v M ‘
NV.” .
nay”; , .

m;
an.

I:
"4
mph.
0 \- .
a -.
11V :é".

.v 1
‘ ‘ -ififih
“ I

J1 . h, ‘ - , v k “align" . r I
“5;": , . ‘ ‘ f x ‘ ‘ ; _ Th :2.

I . ' t A '7 _ , _ .Pn; .
Mr" W , » . . ‘ , .

q r. .
{32 ‘9: :

anV
3‘5"

 

\

. . g ,
15?. .3 asp—mu» A _ .

7559.5;

'7

C‘

3
0 CV} \
r v. ;
55%0137'52’

This is to certify that the
dissertation entitled

TRANSCRIPTIONAL REPRESSION MEDIATED BY THE
DROSOPHILA KNIRPS PROTEIN:
CONTRIBUTION OF CtBP AND RPD3

presented by

PAOLO STRUFFI

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Genetics

 

 

5 «2.243?th r 37w ~ / / 41C; L ~~

(filajor Professor's Signature

/Wau // /OC/~f
7 / /

Date

MSU is an Affinnative Action/Equal Opportunity Institution

- _V_.._ -.—.-~-.-.-.-.-.-v---.-.- ---0-n-I--.--.-o-o--0-n-u-o-I-I-I-o-l-9-o----n.

W.
Michigan State

 

University

 

 

PLACE IN RETURN BOX to remove this checkout from ydur record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 c:/ClFlC/DateDue.p65-p.15

 

 

TRANSCRIPTIONAL REPRESSION MEDIATED BY THE DROSOPHILA
KNIRPS PROTEIN: CONTRIBUTIONS OF CtBP AND RPDB

By

Paolo Struffi

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHYLOSOPHY
Genetics Program

2004

ABSTRACT

TRANSCRIPTIONAL REPRESSION MEDIATED BY THE DROSOPHILA KNIRPS
PROTEIN: CONTRIBUTIONS OF CtBP AND RPD3

By

Paolo Struffi

The Drosophila Knirps protein is a short-range transcriptional repressor essential
for proper embryonic development. Short-range repressors work over distances of less
than 100-150 base pairs to inhibit activators in a local fashion, allowing multiple
enhancers to be regulated autonomously. The mechanisms of short-range repression
remain poorly understood at the molecular level. Knirps mediates repression in part by
recruiting the corepressor CtBP, but it also posses a CtBP-independent repression activity
that maps to the N-terrninus of the protein. The functional relevance of multiple
repression activities is not well understood, but the findings that Knirps does not repress
some cis-regulatory elements in the absence of CtBP, suggested that the co-factor may
supply a unique function essential to repress certain types of activators. I assayed the
CtBP-dependent and —independent repression activities of Knirps in Drosophila embryos
and found that the requirement for CtBP at certain enhancers appears to reflect the need
for overall higher levels of repression, rather than a requirement for an activity unique to
CtBP. Thus, CtBP contributes quantitatively, rather than qualitatively to Knirps function.

To investigate whether Knirps interacts with other cofactor/s in addition to CtBP,
I generated transgenic flies that express inducible, double-tagged versions of Knirps and
performed affinity purification experiments. Recombinant, full-length Knirps could be

expressed in embryos at the same time as the endogenous factor and the protein acted as a

functional repressor. Gel filtration chromatography of embryonic extracts expressing full-
Iength Knirps indicate that the recombinant protein is part of a complex of ~450 kDa,
suggesting that other factors in addition to CtBP interact with Knirps. In a survey of
possible cofactors, we found that the histone deacetylase de3 (HDAC 1) co-
immunoprecipitates with Knirps and the two proteins cofractionate during gel filtration.
To facilitate characterization of novel Knirps—interacting proteins, we developed a
tandem affinity chromatography protocol from embryonic extracts overexpressing Knirps
and find that de3 copurifies with full-length Knirps, but not the CtBP-independent
repression domain. To test the functional relevance of this association, we carried out
dosage interaction assays, and find that the rpd3 and knirps interact genetically.
Altogether these results suggest that histone deacetylation plays a role in short-range

transcriptional repression mediated by Knirps.

To my father, Giuseppe, and my mother, Elda, for their love, wisdom and
encouragement

iv

ACKNOWLEDGMENTS

First of all, I would like to express my deepest gratitude to my thesis advisor and
mentor, Dr. David N. Amosti, for the excellent guidance, enthusiasm and quest for higher
standards he always provided. David invested an incredible amount of time and effort in
my graduate education and research project, which helped me tremendously in becoming
a better scientist. My research project was substantially enriched by the thoughtful
contribution of my thesis guidance committee: Dr. Steven J. Triezenberg, Dr. Min-Hao
Kuo, and Dr. Michael S. Grotewiel. I would like to thank Dr. Frans J. de Bruijn for
inviting me to his laboratory here at Michigan State University, and in so doing giving
me the opportunity to learn more about MSU and the Genetics Program. Many thanks to
Dr. Steven J. Triezenberg, Dr. Lee R. Kroos, and Dr. Jonathan D. Walton for the
wonderful experience and good time I had during my rotations in their laboratories. I
would also like to thank past and present members of the Amosti laboratory for many
hours of scientific discussion. I also extend my appreciation to Dr. Albert J. Courey, Dr.
Richard R. Burgess, Dr. Sue-Hwa Lin, and Dr. Sheenah M. Mische, who introduced me
to the wonderful world of proteins during a memorable “Protein Purification and
Characterization” course at the Cold Spring Harbor Laboratory. I am especially grateful
to Dr. R. William Henry, Dr. Craig S. Hinkley, Dr. Zackir Ullah and Dr. Heather A.
Hirsch for many helpful suggestions about protein purification and hours of discussion
about my experiments. My deepest gratitude go to my parents (Giuseppe and Elda),
brothers (Riccardo and Daniele) and sisters (Franca, Lucia, and Tiziana), which

supported and encouraged me constantly during the course of this work.

TABLE OF CONTENTS

LIST OF FIGURES ........................................................................ vi
LIST OF TABLES ........................................................................ viii
KEY TO ABBREVIATION .............................................................. xii
CHAPTER 1:
Introduction .................................................................................... 1
CHAPTER 2:
CtBP-independent repression activity of the Drosophila Knirps protein.
2.1 Introduction ............................................................ 39
2.2 Functional identification of the CtBP-independent
repression domain of Knirps ........................................ 42
2.3 Role of CtBP in transcriptional repression by the
Drosophila Giant protein ............................................ 49
References .................................................................. 80

CHAPTER 3:
Quantitative contributions of CtBP-dependent and —independent
repression activities of Knirps.

Abstract ...................................................................... 83

Introduction ................................................................. 84

Material and Methods ..................................................... 88

Results ....................................................................... 92

Discussion ................................................................. 1 11

References ................................................................. 120
CHAPTER 4:

A functional interaction between the histone deacetylase de3 and the
Drosophila short-range repressor Knirps.

Abstract .................................................................... 125
Introduction ............................................................... 126
Material and Methods ................................................... 13 1
Results ..................................................................... 138
Discussion ................................................................. 155
References ................................................................. 161

CHAPTER 5:

Conclusions and Future Directions ...................................................... 167

vi

APPENDIX A:
Multiple forms of the CtBP corepressor are present during

Drosophila embryogenesis

Introduction ................................................................. 172
Material and Methods ...................................................... 173
Results ....................................................................... 175
References .................................................................. l 80

APPENDIX B:

Characterization of Drosophila transgenic lines expressing full-length,

double-tagged Knirps
Introduction ................................................................. 181
Material and Methods ..................................................... 182
Results ....................................................................... 1 84
References .................................................................. 193

APPENDIX C:

Additional experiments not included in chapter 3 200
Introduction ................................................................ 194
Material and Methods .................................................... 196
Results ...................................................................... 197
References .................................................................. 205

vii

LIST OF TABLES

Table 2-1 ........................................................................ 68

Table 3-1 ........................................................................ 98

viii

Figure 1-1:
Figure 1-2:

Figure 1-3:

Figure 1-4:
Figure 1-5:
Figure 1-6:

Figure 2-1:

Figure 2-2:

Figure 2-3:

Figure 2-4:

Figure 2-5:

Figure 2-6:

Figure 2-7:

Figure 2-8:

Figure 2-9:

Figure 3-1:

LIST OF FIGURES

Mechanisms of transcriptional repression.
Long-range and short-range repression.

Early development in Drosophila is controlled
by a hierarchy of transcription factors.

Regulation of the pair-rule gene even-skipped (eve).
Knirps mRNA and protein expression patterns.
Schematic structure of the Knirps protein.

Knirps N-terminal repression activity functions
in dCtBP mutant embryos.

eve stripe 3 lacZ reporter gene is repressed normally
in posterior regions in a CtBP mutant embryo.

Derepression of eve stripe 2 expression
in a CtBP mutant background.

Loss of Giant repression activity in a CtBP mutant background.

Anterior domain (AD) of Kr expression is regulated by CtBP
and Giant, while central domain (CD) is regulated by Giant
but not CtBP.

Gal4-giant protein is an active repressor
in a CtBP mutant background.

Structure and activity of Gal4-giant chimeras
assayed in transgenic embryos.

Peptide sequence of giant homolog isolated fi'om D. hydei
aligned with D. melanogaster sequence.

Alignment of Giant binding sites and consensus.

CtBP is required for Knirps repression of even-skipped (eve)
stripe 4/6 enhancer, but not stripe 3/7 enhancer.

ix

ll

16

19

23

24

45

47

58

6O

63

64

67

71

77

93

Figure 3-2:

Figure 3-3:

Figure 3-4:

Figure 3-5:

Figure 3-6:

Figure 3-7:

Figure 4-1:

Figure 4-2:

Figure 4-3:

Figure 4-4:

Figure 4-5:

Figure 4-6:
Figure A-l:

Figure A-2:

Figure B-l:

Figure B-2:

Expression of full-length and CtBP-independent portions of
the Knirps transcriptional repressor in transgenic Drosophila.

Pattern of endogenous eve expression in embryos expressing
full-length Knirps 1-429 (A-D) and CtBP-independent region
of Knirps 1-330 (E-G).

Differential repression of minimal eve stripe enhancers by
Knirps 1-429 and 1-330, demonstrates differential sensitivities
to Knirps activity.

Quantitation of proteins expressed from hsp 70-knirps transgenes
demonstrates that full-length Knirps 1-429 is less abundant than
Knirps 1-330.

Effect of expression of Knirps proteins on hunchback (hb),
runt, hairy, and fushi tarazu (ftz) demonstrates differential

activity of Knirps 1-429 versus Knirps 1-330.

Quantitative model for contribution of CtBP activity
to repression by Knirps.

Recombinant, fiill-length Knirps is a phosphoprotein
when expressed in the Drosophila embryo.

Recombinant Knirps is present in a ~450 kDa complex.

Double affinity purification of recombinant,
full-length Knirps from crude embryo lysates.

Histone deacetylase de3 (HDAC 1) copurifies
with full-length Knirps.

de3 does not copurify with the N-terminal, CtBP-independent
repression domain of Knirps during double-affinity purification.

Genetic interactions between rpd3 and knirps.

Characterization of a polyclonal antiserum raised against CtBPlong

Developmental Western of Drosophila embryonic extracts
using or-CtBP antiserum.

Characterization of a polyclonal antiserum raised against Knirps.

Characterization of Drosophila transgenic lines expressing

96

97

103

106

109

113

139

141

144

148

151

153

177

179

185

Figure 8-3:

Figure 3-4:

Figure C-l:

Figure C-2:

Figure 03:

full-length, double-tagged Knirps.

Recombinant full-length Knirps persist in the embryo for
~2 hours after a pulse of induction.

Recombinant full-length Knirps is expressed ubiquitously
and in a punctuate pattern in blastoderrn embryos.

Direct repression of even-skipped (eve) enhancer elements
by ectopic fiill-length Knirps.

Competition for DNA binding does not play a role in
Knirps-mediated repression of even-skipped (eve) stripe

elements.

Misexpression of the CtBP-dependent repression domain of

Knirps does not affect even-skipped (eve) expression pattern.

xi

188

190

192

198

201

204

cDNA:
ChIP:
Co-IP:
CtBP:
dCtBP:
DBD:
DNA:
DTT:
E. coli:
EDTA:
HAT:
HDAC:

HEPES:

KEY TO ABBREVIATIONS

amino acid

anterior-posterior

base pair(s)

complementary deoxyribonucleic acid
chromatin immunoprecipitation
co-immunoprecipitation

C-terminal binding protein
Drosophila C-terminal binding protein
DNA binding domain
Deoxyribonucleic acid

dithiothreitol

Escherichia coli

ethylenedinitrilo tetraacetic acid
histone acetyltransferase

histone deacetylase
N-2-hydroxyethy1piperazine-N’-2-ethanesulfonic acid
histone methyltransferase

heat shock promoter

Kilobase

Kilodalton

knirps

nicotineamide adenine dinucleotide
nuclear localization signal
polyacrylammide gel electrophoresis
Polycomb group

Polymerase chain reaction
polymerase II

Retinoblastoma tumor suppressor protein
Ribonucleic acid

TATA binding protein

Sodium dodecyl sulfate

Suppressor of variegation
transcription factor

xii

Chapter 1

Introduction

The development of multicellular organisms from a single cell, the fertilized egg,
is an amazing achievement and a fascinating subject to study. In multicellular eukaryotes,
all cells possess the same information, yet they give rise during development to hundreds
of different cell types, which form structures as complex and varied as eyes, wings or the
brain ( 1). Each cell type is defined by a specific gene expression program that controls
which genes are transcribed, when and for how long. Understanding the molecular basis
that underlies cell differentiation remains a formidable challenge. In eukaryotes there are
tens of thousands of protein-coding genes, each of which has its own specific program of
transcriptional control. Much of the specificity of these programs is affected by sequence-
specific DNA-binding transcription factors, which bind to proximal promoter and distal
transcriptional regulatory regions and function as a key interface between genetic
information and the transcriptional machinery (2). Regulation of transcription, especially
the initiation of transcription, is a pivotal step in the control of gene expression. An
enormous body of work generated over the past three decades has revealed that
eukaryotic gene transcription is a remarkably intricate biochemical process that is tightly
regulated at many levels. Despite many advances, surprisingly little is known about the
detailed mechanisms by which individual genes are turned on or off in a cell (3).
Knowledge of these basic mechanisms will impact several fields, from cell biology to

medicine.

In this work, I describe studies that shed light on the mechanisms of
transcriptional regulation mediated by one of these sequence-specific transcription
factors: the Dros0phila short-range repressor Knirps. I studied the contribution of a
conserved corepressor, the C-terrninal binding protein (CtBP), to Knirps-mediated
repression, and found that the requirement for CtBP for effective Knirps repression
depends on the nature of the target regulatory element (chapter 2 and 3). I provide
evidence that supports the hypothesis that CtBP contributes quantitatively rather than
qualitatively to Knirps repression (chapter 3). In addition, I developed a biochemical
purification scheme suitable to look in vivo for Knirps-interacting proteins and found that
the histone deacetylase de3 (HDACl) biochemically and genetically interacts with
Knirps, providing experimental evidence that links chromatin modifications to

transcriptional repression by Knirps (chapter 4).

Eukaryotic transcriptional repression

Much of the initial efforts in the field of eukaryotic transcriptional regulation have
been devoted to two related issues: how the general transcription machinery is assembled
to initiate transcription and how activators and coactivators facilitate this process. A third
issue, how eukaryotic transcriptional repressors work, did not receive until recently the
attention given to the two other topics (4). However, it is becoming increasingly clear that
transcriptional repression is just as important as transcriptional activation for establishing
cell- and tissue-specific pattems of gene expression. Transcriptional repression has been
implicated in a variety of developmental processes including the specification of mating

type in yeast (5), segmentation patterning in the Drosophila embryo (6), tissue-specific

patterns of gene expression in sea urchins (7), mice (8) and lineage-restricted expression
in mammalian lymphocytes (9, 10). During development, boundaries of gene expression
are ofien determined by the spatially—restricted localization or activity of transcriptional
repressors (6, 11—12).

Although gene expression can be achieved at several different levels,
transcriptional initiation is believed to be the principal regulatory step for many, if not
most, genes (13). Transcription initiation of protein-encoding genes by RNA polymerase
H (pol 11) requires the assembly of a pre-initiation complex (PIC), which involves over
one hundred polypeptides (l4). Repressors can prevent recruitment of some of these
factors to a target promoter, they may prevent the isomerization of the PIC to form an
open complex, or they may act at a later stage (promoter escape or elongation).

Considering possible mechanisms of transcriptional repression, we need to
remember that in vivo the transcription template is organized into condensed,
heterogeneous chromatin fibers. Although it is still unclear whether transcription occurs
on nucleosomal DNA or on higher order (30 nm) structures, chromatin seems to be
inherently repressive for transcription (15, 16). Therefore, factors that promote or
stabilize the formation of higher order chromatin structures are thought in most cases to
interfere with transcription. An additional level of complexity is provided by the fact that
transcription does not occur independently from other cellular processes, such as RNA
processing or protein degradation, but is tightly integrated with these events and

regulated at many different levels.

Mechanisms of transcriptional repression

Transcriptional repression can be achieved in several different ways (Fig. 1-1).
Cellular processes that modify, destroy, or remove from the nucleus positively acting
transcription factors (activators or parts of the general transcriptional machinery) can
prevent transcription by eliminating an activating signal (Fig. l-lA). In these cases,
negatively acting factors are not required to directly interact with the target gene to
repress (17, 18). These cellular activities may affect transcription in alternative ways. For
example, the ubiquitin-mediated proteolysis of a transcription factor such as the Herpes
simplex factor VP16 would be expected to reduce its transcription ability by targeting the
activator to destruction. However, recent studies have demonstrated that ubiquination of
the VP16 activator is essential for its activity (19), suggesting that “dc-stabilization” may
be a pre-requisite for transcriptional activity (20).

Transcriptional repression is also mediated by cis-acting elements termed
silencers or boundary elements (Fig. l-lB), which prevent transcription of a gene when
located between the core promoter and an upstream enhancer (21, 22). This type of
repression does not depend on the particular enhancer or core promoter elements, and
seems to involve the formation of a loop in the chromatin structure that isolates enhancers
and promoters to functionally independent chromosomal domains, thus preventing
communication between an enhancer and the promoter it regulates (23, 24).

Repression is also achieved by preventing an activator from binding to its targets,
either by altering the chromatin structure (Fig. l-lC) or by competing for common or

overlapping DNA binding sites (Fig. 1-1D1). Chromatin modifications that render the

Figure 1-1: Mechanisms of transcriptional repression.

Transcriptional repression can be achieved in a number of different ways, and in some
cases multiple mechanisms may be employed simultaneously. Repression can be
indirectly caused by the inability of positively-acting factors to reach their targets on the
promoter (A, C, and D1), or be the direct consequence of protein-protein interactions
between repressors and either activators or the basal transcriptional machinery (B and
D2-3). Sequence-specific repressors are depicted as dark gray rectangles, activators as
gray circles. Arrow depicts the transcription start site.

A. Cellular processes that results in the modification ( 1), sequestration (2), degradation
(3) or removal from the nucleus (4) of positively acting, sequence-specific transcriptional
activators will indirectly cause transcriptional repression. B. A boundary element or
insulator (black bar) positioned between an enhancer and the core promoter will prevent
the enhancer from activating the downstream gene. However, if the boundary element is
located upstream of the enhancer, the enhancer retains the ability to activate the gene.
The repressive activity brought by boundary elements does not depend on the nature of
the enhancer element. C. Alteration of the chromatin structure caused either by the
utilization of particular histone variants to assemble non-canonical nucleosomes (l), by
covalent modifications of histones tails or DNA (2), or by the particular spacing of
nucleosomes over a regulatory sequence (3) can results in local or general repression.

D. Gene-specific repression by DNA-binding proteins can be caused by competition
between the activator and the repressor for the same or an overlapping DNA-binding site
(1), by direct interaction between the repressor and the basal transcriptional machinery
(2), or by quenching of the activator (3). Figure modified from 18.

 

 

 

 

 

Figure 1-1: Mechanisms of transcriptional repression.

6

DNA template less accessible to transcription factors may include the use of particular
histone variants to assemble different types of nucleosomes, covalent modifications of
histone proteins or DNA, and mobilization of nucleosomes relative to the DNA. Histone
variants may regulate transcription by creating new chromatin structures. For instance, in
mammalian cells the histone variant macroH2A (mH2A) is enriched in the inactive X
chromosome (25). In vitro studies with reconstituted chromatin have shown that mHZA
interferes with transcription factor binding and nucleosome remodeling and may be
important for establishing or maintaining the repressive status of large chromatin
domains rather than single genes (26). A diverse array of post-translational modifications
that often occurs on the N-terminal histone “tails” has been proposed to act in a
combinatorial way as an epigenetic code (27). For example, the removal of acetyl groups
from lysine residues of the histone proteins, mediated by histone deacetylases (HDACs),
has usually an inhibitory effect on gene expression (28). HDACs may mediate repression
by increasing the affinity of nucleosomes for their DNA, therefore creating a chromatin
structure less accessible to transcription factors. This modification is readily reversible
and can be targeted to single nucleosomes, providing a means to control genes in a
dynamic and specific manner (29, 30). HDACs have been found to directly interact with
a number of corepressors (31-33) including the mammalian homolog of the Knirps
corepressor CtBP (34). DNA methylation and histone methylation at specific residues in
the histone H3 N-terminal tails (K9 and K27) have also been associated with repression
(35-37). Unlike acetylation/deacetylation, methylation is not believed to be readily
reversible and therefore it may be important to confer stable gene repression required for

maintaining cell identity (38). The mammalian corepressor CtBP 1 has also been shown

to interact with the histone methyltransferases G9a and Eu-HMTasel (34), although it is
not clear whether this interaction could play a role in the transient repression mediated by
short range repressors. ATP-dependent nucleosome remodeling complexes change the
physical association between DNA and nucleosomes (39-41). In vitro, these enzymes
weaken the tight wrapping of DNA around the histone octamers, thereby facilitating the
sliding of nucleosomes to neighboring DNA segments, their displacement to unlinked
DNA, and the accumulation of patches of accessible DNA on the surface of nucleosomes
(reviewed in 42). The activity of these complexes in vivo has been mainly associated with
transcriptional activation, but they can also lead to nucleosome positioning which has
been shown to govern the repressed state of the PHO 5 promoter in yeast (43).

Direct competition for the same or overlapping binding sites can also prevent an
activator from reaching its target/s on a promoter and therefore lead to repression (Fig. l-
lDl). Analysis of Drosophila cis-regulatory elements have identified several examples
where binding sites for an activator and a repressor overlap, leading to the hypothesis that
competition for DNA binding might be an important way to control gene expression (11).
In some cases, in vitro and in vivo overexpression studies support this hypothesis (44).
However, under physiological levels of protein expression, repression was also observed
from non-overlapping sites (45, 46). Moreover, in the case of the even-skipped I (eve)
stripe enhancers, where DNA-binding sites for Knirps overlap in many instances with
binding sites for activators, in vivo overexpression of the Knirps DNA binding domain

alone was unable to mediate repression (see chapter 3).

 

' Note the use of new Drosophila genetic nomenclature throughout the entire document. All gene names
are italicized and written in all lower case letters. Protein names are in regular font and start with an upper
case letter.

Transcriptional repressors have also been suggested to function through direct
protein-protein interactions with the basal transcriptional machinery (Fig. 1-1D2).
According to this model, referred to as direct repression, the repressor would interfere
with the formation or activity of the PIC, inhibiting transcription initiation or elongation.
Direct repression may occur not only when the repressor binds close to the core
promoter, but also when it is brought close to it by looping of the DNA double helix
between the start of transcription and the binding site for the repressor. Cell-culture and
in vitro studies have identified several targets of transcriptional repressors within the
basal machinery, including TFIIA, TFIIB, TFIID, RNA polymerase, and the holoenzyrne
subunits SrblO/ 11 (reviewed in 47). In the case of Drosophila short-range repressors
there are no convincing biochemical data supporting possible direct interactions with the
basal machinery. However, the Drosophila transcriptional repressor even-skipped has
been shown to inhibit transcription by directly binding to the TATA binding protein
(TBP) and preventing in this way the recruitment of TFIID to the TATA box (48-50). In
Drosophila, Polycomb Group (PcG) proteins are involved in the long-term repression
necessary to maintain cell identity (38). Chromatin immunoprecipitation analysis of
several repressed genes, indicate that binding of PcG proteins to repressed promoters
does not exclude general transcription factors and RNA pol 11, suggesting that PcG
repression may be at a stage subsequent to PIC formation (51).

Transcriptional repression can also result from direct interactions between
activator and repressor (Fig. 1-1D3). According to this mechanism, sometimes referred to
as quenching or masking, repressor and activator bind to distinct sites on the DNA and

interact with each other in a manner that prevents the activator to function. For instance,

the yeast Ga180 protein represses the GAL] promoter by binding to and obstructing the
activation domain of the Gal4 activator protein, thus preventing the recruitment of
histone acetyltransferase complexes (52). However, because many Drosophila repressors
including Knirps, have been found to inhibit a wide variety of activators, some of which
likely to activate transcription through different pathways, it is likely that they do so

without making specific activator-repressor contacts (46, 53).

Consistent with the variety of inhibitory processes involved in establishing
transcriptional repression, the effects of repression are also diverse. Repression can be
transient and limited to the time when negative factors are found at a gene, or the
repressor can leave an epigenetic mark so that transcription is blocked for the life on an
organism (38). Repression can be limited to a single gene by the activity of a dedicated
repressor, or many genes can be regulated by modifications of the general transcription

machinery or the chromatin structure.

Short-range and long-range repression

Studies on transcriptional repression in the Drosophila embryo suggest that there
are two basic forms of repression, namely long-range and short-range repression (Fig. 1-
2; 6, 11-12). The range of activity of repressors from other organisms has not been
extensively characterized; however, it is likely that basic mechanisms underlying these
modes of repression are conserved between metazoans. Long-range repressors function in
a dominant fashion to block multiple enhancers, even when these are located thousands

of base pairs from the repressor binding site (Fig. 1-2A; 54). This kind of repression is

10

A

M96

 

 

>1 Kb

 

 

Figure 1-2: Long-range and short-range repression.

In Drosophila, repressors have been classified according to the range of their activity.

A. Long-range repressors such as Hairy, Engrailed and in some contexts Dorsal are able
to mediate repression of multiple enhancers over distances of > 1000 bp. These repressors
function in a dominant way to silence an entire locus. B. Short-range repressors, such as
Knirps, Kriippel, Giant and Snail are able to repress the activity of enhancers elements
when bound within 100-150 bp from key activator binding sites, or basal promoter
elements when cognate sites are introduced close to the start site of transcription. Short-
range repressors allow multiple enhancers in a complex promoter to function
autonomously, so that repressors acting on one enhancer do not interfere with activators
present on a near by enhancer.

Activators are depicted as ovals or circles, repressors as squares. Enhancers are indicated
by black rectangles.

ll

often referred to as silencing because an entire chromosomal locus is inactivated (12).
Short-range repressors, such as Knirps, Giant, Kriippel and Snail, work over distances of
less than 100-150 bp to inhibit upstream activators in a local fashion (55-5 7). Rather than
silencing the gene, they block the function of nearby DNA-bound activators, while the
activity of more distant enhancers is intact. Short-range repression represents a more
flexible way to regulate gene expression in complex modular promoters, because it
allows enhancers to work independently from one another in an autonomous fashion (45).
The precise distance over which a short-range repressor is able to work depends to some
extent on the repressor concentration. Thus, short-range repressors may provide a

sensitive means of responding to a transcription factor concentration gradient (58).

Drosophila early embryogenesis

Embryonic development in Drosophila melanogaster is a remarkably rapid process (59-
61). It starts immediately following egg deposition and within only one day leads to a
larva able to hatch. Following fertilization, the embryo undergoes a series of rapid
nuclear replications with cell cycle durations of 8-15 minutes and no intervening
cytokinesis, leading to the formation of a syncytium. The first seven zygotic divisions are
synchronous (stage 1-2), leading to a syncytium of 128 nuclei distributed in the central
region of the embryo. During the course of the next three divisions most of the nuclei,
each with a surrounding islet of cytoplasm, migrate outwards as they continue to divide
and approach the surface (stage 3). After three additional divisions (stage 4), there is a

pause in the cell cycle and cellularization, a morphogenetic program with a duration of

12

about 50 minutes, starts to enclose the nuclei in newly emerging cell membranes (stage
5). At the beginning of this stage, most nuclei are near the surface of the embryo forming
a monolayer, the blastoderm. During cellularization the plasma membrane extends
centripetally into the embryo and between the nuclei, eventually cutting in under them to
leave, for a time, channels between the nascent cells and the internal yolk. The
blastoderm stage is of particular importance because it marks the transition fi'om a
syncytial to a cellular environment and the initially homogeneous blastoderm becomes
divided up into diverse cell groups, each with a defined role. The result is a ground plan
of the embryo, laid out in a two-dimensional cell sheet. The possibility of free diffusion
of proteins during these early stages of development is extremely important for the
generation of morphogenetic gradients that control embryonic pattern formation. During
gastrulation, which last only about 20 minutes (stage 6-7), the newly formed cells change
their shape and dramatic morphogenetic movements rearrange their positions respective
to one another. Gastrulation is a universal step in animal development and occurs when a
ventral subset of the blastoderm cells roll in to create a two-layered embryo. The outer
germ layer (ectodenn) specifies the epidermis and the nervous system. The inner layer
(mesoderm) will form most of the internal organs, such as muscles. In the meantime,
segmentation divides the body into periodically repeated units. Segmentation begins at
the level of gene expression at the syncytial blastoderm stage, but becomes
morphologically visible only after germ band extension (stage 11). By this stage, the
outer ectodermal epithelium displays evenly spaced grooves, which demarcate 14

parasegrnents, and the internal mesoderm is arranged in corresponding bulges. These

13

parasegrnents roughly correspond to the three mouth parts, three thoracic and eight

abdominal segments present in the adult fly.

Genes controlling the body pattern in Drosophila

Systematic genetic screens have led to the discovery of at least 100 genes that
control the organization of the Drosophila body plan during embryogenesis (62, 63).
These studies demonstrated that early embryonic development in Drosophila is
controlled by a hierarchy of transcription factors and is initiated by preformed mRNAs
and proteins that are synthesized by the mother fly and laid down in the egg. Maternal
gene products establish the antero-posterior (A—P) and dorso-ventral (D-V) axes and set
up regional differences along each axis in the form of spatially distributed mRNAs and
proteins. These maternal proteins act as morphogens that activate or repress zygotic
genes at particular positions along both axes for the next round of patterning (64).
Sequential activity of maternal and zygotic genes pattern the embryo in series of steps:
broad regional differences are established first, and these are then refined to produce a
large number of smaller developmental domains, each characterized by a unique gene
expression profile and destiny. Developmental genes act in a strict temporal sequence.
They form a hierarchy of gene activity in which the action of one set of genes is essential
for another set of genes to be activated, and thus for the next stage of development to
occur (65-67).

Segmentation is initiated by maternally derived morphogenetic gradients that
emanate from sources localized at each end of the embryo (Fig 1-3). These maternal

gradients directly or indirectly regulate the expression of the gap class of segmentation

14

Figure 1-3: Early development in Drosophila is controlled by a hierarchy of
transcription factors.

Anterior-posterior (AP) and dorsal-ventral (DV) patterning is already established in the
late oocyte by the localized accmnulation of specific mRNAs. Soon afier fertilization
maternal gene products laid down in the egg, such as bicoid (bed) and nanos (nos)
mRNAs, are translated and the corresponding proteins freely diffuse in the syncytial
environment creating morphogenetic gradients. These gradients provide positional
informations that activate the zygotic genes in a temporal cascade. The first zygotic genes
to be activated are the gap genes which include hunchback, giant, krz’ippel, knirps and
tailless. Each of the gap genes is expressed in one or two broad domains along the AP
axis and together with the maternally derived transcription factors regulate the expression
pattern of pair-rule genes. Pair-rule genes are expressed in a periodic pattern of seven
transverse stripes along the AP axis, which define the parasegrnents and foreshadow
segmentation. Gap and pair-rule genes regulate the expression of the segrnent-polarity
genes which that define the borders of the future segmental compartments. Segment
identity is than determined by selector genes (not shown).

Panels on the left-side represent in situ hybridizations with digoxigenin-labled antisense
mRNA for the indicated gene. Embryos are oriented with the anterior pole towards the
left, dorsal side upwards.

Images in this dissertation are presented in color.

15

 

 

 

 

 

 

 

bcd ( a Maternal genes
‘ bicoid (bcd)
nanos (nos)

.. I

‘ ’" hunchback (hb)
k - giant (gt)

"' \ ‘ knirps (kni)
krr'ippel (kt)
tailless (fl!)

4 9 O! ' I I : ‘F
h 4 0‘ s I ‘1‘
Pair-rule genes
ftz I 'J' I
I‘ll
w...— _ -— hairy (h)
rum-g ‘ even-skipped (eve)
eve ' a. ...s‘ runt (run)
fushi-tarazu (ftz)

Figure 1-3: Early development in Drosophila is controlled by a hierarchy of
transcription factors.

genes. Gap genes are the first zygotic genes to be expressed along the A-P axis and
include hunchback (hb), giant (gt), kriippel (kr), knirps (kni), and tailless (tl). Gap genes
are expressed in a simple pattern made up of one or two broad expression domains and
perform two major functions. First, they control expression of the pair-rule class of
segmentation genes, each of which is expressed in a series of seven transverse stripes
along the A-P axis. These striped patterns are the first evidence of a reiterated body plan
in early development, and precisely define the segmental compartments of the embryo.
The borders of these compartments are then set by the segment polarity class of genes,
which are expressed in a series of 14 stripes about one cell wide along the A-P axis. The
second function of the gap genes in setting up the body plan is to limit the expression of
the homeotic selector genes, which are involved in the specification of structures that are
unique to each segment (67-68).

A textbook example of how pair-rule expression patterns are generated is
provided by the regulation of the even-skipped (eve) gene (Fig. 1-4). In the syncytial
blastoderm embryo, eve is expressed in a pattern of seven stripes along the A—P axis (69-
72). The striped expression pattern appears gradually. Initially the gene is expressed at
low level in most of the nuclei forming a broad stripe of expression which then is
restricted to certain nuclei. Each stripe is initially fuzzy, but eventually acquires sharp
margins. The eve locus (Fig. 1-4D) contains five non-overlapping enhancers that control
the expression of individual or pairs of stripes (73, 74). Each stripe is specified
independently, but a similar general mechanism is employed: the stripe is potentially
expressed in a broad region by the activity of widely distributed activators and the final

borders of each stripe are set by the combined activity of localized repressors. The best-

17

Figure 1-4: Regulation of the pair-rule gene even-skipped (eve).

At the blastoderm stage, the pair-rule gene even-skipped (eve) is expressed in seven
transverse stripes along the anterior-posterior axis (A and top panel). The expression of
eve was visualized in the embryo showed at the top by in situ hybridization using
digoxigenin-labeled, antisense eve mRNA probe (the embryo is oriented anterior towards
the left, dorsal upwards). The seven blastoderm stripes of eve expression are regulated by
five independent enhancer elements (D) that are located within a l6-kbp regulatory locus.
Three enhancers drive expression of single stripes (eve 1, eve 2 and eve 5), and the
remaining two drive expression of pairs of stripes (eve 3+7 and eve 4+6). The minimal
eve stripe 2 enhancer (E) is a ~480 bp cis-regulatory element which contains binding sites
for the maternally contributed transcriptional activators Bicoid (Bed) and Hunchback
(Hb), and for the short-range repressors Giant (Gt) and Kriippel (Kr). A model for the
regulation of eve stripe 2 is shown in panel B. The maternal Bed and Hb (not shown)
proteins form steep anterior to posterior gradients, activating eve stripe 2 expression in a
broad anterior region of the embryo. Giant is expressed in a broad band in the anterior
region of the embryo (blue curve) and represses the expression of eve stripe 2 in this
region, setting the anterior border of the stripe. Similarly, Kriippel, which is expressed in
the central region of the embryo (purple curve), sets up the posterior border of eve stripe
2 expression pattern. Regulations of other eve stripes follow a similar general mechanism
although the activators and repressors involved are different. For instance, in the case of
eve 3+7 and eve 4+6 regulation (panel C), the short-range repressor Knirps (Kni) sets up
the inner borders for these stripes, whereas Hunchback (Hb) established the outer
borders.

Panels A, B, and C are reproduced, with permission, from Dimitri Papatsenko
(http://homepages.nyu.edu/~dap).

Images in this dissertation are presented in color.

18

even-skipped (eve)

 

 

   

 

3+7 enc
4+6 enc

      

 

anterior A posterior

D

 

Figure 1-4: Regulation of the pair-rule gene even-skipped (eve).

characterized eve enhancer drives expression of stripe 2 (75-77), which is activated in a
broad anterior domain by the maternal morpho gens Bicoid (Bed) and Hunchback (Hb).

Borders of the stripe are formed by repressive interactions involving the gap protein
Giant (Gt) Kriippel (Kr) and Sloppy Paired, which are expressed in gradients anterior and
posterior to the stripe (Fig. 1-4B). Activation and repression are mediated by the direct
binding of these proteins to discrete sites in the enhancer (Fig. 1-4E; 75, 77-79). Thus,
this enhancer acts as a transcriptional switch that senses activator/repressor ratios in

individual nuclei.

The short-range transcriptional repressor Knirps

The Drosophila gene knirps (kni) was identified in a genetic screen for mutations
affecting embryonic segmentation in the fruit fly D. melanogaster (62). On the basis of
its mutant phenotype it was classified as a gap gene, a class of mutants where large
sections of the body pattern along the antero-posterior axis are missing. Mutations in the
kni gene are embryonic lethal and show deletion of adjacent segments in the abdominal
region (62, 80). In kni lack of function mutant embryos, out of the normal eight
abdominal segments (Al-8) only one (A8) is properly formed. In place of the others, a
single undifferentiated field is found (80-82). Chromosomal rearrangements associated
with kni mutants enabled the localization of the kni locus to region 77E in the lefi arm of
the third chromosome and the gene was cloned by a chromosome walk approach (80).
The kni gene encodes a 429 a basic protein (estimated pl= 10.2) with a calculated

relative molecular mass of 45.6 kDa. The N-terminus of the protein shows significant

20

homology (about 50% identity) with members of the nuclear hormone receptor
superfamily (80). This region corresponds to the DNA binding motif (aa 1-74), which
encodes a Cysz/Cysz type of zinc finger. Knirps is capable of binding as a monomer to its
target DNA (83). The C-terminal region does not resemble the canonical hormone
receptor ligand binding domain, however, and Knirps is not known to interact with small
molecule ligands.

knirps expression is exclusively zygotic and the transcript is first detected after
the 11th nuclear division (stage 4, ~1.5-2 hours after fertilization), forming a broad band
in the posterior region of the embryo (84 and Fig. 1-5A). Soon after, km' transcripts are
also observed in the ventral region at the anterior tip (Fig. l-5B). During cellularization
(stage 5, 2-4 hours after fertilization), a third domain appears as a stripe posteriorly
adjacent to the anterior domain (Fig. l-SC). The posterior domain of kni expression gets
weaker during gastrulation (Fig. l-5D) and it cannot be detected during germ band
extension (Fig. 1-5E, stage 6-7). In contrast, the anterior domains of expression remain
detectable both during germ band extension and thereafter, when the pattern becomes
highly complex (Fig. 1-5F, stage 8). The spatial distribution of Knirps protein closely
follows the mRNA expression pattern and the protein appears to be nuclear (85 and Fig.
l-SG-L).

At the blastoderm stage, molecular targets of Knirps protein include the even-
skipped (eve), hairy, hunckback and runt genes (53, 88-89). Knirps functions outside the
blastoderm stage include tracheal formation during late embryogenesis and vein
formation in the wing (90, 91). In transgenic embryo assays, Knirps represses

heterologous enhancers and promoters over a short range. This repression function is

21

Figure 1-5: Knirps mRNA and protein expression patterns.

A-F. knirps (kni) mRNA expression pattern visualized by in situ hybridization using
digoxigenin-UTP-labeled antisense kni mRNA probe. Embryos were fixed and stained
according to standard protocols (77, 86) and are oriented anterior towards the left, dorsal
side upwards. knirps expression at syncytial blastoderm stage appears first in the
posterior domain (A) and slightly thereafter in an antero-ventral domain (B). At cellular
blastoderm stage a third expression domain appears posteriorly to the antero-ventral
domain (C), whereas the posterior domain gets weaker (D) and cannot be detected during
germ band extension (B). At extended germ band stage a complex segmental pattern can
be seen (F).

G-L. Knirps protein expression pattern visualized by in situ antibody staining. Knirps
antibody was kindly provided by John Reinitz and used at 1:100 dilution. Embryos were
fixed and stained according to ref. 87, using the ABC Elite kit (Vector Labs, Burlingame,
CA) as described by the manufacturer. The spatial distribution of Knirps protein closely
follows the mRNA expression pattern.

All embryos were collected from yellow-white flies. A and G: stage 4 embryos. B and H:
early stage 5 embryos. C and I: late stage 5 embryos. D: stage 6 embryo. E: stage 8
embryo. F and L: stage 9 embryos.

22

 

Figure 1-5: Knirps mRNA and protein expression patterns.

23

CtBP-dependent repression domain

 

r I
202 358

332 338
PMDLSMK

75 95 429
-I1=IIIIEIK~I J

CtBP-independent repression domain

Figure 1-6: Schematic structure of the Knirps protein.
Knirps possess two functionally distinct repression domains: CtBP-dependent and —

independent repression domain. DBD is the DNA-binding domain. NSL is the nuclear
localization signal. The CtBP-binding motif is between amino acid 332 and 338.

24

modular and can be transferred to a heterologous DNA binding domain (46). Using an in
vivo repression assay, Keller and colleagues (92) carried out a detailed structure-function
analysis of Knirps and identified two distinct repression domains (Fig. 1-6). The first
repression domain maps to the central region of Knirps (minimally between aa 21 1-35 8)
and includes the CtBP binding motif, PMDLSMK (aa 332-338). This repression activity
depends on CtBP, because deletions or mutations in the CtBP binding motif that abrogate
CtBP binding also result in loss of repression activity (92-94). This repression fimction is
here referred to as CtBP-dependent repression domain. The second repression domain is
localized to the N-terminal region of Knirps (minimally between aa139-330). This
domain of Knirps does not bind CtBP in vitro and is able to function in the absence of
maternal CtBP (92 and Chapter 2). This repression function is here referred to as CtBP-
independent repression domain.

To understand the mechanisms of Knirps-mediated repression, it is critical to
identify the factors that functionally interact with this repressor. A genetic approach
aimed to identify factors involved in kni regulation was impaired by the existence of kni-
cognate gene, knirps-related (knrl) that can compensate for loss of kni activity when the
cell cycle is delayed (95). Even though the expression pattern and biochemical fimctions
of kni and knrl are apparently identical, knrl does not function in abdominal segmentation
because its large primary transcript cannot be fully transcribed during the syncytial
blastoderm stage due to the short duration of mitotic cycles (85). Zygotic suppressors of a
kni mutant (Resurrector and Godzilla) were found to cause mitotic cycle delays at
metaphase during the blastoderm stage. These mitotic cycle delays result in precocious

expression of the knrl gene, which compensates for loss of kni activity (95).

25

Yeast two hybrid assay using Knirps as bait led to the identification of the
corepressor CtBP (see below), but this assay did not identify additional Knirps-
interacting factors (Keller and Amosti, unpublished; 96). Therefore, I decided to use a
biochemical approach to test whether Knirps interacts with additional factors (described

in Chapter 4).

C-terminal Binding Protein (CtBP)

The germinal Binding Protein (CtBP) was originally identified in human cells
during a search for cellular proteins that associate with the C-terrninal region of
adenovirus ElA oncoprotein and negatively modulate its transforming activity (97-98;
reviewed in 99-100). CtBP was first linked to transcriptional repression by its functional
interaction with the Drosophila repressors Knirps, Snail and Hairy (93, 101), and in
subsequent studies has been found to contribute to the repression activity of Giant,
Brinker and Hairless (102-104). A short sequence motif in these repressors, similar to the
PLDLS motif present in ElA, is important for recruiting CtBP to promoter elements
(105) and mutations that abrogate CtBP binding severely impair repression activity (93,
94, 101). CtBP is a bona fide transcriptional corepressor because it is able to directly
repress a target gene when brought to the gene via a heterologous DNA-binding domain
(94). CtBP homologs are present in vertebrates (mouse and Xenopus laevis), invertebrates
(Drosophila melanogaster and Caenorhabditis elegans) and plants (106-109). CtBP
proteins are homologous to NAD-dependent D-hydroxyacid dehydrogenases, and possess
very similar overall structures to other dehydrogenases, as revealed by crystallographic

studies (110, 111). CtBP proteins, like the homologous dehydrogenases, are dimeric

26

proteins containing an NAD/NADH binding domain and a substrate-binding domain (99,
111). Residues involved in NAD/NADH binding and dehydrogenase activity are
absolutely conserved in CtBP proteins, suggesting an important function. Recent studies
have shown that CtBP has a weak dehydrogenase activity in vitro, although the
physiological substrates of CtBP as well as the significance of this enzymatic activity in
transcriptional repression remain unknown (110, 112).

The mechanisms of repression mediated by CtBP are not currently understood.
CtBP itself interacts with chromatin-modifying factors, including histone deacetylases
and histone metyltransferases (113, 114, and 34). Thus, CtBP might repress transcription
by recruiting chromatin- or protein-modifying factors to promoter regions. According to
this model, the co-repressor simply acts as a bridging factor and the repression activity is
caused by the specific factor/s recruited. Alternatively, or in addition, the dehydrogenase
activity observed in vitro might also play an important, yet unclear, role in repression.
CtBP binding to transcriptional repressors might be regulated by the nuclear
NADVNADH ratio, with NADH being two to three orders of magnitude more effective
(115), however, others have failed to reproduce this finding. Agents capable of increasing
NADH levels were shown to stimulate CtBP binding to its partners in vivo and to
potentiate CtBP-mediated repression (115).

In addition to its roles in transcriptional repression, CtBP is also found in the
cytoplasm, where is thought to participate in other cellular processes. CtBP is reported to
possess an acylation activity, which increases membrane curvature during Golgi fission

(116, 117). Subcellular localization of mammalian CtBP can be influenced by expression

27

of CtBP binding partners as well as post-translationally via modifications such as
sumoylation or phosphorylation (118-120).

Drosophila has a single CtBP gene (dCtBP) mapped to region 87 D8-9 on the
right arm cf the third chromosome. The transcript is alternatively spliced to give at least
three different mRNAs, predicted to produce proteins of 479, 386 and 383 amino acids in
length (101). CtBP protein is maternally contributed and ubiquitously expressed
throughout embryogenesis. Western blotting using a polyclonal antibody raised against
the longer version of dCtBP (dCtBPL) detects three proteins, a doublet that runs at
approximately 42 kDa and a polypeptide of approximately 50 kDa. All three forms share
the highly conserved dehydrogenase domain also found in vertebrate CtBP proteins and
are present throughout embryogenesis (see Appendix A). CtBPL and CtBPs (the 383 a-
long isoform) demonstrate similar repression activities when assayed as Gal4-fusion
proteins in cell-culture experiments, as well as on integrated reporters in transgenic
embryos (121, 122), indicating that the C-tenninal extension present in CtBPL does not
affect repression activity. NAD binding to CtBP, but not the conserved histidine in the
predicted catalytic site, was found to be critical for the repression activity mediated by
Gal4-CtBP in vivo, suggesting that NAD may play an important role in short-range

repression (122).

28

REFERENCES

10.

11.

12.

13.

Wolpert L., Beddington R., Brockes T., Jessel T., Lawrence P., and Mayerowitz
E. (1998). Principles of Development. Oxford University Press.

Kadonaga J .T. (2004). Regulation of RNA polymerase II transcription by sequence-
specific DNA binding factors. Cell 116: 247-257.

Lemon B., and Tjian R. (2000). Orchestrated response: a symphony of transcription
factors for gene control. Genes & Dev. 14: 2551-2569.

Johnson A.D. (1995). The price of repression. Cell 81: 655-658.

Herschbach B.M., Arnaud M.B., and Johnson A.D. (1994). Transcriptional
repression directed by the yeast a2 protein in vitro. Nature 370: 309-311.

Gray 8., Cai H., Barolo S., and Levine M. (1995). Transcriptional repression in the
Drosophila embryo. Phil. Trans. R. Soc. Lond. 349: 257-262.

Davidson E.H., Rast J.P., Oliveri P., Ransick A., Calestani C., Yuh C-H.,
Minokawa T., Amore G., Hinman V., Arenas-Mena C., Otim 0., Brown C.T.,
Livi C.B., Lee P.Y., Revilla R., Rust A.G., Pan Z.j., Schilstra M.J., Clarke P.J.C.,
Arnone M.I., Rowen L., Cameron R.A., McClay D.R., Hood L., and Bolouri H.
(2002). A genomic regulatory network for development. Science 295: 1669-1678.

Studer M., Popper] H., Marshall H., Kuroiwa A., and Krumlauf R. ( 1994). Role
of a conserved retinoic acid response element in rhombomere restriction of Hoxb-l.
Science 265: 1728-1732.

Sehoenherr C.J., and Anderson DJ. (1994). The neuron-restrictive silencer factor
(NRSF): a coordinate repressor of multiple neuron-specific genes. Science 267: 1360-
1363.

Sawada S., Scarborough J.D., Killeen N., and Littman DR. (1994). A lineage-
specific transcriptional silencer regulated CD4 gene expression during T-lymphocyte
development. Cell 77: 917-929.

Gray 8., and Levine M. (1996). Transcriptional repression in development. Curr.
Opin. Cell Biol. 8: 358-364.

Courey A.J., and Jia S. (2001). Transcriptional repression: the long and the short of
it. Genes & Dev. 15: 2786-2796.

Lewin B. (2004). Gene VIII. Pearson Education, Inc. Pearson Prentice Hall, Upper
Saddle River, NY 07458.

29

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

Hochheimer A., and Tjian R. (2003). Diversified transcription initiation complexex
expand promoter selectivity and tissue-specific gene expression. Genes & Dev. 17:
1309-1320.

Kornberg RD, and Lorch Y. (1999). Twenty-five years of the nucleosome,
fundamental particle of the eukaryote chromosome. Cell 98: 285-294.

Horn P.J., and Peterson CL. (2002). Chromatin higher order folding: wrapping up
transcription. Science 297: 1824-1827.

Roberts S.G.E. (2000) Mechanisms of action of transcriptional activation and
repression domains. Cell. Mol. Life Sci. 57: 1149-1160.

Arnosti D.N. (2004). Multiple mechanisms of transcriptional repression in
eukaryotes. Submitted.

Salghetti S.E., Caudy A.A., Chenoweth J.G., and Tansey WP. (2001). Regulation
of transcriptional domain function by ubiquitin. Science 293: 1651-1653.

Conaway R.C., Brower GS, and Conaway J.W. (2002). Emerging roles of
ubiquitin in transcription regulation. Science 296: 1254-1258.

Udvardy A. (1999). Dividing the empire: boundary chromatin elements delimit the
territory of enhancers. EMBO J. 18: 1-8.

Gerasimova T.I., and Corces V.G. (2001). Chromatin insulators and boundaries:
effects on transcription and nuclear organization. Annual Rev. Genet. 35: 193-208.

West A.G., Gaszner M., and Felsenfeld G. (2002). Insulators: many functions,
many mechanisms. Genes & Dev. 16: 271-288.

Cai H.N., and Shen P. (2001). Effects of cis arrangement of chromatin insulators on
enhancer-blocking activity. Science 291: 493-495.

Costanzi C., and Pehrson JR. (1998). Histone macroH2A1 is concentrated in the
inactive X chromosome of female in mammals. Nature 393: 599-601.

Angelov D., Molla A., Perche P-Y., Hans F., Cote J., Khochbin S., Bouvet P., and
Dimitrov S. (2003). The histone variant macroH2A interferes with transcription
factor binding and SWI/SNF nucleosome remodeling. Mol. Cell 11: 1033-1041.

Strahl B.D., and Allis CD. (2000). The language of covalent histone modification.
Nature 403: 41-45.

Thiagalingam 8., Cheng K.H., Lee H.J., Mineva N., Thiagalingam A., and Ponte

J.F. (2003). Histone deacetylases: unique players in shaping the epigenetic histone
code. Ann. N. Y. Acad. Sci. 983: 84-100.

30

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

Waterborg J.H. (2002). Dynamics of histone acetylation in vivo. A fimction for
acetylation turnover? Biochem. Cell Biol. 80: 363-378.

Deckert J., and Struhl K. (2002). Targeted recruitment of de3 histone deacetylase
represses transcription by inhibiting recruitment of Swi/Snf, SAGA, and TATA
binding protein. Mol. Cell. Biol. 22: 6458-6470.

Chen 0., Fernandez J., Mische S., and Courey A.J. (1999). A fimtional interaction
between the histone deacetylase de3 and the corepressor Groucho in Drosophila
development. Genes & Dev. 13: 2218-2230.

Ahringer J. (2000). NuRD and SIN3 histone deacetylase complexes in development.
Trends in Gen. 16: 351-356.

Tomita A., Buchholz D.R., and Shi Y.B. (2004). Recruitment of N-CoR/SMRT-
TBLRl corepressor complex by unliganded thyroid hormone receptor for gene
repression during frog development. Mol. Cell. Biol. 24: 3337-3346.

Shi Y., Sawada J., Sui G., Affar el B., Whetstine J.R., Lan F., Ogawa H., Luke
M.P., Nakatani Y., and Shi Y. (2003). Coordinated histone modifications mediated
by the CtBP co-repressor complex. Nature 422: 735-738.

Attwood J.T., Yung R.L., and Richardson B.C. (2002). DNA methylation and the
regulation of gene transcription. Cell. Mol. Life Sci. 59: 241-257.

Zhang Y., and Reinberg D. (2001). Transcription regulation by histone methylation:
interplay between different covalent modifications of the core histone tails. Genes &
Dev. 15: 2343-2360.

Ballestar E., and Wolffe AP. (2001). Methyl-CpG binding proteins. Targeting
specific gene expression. Eur. J. Biochem. 268: 1-6.

Orlando V. (2003). Polycomb, epigenomes, and control of cell identity. Cell 112:
599-606.

Workman J.L., and Kingston RE. (1998). Alteration of nucleosome structure as a
mechanism of transcriptional regulation. Ann. Rev. Biochem. 67: 545-579.

Narlikar G.J., Fan H.Y., and Kingston RE. (2002). Cooperation between
complexes that regulate chromatin structure and transcription. Cell 108: 47 5-487.

Peterson CL. (2002). Chromatin remodeling: nucleosomes bulging at the seams.
Curr. Biol. 12: R245-7.

Becker P.B., and Hbrz W. (2002). ATP-dependent nucleosome remodeling. Ann.
Rev. Biochem. 71: 247-273.

31

43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

53.

54.

55.

Hbrz W., and Roth S. (2003). Chromatin structure and control of transcription in
vivo. Chapter 3; page 49-70. In: Protein complexes that modify chromatin. Workman
J .L. (Ed.). Springer.

Hoch M., Gerwin N., Tauber H., and Jackle H. (1992). Competition for
overlapping sites in the regulatory region of the Drosophila gene kriippel. Science
256: 94-97.

Gray 8., Szymauski P., and Levine M. (1994). Short-range repression permits
multiple enhancers to function autonomously within a complex promoter. Genes &
Dev. 8: 1829-1838.

Arnosti D.N., Gray S., Barolo 8., Zhou J., and Levine M. (1996). The gap protein
knirps mediates both quenching and direct repression in the Drosohila embryo.
EMBO J. 15: 3659-3666.

Gaston K., and Jayaraman RS. (2003). Transcriptional repression in eukaryotes:
repressors and repression mechanisms. Cell. Mol. Life Sci. 60: 721-741.

Austin R.J., and Biggin M.D. (1995). A domain of the even-skipped protein
represses transcription by preventing TFIID binding to a promoter: repression by
cooperative blocking. Mol. Cell. Biol. 15: 4683-4693.

Li C., and Manley J.L. (1998) Even-skipped represses transcription by binding
TATA binding protein and blocking the TFIID-TATA box interaction. Mol. Cell.
Biol. 18: 3771-3781.

McKay L.M., Carpenter B., and Roberts S.G.E. (1999). Evolutionary conserved
mechanism of transcriptional repression by even-skipped. Nucl. Acids Res. 27 : 3064-
3070.

Breiling A., Turner B.M., Bianchi M.E., and Orlando V. (2001). General
transcription factors bind promoters repressed by Polycomb group proteins. Nature
412: 651-655.

Carrozza M.J., John 8., Si] A.K., Hopper J.E., and Workman J.L. (2002). Ga180
confers specificity on HAT complex interactions with activators. J. Biol. Chem. 277:
24648-24652.

Small S., Blair A., and Levine M. (1996). Regulation of two pair-rule stripes by a
single enhancer in the Drosophila embryo. Dev. Biol. 175: 314-324.

Barolo S., and Levine M. (1997). hairy mediates dominant repression in the
Drosophila embryo. EMBO J. 16: 2883-2891.

Nibu Y., Zhang H., and Levine M. (2001). Local action of long-range repressors in
the Drosophila embryo. EMBO J. 20: 2246-2253.

32

56.

57.

58.

59.

60.

61.

62.

63.

64.

65.

66.

67.

Gray 8., and Levine M. (1996). Short-range transcriptional repressors mediate both
quenching and direct repression within complex loci in Drosophila. Genes & Dev.
10: 700-710.

Nibu Y., Senger K., and Levine M. (2003). CtBP-independent repression in the
Drosophila embryo. Mol. Cell. Biol. 23: 3990-3999.

Hewitt G.F., Strunk B.S., Margulies C., Priputin T., Wang X.D., Amey, R. Pabst
B.A., Kosman D., Reinitz J., and Arnosti D.N. (1999). Transcriptional repression
by the Drosophila Giant protein: cis element positioning provides an alternative
means of interpreting an effector gradient. Development 126: 1201-1210.

Campos-Ortega J.A., and Hartenstein V. (1997). The embryonic development of
Drosophila melanogaster. 2nd edition. Springer.

Foe V.E., Garrett M., Odell M., and Edgar B.A. (1993). Mitosis and
morphogenesis in the Drosophila embryo: point and counterpoint. In: The
development of Drosophila melanogaster. Bate M. and Martinez Arias A. (Eds.). pp
149-300. Cold Spring Harbor Laboratory Press. New York.

Lawrence RA. (1992). The making of a fly: the genetics of animal design. Blackwell
Scientific Publications.

Ntlsslein-Volhard C., and Wieshaus E. (1980). Mutations affecting segment
number and polarity in Drosophila. Nature 287: 795-801.

Niisslein-Volhard C., Kluding H., and Jtlrgens G. (1985). Genes affecting the
segmental subdivision of the Drosophila embryo. Cold Spring Harbor Symp. Quant.
Biol. 50: 145-154.

St. Johnston D., and Nitsslein-Volhard C. (1992). The origin of pattern and polarity
in the Drosophila embryo. Cell 68: 201-219.

Driver W. (1993). Maternal control of anterior development in the Drosophila
embryo. In: The development of Drosophila melanogaster. Bate M. and Martinez
Arias A. (Eds.). pp 301-324. Cold Spring Harbor Laboratory Press. New York.

Sprenger F., and Ntisslein-Volhard C. (1993). The terminal system of axis
determination in the Drosophila embryo. In: The development of Drosophila
melanogaster. Bate M. and Martinez Arias A. (Eds.). pp 365-386. Cold Spring
Harbor Laboratory Press. New York.

Pankratz M.J., and Jitckle H. (1993). Blastoderm segmentation. In: The
development of Drosophila melanogaster. Bate M. and Martinez Arias A. (Eds.). pp
467-516. Cold Spring Harbor Laboratory Press. New York.

33

68.

69.

70.

71.

72.

73.

74.

75.

76.

77.

78.

79.

80.

Small S. (1997) Mechanisms of segmental pattern formation in Drosophila
melanogaster. In: K.G. Adiyodi and R.G. Adiyodi (ed.), Reproductive biology of
invertebrates, vol VIII, p. 137-178. John Wiley and Sons, New York, NY.

Harding K., Rushlow C., Doyle H.J., Hoey T., and Levine M. (1986). Cross-
regulatory interactions among pair-rule genes in Drosophila. Science 233: 953-959.

Harding K., Hoey T., Warrior R., and Levine M. (1989). Autoregulatory and gap
gene response elements of the even-skipped promoter of Drosophila. EMBO J. 8:
1205-1212.

Macdonald P.M., Ingham P., and Struhl G. (1986). Isolation, structure, and
expression of even-skipped: a second pair-rule gene of Drosophila containing a
homeo box. Cell 47: 721-734.

Frasch M., Hoey T., Rushlow C., Doyle H.J., and Levine M. (1987).
Characterization and localization of the even-skipped protein of Drosophila. EMBO
J. 6: 749-759.

Fujioka M., Emi-Sarker Y., Yusibova G.L., Goto T., and Jaynes J.B. (1999).
Analysis of an even-skipped rescue transgene reveals both composite and discrete
neuronal and early blastoderm enhancers, and multi-stripe positioning by gap gene
repressor gradients. Development 126: 2527-2538.

Sackerson C., Fujioka M., and Goto T. (1999). The even-skipped locus is contained
in a 16-kb chromatin domain. Dev. Biol. 211: 39-52.

Small 8., Kraut R., Hoey T., Warrior R., and Levine M. (1991). Transcriptional
regulation of a pair-rule stripe in Drosophila. Genes & Dev. 5: 827-839.

Stanojevic D., Small 8., and Levine M. (1991). Regulation of a segmentation stripe
by overlapping activators and repressors in the Drosophila embryo. Science 254:
1385-1387.

Small 8., Blair A., and Levine M. (1992). Regulation of even-skipped stripe 2 in the
Drosophila embryo. EMBO J. 11: 4047-4057.

Stanojevic D., Hoey T., and Levine M. (1989). Sequence-specific DNA-binding
activities of the gap proteins encoded by hunckback and Krz’ippel in Drosophila.
Nature 341: 331-335.

Andrioli L.P., Vasisht V., Theodosopoulou E., Obersteiu A., and Small S. (2002).
Anterior repression of a Drosophila stripe enhancer requires three position-specific
mechanisms. Development 129: 4931-4940.

Nauber U., Pankratz M.J., Kienlin A., Seifert E., Klemm U., and Jaeckle H.
(1988). Abdominal segmentation of the Drosophila embryo requires a hormone
receptor-like protein encoded by the gap gene knirps. Nature 336: 489-492.

34

81.

82.

83.

84.

85.

86.

87.

88.

89.

90.

91.

92.

93.

Lehmann R. (1985). Regionsspezifishe segrnentierungsmutanten bei Drosophila
melanogaster meigen. Ph.D. Thesis. Univ. Titbingen.

Lehmann R. (1988). Phenotypic comparison between maternal and zygotic genes
controlling the segment pattern of the Drosophila embryo. Development (Suppl)
104: 17-27.

Gerwin N., La Rosée A., Sauer F., Halbritter H.P., Neumann M., Jackle H., and
Nauber U. (1994). Functional and conserved domains of the Drosophila transcription
factor encoded by the segmentation gene knirps. Mol. Cell. Biol. 14: 7899-7908.

Rothe M., Nauber U., and Jackle H. (1989). Three hormone receptor-like
Drosophila genes encode an identical DNA-binding finger. EMBO J. 8: 3087-3094.

Rothe M., Pehl M., Taubert H., and Jitckle H. (1992) Loss of gene function
through rapid mitotic cycles in the Drosophila embryo. Nature 359: 156-159.

Tautz D., and Pfeifle C. (1989). A non-radioactive in situ hybridization method for
the localization of specific RNAs in Drosophila embryos reveals translational control
of the segmentation gene hunchback. Chromosoma 98: 81-85.

Ashbumer M. (1989). Drosophila: a laboratory manual. Protocol 95, 214-216. Cold
Spring Harbor Laboratory Press. New York.

Kosman D., and Small S. (1997). Concentration-dependent patteming by an ectopic
expression domain of the Drosophila gap gene Knirps. Development 124: 1343-1354.

Langeland J.A., and Carroll SB. (1993). Conservation of regulatory elements
controlling hairy pair-rule stripe formation. Development 117: 585-596.

Chen C-K., Kithnlein R.P., Eulenberg K.G., Vincent 8., Affolter M., and Schuh
R. (1998). The transcription factor KNIRPS and KNIRPS RELATED control cell
migration and branch morphogenesis during Drosophila tracheal development.
Development 125: 4959-4968.

Lunde K., Biehs B., Nauber U., and Bier E. (1998). The knirps and knirps-related
genes organize development of the second wing vein in Drosophila. Development
125: 4145-4154.

Keller S.A., Mao Y., Struffi P., Margulies C., Yurk c.E., Anderson A.R., Amey
R.L., Moore 8., Ebels J.M., Foley K., Corado M., and Arnosti D.N. (2000).
dCtBP-dependent and -indipendent repression activities of the Drosophila Knirps
protein. Mol. Cell. Biol. 20: 7247-7258.

N ibu Y., Zhang H., and Levine M. (1998) Interaction of short-range repressors with
Drosophila CtBP in the embryo. Science 280: 101-104.

35

94. Nibu Y., Zhang H., Bajor E., Barolo S., Small S., and Levine M. (1998) dCtBP
mediates transcriptional repression by Knirps, Kriippel and Snail in the Drosophila
embryo. EMBO J. 17: 7009-7020.

95. Ruden B.M., and Jackie H. (1995). Mitotic delay dependent survival identifies
components of cell cycle control in the Drosophila blastoderm. Development 121:
63-73.

96. Giot L., Bader J.S., Brouwer C., Chaudhuri A., Kuaug B., Li Y., Hao Y.L., Ooi
C.E., Godwin B., Vitols E., Vijayadamodar G., Pochart P., Machineni H., Welsh
M., Kong Y., Zerhusen B., Malcolm R., Varrone Z., Collis A., Minto M., Burgess
S., McDaniel L., Stimpson E., Spriggs F., Williams J., Neurath K., Ioime N.,
Agee M., Voss E., Furtak K., Renzulli R., Aauensen N., Carrolla S., Bickelhaupt
E., Lazovatsky Y., DaSilva A., Zhang J., Stanyon C.A., Finley R.L.Jr., White
K.P., Braverman M., Jarvie T., Gold S., Leach M., Knight J., Shimkets R.A.,
McKenna M.P., Chant J., and Rothberg J.M. (2003). A protein interaction map of
Drosophila melanogaster. Science 302: 1727-1736.

97. Boyd J.M., Subramanian T., Schaeper U., La Regina M., Bayley S., and
Chinnadurai G. (1993). A region of the C-terrninus of adenovirus 2/5 Ela protein is
required for association with a cellular phosphoprotein and important for the negative
modulation of T24-ras mediated transformation and metastasis. EMBO J. 12: 469-
478.

98. Schaeper U., Boyd J.M., Verma S., Uhlmann E., Subramanian T., and
Chinnadurai G. (1995) Molecular clononing and characterization of a cellular
phosphoprotein that interacts with a conserved C—terminal domain of adenovirus ElA
involved in negative modulation of oncogenic transformation. Proc. Nat. Acad. Sci.
USA 92: 10467-10471.

99. Turner J., and Crossley M. (2001). The CtBP family: enigmatic and enzymatic
transcriptional co-repressors. BioEssay 23: 683-690.

100.Chinnadurai G. (2002). CtBP, an unconventional transcriptional repressor in
development and onco genesis. Mol. Cell 9: 213-224.

101.Poortinga G., Watanabe M., and Parkhurst S.M. (1998). Drosophila CtBP: a
Hairy-interacting protein required for embryonic segmentation and hairy-mediated
transcriptional repression. EMBO J. 17: 2067-2078.

102.Strunk B., Struffi P., Wright K., Pabst B., Thomas J., Qin L., and Arnosti D.N.
(2001). Role of CtBP in transcriptional repression by the Drosophila giant protein.
Dev. Biol. 239: 229-240.

103.Hasson P., Mitller B., Basler K., and Paroush Z. (2001). Brinker requires two
corepressors for maximal and versatile repression in Dpp signaling. EMBO J. 20:
5725-5736.

36

104.Morel V., Lecourtois M., Massiani 0., Maier D., Preiss A., and Schweisguth F.
(2001). Transcriptional repression by suppressor of hairless involves the binding of a
hairless-dCtBP complex in Drosophila. Curr. Biol. 11: 789-792.

105.Schaeper U., Subramanian T., Lim L., Boyd J.M., and Chinnadurai G. (1998).
Interaction between a cellular protein that binds to the C-terminal region of
adenovirus ElA (CtBP) and a novel cellular protein is disrupted by ElA through a
conserved PMDLS motif. J. Biol. Chem. 273: 8549-8552.

106.Hildebrand J.D., and Soriano P. (2002). Overlapping and unique roles for the C-
tenninal binding protein 1 (CtBPl) and CtBP2 during mouse development. Mol. Cell.
Biol. 22: 5296-5307.

107.Sewalt R.G.A.B., Guuster M.J., van der Vlag J., Satijn D.P.E., and Otte AP.
(1999). C-terminal binding protein is a transcriptional repressor that interacts with a
specific class of vertebrate Polycomb proteins. Mol. Cell. Biol. 19: 777-787.

108.Kim C.T., Shoda K., Tsuge T., Cho K.H., Uchimiya H., Yokoyama R., Nishitani
K., and Tsukaya H. (2002). The ANGUSTIFOLIA gene of Arabidopsis, a plant
CtBP gene, regulates leaf-cell expansion, the arrangement of cortical microtubules in
leaf cells and expression of a gene involved in cell-wall formation. EMBO J. 21:
1267-1279.

109.Folkers U., Kirik V., Schobiuger U., Falk S., Krishnakumar S., Pollock M.A.,
Oppenheimer D.G., Day I., Reddy A.S., Jurgeus G., Hulskamp M., and Reddy
A.R. (2002). The cell morphogenesis gene AN GUSTIFOLIA encodes a CtBP/BARS-
like protein and is involved in the control of the microtubule cytoskeleton. EMBO J.
21: 1280-1288.

110.Kumar V., Carlson J.E., Ohgi K.A., Edwards T.A., Rose D.W., Escalante C.R.,
Rosenfeld M.G., and Aggarwal AK. (2002). Transcriptional represor CtBP is an
NAD+-regulated dehydrogenase. Mol. Cell 10: 857-869.

111.Nardini M., Spano S., Cericola C., Pesce A., Massaro A., Millo E., Luini A.,
Corda D., and Bolognesi M. (2003). CtBP/BARS: a dual-function protein involved
in transcriptional co-repression and Golgi membrane fission. EMBO J. 22: 3122-
3130.

112.Balasubramanian P., Zhao L.J., and Chinnadurai G. (2003). Nicotinamide
adenine dinucleotide stimulates oligomerization, interaction with adenovirus EIA and
an intrinsic dehydrogenase activity of CtBP. FEBS Lett. 537: 157-160.

113.Sundqvist A., Sollerbrant K., and Svensson C. (1998). The carboxy-tenninal
region of adenovirus El A activates transcription through targeting of a C-terminal
binding protein-histone deacetylase complex. FEBS Lett. 429: 183-188.

114.Subramanian T., and Chinnadurai G. (2003). Association of class I histone
deacetylases with transcriptional corepressor CtBP. F EBS Lett. 537: 255-258.

37

115.Zhang Q., Piston D.W., and Goodman RH. (2002). Regulation of corepressor
function by nuclear NADH. Science 295: 1895-1897.

116.Spano S., Silletta M.G., Colanzi A., Alberti S., Fiucci G., Valente C., Fusella A.,
Salmona M., Mironov A., Luini A., Corda D., and Spanfo S. (1999). Molecular
cloning and functional characterization of brefeldin A-ADP-ribosylated substrate. A
novel protein involved in the maintenance of the Golgi structure. J. Biol. Chem. 274:
17705-17710.

117.Weigert R., Silletta M.G., Spano S., Turacchio G., Cericola C., Colanzi A.,
Senatore S., Mancini R., Polishchuk E.V., Salmona M., Facchiano F., Burger
K.N., Mironov A., Luini A., and Corda D. (1999). CtBP/BARS induces fission of
Golgi membranes by acylating lysophosphatidic acid. Nature 402: 429-433.

118.Riefler G.M., and Firestein B.L. (2001). Binding of neuronal nitric-oxide synthase
(nNOS) to Carboxyl-terrninal-biding protein (CtBP) changes the localization of CtBP
from the nucleus to the cytosol: a novel function for targeting by the PDZ domain of
nNOS. J. Biol. Chem. 276: 48262-48268.

119.Kagey M.H., Melhuish T.A., and Wotton D. (2003). The polycomb protein P02 is
a SUMO E3. Cell 113: 127-137.

120.Lin X., Sun B., Liang M., Liang Y-Y., Gast A., Hildebrand J., Brunicardi F.C.,
Melchior F., and Feng X-H. (2003). Opposed regulation of corepressor CtBP by
SUMOylation and PDZ binding. Mol. Cell 11: 1389-1396.

121.Ryu J-R., and Arnosti D.N. (2003). Functional similarity of Knirps CtBP-
dependent and CtBP-independent transcriptional repression activities. Nucl. Acids
Res. 31: 4654-4662.

122.Sutrias-Grau M., and Arnosti, D.N. (2004). CtBP contributes quantitatively to
Knirps repression activity in an NAD binding dependent manner. Mol. Cell. Biol. In
press.

38

Chapter 2

CtBP-independent repression activity of the Drosophila
Knirps protein

2.1 Introduction

The identification of CtBP as a common corepressor for several Drosophila
repressors including Knirps (Nibu et al., 1998a; Poortinga et al., 1998) was an important
advance in our understanding of short-range transcriptional repression. By looking at the
expression pattern of both synthetic and endogenous targets for knirps (kni), krr'ippel (kr)
and snail (sna) in a maternal CtBP mutant, Nibu and colleagues concluded that CtBP was
very important, if not essential, for the repression activity of short-range repressors. They
also proposed the hypothesis that the functional distinction between short- and long-range
repression depended on the type of corepressor recruited, such that short-range repressors
utilized CtBP whereas long-range repressors employed Groucho (N ibu et al. 1998b).

A detailed structural-functional study carried out from our laboratory and aimed
to map the Knirps minimal repression domain using an in vivo repression assay identified
two firnctionally distinct repression domains (Fig. 1-6; Keller et al., 2000). The first
repression domain includes the previously identified CtBP-binding domain (P-DLS-K,
between amino acids 332-338) and comprises minimally amino acids 202-358. This
repression domain is totally dependent upon the presence of an intact CtBP binding
motif. Deletions or point mutations that abrogate binding also result in loss of repression
in vivo (Keller et a1. 2000). We refer to this Knirps repression domain as CtBP-dependent

repression domain. The second repression domain, which maps to the N-terminal region

39

of Knirps (minimally between amino acids 139-330) does not contain a recognizable
CtBP-binding motif and does not bind CtBP in vitro (Keller et al., 2000). These results
suggest that the endogenous Knirps protein is potentially able to repress in the absence of
the corepressor. Alternatively, the repression activity observed with the N-terminus of
Knirps may also be CtBP-dependent, with the corepressor binding to non-canonical
binding motif/s.

To test these two hypotheses I determined: 1) whether forms of Knirps containing
the putative CtBP-independent activity, namely Gal4-Knirps 7 5-330 and Gal4-Knirps 75-
429APMDLS, would repress a synthetic Knirps target in the absence of maternal CtBP
and 2) whether the endogenous Knirps protein was able to repress a native target without
the contribution of CtBP. The results showed that both Gal4-Knirps chimeric proteins
were able to repress an eve stripe 2-lac Z reporter gene in a maternal CtBP“ background,
suggesting that endogenous Knirps has the potential to function without the contribution
of CtBP. More importantly, endogenous Knirps was able to repress a native target, the
eve stripe 3 enhancer, in the absence of maternal CtBP, indicating that CtBP is
dispensable at least for some targets. These results were included in Keller et a1. (2000)
and I include here only the portions of that paper that describe these experiments (section
2.2; Figures 2-1 and 2-2).

The short-range repressor Giant does not have a canonical CtBP-binding motif
and previous studies suggested that Giant does not require CtBP for repression of the eve
stripe 2 enhancer (Nibu et al., 1998b). To determine the contributions of CtBP to Giant
mediated repression, I tested the expression patterns of endogenous and artificial Giant

targets in a CtBP“ maternal mutant. The results indicate that CtBP is required for Giant

40

repression of some, but not all, genes and that the Giant-CtBP interaction is likely to be
direct. These results were included in Strunk et a1. (2001), which I include here in its
entirety (Section 2.3), as my experiments contributed to a major portion of this paper
(Figures 3-3, 3-4 and 3-5). A parallel study carried out at the same time, also concluded
that Giant might interact with the corepressor CtBP (Nibu, Y. and Levine, M. (2001).
CtBP-dependent activities of the short-range Giant repressor in the Drosophila embryo.

Proc. Natl. Acad. Sci. USA 98: 6204-6208).

41

2.2 Functional identification of the CtBP-independent
repression domain of Knirps2

Materials and Methods

Analysis of gene expression in embryos lacking maternal dCtBP. CtBP' germ line
clones were produced using the autosomal FLP-DFS technique (Chou and Perrimon,
1996). Females carrying an eve stripe 2-upstream activation sequence (UAS)-IacZ
reporter gene on chromosome 1 (Arnosti et al. 1996) were crossed to D/T M3, Sb males.
Male progeny carrying the [col reporter and D were crossed to females carrying a
balanced, P-element insertional mutation of CtBP (CtBPO3463/T M3, Sb; Bloomington
stock no. P1590).

FRT, ovom/TM3, Sb males (Bloomington stock no. 2149) were mated to females
carrying the Saccharomyces cerevisiae FLP recombinase gene under the control of the
hsp 70 promoter (hsF LP; D/T M3, Sb; Bloomington stock no. 1970) to generate males with
hsF LP on chromosome 1 and ovoD1 over D on chromosome 3. Females carrying the lacZ
reporter and the CtBP mutant allele over D were crossed to these hsFLP; ovom/D males.
Embryos from this cross were collected for 24 h, aged for 48 h and heat shocked for 2 h
in a 37°C water bath. The heat shock was repeated 24 h after the first treatment. Females

lacking the D marker (hsFLP; FRT, ovom/CtBP03463) were mated to males carrying the

 

2 The results in this section were included in the following publication: Keller S.A., Mao Y., Struffi P.,
Margulies C., Yurk C.E., Anderson A.R., Amey R.L., Moore S., Ebels J .M., Foley K., Corado M.,
and Arnosti D.N. (2000). dCtBP-dependent and -independent repression activities of the Drosophila
Knirps protein. Molecular and Cellular Biology 20: 7247-7258.

42

appropriate Gal4-Knirps transgene. To assay for expression driven by the eve stripe
3 enhancer in a CtBP mutant background, males carrying an eve-lacZ fusion gene
containing a 500-bp (—3.8 to —3.3 kbp) or an 800-bp (—3.8 to —3.0 kbp) portion of the eve
stripe 3 enhancer (Small et al., 1996) were crossed to the females producing oocytes
deficient in dCtBP. Embryos were collected, fixed, and stained as described (Small et al.,
1992). As expected for CtBP mutants, embryos derived from these crosses died before

hatching.

Results

Repression by Knirps proteins in dCtBP mutant embryos. We tested whether the N-
terrninal region of the Knirps protein, which does not directly interact with dCtBP
protein, would mediate transcriptional repression in embryos lacking maternal dCtBP.
Such embryos have been shown to be defective for repression by other dCtBP-binding
repressor proteins, such as Snail (Nibu et al., 1998a), and the embryos show patterning
defects reflective of disruption in pair-rule gene expression (Poortinga et al., 1998). The
CtBP gene is expressed during oogenesis, and the message is deposited in the egg prior to
fertilization (Poortinga et al., 1998). Therefore, we generated embryos that lacked a
maternal contribution of dCtBP by the dominant female sterile FLP-DFS method
(Perrimon et al., 1996). An eve stripe 2 lacZ reporter (Fig. 2-1A) was crossed into the
dCtBP background, and somatic recombination was induced in females heterozygous for
ovoDl and the CtBP mutant allele to generate oocytes lacking dCtBP. Females were mated
to males carrying Gal4-Knirps transgenes, and embryos were analyzed by in situ

hybridization. The pattern of expression of the eve stripe 2 transgene is noticeably altered

43

Figure 2-1: Knirps N-terrrrinal repression activity functions in dCtBP mutant
embryos.

(A) eve stripe 2 [col reporter in a wild-type embryo. (B) eve stripe 2 lacZ reporter in a
mutant embryo lacking maternal dCtBP. Anterior and posterior boundaries of the stripe
are less well defined. (C) Repression by Gal4-Knir'ps 75-332 in a dCtBP mutant. Ventral
expression of the transgene is repressed. (D) Repression by Gal4-Knirps 75-364mut,
lacking the dCtBP binding motif. (E) Repression by Gal4-Knirps 75-429mut, lacking the
dCtBP binding motif. Embryos are oriented with anterior being to the left and dorsal
being to the top. Lateral views are shown, except for the ventrolateral view in panels C
and E. CtBP embryos were generally shorter and broader than wild-type embryos. In the
absence of repressor, 4% of embryos showed loss of ventral expression of the eve stripe 2
lacZ stripe in the mutant embryos (versus less than 1% in wild-type embryos). For the
repressor shown in panel C, 31% of embryos showed loss of ventral staining (n = 140);
for panels D and E, 31% (n = 39) and 75% (n = 65) of embryos, respectively, showed
loss of ventral staining.

44

 

.‘ —'—.“"T ’——_'l
.GAL4. Knirps 1

75-332

 

 

 

75-429mut

Figure 2-1: Knirps N-terminal repression activity functions in dCtBP mutant
embryos.

45

in such a genetic background (Fig. 2-1B), changing from the normal narrow stripe to a
broader band, consistent with the loss of Kriippel repression activity in posterior regions
(Nibu et al., 1998) and possibly loss of Giant activity in anterior regions (B. Strunk,
unpublished observations). The Gal4-Knirps 75-332 transgene was able to repress
reporter gene expression in a significant number of embryos (Fig. 2-1C), while very few
control embryos showed loss of ventral expression. Repression of the transgene in the
dCtBP mutant background was also observed when we assayed Gal4-Knirps 75-364mut
and 75—429mut proteins that lack the dCtBP interaction motif (Fig. 2-1D and E). Overall
levels of repression were higher than those observed in wild-type embryos, possibly due
to changes in Gal4-Knirps protein stability or transcription complex stability.

The endogenous Knirps target eve stripe 3 is repressed in a dCtBP mutant. To test
whether endogenous targets of the knirps gene might also show repression in a dCtBP
mutant embryo, we examined expression of a lacZ reporter gene derived from eve, which
is a direct target of Knirps. Five binding sites for the Knirps protein have been identified
within the 500-bp eve stripe 3 enhancer (Small et al., 1996). Consistent with this picture,
a lacZ transgene driven by the eve stripe 3 enhancer shows broad posterior derepression
in a kni mutant embryo (Fig. 2-2A and B) (Small et al., 1996). To test whether a similar
pattern of derepression would be observed in the absence of dCtBP, we crossed males
carrying a 500-bp eve stripe 3 lacZ transgene (Small et al., 1996) to females producing
dCtBP-deficient oocytes. Expression of the eve stripe 3 transgene was not derepressed in
posterior regions of the embryo, suggesting that Knirps is still able to repress this element
in the absence of maternal dCtBP (Fig. 2-2C). The mutant embryos did show other

alterations in lacZ expression, including ectopic expression in anterior regions and a

46

 

kni

CtBP

 

Figure 2-2: eve stripe 3 lacZ reporter gene is repressed normally in posterior
regions in a CtBP mutant embryo.

(A) Expression pattern of a 500-bp eve stripe 3 reporter gene in a wild-type embryo. (B)
Posterior derepression of the reporter gene in a knirps mutant embryo. (C) Expression
pattern of eve stripe 3 lacZ in a CtBP mutant embryo. Embryos did not show derepression
in the posterior region of the embryo but did show consistently stronger staining in eve
stripe 7 regions (an activity partially contained within eve stripe 3 enhancer sequence
[Small et al., 1996]) and ectopic activation in the anterior regions of the embryo.

(A and B) Parasagittal view; (C) surface view. Embryos are oriented with anterior at the
left and dorsal at the top.

47

broadening and intensifying of the posterior stripe (Fig. 2-2C). A similar pattern of
repression was observed with a stripe 3 lacZ reporter carrying an 800-bp enhancer (—3.8
to —3 kbp) (data not shown). The stronger derepression phenotype of the kni mutant

compared to the CtBP mutant suggests that Knirps contains a repression activity separate

from dCtBP, consistent with our identification of an additional N-terminal repression

region.

48

2.3 Role of CtBP in transcriptional repression by the
Drosophila Giant protein3

Abstract

The Giant protein is a short-range transcriptional repressor that refines the
expression pattem of gap and pair-rule genes in the Drosophila blastoderm embryo.
Short-range repressors including Knirps, Kriippel, and Snail utilize the CtBP cofactor for
repression, but it is not known whether a functional interaction with CtBP is a general
property of all short-range repressors. We studied giant repression activity in a CtBP
mutant and find that this cofactor is required for Giant repression of some, but not all,
genes. While targets of Giant such as the even-skipped stripe 2 enhancer and a synthetic
lacZ reporter show clear derepression in the CtBP mutant, another Giant target, the
hunchback gene, is expressed normally. A more complex situation is seen with
regulation of the kriippel gene, in which one enhancer is repressed by Giant in a CtBP-
dependent manner, while another is repressed in a CtBP-independent manner. These
results demonstrate that Giant can repress both via CtBP-dependent and CtBP-
independent pathways, and that promoter context is critical for determining Giant-CtBP
functional interaction. To initiate mechanistic studies of the Giant repression activity, we
have identified a minimal repression domain within Giant that encompasses residues 89-

205, including an evolutionarily conserved region bearing a putative CtBP binding motif.

 

3 This section was published as the following manuscript: Strunk B., Struffi P., Wright K., Pabst B.,
Thomas J ., Qin L., and Arnosti D.N. (2001). Role of CtBP in transcriptional repression by the
Drosophila giant protein. Developmental Biology 239: 229-240.

49

Introduction

The precise expression of developmentally regulated genes often reflects the
coordinate activity of both transcriptional activators and repressors acting on complex
regulatory elements (Arnone and Davidson, 1997; Ghazi and VijayRaghavan, 2000).
Transcriptional repressors involved in early gene expression in Drosophila
embryogenesis include the products of gap genes, pair-rule genes, and mesodenn-specific
genes. A major advance in understanding the action of some of these proteins came in the
recognition that some of these factors, including Kriippel, Knirps, Snail, and Giant, are
“short-range’ repressors, able to act over distances of 100-150 bp to interfere with the
activity of enhancers and basal promoter elements (Gray et al., 1994). Other “long-
range” repressor proteins such as Hairy are able to interfere with enhancers and
promoters over distances of >1kb, and can block the activity of multiple enhancers
simultaneously (Cai et al., 1996).

The mechanisms by which short-range and long-range Drosophila repressors
inhibit transcription are poorly understood, although a variety of potential pathways have
been described, including competitive binding with activators or elements of the basal
machinery, “quenching” of nearby activators, and chromatin remodeling (Stanojevic et
al., 1991; Hoch et al., 1992; Gray et al., 1994; Chen and Courey, 2000). Differences in
cofactor requirement suggest that these proteins are likely to utilize distinct pathways to
effect transcriptional repression. Long-range repression complexes involving Dorsal
protein and the Hairy protein have been shown to bind to the Groucho corepressor, which
is thought to act in turn through histone deacetylases (Jimenez et al., 1997; Chen and

Courey, 2000). Several short-range repressors have been shown to interact with the CtBP

50

corepressor, although it is not known if this is a general characteristic of all short-range
repressors (Nibu et al., 1998a, 1998b). It has been suggested that Giant, in particular,
does not require CtBP for repression of the eve stripe 2 enhancer (Nibu et al., 1998b). In
addition, CtBP has been shown to interact with Hairy, although in this case the cofactor
appears to inhibit, rather than potentiate, repression (Poortinga et al., 1998; Zhang and
Levine, 1999).

Previous work has established that the Giant protein functions in a number of
embryonic transcriptional circuits to regulate the expression of gap and pair rule genes,
including even-skipped (eve), hunchback (hb), and Kriippel (Kr) (Stanojevic et al., 1991;
Kraut and Levine, 1991; Capovilla et al., 1992; Wu et al., 1998). Recent work has also
identified the firnctional interaction of Giant with the iab-2 enhancer of the abd—A
homeotic selector gene (Shimell et al., 2000). Several lines of evidence suggest that eve,
Kr, and abd—A are direct targets of Giant: their expression is derepressed in a giant (gt)
mutant background, and these genes’ regulatory elements contain binding sites for giant
protein. In the cases of eve and abd—A, the sites have been mutated to verify that giant
repression is lost in vivo (Small et a1. 1992; Arnosti et al., 1996; Shimell et al., 2000). In
addition, ectopic expression of Giant, either via a heatshock inducible promoter or an
ectopic eve stripe 2 enhancer, represses Kr and eve expression in the blastoderm embryo
(Kraut and Levine, 1991; Capovilla et al., 1992; Wu et al., 1998). Acting within these
regulatory regions, the short-range repression activity of Giant prevents regulatory
“cross-talk”, so that Giant repression of one enhancer does not interfere with the activity
of another (Small et al. 1993; Hewitt et al., 1999). The short range of Giant activity can

be used to produce genetic switches which are finely “tuned” to respond to small

51

differences in Giant protein concentration (Hewitt et al., 1999). Such fine adjustments in
repression activity appear to have been used during the evolutionary modification of the
eve stripe 2 enhancer, where a Giant binding site has been repositioned to compensate for
increased activation activity due to acquisition of a novel Bicoid activator binding site
(Ludwig et al., 1998; Hewitt et al., 1999; Ludwig et al., 2000).

While much is known about the action of Giant in native regulatory circuits, we
do not understand the molecular details of repression by the Giant protein. In particular,
it is not known whether Giant functionally interacts with the CtBP cofactor.
Furthermore, it is not known whether the ultimate target of Giant is the transcriptional
machinery, activator proteins, or chromatin, although Giant, like other short-range
repressors, is capable of repressing from within enhancers or when situated proximal to
basal promoter elements (Small et al., 1992; Hewitt et a1. 1999, Shimell et al., 2000). To
determine whether CtBP is required for Giant’s short-range repression activity, we have
studied the activity of endogenous and chimeric repressors in wild-type and CtBP mutant
embryos, and we have identified an evolutionarily conserved minimal repression region

that is sufficient to mediate transcriptional repression in transgenic embryos.

52

Materials and Methods

Plasmids. The following oligonucleotides were used in construction of Gal4-giant
chimeric constructs:

5 ’ -GATC C GC CGATTACAAGGATGAC GATGACAAGTAGTAATTAGTTAGT-3 ’

(a), 5 ’ -CTAGACTAACTAATTACTACTTGTCATCGTCATCCTTGTAATCGGCG-3 ’
(b), 5’-GATCCCGCCGATTACAAGGATGACGATGACAAGTAGTAATTAGTTAG
T-3’ (c), 5’-CTAGACTAACTAATTACTACTTGTCATCGTCATCCTTGTAATCGG
CGG-3’ (d), 5 ’-GGCCGCCGATTACAAGGATGACGATGACAAGTAGTAATTAGTT
AGT-3’ (e), 5’-CTAGACTAACTAATTACTACTTGTCATCGTCATCCTTGTAATCG
GC-3’ (f), 5’-ATGAAGCTACTGTCTTCTATC-3’ (g), 5’-GGGGTCTAGACTAACTA
AT TACTACTTGTCATCGTCATCCTTGTAATCGGCGTAAAAAGCGGGATACAG
GGAGGC-3’ (h), 5’-GGGGTCTAGACTAACTAATTACTACTTGTCATCGTCATCC
TTGTAATCGGCTTGGGCGGCATACAGAAGATTGCT-3’ (i), 5’-GGCCGATTACA
AGGATGACGATGACAAGTAGTAATTAGTTAGT—3’ (j), 5’-CTAGACTAACTA
ATTACTACTTGTCATCGTCATCCTTGTAATCGGCCTGCA-3’ (k), 5’-CGCAGCT
GCA-3’ (l), 5’-GCTGCGGTAC-3’ (m), 5’-GGGTCGGTAACCGCAGCCCAACAGCA
GCAACATCAG-3’ (n), 5’-GGGTCGGTACCGCAGCCGCTGCCGCCTCTGCTGCG-
3’ (o), 5’-CGCCGCAGC CG-3’ (p), 5’-GATCCGGCTGCGGCGGTAC-3’ (q), 5’-
GGGGTACCGCCGCAGCGC AGCAGCAGCATACCTCCTCTGCA-3’ (r), 5’-
GGGGTCTAGACTAACTAATTACTACTTGTCATCGTCATCCTTGTAATCGGC
GTTAGCGGTTGGTGTGACCTTGGG—3’ (s), 5’-GGGGTCTAGACTAACTAATT

ACTACTTGTCATCGTCATCCTTGTAATCGGCGTAAAAAGCGGGATACAGGGA

53

GGC-3’ (t), 5’-GGGTCGGTACCGCCGCAGCGAGCGTAGAGACGCCCAGGAAGA
CT-3’ (u), 5’-GGGTCGGTACCGCCGCAG CGAATCTTCTGTATGCCGCCCAA

ATG-3’ (v), 5’-CTCTGTAGGTAGTTTGTCC-3’ (SV4O 3’UTR) (w).

To generate construct 2, construct 1 (Gal4-giant1-389, described in Hewitt et al.,
1999) was digested first with XbaI and partially with HindIII. The digested plasmid was
then ligated with oligonucleotides (a) and (b) to generate Gal4-giant (1-322). Construct 3
was made the same way, using the linearized vector containing Giant codons 1-265 and
ligating oligos (c) and (d). Construct 4 was made by digesting construct 1 with NotI and
XbaI and ligating with oligos (e) and (t). Constructs 7, 8, and 11 were made in a similar
fashion digesting construct l with PstI and XbaI and ligating oligos (j) and (k) for
construct 7, digesting construct 1 with KpnI and PstI and ligating oligos (l) and (m) for
construct 8, and digesting construct l with KpnI and BamHI and ligating oligos (p) and
(q) for construct ll. Constructs 5, 6, 9, and 10 were made by PCR amplifying the
appropriate portion of the gene, digesting with KpnI and XbaI, and ligating the fragment
into pTwiggy (Hewitt et al., 1999). Oligos (g) and (h) were used to generate construct 5,
(g) and (i) were used for construct 6, (n) and (w) were used for construct 9, (o) and (w)
were used for construct 10, (r) and (w) for construct 12, (r) and (t) for construct 14, (u)

and (w) for construct 15, and (v) and (w) for construct 16, and (r) and (s) for construct l3.

Isolation of giant homolog from Drosophila hydei. D. hydei, originally derived from a

parent stock collected in 1993 at the South Coast Agricultural Research Station,

California, was obtained from the Scott Pitnick laboratory, Syracuse University.

54

Genomic DNA was prepared from adult flies using the Promega Wizard Genomic Prep
Kit (cat. #A1120). Degenerate oligos:

DA-190 5’-AAAAGAATTCATGCAYCAYCAYCARTAYCARC-3’ and DA-l91 5’-
AAAAGAATTCNGCNGCGAARTTNGCNGCHAT-3’ were used to amplify a region of
the gene corresponding to D. melanogaster giant codons 23-274 using 35 one minute
cycles of 95°C, 50°C, and 72°C. Visible bands of approximately the correct size were
isolated, digested with EcoRI, subcloned into pBluescript SK(+) and individual clones
were sequenced. Sequence information was used to generate nondegenerate
oligonucleotides DA-44l 5’-AAAAGAATTCCAGCAGCAGCAAGCATCGCAT-3’,
DA-443 5’-AAAAGAATTCCACGAGCGGATCACGCGGAAAG-3’ and DA-444 5’-
AAAAGAATTCGGAAAGGCCTTAAACGGGCGCG-3’ corresponding to D.
melanogaster codons 32 to 267. These oligonucleotides were used in genomic
amplifications, and resulting products were directly sequenced without subcloning to

reconfirm sequences. (GenBank accession number AF 356543).

P-element transformation, whole-mount in situ hybridization of embryos, and
crosses to lacZ reporter lines. P-element mediated gennline transformation and in situ
hybridization was carried out as described, except that during the hybridization
procedure, embryos were not fixed again with formaldehyde and not treated with
proteinase K (Small et al., 1992). Probes for eve and Kr staining were prepared by
subcloning a 2.6 kbp EcoRI/Xbal eve fragment or 1.9 kbp EcoRl/Xbal Kr fragment fiom
bacterial expression vector pAR3040 (S. Small) into pBluescript H KS(+) and performing

in vitro transcription reactions of template linearized with XbaI with T3 RNA polymerase

55

in the presence of digoxigenin UTP as described (Small et al., 1992). Quantitative assays
of percent repression by Gal4-giant fusions were performed as previously described,
using eve stripe 2 lacZ and eve stripe 2/eve stripe 3 lacZ transgenes as reporters (Keller et
al., 2000). Levels of repression never exceed 50% because of heterozygosity of the Gal4-

giant lines.

Analysis of gene expression in embryos lacking maternal CtBP. CtBP gennline
clones were produced using the autosomal FLP-DF S technique (Chou and Perrimon,
1996). Single reporter transgenes were assayed in the mutant embryo background by
crossing males carrying the transgene to females producing CtBP embryos. To test the
activity of Gal4-giant in a CtBP mutant background, the eve stripe 2 lacZ reporter gene

was crossed into the CtBP mutant stock as described previously (Keller et al., 2000).

56

Results

Giant repression is compromised in a CtBP mutant background.

To determine if repression activity by the Giant protein was affected in a CtBP mutant
background, we studied the expression pattern of eve and synthetic lacZ reporter genes
that are direct targets of Giant, using in situ hybridization. Giant protein helps to set the
anterior border of eve stripe 2, and binding sites for the Giant protein have been identified
in the stripe 2 enhancer (Stanojevic et al., 1991; Small et al., 1992). Loss of gt activity or
disruption of Giant binding sites within the stripe 2 enhancer causes anterior expansion of
expression of an eve stripe 2 lacZ reporter gene (Small et al., 1992; Arnosti et al., 1996).
The expression pattern of endogenous eve shows complex changes in a CtBP mutant
(Poortinga et al., 1998; Nibu et al., 1998b; Fig. 2-38), including a possible anterior
expansion of stripe 2, but the presence of multiple enhancers in the endogenous gene
makes it difficult to determine specifically how the stripe 2 enhancer activity is affected.
We therefore examined the expression pattern of an eve stripe 2 lacZ reporter gene and
found, in contrast to an earlier report (Nibu et al., 1998b) that in most embryos there is a
significant anterior expansion of the eve stripe 2 expression pattern in the CtBP mutant
background, as well as the posterior expansion previously noted. The expression pattern
changes from the wild-type pattern of 56-62% egg length (SD. 1.5%, n=25) to 52-67%
egg length (SD. 3%, n=34) in the mutant (Fig. 2-3C-F). Posterior expansion results from
loss of Kriippel activity (N ibu et al., 1998b), while anterior expansion mimics that seen in
a gt mutant (Stanojevic et al., 1991; Small et al., 1992; Wu et al., 1998). This result is

consistent with CtBP participating in establishment of the anterior border of expression

57

 

Figure 2-3: Derepression of eve stripe 2 expression in a CtBP mutant background.

The expression of the endogenous eve gene (A, B) or an eve stripe 2 lacZ reporter gene
(C-F) was assayed in wild-type (A,C,E) or CtBP mutant embryos lacking maternal CtBP
(B, D, F) by in situ hybridization. Anterior border expansion, consistent with loss of
Giant activity, and posterior border expansion, resulting from loss of Krilppel repression,
can be seen in D and F. The average position of the pattern generated by the eve stripe 2
lacZ transgene in wild-type embryos was 56 to 62% egg length (n=25, standard deviation
for each border 1.5%), while the average position of the pattern in CtBP mutant embryos
was 52 to 67% egg length (n=34, standard deviation for each border 3%). Embryos are
shown anterior to the lefi, dorsal side up. (C, D) parasaggital views (to compare age of
embryos); (E, F) surface views. CtBP embryos are typically shorter than wild-type
embryos.

lacZ mRNA and endogenous eve mRNA were visualized by in situ hybridization.

58

of eve stripe 2, but does not prove that CtBP works through the Giant protein. CtBP may
interact with a putative heterodimeric partner of Giant, or it may interact with other
repressors that have been proposed to also play a role in setting the anterior border of eve
stripe 2 (Vasisht, V., Theodosopoulou, K., Small S., Abstract 452A; 40th Annual
Drosophila Research Conference, Seattle, WA, 19994). Therefore, to study Giant activity
in the absence of other putative repressor sites, we employed a lacZ reporter gene that we
showed previously is directly regulated by Giant, containing two high-affinity Giant
binding sites 5’ of the P element basal promoter (Hewitt et al., 1999). Expression is
driven in lateral regions by an upstream rhomboid enhancer, and in ventral regions by the
twist enhancer (Fig. 2-4A, C). The strong anterior and posterior repression of the lacZ
transgene is almost completely abolished in the CtBP mutant background (Fig. 2-4B, D),
leaving weakly attenuated expression in narrow anterior and posterior regions. This
pattern is reminiscent of those obtained from lacZ reporter derivatives that have the Giant
binding sites moved to distal positions at —1 10 bp or -160 bp, at the limit of giant’s range
of activity (Hewitt et al., 1999). The gt gene is still expressed in the CtBP mutant,
indicating that the loss of repression is not simply due to loss of gt expression, although
the area of posterior expression is expanded, as has been previously noted (Nibu et al.,

1998b; Fig. 2-4E, F).

 

‘ Now published as: Andrioli L.P.M., Vasisht V., Theodosopoulou E., Obersteiu A., and Small S.
(2002). Anterior repression of a Drosophila stripe enhancer requires three position-specific mechanisms.
Development 129: 49314940.

59

wild-type dCtBP -

 

 

 

Figure 2-4: Loss of Giant repression activity in a CtBP mutant background.

Wild-type (A, C) and CtBP mutant (B, D) embryos carrying a lacZ reporter gene with
tandem Giant binding sites at —55 bp were assayed by in situ hybridization. Ventral and
ventrolateral expression is driven by rhomboid and twist enhancer elements, which in the
absence of Giant binding sites allow expression of the lacZ transgene from anterior to
posterior (Hewitt et al., 1999). The strong anterior and posterior repression mediated by
Giant (A, C) is greatly attenuated in the CtBP mutant embryos (B, D). Expression of gt
in wild-type (E) and CtBP mutant (F) embryos indicates that CtBP mutant embryos
express gt in an almost wild-type pattern. Embryos are shown anterior to the left, dorsal
side up (A, B, E, F) or ventral side toward viewer (C, D).

60

Selective requirement for CtBP in regulation of Kr

The loss of repression in the CtBP background exhibited by the two different lacZ
reporter genes strongly suggests that Giant repression can depend on CtBP. Therefore we
carefully examined the patterns of Kr and hb, two endogenous targets of giant. The
anterior border of Kr is highly sensitive to changes in levels of Giant protein (Wu et al.,
1998), and two high-affinity binding sites for the Giant protein have been identified
within the upstream regulatory region that controls expression of Kr in the central domain
(CD) of the embryo (Capovilla et al., 1992). Previous studies indicated that the central
domain of Kr expression is not grossly disrupted in a CtBP mutant (Nibu et al., 1998b;
Poortinga et al., 1998), but as early blastoderm embryos were shown in these studies, it is
unclear whether the later anterior shifts in Kr expression caused by loss of gt would have
been noted. We compared the pattern of Kr expression in wild-type, CtBP, and gt
embryos, and did not detect noticeable anterior expansion of the CD in the CtBP mutant.
However, a striking difference was noted in the Kr anterior domain (AD), which is wider
and persists later in development in CtBP embryos than in wild-type embryos (Fig. 2-5).
gt embryos show a similar pattern of altered expression in the AD (Fig. 2-5 G, H, I). The
AD stripe is expressed in ventral regions in the CtBP mutant, while in the wild-type and
gt embryos, this stripe does not extend into ventral regions. This loss of ventral
repression in a CtBP mutant is probably due to a loss of knirps activity, for knirps is
expressed in ventral anterior regions, and Knirps protein has been shown to bind to the Kr
promoter (Hoch et al., 1992). giant is also required for repression of hb expression in the
region of the embryo anterior to the parasegrnent 4 stripe, and low levels of ectopic Giant

protein are sufficient to repress hb in this area, suggesting that the element is highly

61

 

Wm" ,'-t::.. «:9, ”rm/I. _/
9M8 crap
B E *""- H
.' It; I..."
9M8 .‘ CtBP
c -- F _ i ._ I .. .. _
A '1 ”a: ‘
._. ‘
9M8 crap

Figure 2-5: Anterior domain (AD) of Kr expression is regulated by CtBP and Giant,
while central domain (CD) is regulated by Giant but not CtBP.

Kr expression in staged embryos (youngest at top) was examined by in situ hybridization.
Blastoderm expression is comprised of a small AD stripe, a prominent CD domain, and a
posterior domain of expression. (A-C) Wild-type embryos, (D-F) gtA8 mutant embryos,
and (G-I) CtBP embryos. The expression of the AD is expanded in both gt and CtBP
mutant embryos, while the CD is expanded only in gt mutant embryos. Abnormal ventral
expression of AD in CtBP mutant embryos may represent loss of Knirps activity.
Embryos are oriented anterior to the left, dorsal side up.

62

sensitive to Giant (Wu et al., 1998). We did not find any differences in the hb expression
pattern between wild-type and CtBP mutant embryos (data not shown). These results
indicate that CtBP is not required for Giant mediated repression of some endogenous
genes and enhancers, consistent with earlier suggestions that Giant may function by more

than one mechanism (Wu et al., 1998).

Gal4-giant repression domain can function in a CtBP mutant embryo

It is not known whether Giant normally acts as a homodimer or a heterodimer,
thus assays of endogenous Giant activity might reflect the contribution of a basic zipper
partner protein rather than the Giant protein itself (V avra et al., 1989). The non-DNA
binding region of the Giant protein is clearly a bona fide repressor; when tethered to the
Gal4 DNA binding domain this protein can mediate repression in the embryo, indicating
that another basic-zipper partner protein is not required for activity (Hewitt et al., 1999).
We tested whether the Gal4-giant fiision protein used in these assays was capable of
repressing in a CtBP background. Females producing embryos that lacked maternal
CtBP protein and containing the eve stripe 2 lacZ reporter gene were crossed to males
carrying the Gal4-giant repressor gene (Figure 2-6). A high percentage of embryos
showed repression in ventral regions, where the Gal4-giant firsion protein is expressed
under control of the twist promoter. These results indicate that the Giant protein itself
contains an activity that is capable of repressing under conditions where the CtBP protein

is severely reduced or absent.

63

 

 

 

7‘
. I
live stripe 2] [Incl
2x UAS
C. ,. . D.

‘ .
«‘L-s.
I ‘ V
- —‘\.'_
I. . I, 7
f,
. JV,”

Fave stripe? 5 3 [Ta—c7

2XUAS

a}

 

Figure 2-6: Gal4—giant protein is an active repressor in a CtBP mutant background.

Expression of an eve stripe 2 lacZ reporter gene is shown in wild-type (A, B) and a CtBP
mutant background (C, D). Embryos shown in C, D contains Gal4-giant chimeric protein
expressed in ventral regions under control of the twist promoter. Embryos are oriented
anterior to the left, dorsal side up. Parasagittal views (A, C) shown to compare stage of
embryos, and surface views (B, D) to illustrate ventral interruption of stripe. In CtBP
embryos expressing Gal4-giant, 32 of 81 (40%) embryos scored showed loss of ventral
activation, compared with 4 of 132 (3%) in CtBP embryos without Gal4-giant. (In wild-
type embryos, less than 0.5% of embryos show abnormal stripes).

64

Identification of a minimal repression domain in Giant

Repression by Giant can be mediated by the N-terminal 389 residues of the protein,
independent of its native basic-zipper DNA-binding domain (Hewitt et al., 1999). We
tested which residues are sufficient to mediate repression in transgenic embryo assays by
preparing and testing transgenic lines expressing chimeric Gal4-giant proteins in ventral
regions of the embryo (Fig. 2-7). These repressors were assayed on eve stripe 2 lacZ and
eve stripe 2+3 lacZ reporter genes and the fraction of embryos showing repression was
quantitated (Table 2-1). Fusion proteins containing most of the Giant protein showed
robust repression, comparable to levels achieved with Knirps firsion proteins (Keller et
al., 2000). C-tenninal truncations to residue 205 retained significant, although somewhat
reduced levels of repression activity, as did N—tenninal deletions to residue 96. A
minimal Gal4-giant (89-205) chimeric protein was also active for repression in these
assays (Fig. 2-7 and Table 2-1). However, a further N-terrninal deletion of this minimal
repressor, removing residues 89-106, produced an inactive construct. Within this short
deletion is a sequence (residues 98-104, V-DLS-R) that is similar to a high affinity CtBP
binding motif (P-DLS-K/R) (Nibu et al., 1998b, Poortinga et al., 1998), therefore it is
possible that the N-terminal deletion removes a CtBP interacting site. The first residue of
the canonical CtBP-binding motif, a proline, is required for high affinity in vitro binding
(Molloy et al., 1998), consistent with the lack of measurable direct in vitro interaction
between Giant and GST-CtBP (data not shown, see Discussion). Constructs truncated
after residue 169 (number 5 and 14) had detectable, but significantly reduced activity,
while the activity of lines containing a construct truncated after residue 143 (number 6)

was close to background levels (Table 2-1). Some lines expressing a Gal4- giant fusion

65

Figure 2-7: Structure and activity of Gal4-giant chimeras assayed in transgenic
embryos.

(A) Genes encoding Gal4 fusions including Giant residues indicated in constructs 1-16
were introduced into Drosophila by P-element mediated germline transformation.
Repression activity of the chimeric proteins was assayed by crossing Gal4-giant lines to
reporter lines containing eve stripe 2 lacZ and eve stripe 2 + stripe 3 lacZ reporter genes.
Activities are shown as “+” (> 9% repressed), “+/-” (1 .5-4% repressed), and “-” (less than
1% repressed). (B) Representative embryos showing pattern of the unrepressed reporter
gene, and embryos from Gal4-giant (1-389), Gal4-giant (1-322), and Gal4-giant (89-205)
crosses, showing ventral interruption of stripe 2 pattern. In comparing embryos showing
ventral repression, no significant differences in extent of repression of stripe patterns
were noted.

66

 

 

 

 

 

 

 

 

 

 

 

0959999!"

. 144-389
1 0. 189-389
1 1 . 321-389
12. 89-205
1 3. 89-192
14. 89-169
1 5. 107-205
1 6. 1 38-204

rs. I

eve 2+3-lacZ

 

 

 

 

 

 

 

I?

 

1 -389

 

o
‘ o. . i
brass-«b
r . ,
.. ,3

1.322 '

Figure 2-7: Structure and activity of Gal4-giant chimeras assayed in transgenic embryos.

67

 

{cm can gm am; one? “.88“ mos: ooh: 05 Co 83333

a «Q
.2 Ba : 5

325280 How case.“ 803 scammed”: wgofi 83980 02 .368 203 woe: cis—2.: 96:3 maozbmcoo co.“ 83328
8o? Ecuam>oe 335% wee 56852 .x. owwco>< dcfimoaoc com 338 ob? 8:: 35365 Bob aches—on

 

m m? o 3N6»: 3
m N? ed Hod moNNS 2
fl NoN m 9.7% E
v 32 ~Hm4 37mm 2
n :3 m H a mON-aw Nfi
m cmm o mwmANm 2
fl wmm H awmmfl S
m no: em I a $311 a
m 2% _ H 2 awmém w

v Ev o aw; n
m 32 N H N NE; c
m 83 NHm.m of; m

m m2 _ H m 3N; v
N u: _ H M: moNA m

m mum m H om NNm; N

v won a H N awn; fl

BSA—«SN won: @808 8.0580 eeommoeaom £805 Him 598::
Co c3852 me 698: Z X Soc Esteem 83.3ch

 

690580 Egan—5.: E «53?:— aemmoaoa «Same—«O 3.8.an .«e 5333‘ "TN ~33.

68

including residues 144-389 showed activity, suggesting that the putative CtBP binding
motif is apparently not strictly required for repression activity. The transgenes were not
expressed at high enough levels for us to quantitate expression by antibody staining (data
not shown). Therefore, it is possible that the inactive constructs are simply not well

expressed or are unstable.

giant homolog from Drosophila hydei contains regions of conserved residues

To identify regions of the Giant protein that have been evolutionarily conserved,
and hence of possible functional importance, we sought the homologous gene from a
related Drosophila species, Drosophila hydei, which is thought to have shared a last
common ancestor with D. melanogaster approximately 60-80 million years ago
(Beverley and Wilson, 1984). No close homolog to giant has yet been reported, aside
from genes that encode similar basic-leucine zipper dimerization/DNA-binding domains.
Therefore we designed degenerate oligonucleotides corresponding to several regions of
the repression domain and carried out PCR reactions under conditions of low stringency.
Southern blotting was used to analyze PCR products, and primer pairs that yielded
products of similar size to the D. melanogaster clone were used in further rounds of PCR.
A degenerate primer pair that amplified a region corresponding to codons 30 to 268 of D.
melanogaster was found to give optimal results, and several clones of the corresponding
PCR products were sequenced. A 774 bp fi'agment encompassing 258 codons was

recovered, including the entire minimal repression domain (Figure 2-8). This portion of

69

Figure 2-8: Peptide sequence of giant homolog isolated from D. hydei aligned with D.
melanogaster sequence.

Minimal repression domain spanning residues 89-205 in D. melanogaster shown in box,
conserved putative CtBP binding motif underlined. Vertical arrows indicate N- and C-
terminal deletions in minimal repression region that abolish repression activity. A D.
hydei sequence corresponding to D. melanogaster residues 30 — 268 was isolated fi'om
genomic DNA by degenerate PCR. Sequences were obtained from multiple isolates of
independently generated PCR products.

70

cocoa—com LuceeMeeuEE .Q .53 REE—a .833 .Q Beau 13:—cum ”22:2— 2.5“ no 35:—com 25.—om "wuN 95w?“

>AmQMQm¢KWQMHZMmOQ>OU¢Hmamdhhmmhmfifim .£.Q

>Am0mmmdxmmmfizmwdm ........ Ummmhfimfifid H¢N .E.Q

     

 

memZmmmcmcmqommmmeaammmomamq>cHozem¢2m<mmmmmm>¢mam> m .n.c
____ ________________ .._ _________

m>< .................. amomzmq>cHozema2m<mmamz...emm m Hom .E.Q

anameoqqm<em2mmmM¢>¢¢¢2mmoxHzccwwqaqumaqoooooooooooa...><ao .c.c

fiddeOAAZ¢BmB>Mmm¢¢8m8¢0moxHZm.wwmdqudeOOOOOOOOOOOomOOOOZO N¢H .E.Q

fimVQAmeHdhmm¢¢mm0mUVmWZBOMmmmBmmmBm>mmumMmQQQ>mB¢¢¢HBO0.0om .£.Q

¢<NAAZW...BmmdmmmUmONmNmHOMmmmBmmmBm>mmummmAQQ>m<mmBmOOquom mm .E.Q
...00000000mA¢<d¢¢<mUQQOOOM¢W¢dNAQZMm4 ........... HQEmeOOOOO .£.Q

____________ __________ _______ __ ___

OOOOOOOOOOOmAdd ..... UddOOONdMflHMAQZXQAUQmOO>qummmqmmAm000mm om.E.Q

 

 

 

 

71

the gene had 66% identity (70% similarity) at the amino acid level and 65% identity at
the nucleic acid level. The minimal repression domain was overall somewhat more

conserved, including three large blocks of identical residues, with overall 73% identity
(78% similarity) at the amino acid level (Fig. 2-8). These levels of identity with D.
melanogaster genes are similar to those of the D. hydeifushi tarazu (68%) and Hairless
genes (69%) (Jost et al., 1995; Marun et al., 1999). The putative CtBP binding motif
spanning residues 98-104 is absolutely conserved, as are other blocks of residues

throughout the predicted protein sequence.

Discussion

Giant represses through CtBP-dependent and —independent mechanisms

Previous work suggested that Giant, in contrast to other short-range repressors,
does not require CtBP activity to mediate repression, based on the expression pattern of
an eve stripe 2 lacZ transgene (Nibu et al., 1998). Our studies of the same enhancer
element in a CtBP mutant background indicates that although there is a range of
phenotypes, with a small percentage of embryos showing a sharp anterior border, the
border of the stripe is clearly expanded in most embryos, consistent with loss of giant
function (Fig. 2-3). Additional evidence for CtBP dependence comes from analysis of a
reporter gene that is directly repressed through tandem Giant binding sites at —55 bp.
This gene shows strong, but not complete, derepression in a CtBP mutant background

indicating that CtBP is required for full activity of Giant on this gene (Fig. 2-4).

72

Repression by Giant of the eve stripe 5 enhancer is also reportedly compromised in a
CtBP mutant background (M. Levine and Y. Nibu, personal communication). Clear
evidence for Giant- and CtBP-dependent repression of an endogenous target gene comes
from expression in the anterior domain (AD) of the Kn’ippel gene, where marked
derepression is observed in both giant and CtBP mutant backgrounds (Fig. 2-5).
Although the roles of individual Giant binding sites in the Kr promoter are less well
characterized than with eve stripe 2 and the synthetic lacZ reporters shown in Figs. 2-3
and 2-4, Giant and CtBP most likely work through common DNA elements on the Kr
promoter because Giant protein is present in the region of AD expression and there are
identified high-affinity binding sites for Giant within the AD enhancer region (Capovilla
et al., 1992).

Our results clearly indicate that Giant repression can be CtBP dependent, but
Giant also appears to act through CtBP-independent pathways. A direct indication of
such activity is that the Gal4-giant repressor is still active in a CtBP mutant background
(Fig. 2-6). In addition, Giant repression of the Kr CD enhancer elements is unaffected by
loss .of CtBP activity (Fig. 2-5). Another endogenous target of the Giant repressor, hb, is
not derepressed in a CtBP mutant, suggesting that CtBP dependence of Giant activity can
vary on a gene-to-gene as well as enhancer-to-enhancer basis. Ironically, while this study
consolidates the view that a characteristic property of short-range repressors is functional
interaction with CtBP, our results also indicate that providing a binding platform for
CtBP is not the only activity of short-range repressors. A growing body of evidence
demonstrates that many, or perhaps all, short-range repressor proteins also exhibit CtBP-

independent activity: Knirps can repress the eve stripe 3 enhancer in a CtBP mutant

73

background (Keller et al., 2000), Kriippel can repress the hairy stripe 7 enhancer in the
absence of CtBP (La Rosée-Borggreve et al., 1999), and this study indicates that Giant
likewise possesses CtBP-independent repression activity.

The CtBP-independent activity of short-range repressors is still poorly
characterized, although this activity must by definition be limited to a short-range of
action. The CtBP-independent activity may be mediated in part through direct
competition with transcriptional activators. The tight linkage of activators and repressors
on the eve stripe 2 enhancer has been suggested to be an example of this competitive
situation, and experimentally, competition between the Bicoid activator and the Knirps
repressor has been demonstrated on the Kr promoter (Hoch et al., 1992). Competitive
binding between repressors and activators cannot explain all CtBP-independent
repression, however; the N—terminus of Knirps contains a CtBP-independent repression

activity that can inhibit activators binding to non-overlapping sites (Keller et al., 2000).

Identification of an evolutionarily conserved minimal repression domain

The deletional analysis of Gal4-giant chimeras indicates that Giant repression
function can be localized to residues 89-205, an area of the protein that contains several
tracts of highly conserved residues (construct 12; Fig. 2-7, Table 2-1). Chimeras
containing other portions of the Giant protein (constructs 7, 10, 11) did not exhibit
significant repression activity, suggesting that these regions cannot act autonomously to
mediate repression, and might instead contribute to protein stability or expression. In
particular, residues 266-322, present in constructs l and 2, appear to correlate with

significantly higher repression activity of these proteins. The low levels of chimeric

74

protein expression in the embryo precluded direct quantitation of each protein, thus our
analysis is based primarily on those that did show significant activity.

We have not detected a significant physical interaction between Giant and CtBP
in vitro (A. Kumar, unpublished results), and the Giant protein lacks a perfect match to
the consensus CtBP binding motif P-DLS-K/R/H found in the Knirps, Kriippel and Snail
proteins. However, a partial match is present: VLDLSRR (residues 98-104). The motif
is evolutionarily conserved and is found within the minimal repression domain we have
defined (Figs. 2-7 and 2-8), consistent with a possible role in repression. Indeed, deletion
of residues 89-107 inactivates the chimeric repressor (Fig. 2-7 and Table 2-1). This
region is clearly not sufficient for high-level repression, however, (demonstrated by the
weak activity of constructs 5, 6, 13 and 14), suggesting that other portions of the protein
play important structural or functional roles.

If CtBP directly contacts Giant in vivo, the lack of strong interaction in vitro may
indicate that Giant must be posttranscriptionally modified to facilitate interaction with
CtBP, perhaps via phosphorylation (Capovilla et al., 1992). Posttranslational
modifications are known to play a role in CtBP binding in some instances; ElA-CtBP
interactions have been shown to be regulated by acetylation of a conserved lysine residue
in the CtBP binding motif (Zhang et al., 2000). Alternatively, Giant may bind CtBP
indirectly through a cofactor, much as BRCAl has been suggested to bind CtBP through
Cth (Li et al., 1999), or CtBP might be recruited via a heterodimeric basic-zipper partner
of Giant. To determine whether CtBP-dependent and CtBP-independent repression

activities are mediated by the same or distinct portions of the Giant protein, future studies

75

will need to focus on identifying mutant proteins that are deficient in each of these

activities.

What characteristics of a regulatory region dictate CtBP-dependent or CtBP-
independent repression?

In considering which features of a gene determine CtBP-dependence or —
independence, the structure of the basal promoter cannot be the deciding factor, for the
same Kr promoter is regulated by distinct elements, some that exhibit CtBP-dependence
and some that show CtBP—independence. Similarly, the eve gene is repressed by Knirps
via CtBP-dependent and CtBP—independent regulatory elements (Keller et al., 2000).
While the eve enhancers in question are kilobases apart, the Kr regulatory elements
driving AD and CD expression are closely intertwined, and appear to share at least some
of the same activator binding sites, suggesting that subtle differences in enhancer
architecture or differences in levels of regulatory proteins interacting with those elements
may dictate CtBP dependence (Hoch et al., 1990; Hoch et al., 1991; Jacob et al., 1991).
The Giant binding site in the Kr CD2 enhancer site was shown to be of higher affinity
than the th site in the eve stripe 2 enhancer (Capovilla et al., 1992). Thus, there may be
a correlation between Giant binding site affinity and the requirement for CtBP, with
elements containing Giant sites of lower affinity showing CtBP-dependence. We derived
a consensus for the Giant protein by aligning binding sites for Giant from eve, Kr, and the
recently identified abdA iab-Z enhancer site (Fig. 2-9; Shimell et al., 2000). The
consensus features an extended half-site inverted repeat TNTTAC, consistent with the

dimeric nature of basic zipper proteins, and a central ACGT core common to recognition

76

eve gt 1 AAACACATAATA
eve gt 1 TAGAAAGTCATA
eve gt 2 AGTTTGGTAACA
eve gt 3 TATTAGTCAATT
Kr CD1 TCTTGCGTCATA
Kr CD2 TTTTACGTAACA
abdA iab-Z TATTACGTAAAA
gtcg

consensus TnTTACGTAAnA

Figure 2-9: Alignment of Giant binding sites and consensus.

Footprinted sites from the eve stripe 2 enhancer (Stanojevic et al., 1991), the Kr CD1 and
CD2 enhancers (Capovilla et al., 1992), and the abdA tab-2 enhancer (Shimell et al.,
2000) were aligned with a sequence derived from the center of the small footprinted
regions (13-16 nt) found in the Kr and abd-A genes. Residues that match the consensus
are indicated in bold. The central ACGT cluster is identical to that found in motifs
recognized by other basic zipper DNA binding proteins (Dlakic et al., 2001). The
sequence from the eve Gt3 site is located in the center of a 26 nt footprinted region, and
the two sequences from the th site are adjacent to one another within the 22 nt
footprinted region. The sequence from the Gt2 site is in the 3’ region of the large 44 nt
footprinted site (Stanojevic et al., 1991). The lower case letters below the iab-Z sequence
indicate a mutation that abolishes Giant regulation of the iab-Z enhancer (Shimell et al.,
2000).

77

motifs for many basic zipper proteins (Capovilla et al., 1992; Dlakic et al., 2001). The
higher affinity sequences from the CtBP-independent Kr CD element are closer to the
consensus than those of the CtBP-dependent eve stripe 2 enhancer. Weaker sites may
only be partially occupied, resulting in an overall lower level of Giant mediated
repression. A loss of CtBP might further depress repression activity below a critical
threshold, leading to the derepression we observe in Figures 2-3 and 2-5. Repression of
the lacZ reporter containing the Giant CD1 site from Kr was CtBP dependent, a result
that contrasts with the CtBP independence of the CD itself (Fig. 2—4), but this particular
site may not be optimal, as it contains two mismatches (Fig. 2-9). Full Giant activity may
also be mediated on the native CD element through the additional high-affinity CD2 site.
Other factors besides binding site affinity can affect Giant’s activity, and possibly
its CtBP-dependence. We have previously demonstrated that small alterations in the
location of Giant binding sites are sufficient to strongly affect the ability of Giant to
repress in transgenic embryo assays (Hewitt et al., 1999). Thus, we need to consider
location and affinity of Giant sites in studying CtBP-dependent repression. We do not
believe that differences in the nature of the activators explain CtBP-dependence or -
independence, because both AD and CD enhancers of Kr are activated by Bicoid protein
(Jacob et al., 1991; Hoch et al., 1991), as is the eve stripe 2 enhancer. Detailed studies
illuminating how the general properties of short-range transcriptional repressors are
integrated into the design of promoter elements will promote our understanding of the

control of complex developmentally regulated genes.

78

Note added in proof Material cited as Nibu and Levine, personal communication,
has now appeared as Nibu Y., and Levine MS. (2001). CtBP-dependent activities of the
short-range giant repressor in the Drosophila embryo. Proc. Natl. Acad. Sci. USA 98:

6204-6208.

Acknowledgments

We acknowledge Anu Kumar and Robin A. Wagner for assistance in early parts
of this project, Francisco Herrera for analysis of Gal4-giant constructs, Eduardo
Fernandez—Villatoro for technical assistance, Scott Pitnick for Drosophila hydei, and
Alex Raikhel and Lee Kroos for comments on the manuscript. This work was supported
by a grant from the Michigan State University REF Center for Protein Structure, Function

and Design and grant GM56976 from the National Institutes of Health to D.N.A.

79

References

Arnone M. 1., and Davidson E. H. (1997). The hardwiring of development: organization
and function of genomic regulatory systems. Development 124: 1851-1864.

Arnosti D. N., Barolo S., Levine M., and Small S. (1996). The eve stripe 2 enhancer
employs multiple modes of transcriptional synergy. Development 122: 205-214.

Beverley S. M., and Wilson A. C. (1984). Molecular evolution in Drosophila and the
higher Diptera II. A time scale for fly evolution. J. Mol. Evol. 21: 1-13.

Cai H. N., Arnosti D. N., and Levine M. (1996). Long-range repression in the
Drosophila embryo. Proc. Natl. Acad. Sci. USA 93: 9309-9314.

Capovilla M., Eldon E. D., and Pirrotta V. (1992). The giant gene of Drosophila
encodes a b-ZIP DNA-binding protein that regulates the expression of other gap genes.
Development 1 14: 99-1 12.

Chen G., and Courey A. J. (2000). Groucho/TLE family proteins and transcriptional
repression. Gene 249: 1-16.

Chou T. B., and Perrimon N. (1996). The autosomal FLP-DF S technique for generating
germline mosaics in Drosophila melanogaster. Genetics 144: 1673-1679.

Dlakic M., Grinberg A. V., Leonard D. A., and Kerppola T. K. (2001). DNA
sequence-dependent folding determines the divergence in binding specificities between
Maf and other bZIP proteins. EMBO J. 20: 828-840.

Ghazi A., and VijayRaghavan K. (2000). Control by combinatorial codes. Nature 408:
419-420.

Gray S., Syzmanski P., and Levine M. (1994). Short-range repression permits multiple
enhancers to firnction autonomously within a complex promoter. Genes & Dev. 8: 1829-
1838.

Hewitt G. F., Strunk B. S., Margulies C., Priputin T., Wang X.-D., Amey R., Pabst
B. A., Kosman D., Reinitz J., and Arnosti D. N. (1999). Transcriptional repression by
the Drosophila Giant protein: cis element positioning provides an alternative means of
interpreting an effector gradient. Development 126: 1201-1210.

Hoch M., Schrfider C., Seifert E., and Jackle H. (1990). Cis-acting control elements
for Krfippel expression in the Drosophila embryo. EMBO J. 9: 2587-2595.

Hoch M., Seifert E., and Jackle H. (1991). Gene expression mediated by cis-acting
sequences of the Kriippel gene in response to the Drosophila morphogens bicoid and
hunchback. EMBO J. 10: 2267-2278.

80

Hoch M., Gerwin N., Taubert H., and Jilckle H. (1992). Competition for overlapping
sites in the regulatory region of the Drosophila gene Krz’ippel. Science 256: 94-97.

Jacob Y., Sather S., Martin J. R., and 0110 R. (1991). Analysis of Kriippel control
elements reveals that localized expression results fiom the interaction of multiple
subelements. Proc. Natl. Acad. Sci. USA 88: 5912-5916.

Jimenez G., Paroush Z., and lsh-Horowicz D. (1997). Groucho acts as a corepressor
for a subset of negative regulators, including Hairy and Engrailed. Genes & Dev. 11:
3072-3082.

Jost W., Yu Y., Pick L., Preiss A., and Maier D. ( 1995). Structure and regulation of the
fushi tarazu gene from Drosophila hydei. Roux’s Arch. Dev. Biol. 205: 160-170.

La Rosée-Borggreve A., Hider T., Wainwright D., Sauer, F., and Jackle H. (1999).
hairy stripe 7 element mediates activation and repression in response to different domains
and levels of Kriippel in the Drosophila embryo. Mech. Dev. 89: 133-140.

Keller 8. A., Mao Y., Struffi P., Margulies C., Yurk C. E., Anderson A. R., Amey R.,
Moore S., Ebels J. M., Foley K., Corado M., and Arnosti D. N. (2000). dCtBP-
dependent and —independent repression activities of the Drosophila knirps protein. Mol.
Cell. Biol. 20: 7247-7258.

Kraut R., and Levine M. ( 1991). Mutually repressive interactions between the gap
genes giant and Krz'ippel define middle body regions of the Drosophila embryo.
Development 111: 611-621.

Li S., Chen P.-L., Subramanian T., Chinnadurai G., Tomlinson G., Osborne C. K.,
Sharp Z. D., and Lee W.-H. (1999). Binding of €th to the BRCT repeats of BRCA1
involved in the transcription regulation of p21 is disrupted upon DNA damage. J. Biol.
Chem. 274: 11334-11338.

Ludwig M. Z., Patel N. H., and Kreitman M. (1998). Functional analysis of eve stripe
2 enhancer evolution in Drosophila: rules governing conservation and change.
Development 125: 949-958.

Ludwig M. Z., Bergman C., Patel N. H., and Kreitman M. (2000). Evidence for
stabilizing selection in a eukaryotic enhancer element. Nature 403: 564-567.

Marquart J., Alexief-Damianof C., Preiss A., and Maier D. (1999). Rapid divergence
in the course of Drosophila evolution reveals structural important domains of the Notch
antagonist Hairless. Dev. Genes Evol. 209: 155-164.

Molloy D. P., Milner A. E., Yakub I. K., Chinnadurai G., Gallimore P. H., and
Grand R. J. A. (1998). Structural determinants present in the C-terrninal binding protein
binding site of adenovirus early region 1A proteins. J. Biol. Chem. 273: 20867-20876.

81

Nibu Y., Zhang H., and Levine M. (1998a). Interaction of short-range repressors with
Drosophila CtBP in the embryo. Science 280: 101-104.

Nibu Y., Zhang H., Bajor E., Barolo S., Small S., and Levine M. (1998b). dCtBP
mediates transcriptional repression by Knirps, Krfippel and Snail in the Drosophila
embryo. EMBO J. 17: 7009-7020.

Perrimon N., Lanjuin A., Arnold C., and N011 E. 1996. Zygotic lethal mutations with
maternal effect phenotypes in Drosophila melanogaster. H. Loci on the second and third
chromosomes identified by P-element-induced mutations. Genetics 144: 1681-1692.

Poortinga G., Watanabe M., and Parkhurst S. M. (1998). Drosophila CtBP: a Hairy-
interacting protein required for embryonic segmentation and Hairy-mediated
transcriptional repression. EMBO J. 17: 2067-2078.

Shimell M. J., Peterson A. J., Burr J., Simon J. A., and O’Connor M. B. (2000).
Functional analysis of repressor binding sites in the iab-2 regulatory region of the
abdominal-A homeotic gene. Dev. Biol. 218: 38-52.

Small S., Blair A., and Levine M. (1992). Regulation of the even-skipped stripe 2 in the
Drosophila embryo. EMBO J. 11: 4047-4057.

Small S., Arnosti D. N., and Levine M. (1993). Spacing ensures autonomous expression
of different stripe enhancers in the even-skipped promoter. Development 119: 767-772.

Small S., Blair A., and Levine M. (1992). Regulation of even-skipped stripe 2 in the
Drosophila embryo. EMBO J. 11:4047-4057.

Stanojevic D., Small 8., and Levine M. (1991). Regulation of a segmentation stripe by
overlapping activators and repressors in the embryo. Science 254: 1385-1387.

Vavra S. H., and Carroll S. B. (1989). The zygotic control of Drosophila pair-rule gene
expression. 1. A search for new pair-rule regulatory loci. Development 107: 663-672.

Wu X., Vakani R., and Small S. (1998). The gap protein giant uses distinct mechanisms
for differential positioning of gene expression borders in the Drosophila embryo.
Development 125: 3765-3774.

Zhang H., and Levine M. (1999). Groucho and dCtBP mediate separate pathways of

transcriptional repression in the Drosophila embryo. Proc. Natl. Acad. Sci. USA 96: 535-
540.

Zhang Q., Yao H., Vo N., and Goodman R. H. (2000). Acetylation of adenovirus ElA

regulates binding of the transcriptional corepressor CtBP. Proc Natl. Acad. Sci. USA 97:
14323-14328.

82

Chapter 3

Quantitative contributions of CtBP-dependent and —
independent repression activities of Knirps5

Abstract

The Drosophila Knirps protein is a short-range transcriptional repressor that locally
inhibits activators by recruiting the CtBP corepressor. Knirps also possesses CtBP-
independent repression activity. The functional importance of multiple repression
activities is not well understood, but the finding that Knirps does not repress some cis-
regulatory elements in the absence of CtBP suggested that the cofactor may supply a
unique function essential to repress certain types of activators. We assayed CtBP-
dependent and —independent repression domains of Knirps in Drosophila embryos, and
found that the CtBP-independent activity, when provided at higher than normal levels,
can repress an eve regulatory element that normally requires CtBP. Dose response
analysis revealed that the activity of Knirps containing both CtBP-dependent and —
independent repression activities is higher than that of the CtBP-independent domain

alone. The requirement for CtBP at certain enhancers appears to reflect the need for

 

5 This work was published as the following manuscript:
Strufl'i P., Corado M., Kulkarni M., and Arnosti D.N. (2004). Quantitative contributions of CtBP-
dependent and —independent activities of Knirps. Development 131: 2419-2429.

83

overall higher levels of repression, rather than a requirement for an activity unique to
CtBP. Thus, CtBP contributes quantitatively, rather than qualitatively, to overall
repression function. The finding that both repression activities are simultaneously
deployed suggests that the multiple repression activities do not function as cryptic

“backup” systems, but that each contributes quantitatively to total repressor output.

Introduction

Dynamic patterns of gene expression in the Drosophila embryo are orchestrated
by the combined action of transcriptional activators and repressors acting on complex cis
regulatory elements, or enhancers. In a number of well-studied cases in the Drosophila
embryo, multiple enhancers act independently on a single promoter, in part due to the
action of so-called short-range repressors, proteins whose inhibitory action is restricted to
ranges of ~100 bp from the factor binding site (Gray and Levine, 1996a). In cell culture
and transgenic embryo assays, short-range repressors can selectively inhibit individual
enhancers, or entirely silence a gene if bound close to the basal promoter (Arnosti et al.,
1996; Gray and Levine, 1996b; Ryu and Amosti, 2003). The apparent impuissance of
short-range repression actually provides a highly flexible mechanism for specific gene
regulation, allowing genes to be “tuned” to respond to subtle differences in repressor
protein concentration and by small changes in the positions of factor binding sites
(Hewitt et al., 1999). Changes in the spacing of short-range repressor binding sites
correlate with functional alterations observed during enhancer evolution (Ludwig and

Kreitman, 1998; Ludwig et al., 2000).

84

The CtBP corepressor is required for full activity of short-range repressors such as
Knirps, Kriippel, Giant, and Snail that play important roles in patterning the blastoderm
embryo (Nibu et al., 1998a,b). This evolutionarily conserved cofactor also interacts with
a number of vertebrate transcriptional regulators, including the adenovirus ElA protein,
Net, Ikaros, Zeb, and, indirectly, the Retinoblastoma tumor suppressor protein (reviewed
in Chinnadurai 2002). Transcription factors typically bind to CtBP via a short peptide
motif similar to the PLDLS sequence originally identified in EIA (Schaeper et al., 1995).
CtBP is homologous to or-hydroxyacid dehydrogenases, and contains a conserved NAD
binding domain as well as conserved residues in the putative active site (reviewed in
Chinnadurai, 2002; Turner and Crossley, 2001). Although not identified in previous
studies, recent reports found a weak dehydrogenase activity associated with CtBP
(Kumar et al., 2002; Balasubramanian et al., 2003; Shi et al., 2003). CtBP has been
found to bind directly to histone deacetylases (HDACs), suggesting that the corepressor
may effect repression by chromatin remodeling (reviewed in Turner and Crossley, 2001;
Chinnadurai, 2002). A recent biochemical purification of CtBP identified additional
proteins in a complex, including histone methyltransferases, the CoREST repressor, and a
protein homologous to polyamine oxidases (Shi et al., 2003). This additional complexity
suggests that CtBP itself may utilize multiple activities to effect transcriptional
repression. Drosophila factors functionally characterized as short-range repressors all
interact with CtBP, although it has not been established that all factors that bind the
cofactor are necessarily short-range repressors. The long-range repressor protein Hairy,
in particular, is thought to interact with CtBP, although this might be in an antagonistic

mode (Poortinga et al., 1998; Zhang and Levine, 1999).

85

CtBP-mediated repression is critical for full activity of short-range repressors;
however, Drosophila short-range repressors also possess CtBP-independent repression
activities (La Rosee-Borggreve et al., 1999; Keller et al., 2000; Strunk et al., 2001; Nibu
et al., 2003). In the case of Knirps, a form of the protein that lacks the CtBP binding
motif exhibits weak activity when overexpressed (Nibu et al., 1998b). The CtBP
independent activity has been mapped to an N terminal repression domain that lacks a
CtBP-binding motif and is able to repress in the absence of CtBP (Keller et al., 2000).
Although many transcriptional repressors have been found to possess multiple activities,
the functional relevance of such activities is not well understood. Previous studies
suggest that multiple repression activities underlie both gene specific and activator
specific effects. In the case of the Zeb repressor, a protein with CtBP-dependent and -
independent activities, it was found that specific repression activities are directed at
distinct classes of transcriptional activators (Postigo and Dean, 1999). In another case,
distinct mechanisms are used at different promoters: the NRSF repressor mediates HDAC
and DNA methylation-dependent repression of the NaCh II gene and a distinct form of
repression of the SCGI 0 gene (Lunyak et al., 2002).

Previous studies also hint that the possession of CtBP-dependent and —
independent activities may confer important quantitative effects. For example, the
Kriippel promoter is activated by Bicoid in both anterior and central regions of the
blastoderm embryo, and is repressed by Giant in either CtBP-independent or CtBP-
dependent manners, depending on the region of the embryo (Strunk et al., 2001). The
higher levels of Bicoid activator in anterior regions of the embryo might necessitate

additional repression activities beyond those afforded by CtBP-independent pathways,

86

suggesting that CtBP might contribute quantitatively to overall repressor output. In cell
culture studies, CtBP-dependent and CtBP-independent repression activities of Knirps
possess similar functional attributes, including distance dependence, trichostatin A
insensitivity, and activator specificity, suggesting that their quantitative effects might be
mediated through similar pathways (Ryu and Arnosti, 2003).

The Knirps protein is able to regulate at least one known target, the stripe 3
enhancer of the even-skipped (eve) gene in a CtBP-independent fashion, yet this CtBP-
independent activity is not sufficient to supply the full biological function of Knirps
(Keller et a1. 2000; Nibu et al., 1998b). For instance, transheterozygous knirps and CtBP
embryos have disruptions in eve expression, suggesting that Knirps function is partially
impaired, and a frameshifi mutation in knirps encoding a protein lacking the CtBP
binding motif is a strong hypomorph (Gerwin et al., 1994; Nibu et al. 1998a).
Furthermore, a point mutation in the CtBP binding motif results in a protein that lacks the
dominant phenotype of the wild-type protein when misexpressed in a pattern of eve stripe
2 (Nibu et al., 1998b). These results suggest that Knirps requires CtBP for effective
regulation of at least some of its targets. Here, we examine the regulation of several
enhancers targeted by Knirps to test the possibility that the CtBP-dependent and CtBP-
independent repression activities of Knirps might be deployed to achieve qualitatively or
quantitatively distinct effects. Our results suggest that in the case of the eve gene, the two

activities are both required to achieve quantitatively sufficient levels of repression.

87

Materials and Methods

Plasmid construction. To generate transgenic flies that carry inducible, double tagged
Knirps genes, the P-element transformation vector pCaSpeR-hs (Pirrotta, 1988) was
modified to incorporate an N-terminal hexahistidine tag and a C-terminal double FLAG
tag in frame with a KpnI —XbaI insert (reading frame commencing with GGT). First, an
oligonucleotide containing the ribosome binding site (Kozac) consensus sequence for
Drosophila (Cavener and Ray, 1991) and an N-terrninal sequence encoding
MARGS(his)6 was introduced into the unique EcoRI site of pCaSpcR-hs. This fragment
was generated by annealing and extending the following primers: S’CCG CGG AAT
TCA CAA CCA AAA TGG CGA GAG GAT CGC ATC 3’ and 5’ GGC CGA ATT
CGG TAC CGT GAT GGT GAT GGT GAT GCG ATC C 3’, to generate an EcoRI-
Kozac-MARGS(his)6-KpnI-EcoRI-containing oligonucleotide, which was restricted with
EcoRI, PAGE-purified and cloned into pCaSpeR-hs. Two FLAG epitope sequences were
introduced in two successive steps using annealed oligonucleotides. To introduce the first
FLAG epitope tag the vector containing the hexahistidine tag was cut with KpnI and Stul
and ligated with two annealed oligonucleotides (5’ CGA TCG ATC GTC TAG AGA
TTA CAA GGA TGA CGA TGA CAA GGC GGC CGC TTA GTA ATT AGT TAG
3’ and 5’ CTA ACT AAT TAC TAA GCG GCC GCC TTG TCA TCG TCA TCC
TTG TAA TCT CTA GAC GAT CGA TCG GTA C 3’, FLAG-codons in bold) to
generate a KpnI-(9bp)-XbaI-FLAG-(stop)s fragment. A second FLAG epitope was
generated by annealing and cloning two NotI-compatible, FLAG-containing
oligonucleotides (5’ GGC CGC TGA TTA CAA GGA TGA CGA TGA CCA GGC 3’

and 5’ GGC CGC CTT GTC ATC GTC ATC CTT GTA ATC AGC 3’) into the unique

88

NotI site of the vector. The correct orientation of the second FLAG oligonucleotide was
determined by PCR. The final vector, pCaSpeR-hs(H2xF), was sequenced to confirm the
correct frame and orientation of the tags inserted. Different knirps fragments were
subcloned as KpnI-XbaI inserts into pCaSpeR-hs(H2xF), generating thnil-429, which
contains full-length Knirps, thnil-330, which contains the CtBP-independent repression
domain of Knirps, thni1-105, which contains the Knirps DNA binding domain (a 1-
74) and its nuclear localization signal (a 75-95; Gerwin et al., 1994), thni75-429 and
thni75-330. All fragments were PCR amplified using as template pBS-N741, which
contains a full-length knirps cDNA (kindly provided by Michael Levine). To amplify
full-length Knirps (1-429), the primers used were DA-502: 5’ CGC GCG GTA CCA
TGA ACC AGA CAT GCA AAG TG 3’ and DA-503: 5’ CGG CCT CTA GAG ACA
CAC ACG AAT ATT CCC CT 3’. To amplify Knirps75-330 the primers used were DA-
504: 5’ CGC GCG GTA CCG GAT CCC GCT ACG GAC GTC GC 3’ and DA-505: 5’
CGG CCT CTA GAT CCT TCT TGA GCG GAA ACG GTG G 3’. To amplify Knirpsl-
330, DA-502 and DA-505 were used. To amplify Knirps75-429, DA-504 and DA-503
were used. To amplify Knirps1-105 the primers used were DA-502 and DA-773: 5’ CGG
CCT CTA GAA GGC GCC TTG CCC GCC GCT GC 3’.

Heat-shock experiments. To induce expression of recombinant Knirps proteins, 2-4
hour old embryos collected on apple-juice plates at room temperature (22-23°C) were
incubated for 5, 10, 20 or 30 minutes at 38°C in a 10-liter water bath to ensure rapid and
even heating. After induction, embryos were allowed to recover in a water bath at room
temperature for 30 minutes prior to fixation or sonication. Heat-shock inductions of

Knirpsl-330 and Knirpsl-429 were also performed with no recovery. For the

89

experiments described in Fig. 3-6, hairy expression pattern was monitored after 10 or 30
minutes of heat-shock, ftz expression pattern was determined after 5, 10, 15, 20 or 30
minutes of heat-shock, run expression pattern was determined after 15 or 30 minutes of
heat-shock and hb expression pattern was determined afier 30 minutes of heat-shock. 3O
minues of recovery after heat-shock was applied for all the experiments described in Fig.
3-6.

Crude embryo lysate preparation. Approximately 50 mg of dechorionated embryos
were resuspended in 1.2 ml of lysis buffer (25 mM HEPES pH 7.9, 150 mM NaCl, 1 mM
DDT, 1 mM PMSF, 1 mM Na-metabisulfite, 1 mM benzamidine, 10 uM pepstatin A)
and disrupted by sonication using a Branson Sonifier 250 (2 cycles of 12 pulses each,
output 3, duty cycle 60%). After sonication, lysates were centrifuged for 15 minutes at
14,000 rpm using an Eppendorf centrifuge, and the protein concentration of the
supernatant was determined using the Bradford assay, with BSA as the standard.
Western blot analysis. Irnmunoblotting was performed according to standard protocols
(Harlow and Lane, 1999) using a tank transfer system (Mini Trans-Blot Cell, Biorad).
Sequi-BlotTM PVDF membranes (BioRad) were used and antibody incubation was in
TBST (20 mM Tris-HCl, pH 7.5, 120 mM NaCl, 0.1% Tween-20) supplemented with 5%
(w/v) nonfat dry milk as blocking agent. The primary anti FLAG M2 monoclonal
antibody (Sigma) was used at 1:10,000 dilution. The secondary ImmunoPure® Goat
Anti-Mouse HRP-conjugated antibody (Pierce) was used at l:20,000 dilution. Western
blots were quantitated using a Fluor-S® MultiImager (Biorad) set on high sensitivity and

with an exposure time of 50 min. The QuantityOne package (BioRad) was used to

90

analyze the data. Four independent quantitations of four gels were performed, analyzing
lysates from an experiment performed as described for Fig. 3-3 and Table 3-1.

P-element transformation, whole mount in situ hybridization. P-element
transformation vectors were introduced into the Drosophila germline by injection of y W67
embryos and in situ hybridizations were performed using digoxigenin-UTP-labeled
antisense RNA probes to eve, h, kni, run, ftz and lacZ as described (Small et al., 1992).
lacZ reporters. The eve stripe 3/7 and 4/6 lacZ reporter genes used in Fig. 3-1 were
described in Small et a1. (1996) and F ujioka et a1. (1999), respectively. Germline mutants
of CtBP were generated as previously described (Keller et al., 2000) using
CtBPO3463/TM3, Sb (Bloomington stock no. P1590). The even-skipped stripe 2/3 lacZ
reporter used in Fig. 3-4 contains ~500 bp minimal elements separated by a 340 bp spacer
sequence and 2 UAS sites (not utilized in this experiment) fused to the eve basal
promoter (Keller et al., 2000). The eve stripe 3/7 reporter used in Fig. 3-4 (stock E9) was
kindly provided by Steve Small and the eve stripe 4/6 lacZ reporter (stock B45C52-B)

was kindly provided by Jim J aynes (Fujioka et a1. 1999).

91

Results

Repression by Knirps of even-skipped stripe 3/7 enhancer is independent of CtBP,
while repression of stripe 4/6 enhancer is CtBP-dependent.

The expression of the endogenous eve gene is strongly perturbed by a loss of
CtBP, consistent with this corepressor’s important role in the activity of gap repressors
Giant, Kriippel, and Knirps (Nibu et a1. 1998 a, 1998b; Strunk et al., 2001). To study the
effectiveness of Knirps repression of individual eve regulatory elements, we assayed the
expression of eve-lacZ reporter genes. Knirps is required for correct regulation of the eve
stripe 3/7 and 4/6 enhancers, as demonstrated by the expression patterns of lacZ reporter
genes in kni mutant embryos (Fujioka et al., 1999; Small et al., 1996). As previously
observed (Keller et al., 2000) the posterior border of eve stripe 3 was not derepressed in a
CtBP mutant, consistent with the CtBP-independent activity of Knirps on this enhancer
(Fig. 3-1A, B). In contrast, Knirps repression of eve stripe 4/6 is compromised in a CtBP
mutant background, indicating that the CtBP-independent repression activity of Knirps is
insufficient to regulate this enhancer (Fig. 3-1C, D). Therefore, depending on which
portion of the eve gene is bound by the Knirps protein, its repression activity is either

dependent or independent of the CtBP cofactor (Fig. 3-1E).

92

 

E

.. CtBP

t Knirps ,5 ifKniirps, ,9
.1
43%| eve I‘m

Figure 3-1: CtBP is required for Knirps repression of even-skipped (eve) stripe 4/6
enhancer, but not stripe 3/7 enhancer.

Expression patterns of eve stripe 3/7 (A, B) and eve stripe 4/6 lacZ reporter genes (C, D)
in wild-type and CtBP mutant embryos, showing derepression only of the eve stripe 4/6
element in the CtBP mutant. E. Schematic representation of eve regulatory regions,
showing cofactor requirements for Knirps repression. Expression patterns were
characterized in transgenic embryos by in situ hybridization. Embryos are oriented
anterior towards the lefi, dorsal side upwards.

93

Ectopic expression of Knirps proteins in embryos

To determine whether the eve stripe 4/6 enhancer is intrinsically resistant to
repression by the CtBP-independent activity of Knirps, or just less sensitive to this
activity, we overexpressed full-length (1-429) FLAG epitope tagged Knirps or a
truncated form of the protein that contains only the N-terminal, CtBP-independent
repression activity (1-330) in embryos (Fig. 3-2A). As controls, proteins lacking the N-
terrninal DNA binding domain were also overexpressed to test for specificity of
repression. All proteins were expressed from a hsp 70 promoter construct introduced by
germline transformation into Drosophila. In situ analysis showed a uniform distribution
of knirps mRNA in embryos after heat shock, reaching levels comparable to the
endogenous knirps gene (Fig. 3-ZB). The different forms of the Knirps protein were
expressed at similar levels after heat shock induction of the transgenes, with undetectable
levels present before heat shock (Fig. 3-2C and data not shown). Heat shock induction of
full-length Knirps in the embryo was lethal (data not shown), as is expected for this

regulatory factor whose expression usually exhibits tight temporal and spatial regulation.

Differential effects of Knirps protein on the even-skipped gene

The effect of misexpression of Knirps proteins was monitored by measuring
endogenous eve expression by in situ hybridization. Heat shocks of variable duration
were performed to test the effects of increasing levels of the Knirps protein (Fig. 3-3).
Misexpession of the full-length Knirps protein, 1-429, resulted in repression of stripe 3
expression even after a short (5 minutes) heat shock pulse, with almost as frequent

repression of stripe 7 (Fig. 3-3A-B; Table 3-I). Heat shocks of longer duration resulted in

94

Figure 3-2: Expression of full-length and CtBP-independent portions of the Knirps
transcriptional repressor in transgenic Drosophila.

A. Structure of proteins expressed from hsp70 promoter: 1-429, full-length Knirps
protein; 75-429, non-DNA binding control protein; 1-330, CtBP-independent Knirps
repression domain; 75-330, non-DNA binding control protein. B. In situ analysis of
expression of knirps mRNA produced from hsp70-knirps transgene before and after
heatshock. C. Above, proteins expressed from representative lines of the four constructs
measured by Western blot. M2 a-FLAG antibody was used to detect recombinant
proteins. Lines shown in lanes 2 and 4 were used in subsequent experiments. Lane 8,
non heat shock control. Below, Coomassie blue stained gel illustrates equal loading.

95

CtBP

 

 

 

 

 

 

 

 

 

1
A PM\DL§K
ME I fissure haKnI1-429
75 429
hb I? l rFLAG haKnl75-429
1 330
M. l_—nnn l jruc haKnl1-330
75
m. I7 :lFLAG he Knl 754330
B non heat shock 38° C heat shock
a In 2 3 :3 53
n ,_ m . . . . .
a a ' '3 9‘ § § §
zziiiéea.
kDa + + + + + + + + heat

shock

  

1 2 3 4 5 6 7 8 9 10
Figure 3-2: Expression of full-length and CtBP-independent portions of the Knirps
transcriptional repressor in transgenic Drosophila.

96

hskni1 429.3 hskni1-330.1

A uni .

   

B F
c G
D d

Figure 3-3: Pattern of endogenous eve expression in embryos expressing full-length
Knirps 1-429 (A-D) and CtBP-independent region of Knirps 1-330 (E-G).

Phenotypes of increasing severity are illustrated. Class I pattern (A, E), repression of
stripe 3; Class II (B, F), repression of stripe 3 and 7; Class HI (C, G) repression of stripe
3,4,6, and 7; Class IV, all stripes repressed except stripe 5. Endogenous eve patterns
were visualized by in situ hybridization; embryos are oriented with anterior towards the
lefi, dorsal side upwards. More severe phenotypes were produced by expression of full-
length Knirps 1-429 than Knirps 1-330, as documented in Table 3-1.

97

 

wow £0 03 Eb Omv w :r :

 

 

 

 

we K S 3 ow v; N.
8 cm mm 2 w c o
o S o 2 m o m
we mm 3 2 a o V
we ow me 2. cm 3 m
mm o Wm o o o N
mm o Wm o o o fl
3: can; 3: can-“ 31 can-“ 8:; so
as 3 as S as m 5:22.
c.9238:

98

 

£92? :3: not.“ 8&5... was we 37.839. wage—7. mere—.0 £59.52» .3 oust—3.3m .Tm 03:.

significant repression of stripe 4 and 6 (Fig. 3-3C). A 20 minutes heat shock also resulted
in repression of stripe 1 and 2, leaving only stripe 5 expression (Fig. 3-3D). The selective
repression of a subset of multiple enhancer elements is a striking down a gene entirely.
No disruption of the eve pattern was noted in lines expressing Knirps proteins lacking
amino acids 1-74, demonstrating that an intact DNA binding demonstration of the way
short-range repressors can repress individual regulatory elements without shutting
domain is required for the effects observed (see Appendix B). The hierarchy of eve stripe
3-7 enhancer sensitivity to Knirps is consistent with the relative positions of these stripes
within the Knirps protein gradient, whereby stripes 3 and 7 are sensitive to lower
concentrations of Knirps than are 4 and 6 (F ujioka et al., 1999; Clyde et al., 2003).

Similar to the case with Knirps 1-429, stripes 3 and 7 were the first to be affected by
misexpression of the Knirps 1-330 protein, which bears only the CtBP-independent
repression activity. In this latter instance, however, the numbers of embryos showing
repression was smaller (Fig. 3-3E, F; Table 3-1). Unexpectedly, overexpression of
Knirps 1-330 also led to repression of eve stripes 4 and 6, indicating that this regulatory
element is sensitive to the CtBP-independent activity of Knirps (Fig. 3-3G). Again, the
relative number of affected embryos was smaller, indicative of a quantitative difference
in repression between hill-length Knirps and the CtBP-independent domain alone (Table
3-1). Unlike the case for Knirps 1-429, no embryos were observed that showed
repression of stripes 1 and 2 by overexpression of Knirps 1-330. This result suggests that
either these enhancers require still higher levels of Knirps 1-330 to be effectively
repressed, or that there are qualitative as well as quantitative differences between the

repressors. In a small percentage of cases, stripe 5 expression was also observed to be

99

repressed in embryos misexpressing Knirps 1-330 and Knirps 1-429 (Table 3-1),
however, a small percentage of nontransgenic controls also appear to show loss of stripe
5 expression (not shown), indicating that this phenotype may be a nonspecific heat shock
effect.

Heat-shock experiments were also performed with no recovery time after
induction to test whether Knirps might be repressing eve indirectly. We found that the
order of repression of eve stripes was identical as in Fig. 3-3, although for each heat-
shock regimen repression was not as complete (data not shown), possibly because the eve
mRNA had less time to turn over. This result is consistent with a direct action of Knirps
on eve enhancers.

The activity of Knirps 1-330, containing the CtBP-independent domain of Knirps
may reflect the previously identified CtBP-independent autonomous activity.
Alternatively, some or all of the activity may be due to competition of the DNA binding
domain for activator binding sites. Therefore, we overexpressed the DNA binding
domain of Knirps (residues 1-105, containing the previously defined DNA binding
domain and nuclear localization signal; Gerwin et al., 1994) and determined its effect on
eve expression pattern. As measured by quantitative Western blotting, this protein was
readily induced to levels almost as great as Knirps 1-330. Even at high expression levels,
however, Knirps 1-105 was unable to perturb eve expression (data not shown), suggesting
that Knirps represses eve by means other than direct competition for activator binding

sites.

100

Differential effects of Knirps protein on minimal even-skipped stipe enhancers

Next, we tested the effects of overexpression of full-length Knirps and the N-
terminal, CtBP-independent domain of Knirps on minimal eve stripe 2-3, 3/7- and 4/6-lac
Z reporters. We confirmed that the differential susceptibility to repression of eve stripe 3
compared to stripe 2 (Fig. 3-3) was directly associated with the previously defined
regulatory regions using a lacZ reporter gene coupled to the minimal 500 bp stripe 2 and
3 enhancers. Both full-length Knirps 1-429 and Knirps 1-330 preferentially repressed
stripe 3 over stripe 2 (Fig. 3-4B and F). The Knirps 1-429 protein was able to entirely
repress stripe 3 in almost all embryos, and stripe 2 in a majority of embryos (Fig. 3-4A-
C). In contrast, as noted with the endogenous eve gene, the CtBP-independent 1-330
repression domain was less potent than 1-429, resulting in more embryos with only
partially repressed eve stripe 3, and fewer embryos in which stripe 2 was repressed (Fig.
3-4D-F). Embryos in which both stripes 2 and 3 were repressed were distinguishable
from nontransgenic embryos by residual stripe 2 expression in ventral regions and an
anterior stripe driven by vector sequences (Fig. 3-4C). The minimal stripe 2 enhancer is
probably more sensitive to repression by Knirps 1-330 than the endogenous stripe 2
enhancer because it does not contain all sequences involved in stripe 2 regulation (M.
Ludwig and M. Kreitman, personal communication). A previous study found that the
minimal stripe 2 element was only slightly affected by Knirps overexpression (Kosman
and Small, 1997), but here we are probably achieving higher levels of expression.
To ftuther verify the relative activity of full-length Knirps versus the CtBP-independent
activity of Knirps, we tested the effects of overexpression of Knirps proteins in embryos

carrying eve stripe3/7- and 4/6-lacZ reporters (Fig 3-4G-L). As observed on

101

Figure 3-4: Differental repression of minimal eve stripe enhancers by Knirps1-429
and 1-330, demonstrates differential sensitivities to Knirps activity.

Repression of eve stripe 2/3-lacZ reporter gene demonstrate differential sensitivities of
eve stripe 2 vs. stripe 3 enhancers to Knirps expression. Patterns of lacZ expression in
embryos prior to heat shock (A, D) and after heat shock (B, C, E, F). After a 10 minutes
heat shock, the majority of embryos expressing Knirps 1-429 showed repression of eve
stripe 3 (B). After a 30 minutes heat shock, the majority of embryos showed repression
of both stripe 2 and 3 (C). A significant percentage of embryos showed only partial
repression of stripe 3 upon overexpression of Knirps 1-330 (E). The majority of embryos
overexpressiong Knirps 1-330 demonstrated a loss of stripe 3, but not stripe 2 after 30
minutes of heat shock (F).

Effects of overexpression of Knirpsl-429 and 1-330 in embryos carrying the eve stripe
3/7 lacZ reporter (G-I) or eve stripe 4/6 lacZ reporter (J-L). Full-length Knirps was a
more potent repressor, but Knirps 1-330 was capable of repressing the minimal eve stripe
4/6 element (see text for details). The pattern shown in H and K is representative of
embryos heat-shocked for 15 minutes whereas the pattern shown in I and L is typical of
embryos heat-shocked for 30 minutes. Embryos are oriented with anterior towards the
left, dorsal side upwards.

102

1;. u: “3‘1

Mi.“
/

hskni1-429 ) ,,
5 A

l .

mg 3:

D wé.f* ‘ EWM‘ F \‘wax.

non heat shocked

hskni1-330

 

 

43: W2 441.1 Ed

H ?K " f
* L..__._ “an“. M. _!
‘x‘g
‘r n
hskni1 -330
s sv/
I L “

Figure 3-4: Differential repression of minimal eve stripe enhancers by Knirps 1-429
and 1-330, demonstrates differential sensitivities to Knirps activity.

103

the endogenous eve gene, full-length Knirps was a more potent repressor than the CtBP-
independent domain, causing complete repression of eve stripe 4 and 7 and ahnost
complete repression of eve stripe 3 and 6 (Fig. 3-4H and K compare with 3-4G and J). A
large decrease in the number of stained embryos also indicates that many lacZ reporter
genes were completely repressed. Knirps 1-330 caused a similar repression pattern, but
longer heat shocks were required to achieve comparable repression of the more sensitive
eve stripe 4 and 7. After 30 min of heat shock, repression of eve stripe 3 and 6 was not as
complete as that achieved by Knirps 1-429 after 15 min of heat shock (Fig. 3-41 compare
with H and L compare with K). Importantly, when expressed at high level, the CtBP-
independent repression activity of Knirps was able to completely repress eve stripe 4, and

partially repress stripe 6, confirming the results observed with the endogenous eve gene.

Higher specific activity of Knirps protein containing multiple repression activities.
The lower activity of Knirps 1-330 protein relative to the firll-length Knirps
protein might be due to a greater potency of the protein containing two distinct repression
activities, or it might merely reflect lower protein expression levels. To directly compare
levels of ectopically expressed Knirps proteins, lysates from transgenic embryos were
subject to Western blot analysis, using the same heat shock regime as that used for the in
situ analysis above (Fig. 3-5A). Equivalent amounts of total protein from whole embryo
lysates were separated on SDS gels, transferred to membranes and probed with an
antibody specific for the C-terminal FLAG epitope. Quantitation of the signals from the

blots indicate that the weaker Knirps 1-330 repressor was actually expressed at

104

Figure 3-5: Quantitation of proteins expressed from hsp 70-knirps transgenes
demonstrates that full-length Knirps 1-429 is less abundant than Knirps 1-330.

A. Western blot analysis of embryos subjected to the same heat-shock regiment (0, 5, 10,
20 min.) used for analysis shown in Table 3-1. Asterisk marks nonspecific cross-reacting
protein that was also present in lysates from nontransformant Drosophila (presence of
nonspecific band appeared to vary with batch of antibody; data not shown). Because this
nonspecific band comigrates with the 1-330 protein, the signal from the nonspecific
protein (averaged from lanes 5-8) was subtracted from each of the values in lanes 1-4 to
determine levels of 1-330 protein. Below, Coomassie stained gel showing equal loading.
B. Quantitation of Western blots demonstrates an approximately two-fold higher level of
Knirps 1-330 protein at each time point than Knirps 1-429, demonstrating that the higher
activity of the 1-429 is not due to higher levels of this protein. Standard deviations are
shown in B for four separate gels and quantitations of the heatshock experiment shown in
panel A.

105

A. Knirps 1-330 Knlrpo 1429
0 5 1020 o 5 10 20mln.at38°c

”—

“‘ u
W‘N-‘sruufl":
36-

ragga: s a

 

m12345678

B. Knl 1-330 KnlE1-429
om; 1o 20 o 5 10 20

    

Math" M! (96)

Figure 3-5: Quantitation of proteins expressed from hsp70-knirps transgenes
demonstrates that full-length Knirps 1-429 is less abundant than Knirps 1-330.

106

approximately twofold higher levels than Knirps 1-429 at each time point tested (Fig. 3-
53). Therefore, the greater potency of the full-length Knirps is not just a function of
greater expression or stability of this protein, but presumably reflects the greater activity

of the combined repression domains.

Potency of Knirps 1-429 vs. Knirps 1-330 in regulation of hunchback, runt, hairy,
and fushi tarazu.

To compare the activities of full-length Knirps 1-429 with the Knirps CtBP-
independent repression domain on other endogenous target genes, we examined the
effects of overexpressing Knirps 1-429 or Knirps 1-330 on hunchback, runt, hairy and
fushi tarazu. Previous studies demonstrated that the hunchback parasegrnent 4 stripe is
very sensitive to low levels of Knirps (Kosman and Small, 1997), and we found that both
the full-length Knirps protein as well as the CtBP-independent Knirps repressor strongly
downregulated this stripe (Fig. 3-6A-C). Consistent with genetic information about
knirps regulation of runt (Klingler and Gergen, 1993; Kosman and Small, 1997),
misexpression of Knirps 1-429 had a drastic effect on runt expression, leading to
repression of up to six of the runt stripes (Fig. 3-6F). Stripe 1 was repressed less
frequently than stripes 2-4 and 6, consistent with an earlier report that indicated it was not
affected by levels of Knirps sufficient to inhibit stripe 2-3 (Kosman and Small, 1997).
Knirps 1-330 was much less effective in perturbing runt expression, except for weakened
runt stripe 3 expression (Fig. 3-6E).

The stripe elements 3, 4, 6 and 7 of hairy have been found to be affected by

misexpression of Knirps protein or mutations in the knirps gene (Pankratz et al., 1990;

107

Figure 3-6: Effect of expression of Knirps proteins on hunchback (hb), runt, hairy
and fushi tarazu (ftz) demonstrates differential activity of Knirps 1-429 versus
Knirps 1-330 on all but the most sensitive target genes.

hb, a sensitive target of Knirps (A-C), showed similar repression by both Knirps 1-330
and Knirps 1-429 of the parasegrnent 4 zygotic expression pattern (arrow) after 30
minutes of heat shock. On other genes, Knirps 1-330 was much less potent than Knirps
1-429. 1-330 repressed only the stripe 3 of run (E), while Knirps 1-429 repressed all
stripes but run stripe 5 (F) after 15 minutes of heat shock (similar patterns were observed
at 30 minutes). Similarly, 1-330 had a modest effect only on hairy stripes 3/4 (H) and fiz
stripe 3 (L), while Knirps 1-429 completely repressed hairy 3,4 and 7 (I) and extensively
disrupted ftz expression (K) after 5 and 10 minutes of heat shock respectively (similar
patterns were noted at 15 and 30 minutes). Transcripts of endogenous Knirps target genes
were visualized by in situ hybridization. All embryos are oriented with anterior towards
the left, dorsal side upwards.

108

 

 

:mxsi ..qu :93: Lno
is ’ ‘3 .‘
m x a x
as.
U .1 y r r m “ grin...

.._... .g :5; ._ Em «N n.

_A

 

Emu—6 .99 Hanna a. 86333: 3. Riga 6.635..“ on waaggg 33. 2:5 sass. 35.35:. BEN: 95
33:53.38 952.33.: 921.3. cm Nam—.3 Tag «635 Rum—flu Tum: e: a: U5 =3 52: 8555 Sum: «38.

', burr
versus
. l 330
list 30
KINDS
.sed all
mud
and fl:
[1511811
bmrrlat
t gem
ow aids

109

Langeland et al., 1994; Kosman and Small, 1997) and binding sites for Knirps protein
have been mapped on the hairy stripe 6 and 7 enhancer elements (Langeland et al., 1994;
Hader et al., 1998). Expression of Knirps 1-429 caused a strong repression of hairy stripe
3, 4, and 7 expression, while expression of Knirps 1-330 had no such inhibitory effect
(Fig. 3-6G-I). The ftz pair-rule gene is also under control of gap gene regulators, as well
as primary pair rule genes (Carroll and Scott, 1986; Yu and Pick, 1995). In Knirps 1-429
overexpressing embryos, the central stripes are fused, but overexpression of Knirps 1-330
had a much milder effect, with partial weakening of ftz stripes 2 and 3 (Fig. 3-6J-K). As
discussed below, the effects of Knirps misexpression on ftz might well represent
secondary effects mediated through upstream regulators, in particular eve and hairy.
These effects on eve and other endogenous pair rule genes support the observation that
the CtBP-independent repression domain of Knirps is capable of mediating repression on
the most sensitive target genes, but is quantitatively less potent than the full-length

protein.

110

Discussion

Multiple repression activities - quantitative contributions to reaching repression

thresholds.

Just as transcriptional activators are known to possess multiple activities to
stimulate transcription, a growing number of transcriptional repressors have been found
to have multiple activities that are dependent on distinct cofactors. In Drosophila, the
Brinker repressor can interact with both the CtBP and Groucho corepressors to mediate
repression of Dpp regulated genes (Hasson et al., 2001; Zhang et al., 2001). For this
repressor, distinct cofactors are required at different promoters. The tolloid gene is
repressed by Brinker in the blastoderm embryo in a Groucho-dependent manner, while
either CtBP or Groucho are sufficient to mediate brk autoinhibition. Interestingly, neither
cofactor appears to be required for repression of omb and sal, suggesting a third pathway
for repression, possibly direct competition (Hasson et al., 2001; Rushlow et al., 2001).
Similarly, the Even-skipped, Runt, and Engrailed proteins repress through Groucho-
dependent and —independent pathways, again showing gene-specificity. In none of these
cases is it known whether the requirement for specific repression activities at endogenous
enhancers reflects gmflitativelv distinct mechanisms, or alternatively, distinct quantitative
requirements for repression levels (Kobayashi et al., 2001; Fujioka et al., 2002; Aronson
et al., 1997). Analysis of the Groucho-dependent and —independent activities of Eve
protein on lacZ reporters, suggest that in combination these two domains do provide
quantitatively superior level of repression (Fujioka et al., 2002).

Previous studies of Kriippel, Giant, and Knirps have indicated that CtBP-

dependence or —independence of their repression activities varies according to the

111

specific cis regulatory element involved, suggesting that there are particular enhancer
architectures that necessitate CtBP activity. The clearest example of enhancer specific
requirements for CtBP is shown in the case of eve enhancers. In nuclei situated between
eve stripes 4 and 6, the stripe 4/6 and 3/7 enhancers are both repressed by Knirps in the
same nuclei, yet this repression is independent of CtBP on the 3/7 element and dependent
on CtBP on the 4/6 element (Fig. 3-1). By expressing increasing levels of the CtBP-
independent form of Knirps, the requirement for CtBP is obviated (Fig. 3-3). These
results suggest that distinct requirements for the CtBP cofactor at different genes or cis
regulatory elements can be based on the quantitative levels of repression activity. Indeed,
the combination of the CtBP-dependent and CtBP-independent activities make a
particularly powerful repressor, as judged by comparison of repression activities of
Knirps 1-429 vs. Knirps 1-330 on eve (Fig. 3-3 and Table 3-1) and other pair rule genes
(Fig. 3-6). These results suggest that both repression domains can be simultaneously
engaged on a given cis regulatory element, rather than a particular repression activity
being selectively engaged at particular enhancers. Consistent with this picture, when they
are assayed separately as Gal4 fllSiOIl proteins in embryos, both CtBP-dependent and
CtBP-independent repression domains of Knirps have equal, modestly effective
repression activities. In contrast, a Gal4 protein containing both domains is much more
effective at repressing a strongly activated promoter (Sutrias-Grau and Amosti,
submitted).

A model that explains the quantitative contribution of the CtBP corepressor to

Knirps repression activity is shown in Fig. 3-7. At the top, two lines depict the levels of

112

  
 

 

 

 

 

+CtBP
Knirps -CtBP
mediated . . . , .._..Wmms ,a/w stripe 4% threshold
msmn /g
_ , ,..,..._. stripe 31? threshold

smon :

(% cl) X
hat shocked Knirps level

 

 

Knirps concentration —>

Figure 3-7: Quantitative model for contribution of CtBP activity to repression by
Knirps.

Protein levels of Knirps protein (horizontal axis) are read out as differential levels of
repressor activity (vertical axis at top). With CtBP, Knirps repression levels increase
more sharply with increasing protein levels, allowing the activity to cross critical
thresholds at lower protein levels. The position of the Knirps protein levels in the
embryo (lower part of figure indicated by % egg length) then dictates where appropriate
stripe boundaries will form (vertical broken lines). This model predicts that due to the
inherently high threshold of the eve stripe 4/6 enhancer, loss of CtBP activity will move
the intercept off of the range of physiological Knirps concentrations, while having little
effect on the stripe 3/7 position.

113

repression activity generated by increasing Knirps concentrations, the top line illustrating
the levels of repression achieved by the Knirps protein complexed with CtBP.

Thresholds of repression required by the eve stripe 3/7 and 4/6 enhancers are depicted by
horizontal lines. Below, relative levels of Knirps are shown with respect to position (egg
length) in the embryo. At a relatively low level of Knirps protein activity, the eve 3/7
enhancer is repressed, and this level of repression activity is achieved at similar levels of
Knirps, regardless of whether or not CtBP contributes to repression. Thus, in the absence
of CtBP, the positions at which the stripe 3/7 boundaries form shift very little. The much
higher level of repression required by the stripe 4/6 element is achieved only near the
peak of Knirps protein levels. If CtBP is not complexed with Knirps, the intercept shifts
sharply to the right, to a level of Knirps not normally present in the embryo. The
sufficient level of repression in the absence of CtBP activity or protein is only achieved

under conditions where Knirps is overexpressed, as in Figure 3-3.

Setting Thresholds

The threshold model explains how the contributions of separate repression
activities act in a quantitative fashion to meet given thresholds, but what is the basis for
distinct repression thresholds? There are at least two variables involved in dictating a
threshold, namely, regulatory protein levels, and the nature (number, affinity, and
placement) of the relevant binding sites within a regulatory element. Varying
intranuclear activator levels can influence repression thresholds, as suggested by
regulation of the Kriippel gene: Giant requires CtBP for repression of this gene only in

nuclei containing peak levels of the Bicoid activator (Strunk et al., 2001). Varying

114

intranuclear rgpressor levels will dictate how easily those thresholds are met with or
without multiple repression activities. Gap genes, including Imirps, generate protein
gradients that have properties of morphogens, that is, they trigger differential responses at
different threshold levels (Kosman and Small, 1997). The stripe 4/6 and 3/7 modular
enhancers of the even-skipped gene are designed to respond to different levels of Knirps
protein, allowing the embryo to establish multiple stripe boundaries with a single protein
gradient. The short-range activity of Knirps allows the two enhancers to act
independently, so that activators bound to the stripe 4/6 enhancer activate the gene in
nuclei where the levels of Knirps are already sufficiently high to inhibit the stripe 3/7
enhancer.

Binding site affinity and number have been clearly established to influence
threshold responses in the case of transcriptional activators, such as Bicoid and Dorsal
(Jiang and Levine, 1993; Szyrnanski and Levine, 1995; Struhl et al., 1989). A similar
effect is likely to be true for repressors. Sequence analysis of the eve gene indicates that
there are more high-affinity Knirps binding sites within the eve stripe 3/7 element than in
the 4/6 enhancer, consistent with relative sensitivities of these elements that we
determined experimentally (Fig. 3-3; Papatsenko et al., 2002, Berman et al., 2002).
Removal of some of the Knirps binding sites in the eve stripe 3/7 enhancer reduces the
sensitivity of this element to the Knirps gradient (Clyde et al., in press). However, the
number of predicted high affinity binding sites alone is not sufficient information to
predict relative sensitivity to Knirps. If it were, one would expect the eve stripe 2
enhancer, with 3 predicted Knirps sites, to be more sensitive to Knirps than eve stripe 4/6,

with only a single site, yet the reverse is true (Berman et al., 2002; Fig. 3-3). This lack of

115

correlation might be partly attributable to errors in prediction of binding sites, however,
additional factors, such as affinity of binding sites and relative placement with respect to
other proteins, are likely to make the decisive difference in determining enhancer
sensitivity to Knirps. In the case of the Giant repressor, small shifts in the placement of
the binding site allows detection of less than two-fold differences in repressor
concentrations, a “gene tuning” mechanism that seems to have been invoked during
internal evolution of the eve stripe 2 enhancer (Ludwig et al., 2000; Hewitt et al., 1999).
The stoichiometry of activators to repressors has also been suggested to be a critical
factor in determining repression levels, and direct tests indicate that Giant and Knirps
respond sensitively to differences in activator binding site number and affinity on defined
regulatory elements (Hader et al., 1998; Kulkarni and Arnosti, 2003).

eve stripe 1 lies just posteriorly to the weak anterior domain of knirps expression,
suggesting a possible role of Knirps in regulating that element, but it is not clear whether
the relative sensitivity of other eve stripe enhancers normally active outside of the main
posterior domain of Knirps expression is of physiological significance. The eve stripe 2
pattern lies outside of the normal area of Knirps expression, and is only repressed at
highest levels of Knirps (Table 3-1), suggesting that repression might be through cryptic
Knirps sites in the element (Berman et a1, 2002). The robust activity of the eve stripe 5
enhancer even under conditions of high levels of Knirps misexpression underlines that
this regulatory element has been designed to function in nuclei containing peak levels of
Knirps protein (Fig. 3-3). Similarly, runt stripe 5 also resists peak levels of ectopic
Knirps (Fig. 3-6). Both of these regulatory elements have few or no predicted Knirps

binding sites (Berman et a1, 2002). These elements would provide a useful platform to

116

test the number and placement of novel Knirps binding sites required to bring the element

under the control of this repressor.

Knirps regulation of hb, run, h, and ftz

The effects of Knirps misexpression on other endogenous pair rule genes
reinforce the lessons learned from eve, regarding the relative potency of the Knirps
repression domains and the sensitivity of different enhancers. Both the CtBP-independent
portion of Knirps as well as the intact protein were capable of repressing the hunchback
parasegrnent 4 stripe, a highly sensitive target of Knirps (Kosman and Small, 1997).
However, hairy, rant, and ftz, previously noted to have a higher threshold to Knirps
repression, were noticeably less affected by Knirps 1-330 compared to Knirps 1-429 (Fig.
3-6). Thus, it is likely that CtBP activity contributes quantitatively to repression of other
Knirps target genes in addition to eve.

Repression of central run stripes is consistent with previous findings of direct
repression by Knirps and the greater sensitivity of stripes 2-4 relative to stripe 1 (Kosman
and Small, 1997). We observed a greater effect of ectopic expression of Knirps on hairy
than noted in previous experiments, probably on account of higher levels of expression.
Knirps expressed under the control of an eve stripe 2 enhancer was previously found to
have little effect on anterior hairy expression, except for a delay in stripe 3/4 separation
(Kosman and Small, 1997). Heat shock expression of full length Knirps 1-429, in
contrast, resulted in strong repression of hairy stripes 3, 4 and 7 (Fig. 3-61). The hairy
stripe 3, 4 and 7 enhancers are predicted to contain Knirps binding sites, in contrast to the

unrepressed stripe 1 and 5 enhancers (Langeland et al., 1994; La Rosee et al., 1997;

117

Berman et al., 2002). The weaker Knirps 1-330 protein had an effect similar to that of
full-length Knirps expressed from an eve stripe 2 expression construct, that is, a delay of
stripe 3/4 separation (Fig. 3-6H). Interestingly, knirps is important for activation of hairy
stripe 6, and the protein can bind to the stripe 6 enhancer directly in vitro Riddihough
and Ish-Horowicz, 1991; Langeland et a1. 1994). We see no evidence of activation upon
overexpression, however, suggesting that such activation might be indirect.

The derepression of ftz we observe between stripe 2-4 and 6-7 is likely to be due
to indirect effects of repression of hairy and eve expression; both of these genes are
thought to repress ftz directly (Jimenez et al, 1996; Manoukian and Krause, 1992). In
contrast, previous work involving lower levels of anteriorly expressed Knirps observed
only weakened ftz stripes 2 and 3, rather than stripe fusion. This lower level of Knirps
had a much less profound effect on upstream regulators hairy and eve, suggesting that
Knirps might be a direct gap gene input to this pair rule gene, as suggested by earlier

studies (Yu and Pick, 1995; Kosman and Small, 1997).

Repression mechanisms

Our study suggests that the multiple repression activities of Knirps can be simultaneously
mobilized to provide quantitatively correct levels of repression activity, and that the
design of cis regulatory elements can elicit CtBP-dependence. CtBP-independent activity
can in some cases be directly attributed to direct competition with activator for DNA
binding (Hoch et al., 1992; Nibu et al., 2003), however, the CtBP-independent activity of
Knirps can repress activators on elements where sites are not overlapping (Keller et al.,

2000; Ryu and Arnosti, 2003), and overexpression of the DNA binding domain of Knirps

118

(Knirpsl-IOS) is insufficient to mediate repression of endogenous eve enhancers (see
Appendix B). Cell culture and transgenic embryo assays indicate that both CtBP-
dependent and —independent repression activities of Knirps have very similar
characteristics with respect to activator specificity, distance dependence, and overall
potency, thus the targets and molecular mechanisms might well be similar in each case
(Ryu and Arnosti, 2003; Sutrias-Grau and Arnosti, submitted). Key to a deeper
understanding of the molecular circuitry controlled by short-range repressors such as
Knirps will be biochemical knowledge of the mechanisms of repression employed on

these developmentally regulated enhancers.

Acknowledgments

We thank Miki Fujioka and Jim Jaynes for the eve stripe 4/6 lacZ reporter
construct, and Steve Small for eve stipe 3/7 lacZ reporter construct. We thank David
Kosman and Steve Small for runt, hairy, fushi-tarazu and even-skipped cDNAs. M.C.
demonstrated the CtBP-dependent repression of the eve stripe 4/6 enhancer. M.K. carried
out the initial heat shock experiments that demonstrated the sensitivity of the eve stripe
4/6 enhancer to the CtBP-independent repression activity of Knirps. P.S. created the heat
shock Knirps lines, characterized the induction of proteins, carried out and quantitated the
titrations of Knirps proteins, and quantitated the effects on eve and other pair rule genes.
The authors wish to thank S. Small for sharing information prior to publication, Lee
Kroos for comments on the manuscript and three anonymous reviewers for helpful

suggestions. This study was supported by grant NIH GM56976 to DNA.

119

References

Arnosti D. N., Gray S., Barolo S., Zhou J., and Levine M. (1996). The gap protein
knirps mediates both quenching and direct repression in the Drosophila embryo. EMBO
J. 15: 3659-3666.

Aronson B. D., Fisher A. L., Blechman K., Caudy M., and Gergen J. P. (1997).
Groucho-dependent and -independent repression activities of Runt domain proteins. Mol.
Cell. Biol. 17: 5581-5587.

Balasubramanian P., Zhao L. J., and Chinnadurai G. (2003). Nicotinamide adenine
dinucleotide stimulates oligomerization, interaction with adenovirus ElA and an intrinsic
dehydrogenase activity of CtBP. FEBS Lett. 537: 157-160.

Berman B. P., Yutaka N., Pfeiffer B. D., Tomancak P., Celniker S. E., Levine M.,
Rubin G. M., and Eisen M. B. (2002). Exploiting transcription factors binding site
clustering to identify cis-regulatory modules involved in pattern formation in the
Drosophila genome. Proc. Natl. Acad. Sci. USA 99: 757-762.

Carroll S. B., and Scott M. P. (1986). Zygotically active genes that affect the spatial
expression of the fushi tarazu segmentation gene during early Drosophila embryogenesis.
Cell 45: 113-126.

Cavener D. R., and Ray S. C. (1991). Eukaryotic start and stop translation sites. Nucl.
Acids Res. 19: 3185-3192.

Chinnadurai, G. (2002). CtBP, an unconventional transcriptional corepressor in
development and oncogenesis. Mol. Cell 9: 213-224.

Clyde D. E., Corado M. S. G., Wu X., Pare A., Papatsenko D., and Small S. (2003).
A self-orgarrizing system of repressor gradients establishes segmental complexity in
Drosophila. Nature 426: 849-853.

Fujioka M., Emi—Sarker Y., Yusibova G. L., Goto T., and Jaynes J. B. (1999).
Analysis of an even-skipped rescue transgene reveals both composite and discrete
neuronal and early blastoderm enhancers, and multi-stripe positioning by gap gene
repressor gradients. Development 126: 2527-2538.

Fujioka M., Yusibova G. L., Patel N. H., Brown S. J., and Jaynes J. B. (2002). The
repressor activity of Even-skipped is highly conserved, and is sufficient to activate
engrailed and to regulate both the spacing and stability of parasegrnent boundaries.
Development 129: 441 1-4421.

Gerwin N., La Rosee A., Sauer F., Halbritter H. P., Neumann M., Jilckle H., and
Nauber U. (1994). Functional and conserved domains of the Drosophila transcription
factor encoded by the segmentation gene knirps. Mol. Cell. Biol. 14: 7899-7908.

120

Gray S., and Levine M. (19963). Transcriptional repression in development. Curr. Opin.
Cell Biol. 8: 358-364.

Gray S., and Levine M. (1996b). Short-range transcriptional repressors mediate both
quenching and direct repression within complex loci in Drosophila. Genes & Dev. 10:
700-710.

Hader T., La Rosee A., Ziebold U., Busch M., Taubert H., Jackle H., and Rivera-
Pomar R. (1998). Activation of posterior pair-rule stripe expression in response to
maternal caudal and zygotic knirps activities. Mech. Dev. 71: 177-186.

Harlow E., and Lane D. (1999). Using Antibodies: A Laboratory Manual. Cold Spring
Harbor Press, Cold Spring Harbor, NY.

Hasson P., Muller B., Basler K., and Paroush Z. (2001). Brinker requires two
corepressors for maximal and versatile repression in Dpp signalling. EMBO J. 20: 5725-
5736.

Hewitt G. F., Strunk B. S., Margulies C., Priputin T., Wang X., Amey R., Pabst B.
A., Kosman D., Reinitz J., and Arnosti D. N. (1999). Transcriptional repression by the
Drosophila Giant protein: cis element positioning provides an alternative means of
interpreting an effector gradient. Development 126: 1201-1210.

Hoch M., Gerwin N., Taubert H., and Jllckle H. (1992). Competition for overlapping
sites in the regulatory region of the Drosophila gene kriippel. Science 256: 94-97.

Jiang J., and Levine M. (1993). Binding affinities and cooperative interactions with
bHLH activators delimit threshold responses to the dorsal gradient morphogen. Cell 72:
741-752.

Jimenez G., Pinchin S. M., and Ish-Horowicz D. (1996). In vivo interactions of the
Drosophila Hairy and Runt transcriptional repressors with target promoters. EMBO J.
15: 7088-7098.

Keller S. A., Mao Y., Struffi P., Margulies C., Yurk C. E., Anderson A. R., Amey R.
L, Ballard S., Ebels J. M., Foley K., Corado M., and Arnosti D. N. (2000). dCtBP-
dependent and -independent repression activities of the Drosophila Knirps protein. Mol.
Cell. Biol. 20: 7247-7258.

Klingler M., and Gergen J. P. (1993). Regulation of runt transcription by Drosophila
segmentation genes. Mech. Dev. 43: 3-19.

Kobayashi M., Goldstein R. E., Fujioka M., Paroush Z., and Jaynes J. B. (2001).
Groucho augments the repression of multiple Even-skipped target genes in establishing
parasegrnent boundaries. Development 128: 1805-1815.

Kosman D., and Small S. (1997). Concentration-dependent patteming by an ectopic
expression domain of the Drosophila gap gene knirps. Development 124: 1343-1354.

121

Kulkarni M. M., and Arnosti D. N. (2003). Information display by transcriptional
enhancers. Development 130: 6569-6575.

Kumar V., Carlson J. E., Ohgi K. A., Edwards T. A., Rose D., Escalante C. R.,
Rosenfeld M. G., and Aggarwal A. K. (2002). Transcription corepressor CtBP is an
NAD(+)-regulated dehydrogenase. Mol. Cell 10: 857-869.

Langeland J. A., Attai S. F., Vorwerk K., and Carroll S. B. (1994). Positioning
adjacent pair-rule stripes in the posterior Drosophila embryo. Development 120: 2945-
2955.

La Rosee-Borggreve A., Hader T., Wainwright D., Sauer F., and Jfickle H. (1999).
hairy stripe 7 element mediates activation and repression in response to different domains
and levels of Krilppel in the Drosophila embryo. Mech. Dev. 89: 133-140.

Ludwig M. Z., and Kreitman M. (1998). Functional analysis of eve stripe 2 enhancer
evolution in Drosophila: rules governing conservation and change. Development 125:
949-58.

Ludwig M. Z., Bergman C., Patel N. H., and Kreitman M. (2000). Evidence for
stabilizing selection in a eukaryotic enhancer element. Nature 403: 564-67.

Lunyak V. V., Burgess R., Prefontaine G. G., Nelson C., Sze S. H., Chenoweth J.,
Schwartz P., Pevzner P. A., Glass C., Mandel G., and Rosenfeld M. G. (2002).
Corepressor-dependent silencing of chromosomal regions encoding neuronal genes.
Science 298: 1747-1752.

Manoukian A. S., and Krause H. M. (1992). Concentration-dependent activities of the
even-skipped protein in Drosophila embryos. Genes & Dev. 6: 1740-1751.

Nibu Y., Zhang H., and Levine M. (1998a). Interaction of short-range repressors with
Drosophila CtBP in the embryo. Science 280: 101-104.

Nibu Y., Zhang H., Bajor E., Barolo S., Small S., and Levine M. (1998b). dCtBP
mediates transcriptional repression by Knirps, Krilppel and Snail in the Drosophila
embryo. EMBO J. 17: 7009-7020.

Nibu Y., Senger K., and Levine M. (2003). CtBP-independent repression in the
Drosophila embryo. Mol. Cell. Biol. 23: 3990-3999.

Pankratz M. J., Seifert E., Gerwin N., Billi B., Nauber U., and Jackle H. (1990).
Gradients of Krtippel and knirps gene products direct pair-rule gene stripe patterning in
the posterior region of the Drosophila embryo. Cell 61: 309-317.

Papatsenko D. A., Makeev V. J., Lifanov A. P., Regnier M., Nazina A. G., and
Desplan C. (2002). Extraction of functional binding sites from unique regulatory regions:
the Drosophila early development enhancers. Genome Res. 12: 470-481.

122

Pirrotta V. (1988). Vectors for P-mediated transformation in Drosophila. Biotechnology
10: 437-456.

Poortinga G., Watanabe M., and Parkhurst S. M. (1998). Drosophila CtBP: a Hairy-
interacting protein required for embryonic segmentation and Hairy-mediated
transcriptional repression. EMBO J. 17: 2067-2078.

Postigo A. A., and Dean D. C. (1999). Independent repressor domains in ZEB regulate
muscle and T-cell differentiation. Mol. Cell. Biol. 19: 7961-7971.

Riddihough G., and Ish-Horowicz D. (1991). Individual stripe regulatory elements in
the Drosophila hairy promoter respond to maternal, gap, and pair-rule genes. Genes &
Dev. 5: 840-854.

Rushlow C., Colosimo P. F., Lin M. C., Xu M., and Kirov N. (2001). Transcriptional
regulation of the Drosophila gene zen by competing Smad and Brinker inputs. Genes &
Dev. 15, 340-351.

Ryu J.-R., and Arnosti D. N. (2003). Functional similarity of Knirps CtBP-dependent
and CtBP-independent transcriptional repressor activities. Nucl. Acids Res. 31: 4654-
4662.

Schaeper U., Boyd J. M., Verma S., Uhlmann E., Subramanian T., and Chinnadurai
G. (1995). Molecular cloning and characterization of a cellular phosphoprotein that
interacts with a conserved C-terminal domain of adenovirus ElA involved in negative
modulation of oncogenic transformation. Proc. Natl. Acad. Sci. USA 92: 10467-10471.

Shi Y., Sawada J., Sui G., Affar E. B., Whetstine J. R., Lan F., Ogawa H., Luke
M.P-S., Nakatani Y., and Shi, Y. (2003). Coordinated histone modifications mediated
by a CtBP co-repressor complex. Nature 422: 735-738.

Small S., Blair A., and Levine M. (1992). Regulation of the even-skipped stripe 2 in the
Drosophila embryo. EMBO J. 11: 4047-4057.

Small S., Blair A., and Levine M. (1996). Regulation of two pair-rule stripes by a single
enhancer in the Drosophila embryo. Dev. Biol. 175: 314-324.

Struhl G., Struhl K., and Macdonald P. M. (1989). The gradient morphogen bicoid is a
concentration-dependent transcriptional activator. Cell 57: 1259-1273.

Strunk B., Struffi P., Wright K., Pabst B., Thomas J., Qin L., and Arnosti D. N.
(2001). Role of CtBP in transcriptional repression by the Drosophila giant protein. Dev.
Biol. 239: 229-240.

Szymauski P., and Levine M. (1995). Multiple modes of dorsal-bHLH transcriptional
synergy in the Drosophila embryo. EMBO J. 14, 2229-2238.

123

Turner J., and Crossley M. (2001). The CtBP family: enigmatic and enzymatic
transcriptional co-repressors. BioEssays 23: 683-690.

Yu Y., and Pick L. (1995). Non-periodic cues generate seven ftz stripes in the
Drosophila embryo. Mech. Dev. 50: 163-175.

Zhang H., and Levine M. (1999). Groucho and dCtBP mediate separate pathways of
transcriptional repression in the Drosophila embryo. Proc. Natl. Acad. Sci. USA 96,
535-540.

Zhang H., Levine M., and Ashe H. L. (2001). Brinker is a sequence-specific
transcriptional repressor in the Drosophila embryo. Genes & Dev. 15: 261-266.

124

Chapter 4

A functional interaction between the histone deacetylase de3
and the Drosophila short-range repressor Knirps6

Abstract

The Drosophila Knirps protein is a short-range transcriptional repressor essential
for proper embryonic development. Short-range repressors work over distances of less
than 100-150 base pairs to inhibit activators in a local fashion, allowing multiple
enhancers to be regulated autonomously. The mechanisms of short-range repression
remain poorly understood at the molecular level. Knirps mediates repression in part by
recruiting the corepressor CtBP, but it also possesses a CtBP-independent repression
activity. To investigate whether Knirps interacts with additional factors, we generated
transgenic flies that overexpress inducible, double-tagged versions of Knirps and
performed affinity purification experiments. Full-length, recombinant Knirps can be
expressed in embryos at the same time as the endogenous factor. The protein is heavily
phosphorylated and acts as a functional repressor to control several endogenous Knirps
targets. Gel filtration chromatography of embryonic extracts expressing full-length

Knirps indicate that the recombinant protein is part of a complex of ~450 kDa, suggesting

 

6 Chapter 4 is presented in the form of a manuscript to be submitted for publication as:
Struffi, P., and Arnosti, D.N. A functional interaction between the histone deacetylase de3 (HDACl) and
the Drosophila short-range repressor Knirps.

125

that other factors in addition to CtBP interact with Knirps. In a survey of possible
cofactors, we found that de3 (HDACl) cofractionates with Knirps during gel filtration.
To facilitate characterization of novel Knirps-interacting proteins, we developed a
tandem affinity chromatography protocol from embryonic extracts overexpressing Knirps
and, consistent with the gel filtration results, find that histone deacetylase de3
copurifies with full-length Knirps, but not the CtBP-independent repression domain. To
test the functional relevance of this association, we carried out dosage interaction assays,
and find that the rpd3 and knirps interact genetically. Altogether these results suggest that

histone deacetylation plays a role in short-range repression.

Introduction

Transcriptional repression plays essential roles in establishing cell- and tissue-
specific gene expression patterns during Drosophila embryogenesis (Pankratz and J tickle,
1990; Gray et al., 1992; Gray and Levine, 1996). For example, in the blastoderm embryo,
the activity of gap-gene repressors restricts the expression pattern of pair-rule genes,
generating their characteristic seven-stripe expression pattern, which marks the onset of
segmentation (Small et al., 1992; Clyde et al., 2003). Several modes of repression have
been proposed, including competition between repressors and activators for overlapping
binding sites on the DNA, the formation of inactive heteromeric complexes off the DNA,
the local quenching of activators or direct repression of the basal transcription machinery
(reviewed in Gray et al., 1995; Gray and Levine, 1996; Nibu et al., 2003). Repressors

might also work by modifying, directly or indirectly, the structure of chromatin and

126

therefore making the DNA template less accessible to activators and/or the basal
transcriptional machinery (reviewed in Courey and J ia, 2001).

Transcriptional repressors have been classified according to the range of their
activity (Cai et al., 1996; Barolo and Levine, 1997). Short-range repressors work over
distances of 100-150 bp to block nearby activators or the core transcription complex. This
form of repression allows enhancers to work independently of one another to direct
complex, additive patterns of gene expression (Gray et a1. 1994). Long-range repressors
can function over distances of >1 kb to inhibit multiple enhancers in complex modular
promoters, thereby resulting in simple on/off patterns of gene expression (Barolo and
Levine, 1997). The molecular mechanisms by which repressors works are poorly
understood, although the short-range/long-range distinction may result from the
recruitment of different corepressors (Nibu et a1. 1998). Short-range repressors interact
with the Drosophila homolog of mammalian C-terrninal binding protein (dCtBP),
whereas long-range repressors interact with the Groucho corepressor (Nibu et al., 1998;
Courey and J ia, 2001).

The CtBP corepressor is required for full activity of short-range repressors such as
Knirps, Kriippel, Giant, and Snail that play important roles in patterning the blastoderm
embryo (N ibu et al., 1998a,b; Strunk et al., 2001). This evolutionarily conserved cofactor
also interacts with a number of vertebrate transcriptional regulators, including the
adenovirus ElA protein, Net, Ikaros, Zeb, and, indirectly, the Retinoblastoma tumor
suppressor protein (reviewed in Chinnadurai 2002). Transcription factors typically bind
CtBP via a short peptide motif similar to the PLDLS sequence originally identified in

E1A(Schaeper et al., 1995). CtBP is homologous to a-hydroxyacid dehydrogenases, and

127

it contains a conserved NAD binding domain as well as conserved residues in the
putative active site (reviewed in Chinnadurai, 2002; Turner and Crossley, 2001).
Although not identified in previous studies, recent reports found a weak dehydrogenase
activity associated with CtBP (Kumar et al., 2002; Balasubramanian et al., 2003; Shi et
al., 2003). CtBP has been found to bind directly to histone deacetylases (HDACs),
suggesting that the corepressor may affect transcription by chromatin remodeling
(reviewed in Turner and Crossley, 2001; Chinnadurai, 2002). A recent biochemical
purification of human CtBP identified additional proteins in a complex, including histone
methyltransferases, the CoREST repressor, and a protein homologous to polyamine
oxidases (Shi et al., 2003). This additional complexity suggests that CtBP itself may
utilize multiple activities to effect transcriptional repression.

CtBP-mediated repression is critical for full activity of short-range repressors.
However, several Drosophila short-range repressors also possess CtBP-independent
repression activities (La Rosee-Borggreve, 1999; Keller et al., 2000; Strunk et al., 2001;
Nibu et al., 2003). In the case of Knirps, the CtBP-independent activity has been mapped
to an N-terrninal repression domain that lacks a CtBP-binding motif, does not bind CtBP
in vitro, and is able to repress in the absence of maternal CtBP (Keller et al., 2000).
Endogenous targets of Knirps display different requirements for CtBP. For example, the
even-skipped (eve) stripe 3/7 enhancer is regulated by Knirps in a CtBP-independent
fashion, whereas the eve stripe 4/6 enhancer shows loss of Knirps-mediated repression in
the absence of maternal CtBP (Struffi et a1. 2004). Moreover, a CtBP-dependent Knirps
target, such as the eve stripe 4/6, can be repressed by the N-terminus, CtBP-independent

repression domain of Knirps when this protein is provided at higher than normal levels

128

suggesting that CtBP may contribute quantitatively to Knirps repression (Struffi et al.
2004). Cell culture and transgenic embryos assays indicate that both the CtBP-dependent
and -independent repression activities of Knirps possess similar functional characteristics
with respect to activator specificity, distance dependence and overall potency, suggesting
that their activities might be mediated through similar pathways (Ryu and Arnosti, 2003;
Sutrias-Grau and Arnosti, 2004).

The ability of Knirps to repress without the contribution of CtBP might suggest
either the existence of additional cofactors that mediate short-range repression, or that the
Knirps proteins itself has an intrinsic ability to block transcription. Yeast two hybrid
analysis has not identified additional Knirps-interacting factors other than CtBP (Keller
and Arnosti, unpublished; Giot et al., 2003), therefore we employed biochemical
approaches to identify additional cofactors that interact with Knirps. Knirps is found in a
complex with apparent molecular size of ~450 kDa, suggesting that other factor/s in
addition to CtBP interact with Knirps. The histone deacetylase de3 (HDACl; De
Rubertis et a1, 1996) interacts with full-length Knirps during two rounds of affinity
purification and the two proteins copurify during gel filtration chromatography,
consistent with the hypothesis that Knirps and de3 are present in the same complex.
However, de3 does not interact with the N-terrninal, CtBP-independent repression
domain of Knirps (Knirps1-330), suggesting that the interaction is mediated either
through CtBP or via the C-terrninus of Knirps. Gene dosage assays suggest that knirps
and rpd3 functionally interact in vivo. Previous studies designed to test the contribution
of de3 in transcriptional repression during early Drosophila embryogenesis concluded

that this deacetylase was probably not essential for gap gene activity (Mannervick and

129

Levine, 1999). However, this study was based on a hypomorphic rpd3 mutant that
reduces, but not abolishes, rpd3 function. Consistent with this hypothesis, we found that
only when a null rpd3 mutant was used in gene dosage assays, a genetic interaction
between knirps and rpd3 was detected. Altogether, these results support the hypothesis

that histone deacetylation plays a role in short-range repression.

130

Materials and Methods

Transgenic flies carrying inducible, double-tagged Knirps genes. Details on the
generation of transgenic flies expressing either full-length Knirps (1-429) or the N-
terminal, CtBP-independent repression domain of Knirps (1-330) were reported
elsewhere (Struffi et al., 2004). Each protein is double-tagged, carrying an N-terminal
hexahistidine tag and a C-terminal double FLAG tag and is expressed under the control

of the hsp 70 promoter. Recombinant proteins are functional (Struffi et al., 2004) and can

be expressed in embryos older than ~2 hours (see Appendix B).

Heat-shocks. To induce expression of recombinant Knirps proteins, transgenic embryos
collected on apple-juice plates at room temperature (22-23°C) were incubated for 30
minutes at 38°C in a 10-liter water bath to ensure rapid and even heating. After induction,
embryos were immediately dechorionated and sonicated within 15 minutes from the end

of heat-shock.

Western blotting analysis. Irnmunoblotting was performed according to standard
protocols (Harlow and Lane, 1999) using a tank transfer system (Mini Trans-Blot® Cell,
Biorad 170-3930). Irnmun-BlotTM PVDF membranes (BioRad 162-0177) were used and
antibody incubation was in TBST (20 mM Tris-HCl, pH 7.5, 120 mM NaCl, 0.1%
Tween-20) supplemented with 5% (w/v) nonfat dry milk as blocking agent.
SuperSignal® West Pico Chemiluminescent substrate (Pierce 34080) was used for

detecting horseradish peroxidase (HRP) on immunoblots.

Antibodies. FLAG M2 monoclonal antibody (Sigma F3165) was used at 1:10,000

dilution. Rabbit polyclonal antiserum against Drosophila de3 (from D. Wassarman,

131

University of Wisconsin; Pile and Wassarman, 2000) was used at 1:5,000 dilution. Rabbit
polyclonal antiserum against Drosophila CtBP (dCtBP) was generated against full-length
dCtBP and used at 120,000 dilution. To generate this antiserum, recombinant full-length,
hexahistidine-tagged Drosophila CtBP (dCtBP 1-479) from pETleCtBPL vector was
expressed in E. coli BL21-CodonPlusTM RIL competent cells (Stratagene #230240) and
purified on Ni-NTA agarose beads (Qiagen 30210) according to the manufacturer’s
instructions. dCtBP protein (400ug) in 0.2 ml PBS buffer (1.9 mM NaHzPO4, 8.1 mM
NazHPO4, 154 mM NaCl, pH 7.2) was mixed with an equal volume of Titermax Gold
adjuvant (Sigma T2684) and injected subcutaneously at multiple sites in a New Zeeland
female rabbit. Two secondary boosts were performed similarly after 4 and 12 weeks.
Serum was prepared according to Harold and Lane (1999). Monoclonal antibody against
Drosophila HPl (C1A9) was obtained from the Developmental Studies Hybridoma Bank
(University of Iowa) and used at 1:2,000 dilution. Rabbit polyclonal antiserum against
Drosophila E(z) (from P. Harte, Case Western Reserve University) was used at 1: 1,000
dilution. Rabbit polyclonal antiserum against Drosophila Su(Var)3-9 (from T. Grigliatti,
University of British Columbia; Ner et al., 2002) was used at 1:5,000 dilution.
Monoclonal antibody against Drosophila Sir 2 (from S. Parkhurst, Fred Hutchinson
Cancer Research Center) was used at 1:500 dilution. Rabbit polyclonal antiserum against
Drosophila Brahma (from P. Venijzer, University of Leiden) was used at 1:1,000.
ImmunoPure® Goat Anti-Mouse HRP-conjugated antibody (Pierce 31430) was used at
1120,000 dilution. Goat Anti-Rabbit HRP-conjugated antibody (BioRad 170-6515) was

used at 1:10,000 dilution.

132

Drosophila embryo nuclear extract preparation. 0-12 hours embryos from hskni1-
429.3 were collected on grape juice plates from two population cages. For each
extraction, two 0-12 hour collections (the first one stored 12 hours at 13°C) were pooled
together. 20-40 grams of embryos were either dechorionated and processed immediately
or transferred on a 155-mm Petri dish and floated on a 38°C water bath for 60 min. Heat-
shocked embryos were recovered for 30 min at room temperature, prior to dechorionation
and homogenization. Drosophila standard nuclear extracts (DSNE) were made according

to Soeller et a1. (1988).

Co-immunoprecipitation (Co-1P) experiments. 200 pl of nuclear extracts (30 ug/ul of
total protein) from embryos overexpressing full-length Knirps were incubated overnight
at 4°C with 4 pl (4.9ug/ul) of oc-FLAG M2 monoclonal antibody or an equivalent
amount of a-IgG monoclonal antibody on a rotating wheel. One milliliter of washing
buffer (150 mM NaCl, 50mM Hepes pH 7.9, 0.5 mM EDTA, 10% glycerol, lmM DTT, 1
mM PMSF, lmM Na-metabisulfite, lmM benzamidine, IOuM pepstatin A) was added
and each sample was supplemented with 10 pl of pre-equilibrated protein G-agarose
beads (Cat. #16-266, Upstate) and incubated for 3 hours at 4°C on a rotator. Beads were
washed for four times (10 minutes each time) with 1 ml of washing buffer, resuspended

in Laemmli buffer, and boiled for 5 min at 95°C.

Lambda protein phosphatase (k-PPase) digestion. To test whether recombinant Knirps
is a phosphoprotein, crude embryo lysates were prepared from embryos expressing full-
length Knirps (hskni1-429.3) and subjected to treatment with increasing amounts of k-

PPase. For each reaction, 20 ul of crude embryo lysate (280 ug of total protein) from 2-4

133

hour hskni1-429.3 embryos subjected to 30 minutes heat-shock was incubated with 0, 20,
80, 400 or 1600 units of l-PPase (New England Biolabs, P0753S) in 1X X-PPase buffer
(50 mM Tris-HCl pH 7.5, 0.1 mM NazEDTA, 5 mM DTT, 0.01 % Brij 35) supplemented
with 2 mM MnClz, in a final volume of 50 ul. To limit the activity of endogenous
phosphatases, reactions were carried out at 4°C for 1 hour. To determine whether the
phosphatase activity was the result of h-PPase rather than due to endogenous activities,
20-mM sodium orthovanadate (Sigma, S-6508), a specific inhibitor of l-PPase, was
added to each reaction and incubated in the same conditions as described. Reactions were
stopped by the addition of Laemmli buffer immediately followed by incubation at 95°C
for 5 min. Proteins were resolved onto a 8% SDS-PAGE and recombinant Knirps was

detected by Western blot using anti-FLAG M2 antibody.

Double affinity purification of recombinant Knirps proteins. Although Knirps is
expressed maximally between two and four hours after the embryo has been laid,
microarray data from the Berkley Drosophila Genome Project (http://www.fruitfly.org)
indicate that the gene is expressed at relatively high levels also between 7 and 10 hours.
Therefore, for all affinity purification experiments we used 0-12 hour embryos collected
at room temperature (22-23°C). Embryos were heat-shocked for 30 min at 38°C as
described. 2-4 grams of dechorionated embryos were resuspended in 40 ml lysis buffer
(150 mM NaCl, 50 mM Hepes pH 7.9, 10% glycerol, 10 mM imidazole, 20 mM 13-
mercaptoethanol, 1 mM PMSF, 1 mM Na-metabisulfite, 1 mM benzamidine, 10 uM
pepstatin A) and sonicated using a Branson-250 Sonifier (4 cycles, 20-30 pulses/cycle,
output 6, duty cycle 60%, 3 min on ice between cycles, using a medium-tip). Lysates

were cleared by centrifugation (20 min at 27,000xg) and 2 ml of washed and pre-

134

equilibrated Ni-NTA agarose beads (His SelectTM HC Nickel, Sigma 6611) were added to
the supernatant. After 6 hours at 4°C on a rotating wheel, beads were washed three times
with 50 ml of lysis buffer supplemented with 20-mM imidazole and transferred to a 5-ml
tube. Proteins were eluted twice using 3 ml of lysis buffer supplemented with 150 mM
imidazole. The eluates were pulled together and diluted to 50 ml with 150 mM NaCl, 50
mM Hepes pH 7.9, 10% glycerol, 0.2 mM EDTA, 2 mM DTT, 1 mM Na-metabisulfite, 1
mM benzamidine, 10 uM pepstatin A, 1 mM PMSF. 2-300111 of Protein-G agarose beads
(Upstate, 16-266) covalently coupled with anti-FLAG M2 antibody (2 mg of antibody per
m1 of wet beads) were added to the solution and incubated for 12-18 hours at 4°C on a
rotating wheel. Beads were washed three times with 50 ml of the same buffer, transferred
to an eppendorf tube and proteins were eluted either with 0.5 ml of buffer supplemented
with 0.25 mg/ml of 3X FLAG® peptide (Sigma, F4799), or with 1.2 ml of buffer
supplemented with 0.2% sarkosyl (N-lauroyl-Sarkosine, Sigma L-5777). Protein samples
were TCA precipitated using 4 mg/ml Na-deoxycholate (deoxycholic acid, Sigma D-
6750) as carrier, resuspended in Laemmli buffer and boiled 5 min at 95°C. For each
purification experiment, one or two negative controls were used in parallel: either heat-
shocked, non-transgenic (yellow-white) embryos (yw), or, transgenic embryos from the

same line, that were not heat-shocked.

Chromatographic identification of the Knirps complex. To determine the apparent
molecular size of recombinant Knirps, whole-cell extracts from embryos expressing full-
length Knirps were subjected to gel filtration chromatography. 0-12 hour embryos from
hskni1-429.3 were heat-shocked 30 min and a crude lysate was prepared essentially as

described above, using a lysis buffer containing 100 mM NaCl, 50 mM Hepes pH 7.9,

135

5% glycerol, 0.1 mM EDTA, 1 mM DTT, 1 mM Na-metabisulfite, 1 mM benzamidine,
10 pM pepstatin A, and 1 mM PMSF. Lysates were centrifuged at 27,000xg for 20 min
and 300 pl of cleared lysate (6 mg of total protein) was loaded onto a pre-equilibrated
Superdex-200 HR 10/30 column (Amersham, 17-1088-01) and eluted with 1.5 volume of
lysis buffer at the flow rate of 0.4 ml/min using the AKTAexplorer 100 system
(Amersham). Fractions (0.5ml) were collected and analyzed by Western blot for the
presence of recombinant Knirps, CtBP and de3. The same column was loaded with size
markers (MW-GF-lOOO, Sigma) and run using identical conditions to determine in which

fractions the different markers elute.

Genetic interaction between knirps and rpd3. To test for a genetic interaction between
kni and rpd3, transheterozygous flies for kni and rpd3 were generated and the expression
pattern of the Knirps target gene even-skipped (eve) was monitored by in situ
hybridization. For each gene, two alleles were used to account for genetic variability.
kni9 (Bloomington stock #3332) carries a null mutation in Knirps and was previously
used to test a genetic interaction between kni and CtBP (Nibu et al. 1998). kni7G
(Tiibingen stock # Z334) is a loss of function mutation caused by a point mutation
(C48S) in the DNA binding domain (Gerwin et al. 1994). rpd304556 (Bloomington stock
11633) is a strong hypomorphic mutation caused by a P-element insertion in the 5’
untranslated region of rpd3 and results in a severe reduction in de3 expression
(Mannervik and Levine, 1999). rpd3d°m (kindly provided by Steward Frankel) is a null
allele caused by deletion of ~870 bp from the insertion point of the P-element in rpd304556
into the amino terminal coding region of the gene (Mottus et al., 2000); To distinguish

transheterozygous embryos (rpd3/102i) from single heterozygous one (kni/+ or rpd3/fl the

136

third chromosome was balanced with a ftz-lacZ marker (Bloomington stock 2055). A
double staining with digoxigenin-UTP-labeled eve and lacZ antisense RNA indicates the
transheterozygous embryos (which are not stained with lacZ) from the single

heterozygous that are stained with both probes giving a unique staining pattern.

137

Results

Recombinant Knirps is heavily phosphorylated in vivo.

In vivo expression of different domains of Knirps, monitored by Western blotting
using a-FLAG M2 antibody which recognizes the C-terminal epitope, leads to the
appearance of clusters of bands rather than discrete products (Struffi et al., 2004). In the
case of recombinant full-length Knirps (hskni1-429) these products span approximately
25 kDa (from ~55 to ~80 kDa; Fig 4-1, lane 2). Some of the higher molecular size
products were no longer detected after an overnight incubation of the extract at 4 °C in
the presence of protease inhibitors (data not shown), suggesting that the protein might be
post-translationally modified. A search for putative phosphorylation sites using
NetPhosZ.0 software (http://www.cbs.dtu.dk/services/NetPhos/) revealed 35 predicted
phosphorylation sites (29 serine and 6 tyrosine). To directly test whether recombinant,
full-length Knirps is phosphorylated in vivo, crude lysates from induced hskni1-429
embryos were incubated with increasing amounts of lambda protein phosphatase (7»-
PPase), in the absence or presence of sodium orthovanadate, a specific inhibitor of this
enzyme. it-PPase is a Mn2+-dependent protein phosphatase with activity towards
phosphorylated serine, threonine and tyrosine residues (Cohen and Cohen, 1989; Zhuo et
al, 1993). The presence of k-PPase caused the conversion of lower mobility products into
the fastest migrating species, which has a mass close to the predicted size for
recombinant Knirps (~51 kDa). The extent of this conversion depended on the amount of
enzyme present and the reaction was complete with a concentration of about 4 U/pg of

total protein (Fig. 4-1, lane 7). Importantly, at the highest concentration of enzyme, the

138

heatshock— ++ + +++++

 

Na3VO4 — - — — — — — 20 ZOmM
x-PPase - 0 5 20 80 40012004001200U
-.. . . ‘-250

—148

P98

III: II»
+ , .-

nonspecific» FFW~~-*--so

product

 

 

 

Figure 4-1: Recombinant, full-length Knirps is a phosphoprotein when expressed in

the Drosophila embryo.

2-4 hours embryos from a line carrying an hsp70-lmirps transgene (hskni1-429.3) were

heat-shocked for 30 minutes at 38°C to express double-tagged, full-length Knirps
proteins (lane 2-9) or left at room temperature (lane 1). A cross-reacting product (arrow)
serves as convenient marker for equal loading. Crude embryo lysates were incubated with

increasing amount of k-protein phosphatase (A-PPase) in the absence (lane 1-7) or
presence (lane 8-9) of a lt-PPase inhibitor, sodium orthovanadate (Na3VO4). Extracts
were resolved on an 8% SDS-PAGE and a Western blot was performed using or-F LAG

M2 monoclonal antibody, which recognizes Knirps C-teminal epitope tag.

139

reaction was completely inhibited by the presence of 20mM sodium orthovanadate (Fig.
4-1, lane 9), suggesting that h-PPase, rather than other endogenous factors, was
responsible for this effect. Altogether, these results indicate that recombinant Knirps is
heavily phosphorylated in vivo. It is possible that the endogenous protein might be as

well, but we have not investigated this possibility yet (see discussion).

Knirps is present in a ~450 kDa complex.

To test whether Knirps interacts with additional factor/s other than dCtBP, gel
filtration chromatography was performed using whole cell extracts from embryos
expressing recombinant full-length Knirps. Although is not known whether endogenous
Knirps is able to dimerize, dimerization is not required for DNA binding (Gerwin et a1,
1994). Drosophila CtBP (dCtBP) is expressed throughout embryogenesis in two major
forms (CtBPkmg and CtBPshon) with apparent molecular masses of ~42 and ~50 kDa
respectively (Appendix A). It is not known whether Knirps interacts with both CtBP
forms, but in vivo assays indicate that both forms are able to mediate repression (Sutrias-
Grau and Arnosti, 2004). The mammalian homolog of dCtBP],mg was recently crystallized
as a dimer (Kumar et al., 2002). Therefore, if recombinant Knirps interacts exclusively
with a CtBP dimer, the complex should have a molecular mass of ~150-180 kDa. Gel
filtration chromatography was performed using 0-12 hours embryos expressing full-
length, double-tagged Knirps protein (with molecular mass of ~55-80 kDa). Recombinant
Knirps eluted predominantly in fraction 17-19 with a peak in fiaction 18 (Fig. 4-2A),

which corresponds to an apparent molecular size of ~450 kDa, along with both forms of

140

‘— 2 MDa
‘— 443 KDa
"- 200 KDa
‘— 150 KDa
‘— 29 KDa

a
D
X
or
8
l
4

16 18 20 22 24 6 28 30 32 34

A\inp1o121

-64
Knirps
N. -50
*‘ -. - - - ~ .-I ~-
a-FLAG —36
. to no N 00.- u -64
. -50
‘s
a-de3

mp 10 12 14 16 18 20 22 24 26 28 30 32 34

Figure 4-2: Recombinant Knirps is present in a ~450 kDa complex.

A. Recombinant, full-length Knirps elutes during gel filtration chromatography with an
apparent molecular mass of ~450 kDa. Gel filtration chromatography was performed
using crude embryo lysates from 0-12 hour embryos expressing FLAG-tagged, frill-
length Knirps. Every other fraction, starting with fraction 10, was resolved on a 10%
SDS-PAGE, proteins were transferred onto a PVDF membrane and the blot was probed
with monoclonal or-FLAG M2 antibody. Recombinant Knirps (bracket) eluted
predominantly in fraction 18, which correspond to an apparent molecular mass of ~450
kDa. The asterisk indicates a non-specific product also present in non-transgenic
embryonic extracts (data not shown). B. The histone deacetylase de3 (HDAC 1) co-
fractionates with Knirps during gel filtration chromatography. Fractions collected from
the same experiment as in A were probed using a polyclonal antibody against de3. The
peck fraction for Knirps (fraction 18) also contains de3.

Size markers ran in the same conditions eluted as indicated on the top.

141

dCtBP (data not shown). We could detect a limited amount of recombinant Knirps
protein also in fraction 20-29 (data not shown) suggesting that the majority of protein is
part of the same complex and very little is present as free monomer. The apparent
molecular mass for the Knirps complex as determined by gel filtration chromatography is
well above the predicted size of a Knirps-CtBP complex, suggesting the presence of

additional cofactors.

Double affinity purification of recombinant Knirps expressed in embryos.

To identify additional factors that may interact with Knirps we developed a
tandem affinity purification scheme using transgenic flies that carry inducible, double—
tagged knirps genes. Recombinant, full-length Knirps was previously found to act as a
functional repressor in vivo, as judged by the ability of the protein to repress several
endogenous Knirps targets, as well as integrated eve-lacZ reporter genes, in a dose-
dependent manner (Struffi et al., 2004). Recombinant Knirps proteins expressed in
embryos did not reach high enough levels to detect differences in the Coomassie-stained
protein profile of crude extracts after 30 minutes of heat-shock induction (data not
shown). However, recombinant Knirps protein is detected after just 5 minutes of heat-
shock induction by immunoblotting using a-F LAG M2 monoclonal antibody (Struffi et
a1. 2004), due to the enhanced detection achieved with double FLAG-tagged proteins
(Heman et al, 2000). The majority of recombinant, full-length Knirps (~80% of the
input) did bind to Ni-NTA agarose in batch purifications as determined by quantitation of
Western blots using a Fluor-S® MultiImager (Biorad), although this is not apparent from

the fixed-time exposure shown in Fig. 4-3B, where lanes 1 and 2 seem to contain

142

Figure 4-3: Double affinity purification of recombinant, full-length Knirps from
crude embryo lysates.

The starting material for the tandem affinity purification (INl) was a crude lysate from
embryos expressing double-tagged, full-length Knirps (lane 1). Proteins were bound in
batch purifications to Ni-NTA beads and eluted in three successive elutions using 150
mM imidazole (El-3). Irnidazole eluates were pooled, diluted ten times and used as
starting material for the second affinity purification (INZ). Proteins were bound in batch
purifications to or-F LAG M2-Protein G beads and eluted in three successive steps using
0.2% sarkosyl (SI-3). Fractions from each purification step were resolved on 4-12% Nu-
PAGE gels (Invitrogen) and transferred to PVDF membrane for Western blotting.

A. Coomassie-stained gel of fractions from the Ni-NTA purification (lane 1-9) shows a
clear decrease in protein complexity after a single purification step (compare lane 1 with
6). Silver-stained gel of fractions from the a-FLAG purification (lane 10-18) shows an
additional simplification of the protein profile. B. Knirps tandem affinity purification.
Western blot of fractions as in A, using a-FLAG M2 monoclonal antibody. Recombinant
Knirps (arrow) was able to bind to both affinity matrices (lane 6-8 and 15-17). The IgG
light chain is indicated (asterisk). C. Profile of CtBP in the Knirps double affinity
purification. Western blot of fractions as in A, using a rabbit antiserum against dCtBPL,
that recognizes both the long- (L) and short-form (S) of CtBP. Both forms of CtBP
copurify together with Knirps during two rounds of affinity purifications (lane 15-16).

1N1, input first affinity purification; FTn, flow-through Ni-NTA beads; Wl-3, wash 1-3;
E1, first imidazole elution; E2, second imidazole elution; E3, third imidazole elution; nB,
Ni-NTA beads after three imidazole elutions; IN 2, input second affinity purification; FTf,
flow-through FLAG beads; W4-6, wash 4-6; S1, first elution with sarkosyl; S2, second
elution with sarkosyl; S3, third elution with sarkosyl; fB, FLAG beads after three
sarkosyl elutions.

Lane 1 corresponds to 50pg of total protein. Lane 1-5, ~0.007% of the original sample.
Lane 6-8, ~0.13% of the original sample. Lane 10-14, ~0.16% of the original sample.
Lane 15-18, ~0.08% of the original sample.

143

elm
undm

12 151

on: F1:
‘ 550:6
er 113‘

Ni-purification

FLAG-purification

 

IN1FTnW1 W2 W3 E1 E2 E3 nB

IN2FTfW4W5W6$1 S2 83 fB

 

 

 

 

 

 

 

 

 

 

 

 

A : ' H E 7
_ '. 1.,, 3% ._ T."
-._ M :-
»- <4
. - .. 2:...
188— ’ ' i —188
398- "" ' "I!” -98
62- ' ‘ g... ..' ' -62
~- ~ 4-
49- -49
33- -38
28- -‘~-*-28
17- -17
188— -188
98— -98
62- —62
L>49_ --—- -—-- “ ‘ ' "" -49
8'38_..’ -_-_ _ - -38
28— -28
17- -17
123456789 101112131415161718

Figure 4-3: Double affinity purification of recombinant, full-length Knirps from
embryo lysates.

comparable amounts of Knirps protein. This first purification step was quite efficient in
reducing the complexity of the protein profile (Fig. 4-3A, lane 6, compared with l), but
the pattern was still too complex to detect differences between samples before and after
heat-shock (data not shown). Approximately 50% of the total Knirps protein (starting
material of first affinity purification equal to 100%) was recovered after the Ni-NTA
purification. After the second affinity purification step, using orFLAG-ProteinG agarose
beads, approximately 10-20% of the total recombinant Knirps could be recovered with
two elutions with buffer supplemented with 0.2% sarkosyl. Recombinant Knirps was not
detected in fractions obtained from non-induced transgenic embryos or heat-shocked yw
embryos, which served as negative controls. FLAG peptide elution of double affinity-
purified Knirps was inefficient and, starting with 2-4 grams of embryos, we were below
the detection limits of silver staining (data not shown). Therefore, we used the detergent
sarkosyl to elute bound material after the second affinity purification. Sarkosyl elution
was efficient in releasing recombinant Knirps protein bound to FLAG beads (Fig. 4-3B,
lane 15-17), but it also elutes other proteins, which probably bind to the beads non-
specifically, resulting in a quite complex protein profile (Fig. 4-3A, compare lane 15 with
10).

To determine whether the affinity purification protocol used was suitable to retain
Knirps-interacting factors, we tested whether the corepressor CtBP was co-purifying
together with recombinant Knirps protein during both purification steps. Indeed, both
forms of CtBP co-purified with recombinant Knirps (Fig. 4-3C) and were not detected in

fractions from heat-shocked, non-transgenic yw embryos (data not shown), suggesting

145

that this purification protocol is suitable to detect protein-protein interactions that occur

under physiological conditions.

Histone deacetylase de3 co-purifies with recombinant, full-length Knirps.

Limiting amount of embryos expressing recombinant Knirps forced us to take a
candidate approach for the identification of Knirps-interacting factors. Proteins
implicated in transcriptional repression and gene silencing in Drosophila include
methyltransferases such as Su(Var)3-9 (Ner et al. 2002; Shotta et al., 2002) and E(z)
(Carrington and Jones, 1996; Laible et al. 1997), histone deacetylases including de3
(Chen et al. 1999) and Sir2 (Rosenberg et al. 2002), and ATP-dependent nucleosome
remodeling factors such as Brahma (Elfring et al. 1998; Kal et al., 2000). To test whether
any of these proteins interact in vivo with Knirps, we performed immunoprecipitation
experiments using or-F LAG M2-beads and nuclear extracts prepared from embryos
expressing FLAG-tagged, full-length Knirps. FLAG-bound proteins were resolved on
10% SDS PAGE gels, transfer to PVDF membranes and subjected to Western blotting
analysis using antibodies against each of the above factors (Fig. 4-4A, and data not
shown). de3 was consistently immunoprecipitated using or-FLAG M2-beads, but not or-
IgG-beads (Fig. 4-4A, lane 4 versus 5). To confirm this interaction we performed tandem
affinity purification experiments using transgenic embryos expressing double-tagged,
full-length Knirps (hsp70-knirps1 -429.3 embryos after heat shock; Fig. 4-4B). As
negative controls, double-affinity purifications were performed in parallel using the same
amount of material from heat-shocked, non-transgenic embryos (yellow white MD, as

well as from non-induced, transgenic embryos (hsp 70-kni 1-429.3 non heat-shocked;

146

Figure 4-4: Histone deacetylase de3 (HDAC 1) copurifies with full-length Knirps.

A. de3 co-immunopurifies with or-FLAG antibody (lane 4), but not or-IgG antibody
(lane 5) from embryonic nuclear extracts overexpressing recombinant full-length Knirps.
Nuclear extracts from transgenic embryos expressing FLAG-tagged, full-length Knirps
were immunoprecipitated using a-FLAG M2-Protein G-beads. F LAG-bound material
was resolved on a 10% SDS-PAGE gel, proteins were transferred to a PVDF membrane
and Western blotting was performed using a polyclonal antibody against Drosophila
de3.

B. de3 copurifies with recombinant, full-length Knirps during tandem affinity
purification. Crude extracts from embryos expressing double-tagged, full-length Knirps
were subjected to two successive affinity purification steps (as described in Fig. 4-3).
Fractions from each purification step were subjected to Western blotting using a-de3
(fractions are as in Fig. 4-3). After two affinity purifications, fractions that contained
recombinant Knirps (SI-S2; see Fig. 4-3B) also contained de3 (Fig. 4-4B, lane 15-16).

C. After double-affinity purification, de3 is present exclusively in fractions that express
recombinant, full-length Knirps. Tandem affinity purification experiments were
performed in parallel using equivalent amounts of embryos expressing double-tagged,
full-length Knirps (kni 1-429 after heat shock; lane 3 and 6) or not expressing Knirps
(yellow white (yw) after heat shock [lane 1 and 4]; non heat-shocked kni1-429 [lane 2 and
5]). After the second affinity purification, F LAG-bound materials were eluted using 0.2%
sarkosyl and resolved on 10% SDS-PAGE gels, proteins were transferred to a PVDF
membranes and Western blotting was performed using a monoclonal antibody against
FLAG (lane 1-3) or a polyclonal antibody against Drosophila de3 (lane 4-6). de3 is
detected only in the sarkosyl eluates from embryos that express recombinant, full-length
Knirps (lane 6), but not in the eluates from the two negative controls (lane 4-5).

147

A Huge

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

25
14
a-de3
98-
54.. ~ .. .._. ..4 . 4—
50—4
I'pl.
“..- *
36w ..
did“; 1 2 3 4 5
iii; B Ni-purification FLAG-purification
.22: IN1FTnW1W2W3E1 E2 E3 nB |N2FTfW4W5W6$1 S2 SafB
15:-.1: 188- '
Ill} 98-
62— -- — —— ‘- -— {—
rt‘irt' 49-
19-2? 38-
;th 28-
LR.)- 17_ . (l-FLAG
“$3“ 12345 6789 101112131415161718
(.101
31,3155 yw kni1-429 yw W
m + _ + + — + heat-shock
2:31 C 250- _ -250
m 148- —148
5311‘:
girl“: 98 d — 98
m:
2:55“ 64- i I h‘ '54
rpi‘t
Jet-'5 50" -50
cm
36- --- . ; ; -36
1 2 3 4 5 6
or-FLAG oc-de3

Figure 4-4: Histone deacetylase de3 (HDAC 1) copurif'res with full-length Knirps.

148

Fig. 4-4C). After two successive purification steps, de3 was detected only in samples
expressing recombinant Knirps, but not in the two negative controls (Fig. 4-4C, lane 3
versus 1-2). Altogether, these results suggest that de3 physically interacts, directly or
indirectly, with full-length Knirps. If the two proteins are present in the same complex,
they should also co-fractionate during gel filtration chromatography. Consistent with this
hypothesis, fraction 18 where the majority of recombinant Knirps eluted, also contained
de3 (Fig. 4-2B). The majority of de3 eluted in fraction 26, which correspond to the
monomeric form, but significant amounts were also present in higher molecular size
fractions, consistent with the possibility that the protein is part of many different

complexes.

de3 does not interact with the N-terminal, CtBP-independent repression domain
of Knirps.

Mammalian CtBP has been shown to interact with the histone deacetylase HDAC 1
(Shi et al. 2003). Therefore, it is possible that the Knirps-de3 interaction we detected
during our tandem affinity purification experiments is an indirect interaction mediated
through dCtBP. To test this hypothesis, we performed double affinity purification
experiments using transgenic embryos expressing the N-terminal, CtBP-independent
repression domain of Knirps (Fig. 4-5). Neither forms of dCtBP bound to double-tagged
Knirps 1-330 and both were quantitatively lost in the flow-through from the Ni-NTA
column (Fig. 4-5B). Some de3 was able to bind to Ni-NTA agarose beads, however,
and this material was efficiently eluted with imidazole and was present in the input of the

second affinity purification (Fig. 4-5C, lane 5). The affinity of de3 for Ni-NTA

149

Figure 4-5: de3 does not copurify with the N-terminal, CtBP-independent
repression domain of Knirps during double-affinity purification.

Tandem affinity purification experiments were performed using crude extracts from
embryos expressing double-tagged, Knirps 1-330. Fractions were resolved on a 10%
SDS-PAGE, transferred to a PVDF membrane and Western blotting was performed using
antibodies against FLAG (A), CtBP (B), and de3 (C). Fractions are as in Fig. 4-3.

A. Double affinity purification of Knirps 1-330. The N-terminal, CtBP-independent
repression domain of Knirps was expressed by heat shocking embryos carrying an hsp 70-
knirps 1-330 transgene for 30 minutes. Crude extracts (lane 1) were first bind to Ni-NTA-
agarose beads and eluted with imidazole (lane 3). Irnidazole eluates were pooled (lane 5)
and bound to orFLAG M2-Protein G agarose beads. F LAG-bound material was eluted
with sarkosyl (lane 7-8). B. CtBP does not interact with Knirps 1-330. Both forms of
CtBP were quantitatively lost in the flow-through of the first affinity column (lane 2,
compare with 1). C. de3 does not interact with Knirps 1-330. Some de3 is able to bind
to the Ni-NTA column and is eluted with imidazole (lane 3). However, this material is
unable to efficiently bind to or-FLAG beads and is present in the flow-through of the
second affinity column (lane 6).

Lane 1-2, ~0.16% of the original sample. Lane 3, ~0.3% of the original sample. Lane 4,
~0.2% of the original sample. Lane 5-9, ~20% of the original sample.

150

Ni-purification FLAG-purification

 

IN1 FTn E1 118 |N2 F“ 81 82 f3

250- 1 l
143- '

A or-F LAG

98--i

 

H

50- _..-h,,fi_fldv‘ «Kni1-330
36-

ndert

 

 

250-
148-

5 m B Ot-CtBP

a 11?; 98 -

9‘ SO- - - ‘ CtBPL

- _- 4 CtBPs
3.11.1. 36-

 

 

 

m 33 250-
111:5 I. 148-

10535
1511215 C 98- OC'RPd3

 

 

 

Figure 4-5: de3 does not copurify with the N-terminal, CtBP-independent
repression domain of Knirps during double-affinity purification.

151

agarose beads was also observed using extract from non heat-shocked transgenic
embryos carrying an hsp 70-knirps1-429.3 transgene (data not shown), suggesting it is not
dependent by the presence of Knirps 1-330. However, de3 was unable to bind to CL-
FLAG beads when extracts expressing double-tagged, Knirps 1-330 were used (Fig. 4-
5C, lane 7-8). These results are consistent with the hypothesis that de3 directly interacts

with CtBP or with the C-terrninus of Knirps.

rpd3 genetically interacts with knirps

To test whether rpd3 genetically interacts with kni, we generated
transheterozygous embryos for both genes (rpd3/kni) by crossing two heterozygous flies
(kni/+ and rpd3/+) and determining the expression pattern of eve in blastoderm embryos
from the singly heterozygous parents as well as from the doubly heterozygous F.
embryos. To determine whether the results obtained were allelic-specific, we chose two
alleles for each gene and checked all four combinations. In order to distinguish
transheterozygous embryos from singly heterozygous embryos, the third chromosome
was balanced with a ftz-lacZ reporter and the F1 embryos obtained by crossing the two
singly heterozygous parents were hybridized with digoxigenin-labeled antisense mRNA
for eve and lacZ. Embryos heterozygous for each rpd3 allele (rpd304556/+ and
rpd3dcm/+) showed a normal eve expression pattern (Fig. 4-6A and data not shown).
Control embryos obtained from the mating of kni9/+ or kni7G/+ males with normal (yw)
females showed a reduction or complete repression of eve stripe 5 expression in

approximately 10% of the embryos (Fig. 4-6B and data not shown). This effect is

152

eve

 

kni9/+

rpd3A24lkni9

 

Figure 4-6: Genetic interactions between rpd3 and knirps.

Embryos that are heterozygous for the rpd3d‘fl‘ null mutation (rpd3‘m/+) exhibited a
normal even-skipped (eve) expression pattern (A). Embryos that are heterozygous for the
kni9 null mutation (kni9/+) exhibited reduced or complete repression of eve stripe 5
expression (B) in approximately 10% of the embryos. F1 embryos obtained by mating kni
heterozygous males with rpd3‘m heterozygous females showed derepression of eve stripe
4/6 expression (C).

Embryos were hybridized with digoxigenin-labeled eve antisense RNA (A—C) and
digoxigenin-labeled lacZ antisense RNA (C), and visualized by histochemical staining.

153

probably indirect, since eve stripe 5 does not have predicted binding sites for Knirps
(Clyde et a1, 2003). F1 embryos obtained by mating rpd3d‘fl4 heterozygous males (or
females) with kni9 heterozygous females (or males) showed fusion of eve stripe 4-6 (Fig.
4-6C). Similar results were obtained with rpd3defl4/kni7G transheterozygous embryos
(data not shown), suggesting that these results are not allele-specific. Derepression of eve
stripe 4/6 did not allow determining whether eve stripe 5 expression is also affected in the
doubly heterozygous embryos. F1 embryos obtained by mating rpd305446 heterozygous
females with kni9 or kni7G heterozygous males did not show alteration of the eve pattern
(data not shown). These results may reflect different levels of de3 protein in the two

d305446

alleles tested, since rpd3d‘fl4 is a null and rp is a hypomorphic allele.

154

Discussion

In order to identify functionally-relevant Knirps cofactors, we took a biochemical
approach and employed recombinant Knirps proteins expressed in the embryo as affinity
matrixes. To this goal, we created transgenic flies that carry double-tagged versions of
Knirps (the full-length protein, Knirpsl-429, and the N-terrninal, CtBP-independent
repression domain, Knirspl-330) under the control of the heat-shock inducible, hsp70
promoter. Upon heat shock of such transgenic embryos, Knirps is expressed ubiquitously
throughout the embryo and induction can be achieved at the blastoderm stage, when
endogenous Knirps is maximally expressed (Struffi et al., 2004). Recombinant Knirps
proteins are functional as judged by their ability to repress several endogenous Knirps
targets including eve, hairy, rant and hunchback (Struffi et al., 2004). The recombinant
proteins are double-tagged (hexahistidine-tagged at the N-terminus and double FLAG-
tagged at the C-terminus) allowing the use of affinity purification methods to purify
Knirps-interacting factors.

First, we found that recombinant, full-length Knirps expressed in the embryo is
heavily phosphorylated (Fig. 4-1). All recombinant Knirps proteins tested, which include
Knirps 1-330, Knirps 75-330, Knirps 75-429 and Knirps 1-429, appeared to be
phosphorylated when expressed in vivo (Fig. 4-1 and data not shown). Knirps is not
known to be post-translationally modified, but it has 35 predicted phosphorylation sites.
Unfortunately, the poor quality of available Knirps antibodies for Western blotting
analysis precluded us from testing whether the endogenous Knirps protein is

phosphorylated as well. The short-range repressor Giant, when overexpressed in

155

Drosophila embryos, was also found to be phosphorylated, but the functional relevance
of this modification in Giant-mediated repression was not investigated (Capovilla et al.,
1992). A recent study of the mammalian homolog of the Drosophila short-range
transcriptional repressor Snail showed that phosphorylation regulates the subcellular
localization and activity of this repressor (Dominguez et al., 2003). Testing whether
endogenous Knirps is phosphorylated and whether this post-translational modification
plays a role in Knirps repression was beyond the scope of this work and was not pursued
further.

To test whether Knirps interacts with other co-factors in addition to CtBP, we
determined the apparent molecular mass of the Knirps complex by gel filtration
chromatography using crude embryonic extracts expressing recombinant, full-length
Knirps. The apparent size of the complex is ~450 kDa, well above the expected size of a
Knirps-CtBP complex (Fig. 4-2A). This result is the first indication that the short-range
repressor Knirps may interact with additional factors other than CtBP. The majority of
recombinant Knirps was found in the high molecular weight fraction (fraction 18), and
very low amounts eluted as a free monomeric form (expected to elute in fraction 26-28).
This unexpected result could be explained assuming that the recombinant protein is
expressed at relatively low levels compared to its associating factors. Gel filtration
chromatography separates proteins not only according to their mass, but also according to
their shape, therefore, we should take these results as an indication, rather than a proof,
that the size of the Knirps complex is around 450 kDa.

The double affinity purification protocol we developed is suitable for detecting

physiologically relevant interactions, since we were able to co-purify CtBP together with

156

Knirps along each step of the tandem affinity purification (Fig. 4-3B, C). We found that
both forms of CtBP have the ability to bind to full-length Knirps (Fig. 4-3C) and are
present together with Knirps in the same fractions during gel filtration chromatography
(data not shown). It is not known whether endogenous Knirps interacts with both CtBP
forms, but in vivo repression assays using Gal4-CtBPkmg and Gal4-CtBPshon, indicate that
both forms are able to mediate similar levels of repression (Sutrias-Grau and Amosti,
2004). The unbiased identification of Knirps-interacting factors will involve mass
spectrometry analysis of peptide-eluted material from double affinity purification of
embryo expressing full-length Knirps versus embryos that are not expressing the
recombinant protein (either because non transgenic or because Knirps was not induced).
These experiments are in progress, but in the meantime we took a candidate approach and
tested whether several proteins that have been involved in transcriptional repression were
present in fractions enriched for Knirps. Embryonic nuclear extracts overexpressing
recombinant, full-length Knirps were immunoprecipitated using or-FLAG and probed
using a panel of antibodies (see material and methods for the antibodies tested; data not
shown). The histone deacetylase de3 (HDAC 1; De Rubertis et al., 1996) was
consistently found in the F LAG-bound fraction (Fig 4-4A). Only a minority of de3 did
bind to Knirps, which was in part expected, since de3 is an abundant protein and it is
probably present in several different complexes. We could unambiguously detect an
de3-Knirps interaction only when the immunoprecipitation experiments were
performed using nuclear extracts prepared from embryos overexpressing recombinant
full-length Knirps (Fig. 4-4A), but not when crude embryo lysates overexpressing Knirps

were used (data not shown). This is probably due to the low levels of expression of

157

recombinant Knirps. We confirmed this interaction by testing whether de3 was
copurifying together with Knirps during double affinity purification experiments. de3
was detected in the bound fraction after two rounds of affinity purification only when the
starting material contained recombinant full-length Knirps, but not from two different
negative controls (Fig. 4-C). Gel filtration chromatography supports the hypothesis that
Knirps and de3 interact, since both proteins eluted in the same chromatographic
fraction (Fig. 4-ZB).

Mammalian CtBP l was recently found to interact with HDAC 1 (Shi et al.,
2003), therefore we tested whether de3 was interacting with Knirps indirectly, through
CtBP. Double affinity purification experiments were carried out using embryos
overexpressing the N-terminal, CtBP-independent domain of Knirps. Although able to
bind (non-specifically) to Ni-NTA agarose beads, de3 was quantitatively lost during the
second affinity purification, suggesting that the de3-Knirps interaction is mediated
either through the C-terrninal domain of Knirps or via CtBP (Fig. 4-5).

Previous analysis of gene expression in Drosophila embryos lacking maternal
rpd3 concluded that this deacetylase was not required for short-range repression
(Mannervik and Levine, 1999). However, we found that knirps genetically interacts with
rpd3 (Fig. 4-6). This interaction is detectable only when a null mutant for each gene is
used, and also in this case the effects observed are not as severe as a complete loss of
knirps function, suggesting that de3 contributes only partially to Knirps activity. In their
analysis, Mannervik and Levine used a hypomorphic allele for rpd3 (rpd304556) which
also in our hands did not show appreciable interaction with two different kni null alleles.

Therefore, it is likely that low de3 levels in the md30455 mutant are still sufficient to

158

maintain Knirps firnction and only when the de3 level is further reduced (as in the

e124 mutant), it is possible to detect a genetic interaction with knirps. These results

rpd
suggest that de3 contributes to Knirps-mediated repression. Although additional
experiments are required to test the molecular basis behind the genetic interaction we
observed between knirps and rpd3, it is plausible to assume that histone deacetylation is
involved in short-range transcriptional repression mediated by Knirps. Whether de3
plays a role in the'repression activity of other Drosophila short repressors remain to be
determined. However, if deacetylation contributes to short-range repression, this
chromatin modification must be localized to a single nucleosome, since the range of
activity for short range repressors is about 100-150 bp. Yeast de3 is capable of targeting
deacetylation to a single nucleosome (Deckert and Struhl, 2002). Therefore, it would be
important to determine the acetylation state of the chromatin surrounding Knirps target
sites in the presence and absence of the repressor.

Our data supports the hypothesis that de3 is recruited to Knirps indirectly
through the corepressor CtBP (Fig. 4-5) and this interaction is important for Knirps-
mediated repression (Fig 4-6). However, de3 was previously found to functionally
interact with the Groucho corepressor (Chen et a1, 1999), which mediates long-range
transcriptional repression (Paroush et al., 1994; Fisher and Caudy, 1998). Since both
short- and long-range transcriptional repressors interact with de3, what dictates the
range of repression activity? Groucho is able to form high-order oligomers (Chen et al.,
1998) and oligomerization was recently shown to be essential for Groucho-mediated
repression (Song et al., 2004). The ability to polymerize may perhaps allow the

corepressors to spread along the chromatin template recruiting histone deacetylases

159

 

 

and/or other chromatin modifying activities to a large domain, whereas short-range
repressors may lack the capacity to spread. Alternatively, short- and long-range
repressors may recruit specific factor/s which in turn dictates the range of activity over

which the repressor is able to function.

Acknowledgments

We thank David Wassarman, Peter Harte, Susan Parkhurst, Thomas Grigliatti, Peter
Verrijzer, and the Developmental Studies Hybridoma Bank (University of Iowa) for
providing antibodies. Many thanks to the Bloomington and Tiibingen stock centers and to
Steward Frankel and Norbet Perrimon for providing fly stocks. Zakir Ullah prepared the
gel filtration column used during this study and helped in determining the size of the
Knirps complex. P.S thanks Heather Hirsh, Craig Hinkley and Bill Henry for many
suggestions on protein purification. This work was supported by grant NIH GM56976 to

D.N.A.

160

References

Arnosti D.N., Gray S., Barolo S., Zhou J., and Levine M. (1996). The gap protein
knirps mediates both quenching and direct repression in the Drosophila embryo. EMBO
J. 15: 3659-3666.

Balasubramanian P., Zhao L.J., and Chinnadurai G. (2003). Nicotinamide adenine
dinucleotide stimulates oligomerization, interaction with adenovirus EIA and an intrinsic
dehydrogenase activity of CtBP. FEBS Lett. 537: 157-160.

Barolo S., and Levine M. (1997). hairy mediates dominant repression in the Drosophila
embryo. EMBO J. 16: 2883-2891.

Capovilla M., Eldon E.D., and Pirrotta V. (1992). The giant gene of Drosophila
encodes a b-ZIP DNA binding protein that regulates the expression of other segmentation
gap genes. Development 114: 99-112.

Cai H.N., Arnosti D.N., and Levine M. (1996). Long-range repression in the
Drosophila embryo. Proc. Natl. Acad. Sci. USA 93: 9309-9314.

Carrington E.A., and Jones RS. (1996). The Drosophila Enhancer of zeste gene
encodes a chromosomal protein: examination of wild-type and mutant protein distribution
Development 122: 4073-4083.

Chen G., Fernandez J., Mische S., and Courey A.J. (1999). A functional interaction
between the histone deacetylase de3 and the corepressor groucho in Drosophila
development. Genes & Dev. 13: 2218-2230.

Chen G., Nguyen P.B., and Courey A.J. (1999). A role for Groucho tetramerization in
transcriptional repression. Mol. Cell. Biol. 18: 7259-7268.

Chinnadurai G. (2002). CtBP, an unconventional transcriptional corepressor in
development and oncogenesis. Mol. Cell 9: 213-224.

Clyde D.E., Corado M.S.G., Wu X., Pare A., Papatsenko D., and Small S. (2003). A
self-organizing system of repressor gradients establishes segmental complexity in
Drosophila. Nature 426: 849-853.

Cohen P.T.W., and Cohen P. (1989). Discovery of a protein phosphatase activity
encoded in the genome of bacteriophage lambda. Probable identity with open reading
frame 221. Biochem. J. 260: 931-934.

161

 

 

Courey A.J., and Jia S. (2001). Transcriptional repression: the long and the short of it.
Genes & Dev. 15: 2786-2796.

Deckert J., and Struhl K. (2002). Targeted recruitment of de3 histone deacetylase
represses transcription by inhibiting recruitment of Swi/Snf, SAGA, and TATA binding
protein. Mol. Cell. Biol. 18: 6458-6470.

De Rubertis F., Kadosh D., Henchoz D., Pauli D., Reuter G., Struhl K., and Spierer
P. (1996). The histone deacetylase de3 counteracts genomic silencing in Drosophila
and yeast. Nature 384: 589-591.

Dominguez D., Montserrat-Semis B., Virgos-Soler A., Guaita S., Grueso J., Porta
M., Puig I., Baulida J., Franci C., and Garcia de Herreros A. (2003). Phosphorylation
regulates the subcellular location and activity of the Snail transcriptional repressor. Mol.
Cell. Biol. 23: 5078-5089.

Elfring L.K., Daniel C., Papoulas 0., Deuring R., Sarte M., Moseley S., Beek S.J.,
Waldrip W.R., Daubresse G., DePace A., Kennison J.A., Tamkun J.W. (1998).
Genetic analysis of brahma: the Drosophila homolog of the yeast chromatin remodeling
factor SW12/SNF2. Genetics 148: 251-265.

Fisher A.L., and Candy M. (1998). Groucho proteins: transcriptional corepressors for
specific subsets of DNA-binding transcription factors in vertebrates and invertebrates.
Genes & Dev. 12: 1931-1940.

Fujioka M., Emi-Sarker Y., Yusibova G.L., Goto T., and Jaynes J.B. (1999).
Analysis of an even-skipped rescue transgene reveals both composite and discrete
neuronal and early blastoderm enhancers, and multi-stripe positioning by gap gene
repressor gradients. Development 126: 2527-2538.

Fujioka, M., Yusibova, G. L., Patel, N. H., Brown S. J. and Jaynes, J. B. (2002). The
repressor activity of Even-skipped is highly conserved, and is sufficient to activate

engrailed and to regulate both the spacing and stability of parasegrnent boundaries.
Development 129: 441 1-4421.

Gerwin N., La Rosee A., Sauer F., Halbritter H. P., Neumann M., Jilckle H., and
Nauber U. (1994). Functional and conserved domains of the Drosophila transcription
factor encoded by the segmentation gene knirps. Mol. Cell. Biol. 14: 7899-7908.

Giot L., Bader J.S., Brouwer C., Chaudhuri A., Kuang B., Li Y., Hao Y.L., Ooi
C.E., Godwin B., Vitols E., Vijayadamodar G., Pochart P., Machineni H., Welsh M.,
Kong Y., Zerhusen B., Malcolm R., Varrone Z., Collis A., Minto M., Burgess S.,
McDaniel L., Stimpson E., Spriggs F., Williams J., Neurath K., Ioime N., Agee M.,
Voss E., Furtak K., Renzulli R., Aauensen N., Carrolla S., Bickelhaupt E.,
Lazovatsky Y., DaSilva A., Zhong J., Stanyon C.A., Finley R.L.Jr., White K.P.,
Braverman M., Jarvie T., Gold S., Leach M., Knight J., Shimkets R.A., McKenna

162

.1l. 1.3.1.137“ ‘MJ

 

 

M.P., Chant J., and Rothberg J.M. (2003). A protein interaction map of Drosophila
melanogaster. Science 302: 1727-1736.

Gray S., Szymauski P., and Levine M. (1994). Short-range repression permits multiple
enhancers to function autonomously within a complex promoter. Genes & Dev. 8: 1829-
1838.

Gray S., Cai H., Barolo S., and Levine M. (1995). Transcriptional repression in the
Drosophila embryo. Phil. Trans. R. Soc. Lond. 349: 257-262.

Gray S., and Levine M. (1996a). Transcriptional repression in development. Curr. Opin.
Cell Biol. 8: 358-364.

Gray S., and Levine M. (1996b). Short-range transcriptional repressors mediate both
quenching and direct repression within complex loci in Drosophila. Genes & Dev. 10:
700—710.

Harlow E., and Lane D. (1999). Using Antibodies: A Laboratory Manual. Cold Spring
Harbor Press, Cold Spring Harbor, NY.

Hasson P., Muller B., Basler K., and Paroush Z. (2001). Brinker requires two
corepressors for maximal and versatile repression in Dpp signalling. EMBO J. 20: 5725-
5736.

Hernan R., Heuermann K., and Brizzard B. (2000). Multiple epitope tagging of
expressed proteins for enhanced detection. BioTechniques 28: 789-793.

Hewitt G.F., Strunk B.S., Margulies C., Priputin T., Wang X., Amey R., Pabst B.A.,
Kosman D., Reinitz J., and Arnosti, D.N. (1999). Transcriptional repression by the
Drosophila Giant protein: cis element positioning provides an alternative means of
interpreting an effector gradient. Development 126: 1201-1210.

Kal A.J., Mahmoudi T., Zak N.B., Verrijzer C.P. (2000). The Drosophila brahma
complex is an essential coactivator for the trithorax group protein zeste. Genes &
Development 14: 1058-1071.

Keller S.A., Mao Y., Struffi P., Margulies C., Yurk C.E., Anderson A.R., Amey R.L,
Ballard S., Ebels J.M., Foley K., Corado M., and Arnosti, D.N. (2000). dCtBP-

dependent and -independent repression activities of the Drosophila Knirps protein. Mol.
Cell. Biol. 20: 7247-7258.

Kulkarni M.M., and Arnosti D.N. (2003). Information display by transcriptional
enhancers. Development 130: 6569-6575.

163

Kumar V., Carlson J.E., Ohgi K.A., Edwards T.A., Rose D., Escalante C.R.,
Rosenfeld M.G., and Aggarwal A.K. (2002). Transcription corepressor CtBP is an
NAD(+)-regulated dehydrogenase. Mol. Cell 10: 857-869.

Laible G., et al. (1997). Mammalian homologues of the Polycomb-group gene Enhancer
of zeste mediate gene silencing in Drosophila heterochromatin and at S. cerevisiae
telomeres. EMBO J. 16: 3219-3232.

Langeland J.A., Attai S.F., Vorwerk K., and Carroll S.B. (1994). Positioning adjacent
pair-rule stripes in the posterior Drosophila embryo. Development 120: 2945-2955.

La Rosee-Borggreve A., Hader T., Wainwright D., Sauer F., and Jfickle H. (1999).
hairy stripe 7 element mediates activation and repression in response to different domains
and levels of Kriippel in the Drosophila embryo. Mech. Dev. 89: 133-140.

Mannervik M., and Levine M. (1999). The de3 histone deacetylase is requited for
segmentation of the Drosophila embryo. Proc. Natl. Acad. Sci. USA 96: 6797-6781.

Mottus R., Sobel RE, and Grigliatti T.A. (2000). Mutational analysis of a histone
deacetylase in Drosophila melanogaster: missense mutations suppress gene silencing
associated with position effect variegation. Genetics 154: 657-668.

Ner S.S., Harrington M.J., and Grigliatti T.A. (2002). A role for the Drosophila
SU(VAR)3-9 protein in chromatin organization at the histone gene cluster and in
suppression of position effect variegation. Genetics 162: 1763-1774.

Nibu Y., Zhang H., and Levine M. (1998a). Interaction of short-range repressors with
Drosophila CtBP in the embryo. Science 280: 101-104.

Nibu Y., Zhang H., Bajor E., Barolo S., Small S., and Levine M. (1998b). dCtBP
mediates transcriptional repression by Knirps, Kriippel and Snail in the Drosophila
embryo. EMBO J. 17: 7009-7020.

Nibu Y., Senger K., and Levine M. (2003). CtBP-independent repression in the
Drosophila embryo. Mol. Cell. Biol. 23: 3990-3999.

Pankratz M.J., and J fickle H. (1990). Making stripes in the Drosophila embryo. Trends
in Genetics 6: 287-292.

Paroush Z., Finley R.L., Kidd T., Wainwright S.M., Ingham P.W., Brent R., and
Ish-Horowicz D. (1994). Groucho is required for Drosophila neurogenesis, segmentation

and sex determination and interacts directly with hairy-related bHLH proteins. Cell 79:
805-815.

164

Pile L.A., and Wassarman D.A. (2000). Chromosomal localization links the SIN3-
RPD3 complex to the regulation of chromatin condensation, histone acetylation and gene
expression. EMBO J. 19: 6131-6140.

Poortinga G., Watanabe M., and Parkhurst S.M. (1998). Drosophila CtBP: a Hairy-
interacting protein required for embryonic segmentation and Hairy-mediated
transcriptional repression. EMBO J. 17 : 2067-2078.

Rosenberg M.I., and Parkhurst S.M. (2002). Drosophila Sir2 is required for
heterochromatic silencing and by euchromatic Hairy/E(Spl) bHLH repressors in
segmentation and sex determination. Cell 109: 447-458.

Ryu J.-R., and Arnosti D.N. (2003). Functional similarity of Knirps CtBP-dependent
and CtBP-independent transcriptional repressor activities. Nuc. Acids Res. 31: 4654-
4662.

Schaeper U., Boyd J.M., Verma S., Uhlmann E., Subramanian T., and Chinnadurai
G. (1995). Molecular cloning and characterization of a cellular phosphoprotein that
interacts with a conserved C-terrninal domain of adenovirus ElA involved in negative
modulation of oncogenic transformation. Proc. Natl. Acad. Sci. USA 92: 10467-10471.

Schotta G., Ebert A., Krauss V., Fisher A., Hoffmann J., Rea S., Jenuwein T., Dorn
R., and Reuter G. (2002). Central role of Drosophila SU(VAR)3-9 in histone H3-K9
methylation and heterochromatic gene silencing. EMBO J. 21: 1121-1132.

Shi Y., Sawada J., Sui G., Affar E.B., Whetstine J.R., Lan F., Ogawa H., Luke M.P-
S., Nakatani Y., and Shi Y. (2003). Coordinated histone modifications mediated by a
CtBP co-repressor complex. Nature 422: 73 5-738.

Small S., Blair A., and Levine M. (1992). Regulation of the even-skipped stripe 2 in the
Drosophila embryo. EMBO J. 11: 4047-4057.

Small S., Blair A., and Levine M. (1996). Regulation of two pair-rule stripes by a single
enhancer in the Drosophila embryo. Dev. Biol. 175: 314-324.

Soeller W.C., Poole S.J., and Kornberg T. (1988). In vitro transcription of the
Drosophila engrailed gene. Genes & Dev. 2: 68-81.

Song H., Hasson P., Paroush Z., and Courey A.J. (2004). Groucho oligomerization is
required for repression in vivo. Mol. Cell. Biol. 24: 4341-43 50.

Struffi P., Corado M., Kulkarni M., and Arnosti D.N. (2004). Quantitative

contributions of CtBP-dependent and —independent activities of Knirps. Development
131: 2419-2429.

165

Strunk B., Struffi P., Wright K., Pabst B., Thomas J., Qin L., and Arnosti D.N.
(2001). Role of CtBP in transcriptional repression by the Drosophila giant protein. Dev.
Biol. 239: 229-240.

Sutrias-Grau M., and Arnosti, D.N. (2004). CtBP contributes quantitatively to Knirps
repression activity in an NAD binding dependent manner. Mol. Cell. Biol. In press.

Szymauski P., and Levine M. (1995). Multiple modes of dorsal-bHLH transcriptional
synergy in the Drosophila embryo. EMBO J. 14: 2229-2238.

Turner J., and Crossley M. (2001). The CtBP family: enigmatic and enzymatic
transcriptional co-repressors. BioEssays 23: 683-690.

Yu Y., and Pick L. (1995). Non-periodic cues generate seven ftz stripes in the
Drosophila embryo. Mech. Dev. 50: 163-175.

Zhang H., and Levine M. (1999). Groucho and dCtBP mediate separate pathways of
transcriptional repression in the Drosophila embryo. Proc. Natl. Acad. Sci. USA 96:
535-540.

Zhang H., Levine M., and Ashe H.L. (2001). Brinker is a sequence-specific
transcriptional repressor in the Drosophila embryo. Genes & Dev. 15, 261-266.

Zhuo S., Clemens J.C., Hakes D.J., Barford D., and Dixon J.E. (1993). Expression,

purification, crystallyzation, and biochemical characterization of a recombinant protein
phosphatase. J. Biol. Chem. 268: 17754-17761.

166

Chapter 5

Conclusions and future directions

Conclusions

The main conclusions of my work are the following:
1) Knirps is able to repress certain targets without the contribution of CtBP. For instance,
the eve stripe 3/7 enhancer is regulated by Knirps also in a maternal mutant for CtBP
(Fig. 3-1).
2) CtBP may contribute quantitatively rather than qualitatively to Knirps repression. My
data (presented in Chapter 3) support the hypothesis that targets that require low level of
Knirps activity can exhibit CtBP-independent repression activity, whereas targets that
require higher levels of Knirps activity will need the combined activities of Knirps and
CtBP. However, CtBP does not seem to contribute a unique repression activity because a
CtBP-dependent target, such as the eve stripe 4/6 enhancer, was able to be repressed by
the N-terminal, CtBP-independent repression activity of Knirps when provided at higher
than normal levels.
3) Knirps does not regulate even-skipped by competition for DNA binding. Repression by
simple competition has been suggested for many enhancers in Drosophila where DNA
binding sites for activators and repressors often overlap. However, overexpression of the
Knirps DNA binding domain was unable to affect eve expression pattern (Appendix C).
4) Recombinant Knirps is present in a complex of approximately 450 kDa (Fig. 4-1),
which strongly suggests the existence of additional Knirps cofactors other than the known

corepressor CtBP.

167

5) The histone deacetylase de3 (HDAC 1) interacts biochemically and genetically with
Knirps. This interaction is most likely mediated through CtBP, since de3 is lost when
the N-terrninal, CtBP-independent repression domain of Knirps was used during tandem
affinity purification experiments (Fig. 4-5).

My results suggest that histone modifications are likely to play a role in short-
range repression. Therefore, the difference between short-and long-range repressors may
result in the ability to localize or spread certain patterns of histone modifications.
Chromatin immunoprecipitation (ChIP) experiments will help to determine whether
histone deacetylation is indeed involved in short-range repression, as my results are
suggesting, and whether the deacetylation is localized in the case of short-range

repressors and spread over a large chromatin domain in the case of long-range repressors.

I also developed an in vivo biochemical purification strategy which is suitable to
identify Knirps-interacting factors in an unbiased way. For this purpose, 1 generated
transgenic flies that carry inducible, double-tagged knirps transgenes. Upon heat shock, I
was able to express recombinant Knirps proteins in the embryo and at the same time the
endogenous gene is expressed. Double-tagged Knirps proteins (full-length and N-
terminal repression domain) were functional since they were able to repress a number of
endogenous Knirps targets in a dose dependent manner (results in Chapter 3). Using these
transgenic embryos, I was able to affinity purify recombinant Knirps protein on a small
scale and showed that CtBP copurifies together with full-length Knirps at each step of the
purification. Using the same method I also confirmed that de3 copurifies with Knirps,

and these interactions are strong enough to be retained through two rounds of affinity

168

purification. The discovery that de3 functionally interacts with Knirps is novel and was
previously unnoticed (Mannervik and Levine, 1999).

The importance of multiple repression domains within the same protein is not
well understood, but it might be an effective way to tune the repression activity required
at different targets along a gradient of repression activity. In regions of the embryo where
low levels of repressor are present, effective repression may be achieved by the combined
contribution of both repression activities, or by a single one, provided that a sufficient

amount of repressor binds to the target.

Future directions

The following are possible future directions that will increase our knowledge of

the mechanisms of transcriptional repression mediated by Knirps and possibly other
short-range repressors.
l) The double-affinity purification protocol I developed is suitable to identify Knirps-
associating factors in an unbiased way. To this aim, I suggest using nuclear extracts from
embryos overexpressing recombinant Knirps proteins as the starting material for the
tandem affininity purification. I also suggest that the bound complexes at the end of the
purification be eluted with triple-FLAG peptide. Concentrating the starting material and
specifically eluting Knirps complexes should be sufficient to detect differences in protein
profiles between positive and negative controls. These bands would then be excised and
submitted to mass spectrometric analysis.

2) The ability to overexpress a transcriptional repressor such as Knirps ubiquitously and

169

uniformly throughout the embryos will allow us to create genetic switches which could
be investigated using chromatin immunoprecipitation (ChIP) assays (Orlando, 2000).
Endogenous targets of gap-gene regulators including Knirps are expressed in discrete
domains, so that the population of nuclei at the blastoderm stage is a mix of on and off
states. Therefore, ChIP performed on wild type embryos will always give a high
noise/signal ratio, making the results hard to interpret. A better way to obtain meaningfirl
mechanistic information about short-range repression in vivo would be to create embryos
that express activator/s and repressor/s in all (or a vast majority) of nuclei. Ubiquitous
activation could be achieved by crossing a UAS-lacZ reporter line with an actin5C-Gal4-
activator line, whereas ubiquitous repression could be achieved by heat shock of a
transgenic line expressing a heat-shock inducible repressor, such as the lines I generated
during my research.

3) ChIP assays could also be used to determine the protein complexes and chromatin
modifications associated with short-range repression mediated by Knirps. For instance
we could directly test whether de3 is present at the eve stripe 4/6 enhancer, where I
expected to find this protein based on the results presented in chapter 4 (Fig. 4-6), versus
an eve enhancer not regulated by Knirps, such as eve stripe 5. For these experiments, full-
length, double-tagged Knirps is expressed ubiquitously in 2-4 hour embryos and ChIP is
performed using ot-FLAG (or or-Knirps) and an irrelevant antibody. A sequential IP is
performed using a-de3 followed by PCRs using primers specific for eve stripe 4/6 and
eve stripe 5. In this way we can determined whether both proteins are simultaneously
present on a Knirps target. ChIP assays using embryos expressing or non-expressing

Knirps ubiquitously together with antibodies against deacetylated histones will allow to

170

determine the state of the chromatin upon Knirps expression. All these experiments could
also be carried out overexpressing the N-terrninal, CtBP-independent domain of Knirps to
determine whether this portion of Knirps mediates repression through similar
mechanisms.

4) Production of a highly specific Knirps antisera that recognize endogenous Knirps, will
allow to determine the apparent molecular size of endogenous Knirps complexes as well
as to perform direct affinity purification experiments from wild-type embryos. The
Knirps antiserum I raised against Knirps 75-330 is able to recognize the endogenous
protein, but it also cross-reacts with additional factors (Fig. B-l). Purification of the
antiserum could be achieved by affinity chromatography using a GST-Knirps75-330
column and eluting the bound antibody with glicine pH 1.9 according to published

protocols (Harlow and Lane, 1999).

References

Harlow E., and Lane D. (1999). Using Antibodies: A Laboratory Manual. Cold Spring
Harbor Press, Cold Spring Harbor, NY.

Mannervik M., and Levine M. (1999). The de3 histone deacetylase is requited for
segmentation of the Drosophila embryo. Proc. Natl. Acad. Sci. USA 96: 6797-6781.

Orlando V. (2000). Mapping chromosomal proteins in vivo by forrnaldehyde-
crosslinked-chromatin immunoprecipitation. Trends Biochem. Sci. 25: 99-104.

171

Appendix A

Multiple forms of the CtBP corepressor are present during
Drosophila embryogenesis

Introduction

At the onset of my research project, our laboratory did not have antibodies against
CtBP and Knirps. These reagents could be particularly useful for a number of projects
including mine; therefore, I decided to generate polyclonal antibodies against both
proteins. Drosophila CtBP was shown to be matemally-contributed and three mRNAs
were dynamically expressed during all stages of development (Poortinga et al. 1998).
However, no data were available about the dCtBP protein. To understand the firnctions of
this corepressor it will be important to determine whether the different mRNAs for CtBP
give rise to functionally different proteins. To start addressing this question we should
determine whether these proteins are present at similar steady-state levels during
development and whether they all are nuclear proteins. The original yeast two hybrid
screen that identified CtBP as the corepressor for several short-range repressors found
that the short isoform of dCtBP (383 aa) interacted with Knirps (Nibu et al., 1998).
Whether Knirps was able to interact with other CtBP isoforms was not known. An
antibody against CtBP would have been useful for addressing these and other questions.

Therefore, a rabbit polyclonal antiserum was raised against bacterially-expressed,
fiill-length dCtBP protein (aa 1-479). The antiserum was able to recognize both

bacterially-expressed and endogenous dCtBP proteins. Three different cross-reacting

172

 

 

bands were detected using Drosophila whole-cell extracts and nuclear fractions. A
developmental Western using embryonic extracts of different stages showed that all

forms are present at similar levels throughout all stages of embryogenesis.

Material and methods

Generation of a polyclonal antibody against dCtBP. Rabbit polyclonal antiserum
against Drosophila CtBP (dCtBP) was generated against full-length dCtBP and used at
1:20,000 dilution. To generate this antiserum, recombinant full-length, hexahistidine- and
FLAG-tagged Drosophila CtBP (dCtBP 1-479) from pETleCtBPL vector (generated by
David Arnosti) was expressed in E. coli BL21-CodonPlusTM RIL competent cells
(Stratagene #230240) and purified on Ni-NTA agarose beads (Qiagen 30210) according
to the manufacture’s instructions. dCtBP protein (400 pg) in 0.2 ml PBS buffer (1.9 mM
NaHzPO4, 8.1 mM NazHPO4, 154 mM NaCl, pH 7.2) was mixed with an equal volume of
Titermax Gold adjuvant (Sigma T2684) and injected subcutaneously at multiple sites in a
New Zealand White female rabbit. Two secondary boosts were performed similarly after
4 and 12 weeks. Serum was prepared according to Harold and Lane (1999).

Western Blotting analysis. Irnmunoblotting was performed according to standard
protocols (Harlow and Lane, 1999) using a tank transfer system (Mini Trans-Blot® Cell,
Biorad 170-3930). Irnmun-BlotTM PVDF membranes (BioRad 162-0177) were used and
antibody incubation was in TBST (20 mM Tris-HCl, pH 7.5, 120 mM NaCl, 0.1%
Tween-20) supplemented with 5% (w/v) nonfat dry milk as blocking agent.
SuperSignal® West Pico Chemiluminescent substrate (Pierce 34080) was used for

detecting horseradish peroxidase (HRP) on immunoblots. Rabbit antiserum against CtBP

173

(ocCtBP) was used at 1:20,000 dilution (any batch of serum collected between 01-05-02
and 04-25-02). Goat anti-Rabbit HRP-conjugated antibody (BioRad 170-0615) was used
at 1:10,000 dilution.

Embryo collection. Wild-type Drosophila embryos from Canton S flies were collected
on apple-juice plates from well-fed, one week old flies using standard techniques.
Embryos were collected and aged at 25°C. After a prelaying period of four hours (two
changes) to avoid stored embryos, apple-juice plates were changed every hour and
embryos were aged for the appropriate amount of time (i.e. 6-7 hour embryos were a 0-1
hour collection aged 6 hours; 16-18 hour embryos were 0-2 hour aged 16 hours).
Embryonic extracts. All extracts were prepared from Canton S embryos. Whole cell
extract (WCE) from staged embryos was prepared as described in chapter 4. Drosophila
standard nuclear extract (DSNE) from 0-12 hour embryos was prepared according to
Soeller et al. (1988). Drosophila embryonic nuclear extract (DENE) was prepared from
0-12 hour embryos according to Heierrnan and Pongs (1985), except that KC] was used
in place of NaCl. Soluble nuclear fraction (SNF) from 0-12 hour embryos was prepared

according to Kamakaka and Kadonaga (1994).

174

 

Results

The rabbit polyclonal antiserum raised against dCtBP],mg was able to recognize
bacterially expressed CtBPshon (aa 1-386) and CtBP],mg (aa1-479) proteins (Fig. A-lA,
lane 2 and 4, and data not shown). Recombinant CtBPshon and CtBPlong, bearing a
hexahistidine repeat and FLAG epitope tag, migrated slightly slower than the endogenous
proteins (Fig. A-lA). Two prominent bands were detected using whole-cell Drosophila
embryonic extracts (WCE) which migrated with the expected mobilities for CtBPshon and
CtBP]ong (Fig. A-lA, lane 6). Using Drosophila embryonic nuclear extracts prepared
according to high-salt extraction protocols (DSNE and DENE), we could detect both
forms of dCtBP as well (Fig. A-1A, lane 8-9). However, using nuclear extracts prepared
according to a low-salt extraction protocol (SNF), we detected only one form of CtBP
(CtBPshon) and additional high molecular products (around 90 kDa) of unknown identity
(Fig. A-lA, lane7). Altogether these results demonstrate that both forms of dCtBP are
expressed in embryos and the proteins are present in nuclear fractions. Western blotting
analysis of cytosolic and nuclear embryonic fractions using or-CtBP indicate that both
forms of CtBP are present at similar levels in the nucleus and cytosol of Drosophila
embryos (data not shown).

On a high-resolution, 8% SDS-PAGE gel the fast mobility cross-reacting band
detected using a-CtBP appears to be a doublet (Fig. A-lC). These two bands could
correspond to the two shorter isoforms of dCtBP, which differs by three amino acids (383
and 366 aa). Alternatively, one of these products could correspond to a post-translational
modification of dCtBPshon, possibly a phosphorylation product. Mammalian CtBP was

originally identified as a phosphoprotein (Boby et al. 1993) and both forms of Drosophila

175

 

 

Figure A-l: Characterization of a polyclonal antiserum raised against dCtBPlong

A. Polyclonal antiserum raised against dCtBP],mg recognizes both forms of CtBP in
bacterial extracts as well as in Drosophila embryonic extracts. Western blot analysis was
performed using 1220,000 dilution of serum from rabbit 208, which was immunized
against bacterially expressed dCtBP]ong protein (01-05-02 bleed). Proteins were resolved
on a 10% SDS-PAGE and transferred to a PVDF membrane for Western blotting.

The antiserum recognizes bacterially expressed CtBP],mg (lane 4) and CtBPshon (lane 2
[arrow]; in this case a very faint band is detected due to lower loading). Drosophila
whole-cell embryonic extract (lane 6) or embryonic nuclear extracts prepared using high-
salt extraction protocols (lane 8 and 9), showed bands that correspond to both forms of
dCtBP. A low-salt nuclear extract (lane 7) was enriched of dCtBPshon. The two dCtBP
forms have an apparent mass of ~50 and ~40 kDa.

B. Silver-stained 10% SDS-PAGE gel of fractions as in A, showing relative amounts of
total proteins.

C. High-resolution gel electrophoresis of crude embryonic Drosophila extracts was
followed by Western blotting using or-CtBP. The higher mobility band (~40 kDa) is
resolved in a doublet (lane 2 represent a lower exposure of lane 1).

A. Lane 1 and 2, ~lng and ~5 ng of bacterially expressed dCtBPshon. Lane 3 and 4, ~1 ng
and ~5 ng of bacterially expressed dCtBPlong. Lane 5, 10 pl of extract from Schneider cell
line 2. Lane 6-9, ~40 pg of total protein from 0-12 hour embryonic Drosophila nuclear
extracts prepared according to different protocols. Lane 6, soluble nuclear fi'action
(Kamakaka et al. 1991). Lane 7, Drosophila standard nuclear extract (Soeller et al.,
1988). Lane 9, Drosophila embryonic nuclear extract (Heierrnann and Pongs, 1985).

B. Lane 1 and 2, ~5 ng and ~50 ng of bacterially expressed dCtBPshon. Lane 3 and 4, ~5
ng and ~50 ng of bacterially expressed dCtBPlong. Lane 5, 20 pl of extract from Schneider
cell line 2. Lane 6-9, ~2 pg of total protein from 0-12 hour embryonic Drosophila nuclear
extracts prepared according to different protocols.

C. Lane 1, 50 pg of total protein fiom whole-cell embryo extracts. Lane 2 is a light
exposure of the higher mobility product. Proteins were separated on a 15-cm long, 8%
SDS-PAGE gel.

176

31),,

f CtBP r
131)er us
re rescind
1%

h, (lane!
Drosoplit
using hr;—
ir 1011er
two dCtBP

amounls Oi

(tram “5
.40 10311:

M CtBPs CtBPI $2

64—
-
50- u... --
/ ”‘ ---
36-

 

 

 

 

 

 

47- ‘
- 3"
36-
2
g
1

Figure A-l: Characterization of a polyclonal antiserum raised against dCtBPlong.

177

 

 

CtBP have a number of predicted phosphorylation sites. A search for putative
phosphorylation sites using NetPhos 2.0 (http://www.cbs.dtu.dk/services/NetPhos/) of the
long form of dCtBP (479 aa) revealed 17 predicted phosphorylation sites (11 serine, 5
threonine and 1 tyrosine).

Next, I performed Western blotting analysis using oc-dCtBP and wild-type
(Canton S) crude embryonic extracts prepared from staged embryos (Fig. A-2). Each
sample represented a 60-minutes collection aged for different amount of time to cover the
entire duration of embryogenesis. Two forms of dCtBP of approximately equal intensities
were detected throughout all stages of embryogenesis. The higher mobility doublet is not
resolved on a 10% SDS-PAGE minigel and I referred to these isoforms as CtBPshon
throughout this dissertation. Both forms are present from the onset of embryogenesis (0-2
hours; Fig. A-2, lane 1-2) consistent with the fact that this corepressor is maternally
contributed. CtBPlong appeared to be slightly more abundant than the shorter forms
(CtBPshon) between 2 and 5-6 hours (lane 3-6), whereas it was less abundant than

CtBPshm towards the end of embryogenesis (lane 9-14).

178

Canton S crude embryonic extracts (hours)

«9 ,3. br- .3633: 39

0’" N3" ’1?) ‘5" V" 6'6 ”A «a, ‘b’ '9' '3' N“ N '3’
A i218: '7
98- .
64—
50— 'V "I——"——- ‘——————

w ——'— ———_‘d N-—_o~_---'

,

I
,1
h:
v
‘1
s
t

   

“We”

12345678 91011121314

Figure A-2: Developmental Western of Drosophila embryonic extracts using a—CtBP
antiserum.

A. Both forms of CtBP are expressed at similar levels throughout all stages of Drosophila
embryogenesis. Embryonic whole-cell extracts were prepared from staged Canton S
embryos of the indicated age (expressed in hours after egg deposition). 40 pg of total
protein were resolved on a 10% SDS-PAGE gel, transferred to PVDF membranes and
Western blotting was performed using polyclonal or-CtBP antiserum (1220,000 dilution).
B. Coomassie-stained gels with the same amount of material used in A showing equal
loading.

179

 

References

Boyd J.M., Subramanian T., Schaeper U., La Regina M., Bayley S., and
Chinnadurai G. (1993). A region of the C-terrninus of adenovirus 2/5 Ela protein is
required for association with a cellular phosphoprotein and important for the negative
modulation of T24-ras mediated transformation and metastasis. EMBO J. 12: 469-478

Harlow, E., and Lane, D. (1999). Using Antibodies: A Laboratory Manual. Cold Spring
Harbor Press, Cold Spring Harbor, NY.

Heiermann R., and Pongs O. (1985). In vitro transcription with extracts of nuclei of
Drosophila embryos. Nucl. Acid Res. 13: 2709-2730.

Kamakaka R.T., and Kadonaga J.T. (1994). The soluble nuclear fi'action, a highly
efficient transcription extract from Drosophila embryos. Methods Cell Biol. 44: 225-235.

Nibu Y., Zhang H., and Levine M. (1998a). Interaction of short-range repressors with
Drosophila CtBP in the embryo. Science 280: 101-104.

Poortinga G., Watanabe M., and Parkhurst S. M. (1998). Drosophila CtBP: a Hairy-
interacting protein required for embryonic segmentation and Hairy-mediated
transcriptional repression. EMBO J. 17: 2067-2078.

Soeller W.C., Poole S.J., and Kornberg T. (1988). In vitro transcription of the
Drosophila engrailed gene. Genes & Dev. 2: 68-81.

180

Appendix B

Characterization of Drosophila transgenic lines expressing full-
length, double-tagged Knirps

Introduction

As a first step in the long-term goal of understanding the mechanisms of
transcriptional repression mediated by the Drosophila Knirps protein, 1 proposed to
biochemically identify Knirps-interacting proteins. Initial attempts to identify proteins
from embryonic nuclear extracts that interact with GST-Knirps chimeric fusions were not
successful. Fusion proteins containing the entire repression domain of Knirps were
insoluble and fusions to the N-terminal repression domain did not specifically interact
with any proteins visible on silver stained gels (data not shown). Possible targets of
Knirps may not recognize bacterially expressed GST-Knirps, or might not readily
exchange from endogenous complexes. Therefore, I developed a protocol for the affinity
purification of Knirps complexes from embryos overexpressing double-tagged versions
of Knirps. To this aim, I generated transgenic flies carrying stably integrated hsp70-
knirps transgenes that express recombinant full-length Knirps in the embryo at the same
time as endogenous Knirps expression (see Fig. 3-2). This appendix reports the initial
characterization of hsp 70-knirps1 -429 transgenic lines, which are able to express double-
tagged, full-length Knirps protein upon heat-shock. Five minutes of heat shock were
found to be sufficient for detecting the recombinant protein. Induction could be achieved
starting from 2-3 hours old embryos and, upon firll induction, recombinant Knirps protein

persisted in the embryo for approximately 2 hours.

181

 

 

In parallel, I generated a polyclonal antiserum against Knirps. This reagent would
allow us to determine the size of endogenous Knirps complexes, the relative abundance
of this transcription factor during different developmental stages, and to directly purify

Knirps complexes from wild-type embryos.

Material and Methods

Generation of transgenic flies carrying inducible, double-tagged Knirps genes. See
Chapter 3 for a detailed description.

Heat-shock experiments. Transgenic embryos from hsp70-knirps1 -429 of the indicated
age were collected on apple-juice plates at room temperature (22-23°C). To induce
expression of full-length Knirps proteins, transgenic embryos were incubated for the
indicated time at 38°C in a lO-liter water bath to ensure rapid and even heating. After
induction, embryos were immediately dechorionated and lysed.

Crude embryo lysate preparation. See Chapter 3 for a detailed description.
Dose-dependent induction of full-length Knirps. 1-5 hour old embryos from hsp70-
knirpsI-429.3 line were heat-shocked for increasing amount of time (5-120 minutes) at
38°C. After heat shock, embryos were immediately dechorionated and lysed within 15
minutes from the end of induction.

Induction of full-length Knirps in staged embryos. Embryos from hsp70-knirps1-
429.3 line were collected at room temperature (22-23°C) for one hour and allowed to age
for 0, 1, 2, 3, 4, 5, or 6 hours at 25°C (final age from 0-1 to 6-7 hour). To ensure the
proper and uniform age of the embryos, apple-juice plates were changed three times over

a period of 4 hours before starting the embryo collection. Each collection of embryos was

182

'I "3'4“:

:- u r.‘\. Mug-JD .1."

 

 

heat-shocked for 30 minutes at 38°C, immediately dechorionated and lysed within 15
minutes from the end of the heat-shock.

Turnover of recombinant Knirps protein. To determine how long full-length, double-
tagged Knirps protein persists in the embryo after induction, 1-5 hours embryos from
hsp 70-knirpsI-429 (line 3) were heat-shocked for 30 minutes at 38°C and recovered at
room temperature for 10, 30, 45, 60, 90, 120, or 180 minutes before sonication. After the
heat shock embryos were transferred to a water bath at room temperature to ensure rapid
return to normal temperature.

In situ antibody staining. Embryos were fixed and stained according to previously
published protocols (Ashbumer, 1989), using the Vectastain® Universal Elite ABC kit
(Vector Laboratories, Burlingame, CA). Polyclonal antibody against Knirps (#566) was
kindly provided by John Reinitz and used at 1:25 dilution. FLAG M2 monoclonal
antibody (4.9 mg/ml; F3165, Sigma) was used at 1:4,000 dilution.

Generation of a polyclonal antiserum against Knirps. Rabbit polyclonal antiserum
was generated against the N-terrninal, CtBP-independent repression domain of Knirps
(Knirps 75-330). Hexahistidine- and FLAG-tagged Knirps 75-330 from pETleKni75-
330F was expressed in E. coli BL21 CodonPlusTM RIL competent cells (Stratagene
#230240) and purified on Ni-NTA agarose beads (Qiagen 30210) according to the
manufacturer’s instruction. . Knirps 75-330 protein (400 pg) in 0.2 ml PBS buffer (1.9
mM NaHzPO4, 8.1 mM NazHPO4, 154 mM NaCl, pH 7.2) was mixed with an equal
volume of Titermax Gold adjuvant (Sigma T2684) and injected subcutaneously at

multiple sites in a New Zealand White female rabbit. Two secondary boosts were

183

 

performed similarly after 7 and 16 weeks. Serum was prepared according to Harold and

Lane (1999).

Results

Polyclonal antiserum against Knirps recognizes the endogenous protein.

The rabbit antiserum raised against Knirps 75-330 was able to recognize bacterially
expressed Knirps75-330 and Knirpsl-429 proteins (Fig. B-lA, lane 1-2). It was also able
to recognize recombinant Knirps proteins expressed in the embryo (Fig. B-lA, lane 7-9)
and endogenous Knirps from embryonic nuclear extracts (Fig. B-lA, lane 10). However,
the antiserum was unable to recognize endogenous Knirps from crude lysates prepared
from 2-4 hour embryos, probably because of the low level of the endogenous repressor
(Fig. B-lA, lane 4-6). These results were compared with those obtained with a Knirps
antibody (#566) obtained from John Reinitz and successfully used in in situ antibody
staining (Fig. B-4A and B). The two antibodies gave similar results with bacterially
expressed Knirps, but the antiserum I raised appeared to be able to detect all three
recombinant Knirps protein tested, whereas #566 detected only recombinant full-length
Knirps. However, additional cross-reacting bands were present using both antibodies,
which probably correspond to non-specific products. After purification (possibly using
GST-Knirps beads), the antiserum I raised will likely be a useful reagent for

immonoaffinity purification of endogenous Knirps complexes.

184

 

°s°1°
.59 m5? «“6
$.93” a «1’00 amp (5‘ e "‘99“
+°~19M

- - - + + + - heat-shock
250— . . _. . . .
A - --
98" - a In. ‘ '
.._ - ‘l
-4
- 4
a ‘

 

 

 

 

 

 

 

 

 

 

Figure B-l: Characterization of a polyclonal antiserum raised against Knirps.

A. Western blotting using of a rabbit polyclonal antiserum raised against Knirps 75-330
(1:20,000 dilution of serum 04-26-02 from rabbit 209). B. Western blotting using rat
aKnirps (1:5,000 dilution). C. Coomassie stained gel of an identical gel as in A-B.

Lane 1-2, 10 pl of bacterially expressed and affinity purified Knirps 75-330 (lane 1) and
Knirps 1-429 (lane 2). Lane 4—10, 50 pg of total proteins from crude lysates of 2-4 hour
embryos (lane 4-9) and nuclear extract (lane 10). Lane 6, Canton S embryos. Lane 4 and
7, hsp70-knirps1-330.1 embryos. Lane 5 and 9, hsp70-knirpsI-429.3 embryos. Lane 7,
hsp 70-knirps 75-330. 10 embryos. (-) before and (+) after 30 minutes of heat shock.

185

 

Generation and characterization of Drosophila transgenic lines expressing full-
Iength, double-tagged Knirps.

Ectopic expression of a transcription factor may result in lethality. Therefore, I
decided to place the double-tagged knirps transgene under the inducible hsp 70 promoter
using the injection vector pCaSpeR-hs. In some cases, transgenes based on this vector did
show leaky expression at 25°C (Steller and Pirrotta, 1985). Therefore, to reduce the
likelihood of basal Knirps expression flies were always kept at temperatures of 22-23°C
or lower. For hsp 70-knirpsI-429, 32 transgenic lines from male survivors were obtained
by injection of approximately 1000 embryos, suggesting that the transgene does not have
a deleterious effect on the ability to generate transgenic animals. Nine lines were further
analyzed for their ability to induce recombinant Knirps upon heat-shock. The results for
seven lines are reported in Fig. B-ZA. All lines did express a cluster of bands of
approximately the expected molecular mass for fiill-length, double-tagged Knirps (~55
kDa). Expression was completely heat-shock-dependent with no cross-reacting bands
detected from embryos that were not heat-shocked (Fig. B-2A, line 8 and data not
shown). The majority of lines expressed similar steady-state levels of Knirps and one line
(hsp 70-knirps1-429. 3) was chosen for all further experiments.

Heat-shock induction in Drosophila is achievable during most of the life cycle
except during late oogenesis and early embryogenesis (Parsell and Lindquist, 1994).
Early Drosophila embryos are refractory to heat shock as a result of nuclear exclusion of
the heat shock transcription factor dHSF. From cycle 13 onward (~2 hours after egg
deposition) the transport factor dKap-a3 is present and dHSF is localized within the

nucleus thus allowing the embryo to respond to heat-shock (Fang et al., 1991). In the

186

A aw-“—
r

 

 

Figure B-2: Characterization of Drosophila transgenic lines expressing full-length,
double-tagged Knirps proteins.

A. Heat-shock induction of recombinant, full-length Knirps in different transgenic lines.
(Top panel) Western blotting analysis using a-FLAG M2 monoclonal antibody of whole-
cell extracts from 0-12 hour embryos carrying hsp70-knirps1 -429 transgene (line 1-7)
after 30 minutes of heat-shock at 38°C (+ hs). Lane 9, ~5 ng of bacterially expressed and
affinity purified dCtBPlong (used for size comparison). (Bottom panel) Coomassie blue
stained gel with identical amounts of embryonic extract used in the Western blot shown
on the top.

B. Heat-shock induction of recombinant, full-length Knirps in transgenic embryos of
different stages. (Top panel) Western blotting analysis using on-FLAG M2 monoclonal
antibody of whole-cell extracts from embryos carrying hsp 70-knirps1-429 transgene (line
3) of the indicated age (in hours after egg deposition). See text for details.

(Bottom panel) Coomassie blue stained gel with identical amounts of embryonic extract
used in the Western blot shown on the top.

C. Dose-dependent induction of recombinant, full-length Knirps.

1-5 hour old embryos from hsp 70-km’rpsI-429 (line 3) were heat-shocked for increasing
amount of time (5-120 minutes) at 38°C. (Top panel) Western blotting analysis using a-
FLAG M2 monoclonal antibody of whole-cell extracts fi'om transgenic embryos after
heat shocks of variable length. (Bottom panel) Coomassie blue stained gel with identical
amounts of embryonic extract used in the Western blot shown on the top.

All Western blotting were done using a-FLAG M2 monoclonal antibody at 1:20,000
dilution.

Lane 1-27 (except 9), whole-cell Drosophila embryonic extract from transgenic lines
carrying hsp 70-kni1-429 transgenes before (-) and after (+) heat shock. ~50 pg of total
protein/lane.

187

6.589:— mQLEM “rummage—age gyms—-._;— wEunoEno 8:: 359.595 SEESEQ he 5.3533326 arm FEW—m

5N cw mN VN MN NN 3 an 2

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

up t 2 or .3 2 NF 3 or a a s a n v n N w
-. If“ ugn..umv- .....; , é
mm Mil. it!!! ..I. t ..II a 2
. "M.,“ ”‘1 a m ' ”.4 new L3
a- nu , .1 “fl" w... mm on -2
I e . lav . IOm
om m m -3 I. 1%
$1. , 1-8
wml .. .. .,. . m Iwm . Iwm
a ..X... . .. . al.: , l x
mm“! 7.; ..LL ,. . .wm ”mm
mm- .2 -2
WMI “ IWM IWM
v tel. TL l I
8.. tom .8
"i \-
3. ill I III-I .3 I; ii... 4..
won two :3
n -9: u
AC—w—WMV . . . . . . . . . _ _ . . . _ . _ IomN . . . . . . . . mm
a... ouwowowchnmpgmo +IHN+HUHM . .+++++++m:
H H k 9 H .T a... r. .l was w n. h. w. m. e. n. N. _.
3?:53; a
m.m~¢..._5_m: 1 mwfizcxmc
m mamamm wmu m anew M mm
m mmmmmm WWW m WWWM m we
.H. MWmem emu w. .mwhm ..ay mm.

188

early embryo, Knirps is maximally expressed between 2 and 4 hours after egg deposition.
For the identification of physiologically relevant Knirps-interacting factors using full-
length, double-tagged Knirps as affinity matrix, it would be important to achieve
expression at the same or overlapping time as the endogenous knirps expression.
Therefore, I tested how early the induction of recombinant Knirps proteins could be
achieved, by heat-shocking embryos of different ages and performing Western blotting
using a-FLAG antibody. Induction of full-length Knirps was possible as early as 2-3
hours post-fertilization (Fig. B-2B). In situ hybridization experiments using digoxigenin-
UTP-labeled antisense mRNA for knirps also indicate that the induction of hsp70-knirps
transgenes can be achieved at the blastoderm stage, when the endogenous gene is
maximally expressed (Fig. 3-ZB). A dose-dependent induction indicated that 5 minutes of
heat shock were sufficient for detecting the recombinant protein, and 30 minutes of heat-
shock were sufficient to reach the maximum level of recombinant Knirps expression (Fig.
B-2C).

To determine the in viva stability of recombinant, full-length Knirps after a pulse
of induction, transgenic embryos carrying hsp70-knirpsI-429 were subjected to 30
minutes of heat-shock at 38°C, followed by a recovery period at room temperature of
variable duration before the embryos were lysed. Recombinant Knirps proteins were
detected using a-FLAG M2 monoclonal antibody. Following a pulse of induction that
expresses near maximum levels of Knirps, the recombinant protein was detectable in

embryos up to ~2 hours after the end of the heat shock (Fig. B-3).

189

 

hskni1-429.3

chase (min) 10 30 45 60 90 120180
heatshock ffftfff:
$39:

98-

A 64‘ III-II!"

50-

 

 

36-

22-

148-
98-1-
64..

B so ..I..-

 

 

36-

22-

 

 

 

212-

13322 . w, ..
C 22:,

43' Lauuuwud
37-.

0

no

12345678

 

 

Figure B-3: Recombinant full-length Knirps persist in the embryo for ~2 hours after
a pulse of induction.

Transgenic embryos from hsp70-knirps1 -429 (line 3) were heat-shocked for 30 minutes
at 38°C and recovered at room temperature (22-23C) for variable time before lysis.
Whole-cell extracts were prepared after the indicated recovery time (from 10 to 180
minutes).

A, B. Western blotting analysis using a-FLAG M2 antibody (1:20,000 dilution) of
whole-cell extracts from transgenic embryos expressing full-length Knirps after 30
minutes of heat-shock and 10-180 minutes of recovery. The picture in panel B is a lighter
exposure of the same blot used in A.

C. Coomassie blue stained gel loaded with identical amount of extracts as in A.

190

To determine whether recombinant, full-length Knirps is a nuclear protein, in situ
antibody staining were performed using embryos from hsp 70-knirpsI-429.3, before and
after induction. After heat shock induction, recombinant Knirps was expressed
ubiquitously throughout the embryo (Fig. B-4E compare with C). Higher magnification
photographs of the surface of the embryo shows that, upon Knirps expression, the
staining is present in a punctuate pattern similar to the endogenous Knirps protein pattern
(Fig. B-4F compare with B). Uninduced embryos showed background levels of staining
and the pattern was completely uniform (Fig. B-4C and D). Embryonic nuclear extracts
were prepared from embryos over expressing recombinant, full-length Knirps and the
protein was found predominantly in the nuclear fraction (data not shown). Finally, the
repression activities of recombinant Knirps proteins (full-length Knirps and the N-
terminal, CtBP-independent repression domain: Knirps 1—330) on endogenous Knirps
targets including eve, hb, run, h, and ftz clearly prove that at least some of the
recombinant protein is imported into the nucleus and is able to repress endogenous

Knirps targets (Figs. 3-3 and 3-6).

191

yellow-white

 

 

 

 

 

 

 

hskni1-429

non heat-shocked 20min heat-shocked

 

 

 

 

 

Figure B-4: Recombinant full-length Knirps is expressed ubiquitously and in a
punctuate pattern in blastoderm embryos.

A-B. In situ antibody staining of a blastoderm yellow-white embryo using a-Knirps
antiserum (antibody #566 from John Reinitz). A, 20X. B, 100X.

C-F. In situ antibody staining using (Jr-FLAG M2 monoclonal antibody of transgenic
embryos from hsp 70-knirps1-429 line 3 that were either heat shocked for 20 minutes (E
and F) or kept at room temperature (C and D). C and E, 20X. D and F, lOOX.

192

References

Ashburner M. (1989). Drosophila, a laboratory manual. p. 214-216. Cold Spring Harbor
Laboratory Press. New York.

Fang X-d., Chen T., Tran K., and Parker CS. (1991). Developmental regulation of the

heat shock response by nuclear transport karyopherin-a3 protein. Development 128:
3349-3358.

Harlow E., and Lane, D. (1999). Using Antibodies: A Laboratory Manual. Cold Spring
Harbor Press, Cold Spring Harbor, NY.

Parsell D.A., and Lindquist S. (1994). Heat shock proteins and stress tolerance. In: The
biology of heat shock proteins and molecular chaperones. Monograph 26, p. 457-494.
Cold Spring Harbor Laboratory Press.

Steller H., and Pirrotta V. (1985). Expression of the Drosophila white gene under the
control of the hsp 70 heat shock promoter. EMBO J. 4: 3765-3772.

193

Appendix C

Additional experiments not included in chapter 3

Introduction

This appendix documents several experiments that were suggested by three
anonymous reviewers and whose results were referenced in chapter 3 as “data not
shown”.

The first question raised by the reviewers of my original manuscript7 regarded
whether the effects observed on even-skipped (eve) and other Knirps targets upon
overexpression of recombinant Knirps proteins represented direct or indirect effects.
Following a heat-shock treatment of increasing durations (from 5 to 30 minutes at 38C),
the embryos were allowed to recovered for 30 minutes at room temperature prior to
fixation, allowing in principle sufficient time for indirect effects to occur, through
changes in the expression of other genes. Therefore, it was suggested to repeat the heat-
shock experiments without recovery time and determine whether the expression pattern
of eve looked similar to the one shown in Fig. 3-3. The heat-shock experiments were
conducted without recovery time and the results obtained (Fig. C-l) was essentially the
same as those obtained with a 30 minutes recovery period, suggesting that we are

probably looking at direct effects.

 

7 Now published as: Struffi P., Corado M., Kulkarni M., and Arnosti D.N. (2004). Quantitative
contributions of CtBP-dependent and -independent activities of Knirps. Development 131: 2419-2429.

194

An additional question concerned whether some of the repression activities
observed upon overexpression of recombinant Knirps proteins were mediated by direct
competition of the DNA binding domain (DBD) of Knirps with activator/s binding sites.
Overexpression of full-length Knirps or the N-terminal, CtBP-independent repression
domain of Knirps resulted in repression of a subset of even-skipped (eve) regulatory
elements which was attributed to the different potency of the two repression domains of
Knirps. However, both proteins have an intact DNA binding domain (DBD). Therefore,
some (or all) of the repression activities observed could in principle result fi'om direct
competition of the Knirps DBD with overlapping DNA binding sites for activator/s. To
test this hypothesis, 1 generated transgenic lines expressing the DNA binding domain and
nuclear localization signal (NLS) of Knirps (Knirpsl-IOS). As well as for the other
recombinant Knirps proteins expressed in embryos, Knirps 1-105 is double-tagged and
expressed under the hsp 70 promoter. I measured heat-shock induction of this protein by
Western blotting analysis, and quantitated the level of protein expression with respect to
the other forms of Knirps. A transgenic line expressing the DBD of Knirps at comparable
levels as for the full-length (Knirps 1-429) and the N-terminus domain of Knirps (Knirps
1-330) used in chapter 3 was selected. Knirps 1-105 was induced at increasing levels and
its effects on eve expression pattern were determined. The DBD of Knirps was unable to
mediate repression of eve, including the most sensitive Knirps target (eve stripe 3/7),
even under high level of protein expression (Fig. C-2). These results demonstrate that
Knirps represses eve by means other than direct competition for activator binding sites.

These results also suggest that the repression activity measured with the N-terminal

195

region of Knirps (Knirps 1-330) is contributed by the previously identified CtBP-
independent repression domain, and not through the Knirps DBD.

To assess the contribution of the CtBP-dependent repression domain of Knirps
alone to the overall Knirps repression activity, I generated transgenic flies overexpressing
the previously identified minimal CtBP-dependent repression domain (Knirps 202-358;
Keller et al., 2000) fused in frame with the Knirps DBD and NLS (Knirps 1-105). The
expression pattern of eve was unaffected upon overexpression of the CtBP-dependent
domain of Knirps. However, Western blotting analysis of transgenic embryos
overexperissing Knirps1-105/202-358 showed an apparent proteolysis between the two

domains and therefore the lack of repression is not informative (Fig. C-3).

Materials and Methods.

Heat-shock experiments. See Chapter 3 for details. Heat-shock inductions of
hsp70-km’rps1-429 (line 3) and hsp70-knirpsI—330 (line 1) embryos were performed
without recovery. 10-12 minutes were required to process the embryos from the end of
the heat shock induction to the start of fixation/sonication.

Plasmid construction. See Chapter 3 for details regarding contruction of Knirps-
1-105. To test the contribution of the CtBP-dependent repression domain alone to the
overall repression activity of Knirps, I generated transgenic flies carrying the minimal
CtBP-dependent repression domain of Knirps (residues 202-358; Keller et al., 2000)
fused in frame with the Knirps DNA binding domain (residues 1-105). Knirps 202—358
was amplified using primers DA776 (5’-CCG CGC TCT AGA GCT GCC GCT GCA

GCG GCT TCT GCT GCC-3’) and DA775 (5’-CGG CCT CTA GAC ACC TCC ACT

196

TCT TGA TCC TCG GAG CC-3’) and pBS-N741 as DNA template. The PCR product
was restricted with XbaI and cloned into Knirpsl-lOS restricted with XbaI and
dephosphorylated. The correct orientation of the insert was determined by PCR. This
cloning strategy introduces two additional codons (Ser and Arg) between residues 105
and 202 of Knirps. The final vector consist of pCaSpeR-hs(H2xF) (Struffi et al., 2004)
containing a KpnI-XbaI insert corresponding to Knirps1-105/202-358. The insert was

sequenced to confirm the correct sequence and frames.

Results

Repression of even-skipped enhancer elements by ectopic Knirps is a direct effect.

Ectopic expression of recombinant Knirps proteins (full-length and N-terminus,
CtBP-independent repression domain) in blastoder embryos led to differential repression
of even-skipped (eve) and other Knirps targets (Fig. 3-3 and 3-6). In the initial
experiments, afier heat-shock inductions of variable duration, the embryos were allowed
to recover for 30 minutes prior to fixation. This window could allow sufficient time for
indirect effect to occur, through changes in the expression of other genes. As suggested
by an anonymous reviewer, all heat-shock experiments were also conducted without
recovery time to determine whether the patterns of repression on eve would differ.

For recombinant full-length Knirps (1-429), afier 10 minutes of heat shock with
no recovery time, eve stripe 3 and 7 were partially repressed (Fig. C-lA), similar to the
results reported in Fig. 3-3. Lengthening the heat shock to 15 minutes led to complete
loss of eve stripe 3 and 7 expression with weakening of the next most susceptible target,

eve stripe 4 and 6 (Fig. C-lB). After 20 minutes of heat shock with no recovery, all eve

197

hsp 70-knirps 1-429

; § '3 5. 10 min heat shock
s . if ‘i, i no recovery
1 1 £-
A
,5" 15 min heat shock
" no recovery

20 min heat shock
no recovery

_ will

Figure C-l: Direct repression of even-skipped (eve) by ectopic full-length Knirps.

Embryos carrying an hsp 70-ImirpsI-429 transgene were heat-shocked for 10 (A), 15 (B),

or 20 minutes (C) at 38°C and immediately fixed for in situ hybridization (no recovery),
to reduce indirect effects.

In situ hybridization was performed using digoxigenin-UTP-labeled antisense mRNA

probe to eve. Surface views of blastoderm embryos are shown. Embryos are oriented
anterior towards the lefi, dorsal side upwards.

198

 

stripes except eve stripe 5 were repressed, similar to the finding shown in Fig. 3-3, except
that residual staining for the other stripes remains, presumably because the eve mRNA
has had less time to turn over (Fig. C-lC). The order of disappearance of the eve stripes is
in all cases identical, indicating that the differential sensitivity of eve enhancers to
misexpressed Knirps identified previously is similar.

The pattern of repression of eve stripe enhancers obtained by misexpression of
Knirps 1-330 was also similar to that reported in Fig. 3-3, but residual eve mRNA was
detectable. With no recovery after heat shock, eve stripe 4 and 6 appeared to be less
effectively repressed that in Fig. 3-3 (data not shown). However, the minimal eve stripe
4/6-IacZ reporter was repressed by Knirps 1-330 in experiments performed with no
recovery (Fig. 3-4K and L). In conclusion, it appears that the results shown in Fig. 3-3 are
essentially the same as those obtained using a protocol without the recovery period.
Therefore, the differential repression of eve stripe elements observed upon misexpression

of recombinant Knirps proteins is likely to be a direct effect.

Competition for DNA binding does not play a role in Knirps-mediated repression of
eve stripe elements.

Some of the repression activities observed upon misexpression of recombinant
Knirps proteins on even-skipped (eve) stripe elements could be mediated by the DNA
binding domain of Knirps directly competing for activator binding sites. To test the
relevance of direct competition in eve regulation by Knirps, I created transgenic embryos
that express double-tagged Knirps 1-105 upon heat shock. Knirps 1-105 contains the

previously defined DNA binding domain (DBD) of Knirps (a 1-74) as well as the

199

Figure 02: Competition for DNA binding does not play a role in Knirps-mediated
repression of even-skipped (eve) stripe elements.

A. Quantitation of proteins expressed from hsp70-knirpsI-105.

Transgenic embryos (from line 11a) were heat-shocked at 38°C for increasing amounts of
time and immediately lysed. Crude embryonic extracts (50 pg of total protein/lane) were
resolved on a 4-20% SDS-PAGE gel (Gradipore, NG21-420) and recombinant Knirps
proteins were detected by Western blotting analysis using or-FLAG M2 monoclonal
antibody (1:10,000 dilution). Protein levels were quantitated relative to the level of
Knirps 1-330 and are reported on the bottom in percentage (100% being the level of
Knirps 1-330 after 20 minutes of heat shock). Asterisk marks a nonspecific cross-reacting
protein that was also present in lysates from non-transgenic embryos (data not shown).

B. eve expression pattern in transgenic embryo misexpressing Knirps 1-105.

Transgenic embryos (from hsp 70-knirpsI-105.11a) were heat-shocked for 30 minutes at
38°C and immediately fixed. In situ hybridization was performed using digoxigenin-
UTP-labeled antisense mRNA probe to eve. Surface view of a blastoderm embryo
oriented anterior towards the left, dorsal side upwards.

200

A hskni1-105 hskni1-330
9 s 13 1,5 go so 9 s 1,0 heatshock (min)

 

 

 

 

 

 

250—
148-
98-
64- .
“FHA” “\f'NAv—w *
50"
. ' cl
)5 medm 36_
22‘ ~ —. W
16-1
9. Emmi Ci
inlanclm 2 14 28 31 42 48 2 13 35 relative levels (%)
mm KW
monoclca
the Milt"
me lcxtlli
reg-ref»? B hsp70-knirps1-105
)Is O“-
;0 minuzél'
digoxigfl‘: eve
[arm 5‘35

 

 

 

 

30 min heat shock
no recovery

Figure C-2: Competition for DNA binding does not play a role in Knirps-mediated

repression of even-skipped (eve) stripe elements.

201

putative nuclear localization signal (a 75-93; Gerwin et al., 1994). Dose-dependent
induction of Knirps 1-105 protein was monitored by Western blotting and quantitated
with respect to the other forms of Knirps as described in chapter 3. Quantitation of
Western blots indicated that transgenic embryos from hsp70-knirps 1-105 (line 11a)
expressed the DBD of Knirps at levels higher than the full-length protein, and somehow
lower than that of Knirps 1-330 (Fig. C-2A). Double-tagged Knirps 1-105 was unable to
mediate repression of even-skzpped, even of the most sensitive eve stripe 3/7 enhancer
when embryos were heat-shocked up to 30 minutes (Fig. C-2B). This result suggests that
the CtBP-independent repression activity of Knirps is not simply a measure of residual
direct competition activity. The results are consistent with the model that Knirps

represses eve by means other than competition for activator binding sites.

Transgenic embryos misexpressing the CtBP-dependent repression domain of
Knirps do not affect eve expression pattern.

To test the contribution of the CtBP-dependent repression activity of Knirps
relative to the repression activity of the full-length protein, I created lines carrying a
transgene that express under heat shock conditions a fusion protein between the Knirps
DBD and the minimal CtBP-dependent repression domain of Knirps (Knirpsl-105/202-
358). Misexpression of the CtBP-dependent domain of Knirps did not alter eve
expression pattern (Fig. C-3B) although a similar Gal4 fusion protein (Ga14-Knirps 202-
358) was able to repress an eve stripe2/3-lacZ reporter using an in viva repression assay
(Keller et al., 2000). Unlike other recombinant Knirps proteins tested, Knirps 1-105/202-

358 was subjected to considerable proteolysis in vivo (Fig.C-3A).

202

 

Figure C-3: Misexpression of the CtBP-dependent repression domain of Knirps does
not affect even-skipped (eve) expression pattern.

A. Quantitation of proteins expressed from hsp 70-knirpsI-105/202-358.

Transgenic embryos (from line 1a) were heat-shocked at 38°C for increasing amounts of
time and immediately lysed. Crude embryonic extracts (50 pg of total protein/lane) were
resolved on a 4-20% SDS-PAGE gel (Biorad 161-1105) and recombinant Knirps proteins
were detected by Western blotting analysis using a-FLAG M2 monoclonal antibody
(1:10,000 dilution). Asterisk marks a nonspecific cross-reacting protein that was also
present in lysates from non-transgenic embryos (data not shown).

B. eve expression pattern in transgenic embryo misexpressing Knirps 1-105/202—358.
Transgenic embryos (from hsp70-lmirpsl -1 05.1a) were heat-shocked for 30 minutes at
38°C and immediately fixed. In situ hybridization was performed using digoxigenin-
UTP-labeled antisense mRNA probe to eve. Surface view of a blastoderm embryo
oriented anterior towards the lefl, dorsal side upwards.

203

Knirps docs

g animal
inlanel m
llIPS prom
anal mini“.
hat MS 3150

303-3555

;0 minute-‘3
digoxiim'
lenil mini

hskni1-105I202-358 hskni1-330
A 0 5 10. 20 30 0 5 10 20 heat shock (min)
250-

 

 

5— *~—~ I. -

22- 'A"-

 

 

 

9V6

 

30 min heat shock
no recovery

Figure C-3: Misexpression of the CtBP-dependent repression domain of Knirps

does not affect even-skipped (eve) expression pattern.

204

Therefore, protein stability might be a factor that explains the lack of repression activity

displayed by the CtBP-dependent domain of Knirps.

References

Gerwin N., La Rosee A., Sauer F., Halbritter H. P., Neumann M., Jackie H., and
Nauber U. (1994). Functional and conserved domains of the Drosophila transcription
factor encoded by the segmentation gene knirps. Mol. Cell. Biol. 14: 7899-7908.

Keller S.A., Mao Y., Struffi P., Margulies C., Yurk C.E., Anderson A.R., Amey R.L,
Ballard S., Ebels J.M., Foley K., Corado M., and Arnosti, D.N. (2000). dCtBP-
dependent and -independent repression activities of the Drosophila Knirps protein. Mol.
Cell. Biol. 20: 7247-7258.

Struffi P., Corado M., Kulkarni M., and Arnosti D.N. (2004). Quantitative

contributions of CtBP-dependent and —independent activities of Knirps. Development
131: 2419-2429.

205

 

   

1|111111111111111111111111111111111
3 1293 02551 6497