 

. . r. gm”. (vi.
.4 $1.”: 42% W.% t... ﬁn.”
~ I

r . .
2:... w 5..
Au. . 7 .35 . . .
. 1i. i : Cm“,

A r: .
53.43....
. n
(mnrﬁv‘tiaa

. . .27.th

. 9! A . i
a , a
‘3 w? a 3 7’1"}. ..
.61 ~ . .53.! ﬁrm“-
. . ..u;,.{..ﬁa¢
.3.
6.

if!!! “.35. P

. «502,405.24. It?“

Amwrﬁwnﬁiramu .2 . .
ham... ﬂusﬂmwﬂki . 1...»...

9...... i... .ta...w .3. .
insnﬂ .idmﬂmnm.

 

has:

3%

2- Mm.

_
6.
a

.1...

.

.

94.3.. .9}: a
MA

2
$8.”? 2 .

.. . 3-
ﬁéﬁmﬁzxﬁm
» E

 

 

 

 

 

 

 

 

 

 

 

54!!" It; .
19 is; 349.5,}..713

4. .1.
A3. .5

12. t){ '3.
{.3 2.1.”... .‘
x ( er-

a

 

3.431%?!-

....5. .

2m. , 3.....-«9».
. a: .1 .

 

Ln: .

.. LIBRARIES

’3 MICHIGAN STATE UNIVERSITY
d 0 05. EAST LANSING, MICH 48824-1048
6‘ ' l

Biff/$3

This is to certify that the
dissertation entitled

ROLES OF PULMONARY ANGIOTENSIN SYSTEM IN THE
DEVELOPMENT OF PULMONARY FIBROSIS

presented by
XIAOPENG LI

has been accepted towards fulﬁllment
of the requirements for the

 

 

 

 

Ph. D. degree in Physiologi
Major Professor's Signature
lz { I; '[o 1—
Date

MSU is an Afﬁrmative Action/Equal Opponunity Institution

PLACE IN RE‘lURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

3%? 31‘ 2.011
v _ 1 I,

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 cEiﬁC/DatoDueIndd-pJS

ROL

ROLES OF PULMONARY ANGIOTENSIN SYSTEM IN THE
DEVELOPMENT OF PULMONARY FIBROSIS

By

Xiaopeng Li

A DISSERTATION

Submitted to
Michigan State University
in partial fulﬁllment of the requirements
for the degree of

DOCTOR OF PI-HLOSOPHY
Department of Physiology

2004

ROLES OF

Treatment ft
suggesting tl
llortallt} ot‘l
Nth the pres
aheolar epit'r
ﬁbrosis can b
The l0:
amptosis “a
liltllt‘allon lhd
of anglOlL’nsl
mO-dels. Our
AEC S tthgl“
Ligm N-
amitosis can
3F;"S‘Hl'tillerbq'nogL

ll recepmr l:\'

Sh» _
Uﬁeqtlem 1W1;-

ABSTRACT

ROLES OF PULMONARY ANGIOTENSIN SYSTEM IN THE DEVELOPMENT OF
PULMONARY FIBROSIS

By
Xiaopeng Li

Treatment for IPF targeting the suppression of inﬂammation has not been successful,
suggesting that inﬂammation is not the sole mechanism underlying lung ﬁbrogenesis.
Mortality of IPF patients is not dependent on severity of inﬂammation, but correlates well
with the presence of “ﬁbroblastic foci” and adjacent failure of reepithelization. Loss of
alveolar epithelial cells (AECS) and failure of reepithelization characterized in pulmonary
ﬁbrosis can be considered as proﬁbrotic and are believed to initiate the ﬁbrotic lesion.

The loss of AECS could result from necrosis and/ or apoptosis. Increased level of
apoptosis was found in AECS in experimental and human pulmonary ﬁbrosis. One
indication that the angiotensin system is involved in ﬁbrogenesis is ﬁndings that blockade
of angiotensin systems blocked Pulmonary Fibrosis (PF) at least in several animal
models. Our lab showed that angiotensin II (ANG II) induces apoptosis of the primary
AECS through ANG 11 type I (AT1) receptor in vitro. Apoptosis of AECS induced by F as
Ligand, TNF-alpha, and amiodarone requires angiotensin synthesis de novo as AECS
apoptosis can be blocked by the antisense oligonucleotide against the mRNA of the
angiotensinogen (ANGEN), angiotensin converting enzyme (ACE) inhibitors, and ANG
II receptor (AT receptor) antagonists in vitro. Taken together, those data suggest that
ANG II, the processed product of ANGEN, is the key to regulate apoptosis of AECS and

subsequent lung ﬁbrosis.

lite existent
endocrine K45~
sistem compo“C
and amiodamne
and mouse pulmi
Bmuch still unki
in bleemuin-intl‘
l
to determine the
pulmonan‘ libmsi
including its con
essential role in tl
through ANG 11-.
that: llAEC apo
tritibiled b)‘ ANG
to blenmycin at It
Gillie ATl-Selet'l
BLED-induced .-\
epithelial cell: and
liltilo; 5’ Admin

beemcin-induwd

The existence of “local angiotensin system” in the lung, which is independent of the
endocrine RAS, is supported by studies demonstrating the expression of angiotensin
system components in cultured primary rat AECS in response to Fas Ligand, TNF—alpha,
and amiodarone and myoﬁbroblasts from human ﬁbrotic lungs. Bleomycin-induced rat
and mouse pulmonary ﬁbrosis model is a well-studied model for ﬁbrogenesis. But there
is much still unknown about the components and roles of pulmonary angiotensin system
in bleomycin-induced pulmonary ﬁbrosis. The overall objective of my thesis project was
to determine the roles of pulmonary angiotensisn system in the development of
pulmonary ﬁbrosis. We tested the overall hypothesis: the pulmonary angiotensin system
including its components angiotensinogen, cathepsin D and AT1 receptor, plays an
essential role in the development of bleomycin-induced pulmonary ﬁbrosis at least in part
through ANG II-ATl receptor pathway mediated apoptosis of AECS. Our data showed
that: 1) ABC apoptosis in response to bleomycin (BLEO) requires ANG synthesis and is
inhibited by ANG system antagonists; 2) Cat D is required for ABC apoptosis in response
to bleomycin at least in part by converting angiotensinogen to ANGI; 3) Administration
of the ATl-selective receptor antagonist and deletion of the ATla receptor gene block
BLED-induced AEC apoptosis and lung ﬁbrosis; 4) The apoptotic type II alveolar
epithelial cells and myoﬁbroblasts are the major cellular sources of lung-derived ANGEN
in vivo; 5) Administration of the antisense against ANGEN messenger RNA attenuates

bleomycin-induced AEC apoptosis and lung ﬁbrosis.

7’0”}:

‘To my level) mﬁﬂlﬁn Luo, you malig tﬁis possiliﬂa.

To my parents, Han-Tu Li and'QBao-‘Yu Clien, for your uttermost lime and support

iv

 

This dissertatit

assistance ofrr

First. I “ant to
Ural. I thank I:
[lit past four )i
as how to \triti

cntics. hon to r

1 next tub-h u.
C0mmittee: DB
[hank .VOU Of a]
Particular”. l \\
“hen l “as rotnt
mm] for all t
grammar and SPC
I “Out

Id “1‘6 10 ti

~
I

Acknowledgments

This dissertation project was the outcome of my hard work and the input, advice, and the

assistance of many other people.

First, I want to express my gratitude, respect and admiration for my mentor, Dr. Bruce D.
Uhal. I thank Dr. Uhal for his support, understanding and his patient training of me over
the past four years. He trained me from every aspect to be an independent scientist such
as how to write a proposal, how to design an experiment, how to response to scientiﬁc

critics, how to review other scientists’ work and so on.

I next wish to thank and acknowledge the members of my dissertation guidance
committee: Drs. Greg Fink, David Kreulen, Stephanie Watts and Douglas Luckie. I
thank you of all for your precious advice and endorsement for my dissertation project.
Particularly, I would like to thank Dr. Kreulen for giving me the initial scientiﬁc training
when I was rotating in his lab where I started my scientiﬁc life. In addition I am deeply
grateful for all of you for your critical reading this dissertation and correction of the

grammar and spelling mistakes, especially Drs. Watts, Luckie, Kreulen.

I would like to thank the Department of Physiology for recruiting me and providing me
the excellent academic and extracurricular trainings. I also thank the American Heart
Association Midwestern Afﬁliate for awarding me a pre-doctoral fellowship (2004). I
would like to acknowledge Dr. Uhal as my sponsor and Drs. Fink, Kreulen, Spielman for

writing recommendation letters for the fellowship application.

 

Then. I thank

for part of m}
helped me alt
Zhuang. Dr. l

Conrad.

I also would

BoeSen. I am:
living in this e:
Finally l “on
tmpossible for

their uttermmt

Then, I thank Dr. Jump and Dr. Olson’s lab for letting me use their space and equipments
for part of my experiments. In addition, I would to thank all those individuals who have
helped me along the way. They are my colleagues in Dr. Uhal lab including Dr. Jiaju
Zhuang, Dr. Huiying Zhang, Ruijie Shu, Jong-kyong Kim, Heather Rayford, Valerie

Conrad.

I also would like to thank my American Friendship family: Hank Hanson and Chris
Boesen. I appreciate their friendship, support and endeavors to enrich my experience of

living in this country for the past years.

Finally I would like to acknowledge my wife Min Luo: without you, it would be

impossible for me to achieve this goal, and my parents Han-F u Li and Bao-Yu Chen for

their uttermost love and support.

vi

 

LIST OF F
LIST OF A
CHAPT ER

1. ldior

1.1 E

TABLE OF CONTENTS

LIST OF FIGURES .............................................................................. viii
LIST OF ABBREVIATIONS ................................................................. xxiii
CHAPTER 1: GENERAL INTRODUCTION ................................................. l
1. Idiopathic pulmonary fibrosis ........................................................... l

1.1 Epidemiology of IPF .................................................................... 1

1.2 Predisposing factors for IPF ............................................................ 1

1.2.1 Geneticfactors...... 2

1.2.2 Environmentalfactors... ......3

1.3 Clinical features ........................................................................ 4
1.4 Histopathology .......................................................................... 6
1.5 Therapeutic options for pulmonary ﬁbrosis ......................................... 7
2. Bleomycin-Induced Experimental Pulmonary Fibrosis Model ................... 8
3. Mechanisms of Fibrogenesis ............................................................ 10
3.1 The roles of alveolar epithelial cells (AECS) ....................................... 11
3.2 Consequence of alveolar epithelial cells damage/injury .......................... 13

3.2.1 Loss ofpermeability barrier... ...13
3.2.2 Loss of the barrier limiting ﬁbroblast migration into the alveolar

a1rspace13
3. 2.3 Loss of cell surface that prevents collapse and fusion of alveolar walls] 4
3.2.4SurfactantAlterations.................................................................14
3.2.5 Loss ofthe Alveolar Progenitor Cells... ....15

3.2.6 Loss ofActive Transport Properties... 16

vii

3. 2. 7Loss of the ability to clear intra-alveolar ﬁbrin and regulate the
plasminogenactivationsystem...................................................17

3.2.8 Abnormal AECs as a primary source of proﬁbrotic cytokines... 19

4. Apoptosis of AECs is involved in pulmonary fibrogenesis ..................... 19
4.1 General information about apoptosis .............................................. 19
4.2 Epithelial cell apoptosis in ﬁbrotic lungs .......................................... 20
4.3 Mechanism and signaling of epithelial apoptosis in ﬁbrotic lung ............. 23

5. Renin-Angiotensin System ............................................................. 24
5.1 General information .................................................................. 24
5.2 Effects of Angiotensin II ............................................................ 25
5.3 Angiotensin 11 signal pathway ...................................................... 25

6. Pulmonary angiotensin system in idiopathic pulmonary ﬁbrosis ............... 27
6.1 Local pulmonary angiotensin system ............................................... 27
6.2 Pulmonary angiotensin system components ....................................... 28

6.2.2 Renin and Renin- like enzymes... ......29
6.2.3 ACE andACE-like enzymes... ...29
6.2.4Angiotensin IIreceptors...... ........30
6.3 Potential roles of pulmonary ANG II in pulmonary ﬁbrosis ..................... 31
6. 3. 1 Pulmonary angiotensin system is linked to lung epithelial apoptosis....31
6.3.2 Mytogenic for ﬁbroblasts and Activate TGF beta expression... 31
6.3.3 Inhibition oftheﬁbrinolyticpathway... ...32

6. 3. 4 Downregulation of hepatocyte growth factor (HGF) expression ......... 32

viii

 

6.4 At

6.1

7- “iorkir

8. Signiﬁc

CHAPTER 2

CHAPTER 3:

EPITHEUAI

Abstracz.
IntrodUm
Mclhﬁldg
Results. ..

6.4 Angiotensin system is involved in pulmonary ﬁbrosis ........................... 33

6.4.1. Increased levels of converting enzymes and A T1 receptors in IPF ...... 33
6. 4. 2. Blockade of experimental lung ﬁbrosis by angiotensin system ............ 34
antagonists

6.4.3. Blockade of apoptosis by ACE inhibitors or caspases inhibitors blocks

pulmonaryﬁbrosis... ...35

7. Working hypothesis ........................................................................ 36
8. Significance .................................................................................. 37
CHAPTER 2: HY POTHESES AND SPECIFIC AIMS .................................. 38

CHAPTER 3: BLEOMYCIN-INDUCED APOPTOSIS OF ALVEOLAR

EPITHELIAL CELLS REQUIRES ANGIOTENSIN SYNTHESIS DE NOV0.....41

Abstract ....................................................................................... 42
Introduction .................................................................................... 43
Methods ........................................................................................ 45
Results ......................................................................................... 50
Discussion ..................................................................................... 61

CHAPTER 4: ESSENTIAL ROLE FOR CATHEPSIN D IN BLEOMYCIN-

INDUCED APOPTOSIS OF ALVEOLAR EPITHELIAL CELLS .................... 65
Abstract. ..................................................................................... 66
Introduction .................................................................................. 68

ix

MCIhO
RCSUII:

Discus

CHAPTER 1

BLEOMYCI

Abstract

lntroduc

 

Methodt
Results. _

Disc U551}

CHXPTER 6:
FIBROSIS m

Absmq .
IHIIOdUCIlk
Methods. ..
Reguhs‘ . . .
DiSCUSSlrm.

CHAPTER 7: (

J

Methods ....................................................................................... 7 1
Results ......................................................................................... 75

Discussion .................................................................................... 86

CHAPTER 5: ESSENTIAL ROLES FOR ANGIOTENSIN RECEPTOR ATla in

BLEOMYCIN-INDUCED APOPTOSIS AND LUNG F IBROSIS IN MICE ........ 91

Abstract ........................................................................................ 92
Introduction .................................................................................... 93
Methods ........................................................................................ 95
Results ........................................................................................ 100
Discussion ................................................................................... 11 1

CHAPTER 6: ATTENUATION OF BLEOMYCIN-INDUCED PULMONARY

FIBROSIS BY INTRATRACHEAL ADMINISTRATION OF ANTISENSE

OLIGO-NUCLEOTIDES AGAINST ANGIOTENSINOGEN mRN A ............... 116
Abstract. ..................................................................................... 117
Introduction .................................................................................. 1 19
Methods ....................................................................................... 122
Results ........................................................................................ 129
Discussion .................................................................................... 147

CHAPTER 7: GENERAL DISCUSSION AND CONCLUSIONS ..................... 152

 

Lun

At
1.4 A]

1.5 P0

1. Angiotensin Receptor ATl mediates Bleomycin-Induced Apoptosis and
Lung Fibrosis ........................................................................... 152

1.1 An Essential Role by Angiotensin Receptor ATl in Bleomycin-Induced
Apoptosis in Alveolar Epithelial Cells (AECs): ................................ 152

1.2 An Essential Role of Angiotensin Receptor AT] in Bleomycin—induced
Apoptosis and Fibrosis in Lung Explants: ........................................ 153

1.3 In vivo Inhibition of Apoptosis and Collagen Deposition by an ATI

Antagonist and AT] Gene Deletion: .............................................. 154

1.4 AT1 receptor blockade block ﬁbrosis via suppression of apoptosis ........... 155

1.5 Potential intracellular mechanisms underlying ATI mediated apoptosis. 157

2. Essential role for cathepsin D in bleomycin-induced apoptosis of alveolar
epithelial cells ............................................................................ 158
2.1 CatD activity is upregulated in AECs apoptosis response to bleomycin and in

ﬁbrotic lungs: ......................................................................... 159
2.2 Bleomycin-induced apoptosis of AECs is reduced by blockade of CatD
activity or synthesis: ................................................................ 160
2.3 CatD is involved in conversion of angiotensinogen to ANG 1 during

bleomycin —induced AECs apoptosis .............................................. 161

3. Essential Roles for Angiotensinogen in Bleomycin-Induced Apoptosis and

Lung Fibrosis .......................................................................... 163

xi

 

4- Ihﬂes
induced Puln

5- Rate-Ii n

5-1 Rer

6- Therapeu.
6l EXIS
6-3 AT]

anti 1‘;

6.3 pm“

anllSc:
6.3. /

6.3g)

ex

3.1 Essential Roles for Angiotensinogen in Bleomycin-Induced Apoptosis in
Alveolar Epithelial Cells: ............................................................ 163

3.2 Essential Roles for Angiotensinogen in Bleomycin-Induced Apoptosis and
Lung Fibrosis in explants: ......................................................... 165

3.3 Essential Roles for Angiotensinogen in Bleomycin-lnduced Apoptosis and

Lung Fibrosis in vivo: .............................................................. 166

4. Roles of Pulmonary Angiotensin System in Development of Bleomycin-

induced Pulmonary Fibrosis ................................................................... 167

5. Rate-limiting step of pulmonary angiotensin II generation in bleomycin—

induced pulmonary ﬁbrosis ............................................................. 168
5.1 Renin and/or Cat D .................................................................. 168

5.2 ACE .................................................................................... 169

5.3 AN GEN and angiotensin peptides ................................................. 170

6. Therapeutic Implications ................................................................. 173
6.1 Existing clinical trials ............................................................... 173

6.2 ATl antagonist may be more efﬁcient than ACE inhibitor in term of
antiﬁbrotic effect in vivo ............................................................ 176

6.3 Potential therapeutic approaches for IPF: Local administration of ANGEN
antisense or AT] antagonist for IPF ............................................... 177
6.3.1 Local administration does not disturb the systemic angiotensin system.
6. 3.2 Local administration is a more effective approach with fewer side

effects... ....178

xii

 

7. General

 

I
REFERENCI

 

 

7. General Conclusions ........................................................................ 178

REFERENCE ..................................................................................... 179

xiii

 

Figural]

 

Figure 3.1: D:

, |

CU.

“<73

MCI
“it?
and

label

 

 

 

C01 0"

(Elfin

LIST OF FIGURES

Figure 1.1 .............................................................................................. 36

Figure 3.1: Detection of apoptosis in primary AECs and A549 cells. A, B and C: Primary
cultures of AECs were exposed to vehicle (A) or BLEO (B and C) at
25mU/m1 for 20hr and were then ﬁxed in 70% ethanol without washing (see
Methods). Cells exhibiting chromatin condensation and nuclear fragmentation
with propidium iodide (arrowheads, B) were scored as described earlier (27
and Methods). C: BLED-exposed cells were ﬁxed and prepared for in situ end
labeling (ISEL, left) or TUNEL (right) of fragmented DNA (25); note
colocalization of label (blue or brown, respectively) in nuclear fragments
(arrowheads) identiﬁed by propidium in B. D, E and F: A549 cells exposed to
vehicle (D) or BLEO at 25mU/m1 (E) or IOOmU/ml (F) for 20hrs were ﬁxed
and prepared for immunolabeling for the active form of Caspase 3 (see
Methods). Note labeling of active Caspase 3 (purple) in cells with either
normal morphology (arrowheads, E) or in cells with condensed cytoplasm and
nucleus (arrows, E and F). Note also reduced total cell number with increasing

BLEO doses (E and F) ................................................................ 52

Figure 3.2: Dose-dependent induction of nuclear fragmentation by bleomycin (BLEO) in
primary rat AECs and blockade by inhibitors of caspases, endonucleases,
ANG converting enzyme (ACE) and ANG-receptor interaction. Rat AECs
were isolated and challenged with the indicated concentrations of BLEO on

Day 2 of primary culture (see Methods). Putative inhibitors were added 30

xiv

 

 

 

 

“it

llii

lo.-

.\1

Ct

in

11:

Se

minutes prior to addition of BLEO; nuclear fragmentation was scored as
described in Fig.1B and Methods. ZVAD = ZVAD-fmk (N-benzylcarboxy-
Val-Ala-Asp-[O-Me]—CH2F, 60uM); ATA = aurintn'carboxylic acid IOuM);
CAPTO = captopril (SOOng/ml); SARAL = saralasin (50ug/ml). Bars are the
mean j; S.E.M. of at least 4 observations; * = p<0.05 versus control (0.0

BLEO) ................................................................................... 54

Figure 3.3: Blockade of bleomycin-induced apoptosis in primary AECs by selective
caspase or ANG receptor blockers. Rat AECs were isolated and challenged
with 25mU/ml BLEO alone or in the presence of the Caspase 3-selective
inhibitor DEVD-fmk (60uM) or the ANG receptor ATl-selective antagonist
losartan (LOS, 10'6M). Control cultures (CTL) received BLEO and blocker
vehicles only. Nuclear fragmentation was scored as described in Fig.1 and
Methods. Bars are the mean i S.E.M. of at least 4 observations; * = p<0.05

versus control ........................................................................... 55

Figure 3.4: Inhibition of bleomycin-induced apoptosis of A549 cells by inhibitors of
caspases or ANGII-receptor interaction. A549 cells were cultured to 8%
conﬂuence as described in Methods and were challenged with 25mU/ml BLEO
in the presence or absence of the indicated compounds. Anti-ANGII =
neutralizing antibody to ANGII (lug/m1); N.S.IgG = isotype matched
nonimmune immunoglobulin (lug/m1); L158809 = ANG receptor ATl-

selective antagonist (10'6 M); PD123319 = ANG receptor AT2-selective

XV

 

 

.
Ff
.

am.

on

ant

W

Elite 3.6: Sci

SQ

antagonist (1045M). Other abbreviations and concentrations are the same as in
Figs. 2 and 3. Nuclear fragmentation was scored as described in Fig.1 and
Methods. Bars are the mean : S.E.M. of at least 4 observations; * = p<0.05

versus control (0 dose) .................................................................. 56

Figure 3.5: Induction of caspase 3 activity by bleomycin and inhibition by an ANG
receptor antagonist. A549 cells were challenged with BLEO (25mU/m1) for
20 hours in the presence and absence of the nonselective ANG receptor
antagonist saralasin (SARAL, 50ug/ml). Assay of Caspase 3 was conducted
on adherent cells as described in Methods. * = p<0.05 versus control (CTL)

and ** = p<0.05 versus BLEO ....................................................... 57

Figure 3.6: Semiquantitative RTPCR of angiotensinogen (ANGEN) mRNA in AECs after
bleomycin exposure. Primary cultures of rat AECs (A) and A549 cells (B) were
exposed to BLEO (25mU/ml) for the indicated times and total RNA was
isolated. RTPCR was performed as described before with primers speciﬁc for
rat or human angiotensinogen (ANGEN), B-microglobulin (B-MG) or B-actin as

control mRNAs ......................................................... 58

Figure 3.7: Blockade of bleomycin induced apoptosis and net cell loss in AECs and A549
cells by antisense oligonucleotides against angiotensinogen mRNA. Primary
rat AECs (A) or A549 cells (B) were transfected for 4 hours with antisense or

scrambled sequence (scram) oligonucleotides as described earlier (see

xvi

 

 

Figure 4.1:

 

 

 

ﬂ L10

Mei

an}.

E9“ 4.2.

Cu

(1!

Figure 4.1:

Methods). Cells were challenged with bleomycin (BLE, 25mU/ml) for 20
hours immediately thereafter, and apoptosis (upper panel) was scored as
detailed in Figs.1-3; net cell loss (bottom panel of B) was measured as
detailed in Methods. lipo = lipofectamine; see Methods for details. Bars are
the mean 1: S.E.M. of at least 4 observations; * = p<0.05 and ** = p<0.01

versus corresponding control (CTL) ................................................ 59

Cleavage of a ﬂuorogenic substrate for Cathepsin D (CatD) is dependent on
time and protein concentration. Lysates of primary alveolar epithelial cells
(AECs) were incubated with the ﬂuorogenic substrate MOCAc-Gly-Lys-Pro-
Ile-Leu-Phe-Phe-Arg—Leu-Lys (an)-D-Arg-NH2, and generation of
ﬂuorescent product was monitored continuously over 30 minutes (see
Methods for details). Note linearity of product formation with time and

amount of ABC lysate ................................................................. 78

Figure 4.2. Bleomycin upregulates CatD activity and release from AECs. Primary

cultures of rat alveolar epithelial cells (AECs) were exposed to bleomycin
(BLEO) for 20 hours at a concentration known to induce AEC apoptosis
(25mU/m1). CatD activity was measured in cell lysates as described in Figure
1, in the presence or absence of the aspartyl protease inhibitor pepstatin A
(pepA). Inset: CatD activity was measured in concentrated cell culture

medium collected from BLEO-treated (BL) and untreated (C) cells studied in

xvii

C0

Figure 4.3. l«

 

 

 

 

plt‘.

 

 

Figure 4.4. Bl

cult.
(Bl

Imt

panel A. Bars are the mean :t S.E.M. of n = 6; * = p<0.01 versus untreated

control (CTL) by AN OVA and Student-Newman-Keul’s test .................. 79

Figure 4.3. Bleomycin does not alter steady-state levels of CatD mRNA. A: PCR
products from two different primer sets (1 and 2, see Methods) used to
amplify CatD mRNA by RTPCR; starting material was total RNA isolated
from primary rat AECs exposed to BLEO or vehicle for the indicated times.
B: Realtime RTPCR of CatD mRNA (primer set 2) at the indicated times after
exposure to BLEO (see Methods). B-MG = B-microglobulin; bars are the

mean+S.E.M. of three separate AEC cultures ...................................... 80

Figure 4.4. Bleomycin increases the release of immunoreactive CatD protein from
cultured AECs. Primary cultures of AECs were exposed to bleomycin
(BLEO) as in Figure 2; detergent lysates were harvested from the cells
(monolayer), and the cell culture medium was collected and concentrated.
Equal amounts of lysate protein (10ug/lane) or volume of culture medium
(equivalent to 105 cells) were subjected to western blotting with Cat-D-
speciﬁc antibodies (see Methods). Note increases in immunoreactive proteins
of apparent MW~ 52, 48 and 44kda1 (arrowheads) in medium from BLEO-

treated AECs ............................................................................ 81

Figure 4.5. Pepstatin A inhibits bleomycin-induced apoptosis of AECs in vitro. Primary

cultures of rat AECs were exposed to BLEO in the presence or absence of

xviii

 

m.
30.
of

b)

Figure 4.6.
blc.

SUI:

Flﬂur ,
i “'7' Pmdu.

A: Ali:

 

With”:-

the re.

L...

pepstatin A (pepA) at 100uM. Apoptosis was quantitated by scoring of
nuclear fragmentation with propidium iodide (panel A) or by the enzymatic
activity of Caspase 3 (B). See Methods for details. Bars are the mean + S.E.M.
of n = 6; * = p<0.01 versus untreated control and ** = p<0.05 versus BLEO

by ANOVA and Student-Newman-Keul’s test ................... 82

Figure 4.6. Antisense oligonucleotides reduce CatD immunoreactivity and inhibit

Figure 4.7.

bleomycin-induced apoptosis of AECs in vitro. A: Antisense (AS) or
scrambled-sequence oligonucleotides (SCR) were transfected into primary
cultures of rat AECs in the presence of lipofectin (LIPO, see Methods),
without challenge with bleomycin (CTL). Western blotting of concentrated
cell culture media was performed with CatD—speciﬁc antibodies; note
decrease in immunoreactive CatD by AS but not SCR oligonucleotides. B:
After antisense oligonucleotide transfection as in panel A, AECs were
challenged with BLEO (25mU/m1) and harvested for detection of fragmented
nuclei as in Figure 5. Bars are the mean + S.E.M. of n = 3; * = p<0.01 versus
untreated control (CTL) and ** = p<0.05 versus BLEO by ANOVA and

Student-Newman-Keul’s test ......................................................... 83

Production of ANGII from angiotensinogen fragment 1-14 in vitro.
A: Angiotensinogen fragment 1-14 (F 1-14, SuM) was incubated in vitro
(without cells) with the indicated puriﬁed enzymes; ANGII was measured in

the reaction buffer by speciﬁc ELISA (see Methods for details). Note

xix

Figure 4.8.

Figure 5.1.

production of ANGII by the combination of puriﬁed CatD + puriﬁed
angiotensin converting enzyme (ACE), but not by either enzyme alone. B:
Primary cultures of AECs were exposed to 5uM F1-14, and ANGII was
measured in the serum-free cell culture medium; note production of ANGII by

AECs challenged with F1-14, but not by untreated AECs ....................... 84

CatD-dependent induction of ABC apoptosis by angiotensinogen fragment 1-
14. Primary cultures of ABC were incubated with F 1-14 as in Figure 7, in the
presence or absence of pepstatin A (pepA, luM); CatD-speciﬁc neutralizing
antibodies (CatD AB, 1:100) and the ANG receptor antagonists saralasin
(SARAL, 50ug/ml) or L158809 (10'6 M). See Methods for details. Bars are
the mean + S.E.M. of n = 3; * = p<0.001 versus untreated control (CTL) and

** = p<0.001 versus F 1-14 by ANOVA and Student-Newman-Keul’s test...85

Detection of DNA fragmentation, activation of caspase 3, and alveolar type II
pneumocytes in mouse lung. Deparafﬁnized lung sections were prepared from
mice instilled intratracheally 14 days earlier with sterile saline (A, C, and E)
or BLEO (B, D, F, and G). The sections were subjectedto ISEL of fragmented
DNA (A and B) or IHC with antibodies against the active form of caspase 3
(E—H) or with the type II cell-speciﬁc antibody MNF116 (C and D). G:
Higher magniﬁcation of active caspase 3 labeling. in F. H: Active caspase 3
labeling in mice treated with BLEO and LOS, an AT1 receptor antagonist.

Note ISEL and active caspase 3 labeling in cells in the comers of alveolar

XX

 

\\

,\1
all

of

Figure 5.3. l-li.~.
Her.
14 if
IEXI -.

X20

 

 

Figure 5.2.

Figure 5.3.

walls in the lungs of BLEO-treated mice (B, F, and G, arrowheads) but not
in saline-treated mice (A and E) or in mice treated with BLEO and LOS (H).
Note also the co-localization of MNF 1 16 (C) with

anti-caspase 3 IHC (G) or ISEL (B) in BLEO-treated lungs. D reveals labeling
of the type 11 cell marker MNF116 in relatively normal regions of
BLEOtreated lung (D, right) but not in more severely affected regions (D,
left). See text for details. Original magniﬁcations: X400 (A, B, C, G); X200

(1)); x100 (E, F, H) .................................................................. 103

Histology of mouse lungs at 14 days after instillation of BLEO. A—C:
Hematoxylin and eosin preparations of mouse lung instilled intratracheally

14 days earlier with sterile saline (A), BLEO (B), or BLEO and LOS (C). See
text and Materials and Methods section for details. Original magniﬁcations,

X200 .................................................................................. 105

The ATl-selective receptor antagonist LOS inhibits BLEO-induced
activation of caspase 3. A: BLEO was instilled intratracheally into normal
mice with and without LOS in the intratracheal instillate (see Materials and
Methods). Six hours later, the lungs were perfused to remove blood, excised,
and the enzymatic activity of caspase 3 was measured in lung homogenates.
B: Lung explants were prepared from normal mouse lung tissue perfused
before excision (see Materials and Methods). BLEO (25 mU/ml) was

applied in serum-free culture medium for 24 hours in the presence or

xxi

 

\‘E

Figure 5.4. A
act

mi

abs

intr

MIN

“'35

the 1

Very

F1gills-5.5.AT1
days
PTL‘sQ
tOIal l

hbikl m

absence of LOS (10_6 mol/L). Bars are the means i SEM of n = 6; *, P <
0.05 versus control (CTL); ** , P < 0.05 versus BLEOiLOS by analysis of

variance and Student-Newman-Keul’s test .................................... 106

Figure 5.4. AT1 receptor blockade inhibits DNA fragmentation and caspase 3
activation in lung epithelial cells 14 days after BLEO instillation. Normal
mice were given a single intratracheal instillation of BLEO in the presence or
absence of LOS in the instillate. LOS also was administered thereafter daily
intraperitoneally. Fourteen days later, lung sections were prepared and
labeled by ISEL (A) or by IHC for the active form of caspase 3 (B). Labeling
was quantitated in cells within the alveolar surfaces (see Figure 1C). Bars are
the means i SEM of n = 6; *, P < 0.01 versus control (CTL); **, P < 0.05

versus BLEO by analysis of variance and Student-Newman-Keul’s test. . . .. 107

Figure 5.5. AT1 receptor blockade inhibits lung collagen accmnulation at 14
days after BLEO instillation. Normal mice were administered BLEO in the
presence or absence of LOS as described in Figure 3. Fourteen days later,
total lung collagen was determined by assay of total hydroxyproline (HP) in
hydrolyzed lung tissue (see Materials and Methods). Bars are the means :t
SEM of n = 6; *, P < 0.05 versus control (CTL) by analysis of variance and

Student-Newman-Keul’s test ....................................................... 108

Figure 5.6. Mice deﬁcient in angiotensin receptor ATla exhibit reduced DNA

fragmentation and caspase 3 activation in lung epithelial cells 14 days after

xxii

 

 

\ti.

XL“

Figure 5.7. M:

 

8C0.
heir
intru
h} (In
descr
0f the
31110111
yer-ills

Keulig

 

 

BLEO instillation. Normal [wild type (w.t.)] or heterozygous ATla knockout
mice (+/-) were administered BLEO intratracheally as in Figure 3. Fourteen
days later, lung sections were prepared and labeled by ISEL (A) or by IHC for
the active form of caspase 3 (B), which were quantitated as described in
Figure 4 and Materials and Methods. Bars are the means :1: SEM of n = 5; *, P
< 0.001 versus wild-type unchallenged (w.t. - BLEO); **, P < 0.01 versus
wild-type challenged (w.t. + BLEO) by analysis of variance and Student-

Newman-Keul’s test .................................................................. 109

Figure 5.7. Mice deﬁcient in angiotensin receptor ATla exhibit reduced lung collagen
accumulation in response to BLEO instillation. Normal [wild type (w.t.)] or
heterozygous ATla knockout mice (+/-) were administered BLEO
intratracheally as in Figure 3 . Fourteen days later lung tissue was fast-frozen,
hydrolyzed, and total collagen was measured by hydroxyproline assay (HP) as
described in Materials and Methods. A: HP data are expressed as a percentage
of the corresponding control (- BLEO). B: Data are expressed as the absolute
amount of HP per left lung. Bars are the means i SEM of n = 5; *, P < 0.01
versus untreated (- BLEO) by analysis of variance and Student-Newman-

Keul’s test ........................................................................... 110

Figure 6.1: Semiquantitative RT-PCR of angiotensinogen (ANGEN) mRNA in lungs

3hours aﬁer Bleo exposure. Normal rats were intraltracheeally instilled with

Bleo (8U/Kg) or saline (CTL) for 3hours and total RNA was isolated. RT-

xxiii

 

 

 

 

Figure 6.3; T}
and

0f

fun

at}.

It...

(I

Coj

PCR was performed as described before (see Meterial and Methods) with
primers speciﬁc for rat ANGEN, -Microglobulin (B-MG) as control

mRNAs ................................................................................ 134

Figure 6.2: In situ hybridization of ANGEN mRNA demonstrated that positive labeling
(dark purple, shown by arrowhead) increased 6h (B x 200 magniﬁcation, C x
400 magniﬁcation) and 14 days (E, Fx200 magniﬁcation) after BLEO
instillation compared to the corresponding controls (A, D x 200
magniﬁcation). 6h after BLEO instillation, the positive labeling is mainly
localized at the comers of the alveolar, which typically are the positions for
type II alveolar cells (BC). 14 days aﬁer BLEO instillation, the positive
labeling is mainly localized at ﬁbrotic foci (E) where myoﬁbroblast /
ﬁbroblast accumulate and the corners of the alveolar (F) near the ﬁbrotic

region .................................................................................. 13 5

Figure 6.3: The sections were subjected to IHC with antibodies against the ANGI, lectin
and a-SMA 24 hours (B, C) and 7 days (D, E, F) after intratracheal instillation
of bleomycin. 24h after BLEO instillation ANGEN /ANG I (purple) was
found in alveolar walls cell at the corners that did not label with lectin
(compare B &C x400, same ﬁled with matched arrowhead). In severely
affected areas of the parenchyma of bleomycin— induced ﬁbrotic rat lungs,
regions of ANGEN / ANG I labeling (Dx200, black box) were observed to

coincide with a loss of lectin labeling (Ex200, white box: double label of same

xxiv

Figure 6.4 P

lit

'Jv
'J

Stu

Figure 6.5 H

 

indL

lun‘;

 

Figure 6.6 The ‘\
lUng L

 

 

section as D). Enlargement of the white-boxed region (F x400) revealed a-
SMA immunoreactivity in the middle of the box on the adjacent serial section,

suggestive of myoﬁbroblasts ........................................................ 136

Figure 6.4 Pulmonary angiotensin II (ANG II) increased in bleo-induced lung injury. 6
hours and 14 days after bleo instillation, lungs were perfused, homogenized,
and analyzed by ELISA speciﬁc for ANG II. Values are means of at least
5 separate determinations. * Signiﬁcantly different from CTL, P < 0.05 (by

Student's t-test) ....................................................................... 137

Figure 6.5 The Antisense oligonucleotides against ANGEN mRNA inhibit BLEO-
induced activation of caspase 3. Lung explants were prepared from normal rat
lung tissue perfused before excision (see Materials and Methods). BLEO (25
mU/ml) was applied in serum-free culture medium for 24 hours in the
presence or absence of antisense (40nM)). Bars are the means 3: SEM of n
= 3; *, P < 0.05 versus control (CTL+lipo) by analysis of variance and

Student-Newman-Keul’s test ........................................................ 138

Figure 6.6 The Antisense oligonucleotides against AN GEN mRNA and non-selective AT
receptor antagonist saralasin inhibit BLEO-induced collagen accumulation in
lung explants. Lung explants were prepared from normal mouse lung tissue
perfused before excision (see Materials and Methods). BLEO (25 mU/ml) was

applied in 10% FBS (A) or 1% ITS (B) for 14 days in the presence or absence

XXV

 

Figure 6.7 l:
01
di
int

nor

Hum68hw
;\\t
0ng
Pane
ﬂuor
ﬁekl
rereu
ofau

Panel

 

ﬁnenx

“llll l;

 

of SAR (50ug/ml) or antisense (40nM). Bars are the means i SEM of n = 3; *,
P < 0.05 versus control (CTL) in A; *, P < 0.01 versus CTL in B by analysis

of variance and Student-Newman-Keul’s test .................................... 139

Figure 6.7 Distribution of ﬂuorescence in lung, liver and kidney 2 hous after instillation
of BODIPY labeled oligonucleotides. Normal rats were instilled with
different dose of BODIPY labeled oligonucleotides. Measure ﬂuorescence
intensity in the homogenates of the frozen lung, liver and kidneys after

normalization to total tissue protein ............................................... 140

Figure 6.8 Localization of the intratracheal instilled ﬂuoscence—labelled antisense against
ANGEN mRNA on the lung sections from rats treated with 75ug of
oligonucleotides.

Panels with red ﬂuorescence show Pl staining and panels with green
ﬂuorescence show BODIPY staining. Panel A, B (10 x10) show the same
ﬁeld from the same section. And so do panel C, D (40 x 10). Panel A, B
revealed that BODIPY ﬂuorescence was localized primarily to the epithelium
of airways (arrow) and in isolated cells of the alveolar walls (arrowhead).
Panel C, D revealed that some alveolar wall cells were stained with high
intensity of BODIPY-oligonucleotides (arrows) while others were stained

with very little of the oligonucleotides (arrowheads) ........................... 141

xxvi

ﬁgure 6'9 "

 

5U,"

ins:

 

f0 1’

den

igure 6.1 l. Dete
blots
indie.
treatr‘.
fragn;

bleorr.

 

caspm

 

Figure 6.9

A: Macroscopic photographs of the lungs 14 days after different treatment.
Note the almost normal appearance of the lung in the Bleo +AS treated rat
compared with the 8160- and bleo+SCR treated rat lungs, which are smaller
with many patchy bleeding spots. B: Quantitation of total lung collagen by
hydroxyproline (HP) assay. At 14 days post-Bleo, collagen was quantitated by
HP assay applied to hydrolyzed lung tissue. See METHODS for details. *

P < 0.05 vs. CTL by ANOVA ..................................................... 142

Figure 6.10 Bleomycin increased angiotensinogen protein expression, which was

Figure 6.11.

suppressed by the treatment of antisense in perfused lung tissues. 14 days after
instillation of bleomycin or vechicle, lungs were perfused and homogenized
for the western blot analysis. (A) Representative immunoblots and (B)
densitometn'c evaluation of blot data. Data are presented as mean isSE (n=5).

*: P<0.05 versus CTL ............................................................... 143

Detection of active caspase-3 by immunohistochemistry (IHC) and western
blots (WB) 14 days after described treatment. Male Wistar rats received
indicated treatment intratracheally. Lung tissues were harvested 14 days after
treatment and subjected to IHC and WB by using anti-active caspsase-3 (p17
fragment) antibody. Upper penal (WB): Active caspase-3 was induced by
bleomycin and suppressed by antisense treatment. Lower penal (IHC): active

caspase —3 was localized in alveolar epithelial cells and alveolar macrophages.

......................................................................................... 144

xxvii

 

Figure 6.12

Pt
0b

the

pos—

did

Fig. 6.13 The
flaw
“ere
3min
“CFC

the u.

 

C(lnlli

'-
‘o
n
n
o
u

1..
'-
u
'o
‘.

 

Figure 6.12. Detection of apoptotic cells by in situ end labeling (ISEL) of fragmented

Fig. 6.13
Fig- 7.1.
Fig. 7.2.

DNA 14 days after described treatment. Male Wistar rats received indicated
treatment intratracheally; lung tissues were harvested 14 days after treatment
and subjected to ISEL coupled to a fast blue detection system (see METHODS).
Positive reaction is blue. A: in CTL group, ISEL-positive nuclei were not
observed. B: in bleo group, ISEL-positive nuclei were observed in cells within
the alveolar walls, many ISEL-positive nuclei were observed in septal wall
cells at the alveolar corners. C: administration of antisense decreased ISEL
positive cells in response to Bleo. D: administration of scramble nucleotides

did not decreased ISEL positive cells in response to Bleo ...................... 145

The Antisense oligonucleotides against ANGEN mRNA inhibited DNA
fragmentation in lung epithelial cells 14 days after BLEO instillation. Rats
were given a single intratracheal instillation of BLEO in the presence
antisense or scramble ONT in the instillate. Fourteen days later, lung sections
were prepared and labeled by ISEL. Labeling was quantitated in cells within
the alveolar surfaces. Bars are the means :4: SEM of n = 5; *, P < 0.01 versus
control (CTL); **, P < 0.01 versus BLEO or BLEO +SCR by analysis of

variance and Student-Newman-Keul’s test ....................................... 146

............................................................................................ 167

............................................................................................ 178

xxviii

 

ACE

AC Eis
AECS
ANGEN
ANT}
ANGI
ANG II
APR
u-SMA
AS

ATA

AT 1 cell
AT ll cell
All Reeept0r
Arr
BALF
blo‘dl'Tp
BLEO
BPAEC
CAMP

CAPT

ACE
ACEis
AECs
ANGEN
ANG
ANG I

ANG II

a-SMA
AS

ATA

AT I cell
AT 11 cell
ATl Receptor
ATF
BALF
bio-dUTP
BLEO
BPAEC
cAMP

CAPT

LIST OF ABBREVIATIONS

Angiotensin Converting Enzyme
Inhibitors of ANG converting enzyme
Alveolar Epithelial Cells
Angiotensinogen

Angiotensin

angiotensin I

angiotensin II

Acute Phase Response Element
Alpha-Smooth Muscle Actin

antisense oligonucleotides
aurintricarboxylic acid

Alveolar type I cell

Alveolar type II cell

ANG 11 type I receptor

Activating transcription factor
bronchoalveolar lavage ﬂuid
biotinylated deoxyuridine trisphosphate
bleomycin

Bovine pulmonary artery endothelial cells
Cyclic AMP

captopril

xxix

 

CmD
CMV
CID-PF
DAG
dgdCIP
DLco
EBV
ECL
ECNI
HJSA
REL
FBS
FL14
HGF

HP

HRCT

 

CatD
CMV
CTD-PF
DAG
dig-dUTP
DLco
EBV
ECL
ECM
ELISA
Fas L
FBS

F l - l 4
HGF
HP
HRCT
IHC
IL-6
ILD
1P3
IPF
ISEL

ISH

cathepsin D

cytomegalovirus

Connective tissue disease-pulmonary ﬁbrosis
diacylglycerol

digoxigenin-labeled deoxyuridine trisphosphate
Diffusion capacity of carbon monoxide
Epstein-Barr virus

Enhanced chemiluminescence
extracellular matrix

Enzyme-Linked Irnmunosorbent Assay
Fas ligand

Fetal bovine serum

angiotensino gen fragment 1 -14
Hepatocyte growth factor
hydroxyproline

High-resolution CT
Immunohistochemistry

Interleukin-6

Interstitial lung disease

Inositol- l , 4, 5-trisphosphate
Idiopathic Pulmonary Fibrosis

In situ end labeling

In Situ Hybridization

XXX

 

 

1.1.

[TS
KGF
IIPO
LOS
110

Km

9 MG
PAls

PBS
PepA

PDGF

pr
PGE;

Pl

P1P:
PM

PRC
1’sz
PIC B
PLD
PFOSP-C
Rag

SARAL
SCR

I.T.

ITS
KGF
LIPO
LOS
LTo.

Km

B -MG
PAIs

PBS
PepA

PDGF

PF
PGEz

PI

PIP2
PKA

PKC
PLA2
PLC B
PLD

proSP-C

SARAL

SCR

intratracheal
Insulin-transferrin-selenium
Keratinocyte growth factor
lipofectin

losartan

lymphotoxin-o.

Michaelis Constant

[3 -Microglobulin
plasminogen activator inhibitors

Phosphate-buffered saline
pepstatin A

Platelet-derived growth factor

Pulmonary Fibrosis
Prostaglandin E2

propidium iodide

Phosphatidylinositol-4, 5-bisphosphate
Protein kinase A

Protein kinase C
phospholipase A2
phospholipase C-beta
phospholipase D
pro-surfactant protein-C
renin-angiotensin system
saralasin

Scrambled-sequence control oligonucleotides

xxxi

 

SNPS
SP-A
TBS
101.5
INF-a
TNF-Rll
tPA

TLNEL

L'PA
wr.

ZVADfmlr

 

 

SNPs

SP-A

UPA

w.t.

ZVADfrnk

Single nucleotide polymorphisms
Surfactant protein A
Tris-buffered saline
Transforming growth factor-beta
Tumor necrosis factor alpha
TNF-a/LTo. receptor 2
tissue-type plasminogen activator

Terminal deoxynucleotidyl transferase (TdT) mediated
deoxyuridine End Labeling

urokinase-type plasminogen activator
wild type

N—benzylcarboxy-Val-Ala-Asp-ﬂuoromethylketone

xxxii

 

GENERAL

1. Idiop
Idiopathic pt;
disease result
to thickening
unknoun etio
reepitheliulim

matrix. and d;

1.1 Epidem

IPF is a relatixr

 

Chapter 1

GENERAL INTRODUCTION

1. Idiopathic Pulmonary Fibrosis
Idiopathic pulmonary ﬁbrosis (IPF) is a progressive, usually fatal, form of interstitial lung
disease resulting from injury to the lung and an ensuing ﬁbrotic response. Fibrosis leads
to thickening of the alveolar walls and the obliteration of the alveolar space with
unknown etiology (Fonseca et al., 2000). The characteristics of IPF are failure of alveolar
reepithelialization, persistence of ﬁbroblasts/myoﬁbroblasts, deposition of extracellular

matrix- and distortion of lung architecture, which ultimately results in respiratory failure.

1.1 Epidemiology of IPF
IPF is a relatively rare disease and more common in males than in females. The estimated
annual incidence is 7 cases per 100,000 women and 10 cases per 100,000 men (Coultas et
al., 1994). The incidence, prevalence, and death rate increase with age (Coultas et al.,
1994; Mannino et al., 1996; Schwartz et al., 1994). For the age group between 35 to 44
Years there are 2.7 cases of IPF in a population of 100,000. For the age group older than
75 years there are about 175 cases in the same population (Coultas et al., 1994). Two
thirds of patients diagnosed with IPF are with an age greater than 60 years (Johnston et
al., 1997). The mean age at diagnosis of IPF is 66 years (Johnston et al., 1997; Carrington

et al., 1978).

 

1.2 Pre
Some studi

solvents. or

Hubbard et

1.2.1
Genetic factr
the IPF patiei
genes in thos.
gene. which 1
protein (Thou
mum“! Protein
is ablmfmal (“I
Produces prot.
cornpanmenI tc
abnormal SUrfa

 

 

Geﬂellc 1'

associated with ~
”- 3001) Ar

. |

 

 

ACE COnferS a h

1.2 Predisposing factors for IPF
Some studies indicate that genetic factors and environmental exposure to dusts, organic
solvents, or urban pollution increases the risk of developing IPF (Johnston et al., 1997;

Hubbard et al., 1996; Iwai et al., 1994).

1.2.1 Genetic factors

Genetic factors may play an important role in the pathogenesis of IPF and about 3% of
the IPF patients aggregated in families (White et al., 2003). Studies seeking the abnormal
genes in those patients demonstrated a mutation in the pro-surfactant protein-C (proSP-C)
gene, which lead to the substitution of leucine by glutamine in the C-terminus of that
protein (Thomas et al., 2000). Electron microscopic studies demonstrated that this
mutant protein is aberrantly located in the cell and lamellar bodies containing surfactants
is abnormal (Thomas et al., 2000). These results suggest that the mutation of the gene
produces protein that could not be properly processed to the correct subcellular
compartment to be secreted out of type II alveolar epithelial cells. The mutation results in
abnormal surfactant production in alveolar type II cells. These ﬁndings suggest that in
this familial IPF, improper cellular processing of proSP-C may contribute to pulmonary
ﬁbrosis.

Genetic polymorphisms of several other enzymes and cytokines have been
associated with either the incidence or progression of IPF (Whyte et al., 2000; Pantelidis
et al., 2001). Angiotensin converting enzyme (ACE) gene polymorphisms were studied in
pulmonary ﬁbrosis. The D allele of the insertion] deletion (I/D allele) polymorphism of

ACE confers a higher level of ACE gene expression compared to I allele. The incidence

 

ofD allele 1‘
moderate tr
incidence o
approximate
et al.. 2001 ).
angiotensin
ﬁbrosis (Mod
Single nuclec
in 74 IPF pat
2001). Four c
I.Vmphoto.\rin.
”W- No dit
found bemee
frequency of
Increased in
asSOCiation “a
Capach." for ck,
diseaSe ’
Progrct

dimmed prod.

 

1.2_2 E” _

1,1

 

of D allele and D/D genotype of ACE gene in 24 patients with interstitial pneumonia and
moderate to severe pulmonary ﬁbrosis was examined (Morrison et al., 2001). The
incidence of the D allele was approximately 15% higher and the D/D genotype was
approximately 11% higher in the patients group than in the general population (Morrison
et al., 2001). That study suggests that gene polymorphisms that confer higher levels of
angiotensin converting enzyme (ACE) gene expression predispose patients to lung
ﬁbrosis (Morrison et al., 2001).

Single nucleotide polymorphisms (SNPs) of some pro-inﬂammatory genes was evaluated
in 74 IPF patients with conﬁrmed diagnosis by clinical or biopsy data (Pantelidis et al.,
2001). Four candidate genes were proposed including tumour necrosis factor-a. (TNF-a),
lymphotoxin-a. (LTa), high afﬁnity TNF-a/LTa. receptor 2 (TNF-RII), and interleukin-6
(IL-6). No difference in genotype, allele, or haplotype frequencies of those genes was
found between patients inﬂicted with IPF and control population. However, the
frequency of carriage of the IL-6 allele (intron 4G) and the TNF-RII allele (1690C)
increased in patients, which was not observed in controls. In addition, a strong
association was found between progression of IPF and IL-6 genotype since diffusion
capacity for carbon monoxide (DLCO) was decreased, suggesting that the rapidity of
disease progression is higher in patients with IL-6 genotype, this may account for

decreased production of IL-6 (Pantelidis et al., 2001).

1.2.2 Environmental factors:
Environmental factors have also been considered to contribute to the development of

pulmonary ﬁbrosis.

 

   
  
   
   

Several VII’L
implicated i
detected in
demonstrate
1999;1(elly
Investigators

occupational

I .
>3 CllniCal 1
The -
Clin'
. 10211 m._
1031':

FilaIOI-y Crag;

Several viruses including Epstein-Barr virus (EBV), cytomegalovirus (CMV) have been
implicated in pathogenesis of IPF as those viruses and latent viral infections have been
detected in patients with IPF. However, there exists no convincing evidence to
demonstrate certain viruses directly cause IPF (Yonemaru et al, 1997; Stewart et al.,
1999; Kelly et al., 2002).

Investigators have also made some extent of associations between unidentiﬁed
occupational and dust exposures and IPF (Baumgartner et al., 2000; Mullen et al., 1998).
Cigarette smoking is the most extensively studied environmental risk factor for IPF.
Howerve, instead of showing smoking as a risk factor for IPF, some clinical studies
indicate that current smokers have improved mortality in established cases of IPF (King
et al., 2001; Flaherty et al., 2002). In agreement with those studies, those IPF patients
who currently smoke also had lower granulation/connective tissue (FF) scores, another
independent predictor of disease survival, indicating better prognosis (Flaherty et al.,
2003; King et al., 2001). These observations thus suggest that some factors produced in

the process of cigarette smoking may be helpful for treating IPF (N obukuni et al., 2002).

Genetic susceptibility and environmental factors may contribute to the development of
IPF, yet evidence of predisposing or etiologic factors is not strong since most patients do

not demonstrate any obvious risk factors (Selman et al., 2001).

1.3 Clinical features
The clinical manifestations include dyspnea on exertion, nonproductive cough, and

inspiratory crackles; at the late stage of this disease patients also present shortness of

breath at rest (Crystal et al., 1976). Bi-basilar and end-expiratory rales are demonstrated
through physical examination in more than 80% of patients with IPF (ATS, 2000).
Digital clubbing is noted in up to half of all patients (Johnston et al., 1997). Cyanosis and
signs of pulmonary hypertension may be seen in patients at the late stage of IPF (Panos et
al, 1999).

There is no laboratory test speciﬁc for the diagnosis of IPF. Laboratory evaluation of
patients with suspected IPF is primarily to rule out alternative causes of interstitial lung
disease such as sarcoidosis or connective tissue disease—pulmonary ﬁbrosis (CTD-PF).
Pulmonary function tests reveal restrictive impairment, reduced diffusing capacity for
carbon monoxide, and arterial hypoxemia exaggerated or elicited by exercise (Selman et
aL,2001)

More than 90% of patients with IPF at the time of diagnosis had abnormal chest
radiographs (Johnston et al., 1997). The characteristic pattern of abnormal chest
radiography is diffuse bilateral interstitial or reticulonodular inﬁltrates, predominantly in
the basilar and subpleural regions of the lower lung (Guerry-Force et al., 1987).
Diagnosis for patients with suspected IPF can be improved by using the high-resolution
CT (HRCT) scanning since HRCT can produce reconstructed images of thin scan
sections (1-2 mm slices) in three-dimensions to visualize the enhanced spatial structure of
the lung parenchyma (White et al., 2003). Patterns of HRCT images typically seen in IPF
patients include coarse reticular or linear opacities indicating intralobular and interlobular
septal thickening, a predilection for the periphery and lower lobes of the lungs,
honeycomb cysts, and traction bronchiectasis (Kazerooni et al., 1997). Ground glass

opacities and ill-deﬁned hazy zones that represent active alveolitis or ﬁbrosis of the

intralobular and alveolar septae can also be present (Kazerooni et al., 1997; Wells et al.,
1993). Extensive honeycombing, septal thickening, and a lack of ground glass opacities
often predict a poor prognosis.

The deﬁnite diagnosis of IPF must meet the following criteria: 1) a compatible clinical
history; 2) the exclusion of other known causes of interstitial lung disease such as drug
injuries, environmental exposures, or collagen vascular disease; 3) a surgical lung biopsy
showing usual interstitial pneumonia histologic pattern (ATS, 2000). The histologic
hallmark of usual interstitial pneumonia is a heterogeneous appearance with alternating
areas of dense ﬁbrosis, ﬁbroblastic foci, interstitial inﬂammation, and honeycomb change

and normal lung at low magniﬁcation.

1.4 Histopathology

In IPF the normal architecture and functional integrity of the lung are destroyed. The
main histological features of the ﬁbrotic lung are persistent and unrepaired epithelial
damage, proliferation and accumulation of ﬁbroblast/myoﬁbroblast cells, and increased
collagen deposition (Selman et al., 2001).

Temporal heterogeneity is a histopathologic hallmark of IPF. At low magniﬁcation, a
typical heterogeneous appearance can be observed with normal areas alternating with
areas with peripheral ﬁbrosis, interstitial inﬂammation, and honeycomb changes (ATS,
2000). The inﬂammatory component is typically not intensive and consists primarily of
lymphocytes and plasma cells. Other inﬂammatory cells such as neutrophils and
eosinophils may be present with low abundance. Under high-power magniﬁcation,

ﬁbroblastic foci can be found at the border between ﬁbrotic and normal lung where

 

rationales”i
collagen bunt
for IPF as it
tibroblastic fr
2003:1(ing et
Another imp-
Alveolar epitl
active ﬁbrosis

airspaces linec

1.5 Thera p
The traditiona
proudes the b
treat IPF (Flah

ImmUDOSUPpr-e

300t .
”ll. a-Lalhlu

L'“ffmunatelx-

0111} Offer a m

pinenjdone int
a; .
Id Or I \'i\'(

l
H0"met.

ﬁbroblasts/myoﬁbroblasts accumulate with collection of dense, relatively acellular
collagen bundles. The presence of ﬁbroblastic foci may be an important prognostic factor
for IPF as it represents the active lesion of IPF (Selman et al., 2001). The number of
ﬁbroblastic foci is correlated with the morality of patients with IPF (Nicholson et al.,
2002; King et al., 2001).

Another important characteristic of IPF is unrepaired alveolar epithelial damage.
Alveolar epithelial injury with abnormal type II pneumocytes is often seen at areas of
active ﬁbrosis (Kuhn et al., 1991). Honeycomb changes are formed by enlarged, cystic

airspaces lined by abnormal type II pneumocytes.

1.5 Therapeutic options for pulmonary ﬁbrosis
The traditional view considers pulmonary ﬁbrosis is an inﬂammatory disorder, which
provides the basis for using potent anti-inﬂammatory agents such as corticosteroids to
treat IPF (Flaherty et al., 2001). Anti-inﬂammatory agents were often supplemented with
immunosuppressive and cytotoxic agents such as cyclophosphamide (Zisman et al.,
2000), azathioprine (Raghu et al., 1991) and colchicines (Douglas et al., 1998).
Unfortunately, clinical studies indicate that those traditional therapeutic approaches can
only offer a marginal beneﬁt at best (King et al., 2000). In contrast, new approaches
employing anti-ﬁbrotic agents such as angiotensin system antagonists (captopril),
pirfenidone, interferon-Y and statin have been shown to have antiﬁbrotic effects in vitro
and/or in vivo in experimental pulmonary ﬁbrosis models (Selman et al., 2001).
However, prospective, randomized, placebo-controlled multi-center clinical trials are

needed to evaluate their efficacy in the treatment of IPF.

2. Bleomycin-Induced Experimental Pulmonary Fibrosis Model:

A number of animal models of pulmonary ﬁbrosis have been developed to address the
pathogenesis of pulmonary ﬁbrosis. One of them is the bleomycin-induced experimental
pulmonary ﬁbrosis model. [see review (Thrall and Scalise, 1995)].

Bleomycin is an antineoplastic antibiotic, which was isolated from a strain of
Streptomyces verticillus (Umezawa et al., 1966). Bleomycin is not a single peptide.
Instead, it consists of a family of complex glycopeptides with different amine groups
(Umezawa et al., 1966, 1967; Umezawa, 1973, 1974). It is used in the treatment of
squamous cell carcinomas and various lymphomas (Ichikawa et al., 1967, 1969; Yagoda
et al., 1972; Blum et al., 1973). The mechanisms of antineoplastic action of bleomycin
are complex and cell cycle-dependent. Brieﬂy, bleomycin intercalates between DNA base
pairs, causing DNA to unwind and impairing protein synthesis. Bleomycin increases
radical oxygen species by reducing molecular oxygen to superoxide and hydroxyl
radicals. Those free radicals then attack DNA and cause strand cleavage (Sausville et al.,
1978)

Lack of side effects on bone marrow (Kimura et al., 1972; Boggs et al, 1974) and
immunocompetence (Dlugi et al., 1974; Lahane et al., 1975) are the major advantages of
using bleomycin over other chemotherapeutic agents. However, the lung and skin are the
major organ systems affected by the toxic side effects of bleomycin (Thrall and Scalise,
1995). The fact that these organ systems are susceptible to bleomycin can be explained in
part, but not entirely, by the pharmacokinetics of bleomycin. Bleomycin reaches the

highest concentration in the lung and skin aﬁer parenteral administration. This is likely

due to the lack of a hydrolase, which inactivates bleomycin, in the lung and skin as
bleomycin-induced cytotoxicity is higher with low cellular levels of hydrolase activity
(Umezawa et al., 1972). Currently the bleomycin induced pulmonary ﬁbrosis animal
model is the most commonly used model for studying the pathogenesis of ﬁbrotic lung
disease.

The bleomycin—induced pulmonary ﬁbrosis is dose and administration route dependent.
Two most common administration routes are parenteral and intratracheal. Cumulative
doses of 100-200 mg (units)/kg were used in the parenteral injection model whereas the
intratracheal single-injection model uses doses in the range of 2.5-7.5 mg/kg (Thrall and
Scalise, 1995). The parenteral injection produces lesions with a more diffuse pattern in
perivascular and subpleural locations whereas the intratracheal injection produces patchy
focal lesions in peribronchial locations. Various animals, including mice and rats, have
been used for models of bleomycin induced pulmonary ﬁbrosis (Thrall and Scalise,
1995)

Generally speaking, the development of lung injury in various bleomycin animal models
is quite similar regardless of species and route of administration. The lung injury
progresses through three stages (Thrall and Scalise, 1995): (l) The acute inﬂammatory
stage (1-3 days post-intratracheal instillation of bleomycin and later in the parenteral
models). This stage features the activation of inﬂammatory mediator systems and
emerging of pulmonary edema. (2) The subacute stage (4-21 days post intratracheal
instillation of bleomycin). This stage is characterized by the synthesis of collagen and

elevation of the levels of net lung collagen as well as other connective tissue components.

 

(3) The chrC
metabolism OI
111 Summary:

carcinomas an
confers the ”7
however. pr 0V1

m'th direct clin

3. Mechanisms
IPF is the me
physicians (M;
pathogenesis. tl
approaches u:
iUltrrunosuppres.
Recent NHLBI

PthOgenesis of‘

(3) The chronic stage (21 days to termination). This stage is dominated by the
metabolism of connective tissue towards reepithelialization.

In summary, as an effective antineoplastic agent used in the treatment of various
carcinomas and lymphomas, bleomycin has toxic side effects on lung tissues, which
confers the major limitation to its therapeutic use. The bleomycin animal models,
however, provide a valuable tool to investigate the pathogenesis of ﬁbrotic lung disease

with direct clinical relevance.

3. Mechanisms of F ibrogenesis

IPF is the most common interstitial lung disease (ILD) encountered by respiratory
physicians (Mapel et al., 1998). Unfortunately, despite years of research on its
pathogenesis, the treatment of PF has not been successful. The traditional therapeutic
approaches using potent anti-inﬂammatory agents supplemented with an
immunosuppressive agent could only offer a marginal beneﬁt at best (King et al., 2000).
Recent NHLBI Workshops have concluded that our current understanding of the
pathogenesis of the IPF is incomplete (Mason et al., 1999; Crystal et al., 2002).

Current opinions regarding the pathogenesis of PF are controversial. The
traditional view considers pulmonary ﬁbrosis as an inﬂammatory disorder, in which
inﬂammation in the lower respiratory tract (alveolitis) is responsible for derangements of
the alveoli and results in scaring of the lung parenchyma (Gallin et al., 1992). The
consequence of the inﬂammation is the loss of ﬁmctional alveolar—capillary unit, the

accumulation of collagen, and the formation of honeycomb lung. The limited success of

 

anti-inﬂammz
alternative by
Current evolv
failure of reer
h}pothesis me
and efficient e
1990,). There .
this hjpothesis
facilitates sub

Imeent ﬁbroti

1998).

3-1 The rof

anti-inﬂammatory/ immunosuppressive therapy for IPF has stimulated the generation of
alternative hypothesis regarding the pathogenesis of IPF (Crystal et al., 2002).

Current evolving hypothesis is that IPF results from the epithelial microfoci injury and a
failure of reepithelization (Selman et al., 2001). Haschek and Witschi ﬁrst proposed this
hypothesis more than 20 years ago, speculating that epithelial damage drives ﬁbrogenesis
and efﬁcient epithelialization would prevent ﬁbrogenesis (Haschek et al., 1979; Witschi,
1990). There is some evidence from both animal model and human patients that supports
this hypothesis. In the animal models, experimental delay of epithelial repair after injury
facilitates subsequent ﬁbrogenesis (Haschek et al., 1979). In human lung biopsies,
nascent ﬁbrotic foci were colocalized with unrepaired or abnormal epithelia (Uhal et al.,

1998).

3.1 The roles of alveolar epithelial cells (AECs)

The lung is the respiratory organ that functions to maintain the constant internal
environment by inspiring oxygen into blood circulation and removing carbon dioxide
from blood circulation. To fulﬁll this function, the lung has special architecture. The
basic functional unit of the lung is alveoli where gas exchange occurs between the air and
the circulating blood. Alveoli consists of several components: 1) the alveolar epithelium
that covers the air space; 2) the endothelium lining the capillaries; 3) thin interstitium
separating the epithelium and the endothelium, which includes the connective tissue and
extracellular matrix components with a few resident ﬁbroblasts (Fonseca et al., 2000).

The intact alveolar epithelium is composed of two cell types, alveolar type 1 cells

(AT I cell) and type 11 cells (AT 11 cell) (Uhal et al., 1997; Sutherland et al., 2001). They

ll

are morphologically and functionally different although the cell numbers of these two
types are similar (Mason and Williams, 1991). AT 1 cells are large elongated cells and are
terminally differentiated. They cover over 90% of the alveolar surface. The thin and
attenuated cytoplasm of the AT 1 cell facilitates the gas exchange by minimizing the
diffusion distance between alveolar gas and blood. These cells are metabolically active
and harbor cell surface receptors for a variety of substances, including extracellular
matrix (ECM) proteins, growth factors, and cytokines. AT 11 cells are cuboidal in shape
with rounded nuclei. They are predominantly located in the comers of the alveoli and
cover about 10% of the alveolar surface. Type 11 cells have distinctive features such as
apical microvilli and cytoplasmic lamellar bodies that contain the alveolar lining material
surfactant. Type II cells have abundant intracellular organelles including extensive
endoplasmic reticula, Golgi complexes, peroxisomes, and mitochondria. AT II cells are
not terminally differentiated and have a number of unique functions (Sutherland et al.,
2001). For example, AT 11 cells can synthesize and secrete surfactant that is involved in
regulating the surface tension in the alveolar epithelium. AT 11 cells are also involved in
xenobiotic metabolism by regulating the activities of the cytochrome P-450
monooxygenase, transepithelial ion and H20 movement. In addition, AT 11 cells have
immuno-modulatory functions and regulate the lung extracellular matrix (ECM)
metabolism (Pardo et al., 1997). Another important function of the AT II cells is the
maintenance of the alveolar epithelium. It can function as stem cells to proliferate to give
rise to new AT 11 cells or differentiate into AT I cells. As such, AT 11 cells play important
role in the repairing of the alveolar epithelium by replacing the lost cells and restoring

normal tissue architecture and lung function (Uhal, 1997).

12

 

3.2 Cons'
Loss of AEC

PathoPhFSiOI‘

1211
lite mallOr fur
alveolar air at
which facilitz
endothelial CC
Space. In 0rdc
prevented frOfT
this function. I
alveolar epilhc
benveen adj ace
epithelial cells
ltrnphatic s_vstc

elllut of plastr.

3.2 Consequence of alveolar epithelial cells damage/ injury:
Loss of AECs during IPF has a number of adverse effects, which likely contribute to the

pathophysiology of IPF [see review (Simon, 1995)].

3.2.1 Loss of permeability barrier
The major function of type I alveolar cells is gas exchange. Diffusion distances between
alveolar air and capillary blood are very short due to the thin shape of the type I cells,
which facilitates gas exchange. Intercellular junctions between adjacent capillary
endothelial cells are not tight. Therefore, plasma proteins can leak into the interstitial
space. In order to maintain the functional integrity of the lung, the plasma has to be
prevented from leaking into the airspaces. The alveolar wall provides a barrier that fulﬁlls
this function. This barrier of the alveolar wall consists of the capillary endothelium and
alveolar epithelium (Gorin and Stewart, 1979). Compared to the intercellular junctions
between adjacent capillary endothelial cells, the intercellular junctions between alveolar
epithelial cells are much tighter which prevent air space from ﬂooding. The pulmonary
lymphatic system also helps to prevent air space ﬁom ﬂooding by draining the normal
efﬂux of plasma components back to the circulation. However, in patients with IPF,
plasma proteins, e. g., ﬁbrinogen, leak into the alveolar space (Basset et al., 1986; Kuhn et

al., 1989; Crouch, 1990).

3.2.2 Loss of the barrier limiting ﬁbroblast migration into the alveolar airspace
Migration of ﬁbroblasts into the airspaces would lead to collagen deposition and

obliteration of alveoli. In addition to providing a barrier for plasma proteins leakage, the

13

 

aheohri

Rat trachr

epithelial

m'thout e
becomes 1
dssue. Vl'
ﬁbrosis d
preventing
ﬁbrosis. Ft
ls a meat
198:; Lani
Image ("8.1
(Borok et a

Sl'mhcslze ]

alveolar epithelium also prevents the migration of ﬁbroblasts into the alveolar airspaces.
Rat tracheal grafts with or without denuded epithelial cells were used to demonstrate that
epithelial cells suppress migration of ﬁbroblasts (Terzaghi et al., 1978). When the grafts
without epithelial cells were transplanted into another rat, the tracheal lumen rapidly
becomes obliterated by the inward migration of ﬁbroblasts and formation of connective
tissue. When the tracheal grafts were repopulated with epithelial cells, intralumenal
ﬁbrosis did not occur. Therefore, an intact epithelia layer appears to be crucial for
preventing ﬁbrosis. This is likely due to the fact that AECs produce inhibitory factors for
ﬁbrosis. For example, prostaglandin E2 (PGE2) that is secreted by alveolar epithelial cells
is a potent inhibitor of ﬁbroblast collagen synthesis and proliferation (Goldstein et al.,
1982; Lama et al., 2002). Furthermore, the PGE2 levels are lower in broncho-alveolar
lavage (BAL) ﬂuid from patients with IPF compared to those from control patients
(Borok et al., 1991). Therefore, loss of AECs or damaged AECs with deceased ability to

synthesize PGE2 may contribute to pathogenesis of IPF.

3.2.3 Loss of cell surface that prevents collapse and fusion of alveolar walls
Alveolar collapse and fusion of adjacent walls can occur in severely damaged areas of
lung parenchyma in IPF patients due to loss of the epithelial cell surface. Fibrotic
Connective tissue replaces the collapsed alveolar space and nuked basement membrane.

Those processes lead to the decrease of alveolar surface area and contribute to the

restrictive lung volumes (Simon, 1995).

3.2.4 Surfactant Alterations

l4

 

Surfactant
llS functit
geometry
Bronchoal
surfactant
('Lovv, 198
abnormal.
surfactant.
1991). It 1:
PTOgnosis s
The delicic
abnonnal s
Collapse of
0fHal-red b3
the hl'drosr
(Gullon an
companmer
airspace am
Wactam tL

nothly gem

3.25

Surfactant is a lipid-rich material that is synthesized exclusively by type II alveolar cells.
Its function is to lower the surface tension of the air-ﬂuid interface so that alveolar
geometry can be maintained to protect smaller alveoli from collapsing.
Bronchoalveolar lavage ﬂuid obtained from patients with IPF has abnormalities in its
surfactant components. Particularly, the composition of phospholipids is out of ratio
(Low, 1989; McCormack et al., 1991). The protein component of surfactant in IPF is also
abnormal. For example, surfactant protein A (SP-A), the major protein species within
surfactant, was shown to decrease in bronchoalveolar lavage ﬂuid (McCormack et al.,
1991). It was also revealed that patients with better-preserved levels of SP-A had better
prognosis showed by lung functions test (McCormack et al., 1991).
The deﬁciencies in surfactant have several impacts on the pathophysiology of IPF. First,
abnormal surfactant causes higher surface tension on the alveoli that can lead to the
collapse of smaller alveoli. Permanent collapse will occur where those alveoli have areas
of naked basement membrane. Second, the abnormally high surface tension will decrease
the hydrostatic pressure within the alveolar lining ﬂuid below the air-ﬂuid interface
(Guyton and Moffatt, 1981). Pressure gradients between the vascular and interstitial
compartments and the alveolar space will increase causing water movement into alveolar
airspace and leading to alveolar ﬂooding. Third, the deﬁciency of SP-A can affect
Surfactant turnover as SP-A serves as a ligand for the uptake and reprocessing of pre-

viously secreted surfactant by alveolar epithelial cells (Wright et al., 1987).

3. 2.5 Loss of the Alveolar Progenitor Cells

15

 

Type 11 cells
whereas Type
damaged area
and differenti:
ope ll cells It
The regenerat
normal healing
FEE-W ding the 1

failure of reepi

3.2.6 L.
Tll‘e ll cells,
COmpaﬂmem b
the Sodium-pm
Strrface 0f the
Process “as fr re

Type 11 cells are known to serve as the progenitor cells for the alveolar epithelium
whereas Type I cells are terminally differentiated and do not proliferate (Uhal, 1997). In
damaged areas of the alveolar surface where type I cells are lost, type 11 cells proliferate
and differentiate into type 1 cells. If the injury to the alveolar surface is too severe for
type II cells to survive, the potential for reconstituting a normal alveolar surface is lost.
The regeneration and reepithelialization of the normal alveolar wall are critical for
normal healing without the consequence of ﬁbrosis. Hence, the current presiding view
regarding the mechanism of ﬁbrogenesis holds that IPF results from epithelial injury and

failure of reepithelization (Selman et al., 2001).

3.2.6 Loss of Active Transport Properties
Type 11 cells, and probably type 1 cells, help to maintain a relatively dry alveolar
compartment by clearing ﬂuid within the compartment via active transporter coupled to
the sodium-potassium ATPase. The sodium-potassium ATPase located on the basolateral
surface of the cells pumps sodium ions out of the cell into the interstitial space. This
process was ﬁrst noted through tissue culture studies which demonstrasted domes formed
by monolayers of type 11 cells (Mason et al., 1982; Goodman and Crandall, 1982). These
domes are caused by accumulation of the ﬂuid from the media under the monolayer as a
result of import of sodium molecules and accompanying water. Consequently, the
trapped ﬂuid lifts up the monolayer and form domes (Goodman et al., 1983; Cott et al.,
1986). Studies have also been performed on intact lungs and conﬁrmed that solute
molecules can be removed from the alveolar space against concentration gradients

(Bassett et al., 1987; Matthay and Wiener-Kronish, 1990). Therefore, damage to or loss

 

of the ﬁlled:

ability of“ 1'

3.2.7 1
Plasmlnoge" a
Alveolar epllh‘
ultra-alveolar l
as nbanogen ls
ll alveolar cell:
1985) come”
The clearance 1
(Sitrin et al.. 1‘
fashion. it is pr
“ill attach to
interstitial colla,
of pulmonary ﬁt

The fate of th

of the alveolar epithelium would destroy the active transport system and impair the

ability of the lung to clear ﬂuid from the alveolar space.

3. 2. 7 Loss of the ability to clear intro-alveolar ﬁbrin and regulate the
plasminogen activation system:
Alveolar epithelial cells are in part responsible for both the formation and clearance of
intra-alveolar ﬁbrin. When alveolar epitheliums are damaged, plasma components such
as ﬁbrinogen leak into the alveolar space. Tissue factors expressed on the surface of type
II alveolar cells (Gross et al., 1991) and alveolar macrophages (McGee and Rothberger,
1985) convert ﬁbrinogen to ﬁbrin, which can act as scaffolds for ﬁbroblast migration.
The clearance of this intra-alveolar ﬁbrin is critical to the outcome of the lung injury
(Sitn'n et al., 1987; Brown et al., 1989). If extravascular ﬁbrin is cleared in an orderly
fashion, it is possible to reconstitute the normal alveolar space. Otherwise, ﬁbroblasts
will attach to and migrate along the remaining ﬁbrin leading to the deposition of
interstitial collagens and obliteration of the alveolar space, which are the characteristics
of pulmonary ﬁbrosis.
The fate of the newly formed ﬁbrin in alveolar space depends on whether the
proﬁbrinolytic and antiﬁbrinolytic processes within the alveolar compartment is
balanced. The ﬁbrinolytic process is mediated by the plasminogen activation system,
which tissue-type plasminogen activator (tPA) and urokinase-type plasminogen activator
(uPA) can activate (Martin et al., 2002). Both tPA and uPA can transform the
plasminogen to plasmin, the primary ﬁbrinolytic enzyme responsible for degrading ﬁbrin.

uPA is considered to be the major contributor for the ﬁbrinolytic activity within

17

bronchoalveolar lavage ﬂuid from normal lungs (Chapman et al, 1986; Hasday et al.,
1988; Idell et al., 1989). In IPF the plasminogen activation system has been implicated to
regulate ﬁbrin turnover and ECM degradation (Simon et al., 1995). The antiﬁbrinolytic
process is mediated by plasminogen activator inhibitors (PAIs), which negatively
regulate the activity of plasminogen and thus plasmin. Studies using animal models
suggest that overexpression of PAIs (inhibiting plasmin activity) promotes ﬁbrosis,
whereas lack of PAIs (allowing greater plasmin activity) prevents the formation of
signiﬁcant ﬁbrosis (Eitzman et al, 1996). Epithelial cells control the balance between
ﬁbrolytic and antiﬁbrolytic process by synthesizing both urokinase (Gross et al., 1990)
and plasminogen activator inhibitor-1 (Gross et al., 1990, 1991; Simon et al., 1992;
Hasegawa 1997). Epithelial cells express urokinase that activates the plasminogen
present within the plasma clot. Alveolar epithelial cells also express cell surface receptors
for urokinase, which contain the ﬁbrinolytic activity on the cell surface.

Normal alveolar epithelium is efﬁcient in clearing intra-alveolar ﬁbrin and
proﬁbrinolytic. However, damaged alveolar epithelial cells often show impaired ability to
remove intra-alveolar ﬁbrin. For example, the ﬁbrinolytic activity of bronchoalveolar
lavage ﬂuid from IPF patients was deﬁcient (Chapman et al., 1986). The compromised
ﬁbrinolysis was due to a decreased level of urokinase protein and an increased level of
the inhibitors for urokinase and plasmin, an imbalance between proﬁbrinolytic and
antiﬁbrinolytic processes (Chapman et al., 1986). Kotani et al showed that BAL ﬂuid
from patients with IPF contains signiﬁcantly greater amounts of tissue factor and PAIs
than normals whereas uPA levels were similar between the two groups (Kotani et al.,

1995). Combined together, those studies suggest that the alveolar microenvironment in

18

IPF favors a pro-coagulant, anti-ﬁbrinolytic state promoting ECM accumulation and

retarding alveolar re-epithelialization.

3. 2.8 Abnormal AE Cs as a primary source of proﬁbrotic cytokines
Dying or abnormal AECs in IPF synthesize numerous growth factors and cytokines that
activate ﬁbroblasts and mesenchymal cells. AECs are the primary source for
transforming growth factor-beta (TGF-B) which transdifferentiate normal ﬁbroblasts into
the myoﬁbroblast producing most of the ECM in the ﬁbrotic lungs (Khalil et al., 1996).
Additionally, AECs produce ANG II, platelet-derived growth factor (PDGF) (Antoniades
et al., 1990), tumour necrosis factor alpha (TNF-u.) (Kapanci et al., 1995), and
endothelin-l (Giaid et al., 1993). PDGF is a potent rrritogen and chemoattractant for
ﬁbroblasts. The mRNA and protein level of PDGF have been shown to be upregulated in
epithelial cells of patients with IPF (Antoniades et al., 1990). TNF-a promotes DNA
synthesis and proliferation of ﬁbroblasts (Battegay et al., 1995) and was secreted by
hyperplastic type II AECs in pulmonary ﬁbrosis (Kapanci et al., 1995; Nash et al., 1993).
Endothelin-l has also been shown to stimulate ﬁbroblast DNA synthesis and proliferation
as well as to induce transdifferentiation of ﬁbroblasts to myoﬁbroblasts (Shahar et al.,
1999). The various ﬁbrosis-promoting effects of those factors produced by damaged
AECs support the view that death of the AECs within alveolar epithelium can be

regarded as proﬁbrotic and could initiate a ﬁbrotic lesion.

4. Apoptosis of AECs is involved in pulmonary ﬁbrogenesis

4.1 General information about apoptosis:

19

 

There
death
necros
proces
cellula
death.
enzym
(I'hal .'
c_\t0pla
311011101
from Its
un“ante
cell rem

1. SUll’lerI

There are two kinds of cell deaths in alveolar epithelium: necrosis and programmed cell
death also known as apoptosis. The morphological and biochemical characteristics of
necrosis and apoptosis are different. Necrosis is considered as a passive and un-regulated
process associated with inﬂammation which results in disintegration of membrane and
cellular organelles (Saraste and Pulkki, 2000). In contrast to necrosis or "accidental" cell
death, apoptosis is an active form of cell death that requires the activation of speciﬁc
enzymes such as caspases, endonucleases and other components of signaling pathways
(Uhal 2002). Apoptotic cells often are characterized with intact cell membrane, shrunk
cytoplasm and fragmented DNA. These hallmarks are commonly used to identify
apoptotic cells (Allen et al., 1997). Apoptosis results in single cell death and deletion
from tissues with minimum inﬂammation. By doing so, apoptosis leads to the removal of
unwanted or damaged cells. As apoptosis is a highly regulated physiological process of
cell removal, it plays a fundamental role in the homeostatic control of cell population

(Sutherland et al., 2001).

4.2 Epithelial cell apoptosis in ﬁbrotic lungs
A relatively small increase in the incidence of apoptosis within a given cell population
can result in considerable cell loss over time. Therefore, a seemingly minor upregulation
of apoptosis is theoretically capable of accounting for the excessive loss of AECs and the
failure of the reepithelization characteristic of pulmonary ﬁbrosis. Recent studies strongly
suggested a role for epithelial apoptosis as a key proﬁbrotic event in lung ﬁbrogenesis.

Evidence in support of this viewpoint is summarized below.

20

 

First. at
models
bronchir
1996) at
et al.. 1‘
labeling
biopsies
epitheliu;
positive 1'
myofibro
fccentl),
Filho er al
Consisten
AECS vvit
et al.. 199
SOlUble Fa
6131. 2C 103
Showed 91‘
induced Pu
the [mind
1997).
Second. ind

In animal p

First, apoptosis of AECs is found both in the lungs of patients with IPF and in animal
models of the disease. Fragmented DNA, a hallmark of apoptosis, was found in
bronchiolar cells and AECs within lung biopsies from patients with IPF (Kuwano et al.,
1996) and in the lungs of mice and rats with bleomycin-induced lung ﬁbrosis (Hagimoto
et al., 1997; Wang et al., 2000). This ﬁnding was conﬁrmed by simultaneous double
labeling of fragmented DNA and a-smooth muscle actin, a marker for myoﬁbroblasts, in
biopsies from patients with IPF (Uhal et al., 1998). Fragmented DNA in the alveolar
epithelium was found frequently and immediately adjacent to u-smooth muscle actin-
positive interstitial cells and foci of collagen. Thus epithelial apoptosis colocalizes with
myoﬁbroblasts where collagen deposition is severe, at least in patients with IPF. Very
recently, apoptosis within AECs of ﬁbrotic human lungs was reconﬁrmed by Barbas-
Filho et a1. (Barbas-Filho et al., 2001), also through the detection of fragmented DNA.
Consistent with those ﬁndings, the "death receptor" Fas was found to be expressed in
AECs within the lungs of IPF patients by several independent research groups (Kazufumi
et al., 1997; Domagala—Kulawik et al., 2000). Thereafter, increased circulating levels of
soluble FasL were shown to correlate with disease activity in patients with IPF (Kuwano
et al, 2002). In animal models, similar observations were obtained; Hagimoto et al. (1997)
showed epithelial apoptosis and upregulation of Fas on the epithelium in bleomycin-
induced pulmonary ﬁbrosis in mice. Another study demonstrated that Fas is expressed on
the luminal surface of a subset of alveolar type 11 cells in the mouse model (Fine et al.,
1997)

Second, induction of apoptosis in the epithelium is sufﬁcient to initiate a ﬁbrotic response

in animal models. Hagimoto et a1. (1997) showed that intratracheal instillation of an

21

 

antibody

express 1

knockout

effect of

developrr
instillatio
Show in

the devel
pathuats
Third. ph;
al. (Wang
Could be r
d311," intr
lZVADfm
i“duction
“mg the
Strategy 1.
Dummy}

antibody that activates Fas-induced apoptosis of bronchial and AECs (both of which
express Fas constitutively) initiated a ﬁbrotic response detectable 1 wk later. Moreover,
knockout mice deﬁcient in the receptor Fas were found to be resistant to the proﬁbrotic
effect of bleomycin (Kuwano et al., 1999). However, another study found that the
development of bronchiolar and alveolar epithelial apoptosis and ﬁbrosis after bleomycin
instillation in the lungs in Fas-null lpr mice and gld mice was similar to development
shown in wild-type mice (Aoshiba et al., 2000). Thus the role of Fas-induced apoptosis in
the development of the pulmonary ﬁbrotic response is still controversial; in addition,
pathways other than F as can initiate epithelial apoptosis and facilitate ﬁbrogenesis.

Third, pharmacological blockade of apoptosis can prevent the ﬁbrotic response. Wang et
al. (Wang et al, 2000) ﬁrst found that bleomycin-induced accumulation of lung collagens
could be blocked by the angiotensin-converting enzyme (ACE) inhibitor captopril or by
daily intraperitoneal injections of N-benzylcarboxy-Val-Ala-Asp-ﬂuoromethylketone
(ZVADfmk), a broad-spectrum inhibitor of caspases (cysteine proteases) required for the
induction of apoptosis. Soon thereafter, Kuwano et a1. (2001) conﬁrmed the blockade by
using the same caspase inhibitor (ZVADfmk) administered by aerosol to mice. Another
strategy to interrupt AEC apoptosis proved effective in blocking bleomycin-induced
pulmonary ﬁbrosis; Inoshima et al (2004) showed that the forced expression of p21,
predominantly in lung epithelial cells, exerted both antiapoptotic and antiﬁbrotic effects.
Thus the blockade of collagen deposition in vivo by inhibitors of apoptosis suggests that
the ﬁbrotic response is secondary to the apoptotic death of certain lung cell types. This
premise in turn is consistent with the theories put forth by Witschi (1990) and Adamson

and Bowden (1976) that alveolar reepithelialization is necessary to prevent subsequent

22

ﬁbrogenesis after lung injury. Other data consistent with this theory include studies of
keratinocyte growth factor (KGF), a potent proliferation and differentiation factor for
alveolar type 11 cells known to promote alveolar epithelial repair (Stern et al., 2003). Both,
KGF and the related hepatocyte grth factor (HGF) prevented bleomycin-induced lung
ﬁbrosis in rats and mice (Yi et al., 1996; Deterding et al., 1997; Sugahara et al, 1998; Yi

et al., 1998; Dohi et al., 2000).

4.3 Mechanism and signaling of epithelial apoptosis in ﬁbrotic lung

Alterations in the expression of various antiapoptotic and proapoptotic factors likely
regulate apoptosis of AECs. The proapoptotic factors p53 and p21 are upregulated in
bronchiolar and AECs within lung biopsy specimens from patients with IPF and in
bleomycin-induced pulmonary ﬁbrosis animal models (Kuwano et al, 1996; Kuwano et
al., 2000). Upregulation of the proapoptotic factor BAX in patients with diffuse alveolar
damage and in bleomycin-induced pulmonary ﬁbrosis may enhance the susceptibility of
AECs to apoptosis (Guinee et al., 1997; Kuwano et al., 2000).

In vitro studies of epithelial cell lines or primary cells showed that JNK, a member of the
MAPK family is involved in stress-induced apoptosis. Activation of JNK (Adler et al.,
1995: Janssen et al., 1999; Lander et al., 1996) leads to phosphorylation of its targets, c-
Jun and activating transcription factor (ATF)-2 (Ip et al., 1998; Schaeffer et al., 1999),
and activation of downstream gene expression when epithelial cells are exposed to
oxidative stress, which is avery important contributor to pulmonary injury and ﬁbrosis.
An in vivo study of p38 MAPK in bleomycin-induced pulmonary ﬁbrosis showed that

p38 MAPK and its substrate, ATF-2, were phosphorylated in BAL ﬂuid cells after

23

intratracheal instillation of bleomycin. The phosphorylation of ATF-2 was inhibited by
subcutaneous administration of a speciﬁc inhibitor of p38 MAPK, FR-167653. FR-
167653 also prevented the apoptosis of lung cells and ﬁbrosis induced by bleomycin
administration (Matsuoka et al, 2002). Signaling pathways that can contribute to the
apoptosis of AECs in IPF patients were investigated by Yoshida et al. (2002), who found
that active ERK was decreased and active JNK was increased in epithelial cells and was
accompanied by the progression of ﬁbrosis. Activated p38 MAPK in epithelial cells was
increased at the intermediate stage of ﬁbrosis, in which the TUNEL-positive cells were

predominantly detected (Yoshida et al., 2002).

5. Renin-Angiotensin System
5.1 General information

The conventional renin-angiotensin system (RAS) is an endocrine system known to
regulate ﬂuid homeostasis, electrolyte metabolism and blood pressure etc. Renin, an
aspartyl protease, is secreted by the granular cells of the juxtaglomerular apparatus of the
kidney. Synthesis and release of renin into the circulation is considered as the rate-
limiting step of the RAS and is activated by decreased renal perfusion and plasma sodium
concentration. Angiotensinogen (ANGEN), the precursor for angiotensin II (Ang II), is
secreted by the liver and cleaved by circulating renin to form the decapeptide:
angiotensin I (Ang I). Angiotensin converting enzyme primarily located at the endothelial
surface of pulmonary capillaries converts Ang I to an octapeptide Ang II. Ang II is
considered the primary effector molecule of the RAS (Bader et al., 1994; Griendling and

Alexander, 1994).

24

5.2 Effects of Angiotensin II
ANG II exerts its effects through at least two subtypes of Ang 11 receptors, AT] and AT2.
These receptors are G-protein coupled receptors that have seven transmembrane domains
(Murphy et al., 1991; Sasaki et al., 1991). The majority of physiological and
pathophysiologic functions of ANG II are mediated by ATI receptors. Those effects
include, but are not limited to: l) Vasoconstriction in arterial smooth muscle and
concomitant increase of blood pressure; 2) Secretion of aldosterone from the adrenal
gland, which increases renal SOdlM‘ reabsorption; 3) Facilitated release of
catecholamines in the sympathetic nerve, which increases cardiac output and total
peripheral resistance and blood pressure; 4) Elevated sympathetic nerve activity and
vasopressin secretion in the brain; 5) Enhanced cardiac contractility and ventricular
hypertrophy; 6) Remodeling of the vascular wall resulting in increased total peripheral
resistance (Geisterfer et al., 1988; Robertson and Nicholls, 1993); and 7) Direct action
on the renal tubular cells to promote sodium and water reabsorption in the kidney
(Deshmukh et al., 1998). ANG II is also proposed to play an important role in the

pathogenesis of lung injury that will be discussed later in this chapter.

5.3 Angiotensin 11 signal pathway

There exist several signaling pathways to transduct the effects of ANG II (Timmerrnans
et al., 1993; Lee and Severson, 1994). AT] receptor-mediated signaling pathways have

been more extensively studied than that AT2 mediated. ATl receptors are guanine

25

 

nucleo
mediat
1)
The bi
phospl‘
(PIP2)
binds t.
the rele
activate
the cm
Which
calmed
kinases
also act
Phosph;
PhOSphr
p hOSPh:
leardjng
phl'Siol,
2; A
AT] rec
Wovens

PIOsragIa

nucleotide-binding regulatory proteins (G proteins)-coupled. The signaling pathways
mediated by ATI receptors are as follows:
1) Increases intracellular [Caz +1 :
The binding of ANG II to AT] receptors activates the Gq protein and consequently
phospholipase C-beta (PLCB). PLC B hydrolyzes phosphatidylinositol-4, 5-bisphosphate
(PIP2) to generate inositol-l, 4, 5-trisphosphate (1P3) and diacylglycerol (DAG). 1P3
binds to receptors on IP3-sensitive organelles with intracellular Ca2+ stores and stimulates
the release of intracellular Ca2+. In addition, binding of ANG II to AT1 receptor directly
activates the cytoplasmic membrane-bound Ca2+ channels to allow the inﬂux of Ca2+ into
the cytoplasm. Both pathways lead to the elevation of intracellular Ca2+ concentration,
which produce a variety of effects. Then Ca2+ binds to calmodulin, and the Ca2+/
calmodulin complex activates a number of intracellular enzymes, such as ATPase and
kinases that contribute to the cellular response. The binding of ANG II to ATl receptors
also activates phospholipase D (PLD), which hydrolyzes phosphatidylcholine to generate
phosphatidic acid. Phosphatidic acid is then transformed into DAG by phosphatidate
phosphohydrolase. DAG derived from phosphatidylcholine through PLD and
phosphatidylinositol-4, 5-bisphosphate through PLC activates protein kinase C (PKC)
leading to the phosphorylation of downstream proteins and cascade events to produce
physiological response.
2) Increases Arachidonic Acid metabolites:

AT1 receptor activation also stimulates activation of phospholipase A2 (PLA2), which
converts phosphatidylcholine to arachidonic acid. Arachidonic acid is metabolized to

prostaglandins and thromboxane A2 by cyclooxygenase and to hydroxyeicosatetraenoic

26

 

acids and IC

 

activate a con
3) Decre.

In some cells
(onandsube
of intracellula
inhibited activ
of substrates ft
4) Increw
Activation of
expression of t
such as AP] (
STATts) active
proteins such a
In addition. int
DNA associate

PDGFrRe.200

acids and leukotrienes by lipoxygenase. Those metabolites of arachidonic acid then
activate a complex of cellular signaling pathways.

3) Decrease intracellular [CAMP]:
In some cells AT1 receptor activation leads to the activation of the inhibitory G-protein
(Gi) and subsequently inhibition of adenylyl cyclase activity and thus the decreased level
of intracellular cyclic AMP (CAMP). Decreased intracellular [CAMP] level leads to the
inhibited activity of protein kinase A (PKA) and thereby supressed phosphorylation state
of substrates for PKA causing corresponding biological effect.

4) Increases growth factors production:
Activation of AT] receptors by ANG II stimulates cell growth by regulating gene
expression of transcriptional factors of MAP kinase and JAK tyrosine kinase(s) pathway
such as AP] (F05 and Jun) and STAT(s) (Bhat et al., 1994). AP] (Fos and Jun) and
STAT(s) activate the transcription of a number of growth factors and extracellular matrix
proteins such as TGF [3 and collagen.
In addition, internalized ANG 11 together with intracellular ANG II can directly bind to
DNA associated AT] like receptors and regulate gene transcriptions of renin, ANGEN.

PDGF (Re, 2004).

6. Pulmonary angiotensin system in idiopathic pulmonary ﬁbrosis

6.1 Local pulmonary angiotensin system:
Recently a few studies suggested the existence of “local” angiotensin systems in various
organs and tissues. For example, the ANG 11 concentrations in the interstitial

compartment of heart and eye were found to be 5-100 fold higher (about 50 —500pM)

27

than that in plasma (~5-10pM) (van Kats et al., 1998; Danser et al., 1994). The higher
interstitial levels of ANG 11 compared to the circulating level could not be explained by
diffusion and/or receptor-mediated uptake of circulating angiotensin 11. These results
thereby suggest that tissue angiotensin II is largely, if not completely, synthesized locally.
Furthermore, cultured cells from various organs including heart (Lindpaintner et al.,
1988), vascular endothelium (Li et al., 1999), brain (Campbell et al., 1986; Dzau et al.,
1982; Ohkubo et al., 1986) and lung (F ilippatos et al., 2001) were shown to express the
RAS components such as ANGEN, ANG II and their corresponding converting enzymes
and angiotensin receptors. In contrast to the classical endocrine system of RAS in which
angiotensin II is delivered to tissues via circulating blood, local angiotensin systems can
be from either “intrinsic “(independent of the endocrine RAS) or “extrinsic” (relying on

the endocrine RAS as its components sources) sources.

6.2 Pulmonary angiotensin system components:
The local pulmonary angiotensin system appears to consist of ANGEN, ANG I, ANG II
and their corresponding converting enzymes and angiotensin receptors.
6.2.1 ANGEN:

It was shown that two types of cells in the lung could produce ANGEN in vitro
under certain conditions: AECs and myoﬁbroblasts. For example, primary AECs could
synthesize and secrete ANGEN, which was converted to ANG II when undergoing
apoptosis induced by Fas ligand (Wang et al., 1999), TNF-alpha (Wang et al., 2000),
amiodarone (Bargout et al., 2000) and bleomycin (Li et al., 2003). Primary

myoﬁbroblasts isolated from ﬁbrotic human lungs (IPF biopsies) expressed the ANG II

28

precursor ANGEN mRNA and protein (Wang et al., 1999), suggesting that human lung
myoﬁbroblast can synthesize ANGEN in culture. Furthermore, preincubation of the
culture medium of myoﬁbroblast with puriﬁed renin and ACE increased the Enzyme-
Linked Immunosorbent Assay (ELISA)- detectable ANG 11 concentration eight folds,
indicating that there are abundant ANGEN synthesized constitutively waiting to be
converted to AN G II (Wang et al., 1999). Despite of evidence from in vitro studies, there

is no in vivo study demonstrating the existence of lung-derived ANGEN.

6.2.2 Renin and Renin- like enzymes:

Production of the local angiotensin systems can use elements that are “extrinsic” such
as relying on the renin from the endocrine RAS. In many organs and tissues such as the
heart and vessel wall, the synthesis of local ANG II was shown to depend on the uptake
of circulating renin and/ or prorenin either via diffusion into the interstitial space or
through binding to prorenin receptors (Re, 2004). No renin mRNA has been detected in
the lungs and it is unclear whether there exists samilar mechanism in the lung to locally
produce ANG 11. Nevertheless, there exist non-renin proteases capable of generating
angiotensins in the lung such as cathepsin D. Cathepsin D might be responsible for the
synthesis of generating angiotensin I from ANGEN and subsequent synthesis of ANG II
in some cells like vascular interstitial cells (Weber et al., 1995). Other proteases, such as

the enzyme tonin, can also generate angiotensin I from angiotensinogen (Re, 2004).

6.2.3 ACE and ACE-like enzymes:

29

There exist two forms of ACE. One is membrane-bound and the other is soluble. The
membrane-bound ACE is attached to the plasma membrane of endothelial cells via a
short hydrophobic sequence at the C-terminus and is found in most organs. The soluble
ACE, detached form of the membrane-bound ACE, is found in most of the body ﬂuid
including lymph, plasma, cerebrospinal ﬂuid and amniotic ﬂuid (Erdos, 1990). The
soluble form lacks the hydrophobic terminus and is derived from the membrane-bound
form via post-translational cleavage by an ACE-secretase. Membrane-bound ACE is
abundantly expressed by the vascular endothelium of the pulmonary circulation and is
primarily responsible for the conversion of ANG I to ANG II in the circulation (Oparil et
al., 1971). The extent of the conversion of ANGI to ANG II is a function of the vascular
surface area and the transit time of blood circulating through the lung (Oparil et al.,
1971). The contribution of soluble ACE to ANG II generation is negligible (N g and Vane
1968; Admiraal et al., 1993).

Primary cultures of AECs were shown to express the ACE mRNA (Wang et al., 1999a,
b). Other non-ACE enzymes that also convert angiotensin I to angiotensin 11 include
chymase found in human cardiac tissue, cathepsin G and ACE2, a recently described

enzyme (Re, 2004).

6.2.4 Angiotensin II receptors:
Bullock et al. demonstrated that in the human lung AT1 receptor mRNA and protein were
localized on vascular smooth muscle cells, macrophages and in the stroma underlying the
airway epithelium, possibily relating to underlying ﬁbroblasts (Bullock et al., 2001).

However, the AT] receptor protein was not detected in the epithelium although there was

30

 

a lovv 16"51 O
the within“
underlying ’1
study. h Owev
(Bullock 3‘ a
localized 0“
endothelial C
increased ”13
generate lib“

pulmonarl' Iii”

6.3 Potent
6.3.1 P
Purified ANG
This ellect ml
apoptosis of A
2000). amiodl
angiotensin s_\
oligonucleotide

(AI receptor)

inducers of alt.

 

induced bv- Fa~

 

a low level of mRNA. In contrast, AT2 receptor RNA and protein was strongly stained in
the epithelium, particularly on the bronchial epithelial cell brush border and the
underlying mucous glands as well as some endothelial cells (Bullock et al., 2001). This
study, however, did not exam the AT] and AT2 receptors in the alveolar epithelial cells
(Bullock et al., 2001). Consistently, another study on rat lung reported that AT] was
localized on alveolar macrophages, alveolar type II cells, vascular smooth muscle cells,
endothelial cells and ﬁbroblasts (Otsuka et al., 2004). AT] expression in the lung
increased markedly after intratracheal administration of BLM, which is known to
generate ﬁbrosis, suggesting that angiotensin II as a ligand of AT] is involved in

pulmonary ﬁbrosis (Otsuka et al., 2004).

6.3 Potential roles of pulmonary AN G 11 in pulmonary ﬁbrosis:
6.3.1 Pulmonary angiotensin system is linked to lung epithelial apoptosis:
Puriﬁed ANG II was shown to induce apoptosis of AECs in culture (Wang et al., 1999).
This effect was mediated by AT] receptors (Papp et al., 2002). It was also shown that
apoptosis of AECs induced by Fas Ligand (Wang et al., 1999), TNF-alpha (Wang et a1
2000), amiodarone (Bargout et al., 2000) and bleomycin (Li et al., 2003) required
angiotensin synthesis de novo as AECs apoptosis could be blocked by the antisense
oligonucleotides against mRNAs of the ANGEN, ACE inhibitors, and ANG II receptor
(AT receptor) antagonists in vitro. Furthermore, human lung myoﬁbroblast—derived
inducers of alveolar epithelial apoptosis were identiﬁed as angiotensin peptides (Wang et
al., 1999). These data suggest that ANG II is the “Master Switch” for apoptosis of AECs

induced by Fas Ligand, TNF-alpha, amiodarone and bleomycin. This “Master Switch”

31

 

function of
in ﬁbrogene:

fibrosis.

6.3.2

   
  
  
  

ANG II stimt
receptor and t
al.. 2000). A

vitro via AT]

 

 

 

function of ANG II for AECs apoptosis could account for the role of angiotensin system
in ﬁbrogenesis since apotosis of AECs is essential for the development of pulmonary

ﬁbrosis.

6. 3.2 Mitogenic for ﬁbroblasts and Activate T GF beta expression:
ANG II stimulates fetal and adult human lung ﬁbroblast proliferation in vitro via the AT1
receptor and the autocrine action of transforming growth factor beta (TGF [3) (Marshall et
al., 2000). ANG II also increased procollagen synthesis by human lung ﬁbroblasts in

vitro via AT] receptors (Marshall et al., 2000).

6.3.3 Inhibition of the ﬁbrinolytic pathway:
Mice with deﬁcient ﬁbrinolytic system developed pulmonary ﬁbrosis in response to
bleomycin, suggesting that IPF could result from compromised ﬁbrolytic capability
(Swaisgood et al., 2000). Plasminogen activator inhibitor 1 (PAI-l) inhibits plasmin and
subsequently decreases the ﬁbrinolytic capability promoting the deposition of collagen
and other extracellular matrixs in bleomycin-induced lung injury in animal models
(Eitzman et al., 1996; Swiderski et al., 1998). ANG II has been shown in rat microvessel
endothelial cells to control thrombosis by inducing, PAI-l, the inhibitor for extracellular
matrix turnover and ﬁbrinolysis (N ishimura et al., 1997). In addition, in a rat model used
to investigate the cardiac vasculopathy mediated by nuclear factor-KB and activator
protein-1, ANG II was shown to regulate the thrombogenic pathway by increasing the

expression of tissue factor which can convert ﬁbrinogen into ﬁbrin (Muller et al., 2000).

32

 

Hence. AN('

and induce a

6.3.4
HGF has bee
suggesting t}
Taniyama e1
prevented ms
for local 11

dounregulatir

6.4 Angie
The angiotens

6”ch5 and

 

much evidenc

6.4.1. 1
A number of s
Peptide Were 11
upregulated in
increased in the
Pulmonan.

. ﬁbr

1990). thcm

Hence, ANG II can break the balance between the ﬁbrolytic and antiﬁbrolytic process

and induce an environment favoring the deposition of collagen.

6.3.4 Downregulation of hepatocyte growth factor (H GP) expression:
HGF has been shown to be important in suppressing bleomycin-induced ﬁbrosis in mice,
suggesting the antiﬁbrotic function of HGF (Yaekashiwa et al., 1997). Furthermore,
Taniyama et al. (2000) using a cardiomyopathic hamster model showed that HGF
prevented myocardial ﬁbrosis and that both ANG II and TGF-beta are strong inhibitors
for local HGF production. Therefore, ANG 11 may have proﬁbrotic role by

downregulation of the hepatocyte growth factor (HGF) expression in the lung.

6.4 Angiotensin system is involved in pulmonary ﬁbrosis:
The angiotensin system consists of ANGEN, ANGI, ANG 11, corresponding converting
enzymes and angiotensin 11 receptors (Proudn 199]; Filippatos et al., 200]). There is

much evidence suggesting that angiotensin system is involved in pulmonary ﬁbrosis.

6.4.1. Increased levels of converting enzymes and A T I receptors in IPF
A number of studies show that enzymes required for the production of local angiotensin
peptide were upregulated in pulmonary ﬁbrosis. ACE which converts AN G1 to ANG II is
upregulated in both human and animal ﬁbrotic lungs. ACE activity was shown to be
increased in the bronchoalveolar lavage ﬂuid (BALF) of animals with bleomycin-induced
pulmonary ﬁbrosis (V enkatesan, et al.1997) and human patient with IPF (Specks et al.,

1990). Furthermore, bleomycin upregulated gene expression and enzyme activity of ACE

33

in bovine pulmonary artery endothelial cells (BPAEC) (Day, et al., 2001). Those data
suggest ACE may play a critical role in development of pulmonary ﬁbrosis. In addition,
the study to examine the incidence of D allele of the insertion/ deletion (I/D)
polymorphism of ACE in patients with interstitial pneumonia and moderate to severe
pulmonary ﬁbrosis showed that the incidence of the D allele which confers a higher ACE
expression was approximately 15% higher in the study population than in the general
population (Morrison et al., 2001). Although the sample size is limited, these data
indicate that polymorphisms that confer higher levels of ACE predispose patients to lung
ﬁbrosis and thus support the hypothesis that ACE and its product ANG II are involved in
the pathogenesis of human pulmonary ﬁbrosis.

Cathepsin D (Cat D) is one of the enzymes capable of cleaving ANGEN to ANG 1. Cat D
was upregulated in both animal and human ﬁbrotic lung. Our lab showed that Cat D
immunolabeling in alveolar wall cells morphologically consistent with type I and type 11
cells increased following intratracheal administration of bleomycin. Meanwhile, soluble
Cat D enzymatic activity was elevated in cell-free bronchoalveolar lavage ﬂuid (BALF)
from the same lungs. Upregulation of Cat D was also been shown in human lungs from
PF patients (Kasper et al., 1996) and was induced in L132 lung cells during apoptosis
(Kasper et al., 1999).

AT] receptors were also upregulated in animal ﬁbrotic lung (Otsuka et al., 2004). AT]
expression in the lung increased markedly after intratracheal administration of bleomycin,
suggesting that angiotensin II as a ligand of AT] is involved in pulmonary ﬁbrosis

(Otsuka et al., 2004).

34

6.4.2. Blockade of experimental lung ﬁbrosis by angiotensin system antagonists
Application of ACE inhibitor, which presumably inhibits ANG 11 production, has been
shown to attenuate experimental pulmonary ﬁbrosis in animal models induced by various
agents. For example, ACE inhibitor captopril exerted inhibitory effects on monocrotaline
(Molteni et al, 1985) as well as y irradiation-induced lung ﬁbrosis in rats (Ward et al,
1990). Captopril also inhibited the proliferation of human lung ﬁbroblast in vitro
(Nguyen et al., 1994). More recently, the AT] receptor-selective antagonists L158809 as
well as the nonthiol ACE inhibitor enalapril were shown to have similar effects on
radiation-induced pulmonary ﬁbrosis in rats (Molteni et al., 2000). Uhal et al
demonstrated that captopril prevented collagen deposition in bleomycin-treated rats
(Wang et al., 2000). It was later shown that captopril and AT] selective antagonist
losartan blocked the amiodarone induced pulmonary ﬁbrosis in rats. (Uhal et al., 2002)
These results combined together indicate that ANG 11 plays an important role in lung

ﬁbrogenesis via AT1 -receptor.

6. 4.3. Blockade of apoptosis by ACE inhibitor captopril or caspases inhibitors
blocks pulmonary ﬁbrosis
Caspase is one of the key enzymes mediating apoptosis. Collagen deposition and
epithelial apoptosis were blocked by both captopril and ZVADﬁnk, a broad-spectrum
inhibitor of caspases in intratracheally administered bleomycin-induced pulmonary
ﬁbrosis in rats (Wang et al., 2000). Another group conﬁrmed this result by showing that

the same caspase inhibitor delivered by inhalation attenuated bleomycin-induced

35

pulmonary ﬁbrosis in mice (Kuwano et al., 2001). Those results suggest that both ANG II

and epithelial apoptosis are required for lung ﬁbrogenesis.

7. Working hypothesis:

The pulmonary angiotensin system including its components angiotensinogen,
cathepsin D and AT1 receptor plays an essential role in the development of
bleomycin-induced pulmonary ﬁbrosis at least in part through ANG II-ATl
receptor pathway mediated apoptosis of alveolar epithelial cells.

The role of pulmonary angiotensin system during PF can be summarized in the following
ﬁgure (Fig. 1.1):

Lung epithelium apoptosis
inducers: Bleomycin

_ An . t . Antisense of
go ensmogen ANGEN mRNA

CatD?

 

 

4+ Angiotensin I

l ACE ACE inhibitors

-> Angiotensin II /\
AT receptor
a antagonists

Apo ptosis > Fibrosis

 

 

 

 

 

 

Bleomycin induces apoptosis of lung AECs by upregulation of ANGEN gene expression.
Synthesized ANGEN can be converted to ANG I by cathepsin D (Cat D). ANG I can be

further converted to ANG II by ACE. ANG II can induce apoptosis of the AECs through

36

AT1 receptor, which will cause excessive loss of AECs and insufﬁcient epithelial repair.
ANG 11 produced by apoptotic epithelial cells can also directly contribute to the
ﬁbroblast activation. Both ways will lead to lung ﬁbrosis. Synthesis of ANGEN is the
key upstream event in this process, which can be blocked by the antisense against

ANGEN mRNA.

8. Signiﬁcance:

Our study is one of the ﬁrst studies to determine the existence of intrinsic pulmonary
angiotensin system and its role in the development of bleomycin induced pulmonary
ﬁbrosis. This study helps us to better understand the mechanism of lung ﬁbrogenesis with
regard to the pulmonary angiotensin system, which will likely lead us to the ﬁnding of

effective therapeutic or preventive approaches for IPF.

37

Chapter 2

HYPOTHESIS AND SPECIFIC AIMS

Treatment for IPF targeting the suppression of inﬂammation has not been
successful, suggesting that inﬂammation is not the sole mechanism underlying lung
ﬁbrogenesis. Mortality of IPF patients is not dependent on severity of inﬂammation, but
correlates well with the presence of “ﬁbroblastic foci” and adjacent failure of
reepithelization (Selman et al., 200]). The normal alveolar epithelium has “anti-ﬁbrotic”
functions including inhibiting ﬁbroblast proliferation. Loss of alveolar epithelial cells
(AECs) and failure of reepithelization characterized in pulmonary ﬁbrosis can be
considered as proﬁbrotic and are believed to initiate the ﬁbrotic lesion.

The loss of AECs could result from necrosis and/ or apoptosis. Increased level of
apoptosis was found in AECs in experimental and human pulmonary ﬁbrosis. One
indication that the angiotensin system is involved in ﬁbrogenesis is ﬁndings that blockade
of angiotensin systems blocked Pulmonary Fibrosis (PF) at least in several animal models.
Our lab showed that angiotensin II (ANG II) induces apoptosis of the primary AECs
through ANG 11 type I (AT1) receptor in vitro. Apoptosis of AECs induced by Fas
Ligand, TNF-alpha, and amiodarone requires angiotensin synthesis de novo as AECs
apoptosis can be blocked by the antisense oligonucleotide against the mRNA of the
angiotensinogen (ANGEN), angiotensin converting enzyme (ACE) inhibitors, and ANG
II receptor (AT receptor) antagonists in vitro. Taken together, those data suggest that
ANG II, the processed product of ANGEN, is the key to regulate apoptosis of AECs and

subsequent lung ﬁbrosis.

38

The existence of “local angiotensin system” in the lung, which is independent of
the endocrine RAS, is supported by studies demonstrating the expression of angiotensin
system components in cultured primary rat AECs in response to Fas Ligand, TNF-alpha,
and amiodarone and myoﬁbroblasts from human ﬁbrotic lungs. Bleomycin-induced rat
and mouse pulmonary ﬁbrosis model is a well-studied model for ﬁbrogenesis. But there
is much still unknown about the components and roles of pulmonary angiotensin system
in bleomycin-induced pulmonary ﬁbrosis.

Overall Hypothesis:

The pulmonary angiotensin system including its components angiotensinogen,
cathepsin D and AT1 receptor plays an essential role in the development of
bleomycin-induced pulmonary ﬁbrosis at least in part through ANG II-ATl

receptor pathway mediated apoptosis of alveolar epithelial cells.

Speciﬁc Aims:

1) To examine if bleomycin-induced apoptosis of alveolar epithelial cells requires
angiotensin synthesis de novo.

Speciﬁc hypothesis: AEC apoptosis in response to bleomycin (BLEO) requires ANG
synthesis and might be inhibited by ANG system antagonists.
2) To identify the primary aspartyl protease that could convert angiotensinogen to
AN GI and contribute to pulmonary angiotensin system in vitro.
Speciﬁc hypothesis: Cat D is required for ABC apoptosis in response to bleomycin at

least in part by converting angiotensinogen to ANGI.

39

3) To examine if angiotensin receptor ATl is essential for AEC apoptosis and lung
ﬁbrosis in viva.

Speciﬁc hypothesis: Administration of the ATl-selective receptor antagonist and deletion
of the ATla receptor gene block BLEO-induced AEC apoptosis and lung ﬁbrosis.

4) To identify the cellular sources of lung-derived ANGEN in situ:

Speciﬁc hypothesis: The apoptotic type II alveolar epithelial cells and myoﬁbroblasts are
the major cellular sources of lung-derived ANGEN.

5) To examine the effect of blockade of lung-derived AN GEN on pulmonary ﬁbrosis.
Speciﬁc hypothesis: Administration of the antisense against ANGEN messenger RNA

attenuates bleomycin-induced AEC apoptosis and lung ﬁbrosis.

40

Chapter 3

BLEOMYCIN-INDUCED APOPTOSIS OF ALVEOLAR EPITHELIAL CELLS

REQUIRES ANGIOTENSIN SYNTHESIS DE N0 V0

Xiaopeng Li, Huiying Zhang, Valerie Soledad-Conrad, J iaju Zhuang and Bruce D. Uhal

Department of Physiology, Michigan State University, East Lansing, Michigan, 48824

This chapter is published in:

Am J Physiol Lung Cell Mol Physiol. 2003, 284(3): L501-507

41

ABSTRACT

Primary cultures of rat type II alveolar epithelial cells (AECs) or human AEC-derived
A549 cells, when exposed to bleomycin (BLEO), exhibited dose-dependent apoptosis
detected by altered nuclear morphology, fragmentation of DNA, activation of Caspase 3
and net cell loss over time. In both cell culture models, exposure to BLEO caused time-
dependent increases in angiotensinogen (ANGEN) mRNA. Antisense oligonucleotides
against ANGEN mRNA inhibited BLEO-induced apoptosis of rat AEC or A549 cells by
83% and 84%, respectively (p<0.01 and p<0.05) and prevented] BLEO-induced net cell
loss. Apoptosis of rat AECs or A549 cells in response to BLEO was inhibited 91% by the
ACE inhibitor captopril or by 82%, respectively, by neutralizing antibodies speciﬁc for
ANGII (both p<0.01). Antagonists of ANG receptor AT] (losartan, L158809 or
saralasin), but not an AT2-selective blocker (PD123319), inhibited BLEO-induced
apoptosis of either rat AECs (79%, p<0.01) or A549 cells (83%, p<0.01) and also
reduced the activity of Caspase 3 by 52% (p<0.05). These data indicate that BLEO, like
FasL or TNF-a, induces transactivation of ANG synthesis de novo that is required for
ABC apoptosis. They also support the theory that ANG system antagonists have potential

for the blockade of ABC apoptosis in situ.

42

INTRODUCTION

Alveolar epithelial cells (AECs) have many important roles that are critical to normal
lung function (Mason and Williams, 1991). The death of AECs by apoptosis is now
believed to be an important event in the pathogenesis of lung ﬁbrosis (Haschek and
Witschi, 1979) and in more acute lung injury (Matute-Bello et al., 2001; Uhal, 2001). A
variety of investigations have implicated important roles for key molecules such as tumor
necrosis factor alpha (TNF-a) and F as ligand (F asL), both known inducers of apoptosis in
a variety of cell types, in the events that lead to ﬁbrogenesis in the lung (Hagimoto et al.,
1997a; Hagimoto et al., 1997b; Ortiz et al., 1998).

In earlier work (Wang et al., 2000; Wang et al., 1999), we showed that exposure of either
primary cultures of rat AECs or the human AEC-derived A549 cell line to FasL or TNF-a
increases angiotensinogen (ANGEN) mRNA and protein, and evokes its subsequent
conversion to angiotensin II (ANGII). Moreover, we found that transactivation of ANGII
synthesis is required for ABC apoptosis in response to TNF-a or F as ligand. Thus, AEC
death in response to these could agents could be blocked by ANG receptor antagonists or
inhibitors of ANG converting enzyme (ACEis), at least in vitro. Studies of another
inducer of ABC apoptosis, the antiarrythmic agent amiodarone, also showed that
antagonists of ANG production or receptor interaction could prevent apoptosis of AECs
in response to this benzofuran compound (Bargout et al., 2000).

For these reasons we hypothesized that AEC apoptosis in response to bleomycin (BLEO)
might also require ANG synthesis and might therefore be inhibitable by ANG system
antagonists. We report here that bleomycin, if applied to rat or human AECs in vitro,

induces the expression of angiotensinogen mRNA and subsequent apoptosis that can be

43

blocked by ANGEN antisense oligonucleotides, by ACEis or by ANG receptor

antagonists of the ATl-selective subtype.

44

MATERIALS AND METHODS

Reagents and materials: The ATl-selective antagonists L158809 and losartan were
obtained from Merck and Co., West Point, PA. The AT2-selective antagonist PD123319
was obtained from Parke Davis Research Division, Ann Arbor, MI. The caspase inhibitor
ZVAD-fink (N-benzylcarboxy-Val-Ala-Asp- [O-Me]-CH2F) was obtained from Kamiya
Biomedical, Seattle, WA. DEVDfmk (Asp-Glu-Val-Asp- [O-Me]-CH2F) was obtained
from Pharrningen, San Diego, CA. Alkaline phosphatase-conjugated streptavidin,
digoxigenin-labeled deoxyuridine trisphosphate (dig-dUTP) and biotinylated
deoxyuridine trisphosphate (bio-dUTP) were obtained from Boerhinger Mannhiem,
Indianapolis, IN. Bleomycin (BLEO), anti-angiotensin antibodies, ATA, captopril and
saralasin were obtained from Sigma Chemical Co., Saint Louis, MO. Reagents for
detection of alkaline phosphatase and other secondary reagents for in situ end labeling of
DNA or western blotting were from sources described earlier (Wang et al., 2000). All
other materials were of reagent grade and were obtained from Sigma Chemical Co., Saint
Louis, MO.

Cell culture: The human lung adenocarcinoma cell line A549 was obtained from the
American Type Cell Culture Collection and cultured in Ham’s F12 medium
supplemented with 10% fetal bovine serum (FBS). Primary alveolar epithelial cells
isolated from adult male Wistar rats as described earlier (Wang et al., 1999). The primary
cells were studied at day two of culture, a time at which they are type II cell-like by
accepted morphologic and biochemical criteria (Paine and Simon, 1996). Primary cell
preparations were of better than 90% purity assessed by acridine orange staining as

described previously (Wang et al., 2000; Wang et al., 1999). All cells were grown in 24-

45

or 6-well chambers and were analyzed at subconﬂuent densities of 80-90%. All
subsequent incubations with BLEO and/or other test agents were performed in serum-free
medium. The cells were exposed to caspase inhibitors or antagonists of the angiotensin
system 30 minutes before exposure to BLEO for 1-20 hours as indicated.

Quantitation of apoptosis and cell loss: Detection of apoptotic cells with propidium
iodide (PI) was conducted as described earlier (Wang et al., 2000; Wang et al., 1999)
following digestion of ethanol-ﬁxed cells with DNase-free RNase in PBS containing
5ug/ml P1. In these assays, detached cells were retained by centrifugation of the 24-well
culture vessels during ﬁxation with 70% ethanol. Cells with discrete nuclear fragments
containing condensed chromatin were scored as apoptotic. As in earlier publications, the
induction of apoptosis was veriﬁed by in situ end labeling (ISEL) of fragmented DNA
(Uhal et al., 1998; Wang et al., 2000; see Figure 3.1). Apoptotic cells were scored over a
minimum of four separate microscopic ﬁelds from each of at least three culture vessels
per treatment group.

Cell loss over 20 hours of culture was quantitated by cell counts of the adherent plus
detached cell populations. These were obtained following centriﬁagation of the culture
vessels as described in the preceding paragraph, without prior washing. Thus, detached
cells (routinely less than 10% of the total cell number) were included in the cell loss data.
Total cell counts (attached plus detached) were scored over a minimum of 200 nuclei per
ﬁeld, 4 ﬁelds per well with a minimum of 6 culture wells, or 4,800 nuclei, per treatment
group. Data from each treatment group were compiled and analyzed by ANOVA

followed by Student-Newman-Keul’s post hoc analysis.

46

Detection and quantitation of caspase 3 activity: Activation of Caspase 3 was detected
through: a) immunolabeling of ﬁxed cells adherent to plastic culture surfaces with an
antibody that recognizes only the active form of the enzyme (Biovision, Mountain View,
CA). The primary antibody was detected with an alkaline phosphatase-conjugated
secondary antibody followed by nitro-blue tetrazolium. The enzymatic activity of
Caspase 3 was measured in adherent cells incubated for 20 hours with the membrane
permeable substrate Ac-DEVD-AMC (Upstate Biotech, Saranac Lake, NY) at SOuM.
Quantitation of the ﬂuorescent product was achieved with a Biotek FL600 ﬂuorescence
plate reader. Fluorescence values were normalized to cell number determined on the
same culture well after cell ﬁxing and staining of DNA with propidium iodide (Uhal and
Rannels, 1991).

RTPCR and antisense experiments: Semiquantitative reverse transcriptase polymerase
chain reaction was performed as described earlier (Wang et al., 2000; Wang et al., 1999).
The annealing temperatures for PCR reactions were optimized for each primer by
preliminary trials. All PCR ampliﬁcations were terminated at or near the center of the
linear range for each gene product analyzed, as determined by sequential withdrawal of
sample at 5-cycle intervals between 20 and 40 cycles (not shown). The identity of
expressed genes was determined by expected size ‘of the PCR product in 1.6% agarose
gels.

For RTPCR of rat-speciﬁc gene products, the following primers were used: for
angiotensinogen, coding = 5'-CCTCGCTCTCTGGACTTATC-3', and uncoding = 5'-
CAGACACTGAGGTGCTGTTG-3', which yields a PCR product of 226bp by single-

step RTPCR (Pierzchalski et al., 1997). For El-microglobulin, the primers used were:

47

coding = 5' -CTCCCCAAA-TTCAAGTGTACTCTCG-3', and uncoding = 5'-
GAGTGACGTGTTTAACTCTGCA-AGC-3', which yields a product of 249bp (Katwa,
et al., 1995). For RT—PCR from human A549 cells, the following primers were used: for
angiotensinogen, coding = 5'GCTTTC-AACACCTACGTCCA3', and uncoding =
5'AGCTGTTGGGTAGACTCTGT3'. These primers yield a ﬁnal PCR product of 509bp
(Lai et al., 1998). For [II-actin, single-step RTPCR was used with the primers: coding =
5'AGG-CCAACCGCGAGAAGATGACC3', and uncoding =
5'GAAGTCCAGGGCGACGT-AGC3', which produces a PCR product of 332bp (Ponte
et al., 1984).

For antisense studies, phosphorothioated control and antisense oligonucleotides against
angiotensinogen (l8-mers) were synthesized and transfected into A549 cells or primary
rat AEC (both at 4011M ﬁnal concentration) using the lipofectin reagent OligofectAMINE
(Invitrogen Life Technologies, Grand Island, NY) at 4ul/ml as the vehicle, diluted in the
OPTIMEM medium accompanying the lipofectin. The control nucleotides were of the
same length and base composition as the antisense, but with scrambled sequence. The
oligonucleotide: lipofectin ratio was optimized (over a 4hr tranfection) to yield
transfection efﬁciencies of 50-75% with no apparent cell loss or detachment.
Transfection efﬁciency was monitored with F ITC-labeled 25-mer oligonucleotide for
luciferase (not shown). Transfections were conducted for 4 hours followed by 5 times
washing with serum-free cell culture medium; immediately thereafter, BLEO or vehicle
was applied as described above for 20 hours. The transfection protocol itself had no
signiﬁcant effect on basal or BLEO-induced apoptosis (see Results). Phosphorothioated

oligonucleotides used for transfection were: (ANGEN antisense) 5-

48

CCGTGGGAGTCATCACGG-3', and (ANGEN scramble) 5'-
CAGGGATCTCTGGCGGAC-3' as described by Phillips et al. (Phillips et al., 1994).

Attention: Images in this dissertation are presented in color.

49

RESULTS

Exposure of primary cultures of rat AECs or A549 cells to BLEO for 20 hours
caused apoptosis detectable by nuclear fragmentation, DNA fragmentation and by
immunolabeling of the active form of Caspase 3 (Figure 3.1). Although these markers
were detected in a minor fraction of the cells, the apoptosis induced was sufficient to
reduce the total cell number signiﬁcantly over time (see Figure 3.1D-F and quantitation
in Figure 3.7B). Scoring of fragmented nuclei revealed dose-dependent apoptosis that
reached statistical signiﬁcance beginning at 0.5mU/ml in primary AECs (Figure 3.2) and
at lmU/ml in A549 cells (not shown). The nuclear fragmentation was blocked by the
broad-spectrum caspase inhibitor ZVAD-ﬁnk (60uM) or by the endonuclease inhibitor
aurintricarboxylic acid (ATA, IOuM), conﬁrming the speciﬁcity of the assay for
apoptosis. Apoptosis of the rat AECs also was blocked by the ACE inhibitor captopril
(CAPTO, SOOng/ml) and by the nonselective ANG receptor antagonist saralasin
(SARAL, 50ug/ml), in agreement with earlier studies of F as L and TNFa-induced AEC
apoptosis (Wang et al., 2000; Wang et al., 1999).
In a separate experiment (Figure 3.3), BLEO-induced apoptosis of primary AECs was
blocked by the Caspase 3-selective blocker DEVD-fmk (60uM) and by the ANG receptor
subtype ATl-selective blocker losartan (10'6M, p<0.01), suggesting that subtype AT]
mediates BLEO-induced apoptosis as it does AEC apoptosis in response to ANGII (Papp
et al., 2002). This was found to be the case in human AECs as well (Figure 3.4); BLEO-
induced apoptosis of A549 cells was inhibited 83% by the ATl-selective blocker
L158809, but was not reduced by the AT2—selective antagonist PD123319. Moreover,

BLEO-induced apoptosis was also prevented by a neutralizing antibody speciﬁc for

50

ANGII (anti-ANGII), but not by an isotype-matched nonimmune immunoglobulin
(N .S.IgG). Further, the total enzymatic activity of Caspase 3 was elevated by exposure of
A549 cells to BLEO (Figure 3.5) but the increase was inhibited 52% by saralasin.
These data suggested that BLEO induces ANGII synthesis de novo in primary AECs and
A549 cells. Consistent with this theory, semiquantitative RTPCR for angiotensinogen
(ANGEN) revealed more abundant ANGEN mRNA in primary AECs at 3 hours and
especially at 20 hours after challenge with 25mU/ml BLEO (Figure 3.6A). In A549 cells
(Figure 3.6B), 25mU/ml BLEO stimulated a signiﬁcant increase in ANGEN mRNA that
was detectable at 1 hour after addition of BLEO and increased by 7 hours.
To determine if functional ANGEN mRNA is required for the apoptotic response to
BLEO, phosphorothioated antisense or scrambled-sequence control oligonucleotides
against ANGEN mRNA were transfected into rat AECs and A549 cells immediately
before challenge with BLEO for an additional 20 hours. As shown in Figure 3.7, BLEO-
induced apoptosis of primary AECs (Panel A) was inhibited by 83% by the ANGEN
antisense but not by the scrambled control oligonucleotides (+scram). In A549 cells (B),
the antisense also reduced BLEO-induced apoptosis by 84% but the scrambled
oligonucleotide had no signiﬁcant effect. Moreover, exposure to BLEO for 20 hours

reduced the total cell number of A549 cells (attached plus detached, bottom panel) by

43%, but the ANGEN antisense prevented the BLEO-induced cell loss.

51

 

52

ow.

 

 

Figure 3 . 1: Detection of apoptosis in primary AECs and A549 cells. A, B and C: Primary
cultures of AECs were exposed to vehicle (A) or BLEO (B and C) at 25mU/ml for 20hr
and were then ﬁxed in 70% ethanol without washing (see Methods). Cells exhibiting
chromatin condensation and nuclear fragmentation with propidium iodide (arrowheads,
B) were scored as described earlier (27 and Methods). C: BLEO-exposed cells were ﬁxed
and prepared for in situ end labeling (ISEL, left) or TUNEL (right) of fragmented DNA
(25); note colocalization of label (blue or brown, respectively) in nuclear fragments
(arrowheads) identiﬁed by propidium in B. D, E and F: A549 cells exposed to vehicle (D)

or BLEO at 25mU/ml (E) or lOOmU/ml (F) for 20hrs were ﬁxed and prepared for
immunolabeling for the active form of Caspase 3 (see Methods). Note labeling of active
Caspase 3 (purple) in cells with either normal morphology (arrowheads, E) or in cells
with condensed cytoplasm and nucleus (arrows, E and F). Note also reduced total cell

number with increasing BLEO doses (E and F).

53

 

 

* AEC

°/o of TOTAL

 

 

FRAGMENT ED NUCLEI,

 

Figure 3.2: Dose-dependent induction of nuclear fragmentation by bleomycin (BLEO) in
primary rat AECs and blockade by inhibitors of caspases, endonucleases, ANG
converting enzyme (ACE) and ANG-receptor interaction. Rat AECs were isolated and
challenged with the indicated concentrations of BLEO on Day 2 of primary culture (see
Methods). Putative inhibitors were added 30 minutes prior to addition of BLEO; nuclear
fragmentation was scored as described in Fig.3.lB and Methods. ZVAD = ZVAD-fmk
(N-benzylcarboxy—Val-Ala-Asp-[O-Me]-CH2F, 60uM); ATA = aurintricarboxylic acid
lOuM); CAPTO = captopril (SOOng/ml); SARAL = saralasin (50ug/ml). Bars are the

mean i S.E.M. of at least 4 observations; * = p<0.05 versus control (0.0 BLEO).

54

400

 

* AEC

APOPTOTIC CELLS,
% of CONTROL

 

 

 

CTL BLEO BLEO BLEO
25mU/ml +DEVD +LOS

Figure 3.3: Blockade of bleomycin-induced apoptosis in primary AECs by selective
caspase or ANG receptor blockers. Rat AECs were isolated and challenged with
25mU/ml BLEO alone or in the presence of the Caspase 3-selective inhibitor DEVD—fmk
(60uM) or the ANG receptor ATl-selective antagonist losartan (LOS, 10'6M). Control
cultures (CTL) received BLEO and blocker vehicles only. Nuclear fragmentation was
scored as described in Fig.1 and Methods. Bars are the mean i S.E.M. of at least 4

observations; * = p<0.05 versus control.

55

‘AJ

 

   
  
  

 

 

3 500- * A549
g8 * *
W ,
om 4°°
BE 300m
88
EM 200'
O
8:100-
< 0-
BLEOmU/ml: 0 25 25 25 25 25 25 25

X

X. X X X X
‘72-. 06}, ‘99,}, ‘le <{g’60
70 o ‘74,. ﬁat, d’
00

Figure 3.4: Inhibition of bleomycin-induced apoptosis of A549 cells by inhibitors of
caspases or ANGII-receptor interaction. A549 cells were cultured to 8% conﬂuence as
described in Methods and were challenged with 25mU/ml BLEO in the presence or
absence of the indicated compounds. Anti-ANGII = neutralizing antibody to ANGII
(lug/ml); N.S.IgG = isotype matched nonimmune immunoglobulin (lug/ml); L158809 =
ANG receptor ATl-selective antagonist (10'6 M); PD123319 = ANG receptor AT2-
selective antagonist (lO‘6M). Other abbreviations and concentrations are the same as in
Figs. 2 and 3. Nuclear fragmentation was scored as described in Fig.3.l and Methods.

Bars are the mean : S.E.M. of at least 4 observations; * = p<0.05 versus control (0 dose).

56

 

25 * A549 *

N
O

CASPASE 3 ACTIVITY,
F.U./10‘ CELLS
a:

 

 

 

10 ‘
5 .
o .
CTL BLEO BLEO
+SARAL

Figure 3.5. Induction of caspase 3 activity by bleomycin and inhibition by an
ANG receptor antagonist. A549 cells were challenged with BLEO (25mU/ml) for 20
hours in the presence and absence of the nonselective ANG receptor antagonist saralasin
(SARAL, SOug/ml). Assay of Caspase 3 was conducted on adherent cells as described in

Methods. * = p<0.05 versus control (CTL) and ** = p<0.05 versus BLEO.

      

A AECS CT. 3hr 20hr

  

 

 

p-MG . .
B A549:
CTL 1hr 3hr 7hr

 

 

Figure 3.6. Semiquantitative RTPCR of angiotensinogen (ANGEN) mRNA in
AECs aﬁer bleomycin exposure. Primary cultures of rat AECs (A) and A549 cells (B)
were exposed to BLEO (25mU/ml) for the indicated times and total RNA was isolated.
RTPCR was performed as described before with primers speciﬁc for rat or human

angiotensinogen (ANGEN), B-microglobulin (B-MG) or a-actin as control mRNAs.

58

 

AEC

 

 

 

A
MW nu nu
Qv at 1
4019750.? .x.
.mddmu 05.9—50.3.

nu nu nu

+anti- +scram

sense

+lipo

CTL BLE CTL BLE BLE BLE
25mU +lipo

/ml

 

*

A549

B 1

 

 

it I -

nu nu nu nu
nu nu nu nu
no 00 AW at

w—OMHZOU .«o .x.
.mAAHU U—POPa—Om<

nu

 

 

*

*

*

*
Tu
. w- m m m m o
Emmogmnammoghé

o\o .MHEDZ AAHU A<POH

BLEO BLEO BLEO

25mU/ml +anti-
+Iipo

CTL
+lipo

+scrani

sense

59

Figure 3.7. Blockade of bleomycin induced apoptosis and net cell loss in AECs and A549
cells by antisense oligonucleotides against angiotensinogen mRNA. Primary rat AECs
(A) or A549 cells (B) were transfected for 4 hours with antisense or scrambled sequence
(scram) oligonucleotides as described earlier. Cells were challenged with bleomycin
(BLE, 25mU/ml) for 20 hours immediately thereafter, and apoptosis (upper panel) was
scored as detailed in Figs.1-3; net cell loss (bottom panel of B) was measured as detailed
in Methods. lipo = lipofectamine; see Methods for details. Bars are the mean : S.E.M. of

at least 4 observations; * = p<0.05 and ** = p<0.01 versus corresponding control (CTL).

60

DISCUSSION

The results described here agree with previous studies from this laboratory that

showed a requirement for autocrine ANGII production and receptor interaction for AEC
apoptosis in response to F asL or TNF-a (Wang et al., 2000, Wang et al., 1999).
Other authors also have reported DNA damage and death of AECs in response to
bleomycin (Hagimoto et al., 1997; He et al., 2001). Although a previous report of
bleomycin action on A549 cells described no inﬂuence of the drug on cell viability in
vitro (Sato et al., 1999), the levels of apoptosis described here (apoptotic index about 10-
20%, see Figures 3.1 and 3.2) suggest that cell death at the relatively low doses used in
that study (0.1-2mU/ml) may have gone undetected. Nonetheless, the levels of apoptosis
reported here are more than sufﬁcient to result in signiﬁcant net cell loss in a relatively
short period of time (see Figure 3.7). More importantly, both the cell loss and markers of
apoptosis could be blocked by ANG system antagonists, consistent with the theory that
these agents can prevent apoptosis and thus cell loss in response to bleomycin.

The ﬁndings that bleomycin-induced apoptosis of AECs could be blocked by the
ATl-selective antagonists losartan (Figure 3.3) and L158809 (Figure 3.4) but not by the
AT2-selective antagonist PD123319 are in agreement with our recent demonstration that
the AT1 receptor subtype mediates AEC apoptosis in response to puriﬁed ANGII (Papp
et al., 2002). They also support the contention that autocrine production of ANGII and
binding to its receptor(s) are required for the apoptotic response. This contention also is
supported by the ability of ANGEN antisense oligonucleotides or a neutralizing antibody
that recognizes ANGII, but not ANGI or ANGEN, to essentially abrogate apoptosis and

prevent net cell loss in response to bleomycin (Figures 3.4 and 3.7).

61

In an earlier report we described the induction of apoptosis in AECs by exposure to
puriﬁed ANG 11 (Wang et' al., 1999), which also occurred in a concentration-dependent
manner with an ECso of 10 and 50nM for primary AECs and A549 cells, respectively.
Those data indicated that exposure of AECs to exogenous ANG II is sufﬁcient, in the
absence of other stimuli, for the induction of apoptosis. Measurements of the ANG II
concentration in the cell culture media at a single sampling time (20 h) suggest that Bleo
increases ANG II in the medium by at least two- to threefold, to a level close to that
required for induction of apoptosis by puriﬁed ANG 11 (2-3 nM, data not shown).
However, intracellular receptors for ANG II have been demonstrated in other cell types
(Eggena et al., 1993; Haller et al., 1996), and ANG II administered intracellularly by
microinjection (Haller et al., 1996) has been shown to invoke a variety of signaling
pathways. Thus, in the present study, intracellular generation of ANG II by Bleo may be
sufﬁcient to stimulate apoptosis independently of extracellular AN G II. In both serum and
interstitial ﬂuid, the half-life of ANG II is short (15 s-15 min), and receptor-bound ANG
II is known to be internalized in many cell types (Filippatos et al., 2001); for all these
reasons, the interpretation of extracellular ANG II levels is difficult at best.

The RT-PCR data of Fig.3.7 and measurements of ANGEN protein by Western blotting
(not shown) suggest that there is a basal level of ANGEN expression by AECs, even in
the absence of other proapoptotic stimuli. In experiments not reported here, the AN G
receptor antagonist saralasin, applied alone, decreased the basal rate of spontaneous AEC
apoptosis (normally 1-2% of total cells at steady state); this ﬁnding supports the notion
that basal ANGEN expression is involved in the basal rate of ABC death. On the other

hand, the rate at which ANGEN protein is proteolytically cleaved, both inside and outside

62

the cell, likely constitutes another point of regulation, but at present we have little data to
indicate which point of control is most critical. Moreover, it seems reasonable to suspect
that Bleo and other inducers of ABC apoptosis alter the expression of additional
components of the local renin-angiotensin system in AECs, such as angiotensin-
converting enzymes and receptors as well as ANGEN expression. Consistent with this
theory, recent work by Day et a1. (Day et al., 2001) demonstrated upregulation of ACE in
cultured endothelial cells by Bleo. Alveolar epithelial cells also express ACE mRNA, and
ACE inhibitors block AEC apoptosis in response to FasL (Wang et al., 1999), TNF-u
(Wang et al., 2000), and Bleo (Figure 3.2). Investigations to deﬁne the possible regulation

of ACE and other peptidases in AECs are currently underway.

Although the mechanism by which bleomycin upregulates ANGEN mRNA was
not addressed in this study, the ﬁndings that BLEO, Fas], and TNF-a all increased
ANGEN mRNA (Wang et al., 1999; Wang et al., 2000) imply the involvement of a
pathway common to these inducers. Regulation of ANGEN expression is best studied in
the hepatocyte, in which the stimulatory effects of TNF-a and Interleukin-6 have been
shown to be mediated through the interaction of transcription factors NF -KB and STAT-3
with the Acute Phase Response Element (APR) of the ANGEN promoter (Brasier et al.,
1994; Sherman and Brasier, 2001). In contrast, studies of the regulation of ANGEN
expression by the cardiac myocyte have shown that p53 is a key regulator of its
expression in response to a variety of stimuli (Leri et al., 1998; Pierzchalski et al., 1997).

Whether this difference reﬂects the distinct developmental lineages of these cell types or

63

other factors is unknown. Viewed in this context, ﬁiture investigations of the regulation
of ANGEN expression by cells of the lung will be most interesting, particularly in light of
the fact that the lung contains many different cell types that are in very close proximity,
but which arose from distinct embryologic origins. As an example, the results reported
here for AECs compliment our earlier report of ANGEN expression by human lung
myoﬁbroblasts (Wang, et al., 1999), which reside immediately adjacent to AECs in the
ﬁbrotic lung in situ.

In summary, exposure of primary cultures of rat alveolar epithelial cells or the
AEC-derived A549 cell line to bleomycin caused a time-dependent increase in
angiotensinogen mRNA and caspase-dependent apoptosis. In either cell type, the
apoptosis could be prevented by agents that prevent the synthesis of angiotensinogen
protein, its conversion to the mature peptide angiotensin II, or the binding of the peptide
to its receptors. These ﬁndings may have important implications toward possible
therapeutic strategies to prevent lung injury and/or ﬁbrogenesis. They also raise the
possibility that previous clinical trials involving ACEis or ANG receptor antagonists may
hold useful information related to the potential of these agents to affect pulmonary

disease.

64

Chapter 4

ESSENTIAL ROLE FOR CATHEPSIN D IN BLEOMYCIN-INDUCED

APOPTOSIS OF ALVEOLAR EPITHELIAL CELLS

Xiaopeng Li, Heather Rayford, Ruijie Shu, Jiaju Zhuang and Bruce D. Uhal

Department of Physiology, Michigan State University, East Lansing, Michigan, 48824

This chapter is published in:

Am J Physiol Lung Cell Mol Physiol. 2004, 287(1): L46-L51.

65

ABSTRACT

Earlier studies from this laboratory showed that bleomycin-induced apoptosis of type II
alveolar epithelial cells (AECs) requires the autocrine synthesis and proteolytic
processing of angiotensinogen into angiotensin II (ANGII), and that inhibitors of ANG
converting enzyme (ACEis) block bleomycin-induced apoptosis (Li, X, H Zhang, V
Soledad-Conrad, J Zhuang and BD Uhal. Bleomycin-induced apoptosis of alveolar
epithelial cells requires angiotensin synthesis de novo. Am. J. Physiol. 284(3): L501-
L507, 2003.). Given the documented role of cathepsin D (CatD) in apoptosis of other cell
types, we hypothesized that CatD might be the AEC enzyme responsible for the
conversion of angiotensinogen into ANGI, the substrate for ACE. Primary cultures of rat .
type II AECs challenged with bleomycin in vitro showed upregulation and secretion of
CatD enzymatic activity and immunoreactive protein, but no increases in CatD mRNA.
The aspartyl protease inhibitor pepstatin A, which completely blocked CatD enzymatic
activity, inhibited bleomycin-induced nuclear fragmentation by 76% (p<0.01) and
reduced bleomycin-induced caspase 3 activation by 47% (p<0.05). Antisense
oligonucleotides against CatD mRNA reduced CatD immunoreactive protein and
inhibited bleomycin-induced nuclear fragmentation by 48% (p<0.01). A puriﬁed
fragment of angiotensinogen (Fl-14) containing the CatD and ACE cleavage sites, when
applied to unchallenged AEC in vitro, yielded mature ANGII peptide and induced
apoptosis. The apoptosis induced by F 1-14 was inhibited 96% by pepstatin A and 77% by
neutralizing antibodies speciﬁc for CatD (both p<0.001). These data indicate a critical

role for CatD in bleomycin-induced apoptosis of cultured ABC, and suggest that the

66

role(s) of CatD in ABC apoptosis include the conversion of newly synthesized
angiotensinogen to ANGII.

Key Words:

aspartyl protease lung injury programmed cell death

lung ﬁbrosis type II pneumocyte

67

INTRODUCTION

Angiotensin II (ANGII) is a potent inducer of apoptosis in alveolar epithelial cells (ABC)
and is synthesized and released from ABC undergoing apoptosis in response to other
stimuli (Filippatos and Uhal, 2003). Work from this laboratory has shown that ANGII is
secreted by ABC challenged in vitro with Fas ligand (Wang et al., 1999) or TNF-alpha
(Wang et al., 2000), and demonstrated that the production of ANGII is required for the
signaling of apoptosis by these inducers. More recent investigations showed that AEC
apoptosis in response to the ﬁbrogenic agent bleomycin requires the autocrine synthesis
of angiotensin II (ANGII) and the subsequent binding of AN OH to receptor subtype ATl
(Li et al., 2003). Apoptosis of ABC in response to the ﬁbrogenic antiarrhythmic agent
amiodarone also is blocked by ANG receptor ATl-selective antagonists (Filippatos and
Uhal, 2003;Uhal et al., 2003). Together, these ﬁndings have lead to the theory that
autocrine production of ANGII by ABC de novo, i.e., from the precursor angiotensingen,
is a common event required for ABC apoptosis regardless of the initiating stimulus (Uhal,
2002)

Primary cultures of rat AEC were shown to constitutively express low but functional
levels of angiotensin converting enzyme (ACE) mRNA (Wang et al., 1999), and to
respond to ACE inhibitors such as captopril or lisinopril (Uhal et al., 1998; Wang et al.,
2000). However, the identity of the enzyme(s) in ABC which act upstream of the ACE
reaction, i.e., performing the conversion of angiotensinogen to ANGI (the substrate for
ACE), remains unknown. In the serum, the conversion of liver-derived circulating
angiotensinogen into ANGI is accomplished by the kidney-derived enzyme renin; this

system is now viewed as the classical “endocrine” renin-angiotensin system (Filippatos et

68

al., 2001). In contrast, tissue-speciﬁc “local” angiotensin systems exist in many tissues as
either “extrinsic” systems (i.e., dependent on one or more components of the endocrine
system) or as “intrinsic” ANG systems in which all the enzymes and substrates required
for the production of ANGII are synthesized locally. In local intrinsic systems outside the
lung, the primary aspartyl protease that converts newly synthesized angiotensinogen to
ANGI is cathepsin D (CatD) (Weber et al., 1995), a ubiquitous lysosomal aspartyl
protease expressed by virtually all cells (Isahara et al., 1999). The identity of this aspartyl
protease in the pulmonary local ANG system is the subject of this study.

A critical role for CatD in the execution of apoptosis has been shown previously
in a variety of cell types including kidney cell lines (Heinrich et al., 1999), PC12 cells
and dorsal root ganglion-derived neurons (Isahara et al., 1999) and in MLl leukemia or
U1752 lung cancer cells exposed to etoposide or adriamycin (Wu et al., 1998). In those
studies, apoptosis in response chemical stimuli or trophic withdrawal could be prevented
by the aspartyl protease inhibitor pepstatin A or by antisense oligonucleotides against
CatD mRNA. One investigation of CatD-dependent apoptosis in neuronal cells led to the
hypothesis that activation of CatD by apoptosis inducers leads to the generation of an
unidentiﬁed “bioactive molecule” that is required for the signaling of apoptosis, but is
either degraded or expressed at low levels in viable cells under basal unstimulated

conditions (Isahara et al., 1999).

In the light of previous demonstrations that AEC apoptosis requires the autocrine

synthesis of ANGII and the documented ability of CatD to convert angiotensinogen to

ANGI, we hypothesized that CatD might be required for ABC apoptosis. We also

69

theorized that the primary function of CatD in AEC apoptosis is the conversion of
angiotensinogen to ANGI. We report here that ABC apoptosis in response to bleomycin

is inhibited by CatD knockdown as a result of its blockage of ANGII synthesis.

70

MATERIALS AND METHODS

Reagents and materials: The ANG receptor ATl-selective antagonist L158809 was
obtained from Merck and Co., West Point, PA. The CatD ﬂuorescent substrate MOCAc-
Gly-Lys-Pro-Ile-Leu—Phe-Phe-Arg-Leu-Lys (an)-D-Arg-NH2 (Yasuda et al., 1999) was
obtained from Peptides International, Louisville, KY. Bleomycin (BLEO), anti-
angiotensin antibodies, ATA, captopril and saralasin were obtained from Sigma Chemical
Co., Saint Louis, MO. A kit for ELISA quantitation of angiotensin II was obtained form
Peninsula Laboratories (San Carlos, CA). All other materials were of reagent grade and
were obtained from Sigma Chemical Co., Saint Louis, MO.

Cell culture: Primary alveolar epithelial cells isolated from adult male Wistar rats as
described earlier (Wang et al., 1999). The primary cells were studied at day two of
culture, a time at which they are type II cell-like by accepted morphologic and
biochemical criteria (Papp et al., 2002). Primary cell preparations were of better than
90% purity assessed by acridine orange staining as described previously (Wang et al.,
1999;Wang et al., 2000). All cells were grown in 24- or 6-well chambers and were
analyzed at subconﬂuent densities of 80-90%. All subsequent incubations with BLEO
and/or other test agents were performed in serum-free medium. The cells were exposed to
caspase inhibitors or antagonists of the angiotensin system 30 minutes before exposure to
BLEO for 1-20 hours as indicated.

Quantitation of nuclear fragmentation and caspase-3 activity: Detection of apoptotic
cells with propidium iodide (PI) was conducted as described earlier (Wang et al., 1999;
Wang et al., 2000) following digestion of ethanol-ﬁxed cells with DNase-free RNase in

PBS containing Sug/ml P1. In these assays, detached cells were retained by centrifugation

71

of the 24-well culture vessels during ﬁxation with 70% ethanol. Cells with discrete
nuclear fragments containing condensed chromatin were scored as apoptotic. As in earlier
publications, the induction of apoptosis was veriﬁed by in situ end labeling (ISEL) of
fragmented DNA (Li et al., 2003). Apoptotic cells were scored over a minimum of four
separate microscopic ﬁelds from each of at least three culture vessels per treatment
group.

The enzymatic activity of Caspase 3 was measured in adherent cells incubated for 20
hours with the membrane permeable substrate Ac-DEVD-AMC (Upstate Biotech,
Saranac Lake, NY) at 50uM ﬁnal concentration. Quantitation of the ﬂuorescent product
was achieved with a Biotek F L600 ﬂuorescence plate reader. Fluorescence values were
normalized to cell number determined on the same culture well aﬁer cell ﬁxing and
staining of DNA with P1 (Wang et al., 1999).

Assay of CatD activity: The enzymatic activity of CatD was determined with the
ﬂuorogenic substrate MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-Leu-Lys (an)-D-Arg-
NH2 as described by its inventors (Yasuda et al., 1999). Brieﬂy, aliquots of AEC lysates
or concentrated cell culture media were incubated in opaque 96-well culture plates
(suitable for top reading in a ﬂuorescence plate reader) in 1.0M sodium acetate buffer, pH
4.0 containing 50uM ﬂuorogenic substrate. The total volume of reaction buffer, including
sample, was 100ul. In the case of cell lysates, equal amounts of lysate protein were
assayed per culture vessel in triplicate. For concentrated cell culture media, the volume of
medium assayed was normalized to equivalent amounts of cells used for conditioning the
media, as determined by the lysate protein concentration. Initial rates of ﬂuorescent

product formation were obtained from the slope of continuous readings taken over 30

72

minutes following the addition of substrate. Initial reaction rates were linear with both
time and protein concentration (see Results).

RTPCR and antisense experiments: Quantitative realtime reverse transcriptase
polymerase chain reaction was performed by standard protcols in the Genomics
Technology Support Facility, Michigan State University. Primer sequences were
designed on the basis of published sequence information and the public domain software
Primer3 (MIT, Cambridge, MA). The annealing temperatures for PCR reactions were
optimized for each primer by preliminary trials. The identity of expressed genes was
determined by expected size of the PCR product in 1.6% agarose gels, followed by
excision and sequencing of the PCR product.

For RTPCR of rat CatD, the primers used were: (primer set 1) coding = 5'-
ACACTGTGTCGGTTCCATGT-3', and uncoding = 5'-TGCGATGAATACGACTCC-
AG-3', which produces a PCR product of lOlbp, and (primer set 2) coding = 5'-
GCGTCTTGCTGCTCATTCTC-3', and uncoding = 5'-TGGGACCTTTAAGGATCA-
GG-3', which produces a PCR product of 141bp.

For antisense studies, phosphorothioated control and antisense oligonucleotides against
CatD (22-mers) were designed through published sequence information and public
domain software, synthesized and transfected into primary rat AEC (both at 40nM ﬁnal
concentration) using the lipofectin reagent OligofectAMINE (Invitrogen Life
Technologies, Grand Island, NY) at 4ul/ml as the vehicle, diluted in the OPTIMEM
medium accompanying the lipofectin. The control nucleotides were of the same length
and base composition as the antisense, but with scrambled sequence. The

oligonucleotide: lipofectin ratio was optimized to yield transfection efﬁciencies of 50-

73

75% with minimal cell loss or detachment. Transfection efﬁciency was monitored with
F ITC-labeled 25-mer oligonucleotide for luciferase (not shown). Transfections were
conducted for 4 hours followed by 5 times washing with serum-free cell culture medium,
as described earlier (Wang et al., 1999; Wang et al., 2000). Immediately thereafter,
BLEO or vehicle was applied as indicated for 20 hours. The transfection protocol itself
had no signiﬁcant effect on basal or BLEO-induced apoptosis (see Results).
Phosphorothioated oligonucleotide sequences were: (CatD antisense) 5’-
CATATAGT'I'I‘TGCTTCTGTCCT-3', and (CatD scramble) 5'-

TGCCCTATATGTTAGTTC-I I IC-3'.

74

RESULTS

Measurements of cathepsin D (CatD) enzymatic activity with the ﬂuorogenic substrate
MOCAc-Gly—Lys-Pro-Ile-Leu—Phe-Phe-Arg-Leu-Lys (an)-D-Arg-NH2 revealed CatD
enzymatic activity in lysates of puriﬁed rat alveolar epithelial cells (AECs, Figure 4.1);
the generation of ﬂuorescent product was linear with time and lysate protein
concentration. Incubation of primary AEC cultures with bleomycin for 20 hours, at a
concentration previously shown to stimulate AEC apoptosis (25mU/ml)(Li et al., 2000),
signiﬁcantly increased the activity of CatD in both AEC lysates and in the serum-free cell
culture medium (Figure 4.2). The aspartyl protease inhibitor pepstatin A (pepA) inhibited
the CatD activity by over 90%.

Apoptosis inducers are known to increase CatD activity and mRNA in other cell types
(Isahara et al., 1999;Wu et al., 1998). Analyses of CatD mRNA in primary AECs by
RTPCR (Figure 4.3A) revealed PCR products of the correct size expected from two
different primer sets, but no apparent change in response to bleomycin. Sequencing of
both PCR products veriﬁed the speciﬁcity of the PCR for rat CatD (not shown).
Quantitative analyses of CatD mRNA by realtime PCR was unable to detect signiﬁcant
changes in the mRNA in response to bleomycin challenge (Figure 4.3B). In contrast,
western blotting of ABC lysates and culture media with CatD-speciﬁc antibodies and
high resolution gels (Figure 4.3) revealed bleomycin-induced increases in
immunoreactive CatD proteins in the cell culture medium, but apparently not in the cell
lysates. Bleomycin increased isoforms of CatD of apparent MW 52, 48 and 44kdal in the
culture medium, whereas a 44kdal protein was the major immunoreactive isoform of

CatD present in ABC lysates.

75

To begin determining if CatD might play a role in apoptosis of AECs as it does in other
cell types, AEC apoptosis was evaluated in the presence and absence of the aspartyl
protease inhibitor pepstatin A. In Figure 4.5, pepstatin A (pepA) inhibited bleomycin-
induced nuclear fragmentation of primary AEC by 76% (p<0.01) and reduced bleomycin-
stirnulated caspase 3 activity by 47% (p<0.05). The pepstatin A alone did not affect basal
nuclear fragmentation or caspase 3 activity.

As an alternate test of the role of CatD in ABC apoptosis, phosphorothioated antisense
oligonucleotides speciﬁc for CatD mRNA were designed and transfected transiently into
primary rat AEC with lipofectin (LIPO, Figure 4.6). In Figure 6A, the antisense
oligonucleotides (AS) signiﬁcantly reduced the immunoreactive CatD released into AEC
culture media, as determined by western blotting on low resolution gels. In contrast,
scrambled-sequence control oligonucleotides (SCR), of the same length and base
composition as the antisense, did not reduce CatD immunoreactivity. In Figure 4.68,
pretreatment of primary AECs with the same antisense oligonucleotides used in panel A
(AS) reduced bleomycin-induced nuclear fragmentation by 48% (p<0.05).

Recent work from this laboratory showed that the induction of ABC apoptosis by
bleomycin requires de novo synthesis of angiotensin II (ANGII) and its subsequent
binding to ANG receptor subtype ATl (Li et al., 2003). To begin addressing the theory
that the primary role of CatD in ABC apoptosis is its ability to process angiotensinogen to
the peptide angiotensin I, CatD knockdown strategies were evaluated for the ability to
prevent AEC apoptosis in response to a synthetic angiotensinogen fragment consisting of
amino acids l-l4. This domain of angiotensinogen contains the catalytic sites for both

CatD and angiotensin converting enzyme (ACE), which together generate angiotensin II.

76

To conﬁrm this premise with the reagents currently commercially available for this study,
the pm'iﬁed angiotensinogen fragment 1-14 (Fl-14) was treated in vitro (without cells)
with puriﬁed ACE or puriﬁed CatD enzymes (Figure 4.7A). As expected, treatment of
F1-14 with both ACE and CatD together resulted in signiﬁcant production of the peptide
ANGII (Figure 4.7A), as measured by an ELISA that detects ANGII but not ANGI or
angiotensinogen. In contrast, neither puriﬁed ACE alone nor puriﬁed CatD alone could
convert Fl-l4 to the peptide ANGII. In Figure 4.7B, incubation of primary rat AECs with
fragment F1-14 alone in serum-free culture medium (but without added enzymes) yielded
signiﬁcant production of ANGII, conﬁrming the constitutive expression of ANG
converting enzymes by primary AEC (Wang et al., 1999).

In Figure 4.8, incubation of primary rat AEC with Fl-l4 induced apoptosis detected by
nuclear fragmentation. The apoptosis was completely blocked by the nonspeciﬁc or ATl -
selective ANG receptor antagonists saralasin (SARAL) or L158809, respectively.
Moreover, the apoptosis was inhibited 96% by the CatD inhibitor pepstatin A (pepA),
and was reduced 77% by neutralizing antibodies speciﬁc for CatD (CatD AB, both

p<0.001).

77

 

 

 

700 Cat-D Assay o 10
5:: . '
E 600- .
\
E - '
E 500‘ .
v , ° 0 5.0
g 400‘ . o o o
.g . o o
o 3004 . 0 °
h C o O V V V 205
0" o o o v V v ' T
200- 0 v V '
. 3 , v v ulAEC
9 lysate

 

O
0 300 600 900 1200 1500 1800
Time (seconds)

Figure 4.1. Cleavage of a ﬂuorogenic substrate for Cathepsin D (CatD) is dependent on
time and protein concentration. Lysates of primary alveolar epithelial cells (AECs) were
incubated with the ﬂuorogenic substrate MOCAc-Gly-Lys-Pro-Ile-Leu-Phe-Phe-Arg-
Leu—Lys (an)-D—Arg—NH2, and generation of ﬂuorescent product was monitored
continuously over 30 minutes (see Methods for details). Note linearity of product

formation with time and amount of ABC lysate.

78

 

1.6

   

 

g 1.4- £03 *
'5' .5 1.2-"'20-2
o 3 3
<3 8 13120.1
Q 9* 0.8- 3
.E 50 '
a3 0.6~
4’ D 0.4-
% E.

0.2-
U

0.0-

 

 

pepA: - + - +
W W
CTL BLEO

Figure 4.2. Bleomycin upregulates CatD activity and release from AECs. Primary
cultures of rat alveolar epithelial cells (AECs) were exposed to bleomycin (BLEO) for 20
hours at a concentration known to induce AEC apoptosis (25mU/ml). CatD activity was
measured in cell lysates as described in Figure 4.1, in the presence or absence of the
aspartyl protease inhibitor pepstatin A (pepA).

Inset: CatD activity was measured in concentrated cell culture medium collected from
BLEO-treated (BL) and untreated (C) cells studied in panel A. Bars are the mean :1:
S.E.M. of n = 6; * = p<0.01 versus untreated control (CTL) by ANOVA and Student-

Newman-Keul’s test.

79

 

eo: - + — + +
20h 20h 3hr 3hr 20hr

MGew

1
ab
\ .5
Q
[:5 0
U 2hr 2hr 6hr 6hr 20hr 20hr
Bleo: - + - + — +

Figure 4.3. Bleomycin does not alter steady-state levels of CatD mRNA.
A: PCR products from two different primer sets (1 and 2, see Methods) used to amplify
CatD mRNA by RTPCR; starting material was total RNA isolated from primary rat
AECs exposed to BLEO or vehicle for the indicated times. B: Realtime RTPCR of CatD
mRNA (primer set 2) at the indicated times after exposure to BLEO (see Methods). [3-

MG = B-microglobulin; bars are the meaniS.E.M. of three separate AEC cultures.

 

monolayer medium
J_ I

 

CTL BLEO CTL BLEO

Figure 4.4. Bleomycin increases the release of immunoreactive CatD protein from
cultured AECs. Primary cultures of AECs were exposed to bleomycin (BLEO) as in
Figure 2; detergent lysates were harvested from the cells (monolayer), and the cell culture
medium was collected and concentrated. Equal amounts of lysate protein (lOug/lane) or
volume of culture medium (equivalent to 105 cells) were subjected to western blotting
with Cat-D-speciﬁc antibodies (see Methods). Note increases in immunoreactive proteins

of apparent MW~ 52, 48 and 44kdal (arrowheads) in medium from BLEO-treated AECs.

81

 

i»

400

300

200

100

% of Control

 

 

 

mFU/ug DNA
g

 

Caspase 3 Activity, W Fragmented Nucle

 

 

1.0
Bleo: - + + -
pepA: - - + +

Figure 4.5. Pepstatin A inhibits bleomycin-induced apoptosis of AECs in vitro. Primary
cultures of rat AECs were exposed to BLEO in the presence or absence of pepstatin A
(pepA) at lOOuM. Apoptosis was quantitated by scoring of nuclear fragmentation with
propidium iodide (panel A) or by the enzymatic activity of Caspase 3 (B). See Methods
for details. Bars are the mean :1: S.E.M. of n = 6; * = p<0.01 versus untreated control and

** = p<0.05 versus BLEO by ANOVA and Student-Newman-Keul’s test.

82

   

 

 

49»
36>
. CTL CTL CTL
+LIPO +AS +SCR
°\o 500
3 400
d 300
U
o 200
H
8 100
E 0
O CTL BLEO BLEO
% +LIPO +LIPO +AS

Figure 4.6. Antisense oligonucleotides reduce CatD immunoreactivity and inhibit
bleomycin-induced apoptosis of AECs in vitro. A: Antisense (AS) or scrambled-sequence
oligonucleotides (SCR) were transfected into primary cultures of rat AECs in the
presence of lipofectin (LIPO, see Methods), without challenge with bleomycin (CTL).
Western blotting of concentrated cell culture media was performed with CatD-speciﬁc
antibodies; note decrease in immunoreactive CatD by AS but not SCR oligonucleotides.
B: After antisense oligonucleotide transfection as in panel A, AECs were challenged with
BLEO (25mU/ml) and harvested for detection of fragmented nuclei as in Figure 5. Bars
are the mean i: S.E.M. of n = 3; * = p<0.01 versus untreated control (CTL) and ** =

p<0.05 versus BLEO by ANOVA and Student-Newman-Keul’s test.

83

 

so-A

 

 

 

   

 

AN GH produced, pmol/ml

Fl-l4 Fl-14 F1-14 F1-14 AECs, AECS-l-
+ACE +CatD +CatD no F 1-14
+ACE Fl-14

Figure 4.7. Production of ANGII from angiotensinogen fragment 1-14 in vitro.

A: Angiotensinogen fragment 1-14 (F l-l4, 5uM) was incubated in vitro (without cells)
with the indicated puriﬁed enzymes; ANGII was measured in the reaction buffer by
speciﬁc ELISA (see Methods for details). Note production of ANGII by the combination
of puriﬁed CatD + puriﬁed angiotensin converting enzyme (ACE), but not by either
enzyme alone. B: Primary cultures of AECs were exposed to 5uM F1-l4, and ANGII was
measured in the serum-free cell culture medium; note production of ANGII by AECs

challenged with F1-14, but not by untreated AECs.

84

APOPTOTIC AECS, %

0 50 100 150 200 250 300

 

 

 

 

Figure 4.8. CatD-dependent induction of ABC apoptosis by angiotensinogen fragment 1-
14. Primary cultures of AEC were incubated with F1-14 as in Figure 4.7, in the presence
or absence of pepstatin A (pepA, luM); CatD-speciﬁc neutralizing antibodies (CatD AB,
1:100) and the ANG receptor antagonists saralasin (SARAL, 50ug/ml) or L158809

(10'6 M). See Methods for details. Bars are the mean :1: S.E.M. of n = 3; * = p<0.001
versus untreated control (CTL) and ** = p<0.001 versus F1-14 by ANOVA and Student-

Newman-Keul’s test.

DISCUSSION

A role for the aspartyl protease CatD in apoptosis has been shown previously in HeLa
cells exposed to interferon-y, Fas ligand or TNF ~01 (Deiss et al., 1996) and in PA] ovarian
cancer cells (Wu et al., 1998). The activity of CatD is upregulated by the apoptosis
inducer adriamycin in PA] cells and in MLl leukemia cells and U1752 lung cancer cells
(Wu et al., 1998). Although the aspartyl protease inhibitor pepstatin A could block
apoptosis in these cell types, the exact mechanism(s) by which CatD participates in the
execution of apoptosis is unclear. In accord with the known ubiquitous expression of
CatD as a lysosomal protease (U chiyama et al., 2001), it has been suggested that this and
other lysosomal proteases might be involved in the production of a bioactive molecule
required for apoptosis of PC12 cells in response to trophic withdrawal (Isahara et al.,
1999)

Cathepsin D also is known to be one of the enzymes capable of proteolytically processing
the liver-derived and serum-borne protein angiotensinogen to the peptide angiotensin I, a
function normally performed in the serum by the kidney—derived enzyme renin
(Filippatos et al., 2001). On the other hand, evidence from several nonpulmonary cell
types has established CatD as the primary enzyme that converts angiotensinogen to
ANGI within local “intrinsic” angiotensin systems, independently of renin (F ilippatos et
al., 2001; Weber et al., 1995).

Recent studies from this laboratory have shown that bleomycin-induced apoptosis of
alveolar epithelial cells requires the autocrine synthesis of angiotensinogen, angiotensin
II and it’s binding to ANG receptor ATl (Li et al., 2003). Those data were consistent

with related studies showing that puriﬁed AN GII itself was a potent inducer of apoptosis

86

in ABC (Wang et al., 1999), and implied that AEC express enzymes capable of
converting angiotensinogen to ANGII. Although the same study showed constitutive
expression of angiotensin converting enzyme (ACE) by alveolar epithelial cells, the
aspartyl protease required for providing the substrate for ACE (ANGI) in ABC was
unknown.

The data herein strongly suggest that CatD functions in this capacity in ABC; bleomycin-
induced nuclear fragmentation and caspase 3 activity were signiﬁcantly reduced by the
aspartyl protease inhibitor pepstatin A (Figure 4.5) or by antisense oligonucleotides
against CatD mRNA (Figure 4.6). In earlier investigations, bleomycin-induced apoptosis
of AEC was competely blocked by speciﬁc angiotensin receptor antagonists or ANG-
neutralizing antibodies (Li et al., 2003); this ﬁnding lead to the theory that autocrine
generation of ANGII is required for ABC apoptosis regardless of the initiating stimulus
(Uhal, 2002). In the light of those results, the ﬁnding that CatD antisense treatment did
not completely block bleomycin-induced nuclear fragmentation (48%, Figure 4.6B)
might indicate a potential role for additional protease(s) in angiotensinogen processing
and subsequent AEC apoptosis. This interpretation is consistent with the ﬁnding that the
protease inhibitor pepstatin A, which blocks all aspartyl proteases, also was incapable of
complete blockade of nuclear fragmentation (76%, Figure 4.5) despite complete
inhibition of CatD enzyme activity in AEC lysates (Figure 4.2). On the other hand, the
antisense treatment, which is at least theoretically speciﬁc, did not completely eliminate
immunoreactive CatD detected by western blotting (Figure 4.6A). Thus, it is difﬁcult to
know with certainty if the incomplete blockage of apoptosis is due to inefﬁcient CatD

knockdown or additional proteases activities.

87

Regardless, studies of angiotensinogen fragment 1-14 (Figures 4.7&8) are consistent with
the theory that CatD is required for the conversion of angiotensinogen to ANGII by ABC,
and with earlier work. For example, the ﬁnding that incubation of primary rat AECs with
the fragment F1-l4 alone in serum-free culture medium (but without added enzymes)
yielded signiﬁcant production of ANGII (Figure 4.7) is consistent with the earlier
demonstration of constitutive, albeit low, expression of both ACE and an unidentiﬁed
aspartyl protease by primary AECs (Wang et al., 1999). Moreover, the complete
abrogation of ABC apoptosis in response to angiotensinogen fragment F 1-14 by the
nonselective and ATl-selective ANG receptor antagonists saralasin and losartan (Figure
4.8) conﬁrmed that the induction of apoptosis was dependent on both the generation of
ANGII from F1-14 and the binding of ANGII to receptor ATl. Those results also are
consistent with our earlier demonstrations that AT1 receptor mediates AEC apoptosis in
response to bleomycin (Li et al., 2003), amiodarone (Filippatos and Uhal, 2003; Uhal et
al., 2003) or puriﬁed ANGII (Papp et al., 2002). Most important, the ﬁndings that ABC
apoptosis in response to F1-14 was essentially abrogated by either pepstatin A or by CatD
antibodies (Figure 4.8) strongly suggest that the conversion of angiotensinogen to ANGI,
and subsequently ANGII to induce AEC apoptosis, is dependent on CatD activity.

The upregulation of CatD activity by bleomycin in this study is consistent with the earlier
ﬁndings that CatD is upregulated in alveolar epithelial cells in ﬁbrotic human lung
(Kasper et al., 1996) and is induced in the L132 lung cell line during apoptosis in vitro
(Kasper et al., 1999). In other cell types, apoptosis inducers upregulate both CatD protein
and mRNA, which suggests control of activation at the level of RNA (Wu et al., 1998). In

contrast, RTPCR studies of ABC transcripts after bleomycin treatment failed to detect

88

changes in CatD mRNA (Figure 4.3) despite signiﬁcant increases in CatD activity
(Figure 4.2) and immunoreactive protein by western blotting (Figure 4.4). It is possible
that the relatively few sampling times chosen for realtime analyses of CatD mRNA may
have missed a transient but shortlived increase in the mRNA that might be revealed by a
more exhaustive timecourse study. On the other hand, CatD is known to undergo
activation by proteolytic mechanisms as well; in human U937 cells, CatD was shown to
undergo processing of the inactive prepro- isoform (52kdal) to the active proCatD
(48kdal) and an active 32kdal isoform, in response to autocatalysis of the enzyme
induced by the direct binding of the apoptosis mediator ceramide (Heinrich et al., 1999).
Consistent with those ﬁndings, western blotting of rat AEC lysates did reveal bleomycin-
induced increases in several isoforms of apparent MW 44-52kdal. However, two of the
isoforms shown to be increased in ABC media (52 and 48kdal, see “medium” in Figure
4.4) are larger than the primary isoform detected intracellularly in ABC (44kdal,
“monolayer” in Figure 4.4). This ﬁnding argues against proteolytic processing alone as a
mechanism of CatD activation in AEC. Thus, the exact mechanism(s) by which
bleomycin upregulates CatD in ABC is unknown, but will pose an interesting problem for
future studies. Pepstatin A-inhibitable CatD activity also was upregulated by amiodarone
(Uhal et al., 2003) and TNF-alpha (Wang et al., 2000), both of which induce apoptosis in
AECs (Uhal et al., 2003; Wang et al., 2000), but a determination of whether the
requirement for CatD is universal to all proapoptotic stimuli for AEC will require further
investigation.

In summary, bleomycin upregulated CatD enzymatic activity and immunoreactive protein

in primary cultures of rat alveolar epithelial cells (AEC). Apoptosis of cultured AEC in

89

response to bleomycin was signiﬁcantly inhibited by the aspartyl protease inhibitor
pepstatin A or by antisense oligonucleotides against CatD mRNA. The same inhibitors
also prevented the enzymatic processing of a synthetic fragment of angiotensinogen
(amino acids 1-14), and completely blocked AEC apoptosis in response to the same
peptide. These data are consistent with earlier studies showing that apoptosis of AEC in
response to bleomycin requires the autocrine synthesis and proteolytic processing of
angiotensinogen to angiotensin II, and suggest that the proteolytic processing requires
CatD. The data herein also suggest that blockade of CatD and other aspartyl proteases
might provide a potential strategy for preventing AEC apoptosis and lung injuries that

involve this mode of cell death.

90

Chapter 5
ESSENTIAL ROLES FOR ANGIOTENSIN RECEPTOR ATla in BLEOMYCIN-

INDUCED APOPTOSIS AND LUNG F IBROSIS IN MICE

Xiaopeng Li, Heather Rayford, and Bruce D. Uhal

From the Department of Physiology, Michigan State University,

East Lansing, Michigan

This chapter is published in:

Am J Pathol 2003, 163(6): 2523-2530

91

ABSTRACT:

Apoptosis of alveolar epithelial cells (AECs) has been implicated as a key event in
the pathogenesis of lung ﬁbrosis. Recent studies demonstrated a role for the synthesis and
binding of angiotensin II to receptor ATl in the induction of AEC apoptosis by
bleomycin (BLEO) and other proapoptotic stimuli. On this basis we hypothesized that
BLEO-induced apoptosis and lung ﬁbrosis in mice would be inhibited by the ATI
antagonist losartan (LOS) or by targeted deletion of the AT1 gene. Lung ﬁbrosis was
induced by intratracheal administration of BLEO (1 U/kg) to wild-type C57BL/6J mice.
Co-administration of LOS abrogated BLEO-induced increases in total lung caspase 3
activity detected 6 hours after in vivo administration and reduced by 57% BLEO-induced
caspase 3 activity in blood-depleted lung explants exposed to BLEO ex vivo (both P <
0.05). Co-administration of LOS in vivo reduced DNA fragmentation and
immunoreactive caspase 3 (active form) in AECs, measured at 14 days after intratracheal
BLEO, by 66% and 74%, respectively (both P < 0.05). LOS also inhibited the
accumulation of lung hydroxyproline by 45%. The same three measures of apoptosis and
lung ﬁbrosis were reduced by 89%, 85%, and 75%, respectively (all P < 0.01), in mice
with a targeted disruption of the ATla receptor gene (C57BL/6J-Agtrla‘mlunc). These
data indicate an essential role for angiotensin receptor ATla in the pathogenesis of
BLEO-induced lung ﬁbrosis in mice and suggest that AT1 receptor signaling is required

for BLEO-induced apoptosis of AECs in mice as it is in rat and human AECs.

92

INTRODUCTION:

Idiopathic pulmonary ﬁbrosis is a progressive and often fatal human disease
characterized by inﬁltration of inﬂammatory cells into interstitial and alveolar spaces,
ongoing damage to the lung parenchyma, ﬁbroblast proliferation, and accumulation of
interstitial collagens (Selman et al., 2001). Ongoing evaluations of both older and newer
data have lead to the recent characterization of idiopathic pulmonary ﬁbrosis as a disease
of abnormal wound repair, in which abnormalities in epithelial-mesenchymal interactions
are of key importance (Selman et al., 2001; Gauldie et al., 2002). This evolving theory
about the pathogenesis of idiopathic pulmonary ﬁbrosis is, in some respects, a revival of
the hypothesis ﬁrst put forth by Haschek and Witschi (Haschek and Witschi, 1979) and
Adamson and colleagues (Adamson et al., 1988) that the severity of the ﬁbrogenic
response in the lung is directly related to the severity of epithelial injury. A growing body
of evidence suggests that alveolar epithelial cell (AEC) death by apoptosis is a key event
in the initiation and progression of lung ﬁbrosis. In mice exposed to bleomycin (BLEO)
by intratracheal instillation, up-regulation of the receptor Fas on lung epithelial cells and
F as ligand on inﬁltrating lymphocytes were associated with DNA fragmentation in
epithelia and subsequent accumulation of collagens (Hagimoto et al., 1997a).
Intratracheal instillation of Fas—activating antibodies caused epithelial cell apoptosis and
subsequent collagen accumulation, the severity of which was proportional to the amount
of Fas-activating antibody instilled (Hagimoto et al., 1997b). Other investigators have
shown that BLEO itself induces apoptosis of AECs, which precedes the deposition of
collagens (Wang et al., 2000). More importantly, several groups have found that blockage

of epithelial apoptosis with caspase inhibitors administered in vivo can prevent

93

BLEO-induced lung cell apoptosis and the subsequent accumulation of lung collagens
(Wang et al., 2000; Kuwano et al., 2001)

Recent work from this laboratory has shown that exposure of cultured AECs to F as
ligand (Wang et al., 1999), tumor necrosis factor-a (Wang et al. R, 2000), or BLEO (Li et
al., 2003) all induce expression of angiotensinogen mRNA and protein, and its cleavage
to the peptide angiotensin II (ANGII). Moreover, apoptosis of cultured AECs in response
to these apoptosis inducers was abrogated by antagonists of ANG receptor AT1, such as
losartan (LOS) or L158809 (Li et al., 2003; Uhal et al., 2003; Filippatos and Uhal, 2003)
For all these reasons, it was hypothesized that angiotensin receptor AT1 is essential for
ABC apoptosis and lung ﬁbrosis in vivo. To test this theory, normal mice and mice
deﬁcient in ANG receptor ATla, the AT1 subtype expressed in lung (Burson et al.,
1994), were subjected to intratracheal BLEO administration and quantitation of apoptosis
and lung collagens. We report here the prevention of both BLEO-induced AEC apoptosis
and lung collagen accumulation in mice by administration of the AT1-selective receptor

antagonist LOS or by targeted deletion of the ATla receptor gene.

94

MATERIALS AND METHODS

Reagents and Materials

The AT1-selective antagonist LOS was obtained from Merck and Co., West Point, PA.
Alkaline phosphataseconjugated streptavidin, digoxigenin-labeled deoxyuridine
trisphosphate (dig-dUTP), and biotinylated deoxyuridine trisphosphate (bio—dUTP) were
obtained from Boehringer Mannheim, Indianapolis, IN. BLEO was obtained from Sigma
Chemical Co., Saint Louis, MO. Reagents for detection of alkaline phosphatase and other
secondary reagents for in situ end labeling (ISEL) of DNA or Western blotting were from
sources described earlier (Wang et al., 2000). All other materials were of reagent grade

and were obtained from Sigma Chemical Co.

Animals, Induction of Pulmonary Fibrosis, and Surgical Procedures

All mice were obtained from The Jackson Laboratories, Bar Harbor, ME, and were
housed in a satellite facility of University Laboratory Animal Resources, Michigan State
University. Control animals were wild-type C57BL/6J mice used at 7 to 8 weeks of age.
Some experiments also used mice of the same genetic background but with a targeted
disruption in the ANG receptor ATla gene (C57BL/6J-Agtr1a’mwm) that removes a
portion of the coding region sufﬁcient to eliminate speciﬁc binding of AT1-selective
agonists in all organs tested (Ito et al., 1995). Heterozygous animals were used on the

basis of availability at the same age and body weight as wild types.

Induction of Lung Injury and Fibrosis

95

Animals under pentobarbital anesthesia received a single intratracheal instillation of
bleomycin sulfate (BLEO) at 1 U/ kg body weight, in 50 pl of sterile saline. The 50-111
dose was instilled at end-expiration, and the liquid was followed immediately by 300 pl
of air to ensure delivery to the distal airways. Control animals were instilled with an
equal volume of sterile saline. In some studies the AT1 receptor antagonist LOS was
added to the intratracheal instillate at 20 umol/L; the same animals also received daily
intraperitoneal injections of LOS at 10 mg/kg in sterile saline throughout the test interval.
Other treatment groups received daily intraperitoneal sham injections of the saline alone.
LOS or sham injections were continued for 14 days after instillation of BLEO, at which
point all animals were sacriﬁced for histology, detection of collagen or DNA

fragmentation, and caspase-3 activation in epithelial cells.

Surgical Procedures

Immediately before sacriﬁce, animals were given intraperitoneal injections of sodium
pentobarbital and the trachea was cannulated. The left lung was ligated at the hilus,
excised distal to the ligation, and immediately frozen in liquid N2 for hydroxyproline
assay of total collagen (see below). The remaining lung tissues were carefully removed
and were instilled with 4% paraforrnaldehyde in phosphate-buffered saline (PBS) at 20
cm of H20 constant pressure, then immersed in the same ﬁxative for 30 minutes followed
by storage in 70% ethanol. The ﬁxed tissues were washed with PBS three times for 15
minutes and were then embedded in parafﬁn. Five 11m sections of lung were
deparafﬁnized by passing through xylene, xylene: alcohol 1:], 100% alcohol, and 70%

alcohol for 10 minutes each. Ethanol was removing by rinsing with distilled water.

96

Lung Explant Culture

Explants of 1 mm2 were prepared by mincing of blood depleted (PBS-perfused) mouse
lung, and were cultured in Transwell polycarbonate inserts (3.0um pore; Costar, Corning,
NY) under a thin layer (1 mm) of Dulbecco’s modiﬁed Eagle’s medium cell culture
medium to facilitate gas exchange (Taylor et al., 2000). All explants were obtained from
normal mouse lung that was PBS-perfused in situ before excision of the lungs. After
excision of the lungs, treatment with BLEO or LOS was initiated ex vivo by intratracheal
instillation of BLEO at 25 mU/ml in 300 pl of sterile Dulbecco’s modiﬁed Eagle’s
medium (+/- LOS at 10’6 mol/L). The culture medium for explants also contained BLEO
at 25 mU/ml, +/- LOS at 10'6 mol/L. Explants were harvested by transfer into liquid N2

and storage at -80°C until assay.

Identification and Quantitation of Apoptotic Cells and Total Lung Caspase 3
Activity

Localization of DNA Fragmentation

ISEL of fragmented DNA was conducted by a modiﬁcation of the method of Mundle and
colleagues (Mundle et al., 1994). Brieﬂy, ethanol was removed from deparafﬁnized lung
sections by rinsing in distilled water for at least 10 minutes. The slides were then placed
in 3% hydrogen peroxide (Sigma Chemical Co.) for 30 minutes at 20°C, rinsed with PBS,
and incubated with Proteinase K (Sigma) in standard saline citrate for 15 minutes at
37°C. Samples were rinsed once in water, three times in 0.15 mol/L PBS for 4 minutes

each, and were then incubated in standard saline citrate (0.3 mol/L NaCl and 30 mmol/L

97

sodium citrate in water, pH 7.0) at 80°C for 20 minutes. After four rinses in PBS and four
rinses in buffer A (50 mmol/L Tris/HCl, 5 mmol/L MgCl, 10 mmol/L B-
mercaptoethanol, and 0.005% bovine serum albumin in water, pH 7.5), the sections were
incubated at 18°C for 2 hours with ISEL solution (0.001mmol/L digoxigenin-dUTP; 20
U/ml DNA Polymerase I; and 0.01 mmol/L each of dATP, dCTP, and dGTP in buffer A).
Afterward the sections were rinsed thoroughly ﬁve times with buffer A and three
additional times in PBS. Detection of incorporated dUTP was achieved with by
incubation for 2 hours at 37°C with AP-conjugated antidigoxigenin (Boehringer
Mannheim) at 1/400 dilution. Bound AP-antibody was then detected with the Fast Blue
chromogen system and the sections were mounted with F luoromount solution (Southern

Biotechnology, Birmingham, AL).

Immunohistochemistry (IHC) for Activated Caspase 3

IHC was performed with an antibody that recognizes only the active form of the enzyme
(BioVision, MountainView, CA). Deparafﬁnized lung sections were blocked with a
solution of 3% bovine serum albumin in PBS for 1 hour; the primary antibody was then
applied overnight at 4°C in 3% bovine serum albumin/PBS. After washing in PBS, the
antibody was detected with a biotin-conjugated secondary antibody and avidin-linked
chromogen system. Type II pneumocytes were identiﬁed with the anticytokeratin
antibody MNF 116, an established marker of type II cells (Fehrenbach et al., 2000).
Detection of mouse lung antigens with this mouse monoclonal antibody was achieved
with the Mouse-on-Mouse Iso-IHC kit (InnoGenex, San Ramon, CA) according to the

manufacturer’s instructions.

98

For quantitation of ISEL- or caspase 3-positive epithelial cells, the number of positive
cells within the surfaces of the alveolar walls was counted in a minimum of six randomly
selected x 400 microscopic ﬁelds per lung section. Positive cells within the alveolar
airspaces, or otherwise clearly not within the surface of the alveolar wall, were not
scored. The counts of positive nuclei per ﬁeld were expressed as a percentage of the total
number of nuclei in the same microscopic ﬁeld. Sections from each of at least ﬁve mice

per treatment group were analyzed by an investigator blinded to sample identity.

Caspase 3 Enzyme Activity

Assay of total lung caspase-3 enzyme activity was conducted with a commercially
available kit (Molecular Probes, Eugene, OR). Fast-frozen lung was homogenized in
assay kit buffer and was analyzed according to the manufacturer’s instructions on a
Biotek FL600 ﬂuorescence plate reader. In all samples, speciﬁcity of the reaction for
caspase 3 was veriﬁed by abrogation of the signal with a caspase 3-selective irreversible

inhibitor (data not shown).

Quantitation of Lung Collagen

For quantitation of total lung collagen, tissues frozen in liquid N2 were dried to constant
weight in preweighed tubes at 80°C. The weighed dry tissue was hydrolyzed in 6 N HCl
and was subjected to determination of hydroxyproline as described earlier by Woessner
(Woessner, 1961) The efﬁciency of the hydrolysis was veriﬁed with rat-tail collagen by
comparison to standard hydroxyproline (Sigma Chemical Co.).

Attention: Images in this dissertation are presented in color.

99

RESULTS

Quantitation of Apoptosis and Lung Injury

On the basis of earlier work with rat models (Wang et al., 2000; Li et al., 2003), we
hypothesized that BLEO would induce apoptosis of mouse lung AECs that might be
detected in situ by end labeling of fragmented DNA or by IHC for the active form of
caspase 3. Consistent with this expectation, intratracheal instillation of BLEO caused
increased ISEL and positive caspase 3 IHC within cells in the surfaces of alveolar
corners, the expected locations of type II pneumocytes (Figure 5.1; B, F, and G, arrows;
see subsequent ﬁgures for quantitation). Many ISEL- or caspase 3-positive cells
colocalized with positive immunoreactivity to monoclonal antibody MNF116 (Figure
5.1C), an established marker of type II pneumocytes (Fehrenbach et al., 2000).
Interestingly, MNFl l6 immunoreactivity was observed in relatively normal regions of
BLEO-exposed lung (Figure 5.1D, right) but not in more severely affected regions
(Figure 5.1D, left), consistent with the elimination of type II cells in these areas. Co-
administration of the AT1 receptor antagonist LOS with the BLEO (Figure 5.1H)
signiﬁcantly reduced caspase 3 IHC (see below for quantitation).

The instillation of BLEO also resulted in histological changes typical of BLEO-induced
lung ﬁbrosis by day 14 after instillation (Figure 5.2). These include the inﬁltration of
inﬂammatory cells, thickening of alveolar walls, and collagen accumulation (Figure
5.2B); for quantitation, see Figures 5.5 and 5.7 below. Again, the co-administration of
LOS with the BLEO (Figure 5.2C) signiﬁcantly reduced the alterations in lung

morphology and collagen deposition (see below).

100

Inhibition of Apoptosis and Collagen Deposition by an AT1 Antagonist

Apoptosis also was detected as an increase in the total activity of caspase 3 in lung tissue,
measured by enzyme assay of lung homogenates. As early as 6 hours after instillation of
BLEO intratracheally (Figure 5.3A), lung caspase-3 activity was increased 100%, but the
increase was prevented by co-administration of the AT1 receptor antagonist LOS (see
Materials and Methods). In Figure 5.3B, BLEO also increased caspase-3 activity when
applied in vitro at 25 mU/ml to mouse lung explants that were depleted of blood before
explant culture. Application of BLEO in vitro increased caspase-3 activity in the explants
by nearly 100% in 24 hours (P <0.05), but LOS (10'6 mol/L) inhibited the increase by
57%. The ability of LOS to inhibit lung epithelial apoptosis was also observed in vivo at
14 days after BLEO administration. In Figure 5.4A, intratracheal BLEO increased the
abundance of ISEL-positive cells by ll-fold (P < 0.01), but LOS inhibited the increase
by 66% (P < 0.05). Similarly, intratracheal BLEO increased the number of caspase 3-
positive cells by 25-fold (Figure 5.4B, P < 0.01), but LOS blocked the increase by 74%
(P < 0.05). Measurement of lung collagen accumulation in the same animals by
hydroxyproline assay (Figure 5.5) revealed an increase in total lung collagen of 56% by
14 days aﬁer intratracheal BLEO, but LOS reduced the increase by 45%, to a value not

signiﬁcantly different from the control (CTL).

Inhibition of Apoptosis and Collagen Deposition by AT1 Gene Deletion
Receptor subtype ATla is the AT1 isoform expressed in the lungs of mice (Burson et al.,
1994). To test the hypothesis that angiotensin receptor AT1 is essential for BLEO-

induced epithelial apoptosis and lung ﬁbrogenesis, heterozygous ATla-null mice were

101

exposed to intratracheal BLEO in the same manner as wild-type mice of the same genetic
background. In Figure 5.6, the deletion of one allele of the ATla gene (+/-) reduced
BLEO-induced ISEL by 89% (Figure 5.6A) and inhibited BLEO-induced caspase 3 IHC
by 85% (Figure 5.6B), both relative to the response in wild-type mice (**, P <0.01).

When the susceptibility of the same mice to BLEOinduced ﬁbrosis was measured,
heterozygous ATla-null mice did not exhibit a statistically signiﬁcant increase in lung
hydroxyproline at 14 days after intratracheal BLEO (Figure 5.7A), in contrast to wild-
type mice. Expression of the hydroxyproline data as the absolute amount of collagen per
left lung (Figure 5.7B) suggested that unchallenged ATla +/- mice, of the same age and
body weight as the wild types, have more total collagen per leﬁ lung at baseline relative

to wild-type mice, but the difference was not statistically signiﬁcant.

102

 

103

Figure 5.1. Detection of DNA fragmentation, activation of caspase 3, and alveolar type II
pneumocytes in mouse lung. Deparafﬁnized lung sections were prepared from mice
instilled intratracheally 14 days earlier with sterile saline (A, C, and E) or BLEO (B, D,
F, and G). The sections were subjected to ISEL of fragmented DNA (A and B) or IHC
with antibodies against the active form of caspase 3 (E—H) or with the type II cell-
speciﬁc antibodyMNFll6 (C and D). G: Higher magniﬁcation of active caspase 3
labeling in F. H: Active caspase 3 labeling in mice treated with BLEO and LOS, an AT1
receptor antagonist. Note ISEL and active caspase 3 labeling in cells in the comers of
alveolar walls in the lungs of BLEO-treated mice (B, F, and G, arrowheads) but not in
saline-treated mice (A and E) or in mice treated with BLEO and LOS (H). Note also the
co-localization of MNF116 (C) with anti-caspase 3 IHC (G) or ISEL (B) in BLEO-
treated lungs. D reveals labeling of the type 11 cell marker MNF116 in relatively normal
regions of BLEOtreated lung (D, right) but not in more severely affected regions (D,
leﬁ). See text for details. Original magniﬁcations: X400 (A, B, C, G); X200 (D); X100

(E, F, H).

104

 

Figure 5.2. Histology of mouse lungs at 14 days after instillation of BLEO. A—C:
Hematoxylin and eosin preparations of mouse lung instilled intrauacheallyl4 days earlier
with sterile saline (A), BLEO (B), or BLEO and LOS (C). See text and Materials and

Methods section for details. Original magniﬁcations X200.

105

 

mU/mg protein

 

Caspase 3 Activity, Caspase 3 Activity,
mU/mg protein

 

 

 

CTL BLEO BLEO
+LOS

Figure 5.3. The AT1—selective receptor antagonist LOS inhibits BLEO-induced activation
of caspase 3. A: BLEO was instilled intratracheally into normal mice with and without
LOS in the intratracheal instillate (see Materials and Methods). Six hours later, the lungs
were perfused to remove blood, excised, and the enzymatic activity of caspase 3 was
measured in lung homogenates. B: Lung explants were prepared from normal mouse lung
tissue perfused before excision (see Materials and Methods). BLEO (25 mU/ml) was

applied in serum-free culture medium for 24 hours in the presence or absence of LOS
(10’6mol/L). Bars are the means 3: SEM ofn = 6; *, P < 0.05 versus control (CTL); ** , P

< 0.05 versus BLEOiLOS by analysis of variance and Student-Newman-Keul’s test.

106

 

3518

 

of Alveolar Walls,%

 

III
6

 

 

Active Caspase 3+ cells ISEL+ cells in Surface

 

in Alveolar Walls,%

C TL BLE 0 BLE 0+L0 S

Figure 5.4. AT1 receptor blockade inhibits DNA fragmentation and caspase-3 activation
in lung epithelial cells 14 days after BLEO instillation. Normal mice were given a single
intratracheal instillation of BLEO in the presence or absence of LOS in the instillate.
LOS also was administered thereafter daily intraperitoneally. Fourteen days later, lung
sections were prepared and labeled by ISEL (A) or by IHC for the active form of caspase
3 (B). Labeling was quantitated in cells within the alveolar surfaces (see Figure 1C). Bars
are the means :1: SEM of n = 6; *, P < 0.01 versus control (CTL); **, P < 0.05 versus

BLEO by analysis of variance and Student-Newman-Keul’s test.

107

 

i—s
{xi-36%:
GGOGG

 

 

 

HP/Left Lung, 11g

6

CTL BLEO BLEO
+LOS

Figure 5.5. AT1 receptor blockade inhibits lung collagen accumulation at 14 days after
BLEO instillation. Normal mice were administered BLEO in the presence or absence of
LOS as described in Figure 5.3. Fourteen days later, total lung collagen was determined
by assay of total hydroxyproline (HP) in hydrolyzed lung tissue (see Materials and
Methods). Bars are the means i SEM of n = 6; *, P < 0.05 versus control (CTL) by

analysis of variance and Student-Newman-Keul’s test.

108

 

OF ALVEOLAR WALLS, %

 

 

 

 

CASP3+ CELLS IN SURFACE ISEL+ CELLS IN SURFACES

OF ALVEO LAR WALLS, “/0

Bleo: - + - +

Figure 5.6. Mice deﬁcient in angiotensin receptor ATla exhibit reduced DNA
fragmentation and caspase-3 activation in lung epithelial cells 14 days after BLEO
instillation. Normal [wild type (w.t.)] or heterozygous ATla knockout mice (+/-) were
administered BLEO intratracheally as in Figure 5.3. Fourteen days later, lung sections
were prepared and labeled by ISEL (A) or by IHC for the active form of caspase 3 (B),
which were quantitated as described in Figure 5.4 and Materials and Methods. Bars are
the means i SEM of n = 5; *, P < 0.001 versus wild-type unchallenged (w.t. - BLEO);
**, P < 0.01 versus wild-type challenged (w.t. + BLEO) by analysis of variance and

Student-Newman-Keul’s test.

109

w.t. w.t. +/- +/-
.A *

 

§ E

% of Control
g

 

 

 

 

I-IP/Left Lung, pg HP/Left Lung
é

 

O

Bleo: - + - +

Figure 5.7. Mice deﬁcient in angiotensin receptor ATla exhibit reduced lung collagen
accumulation in response to BLEO instillation. Normal [wild type (w.t.)] or heterozygous
ATla knockout mice (+/-) were administered BLEO intratracheally as in Figure 5.3.
Fourteen days later lung tissue was fast-frozen, hydrolyzed, and total collagen was
measured by hydroxyproline assay (HP) as described in Materials and Methods. A: HP
data are expressed as a percentage of the corresponding control (— BLEO). B: Data are
expressed as the absolute amount of HP per left lung. Bars are the means i SEM of n = 5;

*, P < 0.01 versus untreated (- BLEO) by analysis of variance and Student-Newman-

Keul’s test.

110

DISCUSSION

Inhibitors of angiotensin-converting enzyme (ACE) or antagonists of ANG receptor AT1
have been shown to have anti-apoptotic and anti-ﬁbrotic effects in the heart (Sun and
Weber, 1998), kidney (Mezzano et al., 2001), and liver (Yoshiji et al., 2001). The ﬁrst
reports of anti-ﬁbrotic actions in the lung by the ACE inhibitor captopril, published many
years ago (Molteni et al., 1985; Ward et al., 1990), were recently extended by the
demonstration that the AT1 antagonists LOS and L158809 have even more potent anti-
ﬁbrotic potential in the lungs than do ACE inhibitors (Molteni et al., 2000). The present
work extends those observations by showing that at least one of the mechanisms by
which AT1 antagonists act is through the inhibition of apoptosis in AECs. Other potential
mechanisms by which AT1 antagonists might act on the lung in vivo, a topic recently
reviewed by Marshall (Marshall, 2003), include decreased vascular tone, decreased
vascular permeability, and altered ﬁbroblast activity. At least some of these actions could
be envisioned to be related to the ability of ACE inhibitors or AT1 antagonists to reduce
blood pressure. Indeed, the AT1-null mice used here were shown earlier to exhibit
reductions in systemic blood pressure of about 12 mm Hg for heterozygous animals at
baseline. Thus, it is possible that some of the anti-ﬁbrotic actions of LOS or ATla
deletion might be related to lowered systemic or pulmonary hydrostatic pressures, and the
data herein do not strictly exclude that possibility. On the other hand, the ability of LOS
to prevent caspase-3 activation by BLEO in cultured lung explants (Figure 5.3B) argues
against the involvement of decreased blood pressure in the inhibition of apoptosis

because no hydrostatic pressure changes occur in explants manipulated ex vivo.

lll

Moreover, the induction of LOS-inhibitable caspase 3 activities in lung explants, depleted
of blood by previous PBS perﬁrsion, and argues against a primary role for blood-derived
cells in the initiation of the apoptosis. This experiment also supports the theory that the
inhibitory effect of LOS on apoptosis was not mediated by an indirect action on
inﬁltrating inﬂammatory cells. The initial protocol for the reported in vivo studies was

designed to determine whether blockade or deletion of the AT1 receptor, throughout the
time course of the 14- day BLEO model, was capable of inhibiting or blocking the
apoptotic and ﬁbrotic responses. The success of this strategy, particularly in light of the
many known functions of angiotensin discussed in preceding paragraphs, raises the
interesting question of whether the blockage of ﬁbrogenesis was due to the acute or
delayed consequences of AT1 blockade. Although a time course study of various LOS
administration protocols was not performed, quantitation of the number of erythrocytes
reaching the alveolar airspaces by 6 hours aﬁer BLEO (a crude index of lung barrier
collapse) suggested that LOS did not prevent acute, transient barrier collapse (data not
shown) despite its ability to reduce caspase 3 activation at the same sampling time
(Figure 5.3). This observation, although very preliminary, is consistent with the theory
that the blockage of apoptosis in AECs is a key to the subsequent blockade of collagen
deposition. In contrast, blockage of receptor AT1 may also inhibit mitosis of lung
ﬁbroblasts (Marshall et al., 2000) and reduce collagen synthesis by the same cells
(Marshall et al., 2004) relatively delayed effects that might be independent of AEC
apoptosis at early time points. Moreover, endothelial cells also express receptor AT1 and
undergo apoptosis in response to angiotensin, albeit at relatively high concentrations

(Dimmeler et al., 1997; Li et al., 1999) and other cell types resident in the lung are known

112

to respond to angiotensin in ways currently under intense study (Harrison et al., 2003).
Thus, it is possible that the acute early effects of AT1 blockade on AEC apoptosis

are not necessary for inhibition of collagen deposition at later time points, and this study
does not exclude that possibility. On the other hand, earlier work has shown that AECs
undergoing apoptosis in response to F as ligand, tumor necrosis factor-a or BLEO begin
secreting angiotensin into the extracellular space within hours of exposure (Wang et al.,
1999; Wang et al., 2000; Li et al., 2003), at least in vitro. Those studies also showed that
the autocrine production of angiotensin and its binding to receptor AT1 on AECs were
required for apoptosis in response to these agents; this mechanism can explain the ability
of LOS to block AEC apoptosis in vivo in the present study. Moreover, previous studies
with apoptosis inhibitors support the contention that the acute apoptotic response is a
pivotal event in the BLEO model. Wang and colleagues (Wang et al., 2000) showed that
the ACE inhibitor captopril or the caspase inhibitor ZVAD-fmk had essentially equal
ability to block the appearance of apoptotic epithelial cells in rats exposed to intratracheal
BLEO and to prevent subsequent collagen deposition (Wang et al., 2000). That report,
which was conﬁrmed by Kuwano and colleagues (Kuwano et al., 2001) in studies of mice
exposed to BLEO and/or ZVADfmk, suggested that the blockade of ﬁbrogenesis by
captopril was indeed related to inhibition of apoptosis, rather than the many other effects
of ACE inhibition in vivo (Marshall, 2003). Later work conﬁrmed that the ZVAD
compound had no inhibitory effect on angiotensin converting enzyme itself (F ilippatos
and Uhal, 2003). Thus, the present data are consistent with the ability of ACE inhibition
by captopril to block both AEC apoptosis and collagen deposition in rats (Wang et al.,

2000), and extend this concept to angiotensin receptor blockade in mice. The data herein

ll3

also are in agreement with recent reports that LOS inhibits BLEO-induced collagen
deposition in rat lung (Fang et al., 2002) and that ATla-null mice show reduced liver
ﬁbrosis in response to carbon tetrachloride (Kanno et al., 2003). The AT1 receptor is
expressed as two isoforms, ATla and Ale, for which no selective antagonists have yet
been developed (Filippatos et al., 2001). Subtype ATla is known to be expressed in the
lungs of mice, but Ale was not detected in mouse lung by reverse transcriptase-
polymerase chain reaction (Burson et al., 1994). Although it is possible that cells of
minor abundance in the lung, such as type II cells, might express Ale in quantities not
detected in earlier studies, the primary isolates of type II pneumocytes from Wistar rats
did not reveal Ale expression by reverse transcriptase- polymerase chain reaction
despite the use of two different primer sets and high-ampliﬁcation cycle numbers (data
not shown). In any case, the ﬁnding that deletion of only one allele of the ATla gene
signiﬁcantly supports the notion that ATla is the only active AT1 receptor subtype on the
alveolar epithelium of mice.

In an earlier report describing the mechanisms by which angiotensin induces apoptosis in
primary cultures of AECs, Papp and colleagues (Papp et al., 2002) showed that blockage
of AT1 signaling through protein kinase C (PKC) with the speciﬁc PKC inhibitor
chelerythrin could attenuate the apoptotic response to angiotensin. This ﬁnding is
consistent with the known role of PKC in AT1 signaling in a variety of cell types (Li et
al., 1999), but the pathways from PKC to the effector caspase 3, which is also required
for this response (Papp et al., 2002), are currently unknown. Given that ABC apoptosis in
response to Fas ligand, tumor necrosis factor- a, or BLEO all require the autocrine

production and binding of angiotensin to AT] (Wang et al., 1999; Wang et al., 2000; Li

“4

et al., 2003), the report of Papp and colleagues (Papp et al., 2002) suggests that PKC
inhibitors would also block AEC apoptosis in response to these agents in vivo as well.
This prediction was not tested in the present study, but will be an interesting topic for
future inquiry.

In summary, BLEO-induced apoptosis of lung epithelial cells in mice was signiﬁcantly
inhibited by the AT1- selective angiotensin receptor antagonist LOS or by targeted
deletion of the gene for angiotensin receptor subtype ATla. Both methods of reducing
AT1 action also reduced or abrogated lung collagen accumulation in response to BLEO
challenge. These data agree with earlier demonstrations of the anti-ﬁbrotic action of ACE
inhibitors and AT1-selective antagonists in rat models of lung ﬁbrosis, and with in vitro
studies showing a role for receptor AT1 in mediating apoptosis of AECS. They also
suggest the possibility that AT1 antagonists may hold potential for the treatment of lung
ﬁbrosis in humans; this possibility is supported by the recent ﬁnding that patients with
pulmonary ﬁbrosis have a higher frequency of the D allele of angiotensin-converting
enzyme (Morrison et al., 2001), a deletion polymorphism that confers higher levels of

ACE.

115

Chapter 6

ATTENUATION OF BLEOMYCIN-INDUCED PULMONARY FIBROSIS BY

INTRATRACHEAL ADMINISTRATION OF ANTISENSE OLlGO-

NUCLEOTIDES AGAINST ANGIOTENSINOGEN mRN A

Xiaopeng Li, J iaju Zhuang, Heather Rayford, Huiying Zhang, Ruijie Shu and

Bruce D. Uhal

Department of Physiology, Michigan State University, East Lansing, Michigan, USA

116

ABSTRACT:

Apoptosis of alveolar epithelial cells (AECs) is believed to be critical for the
development of bleomycin-induced pulmonary ﬁbrosis. Angiotensin II is generated by
AECs undergoing apoptosis and by human lung myoﬁbroblasts isolated from IPF patient
biopsies (Am J Physiol. 277:L1245-L1250, 1999; Am J Physiol. 277:L1158-L1164,
1999). Previous studies showed that apoptosis of alveolar epithelial cells in response to
bleomycin could be abrogated by antisense oligonucleotides against angiotensinogen
(ANGEN) mRNA and requires angiotensin II synthesis de novo (Am J Physiol Lung Cell
Mol Physiol 284: L501-L507, 2003). Here we hypothesized that blockade of local
pulmonary ANG II synthesis by intratracheal administration of antisense oligonucleotides
against ANGEN mRNA might attenuate bleomycin-induced apoptosis of AECs and
pulmonary ﬁbrosis. Male Wistar rats received 8 U/kg of bleomycin sulfate or vehicle
intratracheally. Endogenous lung ANGEN was upregulated in vivo as early as 3 hours
after bleomycin instillation in rat lungs by RT-PCR, in situ hybridization and
immunohistochemistry staining methods. ANGEN mRN A and angiotensin peptides were
localized in alveolar wall cells in the alveolar comers, tentatively identiﬁed as type II
cells, and also colocalized with alpha-Smooth Muscle Actin (a-SMA). Labeled antisense
administered by intratracheal instillation was speciﬁcally accumulated in the lung
compared to liver and kidney, and localized primarily in the epithelium of airways and
cells within alveolar walls. Intratracheal instillation of 75ug antisense reduced
bleomycin—induced pulmonary ﬁbrosis detected by hydroxyproline assay; decreased
ANGEN and active caspase-3 protein detected by western blot and reduced the ISEL

positive cells, but had no effect on the serum ANG II level. These data are consistent with

117

the hypothesis that lung-derived ANGEN is involved in bleomycin-induced pulmonary

ﬁbrosis.

118

INTRODUCTION :

Idiopathic Pulmonary ﬁbrosis (IPF) is a pathological condition resulting from injury to
the lung and an ensuing ﬁbrotic response leading to thickening of the alveolar walls and
the obliteration of the alveolar space without known etiology (F onseca C et al., 2000). In
IPF the normal architecture and functional integrity of the lung are destroyed. The main
histological features of the ﬁbrotic lung are persistent and unrepaired epithelial damage,
proliferation and accumulation of ﬁbroblast/ myoﬁbroblast cells, and increased collagen
deposition (Selman et al., 2001). Unfortunately, despite years of research on its
pathogenesis, the treatment of IPF has not been successful. The traditional therapeutic
approaches using potent anti-inﬂammatory agents supplemented with an
immunosuppressive agent could only offer a marginal beneﬁt at best (King et al., 2000).
Recent NHLBI Workshops have concluded that our current understanding of the
pathogenesis of the IPF is incomplete (Mason et al., 1999; Crystal et al., 2002). Current
evolving hypothesis about pathogenesis is that IPF results from the epithelial microfoci
injury and a failure of reepithelization (Selman et al., 2001, Gauldie et al., 2002).
Haschek and Witschi ﬁrst proposed this hypothesis more than 20 years ago, who believe
that epithelial damage drives ﬁbrogenesis and efficient epithelialization would prevent
ﬁbrogenesis (Haschek et al., 1979; Witschi H., 1990).

Recent studies in our lab and others using bleomycin-treated rat and mouse models
strongly suggested a role of epithelial apoptosis as the proﬁbrotic event in ﬁbrogenesis.
The evidences include: First, apoptosis of AECs was found in both patients with IPF

(Uhal, et al., 1998) and animal models (Hagimoto, et al., 1997). Second, induction of

119

apoptosis in the epithelium is sufﬁcient to initiate a ﬁbrotic response (Hagimoto N. et al.,
1997). Third, several labs showed that blockade of the apoptosis could prevent ﬁbrotic
response (Wang, et al., 2000; Kuwano et al., 2001). These studies support the “Witschi
Hypothesis” regarding the pathogenesis of pulmonary ﬁbrosis that is PF results from the
epithelial injury and failure to reepithelization. Results obtained from studies on human
lungs are consistent with those on animal models. Fragmented DNA, the hallmark of
apoptosis, in bronchiolar and AECs were found in lung biopsies from patients with IPF
(Kuwano et a1, 1996). Our lab conﬁrmed this result by showing the simultaneous double
labeling of fragmented DNA and alpha-smooth muscle actin (a-SMA), the marker for
myoﬁbroblast, in biopsies from patients with IPF (Uhal et al., 1998). Fragmented DNA in
the alveolar epithelium was found frequently and immediately adjacent to a-SMA-
positive interstitial cells. Thus, epithelial apoptosis colocalizes with myoﬁbroblast where
collagen deposition is severe, at least in patients with IPF.

Recent work from this laboratory has shown that exposure of cultured AECs to Fas
ligand (Wang et al., 1999), tumor necrosis factor-a (Wang et al., 2000), or BLEO (Li et
al., 2003) all induce expression of angiotensinogen mRNA and protein, and its cleavage
to the peptide angiotensin II (ANGII). Moreover, apoptosis of cultured AECS in response
to these apoptosis inducers was abrogated by antisense oligonucleotides against ANGEN
mRNA (Li et al., 2003; Uhal et al., 2003; Filippatos and Uhal, 2003). For all these
reasons, it was hypothesized that blockade of local pulmonary ANG II synthesis by
administration of antisense oligonucleotides against ANGEN mRNA might attenuate
bleomycin-induced apoptosis of AECs and pulmonary ﬁbrosis. To test this theory,

normal rats and explants were subjected to intratracheal BLEO administration and

120

quantitation of apoptosis and lung collagens. We report here the prevention of both
BLEO-induced AEC apoptosis and lung collagen accumulation in whole animals and

explants by administration of the antisense oligonucleotides against ANGEN mRNA.

121

MATERIALS AND METHODS

Reagents and Materials

Phosphorothioated control and antisense oligonucleotides against angiotensinogen (18-
mers) were synthesized and purchased from Genemed Synthesis (San Francisco, CA).
Alkaline phosphataseconjugated streptavidin, digoxigenin-labeled deoxyuridine
trisphosphate (dig-dUTP), and biotinylated deoxyuridine trisphosphate (bio-dUTP) were
obtained from Boehringer Mannheim, Indianapolis, IN. BLEO was obtained from Sigma
Chemical Co., Saint Louis, MO. Reagents for detection of alkaline phosphatase and other
secondary reagents for in situ end labeling (ISEL) of DNA or Western blotting were from
sources described earlier (Wang et al., 2000). All other materials were of reagent grade

and were obtained from Sigma Chemical Co.

Animals, Induction of Pulmonary Fibrosis, and Surgical Procedures:

Induction of Lung Injury and Fibrosis

Adult male Wistar rats, 150-200 g, were housed in a satellite facility of University
Laboratory Animal Resources, Michigan State University. Animals under pentobarbital
anesthesia received a single intratracheal instillation of bleomycin sulfate (BLEO) at 8 U/
kg body weight, in 400 pl of sterile saline. The 400-111 dose was instilled at end-
expiration, and the liquid was followed immediately by 2ml of air to ensure delivery to
the distal airways. Control animals were instilled with an equal volume of sterile saline
by using previously published protocols (Wang et al., 2000). And lung tissue was
perfused with PBS and harvested at 3 hours, 6 hours, 24 hours, or 2,7,14 days after

instillation of bleomycin. ANGEN mRNA was detected by semiquantitative RTPCR and

122

in situ hybridization. Double immunolabeling was performed by using Anti-ANG I,
lectin or Anti-alpha smooth muscle actin (a-SMA) antibody to identify the cellular source
of ANGEN/ANG 1 protein. ANG II in perfused lung tissue was measured by ELISA kit
speciﬁc for ANG II.

Intratracheal delivery of antisense in vivo

Fluorescent (BODIPY)-labeled 18-mer antisense phosphorothioated oligonucleotides
against ANGEN were synthesized and used in a series of instillations of bare
oligonucleotide at 4 different doses: 150, 75, 25 and 10ug in 400ul PBS, each of which
were instilled one time I.T. into Wistar rats. 2 hours later, the lungs, livers and kidneys
were excised. One half tissue was immediately frozen in liquid nitrogen and the other
half was processed by a standard protocol for the preparation of frozen sections. Frozen
tissues in dry ice were sent to the histology lab at Michigan State University for frozen
cryostat sectioning. In order to demonstrate individual cells, all sections were incubated
with P1 to stain the cell nuclei. Sections then were examined under ﬂuorescence
microscope.

In some studies antisense oligonucleotides against ANGEN mRNA and scramble
oligonucleotides was added to the intratracheal instillate at the dose of 75ug/rat. 14 days
after instillation of BLEO with or without oligonucleotides, all animals were sacriﬁced
for histology, detection of collagen or DNA fragmentation, and caspase 3 activation in
epithelial cells.

Surgical Procedures

Immediately before sacriﬁce, animals were given intraperitoneal injections of sodium

pentobarbital and the trachea was cannulated. Aﬁer perfusion by PBS, the left lung was

123

ligated at the hilus, excised distal to the ligation, and immediately frozen in liquid N2 for
hydroxyproline assay of total collagen (see below). The remaining lung tissues were
carefully removed and were instilled with 4% parafonnaldehyde in phosphate-buffered
saline (PBS) at 20 cm of H20 constant pressure, then immersed in the same ﬁxative for
30 minutes followed by storage in 70% ethanol. The ﬁxed tissues were washed with PBS
three times for 15 minutes and were then embedded in parafﬁn. Five um sections of lung
were deparafﬁnized by passing through xylene, xylene: alcohol 1:1, 100% alcohol, and

70% alcohol for 10 minutes each. Ethanol was removing by rinsing with distilled water.

Lung Explant Culture

Normal rat lungs were removed and perfused with PBS to ﬂush the blood out. Tracheas
were cannulated and DMEM contains bleomycin (25mU/ml) alone or with
oligonuclitides (40nm) were instilled. Medium ﬁlled lungs were then cut into 1 mm
square pieces. As suggested in other lung tissue culture study (Taylor et al., 2000), the
minced lung chunks were plated into transwell polycarbonate inserts (0.4 um pore) and
covered by a thin layer (1 mm) of culture medium with 10% fetal bovine serum (FBS) or
1% insulin-transferrin-selenitun (ITS) to facilitate gas exchange. We used two different
culture medium to test whether culture medium with ITS has the same effect of that
with F BS which could contain angiotensin system components like ANGEN.

The explants were exposed to bleomycin (25mU/ml), BLEO plus saralasin (SAR:
50ug/ml) or BLEO plus ANGEN antisense oligonucleotides (AS: 40nM) and Vit C
(0.1mM). The culture medium was changed every other day and at the same time added

fresh reagents. The explants were cultured in a 5% C02 incubator at 37 °C for 24 hours

124

or 14 days, and then harvested by transfer into liquid N2 and storage at -80°C until for
hydroxyproline assay to quantitate collagen amount (Woessner, 1961) and caspase-3
enzyme assay.

Identiﬁcation and Quantitation of Apoptotic Cells and Total Lung Caspase 3
Activity

Localization of DNA Fragmentation

ISEL of fragmented DNA was conducted by a modiﬁcation of the method of Mundle and
colleagues (Mundle et al., 1994). Brieﬂy, ethanol was removed from deparafﬁnized lung
sections by rinsing in distilled water for at least 10 minutes. The slides were then placed
in 3% hydrogen peroxide (Sigma Chemical Co.) for 30 minutes at 20°C, rinsed with PBS,
and incubated with Proteinase K (Sigma) in standard saline citrate for 15 minutes at
37°C. Samples were rinsed once in water, three times in 0.15mol/L PBS for 4 minutes
each, and were then incubated in standard saline citrate (0.3 mol/L NaCl and 30 mmol/L
sodium citrate in water, pH 7.0) at 80°C for 20 minutes. After four rinses in PBS and four
rinses in buffer A (50 mmol/L Tris/HCl, 5 mmol/L MgCl, 10 mmol/L B-
mercaptoethanol, and 0.005% bovine serum albumin in water, pH 7.5), the sections were
incubated at 18°C for 2 hours with ISEL solution (0.001mmol/L digoxigenin-dUTP; 20
U/ml DNA Polymerase I; and 0.01 mmol/L each of dATP, dCTP, and dGTP in buffer A).
Afterward the sections were rinsed thoroughly ﬁve times with buffer A and three
additional times in PBS. Detection of incorporated dUTP was achieved with by
incubation for 2 hours at 37°C with AP-conjugated antidigoxigenin (Boehringer

Mannheim) at 1/400 dilution. Bound AP-antibody was then detected with the Fast Blue

125

chromogen system and the sections were mounted with Fluoromount solution (Southern
Biotechnology, Birmingham, AL).

For quantitation of ISEL- positive epithelial cells, the number of positive cells within the
surfaces of the alveolar walls was counted in a minimum of six randomly selected x 400
microscopic ﬁelds per lung section. Positive cells within the alveolar airspaces, or
otherwise clearly not within the surface of the alveolar wall, were not scored. The counts
of positive nuclei per ﬁeld were expressed as a percentage of the total number of nuclei in
the same microscopic ﬁeld. Sections from each of at least ﬁve rats per treatment group

were analyzed by an investigator blinded to sample identity.

Caspase 3 Enzyme Activity

Assay of total lung caspase-3 enzyme activity was conducted with a commercially
available kit (Molecular Probes, Eugene, OR). Fast-frozen lung was homogenized in
assay kit buffer and was analyzed according to the manufacturer’s instructions on a
Biotek FL600 ﬂuorescence plate reader. In all samples, speciﬁcity of the reaction for
caspase 3 was veriﬁed by abrogation of the signal with a caspase-3 selective irreversible

inhibitor (data not shown).

Quantitation of Lung Collagen
For quantitation of total lung collagen, tissues frozen in liquid N2 were dried to constant

weight in preweighed tubes at 80°C. The weighed dry tissue was hydrolyzed in 6 N HCl

and was subjected to determination of hydroxyproline as described earlier by Woessner

126

(Woessner, 1961) The efﬁciency of the hydrolysis was veriﬁed with rat-tail collagen by

comparison to standard hydroxyproline (Sigma Chemical Co.).

Detection of AN GEN mRNA in lung section by In Situ Hybridization (ISH)

Based on published methods (Panoskaltisis-mortari et al., 1995), modiﬁcation was done
so that digoxigenin-labled DNA probes will be substituted for riboprobes. For this reason,
denaturation, hybridization and wash conditions was modiﬁed to favor RNA/DNA
hybridization rather than RNA/RNA. Then lung sections were incubated with biotin-
conjugated anti-digoxigenin antibodies, followed by using the streptavidin- AP and

NBT/BCIP detection system to amplify the chromogen signal.

Immunohistochemistry (IHC) for Activated Caspase 3, ANGEN/ANGI, lectin,
alpha- smooth muscle actin (aSMA).

IHC was performed with an antibody that recognizes only the active form of caspase 3
(BioVision, MountainView, CA) and anti- ANGEN/ANGI antibody (Santa Cruz, CA).
Deparafﬁnized lung sections were blocked with a solution of 3% bovine serum albumin
in PBS for 1 hour; the primary antibody was then applied overnight at 4°C in 3% bovine
serum albumin/PBS. After washing in PBS, the antibody was detected with a biotin-
conjugated secondary antibody and avidin-linked chromogen system. For double
labeling, lectin (Vector Laboratories, CA) and alpha- smooth muscle actin (Sigma,

Missouri) antibody directly conjugated with FITC were applied on some sections.

127

Western blot analysis to detect and quantitate pulmonary angiotensinogen and
active caspase 3

The lungs were perfused and snap-frozen in liquid nitrogen and stored at -80°C until
protein extraction. Lung protein extraction was performed as following. Brieﬂy, the
frozen lungs were pulverized in a chilled mortar and placed in NP40 tissue lysis buffer
contain protease inhibitors cocktail. The samples were ﬁrrther centrifuged at 15,800 g for
10 min at 4°C. The supernatants were collected, and protein levels were determined using
a Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA). The protein samples (60
ug) were electrophoresed on 12% SDS-PAGE in a Mini-Protean II Electrophoresis Cell
(Bio-Rad). Protein molecular weight markers (Invitrogen) were run parallel to each blot
as an indicator of the molecular weight. The separated proteins were transferred at 150 V
for 1.5 hours onto PVDF membrane (Bio-Rad) in a Mini Trans-Blot chamber with
transfer buffer (25 mM Tris-HCI, 192 mM glycine, and 20% methanol). The PVDF
membrane was blocked for l h using 5% no fat dry milk in Tris-buffered saline (TBS).
For detection of angiotensinogen, a 1:100 dilution of ANG I/II antibody (Santa cruz, CA)
as used and for detection of active caspase-3, 1 ug/ml antibody (Bio Vision, CA) as used.
After being washed, the membrane was incubated with horseradish peroxidase linked
with the secondary antibody (anti-goat immunoglobulin G for ANGEN; anti-rabbit
immunoglobulin G for active caspase-3), as recommended by the manufacturer. Finally,
the washed blots were exposed to an enhanced chemiluminescence (ECL) detection
system (Amersham) and recorded on an autoradiograph (Amersham ﬁlm).

Attention: Images in this dissertation are presented in color.

128

RESULTS:
Local pulmonary angiotensin synthesis was upregulated in vivo after bleomycin
instillation.
Semiquantitative RTPCR (Fig. 6.1) showed upregulation of ANGEN mRNA in the lungs
as early as 3h after i.t. instillation of bleomycin. In situ hybridization of ANGEN mRNA
(Fig. 6.2) demonstrated that positive labeling (dark purple, shown by arrowhead)
increased 6h (Fig. 6.2: Bx200 magniﬁcation, Cx400 magniﬁcation) and 14 days (F ig.6.2:
E, Fx200 magniﬁcation) after BLEO instillation compared to the corresponding controls
(Fig. 6.2: A, Dx200 magniﬁcation). 6h after BLEO instillation, the positive labeling is
mainly localized at the corners of the alveolar, which typically are the positions for type
II alveolar cells (Fig. 6.ZBC). 14 days after BLEO instillation, the positive labeling is
mainly localized at ﬁbrotic foci (Fig. 6.2E) where myoﬁbroblast / ﬁbroblast accumulate
and the comers of the alveolar (Fig. 6.2F) near the ﬁbrotic region.
Immunohistochemistry (IHC) staining (Fig. 6.3) by using anti-ANG I antibody,
which cross-reacted with ANGEN [see Fig. 6.10 western blot: rat liver ANGEN (ﬁrst
lane) was recognized by anti-ANG I Ab], showed that at 24h after i.t. BLEO ANGEN
/ANG I (purple) was found in alveolar walls cell at the comers that did not label with
lectin (compare Fig 6.3 A &B x400, same ﬁled with matched arrowhead), consistent with
the identity of those alveolar wall cells as type 11 cells because lectin labels bronchial
epithelium and type I alveolar epithelial cells but not type 11 cells (Fehrenbach et al.,
2000). In severely affected areas of the parenchyma of bleomycin- induced ﬁbrotic rat
lungs, regions of ANGEN / ANG I labeling (Fig. 6.3 Cx200, black box) were observed to

coincide with a loss of lectin labeling (Fig. 6.3 Dx200, white box: double label of same

129

section as C), consistent with our theory that alveolar epithelium dies in regions rich in
ANG peptides. Enlargement of the white boxed region (Fig. 6.3 Ex400) reveals a-SMA
immunoreactivity in the middle of the box on the adjacent serial section, suggestive of
myoﬁbroblasts.

Western blot for ANGEN showed that ANGEN protein in the lungs which were perfused
by PBS, 14 days after bleomycin instillation were signiﬁcantly higher than that in control
lung instilled with saline (Fig. 6.10). (Bars are the meansi SEM of n=5, p<0.05 vs. CTL
by t test).

A speciﬁc ELISA for ANG II detected that the pulmonary concentrations of ANGII in
the lungs which were perfused by PBS, 6h and 14 days after bleomycin instillation were
signiﬁcantly higher than that in control lung instilled with saline (Fig. 6.4). (Bars are the

meansi SEM of n=5, p<0.05 vs. CTL by t test).

Antisense oligonucleotides against ANGEN mRNA blocked bleomycin induced
apoptosis and collagen accumulation in lung explants (ex vivo).

BLEO increased caspase 3 activity (P < 0.05), when applied in vitro at 25 mU/ml for 24
hours to rat lung explants that were depleted of blood before explant culture. Fig 6.5
showed that application of BLEO in vitro increased caspase-3 activity in the explants in
24 hours but Antisense oligonucleotides against ANGEN mRNA (40nM) inhibited the
increase. Fig. 6.6A showed that there was more collagen accumulation in explants
cultured in 10% F BS, treated with bleomycin compared with control group treated
without bleomycin [Results were shown as pg hydroxyproline (HP) per mg of dry lung

tissue. Bars are the mean 1 SEM of at least 4 separated samples; * = p<0.05 versus

130

control]. Moreover, Fig 6.6B showed that ANGEN antisense oligonucleotides reduced
BLEO-induced collagen accumulation in explants cultured in 1% ITS (Bars are the mean

35 SEM; * = p<0.01 versus BLEO+AS).

Blockade of lung-derived ANGEN suppressed apoptosis of AECs and pulmonary
ﬁbrosis in vivo.

The feasibility of intratracheal delivery of antisense oligos specifically to the lung:
Figure 6.7 shows the distribution of BODIPY ﬂuorescence in homogenates of the frozen
lung, liver and kidneys after normalization to total tissue protein. At the dose of 150ug,
lung tissue retained 30-fold more ﬂuorescence, per unit protein, than liver and 37-fold
more than kidney. At the dose of 75ug, the lungs retained 6-fold more than liver and 13-
fold more than kidney.

Sections from the rat treated with 75ug of oligonucleotide revealed that BODIPY
ﬂuorescence (green) was localized primarily to the epithelium of airways (Fig. 6.8B,
arrow) and in isolated cells of the alveolar walls (Fig. 6.8B, arrowhead). At higher
magniﬁcation (Fig. 6.8C, D), some alveolar wall cells were found to concentrate the
BODIPY-oligonucleotide (arrows) while others were stained with very little of the
BODIPY-oligonucleotide (arrowheads).

Inhibition of Apoptosis and Collagen Deposition by Antisense in vivo:

The ability of Antisense to inhibit lung epithelial apoptosis was also observed in vivo at
14 days after BLEO administration. In Figure 6.12, intratracheal BLEO increased the
abundance of ISEL-positive cells, but AS inhibited the increase. Measurement of lung

collagen accumulation in the same animals by hydroxyproline assay (Figure 6.9B)

131

revealed an increase in total lung collagen by 14 days after intratracheal BLEO, but AS
reduced the increase to a value not signiﬁcantly different from the control (CTL). Fig. 6.9
A showed macroscopic photographs of the lungs 14 days after different treatment. Note
the almost normal appearance of the lung in the Bleo +AS treated rat compared with the
Bleo- and bleo+SCR treated rat lungs, which are smaller with many patchy bleeding
spots. Histology of the whole lung sections obtained 14 days alter intra tracheal
bleomycin administration revealed typical changes of PF in bleomycin treated rats
without antisense administration. The normal alveolar architecture appeared to be
distorted with collapsed alveolar spaces and thickening of nearby alveolar septa. In .
antisense treated rats challenged with bleomycin, ﬁbrosis—like changes were less
extensively present. In rats treated with sterile saline, the histology was normal.

Active caspase-3 was detected by immunohistochemistry (IHC) and western blots (WB)
14 days after bleomycin instillation. Active caspase-3 shown by WB by using anti-active
caspsase-3 (p17 fragment) antibody was induced by bleomycin and suppressed by
antisense treatment (Figure 6.11, upper panel). Active caspase—3 was localized in
alveolar epithelial cells and alveolar macrophages (Figure 6.11, lower panel).

The Antisense oligonucleotides against ANGEN mRNA inhibited DNA fragmentation
detected by in situ end labeling (ISEL) of fragmented DNA in lung epithelial cells 14
days after BLEO instillation (Figure 6.12, Figure 6.13). ISEL positive cells are blue. In
CTL group, ISEL-positive nuclei were not observed (Figure6.l2A). In bleomycin alone
treated group, ISEL-positive nuclei were observed in cells within the alveolar walls,

many ISEL-positive nuclei were observed in septal wall cells at the alveolar corners

132

(Figure6.lZB). Administration of antisense decreased ISEL positive cells in response to

bleomycin, but scramble did not (Figure6. 12 C, D).

Effect of antisense treatment on angiotensin peptides:
Intratracheal instillation of 75ug antisense decreased pulmonary ANGEN expression (ﬁg

6.10) but had no effect on the serum ANG II level. The plasma ANGEN protein did not

decreased in response to intratracheal instillation of antisense.

133

CTL BLEO

 

 

Fig. 6.1: Semiquantitative RT-PCR of angiotensinogen (ANGEN) mRNA in lungs 3hours
after Bleo exposure. Normal rats were intraltracheeally instilled with Bleo (8U/Kg) or
saline (CTL) for 3hours and total RNA was isolated. RT-PCR was performed as
described before (see Material and Methods) with primers speciﬁc for rat ANGEN,

13 -Microglobulin ( B -MG) as control mRNAs.

134

 

Fig. 6.2: In situ hybridization of ANGEN mRNA demonstrated that positive labeling
(dark purple, shown by arrowhead) increased 6h (B x 200 magniﬁcation, C x 400
magniﬁcation) and 14 days (E, Fx200 magniﬁcation) after BLEO instillation compared to
the corresponding controls (A, D x 200 magniﬁcation). 6h aﬁcr BLEO instillation, the
positive labeling is mainly localized at the corners of the alveoli, which typically are the
positions for type II alveolar cells (BC). 14 days after BLEO instillation, the positive
labeling is mainly localized at ﬁbrotic foci (E) where myoﬁbroblast / ﬁbroblast

accumulate and the comers of the alveolar (F) near the ﬁbrotic region.

ANTI-ANGI: crr. ANT"A”G'=FL30 '

1_I"('l|\ \\ll;rS\1\

   

Fig. 6.3: The sections were subjected to IHC with antibodies against the ANGI, lectin and
a-SMA 24 hours (B, C) and 7 days (D, E, F) after intratracheal instillation of bleomycin.

24h alter BLEO instillation ANGEN /ANG I (purple) was found in alveolar walls cell at
the corners that did not label with lectin (compare B&C x400, same ﬁeld with matched
arrowhead). In seveme affected areas of the parenchyma of bleomycin- induced ﬁbrotic
rat lungs, regions of ANGEN / ANG I labeling (Dx200, black box) were observed to
coincide with a loss of lectin labeling (Ex200, white box: double label of same section as
D). Enlargement of the white-boxed region (F x400) revealed a-SMA immunoreactivity

in the middle of the box on the adjacent serial section, suggestive of myoﬁbroblasts.

136

 

“' rill

yup;

 

20 a =p<0.05 vs. CTL

.3.
0|

..‘L
O

01

 

[ANG II] IN PERFUSED LUNG
(ng/ mg DNA)

 

C TL BLEO 6h BLEO 14D

Fig. 6.4 Pulmonary angiotensin II (ANG II) increased in bleo-induced lung injury. 6
hours and 14 days after bleo instillation, lungs were perfused, homogenized, and

analyzed by ELISA speciﬁc for ANG 11. Values are means of at least 5 separate

determinations.

* Signiﬁcantly different from CTL, P < 0.05 (by Student's t-test).

137

 

 

 

 

Caspase 3 Activety (uMol/g protein)

CTL BLEO BLEO+ BLEO+
+lipo +lipo antisense scramble

Fig. 6.5 The Antisense oligonucleotides against ANGEN mRNA inhibit BLEO-induced
activation of caspase 3. Lung explants were prepared from normal rat lung tissue
perfused before excision (see Materials and Methods). BLEO (25 mU/ml) was applied in
serrun-free culture medium for 24 hours in the presence or absence of antisense (40nM).
Bars are the means :1: SEM of n = 3; *, P < 0.05 versus control (CTL+lipo) by analysis of

variance and Student-Newman-Keul’s test.

138

w
e

 

AzFBS

u—t—NN
UIOUIOUI

 

pg HP/ mg dry weight

*=p<0.05

CT'L BLEO BLEO+ SAR

 

30
25
20
15
10

 

B: ITS

     

a: =p<0.01

 

 

CT L BLEO BLEO+AS

Fig. 6.6 The Antisense oligonucleotides against ANGEN mRNA and non-selective AT

receptor antagonist saralasin inhibit BLEO-induced collagen accumulation in lung

explants. Lung explants were prepared from normal mouse lung tissue perfused before

excision (see Materials and Methods). BLEO (25 mU/ml) was applied in 10% FBS (A) or

1% ITS (B) for 14 days in the presence or absence of SAR (50ug/ml) or antisense

(40nM). Bars are the means :1: SEM of n = 3; *, P < 0.05 versus control (CTL) in A; *, P

< 0.01 versus CTL in B by analysis of variance and Student-Newman-Keul’s test.

139

 

[:1

(D

5515- 150ugl.T. -* 75ugI.T. ‘
m8

HO

an- -. .
1321’

>\

B3 5. -. .
gs

 

 

 

 

   

 

 

LUNG LIVER KIDNEY LUNG LIVER KIDNEY

Fig. 6.7 Distribution of ﬂuorescence in lung, liver and kidney 2 hous after instillation of
BODIPY labeled oligonucleotides. Normal rats were instilled with different dose of
BODIPY labeled oligonucleotides. Fluorescence intensity was measured in the
homogenates of the frozen lung, liver and kidneys after normalization to total tissue

protein.

140

 

Fig. 6.8 Localization of the intratracheal instilled ﬂuoseence-labelled antisense against
ANGEN mRNA on the lung sections ﬁ'om rats treated with 75ug of oligonucleotides.

Panels with red ﬂuorescence show PI staining, and panels with green ﬂuorescence show
BODIPY staining. Panel A, B (10 x10) show the same ﬁeld from the same section. And
so do panel C, D (40 x 10). Panel A, B revealed that BODIPY ﬂuorescence was localized
primarily to the epithelium of airways (arrow) and in isolated cells of the alveolar walls
(arrowhead). Panel C, D revealed that some alveolar wall cells were stained with high
intensity of BODIPY-oligonucleotides (arrows) while others were stained with very little

of the oligonucleotides (arrowheads).

141

 

 

12

”6‘0

%10- *
5

w 8“

a:

.g 6_

E 2-

E o-

 

 

 

CTL BLEO BLEO+AS BLEO+SCR

Fig. 6.9 A: Macroscopic photographs of the lungs 14 days after different treatment. Note
the almost normal appearance of the lung in the Bleo +AS treated rat compared with the
Bleo- and bleo+SCR treated rat lungs, which are smaller with many patchy bleeding
spots. B: Quantitation of total lung collagen by hydroxyproline (HP) assay. At 14 days
post-Bleo, collagen was quantitated by HP assay applied to hydrolyzed lung tissue. See

METHODS for details. * P < 0.05 vs. CTL by ANOVA.

142

. Lena-we - n -. nu --. rn-I .- s-.- -a--.

Z

 

1. . ‘
ll ' I
i .
- . , .
. . .
7 I l 1..
.

 

. a ’ I
. .
’ h
n- . - .. .---h. u..- .n v. ' x .a'.
J
74
..
.
. r- ' .
1'.
.1 .
'0

. n.—
m .
0‘ ‘H
i
‘ 1‘)
, «u a
' ‘

 

V“.
.-.
pa.
--. ”a
g-
l-
I.“
I
’1
. n-a
.‘f t
. .
. r | r . .'
. , I:
. .
. f' ‘. "
, .

 

   

 

A: Liver CTL BLEO BLEO+AS

u
0'!

 

3.0 -
2.5 .
2.0 -

.x
01

1.0 ‘

O
01

0.0 .

 

 

Relative Density Intensi

   

CTL BLEO BLEO+AS

Fig. 6.10 Bleomycin increased angiotensinogen protein expression, which was
suppressed by the treatment of antisense in perfused lung tissues. 14 days after instillation
of bleomycin or vechicle, lungs were perfused and homogenized for the western blot
analysis. (A) Representative imrnunoblot is shown and (B) densitometric evaluation of

blot data. Data are presented as mean iSE (n=5). *: P<0.05 versus CTL

143

WB: Active Caspase 3 (P17) . I

M ﬂan-1‘. 4.91“"

 

CTL BLEO BLEO+AS BLEO+SCR

 

Fig 6.11. Detection of active caspase-3 by immunohistochemistry (IHC) and western
blots (WB) 14 days after described treatment. Male Wistar rats received indicated
treatment intratracheally. Lung tissues were harvested 14 days after treatment and
subjected to IHC and WB by using anti-active caspsase-3 (p17 fragment) antibody.
Upper penal (WB): Active caspase-3 was induced by bleomycin and suppressed by
antisense treatment. Lower penal (IHC): active caspase—3 was localized in alveolar

epithelial cells and alveolar macrophages.

sqwznw aka: . 1 garages” at;

 

Fig 6.12. Detection of apoptotic cells by in situ end labeling (ISEL) of fragmented DNA
14 days after described treatment. Male Wistar rats received indicated treatment
intratracheally; lung tissues were harvested 14 days after treatment and subjected to ISEL
coupled to a fast blue detection system (see METHODS). Positive reaction is blue. A: in
CTL group, ISEL-positive nuclei were not observed. B: in bleo group, ISEL-positive
nuclei were observed in cells within the alveolar walls, many ISEL-positive nuclei were
observed in septal wall cells at the alveolar corners. C: administration of antisense
decreased ISEL positive cells in response to Bleo. D: administration of scramble

nucleotides did not decreased ISEL positive cells in response to Bleo.

145

.3
O

 

  
 
 

* p<0.01 Vs.CTL

8 **p<0.01 Vs. BLEO
or B+SCR

  

 

 

 

o .
CTL BLEO BLEO+AS BLEO+SCR

ISEL positive cells in total nuclei, %

Fig. 6.13 The Antisense oligonucleotides against ANGEN mRNA inhibited DNA
fragmentation in lung epithelial cells 14 days after BLEO instillation. Rats were given a
single intratracheal instillation of BLEO in the presence antisense or scramble ONT in
the instillate. Fourteen days later, lung sections were prepared and labeled by ISEL.
Labeling was quantitated in cells within the alveolar surfaces. Bars are the means i SEM
ofn = 5; *, P < 0.01 versus control (CTL); **, P < 0.01 versus BLEO or BLEO +SCR by

analysis of variance and Student-Newman—Keul’s test.

146

DISCUSSION:

Recently a few studies suggested the existence of “local” angiotensin systems in various
organs and tissues. For example, the ANG II concentrations in the interstitial
compartment of heart and eye were found to be 5-100 fold higher (about 50 —500pM)
than that in plasma (~5-10pM) (van Kats et al., 1998; Danser et al., 1994). The higher
interstitial levels of ANG 11 compared to the circulating level could not be explained by
diffusion and/or receptor-mediated uptake of circulating angiotensin 11. These results
thereby suggest that tissue angiotensin II is largely, if not completely, synthesized locally.
Furthermore, cultured cells from various organs including heart (Lindpaintner et al.,
1988), vascular endothelium (Li et al., 1999), brain (Campbell et al., 1986; Dzau et al.,
1982; Ohkubo et al., 1986) and lung (Filippatos et al., 2001) were shown to express the
RAS components. In contrast to the classical endocrine system of RAS in which
angiotensin II is delivered to tissues via circulating blood, local angiotensin systems can
be from either “intrinsic “(independent of the endocrine RAS) or “extrinsic” (relying on

the endocrine RAS as its components sources) sources.

The evidence that local angiotensin system is involved in pulmonary ﬁbrosis is as follows:
1) Enzymes needed for the production of local angiotensin peptide were upregulated in
pulmonary ﬁbrosis. Polymorphisms that confer higher levels of ACE predispose patients
to lung ﬁbrosis (Morrison et al., 2001). Cathepsin D was upregulated in both animal and
human ﬁbrotic lung (Kasper et al., 1996; Koslowski et al., 2003). ACE is upregulated in
both human and animal ﬁbrotic lungs (V enkatesan et al., 1997; Specks et al., 1990). 2)

Angiotensin system antagonists block experimental lung ﬁbrosis (Ward et al., 1990; Uhal

147

et al., 2000 and 2002; Molteni et al., 1985 and’2000; Fang et al., 2002; Li et al., 2003;
Marshall et al., 2004; Otsuka et al., 2004).

For the pulmonary angiotensin system, where the ANGEN, the only precursor of
angiotensin 11, comes from is unknown. Two cells types in the lung under certain
conditions, so far, have been found to be able to produce ANGEN in vitro. In vitro
primary AECs could synthesize and secrete ANGEN that is converted to ANG II when
undergoing apoptosis induced by Fas ligand (Wang et al., 1999), TNF-alpha (Wang et al.,
2000), amiodarone (Bargout et al., 2000) and bleomycin (Li et al., 2003). Studies done in
our lab showed that primary myoﬁbroblasts isolated from ﬁbrotic human lungs (IPF
biopsies) expressed the ANG II precursor ANGEN mRNA and protein (Wang et al.,
1999), suggesting that human lung myoﬁbroblast can synthesize ANGEN in culture.
Furthermore, the concentration of ANG II detected by Enzyme-Linked Immunosorbent
Assay (ELISA) was found to be signiﬁcantly higher in culture medium of myoﬁbroblast
isolated from ﬁbrotic human lungs than that from normal lungs. Preincubation of the
medium with puriﬁed renin and ACE increased the ELISA-detectable ANG 11
concentration roughly eight fold, indicating that there are abundant ANGEN synthesized
constitutively which waits to be converted to ANG 11. However, no in vivo studies have
been published to directly prove the existence of a local angiotensin system produced in
the lung independently of the endocrine angiotensin system during the development of
pulmonary ﬁbrosis. Therefore, the present study was performed to answer a part of
unknown question. We showed that endogenous lung ANGEN was upregulated in vivo
as early as 3 hours after bleomycin instillation in rat lungs by RT-PCR, in situ

hybridization and immunohistochemistry staining methods. ANGEN mRNA and

148

angiotensin peptides were localized in alveolar wall cells in the alveolar comers,
tentatively identiﬁed as type 11 cells, and also colocalized with alpha-Smooth Muscle
Actin (aSMA)(Fig 6.3). Those data suggested that bleomycin activated the production of
the local angiotensin systems in vivo. Moreover, those data are consistent with our
earlier ﬁnding of epithelial cell death in the vicinity of alpha- SMA-positive
myoﬁbroblast in ﬁbrotic human lung and support the theory that alveolar epithelial death
is caused by the ANG peptide.

We hypothesized that lung derived angiotensinogen is required for development of PF.
Using whole animal models of bleomycin— induced PF, we cannot discriminate the lung-
derived angiotensin system from the endocrine angiotensin system. However, using
explants as the ex vivo model we can rule out the contributions of endocrine angiotensin
system and hemodynamics to the development of bleomycin-induced PF as blood
circulation is removed in explants. Furthermore, as lung explants provide an in vitro
condition at the organ level, it will provide a better mimic of the in vivo conditions
compared to cell cultures. This study showed that bleomycin could induce apoptosis and
ﬁbrosis in lung explants, which could be blocked by antisense oligonucleotides against
ANGEN mRNA (Fig. 6.6), suggesting lung-derived ANGEN is required for bleomycin-
induced pulmonary ﬁbrosis in serum free condition.

The previous studies in our lab demonstrate that apoptosis of AECs in response to BLEO
can be abrogated by antisense oligonucleotides against angiotensinogen (ANGEN)
mRNA. We use the same oligonucleotide sequences, delivered by intratracheal (I.T.)
instillation, for in vivo experiments to attempt blockade of BLEO-induced apoptosis and

lung ﬁbrosis in the intact animal. The success of such an experiment will depend on

149

speciﬁc delivery to the lung, so we sought to determine the distribution of the
oligonucleotides in the lungs and other tissues after I.T. instillation. Our data showed that
a single I.T. dose of 150ug antisense oligonucleotide can provide delivery primarily to
lung with relatively little accumulation in liver or kidney. Moreover, the intratracheal
instillation of antisense at dose of 75ug provided delivery of oligonucleotides primarily to
lining cells of the airways and alveolar walls, suggesting that this is a feasible approach
for in vivo studies. The initial concern was that a single dose of the antisense
oligonucleotides against ANGEN mRNA is not sufﬁcient to exert its effects on
pulmonary ﬁbrosis considering the decay of its efﬁcacy over time in vivo although a
single dose of the same antisense oligonucleotides against angiotensinogen mRNA
reduces hypertension for a long time in various hypertension animal model (Gyurko et
al., 1993; Wielbo et al., 1995; Wielbo et al., 1996; Peng et al., 1998; Kagiyama et al.,
2001; Phillips, 2001). The half-life of ANGEN antisense oligonuclotide is not known
although there are a few reports regarding the half-lives of similar oligonucleotides
available. Some studies showed that the half-life of a 15-mer phosphorothioate
oligonucleotide was 9 hours in human serum, 4 days in tissue culture media (Li et al.,
1996) and 19 hours in cerebrospinal ﬂuid (Campbell et al., 1990). Other studies reported
that the half-life of phosphorothioate oligonucleotide following inhalation delivery to
lung was more than 20 hours in mice (Templin et al., 2000) and 30 hours in rabbit (Ali et
al., 2001). Regardless of this concern, intratracheal instillation of 75ug antisense once
reduced bleomycin—induced pulmonary ﬁbrosis detected by hydroxyproline assay,
decreased pulmonary ANGEN and active caspase-3 level detected by western blot and

ISEL positive cells, but had no effect on the serum ANG 11 level. These data are

150

consistent with the hypothesis that lung-derived ANGEN is involved in bleomycin-
induced pulmonary ﬁbrosis.

Summary and Conclusion

The present study demonstrated that the upregulation of de novo ANGEN synthesis
found in vitro occurs in vivo. Administration of antisense oligos against ANGEN mRN A,
presumably by blockade the synthesis of lung-derived ANGEN, blocked BLEO-induced
apoptosis and lung ﬁbrosis. Those data also suggest that lung-derived ANGEN is the
additional therapeutic target within the pulmonary angiotensisn system and antisense
oligonucleotides against ANGEN mRNA may hold potential for the treatment of lung

ﬁbrosis in humans.

151

Chapter 7

GENERAL DISSCUSSION

l. Angiotensin Receptor AT1 Mediates Bleomycin-induced Apoptosis and Lung
Fibrosis
Our study demonstrated at various levels including cellular, organ and whole animal level

that AT1 receptor mediates bleomycin-induced apoptosis and lung ﬁbrosis.

1.1 An Essential Role by Angiotensin Receptor AT1 in Bleomycin-Induced
Apoptosis in Alveolar Epithelial Cells (AECs):

We demonstrated that BLEO induced apoptosis of primary AECS in a dose
dependent manner in vitro. This result is consistent with the in vivo studies from other
labs showing that AECs apoptosis is found in bleomycin-induced pulmonary ﬁbrosis
model (Hagimoto et al., 1997). To conﬁrm the nature of the cell death induced by BLEO
was apoptosis, our study also showed that fragmented DNA induced by bleomycin was
blocked by the broad-spectrum caspase inhibitor ZVAD-ﬁnk, the caspase 3-selective
inhibitor DEVD-fmk and endonuclease inhibitor ATA. F urtherrnore, we found that the
ANG receptor subtype AT1-selective blocker losartan blocked nuclear fragmentation
induced by bleomycin, suggesting that angiotensin receptor subtype AT1 mediates
BLEO-induced apoptosis as it does in ANGII-induced apoptosis (Papp et al., 2002).
Similarly, our study using the human AECs showed that BLEO-induced apoptosis of
A549 cells was inhibited by the AT1-selective blocker L158809 but not by the AT2-

selective antagonist PD123319 (Li et al., 2003). Moreover, BLEO-induced apoptosis was

152

also prevented by a neutralizing ANGII antibody (anti-ANGII). Furthermore, the total
enzymatic activity of caspase 3 was elevated by exposure of A549 cells to BLEO and the
increase was inhibited by non-selective AT receptor antagonist saralasin (Li et al., 2003).
The ﬁndings that bleomycin-induced apoptosis of AECS could be blocked by the AT1-
selective antagonists but not by the AT2-selective antagonist support the contention that

there is an essential role by AT1 receptor in Bleomycin-induced apoptosis in AECs.

1.2 An Essential Role of Angiotensin Receptor AT1 in Bleomycin-induced
Apoptosis and Fibrosis in Lung Explants:

We cannot discriminate the lung-derived angiotensin system from the endocrine
angiotensin system using whole animal models of bleomycin- induced PF. However,
using explants as the ex vivo model the contributions of endocrine angiotensin system
and hemodynamics to the development of bleomycin-induced PF can be ruled out as
blood circulation is removed in explants. Furthermore, as lung explants provide an in
vitro condition at the organ level, it offers a better mimic of the in vivo conditions
compared to cell cultures. Our studies showed that bleomycin could induce apoptosis and
ﬁbrosis in lung explants, which could be blocked by AT] selective antagonists losartan,
suggesting that AT1 receptor is required for bleomycin-induced apoptosis and pulmonary
ﬁbrosis in serum free condition.

The ability of LOS to prevent caspase-3 activation by BLEO in cultured lung
explants argues against the involvement of decreased blood pressure in the inhibition of
apoptosis as no hydrostatic pressure is there in explants. Moreover, the induction of LOS-

inhibitable caspase 3 activities in lung explants argues against a primary role for blood-

153

derived cells in the initiation of the apoptosis as blood was removed from the explants.
Hence, this result also suggests that the inhibitory effect of LOS on apoptosis was not

mediated by an indirect action on inﬁltrating inﬂammatory cells.

1.3 In vivo Inhibition of Apoptosis and Collagen Deposition by an AT1
Antagonist and AT1 Gene Deletion:

Our study demonstrated that losartan, the AT1 receptor antagonist, inhibited lung
epithelial apoptosis and ﬁbrosis in vivo 14 days after BLEO administration. The speciﬁc
effect of inhibition of apoptosis was conﬁrmed by using two different assays: ISEL
labeling to mark the fragmented DNA and active caspase 3 labeling to show the activat-
ion of caspase 3. Meanwhile, measurement of lung collagen accumulation in the same
animals by hydroxyproline assay revealed an increase in total lung collagen after
intratracheally delivery of BLEO, which was reduced by LOS to a level not signiﬁcantly
different from the control.

The AT1 receptor is expressed in two isoforms, ATla and Ale, for which no
selective antagonists have yet been developed (Filippatos et al., 2001). Subtype ATla is
known to be expressed in the lungs of mice, but Ale was not detected in mouse lung by
reverse transcriptase-polymerase chain reaction (Burson et al., 1994). Although it is
possible that cells of minor abundance in the lung, such as type 11 cells, express Ale in
quantities not detected in earlier studies (Burson et al., 1994), the primary isolates of type
II pneumocytes from Wistar rats did not reveal Ale expression by reverse transcriptase-
polymerase chain reaction despite the use of two different primer sets and high-

ampliﬁcation cycle numbers (from unpublished observation). Based on those studies, we

154

used ATla-null mice to test the hypothesis that AT1 receptor is essential for the
development of pulmonary ﬁbrosis. Our study demonstrated that deletion of the AT1
receptor, throughout the time course of the 14-day BLEO model, was capable of
inhibiting or blocking apoptotic and ﬁbrotic responses. Furthermore, the ﬁnding that
deletion of only one allele of the ATla gene signiﬁcantly reduced Bleo-induced apoptosis
and collagen accumulation supports the notion that ATla is the only active AT1 receptor
subtype on the alveolar epithelium of mice.

One concern was raised when we were using ATla deletion mice. That is whether the
ANG II dependent caspase-3 activation cascade is still intact in ATla deletion mice since
we detected less active caspase-3 in response to instillation of bleomycin. The chance that
caspase-3 activation cascade has been compromised is small since those mice have
normal phenotype except that 12-mmHg lower blood pressure is observed. If caspase-3
activation cascade were damaged in those mice, they would have a much higher chance
to develop tumors, which has not been reported in those mice. In addition, in a recently
published study, Ohashi et al. (2004) demonstrated that ANG II dependent caspase-3
activity is increased in ATla deletion mice, strongly supporting that AN G 11 dependent

caspase 3 activation cascades is intact in ATla deletion mice.

1.4 AT1 receptor blockade block ﬁbrosis via suppression of apoptosis:

Considering the many known functions of angiotensin 11, these results above raise
the question of whether the inhibition of ﬁbrogenesis by AT1 blockade was due to its
suppression of apoptosis. For example, blockade of AT1 receptor may also inhibit mitosis

of lung ﬁbroblasts (Marshall et al., 2000) and reduce collagen synthesis by lung

155

ﬁbroblasts (Marshall et al., 2004). Both effects are relatively delayed consequences of
AT1 blockade that might be independent of ABC apoptosis occurring at earlier time.
Moreover, endothelial cells also express AT1 receptor and undergo apoptosis in response
to angiotensin, although at relatively high concentrations (Dimmeler et al., 1997; Li et al.,
1999). There are also other cell types residing in the lung known to respond to
angiotensin by mechanisms currently under intensive study (Harrison et al., 2003). Thus,
it is possible that the acute early effects of AT1 blockade on ABC apoptosis are not
required for inhibition of collagen deposition later.

Quantiﬁcation of erythrocytes reaching the alveolar airspaces 6 hours after BLEO
administration (a crude index of lung barrier collapse) suggested that LOS did not
prevent acute, transient barrier collapse despite its ability to reduce caspase-3 activation
at the same time. This observation is in agreement with the theory that the blockade of
apoptosis in AECs is a key to the subsequent blockade of collagen deposition. Moreover,
previous studies in our lab with apoptosis inhibitors support the contention that the acute
apoptotic response is a crucial event in the BLEO model of PF (Wang et al., 2000). Wang
and colleagues showed that the ACE inhibitor captopril or the caspase inhibitor ZVAD-
fmk had essentially equal ability to block the appearance of apoptotic epithelial cells in
rats exposed to intratracheal BLEO and to prevent subsequent collagen deposition (Wang
et al., 2000). That report, which was conﬁrmed by Kuwano and colleagues (Kuwano et
al., 2001) in studies of mice exposed to BLEO and/or ZVADfmk, suggested that the
blockade of ﬁbrogenesis by captopril was indeed related to inhibition of apoptosis, rather

than the many other effects of ACE inhibition in vivo (Marshall, 2003). Later work in our

156

lab conﬁrmed that the ZVAD compound had no inhibitory effect on angiotensin
converting enzyme itself (Filippatos and Uhal, 2003).

On the other hand, earlier work has shown that AECs undergoing apoptosis in
response to F as ligand, tumor necrosis factor-a or BLEO begin secreting angiotensin into
the extracellular space within hours of exposure (Wang et al., 1999; Wang et al., 2000; Li
et al., 2003). Those studies also showed that the autocrine production of angiotensin and
its binding to AT1 receptor on AECs were required for apoptosis in response to those
agents. This mechanism can explain the ability of LOS to block AEC apoptosis in vivo in
the present study. My data also are in agreement with recent reports that LOS inhibits
BLEO-induced collagen deposition in rat lung (Fang et al., 2002) and that ATla-null
mice show reduced liver ﬁbrosis in response to carbon tetrachloride (Kanno et al., 2003).
Thus, the present data are consistent with the ability of ACE inhibition by captopril to
block both AEC apoptosis and collagen deposition in rats (Wang et al., 2000), and extend

this concept to angiotensin receptor blockade in mice.

1.5 Potential intracellular mechanisms underlying AT1 mediated apoptosis:

In an earlier report describing the mechanisms by which angiotensin induces
apoptosis in primary cultures of AECs, Papp and colleagues (Papp et al., 2002) showed
that blockage of AT1 signaling through protein kinase C (PKC) with the speciﬁc PKC
inhibitor chelerythrin could attenuate the apoptotic response to angiotensin. This ﬁnding
is consistent with the known role of PKC in AT1 signaling in a variety of cell types such
as human coronary artery endothelial cells (Li et al., 1999) but the pathways from PKC to

the effector caspase 3, which is also required for this response (Papp et al., 2002), are

157

currently unknown. Given that ABC apoptosis in response to F as ligand, tumor necrosis
factor- a, or BLEO all require the autocrine production and binding of angiotensin to
AT1, (Wang et al., 1999; Wang et al., 2000; Li et al., 2003) the report of Papp and
colleagues (Papp et al., 2002) suggests that PKC inhibitors would also block AEC
apoptosis in response to these agents in vivo as well. This prediction was not tested in the

present study, but will be a worthwhile topic for future inquiry.

2. Essential role for cathepsin D in bleomycin-induced apoptosis of alveolar

epithelial cells

CatD is a lysosomal protease known to be ubiquitously expressed (Uchiyama et al.,
2001). It has been suggested that this and other lysosomal proteases might be involved in
the production of a bioactive molecule required for apoptosis of PC12 cells in response to
trophic withdrawal (Isahara et al., 1999). Particularly, a role for the aspartyl protease
CatD in apoptosis has been shown previously in HeLa cells exposed to interferon-y, F as
ligand or TNF-or (Deiss et al., 1996) and in PA] ovarian cancer cells (Wu et al., 1998).
Furthermore, the activity of CatD is upregulated by the apoptosis inducer adriaourcin in
PA], MLl leukemia cells and U1752 lung cancer cells (Wu et al., 1998). Although the
aspartyl protease inhibitor pepstatin A could block apoptosis in these cell types, the exact
mechanism(s) by which CatD participates in the execution of apoptosis is unclear.

Cathepsin D also is known to be one of the enzymes capable of proteolytically processing
the liver-derived and serum-borne protein angiotensinogen to the peptide angiotensin I, a

function normally performed in the serum by the kidney-derived enzyme renin

158

(F ilippatos et al., 2001). Evidence from several nonpulmonary cell types has established
CatD as the primary enzyme that converts angiotensinogen to ANGI within local
“intrinsic” angiotensin systems, independently of renin (F ilippatos et al., 2001; Weber et

al., 1995).

2.1 CatD activity is upregulated in AECs apoptosis response to bleomycin and
in ﬁbrotic lungs:

It was shown that CatD activity is upregulated in AECs in ﬁbrotic human lung
(Kasper et al., 1996) and induced in the L132 lung cell line during apoptosis in vitro
(Kasper et al., 1999). Consistent with those ﬁndings, in our study, western blotting of
conditioned medium from rat AECs exposed to bleomycin reveals bleomycin-induced
increases in several isoforms of CatD. Hence, we demonstrated that bleomycin
upregulated CatD activity and release from AECs.

To investigate the mechanisms underlying the increase of CatD activity in response
to bleomycin, we performed the time course study to monitor the change of the level of
CatD mRNA. In other cell types such as PAl human ovarian cancer cells, it was shown
that apoptosis inducers upregulate both CatD protein and mRNA, suggesting control of
activation at the level of mRNA (Wu et al., 1998). However, in our study, RT-PCR
studies of ABC transcripts after bleomycin treatment failed to detect changes in CatD
mRNA despite signiﬁcant increases in CatD activity and’immunoreactive protein by
western blotting. It is likely that the relatively few sampling times chosen for realtime
analyses of CatD mRNA may have missed a transient but shortlived increase in the

mRNA that might be revealed by a more exhaustive time course study. On the other

159

hand, CatD is known to undergo activation by proteolytic mechanisms as well; in human
U937 cells, CatD was shown to undergo processing from the inactive prepro-isoform
(52kdal) to the active proCatD (48kdal) and an active 32kdal isoform, in response to
autocatalysis of the enzyme induced by the direct binding of the apoptosis mediator
ceramide (Heinrich et al., 1999). However, two of the isoforms shown to be increased in
ABC media (52 and 48kda1) are larger than the primary isoform detected intracellularly
in ABC (44kdal). This ﬁnding argues against proteolytic processing alone as a
mechanism of CatD activation in AEC. Thus, the exact mechanism(s) by which
bleomycin upregulates CatD in ABC is unknown, but will pose an interesting problem for
future studies.

Pepstatin A-inhibitable CatD activity also was upregulated by amiodarone and TNF-
alpha, both of which induce apoptosis in AECS (Uhal et al., 2003; Wang et al., 2000).
However to determine whether the requirement for CatD is universal to all proapoptotic

stimuli for ABC will require further investigation.

2.2 Bleomycin-induced apoptosis of AECs is reduced by blockade of CatD
activity or synthesis:
Our data showed that bleomycin-induced nuclear fragmentation and caspase 3 activity
were signiﬁcantly reduced by the aspartyl protease inhibitor pepstatin A and by antisense
oligonucleotides against CatD mRNA, strongly suggesting a role played by CatD in AEC
apoptosis.
The other ﬁnding from our study that CatD antisense treatment did not completely block

bleomycin-induced nuclear fragmentation indicates a potential role for additional

160

protease(s) in angiotensinogen processing and subsequent AEC apoptosis. This
interpretation is reﬂected by the result the protease inhibitor pepstatin A, which blocks all
aspartyl proteases, was also incapable of complete blockade of nuclear fragmentation
despite complete inhibition of CatD enzyme activity in AEC lysates. On the other hand,
the antisense treatment for CatD, which is at least theoretically speciﬁc, did not
completely eliminate immunoreactive CatD detected by western blotting. Thus, it is
difﬁcult to determine whether the incomplete blockade of apoptosis is due to insufﬁcient

CatD knockdown or additional proteases activities.

2.3 CatD is involved in conversion of angiotensinogen to ANG I during
bleomycin -induced AECs apoptosis.

Our previous study demonstrated that bleomycin-induced apoptosis of AECs was
competely blocked by speciﬁc angiotensin receptor antagonists or ANG-neutralizing
antibodies or antisense oligonucleotides against ANGEN mRNA (Li et al., 2003).
Therefore, bleomycin-induced apoptosis of AECs requires the autocrine synthesis of
angiotensinogen, angiotensin II and it’s binding to ANG receptor AT1 (Li et al., 2003).
This ﬁnding support the hypothesis that autocrine generation of ANGII is required for
ABC apoptosis regardless of the initiating stimulus (Uhal, 2002). This result is also
consistent with data from previous studies in our lab showing that puriﬁed AN GII itself
was a potent inducer of apoptosis in ABC (Wang et al., 1999). Those data imply that
AECs express enzymes capable of converting angiotensinogen to ANGII. Although

Wang et al. (Wang et al., 1999) showed constitutive expression of angiotensin converting

161

enzyme (ACE) by AECs, the aspartyl protease required for providing the substrate for
ACE (ANGI) in AEC was unknown.

As noted before, apoptosis of cultured AECs in response to bleomycin was signiﬁcantly
inhibited by the aspartyl protease inhibitor pepstatin A and by antisense oligonucleotides
against CatD mRNA. The same inhibitors also prevented the enzymatic processing of a
synthetic fragment of angiotensinogen (amino acids 1-14) containing the CatD and ACE
cleavage sites, and completely blocked AEC apoptosis in response to the same peptide.
For example, incubation of primary rat AECs with the ﬁ'agment F1-14 alone in serum-
free culture ‘medium without CatD yielded signiﬁcant production of ANGII. Our result
from study using the fragment 1-14 of angiotensinogen containing the Cat D and ACE
cleavage sites supports the theory that CatD is required for the conversion of
angiotensinogen to ANGII by AEC. This result is also consistent with the earlier
demonstration of constitutive, although low, expression of both ACE and an unidentiﬁed
aspartyl protease by primary AECs (Wang et al., 1999). Moreover, the complete
abrogation of AEC apoptosis in response to angiotensinogen fragment F1-14 by the
nonselective and AT1-selective AN G receptor antagonists saralasin and losartan,
conﬁrmed that the induction of apoptosis was dependent on both the generation of
ANGII from F1-14 and the binding of ANGII to receptor AT1. Most importantly, the
ﬁndings that ABC apoptosis in response to F1-14 was essentially abrogated by either
pepstatin A or by CatD antibodies, strongly suggest that the conversion of
angiotensinogen to ANGI, and subsequently ANGII to induce AEC apoptosis, is

dependent on CatD activity.

162

In summary, bleomycin upregulated CatD enzymatic activity and expression in primary
cultures of rat AECS. Apoptosis of cultured AECs in response to bleomycin was
signiﬁcantly inhibited by the aspartyl protease inhibitor pepstatin A and by antisense
oligonucleotides against CatD mRNA. The same inhibitors also prevented the enzymatic
processing of a synthetic fragment of angiotensinogen (amino acids 1-14), and
completely blocked AEC apoptosis in response to the same peptide. These data are
consistent with earlier studies showing that apoptosis of AECs in response to bleomycin
requires the autocrine synthesis and proteolytic processing of angiotensinogen to
angiotensin II, and suggest that the proteolytic processing requires CatD. Therefore, our
data suggest that blockade of CatD and other aspartyl proteases might provide a potential
therapeutic strategy for pulmonary ﬁbrosis by preventing AECS apoptosis and for lung

injuries involving this mode of cell death.

3. Essential Roles for Angiotensinogen in Bleomycin-Induced Apoptosis and Lung
Fibrosis

In our study, the same strategies were used to demonstrate the essential roles for
angiotensinogen in bleomycin-induced apoptosis and lung ﬁbrosis as for AT1 receptor.
Our studies demonstrated that lung-derived angiotensinogen is involved in bleomycin-
induced apoptosis and lung ﬁbrosis at various levels including cellular, organ and whole

animal level.

3.1 Essential Roles for Angiotensinogen in Bleomycin-Induced Apoptosis in

Alveolar Epithelial Cells:

163

Our data demonstrated that BLEO induces ANGEN expression in primary AECs and
A549 cells. To determine if functional ANGEN mRNA is required for the apoptotic
response to BLEO, phosphorothioated antisense or scrambled-sequence control
oligonucleotides against ANGEN mRNA were transfected into rat AECs and A549 cells.
Our studies showed that BLEO-induced apoptosis of primary AECs and A549 cells was
inhibited by the ANGEN antisense but not by the scrambled control oligonucleotides.
Moreover, exposure to BLEO for 20 hours reduced the total cell number of A549 cells
(attached plus detached, bottom panel), which was prevented by the ANGEN antisense.
Although the mechanism by which bleomycin upregulates ANGEN mRNA was not
addressed in this study, the ﬁndings that BLEO, Fas L and TNF-a all increased ANGEN
mRNA (Wang et al., 1999; Wang et al., 2000) imply the involvement of a pathway
common to these inducers. Regulation of ANGEN expression is mostly studied in the
hepatocyte, in which the stimulatory effects of TNF-a and interleukin—6 have been shown
to be mediated through the interaction of transcription factors NF-kB and STAT-3 with
the Acute Phase Response Element (APR) of the ANGEN promoter (Brasier et al., 1994;
Sherman and Brasier, 2001). In contrast, studies of the regulation of ANGEN expression
by the cardiac ourocyte have shown that p53 is a key regulator of its expression in
response to a variety of stimuli (Leri et al., 1998; Pierzchalski et al., 1997). Whether this
difference reﬂects the distinct developmental lineages of these cell types or
other factors is unknown. From this point of view, future investigations of the regulation
of ANGEN expression by cells of the lung shall be quite worthwhile, particularly in light
of the fact that the lung contains many different cell types that are in very close proximity

but of distinct embryologic origins. As an example, the results reported here that ANGEN

164

expression is required for apoptosis of AECs compliment our earlier report of ANGEN
expression by human lung myoﬁbroblasts (Wang, et al., 1999), which reside immediately

adjacent to apoptotic AECs in the ﬁbrotic lung in situ.

3.2 Essential Roles for Angiotensinogen in Bleomycin-Induced Apoptosis and
Lung Fibrosis in explants:

Lung-derived angiotensin system can not be discriminated from the endocrine
angiotensin system if a whole animal model is used to study the role of angiotensin
system in bleomycin- induced PF. However, using explants as the ex vivo model we can
rule out the contributions of endocrine angiotensin system and hemodynamics to the
development of bleomycin-induced PF as blood circulation is removed in explants.
Furthermore, providing an in vitro condition at the organ level, lung explants will offer a
better mimic of the in vivo conditions compared to cell cultures.

Our studies showed that BLEO increased caspase 3 activity when applied in
vitro to rat lung explants that were depleted of blood before explant culture. Application
of BLEO in vitro increased caspase—3 activity in the explants, which was inhibited by
antisense oligonucleotides against ANGEN mRNA. F uthemmore, we showed that there
was more collagen accumulation in explants treated with bleomycin compared with
control group without bleomycin. Moreover, we showed that ANGEN antisense
oligonucleotides reduced BLEO-induced collagen accumulation in explants cultured in
1% ITS. Hence, this study demonstrated that bleomycin could induce apoptosis and

ﬁbrosis in lung explants, which could be blocked by antisense oligonucleotides against

165

ANGEN mRNA, suggesting lung-derived ANGEN is required for bleomycin-induced

pulmonary ﬁbrosis in serum free condition.

3.3 Essential Roles for Angiotensinogen in Bleomycin-Induced Apoptosis and
Lung Fibrosis in vivo:

The previous studies in our lab demonstrated that apoptosis of AECs in response to
BLEO was abrogated by antisense oligonucleotides against angiotensinogen (ANGEN)
mRNA (Li et al., 2003). We used the same oligonucleotide sequences delivered by
intratracheal (I.T.) instillation for in vivo experiments to block BLEO-induced apoptosis
and lung ﬁbrosis in the intact animal. To ensure speciﬁc delivery of the oligonucleotide
to the lung, the distribution of the oligonucleotides in the lungs and other tissues after I.T.
instillation was determined. Our data showed that a single I.T. dose of 150ug antisense
oligonucleotide provided delivery primarily to lung with relatively little accumulation in
liver or kidney. Moreover, the intratracheal instillation of antisense at close of 75ug
provided delivery of oligonucleotides primarily to lining cells of the airways and alveolar
walls. Those results suggest that IT. instillation of the oligonucleotide is a feasible
approach for in vivo studies.

Intratracheal instillation of 75ug antisense once along with bleomycin reduced
bleomycin—induced pulmonary ﬁbrosis detected by hydroxyproline assay or picrosirius
red staining, decreased ANGEN protein expression and active caspase-3 labeling and
ISEL positive cells, but had no effect on the serum ANG II level. These data are
consistent with the hypothesis that lung-derived ANGEN is involved in bleomycin-

induced pulmonary ﬁbrosis. Those data also suggest that lung-derived ANGEN is the

166

additional therapeutic targets within the pulmonary angiotensisn system and antisense
oligonucleotides against ANGEN mRNA may hold potential for the treatment of lung

ﬁbrosis in humans.

4. Roles of Pulmonary Angiotensin System in Development of Bleomycin-induced

Pulmonary Fibrosis: [Figure 7.1 modiﬁed from (Selman et al., 2001)]

 
  

® ANGEN

1‘ HM ~

’1 ..‘“\‘

  

 

 

 

Roles of pulmonary angiotensin system in development of bleomycin-induced pulmonary
ﬁbrosis can be summarized in the above ﬁgure, described as following:

1) Induce epithelial damage and activation:

Bleomycin induces apoptosis of lung AECs by upregulation of AN GEN gene expression.
Synthesized ANGEN, which can be converted to ANG I by cathepsin D (Cat D). ANG I

can be further converted to ANG II by ACE. ANG II can induce apoptosis of the AECs

167

 

through AT1 receptor, which will cause excessive loss of AECs and insufﬁcient
epithelial repair.

2) Cause ﬁbroblast migration and proliferation:

ANG II synthesized by epithelial cells can cause proliferation and transdifferentiation of
ﬁbroblasts into myoﬁbroblasts, which are the most important source of collagen in
pulmonary ﬁbrosis through upregulation of TGF-beta gene expression. In addition, TGF
beta can induce ANGEN gene expression in lung ﬁbroblast (unpublished data from Uhal
lab). There is an ANG II- TGF beta autocrine loop in the lung ﬁbroblasts, which can
amplify the proﬁbrotic of ANG II and cause myoﬁbroblast foci formation.

3) Cause impaired reepithelialization and subsequent pulmonary ﬁbrosis

Myoﬁbroblasts in myoﬁbroblast foci can synthesize ANGEN, which can be further
converted to ANG II. ANG 11 derived form myoﬁbroblast can cause the apoptosis of

AECs and contribute the development of pulmonary ﬁbrosis.

5. Rate-limiting step of pulmonary angiotensin [1 generation in bleomycin—induced
pulmonary ﬁbrosis:

There are several potential rate limiting steps for pulmonary angiotensin II generation in
bleomycin induced pulmonary ﬁbrosis including:

5.1 Renin and/or Cat D:

In other organ systems such as the cardiovascular system, renin has been shown to be the
major determinant for local ANG II production, in which renin derived from kidney is
taken up by the tissues via diffusion and binding to the (pro)renin receptors ( Danser,

2004). However, there is no evidence suggesting that similar mechanism for the

168

 

production of the pulmonary angiotensin system exists since the local renin synthesis has
never been demonstrated in the lung (Re, 2004). In our study (unpublished data), when a
non-speciﬁc aspartyl protease inhibitor Pepstatin A, also an inhibitor for renin, was
systemically administered, bleomycin induced pulmonary ﬁbrosis was more severe in
those animals.

Our study demonstrated that Cat D is responsible for the conversion of AN GEN to Ang I
in the primary AECs. However, it is probably not the only enzyme capable of doing so as
the complete inhibition of CatD by non-selective protease inhibitor pepstatin A did not
completely block bleomycin-induced apoptosis in AECs. Hence, additional protease(s)
may be involved in angiotensinogen processing and subsequent AEC apoptosis. Although
Cat D activity and protein expression was increased in bleomycin- induced pulmonary
ﬁbrosis model in rats (Koslowski et al., 2003; Uhal et al., unpublished data), its roles in
pulmonary ﬁbrosis and pulmonary angiotensin peptides generation is still unclear in vivo.
Futhermore, in bleomycin induced rat pulmonary ﬁbrosis model, systemically
administrated Pepstatin A did not protect the animals from bleomycin induced pulmonary
ﬁbrosis argues against that conversion of ANGEN to ANGI by Cat D is the rate limiting
step in pulmonary angiotensin synthesis.

5.2 ACE

ACE is expressed predominantly by the pulmonary endothelial cells in a membrane-
bound form and mainly responsible for generating circulating ANG II from angiotensin I.
ACE inhibitors completely blocked apoptosis of AECs induced by Fas L, TNF a,
bleomycin and Amiodarone, suggesting that ACE is the only enzyme responsible for

converting angiotensin I to angiotensin II in vitro. The in vivo condition could be

169

different though ACE activity was elevated in bronchoalveolar lavage ﬂuid (BALF)
and/or serum in many potentially ﬁbrotic lung diseases including idiopathic pulmonary
ﬁbrosis (Specks et al, 1990). However, the functional signiﬁcance of increased ACE
activity in those ﬂuids is not clear. It is speculated that increased ACE activity indicates
endothelial cell damage causing ACE to dissociate from the surface of injured endothelial
cells (Marshall, 2003). There is evidence supporting that ACE is functionally relevant to
pulmonary angiotensin generation although pulmonary tissue ACE activity remain
unchanged in bleomycin induced pulmonary ﬁbrosis model (Marshall et al., 2004). For
example, ACE inhibitor Ramipril decreased pulmonary ANG 11 concentration and
reduced bleomycin-induced pulmonary ﬁbrosis in rats. This result is consistent with our
previous ﬁnding that Captopril, another ACE inhibitor, attenuated bleomycin-induced
pulmonary ﬁbrosis (Wang et al., 2000). Although Ramipril completely inhibited ACE
activity in the lung, pulmonary ANG II concentration only decreased by half, suggesting
that ACE activity represents approximately half of the AN G II-generating capacity in the
lung. Other non-ACE enzyme such as chymases could be responsible for a signiﬁcant
proportion of ANG Il-generating activity in the lung as shown in the cardiac tissue (Urata
et al., 1990). In addition, chymase was shown to be activated in the pulmonary
inﬂammation and ﬁbrosis induced by paraquat in hamsters (Orito et al., 2004).

Taken together, those data argue against that ACE activity underlies the rate-limiting step

in ANG II generation within the lung.

5.3 AN GEN and angiotensin peptides:

170

ANGEN is the only known precursor for the synthesis of angiotensin peptides. Our
studies demonstrated that AN GEN mRNA expression in primary AECs and A549 cells is
upregulated and functional ANGEN mRNA is required for the apoptotic response to F as
L, TNF or, bleomycin and Amiodarone as apoptosis of primary AECS and A549 cells was
inhibited by the ANGEN antisense but not by the scrambled control oligonucleotides (Li
etaL,2003)

In lung explant where systemic angiotensin system was removed, bleomycin —induced
collagen accumulation ex vivo requires the ANGEN gene expression as ANGEN
antisense blocked the collagen deposition in explants. In whole animal model, circulating
levels of angiotensinogen are approximately equal to the Michaelis Constant (Km) of
renin for its substrate (about 1 uM) (Gould and Green, 1971). Therefore, the rate of
angiotensin II synthesis can be regulated by changes in angiotensinogen levels. Since the
normal concentration of ANGEN is near the Km for its reaction with renin (Gould and
Green 1971), one would expect any change in ANGEN levels to be accompanied by
parallel changes in the formation and actions of Ang II. For instance, transgenic mice
expressing the rat angiotensinogen gene are hypertensive (Kimura et al., 1992) and mice
without angiotensinogen gene expression are hypotensive (Tanimoto et al., 1994). In
addition, for any given level of renin activity angiotensin II synthesis can be altered by
changes in the concentration of available angiotensinogen (Poulsen and Jacobson, 1993).
For example, up-regulation of ANGEN in tissue can alter tissue concentrations of
angiotensin II, particularly, in tissues where are not subjected to systemic short loop or
long loop feedback control (Poulsen and Jacobson, 1993). In bleomycin induced

pulmonary ﬁbrosis model, ANGEN expression is upregulated in the lung shown in

171

chapter 6. Elevation of local pulmonary ANGEN concentration increased pulmonary
ANG II concentration. Furthermore, intratracheal delivery of antisense against ANGEN
mRNA blocked the apoptosis of alveolar epithelial cells and subsequent ﬁbrosis, which is
consistent with the result that local ANG II generation is decreased.

Whether the circulating ANGI and ANGII contribute to the pulmonary ANGII is
unknown. There is a possibility that tissue can uptake circulating angiotensins through
AT1 receptor binding and internalization (Danser, 2004). Uptake from the circulation can
be quantiﬁed by measuring steady state tissue and plasma levels of 1251—Labelled Ang I
and 11 during 1251‘-ANGI and II infusion. The results obtained ﬁom pigs (van Kats et al.
1997, 1998, 2001) showed that 1251-Ang II, but not 1251-Ang I, accumulated in tissues
like heart, kidney and adrenal gland. The absence of signiﬁcant tissue 125 l-Ang I
accumulation indicated that the presence of tissue ANG I cannot be attributed to uptake
from circulation. If the same thing occurs in the lung, circulating ANGI does not
contribute to the local pulmonary AN GII generation.

Accumulation of 125 I-Ang II at tissue sites was largely prevented by pretreatment with
an AT 1 receptor antagonist (Danser, 2004), suggesting that uptake of Ang II is mediated
via AT 1 receptor-dependent endocytosis. It is unlikely that AT 2 receptors play a role in
this process since AT 2 receptors do not internalize Ang II (Matsubara 1998). Similar
conclusions about AT1 receptor mediates internalization of ANG II were drawn from
Ang II infusion studies in rats (Zou et al. 1996a,b). However, comparison of the 125 l-
labelled and endogenous angiotensin levels revealed that, despite the signiﬁcant uptake of
1251-Ang II in various tissues, the majority (>90%) of tissue Ang II is not derived from

circulation. Instead, it is locally synthesized from locally generated Ang I (Danser, 2004).

172

In the lung AN GII uptake may not exist as treatment with losartan increased rather than
decreased pulmonary ANG 11 concentration (Marshall, 2004).

Taken together, our results together with others’ indicate that elevation of ANGEN
concentration in the lung is the most likely rate-limiting step for the pulmonary

angiotensin II generation.

6. Therapeutic Implications:

6.1 Existing clinical trials:
There have been several clinical trials to examine the therapeutic potentials of
angiotensin system antagonists, especially the ACE inhibitors, on IPF as well as other
ﬁbrotic lung diseases. The results obtained from those trials, however, are still
controversial and inconclusive. For example, Kyung et a1 (2002) conducted a small size
clinical study to investigate the clinical efﬁcacies of angiotensin receptor antagonist on
treating IPF. Fourteen patients diagnosed with IPF by open lung biopsy and by arnerican
thoracic sociatey (ATS) criteria were divided into two groups; the ﬁrst group were given
AT1 antagonist losartan (n=8), the second group were given placebo without losartan
(n=6). Although there was no signiﬁcant difference in serum angiotensin II level between
the two groups, patients treated by losartan showed increased Forced Vital capacity
(FVC) (by 12%). These results suggest that angiotensin II receptor antagonist may be an
effective agent for treating IPF.
Uhal et al. evaluated the effects of angiotensin system antagonists on pulmonary ﬁbrosis
induced by amiodarone, an antiarrhythmic reagent in which angiotensin system is also

considered to play an important role in the pathogenesis of this disease (Uhal et al.,

173

unpublished observation). After re-analyzing the CHF-STAT study (Survival Trial of
Antiarrythmic Therapy in CHF) (Singh et al., 1997), we found that compared with those
who did not receive the ACE inhibitors, there was a higher percentage without lung
ﬁbrosis (90.5% vs. 83.3%) and a lower percentage (0.98 vs. 3.3%) with severe
pulmonary ﬁbrosis of patients receiving either ACEis or ANG receptor antagonists
although the difference was not statistically signiﬁcant due to the low statistics power.
Based on these results, we speculate that there is a “trend” for patients who did not
receive ACEis drugs to develop more frequent and severe lung ﬁbrosis. Similarly, we
observed that with concurrent administration of the ACE inhibitors there was a trend
toward improved survival in patients with long-terrn administration of amiodarone
although the difference was not statistically signiﬁcant clue to the low statistics power
(p=0.57). That the CHF-STAT study did not demonstrate statistical differences in
pulmonary toxicity of patients receiving ACE inhibitors versus placebo (Boutitie et al.,
1999) may be due to the fact that the number of patients receiving placebo was too low to
reach sufﬁcient statistical power as they consist only 9% of the total patients. Hence, a
larger population of patients treated with amiodarone is needed to determine the
protective effects of ACEiS and angiotensin receptors blocker on amiodarone induced
pulmonary toxicity (Flaherty et al., 2002).

Contradictory to those above ﬁndings, results from two other clinical trials performed by
different investigators do not suggest the beneﬁcial role of angiotension-converting
enzyme inhibitors in treating IPF. The ﬁrst study by Raghu et al. (Raghu et al., ATS 2004
Mtg, Orlando, FL) employed prospective, randomized, double blind trials to investigate

the association of ACE inhibitors with survival and disease progression in patients with

174

IPF. Data were collected from 168 patients, of which 20 were on ACEis and 146 patients
were not. The other recently published clinical study by Nadrous et a1 (Nadrous et al.,
2004) retrospectively reviewed the effects of ACEis on survival of 478 patients with IPF
who visited Mayo Clinic Rochester from 1994 through 1996. 57 patients (12%) received
ACEI and the rest of them were not. Both studies found that the mortality rates and rates
of disease progression were similar in patients with or without ACEiS treatment, thus
suggesting that there is no beneﬁcial effect of ACEis on survival of patients with IPF.
However, there are some pitfalls in those two studies. For example, the ﬁrst study was
not speciﬁcally designed for evaluating the effects of ACEis on IPF. Instead, the major
purpose was to evaluate the effects of interferon gamma-1 b on treatment of IPF. As a
retrospective study, the limitations in the second study include lack of blinded
randomization for ACEis use, variations in the speciﬁc types and doses of ACEis
prescribed, varying concurrent therapies for IPF, reliance on clinicoradiologic parameters
for case deﬁnition in most patients, and incomplete information on duration of ACEis use
before establishment of the diagnosis of IPF. In addition, in order to detect a 20% survival
difference in a trial evaluating an agent for IPF, the minimum sample size is 700 patients
(Mapel et al., 1996). In both studies, the number of patients who received ACEis was
relatively small; therefore, those studies may be statistically underpowered to reliably
detect a survival beneﬁt of ACEis.

In conclusion, the results from clinical trials regarding whether the angiotensin system
antagonists have therapeutic effects on IPF are still controversial. Clinical trials
involving larger population with randomized and double blind designs need to be done to

determine their therapeutic potentials for IPF.

175

 

6.2 AT1 antagonist may be more efﬁcient than ACE inhibitors in term of
antiﬁbrotic effect in vivo
AT1 antagonist and ACE inhibitors both completely blocked AECs apoptosis induced by
Fas L, TNF alpha and amiodarone, bleomycin in vitro. And we were not able to detect
the difference between those two lines of reagents in inhibiting apoptosis. However, there
are some in vivo studies suggesting that the AT1 antagonist may be a more efﬁcient
antiﬁbrotic drug than ACE inhibitors. For example, it was shown that L-158, 809, a AT1
receptor antagonist, L-158, 809, was more effective in preventing radiation-induced
pneumopathy and lung ﬁbrosis than angiotensin-converting enzyme inhibitors captopril
and enalapril (Moltine et al., 2000), the mechanism of which, however, was unknown.
Theoretically speaking, AT1 receptor antagonist should be a more efﬁcient anti-ﬁbrotic
drug than ACE inhibitors in the lung due to the following reasons: 1) AT 1 receptors
mediate most of the proﬁbrotic effects in the lung. Therefore, inhibition of AT1 receptors
should exert more direct effects than ACE on AT1 receptor-mediated signal transduction.
2) AT 1 receptor antagonists increase the local concentration of ANG 11 (Marshall et al.,
2004), which may act through AT2 receptor to exert antiﬁbrotic function as shown in the
heart (Danser, 2004). 3) ACE is not the only enzyme to convert ANG I to ANG II in the
lung. Thus, ACE inhibitors might not completely block the proﬁbrotic effect of ANG II
converted by other enzymes such as chymase 4) ACE inhibitors disturb the bradykinin
system, the function of which is unknown in pulmonary ﬁbrosis. 5) Long —-term
administration of ACE inhibitors can induce the production of ACE, which will

counteract the antiﬁbrotic effects of ACE inhibitors (Boomsma et al., 1981).

176

6.3 Potential therapeutic approaches for IPF: Local administration of ANGEN
antisense or AT1 antagonist for IPF:
Our studies together with others’ demonstrated that activated pulmonary angiotensin
system plays an essential role in the development of pulmonary ﬁbrosis. The potential
rate-limiting step in the production of the pulmonary angiotensin system is the local
synthesis of angiotensinogen. The AT 1 receptor plays a major role in mediating the
proﬁbrotic effect of local ANG II in the lung. Those ﬁndings indicate that local
administration of ANGEN antisense or AT1 antagonists are potential therapeutic

approaches for IPF. The beneﬁts of local administration of those regents are as follows.

6. 3. 1. Local administration does not disturb the systemic angiotensin system
Lung is easier to be accessed compared to most of the other organ systems and local
delivery of drugs via the airway is feasible as nebulization or aerosolation of medications
via inhalation are commonly used clinically. Furthermore, in our study, intratracheal
instillation of antisense oligonucleotides against ANGEN mRNA achieved lung speciﬁc
delivery of the drug as the instilled antisense were contained in the lung and did not affect
plasma ANGEN and ANG 11 level. Yet, it is notable that, there exist regional differences
in alveolar ventilation resulting in the uneven delivery of the inhaled drugs. Hence, this
could cause insufﬁcient delivery to most severely ﬁbrotic areas within the lung (Marshall
et al., 2003). Direct instillation through the endo-tracheal tube or via a bronchoscope in
patients with IPF could be an alternative approach to compensate for the non-selective

delivery of nebulized drug in the lung.

177

6.3.2 Local administration is a more effective approach with fewer side effects
High tissue speciﬁcity ensures that much lower doses are needed to achieve the same
effects for locally administered drugs compared to systemically administered
counterparts. In addition, locally administration will cause much fewer side effects. This
has been proven by the locally administered steroids for asthma treatment (V ervereli et
al., 2004).

7. General Conclusions: (Fig. 7.2)

Lung epithelium apoptosis inducer:

 

 

 

 

 

 

 

 

 

 

Blerimycin
— Angiotensinogen .L I Antisense of I
| ANGEN mRNA
1 CatD *
-> Angiotensin I
l ACE : @E inhibi®
-> Angiotensin II /\
AT receptor
antagonists
Apoptosis > Fibrosis

Pulmonary angiotensin system is activated in bleomycin induced pulmonary ﬁbrosis
model. During the process of bleomycin-induced AECs apoptosis, AECs synthesize
ANGEN, which is converted to ANG I by cathepsin D (Cat D). ANG I is further

converted to ANG II by ACE. Locally produced ANG II mediates apoptosis of the AECs

178

leading to excessive loss of AECS and insufﬁcient epithelial repair. ANG 11 produced by
apoptotic epithelial cells also directly activates the ﬁbroblasts. Both effects lead to
pulmonary ﬁbrosis. Synthesis of ANGEN is the key upstream event in this process,
which can be blocked by the antisense oligonucletides against ANGEN mRNA. Local
administration of AN GEN antisense can be used, as a potential therapeutic approach for
treating PF. AT1 receptor is required for bleomycin- induced apoptosis and ﬁbrosis and

thus can also be a potential therapeutic target for PF.

179

REFERENCE

Adamson IYR and Bowden DH. (1976) Pulmonary injury and repair: organ culture
studies of murine lung after oxygen. Arch Pathol Lab Med 100: 640-643

Adamson IYR, Young L, et al. (1988) Relationship of alveolar epithelial injury and repair
to the induction of pulmonary ﬁbrosis Am J Pathol 130:377—3 83

Adler V, Schaffer A, et al. (1995) UV irradiation and heat shock mediate JNK activation
via alternate pathways J Biol Chem 270: 26071-26077

Admiraal PJ, Danser AH, et al. (1993) Regional angiotensin 11 production in essential
hypertension and renal artery stenosis Hypertension 21 : 173-84

Ali S, Leonard SA, et al. (2001) Absorption, distribution, metabolism, and excretion of a
respirable antisense oligonucleotide for asthma Am J Respir Crit Care Med 163: 989-993

Allen RT, William III JH, et al. (1997) Morphological and biochemical characterization
of apoptosis J Pharm Toxicol Meth 37: 215—228

American Thoracic Society (ATS), and the European Respiratory Society (ERS). (2000)
Idiopathic pulmonary ﬁbrosis: diagnosis and treatment. International consensus statement
Am J Respir Crit Care Med 161: 646-664

Antoniades HN, Avila RB, et al. (1990) Platelet-derived growth factor in idiopathic
pulmonary ﬁbrosis. J Clin Invest 86: 1055-1064

Antus B, Mucsi I, et al. (2000) Apoptosis and inhibition of cellular proliferation by ANG
11: possible implication and perspective. Acta Physiol Hung 87: 5—24

Aoshiba K, Yasui S, et al. (2000) The Fas/Fas-ligand system is not required for
bleomycin-induced pulmonary ﬁbrosis in mice. Am J Respir Crit Care Med 162: 695-700

Bader M, Paul M, et al. (1994) Renin -angiotensin system A: molecular biology of the
renin- angiotensin system. In: Swales JD, ed. Textbook o f Hypertension. Oxford:
Blackwell Scientific Publications, 214-232

Barbas-Filho J, Ferreira M, et al. (2001) Evidence of type II pneumocyte apoptosis in the
pathogenesis of idiopathic pulmonary ﬁbrosis (IPF)/usual interstitial pneumonia (UIP) J
Clin Pathol 54:132-138

Bargout R, Jankov A, et al. (2000) Amiodarone induces apoptosis of human and rat
AECS in vitro Am J Physiol Lung Cell Mol Physiol 278: L1039-1044

180

Basset F, Soler P, et al. (1986) Importance of cellular data from broncho-alveolar lavage
in interstitial pulmonary pathology Bull Acad Natl Med 170: 525-529

Basset G, Crone C, et al. (1987) Signiﬁcance of active ion transport in transalveolar
water absorption: a study on isolated rat lung J Physiol 384: 31 1-3 24

Battegay EJ, Colbert T, et al. (1995) TNF-alpha stimulation of ﬁbroblast proliferation:
Dependence on platelet-derived growth factor (PDGF) secretion and alteration of PDGF
receptor expression J Immunol 154: 6040-6047

Baumgartner KB, Samet JM, et al. (2000) Occupational and environmental risk factors
for idiopathic pulmonary ﬁbrosis: a multicenter case-control study. Collaborating Centers
Am J Epidemiol 152(4): 307-315

Bhat GJ, Thekkurnkara TJ, et al. (1994) Angiotensin II stimulates sis-inducing factor-like
DNA binding activity. Evidence that the ATlA receptor activates transcription factor-
Stat9l and/or a related protein J Biol Chem 269(50): 31443-31449

Blum RH, Carter SK, et al. (1973) A clinical review of bleomycin--a new antineoplastic
agent Cancer 31(4): 903-914

Boggs SS, Sartiano GP, et al. (1974) Minimal bone marrow damage in mice given
bleomycin Cancer Res 34(8): 1938-1942

Boomsma F, de Bruyn JH, et al. (1981) Opposite effects of captopril on angiotensin I-
converting enzyme 'activity' and 'concentration'; relation between enzyme inhibition and
long-term blood pressure response Clin Sci (Lond) 60(5): 491-498

Borok Z, Gillissen A, et a1. (1991) Augmentation of functional prostaglandin E levels on
the respiratory epithelial surface by aerosol administration of prostaglandin E Am Rev
Respir Dis 144(5): 1080-1084

Brasier A, Junyi L, et a1. (1994) Transcription factors modulating angiotensinogen gene
expression in hepatocytes Kidney International. 46: 1564-1566

Brown LF, Dvorak AM, et al. (1989) Leaky vessels, ﬁbrin deposition, and ﬁbrosis: a
sequence of events common to solid tumors and to many other types of disease Am Rev
Respir Dis 140(4): 1104-1107

Bullock GR, Steyaert I, et al. (2001) Distribution of type-l and type-2 angiotensin
receptors in the normal human lung and in lungs from patients with chronic obstructive

pulmonary disease Histochem Cell Biol 115(2): 117-1124

Burson JM, Aguilera G, et al. (1994) Differential expression of angiotensin receptor 1A
and 1B in mouse. Am J Physiol 267(2 Pt 1): E260-267

181

 

 

Campbell JM, Bacon TA, et al. (1990) Oligodeoxynucleoside phosphorothioate stability
in subcellular extracts, culture media, sera and cerebrospinal ﬂuid J Biochem Biophys
Methods 20: 259-267

Campbell DJ and Habener JF. (1986) ANGEN gene is expressed and differentially
regulated in multiple tissues of the rat. J Clin Invest 78: 31-39

Canington C, Coutu R, et al. (1978) Natural history and treated course of usual and
desquamative interstitial pneumonia. N Engl J Med 298: 801-809

Chapman HA, Allen CL, et al. (1986) Abnormalities in pathways of alveolar ﬁbrin

turnover among patients with interstitial lung disease. Am Rev Respir Dis 133(3): 437-
443

Cott GR, Sugahara K, et al. (1986) Stimulation of net active ion transport across alveolar
type 11 cell monolayers Am J Physiol 250(2 Pt 1): C222-227

Coultas DB, Black WC, et a1. (1994) The epidemiology of interstitial lung disease. Am J
Respir Crit Care Med 150:967-972

Crouch E. (1990) Pathobiology of pulmonary ﬁbrosis. Am J Physiol 259(4 Pt 1): L159-
184.

Crystal RG, Bitterrnan PB, et al. (2002) Future research directions in idiopathic PF:
summary of a National Heart, Lung, and Blood Institute working group. Am J Respir Crit
Care Med 166: 236-246

Crystal RG, Roberts WC, et al. (1976) Idiopathic pulmonary ﬁbrosis: Clinical, histologic,
radiographic, physiologic, scintigraphic, cytologic, and biochemical aspects. Ann Intern
Med 85: 769-788

Danahay H, Giddings J, et al. (1999) Distribution of a 20-mer phosphorothioate
oligonucleotide, CGP69846A (ISIS 5132), into airway leukocytes and epithelial cells
following intratracheal delivery to brown-norway rats. Pharm Res 16:1542-1549

Danser AHJ (2004). Renin-angiotensin system: plasma versus tissue. In: Unger T and
Schdlkens BA, ed. Angiotensin. Berlin, New York: Springer, 129-147

Danser AH, Derkx FH, et al. (1994) Angiotensin levels in the eye. Invest Ophthalmol Vis
Sci 35: 1008-1018

Day RM, Yang Y, et al. (2001) Bleomycin upregulates gene expression of angiotensin-
converting enzyme via mitogen-activated protein kinase and early growth response
1 transcription factor. Am J Respir Cell Mol Biol 25: 613-619

182

 

 

Dechend R, Wallukat G, et al. (2000). AT (1) receptor agonistic antibodies from
preeclamptic patients cause vascular cells to express tissue factor Circulation 101 :2382-
2387

Deiss LP, Galinka H, et al. (1996) Cathepsin D protease mediates programmed cell death
induced by interferon-gamma, Fas/APO-l and TNF-alpha EMBO J 15: 3861-3870

Deshmukh R, Smith A, et al. (1998) Hypertension. In: Lilly LS, ed. Pathophysiology of
Heart Disease; Second edition. Baltinmore: Williams and Wilkins, 267-288

Deterding RR, Havill AM, et al. (1997) Prevention of bleomycin-induced lung injury in
rats by keratinocyte growth factor Proc Assoc Am Physicians 109:254-268

Dimmeler S, Rippmann V, et al. (1997) Angiotensin II induces apoptosis of human
endothelial cells, Protective effect of nitric oxide C irc Res 81 :970—976

Dlugi AM, Robie KM, et al. (1974) Failure of bleomycin to affect humoral or cell-
mediated immunity in the mouse Cancer Res 34(10): 2504-2507

Dohi M, Hasegawa T, et a1. (2000) Hepatocyte growth factor attenuates collagen
accumulation in a murine model of pulmonary ﬁbrosis. Am J Respir Crit Care Med
162:2302-2307

Domagala-Kulawik J, Droszcz P, et al. (2000) Expression of Fas antigen in the cells from
bronchoalveolar lavage ﬂuid (BALF) Folia Histochem Cytobiol 38: 185-188

Douglas WW, Swensen SJ, et al. (1998) Colchicine versus prednisone in the treatment of
idiopathic pulmonary ﬁbrosis. A randomized prospective study. Members of the Lung
Study Group Am J Respir Crit Care Med 158: 220-225

Dzau VJ, Brenner A, et al. (1982) Evidence for renin in rat brain: differentiation from
other renin-like enzymes Am J Physiol 242: E292-297

Eggena P, Zhu J, et al. (1993) Nuclear angiotensin receptors induce transcription of
renin and angiotensinogen mRN A Hypertension 22: 496-501

Eitzman DT, Zheng X, et al (1996) Bleomycin-induced pulmonary ﬁbrosis in transgenic
mice that either lack or overexpress the murine plasminogen activator inhibitor-1 gene. J
Clin Invest 97:232-237

Erdos EG. (1990) Angiotensin I converting enzyme and the changes in our concepts
through the years. Lewis K. Dahl memorial lecture Hypertension 16(4): 363-3 70

Fang X, Zhu Y, et al. (2002) Losartan in the rat model of bleomycin-induced pulmonary

ﬁbrosis and its impact on the expression of monocyte chemoattractant protein-1 and basic
ﬁbroblast growth factor. Zhonghua Jie He He Hu Xi Za Zhi 25:268—272

183

Fehrenbach H, Kasper M, et al. (2000) Alveolar epithelial type 11 cell apoptosis in vivo
during resolution of keratinocyte growth factor-induced hyperplasia in the rat Histochem
Cell Biol 114:49—61

Flaherty KR, Toews GB, et al. (2001) Steroids in idiopathic pulmonary ﬁbrosis: a
prospective assessment of adverse reactions, response to therapy, and survival Am J Med
110(4): 278-282

F laherty KR, Toews GB, et al. (2002) Clinical signiﬁcance of histological classiﬁcation
of idiopathic interstitial pneumonia Eur Respir J 19(2): 275-283

Flaherty KR, Travis WD, et al. (2003) Fibroblastic foci in usual interstitial pneumonia:
idiopathic versus collagen vascular disease. Am J Respir Crit Care Med 167:1410-1415

Filippatos GS, Gangopadhyay N, et a1. (2001) Regulation of apoptosis by vasoactive
peptides Am J Physiol Lung Cell M01 Physiol 281: L749-761

Filippatos G, Tilak M, et al. (2001) Regulation of apoptosis by ANG II in the heart and
lungs Int J Mol Med 7: 273-280

Filippatos G and Uhal BD. (2003) Blockade of apoptosis by ACE inhibitors and
angiotensin receptor antagonists Curr Pharm Design 9:707—714

Fine A, Anderson NL, et al. (1997) Fas expression in pulmonary alveolar type 11 cells.
Am J Physiol 273:L64-71

Fine A, Uhal BD, et al. (2000) Apoptosis in lung pathophysiology. Am J Physiol Lung
Cell Mol Physiol 279(3): L423-427

Fonseca C, Abraham D, et a1. (2000) Lung ﬁbrosis Springer Semin lmmunopathol
21:453-474

Gallin JI, Goldstein IM, et al. (1992) Inﬂammation: Basic principles and clinical
correlates, Second edition, Raven press, Chapter 5: 991-997

Gauldie J, Kolb M, et al. A new direction in the pathogenesis of pulmonary ﬁbrosis
Respir Res 2002, 3: 1—3

Geisterfer AA, Peach MJ, et al. (1988) Angiotensin II induces hypertrophy, not
hyperplasia, of cultured rat aortic smooth muscle cells Circ Res 62(4): 749-56

Giaid A, Hamid Q, et al. (1993) Expression of endothelin-1 in lungs of patients with
cryptogenic ﬁbrosing alveolitis Lancet 341: 1550-1554

184

Goldstein R and Polgar P. (1982) The effect and interaction of bradykinin and
prostaglandins on protein and collagen production by lung ﬁbroblasts J Biol Chem 257:

8630-8633

Goodman BE and Crandall ED. (1982) Dome formation in primary cultured monolayers
of alveolar epithelial cells Am J Physiol 243(1): C96-100

Goodman BE, Fleischer RS, et al. (1983) Evidence for active Na+ transport by cultured
monolayers of pulmonary alveolar epithelial cells Am J Physiol 245(1): C78-83

Gorin AB and Stewart PA (1979) Differential permeability of endothelial and epithelial
barriers to albumin ﬂux. J Appl Physiol 47(6): 1315-1324

Gould AB and Green D (1971) Kinetics of the human renin and human substrate reaction
Cardiovasc Res 5(1): 86-89

Griendling K and Alexander RW. (1994) Renin —angiotensin system C: Cellular
mechanisms of angiotensin 11 action. In: Swales JD, ed. Textbook o f Hypertension.
Oxford: Blackwell Scientiﬁc Publications 214-232

Gross TJ, Simon RH, et al. (1991) Rat alveolar epithelial cells concomitantly express
plasminogen activator inhibitor-1 and urokinase Am J Physiol 260(4 Pt 1): L286-295

Gross TJ, Simon RH, et al. (1990). Expression of urokinase-type plasminogen activator
by rat pulmonary alveolar epithelial cells Am J Respir Cell Mol Biol 3(5): 449-456

Gross TJ and Sitrin RG. (1990) The THP-l cell line is a urokinase-secreting mononuclear
phagocyte with a novel defect in the production of plasminogen activator inhibitor-2 J
Immunol 144(5): 1873-1879

Gross TJ, Sitrin RG. (1990) Expression of urokinase-type plasminogen activator by rat
pulmonary alveolar epithelial cells Am J Respir Cell Mol Biol; 3: 449-456

Guerry-Force ML, Wright JL, et a1. (1987) A comparison of bronchiolitis obliterans with
organizing pneumonia, usual interstitial pneumonia, and small airways disease Am Rev
Respir Dis 135: 705-712

Guinee D Jr, Brambilla E, et al. (1997) The potential role of BAX and BCL-2 expression
in diffuse alveolar damage. Am J Pathol 151:999-1007

Guyton AC and Moffatt DS. (1981) Role of surface tension and surfactant in the

transepithelial movement of ﬂuid and in the development of pulmonary edema Prog
Respir Res 15: 62-75

185

Gyurko R, Wielbo D, et al. (1993) Antisense inhibition of AT1 receptor mRNA and
angiotensinogen mRNA in the brain of spontaneously hypertensive rats reduces
hypertension of neurogenic origin Regul Pept 49(2): 167-174

Hagimoto N, Kuwano K, et al. (1997) Induction of apoptosis and pulmonary ﬁbrosis in
mice in response to ligation of FAS antigen Am J Respir Cell Mol Biol 17:272-278

Hagimoto N, Kuwano K, et al. (1997) Apoptosis and expression of Fas/F as ligand mRN A
in bleomycin-induced pulmonary ﬁbrosis in mice Am J Respir Cell Mol Biol 16291-101

Hamilton RF, Li L, et al. (1995) Bleomycin induces apoptosis in human alveolar
macrophages. Am J Physiol Lung Cell Mol Physiol 269: L318-L325

Haller H, Lindschau C, et al. (1996) Effects of intracellular angiotensin II in vascular
smooth muscle cells C irc Res 79: 765-772

Harrison DG, Cai H, et al. (2003) Interactions of angiotensin II with NAD (P) H oxidase,
oxidant stress and cardiovascular disease J Renin Angiotensin Aldosterone Syst 4:51—61

Haschek WM and Witschi H. (1979) PF--a possible mechanism Toxicol Appl Pharmacol
51: 475-87

Hasegawa T, Marshall BC, et al. (1997) Induction of urokinase-type plasminogen
activator receptor by IL-1 beta Am J Respir Cell Mol Biol 16: 683-692

Hasday JD, Bachwich PR, et al. (1988) Procoagulant and plasminogen activator activities
of bronchoalveolar ﬂuid in patients with pulmonary sarcoidosis Exp Lung Res 14(2): 261-
278

Hasegawa T, Sorensen L, et al. (1997) Induction of urokinase-type plasminogen activator
receptor by IL-1 beta Am J Respir Cell Mol Biol 16(6): 683-692

He Y, Martin WJ, et al. (2001) Expression of yeast apurinic/apyridimidinic
endonuclease (APNl) protects lung epithelial cells from bleomycin toxicity Am J Resp
Cell Mol Biol 25:692-698

Heinrich M, Schutze S, et al. (1999) Cathepsin D targeted by acid sphingomyelinase-
derived cerarnide EMBO J, 18:5252-5263

Hubbard R, Britton J, et a1. (1996) Occupational exposure to metal or wood dust and
aetiology of cryptogenic ﬁbrosing alveolitis Lancet 347: 284-289

Ichikawa T, Matsuda A, et al. (1967) Biological studies on bleomycin A J Antibiot
(Tokyo) 20(3): 149-155

186

Ichikawa T, Nakano I, et al. (1969) Bleomycin treatment of the tumors of penis and
scrotum J Urol 102(6): 699-707

Idell S, James K, et al. (1989) Local abnormalities in coagulation and ﬁbrinolytic
pathways predispose to alveolar ﬁbrin deposition in the adult respiratory distress
syndrome J Clin Invest 84(2): 695-705

Inoshima I, Kuwano K, et al. (2004) Anti-monocyte chemoattractant protein-1 gene
therapy attenuates pulmonary ﬁbrosis in mice. Am J Physiol Lung Cell Mol Physiol
286:L1038-1044

Ip YT and Davis RJ. (1998) Signal transduction by the c-Jun N-terminal kinase (JNK)-
from inﬂammation to development Curr Opin Cell Biol 10: 205-219

Isahara K, Ohsawa Y, et al. (1999) Regulation of a novel pathway for cell death by
lysosomal aspartic and cysteine proteinases Neuroscience 91 :233-249

Ito M, Oliverio MI, et al. (1995) Regulation of blood pressure by the type 1A ANG II
receptor gene. Proc Natl Acad Sci U S A, 92: 3521-3525

Iwai K, Hosoda Y, et al. (1994) Idiopathic pulmonary ﬁbrosis. Epidemiologic approaches
to occupational exposure. Am J Respir Crit Care Med 150: 670-675

Janssen YM and Sen CK. (1999) Nuclear factor kappa B activity in response to oxidants
and antioxidants Methods Enzymol 300: 363-374

Johnston IDA, Rudd RM, et al. (1997) British Thoracic Society study of cryptogenic
ﬁbrosing alveolitis: current presentation and initial management. Fibrosing Alveolitis
Subcommittee of the Research Committee of the British Thoracic Society. Thorax.

52:38-44

Kagiyama S, Varela A, et al. (2001) Antisense inhibition of brain renin-angiotensin
system decreased blood pressure in chronic 2-kidney, 1 clip hypertensive rats
Hypertension 37(2 Part 2): 371-375

Kanno K, Chayama K, et al. (2003) ATlA-deﬁcient mice Show less severe progression of
liver ﬁbrosis induced by CC1(4) Biochem Biophys Res Commun 308: 177—183

Kapanci Y, Gabbiani G, et al. (1995) Cytoskeletal protein modulation in pulmonary
alveolar myoﬁbroblasts during idiopathic pulmonary ﬁbrosis. Possible role of
transforming growth factor beta and tumor necrosis factor alpha Am J Respir Crit Care
Med 152: 2163-2169

Kasper M, Lackie P, et al. (1996) Immunolocalization of cathepsin D in pneumocytes of
normal human lung and in PF. Virchows Arch 428(4-5): 207-215

187

Kasper M, Schinzel R, et a1. (1999) Experimental induction of AGES in fetal L132 lung
cells changes the level of intracellular cathepsin D. Biochem Biophys Res Commun 261:
175-182

Katwa LC, Ratajska A, et a1. (1995) Angiotensin converting enzyme and kininase lI-like
activities in cultured valvular interstitial cells of the rat heart Cardiovasc Res 29:57-64

Kazerooni EA, Flint A, et al. (1997) Thin-section CT obtained at lO-mm increments
versus limited three-level thin-section CT for idiopathic pulmonary ﬁbrosis: correlation
with pathologic scoring. Am J Roentgenol 169: 977-983

Kazufumi M, Sonoko N, et al. (1997) Expression of bcl-2 protein and APO-1 (Fas
antigen) in the lung tissue from patients with idiopathic pulmonary ﬁbrosis. Microsc Res
Tech 38:480-487

Kelly BG, Hasleton PS, et al. (2002) A rearranged form of Epstein-Barr virus DNA is
associated with idiopathic pulmonary ﬁbrosis. Am J Respir Crit Care Med 166:510-513

Khalil N, Unruh H, et al. (1996) TGF-beta l, but not TGF-beta 2 or TGF-beta 3, is
differentially present in epithelial cells of advanced pulmonary ﬁbrosis: an
immunohistochemical study. Am J Respir Cell Mol Biol 14: 131-138

Kim HS, Krege JH, et al. (1995) Genetic control of blood pressure and the
angiotensinogen locus. Proc Natl Acad Sci U S A 92: 2735-2739

Kirnura I, Onoshi T, et a1. (1972) Treatment of malignant lymphomas with bleomycin
Cancer 29(1): 58-60

Kirnura S, Mullins JJ, et al. (1992) High blood pressure in transgenic mice carrying the
rat angiotensinogen gene. Embo J 11(3): 821-827

King TE Jr., Brown K, et a1. (2001) Idiopathic pulmonary ﬁbrosis: relationship between
histopathologic features and mortality. Am J Respir Crit Care Med 164:1025-1032

King TE Jr., Costabel U, et al. (2000) Idiopathic Pulmonary Fibrosis: Diagnosis and
Treatment lntemational Consensus Statement Am J Respir Crit Care Med 161: 646-664

Koslowski R, Knoch K, et al. (2003) Cathepsins in bleomycin induced lung injury in rat.
Eur Respir J 22:427-435

Kotani I, Takada A, et al. (1995) Increased procoagulant and antiﬁbrinolytic activities in
the lungs with idiopathic pulmonary ﬁbrosis Thromb Res 77: 493-504

Kuhn C., Boldt J, et al. (1989) An immunohistochemical study of architectural

remodeling and connective tissue synthesis in pulmonary ﬁbrosis Am Rev Respir Dis
140(6): 1693-703

188

Kuhn C and McDonald JA. (1991) The roles of the myoﬁbroblast in idiopathic
pulmonary ﬁbrosis. Ultrastructural and immunohistochemical features of sites of active

extracellular matrix synthesis Am J Pathol 138: 1257-1265

Kuwano K, Kunitake R, et al. (1996) P21 and p53 expression in association with DNA
strand breaks in idiopathic pulmonary ﬁbrosis. Am J Respir Crit Care Med 154: 477-483

Kuwano K, Hagimoto N, et al. (1999) Essential roles of the F as/F as ligand pathway in the
development of pulmonary ﬁbrosis. J Clin Invest 104: 13-19

Kuwano K, Hagimoto N, et al. (2000) Expression of apoptosis-regulatory genes in
epithelial cells in pulmonary ﬁbrosis in mice. J Pathol 190:221-229

Kuwano K, Kunitake R, et al. (2001) Attenuation of bleomycin-induced pneumopathy in
mice by a caspase inhibitor. Am J Physiol Lung Cell Mol Physiol 280:L316-325

Kuwano K, Maeyama T, et al. (2002) Increased circulating levels of soluble Fas ligand
are correlated with disease activity in patients with ﬁbrosing lung diseases. Respirology
7:15-21

Kyung SY, lim YH, et a1. (2003) The clinical efﬁcacy of angiotensin II receptor
antagonist on idiopathic pulmonary ﬁbrosis Am J Respir Crit Care Med 167: A166
(abstract)

Lai K, Leung J, et a1. (1998) Gene expression of the renin-angiotensin system in human
kidney. J Hypertens 16:91 -102

Lama V, Peters-Golden M, et al. (2002) Prostaglandin E2 synthesis and suppression of
ﬁbroblast proliferation by alveolar epithelial cells is cyclooxygenase-Z-dependent. Am J

Respir Cell Mol Biol 27: 752-758

Lander HM, Jacovina AT, et al. (1996) Differential activation of mitogen-activated
protein kinases by nitric oxide-related species. J Biol Chem 271: 19705-19709

Lee YC, Chen KT, et al. (2000) Gene polymorphisms of endothelial nitric oxide synthase
and angiotensin-converting enzyme in patients with asthma Allergy 55:959—963

Lee MW and Severson DL. (1994) Signal transduction in vascular smooth muscle:
diacylglycerol second messengers and PKC action. Am J Physiol 267(3 Pt 1): C659-678

Lehane DE, Hurd E, et al. (1975) The effects of bleomycin on immunocompetence in
man. Cancer Res 35(10): 2724-2728

Leri A, Claudia PP, et al. (1998) Stretch-Mediated Release of Angiotensin II Induces
Myocyte Apoptosis by Activating p53 That Enhances the Local Renin-Angiotensin

189

System and Decreases the Bcl-2-to-Bax Protein Ratio In the Cell. J Clin Invest
101:1326-1342

Li B, Philips MI, et al. (1997) Uptake and efﬂux of intact antisense phosphorothioate
deoxyoligonucleotide directed against angiotensin receptors in bovine adrenal cells.
Neurochem Int 31 :393-403

Li D, Philips MI, et al. (1999) Proapoptotic effects of ANG II in human coronary artery
endothelial cells: role of AT1 receptor and PKC activation. Am J Physiol 276(3 Pt 2):
H786-792

Li HP, Kaplan AP, et a1. (2004) The inﬂuence of dexamethasone on the proliferation and
apoptosis of pulmonary inﬂammatory cells in bleomycin-induced pulmonary ﬁbrosis in
rats. Respirology 9:25-32

Li X, Uhal BD, et al. (2003) Essential roles for angiotensin receptor ATla in bleomycin-
induced apoptosis and lung ﬁbrosis in mice. Am J Pathol 163: 2523-2530

Li X, Uhal BD, et al. (2003) Bleomycin-induced apoptosis of alveolar epithelial cells
requires angiotensin synthesis de novo. Am J Physiol Lung Cell Mol Physio 284: L501-
507,

Lindpaintner K, Ganten D, et a1. (1988) Intracardiac generation of angiotensin and its
physiologic role. Circulation 77(6 Pt 2): 118-23

Low RB. (1989) Bronchoalveolar lavage lipids in idiopathic pulmonary ﬁbrosis Chest
95(1):3-5

Mannino DM, Parrish RG, et al. (1996) Pulmonary ﬁbrosis deaths in the United States,
1979-1991. An analysis of multiple-cause mortality data. Am J Respir Crit Care Med.
153:1548-1552

Mapel DW, Coultas DB, et al. (1998) Idiopathic PF: survival in population based and
hospital based cohorts. Thorax 53: 469-476

Mapel DW, Samet JM, et al. (1996). Corticosteroids and the treatment of idiopathic
pulmonary ﬁbrosis. Past, present, and future. Chest 110(4): 1058- 1067

Marshall RP. (2003) The pulmonary renin-angiotensin system. Curr Pharm Des 9(9):
715-722

Marshall R, Laurent G, et al. (2000) Angiotensin II is mitogenic for human lung
ﬁbroblasts via activation of the type I receptor. Am J Respir Crit Care Med 161:1999—
2004

190

Marshall RP, Laurent GJ, et al. (2004) Angiotensin II and the ﬁbroproliferative response
to acute lung injury Am J Physiol Lung Cell Mol Physiol. 286:L156-164

Martin I, Humbert M, et al. (2002) Plasminogen activation by blood monocytes and

alveolar macrophages in primary pulmonary hypertension Blood Coagul Fibrinolysis
13(5): 417-22.

Mason RJ, Williams MC, et al. (1982) Transepithelial transport by pulmonary alveolar
type 11 cells in primary culture Proc Natl Acad Sci U S A 79(19): 6033-6037

Mason RJ, Schwarz MI, et al. (1999) NHLBI Workshop Summary. Pharmacological
therapy for idiopathic PF. Past, present, and future Am J Respir Crit Care Med 160(5 Pt
1): 1771-1777

Mason RJ and Williams MC (1991) Type II alveolar epithelial cells In: The Lung:
Scientiﬁc Foundations (Crystal, R. and West, J .B., Eds.) Raven Press 1: 235-241

Matsubara H. (1998) Pathophysiological role of angiotensin 11 type 2 receptor in
cardiovascular and renal diseases Circ Res 83(12): 1182-1191

Matsuoka H, Arai T, et al. (2002) p38 MAPK inhibitor, FR-167653, ameliorates murine
bleomycin-induced pulmonary ﬁbrosis. Am J Physiol Lung Cell Mol Physiol 283:L103-
112

Matute-Bello G, Liles WC, et al. (2001) Recombinat human Fas ligand induces alveolar
epithelial cell apoptosis and lung injury in rabbits. Am J Physiol 281 :L328-L335

Matthay MA, and Wiener-Kronish JP (1990) Intact epithelial barrier function is critical
for the resolution of alveolar edema in humans. Am Rev Respir Dis 142(6 Pt 1): 1250-
1257

McCormack F X, King Jr. TE, et al. (1991) Idiopathic pulmonary ﬁbrosis. Abnormalities
in the bronchoalveolar lavage content of surfactant protein A. Am Rev Respir Dis 144(1):
160-166

McGee MP and Rothberger H. (1985) Tissue factor in bronchoalveolar lavage ﬂuids.
Evidence for an alveolar macrophage source. Am Rev Respir Dis 131(3): 331-336

Mezzano S, Ruiz-Ortega M, et a1. (2001) Angiotensin II and renal ﬁbrosis Hypertension
38:635—638

Molteni A, Moulder JE, et al. (2000) Control of radiation-induced pneumopathy and lung
ﬁbrosis by angiotensin-converting enzyme inhibitors and an ANG 11 type 1 receptor
blocker. Int J Radiat Biol 76: 523-532

191

Molteni A, Ward WF, et al. (1985) Monocrotaline-induced PF in rats: amelioration by
captopril and penicillamine. Proc Soc Exp Biol Med 180: 112-120

Morrison CD, Papp AC, et al. (2001) Increased D allele frequency of the angiotensin-
converting enzyme gene in PF. Hum Pathol 32: 521-528

Mullen J, Hodgson MJ, et al. (1998) Case-control study of idiopathic pulmonary ﬁbrosis
and environmental exposures. J Occup Environ Med 40(4): 363-3 67

Muller DN, Dechend R, et al. (2000) Angiotensin II (AT(I)) receptor blockade reduces
vascular tissue factor in angiotensin II-induced cardiac vasculopathy. Am J Patho 1157:
111-122

Mundle S, Iftikhar A, et al. (1994) In situ end labeling of DNA to detect apoptotic cell
death in a variety of human tumors. Cell Death Diﬂer 1: 117-122

Murphy TJ, Alexander RW, et al. (1991) Isolation of a cDNA encoding the vascular
type-1 angiotensin II receptor. Nature 351(6323): 233-6

Nadrous HF, Ryu JH, et al. (2004) Impact of angiotensin-converting enzyme inhibitors
and statins on survival in idiopathic pulmonary ﬁbrosis. Chest 126(2): 438-446

Nash JR, Corrin B, et al. (1993) Expression of tumour necrosis factor-alpha in
cryptogenic ﬁbrosing alveolitis. Histopathology 22: 343-347

Ng K and Vane JR. (1968) The conversion of angiotensin I to angiotensin II in vivo
Naunyn Schmiedebergs Arch Exp Pathol Pharmakol 259(2): 188-189

Nguyen L, Ward WF, et al. (1994) Captopril inhibits proliferation of human lung
ﬁbroblasts in culture: a potential antiﬁbrotic mechanism. Proc Soc Exp Biol Med 205: 80-
84

Nicholson AG, Wells AU, et al. (2002) The relationship between individual histologic
features and disease progression in idiopathic pulmonary ﬁbrosis. Am J Respir Crit Care
Med 166: 173-177

Nishimura H, Masuda H, et al. (1997) Angiotensin 11 increases plasminogen activator
inhibitor-1 and tissue factor mRNA expression without changing that of tissue type
plasminogen activator or tissue factor pathway inhibitor in cultured rat aortic endothelial
cells. Thromb Haemost 77:1189-1195

Nobukuni S, Inoue J, et a1. (2002) Cigarette smoke inhibits the growth of lung ﬁbroblasts
from patients with pulmonary emphysema. Respirology 7:217-223

192

Ohashi H, Takagi H, et a1. (2004) Phosphatidylinositol 3-kinase/Akt regulates
angiotensin II- induced inhibition of apoptosis in microvascular endothelial cells by
governing survivin expression and suppression of caspase-3 activity. C irc Res 94(6): 785-
793

Ohkubo H, and Nakanishi S. (1986) Tissue distribution of rat ANGEN mRNA and
structural analysis of its heterogeneity. J Biol Chem 261(1): 319-323

Oparil S, Tregear GW, et al. (1971) Mechanism of pulmonary conversion of angiotensin I
to angiotensin II in the dog Circ Res 29(6): 682-690

Orito K, Akahori F, et a1. (2004) Chymase is activated in the pulmonary inﬂammation
and ﬁbrosis induced by paraquat in hamsters. Tohoku J Exp Med. 203(4): 287-294

Ortiz LA, Moroz K, et al. (1998) Alveolar macrophage apoptosis and TNF-E1, but not
p53, correlate with murine response to bleomycin. Am J Physiol 275: L1208-L1218

Otsuka M, Takahashi H, et al. (2004) Reduction of bleomycin induced lung ﬁbrosis by
candesartan cilexetil, an angiotensin 11 type 1 receptor antagonist. Thorax 59(1): 31-38

Paine R, and Simon RA. (1996) Expanding the frontiers of lung biology through the
creative use of alveolar epithelial cells in culture. Am J Physiol 270: L484-L486

Panos R, King T, et al. (1990) Clinical deterioration in patients with idiopathic
pulmonary ﬁbrosis: causes and assessment. Am J Med 88: 396-404

Pantelidis P, Du Bois RM, et a1. (2001) Analysis of tumor necrosis factor-alpha,
lymphotoxin-alpha, tumor necrosis factor receptor 11, and interleukin-6 polymorphisms in
patients with idiopathic pulmonary ﬁbrosis. Am J Respir Crit Care Med 163: 1432-1436

Panoskaltsis-Mortari A and Bucy RP. (1995) In situ hybridization with digoxigenin RNA
probes: fact and artifacts. Biotechniques 18:300-3 07

Papp M, Li X, et al. (2002) Angiotensin receptor subtype AT(1) mediates AEC apoptosis
in response to ANG 11. Am J Physiol Lung Cell Mol Physiol 282: L713-718

Pardo A, Selman M, et a1. (1997) Lung AECS synthesize interstitial collagenase and
gelatinases A and B in vitro. Int J Biochem Cell Biol 29: 901-910

Peng JF, Kirnura B, et al. (1998) Reduction of cold-induced hypertension by antisense
oligodeoxynucleotides to angiotensinogen mRNA and AT1-receptor mRNA in brain and

blood Hypertension 31(6): 1317-1323

Phillips MI, Gyurko R, et al. (1994) Antisense inhibition of hypertension: a new strategy
for renin-angiotensin candidate genes. Kidney International 46:1554-1556

193

Phillips MI. (2001) Gene therapy for hypertension: sense and antisense strategies. Expert
Opin Biol Ther 1(4): 655-662

Pick R, Weber K, et al. (1989) The ﬁbrillar nature and structure of isoproterenol-induced
myocardial ﬁbrosis in the rat. Am J Pathol 134: 365-371

Pierzchalski, Anversa P, et a1 (1997) p53 induces myocyte apoptosis via activation of the
renin-angiotensin system. Exp Cell Res 234:57-65

Ponte P, Kedes L, et al. (1984) Evolutionary conservation is in the untranslated regions of
actin mRNAs: DNA sequence of a human III-actin cDNA Nuc Acid Res12: 1687-1696

Poulsen K and Jacobson J. (1993) Enzymatic reactions of the renin-angiotensin system
In: Robertson JIS, Nicholls MG, eds. The renin- angiotensin system: Volume one:
Biochemistry and Physiology. New York: Gower Medical Publishing; P.5.1-5.12

Proudn D (1991) Production and metabolism of kinnins. In: Crystal, RG. and West, J .B.,
Editors, The Lung: Scientific Foundations, Raven, New York, 61—68

Raghu G, Cain K, et al. (1991) Azathioprine combined with prednisone in the treatment
of idiopathic pulmonary ﬁbrosis: a prospective double-blind, randomized, placebo-
controlled clinical trial. Am Rev Respir Dis 144: 291 -296

Raghu G, Safrin S, et al. (2004) Association of statin and angiotensin-converting enzyme
inhibitor use with survival and disease progression in patients with idiopathic pulmonary

ﬁbrosis. Am J Respir Crit Care Med 169: A706 (abstract)

Robertson JIS, Nicholls MG, eds. (1993) The renin- angiotensin system: Volume one:
Biochemistry and Physiology. Gower Medical Publishing

Re RN. (2004) Tissue renin angiotensin systems Med Clin North Am 88(1): 19-38

Sasaki K, Yamano Y, et al. (1991) Cloning and expression of a complementary DNA
encoding a bovine adrenal angiotensin II type-1 receptor. Nature 351(6323): 230-233

Sato E, Koyama S, et al. (1999) Bleomycin stimulates lung epithelial cells to release
neutrophil and monocyte chemotactic factors. Am J Physiol 276:L941-L950

Saraste A and Pulkki K. (2000) Morphological and biochemical hallmarks of apoptosis
Cardiovasc Res 45: 528—537

Sausville EA, Stein RW, et al. (1978) Properties and products of the degradation of DNA
by bleomycin and iron (II) Biochemistry 17(14): 2746-2754

Schaeffer HJ and Weber MJ. (1999) Mitogen-activated protein kinases: speciﬁc
messages from ubiquitous messengers. Mol Cell Biol 19: 2435-2444

194

Schwartz DA, Dayton CS, et a1. (1994) Determinants of survival in idiopathic pulmonary
ﬁbrosis. Am J Respir Crit Care Med. 149: 450-454

Selman M. (1990) Pulmonary ﬁbrosis: human and experimental disease. Rojkind M Eds
Connective tissue in health and disease, CRC Press Boca Raton, FL 123-188

Selman M, Pardo A, et al. (2001) American Thoracic Society; European Respiratory
Society; American College of Chest Physicians. Idiopathic PF: prevailing and evolving
hypotheses about its pathogenesis and implications for therapy. Ann Intern Med 134:136-
15]

Shahar I, Topilsky M, et al. (1999) Effect of endothelin-1 on alpha-smooth muscle actin
expression and on alveolar ﬁbroblast proliferation in interstitial lung diseases Int J
Immunopharmacol 21: 759-775

Sherman T and Brasier AR (2001) Role of signal transducers and activators of
transcription 1 and 3 in inducible regulation of the human angiotensinogen gene by
interleukin-6 Mol Endocrin 1 5:441 -457

Simon R. (1995) Alveolar epithelial cells in pulmonary ﬁbrosis. In: Pulmonary F ibrosis,
P. S., Thrall RS (eds). Marcel Dekker: New York, 511-540

Simon RH, Sitrin RG, et al. (1992) Fibrin degradation by rat pulmonary alveolar
epithelial cells. Am J Physiol 262: L482-L488

Singh SN, Fisher SG, et al. (1997) Pulmonary effect of amiodarone in patients with heart
failure. The Congestive Heart Failure-Survival Trial of Antiarrhythmic Therapy (CHF-
STAT) Investigators (Veterans Affairs Cooperative Study No. 320). J Am Coll Cardiol
30(2): 514-517

Sitrin RG, Brubaker PG, et al. (1987) Tissue ﬁbrin deposition during acute lung injury in
rabbits and its relationship to local expression of procoagulant and ﬁbrinolytic activities.
Am Rev Respir Dis 135(4): 930-936

Specks U, Rohrbach MS, et al. (1990) Bronchoalveolar lavage ﬂuid angiotensin-
converting enzyme in interstitial lung diseases Am Rev Respir Dis 141: 117-123

Stern JB, Crestani B, et al. (2003) Keratinocyte growth factor and Hepatocyte growth
factor: their roles in alveolar epithelial repair Rev Mal Respir 202896-903

Stewart JP, Ross AJ, et al. (1999) The detection of Epstein-Barr virus DNA in lung tissue

from patients with idiopathic pulmonary ﬁbrosis. Am J Respir Crit Care Med 159:1336-
1341

195

Sugahara K, Iyama K, et al. (1998) Double intratracheal instillation of keratinocyte
growth factor prevents bleomycin-induced lung ﬁbrosis in rats. J Pathol 186:90-98

Sun Y and Weber TK. (1998) Cardiac remodelling by ﬁbrous tissue: role of local factors
and circulating hormones. Ann Med 1:83—88

Sutherland LM, Murray AW, et al. (2001) Alveolar type 11 cell apoptosis. Comp Biochem
Physiol A Mol Integr Physiol 129: 267-285

Swaisgood CM, Noga C, et al. (2000) The development of bleomycin-induced pulmonary
ﬁbrosis in mice deﬁcient for components of the ﬁbrinolytic system. Am J Pathol 157:
177-187

Swiderski RE, Floerchinger CS, et al. (1998) Differential expression of extracellular
matrix remodeling genes in a murine model of bleomycin-induced pulmonary ﬁbrosis.
Am JPathol 152: 821-828

Tanimoto K, Sugiyama F, et al. (1994) Angiotensinogen-deﬁcient mice with
hypotension. J Biol Chem 269(50): 31334-31337

Taniyama Y, Nakagarni H, et al. (2000) Potential contribution of a novel antiﬁbrotic
factor, hepatocyte growth factor, to prevention of myocardial ﬁbrosis by angiotensin II
blockade in cardiomyopathic hamsters. Circulation 102:246-252

Taylor BK, Stoops TD, et al. (2000) Protein phosphatase inhibitors arrest cell cycle and
reduce branching morphogenesis in fetal rat lung cultures. Am J Physiol Lung Cell Mol

Physiol 278: L1062-1070

Templin MV, Levin AA, et al. (2000) Pharmacokinetic and toxicity proﬁle of a
phosphorothioate oligonucleotide following inhalation delivery to lung in mice. Antisense
Nucleic Acid Drug Dev, 10:359-368

Terzaghi M, Nettesheim P, et al. (1978) Repopulation of denuded tracheal grafts with
normal, preneoplastic, and neoplastic epithelial cell populations. Cancer Res 38(12):
4546-4553

Thomas AQ, Phillips J 3rd LK, et a1. (2002) Heterozygosity for a surfactant protein C
gene mutation associated with usual interstitial pneumonitis and cellular nonspeciﬁc

interstitial pneumonitis in one kindred. Am J Respir Crit Care Med 165: 1322-1328

Thrall R, McCormick J, et al. (1979) Bleomycin-induced PF in the rat. Am J Pathol, 95:
117-130

Thrall RS and Scalise PJ. (1995). Bleomycin In: Phan SH and Thrall RS, ed. Pulmonary
ﬁbrosis. New York: Marcel Dekker, Inc., 231-264

196

Timmerrnans PB, Wong PC, et al. (1993). Angiotensin 11 receptors and angiotensin II
receptor antagonists. Pharmacol Rev 45(2): 205-251

Uchiyama Y. (2001) Autophagic cell death and its execution by lysosomal cathepsins.
Arch Histol Cytol. 64: 233-246

Umezawa H. (1967) Bleomycin Gan No Rinsho 13(10): 735

Umezawa H. (1973) Studies on bleomycin: chemistry and the biological action.
Biomedicine 18(6): 459-475

Umezawa H. (1974) Chemistry and mechanism of action of bleomycin. Fed Proc 33(11):
2296-2302

Umezawa H, Maeda K, et al. (1966) New antibiotics, bleomycin A and B. J Antibiot
(Tokyo) 19(5): 200-209

Umezawa H, Takeuchi T, et a1. (1972) Studies on the mechanism of antitumor effect of
bleomycin of squamous cell carcinoma. J Antibiot (Tokyo) 25(7): 409-420

Uhal BD, Filippatos G, et al. (2003) Inhibition of Amiodarone-induced lung ﬁbrosis but
not alveolitis by angiotensin system antagonists Pharmacol Toxicol 92:81-87

Uhal BD, Filippatos G, et al. (1998) Captopril inhibits apoptosis in human lung epithelial
cells: a potential antiﬁbrotic mechanism. Am J Physiol 275:L1013-L1017

Uhal BD, Flowers KM, et al. (1991) Type II pneumocyte proliferation in vitro: problems
and future directions. Am J Physiol Suppl, 261 :1 10-1 17

Uhal BD and Rannels DE. (1991) DNA distribution analysis of type II pneumocytes by
laser ﬂow cytometry: technical considerations. Am J Physiol 261:L296-L306

Uhal BD, Selman M, et al. (1998) AEC death adjacent to underlying myoﬁbroblasts in
advanced ﬁbrotic human lung Am J Physiol 275: L1 192-1 199

Uhal BD, (1997) Cell cycle kinetics in the alveolar epithelium. Am J Physiol 272(6 Pt 1):
L1031-1045

Uhal BD. (2001) Fas and apoptosis in the alveolar epithelium: holes in the dike?
(Editorial) Am J Physiol 281:L326-L327

Uhal BD (2002) Apoptosis in lung ﬁbrosis and repair Chest 122:293S-2988

Uhal BD. (2002) Apoptosis in lung ﬁbrosis and repair Chest 122(6 Suppl): 293 S-298S.

197

Urata H, Husain A, et al. (1990) Identiﬁcation of a highly speciﬁc chymase as the major
angiotensin II-forming enzyme in human heart J Biol Chem 266: 22348-22357

Van Kats JP, Danser AH, et al. (1998) Angiotensin production by the heart: a quantitative
study in pigs with the use of radiolabeled ANG Infusions. Circulation 98: 73-81

Van Kats JP, de Lannoy LM, et al. (1997) Angiotensin 11 type 1 (AT1) receptor-mediated
accumulation of angiotensin II in tissues and its intracellular half-life in vivo.
Hypertension 30(1 Pt 1): 42-49

Van Kats JP, Schalekamp MA, et al. (2001) Intrarenal angiotensin II: interstitial and
cellular levels and site of production. Kidney Int 60(6): 2311-2317

Venkatesan N, Punithavathi V, et al. (1997) Curcumin protects bleomycin-induced lung
injury in rats. Life Sci 61: 51-58

Ververeli K and Chipps B. (2004) Oral corticosteroid-sparing effects of inhaled
corticosteroids in the treatment of persistent and acute asthma. Ann Allergy Asthma
Immunol 92(5): 512-522

Wang R, Uhal BD, et al. (2000) Apoptosis of lung epithelial cells in response to TNF-
alpha requires ANG II generation de novo. J Cell Physiol 185:253-259

Wang R, Uhal BD, et al. (2000) Abrogation of bleomycin-induced epithelial apoptosis
and lung ﬁbrosis by captopril or by a caspase inhibitor. Am J Physiol Lung Cell Mol
Physiol 279: Ll43-151

Wang R, Uhal BD, et al. (1999) Human lung myoﬁbroblast-derived inducers of alveolar
epithelial apoptosis identiﬁed as angiotensin peptides. Am J Physiol 277: L1158-ll64

Wang R, Uhal BD, et al. (1999) Fas-induced apoptosis of AECS requires ANG II
generation and receptor interaction. Am J Physiol 277: L1245-1250

Wang R, Uhal BD, et al. (1999) ANG II induces apoptosis in human and rat AECS. Am J
Physiol 276: L885-889

Ward WF, Molteni A, et al. (1990) Captopril reduces collagen and mast cell
accumulation in irradiated rat lung. Int J Radiat Oncol Biol Phys 19: 1405-1409

Weber KT, Campbell SE, et a1 (1995) Structural remodeling of the heart by ﬁbrous
tissue: role of circulating hormones and locally produced peptides. Eur Heart J 16(suppl
N): 12-18

Wells A, DuBois R, et al. (1993) The predictive value of appearances on thin-section
computed tomography in ﬁbrosing alveolitis Am Rev Respir Dis 148: 1076-1082

198

White ES, Lazar MH, et a1. (2003) Pathogenetic mechanisms in usual interstitial
pneumonia/idiopathic pulmonary ﬁbrosis J Pathol 201(3): 343-354

Whyte M, Meliconi R, et al. (2000) Increased risk of ﬁbrosing alveolitis associated with
interleukin-1 receptor antagonist and tumor necrosis factor- gene polymorphisms. Am J
Respir Crit Care Med 162:755-758

Wielbo D, Semia C, et al. (1995) Antisense inhibition of hypertension in the
spontaneously hypertensive rat Hypertension 25(3): 314-9

Wielbo D, Simon A, et al. (1996) Inhibition of hypertension by peripheral administration
of antisense oligodeoxynucleotides Hypertension 28(1): 147-151

Witschi H. (1990) Responses of the lung to toxic injury Environ Health Perspect 8525-13

Wright JR, Wager RB, et al. (1987) Surfactant apoprotein Mr = 26,000-36,000 enhances
uptake of liposomes by type 11 cells J Biol Chem 262(6): 2888-2894

Woessner J. (1961) The determination of hydroxyproline in tissue and protein samples
containing small proportions of this imino acid. Arch Biochem Biophys 93: 440-447

Wu G, El-Deiry W, et al. (1998) Potential role for Cathepsin D in p53-dependent tumor
suppression and chemosensitivity. Oncogene 16:2177-2183

Yaekashiwa M, Ohnuma K, et al. (1997) Simultaneous or delayed administration of
hepatocyte growth factor equally represses the ﬁbrotic changes in murine lung injury
induced by bleomycin. A morphologic study Am J Respir Crit Care Med 1562193 7-1944

Yagoda A, Mukherji B, et al. (1972) Bleomycin, an antitumor antibiotic. Clinical
experience in 274 patients Ann Intern Med 77(6): 861-870

Yasuda Y, Yamarnoto K, et al. (1999) Characterization of new ﬂuorogenic substrates for
the rapid and sensitive assay of cathepsin E and cathepsin D. J Biochem 125:1137-1143

Yi ES, Ulich TR, et al. (1998) Keratinocyte growth factor decreases pulmonary edema,
transforming growth factor-beta and platelet-derived growth factor-BB expression, and
alveolar type II cell loss in bleomycin-induced lung injury. Inﬂammation'22z315-325

Yi ES, Ulich TR, et al. (1996) Keratinocyte growth factor ameliorates radiation- and
bleomycin-induced lung injury and mortality. Am J Pathol 149:1963-1970

Yonemaru M, Kusumoto H, et al. (1997) Elevation of antibodies to cytomegalovirus and
other herpes viruses in pulmonary ﬁbrosis Eur Respir J 10:2040-2045

199

Yoshida K, Hara N, et al. (2002) MAP kinase activation and apoptosis in lung tissues
from patients with idiopathic pulmonary ﬁbrosis J Pathol 1982388-396

Yoshiji H, Kuriyama S, et al. (2001) Angiotensin-II type I receptor interaction is a major
regulator for liver ﬁbrosis development in rats. Hepatology 342745—750

Young L and Adamson I. (1993) Epithelial-ﬁbroblast interactions in bleomycin-induced
lung injury and repair Environ Health Perspect 101: 56-61

Zou LX, Hymel A, et al. (1996) Renal accumulation of circulating angiotensin II in
angiotensin II-infused rats Hypertension 27(3 Pt 2): 658-662

Zou LX, Imig JD, et al. (1996) Receptor-mediated intrarenal angiotensin II augmentation
in angiotensin II-infused rats Hypertension 28(4): 669-677

Zisman DA, Martinez FJ, et al. (2000) Cyclophospharnide in the treatment of idiopathic

pulmonary ﬁbrosis: a prospective study in patients who failed to respond to
corticosteroids. Chest 1 17: 1619-1626

200

11131111111111111111111111111