awe

”~44.

huh... I.
.3. .. a

»

.uqhww
A .. :13

7 m It...
I... «\3.
.3 1. ..

‘vdr

“.1 s.
.4311

an?“
a.

A.
.a

 

a.?:.9!.t:
,1. . 55....
. . . 5... .y. ..
.r.§:...... .

 

 

 

 

 

 

 

 

 

 

'. .1 .
u." 533}.
I :A .. s
1.2. a}?
. v:

 

 

; . 31.3“... 4.“..1.‘ u .{;....u...i......, .
. n..u...:..:.e....:.; , , @wgyiywagwfiaafiyngfisfifing fi
. . . ‘ .?§fi§.yfi . ‘ .ur . .. ‘ , . § .
1.333% . , , . , . . .

.
F .
.P: : :lx... ,.

 

fir M

LIBRARIES
7 MICHIGAN STATE UNIVERSITY
J EAST LANSING, MICH 48824-1048
72‘ b I;
l( {2 [73

This is to certify that the
dissertation entitled

EFFECTS OF MYCOBACTERIUM BOVIS INOCULATION IN
SELECT POTENTIAL RESERVOIR OR SPILLOVER
WILDLIFE HOST SPECIES

presented by

KATHY-ANNE ROCHELLE CLARKE

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Pathobiology and Diagnostic
lnvesfigafion

 

 

‘,M%297 W

 

Major Professor’s' S'ignature

Sf/O 7/05-

Date

MSU is an Affinnative Action/Equal Opportunity Institution

 

-.-.-.-.-.—.-.—.-.-.—.-.-.—--v-.-g.!.-.—-.-.-

_ --—.-.-u-o-.-.--.-.—.-.-.-.-«--.-o-

 

PLACE IN RETURN Box to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE
FEB 0 9 2007

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 cfiififieOUOJndd-p.”

 

EFFECTS OF MYCOBACTERIUM BOVIS INNOCULATION IN SELECT
POTENTIAL RESERVOIR OR SPILLOVER WILDLIFE HOST SPECIES

By

Kathy-Anne Rochelle Clarke

A DISSERTATION

Submitted to
Michigan State University
in partial fiIlfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Pathobiology and Diagnostic Investigation

2005

ABSTRACT
EFFECTS OF MYCOBACTERIUM BOVIS INOCULATION IN SELECT
POTENTIAL RESERVOIR OR SPILLOVER WILDLIFE HOST SPECIES
By
Kathy-Anne Rochelle Clarke
White-tailed deer (Odocoileus virginianus) in the state of Michigan are
recognized to be maintenance hosts for Mycobacterium bovis, the causative agent
of bovine tuberculosis. It is believed that this organism was spread to the deer
from tuberculous cattle prior to 1979 when the state was declared free of bovine
tuberculosis. The first case of the disease in Michigan deer was identified in 1994.
Since that time there have been just over five hundred deer diagnosed with this
disease in the state. In addition to continued annual surveillance of hunter
harvested deer, testing of domestic livestock for bovine tuberculosis and
continued research efforts are necessary components of the plan to manage and
eventually eradicate this endemic disease.
Thus, the primary objective of this dissertation was to experimentally introduce
M. bovis into select wildlife species in order to provide necessary data on the
transmission and pathogenesis in such Species and ultimately to assess the
attendant risk for each species in their ability to serve as either a reservoir or
spillover host. Three rodent species (meadow voles [Microtus pennsylvanicus],
house mice [Mus musculus] and rats [Rattus norvegicus]) and one avian species
(the wild turkey [Meleagris gallopavo]) were experimentally inoculated. Meadow

voles were found to be susceptible to both intranasal and oral inoculations. House

mice were also susceptible to oral exposure. The Norway rat was resistant to oral
inoculation and wild turkeys were resistant to both intratracheal and oral
inoculation.

As an extension of the inoculation study performed in house mice, expression of
the Bcg/Nramp-I/ Sell 1 a1 gene was also determined in this Species. House mice
were of the dominant/resistant phenotype, and thus it was concluded that the Bcg
gene alone cannot determine the response to infection with M bovis in this
species.

The secondary objective of this dissertation was to deve10p a new technique for
the diagnosis of M. bovis infection which utilized laser capture microdissection
(LCM) for the procurement of granulomas from formalin-fixed paraffin-
embedded tissues with subsequent PCR analysis of captured material. This study
showed that the sensitivity of the LCM/PCR technique to be 69.2% when

compared to the gold standard diagnostic technique, that of mycobacterial culture.

DEDICATION

This work is dedicated to mummy and daddy, Montelle and James Clarke.
I am very thankful and proud to have both of you as my parents.
Your years of support and love are my ‘fuel’.

This body of work would not have been possible without the grace of God Almighty,
the cleansing shed blood of Jesus Christ, the Lamb, and the power of the Holy Spirit -
the Trinity, one in three and three in one.

iv

ACKNOWLEDGMENTS

I would like to first thank the members of my graduate committee, Drs. Scott
Fitzgerald, Willie Reed, John Kaneene, Steven Bolin and Kelly Diegel. Scott was
an excellent academic advisor who kept me focused on the big picture. He was
able to push me when necessary (sigh) but in a ‘nice’ way and the end result is
very satisfying. Thanks very much for all of your ‘hard work’ although you made
it seem very easy. The best attribute of my committee is that they worked together
very well on this one and the student, yes me, always knew that they had my best
interest at heart and would make time in their busy schedule to help me out if I
got myself in a jam. Thanks to you all.

Much thanks to Aunt Ammie and Uncle George (Ornrel and George Weekes)
Lynn and Kristy who let me crash at their home in Toronto when I needed a break
in order to rest and refresh my mental faculties.

I am especially grateful to my sister Juliet, her husband Earl and son
Christian, who just let me be the annoying little Sister, sister-in-law and ‘Aunt
Kath’. Thanks very much to all of you for letting me be a part of your lives.

I would like to also thank Sharon Thon for her assistance and expertise with
photography and Ann Wismer who was very helpful with animal husbandry for
all the inoculation studies. Ralph Common in the Department of Human
Pathology also ably assisted me with photography.

To Ailam Lin and Nicole Grosjean in Dr. Bolin’s lab who were most helpful
and patient in getting me up to speed and honing my skills in working with DNA

and running PCR tests.

To Sherrie Lenneman and Denise Harrison in the Department of Pathobiology
and Diagnostic Investigation who were most helpful in assisting me with
navigating the wonderful world that is graduate school with what seemed to be
endless forms, deadlines and ever evolving regulations. Fortunately it was not
always ‘business as usual’ and both ladies were instrumental in keeping me ‘in
touch with the real world’ and allowed me to vent on the not so good days.
Thanks!

Much gratitude is extended to RoseAnn Miller for her assistance in getting my
statistical analyses done.

I would also like to acknowledge all personnel within the Michigan
Department of Natural Resources for their compilation of current wildlife survey
data and their willingness to share such data. Special thanks to Jean Fierke and
Stephanie Hogle who provided me with the surveillance maps.

Gratitude is also extended to Dale Berry and Steve Church at the Michigan
Department of Community Health who provided the inocula for my animal
studies and also cultured select samples. Both of them were also available to
answer any follow up questions.

To the countless and mostly nameless staff members and students at the
Michigan State University’s main library in the circulation, interlibrary loan,
document delivery and photo duplication departments who were always efficient,
courteous and helpful in assisting me with tracking down the numerous text and
journal articles which, in great part, enabled me to bring this body of work to

fruition.

vi

To all of my ‘prayer warriors’ both near and far, Rochelle Paydana, Almarie
Jacque and Drs Susan Smith, David Gachiiri, Settor Kemeh and Stewart
Garriques who were always there to remind me that there is a greater power at
work in all of this. Yes God is good.

I would also like to thank Dr. Susan Williams who has ‘walked this way
before’ and who was always willing to Share her knowledge of what ‘dark holes’
to avoid! Thanks girl. I would not have been able to do it without you - the
suspense would have killed me.

Special thanks also to Keith who helped me to keep my sanity while getting

this dissertation put together. I am most appreciative.

vii

TABLE OF CONTENTS

Page

LIST OF TABLES ............................................................................ xi

LIST OF FIGURES ......................................................................... xii

LIST OF ABBREVIATIONS ......................................................... xiv

CHAPTER 1: Literature review

History of bovine tuberculosis .................................................... 1

History of bovine tuberculosis in the USA ..................................... 1

Agent ................................................................................ 2

Morphology and staining characteristics ....................................... 3

Transmission ....................................................................... 4

Pathogenesis ........................................................................ 8

Lesions ............................................................................ 10

Virulence ........................................................................... 11

Immunity ........................................................................... 14

Macrophages ............................................................. 14

T cell response ........................................................... 15

CD4 ........................................................................ 16

CD8/CD1/78 T cells ..................................................... 17

Cytokines ................................................................. l9

CMI ....................................................................... 21

DTH ...................................................................... 22

Apoptosis .......................................................................... 23

Mycobacteriosis in birds ........................................................ 24

Mycobacterium avium-intracellulare ccomplex ............................. 24

Mycobacterium genavense in birds ........................................... 26

Mycobacterium tuberculosis in birds .......................................... 28

Mycobacterium bovis in birds .................................................. 29

Mycobacterium species infection in rodents .................................. 30

Voles ............................................................................... 30

Rats ................................................................................. 33

Mice ................................................................................ 37

Nramp/Bcg gene ................................................................. 4O
Surveillance for bovine tuberculosis in white tailed deer

and other wildlife in Michigan, 2000-2003 ............................................. 43

viii

Page
CHAPTER 1: Objectives for research .............................................. 50

CHAPTER 2: Experimental Inoculation of Wild Turkeys (Meleagris

gallopavo) with Mycobacterium bovis ................................................ 67
Abstract .................................................................................... 67
Introduction ............................................................................... 68
Materials and methods ................................................................. 70
Animals ............................................................................ 7O
Inocula .............................................................................. 71
Study design ....................................................................... 71
Mycobacterial isolation and identification .................................... 72
Statistical analysis ................................................................ 73
Results ...................................................................................... 74
Weight change data ............................................................... 74
Gross lesions ..................................................................... 74
Microscopic lesions .............................................................. 74
Mycobacterial isolation/ identification ....................................... 75
Statistical analysis ................................................................ 75
Discussion and conclusion ............................................................. 75

CHAPTER 3: Mycobacteriym bovis Experimental Inoculation in Three Wild
Rodent Species: Meadow Voles (Microtus pennsylvanicus), House Mice Mus

musculus) and Norway Rats (Rattus norvegicus) ................................... 80
Abstract .................................................................................... 80
Introduction ............................................................................... 81
Materials and methods .................................................................. 84
Inocula ............................................................................. 84

Study design ....................................................................... 85
Meadow voles ............................................................ 85

House mice ............................................................... 87

Norway rats ............................................................... 87
Mycobacterial isolation and identification .................................... 88

Bcg gene protocol in house mice .............................................. 89

DNA extraction .......................................................... 89
Amplification, sequencing and detection ............................. 90

Statistical analysis ................................................................ 91

ix

Page

Results ............................................................................. 92
Animal health ..................................................................... 92
Weight change data ............................................................... 92
Gross lesions ..................................................................... 93
Microscopic lesions .............................................................. 94
Mycobacterial isolation/identification ......................................... 96
Mouse Bcg study .................................................................. 96
Statistical analysis ................................................................ 97
Discussion and conclusion .............................................................. 97

CHAPTER 4: A Comparison of Mycobacterial Culture with Polymerase
Chain Reaction on Granulomas Isolated by Laser Capture Microdissection

in the Diagnosis of Mycobacterium bovis Infection ............................... 133
Abstract ................................................................................... 133
Introduction .............................................................................. 134
Materials and methods ................................................................ 137
Inoculum ......................................................................... 137
Inoculation of house mice ...................................................... 137
Preparation of lung tissue & laser capture microdissection ............... 139

DNA extraction .................................................................. 139
Amplification and detection procedures ..................................... 139
Statistical analysis ............................................................... 140

Results .................................................................................... 141
Discussion and conclusion ............................................................ 141
CHAPTER 5: Conclusions and Further Research ........................................... 158
APPENDICES ...................................................................................................... 165
REFERENCES ........................................................................... 175

LIST OF TABLES

Page
Table 1:1 A summary of in vitro biochemical tests used to identify M.
bovis, M avium and M tuberculosis ...................................................... 60
Table 1:2 A summary of pertinent findings of research (1907 through
1953) in various strains of mice experimentally infected with
Mycobacterium bovis via various routes .................................................... 61
Table 1:3 Classification of inbred strains of mice based on their
susceptibility to infection with M tuberculosis ............................................ 62
Table 1:4 A summary of the surveillance for Mycobacterium bovis in
white- tailed deer in the state of Michigan, USA for 1995-2003 ........................ 63
Table l: 5 Summary of carnivore and omnivore species in Michigan
that were tested for M bovis infection for the years 1997 through 2003 ............... 65
Table 2:1 Summary of research findings in wild turkeys (Meleagris
gallopavo) inoculated with M bovis ......................................................... 78
Table 3:1 Gross lesions consistent with tuberculosis detected at
necropsy in voles experimentally inoculated with M bovis ........................... 105
Table 3:2 Gross lesions consistent with tuberculosis detected at
necropsy in mice experimentally inoculated with M bovis ........................... 106
Table 3:3 Microscopic lesions consistent with tuberculosis detected in
voles experimentally inoculated with M bovis ............................................ 107
Table 3:4 Microscopic lesions consistent with tuberculosis detected in
mice experimentally inoculated with M bovis ........................................... 108
Table 4:1 Summary of the results in house mice (Mus musculus)
orally inoculated with M bovis .............................................................. 149
Table 4:2 Comparisons between the results of mycobacterial culture
and isolation (gold standard) and the results of LCM/PCR ............................. 151
Table 4:3 A summary of the costs and turnaround time for the
LCM/PCR procedure and mycobacterial culture .......................................... 152

xi

LIST OF FIGURES

Page
Figure 1:] Map of the lower peninsula of Michigan which depicts the total
number of deer positive for bovine tuberculosis from 1995 through 2003
and the counties where they were captured ................................................. 52
Figure 1:2 Map of the lower peninsula of Michigan which depicts the total
number of beef and dairy herds in which animals were diagnosed with
bovine tuberculosis from 1998 through October 2004 .................................... 54
Figure 1:3 Deer management unit (DMU) 452 ........................................... 56
Figure 1: 4 Map of the lower peninsula of Michigan which depicts the
total number of elk positive for bovine tuberculosis from 1996 through
2003 and the counties where they were captured ......................................... 58
Figure 3:1a Survival analysis for rodent species according to treatment ............ 109
Figure 3:1b Survival analysis for rodent species according to species ............... 110
Figure 3:2 Bilaterally enlarged submandibular and superficial cervical
lymph nodes in an IN vole ..................................................................... 111
Figure 3:3 Caseogranulomas in the liver and lung of an IN vole ..................... 112
Figure 3:4 An unaffected (control) lung and one affected with bovine
tuberculosis in mice .......................................................................... l 14

Figure 3:5 Photomicrographs of sections of lung from an unaffected (control) vole
and from one inoculated with M bovis IN ................................................ 116

Figure 3:6 Photomicrograph of a section of lung from a vole inoculated
with M bovis IN, Ziehl-Neelsen acid-fast stain .......................................... 118

Figure 3:7 Photomicrograph of a section of nasal turbinate from a vole
inoculated with M bovis IN, Ziehl-Neelsen acid-fast stain ............................. 119

Figure 3:8 Section of mesenteric lymph node from a vole inoculated with
M bovis IN .................................................................................... 120

Figure 3:9 Section of liver from a vole inoculated with M bovis IN .................. 121

xii

Page
Figure 3:10 Sections of nasal turbinate from a vole inoculated with M

bovis IN ....................................................................................... 122

Figure 3:11 Photomicrographs of sections of lung from an unaffected
(control) mouse and from one inoculated with a high dose of M bovis ............... 124

Figure 3: 12 Sections of tracheobronchial lymph node from a mouse
inoculated with a low dose of M bovis .................................................... 126

Figure 3:13 Sections of tracheobronchial lymph node from a rat
inoculated with a high dose of M bovis ................................................... 128

Figure 3:14 PCR amplification of Bcg gene DNA ....................................... 130

Figure 3:15 Nucleic acid sequences of Nramp-l/Bcg cDNA in house
mice ............................................................................................. 132

Figure 4:1 Laser capture microdissection of pulmonary granulomas in
a house mouse inoculated with M bovis .................................................. 154

Figure 4:2 PCR amplification from formalin-fixed paraffin-embedded

microgranulomas in lung tissues of house mice inoculated with M bovis
day 20 PI ........................................................................................ 156

xiii

AFB
AIDS
AHDL

APC
BCG
BL3

CCT
CFU
CD

CI

CMI
CON
DC
DCPAH

DNA
dNTP
DMU
DTH

EB

yS-T
GM-CSF

HD
H&E
HEPA
HIV
HLA
HPF
IFN-y
IL

IS

IT

IV
LAM
LD
LCM
LN
LT

LIST OF ABBREVIATIONS

acid-fast bacteria

Acquired Immune Deficiency Syndrome
Animal Health Diagnostic Laboratory
alveolar macrophage

antigen presenting cell

bacillie Calmette-Guerin

biolevel-3

base pair

comparative cervical tuberculin test
colony forming unit

cluster of differentiation
confidence interval

cell mediated immunity

control animals

dendritic cell

Diagnostic Center for Population & Animal
Health

deoxyribonucleic acid
deoxyribonucleoside triphosphates
deer management unit

delayed type hypersensitivity
ethidium bromide

gamma-delta T cell

granulocyte macrophage-colony stimulating
factor

high dose

hematoxylin and eosin

high efficiency particulate air
Human Immunodeficiency Virus
human leukocyte antigen

high power field/ 40X

interferon gamma

interleukin

intranasal

intraperitoneal

insertion sequence

intratracheal

intravenous

lipoarabinomannan

low dose

laser capture microdissection
lymph node

leukotriene

xiv

MAIC

MDCH
MDNR
MHC
MOTI‘
MSU
M Tb
NADC
NK
NO
Nramp

OMIM
PCR
PGL
PI
PPD
PZA
RFLP
RNA
RN I
ROI
SB
Scll lal
SQ

SS!
TACO

TB
TBE

TCH
TE
TLR
TM
TNF-or
VDR
WTD

Mycobacterium avium-intracellulare
complex

Michigan Department of Community Health
Michigan Department of Natural Resources
major histocompatibility complex
mycobacteria other than tuberculosis
Michigan State University
Mycobacterium tuberculosis

National Animal Disease Center

natural killer T cell

nitric oxide

natural resistance associated macrophage
protein

Online Mendelian Inheritance in Man
polymerase chain reaction
phenoglycolipid mycosides
post-inoculation

purified protein derivative

pyrazinamide

restriction fragment length polymorphism
ribonucleic acid

reactive nitrogen intermediates

reactive oxygen intermediates

sodium borate

solute carrier family 11 member 1
subcutaneous

susceptibility to tuberculosis

tryptophane aspartate-containing coat
protein

tuberculosis
tris-borate/trisethylenediarninetetraacetic-
acid (EDTA)

thiopen-2-carboxylic acid hydrazide
tris-ethylenediaminetetraacetic-acid (EDTA)
toll-like receptor

transmembrane

tumor necrosis factor or

vitamin D receptor

white-tailed deer

XV

CHAPTER ONE
LITERATURE REVIEW
History of bovine tuberculosis
Robert Koch first described Mycobacterium bovis, the causative agent of bovine
tuberculosis in 1882 in the seminal article of the tubercle bacillus isolated from human
and animal sources. Theobald Smith in 1898 was further able to demonstrate predictable,
small but definite differences between strains of tubercle bacilli of bovine and human
origin. Although it was common to refer to tubercle bacilli of bovine origin as M bovis

this name was not legitimized until 1970 (Karlson and Lessel, 1970)

Bovine tuberculosis in the United States (USA)

During the early 18008 and early 19003, bovine tuberculosis was the most prevalent
infectious disease of cattle and swine in the USA, causing more losses among farm
animals than all other infectious diseases combined. The National Cooperative State-
Federal Bovine Tuberculosis Eradication Program was initiated in 1917 by the United
States Department of Agriculture (USDA) and has brought the USA close to eradicating
bovine tuberculosis (Montali et a1, 2001; Pritchard, 1988).

The regulatory agency in the USA with oversight for bovine tuberculosis eradication
was known as the Bureau of Animal Industry up to 1955 when it was then changed to the
Animal Disease Eradication Division until 1972. The agency is now referred to as the
Animal and Plant Health Inspection Services (APHIS).

Area testing was the main method of testing during the first 50 years of the

eradication program. It involved tuberculin testing of 15% of a State’s cattle herds each

year, thus during a 6 year accreditation period all of the State’s cattle herds should have
been tested at least once. By 1940, all states had achieved Modified-Accredited State
status, meaning that the prevalence of bovine tuberculosis did not exceed 0.5% in any
State. Over the first 50 years, the prevalence of bovine tuberculosis in the United Sates
had decreased from 55% to less than 0.3% (Essey and Koller, 1994). The national
prevalence of bovine tuberculosis in infected herds in the United States was estimated to
be 0.0011% in 2003 (USAHA, 2003).

In 1965, the program emphasis shifted to a slaughter surveillance policy whereby
animals with lesions of tuberculosis detected at slaughter where traced back to the herd
of origin. All animals in the herd of origin were then tested for tuberculosis. Extensive
epidemiological investigations of infected herds were then carried out to locate all other
herds that may have been exposed to animals in the source herd and to identify the

origin of their infection (Frye, 1995).

Agent

Mycobacterium bovis is a member of the Mycobacterium tuberculosis (M Tb)
complex that includes M tuberculosis, M bovis, attenuated M bovis BCG (bacillie
Calmette-Guerin) strains, M afi'icanum, M microti and M canettii (Brosch et al.,
2002). It is widely accepted in both human and veterinary medicine that tuberculosis
refers to infection with any one of the members of the M Tb complex. Mycobacteriosis
is usually reserved for infection with mycobacteria that are not members of the M Tb

complex [mycobacteria other than the M Tb complex (MOTT)], M leprae, or M

lepraemurium (Hines et al., 1995). Atypical mycobacteriosis refers to infection with
species other that M bovis and M tuberculosis (Dungworth, 1993).

The genus Mycobacterium in which members of the M Tb complex are included
encompasses about 85 species. Clinically mycobacteria can be subdivided in to one of
three principal groups: 1) strict pathogens e. g. M tuberculosis, M leprae, M bovis 2)
opportunistic pathogens e.g. M simiae, M avium, M xenopi and 3) rare pathogens e. g.
M smegmatis, M phlei (Rastogi et al., 2001).

Speciation of mycobacteria is usually a challenging and time consuming exercise
that often requires submission of samples to a diagnostic laboratory that specializes in
such tests. Currently available methods for detection of mycobacterial species include
but are not limited to: i) PCR, ii) nucleic acid probes, iii) gas liquid chromatography
(GLC) and high-performance liquid chromatography (HPLC), iv) thin layer
chromatograph, v) growth rate, vi) colony morphology, and vii) biochemical tests
(Hines et al., 1995). The latter three tests will be further addressed in the following

section.

Morphology, staining characteristics and biochemical test reactions

Mycobacteria are non-spore-forming nonmotile slender bacilli, 0.5 to 1.5 pm in
length, with a lipophilic waxy coat that resists regular staining with Gram stain but
confers acid fastness (Rastogi et a1, 2001; Samuelson, 1999; Hines et a1, 1995; Timoney
et al, 1988). Such bacteria were formerly thought to be strictly aerobic but M bovis is
now known to be microaerophilic. Acid fast indicates that mycobacteria are routinely

stained with hot carbol dyes, usually carbol-fuchsin, and then resist decolorization by

acid alcohol. The mycolic acids in the cell wall enable mycobacteria to resist
decolorization. Mycobacteria then appear red against a methylene blue counterstain
(Dungworth, 1993). Additionally, mycobacteria can be stained with fluorescent dye and
auramine-O is commonly used. Auramine-O, when combined with rhodanine is the
procedure of choice for clinical specimens. F luorochrome staining is more sensitive as
mycobacteria are visualized at 25X objective whereas carbol-fuchsin techniques require
oil-immersion 100X objective (Zheng and Roberts, 1999).

Growth characteristics, colony morphology and biochemical tests of the three
species recognized to cause most disease in humans and animals, namely M
tuberculosis, M bovis and M avium are further defined. Each of these species is
considered to be slow growing (mean division time of 12 h to 24 h, with a fully-grown
culture requiring approximately 15 to 28 days). Colonies of the three species are not
pigmented. However, M bovis colonies on solid media are sparse (dysgenic) whereas
M tuberculosis is luxuriant (eugenic). Characteristics of these species demonstrated

with select biochemical tests are listed in Table 1:1.

Transmission

M bovis is reported to survive for variable periods on inanimate objects, soil, feces,
urine and pasture if exposure to direct sunlight is limited. However, as the Size of the
minimum infective dose for oral infection is high, it is unlikely that the persistence of
bacilli on fomites plays a significant part in transmission (Phillips et al,. 2003; Menzies

and Neil], 2000; Morris et al., 1994).

In cattle, the aerosol route is currently accepted as the most frequent route of
transmission between cattle. M bovis is found to survive in water and can, therefore,
enter the respiratory tract during drinking (Phillips et al., 2003). Spread to calves
ingesting milk from tuberculous udders formerly factored significantly in transmission,
but due to improved animal management practices and eradication programs in
developed countries this mode is less common. However, in humans in developing
countries Spread of M bovis to man via ingestion of raw or unpasteurized milk from
infected animals remains a problem. Historically lesions on the penis of bulls and/or the
external genitalia of cows also contributed to the spread of infection (Neill et al., 1994).

In pigs, oral transmission of tuberculosis remains the principal route of infection.
Such animals are exposed via consumption of milk or milk products, kitchen and
slaughterhouse scraps and excreta of tuberculous cattle (Morris et a1, 1994)

Wildlife such as the brushtail possum (T richosus vulpecula) in New Zealand and
the badger (Meles meles) in Great Britain and the Republic of Ireland also serve as
reservoirs of infection for domestic animals. Reservoir or maintenance hosts are those
animals in which infection persists through horizontal transmission between individuals
in the absence of any other source of M bovis from either domestic or wild animals (de
Lisle etal., 2001; O’Reilly and Daborn, 1995; Morris et al., 1994 ). In both the badger
and possum, maintenance of infection within a local population iS due to pseudo-
vertical transmission (between birth and independence) from mother to young and
horizontal transmission linked to breeding activity (Morris et al, 1994). The majority of
spread within wildlife is via the airborne route. Similar to human tuberculosis it is

thought that transmission by environmental contamination does not contribute to the

spread of infection (Menzies and Neill, 2000; Morris etal., 1994). An important
exception is pasture contamination by excretion in badger urine.

Transmission among badgers is primarily via the respiratory route with a high
component of pseudovertical transmission from mother to cub as well as via bite
wounding in males. However, transmission from badger to cattle is due primarily to
contamination of pasture by urine of tuberculous badgers with kidney lesions in
addition to sputum, feces and discharges from bite wound fistulas (Gallagher and
Clifton-Hadley, 2000).

Brushtail possurns spread large numbers of M bovis through draining open
cutaneous lesions or the respiratory tract. Surface contamination of the pasture is not
thought to be a factor in the spread from infected possurns to cattle. Cattle that Show
much exploratory behavior are thought to be infected by contact with possum carcasses.
Transmission from mothers to dependent joeys while in the pouch is another effective
means of spreading infection (O’Reilly and Dabom, 1995; Morris et al., 1994).

Transmission to Spillover wildlife hosts primarily occurs by scavenging of infected
carcasses and predation. In spill-over hosts infection occurs sporadically when the
challenge level is high and can only persist in such populations when a true
maintenance host is present (de Lisle et al., 2001; O’Reilly and Dabom, 1995; Monis
et al., 1994).

Reports to date clearly indicate that M bovis is pathogenic for humans, but its
pathogenicity may be less than that of M tuberculosis (Grange, 1995). Zoonotic
tuberculosis due to infection with M bovis is currently more of a problem in developing

countries where pasteurization is less ofien practiced (Grange, 2001). Such countries

also do not have the infrastructure in place to diagnose and monitor infection in
domesticated animals (Cosivi et a1, 1998)

Human to human transmission of M bovis has been documented in HIV-positive
individuals (Houde and Dery, 1988). Human to animal transmission, although rarely
documented has been reported in the Netherlands, Germany, England, Sweden, New
Zealand, Canada, Czechoslovakia and the USA (Grange, 1995; Pritchard, 1988).
Transmission from humans to animal is usually via the respiratory route, although
urinary tract infection (renal tuberculosis) in humans has also been implicated (Grange
and Yates, 1994). This is a contentious issue as Dankner et al, 1993 state that most
human tuberculin reactors do not develop progressive disease with M bovis and are,
therefore, incapable of transmitting disease.

The clinical presentation and severity of disease in humans infected with M bovis is
similar to that of M tuberculosis (Collins, 2000; Moda et al., 1996). Scrofula or
cervical lymphadenitis has been associated with drinking unpasteurized milk from cows
with bovine tuberculosis (Ashford et al., 2001). Although 5% of human cases of
tuberculosis were caused by M bovis in children less than 5 years old this increased to
30% (Pritchard, 1988). However, it is not currently known what the frequency and
severity of pulmonary disease is in humans who have reactivation of M bovis later in
life after an initial infection in childhood.

When contaminated cow’s milk was eliminated as the primary vector for human
infection, the distribution of anatomical Sites of disease changed significantly. The lung
became the predominant site of disease; genitourinary disease became relatively more

common while lupus vulgaris became rare (Smith, 2003; Grange, 1995)

Mycobacterium bovis is resistant to isoniazid, thus it is important to determine the
cause of tuberculosis in humans before treatment is initiated. In addition, detection of

M bovis in humans may act as a sentinel for infection in cattle.

Pathogenesis

The two most common portals of entry for M bovis are respiratory and oral.
However, the respiratory route is predominant in both humans and most animals
(O’Reilly and Dabom, 1995; Neill et al., 1994).

The currently accepted pathogenesis of M bovis in mammals is based on the rabbit
model (Dannenberg, 2001). With inhalation of bacilli as the route of introduction, M
bovis organisms are first exposed to pulmonary alveolar macrophages (AM). Alveolar
macrophages engulf the 0.5 x 2 pm bacilli. Multiplication of the bacilli occurs within
the AM and the site of infection develops into a granuloma It is at this stage that the
infection can follow one of two divergent routes, delayed type hypersensitivity (DTH)
or cell mediated immunity (CMI). Caseous necrosis occurs in DTH with liquefaction of
the granuloma and dissemination of mycobacteria via blood or lymphatics. Direct
implantation (extension) into adjacent tissues can also occur from the initial focus. In
an immunocompetent host bacilli are destroyed. Alternatively in a susceptible host
further multiplication occurs ultimately resulting in death .With CMI, however, the
caseous center is surrounded by activated macrophages which ingest and destroy bacilli

at the periphery. Thus, the disease is arrested.

With infection via ingestion humans are usually exposed via contaminated milk.
Animals may also be infected via milk (dam to offspring), contaminated foliage in
herbivorous species, or via infected carcasses/viscera in carnivores. Lesions detected in
orally acquired infection generally occur within the gastrointestinal tract (tonsils,
mesenteric lymph nodes, liver, hepatic lymph nodes).

The ability of mycobacteria to survive and multiply intracellulary within
macrophages is instrumental in their pathogenicity. The mycobacterial phagosome
interacts with early endocytic compartments but does not mature into or fuse with
lysosomes. This process is referred to as the M tuberculosis phagosome maturation
arrest or inhibition of phagosome-lysosome fusion (V ergne et al., 2004). Therefore
mycobacteria not only avoid destruction within the lysosomes, but also avoid the
generation of antigenic peptides in the endosomal compartments. By hiding within a
mycobacterial phagosome, mycobacteria not only escape from the immediate
antimicrobial macrophage host response but also interfere with the induction of
adaptive immunity (Pieters and Gatfield, 2002; Russell, 2001).

Cholesterol is essential for the entry of mycobacteria into macrophages. In studies
using macrophages which had their plasma membrane depleted of cholesterol such
macrophages were unable to internalize mycobacteria (Gatfield and Pieters, 2000). The
exact reason why cholesterol-depleted macrophages fail to phagocytose mycobacteria is
currently unknown (Pieters and Gatfield, 2002)

Complement receptors are among the most widely used receptors for mycobacteria,
although they may also use mannose receptors, Fc receptors and scavenger receptors.

With the uptake of mycobacteria via complement receptors there is no upregulation of

bactericidal mechanisms. Thus, uptake via the complement system ensures that
mycobacteria enter macrophages under relatively non-lethal conditions (Pieters and
Gatfield, 2002)

The mycobacteriocidal ability of the macrophage depends on several factors
including the virulence factors of the organism, immunologic factors and genetic

factors of the host (Hines et al., 1995)

Lesions

The granuloma, the primary lesion seen with M bovis infection and other
Mycobacterium spp infection is formed by the host in an attempt to wall off or limit the
spread of infection. Granulomas in tuberculosis also localize inflammatory and immune
responses to the site of infection (Lagrange, 1984). Collins (1999) defines a granuloma
as a focal area of granulomatous inflammation, which consists of a microscopic
aggregation of macrophages that are transformed by cytokines such as Il-2 produced by
T cells into epithelium-like cells which are surrounded by a collar of mononuclear
leukocytes, principally lymphocytes and occasionally plasma cells. Granulomas in
tuberculosis are referred to as tubercles when there is central caseous necrosis, resulting
from the destructive effects of delayed type hypersensitivity (DTH). The word
“tuberculosis” is derived from the Latin word “tuberculum” which means a lump or
nodule. Such nodules are synonymous with tubercles (Hines et al., 1995). Caseous
necrosis refers to the loss of cellular detail centrally with replacement by amorphous

eosinophilic granular debris admixed with acid-fast bacilli.

10

Macrophages infected with mycobacteria produce TNF-a which in concert with
IFN-y produced by lymphocytes induces a chemokine gradient at the site of infection
which causes migration of cells (monocyteS/macrophages, T and B lymphocytes) to the
infected macrophages, and a granuloma forms (Scott Algood, 2003) In addition,
addressins, selectins and integrins are important in the recruitment, migration and
retention of cell to and within the granuloma, that is granulomas are not static
(Saunders and Cooper, 2000; Collins, 1999)

Mycobacterium bovis has a broad host range (O’Reilly and Dabom, 1995).
Manifestation of disease following M bovis infection shows subtle to significant
variation according to the species infected. Lesions in cattle display typical caseated
granulomas which may calcify. Cavitations may develop in cattle but are a more
prominent feature of tuberculosis in humans. In swine, lesions are similar to those in
cattle. Although infection is rare in cats and horses, when it does occur lesions are more
indicative of a sarcoma and this may lead to misdiagnosis. Cavitation due to
liquifactive necrosis often develops in these sarcoma-like lesions in dogs. In nonhuman
primates, primarily Old World species, lesion development is Similar to that of humans

(Hines et al., 1995, Timoney et al., 1988).

Virulence

Although M tuberculosis and M bovis were identified by Koch as the respective
causative agents of human and bovine tuberculosis over a century ago, to date, much
remains unknown about virulence factors utilized by these microorganisms. Virulence

factors in mycobacterial species incorporate those features which enable them to

11

survive, multiply and cause disease in the animal host (Collins, 2001). More
specifically, mycobacterial species have demonstrated a remarkable ability to survive in
diverse conditions encountered during the infection process. These include, but not
limited to, surviving the bactericidal stresses within the macrophage, the anaerobic and
nutritionally altered environment of the granuloma, and the metabolically inactive
latent state (Mehrotra and Bishai, 2001)
The majority of known virulence factors occurs within the cell wall and includes:
i. phenoglycolipid mycosides (PGL-1) which suppress monocyte oxidative
burst and are oxygen radical scavenger
ii. cord factor (trehaloes-6,6’- dimycolate TDM) which is a potent initiator of
the innate and acquired immune response. Specifically, it inhibits the
migration of neutrophils and is involved in the depression of microsomal
enzymes and glycogen synthesis. It also induces granuloma formation,
inhibits phagosome-lysosome firsion, decreases TNF secretion, increases
IL] -0 secretion, induces leakage of liposomes and is leukotoxic
iii. sulfatides are the component of the mycobacterial wall which promotes
survival of virulent tubercle bacilli within macrophages by inhibiting
phagoloysosme formation. Sulfatides have also been found to inhibit
phosphorylative oxidation in mitochondria (Thoen and Himes, 1986;
Brubaker, 1985)
iv. mycobactins and exochelins are iron chelators. It had been proposed that

exochelins bind iron in the extracellular aqueous environment and transport

12

the metal ion to mycobactin, another molecule in the mycobacterial cell
wall, which facilitates transport of iron into the cell cytoplasm

v. lipoarabinomannan (LAM) is a potent oxygen radical scavenger,

increases secretion of TNF and inhibits protein kinase C. Activation of
macrphages by IFN-y and induction of nitric oxide are inhibited by
treatment with LAM which results in decreased microbicidal activity. LAM
also induces IL-8, a chemotactic factor for neutrophils that may be involved
in the initiation of granuloma formation (Quinn et al., 1996).

vi. macrophage inhibitory factor A3 (MIF-A3) scavenges oxygen radicals

and induces interleukin 6 mRNA expression

Research is ongoing to identify the genes and proteins involved in the virulence of
mycobacteria as in hopes of providing new bacterial targets which can be utilized in
creating vaccines and chemotherapeutic agents, as well as for use in the development of
more selective diagnostic reagents (Smith, 2003). Such studies are in vitro utilizing
tissue culture (macrophages, dendritic cells and pneumocytes) or in vivo where the
three main animal models used are mice, guinea pigs and rabbits.

Although several genes have been identified as being important in the pathogenesis
of tuberculosis, their role in virulence is less well known. The slow generation rate of
M tuberculosis and M bovis is identified as a limiting factor in the elucidation of the
role of such genes in the virulence of tuberculosis. The BCG vaccine strain of M bovis
is however known to lack several virulence genes. The Rv3 875 gene which encodes
ESAT 6 in RDl of this particular strain is implicated in virulence. Mutations in this

gene reduce virulence and specifically reduce the ability of the organism to spread

13

locally and to lyse pneumocytes (Hsu et al., 2003). Transgenic strains of BCG in which

the RBI is reconstituted regain virulence.

Immunity

The interacting network of immune responses to mycobacteria is complex. The
macrophage is the principal effector cell of protective innate immunity whereas the T
lymphocyte of various subtypes is the major inducer of the protective acquired immune
response (Kaufmann, 2002; Skinner et a1, 2001). Cross talk between T cells and
macrophages is achieved by various cytokines (IFN-y, TNF-a and LT-a). This cross
talk leads to macrophage activation and granuloma formation (Kaufinann, 2002).
Macrophages

Mycobacterium bovis can multiply in resting macrophages but is killed in activated
macrophages. Activation of macrophages is effected by cytokines and results in
increased size, increased subcellular organelles, ruffled cell membranes,
and enhanced phagocytic and microbicidal activities including production of reactive
oxygen intermediates (ROI), reactive nitrogen intermediates (RN 1) and lysosomal
enzymes (Monack et al., 2004; Cosma et al., 2003; Dannenberg 1999 and 1991).
Activated macrophages are able to destroy small numbers of bacilli but are
overpowered by bacilli in large numbers. Thus, macrophages are involved in both the
control (destruction) and dissemination of tubercle bacilli.

In the mouse model of tuberculosis, IFNy and TNF-or act synergistically in the
production of nitric oxide (N O) and RNI by macrophages via the action of the inducible

form of nitric oxide synthase (N082 or iNOS) (Flynn and Chan, 2001; Stenger and

14

Modlin, 1999) However, mycobacteria may inhibit N082 recruitment to phagosomes
during macrophage infection (Miller et al., 2004). Nitric oxide in association with IFNy
can limit damaging irnmunopathological consequences of chronic mycobacterial
infection (Copper et a1, 2002). In humans, NO is one of the few host products which is
known to be directly toxic to mycobacteria at clinically significant concentrations
(Cosma et a1, 2003; Long et al., 1999; Nozaki et al., 1997). However, the role of NO in
humans affected with tuberculosis remains unclear (Rook et al., 2001).

Tubercle bacilli produce large amounts of ammonia within lysosomal vacuoles
which limits phagolysosome fusion and diminishes the potency of the intralsosomal
enzymes via alkalinization. In this way mycobacteria are able to evade killing in
lysosomal vacuoles (Russell et a1, 1996; Schaible, 1998; Flynn and Chan, 2001).
Additionally, it has been found with in vitro studies of mouse macrophages that
tryptophane aspartate-containing coat protein (TACO), a protein found in phagosomes
containing living mycobacteria, also facilitates the interruption of the fusion of
phagososme with lysosomes (Flynn and Chan, 2001; Ferrari et a1, 1999).

Cell surface reactors present on macrophages also influence the fate of engulfed
mycobacteria. In M tuberculosis infection interactions with the constant regions of
immunoglobulin receptors (Fc receptors- F cRs) and Toll-like receptors stimulate the
host defense mechanisms whereas those with complement receptors (CR3) promote
mycobacterial survival (Kaufinann, 2001; Thoma-Uszynski, 2001; Brightbill, 1999)

T cell response
The various types of T lymphocytes which are implicated in the induction of the

protective acquired immune response in tuberculosis include CD4, CD8, 76 and CD1

15

restricted T cells. The role of the various T cell populations in control of mycobacterial
infection may vary in different animal species (Wedlock, 2002).
CD4

The importance of this T cell subset in controlling acute mycobacterial infection
was confirmed with numerous experimental models utilizing antibody depletion and
knockout mouse strains deficient in CD4 or MHC class 11 (Collins and Kaufrnann,
2001). Two functionally different subsets of CD4 T helper cells are recognized. The
Th1 subset produces the cytokines interleukin-2 (IL-2) and IFN-y whereas the Th2
subset produces Il-4 and Il-5. The Th1 subset is associated with CMI and is therefore
important in immunity to tuberculosis. Mycobacterial antigens are presented to CD4 T
cells via MHC class II. Under the influence of IL-12 and 11—18 from the antigen
presenting cells (APCS) (e. g. macrophages and dendritic cells), CD4 T cells producing
a Th1 type immune response are stimulated (Skinner et al., 2001). CD4 T cell then
produce IFNy in response to the wide variety of mycobacterial antigens. IFNy produced
by these cells activates the macrophage to enhance the ability to kill the mycobacteria
that they harbor (Stenger and Modlin, 1999).

Recent research has indicated that CD4 T cells also mediate IFN-y independent
control of M tuberculosis. Such processes occur via a NO-dependent mechanism and
are important during secondary response to M tuberculosis and in preventing the
reactivation of tuberculosis (Cowley and Elkins, 2003).

Another important function of CD4 T cells (the long-lived portion) is to mediate

immunological memory (Skinner et al., 2001).

16

CD8/CD 1/78 T cells

The role of CD8 cells in tuberculosis is less well understood, however, such cells
appear to be more involved in controlling the chronic phase of the disease or latent
infection (Skinner et a1, 2001). In spite of the intracellular location of mycobacteria
within phagosomes, it is known that CD8 T cells are required for a successful immune
response against the organism (Collins and Kaufinann, 2001).

CD8 T cells are split into TC] and Tc2 subsets based on the cytokines they secrete.
Tcl cells secrete Il-2, IFNy and TNF-u, whereas Tc2 cells secret Il-4, IL-5 and IMO.
The TC] phenotype, which is similar to a Th1 phenotype, is the predominant type of
CD8 T cell (Smith and Dockrell, 2000). '

CD8 T cells in mycobacterial infections are both classically (MHC I) and
nonclassically (CD1) restricted. MHC class I molecules present peptide antigens,
whereas CD1 presents lipids or glycolipids which are abundant in the mycobacterial
cell wall to T cells (Schaible and Kaufrnann, 2000). The mechanism by which
mycobacterial proteins gain access to the MHC class I molecules is not fully
understood as this pathway is usually reserved for those pathogens that reside in the
cytoplasm of affected cells (Kaufinann, 2002; Flynn and Chan, 2001). However,
classically presented antigens result in the activation of antirnycobacterial effects such
as IFNy production and lysis of infected cells by perforin and granzymes or via the
F M asL pathway (Stenger and Modlin, 1999). Likewise, the way in which
mycobacterial glycolipids are presented by CD1 molecules is also not entirely known

0(aufmann, 2002). However, saposins which are cofactors for enzymatic sphingolipid

l7

hydrolysis have recently been shown to promote the loading of glycolipids onto CD1
molecules (Kaufinann, 2004).

CD1 molecules are divided into two groups. Group I includes CDla, b and c,
whereas CDld is the only member of group II currently identified. Mycobacterial lipid
containing antigens that have been reported to be presented by group I CD1 include
mycolic acid, LAM, phosphatidylinositol mannoside, glucose monomycolate and
isoprenoid glycolipids. Cle surface expression is downregulated in cells infected
with M tuberculosis (Collins and Kaufrnann, 2001; Kaufrnann, 2001). To date, no
bacterial antigens presented by group 11 CD1 molecules have been identified. In
mycobacterial infections, several different T-cell subsets have been found to interact
with CD1, including CD4' CD8' (double-negative) T cells, CD4+ or CD8+ Single
positive cells and 76 T cells (van Crevel et al., 2002)

Gamma delta (75) T cells are primarily localized to mucosal surfaces and are
therefore most prominent in organs directly exposed to antigens from outside
environments e.g. lungs, intestine and skin. Although their precise role in mycobacterial
infections is not completely known such cells are capable of producing IFN-y and are
also a rich source of cytokines (IL-2). The 78 cells are thought to be involved in
influencing the local cellular traffic of lymphocytes and monocytes and limiting access
of inflammatory cells that may cause tissue damage (Skinner et al., 2001). Recently it
was proposed that y8 T cells may have little to no effect in immunity to tuberculosis, as
gene-deleted mice were identical to wild type mice in their ability to control infection

and survive (Mouges et al., 2001).

18

The higher proportion of circulating 78 cells in ruminants is suggestive of a greater
role in the protective immune response against bovine tuberculosis than that seen in
other Species (Wedlock et a1, 2002)

The role of humoral immunity (antibodies, B cells) in the control of infection with
M bovis is not well defined at present it may be of limited importance. Antibodies
develop at a late stage in bovine tuberculosis and are associated with disease
progression (Pollock and Neill, 2002)

Cytokines

As previously stated the cytokines which are of primary importance in immunity to
tuberculosis are those secreted by Th1 type CD4+ T cells and activated macrophages.
Although both NK cells and CD8+ T cells are also capable of secreting these cytokines,
they are of lesser importance. Cytokines of importance include interleukin-1 (IL-1), 11-
2, Il-12, Il-18 and IFNy. IL-1 is produced by activated macrophages and many other
cell types. It is important in the acute phase response- (e. g. fever and cachexia) and also
facilitates T lymphocyte expression of IL-2 receptors and IL-2 release.

The type 1 cytokines (IL-2, IL-12, IL-18 and IFNy) all have essential roles in cell
mediated immunity (CMI). Il-2 has a role in inducing expansion of the pool of
lymphocytes specific for an antigen and aids in the multiplication of T cells and the
generation of memory cells. Interleukin-12 which is produced by antigen-presenting
cells (macrophages and dendritic cells), is the principle mediator of cell-mediated
immunity (CMI) and DTH. It can augment both the granulomatous response and
protection against mycobacterial infection. Additionally, IL-12 can stimulate

production of IFNy, TNF-or and GM-CSF which activate macrophages, NK cells, and

19

naive Th cells into Th1 cells (van Crevel et al., 2002; Kobayashi et al., 2001; Jullien et
a1, 1997).

IFNy is central to many of the effector functions which are activated upon
mycobacterial infection. Its many functions include stimulation of the production of
ROI and RNI by macrophages, increasing the expression of class II molecules resulting
in increased antigen presentation and upregulation of the expression and secretion of
TNF from macrophages. IFNy is essential to the host as it controls bacterial growth.
Thus once macrophages are activated with IFN-y they negate the block that the
bacterium exerts over phagosome maturation and acidify the vacuoles to ~ pH 5.2
(Russell, 2001). IFNy can also mediate anti-inflammatory effects by preventing
excessive cellular influx and T cell proliferation and/or activity at the site of antigen
deposition (Copper et a1, 2002).

Humoral immunity is not protective against tuberculosis. However three of the
cytokines produced by Th2 cells do have an important regulatory role in immunity to
tuberculosis. IL-10 which is produced by macrophages and T cells down regulates IL-
12 production, which leads to a decrease in IFN'y production. It also down regulates
production of TNF-a. IL-10 also directly inhibits CD4+ T cell responses and inhibits the
APC function of cells infected with mycobacteria. Il-4 and Il-13 also down regulate the
Th1 response.

In mycobacterial infections TNF-u is important for walling off infection and
preventing the dissemination of mycobacteria as it affects cell migration to and
localization within the granuloma. It is therefore effective in the acute response

(Skinner et al., 2001). Thus as with many other infections, the production of TNF-or

20

must be finely balanced, as its overproduction leads to increased cellular accumulation
which compromises lung function and exacerbates tissue damage (Collins and

Kaufrnann, 2001)

CMI

Cell mediated immunity may be defined as a beneficial host response characterized
by an expanded population of specific T lymphocytes (Th1) that, in the presence of
microbial antigens, produce cytokines locally. Interferon gamma (IFN-y) and IL-2
produced by these Th1 lymphocytes are critical in the production of CMI. In CMI,
activated macrophages are able to kill and destroy bacilli which were ingested, that is
the bacilli are destroyed intracellularly (Dannenberg, 1993; Danneberg, 1999). The
macrophages which are activated are the surrounding or perifocal macrophages. The
now activated perifocal macr0phages ingest and destroy the bacilli escaping from the
edges of the caseous center and released from the dead bacilli-laden macrophages. Cell
mediated immunity is indicated in tuberculosis as the pathogen is intracellular,
primarily residing in macrophages, thus humoral immunity mediated by antibody
production would be ineffective.

Since the main function of CMI is to activate the surrounding uninvolved
macrophages, it serves a protective firnction in immunity to tuberculosis by limiting the
spread of infection in the involved tissue, usually the lung. Thus, CMI limits the spread
of tubercle bacilli by activating macrophages to kill the bacilli that they ingest

(Dannenberg, 1999)

21

DTH

Like CMI, tissue damaging delayed type hypersensitivity (DTH) is also mediated
by Th-l type lymphocytes. Unlike CMI however, macrophages in DTH remain
inactivated. Delayed type hypersensitivity is of importance in tuberculosis as it is the
means whereby bacilli-laden macrophages, which multiply during the log phase of
bacterial growth, can be destroyed. Killing of bacteria in this way results in the
formation of the caseous center of the tubercle. Thus in DTH, bacilli are inhibited
extracellulary within the necrotic debris (Dannenberg, 1993 and 1991). The destruction
of tubercle bacilli via DTH occurs at the expense of host tissues. In a susceptible host,
bacilli escaping from the edge of the lesion are again ingested by nonactivated
macrophages where they are able to multiply. The DTH response will again destroy the
bacilli-laden macrophages and the adjacent tissues. If prolonged, this cycle will
ultimately result in destruction of so much viable lung tissue that it results in death of
the host (Dannenberg and Rook, 1994)

Delayed type hypersensitivity leads to pathologic responses such as granulomatous
inflammation, calcification, caseous necrosis and cavity formation (Kobayashi et a1,
2001). Release of cytotoxic factors and hydrolytic enzymes from macrophages in
combination with the release of tuberculin-like antigens from the bacillus in excessive
concentrations is principally responsible for the caseation necrosis characteristic of
many tuberculous lesions (Dannenberg, 1999; Dungworth, 1993).

The currently approved in vivo diagnostic skin test for tuberculosis is based on the
DTH reaction (Adams, 2001). This antigen specific test is facilitated by memory T

cells. In the caudal fold test purified protein derivative from M bovis (PPD-B) is

22

injected subcutaneously. Results are read after 48 to 72 hours. In any positive animals
or ‘suspects’ the comparative cervical test is done within 7 days where PPD-B and
PPD-A (M avium) are both injected subcutaneously (Adams, 2001).

Due to the limitations of the standard skin test and the comparative cervical
research is ongoing to identify in vivo tests with better sensitivity and Specificity.
BOVIGAMTM an in vitro cellular diagnostic is the best known. BOVIGAMTM is based
on the detection of IFN-y. Whole blood from suspect cattle is incubated overnight with
bovine PPD, avian PPD or negative control antigens. Interferon y in the supernatant
plasma is then measured by enzyme immunoassay (EIA) (Wood and Jones 2001).
Development of ancillary tests is also encouraged.

A major drawback of both DTH and CMI in immunity to tuberculosis is that they
can exert their influence only locally and not systemically. This is of importance in the

development of new vaccines for tuberculosis.

Apoptosis

The role of apoptosis in mycobacterial infections remains controversial. Although
some researchers hold the view that macrophages infected with mycobacteria can be
removed via apoptosis (Kaufmann, 2001; Oddo et al, 1998) others have queried
whether apoptosis is indeed required (Stenger et al, 1997; Palmer et al., 2002’).
Currently research indicates that apoptosis may play a role in the immunity to
tuberculosis via CD8 T cell activation. Apoptotic blebs from infected macrophages
containing pathogen-derived antigens are subsequently engulfed by uninfected

professional APC or dendritic cells. The dendritic cells utilizing MHC] and CD1 on

23

their surface can then present microbial antigens to CD8 T cells (Winau et al., 2004;

Schaible et al., 2003).

Mycobacteriosis in birds

Historically avian tuberculosis is the term used to refer to infection with
Mycobacterium avium in birds. However, mycobacteriosis is the term now preferred to
refer to disease in birds infected with members of the genus Mycobacterium. There is
also the risk of zoonosis as MAI and Mycobacteriun genavense can cause disease in
humans, usually irnmunocompromised patients (AIDS, young children).

The identity and function of avian cytokines involved in mycobacterial immunity
remain undetermined (Tell et al., 2001). As with lesions seen in mammals with

mycobacterial infection, the granuloma is also present in birds with mycobacteriosis

(Montali, 1988).

Mycobacterium avium-intacellulare complex (MAIC)

This complex includes M avium subspecies avium, M avium subsp.
paratuberculosis, M avium subsp silvaticum and M intracellulare. Mycobacterium
avium subsp paratuberculosis the causative agent of Johne’s disease in ruminants and
Mycobacterium avium subsp. silvaticum, also known as the wood-pigeon bacillus, will
not be discussed further here. Mycobacterium avium and Mycobacterium intracellulare
Share several growth characteristics and some Species-Specific agents therefore these
species are often grouped together and termed M avium-intracellulare complex. The

classical M avium serotypes 1-3 are far more pathogenic for birds than are those of M

24

intracellulare (Montali et al., 1976). M intracellulare appears to be minimally
pathogenic for birds (Tell et a1 2001). Interestingly, whereas birds are susceptible to M
avium serovars 1-3, they are very resistant to infection with M bovis and M
tuberculosis (Thoen and Chiodini, 1993).The orders of birds that appear to be most
susceptible to mycobacteriosis in zoological collections are Anserifonnes, Gruiforrnes
and Galliformes(Tell et al, 2001)

In any avian species, susceptibility to mycobacterial infection probably increases as
the intensity or number of stressors increases. Stressors include but are not limited to
malnutrition, overcrowding, adverse environmental conditions, pinioning and
concurrent disease (Tell et al, 2001)

Infected birds, which are shedding M avium via the feces, are a principle source of
infection for other birds. Clinically affected pet birds can present with weight loss,
depression, diarrhea, polyuria, poor feathering and lameness. Abdominal distention,
subcutaneous and conjunctival masses, along with dull and damaged feathers is
detected on physical examination (V anDerHeyden, 1997). Lesions are usually limited
to the alimentary tract, liver and Spleen. Bone marrow and joint involvement is also
reported. Birds do not usually have pulmonary lesions with tuberculosis. Mineralization
rarely occurs but caseating granulomas are usually present in the liver. Histologically
lesions consist of multiple granulomas with central caseous necrosis.

In Ziehl-Neelsen stained sections large numbers of acid-fast bacilli occur in the
central necrotic area as well as in the adjacent epithelioid macrophages (Fulton and

Theon, 2003, Tell et a1 2001, Hines et al 1995).

25

In domestic mammals, pigs are the most susceptible species to M avium infection.
Such animals are thought to be infected via the oral route and infected swine can
exhibit clinical disease. Lesions occur primarily in mandibular and mesenteric lymph
nodes, the intestinal mucosa, tonsils and liver. Such lesions are generally proliferative,
caseogranulomas and tubercles are rare in swine with MAIC infection (Hines et a1.
1995, Dungworth 1993, Timoney et al.1988)

The economic impact of MAI infection in domestic animals can be indirect due to
transmission of mycobacteria from infected birds to swine and cattle. In cattle, MAI
organisms can cause non-specific positive reactions to tuberculin, thus compounding
problems in eradication and surveillance programs for bovine tuberculosis (Tell et al

2001).

Mycobacterium genavense in birds

Mycobacterium genavensae is a very fastidious organism which does not grow well
on conventional solid media but can be isolated in liquid media (Middlebrook 13 or
BACTEC 13A) culture (Preheim, 1999). The optimal solid medium for primary
cultures is Middlebrook 7H1] acidified to pH 6 and supplemented with charcoal and
sheep blood. Colonies are observed within six to twelve weeks of incubation. Added
blood and charcoal were not as essential for subcultures (Realini et a1 1999).

Sequencing of 16S RNA revealed a Specific sequence for M genavense that was
used for the formal description of the species. The phylogenetic tree based on 168 RNA
sequences showed that M genavense and M simiae are closely related, on the same

branch, rooted deeply from the basis of slowly growing mycobacteria. Because of the

26

fastidious growth of M genavense, molecular methods are especially useful in the
identification of the species. In particular, efforts have been made to develop Specific
probes (Bercovier and Vincent, 2001).

Mycobacterium genavense was first identified in 1990, in a human patient with
acquired immunodeficiency syndrome (AIDS) (Bottger et al 1992, Hirschel et al 1990).
This mycobacterium appears to have a wide geographic distribution and has been
isolated from patients in Europe, the United States and Australia (Pechere et al 1995).
The source of M. genavense infection in humans is unknown, although an intestinal
source has been proposed since a variety of uncharacterized, fastidious mycobacteria
have been isolated from intestinal tissue and feces. Because the growth requirements of
M genavense are unknown, it is not possible to exclude any environmental source
(F alkinham, 1996)

Mycobacterium genavense is now recognized as the most frequent etiologic agent
of avian mycobacteriosis (cutaneous and disseminated) in pet birds, especially in
Passeriformes and Psittaciformes (Bercovier and Vincent, 2001; vanDerHeyden, 1997;
Hoop et al., 1996).

In birds, the clinical signs associated with the disease due to infection with M
genavense are Similar to any mycobacteriosis and are not specific i.e. sudden death
without any symptoms or following a wasting syndrome and emaciation (severe
muscular wasting), acute respiratory distress and sometimes diarrhea (Bercovier and
Vincent, 2001; vanDerHeyden, 1997). In general, the evolution of disease is more rapid

than that of M avium infection (Bercovier and Vincent, 2001)

27

Gross postmortem findings are nonspecific. In birds, M genavense infection is
associated with an enlarged spleen and liver, and thickening of the intestinal wall,
trachea and lungs. If present on internal organs, inflammatory nodules are non-caseous
and infiltrated by large macrophages. In the intestine, the mucosal area is generally
heavily infiltrated, suggesting an intestinal origin of the infection. Severe muscular
wasting, cutaneous nodules and subcutaneous granulonmas can also be observed
(Bercovier and Vincent, 2001; Hopp et al., 1996; Kiehn et al., 1996; Portaels et al.,
1996; Hoop et al., 1993).

As it was originally isolated from HIV-infected patients, M genavense typically
causes disseminated disease in those with advanced AIDS. Clinically the disease
mimics that caused by MAI. Spiking fevers, weight loss, diarrhea, anemia,
splenomegaly and lymphadenopathy are common, whereas pulmonary symptoms are

rare (Preheim, 1999).

Mycobacterium tuberculosis in birds

In contrast to M bovis, M tuberculosis has a more limited host range and does not
appear to have an indigenous animal host or reservoir. This conclusion is primarily
based on the facts that M tuberculosis does not appear to exist in the wild as an animal
pathogen and that animals that do become infected appear to be accidental hosts
(Montali et al., 2001). Humans and primates are the only known reservoir hosts for M
tuberculosis. Spread of M tuberculosis from humans to psittacines was first described
in the 1920’s and 1930’s (Hinshaw, 1933). As infections with M tuberculosis are

reported sporadically in pet psittacines they should always be considered a differential

28

for masses involving the face and head of a bird (Tell et al., 2001; Washko et al, 1998;
Hoefer et al., 1996; Woerpel and Rosskopf, 1983; Thoen et al., 1977; Ackerrnan et a1,
1974). In addition to psittacines, M tuberculosis infection has been reported in
Passeriformes (Hoop, 2002). Histologic lesions of M tuberculosis in birds typically
include caseous granulomas with giant cells and small numbers of acid-fast bacilli
(Montali et al, 2001 , Montali et al, 1976). It is unlikely that M tuberculosis infection in
birds is of great zoonotic potential (Montali et al, 2001).

Nonhuman primates are also susceptible to infection with M tuberculosis. Infection
with this agent has also been reported in captive elephants, dog, cats, swine and rarely

cattle (Michalak et al., 1998; O’Reilly and Daborn, 1995).

Mycobacterium bovis in birds

There are no reported cases of naturally acquired infection with M bovis in birds
(Pillai et al., 2000; Thoen et al., 1977). However, in experimental studies pigeons,
crows and starlings were found to be somewhat susceptible (Fitzgerald et al., 2003”;

Butler et al., 2001) whereas mallard ducks are resistant (Fitzgerald et al., 2005).

29

Mycobacterium Species infection in rodents
Voles

Susceptibility of voles to mycobacteria is recorded from the inception of studies
with this family of bacteria, as the field mouse (Arvicola [Microtus] arvalis) described
by Koch in 1884 are, in fact, “Southern field” or “common voles”. Voles are naturally
susceptible to infection with Mycobacterium microti the so-called vole bacillus.
Experimental infection with M tuberculosis and M bovis is also reported. There is a
single retrospectively confirmed report (spoligotyping) of M bovis infection in three
voles from southern England but there are no documented cases of voles naturally
infected with M tuberculosis (Delahay et al., 2002; Little et al, 1982; Francis, 1958).

Griffith (1937&1939) confirmed that voles are susceptible to infection with M
bovis and M tuberculosis when inoculated subcutaneously (SQ) and orally. Lesions
were more severe with M bovis, with generalized tuberculosis seen. Caseous
lymphadenitis was a prominent feature in addition to granulomatous pneumonia and
splenomegaly. Large numbers of bacilli were present in affected tissues when evaluated
histologically and in culture. Wells in 1938 used the same two species of Mycobacteria
but inoculated them intraperitoneally (IP). He obtained similar results and deduced
“that the vole is at least 100,000 times as sensitive to bovine tubercle bacilli as it is to
human tubercle bacilli”. Griffith (1941) in further experiments with voles inoculated
subcutaneously with bovine and human strains, the so called ‘vole test’, determined that
these animals could not be used to differentiate between ordinary M tuberculosis

strains and M bovis strains which were avirulent for the rabbit and guinea pig.

30

J espersen (1975’) repeated the experiments conducted by Koch in Microtus arvalis,
the common vole. Contrary to Koch’s report that common voles are susceptible to both
M bovis and M tuberculosis Jespersen determined that the common vole is susceptible
to M bovis only. Jespersen again demonstrated the lethality of M bovis versus M
tuberculosis in Arvicola terrestris, the vole rat (1974) and in Microtus ogrestis, the field
vole (1976). Additionally, J espersen conducted a series of experiments in red mice or
bank voles Clethrionomys glareolus. Bank voles (1975 t’) were inoculated IP with M
bovis, M tuberculosis, M bovis BCG and M avium. Bacteremia was most pronounced
in voles that received M bovis. Comparative studies with white mice showed less
severe bacteremia with M bovis. In another series of experiments bank voles were
inoculated via the subcutaneous, peritoneal and intravenous routes respectively (1977‘
b’ ”“1 °). In all instances, M bovis was universally fatal whereas the voles were resistant
to M tuberculosis.

Mycobacterium microti was first described by Wells in the 1930’s [formerly known
as Mycobacterium muris and Mycobacterium tuberculosis var. muris] to cause
tuberculosis in field voles (Microtus agrestis) (Wells and Oxon, 1937). This bacillus is
a member of the Mycobacterium tuberculosis complex and differs from other members
in its curved morphology, very slow growth in vitro and a predilection for infecting
laboratory animal species. M microti is identified by PCR-based Spoligotyping and/or
IS6110 restriction fragment length polymorphism (RFLP) typing. To date, M microti
infection has also been reported in wood mice (Apodemus sylvaticus), bank voles

(Clethrionomys glareolus), shrews (Sorex araneus) and rarely in llamas (Lama vicugna

31

molina), cats, pigs and humans (F rota et al., 2004; Oevermann et al., 2004; Cavanaugh
et al., 2002, Neimann et al., 2000; Foudraine et al., 1998; Kremer et al., 1998).

Common routes of infection in voles are by ingestion of diseased voles or their
excreta and by infection of wounds received in fighting (Rankin and McDiarmid,
1968). Initially Wells and Oxon suggested that gross lesions observed in affected voles
are indistinguishable from those due to M bovis and include caseous granulomas in the
lung and lymph nodes and splenomegaly. However, Griffith in 1939 in experimentally
infected voles did not detect ‘tubercles’ but there were subcutaneous masses of necrotic
tissue admixed with acid-fast bacilli.

Due to the fastidious growth of this bacillus with routine mycobacterial culture, the
prevalence of infection in animals and humans may be underestimated (vanSoolingen,
2001). Although M microti was first described over 70 years ago, few studies have
been undertaken to better understand its transmission between animals, zoonotic
potential or pathogenesis (Cavanagh et al, 2002).

As the vole bacillus is of lower virulence when compared to other mammalian
tubercle bacilli it was proposed as an alternative to M bovis BCG for use in
vaccination. However, the use of this vaccine in humans did result in clinical disease in
some immunocompetent individuals (van Soolingen et al., 1998). Research is ongoing
with use of M microti in vaccination (Brodin et al., 2004; Manabe et al., 2002;

Dannenberg et al., 2000).

32

Rats

Results of inoculation studies in rats consistently report high resistance to infection
with human, avian and bovine forms of tubercle bacilli (Francis 1958, Koch 1882 and
1932)

Griffith (1907’) conducted a series of experimental inoculations with M bovis in
rats. Large doses ranging from 1.0g to 10.0g of bacilli were used. Significant findings
were that rats subjected to IP inoculation were more susceptible compared to those
subjected to SQ inoculation. Although doses in excess of 5.0g did result in death from
tuberculosis in some of the animals, there was no gross or histologic evidence of classic
tubercles. Large numbers of bacilli were often cultured from lymph nodes, liver, spleen,
kidneys, lungs, omentum and bone marrow. Bacilli were occasionally detected in the
blood. Rats inoculated orally with tuberculous milk or tissues failed to develop
tuberculosis. On histology, foci of necrosis with intralesional bacilli were seen in two
out of 26 rats. Tissue smears revealed acid fast bacilli in the mesenteric lymph node in
17 of the rats and in the celiac lymph node in one rat.

The majority of experimental studies in the rat were performed on albino or
laboratory strains. Evidence for strain differences in susceptibility to M bovis infection
is therefore equivocal. Thus, Cobbett (1917) mentioned that the brown rat might be
more susceptible than the white rat while results of Schalk et al in 1935 indicated that
the brown rat is not easily infected with mycobacteria. However, as Schalk and
associates used M avium a valid comparison cannot be made (cited in Francis 1958).

Hehre and Freund in 1939 reported their findings of intravenous inoculation of M

bovis Ravenel strain in albino rats. Rats received 1mg and occasionally 10mg doses. Of

33

the eight rats inoculated, only one survived up to eighteen months. However as there
were no control animals used it was uncertain if tuberculosis did indeed contribute to
the demise of the seven rats that succumbed. Gross lesions indicative of tuberculosis
were minute tubercles in the lung and enlargement of the spleen. On histology, small
tubercles with intralesional bacilli were in the lung, spleen, liver and kidney. Caseation
was not present. The authors observed that these results supported the great resistance
of the rat to tuberculosis as 0.00001 mg doses of the same Ravenel strain given IV to
rabbits resulted in their demise within three to six months and at necropsy, there were
massive lesions in the lungs and kidneys.

Wessels (1941’) in studies on Wistar albino rats given 0.1mg doses of M bovis
intravenously (IV) found tuberculos lesions in visceral organs [lungs, liver, spleen and
tracheobronchial lymph nodes] except the kidneys. The rats however did not exhibit
any clinical signs of tuberculosis. Furthermore deposition of tubercle bacilli 24 hours
after IV inoculation was greatest in the liver followed in decreasing order by the lung,
spleen, tracheobronchial lymph nodes and kidney (Wessels 1941b). However, the
overall maximum rate of bacterial replication occurred in the lungs. Histologic
evaluation (Wessels 1941‘) confirmed the presence of immature epitheliod cells in the
lung that were incapable of destroying tubercle bacilli. In addition, caseation was not a
feature of microscopic lesions.

Ratcliffe (1953, 1952) in a series of aerosol inoculation studies concluded that
Long-Evans rats developed pulmonary tubercles very slowly. There was no evidence of

spread to thoracic lymph nodes or other organs.

34

Thorns et a1 1982 found that inbred Fisher F -344 rats when inoculated with M
bovis IP, harbored small numbers of the organism in their tissues (lungs) while
producing very little or undetectable CMI. It is probable that rats and other Species that
are more resistant to disease are able to modulate the cell-mediated immune response so
that the protective Listeria-like reaction is not overwhelmed by the more harmful
necrotic Koch-type reaction. It may be significant that degraded acid—fast bacilli were
seen associated with macrophages in many sections of infected rat tissues. The growth
of mycobacteria in rats was therefore controlled by the host, which resulted in a
persistent subclinical infection with no mortality.

Recently Sugawara and associates (2004) in a study with Lewis female rats which
were infected aerially with M tuberculosis report that granulomatous lesions were
detected in the lungs, Spleen, lymph nodes and liver. Additionally, expansion of IFN-y,
TNF-u and iNOS mRN A increased strongly over time but decreased afier 12 weeks of
infection.

Apart from the experimental studies done in laboratory strains environmental
surveys also evaluated wild type or pigmented strains of rat. In 1982, Little et a1
summarized their findings of a survey of wild animals in an area of Dorset, Great
Britain where M bovis infection is widespread in cattle and badgers. They stated that
M bovis was isolated from the lymph nodes in two out of 90 rats (Rattus norvegicus)
but there were no lesions observed. They postulated that these rats might become
infected by eating undigested grains of maize that were sometimes observed in badger
feces on the particular farm or from eating the carcasses of dead tuberculous badgers.

They concluded that the non-progressive nature of the disease in rats, however, makes

35

them unlikely to transmit infection to other rats or other species of mammals. Excretion
is unlikely to occur and the rat may be regarded as a dead-end host. Hancox (1996)
however thinks this view may be erroneous as there may be passive transmission of M
bovis by ‘healthy’ rats given prior reports of culture of bacteria from mesenteric lymph
nodes in animals with no gross or microscopic lesions.

Bosworth (1940) reported the incidental finding of M bovis in two wild rats in a
survey that he conducted to determine if these rats were carriers of Brucella abortus.
There were no gross lesions consistent with tuberculosis in either of these naturally
infected rats.

Pillai and associates (2000) initiated a study on the premises of 14 dairy herds in the
El Paso milkshed area in the state of Texas, USA. Texas had the most (cumulative)
tuberculous cattle herds of any‘state during the decade ending in 1997. Three roof rats
(Rattus rattus) were sampled [mandibular, prescapular, popliteal, parotid,
suprapharyngeal and bronchial lymph nodes, tonsil, lung, spleen, liver, mesenteric and
suprarnarnmary glands] for mycobacterial culture but M bovis was not detected.

Wilesmith and associates (1986) conducted a similar study in East Sussex, Great
Britain during a three-year period from 1981 to 1983. Of the103 rats (Rattus
norvegicus) captured all were negative for M bovis on mycobacterial culture [spleen,
kidneys, liver, lung, heart and any visible lymph nodes].

It should be noted that rats in addition to cats and mice are naturally susceptible to
Mycobacterium lepraemurium the so-called rat leprosy bacillus. In rats, the disease
presents in two forms glandular and musculocutaneous. The acid-fast bacillus occurs in

infected tissues in large numbers but there is no associated caseation or necrosis

36

(Rankin and McDiarmid, 1968). Natural infection likely occurs via cutaneous
abrasions and respiratory mucocsal surfaces. Ingestion is another possible route of
infection (Rojas-Espinosa and Lovik, 2001). Although a separate species from
Mycobacterium leprae (the cause of leprosy in humans), M lepraemurium in rodents

was used historically as a model of the human disease.

Mice

Much of the early research conducted with Mycobacterium spp. in mice utilized
white or albino mice that frequently were not classified to the strain level (Table 1:2).
This made it challenging at best to advance laboratory studies with mice from the late
1890’s up to the 1940’s. During this period, it was generally accepted that mice, like
rats, were resistant to tuberculosis. However, Koch did propose differences in the
susceptibility of mice of varying strains with white or albino mice being resistant to
inoculation with bovine bacilli and pigmented strains being susceptible (Smith, 1898).
It is now suspected that variability in resistance to tuberculosis in mice is dependent on
their genotype (Kramnik and Boyartchuk, 2002; Chackerian and Behar, 2003).

The mouse has largely replaced guinea pigs and rabbits as the animal model of
choice in experimental tuberculosis studies (primarily those of M tuberculosis and, to a
lesser extent, M bovis). The vast majority of studies are concerned with the
immunology of mycobacterial infection, vaccine development and, more recently,
genetics of host resistance and susceptibility. Mice are suited to use in such research as
they are inexpensive, can be easily housed in biosafety level three (BL3) facilities and

an extensive immunological database is available. In addition, the importance and role

37

of T cell subsets in mice is consistent with observations in humans, and inbred strains
including knockout mice Show a range of resistance or susceptibility to infection (North
and Jung, 2004; Orme, 2003; Orrne et al., 2001; Glickman and Jacobs, 2001; Griffin et
al., 1995; Leeford, 1984). However, a major disadvantage to the use of mice in the
study of tuberculosis is that delayed type hypersensitivity (tuberculin skin test) response
is poor. Caseation and liquefaction of pulmonary tubercles is also not a feature in
murine tuberculosis (McMurray, 2001). Laboratory strains of mice currently used in
tuberculosis research, primarily M tuberculosis are listed in Table 1:3.

Several routes of inoculation have been utilized in studies of tuberculosis in the
mouse model including but not limited to SQ, IP, IV, oral, intranasal (IN), inhalation/
intratracheal (IT) and intracerebral (Francis, 195 8). However, IV and aerogenic routes
are the more common experimental routes. Irrespective of the route used in
experimental studies, the lungs are the most severely affected in susceptible mice as
evidenced by gross and histologic lesions. Gross pulmonary lesions observed are
enlargement of the lungs up to four or five times the normal size which are firm to
consolidated with multifocal to coalescing granulomas/tubercles. Histologic lesions
range from interstsitial aggregates of foamy macrophages with abundant lymphocytes
in resistant animals to a more florid granulomatous and necrotizing pneumonia in
susceptible mice. Large foamy and epitheliod macrophages with moderate to abundant
numbers of neutrophils are reported in pulmonary lesions of susceptible strains, but the
numbers of lymphocytes are reduced when compared to resistant strains. Acid-fast
bacilli accumulate intracellularly within macrophages as well as extracellularly in the

necrotic debris (Turner et a1. 2003, Turner et a1. 2001, Raleigh and Youmans, 1948). It

38

is proposed that lymphocyte (CD4+) migration to the Site of inflammation and the
associated cytokines (IFN-y), which they release, serve to modulate the severity of
pulmonary lesions in mice due to tuberculosis (Chackerian and Behar, 2003; Turner et
al,. 2001; Dunn and North, 1995). Unlike tuberculosis in humans, typical tubercles,
cavitation and Langhans giant cells are not evident in mice (Francis 1958, Raleigh and
Youmans 1948). Other organs affected less consistently are the Spleen, liver and
various lymph nodes (Griffin et al.1995).

Although laboratory strains of mice are derived from the domestic or house mouse
(Mus musculus) documented instances of natural/environmentally acquired infection
with M bovis in the wild type mouse were not encountered in a review of the literature.
Little and associates (1982) evaluated 14 house mice, Wilesmith and associates (1986)
examined 58 house mice, Fischer and associates (2000) examined 33 house mice and
Pillali and associates (2000) examined 54 house mice. In each of the environmental
surveys, all mice evaluated had no gross or microscopic evidence of tuberculosis and
tissue cultures for Mbovis were consistently negative.

Natural infection with M avium is, however, reported in mice. deJong in 1903
reported such an occurrence in the white laboratory mouse and Hemmert-Halswick in
1934 documented a similar occurrence in the gray mouse (cited in Raleigh and

Youmans 1948).

39

Nramp/Beg

The Bcg/Ity/Lsh locus in mice is located on chromosome 1 and is thought to control
the innate resistance to infection of certain intracellular pathogens, namely
Mycobacterium spp., Salmonella typhimurium and Leishmania donovani. The Bcg gene
has subsequently been renamed Nramp] as it was found to be allelic with the gene that
encodes the natural resistance associated macrophage protein (Nramp). Recently this
gene has been renamed solute carrier familyll member 1(Scll IaI), OMIM [Online
Mendelian Inheritance in Man] #600266. Thus, Nramp] and Sell 1 a1 are used
interchangeably. The Nramp family of proteins is highly conserved from bacteria to
man. Homologues have been identified in the fruit fly Drosophila (70% identity), the
worm Caenorhabditis (C. elegans, 68%), plants (0sNramp family, 50-60%) and the
yeast Saccharomyces cerevisiae (40-45%) (Skamene et al.1998).

In mice, the Nramp-l protein is an integral membrane protein expressed exclusively
in the lysosomal compartment of monocytes/ macrophages. In human leukocytes,
however NRAMPl is primarily expressed in polymorphonuclear leukocytes
(Buschman and Skamene 2001). This membrane protein is highly hydrophobic with a
predicted molecular mass of 60kD and has twelve transmembrane (TM) domains, a
glycosylated extracellular loop and several phosphorylation sites. Afier phagocytosis,
Nrarnpl is targeted to the membrane of the microbe-containing phagosome (late
endosome/lysosome) in the macrophage (Gruenheid et al., 1997).

Initially it was thought that Nrarnpl and its human homologue NRAMleithin the
phagosome may influence the intracellular concentration of F e2+ and/or other divalent

cations (Bellamy 1999, Canonne-Hergaux et al 1999, Zwilling et a1 1999, Govoni and

40

Gros 1998). Divalent cations are essential cofactors for many microbial metabolic
enzymes, and alterations in their availability could have pleiotropic effects on
antigenically unrelated microbes included in the phagosome (Govoni and Gros 1998).
Now it is known that Nrampl (Slcl lal) is a highly pH-dependent antiporter that can
flux bivalent cations in either direction depending on the pH on either side of the
membrane. As Nrampl (Slcl lal) is localized to the late endosomal/lysosomal
membrane delivery of cations from the cytosol to the mycobacteria containing
phagosomes is associated with bacteriostasis, bacterial damage and can also inhibit the
ability of mycobacteria to block phagolysosomal fusion and acidification (Goswami et
al. 2001).

Sequencing of the Nrampl mRN A in mice revealed the difference in the Bcg locus
of resistant (dominant) mouse strains (Bcg’) when compared to susceptible (recessive)
(Bcg‘) was a Single glycine (G) to aspartate (D) substitution at amino acid position 169
in Nramp molecules. Thus, G169 in resistant mouse strains is replaced by D169 in
susceptible strains (Nakanaga et a1 1999, Govoni et al 1996, Vidal et al, 1995, Sakmene
1994). However, it should be noted that these initial studies utilized the attenuated M
bovis (BCG) strain, M lepraemurium, M intracellulare, M smegmatis and M avium
(Skamene et al. 1998).

Other researchers have suggested that it may be too simplistic to associate
resistance to mycobacterial infection in mice with a single genetic locus, namely
Nrampl . North and Medina (1998, 1996‘I and b), in experimental studies with the virulent
H37Rv strain of M tuberculosis in mice found that although the infection in the lung

was initially controlled, some strains namely DBA/2, NJ and CBA/J, were unable to

41

maintain this control. Tuberculosis in these strains was later reactivated which led to
their demise. C57 background mice were however able to limit bacterial growth.
Confirmation of the lack of Nrampl to influence infection in mice with virulent M
tuberculosis was revealed in studies of gene knockout mice on a 129/J background.
Nrampl-resistant and susceptible mice each had comparable susceptibility in all of the
organs evaluated (North et al. 1999).

In addition to humans and mice, NRAMP genes are documented in cattle (Barthel et
al.2000, Feng et al. 1996). Primary studies in rhesus macaques and deer with M
tuberculosis and M bovis respectively however failed to identify an association
between resistance to infection and NRAMP genes (Deinard et al 2002, Mackintosh et
al. 2000).

It is likely that genetic resistance to mycobacterial infection is multifactorial and
therefore not related to just one gene. Genetic ‘systems’ and loci other than NRAMP
which have been implicated are interferon-y-receptor, vitamin D receptor (V DR),
interleukin 1 gene cluster, specific HLA alleles and the SSH (susceptibility to
tuberculosis I) locus (Krarnnik et al. 2000, Wilkinson et al. 2000, Wilkinson et al.

1999, Goldfeld et al. 1998, Newport et al. 1996).

42

Surveillance for bovine tuberculosis in white tailed deer and other wildlife in
Michigan, 2000-2003

Initially M bovis was thought to be maintained only in cattle (Dungworth, 1993).
However, the presence of maintenance or reservoir host of bovine tuberculosis in some
countries threatens to disrupt efforts to eradicate this disease from domestic animals.
Indeed Cosivi and associates (1998) state “wild animal TB represents a permanent
reservoir of infection and poses a serious threat to control and elimination programs”.
Maintenance hosts of M bovis include the brushtail possum (T richosurus vulpecula) in
New Zealand, Eurasian badger (Meles meles) in Ireland and the United Kingdom, bison
(Bison bison) in Canada, African buffalo (Syncerus cafler) in Uganda, white-tailed deer
(Odocoileus virginianus) in Michigan, USA and lechwe antelope (Kobus leche) in
Zambia. Spillover hosts are numerous (de Lisle et al. 2002, de Lisle et al. 2001,
O’Reilly and Daborn 1995)

Mycobacterium bovis infection in various species of deer including fallow deer
(Dama dama), axis deer (Axis axis), sika deer (Cervus nippon), red deer (C. elaphus),
roe deer (Capreolus capreolus) moose or elk (A Ices alces) and white-tailed deer
(Odocoileus virginianis) is sporadically reported Countries where this disease has been
detected include but are not limited to the United Kingdom, New Zealand, the Republic
of Ireland, Denmark, Switzerland, Germany, Sweden, the USSR, India, Canada and the
United States of America (Clifton-Hadley and Wilesmith 1991). Tuberculosis due to
M bovis affects both free-living wild and captive deer (Kaneene et al., 2002; de Lisle et

al. 2001).

43

Gross lesions in tuberculous deer usually present as thin walled abscess filled with
cream colored purulent material. Less frequently, the ‘classical granuloma’ common in
cattle with caseation and calcification may occur in deer. Tissues most often affected
are retropharyngeal, submandibular, mediastinal and mesenteric lymph nodes and the
lungs. Histologically, acid-fast bacilli occur in small numbers or are rare to nonexistent.
Lesions in affected cervids range from granulomatous to necrotizing or suppurative
with partial mineralization (Schmitt et a1 1997, Rhyan and Saari 1995). In white - tailed
deer, liquifaction of tuberculous lesions over time is common (Palmer et al 2002b).
Similar to cattle, deer are infected via the respiratory and gastrointestinal tract (O’Reilly
and Daborn 1995).

Tuberculosis due to M bovis is endemic in white-tailed deer (WTD) in Michigan.
The genesis of this outbreak was recognized in 1994 with the discovery of an infected
four and a half year old hunter harvested male WTD from the northeastern area of the
lower peninsula of Michigan. Other WTD were identified the next year in a follow up
study of animals within a ten mile radius (Schmitt et al, 1997). Mycobacterium bovis
infection in deer in Michigan was reported sporadically prior to this; a single WTD
from Alpena county in 1975 and in 1962 an outbreak at a deer park involving exotic
fallow deer (Quinn and Towar, 1963).

As it was realized that WTD in Michigan were a maintenance host for M bovis, the
only known occurrence of this phenomenon, annual surveillance of the disease in deer
was initiated in 1995 and is ongoing. The total number of deer evaluated at the
Diagnostic Center for Population and Animal Health (DCPAH) (formerly the Animal

Health Diagnostic Laboratory (AHDL), Michigan State University (MSU) from 1995

44

through fall 2003 was 107, 791. The number of deer positive for M bovis during this
interval was 455. . The prevalence of bovine TB in WTD in the state of Michigan is
highest in the counties of Oscoda, Alcona, Montrnorency, Alpena and Presque Isle (5-
county area). Cumulative data on the WTD hunter harvest surveillance from the
inception through 2003 are presented in Table 1: 4 and Figure 1:1.

The establishment of white-tailed deer as a maintenance host for M bovis was
thought to be related to the focal density of the population and utilization of
supplemental feeding (Schmitt et al, 1997). M bovis could, therefore, be transmitted
directly from deer-to deer as well as via contamination of feedstuff not fully ingested
by infected animals (Palmer et al. 2004”, Palmer et al. 2001). Thus, a voluntary ban on
supplemental feeding was instituted by the Michigan Department of Natural Resources
(MDNR) in the fall of 1998 with a mandatory ban introduced in the fall of the
following year in addition to restrictions on baiting. A retrospective study conducted by
Miller et al. (2003) showed that an increase in the prevalence of M bovis in WTD was
associated with an increase in the percentage of supplemental feeding sites that
provided fruits and vegetable and this provided evidence to support the feeding ban.

In conjunction with feeding restrictions, there was concomitant increase in the
number of antlerless deer permits issued and extension of hunting seasons
(firearm/muzzleloader, archery, and youth) to increase the numbers of WTD harvested
which consequently drives the population down. This would limit congregation of deer
in any given location at any given time that would translate into reduced potential for

the spread of M bovis from animal to animal.

45

Infection in deer likely occurred from spill over from infected cattle [the state was
declared TB- free in 1979]. Subsequently infected deer transmitted M bovis back to
cattle (Palmer et al. 2004’). Up to October 2004, 32 bovine tuberculosis infected herd
have been identified in Michigan, 26 beef herds and six dairy herds. Three of the
affected herds are not confined to the 5-county area but were still found in counties
where bovine TB positive deer were found (Figure 1:2).

The protocol for evaluation of WTD for bovine TB at the DCPAH, MSU entails
examination of the cranial lymph nodes (medial retropharyngeal, parotid,
submandibular) in deer heads submitted through the Michigan Department of Natural
Resources (MDNR). The basis for submission of the head only is founded in a review
of the literature which documents the retropharyngeal lymph node as the most
commonly affected site in cervidae (Griffin and Mackintosh 2000, O’Reilly and
Daborn 1995, Griffin and Buchan 1994, Whiting and Tessaro 1994). Although less
frequently entire carcasses and other tissues, usually the lungs, are also submitted when
displaying gross lesions suggestive of tuberculosis. Samples of grossly visible lesions
are then collected for histopathology (routine H&E and acid-fast) and for submission to
the Michigan Department of Community Health (MDCH) Tuberculosis laboratory for
mycobacterial isolation and identification.

AS only lesioned deer are sampled, there was concern that this protocol may result
in an underestimation of the prevalence by as much as 57% (Palmer et al. 2000).
However, a more extensive study in the free ranging deer population in the fall of 2001
where all negative deer, that is those having no grossly visible lesions, taken in six

townships within the core (DMU 452) (Figure 1:3) were sampled. The estimated

46

apparent and true prevalence were determined to be 2.7% and 3.6%, respectively
(O’Brien et al. 2004)

In addition to white-tailed deer, M bovis infection has also spilled over to other
carnivore/omnivore wildlife species in Michigan. In response to the discovery of
endemic disease in the deer population, surveillance of other noncervid wildlife was
initiated in 1996 (Bruning-Fann et al., 2001). To date 16 different species have been
tested. F orty-two positive animals were identified from 1997 thru 2003 in Six of the
species (black bear, bobcat, coyote, opossum, raccoon and red fox) (Table 1:5). The
majority of affected animals are confined to the 5 - county area which supports the
transmission of infection from WTD. In contrast to the deer surveillance study, in other
species, the entire carcass is submitted except for those of black bears which were
evaluated (necropsied) in the field. In addition to cranial lymph nodes thoracic
(mediastinal, tracheobronchial) and abdominal (mesenteric, hepatic, ileocecal) are
collected and pooled for histopathology (H&E and AF) and mycobacterial culture.

Gross lesions suggestive of tuberculosis detected. in five animals were
predominantly confined to abdominal lymph nodes [enlarged mesenteric lymph node in
four; focal pulmonary granuloma in one]. This is supportive of infection via ingestion
of contaminated tuberculous material. On microscopic evaluation, 10 of the 42 culture
positive animals had low or even rare numbers of acid-fast bacilli. These 10 animals
also had histologic lesions [caseogranulomas] suggestive of tuberculosis. However, in
an additional four culture positive animals with histologic lesions, acid-fast bacilli were
not detected. As spillover hosts are implicated in the dissemination of bovine

tuberculosis experimental studies are ongoing to better define pathogenesis and

47

attendant risk factors in such species. It is anticipated that elimination or decrease in the
prevalence on M bovis infection in cattle and WTD will preclude persistence of
infection in carnivore/ omnivore species in Michigan.

In experimental studies the North American opossum was found to develop lesions
primarily in the lung resulting from IM, oral, and aerosol inoculation. Thus,
dissemination of bacteria via aerosol in naturally infected opossums is possible. An
orally inoculated animal also shed mycobacteria in the feces. However, unlike their
New Zealand relative the brushtail possum, maintenance of bovine tuberculosis in
North American opossums in the lower peninsula of Michigan does not appear to be a
major factor in the transmission of organisms to cattle and deer (Fitzgerald et al. 2003‘,
Diegel et al. 2002)

Palmer and associates (2003‘), in studies with raccoons inoculated with varying
doses of M bovis and via varying routes, concluded that large doses were required to
establish infection and low numbers of bacilli were excreted in nasal secretions and
saliva. It is, therefore, unlikely that tuberculosis in raccoons is widespread.
Dissemination of tubercle bacilli fiom infected raccoons into the environment may be
unlikely as M bovis was not isolated from urine or feces in any of the raccoons in this
study. Two of the IV inoculated raccoons did, however, develop fistulous tracts in
infected superficial lymph nodes similar to lesions that develop in naturally infected
brushtail possums.

In addition to the unique occurrence of maintenance of M bovis infection in WTD
in Michigan bovine tuberculosis is also reported in North America in a related cervid

species the elk (Cervus elaphus). These animals either were in a captive herd or

48

infected by close contact with infected cattle (Lees et al. 2003, Thoen et al. 1992,
Rhyan et a1. 1992). Since the geographic location of the reintroduced herd of elk in
Michigan overlaps that of the M bovis infected WTD, surveillance of elk commenced
in 1996 on a voluntary basis. Mandatory testing of all elk killed/ hunted commenced in
1998. Four elk positive for M bovis have been identified from a total of over 1200 elk
evaluated from 1996 thru December 2003 (Figure 1:4). Histologically, lesions were
detected in three of the four elk [suppurative tonsillitis; caseogranulomas in medial
retropharyngeal LN; multinucleated giant cells in LN] and further, acid-fast bacilli were
seen in two of these three elk.

It is challenging to propose a mode of infection for the elk in the northern Lower
Peninsula as only the head is submitted for evaluation for tuberculosis. However,
evaluation of farmed elk involved in an outbreak of bovine TB in Alberta, Canada in
1991 suggested that aerosol transmission was the most significant means of Spread
within the herd. Similar to WTD in Michigan, gross lesions were predominantly in the
lymph nodes and were of a suppurative nature. Retropharyngeal lymph nodes were the
most consistently affected lymph node in the head. Other visceral lesions consistent
with tuberculosis were observed only in the lung and pleura of affected elk (Fitzgerald
et a1. 2000, Whiting and Tessaro 1994). The prevalence (apparent) of gross lesion in
these elk was determined to be 39.8%. This high prevalence is likely indicative of the
increased population density and management factors in these farmed animals. The
apparent prevalence of bovine Tb in free-roaming elk near Riding Mountain National
park in Manitoba, Canada is approximately 1 %, which is nearer to that currently

detected in Michigan elk (~ 0.31 %) (Lees 2004).

49

Objectives for research

Given the wide host range of M bovis, and the identification of WTD in Michigan
as a reservoir host, it was realized that there is insufficient information on the
transmission and pathogenesis of infection by this bacterium in many of the wildlife
species in the state which are in contact with cattle as well as free-ranging and captive
cervidae. Thus the global objective of this collection of studies was to experimentally
introduce M bovis into select wildlife species in order to provide necessary data on the
transmission and pathogenesis in such species and ultimately to assess the attendant
risk associated with them serving as reservoir or spillover hosts

The four species which were experimentally inoculated with M bovis were wild
turkeys, meadow voles, house mice and Norway rats. For each species, a route of
experimental exposure was chosen which would most closely mimic that to which they
would potentially be exposed to M bovis if it were present in their natural habitat.
Thus, turkeys were inoculated via the trachea and orally. The voles were exposed via
the nasal and oral routes, whereas the mice and rats were orally inoculated. In each of
these studies, the stated hypothesis was that such synanthropic Species can be infected
with M bovis and would thereafter shed bacilli in the environment and act as a source
of infection in cattle and humans.

Additionally, in the house mice another experiment was performed to determine
their phenotype for the Bcg/Nramp—I gene in order to determine if this gene is
associated with their susceptibility to infection with M bovis. Mice were selected as the

sequence for this particular gene is well documented in this species.

50

In addition to studies evaluating transmission of bovine tuberculosis in wildlife
another area of research which is lacking is a method to diagnose mycobacterial
infection which is relatively fast, inexpensive and reliable. Mycobacterial culture is still
upheld as the ‘gold standard’ in diagnosis although it can take up to eight to twelve
weeks for a definitive diagnosis. Consequently, in this body of work a novel
experimental technique for the identification of M bovis in formalin fixed paraffin
embedded tissues which utilized laser capture microscopy and PCR was investigated in

an attempt to improve turn around time for diagnosis.

51

Figure 1: 1 Map of the lower peninsula of Michigan which depicts the total
number of deer positive for bovine tuberculosis from 1995 through 2003 and the
counties where they were captured. Also included are the deer with tuberculosis
detected in 1975 and 1994 as well as a positive captive deer herd diagnosed in
1997.

Images are presented in color

52

BOVINE TUBERCULOSIS SURVEY RESULTS

NgMBER
is $7322?" 1 amour...
h goaggnsmVE 1 | | 113 INFECTED COUNTY
h 1996-zoo: POSI11VE 441 - HYDROLOGY

TB DEER D COUNTY LINES

zoo: POSITIVE 32

13 DEER /\/ HIGHWAYS

E 1991 POSITIVE
CAPTIVE DEER HERD

        
    

 

0 10 20 30 Miles
E

NOUI'IH BMW

Figure 1:1

53

Figure 1:2 Map of the lower peninsula of Michigan which depicts the total
number of beef and dairy herds in which animals were diagnosed with bovine
tuberculosis from 1998 through October 2004.

Images are presented in color

54

 

BOVINE TUBERCULOSIS SURVEY RESULTS
POSITIVE CATTLE FARMS BY YEAR

NUMBER
W 1998 BEEF HERDS 3

now 452 (2001)
‘F’ 1’” BEEF "ER” 1 I ' ITB INFECTED couurv
‘ zooo BEEF HERDs E] HYDROLOGY
‘ 2001 BEEF HERDs D COUNTY ”"53
HIGHWAYS

    
  
 
 
     
    

5
a
1:; 2002 BEEF NEWS 5: 0 1o 20 30 Miles
1” zoos BEEF HERDs 4 F:—
N’.“ 2000 DAIRY HERDs 2
2002 DAIRY HERD 1
"3'" zoos DAIRY HERDs

"2." 2004 DAIRY HERDs
" ' 'Totai Includes twice
affected fan'ns

‘.

 

M MISSAUKEE

CLARE GLADWIN I ”‘5“ch
I D
. ‘ ' .‘ |

Tuscou

 

NEWAYGo

 

      
 

MONTCALM 5361107

 

mum—Truman“ IMIIWM Rn. 1001M

Figure 1:2

55

Figure 1:3 Map of the lower peninsula of Michigan which depicts the location of
deer management unit (DMU) 452 and the counties of the lower peninsula of
Michigan where animals (all species) with bovine tuberculosis were detected.

Images are presented in color

56

 

 

a TB CORE AREA

:1 TB INFECTED COUNTY
El HYDROLOGY

D COUNTY uNES

/ / HIGHWAYS

0 10 20 30 Miles

 

 

 

 

 

 

 

 

 

IGBQYGA
.. 3 ®
j " m
’CHARL Ix .
65
" as
25 as a: g ‘
3‘ on 31 .
R
H
.. .. '3
@l .. .v. n 23 fi
I I r2 7: 77 n I
a 10 c
K“ RA 2:
,5 O
@ 2
,2 66)
. ‘ ‘1 as \I n- E 55
‘ ‘MANISTQ IWEXFQ‘D" MISSAUREE o‘ Fm
I "x“ ‘ . ENACI
a CLARE guy , IN 6R 4.7:}
@ [l , \ C.
m @ 7, :1 @_... ,. . 1
IB‘ B 1‘;
BABE. > IIIDLAND .
20 “° ‘ U.Y
>- 70 _. » A. |
2. Eli
Efl __ 47 ‘
. :I I1 , '
Y M6NTCALM~ @sh‘m" . 3‘ I“ _ '5
. ' './ ® .
I (7\ _‘__ .
@.......Wp....,......m..w..z.~, “mama

 

 

Figure 1:3

57

Figure 1:4 Map of the lower peninsula of Michigan which depicts the total
number of elk positive for bovine tuberculosis from 1996 through 2003 and the
counties where they were captured.

Images are presented in color

58

 

 

Figure 1:4

BOVINE TUBERCULOSIS
ELK SUBMITTED FOR TB TESTING

N PRIMARY ELK RANGE D 2001 DMU 452
O 1292 ELK TESTED FOR TB
2000 2001 a. zoo: POSITIVE
TB ELK

__] TB INFECTED COUNTY

In HYDROLOGY

D COUNTY UNES
HIGHWAYS

HEBOYGAN

59

NOHI'IH BMW

Table 1:1 A summary of in vitro biochemical tests used to identify M bovis,
M. avium and M. tuberculosis

 

 

M. bovis M. avium M. tuberculosis
Nitrate Negative Negative Positive
Niacin Negative Negative Positive
PZAl Resistant Susceptible Susceptible
Catalase Negative Negative Negative
Urease Positive Negative Positive
TCH2 Susceptible Resistant Resistant

 

lpyrazinamide, 2 thiophen-2-carboxylic acid hydrazide
After Witebsky and Kruczak-Filipov 1996

60

Table 1:2 A summary of pertinent findings of research (1907 through 1953) in various strains of mice
experimentally infected with Mycobacterium bovis via different routes

 

Route/Investigator Year

SQ/IP

Griffith, A53

Griffith, ASm

Gerstl & Thomas'

[V
Gunn, Nungester
& Hougen

Schwabcher
& Wilsonl

Kirchheimer et a13

IN/ aerosol
Schwabacher
& Wilson‘

Glover 3

Ratcliffe3

Ratcliffe3

1907b

1911,1937

1940—4 1

1933-34

1937

1950

1937

l 944

1952

1953

Strain

not stated

white & field

dilute brown albinos,
ABC black/ white

white

white

Strong A

white

not stated

albino

albino

Results

IP mice death due to Tb; SQ no
deaths due to Tb. Mice less resistant
to growth of Tb bacillus than rats

White mice more susceptible than
rats. Field voles more susceptible

than field or house mice.

Lesions regressed 80 days Pl.

No observable differences in
lesions with bovine and human
Tb strains

Similar survival with bovine and
human Tb strains [22-33 days]

Bacilli shed in feces

Lesions similar to IV infection
and were dose-dependent

Lesions primarily in the lungs,
lacked caseation

Lung lesions 4-8 weeks PI

Death from bronchial spread in
< 60 days

 

I After Darzins 1958
2 After Francis 1958

3 See references

SQ- subcutaneous; IP- intraperitoneal; lV-intravenous; lN-intranasal; Tb- tuberculosis; Pl- post-inoculation

6l

Table 1:3 Classification of inbred strains of mice based on their susceptibility
to infection with M. tuberculosis

 

Resiatant Intermediate Susceptible
A/Sn BALB/c 129/Sv
BALB/c A/J
C57BL/10 C3Hc
C57BL/6 CBA

DBA/2

I/St

SWR‘

 

After Chackerian and Behar, 2003; Medina and North, 1998
1 Turner et al. 2003

62

Table 1:4 A summary of the surveillance for Mycobacterium bovis infection in
white-tailed deer in the state of Michigan, USA for 1995-2003

Core area also referred to as deer management unit (DMU) 452 is an area of
approximately 1561 square km as defined by administrative boundaries of the
Michigan Department of Natural Resources afier the 1994 tuberculous WTD was
found

Apparent prevalence (AP) calculated as the number of deer exhibiting gross
lesions consistent with TB that are mycobacterial culture positive divided by the
total number of deer submitted for testing multiplied by 100

True prevalence (T P) is the total number of diseased deer in the population. TP
was calculated from the sensitivity and specificity using the formula of Rogan and
Gladden (1978)Aas referenced by O’Brien et al. in 2004.
p = _B_+ - 1
a+B—l

A . .
’13 = true prevalence, t = apparent prevalence, B = specrficrty and

a = sensitivity

Five county area (CO) — The five counties with the highest prevalence of M
bovis infection in WTD are Presque Isle, Montrnorency, Alpena, Oscoda and
Alcona

63

 

Table 1:4 A summary of the surveillance for Mycobacterium bovis
in white- tailed deer in the state of Michigan, USA for 1995-2003

 

Total #TB Core Core 5-CO 5-CO

# deer Pos AP (%) TP (%) AP (%) TP (%)
1995 386 18 5.1 6.8 NA NA
1996 3,690 47 2.5 3.3 0.17 0.23
1997 3,518 67 4.4 5.9 0.43 0.57
1998 7,915 75 2.7 3.6 0.28 0.37
1999 17,502 56 2.3 3.1 0.19 0.25
2000 22,01 1 53 2.6 3.5 0.35 0.47
2001 20,461 56 1.8 2.4 0.55 0.73
2002 16,137 51 2.8 3.7 0.48 0.64
2003 16,171 32 1.7 2.3 0.22 0.29

 

64

Table l: 5 Summary of carnivore and omnivore species in Michigan that were
tested for M bovis infection for the years 1997 through 2003

I Total number of this species of animal tested

ITotal number of animals positive for M bovis on culture

I Prevalence is the total number of positive animals of a given Species divided by

the total number of animals in that group multiplied by 100

65

Table 1:5 Summary of carnivore and omnivore Species in Michigan that were tested
for M. bovis infection for the years 1997 through 2003

 

 

SPECIES TESTED‘ POSITIVEf PREVALENCE‘
Badger (Taxidea taxus) 46 0 0
Black bear (Ursus americanus) 214 7 3.27
Bobcat (F elis rufus) 58 4 6.90
Coyote (Canis latrans) 379 18 4.75
Feral cat (F elis silvestris catus) 35 0 0
Feral dog (Canisfamiliaris) l 0 0
Gray fox (Urocyon cinereoargenteus) 5 0 0
Mink (Mustela vison) 5 0 0
Opossum (Didelphis virginiana) 381 2 0.52
River otter (Lutra canadensis) 10 0 0
Porcupine (Erethizon dorsatum) 1 0 0
Raccoon (Procyon lotor) 3 3 5 8 2.39
Red fox (Vulpes vulpes) 29 3 10.3
Skunk (Memphitis memphitis) 21 0 0
Snowshoe hare (Lepus americanus) l 0 0
Long-tailed weasel (Mustelafi'enata) l 0 0
TOTAL 1,522 42 2.76

 

66

CHAPTER TWO

Experimental Inoculation of Wild Turkeys (Meleagris gallopavo) with

Mycobacterium bovis

Abstract

Although avian species are known to be susceptible to infection with
Mycobacterium spp. organisms much remains unknown about the susceptibility of
birds to infection with M bovis. The objective of this current study was to
determine if wild turkeys (Meleagris gallopavo) can be infected with M bovis
when inoculated by the oral or intratracheal route. Six turkeys were orally
inoculated and another six were inoculated via the trachea with a high dose of M
bovis, 1 x 105 CF U/ml. Six turkeys were sham inoculated controls. Two turkeys
from each treatment group were sacrificed on day 30, 60 and 90 post-inoculation
(PI). There were no gross or microscopic lesions consistent with mycobacteriosis
in the twelve inoculated turkeys over the 90 day duration of this study. Fecal
cultures were also consistently negative for M bovis when sampled prior to
inoculation and on days 1, 30 and 60 PI. Two intratracheally inoculated turkeys
were positive for M bovis in visceral tissues at 30 days post-inoculation.
However, this finding was only indicative of passive persistence of mycobacteria
in the tissues and not of infection as there were no attendant lesions or clinical

compromise to support infection. Thus, it can be concluded that wild turkeys are

67

resistant to infection with M bovis and, therefore, pose minimal threat as

reservoir or spillover hosts for this organism.

Introduction

F rec-ranging white-tailed deer (WTD) (Odocoileus virginnianus) in the Lower
Peninsula of Michigan are known to be reservoir hosts for Mycobacterium bovis,
the causative agent for bovine tuberculosis (deLisle etal., 2001; Schmitt et al.,
1997). Spillover from deer has resulted in infected dairy and beef cattle in the
state.

A need for determining the ability of wild turkeys to serve as reservoir or
spillover hosts of M bovis organisms was kindled by the observation that in the
area of the lower peninsula where bovine TB is endemic, that the greatest number
of wildlife/cattle interactions with other species is with wild turkeys (Hill, 2005).
Anecdotal evidence suggests that wild turkeys are frequently observed on farms
in this area of Michigan, in their and in cattle feeders. The number of wild turkeys
in Michigan has recovered from near extinction of the species [in the US in the
early 1900’s] and can now support two hunting season per year in the spring and
fall (CNN Interactive, 1998). Turkey hunting brings millions of dollars to states’
Department of Natural Resources, public, and private organizations (McCullough,
2001).

The diet of wild turkeys varies according to season and habitat but they forage
mostly on the ground for seed, nuts, acorns, buds, berries and insects. In the fall

they form flocks with several males accompanying several females. Consequently

68

these birds could be exposed to grains and pasture contaminated by tuberculous
cattle as wild turkeys do occasionally ingest manure or pick undigested corn out
of manure. Given that such birds can fly and are able to cover more than a mile
when airborne they could potentially disseminate infectious material to adjoining
uninfected premises. Additionally, the interaction of hunters and other naturalists
with wild turkeys is indicative of potential zoonosis.

Such concern about wild turkeys disseminating M bovis is warranted as wild
turkeys have been found to be carriers of select avian pathogens and parasites in
environmental studies done in the United States. Peterson and associates (2002) found
that wild turkeys in the Edwards Plateau of Texas were seropositive for Mycoplasma
gallisepticum and M synoviae. Furthermore, some of theses birds tested positive for
reticuloendotheliosis virus by PCR. Hopkins and associates (1990) in a survey of wild
turkeys in Arkansas found that some birds were positive for Pasteurella multocida,
Bordatella avium and Newcastle disease virus. Avian species are known to be
susceptible to infection with Mycobacterium spp. organisms, and interspecies
transmission of mycobacteria in birds is well documented. Several species of birds
including those of the order Galliforrnes which embraces domestic chickens and
turkeys are known to be susceptible to infection with Mycobacterium avium. Wild
birds (Sparrows, starlings, pigeons) can Spread M avium to domestic poultry, pet
birds and captured exotic birds (Fulton and Thoen, 2003; Tell et al., 2001). Other
species of birds, particularly in the order Psittaciformes, are susceptible to infection
with M tuberculosis (Hoop, 2002; Tell etal., 2001; Washko et al, 1998; Hoefer et al.,

1996; Woerpel and Rosskopf, 1983; Thoen et al., 1977; Ackerman et al, 1974).

69

Recently, infection of pet birds with M genavense has been documented (Bercovier
and Vincent, 2001; vanDerHeyden, 1997; Hoop et al., 1996). However, much
remains unknown about the susceptibility of birds to infection with M bovis.
Additionally, birds are implicated as vectors in the transmission of zoonoses such as
West Nile, influenza type A, chlarnydiosis, and salmonellosis.

Given the presence of bovine tuberculosis in white-tailed deer in Michigan
which serve as a reservoir host it is important to determine the potential of other
wildlife species to serve as reservoir hosts as this could delay or hinder efforts to
eradicate this disease. Therefore there was a need to determine via experimental
infection if wild turkeys are indeed susceptible to bovine tuberculosis. The
objective of this pilot study was to ascertain whether wild turkeys are susceptible
to infection with M bovis via oral or intratracheal routes. Further, this study also
determined the feasibility of infected turkeys disseminating this organism in the
environment via fecal Shedding. The hypothesis for this study is that wild turkeys
can be infected with M bovis when exposed via oral and intratracheal routes.
Infected birds can then disseminate mycobacteria via their feces to the

environment.

Materials and Methods
Animals

Eighteen wild turkey poults (ten male; eight female) were obtained from
Murray McMurray Hatchery, Webster City IA. Twelve of the birds were

inoculated and the remaining six were sham inoculated controls. Inoculated and

70

control birds were housed in separate rooms. Inoculated birds were housed
individually in biosafety cabinets in a high efficiency particulate air (HEPA)-
filtered room (biolevel-3 conditions) at the Michigan State University

Containment Facility.

Inocula

Inocula used were prepared by the tuberculosis laboratory, Michigan Department
of Community Health (MDCH). The M bovis isolate was from a positive WTD
identified by annual surveillance and was confirmed as the strain typical to all cases
by restriction fragment length polymorphism (RF LP). Seven-day growth in
Middlebrook 7H9 broth was adjusted to 0.5 McFarland turbidity standard, diluted to
12100 with sterile water and tested by plate counts to determine the colony-forming
units (CF U) per unit of volume. The dose was confirmed again at the time of
inoculation. A Single 1 ml dose containing approximately 1 x 105 CFU/ml was
administered orally via a tomcat catheter. Intratracheal (IT) inoculates had a 0.5 m1

dose injected into the trachea via a 1- cc tuberculin syringe.

Study design

All experimental procedures were approved by the All-University Committee on
Animal Use and Care at MSU. Seven-day old turkey poults were randomly separated
into six oral inoculates, six IT inoculates and three sham inoculates for each route and
dose. Fecal samples were collected from each bird on the day prior to inoculation and

on day 1 post inoculation (PI). Fecal samples were obtained from surviving birds on

71

days 30 and 60 P1. All fecal samples were submitted to the tuberculosis laboratory,
MDCH, for mycobacterial isolation and identification. Birds were fed Purina® turkey
grower W/O (Purina Mills Inc., St Louis, MO, see appendix V) and water ad libitum.
Birds were evaluated daily for food and water consumption and general physical
condition. Each bird was weighed on the day of inoculation and every two weeks
thereafter. Two birds from each inoculation group and one control bird from the
corresponding sham inoculates were sacrificed on days 30, 60 and 90 PI. Turkeys
were euthanized by intracardiac injection of sodium pentobarbital solution (Fatal
Plus®, Vortech Pharmaceuticals, Dearbom, MI). At necropsy the total body weight in
grams (g) as well as the weight of the liver, lung and spleen was recorded for each
bird. Tissues collected at necropsy were preserved in 10% neutral buffered formalin
(NBF) and included brain, lung, trachea, heart, liver, kidney, Spleen, gonad, adrenal
gland, proventricular-ventricular junction, pancreas, small intestine (SI) and cecal
tonsil. Tissues were routinely processed and sectioned (5 pm) for staining with
hematoxylin and eosin (H and E). All tissues were also stained with Ziehl-Neelsen
(acid fast).

Tissues for mycobacterial culture were collected using sterile instruments and
were grouped into three pools; pool A: lung and trachea, pool B: liver, kidney and

spleen, pool C: small intestine and cecum.
Mycobacterial isolation and identification (refer to index IV)

Mycobacterial cultures were performed at the Tuberculosis Laboratory,

MDCH. Briefly the tissue Specimens were homogenized digested and

72

concentrated (Kent and Kubica, 1985). Fecal samples did not require
homogenization and were cultured after digestion and concentration. One each of
a Lowenstein-Jensen medium slant (Becton—Dickinson, Cockeysville, MD),
Middlebrook 7H1 18 medium Slant (Becton-Dickinson) and a BACTEC 12B broth
vial (Becton-Dickinson, Sparks, MD) was inoculated with the resulting
concentrated material. Media were examined weekly for mycobacterial growth up
to 8 weeks. Cultures determined to consist of acid fast organisms by slide
examination (Kent and Kubica, 1985) were tested by nucleic acid probe
(Accuprobe®, Gen-Probe® San Diego, CA) to ascertain if they were members of
the M tuberculosis complex (Reisner et al., 1994). Biochemical testing and high-
perfonnance liquid chromatography was performed for complete Speciation of
mycobacteria that is to differentiate M bovis from other members of the M

tuberculosis complex (Reisner et al., 1994; Butler, 1991; Kent and Kubica, 1985).

Statistical analysis

SAS version 9.1.3 statistical software was used for all calculations (SAS
Institute, Inc., Cary, NC). The Wilcoxon rank-sum test was used to ascertain
statistical significance (P < 0.05) of changes in total body weight and organ
weights within treatment groups and between groups. The association between
routes of exposure and outcomes of interest (gross lesions, microscopic lesions
and mycobacterial culture) were compared with the two-tailed Fischer’s exact

test.

73

Results
Weight change data

There was no Significant change in the total body weight in any of the turkeys
from the three treatment groups for the duration of the study (P> 0.05).
Additionally, none of the birds exhibited any adverse clinical signs or symptoms

of inappetence.

Gross lesions
There were no gross lesions suggestive of mycobacteriosis detected in any

bird from the three treatment groups on postmortem evaluation.

Microscopic lesions

In all of the turkeys there were no microscopic lesions consistent with or
suggestive of mycobacteriosis detected in any of the tissues evaluated. Acid fast
stained sections were negative. Non-tuberculosis associated lesions detected in
wild turkeys included a single foreign body granuloma at the proventricular-
ventricular junction in an oral inoculate at day 60 PI and focal superficial mucosal
ulceration within the proventriculus in an oral inoculate at 90 days PI.
Nonspecific findings detected in some birds were prominent lymphoid aggregates
surrounding secondary bronchi in the lung and randomly disseminated in the
parenchyma of liver, kidney, adrenal gland and testis in male birds (total number

of turkeys affected; oral 6, IT 6, controls 5).

74

Mycobacterial isolation/identification

Visceral tissues in pool B (liver, lung and Spleen) in two IT inoculated turkeys
were positive for M bovis on day 30 PI. Tissues from oral inoculates and control
birds were consistently negative for M bovis. Tissues in pool C (small intestine
and cecum) in two turkeys, one IT inoculate and the other oral were positive for
M avium on day 60 PI. A Mycobacterium spp. organism other than M TB
complex or M avium complex was cultured from pool C of an oral inoculate on
day 90 PI. Fecal samples in all birds were consistently negative for M bovis prior

to inoculation and on days 1, 30 and 60 post-inoculation

Statistical Analysis

Changes in total body weight (Wilcoxon rank-sum x2= 2.63; P = 0.2316) and
organ weights (Wilcoxon rank-sum )8 liver =0.8889, P =0.64l2; lung = 0.1520, P
= 0.9268; Spleen = 0.5395, P = 0.7636) in turkeys in the three treatment groups
were not statistically significant. As there were no gross or histologic lesions
consistent with tuberculosis detected in any of the turkeys this nullified the
necessity for statistical analysis. Similarly, statistical tests were not required for

the consistently negative fecal cultures.
Discussion and conclusion

Results of this study indicate that wild turkeys of the order Galliforrnes are

highly resistant to infection with M bovis. This organism was only cultured from

75

the visceral pool of tissues in two birds 30 days PI that were inoculated
intratracheally. However, there were no gross or microscopic lesions detected in
these two birds to suggest that this was indeed an active infection (Table 2: l). The
only conclusion that can be derived from this occurrence is that such birds were
able to disseminate the organism from the site of inoculation but remained
physiologically nonresponsive to the presence of M bovis organisms.

Further support for turkeys being resistant to M bovis is that they were
inoculated at 7 days of age when their immune system Should be still immature
but in spite of this they were still resistant. In a similar challenge study in
chickens with M avium birds as young as eight weeks of age were highly
susceptible to mycobacterial infection (Tell et al., 2001).

The wild turkeys in this study were not observed to shed M bovis in their
feces on any of the days selected for sampling post-inoculation. Again this
supports their high resistance to bovine tuberculosis as fecal shedding is the
principal way in which M avium is spread from infected to susceptible birds (Tell
et al., 2001).

Exposure of WTD to feed material contaminated with M bovis is a proven
means of transmission of bovine tuberculosis in this Species (Palmer et al., 2004b;
Palmer et al., 2001). Results of environmental contamination in cattle-to-cattle
spread and cattle to other species is more equivocal (Phillips et al. 2003).

Additionally, the results of this study in conjunction with the previous
inoculation studies done in pigeons, crows and starlings suggests that avian

species are variably susceptible to Mycobacterium spp. organisms. Pigeons are

76

reportedly highly resistant to M avium but are, however, moderately susceptible
to M bovis (Fitzgerald et al., 2003b). The reverse of this is true in wild turkeys
which are highly resistant to M bovis but moderately susceptible to M avium
(Tell et al., 2001). To summarize results in the series of experimental studies on
susceptibility to infection with M bovis in avian species known to frequent the
area of endemic bovine tuberculosis in Michigan pigeons are susceptible, starlings
and crows are partially susceptible, and wild turkeys and mallard ducks are highly
resistant (Fitzgerald et al., 2005; Fitzgerald etal., 2003 b; Butler et al., 2001).
Hence, the results of this study and previous studies would suggest that it is
imprudent to extrapolate the effects of infection with a particular Mycobacterium
spp. organism across various avian species. Moreover, further research may be
required on the physiology of avian species susceptible to infection with
Mycobacterium spp. organisms as well as on their immunological response to
such infection.

In conclusion, the results of this study in which M bovis was experimentally
inoculated in wild turkeys via oral and intratracheal routes demonstrate that such
birds are resistant to infection with this organism. They were no gross or
microscopic lesions consistent with mycobacteriosis detected in any inoculated
turkey for the duration of the study. Consistently negative PI fecal cultures also
indicate that these birds are unlikely to contribute to the retention or Spread of this

organism on infected farm premises.

77

 

Table 2:1 Summary of research findings in wild turkeys (Meleagris gallopavo)

inoculated with M bovis

* - Number of birds expressing this feature/ total number of birds tested
I- Histologic lesions

1- Intratracheal

§- Includes two IT inoculates positive for M bovis on day 30 post-
inoculation (liver, kidney and spleen)

" - An IT inoculate positive for M avium 60 days post-inoculation in
the intestine

I - Includes an oral inoculate positive for M avium in the intestine on
day 60 post-inoculation and another oral inoculate positive for
Mycobacterium spp. other than M tuberculosis complex or M avium

complex in the intestine on day 90 post-inoculation

78

 

 

So So So So So 0 3.980

 

So ER So 05 c5 w ~80

So I. 9 ~ mQN So So 0 TE
MES we :02 SSE .2

.Room .onmmfl. .oammc. r828..— .mcofioq mace—c3 «o 380

DEE—DO Htofienoomg oi: $80 SEE: Z Banana...

 

flag .2 .53 68252: ASSESS.» fiauefiegv mace-.5. 1:3 3 mag—Em 5.580.. E CREE—Em flN 93.;

79

CHAPTER THREE

Mycobacterium bovis Experimental Inoculation in Three Wild Rodent Species:
Meadow Voles (Microtus pennsylvanicus), House Mice (Mus musculus) and

Norway Rats (Rattus norvegicus)

Abstract

Mycobacterium bovis has a wide host range and is known to infect several wildlife
host species, which effectively limits attempts to eradicate bovine tuberculosis from
livestock. Therefore the purpose of this current study was to determine if several rodent
species, namely meadow voles (Microtus pennsylvanicus), house mice (Mus musculus)
and Norway rats (Rattus norvegicus) which are known to frequent the area of the lower
peninsula of the state of Michigan where bovine tuberculosis is endemic, can be
experimentally infected with M bovis. The objectives of the study were to 1) determine
if these rodents can be infected, and if so, to document attendant pathological
processes/pathogenesis; 2) detect any fecal shedding of M bovis; 3) evaluate the
relative susceptibility of the three species and 4) determine if genotype is a factor in
susceptibility in house mice. Thirty-six animals of each species were used and studies
were run for 60 days. In each study there were three treatment groups with 12 animals
per group. The voles received high dose inocula via oral and intranasal routes where as
the mice and rats were given high dose and low dose oral inocula. Meadow voles were
the most susceptible to M bovis infection. In intranasal inoculates all 12 voles were

affected (gross and microscopic lesions, positive tissue and fecal mycobacterial

80

cultures). Seven of the oral inoculates were similarly affected. House mice were also
susceptible to infection (14/24 animal were culture positive). Thus, although house
mice were of a resistant phenotype for the Bcg gene, this alone did not protect them
from infection. Rats were essentially resistant as there was a single positive culture in a
high dose inoculate animal with minimal attendant lesions detected in this animal and
no lesions or positive mycobacterial cultures in the other 23 inoculated rats. Results of
this study indicate that meadow voles and house mice can be infected with M bovis and
can potentially serve as spillover hosts. Concerted efforts should, therefore, be made to
reduce or eliminate these rodents on premises where domestic livestock with bovine

tuberculosis are found.

Introduction

Mycobacterium bovis is able to infect a wide range of species including humans
(O’Reilly and Daborn, 1995; Grange and Yates, 1994). Thus much interest is generated
in cross-species infection and reservoir hosts. Reservoir hosts identified include badgers
in Great Britain, brush-tail possum and ferrets in New Zealand and white tail deer
(WTD) in Michigan, USA (deLisle et al., 2002; deLisle et al., 2001; Morris et al.,
1994)

Subsequent to the discovery in 1994 of WTD in Michigan serving a reservoir host
for M bovis, surveillance has been ongoing to identify any other species that may act as
reservoir hosts. Several carnivore and omnivore species such as coyotes, raccoons,

bobcats, opossums and red foxes were identified as spill-over hosts but to date WTD

81

are the only known reservoir host in this outbreak (Bruning—Fann et al., 2001; Schmitt
et al, 1997)

A continuing obstacle in the control or eradication of M bovis from infected
premises is the presence of these wildlife reservoirs. If infection is uncontrolled in these
species, then domestic livestock and indeed humans are at constant risk for infection or
reinfection (Bengis et al., 2002; Wedlock et al., 2002; Cousins, 2001; Nelson, 1999;
O’Reilly and Daborn, 1995).

Prior to this study, research on tuberculosis in mice and rats has primarily been
limited to laboratory/albino strains. These laboratory Strains are derived from house
mice and Norway rats respectively (National Wildlife Federation, enature). VoleS,
house mice and brown rats are all known to be prolific breeders. The diet of voles and
house mice consists of grasses, seed grain, bark and some insects. Norway rats are
omnivorous and feed on meat, insects, wild plants, seed and stored grains. In all
instances due to the close association of these rodents with man and livestock, they can
potentially be exposed to undigested grain in fecal material from tuberculous cattle.
Rats can potentially feed on a tuberculous carcass and contaminated eviscerated
material (gut piles). Consequently concern is expressed about such species potentially
disseminating mycobacteria on farm premises. Such concern is warranted as mice and
rats are known to spread diseases such as typhus, Spotted fever, tularemia, bubonic
plague, Hantavirus, Lyme disease, toxoplasmosis and leptospirosis. Voles can also be
infected with Francisella tularensis, the causative agent of tularemia (Sainsbury, 2003;
Wallach and Boever, 198 3). Furthermore these rodent species are themselves preyed

upon by birds, carnivore and omnivore species such as owls, hawks, dogs, house cats,

82

skunks, weasels, foxes and coyotes and could also potentially spread M bovis to these
predators. Infection in these species is also of concern as they have the potential of
infecting humans and initiating a public health crisis.

In inbred laboratory strains of mice it has been suggested that the Bcg gene (also
known as Nrampl and Sci] 1 a1), located on chromosome one, may have some
function in protecting animals with the homozygous/dominant phenotype (Bcg’)
from infection with intracellular organisms namely Mycobacterium Spp.,

Salmonella typhimurium and Leishmania donovani. Conversely, mice with the
heterozygous/recessive phenotype (Bcg’) are susceptible to intracellular pathogens
(Skamene et al., 1998). Nucleotide sequencing has revealed that a single nucleotide
change substituting A for G, yielding a change in amino acid sequence from
nonconservative glycine to aspartate at position 169 is predicted in mice with the
Bcg” phenotype (N akanaga et a1 1999, Govoni et a1 1996, Vidal et al, 1995,
Sakmene 1994). Yet, there are no published studies on the effect of the Bog gene in
infections with the aforementioned pathogens in the wild type house mouse from
which today’s laboratory strain were derived.

As a continuation of experimental inoculation studies in various species [North
American opossums, crows, starlings, pigeons, mallard ducks] (Fitzgerald et al., 2005;
Fitzgerald et a1, 2003 a; Fitzgerald et al., 2003 b; Diegel et al, 2002; Butler et al., 2001)
known to frequent farms in the northeastern section of the lower peninsula of Michigan
which is the nidus of the current M bovis outbreak in this state, it was realized that little
was known about the pathology and pathogenesis of bovine tuberculosis in the three

most common rodent species which are often recognized infesting such premises. If

83

such species can be infected, and if infection is uncontrolled in these species, then they
could potentially place domestic livestock at constant risk. To date there are no reported
studies of M bovis infection and attendant risk factors in the three wild rodent species
evaluated in this current study meadow voles (Microtus pennsylvanicus), house mice
(Mus musculus) and brown rats (Rattus norvegicus).

The stated hypotheses of this study were 1) free living wild rodent Species
indigenous to Michigan can be infected with M bovis and serve as reservoir or
spillover hosts. Dissemination of mycobacteria from these rodents to the environment
places livestock at risk, and 2) in house mice the Bcg’ resistance phenotype protects
these animals against infection with M bovis.

The objectives of this study were to determine i) if the rodents studied can become
infected with M bovis when experimentally inoculated and further if they can
disseminate mycobacteria into the environment via fecal shedding following
inoculation, ii) the relative susceptibility to infection with M bovis in the three species,
iii)specifically in the house mouse, what role if any does genotype play in
susceptibility, and iv) documentation of any variation in the pathology of M bovis
infection in the three rodent species (gross and microscopic lesions, variations in total

body weight and organ weights, mortality, dissemination and maintenance of infection).

Materials and Methods
Inocula
Inocula used were prepared by the tuberculosis laboratory, Michigan Department of

Community Health (MDCH). The M bovis isolate is from a positive WTD identified

84

by annual surveillance and Was confirmed as the strain typical to all cases by restriction
fragment length polymorphism (RF LP). Seven-day growth in Middlebrook 7H9 broth
was adjusted to 0.5 McFarland turbidity standard, diluted to 1:100 with sterile water
and tested by plate counts to determine the colony-forming units (CFU) per unit of
volume. The dose was confirmed again at the time of inoculation. Voles and house
mice were anesthetized prior to inoculation with isoflurane (IsoFlo®, Abbott Animal
Health, North Chicago, IL) administered in an inhalation chamber attached to a gas
anesthesia machine with a precision vaporizer. Animals were dosed orally via a tomcat

catheter gavage. Voles were inoculated intranasally in each nostril via a micropipette.

Study design

Each animal was weighed prior to inoculation (day 0) and at weekly intervals there
after. They were evaluated daily for Signs of respiratory distress, weight loss or other
signs of ill health (bristled hair, hunched posture, reluctance to move). Animals were
euthanized with an overdose of isoflurane (IsoFlo®, Abbott Animal Health, North
Chicago, IL) to minimize any suffering. All experimental procedures were approved by

the All-University Committee on Animal Use and Care at MSU.

Meadow voles

Thirty-Six meadow voles (19 male; 17 female) were sourced from the MSU
meadow vole colony in Giltner Hall. All animals tested negative for five specific
pathogens prior to inoculation (listed in appendix 1). To assess fecal shedding, fecal

samples for mycobacterial culture and isolation were obtained from each vole on the

85

day prior to oral inoculation, day 1 post inoculation (PI), and from surviving animals on
day 30 PI. The voles were randomly assigned to one of four groups: 12 received 5 x 103
CFU of M bovis orally in a total volume of 0.5 ml, 6 oral sham inoculates were given a
similar volume of sterile water, 12 were given 1 x 105 CF U intranasally, a total volume
of 20u1 in each nostril, and 6 IN were sham inoculates were given a similar volume of
sterile water. The voles were housed in a secure BSL-3 facility in rodent cages placed
in Horsfal units. Rodent chow (Teklad 22/5 rodent diet (W) 8640, Harlan Teklad, Troy
IL, see appendix VI) and water were supplied ad libitum. Voles were sacrificed at 30
and 60 days post inoculation (PI) or earlier if they exhibited marked weight loss or
signs of illness.

Each animal was weighed prior to inoculation (day 0) and at weekly intervals
thereafter. At necropsy, total body weight (TBW) in grams (g) was obtained for each
animal. The weight of the lung, liver and spleen was also recorded. Tissues harvested at
necropsy were preserved in 10% neutral buffered formalin (NBF) and included brain,
nasal turbinates, trachea, lung, heart, liver, kidney, spleen, gonad, adrenal gland, small
intestine (SI), large intestine (LI), cranial, thoracic and abdominal lymph nodes. Tissues
were routinely processed and sectioned (5 pm) for staining with hematoxylin and eosin
(H and E). All tissues were also stained with Ziehl-Neelsen (acid fast).

Tissues for mycobacterial culture were collected using sterile instruments and were
grouped into three pools: pool A (lung, tracheobronchial lymph nodes and cranial
lyniph nodes); pool B (liver, kidney, spleen); and pool C (SI, LI and mesenteric lymph

nodes).

86

House mice

Thirty-six house mice (18 male; 18 female) were sourced from The Geriatrics
Center, University of Michigan, Ann Arbor. All mice tested negative for the 14 specific
murine pathogens listed in appendix II. Fecal samples were procured from each mouse
as described for the voles on day 0 and day 1 PI, and from surviving animals on days 20
and 40 PI. The mice were randomly assigned to one of three groups: 12 received a high
dose of M bovis (1x 104 CF U), 12 received a lower dose (1x 102 CFU) and 12 were
sham inoculated controls. Each mouse received 0.25ml total volume orally. The mice
were housed and fed in a manner identical to the voles. Mice were sacrificed at 20, 40
and 60 days P1 or earlier if they exhibited marked weight loss or Signs of illness.

The necropsy protocol for the mice was identical to that previously described for
the voles however nasal turbinates were not included in the tissues harvested.
Histopathologic processing and staining in addition to the tissues harvested and pooled

for mycobacterial culture were identical to that in the voles.

Norway rats
Thirty-six male brown Norway rats were obtained from Charles River Laboratories,
Portage, MI. All rats tested negative for the Specific pathogens listed in appendix III.
Fecal shedding was assessed in each rat as previously described for house mice. The
rats were randomly assigned to one of three groups: 12 received a high dose of M bovis

(5 x 103 CFU), 12 low dose (1 x 102 CFU) and 12 were sham inoculated controls. The

87

rats were housed and fed in a manner identical to the voles. Rats were sacrificed at 20,
40 and 60 days PI.
The necropsy protocol, histopathologic processing and staining as well as

mycobacterial culture were identical to that in the mice.

Mycobacterial isolation and identification (refer to index IV)

Mycobacterial cultures were performed at the Tuberculosis Laboratory, MDCH.
Briefly the tissue Specimens were homogenized digested and concentrated (Kent
and Kubica, 1985). Fecal samples did not require homogenization and were
cultured after digestion and concentration. One each of a Lowenstein-Jensen
medium slant (Becton-Dickinson, Cockeysville, MD), Middlebrook 7H1 IS medium
slant (Becton-Dickinson) and a BACTEC 12B broth vial (Becton-Dickinson,
Sparks, MD) was inoculated with the resulting concentrated material. Media were
examined weekly for mycobacterial growth up to 8 weeks. Cultures determined to
consist of acid fast organisms by Slide examination (Kent and Kubica, 1985) were
tested by nucleic acid probe (Accuprobe®, Gen-Probe® San Diego, CA) to ascertain
if they were members of the M tuberculosis complex (Reisner et al., 1994).
Biochemical testing and high-performance liquid chromatography was performed
for complete Speciation of mycobacteria that is to differentiate M bovis from other
members of the M tuberculosis complex (Reisner et al., 1994; Butler, 1991; Kent

and Kubica, 1985).

88

Bcg gene protocol in house mice
DNA extraction

Briefly, approximately 100mg of fresh frozen liver from each mouse was
homogenized in lmL of TRIzol® reagent (GIBCO BRL®, Grand Island, NY, USA) and
then incubated at room temperature for 5 minutes. Next 0.2mL of chloroform per 1 mL
of trizol was added, tubes capped and shaken vigorously by hand for 15 seconds.
Samples were then incubated at room temperature for an additional 2 to 3 minutes. The
solutions were centrifuged at 12, 000 x g for 15 minutes at 4° C. The upper aqueous
phase containing RNA was removed and discarded. Next 0.3mL of 95% ethanol was
added per lmL of TRIzol and samples mixed by inversion. Samples were again stored
at room temperature for 2 to 3 minutes and then the DNA sediment was pelleted by
centrifugation at 2000 x g for 5 minutes at 4° C. The phenol-ethanol supernatant was
carefully removed. The DNA pellet was washed twice in a solution containing 0.1 M
sodium citrate in 10% ethanol. At each wash the DNA pellet was stored in the washing
solution for 30 minutes at room temperature, with periodic mixing, and then
centrifuged at 2,000 x g for 5 minutes at 4° C. Following the two washes the DNA
pellet was suspended in 75% ethanol, stored for 10-20 minutes at room temperature
with periodic mixing and centrifuged at 2,000 x g for 5 minutes at 4° C. The
supernatant was removed and the DNA pellet was air dried for 5-15 minutes. The DNA
was dissolved in lOOul of 8mM NaOH and 1/10 volume of 10x TE buffer added. The
mixture was centrifuged at 12,000 x g for 10 minutes to remove insoluble material. The
purified DNA in the supernatant was transferred to a micocentrifuge tube and stored at

4°Cor-20°C

89

Amplification, sequencing and detection procedures

The variant codon 169 lies near the 5 prime end of exon 6 of the mouse NRAMP
gene. To facilitate amplification of this region from genomic DNA, we placed
amplification primers in the introns flanking exon 6. The mouse mRNA (L13732) was
aligned to the mouse genome using the Genome Browser (available through University
of California, Santa Cruz) and the intronic regions identified.

The figure below shows the sequence amplified: Primer targets are in bold,

intronic sequences are in lower case and exonic sequences are in uppercase

caagctat ttgggttcct gac tccccag atctgggtca ggctgattga
tctgccctac ttggtttcag TATCCCGCTG TGGGaCGGTG TACTGATCAC CATTGTGGAC
ACCTTCTTCT TCCTCTTCTT GGATAACTAT sgtgagagaa agcccctcat cttgggggat
aaaagtaggc

agggctgccc ttggggagcc ttggcttctc ctagggctgt gggtcccccc

ccatccagct atatggtgtg a gcaacttac tcctgtttcc gtt

cgttgaatc aggacaaagg can

PCR with a final volume of 25 [.11 was set up using 10 pM primers, 0.635 U DNA
polymerase (Gibco BRL, Gaithsersburg, MD) and final concentrations of 100uM
nucleotides, 1.5 mM MgClz , SOmM Tris CL (pH 8.3) and 10 mM KCl. A 1.5 ul DNA
test sample was added to a 23.5 pl volume of master mix.

Amplification conditions were as follows: 94 ° C for 4 minutes, 94 ° C for 1
minute, 67 ° C for 1.5 minutes and 72 ° C for 2 minutes repeated 40 times with a final
10 minute extension at 72° C (MJ Research PTC-100 Peltier Thermal Cycler,
Watertown MA, USA). The amplification products were separated on 2% agarose gels

in TBE buffer (90 mm Tris-borate, 2mm EDTA). A 6 ul aliquot of the PCR product

90

was restricted with Aci I overnight at 37° C The samples were then separated on 2%
agarose gels in TBE buffer. The amplification product from the dominant allele
produces a 200 base pair (bp) restricted fragment whereas the amplification product
from the resistant allele produces a 271 bp fragment. The bands were excised and
purified using the QIAEX II kit (Qiuagen, Valencia, CA) following the manufactures
directions with each sample resuspended in a final volume of 30 pl of IOmM Tris, pH
8. Manual sequencing was performed using the Thermosequence Sequenase
radioloabeled terminator cycle sequencing kit (U SB Corporation, Cleveland, OH).
Samples were sequenced using the forward primer (5’-CAA GCT ATT TGG GT'I‘ CCT
GAC) used in PCR amplification. Sequencing followed the manufactuer’s standard
protocol for dGTP termination. The reaction products were separated on 6% denaturing

polyacrylarnide gels and visualized by exposure to x-ray film.

Statistical analysis

SAS version 9.1.3 statistical software was used for all calculations (SAS
Institute, Inc., Cary, NC). The Wilcoxon rank-sum test was used to ascertain
statistical significance (P< 0.05) of changes in total body weight and organ weights
within treatment groups and between groups. The association between routes of
exposure and outcomes of interest (gross lesions, nricroscopic lesions and
mycobacterial culture) were compared with the two-tailed Fischer’s exact test. The
significance of differences between survival times of the rodents with variables of
species and treatment was computed with the non-parametric Kaplan-Meier

estimate of the survivor function.

91

Results
Animal Health

Ten of the voles exhibited respiratory distress arising from tuberculosis and either
died ‘naturally’ or were euthanized prematurely. This included a total of six oral
inoculates and four IN inoculates. Deaths in voles occurred earlier in those that
received an oral inoculum (between days 12 and 21 PI) when compared to the IN
inoculates (death in three of the four occurred after day 45 PI) (Figures 3:1a and b).
Four of the mice in the HD group died prematurely as a result of tuberculosis. Deaths in
these mice occurred between days 28 and 35 PI (Figures 321a and b). All of the rats

remained clinically healthy throughout the study.

Weight change data

Although the voles were severely clinically affected with tuberculosis (lack of
appetite, marked decrease in activity/moribund, respiratory distress/ abdominal
breathing) they did not exhibit statistically significant total body weight loss (Wilcoxon
rank-sum x2 = 5.1481; P = 0.0795). The increase in the weight of lungs in voles affected
with bovine tuberculosis (intranasal and oral inoculates) when compared to the weight
of the lungs in control animals was statistically significant (Wilcoxon rank-sum )8 =
11.8528; P = 0.0027). However, there was no difference in the weights of the liver and
spleen between inoculated and sham inoculated control voles. Four of the HD mice lost
weight (ranged from 1.7g to 5.4g lost) during the first 30 days of the study (two of

which were euthanized and two died from TB) but after this time period the mice were

92

able to regain and maintain their body weight. Mice also had no statistically significant
body weight loss over the duration of the study (Wilcoxon rank-sum x2 = 0.3865; P =
0.8243). As in the voles the increase in the weight of the lungs in inoculated mice (HD
and LD) when compared with control mice was statistically significant (Wilcoxon rank-
sum x2 = 9.4977; P = 0.0087). Inoculation in the Norway rats (HD and LD) caused
these animals to have a lower mean total body weight when compared to the sham
inoculated controls (Wilcoxon rank-sum x‘ = 22.3844; P = <0.0001). There was no

observable differences in any of the organ weights between inoculated and control rats.

Gross lesions

Gross lesions suggestive of tuberculosis were detected in 19 of the 24
inoculated voles and included; pneumonia (severe, focally extensive to diffuse, firm
and consolidated), hepatitis and hepatomegaly, splenitis and splenomegaly and
lymphadenopathy (submandibular. parotid, cervical, traceobronchial, and
mesenteric lymph nodes affected) (Table 3:1 and Figures 3:2 and 3:3). NonTB
associated lesions were detected in two voles; severe cecal dilation and an ovarian
mass in one vole and a severe urogenital infection in another (cystitis with enteritis
in the adjoining intestine, both transmural). In addition two of the voles had
cutaneous mites.

Twelve of the 24 inoculated mice exhibited gross lesions suggestive of
tuberculosis. Gross lesions of caeogranulomatous multifocal to diffuse and
coalescing pneumonia which ranged in severity from mild to severe was present in

eight of the mice (all HD days 20 and 40 PI) (Table 3:2 and Figure 3:4). One

93

mouse in the LD group (day 40 PI) had congested lungs which were mottled red
and tan. Enlarged lymph nodes were detected in four mice (superficial cervical,
tracheobronchial, mesenteric, inguinal, lumbar) (one HD day 20 PI; two HD day
40PI and one LD day 60PI). Splenomegaly was present in two mice day 60 PI (one
HD; one LD). A nonTb associated lesion was present in one mouse a 4mm diameter
focal pulmonary mass (HD day 20Pl).

There were no gross lesions suggestive of M bovis infection in any of the rats

on postmortem evaluation.

Microscopic lesions
Histologic lesions in the voles were the most extensive and severe of the three

rodent species (Table 3:3 and Figure 3:5). In each of the affected organs lesions
were moderate to severe, multifocal to coalescing, caseogranulomatous and
granulomatous to pyogranulomatous. Numbers of acid fast bacilli ranged from
abundant to rare (Figures 3:6 and 3:7). Of note in the microscopic lesions seen in
the voles was partial mineralization which was often evident in areas of
caseogranulomatous lymphadenitis (Figure 3:8). One IN inoculate (day 30 PI) had
multinucleate giant cells in the liver (Figure 3:9). Moderate to severe
granulomatous and necrotizing rhinitis was a prominent feature in the IN inoculates
(11 of 12) and in a single oral inoculate (Figure 3: 10). Non Tb associated lesions
detected in meadow voles on microscopic evaluation included colonic nemotodiasis

in five animals, an ovarian teratoma in one vole (#26/ IN), cystitis (transmural

94

chronic fibrosing, pyogranulomatous and necrotizing with intralesional bacteria)
and adjacent transmural enteritis in one vole (# 31).

In house mice histologic lesions consistent with tuberculosis were present most
frequently in the lungs and were seen in 11 mice; seven HD and four LD (Table 3:4
and Figure 3: 11). Acute to subacute lesions were seen in mice sacrificed on days
20 and 40 PI and presented as severe coagulative necrosis (sequestrum) with
moderate to massive numbers of acid fast bacilli (+ macrophages on day 40 PI).
Chronic granulomatous pneumonia with infiltrates of macrophages, epitheliod cells
and rare multinucleated giant cells were evident in mice sacrificed at day 60 PI.
Acid fast bacilli were present in macrophages in small numbers or were rare. Other
organs affected were lymph nodes (three tracheobrochial and one mesenteric)
(Figure 3:12) and spleen in four mice, and liver in one animal. In each of these
tissues acid fast bacilli were present in macrophages, but tissue architecture was
otherwise unaffected. The only nonTb lesion detected microscopically was a focal
pulmonary bronchiogenic adenocarcinoma in one mouse day 20 P1.

In a single Norway rat (HD 20 days PI) there was focal aggregation of small
numbers of multinucleate giant cells which contained a few acid fast bacilli within a
tracheobronchial lymph node (Figure 3: l 3). In another rat, LD day 60 P1, in
sections of cerebrum a Single blood vessel (vein) contained a few acid fast bacilli.
NonTB associated lesions seen in the Norway rat included a meningeal granular
cell tumor (control rat day 40 PI) and a focal sperm granuloma in the testis in

another rat (day 40 PI).

95

Mycobacterial isolation and identification

In the voles all fecal cultures were negative prior to inoculation and the sham
inoculated controls remained negative on days 1 and 30 PI. Eight of the 12 IN
voles and 9 of 12 oral inoculates had positive fecal cultures on day 1 PI. Two of the
five surviving IN inoculates had positive fecal cultures on day 30 PI whereas the
five surviving oral inoculates all had negative fecal cultures when sampled 30 days
P1. All fecal cultures taken prior to inoculation and on days one, 20 and 40 PI for
the house mice and rats were consistently negative.

Positive tissue cultures were obtained in all 12 of the IN inoculated voles and in
seven of the oral inoculates. Tissues from sham inoculated voles were all negative
on culture. Fourteen of the 24 inoculated mice had positive tissue cultures, nine HD
and five LD. All tissues from sham inoculated mice were negative. A single HD rat
had a positive culture for tissues in pool A on day 20 PI. Tissues in pool B and C

were negative. All other rats were consistently negative for all tissue sampled.

Mouse Bcg study

All of the house mice were of the resistant phenotype and therefore the
amplified nucleotide sequence was cut with Aci I to give 200 and 71 bp segments
(Figure 3:14). Sequencing revealed a guanine nucleotide at position 596 (Bcg’) as
opposed to adenine which is seen in mice with the susceptible phenotype and this
translates to a glycine residue (G) at amino acid position 169 in the Nramp

molecule (Figure 3:15).

96

Statistical analysis

There was a statistically significant difference seen between animals of the three
different species that were positive for M bovis on mycobacterial culture (Fisher’s
exact test, P = 2.927 x 10'“). Thus being a vole or mouse was consistent with being
highly susceptible to developing bovine tuberculosis. Additionally susceptibility to
infection with M bovis is true with both routes of inoculation in meadow voles
(Fisher’s exact test, P = 2.123 x 10'”).

In voles there was a significant difference between the gross lesions in
intranasal versus orally inoculated animals (Fisher’s exact test, P =0.0046). A
similar association was obtained for histologic lesions in voles (Fisher’s exact test,
P =0.0046).

With the mice there was a significant difference between the gross lesions in
high dose and low dose animals (Fisher’s exact test, P =0.0391). However, with
microscopic lesions HD inoculation in mice did not indicate greater probability of

having lesions when compared to low dose animals (Fisher’s exact test, P =0.2203).

Discussion and Conclusion

The results of this study indicate that meadow voles are very susceptible to
infection with M bovis via oral and intranasal routes and house mice are also
susceptible to infection via the oral route. Conversely, Norway rats appear to be very
resistant to experimental infection with high doses of M bovis when given via the oral
route. Respiratory/ inhalation and oral routes of experimental infection were chosen as

they represent the routes of infection known to occur in established wildlife reservoirs

97

(brush tail possums, badgers, and whitetail deer) and the several spillover hosts of M
bovis (de Lisle et a1, 2001; O’Reilly and Daborn, 1995). The doses selected were
chosen to be of sufficient magnitude to accelerate any expected pathological responses
in these species. Additionally similar doses have been used in other inoculation animal
studies both within this laboratory and by other researchers (Diegel et al., 2002; Buddle
et al., 1994; Corner and Presidente, 1981; Comer and Presidente, 1980).

Evidence in support of meadow voles being the most susceptible to experimental
inoculation with M bovis of the three rodent species studied include deaths due to
tuberculosis in 10 of the 24 inoculated animals, extensive gross and histologic lesions
(19 animals) and positive mycobacterial cultures (19 animals). Sensitivity of voles to
M bovis seen in this study supports the work of Jespersen (1974, 1975, 1976, 1977" b
and c) in common (Microtus arvalis), field (Microtus agrestis) and bank (Clethrionomys
glareolus) voles as well as in the vole rat (Arvicola terrestris), all of which developed
lethal infections following experimental inoculation of M bovis. Similar results were
obtained earlier by Griffith (1939 and 1937) and Wells (193 8). Gross lesions of caseous
lymphadenitis in addition to granulomatous pneumonia, splenomegaly and hepatitis
similar to what obtained in this study were seen in these earlier studies.

Further, the results in this current study demonstrate that infected voles are capable
of disseminating M bovis via their feces as there were 19 positive fecal cultures out of
the 24 inoculated animals. Seventeen of these occurred on day one post-inoculation and
are likely indicative of passive transit through the gastrointestinal tract. The majority of
these (nine) were seen in voles that were inoculated orally. However, the eight positive

fecal cultures in intranasally inoculated voles suggest that the inoculum was coughed

98

up from the respiratory tract and subsequently swallowed in these animals. In addition,
two of the intranasal inoculates had positive fecal cultures at 30 days post-inoculation
which indicates both dissemination of M bovis and a state of infection in these animals.
Support for voles having the ability to disseminate Mycobacterium spp. organisms via
the feces is seen with the closely related M microti, or vole bacillus which like M
bovis is a member of the M tuberculosis complex. Mycobacterium microti can be
spread from vole to vole via the ingestion of the excreta from diseased voles (Rankin
and McDiarmid, 1968). Griffith (1939) also detected acid-fast bacilli microscopically
(acid-fast smears) in the feces of field voles experimentally inoculated with M microti.
However feces in this study were not cultured, so other acid fast mycobacteria/
organisms should be included in a differential.

The meadow voles were more susceptible to infection via the oral route in
comparison to the intranasal route as six of these animal died prematurely or were
euthanized in less than 21 days (Figure 3: 1a) compared to death of a Single
intranasal inoculate at day 19 with three others occurring within days 46 to 52
post-inoculation.

Positive fecal cultures in the meadow voles also indicate potential to serve as
a reservoir host. Although the high doses of M bovis used in this study resulted in
the demise of some animals the dose to which these animals would be exposed to
in the environment would be much lower. Thus the voles could become infected
either orally or via the IN route (both equally can lead to fecal shedding) and

survive long enough to further disseminate M bovis via fecal shedding.

99

The results of this study are the first to document the susceptibility of house mice to
infection with M bovis via the oral route. Contrary to Lefford (1984) who states that
adult mice cannot be infected by virulent tubercle bacilli via the gastrointestinal tract
results of this current study clearly demonstrate that adult house mice can in fact be
infected orally. Pierce and associates (1947) did, however, demonstrate that immature
house mice (four to six weeks old) were susceptible to oral infection with M
tuberculosis. Extensive gross and micoscopic lesions in affected mice as well as
positive mycobacterial cultures in the lungs, liver and spleen are indicative of
dissemination of M bovis from the site of inoculation, that is the gastrointestinal tract.
Both gross and microscopic lesions in mice following oral inoculation with M bovis
were most severe in the lung, which is similar to previously published studies in
laboratory strains of mice experimentally infected with M bovis (Gunn, Nungester and
Hougen, 1933-34, cited in Darzins 1958; Ratcliffe, 1953; Ratcliffe 1952, Glover, 1944;
Griffith 1907”). Similar to what has previously been reported in mice experimentally
infected with M tuberculosis, caseation or calcification of pulmonary granulomas was
not evident in the lungs of affected house mice in this study (Cosma et al., 2003). There
is however no report of mice naturally infected with M bovis following several
surveillance/ environmental studies (Pillali et al., 2000; Fischer etal., 2000; Wilesmith
et al., 1986; Little et al., 1982), which is possibly due to their exposure to lower M
bovis inoculation doses.

Greater severity of infection was evident in mice that received the higher dose
inoculum. A total of eight HD mice (67%) had gross and microscopic lesions consistent

with tuberculosis compared to four (33%) of the LD mice. The results in house mice

100

also suggest that those animals receiving the HD oral inoculum of M bovis suffered
adverse effects up to day 40 PI. By this time severe pulmonary disease had occurred in
seven of the eight animals in this group which were affected, all eight animals had
positive mycobacterial cultures and four deaths due to bovine tuberculosis occurred
between days 28 and 35 post-inoculation. However after day 40 it appears that the
immune system, likely cell-mediated immunity (CMI), is activated which allowed
surviving mice in this group to control or maybe even reverse their infection (based on
only one positive mycobacterial tissue culture in the four mice sampled).The converse
of this was seen in mice receiving the low dose oral inoculum as chronic pulmonary
disease was detected in these animals at day 60 post-inoculation (three of the four
animals in this group with positive mycobacterial tissue cultures). This suggests that the
initial LD inoculum received by these mice was not as effective in stimulating a CMI
response which therefore allowed M bovis organisms to persist in the pulmonary
tissues. Thus house mice might serve as an ideal animal model for tuberculosis in
humans infected with M tuberculosis and M bovis as there is evidence that some of
these mice were able to recover from their infection. However, this would require an in
depth study of their immune system.

Although fecal cultures in the house mice were consistently negative, in six of the
14 mice with positive tissue cultures the intestinal pool was positive for M bovis. This
indicates that the mice were able to retain (become infected with) M bovis following
oral exposure and could possibly have shed mycobacteria sporadically in the feces

which was not detected by the sampling methods used in this current study.

101

Results of the mouse/Beg study indicate that genetics are not a reliable indicator of
susceptibility to infection with M bovis in this wild type strain, since all house mice
were determined to be of the resistant phenotype but were relatively susceptible to oral
infection. Genotypically house mice conform to the DBA/2 and C57BL/6-Bcgr strains
which are all resistant (N akanaga et al., 1999). Medina and North (1996) also
demonstrated that the Bcg gene was unable to protect resistant strains of mice namely
DBA/2, from infection (intavenous) with M tuberculosis H3 7R V.They concluded that
although the resistant allele of the Nrampl gene can provide mice with natural
resistance to Salmonella typhimurium , Leishmania donovani, and BCG there was no
measurable influence on resistance to infection with virulent M tuberculosis. Likewise
the presence of a dominant/resistant Bcg in wild type house mice does not afford them
any resistance to infection with M bovis.

The lack of gross lesions and consistently negative fecal cultures in rats is indicative
of inherent resistance to oral infection with M bovis in this species. However, there was
one positive tissue culture (lung, tracheobronchial and cranial lymph nodes) is a single
HD rat on day 20 PI. This rat also had histological lesions consistent with
mycobacterial persistence/colonization as multinucleated giant cells with acid fast
bacilli were present in the tracheobronchial lymph node. Moreover, this also indicates
that Norway rats are capable of disseminating mycobacteria following oral inoculation.
Lack of lesions (gross and microscopic) and negative mycobacterial cultures in the
Norway rats in this study beyond 20 days PI is supportive of prior reports of rats having
the ability to modulate their cell-mediated immune response to Mycobacterium spp.

infection which essentially renders them resistant (Thorns et al., 1982). In a recent

102

study with female Lewis rats, Sugawara and associates (2004) report that animals
infected aerially with M tuberculosis developed granulomatous lesions in the lungs,
spleen, lymph nodes and liver. This begs the question of rats being susceptible to
Mycobacterium spp. organisms via a respiratory route. However, wild type rats are
unlikely to be exposed to the large dose of M tuberculosis used in this study (2 x 106
CFU) in their natural environment.

Of concern, however, is the finding in this study of decreased total body weight in
inoculated rats when compared with controls although none of the rats exhibited any
other adverse clinical signs (respiratory distress, bristled hair, reluctance to move etc.).
A similar lack of clinical signs in rats affected with bovine tuberculosis following
experimental inoculation is also reported by Griffith (1907‘) with intraperitoneal (IP)
and subcutaneous (SQ) routes as well as by Wessels (1941“) who utilized the IV route.
These other researchers also report widespread replication of M bovis in several tissues
(lungs, liver, spleen, lymph nodes, kidneys, omentum, and bone marrow) which was
not a feature in this present study. Accordingly, one can conclude that Norway rats are
essentially resistant to infection with M bovis at high oral doses and are incapable of
disseminating this organism laterally via fecal shedding. Support for rats being dead
end hosts for M bovis is gleaned from previously reported environmental survey
studies in which rats were negative on culture (Pallai et al., 2000; Wilesmith etal.,
1986) or lacked lesions in the face of positive cultures (four animals total) (Little et al.,
1982; Bosworth, 1940).

In conclusion, the results of this study indicate that meadow voles are highly

susceptible to infection with M bovis via both oral and intranasal routes. Further,

103

infected voles can disseminate mycobacteria via their feces. In voles, lesions consistent
with tuberculosis occurred in several tissues including the lungs, liver and spleen,
various lymph nodes and in the intranasal inoculate the nasal turbinates. House mice
are also susceptible to infection with M bovis via the oral route but are apparently less
efficient in transmitting mycobacteria via fecal shedding when compared to the vole.
Affected mice suffered most lesions in the lungs. The rat is the most resistant of the
three rodent species to oral infection with M bovis.

In the house mouse Bcg genotype alone was found to be ineffective in predicting
susceptibility to infection with M bovis as these animals were all of the resistant
phenotype (Bcg’ ; glycine residue at position 169 in the nucleotide sequence) but did in
fact become infected with M bovis.

Although meadow voles and house mice are unlikely to encounter the high dose
inocula of M bovis used in this study in their natural environment, it is recommended
that appropriate measures be taken to eliminate these animals or at least control their
numbers on premises where bovine tuberculosis positive animals are present. Further, it
would be strongly advised that access of voles and mice to food and water sources of

domestic animals be restricted wherever possible.

104

Table 3:1 Gross lesions consistent with tuberculosis detected at necropsy in

voles experimentally inoculated with Mycobacterium bovis

 

 

 

 

 

 

 

 

 

Voles: # affected/ Route Lung LN* Liver Spleen
total # in group
Day 30
7/7 INT 5 6 2 1
7/7 Oral 7 3 0 2
Day 60
5/5 INT 3 5 1 5
0/5 Oral 0 0 0 0
Total # affected/ 15 14 3 8

total # inoculated = 19/24

 

 

 

 

 

 

* Lymph node
I Intranasal

105

 

Table 3:2 Gross lesions consistent with tuberculosis detected at necropsy in
mice experimentally inoculated with Mycobacterium bovis

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Mice: # affected/ Dose Lung LN * Liver Spleen
total # in group
Day 20
4/4 HI)1 1 0 0
1/4 LDf 1 0 0
Day 40
4/4 HD1 4 2 0 0
1/4 LI)1 1 0 o 0
Day 60
1/4 HDI 0 1 0
1/4 LI)1 0 0 0
Total # affected/ 9 4‘ 0
total # inoculated = 12/24

 

* Lymph node
I High dose
1Low dose

106

385.55 a.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

owe: €53 .
:5 n
33:83 a .33
m a E a 2 3 easuafsfi
252 o o o o o a5 ma
8
£205:
8
ASSESS m m m m a. .7: an
8 m5
8% _ a S m a a5 5
L
ASSESS e e A m a. E E
8 E5
macawI
E a .33
3885
.550 SHEAEH Coo—mm Ceza— «24 was:— 853— a 3615
£33 Eateuoeaeeéé

5m? wens—=35 Eauaofitoauo 83> 5 639896 ammo—=23... .53 2.8333 2.38— 9338334 mum ozah.

107

Table 3:4 Microscopic lesions consistent with tuberculosis detected in mice
experimentally inoculated with Mycobacterium bovis

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Mice: # affected/ Dose Lung LN* Liver Spleen
total # in group
Day 20
4/4 HD‘r 3 1 o 1
0/4 LD1 0 o 0 0
Day 40
4/4 H07 4 1 I 1
1/4 LI)I 1 0 0 1
Day 60
0/4 HDT 0 0 o 0
3/4 LI)1 3 2 0 1
Total # affected] 11 4 1 4
total # inoculated = 12/24

 

* Lymph node
I High dose
1 Low dose

108

 

 

 

 

 

 

 

S
U100 —— .9 e C c
R L] +-—————o—————o———
V c.—
' '1
v I
t fl- 1
0.75: “—T'
D
l I II
S
T
R
10.50:
B
U
T
I
O
"0.25-
F
U
N
C
T
'OOOO‘Il I I I ‘F I I
0 30.
N 0 10 20 NORTDAY 40 50 60
—1 0001
——-2 0002
—3 III3

Figure 3:1a Survival analysis for the rodent Species according to treatment.
The treatment codes are as follows; 1 = controls, 2 = low dose/intranasal, 3 =

high dose/oral

109

 

 

 

 

 

 

3
U1 00 ‘ "“"'“”‘““T 9 v
R "‘I
v E
I I—,
V ~———e— ————————————— o
A =
L0.75
D
l I
s
T
R
'0.50
a
U
T
I
o
N0.25
F
U
N
c
T
'0.00 . ‘ . v1 I I
o O 10 20 30 4O 50 6O
" HORTDAY
—1 0001
-—-2 0002
-———3 III;

Figure 3:1b Survival analysis for the rodent species according to Species.

The species codes are as follows; 1 = rat, 2 = mouse, 3 = vole

110

 

 

Figure 3:2 Vole # 18 IN 51 days PI
Bilaterally enlarged submandibular and superficial cervical

lymph nodes

111

Figure 3:3 Vole # 14 IN 52 days P1 with M bovis

The liver (top) contains several (more than 100) randomly disseminated pale tan
slightly raised granulomas which ranged from 1 mm to 2 mm in diameter.

The lungs (bottom) were diffusely firm, non-collapsing, mottled pale tan and red
and contained Similar raised granulomas which ranged from 1mm to 5 mm in

diameter

112

 

 

 

Figure 3:3

113

Figure 3:4 Bottom- House mouse # 8 HD (died) 30 days P1 with M bovis
The lungs were diffusely firm, non-collapsing, mottled pale tan and red and
contained raised granulomas which ranged from 2mm to 6 mm in diameter

admixed with foci of necrosis

114

 

Figure 3:4

115

Figure 3:5 Top - Vole- normal lungs sham inoculated control, H&E X 6.25

Figure 3:5 Bottom - A section of lung from vole # 16 IN day 19 P1 with M bovis,
H&E X 12.5
The lungs have severe, diffuse granulomatous and necrotizing pneumonia which

has almost totally effaced the pulmonary parenchyma

116

 

5

Fig3

117

 

Fig 3:6 Photomicrograph of a section of lung from a vole inoculated
with M bovis 1N, Ziehl-Neelsen acid-fast stain

A section of lung from vole # 16 IN day 19 PI withM. bovis, X 200
The necrotic debris within the pulmonary parenchyma contains numerous acid-

fast bacilli (arrow), Ziehl-Neelsen acid-fast

118

 

Figure 3:7 Photomicrograph of a section of nasal turbinate from a vole
inoculated with M. bovis 1N, Ziehl-Neelsen acid-fast stain

A section of nasal turbinate from vole # 13 IN day 60 PI withM. bovis, H&E X
200
The necrotic debris adhered to the nasal turbinate surface contains moderate

number of acid-fact bacilli (arrow), Ziehl-Neelsen acid-fast

119

 

Figure 3:8 Section of mesenteric lymph node from a vole inoculated
with M. bovis IN

A section of mesenteric lymph node from vole # 19 IN day 46 (euthanized
prematurely) P1 with M bovis, H&E X 6.5
The mesenteric lymph node has severe, focally extensive caseogranulomatous

lymphadenitis

120

 

Fig 3:9 Section of liver from a vole inoculated with M
bovis IN

A section of liver fi'om vole # 25 IN day 30 PI withM. bovis, H&E X 100
The liver contained a few (less than 10) randomly disseminated multinucleated

giant cells (one shown) [mild multifocal granulomatous hepatitis]

121

Figure 3:10 Top — A section of nasal turbinate from vole # 13 IN day 60 PI with
M bovis, H&E X 6.25

There is moderately severe, focally extensive granulomatous rhinitis

Figure 3:10 Bottom - A section of nasal turbinate from vole # 13 IN day 60 PI
with M bovis, H&E X 50
Necrotic cellular debris is adhered to the epithelial surface of the nasal turbinate

(arrow)

122

 

Figure 3:10

123

 

Figure 3:11 Top - House mouse- normal lungs Sham inoculated control, H&E X

7.5

Figure 3:11 Middle - A section of lung from house mouse # 16 HD day 40 P1
with M bovis, H&E X 7.5

The normal lung parenchyma is almost totally effaced by severe extensive
coagulative necrosis. Admixtures of degenerate neutrophils, lymphocytes, plasma

cells and macrophages surround the necrotic foci.

Figure 3:11 Bottom - A section of lung from house mouse # 16 HD day 40 P1
with M bovis, X 150
The necrotic pulmonary parenchyma contained abundant acid-fast bacilli (arrow),

Ziehl-Neelsen acid-fast

124

 

 

 

125

 

Figure 3:12 Top - A section of tracheobronchial lymph node from mouse #3 LD
day 60 P1 with M bovis, H&E X 50
The medullary sinuses of the tracheobronchial lymph node are infiltrated by

moderate numbers of histiocytes

Figure 3:12 Bottom -A section of tracheobronchial lymph node from mouse #3
LD day 60 P1 with M bovis, X 250
The histiocytes which have infiltrated the medullary sinuses have small numbers

of acid-fast bacilli within the cytoplasm (arrow), Ziehl-Neelsen acid-fast

126

  
 
 

 
  

  

we .3 .a—
"39:; I}: 4.. 0'. .

.450" ”'2-OW" ‘-
4 <5" . I "0‘ . “

 
 
  
 
   
  

    

u

 
 

:4' ‘3 I‘. l. v ‘1 . -rfiq{w\v‘..‘ J‘
INF-(W 35k - “ :21 {» g5}, 5313?,

    

 

Figure 3:12

127

 

Figure 3:13 Top - A section of tracheobronchial lymph node from Norway rat
#29 HD day 20 P1 with M. bovis, H&E X 100
The tracheobronchial lymph node had randomly disseminated multinucleated

giant cells (less than 10)

Figure 3:13 Bottom -A section of tracheobronchial lymph node from Norway rat
#29 HD day 20 P1 with M bovis, H&E X 500
The multinucleated giant cells contained a few acid-fact bacilli (arrow), Ziehl-

Neelsen acid-fast

128

 

4.35..

 

has
X04:
\‘%\f0 54., s

«.1
W L

    

.s. amnw 3....M
«0.904 3‘01”“ WW. u. .
am. .....
4 .o ,. o p

7% mama

129

Figure 3:13

Figure 3:14 PCR amplification of Bcg DNA.

M — molecular weight marker lOO-bp ladder

U — amplified Bcg DNA which is uncut

Mouse samples- all other lanes are DNA from the 36 mice that were amplified

and then cut with Aci I which show the 200 bp cut segment

130

 

MOUSE SAMPLES

131

.5
'4 .14}?

1.. ,

Mil? ,

' g“;

\

 

14

Figure 3

0 000
O

 

Figure 3:15 Nucleic acid sequence of Nramp 1 Beg DNA in house mice
The sequence indicated in the gel is as follows (top to bottom)
GTGTTACCATAGTCATGTGGCGGGG'TGTCGCCCTACGA

'Indicates the guanine nucleotide at position 596

132

CHAPTER FOUR

A Comparison of Mycobacterial Culture with Polymerase Chain Reaction on
Granulomas Isolated by Laser Capture Microdissection in the Diagnosis of

Mycobacterium bovis Infection

Abstract

A major impediment to the diagnosis of Mycobacterium bovis infection is the
organism’s fastidious growth in culture. There is a need for diagnostic techniques
which have improved sensitivity and specificity compared to mycobacterial culture,
particularly those that are more cost effective with reduced turnaround times. In this
study laser capture microdissection (LCM) was used to procure granulomas from
formalin-fixed, paraffin-embedded lung tissues from house mice (Mus musculus)
inoculated with Mycobacterium bovis. Thirty-six lung samples were evaluated. PCR -
DNA amplification of a 123-bp segment of IS 6110 which is specific for organisms of
the M. tuberculosis complex was used to detect M. bovis in the microdissected
granulomas. LCM/PCR results were compared with the gold standard of mycobacterial
culture. Cohen’s kappa (K) values for complete agreement between mycobacterial
culture and LCM/PCR in diagnosing M. bovis infected house mice was 0.68 (95 % CI
0.425- 0.941) which is classified as ‘good’ agreement. The LCM/PCR method has a
faster turnaround time of three to four days when compared to 8-12 weeks for culture.

Additionally, the LCM method was more cost effective at $55 per sample, compared

133

with $100 for mycobacterial culture. Thus, the LCM method appears to be inferior to
mycobacterial culture in detecting true positives or infected individuals and would,
therefore, not be adequate for use as a screening test. Yet a specificity of 95.6% may be

indicative of this procedure having some usefulness as a confirmatory test.

Introduction

In 1993 the World Health Organization (WHO) eclared that tuberculosis in
humans due to M. tuberculosis was a global health emergency (Ainsa et al., 2001).
Rapid and accurate diagnosis of a disease outbreak is an essential first step in an
epidemiologic outbreak investigation, and subsequent control/ management as
antibiotic treatment differs according to the species of mycobacterium (Soini'and
Musser, 2001; Watterson and Drobniewski, 2000). A chief goal in tuberculosis
research, that is primarily evident with M tuberculosis infections but is no less
important for M. bovis, is the development of improved diagnostic and therapeutic
intervention strategies (Garg et al., 2003).

Although mycobacterial culture using a combination of solid and liquid media is
accepted as the ‘gold standard’ for isolation of Mycobacterium spp. organisms prior to
identification, it is very time consuming. These bacteria have slow generation times on
the order of 15 to 20 hours and visible bacteria are detected only after several weeks of
incubation. It may take as long as six to eight weeks to identify mycobacteria in clinical
specimens (Butcher et al., 1996). Since the discovery of mycobacteria by Koch in 1882,
the acid-fast smear technique is still the most rapid method for detection of M

tuberculosis (Caws and Drobniewski, 2001). However, this test is neither sensitive nor

134

specific for tuberculosis (Woods, 2001). Sensitivity for this technique is reported to
range from 61% to 90% (Ulukanligil et al., 2000; Fitzgerald et al., 2000). Therefore,
there is a need for techniques that are more sensitive and specific than acid-fast bacteria
(AFB) smear techniques and more rapid than culture. In an effort to expedite the final
diagnosis of Mycobacterium spp. several molecular methods have been developed
within the past decade for direct detection, identification, and susceptibility testing.
Diagnostic laboratories are increasingly favoring such methods since biochemical
testing is slow, cumbersome, and may yield ambiguous results. Molecular methods can
reduce the turnaround time from weeks to days (Soini and Musser, 2001; Caws and
Drobniewski, 2001).

Amplification of nucleic acids is a common starting point for molecular diagnostic
methods. Polymerase chain reaction (PCR) is the most widely recognized and utilized
of these techniques. Two nucleic acid based tests have been approved by the Food and
Drug Administration for direct detection of M. tuberculosis from clinical specimens.
The Amplicor Mycobacterium tuberculosis Test (Amplicor; Roche Diagnostic Systems,
Inc., Branchburg, NJ) is a PCR based test and the Enhanced Mycobacterium
tuberculosis Direct Test (E-MTD; Gen-Probe, San Diego, CA) is based on the
transcription amplification system (TAS) where target rRN A is converted into cDNA
isothermally. A drawback of these tests is that they are only approved for M
tuberculosis complex organisms (M tuberculosis, M. bovis, attenuated M. bovis BCG
strains, M afiicanum, M microti and M canettii). Culture is still required to identify
nontuberculous mycobacteria and for drug susceptibility testing (to determine

drug/antibiotic sensitivity; response to therapy). Moreover the tests do not differentiate

135

between live and dead mycobacteria and, therefore, are unsuitable for monitoring TB
therapy. Assays based on PCR using formalin-fixed paraffin-embedded sections with
typical tuberculous lesions are being used increasingly by diagnostic laboratories since
primers are available which are highly specific for M tuberculosis complex
mycobacteria. Such assays are attractive as they are more rapid than bacterial culture by
three to four weeks (Adams, 2001)

Other tests which are routinely used are nucleic acid analysis without amplification
e. g. nucleic acid probes (GenProbe) which can identify mycobacteria to the species
level. DNA microarrays are the latest molecular method with potential to provide
reliable results on mycobacterial Speciation in a rapid and reliable manner (Soini and
Musser, 2001).

Sensitive and specific confirmatory tests for bovine tuberculosis samples collected
at post mortem enhance depopulation procedures in a herd situation. Such tests would
also be able to detect subclinical infection in animals presented for slaughter and would
prevent meat or any other byproducts being passed for food consumption or further
processing. Timely and accurate test results would reduce the cost incurred by the
owner/producer and regulatory agencies (federal and state) when herds are held in
quarantine awaiting confirmation of the herd’s bovine tuberculosis status. In addition,
the availability of such test results could limit further transmission to other animals as
well as humans.

The aim of this study was to evaluate the novel diagnostic procedure of laser
capture microdissection (LCM) in conjunction with PCR for the identification of M

bovis from formalin- fixed paraffin-embedded pulmonary tissues from experimentally

136

infected house mice. It is our hypothesis that the LCM/PCR method is comparable to
mycobacterial culture, the gold standard, in both sensitivity and specificity while

having an improved turnaround time and reduced cost.

Materials and Methods
Inoculum
Inocula used were prepared by the tuberculosis laboratory, Michigan Department of

Community Health (MDCH). The M bovis isolate is from a positive white-tailed deer
(WTD) identified by annual surveillance and was confirmed as the strain typical to all
cases by restriction fragment length polymorphism (RFLP). Seven-day growth in
Middlebrook 7H9 broth was adjusted to 0.5 McFarland turbidity standard, diluted to
1:100 with sterile water and tested by plate counts to determine the colony-forming
units (CF U) per unit of volume. The dose was confirmed again at the time of
inoculation of the house mice. The oral inocula were administered via tomcat catheter

gavage.

Inoculation of house mice

Thirty six adult house mice were sourced from The Geriatrics Center, University of
Michigan, Ann Arbor. All animals were known to be free from common murine
pathogens tested for at Charles River Diagnostics, Wilmington, MA prior to inoculation
(listed in appendix II). To assess fecal shedding fecal samples for mycobacterial culture
and isolation were obtained from each mouse on the day prior to oral inoculation, day 1

post inoculation (PI) and from surviving animals on days 20 and 40 PI. The mice were

137

randomly assigned to one of three groups: 12 received a high dose of M bovis (1x 104
CFU), 12 low dose (1x 102 CFU) and 12 were sham inoculated controls. Each mouse
received 0.25ml total volume orally. Inoculated and control mice were housed
individually in microisolator cages in a HEPA-filtered room (biolevel-3 conditions) at
the Michigan State University Containment Facility. Rodent chow and water were
supplied ad libitum. Four mice from each group were sacrificed at 20, 40 and 60 days
post inoculation (PI).

Each animal was weighed prior to inoculation (day 0) and at weekly intervals
thereafter. All animals were euthanized with an overdose of isoflurane (IsoFlo®, Abbott
Animal Health, North Chicago, IL). At necropsy, total body weight in grams (g) was
obtained for each animal. The weight of the lung, liver and spleen was also recorded.
Tissues harvested at necropsy were preserved in 10% neutral-buffered formalin (N BF)
and included brain, trachea, lung, heart, liver, kidney, spleen, gonad, adrenal gland,
small intestine (81), large intestine (LI), cranial, thoracic and abdominal lymph nodes.
Tissues were routinely processed and sectioned for staining with hematoxylin and eosin
(H and B). All tissues were also stained with Ziehl-Neelsen (acid fast).

Tissues for mycobacterial culture were collected using sterile instruments and were
grouped into three pools; pool A: lung, tracheobronchial lymph nodes and cranial
lymph nodes, pool B: liver, kidney and spleen, pool C: SI, LI and mesenteric lymph

nodes

138

Preparation of lung tissue and laser capture microdissection

Five-um sections of lung on uncoated, uncharged glass slides were deparaffinised
in xylene and rehydrated by immersion in absolute and 95% ethanol. Sections were
then stained with hematoxylin. To prevent cross contamination the microtome blade
was cleaned with absolute alcohol between each block. With the laser capture
microscope (Pix-Cell II, Arcturus Engineering, Mountain View, CA) a 7.5 pm laser
beam was used to procure selected granulomas. The amplitude range was 60-70 mW

for 2 ms.

DNA extraction
The microdissected granulomas adhered to the thermosensitive membranes were

peeled from the caps and transferred into a 2 ml microcentrifuge tube containing 501.11
of tris-ethylenedaiminetetraacetic-acid (TE) buffer (10mM tris-HCl 1 mM EDTA, pH
8.4) (modified after Zhu et al. 2003). Mycobacterial cell lysis was achieved by placing
the tubes in an ultrasonication water bath for 5 minutes (80W) (model # 2510, Branson,
Danbury CT). Samples were then boiled for 10 minutes and snap frozen (ethanol on dry
ice). After freezing the sample was centrifuged at 16,000 x g for 10 minutes and 5 ul of

the supernatant was used for each PCR test (modified after Eing et al., 1998).

Amplification and detection procedures

Samples were examined with primer sets for amplification of a 123 base-pair (bp)

segment of insertion sequence (IS) 6110 as follows; the forward primer sequence was

139

5’-CTCGTCCAGCGCCGCTTCGG and the reverse primer sequence was 5’-
CCTGCGAGCGTAGGCGTCGG (Eisenach et al., 1990).

A hot-start method which utilized heat activated DNA polymerase was selected for
amplification (TakaRa TaqTM HS 10x PCR buffer dNTP mixture, Takara Mirus Bio,
Madison, WI). The final reaction volume of 25 pl contained 10 pM primers, 0.635 U
DNA polymerase and 0.2 nM nucleotides. A 5 ul DNA test sample was added to a 20
pl volume of master mix. Positive control DNA was obtained from M bovis cultures.
Each PCR run included a negative control (dd H20) and a reagent only negative
control.

Amplification conditions were as follows: 94 ° C for 308 and 72 ° C for 755
repeated 50 times with a final 10 minute extension at 72° C (MJ Research PT-200
Peltier Thermal Cycler, Waltham, MA, USA). 12 p1 of the amplification products were
analyzed by gel electrophoresis [1.5% agarose, SB buffer (5 mm disodium borate
decahydrate, pH8.5)] and stained with ethidium bromide. Electrophoresis was
performed for 20 minutes at 200V. Ultraviolet transillurnination was used to delineate
base pair fragments (UVP, Ultraviolet Products, Upland, CA). Images were taken with

the Kodak EDAS 290 system (Eastman Kodak Co., Rochester, NY).

Statistical analysis
Agreement of LCM/PCR with the ‘gold standard’ of mycobacterial culture was

calculated with Cohen’s kappa statistic (K). Kappa values of < 0.4 are considered poor;
0.40 —- 0.60 fair; 0.60 - 0.80 good; > 0.80 is excellent. Validity was assessed by

sensitivity, specificity, accuracy and predictive value measures. Sensitivity is defined as

140

the percentage of true positive samples that are so indicated by the test whereas
specificity is the percentage of true negative samples that are so indicated by the test.
The positive predictive value (PPV) is the probability that a test positive sample is a
true positive. Conversely the negative predictive value (NPV) is the probability that a
test negative sample is a true negative. Accuracy is defined as the degree of agreement
between the estimated value (teat value or measurement) and the true value and is

determined by a+d/ (a+b+c+d) x 100.

Results

Of the thirteen mycobacterial culture positive lung samples (pool A) from M bovis
infected house mice, nine of them were also positive by the LCM/PCR technique
(Tables 4:1 and 4:2). The LCM/PCR technique detected M bovis in one mouse that
was culture negative on lung tissue. Yet tissues from this particular mouse were
positive on culture in the liver, kidney and spleen.

The sensitivity for the LCM/PCR technique when compared to mycobacterial
culture was 69.2%, specificity was 95.6%, positive and negative predictive values were
90% and 84.6% respectively (Table 4:2).

Cohen’s kappa statistic (K) for agreement of LCM/PCR with mycobacterial culture

was 0.68 (95 % CI 0.425- 0.941).

Discussion and Conclusion
Since its inception in the mid 1990’s laser capture microdissection is increasingly

being utilized in pathology for the procurement of groups or even individual cells of

141

interest primarily in cancer studies (Frost et al., 2001; Suzuki et al., 2001; Webb T,
2000). In the laser capture procedure a dehydrated tissue section is placed on the stage
of a specially designed microscope. Once the cells of interest are visually selected a
thermoplastic membrane is directly opposed to the cells. A low power infrared laser
beam is applied to the cells which melts the overlying membrane. The polymers in the
membrane surround the cells of interest and hold them tight. Such cells remain
embedded in the membrane once it is lified (Curran et al., 2000; Fend and Raffeld,
2000). The main advantage to LCM is that a relatively pure population of cells can be
procured for subsequent analysis of DNA, RNA and protein (Eltoum et al., 2002; Grant
and Jerome, 2002; Suarez-Quian et al., 1999; Simone et al., 1998; Bonner et al., 1997;
Emmett-Buck et al., 1996).

It is known that culture, the gold standard for mycobacterial isolation and
identification, is unable to provide a diagnosis in a timely fashion, although being very
specific. Thus, research is ongoing to identify diagnostic tests which have greatly
reduced turnaround times while retaining reliability. When employed in the detection of
mycobacteria, molecular techniques are successful in reducing turnaround time, but are
often less reliable than culture with reduced sensitivity and specificity. Specifically,
challenges that occur with DNA amplification procedures are related to the extraction
and purification of mycobacterial DNA from a larger mass of tissue. The overall
objective of this study, therefore, was to utilize LCM to extract focal granulomas
containing mycobacteria from formalin-fixed paraffin-embedded lung tissue in M
bovis infected mice in an effort to enhance the purity of DNA extracted for PCR

(Figures 4:1 and 4:2). Consequently this method would have equivalent sensitivity and

142

specificity when compared to the gold standard of mycobacterial culture which utilizes
a combination of liquid and solid media. Indeed a Cohen’s kappa value of 0.68
indicates there is good agreement for LCM/PCR and mycobacterial culture.

PCR is currently the most widely utilized molecular technique employed by
diagnostic laboratories to detect mycobacteria. Advantages are that small quantities of
DNA on the order of one to 10 bacilli can be amplified and detected. Ethidium bromide
stained gels can resolve lfg of DNA (Garg et al., 2003). However, a disadvantage
resulting from this is that remnant DNA from inactivated mycobacteria can be
amplified thus PCR can detect infection but not active disease necessarily. PCR also
does not facilitate species identification.

Another disadvantage in the use of PCR is the difficulty in extracting of DNA from
Mycobacterium spp. organisms due to the presence of a thick lipid-rich cell wall. In this
study alone, enzymatic (proteinase K) and chemical (Extract-N-AmpTM Plant PCR kit,
Sigma-Aldrich Corporation, St. Louis, MO) extraction methods were attempted (data
not presented) without success. Although the physical extraction procedure utilized
(sonication/boil and freeze-thaw) was the most successful it still did not produce
consistent results. Failure of PCR to identify all of the M bovis infected lung samples
can be related to problems previously identified by other researchers when applying
molecular techniques to mycobacteria.

Failure to detect all of the culture positive mouse lung samples in this study may be
due to incomplete digestion of the mycobacterial cell wall to release the DNA, presence
of inhibitors of PCR in the tissues or a dilution of available DNA in the extraction

process. Even though the granuloma containing mycobacteria was successfully

143

harvested, failure to digest the mycobacterial cell wall would manifest as a false
negative. Another caveat to be considered in the procurement of granulomas is that the
mycobacteria may be unevenly distributed in the tissue and it is possible that this
variation in numbers of organisms within and between granulomas could contribute to
variation in the amount of DNA procured. This problem is not one that is unique to this
study and suggests that further research is need to devise better and more consistent
methods of extracting DNA from Mycobacterium spp. organisms (Honore-Bouakline et
aL,2003)

Another drawback is the presence of contaminants which hinder DNA
amplification. Exogenous inhibitors include residual fixative or paraffin, anticoagulants
and detergents. Mycobacterial cell wall components contribute to endogenous
inhibition (Goldsworthy et al., 1999; Pfyffer, 1999).

False negative results with the LCM-PCR procedure may have occurred due to the
uneven distribution of mycobacteria in the SOul of TE buffer. Mycobacteria are known
to aggregate in liquid cultures and solutions.

Additionally the reduced sensitivity of the LCM/PCR technique when compared to
mycobacterial culture may be related to fixation of tissues with formaldehyde
(10%NBF). Forrnalin is a cross-linking fixative that is it causes cross-linking between
protein and DNA Formaldehyde initiates DNA denaturation at the AT-rich regions of
double-stranded DNA creating sites for chemical interaction. The overall rate of
formalin-induced modification of DNA is dependent on the concentration, temperature
and pH of the fixative. F orrnalin can decrease the quality and quantity of DNA which

can be extracted from tissues immersed in this fixative. The average size of DNA

144

extracted from tissues fixed in buffered formalin decreases with increasing fixation
time (Serth et al., 2000; Williams et al., 1999). Short-term treatment of sections with
formalin have been shown to significantly reduce DNA solubility (Srinivasan et al,
2002)

Cataloluk et a1. (2003), in summarizing the prior reports of other researchers as it
related to their study on archival paraffin-embedded, M tuberculosis infected tissues,
stated that the preservation process or the storage time afier preservation of tissue
samples may lead to false positive and/or false negative results. Therefore shortening
the amount of time that the mouse pulmonary tissue was immersed in formalin before
processing for paraffin embedding could improve the quantity and quality of DNA
obtained.

Wards and associates in 1994 were able to demonstrate the utility of PCR in
detecting M bovis in fresh tissue. They obtained a specificity of 91% but used a
different M tuberculosis complex-specific insertion sequence (IS 1 081). Miller and
associates in 1997 used PCR to detect M bovis from archival formalin-fixed paraffin-
embedded tissues from various ruminant species. They obtained a sensitivity of 93%.
Similar to the conclusions of Miller et al.1997 with a crude freeze-thaw DNA
extraction protocol a negative PCR result following sample selection with LCM could
not be interpreted to mean that the tissue does not contain M tuberculosis complex
bacteria, specifically M bovis in this study.

In a follow up study in 2002 of 102 culture negative samples, Miller and associates
obtained a specificity of 59.8% for M tuberculosis complex. The overall specificity for

mycobacterial infection was 43.1%. Although the crude PCR procedure used in this

145

earlier study was able to detect an additional 41 M TB complex positive samples out of
a total of 102 that were culture negative but had lesions suggestive of mycobacterial
infection, the LCM/PCR technique utilized in this study was superior in this respect as
the specificity was 95.6% versus 59.8%. The high false negative rate (low specificity)
at the National Animal Disease Center (Miller study) may be due to the
decontamination procedure used at this particular center (the tissues were submitted in
sodium borate to control contaminating organisms). Sodium borate (bleach) is
notorious for killing mycobacteria after prolonged exposure (Miller, 2002).

It should be noted that in this current study the specificity was determined based on
culture results in the lung only. However, if specificity was determined using a positive
culture result for any of the tissues submitted for a given mouse, then the specificity of
the LCM/PCR technique versus culture would be 100%. This is so as the mouse
determined to be positive by LCM/PCR but culture negative on the lung was, however,
positive on culture in the pooled liver, kidney and spleen.

Selva et al. (2004) reported a sensitivity of 92% and a specificity of 100% in a
similar LCM/PCR study for the detection of M tuberculosis in granulomas from
formalin fixed tissues. The greater sensitivity in this study is likely as a result of M
tuberculosis having up to 20 copies of 186110 whereas the majority of M bovis isolates
from infected cattle have only a single copy of IS61 10 (Durr et al., 2000). Similar to
bovine isolates, the majority of WTD isolates in Michigan (strain used to inoculate the
mice in this study) were found to have a single copy of 186110 (Whipple etal., 1999).

Further, Selva and associates concluded that LCM did not increase the sensitivity of

PCR when compared to that on whole tissue sections. Referring to the study done by

146

Miller et a1. (1997) with crude DNA extracted from formalin-fixed paraffin-embedded
tissues with sensitivity of 97%, a sensitivity of 69.2% in this current LCM/PCR study is
supportive of the conclusion reported by Selva.

The efficiency of the LCM/PCR technique could be enhanced by increasing the
initial sample size (multiple caps per individual slide/animal), using a nested primer
method, or increasing the number of amplification cycles (Goldsworthy et al., 1999).
Further, the efficiency of this procedure could be improved with the use of an internal
control. Apart from increasing the total cost internal controls are not failsafe especially
if different primers are used and it involves amplification from a different primer
binding site.

The turnaround time for the LCM/PCR method is 3-4 days compared to eight to
twelve weeks for mycobacterial isolation and identification (Table 4:3). The laser
capture method is also more economical as the total cost was a little over $55 compared
to $100 for mycobacterial culture. Sensitivity may be improved by using more than one
capful of tissue. Although this would increase the turnaround time by a negligible
amount the total cost of this technique would increase precipitously and approach that
of mycobacterial culture.

In summary, this study demonstrates that the LCM/PCR test has a sensitivity of
69.2% but costs less and has a more efficient turnaround time when compared to
mycobacterial culture. However, a specificity of 95.6% and a K value of 0.68, indicative
of good agreement, suggest that the LCM/PCR procedure could with further refinement
be utilized as a confirmatory test in the diagnosis of M bovis infections in a clinical

setting. Yet, much remains to be achieved in order to attain the ideal typing method

147

‘r‘fl‘fl'l

 

 

 

which should be inexpensive, reproducible, and rapid, easily performed and have direct

application to clinical specimens (Adams, 2001).

148

 

 

Table 4:1 A summary of the results (Ziehl-Neelsen acid-fast stained sections,
mycobacterial culture, LCM/PCR) in house mice (Mus musculus) orally

inoculated with M bovis.

* Low dose

* High dose

t Controls

§Hematoxylin and eosin/ Ziehl- Neelsen acid fast
" Culture

l Laser capture microdissection/ PCR technique

149

 

 

 

 

- - - + - - - 3 3 ES

.. .. .. u + u u u + + u—DMV

- - - - - - - - + + hsm:
mm an mu 3 3 an en h c— a v a. mmDOZ
8 ><G

u u u . Any + + + .. . EDA
- - - - + + + + - - ADD
- - - - + + + + + - - msnm:
on an mm a mm o— m— a N— 2 e n mmDOE
3. ><G

- - - - + + + + - 3 - 7201—

- u u n n + + + .. + . =1—DU

- - - - + + + + - - - mus”:—
vm mm VN 3 3 FN an E 3 m— N n mmDOZ

“ZOO .3: A:
an ><D

6.53 .3 .53 63232: .558 A§~=o§=~ 3:531: 8:2. 5 3.2.8.. 2: he .CaEE—i _ 3. mail.

150

Table 4:2 Comparisons between the results of mycobacterial culture
and isolation (gold standard) and the results of LCM’IPCR"

Mycobacterial culture

 

 

 

+ -
+ 9 1 10

LCM/PCR' (a) (b)
- 4 22 26

(c) (d)
13 23 36

 

 

 

' LCM- laser capture microdissection

b PCR - polymerase chain reaction

* Sensitivity 69.2%; specificity 95.6%; positive predictive value 90%;
negative predictive value 84.6%; accuracy 86%

K = Q;E
l-E
= 0.86- 0.56
1 — 0.56
= 0.68

*Chance/ observed agreement [0] = 0.86
IExpected agreement [E] = 0.56

TO= a

+d
a+b+c+d

*E = [(a+CIx(a+b)l+l(c+d) x (b+d)l
[a+b+c+d]2

151

ll

Table 4:3 A summary of the total laboratory costs for laser capture
microsdissection (LCM) with PCR on puhnonary granulomas from formalin-fixed
paraffin-embedded tissues. This cost is compared with for the gold standard,
mycobacterial culture. The turnaround time for the LCM/PCR procedure and

mycobacterial culture is also displayed

152

 

 

 

 

333 Nu -m
@303 m 8
we: 2.3—53mg 308m a 8303 Q _..
8.83 w - m tone Ram...

3003 N :32 $5828;

mew ~ 808m 58m “2
2: m mmw
oma <2 88“ 80:85
\boumfibmcoo
5 <2 3239 8:05
3% owmm 23:6
3% 84% oEmEQEm m<
Rm 5 .Béwaaooem
:58: 9.5.50 we: 2.5—=0
>325 ozzmem >325 guano Z
gala

when. Tm .38.

was om sea :8
E o: s: 226

e; E a: am «8
8E 8 8:898 38
meme on 2393 593
as 2 02m Essa

88: unaccounsh.

momma .sfi
8.5 5: mom
28 age éfifl
w a 25m

om a 96

cm m hone—\wfimmoooi

204
”380

9:53 328933.»:— 15 9:539:— mUEUA 2: 3.. «E: vases—:3 can 389 2: he ban—Ea < m3 033—.

153

 

Figure 4:1 Laser capture microdissection (LCM) of a pulmonary granuloma from

a LD mouse (#17) on day 20 PI, X 35

Top panel: before LCM.

Middle panel: Afier LCM.

Lower panel: Captured granuloma.

154

 

 

 

  
   

   
    

‘ . .
5, ‘ ref-0r- -.
sf; ”3,23% .3

' 7.?" ring”
mg. - 33¢ .2

 
 
 
 
 

  
   

”A ' l“ :9 ‘P
53423.2..3 rat’-

J . o ',
“ war .0»;- , ‘9.fi_
aww‘ur‘lh as.

Figure 4zl Laser capture microdissection of pulmonary granulomas from
a house mouse inoculated with M bovis

155

Figure 4:2 PCR amplification from formalin-fixed paraffin-embedded
microgranulomas in lung tissues of house mice inoculated with M bovis day 20
PI.

MW: molecular weight marker 100-bp ladder

Lane 1- mouse # 27 HD culture positive

Lane 2- mouse # 28 HD not culture positive on pool A

Lane 3 — mouse # 13 LD culture positive but no microscopic lesions detected
Lane 4- mouse # 14 LD culture negative

Lanes 5 and 6 — mice # 33 and # 34 respectively sham inoculated controls
Laue7 — Negative control dd H20

Lane 8 - PCR reagent only negative control

Lane 9 — Positive control

156

 

 

 

 

Figure 4:2

157

CHAPTER FIVE

Conclusions and Further Research

Since the discovery in 1882 by Robert Koch of Mycobacterium bovis as the cause
of bovine tuberculosis, this disease remains today as one of considerable importance.
Unlike the closely related human pathogen M tuberculosis, M bovis has a broad host
range and an ability to survive, produce disease and be transmitted apparently with
ease from one host to another, posing significant challenges to the control and
understanding of the pathogenesis of M bovis infection. Even after more than a
century of recognizing its role in causing disease in animals and often in humans,
much still remains unknown about this formidable pathogen.

In the state of Michigan there has been resurgence of bovine tuberculosis since
the state was declared free of this disease in 1979. Following the discovery of M
bovis in white-tailed deer (Odocoileus virginianus) in 1994, it has become accepted
that white-tailed deer are a maintenance host for this disease. Given this
unprecedented occurrence of white-tailed deer maintaining M bovis and serving as a
source of infection for the disease in cattle, there is now a concerted effort to identify
any other wildlife species which may serve as reservoir or spillover hosts for this
organism. In addition to the test and slaughter technique performed in domestic
animals which includes captive cervidae (Michigan Department of Agriculture,
USDA, there is also ongoing surveillance of wildlife which are found in the area of

the state where the disease is endemic (MDNR, MSU researchers).

158

Complementary to these surveillance studies it was appreciated that little was
known about the transmission, pathogenesis and pathology of M bovis infection in
such wildlife. Indeed if members of these various species were to be infected with M
bovis would the disease be recognized? To this end, experimental inoculation studies
were begun in these animals notably in avian species such as pigeons (Columba
Iivia), starlings (Sturnus vulgaris), American crows (Corvus brachrhynchos) and
mallard ducks (Anas platyrhynchos). The North American opossum (Didelphis
virginiana) was also studied as it is related to the brushtail possum (Trichosurus
vulpecula) in New Zealand that is recognized to be a significant reservoir host in that
country.

As a continuation of these inoculation studies for determining what effect, if any,
does M bovis have on wildlife which interact with cattle and humans in the state, this
current study examined the disease (transmission, pathogenesis, pathology) in three
rodent species (meadow voles, house mice, Norway rats) and also in wild turkeys, all
of which are known to frequent infected farm premises in the northeastern area of the
lower peninsula where bovine tuberculosis is endemic.

The voles (Microtus pennsylvanicus) received oral and intranasal inocula whereas
the house mice (Mus musculus) and rats (Rattus norvegicus) received high and lower
dose oral inocula. The results of this study showed that the rats were resistant to oral
infection with M bovis as they failed to develop extensive lesions pathognomonic for
bovine tuberculosis. Fecal cultures were consistently negative and there was a single
positive tissue culture in an animal that receive a high dose inoculum. Consequently,

Norway rats appear to play no role in endemic bovine tuberculosis in Michigan.

159

Conversely, the meadow voles were found to be highly susceptible to bovine
tuberculosis via both of the inoculation routes to which they were exposed. This was
evidenced by the development of extensive lesions consistent with tuberculosis in
several tissues and positive mycobacterial tissue and fecal cultures. House mice were
also found to be susceptible to oral infection with M bovis as they too developed
lesions consistent with tuberculosis and had positive tissue cultures. The response in

mice was dose dependent as animals that received high dose inocula were more

n—.-... i‘ l.” “.1 a!
,3

severely affected with a third of these animals actually succumbing. Hence, it was

concluded that meadow voles and house mice are capable of acquiring bovine

 

lf'

tuberculosis via the oral route and can potentially disseminate mycobacteria in their
feces. It is, therefore, recommended that the numbers of these rodent pests be
controlled on farm premises in Michigan where bovine tuberculosis is endemic,
especially where herds have been depopulated and prior to repopulation, as there is a
real risk of these rodents spreading M bovis via their feces into feed and water
sources and in so doing introducing or reintroducing bovine tuberculosis.

As an adjunct to the inoculation study in the house mice, further experimentation
was conducted to elucidate their phenotype for the Bcg/Nramp-I/ SclI Ia] gene which
is thought to confer some resistance to infection by Mycobacterium spp. organisms.
However, it was found that although the house mice studied were of the resistant
phenotype (Bcg') this did not prevent them from being infected with M bovis. This
suggests that in house mice, a Bcg resistance phenotype alone does not predict their

response to infection with M bovis.

160

Similar to what was found in Norway rats, wild turkeys were also determined to
be resistant to infection with M bovis when inoculated with high doses via oral and
intratracheal routes. So although wild turkeys are found in large numbers on farms in
the area where bovine tuberculosis is endemic, results of this study demonstrate that
there may be minimal risk of such birds serving as maintenance or spillover host of
M bovis.

The final study of this dissertation dealt with another aspect of tuberculosis where
there is limited advancement, namely the development of a diagnostic test which is
accurate, relatively inexpensive and has a rapid turnaround time. Currently
mycobacterial culture (isolation and identification) is the ‘gold standard’ for
diagnosis. Although this test is very specificity it can take up to twelve weeks to
obtain the final result. Techniques incorporating PCR are increasingly being used in
the diagnosis of mycobacterial infections in an effort to improve the turnaround time
but this is often at the expense of sensitivity and specificity. To this end, a novel
technique with the use of laser capture microsdissection to select granulomas from
formalin- fixed paraffin-embedded tissues for evaluation by PCR to diagnose M
bovis was developed. However, this technique had a sensitivity of 69% when
compared to the gold standard of mycobacterial culture. The turnaround time was
considerably reduced, however, at three to four days compared to eight to twelve
weeks for culture. The LCM/PCR procedure may have some usefulness as a
confirmatory test if further refined and tested on a larger number of samples or even
in granulomatous lesions of other species (e. g. cattle). Such studies were precluded by

the limitations of time and cost in this present body of work.

161

Arising out this body of work are other interesting questions relating to M bovis
infection in the rodent species evaluated. Specifically, in the voles and house mice it
would be of interest to determine their response to lower dose inocula via the
inhalation route. It is well accepted that cattle as well as humans are usually infected
with mycobacteria via this route. As these rodents are found associated with both
cattle and humans, it should be determined if they can be infected via this route as
well.

Additionally, in the rodent species evaluated reports in the literature of
environmental surveys indicate that both Norway rats and meadow voles can be
infected naturally with M bovis, although in very small numbers. It would, therefore,
be of interest to do similar live trapping studies on farms in Michigan where
tuberculous cattle have been detected to determine if, indeed, the mice, rats and voles
exposed to M bovis do become infected.

The results of the Bcg study in house mice are also of interest as they indicate that
much remains to be learned about the way in which genotype is related to infection
with mycobacteria, specifically in this case M bovis. The satellite DNA sequence of
Bcg(Nramp1) in rats is also known (Ge et al., 1996), thus a study similar to the one
in mice but performed on rats would serve to provide much needed information about
the way in which genotype may or may not relate to tuberculosis in these species.
Ultimately such research may be extrapolated to what has been obtained in man.

As the lungs were the principal organ affected in the house mice and this is
similar to what occurs in humans this suggests that this species could reasonably be

used as an animal model of the human disease for the development of vaccine and

162

chemotherapeutic agents for the treatment of tuberculosis in humans. The hope of
eradication of tuberculosis, both human and bovine, rests with the development of
improved diagnostics and new vaccination strategies. Vaccination of wildlife
reservoirs initially is not focused on preventing infection in such animals but seeks to
prevent the shedding of mycobacteria once these animals are infected. Although
encouraging results have been realized in preliminary vaccine trials in badgers in the
United Kingdom and Ireland much remains to be done. Many of the prior studies of
vaccination in animals relied on M bovis BCG but it is realized that, as in humans,
this particular vaccine does not offer reliable protection in animals. Also it introduces
problems in differentiating vaccinated cattle from infected animals. Further research
is need to develop novel adjuvants for such vaccines and an effective way in which
repeated doses of vaccine can be administered to wildlife. Experimental studies to
determine the preferred route of inoculation and dosages of vaccine required will
therefore be necessary in white-tailed deer once such a vaccine is identified. Given
that the complete genome sequence of M bovis is known (Garnier et al., 2003) it is
hoped that such knowledge will be translated into the development of effective
vaccines for the prevention of infection in both animals and humans. Moreover, this
knowledge should assist in the development of better and more specific molecular
based techniques for diagnosis of M bovis infection.

Although the LCM/PCR study ultimately proved to be of low sensitivity (69.2%)
the fact that it did reduce the turnaround time for a final diagnosis to three to four

days suggests that with further modifications in the extraction of mycobacterial DNA

163

from formalin-fixed paraffin-embedded tissues this method may ultimately be further
applied.

In summary, this body of work provided essential information on the transmission
and pathogenesis of M bovis infection in several wildlife species. Specifically, wild
turkeys (Meleagris gallopavo) were found to be resistant to infection via both the oral
and intratracheal route which is supportive of them having no role in the maintenance
of bovine tuberculosis in Michigan. Norway rats were also found to be resistant to
bovine tuberculosis and similar to the wild turkeys pose no threat. However, results of
this study did indicate that meadow voles and house mice if infected with M bovis in
their natural environment can potential spread this organism via their feces. Finally
application of a novel diagnostic technique, namely LCM/PCR, failed to improve on
the sensitivity of the gold standard of mycobacterial culture and at best this new

technique could only be applied as a confirmatory test.

164

Appendices

165

APPENDIX I

The meadow vole (Microtus pennsylvanicus) colony was tested and negative for:

SEND Sendai virus

PVM Pneumonia virus of mice

MHV Mouse hepatitis virus

Reo-3 Reovirus type 3

LCM Lymphocytic choriomeneigitis virus

The colony tested positive for Helicobacter (Helicobacter spp. not bilis or hepaticus) in
August 2000 but was negative at the time animals were sourced for this inoculation

study

166

APPENDIX II

The house mouse (Mus musculus) colony was tested and negative for:

SEND

PVM

MHV

GDV 11

RED

MPUL

LCMV

ECTRO

K

POLY

MAV1&2

EDIM

MPV

PARV NSl

Sendai virus

Pneumonia virus of mice

Mouse hepatitis virus

Theiler’s mouse encephalitis virus (es)
Reovirus

Mycoplasma pulmonis

Lymphocytic choriomeningitis virus
Ectromelia virus

Mouse pneumonitis virus

Polyoma virus

Mouse adenovirus

Epizootic Diarrhea of Infant Mice virus
Mouse parvovirus

Mouse parvovirus (ELISA)

The colony tested positive for Syphacia spp. and was treated with fenbendazole prior to

the inoculation study.

167

APPENDIX III

SEROLOGY

The Norway rat (Rattus norvegicus) colony was tested and negative for:

SEND Sendai virus

PVM Pneumonia virus of mice

SDAV Sialodacryoadenitis

KRV Kilham rat virus

H1 Toolan’s H-l virus

REO Reovirus

REV Rat enterovirus

MPUL Mycoplasma pulmonis

LCMV Lymphocytic choriomeningitis virus
HAN T Hantaan virus

MAV Mouse adenovirus

ECUN Encephalitozoon cuniculi

CARD Cilia-associated respiratory bacillus
RPV Rat parvovirus
PARASITOLOGY

The colony was tested and negative for numerous but un-narned ectoparasites,

endoparasites and enteric protozoa

168

Norway rats cont’d

BACTERIOLOGY

Rats were tested and negative for Bordatella bronchioseptica, Corynebacterium
kutscheri, Mycoplasma pulmonis, Salmonella spp., Streptobacillus moniliformis,
Helicobacter hepaticus, Helicobacter bilis, Helicobacter spp., Klebsiella pneumoniae,
Klebsiella oxytoca, Pasteurella multocida, Pasteurella pneumotropica, Pasteurella
spp., Streptococcus pneumoniae, Beta Streptoccus groups B & G, Beta Streptococcus
spp.

A few rats tested positive for Pseudomonas aeruginosa and Staphylococcus aureus.

169

APPENDIX IV

Mycobacterial isolation and identification procedure as practiced at the Michigan
Department of Community Health (MDCH), Tuberculosis Laboratory Lansing,
Michigan (Kent & Kubica, 1985, Reisner et al. 1994, Butler et al. 1991).

Tissue samples are ground using a KendallTM sterile disposable 50 cc tissue grinder.
. Decontamination is accomplished using the mucolytic agent N-Actely-L-cysteine
(N ALC) along with a high pH sodium hydroxide/tri-sodium citrate decontaminant. The
digested specimen is concentrated by centrifugation at 5000 g for 15 minutes. The
supernatant is poured off leaving a spun sediment for subsequent testing.

Smears for microscopic evaluation are prepared from the concentrated sediment and
stained using an Auramine-O (A0) fluorescent acid-fast staining method. Smears found
AFB positive by A0 are confirmed using the Ziehl-Neelsen acid-fast staining method.

Preliminary cultures are made as follow (0.5 m1 inoculum/ each):

i. One Lowenstein-Jensen (LJ) medium slant (egg based)
(Becton-Dickinson, Cockeysville, MD)

ii. One Middlebrook 7H11S medium slant (agar based) (Becton-
Dickinson)

These are incubated at 37°C with 5% C02

iii. One BACTEC 123 broth vial (containing MC for radiometric
detection of growth) (Becton-Dickinson, Sparks, MD)

Bactec lZB vials are evaluated twice a week for two weeks then once a week for a

further two weeks.

170

If growth suggestive of Mycobacterium spp. is detected then subcultures (for
identification and susceptibility testing) are inoculated into Middlebrook 7H9 broth
(bead bottles) (Becton-Dickinson) and are incubated for 3-4 days for subsequent
inoculation to a panel of media.

Subcultures are inoculated as follows:

- Four LJ slants; two are inoculated with 6 drops (~ 0.3 ml) from the 7H9 broth,

the other two are inoculated with a 1:100 dilution from the broth

- One LJ deep tube inoculated with 4 drops (~ 0.2 ml) from the 7H9 broth

- One 5% NaCl tube made with 0.3 ml inoculum

- One 7H11 slant made with 0.3 ml inoculum
Antibiotic susceptibility is a concern, usually only for human isolates. Mycobacterial
isolates may be tested for susceptibility to rifampin, streptomycin, isoniazid,
ethambutol and pyrazinamide.

Subcultured plates and slants are evaluated weekly for eight weeks. BACTEC 12B
vials are read twice weekly for two weeks and thereafter at weekly intervals up to eight
weeks. Cultures may be read for up to 12 weeks, if the smear of the specimen is
positive and the culture is negative at 8 weeks of incubation.

Speciation of mycobacteria is accomplished using three methods of identification:
1. Biochemical tests- a major draw back to such tests is that they are very time
consuming
2. Nucleic acid probe utilizing the Accuprobe® Mycobacterium tuberculosis
complex culture identification test (Gen-Probe® San Diego, CA). Samples

for Accuprobe® can be obtained from the 7H11 medium, Lowenstein-Jensen

171

medium or BACTEC vials. The fluorescently labeled DNA probe (for the M
Tb complex) forms a hybrid with the ribosomal RNA from the mycobacteria
(test sample). The DNA-rRNA hybrid fluorescence is detected and then
recorded

3. High-performance liquid chromatography (HPLC): Long chain fatty acids/
mycolic acids are digested into shorter fragments, extracted and then passed
through a column with a stationary phase. As these fatty acids migrate at
different rates the number, height and pattern of the peaks is used to identify
the mycobacteria. The rate of migration through the column is directly
related to differences in the mycolic acid carbon chain fragment length
resulting from unique fragmentation of different Mycobacterium spp.

If strain differentiation is a concern for molecular epidemiologic purposes then the
specimen is submitted to the National Veterinary Services Laboratory, Ames, Iowa for
restriction fragment length polymorphism (RFLP) testing. This is necessary to detect
insertion sequence (IS) 6110 the most important insertion sequence detected in the M

Tb complex.

172

 

APPENDIX V

 

I
Magi sustains!”

PURI%§%O
TURKEY GROW’ER
W/O

A com lets feed for growing turkeys
CA lON: Use Only As Directed.
GUARANTEED ANALYSiS

Crude protein (Min) ................... . ................... 20.000034.
L sine (Min) ............................ . ....................... 1 .0000%

ethicnine (Min) ............................................. 0.420096
Crude {at (Min) .......... . ...................................... 3.0000%
Crude fiber Max) ..................... . ....................... 5.500026
Calcium (Cafi (Min) ......................................... 1.100096
Calcium (Ca Mex) . ..................... . .................. 1.6000374.
Phosphorus ( ) (Min) ..................................... O.BOOO%
Salt (NaCi) (Min) .......................... . .................. 0.200096
Salt (NaCl) (Max) ................. . ........................... 0.700036

lNGREDlElfl’S

Grain products, plant protein products. processed grain
by-products dicalcium phosphate, calcium carbonate,
animal protein products, salt, magnesium sulfate.
potassium sulfate, DL-methicnine, L-lysine, choline
chloride. calcium lignin sultonate. niacin supplement.
calcium panlolhenate, pyridoxlne hydrochloride, biotin,
riboflavin supplement, Vitamin E supplement, vitamin B12

supplement. menadione dimethyipyrlmidinol bieullite

(source of vitamin K). folic acid. vitamin A supplement,
vitamin 0 supplement. manganous oxide, zinc oxide.
copper sugars. calcium iodate, sodium selenite.
O8BH G 8386

DIRECTIONS

Feed as sole ration following Turkey Starter VJ/O Poultry
Feed to turkey toms a total of 23 pounds per bird or
between 8-13 1/2 weeks of age and to turkey hens a total
of 13.5 pounds per bird or between 7 t/2-t t 1/2 weeks ol‘

age.

Important:
A feeding program is only as effective as the
management practices and disease control measures
followed.

173

APPENDIX VI

Rodent Diet

Tekgd 2.2/5 Rodent Diet (W) ..8640

Guaranteed Analysis:

Crude Protein, not less than. ................................................... 22.0%
Crude Fat, not less than ...................................................... 5.0%
Crude Fiber, not more than ................................................. 4.5%
Ingrgdients:

Soybean meal, ground corn, wheat middlings, corn. flakes, fish meal, dried molasses, soybean
oil, ground wheat, dried whey, dicalcium phosphate, dried brewers yeast, calcium carbonate,
iodized salt, choline chloride, vitamin A acetate, vitamin D3 supplement, vitamin E
supplement, niacin, calcium pantothenate, riboflavin, thiamine mononitrate, pyridoxine
hydrochloride, menadione sodium bisulfite complex (source of vitamin K

activity), folic acid, biotin, vitamin BIZ supplement, magnesium oxide,

calcium iodate, cobalt carbonate, chromium potassium sulfate.

174

References

175

REFERENCES

Ackerrnan LJ, Benbrook SC, Waltom BC, 1974: Mycobacterium tuberculosis infection
in a parrot (Amazona farinosa). Am. Rev. Respir. Dis. 109(3): 388-390

Adams LG, 2001: In vivo and in vitro diagnosis of Mycobacterium bovis infection. Rev.
sci. tech. Ofl int. Epiz. 20(1): 304-324

Ainsa JA, Martin C and Gicquel B, 2001: Molecular approaches to tuberculosis. Mol.
Microbiol. 42(2):561-57O

Ashford DA, Whitney E, Raghunathan P and Cosivi O, 2001: Epidemiology of selected
mycobacteria that infect humans and other animals. Rev. sci. tech. Off int. Epiz. 20(1):-
325-337

Barthel R, Piedrathita JA, McMurray DN, Payeur J, Baca D, Suarez Guemes F et al.,
2000: Pathologic findings and association of Mycobacterium bovis infection with the
bovine NRAMP] gene in cattle from herds with naturally occurring tuberculosis. Am. J.
Vet. Res. 61(9): 1140-1144

Bellamy R 1999: The natural resistance-associated macrophage protein and
susceptibility to intracellular pathogens. Microbes. Infect. 1: 23-27

Bengis RG, Kock RA and Fischer J, 2002: Infectious animal diseases: the
wildlife/livestock interface. Rev. sci. tech. OflT int. Epiz. 21(1): 53-65

Bercovier H and Vincent V, 2001: Mycobacterial infections in domestic and wild
animals due to Mycobacterium marinum, M fortuitum, M chelonae, M chelonae, M
porcinum, M farcinogenes, M smegmatis, M smegmatis, M scrofulaceum, M xenopi,
M kansasii, M simiae and M genavense. Rev. sci. tech. Ofif int. Epiz. 20(1): 265-290

Bonner RF, Emmert-Buck M, Cole K, Pohida T, Chuaqui R, Goldstein S and Liotta LA,
1997: Laser capture microdissection: molecular analysis of tissue. Science 278 (5342):
1481-1483

Bosworth TJ 1940: Further observations of the wild rat as a carrier of Brucella abortus.
J. Comp. Pathol. T her. 53: 42-49

Bottger EC, Teske A, Kirschner P, Bost S, Chang HR, Beer V and Hirschel B, 1992:
Disseminated “Mycobacterium genavense” infection in patients with AIDS. Lancet 340:
76-80

Brightbill HD, Libraty DH, Krutzik SR, Yang RB, Belisle JT, Belharski JR et al, 1999:

Host defense mechanisms triggered by microbial lipoproteins through toll-like receptors.
Science 285: 732-736

176

 

Brodin P, Majlessi L, Brosch R, Smith D, Bancroft G, Clark S et al, 2004: Enhanced
protection against tuberculosis by vaccination with recombinant Mycobacterium microti

vaccine that induces T cell immunity against region of difference 1 antigens. J. Infect.
Dis. 190: 115-122

Brosch R, Gordon SV, Marmiesse M, Brodin P, Buchrieser C, Eiglmeier K, et al., 2002:
A new evolutionary scenario for the Mycobacterium tuberculosis complex. Proc. Natl.
Acad. Sci. U S A. 99(6):3684-3689.

Brubaker RR, 1985: Mechanism of bacterial virulence. Ann. Rev. Microbiol. 39: 21-50

Bruning-Fann CS, Schmitt SM, Fitzgerald SD, F ierke JS, Friedrich PD, Kaneene JB et
al, 2001: Bovine tuberculosis in free-ranging carnivores from Michigan. J. Wildl. Dis.
37(1): 58-64

Buddle BM, Aldwell FE, Pfeffer A and de Lisle GW, 1994: Experimental
Mycobacterium bovis infection in brustail possum (T richosurus vulpecula): pathology,
haematology and lymphocyte stimulation responses. Vet. Microbiol. 38(3):241-254

Buschman E and Skamene E, 2001: From Bcg/Lsh/Ity to Nrampl : three decades of
search and research. Drug Metab. Dispos. 29 (4 Pt. 2): 471-473

Butcher PD, Hutchinson NA, Doran TJ and Dale J W, 1996: The application of
molecular techniques to the diagnosis and epidemiology of mycobacterial diseases. Soc.
Appl. Bacterial. Symp. Ser. 81: 538-718

Butler KL, Fitzgerald SD, Berry DE, Church SV, Reed WM and Kaneene JB, 2001:

Experimental inoculation of European starlings (Sturnus vulgaris) and American crows
(Corvus brachrhynchos) with Mycobacterium bovis. Avian Dis. 45:709-718

Butler WR, Jost KC and Kilburn JO, 1991: Identification of mycobacteria by high-
performance liquid chromatography. J. Clin. Microbiol. 29(11): 2468-2472

Canonne-Hergaux F, Gruenheid S, Govoni G and Gros P, 1999: The Nrampl protein
and its role in resistance to infection and Macrophage function. Proc. Assoc. Am.
Physicians 111 (4): 283-289

Cataloluk O, Cakmak EA, Buyukberber N and Barlas O, 2003: Forrnalin fixing and
paraffin embedding may lead to extra band development in PCR. Microbiologica 26:
193-198

Cavangh R, Begon M, Bennett M, Ergon T, Graham IM, deHaas PEW et al, 2002:

Mycobacterium microti infection (vole tuberculosis) in wild rodent populations. J. Clin.
Microbiol. 40(9): 3281-3285

177

Caws M and Drobniewski FA, 2001: Molecular techniques in the diagnosis of
Mycobacterium tuberculosis and the detection of drug resistance. Ann. N. Y. Acad. Sci.
953: 138-145

Chackerian AA and Behar SM, 2003: Susceptibility to Mycobacterium tuberculosis:
lessons from inbred strains of mice. Tuberculosis 83: 279-285

Clifton-Hadley RS and Wilesmith JW, 1991: Tuberculosis in deer: a review. Vet. Rec.
129: 5-12

CNN Interactive 1998: The wild turkey is on the comeback trail. Back from the brink of
extinction. Available at: www.cnn.com/EARTH/9804/07/wild.turlm Last accessed on r
November 30, 2004

Collins CH, 2000: The bovine tubercle bacillus. Br. J. Biomed. Sci 57: 234-240

Collins DM, 2001: Virulence factors of Mycobacterium bovis. Tuberculosis (Edinb)
81(1-2): 97-102

 

Collins DM, Radford AJ, deLisle GW and Billman-Jacobe H, 1994: Diagnosis and
epidemiology of bovine tuberculosis using molecular biological approaches. Vet.
Microbiol. 40: 83-94

Collins HL and Kaufmann SHE, 2001: The many faces of host responses to
tuberculosis. Immunology 103: 1-9

Collins T: Acute and chronic inflammation. In: Cotran RS, Kumar V, Collins T, editors.
Robbins Pathologic Basis of Disease 6th ed. Philadelphia, W.B. Saunders Co.1999:83-84

Copper AM, Adams LB, Dalton DK, Appelberg R and Ehlers S, 2002: IFN-y and NO in
mycobacterial disease: new jobs for old hands. Trends Microbial. 10(5): 221-226

Comer LA and Presidente PJA, 1981: Mycobacterium bovis infection in the brush-tailed
possum (Trichosurus vulpecula): 11 Comparison of experimental infections with an
Australian cattle strain and a New Zealand possum strain. Vet. Microbiol. 6:351-366

Comer LA and Presidente PJA, 1980: Mycobacterium bovis infection in the brush-tailed
possum (T richosurus vulpecula): 1 Preliminary observations of experimental infection.
Vet. Microbiol. 5:309-321

Cosivi O, Grange JM, Daborn CJ, Raviglione MC, F ujikura T, Cousins D et al., 1998:
Zoonotic tuberculosis due to Mycobacterium bovis in developing countries. Emerg.

Infect. Dis. 4(1): 59-70

Cosma CL, Sherman DR and Ramakrishnan L, 2003: The secret lives of pathogenic
mycobacteria. Ann. Rev. Microbiol. 57: 641-76

178

Cousins DV, 2001: Mycobacterium bovis infection and control in domestic livestock.
Rev. sci. tech. Ofif int. Epiz. 20(1): 71-85

Cowley SC and Elkins KL, 2003: CD4+ T cells mediate IFN-y independent control of
Mycobacterium tuberculosis infection both in vitro and in vivo. J, Immunol. 171: 4689-
4699

Curran S, McKay JA, McLeod HL and Murray GI, 2000: Laser Capture Microscopy. J.
Clin. Pathol.: Mol. Pathol. 53 (2): 64-68

Dankner WM, Waeckner NJ, Essey MA, Moser K, Thompson M and Davis CE, 1993: F
Mycobacterium bovis infections in San Diego: A clinicoepidemiologic study of 73

patients and a historical review of a forgotten pathogen. Medicine (Baltimore) 72(1): 11-
37

Dannenberg AM Jr., 2001: Pathogenesis of pulmonary Mycobacterium bovis infection:
basic principles established by the rabbit model. Tuberculosis 81: (1/2): 87-96

 

Dannenberg AM Jr., Bishai WR, Parrish N, Ruiz R, Johnson W, Zook BC et a1 2000:
Efficacies of BCG and vole bacillus (Mycobacterium microti) vaccines in preventing

clinically apparent pulmonary tuberculosis in rabbits: a preliminary report. Vaccine
19:796-800

Dannenberg AM Jr.: Pathophysiology: Basic aspects. In: Schlossberg D, editor.
Tuberculosis and Nontuberculous Mycobacterial Infections 4th ed. Philadelphia, W.B.
Saunders Co.1999217-47

Dannenberg AM Jr. and Rook GAW: Pathogenesis of pulmonary tuberculosis: an
interplay of tissue-damaging and macrophage-activating immune response- dual
mechanisms that control bacillary multiplication. In: Bloom BR, editor. Tuberculosis:
pathogenesis, protection and control. Washington, DC, American Society for
Microbiology Press 1994: 459-483

Dannenberg AM Jr. 1993: Immunopathogenesis of pulmonary tuberculosis. Hosp.
Pract. 28(1): 51-58

Dannenberg AM Jr. 1991: Delayed-type hypersensitivity and cell-mediated immunity in
the pathogenesis of tuberculosis. Immunol. Today 12(7): 228-233

Darzins E: The mouse in experimental tuberculosis. In: The bacteriology of tuberculosis.
Minneapolis, University of Minnesota Press 1958: 340-356

Deinard AS, Lerche NW and Smith DG, 2002: Polymorphism in the Rhesus macaque

(Macaca mulatta) NRAMP] gene: lack of an allelic association to tuberculosis
susceptibility. J. Med. Primatol. 31: 8-16

179

Delahay RJ, De Leeuw ANS, Barlow AM, Clifton-Hadley RS and Cheeseman CL,
2002: The status of Mycobacterium bovis infection in UK wild mammals: a review. Vet.
J. 164: 90-105

de Lisle GW, Bengis RG, Schmitt SM and O’Brien DJ, 2002: Tuberculosis in free-
ranging wildlife: detection, diagnosis and management. Rev. sci. tech. Ofif int. Epiz.
21(2): 317-334

de Lisle GW, Mackintosh CG and Bengis, 2001: Mycobacterium bovis in free-living and
captive wildlife, including farmed deer. Rev. sci. tech. Ofi? Epiz. 20(1): 86-111

Diegel KL, Fitzgerald SD, Berry DE, Church SV, Reed WM, Sikarskie JG and Kaneene
JB, 2002. Experimental inoculation of North American opossums (Didelphis virginiana)
with Mycobacterium bovis. J. Wildl. Dis. 38(2): 275-281

Dungworth DL: The respiratory system. In: Jubb KVF, Kennedy P, Palmer N, editors.
Pathology of Domestic Animals Volume 2, 4th ed. San Diego, Academic Press Inc. 1993:
641-652

Dunn PL and North RJ, 1995: Virulence ranking of some Mycobacterium tuberculosis
and Mycobacterium bovis strains according to their ability to multiply in the lungs,
induce lung pathology, and cause mortality in mice. Infect. Immun. 63(9): 3428-3437

Durr PA, Hewinson RG and Clifton-Hadley RS, 2000: Molecular epidemiology of
bovine tuberculosis I. Mycobacterium bovis genotyping. Rev. sci. tech. Ofl int. Epiz.
19(3):675-688

Eing BR, Becker A, Sohns A and Ringelmann R, 1998: Comparison of Roche Cobas
Amplicor Mycobacterium tuberculosis assay with in-house PCR and culture for
detection of M tuberculosis. J. Clin. Microbiol. 36(7): 2023-2029

Eisenach KD, cave MD, Bates JH and Crawford JT, 1990: Polymerase chain reaction
amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis. J.
Infect. Dis. 161(5): 977-981

Eltoum IA, Siegal GP and Frost AR, 2002: Microdissection of histologic sections: past,
present and future. Adv. Anat. Pathol. 9(5): 316-322

Emmert-Buck MR, Bonner RF, Smith PD, Chuaqui RF, Zhuang Z, Golstein SR, Weiss
RA and Liotta LA, 1996: Laser capture microdissection. Science 274(5289): 998-1001

Essey MA and Koller MA, 1994: Status of bovine tuberculosis in North America. Vet.
Microbiol. 40: 15-22

Falkinham JO, 1996: Epidemiology of infection by nontuberculous mycobacteria. Clin.
Microbiol. Rev. 9(2): 177-215

180

Fend F and Raffeld M, 2000: Laser capture microdissection in pathology. J. Clin.
Pathol. 53 (9): 666-672

Feng J, Hashad M, Schurr E, Gros P, Adams LG and Templeton JW, 1996: Bovine
natural resiatance associated macrophage protein 1(Nramp 1) gene. Genome. Res. 6(10):
956-964

Ferrari G, Langen H, Naito M and Pieters J, 1999: A coat protein on phagosomes
involved in the intracellular survival of mycobacteria. Cell 97: 43 5447

Fischer 0, Matlova L, Bartl J, Dvorska L, Melicharek I and Pavlik I, 2000: Findings of I—
mycobacteria in insectivores and small rodents. F olia Microbiol (Praha) 45(2): 147-152

Fitzgerald SD, Boland KG, Clarke KR, Wismer A, Kaneene JB, Berry DE etal., 2005:
Resistance of Mallard ducks (A nas platyrhynchos) to inoculation with Mycobacterium
bovis. Avian Dis. 49(1): 144-146

 

Fitzgerald SD, Zwick LS, Diegel KL, Berry DE, Church SV, Sikarskie JG et al., 2003a: 3'
Experimental aerosol inoculation of Mycobacterium bovis in North American opossums
(Didelphis virginiana). J. Wildl. Dis. 39(2): 418-423

Fitzgerald SD, Zwick LS, Berry DE, Church SV, Kaneene JB and Reed WM, 2003”:
Experimental inoculation of Pigeons (Columba livia) with Mycobacterium bovis. Avian
Dis. 47: 470-475

Fitzgerald SD, Kaneene JB, Butler KL, Clarke KR, Fierke J S, Schmitt SM et al., 2000:
Comparison of postmortem techniques for the detection of Mycobacterium bovis in
white-tailed deer (Odocoileus virginianus). J. Vet. Diagn. Invest. 12: 322-327

Flynn J L, 2004: Immunology of tuberculosis and implications in vaccine development.
Tuberculosis 84: 93-101

Flynn JL and Chan J, 2001: Immunology of tuberculosis. Annu. Rev. Immunol. 19: 93-
129

Flynn J L, Chan J, Triebold KJ, Dalton DK, Stewart TA and Bloom BR, 1993: An
essential role for interferon y in resistance to Mycobacterium tuberculosis infection. J.
Exp. Med 178:2249-2254

F oudraine NA, van Soolingen D, Noordhoek GT and Reiss P, 1998: Pulmonary
tuberculosis due to Mycobacterium microti in a Human Immunodeficiency Virus-
infected patient. Clin Infect. Dis. 27: 1543-1544

Francis J: Tuberculosis in animals other than bovines. In: Tuberculosis in Animals and
Man A Study in Comparative Pathology. London, Cassell and Co.1958: 237-242

181

Frota CC, Hunt DM, Buxton RS, Rickman L, Hinds J, Kremer K et al., 2004: Genome
structure in the vole bacillus, Mycobacterium microti, a member of the Mycobacterium
tuberculosis complex with low virulence for humans. Microbiology 150: 1519-1527

Frost AR, Eltoum IE, Siegal GP: Nucleic acid amplification from individual cells: laser
capture microdissection. In: Current protocols in molecular biology. New York, Greene
Pub. Assoc. and Wiley International 2001: 25A1.1-25A1.23

Frye GH: Bovine tuberculosis eradication: the program in the United States. In: Thoen
CO and Steele JH, editors. Mycobacterium bovis infection in animals and humans
Ames, Iowa State University Press 1995: 199-129

Fulton RM and Thoen CO: Tuberculosis. In: Saif YM editor. Diseases of Poultry 11th
ed. Ames, Iowa State Press 2003: 836-844

Gallagher J and Clifton-Hadley RS, 2000: Tuberculosis in badgers; a review of the
disease and its significance for other animals. Rev. Vet. Sci. 69: 203-217

Garg SK, Tiwari RP, Tiwari D, Singh R, Malhotra D, Rarnnani VK et al., 2003:
Diagnosis of tuberculosis: available technologies, limitations and possibilities. J. Clin.
Lab. Anal. 17: 155-163

Gamier T, Eiglmeier K, Camus J -C, Medina N, Mansoor H, Pryor M et al., 2003: The
complete genome sequence of Mycobacterium bovis. Proc Natl Acad Sci U S A.
100(13): 7877-7882

Gatfield J and Pieters J, 2000: Essential role for cholesterol in entry of mycobacteria into
macrophages. Science 288: 1647-1650

Ge L, Remmers EF, Du Y and Wilder RL, 1996: Genomic cloning and genetic mapping
Nramp 1 (Bcg) gene on chromosome 9. Mamm. Genome 7(11): 856-857

Glickman MS and Jacobs WR, 2001: Microbial pathogenesis of Mycobacterium
tuberculosis: dawn of a new discipline. Cell 104: 477-485

Goldfeld AE, Delgado JC, Thim S, Bozon MV, Uglialoro AM, Turbay D et al., 1998:
Association of HLA-DQ allele with clinical tuberculosis. JAMA 279(3): 226-228

Goldsworthy SM, Stockton PS, Trempus CS, Foley J F and Maronpot RR, 1999: Effects
of fixation on RNA extraction and amplification from laser capture microdissected
tissue. M01. Carcinog. 25: 86-91

Goswami T, Bhattacharjee A, Babal P, Searle S, Moores E, Li M and Blackwell JM,

2001: Natural-resistance-associated macrophage protein 1 is an H+ fbivalent cation
antiporter. Biochem. J. 354: 51 1-519

182

Govoni G and Gros P, 1998: Macrophage Nramp 1 and its role in resistance to microbial
infections. Inflamm. Res. 47: 277-284

Govoni G, Vidal S, Gauthier S, Skamene E, Malo D and Gros P, 1996: The Bcg/Ity/Lsh
locus: Genetic transfer of resistance to infection in C57BL/6J mice transgenic for the
NrampIG’y’” allele. Infect. Immuun. 64: 2923—2929

Grange JM, 2001: Mycobacterium bovis infection in human beings. Tuberculosis
81(1/2): 71-77

Grange JM: Human aspects of Mycobacterium bovis infection. In: Thoen C0 and Steele
JH, editors. Mycobacterium bovis infection in animals and humans Ames, Iowa State
University Press 1995: 29-46

Grange JM and Yates MD, 1994: Zoonotic aspects of Mycobacterium bovis infection.
Vet. Microbiol. 40:137-151

Grant K and Jerome WG, 2002: Laser capture microdissection as an aid to
ultrastructural analysis. Microsc. Microanal. 8 (3):l70—175

Griffin JF T and Mackintosh CG, 2000: Tuberculosis in deer: perception, problems and
progress. Vet. J. 160: 202-219

Griffin JF T, Mackintosh CG and Buchan GS, 1995: Animal models of protective
immunity in tuberculosis to evaluate candidate vaccines. Trends Microbial. 3(11): 418-
424

Griffin JFT and Buchan GS, 1994: Aetiology, pathogenesis and diagnosis of
Mycobacterium bovis in deer. Vet. Microbiol. 40: 193-205

Griffith AS, 1941: Further experiments on the field vole with tubercle bacilli. J. Hyg.
(Land) 41: 250-259

Griffith AS, 1939: The relative susceptibility of the field vole to the bovine, human and
avian types of tubercle bacilli and to the vole strain of acid-fact bacillus (Wells, 193 7):
J. Hyg. (Lond) 39:244-259

Griffith AS, 1937: Experimental tuberculosis in field voles and mice. Vet. Rec. 49: 982-
984

Griffith AS, 19073: Inoculation experiments on rats with tuberculous material of bovine
origin. Roy. Com. Tuberc. 2"" Int. Rep., Pt. 11, App. V01 1. 481-490, 633, 692-693

Griffith AS, 1907b: Inoculation experiments on mice with tuberculous material of bovine
origin. Roy. Com. Tuberc. 2'“ Int. Rep., Pt. II, App. V01 1. 491-496

183

Gruenheid S, Pinner E, Desjardins M and Gros P, 1997: Natural resistance to infection
with intracellular pathogens: The Nramp 1 protein is recruited to the membrane of the
phagosome. J. Exp. Med. 185(4): 717-730

Hancox, M, 1996: Rats and Tb misunderstood [letter]. Ir. Vet. J. 49 (4):206

Hehre E and Freund J, 1939: Sensitization, antibody formation and lesions produced by
tubercle bacilli in the albino rat. Arch. Pathol. 27: 289-306

Hill J, 2005: Wildlife cattle interactions in northern Michigan: Implications for the
transmission of bovine tuberculosis. MS. Thesis. Logan, Utah: Utah State University (in
press)

Hines ME, Kreeger JM and Herron AJ, 1995: Mycobacterial infections of animals:
pathology and pathogenesis. Lab. Anim. Sci. 45 (4): 334-351

Hinshaw WR, 1933: Tuberculosis of human origin in an Amazon parrot. Am. Rev.
Tuber. 28: 273-278

Hirshel B, Chang HR, Mach N, Piguet PF, Cox J, Piguet JD et al., 1990: Fatal infection
with a novel, unidentified mycobacterium in a man with the acquired immunodeficiency
syndrome. N. J. Eng]. Med. 323(2): 109-113

Hoefer HL, Kiehn TE and Friedan TR, 1996: Systemic Mycobacterium tuberculosis in a
green-winged macaw. In Proceedings of the Annual Conference of the Association of
Avian Veterinarians. p. 167-168

Honore-Bouakline S, Vincensini JP, Giacuzzo V, lagrange PH and Herrmann JL, 2003:
Rapid diagnosis of extrapulmonary tuberculosis by PCR: Impact of sample preparation
and DNA extraction. J. Clin. Microbiol 41(6): 2323-2329

Hoop RK, 2002: Mycobacterium tuberculosis infection in a canary (Serinus canaria L.)
and a blue-fronted Amazon parrot (Amazona amazona aestiva). Avian Dis. 46: 502-504

Hoop RK, Bottger EC and Pfyffer GE, 1996: Etiological agents of mycobacterioses in
pet birds between 1986 and 1995. J. Clin. Microbiol. 34(4) 991-992

Hoop RK, Bottger EC, Ossent P and Salfinger M, 1993: Mycobacteriosis due to
Mycobacterium genavense in six pet birds. J. Clin. Microbiol. 31(4): 990-93

Hopkins BA, Skeeles JK, Houghten GE, Slagle D and Gardner K, 1990: A survey of

infectious diseases in wild turkeys (Meleagridis gallopavo silvestris) from Arkansas. J.
Wildl. Dis. 26(4): 468-472

Houde C and Dery P, 1988: Mycobacterium bovis sepsis in an infant with
immunodeficiency virus infection. Pediatr. Infect. Dis. J. 7(11): 810-812

184

Hsu T, Hingley-Wilson SM, Chen B, Chen M, Diaz AZ, Morin PM etal., 2003: The
primary mechanism of bacillus Calmette-Guerin is a loss of secreted lytic function

required for invasion of lung interstitial tissue. Proc. Natl. Acad. Sci USA 100(21):
12420-5

Huggett JF, McHugh TD and Zumla A, 2003: Tuberculosis: amplification-based clinical
diagnostic techniques. Int. J. Biochem. Cell Biol. 35: 1407-1412

J espersen A, 1977“: Infection of Clethrionomys g. glareolus Schreb. (red mice) with
Mycobacterium tuberculosis and Mycobacterium bovis injected subcutaneously. Acta.
path. microbial. scand. Sect B 85: 329-333

J espersen A, 1977b: Infection of Clethrionomys g. glareolus Schreb. (red mice) with
Mycobacterium tuberculosis and Mycobacterium bovis injected intraperitoneally. Acta.
path. microbial. scand. Sect B 85: 397-402

Jespersen A, Weis Bentzon M and Moller S, 1977°: Infection of Clethrionomys g.
glareolus Schreb. (red mice) with Mycobacterium bovis injected intravenously. Acta.
path. microbial. scand. Sect B 85: 415-426

J espersen A, 1976: Multiplication of Mycobacterium tuberculosis and Mycobacterium
bovis in Microtus agrestis (field vole). Acta. path. microbial. scand. Sect B 84: 57-60

J espersen A, 1975‘: Infection of Microtus arvalis (common vole) with Mycobacterium
tuberculosis and Mycobacterium bovis. Acta. path. microbial. scand. Sect B 83: 201-210

J espersen A, 1975b : Bacteremia in red mice (Clethrionomys g. glareolus Schreb.) after
intraperitoneal injection of large doses of tubercle bacilli. Acta. path. microbial. scand.
Sect B 83: 211-218

J espersen A, 1974: Infection of Arvicola terrestris (vole rat) with M tuberculosis and M
bovis. Acta. path. microbial. scand. Sect B 82: 667-675

Jullien D, Stenger S, Ernst WA and Modlin RL, 1997: CD1 presentation of microbial
nanopeptide antigens to T cells. J. Clin. Invest. 99(9): 2071-2074

Kaneene JB, VanderKlok M, Bruning-Fann CS, Palmer MV, Whipple DL, Schmitt SM
and Miller R, 2002: Prevalence of Mycobacterium bovis infection in cervids on privately
owned ranches. J. Am. Vet. Med. Assoc. 220 (5): 656-659

Karlson AG and Lessel EF, 1970: Mycobacterium bovis nom. nov. Int. .1. Syst.
Bacteriol. 20: 273-228

Kaufmann SHE, 2004: New issues in tuberculosis. Ann. Rheum. Dis. 63(Suppl II): ii50-
ii56

185

Kaufinann SHE, 2002: Protection against tuberculosis: cytokines, T cells, and
macrophages. Ann. Rheum. Dis. 61(Suppl II):ii54-ii58

Kaufmann SHE, 2001: How can immunology contribute to the control of tuberculosis?
Nat. Rev. Immunol. 1: 20-30

Kent PT and Kubica GP, 1985: Public health mycobacteriology. A guide for the level
III laboratory. US. Department of Health and Human Services, Atlanta, Georgia 207

PP-

Kiehn TE, Hoefer H, Bottger EC, Ross R, Wong M, Edwards F et al., 1996:
Mycobacterium genavense infection in pet animals. J. Clin. Microbiol. 34(7): 1840-1842

Kirchheimer WF, Hess AR, Williston EH and Youmans GP, 1950: Isolation of tubercle
bacilli from feces and gastric contents of intravenously infected mice. Am. Rev. Tuber.
62: 481-483

Kramnik I and Boyartchuk V, 2002: immunity to intracellular pathogens as a complex
genetic trait. Curr. Opin. Microbial. 5(1):1 1 1-1 17

Kramnik I, Dietrich WF, Dermant P and Bloom BR, 2000: Genetic control of resistance
to experimental infection with virulent Mycobacterium tuberculosis. Proc. Natl. Acad.
Sci USA. 97(15): 8560-8565

Kremer K, van Soolingen D, van Embden J, Hughes S, Inwald J and Hewinson G, 1998:
Mycobacterium microti: more widespread than previously thought. J. Clin. Microbiol.

36(9): 2793-2794

Kobayashi K, Kaneda K and Kasarna T, 2001: Immunopathogenesis of delayed-type
hypersensitivity. Micros. Res. Tech. 53: 241-245

Koch R, 1932: Die aetiologie der tuberculose .Am. Rev. Tuberc. 25: 285-323
[Translated from the original 1882 article by Berna Pinner and Max Pinner.]

Koch R, 1897: Uber neue Tuberkulinpraparate. Dtsch. Med. Wochenschr. 14: 209-213

Koch R, 1891:Weitere Mitteilung uber das Tuberkulin. Dtsch. Med. Wochenschr. 43:
1 1 89-1 192

Koch R, 1882: Die aetiologie der tuberculose. Berliner Klin Wochenschr. 19:221-230
Lagrange PH: Cell-mediated immunity and delayed-type hypersensitivity. In: Kubica

GP, Wayne LG, editors. The Mycobacteria A Sourcebook Part B. New York, Marcel
Dekker, Inc 1984: 681-720

186

Lefford MJ: Diseases in mice and rats. In: Kubica GP, Wayne LG, editors. The
Mycobacteria A Sourcebook Part B. New York, Marcel Dekker, Inc 1984: 947-977

Lees VM, 2004: Learning from outbreaks of bovine tuberculosis near Riding Mountain
National Park: Application to a foreign animal disease outbreak. Can. Vet. J. 45: 28-34

Lees VW, Copeland S and Rousseau P, 2003: Bovine tuberculosis in elk (Cervus
elaphus manitabensis) near Riding Mountain National Park, Manitoba, from 1992 to
2002. Can. Vet. J. 44(10): 830-831

Little TWA, Swan C, Thompson HV and Wilesmith J W, 1982: Bovine tuberculosis in
domestic and wild mammals in an area of Dorset III. The prevalence of tuberculosis in
mammals other than badgers and cattle. J. Hyg. (Land) 89(2): 225-34

Long R, Light B and talbot JA, 1999: Mycobacteriocidal action of exogenous nitric
oxide. Antimicrob. Agents Chemother. 43(2): 403-405

Mackintosh CG, Qureshi T, Waldrup K, Labes RE, Dodds KG and Griffin JF T, 2000:
Genetic resistance to experimental infection with Mycobacterium bovis in red deer
(Cervus elaphus). Infect. Immun. 68(3): 1620-1625

Manabe YC, Scott CP and Bishai WR, 2002: Naturally attenuated, orally administered
Mycobacterium microti as a tuberculosis vaccine is better than subcutaneous
Mycobacterium bovis BCG. Infect. Immun. 70(3): 1566-1570

McCullough J, 2001: “Meleagris gallopavo” (On-line), Animal Diversity Web.
Available at
www.animaldiversity.ummz.umich.edu/site/accounts/information/Meleagris gallopavo.
m Last accessed on November 30, 2004

McMurray DN, 2001: Disease model. Pulmonary tuberculosis. Trends Mal. Med. 7(3):
135-137

Medina E and North RJ, 1998: Resistance ranking of some common inbred mouse
strains to Mycobacterium tuberculosis and relationship to major histocompatibility
complex haplotype and Nrampl genotype. Immunology 93(2): 270-274

Medina E and North RJ 1996“: The Bcg gene (Nrampl) does not determine resistance of
mice to virulent Mycobacterium tuberculosis. Ann. NY. Acad Sci. 797: 257-259

Medina E and North RJ 1996”: Evidence inconsistent with a role for Bcg gene (Nrampl )
in resistance of mice to infection with virulent Mycobacterium tuberculosis. J. Exp.
Med. 183: 1045-1051

Mehrotra J and Bishai WR, 2001: Regulation of virulence genes in Mycobacterium
tuberculosis. Int. J. Med. Microbial. 291(2): 171-182

187

Menzies FD and Neill SD, 2000: Cattle-to-cattle transmission of bovine tuberculosis.
Vet. J. 160: 92-106

Michalak K, Austin C, Diesel S, Bacom JM, Zimmerman P and Maslow JN, 1998:
Mycobacterium tuberculosis infection as a zoonotic disease: transmission between
humans and elephants. Emerg. Infect. Dis. 4: 283-287

Miller BH, Fratti RA, Poschet JF, Timmins GS, Master SS, Burgos M et al. 2004:
Mycobacteria inhibit nitric oxide synthase recruitment to phagosomes during
macrophage infection. Infect. Immun. 72(5): 2872-2878 F'-

Miller JM, Jenny AL and Payeur JB, 2002: Polymerase chain reaction detection of
Mycobacterium tuberculosis complex and Mycobacterium avium organisms in formalin-
fixed tissues from culture-negative ruminants. Vet. Microbial. 87: 15-23

Miller J, Jenny A, Rhyan J, Saari D and Suarez D, 1997: Detection of Mycobacterium
bovis in formalin-fixed, paraffin-embedded tissues of cattle and elk by PCR _
amplification of 186110 sequence specific for Mycobacterium tuberculosis complex '-
organisms. J. Vet. Diagn. Invest. 9: 244-249

 

Miller R, Kaneene JB, Fitzgerald SD and Schmitt SM, 2003: Evaluation of the influence
of supplemental feeding of white-tailed deer (Odocoileus virginianus) on the prevalence
of bovine tuberculosis in the Michigan wild deer population. J. Wildl. Dis. 39(1): 84-95

Moda G, Daborn CJ, Grange JM and Cosivi O, 1996: The zoonotic importance of
Mycobacterium bovis. Tuber. Lung Dis. 77: 103-108

Monack DM, Mueller A and Falkow S, 2004: Persistent bacterial infections: the
interface of the pathogen and the host immune system. Nat. Rev. Microbial. 2: 747-765

Montali RJ, Mikota SK and Cheng L1, 2001. Mycobacterium tuberculosis in 200 and
wildlife species. Rev. sci. tech. Ofl int. Epiz. 20(1): 291-303

Montali RJ, 1988: Comparative pathology of inflammation in the higher vertebrates
(reptiles, birds and mammals). J. Comp. Path. 99: 1-26

Montali RJ, Bush M, Thoen CO and Smith E, 1976: Tuberculosis in captive exotic birds.
J. Am. Vet. Med Assoc 169(9):920-927

Morris RS, Pfeiffer DU and Jackson R, 1994: The epidemiology of Mycobacterium
bovis infections. Vet. Microbiol. 40: 153-177

Mouges T, Goodrich ME, Ryan L, LaCourse R and North RJ, 2001: The relative

importance of T cell subsets in immunity and immunopathology of airborne
Mycobacterim tuberculosis infection in mice. J. Exp. Med. 193(3): 271-280

188

Nakanaga K, Maeda S, Myojin Y, Xu DL and Goto Y, 1999: Sequence analysis and
expression of Nramp-1 gene in Bcgr and Bcgs mice. J. Vet. Med. Sci. 61 (6): 717-720

National Wildlife Federation, enature. Available at
www.enature.com/fieldguide/showSpecies. Last accessed on March 22, 2005

 

Neill SD, Pollock JM, Bryson DB and Hanna J, 1994: Pathogenesis of Mycobacterium
bovis infection in cattle. Vet. Microbiol. 40: 41-52

Nelson AM, 1999: The cost of disease eradication. Smallpox and Bovine tuberculosis.
Ann. N Y Acad. Sci. 894283-91.

Newport MJ, Huxley CM, Huston S, Hawrylowicz CM, Oostra BA, Williamson R and

Levin M, 1996: A mutation in the interferon-y-receptor gene and susceptibility to
mycobacterial infection. N. Engl. J. Med. 335(26): 1941-1949

Niemann S, Richter E, Dalugge-Tamm H, Schlesinger H, Graupner D, Konigstein B et
al, 2000: Two cases of Mycobacterium microti- derived tuberculosis in HIV-negative
immunocompetent patients. Emerg. Infect. Dis. 6(5): 539-542

North RJ and Jung Y, 2004: Immunity to tuberculosis. Annu. Rev. Immunol. 22: 599-623

North RJ, LaCourse R, Ryan L and Gros P, 1999: Consequence of Nrampl deletion to
Mycobacterium tuberculosis infection in mice. Infect. Immun. 67(11): 5811-5814

North RJ and Medina E, 1998: How important is NRAMP] in tuberculosis? Trends
Microbial. 6(1 1): 441-443

Nozaki Y, Hasegawa Y, Ichiyama S, Nakashima I and Shimokata K, 1997: Mechanism
of nitric oxide-dependent killing of Mycobacterium bovis BCG in human alveolar
macrophages. Infect. Immun. 65(9): 3644-3647

O’Brien DJ, Schmitt SM, Berry DE, Fitzgerald SD, Vanneste JR, Lyon TJ et al., 2004:
Estimating the true prevalence of Mycobacterium bovis in hunter-harvested white-tailed
deer in Michigan. J. Wildl. Dis. 40(1): 42-52

O’Brien DJ, Fitzgerald SD, Lyon TJ, Butler KL, Fierke KS, Clarke KR et al, 2001:
Tuberculous lesions in free-ranging white-tailed deer in Michigan. J. Wildl. Dis. 37(3):
608-613

Oddo M, Renno T, Attinger A, Bakker T, MacDonald HR and Meylan PRA, 1998: Fas

ligand-induced apoptosis of infected human macrophages reduces the viability of
intracellular Mycobacterium tuberculosis. J. Immunology 160: 5448-5454

189

Oevermann A, Pfyffer GE, Zanolari P, Meylan M and Robert N, 2004: Generalized
tuberculosis in llamas (Lama glama) due to Mycobacterium microti. J. Clin. Microbial.
42(4): 1818-1821

O’Reilly LM and Daborn CJ, 1995: The epidemiology of Mycobacterium bovis
infections in animals and man: a review. Tuber. Lung Dis. 76 Supplement 1: 1-46

Orme IM 2003: The mouse as a useful model of tuberculosis. Tuberculosis 83: 112-115

Orme IM, McMurray DN and Belisle JT, 2001: Tuberculosis vaccine development:
recent progress. Trends Microbial. 9(3): 115-118

Palmer MV, Waters WR and Whipple DL, 2004“: Investigation of the transmission of
Mycobacterium bovis from deer to cattle through indirect contact. Am. J. Vet. Res.
65(11): 1483-1489

Palmer MV, Waters WR and Whipple DL, 2004”: Shared feed as a means of deer-to-
deer transmission of Mycobacterium bovis. J. Wildl. Dis. 40(1): 87-91

Palmer MV, Gosch G, Lyon R, Waters WR and Whipple DL, 2002“: Apoptosis in lymph
node granulomas from white-tailed deer (Odocoileus virginianus) experimentally
infected with Mycobacterium bovis. J. Comp. Path. 127: 7-13

Palmer MV, Waters WR and Whipple DL, 2002b: Lesion development in white-tailed
deer (Odocoileus virginianus) experimentally infected with Mycobacterium bovis. Vet.
Pathol. 39: 334-340

Palmer MV, Waters WR and Whipple DL, 2002c: Susceptibility of raccoons (Procyon
lotor) to infection with Mycobacterium bovis. J. Wildl. Dis. 38(2): 266-274

Palmer MV and Waters RW, 2001: Experimental deer-to-deer transmission of
Mycobacterium bovis. Am. J. Vet. Res. 62: 692-696

Palmer MV, Whipple DL, Payeur JB, Alt DP, Esch KJ, Bruning-Fann CS et al., 2000:
Naturally occurring tuberculosis in white-tailed deer. JA VII/LA 216(12): 1921-1924

Pechere M, Opravil M, Wald A, Chave JP, Bessesen M, Sievers A, Hein R, von
Overbeck J, Clark RA, Tortoli E et al, 1995: Clinical and epidemiologic features of
infection with Mycobacterium genavense. Swiss HIV cohort study. Arch. Intern. Med.

155(4): 400-404
Peterson MJ, Aguirre R, F erro PJ, Jones DA, Lawyer TA, Peterson MN and Silvy NJ,

2002: Infectious disease survey of Rio Grande wild turkeys in the Edwards Plateau of
Texas. J. Wildl. Dis. 38(4): 826-833

190

 

Pfyffer GE, 1999: Nucleic acid amplification for mycobacterial diagnosis. J. Infect. 39:
21-26

Phillips CJC, Foster CRW, Morris PA and Teverson MR, 2003: The transmission of
Mycobacterium bovis infection to cattle. Res. Vet. Sci. 74(1): 1-15

Pieters J and Gatfield J, 2002: Hijacking the host: survival of pathogenic mycobacteria
inside macrophages. Trends Microbial. 10(3): 142-146

Pillai SD, Widmer KW, Ivey LJ, Coker KC, Newman E, Lingsweiler S, Baca D, Kelley
M, Davis DS, Silvy NJ and Adams LG, 2000: Failure to identify non-bovine reservoirs
of Mycobacterium bovis in a region with a history of infected dairy-cattle herds. Prev.
Vet. Med. 43: 53-62

Pollock JM and Neill SD, 2002: Mycobacterium bovis infection and tuberculosis in
cattle. Vet. J. 163: 115-127

Portaels F, Realini L, Bauwens L, Hirschel B, Meyers WM and De Meurichy W, 1996:
Mycobacteriosis caused by Mycobacterium genavense in birds kept in a zoo: ll-year
survey. J. Clin. Microbiol. 34(2): 319-323

 

Preheim, LC: Other nontuberculosis mycobacteria and Mycobacterium tuberculosis. In:
Schlosberg D, editor. Tuberculosis and nontuberculous mycobacterial infections 4th ed.
Philadelphia, W.B. Saunders Co.1999: 400

Pritchard DG 1988: A century of bovine tuberculosis 1888-1988: conquest and
controversy. J. Comp. Path. 99: 357-399

Quinn FD, Newman GW and King CH, 1996: Virulence determinants of
Mycobacterium tuberculosis. Curr. Top. Microbial. Immunol. 215: 131-156

Quinn JF and Towar D. Tuberculosis problems at a deer park in Michigan. In
Proceedings of the 100th Annual Meeting of the American Veterinary Medical
Association 1963 pp262-264

Raleigh GW and Youmans GP, 1948: The use of mice in experimental chemotherapy of
tuberculosis. J. Infect. Dis. 82: 197-204

Rankin JD and McDiarmid A, 1968: Mycobacterial infections in free-living wild
animals. Symp. 2001. Sac. Land 24: 119-131

Rastogi N, Legrand E and Sola C, 2001: The mycobacteria: an introduction to
nomenclature and pathogenesis. Rev. sci. tech. Off int. Epiz. 20(1): 21-54

l9l

Ratcliffe HL and Palladino VS, 1953: Tuberculosis induced by droplet nuclei infection.
Initial homogeneous response of small mammals (rats, mice, guinea pigs and hamsters)

to human and bovine bacilli and the rate and pattern of tubercle development. J. Exp.
Med 97 : 61-68

Ratcliffe HL, 1952: Tuberculosis induced by droplet nuclei infection. Pulmonary
tuberculosis of predetermined initial intensity in mammals. Amer. J. of Hyg. 55: 36-48

Realini L, De Ridder K, Hirschel B and Portaels F, 1999: Blood and charcoal added to
acidified agar promote the growth of Mycobacterium genavense. Diag. Microbial.
Infect. Dis. 34(1): 45-50 W

Rhyan J C and Saari DA, 1995: A comparative study of the histologic features of bovine E
tuberculosis in cattle, fallow deer (Dama dama), sika deer (Cervus Nippon), and red deer .‘l'
and elk (Cervus elaphus). Vet. Pathol. 32: 215-220 is

Rhyan JC, Saari DA, Williams ES, Miller MW, Davis AJ and Wilson AJ, 1992: Gross
and microscopic lesions of naturally occurring tuberculosis in a captive herd of wapiti
(Cervus elaphus nelsoni) in Colorado. .1. Vet. Diagn. Invest. 4: 428-433

 

Roj as-Espinosa O andLovik M, 2001: Mycobacterium leprae and Mycobacterium
lepraemurium infections in domestic and wild animals. Rev. sci. tech. Ofif int. Epiz.
20(1): 219-251

Russell DG, 2001: Mycobacterium tuberculosis: here today, and here tomorrow. Nat.
Rev. Mol. Cell. Biol. 2(8): 569-577

Russell DG, Dant J and Sturgill-Koszycki S, 1996: Mycobacterium avium and
Mycobacterium tuberculosis- containing vacuoles are dynamic, fusion-competent

vesicles that are accessible to glycosphingolipids from the host cell plasmalemma. J.
Immunol. 156: 4764-73

Sainsbury AW: Rodentia (rodents). In:Fowler ME and Miller RE editors. Zoo and Wild
Animal Medicine. 5 ‘h ed.St Louis, Saunders 2003: 420- 442

Sakamene E, Schurr E and Gros P, 1998: Infection genomics: Nramp 1 as a major

determinant of natural resistance to intracellular infections. Annu. Rev. Med 49: 275-
287

Sakamene E, 1994: The Bcg gene story. Immunobial. 119 (4-5): 451-460

Saunders BM and Cooper AM, 2000: Restraining mycobacteria: Role of granulomas in
mycobacterial infections. Immunol. Cell Biol. 78: 334-341

192

Schaible UE, Winau F, Sieling PA, Fischer K, Collins HL, Hagens K et al., 2003:
Apoptosis facilitates antigen presentation of lymphocytes through MHC-1 and CD1 in
tuberculosis. Nat. Med 9(8): 1039-1046

Schaible UE and Kaufmann SHE, 2000: CD1 and CD1-restricted T cells in infections
with intracellular bacteria. Trends Microbiol. 8: 419-425

Schaible UE, Sturgill-Koszycki S, Schlesinger PH and Russel DG, 1998: Cytokine
activation leads to acidification and increases maturation of Mycobacterium avium-
containing phagosomes in murine macrophages. J. Immunol. 160:1290-1296

Schmitt SM, Fitzgerald SD, Cooley TM, Bruning-Fann CS, Sullivan L, Berry D et al,
1997: Bovine tuberculosis in free-ranging white-tailed deer from Michigan. J. Wildl.
Dis. 38(2): 275-281 E

Schneider BG, 2004: Principles and practical applications of laser capture
microdissection. J. Histatechnol. 27(1): 69-78

 

Scott Algood HM, Chan J and Flynn JL, 2003: Chemokines and tuberculosis. Cytokine
Growth Factor Rev. 14: 467-477

Seibert F B and Munday B, 1932: The chemical composition of the active principle of
tuberculin. Xv. A precipitated purified tuberculin protein suitable for the preparation of a
standard tuberculin. Am. Rev. Tuberc. 25: 727-737

Selva E, Hofinan V, Berto F, Musso S, Castillo L, Santini J et al, 2004: The value of
polymerase chain reaction detection of Mycobacterium tuberculosis in granulomas
isolated by laser capture microdissection. Pathology 36(1): 77-81

Serth J, Kuczyk MA, Paeslack U, Lichtinghagen R and Jonas U, 2000: Quantitation of
DNA extracted after micropreparation of cells from frozen and formalin-fixed tissue
sections. Am. J. Pathol. 156(4): 1189-1196

Simone NL, Bonner RF, Gillespie JW, Emmert-Buck MR and Liotta LA, 1998: Laser-
capture microdissection: opening the microscopic frontier to molecular analysis. Trends

Genet. 14(7): 272-276

Skinner MA, Wedlock DN and Wedlock BM, 2001: Vaccination of animals against
Mycobacterium bovis.. Rev. sci. tech. 01?? int. Epiz. 20(1): 112-132

Smith I, 2003: Mycobacterium tuberculosis pathogenesis and molecular determinants of
virulence. Clin. Microbiol. Rev. 16(3): 463-496

Smith SM and Dockrell HM, 2000: Role of CD8+ T cells in mycobacterial infections.
Immunol. Cell Biol. 78: 325-333

193

Smith T, 1898: A comparative study of bovine tubercle bacilli and of human bacilli from
sputum. J. Ex. Med 3:451-511

Soini H and Musser JM, 2001: Molecular diagnosis of mycobacteria. Clin. Chem. 47(5):
809-814

Srinivasan M, Sedmak D and Jewell S, 2002: Effect of fixatives and tissue processing on
the content and integrity of nucleic acids. Am. J. Pathol. 161: 1961-1971

Stenger S and Modlin RL, 1999: T cell mediated immunity to Mycobacterium
tuberculosis. Curr. Opin. Microbiol. 2: 89-93

Stenger S, Mazzaccaro RJ, Uyemura K et al. 1997: Differential effects of cytolytic T cell
subsets on intracellular infection. Science 276: 1684-1687

Suarez-Quain CA, Goldstein SR, Pohida T, Smith PD, Peterson JI, Wellner E et al.,
1999. Laser capture microdissection of single cells from complex tissues. Bio Techniques
26 (2): 328-335

Sugawara I, Yamada H and Mizuno S, 2004: Pathological and immunological profiles of
rat tuberculosis. Int. J. Exp. Path. 85: 125-134

Suzuki K, Matsui H, Hasumi M, Ono Y, Nakazato H, Koike H et al., 2001: Gene
expression profiles in human BPH: utilization of laser capture microdissection and
quantitative real-time PCR. Anticancer Res. 21: 3861-3 864

Tell LA, Woods L and Cromie RL, 2001: Mycobacteriosis in birds. Rev. sci. tech. Off
int. Epiz. 20: 180-203

Thoen CO and Chiodini RJ,: Mycobacterium. In: Gyles CL and Thoen CO, editors.
Pathogenesis of bacterial infections in animals 2Ind ed. Ames, Iowa State University
Press 1993: 44-56

Thoen CO, Quinn WJ, Miller LD, Stackhouse LL, Newcomb BF and Ferrell JM, 1992:
Mycobacterium bovis infection in North American elk (Cervus elaphus). J. Vet. Diagn.
Invest. 4: 423-427

Thoen CO and Himes EM, 1986: Pathogenesis of Mycobacterium bovis infection. Prag.
Vet. Immun. vol 2 pp 198-214.

Thoen CO, Richards WD and Jarnagin J L, 1977: Mycobacteria isolated from exotic
animals. J. Am. Vet. Med. Assoc 170(9): 987-990

Thoma-Uszynski S, Stenger S, Takeuchi O et al, 2001: Induction of direct antimicrobial
activity through mammalian toll-like receptors. Science 291 : 1544-1547

194

Thorns CJ, Morris JA and Little TWA, 1982: A spectrum of immune response and
pathological conditions between certain animal species to experimental Mycobacterium
bovis infection. Br. J. Exp. Path. 63(5): 562-572

Timoney JF, Gillespie JH, Scott FW and Barlough JE: The genus Mycobacterium. In:
Hagen and Bruner ’s Microbiology and Infectious Diseases of Domestic Animals 8th
edn.New York, Cornell University Press 1988: 270-289

Turner OC, Keefe RG, Sugawara I, Yamada H and Orme IM, 2003: SWR mice are
highly susceptible to pulmonary infection with Mycobacterium tuberculosis. Infect.
Immun. 71(9): 5266-5272

Turner J, Gonzales-Juarrero M, Saunders BM, Brooks JV, Marietta P, Ellis DL et al.,

2001: Immunological basis for reactivation of tuberculosis in mice. Infect. Immun.
69(5): 3264-3270

Ulukanligil M, Aslan G and Tasci S, 2000: A comparative study of the different staining
methods and number of specimens for‘the detection of acid fast bacilli. Mem. Inst.
Oswaldo Cruz 95(6): 855-858

United States Animal Health Association (USAHA).2003 Committee Reports. Report of
the committee on tuberculosis. Available at: www.usaha.org/reports/reportsO3/r03tb
Last accessed on November 8, 2004

van Crevel R, Ottenhoff THM and van der Meer J WM, 2002: Innate immunity to
Mycobacterium tuberculosis. Clin. Microbiol. Rev. 15(2): 294-309

vanDerHeyden N, 1997: Clinical manifestations of mycobacteriosis in pet birds..
Seminars in Avian and Exotic Pet Medicine 6(1): 1 8-24

van Soolingen D 2001: Molecular epidemiology of tuberculosis and other mycobacterial
infections: main methodologies and achievements. J. Intern. Med 249: 1-26

van Soolingen D, van der Zaden AGM, de Haas PEW, Noordhoek GT, Kiers A,
Foudraine NA et al., 1998: Diagnosis of Mycobacterium microti infections among
humans using novel genetic markers. J. Clin. Microbial. 36(7): 1840-1845

Vergne I, Chua J, Singh and Deretic V, 2004: Cell biology of Mycobacterium
tuberculosis phagosome. Annu. Rev. Cell Dev. Biol. 20: 367-394

Vidal S, Tremblay ML, Govoni G, Gauthier S, Sebastiani G, Malo D et al, 1995: The
Ity/Lsh/Bcg locus: Natural resistance to infection with intracellular parasites is abrogated
by disruption of the Nramp] gene. J. Exp. Med 182: 655-666

Wallach JD and Boever WJ: Rodents and Lagomorphs. In: Diseases of exotic animals:
medical and surgical management. Philadelphia, W.B. Saunders Co. 1983: 134 — 195

195

Wards BJ, Collins DM and de Lisle GW, 1995: Detection of Mycobacterium bovis by
polymerase chain reaction. Vet. Microbiol. 43: 227-240

Washko RM, Hoefer H, Kiehn TE, Armstrong D, Dorsinville G and Frieden TR, 1998:
Mycobacterium tuberculosis infection in a green-winged macaw (Ara chloroptera):
Report with public health implications. J. Clin. Microbiol. 36(4):]101-1102

Watterson SA and Drobniewski FA, 2000. Modern laboratory diagnosis of
mycobacterial infections. J Clin. Pathol. 53: 727-732

Webb T, 2000: Laser capture microdissection comes into mainstream use. J. Nal.
Cancer Inst. 92 (21): 1710-1711

Wedlock DN, Skinner MA, deLisle GW and Buddle BM, 2002: Control of
Mycobacterium bovis infections and the risk to human populations. Microbes Infect.
4: 471-480

Wells AQ, 1938: The susceptibility of voles to human and bovine strains of tubercle
bacilli. Br. J. Ex. Path. 19: 324-328

Wells AQ and Oxon DM, 1937: Tuberculosis in wild voles. Lancet 232: 1221

Wessels CC, 1941“: Tuberculosis in the rat 1. Gross organ changes and tuberculin
sensitivity in rats infected with tubercle bacilli. Am. Rev. Tuber. 43: 449-458

Wessels CC, 1941'”: Tuberculosis in the rat II. The fate of tubercle bacilli in the various
organs of the rat. Am. Rev. Tuber. 43: 459-474

Wessels CC, 1941c: Tuberculosis in the rat III The correlation between the histologic
changes and the fate of living tubercle bacilli in the organs of the albino rat. Am. Rev.
Tuber. 43: 637-662

Whipple DL, Jarnagin JL and Payeur J B: DNA fingerprinting of Mycobacterium bovis
isolates from animals in northeast Michigan. Risk associated with M. bovis in Michigan
free-ranging white-tailed deer: an update to the 1996 report (United States Department
of Agriculture, Animal and Plant Health Inspection Service, Centers for Epidemiology
and Animal Health Fort Collins, CO 1999: 25

Whiting TL and Tessaro SV, 1994: An abattoir study of tuberculosis in a herd of farmed
elk. Can. Vet. J. 35: 497-501

Wilesmith J W, Sayers PE, Little TWA, Brewer JI, Bode R, Hillman GDB, Pritchard DG

and Stuart FA, 1986: Tuberculosis in East Sussex IV. A systematic examination of wild
mammals other than badgers for tuberculosis. J. Hyg. (Land) 97: 37-48

196

Wilkinson RJ, Llewelyn M, Toossi Z, Patel P, Pasvol G, Lalvani A etal., 2000:
Influence of vitamin D deficiency and vitamin D receptor polymorphisims on
tuberculosis among Gujarati Asians in west London: a case control study. Lancet 355:
618-621

Wilkinson RJ, Patel P, Llewelyn M, Hirsch CS, Pasvol G, Snounou G et al., 1999:
Influence of polymorphism in the genes for the interleukin (IL)-1 receptor antagonist
and the Il-lB on tuberculosis. J. Exp. Med 189(12): 1863-1873

Williams C, Ponten F, Moberg C, Soderkvist P, Uhlen M, Ponten J et al., 1999: A high
frequency of sequence alterations is due to formalin fixation of archival specimens. Am.
J. Pathol. 155:1467-1471

Winau F, Kaufmann SHE and Schaible UE, 2004: Apoptosis paves the detour path for
CD8 T cell activation against intracellular bacteria. Cell. Microbial. 6(7): 599-607

Witebsky FG and Kruczak-Filipov P, 1996: Identification of mycobacteria by
conventional methods. Clin. Lab. Med 16(3): 569-601

Woerpel RW, and Rosskopf WR, 1983: Retro-orbital Mycobacterium tuberculosis
infection in a yellow-napped Amazon parrot (A mazana achrocephala auropalliata). In
Proceedings of the Annual Meeting of the Association of Avian Veterinarians p 71-76

Woods GL, 2001: Molecular techniques in mycobacterial detection. Arch. Pathol. Lab.
Med 125: 122-126

Woods PR and Jones SL, 2001: BOVIGAMTM: an in vitro cellular diagnostic test for
bovine tuberculosis. Tuberculosis 81(1/2): 147-155

Zheng X and Roberts GD, 1999: Diagnosis and susceptibility testing. In: Schlossberg
D, editor. Tuberculosis and Nontuberculous Mycobacterial Infections 4th ed.

Philadelphia, W.B. Saunders Co.1999z57-64

Zhu G, Xiao H, Mohan VP et al., 2003: Gene expression in the tuberculous granuloma:
analysis by laser capture dissection and real-time PCR. Cell. Microbial. 5(7): 445-453

Zwilling BS, Kuhn DE, Wikoff L, Brown D and Lafuse W, 1999: Role of iron in
Nramp-1 mediated inhibition of mycobacterial growth. Infect. Immun. 67(3): 1386-1392

197

 

I"ElllljjfllljljlljlIllj‘ljll