1W"? 1&‘2Eééfi .r. lint... .... gm“?

 

‘0.
j \
- x \I/
~\ '

LIBRARIES
MICHIGAN STATE UNIVERSITY
EAST LANSING, MICH 48824-1048

This is to certify that the
dissertation entitled

ARABIDOPSIS VERNALIZA TION INDEPENDENCE GENES
ARE REQUIRED FOR FLOWER/N6 LOCUS C ACTIVATION

presented by

HUA ZHANG

has been accepted towards fulfillment
of the requirements for the

 

 

Ph.D degree in Genetics

 

Major Professor’s Signature
{ 4/ 51/07

Date

MSU is an Affirmative Action/Equal Opportunity Institution

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

6/01 c:/CIRC/DatoDuo.p65-p.15

ARABIDOPSIS VERNALIZA TION INDEPENDENCE GENES ARE INVOLVED
IN FLOWERING LOCUS C ACTIVATION
By

HUA ZHANG

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
DOCTOR OF PHILOSOPHY

Genetics

2004

ABSTRACT

ARABIDOPSIS VERNALIZA T ION INDEPENDENCE GENES ARE INVOLVED
IN FLOWERING LOC US C ACTIVATION

By

Hua Zhang

Vemalization is the phenomenon of flowering being promoted by long period of
near-freezing temperatures (e. g., natural winter). In Arabidopsis, a flowering repressor
gene, FLOWERING LOC US C (FLC), is believed to be the main target of vemalization.
Although several genes have been identified as either positive or negative FLC
regulators, none of them is required for the vemalization mechanism.

In order to achieve a better understanding of vemalization at the molecular level,
a genetic approach has been carried out to identify Arabidopsis genes that promote FLC
expression. Seven genetic loci, designated VERNALIZA T ION INDEPENDENCE (VIP),
were identified. All of the vip mutants show an early flowering phenotype and
suppressed FLC mRNA expression. Besides flowering early, the vip mutants also show
mild developmental pleiotropy, suggesting that VIPs play multiple roles in plant
development.

Two of the VIP genes, VIP3 and VIP4, have been cloned fiom the presented
dissertation. VIP3 encodes a protein composed of almost entirely WD repeats,
suggesting a role in protein-protein interaction. VIP-4 encodes a protein with sequence
homology to a yeast protein Leolp, a subunit of the yeast transcription complex named
Pafl /RNA polymerase II complex (Pafl C). Later research of this laboratory revealed

that the VIPZ, VIPS and VIP6 all encode proteins similar to the components of Pafl C.

The sequence homology between these VIPs and PaflC components suggests that some
VIPs, if not all, could be subunits of a plant transcription complex that is similar to the
yeast PaflC.

A genetic approach and a biochemical approach were adopted to test the
hypothesis that VIPs may present in a protein complex. My results showed that genetic
combinations of vip4 mutation with mutations in the other six VIP genes did not give an
enhanced mutant phenotype when compared with either of the parental single mutant.
Furthermore, VIP3, VIP4 and VIP6 proteins were shown to physically interact with each
other in viva. Both results indicate that VIPs are components of a protein complex.

The outcomes of the presented study suggest that VIPs might represent a

previously un-recognized transcriptional regulation mechanism in plants.

Dedicated to my wife Zehua Fu for her eternal love

iv

ACKNOWLEDGEMENTS

I would like to thank people who have been helping me to complete this
dissertation. First and foremost, I thank Dr. Steve van Nocker for taking the risk to have
me as his student. I also thank my committee members Dr. Mitch McGrath, Dr. John

Ohlrogge, Dr. Mike "Thomashow for helpful suggestions during my research and study.

I thank Dr. Richard Amasino for providing me the vipI -1 , vip4-2, vip4-3, vip6-2

and vip7-1 mutant alleles.

I appreciate the help from members of the van Nocker laboratory, both past and
present. These people include Philip Ludwig, Sookyung Oh, Jolissa Ek-Ramos, Callista
Ransom, Lingxia Sun, Ying Yan, and Sang-dong Yoo.

I own many thanks to my parents and my younger for their encouragement.

The Plant Breeding and Genetics Program, the College of Natural Sciences of the

Michigan State University and USDA provided the financial supports to finish my study.

TABLE OF CONTENTS

ABSTRACT ....................................................................... ii
DEDICATION .................................................................... iv
ACKNOWLEDGEMENTS ..................................................... v
LIST OF TABLES ............................................................... ix
LIST OF FIGURES .............................................................. x
ABBREVIATIONS .............................................................. xii
CHAPTER 1: LITERATURE REVIEW ...................................... 1
REFERENCES ................................................................... 31

CHAPTER 2: THE VERNALIZATION INDEPENDENCE4 GENE
ENCODES A NOVEL REGULATOR OF FLOWERING

LOC US C ................................................................ 39
ABSTRACT ...................................................................... 40
INTRODUCTION ............................................................... 4 1
MATERIAL AND METHODS ................................................ 46
RESULTS ......................................................................... 49
DISCUSSION .................................................................... 64
REFERENCES ................................................................... 70

CHAPTER 3: GENETIC ANALYSIS OF EARLY FLOWERING
MUTANTS IN ARABIDOPSIS DEF INES A CLASS OF

vi

PLEIOTROPIC DEVELOPMENTAL REGULATOR REQUIRED
FOR EXPRESSION OF THE FLOWERING-TIME SWITCH

FLOWERING LOC US C ............................................... 75
ABSTRACT ...................................................................... 76
INTRODUCTION ............................................................... 77
MATERIALS AND METHODS .............................................. 80
RESULTS ........................................................................ 86
DISCUSSION ................................................................... 107
REFERENCES .................................................................. 113

CHAPTER 4: A PLANT TRANSCRIPTIONAL REGULATORY
MECHANISM RELATED TO THE YEAST PAF l/RNA
POLYMERASE II COMPLEX CONTAINS VERNALI-

ZATION INDEPENDENCE PROTEINS .......................... 116
ABSTRACT ..................................................................... 117
INTRODUCTION .............................................................. 118
MATERIALS AND METHODS ............................................. 123
RESULTS ........................................................................ 125
DISCUSSION ................................................................... 134
REFERENCES .................................................................. 142
CHAPTER 5: PERSPECTIVES AND FUTURE DIRECTIONS ....... 147
INTRODUCTION ............................................................. 148

A SUCCESSFUL GENETIC APPROACH TO IDENTIFY FLC
REGULATORS ....................................................... 1 50

VIPs MAY REPRESENT A PREVIOUSLY UNKNOWN TRANS-
CRIPTION REGULATION MECHANSIM IN PLANTS ...... 153

vii

PRELIMINARY RESULTS .................................................. 158

REFERENCES ................................................................. l 72

viii

LIST OF TABLES

Table 1-1 The Arabidopsis flowering time genes that are

discussed in this review .......................................... 3
Table 1-2. Major field crops with vemalization response ................ 28
Table 3-1. Approximate map positions of VIP loci ....................... 105

Table 3-2. Complementation testing of vemalization
independence mutants ........................................... 106

Table 5-1. Early flowering mutants that were identified
from my screening ................................................ 151

Table 5-2. The VIP4 interacting proteins identified from
the yeast two-hybrid screening .................................. 162

Table 5-3. The primer sequence for amplifying DNA
fragment to construct plasmids for the RNAi
experiment ......................................................... 162

Table 5-4. The primers for the PCR/cleaved amplified

polymorphic sequence (CAPS) markers of the
corresponding autonomous pathway mutants ................ 168

ix

LIST OF FIGURES

Figure 1-1. Flowering time control in Arabidopsis ....................... 6

Figure 1-2. The types of common nucleosome histone
modifications and ”the potential histone
modification sites ............................................... 19

Figure 2-1. Phenotype of the wild-type, ColeRI SFZ
introgression line and a vip4 mutant ......................... 51

Figure 2-2. Flowering time of wild-type plants, vip4
mutants, and mutants lacking activity of FR] or FLC. 54

Figure 2-3. Depiction of the region of chromosome V
encompassing the VIP4 gene .................................. 57

Figure 2-4. Molecular complementation of the vip4-1
mutation and manipulation of VIP4 expression
in transgenic plants ............................................. 60

Figure 2-5. Analysis of VIP4 and FLC RNA expression in
various organs and tissues of wild-type plants,
in non-vemalized and vemalized wild-type plants,
and in various genetic backgrounds .......................... 62

Figure 3-1. Phenotype of the vip3 mutant and analysis of

VIP3 expression ................................................ 88
Figure 3-2. Flowering time of genotypes used in this study as

affected by photoperiod and cold treatment ................ 92
Figure 3-3. Region of chromosome IV encompassing BAC

F27Bl3 containing the VIP3 (At4g29830) gene ........... 97
Figure 3-4. Characterization of Arabidopsis vip mutants ............... 104

Figure 4-1. The homology of VIPZ/Pafl, VIP4/Leol,
VIP5/Rtfl and VIP6/Ctr9 ...................................... 122

Figure 4-2. Combination of vip4 with vipI, vip2, vip3, vip5,
vip6 and vip7 mutations does not enhance the early

flowering phenotype of the single mutants ................. 128
Figure 4-3. VIP4 protein abundance in all seven vip mutants ......... 131
Figure 4-4. VIP3, VIP4 and VIP6 physically interact in vivo ......... 133
Figure 4-5. Protein species immunoreactive to anti-VIP3 and

anti-VIP4 antibodies are present in broccoli and

cauliflower ...................................................... 136
Figure 4-6. A model for the VIP mechanism ............................ 141
Figure 5-1. VIPs operate in a mechanism distinct from that

of FRIGIDA .................................................... 149

Figure 5-2. VIP4 protein is present only in Arabidopsis
inflorescence tissue ............................................ 157

Figure 5-3. B-galactosidase activity assay of the four
VIP4-interacting clones identified from the
yeast two-hybrid screen ....................................... 161

Figure 5-4. Bo VIP3 is detected in every fraction with a
molecular weight range of 40 kDa ~ 2 MDa in a
gel infiltration column chromatography experiment ...... 166

Figure 5-5. Detection of the elongating form of RNA
polymerase II in Arabidopsis ................................. 170

Figure 5-6. VIP4 does not physically interact with elongating
form of RNA polymerase II in vivo ......................... 171

xi

Chemicals:
Bis-Tris Propane
DTE

EDTA

MOPS

PAGE

PMSF

SDS

9533.8;
ABHI
A GL20
CO
CR Y2
ELF7
ESD4
FLC
FLD
FLK
FRI

FRLI

ABBREVIATIONS

bis[tris(hydroxymethyl)methylamino]propane
dithioerythritol

ethylenediaminetetraacetic acid
3-[N-morpholino]propanesulfonic acid
polyacrylamide gel electrophoresis
phenylmethylsulfonyl fluoride

sodium dodecyl sulfate

ABA H YPERSENSITI VE 1
AGAMOUS—LIKEZO

CONSTANS

CR YPTOCHROMEZ

EARLY FLOWERING 7
EARLYINSHORTDA YS4
FLOWERING LOC US C

FLOWERING LOC US D

FLOWERING LA TE WITHKHMOTIFS
FRIGIDA

FRI GIDA -LIKE1

xii

FRL2

FT

GI

LD

PH YA

PIE 1

SOC 1

V1N3

VIP3

VIP4

VIP5

VIP6

VRN]

VRNZ

FRI GIDA -LIKE2

F L0 WERING LOC US T

GI GAN T EA

L UMINIDEPENDENS

PH Y T OCHR OME A

PH 0T OPERIOD INSENSI T I VE 1

S UPPRESSOR OF C ONS T ANS 1
VERNALIZA T 1 ON INSENSI T I VE 3
VERNALIZ4 T I 0N INDEPENDENCE3
V ERNALIZA T I 0N INDEPENDENCE 4
VERNALIZA T I 0N INDEPENDENCE 5
VERNALIZA T ION INDEPENDENCE 6
V ERNALIZA T I ON 1

VERNALIZA TIONZ

xiii

Chapter 1

Literature review

Unlike animals, higher plants produce their organs post-embryonically (i.e., after
germination). This developmental scheme is sustained by the meristem tissue, comprised
of a mass of stem cells. The meristem provides cells not only for differentiating into new
organs but also for self-renewal. After undergoing a certain period of vegetative growth,
a plant acquires the capability of reproductive growth (flowering), a physiological state
called competency. Subsequently, the plant will flower once favorable environmental
conditions permit. During this phase change, the meristem fate is changed from a
vegetative state to a reproductive state, producing cells for flowers and gametophytes.
For most of the higher plants, flowering to set seeds is the only way of propagating. Thus,
the success of reproductive growth is critical for species continuity.

Most of our knowledge concerning flowering is obtained from studies of the
model plant Arabidopsis thaliana. A number of genes (Table 1) have been identified to
'time' this phase change. These genes, called flowering-time genes, compose different
flowering pathways that sense both endogenous and exogenous cues, ensuring flowering
to occur under favorable conditions for seed production (Figure 1). Conceptually, signals
from the flowering regulatory pathways are integrated by a limited number of flowering
pathway integrator genes, and the activity of the flowering pathway integrators
('processed signals') specifies the expression state of a group of meristem identity genes,

which, in turn, control genes determining floral organ identity and patterning.

 

 

88 .a a .8385 See 8.3.2828 2.53... .E
v :2. mo memmmxfiam
508.532 .39. 9
3.5.... 55% wees; 8. .306
38 ....... s as... 5.3 538.. 8.95 888m 8839.. SE
$2 .a .0 BEES.

.32 ...a s 3255. seen... 08.6. 2.55 2:8» .2 c Q53 ESE. 35 .E
38 ....w s 222.22 382... 3 838 seem 9... _ mm .2 RESAAQGES 3E
38 I... s 222.22 .352“. a BEE 538.. 8833 CmMEiSoEE 3E

mama—how
88 ...a a “.8532 €32.06 5.3 £28.. 88%.? 3353 3E
58 s... .0 maneofim 538.. 325%.? o. $.32 32
38 s.“ s a: Essa 3.832%. 23% 3. SEQ: 5. 5:. E E OESEE ME
88 I... a o: 522.. Ba.8§¢<om 8833. S .863 egg. 3.: 3m
82
I... a 823m .82
653:2. Ea 238.2 .35 83:85: 339.: 8.23.. 6 S93 e58: 3.5 0.2
82 .a s Ewing: Essa $6532.. $83.2 VON
88 r.“ s and: 2%.:on 388:. 3222 game... 3... waxomwfixfiws 3%
3:23:95 coo—82
§> Ea mos—«dim Ewan “23:8 Raosatowcdb
.38 .a s 0.. sag 2.. a $288.. 5.3 532m 83% .2 an: .32 .A e233. 3:5.me aim
88 .a a 35.5... 8382 2w: 02m 83% .2 Gmsommoosémov E 5
82 :3 so :52... .98.. 8.3.528. can-.. 853.... Gzfimzoov 8
88 .a s 03 see 8.5552. $9832 883... coon 3? .emmcafisozwo 3 3qu
02-0530.”— EOflofl-fl Emschh 259..- 03a: 0:8

 

.3939. 25 5 682.8% 0.3 .2: 85» «E: ”£326: £33395. .3 «as A 03:.

 

 

.08 0.0.0 8.0000 0.0.0.... 5080.2. 05.8.38 0000.00... .8282 83022.03. 82.:
88 0.0.0 0000. 0.0.0... 00.00.0220. 0.050.. B 88.00.... C28,. 830.2220: 22.:
008 0.0 85 3.02.00 .000......_0000.. 52.2.. .00....
.0 0.. .008 0.0.0 .5 .0000 05 0. 000.052. 5..0 0.0.0... 0. 8808... 0522222220222 205 53.02203. 00.:
3.3M 8.03.20 352.9585»:
008 0.0.0 no .000. 05 o. 000.052. 5.3 0.0.0.. 80.8 :0. 5323222252. 202 0822.02.80: 00E
NOON 384 8.03.8 3505550555
000.82 00> .000 000.8 .0000 05 o. 000.050.. 5..0 0.0.05 8. .80.... 5292222222222 2c: 82.0285 02:
88 0.0.0 0.0.8 0.0.0... 0.02.2-9.» 80800... 5006222222822. 20: 083.022.... E:
008 0.080.. B... .000
60.00.00. 000 055 0.0000. 5.00005... 5..0 0.0.0... 8 00000.... 520.552.0522 202 88.02220: .2:
.802... .00.... 452.528 06
280.552.822.030
88 0.0.0 000805 00.00.. 02.0.6800. 000-590.). 000.008... 0.5 2055.02.20.22... 5%
88
60.0002. .000 002 0.0.0... 00...-0000..0..-...z§3m o. 8.00.... .322522522 20.50.8022. .0022
88 0.0 .0 000.0005 8.0000. .00.. .000. 8080.2 .0. 220229822... 3.20.
008. 0.0 .0 00. 0.0.0.... 0.0508080: 00880.... 82522202282222 .2. 3
oaa~ is «0 Jam mango“. 23.5808
.08. 0.0 .0 00.300. -000... 0.0 00.50.08 0.0.8.. 8080 :0. 352.65. B
Quay-0&0”— :cfluflau Eucachm wave..— 95:: 0:8

 

5.2.8. . 0.5:.

Figure 1. Flowering time control in Arabidopsis. Multiple mechanisms co-exist to
give a delicate control of flowering time. The vemalization pathway responds to
extended near-freezing temperatures; the autonomous pathway responds to endogenous
signals; the photoperiodic pathway responds to changes of day-length, the gibberellin
pathway is regulated by phytohormone gibberellin; and the ambient temperature pathway
promotes flowering at higher ambient temperatures. This flowering model indicates that
these pathways regulate, directly or indirectly, a limited number of flowering pathway
integrator genes (SOCI, F T), which, in turn, controls the expression of the floral
meristem identity genes to promote flowering.

In the diagram, the arrow indicates a promotive effect, while the “.1.” indicates an
inhibitory effect.

Gnu .NU .QU
.395:an um—ucmhohofiih
0559-2—53 unsung-4w

 

VQVJW
NWNAN
haNN\_

 

hair-=2—
flfi—ohoanmmv

:omuaNm-aflho>

.3» .VUnN .QNK .QN
55$:an 93532554

NgnN .Nanfi
a“

TEMPERATURE AND FLOWERING

As mentioned above, flowering is under the control of both endogenous and
environmental cues. One of the environmental factors that affect flowering is
temperature, including both ambient and near-freezing temperatures. For some species,
high ambient temperatures have a flowering-promotive effect. For example, wild-type
Arabidopsis plants flower earlier at 23 °C than at 16 °C (Blazquez et al., 2003). The
molecular basis of ambient temperature in flowering—time control was studied recently,
and it was found that this mechanism is probably mediated through the blue light receptor
CRYPTOCHROME2 (CRY2) and the red light receptor PHYTOCHROME A (PHYA).
As Blazquez and his colleague reported, the late-flowering phenotype of 0322 mutant is
exacerbated at 16 °C. The phyA mutant flowers slightly late at 23 °C. However, the 01322
phyA double mutant growing at 23 °C flowers as late as the cryZ single mutant growing
at 16 °C (i.e., a more than additive effect was observed) (Blazquez et al., 2003). This
observation suggests that the promotive effect of high ambient temperatures is mediated
redundantly by photoreceptors CRY2 and PHYA.

For certain plants, flowering can also be accelerated or triggered by a long period
of near-freezing temperatures, a phenomenon known as vemalization. It needs to be
clarified that vemalization specifically refers to the flowering-promotive effect of chilling
treatment, rather than the breakage of dormancy by cold (Lang, 1965). An understanding
of vemalization has great practical and fundamental value. Practically, some crops (e. g.,

winter wheat) need vernalizing cold to flower, and thus the production of these crops is

limited to areas with appreciable cold during winter. An understanding of the mechanism
of vemalization will help to develop ways to bypass the requirement for cold, and thus
extend the production area of these crops. Fundamentally, vemalization is a
developmental process that involves an epigenetic mechanism (see below). In animals,
epigenetic mechanisms play key roles in development, by maintaining the expression
states of developmental regulatory genes. However, the involvement of epigenetic
mechanisms in plant development is not well studied. Thus, an understanding of

vemalization will enrich our knowledge of epigenetic gene regulation in development.

THE PHYSIOLOGY OF VERNALIZATION

The physiology of vemalization has been extensively studied. For most species
that have been studied, the range of effective chilling temperature for vemalization is
typically 1-7 °C (Lang, 1965). Results from localized cold treatment and grafting
experiments suggested that, in intact plants, vemalization and the perception of the cold
signal for vemalization take place in the shoot apex. In such experiments, it was found
that chilling of the shoot apex while maintaining other portions of the plant at a non-
inductive temperature was sufficient to promote flowering in celery, beets and
Chrysanthemums (Curtis and Chang, 1930; Chroboczek, 1934; Schwabe, 1954); and
grafting of shoot tips from vemalized Althaea rosea onto non-vemalized stock resulted in
flowering induction (reviewed in Lang, 1965). The dose-effect curve of cold treatment

indicates that vemalization is a quantitative effect, and the duration of chilling to achieve

maximum flowering promotion is species-dependent (Lang, 1965). At least for some
species (e.g., sugarbeets and Arabidopsis), the vemalized state can be annulled by several
days of high temperatures (e. g., 30 °C) immediately following the cold treatment, a

phenomenon known as devernalization (Lang, 1965).

VERNALIZATION AND GIBBERELLIN

It has long been hypothesized that the phytohormone gibberellin (GA) is involved
in vemalization. Exogenous application of GA to the biennial plant Hyoscyamus niger is
capable of flowering induction under long-day conditions in the absence of cold (Lang,
1957). Later, the flowering-inductive effect of GA application on a number of other cold
requiring species was also observed (Zeevaart, 1983). Furthermore, in radish, the
endogenous GA level was found to increase during the course of a vernalizing cold
treatment (Suge, 1970). All of these observations suggest that GA may play a role in
vemalization. Nevertheless, recent studies indicate that, at least in Arabidopsis, GA
probably is not required for this process. In one of such studies, exogenous GA
application did not affect the expression of the FLOWERING LOCUS C gene, the main
target of vemalization in Arabidopsis (see below) (Sheldon et al., 1999). In another
experiment, the endogenous GA level of vemalization-responsive Arabidopsis strains
was genetically reduced by a mutation in the GA] gene, which encodes an enzyme that

catalyes the first step of GA biosynthesis (Sun et al., 1992). Although this gal mutation

can cause a very severe GA deficiency (Sun et al., 1992), it did not cause a loss of

vemalization response (Michaels and Amasino, 1999a; Chandler et al., 2000).

THE EPIGENETIC NATURE OF VERNALIZATION

In most cases, plants do not flower immediately after being vemalized, suggesting
that plants can somehow ‘remember’ their past experience of the vernalizing cold. This
type of ‘plant memory’ was excellently demonstrated using Hyocyamus niger (Lang,
1965). For flowering, H. niger obligately requires both vernalizing cold and long-day
conditions. Vernalized H. niger could be maintained at the vegetative stage under short-
day conditions (non-inductive photoperiods) for up to ~ 300 days. The plant was
subsequently able to flower after being provided with inductive, long-day photoperiods
(Lang, 1965).

The epigenetic memory of vemalization seems to require mitotic activity, as
suggested by regeneration experiments using vemalized Lunaria biennis, a biennial
(Wellensiek, 1962; 1964). In such experiments, mature leaves and young leaves were
marked at the beginning of the cold treatment. After a vernalizing cold treatment, these
leaves were detached and regenerated into plants. It was found that plants regenerated
from mature leaves remained vegetative, whereas plants regenerated from young leaves
could flower without being vemalized. These plant regeneration experiments suggested

that the vemalization state is aquired and transmitted mitotically. However, the

vemalization state cannot be transmitted through meiosis (i.e., the progeny of vemalized

plants must be re-subjected to cold treatment for flowering).

VERNALIZATION IN ARABIDOPSIS OPERATES PREDOMINATELY VIA
SILENCING 0F FLC

Recently, researchers started to unravel the molecular basis of vemalization,
mostly using Arabidopsis as a model. Two types of growth habits, annuals and winter—
annuals, exist in this reference plant species. Whereas the commonly used ‘lab strains’
behave as annuals, flowering soon after germination, most natural ecotypes are winter-
annuals, germinating in the fall, remaining vegetative during the winter, and flowering in
the following spring. By contrast with the biennials, which have a qualitative
requirement for cold treatment for flowering, winter-annuals have a quantitative
requirement. Genetic and molecular studies indicate that this naturally occun'ing
flowering-time variation is mainly determined by allelic variations in two genes, namely
FRIGIDA (FRI) and FLOWERING LOC US C (FLC). The functional, dominant FRI and
semidominant FLC act synergistically to confer a winter-annual growth habit, and
mutations in either gene create an annual habit (Burn et al., 1993a; Lee et al., 1993,
1994b; Koornneef et al., 1994; Johanson et al., 2000; Michaels et al., 2003).

In Arabidopsis, vemalization is mediated predominantly through silencing of FLC
(Michaels and Amasino, 1999b; Sheldon et al., 1999). FLC encodes a MADS-box

transcription factor and acts as a flowering repressor, by suppressing the flowering

ll

pathway integrator genes SUPPRESSOR 0F OVEREHRESSION 0F CONSTANSI
(SOC!) [a.k.a. AGAMOUS—LIKE 20 (A GL20)] and FLOWERING LOCUS T (FT), which
trigger the floral transition (Michaels and Amasino, 1999b; Sheldon et al., 1999; Lee et
al., 2000; Samach etal., 2000; Michaels and Amasino, 2001). After vernalizing cold,
FLC mRNA abundance decreased to an undetectable level in Arabidopsis strains
showing a winter-annual growth habit (Michaels and Amasino, 1999b; Sheldon et al.,
1999). FLC was found to be highly expressed in shoot and root tips (Michaels and
Amasino, 2000). As suggested by the regeneration experiments mentioned above,
mitotically active tissues are responsive to vemalization; the spatial expression pattern of
FLC is consistent with the proposed role of FLC being the main target of vemalization.

As mentioned above, vemalization was proposed to involve an epigenetic
mechanism. This is also reflected by the kinetics of FLC expression. Once down-
regulated by cold, the suppressed status of FLC is maintained throughout the rest of the
plant’s life cycle. However, the expression of FLC is reset to a high level in the next
generation (Michaels and Amasino, 1999b; Sheldon et al., 1999).

It needs to be stressed that vemalization does not operate exclusively through
FLC. Recently, an FLC-independent vemalization mechanism was also proposed, based
on the observation that the flc null mutant maintains a small vemalization response
(Michaels and Amasino, 2001). FLC belongs to a six-member MADS—box gene family
named FLC/MADS AFFECTING FLOWERHVG (MAF). The other five members of this

family are MAFI [a.k.a. FLOWERING LOC US M (FLM) (Scortecci et al., 2001)] -

12

MAP 5 . All MAFs give a late-flowering phenotype when overexpressed (Ratcliffe et al.,
2001; 2003), suggesting that these MAFs, like FLC, act as floral repressors. Although
proposed to have evolved from a common ancestor, at least some members of the
FLC/MAF gene family appear to be involved in different flowering regulatory
mechanisms. For example, mutations in FLC suppress the late-flowering phenotype of
the autonomous pathway mutants (see below); whereas mutations in MAFI/FLM
suppress the late-flowering phenotype caused by mutations in genes that promote
flowering through a photoperiodic response (Scortecci et al., 2001). Like FLC, the MAFs
are subject to repression by vernalizing cold, although to different extent, suggesting that
MAFs may act to 'fine-tune' the vemalization response under different environmental

conditions (Ratcliffe etal., 2001; 2003; van Nocker, unpublished).

COLD SIGNALING PATHWAYS ASSOCIATED WITH VERNALIZATION
MIGHT BE DISTINCT FROM THAT OF COLD ACCLIMATION

The signaling pathway leading to vemalization-associated FLC repression is
largely unknown. It is possible that vemalization may share some components with other
cold response signaling pathways. Two other plant responses that are also observed
under vemalization-effective temperatures are cold acclimation and breakage of seed

dormancy. Cold acclimation has been extensively studied at the molecular level

(Thomashow, 1999).

Cold acclimation is a phenomenon whereby plants aquire the ability to
withstanding freezing temperature after being exposed to near-freezing temperatures for a
certain period of time (Thomashow, 1999). Plants show pronounced changes during/alter
the acclimation process, including changes in membrane lipid composition, accumulation
of cryoprotectants, and large changes in gene expression (see below) (Thomashow, 1999).

The best known signaling pathway leading to cold acclimation is mediated
through the C—repeat/DRE Binding Factor (CBF) regulon. In the current model of cold
acclimation involving this regulon, low temperature activates an ubiquitously present
INDUCER OF CBF EXPRESSION protein to induce the expression of CBFs. The CBFs,
in turn, induce the expression of the whole CBF regulon, leading to an increase in cold
tolerance (Thomashow, 2001). A negative regulator of CBF, designated HIGH
EJG’RESSION 0F OSMOTICALLY RESPONSIVE GENE I (HOSI), has been identified
from the Arabidopsis ecotype C24, which shows a marginal vemalization response.
Interestingly, besides the defects in cold acclimation, the has] mutant was also reported
to show an early flowering phenotype and a decrease of FLC expression, suggesting a
potential role of HOSI in vemalization signaling as well (Ishitani et al., 1998; Lee et al.,
2001).

Although vemalization and cold acclimation may share some upstream
components (e. g., HOSl), it has been suggested that the cold signaling pathway
downstream fiom CBF is independent of that leading to F LC repression. Overexpression

of CBF] in Arabidopsis is capable of turning on an array of Cold Responsive (COR)

genes, resulting in an increase in cold tolerance (J aglo-Ottosen et al., 1998; Liu et al.,
2002). However, overexpression of CBF] in a winter-annual Arabidopsis strain did not
cause a decrease in FLC expression, nor did it alter the vemalization property of this

strain, suggesting that the CBF] regulon is not involved in vemalization (Liu et al., 2002).

EPIGENETIC REGULATION OF FLC IN VERNALIZATION
Genes that are required for vemalization-associated FLC silencing

The establishment and maintenance of epigenetic FLC silencing under cold
apparently requires the function of the VERNALIZA T ION INSENSIT I VE3 (VIN3) and a
set of VERNALIZA TION (VRN) genes (Sung and Amasino, 2004a; Chandler et al., 1996).
These genes were identified through a genetic screen for loss of vemalization response.
In the vin3 mutant, FLC continues to be expressed at high levels even after vernalizing
cold, suggesting that VIN3 is involved in establishing the repression of FLC (Sung and
Amasino, 2004a). Molecular studies showed that VIN3 transcripts accumulate during the
course of vernalizing cold treatment but become absent again afier subsequent growth
under warm temperatures (Sung and Amasino, 2004a). The VIN3 protein contains a
plant homeodomain (PHD) that is often found in proteins associated with chromatin
remodeling complexes (Sung and Amasino, 2004a).

Unlike what was seen in the vin3 mutant, FLC expression decreased to similar
levels in vrnI or vrn2 mutant and wild-type plants during cold treatment. However,

during the subsequent growth under normal growth temperatures, FLC levels increased in

15

the Wit] and vrn2 mutants, in sharp contrast to the wild type plants, in which FLC was
maintained at low levels (Gendall et al., 2001; Levy et al., 2003). The FLC expression
kinetics in vrn mutants indicates that VRNs are required to maintain FLC in a silenced
state, and thus VRNs function downstream of VIN3. VRNI encodes a putative DNA
binding protein (Levy et al., 2002); VRN2 encodes a nuclear localized, zinc finger protein,
with sequence similarity to the Drosophila Polycomb-group protein Su(Z)12 (Gendall et
al., 2001). In Drosophila, Polycomb-group proteins are components of large complexes
that reinforce the transcriptionally suppressed state of homeotic genes, probably by
packaging and/or maintaining chromatin in states less accessible to transcriptional
machinery (Pirrotta, 1997). Consistent with its predicted function, VRN2 seems to be
required to maintain an inaccessible status of the FLC gene, as suggested by the
observation that, after vernalizing cold, the FLC chromatin region is more accessible to
the DNase I digestion in a vrn2 mutant than in wild-type plants (Gendall et al., 2001).
Recent findings that Su(Z)12 is a component of a protein complex with histone
methyltransferase activity suggest that VRN2 may also function, at least in part, through

histone modifications (Kuzmichev et al., 2002; Muller et al., 2002) (see below).

Chromatin histone modification and epigenetic gene regulation
Eukaryotic gene transcription by RNA polymerase II is a highly coordinated
process that involves a large number of auxillary factors to facilitate gene recongition and

transcription initiation, elongation and termination. In eukaryotes, the genomic DNA

16

template is packaged into chromatin (and subsequently into chromosomes). The basic
repeating unit of chromatin is the nucleosome, which is composed of ~146 bp DNA
wound twice around a histone core, composed of an octamer of histone H2A, H2B, H3
and H4. The linker DNA between two adjacent nucleosomes is covered by histone H1.
This compact chromatin structure can make the DNA template inaccessible to the
transcription machinery. Recent studies on transcription identified a number of
transcription factors that modify chromatin structure, by either displacing nucleosomes
along the DNA or posttranslationally modifying nucleosomal histones (Svejstrup, 2004).
These histone modifications include, but are not limited to, phosphorylation, methylation,
acetylation, ubiquitination and sumoylation (Figure 2). Accumulating evidence indicates
that posttranslational histone modifications play important roles in epigenetic gene
regulation. Potentially, these histone modifications may affect gene transcription by
altering higher order chromatin folding, and/or by creating a signal for recruiting
additional regulatory elements. In a recently raised 'histone code' hypothesis, the type,
number and pattern of the nucleosome histone modifications epigenetically determine the
transcriptional state of a certain gene (for reviews, see Jenuwein and Allis, 2001; Fischle

etaL,2003)

l7

Figure 2. The types of common nucleosome histone modifications and the potential
histone modification sites. P: phosphorylation, AC: acetylation, Ub: ubiquitination, Me:
methylation.

18

H—UO—ZG¢H>v—N¢IMM<UUNMUAUWUQv—Uy—Um mil VI

arrii.

nubnen w— 2 3a v m N
th—mfl: .v—v—>U.. .<mv~m<<v—Nm<dO¥¢3<L00va~m<HOMhm< all m:

r e Weewwm go

328.» 5 MN: ca—
Mmmh>¥>= .MZ—<¥mv—mUV~—Mm>m<wvm~>hmm MHZ EN:

. «e r

a:
Mllwmhxfihdfl>¢§ .<~—<V~UUOvm—Ummvm mflz

. I...

 

 

 

 

 

 

 

 

 

 

 

 

19

Current model of vemalization-associated FLC silencing

Examination of FLC chromatin in vemalized wild-type and mutants indicated that
there are sequential histone modification events that occur during the vernalizing cold
treatment, and such histone modifications depend on the functions of VIN3, VRNl and
VRN2 (Sung and Amasino, 2004a; Bastow et al., 2004). In a recent model of
vemalization, VIN3 targets a histone deacetylation (HDAC) mechanism to create a
hypoacetylation environment on FLC chromatin. Such hypoacetylated chromatin may
subsequently recruit a histone methyltransferase (HMT) mechanism(s) that is mediated
by VRNl and VRN2 to methylate histone H3 at lysine-9 (K9) and K27 residues (Sung
and Amasino, 2004b). At least in animal systems, H3K9 methylation in euchromatin is
required for recruitment of heterochromatin protein] (HPl) to establish a localized

heterochromatic region, associated with long-term gene silencing (Schultz et al., 2002).

DNA methylation and vemalization

More evidence that epigenetic modification of chromatin structure is involved in
FLC regulation or vemalization comes from the study of Arabidopsis transgenic lines
defective in DNA methylation, a process that is tightly linked to chromatin dynamics.
Prolonged growth at low temperature results in a hypomethylation in Arabidopsis
genome, and a 5-azacytidine treatment, which causes a reduction of methylated cytocine
in DNA was capable of promoting flowering on vemalization-responsive Arabidopsis

strains, but not on vemalization-nonresponsive lines (Burn et al., 1993b). Genetically

20

reducing the genomic methylation level via antisense expression of a cytosine
methyltransferase gene in a winter-annual Arabidopsis strain has been found to
remarkably decrease the FLC transcript level in a vemalization-independent manner
(Finnegan et al., 1998; Sheldon et al., 1999). However, no change of FLC DNA
methylation status was detected before and after chilling (J. Finnegan, personal

communication).

FLC NEGATIVE REGULATORS - “AUTONOMOUS PATHWAY GENES”

Besides being suppressed by vemalization, FLC is also negatively regulated by
genes composing a so-called autonomous flowering promotion pathway (Figure 1). The
autonomous pathway is represented by seven genes, F CA, FY, F VE, FPA,
LUMINIDEPENDENS (LD), FLOWERING LOCUS D (FLD), and FLOWERHVG LA TE
WITH KH MOT IFS (FLK), which have been identified through screening for late-
flowering mutants in early-flowering Arabidopsis ecotypes. The autonomous pathway
mutants flower late in both long-day and short-day photoperiodic conditions. However,
these mutants are vemalization responsive (Martinez-Zapater and Somerville, 1990;
Koornneef et al., 1991), indicating that the autonomous pathway genes are not required
for vemalization. Compared to the wild-type plants, the autonomous pathway mutants
express FLC mRNA to high levels (Michaels and Amasino, 1999b; Sheldon et al., 1999;
Lim et al., 2004). Additional evidence for autonomous pathway genes negatively

regulating FLC expression comes from the observation that an flc null mutation is

21

epistatic to mutations in autonomous pathway genes F CA, F PA, F VE , or LD (Michaels
and Amasino, 2001).

Although autonomous pathway mutants behave similarly, it is not likely that
autonomous pathway genes are involved in a simple linear pathway. Clear genetic
interactions exist when combining some of the autonomous pathway mutants (Koomneef
et al., 1998). An additive effect was observed when combining fca and fve, and a more
than additive effect was observed between fca and firm, suggesting that F CA operates in a
mechanism distinct from that of FPA and F VE . The fpa mutant is epistatic to fve, which
indicates that FPA and F VE may act in the same mechanism and locates F VE
downstream of FPA. The fca mutant showed a less than additive interaction with fix,
implying that F CA and FY operate in the same mechanism. The fiva fix double mutant
might be lethal because no such double mutant was recovered. The fact that the fpa fca
mutant is viable would place F CA upstream to FY, because otherwise the fpa fca double
mutant is expected to be lethal (Koornneef et al., 1998).

All of the autonomous pathway genes mentioned above have been cloned. From
analysis of the proteins that they encode, these genes appear to regulate FLC through
partially distinct mechanisms. LD encodes a protein with a homeobox and putative
nuclear localization signal and may act as a transcription factor (Lee et al., 1994a). F CA,
FPA and FLK encode proteins containing potential RNA-binding domains (Macknight et
al., 1997; Schomburg et al., 2001, Lim et al., 2004), and FY, which physically interacts

with FCA, is related to the yeast mRNA 3'-end processing factor Pfs2p (Simpson et al.,

22

2003), indicating that these proteins may have roles in posttranscriptional control of gene
expression. FLD is homologous to a human protein, KIAAO601, a component of the
histone deacetylase 1,2 (HDAC1/2) complex (He et al., 2003), while FVE is homologous
to mammalian retinoblastoma-associated proteins (RbAp) and yeast multicopy suppressor
of IRAl (MSI) (Ausin et al., 2004; Kim et al., 2004). RbAp was shown to interact with
the HDAC that is recruited by the transcriptional repressor Retinoblastoma protein
(Nicolas et al., 2000). This evidence suggests that FLD and FVE might be involved in a
histone deacetylation mechanism. And indeed, histones of the FLC chromatin were
shown to be hyperacetylated in both fld and fve mutants (He et al., 2003; Ausin et al.,
2004). More significantly, FVE and another Arabidopsis MSI-like protein, AtMSIl,
were found to be involved in a polycomb group-like complex and chromatin assembly
facter-l (CAF—l), respectively, suggesting their potential roles in epigenetic gene

silencing and chromatin assembly (Kohler et al., 2003; Kaya et al., 2001).

FLC POSITIVE REGULATORS
FRIGIDA and FRIGIDA-LIKE genes

In addition to being negatively regulated by autonomous pathway genes and
vernalizing cold, FLC was also found to be positively regulated by FRIGIDA (FRI) and
FRI LIKE] (FRLI). Together with another related gene FRLZ, FRI and F RLI belong to
one clade of a seven-member gene family named FRLI (Michaels et al., 2004). Of this

gene family, FRI has been the best-studied member. This is mainly because the

23

commonly used Arabidopsis 'lab strains' carry a dysfunctional FRI allele or a weak FLC
allele, and allelic variation at FRI and FLC are major determinants of the natural
variability of flowering habit in Arabidopsis (Johanson et al., 2000; Michaels et al., 2003).

FRI is epistatic to autonomous pathway genes for FLC regulation, as shown by
the fact that in an Arabidopsis introgression line containing both functional FRI and a
functional autonomous pathway, F LC expression is elevated, and the strain behaves as a
winter-annual (i.e., vemalization responsive) (Michaels and Amasino, 1999b; Lee et al.,
1994b). FRI encodes a protein without homology to any protein with known function.
However, the predicted coiled-coil domains in FRI suggest that additional protein
partners may be required for FRI fiinction (Johanson et al., 2000). More extensive
molecular study of FRI has not yet been reported. It must be pointed out that although
both FRI and the autonomous pathway genes control FLC expression, none of them is
required for cold-associated FLC silencing, because, as mentioned above, the
autonomous pathway mutants, lacking both functional FRI and autonomous pathway
genes, maintain an intact vemalization response.

The activation of FLC by FRI requires F RLl. Mutations in FRLl suppress the
late flowering phenotype caused by dominant FRI but has no or little effect on the late
flowering phenotype caused by mutations in LD or FPA, suggesting that the function of
FRLl is specific to FRI containing background (Michaels et al., 2004). Accordingly,
FRLl is not required for the high FLC expression caused by mutations in autonomous

pathway genes LD or FPA (Michaels et al., 2004). FRLl may share partial functional

24

redundancy with FRL2, because a fill fr12 double mutant flowers earlier than a fri 1
single mutant (Michaels et al., 2004). However, although FRLl is homologous to FRI,
they do not seemly have redundant functions, because overexpressing of FRLI cannot

complement the fri mutant and vise versa (Michaels et al., 2004).

VERNALIZA TION INDEPENDENCE genes

The high FLC expression level in autonomous pathway mutants (lacking
functional FRI) strongly suggests that there are additional FLC activators. Identification
of these FLC positive regulators, which can be accomplished by analyzing early-
flowering mutants in a winter-annual background, is a necessary step to better understand
the FLC regulatory mechanism and, ultimately, vemalization.

Recently, a group of vemalization independence (vip) mutants have been isolated
to define novel FLC positive regulators (Zhang and van Nocker, 2002; Zhang et al.,
2003). Molecular characterization of VIPs suggests that these proteins might be involved
in a transcriptional regulation complex related to the yeast Pafl /RNA polymerase II

complex (this dissertation).

EARLY IN SHORT DAYS4 and PHOTOPERIOD-INDEPENDENT EARLY
FLOWERINGI

Four additional F LC activators that do not belong to the VIP group have also been

reported. These non-VIP FLC activators include F RLl, FRL2 (see above), EARLY IN

25

SHORT DAYS4 (ESD4) and PHOTOPERIOD-INDEPENDENT EARLY
FLOWERINGI (PIEl). The fill mutant was identified from a genetic screen similar to
the one that was used to identify the VIPs (Michaels et al., 2004; Zhang and van Nocker,
2002), conversely, esd4 and pie] mutants, both flowering early under short—day
conditions, were isolated from genetic screens that were not designed to target FLC
regulators (Reeves et al., 2002; Noh and Amasino, 2003).

The ESD4 protein is similar to yeast and animal proteases that are important for
SMALL UBIQUITlN-RELATED MODIFIER (SUMO) processing and recycling, and it
appears that the main function of the ESD4 in Arabidopsis is SUMO recycling (Murtas et
al., 2003). SUMOylation of a protein may regulate its localization, activity or stability
(Melchior, 2000; Muller et al., 2001). Intriguingly, SUMOylation was also shown to be a
type of histone modification, and possibly a part of the ‘histone code’ (Shiio and
Eisenman, 2003), raising the possibility that ESD4 might also be involved in chromatin
dynamics.

Being homologous to the ISWI and SWI2/SNF2 class of proteins, PIE] is
probably involved in modifying chromatin structures (Noh and Amasino, 2003). In
Drosophila, some proteins of this family (e.g., brahma and zeste) were characterized as
Trithorax group (TrxG) proteins, which keep homeotic genes actively expressed, in an
opposite manner to the PcG proteins (Kennison, 1995). Thus, hypothetically, PIEl may
participate in a TrxG like protein complex to activate FLC by changing chromatin

structures (Noh and Amasino, 2003).

26

VERNALIZATION IN CROPS

Many varieties of crop plants also show a vemalization response (Table 2), and
the molecular basis of vemalization has also been studied in some of these crop plants. It
has been suggested that the FLC-mediated vemalization mechanism might be conserved
within the Brassica species. Overexpressing a Brassica napus FLC orthologue in
Arabidopsis delayed flowering, and vernalizing cold dramatically reduced the level of
BnFLC transcripts in winter-annual B. napus cultivars (Tadege et al., 2001). Furthermore,
the FLC-activating system involving VIPs might also be conserved, because proteins
immunoreactive to VIP3, VIP4 and VIP6 antibodies were found to be present in Brassica
oleracea (Cauliflower) (Chapter 4, Figure 5).

Although vemalization might act through an FLC-like mechanism in Brassica
species, no clear homologues of FLC are present in cereals (Henderson et al., 2003),
suggesting that vemalization operates through a different mechanism in cereal plants.
Genetic studies indicated that, in wheat, the vemalization response is determined by the
VRNI and VRN2 loci. Although bearing the same names as the Arabidopsis VRNI and
VRN2, the wheat VRNI and VRN2 do not have any relationship with the Arabidopsis ones
(see below; and unless it is pointed out, the VRNI and VRN2 refer to the wheat VRNI and
VRN2 genes/loci in this section). Dominant alleles of VRNI confer a spring annual
growth habit, whereas dominant alleles of VRN2 confer a winter-annual growth habit

(Dubcovsky et al., 1998). Genetic studies showed that the dominant VRNI allele is

27

Table 2. Major field crops with vemalization response*.

 

Species

Common name

 

Allium cepa

Avena sativa

Beta vulgaris
Brassica napus
Brassica oleracea
C icer arietinum
Dactylis glomerata
Daucus carota
Hordeum vulgare
Lactuca sativa
Lens culinaris
Linum usitatissimum
Lolium perenne
Papaver somniferum
Pisum sativum
Raphanus sativus
Secale cereale
Spinacia oleracea
T rifolium repens

T riticum aestivum
Vicia taba

Onion
Oat

Beet

Rape
Cauliflower
Chickpea
Cocksfoot
Carrot
Barley
Lettuce
Lentil
Flax
Ryegrass
P0ppy
Pea
Radish
Rye
Spinach
White clover
Wheat
Faba bean

 

* This table is a re-edited version of TABLE 1 from Henderson et al., (2003).

epistatic to the dominant VRN2 allele, the dominant VRN2 allele is epistatic to the
recessive vrnI allele, and the recessive vrn2 allele is epistatic to the recessive vrnI allele
(Tranquilli and Dubcovsky, 2000). This is consistent with a model whereby VRN2 acts
upstream of VRNI .

Both VRNI and VRN2 have recently been identified by a positional cloning
approach. VRNI encodes a MADS-box protein homologous to the Arabidopsis
APETALAl (APl) protein, which is involved in determining floral meristem identity
(Yan et al., 2003; Liljegren et al., 1999). In wheat cultivars with a winter-annual growth
habit, the VRNI transcripts were not detectable until after vernalizing cold; while in an
accession that does not require vemalization, VRNI was expressed independently of cold
treatment (Y an et al., 2003). Sequence analysis showed that in spring accessions, there is
a 20bp deletion in the VRNI promoter region, presumably abrogating the binding of a
transacting repressor (Y an et al., 2003; 2004).

Expression profiling showed that VRN2 mRNA was down-regulated by
vernalizing cold, with a kinetics opposite to that of VRNI (Yan et al., 2004), suggesting
that VRN2 may act as a flowering repressor. VRN2 encodes a protein similar to
Arabidopsis CONSTANS (CO) and CO-like proteins (Yan et al., 2004). These
Arabidopsis proteins, all containing a CO, CO-like, and TOCl (CCT) domain, were
shown to be involved in a flowering mechanism responding to inductive photoperiod
(Putterill et al., 1995). The CCT domain was proposed to mediate protein-protein

interactions (Kurup et al., 2000). A survey of a large collection of wheat accessions with

29

winter or spring grth habit suggested that, besides the deletion in the VRNI promoter,
mutation in the VRN2 CCT domain or a complete deletion of the VRN2 gene from the

genome are other determinants for the spring growth habit in wheat (Yan et al., 2004).

CONCLUSIONS

The identification of FLC created a boost for understanding the molecular basis of
vemalization. More and more results support the hypothesis that, in Arabidopsis, a
mechanism involving histone modifications participates in the epigenetic silencing of
FLC during vemalization. There are still many questions that need to be answered.
What is the upstream receptor that perceives the vernalizing cold signal? Is this receptor
common for other cold related processes, for example, acclimation? What are the
factor(s), if any, that operate between FLC and its activators or repressors? How are the
FLC activation mechanisms counteracted by vemalization? How is the epigenetic
silencing of FLC reset for the next generation? As seen above, results from wheat studies
suggest that plants have "chosen" different proteins to regulate the vemalization response;
is the epigenetic silencing system in wheat different from that seen in Arabidopsis?
Continuing work on these two representative systems will hopefully answer these

questions.

30

References

Ausin, I., Alonso-Blanco, C., Jarillo, J .A., Ruiz—Garcia, L., and Martinez-Zapater, J .M.

(2004) Regulation of flowering time by FVE, a retinoblastoma-associated protein.
Nat. Genet. 36: 162-166.

Bastow, R., Mylne, J .S., Lister, C., Lippman, Z., Martienssen, R.A., and Dean, C. (2004)
Vemalization requires epigenetic silencing of FLC by histone methylation. Nature
427: 164-167.

Bezerra, I.C., Michaels, S.D., Schomburg, F .M., and Amasino, RM. (2004) Lesions in
the mRNA cap-binding gene ABA H YPERSENSIT I VE I suppress FRIGIDA-
mediated delayed flowering in Arabidopsis. Plant J. 40: 112-119.

Blazquez, M.A., Ahn, J .H., and Weigel, D. (2003) A therrnosensory pathway controlling
flowering time in Arabidopsis thaliana. Nat. Genet. 33: 168-171.

Burn, J .E., Smyth, D.R., Peacock, W.J., and Dennis ES. (1993a) Genes confen‘ing late
flowering in Arabidopsis thaliana. Genetica 90: 145-157.

Burn, J.H., Bagnall, D.J., Metzger, J .D., Dennis, ES, and Peacock, W.J. (1993b) DNA
methylation, vemalization, and the initiation of flowering. Proc. Natl. Acad. Sci.
USA 90: 287-291.

Chandler, J ., Wilson, A., and Dean, C. (1996) Arabidopsis mutants showing an altered
response to vemalization. Plant J. 10: 637-644.

Chandler, J., Martinez-Zapater, J .M., and Dean, C. (2000) Mutations causing defects in
the biosynthesis and response to gibberellins, abscisic acid and phytochrome B do
not inhibit vemalization in Arabidopsisfca-I. Planta 210: 677-682.

Chroboczek, E. (1934) Study of some ecological factors influencing seed-stalk
development in beets (Beta vulgaris). Cornell Agric. Exp. Stat. Mem. No. 154.

Curtis, CF. and Chang, HT. (1930) The relative effectiveness of the temperature of the
crown as contrasted with that of the rest of the plant upon the flowering of celery
plants. Amer. J. Bot. 17: 1047-1048.

Dubcovsky, J., Lijavetzky, D., Appendino, L., and Tranquilli, G. (1998) Comparative

RFLP mapping of Triticum monococcum genes controlling vemalization
requirement. Theor. Appl. Genet. 97: 968-975.

31

Finnegan, E.J., Genger, R.G., Kovac, K., Peacock, W.J., and Dennis, ES. (1998)
Methylation controls the low-temperature induction of flowering in Arabidopsis.
Proc. Natl. Acad. Sci. USA 95: 5824-5829.

F ischle, W., Wang, Y., and Allis, CD. (2003) Binary switches and modification cassettes
in histone biology and beyond. Nature 425: 475-479.

Gendall, A.R., Levy, Y.Y, Wilson, A., and Dean, C. (2001) The VERNALIZA T ION2 gene
mediates the epigenetic regulation of vemalization in Arabidopsis. Cell 107: 525-
535.

He, Y., Michaels, 8., and Amasino, R. (2003) Regulation of flowering time by histone
acetylation in Arabidopsis. Science 302: 1751-1754.

Henderson, l.R., Shindo, C., and Dean, C. (2003) The need for winter in the switch to
flowering. Annu. Rev. Genet. 37: 371-392.

Ishitani, M., Xiong, L., Lee, H., Stevenson, B., and Zhu, J .K. (1998) HOS], a genetic
locus involved in cold-responsive gene expression in arabidopsis. Plant Cell 10:
1151-1161.

Jaglo-Ottosen, K. R., Gilmour, S. J ., Zarka, D. G., Schabenberger, O., and Thomashow M.
F. (1998) Arabidopsis CBF] overexpression induces COR genes and enhances
freezing tolerance. Science 280: 104-106.

Jenuwein, T. and Allis, CD. (2001) Translating the histone code. Science 293: 1074-
1080.

Johanson, U., West, J ., Lister, C., Michaels, 8., Amasino, R., and Dean, C. (2000)
Molecular analysis of FRIGIDA, a major determinant of natural variation in
Arabidopsis flowering time. Science 290: 344-347.

Kaya, H., Shibahara, K., Taoka, K., Iwabuchi, M., Stillman, B., and Araki, T. (2001)
FASCIA TA genes for chromatin assembly factor-1 in Arabidopsis maintain the
cellular organization of apical meristems. Cell 104: 131-142.

Kim, H.J., Hyun, Y., Park, J.Y., Park, M.J., Park, M.K., Kim, M.D., Kim, H.J., Lee, M.H.,

Moon, J ., Lee, I., and Kim, J. (2004) A genetic link between cold responses and
flowering time through FVE in Arabidopsis thaliana. Nat. Genet. 36: 167-171.

32

Kohler, C., Hennig, L., Bouveret, R., Gheyselinck, J., Grossniklaus, U., and Gruissem, W.
(2003) Arabidopsis MSIl is a component of the MBA/FIE polycomb group
complex and required for seed development. EMBO J. 22: 4804-4814.

Koomneef, M., Hanhart, C.J., and Van Der Veen, J .H. (1991) A genetic and
physiological analysis of late flowering mutants in Arabidopsis thaliana. Mol.
Gen. Genet. 229: 57-66.

Koomneef, M., Blankestijn-de Vries, H., Hanhart, C., Soppe,W., and Peeters, T. (1994)
The phenotype of some late-flowering mutants is enhanced by a locus on
chromosome 5 that is not effective in the Landsberg erecta wild-type. Plant J. 6:
911-919.

Koomneef, M., Alonso-Blanco, C., Blankestijn-de Vries, H., Hanhart, C.J., and Peeters,
A.J.M. (1998) Genetic interactions among late-flowering mutants of Arabidopsis.
Genetics 148: 885-892.

Kurup, S., Jones, H.D., and Holdsworth, MJ. (2000) Interactions of the developmental
regulator ABI3 with proteins identified from developing Arabidopsis seeds. Plant
J. 21: 143-155.

Kuzmichev, A., Nishioka, K., Erdjument-Bromage, H., Tempst, P., and Reinberg, D.
(2002). Histone methyltransferase activity associated with a human multiprotein
complex containing the Enhancer of Zeste protein. Genes Dev. 16: 2893-2905.

Lang, A. (1957) The effect of gibberellin on flower formation. Proc. Natl. Acad. Sci.
USA. 43: 709-717.

Lang, A. (1965) Physiology of flower initiation. In Encyclopedia of Plant Physiology (ed.
W. Ruhland), pp. 1371-1536. Springer-Verlag, Berlin.

Lee, H., Suh, S.S., Park, E., Cho, E., Ahn, J.H., Kim, S.G., Lee, J.S., Kwon, Y.M., and
Lee, I. (2000) The AGAMOUS-LIKE 2O MADS domain protein integrates floral
inductive pathways in Arabidopsis. Genes Dev. 14: 2366-2376.

Lee, H., Xiong, L., Gong, Z., Ishitani, M., Stevenson, B., and Zhu, J-K (2001) The
Arabidopsis HOS] gene negatively regulates cold signal transduction and encodes
a RING finger protein that displays cold-regulated nucleo-cytoplasmic
partitioning. Genes Dev. 15(7): 912-924.

33

Lee, I., Bleecker, A., and Amasino, RM. (1993) Analysis of naturally occurring late
flowering in Arabidopsis thaliana. Mol. General Genet. 237: 171-176.

Lee, I., Aukerrnan, M.J., Gore, S.L., Lohman, K.N., Michaels, S.D., Weaver, L.M., John,
M.C., Feldmann, K.A., and Amasino, R.M. (1994a) Isolation of
LUMINIDEPENDENS: A gene involved in the control of flowering time in
Arabidopsis. Plant Cell 6: 75-83.

Lee, I., Michaels D.D., Masshardt AS, and Amasino, R.M. (1994b) The late-flowering
phenotype of FRIGIDA and mutations in LUMINIDEPENDENS is suppressed in
the Landsberg erecta strain of Arabidopsis. Plant J. 6: 903-909.

Levy, Y.Y., Mesnage, S., Mylne, J .S., Gendall, AR. and Dean, C. (2002) Multiple Roles
of Arabidopsis VRN] in Vernalization and Flowering Time Control. Science 297:
243-246.

Liljegren SJ, Gustafson-Brown C, Pinyopich A, Ditta GS, Yanofsky MF. (1999)
Interactions among APETALA], LEAFY, and TERMINALFLOWER] specify
meristem fate. Plant Cell 11: 1007-1018.

Lim, M.H., Kim, J., Kim, Y.S., Chung, K.S., Seo, Y.H., Lee, 1., Kim, J., Hong, C.B., Kim,
H.J., and Park, CM. (2004) A new Arabidopsis gene, FLK, encodes an RNA

binding protein with K homology motifs and regulates flowering time via
FLOWERING LOCUS C. Plant Cell 16: 731-740.

Liu, J ., Gilmour, S.J., Thomashow, ME, and van Nocker, S. (2002) Cold signalling
associated with vemalization in Arabidopsis thaliana does not involve CBF] or
abscisic acid. Physiol. Plant. 114: 125-134.

Macknight, R., Bancroft, I., Page, T., Lister, C., Schmidt, R., Love, K., Westphal, L.,
Murphy, G., Sherson, S., Cobbett, C., and Dean, C. (1997) F CA, a gene
controlling flowering time in Arabidopsis, encodes a protein containing RNA-
binding motifs. Cell 89: 737-745.

Martinez-Zapater, J .M. and Somerville, CR. (1990) Effect of light quality and
vemalization on late-flowering mutants of Arabidopsis thaliana. Plant Physiol. 92:

770-776.

Melchior, F. (2000). SUMO: Nonclassical ubiquitin. Annu. Rev. Cell Dev. Biol. 16: 591-
626.

34

Michaels, SD. and Amasino, R.M. (1999a) The gibberellic acid biosynthesis mutant gal-
3 of Arabidopsis thaliana is responsive to vemalization. Dev. Genet. 25: 194-198.

Michaels, SD. and Amasino, R.M. (1999b) FLO WERING LOCUS C encodes a novel
MADS domain protein that acts as a repressor of flowering. Plant Cell 1 1: 949-
956.

Michaels, SD. and Amasino, RM. (2000) Memories of winter: vemalization and the
competence to flower. Plant Cell Environ. 23: 1145-1153.

Michaels, SD. and Amasino, RM. (2001) Loss of FLOWERING LOCUS C Activity
Eliminates the Late-F lowering Phenotype of FRIGIDA and Autonomous Pathway
Mutations but Not Responsiveness to Vernalization. The Plant Cell 13: 935-941.

Michaels S.D., He, Y., Scortecci, K.C., Amasino, RM. (2003) Attenuation of
FLOWERING LOCUS C activity as a mechanism for the evolution of summer-
annual flowering behavior in Arabidopsis. Proc Natl Acad Sci USA. 100: 10102-
10107.

Michaels, S.D., Bezerra, LC, and Amasino, RM. (2004) FRIGIDA-related genes are
required for the winter-annual habit in Arabidopsis. Proc Natl Acad Sci USA.
101: 3281-3285.

Mueller, CL. and Jaehning, J .A. (2002) Ctr9, Rtfl, and Leo] Are Components of the
Pafl/RNA Polymerase II Complex. Mol. Cell. Biol. 22: 1971-1980.

Muller, S., Hoege, C., Pyrowolakis, G., and Jentsch, S. (2001). SUMO, ubiquitin’s
mysterious cousin. Nat. Rev. Mol. Cell Biol. 2: 202-210.

Muller, J., Hart, C.M., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L.,
O'Connor, M.B., Kingston, RE, and Simon, J .A. (2002). Histone

methyltransferase activity of a Drosophila Polycomb group repressor complex.
Cell 111: 197-208.

Murtas, G., Reeves, P.H., Fu, Y.F., Bancroft, 1., Dean, C., and Coupland, G. (2003) A
nuclear protease required for flowering-time regulation in Arabidopsis reduces the
abundance of SMALL UBIQUITlN-RELATED MODIFIER conjugates. Plant
Cell 15: 2308-2319.

35

Ng, H.H., Dole, S., and Struhl, K. (2003a). The Rtfl component of the Pafl
transcriptional elongation complex is required for ubiquitination of histone H2B. J.
Biol. Chem. 278: 33625-33628.

Ng, H.H., Robert, R, Young, R.A., and Struhl, K. (2003b). Targeted recruitment of Set]
histone methylase by elongating PolII provides a localized mark and memory of
recent transcriptional activity. Mol. Cell 11: 709-719.

Nicolas, E., Morales, V., Magnaghi-Jaulin, L., Harel-Bellan, A., Richard-Foy, H., and
Trouche, D. (2000) RbAp48 belongs to the histone deacetylase complex that
associates with the retinoblastoma protein. J Biol Chem. 275: 9797-9804.

Noh, Y.S., and Amasino, RM. (2003). PIE 1 , an ISWI family gene, is required for FLC
activation and floral repression in Arabidopsis. Plant Cell 15: 1671-1682.

Oh, S., Zhang, H., Ludwig, P., and van Nocker, S. (2004) A mechanism related to the
yeast transcriptional regulator PaflC is required for expression of the Arabidopsis
FLC/MAF MADS-box gene family. Plant Cell 16: 2940-2953.

Pirrotta, V. (1997) PcG complexes and chromatin silencing. Curr. Opin. Genet. Dev. 7:
249-258.

Putterill, J ., Robson, F ., Lee, K., Simon, R., and Coupland, G. (1995) The CONSTANS
gene of Arabidopsis promotes flowering and encodes a protein showing
similarities to zinc finger transcription factors. Cell 80: 847-858.

Ratcliffe, O.J., Kumimoto, R.W., Wong, 3.1., and Riechmann, J.L. (2003). Analysis of
the Arabidopsis MADS AFFECTING FLOWERING gene family: MAF 2 prevents
vemalization by short periods of cold. Plant Cell 15: 1159-1169.

Ratcliffe, O.J., Nadzan, G.C., Reuber, T.L., and Riechmann, J .L. (2001). Regulation of
flowering in Arabidopsis by an FLC homologue. Plant Physiol. 126: 122-132.

Reeves, P.H., Murtas, G., Dash, S., and Coupland, G. (2002) early in short days 4, a
mutation in Arabidopsis that causes early flowering and reduces the mRNA
abundance of the floral repressor FLC. Development 129: 5349-5361.

Samach, A., Onouchi, H., Gold, S.E., Ditta, G.S., Schwarz-Sommer, Z., Yanofsky, M.F.,

and Coupland, G. (2000) Distinct roles of CONSTANS target genes in
reproductive development of Arabidopsis. Science 288: 1613-1616.

36

Schomburg, F .M., Patton, D.A., Meinke, D.W., and Amasino, RM. (2001) FPA, a gene
involved in floral induction in Arabidopsis, encodes a protein containing RNA-
recognition motifs. Plant Cell 13: 1427-1436.

Schultz, D.C., Ayyanathan, K., Negorev, D., Maul, G.G., and Rauscher, F.J. 3rd. (2002)
SETDB l: a novel KAP-l-associated histone H3, lysine 9-specific
methyltransferase that contributes to HPl-mediated silencing of euchromatic
genes by KRAB zinc-finger proteins. Genes Dev. 16: 919-932.

Schwabe, W.W. (1954) Factors controlling flowering in the Chrysanthemum. IV. The site
of vemalization and translocation of the stimulus. J. Exp. Bot. 5: 389-400.

Scortecci KC, Michaels SD, Amasino RM. (2001) Identification of a MADS-box gene,
FLO WERING LOCUS M, that represses flowering. Plant J. 26:229-36.

Sheldon, C.C., Burn, J.E., Perez, P.P., Metzger, J ., Edwards, J .A., Peacock, W.J., and
Dennis, ES. (1999) The FLF MADS box gene: a repressor of flowering in
Arabidopsis regulated by vemalization and methylation. Plant Cell 1]: 445-458.

Shiio, Y., and Eisenman, RN. (2003) Histone sumoylation is associated with
transcriptional repression. Proc. Natl. Acad. Sci. USA. 100: 13225-13230.

Simpson, G.G., Dijkwel, P.P., Quesada, V., Henderson, 1., and Dean, C. (2003) FY is an
RNA 3' end-processing factor that interacts with F CA to control the Arabidopsis
floral transition. Cell 113: 777-787.

Suge, H. (1970) Changes of endogenous gibberellins in vemalized radish plants. Plant
Cell Physiol. 11: 729-735.

Sun, T.P., Goodman, H.M., and Ausubel, RM. (1992) Cloning the Arabidopsis GA]
locus by genomic subtraction. Plant Cell 4: 119-128.

Sung, S., and Amasino, R.M. (2004a) Vernalization in Arabidopsis thaliana is mediated
by the PHD finger protein VIN3. Nature 427: 159-164.

Sung, S., and Amasino, R.M. (2004b) Vernalization and epigenetics: how plants
remember winter. Curr. Opin. Plant Biol. 7: 4-10.

Svejstrup, J O. (2004) The RNA polymerase II transcription cycle: cycling through
chromatin. Biochim. Biophys. Acta. 1677: 64-73.

37

Tadege, M., Sheldon, C.C., Helliwell, C.A., Stoutjesdijk, P., Dennis, ES, and Peacock,
W.J. (2001) Control of flowering time by FLC orthologues in Brassica napus.
Plant J. 28: 545-553.

Thomashow, M.F. (1999) Plant cold acclimation: Freezing tolerance genes and
regulatory mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50: 571-599.

Thomashow, M.F. (2001) So what's new in the field of plant cold acclimation? Lots!
Plant Physiol. 125: 89-93.

Tranquilli, G., and Dubcovsky, J. (2000) Epistatic interaction between vemalization
genes Vrn-A'"! and Vrn-AmZ in diploid wheat. J Hered. 91: 304-306.

Wellensiek, SJ. (1962) Dividing cells as the locus for vemalization. Nature 195: 307-308.

Wellensiek, SJ. (1964) Dividing cells as the prerequisite for vemalization. Plant Physiol.
39: 832-835.

Yan, L., Loukoianov, A., Blechl, A., Tranquilli, G., Ramakrishna, W., SanMiguel, P.,
Bennetzen, J .L., Echenique, V., and Dubcovsky, J. (2004) The wheat VRN2 gene
is a flowering repressor down-regulated by vemalization. Science 303: 1640-1644.

Yan, L., Loukoianov, A., Tranquilli, G., Helguera, M., Fahima, T., and Dubcovsky, J.
(2003) Positional cloning of the wheat vemalization gene VRN] . Proc. Natl. Acad.
Sci. USA. 100: 6263-6268.

Zeevaart, J .A.D. (1983) Gibberellins and flowering. In: Crozier A, editor. The
biochemistry and physiology of gibberellins. Vol 2. New York: Praeger. p 333-
374.

Zhang, H. and van Nocker, S. (2002) The VERNALIZA TION INDEPENDENCE4 gene
encodes a novel regulator of FLOWERING LOCUS C. Plant J 31: 663-673.

Zhang, H., Ransom, C., Ludwig, P., and van Nocker, S. (2003) Genetic analysis of early-
flowering mutants in Arabidopsis defines a class of pleiotropic developmental
regulator required for activity of the flowering-time switch FLO WERING LOCUS
C. Genetics 164: 347-358.

38

Chapter 2

The VERNALIZA T ION INDEPENDENCE4 gene encodes a novel regulator of
FLOWERING LOCUS C

This chapter is a re-edited version of my publication Zhang, H. and van Nocker, S. (2002)
Plant J. 31: 663-673.

39

Abstract

The late-flowering, vemalization-responsive habit of many Arabidopsis ecotypes is
mediated predominantly through repression of the floral programme by the FLO WERING
LOCUS C (FLC) gene. To better understand this repressive mechanism, we have taken a
genetic approach to identify novel genes that positively regulate FLC expression. We
identified recessive mutations in a gene designated VERNALIZA T ION INDEPENDENCE
4 (VIP4), that confer early flowering and loss of FLC expression in the absence of cold.
We cloned the VIP4 gene and found that it encodes a highly hydrophilic protein with
similarity to proteins from yeasts, Drosophila, and Caenorhabditis elegans. Consistent
with a proposed role as a direct activator of F LC, VIP4 is expressed throughout the plant
in a pattern similar to that of FLC. However, unlike FLC, VIP4 RNA expression is not
down-regulated in vemalized plants, suggesting that VIP4 is probably not sufficient to
activate FLC, and that VIP4 is probably not directly involved in a vemalization
mechanism. Epistasis analysis suggests that VIP4 could act in a separate pathway from
previously identified FLC regulators, including F RIGIDA and the autonomous flowering
promotion pathway gene LUMINIDEPENDENS. Mutants lacking detectable VIP4
expression flower earlier than FLC null mutants, suggesting that VIP4 regulates
flowering-time genes in addition to FLC. F loral morphology is also disrupted in vip4

mutants; thus, VIP4 has multiple roles in development.

40

Introduction

In many plants, flowering is not initiated until after an extended period of growth
in the cold. In the natural environment, this mechanism allows flowering and seed
production to occur only after winter. In the many ecotypes of Arabidopsis thaliana that
exhibit this type of flowering habit, repression of flowering is mediated predominantly
through the activity of the MADS-box gene FLOWERING LOCUS C (FLC) (Koornneef
et al., 1994; Lee et al., 1994b; Michaels and Amasino, 1999; Sheldon et al., 1999). In
current models of flowering, the repressive mechanism involving FLC acts
antagonistically with promotive pathways associated with GA biosynthesis/sensitivity
and perception of inductive photoperiods (Simpson et al., 1999). The accelerated
flowering of plants treated with GAs, or grown in inductive photoperiods, is not
accompanied by greatly decreased FLC RNA expression (Michaels and Amasino, 1999;
Sheldon et al., 1999), and FLC does not appear to be developmentally regulated (Rouse
et al., 2002; Sheldon et al., 1999), indicating that flowering pathways are integrated
predominantly 'downstream' of FLC. However, both genetic and molecular experiments
have suggested that some 'crosstalk' occurs among pathways (Koornneef et al., 1998a;
Rouse et al., 2002), and thus these flowering mechanisms cannot be proposed to act

completely independently.

FLC is subject to both positive and negative regulation, and several flowering-
time genes are known that act as strong, 'upstream' regulators of FLC. For example, genes
in the so-called autonomous pathway, including LUMINIDEPENDENS (LD),

FLOWERING LOCUS D (FLD), FPA, F VE, FY, and F CA, act to repress FLC (Koornneef

41

et al., 1991, 1998a). This regulation occurs at least partly at the RNA level, as FLC RNA
is expressed to high levels in autonomous-pathway mutants relative to wild-type plants
(Michaels and Amasino, 1999; Sheldon et al., 1999). Several of the autonomous-pathway
genes have now been characterized at the molecular level. LD encodes a nuclear protein
containing a diverged homeodomain and an acidic carboxyl-terrninal region enriched in
glutamine residues (Aukerrnan and Amasino, 1996; Lee et al., 1994a; van Nocker et al.,
2000) suggesting that it could act as a transcriptional regulator. Two other autonomous-
pathway genes, F CA and FPA, encode proteins containing potential RNA-binding
domains (Macknight et al., 1997; Schomburg et al., 2001), suggesting that they function

in post-transcriptional control of expression.

The FRIGIDA (FRI) gene also regulates FLC RNA expression, but, in contrast to
the autonomous-pathway genes, acts in a promotive manner (Koornneef et al., 1998b;
Michaels and Amasino, 1999). The predicted FRI protein does not exhibit strong
homology with any other protein of known fiinction, but exhibits coiled-coil domains,
suggesting that it interacts with protein partner(s) (Johanson et al., 2000). Although it is
now clear that other positive regulators of F LC exist (below), only FRI has been
characterized, because allelic variation at FR] is a major determinant of the flowering
habit (i.e. annual versus winter-annual) among natural Arabidopsis ecotypes (Johanson et

al., 2000; Lee et al., 1993).

The mechanistic relationships among the autonomous-pathway genes, and
between these genes and FR], have not been well characterized. Koomneef et al. (1998a)

explored these relationships through genetic epistasis experiments. Mutations in FY did

42

not further enhance the late flowering conferred by loss of F CA function, suggesting that
the two genes have a close functional relationship. In contrast, mutations in two other
autonomous-pathway genes, FPA and F VE , greatly enhanced the lateness of fca and fit
mutants. These genetic interactions were subsequently found to be reflected at the level
of FLC RNA and protein expression, which were enhanced in fira/fca, fve/fca, and fve/sz
double mutants relative to the respective single mutants (Rouse et al., 2002). These
findings could indicate that FPA/FVE and F CA/F Y comprise two, partially redundant,
mechanisms of FLC repression. However, this type of analysis is contingent on mutations
creating a complete loss of function, and this has not yet been demonstrated for all of
these genes. Loss of FLC function completely suppresses the late-flowering phenotype
conferred either by FRI, or by loss of function at least of fve, ld,fpa, or fca (Michaels and
Amasino, 2001). Thus, F R] and these autonomous-pathway genes likely act in flowering
solely through mediation of FLC activity. The activation of FLC by FRI is epistatic to
repression of FLC by autonomous-pathway genes (Michaels and Amasino, 2000). This is
consistent with a mechanism whereby FRI limits the activity of the autonomous pathway,

possibly through the negative regulation of one or more components.

The flowering-promotive effect of cold, termed vemalization, is mediated largely
through repression of inhibitory FLC activity. This also occurs at the RNA level
(Michaels and Amasino, 1999; Sheldon et al., 1999), and probably at the transcriptional
level, as cold is not sufficient to overcome the repression of flowering associated with
constitutive expression of FLC in transgenic plants (Michaels and Amasino, 1999;
Sheldon et al., 1999). The molecular process(es) involved in vemalization-associated

down-regulation of FLC is completely unknown. However, it is not likely to directly

43

involve FRI or the autonomous-pathway genes; the evidence for this is that a long period
of cold is fully effective to abrogate the late flowering phenotype of mutants lacking
activities of both FRI and any of the known autonomous-pathway genes (Michaels and
Amasino, 2000). Although vemalization by nature should involve a temperature—sensitive
mechanism, no molecular components of such a mechanism have been definitively
identified. Moreover, although pathways of cold signalling in Arabidopsis are becoming
increasingly well characterized, the involvement of known cold-signalling components in
vemalization has generally not been explored. This is, at least in part, because most
studies of cold signalling have been carried out in 'lab strains' of Arabidopsis [e. g.
Columbia (Col), Landsberg erecta (Ler)] that, because they lack effective FRI and/or
FLC alleles, do not exhibit strong FLC activity and typically flower soon after
germination irrespective of cold (Johanson et al., 2000; Koomneef et al., 1994; Lee et al.,
1994b). The well-known CBF family of transcription factors, which act as molecular
'switches' to induce many elements of the cold acclimation response (Gilmour et al.,
2000), do not seem to be involved in vemalization. Constitutive expression of CBF] or
CBF 3 in a late-flowering genetic background containing active FRI and FLC alleles,
although sufficient to activate cold-responsive genes, did not greatly affect flowering

time or FLC expression (Liu et al., 2002; our unpublished results).

Once FLC is down-regulated in vemalized plants, repression is maintained
through an epigenetic mechanism involving the VRN2 gene (Gendall et al., 2001). The
cold-associated down-regulation of FLC is not greatly affected by loss of VRN2 function,
indicating that this gene probably is not important for initial suppression of FLC. VRN2

encodes a protein with sequence similarity to a member of the Polycomb-group protein

44

class, which has been best characterized in Drosophila. These proteins are components of
large complexes that reinforce the transcriptionally suppressed state of homeotic genes,
potentially by packaging and/or maintaining chromatin in states less accessible to
transcriptional machinery (Pirrotta, 1997). Similarly, it is likely that VRN2 functions in
some way to reduce accessibility of the FLC gene, as FLC chromatin in vrn2 mutants
exhibits increased DNase sensitivity relative to that of wild-type plants, following cold
treatment (Gendall et al., 200]). That chromatin structure is intimately involved in
flowering and vemalization, was previously shown by the strong effect on flowering
conferred by disruption of processes tied to chromatin dynamics, including DNA
methylation (Finnegan et al., 1996; Finnegan, 1998; Ronemus et al., 1996) and histone
deacetylation (Tian and Chen, 2001), especially in genotypes with a winter-annual
flowering habit (Burn et al., 1993). Transgenic plants in which endogenous DNA
methylation was disrupted exhibited decreased FLC expression in the absence of a
vernalizing cold treatment (Sheldon et al., 1999), indicating that appropriate chromatin
structure is crucial for the maintenance of FLC expression in non-vemalized plants, as

well as its suppression in vemalized plants.

As a first step to characterize the mechanism of flowering repression involving
FLC, and how this mechanism is negatively regulated by cold, we carried out a genetic
screen designed to identify positive regulators of FLC. Here we present the genetic and
molecular analyses of one of these regulators, designated VERNALIZA T ION

INDEPENDENCE 4 .

45

Material and Methods:

Plant material and growth conditions

Introgression line ColeRISF2 consists of the FR] locus from ecotype San F e1iu-2
(FRISFZ) introgressed into the Columbia (Col) ecotype through six successive

backcrosses and made homozygous by self-pollination (Lee et al., 1994b). Line FN231

contains a fast-neutronflc allele isolated in the ColeRISF2 background, and is identical

with flc—I described by Michaels and Amasino (1999). Line FN235, containing a fast-

neutron fri allele isolated in the ColeRISFZ background, is as described by Michaels and
Amasino (1999). The ld-I mutant in the Col background was obtained from the
Arabidopsis Biological Resource Center (ABRC) at The Ohio State University. Standard

2 1

growth conditions were 22 0C under 100-180 umol-m' -sec' of cool white fluorescent
lighting and 16-h light/8-h dark (long-day) or 8-h light/ 16-h dark (short—day)
photoperiods. For vernalizing cold treatments, seeds were surface-sterilized, placed on
agar-solidified germination medium as described by van Nocker et a]. (2000), and grown
at 4 °C under SD photoperiods. To evaluate flowering time, plants were grown

individually in 5.7 X 5.7 X 7.5 cm pots. Plant transformations used the floral dip method

of Clough and Bent (1998) and Agrobacterium strain ABI.
Mutagenesis and screening

For T-DNA mutagenesis, a binary vector designated pPZP201zBAR, containing a

5' mannopine synthase/glufosinate resistance/3' octopine synthase cassette cloned into the

SmaI site of pPZP201 (Hajdukiewicz et al., 1994), was introduced into ColeRISF2

46

plants. Seeds from infiltrated plants (Tl seeds) were subjected to a vernalizing cold
treatment, transferred to soil for further growth, and herbicide-resistant T1 plants were
allowed to self-pollinate and set seed. Seeds from approximately 500 T1 plants were
pooled. Approximately 5000 T2 plants from each pool were screened for early flowering
in the absence of cold. F ast-neutron mutagenesis and screening were described by
Michaels and Amasino (1999). FLC RNA expression was evaluated in approximately 14-
day-old progeny (T3 or M3) plants grown without a cold treatment in SD conditions. To
test for genetic complementation of the flc or fit mutations, T3 or M3 individuals were

crossed with lines FN231 and FN235, and flowering time was evaluated in F1 progeny.

Molecular techniques

DNA was isolated essentially as described by Murray and Thompson (1980);
RNA was isolated as described by Liu et al. (2002). DNA and RNA gel-blot analyses
were carried out as described by Liu et al. (2002). The probe for gel-blot analyses of
VIP4 was a 432-bp fragment amplified from genomic DNA using primers CVN4-F1
(5'..ATGGACGAAAGGAGAGTGAAAG..3') and CVN4-Rl (5'..GGAATCAGAATAT
GAGACGGAAG..3'); the probe for gel-blot analysis of FLC was a 510-bp RT-PCR
product corresponding to FLC coding region but excluding the conserved MADS-
domain. This segment of the FLC gene does not exhibit significant sequence homology
with any other Arabidopsis gene. For inverse-PCR, 200 ng of restriction endonuclease-
digested genomic DNA was purified using the QIAquick PCR Purification Kit
(QIAGEN, Valencia, CA, USA), and subsequently incubated with 10 11 T4 DNA ligase

(Roche, Indianapolis, IN, USA) in a final reaction volume of 30 u] at 16 °C overnight.

47

DNA was amplified directly from 2 ul of the ligation mixture using Advantage cDNA

Polymerase Mix (Clontech, Palo Alto, CA, USA).

For identification of VIP4 cDNAs, shoot apex cDNA libraries were constructed.

Vernalized and non-vemalized ColeRISF2 plants were grown under SD conditions, and
when plants had formed 20-25 rosette leaves, 1-2 mm-thick sections containing the shoot
apex were excised. Library construction utilized the ZAP Express XR system

(Stratagene, La Jolla, CA, USA). Library A contained approximately 1.5-8.0 kbp cDNAs
and had a primary titre of 6.25 X 106 recombinants; library B contained approximately

0.5-3.0 kbp cDNAs and had a primary titre of 4.25 X 106 recombinants.
Construction of transgenic Arabidopsis lines

For molecular complementation analysis, the bacteriophage Pl clone MAF19 was
obtained from the Kazusa DNA Research Institute (Y ana, Kisarazu, Chiba, Japan),
amplified in E. coli, purified using the Qiagen Plasmid Midi Kit, and subjected to
restriction with Nsil. An approximate 7.1 kb fragment containing the VIP4 transcriptional
unit and adjacent intergenic regions was cloned into the PM site of binary vector PZP212
(Hajdukiewicz et al., 1994), and introduced into the vip4-I mutant background. For
antisense expression and constitutive expression, a DNA segment containing the VIP4
transcribed region was amplified by PCR using primers CVN4-F1 and CVN4-R2
(5'..AGGCAAACACAAGCTCACTATC..3'), and cloned into the BamHI site of binary
vector pPZP201:BAR:3SS in reverse (for antisense expression) or forward (for

constitutive expression) orientations. The pPZP201:BAR:3SS plasmid was engineered by

48

inserting the cauliflower mosaic virus (CaMV) 355 promoter from plasmid pB1121

(Clontech) into the XbaI site of pPZP201 :BAR (above).
Results:
A genetic screen for activators of FLC

To identify potential activators of FLC, we mutagenized the winter-annual,

ColeRI SFZ (hereafter referred to as 'wild-type') genetic background and screened for
recessive mutations that conferred cold-independent, early flowering. Early flowering
lines were re-screened by assaying for reduced FLC RNA expression in seedlings, where
FLC RNA is typically easily detectable (below). To eliminate further consideration of
lines with mutations in the FLC and FR] genes, mutants were also used in genetic
complementation analysis with lines FN231 and FN235, carrying loss-of-function
mutations in the FLC and FR] genes, respectively. Early flowering lines that exhibited
reduced FLC RNA expression, and that were not likely to represent new alleles of FLC or
FRI, were sorted into allelic groups through complementation analysis. This strategy
resulted in the identification of several complementation groups representing mutants that
we designated vemalization independence (vip) mutants. The vip4 group, represented by
two T-DNA alleles and one fast-neutron allele, was selected for further study (Figure 1).
FLC expression was not detectable in plants carrying the T-DNA allele vip4-1, as
determined by gel-blot analysis of seedling RNAs, indicating that VIP4 is a strong

activator of FLC (Figure 1b).

49

Figure l. (a) Phenotype of the wild-type, ColeRI SFZ introgression line and a vip4
mutant.

(i) Wild-type plant grown in the absence of cold. Plant is 8-weeks-old and has produced
approximately 60 leaves.

(ii) Wild-type plant grown after a vernalizing cold treatment and flowering afier
approximately 3 weeks.

(iii) A vip4-1 mutant plant grown in the absence of cold, and flowering after
approximately 3 weeks.

(iv) Inflorescence from a vip4-I mutant plant. Morphologically abnormal flowers where
sepals fail to enclose the developing floral buds are indicated (arrows).

(b) Analysis of FLC RNA expression in wild-type (WT) and vip4 mutant plants. RNA
was extracted from aerial portions of l4-day-old, wild-type and vip4-1 seedlings and
analysed bygel blotting using an FLC probe as described in Experimental procedures.
The membrane was subsequently stripped and reprobed with an 188 rDNA probe to
indicate the integrity and relative quantity of total RNA in each lane.

50

f is“

‘1

 

51

To address the relationship between VIP4, FLC, and FR], we evaluated the effects
of a vernalizing cold treatment on the flowering response of vip4-1 relative to that of
wild-type,flc, and fit plants (Figure 2). Flowering time was measured from a
developmental perspective, as the total number of leaves produced on the primary stem.
When grown under inductive (long-day) photoperiods in the absence of cold, vip4
mutants flowered at approximately the same time as the flc and fri mutants, and
vemalized wild-type plants. However, significant differences were apparent when plants
were grown under non-inductive (short-day) photoperiods, where the promotive activity
of genes acting through perception of inductive photoperiods is expected to be
minimized. We found that flc mutants flowered earlier (23.9 i 4.4 leaves) than fri
mutants (44.1 :1: 1.2 leaves), suggesting that FLC retains a small degree of activity even in
the absence of FRI function, and this is in accordance with previous observations
(Michaels and Amasino, 2001). However, under these conditions, vip4-I plants flowered
even earlier (17.1 i 1.3 leaves) than flc plants. This indicates that VIP4 may also repress
flowering outside of its positive regulation of FLC. Also, similar to previous
observations, cold reduced the flowering time of flc mutants suggesting that vemalization
targets FLC-independent as well as FLC-dependent mechanisms (Michaels and Amasino,
2001). However, even vip4-I plants showed a slight acceleration of flowering in response
to cold, and vemalized wild-type plants flowered significantly earlier (10.7 :1: 0.9 leaves)
than did vip4-1 plants grown in the absence of cold (Figure 2). This suggests that, if vip4-

] is a null mutation, vemalization also involves a vip4-independent mechanism.

52

Figure 2. Flowering time of wild-type plants, vip4 mutants, and mutants lacking activity
of FRI or FLC.

Wild-type (WT) plants, vip4-I mutants, and the FN231 and FN235 mutants lacking
activity of FLC or FRI, respectively, were grown without a cold treatment (- cold), or
after a 70-day cold treatment (+ cold) under long-day (LD) or short-day (SD)
photoperiods, as described in Experimental procedures. 'Leaf number' indicates the total
number of rosette and cauline leaves produced. Data is the mean and standard deviation
for at least 12 plants. Wild-type plants grown in SD without cold did not flower during
the course of this experiment.

53

 

 

El LD, -co|d
LD, +cold
I SD, -co|d
SD, +cold

 

 

 

—q_q_

m w w
goons: HQ

flc

fri

vip4- 1

54

In addition to the flowering-time phenotype, vip4 plants exhibit defects in floral
morphology. Among these is a widening of medial sepals, such that sepals typically fail
to enclose the remainder of the floral bud in the latest stages of flora] development
(Figure la). Petals are narrower than in wild-type flowers, and occasionally are greatly
reduced in size. Stamens are often reduced in number to four or five. No defect in carpe]
morphology was apparent, and flowers are typically fully fertile. No additional

phenotypic defects were obvious in vip4 mutants.

Cloning and identification of the WP4 gene

Because segregation data indicated that the vip4-1 mutation might be due to T-
DNA integration, we recovered genomic DNA flanking the T-DNA by inverse-PCR and
found that the T-DNA was inserted into the transcribed region of a predicted gene near
the bottom of chromosome V, designated At5g61150 (Figure 3a). Subsequent
characterization of the At5g61150 region of vip4-2 and vip4-3 plants indicated the
presence in the transcribed region of a T-DNA for vip4-2, and a large genomic insertion,
originating from the top of chromosome V, for vip4-3 (Figure 3a). In vip4-1 plants,
RNAs hybridizing with an At5g61150 probe failed to accumulate to levels detectable by
gel blotting of total RNAs, whereas these RNAs were readily detectable in wild-type
plants (Figure 3b). The observed size of the transcript was approximately 2.4 kb,
consistent with the size derived from the annotation of the At5g61150 intron/exon

structure provided by the Arabidopsis Genome Initiative. This predicted structure was

55

Figure 3. (a ) Depiction of the region of chromosome V encompassing the VIP4 gene.

The direction of transcription for VIP4 and two adjacent genes is indicated by arrows.
Introns are shown as white boxes, whereas exons are shown as black (translated region)
or grey (untranslated region) boxes. Only the proximal portion of adjacent genes are
depicted; for these, intron/exon structure is shown as annotated by the Arabidopsis
Genome Initiative, and the extent of untranslated regions is based on EST sequences in
the GenBank/EMBL databases. The position of the inserted DNA for the vip4-I, vip4-2,
and vip4-3 alleles is indicated. A zig-zagged line in the 3' region of the VIP4 gene
indicates the probe used for RNA gel blot analyses (below). The NsiI sites delineating the
region used to complement the vip4-I mutation are indicated.

(b) Analysis of VIP4 RNA expression in wild-type (WT) and vip4 mutant plants.RNA
was extracted from aerial portions of l4-day-old, wild-type and vip4-1 seedlings and
analysed by gel blotting using a VIP4 probe as described in Experimental procedures.
The membrane was subsequently stripped and reprobed with an ]8S rDNA probe to
indicate the integrity and relative quantity of total RNA in each lane.

56

 

 

57

confirmed by isolation and sequencing of several cDNAs from libraries prepared from

Col:FRI SF2 shoot apices (data not shown).

To confirm that we had identified the VIP4 gene, we introduced the entire
At5g61150 transcriptional unit, plus immediately adjacent genomic regions, into the vip4-
] background, through A grobacterium-mediated transformation. Primary transformants
(T1 plants) were grown either in the absence of cold, or after a vernalizing cold
treatment. All of the 20 T1 plants recovered in both cases were phenotypically
indistinguishable from wild-type plants, producing at least 60 leaves before flowering in
the absence of cold, flowering very early when given a cold treatment, and exhibiting
normal floral morphology (Figure 4a, and data not shown). In non-vemalized progeny of
a representative Tl plant, both VIP4 and FLC RNAs were expressed to levels similar to
that seen in the wild-type plant (data not shown). As additional evidence that At5g61 15 0
is VIP4, we disrupted expression of the At5g61150 gene in wild-type plants through
antisense RNA expression. For this experiment, we engineered a transgene in which the
part of At5g61 ] 50 corresponding to the translated and 3' regions, including introns, was
expressed in 3' to 5' orientation from the 35S CaMV promoter. Approximately one-third
of the > 100 T1 plants recovered flowered very early in the absence of cold, and
produced flowers with a vip4-like phenotype (Figure 4a, and data not shown). Finally, in
transgenic plants engineered to express the At5g61150 transcribed region in the 5' to 3'
orientation from the 35S promoter (35S: VIP4; see below), early flowering, vip4-like
plants appeared with high frequency (approximately one-third of > 100 T1 plants) (Figure

4a). The vemalization-independent early flowering of the VIP4-antisense and 35S: VIP4

58

Figure 4. Molecular complementation of the vip4-1 mutation and manipulation of VIP4
expression in transgenic plants.

(a) (i, ii) Transgenic, vip4-I mutant plants carrying an introduced copy of the VIP4 gene,
grown without a cold treatment (i), or after a vernalizing cold treatment (ii). Plant shown
in (i) is 6-weeks-old and has produced approximately 45 leaves. (iii, iv) Transgenic, wild-
type plants expressing VIP4 antisense RNA (iii) or expressing the VIP4 gene from the
35S promoter (iv) grown without a cold treatment.

(b) Analysis of VIP4 and FLC RNA expression in wild-type and transgenic plants. VIP4
and FLC RNA expression was evaluated in wild—type (WT) plants, a representative, late-
flowering transgenic plant expressing the VIP4 gene from the 35S promoter

(35S: VIP4#5), and representative, early flowering transgenic plants expressing VIP4
antisense RNA (VIP4-AS#4) or expressing the VIP4 gene from the 35S promoter

(35S: VIP4#9). RNA was extracted from rosette leaves of non-vemalized plants grown in
LD photoperiods and analysed by gel blotting, using VIP4 and FLC probes. Blots were
subsequently stripped and reprobed with an 18S rDNA probe to indicate the integrity and
relative quantity of total RNA in each lane.

59

 

 

A
N
m

60

plants was presumably due to suppression of the endogenous VIP4 gene, as VIP4 RNA
did not accumulate to detectable levels in any of the several plants assayed (Figure 4b). In
addition, in contrast to non-transgenic, wild-type plants, FLC RNA was not detectable in
leaf tissues of these early flowering, VIP4-antisense and 35S: VIP4 plants (Figure 4b),
indicating that early flowering was mediated at least partly through loss of FLC

expression.

The VIP4 gene encodes a 633-residue, 72-kDa protein with a predicted pI of 4.4
(data not shown). Almost one-half of the residues are charged (Glu, Asp, His, Lys, Arg)
and thus the VIP4 protein is highly hydrophilic; this hydrophilicity is most apparent in
extensive amino-terminal and carboxyl-terrnina] regions (data not shown). The VIP4
protein does not exhibit any motif currently defined in the PROSITE Dictionary of
Protein Sites and Patterns. However, predominantly within its less hydrophilic central
domain, VIP4 exhibits sequence homology with the Leo] protein from Saccharomyces
cerevisiae, and other hydrophilic proteins of unknown function from Saccharomyces
pombe, C. elegans, and Drosophila (23-29% identity over 239-311-amino acid segments;
data not shown). VIP4 does not exhibit strong homology with any other protein predicted
to be encoded by the Arabidopsis genome, and proteins homologous to VIP4 have not

been reported from other plant species.

We used RNA gel blotting to analyze the general spatial expression pattern of
VIP4 in non-vemalized plants. We found that VIP4 was expressed throughout the plant,
with the potential exception of rosette leaves (Figure 5a). We subsequently used RT-PCR

to confirm that VIP4 was expressed in these tissues as well (data not shown). This

61

 

Figure 5. Analysis of VIP4 and FLC RNA expression in various organs and tissues of
wild-type plants, in non-vemalized and vemalized wild-type plants, and in various
genetic backgrounds.

(a) Expression in seedlings (SL), shoot apices (SA), rosette leaves (RL), cauline leaves
(CL), inflorescence apices (IA), flowers (F), stems (S), and roots (R) of non-vemalized
plants. In order to obtain reproductive tissues for analysis, plants were grown under long-
day (LD) photoperiods.

(b) Expression in aerial portions of 14-day-old seedlings grown without a cold treatment
(non-vemalized; NV), or after a 40-day cold treatment (vemalized; V) under short-day
(SD) photoperiods.

(c) Expression in aerial portions of 14-day-old Columbia (Col), wild-type ColeRISFZ
(WT) and Id-] (Colzld-I) seedlings grown without a cold treatment under short-day (SD)
photoperiods.RNAs were analysed by gel blotting using VIP4 and FLC probes. Blots
were subsequently stripped and reprobed with an ]8S rDNA probe to indicate the
integrity and relative quantity of total RNA in each lane.

62

expression pattern generally paralleled that of FLC, which was also expressed
ubiquitously, but at very low levels in the leaves (Figure 5a). A search of current
databases of expressed sequence tags (ESTs) resulted in the identification of a single EST
(BE527160) originating from developing seeds, indicating that VIP4 is expressed in seed

tissues as well.

To determine if the suppression of FLC RNA expression associated with
vemalization might be mediated through suppression of VIP4, we evaluated VIP4 RNA
expression in vemalized and non-vemalized seedlings. As shown in Figure 5b, VIP4
RNA was expressed to similar levels irrespective of the vemalization status. The
effectiveness of the cold treatment given to these plants was evident by the decrease of
FLC'RNA to non-detectable levels (Figure 5b). This suggests that VIP4 is insufficient to
activate FLC in vemalized plants, and that modulation of VIP4 RNA expression is

unlikely to be involved in the vemalization response.

Molecular analysis of VIP4 function

We further characterized the relationship between VIP4, FRI, and an autonomous-
pathway gene, LD, through analysis of molecular epistasis. As previously reported
(Michaels and Amasino, 1999), we did not detect FLC RNA expression in the Col

ecotype lacking activity of FR], but found that it was expressed to readily detectable

levels in the ColeRISF2 line, and in an ld mutant in the Col background, which lacks
activity of both FRI and LD (Figure So). In contrast, VIP4 RNA was expressed to similar

levels in all three genotypes (Figure 5c). That VIP4 RNA expression was similar between

63

Co] and ColeRI SF2 indicates that VIP4 is not likely to mediate the activation of FLC
expression by FRI. Likewise, that VIP4 expression was similar between an ld mutant and
its wild-type genetic background Col indicates that the de-repression of FLC conferred by

loss of LD function is also unlikely to be mediated through VIP4. We also found that FRI

RNA expression is similar between ColeRISF2 and the vip4 mutant (Figure 1, chapter
5), indicating that VIP4 probably does not activate FLC through regulating FRI

expression.

To help define the role of VIP4 and especially its relationship to FLC, we

evaluated the effects of enhanced expression of VIP4 in transgenic ColeRI SFZ plants.
Several plants expressing high levels of VIP4 RNA were identified from a 35S: VIP4 T1
population grown in the absence of cold (Figure 4b). This RNA was apparently processed
to the same extent as the endogenous VIP4 RNA, as evidenced by its co-migration with
the VIP4 transcript from wild-type plants (data not shown). These 355: VIP4 T] plants
were phenotypically similar to wild-type plants with respect to flowering time and floral
morphology (data not shown). Although VIP4 RNA accumulated to high levels in leaf
tissues of these plants, FLC RNA expression was not enhanced in leaves, relative to its
levels in wild-type plants (Figure 4b), suggesting that ectopic VIP4 activity was not

sufficient to activate FLC, even in the absence of vemalization.

Discussion

As a first step towards understanding the mechanism of FLC-mediated flowering

repression and its negative regulation by cold, we are taking a genetic approach to

64

identify components of floral-repressive mechanisms that act, at least partly, through
promotion of FLC expression. Although several genetic efforts have already been carried
out to identify regulators of flowering, these have mainly focused on recessive mutations
that delay flowering, and thus most of the genes identified are assumed to act in a
flowering-promotive capacity (Koornneef et al., 1991; Lee et al., 1994a; Redei, 1962).
Several genes that act as floral repressors have also been identified (see below), largely
through associated developmental pleiotropy, but these genes have been characterized
only in the common 'lab strains' or ecotypes of Arabidopsis that do not normally exhibit
strong FLC activity. Our use of a synthetic genetic background, containing an active FRI
locus from a natural, winter-annual ecotype, introgressed into the Col genotype (Lee et
al., 1994b), permits rigorous genetic analysis of FLC-associated repressive
mechanism(s), while simultaneously permitting full utilization of currently available

Arabidopsis genomics tools.

The genetic and molecular analysis of VIP4 demonstrates that it acts as a
repressor of flowering at least partly through its ability to strongly activate FLC. Our
current knowledge of flowering is consistent with FLC being regulated predominantly.
through at least two mechanisms or pathways (Michaels and Amasino, 1999). One
mechanism involves the autonomous-pathway genes, which repress FLC expression, and
FR], which acts antagonistically to the autonomous pathway (Simpson et al., 1999),
possibly by limiting the activity of one or more components. At least a second
mechanism must be proposed to promote FLC expression, based on the observation that,
in plants lacking activity of the autonomous pathway, FLC is strongly expressed even in

the absence of FR]. Because FLC expression is repressed by cold even in the absence of

65

FRI and/or autonomous pathway function, vemalization likely acts to limit the activity of

this second mechanism.

VIP4 could be hypothesized to occupy any of a number of positions with respect
to these pathways. VIP4 RNA levels were not affected by loss of function of FR] or LD,
indicating that, if VIP4 mediates activation of FLC by FRI and/or de-repression of FLC
by loss of LD activity, such a mechanism would have to involve changes in VIP4 protein
activity, or changes in RNA levels within restricted tissues. Our observation that vip4
mutants flower much earlier than fri null mutants also suggests that VIP4 does not act in
flowering exclusively with FRI as a co-activator of FLC. Thus, it is possible that VIP4
acts independently of these genes in a distinct mechanism required for FLC expression in
the absence of cold. We found that increasing VIP4 RNA expression was not sufficient to
further activate FLC, even in non-vemalized plants where other elements necessary for
FLC expression are active. Also, vip4 mutations appear to be completely recessive (data
not shown). The lack of gene dosage effect is consistent with VIP4 acting as one non-
limiting component of a more extensive mechanism. Obvious candidates for other
potential components are represented by the several allelic groups of vip mutations that

we have identified through our genetic approach.

A flowering-repressive mechanism involving VIP4 could function in several
possible capacities. For example, because the 'vernalized state' is not maintained through
meiosis (i.e. the requirement for cold is re-set in each generation; Lang, 1965), this
mechanism could act to re-establish FLC expression in the developing embryo, possibly

by disrupting the epigenetic repressive mechanism involving VRN2. If so, then this might

66

be reflected by decreased accessibility of FLC chromatin in the vip4 mutant, relative to
that in wild-type plants. Another possibility is that VIP4 acts in a hypothetical pathway of
vemalization cold signalling, maintaining it in an 'off‘ state. However, if this is the case,
then VIP4 is unlikely to act as a general suppressor of cold-signalling pathways, a role
hypothesized for the HOS] gene (Lee et al., 2001), because unlike hos] mutants, vip4
plants exhibited neither ectopic expression of a representative cold-responsive gene,

COR 78, nor enhanced freezing tolerance as measured by electrolyte leakage assays (our

unpublished results).

Irrespective of its nature, the flowering-repressive mechanism involving VIP4
could be deactivated by cold through the negative regulation of one or more components.
The observation that VIP4 RNA is expressed to equivalent levels in both non-vemalized
and vemalized plants suggests that if VIP4 itself were a cold-regulated component,
regulation would either be mediated at the level of VIP4 protein activity, or at the RNA
level within a restricted subset of tissues. However, in this respect, it is noteworthy that
the subtle flora] defects seen in plants lacking VIP4 activity are not observed in
vemalized, wild-type plants, suggesting that VIP4 maintains activity in vemalized plants,

at least in floral tissues.

The VIP4 protein exhibits sequence homology with yeast Leo] and proteins from
Drosophila and C. elegans; in addition, the highly hydrophilic nature of these proteins is
conserved. These observations suggest that these proteins could firnction in analogous
molecular mechanisms. Of these proteins, only Leo] has been characterized. Hi gh-

throughput, proteomic analyses suggest that Leo] physically interacts with multiple

67

protein partners in several cellular contexts (Gavin et al., 2002; Ito et al., 200]). This
protein has been shown to exhibit an ATP-sensitive interaction with the 19S 'cap' of the
proteasome (Verma et al., 2000), and is a component of the Pafl transcriptional complex,
which is required for firll expression of a subset of yeast genes (Mueller and Jaehning,
2002). It is noteworthy that the defects in floral morphology seen in vip4 mutants are not
observed in mutants or natural ecotypes lacking FLC activity (Michaels and Amasino,
1999), suggesting that the role of VIP4 in floral development is mediated outside of its
relationship with FLC. Thus, VIP4 likely acts as a common component of distinct

developmental mechanisms, possibly through interactions with multiple protein partners.

The observation that vip4 mutants flower earlier than flc null mutants indicates
that VIP4 regulates flowering-time genes in addition to FLC. These hypothetical target(s)
could have a role in GA biosynthesis or sensitivity, or in the perception of photoperiod,
as current models of flowering predict that such mechanisms would influence flowering
outside of pathway(s) involving FLC (Simpson et al., 1999). An especially attractive
candidate is FLM [also known as AGL27 (Alvarez-Buylla et al., 2000) or MAF]
(Ratcliffe et al., 2001)], which encodes a MADS-box protein highly related to FLC, and
acts as a floral repressor through a mechanism that is likely independent of FLC
(Ratcliffe et al., 2001; Scortecci et al., 2001). Other possibilities include AGL3], a
tandemly repeated cluster of four genes which also encode proteins highly related to FLC

(Alvarez-Buylla et al., 2000; Scortecci et al., 2001).

A more speculative candidate for an additional target of VIP4 regulation is the

MADS-box gene AGAMOUS (A G), which has functions in floral organ and meristem

68

identity (Mizukami and Ma, 1997). Ectopic expression of AG is associated with early
flowering, and in some cases, floral defects similar to that observed for vip4 (Gomez-
Mena et al., 2001; Mizukami and Ma, 1997; Serrano-Cartagena et al., 2000; our
unpublished results). If this were the case, then VIP4 would be included in an expanding
class of gene acting both in floral repression and negative regulation of AG. These genes
include CURLY LEAF (CLF), WA VY LEA VES and COTYLEDONS (WLC), INCUR VA TA
2 (ICUZ), EMBRYONIC FLOWER (EMF)] and 2, and EARLY BOLTING IN SHORT
DAYS (EBS') (Chen etal., 1997; Gomez-Mena et al., 2001; Goodrich et al., 1997;
Serrano-Cartagena et al., 2000; Simpson et al., 1999). Interestingly, Goodrich et a].
(1997) found that the ectopic activity of AGAMOUS could not explain the full degree of
early flowering of the elf-2 mutant plants, and suggested that CLF also regulates other
flowering gene(s). It is tempting to speculate that CLF, and perhaps these other genes as
well, might play a role as regulators of FLC. As these genes have been characterized only
in laboratory strains of Arabidopsis that lack FR] function, and therefore express FLC
only weakly, their potential to regulate FLC remains unclear. The possibility that these
genes are involved in vemalization is intriguing because at least CLF and another
member of this class, EMF 2, encode Polycomb-group-like proteins (Goodrich et al.,
1997; Yoshida et al., 2001), suggesting that they participate in epigenetic regulation of
gene activity. To test this possibility will require the introduction of the respective
mutations into genetic backgrounds that normally express FLC. Alternatively, new alleles

of these genes may be identified through further characterization of other vip allelic

groups.

69

References

Alvarez-Buylla, E.R., Liljegren, S.J., Pelaz, 8., Gold, S.J., Burgeff, C., Ditta, G.S.,
Vergara—Silva, F., and Yanofsky, M.F. (2000) MADS-box gene evolution beyond

flowers: expression in pollen, endosperm, guard cell, roots and trichomes. Plant J.
24: 457-466.

Aukerman, M.J. and Amasino, RM. (1996) Molecular genetic analysis of flowering time
in Arabidopsis. In: Seminars in Developmental Biology, Vol. 7 (Amasino, R.M.,
ed.). Cambridge: Academic Press, pp. 427-434.

Burn, J.E., Bagnall, D.J., Metzger, J .M., Dennis, ES, and Peacock, W.J. (1993) DNA
methylation, vemalization, and the initiation of flowering. Proc. Natl. Acad. Sci.
USA 90: 287-291.

Chen, L., Cheng, J .C., Castle, L., and Sung, Z.R. (1997) EMF genes regulate Arabidopsis
inflorescence development. Plant Cell 9: 2011-2024.

Clough, SJ. and Bent, AF. (1998) Flora] dip: a simplified method for Agrobacterium-
mediated transformation of Arabidopsis thaliana. Plant J. 16: 735-743.

Finnegan, E]. (1998) DNA methylation and the promotion of flowering by vemalization.
Proc. Natl. Acad. Sci. USA 95: 5824-5829.

Finnegan, E.J., Peacock, W.J., and Dennis, ES. (1996) Reduced DNA methylation in
Arabidopsis thaliana results in abnormal plant development. Proc. Natl. Acad.
Sci. USA 93: 8449-8454.

Gavin, A.C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J.,
Rick, J .M., Michon, A.M., Cruciat, C.M., Remor, M., Hofert, C., Schelder, M.,
Brajenovic, M., Ruffner, H., Merino, A., Klein, K., Hudak, M., Dickson, D., Rudi,
T., Gnau, V., Bauch, A., Bastuck, S., Huhse, B., Leutwein, C., Heurtier, M.A.,
Copley, R.R., Edelmann, A., Querfurth, E., Rybin, V., Drewes, G., Raida, M.,
Bouwmeester, T., Bork, P., Seraphin, B., Kuster, B., Neubauer, G., and Superti-
Furga, G.. (2002) Functional organization of the yeast proteome by systematic
analysis of protein complexes. Nature 415: 141-147.

Gendall, A.R., Levy, Y.Y., Wilson, A., and Dean, C. (2001) The VERNALIZA T [0N2
gene mediates the epigenetic regulation of vemalization in Arabidopsis. Cell 107:
525-535.

Gilmour, S.J., Sebolt, A.M., Salzar, M.P., Everard, J.D., and Thomashow, M.F. (2000)
Overexpression of the Arabidopsis CBF 3 transcriptional activator mimics

multiple biochemical changes associated with cold acclimation. Plant Physiol.
124: 1845-1865.

70

Gomez-Mena, C., Pineiro, M., Franco-Zorrilla, J .M., Salinas, J ., Coupland, G., and
Martinez-Zapater, J .M. (200]) early bolting in short days: An Arabidopsis
mutation that causes early flowering and partially suppresses the floral phenotype
of leafy. Plant Cell 13: 1011-1024.

Goodrich, J ., Puangsomlee, P., Martin, M., Long, D., Meyerowitz, E.M., and Coupland,
G. (1997) A polycomb-group gene regulates homeotic gene expression in
Arabidopsis. Nature 386: 44-51.

Hajdukiewicz, P., Svab, Z., and Maliga, P. (1994) The small, versatile pPZP family of
Agrobacterium binary vectors for plant transformation. Plant Mol. Biol. 25: 989-
994.

Ito, T., Chiba, T., Ozawa, R., Yoshida, M., Hattori, M., and Sakaki, Y. (2001) A
comprehensive two-hybrid analysis to explore the yeast protein interactome. Proc.
Natl. Acad. Sci. USA 98, 4569-4574.

Johanson, U., West, J ., Lister, C., Michaels, 8., Amasino, R., and Dean, C. (2000)
Molecular analysis of FRIGIDA, a major determinant of natural variation in
Arabidopsis flowering time. Science 290: 344-347.

Koomneef, M., Alonso-Blanco, C., Blankestijn-de Vries, H., Hanhart, C.J., and Peeters.
A.J.M. (1998a) Genetic interactions among late-flowering mutants of
Arabidopsis. Genetics 148: 885-892.

Koomneef, M., Alonso-Blanco, C., Peeters, A.J.M., and Soppe, W. (1998b) Genetic
control of flowering time in Arabidopsis. Annu. Rev. Plant Physiol. Plant Mol.
Biol. 49: 345-370.

Koomneef, M., Blankestijn-de Vries, H., Hanhart, C., Soppe, W., and Peeters, T. (1994)
The phenotype of some late-flowering mutants is enhanced by a locus on
chromosome 5 that is not effective in the Landsberg erecta wild-type. Plant J. 6:

911-919.

Koomneef, M., Hanhart, C.J., and van der Veen, J .H. (1991) A genetic and physiological
analysis of late flowering mutants in Arabidopsis thaliana. Mol. General Genet.
229: 57-66.

Lang, A. (1965) The physiology of flower initiation. In: Encyclopedia of Plant
Physiology (Ruhland, W., ed.). Berlin: Springer-Verlag, pp. 1371-1536.

Lee, I., Aukerman, M.J., Gore, S.L., Lohman, K.N., Michaels, S.D., Weaver, L.M., John,
M.C., Feldmann, K.A., and Amasino, R.M. (1994a) Isolation of
LUMINIDEPENDENS a gene involved in the control of flowering time in
Arabidopsis. Plant Cell 6: 75-83.

71

Lee, I., Bleecker, A., and Amasino, RM. (1993) Analysis of naturally occurring late
flowering in Arabidopsis thaliana. Mol. General Genet. 237: 171-176.

Lee, 1., Michaels, S.D., Masshardt, AS, and Amasino, R.M. (1994b) The late-flowering
phenotype of FRIGIDA and LUMINIDEPENDENS is suppressed in the
Landsberg erecta strain of Arabidopsis. Plant J. 6: 903-909.

Lee, H., Xiong, L., Gong, Z., Ishitani, M., Stevenson, B., and Zhu, J .-K. (2001) The
Arabidopsis HOS] gene negatively regulates cold signal transduction and encodes
a RING finger protein that displays cold-regulated nucleo-cytoplasmic
partitioning. Genes Dev. 15: 912-924.

Liu, J., Gilmour, S.J., Thomashow, M.F., and van Nocker, S. (2002) Cold signalling
associated with vemalization in Arabidopsis thaliana does not involve CBF] or
abscisic acid. Physiol. Plant. 114, 125-134.

Macknight, R., Bancroft, 1., Page, T., Lister, C., Schmidt, R., Love, K., Westphal, L.,
Murphy, G., Sherson, S., Cobbett, C., and Dean, C. (1997) F CA, a gene
controlling flowering time in Arabidopsis, encodes a protein containing RNA-
binding motifs. Cell 89: 737-745.

Michaels, SD. and Amasino, RM. (1999) FLOWERING LOCUS C encodes a novel
MADS domain protein that acts as a repressor of flowering. Plant Cell 11: 949-
956.

Michaels, SD. and Amasino, RM. (2000) Memories of winter: vemalization and the
competence to flower. Plant Cell Environ. 23: 1145-1153.

Michaels, SD. and Amasino, RM. (2001) Loss of FLOWERING LOCUS C activity
eliminates the late-flowering phenotype of FRIGIDA and autonomous-pathway
mutations but not responsiveness to vemalization. Plant Cell 13: 935-941.

Mizukami, Y. and Ma, H. (1997) Determination of Arabidopsis floral meristem identity
by AGAMOUS. Plant Cell 9: 393-408.

Mueller, CL. and Jaehning, J .A. (2002) Ctr9, Rtfl, and Leo] are components of the
Pafl/RNA polymerase H complex. Mol. Cell. Biol. 22: 1971-1980.

Murray, MG. and Thompson, W.F. (1980) Rapid isolation of high molecular-weight
DNA. Nucl. Acids Res. 8: 4321-4325.

Pirrotta, V. (1997) PcG complexes and chromatin silencing. Curr. Opin. Genet. Dev. 7:
249-258.

72

Ratcliffe, O.J., Nadzan, G.C., Reuber, T.L., and Riechmann, J .L. (2001) Regulation of
flowering in Arabidopsis by an FLC homologue. Plant Physiol. 126: 122-132.

Redei, GP. (1962) Supervital mutants of Arabidopsis. Genetics 47: 443-460.

Ronemus, M., Galbiati, M.K., Ticknor, C., Chen, J ., and Dellaporta, S. (1996)
Demethylation-induced developmental pleiotropy in Arabidopsis. Science 273:
654-657.

Rouse, D.T., Sheldon, C.C., Bagnall, D.J., Peacock, W.J., and Dennis, ES. (2002) FLC, a
repressor of flowering, is regulated by genes in different inductive pathways.
Plant J. 29: 183-191.

Schomburg, F.M., Patton, D.A., Meinke, D.W., and Amasino, RM. (2001) FPA, a gene
involved in floral induction in Arabidopsis, encodes a protein containing RNA-
recognition motifs. Plant Cell 13: 1427-1436.

Scortecci, K.C., Michaels, SD, and Amasino, RM. (2001) Identification of a MADS-
box gene, FLO WERING LOCUS M, that represses flowering. Plant J. 26: 229-
236.

Serrano-Cartagena, J .S., Candela, H., Robles, P., Ponce, M.R., PeA rez-PeA rez, J .M.,
Piqueras, P., and Mico], J .L. (2000) Genetic analysis of incurvata mutants reveals
three independent genetic operations at work in Arabidopsis leaf morphogenesis.
Genetics 156: 1363-1377.

Sheldon, C.C., Burn, J .E., Perez, P.P., Metzger, J ., Edwards, J .A., Peacock, W.J., and
Dennis, ES. (1999) The FLF MADS box gene: a repressor of flowering in
Arabidopsis regulated by vemalization and methylation. Plant Cell 1 1: 445-458.

Simpson, G.G., Gendall, A.R., and Dean, C. (1999) When to switch to flowering. Annu.
Rev. Cell Dev. Biol. 99: 519-550.

Tian, L. and Chen, Z.J. (2001) Blocking histone deacetylation in ArabidOpsis induces
pleiotropic effects on plant gene regulation and development. Proc. Natl. Acad.
Sci. USA 98: ZOO-205.

van Nocker, S., Muszynski, M., Briggs, K., and Amasino, RM. (2000) Characterization
of a gene fi'om Zea mays related to the Arabidopsis flowering-time gene
LUMINIDEPENDENS. Plant Mol. Biol. 44: 107-122.

Verma, R., Chen, S., Feldman, R., Schieltz, D., Yates, J ., Dohmen, J ., and Deshaies, R.J.
(2000) Proteasomal proteomics: identification of nucleotide-sensitive proteasome-

interacting proteins by mass spectrometric analysis of affinity-purified
proteasomes. Mol. Biol. Cell. 11: 3425-3439.

73

Yoshida, N., Yanai, Y., Chen, L., Kato, Y., Hiratsuka, J., Miwa, T., Sung, Z.R., and
Takahashi, S. (2001) EMBR YONIC FLOWERZ, a novel polycomb group protein

homolog, mediates shoot development and flowering in Arabidopsis. Plant Cell
13: 2471-2481.

74

Chapter 3

Genetic analysis of early flowering mutants in Arabidopsis defines a class of
pleiotropic developmental regulator required for expression of the flowering-time
switch FLOWERING LOCUS C.

This chapter is a re-edited version of my publication Zhang, H., Ransom, C., Ludwig, P.
and van Nocker, S. (2003) Genetics 164: 347-35 8.

75

Abstract

The Arabidopsis flowering-repressor gene FLOWERING LOC US C (FLC) is a
developmental switch used to trigger floral induction after extended growth in the cold, a
process termed vemalization. In vemalized plants, F LC becomes transcriptionally
silenced through a process that involves an epigenetic mechanism. We identified
recessive mutations designated vemalization independence (vip) that confer cold-
independent flowering and suppression of F LC. These mutations also lead to
developmental pleiotropy, including specific defects in floral morphology, indicating that
the associated genes also have functions unrelated to flowering time. We identified the
VIP3 gene by positional cloning and found that it encodes a protein consisting almost
exclusively of repeated Trp-Asp (WD) motifs, suggesting that VIP3 could act as a
platform to assemble a protein complex. Constitutive transgenic expression of VIP3 in
vemalized plants is insufficient to activate FLC, and thus VIP3 probably participates in
the regulation of FLC as one component of a more extensive mechanism. Consistent with
this, genetic analyses revealed that the VIP loci define a functional gene class including at
least six additional members. We suggest that VIP3 and other members of this gene class

could represent a previously unrecognized flowering mechanism.

76

Introduction

Genetic and molecular studies in Arabidopsis have shown that flowering results
from the action of several interdependent regulatory mechanisms or pathways, each
mediating the effect of separate endogenous or environmental influences (Koornneefet
al., 1998b; Simpson and Dean, 2002). The Arabidopsis FLOWERING LOCUS C (FLC)
MADS-domain protein is a key flowering-time regulator that integrates the activity of the
so-called autonomous pathway and the FRIGIDA (FRI) gene, which influence flowering
independently of day length, and the "vemalization pathway," which moderates the
promotive effects of extended growth in the cold (Simpson and Dean, 2002). FLC in turn
represses flowering through negative regulation of the SOC] (A GL20) and FT genes (Lee
et al., 2000; Samach et al., 2000; Michaels and Amasino, 2001). In this manner, FLC acts
antagonistically with CONSTANS (C0), which moderates the promotive effects of

inductive photoperiods (Hepworth et al., 2002).

At least six genes, designated FY, F CA, FPA, FLD, LD, and F VE, have been
proposed to participate in the autonomous pathway. These genes collectively act to
promote flowering through repression of FLC (Michaels and Amasino, 1999; Rouse et
al., 2002). In contrast, the activity of FR] represses flowering by positively regulating
FLC expression (Michaels and Amasino, 1999; Sheldon et al., 1999). The antagonistic
relationship between F R] and the autonomous pathway has not been clearly defined, but
the observation that FRI activates FLC and represses flowering even in the presence of

autonomous pathway activity (i. e., in wild-type plants that carry a functional FRI allele)

77

suggests that FRI could function to limit the activity of one or more autonomous pathway

components.

The early flowering conferred by loss of FLC is apparently completely epistatic to
the repressive effects of FR] or mutation in at least F CA, F VE , and LD, suggesting that
the only function of FR] or these autonomous pathway genes, with respect to flowering, is
to regulate FLC (Michaels and Amasino, 2001). In noninductive photoperiods, where the
promotive influence of the photoperiodic pathway involving CO is minimized, plants
lacking only FLC activity flower earlier than plants lacking only F R] activity. This
suggests that FLC represses flowering to some extent even in the absence of FR] and
suggests that FLC expression is also promoted through mechanism(s) not involving FRI

(Michaels and Amasino, 200]).

Although FRI and the known autonomous pathway genes have now been
identified at the molecular level, the nature of the corresponding regulatory mechanisms
is undefined. Both transcriptional and post-transcriptional events are likely involved, as at
least one autonomous pathway gene, LD, encodes a homeodomain-transcription factor-
like protein (Aukerman and Amasino, 1996), and two others, F CA and FPA, encode
proteins with structural features suggestive of RNA binding (Macknight et al., 1997;
Schomburg et al., 2001). Repression of FLC by the autonomous pathway is presumed to
occur at least partly at the level of FLC transcriptional activity, because FLC represses
flowering when expressed from the constitutive CaMV 358 promoter, even in a genotype
lacking strong FRI activity (i. e., where the autonomous pathway is active; Michaels and

Amasino, 1999).

78

Vernalization is an epigenetic effect (Wellensiek, 1962, Wellensiek, 1964)
associated with suppression of the FLC gene (Michaels and Amasino, 1999).
Vernalization likely targets FLC regulatory mechanisms that do not directly involve F R]
or the autonomous pathway, because cold promotes flowering even in genotypes carrying
combined loss-of-function mutations in autonomous pathway genes and in FRI
(Koornneef et al., 1998b). Vernalization-associated FLC repression is mediated by at
least two genes, VRN] and VRN2 (Simpson and Dean, 2002). VRN2 may act to initiate or
maintain a relatively silent state of FLC chromatin, as a vrn2 mutant shows increased
accessibility of the FLC locus to DNAse I (Gendall et al., 2001). Also, the VRN2 protein
resembles the Drosophila Polycomb-group transcriptional regulator Su(Z)12, which
potentially acts at the level of chromatin structure (Gendall et al., 2001). Transgenic
overexpression of VRN], which encodes a nuclear-localized DNA-binding protein, results
in early flowering that is associated with increased expression of FT, but not decreased
expression of FLC (Levy et al., 2002). This suggests both that VRN] requires
vemalization-specific auxiliary factors to target FLC and that VRN] may also regulate
flowering through an FLC-independent mechanism. In addition, VRN] overexpression
disrupts seemingly unrelated developmental processes, indicating that its role may be
wider than that of regulating flowering. Neither VRN] nor VRN2 seems to be regulated in
a vemalization-associated manner, also revealing that specificity is derived from
relationships with cold-regulated factors (Levy et al., 2002; C. Dean, personal
communication). Genetic analyses suggest that VRN] and VRN2 could represent members

of a larger group of genes with similar function (Chandler et al., 1996).

79

Most genotypes of Arabidopsis commonly used in laboratory studies carry a
dysfunctional fri allele (Johanson et al., 2000) and flower soon after germination. Thus,
genetic pathways of floral repression in this reference plant have not been extensively
characterized. We previously reported the identification and cloning of the
VERNALIZA T ION INDEPENDENCE 4 (VIP4) gene, which acts as a flowering repressor
by promoting expression of FLC (Zhang and van Nocker, 2002). We report here the
cloning and characterization of a novel positive regulator of FLC designated VIP3. On the
basis of genetic and molecular evidence presented here, we propose that VIP3 and,
possibly, VIP4 as well could promote FLC expression through a previously unrecognized
mechanism and that these genes are members of a functionally similar gene class in

Arabidopsis.

Materials and Methods

Growth conditions:
Arabidopsis seeds were either planted directly into artificial soil mix or surface

sterilized and germinated under sterile conditions as described previously (van Nocker et

al., 2000). Standard growth conditions were 60—100 umol rn'2 sec'1 of fluorescent
lighting in a 16 hr light/8 hr dark photoperiod at 22° and -SO% relative humidity. Short-
day growth conditions were identical with standard growth conditions but utilized 8 hr

light/ 1 6 hr dark photoperiods. For a vernalizing cold treatment, seeds on germination

medium were first placed at 4° under 2050 umol m'2 sec”1 of fluorescent lighting in an

80

8 hr light/16 hr dark photoperiod for 30 or 70 days. For grth under far-red 1i ght-

enriched conditions, lighting was supplied entirely by household incandescent bulbs.

Strains and genetic techniques:

Introgression line ColeRISFZ consists of the dominant FRI locus from ecotype
San Feliu-2 (FRISFz) introgressed into the Columbia (Col) ecotype (Lee et al., 1994).
Introgression line Ler: FRISFzzFLCSFZ consists of FRISF 2 and the semidominant FLC

locus from ecotype San Feliu—2 (FLCSFZ) both introgressed into the Landsberg erecta
(Ler) genetic background through seven successive backcrosses and made homozygous
through self-pollination (Lee et al., 1994). The ld-I mutant (ecotype Col-1) was obtained
from the Arabidopsis Biological Resource Center (ABRC) at The Ohio State University
(Columbus, Ohio). The null flc—3 mutant was a generous gift from S. Michaels and R.
Amasino (University of Wisconsin). The Ler::vip3 introgression line was created by
carrying out four successive outcrosses to wild-type Ler and selecting for plants that
carried Ler alleles of FR] and FLC after the second outcross. The Escherichia coli strain

harboring bacterial artificial chromosome (BAC) F27B13 was obtained from the ABRC.

Polymerase chain reaction (PCR)-based molecular markers were utilized to
discriminate between wild-type and mutant alleles of VIP3, FRI, and LD. A marker for
presence of the wild-type VIP3 allele was designed to amplify, from the wild-type allele,
a region spanning the site corresponding to the vip3 mutation [primersz F27B13.7F2 (5'-
TTGCAGGTGGAAGTAGTGCCTC-3') and F27Bl3.7 R2 (5'-TGTCATCAGAGACAC

TAGCAAGTCG-3')]. To determine presence of the vip3 allele, a marker was designed to

81

amplify the right junction of the genomic insertion [primersz F27B13.7F2 and T16L4F

(5'-GCCACTGCCGCCAG'I"1"I"I'ATCAAG-3')]. A marker for discrimination between the

FRISFZ and friCOI alleles was based on a 16-bp length polymorphism within the FR]
promoter as described by JOHANSON et al. 2000 and employed primers FR116F (5'-
TGGTGTTCCTTCAAACTTTAGG-3') and FRIl6R (5'-GCTCAATCAGTCATTGCAC
TC-3'). A marker for discrimination between the LD and ld-I alleles was based on the Id-
1 mutation, which is localized within the LD transcribed region, and was generously

provided by S. Michaels (University of Wisconsin).

A vip3/fri double mutant was created by crossing vip3 with wild-type Col

(carrying the strong, loss-of-fimctionfriCOI allele). A VIP3/vip3,friC0[/friC01 plant was
identified in the respective F2 population and allowed to self-pollinate, and double
mutants were analyzed in the corresponding progeny. A vip3/fri/ld triple mutant was

created by crossing vip3 with a plant carrying the strong ld-I allele in the Col

background. F2 progeny from this cross that were friCOI/fri C0] , VIP3/vip3, and LD/ld
were allowed to self-pollinate, and triple mutants were analyzed in the corresponding
progeny. A vip3/vip4 double mutant was created by crossing vip3 with vip4-I and
backcrossing the corresponding Fl plant with a vip3 mutant. A vip3/vip3 V1P4-1/vip4-1
plant was allowed to self-pollinate, and double mutants were analyzed in the

corresponding progeny.

Mutagenesis and cloning of VIP3:

For mutagenesis of introgression line ColeRISFZ, seeds were exposed to ~165

Gy of fast-neutron radiation using the fast-neutron beam at the Michigan State University

82

Cyclotron Laboratory or incubated with 0.15% ethyl methanesulfonate (EMS) overnight
and subsequently rinsed extensively with distilled water. Seeds were then subjected to a
vernalizing cold treatment and planted in soil, and plants were allowed to self-pollinate.
M2 seed was collected in pools each representing ~1000 M1 individuals. Approximately
5000 plants from each of 24 fast neutron-derived M2 families and 20 EMS-derived M2
families were screened. T-DNA mutagenesis and screening were described previously
(Zhang and van Nocker, 2002). The vip3 mutant was backcrossed three times in
succession to wild-type plants before phenotypic analysis. Phenotypic analysis of other
vip mutants was performed with progeny derived from a backcross of M2 plants to wild
type. For genetic complementation analysis, mutants were grown at 18 °C, under which

conditions all mutants were fertile.

Positional cloning of the VIP3 gene utilized F2 progeny of a single F1 individual

derived from a cross between vip3 and introgression line LerzFRISF2:FLC‘SF2. Bulked-
segregant analysis was performed with 24 F2 individuals and molecular markers
described by Lukowitz et al. (2000). Fine mapping was done entirely using molecular
markers based on small insertion-deletion polymorphisms as characterized and cataloged
by Cereon (http://www.arabidopsis.org/cereon/index.html; courtesy of S. Rounsley) and

noted in Fig 3.

Molecular techniques:
For use as probes in DNA gel blotting, BAC DNA was purified from 250-m1
bacterial cultures using a commercially available kit (QIAGEN, Valencia, CA). For PCR

purposes, DNA was prepared from plant tissues using the CTAB-based method described

83

by Lukowitz et al. (2000). DNA and RNA gel blotting was performed essentially as
previously described (Zhang and van Nocker, 2002). For detection of VIP3 RNA, the
probe was a DNA corresponding to the entire VIP3 coding region, amplified from flower-
derived cDNA using primers F 27Bl3.7FBam (5'-AAAGGATCCATGAAACTCGCAGG
TCTGAAATCG-3') and F27Bl3.7RBam2 (5'-AAAGGATCCGAATTGTTCATGAGTA
ATCATAGAGC-3'). For detection of FLC RNA, the probe was as described by Zhang
and van Nocker (2002). For molecular complementation of the vip3 mutation, an ~6.4-kb
BamHI fragment derived from BAC F27B13 was ligated into the BamHI site of vector
pPZPzBAR (Zhang and van Nocker, 2002) and introduced into wild-type plants through
floral dipping. This DNA contained the entire predicted transcriptional units At4g29830
(VIP3) and At4g29820, as well as part of transcriptional units At4g29840 and
At4g29810. Several independent T1 lines were crossed to the vip3 mutant, herbicide-
resistant progeny from these crosses were allowed to self-pollinate, and the resulting
progeny were again subjected to herbicide selection. All vip3-like progeny were found to
be herbicide sensitive. PCR analysis of several wild-type-like progeny indicated

homozygosity for the vip3 allele and presence of the transgene (data not shown).

For overexpression or antisense expression of VIP3 in transgenic plants, the VIP3
coding and 3' untranslated region was amplified from genomic DNA using primers
F27Bl3.7FBam and F27B13.7RBam (5'-AAAGGATCCAATGCCATCCCTGACATGG
CTTGC-3'). These primers incorporate a BamHI restriction endonuclease site into both
termini. The PCR products were ligated into vector pGEM-T (Promega, Madison, WI),
the resulting construction was subjected to digestion with BamHI, and the fragment

containing the VIP3 coding and 3' region was ligated into the BamHI site of vector

84

pPZPzBARz3SS (Zhang and van Nocker, 2002). Ligation products were obtained that
contained the VIP3 fragment in both forward (sense) and reversed (antisense) orientation.
These were introduced into Agrobacterium strain A31, and the resulting strains were used

to infect wild-type plants through floral dipping.

For immunological studies, recombinant, hexahistidine-tagged, fiill-length VIP3

protein was expressed in E. coli and purified using N12+-affinity chromatography and a
commercially available kit (Novagen; His-Bind) according to the manufacturer's
instructions. This purified protein was used to generate anti—VIP3 sera in rabbits. For
immunoblotting, plant protein extracts were prepared by grinding tissues under liquid
nitrogen, adding the frozen tissue powder to sample buffer containing 4% SDS (Laemmli
1970), incubating at 100°C in a boiling water bath, and clarifying by centrifugation for 5
min at 12,000 x g. Immunoblotting was done as described by Harlow and Lane 1988,
using PVDF membranes (Bio-Rad, Richmond, CA) blocked with Tween-20 in
phosphate-buffered saline and alkaline-phosphatase-labeled goat anti-rabbit IgGs (Bio-

Rad).

Sequence analysis:

WD motifs in the VIP3 protein were identified using the Protein Sequence
Analysis server (http://bmerc-www.bu.edu/psa/index.html) at the BioMolecular
Engineering Research Center, Boston University. Other sequence analyses were
performed using BLAST on web servers maintained by the National Center for

Biotechnology Information (NCBI; http://www.ncbi.nlm.nih. gov) or The Arabidopsis

85

Information Resource (http://www.arabidopsis.org) and programs of the Genetics

Computer Group (Madison, WI).

Results

Identification and genetic analysis of the VIP3 locus:
To identify new floral repressors important for regulation of FLC, we extensively

mutagenized the late-flowering, vemalization-responsive (winter-annual) genetic

background Col:FRISF2 (hereafier referred to as wild-type) using fast neutrons, T-DNA,
and EMS and identified individuals that flowered very early independently of a
vernalizing cold exposure. Several early flowering individuals were recovered that
displayed defects in floral morphology similar to that described for the previously
identified vip4 mutants and that were found to be nonallelic with vip4 (see below). One of
these mutants, designated vip3, was selected for further study (Fig 1A). To determine if
the defect conferred by the vip3 mutation could be in a flowering-repressive mechanism
involving FLC, we evaluated FLC expression by RNA gel blotting of seedling RNAs. In
contrast to wild-type plants, FLC RNA expression was not detectable in the vip3 mutant,

even with phosphorimaging and extended exposures (Fig 18).

In addition to the defect in flowering time (see below), vip3 plants exhibited
several other defects in growth and development when grown under standard conditions.
Specifically, rosette leaves of vip3 plants were smaller than those of wild-type plants, and

overall plant size was reduced (Fig 1A, c). In addition, flowers of vip3 plants exhibited

86

Figure 1. Phenotype of the vip3 mutant and analysis of VIP3 expression. (A) Whole-
plant and floral phenotypes of wild-type plants, the vip3 mutant, and VIP3 transgenic
plants. All plants in a—f are shown at the same scale. (a) Wild-type plant grown in the
absence of cold. Bar, 25 mm. (b) Wild-type plant grown after a vernalizing cold
treatment. (c) vip3 mutant plant grown in the absence of cold. ((1) Ecotype Ler wild-type
(left) and a Ler::vip3 introgression line (right). (e) Representative transgenic plant
expressing VIP3 antisense RNA, grown in the absence of cold. (f) Transgenic vip3 plant
containing an introduced copy of the wild-type VIP3 gene. (g) Inflorescence from a wild-
type plant. The more basal flowers were removed. (h) A vip3 mutant inflorescence with
flowers showing reduced or filamentous sepals (s) and petals (p). (i) Inflorescence from
the Ler::vip3 introgression line. (i) Inflorescence from a representative transgenic plant
expressing VIP3 antisense RNA. (B) Gel-blot analysis of FLC and VIP3 RNA expression
and immunoblot analysis of VIP3 protein (V IP3p) abundance in 10-day-old wild-type
(WT) and vip3 mutant seedlings, in 2-week-old nonvemalized (NV) or vemalized (V)
wild-type plants, and in 2-week-old Col, WT, and ld-I (Colzld-I) mutant plants. (C) Gel-
blot analysis of FLC and VIP3 RNA expression and immunoblot analysis of VIP3 protein
abundance in nonvemalized wild-type plants (WT-NV) and a representative vemalized
358: VIP3 plant. For RNA blots, hybridization of RNAs with an actin probe is shown to
indicate relative abundance of mRNA in each lane. For immunoblots, a weakly
immunoreactive protein species is indicated (asterisk) to show relative abundance of total
protein in each lane.

87

VIP3 at” as...» ”if
FLC U l f;

 

ACT/N W m :

* '--

 

Aan ‘
FLC g . g)
VIP3 Q

VlP3p -. .

ou¢

*-‘.c—’

abnormalities of organs in the outer three whorls (Fig 1A, h). Sepals typically had
irregular, translucent margins, and lateral sepals were always reduced in size. Petals were
also reduced in size and were often variable in number; whereas wild-type flowers have
four petals, vip3 flowers had up to six. Stamens were typically decreased in number from
six to four or five. Organs in the outer three whorls were also often replaced by
filamentous structures. The gynoecium was morphologically normal, but slightly reduced
in size. Flowers were typically male sterile, and self-pollination was rare. When plants
were grown at a lower temperature (18 °C), these floral defects were attenuated, and
plants were typically fertile (data not shown). The vip3 mutation conferred essentially
identical pleiotropy when introgressed into the commonly used Ler ecotype (Fig 1A, (1

and i).

Similar to wild-type plants, heterozygous VIP3/vip3 plants resulting from a
backcross between vip3 and wild-type plants flowered very late under photoperiodically
inductive (long-day) conditions in the absence of cold. In addition, none of the
phenotypic defects described above for the vip3 mutant were apparent in VIP3/vip3 plants
(data not shown). These observations indicate that the vip3 mutation is effectively
recessive. In the progeny of a VIP3/vip3 plant, mutant individuals were found with a
frequency expected for Mendelian segregation of a single recessive locus (data not
shown). In addition, analysis of the progeny of reciprocal crosses between a wild-type
plant and a VIP3/vip3 plant indicated that the vip3 mutant allele was transmitted through
both male and female gametes with a frequency similar to that of the wild-type allele

(data not shown).

89

Flowering response of the vip3 mutant:

To better define the position of VIP3 with respect to flowering pathways
involving FLC, we evaluated the effects of photoperiod, extended cold, and light quality
on the flowering response of the vip3 mutant relative to that of wild-type plants and plants
carrying a null mutation in FLC (Fig 2A and B). When grown in the absence of cold,
wild-type plants produced v67 leaves under long-day conditions but did not flower under
short-day (noninductive) conditions, even after producing >100 rosette leaves. We found
that when given an extended (70 days) cold treatment, the photoperiodic response of
wild-type plants was effectively eliminated, and plants flowered after producing ~10 or 11
leaves irrespective of photoperiod (Fig 2A). This is consistent with current models of
flowering where vemalization, acting through suppression of FLC, can bypass the lack of
floral promotion from inactivity of the photoperiodic pathway (Simpson and Dean, 2002).
Both the flc null mutant and the vip3 mutant exhibited strong photoperiodic responses
when grown in the absence of cold and still showed slight photoperiodic responses even

after being given a 70-day cold treatment (Fig 2A).

When grown under photoperiodically inductive conditions, the vemalization
response of winter-annual types of Arabidopsis appears saturated after ~40 days of cold;
i. e., longer cold periods have no further flowering-promotive effects (Lee and Amasino,
1995). This probably reflects the ability of the photoperiodic pathway to partially bypass
repression of flowering by FLC, because much longer (e. g., ~70 days) cold periods are
necessary to saturate the vemalization response when flowering is evaluated in
noninductive photoperiods (Lee and Amasino, 1995). Under short-day conditions, we

found that vip3 plants grown in the absence of cold flowered appreciably later (17.8 d: 0.9

90

Figure 2. Flowering time of genotypes used in this study as affected by photoperiod and
cold treatment (A), light quality (B), or photoperiod (C). Flowering time was evaluated
under standard growth conditions (SGC; long-day photoperiods, without cold treatment
and with fluorescent lighting) or SGC modified as follows: SD, short-day photoperiods;
C, 70-day cold treatment; and I, incandescent lighting. At least 10 plants of each
genotype were evaluated in each condition. Error bars indicate the standard deviation.
Individual panels reflect the results of independent experiments. Flowering time was
measured as the total number of leaves (vegetative nodes) produced on the primary stem.
Scale varies along the y-axis. Wild-type plants grown in short-day photoperiods without
cold did not flower during the course of this experiment.

9]

pmf/rdm
:4! {414'
s .14

pant/rd“
Malia '
rd!“

 

 

 

 

 

 

 

 

 

vip3

WT

 

 

 

 

8 % °
N G
F‘ Q

.raqrnnu jnal

92

leaves) than wild-type plants given a 70-day cold treatment (10.7 d: 0.9 leaves; Fig 2). A
70-day cold treatment reduced flowering time of vip3 plants to that of vemalized wild-
type plants (Fig 2). The observation that cold effectively promotes flowering in vip3
plants suggests that, if vip3 is a null mutation, vemalization could promote flowering at

least partially independently of VIP3.

Wild-type plants flowered much earlier (44.7 i 10.2 leaves) when grown under
far-red-enriched light supplied by incandescent bulbs than when grown under the
fluorescent lights used in our standard growth conditions (75.2 i 8.2 leaves; Fig ZB), and
this is consistent with previous observations that far-red-enriched light promotes
flowering in genotypes that strongly express FLC (Bagnall, 1993; Lee and Amasino,
1995). We found that flc mutant plants flowered earlier when grown under incandescent
lighting (9.6 i 0.9 leaves) relative to fluorescent lighting (12.2 i 1.] leaves; Fig ZB),
suggesting that promotion of flowering associated with light quality is mediated at least
partly independently of FLC. The vip3 mutant plants also flowered earlier under these
conditions (9.2 :t 0.6 leaves) than under standard growth conditions (11.1 d: 0.8 leaves),
and the net reduction in flowering time was similar to that observed for the flc mutant.
This observation suggests that mechanisms that promote flowering in response to light

quality are intact in the vip3 mutant.

Under all conditions evaluated, vip3 mutant plants flowered earlier than flc
mutants (Fig 2A and B). This was most apparent when plants were grown in short-day
photoperiods, irrespective of cold. This observation indicates that VIP3 has an additional

flowering-repressive role that is mediated outside of its positive regulation of FLC.

93

Interactions with FRI and LD:

One of several potential positions of the VIP3 gene within the regulatory
hierarchy of flowering is as a negative regulator of the activity of the autonomous
pathway, a firnction that has been proposed for FRI (above). If this were the case, then
loss of VIP3 function would not be expected to suppress the late flowering associated
with loss of autonomous pathway activity. To test this, we evaluated the epistatic
interactions between VIP3 and the autonomous pathway gene LD. We introduced the vip3
mutation into the Col::ld-I genetic background, which carries strong loss-of-function
alleles in both FRI and LD. Col::ld-I plants behave as winter annuals, because loss of LD
activity leads to derepression of FLC; these plants were otherwise phenotypically
indistinguishable from wild-type plants (data not shown). We found that vip3/fri/ld triple-
mutant plants were phenotypically similar to vip3 plants, exhibiting aberrant floral
morphology and reduced plant size (data not shown). Under long-day conditions, there
was no apparent difference in flowering time between vip3 plants and the vip3/fri/ld triple
mutant (Fig 2C). Under short-day conditions, however, the vip3/fri/ld triple mutant
flowered notably later (26.7 :t 2.9 leaves) than vip3 plants (20.8 i 3.8 leaves; Fig 2C).
That the vip3 phenotype was predominantly epistatic to the late-flowering ld phenotype
indicates that VIP3 is unlikely to function as an upstream regulator of the autonomous
pathway and that it has a function that is distinct from that of FRI. The observation that
this epistasis was incomplete also suggests that VIP3 could function in a pathway that is
distinct from the autonomous pathway mechanism involving LD. A caveat to this analysis
is that the incomplete epistasis observed could potentially result from weak function of

VIP3, if the vip3 mutation were not null.

94

To determine if FRI has any flowering-repressive effect in a vip3 genetic

background, we evaluated the effect of the strong loss-of-functionfriCOl allele on
flowering time of vip3 plants. When grown under long-day photoperiods, there was no
significant difference in flowering time between vip3 single mutants and vip3/fri double
mutants (Fig 2C). Under short-day photoperiods, vip3/fri double mutants flowered
marginally earlier (16.7 :1: 2.2 leaves) than vip3 single mutants (20.8 i 3.8 leaves; Fig 2C).
Thus, with respect to flowering time, the effect of the vip3 mutation was strongly epistatic
to the effect of FR]. Mutants lacking both VIP3 and FR] were otherwise phenotypically
similar to vip3 single mutants, exhibiting aberrant floral morphology and reduced plant

size (data not shown).

Positional cloning of the VIP3 gene:

Through genetic mapping, we localized the vip3 mutation to an ~2.4-Mb region of
the lower arm of chromosome IV, represented by three overlapping BAC clones (Fig 3A).
Subsequently, we analyzed genomic DNA from vip3 and wild-type plants by gel blotting
using these three BACs as probes. This approach resulted in the indication of an insertion
within the predicted coding region of a transcriptional unit designated At4g29830 by the
Arabidopsis Genome Initiative (AGI; Fig 3A). Further analysis using inverse PCR and
sequencing indicated that the insertion was associated with the translocation of up to ~320
kb, a possibly contiguous sequence from a proximal region of chromosome IV (data not
shown). We found that, in the vip3 mutant, RNAs hybridizing with an At4g29830 probe
accumulated to detectable levels, but were shorter than RNAs seen in wild-type plants,
suggesting that the insertion in the vip3 mutant resulted in a truncation of the At4g29830

gene (Fig 18). DNA and RNA gel-blot analyses of the adjacent genes, At4g29820 and

95

Figure 3. (A) Region of chromosome IV encompassing BAC F27Bl3 containing the
VIP3 (At4g29830) gene. Molecular markers used in mapping are shown (top), with
genetic distance (recombinations/chromosomes analyzed) between the marker and vip3
mutation identified. The position and orientation of BAC clones is indicated. An
enlargement of the region containing the VIP3 (At4g29830) gene is shown (bottom).
Lines with arrows indicate the orientation and extent of RNA transcripts, as determined
from analysis of cDNAs present in current databases. No cDNAs were identified for
At4g29820. Open reading frames as predicted by the AGI are shown as solid rectangles.
The position of the insertion in the vip3 mutant is shown (INS). Restriction sites that were
used in DNA gel-blot analysis to delineate the region containing the mutation are shown
(H, HindIII; B, BamHI). (B) Amino acid sequence of the VIP3 protein with WD repeats
aligned. The consensus sequence that defines the alignment of the repeats is enclosed in a
box. This consensus sequence includes those residues that most frequently occur at a
specific position [Smith et al. 1999 , modified as described by T. F. Smith (http://bmerc-
www.bu.edu/wdrepeat/H. The letter x signifies that any amino acid can be found at the
position. The symbol ~signifies that additional amino acids are typically present at the
position. The position of three antiparallel B-strands, here labeled A, B, and C, is based
on the structure determined for the GB protein. A fourth B-strand found in WD motifs,
strand D, is not strongly conserved at the amino acid sequence level and is not indicated.

96

ovN
baa
mma
mm
mm

 

 

 

 

 

 

 

 

>

m U Hm H 0

NH A «m A> mmo A H
zmqm>w DQH>H mZm 3 A H m
z 03>MHH xox mwmdqx imam xmx>xx >xxxmw
Hmm m» owqm>m MOD m>m¢qm 0<m>wamwmm mm¢>m3 >Oozmz
mmeqqexwmm omzz>m GOD mwmmq> mmo>m mm>qmm >mzzmw
mqomqquma> Qm>UHB 0oz mwufiqm xwzm m3¢>wq >mxxmm
mqequm3m¢B Q3qx>m 4mm ow¢>dq Hewxm mmOZOB >mmmm¢
mA><HB¢ZHQ> Qm>m>m mDH mmmfidH mem m¢¢9¢d >0Amm0
Bzem>qoqmom mBAM>B mag mwquq dmmomeflm >BH<<3 >momm¢

o m <

Rea
movwammvé - omwmmmvz o~mm~m$<
4 _IE

 

«3/\

52m“. tillmwom Shun. via—L. I mwmmwu—

III

Al 0P<NTL ‘IIIII

 

488.4 «KN? «mum? @854 48me
894 9.9% «36 mic

 

q-

nEw

-
d

wfiQ _.

wmommfi
mag _.

ZmHm

97

At4g29840, in the vip3 mutant revealed that both genes were intact and expressed to
levels similar to those seen in wild-type plants (data not shown). Using immunoblotting
and antisera generated against recombinant At4g29830 protein, we observed a highly
reactive protein species in wild-type plant extract approximating the predicted size of the
At4g29830 protein (Fig 1B). This protein was not detectable in equivalent extracts from
vip3 plants (Fig 1B). Also, there were no immunoreactive protein species of larger or
smaller molecular mass unique to vip3 extracts (Fig IB and data not shown), suggesting
that any aberrant protein produced from the At4g29830 gene in vip3 plants is unstable. A
query of Arabidopsis expressed sequence tag databases resulted in the identification of six
independent cDNAs corresponding to the At4g29830 gene. These cDNAs collectively
defined a transcribed region and intron/exon structure that is consistent with that predicted
by the AGI and with the size of At4g29830 RNAs as determined by gel blotting (Fig 3A).
RNA gel-blot analysis and immunoblot analysis indicated that At4g29830 RNA and

protein are expressed throughout the plant (data not shown).

To determine if disruption of At4g29830 was the lesion causing the vip3
phenotype, we performed molecular complementation in transgenic plants using an v6.4-
kb DNA containing the entire At4g29830 transcriptional unit. Because the vip3 mutant
was predominately male sterile when grown under standard conditions and was therefore
incompatible with the standard floral-dip method of plant transformation (Clough and
Bent, 1998), we first introduced the transgene into wild-type plants and then introduced
the transgene into the vip3 mutant through crossing. Several independent lines were

generated that were homozygous for the translocation mutation and contained at least one

98

copy of the VIP3 transgene. These plants were phenotypically indistinguishable from
wild-type plants, flowering extremely late in the absence of cold and producing
morphologically normal flowers (Fig 1A, f and data not shown). On the basis of these
data and the observation that antisense expression of At4g29830 resulted in a phenocopy

of the vip phenotype (below), we concluded that At4g29830 is the VIP3 gene.

On the basis of annotation provided by the AGI, VIP3 encodes a 321-amino-acid
protein that is composed almost entirely of seven repeats of a motif designated the Trp-
Asp (WD) motif (also known as the WD-4O repeat; Neer et al. 1994; Smith et al. 1999;
Fig 33). No closely related genes exist in the Arabidopsis genome, and the predicted
VIP3 protein does not show extensive sequence homology with any protein cataloged in

current protein databases.

VIP3 expression:

Genetic epistasis analysis (above) indicated that VIP3 could function downstream
from the strong FLC regulators FRI and LD. To determine if the promotive activity of
FR] on FLC expression might be mediated through activation of FLC by VIP3, we
compared VIP3 RNA and protein abundance in wild-type plants with that in the Col
ecotype (lacking strong FRI activity). Likewise, to determine if VIP3 might mediate the
derepression of the FLC gene due to loss of LD activity, we evaluated VIP3 RNA and
protein levels in the ld-I mutant. Although loss of FR] or LD activity resulted in obvious
differences in FLC RNA expression, no effect on VIP3 expression was apparent (Fig 18).
In addition, to determine if the promotive activity of VIP3 on FLC expression is mediated

via activation of FR], we evaluated FRI RNA expression in wild-type plants and in the

99

vip3 mutant. We did not observe a significant change in FRI RNA expression between
wild-type and vip3 (Figure 1, chapter 5). To determine if the repressive effect of cold on
FLC expression might be mediated through loss of VIP3 activity, we evaluated VIP3
RNA and protein levels in vemalized and nonvemalized wild-type plants. In both
situations, VIP3 was expressed to similar levels (Fig 1B). These findings suggest that
modulation of VIP3 RNA or protein levels is unlikely to be involved in the regulation of

FLC by FRI, the autonomous pathway, or cold.

Constitutive and antisense expression of VIP3 in transgenic plants:

To study the potential effects of manipulated expression of VIP3 on growth and
development, we engineered transgenic plants in which the wild-type genomic copy of
VIP3 was expressed in either sense or antisense orientation, under control of the
constitutive CaMV 35S promoter. For both the sense (35S: VIP3) and the antisense (VIP3-
AS) strategies, at least 150 transgenic plants were recovered. For the VIP3-AS strategy,
self-pollinated offspring from infiltrated plants (designated Tl plants) were grown
without a vernalizing cold treatment. Approximately one-half of VIP3-AS plants
surviving selection flowered very early, with as few as 5 rosette leaves (Fig 1A, e). In
contrast, nonvemalized wild-type plants grown under similar conditions produced at least
60 rosette leaves without flowering (Fig 1A, a). In addition, the typical early flowering
VIP3-AS plants were smaller than wild-type plants and produced morphologically
abnormal flowers similar to those seen on vip3 plants (Fig 1A, e and j). For the 35S: VIP3
strategy, a population of T1 plants was grown without a vernalizing cold treatment.
Similar to nonvemalized wild-type plants, the great majority of these plants flowered

extremely late or did not flower during the course of this experiment. Analysis of VIP3

100

RNA and protein levels in leaf tissues of eight of these late-flowering plants indicated
that all expressed the 35S: VIP3 transgene to high levels relative to wild-type
nontransgenic plants (data not shown). The few very early flowering plants observed in
this population possibly resulted from transgene-associated suppression of the
endogenous VIP3 gene, as VIP3 protein was not detectable in leaf tissues of these plants

(data not shown).

To determine if constitutive expression of VIP3 could overcome the repressive
effect of cold on FLC expression, we analyzed another population of 35S: VIP3 T1 plants
grown after being subjected to a vernalizing cold treatment. In this population of ~250
individuals, all plants flowered very early, and there was no large variation in flowering
time among the plants (data not shown). VIP3 was expressed to high levels in several of
these plants, as determined by RNA gel-blot and immunoblot analyses of leaf tissues (Fig
1C). Even in these VIP3-expressing plants, FLC expression was not detectable (Fig 1C).
These findings indicate that VIP3 is probably insufficient to activate FLC in vemalized

plants.

VIP3 is a member of a class of functionally related genes in Arabidopsis:

The phenotype of the vip3 mutant was similar to that of plants with mutations in
the previously identified flowering-time gene VIP4 (Zhang and van Nocker, 2002). For
example, vip4 mutants do not express detectable levels of FLC, flower earlier than an
FLC null mutant, and exhibit defects in floral morphology in whorls 1—3 (Zhang and van
Nocker, 2002). The observation that several vip3/vip4-like mutations identified through

our genetic screens were nonallelic to either VIP3 or VIP4 (see below) indicated that a

101

class of gene with similar roles in flowering timing and floral development could exist in
Arabidopsis. To attempt to define the extent of this potential gene class, we mapped all of
the seven vip3/4-like mutations recovered in our screens to a limited region of the
genome, and those plants harboring mutations on the same chromosome were subjected
to genetic complementation analysis (Table l and Table 2). In addition to VIP3 and VIP4,
five new loci were identified, which we tentatively designated VIP], VIP2, VIP5, VIP6,
and VIP7 (Table 1 and Table 2; Fig 4). All of the mutants exhibited early flowering,
reduced plant size, and floral defects in whorls 1—3 similar to those described for vip3
above. In all cases these phenotypes co-segregated with early flowering in the small
mapping populations and with a frequency expected for Mendelian segregation of a
single, recessive locus (Fig 4 and data not shown). When evaluated under short-day
photoperiods in the absence of cold, most of these mutants flowered as early as, or earlier
than, an flc null mutant (Fig 4E). The exception was vip2, originating in an EMS-
mutagenized population, which flowered slightly later (Fig 4E). Analysis of FLC RNA
levels in the mutants revealed that in all cases except for vipZ, this early flowering was
associated with loss of detectable FLC expression (Fig 4, B and C and data not shown).
For the vip2 mutant, FLC expression was detectable using phosphorimaging and extended
exposures (data not shown). None of the mutations mapped to previously described
flowering-time genes, with the exception of VIPZ and VIP5, which are located within a
broad region described for EARLY FLO WERING IN SHORT DA YS (EFS; Soppe et al.,

1999).

To help clarify the potential relationships among these genes, we analyzed VIP3

102

Figure 4. Characterization of Arabidopsis vip mutants. (A) Nonvemalized vip mutant
plants showing reduced size and early flowering (a—e) and floral defects (f—j). Shown are
vip] (a and t), vip2 (b and g), vip5 (c and h), vip6-3 (d and i), and vip7 (e and j). All
plants in a—e are shown at the same scale. Bar in a, 25 mm. (B and C) RNA gel blots
showing FLC, VIP3, and VIP4 expression in wild-type (WT) plants and in other vip
mutants. The left and right panels of B and C were assembled from the same images. (D)
Immunoblot analysis of VIP3 protein expression in WT plants and in vip mutants. A
weakly immunoreactive protein species is indicated (asterisk) to show relative abundance
of total protein in each lane. (E) Flowering time (total leaf number) of the null flc-3
mutant and vip mutants grown in short-day photoperiods without cold. At least 15 plants
of each genotype were evaluated. Error bars indicate the standard deviation.

103

.~
‘3] ”Qw-
r”

a;
‘5’“..-
.

.5
..

M.

n.

91
an.
m

a

ACTIN ‘

 

 

 

 

 

 

 

3:

3A:
31:
, EA...
3.:
3a.:
3...
E:
H E...
5.9%
I uno- 0 d 4m! .0
3 2 I
Lana-=— H30—
E
«oma . m m
«me u .. n
as... m . u
.a .
ya. u w
as. ~
as».

104

Table 1. Approximate map positions of VIP loci.

 

 

No.
Locus alleles Chromosome Marker Recombination
VIP] 1 I nga2 80 0/ 100
VIP2 1 I ngalll 11/118
VIP3 1 1v (Cloned)a (Cloned)a
VIP4 3 v (Cloned)b (Cloned)b
VIP5 1 I ngal 11 14/104
VIP6 3 II ciw3 12/164
VIP7 1 V ciw10 10/136

 

The molecular markers used and recombination between the mutation and the

marker (recombinations/chromosomes analyzed) are indicated.

a This report.
b Zhang and van Nocker (2002).

105

.OxB oomv 25:52:

o>vooam8 05 Low vengeance gamma Qua 90 £me 05 co was» coax—«SW on 8 8380 con cocoflom $5on _ m wincommoboo
65 E 82030 29.5 mfisEzvfi “=82: bao 58on E :52: 30355 momma“. 20:3 momma :2“ E .3382: 8380
2a 88m .28on _ m we 093053 3 ESE: 8 TV 256:? 2865 238% .msowzuoEo: 22> 885 8.82: =<

 

+

+ + + 94.3 32m

- - mass as
- segue mi

- 2.35 5
+ + ARE .8

- - @433 ~32...

- - $35 3mm

- - 93.3 R

+ + as: Emzm

+ + CA»: 427:

 

wSZh

ma. _D ND Q N75 mama NX :mmEm VNZAK 3&th

 

0?:

 

6.2.3::— ouzuunumuufi asunufiuzaua we magma 5535503890 .N 93:.

106

and VIP4 mRNA levels and VIP3 protein abundance in all of the vip mutant backgrounds.
In the vip], vip2, vipS, vip6-3, and vip7 backgrounds, VIP3 and VIP4 RNA levels and
VIP3 protein abundance were similar to that seen in wild-type plants (Fig 4, B—D and data
not shown). In addition, VIP3 RNA and protein was expressed to apparent wild-type
levels in plants carrying the strong vip4-3 mutation, and VIP4 RNA was expressed to
apparent wild-type levels in the vip3 mutant (Fig 4 C and D). These findings suggest that,
if these genes function in a pathway involving VIP3 or VIP4, they probably do not act as

direct regulators of VIP3 or VIP4.

Discussion

Current models of flowering propose that FLC is regulated through several
mechanisms, including the autonomous pathway, FRI, and vemalization (Simpson and
Dean, 2002). In addition, both genetic and molecular studies indicate that FLC is weakly
regulated by genes operating outside of these pathways, as a result of poorly defined
"feedback" mechanisms (Koornneef et al., 1998a; Rouse et al., 2002). VIP3 encodes a
strong activator of FLC, as FLC RNA expression appears to be abolished in the vip3
mutant. Irnportantly, FLC expression is apparently ubiquitous in wild-type plants and
does not appear to be developmentally regulated (Sheldon et al. , 1999), indicating that
VIP3 acts in a more direct manner. VIP3 is also expressed throughout the plant, similar to
FLC (Sheldon et al., 1999), and this is consistent with a role for VIP3 as a direct activator

of FLC.

107

As an activator of FLC, VIP3 functions in a manner distinctly different from FRI,
which has been proposed to limit that activity of the autonomous pathway (Zhang and
van Nocker, 2002). This was evident by the epistasis analysis employing a strong
mutation in the autonomous pathway gene LD. The derepression of FLC and late
flowering conferred by the ld mutation is effectively epistatic to loss of FLC activation

l-Col

and early flowering conferred by the strong loss-of-functionfr allele. This effect was

largely suppressed when the vip3 mutation was introduced into the ld/fri C01 background.
This indicates that VIP3 probably does not act to limit the activity of LD. However, this
epistasis was incomplete, and the small inhibitory effect caused by loss of LD function in
a vip3 background could suggest that vip3 functions at least partly independently of LD.
In addition, we found that an active FRI allele marginally delays flowering in a vip3
background, suggesting that VIP3 might have FRI-independent functions. These
conclusions are dependent on the vip3 mutation creating a total loss of function of the
VIP3 gene. Although full-length VIP3 RNA or protein was not detectable in the vip3

mutant in our experiments, it is possible that VIP3 is still expressed at a very low level.

The lack of effect of disruption of FRI or LD on VIP3 RNA or protein expression
suggests that modulation of VIP3 expression is unlikely to be involved in the regulation
of FLC by FRI or LD. Likewise, because VIP3 RNA and protein are expressed to similar
levels in vemalized and nonvemalized plants, VIP3 is unlikely to be a direct regulator of
the vemalization response. Possibly, regulation of VIP3 by these factors is carried out
through modification of protein activity or within a small spatial domain. However, the
simple observation that the developmental pleiotropy conferred by the vip3 mutation is

not apparent in a fri null mutant, where the autonomous pathway is actively suppressing

108

FLC, or in vemalized plants, also suggests that VIP3 retains activity under these
circumstances. Thus, our data are most consistent with VIP3 acting outside of

mechanisms involving F R] or LD.

A mechanism of FLC regulation in which VIP3 participates could be a major
target of the vemalization pathway. This is suggested by the observation that both vip3
and vemalization affect flowering predominately through FLC, but also through FLC-
independent mechanisms. Our findings that a long cold treatment slightly accelerates
flowering of the vip3 mutant and that vip3 plants flower slightly later than vemalized
wild-type plants could indicate that vemalization is mediated at least partly outside of
VIP3 activity. However, a slight vemalization response could be mediated by weak VIP3
activity in vip3 plants. These possibilities can be resolved only through the identification

and analysis of an unambiguous vip3 null mutation.

VIP3 encodes a protein containing WD motifs. The WD motif is found in a large
variety of proteins that do not share any obvious function (N eer et al., 1994). The crystal
structure of the well-known WD-repeat protein GB shows that each of the seven WD
motif units takes the form of four antiparallel B-strands, with the seven repeated WD
motifs forming a symmetrical structure termed a B-propeller (Smith et al., 1999). A
distinctive feature of the VIP3 protein is a 13-residue extension within the region
predicted for strand D of repeat IV. The analogous region of GB takes the form of a loop
comprising the exterior surface of the propeller structure, and additional amino acids at
this position may comprise an independently folded domain that would protrude from the

structure. VIP3 appears to lack extensive amino- or carboxyl-terminal domains outside of

109

the potential B—propeller, suggesting that it could act exclusively in the context of a

molecular scaffold.

We formerly identified the Arabidopsis VIP4 gene, an FLC activator that encodes
a highly hydrophilic protein with similarity to the Leo] protein from Saccharomyces
cerevisiae and similar proteins from Drosophila and Caenorhabditis elegans (Zhang and
van Nocker, 2002). Leo] is involved in the expression of a small subset of yeast genes, as
a component of the Pafl transcriptional regulator, which may represent a transcriptional
endpoint of protein kinase C-mitogen-activated protein kinase signaling (Mueller and
Jaehning, 2002). On the basis of the phenotypic similarity between the vip3 and vip4
mutants, the observation that the VIP4 gene exhibits epistatic relationships with FRI and
LD that are similar to that seen for VIP3, and our observations that the vip4-1 mutation
does not obviously enhance the phenotype of vip3 plants (our unpublished results), it is
likely that the VIP3 and VIP4 genes act in close functional proximity. The relationship
between VIP3 and VIP4 at the molecular level is not known, but our results suggest that it
does not involve modulation of RNA expression of either gene or modulation of VIP3

protein abundance.

In addition to VIP4, mutations at five other loci create phenotypes that are
superficially indistinguishable from that of vip3. Although two of the VIP loci, VIP2 and
VIP5, map roughly to the previously identified flowering-time gene EF S, the vip2 and
vip5 mutants do not exhibit specific pleiotropic phenotypes described for efis mutants. For
example, efis mutants show increased seed dormancy, decreased apical dominance, and

normal development of more apical flowers (Soppe et al., 1999), and these phenotypes

llO

were not observed in the vip mutants. In addition, the specific floral defects seen in the
vip mutants were not reported in efls mutants (Soppe et al., 1999). Thus the VIP loci
probably define a previously unreported group of flowering repressors. In spite of the
large numbers of mutagenized plants screened in this study, the screen does not appear to
approach saturation, as five of the seven VIP loci are defined by only a single allele.
Therefore this group could be extensive. Although the relationships among these genes
remain largely undefined, evidence presented here indicates that they are unlikely to act
to modify VIP4 RNA, VIP3 RNA, or protein levels. One possibility is that these genes
define components of a protein complex, potentially analogous to the yeast Pafl
transcriptional complex. However, at least VIP3 does not exhibit strong homology with

known Pafl components or with any other yeast protein.

In addition to its early flowering phenotype, vip3, vip4, and the other vip mutants
described here display similar defects in floral development. Because plants lacking FLC
do not display floral defects, the role of these genes in floral development is mediated
outside of their regulation of FLC. We formerly proposed (Zhang and van Nocker, 2002)
that VIP4 may have a floral function similar to that of a class of gene involved in
repressing the expression of A GAMOUS (AG) and/or other floral homeotic genes outside
of their typical spatial or temporal domains. We analyzed AG RNA abundance in vip3
fully developed flowers and found that it was elevated substantially (~50%) over wild-
type flowers (data not shown) but it remains unclear if this resulted from a direct role in

AG expression or was merely an indirect effect of altered morphology of vip3 flowers.

1]]

We propose that the VIP gene class defines a mechanism involved in multiple
developmental processes, including flowering (through activation of FLC) and floral
development (through interaction with yet-undefined factors). The activity of such a
mechanism in specific contexts could be directed by spatial or temporal cues provided by
specific auxiliary factors. The functions in plant development that we propose for VIP3
are similar, but opposite, to those described for the VRN] gene (Simpson and Dean,
2002). For example, gain-of-function studies suggest that, like VIP3, VRN] is involved in
flowering through both FLC-dependent and FLC-independent mechanisms and that VRN]
is also involved in developmental processes apparently unrelated to timing of flowering,
including floral development (Levy et al., 2002). Thus, these two genes could act in an
antagonistic manner. Because the silencing of FLC associated with vemalization might
involve changes in chromatin environment, one possibility is that a VIP3 mechanism
could maintain FLC chromatin in a configuration that is relatively accessible to
transcription. In additional developmental contexts, this mechanism may act on other
genes subject to chromatin-associated silencing. Further characterization of the VIP genes
will require the identification of additional regulatory targets and the definition of

elements that specify these as targets.

112

References

Aukerman, M. J ., and Amasino, RM. (1996) Molecular genetic analysis of flowering
time in Arabidopsis, pp. 427-434 in Seminars in Developmental Biology, Vol. 7,
edited by R. M. AMASINO. Academic Press, Cambridge, UK.

Bagnall, DJ. (1993) Light quality and vemalization interact in controlling late flowering
in Arabidopsis thaliana ecotypes and mutants. Ann. Bot. 71: 75-83.

Chandler, J ., Wilson, A., and Dean, C. (1996) Arabidopsis mutants showing an altered
response to vemalization. Plant J. 10: 637-644.

Clough, SJ. and Bent, AF. (1998) Flora] dip: a simplified method for Agrobacterium-
mediated transformation of Arabidopsis thaliana.. Plant J. 16: 735-743.

Gendall, A.R., Levy, Y.Y, Wilson, A., and Dean, C. (2001) The VERNALIZA TION2 gene
mediates the epigenetic regulation of vemalization in Arabidopsis. Cell 107: 525-
535.

Harlow, E., and Lane, D. (1988) Antibodies -- a Laboratory Manual. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.

Hepworth, S. R., Valverde, F., Ravenscroft, D., Mouradov, A., and Coupland, G. (2002)
Antagonistic regulation of flowering-time gene SOC] by CONSTANS and FLC
via separate promoter motifs. EMBO J. 21: 4327-4337.

Johanson, U., West, J ., Lister, C., Michaels, S., Amasino, R., and Dean, C. (2000)
Molecular analysis of FRIGIDA, a major determinant of natural variation in
Arabidopsis flowering time. Science 290: 344-347.

Koomneef, M., Alonso-Blanco, C., Blankestijn—de Vries, H., Hanhart, C.J., and Peeters,
A.J.M. (1998a) Genetic interactions among late-flowering mutants of Arabidopsis.
Genetics 148: 885-892.

Koomneef, M., Alonso-Blanco, C., Peeters, A.J.M., and Soppe, W. (1998b) Genetic
control of flowering time in Arabidopsis. Annu. Rev. Plant Physiol. Plant Mol.
Biol. 49: 345-370.

Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of
bacteriaphage T4. Nature 227: 680-685.

Lee, H., Suh, S.S., Park, E., Cho, E., Ahn, J.H., Kim, S.G., Lee, J.S., Kwon, Y.M., and

Lee, I. (2000) The AGAMOUS-LIKE 20 MADS domain protein integrates floral
inductive pathways in Arabidopsis. Genes Dev. 14: 2366-2376.

113

Lee, I. and Amasino, R. M. (1995) Effect of vemalization, photoperiod, and light quality
on the flowering phenotype of Arabidopsis plants containing the FRIGIDA gene.
Plant Physiol. 108: 157-162.

Lee, I., Michaels D.D., Masshardt AS, and Amasino, RM. (1994) The late-flowering
phenotype of FRIGIDA and mutations in LUMINIDEPENDENS is suppressed in
the Landsberg erecta strain of Arabidopsis. Plant J. 6: 903-909.

Levy, Y.Y., Mesnage, S., Mylne, J .S., Gendall, A.R., and Dean, C. (2002) Multiple roles
of Arabidopsis VRN] in vemalization and flowering time control. Science 297:
243-246.

Lukowitz, W., Gillmor, C. S., and Scheible, W. R. (2000) Positional cloning in
Arabidopsis. Plant Physiol. 123: 795-805.

Macknight, R., Bancroft, 1., Page, T., Lister, C., Schmidt, R., Love, K., Westphal, L.,
Murphy, G., Sherson, S., Cobbett, C., and Dean, C. (1997) F CA, a gene
controlling flowering time in Arabidopsis, encodes a protein containing RNA-
binding motifs. Cell 89: 737-745.

Michaels, SD. and Amasino, RM. (1999) FLO WERING LOCUS C encodes a novel
MADS domain protein that acts as a repressor of flowering. Plant Cell 11: 949-
956.

Michaels, SD. and Amasino, RM. (2001) Loss of FLOWERING LOCUS C activity
eliminates the late-flowering phenotype of FRIGIDA and autonomous pathway
mutations but not responsiveness to vemalization. Plant Cell 13: 935-941.

Mueller, CL. and Jaehning, J .A. (2002) Ctr9, Rtfl, and Leo] are components of the
Pafl/RNA polymerase II complex. Mol. Cell. Biol. 22: 1971-1980.

Neer, E. J ., Schmidt, C. J ., Nambudripad, R., and Smith, T. F. (1994) The ancient
regulatory-protein family of WD-repeat proteins. Nature 371: 297-300.

Rouse, D.T., Sheldon, C.C., Bagnall, D.J., Peacock, W.J., and Dennis, ES. (2002) FLC, a
repressor of flowering, is regulated by genes in different inductive pathways.
Plant J. 29, 183-191.

Samach, A, Onouchi, H., Gold, S.E., Ditta, G.S., Schwarz-Sommer, Z., Yanofsky, M.F.,
and Coupland, G. (2000) Distinct roles of CONSTANS target genes in
reproductive development of Arabidopsis. Science 288: 1613-1616.

Schomburg, F .M., Patton, D.A., Meinke, D.W., and Amasino, RM. (2001) FPA, a gene

involved in floral induction in Arabidopsis, encodes a protein containing RNA-
recognition motifs. Plant Cell 13: 1427-1436.

114

Sheldon, C.C., Burn, J.E., Perez, P.P., Metzger, J ., Edwards, J .A., Peacock, W.J., and
Dennis, ES. (1999) The FLF MADS box gene: a repressor of flowering in
Arabidopsis regulated by vemalization and methylation. Plant Cell 11: 445-458.

Simpson, G. G. and Dean, C. (2002) Arabidopsis, the rosetta stone of flowering time?
Science 296: 285-289.

Smith, T.F., Gaitatzes, C., Saxena, K., and Neer, E.J. (1999) The WD repeat: a common
architecture for diverse functions. Trends Biochem. Sci. 24: 181-185.

Soppe, W.J.J., Bentsink, L., and Koomneef, M. (1999) The early-flowering mutant efis is
involved in the autonomous promotion pathway of Arabidopsis thaliana.
Development 126: 4763-4770.

van Nocker, S., Muszynski, M., Briggs, K., and Amasino, R. M. (2000) Characterization
of a gene from Zea mays related to the Arabidopsis flowering-time gene
LUMINIDEPENDENS. Plant Mol. Biol. 44: 07-122.

Wellensiek, SJ. (1962) Dividing cells as the locus for vemalization. Nature 195: 307-308.

Wellensiek, SJ. (1964) Dividing cells as the prerequisite for vemalization. Plant Physiol.
39: 832-835.

Zhang, H. and van Nocker, S. (2002) The VERNALIZA TION INDEPENDENCE4 gene
encodes a novel regulator of FLOWERING LOC US C. Plant J. 31: 663-667.

115

Chapter 4

A plant transcriptional regulatory mechanism related to the yeast Pafl/RNA
polymerase II complex contains VERNALIZATION INDEPENDENCE proteins

Flowering time data of vip3 vip4, vip4 vip5 and vip4 vip6 double mutants, anti-VIP4
antibody characterization, and immunocoprecipitation of VIP3, VIP4 and VIP6 were
contributed to the paper by Oh, S., Zhang, H., Ludwig, P., and van Nocker, S. (2004) A
mechanism related to the yeast transcriptional regulator PaflC is required for expression
of the Arabidopsis FLC/MAF MADS-box gene family. Plant Cell 16: 2940-2953.

116

Abstract

The Arabidopsis VERNALIZA T ION INDEPENDENCE genes are essential for
expression of FLOWERING LOCUS C (FLC), a major target of vemalization. Four of
these VIPs (VIP2, VIP4, VIP5, VIP6) encode proteins similar to components of the yeast
Pafl/RNA polymerase II complex (Pafl C). Considering the indistinguishable phenotype
of vip mutants, VIPs were proposed to participate in a protein complex related to Pafl C,
which has recently been shown to be involved in nucleosomal histone modifications.
Genetic and biochemical approaches were used to test this hypothesis. It was found that
double mutants of vip4 and other vip mutants did not give an enhanced phenotype when
compared with either of the single mutant parents; and VIP3, VIP4, VIP6 proteins
immunocoprecipitated. Both results suggest that VIPs may be involved in an
evolutionally conserved transcription regulatory mechanism to maintain gene expression

in higher eukaryotic organisms.

117

Introduction

Flowering to set seeds is a crucial step for plants to maintain their ecological
niche. Thus, this process is under delicate controls of multiple mechanisms to ensure that
reproductive growth coincides with favorable conditions. For certain species, flowering
does not occur or is delayed unless the plant is exposed to cold temperatures for several
weeks - a phenomenon known as vemalization.

In Arabidopsis, vemalization is mediated predominantly via epigenetic silencing
of the MADS-box flowering repressor gene FLO WERING LOC US C (FLC). At least
three factors, VERNALIZATION INSENSITIV E3 (VIN3), VERNALIZATION] (V RNl)
and VRN2, are necessary for initiating or maintaining the cold-associated FLC
suppression. VIN3 encodes a protein containing a plant homeodomain (PHD) that is
often found in proteins associated with chromatin remodeling complexes (Sung and
Amasino, 2004a); VRN] encodes a putative DNA binding protein (Levy et al., 2002); and
VRN2 encodes a protein similar to the Drosophila Polycomb-group protein Su(Z)12
(Gendall et al., 2001). Molecular studies suggest that these proteins may sequentially
modify histone H3 within FLC chromatin to establish a transcriptionally silent state
(Sung and Amasino, 2004a; Bastow et al., 2004). From a recent hypothetical model,
histone H3 of FLC chromatin in the promoter and first intron regions is de-acetylated
during vernalizing cold, dependent on VIN 3 and unknown histone deacetylase (HDAC)
activities. This hypoacetylated chromatin region may subsequently be targeted by a
histone methyltransferase (HMT) mechanism mediated by VRN] and VRN2 proteins to

methylate H3 at lysine-9 (K9) and K27 residues (Sung and Amasino, 2004b). At least in

118

yeast and animal systems, methylation at H3K9 in euchromatic regions is associated with
heterochromatin and subsequent long-term transcriptional silencing (Schultz et al., 2002).
In addition to being negatively regulated by vemalization, genetic and molecular
studies indicated that FLC is also under controls of several other mechanisms,
"firnneling" regulatory signals to suppress the expression of the flowering pathway
integrator genes SOC] and FT, which, in turn, suppresses the floral transition (Simpson
and Dean, 2002; Lee et al., 2000; Samach et al., 2000; Michaels and Amasino, 2001). An
autonomous flowering pathway, including the LUMINIDEPENDENS (LD), F CA, FY,
F VE, FPA, FLOWERING LOCUS D (FLD), and FLOWERING LATE WITH KH
MOTIFS (FLK) genes, apparently limits the accumulation of FLC transcripts through
different mechanisms, based on the proteins encoded by these genes. For example, LD
encodes a protein with a homeobox domain (Lee et al., 1994a), which is often found in
proteins associated with chromatin remodeling complexes (Fair et al., 2001), suggesting a
role of LD in chromatin dynamics. However, in some other cases, homeodomain
proteins were also shown to bind RNA (Dubnau and Struhl, 1996; Rivera-Pomar et al.,
1996), indicating that LD might also be involved in posttranscriptional control. F CA,
F PA and FLK encode proteins containing a RNA binding domain, suggesting their roles
in posttranscripiton regulation as well (Macknight et al., 1997; Schomburg et al., 2001;
Lim et al., 2004). FLC chromatin is hyperacetylated in the fld and fve mutant, suggesting
that FLD and FVE may regulate flowering by histone deacetylation (He et al., 2003;
Ausin et al., 2004). In contrast to the autonomous pathway genes, FRIGIDA (FRI) and

FRIGIDA-related (FRL) genes positively regulate FLC expression (Michaels and

119

Amasino, 1999; Sheldon et al., 1999; Michaels et al., 2004). It is not known how F R]
activates the expression of FLC.

A group of seven vemalization independence (vip) mutants (vipI - vip7) were
recently isolated to define novel FLC positive regulators (Zhang and van Nocker, 2002;
Zhang et al., 2003). These vip mutants, identified from a vemalization responsive
genetic background, flower early and suppress FLC RNA expression in the absence of
vernalizing cold. The apparently identical phenotype of the vip mutants suggests that
they may operate in the same pathway, possibly as components of the same protein
complex. Besides early flowering, the vip mutants also show mild developmental
pleiotropy, suggesting that VIP genes may play multiple roles in plant development
(Zhang et al., 2003). Molecular and genetic epistatic analysis suggested that the VIP
mechanism might be independent of FRI and the autonomous pathway (Zhang et al.,
2003)

Five of these VIP genes have been cloned. VIP3 encodes a protein consisting
almost entirely of WD motifs, which have been proposed to play a role in protein-protein
interaction. VIP2, VIP4, VIP5 and VIP6 encode proteins with sequence homology to
yeast proteins Pafl, Leo], Rtfl and Ctr9, respectively (Figure l) (Ek-Rarnos and van
Nocker, unpublished; Zhang and van Nocker, 2002; Zhang et al., 2003; Oh et al., 2004).
Together with another protein Cdc73, these yeast proteins are components of the
Pafl /RNA polymerase H complex (Pafl C, here and after), which mediates full
expression of a small subset of yeast genes and was proposed to be involved in
transcription elongation (Shi et al., 1997; Mueller and Jaehning, 2002; Krogan et al.,

2002). The sequence homology between these VIPs and the PaflC components suggests

120

Figure l. The homology of VIP2/Pafl, VIP4/Leo], VIP5/Rtfl and VIP6/Ctr9. The
pictures are drawn to scale. Putative nuclear localization signals, predicted using the
server at http://psort.ims.u-tokyo.ac.jp, are shown as ‘N’. The homologous regions of
VIP2/Pafl and VIP4/Leo] are shown as shaded boxes. The Plus-3 domain of VIP5/Rtfl
and the TPR repeats in VIP6/Ctr9 are indicated.

The pictures showing the homology of VIP5/Rtfl and VlP6/Ctr9 are from Oh et al., 2004.

121

 

 

 

 

 

 

 

 

Ema
Nn=>

122

that VIPs might constitute a plant counterpart of PaflC and regulate a sub-set of plant
genes (including FLC) involved in multiple developmental processes. The presented
research aimed to further characterize the VIP mechanism by determining the genetic

interactions among VIPs and exploring the physical interaction among these proteins.

Material and Methods

Plant material and manipulations

The flc null mutant flc-3 was a gift from Richard Amasino (University of
Wisconsin). The vipI-I, vip3-1, vip4-2, vip5-1, vip6-1 and vip7-1 mutants are as
described previously (Zhang and van Nocker, 2002; Zhang et al., 2003). The vip2-
046605 (SALK_046605) mutant was obtained from Arabidopsis Biological Resource
Center at The Ohio State University (Columbus, OH) and introduced into the ColeR]
background (Lee et al., 1994b).

To generate transgenic plants expressing FLAG-epitope-tagged VIP3 protein, a
VIP3 transcriptional unit, containing 1.2 kb of 5'/promoter DNA, was amplified from
wild-type plant DNA using primers PstI-VIP3F (5'..AAACTGCAGTAACGCTCGAGCT
TCTTCACCC..3') and BamHI-VIP3R (5'..AAAGGATCCTGAGTAATCATAGAGCGA
TACA..3'), and cloned into the plant expression vector pHuaFLAG (unpublished). The
pHuaFLAG vector is based on pPZP201zBAR (Zhang and van Nocker, 2002), and allows
for a carboxyl-terrninal translational fusion of one hexahistidine and two tandem copies
of the FLAG epitope. Plants were transformed using the floral dip method (Clough and

Bent, 1998) and Agrobacterium strain GV3101.

123

Standard growth conditions were 22 °C under 100-180 umol/m2/sec of cool white
fluorescent lighting and 16-h light/8-h dark (long-day) or 8-h light] 16-h dark (short-day)

photoperiods. Vernalizing cold treatments were as previously described (Zhang and van

Nocker, 2002).

Double mutants construction

All double mutants were obtained using the same two-step identification scheme.
The vip4-2 mutant, containing a T-DNA conferring resistance to the herbicide glufosinate,
was crossed with the other six vip mutants. Herbicide selection was conducted in the F2
population and herbicide resistant vip-like individuals were chosen for further screening.
The vip4/VIP4 individuals were identified by PCR using primers x2-allele2F (5'..CTCGA
TTCAACAATGGCAGTC AAG..3') and x2-allele2R (5'.. ATTGATCCAAAGCCTTTT
GATGCC..3'), which amplifies a fragment fi'om the wild-type VIP4 allele, but not from
the vip4-2 mutant allele. vip4/ VIP4 plants that exhibited a vip-like phenotype were
assumed to be homozygous for the other vip mutation. The identified vip/vip vip4/VIP4
plant was allowed to self and the vip vip4 double mutants were then identified from the

F3 progeny using the primer set mentioned above.

Immunoblot analysis

To generate VIP4 antiserum, a hexahistidine-tagged VIP4 amino-terminal portion

(amino acids 1-202) was expressed in E. coli and affinity purified using Ni2+-affinity
chromatography. The anti-VIP3 and anti-VIP6 antisera were as described (Zhang et al.,

2003; Oh et al., 2004). Anti-FLAG M2 monoclonal antibody was purchased from Sigma

124

(St. Louis, Mo.; catalog no. F -3 165). For immunoblot analysis, total protein was
extracted from inflorescence tissues using a protocol described previously (Zhang et al.,
2003). For immunoprecipitation experiments, anti-VIP4 and anti-VIP6 IgGs were
purified by elution fiom Protein A-agarose (Roche) using a procedure described by the
manufacturer. We used protein extracts from inflorescence apices, because VIP4 and
VIP6 are strongly expressed in these tissues. Approximately 500 pg of protein extract, in
a volume of 500 p1 of extraction buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM
EDTA, 0.2% Triton X-100, containing 1 mM phenylmethylsulfonyl fluoride (PMSF)]
was incubated with 10 pl of IgGs, and mixed continuously for 2 h. Protein A-agarose
beads (15 pl) were then added, and the mixture was incubated a further 1 h. Protein A-
a garose beads were collected by centrifugation and washed with 1 ml ice-cold washing
buffer (extraction buffer lacking Triton X-100) four times. After the final wash, the beads

were resuspended in 30 pl of SDS-PAGE sample buffer. All immunoprecipitation

procedures were carried out at 4 °C.

Immunoblotting was done as described by Harlow and Lane (1988), using PVDF
membranes (Bio-Rad; Hercules, CA) blocked with Tween-20 in phosphate-buffered

saline, and alkaline phosphatase-labeled, goat anti-rabbit IgGs (Bio-Rad), or
nitrocellulose membranes (Amersham Biosciences, Piscataway, NJ) blocked with 3%

skim milk in phosphate-buffered saline, and peroxidase-conjugated, anti-rabbit IgGs

(Am ersham).

Results

Genetic epistatic analysis between vip4 and other vip mutants

125

Epistatic analysis is a powerful tool to dissect the genetic interactions between

two genes, and it has been successfully used to determine the genetic interactions among
late flowering Arabidopsis mutations (Koornneef et al., 1998). In epistatic analysis, a
double mutant containing two mutations is constructed, and the phenotype of this double
mutant is examined. The epistatic mutation refers to the mutation that completely masks
the phenotype of the other one. If the mutations under investigation confer opposite
signaling states of the same pathway, the epistatic mutation will be genetically
downstream of the other gene; whereas if the two genes confer the same signaling state of
the same pathway, the epistatic one is genetically upstream. If the two mutations confer
similar phenotype and if a more severe phenotype (additive or synergistic) is observed in
the double mutant versus either of the single mutants, it may imply that these two genes
act in two different epistatic groups, whereas in the case that no enhanced phenotype is
observed, these two genes may act in the same epistatic group. Because leaky alleles

may give ambiguous results, epistatic analysis is mostly easily interpreted when both of

the mutations are null alleles.

Currently, the vip mutant group is represented by seven genetic loci (vipI through
mp 7). To determine if the known VIPs are involved in the same mechanism, double
mUtants of vip4 and other six vips were generated and their flowering time was measured.
Under short-day conditions, all single and double mutants flowered significantly earlier
than the flc null (Figure 2). However, there was no significant difference in flowering
betVveen the double mutants and their single mutant parents (Figure 2), and the double

mUtants were morphologically indistinguishable from the single mutant parents (data not

126

Figure 2. Combination of vip4 with vip], vip2, vip3, vipS, vip6 and vip7 mutations
does not enhance the early flowering phenotype of the single mutants. The data are
shown to scale. Flowering time of the double mutants is shown as gray bars.

The flowering time, quantified under short-day conditions, was measured as total leaf
numbers on the primary stem. Data was obtained by evaluating at least 10 plants from all
genotypes except for the vip2-046605 vip4-2, for which only four plants were evaluated.

127

 

 

 

 

 

 

 

 

 

 

 

 

 

 

c: T- sag

L'I : 9'61

I—E] “ “3min
l——l 8'1: 6'8! I
l—E - . 11:29.6
8'1: ['61 I

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

.Iaqurnu 183] "10.1.

128

l‘—l 7'! -T-' 211 |
1‘9 - _ .0'ZT-V'E3é
H or 1 car
l——l 1'2 4'. 9’81
:1: 8‘1?
l I I | l I l
01 01

shown). This lack of synergistic effect is consistent with the hypothesis that VIPs are
involved in the same mechanism.

We previously found that a mutation in VIP2 (vip2-1) was associated with
incomplete suppression of FLC (Zhang et al., 2003). The vip2-I allele was recovered
from a population mutagenized by ethyl methanesulfonate (EMS), which typically
generates point mutations and weak alleles. When grown under the same short-day

conditions, the vip2-046605 mutant flowered significantly earlier than vip2-I (data not

shown). The vipZ-046605 mutant, with a T-DNA inserted in the 8th intron of VIP2 (data
not shown), was generated by T-DNA insertion mutagenesis (Alonso et al. 2003), which
typically results in null or strong alleles. Together with the observation that vip2-046605
flowered at about the same time as other vip single mutants (Figure 2), these results

suggest that vip2-04 6605 probably represents a strong or null allele.

Dysfunction of VIPs does not affect VIP4 protein accumulation

In Arabidopsis, VIP6 protein levels are lower in vip] — vip5 mutants when
compared with the wild-type, suggesting that VIPs are important for maintaining VIP6
protein levels (Oh et al., 2004). Similarly, in yeast, disruption of some PaflC
components affects the accumulation of other integral subunits of Pafl C. For example,
loss of Paflp caused decrease of Leo], Rtfl p, Cdc73p and Ctr9p protein abundance
(Squazzo et al., 2002; Mueller et al., 2004). To determine if any of the VIPs are involved
in maintaining VIP4 abundance, an anti-VIP4 antibody was used to detect VIP4 protein
in all other six vip mutants. Except for the vip4 mutant, this VIP4 antibody specifically

recognized a ~125 kDa protein species from wild-type and other vip mutants, indicating

129

that these VIP genes are not involved in maintaining VIP4 abundance (Figure 3). The
observed molecular mass of the VIP4 protein (~125 kDa) is much larger than the size
predicted from the amino acid sequence (~72 kDa), which could be due to an abnormal

migration of VIP4, or posttranslational modifications on the VIP4 protein.

VIP3, VIP4 and VIP6 physically interact in vivo

The phenotypic similarity among the vip mutants, the results of the epistatic
analysis, and the sequence homology between yeast PaflC components and some VIPs
all suggest that at least some VIPs, if not all, may operate in a protein complex.

As an initial effort to study the constitution of this hypothetical complex, an
immunocoprecipitation experiment was carried out. Anti-VIP4 IgG immunoprecipitated
a protein species from wild-type plant protein extract that was strongly immunoreactive
with anti-VIP6 antisera and that migrated at the expected position for VIP6 (~ 130 kDa)
(Figure 4A). No such protein was detected in immunoprecipitates from either vip4-2 or
vip6-I mutant protein extracts, or from immunoprecipitations with no antibody (mock) or
with the pre-immune sera from wild-type plant protein extract (Figure 4A). A reciprocal
immunocoprecipitation using anti-VIP6 IgG immunoprecipitated a ~125 kDa protein
species that was recognized by anti-VIP4 antisera from wild-type protein extract (Figure
4B). No such protein was present in immunoprecipitates from vip4-2 or vip6-1 mutant
protein samples, or from a mock immunoprecipitation (Figure 43). Consistent with the
observation that VIPs are essential for maintaining VIP6 abundance (Oh etal., 2004), a
barely detectable amount of VIP6 was precipitated from the vip4-2 mutant extract using

anti-VIP6 IgGs.

130

N N N N
’\ ’ 19’
Q 39- 38 39‘: 39' 3% 3.33 39.

anti-VIP4[.~- “w «125 kDa

 

 

 

Figure 3. VIP4 protein abundance in all seven vip mutants. The proteins were
extracted from inflorescence tissues as described in Materials and Methods. The anti-
VIP4 antibody recognizes the N-terminal portion (amino acids 1 to 202) of the VIP4
protein.

131

Figure 4. VIP3, VIP4 and VIP6 physically interact in vivo.

(A) and (B) Physical interaction between VIP4 and VIP6. Total protein from wild-type
inflorescence apices (four lanes at left in each panel) was subjected to
immunoprecipitation using anti-VIP4 IgGs (A) or anti-VIP6 IgGs (B).
Immunoprecipitates were analyzed by protein gel blotting using anti-VIP6 or anti-VIP4
serum as indicated at left. No immunoreactive protein was detected when
immunoprecipitations were performed in the absence of IgGs (mock) or using the
respective preimmune sera. Parallel immunoprecipitations were performed using extracts
from the strong vip4-2 and vip6-1 mutants (two lanes at right in each panel).

(C) Physical interaction between VIP3, and VIP4 and VIP6. Total inflorescence apex
protein from vip3-I plants expressing a transgenic copy of FLAG-epitope-tagged VIP3
was subjected to immunoprecipitation using anti-FLAG antibody. Immunoprecipitates
were analyzed by protein gel blotting using anti-VIP6 or anti-VIP4 serum as indicated at
left. No immunoreactive protein was detected when immunoprecipitations were
performed in the absence of antibody (mock). In each panel, an unrelated, VIP6-
immunoreactive protein species present in total protein extracts is indicated (*).
Immunoblots were developed using colorimetric detection (anti-VIP6) or enhanced
chemiluminescence and autoradiography (anti-VIP4).

(D) Extracts from flc mutant plants (flc-3), vip3-1 plants containing a transgenic copy of

the VIP3-F LAG construction, and vip3-1 plants were subjected to immunoblot analysis
utilizing anti-VIP3 sera (upper panel) or FLAG antibody (lower panel).

132

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

A a? a"
5- .? ~2- -§ 31' 5
Q ‘0 Q“ d . V . U
-s a? s s 4° .93
anti-VIP6”: "“ , “3" “’3
anti-VIP4 w «125 kDa
B
anti-VIP4 ' < 125 kDa
anti-VIP6W z: —-— 4 130 kDa
,9
0”
Q
C 3 D 4*
s 3' 5v '5 '55. a?
5 4° f w 3" 4‘ 4‘
°- —- -——- 1301a) ~-
antr VIP6* _, ‘ 8 a nti—VIP3 H: 1...; <41kDa
- <36 kDa
anti-VIP4 _ “If <125 kDa
h In ' anti-FLAG "' ‘41 "D‘

 

 

133

 

 

 

Although VIP3 does not show homology with any of the PaflC components, the
apparently indistinguishable phenotype between vip3 and other vip mutants suggests that
VIP3 could work in concert with VIP4 and VIP6. To test the possible physical
interactions of VIP3, VIP4 and VIP6, we carried out immunocoprecipitation experiments
using protein extract from a transgenic plant expressing a FLAG-epitope tagged VIP3
protein in the vip3-1 mutant background (Figure 4D). This epitope-tagged VIP3 fusion
protein fully complemented the vip3 mutant phenotype (data not shown), suggesting its
functional equivalency to the native VIP3. The anti-F LAG monoclonal antibody
immunoprecipitated proteins that were strongly immunoreactive to the anti-VIP4 and
anti-VIP6 antisera, with the molecular masses expected for VIP4 and VIP6 proteins. No
such protein species was observed from a mock immunoprecipitation (Figure 4C).

Based on these immunocoprecipitation results, we concluded that VIP3 interacts
with VIP4 and VIP6 in vivo, and that VIPB, VIP4 and VIP6 are components of a protein

complex.

Discussion
For flowering, winter-annual plants must effectively override flowering
suppressive mechanism(s) associated with vegetative growth via a process known as
vemalization. In Arabidopsis, one of such flowering suppressive mechanisms includes at
least seven VIP genes, which are required to maintain the expression of the MADS-box
flowering suppressors FLC and MAFs (Zhang et al., 2003; Oh et al., 2004). Consistent
with the hypothesis that the FLC-dependent vemalization mechanism might be conserved

within the Brassicaceae family (Tadege et al., 2001), proteins immunoreactive to anti-

134

VIP3, anti-VIP4 and anti-VIP6 antibodies are also found in vemalization responsive
Brassica oleracea cultivars (Figure 5 and data not shown). Interestingly, at least VIP4
and VIP6 have clear homologues in the rice genome, whereas no FLC homologue is
present, suggesting that VIPs and their targets also participate in gene expression in plant
species outside of the Brassicaceae family.

Our epistatic analysis indicates that the seven known VIPs may regulate FLC
through the same mechanism. No enhanced phenotype, in terms of either flowering time
or plant morphology, was observed when combining mutations in VIP4 and each of the
other six VIP genes, suggesting that these VIPs comprise a single epistatic group.
However, the lack of synergistic effect in the vip4 vip6 double mutant could also be due
to the dependence of VIP6 upon the presence of VIP4 (Oh et al., 2004). It is not known
if there are any sub-epistatic groups exist among the VIPs (i.e., if some VIPs have distinct
function). In yeast, although Ctr9 and Pafl are present in the same complex,
compromising either one confers a more severe phenotype than compromising Cdc73 or
Rtfl (Betz et al., 2002), suggesting that they have distinct functions. Indeed, a very
recent study indicates that Pafl and Rtfl may be involved in mRNA polyadenylation, a
function distinct from chromatin modification (see below) (Mueller et al., 2004). An
analysis of the complete array of the double mutants, with all possible combinations of
vip mutations, is needed to establish the detailed epistatic relationships, if any, within the
group. However, because VIP6 accumulation is dependent on the other VIPs (i.e., VIP6
protein level is very low in other vip mutants) (Oh et al., 2004), it is not likely to observe

an enhanced phenotype in double mutants containing the vip6 mutation.

135

 

Anti-VIP3 —— W

Figure 5. Protein species immunoreactive to anti-VIP3 and anti-VIP4 antibodies are
present in broccoli and cauliflower. Total protein was extracted from shoot
meristematic tissues as described in Materials and Methods. 1, Wild-type Arabidopsis; 2,
Arabidopsis vip3-1 (top panel) or vip4-2 (bottom panel) mutant; 3, broccoli; 4,
cauliflower.

 

 

 

The genetic epistatic analysis indicated that the VIPs might operate in a common
mechanism. Given the observation that VIP4, VIP5 and VIP6 are homologous to
components of yeast Pafl C, most likely the VIPs are involved in a plant protein complex.
The immunocoprecipitation experiment showed that at least VIP3, VIP4, and VIP6
physically interact in vivo (Figure 4), indicating that these VIPs may indeed operate in a
protein complex, consistent with our previous hypothesis (Zhang and van Nocker, 2002;
Zhang et al., 2003). Whereas no VIP3 homologue is present in yeast, VIP4 and VIP6
yeast homologues were found as integral components of a ~1.7 MDa transcriptional
complex named PaflC (Mueller and J aehning, 2002). Containing three additional yeast
proteins (Rtfl, Cdc73, and Pafl ), PaflC physically interacts with the initiating and
elongating forms of RNA polymerase II (Mueller and Jaehning, 2002). If VIPs indeed
constitute a plant counterpart of Pafl C, we would expect that VIP2 and VIPS,
homologues of Pafl and Rtfl, respectively, also show physical interactions with VIP4
and VIP6. However, we cannot exclude the possibility that some components may have
been removed from the complex during evolution. The physical interaction of VIP3 with
VIP4 and VIP6 suggests that the structure of PaflC might be elaborated in plants. On
one hand, it is possible that new components (e.g., VIP3) may have been recruited to the
PaflC during the course of plant evolution to provide more specific controls for
expanded genome coding capacity and increased chromatin structure complexity. On the
other hand, some specific components might have been disassociated from the complex
and evolved into distinct mechanisms. Preliminary studies of an Arabidopsis mutant
carrying a mutation in the yeast Cdc73 homologous gene did not show a vip mutant

phenotype nor suppress FRI, but had a strong effect on the photoperiodic response (van

137

Nocker, unpublished). It is possible that the AtCDC73 specifically targets the MAFs of
the FLC/MAF gene family, but not FLC.

How VIPs regulate FLC is highly speculative. Recent studies indicate that, rather
than being simply present as scaffold proteins, at least some of the PaflC components are
required for different histone modifiers to set up a 'histone code' on their target genes
(Gerber and Shilatifard, 2003). The 'histone code' is a combination of different covalent
modifications (e. g., phosphorylation, methylation, acetylation, ubiquitination,
sumoylation) on nucleosomal histones to epigenetically determine the transcriptional
state of a gene (for review of the 'histone code' hypothesis, see Jenuwein and Allis, 2001).
The PaflC subunits Paflp and Rtflp may regulate the activity of Rad6-Bre1 complex to
ubiquinate histone HZB on lysine-123 (K123) in the promoter regions (N g et al., 2003;
Wood et al., 2003). HZBK123 ubiquitination is a prerequisite step for the subsequent
methylation of histone H3K4 and K79 by the histone methyltransferases (HMT) Set] and
Dotl , respectively. In an ubiquinated H2BK123-independent manner, H3K36 can be
methylated by another HMT, Set2 (N g et al., 2003). At least methylation at H3K4 and
H3K79 are usually associated with transcriptionally active genes (Hampsey and
Reinberg, 2003). The recruitment of all three HMTs mentioned above to chromatin
requires the presence of Pafl C, and mutations in Rtfl or Ctr9 cause a global methylation
defect in yeast (Krogan et al., 2003a, b). Intriguingly, the human trx-related MLL (mixed
lineage leukemia) protein, which carries out H3K4 methylation at Hox loci in vivo, is
related to the yeast HMT Setl (Milne et al., 2002).

Given the homology between VIPs and PaflC components, the physical

interaction of VIP4 and VIP6, and the existence of homologs of additional Pafl C

138

components in the Arabidopsis genome, it is possible that VIPs represent a plant
counterpart of the Pafl C. Probably, VIPs may function in concert with a plant Trx-like
mechanism to label genes (possibly including FLC or an FLC activator) as
transcriptionally active, by assisting histone methylation on H3K4/K36/K79 (Figure 6).
However, immunoblotting analysis of chromatin histone-enriched proteins from vip3,
vip4, vip5 and vip6 mutants using antisera specific for histone H3 methylated at K4, K36,
or K79 did not detect any significant difference in apparent abundance of modified
histones when compared with the wild-type control extracts (Oh et al., 2004), suggesting
that, unlike their yeast homologs, VIPs apparently do not affect histone methylation in a

genome-wise (global) manner, at least on the H3K4/K36/K79 residues.

139

Figure 6. A model for the VIP mechanism. VIPs may represent a plant version of
Pafl C. This hypothetical VIP complex may function in concert with a plant Trithorax-
like mechanism to activate FLC during vegetative stage, by assisting histone
posttranslational modifications

140

 

SEEP—so but

141

References

Alonso, J .M., Stepanova, A.N., Leisse, T.J., Kim, C.J., Chen, H., Shinn, P., Stevenson,
D.K., Zimmerman, J ., Barajas, P., Cheuk, R., Gadrinab, C., Heller, C., Jeske, A.,
Koesema, E., Meyers, C.C., Parker, H., Prednis, L., Ansari, Y., Choy, N., Deen, H.,
Geralt, M., Hazari, N., Hom, E., Karnes, M., Mulholland, C., Ndubaku, R., Schmidt,
1., Guzman, P., Aguilar-Henonin, L., Schmid, M., Weigel, D., Carter, D.E.,
Marchand, T., Risseeuw, E., Brogden, D., Zeko, A., Crosby, W.L., Berry, CC, and
Ecker, JR. (2003). Genomewide insertional mutagenesis of Arabidopsis thaliana.
Science 301: 653-657.

Ausin, I., Alonso-Blanco, C., Jarillo, J .A., Ruiz-Garcia, L., and Martinez-Zapater, J.M.
(2004) Regulation of flowering time by FVE, a retinoblastoma-associated protein.
Nat Genet. 36: 162-6.

Bastow, R., Mylne, J .S., Lister, C., Lippman, Z., Martienssen, R.A., and Dean, C. (2004)
Vernalization requires epigenetic silencing of FLC by histone methylation. Nature
427: 164-167.

Betz, J.L., Chang, M., Washburn, T.M., Porter, S.E., Mueller, C.L., and Jaehning JA.
(2002) Phenotypic analysis of Pafl /RNA polymerase H complex mutations
reveals connections to cell cycle regulation, protein synthesis, and lipid and
nucleic acid metabolism. Mol. Genet. Genomics 268: 272-285.

Clough, SJ. and Bent, AF. (1998) Floral dip: a simplified method for Agrobacterium-
mediated transformation of Arabidopsis thaliana. Plant J. 16: 73 5-743.

Dubnau, J., and Struhl, G. (1996) RNA recognition and translational regulation by a
homeodomain protein. Nature 379: 694-699.

Fair, K., Anderson, M., Bulanova, E., Mi, H., Tropschug, M., and Diaz, MD. (2001)
Protein interactions of the MLL PHD fingers modulate MLL target gene
regulation in human cells. Mol. Cell. Biol. 21: 3589—3597.

Gendall, A.R., Levy, Y.Y, Wilson, A., and Dean, C. (2001) The VERNALIZA TION2 gene
mediates the epigenetic regulation of vemalization in Arabidopsis. Cell 107: 525-
535.

Gerber, M. and Shilatifard, A. (2003) Transcriptional elongation by RNA polymerase II
and histone methylation. J. Biol. Chem. 278: 26303-26306.

Hampsey M., and Reinberg D. (2003) Tails of intrigue: Phosphorylation of RNA
polymerase II mediates histone methylation. Cell 113: 429-432.

Harlow, E., and Lane, D. (1988) Antibodies -- a Laboratory Manual. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.

142

He, Y., Michaels, 8., and Amasino, R. (2003) Regulation of flowering time by histone
acetylation in Arabidopsis. Science 302: 1751-1754.

Jenuwein, T. and Allis, CD. (2001) Translating the histone code. Science 293: 1074-
1080.

Koomneef, M., Alonso-Blanco, C., Blankestijn-de Vries, H., Hanhart, C.J., and Peeters,
A.J.M. (1998) Genetic interactions among late-flowering mutants of Arabidopsis.
Genetics 148: 885-892.

Krogan, N.J., Kim, M., Ahn, S.H., Zhong, G., Kobor, M.S., Cagney, G., Emili, A.,
Shilatifard, A., Buratowski, S., and Greenblatt, J .F. (2002) RNA polymerase II
elongation factors of Saccharomyces cerevisiae: a targeted proteomics approach.
Mol. Cell. Biol. 22: 6979-6992.

Krogan, N.J., Dover, J., Wood, A., Schneider, J ., Heidt, J ., Boateng, M.A., Dean, K.,
Ryan, O.W., Golshani, A., Johnston, M., Greenblatt, J .F ., and Shilatifard, A.
(2003a) The Pafl complex is required for histone H3 methylation by COMPASS
and Dotlp: linking transcriptional elongation to histone methylation. Mol. Cell.

1 l : 72 1-729.

Krogan, N.J., Kim, M., Tong, A., Golshani, A., Cagney, G., Canadien, V., Richards, D.P.,
Beattie, B.K., Emili, A., Boone, C., Shilatifard, A., Buratowski, S., and Greenblatt,
J. (2003b) Methylation of histone H3 by Set2 in Saccharomyces cerevisiae is
linked to transcriptional elongation by RNA polymerase II. Mol. Cell Biol. 23:
4207-4218.

Lee, H., Suh, S.S., Park, E., Cho, E., Ahn, J.H., Kim, S.G., Lee, J.S., Kwon, Y.M., and .
Lee, I. (2000) The AGAMOUS-LIKE 20 MADS domain protein integrates floral
inductive pathways in Arabidopsis. Genes Dev. 14: 2366-2376.

Lee, I., Aukerman, M.J., Gore, S.L., Lohman, K.N., Michaels, S.D., Weaver, L.M., John,
M.C., Feldmann, K.A., and Amasino, R.M. (1994a) Isolation of
LUMINIDEPENDENS: A gene involved in the control of flowering time in
Arabidopsis. Plant Cell 6: 75-83.

Lee, 1., Michaels D.D., Masshardt AS, and Amasino, R.M. (1994b) The late-flowering
phenotype of FRIGIDA and mutations in LUMINIDEPENDENS is suppressed in
the Landsberg erecta strain of Arabidopsis. Plant J. 6: 903-909

Levy, Y.Y., Mesnage, S., Mylne, J .S., Gendall, A.R., and Dean, C. (2002) Multiple roles

of Arabidopsis VRNI in vemalization and flowering time control. Science 297:
243-246.

143

Lim, M.H., Kim, J., Kim, Y.S., Chung, K.S., Seo, Y.H., Lee, 1., Kim, J., Hong, C.B., Kim,
H.J., and Park, CM. (2004) A new Arabidopsis gene, FLK, encodes an RNA
binding protein with K homology motifs and regulates flowering time via
FLOWERING LOCUS C. Plant Cell 16: 731-40.

Macknight, R., Bancrofi, I., Page, T., Lister, C., Schmidt, R., Love, K., Westphal, L.,
Murphy, G., Sherson, S., Cobbett, C., and Dean, C. (1997) F CA, a gene
controlling flowering time in Arabidopsis, encodes a protein containing RNA-
binding motifs. Cell 89: 737-745.

Michaels, SD. and Amasino, RM. (1999) FLO WERING LOCUS C encodes a novel
MADS domain protein that acts as a repressor of flowering. Plant Cell 11: 949-
956.

Michaels, SD. and Amasino, RM. (2001) Loss of FLOWERING LOCUS C activity
eliminates the late-flowering phenotype of FRIGIDA and autonomous pathway
mutations but not responsiveness to vemalization. Plant Cell 13: 935-941.

Michaels, S.D., Bezerra, LC, and Amasino, RM. (2004) FRIGIDA-related genes are
required for the winter-annual habit in Arabidopsis. Proc. Natl. Acad. Sci. USA
101: 3281-3285.

Milne, T.A., Briggs, S.D., Brock, H.W., Martin, M.E., Gibbs, D., Allis, CD, and Hess,
J .L. (2002) MLL targets SET domain methyltransferase activity to Hox gene
promoters. Mol. Cell 10: 1107-1117.

Mueller, CL. and Jaehning, J.A. (2002) Ctr9, Rtfl, and Leol Are Components of the
Pafl/RNA Polymerase II Complex. Mol. Cell. Biol. 22: 1971-1980.

Mueller, C.L., Porter, S.E., Hoffman, M.G., and Jaehning, J .A. (2004) The Pafl complex
has functions independent of actively transcribing RNA polymerase II. Mol. Cell.
14: 447-56.

Ng, H.H., Dole, S., and Struhl, K. (2003) The Rtfl component of the Pafl transcriptional
elongation complex is required for ubiquitination of histone H2B. J. Biol. Chem.
278: 33625-33628.

Oh, S., Zhang, H., Ludwig, P., and van Nocker, S. (2004) A mechanism related to the
yeast transcriptional regulator PaflC is required for expression of the Arabidopsis
FLC/MAF MADS-box gene family. Plant Cell 16: 2940-2953.

Rivera-Pomar, R., Niessing, D., Schmidt-Ott, U., Gehring, W.J., and Jackle, H. (1996)
RNA binding and translational suppression by bicoid, Nature 379:746-749.

144

Samach, A., Onouchi, H., Gold, S.E., Ditta, G.S., Schwarz-Sommer, Z., Yanofsky, M.F.,
and Coupland, G. (2000) Distinct roles of CONSTANS target genes in
reproductive development of Arabidopsis. Science 288:1613-1616.

Schomburg, F.M., Patton, D.A., Meinke, D.W., and Amasino, RM. (2001) FPA, a gene
involved in floral induction in Arabidopsis, encodes a protein containing RNA-
recognition motifs. Plant Cell 13: I427-1436.

Schultz, D.C., Ayyanathan, K., Negorev, D., Maul, G.G., and Rauscher, F.J. 3rd. (2002)
SETDB l: a novel KAP-l-associated histone H3, lysine 9-specific
methyltransferase that contributes to HPl-mediated silencing of euchromatic
genes by KRAB zinc—finger proteins. Genes Dev. 16: 919-932.

Sheldon, C.C., Burn, J.E., Perez, P.P., Metzger, J., Edwards, J .A., Peacock, W.J., and
Dennis, ES. (1999) The FLF MADS box gene: a repressor of flowering in
Arabidopsis regulated by vemalization and methylation. Plant Cell 11: 445-458.

Shi, X., Chang, M., Wolf, A.J., Chang, C.-H., Frazer-Abel, A.A. Wade, P.A., Burton,
Z.F., and Jaehning, J .A. (1997) Cdc73a and Paflp are found in a novel RNA
polymerase 11- containing complex distinct from the Srbp-containing holoenzyme.
Mol. Cell. Biol. 17: 1160-1169.

Simpson, GO. and Dean, C. (2002) Arabidopsis, the Rosetta stone of flowering time?
Science 296: 285-289.

Squazzo, S.L., Costa, P.J., Lindstrom, D.L., Kumer, K.E., Simic. R., Jennings, J .L., Link,
A.J., Amdt, K.M., and Hartzog, GA. (2002) The Pafl complex physically and
functionally associates with transcription elongation factors in viva. EMBO J. 21:
1764-1774.

Sung, S., and Amasino, R.M. (2004a). Vernalization in Arabidopsis thaliana is mediated
by the PHD finger protein VIN3. Nature 427: 159-164.

Sung, S., and Amasino, R.M. (2004b) Vernalization and epigenetics: how plants
remember winter. Curr Opin Plant Biol. 7: 4-10.

Tadege, M., Sheldon, C.C., Helliwell, C.A., Stoutjesdijk, P., Dennis, ES, and Peacock,
W.J. (2001) Control of flowering time by FLC orthologues in Brassica napus.
Plant J. 28: 545-553

Wood, A., Krogan, N.J., Dover, J ., Schneider, J ., Heidt, J ., Boateng, M.A., Dean, K.,
Golshani, A., Zhang, Y., Greenblatt, J.F., Johnston, M., and Shilatifard, A. (2003).
Brel, an E3 ubiquitin ligase required for recruitment and substrate selection of
Rad6 at a promoter. Mol. Cell 11: 267—274.

145

Zhang, H. and van Nocker, S. (2002) The VERNALIZA TION INDEPENDENCE4 gene
encodes a novel regulator of FLOWERING LOC US C. Plant J. 31: 663-673.

Zhang, H., Ransom, C., Ludwig, P., and van Nocker, S. (2003) Genetic analysis of early-
flowering mutants in Arabidopsis defines a class of pleiotropic developmental
regulator required for activity of the flowering-time switch FLC. Genetics 164:
347-358.

146

Chapter 5

Perspectives and future directions

147

Introduction

One of the most important adaptive features for biennial and winter-annual plants
is vemalization, which ensures plants to flower after winter, under physiologically
favorable conditions. Using Arabidopsis as a model, it was found that, after vernalizing
cold, the MADS-box flowering repressor FLOWERING LOCUS C (FLC) is
epigenetically silenced (Michaels and Amasino, 1999; Sheldon et al., 1999), and mutants
that lost the capability of initiating or maintaining FLC silencing give a vemalization
insensitive phenotype (Sung and Amasino, 2004; Gendall et al., 2001; Levy et al., 2002),
both suggesting an essential role of FLC in vemalization.

My research has been focused on how FLC is maintained in an active state during
the vegetative growth stage. Taking a forward genetic approach, I screened mutagenized
winter-annual populations for Arabidopsis mutants that do not require vernalizing cold to
flower. A group of seven vemalization independence (vip! - vip7) genes was identified
as novel FLC activators. Genetic and molecular epistatic analysis suggested that these
VIPs might represent a FLC regulatory mechanism distinct from that of the previously
known FLC regulators, e. g., FRIGIDA and LUMINIDEPENDENS (Zhang and van
Nocker, 2002; Zhang et al., 2003; Figure 1).

In this chapter, I will discuss the genetic approach that I adopted to identify the
VIPs and speculation of the mechanism for these FLC activators. Finally, I will present

preliminary results from my ongoing projects.

148

s“

“A? 3&6, 39‘ :5" 3.9
.t-a."rt.w_- ..

:’§
.5: in: “"4"” 6.3:“ SQ.

ACTIN

Figure 1. VIPs operate in a mechanism distinct from that of FRIGIDA. Total RNA
was extracted from aerial portions of 14-day-old, wild-type and vip3-1, vip4-2, vip5-1,
vip6-1 seedlings and analyzed by gel blotting using a FRIGIDA probe, amplified using
primers FRIP-F 5'-AAAGGATCCCATGTCCAATTATCCACCGAC-3' and FRIP-R 5'-
AAAACCTGGATCCGTGACCGCTTCAAAGCA-3'. The membrane was subsequently
stripped and reprobed with an ACTIN probe (described in Zhang et al., 2003) to indicate
the integrity and relative quantity of total RNA in each lane.

149

A successful genetic approach to identify FLC regulators

The completely sequenced genome and the availability of vemalization-
responsive strains make Arabidopsis an excellent model to study the molecular basis of
vemalization. Different mutant screen criteria were used to target genes that are involved
in different regulation mechanisms of the hypothetical "vemalization pathway". In
general, screening for mutants that do not need vernalizing cold treatment to flower will
most likely target genes that are able to keep the vemalization pathway in an "off" (for
loss-of-function mutants) or "on" (for gain-of-function mutants) state; while screening for
mutants that are insensitive to vernalizing cold will probably recover genes that are
required to "turn on" (for loss-of-function mutants) or "turn off" (for gain-of-function
mutants) the vemalization pathway.

The vips were identified using the first mutant screening criteria, from screening
populations mutagenized by fast-neutron and T-DNA insertion, which typically generate
strong loss-of-function mutations. My results showed that VIPs are essential for FLC
expression. From this point of view, VIPs define factors to keep the vemalization
pathway in an "off" state. However, vemalization does not seem to operate through
downregulating VIPs, which indicates that VIPs only act closely with vemalization,
rather than being integral components of this process. It is noteworthy that vips only
represent a subgroup of the mutants that have been identified from my screening (Table
1). Two additional subgroups of mutants may define additional FLC activators, one
subgroup is represented by mutants A2, C1, F1, G2, T36-l , and T46-4, which are
indistinguishable from vemalized wild-type plants. The other subgroup is represented by

mutants A3 and N7, which are serrated and flower almost as early as vemalized wild-

150

 

Table 1. Early flowering mutants that were identified from my screening. This table
listed all 13 mutants that have been recovered from screening of a fast-neutron
mutagenized population and a T-DNA insertion mutagenized population. The names in
parenthesis represent specific alleles.

 

 

Fast neutron mutants T-DNA mutants
A2 vip4-I
A3 (N7) T34-1 (G2)
C1 T46-4
vip5-1 vip6-2
F 1
G2 (T34—1)
N7 (A3)
vip3-I
vip6-1

 

151

 

type plants. The existence of these ‘non-vz’p’ mutants suggests that FLC might be under
the control of a regulatory network more complicate than what we thought before.

Besides the vip mutants, there are mutants that do not show the pleiotropic phenotype
displayed by vips, molecular characterization of genes represented by these ‘non-vip’
mutants may identify factor(s) intrinsic to the vemalization mechanism. However, gene(s)
that has been identified from other labs using the same mutant screening approach as

mine may also be represented in our mutant collection [e.g., FRIGIDA LIKE I , ABA

H YPERSENSITI VB 1 (Michaels et al., 2004; Bezerra et al., 2004)]. Based on the
phenotypic study of all of the mutants that have been recovered from my screen, some
known FLC activators [e.g., EARLY IN SHORT DAYS4 and PHOTOPERIOD-
INDEPENDENT EARLY FLOWERINGI (Reeves et al., 2002; Noh and Amasino, 2003)]
are not likely represented in my mutant collection. Together with the fact that most of

the vip mutants only have one allele, it is clear that my mutant screening was not
saturated. Nevertheless, the successful recovery of four of the vip mutants (vip3-l, vip4-1,
vip5-1, vip6-I, vip6-2) and mutants of several potential non- VIP FLC activators suggest
that, although not being a saturated screen, the genetic approach that I used is effective to
target FLC activators (or regulators).

Functionally redundant genes can be identified via analysis of gain-of-function
mutations if they are sufficient to activate the pathways that they are involved in.
Activation tagging, which has the potential to generate gain-of-function version of a
particular gene (Hayashi et al., 1992), could be a complementary strategy to identify FLC
regulators. Based on the same mutant screening criteria as that for the vips, mutants

recovered from an activation tagging population likely represent genes that normally

152

 

suppress FLC, or flowering time genes that are capable of promoting flowering when
overexpressed [e.g., CONSTANS (Onouchi et al., 2000)]. For the research area that I am
involved in, the only gene that was identified so far using the activation tagging approach
is the AGAMOUS-LIKEZO (A GL20) [a.lca. SUPPRESSOR 0F OVEREXPRESSION OF
C ONSTANSI (SOC!) (Lee et al., 2000; Samach et al., 2000)], which is a floral pathway
integrator operating downstream of FLC. Considering the fact that a large number of
FLC regulators have been isolated from "loss-of-fimction" mutagenesis, this gene
discovery rate for the activation tagging approach is very low. The reason that put
activation tagging approach in this apparently disadvantageous position for identifying
FLC regulators might be due to the fact that most FLC regulators are not sufficient to
regulate FLC by themselves [e.g., F VE, VIN3, VIPs (Ausin et al., 2004; Sung and
Amasino, 2004; Zhang et al., 2003)]. Another reason could be the stringent requirement
for the activation tagging cassette being targeted to the correct promoter regions to drive
gene expression, making it difficult to identify novel genes from a relatively small

population.

VIPs may represent a previously unknown transcription regulation mechanism in
plants

VIPs were proposed to operate in a protein complex, in an analogous manner to
the yeast Pafl C. The observation that VIP3, VIP4 and VIP6 physically interact suggests
that VIPs may indeed be involved in a protein complex. To what extent this hypothetical
plant complex resembles PaflC remains to be further explored. VIP2 and VIPS are

homologues of Pafl and Rtfl , respectively (Ek-Ramos and van Nocker, unpublished; He

153

 

et al., 2004; Oh et al., 2004), and their potential interactions with VIP3, VIP4, VIP6
remain to be tested. The interaction of VIP3, a protein that is not similar to any of the
PaflC components, with VIP4 and VIP6 suggests that the structure of PaflC is not fully
conserved in plants (Chapter 4). Most likely, PaflC has recruited new components
during evolution to 'handle' bigger genomes and more complicate chromatins. Molecular
characterization of additional VIP genes and biochemical purification of the VIP complex
offer two complementary approaches to resolve the structure and, more importantly, the
function of the VIP complex.

The yeast PaflC has been recently shown to be involved in generating a ‘histone
code’ for transcriptionally active genes, by assisting histone H3K4 trimethylation (N g et
al., 2003a). Similarly, although VIPs are not likely involved in global histone
methylation (Oh et al., 2004), VIPZ and VIP6 are apparently required for such histone
modifications on FLC and MAFI chromatin (He et al., 2004). At this point, it is still not
known what histone methyltransferase(s) (HMT) is recruited by VIPs. Some of the
PaflC dependent histone methylations require HZB ubiquitination (N g et al., 2003b); if
VIPs represent a plant Pafl C, are their functions also H2B ubiquitination dependent?
Although histone ubiquitination has been shown to affect gene transcription in yeast, no
such study has been documented for Arabidopsis or other plants. The Arabidopsis
genome encodes homologues of Rad6 and Brel (yeast H2b ubiquitination enzymes)
(Ludwig and van Nocker, unpublished), suggesting a potential of histone ubiquitination
in this organism. A detailed characterization of these homologous proteins may help to

elucidate their functions in plants.

154

Besides FLC, VIPs regulate a spectrum of other genes (Oh et al., 2004). How
many of these genes are direct VIP targets is still unknown. Identification of the direct
VIP target(s) is a crucial step for elucidating VIP function. In yeast, the VIP homologous
proteins (PaflC components) were shown to be physically associated with the elongating
form the RNA polymerase II (N g et al., 2003a) and distributed along open reading frames
(Pokholok et al., 2002). If VIPs, like their yeast homologues, are also physically
associated with the elongating form of RNA polymerase II, which can be tested by an
immunocoprecipitation experiment with the appropriate antibody, it would be possible to
identify genes that are directly targeted by the VIP mechanism through the ChIP-on-Chip
approach (van Steensel and Henikoff, 2003).

How the VIP activation effect on FLC is counteracted by vemalization is also
unanswered. It is tempting to think that vemalization may suppress FLC via negatively
regulating VIPs. However, given the fact that VIP2, VIP3, VIP4, VIP5, VIP6 mRNA and
VIP3, VIP4, VIP6 protein levels remain unchanged afier vernalizing cold (Bk-Ramos and
van Nocker, unpublished; Zhang and van Nocker, 2002; Zhang et al., 2003; Oh et al.,
2004), and the fact that vemalized wild-type plants do not phenocopy the vips, it is
unlikely that VIP function is completely annulled by vemalization. Two hypotheses have
been raised to address this question. Briefly, vemalization may weaken, rather than
compromise, VIP activity; or, alternatively, vemalization may change the FLC chromatin
into a configuration that is repellent to the VIP mechanism (Oh et al., 2004). However, at
least two additional scenarios cannot be ruled out to address the antagonistic effects of
vemalization and VIPs on FLC expression. One scenario could be that vemalization may

change the composition of the VIP complex, by removing a component that is crucial for

155

 

targeting or activating FLC. A comparison of the VIP complex components from
vemalized and nonvemalized plants will test this hypothesis. The other scenario could be
that VIPs, instead of functioning throughout the plant life cycle, function only in certain
developmental stages (e.g., during gametogenesis or embryogenesis). In this case,
vemalization and VIPs operate independently, in a temporally separated manner (i.e.,
vemalization does not directly affect VIPs' function). The observation that VIP4 protein
is detectable only in the inflorescence tissue (Figure 2) would support this hypothesis.
However, the presence of steadily detectable VIP3 and VIP6 in seedlings (young leaves)
(Zhang et al., 2003; Oh et al., 2004) may argue against it. To further test this hypothesis,
the temporal requirement of VIPs by plant to establish high FLC expression need to be
determined. This could be explored by using a transgenic plant expressing the cloned

VIPs, in an inducible (controllable) manner (e. g., VIP4-Glucocorticoid Receptor fusion).

156

9?
Q .695
6‘5“ 03
9‘9 9V°°

 

Figure 2. VIP4 protein is detected only in Arabidopsis inflorescence tissue. The
tissue collection, protein extraction and western blotting were carried out essentially as
described previously (Zhang and van Nocker, 2002; Zhang et al., 2003). The anti-VIP4
antibody was described in Chapter 4. A portion of representative SDS-PAGE gel, stained
by Coomassie blue afier blotting, is shown to indicate the relative quality and quantity of
proteins in each lane.

157

Preliminary results
I am currently doing several experiments to further elucidate VIP function. These
experiments are largely in progress. Here I present the data that was obtained, with a

hope of helping future similar studies.

Identification of VIP4-interacting factors using a yeast two-hybrid approach.
An Arabidopsis meristem two-hybrid cDNA library was constructed using the

HybriZAP-2.1 system (Stratagene, La Jolla, CA) following the supplier’s instruction.

The primary library contained 4.65 X 106 pfu (plaque forming units). The primary
library was amplified once and converted to a plasmid (pAD-GAL4) library by in vivo
mass excision following the manufacturer’s protocol (Stratagene).

To construct a VIP4 bait for screening, a cDNA encoding the full length VIP4
protein was amplified by reverse transcription-polymerase chain reaction (RT-PCR)
using oligonucleotide primers EcoRI-VIP4 F 5’-AAGAATTCATGGTTAAAGGAGAA
AAGAG-3’ and SalI-VIP4 R 5’-AAGTCGACTTAATCTTCGTCACTGTCATC-3’. The
PCR product was cloned into the EcoR I/Sal I site of the pBD-GAL4 vector and the
construct was named as pBD-VIP4. The reading frame of the VIP4/pBD-GAL4
conjunction region was verified by sequencing.

For library screening, pBD-VIP4 was transformed into yeast YGR2 cells and the
YGR2zpBD-VIP4 was subsequently transformed with cDNA library plasmid DNA
mentioned above. The transformants were plated on selective medium [SD (synthetic
dropout) lacking leucine, tryptophane and histidine (SD ——L —W — H)] and incubated at 30

°C for six days. Any colonies that grew on the selective medium were streaked onto SD

158

—L —W —H media and assayed for B-galactosidase activity using the filter lift assay,
following the supplier’s instruction (Stratagene). Colonies that were capable of turning
blue in the X-Gal assay were considered as potential positives. Plasmids from these
clones were recovered using the Zymoprep yeast plasmid miniprep (Zymo Research,
Orange, CA), transformed into E. coli strain DHSa, and purified. The purified plasmids
were then transformed into yeast YGR2 either alone or with pBD-VIP4, pLamin C. The
pLaminC, which expresses the BD of GAL4 and amino acids 67-230 of human lamin C,
is used as a control for negative interactions with the identified VIP4 interacting clones.
The transformants were plated onto the appropriate selective medium according to the
provider’s instruction (Stratagene). These transformants were subsequently evaluated for
Lac Z activity and those that are capable of activating reporter gene only in the presence
of pBD-VIP4 were considered as positives. The positives were sequenced using the
oligonucleotide primer 5 ’-CCACTACAATGGATGATGTATA-3 ’.

A B-galactosidase assay was used to quantify interactions. Yeast was grown in
selective medium (SD —Leu ——Trp) overnight. 2ml of the overnight culture was inoculated

into 8 ml YPD and the culture was grown to OD600 0.6-0.8 at 30 °C. The OD600 was

recorded. For each sample, 0.5 ml of culture was transferred into each of three 1.5 ml
microcentn'fuge tubes (thus three duplicate for each sample) and cells were pelleted by
centrifuging. Cells were washed with 0.5 ml Bufferl [100 mM HEPES, 155 mM NaCl, 2
mM L-Aspartate (hemi-Mg salt) (Sigma, St. Louis, MO), 1% BSA, 0.05% Tween 20, pH
7.25-7.3]. Cells were then pelleted and resuspend into 100 pl Bufferl (concentration

factor is 0.5/01:5). To break the cells, the cell suspensions were frozen in liquid N2 for

l min and then thawed in a 37 °C water bath for l min. After repeating the freeze-thaw

159

cycle 2 additional times, 0.7 ml of Buffer 2 [2.23 mM CPRG (chlorophenol red-B-D-
galactopyranoside) in Buffer 1] was added to each tube and mix by votexing. The time
of Buffer 2 addition was recorded. When the color of the samples started to turn red, 0.5

ml of 3.0 mM ZnC12 was added to each tube to stop color development. Samples were

then centrifuged at 14,000 rpm for 1 min and the absorbance at 578 nm of the supernatant
was measured. B-galactosidase activity was calculated using the formula: 1000 x

OD578/(t x V x OD600); where: t=elapsed time (in min) of incubation; V=0.1 x

concentration factor; OD600=A6OO of 1 ml of culture when harvesting.

From screening of ~1.2 X 106 independent transformants, four clones, AD50,
AD175, AD177 and AD341, showed weak interactions with VIP4 (Figure 3). All of
these clones were annotated as encoding either unknown or putative proteins (Table 2).
To evaluate the potential function of these genes in concert with VIP4, I did a RNA
interference (RNAi) experiment to selectively degrade the transcripts of these genes.
Approximately 600bp DNA fragment of each clone was amplified using primers
described in Table 3 and cloned into the Asc I/Swa I and Bam HI/Xba I sites of vector
pFGC5941, which carries the herbicide glufosinate resistant gene as plant selective
marker. The plant transformation and transformant selection were essentially as
described previously (Zhang and van Nocker, 2002). No discernible phenotype was
observed after evaluating ~20 Tl individuals from each constructs (data not shown).
However, it has not yet been determined if the function of the endogenous genes have
been knocked out by RNAi. Thus, at this point, it is difficult to speculate the roles of

these interacting proteins, if any, in the VIP mechanism.

160

 

 

B-galactosidase activity

1.0

 

 

 

 

 

 

0
9)
’2
7
7

V914“ f {“3 {‘5 s s '5 s '5 s
SS 839039 390,39 “39 0,39
. 3‘. la 5’46.- «s.- «s .-
89::‘3‘ e9 v e ' 1’ 99' v"
s Q s s Q s

Figure 3. B-galactosidase activity assay of the four VIP4-interacting clones identified
from the yeast two-hybrid screen. The plasmids pBD-WT, pAD-WT, pBD-MUT,
pAD-MUT and pLaminC were provided by the manufacturer (Stratagene). The pBD-
WT/pAD-WT and pBD-MUT/pAD-MUT were used as the positive control and negative
control, respectively. The pLaminC, which expresses the BD of GAL4 and amino acids
67-230 of human lamin C, was used as a control for negative interactions with the
identified VIP4-interacting clones. The data shows the mean value of three
measurements of each sample. The standard deviations are too small to show in the

figure.

161

Table 2. The VIP4 interacting proteins identified from the yeast two-hybrid
screening. Annotations are from The Arabidopsis Information Resource (TAIR).

 

 

Clone Protein Annotation
AD50 At3g22790 Unknown protein
AD175 At4g28230 Putative protein
AD 1 77 At2 g3 9340 Unknown protein
AD341 At5g42520 Unknown protein

 

Table 3. The primer sequence for amplifying DNA fragment to construct plasmids

 

 

for the RNAi experiment.
Name Sequence
RNAi_AD50 F AATCTAGAGGCGCGCCGTCAGATCCC'I'I‘GAGCAA
RNAi_AD50 R AAGGATCCATTTAAATACTGTGATI‘CAACAGAGG
RNAi_ADl75 F AATCTAGAGGCGCGCCCTGAATATGACATCAATT
RNAi_ADl75 R AAGGATCCAT'ITAAATTTCCAGGAAGCTTAAAGA
RNAi_AD177 F AATCTAGAGGCGCGCCGGGTCTGAAAGTGCCCCA
RNAi_AD177 R AAGGATCCATTTAAAT’I‘TCTGTTTGGCTGTAATA
RNAi_AD341 F AATCTAGAGGCGCGCCACCTTGGAATCTGCCAAA
RNAi_AD34l R AAGGATCCATTTAAATTCATTI‘AATCGTAATGTA

 

 

162

A yeast two-hybrid screening approach was also used to screen VIP3 interacting

proteins. However, no interacting clone was identified from a screening of ~1 .0 X 106

independent transformants (data not shown).

Molecular mass study of the putative VIP complex.

Determination of the molecular mass of the putative VIP complex is a crucial step
for identification of VIP components through a biochemical approach. To obtain enough
inflorescence tissue for protein extraction, I used broccoli (Brassica oleracea) as the
plant material. Broccoli is closely related to Arabidopsis and I have shown that anti-
VIP3, anti-VIP4 and anti-VIP6 antibodies recognize appropriately sized proteins from
broccoli extracts (Chapter 4, Figure 5).

Approximately 50 g of broccoli meristem tissues were homogenized in 100 ml

extraction buffer [50 mM HEPES (pH 7.5), 5 mM EDTA, 150 mM NaCl, 0.1% NP-40,

10% glycerol, 1 mM phenylmethylsulfonyl fluoride (PMSF), 10'4 mM pepstatin A]

using a Waring blender (Fisher Scientific, Pittsburgh, PA). The homogenate was filtered
through two layers of cheesecloth and four layers of mirocloth (Calbiochem, La Jolla, CA)
and then centrifuged at 39,000 Xg for 30 min. The supernatant was precipitated with

40% (NH4)2SO4 at ice temperatures. After centrifugation at 20,000 X g, the pellet was

resuspended into 10 ml of column running buffer [Tris-HCl (pH 7.5) 50 mM, NaCl 150
mM, glycerol 1.0%]. For gel filtration, 5ml samples were applied to a Sephacryl S-400
(Amersham Biosciences, Piscataway, NJ) column pre-equilibrated with the running
buffer. The column was run at a speed of 10 ml/hr and 8m] fractions were collected. All

gel filtration procedures were performed at 4 °C. To determine fractions containing

163

VIPs, 20 ul of each fraction was separated by SDS-PAGE and blotted onto PVDF
membranes (Bio-Rad, Richmond, CA). The blots were probed using anti-VIP3 antibody
following a procedure described previously (Zhang et al., 2003). The reason to choose
anti-VIP3 antibody is that this antibody recognizes BoVIP3 strongly (Chapter 4, Figure
5).

Anti-VIP3 immunoreactive protein species were present in all tested fractions
(Figure 4), with a molecular mass ranging from ~40 kDa to ~2 MDa. This is not likely
due to a failure of protein separation, as judged from comparing the protein profiles of
each fraction on SDS-PAGE gel (data not shown). One possibility could be that the
Sephacryl matrix has a strong tendency to bind Bo-VIP3. Other possibilities could be
that the association of VIP3 with the putative complex is not stable under the
chromatography conditions, or that VIP3 is involved in different types of complexes with

a wide range of molecular mass (e.g., bound with genomic DNA).

Epistatic analysis of VIP4 and autonomous pathway genes.

Although previous study suggested that VIP4 might operate in a mechanism
independent of the autonomous flowering promotion pathway, the result was obtained
from molecular and genetic epistatic analysis of VIP4 and a representative autonomous
pathway gene, LD. We now know that autonomous pathway genes promote flowering
through distinct mechanisms and these genes do not comprise a linear pathway. A
detailed epistatic analysis between VIP4 and all autonomous pathway genes is necessary
to clearly elucidate the interactions, if any, between VIPs and the autonomous pathway.

To address this question, I crossed vip4-2, which is resistant to the herbicide

164

Figure 4. B. oleracea VIP3 is detected in every fraction with a molecular weight
range of 40 kDa ~ 2 MDa in a gel infiltration column chromatography experiment.

(a) Calibration of the gel infiltration column. The retention time of the standard
molecular marker, Blue dextran and Cytochrome C, are designated.

(b) Gel infiltration of the B. oleracea total protein. The retention time of fraction 1
through fraction 9 are designated. The elution curve is aligned to the column calibration
curve shown in panel a.

(c) 20 ul samples from each of the 8 m1 fractions were separated on SDS-PAGE and
blotted onto PVDF membrane for western blotting analysis. Western blotting analysis
and the anti-VIP3 antibody were as described previously (Zhang et al., 2003). The
numbers indicate each of the 8 ml fractions. The ‘*’ indicates an unrelated, VIP3-
immunoreactive protein species present in broccoli total protein extracts and some of the
fractions.

165

' _\._._.fi..__.g

01

U «Eek—830 3H, .. - .- A.

1“

5.55.. 2.:— i 1...-..” .

.._\'//

 

E: can an ooaaaaema< E: :3 .a mafia—33¢.

a .0

123456789

Fraction

1

Total

 

 

qfih.u m M w mu...—

‘w’y “J

g

 

 

*

VIP3PHQ-u—O u v“

166

glufosinate, with autonomous pathway mutants Id, fld,fve,fpa,fi2 and fca. All of these
autonomous pathway mutants are in the Col-0 background. The Id (Id-1) mutant is as
described previously (Zhang and van Nocker, 2002). The fld (SALK_075401),fve
(SALK_013789), fpa (SALK_O85616) and f5» (SALK_053604) mutants are SALK T-
DNA lines, obtained from the Arabidopsis Biological Resource Center (ABRC) at The
Ohio State University (Columbus, Ohio). The fca mutant (fed-9) was a generous gifi
from C. Dean (John Innes Centre, Norwich, UK). Double mutants were constructed
using standard genetic techniques. The primer sequences of PCR/cleaved amplified
polymorphic sequence (CAPS) markers for Id, fca, fiaa, 152, and fld mutants are listed in
Table 4. The PCR marker provided by the SALK institute for the fve mutant did not give
consistant results. Thus, the fve vip4-2 double mutant was obtained by selfing an fve/fve
vip4-2/ VIP4 plant. Flowering time was measured under long-day condition.

I have obtained all the double mutants. However, I have yet to analyze the

flowering time.

Physical interaction of VIP4 and the elongating form of RNA polymerase II.

In yeast, PaflC components are found to be physically associated with the
elongating form of RNA polymerase 11 (Pol II) (i.e., the CTD SerZ-phosphorylated form)
(N g et al., 2003a). If VIPs also interact with the elongating form of RNA Pol II, it will be
feasible to identify VIPs target genes through the ChIP-on-Chip approach using
microarrays currently available to Arabidopsis researchers (van Steensel and Henikoff,
2003)

I conducted an immunocoprecipitation (CoIP) experiment to test the potential

167

 

8 2m ”sax

OHOHUEOFOOP/wwaflctmuh ”on mOmO

 

B o2 “wok _ em oo<<<oo<oeoooEB 555m sax
Boutooéggootoo ”.2 Eemmomxim

B o8 Sz <Boot<ootoo<oooe<o “.5 338 5% Q
<o<oao<o<o<oo<o<oouoo ”.2 Semwflvaé

3 m3 <2 4283830052850 5 £88 83% 3x
<8558E<o<oo<oo ”.2 Sensomfié

3 3w <2 oooEoEgozoozooo 5 85° 5% 3x
.5 mm is oo<o<oo<toeoofio~<e<<o “as: 72

3 own a: _ 8: <ooep<<oe<oEoo§ouoeoo 582 72 :3

«Eu .259..— thuanm 5.5...— 33::

 

33:“ ESE: «5 88m “comm—95 on 53 Eofiwma 0: £22? 0936:?
05 Bob onEEa Saofiwflu 05 8865 3532: Q SQ .3528 «Em 838m 2:. 5:28 ..oE>N=m.. 2: 5 68m: 2 2:35
5853.. a £832: 920 .8.“ E838 zen—3:9. 05 E :5 mm 52 .8 £858 mom 8m .8532: .3352— 2552.33
use—.3823 95 be mus—.3:— Ammdnvv 3:258 omaauefibea BEE—Ea 1028.93“?— 95 .5. 9.25.:— 05. .v «San.

168

physical interaction between VIP4 and elongating form of RNA Pol II. The antibody
recognizing the elongating form of RNA Pol II was obtained fi'om Covance Research
Products (Denver, PA). This antibody recognizes a single protein species with the
expected molecular weight for the Arabidopsis RNA Pol II (~240 kDa) from
inflorescence extract, but not from the leaf extract (Figure 5). For immunoprecipitation
experiments, the protein was extracted using the extraction buffer essentially as described

(Oh et al., 2004), but with an addition of phosphatase inhibitors (1 mM Na4PzO7, 10
mM NaF, 100 uM B-glycerolphosphate, lmM Na3VO4). The immunocoprecipitation

procedure was performed as previously described (Oh et al., 2004).

From the Col? experiment, the anti-VIP4 IgG did not pull down the elongating
form of RNA Pol 11 (Figure 6 top). The absence of Pol H Ser2-P in the
immunoprecipitates is not likely due to a failure of the CoIP, because, as a positive
control, I successfully pulled down the VIP6 with the anti-VIP4 IgG (Figure 6 bottom
panel). Also, the absence of Pol II Ser2-P in the immunoprecipitates is not likely due to
possible de-phosphorylation of the Pol H Ser2-P (Figure 6 top panel, lane “de-phos
control”). These results indicate that VIP4 probably does not physically interact with the
elongating form of RNA Pol II in vivo. However, we cannot rule out the possibility that

VIP4 and Pol II Ser2-P interact weakly or transiently.

169

Anti-P0111 Ser2-P ‘1 4 240 kDa

 

Figure 5. Detection of the elongating form of RNA polymerase II in Arabidopsis.
The designated antibody recognizes a single protein species with a predicted molecular
weight from Arabidopsis inflorescence tissue extract. Only a marginally detectable
amount of such protein species is present in leaf extracts.

A portion of the corresponding SDS-PAGE gel, stained by Coomassie blue after blotting,
is shown to indicate the relative quality and quantity of proteins in each lane.

170

6°\
0: c9°

\
o ,- °"5o

a;
anti-Pol II Ser2-P u“; u < 140 kDa
anti-VIP6 \ £3.32 aw . ”a ‘ 130 kDa

Figure 6. VIP4 probably does not physically interact with elongating form of RNA
polymerase II in vivo.

input

 

Total protein from wild-type and vip4-2 mutant inflorescence apices (two lanes at left in
each panel) was subjected to immunoprecipitation using anti-VIP4 IgGs.

(top) Immunoprecipitates were analyzed by protein gel blotting using anti-Pol II Ser2-P
antibody. No immunoreactive protein was detected. The “de-phos control” lane is a
sample of WT total protein incubated along with the immunoprecipitation samples,
served as a control of potential de-phosphorylation of the RNA pol II Ser2-P that might
cause the missing of RNA pol H Ser2-P signal.

(bottom) Immunoprecipitates from were subjected to protein gel blotting using anti-VIP6
antibody. The successful pull-down of VIP6 indicates that the absence of RNA pol II
Ser2-P is not due to a failure of irrununocoprecipitation.

171

References

Ausin, I., Alonso-Blanco, C., Jarillo, J .A., Ruiz-Garcia, L., and Martinez-Zapater, J .M.
(2004) Regulation of flowering time by FVE, a retinoblastoma-associated protein.
Nat. Genet. 36: 162-166.

Bezerra, I.C., Michaels, S.D., Schomburg, F.M., and Amasino, RM. (2004) Lesions in
the mRNA cap-binding gene ABA H YPERSENSI T I VE 1 suppress FRIGIDA-
mediated delayed flowering in Arabidopsis. Plant J. 40: 112-119.

Gendall, A.R., Levy, Y.Y, Wilson, A., and Dean, C. (2001) The VERNALIZA TION2 gene
mediates the epigenetic regulation of vemalization in Arabidopsis. Cell 107: 525-
535.

Hayashi, H., Czaj a, 1., Lubenow, H., Schell, J ., and Walden, R. (1992) Activation of a
plant gene by T-DNA tagging: Auxin-independent growth in vitro. Science 258:
1350-1353.

He, Y., Doyle, M. R., and Amasino, R. M. (2004) PAFl-complex-mediated histone
methylation of FLO WERING LOCUS C chromatin is required for the vemalization-
responsive, winter-annual habit in Arabidopsis. Genes Dev. 18: 2274-2284.

Lee, H., Suh, S.S., Park, E., Cho, E., Ahn, J.H., Kim, S.G., Lee, J.S., Kwon, Y.M., and
Lee, I. (2000) The AGAMOUS-LIKE 20 MADS domain protein integrates floral
inductive pathways in Arabidopsis. Genes Dev. 14: 2366-2376.

Levy, Y.Y., Mesnage, S., Mylne, J .S., Gendall, AR. and Dean, C. (2002) Multiple Roles
of Arabidopsis VRNl in Vernalization and Flowering Time Control. Science 297:
243-246.

Michaels, SD. and Amasino, RM. (1999) FLO WERING LOCUS C encodes a novel
MADS domain protein that acts as a repressor of flowering. Plant Cell 11: 949-956.

Michaels, S.D., Bezerra, LC, and Amasino, RM. (2004) FRIGIDA-related genes are
required for the winter-annual habit in Arabidopsis. Proc Natl Acad Sci USA.
101: 3281-3285.

Ng, H.H., Robert, F ., Young, R.A., and Struhl, K. (2003a). Targeted recruitment of Set]
histone methylase by elongating PolII provides a localized mark and memory of
recent transcriptional activity. Mol. Cell 11: 709-719.

Ng, H.H., Dole, S., and Struhl, K. (2003b) The Rtfl component of the Pafl

transcriptional elongation complex is required for ubiquitination of histone HZB. J
Biol. Chem. 278: 33625-33628.

172

Noh, Y.S., and Amasino, R.M. (2003).PIE1, an ISWI family gene, is required for FLC
activation and floral repression in Arabidopsis. Plant Cell 15: 1671-1682.

Oh, S., Zhang, H., Ludwig, P., and van Nocker, S. (2004) A mechanism related to the
yeast transcriptional regulator PaflC is required for expression of the Arabidopsis
FLC/MAF MADS-box gene family. Plant Cell 16: 2940-2953.

Onouchi, H., Igeno, M.I., Perilleux, C., Graves, K., and Coupland, G. (2000)
Mutagenesis of plants overexpressing CONSTANS demonstrates novel interactions
among Arabidopsis flowering-time genes. Plant Cell 12: 885-900.

Pokholok, D.K., Hannett, N.M., and Young, R.A. (2002) Exchange of RNA polymerase
II initiation and elongation factors during gene expression in viva. Mol. Cell 9: 799-
809.

Reeves, P.H., Murtas, G., Dash, S., and Coupland, G. (2002) early in short days4, a
mutation in Arabidopsis that causes early flowering and reduces the mRNA
abundance of the floral repressor FLC. Development 129: 5349-5361.

Samach, A., Onouchi, H., Gold, S.E., Ditta, G.S., Schwarz-Sommer, Z., Yanofsky, M.F.,
and Coupland, G. (2000) Distinct roles of CONSTANS target genes in
reproductive development of Arabidopsis. Science 288: 1613-1616.

Sheldon, C.C., Burn, J .E., Perez, P.P., Metzger, J ., Edwards, J .A., Peacock, W.J., and
Dennis, ES. (1999) The FLF MADS box gene: a repressor of flowering in
Arabidopsis regulated by vemalization and methylation. Plant Cell 11: 445-458.

Sung, S., and Amasino, RM. (2004) Vernalization in Arabidopsis thaliana is mediated
by the PHD finger protein VIN3. Nature 427: 159-164.

van Steensel, B. and Henikoff, S. (2003) Epigenomic profiling using microarrays.
Biotechniques 35: 346-357

Zhang, H. and van Nocker, S. (2002) The VERNALIZA T ION INDEPENDENCE4 gene
encodes a novel regulator of FLO WERING LOCUS C. Plant J. 31: 663-673.

Zhang, H., Ransom, C., Ludwig, P., and van Nocker, S. (2003) Genetic analysis of early-
flowering mutants in Arabidopsis defines a class of pleiotropic developmental
regulator required for activity of the flowering-time switch FLO WERING LOCUS
C. Genetics 164: 347-358.

173

   

uijiijjijjijn:ijjji