " J Physiol 353:
249-64.

Swain, P. K., D. Hicks, et al. (2001). "Multiple phosphorylated isoforms of NRL are
expressed in rod photoreceptors." J Biol Chem 276(39): 36824-30.

Teakle, E. M., C. F. Wildsoet, et al. (1993). "The spatial organization of tyrosine
hydroxylase-immunoreactive amacrine cells in the chicken retina and the
consequences of myopia." Vision Res 33(17): 2383-96.

T hanos, S. and F. Bonhoeffer (1983). "Investigations on the development and
topographic order of retinotectal axons: anterograde and retrograde staining of
axons and perikarya with rhodamine in vivo." J Comp Neurol 219(4): 420-30.

Thompson, I. (1991). Considering the evolution of the vertebrate neural retina. Vision
and Visual Dysfunction. J. R. Cronly-Dillon and R. L. Gregory. Boca Raton, FL,
CRC Press. 2: 136-51.

Troilo, D., M. D. Gottlieb, et al. (1987). "Visual deprivation causes myopia in chicks
with optic nerve section." Curr Eye Res 6(8): 993-9.

Ulshafer, R. J ., C. Allen, et al. (1984). "Hereditary retinal degeneration in the Rhode
Island Red chicken. I. Histology and ERG." Exp Eye Res 39(2): 125-35.

Ulshafer, R. J. and C. B. Allen (1985). "Hereditary retinal degeneration in the Rhode
Island Red chicken: ultrastructural analysis." Exp Eye Res 40(6): 865-77.

Vigh, J ., T. Banvolgyi, et al. (2000). "Amacrine cells of the anuran retina: morphology,
chemical neuroanatomy, and physiology." Microsc Res Tech 50(5): 373-83.

Vorobyev, M. (2003). "Coloured oil droplets enhance colour discrimination." Proc R Soc
Lond B Biol Sci 270(1521): 1255-61.

Wack, M. A., N. S. Peachey, et al. (1989). "Electroretinographic findings in human
oculocutaneous albinism." Ophthalmology 96(12): 1778-85.

204

 

“.‘m.a. I

Wallman, J. (1993). "Retinal control of eye growth and refraction." Progess in Retinal
Eye Research 12: 133-53.

 

Wang, H. and X. Yang (1996). "Cobalt ions enhance light responsiveness of carp cone
horizontal cells in low calcium." Sci China C Life Sci 39(3): 258-66.

Weber, B. H., G. Vogt, et al. (1994). "Mutations in the tissue inhibitor of
metalloproteinases-3 (TIMP3) in patients with Sorsby's fundus dystrophy." Nat
Genet 8(4): 352-6.

Weber, B. H., G. Vogt, et al. ( 1994). "Sorsby's fundus dystrophy is genetically linked to
chromosome 22q13-qter." Nat Genet 7(2): 158-61.

Wen, R. and B. Oakley, 2nd (1990). "K(+)-evoked Muller cell depolarization generates
b-wave of electroretinogram in toad retina." Proc Natl Acad Sci U S A 87(6):
2117-21.

Wildsoet, C. and J. Wallrnan (1995). "Choroidal and scleral mechanisms of compensation
for spectacle lenses in chicks." Vision Res 35(9): 1175-94.

Williams, C. V. and S. C. McLoon (1991). "Elimination of the transient ipsilateral
retinotectal projection is not solely achieved by cell death in the developing
chick." J Neurosci 11(2): 445-53.

Witzel, D. A. and C. W. Smith (1976). Electroretinography. Applied electronics for
Veterinary Medicine and Animal Physiology. W. R. Klemm. Springfiled, Charles
C. Thomas Publisher: 365-93.

Won, M. H., T. C. Kang, et al. (2000). "Glial cells in the bird retina: immunochemical
detection." Microsc Res Tech 50(2): 151-60.

Wurziger, K., T. Lichtenberger, et al. (2001). "On-bipolar cells and depolarising third-
order neurons as the origin of the ERG-b-wave in the RCS rat." Vision Res 41(8):
1091-101.

Yang, H., K. M. Standifer, et al. (2002). "Synaptic protein expression by regenerating
adult photoreceptors." J Comp Neurol 443(3): 275-88.

205

Yazulla, S. (1986). "GABAergic mechanisms in the retina." Progress in Retintal Research
5: 1-52.

Yinon, U. and K. C. Koslowe (1986). "Hyperrnetropia in dark reared chicks and the
effect of lid suture." Vision Res 26(6): 999-1005.

Young, R. W. and D. Bok (1969). "Participation of the retinal pigment epithelium in the
rod outer segment renewal process." J Cell Biol 42(2): 392-403.

Zars, T. and D. R. Hyde (1996). "rdgE: a novel retinal degeneration mutation in
Drosophila melanogaster." Genetics 144(1): 127-38.

 

Zimmerman, T. J ., W. W. Dawson, et al. (1973). "I. Electroretinographic changes in
normal eyes during administration of prednisone." Ann Ophthalmol 5(7): 75 7-65.

206

 

 

 

 

IIIIIIIIIIIIIIIIIIIIIIIIIIIIII

111111111131111111111111111!"