tits}: :2:‘
.1. ‘

\. ‘
In .(5
. .31.

.u. unmélfluwu: 15.

I RE! i: . V

”.3. .9

"5m?

m Hana.
.. 4. .T
”K,

i
“Eighfiuu '

15 v.
.m

 

 

 

 

This is to certify that the
dissertation entitled

GENETICS AND GENOMICS OF THE DST-MEDIATED
DECAY PATHWAY IN ARABIDOPSIS THALIANA

presented by

PREETMONINDER LIDDER

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Cell and Molecular Biology

 

 

Vail/é, // /,é[/

Mngrofessor’s Signature

xl/2//0Y'

MSU is an Affirmative Action/Equal Opportunity Institution

u-«-—.—---------.--- -.-.- -.-.--.-.-.-.- ---—-—:-.- ._ - -

 

 

W”
Michigan State
University

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 cleIRC/DateDuepes-p. 1 5

 

 

GENETICS AND GENOMICS OF THE DST-MEDIATED DECAY PATHWAY IN
Arabidopsis thaliana

By

Preetmoninder Lidder

A DISSERTATION

Submitted to
Michigan State University
In partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Cell and Molecular Biology

2004

ABSTRACT
GENETICS AND GENOMICS OF THE DST-MEDIAT ED DECAY PATHWAY IN
Arabidopsis thaliana
By
Preetmoninder Lidder

The control of mRNA stability plays a fundamental role in the regulation of gene
expression in plants and other eukaryotes. The basal mRNA decay machinery, sequence-
specific decay components, and regulatory factors that respond to various stimuli can
influence the control of mRNA stability. Despite the importance of mRN A stability in
providing the cells with a means to rapidly tailor gene expression, little is known about
this process in higher eukaryotes in general, and plants in particular. The overall goal of
the research described in this thesis has been to elucidate the mechanisms and cellular
factors which determine sequence-specific mRN A decay in higher plants. Towards this
end, Arabidopsis mutants defective in the DST-mediated decay pathway were utilized.

The dst mutants were originally isolated as specifically elevating the steady-state
level and increasing the half-life of DST-containing transcripts. To determine new
molecular phentotypes of the dstl mutant and evaluate the biological significance of the
DST-mediated decay pathway, cDNA microarray technology was employed. In addition
to verifying the increase in the transgene mRNA levels, used to isolate these mutants,
new genes with altered mRNA abundance in dstl were identified. RNA gel blot analysis
confirmed the microarray data for all genes tested and was also used to catalog the first
molecular differences in gene expression between the dstI and dst2 mutants. Clustering

analysis of genes altered in dstl exposed new co-expression patterns suggesting a link

between the dst] mutation and circadian rhythms. Earlier results from microarray
expression data for unstable mRNAs in Arabidopsis showed that mRNA instability is
associated with a group of genes controlled by the circadian clock. Experiments
conducted during the course of this dissertation indicated that Ccr-like and SEN], two
transcripts which are regulated at the level of mRNA stability by the clock, are also direct
targets of the DST-mediated decay pathway. Not only were Cor-like and SEN]
transcripts altered in their half-lives in dst], but their stabilities were also altered in the
mutant relative to the parental at different times during the day. This leads to aberrant
circadian oscillation of these transcripts in the mutant demonstrating that the DST 1 locus
is associated with circadian control. Previous experiments (e.g. with the per gene in
Drosophila) have implicated differential mRN A stability in the control of CCGs but the
observations in Arabidopsis are among the first to provide direct evidence for this.

Map-based cloning of the dst] mutant was initiated using RAP2.4, an endogenous
target identified during the microarray experiments. The use of this marker circumvented
some of the problems associated with the transgene to score homozygous mutants in the
mapping population. A new mutant, dst3, was characterized in this thesis which should
facilitate the investigation of the molecular components involved in DST-mediated
degradation. Additionally, microarray experiments with dst2 were carried out to identify
molecular markers specific for dst2 and further address the physiological role of the
DST-mediated mRNA decay pathway in plants.

Taken together, the results described in this dissertation should constitute
significant progress toward understanding the molecular machinery responsible for

sequence-specific mRNA degradation in plants.

Copyright by
PREETMONINDER LIDDER
2004

To my parents

ACKNOWLEDGMENTS

I would like to acknowledge numerous people without whose support this thesis
would not be possible. But where does one begin? Indeed there have been so many who
have helped and encouraged me all through that at times I have felt overwhelmed. During
the period of my stay at the Plant Research Laboratory and subsequently at the Delaware
Biotechnology Institute, I have been the beneficiary of the imagination, wisdom and
insights of a lot of remarkable people.

I owe a special debt of gratitude to my advisor, Dr Pam Green for her patient
guidance at all times during my dissertation. The excellent discussions with her infiised
an inquisitive attitude in my work and enabled me to be more resourceful and productive.
I am also deeply indebted to my committee members, Dr David Amosti, Dr Jon Kaguni
Dr Ken Keegstra and Dr Mike Thomashow, for offering invaluable advice and helpful
suggestions.

Thanks are also due to past and present members of the Green lab who have not
only been great friends but have also helped in creating an outstanding atmosphere in the
lab for great research. Thanks Linda, Nikki, Yukako, Fred, Gustavo, Jim and Cheng. This
acknowledgement would not be complete without a heartfelt thanks to Mark Johnson for
being a superb tutor during my rotation, Miguel Pe'rez-Amador for teaching me all about
microarrays and Rodrigo Gutierrez for thought-provoking comments, timely computer-
help and of course, the “drumming”. I would like to thank Monica for all her help with
the mapping of DST] - it would have been extremely difficult without her and I really
appreciate her assistance on this project. Thanks to the “ice-cream” club at MSU- Sam,

Robin, Verna and Robert, for the refreshing breaks in between experiments.

Vi

My love and gratitude goes out to my parents, Jasbir and Satinder Lidder, who
have stood by me when I have felt like giving up, offering encouragement and helping
out in ways no one else could. A very special thank you to my brother, Nanu, for his
lively remarks and never ending enthusiasm. Thanks to Dana, who has been there for the
long run and I consider her to be the best friend a person could ever ask for. Last, but not
the least, my all out thanks goes to my fiancee, Jashan, who has done whatever it takes to
make this possible. He has been there for me through thick and thin and I want to thank
him from the bottom of my heart. Thanks very much Jashan- you are number one to me

and always will be.

vii

TABLE OF CONTENTS

LIST OF TABLES XI
LIST OF FIGURES XII
ABBREVIATIONS XIV
CHAPTER 1
Control of mRNA turnover in plants 1
Introduction 2
Determination of mRN A decay rates 4
Chemical inhibitors 5
Regulated promoters 6
RNA polymerase II 8
Microarray technology 8
Stimuli affecting mRNA stability 9
Plant hormones 9
Light 10
Sucrose 12
Nitrogen 13
Methionine 13
Biotic Stress 14
Abiotic stress 15
cis-acting determinants of mRN A stability 17
DST element 17
AUUUA sequences 20
5’ UTR 21
General mRNA decay machinery 22
Sequence-specific decay 24
Perspective 28
References 29
CHAPTER 2
New molecular phenotypes of the dst] mutant revealed by microarray analysis 38
Introduction 39
Results 43
Generation of a 600-element DNA microarray 43
The expression levels for most genes are similar in dstl and the parental
plants 45
The 11,521-element microarray reveals additional genes with altered gene
expression in the dst] mutant 48
RNA gel blot analysis confirms DNA microarray data 52
Identification of primary targets of the dst] mutation 56

Multiple replicates remove non-reproducible changes 58

viii

Cluster analysis of genes with altered expression levels in dst]
Discussion
Transcripts altered in dst] have predominantly increased levels, although
some decrease in abundance
Molecular markers to expedite characterization of and differentiation
between dst] and dst2
Circadian association of the dst] mutation
Conclusions and future prospects
Materials and Methods
Plant material
Generation of a 600-element DNA microarray
11,521 AFGC DNA Microarray

Half-life measurements, total RNA Extraction, Poly(A)+ RNA Purification,

and RNA Blot Hybridization

Labeling of Poly(A)+ RNA

DNA Microarray Hybridization and Analysis
References

CHAPTER 3
Circadian control of mRNA stability: Impact of the dst mutants

Introduction

Results
Diurnal control of Ccr-likc and SEN] mRNA stability is affected in the
dst] mutant
DST 1 function is required for normal circadian expression of SEN] and
Ccr-like mRNAs
dst] affects circadian control of mRNA stability
Opposite effect of dst2 on Sen] mRNA stability

Impact at the whole plant level: Classical circadian phenotypes are altered in

the dst mutants
Discussion
Materials and Methods
Arabidopsis strains and grth conditions
Half-life measurements, RNA preparation and analysis
Leaf movement assay
References

CHAPTER 4
Genetic mapping of dst]

Introduction

Results
dst] mutation does not appear to be linked to the transgene
Use of RAP2.4 as an endogenous marker to score homozygous mutants
Fine mapping of the dst] locus

ix

61
65

65

69
7O
71
72
72
73
75

75
76
77
80

85

86
90

9O

92
96
99

99

102
106
106
106
107
109

115

116
118
118
120
120

Discussion

Materials and Methods
Plant material
Half-life measurements, total RNA Extraction and RNA Blot Hybridization
Genomic DNA extraction and markers for mapping

References

CHAPTER 5
Characterization of dst3, a new gene in the DST-mediated mRN A degradation
pathway

Introduction
Results
dst3 exhibits increased HPH-DS T and G US-DST mRNA levels
Genetic analysis of dst3
dst3 is not allelic to dst] or dst2
Increased stability of HPH-DST mRNA in dst3 compared with 1519-31
Discussion
Materials and Methods
Plant material
Half-life measurements, total RNA Extraction and RNA Blot Hybridization
Analysis of the HPH-DSTX4 sequence element in dst3
References

CHAPTER 6
Microarray analysis of dst2

Introduction
Results
15k element microarray reveals genes with altered gene expression in dst2
Identification of the putative primary targets of the dst2 mutation
RNA gel blot analysis of previously identified transcripts
Discussion
Materials and Methods
Plant material
15k AFGC DNA Microarray
Total RNA Extraction, Poly(A)+ RNA Purification, and RNA Blot
Hybridization
Labeling of Poly(A)+ RNA
DNA Microarray Hybridization and Analysis
References

CHAPTER 7
Final remarks and future prospects

123
127
127
127
128
131

133

134
135
135
137
139
139
143
146
146
146
147
148

149

150
150
150
151
156
156
159
159
159

160
160
161
163

165

 

 

 

LIST OF TABLES

Table 2.1. Genes included on the 600-element DNA microarray

Table 2.2. Genes with increased mRNA levels in dst] vs. parental plants
Table 2.3. Genes with decreased mRNA levels in dst] vs. parental plants
Table 2.4. Genes with possible DST-like sequences in their 3' UTR

Table 4.1. Segregation of increased RAP2.4 mRNA abundance in the
progeny of crosses between dst] and 1519-31 (DS T ] )

Table 4.2. Oligonucleotides and restriction enzymes used to detect various
SSLP and CAPS markers

Table 5.1. Segregation of increased HPH mRNA abundance in the progeny
of crosses between dst3 and 1519-31 (DST 3)

Table 5.2. Segregation of increased HPH mRNA abundance in the progeny
of crosses between dst3 and dst] and dst2

Table 6.1. Genes with increased mRNA levels in dst2 vs. parental plants
Table 6.2. Genes with decreased mRNA levels in dst2 vs. parental plants

Table 6.3. Genes with possible DST-like sequences in their 3' UTR

xi

44

53

54

59

121

129

141

142

152

153

154

LIST OF FIGURES

Figure 2.1 Analysis of EST 12509T7 identifies it as SA UR-like] 47
Figure 2.2. RNA gel blot analysis to confirm DNA microarray data 49

Figure 2.3. Comparison of mRN A levels in the dst] mutant and parental plants
using the 11,521 element DNA microarray 51

Figure 2.4. Histogram plot comparing the gene expression values obtained using
microarray analysis and RNA gel blot analysis 55

Figure 2.5. Histograms of the mutant (dst] or dst2)/parental ratios of mRNA
expression for the indicated clones 57

Figure 2.6. RAP2.4, Ccr-like and SEN] mRNAs are primary targets of the DST-

mediated decay pathway 60
Figure 2.7. Assessment of the reproducibility of the microarray data using fewer

replicates 62
Figure 2.8. Cluster analysis of genes with altered mRNA levels in dst] 64

Figure 3.1. Regulation of Ccr-like mRNA stability is altered in the dst] mutant
during the day 91

Figure 3.2. Regulation of SEN] mRNA stability is altered in the dst] mutant
during the day 93

Figure 3.3. Circadian oscillation of Cor-like mRN A is altered in the dst] mutant 94
Figure 3.4. Circadian oscillation of SEN] mRNA is altered in the dst] mutant 95

Figure 3.5. Circadian oscillation of AtGRP7 mRNA is unaltered in the dst]
mutant 97

Figure 3.6. Circadian regulation of Ccr-like mRNA stability is altered in the dst]
mutant 98

Figure 3.7. Circadian regulation of SEN] mRNA stability is altered in the dst]
mutant 100

Figure 3.8. Regulation of SEN] mRNA stability is altered in the dst] mutant
during the day 101

xii

Figure 3.9. Circadian rhythm of leaf movement is altered in the dst mutants 103

Figure 4.1. mRNA abundance of RAP2.4 in F2 plants from the second back-cross

of dst] relative to WT (1519—31) 119
Figure 4.2. RAP2.4 mRNA is stabilized in the dst] mutant and the decay kinetics

are similar in the am and pm. 122
Figure 4.3. DST 1 maps to chromosome I 124
Figure 4.4. Map-based cloning of DST] 125
Figure 5.1 HPH-DST mRNA levels are elevated in dst3 136
Figure 5.2 GUS-DST mRNA levels are elevated in dst3 138

Figure 5.3. mRNA abundance of HPH—DST in F2 plants from the first back-cross
of dst3 relative to WT (1519-31) 140

Figure 5.4 Analysis of HPH-DST mRNA stability in leaves from 1519 and dst3
plants 144

Figure 6.]. RNA gel blot analysis of previously identified transcripts 157

xiii

AFGC

CAPS
CCG
CT
dCAPS
DNA
DST
EST
GUS
HPH
MIPS
mRN A
ORF
PCR
per
SAUR
SMD
SNP
SSLP
TAIR
UTR
ZT

ABBREVIATIONS

Arabidopsis Functional Genomics Consortium
Adenylate/uridylate rich elements
Cleaved amplified polymorphic sequence
Clock controlled gene

Circadian time

Derived CAPS

Deoxyribonucleic acid

Downstream element

Expression sequence tag

B-glucuronidase

Hygromycin phosphotransferase

Munich Information Center for Protein sequences
Messenger RNA

Open reading frame

Polymerase chain reaction

Period

Small auxin up RNA

Stanford Microarray Database

Single nucleotide polymorphism

Simple sequence length polymorphism
The Arabidopsis Information Resource
Untranslated region

Zeitgeber time

xiv

CHAPTER 1

CONTROL OF mRNA TURNOVER IN PLANTS

 

 

INTRODUCTION

Gene expression can be controlled at multiple levels in the cell and requires the
integration of varied processes such as transcription, RNA processing and export,
translation and post—translational events. In the past years, the significance of the plethora
of mechanisms functioning at the post-transcriptional level has become exceedingly
clear. The control of mRNA stability is a notable and well-known form of post-
transcriptional gene regulation in eukaryotic cells. Compared to transcription, much less
is known about the machinery for mRNA degradation. To provide a broad overview of
the various components that contribute to the stability of mRNAs and the pathways by
which mRNA decay occurs in plants, the focus of this chapter will be on the events
affecting the turnover of mRN As encoded by nuclear genes in Arabidopsis. Relevant
examples from other higher plants will also be highlighted. For detailed knowledge on
mRN A decay pathways in other systems, the reader is referred to excellent recent reviews
on the topic (Caponigro and Parker, 1996; Guhaniyogi and Brewer, 2001; McCarthy,
1998; Mitchell and Tollervey, 2001; Ross, 1995).

The level of mRNA that is available in the cytoplasm for translation is a key
control point in the regulation of gene expression. A useful way to consider the control of
mRNA stability is in three interrelated levels (Gutierrez et a1., 1999). Recent studies
indicate that the first and the most fundamental level is that of the basal mRN A decay
machinery responsible for the decay of most cellular mRNAs. Superimposed on the
general decay machinery is the second level of control that establishes the “inherent”
degradation rates of various mRNAs, which can vary over a broad range. The average

half-life of an mRNA in eukaryotic cells is on the order of several hours, but for some

mRNAs, sequence-specific recognition mechanisms can facilitate half-lives as short as
minutes or as long as several days (Gutierrez etal., 1999). The stability of some mRN As
is differentially regulated by exogenous or endogenous stimuli and such differential
regulation of mRNA stability constitutes the third level of control.

There is much to be learned about the mechanisms and cellular factors that are
responsible for mRNA turnover in eukaryotes in general and plants in particular.
However one difficulty has been that most work on the general decay machinery has been
carried out in yeast whereas work in mammals and plants has focused essentially on
sequence-specific (constitutive and regulated) control of mRNA decay. Previous studies
have suggested that there are distinct mechanistic differences between unicellular and
multicellular eukaryotes with respect to mRNA decay. Therefore a thorough investigation
of the mRNA decay machinery in multicellular systems is required to elucidate the
fundamentals of how mRNA stability is controlled.

Arabidopsis thaliana, a member of the mustard family, has emerged as the
primary plant model organism to study mRNA stability because of the various tools
available for its analysis and the technical advantages of this system that surpass those of
mammals for in vivo analysis. A genetic approach in Arabidopsis may offer the best
opportunity to isolate and analyze the cellular factors involved in mRNA turnover. Also
the biological functions of the potential factors that govern mRNA stability can be
addressed using reverse genetic approaches that are hard to reproduce in mammalian
systems. Insertion mutants of Arabidopsis are available from a variety of different
collections. In addition, RNAi constructs, having a “panhandle” structure, can be used to

inactivate the desired gene (Waterhouse et al., 1998). Further overexpression lines are

advantageous to assess the function of newly cloned proteins (Weigel etal., 2000)
especially in conjunction with the inactivation lines. Finally, microarray technology
(Schena et al., 1995; DeRisi et al., 1997) is a powerful approach to assay the expression
of numerous genes involved in multiple aspects of mRN A stability and to monitor
mRN A stability on a global scale. Arrays for Arabidopsis, containing approximately
14,000 clones, have been generated by the Arabidopsis Functional Genomics

Consortium.

DETERMINATION OF mRNA DECAY RATES
The study of mRN A turnover in plants has been greatly aided by a number of
methods for measuring mRNA decay rates. The derivation of the mRNA decay constant
(kd) is based on the assumption that the degradation of mRN A obeys first-order kinetics
i.e. the turnover rate of a message is proportional to the amount of mRNA present at a
given time and the rate constant for decay. Usually, the stability of a message in vivo is
reported as a half-life, the time required for half of the existing mRNA molecules to be
degraded. The half—life of an mRNA (ti/2) is inversely proportional to its decay constant.
ti/2 = In Z/kd
Determination of mRNA half-life begins by blocking mRNA synthesis, isolating
RNA samples at various time intervals and monitoring the loss of a particular message by
analyzing equal amounts of these samples with a message-specific probe. A semi-
logarithmic plot of mRNA concentration as a function of time then yields a straight line

with the decay constant as the slope, as defined by:

In (C/Co) = -kdt

where Co is the initial mRNA concentration and C is the mRNA concentration at time t.
However, there are situations in which mRN A decay might not be stochastic. For
example, in some eukaryotic cells, poly(A) shortening precedes decay of the mRNA body
(Decker and Parker, 1993; Chen and Shyu, 1995) and only after the poly(A) tail has been
shortened to a certain extent does first-order decay occur. Thus for mRN As with
biphasic kinetics, measuring half-life might not be straightforward and it is necessary to
monitor the deadenylation step, or other steps which might precede decay of the body of
the transcript, such as decapping. Over the past years, a number of methods to measure
mRNA decay have been developed, a few of which are described in detail below. For a
comprehensive review of techniques used for determining mRNA degradation rates, the
reader is referred to some earlier reviews (Abler and Green, 1996; Ross, 1995).

The most common method to measure the decay rates of transcripts is to first shut
off transcription and subsequently determine by RNA gel blot analysis the amount of

transcript present as a function of time.

1. Chemical inhibitors: The inhibition of mRNA synthesis in plants is usually
accomplished by treatment with drugs such as actinomycin D, cordycepin and 0t-
amanitin. Actinomycin D interferes with transcription by intercalating into the DNA,
while cordycepin acts as a chain terminating adenosine analog and has been shown to be
a more efficacious inhibitor than actinomycin D in leaf tissue (Holtorf et al., 1999). or-
amanitin is an inhibitor of eukaryotic RNA polymerases II and III and blocks
transcription by binding to the polymerase. Since these drugs inhibit the transcription of

many genes, half-lives of several mRNAs can be measured simultaneously, which is

especially important for genomic analysis. Such experiments are however most
appropriate for measuring half-lives of short—lived mRNAs because of the potential
deleterious effects of prolonged exposure to the drug. Also, it has been observed that the
use of these drugs may increase the half-lives of some transcripts due to potential loss of
labile factors involved in mRNA degradation (Dickey et al., 1994). In addition, the
magnitude of the change in mRNA half-life in response to a particular stimulus may be

dampened (Zhang et al., 1993).

2. Regulated promoters: A more specific method for measuring mRNA half-lives is to
use a promoter that can be regulated to conditionally produce the transcript of interest.
The rationale behind this approach is to first provide a stimulus that leads to a burst of
mRNA synthesis followed by removal of the stimulus which causes rapid repression of
synthesis. As a result, the mRN A of interest is synthesized for only a brief time, increases
in abundance during that time and then degrades at a rate dependent on its half-life. Using
this method, mRN A synthesis is repressed without resorting to toxic chemicals but with a
high degree of synchrony (Ross, 1995). Also, it is unlikely that decay rates of mRNAs
will be altered by depletion of labile turnover factors as they may be when global
inhibitors of transcription are employed. An ideal inducible gene expression system
should have low basal expression levels, high and specific inducibility, fast and efficient
switch-off after the removal of the inducer and low toxicity. Inducible promoter systems
that satisfy some of the aforementioned criteria have been developed in plants (Aoyama

and Chua, 1997; Caddick et al., 1998; Padidam et al., 2003).

In contrast to the other positively regulated promoters, the negatively regulated
ToplO promoter has been used most frequently (Gossen and Bujard, 1992). The ToplO
promoter sequence, which has been used in plants, contains seven copies of the
tetracycline operator DNA sequence fused to a truncated version of the CaMV 358
promoter (Weinmann et al., 1994). The ToplO promoter sequence is recognized by a
transactivator that acts as a synthetic transcription factor. The transactivator is a chimeric
fusion protein between the operator-binding portion of the bacterial tetracycline repressor
fused to the activation domain of the herpes simplex virus transcription factor, VP16
(tTA) (Weinmann et al., 1994). In the absence of tetracycline, the tetracycline repressor
region of tTA has a strong affinity for the operator DNA sequences within the ToplO
promoter resulting in the expression of the desired gene. In contrast, in the presence of
tetracycline, tTA binds tetracycline and is rapidly inactivated, leading to the repression of
transcription. This strategy has been successfully used to measure F erredoxin-l mRN A
stability in response to photosynthesis in transgenic tobacco plants (Petracek et al., 1998)
and also to evaluate mRNA sequences that control the rate of SA UR-A C1 transcript decay
in transgenic tobacco cell lines (Gil and Green, 1996). Recently, it was shown that the
ToplO promoter system is functional in Arabidopsis as well. Love et a1. (2000) generated
a homozygous Arabidopsis line in which tTA was expressed from a single transgenic
locus. Individual plants from this line were then crossed with transgenic plants that
expressed the ER-targeted green fluorescent protein (ER-GFP) from ToplO promoter. In
the resulting progeny, GF P expression was seen to be stringently controlled by

teracycline and the repression of the promoter was reversible upon tetracycline removal.

This system is thus an encouraging new approach for measuring mRNA half-lives in

Arabidopsis.

3. RNA polymerase II: In yeast, an alternative method for inhibiting mRNA synthesis is
to use a temperature-sensitive allele of the RPB] gene (rpr-I), which encodes the large
subunit of RNA polymerase II (Herrick et al., 1990). Use of the rpr -1 mutation to
inhibit transcription again allows the half-lives of many mRNAs to be measured
simultaneously and is also attractive because it promises to have fewer nonspecific
effects compared to general transcriptional inhibitors. In theory it should be possible to
extend the same technology to plants. Arabidopsis has a single gene for the large subunit
of Pol II (Dietrich etal., 1990) and the residue corresponding to the ts Pol 11 mutation
(rpbl-I) (Scafe et al., 1990) is conserved. Recent work by Maillet et al. (1999) also
indicated that a null mutant of RPB4 renders Pol II temperature sensitive in yeast and the

kinetics for mRNA decay after a temperature shift are the same as in the rpr-I mutant.

4. Microarray technology

With the application of genomics, monitoring mRNA stability can be achieved on
a scale much larger than previously possible. Numerous groups have used DNA
microarray analysis to determine mRNA half-lives on a global basis in both prokaryotic
and eukaryotic systems (Bernstein et al., 2002; Holstege et al., 1998; Lam et al., 2001;
Wang et al., 2002).

DNA microarrays have also been used to estimate mRNA half-lives for the genes

of wild type Arabidopsis, by hybridizing spotted cDNA AF GC arrays to probes

corresponding to multiple time points after shutting off RNA synthesis with cordycepin
(Gutierrez et al., 2002). This study indicated that at least 1% of Arabidopsis transcripts
represented on that array are rapidly degraded, with estimated half-lives of less than 60
minutes. Additional transcripts with half-lives of less than 120 minutes were also
identified. The microarray results were very reliable and were confirmed by statistical
analysis and by performing conventional half-life measurements with multiple time
points quantitated on RNA gel blots (Gutierrez et al., 2002). Ultimately, the ability to
monitor mRNA decay on microarrays should help in the identification of transcripts that

are differentially regulated at the level of mRNA stability in response to various stimuli.

STIMULI AFFECTING mRNA STABILITY

1. Plant hormones

Hormones regulate gene expression at many levels but an in depth understanding
of their affect at the post-transcriptional level is lacking. The increase in the abundance of
the mRNA encoding the light-harvesting chlorophyll a/b binding protein in response to
cytokinin application in Lemna gibba occurs principally by a post-transcriptional
mechanism (Flores and Tobin, 1988). mRNA stability has been shown to be responsible
for the cytokinin-induced accumulation of SrEnodZ mRN A in Sesbania rostrata (Silver
et al., 1996). Downes and Crowell (1998) demonstrated that in cytokinin-starved soybean
culture cells, Cim] mRN A is stabilized upon cytokinin treatment. The Cim] protein
product is similar to the B-expansin proteins which are involved in cell wall expansion.

Cim] abundance increases 20-60-fold within four hours of cytokinin addition to

cytokinin-starved soybean suspension cultures and analysis of Cim] stability revealed a
greater than 4-fold increase in the half-life of the mRNA in response to cytokinin. In
addition, Cim] accumulation is stimulated in the absence of cytokinin by the kinase
inhibitor staurosporine and inhibited in the presence of cytokinin by the phosphate
inhibitor okadaic acid, suggesting a role for protein dephosphorylation in cytokinin
regulation of Cim] abundance (Downes and Crowell, 1998).

It has also been suggested that the increase in the abundance of the tomato ER]
transcript in response to ethylene (Lincoln and Fischer, 1988) and the wheat Em
transcript in response to ABA (Williamson etal., 1985) is controlled at the level of

transcript stability but as yet there is no direct evidence.

2. Light
Light affects plant gene expression at many levels, including mRNA stability.

The ferredoxin-encoding genes Fed-1 from pea (Dickey et al., 1998) and FedA from
Arabidopsis (Vorst et al., 1993) show increased mRNA accumulation in light-grown
leaves. The F edA transcript is 20-fold higher in the light relative to the dark, while the
transcriptional activity is only 2-fold higher. This discrepancy suggests that the transcript
is either stabilized in the light or destabilized in the dark.

The pea Fed-1 mRNA is 5-fold higher in the light than in the darkness. Using the
ToplO promoter in transgenic tobacco plants, it was determined that Fed-1 mRNA is
post-transcriptionally regulated by light at the level of mRNA stability as its half-life is
significantly reduced in the dark (Petracek et al., 1998). The region mediating the rapid

degradation of the Fed-1 mRNA includes the 5’ UTR and a portion of the coding region

10

and is called the iLRE (internal light response element; Dickey et al., 1992). In order for
the Fed-1 mRNA to be light responsive, an open reading frame is required (Dickey et al.,
1994), suggesting that the light effect on Fed-1 mRNA is dependent on its synchronous
translation. In addition, the insertion of nonsense codons within the Fed-1 coding
sequence disrupts the light regulation of Fed-1 mRNA abundance (Petracek et al., 2000).
When the Fed-1 gene from pea is expressed in tobacco plants grown in light, Fed-1
mRNAs are found in high molecular weight polysomes. Following a shift to the dark, the
transcript rapidly dissociates from polysomes (Petracek et al., 1998), indicating that
translation of the Fed-1 mRNA is repressed by dark and this may trigger rapid
degradation of the Fed-1 mRNA. Treatment of plants with the electron transport inhibitor
DCMU also results in destabilization of the Fed-1 mRNA (Petracek et al., 1998).
Therefore, it may be the cessation of photosynthesis when plants are shifted to dark that
triggers Fed-1 decay, rather than the mere absence of light.

In pea, a single pulse of high-fluence blue light results in an increased rate of
Lhcb transcription, with no change in the steady-state level of Lhcb mRN A (Kaufman,
1993), suggesting that the excitation of the high-fluence blue light system results in
destabilization of the Lhcb mRN A. Anderson et al. (1999) demonstrated that Lhcb RNA
levels in etiolated Arabidopsis are also regulated in a similar manner by the high-fluence
blue light system and the 65 bp 5’ UTR of AtLhcb is necessary and sufficient for RNA
destabilization. The blue light-induced destabilization response is not dependent on the
phytochrome or the cryptochome receptors (Anderson et al., 1999; F olta and Kaufman,
1999) but the phototropin 1 photoreceptor seems to required for the blue-light mediated

destabilization of the Lhcb transcript (Folta and Kaufman, 2003).

ll

3. Sucrose

a-amylases are major amylolytic enzymes and play an important role in the
degradation of starch. In rice germinating embryos and cultured suspension cells,
expression of a-amylase genes is activated by sugar depletion and suppressed by sugar
provision (Yu et al., 1996). The half-lives of orAmy3, aAmy7 and aAmy8 have been
shown to be prolonged by sucrose starvation, with the mRNA half-life of aAmy3
increasing from 1.5 h to 6 h in sucrose-starved cells (Sheu et al., 1996); however, the
stability of these three mRNAs appears to be controlled by different mechanisms. The
translation inhibitors cylcohexamide and anisomycin enhanced the accumulation of
aAmy3 mRNA regardless of whether or not the cells were provided with sucrose, while
the accumulation of orAmy7 and orAmy8 mRNA was suppressed by the inhibitors, even in
cells starved for sucrose. Moreover, cyclohexamide did not significantly alter the
transcription rates of a-amylase genes, suggesting that labile proteins are involved in the
stabilization of the OLAmy7 and orAmy8 mRNAs but destabilization of the aAmy3 mRNA.
Examination of chimeric gene expression in stably transformed rice cells has shown that
the regulatory sequences in the orAmy3 3' UTR act as potent determinants of mRNA
stability in response to sugar availability (Chan and Yu, 1998).

A recent study conducted by Ho et al. (2001) showed that sugar activated or
repressed gene expression in rice suspension cell cultures and this regulation Operates at
the levels of both transcription rate and mRNA stability. Amongst the sucrose-
upregulated genes that were tested, the half-lives of actin, glyceraldehyde 3-phosphate
dehydrogenase, alcohol dehydrogenase and sucrose synthase P-2 mRNAs were

approximately 1.6-2.6-fold longer in sucrose-provided cells than in sucrose-starved cells.

12

For all the tested sucrose-downregulated genes, the half-lives of mRNAs were 25-74-

fold higher in sucrose-starved cells than in sucrose-provided cells (Ho et al., 2001).

4. Nitrogen

Nitrogen is an essential plant macronutrient and plants obtain nitrogen either from
the soil or through symbiotic nitrogen fixation. Nitrate and nitrogen are reduced to
ammonia, which is assimilated using two enzymes Gln synthase (GS) and Glu synthase
(GOGAT). In higher plants, GS occurs as two isoforms, GS; in the cytoplasm and G82 in
plastids. To determine if GS, genes in alfalfa were regulated at the post-transcriptional
level, Ortega et al. (2001) analyzed transgenic alfalfa plants containing the soybean GS.
gene under the control of the CaMV 358 promoter. A 3-4-fold drop in the level of the
soybean GS] transcript in transgenic alfalfa plants, that were fed nitrate over their non-
nitrate-fed counterpart, was observed. This difference in transcript levels could not be
attributed to differential promoter activity and furthermore the transcript for the alfalfa
endogenous GS] gene also showed a 3-fold drop in levels in the leaves of nitrate-fed
plants. These results indicate that the decrease in GS. transcript levels in nitrate-fed

plants is most likely due to increased turnover of the GSI transcript.

5. Methionine

Methionine biosynthesis is tightly regulated in plants and the first committed step
in methionine biosynthesis is catalyzed by cystathione y-synthase (CGS), suggested to be
a major regulatory site of the pathway (Ravanel et al., 1998). Analysis of Arabidopsis

mto mutants that overaccumulate soluble methionine demonstrated that the gene for CGS

l3

is regulated at the level of mRNA stability (Chiba et al., 1999). Treatment of Arabidopsis
calli with actinomycin D showed that turnover of CGS mRNA, in the absence of
methionine, was faster in wild type than the mtoI-I mutant. Methionine treatment
accelerated the turnover in wild type but not in the mutant. It was also demonstrated that
a 11-13 amino acid region encoded by the first exon of the CGS gene is sufficient and
essential for down-regulating its own mRN A stability in response to methionine or one of
its metabolites (Suzuki et al., 2001; Ominato et al., 2002) and ongoing translation is

probably required (Lambein et al., 2003).

5. Biotic stress

In plants, an important process activated by infection or wounding is the
remodeling of the cell wall (Mehdy and Brodl, 1998). A key constituent of the response
to pathogens appears to be the degradation of a subset of preexisting mRNAs. An
excellent example of the regulation of mRNA stability in response to biotic stress has
been characterized in Phaseolus vulgaris. In bean cells treated with fungal elicitor, the
transcripts of PvPRP] , a gene encoding a proline-rich protein believed to be a component
of the cell wall, decrease to ~6% of the original level within 4 hr (Zhang et al., 1993).
After actinomycin D treatment, the PvPRP] transcript has a half-life of 60 hr in the
absence of fimgal elicitors and 18 hr in the presence of fungal elicitors. Furthermore,
transcriptional rates remain constant regardless of the presence or absence of the elicitor.
A subsequent study by Zhang and Mehdy (1994) identified a 50 kDa protein, PRP-BP,
which specifically binds to a U-rich sequence in the 3' UTR of PvPRP] mRNA (see later

for details). The RNA-binding activity of PRP-BP is redox regulated in vitro and its

14

activity is induced in response to fungal elicitor treatment prior to the onset of PvPRP]
mRNA degradation. On the basis of PRP-BP activation upon elicitor treatment and its
specificity of RNA binding, it has been postulated that the interaction of PRP-BP with
PvPRP] mRNA may be one component in the process of elicitor-induced PvPRP]
mRNA degradation (Mehdy and Brodl, 1998).

In soybean cells, glucan elicitors induce a decrease of the tubBl (B-tubulin 1
isoform) transcript level, most likely by enhancing its degradation, while the transcript
level of another tubulin isoform tubBZ is not affected by this elicitor (Ebel et al., 2001).
Direct evidence that the major control of this down-regulation is at the level of mRNA
stability was provided by the observation that in the presence of cordycepin, the half-life
of tubBI mRNA decreased upon addition of the elicitor. Pre-incubation with Ca2+
modulators blocked the decrease of tubB] mRN A levels, suggesting that calcium might
be involved in the regulation of tubB] message levels. The down-regulation of tubBI
mRN A levels induced by these elicitors could result from a general redirection of the
available cellular resources to defense-related metabolism (Ebel etal., 2001). In
mammalian cells, B-tubulin mRNAs are destabilized in the presence of free tubulin
heterodimers (Theodorakis and Cleveland, 1992) and a similar mechanism could be
occurring in plant cells where tubBImRNA is degraded due to depolymerization of

specific microtubules.
6. Abiotic stress

Abiotic stress may result from water deficit or excess, extreme heat or cold, toxic

substances, salinity or drought and ultraviolet light. Like biotic stress, the regulation of

15

mRNA stability is an important step for the regulation of some genes in the abiotic stress
responses. The steady-state level of transcripts encoding the pyrroline-S-carboxylate
reductase of Arabidopsis (At-P5R) is upregulated under salt and heat stress and this
induction is mainly due to an enhanced mRNA stability (Hua et al., 2001) mediated by its
5' UTR. In carrots, heat shock disrupts the function of the 5' cap and the poly(A) tail
structures, resulting in the loss of translational competence but increases in mRNA
stability (Gallie et al., 1995). In wheat, it has been reported that the activity of RNases
decreases following heat shock and is in correlation with an increase in mRNA half-life
(Chang and Gallie, 1997). In gibberellic acid-stimulated barley aleurone layers, heat
shock reduces the half-life of a-amylase mRNA (Belanger et al., 1986) and other
secreted hydrolases but does not affect the mRNA levels for non-secretory proteins
(Brodl and Ho, 1991). Heat shock also decreases the levels of some wound-inducible
mRNAs encoding extra-cellular proteins in carrot root disks and using cordycepin as a
transcriptional inhibitor, it was shown that this decrease in mRNA levels is due to
accelerated mRN A turnover during heat shock (Brodl and Ho, 1992).

Plants vary widely in response to cold temperature and there is evidence that
altered gene expression occurs during cold acclimation (Thomashow, 1998). The increase
in transcript levels for some cor (cold-regulated) genes from Arabidopsis, in response to
cold stress, has been shown to be mainly at the posttranscriptional level, possibly due to
increased transcript stability (Hajela et al., 1990). In alfala, transcripts of a cold
acclimation-specific gene c0518 are destabilized upon return to warm temperature

(Wolfraim et al., 1993).

16

cis- ACTING DETERMINANTS OF mRNA STABILITY

The majority of mRNAs fall in the stable range of mRNA half-lives for a given
organism (Taylor and Green, 1995; Ross, 1996). This observation led to the hypothesis
that mRNAs might have sequence elements that can either act constitutively to establish
the inherent instability of a particular transcript or modulate the stability of an mRNA in
response to certain physiological, developmental, or environmental cues. Many cis-acting
elements have been identified that target transcripts for rapid turnover in plants as well as
other systems (reviewed in Abler and Green, 1996; Ross, 1995).

A number of studies conducted over several years have suggested a function for
the 7-methyl-G cap at the 5' end and the poly(A) tail at the 3' end, two cis-acting
determinants that are common to all plant mRN As, as mRN A stabilizing structures. It is
known that in the major mRNA degradation pathway of yeast these stabilizing structures
are removed, or at least in the case of the poly(A) tail, greatly shortened, prior to

degradation catalyzed by exoribonucleases (Decker and Parker, 1993).

l. DST element

In plants, an instability determinant called DST (Newman etal., 1993) has been
studied in detail. The DST (gowngtream) element was first identified as a highly
conserved sequence in the 3' UTRs of the soybean SA UR genes (McClure et al., 1989).
The SA UR (small-auxin-up—RNAS) genes encode unstable transcripts whose half-lives
have been estimated to be on the order of 10-50 minutes (McClure and Guilfoyle, 1987;
Franco et al., 1990). Although the function of the SAUR proteins is unknown, the

temporal and spatial expression of SA UR genes correlates with auxin-induced cell

17

elongation (McClure and Guilfoyle, 1989). Detailed studies of SA UR gene expression in
Arabidopsis have been carried out on the SA UR-A C] gene, which contains the DST
element in its 3' UTR. Examination of chimeric gene expression has shown that the
promoter region is responsible for auxin induction, the 3' UTR is largely responsible for
rapid mRN A turnover and the coding region contributes to low mRN A abundance but not
by decreasing mRNA half-life (Gil and Green, 1996).

A synthetic dimer of the DST element has been demonstrated to be sufficient to
destabilize normally stable reporter transcripts in stably transformed tobacco cell
suspension cultures (Newman et al., 1993). DST sequences act as potent instability
determinants in intact plants as well as in cultured cells because DST elements also cause
a marked decrease in mRNA abundance relative to controls in transgenic tobacco plants.
The prototype DST, from SA UR15A of soybean, is about 45 base pairs in length and
consists of three highly conserved subdomains separated by two variable regions
(Newman et al., 1993). Site-directed mutagenesis studies have been performed in order to
determine which features of the DST element are critical for its instability function
(Sullivan and Green, 1996). Residues within the conserved second and third subdomains,
the ATAGAT and the GTA regions respectively, have been found to be necessary for the
DST element to function as an instability determinant.

As mentioned above, the DST element has 3 conserved subdomains, of which the
ATAGAT and the GTA subdomains are critical for its instability function. Five- and six-
base substitutions in the ATAGAT and the GTA regions resulted in inactivation of the
instability function of the DST element in suspension cell cultures as well as in transgenic

plants, while smaller two-base substitution mutations resulted in inactivation of DST in

18

transgenic tobacco leaves but had varying effects on DST function in tobacco cell culture
(Sullivan and Green, 1996). These results suggest that the DST element might be
recognized differently in different cell types.

Interestingly, the SA UR-A C] 3' UTR contains one canonical DST element located
80 bp downstream of the stop codon and 10 bp upstream of the poly(A) addition site (Gil
et al., 1994). Earlier experiments have indicated that two copies of the synthetic DST
element are required for instability function (Newman et al., 1993). There are several
ATAGAT-like and GTA-like subdomains of the DST sequence located just upstream of
the classically defined DST element within the SA UR-A C] 3' UTR. These sites may be
serving as multiple recognition sites for DST-mediated decay within the SA UR-AC] 3'
UTR. Recently additional genes have been identified that have DST-like subdomains
rather than a classical DST sequence like those in soybean SA UR genes (Pérez-Amador et
al., 2001). Furthermore there is accumulating data in favor of multiple subdomains being
sufficient for instability function (Feldbriigge et al., 2002).

Thus far, the DST element appears to be unique to plants. Visual inspection of
known eukaryotic instability determinants has not led to the identification of any
elements that contain all the characteristic features of a DST element. However,
similarities have been noticed in sequence between the GTA region and animal mRNA
elements which are bound by proteins containing a Pumilio-like RNA-binding domain
(Feldbrfigge et al., 2002; Zamore et al., 1999). To investigate whether the plant DST
mRNA instability determinant is also recognized in mammalian cells, DST element
variants were tested in mouse NIH3T3 fibroblasts, a well-defined model system to

monitor mRNA decay in mammalian cells (Zubaiga et al., 1995). From the

19

aforementioned experiments, it seems that the plant DST element is not recognized in
animal cells with the same sequence requirements as in plant cells. Therefore, its mode of
recognition may be plant-specific (Feldbriigge et al., 2002). Interestingly, the GTA region
interacts with the human Pumilio-like protein HsPUM in in vitro binding studies
(Feldbriigge et al., 2002). This raises the intriguing possibility that this region is
recognized by Arabidopsis proteins containing the same type of RNA-binding domain i.e.

AtPUMs.

2. AUUUA sequences

The most widely studied instability determinants in mammalian cells are the AU-
rich elements (ARES). ARES are found in the 3' UTRs of several of the most unstable
mammalian transcripts, such as lymphokine, cytokine and proto-oncogene mRNAs (Chen
and Shyu, 1995). Repeats of the pentamer, AUUUA, are often found in these AU-rich
elements and have been shown to be important for their instability function (Shyu et al.,
1991; Vakalopoulou et al., 1991). Many functional ARES mediate deadenylation as the
first step in mRNA decay, although different classes of ARES exhibit different reaction
kinetics (Chen and Shyu, 1995).

AUUUA repeats are likely to be of broad significance in higher eukaryotes, since
they can target transcripts for rapid decay in plants (Ohme-Takagi et al., 1993), and
recent evidence suggests that the ARE-mediated decay pathway is functional in yeast as
well (Vasudevan and Peltz, 2001). Reporter transcripts containing 11 repeats of the
AUUUA motif were degraded more rapidly in plants as compared to an AU-rich control

lacking AUUUA repeats (Ohme-Takagi et al., 1993). AUUUA motifs present in the 3'

20

UTR of PvPRPI have been proposed to trigger mRNA degradation (Zhang and Mehdy,
1994) in common bean. Three AUUUA motifs are present in the 3' UTR of tubB] but
none have been found in the 3' UTR of tubBZ, which suggests differential regulation via
degradation or stabilization of the message for the two different tubulin isoforms, as
discussed earlier (Ebel et al., 2001). In rice, the entire aAmy3 3' UTR and two of its
subdomains can independently mediate sugar-dependent repression of reporter mRN A
accumulation (Chan and Yu, 1998). Examination of the nucleotide sequences has
revealed that domains I and 111 each contain a stretch of a 9-bp AU-rich conserved
sequence. Moreover, RNA structure prediction of the 3' UTR identified extensive regions
of putative duplex formation, and regions encompassing domains I, II and 111 each
contained a putative stem-loop structure. Also the 9-bp conserved AU-rich sequence is

located in the loop regions of both domains I and III (Chan and Yu, 1998).

3. 5' UTR

Theoretically, the half-life of all mRNAs can be affected by how its 5' UTR
influences its translational efficiency. Light-mediated changes in transcript stability are
known to occur for the Fed-1 mRNA in pea (Dickey et al., 1992). A major light response
element, iLRE, in the pea F ed—I gene is located within the transcription unit and spans a
portion of the 5' UTR and the first 20 codons of the coding region. A CATT repeat
element, located near the 5' UTR, has been identified as being essential for light
regulation (Dickey et al., 1998). This element is important for mRNA stability since two
different mutations in the CATT repeat element altered dark-induced F ed—I mRNA

disappearance. Recently it was demonstrated that mRNA containing the F ed-I iLRE

21

ceases translation and dissociates from polyribosomes soon after plants are transferred
from light to darkness, providing support for the model that Fed-1 mRNA is protected
from degradation in light by association with ribosomes and/or the act of translation
(Hansen et al., 2001).

The 5' UTR of the pea Lhcb] *4 transcript contains a sequence involved in the
regulation of transcript stability (Anderson et al., 1999). No known specific mechanisms
by which the destabilization mediated through the 5' UTR occurs have been reported.
However, it is plausible to postulate that the element somehow stalls translation, exposes
the RNA which is then subject to digestion by RN ase activity (Abler and Green, 1996).
The first 92 bp region of the At-P5R 5' UTR is sufficient to mediate transcript
stabilization during salt and heat stress (Hua et al., 2001). In silica analysis has predicted
that extensive secondary structures in the 5' UTR and high GC content further stabilize
the secondary structures. The At-P5R 5'UTR also contains a 26 bp sequence, repeated
seven times, which has sequence identity with a part of the 3' non-coding region of a
potential retrovirus (Hua et al., 2001). It is possible that the 26 bp region binds protein

factors stabilizing the secondary structures during stress.

GENERAL mRNA DECAY MACHINERY

In contrast to the factors that are involved in the recognition of specific sequences
within mRNAs, proteins which are responsible for general mRNA degradation can be
considered to constitute the basal mRNA degradation machinery. The basal mRNA

decay machinery catalyzes the degradation of mRNAs from many different genes, while

22

sequence specific mRNA binding proteins probably recruit the basal mRNA decay
machinery to specific target molecules, or modulate the degradative activity of the basal
machinery.

In yeast, mRNA turnover is mediated by mRNA decay pathways that use shared,
as well as distinct components of the basal mRNA decay machinery (reviewed in
Tourriere et al., 2002). It is likely that mRNA decay in Arabidopsis, as well as in other
higher plants also occurs through multiple degradation pathways. There are several
Arabidopsis homologs of the yeast basal mRNA decay machinery suggesting that mRN A
turnover in Arabidopsis may resemble the mRN A decay pathways of yeast (Gutierrez et
al., 1999). However, plant-specific mRNA decay pathways and mechanisms are also
likely to be functioning since apparent differences have been observed between the two
systems (Kastenmayer et al., 2001).

The mechanisms responsible for mRNA degradation are most well understood in
yeast. In yeast, the deadenylation-dependent-decapping pathway appears to be the main
pathway for mRNA degradation. In this pathway, mRNAs are deadenylated by a
complex of proteins including Caflp and Ccr4p (Daugeron et al., 2001; Tucker and
Parker, 2000). This deadenylation reaction shortens the poly(A) tail to a length of 10—12
adenylates (Decker and Parker 1993). Shortening of the poly(A) tail then triggers
decapping catalyzed by Dcplp (LaGrandeur and Parker, 1998) and associated factor
Dcp2p (Dunckley and Parker, 1999), after which the decapped transcripts are degraded
from the 5’ end by the 5’-3’ exoribonuclease Xmlp (Muhlrad et al., 1994).

In addition to the major mRNA decay pathway, several minor mRNA decay pathways

operate in yeast. The nonsense mediated decay pathway, responsible for the degradation

23

of mRNAs containing premature nonsense codons, is similar to the major decay pathway;
however, 5’-3 degradation catalyzed by Xmlp is not dependent on prior deadenylation
(Muhlrad and Parker, 1994). Degradation of mRNAs is also catalyzed from the 3’ end
following deadenylation by a multi-protein complex, the exosome. The exosome and its
associated co-factors in yeast consists of greater than 15 proteins, at least 10 of which are

homologous to 3’-5’ exoribonucleases from E. coli (van Hoof and Parker, 1999).

SEQUENCE-SPECIFIC DECAY

Sequence-specific mRN A degradation determines the degradation rate of
particular mRNAs. The instability determinants can be thought to target certain
transcripts to the mRNA decay machinery. In mammals, sequence-specific RNA binding
proteins have been identified that interact in vitro with sequences that regulate mRN A
stability. A number of proteins have been hypothesized to fimction in ARE-mediated
decay based on in vitro activity, the best characterized of which are the human HuR/HuA
protein and AUFl/hnRNP D. HuR belongs to a family of RNA-binding proteins related
to the Drosophila embryonic lethal abnormal visual (ELAV) proteins. Overexpression of
HuR in vivo (Fan and Steitz, 1998) and increased levels of HuR or other ELAV-like
proteins in vitro (Ford et al., 1999) lead to stabilization of ARE-containing mRNAs. In
contrast, in vivo depletion of AUFl/hnRNP D leads to a strong stabilization of diverse
ARE-containing mRNAs whereas ectopic expression restores destabilization (Loflin et
al., 1999). These data suggest that HuR and hnRNP D have antagonistic effects on the

stability of ARE-containing mRNAs.

24

For another mammalian protein, tristetraprolin, a mouse insertional mutant was
available, and demonstrating a role in ARE-mediated decay was more definitive. Half-
life measurements showed that TNF-a mRN A, which contains AUUUA elements in its
3'UTR, was stabilized in cells from the tristetraprolin deficient mutant relative to wild-
type (Carballo et al., 1998). Subsequently, the protein was shown to bind AUUUA
sequences in vitro indicating that it functions to target TNF-a for ARE-mediated decay
(Lai et al., 1999). More recently, it has been shown that tristetraprolin deficient mice are
also defective in the deadenylation of ARE-containing GM-CSF mRNA (Carballo et al.,
2000)

To date, no mRNA-binding proteins have been identified in plants that are known
to play a role in the control of mRN A stability. One plant mRNA-binding protein which
may function in controlling stability is a 50 kDa protein that binds to a sequence in the 3'
UTR of the bean PvPRPI mRN A (Zhang and Mehdy, 1994). The PvPRP] transcript,
which appears to encode a cell wall protein, is rapidly degraded following the addition of
fungal elicitor. The protein-binding Site, a 27-nt U-rich sequence, has not yet been
demonstrated to be a determinant involved in this destabilization event, but the protein
binding activity in extracts increases in response to fungal elicitor treatment, consistent
with this scenario.

Genetic approaches have rarely been applied to mRN A stability problems in
multicellular organisms. The majority of the studies aimed at understanding the cellular
factors in mRNA decay pathways have involved characterization of proteins that bind the
instability sequences in vivo. Many RNA-binding proteins have been isolated that

interact with ARES in vitro (discussed above). Isolation of sequence-specific RNA-

25

binding proteins, involved in mRNA stability, from plant cells has not been as successful,

perhaps because it is difficult to prepare cytoplasmic protein extracts that are free of non-

specific ribonucleases. This may be due to the presence of the plant vacuole, which is
known to contain many non-specific ribonucleases and other hydrolytic enzymes that are
released upon cell rupture during cell extract praparation.

One exception iS the recent isolation of mutant mammalian cell lines that stabilize
green fluorescent protein (GFP)-IL-3 reporter transcripts (Stoecklin et al., 2000). In this
screen, two loci involved in rapid mRNA turnover mediated by the interleukin-3 (IL-3)
3'UTR were identified by screening mutagenized human HT1080 fibrosarcoma cells for
elevated green flourescence. One of the mutants was rescued by a cDNA corresponding
to butyrate-response factor-1 (BRFl), which is a Zn finger protein homologous to
tristetraprolin (Stoecklin et al., 2002).

In order to understand the molecular basis of sequence-specific recognition and
degradation of unstable mRNAs, an approach was devised to isolate Arabidopsis mutants
defective in DST-mediated mRNA degradation (Johnson et al., 2000). This approach
allows several important advantages, such as:

1. Genes identified in a mutant selection would be very likely to play a role in mRNA
degradation in vivo. Of particular interest would be the cellular factors that might be
involved in sequence-specific interactions.

2. Basic information about the mechanisms of mRNA degradation may be obtained by
studying mutants since a genetic approach offers an alternative to biochemical

approaches that have proved difficult.

26

dst], dst2 and dst3 were isolated based on their ability to stabilize specific DST-
containing transgene mRNAs (Johnson et al., 2000; Chapter 5). For this strategy, two
transgenes, hygromycin phosphotransferase (HPH) and B-glucuronidase (GUS), both
containing a tetramer of the consensus DST element in the 3' UTR, were introduced into
Arabidopsis as selectable and screenable markers, respectively. The presence of the DST
elements decreased the mRN A levels for both transgenes, HPH-DST and GUS-DS T,
resulting in decreased resistance to hygromycin and low GUS activity. The dst mutants
were isolated as hygromycin resistant plants with increased GUS activity due to
stabilization of the corresponding mRNAs. In addition, dst mutants have elevated levels
of SA UR-A C1 mRN A, the only endogenous DST-containing unstable transcript
characterized thus far (Gil and Green, 1996; Johnson et al., 2000). The dst mutants that
we isolated are extremely rare (3/~800,000), are all codominant and exhibit no obvious
morphological or developmental phenotype (Johnson et al., 2000). The simplest
explanation to account for the mutant phenotype observed in the dst mutants would be
that the gene corresponds to a sequence-Specific RNA-binding protein or a ribonuclease.
Alternatively, it could encode for a regulatory factor that controls one of these
components.

To evaluate the physiological significance of the DST-mediated mRNA
degradation pathway, we sought to identify additional molecular markers of dst] using
DNA microarrays. In addition to the identification of novel targets of dst], the microarray
experiments provided the first indication of an association between circadian rhythms and

DST-mediated decay (Pe'rez-Amador et al., 2001; Chapter 3).

27

PERSPECTIVE

Recent advances have begun to shed light on the mechanisms that underlie
mRNA turnover in eukaryotic systems. Exciting progress has been made with cis- and
trans-acting determinants of mRN A stability, but there is much to be learned about how
other factors such as exogenous or endogenous stimuli interact with and affect mRN A
decay. The identity of all the players participating in the mRNA degradation process as
well as the rules governing Specific RNA degradation remains to be elucidated. By
combining the power of genomics with traditional genetic and biochemical approaches, it

should be possible to better define the influence of transcript stability on gene expression.

28

REFERENCES

Abler, M. L., and Green, P. J. (1996). Control of mRNA stability in higher plants. Plant
Mol Biol 32, 63-78.

Anderson, M. B., Folta, K., Warpeha, K. M., Gibbons, J ., Gao, J ., and Kaufman, L. S.
(1999). Blue light-directed destabilization of the pea Lhcbl *4 transcript depends on
sequences within the 5' untranslated region. Plant Cell 11, 1579-1590.

Aoyama, T., and Chua, N. H. (1997). A glucocorticoid—mediated transcriptional induction
system in transgenic plants. Plant J 11, 605-612.

Belanger, F. C., Brodl, M. R., and Ho, T. H. (1986). Heat shock causes destabilization of
specific mRNAs and destruction of endoplasmic reticulum in barley aleurone cells. Proc
Natl Acad Sci U S A 83, 1354-1358.

Bernstein, J. A., Khodursky, A. B., Lin, P. H., Lin-Chao, S., and Cohen, S. N. (2002).
Global analysis of mRN A decay and abundance in Escherichia coli at single-gene
resolution using two-color fluorescent DNA microarrays. Proc Natl Acad Sci U S A 99,
9697-9702.

Brodl, M. R., Ho T.h-D. (1991). Heat shock causes selective destabilization of secretory
protein mRNAs in barley aleurone cells. Plant Physiol 96, 1048-1052.

Brodl, M. R., Ho T.h-D. (1992). Heat shock in mechanically wounded carrot root discs
causes the destabilization of stable secretory protein mRNA and the dissociation of
endoplasmic reticulum lamellae. Physiol Plant 86, 253-262.

Caddick, M. X., Greenland, A. J., Jepson, 1., Krause, K. P., Qu, N., Riddell, K. V., Salter,
M. G., Schuch, W., Sonnewald, U., and Tomsett, A. B. (1998). An ethanol inducible gene
switch for plants used to manipulate carbon metabolism. Nat Biotechnol 16, 177-180.

Caponigro, G., and Parker, R. (1996). Mechanisms and control of mRNA turnover in
Saccharomyces cerevisiae. Microbiol Rev 60, 233-249.

Carballo, R, Lai, W. S., and Blackshear, P. J. (1998). Feedback inhibition of macrophage
tumor necrosis factor-alpha production by tristetraprolin. Science 281, 1001-1005.

Carballo, E., Lai, W. S., and Blackshear, P. J. (2000). Evidence that tristetraprolin is a
physiological regulator of granulocyte-macrophage colony-stimulating factor messenger
RNA deadenylation and stability. Blood 95, 1891-1899.

Chan, M. T., and Yu, S. M. (1998). The 3' untranslated region of a rice alpha-amylase
gene mediates sugar-dependent abundance of mRN A. Plant J 15, 685-695.

29

Chang, S. C., and Gallie, D. R. (1997). RNase Activity Decreases following a Heat Shock
in Wheat Leaves and Correlates with Its Posttranslational Modification. Plant Physiol
113, 1253-1263.

Chen, C. Y., and Shyu, A. B. (1995). AU-rich elements: characterization and importance
in mRNA degradation. Trends Biochem Sci 20, 465-470.

Chiba, Y., Ishikawa, M., Kijima, F., Tyson, R. H., Kim, J., Yamamoto, A., Nambara, E.,
Leustek, T., Wallsgrove, R. M., and Naito, S. (1999). Evidence for autoregulation of
cystathionine gamma-synthase mRNA stability in Arabidopsis. Science 286, 1371-1374.

Daugeron, M. C., Mauxion, F ., and Seraphin, B. (2001). The yeast POP2 gene encodes a
nuclease involved in mRNA deadenylation. Nucleic Acids Res 29, 2448-2455.

Decker, C. J ., and Parker, R. (1993). A turnover pathway for both stable and unstable
mRNAs in yeast: evidence for a requirement for deadenylation. Genes Dev 7, 1632-1643.

DeRisi, J. L., Iyer, V. R., and Brown, P. O. (1997). Exploring the metabolic and genetic
control of gene expression on a genomic scale. Science 278, 680-686.

Dickey, L. F ., Gallo-Meagher, M., and Thompson, W. F. (1992). Light regulatory
sequences are located within the 5' portion of the Fed-1 message sequence. Embo J 11,
2311-2317.

Dickey, L. F., Nguyen, T. T., Allen, G. C., and Thompson, W. F. (1994). Light
modulation of ferredoxin mRN A abundance requires an open reading frame. Plant Cell 6,
1171-1176.

Dickey, L. F ., Petracek, M. E., Nguyen, T. T., Hansen, E. R., and Thompson, W. F.
(1998). Light regulation of Fed-1 mRNA requires an element in the 5' untranslated region
and correlates with differential polyribosome association. Plant Cell 10, 475-484.

Dietrich, M. A., Prenger, J. P., and Guilfoyle, T. J. (1990). Analysis of the genes
encoding the largest subunit of RNA polymerase II in Arabidopsis and soybean. Plant
Mol Biol 15, 207-223.

Downes, B. P., and Crowell, D. N. (1998). Cytokinin regulates the expression of a
soybean beta-expansin gene by a post-transcriptional mechanism. Plant Mol Biol 37,
437-444.

Dunckley, T., and Parker, R. (1999). The DCP2 protein is required for mRN A decapping

in Saccharomyces cerevisiae and contains a functional MutT motif. Embo J 18, 5411-
5422.

30

Ebel, C., Gomez, L. G., Schmit, A. C., NeuhauS-Url, G., and Boller, T. (2001).
Differential mRN A degradation of two beta-tubulin isoforrns correlates with cytosolic
Ca2+ changes in glucan-elicited soybean cells. Plant Physiol 126, 87-96.

Fan, X. C., and Steitz, J. A. (1998). Overexpression of HuR, a nuclear-cytoplasmic
shuttling protein, increases the in vivo stability of ARE-containing mRNAs. Embo J 17,
3448-3460.

Feldbrugge, M., Arizti, P., Sullivan, M. L., Zamore, P. D., Belasco, J. G., and Green, P. J.
(2002). Comparative analysis of the plant mRNA-destabilizing element, DST, in
mammalian and tobacco cells. Plant Mol Biol 49, 215-223.

Flores, S. and. Tobin, EM. (1988). Cytokinin modulation of LHCB mRNA levels: the
involvement of post-transcriptional regulation. Plant Mol Biol 11, 409-415.

F olta, K. M., and Kaufman, L. S. (1999). Regions of the pea Lhcbl *4 promoter necessary
for blue-light regulation in transgenic Arabidopsis. Plant Physiol 120, 747-756.

F olta, K. M., and Kaufman, L. S. (2003). Phototropin 1 is required for high-fluence blue-
light-mediated mRNA destabilization. Plant Mol Biol 51, 609-618.

Ford, L. P., Watson, J ., Keene, J. D., and Wilusz, J. (1999). ELAV proteins stabilize
deadenylated intermediates in a novel in vitro mRNA deadenylation/degradation system.
Genes Dev 13, 188-201.

Franco, A. R., Gee, M. A., and Guilfoyle, T. J. (1990). Induction and superinduction of
auxin-responsive mRNAs with auxin and protein synthesis inhibitors. J Biol Chem 265,
15845-15849.

Gallie, D. R., Caldwell, C., and Pitto, L. (1995). Heat Shock Disrupts Cap and Poly(A)
Tail Function during Translation and Increases mRNA Stability of Introduced Reporter
mRNA. Plant Physiol 108, 1703-1713.

Gil, P., Liu, Y., Orbovic, V., Verkamp, E., Poff, K. L., and Green, P. J. (1994).
Characterization of the auxin-inducible SAUR-AC1 gene for use as a molecular genetic
tool in Arabidopsis. Plant Physiol 104, 777-784.

Gil, P., and Green, P. J. (1996). Multiple regions of the Arabidopsis SAUR-AC1 gene
control transcript abundance: the 3' untranslated region functions as an mRNA instability
determinant. Embo J 15, 1678-1686.

Gossen, M., and Bujard, H. (1992). Tight control of gene expression in mammalian cells
by tetracycline-responsive promoters. Proc Natl Acad Sci U S A 89, 5547-5551.

31

Guhaniyogi, J ., and Brewer, G. (2001). Regulation of mRNA stability in mammalian
cells. Gene 265, 11-23.

Gutierrez, R. A., MacIntosh, G. C., and Green, P. J. (1999). Current perspectives on
mRNA stability in plants: multiple levels and mechanisms of control. Trends Plant Sci 4,
429-438.

Gutierrez, R. A., Ewing, R. M., Cherry, J. M., and Green, P. J. (2002). Identification of
unstable transcripts in Arabidopsis by cDNA microarray analysis: rapid decay is
associated with a group of touch- and specific clock-controlled genes. Proc Natl Acad Sci
U S A 99,11513-11518.

Hajela, R. K., Horvath, D.P., Gilmour, S.J., Thomashow, M.F. (1990). Molecular cloning
and expression of cor (cold regulated) genes in Arabidopsis thaliana. Plant Physiol 93,
1246-1252.

Hansen, E. R., Petracek, M. E., Dickey, L. F ., and Thompson, W. F. (2001). The 5' end of
the pea ferredoxin-1 mRNA mediates rapid and reversible light-directed changes in
translation in tobacco. Plant Physiol 125, 770-778.

Herrick, D., Parker, R., and Jacobson, A. (1990). Identification and comparison of stable
and unstable mRNAs in Saccharomyces cerevisiae. Mol Cell Biol 10, 2269-2284.

Ho, S., Chao, Y., Tong, W., and Yu, S. (2001). Sugar coordinately and differentially
regulates growth- and stress-related gene expression via a complex Signal transduction
network and multiple control mechanisms. Plant Physiol 125, 877-890.

Holstege, F. C., Jennings, E. G., Wyrick, J. J., Lee, T. 1., Hengartner, C. J., Green, M. R.,
Golub, T. R., Lander, E. S., and Young, R. A. (1998). Dissecting the regulatory circuitry
of a eukaryotic genome. Cell 95, 717-728.

Holtorf, H., Schob, H., Kunz, C., Waldvogel, R., and Meins, F ., Jr. (1999). Stochastic and
nonstochastic post-transcriptional silencing of chitinase and beta-1,3-glucanase genes
involves increased RNA tumover-possible role for ribosome-independent RNA
degradation. Plant Cell 11, 471-484.

Hua, X. J ., Van de Cotte, B., Van Montagu, M., and Verbruggen, N. (2001). The 5'
untranslated region of the At-P5R gene is involved in both transcriptional and post-
transcriptional regulation. Plant J 26, 157-169.

Johnson, M. A., Perez-Amador, M. A., Lidder, P., and Green, P. J. (2000). Mutants of
Arabidopsis defective in a sequence-Specific mRNA degradation pathway. Proc Natl
Acad Sci U S A 97, 13991-13996.

32

Kastenmayer, J. P., Johnson, M. A., and Green, P. J. (2001). Analysis of XRN orthologs
by complementation of yeast mutants and localization of XRN-GFP fusion proteins.
Methods Enzymol 342, 269-282.

Kaufman, L. S. (1993). Transduction of Blue-Light Signals. Plant Physiol 102, 333-337.

LaGrandeur, T. E., and Parker, R. (1998). Isolation and characterization of Dcplp, the
yeast mRNA decapping enzyme. Embo J 17, 1487-1496.

Lai, W. S., Carballo, E., Strum, J. R., Kennington, E. A., Phillips, R. S., and Blackshear,
P. J. (1999). Evidence that tristetraprolin binds to AU-rich elements and promotes the
deadenylation and destabilization of tumor necrosis factor alpha mRNA. Mol Cell Biol
19, 4311-4323.

Lam, L. T., Pickeral, O. K., Peng, A. C., Rosenwald, A., Hurt, E. M., Giltnane, J. M.,
Averett, L. M., Zhao, H., Davis, R. E., Sathyamoorthy, M., et al. (2001). Genomic-scale
measurement of mRNA turnover and the mechanisms of action of the anti-cancer drug
flavopiridol. Genome Biol 2, 1-11.

Lambein, 1., Chiba, Y., Onouchi, H., and Naito, S. (2003). Decay kinetics of
autogenously regulated CGSl mRN A that codes for cystathionine gamma-synthase in
Arabidopsis thaliana. Plant Cell Physiol 44, 893-900.

Lincoln, J. E., and Fischer, R. L. (1988). Diverse mechanisms for the regulation of
ethylene-inducible gene expression. Mol Gen Genet 212, 71-75.

Loflin, P., Chen, C. Y., and Shyu, A. B. (1999). Unraveling a cytoplasmic role for
hnRN P D in the in vivo mRNA destabilization directed by the AU-rich element. Genes
Dev 13, 1884-1897.

Love, J., Scott, A. C., and Thompson, W. F. (2000). Technical advance: stringent control
of transgene expression in Arabidopsis thaliana using the ToplO promoter system. Plant J
21, 579-588.

Maillet, I., Buhler, J. M., Sentenac, A., and Labarre, J. (1999). pr4p is necessary for
RNA polymerase II activity at high temperature. J Biol Chem 274, 22586-22590.

McCarthy, J. E. (1998). Posttranscriptional control of gene expression in yeast. Microbiol
Mol Biol Rev 62, 1492-1553.

McClure, B. A. and. Guilfoyle, T. (1987). Characterization of a class of small auxin-
inducible soybean polyadenlyated RNAS. Plant MolBiol 9, 611-623.

McClure, B. A., Hagen, G., Brown, C. S., Gee, M. A., and Guilfoyle, T. J. (1989).

Transcription, organization, and sequence of an auxin-regulated gene cluster in soybean.
Plant Cell 1, 229-239.

33

McClure, B. A., and Guilfoyle, T. (1989). Rapid redistribution of auxin-regulated RNAS
during gravitropism. Science 243, 91-93.

Mehdy, M. C. and. Brodl, MR. (1998). The role of stress in regulating mRNA stability.
In A look beyond transcription: Mechanisms determining mRNA stability and translation
in plants (J Bailey-Serres and DR Gallie, eds American Society of Plant Physiologists),
64-67.

Mitchell, P., and T ollervey, D. (2001). mRNA turnover. Curr Opin Cell Biol 13, 320-325.

Muhlrad, D., Decker, C. J ., and Parker, R. (1994). Deadenylation of the unstable mRNA
encoded by the yeast MF A2 gene leads to decapping followed by 5'-->3' digestion of the
transcript. Genes Dev 8, 855-866.

Muhlrad, D., and Parker, R. (1994). Premature translational termination triggers mRNA
decapping. Nature 370, 578-581.

Newman, T. C., Ohme-Takagi, M., Taylor, C. B., and Green, P. J. (1993). DST
sequences, highly conserved among plant SAUR genes, target reporter transcripts for
rapid decay in tobacco. Plant Cell 5, 701-714.

Ohme-Takagi, M., Taylor, C. B., Newman, T. C., and Green, P. J. (1993). The effect of
sequences with high AU content on mRN A stability in tobacco. Proc Natl Acad Sci U S
A 90,11811-11815.

Ominato, K., Akita, H., Suzuki, A., Kijima, F ., Yoshino, T., Yoshino, M., Chiba, Y.,
Onouchi, H., and Naito, S. (2002). Identification of a short highly conserved amino acid
sequence as the functional region required for posttranscriptional autoregulation of the
cystathionine gamma-synthase gene in Arabidopsis. J Biol Chem 277, 36380-36386.

Ortega, J. L., Temple, S. J ., and Sengupta-Gopalan, C. (2001). Constitutive
overexpression of cytosolic glutamine synthetase (GSl) gene in transgenic alfalfa
demonstrates that GSl may be regulated at the level of RNA stability and protein
turnover. Plant Physiol 126, 109-121.

Padidam, M., Gore, M., Lu, D. L., and Smimova, O. (2003). Chemical-inducible,
ecdysone receptor-based gene expression system for plants. Transgenic Res 12, 101-109.

Perez-Amador, M. A., Lidder, P., Johnson, M. A., Landgraf, J ., Wisman, E., and Green,
P. J. (2001). New molecular phenotypes in the dst mutants of Arabidopsis revealed by
DNA microarray analysis. Plant Cell 13, 2703-2717.

Petracek, M. E., Dickey, L. F., Nguyen, T. T., Gatz, C., Sowinski, D. A., Allen, G. C.,

and Thompson, W. F. (1998). Ferredoxin-l mRNA is destabilized by changes in
photosynthetic electron transport. Proc Natl Acad Sci U S A 95, 9009-9013.

34

Petracek, M. E., Nuygen, T., Thompson, W. F., and Dickey, L. F. (2000). Premature
termination codons destabilize ferredoxin-l mRNA when ferredoxin-1 is translated. Plant
J 21, 563-569.

Ravanel, S., Gakiere, 8., Job, D., and Douce, R. (1998). Cystathionine gamma-synthase
from Arabidopsis thaliana: purification and biochemical characterization of the
recombinant enzyme overexpressed in Escherichia coli. Biochem J 331 ( Pt 2), 639-648.

Ross, J. (1995). mRNA stability in mammalian cells. Microbiol Rev 59, 423-450.

Ross, J. (1996). Control of messenger RNA stability in higher eukaryotes. Trends Genet
12, 171-175.

Scafe, C., Martin, C., Nonet, M., Podos, S., Okamura, S., and Young, R. A. (1990).
Conditional mutations occur predominantly in highly conserved residues of RNA
polymerase II subunits. Mol Cell Biol 10, 1270-1275.

Schena, M., Shalon, D., Davis, R. W., and Brown, P. O. (1995). Quantitative monitoring
of gene expression patterns with a complementary DNA microarray. Science 270, 467-
470.

Sheu, J. J ., Yu, T. S., Tong, W. F., and Yu, S. M. (1996). Carbohydrate starvation
stimulates differential expression of rice alpha-amylase genes that is modulated through

complicated transcriptional and posttranscriptional processes. J Biol Chem 271, 26998-
27004.

Shyu, A. B., Belasco, J. G., and Greenberg, M. E. (1991). Two distinct destabilizing
elements in the c-fos message trigger deadenylation as a first step in rapid mRN A decay.
Genes Dev 5, 221-231.

Silver, D. L., Pinaev, A., Chen, R., and De Bruijn, F. J. (1996). Posttranscriptional
Regulation of the Sesbania rostrata Early Nodulin Gene SrEnod2 by Cytokinin. Plant
Physiol 112, 559-567.

Stoecklin, G., Ming, X. F ., Looser, R., and Moroni, C. (2000). Somatic mRNA turnover
mutants implicate tristetraprolin in the interleukin-3 mRNA degradation pathway. Mol
Cell Biol 20, 3753-3763.

Stoecklin, G., Colombi, M., Raineri, I., Leuenberger, S., Mallaun, M., Schmidlin, M.,
Gross, B., Lu, M., Kitamura, T., and Moroni, C. (2002). Functional cloning of BRFl, a
regulator of ARE-dependent mRNA turnover. Embo J 21, 4709-4718.

Sullivan, M. L., and Green, P. J. (1996). Mutational analysis of the DST element in

tobacco cells and transgenic plants: identification of residues critical for mRN A
instability. RNA 2, 308-315.

35

Suzuki, A., Shirata, Y., Ishida, H., Chiba, Y., Onouchi, H., and Naito, S. (2001). The first
exon coding region of cystathionine gamma-synthase gene is necessary and sufficient for
downregulation of its own mRNA accumulation in transgenic Arabidopsis thaliana. Plant
Cell Physiol 42, 1174-1180.

Taylor, C. B., and Green, P. J. (1995). Identification and characterization of genes with
unstable transcripts (GUTS) in tobacco. Plant Mol Biol 28, 27-38.

Theodorakis, N. G., and Cleveland, D. W. (1992). Physical evidence for cotranslational
regulation of beta-tubulin mRNA degradation. Mol Cell Biol 12, 791-799.

Thomashow, M. F. (1998). Role of cold-responsive genes in plant freezing tolerance.
Plant Physiol 118, 1-8.

Tourriere, H., Chebli, K., and Tazi, J. (2002). mRNA degradation machines in eukaryotic
cells. Biochimie 84, 821-837.

Tucker, M., and Parker, R. (2000). Mechanisms and control of mRNA decapping in
Saccharomyces cerevisiae. Annu Rev Biochem 69, 571-595.

Vakalopoulou, E., Schaack, J ., and Shenk, T. (1991). A 32-kilodalton protein binds to
AU-rich domains in the 3' untranslated regions of rapidly degraded mRNAs. Mol Cell
Biol 11, 3355-3364.

van Hoof, A., and Parker, R. (1999). The exosome: a proteasome for RNA? Cell 99, 347-
350.

Vasudevan, S., and Peltz, S. W. (2001). Regulated ARE-mediated mRNA decay in
Saccharomyces cerevisiae. Mol Cell 7, 1 191-1200.

Vorst, 0., van Dam, F., Weisbeek, P., and Smeekens, S. (1993). Light-regulated
expression of the Arabidopsis thaliana ferredoxin A gene involves both transcriptional
and post-transcriptional processes. Plant J 3, 793-803.

Wang, Y., Liu, C. L., Storey, J. D., Tibshirani, R. J ., Herschlag, D., and Brown, P. O.
(2002). Precision and functional specificity in mRNA decay. Proc Natl Acad Sci U S A
99, 5860-5865.

Waterhouse, P. M., Graham, M.W., Wang, M.-B. (1998). resistance and gene silencing in
plants can be induced by Simultaneous expression of sense and antisense RNA. Proc Natl
Acad Sci USA 95, 13959-13964.

Weigel, D., Ahn, J. H., Blazquez, M. A., Borevitz, J. O., Christensen, S. K., Fankhauser,

C., Ferrandiz, C., Kardailsky, 1., Malancharuvil, E. J ., Neff, M. M., et a1. (2000).
Activation tagging in Arabidopsis. Plant Physiol 122, 1003-1013.

36

Weinmann, P., Gossen, M., Hillen, W., Bujard, H., and Gatz, C. (1994). A chimeric
transactivator allows tetracycline-responsive gene expression in whole plants. Plant J 5,
559-569.

Williamson, J. D., Quatrano, R. S., and Cuming, A. C. (1985). Em polypeptide and its
messenger RNA levels are modulated by abscisic acid during embryogenesis in wheat.
Eur J Biochem 152, 501-507.

Wolfraim, L. A., Langis, R., Tyson, H., and Dhindsa, R. S. (1993). cDNA sequence,
expression, and transcript stability of a cold acclimation-specific gene, cas18, of alfalfa
(Medicago falcata) cells. Plant Physiol 101, 1275-1282.

Yu, S. M., Lee, Y. C., Fang, S. C., Chan, M. T., Hwa, S. F ., and Liu, L. F. (1996). Sugars
act as signal molecules and osmotica to regulate the expression of alpha-amylase genes
and metabolic activities in germinating cereal grains. Plant Mol Biol 30, 1277-1289.

Zamore, P. D., Bartel, D. P., Lehmann, R., and Williamson, J. R. (1999). The PUMILIO-
RNA interaction: a single RNA-binding domain monomer recognizes a bipartite target
sequence. Biochemistry 38, 596-604.

Zhang, S., Sheng, J ., Liu, Y., and Mehdy, M. C. (1993). Fungal Elicitor—Induced Bean
Proline-Rich Protein mRNA Down-Regulation IS Due to Destabilization That IS
Transcription and Translation Dependent. Plant Cell 5, 1089-1099.

Zhang, S., and Mehdy, M. C. (1994). Binding of a 50-kD Protein to a U-Rich Sequence
in an mRNA Encoding a Proline-Rich Protein That Is Destabilized by Fungal Elicitor.
Plant Cell 6, 135-145.

Zubiaga, A. M., Belasco, J. G., and Greenberg, M. E. (1995). The nonamer

UUAUUUAUU is the key AU-rich sequence motif that mediates mRN A degradation.
Mol Cell Biol 15, 2219-2230.

37

CHAPTER 2

NEW MOLECULAR PHENOTYPES OF THE dst] MUTANT REVEALED BY

MICROARRAY ANALYSIS

Part of this chapter was published in “Pérez-Amador, M. A., Lidder, P., Johnson, M. A., Landgraf, J.,
Wisman, E., and Green, P. J. (2001). New molecular phenotypes in the dst mutants of Arabidopsis revealed
by DNA microarray analysis. Plant Cell 13, 2703-2717. Experiments done by Pérez-Amador, M.A. or in
collaboration with Pe’rez-Amador, M.A. are clearly marked.

38

INTRODUCTION

Cells must be able to adjust gene expression patterns quickly in order to respond
to intra- and extracellular stimuli; therefore, it is necessary for certain transcripts to reach
new steady-state levels rapidly. The steady state levels of eukaryotic mRNAs are
determined by both their rate of synthesis and rate of degradation. The control of mRNA
stability is a major determinant of steady-state messenger RNA levels in the cell and
ofien has a great impact on the level at which a particular gene is expressed. Further,
mRNA stability affects the rate at which new steady state RNA levels are achieved after
changes in transcription; the more unstable the mRN A, the more rapidly it reaches a new
steady state (Abler and Green, 1996).

Most recent studies on mRNA stability in eukaryotes have focused on transcripts
that are relatively unstable, generally with half-lives of less than 60 minutes (Ross, 1995;
Johnson et al., 1998). Unstable transcripts are particularly interesting because they often
correspond to genes that must be rapidly or stringently controlled, such as those involved
in regulating cell growth and differentiation. Transcripts that fall into this category
include phytochrome mRN A (Higgs etal., 1995) and several auxin-induced transcripts
(McClure and Guilfoyle, 1989) in plants, mating-type transcripts in yeast (Peltz and
Jacobson, 1992) and several proto-oncogene transcripts in mammalian cells (Greenberg
and Belasco, 1993).

The majority of mRNAs fall in the stable range of mRNA half-lives for a given
organism (Taylor and Green, 1995; Ross, 1996). Thus, within the body of unstable

mRNAs, specific sequence motifs must be present that can either act constitutively to

39

establish the inherent instability of a particular transcript or modulate the Stability of an
mRNA in response to certain physiological, developmental, or environmental cues.

The most widely studied instability determinants are the mammalian AU-rich
elements (ARES). ARES are found in the 3' untranslated region (UTR) of several of the
most unstable mammalian transcripts, such as lymphokine, cytokine and proto-oncogene
mRNAs (Chen and Shyu, 1995). Repeats of the pentamer AUUUA are often found in
these AU-rich elements and are important for their instability function (Shyu et al., 1991;
Vakalopoulou et al., 1991). AUUUA repeats are likely to be of broad significance in
higher eukaryotes, since they can target transcripts for rapid decay in plants (Ohme-
Takagi et al., 1993), and recent evidence suggests that the ARE-mediated decay pathway
is firnctional in yeast as well (Vasudevan and Peltz, 2001). It seems that all functional
ARES mediate deadenylation as the first step in mRNA decay, although different classes
of ARES exhibit different reaction kinetics (Chen and Shyu, 1995).

In plants, besides ARES, an instability determinant called DST (Newman et al.,
1993) has been studied in detail. The DST (Qowngtream) element was first identified as a
highly conserved sequence in the 3' UTRS of the soybean SA UR genes (McClure et al.,
1989). The SA UR (small-auxin-up-RNAS) genes encode unstable transcripts whose half-
lives have been estimated to be on the order of 10-50 minutes (McClure and Guilfoyle,
1987; Franco et al., 1990). Although the function of the SAUR proteins is unknown, the
temporal and spatial expression of SA UR genes correlates with auxin-induced cell
elongation (McClure and Guilfoyle, 1989). The prototype DST, from SA UR15A of
soybean, is about 45 base pairs in length and consists of three highly conserved

subdomains separated by two variable regions (Newman et al., 1993). Mutagenesis

40

studies have demonstrated that residues within two of the conserved subdomains, the
ATAGAT and GTA regions, are necessary for the instability function (Sullivan and
Green, 1996).

In order to gain insights into the cellular components involved in the DST-
mediated mRNA degradation pathway, we isolated Arabidopsis mutants defective in their
ability to recognize DST elements. dst] and dst2 were isolated based on their ability to
stabilize specific DST-containing transgene mRNAs (Johnson et al., 2000). For this
strategy, two transgenes, hygromycin phosphotransferase (HPH) and B-glucuronidase
(GUS), both containing a tetramer of the consensus DST element in the 3' UTR, were
introduced into Arabidopsis as selectable and screenable markers, respectively. The
presence of the DST elements decreased the mRNA levels for both transgenes, HPH-DS T
and G US-DST , resulting in decreased resistance to hygromycin and low GUS activity.
The dst mutants were isolated as hygromycin resistant plants with increased GUS activity
due to stabilization of the corresponding mRNAs. In addition, dst mutants have elevated
levels of SA UR-A C] mRNA, the only endogenous DST-containing unstable transcript
characterized thus far (Gil and Green, 1996; Johnson et al., 2000). The only reported
phenotype of the dst mutants is the elevation of these three mRNAs due to increased
mRNA stability. Genetic analysis of two dst mutants isolated via this selection showed
that they are incompletely dominant and represent two independent loci. The dst mutants
exhibit no obvious morphological or developmental phenotype (Johnson et al., 2000).
The main objective of the present work was to search for additional genes that were

directly or indirectly regulated by this pathway.

41

Genes differentially regulated in mutant backgrounds have been identified in the
past by a variety of techniques, such as differential display and subtractive hybridization
(Kehoe et al., 1999). Now, with the application of plant genomics, monitoring gene
expression can be achieved on a scale much larger than previously possible. DNA
microarray technology (Schena et al., 1995) takes advantage of the vast amount of
information generated by the genome sequencing projects, as well as the large number of
expressed sequence tag (EST) clones isolated and sequenced from different organisms. In
addition to dramatic changes in mRNA levels that can be identified by differential
display or other techniques, DNA microarrays allow the detection of more subtle changes
in gene expression (Kehoe et al., 1999). By comparing global patterns of gene expression
in a mutant compared to wild type, we now have the unique opportunity to identify
changes in biochemical processes due to the mutation. This approach may be especially
fruitful when studying a mutation that affects the regulation of mRNA abundance and
may be of particular interest when the mutation does not generate an obvious
morphological phenotype.

Recently published studies have demonstrated how microarrays containing a large
number of Arabidopsis genes can provide a powerful tool for plant gene discovery,
functional analysis, and elucidation of genetic regulatory networks (Kreps et a1, 2002;
Mandaokar et al, 2003; Martzivanou and Hampp, 2003; Seki et al., 2001; Schaffer et al.,
2001; Schenk et al., 2000). Plant microarray experiments have begun to focus on mutant
analyses in addition to gene expression in wild-type plants. A pioneering microarray
study carried out by Reymond et al. (2000) highlighted the promise of this approach, in

which the coronatine-insensitive coil-I Arabidopsis mutant was analyzed on DNA

42

microarrays, resulting in the classification of a large number of C01] -dependent and
C01] -independent wound-inducible genes. Other studies have been carried out with
Arabidopsis mutants since then providing further insight into various biological pathways
(Goda et a1, 2002; Scheible et al, 2003; Wang et al, 2002).

In this report, we describe the use of DNA microarrays containing more than
11,000 Arabidopsis expressed sequence tags (ESTS), representing approximately 7,800
unique genes, to examine gene expression in the DST-mediated mRNA degradation
mutant dst] . Our results indicate that DNA microarrays are a powerful tool to identify
new molecular markers affected by DST-mediated mRNA decay, some of which are
likely direct targets of the pathway. Furthermore, our results suggest new experimental

directions to pursue the biological significance of the pathway.

RESULTS

Generation of a 600-element DNA microarray

AS a first step towards analyzing the dst] mutant for additional changes in gene
expression, a DNA microarray representing approximately 600 Arabidopsis genes was
assembled. The clones included were mainly ESTS from the MSU collection (Newman et
al., 1994). Table 2.1 includes a description of these genes, grouped according to function
or sequence similarity. Because the dst] mutant affects RNA metabolism, half of the
clones included on the microarray were those predicted to be associated with some aspect
of RNA metabolism. The criteria for the selection of many of these EST clones was their
sequence Similarity to potential RNA metabolism genes previously described in

Arabidopsis or other organisms.

43

 

Table 2.1. Genes included on the 600-element DNA microarray (done by Pérez-

 

 

Amador, M.A.)
Category Number of genes

Pathogen-related 70

Lipid metabolism 40

Wounding/jasmonic response 25

MAPK 25

Protein transport vacuole/chloroplast 30

Senescence-associated 10

Auxin-induced 10

Polyamine metabolism 5

RNA metabolism 300
RNA binding proteins 70
Helicases 20
Transcription/translation 20
RNases 15
Splicing factors/snoRNP 15
Nonsense decay 8
Putative DST-containing genes 140
AU-rich genes 10

Other 20

Controls 76
Highly expressed/well studied 17
Ribosomal proteins 15
rRNA 2
Transgenes 5
Human clones 12
Other 25

 

44

Thus far, the SA UR-A C1 transcript is the only known target for the DST-
dependent mRNA degradation pathway in Arabidopsis (Johnson et al., 2000). To identify
additional direct targets of this pathway, genes with possible DST elements were
included. The strategy to identify genes containing potential DST elements was to
combine the results of several pattem searches using different degenerate criteria, since
our knowledge of what constitutes a fimctional DST element is still, rather limited
(Newman et al., 1993; Sullivan and Green, 1996). Because ARES also function in plants
as mRNA instability elements (Ohme-Takagi et al., 1993), genes with AU-rich elements
were selected in a similar manner, by searching for variations of the element AUUUA in
an AU-rich context in the 3' UTR. As a positive control, the HPH and GUS coding
sequences were also included so that the mutant phenotype of dst] could be confirmed.

Approximately 300 additional clones were included on the microarray to expand
coverage beyond genes associated with RNA metabolism. A complete list of the clones
on this array and the raw microarray expression data can be found at

http://www.bch.msu.edu/pamgreen/Perez-Amador_etal/600_list.htm.

The expression levels for most genes are similar in dstI and the parental plants

The dst] mutant has a subtle phenotype; it exhibits a 3- to 4-fold elevation,
relative to the parental plants, of HPH-DST and GUS-DST transgene mRNAs, which was
the basis for its isolation. Each of these transgenes contains a tetramer of the prototype
DST element (Newman et al., 1993; Sullivan and Green, 1996). The dst] mutant also
Shows a 3-fold elevation of the unstable SA UR-A C] mRNA, an endogenous Arabidopsis

transcript known to contain a DST element. Prior to this work, these were the only known

45

dst] phenotypes; dst] mutant plants appear normal with respect to morphology and
development when compared to parental plants (Johnson et al., 2000).

To determine whether additional molecular differences existed, poly(A)+ RNA
from leaves of 40-day-old dst] and parental plants was extracted and used in a DNA
microarray experiment. After hybridization and normalization of data, several genes
could be identified with changes in mRNA levels greater than 1.5-fold. As expected,
HPH-DST and GUS-DST were among genes with elevated mRNA levels in dst] . SA UR-
AC] was also detected on the microarray to be elevated in the mutant. In addition, a
DEAD box RNA helicase RH15 (At5g11200) and EST 12509T7 were identified as being
elevated at the mRNA levels in the dst] mutant. When the sequence from EST 12509T7
was compared to the TAIR database (http://www.arabidopsis.org/), the translation
Showed high similarity (63.7%) to the SAUR-AC1 protein and several other SAUR-like
proteins as depicted in Figure 2.1A. AS a result, this gene was named SA UR-like] . Most
interestingly, although the 3' UTR of this gene lacks a classical DST element, it contains
multiple DST-like subdomains, i.e., two ATAGAT-like and three GTA-like subdomains,
as shown in Figure 2.18.

RNA gel blot analysis was used to confirm the differential regulation of these
genes identified by DNA microarray. In previous experiments, RNA gel blot analysis had
proven an effective method to measure subtle differences in mRNA abundance between
dst] and parental plants (Johnson et al., 2000). In addition, this approach has other
advantages. RNA gel blot analysis has traditionally been relied upon for accurate analysis
of gene expression at the level of mRN A abundance. Moreover, once differentially

abundant mRNAs are identified using one combination of mutant and wild type, these

46

.boéooamoc .5303—
EE EbOmQ Hmm .«o moocoscom .m can .m 2: :09. woman 83 MED .m 05 mo conga—.886 2E. $33838. £39 98 mach“
.3 32865 2a SEEoBE ox:-<.ro can -H<O<._.< 05 Co $38M .ED .m KEANE Rm. 05 E meEoBB Ema 29:32 .m

33.52 Boa 0528 m? 8 Sn 886.: moxom 9:805 com—455$ .838 5:5 _8=_-.~5<m mo 258:3.“ oocoscom .<

3...: 825.422 55 8:858 .5 5.12: we a a agave 583 am co min? 2 2:3...

 

52:03:. 8:..<.P0
50503.3 ox=uh<0(._.< T

<to<t<<h0h9r00<o00<<G<E<h<0<<0<h0h<0<t<<t<0h00<0E<<0<<h0h<h<h<o<oh<00<<o<ot<<ook<

I I
View“... ”saga—"mum Magma ”baa gnaw-dam 3E1: 1%; gal raga flung H #24
Iran. Hgamg Hagan; Baa GgmmOZHNm EEII rga Sugar 1‘ llllllll MIME H ‘nHru—D‘m

i302. Ema Hagan» gamma Egan REES—v egg unmammlmu ”ESQ—dean mailing: a 8.355
uncanny Eben—anon Hagan: gunman—men 4893a» Agggl Gaga mega—«mama imaged $511.55 a 263031
1502. Pugh—Rum Hagan 25353 £830.36 gag.-- mega 939% was; guuiifi a 3.31.33

<

47

mRNAs can be easily investigated in additional mutants. Finally, RNA gel blot analysis -
provides the means to test the biological reproducibility of data obtained in microarray
experiments, because additional samples can be tested readily. Accordingly, the dst2
mutant was included in this analysis in order to compare the molecular phenotypes
between dst] and dst2. Like dst], dst2 has no known phenotype other than elevation of
HPH-DST, GUS-DST and SA UR-A C1 mRNA levels due to increased stability.

EST clones to be investigated were radiolabeled and used as probes on the RNA
gel blots. The translation elongation factor eIF 4A, which was used to normalize RNA gel
blot data as described previously (Johnson et al., 2000), did not show altered mRN A
levels in the dst] mutant in DNA microarray experiments, as expected. All blots were
hybridized first to labeled eIF 4A probe, then stripped and hybridized with the individual
gene probes. Representative RNA gel blots are shown in Figure 2.2. HPH and SA UR-
ACI mRNAs increased in abundance in both dst] and dst2 mutants as expected (3.5-fold
and 3-fold respectively). The mRNA levels for SA UR-Iikel were also elevated in both
mutants, although to different extents (2.2-fold in dst] as opposed to 1.6-fold in dst2).
RH15 showed a 3-fold increase in mRNA level in dst] but did not show altered mRN A

levels in dstZ.

The 11,521-element microarray reveals additional genes with altered gene
expression in the dst] mutant

To expand on the 600-element microarray analysis, high density arrays containing
11,521 clones (prepared by the AFGC DNA Microarray facility at MSU) were used.
Poly(A)+-selected RNA from leaves of five-week-old dst] and parental plants was

extracted, labeled with Cy3 and CyS-CTP, and used for the hybridization. Analysis was

48

>
1519
dsfl
dst2

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

u —
HPH
“IF“ - - -
a
.- z:

B :2 a 3
RH15 .. .
“m U U C

a
1-

c 2 E 2;

SAUR-AC1 . . .

SA UR-llko1 .1 - H
elF4A . . -

 

 

 

Figure 2.2. RNA gel blot analysis to confirm DNA microarray data (in
collaboration with Perez-Amador, M.A.)

Lanes contained 10 pg of total RNA extracted from WT (1519), dst], and
dst2 plants. Each blot was hybridized sequentially with 3'zP-labeled
eIF 4A, and with A) HPH, B) RH15, and C) SA UR-A C1 and SA UR-likel .

49

carried out using four independently grown sample sets to control for biological
variability. Each sample set consisted of the dst] mutant and parental plants. For each set,
two microarrays were used, each with reverse labeling, for a total of eight microarray
slides (raw data is available on http://genome-www4.stanford.edu/cgi-
bin/SMD/cluster/QuerySetup.pl, under the experimenter name Green). The DNA
microarray expression data was normalized as indicated in the “Methods” section to
calculate the ratios of the fluorescence intensities of the two probes. The number of
clones with a ratio greater than 1.5 fold was determined. Although a relatively low cut-off
ratio of 1.5 was used, the data were reproducible and were confirmed by RNA gel blot
analysis (see below). When the expression data, represented as the median of eight
microarray slides, was plotted, 36 clones (31 ESTs and 5 clones for HPH and GUS) with
2 1.5-fold elevated or decreased mRNA levels could be identified (Figure 2.3). Most of
these clones showed a difference of 1.5 fold or greater in at least seven of the eight slides
analyzed. Each EST was mapped to the Arabidopsis genome by conducting a BLAST
search against the Arabidopsis genome sequence database. Multiple ESTS representing
the same gene were also identified in this manner and revealed that the 31 ESTS
corresponded to 25 genes. The redundancy amongst the ESTS present on the array fiirther
allowed us to verify the microarray data, since ESTs for the same genes showed similar
changes in expression. In some cases, ESTs corresponding to the same gene showed
slightly different expression ratios (e.g., the four ESTS corresponding to RAP2.4 ranged
from 2- to 5-fold higher in dst], with a mean of 3.9-fold); this variability could be due to

either variable probe or target length, genetic redundancy, or a combination thereof. The

50

 
   

dst1
- RAP2.4“. RAP2.4
g 5‘ \' HPH RAP2.4
-§ 4. 18702311 .
§§ /"P” \ GUS / . mama-n
n: w 37 ° GUS .° ° .4/
Es / o o 0 °
“6:” 2‘ o a: o 3 ° 0 0
£3 1th” . _ _,_.
m .' 1. ° '0 .' 90° 0 .
.2‘ ° 0\ /° )0
f 111G9T7 COR-like xylwd...
COR-like
Parental

 

Figure 2.3. Comparison of mRNA levels in the dst] mutant and parental plants
using the 11,521 element DNA microarray (in collaboration with Perez-Amador,
M.A.).

The graph was generated from the data obtained with ScanAnalyze software. Ratio
values below 1 were transformed to - l/ratio in order to plot them as fold-difference
(y-axis) against arbitrary clone number (x-axis). Five-point scale indicates genes
with increased/decreased mRNA levels in the dst] mutant.

51

transgenes HPH and GUS, as well as the DEAD box RNA helicase gene RH15, were
again detected with elevated mRNA levels in dst] .

Twenty genes, including the transgenes HPH and GUS, showed elevated mRN A
levels while seven displayed decreased levels of mRNA in the dst] mutant compared
with the parental plants, as listed in Tables 2.2 and 2.3, respectively. After correction for
redundancy in the ESTs and excluding the transgenes HPH and GUS, a total of 25
endogenous genes whose expression levels were altered in dst] were identified. The
probable biological functions of these genes, listed in Tables 2.2 and 2.3, were based on

annotation by the MIPS Arabidopsis thaliana database.

RNA gel blot analysis confirms DNA microarray data

To test whether the transcript changes identified in the dst] mutant by microarray
analysis were reliable, total RNA was obtained from the same plants that were used for
each of the four microarray experiments and examined by RNA gel blot analysis. Several
genes exhibiting altered mRN A levels in the dst] mutant as determined from the 11,521
microarray analysis were tested. All of the genes exhibited increased or decreased mRN A
abundance as expected. Although mRNA changes were relatively small (1.5-3.9 fold), in
all cases, differences in gene expression detected by the microarray translated into similar
fold differences as determined by RNA gel blot analysis (Figure 2.4).

Again, RNA levels in dst2 were also monitored in these experiments. Using this
approach, molecular markers specific for each dst mutant were identified. Most of the
genes that had increased mRN A abundance in the dst] mutant were unaffected in the dst2
mutant. As demonstrated in Figure 2.5A, RAPZ. 4, RH15, and ESTS 120E6T7, F2H12T7,

and 141P19T7 showed mRNA levels similar to the parental plants in the dst2 mutant.

52

 

62% 82365 05 .20 "EC 326% 222 .«o :88 OH< 222 .20 88.228: mcmza 8:258 Pmm A3

 

 

 

No a 3 2222.23 2.2.22; 2 82 2223 2:22 as22....2 <72 2822 32mm
22.22 a 2.2.2 3885. 2.52% 2 8223223, 2505225
2.2.22 a 2.2 38$ £9.23 2 82$»? $2.222 a 322.25
2.22 a 22 22825 E2232 2 3 2522ng 22305225
no a 22.2 2.2222me EEENNN 2 22322225
no 2” 22.2 2 £2 52288 2 82.2232 2233225
28 2" a2 $5.32 E38 2 822%? 2230522222
no 2” m2 222.3% r2882 2 3 82322322 cease:
22 a 2.~ 228222 SSS 2 2283223. 822228282 8228.23 328
«2 a 3 222223: £2.38 2 2833 8 2222222 28222 2822
«.22 a 2: -- -- N .So
22.22 a 3 8222522 522292 2 232.2522 a22222222252225
no 2. 2.~ R2? 3928 2 88mm 22 2282 82222228522 22232.22
S2 2" 3 38$ E2922: 2 8833, 2255225
:2 « 2..~ 223% Pa: 222 2 22822223222 2222222220 055222222 22522.2
Omaha—Cofl
m2 2" 22 23:. $22 2 2 2238322 82295: 228222.22”2 9 222228222
f 2. 22.2“ 223222 £82222 2 2282223 0822.22.22 2282220
2.2 a an -- -- N -- 5:
22228.8 23
22.2 2. 2% $222.82 $282 2 3 822w 22 252222222 822282.28 2 22222.22%

222.2232 ESE

8mm 2 >2 EASE

32222 $258
2.2 a 3 283 2.82% 2. 222222wa 22 2.22228 23 2.352

Om a owfio>< 2228222 9 mEE 280
Hmm

 

2.22.: 835-35 .222; 822282.228 :22 352222 28:83 .m> 2% E 232 (2728 25238222 523 850 .N.~ ozah

 

53

 

.ocow c8865 05 mo :0 326% 05 no cocoa OH< 05 mo anbmacmzm 8:258 Hmm A3

 

 

 

22 a 22.2 SSS/2 52 2320 2 3 o2m€wa< 2565225
2222 #8225:
$232 PEEQN 28222
22 a 22.2 2823.2 Emom m 88%? .32 2222222 ~28 2 222222225
22.22 a m2 2 23% E2222: 2 82 2M2 22 222825.22 3.822222 :5
2 232 £82 0
no « o2 $235 E2222 N Smovwmé 88282?
23 2” S SE: E2028 2 223832 2223222 2228229535 9 22222225
22 2" 3. o 2 £32 52222: 2 252va 2222222 Basemgéaooasm
22.2 a 2 882; E32 22 2 SBNwNE 2223222 2222322 222552
282389222 9 DmE 8.820 .8
am 2“ owns; 2228222 B we: 2200
Hmm

 

2.222.: 28.25.22-322

22223 8228322228 :22 Bum—q ~85qu .m> 2% E 232 SAME wommeoou at? 8:00 .m.~ «Ema.

 

54

.2220 :08 2o.“ m_o>o_ SAME
28 35.20.293-28 05 $5852 £28-» 05 223 @832 8:20 Hmm 32.29» 2: 88:8 €8.22 2:. duh—22a 83
Em <72 can max—28 3.2.3838 wfima 853cc mos—9 568298 28m 05 mataqEOo BE Efiwemi in 9.53,.—

mmcoa hwm

LlJvOI-OZ
LU IVVQ
LLO ld I-lJ
L16 IvNOLIv
-Ll.|-393
SFHH
LLBLd ”Iv
LLZI-HZd
“.930er
LLSIGS L
1.1.9 K)” L
HdH
i'ZdVH

m
s

 

 

- “.69le

H
m
m

5

 

 

 

 

 

 

 

 

 

523.32 I
3:33.: U L.

 

 

55

 

aauapunqe VNHW

 

 

HPH and GUS mRNA levels were elevated in both mutants. The EST for one gene,
168C16T7, which shows high similarity to a cadmium-induced AP2 protein, had mRNA
levels that were elevated in both mutants, although the elevation was higher in dst] than
in dst2 (approximately 3.5-fold versus 2-fold compared to the parental type). EST
13913T7 which encodes an unknown protein may have marginally reduced mRNA levels
in the dst2 mutant.

Of particular interest was the analysis of the seven genes with lower mRNA
abundance in dst] compared to parental plants. Most of these genes were either elevated
(ESTS lllG9T7, E6E1T7, 170N19T7, and H5A10T7) or unaffected (ESTS 171P10T7
and 20101T7) in the dst2 mutant, as is evident from the histograms shown in Figure
2.58. The only exception was EST G4A11T7; this EST codes for an unknown protein,
and the mRN A levels for this gene were also diminished in dst2.

SA UR-A C1 and SA UR-likel were also analyzed by RNA gel blot analysis and
were elevated in both the dst] and dst2 mutants (as shown in Figure 2.2), although they
were beneath our detection limit on the majority of the slides used for the microarray
experiments. These signals were below detection because, in most experiments, the
signals were too close to background to calculate a valid ratio. However, in the
experiments in which we could detect a valid ratio, elevation in dst] was observed as

expected (data not shown).

Identification of primary targets of the dst] mutation

The 3' UTRS of all the genes identified as being differentially regulated in dst]

were analyzed for the presence of either a classical DST element or DST-like

56

50 3 3.0

:2.“

    

120E617 mRNA level

1510 dc" am

1510 dc” den

4.0
3.0
2.0
1 .0
0.0

1510 d!" (182

 

F2H12T7 mRNA level RAP2.4 mRNA level >
'2‘
0
E
2
l:
HPH mRNA level

   

 

 

 

   

168C1617 mRNA level 141P1917 mRNA level

_ 3.0. 3
E 2.5‘ 5
<
20 z
a... g
5 1.0 p
D 0.5 g
(D o.ol '“ ' :2 .o
1519 dat1 dst2 1619 do" d w 1519 do" dst2

 

2.5 E 2.5 E 3.0

2 .2 l

2.0 2.0 l < 2.5:

‘ g z 2.ol

.5 z 1.5 a: l

E E 1.5.

1 0 t 1.0 p 1 0

a: .

0.5 E 0.5 E 0.5
0-0 a 0.0 2 0.0. 2
1519 den den 1519 d." dst2 v- 1519 d5" dat2

‘d-ld”
COON‘GOO

O

1 . .

0. > '
0.4 -

0.2 >

0.0

M 1519 do" den 7 1519 as" dst2
1.2 1.2

1.0 1.0 l

04. 0.0 .

0-0 0.6 .

0.4 0.4 ,

  

 

   

2010117 mRNA level H5A10T7 mRNA level 1116917 mRNA level m

G4A11T7 mRNA level 171P1017 mRNA level

1.2 . .
1519 68” £182 1519 dsfi dst2

Figure 2.5. Histograms of the mutant (dst] or ds12)/parental ratios of mRNA expression for the
indicated clones.

A) Increased levels of mRNA in dst]

B) Decreased levels of mRNA in dst]

57

subdomains. Seven genes were identified that contain possible DST-like sequences in
their 3' UTRS (listed in Table 2.4). Therefore, these genes could be hypothesized to be
primary targets of the DST-mediated decay pathway which is deficient in the mutant. To
determine whether the decay of some of the hypothesized primary targets required a
functional DST] pathway, mRN A turnover rates were measured in the dst] mutant and
1519 parental lines. Northern blot analysis of cordycepin time courses indicated that
RAP2.4 mRNA was more stable in dst] (Figure 2.6A and B) while Ccr-like mRNA
decayed faster in the mutant as compared to 1519 parental Arabidopsis plants (Figure
2.6C and D ). SEN] expression is not high enough to measure mRNA decay accurately in
mature leaves, the material used for the microarrays and the decay curves in Figures 2.6A
and C. However, half-life measurements of SEN] mRNA in seedlings (Figure 2.6E and
F) showed that it too was less stable in dst] than in the parental 1519. This data indicates
that RAPZ. 4, Ccr-like and SEN] mRNAs are indeed bona fide targets of the DST-

mediated mRNA decay pathway in Arabidopsis.

Multiple replicates remove non-reproducible changes

An important aspect of our analysis of the dst] mutant was the ability to detect
subtle changes in gene expression. As shown in Figure 2.4, using eight microarray slides,
all of the changes that met our criteria were highly reproducible in independent RNA gel
blots. However, it was of interest to examine the degree of reproducibility using a single
pair of technical replicate slides and whether fewer than eight slides are sufficient
because the number of slides to use for microarray experiments is not yet routine. This

could be particularly significant for future experiments, since the 1.5-fold cut-off used

58

 

EmEovpsw oVEédb
imp—£53 omeH<O<H< l

25:52.v Ea gages”... U

 

(Bhddmddodéthdodd0404999FOOOBBHHDEQOHBPdHBOddUUFHOBUB
UHUBU¢B<dhBO<<¢UUUHHD¢UUUU¢U<BH<OU948909408H<U<¢UH<<BBU4804UHBUO<BUH¢H¢DB

ll

dEHH<4HHUUHU<UU¢¢HDHBHUHO¢<U<FUFEhmhoHPHOHOHdfiédDHOHdUFQEdBHhhdwddu<¢¢0¢<

 

2822198
522.2 moo 9 22222.5

 

BU<H<849409HHdddeOBQddthdédB04440HUGHddddBOBBUU00400440494<<U<48404¢UUUB
UUDFUBBU<¢HUHH¢HOU<¢<UUfiwoHBBHH599944599UUHHBBBBUBOBGHHOOBBUBBUDBHDOOéd
duodUU<¢O<4¢%©HFH¢¢OH¢EU<¢¢O<¢UHU<FHQBHfldflUHdHHUBHHH<HB$OD<P¢D<U<O¢B¢H¢
dBdeBHBdHHUFUUFEPUHQdOOHUddm0449HHH<UO¢¢<OO¢¢H¢¢¢U¢¢UUmflddflflflMflMwU¢0QU

 

 

ommEmoEx

 

<8BBQUQUdUdBUUUBdUOHdOOOOUdUOédHdeUUdUOUdHBBD<<<U<UU<U<¢O
UHFUddflUU<HBHUO<¢¢UEGDDBH<H¢HUH¢4¢UBOHU<<HHPO<B¢U¢¢¢49UHUBH499<HB<UH<UB
4<UE¢BU<40004<UBUHHUFdOflEUEUHB<¢dB<QUP¢HH<dHOHUUBUU<UH¢B¢UUO£B¢UB<¢U<¢<

l

 

225.3 522.2
3868352288:an

 

DU¢U<O<H<U<H¢
¢B<¢OUOUH<<Hm40¢94<PU<H¢Bw<U<h UddUHHFHPdUEOUHBHDB<¢<<HUHUOH¢¢<UUH<UmB¢
4%HHdB<<¢H¢<UHO¢<¢H<¢DHBHUUdhObHUdUHUOBUHHdu<UU4UUHEOU<<<<¢H¢<BH¢H¢BHE¢D

 

 

 

 

 

 

 

 

 

o:$0584?305595854340SESQGFEE..., SEES. 4.0mm . 2.0.2?le 5805 52233 9.68.5
o<eoeooeeeaBeoe<eoeaeoeoo<eeoeepeeueomoagaheeeeooo
oaeoeeceopee<emeoepeo<we<o<eoeeoeo<e949eo¢w<<u¢¢<e<4o<o<oeoo<ooeoeeaemaemee
8:859:28.2.o<oo<¢oe<oaoae<4o<oc§o520.20H2.2oHooo¢o¢<<§§<§0542858 NME< 9 3:85
o<o<<¢<4hee<<opme<ooeaamo<e<94oe<<<eeemumooeu<eeeoeeemuee<<<<oee
e<<<o<neeea<¢o<4o<¢<uoaeeupeuu<<<eeo<eoeeooemoee<<ueo<<ee<<ee<¢oeoeo
laHl -
22.035:EPeELES:EESamEEHZSEEueecgaeieeiguegwooo 8.: E<U
Poe<eeeeaoepaeoaomoooe<ooaooeooomoeopaeeBEQQUOBHoo¢ooHoooeoeoeoe
u8.8a:53.2.50.252»:3:424:0950099245555Sowegfigeéei E880 x13».
45492800084850Eamaoeopepeeogoefiaoo?ooooo<o§¢§oo§§<moooo . c N mtg
#55 .m mZmO

 

E: .m .222“ 222 322223... 822:8 2.22.822 523 350 .E .592.

 

59

    

 

 

 

 

 

 

A.
1
15 30 60 90 120 15 30 60 90 120 a
E
'E
RAP2.4 u no “'
9' r I...“ g
I-
E o dst] (76 min)
p1519 dst] e
0.1 . . - . .
15 4s 75 105 135
time (min)
C. D
01530 60 90 120 0 15 30 60 90 120 g0
. ‘a
Cor-like . O 'I- - .. .- 'a'
eIF4A 2 - - - - ....... a
E O 1519(31 min)
p1519 dst] ,, 4571(13mm)
0.01 1 - - - -
15 4s 75 105 135
time (min)
E. F.
1
01530 60 90120 01530 60 90120 a
E
SEN] ...--— .~--- .5
a
2
”FM "' " " “‘ ‘ T " " ' 5 91519035111111)
p1519 dst] a G M (35 min)
0.01 . . .

 

 

15 45 75 105 135

time (min)

Figure 2.6. RAP2.4, Ccr-like and SEN] mRNAs are primary targets of the DST-
mediated decay pathway.

Representative northern blot analysis of cordycepin time courses performed in the dst]
mutant and 1519 parental Arabidopsis plants for (A) RAP2.4, (C) Ccr-like, and (E) SEN]
mRNAs. Samples consisted of 10 pg of total RNA isolated from the indicated time
points. Quantitation of the decrease in mRN A abundance and half-life estimation for (B)
RAP2. 4, (D) Ccr-like and (F) SEN] mRNAs. The stable eIF 4A transcript was used as a

reference for equal loading.

60

was lower than the commonly used threshold value of 2-fold (Wildsmith and Elcock,
2001; DeRisi et al., 1997), although a recent study reported that the minimum detectable
fold-change for differential expression is 1.4 fold (Yue et al., 2001).

To monitor the reproducibility of the microarray hybridizations, for individual
pairs of technical replica slides, the number of clones with a ratio greater than 1.5 was
calculated. For each, a clone was considered reproducible if it was represented in the final
set of 36 clones showing 2 1.5 fold difference and non-reproducible if it showed 2 1.5
fold difference in the slide pair but was not present in the final set. Using a cut-off value
of 1.5 fold, a histogram was plotted to compare the percentage of reproducible and non-
reproducible clones. From this histogram, it is evident that such a low cut-off yields non-
reproducible changes (Figure 2.7A). This is expected because the cut-off value is close to
the background. However, these non-reproducible changes can be identified and removed
by conducting multiple experiments. When the reproducibility across repetitions was
plotted as a function of the number of slides (worst to best pair and vice-versa, based on
the percentage of visible gradient on the slide), it was seen that the percentage of non-
reproducible clones decreased to less than 20% afier four slides. In our experiment, it was

possible to remove virtually all non-reproducible clones using seven slides (Figure 2.78).

Cluster analysis of genes with altered expression levels in dst]

Clustering allows the grouping of genes with similar expression profiles and
provides a holistic view since co-expressed genes involved in similar processes provide
clues about the biological significance of the pathway being studied. We used cluster
analysis to compare gene expression data for the 25 genes identified in this study using

data from the 47 Arabidopsis microarray experiments (113 slides) available in the

61

>

 

 

 

 

 

 

 

 

 

 

    

I Reproducible (96 clones In final set)

100 - E] Non-reproducible
3
1:
O
3
'6
o
u
8
E
o
O.

0
"314.1131? 11334.11337 11340.11341 11329.11321
Slide pairs
100

o I Best pair to worst pair

g 80 ‘ Cl Worst pair to best pair
h -
o o
as so-
e s

'0
§ 0 40 -
o a
“ $

c 20 r

O

r:

0

 

 

 

2 4 8 8
Number of slides

Figure 2.7. Assessment of the reproducibility of the microarray data using fewer
replicates.

A. Histogram plot comparing the percentage of reproducible and non-reproducible
clones. The percentage of clones (y-axis) is plotted against slide pairs (x-axis) used
for the microarray experiments. Each slide pair denotes microarray slides that were
technical replicas, i.e., reciprocal labeling was performed with each pair of targets.
The slide numbers denote the ExptID in the Stanford Microarray Database.

B. Graph showing the percentage of non-reproducible clones (y-axis) plotted against
the number of slides used for the microarray analysis (x-axis).

62

Stanford Microarray Database (SMD) (http://genome-www.stanford.edu/Microarray) at
the time of the analysis. A portion of the resulting clusters is shown in Figure 2.8. As
expected, when EST redundancy was not removed, ESTS representing the same gene
clustered next to or in the immediate vicinity of each other, thus validating the observed
pattern of gene expression (data not shown).

Although the cluster analysis was carried out using the limited number of genes
that were identified in this study, certain common expression patterns could be found.
The most prominent cluster is comprised of three genes that are regulated in a diurnal
fashion and share several other expression characteristics. This cluster is characterized by
genes whose transcripts are decreased in abundance in the dst] mutant and include genes
encoding a protein similar to a stem-specific protein, senescence-associated protein, and
xylosidase. These genes show tissue-preferential expression, with a high level of
expression in leaves and a low level in flowers and roots, and are elevated by light. Two
of the three genes in this cluster, senescence-associated protein and xylosidase, have
unstable transcripts (see discussion), contain possible DST-like sequences in their 3'
UTRS, and are also elevated in the dst2 mutant.

Apart from the aforementioned cluster, a second cluster of coordinately expressed
genes was identified. This cluster includes genes for chalcone synthase and a protein
similar to chalcone flavonone isomerase, both of which show increased mRNA levels in
the dst] mutant. These genes are regulated in a diurnal fashion as well but are decreased
by light and have higher levels of expression in flowers compared to leaves or roots. In
addition, these mRNAs are elevated in a mutant defective for protein import into

chloroplasts.

63

:28 E @8885 mm 8:23.536 m3“ :2. 0mg:

5%. E 20>": <ZME 33205 223 85m 882?: at £3» 5 296— <Zm8 @8832. £3, 8:0» 33085

3 60$“qu £0620 2858805 05 88:6. m3°b< dais 23% a .3 coEoSEB mm «258530 :80 Ba .38
2mg“ a .3 33883.2 mm 05% scam .936 05 89m $8853» 5. 89m 83 .23 60.8520 803 8:0» mm 05 Set 525

. 2% 5 £32 <ZME @283 2E? 85% mo mmmbfla 5330 .md Baum.”—

macoEtonxm

A... omega—So 0:00.20
e... 382.com. ococo>a= 2.8.29 8 ._£_E_w
At 3 520.5 oona «as:
M...“ 5505...:
+ Esocxca
E .532. is e83... 5352.8 2 .225.»
+ 92.2 F .88. 3328034100
T. 5505...:
3 2:22.83 s «.252
. :26:ch
T. 5505::
3 8.2. 52:36.8
+ 34 352256
+ 5.65::
3 firm 88:2. <2: .23 n<mo
TV 53 .2

0
.V 582.2 zoo 8 .2256
A. 5392.2. .532. 325.5
E .2205 :ozatomcub 02.83.“.
.2. 5505::
M+w Esocxca
3 Stanza: 33:3 E»m
3 33232 x
. Anesoowmméucoumgew. wzwm
£30.... 05039.net» 8 Luz—Em

64

seuolo

Al

 

mega. m> 2026: .6535
:2 26.29: 25.2.3220

muoo. E 26.29... uommofiotuoosufi mu.

No other common characterizing gene expression patterns could be seen.
However, eight genes (senescence-associated protein, putative patatin protein, protein
similar to CCR, putative membrane channel protein, protein similar to APR2,
calmodulin-like protein, an unknown protein, and chalcone synthase) are regulated in a
circadian manner, which points to a possible connection between the DST-mediated
decay pathway and circadian rhythms. Four of these eight genes also contain DST-like

subdomains in their 3' UTRs and could be direct targets of the dst] mutation.

DISCUSSION

Microarray technology has great potential for characterization of mutants,
especially those with no visible aberrant phenotype. Here we report on the dst] mutant,
which fits into this category. To evaluate molecular phenotypes of this mutant, DNA
microarray technology was used, which allowed the identification of primary as well as
secondary effects, and also revealed clues towards the identification of possible

relationships among genes.

Transcripts altered in dst] have predominantly increased levels, although some
decrease in abundance

The dst] mutant is known to elevate mRNA levels of HPH-DST and GUS-DST
transgenes by 3- to 4-fold (Johnson et al., 2000). The DNA microarray experiments
carried out in this report were sensitive enough to detect reproducibly the elevations of
these transcripts in multiple replicates of the experiment. Moreover, additional changes of

similar magnitudes were detected for transcripts corresponding to 25 genes from among

65

those represented by the 11,521 clone array. Such a limited number of changes is not
surprising, since the mutant does not exhibit any morphological abnormalities. It has been
suggested that dst] and dst2 correspond to weak alleles or affect genes that are part of
gene families and therefore have only partial defects in mRNA stability (Johnson et al.,
2000). The results of our microarray experiments are certainly consistent with this idea,
since we detected only moderate changes in mRNA levels for a few genes in dst] .
Increased transcript levels for some genes were expected, since dst] is known to increase
levels of DST-containing transgene mRNAs and the endogenous DST-containing SA UR-
ACI , presumably due to a defect in a component of the cellular machinery involved in the
recognition and degradation of DST-containing transcripts.

Our analysis showed that expression of several genes decreases in dst] . Decreases
in gene expression could be explained by the same defect if the DST recognition
component acts as both a repressor and activator in a context-dependent manner similar
to some transcriptional regulators. For example, Drosophila Drapl and dCtBP are
bifunctional transcription factors with distinct activation and repression functions (Willy
et al., 2000; Phippen et al., 2000). Further support for this hypothesis comes from studies
conducted on AUF 1. It has been demonstrated that AUF 1 acts as an RNA-destabilizing
protein in the ARE-mediated mRNA decay pathway (Loflin et al., 1999; Buzby et al.,
1999), but it has also been implicated as being part of the complex that mediates the
stabilization of a-globin mRNA (Kiledjian et al., 1997). Similarly, the DST recognition

component could be part of different multiprotein complexes that carry out separate

functions.

66

The genes identified in this study encode for proteins involved in a variety of
cellular processes. The DEAD box RNA helicase, RH15, is a part of a large gene family
in Arabidopsis. RNA helicases are primarily RNA unwinding enzymes and have been
implicated in a variety of molecular processes, including mRNA splicing, ribosome
assembly, and translation initiation (Aubourg et al., 1999). Of the 18 endogenous genes
that are elevated in the dst] mutant, two encode for proteins that have an amino acid
motif known as the AP2 domain (see Table 2.2). The AP2 domain is essential for
APETALAZ functions and contains an 18-amino acid core region that is predicted to
form an amphipathic a-helix (Okamuro et al., 1997). The four ESTS that were most
highly elevated in dst] correspond to the gene RAP2.4, which belongs to the RAP2
(related to AP2) gene family. The AP2 polypeptide is distinct from known fungal and
animal regulatory proteins, and it has been proposed that the RAP2 proteins may function
as plant sequence-specific DNA binding proteins. Another interesting EST, 222C9T7,
that was elevated in dst] corresponds to a protein that is similar to the CCR4 associated
factor 1 protein (CAFl). CAFl is a transcription-associated protein and is a member of
the RNase D family of 3' to 5' exonucleases (Moser et al., 1997). Recently, it was shown
that Caflp is a critical component of the major cytoplasmic deadenylase in yeast (Tucker
et al., 2001), suggesting a potential link between mRNA deadenylation and the DST-
mediated mRNA degradation pathway.

Most transcripts that are affected in the dst] mutant relative to the parental type
are expected to fall into one of two categories. One category consists of mRNAs that are
the direct targets of the DST-mediated decay pathway, the primary transcripts, while the

second category consists of transcripts, referred to as secondary transcripts, that are

67

elevated or diminished as a result of secondary effect of changes in the primary
transcripts. A number of genes showing altered levels of gene expression in dst] may be
due to secondary effects, since these genes do not appear to contain a consensus DST
element or DST-like subdomains in their 3' UTR. Secondary effects would be expected if
altered levels of DST-containing mRNAs influence the abundance of other RNAS. This
situation is not unique to dst] ; secondary effects would be expected in all microarray
experiments comparing mutants with the wild type. However, this study allowed us to
predict and subsequently confirm some of the primary and secondary effects of the dst]
mutation based on the presence or absence of DST-like sequences, respectively.
Although the precise sequences required for a functional DST element have not been
fully elucidated, our data provide us with the advantage of identifying at least some of the
most likely primary effects. For example, none of the 140 possible DST-containing
sequences found by motif searching tools on the 600 element array, were affected in dst] .
This suggests that the DST element is more complex in Arabidopsis than in soybean and
that it is difficult to identify this element by simple sequence search tools. It appears that
multiple subdomains of the DST element are sufficient for its function as an instability
determinant, since 7 of the 25 genes identified contain DST-like subdomains. Earlier
mutagenesis studies of individual subdomains are also consistent with this hypothesis
(Feldbrugge et al., 2002). Further experiments are required to define the DST element,
which would ultimately help refine our understanding of the requirements for DST

recognition.

68

Molecular markers to expedite characterization of and differentiation between dst]
and dst2

The most immediate utility of these results is the identification of new molecular
markers for dst] that could be used to enhance mapping and prompt additional biological
experiments. For example, the analysis of dst] showed that RAP2.4 mRNA levels are
more highly elevated than HPH or GUS mRNA levels. Thus RAP2.4 could be a more
useful marker for the detection of homozygous dst] mutants in future experiments.

Prior to this study, it was difficult to distinguish between dst] and dst2, because
the known phenotypes of the two mutants were identical, and F2 progeny of a cross
between the mutants do not show additive increases in the abundance of DST-containing
mRNAs (Johnson et al., 2000). By examining mRNAs in dst2 that show altered levels in
dst], differences between the two mutants were identified. dst] and dst2 represent
mutations in independent genes (Johnson et al., 2000). The results from these
experiments indicate that some targets of the decay pathway mediated by the two genes
could be different. Further, there could be some degree of overlap leading to the
coordinate regulation of common targets, as exemplified by SA UR-A CI and the
transgenes. The cataloging of molecular markers specific for each mutant is also
significant because specific markers should allow us to identify the double mutant
without relying on map positions and subsequent crosses. This emphasizes another
potential use of microarrays in identifying genes that can be used to examine and
compare related mutants without necessitating individual microarray experiments for
each. For example, a new dst mutant was recently obtained in our laboratory by

activation tagging. The molecular markers identified in this study will facilitate

69

characterization of this mutant as well as subsequent mutants that affect this sequence-

specific mRNA degradation pathway.

Circadian association of the dst] mutation

Utilizing the technique of cluster analysis, parallel expression profiling over many
experiments was conducted. The clusters generated revealed co-expression characteristics
of the genes affected in the dst] mutant that would not have been evident otherwise.
Eight genes, which correspond to 32% of the 25 genes described in this analysis, were
regulated in a circadian manner, while only 2% of 7,800 genes were found to cycle with a
circadian rhythm in a study conducted by Schaffer et al. (2001). In another study by
Harmer et al. (2000), 6% of 8000 genes showed circadian changes in mRNA levels.
Based on comparison with their results, 4 of 25 (16%) genes in our experiments exhibited
a circadian pattern of expression. These data point to a higher representation of circadian-
regulated genes than would be expected by chance. Despite differences in results and
experimental conditions between the two studies (e.g. only about 1500 genes were in
common), four genes with altered expression in dst] were found to be circadian regulated
in both studies adding more credence to our data. The significance of several genes in the
cluster being regulated in a circadian manner is not yet clear, but it suggests an
association between the dst] mutation and circadian rhythms. Further, Harmer et al.
(2000) showed that SA UR-A CI, which is a target of the DST-mediated mRNA
degradation pathway, is also circadian regulated. It is thought that a number of circadian-
regulated transcripts are unstable and are expressed during a narrow window of time. It is
possible that in the dst] mutant, the level of a potential regulatory factor or signal

molecule that plays some part in the circadian clock function is altered, which leads to a

70

cascade effect and changes the expression of several circadian-regulated genes. If this is
true, the circadian effects uncovered here would provide the first insight into the
biological or physiological significance of the DST-mediated mRNA decay pathway.
Elucidating the exact nature of this association and fiirther testing of this hypothesis will

require the cloning of DST 1 .

CONCLUSIONS AND FUTURE PROSPECTS

In addition to reproducing the known elevation of two transgene mRNAs in dst] ,
25 additional transcripts were found to increase or decrease in abundance relative to the
parental plant. Many of the corresponding genes were subsequently examined by RNA
gel blot analysis to confirm the dst] microarray results and to evaluate their expression in
the dst2 mutant. In this way, several interesting and useful differences were uncovered
between the two dst mutants. These new molecular markers should enhance subsequent
analysis of the dst mutants, provide insight into their biological significance, and help
identify other targets of the DST-mediated mRN A decay pathway.

The 25 genes identified in this study are most likely an underrepresentation of the
molecular phenotypes of dst] due to the stringency of our parameters to avoid false
positives. For example, ratios derived by the microarray results from weakly expressed
genes, such as SA UR-A CI and SA UR-likel , which have low levels of expression in the
absence of auxin (McClure and Guilfoyle, 1987), were significantly different from those
determined by RNA gel blot analysis. The channel intensity values for these transcripts
are close to the background fluorescence intensity levels and therefore are more

susceptible to variation. Also, there may be additional targets of the DST-mediated decay

71

pathway not identified because the present generation of slides do not contain all of the
genes of Arabidopsis. In the future, comprehensive microarrays with improved sensitivity
should result in the discovery of a greater number of molecular phenotypes for dst] .
Beyond extending our knowledge of the DST-mediated decay pathway in plants,
the current study provides additional general insights. Our study shows that subtle
changes in gene expression can be measured reliably using multiple microarrays, which
should enhance the global investigation of gene expression patterns under several
conditions. This analysis demonstrates that new molecular phenotypes for mutants
without a visible phenotype can be identified using DNA microarray technology. Also
with full genome microarrays, it should be possible to catalog all the molecular
phenotypes for any mutant. Further, new hypotheses and associations, such as the
potential link between the dst] mutation and circadian rhythms, can be developed by
employing the publicly available databases. Future mutant analyses via DNA microarray
analysis should have even greater utility, particularly for the analysis of mutants
identified by reverse genetic approaches (e. g., T-DNA insertions) that have no apparent

mutant phenotype.

MATERIALS AND METHODS

Plant Material

All Arabidopsis thaliana plants described in this report are from the accession
Columbia, grown in growth chambers under 16 hr light and 60% relative humidity at
20°C. Tissue from the parental line (p1519-31) and dst] and dst2 homozygous mutants

(Johnson et al., 2000) were harvested from 35- to 40-day-old plants. The dst] and dst2

72

lines used were from the second backcross to the parental line. All tissue was harvested

from plants grown in parallel under the same conditions in different growth chambers.

Generation of a 600-element DNA microarray

EST clones were selected based on sequence similarity by BLAST analysis
(Altschul et al., 1997) to known genes involved in RNA metabolism in Arabidopsis, in
other plants, or in other systems, such as bacteria, yeast, and mammals.

Selected Arabidopsis EST clones were obtained from the PRL2 EST collection
(Newman et al., 1994). These ESTS were cloned in lambda Zip-Lox (pZLl clones,
GibcoBRL, Rockville, MD) or pBluescript SK' vector (pBSK clones, Stratagene, La
J olla, CA). To amplify the ESTS by PCR, we designed universal primers corresponding
to the 3' and 5' ends flanking the cloning site of each vector backbone. pZLl clones were

amplified using the 5' primer 5' CGACTCACTATAGGGAAAGCTGG 3', and 3' primer
5' ATTGAATTTAGGTGACACTATAGAAGAGC 3'. pBSK clones were amplified
using the 5' primer 5' CGACTCACTATAGGGCGAATTGG 3' and 3' primer 5'
GGAAACAGCTATGACCATGATTACG 3'. cDNA clones isolated in our laboratory
were cloned in pBluescript (primers as above) or pGEM-T (Promega, Madison, WI)
Vectors. To amplify clones in pGEM-T, we designed the 5' primer 5'
CGACTCACTATAGGGCGAATTGG 3' and 3' primer 5'

A'I‘TTAGGTGACACTATAGAATACTCAAGC 3'.

Plasmid DNA from the MSU collection was diluted to a final concentration of 1-3
mg. 11L" in TE (10 mM TrisHCl pH 8.0, 1 mM EDTA). PCR reactions, in a final volume
of 1 00 pL, contained 40 pmol of the corresponding primers, 0.2 mM of each dNTP, 2-5

“8 of plasmid DNA and 2 units of Taq DNA polymerase in l x reaction buffer (IOmM

73

Tris-HCl pH 8.0, 50 mM KCl, 2mM MgClz). After PCR, DNA was precipitated in
ethanol and resuspended in 20 uL of 3 x SSC (1 x SSC = 0.15 M NaCl, 0.015 M
NaCitrate, pH 7.0). To check the quality and quantity of the amplified DNA, 1 uL of the
final resuspension was analyzed by electrophoresis in 1.0% agarose gels. PCR products
with low concentration (<200 ng-uL'l) or showing multiple bands were discarded and
replaced with a new PCR amplification product derived from a different EST clone
corresponding to the same gene. If no alternative EST was available, a new PCR
amplification was performed using a gene-specific primer designed for the 5' end of the
EST clone along with the corresponding 3' vector primer. In this way, we ensured that
only high quality PCR products were included on the 600-element DNA microarray. To
confirm the identity of the amplified DNAs, we sequenced 12 randomly selected clones.
In each case, the sequence obtained matched the EST sequence deposited in the database.
For clones obtained from genomic DNA, DNA was extracted from total above
ground tissue of mature Arabidopsis plants using the method of Dellaporta et al. (1983),
and 100 ng was amplified as described for EST clones. In all cases, a single PCR product
was obtained. Low abundance PCR products were re-amplified under the same
Conditions using 1 uL of the first PCR reaction as template.
DNA from the PCR reactions was transferred to master DNA plates and stored at
4°C until printing. The final concentration of DNA for printing was estimated to be 200-
400 ng-uL". DNAs were arranged as four subgrids of 12 x 13 and printed twice on poly-
L”lysine-coated slides. Printing, handling, and use of the 600-element DNA microarray

Was as for the 11,521 MSU DNA microarray as indicated below.

74

11,521 AFGC DNA Microarray

Microarrays were generated at the Arabidopsis Functional Genomics Consortium
(AF GC) Microarray facility at Michigan State University. A total of 11,521 ESTS were
spotted on super-aldehyde glass slides (Telechem International, Inc.; Sunnyvale, CA).

Slides were washed and blocked according to the Telechem protocol.

Half-life measurements, total RNA Extraction, Poly(A)+ RNA Purification, and

RNA Blot Hybridization

Half-lives were determined as described by Seeley et al. (1992) with the
following modifications. Two-week old Arabidopsis seedlings or rosette leaves from
Arabidopsis plants were transferred to a flask with incubation buffer. Afier a 30 min
incubation, 3'-deoxyadenosine (cordycepin) was added to a final concentration of 0.6 mM
(time 0). Tissue samples were harvested at regular intervals thereafter and frozen in liquid
nitrogen. Total RNA from leaf samples was extracted as previously described (Newman
et al., 1993). Poly(A)+ RNA was purified from 200 to 400 ug of total RNA using the
Oligotex mRNA kit (Qiagen, Valencia, CA). RNA ( 10 ug of total RNA or 2 pg of
poly(A)+ RNA) was analyzed by electrophoresis on 2% formaldehyde/1.2% agarose gels
and blotted onto nylon membrane (Nytran Plus, Schleicher & Schuell, Keene, NH). DNA
probes were labeled with [a-32P]dCTP by the random primer method (Feinberg and
Vogelstein, 1983) and purified from unincorporated nucleotides using probe purification
columns (NucTrap, Stratagene, La Jolla, CA). The RNA blots were hybridized as
described in Taylor and Green (1991) using the indicated 32P-labeled probes. For a
loading control, RNA blots were hybridized with a 32P-labeled cDNA probe for the

Arabidopsis translation initiation factor eIF 4A (Taylor et al., 1993). Blots were stripped

75

between hybridizations in 0.1% SDS at 90 to 95°C for 1 hour. Quantification of
hybridization signals was achieved using a phosphorimager (Molecular Dynamics,

Sunnyvale, CA).

Labeling of Poly(A)+ RNA

For first strand cDNA synthesis, 1 pg of poly(A)+ RNA and 1 pg oligo dT
(GibcoBRL) in a total volume of 25 pl of DEPC-treated water was denatured at 70°C for
10 min and cooled down on ice. On ice, 8 pL of 5 x RT buffer, 4 pL of 0.1 M DTT, 2 pL
of dNTPs (10 mM each), and 1 pL of Superscript II (GibcoBRL) were added, and the
mixture was incubated at 42°C for 1 hr. To remove RNA, 0.5 pL of RNase H (4 units-pL’
1) was added, and the reaction was incubated for 30 min at 37°C. Single strand cDNA
was purified in a Microcon YM-30 column (Millipore, Bedford, MA), concentrating to a
volume of 10 pL TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). Single-stranded cDNA
was divided into two aliquots for Cy3- and Cy5-dCTP labeling, allowing for two
hybridizations for each sample. The second-strand synthesis reaction contained 5 pL of
single-stranded cDNA, 22 pL water, 4 pL Klenow buffer (500 mM Tris-HCl, pH 8.0, 500
mM NaCl, 100 mM MgClz), and 2 pL random hexamers (3 pg-pL'l, GibcoBRL). The
mixture was denatured at 95 °C for 3 min and annealed at room temperature for 5
minutes. Next, 4 pL of dNTP mix (250 pM dATP, dGTP, and dTTP, and 90 pM dCTP),
1 pL of dCTP-Cy3 or dCTP-CyS (Amersham, Arlington Heights, IL), and 2 pL Klenow
(5 units-pL") (GibcoBRL) were added, and the reaction was incubated for 2 hr at 37°C.
All incubations were carried out in thin-wall 0.5 mL tubes in a RoboCycler 40
Temperature Cycler (Stratagene). Labeled dsDNA was purified using a QIAquick PCR

purification kit (Qiagen) and eluted in 50 pL 2 mM Tris-HCl, pH 8.0. The probe was

76

dried down to 10 pL. To test the quality and quantity of the product, 1 pL was separated
on a 1% agarose gel using a miniprotean gel electrophoresis system (Bio-Rad
Laboratories, Hercules, CA). The portion of the gel containing the DNA sample was
placed on a glass microscope slide, dried on a heat block at 70°C, and scanned using a
ScanArray 3000 or 5000 (GSI Lumonics). The rest of the probe was used to prepare the

hybridization mixture.

DNA Microarray Hybridization and Analysis

For a single DNA microarray, 30 pL of hybridization solution was prepared by
mixing 5.2 pL of 20 x SSC, 4.5 pL 2% SDS, 2.4 pL of tRNA (20 pg-pL'l), 9 pL Cy3-
labeled probe, and 9 pL CyS-labeled probe. The mixture was denatured at 100°C for 1
min and spun for 1 min to recover any condensate. The mixture was then hybridized to
the array under a glass coverslip (24 mm x 40 mm, Corning) that had been washed in
95% ethanol, then 0.2% SDS, and rinsed in distilled water. The slide was then placed in a
microarray hybridization chamber (Arraylt Hybridization Cassette, TeleChem
International, Inc.; Sunnyvale, CA) with 200 pL of 3 x SSC to ensure high humidity
conditions.

Hybridization was carried out in a water bath at 65°C for 12 to 20 hours. After
hybridization, the microarray was washed for 5 min in 1 x SSC/0.2% SDS, 5 min in 0.1 x
SSC/0.2% SDS, and 30 sec in 0.1 x SSC without SDS, and finally dried by centrifugation
at 600 rpm for 5 min.

The slide was scanned once in a ScanArray 3000 or 5000 (G81 Lumonics) for
both channels 1 and 2 (corresponding to Cy3- and Cy5-labeled probes, respectively) at 10

pm resolution. The image files obtained were analyzed using ScanAnalyze sofiware (v.

77

2.32, M. Eisen, Stanford University, http://genome-
ww4.stanford.edu/MicroArray/SMD/restech.html). To ensure that only spots of high
quality were used in the analysis, quality control measurements produced by the
ScanAlyze software were employed. For example, the GTB2 value represents the fraction
of pixels within each spot that are more than 1.5 x the background measurement. Spots
with GTB2 values lower than 0.50 for either channel were removed and not considered
for further analysis.

Data from each channel was transformed to the natural logarithm, and a Z-score
was calculated to normalize the channel values in order to account for variation in RNA
labeling. For the Z-score calculation [Z = (x—pYo, where x = channel value, p = mean of
channel data, and o = standard deviation of channel data], the trimmed mean and standard
deviation using the middle 93% of the channel values were used in order to not bias the
calculation due to extremely high or low values. The new data set has, by definition, a
normal distribution with zero mean and unit variance. Values were retransformed from
the natural logarithm by raising to the power e, and the channel ratio was calculated.
From each of the four replica samples used with the 11,521 MSU DNA microarray, we
generated two slides, with direct and reverse labeling. Ratios from reverse labeling were
reversed in order to compare with the ratios from direct labeling. Therefore, for all slides,
ratios above 1 and below 1 indicated elevated and decreased mRN A levels in dst] vs.
parental plants, respectively. An average, standard deviation, and median of these eight

ratios were determined and used as final ratio of mRNA levels.

78

Hierarchical clustering was performed using Cluster and Treeview software
(Eisen et al., 1998; available at http://genome-

www4.stanford.edu/MicroArray/SMD/restech.html).

79

REFERENCES

Abler, M. L., and Green, P. J. (1996). Control of mRNA stability in higher plants. Plant
Mol Biol 32, 63-78.

Altschul, S. F ., Madden, T. L., Schaffer, A. A., Zhang, J ., Zhang, 2., Miller, W., and
Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic Acids Res 25, 3389-3402.

Aubourg, S., Kreis, M., and Lechamy, A. (1999). The DEAD box RNA helicase family
in Arabidopsis thaliana. Nucleic Acids Res 27, 628-636.

Buzby, J. S., Brewer, G., and Nugent, D. J. (1999). Developmental regulation of RNA
transcript destabilization by A + U-rich elements is AUF l-dependent. J Biol Chem 274,
33973-33978.

Chen, C. Y., and Shyu, A. B. (1995). AU-rich elements: characterization and importance
in mRNA degradation. Trends Biochem Sci 20, 465-470.

Dellaporta, S. L., Wood, J. and Hicks, J .B. (1983). A plant DNA minipreparation: version
II. Plant Mol Biol Rep 1, 19-21.

DeRisi, J. L., Iyer, V. R., and Brown, P. O. (1997). Exploring the metabolic and genetic
control of gene expression on a genomic scale. Science 278, 680-686.

Eisen, M. B., Spellman, P. T., Brown, P. 0., and Botstein, D. (1998). Cluster analysis and
display of genome-wide expression patterns. Proc Natl Acad Sci U S A 95, 14863-14868.

Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction
endonuclease fragments to high specific activity. Anal Biochem 132, 6-13.

Feldbrugge, M., Arizti, P., Sullivan, M. L., Zamore, P. D., Belasco, J. G., and Green, P. J.
(2002). Comparative analysis of the plant mRNA-destabilizing element, DST, in
mammalian and tobacco cells. Plant Mol Biol 49, 215-223.

Franco, A. R., Gee, M. A., and Guilfoyle, T. J. (1990). Induction and superinduction of
auxin-responsive mRN As with auxin and protein synthesis inhibitors. J Biol Chem 265,
15845-15849.

Gil, P., and Green, P. J. (1996). Multiple regions of the Arabidopsis SAUR-AC1 gene
control transcript abundance: the 3' untranslated region functions as an mRN A instability
determinant. Embo J 15, 1678-1686.

Goda, H., Shimada, Y., Asami, T., Fujioka, S., and Yoshida, S. (2002). Microarray
analysis of brassinosteroid-regulated genes in Arabidopsis. Plant Physiol 130, 1319-1334.

80

Greenberg, M. E. and Belasco, J. G. (1993). Control of the decay of labile protooncogene
and cytokine mRNAs. Control of Messenger RNA Stability (San Diego: Academic
Press), 199-218.

Harmer, S. L., Hogenesch, J. B., Straume, M., Chang, H. S., Han, B., Zhu, T., Wang, X.,
Kreps, J. A., and Kay, S. A. (2000). Orchestrated transcription of key pathways in
Arabidopsis by the circadian clock. Science 290, 2110-2113.

Higgs, D. C., Barnes, L. J ., and Colbert, J. T. (1995). Abundance and half-life of the
distinct oat phytochrome A3 and A4 mRNAs. Plant MolBiol 29, 367-377.

Johnson, M. A., Baker, E.J., Colbert, J .T. and Green, P]. (1998). Determinants of mRNA
stability in plants. A look beyond transcription: Mechanisms determining mRNA stability
and translation in plants (Rockville: American Society of Plant Physiologists Press), 40-
53.

Johnson, M. A., Perez-Amador, M. A., Lidder, P., and Green, P. J. (2000). Mutants of
Arabidopsis defective in a sequence-specific mRNA degradation pathway. Proc Natl
Acad Sci U S A 97, 13991-13996.

Kehoe, D. M., Villand, P., and Somerville, S. (1999). DNA microarrays for studies of
higher plants and other photosynthetic organisms. Trends Plant Sci 4, 38-41.

Kiledjian, M., DeMaria, C. T., Brewer, G., and Novick, K. (1997). Identification of
AUFl (heterogeneous nuclear ribonucleoprotein D) as a component of the alpha-globin
mRNA stability complex. Mol Cell Biol 17, 4870-4876.

Kreps, J. A., Wu, Y., Chang, H. S., Zhu, T., Wang, X., and Harper, J. F. (2002).
Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold stress. Plant
Physiol 130, 2129-2141.

Loflin, P., Chen, C. Y., and Shyu, A. B. (1999). Unraveling a cytoplasmic role for
hnRN P D in the in vivo mRNA destabilization directed by the AU-rich element. Genes
Dev 13, 1884-1897.

Mandaokar, A., Kumar, V. D., Amway, M., and Browse, J. (2003). Microarray and
differential display identify genes involved in jasmonate-dependent anther development.
Plant Mol Biol 52, 775-786.

Martzivanou, M., and Hampp, R. (2003). Hyper-gravity effects on the Arabidopsis
transcriptome. Physiol Plant 1 18, 221-231.

McClure, B. A. and Guilfoyle, T. (1987). Characterization of a class of small auxin-
inducible soybean polyadenlyated RNAS. Plant MolBiol 9, 611-623.

81

McClure, B. A., and Guilfoyle, T. (1989). Rapid redistribution of auxin-regulated RNAS
during gravitropism. Science 243, 91-93.

McClure, B. A., Hagen, G., Brown, C. S., Gee, M. A., and Guilfoyle, T. J. (1989).
Transcription, organization, and sequence of an auxin-regulated gene cluster in soybean.
Plant Cell 1, 229-239.

Moser, M. J ., Holley, W. R., Chatterjee, A., and Mian, I. S. (1997). The proofreading
domain of Escherichia coli DNA polymerase I and other DNA and/or RNA exonuclease
domains. Nucleic Acids Res 25, 5110-5118.

Newman, T. C., Ohme-Takagi, M., Taylor, C. B., and Green, P. J. (1993). DST
sequences, highly conserved among plant SAUR genes, target reporter transcripts for
rapid decay in tobacco. Plant Cell 5, 701-714.

Newman, T., de Bruijn, F. J ., Green, P., Keegstra, K., Kende, H., McIntosh, L., Ohlrogge,
J., Raikhel, N., Retzel, E., Thomashow, M., and Somerville, S., (1994). Genes galore: a
summary of methods for accessing results from large-scale partial sequencing of
anonymous Arabidopsis cDNA clones. Plant Physiol 106, 1241-1255.

Ohme-Takagi, M., Taylor, C. B., Newman, T. C., and Green, P. J. (1993). The effect of
sequences with high AU content on mRN A stability in tobacco. Proc Natl Acad Sci U S
A 90,11811-11815.

Okamuro, J. K., Caster, B., Villarroel, R., Van Montagu, M., and Jofiiku, K. D. (1997).
The AP2 domain of APETALAZ defines a large new family of DNA binding proteins in
Arabidopsis. Proc Natl Acad Sci U S A 94, 7076-7081.

Peltz, S. W., and Jacobson, A. (1992). mRNA stability: in trans-it. Curr Opin Cell Biol 4,
979-983.

Phippen, T. M., Sweigart, A. L., Moniwa, M., Krumm, A., Davie, J. R., and Parkhurst, S.
M. (2000). Drosophila C-terminal binding protein functions as a context-dependent
transcriptional co-factor and interferes with both mad and groucho transcriptional
repression. J Biol Chem 275, 37628-37637.

Reymond, P., Weber, H., Damond, M., and Farmer, E. E. (2000). Differential gene
expression in response to mechanical wounding and insect feeding in Arabidopsis. Plant
Cell 12, 707-720.

Ross, J. (1995). mRNA stability in mammalian cells. Microbiol Rev 59, 423-450.

Ross, J. (1996). Control of messenger RNA stability in higher eukaryotes. Trends Genet
12, 171-175.

82

Schaffer, R., Landgraf, J ., Accerbi, M., Simon, V., Larson, M., and Wisman, E. (2001).
Microarray analysis of diurnal and circadian-regulated genes in Arabidopsis. Plant Cell
13, 113-123.

Scheible, W. R., Fry, 3., Kochevenko, A., Schindelasch, D., Zimmerli, L., Somerville, S.,
Loria, R., and Somerville, C. R. (2003). An Arabidopsis mutant resistant to thaxtomin A,
a cellulose synthesis inhibitor from Streptomyces species. Plant Cell 15, 1781-1794.

Schena, M., Shalon, D., Davis, R. W., and Brown, P. O. (1995). Quantitative monitoring
of gene expression patterns with a complementary DNA microarray. Science 270, 467-
470.

Schenk, P. M., Kazan, K., Wilson, I., Anderson, J. P., Richmond, T., Somerville, S. C.,
and Manners, J. M. (2000). Coordinated plant defense responses in Arabidopsis revealed
by microarray analysis. Proc Natl Acad Sci U S A 97, 11655-11660.

Seeley, K. A., Byrne, D. H., and Colbert, J. T. (1992). Red Light-Independent Instability
of Oat Phytochrome mRNA in Vivo. Plant Cell 4, 29-38.

Seki, M., Narusaka, M., Abe, H., Kasuga, M., Yamaguchi-Shinozaki, K., Caminci, P.,
Hayashizaki, Y., and Shinozaki, K. (2001). Monitoring the expression pattern of 1300
Arabidopsis genes under drought and cold stresses by using a fiill-length cDNA
microarray. Plant Cell 13, 61-72.

Shyu, A. B., Belasco, J. G., and Greenberg, M. E. (1991). Two distinct destabilizing
elements in the c-fos message trigger deadenylation as a first step in rapid mRN A decay.
Genes Dev 5, 221-231.

Sullivan, M. L., and Green, P. J. (1996). Mutational analysis of the DST element in
tobacco cells and transgenic plants: identification of residues critical for mRNA
instability. Rna 2, 308-315.

Taylor, C. B., and Green, P. J. (1991). Genes with homology to fungal and S-gene
RNases are expressed in Arabidopsis thaliana. Plant Physiol 96, 980-984.

Taylor, C. B., Bariola, P. A., DelCardayré, S. B., Raines, R. T., and Green, P. J. (1993).
RN82: A senescence-associated RNase of Arabidopsis that diverged from the S-RNases
before speciation. Proc Natl Acad Sci USA 90, 5118-5122.

Taylor, C. B., and Green, P. J. (1995). Identification and characterization of genes with
unstable transcripts (GUTS) in tobacco. Plant Mol Biol 28, 27-38.

Tucker, M., Valencia-Sanchez, M. A., Staples, R. R., Chen, J ., Denis, C. L., and Parker,
R. (2001). The transcription factor associated Ccr4 and Cafl proteins are components of
the major cytoplasmic mRNA deadenylase in Saccharomyces cerevisiae. Cell 104, 377-

386.

83

Vakalopoulou, E., Schaack, J ., and Shenk, T. (1991). A 32-kilodalton protein binds to
AU-rich domains in the 3' untranslated regions of rapidly degraded mRNAs. Mol Cell
Biol 11, 3355-3364.

Vasudevan, S., and Peltz, S. W. (2001). Regulated ARE-mediated mRNA decay in
Saccharomyces cerevisiae. Mol Cell 7, 1191-1200.

Wang, H., Ma, L., Habashi, J., Li, J ., Zhao, H., and Deng, X. W. (2002). Analysis of far-
red light-regulated genome expression profiles of phytochrome A pathway mutants in
Arabidopsis. Plant J 32, 723-733.

Wildsmith, S. E., and Elcock, F. J. (2001 ). Microarrays under the microscope. Mol Pathol
54, 8-16.

Willy, P. J ., Kobayashi, R., and Kadonaga, J. T. (2000). A basal transcription factor that
activates or represses transcription. Science 290, 982-985.

Yue, H., Eastman, P. S., Wang, B. B., Minor, J ., Doctolero, M. H., Nuttall, R. L., Stack,
R., Becker, J. W., Montgomery, J. R., Vainer, M., and Johnston, R. (2001). An evaluation
of the performance of cDNA microarrays for detecting changes in global mRNA
expression. Nucleic Acids Res 29, E41-41.

84

CHAPTER 3

CIRCADIAN CONTROL OF mRNA STABILITY: IMPACT OF THE dst MUTANTS

85

INTRODUCTION

Circadian clocks control rhythmic biological processes in many organisms and
persist in the absence of environmental cues (Allada et al., 2001; Harmer et al., 2001;
McClung, 2001). The Drosophila clock has been very well characterized and has been a
model system to investigate circadian mechanisms. The transcription factors Clock
(CLK) and Cycle (CYC) activate the transcription of the period (per) and timeless (tim)
genes; PER and TIM proteins in turn negatively regulate the transcription of per and tim
thus inhibiting the activity of CLK and CYC (Allada et al., 2001).

Genomic approaches to study circadian gene expression on a global basis in
Arabidopsis, Drosophila and mammalian systems have revealed that 2-10% of mRNAs
show circadian oscillations (Harmer et al., 2000; Claridge-Chang et al., 2001; McDonald
and Rosbash, 2001; Miyazaki et al., 2003; Schaffer et al., 2001; Ueda et al., 2002). A
recent study by Michael and McClung (2003) proposes that this could be an
underestimate and using enhancer trapping, the authors showed that 36% of the
Arabidopsis genome is under transcriptional control by the circadian clock.

For all the circadian clocks studied thus far, the core circadian oscillator is
comprised of transcriptional feedback loops. However numerous lines of evidence in
various systems suggest that posttranscriptional regulatory mechanisms are also required
for clock function (Edery, 1999).

The oscillation in mRNA levels of all clock controlled genes cannot be accounted
for by transcription alone. The best studied example to date corresponds to the per gene,
one of the components of the central oscillator in Drosophila where comparison of per

transcription rates and mRNA levels implicated a temporal regulation of mRNA half-life

86

(So and Rosbash, 1997). Further support for posttranscriptional regulation of per comes
from transgenic flies that demonstrate daily cycling of per mRNA expressed from a
constitutive promoter (F risch et al., 1994). It has also been shown that sequences within
per’s 5’ UTR are required for regulating temporal RNA expression (Stanewsky et al.,
2002) and this event depends on functional PER and TIM proteins (Suri et al., 1999). In
addition, posttranscriptional regulation is thought to be involved in the adaptation of
Drosophila to cold. An alternatively spliced form of the per transcript is generated at
lower temperature causing an advance in the phases of both the mRNA and protein cycles
(Majercak et al., 1999). Temperature appears to affect the translational control of a
central clock component of Neurospora as well. The levels of F RQ (frequency) increase
at higher temperatures although very little changes are seen for frq mRNA levels (Liu et
aL,l998)

Several posttranscriptional mechanisms are responsible for the lag between the
peak levels of mRNA and that of the resulting protein. In Drosophila, a kinase called
DBT (doubletime) is believed to be responsible for phosphorylation of PER thus
targeting PER for rapid degradation (Price et al., 1998). dbt mutants that have reduced
kinase activity show defective PER degradation (Suri and Rosbash, 2000). Another
kinase SGG (shaggy) is thought to be important for the phosphorylation of TIM
(Martinek et al., 2001). Recent experiments indicate that SLMB (slimb), a component of
the ubiquitin proteasome pathway, participates in controlling the levels of PER and TIM
(Grima et al., 2002). Interestingly, TIM is photosensitive and is degraded by the

proteasome in the presence of light (Naidoo et al., 1999).

87

The Drosophila CLK protein is also posttranscriptionally controlled, possibly due
to changes in stability induced by phosphorylation at specific times during the day (Kim
et al., 2002). Similar daily oscillations in the phosphorylated state of the Neurospora F RQ
protein have been observed (Garceau et al., 1997), and frq mutants in which the
phosphorylation site has been abolished have reduced rates of FRQ degradation (Liu et
al., 2000). The Neurospora homolog of Drosophila Slimb, FWDl, regulates the
degradation of FRQ through the ubiquitin-proteasome pathway (He et al., 2003). A recent
report indicates that antisensefrq transcripts are partly responsible for the entrainment of
the Neurospora clock (Kramer et al., 2003). Antisensefrq RNA is induced by light and in
the dark it cycles in antiphase to sense frq RNA. The existence of antisensefrq RNA
could suggest the involvement of RN Ai in the control of circadian gene expression.

Even though higher plants do not contain orthologs of clock proteins from other
systems, oscillatory feedback loops seem to be conserved. The Arabidopsis circadian
clock is suggested to be comprised of the MYB transcription factors LH Y (Late
Elongated Hypocotyl) and CCA] (Circadian Clock Associated 1) that are negative
elements of a transcriptional feedback loop (Schaffer et al., 1998; Wang and Tobin, 1998)
and have partially redundant functions (Mizoguchi et al., 2002). A pseudoresponse
regulator T 0C1 (Timing Of CAB expression 1) might function as a positive element
activating the transcription of CCA I/LH Y (Alabadi et al., 2001).

Posttranscriptional modifications are also an integral part of the plant circadian
clock. In Arabidopsis, a casein kinase II (CK2) phosphorylates CCA] and influences
CCAl binding to DNA (Sugano et a1; 1998). Moreover CK2 phosphorylates LHY in

vitro and its overexpression leads to the shortened period of various circadian rhythms

88

(Sugano et al., 1999). The tej mutant results in a light-independent period lengthening of
some clock genes and is caused by a mutation in a poly (ADP-Rib) glycohydrolase
(Panda et al., 2002). Two Arabidopsis clock associated proteins, ZTL (Zeitlupe) and
FKFl (Flavin-binding, Kelch repeat, F box), contain an F-box motif that promotes
ubiquitination of substrate proteins (Somers et al., 2000; Nelson et a1; 2000). Kim et al.
(2003) used Arabidopsis cell suspension cultures to demonstrate that the rhythmic
changes in the levels of ZTL are caused by circadian phase-specific differences in protein
degradation by the proteasome.

Transcript stability has been hypothesized to be responsible for the oscillations of
the CAB] mRNA in Arabidopsis (Millar and Kay, 1991). Increased transcript stability
has also been implicated in the accumulation of high steady state levels of CA T3 mRNA
in continuous dark (Zhong et al., 1997). Furthermore, based on nuclear run-on assays, the
cycling of NIA2 (Nitrate Reductase 2) is thought to occur through posttranscriptional
regulation (Pilgrim et al., 1993). In rice, the circadian regulation of CatA (CatalaseA)
expression has been postulated to be at the level of pre-mRNA stability (Iwamoto et al.,
2000)

Microarray analysis has shown that a subset of unstable transcripts in Arabidopsis
are controlled by the circadian clock (Gutierrez et al., 2002). Additional microarray
studies led to the finding that an unexpectedly high percentage of transcripts that were
changed in abundance in a mutant deficient in DST-mediated decay, dst], were circadian
regulated, indicating that the biological significance of the DST-mediated mRNA decay
pathway may be associated with the circadian clock (Pérez-Amador et al., 2001). In wild

type plants, for two transcripts SEN] and Ccr-like, mRNA decay is regulated by the

89

circadian clock (Gutierrez, 2003) and these transcripts are direct targets of the dst]
mutant (see Chapter 2). These observations prompted us to test whether the dst] mutation
affects the control of Cer-like and SEN] mRNA stability differently at different times of
the day. The results presented in this chapter demonstrate that the circadian clock
regulated stability of specific plant mRNAs, Ccr-like and SEN], is altered in the dst]
mutant and the DST 1 locus is associated with circadian control. Furthermore our data
indicates that control of mRNA stability adds another layer of regulation which impacts
at the whole plant level for certain circadian processes and has a prominent role in clock

controlled gene expression in plants.

RESULTS

Diurnal control of Ccr-like and SEN] mRNA stability is affected in the dst] mutant

It was previously shown that DSTl function is important for the normal diurnal
oscillatory expression of Ccr-like and SEN] transcripts (Gutiérrez, 2003). To determine if
this alteration in diurnal oscillation was caused by defective mRN A degradation in the
dst] mutant, mRN A decay rates were measured at two times during the day. Cordycepin
time courses were carried out one hour after dawn, ZTl (zeitgeber 1) and 8 hours after
dawn (ZT8) in two week old 1519 and dst] plants grown in 16 hours light/8 hours dark
conditions. In the morning (ZTl), Ccr-like mRNA was more unstable in dst] , relative to
the parental (p-value = 0.0003), as expected from the microarray studies (Figure 3.1A and
B). However this effect was reversed in the aftemoon (ZT8) such that the transcript was
now more stabilized in the mutant (Figure 3.1C and D; p-value < 0.0001). A similar

effect was seen on SEN] mRNA decay kinetics with the transcript being rapidly degraded

9O

 

 

 

 

 

    

Morning (ZTl)
0 15 30 60 90 120 0 15 30 60 90 120 “1)
OF? I . . =
Ccr-like ital v M N "r .u. H I;
5
eIF4A-.p--4-—ouw- uuuuuuu I-
< .1519 (106:1: 15 min)
p1519 .1er 5
E 0 dst] (62 :1: 7 min)
0'1 I I I I I
15 45 75 105 135
time (min)
C. D.
Afternoon (ZT8) 1.
an
0 15 30 60 90 120 0 15 30 60 90 120 .2
'3
Ccr-like..“"h .."?“ E
h
eIF4Auflm--M'- < 0
E 0 1519(48102 min)
”1519 ‘1‘” 0E1 u dst] (86:1: 12 min)

 

 

l I I I l
15 45 75 105 135
time (min)

Figure 3.1. Regulation of Ccr-like mRNA stability is altered in the dst] mutant during
the day.

Representative northern blot analysis of cordycepin time courses performed in 1519 and
dst] plants (A) 1 hour after dawn (zeitgeberl or ZTl), and (C) 8 hours after dawn (ZT8)
for Ccr-like and ez'f4A mRNAs. Samples consisted of 10 pg of total RNA isolated from
the indicated time points. Quantitation of the decrease in mRNA abundance and half-life
estimation for Ccr-like (B) in the morning and (D) in the afternoon. The stable eIF 4A
transcript was used as a reference for equal loading. Half-life values are representative of

2 independent cordycepin time courses.

91

in the afiemoon and stabilized in the morning in parental plants (Figure 3.28 and D).
The opposite trend was seen for the dst] mutant with SEN] mRNA being less stable in
the am. (p-value < 0.0001) and more stable in the p.m. (Figure 3.2B and D; p-value =
0.0061). Statistical analysis, as indicated above, showed that the differences in half-lives
seen for Ccr-like and SEN] mRNAs in the mutant and parental plants are significant.
These results suggest that normal DST 1 function is required for the proper timing of

degradation of Ccr-like and SEN] transcripts under diurnal conditions.

DST] function is required for normal circadian expression of SEN] and Ccr-like

mRNAs

To evaluate the impact of the dst] mutation on the circadian oscillation of Ccr-
like and SEN], mRNA levels were examined under free running conditions. Arabidopsis
seedlings were grown for 12 days in 16/8 LD cycles and on the morning of the 12th day
transferred to continuous light. Seedling tissue for mRN A isolation was harvested every 3
hours starting on the morning of the 12th day (circadian time 0/CTO) up to the 14th day
(CT45). As shown in Figure 3.3A and B, Ccr-like mRNA peaked approximately 3 hours
later in the dst] mutant than in the parental plants. This effect of the mRNA peak lagging
in the dst] was even more pronounced on the second day in constant light. A reduction in
amplitude for Cor-like mRNA was also seen in addition to the delay in phase. dst]
influence on the circadian oscillation of SEN] was slightly more complicated since SEN]
is known to be induced during the dark (Oh et al., 1996) possibly at the level of
transcription (Chung et al., 1997). As is evident in Figure 3.4A, the dark induction of

SEN] was not seen during the second day in continuous light. However, the SEN]

92

 

 

 

 

 

  

 

 

Morning (ZTl) 1
015306090120 015306090120 a” ..
'3
mm a----- ~---- g
2 ,1
< .
31p,“ 5 0 1519 (97 :1: 16 mm)
{.3
p1519 dst] E dst] (41 :1: 7 min)
0.0] I I I r l
15 45 75 105 135
time (min)
C. D.
1 l
Afternoon (ZT8) \
DD 0 . \
.E -
015306090120 015306090120 é o
E
0
SEN] OU"'"' """""‘ E
E o 1519 (53 :1 3 min)
811’“ E U dst] (75 1: 5 min)
p1519 dst] 0'1 I I I j I

15 45 75 105 135
time (min)

Figure 3.2. Regulation of SEN] mRNA stability is altered in the dst] mutant during the
day.

Representative northern blot analysis of cordycepin time courses performed in 1519 and
dst] plants (A) 1 hour after dawn (zeitgeberl or ZTl), and (C) 8 hours afier dawn (ZT8)
for SEN] and eif4A mRNAs. Samples consisted of 10 pg of total RNA isolated from the
indicated time points. Quantitation of the decrease in mRN A abundance and half-life
estimation for SEN] (B) in the morning and (D) in the afternoon. The stable eIF 4A
transcript was used as a reference for equal loading. Half-life values are representative of
2 independent cordycepin time courses.

93

A.

1519
0 3 6 9 12 15 18 2124 27 30 33 36 39 42 45 (CThrs.)

Car-like .-... ...... ..,.. a
muoOO¢ppudubobuuuo

dst]
0 3 6 9 12 15 18 2124 27 30 3336 39 42 45 (CThrs.)

Ccr-like «I Q... Q d an O... Q o
.m4-¢00¢0.09000999Q

B.
+1519 - ' dst]

 

1.2

Relative mRNA levels

 

 

 

 

0 F 1 T T 1 I I f f 1 l T 1 l 1

0 3 6 9121518212427303336394245
CT (hrs)

Figure 3.3. Circadian oscillation of Ccr-like mRNA is altered in the dst] mutant.

A) Representative northern blot analysis of time courses performed throughout two entire
days in continuous light for Ccr-like mRN A in dst] mutant and parental 1519 plants.
Samples consisted of 10 pg of total RNA isolated from the indicated times of the day
after subjective dawn (CT=0). B) Quantitation of mRN A levels for Ccr-like. All values
are the average of two independent experiments and are made relative to the highest
mRNA accumulation in either of the two genetic backgrounds. The signal for eIF 4A was
used as a reference for equal loading.

94

A.

1519
0 3 6 9 12 15 18 2124 27 30 3336 39 42 45 (CThrs.)

SEN] .O“""' ...."“.

eIF4A uuu~~~~“"“““““*

dst]
3 6 9 12 15 18 2124 27 30 33 36 39 42 45 (CThrs.)

s15~1....... QIOCIO.

eIF4A -uuuouuuuuu—udoéd

 

 

 

 

B.
+1519 ' dst]
1.2
5
>
2 L 7 7 _
2
E
0 L
C: 7‘
3 . ‘
7. " , ." ‘ >
0 .. ..

 

0 3 6 9 121518212427303336394245
CT (hrs)
Figure 3.4. Circadian oscillation of SEN] mRNA is altered in the dst] mutant.

A) Representative northern blot analysis of time courses performed throughout two entire
days in continuous light for SEN] mRNA in dst] mutant and parental 1519 plants.
Samples consisted of 10 pg of total RNA isolated from the indicated times of the day
after subjective dawn (CT=0). B) Quantitation of mRNA levels for SEN] . All values are
the average of two independent experiments and are made relative to the highest mRN A
accumulation in either of the two genetic backgrounds. The signal for eIF 4A was used as
a reference for equal loading.

95

transcript had reduced accumulation in the afternoon in the dst] mutant and this
difference in p.m accumulation between the dst] and parental plants was more apparent
on the second day (Figure 3.4A and B). Also the circadian expression of Cor-like and
SEN] transcripts under free running conditions was comparable to that seen previously
under diurnal conditions (Gutierrez, 2003). In order to study the effect of dst] on general
clock controlled gene expression, circadian oscillation of AtGRP7/CCR2, which
functions downstream of the master clock (Staiger, 2001), was tested. Oscillation of

C CR2 mRN A was unchanged in the dst] mutant compared to the parental (Figure 3.5A
and B). Taken together, this indicates that the circadian oscillations of a subset of clock

controlled genes, Ccr-like and SEN, are dependent on DST 1 function.

dst] affects circadian control of mRNA stability

We hypothesized that the stabilization of Ccr—like and SEN] mRNAs caused by
dst] in the afiemoon under diurnal conditions would also occur in the subjective
aftemoon under free running conditions. To test this hypothesis, mRNA half-lives were
measured in Arabidopsis seedlings that were transferred to continuous light for 2 days.
Transcription was inhibited 1 hour (CTl) and 8 hours (CT8) after the subjective morning
to determine mRNA decay rates. The impact of dst] was recapitulated for Ccr-like in
continuous light with the transcript being more unstable in dst] in the subjective morning
(Figure 3.68; p-value < 0.0001) and more stable in dst] in the subjective afternoon
(Figure 3.6D; p-value = 0.0171) relative to the parental. Even though some dampening in
mRNA half-lives was seen under circadian conditions relative to the diurnal conditions,

the differences in mRNA decay rates between the mutant and parental were statistically

96

A.

1519
3 6 9 15 18 2124 27 30 33 36 39 42 45 (CThrs.)

‘99.""'.9"'

elm .O...gouuuou..00

AtGRP7

 

d5” 3 6 9 12 15 18 2124 27 30 33 36 39 42 45 (CThrs.)

AtGRP7 0‘..‘...‘....6.

eIF4A ........QUCCQQQQ

3' + 1519 dst]
1.2

 

Relative mRNA levels

 

 

 

 

0 3 6 9 121518212427303336394245
CT (hrs)

Figure 3.5. Circadian oscillation of AtGRP7 mRNA is unaltered in the dst] mutant.

A) Representative northern blot analysis of time courses performed throughout two entire
days in continuous light for AtGRP7 mRN A in dst] mutant and parental 1519 plants.
Samples consisted of 10 pg of total RNA isolated from the indicated times of the day
after subjective dawn (CT=0). B) Quantitation of mRN A levels for AtGRP7. All values
are representative of at least two independent experiments and are made relative to the
highest mRNA accumulation in either of the two genetic backgrounds. The signal for
eIF 4A was used as a reference for equal loading.

97

Subjective Morning (CTI)

‘
’1 “—

 

0 15 30 60 90 120

Ccr-like .‘llfi" .UIIH

elF4A “.F". 1...-.-

p1519

Subjective Afternoon (ZT8)

 

 

 

 

015 3060 90120

Ccr-like . . . - _ ..

BIFM Conn.-

p1519

   

an
0 15 30 60 90 120 .5
.3 (x
E
2
g 9 1519 (129 1 21 min)
dst] E 'J dst] (70 :1: 10 min)
0'1 I I T r I
15 45 75 105 135
time (min)
1).
1 l.
g0 \‘n‘,\
0 15 30 60 90 120 IE -
<
.....- g °1519(50:l:3min) o
E a dst] (64 1 2 min)
dst] 0 l

 

 

T I I I l

15 45 75 105 135

time (min)

Figure 3.6. Circadian regulation of Ccr-like mRNA stability is altered in the dst] mutant.

Representative northern blot analysis of cordycepin time courses performed in 1519 and
dst] plants (A) 1 hour after subjective dawn (circadian time 1 or CTl), and (C) 8 hours
afier subjective dawn (CT8) for Ccr-like and eif4A mRNAs. Samples consisted of 10 pg
of total RNA isolated from the indicated time points. Quantitation of the decrease in
mRNA abundance and half-life estimation for Cor-like (B) in the subjective morning and
(D) in the subjective afternoon. The stable eIF 4A transcript was used as a reference for
equal loading. Half-life values are representative of 2 independent cordycepin time

courses.

98

significant. In the subjective morning, SEN] mRNA degrades faster in dst] than in
parental (Figure 3.7A and B), whereas in the afternoon no significant differences in
mRNA stability could be seen in dst] compared to the parental (Figure 3.7C and D). This
could be attributed in part to the dampening observed under circadian conditions since
the effect of dst] on SEN] mRNA stability under diurnal conditions was less dramatic

than for Ccr-like (Figure 3.1 and 3.2).

Opposite effect of dst2 on SEN] mRNA stability

For Ccr-like and SEN] , the dst2 mutation is known to have an effect opposite to
that of dst] in RNA gel blots of samples harvested in the am. (see Chapter 1). To
confirm this at the level of mRNA stability, mRNA half-lives were measured at ZTl and
ZT8 in dst2 and parental plants. As shown in Figure 3.8B, SEN] transcript was more
stabilized in the dst2 mutant in the morning. In the aftemoon, SEN] mRNA decayed at a
more or less similar rate in dst2 and parental plants (Figure 3.8D), but on comparing the
am. and p.m. half-lives for the transcript in dstZ, it was observed that the transcript
decayed at a much faster rate than in the parental (Figure 3.8). Similar experiments with

Ccr-like are in progress.

Impact at the whole plant level: Classical circadian phenotypes are altered in the dst
mutants

To address the question if the link between the DST-mediated decay pathway and
the circadian clock impacted at the whole plant level, leaf movement, a classical
circadian phenotype, was monitored in the dst mutants. The oscillation in the position of

leaves can be monitored by video imaging and this technique has been used to study

99

Subjective Morning (CTl)

 

 

 

 

 

 

 

015306090120 015306090120 14,.
:0
SEN] -----.. III-I... .5
.a ..
eIF4A ..---- ...UU- 5
p1519 dst] g 0 1519 (159 1 33 min)
E C dst] (85 1 8 min)
0.1 y I I I I
15 45 75 105 135
time (min)
C D.
Subjective Afternoon (ZT8)
l
015306090120 015306090120 ”1X
fl
SEN] .u.--- III..-” 5 ' ‘-\:
"" V
. . p g \
eIF4A hobo-69“ .16...- 2 '\
< 0 1519 (54 1 3 min) '
9'5” ‘1‘” E a dst] (54 1: 03 min)
0.1 I I I I I

15 45 75 105 135
time (min)

Figure 3.7. Circadian regulation of SEN] mRNA stability is altered in the dst] mutant.

Representative northern blot analysis of cordycepin time courses performed in 1519 and
dst] plants (A) 1 hour after subjective dawn (circadian time 1 or CTl), and (C) 8 hours
after subjective dawn (CT8) for SEN] and eif4A mRNAs. Samples consisted of 10 pg of
total RNA isolated from the indicated time points. Quantitation of the decrease in mRNA
abundance and half-life estimation for SEN] (B) in the subjective morning and (D) in the
subjective afternoon. The stable eIF 4A transcript was used as a reference for equal
loading. Half-life values are representative of 2 independent cordycepin time courses.

100

 

    

 

 

 

 

 

Morning (211) a: F-
:1
IE
015306090120 015306090120 2
SEN] ....._ . ---....- 3
< 6
E o 1519 (51 min) 0
eIF4A ~ --_..__ ""“'"'- E Udst2(10lmin)
p1519 dstZ 0.1 . . . 1 r
15 45 75 105 135
time (min)
C. D
Afternoon (ZT8) LLK
g “L. ..
0 15 30 60 90 120 0 15 30 60 90 120 § \ ‘ ~~
E ..._
SENI C.‘”" VIC-'Hr 2 \‘
. <
E o 1519 (35 min)
eIF4A ufi'“-- ------ E ads!2(53min)
p1519 dst2 0.01 U U , , ,

15 45 75 105 135
time (min)

Figure 3.8. Regulation of SEN] mRNA stability is altered in the dst2 mutant during the
day.

Representative northern blot analysis of cordycepin time courses performed in 1519 and
dst2 plants (A) 1 hour after dawn (zeitgeberl or ZTl), and (C) 8 hours after dawn (ZT8)
for SEN] and eif4A mRNAs. Samples consisted of 10 pg of total RNA isolated from the
indicated time points. Quantitation of the decrease in mRN A abundance and half-life
estimation for SEN] (B) in the morning and (D) in the afternoon. The stable eIF 4A
transcript was used as a reference for equal loading.

10]

mutations in the circadian clock (Millar et el., 1995). Seedlings were grown for 5 days in
12 hr light / 12 hr dark, transferred to 24-well plates and released into continuous light.
Cotyledon movement was then recorded for 7 days The potential significance of our
mRNA steady state and half-life results was emphasized by the finding that dst] was
phase lagging (Figure 3.9A) and dstZ was phase leading (Figure 3.9B) in these

experiments (in collaboration with Salome, P. and McClung, R.).

DISCUSSION

In this study, we have shown that the DST-mediated decay pathway is required
for the normal oscillation of selected clock controlled genes in Arabidopsis and is critical
for proper circadian regulation of the stability of these DST-containing transcripts.

The stability of the SEN] and Ccr-like mRNAs was altered in the mutant under
diurnal conditions and the effect in the morning and afternoon was different (Figure 3.1
and 3.2). From these findings it can be concluded that dst] is required for the proper
diurnal regulation of the stability of these DST-containing transcripts. A cycling mRNA
with a longer half-life will show a phase delay and reduced amplitude when compared
with an mRNA with a shorter half-life, assuming that the transcription rates are similar
(Wuarin et al., 1992). Under circadian conditions, the Ccr-like transcript has an increased
half-life in dst] compared to the parental (Figure 3.6) in the subjective aftemoon and this
posttranscriptional effect probably regulates the phase delay seen at the level of mRN A
oscillation and leaf movement (Figure 3.3 and Figure 3.9A). The dampening in the
mRNA decay rates seen under circadian conditions could be due to the fact that the clock
is not reset in constant light leading to desynchronization such that the individual

seedlings drift out of phase from each other.

102

 

 

 

 

 
  

 

+1519 . dstl
29; j " . ’iii" 1
23 1 l l j 4 l
a * 1 +
z: 27 ‘ ' ' l r - l J
'8 261 ' i ' '
CL 5 “ ' j
25' ' ' ‘ WA
’EL 24 ‘ é . . [HHVJ
o ' ‘ ‘ - i ;
£5 23 . l ' l I j
5' 22 : l , F l i l
21 I ( I I L I
20 5.1.1.1 1 id

 

0 12 24 36 48 60 72 84 96 108120
Hours in continuous light

 

 

 

 

 

 

Relative pixel position

 

 

4- _. , . __ , __

 

0 12 24 ‘3.“45 '60 72— 84 96 108 120
Hours in continuous light

Figure 3.9. Circadian rhythm of leaf movement is altered in the dst mutants.

The graphs represent Arabidopsis leaf movement data taken by video cameras over a
period of five days. Each peak represents the "up" position of the cotyledon as the
underside of the petiole grows more than the upper side. Each trough is the "down"
position as the upper side of the petiole grows more than the underside. The traces for A)
dst] and parental are an average of 6 seedlings while the traces for B) dst2 and parental
are average of 12 seedlings.

103

An opposite effect was seen with dst2 being phase leading in the leaf movement
studies (Figure 3.98). This observation is in agreement with the half-life changes seen in
dst2 and the parental plants. Even though the SEN] transcript is more stabilized in the
mutant compared to the parental in the morning, the mRN A decays at a much faster rate
in dst2 (Figures 3.8, compare am. and p.m.). This results in a shift in phase with the peak
being reached earlier in dst2.

It is evident that cis-acting elements as well as trans-acting factors are involved in
the posttranscriptional regulation of clock controlled mRN As. The 3’ UTR of Drosophila
per gene is AU-rich and it is known that AU-rich elements (ARES) are found in the
3'UTRs of several of the most unstable mammalian transcripts (Chen and Shyu, 1995).
Both Ccr-like and SEN] contain DST-like elements in their 3 ’UTR and are primary
targets of the dst] mutation. In addition, they belong to a unique subset of transcripts that
are decreased in abundance in dst] but are increased in abundance in dst2 (Pérez-Amador
et al., 2001). The exact nature of the DST 1 mutation is not known as yet but it is possible
that it corresponds to a sequence-specific RNA-binding protein. Clock controlled RNA-
binding proteins have been identified in the algae Gonyaulax polyedra (Morse et al.,
1989) and Chlamydomonas reinhardtii (Mittag et al., 1994) that bind to the 3’ UTRS of
several mRNAs that contain a UG-repeat region (Waltenberger et al., 2001). The
circadian clock also controls the binding activity of these proteins which are hypothesized
to function as translational suppressors (Mittag, 2003). Another example is the putative
RNA-binding LARK protein of Drosophila that oscillates in abundance and regulates

adult eclosion (McNeil et al., 1998).

104

Precedence for clock-controlled RNA-binding proteins in Arabidopsis has also
been documented. AtGRP7 mRNA as well as the protein undergoes circadian oscillations
with slight delay of the protein peak relative to the RNA peak (Heintzen et al., 1997).
Overexpression studies have shown that the transcript and protein are linked in a negative
autoregulatory circuit (Staiger, 2001). This negative autoregulation was shown to be
mediated through the binding of the protein to its own pre-mRNA resulting in the
formation of an alternatively spliced transcript with a premature stop codon which is
rapidly degraded (Staiger et al., 2003).

The role of mRNA stability in circadian control of gene expression has been
further highlighted by the recent characterization of a Xenopus deadenylase, noctumin
that is expressed in a rhythmic manner (Baggs and Green, 2003). A nocturnin homolog is
also present in Arabidopsis (Dupressoir et al., 2001). Since noctumin is expressed in a
circadian fashion, it is possible that this enzyme is responsible for the deadenylation of
clock controlled mRNAs. A relevant example is the oscillation of vasopressin transcript
levels in mammals where two species of mRNAs with differences in their poly(A) tail
length are present at different times of the day (Robinson et al., 1988).

dst] plants do not exhibit a severe effect on the clock at the molecular level since
other clock controlled genes such as AtGRP7 show normal oscillation patterns in dst]
(Figure 3.5). Our data predicts that DSTl probably functions downstream of the master
clock and affects a subset of clock controlled genes at the level of mRNA stability. This
hypothesis is further supported by the fact that DST 1 maps to a region on chromosome 1
(see Chapter 4) that does not seem to contain any genes known to be involved in clock

function. Cloning of the DST I gene should help us elucidate the precise relationship

105

between the DST-mediated decay machinery and the circadian clock. The link between
sequence-specific decay and the circadian clock uncovered in our experiments could be
extended to other systems as a powerful tool towards unraveling circadian clock

mechanisms at the posttranscriptional level.

MATERIALS AND METHODS

Arabidopsis strains and growth conditions

All Arabidopsis thaliana plants described are from the accession Columbia. dst]
mutant (from the second backcross to the parental line) and 1519 parental seeds were
plated on agar plates containing 1x Murashige and Skoog salts, 1x Gamborg's vitamins,
1% sucrose and 50 ug/ml kanamycin for two weeks in an incubator set at 16 hours light
(125 uE/mz) /8 hours dark and 21°C. For the circadian (free running) experiments,
Arabidopsis seedlings were grown for 12 days in 16 hours light/8 hours dark and on the
morning of the 12th day were transferred to continuous light for 48 hours. Lighting was

provided by fluorescent light bulbs.

Half-life measurements, RNA preparation and analysis

Half-lives were determined as described by Seeley et al. (1992) with the
following modifications. Two-week old Arabidopsis seedlings were transferred to a flask
with incubation buffer. After a 30 min incubation, 3'-deoxyadenosine (cordycepin) was
added to a final concentration of 0.6 mM (time 0). Tissue samples were harvested at
regular intervals thereafter and frozen in liquid nitrogen. Total RNA was isolated using

standard techniques. RNA was analyzed by electrophoresis on 2% formaldehyde/ 1.2%

106

agarose gels and blotted onto nylon membrane (Nytran Plus, Schleicher & Schuell,
Keene, NH). DNA probes were labeled with [a-32P]dCTP by the random primer method
(Feinberg and Vogelstein, 1983) and purified from unincorporated nucleotides using
probe purification columns (NucTrap, Stratagene, La Jolla, CA). The RNA blots were
hybridized as described in Taylor and Green (1991) using the indicated 32P-labeled
probes. For a loading control, RNA blots were hybridized with a 32P-labeled cDNA probe
for the Arabidopsis translation initiation factor eIF 4A (Taylor et al., 1993).

SEN] is a single gene in the genome of Arabidopsis thaliana (Oh et al., 1996).
Ccr-like protein has no similarity to other protein sequences in the Arabidopsis genome
as determined by BLASTCLUST
(ftp://Ptp.ncbi.nlm.nih.gov/blast/documents/README.bcl). In addition, BLASTN
analysis (nucleotide vs. nucleotide comparison) using SEN] and Cor-like transcribed
sequences as query revealed no significant similarity to other transcribed sequences in the
Arabidopsis genome. Hence, northern blot probes used in this study were made by the
polymerase chain reaction using EST clones as template, 111D3T7 for SEN] and
245H16T7 for Ccr-like, and SP6 and T7 vector primers.

Statistical comparison of the half-lives measured at the different times of the day
was performed using a repeated measure model by Xue Lan (Statistics Department,

Michigan State University).

Leaf movement assay

Assessment of rhythmicity in leaf movement was carried out as described (Millar
et al., 1995). For light entrainment, seedlings were grown under white light for 5 days in

a 12 hr light / 12 hr dark photoperiod. For temperature entrainment, seedlings were grown

107

under white light for 7 days in a 12 hr 22°C / 12 hr 12°C temperature regime. On the 5th
or 7th day, seedlings were transferred to 24-well cloning plates and the plates were
released into continuous white light and constant temperature of 22°C. Leaf movement
was recorded every 20 min over 7 days by Panasonic CCTV cameras, model WV-BP120
(Matsushita Communications Industrial, Laguna, Philippines). Post-run analysis was
performed using the Kujata software program [Millar et al., 1995), and traces were

analyzed by FFT-NLLS [Plautz et al., 1997).

108

REFERENCES

Alabadi, D., Oyama, T., Yanovsky, M. J., Harmon, F. G., Mas, P., and Kay, S. A. (2001).
Reciprocal regulation between TOC 1 and LHY/CCA] within the Arabidopsis circadian
clock. Science 293, 880-883.

Allada, R., Emery, P., Takahashi, J. S., and Rosbash, M. (2001). Stopping time: the
genetics of fly and mouse circadian clocks. Annu Rev Neurosci 24, 1091-1119.

Baggs, J. E., and Green, C. B. (2003). Noctumin, a Deadenylase in Xenopus laevis
Retina. A Mechanism for Posttranscriptional Control of Circadian-Related mRNA. Curr
Biol 13, 189-198.

Chen, C. Y., and Shyu, A. B. (1995). AU-rich elements: characterization and importance
in mRNA degradation. Trends Biochem Sci 20, 465-470.

Chung, B. C., Lee, S. Y., Oh, S. A., Rhew, T. H., Nam, H. G., and Lee, C. H. (1997). The
promoter activity of SENl, a senescence-associated gene of Arabidopsis, is repressed by
sugars. J Plant Physiol 151, 339—345.

Claridge-Chang, A., Wijnen, H., Naef, F ., Boothroyd, C., Rajewsky, N., and Young, M.
W. (2001). Circadian regulation of gene expression systems in the Drosophila head.
Neuron 32, 657-671.

Dupressoir, A., More], A. P., Barbot, W., Loireau, M. P., Corbo, L., and Heidmann, T.
(2001). Identification of four families of yCCR4- and M g2+-dependent endonuclease-
related proteins in higher eukaryotes, and characterization of orthologs of yCCR4 with a
conserved leucine-rich repeat essential for hCAF 1/hPOP2 binding. BMC Genomics 2, 9.

Edery, I. (1999). Role of posttranscriptional regulation in circadian clocks: lessons from
Drosophila. Chronobiol Int 16, 377-414.

Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction
endonuclease fragments to high specific activity. Anal Biochem 132, 6-13.

Frisch, B., Hardin, P. E., Hamblen-Coyle, M. J ., Rosbash, M., and Hall, J. C. (1994). A
promoterless period gene mediates behavioral rhythmicity and cyclical per expression in
a restricted subset of the Drosophila nervous system. Neuron 12, 555-570.

Garceau, N. Y., Liu, Y., Loros, J. J ., and Dunlap, J. C. (1997). Alternative initiation of
translation and time-specific phosphorylation yield multiple forms of the essential clock
protein FREQUENCY. Cell 89, 469-476.

Grima, B., Lamouroux, A., Chelot, E., Papin, C., Limbourg-Bouchon, B., and Rouyer, F.

109

(2002). The F-box protein slimb controls the levels of clock proteins period and timeless.
Nature 420, 178-182.

Gutierrez, R. A. (2003). Inherent and regulated mRNA stability in A. thaliana. PhD
Dissertation, Michigan State University, 67-98.

Gutierrez, R. A., Ewing, R. M., Cherry, J. M., and Green, P. J. (2002). Identification of
unstable transcripts in Arabidopsis by cDNA microarray analysis: rapid decay is
associated with a group of touch- and specific clock-controlled genes. Proc Natl Acad Sci
U S A 99,11513-11518.

Harmer, S. L., Hogenesch, J. B., Straume, M., Chang, H. S., Han, B., Zhu, T., Wang, X.,
Kreps, J. A., and Kay, S. A. (2000). Orchestrated transcription of key pathways in
Arabidopsis by the circadian clock. Science 290, 2110-2113.

Harmer, S. L., Panda, 8., and Kay, S. A. (2001). Molecular bases of circadian rhythms.
Annu Rev Cell Dev Biol 17, 215-253.

He, Q., Cheng, P., Yang, Y., Yu, H., and Liu, Y. (2003). FWDl-mediated degradation of
FREQUENCY in Neurospora establishes a conserved mechanism for circadian clock
regulation. Embo J 22, 4421-4430.

Heintzen, C., Nater, M., Apel, K., and Staiger, D. (1997). AtGRP7, a nuclear RNA-
binding protein as a component of a circadian-regulated negative feedback loop in
Arabidopsis thaliana. Proc Natl Acad Sci U S A 94, 8515-8520.

Iwamoto, M., H.Higo, and K.Higo. (2000). Differential diurnal expression of rice
catalase genes: the 5'- flanking region of CatA is not sufficient for circadian control. Plant
Science 151, 39—46.

Kim, B. Y., Bae, K., Ng, F. S., Glossop, N. R., Hardin, P. E., and Edery, I. (2002).
Drosophila CLOCK protein is under posttranscriptional control and influences light-
induced activity. Neuron 34, 69-81.

Kim, W. Y., Geng, R., and Somers, D. E. (2003). Circadian phase-specific degradation of
the F-box protein ZTL is mediated by the proteasome. Proc Natl Acad Sci U S A 100,
4933-4938.

Kramer, C., Loros, J. J ., Dunlap, J. C., and Crosthwaite, S. K. (2003). Role for antisense
RNA in regulating circadian clock function in Neurospora crassa. Nature 421, 948-952.

Liu, Y., Loros, J ., and Dunlap, J. C. (2000). Phosphorylation of the Neurospora clock

protein FREQUENCY determines its degradation rate and strongly influences the period
length of the circadian clock. Proc Natl Acad Sci U S A 97, 234-239.

110

Liu, Y., Merrow, M., Loros, J. J., and Dunlap, J. C. (1998). How temperature changes
reset a circadian oscillator. Science 281, 825-829.

Majercak, J ., Sidote, D., Hardin, P. E., and Edery, I. (1999). How a circadian clock adapts
to seasonal decreases in temperature and day length. Neuron 24, 219-230.

Martinek, S., Inonog, S., Manoukian, A. S., and Young, M. W. (2001). A role for the
segment polarity gene shaggy/GSK-3 in the Drosophila circadian clock. Cell 105, 769-
779.

McClung, C. R. (2001). Circadian Rhythms in Plants. Annu Rev Plant Physiol Plant Mol
Biol 52, 139-162.

McDonald, M. J ., and Rosbash, M. (2001). Microarray analysis and organization of
circadian gene expression in Drosophila. Cell 107, 567-578.

McNeil, G. P., Zhang, X., Genova, G., and Jackson, F. R. (1998). A molecular rhythm
mediating circadian clock output in Drosophila. Neuron 20, 297-303.

Michael, T. P., and McClung, C. R. (2003). Enhancer trapping reveals widespread
circadian clock transcriptional control in Arabidopsis. Plant Physiol 132, 629-639.

Millar, A. J ., and Kay, S. A. (1991). Circadian Control of cab Gene Transcription and
mRNA Accumulation in Arabidopsis. Plant Cell 3, 541-550.

Millar, A. J ., Straume, M., Chory, J., Chua, NH, and Kay, S. A. (1995). The regulation
of circadian period by phototransduction pathways in Arabidopsis. Science 267, 1163-
1166.

Mittag, M. (2003). The function of circadian RNA-binding proteins and their cis-acting
elements in microalgae. Chronobiol Int 20, 529-541.

Mittag, M., Lee, D. H., and Hastings, J. W. (1994). Circadian expression of the luciferin-
binding protein correlates with the binding of a protein to the 3' untranslated region of its
mRNA. Proc Natl Acad Sci U S A 91, 5257-5261.

Miyazaki, T., Kuwano, H., Kato, H., Ando, H., Kimura, H., Inose, T., Ohno, T., Suzuki,
M., Nakajima, M., Manda, R., et al. (2003). Correlation between serum melatonin
circadian rhythm and intensive care unit psychosis afier thoracic esophagectomy. Surgery
133, 662-668.

Mizoguchi, T., Wheatley, K., Hanzawa, Y., Wright, L., Mizoguchi, M., Song, H. R.,

Carre, I. A., and Coupland, G. (2002). LHY and CCAl are partially redundant genes
required to maintain circadian rhythms in Arabidopsis. Dev Cell 2, 629-641.

111

Morse, D., Pappenheimer, A. M., Jr., and Hastings, J. W. (1989). Role of a luciferin-
binding protein in the circadian bioluminescent reaction of Gonyaulax polyedra. J Biol
Chem 264, 11822-11826.

Naidoo, N., Song, W., Hunter-Ensor, M., and Sehgal, A. (1999). A role for the
proteasome in the light response of the timeless clock protein. Science 285, 1737-1741.

Nelson, D. C., Lasswell, J ., Rogg, L. E., Cohen, M. A., and Bartel, B. (2000). FKF l, a
clock-controlled gene that regulates the transition to flowering in Arabidopsis. Cell 101,
331-340.

Oh, S. A., Lee, S. Y., Chung, I. K., Lee, C. H., and Nam, H. G. (1996). A senescence-
associated gene of Arabidopsis thaliana is distinctively regulated during natural and
artificially induced leaf senescence. Plant Mol Biol 30, 739-754.

Panda, S., Poirier, G. G., and Kay, S. A. (2002). tej defines a role for poly(ADP-
ribosyl)ation in establishing period length of the arabidopsis circadian oscillator. Dev
Cell 3, 51-61.

Perez-Amador, M. A., Lidder, P., Johnson, M. A., Landgraf, J ., Wisman, E., and Green,
P. J. (2001). New molecular phenotypes in the dst mutants of Arabidopsis revealed by
DNA microarray analysis. Plant Cell 13, 2703-2717.

Pilgrim, M. L., Caspar, T., Quail, P. H., and McClung, C. R. (1993). Circadian and light-
regulated expression of nitrate reductase in Arabidopsis. Plant Mol Biol 23, 349-364.

Plautz, J .D., Straume, M., Stanewsky, R., Jamison, C.F., Brandes, C., Dowse, H.B., Hall,
J .C., and Kay, SA. (1997). Quantitative analysis of Drosophila period gene transcription
in living animals. J Biol Rhythms 12, 204-217.

Price, J. L., Blau, J., Rothenfluh, A., Abodeely, M., Kloss, B., and Young, M. W. (1998).
double-time is a novel Drosophila clock gene that regulates PERIOD protein
accumulation. Cell 94, 83-95.

Robinson, B.G., Frim, D., M., Schwartz, W., J. and Majzoub, J .A. (1988). Vasopressin
mRNA in the suprachiasmatic nuclei: daily regulation of polyadenylate tail length.
Science 241, 342—344.

Schaffer, R., Landgraf, J ., Accerbi, M., Simon, V., Larson, M., and Wisman, E. (2001).
Microarray analysis of diurnal and circadian-regulated genes in Arabidopsis. Plant Cell
13, 113-123.

Schaffer, R., Ramsay, N., Samach, A., Corden, S., Putterill, J ., Carre, I. A., and

Coupland, G. (1998). The late elongated hypocotyl mutation of Arabidopsis disrupts
circadian rhythms and the photoperiodic control of flowering. Cell 93, 1219-1229.

112

Seeley, K. A., Byme, D. H., and Colbert, J. T. (1992). Red Light-Independent Instability
of Cat Phytochrome mRNA in Vivo. Plant Cell 4, 29-38.

So, W., V., and Rosbash, M. (1997). Post-transcriptional regulation contributes to
Drosophila clock gene mRNA cycling. Embo J 16, 7145-7155.

Somers, D. E., Schultz, T. F., Milnamow, M., and Kay, S. A. (2000). ZEITLUPE encodes
a novel clock-associated PAS protein from Arabidopsis. Cell 101, 319-329.

Staiger, D. (2001). RNA-binding proteins and circadian rhythms in Arabidopsis thaliana.
Philos Trans R Soc Lond B Biol Sci 356, 1755-1759.

Staiger, D., Zecca, L., Kirk, D. A., Apel, K., and Eckstein, L. (2003). The circadian clock
regulated RNA-binding protein AtGRP7 autoregulates its expression by influencing
alternative splicing of its own pre-mRNA. Plant J 33, 361-371.

Stanewsky, R., Lynch, K. S., Brandes, C., and Hall, J. C. (2002). Mapping of elements
involved in regulating normal temporal period and timeless RNA expression patterns in
Drosophila melanogaster. J Biol Rhythms 17, 293-306.

Sugano, S., Andronis, C., Green, R. M., Wang, Z. Y., and Tobin, E. M. (1998). Protein
kinase CK2 interacts with and phosphorylates the Arabidopsis circadian clock-associated
1 protein. Proc Natl Acad Sci U S A 95, 11020-11025.

Sugano, S., Andronis, C., Ong, M. S., Green, R. M., and Tobin, E. M. (1999). The protein
kinase CK2 is involved in regulation of circadian rhythms in Arabidopsis. Proc Natl Acad
Sci U S A 96, 12362-12366.

Suri, V., Hall, J. C., and Rosbash, M. (2000). Two novel doubletime mutants alter
circadian properties and eliminate the delay between RNA and protein in Drosophila. J
Neurosci 20, 7547-7555.

Suri, V., Lanjuin, A., and Rosbash, M. (1999). TIMELESS-dependent positive and
negative autoregulation in the Drosophila circadian clock. Embo J 18, 675-686.

Taylor, C. B., Bariola, P. A., DelCardayré, S. B., Raines, R. T., and Green, P. J. (1993).
RN82: A senescence-associated RNase of Arabidopsis that diverged from the S-RNases
before speciation. Proc Natl Acad Sci USA 90, 5118-5122.

Taylor, C. B., and Green, P. J. (1991). Genes with homology to fungal and S-gene
RNases are expressed in Arabidopsis thaliana. Plant Physiol 96, 980-984.

Ueda, H. R., Matsumoto, A., Kawamura, M., lino, M., Tanimura, T., and Hashimoto, S.

(2002). Genome-wide transcriptional orchestration of circadian rhythms in Drosophila. J
Biol Chem 277, 14048-14052.

113

Waltenberger, H., Schneid, C., Grosch, J. 0., Bareiss, A., and Mittag, M. (2001).
Identification of target mRNAs for the clock-controlled RNA-binding protein Chlamy 1
from Chlamydomonas reinhardtii. Mol Genet Genomics 265, 180-188.

Wang, Z. Y., and Tobin, E. M. (1998). Constitutive expression of the CIRCADIAN
CLOCK ASSOCIATED l (CCAl) gene disrupts circadian rhythms and suppresses its
own expression. Cell 93, 1207-1217.

Wuarin, J ., Falvey, E., Lavery, D., Talbot, D., Schmidt, E., Ossipow, V., Fonjallaz, P.,
and Schibler, U. (1992). The role of the transcriptional activator protein DBP in circadian
liver gene expression. J Cell Sci Suppl 16, 123-127.

Zhong, H. H., Resnick, A. S., Straume, M., and Robertson McClung, C. (1997). Effects
of synergistic signaling by phytochrome A and cryptochromel on circadian clock-
regulated catalase expression. Plant Cell 9, 947-955.

114

CHAPTER 4

GENETIC MAPPING OF dst]

115

INTRODUCTION

Insertional mutagenesis techniques have been widely used to identify the function
of unknown genes using T-DNAs (Alonso et al., 2003; Krysan et al., 1999) and
transposable elements (Aarts et al., 1995; Weigel et al., 2000). However these methods
cannot create partial loss-of-function or gain-of-function alleles. In contrast, chemical
mutagenesis causes point mutations generating different types of alleles; this could be an
advantage, especially if the genes in the regulatory pathway are essential. Furthermore,
because EMS mutagenesis can result in a higher mutational frequency than T-DNA
mutagenesis, fewer plants need to be screened in order to find a mutation in any given
gene. The mutated genes then have to be isolated based on their map position.

Map-based cloning is an indirect approach; mapping narrows down the genetic
interval that contains a mutation by sequentially excluding all other parts of the genome.
Mapping with a high resolution requires a high density of genetic markers around the
region of interest. This has been greatly facilitated by the sequencing of Columbia and
Landsberg erecta (Ler) ArabidOpsis ecotypes which are sufficiently divergent to support
the design of molecular markers at this high density. Also, the sequence of the
Arabidopsis genome has been completed which should expedite pinpointing the genes
after fine mapping.

Some molecular markers commonly used in mapping experiments include simple
sequence length polymorphisms (SSLPs), cleaved amplified polymorphic sequences
(CAPS) and derived CAPS (dCAPS) (Lukowitz et al., 2000). These markers are co-
dominant and are PCR-based. SSLP (Bell and Ecker, 1994) markers are based on the

variability of short repetitive sequences. These markers are amplified using PCR and

116

exhibit ecotype-specific polymorphisms on agarose/polyarylamide gels. CAPS markers
detect polymorphisms that occur in restriction sites (Konieczny and Ausubel, 1993) while
dCAPS are capable of exploiting all single nucleotide changes whereby mismatches in
PCR primers are used to create restriction sites (Neff et al., 1998). It is also possible to
generate additional markers in the region of interest by utilizing single nucleotide
polymorphism (SNP) changes as well as insertion-deletion (InDel) differences. On
comparing Arabidopsis Columbia and Ler genomic sequences, there is one SNP every
3.3 kb and one InDel every 6.6 kb (Jander et al., 2002). A total of 56,670 polymorphisms
have been deposited on The Arabidopsis Information Resource web site
(http://www.arabidopsis.org/Cereon) including 37,344 SNPs, 18,579 InDels, and 747
Large Indels.

To better understand the molecular mechanisms involved in sequence-specific
mRNA decay, specially designed transgenic plants were used to select for mutants that
are defective in DST-mediated mRNA degradation using an ethyl methane-sulfonate-
mutagenized population (Johnson et al., 2000). The mutants that were isolated were
extremely rare (3/~800,000), were all incompletely dominant and lacked any visible
aberrant phenotype. This could be because the DST genes are essential and the dst
mutants are weak alleles, or it is possible that the DST genes are part of gene families that
have redundant members. Cloning of the DST genes should help in the elucidation of the
components of the DST-recognition and decay machinery. dst] was chosen for cloning
since it is the best characterized but these experiments should be applicable to the other
dst mutants as well. The results described in this chapter demonstrate that RAP2.4, first

identified in the microarray experiments (see Chapter 2), is as an excellent endogenous

117

molecular marker for scoring dst] . Using RAP2.4 expression levels, homozygous dst]
mutants were followed independent of the transgene and the mutation has been mapped

to a 107 kb interval on the bottom of chromosome 1.

RESULTS

dst] mutation does not appear to be linked to the transgene

The dst] phenotype is a 3-4 fold increase in HPH mRN A levels and heterozygous
plants exhibit half this increase (Johnson et al., 2000). The requirement of the transgene
to score the dst] mutants had several drawbacks since both the dst] mutation and the
transgene were segregating in the mapping population. Consequently, in the F2, HPH-
DST mRN A abundance reflected the dosage of the transgene and the dst] mutation. As a
result larger number of plants had to be screened to identify homozygous dst] mutants.
To overcome this dependence on the transgene, inheritance of RAP2.4 mRNA abundance
was examined for the mutant. Progeny of the second backcross to WT (1519-31) (F 1) and
the progeny of self-fertilizations of these plants (F2) were used in these studies. The F1
plants showed intermediate levels of RAP2.4 mRN A abundance as expected (data not
shown). Segregation of increased RAP2.4 mRNA abundance in the F2 populations was
also consistent with semi-dominance. Of 240 F2 plants segregating dst], 57 were
observed with high RAP2.4 mRNA abundance (9.3 i 3.3 fold higher than 1519-31), 111
had intermediate RAP2.4 mRNA abundance (2.07 i 0.8) and 72 showed RAP2.4 mRNA
abundance that was similar to parental (0.92 i 0.2) (Figure 4.1). Segregation in the dst]

F2 populations is most easily explained by a ratio of 1:2:1 as would be expected for the

118

# 329
# 563
# 431
# 363
1519
1519
# 489
# 411
# 421
# 424

RAP2. 4

eIF4A “n. -_. ~~ - .. no. 5.... out. u...-

Figure 4.1. mRNA abundance of RAP2.4 in F2 plants from the second back-cross of dst]
relative to WT (1519-31).

8 representative plants are shown. Total RNA was prepared from rosette leaves and
analyzed by Northern blot hybridization. Radiolabeled probes, prepared against the
indicated transcripts, were used in sequential hybridizations of the same blot. The
numbers indicate individual plants. #411 is an example of an F2 plant with high RAP2.4
mRNA levels, #431 with intermediate and #329 with RAP2.4 mRNA levels similar to
WT (1519-31).

119

inheritance of a semi-dominant single gene, indicating that the mutation is not linked to

the transgene (Table 4.1).

Use of RAP2.4 as an endogenous marker to score homozygous mutants

It is known that the dst] mutation is associated with circadian rhythms (Pérez-
Amador et al., 2001). In order to determine if RAP2.4 could be used as a phenotypic
marker for scoring the dst] mutation in the mapping population, it was critical to
establish that RAP2.4 was not circadian regulated. Towards this end, mRNA half-life
experiments were carried out in dst] and 1519 plants in the morning and afiemoon. A
comparison of Figures 4.2B and 4.2D shows that RAP2.4 mRNA is more stable in dst]
than in the parental 1519 line when mRNA decay is monitored in the morning (zeitgeber
time 1/ZT1) and in the afternoon (ZT 8) and all of the decay curves are nearly identical
under the two conditions. These mRN A stability measurements indicate that the effect of
dst] on RAP2.4 is insensitive to the time of day. It is also of interest to note that RAP2.4

was not regulated by circadian rhythms in the dst] microarray experiments.

Fine mapping of the dst] locus

The first step in a mapping experiment is to generate a mapping population. Since
the mutation is in a Columbia (glI) background, dst] was crossed to Landsberg erecta
(gl] -1 ). F2 plants from this cross were scored by Northern blot analysis for S-fold or
higher RAP2.4 mRNA abundance compared to parental 1519 plants. 78 dst]/dst] F2
plants were identified and genomic DNA was extracted from them for PCR. Mapping of

the DST] gene to chromosome 1 was accomplished by linkage analysis to SSLP markers

120

 

Table 4.1. Segregation of increased RAP2.4 mRNA abundance in the progeny of crosses

between dst1 and 1519-31 (DST1).

 

 

Cross Class RAP2.4' n 12, P’
DST1/dst1 X DSTT/dst 1 F2 High 9.3 i 3.3 57
Int 2.07 i 0.8 111 1.9 P>0.3
WT 0.92 i 0.2 72

 

Int, intermediate.

WT, wild-type.

* RAP2.4 mRNA abundance: (RAP2.4/eif4A) segregating class/ (RAP2.4/eif4A) WT i standard

error.

f 12 calculated for 1:2:1 segregation of WT/lnt/High RAP2.4 mRNA abundance

DST/DST, WT (1519-31).

 

121

 

 

 

 

 

 

Morning (ZTl)
1
15 30 60 90 120 15 30 60 90 120 on
E
. II as: 1‘ d .E
RAP24 ' Q . ' . g h .2
eIF4A fi_,._.__ .................. 2
<1
p1519 dst1 E ° 1519(53 min)
a a dst1 (76 min)
0.1 U I Y I I
15 45 75 105 135
time (min)
C- Afternoon (ZT8) D-
] Rh.
15 30 60 90 120 15 30 60 90 120
5D
RAP2.4 $4.! .. is: u an a. .5
'3
eIF4A . . 1.. ... .. 5
i-
4:
p1519 (15!! E
E °1519(51 min)
‘3 dst] (70 min)
0.1 .

 

 

15 45 75 105 135
time (min)

Figure 4.2. RAP2.4 mRNA is stabilized in the dst1 mutant and the decay kinetics are
similar in the am and p.m.

Representative northern blot analysis of cordycepin time courses performed in 1519 and
dst] plants (A) 1 hour afier dawn (zeitgeberl or ZTl), and (C) 8 hours after dawn (ZT8)
for RAP2.4 and eif4A mRNAs. Samples consisted of 10 pg of total RNA isolated from
the indicated time points. Quantitation of the decrease in mRN A abundance and half-life
estimation for RAP2.4 (B) in the morning and (D) in the aftemoon. The stable eIF 4A
transcript was used as a reference for equal loading.

122

(Figure 4.3). Recombination events between molecular markers and the dst1 locus in the
homozygous mutants were analyzed to confirm that dst1 was located between markers
f16p17 and f1n192. Additional polymorphic SSLP and CAPS markers were identified in
this interval and two markers (f22c121 and flnl9l) were found that were 5.8%
recombination apart (Figure 4.4).

A larger F2 population was then generated for fine-resolution mapping. The
closely linked SSLP markers (107 kb), f22c121 and f1n191, were used to screen a
mapping population of 970 F2 plants. 24 recombinants within the interval defined by the
flanking molecular markers were identified. RNA gel blot analysis was used to determine
whether the recombinants were homozygous mutant, homozygous wild type, or
heterozygous at the DST 1 locus. This information together with additional markers is

now being used to further narrow down the interval.

DISCUSSION

The strategy for scoring dst] was tailored in order to avoid dependence on the
transgene and thereby expedite cloning. The reliance of the dst] phenotype on the
transgene is an immense drawback for the generation of mapping populations due to the
small magnitude of change in HPH-DST mRNA levels. This scenario is further
complicated by the semi-dominance of dst1. A locus like dst] presents unique challenges
as it does not exhibit any visible phenotype and therefore various approaches were
devised to overcome this difficulty. Early on in the mapping process, scoring only the
very highest HPH-DS T mRN A levels as dst] homozygotes was tried but this proved to be

very tedious because a number of homzygotes were lost due to low transgene dosage.

123

I II III IV V

 

 

 

 

lw 5
nga 63 (54%) — l— ciw z c —. —
nga 162 —— CTR]
ciw12_— ciw3(56%) "'— ciw ll -— ciw6 __ ciw8 ——
Cb ciw7 ——
d) nga1126 (52%) “'-
ciw4 J—
ciw 1 (12%) q— a
280 (9°/) nga 6 - —
nga o _— PHYC ——
nga I68 —— “331107 -—
ciw 9"—
nga 111 (14%) ——
ciw 10 --

 

Figure 4.3. DST] maps to chromosome I.
Bulked segregant analysis was used to assign a rough map position to DST 1 on

chromosome 1. SSLP marker positions and the recombination frequencies in the mapping
experiment are indicated.

124

nga 63 ‘-

ciw 12 '1'-

ciw 1 (12%)

 

nga 128 (10%)
t20n2 (9.2%)
nga 280 (9%)
fl4j16 (9.4%)
__ fl4j9 (8.2%)
-_ f25p12 (9%)

 

5.2 Mb

-_ t2k10(7%)
-_ tl3d8 (5.1%)
.. f8a5 (6.2%)

f11p17 (6.3%)
nfllp17 (6.3%) ' f‘ 6P” (49%)

_ tl3mll (7.1%)
.. t8k4 (7%) l- f2kll (3.9%)

_ nf19k23 (8.3%) __ 124d7 (3.9%)
- fl6p17 (4.9%)

ngalll'l

 

I

“P 1220122 (3.9%)

- 12ch21 (2.9%) :]
-” flnl91 (2.9%) 107 kb

720 kb

 

 

:- r1n192 (3.9%)

 

- flnl92 (3.9%)

Figure 4.4. Map-based cloning of DST 1 .

SSLP and CAPS marker positions with the respective recombination frequencies are
indicated.

125

Microarray technology was used as a novel tool towards the cloning of dst] since
it identified a robust endogenous molecular marker. The experiments described in this
chapter suggested that the RAP2.4 transcript has several features which make it an ideal
phenotypic marker for dst]. The 3’ UTR of RAP2.4 contains DST-like sequences and
subsequent half-life analysis indicated that it is a direct target of DST-mediated mRN A
decay. Also, RAP2.4 mRNA levels exhibited greater increases in abundance than HPH-
DST mRNA levels in dst] plants (5-fold compared to 3-4 fold). An added advantage was
that RAP2.4 could be used to screen mapping populations and follow the dst] phenotype
even in plants lacking the transgene. A larger number of homozygous mutants could thus
be scored in a more accurate manner because the presence of the transgene was not
necessary. Finally, an appealing feature of RAP2.4 was that even though it is a primary
target of the DST-mediated decay pathway, it is not regulated in a circadian fashion.
Harvesting hundreds of samples for RNA preparation from a mapping population is a
lengthy and time-consuming process and using RAP2.4 as a marker alleviated concerns
about circadian variations occurring during that interval.

The 107 kb interval containing DST] spans 27 genes, including one t-RNA gene.
Three genes in this region encode transcription factors, one of which belongs to the
RAP2 (related to Apetala 2) family and RAP2.4 mRN A levels are known to be elevated
in dst1. Three genes encode proteins which could be functioning in protein degradation.
There are several evolutionary links that seem to exist between RNA metabolism, protein
degradation and ubiquitin signaling pathways suggesting that these processes interact
with one another (Anantharaman et al., 2002). Numerous ubiquitin, ubiquitin E3 ligases

and other proteins involved with the proteasome show fusions with various domains of

126

proteins functioning in RNA metabolism (Aravind and Ponting, 1998; Fang et al., 2000)
implicating a role for RNA binding proteins in bringing the proteolytic machinery to the
RNA-bound complexes.

Once a small interval containing DST] is defined, candidate genes in that region
and/or the entire interval will be sequenced to identify the mutation. Construction of a
cosmid library is in progress to aid in sequencing. Standard complementation tests to
confirm the identity of DST 1 might not be straightforward due to the semi-dominant
nature of the mutation. As such, the mutant gene might have to be introduced into wild
type plants to phenocopy the mutation, which would also be greatly facilitated by the

cosmid library being generated.

MATERIALS AND METHODS

Plant Material

dst] mutant plants described in this report are from the accession Columbia (gll)
derived from EMS mutagenized Arabidopsis populations (Johnson et al., 2000). 1519 and
dst1 plants, from the second backcross to the parental line, were grown in grth
chambers under 16 hr light and 60% relative humidity at 20°C. Rosette leaves were
harvested from 35- to 40-day-old plants. All tissue was harvested from plants grown in

parallel under the same conditions in different growth chambers.

Half-life measurements, total RNA Extraction and RNA Blot Hybridization

Half-lives were determined as described by Seeley et al. (1992). Rosette leaves

from Arabidopsis plants were transferred to a flask with incubation buffer. After a 30 min

127

incubation, 3'-deoxyadenosine (cordycepin) was added to a final concentration of 0.6 mM
(time 0). Tissue samples were harvested at regular intervals thereafter and frozen in liquid
nitrogen. Total RNA from leaf samples was extracted as previously described (Newman
et al., 1993). 10 ug of total RNA or was analyzed by electrophoresis on 2%
formaldehyde/1.2% agarose gels and blotted onto nylon membrane (Nytran Plus,
Schleicher & Schuell, Keene, NH). DNA probes were labeled with [or-32P]dCTP by the
random primer method (F einberg and Vogelstein, 1983) and purified from
unincorporated nucleotides using probe purification columns (N ucTrap, Stratagene, La
Jolla, CA). The RNA blots were hybridized as described in Taylor and Green (1991)
using the indicated 32P-labeled probes. For a loading control, RNA blots were hybridized
with a 32P-labeled cDNA probe for the Arabidopsis translation initiation factor eIF 4A

(Taylor et al., 1993).

Genomic DNA extraction and markers for mapping

Genomic DNA was prepared from 1519 and dst1 plants as previously described
(Saghai-Maroofet al., 1984). Initial mapping of the dst] locus was carried out using
SSLP markers (Bell and Ecker, 1994; http://genome.bio.upenn.edu/SSLP_info/SSLP.html).
Primers were designed from available sequences and used to amplify genomic DNA by
PCR. The primers used for genotyping the various markers are listed in Table 4.2. The
CAPS PCR products were digested with the appropriate restriction enzymes according to
the manufacturer’s instructions. All PCR products were analyzed on high resolution

agarose gels (4%) or 15% polyacrylamide gels.

128

Table 4.2. Oligonucleotides and restriction enzymes used to detect various SSLP and

 

 

CAPS markers
Marker Left oligonucleotide Right oligonucleotide Enzyme
464030 ggcccattcacaacagagat ctcgcgaaagatcgagattc Alul
464305 tcaggttccttctccgtcat ccaagaacaaatggctgtcc Tan
464424 atcgacggaaaacaaaaagc caaagcgcgtgaataacaac Tsp509I
464476 tgggttatgtcgcgagagtt gtcaattccttggctgcatt AluI
464477 gcatccgttgaggattttgt ccatgaacattgtgtatgtgagaa Alul
464507 gcctaaacacagtgagggaga tgcaaatgcaaacaacaaaga Sau3AI
479633 actttaaagggcccaaatgc cagctgtgttggtcatggag HindIII
479657 tgccactattgactaggttttctg cagcttctgcaaaacgaaga Tsp509I
479671 acaacaggagcaggaaccac gccctgatgcttacgacaat Hian
479760 ccactctcaacaattcccaag acagatcgtgcttgatgtcc Sau3AI
479762 atatccgggacatcaagcac tggatccatctgtcttttaacg Tsp509I
479788 gccaatgtctagccaccaaa tctaccaccgtttagccactg BalI
479790 ggctaatcagccacaaattca gtcttcgaatcgggttgaaa Tsp509I
4798 14 ttgccagtttggagatgaga caacaaaaatcacataacgatttca SpeI
4798 15 cctgcatgggaagaaaaaga ggtcggtttgaccttcttca HindIII
479833 tctgcttcggtttcgttctt gctgttgaatcagagcacca Hinfl
47987 1 gctaagcacgcataggtgaa ttcacgaggaaaattcaaacg pr l 881
23 853 l 99 tggtccaaggatacaaatcaca aacgacattgtttcacctgct Bstz 1 71
23950913 agtctgcgacgagtgaaggt tcttccacctcttcacactca pr1881
2395278 1 ac gcccatctaattcccatt ttttggcctcaacaaggttc Tsp509I
23953329 gcttgaggaatccaaacaatg ggttcgtcccagtcagagtc BerI
23954354 ggtaaaaagaaaatgccattcg cctcacggttatggatctgg NheI
23954862 ccgtgagggatatagccaaa tccaaggccattaagaccac NspI
23955033 ggtagcgacagcgactgaat gccattcagccgtaaactgt NdeI
SNP17905 tttatttcggcccaagtctg gacctcgcaacaattggact Sau3AI
SNP17907 tgaagtggtgacggtaaaatga catggaatcattttgtttagttcg SphI
CER464688 atgaactgtggtacgcgaat aaaatttctttcctttccgtttt -
CER464689 cgccgttttcgttgataaat ccgctctcctccattgatag -
CER464692 tggttatggtttgacattattgc attggcccatttgaagagtg -
CER464693 gatggtcggctctcactctc ttgagttggacggtggagat —
F 1301 l_1 1m aaaagaaaaggcttgggattg tgggacacagaacttgttgc -
F 16G l 6_1 Om aaaatc gacacatcactaagtc g tgatttcgcaaaaacgaatg -
F16M 1 9_1 6b cggtagatgatttccgatgtt atgcgtttttcgtgaattgg -
F 16M 1 9_8m cgctttttcacgaatttaaacc aactcgccattgacacaaca -
F 16P1 7_8b acacgagagagcaatgatcc ttcgcactgcaaattgctta -
F1N19__10e aacgaaacaggggactgaga ttcttggctttcctcttcca -
F 1N1 9_9b cgtctagtttcgcggtgttt gcgtcatcaccatcatcatc -
F22C12_11e tgaaaacatgcaaagggaaa ttcatattttcaatctcttgacttttt -
F 22C 1 2_l 2e ttgtatcttgtgtcaccgtcaa tgatttgagtttaaaccatgttc g -
F22C12_l 2ve tcctcttcgtcttcttcgtca aaagaccggccaaagaaaat -
F22C12_14b gatttcgccggtgatgttac gtcggcccaattgattttt -

129

F 22C 12_1 5b
F 22C 12_l 8b
F23N19_6m
F23N19_7e
F24D7_17m
F24D7_18m
F24D7_9e

F 240 1_l 7m
F2Kl l_l 1m
FSIl4_1 1b
T12P18_6b
T12P18_8m
T13D8_15m
T13D8_9b
T1F9__4e
T3P l 8_6b

ccagtccacaaggagtcca
cctgctcaaatgcgttacaa
agatggctgtgccttctagg
tgaagatctgaaatgaccctaaaa
ttcagcatgcttattttattagcc
aaccagttttcaaatcaactgaag
tccctctcctcctttctcatt
tgtattgtcacaaaaatgcaaca
cggttgtgactcccctaaaa
tgcaacgaccaagaaattga
tgcgcagttatctccttttt
agataaatgcatcaacaaattgac
gaaaacggaatctgcaaaaca
agaaaaggcccatggaatct
gtaggaggagccatggattg
ggtggaaaaggtggtggtaa

tgcccacacaaacaatttca
tccacgagtcagaaggatga
cagcattccccaactctttc
tttctcaagcttttgaatgttttct
cgagcgccttactctgtgat
tggtggtgttgaggtaccaa
gcaggcgatcagacattttt
ctcggacccgttacaagaaa
ttggctaagcatcttttccatt
gaagaagtgcattgcttgaca
aaagagtataatgtcatgactcacgta
acccacctcacactctctcc
aattggcttttaaaacaatgtca
agcagaaacagttggaaacga
aacaaaagcaaatctatagttgttcac

accactacgggaggaggtct

130

REFERENCES

Aarts, M. G., Corzaan, P., Stiekema, W. J ., and Pereira, A. (1995). A two-element
Enhancer-Inhibitor transposon system in Arabidopsis thaliana. Mol Gen Genet 247, 555-
564.

Alonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J ., Chen, H., Shinn, P., Stevenson,
D. K., Zimmerman, J ., Barajas, P., Cheuk, R., et al. (2003). Genome-wide insertional
mutagenesis of Arabidopsis thaliana. Science 301, 653-657.

Anantharaman, V., Koonin, E.V., and Aravind, L. (2002). Comparitive genomics and
evolution of proteins involved in RNA metabolism. Nucl Acids Res 30, 1427-1464.

Aravind, L., and Ponting, GP. (1998). Homologues of 26S proteasome subunits are
regulators of transcription and translation. Protein Sci 7, 1250-1254.

Bell, C. J ., and Ecker, J. R. (1994). Assignment of 30 microsatellite loci to the linkage
map of Arabidopsis. Genomics 19, 137-144.

Fang, S., Jensen, J .P., Ludwig, R.L., Vousedn, K.H., and Weismann, A.M. (2000). Mdm2
is a RING finger-dependent ubiquitin protein ligase for itself and p53. J Biol Chem 275,
8945-8951.

Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction
endonuclease fragments to high specific activity. Anal Biochem 132, 6-13.

Jander, G., Norris, S. R., Rounsley, S. D., Bush, D. F ., Levin, I. M., and Last, R. L.
(2002). Arabidopsis map-based cloning in the post-genome era. Plant Physiol 129, 440-
450.

Johnson, M. A., Perez-Amador, M. A., Lidder, P., and Green, P. J. (2000). Mutants of
Arabidopsis defective in a sequence-specific mRN A degradation pathway. Proc Natl
Acad Sci U S A 97, 13991-13996.

Konieczny, A., and Ausubel, F. M. (1993). A procedure for mapping Arabidopsis
mutations using co-dominant ecotype-specific PCR-based markers. Plant J 4, 403-410.

Krysan, P. J ., Young, J. C., and Sussman, M. R. (1999). T-DNA as an insertional
mutagen in Arabidopsis. Plant Cell 11, 2283-2290.

Lukowitz, W., Gillmor, C. S., and Scheible, W. R. (2000). Positional cloning in
Arabidopsis. Why it feels good to have a genome initiative working for you. Plant
Physiol 123, 795-805.

Neff, M. M., Neff, J. D., Chory, J ., and Pepper, A. E. (1998). dCAPS, a simple technique

131

 

 

for the genetic analysis of single nucleotide polymorphisms: experimental applications in
Arabidopsis thaliana genetics. Plant J 14, 387-392.

Newman, T. C., Ohme-Takagi, M., Taylor, C. B., and Green, P. J. (1993). DST
sequences, highly conserved among plant SAUR genes, target reporter transcripts for
rapid decay in tobacco. Plant Cell 5, 701-714.

Perez-Amador, M. A., Lidder, P., Johnson, M. A., Landgraf, J ., Wisman, E., and Green,
P. J. (2001). New molecular phenotypes in the dst mutants of Arabidopsis revealed by
DNA microarray analysis. Plant Cell 13, 2703-2717.

Saghai-Maroof, M. A., Soliman, K. M., Jorgensen, R. A., and Allard, R. W. (1984).
Ribosomal DNA spacer-length polymorphisms in barley: mendelian inheritance,
chromosomal location, and population dynamics. Proc Natl Acad Sci U S A 81, 8014—
8018.

Seeley, K. A., Byme, D. H., and Colbert, J. T. (1992). Red Light-Independent Instability
of Cat Phytochrome mRNA in Vivo. Plant Cell 4, 29-38.

Taylor, C. B., and Green, P. J. (1991). Genes with homology to fungal and S-gene
RNases are expressed in Arabidopsis thaliana. Plant Physiol 96, 980-984.

Taylor, C. B., Bariola, P. A., DelCardayré, S. B., Raines, R. T., and Green, P. J. (1993).
RN S2: A senescence-associated RNase of Arabidopsis that diverged from the S-RNases
before speciation. Proc Natl Acad Sci USA 90, 5118-5122.

Weigel, D., Ahn, J. H., Blazquez, M. A., Borevitz, J. 0., Christensen, S. K., Fankhauser,

C., Ferrandiz, C., Kardailsky, I., Malancharuvil, E. J ., Neff, M. M., et a1. (2000).
Activation tagging in Arabidopsis. Plant Physiol 122, 1003-1013.

132

 

 

CHAPTER 5

CHARACTERIZATION OF dst3, A NEW GENE IN THE DST- MEDIATED mRNA

DEGRADATION PATHWAY

133

INTRODUCTION

Rates of mRNA degradation are highly variable in eukaryotic cells and these
differences allow for precise control of gene expression (Gutierrez et al., 1999). Cis-
regulatory elements have been identified that act as either instability or stability
determinants in mammalian systems (Chen and Shyu, 1995; Holcik and Liebhaber,

1997). Several sequences that target transcripts for rapid turnover in plants have also
been identified. These include the DST element (Newman et al., 1993), the AUUUA
repeat (Ohme-Takagi et al., 1993), and premature stop-codons (van Hoof and Green,
1996). It is critical to understand the mechanisms by which the cell recognizes these
sequence elements and targets the transcripts that contain them for rapid mRNA
degradation.

Most studies aimed at understanding the cellular factors in mRNA decay
pathways have involved characterization of proteins that bind the instability sequences in
vitro. Isolation of sequence-specific RNA-binding proteins from plant cells has not been
as successful probably due to the difficulty associated with preparing cytoplasmic protein
extracts that are free of non-specific ribonucleases.

In order to gain insights into the molecular basis of sequence-specific recognition
and degradation of unstable mRNAs, a genetic approach was devised to isolate
Arabidopsis mutants defective in DST-mediated mRNA degradation (Johnson et al.,
2000). Such a strategy has several distinct advantages. First, a gene that is identified by a
mutant phenotype is, by definition, affecting the process in vivo. Second, basic
information about the mechanisms of mRN A degradation may be obtained by studying

mutants. Third, genetic analysis is not limited by pre-conceived mechanistic ideas. For

134

example, the cellular factor that recognizes an RNA degradation sequence may itself be
an RNA molecule, not a protein. Finally, experimental complications that have limited
the success of biochemical approaches, such as unstable or low abundance proteins or the
presence of non-specific RNA degrading activities in protein extracts, are eliminated.

The mutagenesis strategy involved the generation of transgenic plants expressing
HPH (hygromycin phosphotransferase) and GUS (B-glucuronidase) reporter genes (line
1519-31). The transcripts from both genes were destabilized by insertion of a tetramer of
the DST instability determinant into their 3’ UTRS (Johnson et al., 2000). Mutants in the
mRNA decay pathway mediated by the DST element are expected to have increased
HPH and GUS mRNA abundance and therefore, it should be possible to isolate them on
the basis of these increased expression levels. dst1 and dst2 were isolated based on their
ability to stabilize specific DST-containing transgene mRNAs, indicating that they harbor
mutations that diminish the function of the DST-mediated decay pathway. Genetic
analysis has demonstrated that dst] and dst2 are semi-dominant mutations in independent
single genes (Johnson et al., 2000). In this chapter, the isolation and characterization of a

third gene, dst3, in the DST-mediated mRN A decay pathway is described.

RESULTS
dst3 exhibits increased HPH-DST and GUS-DST mRNA levels

A third putative mutant was isolated during the selection of 794,000 mutagenized
M2 seeds (Johnson et al., 2000). The abundance of the HPH-DST mRNA for dst3 is
shown in Figure 5.1. The level of this transcript is approximately 3.5 fold higher relative

to p1519-31 and this increase in mRNA abundance is similar to that observed in dst] and

135

 

 

l 5 1 9
dst3
l 493
dst]
dst2

HPH-DST ' - Q ~ ~

eIF4A inn-w»... .w

. E“ E” P
UINUuw'J-Au:
All...

HPH/eIF4A/av par

_
l

 

 

0.5“ l l

151 9-3 1 dst3 dst] dst2
Plant Line

 

 

Figure 5.1 HPH-DST mRNA levels are elevated in dst3.

A) HPH-DST mRNA abundance was measured in the rosette leaves of dst3, p1519-31,
the non-destabilized control 1493 and in previously isolated mutants dst1 and dst2. Each
lane contained 10 pg of total RNA. The abundance of HPH-DS T mRNA was normalized

to that of the loading control, eIF 4A.
B) Quantitation of the increase in HPH-DS T mRNA levels in the dst mutants.

136

dst2 (Figure 5.1B; Johnson et al., 2001). Increased HPH-DST mRNA abundance has
been observed consistently in the progeny of two backcrosses of dst3 to 1519-31. An
analogous increase in GUS-DST mRNA levels was also observed, although the elevation
of this transcript is higher in dst3 than in dst] and dst2 (Figure 5.2). Two transcripts have
always been detected for GUS in the parental line and the dst mutants. The higher
molecular weight transcript is probably due to the recognition of a cryptic downstream
polyadenylation signal. Both transcripts are regulated in a similar manner in the dst
mutants, although for quantitation purposes, the abundance of the lower molecular weight
transcript (the expected size) was measured. Since both the HPH-DST and GUS-DST
transcripts were elevated in the mutant, it was highly unlikely that the phenotype was due
to a mutation in one or more of the DST elements present in the 3'UTR of the reporter
transcripts. To examine this possibility, genomic DNA was isolated from the mutant
plants and the DST tetramer was amplified and sequenced. The DST tetramer was found

to be unaltered for both the genes.

Genetic analysis of dst3

For the genetic analysis of dst3, the inheritance of HPH-DST mRNA abundance
was examined. Progeny of the first backcross to WT (1519-31) (F1) and the progeny of
self-fertilizations of these plants (F2) were used in these studies. Ten Fl plants were
examined. HPH-DST mRNA abundance was on average 1.9 i 0.53 fold higher in dst3 F1
compared to WT (1519-31). These levels of HPH-DST mRNA abundance are
intermediate between WT (1519-31) and mutant levels as would be expected if

heterozygotes showed a semi-dominant phenotype. Segregation of increased HPH-DST

137

 

 

3 a a '12

fl *8 48 -§

1.33:

GUS-DST ti r-u I

e! F 4A

Figure 5.2 GUS-DST mRNA levels are elevated in dst3.

GUS-DS T mRN A abundance was measured in the rosette leaves of dst3, p1519-31, and
in previously isolated mutants dst] and dst2. Each lane contained 10 pg of total RNA.
The abundance of GUS-DST mRNA was normalized to that of the loading control,

eIF 4A.

138

mRNA abundance in the F2 populations was also consistent with semi-dominance. Of 80
F2 plants segregating dst3, 20 were observed with high HPH-DST mRNA abundance (3.2
i 0.59 fold higher than WT[1519-31]), 38 had intermediate HPH-DS T mRNA abundance
(1.7 :t 0.22) and 22 showed HPH-DST mRNA abundance that was similar to WT (1519-
31) (0.97 i 0.24) (Figure 5.3). This pattern of segregation in the dst3 F2 populations is
most easily explained by a ratio of 1:2:1 as would be expected for the inheritance of a

semi-dominant single gene (Table 5.1).

dst3 is not allelic to dst1 or dst2

To determine whether dst3 was allelic with dst1 or dst2, a complementation test
was performed. The data from these experiments are summarized in Table 5.2. Like dst]
and dst2, dst3 is partially dominant, a characteristic of these mutations that complicates
standard complementation tests. The F 1 progeny of a cross between dst3 and dst1 or dst2
showed intermediate HPH-DST mRNA abundance levels implying the lack of an additive
interaction (Table 5.2). The results of DST3-/- crosses to DST 1-/- or DST2-/- were
similar to those of the cross to p1519-31 (DST +/+), indicating that dst], d512, and dst3
are likely to affect three distinct genes. If dst] or dst2 had been allelic with dst3, these
crosses would have resulted in F1 plants with high levels of HPH—DST mRNA
abundance. In addition some F2 plants with HPH-DST mRNA levels similar to 1519-31
were recovered (Table 5.2) which would not be possible if the dst mutations were in the

same gene or tightly linked.

Increased stability of HPH-DST mRNA in dst3 compared with 1519-31

139

1519-31
1519-31

no N m N at so m c

r co r~ — 3 an m In

at at: at 44: :4: =3: =34:
HPH-0S T ” ” «a -

eIF 4A

Figure 5.3. mRNA abundance of HPH-DST in F2 plants from the first back-cross of dst3
relative to WT (1519-31).

8 representative plants are shown. Total RNA was prepared from rosette leaves and 10pg
was analyzed by Northern blot hybridization. Radiolabeled probes, prepared against the
indicated transcripts, were used in sequential hybridizations of the same blot. The
numbers indicate individual plants. #56 is an example of an F2 plant with high HPH-DST
mRNA levels, #82 with intermediate and #12 with HPH-DST mRNA levels similar to
WT (1519-31).

140

 

Table 5.1. Segregation of increased HPH mRNA abundance in the progeny of crosses

between dst3 and 1519-31 (DST3).

 

 

Cross Class HPH-DST‘ n )8, P’
DST3/DST3 X dSl3/dst3 F1 Int 1.9 i 0.53 10
DST3/dst3 X DST3/dst3 F2 WT 0.97 i 0.24 22
Int 1.70 :t 0.22 38 0. 3 P>0.8
High 3.20 i 0.59 20

 

Int. intermediate.

WT, wild-type.

* HPH-DST mRNA abundance: (HPH-DST/eif4A) segregating class/ (HPH-DST/eif4A) WT :
standard error.

f 12 calculated for 12221 segregation of WT/lnt/High HPH-DST mRNA abundance

osr/osr, wr (1519-31).

 

141

 

Table 5.2. Segregation of increased HPH mRNA abundance in the progeny of

crosses between dst3 and dst1 and dst2.

 

 

Cross Class HPH-DST' n
dst3/dst3 x dst1/dst1
F1 lnt 1.6 _+_ 0.1 15
F2 WT 0.9 i 0.2 16
Int 1.6 :1: 0.3 30
High 3.7 i 0.9 21
dst3/dst3 x dstZ/dst2
F1 Int 2.5 i: 0.2 16
F2 WT 0.9 i 0.2 9
Int 1.8 i 0.4 31
High 3.1 i 0.6 21

 

lnt, intermediate.
WT, wild type.
* HPH-DST mRNA abundance: (HPH-DST/eif4A) segregating class/ (HPH-

DST/eif4A) WT 3: standard error.

 

142

The elevation in HPH-DST transcript levels in dst3 is probably due to the DST-
mediated decay pathway being deficient in the mutant. To test this hypothesis, mRN A
decay rates for HPH-DS T mRNA were measured in dst3 and WT plants. A change in
mRNA stability would indicate that the mRNA is a primary target of the decay pathway.
Half-life analysis was carried out in rosette leaves using cordycepin as the transcriptional
inhibitor. The HPH mRNA abundance was standardized relative to the abundance of
eif4A transcript. As is evident in Figure 5.4A and B, the decay of HPH-DST mRNA was
slower in dst3 compared to the parental and the differences in steady state mRNA levels
became even more prominent at later time points. The half-life of HPH mRN A was
calculated to be 1.5-fold greater in dst3 than in 1519-31 suggesting that the dst3 mutation
results in an increase in mRNA stability that is responsible for the increased abundance of
the HPH-DST transcript. It has been noted before that differences in half-life
measurements between the parental and the dst plants are reflective of about 17% of the
differences based on steady state mRNA levels (Johnson et al., 2000), and a coordinate
dampening in the mRNA half-life value for dst3 relative to the parental line was

observed.

DISCUSSION

dst3 was identified using a targeted genetics strategy and exhibited elevated levels
of DST-containing mRN As. mRN A decay kinetics showed that the increased HPH-DS T
mRNA abundance is caused by a corresponding increase in message stability. The three
mutants isolated by this strategy were extremely rare suggesting that the genes involved

in the DST-mediated decay pathway are essential. Further, all three dst mutants are weak

143

0 15 30 60 90 120 0 15 30 60 90120

    
 

 

 

HPH-DST l! o
-
t! ,, g :2 .
eIF4A “" "' “' w
1519 dst3
B.
1 4.x
co
=
2?.
a
E
2
E
o

E

o 1519 (23 min) °

9 dst3 (35 min)
0.01 l t l l
o 30 60 90 120

time (min)

Figure 5.4 Analysis of HPH-DST mRNA stability in leaves from 1519 and dst3 plants.

A) Representative northern blot analysis of cordycepin time courses over a period of 120
minutes. Samples consisted of 10 pg of total RNA isolated from the indicated time
points.

B) Quantitation of the decrease in mRNA abundance and half-life estimation for HPH-
DST. The stable eIF 4A transcript was used as a reference for equal loading.

144

alleles allowing partial functioning of the DST-mediated decay pathway since they did
not restore HPH-DST mRNA levels to those found in plants with non-destabilized
mRNAs (Figure 5.1). These findings may indicate that stronger alleles were lethal or that
there is redundancy in the DST pathway. If so, the genes may be members of the same
gene family.

dst] and dst2 are partially dominant mutations (Johnson et al., 2000), and
interestingly, so is dst3, the new mutation described in this study. A semi-dominant
mutant phenotype could result if the defective DST—recognition factors no longer !
recognized the DST sequence, but still bound the interacting proteins required for mRNA ‘
decay. On the other hand, a semi-dominant phenotype could arise if a defective DST-
binding protein retained the ability to bind a DST subdomain but had reduced ability to
interact with or recruit proteins required for mRNA degradation. Another alternative
would be that a dst gene product encodes a DST-specific ribonuclease that binds the DST
sequence but has decreased RNase activity, thereby providing partial protection to
mRNAs bound by a mutant version.

Studies conducted with the previously identified dst mutants, dst1 and dst2, have

 

indicated that both genes have distinct and overlapping roles in the DST-mediated mRNA

decay pathway (see Chapter 2). It will be of interest to examine how dst3 cross talks with

 

dst] and dst2. In addition, the continuing analysis of all possible mutant combinations

should conclusively define the roles of each gene as they work alone or in combination.
Prior to this work, only two mutants involved in DST-mediated mRNA

degradation were known. Considering the rarity of the mutants isolated, the identification

of an additional mutant, dst3, is important. In theory it should be possible to generate

145

more mutants in this pathway since the screen was not saturating, in spite of being very
tedious. Finally, the cloning of dst3 should lead to a better understanding of the DST-

mediated decay pathway in plants.

MATERIALS AND METHODS

Plant Material

dst3 mutant plants described in this report are from the accession Columbia (glI)
derived from EMS mutagenized Arabidopsis populations (Johnson et al., 2000). 1519,
dst], dst2 and dst3 plants were grown in growth chambers under 16 hr light and 60%
relative humidity at 20°C. Rosette leaves were harvested from 35- to 40-day-old plants.
All tissue was harvested from plants grown in parallel under the same conditions in

different growth chambers.

Half-life measurements, total RNA Extraction and RNA Blot Hybridization

Half-lives were determined as described by Seeley et al. (1992). Rosette leaves
from Arabidopsis plants were transferred to a flask with incubation buffer. After a 30 min
incubation, 3'-deoxyadenosine (cordycepin) was added to a final concentration of 0.6 mM
(time 0). Tissue samples were harvested at regular intervals thereafier and frozen in liquid
nitrogen. Total RNA from leaf samples was extracted as previously described (Newman
et al., 1993). 10 pg of total RNA or was analyzed by electrophoresis on 2%
formaldehyde/1.2% agarose gels and blotted onto nylon membrane (Nytran Plus,
Schleicher & Schuell, Keene, NH). DNA probes were labeled with [a-32P]dCTP by the

random primer method (F einberg and Vogelstein, 1983) and purified from

146

unincorporated nucleotides using probe purification columns (NucTrap, Stratagene, La
Jolla, CA). The RNA blots were hybridized as described in Taylor and Green (1991)
using the indicated 32P-labeled probes. For a loading control, RNA blots were hybridized
with a 32P-labeled cDNA probe for the Arabidopsis translation initiation factor eIF 4A

(Taylor et al., 1993).

Analysis of the HPH-DSTx4 sequence element in dst3

Genomic DNA was prepared from dst3 F2 plants from the first backcross to
p1519-31 as described in Saghai-Maroof et al.(1984). PCR primers complementary to
the 3’ end of the HPH coding region and the 5’ end of the E9 3’UTR were used to
amplify the DST elements with a proof-reading polymerase (Pfu, Stratagene) under
standard PCR cycling conditions. Products were ligated into a derivative of pBluescript

SKII(-) and multiple individual clones were sequenced for each reaction.

147

REFERENCES

Chen, C. Y., and Shyu, A. B. (1995). AU-rich elements: characterization and importance
in mRNA degradation. Trends Biochem Sci 20, 465-470.

Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction
endonuclease fragments to high specific activity. Anal Biochem 132, 6-13.

Gutierrez, R. A., MacIntosh, G. C., and Green, P. J. (1999). Current perspectives on
mRNA stability in plants: multiple levels and mechanisms of control. Trends Plant Sci 4,
429-438.

Holcik, M., and Liebhaber, S. A. (1997). Four highly stable eukaryotic mRNAs assemble
3' untranslated region RNA-protein complexes sharing cis and trans components. Proc
Natl Acad Sci U S A 94, 2410-2414.

Johnson, M. A., Perez-Amador, M. A., Lidder, P., and Green, P. J. (2000). Mutants of
Arabidopsis defective in a sequence-specific mRNA degradation pathway. Proc Natl
Acad Sci U S A 97, 13991-13996.

Newman, T. C., Ohme-Takagi, M., Taylor, C. B., and Green, P. J. (1993). DST
sequences, highly conserved among plant SAUR genes, target reporter transcripts for
rapid decay in tobacco. Plant Cell 5, 701-714.

Ohme-Takagi, M., Taylor, C. B., Newman, T. C., and Green, P. J. (1993). The effect of
sequences with high AU content on mRNA stability in tobacco. Proc Natl Acad Sci U S
A 90,11811-11815.

Saghai-Maroof, M. A., Soliman, K. M., Jorgensen, R. A., and Allard, R. W. (1984).
Ribosomal DNA spacer-length polymorphisms in barley: mendelian inheritance,
chromosomal location, and population dynamics. Proc Natl Acad Sci U S A 81, 8014-
8018.

Seeley, K. A., Byrne, D. H., and Colbert, J. T. (1992). Red Light-Independent Instability
of Oat Phytochrome mRNA in Vivo. Plant Cell 4, 29-38.

Taylor, C. B., and Green, P. J. (1991). Genes with homology to fungal and S-gene
RNases are expressed in Arabidopsis thaliana. Plant Physiol 96, 980-984.

Taylor, C. B., Bariola, P. A., DelCardayré, S. B., Raines, R. T., and Green, P. J. (1993).
RN82: A senescence-associated RNase of Arabidopsis that diverged from the S-RNases
before speciation. Proc Natl Acad Sci USA 90, 5118-5122.

van Hoof, A. and Green, P.J. (1996). Premature nonsense codons decrease the stability of
phtohemeagglutinin mRNA in a position-dependent manner. Plant J 10, 415-424.

148

CHAPTER 6

MICROARRAY ANALYSIS OF dst2

149

INTRODUCTION

The expression level of thousands of genes can be monitored simultaneously
using DNA microarrays. Therefore, studies using DNA microarray technology can be
used to address mechanistic questions on a global basis and identify targets of various
metabolic pathways. DNA microarray technology has been exploited to characterize the
molecular phenotypes of mutants (Pérez-Amador et al., 2001; Goda et al, 2002; Scheible
et al, 2003) and to investigate the intra- and interspecies variations in genome expression
patterns (Enard et al., 2002). Genomic approaches have also been particularly useful to
discriminate the functions of individual members of a gene family which may have
partial redundant functions and would be difficult to dissect using classical genetic
techniques (Wang et al., 2002).

As pointed out in Chapter 2, microarray analysis of the dst1 mutant was critical in
providing the first clue about the physiological significance of the DST-mediated decay
pathway in Arabidopsis. In addition, some of the genes identified as being differentially
regulated in dst] were subsequently examined by RNA gel blot analysis and found to be
either coordinately or oppositely regulated in dst2. In this chapter, preliminary microarray
studies were carried out with dst2 to expand our understanding of this mutant and

discover new molecular markers specific for dst2.

RESULTS
15k element microarray reveals genes with altered gene expression in dst2
15 k slides, prepared by the AF GC microarray facility at MSU, were utilized to

examine global gene expression changes in the dst2 mutant. Poly(A)+-selected RNA from

150

the rosette leaves of five-week old dst2 and parental plants was labeled with the
fluorescent dyes and used for hybridization. Two biological replicate experiments were
performed, each with a reverse labeling technical replicate. After normalization of the
data, 33 ESTs and multiple clones for HPH and GUS showed a difference of 1.5-fold or
greater in all four slides. Of the 33 ESTS, 29 clones corresponded to 22 annotated
Arabidopsis genes while 4 ESTS did not correspond to any annotated open reading
frames. Multiple ESTs corresponding to the same gene that behaved in a similar fashion
further corroborated the microarray data.

Twenty four genes, including the transgenes HPH and GUS, showed elevated
mRN A levels while four displayed decreased levels of mRNA in the dst2 mutant
compared with the parental plants, as listed in Tables 6.1 and 6.2, respectively. After
correction for redundancy in the ESTS and excluding the transgenes HPH and GUS, a
total of 26 endogenous genes whose expression levels were altered in dst2 were
identified. The probable biological functions of these genes, listed in Tables 6.1 and 6.2,

were based on the latest annotation by the TIGR Arabidopsis thaliana database.

Identification of the putative primary targets of the dst2 mutation

As a first step towards determining the primary targets of dst2, the 3’UTRs of the
genes that were differentially regulated were analyzed for the presence of DST-like
subdomains. 11 genes were identified that contained possible DST-like sequences in their
3’ UTR (listed in Table 6.3). Direct targets of the decay pathway mediated by DST 2 are
expected to be stabilized in the dst2 mutant. It will therefore be of interest to measure

mRN A decay rates for these transcripts and determine if the changes in expression levels

151

 

2.5.30

 

S a f ENEE N 2232 3:53 £583 muses .28.. uses Be 222
as a S quo _ ONNRw _2 Essa 3336
no a M: £38 _ 2832 £93 saea 8265 82:68
Nd a 3 £28: _ 853.2 N base nannafieaeneo
3 a M: 2.2sz 2 238232 a 30% 2 dose Sentences 92-323an
N5 4 M: £2 0N2 _ omega _2 Angela 2&3 dose 8:285
No a 3 SEE _ Rama _2 6.522% .e decades“ e2 32: .552
3 a 3 832% _ 8222 been 522; awe: can 25-28
no a 3 ENE N _ 83.32 35% m 55.8 messes :55
No a 3 2528 _ 2 _ <2 .20 Bees; 2
S a 3 2583.2 _ 22 b5 Bees.“ oz
£59.
3 a 3 £2 2N2 N 80322 seen ennneaxm
3 « oN <N.:.<E< _ 8332 NEE 522a come: 02:. 33-558 amé 5
no a o.N E38: _ ca 322 seen Banaxm
ed a oN N53: _ $23.2 Roma 533538
No a oN E220 _ 83432 528a enmmnaxm
no a _.N tea _ «N 2 oNNme _2 .633 see 535:»... 2:522
No a _.N Emma _ 238822 see Essa enwé 02:. 85-558 some: eN
EeENe
no a _.N ENE: N 35.32 naenmeifie naaéem
we a N.N ENS: _ 8232 SE 2:385 e 3852
3 a N.N Snot: _ ©3232 ease»... 28.20
NS :2 _
Ntzm:
$59:
no a «N ENNE _ v can 32 2 .233 >_ saddened? 22o a Beam
2 a 3“ <2 e <2 5:
N._ a 2. 22 m 22 So
am 9 e232 9 2m: Ema 88: .e 22.5.2 .352 9:: 25c

 

mam—m Egan 3%? N33 E 20>“: <72:— 39885 NE? 3:00 —.e 035.

 

152

 

 

S a f Erma—NM: _ 22 "20 3585 oz

3 a 3 252022 2 <2 "20 eases; ez

Na 4 3 NSNoeNN _ ©3822 oar 2983 _ éee 8%. 866828
ENNONS

No a 3 N: NmoNN N oNNmmm 2 N_ eased 05083235: e .225

Gm u” owuho>< A: Dm—Z r—imnm 8:30 ac LuDEBZ hon—552 mam—E 0:00

 

mace—m :35me mam—9» NBS E m_o>o_ SAME 3828c 5:5 3:60 «6 «Sun.

153

 

Table 6.3. Genes with possible DST-like sequences in their 3’ UTRs

 

 

 

 

Gene 3’ UTR

NRAMP metal ion attgaagaattagaacatttcaggtagaagaaatagtgtttacttattgtgatctattgcatagaataa
transporter 6, aaatgaagttgtttacttaagtgtaatctattgcatagatcaaacatgaagacttgactacaaaatcc
(N RAMP6) atcaaacggtttggccaaagaactgagtgtacagattcataaccagacgagacatattgaaaca

gaggtttcacataaccagagacaacaaacaaaagcaacttcaatggttaaggatacttaagggg
gatacttgagggaattaataagcttttcaagaccc

 

Expressed protein

gaaaaacaaaaggtggtgcaagtgcaaacgaaggtgaaacaattctgaagatgccttttttgtg
gaagtctcatcttcgtcacatctaacaaagaagttgtagatttatgggatgatgcttactctgctgg

atttaaacacaggtaacaacagatgatgctactaactagttttcctctacctttacacaaactttattg
agaagttagatttg atctcgtaatgacagtttcttacacaaaaataaaataaaatacaaatttgtcat
gactaatatcttatgaaacatcttctcatatattgtgtttgttct

 

Zn finger (C3HC4-
type RING finger)
protein family

tagttgacttttcttttctcatctttttcatttgtttttgtttgggattgttgataaatacgcaaatacattttc
—>

aattttttaattgaattatccttgttttgtttaaaattctctgtaacgtacatatgaagtcagatcgaaaa

cggattcacttttgaaaactaatg ataaaaaagcttataacaaaacaacggacaatgatgtgag

gtgcgctgtggtgcaggtgggtttctcggtttttcaatattaaaaaagtcgtattcgtggacaaaga
atatagctatccgatcccctgataaaatatatgctaatagaatata

 

 

 

Similar to DNA
topoisomerase IV
subunit A

tcacttaattgaactaatgagattcttgattgtggttaaagcacatgttcaattagttgtggttcttgtg
ttttattttcttgtgttgttttgtttgagactttgtttgttgcttatatcaggggagagaggttgaaaaac
ctttgagagafitagmgagagatttgtgaaacacaaataatgttttagtcgtcttataataaa
acctttttttttcttatatatgctcattgataatactgcaaaaaggtaaaatcatgtttttttttttttaatat
gaatcatgatattcagg

 

Zn finger (C3HC4-
type RING finger)
protein family

tgacttgtcacgtgttggtgtctgattggtttaatgttaaccgggagtaaaaaaaggaattactaca

agtcaacaggcttttgtctaggtgttgatttcggcgcccaaggacacgtggcgaaactgagctt
ccaggaatcaatattcaccgtctattatgattagataggttagatagafifgfgfiacgatgtacaaa

gtcatctacaatattgaatctatttccatttattttaccatattctttttttttttataattttcgaagttctac
aaactcttttatgtaaaacacaatccaatggtcataattgtgataaagactttgcataatt

 

 

 

SKPl interacting
partner 5 (SKIPS)

 

tgatttttgctggttttatttatttttcttcttctgtctgt'aacattagfaatctgtgtgatgatgggaaatg
atccatcttcatttgtactttgtgtttccccttaagaccagacaggtcctttgttgtatgcttattatgttc
agaaataatgtcctttttaggacgaattgccgaattcatttcaattggatttttataatttctgcttagtg
tatcttttgtgataaatggtttctttcttcactgttatcaaaatatt

 

Scarecrow-like
transcription factor
13 (SCL13)

tgatgatggctgggttcacgggttggccggtcagcacatctgcagcgtttgcagcgagtgagat
gctgaaagcttatgacaaaaactacaaactgggaggccatgaaggagcgctctacctgttctgg
aagagacgacccatggctacatgttccgtgtggaagccaaacccaaafifiéttgggtaagtta
tagtgatgatggttacttgagtggataaaFaagagcacaacaaaaacacatctgtcgctgtaaat
tttttaggatgtgcaatgatgttttaagtt aacacaacctaagttaWtacaaaccaaacc

tggtggttgtttttctcttg aaattgtcatgtggttgtgggtgggttgctagtaatgaaatataacca
aaacattgattaggtca

 

 

 

Cadmium induced
protein (A88)

 

taatgctacccaccacgaggatcttaagcatctgagacgcatttcgagatagttactttgatggaa
tttgtgaatgtgactgaaatattcagcacaaatcagaacatgg1tc_ctgtcttgtttggagaagcac
tatgaaccaaacctgaagcccttgtgatttagagttacagagatacattaaaagggttcgggattt
cacagtagcattcatagacagttcaggttagttaaacgtgcttcacaaaaagaaaaaaaacaga
agtgtagttgaggtcacaccacaggtttatgctttgctcttaatcaaatatttatctttctcttttttgtta
tttgtcctttttaattccatttgctttattccttacttgtggggattaaatgtttgcagagaaagataattc
gactgaataaatacacttttacctgt

 

 

154

 

 

 

 

 

 

 

Identical to
Cytochrome P450

 

tgatgctmtcattaggacgtttctgctgggufifatggcgtgaccaatggttatttttcattg
caatatccctttttgttttaatgagtactatgttctcattttaacgaataaaaatg atcagtgctcttgtt
tttggactagaaaagaaagtagtccgatgtttaatattcgggtccctttaatattccctctggtttaca
atattttaagctatcttagtaaagatctat

 

O-methyl-
transferase family
2

taagaggaggacatgaaaga'tatatctttcctttgaggaaaactcaataaatta tgattgttgattt
ggtgtttttatacagaacgacgtgt gtgaataattgtgttgtgtgataataag aaggcttgtttc
agtatcagcagagttgttttttatttg atttttcacatttttttatcattaatttccttgtgagtggcacct
ctaatttacttttttaattgttataggctatataagatagataaccttatacaatgtcaaatcttacaatt
acattatgaacatgaa

 

 

RNA and export
factor binding
protein, putative

 

tagaaa gggagattaaacctattgcatgthccttcctttagtgccgatatgcttttgt
attagtatgatctttagattgaatgtcaatgggtctgacattttcgagctttagcttttgttttttcttctct
tggtgagcttcttagctttttgcagttgagttcagagaaacaagcattgtgtaaccgtggaactca
aaactcttctaaaatatcaattcaaaacacaattctatctactctctta

 

 

ATAGAT-like subdomain
—’ GTA-like subdomain

155

 

detected on the microarray slides are indeed due to a corresponding change in mRNA

stability.

RNA gel blot analysis of previously identified transcripts

Prior microarray studies with dst1 followed by Northern blot confirmation
demonstrated that some transcripts were affected in both the dst1 and dst2 mutants (see
Chapter 2). Intriguingly, only one of these genes showed a greater than 1.5-fold
difference on all four slides (chalcone synthase) although some of them could be detected
on two out of the four slides. Also some of the ESTS for the relevant genes on the 15k
arrays were different from the previously used 11k arrays (see Discussion).

In order to validate the quality of the RNA used for labeling, a few of the
formerly characterized transcripts were checked by RNA gel blot analysis. As illustrated
In Figure 6.1, HPH mRNA levels were elevated in both dst1 and dst2, RAP2.4 mRNA
levels were increased in dst1 but unchanged in dst2 and mRNA levels for a putative
patatin gene were diminished in dst1 but elevated in dst2. All the transcripts tested
increased or decreased in abundance as expected (see Chapter 2). Experiments to confirm

additional transcripts are in progress.

DISCUSSION

Microarray analysis identified 26 genes as being differentially regulated in the
dst2 mutant. The genes identified code for proteins involved in variety of metabolic
processes. Four ESTS corresponding to a protein similar to DNA topoisomerase IV

subunit A showed the highest mRNA elevation in dst2. Topoisomerase IV is a type II

156

a :z a
:2 a s
HPH-DST 4 no I! -
eIF4A
B.
5’3 2 9:.
:2 s e
RAP2. 4 -
eIF4A
C' 3 a a
2 s s
111G9T7 -
eIF4A . ..... .....

Figure 6.1. RNA gel blot analysis of previously identified transcripts.

Lanes contained 10 ug of total RNA extracted from WT (1519), dst], and dst2 plants.
Each blot was hybridized sequentially with 32P-labeled eIF 4A, and with A) HPH, B)
RAP2.4, and C) 111G9T7, EST corresponding to putative patatin protein.

157

isomerase involved in the topological changes of DNA during replication (Zechiedrich
and Cozzarelli, 1995). Four transcription factors were identified, three of which seem to
contain DST-like sequences in their 3 ’UTR. If these are the primary targets of DST 2, it
could be hypothesized that changes in the mRNA levels for these transcripts would lead
to downstream secondary effects. Interestingly, one of the transcription factors was a
scarecrow-like protein (SCL13) and it was recently shown that a certain species of micro-
RNAs (miR171) is responsible for the cleavage of several members of scarecrow-like
mRN As in Arabidopsis (Llave et al., 2002). Micro-RNAS interact with perfect
complementarity guiding cleavage of the target mRNA (Hammond et al., 2001) and
SCL13 seems to be a direct target of dst2, suggesting the possibility of miRNAs being
involved in DST-mediated decay.

The small number of genes reported in this chapter is most likely a conservative
estimate of the actual targets of dst2. Although the high stringency used in the data
analysis possibly reduced the number of false positives, some bonafide targets of the dst2
mutant could have been missed. This is especially relevant because two different
printings of the 15k microarray slides were used for this study. Even though most of the
cDNAs present on the two separately printed slides corresponded to the same genes,
different ESTs were used. ESTS corresponding to the same gene can exhibit variable
expression ratios, depending on the probe or target length, genetic redundancy, or a
combination thereof.

It is perhaps pertinent to note that on comparing the technical replicates for each
set of printings, many more differentially regulated mRNAs could be detected, some with

much greater fold changes and multiple ESTS showing similar changes in expression

158

(data not shown). RNA gel blot analysis to confirm some of these targets, in addition to
the ones shown in Tables 6.1 and 6.2 should be useful in ascertaining molecular markers
specific for dst2. Once a robust marker is found for dst2, that is unaffected in dst1 and
dst3, it could be used to facilitate the mapping of dst2. dstZ- specific markers should also
aid in testing double mutants as well as provide unique clues about the possible genetic
interactions (epistasis relationships) among the multiple loci involved in the DST-
mediated degradation pathway. Finally, additional microarray experiments should be
informative about the impact of dst2 at the whole plant level relative to the other dst

mutants.

MATERIALS AND METHODS

Plant Material

All Arabidopsis thaliana plants described in this report are from the accession
Columbia, grown in growth chambers under 16 hr light and 60% relative humidity at
20°C. Tissue from the parental line (p1519-31) and dst1 and dst2 homozygous mutants
(Johnson et al., 2000) were harvested from 35- to 40-day-old plants. The dst1 and dst2
lines used were from the second backcross to the parental line. All tissue was harvested

from plants grown in parallel under the same conditions in different growth chambers.

15k AFGC DNA Microarray

15,532 and 15,488 element microarrays were generated at the Arabidopsis
Functional Genomics Consortium (AF GC) Microarray facility at Michigan State

University. The ESTS were spotted on super-amine glass slides (Telechem International,

159

Inc.; Sunnyvale, CA). Slides were washed and blocked according to the Telechem

protocol.

Total RNA Extraction, Poly(A)+ RNA Purification, and RNA Blot Hybridization

Total RNA from leaf samples was extracted as previously described (Newman et
al., 1993). Poly(A)+ RNA was purified from 100 ug of total RNA using the Oligotex
mRNA kit (Qiagen, Valencia, CA). RNA (10 pg of total RNA or 2 pg of poly(A)+ RNA)
was analyzed by electrophoresis on 2% formaldehyde/1.2% agarose gels and blotted onto
nylon membrane (Nytran Plus, Schleicher & Schuell, Keene, NH). DNA probes were
labeled with [or-32P]dCTP by the random primer method (Feinberg and Vogelstein, 1983)
and purified from unincorporated nucleotides using probe purification columns
(NucTrap, Stratagene, La Jolla, CA). The RNA blots were hybridized as described in
Taylor and Green (1991) using the indicated 32P-labeled probes. For a loading control,
RNA blots were hybridized with a 32P-labeled cDNA probe for the Arabidopsis
translation initiation factor eIF 4A (Taylor et al., 1993). Blots were stripped between
hybridizations in O. 1% SDS at 90 to 95°C for 1 hour. Quantification of hybridization

signals was achieved using a phosphorimager (Molecular Dynamics, Sunnyvale, CA).

Labeling of Poly(A)+ RNA

Poly(A)+ RNA was labeled using the aminoallyl labeling procedure. 0.5 ug of
poly(A)+ RNA and 6 ug random hexamers in a total volume of 18.5 ul of DEPC-treated
water was denatured at 70°C for 10 min, set at room temperature for 3 minutes and
cooled down on ice. On ice, 6 pl. of5 x RT buffer, 3 uL of 0.1 M DTT, 0.6 uL 50X

aminoallyl-dNTP mix, and 2 uL of Superscript II (ZOOU/uL) were added, and the mixture

160

was incubated at 42°C for 3 hrs. The RNA was hydrolyzed by adding 10 uL 1N NaOH
and 10 uL 0.5M EDTA and incubating at 65°C for 15 minutes. 10 uL 1N HCL was then
added to neutralize the pH. Unincorporated aa-dUTP and free amines were removed with
the Qiagen PCR purification kit using phosphate wash and elution buffers. Aminoallyl-
labeled cDNA was resuspended in 9 uL 0.1M NazCO3, mixed with the appropriate NH S-
ester Cy dye and incubated in the dark for 1 hr. The labeled cDNA was purified using the
Qiagen PCR purification kit. To test the quality and quantity of the product, 2 uL of the
labeling reaction with 2 uL glycerol was separated on a 1% agarose gel using a
miniprotean gel electrophoresis system (Bio-Rad Laboratories, Hercules, CA). The
portion of the gel containing the DNA sample was placed on a glass microscope slide,
dried on a heat block at 70°C, and scanned using Affymetrix 428TM scanner. The rest of

the probe was used to prepare the hybridization mixture.

DNA Microarray Hybridization and Analysis

For a single DNA microarray, 50 uL of hybridization solution was prepared by
mixing 50 uL slide hybridization buffer (Ambion) and 4 uL Cy5- and Cy3-labeled probe.
The mixture was denatured at 95°C for 10 minutes. The mixture was then hybridized to
the array under a glass coverslip that had been washed in 95% ethanol, then 0.2% SDS,
and rinsed in distilled water. The slide was then placed in a microarray hybridization
chamber (Arraylt Hybridization Cassette, TeleChem International, Inc.; Sunnyvale, CA)
with 200 uL of 3 x SSC to ensure high humidity conditions. Hybridization was carried
out in a water bath at 65°C for 12 to 20 hours. After hybridization, the microarray was
washed for 5 min in 1 x SSC/0.2% SDS, 5 min in 0.1 x SSC, and 15 sec in 0.05 x SSC

without SDS, and finally dried by centrifiJgation at 600 rpm for 5 min. The slide was

161

scanned once in an Affymetrix 428TM scanner for both channels 1 and 2 (corresponding
to Cy3- and CyS-labeled probes, respectively).

The image files obtained were analyzed using GenePix Pro 3.0 software. Data
from each channel was transformed to the natural logarithm, and a Z-score was calculated
to normalize the channel values in order to account for variation in RNA labeling. Values
were retransformed from the natural logarithm by raising to the power e, and the channel

ratio was calculated.

162

REFERENCES

Enard, W., Khaitovich, P., Klose, J ., Zollner, S., Heissig, F., Giavalisco, P., Nieselt-
Struwe, K., Muchmore, E., Varki, A., Ravid, R., et a1. (2002). Intra- and interspecific
variation in primate gene expression patterns. Science 296, 340-343.

F einberg, A. P., and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction
endonuclease fragments to high specific activity. Anal Biochem 132, 6-13.

Goda, H., Shimada, Y., Asami, T., Fujioka, S., and Yoshida, S. (2002). Microarray
analysis of brassinosteroid-regulated genes in Arabidopsis. Plant Physiol 130, 1319-1334.

Hammond, S. M., Boettcher, S., Caudy, A. A., Kobayashi, R., and Hannon, G. J. (2001).
Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293,
1146-1150.

Johnson, M. A., Perez-Amador, M. A., Lidder, P., and Green, P. J. (2000). Mutants of
Arabidopsis defective in a sequence-specific mRN A degradation pathway. Proc Natl
Acad Sci U S A 97, 13991-13996.

Llave, C., Xie, Z., Kasschau, K. D., and Carrington, J. C. (2002). Cleavage of Scarecrow-
like mRN A targets directed by a class of Arabidopsis miRNA. Science 297, 2053-2056.

Newman, T. C., Ohme-Takagi, M., Taylor, C. B., and Green, P. J. (1993). DST
sequences, highly conserved among plant SAUR genes, target reporter transcripts for
rapid decay in tobacco. Plant Cell 5, 701-714.

Perez-Amador, M. A., Lidder, P., Johnson, M. A., Landgraf, J ., Wisman, E., and Green,
P. J. (2001). New molecular phenotypes in the dst mutants of ArabidOpsis revealed by
DNA microarray analysis. Plant Cell 13, 2703-2717.

Scheible, W. R., Fry, B., Kochevenko, A., Schindelasch, D., Zimmerli, L., Somerville, S.,
Loria, R., and Somerville, C. R. (2003). An Arabidopsis mutant resistant to thaxtomin A,
a cellulose synthesis inhibitor from Streptomyces species. Plant Cell 15, 1781-1794.

Taylor, C. B., and Green, P. J. (1991). Genes with homology to fungal and S-gene
RNases are expressed in Arabidopsis thaliana. Plant Physiol 96, 980-984.

Taylor, C. B., Bariola, P. A., DelCardayré, S. B., Raines, R. T., and Green, P. J. (1993).
RNSZ: A senescence-associated RNase of Arabidopsis that diverged from the S-RNases
before speciation. Proc Natl Acad Sci USA 90, 5118-5122.

Wang, H., Ma, L., Habashi, J ., Li, J., Zhao, H., and Deng, X. W. (2002). Analysis of far-

red light-regulated genome expression profiles of phytochrome A pathway mutants in
Arabidopsis. Plant J 32, 723-733.

163

Zechiedrich, E. L., and Cozzarelli, N. R. (1995). Roles of topoisomerase IV and DNA
gyrase in DNA unlinking during replication in Escherichia coli. Genes Dev 9, 2859-2869.

164

 

CHAPTER 7

FINAL REMARKS AND FUTURE PROSPECTS

165

 

An important challenge for plant biologists is to understand all of the mechanisms
used by plant cells to regulate gene expression levels. Transcriptional regulation has
justifiably enjoyed a great deal of experimental attention over the years. However, there
are several important modes of regulation that occur once messenger RNA (mRNA)
molecules are generated. The mechanisms responsible for the post-transcriptional
regulation of gene expression are only beginning to be understood in plants. Several
messenger RNA sequences that control abundance, localization, and translation initiation
have been identified, yet the factors that recognize these sequences are largely unknown.

The genetic studies coupled with the functional genomic approaches described in
this thesis should lead to an enhanced understanding of sequence-specific decay in
Arabidopsis and other higher plants. Cloning of the DST 1 gene should be accomplished
in the near future and the characterization of its product should provide insight into the
decay machinery that recognizes and degrades DST-containing transcripts. The simplest
hypothesis is that DST 1 encodes an RNA-binding protein or a ribonuclease. It is also
likely that DSTl is a regulatory factor that controls one of these components or has some
unanticipated function. An intriguing possibility is that the DST element is recognized by
specific complementary noncoding RNAs.

If DSTl is a sequence-specific RNA-binding protein, it could be hypothesized to
influence deadenylation by modulating the rate at which a single ribonuclease functions
or by recruiting kinetically distinct ribonucleases. In addition, if DSTl is indeed a DST-
specific RNA binding protein, it would be of interest to examine its interaction with

specific subdomains of the DST element. Once the identity of DST 1 is known, knock-out

166

and overexpression lines can be generated to further elucidate the function of the DSTl
protein.

Microarray studies and subsequent half-life analyses have indicated that DST 1 is
most likely involved in the degradation of mRN As in discrete pathways. Identification of
the protein complexes that DSTl interacts with will be the next step in determining the
biological role of the DST-mediated degradation pathway in Arabidopsis. Protein-protein
interactions of DSTl could be examined in vitro with other Arabidopsis proteins
predicted to be involved in mRNA decay, such as AtXRN4 (5’-3 exoribonuclease),
AtPARN (poly(A) ribonuclease) and components of the exosome. Alternatively, the yeast
two-hybrid system could be used to detect novel proteins that associate with DST1.

Recent experiments have suggested that DST-mediated mRNA decay might be
developmentally regulated. Early in the analysis of dst1 and dst2, it was noted that the
mRNA turnover defect of these mutants, at least for HPH-DST mRNA, was more
pronounced in older plants compared with seedlings (Johnson and Green, unpublished
data). This result indicates that it may be important to assay the impact of mutations that
affect posttranscriptional regulatory pathways throughout plant development even when
it has been assumed that the element is not developmentally regulated. Future studies will
be required to determine whether components of the DST-mediated mRNA decay
pathway are under temporal regulation or are modulated in response to other stimuli such
as circadian rhythms.

Distinct DST-containing mRNAs could also be differentially regulated within the
same cell and this regulation might be due to the different mRN A decay pathways

mediated by the various DST genes. Likewise, it could be postulated that some of these

167

DST-containing mRNAs require a sequence in addition to the DST element and proper
cooperation between multiple RNA elements is necessary for mRNA stabilization or
destabilization. Furthermore, specific types or numbers of subdomains present in certain
DST—containing mRNAs might be contributing to the modulation of DST-mediated
decay.

The progress outlined in this thesis opens up fresh avenues for evaluating the
association of DST-mediated decay with the circadian clock. The circadian experiments
carried out with the dst1 mutant should be applicable to dst2 and dst3 as well. Analysis of
the effect of the different dst mutants on circadian gene expression should further aid in
unraveling the mechanisms that underlie posttranscriptional control of CCG expression at
the level of mRNA stability.

The dst mutants have and will continue to serve as excellent tools to address how
specific mRNAs are targeted for increased turnover. Although the functioning of the
machinery is only partially known, it is clear that the DST-mediated decay pathway can
regulate particular mRNAs in a rapid, coordinated fashion. Apart from basic research,
detailed knowledge of this pathway should have a potential impact on applied research as
well. The inhibition of rapid mRNA turnover through interaction with the DST complex
might be a means of increasing the amount of a specific protein in plant cells, a highly

desirable trait for commercial applications.

168

‘ urtmiiiiiitfligti1311311