.wf .umfimfiv

.5. .
1.1.}
1....
, I

.3."
an :z....... ‘
. ‘ 0.. z. .2...
“393.
3 I? . ‘
r] $ 1L1»?
a... .5... . 3%.. ,
. 9. .
.3... . ‘
.1”;
Fa
.am‘. as?
2.59%“;
by

1‘ lb;u§fl I
7.... L um»
rflfnshi.

 

 

v0: 0.111.1fl‘5m

 

 

10.21! ; I: .9; . .5 1.1:.) b
. T 1... . . .. u»

 

1.... £1.31

 

0,... ,
V firp.

r .
rllz 1

“My... 1 Er

 

. LIBRARIES
,n. . MICHIGAN STATE UNIVERSITY
XI 74 EAST LANSING, MICH 48824-1048

This is to certify that the
dissertation entitled

MITOCHONDRIAL TRANSCRIPTION IN TRYPANOSOMA
BRUCE]: CONSERVED PROTEINS AND UNUSUAL
INITIATIONS

presented by
SANDRA L. CLEMENT

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Micro iology and Molecular

m . ,Genet'Lcs

/
A 5.: Mia
Majo Wfim ture
@flg/o ,

Date

MSU is an Affirmative Action/Equal Opportunity Institution

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

was-'czlc—Incm—oouo.m.p.15‘

MITOCHONDRIAL TRANSCRIPTION IN TRYPANOSOMA BRUCEI:
CONSERVED PROTEINS AND UNUSUAL INITIATIONS

by

Sandra L. Clement

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Microbiology and Molecular Genetics

2004

ABSTRACT
MIT OCHONDRIAL TRANSCRIPTION IN TRYPANOSOMA BRUCEI:
CONSERVED PROTEINS AND UNUSUAL INITIATIONS

By

Sandra L. Clement

Trypanosoma brucei has an extraordinary mitochondrial genome and is one of the
earliest organisms to possess mitochondria. Mitochondrial gene expression in this
parasitic protist is complex and developmentally regulated, but little is known about the
transcription of this unusual kinetoplast DNA. In order to pinpoint promoter regions
within the T. brucei mitochondrial genome, the 5’ ends of the guide RN As gMURFZ-II
and gCYb(560) were characterized. Each of these genes have uncommon kinetoplast
DNA locations not typically associated with transcription initiation events. The
gMURFZ-II gene is located entirely within the 5’ end of the ND4 gene. Interestingly, the
gMURFZ-II and ND4 transcripts are generated by distinctly different events; the ND4
mRNA is processed from a polycistronic precursor, while transcription of the gRNA
initiates downstream of the 5’ end of the ND4 gene. The data presented in this
dissertation likewise show that the mature gCYb(560) gRNA is also a primary transcript
and that the 5’ end heterogeneity previously observed for this gRN A is a result of
multiple transcription initiation Sites and not imprecise 5’ end processing. Together,

these data indicate that gRNA genes represent individual transcription units regardless of

genomic context and suggest a complex mechanism for mitochondrial gene expression in
T. brucei.

In Spite of its phylogenetic position near the acquisition of mitochondria by
eukaryotes and its bizarre mitochondrial genome structure, the core components of
mitochondrial transcription found in other eukaryotes are conserved in trypanosomes and
their kin. The gene encoding the mitochondrial RNA polymerase, TbmtRNAP was
cloned and shown to be developmentally regulated via differential RNA processing and
stability. In addition, TbmtTFB, a homologue to the universally conserved mitochondrial
transcription factor, mtTFB, was identified in trypanosomes although no homologue to
the vertebrate factor TFAM was found. Over-expression of TbmtTFB caused a slight
increase in growth rate, while RNAi against the gene resulted in slower growth. This
together with the inability to generate double knockouts of this gene suggests an
important role for this TbmtTFB in T. brucei, although the precise function of the protein

is still unresolved.

ACKNOWLEDGEMENTS

Many people deserve credit for helping me to complete this long journey, and I
would like to thank a few of them specifically. My dissertation advisor, Dr. Donna J.
Koslowsky, gave me the opportunity to develop a sense of independence and confidence
by allowing me to work on my own project. Yet, She also gave me the tools to get my
project off the ground, without which I never would have succeeded. In addition, She has
always been respectful of my career goals and has allowed me to pursue opportunities to
obtain additional teaching experience. I would also like to thank some other very
important faculty, Specifically Dr. Ron Patterson, for frequent advice about graduate
school and beyond and for pointing me in the right direction (towards RNA). Both Dr.
John Merrill and Dr. Martha Mulks have been excellent mentors in teaching college
science to a wide variety of students.

I am also very lucky to have been surrounded by extremely intelligent and wise
peers. In particular, I would like to thank Dr. Sheldon Leung, who took me under his
wing and gave me constant advice and support during the initial and toughest years in the
lab. He taught me the most valuable lesson I have learned in graduate school, and
perhaps in life, that of perpetual optimism. The current members of the Koslowsky lab,
Laura Yu, Larissa Reifur, and Mel Mingler, are each among my best friends. I hope they
have learned at least half as much from me as I have learned from them.

Of course, I would have given up on everything long ago if not for the support of
my Matthew, whose importance to me would take more than all the pages of all the

dissertations in the world to describe.

iv

TABLE OF CONTENTS

LIST OF FIGURES ........................................................................ viii
LIST OF ABBREVIATIONS ............................................................... x
CHAPTER I

INTRODUCTION .................................................................. l
Mitochondria ......................................................................... 2
Origins and Evolution ...................................................... 2
Mitochondrial DNA structure and gene content ........................ 3
Mitochondrial Genomes and Promoters ........................................... 4
Animals .............................................................. 4
Fungi ................................................................. 5
Plants ................................................................. 6
Protists ............................................................... 7
Mitochondrial transcription machinery ................................. 8
RNA polymerase ................................................... 8
Accessory Factors .................................................. 9
mtTFB ...................................................... 10
mtTFA (aka TFAM) ...................................... 1 1
Putative Transcription Factors .................................... 12

Mechanism of promoter recognition and likelihood
for diversity in accessory factors .......................................... 13
Trypanosoma brucei ................................................................. l4
Evolutionary, Medical and Economic Significance .................... 14
Life Cycle .................................................................... 15
The Kinetoplast ............................................................... 16
kDNA structure and gene content ............................... l6
kDNA transcription ................................................ 17
Developmental Regulation of Gene Expression ........................ 18
Regulation of kDNA expression ................................. 18
Nuclear Gene regulation .......................................... 19
Overview .............................................................................. 20
LITERATURE CITED ............................................................. 22

CHAPTER II AN INTRAGENIC GUIDE RNA LOCATION SUGGESTS A
COMPLEX MECHANISM FOR MITOCHONDRIAL GENE

EXPRESSION IN TRYPANOSOMA BRUCEI ........................ 34
INTRODUCTION .................................................................. 35
MATERIALS AND METHODS .................................................. 37

Cell growth and mitochondrial isolation ................................. 37

Oligonucleotide probes and primers ...................................... 37

Nucleic acid Isolation, Northern and Southern analysis ............... 38

5’ and 3’ end mapping ..................................................... 38

Enzymatic treatments of RNA ............................................ 39

RNA ligations and poisoned primer extension analysis ............... 39
RESULTS ............................................................................ 40

gMURFZ-II maxicircle localization and expression ................... 40

The gMURF2-II gene is located within the ND4 gene

downstream of an intergenic region ...................................... 45

The mature gMURF2-II and N D4 transcripts are generated via

different events .............................................................. 48

An atypical minicircle gRNA not encoded within a cassette
is also a primary transcript, but shows heterogeneity of

start site selection ........................................................... 56
DISCUSSION ........................................................................ 6O
LITERATURE CITED .............................................................. 64

CHAPTER III UNUSUAL ORGANIZATION OF A DEVELOPMENT ALLY
REGULATED MITOCHONDRIAL RNA POLYMERASE

(TBMTRNAP) GENE IN TRYPANOSOMA BRUCEI ............... 67
INTRODUCTION .................................................................. 68
MATERIALS AND METHODS ................................................. 69

Cell culture and nucleic acid preparation ............................... 69

Degenerate PCR ............................................................ 69

Genomic DNA cloning and gene copy number ........................ 70

cDN A cloning ............................................................... 71

Northern blots ............................................................... 72

Sequencing ................................................................... 73
RESULTS ............................................................................. 73

Genomic cloning ............................................................ 73

cDNA cloning ............................................................... 79

mRNA expression .......................................................... 82
DISCUSSION ........................................................................ 86
LITERATURE CITED .............................................................. 92

CHAPTER IV A CON SERVED MTTFB IN THE EARLY EUKAYROTE
TRYPANOSOMA BRUCEI: IMPLICATIONS FOR THE
ORIGIN AND EVOLUTION OF THE MITOCHONDRIAL

TRANSCRIPTION MACHINERY ....................................... 95
INTRODUCTION ................................................................... 96
METHODS AND MATERIALS .................................................. 98

Database searches and Sequence analysis .............................. 98

Cloning of the TbmtTFB .................................................. 99

Nucleotide sequence accession number ................................. 99

Trypanosome growth, transfections and RNAi inductions ............ 99

Growth curves ............................................................... 100

Nucleic acid Isolation, Northern and Southern blot analysis ......... 100

Western blot analysis ...................................................... 101

vi

Conditional Double Knockout vectors .................................. 101

RESULTS ............................................................................. 102
Identification of a putative mtTFB in T. brucei ........................ 102

RNAi knockown of TbmtTFB mRNA .................................. 105

Gene Replacement ......................................................... 115
DISCUSSION ........................................................................ 123
Role of TbmtTFB in T. brucei ............................................ 123
Analysis of Alignment .................................................... 125
Possible other functions for T bmtTFB ................................... 126
LITERATURE CITED .............................................................. 129
CHAPTER V SUMMARY AND FUTURE RESEARCH ............................. 133
SUMMARY .......................................................................... 134
Mapping transcription start sites .......................................... 135
Conserved mitochondrial RNA polymerase subunits in T. brucei. .. 136
mtRNAP ............................................................ 136

mtTFB ............................................................... 137

Evolutionary significance: A potential intermediate? ....................... 137
FUTURE WORK ..................................................................... 139
Mapping transcription start sites .......................................... 139

In vitro transcription ........................................................ 141

Initial recombinant TbmtRNAP expression attempts ......... 141

Function of the mtTFB ..................................................... 141
LITERATURE CITED ............................................................. 143

vii

Figure 1.

Figure 2.
Figure 3.

Figure 4.

Figure 5.

Figure 6.

Figure 1.
Figure 2.

Figure 3.

Figure 4.

Figure 5.

Figure 1.

Figure 2.

LIST OF FIGURES
CHAPTER 1
CHAPTER II
Linearized map of the coding region of the
T. brucei minicircle ......................................................
gMURF2-H RNA expression and maxicircle localization .........

Mapping the 5’ ends of gMURFZ-H and ND4 ......................

Li gation-dependent poisoned primer assay for
gMURF2—II and ND4 ...................................................

Relative ligation efficiencies ..........................................

Li gation-dependent poisoned primer extension
assay for gCYb(560) ....................................................

CHAPTER III
CODEHOP primer design .............................................
TBMTRNAP locus restriction map and cloning strategy .........

TBMTRNAP protein sequence and mitochondrial
targeting signal ............................................................

Diagram of multiple alignment of respective mtRNAPs
with T7RNAP .............................................................

Developmental profile of steady state transcripts from
the TBMTRNAP locus ...................................................

CHAPTER IV

Schematic of alignment of kinetoplast ths with
animal and yeast homologues ...........................................

Targeting portions of the TbmtTFB ORF with RNAi has
no effect on TmeF B mRN A abundance ..............................

viii

Page

41

47

51

55

59

75

77

78

81

84

104

107

Figure 3.
Figure 4.
Figure 5.
Figure 6.

Figure 7.

Figure 8,

Effects of dsRNAi-3 expression ........................................ 110
Northern blot analysis of mitochondrial transcripts .................. 112
Quantification of relative transcript abundance ....................... 113
Conditional double knockout strategy ................................. 117

Expression of TbmtTFB-T AP results in a
growth rate increase ....................................................... 119

Northern blot analysis of various mitochondrial transcripts
from the TbmtTFB-TAP induction experiment ......................... 121

ix

T. brucei
mtDNA
kDNA
mtTFA, TFAM
mtTFB
mtRN AP
gRNA
mRN A
tRNA

RN Ai
dsRNA
PCR
DDRLACE
RACE
cDNA
ND4

A6

MURF

LIST OF ABBREVIATIONS

Trypanosoma brucei

mitochondrial DNA

kinetoplast DNA

mitochondrial transcription factor A
mitochondria] transcription factor B
mitochondrial RNA polymerase
guide RNA

messenger RNA

transfer RNA

RNA interference

double stranded RNA

polymerase chain reaction
differential display of RNA ligase-mediated cDNA amplification
rapid amplification of cDNA ends
copy DNA

NADH dehydrogenase subunit 4
ATPase subunit 6

maxicircle unidentified reading frame

CHAPTER I

INTRODUCTION

Mitochondria
Origin and Evolution

The acquisition of mitochondria was a defining moment in the early evolution
(and perhaps even the origin) of eukaryotic organisms. Approximately 1.5 to 2 billion
years ago, an oc-proteobacterium took up residence in a proto—eukaryotic cell or possibly
an Archea (3, 50). There are several theories as to the nature of this initial symbiotic
relationship. Because the acquisition of mitochondria occurs around the time of
increasing oxygen levels in the atmosphere, the “Ox-Tox” model suggests that the role of
the symbiont was to protect the host from rising oxygen levels by using 02 as an electron
acceptor (65). In two other common theories, the ability to utilize molecular oxygen is
secondary. The metabolic syntrophy theory suggests that the symbiont fed on methane
while the hydrogen hypothesis proposes the role was to produce hydrogen (4, 65).
Regardless of the impetus of this initial relationship, since bacteria do not have a
mechanism for exporting ATP, it is unlikely that the common explanation that the
relationship involved an exchange of metabolites for ATP is accurate. However, the host
cell rapidly invented many proteins to take advantage of this opportunity early in the
association. As a result, modern mitochondria have evolved to play important roles in
energy production, fatty acid metabolism, ion homeostasis, and apoptosis (52). In
addition, mitochondrial dysfunction is associated with aging and disease (66, 103, 113).
Consequently, learning more about mitochondrial function will improve our knowledge
of how this distinct and often enigmatic organelle contributes to the overall function and

health of the cell.

Aerobic respiration is more efficient than anaerobic respiration, and nearly all
eukaryotes have mitochondria. The only eukaryotes to lack them are unicellular
anaerobic organisms containing specialized organelles called hydrogenosomes which are
thought to be related to mitochondria (4). There are conflicting data and opinions as to
whether the latter group of organisms are primitively or secondarily amitochondriate (3).
In any case, it is clear that mitochondrial function has played a pivotal role in eukaryotic
biology and evolution, and likely fomented the remarkable diversification and boom in
complexity (40). One can imagine that this increase in energy was at least part of what

promoted the development of the much larger and more complex eukaryotic cell.

Mitochondrial DNA structure and gene content

All mitochondria retain small genomes that are relics of their eubacterial
ancestors. These genomes vary in size, gene content, and structure, but have in common
a dramatic reduction of genes relative to the original endosymbiont. During the course of
evolution, many of the genes originally encoded within the ancestor were lost; a
phenomenon also observed for many other endosymbiotic and intracellular pathogens.
Like bacterial genomes, mitochondrial DNA (mtDNA) maps as a circular molecule in
most organisms, but recent evidence suggests that many mtDNAs are in fact linear (9,
61). While mtDNA varies dramatically in size from 6 kb in the malaria parasite,
Plasmodiumfalciparum (43), to 2000 kb in cucumbers and melons (115), there is no
correlation between genome size and coding content. In general, the larger mitochondrial
genomes are often the result of the presence of group I and II introns and associated

proteins as well as a larger proportion of intergenic space.

Although there is some variation in the precise gene content among mitochondria,
a core set of proteins remain encoded within the mitochondrial genome. These genes
include rRNAs, usually tRNAs, and mRNAs for proteins involved in oxidative
phosphorylation and electron transport (22). This common set of retained genes indicates
that the modern mtDN A gene content was established early in evolution, prior to the
divergence of the major groups of eukaryotes. However, the specific genes retained can
vary from group to group by as much as 20-fold (1) indicating that the frequent and
ongoing process of differential loss and migration have also helped to shape

mitochondrial gene content.

Mitochondrial Genomes and Promoters
Animals
Animal mitochondrial genomes are typically small, compact molecules. The
structure and content is highly conserved among animals, especially in mammals, but
some variation does exist. Nearly all multi-cellular animals have a closed circular
genome while phylogenetically early animals such as cnidarians have linear genomes
(17). In general, animal mtDNA encodes 37 or fewer genes including 22 tRNAs, large
and small subunit rRNA, and 13 genes encoding subunits for proteins involved in
oxidative phosphorylation. (For reviews see (30, 44, 106). Coding content, as well as
G+T content, is asymmetric; 14 tRNAs, 2 rRNAs, and 12 protein genes are encoded on
the heavy strand and 8 tRNAs and one protein gene are found on the light strand.
These genomes are compact and in some cases adjacent genes overlap. The only

region of intergenic space is known as the regulatory region or D loop, which contains

promoter elements for each strand. These two transcription units are each transcribed a
polycistronic unit from which individual transcripts are processed. Mitochondrially
encoded genes in animals lack introns and often have no or small (3m) 5’ untranslated
regions and stop codons are often generated by polyadenylation.

The two promoters within the vertebrate D-loop region have been defined using in
vitro assays with partially purified mitochondrial proteins ( 15, 16, 99). These promoters
are located about 150 bp from each other and are known as the heavy strand promoter
(HSP) and light strand promoter (LSP). The promoter elements consist of a 50 bp
bipartite sequence with distinct protein binding sites for factors involved in transcription
initiation. Both the HSP and LSP consist of a 15 bp consensus motif that surrounds the
initiation site and another element located upstream (-12 to -39) which includes the
binding sites for the transcription factor, TFAM (discussed in more detail below). The
LSP also plays a role in the replication of the mitochondrial genome. Processing of
transcripts from this promoter by RNase MRP generates primers for replication of the

heavy strand.

Fungi

Fungal mitochondrial genomes range in size from 19 kb in Schizosaccharomyces
pombe to ~100 kb in Podosopora anserina. They contain several regions of intergenic
space, but gene content is fairly consistent (21). The most well characterized
mitochondrial genome is that of the baker’s yeast, Saccharomyces cerevisiae. The yeast
mtDNA is ~86 kb and encodes both large and small subunit ribosomal RNA, 24 tRNAs

and 30 proteins (36). An unusual feature relative to animal mitochondrial DNA is that

only 1/3 of these protein genes encode vital mitochondrial OXPHOS genes. As many as
10 of the protein-coding genes in the yeast mitochondria code for endonucleases, reverse
transcriptases and mRNA maturases, and yet another 10 encode genes of unknown
function (3).

In contrast to the mammalian mtDNA, the larger yeast mitochondrial genome
contains ~20 promoters and there have been at least 12 identified polycistronic
transcription units (36). All but one gene, tRNAz’h’, are transcribed from the same strand
of DNA. In contrast to the bipartite promoters found in animal mtDNA, yeast
mitochondrial promoters share a nonanucleotide sequence near the start site (83). The
majority of these promoters share the consensus sequence 5’ ATATAAGTA 3’ and
transcription initiates from the 3’ terminal A residue. Interestingly, yeast mitochondrial
promoters are classified as weak or strong depending on the type of nucleotide at position

+2. Weak promoters have a pyrimidine, while strong promoters have a purine (14).

Plants

Mitochondrial genomes of higher plants display a number of unique features
relative to their animal and fungal counterparts. They are the largest of the mitochondrial
genomes. However, with the exception of some ribosomal proteins not found in other
mitochondrial genomes, they encode basically the same core set of proteins found in
mtDNA of other organisms. There is some variability in gene content among the
flowering plants, including several independent gene losses, particularly of ribosomal
proteins (1). The overall structure of plant mtDN A is peculiar, consisting of a large

master circle encoding a full complement of genes, as well as several sub-genomic

minicircles that are generated by recombination. Several plant mitochondrial genomes
have been sequenced and range in size from ~184 kb in the non-vascular plant,
Marchantia(82) to > 2000 kb in curcurbits (115). The mitochondrial genome of the
model organism Arabidopsis thaliana is >360 kb and encodes 57 genes including genes
for rRNA, tRNA and OXPHOS components. These genes make up less than 10% of the
genome (111), as plant mtDNA is rich in intergenic spaces (2-60 kb) and pseudogenes.
Gene order is very dynamic due to intra- and inter- chromosomal rearrangements. As in
fungi, plant mitochondrial genomes also encode maturases and introns. In addition, plant
mtDNA appears to be rather promiscuous, with traces of nuclear and chloroplast DNA
found in some plant mitochondrial genomes.

There are multiple transcription initiation sites in plant mitochondria (12, 19).
Mapping of these transcription start sites and comparison of the surrounding sequences
revealed conserved sequence motifs that are distinct between mono- and dicotyledoneous
plants. (For reviews see (11, 18). Further in vitro characterization with partially purified
mitochondrial extracts has determined in greater detail the nucleotide elements required
for transcription initiation. Both classes share a 5’—CRTA—3' tetranucleotide motif (45).

In dicots, this sequence is extended to a conserved nonanucleotide motif (58).

Protists

Although protists make up the majority of eukaryotic evolutionary diversity, they
are poorly sampled with respect to their mitochondrial genomes. Current genome
sequencing projects such as the Organelle Genome Megasequencing Program (OGMP;

http://megasun.bch.umontreal.ca/ogmp) have revealed that protist mtDNA varies

 

 

dramatically in structure, gene organization and content (21, 22, 51). From an
evolutionary perspective, one of the most exciting mitochondrial genomes belongs to the
early jakobid protist, Reclinomonas americana. This genome not only contains the
largest gene complement of any sequenced mitochondrial genome, it is also thought to be
the most ancestral . At 69 kbp, it is dwarfed in size by many plant mitochondrial
genomes, but contains close to 100 genes, and retains similar gene order and even operon
organization with that of eubacteria (5). Unlike other mitochondrial genomes, which lack
genes required for their own expression, Reclinomonas mtDNA encodes genes for the
eubacterial RNA polymerase subunits 0t, B, B’ and 0' and contains identifiable eubacterial
promoter regions. There have been very few studies of mitochondrial transcription in
protists, although some transcript mapping in Plasmodium (89)and Dictyostelium has

been described (6, 7).

Mitochondrial Transcription Machinery
RNA polymerase (mtRN AP)

Mitochondrial transcription is the initial step in a cascade of regulatory processes
responsible for the expression of the mitochondrial genome. The origin and evolution of
the components involved in this step is still a bit of a mystery. Interestingly, with the
exception of Reclinomonas americana, mitochondria are not known to encode genes for
their own expression. Instead, most organisms appear to use a highly conserved, nuclear
encoded RNA polymerase homologous to that of the single subunit bacteriophage T7
RNAP. The first such protein to be identified is the product of the RP04I gene in S.

cerevisiae (73). Homologues have since been described in vetebrates as well. (93, 109).

A PCR survey performed in 1996 identified homologues in a phylogenetically diverse
variety of organisms, but did not find homologues in the kinetoplastid, Crithidia, or in the
jakobid Reclinomonas. (26) Further phylogenetic studies on the evolution of single
subunit RNAPs did little to shed light on the origin of the mitochondrial RNA
polymerase, other than to indicate that it was acquired shortly after the initial
endosymbiotic event (27). Single subunit RNAPs have been identified in plants as well
(56, 60, 118), although no functional studies have been performed to demonstrate their
role in mitochondrial transcription. Interestingly, Arabidiopsis thaliana has three
ssRNAPs; one targeted to the chloroplast where it transcribes a subset of genes, one
targeted to the mitochondria, and one targeted to both organelles (57).

Multiple sequence alignments of mitochondrial RNAPs with the phage RNAPs
show that nearly all the active domains are highly conserved, but that the mtRNAPs
possess an amino terminal domain (ATD) extension relative to the bacteriophage proteins
. Interestingly, there is little conservation among various species in the ATD sequence,
although closely related groups do share some homology (114). These ATD sequences
are thought to play a role in species specific interactions with other proteins. For
example, fungal mtRNAPs interact with proteins that are important for RNA processing
and translation (20, 91, 114), while vertebrate mtRNAPs have a weakly conserved PPR

motif that is speculated to play a role in RNA processing (91).

Accessory factors
The major feature that distinguishes the mitochondrial RNA polymerases from

their bacteriophage cousins is the requirement for one or more accessory factors. The

bacteriophage enzymes can recognize promoter regions, initiate, elongate and terminate
transcription alone. In contrast, although recent data do suggest that the promoter
recognition domain resides within the mtRNAP subunit (48, 74), all known mtRNAPs
require one or more nuclear encoded accessory factors for accurate transcription
initiation. As is the case for many other host cell inventions, these differences appear to

reflect the different evolutionary pressures experienced by the different groups.

mtTFB

Although the mitochondrial RNA polymerases of various organisms are highly
conserved, there is less conservation among mitochondrial transcription factors (24). The
first transcription factor to be characterized was the product of the M TF1 gene in
Saccharomyces cerevisiae. Together with mtRNAP catalytic subunit, Rpo41, Mtfl was
shown to be necessary and sufficient for transcription initiation using in vitro studies
(62). Early sequence analysis revealed limited homology to eubacterial sigma factors,
particularly in domains 2 and 3 (31, 32, 62), though mutagenesis studies did not show
strong support for a function of these putative conserved domains in promoter recognition
or interaction with Rpo41 (100). However, Mtfl was shown to behave in a manner
similar to that of sigma in that it associates with Rpo41 at the promoter during
transcription initiation and during the early abortive transcription stages but is released
upon conversion of the polymerase into an elongation competent form (71).
Interestingly, the crystal structure of Mtfl demonstrated that it belongs to a large and
highly conserved family of rRNA methyltransferases (96). This information helped two

groups working independently to identify the vertebrate homologue, TFBMl, which

10

binds SAM, and is able to methylate E. coli small subunit (SSU) rRNA, but does not
require this function for transcription initiation (42, 76, 98). Intriguingly, a paralogue of
TFB 1M, TFBZM is 1-2 orders of magnitude more effective at activating transcription

initiation from promoters in vitro and is found only in higher animals (42, 88) including

Drosophila (75).

mtTFA (aka TFAM)

The first mitochondrial transcription factor identified in animals was not
homologous to the yeast Mtfl protein. This protein, mtTFA or Tfam, belongs to a family
of proteins bearing two high mobility group or HMG domains (46). HMG proteins are
eukaryotic inventions not found in eubacteria or archea and consequently were recruited
to play a role in mitochondrial gene expression by the host. In general, HMG proteins
bind the minor groove of DNA in a non-sequence specific fashion and include non-
histone chromosomal proteins and nucleolar transcription factors (108). These proteins
bind and distort or bend DNA, thereby facilitating access to template DNA by the RNA
polymerase. Mitochondrially targeted proteins containing HMG box domains are found
in a variety of organisms including the Glom protein in the slime mold Physarum (94),
mthmgl in the filamentous fungus Podospora anserina (35)and Abf2 in yeast (92, 117).
These proteins all play important roles in mtDNA maintenance, but do not appear to be
transcription factors. TFAM likewise plays a role in mtDNA maintenance, apparently
through two distinct mechanisms. One way in which TFAM helps to maintain mtDNA is
by coating it and condensing it, preventing nucleoid loss (2, 39). Another way is by

playing a role in transcription of the primer at the LSP for heavy strand replication. The

11

other DNA binding proteins are not required for transcription and lack both the hinge
region found in the metazoan TFAMS as well as 29 amino acid basic CT D also unique to
the metazoan TFAMS. This CTD is required for transcription activation, and can convert
the Abf2 protein into a transcriptional activator on human LSP promoters in vitro (33).
This C-tail of TFAM has also been shown recently to interact with mtTFB in humans
(77). Like other HMG proteins, TFAM binds mtDNA non-specifically, but does show a

higher affinity for promoter regions.

Putative mitochondrial transcription factors

Although in vitro transcription systems exist for plants, in vitro promoter
recognition is very fragile and rapidly loses activity in most manipulations (11).
Consequently, attempts at fractionation abolish all activity. This suggests that several
loosely connected proteins may be involved in promoter recognition. One such protein,
p63, has been characterized for wheat mitochondria (59). This protein contains a DNA
binding domain and stimulates transcription from the cox2 promoter in vitro.
Interestingly, this protein also belongs to a large family of RNA processing proteins in
plants. This family of PPR or pentatricopeptide repeat containing proteins contain
putative RNA binding domains and are thought to play a role in RNA processing (69).
Another protein with putative promoter-binding activity was isolated from pea
mitochondria and is homologous to an isovaleryl CoA dehydrogenase enzyme (13, 55).
The authors speculate that it could be dual function protein, as is the style in
mitochondria. However, further studies demonstrating a role in transcription have not

been described.

12

 

 

 

Mechanism of promoter recognition and likelihood for diversity in accessory factors
Exciting new data have become available recently about the mechanism of
promoter recognition by the mitochondrial RNA polymerase. The Jaehning lab has
shown that the mtRNAP itself is capable of promoter recognition in vitro and can even
initiate transcription on its own from an open “bubble” template (74). This result
indicates that the mtTFB does not confer promoter specificity, but rather contributes to
promoter opening. This innate ability to recognize promoter sequences is not unique to
the yeast mitochondrial RNAP. Studies of the human mtRN AP indicate that it too has
promoter recognition ability (48), but that this capacity is absolutely dependent on both
TFAM and the human mtTFB2. Consequently, although yeast and mammals use similar
machinery, the precise mechanism of mitochondrial transcription initiation must be
substantially different in these two organisms. Fungi and animals are more closely
related to each other than either of them are to other groups of organisms. However, they
show distinct differences in the composition of the mtRNAP holoenzyme, making it
likely that other variations will become evident as more systems are studied. In general,
we know very little about the scope of mitochondrial transcription in eukaryotes because
this has only been elaborated for two relatively close clades of crown eukaryotes.
Studying protists, especially early branching organisms such as the parasitic protist
Trypanosoma brucei, can reveal valuable information about the evolution of the
mitochondrial transcription machinery. T. brucei is not only an ancient eukaryote but
also has a remarkable mitochondrial genome and a bizarre mode of mitochondrial gene

expression.

13

Trypanosoma brucei
Evolutionary, Medical and Economic Significance

Trypanosoma brucei is a unicellular flagellated protist that belongs to the order
Kinetoplastida. This evolutionarily ancient group is so named for their unusual
mitochondrial genome, the kinetoplast. Together, T. brucei, and other kinetoplastid
species such as T. cruzi and Leishmania major, cause a wide variety of diseases affecting
hundreds of millions of people in the developing countries of Asia, Africa and South
America (http://www.who.int). Other members parasitize a phylogenetically diverse
array of organisms including reptiles, fish, amphibians and even plants; and free living
forms exist as well (23, 53, 54). T. brucei is perhaps one of the best studied organisms of
the group. This parasite has had a devastating impact in sub-Saharan Africa by causing
African Sleeping Sickness in humans and nagana (a wasting disease) in African
livestock. Dramatic inroads had been made in reducing the spread of the disease, mainly
by limiting the range of its insect vector, the tsetse fly. However, recent political and
socioeconomic instability in the region has led to an increase in the incidence of Sleeping
Sickness, and has placed millions more people at risk. There is no vaccine against the
disease, the treatments are harsh, and left untreated, the disease is inevitably fatal (37, 41,
81). Fortunately, members of the Kinetoplastida share many unusual biochemical
features relative to their mammalian hosts. Learning more about these will hopefully

provide more drug targets to combat the parasite.

14

Life cycle

T. brucei is transmitted from the bloodstream of one host to that of another by the
bite of the tsetse fly. This rapid environmental fluctuation is accompanied by dramatic
morphological and biochemical changes in the parasite (87, 107, 112). Each
trypanosome possesses a single mitochondrion that is fully functional during the insect or
procyclic phase of the life cycle but greatly reduced in size and function during the
bloodstream phase. While living in the midgut of the tsetse fly, procyclic form parasites
generate ATP primarily via oxidative phosphorylation. Unlike other organisms which
predominantly use carbohydrates as an energy source, procyclic trypanosomes use amino
acids such as proline which is fed directly into the Krebs’ cycle as a source of energy.
Glycolysis in T. brucei is also unique in that the first seven steps are contained within a
specialized organelle called the glycosome (84). In the mammalian bloodstream,
trypanosomes rely entirely on glycolysis and substrate level phosphorylation for ATP
production, and the mitochondrion lacks complexes III and IV (95). However, the
mitochondrion does retain important functions in redox balance for the glycosome during
the bloodstream infection (54). A plant-like alternative oxidase exists within the
bloodstream form mitochondrion to oxidize the excess reducing power generated by
glycolysis (28, 54). As with other eukaryotes, the mitochondrion of T. brucei may also
play a role in Ca2+ homeostasis , fatty acid metabolism, and strangely enough for a

unicellular organism, apoptosis (25, 34, 90).

15

The Kinetoplast
kDNA structure and gene content

Aside from its significance as a disease—causing organism, T. brucei is perhaps
best known for its unusual mitochondrial genome and its bizarre mode of expression.
The mitochondrial genome, or kinetoplast, is a disk of highly condensed DNA that is
physically associated with the basal body of the flagellum (102, 104). Consequently,
early observations led people to believe this specialized organelle played a direct role in
flagellar movement. This unusual structure is historically significant as it was one of the
first demonstrations that mitochondria contained DNA (95).

Kinetoplast DNA (kDNA) in T. brucei consists of a network of thousands of
interlocked molecules (68). Although kDN A is one of the most remarkable
mitochondrial genomes studied, the maxicircle encodes similar genes to those found in
other mitochondria including: apocytochrome B (Cyb), cytochrome oxidase (CO)
subunits I, II, and III; ATPase subunit 6 (A6), one ribosomal protein (RPSlZ), both large
and small rRNA genes, and five other open reading frames of unknown homology. Many
of these genes are in fact “cryptogenes” whose mRNAs must be edited by the post-
transcriptional insertion and/or deletion of U residues to create mature transcripts (105).
The maxicircle genes are tightly packed within ~15 kb of the 22 kb maxicircle sequence,
and there is a notable lack of tRNA genes. As with animal mtDNA, these protein-coding
genes lack introns and in many cases the 5’ and 3’ ends of adjacent genes overlap.
However, unlike animal mitochondrial mRNAs, maxicircle encoded mRNAs have both
5’ and 3’ UTRs. The remaining 7 kb of the maxicircle is known as the variable region

due to species- and strain- specific variability (80). This region lacks open reading

16

frames and is thought to contain regulatory elements for transcription and replication,
although none have been precisely mapped.

The majority of the kinetoplast genome is composed of a distinct minicircle
component consisting of thousands of 1 kb interlocked circular molecules. Minicircles
encode the small guide RNA (gRNA) transcripts that play a role in editing the
cryptogenes encoded on the maxicircle genome. In general, T. brucei minicircles each
encode three gRNA genes (101) . There are estimated to be about 300 sequence classes
of minicircles (although only 27 have been sequenced) providing the hundreds of gRNAs
necessary for the extensive editing required for some of the maxicircle mRN As . Nearly
all gRNA genes are flanked by 18 bp imperfect inverted repeats that have been postulated
to play a role in transcription and/or processing of gRNA transcripts and/or gRNA

mobility, but none of these functions have been demonstrated (85, 86).

kDNA Transcription

Although much is known about the post-transcriptional process of RNA editing in
T. brucei, very little is known about transcription of kDNA. Similar to animal
mitochondrial transcription, transcription of the maxicircle appears to generate a
polycistronic precursor from which mature transcripts must be processed by cleavage and
polyadenylation (78, 79). In contrast, minicircle encoded gRNA genes are
monocistronic, although read-through transcription produces oligocistronic precursors
from which only the initiating transcript survives downstream processing (49, 85, 86).
No promoter sequences have been identified for either maxicircle or minicircle genes.

However, transcription of the maxicircle has been shown to initiate at least 1200 nt

17

 

 

upstream of the mature 5’ end of the 128 rRNA (79). Due to the instability of this

precursor, the precise transcription initiation site has not been mapped.

Developmental Regulation of Gene Expression
T. brucei and many other members of this family have alternating forms during
which part of the life cycle is spent in an invertebrate vector before being transmitted to a

vertebrate (and sometimes plant) host. These parasites must respond quickly to extreme

 

changes in their environment with dramatic changes in morphology, surface structure,
and metabolism. Consequently, precise and rapid gene regulation is essential. In T.
brucei, this regulation occurs via the coordinated expression of both the nuclear and
mitochondrial genomes and is indispensable for completion of the trypanosome life
cycle. The dual nature of the kinetoplast genome adds another layer of complexity as

both maxicircle and minicircle genes are required to produce functional mRNAs.

 

Regulation of kDNA expression

Interestingly, the steady state levels of various maxicircle transcripts are
developmentally regulated in T. brucei. The 98 and 12S ribosomal RNAS are 30 fold
more abundant in the procyclic stage than in the bloodstream stage, reflecting the relative
importance of translation of the mitochondrial mRNAs in the different life stages (78,
79). In spite of this dramatic difference, transcription rates measured in organello and in
vivo in bloodstream and procyclic trypanosomes are identical, suggesting that the
regulation of transcript abundance, at least for the rRNAs, occurs at the level of

processing or stability (79). Several mitochondrial mRNAs also show stage specific

18

differences in abundance that reflect the relative importance of the specific functions of
the mitochondrion for each stage. For example, cytochrome subunits are very low or
undetectable in the relatively inactive bloodstream form mitochondrion which are
inactive for electron transport (87). In contrast, NADH dehydrogenase subunit 7 and 8
mRNAs are upregulated in the bloodstream, possibly reflecting their importance in
maintaining redox balance in the glycosome by transferring electrons via ubiquinone to

the alternative oxidase (8, 54, 87). Editing of various transcripts is also developmentally

 

regulated, often in a similar pattern (10, 64). Complex Itranscripts are predominantly
edited in the bloodstream form stage, while complexes III and IV are edited preferentially

in the procyclic stage.

Nuclear gene regulation

As with other eukaryotes, the majority of the genes required for mitochondrial
biogenesis and function are encoded in T. brucei nuclear genome. Many of these genes
are also developmentally regulated according to the life cycle stage of the parasite.
Nuclear gene expression in the kinetoplastida is remarkably different than that studied in
model, crown eukaryotes in that there is very little regulation at the level of transcription
initiation (29, 112). This is likely a consequence of the unique genomic organization of
the nuclear genes. In the chromosomes assembled from sequence data for both T. brucei
and Leishmania major, intron-less open reading frames are clustered in groups of 30 -50
or more (72, 116). Interestingly, these genes are not organized as operons since genes for
similar functions are typically not coded near each other. These genes are co-transcribed

by a highly proccessive a—amanitin sensitive polymerase, presumably pol H, although pol

19

I has been shown to be responsible for the transcription of certain classes of cell surface
proteins (112). Individual genes are processed from this polycistronic precursor by the
addition of a capped ~40 nt trans-spliced leader RNA to the 5’ end and
cleavage/polyadenylation at the 3’ end. No developmental regulation at the level of
transcription, trans-splicing or polyadenylation has been observed (29). It appears that
the predominant element for regulation is the 3’ UTR of mature mRNAs, which affects

both the stability and in some cases translatability of the mRNA (38, 47, 67, 97). 3’ UTR

 

elements include short 16 met sequences that form secondary structure and AU rich

elements (ARES). So far, the only role for the 5’ UTR in regulating transcript abundance
has been seen in Crithidia, in which the 5’ UTR in several nuclear-encoded mitochondrial
genes have been shown to play a role in cell-cycle regulation (70). In addition, regulation

at the level of protein stability has been observed (110).

 

Overview

The modern mitochondrial proteome consists of a limited set of genes encoded
within the mitochondria, and a larger set that have been transferred to the nucleus. In
addition, the majority of the mitochondrial proteome consists of eukaryotic, nuclear-
encoded inventions (63). Whole genome sequence comparisons suggest that new
components of the mitochondrial proteome have continued to evolve after the divergence
of the major taxa. (3). This simple fact is often overlooked in papers describing how
particular mitochondrial properties are conserved throughout evolution from “yeast to fly
to man”. It is clear from sampling even these relatively few taxa that group specific

evolution has resulted in differing requirements for various mitochondrial processes in

20

animals, fungi, plants, and protists. Indeed, distinct differences exist in the mechanisms
for transcription of the mitochondrial genome, both in cis elements and trans-actin g
factors.

The origins and evolution of the mitochondrial transcription apparatus remain an
evolutionary enigma. Since T. brucei belongs to one of the earliest branches of
eukaryotes that possess mitochondria, learning more about the differences and
similarities between trypanosomes and model organisms will provide evolutionary

insight into the development of this unusual transcription machinery. Additionally, the

 

potential to discover novel components and/or mechanisms of transcription in this ancient
organism opens up the possibility of finding much needed chemotherapeutic agents
against this pathogen.

In order to learn more about mitochondrial transcription in T. brucei, my thesis
work has approached some basic questions about the nature of the mitochondrial

transcription apparatus using several different strategies. Very little was known about

 

mitochondrial transcription in this group of organisms when I began this project. The
mitochondrial transcription machinery was unknown, as were maxicircle transcription
start sites. In the work described in this dissertation, I have sought to identify important
components of mitochondrial transcription in T. brucei including the proteins and cis-
elements required for transcription initiation. Chapter 11 describes the identification and
mapping of a transcription start site for a gRNA gene with an unusual intergenic location,
while chapters III and IV describe the identification of homologues to the mitochondrial

RNAP and accessory factor mtTFB, respectively.

21

10.

LITERATURE CITED

Adams, K. L., and J. D. Palmer. 2003. Evolution of mitochondrial gene content:
gene loss and transfer to the nucleus. Mol Phylogenet Evol 29:380-95.

Alam, T. 1., T. Kanki, T. Muta, K. Ukaji, Y. Abe, H. Nakayama, K. Takio, N.
Hamasaki, and D. Kang. 2003. Human mitochondrial DNA is packaged with
TFAM. Nucleic Acids Res 31: 1640-5.

 

Andersson, S. G., O. Karlberg, B. Canback, and C. G. Kurland. 2003. On the
origin of mitochondria: a genomics perspective. Philos Trans R Soc Lond B Biol
Sci 358: 165-77; discussion 177-9.

Andersson, S. G., and C. G. Kurland. 1999. Origins of mitochondria and
hydrogenosomes. Curr Opin Microbiol 2:535-41.

Andersson, S. G., A. Zomorodipour, J. O. Andersson, T. Sicheritz-Ponten, U.
C. Alsmark, R. M. Podowski, A. K. Naslund, A. S. Eriksson, H. H. Winkler,
and C. G. Kurland. 1998. The genome sequence of Rickettsia prowazekii and
the origin of mitochondria. Nature 396:133-40.

Barth, C., U. Greferath, M. Kotsifas, and P. R. Fisher. 1999. Polycistronic
transcription and editing of the mitochondrial small subunit (SSU ) ribosomal
RNA in Dictyostelium discoideum. Curr Genet 36:55-61.

 

Barth, C., U. Greferath, M. Kotsifas, Y. Tanaka, S. Alexander, H. Alexander,
and P. R. Fisher. 2001. Transcript mapping and processing of mitochondrial
RNA in Dictyostelium discoideum. Curr Genet 39:355-64.

Beattie, D. S., and M. M. Howton. 1996. The presence of rotenone-sensitive
NADH dehydrogenase in the long slender bloodstream and the procyclic forms of
Trypanosoma brucei brucei. Eur J Biochem 241:888-94.

Bendich, A. J. 1993. Reaching for the ring: the study of mitochondrial genome
structure. Curr Genet 24:279-90.

Bhat, G. J ., A. E. Souza, J. E. Feagin, and K. Stuart. 1992. Transcript-specific
developmental regulation of polyadenylation in Trypanosoma brucei
mitochondria. Mol Biochem Parasitol 52:231-40.

22

ll.

12.

13.

14.

15.

16.

17.

18.

19.

20.

Binder, 8., and A. Brennicke. 2003. Gene expression in plant mitochondria:
transcriptional and post-transcriptional control. Philos Trans R Soc Lond B Biol
Sci 358: 181—8; discussion 188-9.

Binder, 8., and A. Brennicke. 1993. Transcription initiation sites in
mitochondria of Oenothera berteriana. J Biol Chem 268:7849-55.

Binder, 8., F. Hatzack, and A. Brennicke. 1995. A novel pea mitochondrial in
vitro transcription system recognizes homologous and heterologous mRN A and
tRNA promoters. J Biol Chem 270:22182—9.

Biswas, T. K. 1990. Control of mitochondrial gene expression in the yeast
Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 87 :9338-42.

Bogenhagen, D. F., and M. F. Romanelli. 1988. Template sequences required
for transcription of Xenopus laevis mitochondrial DNA from two bidirectional
promoters. Mol Cell Biol 8:2917-24.

Bogenhagen, D. F., and B. K. Yoza. 1986. Accurate in vitro transcription of
Xenopus laevis mitochondrial DNA from two bidirectional promoters. Mol Cell
Biol 6:2543-50.

Boore, J. L. 1999. Animal mitochondrial genomes. Nucleic Acids Res 27: 1767-
80.

Brennicke, A., E. Zabaleta, S. Dombrowski, M. Hoffmann, and S. Binder.
1999. Transcription signals of mitochondrial and nuclear genes for mitochondrial
proteins in dicot plants. I Hered 90:345-50.

Brown, G. G., A. H. Auchincloss, P. S. Covello, M. W. Gray, R. Menassa, and
M. Singh. 1991. Characterization of transcription initiation sites on the soybean
mitochondrial genome allows identification of a transcription-associated sequence
motif. Mol Gen Genet 228:345-55.

Bryan, A. C., M. S. Rodeheffer, C. M. Wearn, and G. S. Shade]. 2002. Slslp is
a membrane-bound regulator of transcription-coupled processes involved in
Saccharomyces cerevisiae mitochondrial gene expression. Genetics 160:75-82.

23

 

 

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

Bullerwell, C. E., and M. W. Gray. 2004. Evolution of the mitochondrial
genome: protist connections to animals, fungi and plants. Curr Opin Microbial
7:528-34.

Burger, G., M. W. Gray, and B. F. Lang. 2003. Mitochondrial genomes:
anything goes. Trends Genet 19:709-16.

Camargo, E. P. 1999. Phytomonas and other trypanosomatid parasites of plants
and fruit. Adv Parasitol 42:29-112.

Carrodeguas, J. A., S. Yun, G. S. Shade], D. A. Clayton, and D. F.
Bogenhagen. 1996. Functional conservation of yeast mtTFB despite extensive
sequence divergence. Gene Expr 6:219-30.

Catisti, R., S. A. Uyemura, R. Docampo, and A. E. Vercosi. 2000. Calcium
mobilization by arachidonic acid in trypanosomatids. Mol Biochem Parasitol
105:261-71.

Cermakian, N ., T. M. Ikeda, R. Cedergren, and M. W. Gray. 1996. Sequences
homologous to yeast mitochondrial and bacteriophage T3 and T7 RNA

polymerases are widespread throughout the eukaryotic lineage. Nucleic Acids Res
24:648-54.

Cermakian, N., T. M. Ikeda, P. Miramontes, B. F. Lang, M. W. Gray, and R.
Cedergren. 1997. On the evolution of the single-subunit RNA polymerases. J
Mol Evol 45:671-81.

Chaudhuri, M., W. Ajayi, and G. C. Hill. 1998. Biochemical and molecular
properties of the Trypanosoma brucei alternative oxidase. Mol Biochem Parasitol
95:53-68.

Clayton, C. E. 2002. Life without transcriptional control? From fly to man and
back again. Embo J 21:1881-8.

Clayton, D. A. 2000. Transcription and replication of mitochondrial DNA. Hum
Reprod 15 Suppl 2:11-7.

24

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

Cliften, P. F., S. H. Jang, and J. A. Jaehning. 2000. Identifying a Core RNA
Polymerase Surface Critical for Interactions with a Sigma-Like Specificity Factor.
Mol Cell Biol 20:7013-7023.

Cliften, P. F., J. Y. Park, B. P. Davis, S. H. Jang, and J. A. Jaehning. 1997.
Identification of three regions essential for interaction between a sigma-like factor
and core RNA polymerase. Genes Dev 11:2897-909.

Dairaghi, D. J., G. S. Shadel, and D. A. Clayton. 1995. Addition of a 29 residue
carboxyl-terminal tail converts a simple HMG box-containing protein into a
transcriptional activator. J Mol Biol 249:11-28.

Debrabant, A., and H. Nakhasi. 2003. Programmed cell death in
trypanosomatids: is it an altruistic mechanism for survival of the fittest?
Kinetoplastid Biol Dis 2:7.

Dequard-Chablat, M., and C. Allandt. 2002. Two copies of mthmgl, encoding
a novel mitochondrial HMG-like protein, delay accumulation of mitochondrial
DNA deletions in Podospora anserina. Eukaryot Cell 1:503-13.

Dieckmann, C. L., and R. R. Staples. 1994. Regulation of mitochondrial gene
expression in Saccharomyces cerevisiae. Int Rev Cytol 152: 145-81.

Docampo, R., and S. N. Moreno. 2003. Current chemotherapy of human African
trypanosomiasis. Parasitol Res 90 Supp 1:810-3.

Drozdz, M., and C. Clayton. 1999. Structure of a regulatory 3' untranslated
region from Trypanosoma brucei. Rna 5:1632-44.

Ekstrand, M. 1., M. Falkenberg, A. Rantanen, C. B. Park, M. Gaspari, K.
Hultenby, P. Rustin, C. M. Gustafsson, and N. G. Larsson. 2004.

Mitochondrial transcription factor A regulates mtDNA copy number in mammals.
Hum Mol Genet 13:935-44.

Emelyanov, V. V. 2003. Mitochondrial connection to the origin of the eukaryotic
cell. Eur J Biochem 270: 1599—618.

Fairlamb, A. H. 2003. Chemotherapy of human African trypanosomiasis: current
and future prospects. Trends Parasitol 19:488-94.

25

42.

43.

45.

46.

47.

48.

49.

50.

51.

52.

Falkenberg, M., M. Gaspari, A. Rantanen, A. Trifunovic, N. G. Larsson, and
C. M. Gustafsson. 2002. Mitochondrial transcription factors B1 and B2 activate
transcription of human mtDNA. Nat Genet 31:289-94.

Feagin, J. E. 1992. The 6-kb element of Plasmodium falciparum encodes
mitochondrial cytochrome genes. Mol Biochem Parasit0152:145-8.

Femandez-Silva, P., J. A. Enriquez, and J. Montoya. 2003. Replication and
transcription of mammalian mitochondrial DNA. Exp Physiol 88:41-56.

Fey, J ., and L. Marechal-Drouard. 1999. Compilation and analysis of plant
mitochondrial promoter sequences: An illustration of a divergent evolution

between monocot and dicot mitochondria. Biochem Biophys Res Commun
256:409-14.

Fisher, R. P., and D. A. Clayton. 1988. Purification and characterization of
human mitochondrial transcription factor 1. Mol Cell Biol 8:3496-509.

Furger, A., N. Schurch, U. Kurath, and I. Roditi. 1997. Elements in the 3'
untranslated region of procyclin mRNA regulate expression in insect forms of

Trypanosoma brucei by modulating RNA stability and translation. Mol Cell Biol
17:4372-80.

Gaspari, M., M. Falkenberg, N. G. Larsson, and C. M. Gustafsson. 2004. The
mitochondrial RNA polymerase contributes critically to promoter specificity in
mammalian cells. Embo J.

Grams, J ., M. T. McManus, and S. L. Hajduk. 2000. Processing of
polycistronic guide RN As is associated with RNA editing complexes in
Trypanosoma brucei. Embo J 19:5525-32.

Gray, M. W., G. Burger, and B. F. Lang. 2001. The origin and early evolution
of mitochondria. Genome Biol 2:REVIEWS 1018.

Gray, M. W., B. F. Lang, and G. Burger. 2004. Mitochondria of Protists. Annu
Rev Genet.

Gunter, T. E., D. I. Yule, K. K. Gunter, R. A. Eliseev, and J. D. Salter. 2004.
Calcium and mitochondria. FEBS Lett 567:96—102.

26

53.

54.

55.

56.

57.

58.

59.

60.

61.

62.

Haag, J., C. O'HUigin, and P. Overath. 1998. The molecular phylogeny of
trypanosomes: evidence for an early divergence of the Salivaria. Mol Biochem
Parasitol 91:37-49.

Hannaert, V., F. Bringaud, F. R. Opperdoes, and P. A. Michels. 2003.
Evolution of energy metabolism and its compartmentation in Kinetoplastida.
Kinetoplastid Biol Dis 2:11.

Hatzack, F., S. Dombrowski, A. Brennicke, and S. Binder. 1998.
Characterization of DNA-Binding Proteins from Pea Mitochondria. Plant Physiol
116:519-28.

Hedtke, B., T. Borner, and A. Weihe. 1997. Mitochondrial and chloroplast
phage-type RNA polymerases in Arabidopsis. Science 277 :809-1 1.

Hess, W. R., and T. Borner. 1999. Organellar RNA polymerases of higher
plants. Int Rev Cytol 190:1-59.

Hoffmann, M., and S. Binder. 2002. Functional importance of nucleotide

identities within the pea atp9 mitochondrial promoter sequence. J Mol Biol
320:943-50.

Ikeda, T. M., and M. W. Gray. 1999. Characterization of a DNA-binding
protein implicated in transcription in wheat mitochondria. Mol Cell Biol 19:8113-
22.

Ikeda, T. M., and M. W. Gray. 1999. Identification and characterization of
T3/I‘7 bacteriophage-like RNA polymerase sequences in wheat. Plant Mol Biol
40:567-7 8.

Jacobs, M. A., S. R. Payne, and A. J. Bendich. 1996. Moving pictures and
pulsed-field gel electrophoresis show only linear mitochondrial DNA molecules

from yeasts with linear-mapping and circular-mapping mitochondrial genomes.
Curr Genet 30:3-1 l.

Jang, S. H., and J. A. Jaehning. 1991. The yeast mitochondrial RNA
polymerase specificity factor, MTF 1, is similar to bacterial sigma factors. J Biol
Chem 266:22671-7.

27

63.

65.

66.

67.

68.

69.

70.

71.

72.

Karlberg, O., B. Canback, C. G. Kurland, and S. G. Andersson. 2000. The
dual origin of the yeast mitochondrial proteome. Yeast 17:170-87.

Koslowsky, D. J ., G. R. Riley, J. E. Feagin, and K. Stuart. 1992. Guide RNAS
for transcripts with developmentally regulated RNA editing are present in both
life cycle stages of Trypanosoma brucei. Mol Cell Biol 12:2043-9.

Kurland, C. G., and S. G. Andersson. 2000. Origin and evolution of the
mitochondrial proteome. Microbiol Mol Biol Rev 64:786-820.

Lee, H. K. 2004. Mitochondrial pathogenesis from genes and apoptosis to aging
and disease. Overview. Ann N Y Acad Sci 1011: 1-6.

Lee, M. G. 1998. The 3' untranslated region of the hsp 70 genes maintains the
level of steady state mRN A in Trypanosoma brucei upon heat shock. Nucleic
Acids Res 26:4025-33.

Lukes, J ., D. L. Guilbride, J. Votypka, A. Zikova, R. Benne, and P. T.
Englund. 2002. Kinetoplast DNA network: evolution of an improbable structure.
Eukaryot Cell 1:495-502.

Lurin, C., C. Andres, S. Aubourg, M. Bellaoui, F. Bitton, C. Bruyere, M.
Caboche, C. Debast, J. Gualberto, B. Hoffmann, A. Lecharny, M. Le Ret, M.
L. Martin-Magniette, H. Mireau, N. Peeters, J. P. Renou, B. Szurek, L.
Taconnat, and 1. Small. 2004. Genome-wide analysis of Arabidopsis
pentatricopeptide repeat proteins reveals their essential role in organelle
biogenesis. Plant Cell 16:2089-103.

Mahmood, R., J. C. Hines, and D. S. Ray. 1999. Identification of cis and trans
elements involved in the cell cycle regulation of multiple genes in Crithidia
fasciculata. Mol Cell Biol 19:6174-82. '

Mangus, D. A., S. H. Jang, and J. A. Jaehning. 1994. Release of the yeast
mitochondrial RNA polymerase specificity factor from transcription complexes. J
Biol Chem 269:26568-74.

Martinez-Calvillo, S., S. Yan, D. Nguyen, M. Fox, K. Stuart, and P. J. Myler.
2003. Transcription of Leishmania major Friedlin chromosome 1 initiates in both
directions within a single region. Mol Cell 11:1291-9.

28

73.

74.

75.

76.

77.

78.

79.

80.

81.

82.

Masters, B. S., L. L. Stohl, and D. A. Clayton. 1987. Yeast mitochondrial RNA
polymerase is homologous to those encoded by bacteriophages T3 and T7. Cell
51:89-99.

Matsunaga, M., and J. A. Jaehning. 2004. Intrinsic promoter recognition by a
"core" RNA polymerase. J Biol Chem 279:44239-42.

Matsushima, Y., R. Garesse, and L. S. Kaguni. 2004. Drosophila mitochondrial
transcription factor B2 regulates mitochondrial DNA copy number and
transcription in schneider cells. J Biol Chem 279:26900-5.

McCulloch, V., B. L. Seidel-Rogol, and G. S. Shadel. 2002. A human
mitochondrial transcription factor is related to RNA adenine methyltransferases
and binds S-adenosylmethionine. Mol Cell Biol 22: l 1 16-25.

McCulloch, V., and G. S. Shadel. 2003. Human mitochondrial transcription
factor B1 interacts with the C-terminal activation region of h-mtTFA and

stimulates transcription independently of its RNA methyltransferase activity. Mol
Cell Biol 23:5816-24.

Michelotti, E. F., and S. L. Hajduk. 1987. Developmental regulation of
trypanosome mitochondrial gene expression. J Biol Chem 262:927-32.

Michelotti, E. F., M. E. Harris, B. Adler, A. F. Torri, and S. L. Hajduk. 1992.
Trypanosoma brucei mitochondrial ribosomal RNA synthesis, processing and
developmentally regulated expression. Mol Biochem Parasitol 54:31-41.

Myler, P. J ., D. Glick, J. E. Feagin, T. H. Morales, and K. D. Stuart. 1993.
Structural organization of the maxicircle variable region of Trypanosoma brucei:
identification of potential replication origins and topoisomerase H binding sites.
Nucleic Acids Res 21:687-94.

Nok, A. J. 2003. Arsenicals (melarsoprol), pentamidine and suramin in the
treatment of human African trypanosomiasis. Parasitol Res 90:71-9.

Oda, K., K. Yamato, E. Ohta, Y. Nakamura, M. Takemura, N. Nozato, K.
Akashi, T. Kanegae, Y. Ogura, T. Kohchi, and et al. 1992. Gene organization
deduced from the complete sequence of liverwort Marchantia polymorpha

mitochondrial DNA. A primitive form of plant mitochondrial genome. J M01 Biol
223: 1-7.

29

83.

84.

85.

86.

87.

88.

89.

90.

91.

92.

Osinga, K. A., M. De Haan, T. Christianson, and H. F. Tabak. 1982. A
nonanucleotide sequence involved in promotion of ribosomal RNA synthesis and
RNA priming of DNA replication in yeast mitochondria. Nucleic Acids Res
10:7993-8006.

Parsons, M. 2004. Glycosomes: parasites and the divergence of peroxisomal
purpose. Mol Microbiol 53:717-24.

Pollard, V. W., and S. L. Hajduk. 1991. Trypanosoma equiperdum minicircles
encode three distinct primary transcripts which exhibit guide RNA characteristics.
Mol Cell Biol 11:1668-75.

Pollard, V. W., S. P. Rohrer, E. F. Michelotti, K. Hancock, and S. L. Hajduk.
1990. Organization of minicircle genes for guide RNAS in Trypanosoma brucei.
Cell 63:783-90.

Priest, J. W., and S. L. Hajduk. 1994. Developmental regulation of
mitochondrial biogenesis in Trypanosoma brucei. J Bioenerg Biomembr 26: 179-
91.

Rantanen, A., M. Gaspari, M. Falkenberg, C. M. Gustafsson, and N. G.
Larsson. 2003. Characterization of the mouse genes for mitochondrial
transcription factors B1 and B2. Mamm Genome 14: 1-6.

Rehkopf, D. H., D. E. Gillespie, M. I. Harrell, and J. E. Feagin. 2000.
Transcriptional mapping and RNA processing of the Plasmodium falciparum
mitochondrial mRNAs. Mol Biochem Parasitol 105:91-103.

Ridgley, E. L., Z. H. Xiong, and L. Ruben. 1999. Reactive oxygen species
activate a Ca2+-dependent cell death pathway in the unicellular organism
Trypanosoma brucei brucei. Biochem J 340 (Pt l):33-40.

Rodeheffer, M. S., B. E. Boone, A. C. Bryan, and G. S. Shadel. 2000. Namlp,
a protein involved in RNA processing and translation, is coupled to transcription

through an interaction with yeast mitochondrial RNA polymerase. J Biol Chem
15:15.

Sanchez, J. P., Y. Murakami, J. A. Huberman, and J. Hurwitz. 1998.
Isolation, characterization, and molecular cloning of a protein (Abp2) that binds

30

 

93.

94.

95.

96.

97.

98.

99.

100.

101.

to a Schizosaccharomyces pombe origin of replication (ars3002). Mol Cell Biol
18:1670-81.

Santiago, J ., and C. G. Vallejo. 1998. Identification of a mitochondrial RNA
polymerase in the crustacean Artemia franciscana. Arch Biochem Biophys
353:276-84.

 

Sasaki, N., H. Kuroiwa, C. Nishitani, H. Takano, T. Higashiyama, T.
Kobayashi, Y. Shirai, A. Sakai, S. Kawano, K. Murakami-Murofushi, and T.
Kuroiwa. 2003. Glom is a novel mitochondrial DNA packaging protein in

Physarum polycephalum and causes intense chromatin condensation without
suppressing DNA functions. Mol Biol Cell 14:4758-69.

‘ "’1

Schnaufer, A., G. J. Domingo, and K. Stuart. 2002. Natural and induced 1
dyskinetoplastic trypanosomatids: how to live without mitochondrial DNA. Int J
Parasitol 32: 1071-84.

Schubot, F. D., C. J. Chen, J. P. Rose, T. A. Dailey, H. A. Dailey, and B. C.
Wang. 2001. Crystal structure of the transcription factor sc-mtTFB offers insights
into mitochondria] transcription. Protein Sci 10: 1980-8.

Schurch, N., A. Furger, U. Kurath, and I. Roditi. 1997. Contributions of the
procyclin 3' untranslated region and coding region to the regulation of expression
in bloodstream forms of Trypanosoma brucei. Mol Biochem Parasitol 89: 109-21.

Seidel-Rogol, B. L., V. McCulloch, and G. S. Shadel. 2003. Human
mitochondrial transcription factor Bl methylates ribosomal RNA at a conserved
stem-loop. Nat Genet 33:23-4.

Shadel, G. S., and D. A. Clayton. 1996. Mapping promoters in displacement-
loop region of vertebrate mitochondrial DNA. Methods Enzymol 264:139-48.

Shadel, G. S., and D. A. Clayton. 1995. A Saccharomyces cerevisiae
mitochondrial transcription factor, sc- mtTFB, shares features with sigma factors
but is functionally distinct. Mol Cell Biol 15:2101-8.

Simpson, L. 1997. The genomic organization of guide RNA genes in
kinetoplastid protozoa: several conundrums and their solutions. Mol Biochem
Parasitol 86:133-41.

31

102.

103.

104.

105.

106.

107.

108.

109.

110.

111.

112.

Simpson, L. 1986. Kinetoplast DNA in trypanosomid flagellates. Int Rev Cytol
99:119-79.

Smeitink, J ., L. van den Heuvel, and S. DiMauro. 2001. The genetics and
pathology of oxidative phosphorylation. Nat Rev Genet 2:342-52.

Stuart, K., and J. E. Feagin. 1992. Mitochondrial DNA of kinetoplastids. Int
Rev Cytol 141:65-88.

Stuart, K., and A. K. Panigrahi. 2002. RNA editing: complexity and
complications. Mol Microbiol 45:591-6.

Taanman, J. W. 1999. The mitochondrial genome: structure, transcription,
translation and replication. Biochim Biophys Acta 1410: 103-23.

Teixeira, S. M., and W. D. daRocha. 2003. Control of gene expression and
genetic manipulation in the Trypanosomatidae. Genet Mol Res 2: 148-58.

Thomas, J. O., and A. A. Travers. 2001. HMG] and 2, and related 'architectural'
DNA-binding proteins. Trends Biochem Sci 26: 167-74.

Tiranti, V., A. Savoia, F. Forti, M. F. D'Apolito, M. Centra, M. Rocchi, and
M. Zeviani. 1997. Identification of the gene encoding the human mitochondrial
RNA polymerase (h-mtRPOL) by cyberscreening of the Expressed Sequence
Tags database. Hum Mol Genet 6:615-25.

Torri, A. F ., K. I. Bertrand, and S. L. Hajduk. 1993. Protein stability regulates
the expression of cytochrome c during the developmental cycle of Trypanosoma
brucei. Mol Biochem Parasitol 57:305-15.

Unseld, M., J. R. Marienfeld, P. Brandt, and A. Brennicke. 1997. The
mitochondrial genome of Arabidopsis thaliana contains 57 genes in 366,924
nucleotides. Nat Genet 15:57-61.

Vanhamme, L., and E. Pays. 1995. Control of gene expression in trypanosomes.
Microbiol Rev 59:223—40.

32

 

113.

114.

115.

116.

117.

118.

Wallace, D. C. 1999. Mitochondrial diseases in man and mouse. Science
283: 1482-8.

Wang, Y., and G. S. Shadel. 1999. Stability of the mitochondrial genome
requires an amino-terminal domain of yeast mitochondrial RNA polymerase. Proc
Natl Acad Sci U S A 96:8046-51.

Ward, B. L., R. S. Anderson, and A. J. Bendich. 1981. The mitochondrial
genome is large and variable in a family of plants (cucurbitaceae). Cell 25:793-
803.

Worthey, E. A., S. Martinez-Calvillo, A. Schnaufer, G. Aggarwal, J.
Cawthra, G. Fazelinia, C. Fong, G. Fu, M. Hassebrock, G. Hixson, A. C.
Ivens, P. Kiser, F. Marsolini, E. Rickell, R. Salavati, E. Sisk, S. M. Sunkin, K.
D. Stuart, and P. J. Myler. 2003. Leishmania major chromosome 3 contains two

long convergent polycistronic gene clusters separated by a tRNA gene. Nucleic
Acids Res 31:4201-10.

Xu, B., and D. A. Clayton. 1992. Assignment of a yeast protein necessary for
mitochondrial transcription initiation. Nucleic Acids Res 20: 1053-9.

Young, D. A., R. L. Allen, A. J. Harvey, and D. M. Lonsdale. 1998.
Characterization of a gene encoding a single-subunit bacteriophage-type RNA
polymerase from maize which is alternatively spliced. Mol Gen Genet 260:30-7.

33

CHAPTER II

An intragenic guide RNA location suggests a complex mechanism for mitochondrial

gene expression in Trypanosoma brucei

34

""1

INTRODUCTION

Trypanosoma brucei is a parasitic protozoan with an extraordinarily complex
mitochondrial genome. This genome, the kinetoplast, consists of a network of thousands
of 1 kb minicircles unique to kinetoplasts and 50 copies of a 22 kb maxicircle that is
analogous to mitochondrial DNA in other organisms (25). The mRNAs produced from
most maxicircle genes must be edited by the insertion or deletion of uridylate residues to
create mature transcripts. This process is mediated by small, complementary guide
RNAS (gRNAs) encoded on minicircle DNA. The process of editing occurs post—
transcriptionally and has been studied extensively (for recent reviews see (18, 26, 27).
However, the initial step in mitochondrial gene expression, transcription, has been largely
ignored.

While no kinetoplast (kDNA) promoter elements have been described to date,
there are regions from which transcription has been shown to initiate. In T. brucei, most
minicircle gRNA genes encode primary transcripts located within cassettes of imperfect
inverted 18 bp repeats (15 , 22). These inverted repeats have been implicated in playing a
role in transcription. However, there have been no direct tests of their function in
transcription initiation. Although precise maxicircle transcription start sites have not
been identified, transcription of the major strand has been shown to begin at least 1200 nt
upstream of the 5’ end of the mature 12S rRNA and proceed polycistronically (19).
Mature transcripts are rapidly processed from this precursor, often by mutually exclusive
events as many of the coding regions overlap (17, 23). Transcripts corresponding to
the maxicircle minor strand are also present (20), but the transcription start site has not

been identified.

35

7‘51

Observations from relatives of T. brucei indicate that not all maxicircle genes are
transcribed as part of a polycistronic precursor. The maxicircles of both Leishmania
tarantolae and Crithidiafasciculata encode numerous gRNAs located primarily within
intergenic spaces (2, 29). Many of these mature gRNAs are primary transcripts (3),
indicating that several transcription units exist on these maxicircle genomes. In contrast,
the coding region of the T. brucei maxicircle is much more compact and is thought to
encode only 2 gRNAs (29) (Figure 1). Interestingly, both of these gRNAs are located
within mRNA coding sequences. The COII guide RNA, gCOII, is unusual in that it is
encoded within the 3’ end of the C011 mRNA and is thought to function in cis as no
discrete gCOII transcript has been detected (2, 17). The other gRNA, gMURF2-II has
not been tested for expression. This gene is located within the 5’ end of the ND4
message, indicating that the gRNA and the mRN A could be generated via mutually
exclusive processing events from a precursor RNA. Intriguingly, this gRNA is also
located downstream of one of three intergenic regions on the compact maxicircle, raising
the possibility that the gMURF2-II gene is a discrete transcription unit regulated by a
promoter located within this region. This locus therefore represents a unique region on
the T. brucei maxicircle that may be regulated by alternative processing and/or
transcription initiation events.

In order to further characterize potential transcription units in T. brucei kDNA, we
sought to more closely investigate the product of the conserved maxicircle gMURF2-II
gene. This gRNA is expressed exclusively from the maxicircle gMURF2-II locus and is
contained entirely within the 5’ end of the ND4 gene. Characterization of the structure of

the 5’ ends of the gMURF2-II and the ND4 transcripts demonstrates that the gMURF2-II

36

 

RNA is a primary transcript while ND4 mRNA is processed, likely from the polycistronic
precursor. In addition, to examine unusual minicircle transcription units, we investigated
the expression of gCYb(560), which is not located between inverted repeats. This gRN A
is also a primary transcript indicating that minicircle gRNA transcription initiation
signals exist outside the inverted repeat regions. These results imply that gRNA genes
operate as individual transcription units, regardless of genomic context, and suggest a r—

complex mechanism of transcription and processing of mitochondrial transcripts.

 

MATERIALS AND METHODS

Cell growth and mitochondrial isolation. Procyclic Trypanosoma brucei, EATRO 164,
IsTaR 1 serodeme, derived from VAT 1.7 clone A was grown in SDM-79 medium
supplemented with 5% Fetal Bovine Serum (Sigma) at 27°C. Mitochondrial isolations
were prepared from cells harvested at a density of ~3 x 107 cells ml'l. Cells were lysed in
a dounce homogenizer under hypotonic conditions and mitochondrial vesicles were
isolated on Nycodenz step gradients as described (13). In order to obtain precursor
transcripts for the ligation experiments, isolated mitochondria were incubated in
transcription buffer (5mM HEPES, pH 7.6, 3 mM potassium phosphate pH 7.7, 125 mM
sucrose, 6mM KC], 10 mM MgC12, 1 mM EDTA, 2 mM DTT) and 100 M rNTPs for
30 minutes (12). Mitochondria were snap frozen in a dry ice ethanol bath, and stored at -
80° C prior to RNA extraction described below.

Oligonucleotide probes and primers. All DNA oligonucleotides were synthesized by
IDT. The RNA oligo was synthesized by Dharrnacon. Forward primers (F) match the

RNA sequence while reverse (R) primers are complementary.

37

gMURF2-II F: 5’-GAAAGCACAAAAATAAAATTAAATTAGAG-3’
gMURF2-H R: 5’-CATTCAATTACTCTAA'I'ITAATTTTAT'IT1TGTGC-3’
gA6-14sU R: 5 ’TAATTATCATATCACTGTCAAAATCTGATTCGTI‘ATC
GGAG'ITATAGCCCTATAGTGAGTCGTATT AAATT-3’
gND7(506) R: 5’-CACTAACTATACTACAGGTTATTTACATCG-3’
gCYb-(560A/B) R: 5’-CCTCCCYATTACTCAGAAATCTACATTGTC-3’
oli go dA-XBS R: 5’-GATCTAGAGGATCCCGGGAAAAAAAAAAAAAAA3’
XBS F: 5’-GATCTAGAGGATCCCGGG-3’
RNA oligo: 5’ AGAUUUUGACAGUGAUAUGAUAAUUA 3’
Nucleic acid Isolation, Northern and Southern blot analysis. Total T. brucei genomic
DNA was isolated as described previously (8). Mitochondrial RNA was isolated by the
acid guanidinium-phenol-chloroform method (7). Guide RNA was gel purified on a 6%
8M urea acrylamide gel. For Northern blot analysis, mitochondrial RNA was
electrophoresed on a 5% 37.5: 1, 8 M urea acrylamide gel and transferred to Nytran
(Schleicher & Schuell) using a semi-phor electroblotter (Hoeffer). Northern and
Southern blots were hybridized with 32F end-labeled Oligonucleotide probes using
standard conditions.
5’ and 3’ end mapping. Gene specific DNA oligonucleotides were labeled with 7-32P
ATP using T4 polynucleotide kinase (Invitrogen) and gel purified on a 12% 8M urea
acrylamide gel. 2.5 1.1g of mitochondrial RNA was reverse transcribed as previously
described (8) in the presence of 100 kCPM of primer. RNA sequencing ladders were
generated by adding equal amounts of deoxy- and dideoxy- (ATP or TI‘P) in the

extension reaction. Reactions were stopped by the addition of an equal volume of 95%

38

 

formamide gel-loading buffer and resolved on an 8%, 8M urea acrylamide sequencing
gel. Gels were fixed in 7% acetic acid + 7% methanol, dried, and exposed on film.
Enzymatic treatments of RNA. 10 ug of mitochondrial RNA (mtRNA) or 2 ug of gel
purified gRNA was dephosphorylated with alkaline phosphatase (New England Biolabs)
following manufacturer’s instructions. Both untreated and phosphatased RNA (5.0 ug
mtRNA or 1.0 ug gRNA) was phosphorylated with T4 polynucleotide kinase (Invitrogen)
supplemented with 1 mM ATP. The alkaline phosphatase was inactivated with
proteinase K digestion prior to phenol/chloroform extraction. All enzymatic reactions
were terminated by phenol/chloroform extraction followed by ethanol precipitation in the
presence of linear acrylamide carrier.

RNA ligations and poisoned primer extension analysis. A 26 nt long synthetic RNA
Oligonucleotide (Dharmacon) was used as the acceptor RNA in all ligation reactions.
This RNA oligo possesses a 5’ OH and is consequently unable to serve as a donor
molecule in the ligation reaction. 5.0 ug mtRNA or 0.5 ug gRNA was used in each
ligation. Untreated, alkaline phosphatase treated, kinase treated, or alkaline phosphatase
followed by kinase treated RNA was mixed with 200 pmol of the acceptor RNA oligo
(>6-fold molar excess) and incubated overnight at room temperature with 20 units of T4
RNA ligase (New England Biolabs) in the supplied 1X buffer supplemented with 40%
PEG-400. The ligations were phenol/chloroform extracted, ethanol precipitated, and
resuspended in 1X reverse transcription buffer (50 mM KCl, 20 mM Tris, pH 8.5, 0.5
mM EDTA, 8 mM MgClz). Poisoned primer extension reactions were performed on each
population of ligated RNA (1.0 ug of mtRNA or 0.1 ug of gRNA) with 100 kCPM (~ 50

fmol) of primer in the presence of 1.6 mM each dATP, dCTP, dTTP and ddGTP as

39

 

 

described previously (8). Reactions were resolved on an 8%, 8M urea acrylamide
sequencing gel. Gels were fixed in 7% acetic acid + 7% methanol, dried, and exposed on
a phosphorimager cassette (Molecular Dynamics). For each gel, the signal for the ligated
and unligated products was quantified using ImageQuant software (Molecular Dynamics)
and the percent ligation efficiency was represented as the amount of ligated

product/(ligated product + unli gated product)* 100.

RESULTS
gMURFZ-II maxicircle localization and expression.

In T. brucei, the gMURF2-H gene is located within the ND4 coding region
downstream of one of three mapped regions of intergenic space on the maxicircle (Figure
1). Although the position of the gMURF2-II gene is conserved in L. tarantolae and C.

fasciculata, in these organisms transcription initiates within an intergenic region
upstream of ND4. The gMURF2-II transcript has been detected in both Leishmania and
C rithidia as a discrete RNA (1, 2) and has been shown to be a primary transcript in
Leishmania (3). Conservation of the gMURF2-II gene in T. brucei indicates the
possibility of a promoter element within the coding region of maxicircle genome in spite

of the extensive overlap between the gRNA and mRNA genes.

40

Linearized map of the coding region of the T. brucei maxicircle.

 

12$

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

9002 gMURFz-ll
[1 [1 cos A6 c02 r RPS12
N08 ND? CYb CR3 - MURF2 ND4 N05
9s ‘Il;
E3133?; 2 . TH __.
N09 MURFS MURF1 ND1 COl CR4 CF15

Figure 1 Major and minor strand genes are represented above or below the line,

respectively. Overlapping regions are stippled. Intergenic spaces are indicated by white

arrows. The gRNA sequences are represented by black flags. MURF, Maxicircle

Unidentified Reading Frame; CR, “C” — rich; CO, cytochrome oxidase; A6, ATPase 6;

ND, NADH dehydrogenase; CYb, apocytochrome b; RPSl2, ribosomal protein subunit

12.

FIGURE 1

41

In order to confirm that the gMURF2-II RNA was indeed expressed in T. brucei,
we performed a Northern blot on isolated mitochondrial RNA (mtRNA) using an
Oligonucleotide probe complementary to both the gMURF2-II gRNA as well as the 5’
end of the ND4 message. As shown in Figure 2A (lanes 1-3), the gMURF2-II probe
hybridizes to a small RNA of about 60-70 nt representing the gMURF2-II RNA, as well
as to the ~1.3 kb ND4 transcript. The gRNA signal detected by the gMURF2-II probe is [—-
similar in size to the minicircle encoded gRNA, gA6(14), as seen in the blot probed with

an oligo complementary to gA6( 14) in lane 4.

 

 

Since the majority of the gRNAs are encoded in minicircle DNA in T. brucei, we
performed a Southern blot of T. brucei DNA in order to confirm the maxicircle location
of the gMURF2-II gene. As seen in the left panel in Figure 2B, the gMURF2-II probe
hybridizes exclusively to the predicted maxicircle fragments and not to the ~1 kb
minicircle DNA. In contrast, a probe against a minicircle encoded gRNA, gA6(14),
hybridizes exclusively to the predicted minicircle fragments (15) (right panel, Fig. 2B).
These results confirm that no additional copies of the gMURF2-II gene exist in the
kinetoplast genome and that this gRNA must be transcribed from this region of

maxicircle DNA.

42

Figure 2. Expression of the gMURF2-II gene. (A) Northern blot of 1 pg (lane 1), 2.5 pg
(lane 2), 5 ug (lane 3), or 10 ug (lane 4)of mitochondrial RNA probed with an
oligonucleotide complementary to the gMURF2-II (lanes 1-3) or an oligonucleotide
complementary to the minicircle gRNA, gA6(14) (lane 4). The gMURF2-II probe
detects both the ~65 nt gRNA transcript as well as the ~1.3 kb ND4 mRNA, while the
gA6(14) probe hybridizes to a gRNA band only. (B) Restriction digest and Southern
blot analysis of T. brucei genomic DNA. 3 ug of DNA was digested with HindIII (lane
1), HindIII + EcoRI (lane 2), or EcoRI (lane 3), separated on a 1% agarose gel,
transferred to a nytran membrane and probed with an end-labeled gMURF2-II oli go (left
panel). The blot was then stripped and re-hybridized with an end-labeled gA6(14) probe
(right panel). (C) Restriction maps of the T. brucei maxicircle and the gA6(14)

minicircle (HindIII, H; EcoRI, E).

43

 

gMURFZ-II RNA expression and maxicircle localization

 

 

 

Lb;
1.4 -
1.1 -
0.6 —
0.24 —
~o.07 -
gMURF2-II 9‘5““)
E H E H E H E H E
I l I J | I J n I
- fl : :
1- N O U! Q h
to V .—

§ 8 h j: g: g Mlnlclrcle ,3

Maxlclrcle 996bp

22294 bp

FIGURE2

The gMURF2-II gene is located within the ND4 gene downstream of an intergenic
region.

In order to determine the exact location of the gMURF2-H gene, we mapped both
the 5’ and 3’ ends of the gRNA transcript. The 5’ end of gMURF2-II was mapped using
a primer extension assay. The same gMURF2-II probe used in the Northern blot in
Figure 2 was used in the extension experiment and is underlined in Figure 3A. Because
the 5’ end of ND4 overlaps with the gMURF2-II gRNA sequence, this probe hybridizes
to both transcripts to produce two major extension products. As shown in Figure 3B, the
smaller of the two is located 7 nt from the 3’ end of the primer while the larger is 13 nt
from the 3’ end of the primer and corresponds to the mapped 5’ end of ND4 (9). Two
additional minor products of 17 nt and 19 nt are also visible (Figure 3B, lane 1). In order
to determine which of these bands corresponded to the 5’ end of gMURF2-II, the primer
extension analysis was performed on gel purified gRNAs (Figure 3B, lane 2). In this
lane, only the 7 nt product is present, demonstrating that this band represents the 5’ end
of the gMURF2-II transcript while the two larger products in lane 1 represent alternate,
minor mRNA 5’ ends. The maxicircle sequence within this region and the location of the
mapped 5’ ends of the major and minor strand products are shown in Figure 3A. This
result demonstrates that the 5’ end of the gMURF2-II gene is located downstream of the
5’ end of the ND4 gene, within the 5’ UTR.

The 3’ end of the gMURF2-H gRNA was mapped using 3’ RACE. cDNA was
synthesized from mtRNA using a 5’ tagged oligo-d(A) primer which hybridizes to the
poly(U) tail common to the 3’ end of all gRNAs. The PCR product obtained using a

gMURF2-II gene specific primer and a tag-specific primer was sequenced to identify the

45

 

 

. .11

r“.

,1 it;
I

11.1;

. . JP'
ILI-L

:W'

‘.' ‘5‘
. g».
D

1!”)!-
“ML

Figure 3. (A) Nucleotide sequence of the gMURF2-II locus including the mapped 5’
ends of gMURF2-II and ND4 transcripts as well as the minor strand CR4 gene (24). The
5’ end of the gRNA was determined by primer extension analysis using the gMURF2-IIR
primer indicated by the arrow underneath the sequence. The 3’ end of the gRNA
indicated was obtained by sequencing RT-PCR products. The start codon for ND4 is
underlined. (B) Primer extension mapping of gMURF2-II and ND4 5’ ends. End labeled
gMURF2-IIR primer was extended in the presence of 1 ug mitochondrial RNA (lane 1)
or gel-purified guide RNA (lane 2). Nucleotide sequence was obtained via primer
extension of total mitochondrial RNA in the presence of ddA, or ddT (lanes 3 and 4,
respectively). Extension products were run on an 8% acrylamide-urea gel. The 5’ ends
of the gRNA and mRNA are indicated by arrows. Two minor mRNA products are

marked with asterisks.

46

Mapping the 5’ ends of gMURFZ-II and ND4

ND4 gRNA 5’ gRNA 3’
* V

V l
AAATTATAAGAAGGAAATTTATAGAAAGCACAAAAATAAAATTAAATTAGAG'I‘AATTGAA'I‘GTTAAAAT‘I|

C 4 ‘

a:
. mtRNA
gRNA
3 ddA
ddT

 

‘— ND4

4— gMURFz-ll

 

3
:1”; E
. .15. g
3

 

FIGURE 3

47

3’ end of the gRNA(data not shown). As seen for many gRNAs, the 3’ end of the
gMURF2-II ends in a short stretch of T’s. (Indicated in the sequence shown in Figure
3A) (28). Since gRNAs are post-transcriptionally modified by the addition of a short,
poly(U) tail (3), it is unclear whether the 3’ end of this gRNA is generated via
transcription termination at this site or processing of a larger transcript. Together, the
results of the 5’ and 3’ mapping of the gMURF2-II gRNA demonstrate that the gRNA is
encoded completely within the ND4 gene. Although it is common for maxicircle genes
to overlap in T. brucei, this is the first case in which discrete intragenic transcript has

been detected.

The mature gMURFZ-II and ND4 transcripts are generated via different events.
Studies of mitochondrial gene expression in T. brucei have shown that the maxicircle
is transcribed as a polycistronic precursor which is rapidly processed into mature
transcripts (19). Due to the close packing and overlap of genes on the maxicircle, the
generation of mature transcripts often involves mutually exclusive events (17, 23).
According to this model of polycistronic transcription, the intragenic location of the
gMURF2-II gRN A suggests that either the gMURF2-II or the ND4 transcript could be
made from a given precursor RNA, but not both. However, minicircle gRNAs in T.
brucei are primary transcripts as are both the minicircle and maxicircle gRNAs from
Leishmania and Crithidia. Consequently, gMURF2-II may in fact be a primary rather
than a processed transcript. In addition, if a promoter does exist within the intergenic
region upstream of the gMURF2-II/ND4 region, it is possible that ND4 and/or other

downstream mRN As are primary transcripts.

48

In order the distinguish among these possibilities, we employed a modified version
of a technique described by Bruderer et. al. (4) to characterize the structure of the 5’ ends
of gMURF2-II and ND4. Mitochondrial transcripts do not possess the 5’ cap structure
seen in most nuclear RNAS. Consequently, primary transcripts possess tri-phosphate 5’
ends while processed transcripts have monophosphate 5’ ends. This technique takes
advantage of the specificity of the enzyme T4 RNA ligase to ligate an RNA oligo to the
5’ end of transcripts bearing a monophosphate moiety. Transcripts with a di- or tri-
phosphate or hydroxyl group at the 5’ end will not serve as substrates for this enzyme.
Thus, a processed transcript will ligate to an exogenous RNA linker oligo, while primary
transcripts will not. The negative control consists of a phosphatase treatment that results
in all transcripts bearing unligatable 5’ OH ends. Subsequent treatment of phosphatased
RNAs with kinase results in 5’ monophosphorylated molecules that serve as the positive
control for ligation. It is the comparison of the ability of the various treated samples to
li gate to the RNA oligo that allows one to infer the nature of the 5’ end of the molecule.
Primary transcripts, by nature of their polyphosphate ends, will remain unligated in all
but the positive control, while processed transcripts will ligate in all but the negative
control. Figure 4A shows the predicted ligation outcome for each treatment for a
processed and a primary transcript.

We subjected mitochondrial RNA or gel-purified guide RNA to the various
treatments and incubated them in the presence of T4 RNA ligase and a 26 nt synthetic
RNA oligo containing a single C residue 17 nt from the 3’ end (Figure 4B). We then

performed a poisoned primer extension analysis in the presence of ddGTP to compare the

49

Figure 4. Ligation dependent poisoned primer extension assay on total mitochondrial
RNA and gel purified gRNA. (A) Table of the expected ligation outcomes for processed
and primary transcripts subjected to various enzymatic treatments. Treatments: U,
untreated; K, kinase; AP, alkaline phosphatase; AP/K, alkaline phosphatase followed by
kinase; no ligase, untreated RNA not subjected to ligation. (B) Nucleotide sequence of
the synthetic RNA oligo (lowercase italics) and the 5’ end of ND4/gMURF2-Il (capital
letters). The 3’ ends of the primers used in the extension reactions are underlined and the
sizes of the expected products are indicated by arrows. (C) Primer extension products
were electrophoresed on 8% acrylamide-urea gels. The 7nt unligated gMURF2-II
product is visible in all treatments but the positive control (AP/K), while the 13 nt
unligated ND4 product is present only in the negative control (AP). (D) Nucleotide
sequence of the synthetic RNA oligo (lowercase italics) and the 5’ end of gND7-506
(capital letters). The minicircle e encoded gND7(506) remains unli gated in all but the
positive control (AP/K). Asterisks in (C) indicate the minor mRN A 5’ ends seen in

FIGURE 2A, and the corresponding ligation products.

50

Ligation-dependent poisoned primer assay for gMURF2-II and ND4

 

 

A
Ligation? (YIN)
U AP K AP+K Noligase
Processed Y N Y Y N
Primary N N N Y N
B
5' ., .. g: .. u .. AAAUUUAUAGAAAGCACAA. ..
30 nt -mRNA 13 nt 7 nt
24 nt-gRNA mRNA gRNA
0
c 8
¥ é” ¥
0. o a
U AP K < 2 U AP K <

 

 

 

 

FIGURE 4

51

Ligation dependent poisoned primer assay for gND7-506

D
5’gND7-506 RNA
5’agauuuuga(fagugauaugauaauua AAAUACGAUGU. . .
22 nt 5m
0
a
a
E E” E
n. o a
U AP _K < 2 U APK‘ft

 
 

FIGURE 4 (cont’d)

52

ability of various transcripts to ligate to the RNA oligo. This assay was sensitive enough
to allow us to directly analyze the ligation results without the subsequent PCR step
described in the original technique. A representative gel is shown in Figure 4C. As
expected, neither the gRNA nor the mRN A ligates in the negative control sample treated
with alkaline phosphatase (Figure 4C, lane 2). The predominant bands in this lane
represent the 7m gMURF2-H 5’ end and the 13 nt ND4 5’ end. The larger bands seen at
17 and 19 nt represent the minor mRNA 5’ ends seen in Figure 3B. An identical result
was obtained in the no ligase negative control (Figure 4C, lane 5). The faint doublet
seen at ~30 nt in these two negative control lanes is difficult to explain. These bands
were not observed in the original primer extension mapping of 5’ ends (Figure 3B), and
may be a result of a variation in the mitochondrial isolation procedure. In order to
optimize detection of precursor transcripts, isolated mitochondria were incubated in
transcription buffer and rNTPs for 30 minutes before RNA isolation (12). Consequently,
this band may represent a minor precursor product that is typically not detected, and this
signal was subtracted from subsequent quantifications.

In contrast to the negative control lanes, both the N D4 and the gMURF2-H RN As do
ligate in the samples that were kinased following phosphatase treatment (Figure 4C, lane
4) as evidenced by the ddGTP stops seen at 24 nt and 30 nt for the gRNA and mRNA,
respectively, as well as the minor mRNA ligated bands seen at 34 and 36 nt.
Significantly, virtually no unligated gRN A or mRNA remain in this positive control lane,
indicating the efficiency of the enzymatic steps required for this experiment. Likewise,
the 13 nt unligated ND4 mRNA band is not visible in the untreated and kinase-only lanes

(lanes 1 and 3, respectively), although the ligated 30 nt mRNA band is present in these

53

lanes. This indicates that the majority of the ND4 mRNA possesses a 5’ monophosphate
at the 5’ end as expected for a transcript processed from a polycistronic precursor. In
contrast, the unligated 7 nt product corresponding the 5’ end of gMURF2-II is present all
lanes but the positive control, demonstrating that the majority of the gMURF2-II
population possesses an unligatable triphosphate end expected for a primary transcript.
The result for the guide RNA is more clearly visible in the right half of the panel in which
the treatments, ligation, and primer extension were performed on gel-purified gRNA.
Again, the 7 nt product corresponding to the 5’ end of the unligated gRNA is the
predominant product in all lanes but the positive control (Figure 4C, lane 9) in which
only the ligated band is visible.

Although the majority of the gMURF2-II remains unligated in the untreated lanes,
some ligation was observed for this treatment (Figure 4C). Consequently, to better
compare the ligatability of the gMURF2-II and ND4 transcripts, the signals
corresponding to the ligated and unligated products were quantified, and the ligation
efficiency for each RNA was calculated. Comparison of these values shows that ND4
has a ligation efficiency > 80% in all lanes but the negative control, while the gRNA
li gates appreciably only in the positive control lane (Figure 5). In addition, to confirm
that the pattern obtained for gMURF2-H was similar to that seen for other mitochondrial
primary transcripts, we performed this experiment using a primer complementary to the
minicircle-encoded gRNA, gND7(506) (16). Minicircle gRNAs have been shown to be
primary transcripts by their ability to be capped in vitro by the enzyme guanylyl
transferase (21). As seen for gMURF2-II, the gND7(506) RNA does not serve as an

efficient substrate for T4 RNA ligase unless first treated with alkaline

54

Relative Ligation Efficiencies

 

 

 

 

 

 

   

100 —
c 80 **
.9
E 60 ,E
_l
s 40 -r
20 *4
0 -1...
EEL__A%
unwell A :2
EgND7-506 11

FIGURE 5. Calculated RNA ligation efficiencies. Phosphor images of replicate gels
were analyzed using ImageQuant software (Molecular Dynamics). Percent ligation for
an RNA in a given treatment was calculated as ligated product/(ligated + unligated
product) X 100. The percent ligation for each transcript in each treatment is shown in the
bar graph and the values are shown below. ND4 values were calculated using only the
major unligated and ligated products. Error bars represent the standard deviation

obtained from the replicate gels.

FIGURE 5

55

phosphatase followed by kinase treatment (Figure 4D). The 5 at band corresponding to
the mapped 5’ end of the unligated gND7(506) RNA is the predominant band in all lanes
but the AP/K positive control (Figure 4D, lanes 4 and 9) in which only the 22 nt ligated
product is visible. Likewise, the ligation efficiency calculated for gND7(506) for each
treatment is similar to that observed for gMURF2-II (Figure 5).

Together, these results indicate that the majority of the gRNA populations tested
contain a triphosphate 5’ end. However, it is clear from the small amount of ligated
gRNA seen in the untreated lanes that a minor population does contain a monophosphate
5’ end. The 5’ phosphates of in vitro transcribed molecules have been observed via NMR
to be labile under normal storage and handling conditions resulting in a primary transcript
population containing a mixture of tri-, di-, and monophosphates (Dr. Charles
Hoogstraten, personal communication). However, we cannot rule out the possibility that
the minor population of ligatable gRNAs in the untreated lane is a result of a 5’
monophosphate generated by an endogenous mitochondrial ribonuclease. Despite the
presence of this small population, the pattern of ligatability for the processed mRN A is
clearly distinct from that of the primary gRN A transcripts, visibly reflecting the

difference in the structure of their 5’ ends.

An atypical minicircle gRNA not encoded within a cassette is also a primary
transcript but shows heterogeneity of start site selection.

The gene for the gND7(506) gRNA is located between 18 bp imperfect inverted
repeats, as are most minicircle gRNA genes. Each minicircle has on average 3 of these

cassettes (22). Transcription of these minicircle gRNAs initiates a fixed distance

56

 

downstream of the 3’ end of the upstream repeat, leading to speculation that the repeat
sequences play a role in transcription. In addition, the stability of the resulting gRNA
seems to depend upon transcription initiation at this location as downstream gRNAs
transcribed when the mitochondrial RNA polymerase reads through the upstream cassette
are degraded (10). However, some gRNA cassettes lack functional gRNA genes while
other gRNA genes are not located within cassettes (14). The gRNAs that mediate the
initial editing of the CYb message are not located within inverted repeats. These gRNAs
(gCYb(558) and gCYb(560A/B) are redundant but not identical and are located on
closely related minicircles that each also contain three gRNA cassettes (24).
Interestingly, the analogous gRNA identified in both Leishmania and Crithidia (gCYb-I),
is maxicircle encoded (2, 29). The T. brucei gCYb gRNAs have previously been shown
to have heterogeneous 5’ ends as determined in primer extension analysis (24).
Likewise, these transcripts also have heterogeneous 3’ ends that can extend into the
downstream forward repeat (24), indicating that some read-through transcription occurs.
This 5’ and 3’ heterogeneity could be due to lack of precise transcription initiation and
termination signals and/or the result of inexact processing of this RNA from a precursor
generated via read-through from the upstream gRN A cassette. In order to determine
whether the unusual gCYb(560) gRNA is a primary transcript, we performed a similar
ligation-dependent primer extension using a primer complementary to gCYb(560). As
seen in Figure 6, poisoned primer extension analysis does not result in a single band, but
rather a series of bands of ~13 nt for the unligated gRNA reflecting the 5’ heterogeneity

previously observed for these gRNAs. This primer is specific for gCYb(560).

57

FIGURE 6. Ligation-dependent poisoned primer extension analysis of an atypical
minicircle-encoded gRNA. (A) Nucleotide sequence of the synthetic RNA oligo
(lowercase italics) and the 5’ ends of the redundant gCYb(560) and gCYb(558) gRNAs
(capital letters). The gRNA sequence includes the most common 5’ ends (24), and
sequence corresponding to the 3’ end of the primer used for the primer extension reaction
is underlined. (B) 8% acrylamide-urea gel of the primer extension products. The arrows
indicate the most common 5’ ends shown in (A). The asterisk indicates a 7 nt synthetic
RNA oligo-dependent artifact resulting from partial hybridization of the 3’ end of the
primer to the RNA oligo during the extension reaction. (C) Calculated ligation

efficiency for gCYb(560) as described in Figure 5.

58

Ligation-dependent poisoned primer extension assay for gCYb(560)

 

 

 
 

A
gCYb(560)
5":"'""“';""“: 3‘ ‘ 3‘ “ GGAGAUAGUAAAAGACAAUGUAGAUUUC...3’
gCYb558 5’ GGGAGAUUAAAAGACAAUGUGAAUUUU. . . 3’
0
W
81
B E = ¥
u AP K 5, 2 u AP K 3,.
C

 

 

 

% Ligation
O)
c:

 

 

 

 

 

 

40‘_— - — z—
20
0 4:1: .—. r—.—1 E
U ‘ AP K I AP+K
3 2 4 1 44
Treatment
FIGURE 6

59

However, due to the similarity in sequence among the redundant CYb gRNAs, this
primer can also anneal, albeit less efficiently, to the gCYb558 RNA (Figure 6A). The
distance from the 3’ end of the primer to the most common mapped 5’ ends of these
gRNAs is very similar (difference of 1 nt) and does not account for the extent of the
observed heterogeneity. From these experiments, it is clear that the RNA ligation-
dependent pattern shown in Figure 6 matches that seen for the maxicircle encoded
gMURF2-II as well as the minicircle cassette encoded gND7(506) in that the gRNAs
remain unligated in all but the positive control lane. In addition, the heterogeneity of the
ligated product demonstrates that the heterogeneity seen at the 5’ end of gCYb(560) is the
result of imprecise transcription start site rather than processing. These results, taken
together with the maxicircle encoded gMURF2-II result, indicate that mature gRNAs in
T. brucei are primary transcripts regardless of their kDNA location and suggest important

implications for potential transcription regulation of gRNA expression.

DISCUSSION

Although there are a core set of genes retained by all mitochondria, mitochondrial
genomes vary dramatically in size, gene content, and organization (5). The T. brucei
mitochondrial genome is unusual in that two distinct classes of transcripts are localized to
two completely different genome components. The maxicircle component encodes
primarily the ribosomal RNA and protein genes homologous to those encoded in the
mtDNA of other organisms. There is little room for intergenic regulatory elements
within this compact genome, and the rRNA and mRNA genes are transcribed as part of a

polycistronic precursor originating within the variable region (19). Interestingly, the

60

maxicircle genomes of the related kinetoplastid organisms Leishmania and Crithidia have
more potential for regulatory regions and encode additional transcription units in the form
of multiple gRNA genes (2, 29). Analysis of sequences surrounding these maxicircle
gRNA genes does not reveal an obvious consensus promoter element (data not shown).

We have demonstrated that one of the two conserved maxicircle encoded gRN A
genes in T. brucei, gMURF2-II, represents an individual transcription unit located within
the coding region of the maxicircle. This is the only defined maxicircle transcription
initiation site reported for T. brucei. Its location is interesting for two reasons. The
gRNA gene is contained entirely within the coding region of an mRNA that is processed
from a polycistronic precursor. This is the first report of a discrete, primary transcript
generated from a completely intragenic kinetoplast gene. Additionally, the gMURF2-II
locus is downstream of one of only 3 intergenic regions on the maxicircle genome.
Given the tight packing and in most cases overlap of adjacent genes, the retention of this
intergenic region indicates a potential regulatory function. The identification of a
primary transcript within the coding region of the T. brucei maxicircle gives us a small,
stable transcript to measure in in vitro transcription assays as we work to define promoter
elements in T. brucei kDNA. Intriguingly, replication bubbles have also been observed
in electron microscopy studies near this region of the maxicircle (6). This is particularly
interesting in light of evidence linking transcription to maxicircle maintenance in T.
brucei (11).

Analysis of the structure of the 5’ ends of the gMURF2-II and ND4 transcripts
indicated that they are generated via distinctly different events. While the ND4 RNA

must be precisely processed from the polycistronic precursor, the gMURF2-II RNA is

61

initiated de novo a mere 7 nt downstream of the ND4 5’ end and is destined for
termination and/or poly-uridylation 50 bp downstream from the gRNA start site.
Although there are two minor ND4 processing sites upstream of the major 5’ end of the
mRNA, we did not detect any smaller minor products using an ND4 mRNA-specific
primer located downstream of the 3’ end of the gRNA (data not shown). This result
suggests a complex model for maxicircle transcription in which distinct complexes may
be involved in the specific generation of the gRNA and mRNA.

The majority of gRNAs in T. brucei are encoded on the distinct minicircle genome
unique to these organisms, and are located between inverted imperfect 18 bp repeats that
have been implicated as playing a role in transcription (21, 22). Our results indicate that
the unusual minicircle-encoded gCYb(560) gene also produces a mature primary
transcript, demonstrating that minicircle gRNA genes located outside of these repeats
also function as independent transcription units. The heterogeneity at the 5’ and 3’ ends
of gCYb(560) previously reported and detected in this study indicates that while the
repeats are not essential for minicircle gRNA expression, they may contain signals for
precise start site selection and termination. A recent analysis of minicircle genomes
predicts the presence of other gRNA genes located outside of inverted repeats (14). It
will be interesting to determine if these genes are indeed expressed and if so whether they
similarly have heterogeneous ends.

Taken together, the data presented here indicate that gRNA genes in T. brucei,
regardless of genome location, are individual transcription units. Although a common
gRNA promoter sequence is not obvious, these results indicate that a gRNA specific

determinant of transcription exists within kDNA and may reflect an as of yet unidentified

62

gRNA transcription factor. The unique location of the intragenic transcription unit for
the gMURF2-H gRNA suggests the possibility of a distinct gRNA transcription complex
as well as a maxicircle polycistronic transcription complex or a single complex capable
of both activities. In vitro and/or in organelle transcription experiments using this
maxicircle locus will help to distinguish between these possibilities and to identify such

putative gRNA transcription factors.

63

10.

11.

LITERATURE CITED

Arts, G. J., H. van der Spek, D. Speiier, J. van den Burg, H. van Steeg, P.
Sloof, and R. Benne. 1993. Implications of novel guide RNA features for the
mechanism of RNA editing in Crithidiafasciculata. Embo J 12: 1523-32.

Blum, B., N. Bakalara, and L. Simpson. 1990. A model for RNA editing in
kinetoplastid mitochondria: 'guide"; RNA molecules transcribed from maxicircle
DNA provide the edited information. Cell 60: 189-98.

Blum, B., and L. Simpson. 1990. Guide RNAS in kinetoplastid mitochondria

have a nonencoded 3' oligo(U) tail involved in recognition of the preedited region.
Cell 62:391-7.

Bruderer, T., L. C. Tu, and M. G. Lee. 2003. The 5' end structure of transcripts
derived from the rRNA gene and the RNA polymerase I transcribed protein
coding genes in Trypanosoma brucei. Mol Biochem Parasitol 129:69-77.

Burger, G., M. W. Gray, and B. F. Lang. 2003. Mitochondrial genomes:
anything goes. Trends Genet 19:709-16.

Carpenter, L. R., and P. T. Englund. 1995 . Kinetoplast maxicircle DNA
replication in Crithidia fasciculata and Trypanosoma brucei. Mol Cell Biol
15:6794-803.

Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by

acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem
162:156-9.

Clement, S. L., and D. J. Koslowsky. 2001. Unusual organization of a
developmentally regulated mitochondrial RNA polymerase (TBMTRNAP) gene
in Trypanosoma brucei. Gene 272:209-18.

Corell, R. A., P. Myler, and K. Stuart. 1994. Trypanosoma brucei
mitochondrial CR4 gene encodes an extensively edited mRN A with completely
edited sequence only in bloodstream forms. Mol Biochem Parasitol 64:65-74.

Grams, J ., M. T. McManus, and S. L. Hajduk. 2000. Processing of
polycistronic guide RNAS is associated with RNA editing complexes in
Trypanosoma brucei. Embo J 19:5525-32.

Grams, J ., J. C. Morris, M. E. Drew, Z. Wang, P. T. Englund, and S. L.
Hajduk. 2002. A trypanosome mitochondrial RNA polymerase is required for
transcription and replication. J Biol Chem 277: 16952-9.

12.

l3.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

Harris, M. E., D. R. Moore, and S. L. Hajduk. 1990. Addition of uridines to
edited RNAS in trypanosome mitochondria occurs independently of transcription.
J Biol Chem 265:11368-76.

Hauser, R., M. Pypaert, T. Hausler, E. K. Horn, and A. Schneider. 1996. In
vitro import of proteins into mitochondria of Trypanosoma brucei and Leishmania
tarentolae. J Cell Sci 109 ( Pt 2):517-23.

Hong, M., and L. Simpson. 2003. Genomic organization of Trypanosoma brucei
kinetoplast DNA minicircles. Protist 154:265-79.

Jasmer, D. P., and K. Stuart. 1986. Sequence organization in African
trypanosome minicircles is defined by 18 base pair inverted repeats. Mol Biochem
Parasitol 18:321-31.

Koslowsky, D. J ., G. J. Bhat, A. L. Perrollaz, J. E. F eagin, and K. Stuart.
1990. The MURF3 gene of T. brucei contains multiple domains of extensive
editing and is homologous to a subunit of NADH dehydrogenase. Cell 62:901-11.

Koslowsky, D. J ., and G. Yahampath. 1997. Mitochondrial mRN A 3'
cleavage/polyadenylation and RNA editing in Trypanosoma brucei are
independent events. Mol Biochem Parasitol 90:81-94.

Madison-Antenucci, S., J. Grams, and S. L. Hajduk. 2002. Editing machines:
the complexities of trypanosome RNA editing. Cell 108:435-8.

Michelotti, E. F., M. E. Harris, B. Adler, A. F. Torri, and S. L. Hajduk. 1992.
Trypanosoma brucei mitochondrial ribosomal RNA synthesis, processing and
developmentally regulated expression. Mol Biochem Parasitol 54:31-41.

Myler, P. J ., D. Glick, J. E. Feagin, T. H. Morales, and K. D. Stuart. 1993.
Structural organization of the maxicircle variable region of Trypanosoma brucei:
identification of potential replication origins and topoisomerase II binding sites.
Nucleic Acids Res 21:687-94.

Pollard, V. W., and S. L. Hajduk. 1991. Trypanosoma equiperdum minicircles
encode three distinct primary transcripts which exhibit guide RNA characteristics.
Mol Cell Biol 11: 1668-75.

Pollard, V. W., S. P. Rohrer, E. F. Michelotti, K. Hancock, and S. L. Hajduk.
1990. Organization of minicircle genes for guide RNAS in Trypanosoma brucei.
Cell 63:783-90.

Read, L. K., P. J. Myler, and K. Stuart. 1992. Extensive editing of both

processed and preprocessed maxicircle CR6 transcripts in Trypanosoma brucei. J
Biol Chem 267:1123-8.

65

 

24.

25.

26.

27.

28.

29.

Riley, G. R., R. A. Corell, and K. Stuart. 1994. Multiple guide RNAS for
identical editing of Trypanosoma brucei apocytochrome b mRN A have an

unusual minicircle location and are developmentally regulated. J Biol Chem
269:6101-8.

Shapiro, T. A., and P. T. Englund. 1995. The structure and replication of
kinetoplast DNA. Annu Rev Microbiol 49:117-43.

Simpson, L., S. Sbicego, and R. Aphasizhev. 2003. Uridine insertion/deletion
RNA editing in trypanosome mitochondria: a complex business. Rna 9:265-76.

Stuart, K., and A. K. Panigrahi. 2002. RNA editing: complexity and
complications. Mol Microbiol 45:591-6.

Thiemann, O. H., and L. Simpson. 1996. Analysis of the 3' uridylylation sites of
guide RNAS from Leishmania tarentolae. Mol Biochem Parasitol 79:229-34.

van der Spek, H., G. J. Arts, R. R. Zwaal, J. van den Burg, P. Sloof, and R.

Benne. 1991. Conserved genes encode guide RNAs in mitochondria of Crithidia
fasciculata. Embo J 10:1217-24.

66

CHAPTER 111

Unusual organization of a developmentally regulated mitochondrial RNA polymerase

(TBMTRNAP) gene in Trypanosoma brucei

67

INTRODUCTION

The developmental regulation of mitochondrial gene expression is a critical part
of the complex Trypanosoma brucei life cycle and occurs through the coordinated
expression of both the nuclear and mitochondrial genomes (20). Mitochondrial function
in T. brucei is highly regulated, with expression of a complete electron transport chain
restricted to the procyclic (insect) stage of the life cycle. This regulation is complex and
relies on the guide RNA-mediated editing of maxicircle mRNAs to form mature
transcripts (25). Consequently, the expression of functional mitochondrial-encoded
proteins involves not only the transcription of ribosomal and protein coding genes
localized to the maxicircle DNA, but also the transcription of hundreds of small guide
RNAS genes present on both maxicircles and minicircles. Although there has been
extensive research into the process of RNA editing in T. brucei, the precise mechanism of
regulation of mitochondrial activity remains unknown as is the nature of the
mitochondrial transcription machinery.

The mitochondrial genome of a wide variety of organisms including plants,
animals, and protozoa, is transcribed by a nuclear-encoded mitochondrial RNA
polymerase belonging to a family of single-subunit RNA polymerases. These
polymerases share significant homology to the bacteriophage T7 RNA polymerase (2,
26). Unlike the single-subunit T7 RNA polymerase, the catalytic core enzyme of the
mitochondrial RNA polymerase requires at least one specificity factor for accurate and
efficient transcription initiation (26). Despite the conservation of the core enzyme, the

nature and number of these MTRNAP Specificity factors vary among organisms.

68

To further our investigation of the role of mitochondrial transcription in the
developmental regulation of mitochondrial gene expression in T. brucei, we have cloned
and characterized the gene for the mitochondrial RNA polymerase (TBMTRNAP) in this
organism. The full-length cDNA includes the TBMTRNAP open reading frame (ORF) of
3822 bp corresponding to 1274 amino acids. The expression of the TBMTRNAP gene is
regulated during the T. brucei life cycle with a greater relative abundance of the
TBMTRNAP mRNA in the procyclic form than in the bloodstream form trypanosomes.
This regulation is quite complex and appears to involve both alternative polyadenylation
of the TBMTRNAP mRNA as well as stage specific differences in the stability of the

resulting transcripts.

MATERIALS AND METHODS
Cell culture and nucleic acid preparation

T. brucei brucei procyclic form cells (Istar clone from stock EATRO 164) were
grown as previously described (11). Total genomic DNA was isolated by digestion of
cells with Proteinase K in the presence of 1% SDS followed by RNase digestion and
phenol/chloroform extraction (13). Total RNA was isolated as previously described (11).
Poly(A+) RNA was purified from total RNA with oligo-dT polystyrene-latex resin using
the Oligotex kit from Qiagen according to the recommendations of the manufacturer.
Degenerate PCR

COnsensus-DEgenerate Hybrid Oligonucleotide Primers were designed with the
aid of the web-based program CODEHOP (22). These primers were generated from two

blocks of highly conserved amino acids produced from a multiple alignment of the

69

carboxyl termini of seven mitochondrial RNA polymerase genes and gene fragments
(Figure 1). Each CODEHOP primer was designed using the T. brucei codon bias and
consists of a degenerate 3’ core region and a non-degenerate 5’ consensus clamp. PCR
amplification was performed in a 50 11.1 reaction volume with 5 1.1g of sheared genomic
DNA, 1 M of each primer, 0.25 mM each dNTP, and 2.5 U of Taq polymerase
(Promega). Reactions were carried out in a thermocycler (MJ Research, Inc FTC-100)
using the touchdown protocol recommended for the CODEHOP PCR. The resulting
PCR product was sequenced from both ends using the non-degenerate clamp portion of
the CODEHOP primers.
Genomic DNA cloning and gene copy number

A high-density microarrary filter (SM 12#58) from the T. brucei TREU927/4
bacteriophage P1 genomic library was kindly provided by Vanessa Leech of the
Laboratory for Parasite Genome Analysis at Cambridge. The filter was probed with a 40
nt high specific activity antisense riboprobe transcribed using the Uhlenbeck single-
stranded T7 transcription protocol (18). Briefly, a template for transcription by T7 RNA
polymerase (Ambion) was created by hybridizing the 61 nt oligonucleotide T7RP-1,
(5’AATCAC’I‘I‘GG TA'I'I‘ACG'I'IT CGCGAGACGC AAAACTGCCC
TATAGTGAGT CGTATTAAAT T3’) designed using sequence obtained from the
degenerate PCR product with a 22 nt T7 promoter oligo (5’AATTTAATAC
GACTCACTAT AG3’) to create a double stranded T7 promoter. A total of 5 positive P1
clones (1E5, 1G1, 2D11, 16G11, SE12) were identified and ordered from the facility. P1
DNA was obtained from each clone using the Qiagen Midiprep kit following

modifications suggested by the manufacturer for isolation of large constructs. P1 DNA

70

was digested with KpnI, EcoRI, BamHI and all pairwise combinations and resolved on a
0.75% agarose gel. The resolved DNA was transferred to Hy-bond Nytran membrane
using downward capillary transfer and probed with the same riboprobe used to identify
the clones. Positive fragments were subcloned into pBluescript SK- (Stratagene),
propagated in E. coli DH5 0t F’ IQ (Gibco BRL) cells and sequenced. The copy number
for the mitochondrial RNA polymerase gene was determined by probing a Southern blot
of a restriction digest of 10 ug of T. brucei genomic DNA as described for the Pl clones.
cDNA cloning

The 3’end of the putative T. brucei mitochondrial RNA polymerase cDNA was
obtained by a rapid amplification of cDNA ends (RACE) strategy using double-stranded
adapter-ligated cDNA created with the Marathon cDNA Amplification Kit (Clontech)
following the manufacturer’s suggestions. Subsequent PCR reactions used the Clonetech
Adapter Primer API and a gene-specific primer 3’R1 (5’GGTATTACGT
TTCGCGAGAC GCAAAACTGC CG3’) with the following conditions: 94°C for 1 min,
5 cycles of 94°C for 30 sec, 72°C for 4 min, 5 cycles of 94°C for 30 sec, 70°C for 4 min,
20 cycles of 94°C 30 sec and 68°C for 4 min with a hold at 72°C for 10 min. Products
were resolved on a 1% agarose gel, subcloned into the Clonetech vector, and sequenced.

The 5’ end of the polymerase cDNA was determined using reverse transcriptase,
PCR (RT-PCR). Three gene-specific, antisense primers were designed downstream of
the first ATG in the TBMTRNAP open reading frame. Primer CS-l (5’CGTAGAACCC
GCAGATGATI‘ CTGAGGC3’), CS-2 (5’TGTGAAGCAA GTGATAGCAA
ACTACCCCGC TG3’), and 5’RT-1, (5’CTI'TATCGGT GCCAGACTCA ACC3’).

For each RT-PCR, cDNA was reverse transcribed from 1 ug of Poly(A+) RNA, using 40

71

fmol of gene-specific primer, 12.5 11M each dNTP, and 2 Units AMV reverse

transcriptase (Seikagaku) in a 20 u] reaction volume. RNA and primer were denatured
for 2 min at 70°C and cooled at a rate of 2°C /min to 50°C at which point dNTPs and
enzyme were added and the reaction was incubated at 50°C for an additional 45 minutes.
PCR was performed on 5.0 it] of each RT reaction with 0.2 1.1M each of the appropriate
gene-specific primer and the spliced leader primer, TbSL-sal, (5’GTCGTCGACA
ACTAACGCTA TTATTAGAACAG3’), 0.05 mM each dNTP, 2.5 U Taq (Promega)
with initial denaturation at 94°C for 2 minutes followed by 30 cycles of 94°C for 30 sec,
60°C for 30 sec, 72°C for 30 seconds and a hold at 72°C for 10 minutes. Products were
resolved on a 2% agarose gel and sequenced from both the 5’ and 3’ ends using the PCR
primers.
Northern blots

4.5 1.1g of Poly (A+) RNA and 30 ug of total RNA were electrophoresed on a
0.66M formaldehyde-1% agarose gel. The resolved RNA was transferred to a Hy-Bond
Nytran membrane using downward capillary transfer and hybridized with an internal 1.8
kb riboprobe generated by digestion of the BamHI clone with KpnI and transcription
from the T3 promoter using the Ambion T3 Maxiscript kit. The templates for the 5’
probe and 3’ UTR antisense riboprobes were created via PCR to incorporate a T7
promoter. Primer pairs were: T75’probe (5’ GACTCACTAT AGGGTCAATA
AGA’I‘TCATGA3’) and 5’probe (5’GGCGGTI‘GAG TCTGGCACCG
ATAAAGTGG3’) for the 5’ probe and primers T73’UTR (5’GACT CACT AT
AGGGAAGAAT TAAATCCATG3’) and 3’UTR (5’GATAT'I‘AGAA ACTCGCAGAT

TACAAAGTGT3’) for the 3’UTR probe. Riboprobes were transcribed using the T7

72

"a.” v-

Maxiscript kit (Ambion). In each case, the blot was hybridized in 50% formamide, 5X
SSPE, 1% SDS at 68°C for 16 hours and washed twice at room temperature with 0.5x
SSPE, 0.5% SDS for 15 minutes and once in 0.1X SSPE, 0.1% SDS at 68°C for 1-2
hours. The relative abundance of the various transcripts was determined by
phosphoimager analysis (Molecular Dynamics) and normalized to the signal obtained by
rehybridizing the blot with an end-labeled oligo against the B-tubulin gene.
Sequencing

Sequencing was performed by the MSU Sequencing Facility using an ABI 377
sequencer. The 6182 bp BamHI fragment was sequenced using the Tn7 transposon-
based GPSTM-l Genome Priming System from New England Biolabs following the

manufacturer’s instructions.

RESULTS
Genomic Cloning

COnsensus-DEgenerate Hybrid Oligonucleotide Primers (22) (CODEHOP) were
designed from an alignment of the highly conserved carboxyl termini of several
mitochondrial RNA polymerase genes in the database (Figure. 1). Using these primers, a
519 bp fragment was amplified from T. brucei genomic DNA. A BLASTX search
(www.ncbi.nlm.nih.gov/blast) using sequence obtained from this product demonstrated
significant homology (E=9 x 102°) to mitochondrial RNA polymerase genes and gene
fragments in the database. Therefore, we assigned to this gene the name TBMTRNAP, in
accordance with the suggested nomenclature for T. brucei genes (3). The remaining

genomic sequence of the mitochondrial RNA polymerase gene was obtained by screening

73

a P1 bacteriophage genomic library with a riboprobe generated from sequence obtained
from the degenerate PCR product. A restriction map of the TBMTRNAP locus was
constructed from the positive P1 clones (Figure 2A), and the 6182 bp BamHl fragment
was sequenced to construct a genomic contig which was extended 2 kb with sequence
obtained from the Kpn-EcoRI clone. A Southern blot of T. brucei genomic DNA
indicated that the TBMTRNAP exists as a single-copy gene (Figure 2B). With only one
noted exception, (12), the T. brucei genome contains no introns. Consequently, the
genomic sequence contains the mitochondrial RNA polymerase open reading frame,
which consists of 3822 bp corresponding to 1274 amino acids shown in Figure 3A. A
BLASTP search on the entire open reading frame indicated that the TBMTRNAP bears
the strongest similarity to plant mitochondrial RNA polymerases with the most
significant homology to the Arabidopsis thaliana (GenbankTM accession number
AL391144) MTRNAP. This homology is localized to amino acids of the TBMTRNAP
with 37% identity and 52% similarity to the Arabidopsis protein. The significance of this
specific relationship to the plant enzymes is unclear. Evidence suggests that
trypanosomes once possessed a chloroplast lost some time in their distant evolutionary
past (14). However, closer inspection of the alignment does not show stronger similarity
of the TBMTRNAP with plants than with other mtRNAP sequences. Consequently, this
affinity is likely due to a long-branch attraction, a common pitfall when using highly

diverged sequences (9).

74

CODEHOP primer design

 

 

 

 

 

 

 

5’ primer 3’ primer

> c——
Sac VKQTVMTNVYGVTYVGATFQIAKQLSP ........ KQGLDFASVHDSYWTHABD
Tot VKQEVMTSVYGVTFVGARKQIYKQLRD ........ KRGMHFAAVHDSYWTEASD
Han VKQTVMTVVYGVTRYGGRLQIEKRLRE ........ RKGLTFVSVHDCYWTHAAD
Aca VKQEVMTBVYGVTFIGARQQIENALKD ........ EAGLTYASVHDSYWTHASD
Orz VKQTVMTSVYGVTYIGARQQITKRLQE ........ KAGLHFAGVHDSFWVHACD
Cry VKQEVMTTVYGVTFIGAREQIYNRLYE ........ RCGKMFAGVHDSYWTHASD
Pyn VKQIVMTBVYGVTWIGARDQIESRLRE ........ GRGMDFAGVHDSYWTHASD

 

Q T V M T N V Y G V T
5’ primer: CAGACAGTGATGACAAGCGTGTAYGGNGTNAC

D S A H T W Y S D
3' primer: CGCTGCGTGTGTCCAGTARSWRTCRTG

Figure 1. Portions of a multiple alignment of seven MTRNAPs generated using the
program Clustal W. Amino acids from which primers were designed are underlined with
the 5’ consensus clamp in bold. Nucleotide sequence of the CODEHOP primers shown
below the alignment: N=A/C/G/T, R=A/G, W=A/T, Y=C/T. GenBankTM accession
numbers: Sac = Saccharomyces cerevisiae M17539, Tet = Tetrahymena pyriformis
U34406, Horn = Homo sapiens U75370, Aca = Acanthamoeba castellanii U34405, Orz =
Oryza sativa U34283, Cry = Cryptomonas phi U34404, Pyn = Pycnococcus provasolii

U34286.

FIGURE 1

75

Figure 2. (A) Restriction map of the TBMTRNAP locus and cloning strategy. The
T BMTRNAP ORF is represented by a long rectangle within which the degenerate PCR
product is boxed. The bold lines above the restriction map indicate the subcloned P1
fragments. Arrows beneath the map indicate the cDNA clones. The 5’ and 3’ UTRs are
represented by lines extending from the TBMTRNAP ORF. SAS indicates the splice
acceptor site. The multiple polyadenylation sites are indicated by the downward arrows.
Relative positions of the primers used in the 5’ RT-PCR experiments are indicated by
arrowheads above the map. (B) Southern blot analysis of the T. brucei genomic DNA.
10 ug of DNA was digested with BamHI (lane 1), EcoRI (lane 2), KpnI (lane 4), BamHI
+ EcoRI (lane 3), KpnI + BamHI (lane 5), and KpnI + EcoRI (lane 6), separated on a
0.75% gel, transferred to Nytran, and hybridized with a riboprobe spanning the KpnI site
at 4330 and the BamHl site at 6182 relative to the first nucleotide in the TBMTRNAP

ORF.

76

TBMTRNAP locus restriction map and cloning strategy

 

 

 

 

 

 

 

 

I PKE [JJ
1 PBAM I I H l
l 1
SAS Poly(A) sites
ls‘RT-i CS-1CS—2 riboprobe H U
+ ‘- ‘- IIIIIIIIIIIIIIII
,, —:{ TBMTRNAPORF 3822 bp'j—— ,, ,,
II III II J
EcoRl BamHl pnl BamHl EcoRl pnl
-10,000 -2423 4330 6182 ~10,000 ~15,000
<— ——+
<———— ———->
<———— ———->
—————>
5'RACE 3' RACE
clones clones
fl 1 2 3 4 5 6
23.0 — ,.
12.0 m
9.4 _
7.0 _ ., =
,0 1U ..
_ 1‘
5.0
4.0 7‘
3.0 —
2.3 “
2.0 ‘ _
a.“
1.6 _
F1GURE2

77

TBMTRNAP protein sequence and mitochondrial targeting signal

A
MRRLSLAPIK WPAIAQRWGT RGTDVPNRAK

GAIKSPKSRK SRLPYVEVGE RTDRMKEFVS 60
SGTDDNSGDS DNNHNSVKSI NNTDCRNKGT DGGGEIDMDT VAGTDAFTPT VDMEEGYGAP 120
VMATTGSTSS ESVLSVIDVL CDDLFSCKTD VLKSFARTRS VSGSTKSELV MNLIDLANRE 180
AHGESQDLSI TKRVLGDVFN EEVRVSGVRS QWTNKSLEAS HIEMACDNHL KFEAMSYTQK 240
TLMVRRNASE SSRVLRKLIR PFQQDYNRVA EAAVGGVFRN FKAEADQLVN SMMASEIVTP 300
FSSFLVSYVR FATSGNLLTR TNVIERLEQL ELVQIAMDED SDAVLQRLMA LLDDVVAEVE 360
RRALCFGGKR TSWGTETPEV LRCSIQAFSD STAQQHEDLG ERVPAWVHDL VRMFNNWEAI 420
VRTDIPVLED VPRYVFDCIL SGVVCYHLLH KIYGDIISPT DVPPTVRGAV KRAMEAHFKD 480
EEKAGHALAK LFAYVQAPGD SGVVKAEFFP AVLSQMQGAF HDVGQSTLHN VRTAIVLREI 540
CATVSRCTRT CGLFHMLVKL TEDLRFQFRF STIFKKLNGR DRTTIRTKYS INMVKTLEYF 600
EQEYAVTPTS TKAVGFIVIL LLHMSMCSGA ASGHGTKAVL ERYISVTNKE EFSIISISDL 660
EATHVRDLRV AFPPQLSYNS WLHQSNTKDK SVYNVLPSVA VKGSTNQAMI ISQAPMMKAL 720
DAISRVPWRI SKYMLHVQEA IVREGYGFGK IRPAFYPLHY CAKSRGDISY ESTGMDDDDD 780
KTEVYNLQQR REYELQQDED WKNLSELRSN RIHYLQALRQ ARSLVQFSHI YFPNSMDFRG 840
RMYPLPGRLN HTGSDPFRAL LEYAEPKPLG KEGLYWLKVH LANKMGMSKL SFDERVHYVN 900
EHIDDVVCSA EQPLYGDKWW QEAAEPMQCL MACKELADAL KCSQGPENFL SRIPVAVDGS 960
YNGLQHYSAI GRDAFGATLV NLVPSERPAD AYTGILKEMM SSIKADAERD HPVAQRCLGT 1020
GKGQDRDHIK RKSIKRPIMT QVYGVTGYGM SELILDELVK QNKNHGLWTS TDMREMADYL 1080
REKVLESLGI TFRETQNCRR WITDVTNIIW EVQPAELRTA LCWTTPLGLV VRQPYKMRKE 1140
MMIFTVHGCA RVPANAFSAA SRKQLTAIAP NLIHSLDASH LAMTAIEMQN LGLSMMAVHD 1200
SYWTYACDLP TLSRVLREQF VTLYGKYDPL WELKEQWEEA YFMDLRRHGK VLPDPPKRGD 1260
LDLNVVLNSP YFFS 1274

 

Figure 3. (A) Amino acid sequence of the T. brucei mitochondrial RNA polymerase
with the putative mitochondrial targeting sequence in bold. (B) Helical wheel projection
of the first 18 amino acids in the TBMTRNAP ORF. The dashed line divides the
hydrophobic domain from the hydrophilic domain of the helix. Hydrophilic residues are
underlined.

FIGURE 3

78

However, as indicated in Figure 4, the carboxyl-terminal portion of the protein bears
strong homology to the bacteriophage-like MTRNAP characterized for organisms as
phylogenetically diverse as humans and yeast. Interestingly, inspection of the full
alignment indicates that even within the highly conserved blocks, the TBMTRNAP
sequence deviates from that of the other mtRNAPs and T7 RNAP, including a small
insert into domain III. However, residues that have been shown to be critical for activity
of the T7 RNA polymerase (2, 24) are conserved. The amino terminus of this protein is
predicted to form an amphipathic helix and to be targeted to the mitochondrion via the
putative sequence underlined in Figure 3.
cDNA cloning

Nuclear transcripts in T. brucei are expressed as polycistronic precursors from
which mature mRNAs are rapidly processed via the trans-splicing of a conserved,
capped, 39 nt spliced leader RNA to the 5’ end and the 3’ cleavage/polyadenylation of
the individual mRNAs (28). Therefore, to determine the 5’ end of the TBMTRNAP
mRNA, a modified RACE strategy using three different gene-specific primers (Figure
2A) and the conserved spliced leader primer was used. Three independent clones derived
from the three separate PCR products mapped the splice acceptor site to an AG
dinucleotide at a position 29 nt upstream of the first ATG codon in the TBMTRNAP open
reading frame. The 3’ end of the TBMTRNAP mRNA was determined by 3’ RACE
experiments. Four distinct PCR products of various sizes were obtained from the one
pair of primers used for the 3’ RACE (Figure 2A). Sequencing of these cloned products

revealed two size classes of TBMTRNAP mRNA with 3’ UTRs that differ by 500 nt.

79

Figure 4: Multiple alignment of representative mtRNAPs with the T7 RNAP. Cartoon
schematic showing different lengths and motif conservation among the human, yeast,
Arabidopsis, and T. brucei mtRNAPs with that of T7RNAP. The roman numerals below
the diagram depict the conserved motif designations in the T7 RNAP. Motifs that are
strongly conserved are shaded in black, those with moderate conservation are in gray, and
minimal conservation is depicted by white boxes. The pinky specificity domain thought

to be important in promoter recognition is indicated by the dotted oval.

80

Diagram of multiple alignment of representative mtRNAPs with T7RNAP

7 a. a. 14-26 a. a.

 

T. brucei H1274

III I -I|rtrl

 

 

human H1230

Llfl

 

 

 

 

111
[11
111 [ll I-fl
[Hi

 

 

 

yeast E11348
Arabidopsis [. ,1 r I .119) I
T7RNAP

-I- I I IIISII

III 111w v V1/\Ix
VHVHI

FIGURE 4

81

mRNA expression

In order to determine the relative levels of TBMTRNAP mRN A during the life
cycle of T. brucei, RNA from the procyclic (insect) form and bloodstream form
trypanosomes was examined. Additionally, RNA from dyskinetoplastid trypanosomes
that lack mitochondrial DNA and therefore functional mitochondria, was included in this
experiment. Northern blot analysis with a riboprobe specific for the 5’ end of the ORF
detected three distinct transcripts with apparent molecular weights of 4.4 kb, 4.7 kb, and
6.9 kb (Figure 5A). The 4.4 kb and 4.7 kb transcripts are visible in procyclic,
bloodstream, and dyskinetoplastid trypanosomes, while the larger 6.9 kb transcript not
visible in the procyclic lane has been detected in other Northern blots using larger
amounts of poly(A) RNA (data not shown). An identical pattern was seen using the
internal probe located within the coding region of the TBMTRNAP (data not shown). The
difference in size between the 4.4 kb and 4.7 kb TBMTRNAP transcripts reflects the two
distinct 3’ UTRs mapped in the 3’ RACE experiments as demonstrated by hybridization
of a 3’ UTR specific probe solely to the 4.7 kb band (Figure 5B). Whereas the amount of
the 4.7 kb TBMTRNAP mRN A was not significantly different among the three forms, the
4.4 kb transcript was present in procyclic cells at levels 4 times that seen in bloodstream
or dyskinetoplastid trypanosomes. The abundance of TBMTRNAP mRN A in
trypanosomes lacking mitochondrial DNA is roughly equivalent to that in bloodstream
form cells when normalized against tubulin mRNA (Figure 5C), which is expressed
equally during the life cycle. Surprisingly, while both the internal and the 5’ probes gave
identical hybridization patterns, the riboprobe specific for the 3’ UTR of the TBMTRNAP

mRNA hybridized to two additional transcripts of 2.6 kb and 0.7 kb.

82

Figure 5. Developmental profile of steady-state transcripts from the TBMTRNAP locus.
4.5 ug of poly(A)+ or 30 pg of total RNA from procyclic (P), bloodstream (BS), or
dyskinetoplastid (DK) trypanosomes was probed with the 5’ probe riboprobe (A) and
rehybridized with the 3’UTR riboprobe (B). Equal loading of samples was controlled by
rehybridization of the blot with an end-labeled oligonucleotide detecting the B-tubulin
gene (C). (D) Mature mRNAs processed from the 6.9 kb polycistronic transcript are
indicated below the diagram of the TBMTRNAP locus. Filled circles represent splice

acceptor sites. Filled rectangles represent polypyrimidine tracts.

83

Developmental profile of steady-state transcripts from the TBMTRNAP locus

A B

Poly A+ Total Poly A+ Total
PBDK PBS PBSDK PBS

 

 

 

 

D 5’probe Internal probe 3'UTR ds probe
I I] l L- n dsORF -

SL 4.7 kb An
SL 4.4 kb An

0.7 kb

SL '—An SL—flti—An
2.6 kb
A.
FIGURE 5

84

A Southern blot of T. brucei DNA probed with the 3’ UTR riboprobe did not
reveal any related sequences in the T. brucei genome (data not shown). Since these
transcripts were not detected with the internal probe, which is located only 240 nt
upstream of the 3’ UTR riboprobe, it is clear that at least a portion of the sequence
present in the 3’UTR of the 4.7 kb T BMTRNAP transcript is also part of the 5’ ends of the
2.6 kb and 0.7 kb transcripts. Therefore, these transcripts must be produced by mutually
exclusive processing events. Rather interestingly, the 2.6 kb transcript is present at
relatively equal levels in all three forms while the 0.7 kb transcript is quite abundant in all
forms relative to the other transcripts detected in the Northern hybridizations and is 4
times more abundant in procyclic than in bloodstream trypanosomes. We are unable to
detect a product that extends beyond the mapped splice site acceptor shown in Figure 5
for the TBMTRNAP mRN A in 5’ RACE experiments using cDNA from both procyclic
and bloodstream trypanosomes. This together with our hybridization results leads us to
believe that the 6.9 kb transcript may be a pre-mRN A that has not yet undergone the
trans-splicing/polyadenylation processing events to produce the mature TBMTRNAP
mRNA and the downstream transcripts diagrammed in Figure 5D. The trans-splice site
for the 0.7 kb transcript maps to a location 120 bp downstream of the proximal poly(A)
site of the TBMTRNAP mRNA. Although the 3’ end of this transcript is quite
heterogeneous, several 3’ RACE and nested RACE experiments demonstrated that the 3’
end maps to the same region as that of the 4.7 kb TBMTRNAP mRNA (data not shown).
The 2.6 transcript detected with the 3’ UTR probe proved more difficult to characterize.
Repeated 5’ RACE experiments using the spliced leader primer and a gene-specific

primer located downstream of the distal poly(A) site (see Figure 5D) failed to detect a

85

product large enough to have been detected by the 3’ UTR riboprobe. Rather, the 5’ end
of the product that was consistently obtained with this primer pair mapped to a site 126 nt
downstream of the TBMTRNAP mRNA distal poly(A) site. Likewise, 3’ RACE
experiments using a gene specific primer located within the 3’UTR riboprobe region
failed to detect any transcripts long enough to be the 2.6 kb transcript seen in this
Northern blot. However, when the two gene-specific primers used in both of these
RACE experiments were used together in RT-PCR a product was obtained that would
traverse this area. This PCR product is expected based upon our proposed 6.9 kb

precursor, but may also account for the 2.6 kb transcript.

DISCUSSION

We have identified and cloned a single mitochondrial RNA polymerase gene in
Trypanosoma brucei that encodes two differentially expressed mRNAs. While the
significant similarity of the predicted TBMTRN AP sequence to MT RNAPs in the
database is confined to the catalytic carboxyl terminus, the lack of sequence conservation
in the amino terminus of the TBMTNRAP is not surprising. The variation in the length
and composition of the non-conserved region reflects species-specific interactions with
other proteins involved in transcription and RNA processing. For example, the amino
temrinal portion of the yeast mitochondrial RNA polymerase interacts with proteins that
directly link transcription to both RNA processing and translation (1, 21). Other
sequence differences also likely reflect species or group specific functions. For instance,
the “pinky specificity loop” is located within the C-terminal conserved region and shows

group-specific differences (Figure 1). Although there is sequence similarity within each

86

major group (i.e., plants, fungi, kinetoplast, vertebrates), there is little similarity across
groups of organisms. This region in the T7 RNAP is important for promoter recognition
via the insertion of these amino acids into the DNA major groove (24). Interestingly,
recent data suggest that the mitochondrial RNA polymerase has innate promoter
recognition ability (15). Consequently, these differences likely reflect co-evolution with
respective promoter sequences.

In spite of this intrinsic promoter-recognition property, all mitochondrial RNA
polymerases studied to date require at least one specificity factor for accurate
transcription initiation. The nature and number of these factors varies among organisms,
but can be divided into two classes: mtTFB, which is required in both animals and yeast
(10, 17), and mtTFA, a 25 kDa high mobility group (HMG) protein (5), required only in
animals. These are the only two systems for which the protein machinery required for
mitochondrial transcription has been dissected. Fungi and animals are more closely
related to each other than either of them are to other phyla of organisms. However, they
show distinct differences in the composition of the mtRN AP holoenzyme, making it
likely that other variations will become evident as more systems are studied. It is
evolutionarily interesting that the catalytic subunit of the mtRNAP is conserved in T.
brucei as it is one of the deepest branching organisms to possess mitochondria. Given the
remarkable nature of the kinetoplast genome and the early divergence of T. brucei, one
might expect to find unique protein components comprising the mitochondrial
transcription machinery. There may be guide RN A-specific, minicircle-specific, and/or

maxicircle-specific transcription factors not found in higher eukaryotes.

87

The mitochondrion of T. brucei is developmentally regulated during its complex
life cycle (20), making the regulation of the TBMTRNAP mRNA intriguing. While living
in the insect midgut, the mitochondrion of the procyclic form T. brucei is fully functional.
In the glucose-rich bloodstream, however, mitochondrial activity is reduced, and energy
is derived through glycolysis. This regulation occurs through the control of both nuclear
and mitochondrial genes primarily through post-transcriptional and post-translational
processes (20). Our finding that the TBMTRNAP gene is transcribed into two distinct
mRN As subject to differential regulation during the life cycle suggests that mitochondrial
differentiation might be achieved, in part, through the regulated expression of this gene.
It is significant that the TBMTRNAP mRNA with the shorter (50 nt) 3’ UTR is more
abundant in procyclic cells than in bloodstream or dyskinetoplastid cells, while the
mRNA with the longer 3’ UTR (550 nt) seems relatively equal in all three forms. Stage-
specific differences in the length of the 3’ UTR as a result of alternative polyadenylation
site selection has been observed for other T. brucei mRNAs (7). As in other eukaryotic
transcripts, T. brucei 3’UTRs are known to contain information that affects such
processes as mRN A turnover and translatability (6, 8, 28). Thus, elements within the 3’
UTR of the TBMTRNAP mRN A are likely to be important for the regulation of its
expression during the T. brucei life cycle.

Polyadenylation in T. brucei is dependent upon a downstream polypyrimidine
track followed by a 3’ trans-splice site (16, 23). Trans-splicing is rapid and seems to
occur as soon as the 3’ splice site is available to the processing machinery (27). This
posses an interesting question for the choice of poly(A) site on the newly synthesized

TBMTRNAP transcript. In order for the proximal poly(A) site to be favored by the

88

processing machinery in procyclic cells, the splice site immediately downstream of the
polypyrimidine track following this poly(A) site must be favored over downstream splice
sites. Likewise, in bloodstream form cells, this 3’ splice site must be used less efficiently
in favor of a downstream splice site. The 0.7 kb transcript, which contains a trans splice
site located just downstream of the polypyrimidine track following the proximal poly(A)
site, is likely the product of such a decision. This 0.7 kb transcript is 4 times more
abundant in the procyclic cells than in the bloodstream and dyskinetoplastid cells, which
have relatively equal amounts when normalized against the tubulin probe.

It is important to note, however, that the proximal poly(A) site is favored over the
distal site in all three forms as the 4.4 kb transcript is more slightly more abundant in all
forms than is the 4.7 kb transcript. Although the 4.4 kb transcript is dramatically
“upregulated” in procyclic form cells, it does not result in a concomitant decrease in the
amount of the 4.7 kb transcript which leads one to believe that this phenomenon is not
solely a result of a shift in the choice of poly(A) site. However, given the coordinated
decrease in the amount of the 6.9 kb transcript, we propose that regulation of the
transcripts originating from this locus is a result of alternative polyadenylation in concert
with differential stability. One should note that if there is a destabilizing sequence in the
longer 3’ UTR, it must either be transcript-dependent, or exist in the 120 nt located
between the proximal poly(A) site and the trans-splice site of the 0.7 kb transcript, since
this RNA shares considerable sequence with the 3’ UTR yet is clearly quite stable.

Detection of this stable 0.7 kb transcript was intriguing. This RNA contains no
ORFs larger than 35 amino acids and may merely represent an RNA processing by-

product as discussed above. The stability of this small transcript, however, suggests that

89

it may have an important non-coding function, as most dead end RNAs are rapidly
degraded. Searches of sequence databases from Leishmania major and T. cruzi found no
homologous sequences suggesting that the RNA sequence is not conserved among these
related organisms. However, the physiological importance of non coding and small
ORF-coding transcripts has become more apparent with the analysis of whole genome
sequences. Therefore, it will be interesting to determine the significance of this small,
stable transcript in T. brucei.

Given the polycistronic nature of transcription units in T. brucei, post-
transcriptional events such as trans-splicing, polyadenylation, and RNA turnover can
serve as potent regulators for the individual genes within a given pre-mRNA (4, 6). This
type of regulation could be especially important for genes such as the TBMTRN AP,
whose function is likely critical for differentiation of the trypanosomes as they progress
through the dramatically different environments they encounter during their complex life
cycle. Interestingly, the regulation of the expression of the transcripts from the
TBMTRNAP locus in dyskinetoplastid trypanosomes appears quite similar to that seen
for bloodstream form cells. Mitochondrial genome deletion (rhoO) mutants in HeLa cells
have been shown to demonstrate defects in nuclear-organelle cross-talk which can result
in a higher level of expression of some mitochondrially targeted genes including the
mitochondrial transcription factor mtTFA (19). Consequently, further investigation into
the protein levels of TBMTRNAP during the life cycle and in dyskinetoplastid
trypanosomes are warranted and will provide insight into the significance of the
regulation of TBMTRNAP mRNA processing and stability. Likewise, further studies are

necessary to determine how the TBMTRNAP gene product functions in the context of the

90

unique kinetoplast genome. Of particular interest will be the identification of accessory
factors required for transcription initiation and of the promoter regions recognized by the

T. brucei mitochondrial RNA polymerase complex.

91

10.

11.

LITERATURE CITED

Bryan, A. C., M. S. Rodeheffer, C. M. Wearn, and G. S. Shadel. 2002. Slslp is
a membrane-bound regulator of transcription-coupled processes involved in
Saccharomyces cerevisiae mitochondrial gene expression. Genetics 160:75-82.

Cermakian, N., T. M. Ikeda, P. Miramontes, B. F. Lang, M. W. Gray, and R.
Cedergren. 1997. On the evolution of the single-subunit RNA polymerases. J
Mol Evol 45:671-81.

Clayton, C., M. Adams, R. Almeida, T. Baltz, M. Barrett, P. Bastien, S. Belli,
S. Beverley, N. Biteau, J. Blackwell, C. Blaineau, M. Boshart, F. Bringaud, G.
Cross, A. Cruz, W. Degrave, J. Donelson, N. El-Sayed, G. Fu, K. Ersfeld, W.
Gibson, K. Gull, A. Ivens, J. Kelly, L. Vanhamme, and et al. 1998. Genetic
nomenclature for T rypanosoma and Leishmania. Mol Biochem Parasitol 97:221-
4.

Clayton, C., and H. R. Hotz. 1996. Post-transcriptional control of PARP gene
expression. Mol Biochem Parasitol 77: 1-6.

Dairaghi, D. J ., G. S. Shadel, and D. A. Clayton. 1995. Human mitochondrial
transcription factor A and promoter spacing integrity are required for transcription
initiation. Biochim Biophys Acta 1271 : 127-34.

D'Orso, 1., J. G. De Gaudenzi, and A. C. Frasch. 2003. RNA-binding proteins
and mRNA turnover in trypanosomes. Trends Parasitol 19: 151-5.

Erondu, N. E., and J. E. Donelson. 1992. Differential expression of two mRN As
from a single gene encoding an HMGl-like DNA binding protein of African
trypanosomes. Mol Biochem Parasitol 51:11 1-8.

Furger, A., N. Schurch, U. Kurath, and I. Roditi. 1997. Elements in the 3'
untranslated region of procyclin mRN A regulate expression in insect forms of

Trypanosoma brucei by modulating RNA stability and translation. Mol Cell Biol
17:4372-80.

Gribaldo, S., and H. Philippe. 2002. Ancient phylogenetic relationships. Theor
Popul Biol 61:391-408.

Jang, S. H., and J. A. Jaehning. 1991. The yeast mitochondrial RNA
polymerase specificity factor, MTFl, is similar to bacterial sigma factors. J Biol
Chem 266:22671-7.

Koslowsky, D. J ., and G. Yahampath. 1997. Mitochondrial mRN A 3'

cleavage/polyadenylation and RNA editing in Trypanosoma brucei are
independent events. Mol Biochem Parasitol 90:81-94.

92

12.

13.

14.

15.

l6.

17.

18.

19.

20.

21.

22.

Mair, G., H. Shi, H. Li, A. Djikeng, H. O. Aviles, J. R. Bishop, F. H. Falcone,
C. Gavrilescu, J. L. Montgomery, M. 1. Santori, L. S. Stern, Z. Wang, E.
Ullu, and C. Tschudi. 2000. A new twist in trypanosome RNA metabolism: cis-
splicing of pre-mRNA. Rna 6:163-9.

Maizels RM, B. M., Robertson BD, Selkirk ME. 1991. Parsite Antigens,
Parasite Genes A Laboratory Manual for Molecular Parasitology. Cambridge
University Press, Cambridge.

Martin, W., and P. Borst. 2003. Secondary loss of chloroplasts in trypanosomes.
Proc Natl Acad Sci U S A 100:765-7.

Matsunaga, M., and J. A. Jaehning. 2004. Intrinsic promoter recognition by a
"core" RNA polymerase. J Biol Chem 279:44239-42.

Matthews, K. R., C. Tschudi, and E. Ullu. 1994. A common pyrimidine-rich
motif governs trans-splicing and polyadenylation of tubulin polycistronic pre-
mRNA in trypanosomes. Genes Dev 82491-501.

McCulloch, V., B. L. Seidel-Rogol, and G. S. Shadel. 2002. A human
mitochondrial transcription factor is related to RNA adenine methyltransferases
and binds S-adenosylmethionine. Mol Cell Biol 22:1116-25.

Milligan, J. F., D. R. Groebe, G. W. Witherell, and O. C. Uhlenbeck. 1987.
Oligoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA
templates. Nucleic Acids Res 15:8783-98.

Miranda, S., R. Foncea, J. Guerrero, and F. Leighton. 1999. Oxidative stress
and upregulation of mitochondrial biogenesis in mitochondrial DNA-depleted
HeLa cells. Biochem Biophys Res Commun 258:44-9.

Priest, J. W., and S. L. Hajduk. 1994. Developmental regulation of
mitochondrial biogenesis in Trypanosoma brucei. J Bioenerg Biomembr 26:179-
91.

Rodeheffer, M. S., B. E. Boone, A. C. Bryan, and G. S. Shadel. 2000. Namlp,
a protein involved in RNA processing and translation, is coupled to transcription

through an interaction with yeast mitochondrial RNA polymerase. J Biol Chem
15:15.

Rose, T. M., E. R. Schultz, J. G. Henikoff, S. Pietrokovski, C. M. McCallum,

and S. Henikoff. 1998. Consensus-degenerate hybrid oligonucleotide primers for
amplification of distantly related sequences. Nucleic Acids Res 26:1628-35.

93

23.

25.

26.

27.

28.

Schurch, N., A. Hehl, E. Vassella, R. Braun, and I. Roditi. 1994. Accurate
polyadenylation of procyclin mRN As in Trypanosoma brucei is determined by
pyrimidine-rich elements in the intergenic regions. Mol Cell Biol 14:3668-75.

Sousa, R. 1996. Structural and mechanistic relationships between nucleic acid
polymerases. Trends Biochem Sci 21: 186-90.

Stuart, K., T. E. Allen, S. Heidmann, and S. D. Seiwert. 1997. RNA editing in
kinetoplastid protozoa. Microbiol Mol Biol Rev 61: 105-20.

Tracy, R. L., and D. B. Stern. 1995. Mitochondrial transcription initiation:
promoter structures and RNA polymerases. Curr Genet 28:205-16.

Ullu, E., K. R. Matthews, and C. Tschudi. 1993. Temporal order of RNA-
processing reactions in trypanosomes: rapid trans splicing precedes

polyadenylation of newly synthesized tubulin transcripts. Mol Cell Biol 13:720—5.

Vanhamme, L., and E. Pays. 1995. Control of gene expression in trypanosomes.
Microbiol Rev 59:223-40.

94

CHAPTER IV

A conserved mtTFB in the early eukaryote Trypanosoma brucei: Implications for the

origin and evolution of mitochondrial transcription machinery

95

Introduction

Mitochondrial genomes vary considerably in gene content, structure and patterns
of expression (5). In spite of this dramatic variation, these genomes are transcribed by
what appears to be a universally conserved mitochondrial RNA polymerase (mtRNAP)
homologous to the phage T7 RNAP (7). Although mitochondrial transcription has been
characterized for only a few systems, the nuclear encoded mtRN AP gene is present in all
mitochondrial-bearin g eukaryotes for which sequence data is available. Likewise, we
have shown that this gene is also conserved in kinetoplastids, some of the most ancient
organisms to contain mitochondria (9). Mechanistically, the mtRNAP functions
somewhat differently than its phage homologue in that it requires at least one additional
factor for transcription initiation. In yeast, the mitochondrial transcription factor B
(mtTFB, also known as MTF 1) is necessary and sufficient to reconstitute transcription in
association with the mtRNAP (RPO41), on mitochondrial promoters (19, 31). In
contrast, early studies of mammalian mitochondrial transcription showed a requirement
for a distinct factor belonging to the HMG family of proteins, mtTFA or TFAM, in
association with partially purified mtRNAP (14-16, 29). Although an mtTFB-like
activity was identified biochemically in X. laevis, the corresponding gene was never
subsequently identified (4). These differences in the nature and number of transcription
factors are likely due to co-evolution of the transcription apparatus with its respective
genome.

Searches of the rapidly expanding genomic databases for homologues to the yeast
transcription factor did not reveal similar genes in other organisms. This was not

surprising given the lack of sequence conservation even among fungal relatives (6). In

96

addition, early sequence comparisons had likened the yeast mtTFB to sigma factors,
themselves a diverse group of proteins. Consequently, the degenerate PCR technique
used to identify the mtRNAP homologue in a wide variety of organisms was unsuitable
for the purpose of finding homologues to mtTFB. A major breakthrough in the field was
the crystallization of the Sc-mtTFB which decisively demonstrated that the protein was
not homologous to sigma factors as had previously been speculated (32). Analysis of the
protein structure indicated that it belonged to large family of ribosomal RNA
methyltransferases. Specifically mtTFB is homologous to the eubacterial ngA, a
protein responsible for the nearly universal dimethylation of two adjacent adenine
residues in the highly conserved 3’ tetraloop of small subunit rRNA (28). The news of
this surprising relationship was followed rapidly by the identification of the mtTFB
homologue, TFBMl, in humans by two separate groups (13, 24). Interestingly, these
homologues, and those subsequently identified in the sequence databases, bear much
greater similarity to their ngA ancestor than does the yeast mtTFB. Humans and other
“higher” animals also possess a paralogue to mtTFB, TFBM2 (13, 23, 30).
Trypanosoma brucei is an ancient protist with an unusual mitochondrial genome
and is one of the earliest eukaryotes to harbor mitochondria (18). Our lab has previously
identified a developmentally regulated mitochondrial RNA polymerase in T. brucei
homologous to the mtRNAPs of other organisms (9) As was the case with the vertebrate
genome databases, however, initial searches of the T. brucei genomic sequence database
did not reveal any putative mitochondrially targeted proteins with homology either to
transcription factor TFAM or to the yeast mtTFB. However, looking for rRNA

methyltransferase homologues we have identified the homologue to the mtTFB-1 in T.

97

brucei. This gene encodes a 467 amino acid protein with a putative mitochondrial
targeting sequence. Although clearly divergent from the animal mtTFB homologues in
the database, TbmtTFB bears much stronger similarity to these enzymes than does the
yeast MTFl gene. RN Ai knockdowns of the TbmtTFB transcript resulted in a moderate
decrease of target transcript and a slow growth phenotype. However, this was
accompanied by only slight decreases in the steady state levels of various mitochondrial
transcripts. Over-expression of TbmtTFB fused to a C-tenninal tandem affinity
purification (TAP) tag in T. brucei resulted in an increase in trypanosome growth rate
and a slight increase in some mt-mRNA levels but was unexpectedly accompanied by
slight decreases of mitochondrial rRNA. The finding of the TbmtTFB homologue in T.
brucei suggests that the core components of the mitochondrial transcription machinery in
yeast and animals was set in place millions of years ago, early in the course of eukaryotic
evolution. Although our initial data are insufficient to conclusively support or negate a
role as a transcription factor, we are currently working on obtaining conditional double
knockouts that will allow us to decisively determine its function in T. brucei. Given the

phylogenetic placement of T. brucei, either outcome will be interesting and significant.

Methods and Materials
Database searches and Sequence analysis:

The S. cerevisiae MTFlp (Genbank accession number NP_013955) protein
sequence was used to query the T. brucei TIGR database
(http://www.tigr.org/tdb/e2k1/tba1/) using tblastn. The resulting T. brucei nucleotide

sequence was then used in a tblastx search against the NCBI protein databases for further

98

identification. TIGR sequences homologous to the ngA family of methyltransferases
were assembled into a contig that corresponded to the 3’ 500 bp of the gene.
Mitochondrial targeting sequences were predicted using the following programs:

MIT OPROT, http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/mitofilter, Predotar,
httpzllwww.inra.fr/predotar/, TargetP, httpzllwww.cbs.dtu.dk/services/'l‘argetP/ and
iPSORT, http://hypothesiscreator.net/iPSORT/. Multiple alignments were generated by
Clustal X 1.81.

Cloning of the TbmtTFB:

The portion of the TBMTI’FB open reading frame not contained in the TIGR
database as well as the 5’ splice acceptor site was determined by sequencing 5’RACE
(rapid amplification of cDN A ends) products as described previously (9). The T. brucei
mtTFB open reading frame was then amplified from T. brucei genomic DNA (which
lacks introns) using Pfu polymerase (Stratagene) and sequenced by the MSU sequencing
facility.

Nucleotide sequence accession number: The TbmtTFB homologue has been submitted
to the GenBank database under accession no. AY133948.1
Trypanosome growth, transfections, and RNAi inductions:

Procyclic form T. brucei brucei strain 29-13 (generated by the George Cross lab),
which contains both the T7 RNA polymerase and the Tet Repressor integrated within the
genome, were grown in SDM-79 supplemented with 10% fetal bovine serum in the
presence of Geneticin (15].tg/ml) and hygromycin (50 ug/ml) (39). TbmtTFB RNAi
vectors were generated by amplifying a 477 bp fragment (position 430 to 907 in the 1401

ORF) with oligonucleotides 5’XhoI ErmC RNAi and 3’ HindIII ErmC RNAi, and

99

another 460 bp fragment (position 892 to 931 in the 1401 ORF) with oligonucleotides
5’XhoIRNAi-2 and 3’HindIII RN Ai-2. A third RNAi vector was made by amplifying the
mtTFB ORF with 5’ApamtTFB and 3’HindH ErmC RNAi-2, digesting both this PCR
product and the RNAi-1 vector with HindIH, followed by ligation to generate the 1157
+477 = 1634 dsRNA fragment.

For transfections, mid-log phase cells between 2 and 8 x 10° cells/ml were
centrifuged at 1000 x g, washed with ice cold Cytomix+phosphate buffered sucrose and
resuspended in fresh cytomix/PBS at a concentration of 2 x 108 cells/ml. 1 x 108 cells in
500 u] was combined with 30 ug of digested plasmid DNA on ice and transfected using a
Bio-Rad Gene Pulser electroporator at 1500 V and 25 11F. After transfection, cells were
resuspended in 10 mls of fresh medium and allowed to recover for 16-20 hours. Cells
were then spun down and resuspended in fresh medium containing geneticin,
hygromycin, and 2.5 ug/ml phelomycin. Resistant cells appeared 3-4 weeks after
selection.

Growth Curves:

For induction of dsRNA or TbmtTFB-TAP expression, 1 ug/ml tetracycline was
added to the medium. Inductions were started with cells at a density of l x 10° cells/ml
and were harvested between 5 and 10 x 106 cells/ml, and cells were diluted back down to
1 x 106 cells/ml. Growth curves were generated by plotting the cell count multiplied by
the total dilution over a period of 2-3 weeks. Inductions were performed in duplicate on
three separate occasions.

Nucleic acid Isolation, Northern and Southern blot analysis. Total T. brucei genomic

DNA was isolated as described previously (9). Mitochondrial RNA was isolated by the

100

acid guanidinium-phenol-chloroform method (8). Northern and Southern blots were
hybridized with 32P end-labeled oligonucleotide probes using standard conditions.
Western blot analysis

At each time point, ~5 x 107 cells were harvested, washed once with PBS+6mM
glycine, resuspended in 50 u] of 2XSDS-PAGE loading buffer and stored at -80°C. 1 x
107 cells were electrophoresed on an 8% SDS-PAGE gel, transferred to PVDF, and
probed with peroxidase-antiperoxidase (PAP, Sigma P-2026) which reacts with the
protein A portion of the TAP fusion protein. The signal was developed with the
SuperSignal West Pico chemiluminescent system (Pierce)
Conditional Double Knockout Vectors

Drug resistance vectors with the blasticidin resistance gene (pHD889) and
puromycin drug resistance gene (pHD996) were kindly provided by Dr. Christine
Clayton. Sequence flanking the TbmtTFB ORF was amplified from 29-13 genomic
DNA using pfu polymerase (Stratagene). An 880 bp 5’ fragment was amplified with
5’UTR NotIlong and 5’ UTR XhoIRev and the 1200 bp 3’ fragment was amplified with
3’UTR NheIlong and 3’UTR N goMIVRev. The 5’ fragment was inserted into the
pHD996 N ml and XhoI sites, and sequenced, followed by the insertion of the 3’ fragment
between the NheI and N goMIV sites to create the vector, pKOpur. The puromycin drug
resistance cassette was removed from pKOpur and replaced with the blasticidin
resistance cassette from pHD889 to create pKObsd.

The tandem affinity purification vector available from Euroscarf/Cellzome
contained a hygromycin selectable marker, making it inappropriate for use in 29-13 cells.

Consequently, the 586 bp (TAP) expression cassette was purified from the vector

101

pHD918 (Cellzome/Euroscarf) digested with BamHl and HindIII, ligated into the gel-
purified backbone of vector pLEWlOO (3) from which the 1877 HindIII-BamHl
luciferase fragment had been removed to generate pLEW-TAP. The TbmtTFB ORF was
amplified with the kinased primers 5’ ApaImtTFB and 3’mtTFBnostop, and ligated into
HpaI-digested, phosphatase-treated pLEW-TAP to create pLEW-mtTFB-TAP.
Transfections were performed as described above for the RNAi vectors, and cells were

selected in the presence of 2.5 ug/ml phelomycin (pLEW TAP)

Results:
Identification of a putative mtTFB in T. brucei:

Although previously likened to sigma factors, the recent crystal structure of the
yeast mitochondrial transcription factor mtTFB revealed structural homology with a
family of RNA methyltransferases (32). With this new structural information, we
investigated a low-significance hit (E>0.01) to the yeast mtTFB in the T. brucei TIGR
database. The yeast mtTFB protein sequence was blasted against the T. brucei database
with 2 resulting partially overlapping, low probability hits, 37D9.TR M13 Rev and
50N15.TR M13 Rev. A tblastp search with these DNA sequences against the NCBI NR
protein database returned several hypothetical eukaryotic proteins including the
subsequently identified human mtTFBl (24), as well as the genes for the prokaryotic
methyltransferase ngA. Because the TIGR database contained only 450 bp of the 3’
end of the gene, the remaining sequence was obtained by sequencing 5’ RACE products.
The putative TbmtTFB open reading frame of 1401 nt encodes a 467 amino acid

polypeptide predicted to be targeted to the mitochondrion by the web-based programs

102

iPSORT, MitoProtII, Predotar, and TargetP. Southern blot analysis indicates that this is a
single copy gene (data not shown), and analysis of contigs at the T. brucei genome
project website indicates it is located on chromosome X. Homologues to TbmtTFB are
also present in the genomes of the related kinetoplastid organisms, Leishmania major and
T. cruzi as determined by searching their genomic databases (www.5angergcuk, and
http://tcruzidb.org, respectively).

The kinetoplast homologues are significantly similar to vertebrate mitochondrial
transcription factors and retain several of the methyltransferase domains also conserved
in these proteins (Figure 1). It is interesting that the yeast mtTFB, while clearly related,
is not significantly similar to either the human or trypanosome homologues. For
example, a Blastp search of the NCBI NR database using the S. cerevisiae mtTFB protein
sequence yields significant results only for other fungal mtTFBs including those of
Schizosaccharomyces pombe, Kluyveromyces lactis, and Saccharomyces kluyveri with E
values <10'23. The human mtTFB homologue is much less similar with an E value of 1.4.
In contrast, the T. brucei protein is quite similar to the mouse and human mtTFB proteins
(E values of 10'11 and 108, respectively). The divergence of the yeast protein sequence is

likely the result of the greater evolution rate of yeast in general (12, 36).

103

Schematic of alignment of kinetoplast mtTFBs with animal and yeast homologues

1 —VII —'

V VVI
nIImI-
“SIDE Irlllall- II J

II Ifil I 11 l
E "C"

 

 

 

 

Figure 1: Alignment of kinteoplast mtTFBs with animal and yeast homologues.
Schematic diagram of the structure of the mtTFBs. Black boxes indicate conserved
methyltransferase domains. Gray boxes indicate conserved regions with less homology.
Breaks in the boxes indicate absence of sequence homology caused by an insertion in one
of more of the sequences relative to the others. The stippled boxes represent insertions
conserved in the mtTFB homologues that are not present in the eubacterial ngA
proteins. Regions underneath the Sc schematic represent deleterious mutations in yeast
mtTFB. The majority of these mutations occur in regions that are not conserved among
the other mtTFB predicted protein sequences. Tb, Trypanosoma brucei; Hs, Homo

sapiens, Sc, Saccharomyces cerevisiae.

FIGURE 1

104

Interestingly, the mitochondrial mtTFB sequences also have domains in common
that are not shared with the ngA homologues. Comparison of the available mtTFB
sequences in an alignment with ngA sequences reveal 3 blocks of sequence unique to
the mtTFBs (Figure 1). In addition, the kinetoplast sequences contain an insertion
relative to the other aligned mtTFB sequences. This insertion occurs between domains III
and IV, and does not disturb regions known to be important for SAM binding or
catalysis. Of the clusters of mutations performed on the yeast mtTFB sequence (10, 20,
35) shown in Figure 1, only cluster B is highly conserved among the other mtTFB
sequences.

RNAi knockdown of TbmtTFB

In order to determine whether this putative mitochondrial transcription factor
plays a role in transcription in T. brucei mitochondria, we attempted to use RNA
interference (RNAi) to knockdown expression of this gene. RNAi has been used
effectively to study the functions of several T. brucei genes including the T. brucei
mitochondrial RNA polymerase, TBMTRNAP (17). Briefly, the vector pZJM contains a
target PCR gene fragment inserted between two opposing tetracycline-inducible T7
promoters (Figure 2A). Upon transfection into T. brucei, pZJM integrates into the non-
transcribed rDNA spacer region of the T. brucei genome to create a stable cell line

expressing double stranded RNA (dsRNA) corresponding to the insert region (38).

105

Figure 2: (A) Vector for expression of double stranded RNA (dsRNA) (B) Schematic of
TbmtTFB ORF with regions targeted by dsRNA shown as boxes. Probes used in
Northern blots and RPAs are indicated by numbers above the diagram. (C) Northern
blot analysis of RNA from cells expressing dsRNA-1. TbmtTFB mRNA (top panel) or
dsRNA-1 (bottom panel) using probe 1. (D) Ribonuclease protection assay of
TbmtTFB mRNA (top panel) or Northern blot of dsRNA-2 (bottom panel) of RNA from
cells expressing dsRNA-2. Lanes loaded with RNA from uninduced cells are indicated

by minus (-) signs, while those from induced cells are indicated by plus (+) signs.

106

Targeting portions of the TbmtTFB ORF with RNAi has no effect on

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

TbmtTFB mRNA abundance
A
T7 ' etOp] insert [mom
L rDNA [ polyA TBLEISAS T7 m m
B
.1. ‘ 2
[ | RNAi-1 : 1 “NM-2 1
I RNAI—3
| I I '
1 500 1000 1401
c +tet D
2-2468Wt 2-2+4-4+Wt
f. , E: . TbmtTFB . _. , - I ' TbmtTFB
.. ngNA mRNA
  dsRNA-1 dsRNA'z
FIGUREZ

107

Our first two attempts targeted the middle 477 nt (RNAi-1) and a non-overlapping
460 nt region of the 3’ end (RNAi-2) of the transcript (Figure 2B). Northern blot
analyses indicate that the dsRNA is produced in small amounts in the absence of
tetracycline, indicating some leaky expression of the T7 driven cassette (Figure 2, C and
D, bottom panels). Addition of 1 ug/ml of tetracycline induces the production of large
amounts of dsRNA easily observed in the Northern blots. However, both Northern blot
analysis and ribonuclease protection assays (RPAs) indicate that induction with
tetracycline did not lead to a decrease in the detectable TbmtTFB mRN A signal (Figure 2
C and D, respectively). In addition, the growth rate of cells expressing RNAi-l or RNAi-
2 dsRNA was identical to that of uninduced cells (data not shown). Because a correlation
between dsRNA size and efficiency of RNAi has been described (21), a larger fragment
corresponding to 1157 of the ORF was cloned into the vector already containing the
middle fragment to generate RNAi-3 (Figure 2B). Upon induction with tetracycline, a
slow growth phenotype was observed in cells transfected with this construct. This
phenotype was observed in each of three independent experiments, and a representative
graph is shown in Figure 3A. Measurement of the slopes of these growth curves
indicates that induction results in a 30% decrease in average growth rate. Northern blot
analysis using a riboprobe specific to the first 185 nt (not shared with the dsRNA) of the
TbmtTFB ORF demonstrated an immediate, but slight decrease in the amount of
TbmtTFB transcript (Figure 38). Unfortunately, the TbmtTFB mRNA is quite rare and
difficult to detect on Northern blots. However, quantification of the TbmtTFB signal
indicates that it is reduced to 50% of uninduced levels by day 8 followed by a recovery in

transcript levels; a pattern often seen in trypanosomes (Figure 3C).

108

Figure 3. (A) Effect of dsRNAi-3 on cell growth. Growth of RNAi cells induced
(doted line/open symbol) or uninduced (solid line/filled symbol). Cumulative cell density
was determined by multiplying the cell count by the cumulative dilution factors over the
course of the experiment as described in the materials and methods. (B) Northern blot
analysis of TbmtTFB mRN A for uninduced and induced cells (top panel). rRNA
intensity (bottom panel) was used as a loading control. (C) Quantitation of TbmtTFB
signal in induced cells relative to uninduced signal (induced signal/uninduced

signal)* 100.

109

 

Cumulative cells/ml

1x1018
1x1016

1x10“
1x1012

1x1 01°
1x108
1x106

 

Effects of dsRNAi-3 expression

 

 

 

 

 

 

 

 

 

“/7 f

j

2 4 6 81012141618202225

Days Post Induction

+ I uglml Tet

 

24681012

 

V“.
.. I,

 

 
 

 

Relative transcript

abundance
c.8388

-l

 

TbmtTFB

4 6

FIGURE 3

110

10
Days Post Induction

12

 

In order to determine if the decrease in TbmtTFB mRNA affected the level of
steady state mitochondrial transcripts, total RNA was analyzed via northern blot analysis.
Several Northern blots were analyzed for many of the transcripts and representative blots
are shown in Figure 4. Overall, the reduction in TbmtTFB mRN A level appears to have
only slight effects on mitochondrial transcript levels. There is a general trend toward
reduction in RNA levels. However, there are transcript specific differences in these
effects. The 95 rRNA shows the most pronounced decrease with RNA levels in induced
cells reduced to ~60% of that seen in the uninduced lanes. Interestingly, this reduction in
the 9S rRNA signal from induced cells is reversible, as this signal appears to increase to
levels above the uninduced cells after day 8. This effect was seen on multiple blots, but
as shown in the quantitation in Figure 5A, this signal was subject to considerable
variability. The large subunit rRNA also showed a slight and repeatable decrease relative
to uninduced cells, but in contrast to the 9S rRNA, did not show a pronounced recovery.

In addition to the ribosomal RNAs encoded on the major strand of the maxicircle,
mRN As encoded on both the major and minor strand were also analyzed. While the
abundant minor strand N D] transcript appears relatively unchanged, the less abundant
COI transcript remains at ~70-80% of uninduced levels. The major strand mRNAs ND4
and Cyb are reduced farther to levels ~60-70% of the uninduced signal. Several of the
transcripts appear as doublets as a result of differing polyA tail lengths (2). Interestingly,
in each case the reduction in transcript abundance in induced cells is more dramatic for
the upper band than the lower band. This effect is summarized in the graph in Figure 5 D
for the ND4 transcript. Although there is a general trend towards reduction of

mitochondrial transcripts in cells expressing dsRNA, the slight decrease in the

111

Northern blot analysis of mitochondrial transcripts

Hug/ml Tet
Dayspostinduction 2 4 6 810122 4 6 8 1012

    

 

 

 

 

 

 

 

ND1

 

  

U “.30 U“ as flit d tubulin

. rRNA

 

 

 

 

 

Figure 4: A Northern blot analysis of mitochondrial transcripts from induced and
uninduced cells. 10 pg of total RNA from each time point was loaded per lane.
Transcripts were detected with end-labeled oligonucleotide probes, stripped and re-
hybridized. Ethidium bromide staining of rRNA and tubulin signal is shown to indicate

loading.

FIGURE 4

112

Quantification of relative transcript abundance

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

rRNAs
A
.‘é
8 o
2 8
g .g "-0" 98+]-
g g —I—12s+l-
3 .0
a N
E O I T r r l
2 4 6 8 10 12
days post induction
Major Strand
B «3 150
o o
2 2 n
g 3 10° 5:}: ! ct —-°—ND4+I-
C
E 3 50 +CYb-l-l-
'95 a
E o I I I I I
2 4 6 8 10 12
days post induction
Minor strand
C
150

100 A /.'./.
(0H ° ""0 ---<>-- COI+I-

50 + ND1-fl-

 

 

 

 

 

 

relative transcript
abundance

 

 

 

2 4 6 8 10 12
days post induction
Figure 5: Quantification of relative transcript abundance for various transcripts from
induced and uninduced cells. Relative transcript abundance was calculated as (induced
signal/uninduced signal)* 100.

FIGURE 5

113

ND4 signal

 

 

 

 

 

 

 

 

 

 

 

 

130
33. x..
g g "0 ‘ +1....
gig 90 ---x---Upper
3% 70 —a—-Iower
50 i T l I I

2 4 6 8 10 12
days post Induction

Figure 5D. Quantification of relative transcript abundance of upper and lower ND4
transcripts. The decrease in abundance for the transcript with the longer polyA tail is

greater than that seen for the transcript with the shorter polyA tail.

FIGURE 5 (cont’d)

114

TbmtTFB mRNA caused by RNAi has little overall effects on steady state mitochondrial
transcript levels.

Links between mitochondrial transcription and DNA replication have been
observed for both yeast and mammals. Likewise, knockdown of TbmtRNAP via RNAi
results in a decrease in maxicircle abundance but not minicircle abundance, suggesting a
role for transcription in maxicircle maintenance. However, no significant difference was
seen in maxicircle or minicircle levels in cells expressing dsRNA against the TbmtTFB
as determined by Southern blot analysis (data not shown).

Gene Replacement

Given the subtle decrease in TbmtTFB mRNA upon induction of dsRNA,
it was unclear whether the slight but consistent effects seen on mitochondrial RNA levels
were genuine and/or a result of the RNAi mediated gene knockdown. Although RNAi is
a well documented system in T. brucei, there have been other transcripts for which RNAi
has not worked. However, these instances are generally undocumented and it is unclear
what factors may contribute to RNAi failure. Consequently, we decided to perform the
relatively more labor intensive process of double allelic replacement as shown in Figure
6. Sequence flanking the 5’ and 3’ of the ends of TbmtTFB ORF was cloned into a
vector bearing either the blasticidin (BSD) or puromycin (PUR) drug resistance cassette.
Cells were transfected with the knockout plasmids and those surviving selection were
analyzed via PCR and Southern blotting to confirm TbmtTFB gene replacement. Several
independent transfections were performed. Although each knockout plasmid was able to

target the TbmtTFB locus when transfected individually, cells surviving selection after

115

Figure 6. Conditional Double Knockout Strategy (A) Diagram of TbmtTFB locus and
drug resistance vectors used to replace the wild type allele. (B) The inducible, ectOpic
expression vector for the C-terminal TAP tagged TbmtTFB. (C) Optimization of
expression of TbmtTFB-TAP. Cells at 2 x 106 cells/ml were induced with increasing
amount of tetracycline, harvested 48 hours later. Whole cell lysate was electrophoresed
on an 8% SDS-PAGE gel, transferred to PVDF and probed with PAP reagent which

detects the protein A moiety of the TAP tag.

116

Conditional Double Knockout Strategy

 

  
 

urrrrtrriirit I"; T mtTFB 'I—H-U K”. ‘L // WT
I—— 3515 bp 4.

// L—fifitmrammssis

I-— 3108 bp

   

//

 

 

 

 

 

 

 

 

@ Flanking 804090“ El PARP SAS
Actin UTRs

Aldoase UTRs

> PARP promoter

Tet operators 4 1'7promoter

 

 

 

 

BLE hlrbmtrFB-TM // TbmtTFB-TAP

 

 

 

 

[Tet] nglmL
kDa c. 9- .8— _.-
11765 7 ’ 72kDa
’ ._ ",'."."’ " TbmtTFB-TAP
FIGURE6

117

 

sequential or co- transfection with both plasmids were observed to have mis-targeted at
least one of the drug resistance genes (data not shown). Because this result indicated that
the product of the TbmtTFB gene is essential in T. brucei, we transfected a single
knockout (TbmtTFB-/+) strain with a tetracycline-inducible T. brucei expression vector
containing an ectopic copy of the TbmtTFB ORF fused at the C-terminus with a tandem
affinity purification (TAP) tag to create strain TbmtTFB-/+::TbmtTFBTAP. Stably
transfected cells were screened for their ability to express TbmtTFBTAP upon induction
of tetracycline, and expression was optimized (Figure 6C).

During the initial TbmtTFBTAP optimization experiments, a slight increase in
growth rate was observed for the cells expressing TbmtTFBTAP relative to uninduced
controls. Because this effect complemented the decrease seen in the RNAi experiments
described above, we decided to investigate this phenotype further. Growth curves were
performed using the TbmtTFB-/+::TbmtTFBTAP cell line in the presence or absence of
l ug/ml tetracycline. Cells were counted and harvested every other day for RNA, DNA
and protein for a period of 2 weeks. Three independent experiments were performed in
duplicate and a representative growth curve is shown in Figure 7A. The Western blot
shown in Figure 7B indicates that tight regulation of TbmtTFB-TAP expression was

maintained throughout the course of the experiment.

118

 

Expression of TbmtTFB results in a growth rate increase

1x1013
1x1012
‘lx1011
‘lx101o
1x109
1x108
1x107
1x10“

Cumulative Cells/mi

 

0 5 1o 15
days post induction

No tet Plus 1 uglml tet

WWW" 2 5 8 1o 12 14 2 5 8 1o 12 14 kDa
induction ..... , ............. . ..... ..... .....

    

Figure 7: Effect of TbmtTFBTAP expression on cell growth. (A) Growth of T. brucei
cells with tet (solid symbol) or without (open symbol). Total cells/ml determined as in
Figure 3. (B) Western blot of whole cell lysates with PAP reagent. Tight regulation of

TbmtTFBTAP expression was maintained throughout the experiment.

FIGURE 7

119

In order to determine if the growth rate increase seen upon expression of the
TbmtTFBTAP protein was accompanied by a change in steady state mitochondrial
transcript levels, total RNA was analyzed via Northern blot (Figure 8). As seen for the
RNAi strain, differences between RNA from induced cells versus uninduced controls
were slight. The increase seen for the mRNA levels in cells expressing the TbmtTFB-
TAP protein does complement the slight decreases seen in the cells expressing dsRN A.
There appears to be no significant difference in the abundance of transcripts with long
polyA tails versus those with short polyA tails, however. Unexpectedly, a decrease in
the amount of both 128 and 9S ribosomal RNAS was observed upon induction of
TbmtTFBTAP. As seen in the RNAi experiment no significant differences were seen for

kDNA levels (data not shown).

120

Northern blot analysis of various mitochondrial transcripts from

mtTFB-TAP induction experiment

Plus 1 jig/ml Tet
2 5 8 1012 14

Days post
induction 2

5 8 10 1214
125 i

                

93

CYb

 

con
ND4
cor

ND1

TUB 113'“. 'd.':.‘. '2&.‘h§§~“ Llfi Mmatfituwlisbu A
1 2345 6 789101112

Figure 8. Analysis of the effect of TbmtTFBTAP expression on mtRNA levels. 10 mg
of total RNA from each time point was loaded per lane. Transcripts were detected with

end-labeled oligonucleotide probes. Tubulin signal is shown to indicate loading.

FIGURE 8

121

Quantification of relative transcript abundance

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

A rRNA
Li 120
3 3 100
to
gg :3 ......9s./.
’5 g +123 +1-
.2 .o 40
5 a 20
2 O
2 5 8 10 12 14
days post induction
B MajorStrand
a
g 3 200 W“-
g 5 150 —o—ND4+I-
’3 ‘g’ 100 1 —o—cou +1-
“-24.3 so ---A---Cyb+/-
2 o . . . . .
2 5 8 10 12 14
days post Induction
Minorstrand
C .—
-§' 150
g 6 (W‘s—“:3 ----- ° ----- o ---<>--com-
w 5 —-—ND1+/-
.2 a so
:5 a
e o r l r r T

 

 

 

2 4 6 8 10 12
days post induction

Figure 8: Quantification of relative transcript abundance for various transcripts from

induced and uninduced cells. Relative transcript abundance was calculated as (induced

signal/uninduced signal)* 100.

FIGURE 8 (cont’d)

122

Discussion:
Role of TbmtTFB in T. brucei

Our RN Ai attempts result in only a slight decrease in the target TbmtTFB
transcript level with unknown effects on the level of the TbmtTFB protein. Interestingly,
it has been shown that about 20% of siRNA is found associated with polyribosomes in T.
brucei, suggesting an interaction with the translational machinery (11). It is theoretically
possible that expression of the TbmtTFB protein is reduced due to an siRNA inhibition of
translation. However, without antibodies to TbmtTFB, we cannot know for sure. A
simpler explanation for the growth decrease consistently seen after day 7 post-induction
is the stress on the cell caused by excessive dsRNA production. However, the lack of any
growth defect in the other RNAi experiments producing similar amounts of dsRNA
would argue against this trivial explanation.

It does appear that several mitochondrial transcripts decrease upon induction with
tetracycline, however these effects are too slight and variable to be convincing given the
incomplete knockdown of the TbmtTFB mRNA and unknown effect on the protein level.
In contrast to the growth decrease seen during the RNAi knockdown of TbmtTFB, the
expression of a C-terminal TAP tagged TbmtTFB results in an increased trypanosome
growth rate. Again, however, effects on steady state mitochondrial transcript levels are
slight and inconclusive.

If TbmtTFB is a transcription factor in T. brucei it is not necessarily surprising
that a moderate increase/decrease in the expression of this gene would not have an effect
on the steady state levels of various mitochondrial transcripts. In yeast, estimates for

yeast mitochondria indicate that MTFI is limiting with only about 20 molecules per cell

123

P

in contrast to the 50 molecules of RPO41 and 10-30 copies mtDNA (22). However, in
spite of this, overexpression in yeast of RPO41 and/or MTFl separately or together did
not result in an increase in mitochondrial transcript levels (22)(and references therein).
Consequently, slight perturbations of the TbmtTFB level may have little impact on
transcription. Additionally, as is the case for mitochondrial gene expression in other
organisms, post-transcriptional processing and stability appear to play a dominant role in
mitochondrial gene expression in T. brucei. For example, work from the Hajduk lab has
shown that while transcription rates are identical for bloodstream and procyclic form
trypanosomes, the rRNAs are 30-fold more abundant in procyclics suggesting that
regardless of transcription rate, stability has the final say, at least for these transcripts
(26). Consequently, experiments looking at the rate of transcription in isolated organelles
may be needed to determine if TbmtTFB affects the rate of transcription in T. brucei.

One important feature of mitochondrial transcripts in T. brucei that is correlated
with developmental regulation is polyA tail length (2). Interestingly, two distinct
pathways for RNA turnover exist in T. brucei mitochondria; a slow, polyA tail-
independent pathway, and a rapid turnover specific for transcripts bearing polyA tails
(27). Consequently, transcripts with longer polyA tails may be less stable and more
sensitive to slight perturbations in transcription rate. Therefore, it is interesting for
several of the transcripts, those with longer polyA tails appear be more sensitive to RN Ai
against TbmtTFB, although this differential sensitivity was not observed in the

overexpression experiments.

124

Analysis of Alignment:

Much of the early work describing interactions of the yeast mitochondrial RNA
polymerase with the transcription factor mtTFB and the holoenzyme with yeast
promoters worked under the assumption that the yeast mtTFB was homologous to the
RpoD sigma factor. Consequently, many of the mutagenesis studies were performed on
regions with proposed homology to sigma, and are not conserved in the other mtTFBs
(10, 20, 35). Indeed, it is now known that these regions are in fact not homologous to
sigma factors. With the identification of homologues in other organisms, it is worth
while to re-evaluate this mutagenesis data and reinterpret it in light of recent findings.
Although many of the mtTFB mutations described in these studies were not deleterious, a
few were essential and several exhibited a dependence of the holoenzyme on supercoiled
templates. Interestingly, among the 3 clusters of mutations identified that impair
interaction with RPO41(10), cluster A is not conserved among other mtTFB genes which
instead show a stronger similarity to ngA (Figure 1). Likewise, cluster C is an insertion
that is specific to fungal mtTFBs, and mutations in cluster C, specifically 8218, I221K
and D2256 exist in an unstructured loop-like region which extends away from the rest of
the protein in the crystal structure of sc-mtTFB (32). Consequently, given the lack of
conservation of these residues in the other mtTFB homologues, interactions between
mtRN AP and mtTFB have likely co-evolved differently to recognize divergent
promoters. In contrast, the residues in cluster B are conserved in all mtTFBs and span
ngA domains IV, and V as well one of the domains specifically shared only by the
mtTFB proteins. In addition, mutations in regions between cluster B and C (178-189)

result in a dependence on supercoiled templates in vitro(34), and these residues are more

125

highly conserved. Consequently, the conservation of residues in this region may be
important for interact with the mtRNAP and/or promoter in a manner that is shared
among all eukaryotes.

Interestingly, mammalian transcription requires TFAM which bends DNA to
decrease the energy required for promoter melting. Supercoiled DNA has a similar effect
on decreasing the energy of promoter melting, perhaps explaining why residues in the
yeast mtTFB that result in a dependence on supercoiled templates are not conserved in
the mammalian mtTFBs. Interestingly, T. brucei kDNA is not supercoiled in vivo,
however database searches of the T. brucei genome indicate that there are no TFAM
homologues (data not shown). Instead, there is a small histone like protein associated
with kDN A (40). RNAi against this protein results in an increase in mitochondrial
transcripts, probably due to increased accessibility to the DNA, suggesting that this does
not function analogously to TFAM (1). Given recent evidence indicting that the
mtRNAP has an innate ability to recognize promoters in mitochondrial DNA, the
associated proteins therefore assist in other steps of the process, such as promoter
opening.

Possible other functions for TbmtTFB

The original function of mtTFB was likely to modify the small subunit ribosomal
RNA (SSUrRNA). Interestingly, the methyltransferase, and the modification for which it
is responsible, is conserved across all domains of life as well as in organelles (28). One
notable exception is the S. cerevisiae mitochondrial 12S rRNA. Given the divergence of
the MTFl gene from the methyltransferase homologues, it is not surprising that this

modification does not occur. Mammalian mitochondrial SSU rRNA is at least partially

126

modified, and TFBMl and its paralogue, TFBM2 are presumably both capable of .this
activity (33). Interestingly, methyltransferase domains are less conserved in TFBM2 and
it is at least 2 orders of magnitude more efficient than TFBMl in stimulating transcription
(13). Mutagenesis studies have shown that the methyltransferase activity in TFBMl and
2 is not required for activity as a transcription factor (25). It is not known, however, if
the methyltransferase activity is required for mitochondrial biogenesis in vivo. It is
possible that the methylation of SSU rRNA in mammalian mitochondria is important for
mitoribosome biogeneis.

ngA mutants in bacteria are viable, although their doubling time increases and
their ribosomes require a greater number of factors for translation in vitro. They also
show more translation defects such as frameshift and nonsense mutations. It is possible
that TbmtTFB is not a transcription factor but rather serves only to modify the highly
degenerate and diminutive mitochondrial 9S rRNA. All mitochondrial SSU rRNAs are
reduced in length relative to their nuclear encoded homologues, but kinetoplast rRNA is
among the shortest (37). Such a function for TbmtTFB would explain the lack of effect
on steady state RNA levels in spite of the slow growth phenotype observed in the dsRNA
producing strains and the growth increase seen in cells expressing TbmtTFBTAP. These
growth effects could be the result of changes in translation efficiency. Unfortunately,
there are no antibodies to mitochondrially encoded proteins in T. brucei, so we were
unable to test this hypothesis. If mitochondrial RNA levels remain unaffected in the
conditional double knockout strain when expression of the the ectopic TbmtTFBTAP is

downregulated, it would interesting to determine whether or not the 9S rRNA is found

127

associated with mitochondrial polysomes or if mitochondrial translation rates differ

between wild-type and knockout cells.

128

10.

LITERATURE CITED

Avliyakulov, N. K., J. Lukes, and D. S. Ray. 2004. Mitochondrial histone-like

DNA-binding proteins are essential for normal cell growth and mitochondrial
function in Crithidia fasciculata. Eukaryot Cell 3:518-26.

Bhat, G. J ., A. E. Souza, J. E. Feagin, and K. Stuart. 1992. Transcript-specific
developmental regulation of polyadenylation in Trypanosoma brucei
mitochondria. Mol Biochem Parasitol 52:231-40.

Biebinger, S., L. E. Wirtz, P. Lorenz, and C. Clayton. 1997. Vectors for
inducible expression of toxic gene products in bloodstream and procyclic
Trypanosoma brucei. Mol Biochem Parasitol 85 :99-1 12.

Bogenhagen, D. F., and N. F. Insdorf. 1988. Purification of Xenopus laevis
mitochondrial RNA polymerase and identification of a dissociable factor required
for specific transcription. Mol Cell Biol 8:2910-6.

Burger, G., M. W. Gray, and B. F. Lang. 2003. Mitochondrial genomes:
anything goes. Trends Genet 19:709-16.

Carrodeguas, J. A., S. Yun, G. S. Shadel, D. A. Clayton, and D. F.
Bogenhagen. 1996. Functional conservation of yeast mtTFB despite extensive
sequence divergence. Gene Expr 6:219-30.

Cermakian, N., T. M. Ikeda, 1R. Cedergren, and M. W. Gray. 1996. Sequences
homologous to yeast mitochondrial and bacteriophage T3 and T7 RNA

polymerases are widespread throughout the eukaryotic lineage. Nucleic Acids Res
24:648-54.

Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem
162:156-9.

Clement, S. L., and D. J. Koslowsky. 2001. Unusual organization of a
developmentally regulated mitochondrial RNA polymerase (TBMTRNAP) gene
in Trypanosoma brucei. Gene 272:209-18.

Cliften, P. F., J. Y. Park, B. P. Davis, S. H. Jang, and J. A. Jaehning. 1997.
Identification of three regions essential for interaction between a sigma-like factor
and core RNA polymerase. Genes Dev 11:2897-909.

129

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

Djikeng, A., H. Shi, C. Tschudi, S. Shen, and E. Ullu. 2003. An siRNA
ribonucleoprotein is found associated with polyribosomes in Trypanosoma brucei.
Rna 9:802-8.

Doolittle, R. F., D. F. Feng, S. Tsang, G. Cho, and E. Little. 1996. Determining
divergence times of the major kingdoms of living organisms with a protein clock.
Science 271:470-7.

Falkenberg, M., M. Gaspari, A. Rantanen, A. Trifunovic, N. G. Larsson, and
C. M. Gustafsson. 2002. Mitochondrial transcription factors B1 and B2 activate
transcription of human mtDNA. Nat Genet 31:289-94.

Fisher, R. P., and D. A. Clayton. 1988. Purification and characterization of
human mitochondrial transcription factor 1. Mol Cell Biol 8:3496-509.

Fisher, R. P., and D. A. Clayton. 1985. A transcription factor required for
promoter recognition by human mitochondrial RNA polymerase. Accurate

initiation at the heavy- and light-strand promoters dissected and reconstituted in
vitro. J Biol Chem 260:11330-8.

Fisher, R. P., J. N. Topper, and D. A. Clayton. 1987. Promoter selection in
human mitochondria involves binding of a transcription factor to orientation-
independent upstream regulatory elements. Cell 50:247-58.

Grams, J ., J. C. Morris, M. E. Drew, Z. Wang, P. T. Englund, and S. L.
Hajduk. 2002. A trypanosome mitochondrial RNA polymerase is required for
transcription and replication. J Biol Chem 277 :16952-9.

Gray, M. W., G. Burger, and B. F. Lang. 2001. The origin and early evolution
of mitochondria. Genome Biol 2:REVIEWS 1018.

Jang, S. H., and J. A. Jaehning. 1991. The yeast mitochondrial RNA
polymerase specificity factor, MTFl, is similar to bacterial sigma factors. J Biol
Chem 266:22671-7.

Karlok, M. A., S. H. Jang, and J. A. Jaehning. 2002. Mutations in the yeast
mitochondrial RNA polymerase specificity factor, Mtfl, verify an essential role in
promoter utilization. J Biol Chem 277:28143-9.

LaCount, D. J ., and J. E. Donelson. 2001. RNA interference in African
trypanosomes. Protist 152:103-1 l.

Mangus, D. A., S. H. Jang, and J. A. Jaehning. 1994. Release of the yeast

mitochondrial RNA polymerase specificity factor from transcription complexes. J
Biol Chem 269:26568-74.

130

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

Matsushima, Y., R. Garesse, and L. S. Kaguni. 2004. Drosophila
mitochondrial transcription factor B2 regulates mitochondrial DNA copy number
and transcription in schneider cells. J Biol Chem 279:26900-5.

McCulloch, V., B. L. Seidel-Rogol, and G. S. Shadel. 2002. A human
mitochondrial transcription factor is related to RNA adenine methyltransferases
and binds S-adenosylmethionine. Mol Cell Biol 22:1116-25.

McCulloch, V., and G. S. Shadel. 2003. Human mitochondrial transcription
factor B1 interacts with the C-terminal activation region of h-mtTFA and

stimulates transcription independently of its RNA methyltransferase activity. Mol
Cell Biol 23:5816-24.

Michelotti, E. F., M. E. Harris, B. Adler, A. F. Torri, and S. L. Hajduk. 1992.
Trypanosoma brucei mitochondrial ribosomal RNA synthesis, processing and
developmentally regulated expression. Mol Biochem Parasitol 54:31-41.

Militello, K. T., and L. K. Read. 2000. UTP-dependent and -independent
pathways of mRNA turnover in Trypanosoma brucei mitochondria. Mol Cell Biol
20:2308-16.

O'Farrell, H. C., J. N. Scarsdale, and J. P. Rife. 2004. Crystal structure of
ngA, a universally conserved rRNA adenine dimethyltransferase in Escherichia
coli. J Mol Biol 339:337-53.

Parisi, M. A., and D. A. Clayton. 1991. Similarity of human mitochondrial
transcription factor 1 to high mobility group proteins. Science 252:965—9.

Rantanen, A., M. Gaspari, M. Falkenberg, C. M. Gustafsson, and N. G.
Larsson. 2003. Characterization of the mouse genes for mitochondrial
transcription factors B1 and B2. Mamm Genome 14:1-6.

Schinkel, A. H., M. J. Koerkamp, E. P. Touw, and H. F. Tabak. 1987.
Specificity factor of yeast mitochondrial RNA polymerase. Purification and
interaction with core RNA polymerase. J Biol Chem 262:12785-91.

Schubot, F. D., C. J. Chen, J. P. Rose, T. A. Dailey, H. A. Dailey, and B. C.
Wang. 2001. Crystal structure of the transcription factor sc-mtTFB offers insights
into mitochondrial transcription. Protein Sci 10: 1980-8.

Seidel-Rogol, B. L., V. McCulloch, and G. S. Shadel. 2003. Human

mitochondrial transcription factor B1 methylates ribosomal RNA at a conserved
stem-loop. Nat Genet 33:23-4.

131

34.

35.

36.

37.

38.

39.

40.

Shadel, G. S., and D. A. Clayton. 1995. A Saccharomyces cerevisiae
mitochondrial transcription factor, sc- mtTFB, shares features with sigma factors
but is functionally distinct. Mol Cell Biol 15:2101-8.

Shadel, G. S., and D. A. Clayton. 1995. A Saccharomyces cerevisiae
mitochondrial transcription factor, sc-mtTFB, shares features with sigma factors
but is functionally distinct. Mol Cell Biol 15:2101-8.

Sipiczki, M. 2000. Where does fission yeast sit on the tree of life? Genome Biol
l:REVIEWSlOl 1.

Sloof, P., J . Van den Burg, A. Voogd, R. Benne, M. Agostinelli, P. Borst, R.
Gutell, and H. Noller. 1985. Further characterization of the extremely small
mitochondrial ribosomal RNAS from trypanosomes: a detailed comparison of the
9S and 12S RNAS from Crithidia fasciculata and Trypanosoma brucei with
rRNAs from other organisms. Nucleic Acids Res 13:4171-90.

Wang, Z., J. C. Morris, M. E. Drew, and P. T. Englund. 2000. Inhibition of
Trypanosoma brucei gene expression by RNA interference using an integratable
vector with opposing T7 promoters. J Biol Chem 275:40174-9.

Wirtz, E., M. Hoek, and G. A. Cross. 1998. Regulated processive transcription
of chromatin by T7 RNA polymerase in Trypanosoma brucei. Nucleic Acids Res
26:4626-34.

Xu, C. W., J. C. Hines, M. L. Engel, D. G. Russell, and D. S. Ray. 1996.

Nucleus-encoded histone Hl-like proteins are associated with kinetoplast DNA in
the trypanosomatid Crithidia fasciculata. Mol Cell Biol 16:564-76.

132

CHAPTER V

Summary and Future Research

 

133

SUMMARY

Relatively little is known about the scope of mitochondrial transcription in
eukaryotes because this has only been elaborated for two relatively close clades: animals
and fungi. Whole genome sequence comparisons suggest that new components of the
mitochondrial proteome have continued to evolve after the divergence of the major taxa.
It is clear from sampling these relatively few taxa that group specific evolution has
resulted in distinct differences in the mechanisms for transcription of the mitochondrial
genome, both in cis elements and trans-acting factors. The precise origin of the
mitochondrial transcription apparatus is uncertain. Since T. brucei belongs to one of the
earliest branches of eukaryotes that possess mitochondria, learning more about the
differences and similarities between trypanosomes and other organisms will provide
evolutionary insight into the development of this unusual transcription machinery.
Additionally, the potential to discover novel components and/or mechanisms of
transcription in this ancient organism opens up the possibility of finding much needed
chemotherapeutic agents against this pathogen.

Mitochondrial transcription in T. brucei is complex and developmentally
regulated. This regulation involves the transcription of ribosomal and protein coding
genes localized to the maxicircle DNA as well as the transcription of hundreds of
minicircle-encoded guide RN As. Although there has been extensive research into the
process of RNA editing in T. brucei, there has been little research published regarding the
transcription of the kinetoplast genome. The objective of this study has been to learn

more about mitochondrial transcription in T. brucei by identifying and characterizing

134

protein components and promoter elements required for RNA synthesis in this unusual

organelle.

Mapping transcription start sites

Transcription start sites have been mapped for several minicircle gRN A genes
(12), but no maxicircle transcription initiation sites had been identified prior to this work.
In T. brucei, transcription has been shown to initiate within the variable region of the
maxicircle at least 1.2 kb upstream of the 5’ end of the 12S rRNA and proceed
polycistronically through the genome (10). This transcript is processed rapidly, as
precursors spanning more than two genes have not been detected. Since this precursor is
so unstable, and because the initiation site has not been precisely mapped, this region
does not make an ideal area to use as a promoter for in vitro transcription assays.

In T. brucei, two classes of transcripts are produced from two distinct
mitochondrial genome components. Guide RNAS (gRNAs) are usually minicircle
encoded and exist as primary transcripts, while the maxicircle encoded rRNAs and
mRNAs are processed from a polycistronic precursor. The genes for the gRNAs
gMURF2-II and gCYb(560) each have uncommon kDN A locations not typically
associated with transcription initiation events. I have demonstrate that the conserved
maxicircle gRNA, gMURF2-II, has an unusual location within the ND4 gene. This is the
first report of a completely intragenic gene in kinetoplast DNA. In addition, the
gMURF2-II and ND4 transcripts are generated by distinctly different events; the ND4
mRN A is processed from a polycistronic precursor, while transcription of the gRNA

initiates downstream of the 5’ end of the ND4 gene. The gCYb(560) gene has an atypical

135

minicircle location in that it is not flanked by the inverted repeat sequences that surround
the majority of minicircle gRNA genes. These data show that the mature gCYb(560)
gRNA is also a primary transcript and that the 5’ end heterogeneity previously observed
for this gRNA is a result of multiple transcription initiation sites and not imprecise 5’ end
processing. Together, these data indicate that gRNA genes represent individual
transcription units regardless of genomic context and suggest a complex mechanism for
mitochondrial gene expression in T. brucei. In addition, this region thus provides an
excellent area to study the mechanism by which the T. brucei transcriptional and/or
processing machinery discriminates between these events. This work was described in a

publication this year in Eukaryotic Cell (5).

Conserved mitochondrial RNA polymerase subunits in T. brucei
mtRNAP

A previous survey had indicated that the gene for a single subunit catalytic core
mtRN AP homologous to the bacteriophage T7 was widespread in many eukaryotic
lineages, but was not detected in close relatives of T. brucei (2). Using a modified
degenerate PCR technique, I was able to identify the conserved catalytic subunit in T.
brucei (4). In addition, I found that the TbmtRNAP mRNA is one of several mature
mRN A species that are post-transcriptionally processed from a stable, polycistronic
precursor. This finding that the TbmtRNAP gene is transcribed into two distinct mRN As
subject to differential regulation during the T. brucei life cycle suggests that
mitochondrial differentiation might be achieved in part through the regulated expression

of this gene. Further investigation of the TbmtRNAP protein levels are required to

136

determine the significance of the regulation of the processing and stability of this

transcript.

mtTFB

In addition to identifying the TbmtRNAP, I have also found a homologue to the
dual-function mitochondrial transcription factor mtTFB in T. brucei. Initial attempts
using RNA interference indicate that the TbmtTFB belongs to a growing number of
under-reported genes in T. brucei that appear to be “immune” to RNAi as the presence of
TbmtTF B dsRNA does not result in a decrease of the target TbmtTFB transcript.
Although a final RNAi attempt resulted in a decreased growth rate, the reduction in the
target TbmtTFB mRN A was minimal, and only minor and variable differences were seen
in the steady-state levels of mitochondrial transcripts. Given the inconclusive nature of

these data, we cannot be certain of the precise function of the TbmtTFB.

Evolutionary significance: a potential intermediate?

The conservation of the T7 like mtRNAP in the deeply branching T. brucei linear
supports the supposition that the mtRN AP was recruited early in the course of eukaryotic
evolution (3), as trypanosomes are one of the first organisms to have mitochondria. A
puzzling and significant difference between mtRNAP and T7 RNAP is the requirement of
the mtRNAP for additional factors for mitochondrial transcription initiation. Although,
as with the T7 RNAP, promoter specificity appears to reside within the mtRNAP itself (6,

8), during the course of evolution it has become dependent on other factors to initiate

137

transcription. An interesting question arises from these facts: If the mtRNAP was
acquired early in evolution, when did the requirement for accessory factors arise?
Phylogenetic analyses suggest that the mtTFB groups specifically with Ot-
proteobacterial ngA protein (data not shown), suggesting that this gene originated from
the original endosymbiont. However, database searches indicate that this gene is not
encoded in the genome of even the most eubacterial mitochondrion of the protist
Reclinomonas americana. The mtDNA of R. americana instead still encodes the
subunits for eubacterial RNA polymerase, and retains putative eubacterial promoters.
Presumably, this organism utilizes the eubacterial multi-subunit RNAP to transcribe its
genome, and the T7-like RNAP was recruited for this function sometime after Jakobids
split from the last common ancestor. The absence of an mtTFB homologue in the R.
americana mtDNA suggests that the gene for the ngA may have been transferred to the
nucleus before the recruitment of the T7 RNAP. Given the universality of the
modification performed by ngA and its homologues, including in most mitochondria,
this protein was likely also re-imported into the mitochondrion to methylate the small
subunit rRNA sometime before the recruitment of the ssRNAP. So, it is possible that
there exists intermediate organisms among the early branching eukaryote for which the
mtRNAP behaves like its phage cousins and does not require any accessory factor for
transcription. Kinetoplastids would be an excellent candidate for this intermediate given
their branching order. Consequently, should we determine that the TbmtTFB does not
affect transcription in kDN A, it will be an evolutionarily significant discovery. The
development of the conditional TbmtTFB knockout strain will allow us to determine

whether or not TbmtTF B is a transcription factor like its homologues, which would

138

suggest that its dual function was set very early in eukaryotic evolution, or whether it
evolved the ability to assist the mtRNAP in transcription initiation at a later time.
Neither the protein components nor the potential promoter elements for
mitochondrial transcription in T. brucei were known when I began this project.
Consequently, this work has made a significant contribution to the field of mitochondrial
transcription in T. brucei. Likewise, it has laid the foundation for the development of an
in vitro transcription system which will allow us to learn more about the regulation of
mitochondrial gene expression in trypanosomes. Given the remarkable nature of the
kinetoplast genome and the early divergence of this ancient protist, it would not be
surprising to discover that the transcription apparatus contains unique enzymes and/or
mechanisms of transcription. In particular, we propose that there may be maxicircle or
minicircle specific transcription factors, and/or transcription factors that specifically
regulate gRNA transcription. Additionally, links between transcription and other aspects
of mitochondrial genome expression such as replication and RNA processing have been
described for other organisms. Consequently, a better understanding of the mitochondrial
transcription apparatus will also allow us to examine similar links in T. brucei and may

expand drug targets considerably.

FUTURE WORK
Mapping transcription start sites

On of the objectives of this study has been to find transcription start sites on the
maxicircle genome as these regions are candidates for promoters. Similar to T7 RNAP

promoters, mitochondrial promoter regions lie just upstream of and encompass the

139

transcription start site. Currently, the only transcription start site known on the T. brucei
maxicircle is that for the gRNA gMURF2—H (5). The majority of the genes on the
maxicircle, however, are thought to be transcribed as part of a polycistronic precursor, the
start site for which is unknown. Using a ribonuclease protection assay, Michelotti et al,
demonstrated that an unstable RNA precursor originates within the variable region (VR)
at least ~1200 nt upstream of the mapped 5’ end of the processed 12S rRNA (10). It is
unknown how much farther upstream the precursor may originate as the upstream
portions of the VR had yet to be cloned at the time of this study and were not tested.
Interestingly, given the link between the TbmtRNAP and maxicircle maintenance, an
origin of replication has also been mapped to this region (1). It is known from other
studies that both strands of the VR region are transcribed at low levels (11).

Our lab is currently using the “Differential Display of RNA Ligase Mediated
Rapid Amplification of cDNA Ends” (DDRLACE) technique to determine the start site
of both the major and minor strand precursors. Total RNA is treated, ligated, and reverse
transcribed into cDNA that is then PCR amplified with a gene specific primer and a
ligated-linker specific primer. Amplification products that appear only in the positive
control lanes reflect primary transcripts and will be cloned and sequenced to localize the
start site. Once a putative 5’ end is known, poisoned primer extensions as in Chapter H
will be performed to confirm these ends are the result of transcription initiation. The
regions surrounding these mapped start sites, as well as the region surrounding the

gMURF2-H start site, will then be tested in in vitro studies to define promoter elements.

140

In vitro transcription
Initial recombinant TbmtRNAP expression attempts:

The ability to create an in vitro transcription system is critical to furthering our
understanding of the mechanism of mitochondrial transcription initiation in T. brucei and
the characterization of elements in mitochondrial DNA required for promoter
recognition. Due to its low abundance in cells, in vitro mitochondrial transcription assays
in the literature have depended in part on the use of recombinant mtRNAP (7, 9).
Unfortunately, progress in our lab towards the recombinant expression of the TbmtRNAP
and consequently the in vitro transcription assay has been problematic. The polymerase
is insoluble in a variety of systems including baculovirus mediated expression in insect
cells (data not shown). Although a significant amount of time was invested into
optimizing the expression system, including attempts at co-expression with the putative
mtTFB homologue, soluble protein was never obtained. Given this difficulty, at this
point it would be prudent to develop an assay with partially purified mitochondrial
extracts from T. brucei. This assay would take advantage of the gRNA transcription start
sites identified in Chapter H and the surrounding kDNA sequence to define the precise

nucleotide sequence requirements for transcription initiation.

Function of the TbmtTFB

Much to the dismay of researchers in the molecular parasitology community,
trypanosomes are adept at surmounting negative selection pressures. This makes them
very successful organisms, but often difficult to manipulate. It is clear that the only

definitive answer as to the function of the TbmtTFB homologue in T. brucei mitochondria

141

will come as a result of either biochemical characterization of this protein or through
analysis of double knockouts. The failure to obtain double knockouts so far perhaps
suggests that TbmtTFB is an essential gene, or at least that those cells lacking the gene
grow too slowly and are out-competed by those still retaining a copy during the selection
process. Unfortunately, however, this does nothing to clarify its role. Cloning of T.
brucei cells is difficult as a result of density dependent growth, but our lab has recently
improved the survival rate dramatically and experiments are currently underway to

detemiine whether true conditional knockouts have been obtained.

142

10.

11.

LITERATURE CITED

Carpenter, L. R., and P. T. Englund. 1995. Kinetoplast maxicircle DNA
replication in Crithidia fasciculata and Trypanosoma brucei. Mol Cell Biol
15:6794-803.

Cermakian, N., T. M. Ikeda, R. Cedergren, and M. W. Gray. 1996. Sequences
homologous to yeast mitochondrial and bacteriophage T3 and T7 RNA

polymerases are widespread throughout the eukaryotic lineage. Nucleic Acids Res
24:648-54.

Cermakian, N., T. M. Ikeda, P. Miramontes, B. F. Lang, M. W. Gray, and R.
Cedergren. 1997. On the evolution of the single-subunit RNA polymerases. J
Mol Evol 45:671-81.

Clement, S. L., and D. J. Koslowsky. 2001. Unusual organization of a
developmentally regulated mitochondrial RNA polymerase (TBMTRNAP) gene
in Trypanosoma brucei. Gene 272:209-18.

Clement, S. L., M. K. Mingler, and D. J. Koslowsky. 2004. An intragenic guide
RNA location suggests a complex mechanism for mitochondrial gene expression
in Trypanosoma brucei. Eukaryot Cell 3:862-9.

Gaspari, M., M. Falkenberg, N. G. Larsson, and C. M. Gustafsson. 2004. The
mitochondrial RNA polymerase contributes critically to promoter specificity in
mammalian cells. Embo J.

Mangus, D. A., and J. A. Jaehning. 1996. Transcription in vitro with

Saccharomyces cerevisiae mitochondrial RNA-polymerase. Methods Enzymol
264:57-66.

Matsunaga, M., and J. A. Jaehning. 2004. Intrinsic promoter recognition by a
"core" RNA polymerase. J Biol Chem 279:44239-42.

Matsunaga, M., S. H. Jang, and J. A. Jaehning. 2004. Expression and
purification of wild type and mutant forms of the yeast mitochondrial core RNA
polymerase, Rpo41. Protein Expr Purif 35: 126-30.

Michelotti, E. F., M. E. Harris, B. Adler, A. F. Torri, and S. L. Hajduk. 1992.
Trypanosoma brucei mitochondrial ribosomal RNA synthesis, processing and
developmentally regulated expression. Mol Biochem Parasitol 54:31-41.

Myler, P. J ., D. Glick, J. E. Feagin, T. H. Morales, and K. D. Stuart. 1993.
Structural organization of the maxicircle variable region of Trypanosoma brucei:

identification of potential replication origins and topoisomerase H binding sites.
Nucleic Acids Res 21:687-94.

143

12. Pollard, V. W., S. P. Rohrer, E. F. Michelotti, K. Hancock, and S. L. Hajduk.
1990. Organization of minicircle genes for guide RNAS in Trypanosoma brucei.
Cell 63:783-90.

144