THE ROLES OF C/EBPβ AND C-JUN IN TRANSCRIPTION OF THE GENE ENCODING
THE MURINE PROGESTERONE RECEPTOR
By
Han Ngoc Do

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
Cell and Molecular Biology - Doctor of Philosophy
2014

ABSTRACT
THE ROLES OF C/EBPβ AND C-JUN IN TRANSCRIPTION OF THE GENE ENCODING
THE MURINE PROGESTERONE RECEPTOR
By
Han Ngoc Do
Progesterone (P) and its receptor, the progesterone receptor (PR), are important for
mammary gland development. Moreover, P/PR signaling also contributes to mammary
tumorigenesis. Thus, studying the mechanism of PR expression is important in breast cancer
research. C/EBPβ-deficient mice and mice blocked for AP-1 activity show similar defects in
mammary gland development as do PRB-deficient mice, especially during pregnancy, suggesting
that these transcription factors might act in the same pathway or may regulate overlapping sets of
downstream target genes. An overall decrease in PR observed in sexually mature wild type mice
fails to occur in C/EBP-deficient mice, while no alterations in C/EBP expression are observed
in PR-deficient mice. Moreover, AP-1 has been found to regulate PR expression. These
observations suggest that C/EBP and AP-1 act upstream of PR. This leads us to study the
possibility that C/EBP and AP-1 are required for PR expression.
We examined whether C/EBPβ participated in the transcriptional regulation of PR
expression in the mammary gland. Transient co-transfection of a PR promoter-reporter construct
with expression vectors that individually express C/EBPβ isoforms (LAP1, LAP2, or LIP) into a
mouse mammary carcinoma cell line revealed that all C/EBPβ isoforms, surprisingly including
LIP (the shortest isoform lacking transactivation domains), can transactivate the PR promoter.
Importantly, we found that LIP, in particular, robustly synergizes with an AP-1 member, c-Jun,
to drive PR transcription. Consistent with significant roles for C/EBPβ and c-Jun in PR
expression, knockdown experiments showed that endogenous levels of C/EBPβ and c-Jun

expression were sufficient to drive the PR promoter-reporter. Additionally, overexpression of
LIP elevated PR protein expression from the intact endogenous gene encoding PR. Furthermore,
in vivo immunofluorescence studies showed that C/EBPβ and PRA expression are mutually
exclusive in the mammary epithelium, while PRB is only expressed in cells that express
C/EBPβ. This suggests an important role for C/EBPβ in PRB expression during pregnancy.
Then, we studied the mechanism by which LIP and c-Jun synergistically activate the PR
promoter. We demonstrated in the reporter assay that the integrity of C/EBP- and AP-1-binding
sites was required for the respective C/EBPβ and c-Jun activities on the PR promoter. Moreover,
we showed in ChIP assay that efficient promoter occupancy of both LIP and c-Jun and their
synergistic transactivation of the PR promoter required at least one C/EBP- and one AP-1binding site. In addition, as indicating in the sequential ChIP assay, C/EBPβ and c-Jun
simultaneously occupied PR promoter. This leads us to propose a model where the synergy of
C/EBPβ and c-Jun in transactivation of the PR promoter is dependent on the two factors
mutually stabilizing their recruitment to the PR promoter. Collectively, our data suggest a critical
role for C/EBPβ, particularly LIP, in PRB expression.

ACKNOWLEDGMENTS

First, I would like to express my deep gratitude to Professor Richard C. Schwartz for his
guidance and financial throughout my Ph.D. I feel fortunate and privileged to be his student,
from whom I learned not only “Transcriptional Regulation”, a fascinating area of molecular
biology, but also many important things for my future career, such as scientific writing and
statistics. He has always been generous in giving me help, guidance and encouragement every
time I need him, even in my most difficult times.
I would like to thank Dr. Weizhong Wang, for much help and advice during the last 6
years. Without him, my research would have taken much longer.
I would also like to thank the rest of my dissertation committee: Dr. Susan E. Conrad, Dr.
Laura McCabe, Dr. R.William Henry, and Dr. Narayanan Parameswaran for their thoughtful
comments and guidance throughout this journey.
Finally, there are not enough words to describe how much I owe to my parents, sister,
and brother, especially my husband and my daughter. They have been always with me and
always believe in me. All my achievements would never have been possible without their
unconditional sacrifice and unbounded patience with me during my graduate school.

iv

TABLE OF CONTENTS

LIST OF TABLES ................................................................................................................. vi
LIST OF FIGURES ............................................................................................................... vii
CHAPTER 1 LITERATURE REVIEW ................................................................................. 1
Progesterone Receptor (PR) ................................................................................................... 2
Progesterone Receptor Structure ............................................................................................ 2
Progesterone Receptor Function ............................................................................................. 5
Progesterone Receptor Role of in Mammary Gland Development .......................................... 9
Regulation of Progesterone Receptor Expression ................................................................... 12
CCAAT/Enhancer Binding Protein (C/EBP) family ............................................................... 20
C/EBPβ .................................................................................................................................. 22
Role of C/EBPβ in Mammary Gland Development ................................................................ 29
Activating Protein-1 (AP-1) family ........................................................................................ 32
c-Jun ...................................................................................................................................... 33
Role of c-Jun in Normal Mammary Gland Development ........................................................ 36
Molecular mechanisms of synergistic transactivation ............................................................. 38
Cooperative activity of C/EBP and AP-1 ................................................................................ 40
REFERENCES ...................................................................................................................... 42
CHAPTER 2 C/EBPβ LIP AND C-JUN SYNERGIZE TO REGULATE EXPRESSION OF
THE PROGESTERONE RECEPTOR ................................................................................... 63
Abstract ................................................................................................................................. 65
Introduction .......................................................................................................................... 66
Material and methods ............................................................................................................. 67
Results ................................................................................................................................... 73
Discussion.............................................................................................................................. 88
REFERENCES ...................................................................................................................... 92
CHAPTER 3 C/EBPΒ LIP AND C-JUN SYNERGY ON THE PROGESTERONE PROMOTER
IS BASED ON THEIR MUTUAL DEPENDENCE FOR EFFICIENT OCCUPANCY .......... 96
Abstract ................................................................................................................................. 98
Introduction ........................................................................................................................... 99
Material and methods ............................................................................................................. 101
Results ................................................................................................................................... 107
Discussion.............................................................................................................................. 123
APPENDIX ........................................................................................................................... 129
REFERENCES ...................................................................................................................... 132
CHAPTER 4 CONCLUSION AND FUTURE RESEARCH .................................................. 137

v

LIST OF TABLES

Table 3.1. List of Primers for Site Mutagenesis ....................................................................... 101
Table 3.2. List of Primers for ChIP .......................................................................................... 106

vi

LIST OF FIGURES

Figure 1.1. Structure of mouse progesterone receptor ............................................................... 3
Figure 2.1. Map of the murine PR promoter region used in these studies .................................. 74
Figure 2.2. Transient co-expression of LIP and c-Jun synergizes to induce expression from the
PR promoter-reporter ............................................................................................................... 75
Figure 2.3. Co-expression of LIP and c-Jun increases 2xPRE promoter activity ....................... 79
Figure 2.4. LIP expression induces endogenous PRA and PRB expression ............................... 81
Figure 2.5. si-RNAs directed against endogenous C/EBP or c-Jun expression similarly suppress
expression from the tandem PR and 2xPRE promoter-reporters................................................ 83
Figure 2.6. PRA expression is mutually exclusive of C/EBP, while PRB and C/EBP largely
co-localize. ............................................................................................................................... 86
Figure 3.1. Characterization of Progesterone Receptor promoter ............................................ 108
Figure 3.2. The effects of mutation of C/EBP and AP-1 sites on promoter activity ................. 112
Figure 3.3. Differential occupancy of C/EBPβ and c-Jun on wildtype and mutant promoters .. 116
Figure 3.4. The effect of DNA binding inhibition of C/EBPβ and c-Jun on promoter activity . 119
Figure 3.5. Co-occupancy of C/EBPβ and c-Jun in sequential ChIP assays ............................. 120
Figure 3.6: Differential occupancy of three C/EBPβ isoforms ................................................ 122
Figure 3S.1.The effects of mutation of C/EBP and AP-1 sites on the promoter activity .......... 130
Figure 3S.2. The effects of A-CEBP and A-Fos on 2x-CEBP and 2x-AP-1 promoters ............ 131
Figure 4.1. The effects of TSA and HAT on PR promoter activity .......................................... 140

vii

CHAPTER 1

LITERATURE REVIEW

1

Progesterone Receptor (PR)
Progesterone (P4) plays critical roles in regulating normal female reproductive functions
in ovulation, preparation of the uterus for implantation and pregnancy, development of the
mammary gland for lactation, and the regulation of labor (Graham and Clarke, 1997). P4 effects
are largely mediated through the progesterone receptor (PR), a member of the family of nuclear
steroid receptors. PR also plays a major role in the diagnosis and treatment of breast cancers.
Progesterone Receptor Structure
PR belongs to the nuclear steroid receptor superfamily (Bain et al., 2007). All members
of this family share the following structural domains: a C-terminal ligand-binding domain
(LBD), a hinge region, a well-conserved DNA-binding domain (DBD), and a less conserved Nterminal regulatory domain (NTD) containing activation function domains (Figure 1).
In humans and rodents, PR exists as two main isoforms, PRA and PRB. These two
isoforms are encoded from a single gene to give rise to two different transcripts as a result of
transcription from two alternative promoters (Kastner et al., 1990; Kraus et al., 1993). PRA and
PRB are identical in their LBD, DBD, and activation function 1 and 2 (AF1 and AF2) domains.
The AFs are essential for transcriptional activity of PR. AF1 in the NTD is constitutively active
in a ligand-independent manner, whereas AF2 in the LBD depends on ligand binding to induce a
conformational change (Gao and Nawaz, 2002) that allows interaction with cofactors, such as
steroid receptor coactivators SRCs, nuclear receptor interacting protein 1 NRIP1 (RIP 140),
mediator complex DRIP/TRAPS (Hill et al., 2012), and CBP/p300 integrator complex (Kamei,
1996).

2

Figure 1.1. Structure of mouse progesterone receptor. Schematic representation of the mouse
progesterone receptor gene and its two isoforms. Mouse PR gene with eight exons. Two
differential promoters (PRB promoter and PRA promoter) give rise to two transcripts PRB
mRNA and PRA mRNA, and consequent PRB isoform and PRA isoform, respectively. PRB
differs from PRA by an extension of 164 amino acids at its N’-terminus, forming B-upstream
segment (BUS). DNA binding domain (DBD), ligand binding domain (LBD), and three
activation functions (AF1, AF2, and AF3) are indicated.

3

However, PRB differs from PRA by an extension of 164 amino acids at its N’-terminus,
which is named as the B-upstream segment, BUS. BUS contains a third PRB-unique AF (AF3)
which determines the differential functions of PRB in comparison to PRA. Since AF3 is
suggested to interact with coactivators, PRA, lacking this AF3, inefficiently recruits coactivators
GRIP1 and SRC-1 (Giangrande et al., 2000). AF3 is also shown to synergize with AF1 and AF2
(Takimoto et al., 2003; Tung et al., 2006) by cooperative interaction of a PR multimer complex
bound to multiple progesterone responsive elements (PREs) (Tung et al., 2006). The AF3 is
unaffected by an inhibitory function (IF) domain which suppresses the transcriptional activity of
AF1 and AF2. The lack of AF3 in PRA contributes to its weaker transactivation function by
permitting the inhibitory effect of IF on AF1 and AF2 functions (Hovland et al., 1998).
Moreover, the BUS of PRB is also suggested to stabilize an active conformation of PRB (Bain et
al., 2001). Gene expression profiling showed that form of PRB carrying site-specific mutation of
AF3 ineffectively regulates PRB-dependent genes, but does not convert its transcriptional
functions to those of PRA (Tung et al., 2006). In addition, the BUS may also affect the
differential localization of PRA and PRB, and, thus consequentially, their distinct biological
activities. PRA is mostly nuclear, whereas PRB is located both in the nucleus and cytoplasm in
the absence of hormone (Lim et al., 1999).
A third truncated PR isoform, PRC, which is restricted primarily to the cytosolic fraction,
lacks the N-terminal region and one zinc finger of DBD, and, thus, it is unable to bind DNA.
However, PRC is still able to interact with hormone and heterodimerize with other PR isoforms,
and consequent increase their activity in T47D breast cancer cell line (Wei et al., 1990, 1996,
1997). Moreover, alternative splicing is reported to generate PR variants lacking various whole,
multiple or partial exons. These variants, which have been found in normal and cancer breast cell

4

lines and tissues, may compete for dimerization with other isoforms or for cofactors (Cork et al.,
2008; Richer et al., 1998). Together, these variants may alter P4 responsiveness by leading to
lower levels of PRA and PRB activity.
Progesterone Receptor Function
Newly synthesized PR is associated with a chaperone complex containing heat shock
proteins (Catelli et al., 1985; Picard, 2006). In the absence of progestin (P), this complex
maintains PR in an inactive form in the cytoplasm, generates an appropriate conformation for
ligand binding, and prevents PR from proteolytic damage (Catelli et al., 1985; Picard, 2006; Pratt
et al., 2004; Smith, 1993; Smith et al., 1990). P-bound PRs are dissociated from the heat shock
proteins, translocate to the nucleus, and bind to PR binding sequences or progesterone response
elements (PREs) in the promoters of target genes in form of either homo- or heterodimers (Gao
and Nawaz, 2002). After binding, modulation of target gene expression may be altered by
sequential interaction with either coactivators or corepressors (McKenna et al., 1999; Smith and
O’Malley, 2004).
Since most of genes regulated by P do not contain consensus PREs (Richer et al., 2002),
it is suggested that in addition to direct binding of PR to PREs, PRs can be recruited indirectly by
other factors to promoters without PREs. These factors, such as AP-1 (Bamberger et al., 1996),
Sp1 (Gao et al., 2001; Owen et al., 1998; Tang et al., 2002), NF-κB (Kalkhoven et al., 1996),
Stat5 (Richer et al., 1998), Stat3 (Proietti et al., 2005), Cre/AP-1 (Tseng et al., 2003), CEBPβ
(Christian et al., 2002), bind to DNA through their specific binding sites and tether PR to the
target promoter through protein-protein interactions.
PR can also exert transcriptional activity in a ligand-independent manner. Unliganded
PRA is reported to both up- and down-regulate a number of target genes. Most of these genes are
5

not regulated by P, suggesting that these genes have different functions compared to those
involved in P4-driven processes (Jacobsen et al., 2005). For example, ECM adhesion genes
DSCAM, ITGA3, CD44, PCDH1, and IGF-binding protein 5 (IGFBP5) and cell aggressiveness
markers such as ITGA3 are up-regulated by unliganded PR (Jacobsen et al., 2005). In addition,
unliganded PR is reported to bind to DNA and interact with a multi-repressor complex on 20% of
hormone-inducible genes. These genes are maintained in an inactive state by this PR-corepressor
complex. The presence of P may induce a conformational change to dissociate corepressors from
the complex with the sequential association of coactivators to induce transcription of the target
genes (Vicent et al., 2013). Thus, the structure of PRA and PRB determine their association with
coregulators of transcriptional activity, such that PRA has higher affinity for corepressors and
PRB has higher affinity for coactivators (Giangrande et al., 2000). A consequence of this is that
both the availability of P and the PRA:PRB ratio affect the outcome of P stimulation.
In addition to PR genomic functions in direct modulation of target gene expression, PR
can also act in a non-genomic manner through association with several signaling pathways and
cytoplasmic signaling molecules. For example, P treatment rapidly and transiently activates
protein kinases in breast cancer cells, such as MAPK, PI3K, and c-Src kinases
(Boonyaratanakornkit et al., 2001; Migliaccio et al., 1998; Saitoh et al., 2005). The mechanism
for this activity involves a specific polyproline motif in the N’-terminal domain of PR that is
capable of interacting with the SH3 domains of Src family kinases in a progestin-dependent
manner (Boonyaratanakornkit et al., 2001). This ultimately activates Ras and/or Raf1 and the
ERK/MAPK pathways. P-induced c-Src/MAPK activation is disrupted by mutation of the
polyproline motif, but not the DBD that is essential for the transactivation function of PRB. In
addition, a homolog of human PR, Xenopus classical PR (XPR), is reported to directly associate

6

with active kinases PI3K and p42 MAPK in oocytes on induction by P4 (Bagowski et al., 2001).
This mechanism is consistent with the rapid response to P that is observed in a non-genomic
context.
PRE-containing promoters have been used to study PR as a transcriptional activator.
Comparison of PRA to PRB by cotransfection isoform-specific PR expression plasmids with a
PRE-containing reporter plasmid reveals differential activity between isoforms. PRB in all cell
types is a potent transcriptional activator, while PRA exhibits a cell- and promoter-specific
activity (Mote et al., 2007). Additionally, PRA is a weaker transcriptional activator and can act
as a trans-repressor of PRB (Mote et al., 2007).
The study of PR isoform-specific gene signatures in a natural gene context with intact
promoter regions and the expression of potentially PR-interacting transcription factors and
cofactors may avoid the artifacts of artificial PRE-containing promoter-reporters. Expression
profiling data from PR-negative T-47D breast cancer cells stably expressing either only PRA or
PRB reveals distinct activities of the two isoforms (Jacobsen et al., 2005; Richer et al., 2002).
The transcriptional activity of PR is shown to be isoform-, tissue- and promoter-specific. PRA
and PRB regulate different subsets of genes. Under P treatment, the majority of genes are
regulated uniquely by PRB, some genes by PRA, and a few genes by both (Richer et al., 2002).
When the ligand-bound form of either isoform regulates the expression of a particular gene, PRB
is transcriptionally more active than PRA (Richer et al., 2002). However, for those genes
regulated by PR in a ligand-independent fashion, PRA is the stronger transactivator (Jacobsen et
al., 2005). These studies demonstrate that homodimers have capacity to regulate target genes, in
either P-dependent or -independent manners.

7

The aforementioned approaches explored the function of individual isoforms, however,
without comprehensively examining the function of heterodimers. Thus, these results fail to
reflect the co-expression of PRA and PRB, which often occurs physiologically (Mote et al.,
2002). Co-expression yields three possible dimeric forms: PRA:PRA, PRB:PRB, and the
PRA:PRB heterodimer. Cells with co-overexpression of both PRA and PRB at similar levels
have a small number of P-responsive genes (Graham et al., 2005) which are shared with cells
overexpressing single PR isoforms (Richer et al., 2002). This suggests that heterodimers and
homodimers have differential impact on gene regulation.
In T-47D cell line, P-responsive gene profiles are largely unaffected by PRA:PRB ratio
alteration from 1.8 to 5.1 (Graham et al., 2005) and repressive effects of PRA against PRB
transcription activity are not observed unless PRA was more than 15-fold in excess over PRB
(McGowan and Clarke, 1999). This supports the possibility that the presence of heterodimer is
more important in determining the gene targets as long as the PRA isoforms not far exceed PRB
isoforms.
Comparison between normal and breast cancer cells after P treatment shows the distinct
expression profiles of genes between the two cell types with few overlapping genes (Graham et
al., 2009), suggesting a dominant influence of tumorigenesis on P-driven transcription. Similarly,
little overlap is reported between PRA-positive adult and pubertal mammary epithelial cells
(Santos et al., 2009), suggesting dominant influence of the developmental stage of the cell.
Clearly, differences in structures, cis-element sequence, and interactions with other
transcription factors and co-regulators determine each isoform’s distinct activities in mammary
gland regulation, differentiation, proliferation, and response to P.

8

Progesterone Receptor Role in Mammary Gland Development
The mammary gland is a hormone-responsive organ that develops primarily after birth.
The gland dramatically develops during puberty, and more subtly changes with the hormonal
fluctuations of the menstrual cycle. The tissue proliferates and differentiates during pregnancy to
prepare for lactation, and then sequentially regresses at involution. Then, this cycle will repeat in
the next pregnancy.
Progesterone, an ovarian steroid hormone, is produced at its highest levels in the luteal
phase of menstrual cycle. During pregnancy, high levels of P are required to maintain pregnancy.
P largely exerts its effects through its receptor – PR (Obr and Edwards, 2012).
In human mammary gland, both PR isoforms are often co-expressed in the same cells
with similar levels (Mote et al., 2002) and PR levels are unchanged between the follicular and
luteal phases of menstrual cycle (Graham and Clarke, 1997).
In mouse, expression of PRA and PRB are temporally and spatially separated during
mammary gland development. PRA is the only expressed isoform during ductal development of
the virgin mammary gland, and is at its highest levels during puberty. PRA-positive cells do not
incorporate BrdU, thus they are not proliferating. The percentage of PRA-positive cells is
reduced in the mature gland, further reduced in pregnancy. PRB is expressed robustly in majority
of cells during alveologenesis in pregnancy, particularly at side branches and in developing
alveolar lobules. At this stage, co-expression of PRA and PRB is detected in a small subset of
cells. Moreover, PRB-positive cells incorporate the proliferation marker BrdU and stain for
cyclin D1 during pregnancy, indicating that PRB-expressing cells are proliferative during
pregnancy. No PR expression is observed during lactation (Aupperlee et al., 2005). Thus, PRA is
dominant in the virgin gland and PRA-positive cells do not proliferate, while PRB is expressed
9

most highly in the pregnant gland and PRB-positive cells are highly proliferative. This implies
that PRA and PRB are differentially regulated and that each isoform mediates a distinct response
to P.
PR function in the mammary gland development has been studied in both knockout (KO)
and transgenic mice. Mice lacking both PR isoforms (PRKO) exhibit normal ductal development
in virgin glands, but impaired ductal branching and lobuloalveolar development during
pregnancy (Lydon et al., 1995). This indicates that PRs are required for proliferation of the ductal
epithelium and for differentiation of alveolar lobules during pregnancy, which are induced by
prolonged treatment with E and P. Given the different transcriptional activities of the two
isoforms, elucidation of the specific physiological function of each isoform requires mice that are
selectively deficient in individual isoforms. PRAKO mice do not exhibit failure in the responses
of the mammary gland to P (Mulac-Jericevic et al., 2000). The E and P-induced morphological
changes of mammary glands in PRAKO mice are similar to those in wildtype, while these
responses are inhibited in PRKO mice. Studies of PRAKO mice suggest that PRB is necessary
and sufficient for the normal P-mediated proliferative and developmental responses of the
mammary gland, and that functional expression of PRA is not required. In contrast to PRAKO
mice, PRBKO mice exhibit a significant decrease in the proliferation of ductal and alveolar
epithelial cells in response to P. As a result, fewer side branches and reduced lobuloalveolar
development are observed in PRBKO mice (Mulac-Jericevic et al., 2003).
Transgenic mice overexpressing PRA or PRB both exhibit abnormal mammary
development. PRA transgenic mice show increased ductal branching, epithelial cell hyperplasia,
and a disorganized basement membrane (Shyamala et al., 1998), while PRB transgenic mice
show reduced ductal development, precocious alveolar development, but no apparent tumor10

associated abnormalities (Shyamala et al., 2000). Together, this indicates that PRB plays a role in
alveologenesis, while PRA plays a role in side branching.
P/PR signaling also contributes to mammary tumorigenesis. While the two isoforms are
co-expressed at similar levels in the normal human breast, this ratio is altered in tumorigenesis,
consistent with the aberrant response to hormones of breast cancer cells. A high PRA/PRB ratio
is observed in some breast tumors, which are more aggressive and resistant to endocrine
therapies (Hopp, 2004; Mote et al., 2002). Breast cancer patients with this high ratio have a
higher probability of relapse than patients with lower ratios of PRA/PRB (Hopp, 2004).
Consistent with this, transgenic mice with overexpression of PRA exhibit an abnormal
developmental phenotype with hyperplasia (Shyamala et al., 1998). Predominance of PRA may
lead to down-regulation of genes associated with differentiation and apoptosis, but up-regulation
of genes related to tumor development and metastasis. Indeed, overexpression of PRA in
cultured T47-D human breast cancer cells leads to changes in morphology and adhesive
properties (McGowan and Clarke, 1999). Moreover, PRA transgenic mice show differential gene
expression in comparison to wildtype mice, as decreased levels of p21, increased level of cyclin
D1 (Chou et al., 2003), decreased TGFb1 activation (Simian et al., 2009), which correlate with
high proliferation. Collectively, the data suggest that PRA may be more involved in the severity
of breast cancer than PRB. PRA is often associated with high proliferation and a more aggressive
tumor phenotype, while PRB is associated with differentiation of the mammary gland.
In addition, PRKO mice showed a reduction in mammary tumor incidence when treated
with DMBA compared to wildtype mice (Lydon et al., 1999), indicating a critical role of PR in
promoting tumorigenesis.
Collectively, the expression of the two PR isoforms is highly regulated and their
11

comparative expression levels ensure the appropriate cellular response to progesterone.
Regulation of Progesterone Receptor Expression
The status of chromatin has been reported to have effects on PR expression. Gene
silencing mediated by methylation of DNA at cytosine-guanine dinucleotides (CpG) has been
reported for the PR gene. The human PR gene has a CpG island in its 5’ regulatory regions. Early
reports using Southern analysis of DNA digested with methylation-sensitive restriction enzymes
showed that this CpG island was hypermethylated in 40% of PR-negative breast tumors and
cancer cell lines (MDA-MB-231, MDA-MB-468, and MDA-MB-435), but not in normal breast
specimens and PR-positive breast tumors and cancer cell lines (MCF-7, T-47D, and ZR75)
(Lapidus et al., 1996; Yang et al., 2001). Moreover, the study of isoform-specific promoters
showed that the PRA promoter and the PRB promoter were methylated in 7.7% and 92.2% of
breast cancers, respectively (Gaudet et al., 2009). Hypermethylation of PRB promoter has been
also observed in numerous dysplasias of human reproductive tissues, such as uterine endometrial
carcinoma (Sasaki et al., 2001), in endometriotic epithelial cells (Wu et al., 2006), adenomyosis
(Jichan Nie et al., 2010), and sporadic breast cancer (Mc Cormack et al., 2008).
Hypermethylation of PRA was shown in constitutive anti-progestin-resistant tumors, where PRA
is silenced (Wargon et al., 2011). However, reduction of DNA methylation levels by DNA
methyltransferase inhibitor was insufficient to reactivate PR gene expression in MDA-MB-231
cells, which are negative for ER and two PR isoforms. Thus other remodeling chromatin
mechanisms such as histone acetylation and methylation may be a further requirement for PR
gene transcription (Ferguson et al., 1998).
Histone modification, such as histone methylation and histone acetylation, of the PR gene
has been reported. Using the MCF-7 breast cancer cell model, a ChIP assay showed that histone
12

H3 lysine 4 (H3K4) methylation at the region containing the +571bp ERE half-site near PRA
transcription start site was associated with gene activation, and this controlled PR upregulation
by estradiol treatment (Stratmann and Haendler, 2011). In the same study, JARID1A, a H3K4
demethylase that specifically removes H3K4 methylation, is found to bind to this region to
counter E-upregulation of PR expression. Similarly, one physiological phenomenon observed in
the human myometrium during active labor is the increase of H3K4me3 at the PRA promoter.
Even though the occupancy of SMYD3, a co-activator of ER-mediated transcription that
methylates H3K4 at EREs, was enriched at PRA promoter with no labor association in
myometrium, JARID1A occupancy, which demethylates H3K4me3 and represses PR expression,
was reduced at labor stage (Chai et al., 2014). They suggested that interaction of SMYD3 and
JARID1A would determine H3K4 methylation status, and consequent PRA expression at this
stage. Together, those epigenetic changes lead to differential expression levels of PR isoforms.
Two separate promoters for PRA and PRB have been reported in human and rat. Each
promoter gives rise to the expression of different mRNAs. Human PR contains two distinct
promoters, a PRB promoter from -711 to +31bp relative to transcription start site for PRB and a
PRA promoter from +464 to +1105bp (Kastner et al., 1990) . Human studies have found that
17β-estradiol (E2) and ER are the major factors regulating PR. E responsiveness is mediated
through non-canonical EREs, as well as other binding sites for additional transcription factors.
In the human gene, an ERE half-site with two adjacent Sp1 sites in the +571/+595 region, two
Sp1 sites in the -80/-34 region, and a +90AP-1 site have been identified for ER-mediated
upregulation of PR, whereas +745AP-1 site with an adjacent imperfect ERE is repressive.
The ERE half-site with two adjacent Sp1 sites at +571/+595 is located in the PRAspecific region of the human PR promoter. In vitro binding assays confirm that Sp1 and ER
13

directly bind to their respective sites and form a Sp1-ER-DNA complex in this region (Petz and
Nardulli, 2000). This study found that ER enhances Sp1 binding, and that ER fails to bind to a
mutant ERE half site. Further studies examined the individual contributions of each site to E2mediated transcription of PR (Petz et al., 2004a). The two Sp1 sites gave rise to an additive
rather than a cooperative or synergistic effect. Studies in intact cells detect Sp1 occupancy on the
endogenous ERE/Sp1 site with or without E2 treatment, suggesting its role in the basal PR
expression in the absence of E. Basal expression of a TATA-CAT reporters inserted with an
oligo containing mutated single or both Sp1 sites of +571 ERE/Sp1 sequence are decreased in
comparison with the wildtype reporter. Together observations suggest that Sp1 by itself may
activate basal expression of PRA, whose start site is about 150bp downstream. Moreover,
mutation of both Sp1 sites decreases promoter activity more than does mutation of a single site,
while mutation of the ERE site increases transcription. However, ERα occupancy is only
observed after E2 addition and enhanced Sp1 binding in vitro, suggesting that this ERE/Sp1 site
modestly modulates PR transcription.
In addition to this half ERE/Sp1 site, another ERE half-site is found between the two PR
promoters to enhance PR expression. This site is adjacent to an AP-1 site at +90. In gel mobility
shift assay, ER binding enhances AP-1 (c-Jun and c-Fos) protein binding. In the endogenous
promoter of intact cells, this region shows substantial occupancy by ER, c-Fos, and c-Jun in
ChIP assays (Petz et al., 2002). This AP-1 site that interacts with EREs is not well conserved
across species (our observation), so the role AP-1 in E2-responsiveness of PR may not be a
global phenomenon.
The same group found E2-responsive elements in the PRB promoter region located from
-80 to -34, containing two Sp1 sites, but without direct binding of ERα (Schultz et al., 2003).
14

However, ERα is able to enhance Sp1 binding to its site. Mutation of these Sp1 sites leads to
inefficient Sp1-DNAcomplex formation in vitro and substantially decreased promoter activity.
The Sp1 site proximal to transcriptional initiation is more potent than the distal Sp1 site in E2responsive activation of PR, as shown in a promoter-reporter assay utilizing site-specific
mutations plus coexpression of ERα.
An additional E2-responsive AP-1 site with an adjacent imperfect ERE has been reported
for the PR promoter at +745bp. Cotransfection for ERα and c-Jun/c-Fos expression repressed
wildtype 1.5kb promoter activity (containing sequence from -711 to +817), whereas E2 and ERα
enhanced transcription in a promoter where this AP-1 site had been mutated, indicating that
inhibitory effect of E2 at this site on the PR gene was mediated in an AP-1-dependent manner.
The binding of ERα to this ERE site enhances the binding of c-Jun and c-Fos in vitro. In ChIP
assay of the intact endogenous gene, the complex of c-Fos and ERα with DNA was observed in
the presence of E2, while a c-Jun-containing complex was present with and without E2 treatment
(Petz et al., 2004b). This +745 site is adjacent to the PRA transcription start site at +737bp, thus
it is suggested to modulate the expression of PRA.
Because PR levels increase in cyclin D1 transgenic mice with E2 treatment and decrease
in cyclin D1 KO mice (Yang et al., 2010), cyclin D1 was examined for its role in transactivation
of the PR gene (Yang et al., 2010). Cyclin D1 stimulated human PR expression via an enhancer
in the 3’-untranslated region (UTR) which is bound by ERα in a ChIP assay. This UTR when
cloned to a heterologous promoter could enhance transcription in response to E2 and cyclin D1.
This enhancer region conferred significantly activated reporter expression to the PR promoter
region. In experiments examining overexpression or knockdown of cyclin D1, the UTRcontaining promoter was responsive to changes in cyclin D1 levels (Yang et al., 2010). In
15

addition to cyclin D1 modulation of PR expression, there is an auto-inhibitory loop where
liganded PR suppresses cyclin D1 expression (Groshong et al., 1997).
In the rat PR gene, two distinct promoters, a distal -131/+65bp PRB promoter and a
proximal +461/675bp PRA promoter have also been identified (Kraus et al., 1993). Unlike the
human PR gene where E can induce the activity of both isoform-specific promoters and can upregulate the expression of both isoforms, only the rat proximal PRA promoter is induced by E2
in MCF7 cells. These studies found five widely distributed E-responsive regions containing four
imperfect ERE sites and four ERE half-sites. The enhancers constructed by PR fragments of five
EREs showed both promoter specificity and E2-responsiveness. The position and spacing of the
ERE regions determined E2-mediated cooperative effects on PR expression among the
respective elements (Kraus et al., 1994).
In the rabbit, PRB is the only isoform expressed and its transcript is produced from a
single promoter (Savouret et al., 1991). An ERE at the translational initiation site confers Edependent upregulation of PR.
In addition to the effects of EREs and transcription factor binding sites proximal to the
PR gene in the 1-2kb sequence in the vicinity of the transcription start sites (TSS), a long range
transcriptional mechanism of ER-dependent upregulation of PR is also reported (Bonéy-Montoya
et al., 2010). In particular, eight EREs, which had been shown to bind ERα are located in a
region from 311 kb upstream to 4 kb downstream of the PRB TSS. These distal regions
cooperatively interact with TSS proximal regions and increase the sensitivity of the PR gene to
E-mediated upregulation.
There is evidence supporting the notion that other E/ER-independent factors are also
involved in regulating PR expression. For example, PR expression does not change during the
16

hormone fluctuations associated with the menstrual cycle (Mote et al., 2002), so some
mechanism that attenuates hormonal influences must be at play. PR was still detected in ERKO
mice (Korach, 2000), so the basal level of PR expression must depend on other factors that are
not hormone-dependent for their activity. In ER+/PR- breast tumors, the expression of ER is
clearly insufficient for PR expression, even though ER is fully functional in these tumors (Cui et
al., 2003a). Clearly, PR transcription utilizes some E-independent regulatory mechanisms.
Although the two Sp1 sites in the -80/-34bp sequence play a role in E2-mediated
transcription, another study found in that region a -67bp binding site for the homeobox protein
HOXA5, which was involved in hormone-independent PR expression. In vitro binding of
HOXA5 to this site and upregulation of PR expression were observed with a wildtype but not a
HOXA5 binding site mutant promoter sequence (Raman et al., 2000).
GATA5 has also been implicated in PR regulation (Huggins et al., 2006). The human PR
gene has a +331G/A polymorphism that correlates with breast cancer risk. GATA5, which is
strongly expressed in breast cancer cell lines, binds adjacent to the polymorphism at +311 site
and activates the transcription of human PR promoter, especially the PRB promoter. The +331A
allele is more strongly activated by GATA5 than the +331G allele, and is associated with
increased breast cancer risk.
Another level of transcriptional regulation of PR expression occurs through positive and
negative autoregulation that is cell type and tissue-specific.
For example, in rabbit PRB, an ERE for E-dependent upregulation of PR also controls
P/PR-dependent downregulation of PR, which requires the DNA binding domain of PR and not
as a result of decreased affinity of ERE; however, the mechanism is unclear (Savouret et al.,
1991). P blocks the stimulatory effects of E2 on both PR mRNA and protein in the rat uterus
17

(Kraus and Katzenellenbogen, 1993). P represses both basal and E2-stimulated human PR
transcription rate and mRNA concentration without affecting the activity of PRB (−711/+31) and
PRA (+464/+1105) promoters in T-47D human breast cancer cell lines (Graham et al., 1995).
The fact that multiple examples exist for negative P-dependent autoregulation of PR suggests
that the expression levels of these receptors must be limited or that signaling must be transient
rather than sustained.
In addition, PR exerts a positive feedback loop for its own expression by activating its
own promoter (Tang et al., 2002). In human endometrial stromal cells treated with the PR ligand
medrozyprogesterone acetate (MPA), PRA, and to lesser extent PRB, significantly induces the
transcription of PR promoter reporters. Since PR ligand binding domain, but not DNA binding
domain is required, this transactivation is not mediated through a PR binding site, but an Sp1 site
at -49/-43bp, where site-specific mutation abrogates PR-mediated transactivation function.
Moreover, the physical interaction between Sp1 and PR has been identified, suggesting a model
in which Sp1 may recruit PR (Tang et al., 2002).
Provocatively, this positive loop extends to other transcription factors that influence PR
expression. Liganded PR increases C/EBPβ levels in human breast cancer cells (Richer et al.,
2002) and in mouse mammary glands (Aupperlee et al., 2009), and c-Jun, as well, is P-regulated
(Alkhalaf and Murphy, 1992). Our own research (presented in this dissertation) shows the
activity of C/EBPβ and c-Jun in transcription from the PR promoter. This draws a picture of a
regulatory network where P enhances the expression of its own receptor through the activation of
several transcription factors.
In addition to E2, other signaling pathways regulate PR expression in different cell types,
such as follicle stimulating hormone (FSH), luteinizing hormone (LH) and forskolin (all of
18

which elevate cAMP) in rat preovulatory granulosa cells (Clemens et al., 1998; Sriraman et al.,
2003). In rat, distal (-131/+65bp) promoter shows low basal and small induced level to forskolin,
whereas proximal (+461/+675bp) promoter exhibits higher basal activity and response to
forskolin. The putative ERE-like region (ERE3) in the rat proximal PR promoter requires for
forskolin-induce activity of reporter construct containing ERE3 region ligated with PR promoter.
The distal PR promoter contains a GC rich region with a CCAAT box at -68 bp and a GC box for
putative Spl binding at -47 bp. This GC rich region binds Sp1, but does not bind either C/EBPα
or C/EBPβ in vitro. They suspected that Sp1/Sp3 synergized with factors binding to ERE3 to
transactivate forskolin-induced distal promoter (Clemens et al., 1998). In another report
(Sriraman et al., 2003), forskolin/phorbolmyristate (PMA) significantly transactivates the mouse
PR promoter reporter (-348/+680bp). Similarly to the rat promoter, the distal promoter (348/+64) and proximal promoter (+420/+680bp) show similar activity and response to forskolin.
Mutation of either the CCAAT box or the Sp1 site in GC region of distal promoter did not alter
transcriptional function, even though they identified in vitro that NFY-B, Sp1/Sp3, and GATA-4
bound to a CCAAT box, GC box, and a GATA site, respectively. The proximal promoter region
confers PMA-responsiveness, this effect is mediated by two Sp1/Sp3 binding sites +440/+461
and +473/+490. Among of two, mutation +473/+490 Sp1 site results in total loss of proximal
promoter activity, 70-80% reduction of forskolin/PMA-induced intact longer (-145/+680bp)
promoter, and more severe reduction of longer promoter when combination with mutated distal
GC box (Sriraman et al., 2003).
In breast cancer cells, downregulation of PR mRNA transcription by IGF-I (Insulin like
growth factor I), which is mediated through the PI3K/AKT/mTOR signaling pathway, depends
upon PR promoter context (Cui et al., 2003a). Interestingly, IRS-2, which is utilized by IGFs for

19

signal transduction in cells, is transcriptional induced by liganded PRB (Cui et al., 2003b). This
suggests that PR has a negative feedback loop by indirectly suppressing its expression through
IRS-2, an element for IGF-I effectiveness. Together with the positive feedback loops discussed
above, this negative feedback loop may sensitively fine-tune the expression of PR.
In sum, PR gene contains multiple regulatory elements operating at both the
transcriptional and post-transcriptional levels in a species, tissue (e.g., breast vs. reproductive
organs), cell (e.g., normal vs. neoplastic), PR isoform (i.e., PRA vs. PRB), ligand, and
coactivator-specific manner. In addition to the mechanisms discussed here, PR is also regulated
by post-translational modifications, including phosphorylation, ubiquitination, sumoylation, and
acetylation. These modifications affect PR functions at multiple levels to alter PR stability,
localization in the cell, interaction with co-factors/co-regulators, and transcriptional activity.
These mechanisms also show species, tissue, cell, isoform, ligand, and co-regulator specificity to
provide a very complex regulatory system.
CCAAT/Enhancer Binding Protein (C/EBP) family
CCAAT/enhancer-binding proteins (C/EBPs) are widely expressed transcription factors
involved in many biological processes, including energy metabolism, immunity, inflammation,
hematopoiesis, adipogenesis, osteoclastogenesis, cell cycle, and cellular proliferation and
differentiation (Tsukada et al., 2011). The C/EBPs comprise a family of basic leucine zipper
transcription factors with six identified members: C/EBPα, C/EBPβ, C/EBPγ, C/EBPδ, C/EBPε,
and C/EBPδ (Ramji, 2002; Zahnow, 2009). The C/EBPα, -β, -γ, -δ and genes are intronless,
whereas C/EBPε and -δ contain two and four exons, respectively. The C/EBPγ, C/EBPδ, and
C/EBPδ genes produce single proteins. However, the C/EBPα and C/EBPβ genes generate
multiple isoforms by the alternative use of translation initiation sites from the same mRNA. The
20

C/EBPε gene also produces multiple isoforms; however this is accomplished by alternative
promoter usage and differential splicing.
C/EBP family members consist of three structural regions: an N’-terminal activation
domain (AD), a basic amino acid-rich DNA binding domain, and a leucine zipper domain that
allows dimerization. The two latter domains are referred to as a bZIP region. Their N’-terminal
region, which is least conserved across the different family members (20% shared sequence
identity), contains activation domains that interact with the basal transcription apparatus and
several transcriptional coactivators. C/EBPδ lacks defined activation domains and possesses a
less conserved DNA binding domain that fails to bind the C/EBP consensus binding site. It
generally acts as a dominant negative inhibitor of C/EBP-dependent transcription by forming
heterodimers with other C/EBP family members that fail to bind the C/EBP consensus binding
site. C/EBPδ:C/EBPβ heterodimers are known to activate endoplasmic reticulum stress response
genes through a non-consensus binding site. C/EBPγ also lacks defined activation domains and
has generally been seen an inhibitor of C/EBP-depend transcription, although it has been shown
to have a stimulatory effect in the activation of IL-6 and IL-8 transcription (Gao et al, 2002).
In addition to N-terminal activation motifs, negative regulatory regions have also been
identified in some C/EBPs. For example, C/EBPβ has two N'-terminal negative regulatory
domains, RD1 and RD2, of which deletion mutations or phosphorylation result in increased
protein activity. RD1 suppresses transcriptional activity by inhibiting AD through direct
interaction, while RD2 inhibits the DNA binding activity (Williams et al., 1995)
The highly conserved bZIP domain (90% shared sequence identity) is required for DNA
binding and for forming homodimers or heterodimers within the C/EBP family. The multiple
isoforms among C/EBPα, -β, and -ε provide even greater diversity in dimer formation than that
21

derived from six simple family members. There is also limited dimerization with members of
other leucine zipper protein families, such as the AP-1 family. C/EBPs bind as a dimer to a
consensus DNA binding site: RTTGCGYAAY, where R is A or G, and Y is C or T. However,
numerous variations of the consensus site containing a conserved half-site followed by a more
divergent sequence with at least 2 bp of the consensus are functional (Tsukada et al., 2011)
The differential transactivation activity of various C/EBP dimmers for particular target
genes is dependent on not only the DNA binding specificities and affinities, but also the family
member and isoform composition of the dimer. In turn, the composition and formation of C/EBP
dimers depends on tissue- and developmental stage-specific expression of various C/EBP family
members and isoforms. Also, specific post-translational modifications and the availability of coregulators and other transcription factors contribute to the transactivation activity of C/EBP
transcription factors. On the other hand, the structural similarities among all the C/EBP family
members and isoforms can lead to their functional redundancy, depending on their co-expression
in a specific cell type.
C/EBPβ
The C/EBPβ gene has been cloned from the human, mouse, rat, cow, wild boar, chicken,
frog, sea slug, salmon, and zebrafish. In all species, it is encoded by an intronless gene
containing a single exon. In the mouse, the C/EBPβ gene is transcribed into a single 1.4-Kb
mRNA. C/EBPβ expression is widely regulated by multiple mechanisms. At the transcriptional
level, C/EBPβ expression is regulated by a number of transcription factors, including
CREB/ATF, Sp1, c-Jun/ATF2, KLF4, Nrf2, tethering of Stat3, and autoregulation by C/EBPβ
itself (Berrier et al., 1998; Birsoy et al., 2008; Hou et al., 2012; Lin et al., 2002; Niehof et al.,
1997, 2001a, 2001b) . Posttranscriptional control of C/EBPβ gene expression also has been
22

reported. AU-binding protein HuR interacts with the 3'-UTR of C/EBPβ mRNA to enhance
mRNA stability and translation in anaplastic large cell lymphomas (Bergalet et al., 2011). The
expression of the multiple C/EBPβ isoforms is regulated translationally. In the mouse, the three
isoforms are formed by either leaky ribosome scanning or differential initiation of translation
using alternative in-frame AUG sites (Zahnow, 2009): full-length 38-kDa liver-enriched
activator protein (LAP1), 35-kDa N-terminally truncated LAP2, and 21-kDa N-terminally
truncated liver inhibitory protein (LIP). In the mouse, LAP1 comprises the two conserved
regulatory domains found in other C/EBP proteins, as well as the bZIP region. Additionally, the
first N-terminal 21 amino acids constitute a regulatory domain with chromatin remodeling
activity. The smaller LAP2 lacks the first 21 amino acids of the N-terminus, but is otherwise
identical to LAP1. In many cell types and tissues, LAP2 is the most active and abundant isoform
compared to LAP1 and LIP. The shortest truncated isoform, LIP, lacks all of the N-terminal
activation domains. Heterodimerization of LIP with LAP isoforms generally represses the
transactivation function of LAPs. Moreover, LIP homodimers have higher affinity for DNA
binding than LAP1 and LAP2, and thus can effectively compete with these activating isoforms
for DNA binding. LIP is generally considered as a dominant negative isoform, although there are
instances where it can participate in transactivation. For instance, LIP can participate in
activation of the IL-6 promoter (Hu et al., 2000).
LAP1 is translated at the first in-frame start codon. The translation of LAP2 and LIP is
controlled by the 5' UTR containing an upstream AUG (uAUG) and a small upstream open
reading frame (uORF). This region, located between the first start codon for LAP1 and the
second start codon for LAP2, forms a stable secondary hairpin structure, which interferes with
scanning ribosomes. Translation starting at uAUG prevents initiation at the LAP2 initiation

23

codon adjacent to this uAUG, allowing ribosomes to re-initiate translation at the downstream LIP
initiation codon. However, failure of initiation at uAUG allows translation to initiate at the
LAP2 AUG codon to produce LAP2 protein (review in (Zahnow, 2009)).
Translation initiation factors, such as eIF-2 and eIF-4E, have been shown to contribute to
the differential translation C/EBPβ isoforms. Increased activity of eukaryotic translation
initiation factors eIF-2 and eIF-4E through inactivation of RNA-dependent protein kinase (PKR)
and activation of mammalian target of rapamycin (mTOR) favor LIP expression, whereas
decrease of eIF and inhibition of mTOR activity enhance expression of LAPs (Calkhoven et al.,
2000; Jundt et al., 2005). Moreover, some specific RNA binding proteins, such as CUG repeat
binding protein (CUGBP1) and calreticulin, interact with the uORF structure in the 5’- end of the
C/EBPß mRNA and induce translation from downstream start codons (Timchenko et al., 2002,
1999).
In addition to the 5'-UTR/uORF mechanism, LIP can also be generated through
proteolytic cleavage of full-length C/EBPβ by a C/EBPα -dependent mechanism (Welm et al.,
1999), by in vitro proteolysis (Baer and Johnson, 2000), or by the activity of the proteolytic
enzyme calpain (Wei et al., 2006).
The functions of C/EBPβ depend on not only differential translation products and the
resulting isoform ratio, but also post-translational modifications that are linked to multiple
signaling pathways. These modifications, which include phosphorylation, sumoylation,
acetylation, and methylation, alter C/EBPβ function, transcriptional activity, efficiency of DNA
binding, and interaction with other co-factors. C/EBPβ is normally maintained in repressed state
which is controlled by two regulatory domains (Kowenz-Leutz et al., 1994; Williams et al.,
1995). This inhibited conformation is relieved and transcriptional function activated by
24

phosphorylation of multiple C/EBPβ serine and threonine residues by kinases: Ras–MAPK,
growth factors and glycogen synthase kinase 3b (GSK3b), calcium/calmodulin-dependent
protein kinase, ribosomal S6 kinase, protein kinases A and C, the cyclin-dependent kinase
pathway CDK1–CDK2–CCNA2 (cyclin A) (Zahnow, 2009).
There is also a crosstalk between phosphorylation and methylation. In the absence of
activating phosphorylation, C/EBPβ is methylated at conserved K39 and R3 residues by histonelysine N-methyltransferase - H3 lysine-9-specific 3 (G9a) and protein arginine methyltransferase
4 (PRMT4/CARM1), respectively, and maintained in an inactive or repressed state; however,
phosphorylation of C/EBPβ at MAP kinase site (chicken Thr220 and human Thr235) in the RD
disrupts the interaction between the C/EBPβ protein and those methyltransferases (KowenzLeutz et al., 2010; Pless et al., 2008).
Acetylation of C/EBPβ modification may either activate or repress its activity, depending
on the acetyltransferase and sites. Increased acetylation of a cluster of lysine residues from
amino acid 98 to 102 by GCN5 and PCAF during glucocorticoid treatment enhances C/EBPβ
transcriptional potential (Wiper-Bergeron et al., 2007). Similarly, acetylation at Lys39 increases
the transactivational activity of C/EBPβ on promoters for C/EBPα and c-Fos (Ceseña et al.,
2007). However, acetylation at Lys215 or Lys216 decreases C/EBPβ binding activity, whereas
deacetylation by HDAC1 is required for C/EBPβ transactivational function on Id-1 gene (Xu et
al., 2003).
Sumoylation, which correlates with gene silencing, is also reported with C/EBPβ.
Human LAP1, but not LAP2, can be sumoylated on Lys173 (Lys132 in mouse) by SUMO-2 and
SUMO-3. This sumoylation of LAP1 requires Lys173 and the first 23 N’-terminus amino acids
unique to LAP1 of human C/EBPβ. The sumoylated form of LAP1 impairs the transactivational
25

function of LAP1 on cyclin D1 (CCND1) gene (Eaton and Sealy, 2003)
Constitutive expression of C/EBPβ is high in the liver, intestine, lung, adipose tissue,
spleen, kidney and myelomonocytic cells (Ramji and Foka, 2002). In these instances, LAP1 is
generally expressed at lower levels than LAP2 and LIP. In most of cases, LAP2 is regarded as
the most transcriptionally active isoform, while LIP is an inhibitor of C/EBP-dependent
transcription (Zahnow, 2009).
The ratio of LAP:LIP has been shown to be altered in ER stress response, in mammary
gland development, in liver development, regeneration, and lipopolysaccharide (LPS)-mediated
acute phase response, and in some cancer diseases (Li et al., 2008; Zahnow, 2002). These
observations indicate that this ratio has a substantial function importance in these processes and
similarly to dimerization between different C/EBP family members, dimerization among C/EBPβ
isoforms can determine its functional activities, including DNA binding, transactivation, crosstalk with signaling pathways, and interaction with other transcription factors/co-regulators.
LAP1 and LAP2 differ by an additional 21 amino acids at the N-terminus of LAP1. This
structural difference may determine the functional distinction between the two isoforms through
their abilities to form specific folded structures and consequent distinct protein-protein
interactions. LAP2 is generally the more active of the two isoforms, although the activity of
these two isoforms is both dependent upon the specific transcriptional target and the activity of
specific signaling pathways. Unlike LAP2, LAP1 is reported to be a repressor in certain contexts.
The 21 amino acid N'-terminus contains a motif allowing interaction with the enabled/VASP
homology 1 (EVH1) domain of Homer-3. This interaction suppresses C/EBPβ transcriptional
activity (Ishiguro and Xavier, 2004). In addition, N'-terminus of LAP1 is required for binding
and recruiting SWI/SNF to the promoter of Ric-8B gene encoding for a guanine exchange factor
26

(GEF), resulting in negative regulation of this gene expression. However, methylation of R3
prevents the interaction and consequently inhibits LAP1 repressive effect on Ric-8B gene
(Aguilar et al., 2014; Grandy et al., 2011). Moreover, 21-amino acid region also plays a role in
LAP1 susceptibility to sumoylation. Sumoylation is specific for LAP1, and results in LAP1
inactivation. Consequently, LAP1 fails to transactivate cyclin D1 gene. Whereas LAP2, lacking
this modification, is able to activate this gene (Eaton and Sealy, 2003). Other genes repressed by
sumoylated LAP1 include peroxisome proliferator-activated receptor β/δ (PPARβ/δ) (Di-Poï et
al., 2005) and cyclooxygenase-2 (cox-2) through recruiting HDAC4 by LAP1 (Wang et al.,
2008). This effect is target gene-specific, as sumoylation does not inhibit the activity of LAP1 in
IL-4 transcription and relieves the repressive effects of LAP1 on c-myc transcription (BerberichSiebelt et al., 2006). Additionally, there are instances where LAP2 preferentially binds coactivators, while LAP1 with its additional amino acids cannot. For example, Nopp140 synergizes
with LAP2, but not LAP1, to transactivate the AGP promoter-reporter. LAP2 also has higher
basal activity than LAP1 in AGP transactivation (Lee et al., 1996).
However, LAP1 is also has unique activation functions. LAP1 activates manganesecontaining superoxide dismutase (MnSOD), while LAP2 and LIP inhibit IL-1β-dependent
induction of this gene (Qiu et al., 2008). Moreover, LAP1, but neither LAP2 nor LIP, is regulated
in a redox-responsive manner, in which the formation of a Cys11-Cys33 (i.e., positions 11 and
33) disulfide bond in LAP1 represses its activity and allows its activation by a redox switch to
up-regulate IL-6 expression in the presence of LPS (Su et al., 2003). There are other examples
for LAP1-specific activation functions. Unlike repressive effect in Ric-8B gene, the interaction
of chromatin remodeling complex SWI/SNF and the LAP1-specific N-terminal region results in
activation of a number of myeloid target genes (Kowenz-Leutz and Leutz, 1999). Unmethylation

27

of R3 residue in LAP1-specific N'-terminus enhances SWI/SNF recruitment, eventually leads to
target gene activation (Kowenz-Leutz et al., 2010).
Surprisingly, LIP, although lacking any defined activation domains, has also been
reported to play a role in activating some genes via its interactions with other transcription
factors. LIP and PRB cooperatively activate both the mouse mammary tumor virus (MMTV)
promoter, which has several consensus PREs, and a synthetic construct consisting of two
palindromic PREs upstream of the minimal dPRL promoter region (Christian et al., 2002). This
synergy requires the binding of ligand-bound PRB to its binding site with LIP acting as a
coactivator. LIP also interacts with Runx2 to promote osteoblast differentiation (Hata et al.,
2005) and cooperates with NF-κB for LPS-induced transcription of IL-6 promoter in B
lymphoblast (Hu et al., 2000). LIP is also the most active C/EBPβ isoform in activation of the
CDH3 promoter in breast cancer cells (Albergaria et al., 2013), and up-regulates the transcription
of the chemokine receptor CXCR4 through direct binding to the CXCR4 promoter (Park et al.,
2013). It has been suggested that the bZIP domain of C/EBPβ, which comprises the majority of
LIP, serves as a scaffold for mediating the association of various transcriptional activators with
their target genes (Hata et al., 2005; Tominaga et al., 2008). Moreover, the mutated C/EBPβΔSpl
(covalent to LIP protein) activates cyclin D1-responsive promoters similarly to cyclin D1 by
itself, while the LAP1 wildtype protein reduces the cyclin D1-induced promoter activity, this
indicates that LIP may act as a competitive inhibitor to the repressive form of LAP1(Lamb et al.,
2003). These models are not mutually exclusive of each other.
The synergistic effects of C/EBPβ with other factors which bind adjacent to C/EBP site
on DNA have been widely reported. However, the cooperation of C/EBPβ and other factor from
separated sites on a promoter has also been reported. C/EBPβ directly interacts with cMyb in a
28

distant manner, 80 bp away (Tahirov et al., 2002).
Role of C/EBPβ in Mammary Gland Development
Low levels of C/EBPα expression during mammary gland development and the absence
of any effects on gland morphology in C/EBPα KO mice suggests that C/EBPα plays a relatively
minor role in mammary epithelial cell biology (Robinson et al., 1998; Seagroves et al., 1998).
However, C/EBPβ and C/EBPδ show dramatic changes in expression levels and have functions
during mammary gland development.
C/EBPδ mRNA levels are low throughout pregnancy and lactation, but are elevated
transiently at the onset of involution (Gigliotti and DeWille, 1998). C/EBPδ is involved in the
initiation growth arrest and apoptosis during involution (O’Rourke et al., 1999; Thangaraju et al.,
2005). Further, the mammary glands of nulliparous C/EBPδ KO mice show ductal hyperplasia in
gland, as well as delayed involution (Gigliotti et al., 2003). These latter results indicate that
C/EBPδ functions not only in involution, but in growth regulation during development in
nulliparous mice.
C/EBPβ mRNA levels are detectable in the virgin gland, elevated during pregnancy,
decline slightly in mid-lactation, and activated again during involution (Gigliotti and DeWille,
1998; Robinson et al., 1998). At protein levels, LAP1 and LAP2 are detectable and vary in
expression to some degree at all stages, with increased expression of LAP2 at the onset of
pregnancy and very low LIP levels in the virgin gland that are dramatically increased during
pregnancy and decreased to virgin gland levels during lactation (Raught et al., 1995; Seagroves
et al., 1998). The variation in LIP expression during pregnancy suggests it, among other C/EBPβ
isoforms, specifically plays a key role at that stage. The expression of PRB is also elevated at this
time (Kariagina et al., 2008).
29

Mice lacking all three C/EBPβ isoforms exhibit reduced ductal development, decreased
branching, and low proliferative rate. This is especially evident in abnormal alveologenesis with
only limited lobuloalveolar development and ductal side branching during conditions of
pregnancy mimicked by estrogen/progesterone treatment (Robinson et al., 1998; Seagroves et al.,
1998). This phenotype is similar to that observed in PRKO mice, specifically PRBKO mice
(Lydon et al., 1995; Mulac-Jericevic et al., 2003) . While C/EBPβ levels are unchanged in PRKO
mice (Seagroves et al., 2000), an increased number of PR-positive cells and increased mRNA
levels are in C/EBPβ KO mice (Seagroves et al., 2000). Further indication of a relationship
between C/EBPβ and PR expression is that an overall decrease in PR that is observed in sexually
mature wild type mice fails to occur in C/EBP KO mice, while no alterations in C/EBPβ
expression are observed in PR-deficient mice (Seagroves et al., 2000). This is consistent with
C/EBPβ acting upstream of PR. Moreover, uniform distribution of PR in all stages rather than
switching to non-uniform pattern between 8-12 weeks of age and dramatically reduced
proliferation of epithelial cells in E+P treatment are observed in C/EBPβ KO mice. The nonuniform distribution of PR-positive cells was proposed to initiate alveolar development through
the juxtacrine signaling to affect the proliferation of PR-negative cells (Seagroves et al., 2000).
C/EBPβ KO mice actually showed increased numbers of ERα/PR positive cells, yet these cells
fail to proliferate in response to E and P (Grimm et al., 2005). The lack of hormone-responsive
proliferation was attributed to increased active TGF-β1, reduced cyclin E expression, increased
p27 stability, decreased levels of phosphatase cdc25a, and absence of cdk2 kinase activity
(Grimm et al., 2005). Collectively, the data from C/EBPβ KO mice suggest a role in the control
of cell fate determination and proliferation in the mammary epithelium.
Since LAP2 is the most active isoform in most systems and organs, mice lacking only

30

LAP2 were generated by a knock-in mutation that removes the LAP2 translational initiation
codon (Uematsu et al., 2007). In these mice, the defects in mammary gland development and
differentiation which are observed C/EBPβ KO mice are not apparent. Moreover, homozygous
C/EBPβΔuORF female mice which fail to express LIP, while still expressing LAP1 and LAP2,
show normal mammary gland development and function (Wethmar et al., 2010). Together, in
contrast to C/EBPβ KO mice, the deficiency of either LAP2 or LIP alone does not produce a
mammary gland phenotype, implying that both LAP2 and LIP are redundant in regard to
mammary gland development, or that LAP1 is the critical isoform for mammary gland
development. On the other hand, transgenic overexpression of LIP increases mammary epithelial
proliferation leading to mammary hyperplasia and infrequent carcinoma development (Zahnow
et al., 2001). Since LAP1 expression levels in the mammary gland are quite low (Zahnow, 2002),
it is unlikely to be the critical isoform for mammary gland development. We hypothesize that
since LIP is highly regulated during the course of pregnancy, it is likely a key player in the
regulation of mammary gland development in pregnancy. LAP2 clearly has some degree of
redundancy to LIP, but is essential in regulating some genes expressed in the terminally
differentiated gland, such as β-casein (Doppler et al., 1995; Raught et al., 1995) and whey acidic
protein (Seagroves et al., 1998) . These two genes were significantly inhibited in C/EBPβ KO
mice (Robinson et al., 1998; Seagroves et al., 1998).
Mice deficient for these following genes fail to undergo normal lobuloalveolar
morphogenesis during pregnancy: cyclin D1 (Fantl et al., 1995; Sicinski et al., 1995), PR (Lydon
et al., 1995), Id2 (Mori et al., 2000), C/EBPβ (Robinson et al., 1998; Seagroves et al., 1998),
Stat5 (Liu et al., 1997), RANKL/RANK (Fata et al., 2000), PRL/PrlR (Brisken et al., 1999;
Ormandy et al., 1997). Among those genes, C/EBPβ directly binds to promoters and regulates

31

the expression of cyclin D1 (Bundy and Sealy, 2003; Eaton et al., 2001), Id2 (Karaya et al.,
2005), PrlR (Goldhar et al., 2011; Hu et al., 1998), and up-regulates PR (Chapter 2).
Collectively, the literature describe C/EBPβ as a key regulator in the functional
differentiation of mammary epithelial cells and as essential for proper proliferation and
differentiation in response to hormone stimulation during mammary gland development,
particularly pregnancy. Moreover, each isoform has both overlapping and distinct roles in growth
and differentiation of the mammary gland.
Activating Protein-1 (AP-1) family
AP-1, a basic region-leucine zipper family of transcription factors, includes 4 subfamilies Jun (c-Jun, JunB, JunD), Fos (c-Fos, FosB, Fra-1, Fra-2), Atf (ATF2, LRF1/ATF3, BATF, JDP1, JDP2) and Maf (c-Maf, MafB, MafA, MafG/F/K and Nrl) (Shaulian and Karin,
2002). All members share a bZIP region: a leucine zipper domain that mediates dimerization and
a basic amino acid-rich DNA binding domain. Fra-1, Fra-2, and several alternatively spliced
variants of FosB, FosB1 and FosB2, lack transcriptional activation domains and can act as
inhibitors to the transactivation activity of other family members. Similarly to other bZIP
families of transcription of factors, members of the AP-1 family need to dimerize in order to bind
DNA. Its consensus DNA-binding site is TGA(C/G)TCA. However, variation in recognition
sequences has been observed in the promoter and enhancer regions of many genes. These variant
DNA binding elements are suggested to contribute to the differential binding of various AP-1
dimer complexes to target genes (Chinenov Y 2001).
While the Jun and ATF proteins can form homodimers, the Fos proteins cannot
homodimerize but must heterodimerize with Jun members to form active and stable complexes.
c-Maf and Nrl dimerize with both c-Jun and c-Fos, whereas MafB, MafF, MafG and MafK
32

dimerize with only Fos, but not Jun (Meng and Xia, 2011). The composition of AP-1 dimers
formation is dependent upon the abundance and expression levels of family members, which are
cell type- and tissue-specific in their expression, resulting, along with differential binding to
variants in the consensus DNA binding sequence, in AP-1 specificity for individual target genes.
Each AP-1 dimer differs in its transcriptional function and DNA binding affinity. Moreover,
time-dependent changes in dimer composition are considered to dramatically impact the
expression of early and late genes in response to various signaling stimuli (Chinenov Y 2001).
AP-1 can act as a transcriptional activator or repressor, depending on dimer composition, gene
context, and interaction with distinct coactivators or corepressors (Shaulian E 2002).
Individual AP-1 family members, as revealed in various knockout mouse models, have
both redundant functions which can be compensated by other family members, and specific
functions unique to the family member which cannot be substituted by other family members
(Chinenov Y 2001). c-Jun, c-Fos and FosB usually exhibit potent transactivational functions,
while JunB, JunD, Fra1, and Fra2 are less active and even repress the activity of other AP-1
family members (Hess J 2004).
c-Jun
c-Jun is an intronless gene that is regulated by multiple mechanisms. The presence of
multiple transcription factor binding sites and regulatory regions have been identified within the
c-Jun promoter, and their distinct usage in controlling c-Jun expression is dependent on the
specific cell type and stimulus studied (Agarwal et al., 2008; Clarke et al., 1998; Rozek and
Pfeifer, 1993, 1995; Sharma et al., 2003; Wong et al., 1999). This complexity within the c-Jun
promoter implies that the existence of these elements ensures the effective response to a variety
of physiological conditions. For example, in Mink lung epithelial cells (Mv1Lu) and
33

immortalized human keratinocyte cells (HaCaT), Smad and AP-1 sites are critical for TGFβmediated c-Jun promoter activity (Wong et al., 1999), whereas in HeLa cells, ATF1 and MEF2D
and their binding sites are required for EFG and Rac/Cdc42-induced c-Jun expression (Clarke et
al., 1998). In addition to its regulation by other transcription factors, c-Jun is subject to positive
autoregulation by direct binding of c-Jun to an AP-1 site in its own promoter (Angel et al., 1988).
Thus upon rapid activation by stimuli, activated c-Jun, in turn, is responsible for sustaining its
long-term effects by inducing overexpression of itself.
c-Jun function is also changed by some post-translational modifications, and the interplay
of different medication will precisely regulate c-Jun activity function. Phosphorylation of c-Jun
has both stimulatory and inhibitory effect on c-Jun function. N-terminal phosphorylation at
Ser63/Ser73 and Thr91/Thr93 has positive effect on c-Jun transactivational potential (Minden et
al., 1994; Papavassiliou et al., 1995; Pulverer et al., 1991). Phosphorylation of these N’-terminal
sites either (1) transactivates c-Jun by facilitating the its interaction with coactivator CREB
binding protein (Bannister et al., 1995; Tsai et al., 2008), or (2) activates c-Jun in a de-repression
manner through dissociating c-Jun from histone deacetylase 3 (HDAC3) repressor complex
(Weiss et al., 2003), or methyl-CpG-binding domain protein 2/nucleosome remodeling
deacetylase (Mbd3/NuRD) repressor complex (Aguilera et al., 2011), or nuclear receptor
corepressor (NCoR) complex (Ogawa et al., 2004).

In contrast to the N-terminal

phosphorylation, the C-terminal phosphorylation (residues 227-252), mediated by GSK3 in vitro,
decreases c-Jun DNA-binding activity (Boyle et al., 1991). Under treatment with stimuli, such as
tumor promoter phorbol-ester (TPA), c-Jun is rapidly activated by phosphorylation of N’terminal residues, which consequently stimulates the dephosphorylation of the C’-terminal sites
(Boyle et al., 1991; Papavassiliou et al., 1995; Pulverer et al., 1991)

34

Acetylation of Lys271 at DNA-binding domain, mediated by p300, is required for the
repression of collagenase promoter by adenovirus early region 1A (E1A) (Vries et al., 2001).
Moreover, acetylation also leads to rapid degradation of Drosophila homolog of c-Jun, Jra, by
facilitating poly-ubiquitination. However, acetylation level is significant reduced in the presence
of phosphorylation signal or phosphorylation-mimic mutant Jra forms, suggesting

the

collaboration between dramatic activation by phosphorylation and proper degradation by
acetylation of Jra (Zhang et al., 2013).
Sumoylation of c-Jun at Lys257 and Lys229 down-regulates its dimer activity, and
subsequent transcriptional activity (Bossis et al., 2005; Muller et al., 2000). JNK-mediated
phosphorylation decreases, whereas loss of functional phosphorylation sites, Ser63 and Ser73,
increases SUMO-1 modification of Lys229 (Muller et al., 2000).
c-Jun can be subjected for multi-ubiquitination at the δ domain (amino acids 31-57), that
targets c-Jun for proteolytic degradation through the proteasome 26S pathway (Musti et al.,
1996; Treier et al., 1994). In non-stimulated cells, human de-etiolated-1 (hDET1) promotes c-Jun
ubiquitination by assembling a multisubunit ubiquitin ligase containing DNA damage binding
protein-1 (DDB1), cullin 4A (CUL4A), regulator of cullins-1 (ROC1), and constitutively
photomorphogenic-1 (Wertz et al., 2004) (Wertz 2004). In T cells, Itch, a homology to the E6associated protein C terminus (HECT) domain-containing E3 ligase, promotes c-Jun
ubiquitination under JNK activation. The process depends on Itch conformational change and its
subsequent ligase activity, rather than phosphorylation of c-Jun Ser63/Ser73 (Gao 2004). In
response to prolong osmotic stress, PHD/RING finger domain of MEKK1, an E3 ligase,
mediates c-Jun ubiquitination (Xia 2007).

Phosphorylation at Thr239/Ser243 mediated by

GSK3, but not Ser63/Ser73, leads to its interaction with FBW7 ubiquitin ligase complex and
35

subsequent destruction of c-Jun (Wei et al., 2005). Phosphorylation at Ser63/Ser73 or
Thr91/Thr93 prevents c-Jun from ubiquitination-mediated degradation (Fuchs et al., 1996; Musti
et al., 1997). However, contradict study in neuronal cells reported the requirement of JNKmediate Ser63/Ser73 phosphorylation for polyubiquitination by the E3 ligase FBW7-containing
Skp1/cullin/F-box protein complex (Nateri et al., 2004). It is possible that depending on the
cell/tissue types and their specific regulatory induction and existed E3 ligases, c-Jun
ubiquitination will be differentially regulated to ensure the precise c-Jun activity.
Even though all Jun family members share high homology in their amino acid sequences,
especially in their transactivation and DNA binding domains (Volt 1990), c-Jun has the highest
binding affinity of any family member to DNA containing an AP-1 site, and is thus regarded as
the most active transcription factor in the Jun family (Ryseck and Bravo, 1991). Indeed, c-Jun is
able to transactivate promoters carrying a single AP-1 site, while JunB only has activating
function on promoters with multiple binding sites (Deng and Karin, 1993). The heterodimer of cJun with Fos family members exhibits more stability (Halazonetis et al., 1988; Kouzarides and
Ziff, 1988) and higher activity (Ryseck and Bravo, 1991) than does the c-Jun homodimer.
Role of c-Jun in Normal Mammary Gland Development
AP-1 expression has been studied only in the context of involution in mammary gland
development. c-Fos, JunB, JunD show dramatically increased expression, and c-Jun slightly
increased expression at one day post-lactation (Marti et al., 1994). The composition of AP-1
dimers detected in the mouse mammary gland at this stage is largely c-Fos/JunD, and AP-1 DNA
binding activity is transiently increased. These changes are associated with programmed cell
death of epithelial cells. AP-1 DNA-binding activity dramatically increased in late pregnancy
through lactation, and then decreased after involution (Malewski et al., 2005).
36

Although not extensively studied at stages of mammary gland development other than
involution, AP-1 is critical for mammary epithelial proliferation and normal postnatal mammary
gland growth, as shown in mice carrying an inducible AP-1 inhibitor (Tam67), a dominant
negative truncated form of c-Jun lacking a transactivation domain (Shen et al., 2006). Blockade
of AP-1 activity results in reduced gland size, as well as reduced branching and endbud
formation in prepubertal and pubertal glands, and decreased branching and fewer terminal ends
in E+P-stimulated mammary glands. However, c-Jun KO mice showed similar mammary gland
ductal branching and terminal endbuds as did wildtype mice at 8 weeks and 2 days post
involution (Katiyar et al., 2010). Together, these findings suggest that either AP-1 family
members have redundant roles in mammary gland development, or that an AP-1 family
member(s) other than c-Jun is essential for normal development.
The expression of each AP-1 member has been studied in breast tumor and adjacent
normal tissues (Kharman-Biz et al., 2013). In tumors, Fra1, Fra2, JunB and JunD expression
levels are elevated in comparison to adjacent normal tissue, while c-Fos and c-Jun levels are
reduced. This is consistent with earlier findings that c-Fos and c-Jun expression levels and their
transcriptional function are higher in normal cells and immortal human mammary epithelial cells
than in breast cancer cells (Smith et al., 1997). FosB is also higher in normal lobules and ducts
compared to carcinomas. The reduced FosB expression in carcinomas correlates with a lack of
ER and PR expression (Milde-Langosch et al., 2003), while its increased expression in normal
mammary structures is associated with ER and PR expression. Fra1 expression is particularly
elevated in ER-, PR-, and triple-negative tumors (Kharman-Biz et al., 2013).
Consistent with an important role in mammary gland development, AP-1 also directly
regulates several essential genes for mammary gland development. AP-1 binds and regulates the
37

expression of cyclin D1 (Albanese et al., 1995, 1999; Shen et al., 2006; Watanabe et al., 1996)
and PRL (review in (Shen et al., 2006)). AP-1 putative binding sites have been identified in the
intergenic region near to Stat5a promoter (Crispi et al., 2004). AP-1 regulates PR expression
through the +90 AP-1 site (Petz et al., 2002) and +745 AP-1 site (Petz et al., 2004b) in an ERαdependent manner. Jun down-regulates PR transcription by binding to the +745 site in the
absence or presence of E2, indicating that Jun homodimer occupancy at this site would maintain
the low basal level of PR expression in untreated cells. In contrast, Jun up-regulates PR by
binding to the +90 site only in the presence of E2. It is possible that in the presence of E2, the
expression of PR will be determined by the presence of co-activators or co-repressors for
flanking sequences around stimulatory +90 site or inhibitory +475 site, respectively. From these
observations, they suggested a model of dynamic and flexible regulation of PR expression in the
response to environmental and cellular influences.
Molecular mechanisms of synergistic transactivation
Transcriptional regulation is the major mechanism controlling gene expression, which is
driven by multiple regulatory proteins, including RNA polymerase, many transcription factors,
and co-activators. However, there are differential requirements for individual transcription
factors and co-activators in specific cell types, tissues, and developmental stages. The
requirement for specific transcription factors ensures precise spatial, temporal, and expression
levels of gene under physiological conditions. Transcription factors can contribute to specific
gene expression in either an additive or synergistic manner. An additive effect is one in which
promoter activity in the presence of two factors is similar to the sum of their individual activities,
while a synergistic effect is one in which promoter activity in the presence of two factors is
greater than the sum their individual activities.
38

A requirement for synergism in transcriptional activation ensures that a gene will only be
activated to a high level of expression if the correct positive combination of factors are available,
and this in turn often requires two signaling pathways. Synergy over long distances between two
transcription factors is carried out through DNA looping to bring the factors in close proximity,
which requires their physical interaction. Effective DNA looping is exhibited with DNA
separation of at least 500 bp length or longer between two factors (Mossing and Record, 1986).
The synergy in short distances may be explained by the factors’ cooperative binding. Whether
occurring over short or long distances on the DNA, the ultimate proximity of the two factors may
provide a unique structure for recruitment of multiple co-activators (Carey and Smale, 2001). It
is clear that synergy between transcription factors requires that their binding sites be co-localized
on the genome at specific and non-random distances from each other. Cooperativity in binding
results in an increased DNA affinity of the second factor after the first factor binding. One
mechanism for this is DNA binding of the first factor stabilizing a DNA conformation that
confers accessibility to the second factor (Courey, 2009). For example, as reported for the
positive regulatory domain II (PRDII) in the context of the Interferon β (IFNβ) enhancer, binding
of a high mobility group protein (HMG), HMG I(Y), to the AT-rich sequence leads to DNA
unbending. This appropriate conformation enhances p50/p65 binding to NF-κB site on PRDII
(Falvo et al., 1995). The more common mechanism is the mutual dependence of bound
transcription factors for binding, in which one factor stabilizes the binding of the other and vice
versa (Courey, 2009). In this mechanism, the co-expression of two factors results in higher levels
of DNA occupancy than could be achieved by either factor alone and, consequently, synergistic
transactivation of target gene. In the absence of either transcription factor or mutation of either’s
DNA binding site, the promoter activity will be decreased significantly as a result of

39

destabilization of the activator complex. For example, on IL-6 promoter, the synergy of C/EBPβ
and NF-κB in stimulation of IL-6 promoter requires both C/EBP and NF-κB protein expression
and their intact sites. In the presence of expression vectors for both C/EBPβ and p65/p50, the IL6 promoter activity increases dramatically comparing to that when single factor is overexpressed.
In addition, mutations of either C/EBP or NF-κB sites effectively impair their synergistic effect
(Matsusaka et al., 1993). Synergy may also be determined by the more efficient recruitment of a
co-activator when both factors occupy the activated gene; the transcription factor complex may
provide a high affinity surface for co-activator binding (Courey, 2009). For example, recruitment
of CBP/p300 coactivator by efficient interaction with the novel activating surface assembled
from activation domains of p65, IRF1, and ATF2/c-Jun results in the synergistic transactivation
of IFNβ gene (Merika et al., 1998). Ultimately, this cooperative binding enhances the
recruitment of general transcription machinery.
In Chapter 3, we are explore the following possible mechanisms for synergy between
C/EBPβ and c-Jun: 1) Two factors bind independently to two separate sites on the DNA; 2) Two
factors bind to two separate sites on the DNA in a mutually dependent manner; 3) One factor
binds to DNA, while the other factor does not bind directly to the DNA, but rather physically
interacts with the first factor; 4) Two factors bind to multiple redundant sites on the DNA. In the
last instance, the redundancy may ensure promoter activity when transcription factor
concentrations are limited, and levels of gene expression may be dependent on the concentrations
of the respective factors. This latter scenario is not mutually exclusive to the other mechanisms.
Cooperative activity of C/EBP and AP-1
The phenotypes of C/EBPβ KO mice and Tam67-expressing (i.e., AP-1 inhibited) mice
are similar, suggesting that C/EBPβ and AP-1 may co-regulate the same genes. Indeed, C/EBP
40

and AP-1 have been found to functionally cooperate in the regulation of a number of genes,
dependent upon tissue and cell type. Specifically, interaction and cooperation between AP-1 and
C/EBP play role in regulation of many genes, including: melanoma differentiation associated
(mda7) (Madireddi et al., 2000), class A scavenger receptor (SR-A) (Mietus-Snyder et al., 1998),
c4.4a (Fries et al., 2007), TNF-stimulated gene 6 (TSG-6) (Klampfer et al., 1994), tumor necrosis
factor α (TNFα) (Zagariya et al., 1998), endothelin B receptor (ETB receptor) (He et al., 2013),
and cyclooxygenase-2 (cox-2) (Wang et al., 2006). Additionally, C/EBP and AP-1 can
heterodimerize to activate the PU.1 and FosB promoters through this hybrid protein binds to a
hybrid site which contains a half site of C/EBP and a half site of AP-1 (Cai et al., 2008; Hong et
al., 2011).
Moreover, in genome analysis of ER binding sites, AP-1 and C/EBP putative binding
sites have been identified among enriched motifs (including AP-1, Oct, and C/EBP motifs)
within the regions bound by ERα in MCF7 breast cancer cells (Carroll et al., 2006), suggesting
that the collaboration of AP-1 and C/EBP may play key roles in regulating of a number of genes
which are inducible by E/ERα, including PR gene.

41

REFERENCES

42

REFERENCES

Agarwal, S., Kumar, R., Gupta, P., and Dixit, A. (2008). Identification and characterization of a
positive regulatory cis-element within the upstream region of c-jun. Journal of Biochemistry 144,
741–752.
Aguilar, R., Grandy, R., Meza, D., Sepulveda, H., Pihan, P., van Wijnen, A.J., Lian, J.B., Stein,
G.S., Stein, J.L., and Montecino, M. (2014). A Functional N-terminal Domain in C/EBPβ-LAP*
is Required for Interacting with SWI/SNF and to Repress Ric-8B Gene Transcription in
Osteoblasts. Journal of Cellular Physiology.
Aguilera, C., Nakagawa, K., Sancho, R., Chakraborty, A., Hendrich, B., and Behrens, A. (2011).
c-Jun N-terminal phosphorylation antagonises recruitment of the Mbd3/NuRD repressor
complex. Nature 469, 231–235.
Albanese, C., Johnson, J., Watanabe, G., Eklund, N., Vu, D., Arnold, A., and Pestell, R.G.
(1995). Transforming p21ras mutants and c-Ets-2 activate the cyclin D1 promoter through
distinguishable regions. The Journal of Biological Chemistry 270, 23589–23597.
Albanese, C., D’Amico, M., Reutens, A.T., Fu, M., Watanabe, G., Lee, R.J., Kitsis, R.N.,
Henglein, B., Avantaggiati, M., Somasundaram, K., et al. (1999). Activation of the cyclin D1
Gene by the E1A-associated Protein p300 through AP-1 Inhibits Cellular Apoptosis. Journal of
Biological Chemistry 274, 34186–34195.
Albergaria, A., Resende, C., Nobre, A.R., Ribeiro, A.S., Sousa, B., Machado, J.C., Seruca, R.,
Paredes, J., and Schmitt, F. (2013). CCAAT/enhancer binding protein β (C/EBPβ) isoforms as
transcriptional regulators of the pro-invasive CDH3/P-cadherin gene in human breast cancer
cells. PloS One 8, e55749.
Alkhalaf, M., and Murphy, L.C. (1992). Regulation of c-jun and jun-B by progestins in T-47D
human breast cancer cells. Molecular Endocrinology (Baltimore, Md.) 6, 1625–1633.
Angel, P., Hattori, K., Smeal, T., and Karin, M. (1988). The jun proto-oncogene is positively
autoregulated by its product, Jun/AP-1. Cell 55, 875–885.
Aupperlee, M.D., Smith, K.T., Kariagina, A., and Haslam, S.Z. (2005). Progesterone receptor
isoforms A and B: temporal and spatial differences in expression during murine mammary gland
development. Endocrinology 146, 3577–3588.
Aupperlee, M.D., Drolet, A.A., Durairaj, S., Wang, W., Schwartz, R.C., and Haslam, S.Z.
(2009). Strain-specific differences in the mechanisms of progesterone regulation of murine
mammary gland development. Endocrinology 150, 1485–1494.
Baer, M., and Johnson, P.F. (2000). Generation of truncated C/EBPβ isoforms by in vitro
proteolysis. The Journal of Biological Chemistry 275, 26582–26590.
43

Bagowski, C.P., Myers, J.W., and Ferrell, J.E. (2001). The classical progesterone receptor
associates with p42 MAPK and is involved in phosphatidylinositol 3-kinase signaling in
Xenopus oocytes. The Journal of Biological Chemistry 276, 37708–37714.
Bain, D.L., Franden, M.A., McManaman, J.L., Takimoto, G.S., and Horwitz, K.B. (2001). The
N-terminal region of human progesterone B-receptors: biophysical and biochemical comparison
to A-receptors. The Journal of Biological Chemistry 276, 23825–23831.
Bain, D.L., Heneghan, A.F., Connaghan-Jones, K.D., and Miura, M.T. (2007). Nuclear receptor
structure: implications for function. Annual Review of Physiology 69, 201–220.
Bamberger, A.M., Bamberger, C.M., Gellersen, B., and Schulte, H.M. (1996). Modulation of
AP-1 activity by the human progesterone receptor in endometrial adenocarcinoma cells.
Proceedings of the National Academy of Sciences of the United States of America 93, 6169–
6174.
Bannister, A.J., Oehler, T., Wilhelm, D., Angel, P., and Kouzarides, T. (1995). Stimulation of cJun activity by CBP: c-Jun residues Ser63/73 are required for CBP induced stimulation in vivo
and CBP binding in vitro. Oncogene 11, 2509–2514.
Berberich-Siebelt, F., Berberich, I., Andrulis, M., Santner-Nanan, B., Jha, M.K., Klein-Hessling,
S., Schimpl, A., and Serfling, E. (2006). SUMOylation interferes with CCAAT/enhancer-binding
protein β-mediated c-myc repression, but not IL-4 activation in T cells. Journal of Immunology
(Baltimore, Md.: 1950) 176, 4843–4851.
Bergalet, J., Fawal, M., Lopez, C., Desjobert, C., Lamant, L., Delsol, G., Morello, D., and
Espinos, E. (2011). HuR-mediated control of C/EBPβ mRNA stability and translation in ALKpositive anaplastic large cell lymphomas. Molecular Cancer Research: MCR 9, 485–496.
Berrier, A., Siu, G., and Calame, K. (1998). Transcription of a minimal promoter from the NFIL6 gene is regulated by CREB/ATF and SP1 proteins in U937 promonocytic cells. Journal of
Immunology (Baltimore, Md.: 1950) 161, 2267–2275.
Birsoy, K., Chen, Z., and Friedman, J. (2008). Transcriptional regulation of adipogenesis by
KLF4. Cell Metabolism 7, 339–347.
Bonéy-Montoya, J., Ziegler, Y.S., Curtis, C.D., Montoya, J. a, and Nardulli, A.M. (2010). Longrange transcriptional control of progesterone receptor gene expression. Molecular Endocrinology
(Baltimore, Md.) 24, 346–358.
Boonyaratanakornkit, V., Scott, M.P., Ribon, V., Sherman, L., Anderson, S.M., Maller, J.L.,
Miller, W.T., and Edwards, D.P. (2001). Progesterone receptor contains a proline-rich motif that
directly interacts with SH3 domains and activates c-Src family tyrosine kinases. Molecular Cell
8, 269–280.

44

Bossis, G., Malnou, C.E., Farras, R., Andermarcher, E., Hipskind, R., Rodriguez, M., Schmidt,
D., Muller, S., Jariel-Encontre, I., and Piechaczyk, M. (2005). Down-regulation of c-Fos/c-Jun
AP-1 dimer activity by sumoylation. Molecular and Cellular Biology 25, 6964–6979.
Boyle, W.J., Smeal, T., Defize, L.H., Angel, P., Woodgett, J.R., Karin, M., and Hunter, T.
(1991). Activation of protein kinase C decreases phosphorylation of c-Jun at sites that negatively
regulate its DNA-binding activity. Cell 64, 573–584.
Brisken, C., Kaur, S., Chavarria, T.E., Binart, N., Sutherland, R.L., Weinberg, R.A., Kelly, P.A.,
and Ormandy, C.J. (1999). Prolactin controls mammary gland development via direct and
indirect mechanisms. Developmental Biology 210, 96–106.
Bundy, L.M., and Sealy, L. (2003). CCAAT/enhancer binding protein β (C/EBPβ)-2 transforms
normal mammary epithelial cells and induces epithelial to mesenchymal transition in culture.
Oncogene 22, 869–883.
Cai, D.H., Wang, D., Keefer, J., Yeamans, C., Hensley, K., and Friedman, A.D. (2008). C/EBP
α:AP-1 leucine zipper heterodimers bind novel DNA elements, activate the PU.1 promoter and
direct monocyte lineage commitment more potently than C/EBP α homodimers or AP-1.
Oncogene 27, 2772–2779.
Calkhoven, C.F., Müller, C., and Leutz, A. (2000). Translational control of C/EBPα and C/EBPβ
isoform expression. Genes & Development 14, 1920–1932.
Carey, M., and Smale, S.T. (2001). Transcriptional Regulation in Eukaryotes: Concepts,
Strategies, and Techniques (CSHL Press).
Carroll, J.S., Meyer, C. a, Song, J., Li, W., Geistlinger, T.R., Eeckhoute, J., Brodsky, A.S.,
Keeton, E.K., Fertuck, K.C., Hall, G.F., et al. (2006). Genome-wide analysis of estrogen receptor
binding sites. Nature Genetics 38, 1289–1297.
Catelli, M.G., Binart, N., Jung-Testas, I., Renoir, J.M., Baulieu, E.E., Feramisco, J.R., and
Welch, W.J. (1985). The common 90-kd protein component of non-transformed “8S” steroid
receptors is a heat-shock protein. The EMBO Journal 4, 3131–3135.
Ceseña, T.I., Cardinaux, J.-R., Kwok, R., and Schwartz, J. (2007). CCAAT/enhancer-binding
protein (C/EBP) β is acetylated at multiple lysines: acetylation of C/EBPβ at lysine 39 modulates
its ability to activate transcription. The Journal of Biological Chemistry 282, 956–967.
Chai, S.Y., Smith, R., Fitter, J.T., Mitchell, C., Pan, X., Ilicic, M., Maiti, K., Zakar, T., and
Madsen, G. (2014). Increased progesterone receptor A expression in labouring human
myometrium is associated with decreased promoter occupancy by the histone demethylase
JARID1A. Molecular Human Reproduction 20, 442–453.

45

Chou, Y.-C., Uehara, N., Lowry, J.R., and Shyamala, G. (2003). Mammary epithelial cells of
PR-A transgenic mice exhibit distinct alterations in gene expression and growth potential
associated with transformation. Carcinogenesis 24, 403–409.
Christian, M., Pohnke, Y., Kempf, R., Gellersen, B., and Brosens, J.J. (2002). Functional
association of PR and CCAAT/enhancer-binding protein β isoforms: promoter-dependent
cooperation between PR-B and liver-enriched inhibitory protein, or liver-enriched activatory
protein and PR-A in human endometrial stromal cells. Molecular Endocrinology (Baltimore,
Md.) 16, 141–154.
Clarke, N., Arenzana, N., Hai, T., Minden, A., and Prywes, R. (1998). Epidermal growth factor
induction of the c-jun promoter by a Rac pathway. Molecular and Cellular Biology 18, 1065–
1073.
Clemens, J.W., Robker, R.L., Kraus, W.L., Katzenellenbogen, B.S., and Richards, J.S. (1998).
Hormone induction of progesterone receptor (PR) messenger ribonucleic acid and activation of
PR promoter regions in ovarian granulosa cells: evidence for a role of cyclic adenosine 3’,5'monophosphate but not estradiol. Molecular Endocrinology (Baltimore, Md.) 12, 1201–1214.
Cork, D.M.W., Lennard, T.W.J., and Tyson-Capper, A.J. (2008). Alternative splicing and the
progesterone receptor in breast cancer. Breast Cancer Research : BCR 10, 207.
Courey, A.J. (2009). Mechanisms in Transcriptional Regulation. Wiley-Blackwell 167–193.
Crispi, S., Sanzari, E., Monfregola, J., De Felice, N., Fimiani, G., Ambrosio, R., D’Urso, M., and
Ursini, M.V. (2004). Characterization of the human STAT5A and STAT5B promoters: evidence
of a positive and negative mechanism of transcriptional regulation. FEBS Letters 562, 27–34.
Cui, X., Zhang, P., Deng, W., Oesterreich, S., Lu, Y., Mills, G.B., and Lee, A. V (2003a).
Insulin-like growth factor-I inhibits progesterone receptor expression in breast cancer cells via
the phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin pathway: progesterone
receptor as a potential indicator of growth factor activity in brea. Molecular Endocrinology
(Baltimore, Md.) 17, 575–588.
Cui, X., Lazard, Z., Zhang, P., Hopp, T.A., and Lee, A. V (2003b). Progesterone crosstalks with
insulin-like growth factor signaling in breast cancer cells via induction of insulin receptor
substrate-2. Oncogene 22, 6937–6941.
Deng, T., and Karin, M. (1993). JunB differs from c-Jun in its DNA-binding and dimerization
domains, and represses c-Jun by formation of inactive heterodimers. Genes & Development 7,
479–490.
Di-Poï, N., Desvergne, B., Michalik, L., and Wahli, W. (2005). Transcriptional repression of
peroxisome proliferator-activated receptor β/δ in murine keratinocytes by CCAAT/enhancerbinding proteins. The Journal of Biological Chemistry 280, 38700–38710.

46

Doppler, W., Welte, T., and Philipp, S. (1995). CCAAT/enhancer-binding protein isoforms β and
δ are expressed in mammary epithelial cells and bind to multiple sites in the β-casein gene
promoter. The Journal of Biological Chemistry 270, 17962–17969.
Eaton, E.M., and Sealy, L. (2003). Modification of CCAAT/enhancer-binding protein-β by the
small ubiquitin-like modifier (SUMO) family members, SUMO-2 and SUMO-3. The Journal of
Biological Chemistry 278, 33416–33421.
Eaton, E.M., Hanlon, M., Bundy, L., and Sealy, L. (2001). Characterization of C/EBPβ isoforms
in normal versus neoplastic mammary epithelial cells. Journal of Cellular Physiology 189, 91–
105.
Falvo, J. V., Thanos, D., and Maniatis, T. (1995). Reversal of intrinsic DNA bends in the IFNβ
gene enhancer by transcription factors and the architectural protein HMG I(Y). Cell 83, 1101–
1111.
Fantl, V., Stamp, G., Andrews, A., Rosewell, I., and Dickson, C. (1995). Mice lacking cyclin D1
are small and show defects in eye and mammary gland development. Genes & Development 9,
2364–2372.
Fata, J.E., Kong, Y.-Y., Li, J., Sasaki, T., Irie-Sasaki, J., Moorehead, R.A., Elliott, R., Scully, S.,
Voura, E.B., Lacey, D.L., et al. (2000). The Osteoclast Differentiation Factor OsteoprotegerinLigand Is Essential for Mammary Gland Development. Cell 103, 41–50.
Ferguson, A.T., Lapidus, R.G., and Davidson, N.E. (1998). Demethylation of the progesterone
receptor CpG island is not required for progesterone receptor gene expression. Oncogene 17,
577–583.
Fries, F., Nazarenko, I., Hess, J., Claas, A., Angel, P., and Zöller, M. (2007). CEBPβ, JunD and
c-Jun contribute to the transcriptional activation of the metastasis-associated C4.4A gene.
International Journal of Cancer. Journal International Du Cancer 120, 2135–2147.
Fuchs, S.Y., Dolan, L., Davis, R.J., and Ronai, Z. (1996). Phosphorylation-dependent targeting
of c-Jun ubiquitination by Jun N-kinase. Oncogene 13, 1531–1535.
Gao, X., and Nawaz, Z. (2002). Progesterone receptors - animal models and cell signaling in
breast cancer: Role of steroid receptor coactivators and corepressors of progesterone receptors in
breast cancer. Breast Cancer Research 4, 182–186.
Gao, J., Mazella, J., Seppala, M., and Tseng, L. (2001). Ligand activated hPR modulates the
glycodelin promoter activity through the Sp1 sites in human endometrial adenocarcinoma cells.
Molecular and Cellular Endocrinology 176, 97–102.
Gaudet, M.M., Campan, M., Figueroa, J.D., Yang, X.R., Lissowska, J., Peplonska, B., Brinton,
L.A., Rimm, D.L., Laird, P.W., Garcia-Closas, M., et al. (2009). DNA hypermethylation of
ESR1 and PGR in breast cancer: pathologic and epidemiologic associations. Cancer
47

Epidemiology, Biomarkers & Prevention : A Publication of the American Association for
Cancer Research, Cosponsored by the American Society of Preventive Oncology 18, 3036–3043.
Giangrande, P.H., Kimbrel, E.A., Edwards, D.P., and McDonnell, D.P. (2000). The opposing
transcriptional activities of the two isoforms of the human progesterone receptor are due to
differential cofactor binding. Molecular and Cellular Biology 20, 3102–3115.
Gigliotti, A.P., and DeWille, J.W. (1998). Lactation status influences expression of
CCAAT/enhancer binding protein isoform mRNA in the mouse mammary gland. Journal of
Cellular Physiology 174, 232–239.
Gigliotti, A.P., Johnson, P.F., Sterneck, E., and DeWille, J.W. (2003). Nulliparous
CCAAT/enhancer binding protein δ (C/EBPδ) knockout mice exhibit mammary gland ductal
hyperlasia. Experimental Biology and Medicine (Maywood, N.J.) 228, 278–285.
Goldhar, A.S., Duan, R., Ginsburg, E., and Vonderhaar, B.K. (2011). Progesterone induces
expression of the prolactin receptor gene through cooperative action of Sp1 and C/EBP.
Molecular and Cellular Endocrinology 335, 148–157.
Graham, J.D., and Clarke, C.L. (1997). Physiological action of progesterone in target tissues.
Endocrine Reviews 18, 502–519.
Graham, J.D., Roman, S.D., McGowan, E., Sutherland, R.L., and Clarke, C.L. (1995).
Preferential stimulation of human progesterone receptor B expression by estrogen in T-47D
human breast cancer cells. The Journal of Biological Chemistry 270, 30693–30700.
Graham, J.D., Yager, M.L., Hill, H.D., Byth, K., O’Neill, G.M., and Clarke, C.L. (2005). Altered
progesterone receptor isoform expression remodels progestin responsiveness of breast cancer
cells. Molecular Endocrinology (Baltimore, Md.) 19, 2713–2735.
Graham, J.D., Mote, P.A., Salagame, U., van Dijk, J.H., Balleine, R.L., Huschtscha, L.I., Reddel,
R.R., and Clarke, C.L. (2009). DNA replication licensing and progenitor numbers are increased
by progesterone in normal human breast. Endocrinology 150, 3318–3326.
Grandy, R., Sepulveda, H., Aguilar, R., Pihan, P., Henriquez, B., Olate, J., and Montecino, M.
(2011). The Ric-8B gene is highly expressed in proliferating preosteoblastic cells and
downregulated during osteoblast differentiation in a SWI/SNF- and C/EBPβ-mediated manner.
Molecular and Cellular Biology 31, 2997–3008.
Grimm, S.L., Contreras, A., Barcellos-Hoff, M.-H., and Rosen, J.M. (2005). Cell cycle defects
contribute to a block in hormone-induced mammary gland proliferation in CCAAT/enhancerbinding protein (C/EBPβ)-null mice. The Journal of Biological Chemistry 280, 36301–36309.
Groshong, S.D., Owen, G.I., Grimison, B., Schauer, I.E., Todd, M.C., Langan, T.A., Sclafani,
R.A., Lange, C.A., and Horwitz, K.B. (1997). Biphasic regulation of breast cancer cell growth by

48

progesterone: role of the cyclin-dependent kinase inhibitors, p21 and p27(Kip1). Molecular
Endocrinology (Baltimore, Md.) 11, 1593–1607.
Halazonetis, T.D., Georgopoulos, K., Greenberg, M.E., and Leder, P. (1988). c-Jun dimerizes
with itself and with c-Fos, forming complexes of different DNA binding affinities. Cell 55, 917–
924.
Hata, K., Nishimura, R., Ueda, M., Ikeda, F., Matsubara, T., Ichida, F., Hisada, K., Nokubi, T.,
Yamaguchi, A., and Yoneda, T. (2005). A CCAAT/enhancer binding protein β isoform, liverenriched inhibitory protein, regulates commitment of osteoblasts and adipocytes. Molecular and
Cellular Biology 25, 1971–1979.
He, S., Minton, A.Z., Ma, H.-Y., Stankowska, D.L., Sun, X., and Krishnamoorthy, R.R. (2013).
Involvement of AP-1 and C/EBPβ in upregulation of endothelin B (ETB) receptor expression in
a rodent model of glaucoma. PloS One 8, e79183.
Hill, K.K., Roemer, S.C., Churchill, M.E.A., and Edwards, D.P. (2012). Structural and functional
analysis of domains of the progesterone receptor. Molecular and Cellular Endocrinology 348,
418–429.
Hong, S., Skaist, A.M., Wheelan, S.J., and Friedman, A.D. (2011). AP-1 protein induction
during monopoiesis favors C/EBP: AP-1 heterodimers over C/EBP homodimerization and
stimulates FosB transcription. Journal of Leukocyte Biology 90, 643–651.
Hopp, T.A. (2004). Breast Cancer Patients with Progesterone Receptor PR-A-Rich Tumors Have
Poorer Disease-Free Survival Rates. Clinical Cancer Research 10, 2751–2760.
Hou, Y., Xue, P., Bai, Y., Liu, D., Woods, C.G., Yarborough, K., Fu, J., Zhang, Q., Sun, G.,
Collins, S., et al. (2012). Nuclear factor erythroid-derived factor 2-related factor 2 regulates
transcription of CCAAT/enhancer-binding protein β during adipogenesis. Free Radical Biology
& Medicine 52, 462–472.
Hovland, A.R., Powell, R.L., Takimoto, G.S., Tung, L., and Horwitz, K.B. (1998). An Nterminal inhibitory function, IF, suppresses transcription by the A-isoform but not the B-isoform
of human progesterone receptors. The Journal of Biological Chemistry 273, 5455–5460.
Hu, H.M., Tian, Q., Baer, M., Spooner, C.J., Williams, S.C., Johnson, P.F., and Schwartz, R.C.
(2000). The C/EBP bZIP domain can mediate lipopolysaccharide induction of the
proinflammatory cytokines interleukin-6 and monocyte chemoattractant protein-1. The Journal
of Biological Chemistry 275, 16373–16381.
Hu, Z.-Z.Z., Zhuang, L., Meng, J., and Dufau, M.L. (1998). Transcriptional regulation of the
generic promoter III of the rat prolactin receptor gene by C/EBPβ and Sp1. Journal of Biological
Chemistry 273, 26225–26235.

49

Huggins, G.S., Wong, J.Y.Y., Hankinson, S.E., and De Vivo, I. (2006). GATA5 activation of the
progesterone receptor gene promoter in breast cancer cells is influenced by the +331G/A
polymorphism. Cancer Research 66, 1384–1390.
Ishiguro, K., and Xavier, R. (2004). Homer-3 regulates activation of serum response element in
T cells via its EVH1 domain. Blood 103, 2248–2256.
Jacobsen, B.M., Schittone, S.A., Richer, J.K., and Horwitz, K.B. (2005). Progesteroneindependent effects of human progesterone receptors (PRs) in estrogen receptor-positive breast
cancer: PR isoform-specific gene regulation and tumor biology. Molecular Endocrinology
(Baltimore, Md.) 19, 574–587.
Jichan Nie, Xishi Liu, and Guo, S.-W. (2010). Promoter hypermethylation of progesterone
receptor isoform B (PR-B) in adenomyosis and its rectification by a histone deacetylase inhibitor
and a demethylation agent. Reproductive Sciences (Thousand Oaks, Calif.) 17, 995–1005.
Jundt, F., Raetzel, N., Müller, C., Calkhoven, C.F., Kley, K., Mathas, S., Lietz, A., Leutz, A.,
and Dörken, B. (2005). A rapamycin derivative (everolimus) controls proliferation through
down-regulation of truncated CCAAT enhancer binding protein {β} and NF-{kappa}B activity
in Hodgkin and anaplastic large cell lymphomas. Blood 106, 1801–1807.
Kalkhoven, E., Wissink, S., van der Saag, P.T., and van der Burg, B. (1996). Negative
interaction between the RelA(p65) subunit of NF-kappaB and the progesterone receptor. The
Journal of Biological Chemistry 271, 6217–6224.
Kamei, Y. (1996). A CBP Integrator Complex Mediates Transcriptional Activation and AP-1
Inhibition by Nuclear Receptors. Cell 85, 403–414.
Karaya, K., Mori, S., Kimoto, H., Shima, Y., Tsuji, Y., Kurooka, H., Akira, S., and Yokota, Y.
(2005). Regulation of Id2 expression by CCAAT/enhancer binding protein β. Nucleic Acids
Research 33, 1924–1934.
Kariagina, A., Aupperlee, M.D., and Haslam, S.Z. (2008). Progesterone receptor isoform
functions in normal breast development and breast cancer. Crit Rev Eukaryot Gene Expr. 18, 11–
33.
Kastner, P., Krust, A., Turcotte, B., Stropp, U., Tora, L., Gronemeyer, H., and Chambon, P.
(1990). Two distinct estrogen-regulated promoters generate transcripts encoding the two
functionally different human progesterone receptor forms A and B. The EMBO Journal 9, 1603–
1614.
Katiyar, S., Casimiro, M.C., Dettin, L., Ju, X., Wagner, E.F., Tanaka, H., and Pestell, R.G.
(2010). C-jun inhibits mammary apoptosis in vivo. Molecular Biology of the Cell 21, 4264–
4274.

50

Kharman-Biz, A., Gao, H., Ghiasvand, R., Zhao, C., Zendehdel, K., and Dahlman-Wright, K.
(2013). Expression of activator protein-1 (AP-1) family members in breast cancer. BMC Cancer
13, 441.
Klampfer, L., Lee, T.H.A.E.H.O., Hsu, W.E.I., Vilcek, J.A.N., and Chen-Kiang, S. (1994). NFIL6 and AP-1 cooperatively modulate the activation of the TSG-6 gene by tumor necrosis factor
α and interleukin-1. Molecular and Cellular Biology 14, 6561–6569.
Korach, K.S. (2000). Estrogen receptor knock-out mice: molecular and endocrine phenotypes.
Journal of the Society for Gynecologic Investigation 7, S16–7.
Kouzarides, T., and Ziff, E. (1988). The role of the leucine zipper in the fos-jun interaction.
Nature 336, 646–651.
Kowenz-Leutz, E., and Leutz, A. (1999). A C/EBP β isoform recruits the SWI/SNF complex to
activate myeloid genes. Molecular Cell 4, 735–743.
Kowenz-Leutz, E., Twamley, G., Ansieau, S., and Leutz, A. (1994). Novel mechanism of C/EBP
β (NF-M) transcriptional control: activation through derepression. Genes & Development 8,
2781–2791.
Kowenz-Leutz, E., Pless, O., Dittmar, G., Knoblich, M., and Leutz, A. (2010). Crosstalk between
C/EBPβ phosphorylation, arginine methylation, and SWI/SNF/Mediator implies an indexing
transcription factor code. The EMBO Journal 29, 1105–1115.
Kraus, W.L., and Katzenellenbogen, B.S. (1993). Regulation of progesterone receptor gene
expression and growth in the rat uterus: modulation of estrogen actions by progesterone and sex
steroid hormone antagonists. Endocrinology 132, 2371–2379.
Kraus, W.L., Montano, M.M., and Katzenellenbogen, B.S. (1993). Cloning of the rat
progesterone receptor gene 5’-region and identification of two functionally distinct promoters.
Molecular Endocrinology (Baltimore, Md.) 7, 1603–1616.
Kraus, W.L., Montano, M.M., and Katzenellenbogen, B.S. (1994). Identification of multiple,
widely spaced estrogen-responsive regions in the rat progesterone receptor gene. Molecular
Endocrinology (Baltimore, Md.) 8, 952–969.
Lamb, J., Ramaswamy, S., Ford, H.L., Contreras, B., Martinez, R. V, Kittrell, F.S., Zahnow,
C.A., Patterson, N., Golub, T.R., and Ewen, M.E. (2003). A mechanism of cyclin D1 action
encoded in the patterns of gene expression in human cancer. Cell 114, 323–334.
Lapidus, R.G., Ferguson, A.T., Ottaviano, Y.L., Parl, F.F., Smith, H.S., Weitzman, S.A., Baylin,
S.B., Issa, J.P., and Davidson, N.E. (1996). Methylation of estrogen and progesterone receptor
gene 5’ CpG islands correlates with lack of estrogen and progesterone receptor gene expression
in breast tumors. Clinical Cancer Research: An Official Journal of the American Association for
Cancer Research 2, 805–810.
51

Lee, Y.M., Miau, L.H., Chang, C.J., and Lee, S.C. (1996). Transcriptional induction of the α-1
acid glycoprotein (AGP) gene by synergistic interaction of two alternative activator forms of
AGP/enhancer-binding protein (C/EBP β) and NF-kappaB or Nopp140. Molecular and Cellular
Biology 16, 4257–4263.
Li, Y., Bevilacqua, E., Chiribau, C.-B., Majumder, M., Wang, C., Croniger, C.M., Snider, M.D.,
Johnson, P.F., and Hatzoglou, M. (2008). Differential control of the CCAAT/enhancer-binding
protein β (C/EBPβ) products liver-enriched transcriptional activating protein (LAP) and liverenriched transcriptional inhibitory protein (LIP) and the regulation of gene expression during the
respo. The Journal of Biological Chemistry 283, 22443–22456.
Lim, C.S., Baumann, C.T., Htun, H., Xian, W., Irie, M., Smith, C.L., and Hager, G.L. (1999).
Differential localization and activity of the A- and B-forms of the human progesterone receptor
using green fluorescent protein chimeras. Molecular Endocrinology (Baltimore, Md.) 13, 366–
375.
Lin, W.-C., Shen, B.-J., Tsay, Y.-G., Yen, H.-C., Lee, S.-C., and Chang, C.-J. (2002).
Transcriptional activation of C/EBPβ gene by c-Jun and ATF2. DNA and Cell Biology 21, 551–
560.
Liu, X., Robinson, G.W., Wagner, K.U., Garrett, L., Wynshaw-Boris, A., and Hennighausen, L.
(1997). Stat5a is mandatory for adult mammary gland development and lactogenesis. Genes &
Development 11, 179–186.
Lydon, J.P., DeMayo, F.J., Funk, C.R., Mani, S.K., Hughes, A.R., Montgomery, C.A.,
Shyamala, G., Conneely, O.M., and O’Malley, B.W. (1995). Mice lacking progesterone receptor
exhibit pleiotropic reproductive abnormalities. Genes & Development 9, 2266–2278.
Lydon, J.P., Ge, G., Kittrell, F.S., Medina, D., and O’Malley, B.W. (1999). Murine mammary
gland carcinogenesis is critically dependent on progesterone receptor function. Cancer Research
59, 4276–4284.
Madireddi, M.T., Dent, P., and Fisher, P.B. (2000). AP-1 and C/EBP transcription factors
contribute to mda-7 gene promoter activity during human melanoma differentiation. Journal of
Cellular Physiology 185, 36–46.
Malewski, T., Gajewska, M., and Zwierzchowski, L. (2005). Physiological state-dependent
changes in transcription factor DNA-binding activities of the rabbit mammary gland. Animal
Science Papers and Reports 23, 85–94.
Marti, A., Jehn, B., Costello, E., Keon, N., Ke, G., Martin, F., and Jaggi, R. (1994). Protein
kinase A and AP-1 (c-Fos/JunD) are induced during apoptosis of mouse mammary epithelial
cells. Oncogene 9, 1213–1223.
Matsusaka, T., Fujikawa, K., Nishio, Y., Mukaida, N., Matsushima, K., Kishimoto, T., and
Akira, S. (1993). Transcription factors NF-IL6 and NF-kappa B synergistically activate
52

transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proceedings of the
National Academy of Sciences of the United States of America 90, 10193–10197.
Mc Cormack, O., Chung, W.Y., Fitzpatrick, P., Cooke, F., Flynn, B., Harrison, M., Fox, E.,
Gallagher, E., McGoldrick, A., Dervan, P.A., et al. (2008). Progesterone receptor B (PRB)
promoter hypermethylation in sporadic breast cancer: progesterone receptor B hypermethylation
in breast cancer. Breast Cancer Research and Treatment 111, 45–53.
McGowan, E.M., and Clarke, C.L. (1999). Effect of overexpression of progesterone receptor A
on endogenous progestin-sensitive endpoints in breast cancer cells. Molecular Endocrinology
(Baltimore, Md.) 13, 1657–1671.
McKenna, N.J., Lanz, R.B., and O’Malley, B.W. (1999). Nuclear receptor coregulators: cellular
and molecular biology. Endocrine Reviews 20, 321–344.
Meng, Q., and Xia, Y. (2011). c-Jun, at the crossroad of the signaling network. Protein & Cell 2,
889–898.
Merika, M., Williams, A.J., Chen, G., Collins, T., and Thanos, D. (1998). Recruitment of
CBP/p300 by the IFNβ Enhanceosome Is Required for Synergistic Activation of Transcription.
Molecular Cell 1, 277–287.
Mietus-Snyder, M., Glass, C.K., and Pitas, R.E. (1998). Transcriptional activation of scavenger
receptor expression in human smooth muscle cells requires AP-1/c-Jun and C/EBPβ: both AP-1
binding and JNK activation are induced by phorbol esters and oxidative stress. Arteriosclerosis,
Thrombosis, and Vascular Biology 18, 1440–1449.
Migliaccio, A., Piccolo, D., Castoria, G., Di Domenico, M., Bilancio, A., Lombardi, M., Gong,
W., Beato, M., and Auricchio, F. (1998). Activation of the Src/p21ras/Erk pathway by
progesterone receptor via cross-talk with estrogen receptor. The EMBO Journal 17, 2008–2018.
Milde-Langosch, K., Kappes, H., Riethdorf, S., Löning, T., and Bamberger, A.-M. (2003). FosB
is highly expressed in normal mammary epithelia, but down-regulated in poorly differentiated
breast carcinomas. Breast Cancer Research and Treatment 77, 265–275.
Minden, A., Lin, A., Smeal, T., Dérijard, B., Cobb, M., Davis, R., and Karin, M. (1994). c-Jun
N-terminal phosphorylation correlates with activation of the JNK subgroup but not the ERK
subgroup of mitogen-activated protein kinases. Molecular and Cellular Biology 14, 6683–6688.
Mori, S., Nishikawa, S.I., and Yokota, Y. (2000). Lactation defect in mice lacking the helixloop-helix inhibitor Id2. The EMBO Journal 19, 5772–5781.
Mossing, M.C., and Record, M.T. (1986). Upstream operators enhance repression of the lac
promoter. Science (New York, N.Y.) 233, 889–892.

53

Mote, P.A., Bartow, S., Tran, N., and Clarke, C.L. (2002). Loss of co-ordinate expression of
progesterone receptors A and B is an early event in breast carcinogenesis. Breast Cancer
Research and Treatment 72, 163–172.
Mote, P.A., Graham, J.D., and Clarke, C.L. (2007). Progesterone receptor isoforms in normal
and malignant breast. Ernst Schering Foundation Symposium Proceedings 1, 77–107.
Mulac-Jericevic, B., Mullinax, R.A., DeMayo, F.J., Lydon, J.P., and Conneely, O.M. (2000).
Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B
isoform. Science (New York, N.Y.) 289, 1751–1754.
Mulac-Jericevic, B., Lydon, J.P., DeMayo, F.J., and Conneely, O.M. (2003). Defective
mammary gland morphogenesis in mice lacking the progesterone receptor B isoform.
Proceedings of the National Academy of Sciences of the United States of America 100, 9744–
9749.
Muller, S., Berger, M., Lehembre, F., Seeler, J.S., Haupt, Y., and Dejean, A. (2000). c-Jun and
p53 activity is modulated by SUMO-1 modification. The Journal of Biological Chemistry 275,
13321–13329.
Musti, A.M., Treier, M., Peverali, F.A., and Bohmann, D. (1996). Differential regulation of cJun and JunD by ubiquitin-dependent protein degradation. Biological Chemistry 377, 619–624.
Musti, A.M., Treier, M., and Bohmann, D. (1997). Reduced ubiquitin-dependent degradation of
c-Jun after phosphorylation by MAP kinases. Science (New York, N.Y.) 275, 400–402.
Nateri, A.S., Riera-Sans, L., Da Costa, C., and Behrens, A. (2004). The ubiquitin ligase
SCFFbw7 antagonizes apoptotic JNK signaling. Science (New York, N.Y.) 303, 1374–1378.
Niehof, M., Manns, M.P., and Trautwein, C. (1997). CREB controls LAP/C/EBP β transcription.
Molecular and Cellular Biology 17, 3600–3613.
Niehof, M., Streetz, K., Rakemann, T., Bischoff, S.C., Manns, M.P., Horn, F., and Trautwein, C.
(2001a). Interleukin-6-induced tethering of STAT3 to the LAP/C/EBPβ promoter suggests a new
mechanism of transcriptional regulation by STAT3. The Journal of Biological Chemistry 276,
9016–9027.
Niehof, M., Kubicka, S., Zender, L., Manns, M.P., and Trautwein, C. (2001b). Autoregulation
enables different pathways to control CCAAT/enhancer binding protein β (C/EBP β)
transcription. Journal of Molecular Biology 309, 855–868.
O’Rourke, J.P., Newbound, G.C., Hutt, J.A., and DeWille, J. (1999). CCAAT/Enhancer-binding
Protein Regulates Mammary Epithelial Cell G0 Growth Arrest and Apoptosis. Journal of
Biological Chemistry 274, 16582–16589.

54

Obr, A.E., and Edwards, D.P. (2012). The biology of progesterone receptor in the normal
mammary gland and in breast cancer. Molecular and Cellular Endocrinology 357, 4–17.
Ogawa, S., Lozach, J., Jepsen, K., Sawka-Verhelle, D., Perissi, V., Sasik, R., Rose, D.W.,
Johnson, R.S., Rosenfeld, M.G., and Glass, C.K. (2004). A nuclear receptor corepressor
transcriptional checkpoint controlling activator protein 1-dependent gene networks required for
macrophage activation. Proceedings of the National Academy of Sciences of the United States of
America 101, 14461–14466.
Ormandy, C.J., Camus, A., Barra, J., Damotte, D., Lucas, B., Buteau, H., Edery, M., Brousse, N.,
Babinet, C., Binart, N., et al. (1997). Null mutation of the prolactin receptor gene produces
multiple reproductive defects in the mouse. Genes & Development 11, 167–178.
Owen, G.I., Richer, J.K., Tung, L., Takimoto, G., and Horwitz, K.B. (1998). Progesterone
regulates transcription of the p21(WAF1) cyclin- dependent kinase inhibitor gene through Sp1
and CBP/p300. The Journal of Biological Chemistry 273, 10696–10701.
Papavassiliou, A.G., Treier, M., and Bohmann, D. (1995). Intramolecular signal transduction in
c-Jun. The EMBO Journal 14, 2014–2019.
Park, B.-H., Kook, S., Lee, S., Jeong, J.-H., Brufsky, A., and Lee, B.-C. (2013). An isoform of
C/EBPβ, LIP, regulates expression of the chemokine receptor CXCR4 and modulates breast
cancer cell migration. The Journal of Biological Chemistry 288, 28656–28667.
Petz, L.N., and Nardulli, A.M. (2000). Sp1 binding sites and an estrogen response element halfsite are involved in regulation of the human progesterone receptor A promoter. Molecular
Endocrinology (Baltimore, Md.) 14, 972–985.
Petz, L.N., Ziegler, Y.S., Loven, M. a, and Nardulli, A.M. (2002). Estrogen receptor α and
activating protein-1 mediate estrogen responsiveness of the progesterone receptor gene in MCF7 breast cancer cells. Endocrinology 143, 4583–4591.
Petz, L.N., Ziegler, Y.S., Schultz, J.R., Kim, H., Kemper, J.K., and Nardulli, A.M. (2004a).
Differential regulation of the human progesterone receptor gene through an estrogen response
element half site and Sp1 sites. The Journal of Steroid Biochemistry and Molecular Biology 88,
113–122.
Petz, L.N., Ziegler, Y.S., Schultz, J.R., and Nardulli, A.M. (2004b). Fos and Jun inhibit estrogeninduced transcription of the human progesterone receptor gene through an activator protein-1
site. Molecular Endocrinology (Baltimore, Md.) 18, 521–532.
Picard, D. (2006). Chaperoning steroid hormone action. Trends in Endocrinology and
Metabolism: TEM 17, 229–235.

55

Pless, O., Kowenz-Leutz, E., Knoblich, M., Lausen, J., Beyermann, M., Walsh, M.J., and Leutz,
A. (2008). G9a-mediated lysine methylation alters the function of CCAAT/enhancer-binding
protein-β. The Journal of Biological Chemistry 283, 26357–26363.
Pratt, W.B., Galigniana, M.D., Morishima, Y., and Murphy, P.J. (2004). Role of molecular
chaperones in steroid receptor action. Essays Biochem 40, 41–58.
Proietti, C., Salatino, M., Rosemblit, C., Carnevale, R., Pecci, A., Kornblihtt, A.R., Molinolo,
A.A., Frahm, I., Charreau, E.H., Schillaci, R., et al. (2005). Progestins induce transcriptional
activation of signal transducer and activator of transcription 3 (Stat3) via a Jak- and Srcdependent mechanism in breast cancer cells. Molecular and Cellular Biology 25, 4826–4840.
Pulverer, B.J., Kyriakis, J.M., Avruch, J., Nikolakaki, E., and Woodgett, J.R. (1991).
Phosphorylation of c-jun mediated by MAP kinases. Nature 353, 670–674.
Qiu, X., Aiken, K.J., Chokas, A.L., Beachy, D.E., and Nick, H.S. (2008). Distinct functions of
CCAAT enhancer-binding protein isoforms in the regulation of manganese superoxide dismutase
during interleukin-1β stimulation. The Journal of Biological Chemistry 283, 25774–25785.
Raman, V., Tamori, a, Vali, M., Zeller, K., Korz, D., and Sukumar, S. (2000). HOXA5 regulates
expression of the progesterone receptor. The Journal of Biological Chemistry 275, 26551–26555.
Ramji, D.P. (2002). CCAAT/enhancer-binding proteins: structure, function and regulation.
Biochemical Journal.
Ramji, D.P., and Foka, P. (2002). CCAAT/enhancer-binding proteins: structure, function and
regulation. The Biochemical Journal 365, 561–575.
Raught, B., Liao, W.S., and Rosen, J.M. (1995). Developmentally and hormonally regulated
CCAAT/enhancer-binding protein isoforms influence β-casein gene expression. Molecular
Endocrinology (Baltimore, Md.) 9, 1223–1232.
Richer, J.K., Lange, C.A., Wierman, A.M., Brooks, K.M., Tung, L., Takimoto, G.S., and
Horwitz, K.B. (1998). Progesterone receptor variants found in breast cells repress transcription
by wild-type receptors. Breast Cancer Research and Treatment 48, 231–241.
Richer, J.K., Jacobsen, B.M., Manning, N.G., Abel, M.G., Wolf, D.M., and Horwitz, K.B.
(2002). Differential gene regulation by the two progesterone receptor isoforms in human breast
cancer cells. The Journal of Biological Chemistry 277, 5209–5218.
Robinson, G.W., Johnson, P.F., Hennighausen, L., and Sterneck, E. (1998). The C/EBPβ
transcription factor regulates epithelial cell proliferation and differentiation in the mammary
gland. Genes & Development 12, 1907–1916.
Rozek, D., and Pfeifer, G.P. (1993). In vivo protein-DNA interactions at the c-jun promoter:
preformed complexes mediate the UV response. Mol. Cell. Biol. 13, 5490–5499.
56

Rozek, D., and Pfeifer, G.P. (1995). In vivo protein-DNA interactions at the c-jun promoter in
quiescent and serum-stimulated fibroblasts. Journal of Cellular Biochemistry 57, 479–487.
Ryseck, R.P., and Bravo, R. (1991). c-JUN, JUN B, and JUN D differ in their binding affinities
to AP-1 and CRE consensus sequences: effect of FOS proteins. Oncogene 6, 533–542.
Saitoh, M., Ohmichi, M., Takahashi, K., Kawagoe, J., Ohta, T., Doshida, M., Takahashi, T.,
Igarashi, H., Mori-Abe, A., Du, B., et al. (2005). Medroxyprogesterone acetate induces cell
proliferation through up-regulation of cyclin D1 expression via phosphatidylinositol 3kinase/Akt/nuclear factor-kappaB cascade in human breast cancer cells. Endocrinology 146,
4917–4925.
Santos, S.J., Aupperlee, M.D., Xie, J., Durairaj, S., Miksicek, R., Conrad, S.E., Leipprandt, J.R.,
Tan, Y.S., Schwartz, R.C., and Haslam, S.Z. (2009). Progesterone receptor A-regulated gene
expression in mammary organoid cultures. Journal of Steroid Biochemistry and Molecular
Biology 115, 161–172.
Sasaki, M., Dharia, A., Oh, B.R., Tanaka, Y., Fujimoto, S., and Dahiya, R. (2001). Progesterone
Receptor B Gene Inactivation and CpG Hypermethylation in Human Uterine Endometrial
Cancer. Cancer Res. 61, 97–102.
Savouret, J.F., Bailly, A., Misrahi, M., Rauch, C., Redeuilh, G., Chauchereau, A., and Milgrom,
E. (1991). Characterization of the hormone responsive element involved in the regulation of the
progesterone receptor gene. The EMBO Journal 10, 1875–1883.
Schultz, J.R., Petz, L.N., and Nardulli, A.M. (2003). Estrogen receptor α and Sp1 regulate
progesterone receptor gene expression. Molecular and Cellular Endocrinology 201, 165–175.
Seagroves, T.N., Krnacik, S., Raught, B., Gay, J., Burgess-Beusse, B., Darlington, G.J., and
Rosen, J.M. (1998). C/EBPβ, but not C/EBPα, is essential for ductal morphogenesis,
lobuloalveolar proliferation, and functional differentiation in the mouse mammary gland. Genes
& Development 12, 1917–1928.
Seagroves, T.N., Lydon, J.P., Hovey, R.C., Vonderhaar, B.K., and Rosen, J.M. (2000). C/EBPβ
(CCAAT/enhancer binding protein) controls cell fate determination during mammary gland
development. Mol Endocrinol 14, 359–368.
Sharma, D., Ohri, S., and Dixit, A. (2003). The -148 to -124 region of c-jun interacts with a
positive regulatory factor in rat liver and enhances transcription. European Journal of
Biochemistry / FEBS 270, 181–189.
Shaulian, E., and Karin, M. (2002). AP-1 as a regulator of cell life and death. Nature Cell
Biology 4, E131–6.

57

Shen, Q., Zhang, Y., Uray, I.P., Hill, J.L., Kim, H.-T., Lu, C., Young, M.R., Gunther, E.J.,
Hilsenbeck, S.G., Chodosh, L.A., et al. (2006). The AP-1 transcription factor regulates postnatal
mammary gland development. Developmental Biology 295, 589–603.
Shyamala, G., Yang, X., Silberstein, G., Barcellos-Hoff, M.H., and Dale, E. (1998). Transgenic
mice carrying an imbalance in the native ratio of A to B forms of progesterone receptor exhibit
developmental abnormalities in mammary glands. Proceedings of the National Academy of
Sciences of the United States of America 95, 696–701.
Shyamala, G., Yang, X., Cardiff, R.D., and Dale, E. (2000). Impact of progesterone receptor on
cell-fate decisions during mammary gland development. Proceedings of the National Academy
of Sciences of the United States of America 97, 3044–3049.
Sicinski, P., Donaher, J.L., Parker, S.B., Li, T., Fazeli, A., Gardner, H., Haslam, S.Z., Bronson,
R.T., Elledge, S.J., and Weinberg, R.A. (1995). Cyclin D1 provides a link between development
and oncogenesis in the retina and breast. Cell 82, 621–630.
Simian, M., Bissell, M.J., Barcellos-Hoff, M.H., and Shyamala, G. (2009). Estrogen and
progesterone receptors have distinct roles in the establishment of the hyperplastic phenotype in
PR-A transgenic mice. Breast Cancer Research: BCR 11, R72.
Smith, D.F. (1993). Dynamics of heat shock protein 90-progesterone receptor binding and the
disactivation loop model for steroid receptor complexes. Molecular Endocrinology (Baltimore,
Md.) 7, 1418–1429.
Smith, C.L., and O’Malley, B.W. (2004). Coregulator function: a key to understanding tissue
specificity of selective receptor modulators. Endocrine Reviews 25, 45–71.
Smith, D.F., Faber, L.E., and Toft, D.O. (1990). Purification of unactivated progesterone
receptor and identification of novel receptor-associated proteins. The Journal of Biological
Chemistry 265, 3996–4003.
Smith, L.M., Birrer, M.J., Stampfer, M.R., and Brown, P.H. (1997). Breast cancer cells have
lower activating protein 1 transcription factor activity than normal mammary epithelial cells.
Cancer Research 57, 3046–3054.
Sriraman, V., Sharma, S.C., and Richards, J.S. (2003). Transactivation of the progesterone
receptor gene in granulosa cells: evidence that Sp1/Sp3 binding sites in the proximal promoter
play a key role in luteinizing hormone inducibility. Molecular Endocrinology (Baltimore, Md.)
17, 436–449.
Stratmann, A., and Haendler, B. (2011). The histone demethylase JARID1A regulates
progesterone receptor expression. The FEBS Journal 278, 1458–1469.
Su, W.-C., Chou, H.-Y., Chang, C.-J., Lee, Y.-M., Chen, W.-H., Huang, K.-H., Lee, M.-Y., and
Lee, S.-C. (2003). Differential activation of a C/EBP β isoform by a novel redox switch may
58

confer the lipopolysaccharide-inducible expression of interleukin-6 gene. The Journal of
Biological Chemistry 278, 51150–51158.
Tahirov, T.H., Sato, K., Ichikawa-Iwata, E., Sasaki, M., Inoue-Bungo, T., Shiina, M., Kimura,
K., Takata, S., Fujikawa, A., Morii, H., et al. (2002). Mechanism of c-Myb-C/EBP β cooperation
from separated sites on a promoter. Cell 108, 57–70.
Takimoto, G.S., Tung, L., Abdel-Hafiz, H., Abel, M.G., Sartorius, C.A., Richer, J.K., Jacobsen,
B.M., Bain, D.L., and Horwitz, K.B. (2003). Functional properties of the N-terminal region of
progesterone receptors and their mechanistic relationship to structure. The Journal of Steroid
Biochemistry and Molecular Biology 85, 209–219.
Tang, M., Mazella, J., Gao, J., and Tseng, L. (2002). Progesterone receptor activates its promoter
activity in human endometrial stromal cells. Molecular and Cellular Endocrinology 192, 45–53.
Thangaraju, M., Rudelius, M., Bierie, B., Raffeld, M., Sharan, S., Hennighausen, L., Huang, A.M., and Sterneck, E. (2005). C/EBPδ is a crucial regulator of pro-apoptotic gene expression
during mammary gland involution. Development (Cambridge, England) 132, 4675–4685.
Timchenko, L.T., Iakova, P., Welm, A.L., Cai, Z.-J., and Timchenko, N.A. (2002). Calreticulin
Interacts with C/EBP and C/EBP mRNAs and Represses Translation of C/EBP Proteins.
Molecular and Cellular Biology 22, 7242–7257.
Timchenko, N.A., Welm, A.L., Lu, X., and Timchenko, L.T. (1999). CUG repeat binding protein
(CUGBP1) interacts with the 5’ region of C/EBPβ mRNA and regulates translation of C/EBPβ
isoforms. Nucleic Acids Research 27, 4517–4525.
Tominaga, H., Maeda, S., Hayashi, M., Takeda, S., Akira, S., Komiya, S., Nakamura, T.,
Akiyama, H., and Imamura, T. (2008). CCAAT/enhancer-binding protein β promotes osteoblast
differentiation by enhancing Runx2 activity with ATF4. Molecular Biology of the Cell 19, 5373–
5386.
Treier, M., Staszewski, L.M., and Bohmann, D. (1994). Ubiquitin-dependent c-Jun degradation
in vivo is mediated by the δ domain. Cell 78, 787–798.
Tsai, L.N., Ku, T.K.S., Salib, N.K., and Crowe, D.L. (2008). Extracellular signals regulate rapid
coactivator recruitment at AP-1 sites by altered phosphorylation of both CREB binding protein
and c-jun. Molecular and Cellular Biology 28, 4240–4250.
Tseng, L., Tang, M., Wang, Z., and Mazella, J. (2003). Progesterone receptor (hPR) upregulates
the fibronectin promoter activity in human decidual fibroblasts. DNA and Cell Biology 22, 633–
640.
Tsukada, J., Yoshida, Y., Kominato, Y., and Auron, P.E. (2011). The CCAAT/enhancer (C/EBP)
family of basic-leucine zipper (bZIP) transcription factors is a multifaceted highly-regulated
system for gene regulation. Cytokine 54, 6–19.
59

Tung, L., Abdel-Hafiz, H., Shen, T., Harvell, D.M.E., Nitao, L.K., Richer, J.K., Sartorius, C.A.,
Takimoto, G.S., and Horwitz, K.B. (2006). Progesterone receptors (PR)-B and -A regulate
transcription by different mechanisms: AF-3 exerts regulatory control over coactivator binding to
PR-B. Molecular Endocrinology (Baltimore, Md.) 20, 2656–2670.
Uematsu, S., Kaisho, T., Tanaka, T., Matsumoto, M., Yamakami, M., Omori, H., Yamamoto, M.,
Yoshimori, T., and Akira, S. (2007). The C/EBP β isoform 34-kDa LAP is responsible for NFIL-6-mediated gene induction in activated macrophages, but is not essential for intracellular
bacteria killing. Journal of Immunology (Baltimore, Md. : 1950) 179, 5378–5386.
Vicent, G.P., Nacht, A.S., Zaurin, R., Font-Mateu, J., Soronellas, D., Le Dily, F., Reyes, D., and
Beato, M. (2013). Unliganded progesterone receptor-mediated targeting of an RNA-containing
repressive complex silences a subset of hormone-inducible genes. Genes & Development 27,
1179–1197.
Vries, R.G., Prudenziati, M., Zwartjes, C., Verlaan, M., Kalkhoven, E., and Zantema, A. (2001).
A specific lysine in c-Jun is required for transcriptional repression by E1A and is acetylated by
p300. The EMBO Journal 20, 6095–6103.
Wang, J.-M., Ko, C.-Y., Chen, L.-C., Wang, W.-L., and Chang, W.-C. (2006). Functional role of
NF-IL6β and its sumoylation and acetylation modifications in promoter activation of
cyclooxygenase 2 gene. Nucleic Acids Research 34, 217–231.
Wang, W.-L., Lee, Y.-C., Yang, W.-M., Chang, W.-C., and Wang, J.-M. (2008). Sumoylation of
LAP1 is involved in the HDAC4-mediated repression of COX-2 transcription. Nucleic Acids
Research 36, 6066–6079.
Wargon, V., Fernandez, S. V, Goin, M., Giulianelli, S., Russo, J., and Lanari, C. (2011).
Hypermethylation of the progesterone receptor A in constitutive antiprogestin-resistant mouse
mammary carcinomas. Breast Cancer Research and Treatment 126, 319–332.
Watanabe, G., Lee, R.J., Albanese, C., Rainey, W.E., Batlle, D., and Pestell, R.G. (1996).
Angiotensin II activation of cyclin D1-dependent kinase activity. The Journal of Biological
Chemistry 271, 22570–22577.
Wei, L.L., Gonzalez-Aller, C., Wood, W.M., Miller, L.A., and Horwitz, K.B. (1990). 5’Heterogeneity in human progesterone receptor transcripts predicts a new amino-terminal
truncated “C”-receptor and unique A-receptor messages. Molecular Endocrinology (Baltimore,
Md.) 4, 1833–1840.
Wei, L.L., Hawkins, P., Baker, C., Norris, B., Sheridan, P.L., and Quinn, P.G. (1996). An aminoterminal truncated progesterone receptor isoform, PRc, enhances progestin-induced
transcriptional activity. Molecular Endocrinology (Baltimore, Md.) 10, 1379–1387.

60

Wei, L.L., Norris, B.M., and Baker, C.J. (1997). An N-terminally truncated third progesterone
receptor protein, PR(C), forms heterodimers with PR(B) but interferes in PR(B)-DNA binding.
The Journal of Steroid Biochemistry and Molecular Biology 62, 287–297.
Wei, W., Jin, J., Schlisio, S., Harper, J.W., and Kaelin, W.G. (2005). The v-Jun point mutation
allows c-Jun to escape GSK3-dependent recognition and destruction by the Fbw7 ubiquitin
ligase. Cancer Cell 8, 25–33.
Wei, W., Yang, H., Cao, P., Menconi, M., Chamberlain, C., Petkova, V., and Hasselgren, P.-O.
(2006). Degradation of C/EBPβ in cultured myotubes is calpain-dependent. Journal of Cellular
Physiology 208, 386–398.
Weiss, C., Schneider, S., Wagner, E.F., Zhang, X., Seto, E., and Bohmann, D. (2003). JNK
phosphorylation relieves HDAC3-dependent suppression of the transcriptional activity of c-Jun.
The EMBO Journal 22, 3686–3695.
Welm, A.L., Timchenko, N.A., and Darlington, G.J. (1999). C/EBPα regulates generation of
C/EBPβ isoforms through activation of specific proteolytic cleavage. Molecular and Cellular
Biology 19, 1695–1704.
Wertz, I.E., O’Rourke, K.M., Zhang, Z., Dornan, D., Arnott, D., Deshaies, R.J., and Dixit, V.M.
(2004). Human De-etiolated-1 regulates c-Jun by assembling a CUL4A ubiquitin ligase. Science
(New York, N.Y.) 303, 1371–1374.
Wethmar, K., Bégay, V., Smink, J.J., Zaragoza, K., Wiesenthal, V., Dörken, B., Calkhoven, C.F.,
and Leutz, A. (2010). C/EBPβ∆ORF mice--a genetic model for uORF-mediated translational
control in mammals. Genes & Development 24, 15–20.
Williams, S.C., Baer, M., Dillner, A.J., and Johnson, P.F. (1995). CRP2 (C/EBP β) contains a
bipartite regulatory domain that controls transcriptional activation, DNA binding and cell
specificity. The EMBO Journal 14, 3170–3183.
Wiper-Bergeron, N., Salem, H.A., Tomlinson, J.J., Wu, D., and Haché, R.J.G. (2007).
Glucocorticoid-stimulated preadipocyte differentiation is mediated through acetylation of
C/EBPβ by GCN5. Proceedings of the National Academy of Sciences of the United States of
America 104, 2703–2708.
Wong, C., Rougier-Chapman, E.M., Frederick, J.P., Datto, M.B., Liberati, N.T., Li, J.M., and
Wang, X.F. (1999). Smad3-Smad4 and AP-1 complexes synergize in transcriptional activation of
the c-Jun promoter by transforming growth factor β. Molecular and Cellular Biology 19, 1821–
1830.
Wu, Y., Strawn, E., Basir, Z., Halverson, G., and Guo, S.-W. (2006). Promoter hypermethylation
of progesterone receptor isoform B (PR-B) in endometriosis. Epigenetics 1, 106–111.

61

Xu, M., Nie, L., Kim, S.-H., and Sun, X.-H. (2003). STAT5-induced Id-1 transcription involves
recruitment of HDAC1 and deacetylation of C/EBPβ. The EMBO Journal 22, 893–904.
Yang, C., Chen, L., Li, C., Lynch, M.C., Brisken, C., and Schmidt, E. V (2010). Cyclin D1
enhances the response to estrogen and progesterone by regulating progesterone receptor
expression. Molecular and Cellular Biology 30, 3111–3125.
Yang, X., Yan, L., and Davidson, N.E. (2001). DNA methylation in breast cancer. EndocrineRelated Cancer 8, 115–127.
Zagariya, A., Mungre, S., Lovis, R., Birrer, M., Ness, S., Thimmapaya, B., and Pope, R. (1998).
Tumor necrosis factor α gene regulation: enhancement of C/EBPβ-induced activation by c-Jun.
Molecular and Cellular Biology 18, 2815–2824.
Zahnow, C.A. (2002). CCAAT/enhancer binding proteins in normal mammary development and
breast cancer. Breast Cancer Research : BCR 4, 113–121.
Zahnow, C.A. (2009). CCAAT/enhancer-binding protein β: its role in breast cancer and
associations with receptor tyrosine kinases. Expert Reviews in Molecular Medicine 11, e12.
Zahnow, C.A., Cardiff, R.D., Laucirica, R., Medina, D., and Rosen, J.M. (2001). A role for
CCAAT/enhancer binding protein β-liver-enriched inhibitory protein in mammary epithelial cell
proliferation. Cancer Research 61, 261–269.
Zhang, D., Suganuma, T., and Workman, J.L. (2013). Acetylation regulates Jun protein turnover
in Drosophila. Biochimica et Biophysica Acta 1829, 1218–1224.

62

CHAPTER 2

C/EBP LIP AND C-JUN SYNERGIZE TO REGULATE EXPRESSION OF THE
PROGESTERONE RECEPTOR

63

Weizhong Wang1, Han Ngoc Do1,2, Mark D. Aupperlee3,5, Srinivasan Durairaj3, Emily E.
Flynn3,4, Richard Miksicek3, Sandra Z. Haslam3,5, Richard C. Schwartz1,5,6

1

Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing,

MI
2

Cell and Molecular Biology Program, Michigan State University, East Lansing, MI

3

Department of Physiology, Michigan State University, East Lansing, MI

4

Genetics Program, Michigan State University, East Lansing, MI

5

Breast Cancer and the Environment Research Program, Michigan State University, East

Lansing, MI
6

To whom correspondence should be addressed.

Han Do was responsible for the following experiments. Both Han Do and Weizhong Wang
contributed to the experiments in Figure 2. Han Do is responsible for the final data presented in
panels 2.2A, 2.2B, 2.2C and 2.2G. Han Do is fully responsible for the experiments presented in
Figures 2.3 and 2.5.

64

Abstract
C/EBP is a critical transcription factor in the regulation of mammary gland proliferation
and development. Experiments with C/EBP knockout mice demonstrate a requirement of
C/EBP for ductal morphogenesis and alveologenesis. Progesterone is critical for proliferation
and alveologenesis in the adult mammary gland, and experiments with progesterone receptor
(PR) knockout mice show a similar requirement of progesterone receptor B (PRB) for
alveologenesis. We examined whether C/EBP participates in the transcriptional regulation of
PR expression in the mammary gland. Transient co-transfection of a PR promoter-reporter with
expression vectors that individually express C/EBP isoforms into a mammary tumor cell line
revealed that all C/EBP isoforms, surprisingly including LIP, can transactivate the PR
promoter. Importantly, we found that LIP, in particular, robustly synergizes with c-Jun to drive
PR transcription. Consistent with significant roles for C/EBP and c-Jun in PR expression,
knockdown experiments showed that endogenous levels of C/EBP and c-Jun expression are
sufficient to stimulate the PR promoter-reporter. Additionally, overexpression of LIP elevates PR
protein expression from the intact endogenous PR gene. In the course of pregnancy, both PRB
and the relative abundance of LIP among C/EBP isoforms increase. Consistent with a role in
the expression of PRB, in vivo immunofluorescence studies showed that the localization of
C/EBP and PRA expression are mutually exclusive in the mammary epithelium, while PRB is
expressed in cells that express C/EBP. Collectively, our data suggest a critical role for C/EBP,
particularly LIP, in PRB expression.

65

Introduction
C/EBP is a critical transcription factor in the regulation of mammary gland proliferation
and development. Experiments with C/EBP-deficient mice demonstrate a requirement for
C/EBP in ductal morphogenesis and alveologenesis (Robinson et al., 1998; Seagroves et al.,
1998). C/EBP occurs in three isoforms in mammary and other tissues: C/EBP p38 (LAP1) and
C/EBP p35 (LAP2), both potent transcriptional activators, and C/EBP p20 (LIP), a truncated
form generally reported to inhibit C/EBP-dependent transcription (reviewed in Zahnow, 2002).
During the course of pregnancy in the mouse, C/EBP protein expression increases, with LIP
expression being particularly elevated, not being detectable in the virgin mammary gland
(Seagroves et al., 1998).
Progesterone (P) signaling through the progesterone receptor (PR) is also a critical factor
for proliferation, ductal morphogenesis and alveologenesis in the adult mammary gland
(reviewed in Fendrick et al., 1998; Shyamala et al. 1998; Aupperlee et al., 2005; Aupperlee and
Haslam, 2007). Furthermore, experiments with mice deficient in PR isoform B (PRB) show a
requirement of PRB for alveologenesis (Lydon et al., 1995; reviewed in Conneely et al., 2002).
The block to alveologenesis in both C/EBP- and PRB-deficient mice suggests that these
transcription factors might act in the same pathway or may regulate overlapping sets of
downstream target genes. An overall decrease in PR observed in sexually mature wildtype mice
fails to occur in C/EBP-deficient mice, while no alterations in C/EBP expression are observed
in PR-deficient mice (Seagroves et al., 2000). This is consistent with C/EBP acting upstream of
PR. PR isoform A (PRA) is the predominant isoform of PR expressed in the mammary glands of
virgin adults, with its expression dramatically decreasing at pregnancy and PRB being expressed

66

with alveolar development during pregnancy (Aupperlee et al., 2005). This raises the possibility
that C/EBP is required for the differential upregulation and localization of PRB expression that
is observed during pregnancy.
In this report, we examined whether C/EBP participates in the transcriptional regulation
of PR expression in the mammary gland. Transient co-transfection of a PR promoter-reporter
with expression vectors that individually express C/EBP isoforms into a mammary tumor cell
line revealed that all C/EBP isoforms, surprisingly including LIP, can transactivate the PR
promoter. Importantly, we found that LIP, in particular, robustly synergizes with c-Jun to drive
PR transcription. Consistent with significant roles for C/EBP and c-Jun in PR expression,
knockdown experiments showed that endogenous levels of C/EBP and c-Jun expression are
sufficient to stimulate the PR promoter-reporter. Additionally, overexpression of LIP elevates PR
protein expression from the intact endogenous gene encoding PR. Furthermore, in vivo
immunofluorescence studies showed that the localization of C/EBP and PRA expression are
mutually exclusive in the mammary epithelium, while PRB is expressed in cells that express
C/EBP. Collectively, our data suggest a critical role for C/EBP, particularly LIP, in PRB
expression.
Materials and methods
Mice: Female BALB/c mice were purchased from Harlan (Indianapolis, IN). All animal
experimentation was conducted according to standards approved by the All University
Committee on Animal Use and Care at Michigan State University.
Cells and cell culture: MC7-L1, MC4-L2, and MC4-L3 are mammary epithelial cell lines
derived from murine mammary ductal carcinomas (Lanari et al., 2001). These cell lines express
67

both ER and PR. MC7-L1 and MC4-L2 are hormone responsive in vitro and MC4-L3 is
hormone responsive in vivo. Cells were maintained in DMEM-F12 (1:1) medium supplemented
to 5% FCS, 100 units/ml penicillin and 100mg/ml streptomycin. Experiments were carried out
with charcoal-stripped FCS in the absence of antibiotics. Cells were cultured at 37°C with 5%
CO2.
Expression vectors and promoter-reporters: For transient transfections, murine C/EBP
isoforms were individually expressed from pcDNA3.1 (Invitrogen, Carlsbad, CA). pcDNA-LIP
has been described (Dearth et al., 2001). pcDNA-LAP2 (plasmid 12557; Addgene, Cambridge,
MA) has been described (Basu et al., 2011). pcDNA-LAP1 was derived from a plasmid
containing the complete coding sequence of murine C/EBP inserted between the EcoRI and
HindIII sites of pcDNA3.1 (a gift from Dr. Peter Johnson, NCI-Frederick, Frederick, MD). The
AUG translational start sites for LAP2 and LIP were mutated to GCG and a consensus Kozak
sequence introduced upstream of the LAP1 translational start, mutating GCGTTCATG to
GCCACCATG (mutated bases underlined) by site-directed mutagenesis. pCMV-c-Jun has been
described (McCabe at al., 1996).
The tandem PR promoter-reporter (Figure 2.1) consists of the region -2502 to +753 base
pairs (bp) in relation to the predicted PRB transcriptional start inserted between the Asp718 and
NcoI sites of pGL3-Basic (pGL3B) (Promega, Madison, WI). The PR promoter region was
isolated by PCR amplification of C57/Bl6 genomic mouse DNA using the following primers: 2502 to -2471 bp, 5’-ACATGGTACCAGCGTGTCACCTGGCACAGA-3’ (containing an
underlined Asp718 site); +771 to +753 bp, 5’-CTGTCCATGGACACGTCCGAGTGCTGGCT3’ (containing an underlined NcoI site). TA cloning placed the PCR fragment into vector pCR2.1
(TA Cloning Kit; Invitrogen, Life Technologies, Grand Island, NY). The promoter fragment was
68

then excised with Asp718 and NcoI, and inserted into pGL3B. 2xPRE-TK-luc is plasmid 11350
(Addgene; Giangrande et al., 2000), and contains two copies of a consensus P response element
(PRE) upstream of the human thymidine kinase promoter. pRL-SV40 expresses Renilla
luciferase from the SV40 early enhancer-promoter (Promega).
Transient transfections: Transient transfections were conducted in either 12-well cell
culture plates or 6 cm culture plates containing 1 ml/well or 4 ml/plate, respectively, of DMEMF12 supplemented to 5% charcoal-stripped FCS. 12-well cell culture plate was seeded with
5x104 cells/well and 6 cm culture plates with 5x105 cells 24 h prior to transfection. FuGene 6
Transfection Reagent (Promega) and plasmid DNAs were mixed at a 2:1 ratio (volume:weight)
in 100 l or 1 ml of serum-free medium for 12-well and 6 cm culture plates, respectively. This
mixture was incubated at room temperature for 30 min before addition to cell cultures. The
DNA, totaling 500 ng or 5 g per individual 12-well and 6 cm culture plate transfection,
respectively, comprised 100 ng or 1 g of tandem PR promoter-reporter, 1 ng or 10 ng of pRLSV40, and varying amounts of C/EBP expression vector and/or c-Jun expression vectors, as
indicated in figure legends. All quantities of expression vector are expressed as ng per 5x104
cells. Cells were assayed 24 h after transfection. For experiments utilizing 2xPRE-TK-luc, a
slightly modified transfection protocol was used. 200 ng of the 2xPRE-TK-luc promoter-reporter
was transiently co-transfected with DNA totaling 400 ng, comprising 100 ng pcDNA-LIP and/or
100 ng pCMV-c-jun, or 200 ng pcDNA. These transfections were performed in a 12-well plate
format and assayed 36 h after transfection. Transfected cells were harvested, lysed, and analyzed
for luciferase activity using the Dual-Luciferase Reporter Assay System (Promega). Firefly
luciferase values were normalized to the Renilla luciferase values as a control for transfection

69

efficiency between individual samples. All transfections were carried out in duplicate and
repeated at least three times.
In transient transfections assayed by the isolation of RNA or nuclear protein extracts,
5x105 cells were transfected in 6 cm culture plates under conditions similar to those described
above. The quantities of expression plasmids are indicated in figure legends. Cells were
harvested for RNA isolation or nuclear extracts as described below.
RNA isolation and quantitative reverse transcription-PCR (qRT-PCR)
Total RNA was isolated using TRIzol reagent (Invitrogen) according to the
manufacturer’s protocol. For RNA isolation in the experiments examining PR promoter-reporter,
the Agilent Total RNA Isolation Mini Kit (Agilent Technologies, Santa Clara, CA) was used to
eliminate residual transfected plasmid DNA. RNA was reverse-transcribed into cDNA using the
RT2 First Strand Kit (Qiagen, Germantown, MD) according to the manufacturer’s protocol.
cDNA reactions lacking reverse transcriptase were performed to confirm elimination of DNA.
cDNAs (20 L) were diluted to150 l with deionized H2O. For qRT-PCR, each reaction (15 l)
included 7.5 l of RT² SYBR Green qPCR Mastermix (Qiagen), 1 l of diluted first-stand cDNA
synthesis reaction, 1 l of primer, and 5.5 l of deionized H2O. qRT-PCR was performed with
the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Inc., Foster City, CA) using the
following program: step 1: 95C, 10 min; step 2: 40 cycles of 95C for 15 sec, 56C for 30 sec,
and 72C for 45sec; step 3: dissociation curve at 95C for 1 min, 65C for 2 min (optics off), and
65–95C at 2C per minute (optics on). Primers 5’-AAAGGATCCGCAGGTTCTC-3’ and 5’GTTCCATCTTCCAGCGGATA-3’ were used for amplification of total PR transcripts. Primers

70

5’-CCCAGTTCTCAGACCAGACC-3’ and 5’-GTGGGATCTCCACCTCCTG-3’ were used for
amplification of PRB transcripts. The positions of these primers are indicated in Figure 2.1.
Small interfering RNA (siRNA)
C/EBP siRNA (sc-29862), c-Jun siRNA (sc-29224), and control siRNA (sc-37007)
were purchased from Santa Cruz Biotechnology (Dallas, Texas). Transient transfections of
siRNAs were performed in 12-well cell culture plates containing 1 ml/well of DMEM-F12
supplemented to 5% charcoal-stripped FCS. Each well was seeded with 5x104 MC7-L1 cells 24
h prior to transfection. 200 ng plasmid DNA of the tandem PR promoter-reporter, 1 ng of pRLSV40, and either 10 pmol C/EBP siRNA, 25 pmol c-Jun siRNA, both siRNAs, or 25 pmol
control siRNA were diluted in 60 l serum-free medium (solution A). 2 or 3 l of Lipofectamine
2000 (Life Technologies), respectively for C/EBP or c-Jun and control siRNAs, was diluted in
60 l serum-free medium, and incubated for 5 minutes (solution B). Then, solutions A and B
were combined and incubated for another 20 minutes before being added into culture wells.
Transfections were performed in duplicate, and repeated at least three times. Transfected cells
were analyzed for luciferase activity 36 h after transfection as described for transient
transfections.
Western analysis: Nuclear extracts were prepared as follows. Cells were washed in
phosphate-buffered saline (PBS) and lysed in 15 mM KCl, 10 mM HEPES (pH 7.6), 2 mM
MgCl2, 0.1 mM EDTA, 1mM DTT, 0.1% (volume/volume) Nonidet P-40, 0.5mM PMSF, 2.5
g/ml leupeptin, 5 g/ml antipain, and 5 g/ml aprotinin for 10 min on ice. Nuclei were pelleted
by centrifugation at 14,000×g for 1 min at 4oC. Proteins were extracted from nuclei by 20 min
incubation at 40C with vigorous vortexing in buffer C (420mM NaCl, 20mM HEPES (pH 7.9),

71

0.2mM EDTA, 25% [volume/volume] glycerol, 1 mM DTT, 0.5 mM PMSF, 2.5 g/ml
leupeptin, 5 g/ml antipain, and 5 g/ml aprotinin).

Nuclear debris was pelleted by

centrifugation at 13,000 rpm for 30 min at 4oC, and the supernatant extract was collected and
stored at −80oC. The extracts (10 g) were adjusted to 1x Laemmli sample buffer (Laemmli,
1970) and processed by sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis. The gel
was transferred to a Protran membrane (Schleicher and Schuell Bio-Science, Inc., Keene, NH),
and antigen-antibody complexes were visualized with the Enhanced Chemiluminescence Kit
(Amersham Biosciences, Piscataway, NJ). The primary antibodies utilized were rabbit antiC/EBP specific to the carboxyl terminus (C-19; 1:1000; Santa Cruz Biotechnology) and rabbit
anti--tubulin (H-235; 1:1000; Santa Cruz Biotechnology). Anti-rabbit IgG horseradish
peroxidase (HRP)-conjugate was used as a secondary antibody (1:3000; Promega).
Immunofluorescence: Dual immunofluorescence detection of PRA and C/EBP or PRB
and C/EBP was performed using rabbit anti-PRA (1:100; A0098, Dako, Carpinteria, CA) or
rabbit anti-PRB (1:800; B15; Kariagina et al., 2007) with mouse anti-C/EBP (1:50; sc7962,
Santa Cruz Biotechnology) primary antibodies followed by appropriate secondary antibodies
conjugated to Alexa 488 (Molecular Probes, Eugene, OR) or Alexa 546 (Molecular Probes).
Nuclei were counterstained with 4’, 6-diamidino-2-phenylindole, dilactate (DAPI) (1:10,000 w/v
in H2O).
For tissue sections, mice were killed and their mammary glands were fixed and paraffinembedded for immunohistochemistry (Aupperlee et al., 2005). MC7-L1 cells were grown on a
round microscope cover glass (Fisher Scientific, Pittsburgh, PA) with a starting density of 2x105
cells in each well of 6-well cell culture plates. After 20 h, transfections were performed as

72

described above, using 0.5 g of pcDNA or pcDNA-LIP. Transfected cells were incubated for 24
h prior to staining. Cell-coated cover glasses were fixed in 3.7% formalin for 30 min, rinsed
twice in PBS for 5min, permeabilized in 0.5% (weight:volume) Triton X-100 for 15 min, rinsed
again in PBS, and then blocked with PBS containing 2% BSA for 15 min. After blocking, cells
were treated with primary antibodies overnight. The next day, slides were washed with PBS,
incubated with secondary antibody for 30 min. After another rinse in PBS, slides were stained
with DAPI for 5 min. Slides were mounted with fluorescence mounting medium and dried
overnight. Stained tissue sections and cells were visualized and images captured using a Nikon
inverted epifluorescence microscope (Mager Scientific, Dexter, MI) with MetaMorph software
(Molecular Devices Corporation, Downington, PA).
Results
Examination of the DNA sequence in the region from -2494 to +769 of the PRB gene
with MatInspector (Quandt et al., 1995; Cartharius et al., 2005) revealed a number of predicted
C/EBP binding sites (Figure 2.1). In order to investigate the ability of C/EBPβ isoforms to
stimulate transcription of the PR gene, we performed transient co-transfections of vectors that
singly expressed LAP1, LAP2, and LIP into murine mammary carcinoma cell line MC7-L1
(Lanari et al., 2001) with the tandem PR promoter-reporter. The tandem PR promoter-reporter
retains sequences allowing transcription from both the PRB and PRA transcriptional start sites.

73

Figure 2.1. Map of the murine PR promoter region used in these studies.

74

A

B

Figure 2.2. Transient co-expression of LIP and c-Jun synergizes to induce expression from
the PR promoter-reporter. Transient co-transfection of C/EBP and c-Jun expression vectors
were carried out in duplicate and repeated at least three times in murine mammary epithelial cell
lines with the tandem PR promoter-reporter. (A, B, C, D) MC7-L1 cells. The varied nanogram
quantities of the expression vector per 5x104 cells are indicated below the x-axis. For panels A,
B, and C, C/EBP expression vectors were co-transfected with 100 ng of c-Jun expression vector
in some transfections. Luminometer values were normalized for expression from a co-transfected
SV40 early enhancer/promoter-Renilla luciferase reporter. These values were then normalized to
a relative value of 1.0 for cells receiving neither C/EBP nor c-Jun expression vector. The data
presented are the means of at least three experiments with their standard error. p was calculated
by Student’s T-Test in comparison to the control transfection for transfections involving a single
transfected expression vector, and in comparison to transfections involving a C/EBP vector
alone for co-transfections involving both C/EBP and c-Jun expression vectors. *, p<0.1; **,
p<0.05; ***, p<0.01. (E) MC4-L2 cells. 100 ng LIP and 100 ng c-Jun expression vectors per
5x104 cells. Values were normalized and statistics performed as described above. (F) MC4-L3
cells. 50 ng LIP and 50 ng c-Jun expression vectors per 5x104 cells. Values were normalized and
statistics performed as described above. (G) A western blot confirms similar levels of C/EBP
expression among the various isoforms in transfection of MC7-L1 cells. c-Jun is overexpressed
in cells transfected for c-Jun expression. -tubulin was detected as a loading control.

75

Figure 2.2 (Cont'd)

D

E

E

F

76

Figure 2.2 (Cont'd)

G

77

We chose MC7-L1 because its endogenous expression of PR assured its ability to support a
response from the tandem PR promoter-reporter. All three C/EBP isoforms displayed modest
activity (maximally 3 to 6-fold) in stimulating the PR promoter (Figure 2.2A).
Previous investigators demonstrated a role for AP-1 (i.e., c-Jun/c-Fos) in stimulating
human PR promoter activity in conjunction with estrogen receptor and Sp1 binding (Petz et al.,
2002; Shultz et al., 2005). Additionally, transgenic mice expressing inducible TAM67, a
dominant negative truncated form of c-Jun that lacks a transactivation domain, showed reduced
mammary ductal development at puberty, as well as in hormonally stimulated adults (Shen et al.,
2006). We decided to examine how AP-1 overexpression might interact with C/EBP activation
of the tandem PR promoter-reporter. To that end, LAP1, LAP2, and LIP were transiently coexpressed with c-Jun.
Co-expression of LIP with c-Jun showed a striking synergy in activation of the PR
promoter (Figure 2.2A). Peak stimulation of the PR promoter averaged 32-fold under conditions
where LIP and c-Jun singly provided 4-fold and 2.7-fold stimulation, respectively. This synergy
was more modestly evident with LAP2 (Figure 2.2B), while LAP1 (Figure 2.2C) only showed
additive levels of stimulation with co-expression of the two transcription factors. Expression of
c-Jun by itself (Figure 2.2D) showed only modest stimulation of the PR promoter over a range
similar to that of the individual C/EBP isoforms. Differences in activity were not due to
differential levels of expression, as all of the C/EBP isoforms showed similar levels of
expression in parallel transfections, and c-Jun did not induce C/EBP expression (Figure 2.2G).
A similar synergy between LIP and c-Jun on PR promoter was also observed in MC4-L2 and
MC4-L3 (Figure 2.2E and 2.2F), two other mammary carcinoma cell lines that show endogenous
PR expression (Lanari et al., 2001).
78

Figure 2.3. Co-expression of LIP and c-Jun increases 2xPRE promoter activity.
Transient co-transfection of C/EBP and c-Jun expression vectors were carried out in duplicate
and repeated at least three times in MC7-L1 cells with the 2xPRE promoter-reporter. Values
were normalized and statistics performed as described in Figure 2.1. ***, p<0.01.

79

Having observed the robust synergy between LIP and c-Jun in activating the PR promoter
in a transient transfection system, we tested whether the intact endogenous PR gene would
respond to these transcription factors. To that end, LIP and c-Jun overexpression was introduced
transiently into MC7-L1 cells in co-transfections with the 2xPRE-TK-luc promoter-reporter. The
activity of the 2xPRE promoter is dependent upon PR expression. While LIP or c-Jun
overexpression by itself did not significantly increase 2xPRE activity, co-expression of LIP and
c-Jun increased 2xPRE promoter activity 2.8-fold (Figure 2.3).
As a more direct assessment of the effects of LIP and c-Jun overexpression on
endogenous PR gene expression, LIP and c-Jun expression was introduced transiently into MC7L1 cells, and then PRA and PRB expression were examined by immunofluorescence. PRA and
PRB expression were increased about 4-fold in LIP overexpressing cells (Figures 2.4A and B).
C-Jun neither increased PR expression nor enhanced LIP stimulation of PR expression (data not
shown) The lack of an effect from c-Jun overexpression in this assay may reflect a surfeit of cJun expression in the context of the diploid endogenous gene as opposed to more limited
availability for the multiple copies of the transfected tandem PR promoter-reporter. Consistent
with the notion that LIP transcriptionally activates the PR gene, PR RNA levels were increased
23-fold by LIP overexpression (Figure 2.4C).
In order to examine whether the levels of C/EBP and c-Jun normally present in MC7-L1
cells can support PR expression, “gene knockdown” experiments were performed with siRNAs
directed against the mRNAs of these transcription factors. SiRNAs directed against C/EBP and

80

Figure 2.4. LIP expression induces endogenous PRA and PRB expression. Transient
transfections of the LIP expression vector were carried out in MC7-L1 cells. (A)
Immunofluorescent detection of PRA (green) and C/EBP (red) in cells transfected for LIP
expression (LIP) and in cells transfected with empty vector (Ctrl). Nuclei were counterstained
with DAPI (blue). (B) The immunofluorescence of PRA and PRB were measured in cells
showing LIP overexpression after transfection with LIP expression vector (LIP) in comparison to
the level of immunofluorescence in cells transfected with empty vector (ctrl). Values from LIP
overexpressing cells were normalized to a relative value of 1.0 for cells transfected with empty
vector. The data presented are the means of three experiments with their standard error. At least
80 LIP overexpressing cells were scored in each experiment. p was calculated by Student’s TTest in comparison to the control transfection. **, p<0.05. (C) The quantities of PR mRNA were
measured by qRT-PCR in cells transfected for LIP expression (LIP) in comparison to cells
transfected with empty vector (ctrl). Values were normalized to a relative value of 1.0 for cells
receiving the empty vector control. The data presented are the means of three experiments with
their standard error. p was calculated by Student’s T-Test in comparison to the control
transfection. **, p<0.05.
81

Figure 2.4 (Cont'd)
A

B

82

B

A

C

Figure 2.5. si-RNAs directed against endogenous C/EBP or c-Jun expression similarly
suppress expression from the tandem PR and 2xPRE promoter-reporters. (A) Transient
transfections of siRNAs directed against C/EBP (si-C/EBP) and c-Jun (si-c-Jun), as well as
control siRNA (si-Ctrl), were carried out in MC7-L1 cells with the tandem PR promoterreporter. Luminometer values were normalized for expression from a co-transfected SV40 early
enhancer/promoter-Renilla luciferase reporter. These values were then normalized to a relative
value of 1.0 for cells receiving control siRNA. The data presented are the means of at least three
experiments with their standard error. p was calculated by Student’s T-Test in comparison to the
control transfection. ***, p<0.01. (B) Transient transfections of siRNAs directed against C/EBP
(si-C/EBP) and c-Jun (si-c-Jun), as well as control siRNA (si-Ctrl), were carried out in MC7-L1
cells with the 2xPRE promoter-reporter. Data were processed as in (A). (C) A western blot
confirms decreased C/EBP and c-Jun expression with transfection of their cognate siRNAs. tubulin was detected as a loading control.
83

c-Jun mRNAs were transiently transfected, either singly or together, with the tandem PR
promoter-reporter. The activity of this promoter was reduced by about 40% by either siRNA
alone, while co-transfection with both siRNAs reduced promoter activity by about 50% (Figure
2.5A). Similar reductions in basal activity were found for control promoter-reporters specifically
dependent on C/EBP or c-Jun family transcription factors (data not shown). At the same time,
protein levels of C/EBP isoforms and c-Jun were dramatically reduced by their cognate siRNAs
(Figure 2.5C). This suggests that the endogenous levels of C/EBP and c-Jun expressed in MC7L1 cells are sufficient to support PR transcription. Additionally, the fact that co-transfection with
siRNAs for both C/EBP and c-Jun suppresses expression from the PR promoter little more than
each siRNA alone is consistent with the notion that the activity of these transcription factors on
the PR promoter is largely derived from their synergy.
In order to extend our examination of the effects of gene knockdown to the intact
endogenous PR gene, we repeated the transfection of siRNAs directed against C/EBP and c-Jun
mRNAs with the 2xPRE-TK-luc promoter-reporter. Similarly to the case with the tandem PR
promoter, activity of the 2xPRE promoter was reduced by about 40 to 50% whether transfected
singly or with both siRNAs (Figure 2.5B). This suggests a similar dependence of the intact
endogenous PR promoter for endogenous levels of C/EBP and c-Jun expression as for the
tandem PR promoter-reporter.
C/EBP expression, particularly LIP, increases during the course of pregnancy in the
mouse (Seagroves et al., 1998). The block to alveologenesis in both C/EBP- (Robinson et al.,
1998; Seagroves et al., 1998) and PRB-deficient mice (Lydon et al., 1995; Conneely et al.,
2002), coupled with PRB being expressed with alveolar development during pregnancy
(Aupperlee et al., 2005), led us to hypothesize that LIP may be associated PRB expression during
84

pregnancy. Immunofluorescent staining of PRA, PRB and C/EBP was performed on the
mammary glands of nulliparous compared to 14-day pregnant mice. Staining revealed that the
localization of PRA, the predominant PR isoform in the nulliparous mammary gland, was
mutually exclusive of C/EBP (Figure 2.6A). In contrast, PRB, the predominant PR isoform in
the pregnant mammary gland, largely co-localized with C/EBP (Figure 2.6B), consistent with a
role for C/EBP in PRB expression.
Overexpression of LIP increased both PRA and PRB expression in MC7-L1 cells (Figure
2.4A and B), but the relative expression of PRA and PRB proteins is uncertain as these protein
were detected with different antibodies. In order to assess differential expression of PRA and
PRB, we performed a PCR assay utilizing primers specific to either a region common to both
PRA and PRB transcripts or to an upstream region specific to PRB transcripts. Transcripts from
the endogenous gene were not abundant enough to reliably assay (data not shown), so assays
were performed on RNAs isolated from cells transfected with the tandem PR promoter-reporter.
Consistent with a role for LIP in PRB expression, LIP overexpression increased the ratio of PRB
transcripts to total PR transcripts by 1.8-fold (Figure 2.6C).

85

A

C/EBPβ+ also staining for PRA: 2.5%
PRA+ also staining for C/EBPβ: 2.4%
Figure 2.6. PRA expression is mutually exclusive of C/EBP, while PRB and C/EBP
largely co-localize. (A, B) PRA (red) or PRB (red) and C/EBP (green) were detected by
immunofluorescence in the mammary glands of 13-week old nulliparous mice and 14-day
pregnant mice. Nuclei were counterstained with DAPI (blue). Representative tissue sections are
shown with the percentages of PR and C/EBP co-localization. (C) The quantities of PR RNA
transcribed from the tandem PR promoter-reporter were measured by qRT-PCR in cells
transfected for LIP expression (LIP) in comparison to cells transfected with empty vector (ctrl).
A ratio of PRB to total PR RNA was calculated and these values were normalized to a relative
value of 1.0 for cells receiving the empty vector control. The data presented are the means of
three experiments with their standard error. p was calculated by Student’s T-Test in comparison
to the control transfection. **, p<0.05.

86

Figure 2.6 (Cont'd)

B

C/EBPβ+ also staining for PRB: 73%
PRB+ also staining for C/EBPβ: 65%

C

87

Discussion
The data presented in this paper support an important role for C/EBP in the
transcriptional regulation of PR. The LIP isoform of C/EBP was particularly active in synergy
with c-Jun on a PR promoter-reporter, and was capable of increasing PR protein expression in a
murine mammary carcinoma cell line. Importantly, PRB expression in the mammary glands of
pregnant mice co-localized with C/EBP expression, while PRA and C/EBP expression in
nulliparous mice were mutually exclusive in their localization. LIP expression is particularly
increased in the mammary glands of pregnant mice (Seagroves at al., 1998) at the same time
when PRB becomes the predominant PR isoform in the murine mammary gland (Aupperlee et
al., 2005). Both LIP (Seagroves at al., 1998) and PRB (Aupperlee et al., 2005) are also both
down-regulated at lactation and involution. Viewed in this context, our results suggest a specific
role for LIP in the expression of PRB. Observations in knockout mice are consistent with a role
for C/EBP in regulating PRB expression. PRB-deficient mice in are defective in alveologenesis
(Lydon et al., 1995; Conneely et al., 2002), as are C/EBP-deficient mice ((Robinson et al.,
1998; Seagroves et al., 1998). Further, in contrast to alterations in PR expression that are
observed in C/EBP-deficient mice, no alterations in C/EBP expression are observed in PRdeficient mice (Seagroves et al., 2000). This is consistent with our conclusion that C/EBP acts
upstream of PR.
At the same time that knockout studies support the notion of an involvement of C/EBP
in PRB regulation, there are, at least superficially, some inconsistencies. C/EBP-deficient mice
show elevated numbers of PR-positive cells rather than a decrease in PR expression that night be
expected (Seagroves et al. 2000). However, that study did not distinguish between PRA and

88

PRB, and, as those observations were made in nulliparous mice, they most likely represent PRA
expression. The number of PR-positive cells did not decrease in sexually mature C/EBPdeficient mice and is not decreased by E plus P treatment that mimics pregnancy, as is the case in
wildtype mice (Seagroves et al. 2000). Again, the interpretation of this lies with specific isoform
expression that was not assessed. In wildtype animals, PRA decreases with maturity and is
further diminished with pregnancy, and PRB is not evident until day 14 of pregnancy (Aupperlee
et al., 2005). The failure to decrease PR expression in C/EBP-deficient mice may reflect a block
in the transition to PRB expression that occurs with pregnancy. It would be informative to
analyze the developmental expression of PRA and PRB in C/EBP-deficient mice.
Another question arises from studies showing that, in contrast to complete C/EBP
deficiency, mice that fail to express LIP do not show defects in mammary gland development
(Wethmar et al., 2010). Mice lacking LAP2 expression also have normal mammary gland
development (Uematsu et al., 2007). These findings are entirely consistent with our findings that
although LIP is the most robust isoform for transactivation of the PR promoter-reporter, LAP2
also has significant activity. As our results shows little activity for LAP1 on the PR promoter, a
LAP1 knock-in on a C/EBP-deficient background would not be expected to rescue mammary
gland development.
It is interesting that LIP, generally described as an inhibitor of LAP-mediated
transcription (Descombes, and Schibler, 1991), is the C/EBP isoform that most robustly
activates the PR promoter. There is precedent for activation of other genes by LIP, and, as in this
report, LIP activity is associated with synergy with other transcription factors.

LIP can

transactivate the IL-6 promoter reporter in manner dependent upon an intact NF-B site (Hu et
al., 2000; Spooner et al., 2007). IL-8 is similarly activated through a synergy between C/EBP
89

and NF-B, and this is, at least in part, mediated through cooperative DNA binding (Stein and
Baldwin, 1993). LIP and PRB cooperate to transactivate the decidual prolactin and MMTV
promoters (Christian et al., 2002). LIP and Runx2 cooperate to transactivate the promoters for
alkaline phosphatase and osteoclacin (Hata et al., 2005). This latter activity is based upon the
enhanced ability of ATF4-C/EBP (i.e., LIP) heterodimers to bind DNA and interact with Runx2
(Tominaga et al., 2008). Knockdown of C/EBP, c-Jun, or both all inhibited the PR promoterreporter to a similar extent, implying a mutual dependence of the LIP and c-Jun for their
synergistic activity. The basis for this synergy remains to be elucidated.
Progestin acting through PRB is reported to up-regulate C/EBP expression in a human
breast cancer cell line (Richer et al., 2002) and P upregulates C/EBP expression in mouse
mammary glands (Aupperlee et al., 2009). Progestin is also reported to up-regulate c-Jun in a
human breast cancer cell line (Alkhalaf and Murphy, 1992). Thus, our finding of C/EBP and cJun synergy in regulating PR presents a robust mechanism for a positive feedback loop in PRB
expression in the pregnant mammary gland. P decreases PRA and increases PRB levels in the
normal adult murine mammary gland (Aupperlee and Haslam, 2007). Such a positive feedback
loop may be critical in the action of P to promote PRB expression in pregnancy.
Acknowledgements
This work was made possible by the Breast Cancer and the Environment Research
Program (BCERP) award number 1UO1ESO19434 and the Breast Cancer and the Environment
Research Centers (BCERC) award number 1U01ES12800 from the National Institute
of Environmental Health Sciences (NIEHS) and the National Cancer Institute (NCI), NIH,
DHHS. Its contents are solely the responsibility of the authors and do not necessarily represent

90

the official views of the NIEHS or NCI, the National Institutes of Health. We also gratefully
acknowledge support of the Avon Foundation, Ladies Auxiliary to the Veterans of Foreign Wars,
and the Helen L. Kay Charitable Trust for this research.

91

REFERENCES

92

REFERENCES

Robinson GW, Johnson PF, Hennighausen L, Sterneck E. The C/EBP transcription
factor regulates epithelial cell proliferation and differentiation in the mammary gland.
Genes Dev. 1998; 12:1907-1916.
Seagroves TN, Krnacik S, Raught B, Gay J, Burgess-Beusse B, Darlington GJ, Rosen
JM. C/EBP, but not C/EBP, is essential for ductal morphogenesis, lobuloalveolar
proliferation, and functional differentiation in the mouse mammary gland. Genes Dev.
1998; 12:1917-1928.
Zahnow CA. CCAAT/enhancer binding proteins in normal mammary development and
breast cancer. Breast Cancer Res. 2002; 4:113-121.
Fendrick JL, Raafat AM, Haslam SZ. Mammary gland growth and development from the
postnatal period to postmenopause: ovarian steroid receptor ontogeny and regulation in
the mouse. J Mammary Gland Biol Neoplasia. 1998; 3(1):7-22.
Shyamala G, Yang X, Silberstein G, Barcellos-Hoff MH, Dale E. Transgenic mice
carrying an imbalance in the native ratio of A to B forms of progesterone receptor exhibit
developmental abnormalities in mammary glands. Proc Natl Acad Sci U S A. 1998;
95:696-701.
Aupperlee MD, Smith KT, Kariagina A, Haslam SZ. Progesterone receptor isoforms A
and B: temporal and spatial differences in expression during murine mammary gland
development. Endocrinology 2005; 146:3577-3588.
Aupperlee MD, Haslam SZ. Differential hormonal regulation and function of
progesterone receptor isoforms in normal adult mouse mammary gland. Endocrinology.
2007; 148:2290-2300.
Lydon JP, DeMayo FJ, Funk CR, Mani SK, Hughes AR, Montgomery CA Jr, Shyamala
G, Conneely OM, O'Malley BW. Mice lacking progesterone receptor exhibit pleiotropic
reproductive abnormalities. Genes Dev. 1995; 9:2266-2278.
Conneely OM, Mulac-Jericevic B, DeMayo F, Lydon JP, O'Malley BW. Reproductive
functions of progesterone receptors. Recent Prog Horm Res. 2002; 57:339-355.
Seagroves TN, Lydon JP, Hovey RC, Vonderhaar BK, Rosen JM. C/EBP
(CCAAT/enhancer binding protein) controls cell fate determination during mammary
gland development. Mol Endocrinol. 2000; 14:359-368.
Lanari C, Lüthy I, Lamb CA, Fabris V, Pagano E, Helguero LA, Sanjuan N, Merani S,
Molinolo AA. Five novel hormone-responsive cell lines derived from murine mammary
ductal carcinomas: in vivo and in vitro effects of estrogens and progestins. Cancer Res.
2001; 61:293-302.
93

Dearth LR, Hutt J, Sattler A, Gigliotti A, DeWille J. Expression and function of
CCAAT/enhancer binding protein (C/EBP) LAP and LIP isoforms in mouse mammary
gland, tumors and cultured mammary epithelial cells. J Cell Biochem. 2001; 82:357-370.
Basu SK, Malik R, Huggins CJ, Lee S, Sebastian T, Sakchaisri K, Quiñones OA, Alvord
WG, Johnson PF. 3'UTR elements inhibit Ras-induced C/EBPβ post-translational
activation and senescence in tumour cells. EMBO J. 2011; 30:3714-3728.
McCabe LR, Banerjee C, Kundu R, Harrison RJ, Dobner PR, Stein JL, Lian JB, Stein
GS. Developmental expression and activities of specific fos and jun proteins are
functionally related to osteoblast maturation: role of Fra-2 and Jun D during
differentiation. Endocrinology. 1996; 137:4398-4408.
Laemmli UK. Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature. 1970; 227:680-685.
Kariagina A, Aupperlee MD, Haslam SZ. Progesterone receptor isoforms and
proliferation in the rat mammary gland during development. Endocrinology. 2007;
148:2723-2736.
Quandt K, Frech K, Karas H, Wingender E, Werner T. MatInd and MatInspector: new
fast and versatile tools for detection of consensus matches in nucleotide sequence data.
Nucleic Acids Res. 1995; 23:4878-4884.
Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, Frisch M,
Bayerlein M, Werner T. MatInspector and beyond: promoter analysis based on
transcription factor binding sites. Bioinformatics. 2005; 21:2933-2942.
Petz LN, Ziegler YS, Loven MA, Nardulli AM. Estrogen receptor α and activating
protein-1 mediate estrogen responsiveness of the progesterone receptor gene in MCF-7
breast cancer cells. Endocrinology. 2002; 143:4583-4591.
Schultz JR, Petz LN, Nardulli AM. Cell- and ligand-specific regulation of promoters
containing activator protein-1 and Sp1 sites by estrogen receptors  and . J Biol Chem.
2005; 280:347-354.
Shen Q, Zhang Y, Uray IP, Hill JL, Kim HT, Lu C, Young MR, Gunther EJ, Hilsenbeck
SG, Chodosh LA, Colburn NH, Brown PH. The AP-1 transcription factor regulates
postnatal mammary gland development. Dev Biol. 2006; 295:589-603.
Wethmar K, Bégay V, Smink JJ, Zaragoza K, Wiesenthal V, Dörken B, Calkhoven CF,
Leutz A. C/EBPuORF mice--a genetic model for uORF-mediated translational control in
mammals. Genes Dev. 2010; 24:15-20.
Uematsu S, Kaisho T, Tanaka T, Matsumoto M, Yamakami M, Omori H, Yamamoto M,
Yoshimori T, Akira S. The C/EBP isoform 34-kDa LAP is responsible for NF-IL-6mediated gene induction in activated macrophages, but is not essential for intracellular
bacteria killing. J Immunol. 2007; 179:5378-5386.
94

Descombes P, Schibler, U. A liver-enriched transcriptional activator protein, LAP, and a
transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell. 1991;
67:569-579.
Hu HM, Tian Q, Baer M, Spooner CJ, Williams SC, Johnson PF, Schwartz RC. The
C/EBP bZIP domain can mediate lipopolysaccharide induction of the proinflammatory
cytokines interleukin-6 and monocyte chemoattractant protein-1. J Biol Chem. 2000;
275:16373-16381.
Spooner CJ, Guo X, Johnson PF, Schwartz RC. Differential roles of C/EBP β regulatory
domains in specifying MCP-1 and IL-6 transcription. Mol Immunol. 2007; 44:13841392.
Stein B, Baldwin AS Jr. Distinct mechanisms for regulation of the interleukin-8 gene
involve synergism and cooperativity between C/EBP and NF-B. Mol Cell Biol. 1993;
13:7191-7198.
Christian M, Pohnke Y, Kempf R, Gellersen B, Brosens JJ. Functional association of PR
and CCAAT/enhancer-binding protein β isoforms: promoter-dependent cooperation
between PR-B and liver-enriched inhibitory protein, or liver-enriched activatory protein
and PR-A in human endometrial stromal cells. Mol Endocrinol. 2002; 16:141-154.
Hata K, Nishimura R, Ueda M, Ikeda F, Matsubara T, Ichida F, Hisada K, Nokubi T,
Yamaguchi A, Yoneda T. A CCAAT/enhancer binding protein  isoform, liver-enriched
inhibitory protein, regulates commitment of osteoblasts and adipocytes. Mol Cell Biol.
2005; 25:1971-1979.
Tominaga H, Maeda S, Hayashi M, Takeda S, Akira S, Komiya S, Nakamura T,
Akiyama H, Imamura T. CCAAT/enhancer-binding protein  promotes osteoblast
differentiation by enhancing Runx2 activity with ATF4. Mol Biol Cell. 2008; 19:537386.
Richer JK, Jacobsen BM, Manning NG, Abel MG, Wolf DM, Horwitz KB. Differential
gene regulation by the two progesterone receptor isoforms in human breast cancer cells. J
Biol Chem. 2002; 277:5209-5218.
Aupperlee MD, Drolet AA, Durairaj S, Wang W, Schwartz RC, Haslam SZ. Strainspecific differences in the mechanisms of progesterone regulation of murine mammary
gland development. Endocrinology. 2009; 150:1485-1494.
Alkhalaf M, Murphy LC. Regulation of c-jun and jun-B by progestins in T-47D human
breast cancer cells. Mol Endocrinol. 1992; 6:1625-1633.
Aupperlee MD, Haslam SZ. Differential hormonal regulation and function of
progesterone receptor isoforms in normal adult mouse mammary gland. Endocrinology.
2007; 148:2290-2300.

95

CHAPTER 3

C/EBPβ LIP AND C-JUN SYNERGY ON THE PROGESTERONE PROMOTER IS
BASED ON THEIR MUTUAL DEPENDENCE FOR EFFICIENT OCCUPANCY

96

Han Ngoc Do1,2, Weizhong Wang1, Richard C. Schwartz1,3,4
1

Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing,
MI
2
Cell and Molecular Biology Program, Michigan State University, East Lansing, MI
3
Breast Cancer and the Environment Research Program, Michigan State University, East
Lansing, MI
4
To whom correspondence should be addressed.

Han Do is fully responsible for the experiments presented in this manuscript.

97

Abstract
Transcriptional regulation of PR by E and estrogen receptor (ER) is well described;
however, expression of PR in mammary gland may be regulated by cross-talk of multiple
hormones and growth factors leading to activation of multiple transcription factors and coactivators. We recently found that the LIP isoform of C/EBPβ synergizes with the AP-1 family
member c-Jun to up-regulate expression from the PR promoter (Wang et. al., unpublished
results). In this report, we have elucidated the synergistic mechanism of LIP and c-Jun to activate
the PR promoter. We demonstrate that the integrity of C/EBP- and AP-1-binding sites is required
for the respective C/EBPβ and c-Jun activities on the PR promoter, and that efficient promoter
occupancy of both LIP and c-Jun, as well as their synergistic transactivation of the PR promoter,
requires at least one C/EBP- and one AP-1-binding site. From these observations, we propose a
model where the synergy of LIP and c-Jun in transactivation of the PR promoter is dependent on
the two factors mutually stabilizing their recruitment to the PR promoter.

98

Introduction
Mammary gland development is dependent on the actions of three major hormones,
estrogen (E), progesterone (P), and prolactin (Prl), and occurs largely after birth (Brisken and
O’Malley, 2010). The mammary gland undergoes two hormonally regulated developmental
programs, one at puberty and the other at pregnancy. Progesterone (P) and its receptor, the
progesterone receptor (PR), are particularly important for mammary gland development and
maintenance during pregnancy. P signaling through PR is required for normal mammary
development, as ductal side branching is reduced and lobuloalveolar development at duct ends is
absent in PR knockout mice (Lydon et al., 1995).
PR exists as two isoforms, PRA and PRB. PRB comprises the identical amino acid
sequence as PRA, but additionally contains an extension of 164 N-terminal amino acids
(Jacobsen and Horwitz, 2012). In mouse, expression of PRA and PRB is temporally and spatially
separated during mammary gland development (Aupperlee et al., 2005). PRA expression is
dominant in the virgin and pubertal gland, is reduced in the mature gland, and is expressed at its
lowest level in pregnancy. PRB is expressed robustly at pregnancy, particularly during
alveologenesis at side branches and developing alveolar lobules. This indicates that PRBexpressing cells proliferate and differentiate during pregnancy. No PR expression is observed
during lactation. Collectively, this implies that PRA and PRB are differentially regulated during
the various stages of mammary gland development.
The individual roles of each isoform have been identified in mice specifically deficient in
a single isoform. While ablation of PRA allows normal mammary gland development and
response to hormones, ablation of PRB resulted in a defective phenotype, similar to that of mice

99

deficient in both isoforms, indicating that PRB is critical for mammary gland development
during pregnancy (Mulac-Jericevic et al., 2003).
P/PR signaling-mediated cell proliferation, dysfunction in the P/PR pathway, and changes
in the relative ratio of the two PR isoforms have all been shown to contribute to development of
breast cancer. However, PR expression in breast cancer is a positive prognostic indicator for a
better response to endocrine therapy and overall patient survival, and PR-positive tumors are
more differentiated and less invasive than PR-negative tumors (Obr and Edwards, 2012).
Moreover, similar levels PRA and PRB expression, which are detected in normal human breast
tissues, are altered in tumors. The ratio of PRA:PRB is increased in more aggressive tumors
(Hopp, 2004). Thus, elucidation of the mechanisms regulating PR expression, especially PRB,
which correlates with better breast cancer prognosis, may be beneficial in developing therapeutic
strategies for breast cancer that rely on modulating PR expression.
Transcriptional regulation of PR by E and estrogen receptor (ER) is well described
(Jacobsen and Horwitz, 2012). However, PR is still expressed in ERα-deficient mice (Korach,
2000), and total PR levels do not fluctuate with the hormonal changes during the menstrual cycle
(Mote et al., 2006). Further, loss of PR expression in ER-positive tumors does not result from
non-functional ER (Cui et al., 2003). These observations indicate that other E-independent
mechanisms contribute to regulation of PR expression. One other regulator of PR transcription is
AP-1, which has been shown to both up- and down-regulate the human PR gene, respectively
through a +90 AP-1 site (Petz et al., 2002) and a +745 AP-1 site (Petz et al., 2004). We recently
found that the LIP isoform of C/EBPβ synergizes with the AP-1 family member c-Jun to upregulate expression from the PR promoter (Wang, unpublished results).

100

When viewed in the context of the robust increase in LIP expression observed in
mammary glands of pregnant mice (Seagroves et al., 1998), it is clear that the mechanism by
which LIP acts with c-Jun to up-regulate PR expression may be significant to understanding the
regulation of PR expression during murine pregnancy. Moreover, C/EBPβ-deficient mice
(Robinson et al., 1998; Seagroves et al., 1998) and mice blocked for AP-1 activity (Shen et al.,
2006) show similar defects in mammary gland development, as do PRB-deficient mice (MulacJericevic et al., 2003), especially during pregnancy.
In this report, we have elucidated the mechanism by which LIP and c-Jun synergistically
activate the PR promoter. We demonstrate that the integrity of C/EBP- and AP-1-binding sites is
required for the respective C/EBP and c-Jun activities on the PR promoter, and that efficient
promoter occupancy of both LIP and c-Jun, as well as their synergistic transactivation of the PR
promoter, requires at least one C/EBP- and one AP-1-binding site. This leads us to propose a
model where the synergy of LIP and c-Jun in transactivation of the PR promoter is dependent on
the two factors mutually stabilizing their recruitment to the PR promoter. Surprisingly, the DNA
binding and dimerization domains of the two transcription factors, rather than their known
transactivation domains, are required for this synergy.
Material and methods
Cell lines: MC7-L1 is a murine mammary epithelial cell line derived from a ductal
carcinoma (Lanari et al., 2001). Cells were maintained in DMEM-F12 (1:1) (Gibco, Life
Technologies, Grand Island, NY) medium supplemented to 5% charcoal-stripped FCS, 100
units/ml penicillin and 100mg/ml streptomycin. Experiments were carried out with charcoalstripped FCS in the absence of antibiotics. Cells were maintained in a humidified incubator at
37°C at 5% CO2.
101

Expression vectors and promoter-reporters: Murine C/EBPβ isoforms were individually
expressed from pcDNA3.1 (Invitrogen, Carlsbad, CA). pcDNA-LIP has been described (Dearth
et al., 2001). pcDNA-LAP2 (plasmid 12557; Addgene, Cambridge, MA) has been described
(Basu et al., 2011). pcDNA-LAP1 was derived from a plasmid containing the complete coding
sequence of murine C/EBPβ inserted between the EcoRI and HindIII sites of pcDNA3.1 (a gift
from Dr. Peter Johnson, NCI-Frederick, Frederick, MD). The AUG translational start sites for
LAP2 and LIP were mutated to GCG and a consensus Kozak sequence introduced upstream of
the LAP1 translational start, mutating GCGTTCATG to GCCACCATG (mutated bases
underlined) by site-directed mutagenesis. pCMV-c-Jun has been described (McCabe at al.,
1996). pCMV-TAM-67, expressing a dominant negative form of c-Jun that lacks amino acids 3
through 122, has been described (Brown et al., 1996). The expression vectors for A-C/EBP and
A-fos under the control of the CMV promoter has been described (Ahn et al., 1998) and obtained
from Addgene. The 2x-C/EBP-Luc reporter and 2x-AP-1 Luc reporter contain two canonical
C/EBP binding sites and two AP-1 sites, respectively. The tandem PR promoter-reporter consists
of the region -2494 to +769 base pairs (bp) in relation to the predicted PRB transcriptional start
inserted between the Asp718 and NcoI sites of pGL3-Basic (pGL3B) (Promega, Madison, WI).
The PR promoter region was isolated by PCR amplification of C57/Bl6 genomic mouse DNA
using the following primers: -2502 to -2471 bp, 5’-ACATGGTACCAGCGTGTCACCTGGCAC
AGA-3’ (containing an underlined Asp718 site); +771 to +753 bp, 5’-CTGTCCATGGACACGT
CCGAGTGCTGGCT-3’ (containing an underlined NcoI site). TA cloning placed the PCR
fragment into vector pCR2.1 (TA Cloning Kit; Invitrogen, Life Technologies, Grand Island,
NY). The promoter fragment was then excised with Asp718 and NcoI, and inserted into pGL3B.
The PRA (+379bp/+769bp), long PRB (-444bp/+399bp), short PRB (-444bp/+63bp) were

102

similarly constructed using the following primers for PCR amplification: PRA, +379 to +399 bp,
5’-GCTACTTCTTCCTGTCCTCAC-3’, +751 to +769 bp, 5’-GCACGTCCGAGTGCTGGCT3’; long PRB, -444 to -423 bp, 5’-AGCACCTGCAACTTCACCTCTG-3’, +399 to +379 bp, 5’GTGAGGACAGGAAGAAGTAGC-3’;

short

PRB,

-444

to

-423

bp;

5’-AGCACC

TGCAACTTCACCTCTG-3’, +43 to +63 bp, 5’-TAGCAGAATGTCAGA ATCCTC-3’. The
minimal PRB (-117bp/+63bp) was generated by digestion of short PRB (-444/ +63) with SpeI
and re-ligation. Mutations were introduced into the minimal PRB using the QuikChange
Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA) following the
manufacturer’s protocol. Primers for mutagenesis are shown in the Table 3.1.
Site
B1
B2
B3
B4
J1
J2
half
B2J1

Sequence
TGATTGGCTA
TGATGGTCTA
CTTGCTAGAAAG
CTGGTTATACAG
CTTTGTAGTATT
CTTTTTATTATT
TCTGACATTCTGCT
TCTAAGATTGTGCT
ACTGTCA
AATGTAA
TGACATT
TATCATT

Primer sequence 5’-3’
TAGATCTAGCCAGTGATGGTCTAGGGAGGGGCTTTG
CCTAGAGCGCCAACGCTGGTTATACAGCTATGGAGCC
Antisense:
GAATCCTCGCACCCGTAAATAATAAAAAGACTGATAGTGACAGTC
Antisense
GAATTCGCCCTTTAGCACAATCTTAGAATCCTCGCACCCG
GAAAGCTATGGAGCCAGTCTAGAATGTAACTATCAGTCTTTGTAG
CGGGTGCGAGGATTCTATCATTCTGCTAAGGGCG
GTTATACAGCTATGGAGCCAGTCTAGAATGTAACTATCAGTC

Table 3.1. List of Primers for Site Mutagenesis.
DNA transfections and promoter-reporter assays: 5x104 cells were plated in each well of
a 12-well plate 24 h prior to transfection. Transient transfections were performed on the next day
with 100 ng of promoter-reporter, 1 ng of pRL-SV40 as a control, and varied amounts of
expression and control plasmids as indicated in figure legends totaling 500 ng of total DNA per
well. Plasmid DNAs were mixed with 1 l of FuGENE6 Transfection Reagent (Promega,
Madison, WI) in 50 µl of serum-free DMEM-F12 medium. This mixture was incubated at room

103

temperature for 30 min before addition to culture wells. 24 h later, cell lysates were assayed for
luciferase activity using the Dual-Luciferase Reporter Assay System (Promega). The firefly
luciferase values were from the promoter-reporters were normalized to the Renilla luciferase
values from pRL-SV40 (Promega) to control for transfection efficiency between individual
samples. All transfections were carried out in duplicate and repeated at least three times. In
experiments involving the minimal PRB, luciferase values derived from pGL3B lacking any
inserted sequences were subtracted from those of minimal PRB promoter-reporter to eliminate
background levels of luciferase expression driven by C/EBPβ and c-Jun responsive sequences in
the parent vector.
Chromatin immunoprecipitation (ChIP) and sequential ChIP assays: The PRB promoterreporter was precut with ScaI to separate promoter sequences from the pGL3B backbone.
Transient transfections were performed similarly to promoter-reporter assays, except 5x105 cells
were plated per 6 cm culture dish and the DNA transfection mix comprised 2 g of precut
promoter-reporter, 1.5 g of each expression plasmid, an amount of “empty” control expression
vector to total 5 g of total DNA, and10 l FuGENE6 in 100l of serum-free DMEM/F12
medium. ChIP was performed 24 h after transfection.
Trypsinized cells were resuspended in DMEM/F-12 medium supplemented to5% FCS.
The cells were then crosslinkedat1% formaldehyde for10 minutes at room temperature.
Crosslinking was stopped by the addition of glycine to a final concentration of 0.125 M. The
cells were washed twice with ice cold PBS, resuspended in cell-lysis buffer (5 mM Pipes [pH
8.0], 85 mM KC1, 0.5% NP40 with protease inhibitors [1mM dithiothreitol, 0.5 mM PMSF, 2.5
ug/ml leupeptin, 5 ug/ml antipain, 5 ug/ml aprotinin and 1 uMpepstatin A]), and then incubated
on ice for 10 min. Nuclei were pelleted by centrifugation at 5000 rpm for 5 min at 4°C. The
104

nuclei were resuspended in nuclear lysis buffer (50 mMTris-Cl [pH 8.1], 10 mM EDTA, 1%
SDS with protease inhibitors). The cells were then sonicated 10 timesat30% amplitude, 0.7s on
and 1.3s off, over30-s intervals on ice.
Each 100l chromatin was pre-cleared at 4°C overnight in900l ChIP dilution buffer
(0.01% SDS, 1.1% Triton X100, 1.2 mM EDTA, 16.7 mMTris-Cl [pH8.1], 167 mMNaCl with
protease inhibitors) and 80l of a 50% (v/v) Protein G-Agarose slurry containing 20g salmon
sperm DNA and 1 mg/ml BSA, and stored in 4°C for later use. Equal amounts of pre-cleared
chromatin in ChIP dilution buffer were incubated with 2g of either rabbit anti-C/EBPβ (C-19;
Santa Cruz Biotechnology, Dallas, TX), rabbit anti-c-Jun (H-79; Santa Cruz Biotechnology), or
normal rabbit IgG (Santa Cruz Biotechnology) at 4°C overnight. Immunoprecipitated products
were collected after 2 h incubation with 50l of pre-coated Protein G-Agarose beads (The
Thermo Scientific™Pierce™). Protein G-Agarose beads were pre-coated with 20g salmon
sperm DNA and l mg/ml BSA at 4°C overnight, and stored at4°C for later use.
Immunoprecipitated material was washed sequentially in TSE buffer (20 mM Tris [pH
8.1], 0.1% SDS, 2mM EDTA, 1% Triton X-100), TSE buffer plus 150 mMNaCl, and TSE buffer
plus 500 mM NaCl, and finally in buffer III (10 mMTris [pH 8.0], 1 mM EDTA, 0.25 M LiCl,
1% NP-40,1% deoxycholate). Each wash step was performed twice for 15 min at room
temperature with a rotating plate. Beads were then washed twice in TE buffer (20 mM Tris [pH
8.0], 2 mM EDTA), and protein-DNA complexes were eluted in 500 l of 0.1 M NaHC03-l%
SDS for 30 min at 65°C. Crosslinking of the protein-DNA complexes was reversed and RNA
and protein removed by overnight incubation with 2l of 10mg/ml RNAseA at 65°C, followed
by incubation with 2l of 20mg/ml Proteinase K at 42°C for 2 hours. DNA was then purified by

105

phenol-chloroform extraction and ethanol precipitation, and subsequently dissolved in 50 l of
TE buffer.
DNA from the input and immunoprecipitated samples were subjected to quantitative
polymerase chain reaction (qPCR) with specific primers (Table 2) in triplicate. qPCR was
performed with the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Inc., Foster
City, CA) using the following program: step 1, 95°C for 10 min; step 2, 40 cycles of 95°C for 15
s, 58°C for 30 s, and 72°C for 30 s; step 3,72°C for 5 minutes. In experiments with the minimal
PRB, qPCR was also performed with additional primers for the pGL3B backbone region as a
control (Table 3.2). The amplified qPCR products from immunoprecipitated DNA are presented
as the fold enrichment compared to normal rabbit IgG immunoprecipitation products.
Region
Minimal PRB

Primer Sequence 5'-3'
Forward
CTAGCAAAATAGGCTGTCCC
Reverse
CTTTATGTTTTTGGCGTCTTCCA

Control Vector Forward
GCGACACGGAAATGTTGAATAC
Reverse

CTACGTGAACCATCACCCTAATC
Table 3.2. List of Primers for ChIP.

Sequential ChIP was performed similarly to ChIP. Briefly, 100 l of crosslinked
chromatin from transfected cells was incubated first with anti-C/EBPβ, the immunoprecipitated
collected on Protein G-agarose beads, and then protein-DNA complexes eluted from the beads
with TE containing 1% SDS. Each half of the eluted material was then subjected to a second
immunoprecipitation (i.e., sequential ChIP) with either normal IgG, or anti-C/EBPβ, or anti-cJun. The supernatant from the first ChIP was subjected to a second ChIP with anti-c-Jun to detect

106

c-Jun-DNA complexes not associated with C/EBP. This procedure was also performed with an
initial c-Jun ChIP.
Results
We previously demonstrated that C/EBPβ and c-Jun synergistically transactivate the
tandem PR promoter-reporter (Wang et al., unpublished results; see Chapter 2). The truncated
LIP isoform of C/EBP was particularly active in this synergy. To define which sequences of the
tandem promoter (TR, -2494bp/+769bp) are required for the synergistic activity of C/EBPβ and
c-Jun, we used four truncated versions of the PR promoter-reporter: PRA (+399bp/+769bp), long
PRB (-444bp/+399bp), short PRB (-444bp/+63bp), and minimal PRB (-117bp/+63bp). First, the
basal activity of these promoters was evaluated by transiently transfecting each promoter into
MC7-L1 cells (Figure 3.1A). We found that the activities of the TR, PRA, long PRB, short PRB,
and minimal PRB (mPRB) were respectively 5.6-fold, 8.5-fold, 12.5-fold, 21.5-fold, and 10.8fold that of the pGL3B vector that lacks any PR sequences. The increase in promoter activity as a
consequence of deletion suggested the presence of negative regulatory elements within the
promoter regions between -2494bp to -444bp and +63bp to +399bp.
The activities of LIP and c-Jun were then examined individually and together in transient
co-transfections with each promoter-reporter construct in MC7-L1 cells (Figure 3.1B). Both LIP
and c-Jun were individually able to similarly transactivate all four promoters, indicating that all
the promoter constructs retained responsive elements for LIP and c-Jun. Co-transfection of LIP
and c-Jun showed synergistic activation of all of the promoter constructs, including mPRB.

107

Figure 3.1. Characterization of Progesterone Receptor promoter.
(A) Basal promoter activity of truncated forms of PR promoter.MC7-L1 cells were transfected
with 100ng of either full-length tandem promoter (TR) reporter (-2494/+769) or truncated forms
(PRA (+399/+769), lPRB (-444/+399), sPRB (-444/+63), mPRB (-117/+63).The luciferase
activity was normalized by Renilla reporter activity values. The fold change in activity of each
promoter was presented as the ratio of its normalized luciferase activity to the control pGL3basic
promoter, which was set as 1. Results are the mean±S.E. from three independent experiments;
each experiment was performed in duplicate. p was calculated by Student’s T-Test in comparison
to the pGL3-basic plasmid transfection, and in comparison to tandem PR promoter transfections.
*, p<0.1; **, p<0.05; ***, p<0.01. (B) Synergistic effect of C/EBPβ and c-Jun on truncated
forms of PR promoter. MC7-L1 cells were transfected with a fixed amount of eitherTR reporter
or truncated forms, plus individual or combined expression vectors for C/EBPβ-LIP and c-Jun.
The luciferase activity value was normalized by Renilla reporter activity value. The fold change
in activity of each promoter was presented as the ratio of its normalized luciferase activity to the
activity in overexpression of control vector, which was set as 1. Results are the mean±S.E. from
three independent experiments; each experiment was performed in duplicate. p was calculated by
Student’s T-Test in comparison to sum of folds in single factor transfection. *, p<0.1; **,
p<0.05; ***, p<0.01. (C) Differential transactivation of three C/EBPβ isoforms.MC7-L1 cells
were transfected with 100ng of minimal PRB reporter, an increasing amount (25, 50, 100,
150ng) of expression vector for each C/EBPβ isoform with or without 100ng of c-Jun expression
vector. The fold change in activity of each promoter was presented as the ratio of its normalized
luciferase activity to that activity in control expression vector transfection, which was set as 1.
Results are the mean±S.E. from three independent experiments; each experiment was performed
in duplicate. p was calculated by ANOVA in comparison between the co-transfection of LIP and
c-Jun and co-transfections involving other C/EBPβ isoforms plus c-Jun, and in comparison
between single transfection of each C/EBPβ vector alone and co-transfections of that certain
C/EBPβ isoform and c-Jun expression vectors. *, p<0.1; **, p<0.05; ***, p<0.01. (D)
Conservative regions. Conservative comparison of tandem promoter of mouse Progesterone
Receptor with other species’ sequences with mPRB region highlighted. (E) Putative C/EBP and
AP-1 sites on mPRB. The putative C/EBP and AP-1 sites on mPRB.

108

Figure 3.1 (Cont'd)

D

E

109

Since the mPRB is capable of supporting the synergism of LIP and c-Jun, we first asked
if the mPRB resembled the tandem PR promoter in terms of differential transactivation by the
three C/EBPβ isoforms, LAP1, LAP2, and LIP. We previously found that, while all three
isoforms could modestly activate the tandem PR promoter, LIP was the most active in synergy
with c-Jun and LAP1 showed no synergy with c-Jun (Wang et al., unpublished results; see
Chapter 2). Transient transfection with the mPRB promoter-reporter showed a similar pattern of
activity (Figure 3.1C). We found synergy with c-Jun for LAP2 and LIP, but not for LAP1 at any
concentration. Moreover, LIP was the most active isoform in the synergy with c-Jun. Since the
activity of the mPRB in regard to C/EBP and c-Jun was virtually identical to that of the TR, ,
we decided to utilize the mPRB to study the mechanism of synergy between LIP and c-Jun in
regulation of the PR promoter.
To identify the potential cis-acting elements for LIP and c-Jun that may mediate their
synergistic transactivation of the PR gene, we used the UCSC Genome Browser
(https://genome.ucsc.edu/) to align the 5′ region upstream of the PR coding sequence among
available vertebrate sequences. Direct comparison of the genomic PR promoter sequences among
multiple species showed that the mPRB sequence is among the limited regions of sequence
homology shared across species (mouse mPRB has 86% and 73% identity with rat and human,
respectively) (Figure 3.1D). The selection for conservation across species suggests that this
regulatory sequence and its control elements may play a key role in regulating transcription of
the PR gene in vivo. Further screening of the mPRB sequence for C/EBP and AP-1 consensus
binding sites using MatInspector (Cartharius et al., 2005; Quandt et al., 1995) and TFSearch
(Heinemeyer et al., 1998) software revealed four C/EBP sites (B1 to B4) and two AP-1 sites (J1
and J2) (Figure 3.1E). Among those sites, J2 and B4 overlap. However, these potential

110

transcription factor binding sites in this region are less conserved among species with a few
mismatches (Figure 3.1E), indicating the possible species-specific mechanism of PR regulation
by this region of promoter.
To learn which of these putative sites contribute to the observed synergy, we compared
the activity of the wild-type mRRB promoter-reporter construct with that of mutant constructs in
which the predicted binding site(s) were mutated. First, four mPRB promoter-reporters lacking
individual C/EBP binding sites (B1, B2, B3, and B4) were generated by site-directed
mutagenesis. Co-transfection of any of these mutant promoter-reporters with a constant amount
of c-Jun and increasing amounts of LIP or vice versa resulted in a dose response similar to that of
the wild-type promoter (Figure 3S.1A). Since multiple putative C/EBP binding are predicted, it
is possible that the lack of effect in mutating a single site reflects their redundancy. To test this, a
series of mutated promoter-reporters were constructed with double, triple, and quadruple binding
site mutations, and used in transient transfections. Some of the double mutant promoters (B1B2,
B1B3, B1B4, and B2B4) showed only slight impairment of the synergy between LIP and c-Jun
(Figure 3S.1B). Three among the four triple mutant promoters (B1B2B3, B1B2B4, and B1B3B4)
showed statistically significant reductions transactivation by LIP and c-Jun compared to that of
wild-type (Figure 3.2A). These promoter-reporters not only showed reduced transactivation, but
synergy between LIP and c-Jun was absent. A promoter carrying mutations in all four C/EBP
binding sites (B1-4) completely abolished the synergy LIP and c-Jun (Figure 3.2A).

111

Figure 3.2: The effects of mutation of C/EBP and AP-1 sites on the promoter activity.
(A) mPRB with C/EBP mutated sites, (B) mPRB with AP-1 mutated sites, (C) mPRB with
mutation of three C/EBP sites and one AP-1 site, (D) TR with four C/EBP mutated sites, and (E)
TR with two AP-1 mutated sites. MC7-L1 cells were transfected with 100ng of wildtype mPRB
or reporter promoters carrying mutations of indicated sites, plus either an increasing amount (25,
50, 100ng) of c-Jun expression vector (as indicated) and 100ng of LIP expression vector (Left
Sides) or vice versa (Right Sides) The normalized luciferase activity of pGL3 was subtracted
from the normalized luciferase activity of each promoter. The value of promoter activity of each
promoter was presented as the relative activity after subtraction. Results are the mean±S.E. from
six (A and B) or three (C, D, and E) independent experiments; each experiment was performed in
duplicate. p was calculated by ANOVA in comparison between the wildtype promoter and
mutant promoters. *, p<0.1; **, p<0.05; ***, p<0.01.

112

Figure 3.2 (Cont'd)

113

The same approach of mutating individual or both binding sites of the mPRB promoterreporter was applied to the AP-1 sites (Figure 3.2B). c-Jun at 100ng induced J1 mutant and J2
mutant 2-3 folds, which were as similar as wildtype promoter. Both the J1 and J2 mutants still
showed synergistic activation by LIP and c-Jun. However, these mutants had significantly
reduced activity in response to LIP and c-Jun comparing to wildtype promoter. Among two
mutants, J1 mutant retained higher levels of basal and induced activity. These results indicate
that J1 is dispensable, while J2 is essential for full activity of the mPRB promoter and full
synergism between LIP and c-Jun. Moreover, when both AP-1 binding sites were mutated, the
promoter exhibited extremely low basal activity and failed to respond to either LIP or c-Jun
alone, or LIP and c-Jun co-expression. This shows that a J2 binding site is essential for
transactivation of mPRB by both C/EBPβ and c-Jun.
Since the B4 and J2 sites overlap, it suggested to us that it might constitute a regulatory
unit that was sufficient for the synergy between LIP and c-Jun, where the two factors might bind
in close juxtaposition. We examined whether a promoter that only retained the overlapping B4
and J2 sites could still respond synergistically to LIP and c-Jun, similarly to the wild-type
mPRB. However, this mutant responded poorly to LIP and c-Jun co-transfection (Figure 3.2C).
This suggests that the synergy between CEBPβ and c-Jun requires efficient DNA binding of each
factor that might not be available from these overlapping sites.
To determine how the C/EBP and AP-1 binding sites that were examined in the mPRB
influence transcription in the larger context of the 3.3kb tandem PR promoter, we introduced the
same binding site mutations that promoter sequence. A version of the tandem PR promoter
lacking all four C/EBP binding sites of the minimal PRB promoter showed neither decreased
basal activity nor suppression of the synergy between LIP and c-Jun (Figure 3.2D). In contrast,
114

co-transfection of LIP and c-Jun failed to activate the tandem promoter containing lacking the
two AP-1 binding sites identified in the minimal PRB promoter (Figure 3.2E).The retention of
activity with C/EBP binding site mutations that severely cripple the minimal PRB promoter and
the loss of activity with the AP-1 binding site mutations may reflect the redundancy of C/EBP
binding sites in the longer promoter.
Since C/EBP and AP-1 sites were required for mRRB promoter-reporter activity, we next
examined the physical binding of LIP and c-Jun to this minimal promoter region by a transient
transfection ChIP assay. MC7-L1 cells were transfected with pre-cut mPRB promoter-reporter
and expression vectors for LIP and c-Jun or control empty vector. C/EBPβ and c-Jun were
detected on mPRB promoter with 143-fold and 64-fold enrichment relative to IgG, respectively
(Figure 3.3A). These levels of occupancy were much higher than that observed with the control
expression vector or in a region of the mPRB vector distal to the promoter, suggesting that
occupancy of the promoter region containing the C/EBP and AP-1 binding sites is specific..
We hypothesized that the synergy between LIP and c-Jun is mediated through the two
factors mutually stabilizing their occupancy of their respective binding sites. To address this
question, ChIP was performed on transiently transfected reporter-promoters carrying the wildtype binding sites, or four mutated C/EBP binding sites and two wild-type AP-1 sites, or two
mutated AP-1 binding sites and four wild-type C/EBP sites (Figure 3.3B). Mutation of all four
C/EBP sites abolished virtually all binding of C/EBPβ in comparison to the wild-type promoter,
consistent with the same mutant promoter having a very weak response to LIP in the promoterreporter assay (Figure 3.2A). Similar to the case with the promoter lacking all four C/EBP

115

Figure 3.3. Differential occupancy of C/EBPβ and c-Jun on wildtype and mutant
promoters.
(A) Occupancy of C/EBPβ-LIP and c-Jun on wildtypemPRB promoter in ChIP assays. MC7-L1
cells were transfected with pre-cut mPRB promoter and expression vectors for both C/EBPβ-LIP
and c-Jun, or control expression vector (as indicated). Chromatin was precipitated with either
C/EBPβ antibody (Black Colum) or c-Jun antibody (Grey Colum), or IgG. The DNA from
precipitated chromatin was subjected to quantify by qPCR either with a primer pair for the
promoter region (Left Side) or with another primer pair for the control region (Right Side). The
value of qPCR-amplified product was calculated as the percentage of input, then the fold
enrichment was presented here as the ratio of amplified product with specific antibody to that
with nonspecific IgG antibody. Results are the mean±S.E. from three independent experiments. p
was calculated for each IP with specific antibody by Student’s T-Test in comparison to the
control vector transfection, and in comparison to the control region. *, p<0.1; **, p<0.05; ***,
p<0.01.
(B) Differential occupancy of C/EBPβ and c-Jun on wildtypeand mutant mPRBpromoter in ChIP
assays. MC7-L1 cells were transfected with pre-cut mPRB promoter forms (WT:
wildtypemPRB, QuadB: mPRB carrying four C/EBP mutated sites, DoubJ: mPRB carrying two
AP-1 mutated sites) and expression vectors for both C/EBPβ-LIP and c-Jun. Chromatin was
precipitated with either C/EBPβ antibody (Panel B Left) or c-Jun antibody (Panel B Right), or
IgG. The DNA from precipitated chromatin was subjected to quantify triplicate by qPCR either
with a primer pair for the promoter region (Black Colum) or with another primer pair for the
control region (Grey Colum). The value of qPCR-amplified product was calculated as the
percentage of input, then the fold enrichment was presented here as the ratio of amplified product
with specific antibody to that with nonspecific IgG antibody. Results are the mean±S.E. from
three independent experiments. p was calculated for each IP with specific antibody by Student’s
T-Test in comparison to the mutant promoter transfection for promoter regions, and in
comparison to the control region. *, p<0.1; **, p<0.05; ***, p<0.01.
116

binding sites, mutation of both AP-1 binding sites abolished virtually all binding of c-Jun. Again
this is consistent with this promoter’s lack of activity in the promoter-reporter assay (Figure
3.2B). These results demonstrate that LIP and c-Jun bind specifically to these binding sites in the
mRRB region of the PR promoter. It is particularly noteworthy that mutation of either the C/EBP
or the AP-1 binding sites almost completely eliminated occupancy by both factors. Moreover, the
ChIP products from the internal control region show no difference among the wild-type and
mutant promoter-reporters, indicating that the differential occupancy of LIP and c-Jun between
wild-type and mutant promoters was dependent upon the mutated binding sites rather than
differences in the plasmid DNAs. Collectively, these findings are consistent with a cooperative
model in which the stable recruitment and/or binding of these factors is mutually dependent.
Mutation of C/EBP and AP-1 sites on the minimal PRB promoter severely impairs the
LIP and c-Jun transactivation and causes a dramatic decrease in occupancy of the two factors on
DNA. This suggests that these two transcription factors need to bind DNA for their
transactivation effects. To examine this further, we utilized A-C/EBP and A-Fos, dominant
negative inhibitors that, respectively, prevent C/EBP and AP-1 from binding DNA (Ahn et al.,
1998). Co-transfection of A-C/EBP with LIP blocked transactivation of tandem promoter
reporter by LIP (Figure 3.4A). A similar result was seen in co-transfection of A-Fos with c-Jun.
Further, the expression of either A-CEBP or A-Fos in co-transfection of LIP and c-Jun was
sufficient to inhibit the synergy between LIP and c-Jun on the tandem PR promoter. Cotransfection of LIP, c-Jun, and both of their dominant-negative inhibitors suppressed promoter
activation to basal levels. A-C/EBP inhibited C/EBPβ-mediated transactivation of a 2x-C/EBP
promoter-reporter, and A-Fos inhibited c-Jun-mediated transactivation of a 2x-AP-1 promoterreporter (Figure 3S.2C). Moreover, A-C/EBP and A-Fos were unable to inhibit basal activities of

117

2x-AP-1 and 2x-C/EBP, respectively (Figure 3S.2A). These observations confirmed their
specificity and efficacy. Collectively, this is consistent with our hypothesis of mutual dependence
of LIP and c-Jun for DNA binding.
We previously found that siRNA-mediated downregulation of C/EBPβ and c-Jun
attenuated the activity of PR promoter, demonstrating that the endogenous levels of C/EBPβ and
c-Jun play a significant role in activating the PR promoter (Wang et al., unpublished results; see
Chapter 2). To test if A-C/EBP and A-Fos could prevent the endogenous C/EBPβ and c-Jun from
activating the basal activity of the tandem PR promoter, an A-C/EBP and A-Fos were cotransfected with the tandem PR promoter-reporter (Figure 3.4B). Transfection of A-C/EBP had
no significant effect on basal activity of the tandem PR promoter. A-C/EBP also failed to reduce
the basal activity of the 2x-C/EBP promoter-reporter (Figure 3S.2B). However, A-Fos
suppressed the basal activity of the tandem PR promoter in a dose-dependent manner, maximally
inhibiting activity by more than 60% (Figure 3.4B). This latter result is consistent with the
previous studies showing that intact AP-1 sites and c-Jun binding to be essential for
transactivation of the PR gene.
To determine if both LIP and c-Jun co-occupy the minimal PRB promoter, we performed
sequential ChIP (Figure 3.5). This procedure was either performed with an initial
immunoprecipitation with anti-C/EBP or with anti-c-Jun. The recovered precipitate was then
subjected to a second immunopreciptation with non-specific normal IgG, or the same antibody as
in the initial immunoprecipitation, or the transcription factor antibody not used in the initial
immunoprecipitation. Neither supernatant from the initial immunoprecipitation yielded product

118

Figure 3.4. The effect of DNA binding inhibition of C/EBPβ and c-Jun on the promoter
activity.
(A) Synergistic effect of C/EBPβ and c-Jun,(B) Basal activity.MC7-L1 cells were transfected
with (A) 100ng of TR and 100ng of expression vectors for proteins (C/EBPβ-LIP, c-Jun, ACEBP, and A-Fos) as indicated, or (B) 100ng of TR alone and an increasing amount (10, 50,
100, 200ng) of expression vectors for either A-CEBP or A-Fos. The fold change in activity of
each promoter was presented as the ratio of its normalized luciferase activity to the activity in
control expression vector transfection, which was set as 1. Results are the mean±S.E. from five
independent experiments; each experiment was performed in duplicate. For (A) p was calculated
by Student’s T-Test in comparison to the single expression vector transfection and cotransfection with its dominant negative form, and in comparison between LIP and c-Jun cotransfection and LIP, c-Jun, and their dominant negative forms . *, p<0.1; **, p<0.05; ***,
p<0.01. For (B) p was calculated by Student’s T-Test in comparison to the control transfection.

119

Figure 3.5: Co-occupancy of C/EBPβ and c-Jun in sequential ChIP assays.
MC7-L1 cells were transfected with pre-cut mPRB promoter and expression vectors for both
C/EBPβ-LIP and c-Jun. Chromatin was first precipitated with C/EBPβ antibody. Then,
precipitate product was equally subjected to either non-specific IgG antibody (B-ig), or C/EBPβ
(B-B), or c-jun (B-J). The supernatant was subjected to c-Jun antibody (supB-J), as indicated.
The order direction was similarly performed to collect chromatin for J-ig, J-B, and J-J. The DNA
from precipitated chromatin was subjected to quantify triplicate by qPCR. The value of qPCRamplified product was presented as the percentage of input. Results are the mean±S.E. from
three independent experiments. p was calculated for each sequential IP by Student’s T-Test in
comparison to its IgG control in the second IP (B-ig, or J-ig) . *, p<0.1; **, p<0.05; ***, p<0.01.

120

in a second immunoprecipitation suggesting that no significant amount of c-Jun-bound complex
remained in the supernatant after initial immunoprecipitation with anti-CEBP, and that no
significant amount of LIP-bound complex remained in the supernatant after immunoprecipitation
with anti-c-Jun. Importantly, after both initial immunoprecipitation with anti-C/EBP and anti-cJun, ChIP products were seen after the second immunoprecipitation with either anti-C/EBPβ or
anti-c-Jun. This confirms that LIP and c-Jun are simultaneously bound to minimal PRB promoter
region. These results support the model that LIP and c-Jun binding to the PR promoter are
mutually dependent.
In promoter-reporter assays, LIP was the most active C/EBPisoform in synergy with cJun; LAP2 showed synergy with c-Jun but at a lower magnitude, while LAP1 did show any
synergy with c-Jun (Wang et al., unpublished results; see Chapter 2). Having observed that the
synergy of LIP with c-Jun correlated with their mutual dependence for occupancy on the minimal
PR promoter (Figure 3.3B), we questioned whether differential occupancy among C/EBPβ
isoforms with and without c-Jun would correlate with their relative activities in transactivating
the PR promoter. To that end, we performed ChIP in cells transfected with the wild-type minimal
PR promoter-reporter and expression vectors for LAP1, LAP2, or LIP in the absence or presence
of an expression vector for c-Jun (Figure 3.6). The occupancy of singly expressed C/EBPβ
isoforms was low and little different from that observed in negative controls for LAP1, LAP2,
and LIP. The co-expression of c-Jun dramatically enhanced the occupancy of LIP and modestly
enhanced the occupancy of LAP2, while having little effect LAP1 occupancy. Similarly, the
occupancy of c-Jun was very low in single c-Jun overexpression, but slightly and dramatically
increased in the presence of LAP2 and LIP, respectively. The significantly enhanced occupancy

121

Figure 3.6: Differential occupancy of three C/EBPβ isoforms.
MC7-L1 cells were transfected with pre-cut mPRB promoter and either individual expression
vector, or combined vectors for C/EBPβ isoforms and c-Jun, or control expression vector (as
indicated). Chromatin was precipitated with C/EBPβ antibody or IgG. The DNA from
precipitated chromatin was subjected to quantify triplicate by qPCR either with a primer pair for
the promoter region (Black Colum) or with another primer pair for the control region (Grey
Colum). The value of qPCR-amplified product was calculated as the percentage of input, then
the fold enrichment was presented here as the ratio of amplified product with specific antibody to
that with nonspecific IgG antibody. Results are the mean±S.E. from three independent
experiments.MC7-L1 cells were transfected with pre-cut mPRB promoter and expression vectors
for proteins as indicated. Chromatin was precipitated with either C/EBPβ antibody or c-Jun
antibody. The fold enrichment was presented as the ratio of amplified product with specific
antibody to that with nonspecific IgG antibody. Results are the mean±S.E. from three
independent experiments. p was calculated for each IP with specific antibody by Student’s TTest in comparison to the co-transfection of LIP and c-Jun. *, p<0.1; **, p<0.05; ***, p<0.01.

122

observed with co-expression of LIP and c-Jun compared to that of either LAP1 or LAP2 with cJun correlated well with the synergistic transactivation effects seen in the promoter-reporter
assay.
Discussion
The important role for PR in mammary gland development and the correlation of PR
expression with the characteristics of various types of breast cancer require a comprehensive
study of how PR expression is regulated. Differential PR expression levels and isoform
expression between normal and breast cancer cells determine the action of the two PR isoforms
in these two different conditions. Regulated expression of PR is required for appropriate
mammary responsiveness to progesterone; thus, identification of the mechanisms that modulate
the effects of PR may offer new strategies in breast cancer treatment. Our previous work showed
that C/EBPβ and c-Jun synergistically activate the PR promoter (Wang et al., unpublished
results; see Chapter 2). The LIP isoform of C/EBP, generally viewed as an inhibitor of
C/EBP-mediated activation, was the most active isoform in this synergy, while LAP2 displayed
more modest activity and LAP1 showed little activity. This current study provides mechanistic
insight into how PR expression is regulated by C/EBPβ and c-Jun, and the mechanism of synergy
between LIP and c-Jun on the PR promoter. These results expand our current knowledge on PR
regulation.
C/EBP and AP-1 have been found to cooperate in the regulation of a number of genes,
dependent upon tissue and cell type (Cai et al., 2008; Fries et al., 2007; He et al., 2013; Hong et
al., 2011; Klampfer et al., 1994; Madireddi et al., 2000; Mietus-Snyder et al., 1998; Wang et al.,
2006; Zagariya et al., 1998). The data that we present here support a model of mutual
dependence of LIP, and presumably LAP2, and c-Jun for the transactivation of the PR promoter.
123

This mutual dependence appears to be based on each transcription factor requiring binding of the
other for its own efficient DNA binding. This is particularly highlighted by our finding with the
minimal PRB promoter that mutation of all C/EBP binding sites decreased both c-Jun’s
transactivation function and DNA occupancy, and vice versa for mutation of both AP-1 binding
sites. Furthermore, the coincident binding of both LIP and c-Jun is supported by sequential ChIP
studies.
Our data also demonstrate that the C/EBP binding sites are largely redundant. The
mutation of one or two of the C/EBP binding sites in the minimal PRB promoter is not sufficient
to impair the response to LIP and c-Jun. When the B1 C/EBP site by itself is retained, the
response to LIP and c-Jun co-expression is dramatically reduced, but synergy between the two
transcription factors is retained. It should be noted that when only one or two C/EBP sites are
mutated, retention of the B1 site confers no more activity than retention of any of the other sites.
Similarly, when the J2 site retained, there is a significant reduction in the response to LIP and cJun, but again synergy is retained. The B1 and J2 binding sites are the most effective C/EBP and
AP-1 sites, respectively. Also consistent with the redundancy of C/EBP sites, mutation of the
four C/EBP binding sites of the minimal PRB promoter in the context of the larger tandem PR
promoter, which contains additional putative C/EBP binding sites, decreases neither basal nor
LIP- and c-Jun-induced synergistic transactivation.
The physical interaction of C/EBPβ and c-Jun in vitro is mediated by bZIP regions of
both proteins (Hsu et al., 1994). To explore if these two factors can interact without DNA binding
in MC7-L1 cells, we performed co-immunoprecipitation assays. However, we did not observe
C/EBPβ and c-Jun co-immunoprecipitation in the MC7-L1 extracts. It is possible that the
interaction is not stable in vitro without binding to DNA, indicating the absolute requirement of
124

DNA binding for their function on the PR promoter. Similar result showed that C/EBPβ and cJun interact in vitro and in a DNA-dependent manner has been reported by using DNA binding
assays with oligonucleotides derived from the TNFα promoter (Zagariya et al., 1998).
Using a deletion approach, we demonstrated that the synergy of LIP and c-Jun was
observed in all of the truncated PRB promoter-reporters that we tested. This allowed
identification of a minimal region amenable to a mechanistic analysis. This synergy had more
significant impact on the promoter region associated with PRB isoform-specific expression than
on the promoter region associated with PRA expression. This finding of an important role for
C/EBP in PRB expression is consistent with the finding that C/EBPβ and PRB KO mice show
a similar defective phenotype in mammary gland development at pregnancy (Mulac-Jericevic et
al., 2003; Robinson et al., 1998; Seagroves et al., 1998) and that PRB and C/EBPβ co-localize in
the in vivo staining experiments, while staining for PRA and C/EBPβ are mutually exclusive
(Wang et al., unpublished data; see Chapter 2).
We found that the mouse -444bp/+63bp and -117bp/+63bp regions relative to the
transcription start site for PRB are robustly responsive to LIP and c-Jun, and are sufficient to
confer a synergistic response to LIP and c-Jun, similarly to tandem PR promoter. Moreover, in
this well-conserved and short region of the minimal PRB promoter, we found four putative
binding sites for C/EBPβ and two for c-Jun located near or overlapping to each other.
This region has variously been reported to be non-responsive or responsive to various
factors depending upon the cell and tissue type, as well as specific stimuli. Previous studies of
the mouse -368bp/+64bp region in rat primary granulosa cells (Sriraman et al., 2003) and the rat
-131bp/+65bp region, which shares high conservation with the mouse sequence, in MCF-7
human breast cancer cells (Kraus et al., 1993) did not find these sequences to be responsive in
125

promoter-reporter constructs. However, these earlier studies examined either the roles of
Sp1/Sp3, or the role of the estrogen receptor, respectively.
In this proximal promoter region, several other transcription factors and putative binding
sites have been reported to regulate PR expression, dependent upon the specific cell type and/or
inducing stimulus. In the mouse PR promoter, in the region surrounding the B1 site, NFY-B
binds to a CCAAT sequence within B1, GATA-4 to a GATA site, and Sp1/Sp3 to a GC box when
using granulosa cell extract (Clemens et al., 1998; Sriraman et al., 2003). Similarly, the rat and
human sequences spanning the CCAAT sequence within B1 and the GC box were bound by Sp1
only when using rat granulosa cell extract and MCF7 cell extract (Park-Sarge and Sarge, 1995;
Schultz et al., 2003; Tang et al., 2002). However, in the human PR gene, using human
osteosarcoma SAOS2 cell extract, HOXA5 was found to bind a site that overlaps the CCAAT
site in B1 (Raman et al., 2000). Mutation of the CCAAT site reduces cAMP-induced activity, but
not the basal activity of this promoter (Park-Sarge and Sarge, 1995). However, we found that
disruption of the CCAAT motif within the B1 site neither affected basal activity nor the response
to LIP and c-Jun. Moreover, in the human PR gene in the MCF-7 cell line, mutation of the Sp1
binding site adjacent to the B1 CCAAT motif disrupts Sp1 complex formation and decreases
transcription (Schultz et al., 2003). PR is clearly regulated in a tissue- and species-specific
manner with different promoter elements and their cis-binding factors active in differing
contexts. Presumably, this complexity allows regulation of PR expression under varying cellular
and physiological conditions in different tissues, requiring the tissue- and cell type-specific
interaction of multiple factors. Thus, the differential availability of specific factors determines
the precise level and mechanism of PR regulation.
The introduction of the two mutated AP-1 binding sites (J1 and J2) into the 3.2kb tandem
126

PR promoter dramatically decreased the response of the larger promoter to LIP and c-Jun. This
indicates that these two AP-1 sites are required for LIP and c-Jun induced transcription of both
the PRB and PRA promoters. This is quite interesting because these two sites are proximal to the
putative PRB promoter, yet can impact the activity of the downstream PRA promoter, suggesting
that these AP-1 binding sites are critical elements of both the PRB and PRA promoters. There are
no reports about AP-1 sites in minimal PRB promoter region (-117/+63) from any species. In
human the PR promoter, an AP-1 site at +90bp is required for estrogen responsiveness of PR
expression, but not for basal promoter activity (Petz et al., 2002). However, this site is not
conserved in mouse and rat PR promoters.
We show a requirement for DNA binding in the synergistic transactivation function of
LIP and c-Jun through A-C/EBP and A-Fos, dominant negative dimerization partners that
prevent C/EBP and AP-1, respectively, from binding to DNA. Moreover, A-Fos alone can
interfere with endogenous c-Jun activity to decrease basal promoter activity. However, A-C/EBP
alone was unable to down-regulate activity of both tandem PR promoter and 2x-C/EBP
promoter. This observation may be explained by inefficient formation of endogenous C/EBPβ
and A-C/EBP heterodimers due to existing dimers are stable and C/EBPβ protein turnover is
required to allow A-C/EBP entry into heterodimers. Indeed, formation of C/EBP dimmers
through their leucine zipper domains leads to stabilize and prevent their degradation (Hattori et
al., 2003).
Coupled with ChIP data on the mutant promoters that correlate decreased occupancy with
decreased transactivation, these lines of evidence reveal that the synergistic effect of LIP and cJun requires DNA binding of both factors to the promoter; lack of either factor’s binding blocks
the transactivation of the promoter.
127

In a transient transfection assay with the minimal PRB promoter-reporter, we found that
LIP and LAP2 synergize with c-Jun, while LAP1 does not. Moreover, LIP was the most active
C/EBP isoform, inducing 30-fold activation with c-Jun, while LAP2 induced the promoter 15fold with c-Jun. These results parallel the occupancy by these factors observed in a ChIP assay.
Co-expression of LIP and c-Jun gave the highest level of promoter occupancy, LAP2 and c-Jun
gave an intermediate level of occupancy, while LAP1 and c-Jun did not lead to a significant level
of occupancy for either factor.
Although LIP lacks a transactivation domain and is generally regarded as a transdominant
inhibitor of C/EBP activation, there are significant precedents for LIP having a positive
transcriptional function. LIP can participate in LPS-induced transcription of the IL-6 promoter in
a B lymphoblast cell line (Hu et al., 2000). It has also been ascribed unique properties in
transcriptional activation and interactions apart from those of the other C/EBP isoforms.LIP
specifically interacts with PRB to drive PRE-dependent promoters in endometrial stromal cells
(Christian et al., 2002), and with Runx2 to promote osteoblast differentiation (Hata et al., 2005).
LIP specifically up-regulates transcription of the CXCR4 gene through direct promoter binding
(Park et al., 2013). It is also important for induction of CDH3 in breast cancer cells, where
although all C/EBPisoforms activate the CDH3promoter, only LIP activation leads to increased
protein levels (Albergaria et al., 2010, 2013). Moreover, since PRB and LIP are both upregulated and co-localized in murine pregnancy, LIP is plausibly a major factor in driving PRB
transcription during this stage.

128

APPENDIX

129

4.5
4
3.5
3
2.5
2
1.5
1
0.5
0

5

50
ng c-Jun Expression
Vector

4
3
2
1

100

0

5

wt

50
ng LIP Expression
Vector

b1b2

4.5

b1b2

4

b3b4

4

b3b4

b1b3

3.5

b1b4

3

b2b3

2.5

b2b4

2
1.5

b2b3

2.5

b2b4

2
1.5

0.5

0.5

0

0
100

b1b4

3

1

50
ng c-Jun Expression Vector

b1b3

3.5

1

0

100

wt

4.5

Relative Luciferase Activity

Relative Luciferase Activity

wt
b1
b2
b3
b4

0
0

B

5

wt
b1
b2
b3
b4

Relative Luciferase Activity

Relative Luciferase Activity

A

0

50
ng LIP Expression Vector

100

Figure 3S.1.The effects of mutation of C/EBP and AP-1 sites on the promoter activity.
mPRB with single (A) or double (B) C/EBP mutated site. MC7-L1 cells were transfected with
100ng of wildtype mPRB or reporter promoters carrying mutations of indicated sites, plus either
an increasing amount (25, 50, 100ng) of c-Jun expression vector (as indicated) and 100ng of LIP
expression vector (Left Sides) or vice versa (Right Sides) The normalized luciferase activity of
pGL3 was subtracted from the normalized luciferase activity of each promoter. The value of
promoter activity of each promoter was presented as the relative activity after subtraction.
Results are the mean±S.E. from six (A and B) or three (C, D, and E) independent experiments;
each experiment was performed in duplicate.

130

Figure 3S.2. The effects of A-CEBP and A-Fos on 2x-CEBP and 2x-AP-1 promoters.
(A) MC7-L1 cells were transfected with 100ng of promoter reporter (as indicated), and 100ng of
either A-CEBP or A-Fos or control expression vector. The fold change in activity of promoter
was presented as the ratio of its normalized luciferase activity to the control transfection, which
was set as 1. (B) MC7-L1 cells were transfected with 100ng of either 2x-CEBP or 2x-AP-1
promoter reporters (as indicated), and an increasing amount of A-CEBP or A-Fos, respectively.
The fold change in activity of promoter was presented as the ratio of its normalized luciferase
activity to the control transfection, which was set as 1. (C) MC7-L1 cells were transfected with
100ng of either 2x-CEBP promoter and expression vectors for each C/EBPβ isoform in the
absence or presence of A-CEBP (Left Side) or 2x-AP-1 promoter and expression vector for c-Jun
in the presence or absence A-Fos (Right Side). The fold change in activity of each promoter was
presented as the ratio of its normalized luciferase activity to the control transfection, which was
set as 1.

131

REFERENCES

132

REFERENCES

Ahn, S., Olive, M., Aggarwal, S., Krylov, D., Ginty, D.D., and Vinson, C. (1998). A dominantnegative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent
transcription of c-fos. Molecular and Cellular Biology 18, 967–977.
Alani, R., Brown, P., Binétruy, B., Dosaka, H., Rosenberg, R.K., Angel, P., Karin, M., and
Birrer, M.J. (1991). The transactivating domain of the c-Jun proto-oncoprotein is required for
cotransformation of rat embryo cells. Molecular and Cellular Biology 11, 6286–6295.
Albergaria, A., Ribeiro, A.S., Pinho, S., Milanezi, F., Carneiro, V., Sousa, B., Sousa, S.,
Oliveira, C., Machado, J.C., Seruca, R., et al. (2010). ICI 182,780 induces P-cadherin
overexpression in breast cancer cells through chromatin remodelling at the promoter level: a role
for C/EBPβ in CDH3 gene activation. Human Molecular Genetics 19, 2554–2566.
Albergaria, A., Resende, C., Nobre, A.R., Ribeiro, A.S., Sousa, B., Machado, J.C., Seruca, R.,
Paredes, J., and Schmitt, F. (2013). CCAAT/enhancer binding protein β (C/EBPβ) isoforms as
transcriptional regulators of the pro-invasive CDH3/P-cadherin gene in human breast cancer
cells. PloS One 8, e55749.
Aupperlee, M.D., Smith, K.T., Kariagina, A., and Haslam, S.Z. (2005). Progesterone receptor
isoforms A and B: temporal and spatial differences in expression during murine mammary gland
development. Endocrinology 146, 3577–3588.
Brisken, C., and O’Malley, B. (2010). Hormone action in the mammary gland. Cold Spring
Harbor Perspectives in Biology 2, a003178.
Brown, P.H., Chen, T.K., and Birrer, M.J. (1994). Mechanism of action of a dominant-negative
mutant of c-Jun. Oncogene 9, 791–799.
Cai, D.H., Wang, D., Keefer, J., Yeamans, C., Hensley, K., and Friedman, A.D. (2008). C/EBP
α:AP-1 leucine zipper heterodimers bind novel DNA elements, activate the PU.1 promoter and
direct monocyte lineage commitment more potently than C/EBP α homodimers or AP-1.
Oncogene 27, 2772–2779.
Cartharius, K., Frech, K., Grote, K., Klocke, B., Haltmeier, M., Klingenhoff, A., Frisch, M.,
Bayerlein, M., and Werner, T. (2005). MatInspector and beyond: promoter analysis based on
transcription factor binding sites. Bioinformatics (Oxford, England) 21, 2933–2942.
Christian, M., Pohnke, Y., Kempf, R., Gellersen, B., and Brosens, J.J. (2002). Functional
association of PR and CCAAT/enhancer-binding protein β isoforms: promoter-dependent
cooperation between PR-B and liver-enriched inhibitory protein, or liver-enriched activatory
protein and PR-A in human endometrial stromal cells. Molecular Endocrinology (Baltimore,
Md.) 16, 141–154.
Clemens, J.W., Robker, R.L., Kraus, W.L., Katzenellenbogen, B.S., and Richards, J.S. (1998).
Hormone induction of progesterone receptor (PR) messenger ribonucleic acid and activation of
133

PR promoter regions in ovarian granulosa cells: evidence for a role of cyclic adenosine 3’,5'monophosphate but not estradiol. Molecular Endocrinology (Baltimore, Md.) 12, 1201–1214.
Cui, X., Zhang, P., Deng, W., Oesterreich, S., Lu, Y., Mills, G.B., and Lee, A. V (2003). Insulinlike growth factor-I inhibits progesterone receptor expression in breast cancer cells via the
phosphatidylinositol 3-kinase/Akt/mammalian target of rapamycin pathway: progesterone
receptor as a potential indicator of growth factor activity in brea. Molecular Endocrinology
(Baltimore, Md.) 17, 575–588.
Fries, F., Nazarenko, I., Hess, J., Claas, A., Angel, P., and Zöller, M. (2007). CEBPβ, JunD and
c-Jun contribute to the transcriptional activation of the metastasis-associated C4.4A gene.
International Journal of Cancer. Journal International Du Cancer 120, 2135–2147.
Hata, K., Nishimura, R., Ueda, M., Ikeda, F., Matsubara, T., Ichida, F., Hisada, K., Nokubi, T.,
Yamaguchi, A., and Yoneda, T. (2005). A CCAAT/enhancer binding protein β isoform, liverenriched inhibitory protein, regulates commitment of osteoblasts and adipocytes. Molecular and
Cellular Biology 25, 1971–1979.
Hattori, T., Ohoka, N., Inoue, Y., Hayashi, H., and Onozaki, K. (2003). C/EBP family
transcription factors are degraded by the proteasome but stabilized by forming dimer. Oncogene
22, 1273–1280.
He, S., Minton, A.Z., Ma, H.-Y., Stankowska, D.L., Sun, X., and Krishnamoorthy, R.R. (2013).
Involvement of AP-1 and C/EBPβ in upregulation of endothelin B (ETB) receptor expression in
a rodent model of glaucoma. PloS One 8, e79183.
Heinemeyer, T., Wingender, E., Reuter, I., Hermjakob, H., Kel, A.E., Kel, O. V, Ignatieva, E. V,
Ananko, E.A., Podkolodnaya, O.A., Kolpakov, F.A., et al. (1998). Databases on transcriptional
regulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Research 26, 362–367.
Hong, S., Skaist, A.M., Wheelan, S.J., and Friedman, A.D. (2011). AP-1 protein induction
during monopoiesis favors C/EBP: AP-1 heterodimers over C/EBP homodimerization and
stimulates FosB transcription. Journal of Leukocyte Biology 90, 643–651.
Hopp, T.A. (2004). Breast Cancer Patients with Progesterone Receptor PR-A-Rich Tumors Have
Poorer Disease-Free Survival Rates. Clinical Cancer Research 10, 2751–2760.
Hsu, W.E.I., Kerppola, T.K.O.M.K., Chen, P.L., Curran, T.O.M., and Chen-Kiang, S. (1994).
Fos and Jun repress transcription activation by NF-IL6 through association at the basic zipper
region. Molecular and Cellular Biology 14, 268–276.
Hu, H.M., Tian, Q., Baer, M., Spooner, C.J., Williams, S.C., Johnson, P.F., and Schwartz, R.C.
(2000). The C/EBP bZIP domain can mediate lipopolysaccharide induction of the
proinflammatory cytokines interleukin-6 and monocyte chemoattractant protein-1. The Journal
of Biological Chemistry 275, 16373–16381.
Jacobsen, B.M., and Horwitz, K.B. (2012). Progesterone receptors, their isoforms and
progesterone regulated transcription. Molecular and Cellular Endocrinology 357, 18–29.
134

Klampfer, L., Lee, T.H.A.E.H.O., Hsu, W.E.I., Vilcek, J.A.N., and Chen-Kiang, S. (1994). NFIL6 and AP-1 cooperatively modulate the activation of the TSG-6 gene by tumor necrosis factor
α and interleukin-1. Molecular and Cellular Biology 14, 6561–6569.
Korach, K.S. (2000). Estrogen receptor knock-out mice: molecular and endocrine phenotypes.
Journal of the Society for Gynecologic Investigation 7, S16–7.
Kraus, W.L., Montano, M.M., and Katzenellenbogen, B.S. (1993). Cloning of the rat
progesterone receptor gene 5’-region and identification of two functionally distinct promoters.
Molecular Endocrinology (Baltimore, Md.) 7, 1603–1616.
Lydon, J.P., DeMayo, F.J., Funk, C.R., Mani, S.K., Hughes, A.R., Montgomery, C.A.,
Shyamala, G., Conneely, O.M., and O’Malley, B.W. (1995). Mice lacking progesterone receptor
exhibit pleiotropic reproductive abnormalities. Genes & Development 9, 2266–2278.
Madireddi, M.T., Dent, P., and Fisher, P.B. (2000). AP-1 and C/EBP transcription factors
contribute to mda-7 gene promoter activity during human melanoma differentiation. Journal of
Cellular Physiology 185, 36–46.
Mietus-Snyder, M., Glass, C.K., and Pitas, R.E. (1998). Transcriptional activation of scavenger
receptor expression in human smooth muscle cells requires AP-1/c-Jun and C/EBPβ: both AP-1
binding and JNK activation are induced by phorbol esters and oxidative stress. Arteriosclerosis,
Thrombosis, and Vascular Biology 18, 1440–1449.
Mote, P. a, Arnett-Mansfield, R.L., Gava, N., DeFazio, A., Mulac-Jericevic, B., Conneely, O.M.,
and Clarke, C.L. (2006). Overlapping and distinct expression of progesterone receptors A and B
in mouse uterus and mammary gland during the estrous cycle. Endocrinology 147, 5503–5512.
Mulac-Jericevic, B., Lydon, J.P., DeMayo, F.J., and Conneely, O.M. (2003). Defective
mammary gland morphogenesis in mice lacking the progesterone receptor B isoform.
Proceedings of the National Academy of Sciences of the United States of America 100, 9744–
9749.
Obr, A.E., and Edwards, D.P. (2012). The biology of progesterone receptor in the normal
mammary gland and in breast cancer. Molecular and Cellular Endocrinology 357, 4–17.
Park, B.-H., Kook, S., Lee, S., Jeong, J.-H., Brufsky, A., and Lee, B.-C. (2013). An isoform of
C/EBPβ, LIP, regulates expression of the chemokine receptor CXCR4 and modulates breast
cancer cell migration. The Journal of Biological Chemistry 288, 28656–28667.
Park-Sarge, O.K., and Sarge, K.D. (1995). Cis-regulatory elements conferring cyclic 3’,5'adenosine monophosphate responsiveness of the progesterone receptor gene in transfected rat
granulosa cells. Endocrinology 136, 5430–5437.
Petz, L.N., Ziegler, Y.S., Loven, M. a, and Nardulli, A.M. (2002). Estrogen receptor α and
activating protein-1 mediate estrogen responsiveness of the progesterone receptor gene in MCF7 breast cancer cells. Endocrinology 143, 4583–4591.

135

Petz, L.N., Ziegler, Y.S., Schultz, J.R., and Nardulli, A.M. (2004). Fos and Jun inhibit estrogeninduced transcription of the human progesterone receptor gene through an activator protein-1
site. Molecular Endocrinology (Baltimore, Md.) 18, 521–532.
Quandt, K., Frech, K., Karas, H., Wingender, E., and Werner, T. (1995). MatInd and
MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide
sequence data. Nucleic Acids Research 23, 4878–4884.
Raman, V., Tamori, a, Vali, M., Zeller, K., Korz, D., and Sukumar, S. (2000). HOXA5 regulates
expression of the progesterone receptor. The Journal of Biological Chemistry 275, 26551–26555.
Robinson, G.W., Johnson, P.F., Hennighausen, L., and Sterneck, E. (1998). The C/EBPβ
transcription factor regulates epithelial cell proliferation and differentiation in the mammary
gland. Genes & Development 12, 1907–1916.
Schultz, J.R., Petz, L.N., and Nardulli, A.M. (2003). Estrogen receptor α and Sp1 regulate
progesterone receptor gene expression. Molecular and Cellular Endocrinology 201, 165–175.
Seagroves, T.N., Krnacik, S., Raught, B., Gay, J., Burgess-Beusse, B., Darlington, G.J., and
Rosen, J.M. (1998). C/EBPβ, but not C/EBPα, is essential for ductal morphogenesis,
lobuloalveolar proliferation, and functional differentiation in the mouse mammary gland. Genes
& Development 12, 1917–1928.
Shen, Q., Zhang, Y., Uray, I.P., Hill, J.L., Kim, H.-T., Lu, C., Young, M.R., Gunther, E.J.,
Hilsenbeck, S.G., Chodosh, L.A., et al. (2006). The AP-1 transcription factor regulates postnatal
mammary gland development. Developmental Biology 295, 589–603.
Sriraman, V., Sharma, S.C., and Richards, J.S. (2003). Transactivation of the progesterone
receptor gene in granulosa cells: evidence that Sp1/Sp3 binding sites in the proximal promoter
play a key role in luteinizing hormone inducibility. Molecular Endocrinology (Baltimore, Md.)
17, 436–449.
Tang, M., Mazella, J., Gao, J., and Tseng, L. (2002). Progesterone receptor activates its promoter
activity in human endometrial stromal cells. Molecular and Cellular Endocrinology 192, 45–53.
Tominaga, H., Maeda, S., Hayashi, M., Takeda, S., Akira, S., Komiya, S., Nakamura, T.,
Akiyama, H., and Imamura, T. (2008). CCAAT/enhancer-binding protein β promotes osteoblast
differentiation by enhancing Runx2 activity with ATF4. Molecular Biology of the Cell 19, 5373–
5386.
Wang, J.-M., Ko, C.-Y., Chen, L.-C., Wang, W.-L., and Chang, W.-C. (2006). Functional role of
NF-IL6β and its sumoylation and acetylation modifications in promoter activation of
cyclooxygenase 2 gene. Nucleic Acids Research 34, 217–231.
Zagariya, A., Mungre, S., Lovis, R., Birrer, M., Ness, S., Thimmapaya, B., and Pope, R. (1998).
Tumor necrosis factor α gene regulation: enhancement of C/EBPβ-induced activation by c-Jun.
Molecular and Cellular Biology 18, 2815–2824.

136

CHAPTER 4

CONCLUSION AND FUTURE RESEARCH

137

We demonstrated that C/EBPβ and c-Jun can transactivate PR promoter activity, both
individually and in synergy. The synergy between C/EBP and c-Jun shows isoform specificity
with LIP being particularly active with c-Jun, LAP2 less so, and LAP1 inactive. LIP has been
found to be the most abundant isoform of C/EBP at pregnancy stage. However, c-Jun
expression level and activity at this stage should be further investigated by using mammary gland
extracts at pregnancy to perform western blots with antibody to c-Jun and EMSA with AP-1
probe.
Our current studies have used transient co-transfection of a PR promoter-reporter with
expression vectors; a new experimental model in which C/EBPβ and c-Jun are overexpressed in
a stable manner to better allow examination of regulation of the endogenous PR gene. C/EBPβ
co-localizes with PRB in mammary epithelial cells at pregnancy, while it is mutually exclusive
of PRA in the virgin gland. The PRB promoter was more responsive than the PRA promoter to
transient co-expression of C/EBPβ and c-Jun. Moreover, differential function of each C/EBPβ
isoform has been found in reporter assays with transfected PR promoter plasmids. LIP
expression increases the ratio of PRB transcripts to total PR transcripts from the transfected
tandem PR promoter-reporter. We will further confirm our current conclusions that LIP
transactivates the PRB promoter by utilizing stable expression of each C/EBPβ isoform and cJun. This model will provide insight into the physiologic roles of C/EBPβ and c-Jun on
activating specific endogenous PR isoform mRNAs and proteins.
Since we were unable to show binding of C/EBPβ and c-Jun on endogenous PR gene in
transient transfection assay, where only a small portion of cells expressed the expression vectors,
ChIP assays on the endogenous PR gene from stable transfected cells may be more successful for
investigating the occupancy of each C/EBPβ isoform in the presence or absence of c-Jun, and
vice versa, on promoter-specific PR gene regions. We expect to confirm the result observed with
minmal PRB promoter model that LIP requires c-Jun for its binding, and vice versa.
Recent preliminary data showed that trichostatin (TSA), adeacetylase inhibitor, could
enhance basal promoter activity (Figure 4.1.A). Moreover, overexpression of p300, an
acetyltransferase, also increased LIP and c-Jun- mediated transactivation of PR promoter (Figure
4.1.B). We further study the involvement of p300 on PR gene regulation in the following
138

experiments. How p300 alone and in combination of LIP and/or can affect on PR promoter
activity, and on endogenous PR expression. To evaluate if acetylation of C/EBPβ and/or c-Jun
modulates their activity, acetylation level of C/EBPβ and/or c-Jun will be increased under
overexpression of p300. However, if acetylation of these factors showed unaffected by p300,
one explanation is that p300 would facilitate the recruitment of LIP and c-Jun to the promoter if
enhanced occupancy of LIP and c-Jun on endogenous PR promoter will be confirmed in the
presence of p300. The physical interaction of p300 will be determined by co-IP to further support
for the hypothesis of transactivational complex formation among these three proteins. If we fail
to show that the transactivational role of p300 is mediated through LIP and c-Jun, p300 may
interact with other factors and induce an open chromatin state of PR promoter.

139

A

B

Figure 4.1. The effects of TSA and HAT on PR promoter activity. A) MC7-L1 cells were
transfected with 100ng of tandem PR promoter in the presence or absence of TSA. The nontreated activity was normalized to a value of 1. B) MC7-L1 cells were co-transfected with 100ng
of tandem PR promoter, 100ng of each expression vector for LIP and c-Jun, plus an increasing
amount (5, 25, 100ng) of p300 expression vector. The promoter activity in the co-overexpression
of LIP and c-Jun without p300 was set as 1.

140