VIN

1w.;‘.: .U

an .31.
is. in
. mfifid

 

 

 

 

y. . sighswtfrfit.
1.... nutsxfw. zit

 
 

 

A u 21.54 luv».
" 11-.

    

.( § .1}. 2:11..
.7.- v in rm...” 9.1:?” . 7 4.4.. ....\’...I.~.

 

 

?
Evan”).

. y

 

 

 

Sis.

 

 

‘ x.
liis ,

bflrl.

 

THE3S

r

“rpqo
"C: r ,x g,‘ -
) w J ’ 'J ’

 

 

 

LIBRARY . _ .
Mical'lgfenrsitfe Th's'tiéiiiegnfiugéatthe
L

 

Phagocytosis of Mycobacterium Paratubemulosis Causes
Unique Gene Expression Profiles in Bovine Macrophage Cells

presented by

Brian C. Tooker

has been accepted towards fulfillment
of the requirements for the

Master of degree in

Animal Science
Science

 

(32% W-

Major Professor’s Signature
/07 - /o? 37003

Date

MSU is an Affirmative Action/Equal Opportunity Institution

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

@512 r~
AY 1 o 2068’

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 c:/ClRC/DateDue.p65—p. 15

 

PHAGOCYTOSIS OF M YCOBAC TERI UM PARA TUBERCULOSIS CAUSES
UNIQUE GENE EXPRESSION PROFILES IN BOVINE MACROPHAGE CELLS

By

Brian C. Tooker

A THESIS

Submitted to
Michigan State University
In partial fulfillment of the requirements
For the degree of

MASTER OF SCIENCE

Department of Animal Science

2003

ABSTRACT

PHAGOCYTOSIS OF M YCOBAC TERI UM PARA TUBERCULOSIS CAUSES
UNIQUE GENE EXPRESSION PROFILES IN BOVINE MACROPHAGE CELLS

By

Brian C. Tooker

Mycobacterium avium subspecies paratuberculosis (M. paratuberculosis) is a
facultative intracellular bacterium with the ability to survive and proliferate inside the
phagocytic vesicles of macrophage cells. How M. paratuberculosis is able to survive in
this hostile host environment is not well understood. In this study we hypothesized that
phagocytosis of M. paratuberculosis would uniquely alter macrophage gene expression
patterns relative to patterns observed following the phagocytosis of E. coli or latex beads
and that these unique changes could contribute to the survival of M. paratuberculosis.

Using the techniques of DDRT-PCR and Northern blot hybridization we have
begun to test this hypothesis by comparing patterns in bovine macrophage cell gene
expression during no phagocytosis and phagocytosis of E. coli, M. paratuberculosis and
latex beads. These combined analysis revealed that the Nucleolin Related Protein gene
was not activated in macrophage cells following phagocytosis of M. paratuberculosis but
was activated at high levels following phagocytosis of either E. coli or latex beads.
Another gene, NADPH Dehydrogenase subunit 1 (N D1), was activated only at low levels
following M. paratuberculosis phagocytosis but was strongly induced following
phagocytosis of both E. coli and latex beads. Both of these genes have hypothesized
roles in bacterial destruction and the failure to induce gene expression following

phagocytosis may promote survival of M. paratuberculosis within bovine macrophages.

ACKNOWLEDGEMENTS

Performing graduate level research pursuant to a degree in any field in this day
and age is not a one-person operation. There are several people that helped me through
this difficult time and I would like to thank them for making my graduate experience
successful, rich and above all enjoyable.

First, thank you to everyone in the Molecular Pathogenesis and Immunogenetics
Laboratories at Michigan State University, without your constant support and help the
completion of this research project would have been much more difficult and no where
near as enjoyable. Thanks to Carolyn Cassar and Sally Madsen for their help with
DDRT-PCR protocols, Matt Coussens for performing DNA sequencing of my many
amplicons, Amy Abouzied for her help with RNA collection and my numerous Northern
blot hybridizations and Chris Colvin for the many, many things he has done to help me
out. I would like to give a special thank you to Dr. Patty Weber whose close proximity
made her a possibly unwitting target of my many questions and concerns.

I would truly like to show my appreciation to my graduate advisory committee of
Drs. Paul Coussens, Jeanne Burton, Phil Kierszenbaum, and Steve Bolin who have taken
time out of their busy schedules over the past two years to help me with this project.
Their constant questions, critiques, rewrites and advice have been invaluable to my work.

To my major professor Paul Coussens, thank you for taking a very big chance.
Thank you for seeing something in me that you thought would flourish with graduate
school. Thank you for allowing me the freedom to explore my interests and abilities in

your laboratory. I hope that I made you proud.

iii

I wish to thank my mother, father and sister. They have stayed behind me
through my entire life and especially during my graduate school experience. I also thank
them for their attempts at staying awake when I answer their question, “So, what did you
do at work today”.

Most importantly, I must thank Nicole, Kris and Aaron. Over the last decade you
have all been my constant, my friends. I thank you for your sympathetic ears. I thank
you for your inspiration. I thank you for your love. Your support has made it possible
for me to be able to understand and define myself, to grow as a person. For that gift,

words are just not enough.

iv

TABLE OF CONTENTS

LIST OF TABLES ............................................................................... viii
LIST OF FIGURES ............................................................................... ix
LIST OF ABBEVIATIONS ..................................................................... xi
CHAPTER ONE
A Review of Literature ............................................................................. l
I. Mycobacteria, M. paratuberculosis and Johne’s Disease ................................... I
A. An Overview of Mycobacteria and M. paratuberculosis ......................... 1
B. General Overview of the Disease ..................................................... 2
ll. Bacterial Survival ................................................................................ 3
A. The Endocytic Pathway ................................................................. 3
B. Bacterial Survival Strategies ........................................................... 7
C. Mycobacteria] Survival Within Macrophages ..................................... l 1
CHAPTER TWO
Survival Tactics of M. paratuberculosis in Bovine Macrophage Cells ..................... l8
1. Abstract ........................................................................................... 19
11. Introduction....................... ................................................................................. 20
Ill. Material and Methods ........................................................................ 23
A. Cell Culture ............................................................................ 23
B. Phagocytosis and RNA Collection in BovMac Cells ............................. 23
C. Differential Display RT-PCR ....................................................... 24
D. Excision and Re-amplification of Suspect cDNA amplicons ................... 25

E. Dot-Blot Hybridization ............................................................... 26

F. Northern Blot Analysis ............................................................... 27

III. Results .......................................................................................... 28
A. Identification of Differentially Expressed Transcripts in Bovine

Macrophage Cells ..................................................................... 28

B. Validation of Differential Gene Expression by Dot-Blot Hybridization ....... 29

C. Confirmation of Differential Expression by Northern Blot Hybridization. . .. 30

IV. Discussion ..................................................................................... 31
CHAPTER THREE

The Effect of Different Phagocytic Targets on Bovine Macrophage Gene Expression .. 37

I. Introduction ..................................................................................... 37

11. Methods and Materials ......................................................................... 40

A. Cell Culture ........................................................................... 40

B. Bacterial Survival ..................................................................... 40

C. Cloning of Amplicons ............................................................... 44

D. DNA Sequencing ..................................................................... 46

E. Sequence Analysis and Identification .............................................. 48

F. Northern Blot Hybridizations ........................................................ 48

IV. Results .......................................................................................... 50

A. Bacterial Survival ..................................................................... 50

B. DNA Sequencing, Sequence Analysis and Identification ........................ 51

C. Northern Blot Hybridization ......................................................... 53

V. Discussion ..................................................................................... 55
CHAPTER FOUR

vi

General Conclusions and Discussion ............................................................ 70

CHAPTER FIVE

Future Research .................................................................................... 74
APPENDIX ONE

Chapter Two Publication Permission .............................................................. 77
APPENDIX TWO

DNA Sequence Information ...................................................................... 79
APPENDIX THREE

M. paratuberculosis Ingestion and Survival in BOMAC Cells ............................... 82

vii

LIST OF TABLES

CHAPTER ONE

Table 1.1 - Intracellular Bacteria Survival Strategies ......................................... 16
Table 1.2 - Survival Strategies of Mycobacteria .............................................. 17
CHAPTER THREE

Table 3.1 — Real Time PCR Primers ............................................................ 67
Table 3.2 - Quantification of E. coli Survival Using Real Time PCR ...................... 67

Table 3.3 - Quantification of M. paratuberculosis Survival Using Real Time PCR 68

Table 3.4 - Northern Blot Hybridization Information Table ................................. 68

Table 3.5 - DNA Sequence BLAST Analysis .................................................. 69

viii

LIST OF FIGURES

CHAPTER ONE

Figure 1.1 — Antigen Presentation Following Phagocytosis ................................. 15
CHAPTER TWO

Figure 2.1 — The Endocytic Pathway (The Fusion Model) .................................... 34
Figure 2.2 — DDRT-PCR Suspect Amplicons ................................................. 35
Figure 2.3 - Northern Blot Hybridization with Amplicon Probes ........................... 36
CHAPTER THREE

Figure 3.1 — Bacterial Survival Quantified by Real Time PCR .............................. 62
Figure 3.2 — Survival of E. coli in BOMAC Cells ............................................. 63
Figure 3.3 — Survival of M. paratuberculosis in BOMAC Cells ............................ 64
Figure 3.4 - Northern Blot Hybridization Utilizing the Cloned Amplicon 3-1-4 ......... 65
Figure 3.5 - Northern Blot Hybridization Utilizing the Cloned Amplicon 5-2-10 ....... 65
Figure 3.6 - Northern Blot Hybridization Utilizing the Cloned Amplicon 5-4-2 ......... 66
Figure 3.7 - Northern Blot Hybridization Utilizing the Cloned Amplicon 4-1-6 . . . .. 66

ix

APPENDIX THREE

Figure A3.1 - Survival of M. paratuberculosis within BOMAC Cells ..................... 82

Figure A3.2 - Survial of M. paratuberculosis strains within BOMAC and Monocyte
Derived Macrophages (MDM) .................................................................. 83

LIST OF ABBREVIATIONS

ADCC = Antibody Dependant Cellular Cytotoxicity

AICC = Antibody Independent Cellular Cytotoxicity

AP = Anchored Primer

APC = Antigen Presenting Cell

ARP = Anchored Random Primer

ATCC = American Type Culture Collection

BCG = Bacillus Calmette-Guerin

BLAST = Basic Local Alignment Search Tool

BLASTX = Basic Local Alignment Search Tool Against Protein Databases
BRESI-l = Breast Epithelial Stromal Interaction 1

BSA = Bovine Serum Albumin

CD = Cluster of Differentiation

cDNA = Copy Dioxyribose Nucleic Acid

CMI = Cell Mediated Immunity

CR = Complement Receptor

ddH20 = Double Distilled Water

DDRT-PCR = Differential Display Reverse Transcriptase Polymerase Chain Reaction
DHT = Delayed Type Hypersensitivity

DNA = Deoxyribose Nucleic Acid

DTT = Dithiothreitol

EDTA = Ethylenediamine-N,N,N',N'-Tetraacetic Acid

xi

EtOH = Ethanol

FBS = Fetal Bovine Serum

FR = Fibronectin Receptor

GAPDH = Glyceraldehyde-3-Phosphate Dehydrogenase
GM-CSF = Granulocyte-Macrophage Colony-Stimulating Factor
[L = Interleukin

INF = Interferon

iNOS = Inducible Nitrous Oxide Species

IPT G = lsopropylthio-B-Galactoside

IS = Insertion Sequences

KO = Knock Out

LAM = Lipoarabinomannan

LAMP = Lysosomal Associated Macrophage Protein
LB = Luria Broth

LPG = Lipophosphoglycan

LPS = Lipopolysaccharide

MetOH = Methanol

MHC = Major Histocompatibility Complex

MR = Mannose Receptor

NADPH = Nicotinarnide Adenine Dinucleotide Phosphate Hydrogen
NaOAc = Sodium Acetate

N0 = Nitrous Oxide

NRP = Nucleolin-Related Protein

xii

NSF = N-ethylmaleimide-sensitive factor

PBMC = Peripheral Blood Mononuclear Cell

PBS = Phosphate Buffered Saline

PCR = Polymerase Chain Reaction

RNA = Ribose Nucleic Acid

RNI = Related Nitrogen Intermediates

ROS = Reactive Oxygen Species

SDS = Sodium Dodecyl Sulfate

SNAP = N-ethylmaleimide-Sensitive Factor Attachment Protein

SSC = Sodium Citrate and Sodium Chloride

tBLASTx = Basic Local Alignment Search Tool for Back Translated Protein Databases
TCR = T-cell Receptor

TE = Tris-EDTA

TGF = Transforming Growth Factor

TLR = Toll-like Receptor

TNF = Tumor Necrosis Factor

t-SNARE = Target N-ethylmaleimide-Sensitive Factor Attachment Protein Receptor
v-SNARE = Vesicle N-ethylmaleimide-Sensitive Factor Attachment Protein Receptor

X-gal = 5-Bromo-4-Chloro-3-Indolyl-B-D-Galactoside

xiii

CHAPTER ONE

A Review of Literature

1. Mycobacteria, M. paratuberculosis and Johne’s Disease
A. An Overview of Mycobacteria_ and M. paratuberculosis

Intracellular Mycobacteria] pathogens such as Mycobacterium bovis (bovine
tuberculosis), Mycobacterium leprae (human leprosy), Mycobacterium tuberculosis
(human tuberculosis) and Mycobacterium avium (common infectious agent in birds and
mammals) are all closely related to the pathogenic Mycobacterium avium subspecies
paratuberculosis (M. paratuberculosis). M. paratuberculosis infection was first clearly
described in 1895 as “a peculiar case of tuberculosis” (Clarke et al., 1997) in a cow with
chronic enteritis, diffuse thickening and corrugation of the intestinal mucosa and with
acid-fast bacilli in intestinal lesions. As reviewed by Clarke et al. this original diagnosis,
made over one hundred years ago by Johne and Frothingham, identified yet another
Mycobacteria associated with disease (Clarke et al., 1997).

Mycobacteria in general are acid-fast, weakly Gram-positive bacilli 0.5-1.5um in
length, and require an organic source of iron to survive. M. paratuberculosis can be
differentiated phenotypically from other Mycobacteria by an extremely slow growth in
culture (up to 16 weeks) and a requirement for addition of Mycobactin J to the grth
media. Genotypically M. paratuberculosis can be distinguished from its closest relative
M. avium subspecies avium (M avium) by DNA sequence. M. avium and M.

paratuberculosis share a 99.6% similarity in DNA sequence. One marker often used by

researchers is presence of insertion sequences known as 18900 in the M. paratuberculosis
genome. As stated above many Mycobacteria are pathogenic for humans, birds and
mammals. M. paratuberculosis has been described as a facultative intracellular pathogen
of bovine macrophages and as the causative agent of an inflammatory bowel disease now
known as Johne’s disease (Clarke et al., 1997).
B. Generg Overview of the Disease

Chronic weight loss, incurable diarrhea and eventual death are indicative of
Johne’s disease in cattle. The bacterium causes chronic granulomatous enterocolitis and
regional lymphangitis and lympadenitis in cattle leading to typical clinical signs of
progressive weight loss and eventual death, presumably from failure to absorb nutrients.
M. paratuberculosis causes a persistent infection in intestinal macrophages leading to a
local inflammatory immune response in infected hosts. Chronic inflammation leads to
formation of granulomatous lesions at sites of infection and may play a role in the
bacterium’s ability to persist within host tissues by excluding fresh immune cells from
sites of infection. Chronic inflammation may also be responsible for the majority of
localized damage observed in chronic M. paratuberculosis infections. Clinically infected
cattle shed the bacteria through milk, semen and feces. Bacterial shedding in feces is of
principal importance since it allows passage to offspring and herd mates via the fecal to
oral route.

Based on isolation and growth of the bacterium shed in feces of infected cattle
(gold standard), prevalence of Johne’s disease in dairy herds has been estimated from as
low as 15-18% in parts of the United States and the United Kingdom (Braun RK, 1990)

to as high as 54% in some regions of the United States (Johnson-Ifearulundu Y, 1999).

Within dairy herds that have tested positive for Johne’s disease it is not uncommon to
observe individual infection rates of 7-20%. Infection rates within infected herds will
increase through horizontal transfer as healthy calves are exposed to fecal contamination
and infected colostrum. Another cause for concern in the spread of Johne’s disease is
that M. paratuberculosis has been reported to infect fetuses in utero (Doyle et al., 1958;
Seitz et al., 1989; Sweeney et al., 1992) when the dam is in either subclinical or clinical
stages of disease.

Infection with M. paratuberculosis usually occurs within the first 6 months of a
calt‘s life when it’s immune system is not prepared to respond to Mycobacterial
infections (Payne et al., 1961; Rankin et al., 1961). Exactly how the immune system
becomes prepared for a Mycobacterial infection is not yet known, but may involve
balancing between various T cell subsets and tissue distribution of immune cells. Due to
the limits of specificity and sensitivity in commercially available tests that monitor
peripheral blood cytokine profiles for diagnosis of Johne’s disease, M. paratuberculosis
infections can go undetected until there are observable signs of clinical disease. A long
subclinical phase (up to 3 years) of M paratuberculosis infection also makes the task of
tracking and controlling Johne’s disease extremely problematic.

[1. Bacterial Survival
A. The Endocytic Pathway

Macrophages and other APC employ three main strategies for destruction of
invading bacteria. All three of them are represented in the endocytic pathway [see Figure
2.1]. First, APCs can acidify the environment where bacteria are replicating. Secondly,

the cells can sequester bacteria away from essential nutrients such as iron. Lastly, APCs

can fuse phagosomes containing ingested bacteria with lysosomes containing lysozyme
and other killing enzymes thus exposing the bacteria to potent anti-bacterial molecules.
Endocytosis, pinocytosis, macropinocytosis and the receptor-mediated endocytotic
process called phagocytosis are all used by APC to envelope target bacteria.

Since phagocytosis is a receptor-mediated process, it is the most specific ingestion
method available to APCs. Receptors used for phagocytosis of pathogenic bacteria are
the mannose receptors (MR) (Astarie-Dequeker et al., 1999; Schlesinger et al., 1993), the
complement receptors CR1, CR3 and CR4 (Schlesinger and Horwitz, 1991), Fc-y
receptors (Ernst et al., 1999), carbohydrate receptors (Ernst et al., 1999), fibronectin
receptors (FR) (El-Etr and Cirillo, 2001) and Toll-like receptors (TLR) TLR4 and TLR2
(Means etal., 1999). All of these membrane bound receptors on APCs can bind pattern
recognition domains on bacteria and initiate the process of phagocytosis. After binding
bacteria through one of these receptors, APCs form an invagination or pit that surrounds
the bacteria until it is completely sequestered from the extra-cellular space. Membrane
bound vesicles that surround ingested bacteria are known as phagosomes.

Following internalization, phagosomes undergo a stepwise process of maturation
that allows the original phagosome structure to fuse with important endocytic and
exocytic vesicles. The purpose of these fusion events is ultimately to degrade
phagocytozed targets into small peptide and lipid components for presentation as antigens
in the context of major histocompatibility complex, MHC II (in the case of peptides) or
CD1 (in the case of lipids). This presentation of bacterial antigens in the context of MHC
II or CD1 will activate T cells to release pro-inflammatory cytokines (which can increase

bacterial killing) or B cell expansion in an antigen specific fashion (which will increase

bacterial destruction through opsinization). The final stage in pathogen destruction
occurs when late maturation vesicles (late phagosomes) fuse with lysosomes to create a
phagolysosome, where bacteria are fully digested by antimicrobial agents and lysosomal
enzymes.

Processing through the endocytic pathway has been hypothesized to occur via
multiple fusion events with other vesicles (endosomes) in a process termed the “kiss and
run” hypothesis [see Figure 2.1] (Duclos et al., 2000). The specificity of intracellular
trafficking and fusion events are conferred by integral membrane proteins on both the
phagosomes and endosomes, termed v-SNAREs and t-SNAREs for vesicle- and target-
specific soluble-N-ethylmaleimide-sensitive factor (N SF)-attachment protein (SNAP),
respectively. Binding of t-SNAREs with v-SNAREs from opposing vesicle membrane
faces causes vesicles to be brought into close proximity to one another and ultimately to
fuse (Rothman and Wieland, 1996). Several other host proteins are also involved in
regulating vesicle trafficking, including the Rab family of small GTP-binding proteins
with intrinsic GTPase activity (Pfeffer et al., 1994). The Rab family of proteins also
figures prominently in another proposed model of endosome maturation known as the
“fusion” model.

In the fusion model various Rab proteins are brought to maturing phagosomes via
pre-packed endocytic vesicles (Novick and Brennwald, 1993). Acquisition of Rab
proteins is said to “mature” phagosomes. As phagosomes mature, their ability to degrade
bacteria also increases. It has also been theorized that vesicle maturation through the
endocytic pathway may occur through a sequential acquisition process (Via etal., 1997)

where endosomes must acquire Rab5 if they are to acquire Rab7. In this model,

cytoplasmic proteins, including Rab5 and Rab7, are recruited to the maturing phagosome.
Rab protein recruitment brings about structural alteration or enhanced expression of
receptor molecules on the surface of phagosomes, leading to a step-wise fusion process.

Regardless of the way phagosomes acquire Rab proteins, they appear to be
necessary for vesicle maturation through the endocytic pathway (Pfeffer et al., 1994) and
are believed to positively or negatively regulate the rates of SNARE complex assembly
between endosomes (N ovick and Zerial, 1997; Schimmoller et al., 1998). There are more
than thirty known members of the Rab family (Lutcke et al., 1994; Zerial and Stenmark,
1993), including Rab5 and Rab7, which appear to control major fusion steps in the
endocytic pathway [see Figure 2.1]. Both Rab5 and Rab7 have intrinsic GTPase
activities similar to the Ras super-family of proteins (Chavrier et al., 1990; Simons and
Zerial, 1993) and are most likely involved in phosphorylation/de-phosphorylation events
related to membrane fusion. The absence of Rab5 on phagosomes has been shown to
block fusion with early endosomes (Zerial et al., 1992) and stop entry of phagosomes into
the endocytic pathway. (Horwitz and Maxfield, 1984) [see Figure 2.1 “D”].

If the endocytic pathway is functioning correctly, phagosomes acquire vesicular
proton-ATPase (H+-ATPase) pumps from early endosomes (Russell et al., 1995) either
through vesicle fusion or the mechanism put forth in the “kiss and run” hypothesis.
Acquisition of this integral membrane bound H+-ATPase pump has the rather important
job of acidifying early endosomes to initiate destruction of ingested bacteria. Having this
H+-ATPase pump present on early phagosomes, or at least acidification of the early
phagosomes (endosomes) caused by this pump, may be mandatory for further phagosome

maturation (Xu et al., 1994). The next step in vesicle maturation is either fusion of early

phagosomal (endosomal) vesicles with late endosomes or at least acquisition of proteins
from late endosomes.

Maturing phagosomes begin to lose Rab5 and acquire Rab7 (Novick and
Brennwald, 1993) [see Figure 2.1 “F”]. At this stage of maturation bacteria continue to
be degraded by the low pH in early endosomes. Finally, the late phagosome (endosome)
will lose integral Rab7 membrane proteins and fuse with a lysosome to form a
phagolysosome (Deretic et al., 1997). The phagolysosomal environment will expose
already partially degraded bacteria to hydrolytic enzymes, reactive oxygen species
(ROS), reactive nitrogen intermediates (RNI) and inducible nitrogen oxide synthase
(iNOS) that have inherent bactericidal properties. This last step in phagosomal
(endosomal) maturation will fully degrade bacteria and is needed for presentation of
bacterial antigens in the contest of MHC II and CD1 [see Figure 1.1].

B. Bacterial Survival Strategies

As described previously, APC are uniquely designed to destroy bacteria. After
phagocytic uptake, APC can destroy bacteria with a combination of hydrolytic enzymes,
ROS, RNI, iNOS and nutrient deprivation through sequestration in phagosomes and a
process of step-wise destruction through the endocytic pathway. However, several
intracellular bacteria have developed unique methods to evade and circumvent
phagocytic destruction. Generally, bacterial survival mechanisms can affect the
phagocytic host cell on either a global (throughout the cell) or local (limited to a specific
bacterial phagosome) scale (Hackstadt et al., 2000). Although mechanisms vary for
different bacteria, they all have in common the same goal, to circumvent the awesome

destructive power of the endocytic pathway [see Table 1.1].

Salmonella typhimurium enters macrophage cells through the process of
macropinocytosis. Entering macrophages through this non-receptor mediated process is
believed to nullify generation of the oxidative burst used by macrophages to destroy
many types of bacteria (Ernst et al., 1999) and could also avoid calcium mobilization
necessary for some macrophage activation events. Uptake by macrophages also allows
Salmonella typhimurium to avoid neutrophils, which are successful in degrading the
bacterium. S. typhimurium is able to induce polymerization of the local host G-actin.
This polymerized actin surrounds S. typhimurium containing vacuoles for as long as 16
hours and may help stabilize vesicles providing a framework that can be used to recruit
endosomes for vesicle expansion (Amer and Swanson, 2002; Holden, 2002). S.
typhimurium can also exclude host proteins from the vesicle it resides in by using a type
III secretion system that may play a role in preventing formation of the NADPH oxidase
complex on salmonella-containing vesicles (Holden et al., 2002). By utilizing these
different strategies S. typhimurium is able to evade host immune responses and thrive
within vesicles of macrophage cells.

The intracellular bacteria Leishmania donovani has also developed specific
strategies to live within macrophages. Unlike S. typhimurium, L. donovani is believed to
be ingested by phagocytosis not macropinocytosis and ultimately reside within
phagolysosomes where it can tolerate the extremely low pH that would degrade most
other bacteria (Desjardins et al., 1997; Murray et al., 1988). Maturation of L. donovani
phagosomes however, is not rapid. L. donovani can express a bacterial derived protein
called lipophosphoglycan (LPG) and introduce it throughout the surface of the bacteria’s

phagosome (Duclos and Desjardins, 2000). It is believed that this LPG protein

introduction delays maturation of L. donovani phagosomes until the bacteria expresses
genes that will allow it to survive in the hostile environment of the phagolysosome
(Bogdan and Rollinghoff, 1999; Duclos and Desjardins, 2000). This tactic of delaying
phagosome maturation is not unique.

Legionella pneumophila also delays phagosome maturation for several hours
(Amer and Swanson, 2002). In contrast to Leshmania however, L. pneumophila is not
delaying phagosome maturation to gain time for expression of survival genes, but rather
to avoid the endocytic pathway altogether. L. pneumophila phagosomes do not enter the
endocytic pathway (Russell et al., 1995). Through an unknown molecular process, L.
pneumophila phagosomes are able to fuse with early autophagosomes or early endosomes
of the autophagocytic pathway (Baba et al., 1994). The autophagocytic pathway is
principally involved in degradation of organelles and cellular components and is not
designed to destroy bacteria. Once fused with early autophagosomes, L. pneumophila
reside within a cellular milieu that will provide them with ample raw materials for growth
(Dom et al., 2002). L. pneumophila containing endosomes have also been observed to
associate with rough endoplasmic reticulium and ribosomes (Hackstadt et al., 2000).

This association may be yet another way for L. pneumophila to effectively bypass
endocytic pathway destruction.

Phagosomes containing Brucella abortus have been shown to associate closely
with rough endoplasmic reticulium (Amer and Swanson, 2002) and also infiltrate the
autophagocytic pathway (Arenas et al., 2000). In addition to fusing with endosomes from
the autophagocytic pathway, B. abortus also has the capacity to globally affect

phagocytic cells by utilizing a type IV secretion system that translocates effector

molecules to the host cytoplasm (Foulongne et al., 2000). These effector molecules may
slow or inhibit fusion of all vesicles, allowing B. abortus time to express genes that may
be important for facilitating fusion with autophagocytic pathway endosomes.

Membranes of phagosomes containing T oxoplasma gondii are studded with
proteins that originate from the parasite (Mordue and Sibley, 1997). Incorporation of
parasitic proteins into phagosome membranes may allow T. gondii phagosomes to avoid
or slow fusion with other endosomes and ultimately allow this parasite to hide from
machinery that normally integrates phagosomes into the endocytic pathway (Dubremetz
et al., 1998). T. gondii also encodes for enzymes that scavenge hydrogen peroxide,
making T. gondii within phagosomes resistant to destruction by ROS (Murray et al.,
1981). Finally, T. gondii are able to enter macrophage cells by utilizing Bl-integrin
receptors. Utilization of this class of receptors for uptake can protect the bacteria from
destruction within phagolysosomes by avoiding macrophage activation (Solbach et al.,
1991).

In contrast to previous examples, Listera, Rickettsia and Shigella are not able to
control maturation of phagosomes, but have developed a distinct survival strategy. These
three families of bacteria are able to lyse phagosomes and live within the cytoplasm of
host cells (Gouin et al., 1999). Thus, they avoid destruction not by halting maturation of
vesicles, but by simply refusing to stay where they are put by the host cell. In addition to
being able to lyse phagosomes Listera monocytogenes (L. monocytogenes) has another
important survival technique. L. monocytogenes, like Mycobacteria, are able to enter
macrophages through selective use of receptors (Zimmerli et al., 1996). Normally when

L. monocytogenes is phagocytized via CR3 receptors it is degraded, but when L.

10

monocytogenes enters through an unknown alternate receptor (possibly mannose
receptor) it can survive and multiply within macrophages.
C. Mycobacterial Survival Within Macrophagg

Mycobacteria, like other intracellular bacteria mentioned previously, are able to
successfully evade host immune responses. They are able to accomplish this feat by
utilizing one of several survival strategies outlined in Table 1.2 (Kaufmann et al., 1993).
Many Mycobacteria, including M. paratuberculosis, can enter macrophages by
interacting with the cell’s complement receptors (CR) (Stokes et al., 1993; Tessema et al.,
2001) most notably the CR3 (Malik et al., 2000). By entering macrophages through CRs
it is believed that the Mycobacteria are able to interfere with macrophage Ca2+ signaling
and through an unknown mechanism avoid generation of ROS or iNOS (Tessema et al.,
2001) and are thus able to survive one of the most potent weapons available to
macrophages in combating intracellular bacteria. Besides entering macrophages through
receptors to avoid generation of ROS and iNOS, Mycobacteria also actively produce
molecules and proteins that may promote survival in the hostile environment of a
macrophage phagosome.

Mycobacteria produce a lipoprotein named lipoarabinomannan (LAM) as a major
component of their cell walls. This lipoprotein has been shown to not only be associated
with Mycobacterial phagosomes but also to be associated with endosomes that appear to
bud off from Mycobacterial phagosomes (Xu et al., 1994). LAM is an active scavenger
of potentially cytotoxic substances such as ROS (Tessema etal., 2001). This exo-

endosomal role of LAM is complemented by a second ability to delay fusion of

11

Mycobacterial phagosomes with early endosomes and thus delay entry into the endocytic
pathway (Amer and Swanson, 2002).

Phagosomes are dynamic structures that are constantly maturing and moving
throughout the cell. Mycobacterial phagosomes differ from other phagosomes in several
ways. First, the pH of Mycobacterial phagosomes stabilizes around 6.4, matching the
average pH of perinuclear recycling endosomal compartments (Crowle et al., 1991;
Ullrich et al., 2000). This pH stabilization allows Mycobacteria to avoid destruction
within phagosomes even if it does fuse with early endosomes for entry into the endocytic
pathway. Reduced acidification of Mycobacterial phagosomes may be related to reduced
association of H+-ATPases with these endosomes (Deretic and Fratti, 1999; Xu etal.,
1994). Lack of acidification may also account for other differences between phagosomes
that mature through the endocytic pathway and phagosomes that contain Mycobacteria.

Acidification of phagosomes after entry into the endocytic pathway appears to be
required for maturation to the late endosomal stage (marked by acquisition of Rab7).
Mycobacterial phagosomes fail to acquire Rab7, even in systems where Rab7 is over
expressed (Clemens et al., 2000). Deretic et al. showed that Mycobacterial phagosomes
actively exclude Rab7 from their membranes (Deretic et al., 1997) and not only maintain
Rab5 association, but appear to recruit even more Rab5 to their membranes. The
maintenance and recruitment of Rab5 to Mycobacterial phagosomes appears to affect
acquisition of other markers for endosomal maturation such as the mannose 6-phosphate
receptor (M6PR) (Clemens and Horwitz, 1995) and lysosomal associated membrane
protein (LAMP) (Clemens and Horwitz, 1995; Xu et al., 1994). Thus, available evidence

suggests that Mycobacterial phagosomes do not progress past an early endosomal stage

12

[see Figure 2.1 “?”] (Ernst et al., 1999). As shown above, phagosomal arrest is not
unique to Mycobacteria but the arrest of Mycobacterial phagosomes at early endosomal
stages limits intersection of Mycobacteria with MHC II and CD1 antigen presentation
pathways (Ullrich et al., 2000). Interestingly, this limiting of association with antigen
presentation pathways is abolished if macrophages are pretreated with IF N-y (Ullrich et
al., 2000) or with LPS and lFN-y (Via et al., 1998).

In addition to blocking acidification and endosomal maturation, Mycobacteria
also appear to actively modify the expression of host proteins such as tryptophane
aspartate-containing coat (TACO) protein and cellubrevin to avoid endocytic maturation.
Mycobacterial phagosomes actively retain the host TACO protein (Ferrari et al., 1999).
TACO has been implicated in the ability of phagosomes to recruit cholesterol to the
membrane surface (Amer and Swanson, 2002). Recruitment of cholesterol appears to
hide Mycobacterial phagosomes from cellular machinery used to introduce phagosomes
into the endocytic pathway. Cellubrevin is a v-SNARE that is common to macrophage
phagosomes and is part of the cellular machinery controlling fusion between vacuoles. In
phagosomes containing live Mycobacteria, Cellubrevin is degraded (Fratti et al., 2002).
How Mycobacteria are able to induce destruction of this protein is not known at this time,
but this recent finding is yet another potential mechanism by which Mycobacteria alter
and adapt to survive their chosen environment, the macrophage phagosome.

SNARE and Rab proteins control fusion events between phagosomes and
endosomes which move along actin filament networks throughout the cell (Blocker et al.,
1998; Blocker et al., 1997; Blocker et al., 1996; Swanson et al., 1992). Virulent

Mycobacteria are able to disrupt this network of filamentous proteins (Guerin and de

13

Chastellier, 2000). Disruption of the actin cytoskeleton does not appear to be a way for
Mycobacteria to evade entry into the endocytic pathway, as this disruption of the
cytoskeleton occurs approximately 1 day post-phagocytosis. This disruption could be a
way for Mycobacteria to slow or prevent induction of nitric oxide synthetase (Femandes
et al., 1996) by interrupting fusion of NADH dehydrogenase containing vesicles to
phagosomes or inhibiting fusion with other vesicles that may be deleterious to the
bacterium.

In summary, Mycobacteria and M. paratuberculosis specifically, are able to evade
the host immune response by residing within non-maturing macrophage phagosomes.
Once ingested, M. paratuberculosis appear to immediately affect the macrophage
environment. These effects have been shown to halt vesicular maturation, disrupt the
actin network, and actively recruit various proteins to bacterial phagosomes. In the study
we report here, we hypothesized yet another mechanism by which M paratuberculosis
survives in bovine host macrophage cells, whereby phagocytosis of M paratuberculosis
leads to a gene expression profile in the host cells that permits survival of the bacterium.
To begin to test this hypothesis, we used DDRT-PCR as a primary screening tool to
compare and contrast gene expression profiles of resting bovine macrophages and bovine
macrophages that were allowed to phagocytize M paratuberculosis, E. coli (as a bacteria
that is readily degraded), or latex beads (as a positive control for phagocytosis without
destruction) for 60 minutes. Differential expression of several key host genes were
confirmed by Northern blot analysis and associated with prolonged survival of M
paratuberculosis relative to E. coli. Identification and functions of these candidate genes

of M paratuberculosis survival in bovine macrophages cells are discussed.

14

Figure 1.1 — Antigen Presentation Following Phagocytosis.

 

Cytokines

  
   

a/B CD4+ T-cell

 

 

Cell Lysis

      

Cytokines _
a/fl CD8+ T-cell .;

 

Bacteria are brought into professional antigen presenting cells (APC) by the receptor-
mediated process of phagocytosis (A. ). The phagosome is then gradually acidified as it
matures through a step-wise fusion process in the endocytic pathway (B. ). The late
phagosome containing the now semi-degraded bacteria fuses with a lysosome (C. ). The
lysosome contains ROS, iNOS and RN] along with hydrolytic enzymes that finally finish
degrading the bacteria (D. ). Once bacteria are fully degraded they can be presented to
sub-populations of T cells for several different results. If antigens are presented to C 08'
/KEYWORD> <KE Y WORD>GT P-Binding

Proteins/ *metabolism</KE Y WORD> <KEYWORD> Genes, Structural, ial antigens are
presented to CD4 + T cell populations in the context of MHC II (E. ) the APC are
bombarded with cytokines that can induce or suppress APC activation. Finally, APC can
present glycolipids to 76 T cell subpopulations in the context of non-traditional MHC
CD] molecules (G. ).

Table 1.1 - Intracellular Bacteria Survival Strategies.

 

Bacteria

Salmonella typhimurium

Leishmania donovani

Legionella pneumophila

Brucella abortus

Toxoplasma gondii

Listera monocytogenes

Rickettsia
C oxiella burnetti
Shigella

Survival Strategy_
Enters macrophage cells through macropinocytosis
avoiding oxidative burst
Induce polymerization of the local host G-actin
Exclude host proteins from the vesicle by using a type III
secretion system

Tolerate the extremely low pH of the phagolysosome
Delay phagosome maturation with LPG

Delay phagosome maturation

Phagosomes fail to acidify

Fuse with early autophagosomes, avoiding the endocytic
pathway

Fuse with early autophagosomes, avoiding the endocytic
pathway

Utilize a type IV secretion system to slow or inhibit fusion
of host vesicles

Phagosomes are derived from proteins that originate from
the bacteria, not proteins from the host cell

Encodes for enzymes that scavenge hydrogen peroxide
Enter macrophages by the [31- integrin receptors which
appears to protect against lysosomal fUSIOl’l

Lyse the phagosome and live in the cytoplasm
Enter macrophages through receptors that do not induce
activation

Lyse the phagosome and live in the cytoplasm
Tolerate the extremely low pH of the phagolysosome
Lyse the phagosome and live in the cytoplasm

 

This table puts forth several intracellular bacteria that are either obligate or
opportunistic pathogens of cells in the immune system and several ways that they are
able to avoid, halt, confuse or evade the immune response in the host. This table is by no
means a complete listing of intracellular bacteria or their strategies, it is here only as a

comparative tool.

16

Table 1.2 — Survival Strategies of Mycobacteria.

 

Mycobacteria

Survival Strategy

Encode for the protein LAM, that scavenges potentially
cytotoxic substances (ROS).

Recruit cholesteral to the phagosome to block lysosomal
fusion machinery.

Disrupt the actin network in a local fashion which may
hinder endosomal maturation.

Selectively degrad essential endosomal fusion proteins
such as Cellubrevin (v-SNARE) which may retard the
endosomes ability to mature.

Actively repel Rab7 acquistion to phagosomes which
possibly inhibits entry into the later stages of the Endocytic
pathway.

Exclude the stable incorporation of the endosomal
membrane vesiclear H+-ATP pump and thus reducing
acidification.

 

Outlining some specific actions taken by Mycobacteria after entry into host macrophage
cells appears to confer at least a temporary survival advantage to Mycobacteria within
early endosomal compartment. Whether or not any of these actions actually are
responsible for Mycobacterial survival within host macrophage is not yet known.

17

CHAPTER TWO
Adopted from:
BC Tooker, JL Burton, and PM Coussens (2002). “Survival Tactics of M.
paratuberculosis in Bovine Macrophage cells”. Veterinafl Immunology and
Immunogatholou, 87(3-4): 429-437.

By permission of Elsevier Science [see Appendix 1].

18

CHAPTER TWO

Survival Tactics of M. paratuberculosis in Bovine Macrophage Cells

1. Abstract

Mycobacterium avium subspecies paratuberculosis (M paratuberculosis) is a
facultative intracellular bacterium with the ability to survive and proliferate inside the
vesicles of macrophage cells. How M paratuberculosis and other Mycobacteria survive
in this hostile environment is not well understood. Present research findings can be
divided into three possibilities: (I) Mycobacteria may interfere with host protein
expression and trafficking to stop vesicle maturation, (2) Mycobacteria may express
proteins that interfere with macrophage activation in a more direct manner, or (3)
Mycobacteria may enter macrophages in such a way as to avoid the normal process of
activation via Toll-like receptors and other, as yet unknown mechanisms. Research thus
far has predominately centered on possible macrophage/Mycobacteria protein
interactions.

To more completely define how Mycobacteria interfere with the process of
phagosome maturation our group has recently taken a functional genomics approach,
allowing the macrophage to “tell” us what host genes may be affected by phagocytosis of
Mycobacteria. We used DDRT-PCR to examine differences in macrophage cell gene
expression during phagocytosis of E. coli and M paratuberculosis. Macrophage cells not
exposed to any phagocytosis target and in the process of phagocytosing latex beads were

used as negative and positive controls, respectively. To date, we have identified 380

19

DDRT-PCR amplicons corresponding to transcripts whose expression profiles appear to
be altered during the general process of phagocytosis. Dot-blot and Northern blot
hybridizations with a subset of these amplicons were performed to confirm results
observed with DDRT-PCR. Our preliminary results indicate that macrophage gene
expression profiles change dramatically following phagocytosis and that gene expression
profiles following phagocytosis of M paratuberculosis are different than those following
phagocytosis of E. coli or latex beads.
I]. Introduction

Macrophages are phagocytic cells that ingest bacteria and other particulate matter
by the receptor mediated process called phagocytosis. A vesicle is formed around the
bacteria, which then become internalized by the macrophage cell. Following
internalization, vesicles containing bacteria undergo a stepwise process of maturation that
allows the original structure to fuse with important endocytic and exocytic vesicles for
ultimate destruction of the phagocytized bacteria [see Figure 2.1]. The final stage in
pathogen destruction occurs when late maturation vesicles (late phagosomes) fuse with
lysosomes to create a phagolysosome where the bacteria are digested by reactive oxygen
and lysosomal enzymes. Mycobacteria (Crowle et al., 1991) and other intracellular
bacteria, such as L. pneumophila (Baca et al., 1994) and Coxiella burnetti (Feng et al.,
1995) have developed various strategies to avoid degradation in the macrophage
following phagocytosis. Though it is not clear what molecular mechanisms might
contribute to the intracellular survival of various pathogens, recent studies on

mycobacterial survival in the phagocytic/endocytic pathway have revealed that

20

Mycobacteria block vesicle maturation. By doing so, the Mycobacteria avoid
phagosome-lysosome fusion and subsequent bacterial destruction (Via et al., 1997).

As shown in Figure 2.1, processing through the endocytic pathway may occur
through multiple fusion events with other vesicles (endosomes). Several protein markers
for vesicle maturation, called Rab proteins, have been identified as members of the
superfarnily of GTP-binding proteins (Pfeffer et al., 1994). In the fusion model of vesicle
maturation, various Rab proteins are brought to the maturing phagosome via pre-packed
endocytic vesicles (Novick and Brennwald, 1993). It has also been theorized that vesicle
maturation through the endocytic pathway may occur through a sequential acquisition
process (Via et al., 1997). In this model, the recruitment of various cytoplasmic proteins,
including Rab5 and Rab7 may be brought about through structural alteration or enhanced
expression of receptor molecules on the phagosome surface.

Regardless of the way phagosomes acquire Rab proteins, they appear to be
necessary for vesicle maturation through the endocytic pathway (Pfeffer et al., 1994).
There are more than thirty known members of the Rab family (Lutcke et al., 1994; Zerial
and Stenmark, 1993) including Rab5 and Rab7, which control the major fusion steps in
the endocytic pathway [see Figure 2.1]. Both Rab5 and Rab7 have GTPase activities
similar to the Ras super-family of proteins (Chavrier et al., 1990; Simons and Zerial,
1993) and are most likely involved in phosphorylation/de-phosphorylation events related
to membrane fusion. The presence of Rab5 on both phagosomes and early endosomes
promotes both endosomal fusion with the newly formed phagosomes (Zerial et al., 1992)
and entry of the phagosomes into the endocytic pathway (Horwitz and Maxfield, 1984)

[see Figure 2.1 “D”]. Fusion of early endosomal vesicles with late endosomes and

21

lysosomes, required for bacterial killing, is characterized by acquisition of Rab7 (N ovick
and Brennwald, 1993) [see Figure 2.1 “F”].

Mycobacteria-containing vesicles acquire Rab5 in the normal fashion (Gorvel et
al., 1991). However, Mycobacteria-containing phagosomes fail to acquire Rab7 and thus
do not enter the later phases of the endocytic pathway (Via etal., 1997). As a result,
these phagosomes do not become acidified or fuse with lysosomes, thus promoting
survival of the Mycobacteria. Inhibition of the later phases of the endocytic pathway
may thus contribute to the proliferation of phagocytized Mycobacteria in macrophages
[see Figure 2.1 “?”]. Virtually nothing is known regarding the molecular mechanisms by
which Mycobacteria inhibit Rab7 recruitment to phagosomes or stop progression to the
terminal phagosome-lysosome fusion event.

Given the facts that phagocytosis is a receptor-mediated event and that various
proteins marking maturation through the endocytic pathway belong to a family of
proteins involved in signal transduction, we reasoned that there might be critical gene
expression events that are interrupted or miss-directed following phagocytosis of
Mycobacteria. To test this hypothesis, we used a functional genomics approach to study
gene expression profiles in macrophage cells following phagocytosis of Mycobacteria
and other infectious and non-infectious agents. Our preliminary differential display
reverse transcriptase polymerase chain reaction (DDRT-PCR) results suggest that
phagocytosis does cause profound changes in macrophage gene expression, and that
macrophage gene expression profiles are different following phagocytosis of

Mycobacteria compared with phagocytosis of E. coli or latex beads.

22

III. Materials and Methods
A. Cell Culture
Bacterial Cultures

E. coli-DHSor were grown in Luria Broth media at 37°C with agitation for
eighteen hours. The bacteria were serially diluted and counted using a bacterial
hemocytometer.

M paratuberculosis cells were obtained from the American Type Culture
Collection (ATCC #19698) and grown at 37°C in Middlebrooks 7H9 media with 10%
Middlebrooks OADC enrichment and Mycobactin J (Allied Monitor, Lexana KS) at
2mg/L for 12-16 weeks. M paratuberculosis were serially diluted and counted on a
bacterial hemocytometer.

Bovine Macrophage Cells

The BOMAC cell line (Stabel and Stabel, 1995), a generous gift from Dr. J.
Stabel USDA-ARS-NADC, was used in all experiments. BOMAC cells were grown in
75-mm2 flasks containing RPMI-1640 with 10% fetal bovine serum (FBS), 2mM L-
glutarnine, IOOU/ml penicillin, and 100ug/ml streptomycin in a humidified atmosphere of
5% C02 and 95% air at 39°C until a confluent monolayer (approximately 2x10° cells)
was achieved.

B. Phagocytosis and RNA Collection in BOMAC Cells

Cell culture medium was aspirated from the BOMAC cells and 5ml of 0.025%
trypsin, lmM EDTA added to each 75mm2 flask. The flasks were then incubated for 5
minutes at 39°C to facilitate separation of the BOMAC cells from the substratum.

Trypsin/EDTA was quenched with three volumes of growth medium and cells were

23

washed into the supernatant by repeated pipetting. Cells were counted using a
hemocytometer and then added to six-well plates at a concentration of 2.0x105 cells/well.
Cells were allowed to adhere to substratum in the wells overnight in 4ml of grth
medium/well. Afier overnight incubation, growth medium was removed from the six-
well plates by vacuum and the BOMAC cells were washed 3 times with sterile phosphate
buffered saline (PBS) to remove any non-adherent cells. Next, lml of fresh growth
medium was added to each well to cover the BOMAC cells. The various phagocytosis
targets; E. coli, M paratuberculosis, and latex beads were counted and resuspended at
2.0x107 cells or beads per ml of sterile PBS. To initiate phagocytosis, 100p] of the
various target solutions were added to separate wells at a final concentration of 2.0x106
cells or beads/well (10:1, target: cell ratio). One set of wells received only 100p! of PBS
only as a no phagocytosis control. Plates were centrifuged for 10 minutes at 3000xg to
facilitate interaction between the cells and the various phagocytosis targets. Plates were
then incubated for one hour at 39°C in a humidified atmosphere of 5% C02 and 95% air.
Phagocytosis was arrested after 60 minutes by aspirating the medium and washing 3
times in ice cold PBS. RNA was harvested using either a Qiagen RNeasy Maxi Kit
according to the manufacturer’s instructions (Qiagen, Valencia, CA) or by using Trizol,
also according to the manufacturer’s instructions (Invitrogen Life Technologies, Inc.,
Gaithersburg, MD). RNA from the four treatment groups was stored at -80°C under
ethanol until used.
C. Differential Display RT-PCR

RNA from the various phagocytosis treatments was diluted in RNase-free ddHZO

to yield a working concentration of 100ng/ul. Differential display RT-PCR was

24

preformed using the Hieroglyph Kit (Beckman Coulter, Inc., Fullerton, CA), essentially
according to the protocol provided by the manufacturer. Briefly, an anchored primer
(AP) 5’-T7-TTTTTTTTTTXX (where “XX” is a combination of any two base pairs
except TT, TC, TA and TG) was used to synthesize 1st strand cDNA using reverse
transcription (RT) at 50°C for 50 minutes. RT reactions were stopped by heating samples
to 70°C for 15 minutes. The 1st strand cDNA reaction was then split into four separate
pools for amplification of cDNA subsets by polymerase chain reaction (PCR). PCR
amplifications were preformed in the presence of 0.125 uCi [a-33P] dATP/reaction along
with 0.2uM AP, 0.2uM anchored random primer (ARP, a random 10-mer with M13-
Reverse primer sequences appended at the 5’ end), and 20uM dNTP mix. PCR
amplifications were performed using standard conditions: 95°C, for 2 min., [92°C, 15 sec;
50°C, 30 sec; 72°C, 2 min.]4 [92°C, 15 sec; 60°C, 30 sec; 72°C, 2 min.]25, with a final
hold at 4°C. Amplified cDNA fragments (amplicons) were separated by electrophoresis
on a 5.2% Bis-acrylamide gels at 45 watts constant power. For each reaction, two
separate gels were run, one for 5 hours and a second for 8 hours, to facilitate separation
of a wide range of fragment sizes. The gel was then dried to a piece of Whatrnan 3-mm
paper (Whatman Ltd., Maidstone, UK) and exposed to X-ray film for 48 hours.

D. Excisiom Re-amplification of Suspect cDNA amplicons.

Labeled cDNA fragments (amplicons), amplified using the same AP/ARP primer
set, that showed differences in intensity across the four different phagocytosis treatments
were excised from the gel and eluted into IOOul TE pH 7.5. Impurities were removed
using Sephadex G-50 exclusion chromatography (Amersharn Pharmacia Biotech.,

Buckinghamshire, UK), contained in a 96-well spin plate format (Millipore Corp.,

25

Bedford, MA). Re-amplification of excised and eluted cDNA fragments was
accomplished by transferring S-lOul of the purified eluate into a PCR reaction tube
containing ZOuM dNTP mix, 0.2uM T7 primer, 0.2uM Ml3-Reverse primer, PCR
reaction buffer (200mM Tris-HCI (pH 8.4), 500mM KCI), and Taq DNA polymerase
(Invitrogen Life Technologies, Inc., Gaithersburg, MD). Conditions for PCR
therrnocycling were identical to those described above for DDRT-PCR. The quality and
amount of each amplicon DNA was evaluated by gel electrophoresis in 1.0% or 2.0%
agarose/TAE gels.
E. Dot-Blot Hybridization

Suspect cDNA amplicons were amplified as noted above, denatured in 0.4N
NaOH and blotted to nylon membranes (Hybond XL, Amersham Pharmacia Biotech.,
Buckinghamshire, UK) using a 96—well vacuum dot-blot apparatus (Bio-Rad Corp.
Hercules, CA). Spotted cDNA fragments were UV cross-linked and dot-blots stored at —
20°C until utilized. To probe the dot-blots, Sug of total cellular RNA isolated from
negative control (NC) and M paratuberculosis (M) treatments were used to prime
separate first-strand cDNA reactions in the presence of [or-32F] dCTP. Prior to
hybridization, dot-blot membranes were blocked for 2 hours at 65°C with 4mg of heat-
denatured (10 minutes at 95°C) herring sperm DNA in 5ml of Perfect Hyb Solution
(Sigma Chemical Co., St. Louis, MO). Blocking solution was decanted and 2x10°
cpm/ml of heat-denatured probe in 5ml of Perfect Hyb solution was added to the dot-blot
membranes. The membranes were then hybridized overnight (16-18 hours) at 65°C.
Following hybridization, the membranes were washed twice at room temperature in 2X

SSC, 0.1% SDS and twice more at 65°C in 0.1X SSC and 0.1% SDS to remove unbound

26

probe. Radioactivity remaining associated with the membranes was visualized and
quantitated using a Phosphoimager and Quantity-One software (Bio-Rad Corp., Hercules,
CA).
F. Northern Blot Analysis

Total RNA from each treatment (lOug/lane) was separated by gel electrophoresis
on an 11x14cm 1% denaturing formaldehyde/agarose gels. Electrophoresis conditions
were 60V for 5 hours. Separated RNA was then transferred to nylon (Hybond XL,
Amersham Pharmacia Biotech., Buckinghamshire, UK) membranes using the “wicking
technique” in 20X SSC. UV cross-linking was preformed to fix transferred RNA to the
membranes. Final membranes were stored at —20°C and allowed to thaw before being
probed with radiolabeled DDRT-PCR amplicons. The suspect DDRT-PCR cDNA
amplicons were radioactively labeled using a random prime labeling kit (Promega Corp.,
Madison, WI) in the presence of [or-32P] dCTP and used for Northern blot hybridizations.
Prior to hybridization, membranes were blocked for 2 hours at 65°C with 4mg of heat-
denatured (10 minutes at 95°C) herring sperm DNA in 5ml of Perfect Hyb Solution
(Sigma Chemical Corp, St. Louis, MO). Blocking solution was decanted and 2x10°
cpm/ml of heat-denatured probe in 5ml of Perfect Hyb solution was added to the
Northern blot membranes. Membranes were hybridized with radiolabeled probe
overnight (16-18 hours) at 65°C. Following hybridization, membranes were washed
twice at room temperature in 2X SSC, 0.1% SDS and twice at 65°C in 0.1X SSC and
0.1% SDS to remove unbound probe. Washed membranes were exposed to X-ray film

for 24-48 hours.

27

IV. Results
A. Identification of Differentially Expressed Twcripts in Bovine Macrophage Cells.

To begin testing the hypothesis that phagocytosis of Mycobacteria by bovine
macrophage cells would lead to gene expression profiles different than those following
phagocytosis of E. coli or latex beads, we employed DDRT-PCR. In an effort to limit
differences attributable to the source of macrophages or their viability, we initiated this
study using an immortalized bovine peritoneal macrophage cell line, called BOMAC
((Stabel and Stabel, 1995), a generous gift of Dr. J. Stabel, USDA-ARS-NADC). The
functional macrophage characteristics of these cells are well established (Stabel and
Stabel, 1995). In general, BOMAC cells are similar to primary bovine macrophages in
terms of phagocytosis, cellular cytotoxicity, production of oxygen radicals, and
production of key cytokines following activation. In preliminary studies using
differential staining and light microscopy, viable E. coli placed in contact with BOMAC
cells as described in Materials and Methods were readily internalized and degraded. In
contrast, M paratuberculosis were not readily degraded following internalization by
BOMAC cells (data not shown). Subsequent time course analyses showed that most
internalized E. coli were completely degraded within 60 minutes of initial macrophage
contact. In contrast, internalized M paratuberculosis remained visible as acid-fast bacilli
within vesicles of BOMAC cells for at least 96 hours post initial contact (data not
shown).

To begin screening bovine macrophage cells for differentially expressed
transcripts by DDRT-PCR, cells were seeded onto 8 separate six-well plates (2 plates per

treatment category). Phagocytosis targets were prepared and diluted as described in

28

Materials and Methods. Diluted targets were added to appropriate plates and briefly
centrifuged to improve contact between phagocytosis targets and cells. All plates were
incubated for 60 minutes at 39°C in a humidified atmosphere of 5% C02 and 95% air.
Brief rinsing in ice-cold PBS halted phagocytosis and total cellular RNA was extracted as
described in Materials and Methods.

RNA expression profiles from the three phagocytic treatment groups [E coli (E),
M paratuberculosis (M), and latex beads (PC)] were compared to each other and to RNA
expression profiles of the no phagocytosis group (NC) by subjecting extracted RNA to
the DDRT-PCR protocol. By comparing RNA expression profiles across the four
treatments, it was possible to observe differential gene expression during the general
process of phagocytosis and differential gene expression during phagocytosis of specific
phagocytic targets. Because the general process of phagocytosis is not well defined in
the bovine or any other system, DDRT-PCR amplicons representing transcripts that
appeared to change expression levels across any of the four treatments were marked for
isolation. Amplicons were eluted, re-amplified, and cataloged as to how their gene
expression profiles changed (repressed or induced) with respect to the various
phagocytosis treatments. To date, we have isolated 380 amplicons with observed
differences across one or more of our 4 treatment groups. Selected amplicons were
eluted and re-amplified for validation of expression differences by a combination of dot-
blot and Northern blot hybridizations.
B. Validation of Differential Gene Expression by Dot-Blot Hybridization.

To validate expression differences observed by DDRT-PCR, dot-blot analysis was

preformed on 30 selected amplicons. Selected amplicons were spotted in quintuplicate

29

onto a nylon membrane. Membranes also contained 8 GAPDH spots to account for blot-
to-blot variation and to allow normalization between blots. Each membrane also
contained 10 blanks to allow for quantification of background. DNAs were UV cross-
linked to the membranes and probed with [a-32P] labeled lst strand cDNA as described in
Materials and Methods. In the first set of comparisons, labeled cDNA derived from the
no phagocytosis cell RNA (NC) was used to probe one blot while labeled cDNA derived
from the M paratuberculosis phagocytosis treatment cells (M) was used to probe a
duplicate blot. In this comparison, several selected amplicons, such as 5-1-1, and 5-1-9,
hybridized to transcripts that showed statistically significant differences in expression
levels (p < 0.05) between the two treatments. However, other amplicons, such as 5-2-10,
and 5-4-2 hybridized to transcripts that showed no significant differences in expression
level between the NC and M treatments. Based on results of Northern blot hybridization
studies described below, additional dot-blot validations will be performed with the same
set of amplicons, but will compare cDNA derived from cells following phagocytosis of
M paratuberculosis versus cDNA derived from cells following phagocytosis of E. coli.
C. Confirmation of Differential Expression by Northern Blot mbfidimtion

Thus far DDRT-PCR derived suspect amplicons 5-1-1, 5-2-10, 3-1-4, and 5-4-2
have been used to probe Northern blots containing total RNA from the three phagocytic
treatment groups and from macrophages not undergoing phagocytosis. Based on results
of Northern blot hybridizations, amplicon 5-1-1 appears to represent a transcript that is
expressed in macrophage cells not exposed to phagocytosis targets, but is down regulated
following exposure to all three phagocytosis targets. This result agrees with expression

differences between the no phagocytosis and M paratuberculosis phagocytosis treatment

30

groups observed in DDRT-PCR [see Figure 2.2] and validated by dot-blot analysis. As
suggested by initial dot-blot analysis, Northern blot hybridization using amplicons 5-2-
10, 3-1-4, and 5-4-2 as probes revealed that there was indeed little or no difference in the
expression of the corresponding transcripts between the no phagocytosis and M
paratuberculosis phagocytosis treatments [see Figure 2.3]. These amplicons all seem to
represent macrophage transcripts whose expression is up regulated following exposure of
macrophage cells to either E. coli or latex beads, but not following exposure to M
paratuberculosis.
V. Discussion

Failure of phagosomes containing Mycobacteria to progress through the endocytic
pathway promotes survival and proliferation of these pathogens within the host
macrophage. Despite a growing body of literature on movement of phagosomes through
the endocytic pathway and discovery of various proteins critical for this process, the
precise molecular mechanisms responsible for failure of Mycobacteria containing
phagosomes to mature are largely unknown. Efforts to prevent or control mycobacterial
infections in humans and animals depend upon knowledge of mycobacterial survival
mechanisms and on understanding the host response to this diverse group of pathogens.
Our group has developed a working hypothesis that various gene expression events,
critical for maturation of phagosomes and proper macrophage activation are suppressed
in macrophages following phagocytosis of Mycobacteria.

As a first step in testing this hypothesis we have employed DDRT-PCR to
evaluate gene expression profiles in a macrophage cell line exposed to M

paratuberculosis and 2 other phagocytic targets (E. coli and latex beads). Using this

31

approach, we have been able to directly compare the expression patterns from our
treatment groups across thousands of genes as DDRT-PCR amplicons. To date, over 380
DDRT-PCR amplicons that appeared to be differentially expressed across one or more of
the four treatments (NC, E, M, or PC) have been isolated and re-amplified for further
study and confirmation of differential expression. Because DDRT-PCR is known to
yield a high nrunber of false positives, 30 amplicons representing transcripts with the
most obvious differences in expression pattern were selected for verification of DDRT-
PCR results by dot-blot analyses and Northern blot hybridization. In an initial dot-blot
analysis comparing the NC and M treatments, one amplicon (5-1-1) showed clear down-
regulation following macrophage phagocytosis of Mycobacteria. This result confirmed
results of DDRT-PCR, which indicated that the transcript corresponding to amplicon 5-1-
1 was down-regulated following phagocytosis of either M paratuberculosis, E. coli, or
latex beads. Northern blot hybridization using amplicon 5-1-1 as probe subsequently
confirmed both DDRT-PCR and dot-blot analyses. Thus, amplicon 5-1-1 appears to
represent a transcript whose expression is down regulated by the general process of
phagocytosis. While interesting, this gene may not be involved in Mycobacterial survival
in macrophage cells. In contrast transcripts corresponding to 3 other amplicons (3-1-4, 5-
2-10 and 5-4-5) exhibit very low expression levels in both macrophages not undergoing
phagocytosis and macrophages following phagocytosis of Mycobacteria, but are
expressed at high levels in macrophages following phagocytosis of E. coli or latex beads.
We conclude therefore that expression of genes represented by these amplicons is up
regulated in macrophages following phagocytosis of E. coli or latex beads, but is

specifically held at low levels following phagocytosis of M paratuberculosis. It is

32

interesting to speculate that failure to activate genes such as those represented by
amplicons 3-1-4, 5-2-10, and 5-4-5 may be at least partially responsible for the ability of
M paratuberculosis to survive in macrophages.

Of the remaining 30 amplicons selected for dot-blot analysis, 10 have failed to
show clear differential expression in macrophages not undergoing phagocytosis and
macrophages following phagocytosis of M paratuberculosis. However, it is possible that
these amplicons represent transcripts whose expression pattern is similar to 3-1-4, 5-2-10,
and 5-4-5. That is, expression profiles of the remaining amplicon transcripts are similar
between untreated macrophage cells and macrophage cells following phagocytosis of M
paratuberculosis, but distinct from cells following phagocytosis of E. coli or latex beads.
Additional dot-blot validation studies to ascertain this possibility are in progress.
Whatever the outcome from these studies results presented herein validate our
hypothesis, that the general process of phagocytosis has a profound effect on macrophage
gene expression profiles and that gene expression profiles of bovine macrophage cells
following phagocytosis of M paratuberculosis are distinct from those of macrophage
cells following phagocytosis of E. coli or latex beads. Although it still remains to be seen
if results presented here carry over to primary bovine macrophages and monocytes, this
work clearly demonstrates that DDRT-PCR is an effective tool for identifying
differentially expressed macrophage genes. Identification of such genes offers an
opportunity to discover different pathways used by or activated by various pathogens as
they enter macrophages and are either destroyed through the process of phagosome

maturation or persist through interference with this normal first line of host defense.

33

Figure 2.1 - The Endocytic Pathway (The Fusion Model).

 

Macrophage E‘ 605

-
Plasma Membrane '1‘ . A. B.
‘1 Receptor Binding Phagocytosis C,

    

 

 

Bacterial Rab5 -——-- .2 hagnsome
Receptors ‘
M7 4 Early
,. Endosome
Phagolysosome D. Fusion
LAMP-l "
Rab5
Late Endosome
. ‘ ' En nt_ry into the
%.ysnsome
' Endocygc

 

 

 

WW 1 Lydrtva
G. Fusion
3 "‘ PM Fusion Q Acidification
«"j'wr'r-‘w'! 1

Through this pathway degradable bacteria such as E. coli, are destroyed by the stepwise
fusion of phagosomes with early endosomes, late endosomes, and lysosomes. Various
steps within the endocytic pathway are denoted by capital letters. Receptor-mediated
uptake of E. coli by phagocytosis, results information of a phagosome (A-C). Fusion of
the phagosome with early endosomes results in a vesicle that now possesses external
markers of the early endosome, including abundant Rab5 (D). Acquisition of Rab5 may
be viewed as signaling entry of the vesicle into the endocytic pathway. Presence of high
levels of Rab5 on early phagosomes coincides with (and may be directly related to)
initiation of acidification in the vesicle, which aids in the degradation of phagocytized
bacteria (E). Fusion of the early phagosome with late endosomes marks the next stage of
vesicle maturation and is characterized by acquisition of Rab 7 and loss of Rab5 (F).
Presence of Rab7 is absolutely required for subsequent interaction of the phagosome
with lysosomes. Fusion of the late phagosome with lysosomes marks the final stage of
vesicle maturation, and is characterized by the acquisition of LAMP-1 and LAMP-2 (G).
.</A UTHOR> <A UT HOR>Saama, P. M </A UT HOR> <A UT HOR>Bauman, D.
E. </A UT HOR> <A UTHOR>Boisclair, Y. R. </A UT HOR> <A UT HOR>Burton, J.
L. </A U THOR> <A UT HOR> Collier, R. J. </A U THOR> <A U THOR>DePend proliferate
inside macrophage phagosomes. How Mycobacteria might accomplish this is not well
understood, but is thought to occur at the stage of initial acidification (question mark and
solid arrows).

 

 

 

 

 

34

Figure 2.2 - DDRT-PCR Suspect Amplicons.

 

 

Phagocytosis Target

 

M PC E

NC

 

 

via {Lit-r HewsmufiwJugg ..

 

. , “3399—2335131;- ‘ S'QWTRWI-lfln‘qgnf

, ' -.-. yum-hon. _ . .24. _. . .. “Am-fidflti‘h\ ago-u- u -9); Jun-."M‘A"- .z._-.. u‘

PI- - .- .'.'.'x=»mq‘ma.fuur. - .‘4'.'-&P.'L'.Ya."-|.i' ‘ ' '..'." ..'lfw2k!z'l"ll:h'fc'.'u" '.-. . . . . .‘

.
“.‘i‘. ".‘.'.'.".“‘-‘ 2.“! ".~‘.“.‘. Jar-5mm when - ... -. .I‘masmqjuv . an. ~

 
 

 

r ' .‘C‘..-‘J'3"Ul

 

Amplicon

 

3— 1-4

5—2—10

542

3— 2— l

3— 4- 1

5—4-5

 

 

Representative DDR T-PCR amplicons selected for further study on the basis of apparent
diflerential expression across the four treatment scenarios. 33P-labeled amplicons were

separated by electrophoresis and exposed to X-rayfilm for visualization. Selected

amplicons 3-1-4, 5-2-10, and 3-2-1 show an apparent increase in macrophage gene
expression during phagocytosis of M paratuberculosis (M) when compared to either the
E. coli phagocytosis (E) or the no phagocytosis control (NC) treatments. Antithetically, a
marked depression in macrophage gene expression for amplicons 5 -4-2, 3-4-1 and 5 -4-5
is apparent during M paratuberculosis phagocytosis (M) when compared to the WC) no
phagocytosis treatment. In the cases of amplicons 5 -4-2 and 3 -4-1 the depression is
further seen when the M paratuberculosis treatment (M) is compared against either of

the other two phagocytosis treatments of E. coli (E) or latex beads (PC).

35

 

Figure 2.3 - Northern Blot Hybridization with Amplicon Probes.

 

 

 

 

 

 

 

 

 

 

 

 

Northern blot hybridization using selected DDRT-PCR amplicon DNAs as probes. long
of total cellular RNA from each of the four treatments was separated by gel
electrophoresis on 1% denaturing formaldehyde/agarose gels and transferred to nylon
membranes. Membranes were hybridized to the indicated “VP-labeled DDRT-PCR
amplicons, washed and exposed to X-ray film. Each membrane was stripped of
radioactivity and re-probed with 32P-labeled GAPDH amplicon as an RNA loading
control. Amplicon 5 -1-1 hybridized to a macrophage gene transcript that appears to be
expressed when the macrophage cell is not undergoing phagocytosis (NC) and whose
expression is depressed across all the phagocytic treatments [ (M), (E), and (PC) ]. In
contrast, probes 5-2-10, 3-1-4 and 5—4-2 hybridized to macrophage gene transcripts
whose expression levels are up-regulated during the phagocytosis of either E. coli (E) or
latex beads (PC) but which remain at low levels during the phagocytosis of M.
paratuberculosis (M.

36

CHAPTER THREE

The Effect of Different Phagocytic Targets on Bovine Macrophage Gene Expression

1. INTRODUCTION

In the previous chapter our group explained how we used the open platform
functional genomics approach of Differential Display Reverse Transcription Polymerase
Chain Reaction (DDRT-PCR) as a high throughput initial screen in an attempt to more
completely understand how phagocytosis of M paratuberculosis affects host macrophage
gene expression. As previously stated, this approach allows the macrophage to “tell” us
which genes may have an increased or decreased expression due to the phagocytosis of
M paratuberculosis. In the previous chapter, initial screening using DDRT-PCR
revealed apparent macrophage gene expression differences dependent upon phagocytic
stimuli. This has led to the hypothesis that these differences in gene expression, mostly
between E. coli and M paratuberculosis, may be important for survival of M
paratuberculosis in bovine macrophage cells. In this chapter we expand upon several
specific points, such as bacterial survival in BOMAC cells, conformation of observed
differences in gene expression across phagocytic treatments, cloning and sequencing of
DDRT-PCR derived amplicons, and identification of differentially expressed genes via
database searches.

An initial goal of our group was to clarify apparent differences in host gene
expression after phagocytosis of M paratuberculosis or E. coli by the immortalized

bovine macrophage cell line BOMAC (Stabel and Stabel, 1995). A major difference

37

between the two bacteria is that M paratuberculosis can survive within normal bovine
macrophages while E. coli are an example of bacteria that are destroyed following
phagocytosis. To evaluate survival of M paratuberculosis and E. coli in BOMAC cells,
an experimental procedure utilizing quantative real time PCR (Q-RT-PCR) was designed.
This procedure covered time points from time zero to 96 hours post introduction of each
of the bacterial phagocytic stimuli. Genomic DNA from both treatments (E. coli and M
paratuberculosis) was collected and subjected to real time PCR amplification for
accurate quantification of bacterial genomic DNA present in each sample relative to
amounts of BOMAC genomic DNA. Ratios of bacterial to macrophage DNA should
become smaller with successful destruction of bacteria or stay relatively constant if
bacteria survive within BOMAC cells. Two potential caveats are 1) that decreased cell
survival could parallel decrease bacterial survival and therefore, the ratio of bacterial to
BOMAC DNA would stay constant yielding a false report of bacterial survival when in
fact there is bacterial destruction and 2) performing real time PCR will not conclusively
show whether the bacteria are alive or dead. In unpublished data our lab has shown by
microscopy that M paratuberculosis is taken up by BOMAC cells and remains intact for
at least 96 hours following phagocytosis [see Appendix Three: Figure A3.1]. Also work
presented by Dr. Rar'rl G. Barletta’s group at the University of Nebraska showed that two
stains of M paratuberculosis (one wild type K-10 and another K-10 transformed with a
plasmid encoding for GFP) were able to survive and replicate for up to three days within
both monocytes derived macrophages (MDM) and BOMAC cells [see Appendix Three:

Figure A3.2]. By using Q-RT-PCR our group is confirming these survival results.

38

Differential gene expression in cultured macrophage cells was originally assayed
by Northern blot hybridizations with DDRT-PCR derived amplicons [see Chapter 2].
Results obtained from these hybridizations were not conclusive. Multiple hybridization
bands were observed on some Northern blots preformed using amplified DDRT-PCR
derived amplicons as probes. Cloned DDRT-PCR amplicons were used as probes in
further Northern blot hybridizations to remove the possibility of multiple genes
represented in amplicon stocks. The benefits of amplicon cloning are three fold: first,
cloning DDRT-PCR derived amplicons into stable plasmid vectors provided a permanent
stock of DDRT-PCR amplicons. Second, cloning allowed purification of target
amplicons that may have been contaminated by undesired bands during removal from
DDRT-PCR gels. Finally, cloning allowed DNA sequence analysis of amplicon DNAs
that represented genes whose expression differed across the phagocytic treatments.
Sequence information in turn, allowed putative identification of several DDRT-PCR
derived amplicons through BLASTN, BLASTX, and tBLASTx database searches.

At this time very little is known regarding molecular mechanisms that may affect
maturation of M paratuberculosis phagosomes within bovine macrophages. From work
preformed in mouse and other systems a family of well-characterized proteins marking
maturation through the endocytic pathway has been identified but their role in phagosome
maturation is still unclear. In Chapter 2, our group put forth the hypothesis that M
paratuberculosis survival in bovine macrophages brings about a change in macrophage
gene expression profiles relative to profiles of macrophages during the phagocytosis of
bacteria, such as E. coli, that are successfully killed and degraded (Tooker etal., 2002) or

stimuli such as latex beads that are non-degradable, but whose phagosomes undergoes

39

full maturation through the endocytic pathway. In this chapter we identify the genes
discovered in Chapter 2 using DDRT-PCR and quantify differences in gene expression
using Northern blot hybridizations and scanning densitometry with cloned amplicons as
probes.

II. METHODS AND MATERIALS

A. Cell Culture

Bacterial and BOMAC cell culture was preformed as outlined in Chapter 2

Methods and Materials: page 23 [see Chapter2].

B. Bacterial Survival

Quantifying Bacterial Survival Using Quantitative Real Time Polymerase Chain
Reaction (Q-RT-PCR)

BOMAC and bacterial cells were prepared for the time course experiment as
outlined in Chapter 2 Methods and Materials: page 23-24 [see Chapter 2]. To begin the
time course experiment, 10u1 (~2.0x10°) of bacteria or 10ul of sterile room temperature
PBS was added to BOMAC cells in 6 well plates and mixed gently. Plates containing
BOMAC cells and either phagocytic target (M paratuberculosis or E. coli) or PBS as a
negative control, were incubated at 39°C with 5% C02 and 95% humidified air for one
hour. After incubation, medium was removed and the wells vigorously washed 3 times
with sterile room temperature PBS to remove non-adherent bacteria (de Chastellier et al.,
1995). At this time, designated T=0 hr, the first time point was collected by the
following protocol while 5m] complete RPMI was added to remaining wells and

incubated at 39°C with 5% C02 and 95% humidified air until subsequent collection

40

times. For time points after 24 hours (48, 72 and 96 hours), medium was removed by
vacuum and 5ml of complete RPMI media added to each well every 24 hours.

At collection times, growth medium was removed from wells and 500p] of sterile
4°C PBS added to each well. Cells were mechanically dislodged into PBS by scraping
and removed to 1.5ml Eppendorf tubes. Tubes containing BOMAC cells with bacteria
were centrifuged at 1600xg for 5 minutes to pellet cells. Once pelleted, supematants
were removed by pipette and cells resuspended in soil] Buffer API from a Qiagen DNA
Extraction Kit for Plants (for BOMAC cells treated with M paratuberculosis) or 50p]
Cell Lysis Solution from the Promega Wizard Genomic DNA Preparation Kit (for
BOMAC cells treated with E. coli). Our group has observed that Mycobacteria residing
within phagosomes are resistant to cell lysis (unpublished observation). Due to this fact,
M paratuberculosis time course samples were treated more aggressively than the E. coli
time course samples.

BOMAC cells challenged with M paratuberculosis were further subjected to
three rounds of freeze/thaw (freezing in an ethanol-dry ice bath and boiling in water).
Next, lul of 100mg/ml RNase A was added to each tube and cells incubated at 65°C for
10 minutes with tube inversion every 3 minutes to mix. After incubation 30p] of Buffer
AP2 was added to each tube and cells incubated on ice for 5 minutes. Next, each lysate
was added to a shredder column provided in the Qiagen DNA Extraction Kit for Plants
and centrifuged at 14,000xg for 2 minutes. Flow through from each shredder column was
mixed with 1.5 volumes (~200ul) of Buffer AP3/E and mixed gently by pipetting. This
mixture was added to a spin column and centrifuged at 8,000xg for one minute. Flow

through was discarded and 500p] of Buffer AW added to each column. Columns were

41

then centrifuged for 2 minutes at 14,000xg. Spin coltunns were moved to new 1.5ml
Eppendorf tubes and 50p] of 65°C Buffer AE added to each spin column filter. Columns
were incubated for 5 minutes with Buffer AE and centrifuged at 8,000xg for one minute.
The previous step was repeated and eluted genomic DNA stored at 4°C until utilized.
BOMAC cells challenged with either E. coli or the negative phagocytic control of
PBS were subjected to 10 minutes of incubation in cell lysis solution at room temperature
and then centrifuged for 2 minutes at 13,000xg to pellet cells. Supematants were
removed and cells suspended in 60ul of Nuclei Lysis Solution/tube. Following
suspension, lul of RNase A was added to each tube at 100mg/ml and solutions mixed by
inversion 3 times throughout a 10 minute incubation at 65°C. Solutions were allowed to
cool to room temperature for ~5 minutes and 20ul of Protein Precipitation Solution added
to each tube. Solutions were vortexed for 20 seconds and incubated on ice for 5 minutes.
Next, solutions were centrifuged for 4 minutes at 13,000xg and supematants removed to
new 1.5m] Eppendorf tubes containing 120p] of isopropanol. Supernatant and
isopropanol were gently mixed by inversion and centrifuged at 13,000xg for one minute
to pellet DNA. Following centrifugation, supematants were decanted and DNA washed
with 250ul of 70% ethanol by gentle inversion. DNA in 70% ethanol was centrifuged at
13,000xg for one minute to pellet DNA and ethanol removed by pipette. Tubes were
inverted and allowed to air dry for 10 minutes at room temperature. DNA was then
suspended in 100ul of Rehydration Solution/tube and incubated at 65°C for 60-120
minutes. Genomic DNA was quantified by spectrophotometry and visualized by
electrophoresis on 1% argrose gels. After rehydration, DNA was stored at 4°C until

utilized.

42

Quantitative real time PCR (Q-RT-PCR) was performed using primers [see Table
3.1] specific for genomic DNA sequences from E. coli (16S ribosomal), M
paratuberculosis (IS900) and bos taurus (GAPDH). As bacteria are destroyed within
BOMAC cells, their DNA will degrade. This destruction of bacterial DNA will lead to
fewer templates, either 168 or IS900, for real time PCR primers in proportion to the total
amount of genomic DNA collected (BOMAC and bacterial DNA). Conversely if the
bacteria are able to avoid destruction within BOMAC cells, bacterial DNA will remain
intact and continue to be used as template for real time PCR. Primers were designed
using Primer Express Version 2.0 (Applied Biosystems, Foster City, CA) [see Table 3.1]
and real time PCR was preformed by the following protocol.

In duplicate wells, purified genomic DNA from each time point (0, 1, 12, 24, 48,
72, and 96 hours) was used as template in amplification of GAPDH and either IS900 or
16S ribosomal DNA (treatment dependant). Amplification was preformed in an ABI
7000 Sequence Detection System (Applied Biosystems, Foster City, CA) using the
default 2-step amplification procedure and 2X SYBR Green Master Mix (Applied
Biosystems Foster City, CA) in 50p] reaction volumes with 300nM of each primer set
and 30-100ng of mixed genomic DNA (BOMAC and bacteria). After amplification
cycles to threshold (Ct) were converted to amounts of starting template by comparison to
standard curves generated for GAPDH, IS900 and 16S ribosomal DNA and solving the
equation y=mx +b (where m is the slope of the linear standard curve, b is the y-intercept
of that linear line in Ct, x is the log2 of the template concentration and y is the Ct of the
sample) for the template concentration. Once total amount of template material had been

determined, a simple ratio of bacteria DNA (168 or IS1900) to BOMAC DNA (GAPDH)

43

determined amounts of bacterial genomic DNA relative to amounts of BOMAC genomic
DNA. As stated above this ratio becomes smaller as bacteria are being destroyed by
phagocytosis within BOMAC cells, but remains constant if there is no bacterial
destruction or if amounts of bacterial and BOMAC starting templates decrease at equal
levels.

C. Cloning of Amplicons

DDRT-PCR amplicons suspected of representing differentially expressed
transcripts (see Chapter 2) were ligated into pGEM-T Easy plasmids using the pGEM-T
Easy System I (Promega Corp., Madison WI) that inserts DNA into a lacZ reporter gene.
Briefly, 5p] of PCR amplified amplicon (~100ng) was combined with 2X ligation buffer
(60mM Tris-HCI [pH 7.8], 20mM MgCl2, 20mM DTT, 2mM ATP and 10% PEG
[polyethylene glycol-8000]), 50ng of pGEM-T Easy plasmid vector, and 1U T4 DNA
ligase (in IOmM Tris-HCI [pH 7.4], 50mM KCl, lmM DTT, 0.1mM EDTA and 50%
glycerol). This mixture was incubated for 2 hours at room temperature (~25°C). Newly
prepared plasmids with inserted amplicons were then used to transform competent E.
coli-DHSa.

E. coli-DHSor, were removed from —80°C and allowed to thaw on ice. 50p]
aliquots (one for each plasmid) of bacteria were added to sterile ice chilled 1.5ml
Eppendorf tubes. One quarter of the plasmid ligation reaction (5 pl) was added to
competent E. coli and mixed gently by pipette. Transformation mixtures were then
incubated for 30 minutes on ice followed immediately by a heat shock of 42°C for 45

seconds. Heat shock was directly followed by incubation for 2 minutes on ice (cold

44

shock). After incubation, 900p] of room temperature SOC medium was added to each
Eppendorf tube containing the newly transformed cells.

Transformed E. coli were incubated at 37°C for 60 minutes with 250rpm
agitation, as recommended by the manufacturer, to allow expression of plasmid encoded
ampicillion resistance (Amp’) used as a selectable marker. Following incubation,
bacteria were centrifuged at 1000xg to pellet cells and growth media decanted. Bacteria
were suspended in 100p] of fresh room temperature SOC media and immediately spread
onto 60mm2 LB agar plates with 100ug/ml ampicillion, 20mM IPTG (isopropylthio-B-
galactoside), and 0.5ng X-gal (5-bromo-4—chloro-3-indolyl-B-D-galactoside). Plates were
covered and allowed to dry at room temperature (approximately 10 minutes), then
inverted and incubated overnight at 37°C.

After overnight incubation, 10-20 colonies from each amplicon were picked
utilizing blue/white screening (blue colonies arise from E. coli transformed with plasmids
that retain a functional lacZ gene and therefore have no inserted amplicon). Individual
colonies were added to 5ml of LB media with lOOug/ml ampicillion and grown overnight
at 37°C with agitation. After overnight growth, lml of the culture was retained at -80°C
as a glycerol stock. Remaining transformed bacteria were lysed for plasmid recovery.
Recovery of plasmids was preformed using the Promega Wizard Plus Miniprep DNA
Purification System (Promega Corp., Madison WI).

Briefly, bacterial cultures were centrifuged at 1600xg to pellet cells and facilitate
removal of growth media. After removing growth media by vacuum, bacteria were
resuspended in 200p] of Cell Resuspension Solution/culture and transferred to 1.5ml

Eppendorf tubes. Cell Lysis Solution (200ul) was then added to each tube and tubes

45

inverted 4-6 times to facilitate cell lysis. Cell lysis was brought to a halt by the addition
of 200p] of Neutralization Solution and inversion 4-6 times. Tubes were centrifuged at
13000xg for 20 minutes to separate cell lysate from bound protein. After centrifugation
cell lysate was loaded onto a DNA binding column with 1.0ml of DNA Binding Resin
and incubated for 60 seconds at room temperature. Lysate mixture was pulled through
the DNA binding column with vacuum and each column washed with 2.5m] of Column
Wash Solution. Columns were removed from vacuum and transferred to a 1.5m]
Eppendorf tubes and centrifuged at 13000xg for 2 minutes to remove residual Column
Wash Solution. After centrifugation, columns were transferred to new 1.5m] Eppendorf
tubes and 50p] of 65°C double distilled water (ddH2O) added to each column to elute
DNA. Columns and water were incubated for 60 seconds at room temperature followed
by centrifugation at 13,000xg for 30 seconds. Insertion of DDRT-PCR derived
amplicons was checked by restriction digest and PCR amplification. Quality of plasmid
and insert DNA was observed by gel electrophoresis on 1% agarose gels.
D. DNA Sequencigg

Cloned, DDRT-PCR derived amplicons were sequenced using an ABI Prism Dye
Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City CA)
according to the manufacture’s protocol. Briefly, plasmids containing amplicons were
purified from E. coli-DH50t as stated above and between 250-500ng of plasmid DNA
was mixed with 8.0111 of Terminator Ready Reaction Mix (A-Dye Terminator, C-Dye
Terminator, G-Dye Terminator, T-Dye Terminator, dTTP, dITP, dCTP, dATP, thermal
stable pyrophosphatase, MgC12 and AmpliTaq DNA Polymerase FS), 0.16uM SP6

primer, and 0.16uM M13-Forward primer. Once mixed reactions were subjected to the

46

following therrnalcycling conditions: [96°C, 10 seconds; 50°C, 5 seconds; 60°C, 4
minutes]25. The now fluorescently labeled amplicons were purified with the following
protocol.

Sequencing reactions were transferred from 0.2m] thin walled PCR tubes to 1.5m]
Eppendorf tubes where 50p] of ethanol and 2.0ul 3M sodium acetate were added to each
reaction. This mixture was vortexed and placed at -20°C for 2 hours to precipitate
labeled DNA. After precipitation, DNA was centrifuged at 13000xg for 30 minutes at
4°C to pellet DNA. Supematants were decanted and pelleted DNA rinsed with 250ul of
70% ethanol. DNA was centrifuged at 13000xg for 5 minutes at 4°C and supematants
decanted. Next, DNA was centrifuged under vacuum for 5 minutes until dry. Finally 6p]
of loading buffer (25mM EDTA [pH 8.0] with 50mng Blue Dextran and forrnamide at
a ratio of 1:5) was added and DNA suspended by a combination of heating to 95°C for 2
minutes and vigorous vortexing.

Sequencing gels were prepared using the protocol described in Chapter 2 for
DDRT-PCR amplicon separation gels. Briefly, a 0.2mm thick 5.2% Bis-acrylamide gel
was poured between sequencing grade glass plates and allowed to polymerize. Once,
polymerized sequencing gels were placed into an ABI 373 Automatic DNA Sequencing
Apparatus (Applied Biosystems, Foster City CA) and 1X TBE (Tris-HCI, Boric Acid and
EDTA) buffer added to the top and bottom buffer chambers. Finally, DNA sequencing
samples were heated to 95°C for 4 minutes and loaded into wells on the sequencing gel.
The 373 Sequencing Apparatus was then activated and run overnight (16 hours) where a
combination of laser excitement of fluorescent dyes and computer recording yielded

DNA sequences for the various amplicons.

47

E. Sequence Analysis and Identification

Amplicon sequences were visualized and edited using Chromas Software
(Technelysium, Queensland, Australia). After editing, DNA sequences were compared to
known nucleotide sequences available in the NCBI public databases (Genbank NR) using
BLASTN (Basic Local Alignment Research Tool for Nucleotides) analysis to discover
probable identifications. Amplicon sequences were also translated into protein sequences
(in all six frames) and compared to known protein sequences on the NCBI PIR database
by using BLASTX (Basic Local Alignment Research Tool for Protein) to determine if
translated DNA sequences showed any similarity to proteins in public databases. Finally,
DNA sequences were compared to a database of proteins that had been back translated
into DNA using the tBLASTx search tool.
F. Northern Blot Hybridization

Total BOMAC RNA was collected from each of the four phagocytic treatments
and 5-10ug of RNA for each treatment (depending on the gel) mixed with equal volumes
of formarnide containing loading buffer and heated at 65°C for 10 minutes to denature
RNA. RNA was loaded into the wells of 1% denaturing formaldehyde/agarose gels and
electrophoretically separated. Electrophoresis conditions were 60-80V for 3-5 hours
(again depending on the gel). Total BOMAC RNA and Millennium RNA Sizing Ladders
(Ambion Inc., Austin, TX) were run in the first and second lanes of the gel, respectively.
After electrophoresis, these two lanes were excised from the gel and stained with ethidum
bromide. Distances traveled through the denaturing argrose gel were measured for each

size standard. This data was used to plot distance vs. size (standard plot). When

48

Northern hybridizations were preformed, distances to DDRT-PCR amplicon
hybridization bands were compared to the standard plot for hybridization band size.

Separated treatment RNAs, which remained on the remainder of the denaturing
gel, were transferred to nylon membranes (Hybond XL, Amersham Pharmacia Biotech.,
Buckinghamshire, UK) using the overnight (15-18 hours) “wicking technique” in 20X
SSC (Sodium Citrate and Sodium Chloride) (Ausubel et al., 1987). Following transfer,
UV cross-linking was preformed to fix RNA to membranes. Final membranes were
stored at —20°C until utilized. Before probing blots with radiolabeled [ll-321)] cDNA
probes, Northern blots were removed from —20°C and allowed to soak in room
temperature 6X SSC for 15 minutes to reduce background.

Northern blot hybridization probes were derived from amplicons eluted from
DDRT-PCR gels [see Chapter 2] and then cloned [see above]. Cloned amplicons were
PCR amplified using the following protocol: 50ng of plasmid was mixed with 10X PCR
Buffer (200mM Tris-HCl [pH 8.4], 500mM KCl), 2uM SP6 primer, 2uM M13-Forward
primer, 0.5mM dNTP mix (dATP, dTTP, dGTP, and dCTP) and 5U Taq Polymerase and
the following conditions: 95°C, for 10 minutes, [94°C, 60 seconds; 56°C, 60 seconds;
72°C, 60 seconds]30 72°C, 10 minutes. Next, amplicons were radioactively labeled using
a Random Prime Labeling Kit (Invitrogen Life Technologies, Inc., Gaithersburg, MD) as
described by the manufacturer but with some modifications. Briefly, 100ng of PCR
amplified DNA (plasmid insert) was denatured at 95°C for 10 minutes and mixed with
sorter [or-32F] dCTP, 20uM dTTP, 2014M dATP, 20uM dGTP, 15p of Random Primers
Buffer Mixture (0.67M HEPES, 0.17M Tris-HCI, 17mM MgC12, 33mM 2-

mercaptoethanol, 1.33mg/ml BSA, 18 units/ml OD. 260 oligodeoxyribonucleotide

49

primers (hexamers), pH6.8) and 3U Klenow Fragment. Mixture was allowed to incubate
for 2 hours at room temperature and reactions halted by the addition of EDTA to a final
concentration of 0.2M. The radiolabeled probe was separated from unincorporated [or-
32P] dCTP by a 30 second centrifugation at 2000xg through a Sephadex G-50 exclusion
chromatography column (Amersham Pharmacia Biotech., Buckinghamshire, UK). The
radioactive probes were then used for Northern blot hybridizations.

Prior to hybridization membranes were blocked in a hybridization oven for 2
hours at 68°C with 1mg of heat-denatured (10 minutes at 95°C) sheared herring (or
salmon) sperm DNA in 5ml of Perfect Hyb Solution (Sigma Chemical Corp, St. Louis,
MO). Blocking solution was decanted and 2x10°- 2x107cpm of heat-denatured probe
with 0.5mg heat-denatured sheared herring (or salmon) sperm DNA in 5ml of Perfect
Hyb Solution added to Northern blot membranes. Membranes were allowed to hybridize
with radiolabeled probes overnight (16-18 hours) at 65-68°C (depending on the Northern
blot). Following hybridization, membranes were removed from the radioactive
hybridization solution and washed twice at room temperature in 2X SSC, 0.1% SDS and
then twice at 65°C in 0.1X SSC, 0.1% SDS to remove unbound probe. Washed
membranes were exposed to X-ray film with intensifying screens and incubated at —80°C
for 24-48 hours prior to development using a Futura 200E Automatic X-ray Film
Processor (Fischer Industries Inc., Geneva IL).

IV. Results
A. meterial Survival
Quantifying amounts of bacterial DNA utilizing Q-RT- PCR and then

normalizing those amounts to amounts of BOMAC DNA in each time point sample

50

yielded two dramatically different curves (one for GAPDH and one for bacterial 168 or
IS900 amplification) even though the quantities of DNA obtained from each time point
across both treatments were strikingly similar [see Figure 3.1]. Table 3.2 contains
relative mean values for E. coli DNA normalized to amounts of BOMAC DNA present
within each time points from zero to 96 hours post introduction and corresponding
standard errors for each relative mean value. Data from this table are illustrated in Figure
3.2 where the x-axis represents time of incubation until collection and the y-axis
represents relative mean normalized DNA quantities. Data presented in Table 3.2 and
Figure 3.2 suggests that E. coli are undergoing destruction as soon as one hour after
introduction and fully degraded within BOMAC cells by 12 hours post introduction of
bacteria. At all collection time points amounts of E. coli DNA were determined to be
significantly lower by students t-test (p > 0.01) than levels observed at time point zero.
M paratuberculosis are successfully ingested by BOMAC cells [see Appendix
Three: Figure A3.1] but in contrast to E. coli, M paratuberculosis are not degraded by
BOMAC cells within the 96-hour time course [see Table 3.3, Appendix Three: Figure
A3.2]. When data from Table 3.3 were represented graphically, [see Figure 3.3] it was
observed that relative amounts of GAPDH normalized M paratuberculosis DNA
fluctuated over the time course but that overall amounts of DNA did not diminish
significantly throughout 96-hour post treatment. This failure of BOMAC cells to degrade
M paratuberculosis following phagocytosis is consistent with observations of M
paratuberculosis survival within bovine peritoneal macrophages (Tessema et al., 2001).

B. DNA Sequencing, Sequence Analysis and Identification

51

Direct DNA sequencing and BLASTN analysis of cloned amplicons [Appendix 2]
representing differentially expressed genes were used to determine putative gene
identification and function [see Table 3.5]. DNA sequence of amplicon 3-1-4
(upregulated by E. coli and latex beads but not M paratuberculosis) was highly similar to
that of a Rattus norvegicus nucleolin-related protein (N RP) mRN A (Genbank
NM_022621) with 90% similarity over 379bp and a corresponding expectation value of
e’” '. DNA sequence of amplicon 5-4-2 was 87% similar to a hypothetical Homo sapiens
protein, MGC14817, mRNA (Genbank NM_032338) over 369bp and a corresponding
expectation value of e"°4. Sequence derived from amplicon 4-1-6 yielded an 85%
similarity over 145bp to Homo sapiens mRNA encoding epithelial stromal interaction 1
protein (BRESI-l) with an expectation value of 4x 624 (Genbank AF396928.). DNA
sequence for amplicon 5-2-10 was highly similar to the bovine sequence for
Nicotinamide adenine dinucleotide dehydrogenase (F NADH dehydrogenase) subunit 1
(Genbank AF493542). This identification yielded an expectation value of zero and 100%
similarity over 339bp. Further DNA sequence comparisons were preformed utilizing the
BLASTX program available from NCBI that translates DNA sequence into protein
sequences in all 6 open reading frames (3 forward and 3 reverse) [see Table 3.5].

Comparison of translated DDRT-PCR derived amplicon sequences with the
NCBI protein database (PIR) confirmed identifications obtained utilizing DNA
nucleotide BLASTN. Translated sequences from amplicons 3-1-4 and 5-2-10 again
showed similarity to the nucleolin related protein (Genbank AAH05460. 1) and NADH

dehydrogenase subunit I protein (Genbank NP_008095), respectively, while amplicons 5-

52

4-2 and 4-1-6 showed similarity to the hypothetical protein MGC1487 (Genbank
NP_115714) and BRESl-l protein (Genbank AAH23660).

As a final confirmation of amplicon identities, another type of BLAST program
was utilized to compare amplicon sequences to the NCBI (Genbank NR) database [see
Table 3.5]. The tBLASTx program performs a back translation of all protein sequences
in the NCBI database. This database of back translated DNA sequences are then
compared to query DNA sequences, in this case DDRT-PCR amplicons, for probable
identification. Results from the tBLASTx are outlined in Table 3.5, and were identical to
those obtained by both nucleotide BLAST and BLASTX procedures.

C. Northern Blot Hybridization

Probing of Northern blots made from total BOMAC cell RNA from the three
phagocytic treatments (M, E and PC) and the no phagocytosis control (NC) with each
cloned amplicon insert resulted in [see Figure 3.5, 3.6, 3.7 and 3.8] a single band in each
treatment which hybridized to corresponding RNA transcripts. Band intensities were
determined using densitometry and normalized to corresponding treatment GAPDH
transcript intensities to account for potential RNA loading differences. Phagocytic
treatment gene expression levels were then calibrated to no phagocytosis (NC) control
levels for comparison across the three phagocytic treatments.

Amplicon 3-1-4 [see Figure 3.4] yielded a single band with hybridization to an
RNA transcript of ~3. 1 Kb. Transcript levels (represented by amplicon 3-1-4) in
BOMAC cells exposed to M paratuberculosis (M) were similar to levels observed in
negative control or non-challenged BOMAC cells (NC) [see Table 3.4]. Conversely,

BOMAC cells exposed to latex beads (PC) or E. coli (B) increased expression of the 3-1-

53

4 transcript, by 8-fold and 10.5-fold respectively, over expression levels observed in
negative control BOMAC cells (NC). Direct comparison of normalized 3-1-4 transcript
levels from treatments M and E yields a greater then 10.6-fold higher level of expression
in BOMAC cells following phagocytosis of E. coli (E) relative to similar cells following
phagocytosis of M paratuberculosis (M). We conclude that amplicon 3-1-4 represents a
subset of genes whose expression levels are up regulated following phagocytosis of E.
coli and latex beads but not M paratuberculosis [see Figure 3.4].

Amplicon 5-2-10 [see Figure 3.5] hybridized to distinct RNA transcripts of 1.1Kb
in RNA from each of the four treatments. Amplicon 5-2-10 transcript levels in BOMAC
cells following phagocytosis of M paratuberculosis were slightly higher (1 .7-fold) then
levels observed in negative control or non-challenged BOMAC cells (NC) [see Table
3.4]. In contrast, BOMAC cells exposed to latex beads (PC) or E. coli (E) yielded 5-2-10
expression levels, 5.7-fold and 10.3-fold respectively, higher then levels observed in
negative control or non-challenged BOMAC cells (NC). Direct comparison of amplicon
5-2-10 transcript levels in M and E treatments showed 5.8-fold higher expression levels
in BOMAC cells following phagocytosis of E. coli (B) relative to similar cells following
phagocytosis of M paratuberculosis (M). We conclude that amplicon 5-2-10 represents
genes whose expression is increased following phagocytosis of all three phagocytic
stimuli, but expression levels are markedly higher with either E. coli or latex beads then
with M paratuberculosis.

Northern blot hybridizations for amplicon 5-4-2 hybridized to an RNA transcript
of 750bp in RNA from each of the four treatments [see Figure 3.6]. Amplicon 5-4-2

transcript levels in BOMAC cells exposed to M paratuberculosis (M) were 5.5-fold

54

lower then levels observed in negative control or non-challenged BOMAC cells (NC)
[see Table 3.4]. Conversely, BOMAC cells exposed to latex beads (PC) or E. coli (B)
have only nominal (1.4-fold and 1.5-fold respectively) increases in expression of the 5-4-
2 transcript relative to negative control BOMAC cells (NC). Direct comparison of
normalized transcript 5-4-2 levels from treatments M and E yields a greater then 8.5-fold
higher expression level in BOMAC cells following phagocytosis of E. coli (E) relative to
similar cells following phagocytosis of M paratuberculosis (M) [see Table 3.4]. We
conclude that expression of the gene represented by amplicon 5-4-2 is specifically
repressed following phagocytosis of M paratuberculosis (M), but not latex beads (PC) or
E. coli (E).

Finally, amplicon 4-1-6 hybridized to an RNA transcript of~l .6Kb in RNA from
the four treatments [see Figure 3.7]. Amplicon 4-1-6 transcript levels were suppressed in
all three phagocytic treatments [see Table 3.4]. Interestingly, 4-1-6 transcript levels in
BOMAC cells following phagocytosis of M paratuberculosis (M) were 3.3-fold lower
then levels observed in BOMAC following phagocytosis of E. coli (E). Amplicon 4-1-6
therefore represents genes that appear to be repressed following the general process of
phagocytosis although levels of repression across the three phagocytic treatments appear
to be stimuli specific.

V. Discussion

M paratuberculosis is the casual agent of Johne’s disease in ruminants and
responsible for substantial world wide economic losses ($200 million/ year) to the dairy
and beef industries worldwide (Jones et al., 1989). Understanding how this bacterium is

able to suppress or redirect host immune responses and specifically how it is able to

55

survive within the hostile environment of host macrophage phagosomes may aid
development of treatments for this disease in cattle as well as similar diseases in other
animals, possibly including humans afflicted with Crohn’s disease, leprosy or
tuberculosis.

As outlined in Chapter 2 our group used DDRT-PCR as a primary screening tool
to examine differences in gene expression 60 minutes after introduction of three
phagocytic stimuli representing: 1) bacteria that are readily degradable (E. coli); 2)
bacterium that are not degraded (M paratuberculosis); and 3) latex beads as a positive
control for macrophage phagocytosis but not macrophage phagocytic destruction and
PBS as a negative control for phagocytosis. By using the immortalized bovine
macrophage cell line BOMAC in all experiments we eliminated levels of variability that
would be introduced by repeated harvesting and ex vivo stimulation of monocyte derived
macrophages (MDM). This cell line exhibits many well-characterized properties of
macrophages including the ability to phagocytize particles (Stabel and Stabel, 1995). For
BOMAC cells to be useful in this study it was necessary to demonstrate that BOMAC
cells also behaved like primary bovine macrophages during phagocytosis of bacteria such
as E. coli and M paratuberculosis.

Utilizing quantitative real time PCR (Q-RT-PCR) it was possible to quantify
amounts of bacterial DNA relative to total DNA (bacterial and BOMAC) and thus
relative amounts of intact bacteria, by using bacterial DNA as a template for
amplification. Primers were designed to flank DNA regions specific for E. coli (16S), M

paratuberculosis (IS900) and the BOMAC cell line (GAPDH). At time points along the

56

96-hour incubation, challenged BOMAC cells were harvested and total genomic DNA
collected and subjected to real time PCR for detection of bacterial DNA.

Based on Q-RT-PCR analysis of IS900 elements, M paratuberculosis putatively
survived for at least 96 hours within BOMAC phagosomes, while amounts of E. coli
DNA were determined significantly reduced by students t-test (p > 0.01) within 60
minutes after bacterial introduction. By 12 hours following introduction of bacteria, M
paratuberculosis DNA was still at levels similar to the starting concentration but E. coli
DNA was reduced to levels of zero. These data support that BOMAC cells are able to
readily phagocytize both E. coli and M paratuberculosis and that E. coli are readily
destroyed by BOMAC cells while M paratuberculosis remains intact. M
paratuberculosis DNA levels are not an artifact of BOMAC destruction (see caveat to
bacterial survival) as there were similar concentrations of total genomic DNA obtained at
each time point throughout the time course.

Of the more then 380 amplicons derived by DDRT-PCR, only 6 were cloned into
plasmid vectors and used as probes for Northern blot hybridizations. This low number of
cloned amplicons is due to an inability to amplify DDRT-PCR derived amplicons to
sufficient levels where ligation into plasmids was possible. Of the six amplicons that
were successfully cloned into plasmid vectors, four were sequenced and used for
Northern blot hybridization probes.

Amplicon 3-1-4 was identified as the gene that encodes for the nucleolin-related
protein (N RP). Following a 60 minute challenge with E. coli or latex beads, NRP gene
expression was up regulated greater then 10 fold over gene expression observed in resting

BOMAC cells. Conversely in M paratuberculosis challenged cells NRP gene expression

57

remained at levels consistent with gene expression levels in resting BOMAC cells. NRP
is an interesting but not well characterized gene product. As its name implies it is related
to the better characterized nucleolin which shares with NRP an ability to bind calcium
(Sorokina and Kleinman, 1999). This ability to bind calcium is of primary import in how
NRP expression may affect bacterial destruction through the endocytic pathway and
generation of oxygen metabolites.

Calcium has many different roles within cells. It has been proposed as a second
messenger in the signal transduction relevant to the generation of oxygen metabolites by
phagocytic cells (Forehand et al., 1989; Korchak et al., 1988; Tse and Tse, 1999). In fact,
increases in cytosolic calcium concentration are essential for activation of the phagocyte
respiratory burst, production of nitric oxide, secretion of microbicical granule
constituents and synthesis of pro-inflammatory mediators including TNF-a (Denlinger et
al., 1996; Kim-Park et al., 1997; Tapper et al., 1996; Watanabe et al., 1996). Calcium is
essential for destruction of M tuberculosis (Majeed et al., 1998).

Activation of macrophages has been shown to coincide with a brisk increase in
intracellular calcium levels (Marodi et al., 1993). Degradable bacteria such as heat killed
M tuberculosis induce a rapid and significant rise in macrophage calcium concentrations
while macrophages that have ingested viable M tuberculosis do not have increase in
calcium concentrations (Malik et al., 2000). This lack of increase in intracellular calcium
concentration associates with mycobacterial survival within macrophages (Malik et al.,
2000)

Virulent M tuberculosis are able to inhibit complement receptor mediated

calcium signaling. This alteration of macrophage activation contributes to inhibition of

58

phagosome-lysosome fusion and promotion of intracellular mycobacterial survival. This
lack of initiation of calcium signaling may be a general property of pathogenic M
tuberculosis and possibly other pathogenic Mycobacteria such as M bovis and M
paratuberculosis (Malik et al., 2000). Not only the role of calcium but also the role of
calcium binding proteins has been investigated in bacterial destruction.

Both annexin and calmodulin are proteins that have the ability to bind calcium
and have been shown to play roles in bacterial destruction through the endocytic
pathway. Annexin translocation brings calcium to phagosomes inducing phagosome/
lysosome fusion (Majeed et al., 1998). Calmodulin also associates with phagosomes and
is associated with phagosomes that contain virulent M tuberculosis at levels that are
lower then levels observed with heat killed M tuberculosis (Malik et al., 2001 ).

To date NRP has not been investigated for any role in endosome maturation or
bacterial destruction, but NRP does have many characteristics that make it an ideal
candidate for further study. NRP has been shown to associate with the membrane
cytoskeleton in the presence of calcium (Sorokina and Kleinman, 1999). This association
may affect stabilization of the cytoskeleton and maturation of phagosomes through the
endocytic pathway (Sorokina and Kleinman, 1999). Probably the most significant piece
of evidence for NRP involvement in Mycobacterial destruction is described in a paper by
Garcia et al. in 2000. In this paper, Mycobacterial infection decreased the amount of
“phosphonucleolin” while dead bacilli or LPS showed no diminishing effects (Garcia et
al., 2000). This “phosphonucleolin” shows a remarkable similarity to NRP through
BLAST analysis and it is possible that Garcia et a1. were in fact measuring NRP levels.

These data would be consistent with results presented in this paper. Taken together

59

available data suggests calcium and various calcium binding proteins, such as NRP, are
important in destruction of virulent Mycobacteria such as M paratuberculosis.

Expression of the NADH dehydrogenase subunit 1 gene (amplicon 5-2-10) failed
to increase above negative control levels during challenge with M paratuberculosis.
However, stimulation with E. coli increased NADH dehydrogenase subunit 1 gene
expression greater than 5 fold. The NADH dehydrogenase subunit 1 gene encodes for a
protein that has roles in energy metabolism as well as substrate modification (Yagi and
Matsuno-Yagi, 2003; Yano et al., 2002) by catalyzing the initial reaction of the electron
transport chain, the reaction of NADH to NAD+.

Ragno and colleagues investigated the effect of M tuberculosis on murine
macrophage gene expression using DDRT-PCR and observed a change in gene
expression that parallels results our group observed for NADH dehydrogenase subunit 1.
Data presented by Rango et a1. indicated a down-regulation in expression of cytochrome
c oxidase subunit VIIc when murine macrophages were challenged with virulent M
tuberculosis relative to gene expression levels observed with heat killed M tuberculosis,
M tuberculosis BCG or latex beads (Ragno et al., 1997; Ragno et al., 1998). As
reviewed by Weiss et al. (Weiss et al., 1991) cytochrome c oxidase catalyzes the terminal
reaction in the electron transport chain while NADH dehydrogenase catalyzes the initial
reaction.

Interfering with the electron transport chain by suppressing gene expression in the
case of NADH dehydrogenase subunit 1 or down-regulating cytochrome c oxidase would
allow survival of intracellular Mycobacteria by interfering with an infected macrophage’s

ability to generate reactive oxygen species, which are important for antimicrobial defense

60

in macrophages. In this case the NADH dehydrogenase protein, along with the rest of the
electron transport chain proteins are embedded in the phagosomal and plasma
membranes. Alternatively, suppression of NADH dehydrogenase gene expression could
result in altered susceptibility to apoptosis 3 key feature of Mycobacterial survival.
NADH dehydrogenase is imbedded in the mitochondrial cell membrane. Modifying the
properties of mitochondrial membranes in infected macrophages may disrupt the
macrophages ability to undergo apoptosis (Ragno etal., 1997; Ragno et al., 1998).

The exact role of gene expression modulation during M paratuberculosis
phagocytosis is not yet known. It is possible that M paratuberculosis actively induces
changes in gene expression within macrophages and these changes allow for bacterial
survival or that there are factors such as bacterial cell wall components responsible for
these changes in gene expression. By studying how M paratuberculosis and other
Mycobacteria affect their chosen niche we will gain insight on how this intracellular
bacteria is able to live in this hostile environment. Continuing work will reveal how and

why these changes come about on a molecular level.

61

Figure 3.1 — Bacterial Survival Quantified by Real Time PCR.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

mam
inc-com ._., -4-- . ~ -
. xii?"
, / .sd/
1.09“” L. _.. "
GAPDH
amplification ,'
curves ,5
E . 1 ’
9mm .
a ’ IS900
1’ amplification
. , ’-- - A
/ , ‘ , t. .5 curves
. i 'J .
-. . . t f _/ .' . .
roam , .3 :7 . -
I. m‘ . . .—.i
_ ‘ x. V. ‘. . .1 . ,_ r" r? - ‘ '
‘ .1 . , . .3 . , 1 . . ‘
.. .lr ) V--,‘ ..'_ 3:. l “fin“ . ‘1‘ ’1 :1, ‘1' . i
~ . l.. t, j _ I" ' ‘3 a" \ . f A V 4
.‘l. . j. I ,1 it. "\\‘~.\. I: ‘1 - 'j :1" ”Al. I ,M l L]
Lao-one ' ”I \ “ ' “a" r" , i
12346070010H1213141516171.10232122fl24262527282033313233MSGN373N¢
Cycle Number

 

The Real Time PCR amplification plot shown above clearly shows two distinct groups of
DNA amplification. The curves ion the center of the picture is those generated using the
primers designed to amplify GAPDH from the BOMAC genomic DNA. While the curves
on the right side of the figure are fiom primers designed to flank the specific M
paratuberculosis DNA IS900 sequence. A similar set of curves were generated using E.
coli challenged BOMAC (GAPDH and 16S respectively).

62

Figure 3.2 — Survival of E. coli in BOMAC Cells.

 

 

 

 

 

 

 

 

9.0 ‘1
8.0 4
<
E 7.0 «
(I)
E 6.0 <
5—
O
g 5.0 1
E
S 4.3 - *
0 Mi..-
5 3.0 1
é’
u :0 ~
.2.
% LO ale :1: :3: 2k :3:
at Y ‘
.0 , l’i,r*-1 {11 Th [:1,
I r 12 24 as 72 96
Incubation Time (hr)

 

Relative levels ofamplification for E. coli 1 6S ribosomal DNA decreases significantly by
students t-test (*) (p > 0.01) across all time points (I, 12, 24, 48, 72 and 96 hours) when
compared to time point zero hour. Relative amounts of GAPDH (BOMAC template)
remain constant across all time points (line) and thus this decrease in template ratio
implies decreasing levels of E. coli across the time course.

63

Figure 3.3 — Survival of M. paratuberculosis in BOMAC Cells.

 

 

 

Relative Mean Quantity of IS900 DNA

   

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

o r 12 24 4s 72 96
Incubation Time (hr)

 

 

Amounts of M paratuberculosis IS900 template DNA relative to BOMAC template DNA
appear to decrease slightly by 12 hours but increase again to levels higher then starting
levels by 48 hours. By 96 hours post introduction, relative levels of IS900 template DNA
return to levels observed at time point zero implying survival of M paratuberculosis
following phagocytosis by BOMAC cells. Relative levels of GAPDH (BOMAC template)
are constant across all time points (line). Therefore, changes in ratios reflect changes in
M paratuberculosis concentration.

Figure 3.4 - Northern Blot Hybridization Utilizing the Cloned Amplicon 3-1-4.

 

 

 

4— 3.110)

 

1— 1.6510!

 

 

 

 

 

 

 

Northern Blot Hybridization preformed with the cloned amplicon 3-1-4 yielded a band at
3. 1 Kb which showed diyfkrential hybridization across the four treatment groups.
GAPDH hybridization (band at 1.65Kb) was preformed to normalize for RNA loading
differences across the four treatments. The four lanes are BOMC treated with negative
control of PBS WC), M paratuberculosis treatment (M), E. coli treatment (E), and latex
beads as a positive control (PC).

Figure 3.5 — Northern Blot Hybridization Utilizing the Cloned Amplicon 5-2-10.

 

 

 

4— 1.110:
4.— 1.65m

 

 

 

 

 

 

 

Northern Blot Hybridization preformed with the cloned amplicon 5-2-10 yielded a band
at 1.1Kb which showed diflerential hybridization across the four treatment groups.
GA PDH hybridization (band at 1.65Kb) was preformed to normalize for RNA loading
diflerences across the four treatments. The four lanes are BOMAC treated with negative
control of PBS (NC), M paratuberculosis treatment (W, E. coli treatment (E), and latex
beads as a positive control (PC).

65

Figure 3.6 - Northern Blot Hybridization Utilizing the Cloned Amplicon 5-4-2.

 

 

5-4-2

4— 75%|)

 

+— 1.6510)

 

 

 

 

 

 

Northern Blot Hybridization preformed with the cloned amplicon 5 -4-2 yielded a band at
75 0bp which showed differential hybridization across the four treatment groups.
GA PDH hybridization (band at 1. 65Kb) was preformed to normalize for RNA loading
differences across the four treatments. The four lanes are BOMAC treated with negative
control of PBS (NC), M paratuberculosis treatment (M), E. coli treatment (E), and latex
beads as a positive control (PC).

Figure 3.7 — Northern Blot Hybridization Utilizing the Cloned Amplicon 4-1-6.

 

 

4-1-6
NC M E PC

    

,2 +— 1.6K]!

 

.. 5 .— 1.6510!

 

 

 

 

Northern Blot Hybridization preformed with the cloned amplicon 4-1-6 yielded a band at
1. 6Kp which showed differential hybridization across the four treatment groups.
GAPDH hybridization (band at 1.65Kb) was preformed to normalize for RNA loading
differences across the four treatments. The four lanes are BOMAC treated with negative
control of PBS (NC), M paratuberculosis treatment (M), E. coli treatment (E), and latex
beads as a positive control (PC).

66

Table 3.1 - Real Time PCR Primers.

 

Fragment Size

Primer Name Sequence (hp)
GAPDH-FORWARD 5'-GCA TCG TGG AGG GAC TTA TGA

GAPDH-REVERSE 5'-GGG CCA TCC ACA GTC TTC TO 6]
l6S-FORWARD 5'-CGT GTT GTG AAA TGT TGG GTT AAG 63
16S-REVERSE 5'-CCG CTG GCA ACA AAG GATA

IS900-FORWARD 5'-TGG TAG CCA GTA AGC AGG ATC A 60
IS900-REVERSE 5'-TGG AAC GCG CCT TCG A

 

This table contains the forward and reverse sequences for all three sets of primers
designed and employed for real time PCR bacterial survival (GAPDH for BOMAC cells,
1 65 for E. coli, and IS900 for M paratuberculosis.

Table 3.2 — Quantification of E. coli Survival Using Real Time PCR.

 

Mean Normalized

Time (hr) _DN_A Std_e_rr
0 6.82 0.8351

1 3.48 0.2014

12 0.41 0.0879

24 0.27 0.0421

48 0.42 0.2521

72 0.40 0.2700

96 0.47 0.0000

 

Normalized amplification data obtained from Real Time PCR analysis using primers
designed to amplifiy genomic DNA fiom the GAPDH region in BOMAC cells and 1 6S
ribosomal DNA fiom E. coli.

67

Table 3.3 — Quantification of M. paratuberculosis Survival Using Real Time PC R.

 

 

 

Time Mean Normalized
(LIE) DNA m

0 4.14 0.1898

1 3.95 0.01 15
12 3.27 0.2649
24 3.60 0.0694
48 5.57 0.9943
72 5.02 0.2540
96 3.99 0.0288

 

Normalized Normalized amplification data obtained fiom Real Time PC R analysis using
primers designed to amplifiy genomic DNA from the GAPDH region in BOMAC cells
and IS900 DNA from M paratuberculosis.

Table 3.4 - Northern Blot Hybridization Information Table.

 

Normalized M Nonnalired M Normalized E Normalized E Normalized PC Normalized PC
Treatment Values Treatment Values Treatment Values Treatment Values Treatment Treatment Values
Clone Fold Difference Result Fold Difference Result Fold Difference Result
3-1-4 -1 .01 Failure to activate 1049 Highly activated 7.93 Highly activated
5-2-10 1.78 Activation at low level: l0_31 Highly activated 5.66 Highly activated
5-4-2 -5.54 Suppressed 1.53 Activation at low level: 1.40 Activation at low levels
4-1-6 -6 7O Suppressed -2.0| Suppressed -l 1.87 Suppressed

 

Summation of gene expression levels obtained from Northern hybridizations confirms
stimuli dependent expression of the four DDR T-PCR derived amplicons. Genes
represented by amplicon 3-1-4 show no gene expression activation following M
paratuberculosis phagocytosis but high levels of activation following either E. coli or
latex bead phagocytosis. Genes represented by amplicon 5-2-10 show little gene
expression activation following M paratuberculosis phagocytosis but high levels
following E. coli or latex bead phagocytosis. Amplicon 5-4-2 represents genes whose
expression appears to be specifically suppressed following M paratuberculosis
phagocytosis and activated at low levels following E. coli or latex bead phagocytosis.
Finally, amplicon 4-1-6 is represenative of genes whose expression is suppressed
following phagocytosis of any of the phagocytic stimuli (M paratuberculosis, E. coli or
latex beads) but the levels of suppression vary across treatment.

68

.«AEEENQEL TEES Ree u a.» FOO: £83m ESESQQAI .N 3:35. macromoEAEQ EQVZ Nag 8.538on use:

2: EEE EEEE wetness 293328 «DANS mad .2396 decrease. E.cofioza S 383?.th a??? EE he: ES $65353
5295 38:235. RN92 S nooemawmm Eocmfie MEEQEE E hoSEE Es» ESEEN 28:35» hasten «ORR «QQE :SEEEEEo
ENE Hmvdmz mats EESE 3.8: E .525? $53 M5363 when 833 £295 BEEBPTE: N902 m5 2 BuEQEoo ES 825%
macho? «SE b ~E 5 3859.23» 39: mzooamfio xUKRKQQ .E:e£.8\:8 ESLQEK «2&WSS 3.3 SS» E.cofioz: ~90? 2: S
NomEQEoo $8an 39: amoemgom E.cofioza «ORR «QQ ES: 333$ :8: thEEE BEE» ~3wa 2t Essa? ESEoECEE
2823.3 «UKKMQQ .EE§\EE9§ stew SEEK 5.3» EREE octagon 35.3% BE Ramvfim 2.3.“.de E.coEESw

 

 

555.5 Sim—o3
5,225 osmofi
5:39.52
.253 cause 8823 v38.
cosmoEcoZ 3235
mcczasgm . .
2252338 52:
2:93

E

j-‘Ia’.n..t ill-II

 

 

 

 

<sz Aim—mm: _ 85825

 

£23 ease _ 5555 . we? 25:. €23 . .
nee; _mzoeam 223m 85: 2 m8 m _ 85225 _aegm 3:223 2 3:25 3 moo v _an 32:8 2:23 “538 28: f v
Eeégaoé 38% we? 33 Eeészoozrazooz 3a
522; 328%: 229$ 85: 2:2: 2”: 82 522; 3358»: 5205 5552:; 2293 Sam
:92
was $52 52.. ease;
.AEZV _ .233 82035.25 MES.» 3 2.3
. m .A o :3
:92 n. 228. was; 8m 8a _ E33 355 at :8 :32 E33 02.8.2.5 £58 2 .582
35.5552; . - 355$ .
833.5382 aewotoz 3:5. 83 72:32: as: 53282 E 0 522g Ba_2.=__8_u== 899:8 32mm 1 m
Suggafi £59 02?“. 855%: 52.5 was.” SEES: 255m osmz 256

 

Stir-nu... div ..lll..l I‘lli‘cultllllli'nlilsl .u‘oI. 0|.“

ink—23‘ Hm<dm cocoa—com <75 I m.m «fish.

69

CHAPTER FOUR

GENEREAL CONCLUSIONS AND DISCUSSION

The process of phagocytosis is essential for an effective host immune response to
intracellular bacteria. Although much is known about the general interactions between
M. paratuberculosis and host macrophages, the molecular mechanisms used by this
pathogen to survive are still largely unknown. Intracellular bacteria such as M.
paratuberculosis are only one of a large number of bacteria that have developed unique
and varied strategies to circumvent, redirect, shutdown or stop the process of
phagocytosis in resting macrophage cells. By avoiding destruction within macrophage
phagolysosomes, Mycobacteria in general and M. paratuberculosis specifically, have
found a niche in which they can survive and replicate. The hypothesis put forth in this
study is that phagocytosis of bacteria that resist destruction, such as M. paratuberculosis,
would yield observable differences in the pattern of host cell gene expression when
compared to gene expression patterns of cells following the phagocytosis of bacteria that
are easily degraded.

By utilizing an “open platform” genomic tool such as DDRT-PCR it was possible
to identify genes that have differences in expression among treatments involving the
phagocytosis of M. paratuberculosis, E. coli, latex beads or PBS as a negative control for
phagocytosis. This functional genomic tool was responsible for the discovery of genes
that fail to activate specifically during the phagocytosis of M. paratuberculosis, such as

genes encoding both the nucleolin related protein and the NADPH subunit 1 protein.

70

Also, DDRT-PCR led to the discovery of what appeared to be suppression of gene
expression in two other genes. When levels of gene expression during phagocytosis of
M. paratuberculosis for either of the hypothetical proteins MGC14817 or BRESI-I are
compared to levels of gene expression in no phagocytosis control cells, it is apparent that
there is a specific reduction in gene expression following phagocytosis of M.
paratuberculosis. Discovery of differences in gene expression for these four genes
during the process of phagocytosis is significant and opens possible new pathways of
research. Despite considerable progress reported here, DDRT-PCR as a technique for
comparative gene expression analysis has many major drawbacks.

At the time that Chapter 2 was published in Veterinary Immunology and
Immunopathology, our group had excised approximately 380 amplicons from DDRT-
PCR gels. By continuing work, our group excised over 450 amplicons from DDRT-PCR
gels. Of these 450 plus amplicons approximately 380 amplified successfully. Of these, it
was possible to clone 6 amplicons into plasmid vectors. When utilizing the DDRT-PCR
protocol, oligonucletide primers and Taq polymerase are utilized to amplify fragments of
expressed genes by PCR. By directly comparing levels of gene amplification across the
phagocytic treatments it is possible to visualize bacterial dependent differences in
macrophage gene expression.

In macrophages, the process of phagocytosis and bacterial destruction can occur
rapidly following receptor binding. In this series of experiments a 60 minute time point
was utilized to observe initial differences in host macrophage gene expression patterns
that may be important to bacterial destruction. Utilizing DDRT-PCR it is possible to

observe high levels of both false positive and false negatives (Motlik et al., 1998; Ragno

7l

et al., 1997; Rivera-Marrero et al., 1998; Sung and Denman, 1997). This drawback was
understood when our group decided the use DDRT-PCR as an “open platform” genomic
tool and we therefore confirmed all observed differences in gene expression by
quantifying gene expression in each treatment by Northern hybridization.

Four of the DDRT-PCR derived genes; nucleolin related protein gene, NADH
dehydrogenase subunit 1 gene, MGC14817 gene and BRESI-l gene, differed in their
levels of expression between the two phagocytic treatments. Both the hypothetical gene
MGC14817 and the BRESI-l gene have no known function and it is not known how their
changes in expression across the phagocytic treatments may impact the survival of M.
paratuberculosis. It is, however, possible to hypothesize the possible effect that
differences in expression of the other two genes may have on M. paratuberculosis
survival.

Failure to activate the gene for the nucleolin related protein may interfere with
intracellular calcium signaling or movement of M. paratuberculosis containing vesicles
along the macrophages cytoskeleton. Lower levels of NADH dehydrogenase subunit 1
gene expression following M. paratuberculosis phagocytosis may cripple the
macrophages ability to induce an effective ROS response or reduce the macrophages
ability to undergo apoptosis.

This series of experiments has shown that there are indeed vast differences in host
macrophage gene expression following the phagocytosis of M. paratuberculosis, when
compared to either non-challenged macrophages, macrophages challenged with E. coli or
latex bead challenged macrophages. These differences in gene expression may lead to

the investigation of new cellular pathways and hopefully a better understanding of the

72

molecular mechanisms underlying the ability of M. paratuberculosis to survive within

bovine macrophages.

73

CHAPTER FIVE

FUTURE RESEARCH

Discovery of genes that have different expression patterns depending on the type
of targets phagocytized was the main goal of this series of experiments. Future research
into this area might consist of two main thrusts. The first thrust could be an extension of
the current set of experiments.

Even though there are host genes with differences in expression during the
phagocytosis of M. paratuberculosis when compared to E. coli or latex beads, this does
not mean that these genes are important for survival of the Mycobacteria within
macrophage cells. It is possible that these genes could have very little to do with
Mycobacterial survival within macrophages. Therefore, the next stage of research should
test the hypothesis that observed gene expression differences are important for survival of
M. paratuberculosis in host macrophages. To test this hypothesis, overexpression
studies, gene knock out studies and protein expression studies should be preformed in
primary bovine macrophages and BOMAC cells.

One fairly elegant experiment that could be preformed would involve knocking
out the host genes one at a time by various techniques such as RNAi, and exposing the
cells to bacteria that are usually quickly degraded, like E. coli or killed M.
paratuberculosis. If these bacteria are able to remain in macrophages without being
degraded in phagolysosomes, then the knocked-out gene would appear to be important

for M. paratuberculosis survival (remember that all four genes discovered were either

74

down-regulated in gene expression or failed to have any gene expression levels above the
negative control during the process of M paratuberculosis phagocytosis). The second
thrust that should be undertaken would not involve the genes found in this series of
experiments but the attempt to identify more genes that have differences in their
expression across the same type of treatment groups.

This attempt at identification could make use of Michigan State University’s
Center for Animal Functional Genomics (CAF G) high-density bovine specific cDNA
microarrays that are now available (Suchyta et al., 2003). By utilizing these bovine
specific arrays it would be possible to run experiments designed to determine the effect of
M. paratuberculosis specifically on host cells. The test treatments could be expanded to
include other virulent forms of Mycobacteria such as M. bovis or non-virulent
Mycobacteria such as M. bovis (BCG) and M. avium. Other intracellular bacteria could
also be used to determine if there are genes that are affected by intracellular bacteria in
general. The possibilities of comparison are only limited to funding, the imagination of
the investigator and availability of sample. The main focus of these microarray
experiments would not even need to be as broad as finding out of host genes are
differentially expressed with M. paratuberculosis phagocytosis they could be used to
elucidate pathways that may be affected during the phagocytosis of M. paratuberculosis.
This approach would yield data that is much more relevant to disease management and

also to an overall understanding of how the bacterium affects its environment.

75

APPENDIX

76

APPENDIX ONE

CHAPTER TWO PUBLICAION PREMISSION

77

April 14, 2003 Our ref: TTookerMSUML4-O3

Brian C. Tooker

Michigan State University

1310 University Village, Apt. A.
East Lansing, MI 48823

E-mail: Tookerbr@msu.edu

Dear Dr. Tooker:

PUBLICA T ION DETAILS: VETERINARY IMMUNOLOGY AND
IMMUNOPA T HOLOG Y, 87(3-4):429-43 7, T ooker, Burton, and Coussens: “Survival
Tactics of M. paratuberculosis. . ., ” copyright 2002 Elsevier B V.

As per your letter dated March 2], 2003, we hereby grant you permission to reprint the
aforementioned material at no charge in your thesis subject to the following conditions:

I. If any part of the material to be used (for example, figures) has appeared in our
publication with credit or acknowledgement to another source, permission must also
be sought from that source. If such permission is not obtained then that material may
not be included in your publication/copies.

2. Suitable acknowledgment to the source must be made, either as a footnote or in
are reference list at the end of your publication, as follows:
“Reprinted from Publication title, Vol number, Author(s), Title of article, Pages No.,
Copyright (Year), with permission from Elsevier.”

3. Reproduction of this material is confined to the purpose for which permission is
hereby given.

4. This permission is granted for non-exclusive world English rights only. For other
languages please reapply separately for each one required. Permission excludes use
in an electronic form. Should you have a specific electronic project in mind please
reapply for permission.

5. This includes permission for ProQuest to supply single copies, on demand, of the
complete thesis. Should your thesis be published commercially, please reapply
for permission.

Yours sincerely,
Michael J. Lacovara
for Elsevier

Your future requests will be handled more quickly if you complete the online form at
u w w.us.clscv ierhggjtli £9111,

 

78

APPENDIX TWO

DNA SEQUENCE INFORMATION

79

Amplicon 3-1-4
GATTAGCGGATAACAA'ITTCACACAGGACGACTCCAAGAAAATGGCTCCTCC
CCCAAAGGAGGTAGAAGAAGATAGTGAAGATGAGGAAATGTCTGAAGATGA
AGACGATGAGAGCAGTGGAGAAGAGGTTGTTATCCCTCAGAAAAAAGGCAA
GAAGGCTGCCACAACTCCAGCAAAGAAATGGTGGTITCCCCAACAAAAAAG
GTTGCAGTTGCCACACCAGCAAAGAAAGCAGTTGTCACCCCTGGCAAAAAGG
CAGCAGCTATGCCAGCCAAGAAGACAGTTACACCTGCCAAAGCAGTGGTTAC
ACCTGGCAAAAAGGGAGCCACCCCAGCAAAGCAGTGGTAGCAACCTCTGGT
AAGAAGGAGCAGCCACCCCAGGCAAGGGAGCAAAGAACGGCAAGAATGCC
Amplicon 5-2-10
TTTTTTTTT'ITCATAGTAAGTGTATTAGTTGGTCATAGCGAAATCGAGGGTAG
GATGCTCGGATTCATAGGAAGGATATTGTGAGCAGTAGGGATTTAATGGTAA
AATTGATTGTGTAGAGTTCTGGTATGTGTGGATTGTGGGATGTTCCTAGGAAT
AAAATTGCTGTAAGATATI‘TATTATGATAATATTTGCGTACTCTGCTATGAAG
AAGGAGGGCAAATGGTCCTGCTGCATATTCTACGTTGAAGCCCGAGACTAGC
TCTGATTCTCCTTCAGTTAAATCAAATGGAGCTCGGTTTGTTTCTGCTAGTGTT
GAGATAAATCATATTATTGCTAGAGGCCATGCTAGC

Amplicon 5-4-2
GATTAGCGGATAACAATTTCACACAGGAGCTAGCAGACTTAAAAGTATTCTT
AAAATAGATGGTGATGTTTTAATGAAAGACGTTCAAGAGATAGCAACTGTGG
TGGAACCCAAACATTGTCAAGAGAAAACGCAGTGTGTGGTGAAGGATGAAA

C AGATGACATGAAAATGGAGACTGATATTAAGAGAAACAAAAAGACTCTTCT

8O

AGACCAGCATGGGCAGTACCCCATATGGATGGACCAGAGGCAAAGGAAAAG
GCTGAAAGCAAAGCGAGAGAGAAGGAAGGGAAAAAGCAAAGTtTAAGCCAT
GAAGGCAGCAAAGGGTTTGACCTGGTAGACTCTAAAAACTTGAAAAATGCAA
C ATGAGACAAATCT'I‘TGATTAGAATGTATACATGGATTTCAGCTTCCACCAAA
TGAAAAGTTTATTTCCATTTTTTAACTTGGCCTTT’ITC'I‘TC

Amplicon 4-1-6
TTTTTTTT'ITGTCACATTTGTAGCCTGAATTAAGAAAATAGGGATACAAATCT
AAAGGTGCCAGAGCTTCCCCAAACCTGATCTGAGAAGCAGAAAAAAATTAGC
TGCTAGTTTATAGAGACAGACAGGCAGGCAGCAGCCACAGCTCTCACTAACC
TGAAAGCATCAAGTGACTCCCTGCTATTCTAGCTTACTAACATGGCTGTAATT
ATCCTTCCAATAAGAGGCAAAACCAATTAGAAAAATAATGCAGCATTTCACT
AGCAGTAGAGATTAAATATGAGTTCAGTAATCTACGCCTACAAATATGCATA
AATAATGACAGGGAGAAGAAACCAGTTATCCTCAGCCGCTCAGCTGAGTGGG
TGGGTAGTTGGAGTCAAGGTAAAAAACAGTGAGGCTGAACAAAGCTGCAAG
AAAGAAAAACATCTCGTGTGGTTTI‘TCGAGGTCAGTTGACAAAGGCCAGGCA
TAAGCAAATATTTCTCATGTATCCCAGCTGTTACCACTATTCATATTCCAATA

ACCACCAAAGTGCTGGAGGCCACCTGGTTGACI I l IGCCTTGGAGTCGTCC

81

APPENDIX THREE

M PARA TUBERCULOSIS INGESTION AND SURVIVAL IN BOMAC CELLS

82

Figure A3.1 - Survival of M. paratuberculosis within BOMAC Cells.

 

 

 

 

 

Microscope picture at 1000x shows M. paratuberculosis stained acid fast (circled)
surviving within Hematoxylin stained BOMAC cells 96 hours afier phagocytosis.

83

Figure A3.2 — Survial of M. paratuberculosis strains within BOMAC and Monocyte
Derived Macrophages (MDM).

 

 

 

 

 

 

 

 

 

 

 

 

 

a. A
'5
F5"
5
5.44
3.»
o
P
8 1.
3

0 r j—

0 1 2 3
Dmafbrlnfectlon
B

5‘6 c:— c F —4:
2 t _M
55 W _
0
Sn
.:
§a
32*
‘31.
3

O+~ fig.

0 1 2 3

 

 

 

 

Figure used by permission of N. Beth Harris and Raul G. Barletta, Panel A: primary
bovine monocytes (MDM). Panel B: BOMAC cells. Open squares represent the wild-type
M paratuberculosis strain K-10 and filled squares are M paratuberculosis strain K-10
transformed with plasmid p WES4. Cell monolayers were infected with M
paratuberculosis at an moi of I 0 bacilli per cell and incubated for 2 h. After removing
nonadherent bacteria, monolayers were lysed at the time periods shown and the numbers
of viable intracellular bacteria determined by plate counts. Results are shown as the
means i standard deviations of three independent experiments.

84

REFERENCES

Amer, A.O., Swanson, MS, 2002, A phagosome of one's own: a microbial guide to life
in the macrophage. Curr Opin Microbiol 5, 56—61.

Arenas, G.N., Staskevich, A.S., Aballay, A., Mayorga, LS, 2000, Intracellular
trafficking of Brucella abortus in J 774 macrophages. Infect Immun 68, 4255-4263.

Astarie-Dequeker, C., N’Diaye, E.N., Le Cabec, V., Rittig, M.G., Prandi, J .,
Maridonneau-Parini, I., 1999, The mannose receptor mediates uptake of pathogenic and
nonpathogenic mycobacteria and bypasses bactericidal responses in human macrophages.
Infect Immun 67, 469-477.

Ausubel, F.M., 1987, Current protocols in molecular biology. Greene Publishing
Associates ;J. Wiley, order fulfillment, Brooklyn, N. Y.Media, Pa., 2 v. (loose-leaf) pp.

Baba, M., Takeshige, K., Baba, N., Ohsumi, Y., 1994, Ultrastructural analysis of the
autophagic process in yeast: detection of autophagosomes and their characterization. J
Cell Biol 124, 903-913.

Baca, O.G., Li, Y.P., Kumar, H., 1994, Survival of the Q fever agent Coxiella bumetii in
the phagolysosome. Trends Microbiol 2, 476-480.

Blocker, A., Griffiths, G., Olivo, J.C., Hyman, A.A., Severin, F.F., 1998, A role for
microtubule dynamics in phagosome movement. J Cell Sci 111, 303-312.

Blocker, A., Severin, F .F ., Burkhardt, J .K., Bingham, J .B., Yu, H., Olivo, J.C., Schroer,
T.A., Hyman, A.A., Griffiths, G., 1997, Molecular requirements for bi-directional
movement of phagosomes along microtubules. J Cell Biol 137, 113-129.

Blocker, A., Severin, F.F., Habermann, A., Hyman, A.A., Griffiths, G., Burkhardt, J .K.,
1996, Microtubule-associated protein-dependent binding of phagosomes to microtubules.
J Biol Chem 271, 3803-3811.

Bogdan, C., Rollinghoff, M., 1999, How do protozoan parasites survive inside
macrophages? Parasitol Today 15, 22-28.

Braun RK, B.C., Littell RC, Linda SB, Simpson JR., 1990, Use of an enzyme-linked
immunosorbent assay to estimate prevalence of paratuberculosis in cattle of Florida. J
Am Vet Med Assoc. 196, 1251-1254.

Chavrier, P., Parton, R.G., Hauri, H.P., Simons, K., Zerial, M., 1990, Localization of low

molecular weight GTP binding proteins to exocytic and endocytic compartments. Cell 62,
317-329.

85

Clarke, C.J., 1997, The pathology and pathogenesis of paratuberculosis in ruminants and
other species. J Comp Pathol 116, 217-261.

Clemens, D.L., Horwitz, M.A., 1995, Characterization of the Mycobacterium
tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J Exp

Med 181, 257-270.

Clemens, D.L., Lee, B.Y., Horwitz, M.A., 2000, Mycobacterium tuberculosis and
Legionella pneumophila phagosomes exhibit arrested maturation despite acquisition of
Rab7. Infect Immun 68, 5154-5166.

Crowle, A.J., Dahl, R., Ross, B, May, M.H., 1991, Evidence that vesicles containing
living, virulent Mycobacterium tuberculosis or Mycobacterium avium in cultured human
macrophages are not acidic. Infect Immun 59, 1823-1831.

de Chastellier, C., Lang, T., Thilo, L., 1995, Phagocytic processing of the macrophage
endoparasite, Mycobacterium avium, in comparison to phagosomes which contain
Bacillus subtilis or latex beads. Eur J Cell Biol 68, 167-182.

Denlinger, L.C., F isette, P.L., Garis, R.A., Kwon, G., Vazquez-Torres, A., Simon, A.D.,
Nguyen, B., Proctor, R.A., Bertics, P.J., Corbett, J .A., 1996, Regulation of inducible
nitric oxide synthase expression by macrophage purinoreceptors and calcium. J Biol
Chem 271, 337-342.

Deretic, V., Fratti, R.A., 1999, Mycobacterium tuberculosis phagosome. Mol Microbiol
31, 1603-1609.

Deretic, V., Via, L.E., Fratti, R.A., Deretic, D., 1997, Mycobacterial phagosome
maturation, rab proteins, and intracellular trafficking. Electrophoresis 18, 2542-2547.

Desjardins, M., Nzala, N.N., Corsini, R., Rondeau, C., 1997, Maturation of phagosomes
is accompanied by changes in their fusion properties and size-selective acquisition of
solute materials from endosomes. J Cell Sci 110, 2303-2314.

Dom, B.R., Dunn, W.A., Jr., Progulske-Fox, A., 2002, Bacterial interactions with the
autophagic pathway. Cell Microbiol 4, 1-10.

Doyle, T., 1958, Fetal Infection in Johne's Disease. Vet. Rec. 70, 238-238.

Dubremetz, J .F., 1998, Host cell invasion by Toxoplasma gondii. Trends Microbiol 6, 27-
30.

Duclos, S., Desjardins, M., 2000, Subversion of a young phagosome: the survival
strategies of intracellular pathogens. Cell Microbiol 2, 365-377.

86

Duclos, S., Diez, R., Garin, J ., Papadopoulou, B., Descoteaux, A., Stenmark, H.,
Desjardins, M., 2000, Rab5 regulates the kiss and run fusion between phagosomes and
endosomes and the acquisition of phagosome leishmanicidal properties in RAW 264.7
macrophages. J Cell Sci 113 Pt 19, 3531-3541.

El-Etr, S.H., Cirillo, J .D., 2001, Entry mechanisms of mycobacteria. Front Biosci 6,
D737-747.

Ernst, R.K., Guina, T., Miller, 8.1., 1999, How intracellular bacteria survive: surface
modifications that promote resistance to host innate immune responses. J Infect Dis 179
Suppl 2, 8326-330.

Feng, Y., Press, B., Wandinger-Ness, A., 1995, Rab 7: an important regulator of late
endocytic membrane traffic. J Cell Biol 131, 1435-1452.

Fernandes, P.D., Araujo, H.M., Riveros-Moreno, V., Assreuy, J ., 1996, Depolymerization
of macrophage microfilaments prevents induction and inhibits activity of nitric oxide
synthase. Eur J Cell Biol 71, 356-362.

Ferrari, G., Langen, H., Naito, M., Pieters, J ., 1999, A coat protein on phagosomes
involved in the intracellular survival of mycobacteria. Cell 97, 435-447.

Forehand, J .R., Pabst, M.J., Phillips, W.A., Johnston, R.B., Jr., 1989, Lipopolysaccharide
priming of human neutr0phils for an enhanced respiratory burst. Role of intracellular free
calcium. J Clin Invest 83, 74-83.

Foulongne, V., Bourg, G., Cazevieille, C., Michaux-Charachon, S., O'Callaghan, D.,
2000, Identification of Brucella suis genes affecting intracellular survival in an in vitro
human macrophage infection model by signature-tagged transposon mutagenesis. Infect

Immun 68, 1297-1303.

F ratti, R.A., Chua, J ., Deretic, V., 2002, Cellubrevin alterations and Mycobacterium
tuberculosis phagosome maturation arrest. J Biol Chem 277, 17320-17326.

Garcia, R.C., Banfi, E., Pittis, M.G., 2000, Infection of macrophage-like THP—1 cells with
Mycobacterium avium results in a decrease in their ability to phosphorylate nucleolin.
Infect Immun 68, 3121-3128.

Gorvel, J .P., Chavrier, P., Zerial, M., Gruenberg, J ., 1991, rab5 controls early endosome
fusion in vitro. Cell 64, 915-925.

Gouin, E., Gantelet, H., Egile, C., Lasa, I., Ohayon, H., Villiers, V., Gounon, P.,
Sansonetti, P.J., Cossart, P., 1999, A comparative study of the actin-based motilities of
the pathogenic bacteria Listeria monocytogenes, Shigella flexneri and Rickettsia conorii.
J Cell Sci 112, 1697-1708.

87

Guerin, I., de Chastellier, C., 2000, Pathogenic mycobacteria disrupt the macrophage
actin filament network. Infect Immun 68, 2655-2662.

Hackstadt, T., 2000, Redirection of host vesicle trafficking pathways by intracellular
parasites. Traffic 1, 93-99.

Holden, D.W., 2002, Trafficking of the Salmonella vacuole in macrophages. Traffic 3,
161-169.

Horwitz, M.A., Maxfleld, RR, 1984, Legionella pneumophila inhibits acidification of its
phagosome in human monocytes. J Cell Biol 99, 1936-1943.

Johnson-Ifearulundu Y, K.J., 1999, Distribution and environmental risk factors for
paratuberculosis in dairy cattle herds in Michigan. Am J Vet Res. 60, 589-596.

Jones, R., 1989, Review of the Economic Impact of Johne's Disease in the United States,
In: Wood, A.M.a.P. (Ed.) Johne's disease. Current Trends in Research, Diagnosis and
Management. Commonwealth Scientific and Industrial Research Organisation,
Melbourne, Australia, pp. 46-50.

Kaufmann, SH, 1993, Immunity to intracellular bacteria. Annu Rev Immunol 11, 129-
163.

Kim-Park, W.K., Moore, M.A., Hakki, Z.W., Kowolik, M.J., 1997, Activation of the
neutrophil respiratory burst requires both intracellular and extracellular calcium. Ann N
Y Acad Sci 832, 394-404.

Korchak, H.M., Vosshall, L.B., Haines, K.A., Wilkenfeld, C., Lundquist,
K.F.,Weissmann, G., 1988, Activation of the human neutrophil by calcium-mobilizing
ligands. II. Correlation of calcitun, diacyl glycerol, and phosphatidic acid generation with
superoxide anion generation. J Biol Chem 263, 11098-11105.

Lutcke, A., Parton, R.G., Murphy, C., Olkkonen, V.M., Dupree, P., Valencia, A., Simons,
K., Zerial, M., 1994, Cloning and subcellular localization of novel rab proteins reveals
polarized and cell type-specific expression. J Cell Sci 107, 3437-3448.

Majeed, M., Perskvist, N., Ernst, J .D., Orselius, K., Stendahl, O., 1998, Roles of calcium
and annexins in phagocytosis and elimination of an attenuated strain of Mycobacterium
tuberculosis in human neutrophils. Microb Pathog 24, 309-320.

Malik, Z.A., Denning, G.M., Kusner, D.J., 2000, Inhibition of Ca(2+) signaling by
Mycobacterium tuberculosis is associated with reduced phagosome-lysosome fusion and
increased survival within human macrophages. J Exp Med 191, 287-302.

Malik, Z.A., Iyer, S.S., Kusner, D.J., 2001, Mycobacterium tuberculosis phagosomes
exhibit altered calmodulin-dependent signal transduction: contribution to inhibition of

88

phagosome-lysosome fusion and intracellular survival in human macrophages. J Immunol
166, 3392-3401.

Marodi, L., Schreiber, S., Anderson, D.C., MacDermott, R.P., Korchak, H.M., Johnston,
R.B., Jr., 1993, Enhancement of macrophage candidacidal activity by interferon-gamma.
Increased phagocytosis, killing, and calcium signal mediated by a decreased number of
mannose receptors. J Clin Invest 91, 2596-2601.

Means, T.K., Wang, S., Lien, E., Yoshimura, A., Golenbock, D.T., Fenton, M.J., 1999,
Human toll-like receptors mediate cellular activation by Mycobacterium tuberculosis. J
Immunol 163, 3920-3927.

Mordue, D.G., Sibley, L.D., 1997, Intracellular fate of vacuoles containing Toxoplasma
gondii is determined at the time of formation and depends on the mechanism of entry. J
Immunol 159, 4452-4459.

Motlik, J ., Carnwath, J.W., Herrmann, D., Terletski, V., Anger, M., Niemann, H., 1998,
Automated recording of RNA differential display patterns from pig granulosa cells.
Biotechniques 24, 148-153.

Murray, H.W., 1981, Susceptibility of Leishmania to oxygen intermediates and killing by
normal macrophages. J Exp Med 153, 1302-1315.

Murray, H.W., 1988, Survival of intracellular pathogens within human mononuclear
phagocytes. Semin Hematol 25, 101-111.

Novick, P., Brennwald, P., 1993, Friends and family: the role of the Rab GTPases in
vesicular traffic. Cell 75, 597—601.

Novick, P., Zerial, M., 1997, The diversity of Rab proteins in vesicle transport. Curr Opin
Cell Biol 9, 496-504.

Payne, J .a.R.J ., 1961 , The Pathogenesis of Experimental Johne's Disease in Calves and
Cows. Research in Vet. Science 2, 167-179.

Pfeffer, SR, 1994, Rab GTPases: master regulators of membrane trafficking. Curr Opin
Cell Biol 6, 522-526.

Ragno, S., Estrada, 1., Butler, R., Colston, M.J., 1997, Regulation of macrophage gene
expression following invasion by Mycobacterium tuberculosis. Immunol Lett 57, 143-
146.

Ragno, S., Estrada-Garcia, 1., Butler, R., Colston, M.J., 1998, Regulation of macrophage
gene expression by Mycobacterium tuberculosis: down-regulation of mitochondrial
cytochrome c oxidase. Infect Immun 66, 3952-3958.

89

Rankin, J ., 1961, The Experimental Infection of Cattle with Mycobactriumjohnei 11:
Adult Cattle Inoculated Intravenously. J. Comp. Pathol. 71, 6-9.

Rivera-Marrero, C.A., Burroughs, M.A., Masse, R.A., Vannberg, F.O., Leimbach, D.L.,
Roman, J ., Murtagh, J.J., Jr., 1998, Identification of genes differentially expressed in
Mycobacterium tuberculosis by differential display PCR. Microb Pathog 25, 307-316.

Rothman, J.E., Wieland, F.T., 1996, Protein sorting by transport vesicles. Science 272,
227-234.

Russell, D.G., 1995, Of microbes and macrophages: entry, survival and persistence. Curr
Opin Immunol 7, 479-484.

Schimmoller, R, Simon, 1., Pfeffer, SR, 1998, Rab GTPases, directors of vesicle
docking. J Biol Chem 273, 22161-22164.

Schlesinger, LS, 1993, Macrophage phagocytosis of virulent but not attenuated strains
of Mycobacterium tuberculosis is mediated by mannose receptors in addition to
complement receptors. J Immunol 150, 2920-2930.

Schlesinger, L.S., Horwitz, M.A., 1991, Phagocytosis of Mycobacterium leprae by
human monocyte-derived macrophages is mediated by complement receptors CR1
(CD35), CR3 (CD1 1b/CD18), and CR4 (CD1 lc/CD18) and IFN-gamma activation
inhibits complement receptor function and phagocytosis of this bacterium. J Immunol
147, 1983-1994.

Seitz SE, H.L., Heuston WD, Bech-Nielsen S, Rings DM, Spangler L, 1989, Bovine fetal
infection with Mycobacterium paratuberculosis. J Am Vet Med Assoc. 194, 1423-1426.

Simons, K., Zerial, M., 1993, Rab proteins and the road maps for intracellular transport.
Neuron 11, 789-799.

Solbach, W., Moll, H., Rollinghoff, M., 1991, Lymphocytes play the music but the
macrophage calls the tune. Immunol Today 12, 4-6.

Sorokina, E.A., Kleinman, J.G., 1999, Cloning and preliminary characterization of a
calcium-binding protein closely related to nucleolin on the apical surface of inner
medullary collecting duct cells. J Biol Chem 274, 27491-27496.

Stabel, J .R., Stabel, T.J., 1995, Immortalization and characterization of bovine peritoneal
macrophages transfected with SV40 plasmid DNA. Vet Immunol Immunopathol 45, 211-
220.

Stokes, R.W., Haidl, I.D., Jefferies, W.A., Speert, D.P., 1993, Mycobacteria-macrophage

interactions. Macrophage phenotype determines the nonopsonic binding of
Mycobacterium tuberculosis to murine macrophages. J Immunol 151, 7067-7076.

90

Suchyta, S.P., Sipkovsky, S., Kruska, R., Jeffers, A., McNulty, A., Coussens, M.J.,
Tempelman, R.J., Halgren, R.G., Saama, P.M., Bauman, D.E., Boisclair, Y.R., Burton,

J .L., Collier, R.J., DePeters, E.J., Ferris, T.A., Lucy, M.C., McGuire, M.A., Medrano,

J .F., Overton, T.R., Smith, T.P., Smith, G.W., Sonstegard, T.S., Spain, J .N., Spiers, D.E.,
Yao, J ., Coussens, P.M., 2003, Development and testing of a high-density cDNA
microarray resource for cattle. Physiol Genomics 15, 158-164.

Sung, Y.J., Denman, RB, 1997, Use of two reverse transcriptases eliminates false-
positive results in differential display. Biotechniques 23, 462-464, 466, 468.

Swanson, J .A., Locke, A., Ansel, P., Hollenbeck, P.J., 1992, Radial movement of
lysosomes along microtubules in permeabilized macrophages. J Cell Sci 103, 201-209.

Sweeney RW, W.R., Rosenberger AE, 1992, Mycobacterium paratuberculosis isolated
from fetuses of infected cows not manifesting signs of the disease. Am J Vet Res. 53,
477-480.

Tapper, H., 1996, The secretion of preformed granules by macrophages and neutrophils. J
Leukoc Biol 59, 613-622.

Tessema, M.Z., Koets, A.P., Rutten, V.P., Gruys, E., 2001, How does Mycobacterium
avium subsp. paratuberculosis resist intracellular degradation? Vet Q 23, 153-162.

Tooker, B.C., Burton, J .L., Coussens, P.M., 2002, Survival tactics of M. paratuberculosis
in bovine macrophage cells. Vet Immunol Immunopathol 87, 429-43 7.

Tse, F.W., Tse, A., 1999, Alpha-latrotoxin stimulates inward current, rise in cytosolic
calcium concentration, and exocytosis in at pituitary gonadotropes. Endocrinology 140,
3025-3033.

Ullrich, H.J., Beatty, W.L., Russell, D.G., 2000, Interaction of Mycobacterium avium-
containing phagosomes with the antigen presentation pathway. J Immunol 165, 6073-
6080.

Via, L.E., Deretic, D., Ulmer, R.J., Hibler, N.S., Huber, L.A., Deretic, V., 1997, Arrest of
mycobacterial phagosome maturation is caused by a block in vesicle fusion between

stages controlled by rab5 and rab7. J Biol Chem 272, 13326-13331.

Via, L.E., Fratti, R.A., McFalone, M., Pagan-Ramos, E., Deretic, D., Deretic, V., 1998,
Effects of cytokines on mycobacterial phagosome maturation. J Cell Sci 111, 897-905.

Watanabe, N., Suzuki, J., Kobayashi, Y., 1996, Role of calcium in tumor necrosis factor-
alpha production by activated macrophages. J Biochem (Tokyo) 120, 1190-1195.

91

Weiss, H., Friedrich, T., Hofhaus, G., Preis, D., 1991, The respiratory-chain NADH
dehydrogenase (complex I) of mitochondria. Eur J Biochem 197, 563-576.

Xu, 8., Cooper, A., Sturgill-Koszycki, S., van Heyningen, T., Chatterjee, D., Orme, 1.,
Allen, P., Russell, D.G., 1994, Intracellular trafficking in Mycobacterium tuberculosis
and Mycobacterium avium-infected macrophages. J Immunol 153, 2568-2578.

Yagi, T., Matsuno-Yagi, A., 2003, The proton-translocating NADH-quinone
oxidoreductase in the respiratory chain: the secret unlocked. Biochemistry 42, 2266-
2274.

Yano, T., 2002, The energy-transducing NADH: quinone oxidoreductase, complex 1. Mol
Aspects Med 23, 345-368.

Zerial, M., Parton, R., Chavrier, P., Frank, R., 1992, Localization of Rab family members
in animal cells. Methods Enzymol 219, 398-407.

Zerial, M., Stenmark, H., 1993, Rab GTPases in vesicular transport. Curr Opin Cell Biol
5, 613-620.

Zimmerli, S., Edwards, S., Ernst, J .D., 1996, Selective receptor blockade during

phagocytosis does not alter the survival and growth of Mycobacterium tuberculosis in
human macrophages. Am J Respir Cell Mol Biol 15, 760-770.

92