a.” firm

‘ xufl

my?

J .
.3.

 

 

3.1.
A.“
A...
‘ 11.1.:
I: ‘0 '1

I

I}; .1

Lc'. NO!
3 .

. a
imam.»

U
1. n1.
$.35 é
$25.4...
V Ex. Lab“
V‘ .9,

JIII- 5’ J
.1. :b.‘nu...
.715: r

. ..7
. l; .:
9.2.3.3..

:5 - A {Nam . ma. ‘ y , EaJmpzwif “33%?

‘L.
I'

 

 

$1
9398
17/3 ('5‘? 7

LIBRARY
Michigan State
University

This is to certify that the
dissertation entitled

ANALYSIS OF 17p11.2 DELETIONS AND CANDIDATE
GENE CHARACTERIZATION IN SMITH-MAGENIS
SYNDROME

presented by

CHRISTOPHER NICHOLAS VLANGOS

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Genetics

 

 

A

 

V Major Professor's Signature

5/1 1/2005

 

Date

MSU is an Affinnative Action/Equal Opportunity Institution

.- ._.— _—-—.—._.—.—--—---n-o—o—u—o-n-I-.-.-.-o-O-I-o-c-o-o-O-o-o-0-o-n-o-I-o-u-n-3-.-o—o-I—D-a-o-o--o-o-c-o-o--.-.-o-o-o-o-o-

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 cz/cFaCIDateouejnaa-pAs

 

ANALYSIS OF 17p11.2 DELETIONS AND CANDIDATE GENE
CHARACTERIZATION IN SMITH-MAGENIS SYNDROME

By

Christopher Nicholas Vlangos

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Genetics Program

2005

ABSTRACT

ANALYSIS OF 17pll.2 DELETIONS AND CANDIDATE GENE
CHARACTERIZATON IN SMITH-MAGENIS SYNDROME

By
Christopher Nicholas Vlangos

Smith-Magenis syndrome (SMS) is a multiple congenital anomalies and
mental retardation disorder usually associated with an interstitial deletion of
chromosome 17p11.2. The SMS phenotype includes craniofacial/skeletal anomalies,
otolaryngeal abnormalities, and neurological anomalies. The incidence of SMS is
estimated at 1:25,000 births. Unfortunately, the syndrome is not widely known and
under-diagnosis is likely.

In order to identify the genes responsible for SMS, we constructed a physical
and transcription map of the region. Using the small number of markers known to
map to SMS critical region (SMCR), we identified large insert DNA clones mapping
to 17p11.2. We established the location of the known markers within these clones by
Southern analysis and created a genomic contig across the ~1.5 Mb SMCR. The
order and orientation of 29 potential candidate genes was also determined within the
SMCR.

The candidate genes were initially characterized by bioinformatic analysis in
order to determine any known or predicted protein motifs in these sequences. The
developmentally regulated GTP-binding protein 2 (DRGZ) gene was chosen for
further investigation by immunohistochemislry on sectioned mouse embryos where
expression was found localized within the developing nervous system. DRG2 was

localized to the endoplasmic reticulum and the Goligi apparatus with a GFP fusion

product. Drg2 may play a role in embryonic neuronal development by regulating
protein trafficking.

Concurrent to construction of the physical map and gene characterization we
used fluorescent in situ hybridization to characterize the deletion sizes carried by a
cohort of 22 SMS patients in order to decrease the size of the SMS critical region.
Through extensive FISH analysis of these SMS patient samples, we reduced the
smallest region of overlap involving 17p11.2 deletion associated with SMS from 1.5
Mb to ~7OO kb. This refinement reduced the number of candidate genes from >40 to
11.

Within our cohort of 22 patients there was a group of 7 patients in whom a
17p11.2 deletion could not be detected with FISH analysis. We hypothesized that
these patients might carry mutations in gene(s) mapping to the SMCR. Using
systematic direct sequencing of candidate genes, we identified 4 SMS patients with
dominant frame shift mutations in the retinoic acid induced l (RAII) gene.
Haploinsufficiency of the RAII gene is the cause of the physical, neurological, and

behavioral characteristics of Smith-Magenis syndrome.

ACKNOWLEDGEMENTS

The work presented in this dissertation would not have been possible without
the assistance and support from many people. I cannot begin to describe how lucky I
was to perform this work uner the guidance of Dr. Sarah Elsea. Sarah provided an
amazing atmosphere for learning. The dedication and support she provides to her
students in unparralled. The knowledge and skills that I have learned from Sarah are
priceless and will serve me well in the future.

My guidance committee included Dr. Karen Friderici, Dr. Kathy Meek, Dr.
Helga Torriello, Dr. VilmaYuzbasian-Gurkan, and Dr. Michael Grotewiel. Their
assistance and time is greatly appreciated.

My co-workers and friends in the Elsea Laboratory were also key in the
success of this endeavor and include fellow graduate students Rebecca Slager and
Santhosh Girirajan, research technicians Dennis Lettau and Barbara Szomju, and
undergraduate students Tanisha Jain and Suzanne Shunn.

A special thank you goes out to the Genetics Program at MSU, especially to
Jeannine Lee. Without the help of Jeannie no Genetics student would be successful
in their graduate career.

Additionally, I would like to thank those in the Departments of Pediatrics and
Human Genetics at Virginia Commonwealth University. In my brief stay at VCU as
a visiting student they made me feel welcome and treated me as one of their own.

Amazing support also came from my family and friends. Without constant

encouragement fi'om my parents Peter Vlangos and Sue Smith, sister Georgette

iv

Vlangos, and grandparents Nick and Carol Smith I would not have come this far. I
also have to acknowledge Jim and Sue Vogel for feeding me dinner for months
during the more lean times in my graduate career.

It is during the course of my graduate career that my friend Scott Asakevich
introduced me to Jim and Sue’s daughter Michelle Vogel. Michelle is an amazing
and loving woman who provided encouragement and love. As we begin our lives

together as husband and wife I know I can always count on Michelle.

TABLE OF CONTENTS

 

 

 

 

 

 

LIST OF TABLES - . -- ix
LIST OF FIGURES _ -- - -- - - - -_ -- - ...... .1
LIST OF ABBREVIATIONS - -- _ - ..... xii
CHAPTER 1. INTRODUCTION - - - - - - - - - -- 1
The SMS phenotype ....................................................................................................... 2
l7p11.2 deletions associated with SMS ......................................................................... 9
Microdeletion syndromes: from critical region to gene identification ........................ 12
Animal modeling of Smith-Magenis syndrome ............. 16
Summary ...................................................................................................................... 18
CHAPTER 2. PHYSICAL MAPPING OF THE SMITH-MAGENIS
SYNDROME CRITICAL REGION 19
Background .................................................................................................................. 19
The Smith-Magenis syndrome common and critical regions ............................. 20
Rationale ...................................................................................................................... 23
Results .......................................................................................................................... 23
Mapping of new genes and markers using a somatic cell hybrid mapping
panel ........................................................................................................... 23
Construction of the physical map and contig of the SMS critical region ........... 26
Analysis and characterization of ESTs mapped to the SMS critical region ....... 29
Summary of known candidate genes mapping within the SMS critical
region ......................................................................................................... 37
Summary ...................................................................................................................... 42
Materials and methods ................................................................................................. 43
CHAPTER 3. ANALYSIS OF l7p11.2 DELETIONS USING FLUORESCENT
IN SI T U HYBRIDIZATION-_ ....... 48
Background .................................................................................................................. 48
Rationale ...................................................................................................................... 51
Results ......................................................................................................................... 52
Commercially available diagnostic FISH probes for SMS will not detect all
cases. . ........................................................................................................ 56
The SMS common deletion occurs less frequently than reported ...................... 63
Summary ...................................................................................................................... 65

vi

Materials and mehods .................................................................................................. 67

CHAPTER 4. ANALYSIS OF SMITH-MAGENIS SYNDROME PATIENTS

 

 

WITHOUT A FISH DETECTABLE 17P11.2 DELETION ......... 72
Backround and rationale .............................................................................................. 72
Results .......................................................................................................................... 73
Mutation analysis in SMS patients without a FISH detectable deletion ............. 73
The retinoic acid induced l (RAII) gene ............................................................ 84
Summary ...................................................................................................................... 86
Materials and methods ................................................................................................. 87
CHAPTER 5. DEVELOPMENTALLY REGULATED GTP-BINDING
PROTEIN(DRGZ) 94
Background .................................................................................................................. 94
Cloning and identification of mammalian DRG genes ....................................... 95
Rationale ...................................................................................................................... 96
Results .......................................................................................................................... 97
Identification of the STS WI-13499 as DRGZ and mapping to the SMS critical
region. ...................................................................................................... 97
Bioinformatic analysis of DRGZ ......................................................................... 99
Expression levels of DRGZ/DrgZ using northern analysis ............................... 101
Spatial and temporal expression of Drg2 using immunohistochemistry. . .......102
Cellular localiztion of Drg2 .............................................................................. 1 10
Summary .................................................................................................................... 114
Materials and methods ............................................................................................... 115
CHAPTER 6. TARGET OF MYB-l (CHICKEN) LIKE 2 (TOM1L2) ............. 120
Background ................................................................................................................ 120
Rationale .................................................................................................................... 120
Results ........................................................................................................................ 120
Bioinformatic analysis fo TOMILZ .................................................................... 121
Northern analysis of TOMILZ ............................................................................ 122
T am] 12 gene trapped ES cell line ....................................................................... 124
XG909 genotyping and creation of XG909 mice ............................................... 125
Analysis of the F2 generation of Tom112 gene-trapped mice ............................ 126
Summary .................................................................................................................... 130
Materials and methods ............................................................................................... 135
CHAPTER 7. DISCUSSION 136
Future studies in the Elsea Laboratory ....................................................................... 137
TOMILZ/Toml 12 ....................................................................................................... 137
DRG2/Drg2 ................................................................................................................ 140

vii

RAH/Rail ................................................................................................................... 141

 

 

 

Conclusion ................................................................................................................. 145
APENDIXA - - -- - - 147
APPENDIXB 156
APPENDIXC - ......... - - _ _ ..... 157
REFERENCES- - -_ - - 163

 

viii

LIST OF TABLES

Table l. ESTs mapped by Lucas et al., within the 2001 ~l .5 Mb critical
interval identified as known genes ....................................................... 34

Table 2. Novel ESTs mapped by the Elsea Lab within the 2001 ~1.5 Mb
critical interval ..................................................................................... 35

Table 3. ESTs recently mapped by other groups within the 2001 ~l .5 Mb

critical interval ..................................................................................... 36
Table 4. SMS candidate gene disruption in mouse ..................................................... 39
Table 5. Phenotypic comparison of SMS patients with 17p deletions ....................... 61
Table 6. Frequency and type of SMS deletions .......................................................... 66

Table 7. Phenotypic comparison of SMS patients with deletions and
RA]! mutations ..................................................................................... 82

ix

LIST OF FIGURES

Images in this dissertation are presented in color.

Figure 1.
Figure 2.
Figure 3.
Figure 4.
Figure 5.
Figure 6.
Figure 7.
Figure 8.

Figure 9.

Figure 10.
Figure 11.
Figure 12.
Figure 13.
Figure 14.
Figure 15.
Figure 16.
Figure 17.
Figure 18.
Figure 19.

Figure 20.

Chromosome 17p somatic cell hybrid mapping panel ................................ 21
Somatic cell mapping of the RAII gene ...................................................... 25
Screening of the gridded RPll BAC library with D17S740 ....................... 27
Mapping of RA]! to BACs/PACs ................................................................ 28
Contig and transcription map of the SMS critical region ............................ 32
Human RAII northern analysis .................................................................... 33
Examples of deleted and not deleted FISH experiments ............................. 50
Summary of 17p11.2 deletions identified in this study ............................... 55
SMS patients with unusual deletions used to refine the SMCR .................. 58
Location of SMS FISH probes in relation to 17p11.2 deletions ............... 6O
SMSlZ9 RAII mutation analysis ............................................................... 74
SMSlS3 RAII mutation analysis ............................................................... 77
SMS 1 56 RAII mutation analysis ............................................................... 79
SMS 1 59 RA]! mutation analysis ............................................................... 81
Somatic cell mapping of DRGZ ................................................................. 98
Assignment of DRG2 amino acid sequences .......................................... 100
Northern analysis of DRGZ/DrgZ ............................................................ 103
Transfection of Drg2 into COS-7 cells .................................................... 105
Temporal expression of Drg2 during mouse development ..................... 107
Cellular localiztion of Drg2 with GFP .................................................... 113

Figure 21. T 0M1L2 northern analysis ...................................................................... 123
Figure 22. Genetic analysis of the XG909 cell line ................................................... 128

Figure 23. Statistical analysis of XG909 mouse measurements ................................ 132

xi

a.a.:
AGS:
ARF'

ATPAFZ:

aMT6:

ANOVA:

BAC:
BLAST:
CEPH:
CLP:
CL YN2:
del:
DRGZ:
ELN:
ES:
EST:
FISH:
GFP:
FLII:
FZD3:
HBSS:
HGP:
HTGS:
IHC:
kb:

JA GI :
LCR:
LIMKZ:
LLGLI :
Mb:
MR:
NAHR:
NCBL
NHGRI:
NIH:
OMIM:
PCR:
PAC:
PEMT 2:
RA:
RAII :
RASDI :

LIST OF ABBREVIATIONS

amino acid

Alagille syndrome

ADP-ribosylation factor

ATP synthase mitochondria F l comlex assembly factor 2
6-sulphatoxymelatonin

analysis of variance

bacterial artificial chromosome

basic local aligment search tool

Centre d'Etude du Polymorphisme Humain
coactosin like protein

cytoplasmic linker 2

deletion or deleted

developmentally regulated GTP-binding protein
elastin

embryonic stem

expressed sequence tag

fluorescent in situ hybridization

green fluorescent protein

Drosophila flightless I homolog

frizzled 3

Hank’s balanced salt solution

Human Genome Project

high-troughput genome sequencing
immunohistochemistry

kilobase

jagged 1

low-copy repeats

LIM domain kinase 2

lethal giant larvae homolog 1

megabase

mental retardation

nonallelic homologous recombination
National Center for Biotechnology Information
National Human Genome Research Institute
National Institues of Health

Online Mendelian Inheritance in Man
polymerase chain reaction

Pl-artificial chromosome
phosphatidylethanolamine N-methyltransferase
retinoic acid

retinoic acid induced 1

Res, dexamethasome-induced l

xii

RF C2:
REM sleep:
RSTS:
SCN:

SIB:

SMS:
SMCR:

SMS-REPD:
SMS-REPM:

SMS-REPP:
SNP:
SRP:
SSCP:
STX 1A:
SVAS:
TOMILZ:
TRE:
UTR:
VHS:
WS:
YAC:

replication factor c subunit 2
rapid eye movement sleep
Rubinstein-Taybi syndrome
suprachiasmatic nucleus
self-injurious behavior
Smith-Magenis syndrome
Smith-Magenis critical region
distal SMS repetitive element
middle SMS repetitive element
proximal SMS repetitive element
singal nucleotide polymorphism
signal recognition particle from canine pancreas
signal strand conformation polymorphism
syntaxin 1

supravalvular aortic stenosis
Target of myb-l (chicken) like 2
human tumor specific antigen
untranslated region

Vps27p, Hrs and STAM
Williams syndrome

yeast artificial chromosome

xiii

Chapter I

Introduction

Smith-Magenis syndrome (SMS; OMIM#182290) is a multiple congenital
anomalies and mental retardation syndrome usually associated with a de novo
interstitial deletion of chromosome 17p1 1.2 (Smith et a1. 1986; Stratton et al. 1986;
Lockwood et a1. 1988; de Almeida et a1. 1989). The 17p deletions associated with
SMS are difficult to detect using standard cytogenetic Giemsa staining (G-banding)
techniques and are thus termed microdeletions. In addition to SMS, there are many
other microdeletion syndromes including Rubinstein-Taybi syndrome (del 16p13.3),
Miller-Dieker syndrome (del l7p13.3), Alagille syndrome (del 20p11.23),
DiGeorge/velocardiofacial syndrome (del 22q11.2), and Williams syndrome (del
7q11.2). As cytogenetic techniques improved, additional microdeletion disorders
were described. The SMS-associated l7p11.2 deletions usually require high
resolution banding to the 550 or 850 band level in order to be detected with G-
banding. This technology did not become reliably available until the early 19805,
which is likely why the SMS phenotype was not associated with 17p11.2 deletions
until 1982 with the initial description by Ann Smith and Ellen Magenis. With the
advent of fluorescent in situ hybridization (FISH), diagnostic testing for SMS has
become more routine. In just 20 years, the number of known SMS cases now totals in
the thousands worldwide. Unfortunately, the disease is not widely known and under-
diagnosis is likely. Birth incidence of SMS was estimated in one study at 1:25,000

live births (Greenberg et a1. 1991).

The association of SMS with a microdeletion of chromosome 17p11.2 makes
the syndrome an excellent candidate as a contiguous gene disorder. Contiguous gene
syndromes are a group of identifiable disorders caused by chromosomal abnormalities
such as deletions or duplications affecting normal gene dosage (Schmickel 1986).
The genes affected by the deletion or duplication are generally related only by their
proximity to each other along the chromosome and not by their function. The dosage
sensitive genes are thought to contribute independently to the characteristics of the
contiguous gene syndrome; although, it is possible that a change in the gene dosage
of some genes would have no biochemical effect and thus may not contribute to the
overall phenotype. It is also possible that dosage changes in one gene causes the
entire phenotype seen in the microdeletion syndrome, making the disease a single
gene disorder. Additionally, some aspects of the contiguous gene disorder phenotype
may segregate as Mendelian inherited traits (Schmickel 1986). The ultimate goal
when studying contiguous gene disorders is to find the gene or genes responsible for

the characteristics that make up the syndrome phenotype.

The SMS Phenotype

The SMS newborn is usually born at term of normal weight and length;
APGAR scores are generally normal. The baby usually has a facial appearance that is
described as cherubic, caused by mid-face hypoplasia, full checks, 3 tented upper lip,
upward slanting eyes, an upturned nose, and micrognathia. The facial features can be
subtle and are easily overlooked (Allanson et a1. 1999). Infantile hypotonia is usually

present, and the infant may display poor sucking/swallowing and feeding. Failure to

thrive has been noted in some cases (Smith et a1. 1986; Greenberg et al. 1996).
Parents describe the SMS infant as the perfect baby who cries infrequently, has a
smiling disposition, and sleeps well through the night. The infant is usually described
as complacent, lethargic, and generally happy. These features overlap with other
genetic disorders, and SMS children are often misdiagnosed based on phenotypic
characteristics with Down syndrome or Prader-Willi syndrome (Allanson et al. 1999).
Additional congenital anomalies including cleft lip/palate, renal/urinary tract
anomalies, seizures, thyroid abnormalities, and heart defects have been noted in
~25% of patients (Chen et al. 1996; Greenberg et a1. 1996).

During childhood, the SMS phenotype begins to become more apparent.
Though overall length is normal at birth, growth is slow and children are generally
short during childhood. Slower growth results in a shified growth curve, but the
patients usually end up within the normal height range after puberty. Though height
is within normal limits, SMS patients are usually shorter than their genetically
predicted heights. Brachydactyly is almost always present. With age, the facial
features begin to become more distinctive to SMS. The eyes remain up slanting. The
lower jaw becomes more broad and protrusive causing a distinct square looking face
especially during puberty. Mid-face hypoplasia becomes more noticeable, and mild
brachycephaly is common. The brow is usually noted as heavy with the presence of
synophrys adding to the effect (Allanson et al. 1999). Scoliosis can become
problematic during childhood and is reported in over 50% of SMS children over age 4
(Greenberg et al. 1996).

Further pediatric evaluations in SMS patients can reveal additional anomalies.

Opthalmic abnormalities have been thoroughly studied in SMS patients with a variety
of irregularities reported. These include iris abnormalities, microcornia, myopia, and
strabismus occurring in ~50 to 60% of patients (Finucane et a1. 1993; Chen et al.
1996). Blood workup shows hypercholesterolemia in over 50% of patients (Smith et
al. 2002), and decreased immunoglobulins, specifically IgA, in <25% of patients
examined (Greenberg et al. 1996; Cassidy and Allanson 2001).

By childhood, the presence of mental retardation (MR) is apparent and is
usually in the mild to moderate range (IQ 40-54) (Dykens et al. 1997); however, cases
of borderline MR to severe MR have been reported (Greenberg et a1. 1996). Parents
of SMS patients can expect delay of motor and speech developmental milestones.
Signs of peripheral neuropathy including pes planus, pes cavus, depressed deep
tendon reflexes, and insensitivity to pain are seen in >75% of SMS patients
(Greenberg et al. 1996).

SMS patients also display a spectrum of otolaryngeal anomalies. Otitis media
is common leading to placement of ventilation tubes in the ears to alleviate the
frequent infections. Sensorineural or conductive hearing loss are frequent and occur
in ~68% of patients (Greenberg et al. 1996). Almost all patients have a very
characteristic hoarse deep voice. Laryngeal anomalies reported include polyps,
nodules, edema and/or partial vocal cord paralysis (Cassidy and Allanson 2001).
Additional otolaryngologic problems seen in SMS patients include, velopharyngeal
insufficiency, weak bilabial seal, palatal anomalies, limited tongue motion, and
fiequent drooling (Greenberg et al. 1996; Cassidy and Allanson 2001). SMS children

also have an increased incidence of sinusitis, some requiring surgical intervention

(Cassidy and Allanson 2001). Parents also complain that children are sometimes
affected with bouts of constipation (Smith et al. 1998b).

The neurobehavioral hallmarks of SMS discussed below are the most
recognizable characteristic and give parents and professionals the most difficulty in
dealing with SMS patients. Sleep disturbance is common in >75% of SMS patients
(Smith et al. 1998b). Though sleep disturbance is generally not a problem at birth,
alteration of sleep patterns begins around 9 months, and sleep progressively
deteriorates. In an initial sleep study performed in 1996, 50% of SMS participants
(12/24) had a reduced amount of REM sleep (Greenberg et al. 1996). Further study
of sleep in SMS patients has revealed an increased number of awakenings during the
night and early awakening time in the morning leading to an overall decrease in the
amount of total sleep time, daytime sleepiness, and increased number of daytime naps
(Smith et al. 1998b).

One of the main hormonal components of sleep is melatonin. Melatonin
secretion is controlled by the suprachiasmatic nucleus (SCN) of the brain. The SCN
is sometimes referred to as the human biologic clock and is an endogenous keeper of
circadian rhythm. The SCN controls secretion of melatonin by signaling through the
neurotransmitter norepinephrine to the pineal gland. Light/dark cycles have an
impact on the SCN through the retinohypothalarnic tract that connects the retina to
the SCN. Thus, melatonin secretion can be affected by changes in exposure to light
and darkness. Exposure of the photoreceptor cells to light causes their
hyperpolarization, inhibiting both the release of norepinephrine and melatonin

synthesis. When light is reduced, the cells become less polarized and norepinephrine

is released to the pineal gland, which in turn produces and secretes melatonin to the
blood stream (Brzezinski 1997). In humans, melatonin secretion peaks in the middle
of the night somewhere between 2 and 4 am. and is at its lowest around 12 hours
later. Melatonin is quickly metabolized in the liver by hydroxylation and conjugation
with sulfuric or glucuronic acid to 6-sulphatoxymelatonin (aMT6s) which is excreted
in the urine. Levels of aMT6s in mine mirror blood serum levels of melatonin
(Lynch et al. 1975). Thus, measurement of aMT6s in urine is a reliable way to
measure melatonin levels over a period of time without the need for repetitive blood
draws. Two studies have reported the circadian rhythm of melatonin in SMS patients.
These studies have shown an inverted rhythm in 37 of 38 SMS cases studied (Potocki
et al. 2000b; De Leersnyder et al. 2001a). In the SMS individual, melatonin peaks
midday and is at its lowest in the middle of the night. This inverted circadian rhythm
of melatonin may contribute to the nighttime restlessness and early awakening
experienced by SMS patients.

In order to try to reduce the nighttime awakenings and early rising, parents of
SMS patients have tried melatonin supplementation. Improvement in sleep has not
been widely seen with this supplementation. This is likely due to the fact that
increasing the amount of melatonin alone will only boost the total amount in the
system resulting in two peaks rather than reversion of circadian rhythm back to
normal. Two studies were conducted in France in an attempt to correct the sleep
disturbance in SMS patients (De Leersnyder et al. 2001b; De Leersnyder et al. 2003).
In the initial study, 10 SMS children were treated with the selective Bl-adrenergic

antagonist acebutolol in the early morning. With this treatment the patient’s midday

melatonin peak went away and sleep at night improved (De Leersnyder et al. 2001b).
In the follow-up study children were treated with the 61 -adrenergic antagonist in the
morning, and a melatonin dose in the evening (De Leersnyder et al. 2003).
Following this scheme restored the normal circadian rhythm of melatonin. The sleep
in the children involved in the study improved, nighttime awakenings diminished, and
wake time was delayed thus allowing for a longer more restful sleep (De Leersnyder
et al. 2001b; De Leersnyder et al. 2003). Currently, clinical trials using similar
methodologies and further sleep studies to better understand the SMS sleep
disturbance are underway at The Oregon Health and Science University and at The
National Institutes of Health.

Self-injurious (SIB) and maladaptive behaviors are another neurobehavioral
hallmark of SMS patients. In fact, these behaviors are the most recognizable
characteristic that usually causes the physician to suspect SMS. The behaviors
associated with SMS can begin as early as age two and usually begin with head-
banging and wrist biting (Smith et al. 1998a). These behaviors are often sparked
when the child becomes upset or frusterated. Uncontrollable tantrums usually
develop in combination with the head-banging and hand/wrist biting. As the children
age and become stronger, they can become a danger to themselves or others during
periods of tantrum. With age, additional self-injurious behaviors begin to manifest
including onychotillomania (pulling/picking of finger and toenails), and
polyembolokoilomania (insertion of objects into bodily orifices), usually beginning
after age 5 (Greenberg et al. 1996). Skin and nail picking and biting can be persistent

and quite severe causing permanent scaning. Additional stereotypical behaviors

common in SMS patients include the spasmodic upper-body squeeze (known as “self-
hugging”) and “licking and flipping.” The self-hug takes on two forms, one is an
upper body hug, while the other includes clapping together the hands at chin level
followed by the interlocking of the fingers and pushing of the hands together with the
elbows pointed away from the body. These self-hugging behaviors occur usually
when the child is very excited and appear involuntary (Dykens et al. 1997; Smith et
al. 1998a). The licking and flipping behavior involves licking the finger before
turning the pages of a book. The motion is quick and repetitive with little stopping
between pages (Dykens et a1. 1997). Various drugs have been tried to combat the
behaviors associated with SMS including antidepressants, antipsychotics, and
anticonvulsants though none has proven extremely helpful over time and
effectiveness seems to vary between individuals (Smith et al. 1998a).

After puberty and throughout adulthood the self-injurious and maladaptive
behaviors become less prominent. However, SIB can still be an issue during times of
anger. The facial features continue to become more coarse, the chin can become very
prominent, and the brow very heavy. Scoliosis can become more severe with age.
The life expectancy of people with SMS seems to be normal. The oldest known
living SMS patient is over 80 years old. There does not seem to be any increase in
the incidence of cancer in SMS patients. Though the phenotype in infants and
children is well known, less is known about what can be expected in the SMS adult.
Studies of the natural history of SMS are being currently being conducted by Ann
Smith at NHGRI/NII-I in order to refine the characteristics of the phenotype over the

lifetime.

17p11.2 deletions associated with SMS

Association between microduplication and microdeletion syndromes and
flanking repetitive elements termed low-copy repeats (LCRs) is known (Ji et al.
2000). It is estimated that LCRs cover between 5%-10% of the human genome
(Eichler 1998; Ji et a1. 2000). The LCRs can range in size from ~10-400 kb,
averaging between 150-200kb, and having >97% homology (Eichler 1998; Ji et al.
2000; Stankiewicz et al. 2003). Because of the size similarity to BACs and PACs
used in the human genome project and the repetitive nature of the LCRs
(independently occurring in between 2-10 copies), they caused considerable difficulty
in mapping and sequencing of the human genome (Bailey et a1. 2001). LCRs are
different than the highly repetitive repeats, i.e. Alu, SINE/LINE, and satellite repeats,
which are present in numerous copies and were identified based on reassociation
kinetics. LCRs are made up of genes, gene fi'agments, pseudogenes, and retroviral
sequences. Data have shown that nonallelic homologous recombination (NAHR)
between the LCRs causes the segmental anomalies seen in the
microdeletion/microduplication disorders (J i et al. 2000). NAI-IR can occur
interchromosomally or intrachromosomally resulting in deletion, duplication, or
segmental rearrangement depending on the individual characteristics of the LCRs
involved (Stankiewicz and Lupski 2002).

The first physical map of the SMS deletion region constructed in 1997 by
Chen et. al. using yeast artificial chromosomes (Y ACs) identified the LCRs mapping

to the SMS region (Chen et al. 1997). Using a combination of PCR, somatic cell

hybrid mapping, and cosmid mapping, the authors were able to locate three LCRs
mapping within l7p11 which were termed SMS-REPS. Each SMS-REP was
represented by YACs that contained unique flanking sequence solidifying the
hypothesis that there were three unique repetitive regions. The authors termed the
regions SMS-REPP (proximal), SMS-REPM (middle), and SMS-REPD (distal). The
SMS-REPS were determined to be repeated gene clusters of ~200 kb, though it was
not clear whether the genes within the REPS are expressed or are pseudogenes. Three
genes map to all three REP sequences including type-l keratin (KER), signal
recognition particle from canine pancreas (SRP), and the human tumor specific
antigen TRE (T RE). Another gene, coactosin like protein (CLP) only maps to the
proximal and distal REPS, and not the middle REP. Based on Southern analysis, the
authors estimated the size between the proximal and distal REP to be 5 Mb. The
existence of the REP sequences led the authors to investigate whether they could
detect the junction fragment that would remain after recombination events leading to
17p deletions associated with SMS. Using a cDNA representing the CLP gene, the
authors were able to demonstrate an SMS specific junction fragment in 90% of
patient samples studied. The authors hypothesized that NAHR between SMS-REPP
and SMS-REPD facilitates the majority of the deletions seen in SMS, and that 90% of
all SMS patients carry the same deletion that was estimated to cover ~5 Mb (Chen et
al. 1997). The reciprocal of the SMS deletion at 17p11.2 would be a segmental
duplication. The segmental duplication of 17p11.2 was identified in 7 patients with
mild mental retardation and dental anomalies (Potocki et al. 2000a).

Genetic proof of NAHR between the distal and proximal SMS-REPS was

10

provided via genotyping of 24 patient samples harboring 17p11.2
deletions/duplications. The analysis of the 24 cases showed 11 rearrangements
resulting from interchromosomal recombination and 13 from intrachromosomal
recombination indicating no preference for exchange between or within sister
chromatids or homologs (Shaw et al. 2002). Recombination between the proximal
and distal SMS-REPS causes the majority of SMS deletions, but these are not the only
17p11.2 deletions associated with SMS. Deletions overlapping the SMS common
interval have been reported (Juyal et al. 1996; Trask et a1. 1996; Elsea et al. 1997).
These unusual sized deletions can be larger or smaller than the common deletion, and
are currently reported to occur in ~25% of patients, and are mediated by NAHR
between the distal and middle SMS-REPS and/or other newly discovered low copy
repeats in the region (Stankiewicz et al. 2003; Vlangos et al. 2003).

Unusual deletions provide an invaluable resource for the study of
microdeletion disorders. Overlapping deletions fi'om patients who retain all aspects
of the syndrome phenotype delineate the critical region of the disorder. The gene(s)
causing the disease phenotype are most likely to map within the disease critical
region. The SMS critical region (SMCR) was first described in 1997 (Elsea et al.
1997). The SMCR was represented by an unusual deletion harbored by a single
patient. This patient’s deletion was located between the distal and middle SMS-REPS
and spanned ~1.5 Mb. Haploinsufficiency of a gene, or genes, mapping within this
1.5 Mb deletion was hypothesized to be the cause of the Smith-Magenis syndrome

phenotype.

11

Microdeletion syndromes: from critical region to gene identification

Determining the role that any of the positional candidate genes within the
nricrodeletion syndrome critical region play in producing the characteristics of the
disease phenotype is a complicated process. Multiple approaches are usually
employed simultaneously in order to successfully determine the role the candidate
genes may play in disease etiology. The techniques employed in this research have
been successfully used to determine disease etiology in other microdeletion
syndromes including Williams syndrome (WS; del 7q11.2; OMIM#194050) and
Alagille syndrome (AGS; del 20p12; OMIM#118450).

Williams syndrome is an autosomal dominant disorder associated with
deletion of chromosome 7q11.23. Most deletions occur de novo, though incidences
of parental transmission have been reported. Patients with Williams syndrome have a
distinct facial appearance including a wide mouth, flat nasal bridge, small mandible,
and prominent cheeks (Morris et al. 1988). Puberty is often precocious, and there can
be a loss of subcutaneous tissue giving rise to a look of premature aging (Donnai and
Karmiloff-Smith 2000).

Cardiac anomalies in the fornr of supravalvular aortic stenosis (SVAS) and
peripheral pulmonary artery stenosis are common to WS patients and occur in >80%
of patients (Osborne 1999). Stenosis of other peripheral vessels including the
subclavian, corornary, carotid, mesenteric, and renal have also been reported.

The behavioral/cognitive profile of WS patients is a striking array of
extremes. WS patients are usually affected with moderate to severe mental

retardation; average IQ ranges between 51 and 70 (wain and Yule 1991). Though

12

MR is present WS patients do not have problems with language or face and emotional
processing. This is in stark contrast to the extreme problems with visouspatial
cognition (Donnai and Karmiloff-Smith 2000). An amazing propensity for music is
displayed, but hypercusis is present and patients are often startled and display
extreme anxiety in the presence of loud noise. Anxiety is also present when the WS
patient is placed in a new situation. However, their personality is extremely friendly
and social, and fear of strangers is not present (Osborne 1999).

The deletion associated with WS is mediated by recombination between LCR
sequences as is seen in SMS (Urban et al. 1996). The WS deletion interval was
defined in 1998 by assessing 200 WS patients using FISH. The interval spans ~1.5
Mb of DNA. In order to facilitate mapping of candidate genes a complete BAC/PAC
physical map was constructed across the region (Meng et al. 1998).

When the physical map of the WS region was constructed the etiology of one
aspect of the phenotype was already known. Isolated SVAS, an autosomal dominant
trait, was found to map to the same chromosomal region by linkage analysis and by
discovery of a translocation involving chromosome 7q co-segregating in a family
with SVAS (Curran et a1. 1993; Ewart et al. 1993). It was determined that the
translocation breakpoints in these patients disrupted the elastin gene (ELN).
Investigation of Williams syndrome patients determined that >98% were hemizygous
for ELN (Lowery et al. 1995). In evaluation of DNA samples from patients with
isolated SVAS nonsense and splice site mutations were found within the elastin gene
(Li et al. 1997a; Tassabehji et a1. 1997). Haploinsufficiency of ELN in humans

causes the hardening of the vessels seen in SVAS and WS.

13

Elastin is produced in smooth muscles and eventually is formed into
concentric rings of elastic lamellae alternating with rings of smooth muscle (Uin et
al. 1991). Haploinsufficiency of ELN accounts for the SVAS seen in WS, but not the
other characteristics of the syndrome. Thus, Williams syndrome is a true contiguous
gene syndrome where other genes in the critical region are responsible for other
aspects of the phenotype. Additional genes mapping to the region include LIM
domain kinase-2 (LIMKZ) and cytoplasmic linker 2 (CL 1W2) thought to be
responsible for the impaired visuospatial cognition and the neurologic alterations
respectively. Replication factor c subunit 2 (RFCZ) is also a positional candidate for
WS (Osborne 1999). Additional genes that were thought to be excellent candidate
genes included syntaxin 1 (STXIA) and fiizzled (FZD3). Study of two classic WS
patients with unusual deletions showed that these genes are not included in the WS
critical region as these patients are not deleted for these genes (Botta et a1. 1999). To
date, haploinsufficiency of the elastin gene is the only known cause for characteristics
seen in Williams syndrome. The search for additional causative genes in WS
continues through attempts to further narrow the critical region and characterization
of the positional candidate genes mapping to the region.

Alagille syndrome (AGS) is an autosomal dominant disorder with variable
expression that can be associated with a deletion of chromosome 20p12. Phenotypic
diagnosis of AGS is given upon confirmation of paucity of the interlobular bile ducts
upon liver biopsy, and at least three of the five major clinical features described by
Alagille in 1975 including chronic cholestasis, cardiac disease, skeletal anomalies,

ocular anomalies, and characteristic facial features (Alagille et al. 1975; Krantz et al.

14

1999). Hepatic, cardiac, and opthalrnologic manifestations are the most common
features seen in AGS. Most patients are of normal intelligence, though mild delay,
delay of gross motor skills, and mild MR have been associated with the disease.
Additional anomalies associated with the syndrome include delayed puberty, hearing
loss, renal defect, and pancreatic insufficiency (Alagille et al. 1975; Li et al. 1997b;
Oda et al. 1997b; Krantz et al. 1999).

From the initial description of the disease it was clear that AGS was an
autosomal dominant disorder with variable expressivity based on familial inheritance
of the disease (Alagille et al. 1975). In fact, clinical manifestations in AGS are highly
variable between individuals, ranging from subclirrical to life threatening. Birth
incidence is reported between 1:70,000 to 1:100,000 births (Oda et al. 1997b; Krantz
et al. 1999). Cytogenetic analysis of most AGS patients reveal a normal karyotype,
though a small subset (~7%), have interstitial deletions or rearrangement of
chromosome 20p12. Patients who harbor large cytogenetically visible deletions of
chromosome 20p are usually more affected with the spectrum of phenotypic
characteristics. Thus, AGS was an excellent candidate as a contiguous gene
syndrome.

The AGS critical region was delineated using overlapping 20p deletions, and
was estimated to span between 8 and 11.3 cM based on CEPH mapping and linkage
analysis in AGS patients without a 20p deletion (Hol et a1. 1995; Pollet et al. 1995).
In the mid 19908 the number of mapped genes and available genetic markers were
small. A physical map of a continuous path of YAC clones was constructed spanning

3.7 Mb of 20p12 including the AGS critical region in order to facilitate mapping of

15

new markers and identification of possible candidate genes via elucidation of CpG
islands (Pollet et al. 1995). This first physical map containing 15 new anonymous
markers was an excellent start toward identification of AGS candidate genes. Further
analysis of AGS patients with 20p deletions narrowed the critical region to ~250 kb.
A contig of the refined region was created using BAC clones which are less
susceptible to recombination than the more unstable YAC clones. At the time only
one gene mapped wholly within this refined AGS critical region, human Jagged]
(JAGI), a gene orthologous to the rat Jagged gene which is involved in the notch
signaling pathway (Oda et al. 1997b).

The JA GI gene encodes a ligand for the Notch receptor. The notch receptor
through association with its ligands creates a signaling pathway used in directing cell
fate (Luo et a1. 1997; Oda et al. 1997a). Because of its possible function and map
location JA GI was an excellent candidate gene for AGS. Analysis of DNA samples
from patients without a deletion of chromosome 20p was performed via SSCP and
direct sequencing of PCR amplicons of the JAGI gene. Two separate groups
identified 11 mutations in the JAGI gene segregating in affected AGS patients (Li et
al. 1997b; Oda et al. 1997b). Haploinsufficiency of the JAG] gene via hemizygous
deletion or mutation is the cause of Alagille syndrome. In contrast to the theory of
the contiguous gene syndrome hemizygous deletion of other genes flanking the JA GI

gene does not seem to affect the syndrome phenotype.

Animal modeling of Smith-Magenis syndrome

The mouse is an excellent organism for use in animal modeling of human

16

disease due to the similarity of physiology, anatomy, and genetics. Mice are also
relatively inexpensive to house and propagate. The techniques for manipulating the
mouse genome have become readily available and are performed routinely. In
addition, the completion of sequencing of the mouse and human genomes facilitates
comparative analysis aiding experimental design. Genetic mutation of the mouse can
include inactivation of an individual gene, or manipulation of entire segments of
DNA via chromosomal engineering.

In the mouse chromosome 11 is syntenic to human chromosome 17.
Comparative analysis of the SMS critical region between mice and humans shows
that order and orientation of 19 genes are conserved (Bi et al. 2002). Chromosomal
engineering was undertaken in order to examine the phenotypic effect of deleting the
SMS common region in mouse (Walz et al. 2003). Mice lacking a 3 Mb segment of
chromosome 11 syntenic to the SMS common region were created and termed
Df(11)17 animals. Heterozygous animals displayed craniofacial anomalies, EEG
abnormalities, weight differences, and decreased fertility when compared to normal
litterrnates in a mixed genetic background. Gross organ abnormalities in the heart,
urinary tract, and eyes were not noted (Walz et a1. 2003). Behaviorally, the male
Df(1 I )1 7 mice were reported to by hypoactive, while the female heterozygotes had
normal locomotor activity. Both male and female heterozygotes showed shorter
circadian periods when placed in constant darkness after light entraining (Walz et al.
2004). This response indicates a reduced precision in the circadian clock.
Heterozygous mice had no self-injurious behaviors, decreased sensation to pain, or

startle responses (Walz et al. 2004). These results indicate that a dosage sensitive

l7

gene(s) maps within the chromosomal engineered region. Targeting of individual
genes in the region will hopefirlly aid in understanding the genotype:phenotype

correlation in humans.

SUMMARY

The goal of the research project presented here was to determine the
gene(s) responsible for Smith-Magenis syndrome. The work explained in the
following chapters follows the methods employed in elucidating the etiology of
Alagille and Williams syndromes, as well as other rrricrodeletion disorders. Chapter 2
focuses on work performed in creation of a physical and transcriptional map of the
SMS critical region. Chapter 3 describes narrowing of the SMS critical region using
FISH, as well as determination of a more efficient diagnostic SMS probe. Chapter 4
illustrates direct sequencing efforts of candidate genes in SMS patients where
deletion of chromosome l7p11.2 could not be detected. This research led to the
identification of mutations in the RAII gene which is likely responsible for the
majority of SMS characteristics. Chapters 5 and 6 focus on characterization of two
positional candidate genes, DRG2 and T OMILZ respectively, which may play a role
in the less penetrant SMS characteristics. Chapter 7 concludes the dissertation by
discussing how the work presented could be incorporated into future research projects

studying Smith-Magenis syndrome.

18

Chapter II

Physical mapping of the Smith-Magenis syndrome critical region

BACKGROUND

The goal of the research projects in the Elsea Lab is to identify the dosage
sensitive gene(s) mapping to chromosome 17p11.2 responsible for the characteristics
making up the SMS phenotype. Prior to my joining the project, much work had been
performed toward this goal. The SMS critical region (SMCR) had been defined, a
somatic cell hybrid mapping panel had been created, and many markers had been
mapped to the short arm of chromosome 17 by the lab. Using the markers previously
mapped, we embarked on construction of a continuous path of large insert clones (a
“contig”) across the SMS critical region. The creation of the contig also allowed for
mapping of additional markers, genes, and ESTs to the SMS critical region. The final
contig includes the order and orientation of the genes, ESTs, and markers mapped to
the critical region. We initially characterized all the genes and ESTs mapping to the
region using various bioinformatic methods and northern analysis. The genes were
prioritized for further study based on initial characterization as candidate genes for
SMS. Our lab published this work in the European Journal of Human Genetics

(Lucas et al. 2001).

19

The Smith-Magenis syndrome common and critical regions

As discussed in Chapter I, the deletions associated with SMS can range in size
fi'om <2 Mb to >9 Mb (Trask et al. 1996), although it has been reported that >95% of
SMS patients carry a common ~3.5 Mb deletion (Chen et al. 1997). Though there are
a spectrum of deletions associated with SMS, the phenotype remains consistent in
most patients. The dosage-sensitive genes responsible for the syndrome phenotype
are theorized to map to the smallest shared region of deletion in patients displaying
the full syndrome phenotype. This region is referred to as the critical region. The
SMS common deletion and the critical region were delineated in 1996 by studying the
deletions carried by 62 SMS patients (Juyal et al. 1996).

At the start of this project, the SMS critical region was defined by the deletion
carried by a single patient, HOU142-540 (Figure 1) (Elsea et al. 1997). This patient
carries an unusual deletion spanning ~1.5 Mb of DNA roughly between the distal and
middle SMS-REPS. Molecularly, the region is bounded by the genomic marker
D17SZ9 proxirnally and an anonymous cosmid cCIl7-638 (Figure 1) (Juyal et al.
1996; Elsea et al. 1997). The deletion size was delineated by FISH using cosmid
probes for the small number of known markers mapping to the region (Juyal et al.
1996; Elsea et al. 1997). At the beginning of this project, 7 genes, 13 different ESTs,
and 7 markers had been mapped within the SMS critical region (Elsea et al. 1997).

At the same time that the SMS critical region was delineated, the common
region boundaries were also identified. The common interval was shown to map

between genomic marker D17SS8 proxirnally and the anonymous cosmid cCIl7-498

20

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

egaééfi-a
ififiEfiefls
N 14
'2: II“. 13
S
12
| 11
01‘ all 10
:1 .. 9
a. 3
S {I 7
a. | 6
i E
' A.
ET :3 ||‘-‘ 5
"l I 4
7,—— 111—
s a I I I
"‘ IIMII 2
'1. ‘1] W:
3 l l 1
E‘
v-' Bin

 

Figure l. Chromsome 17p somatic cell hybrid mapping panel.

Rodent-human somatic cell hybrids retaining a deleted chromosome 17 are illustrated
at the right. The breakpoints of the naturally occurring deletions divide the region
into bins. Genes and markers mapping to bins were used as anchors in the
construction of the critical interval contig. The common deletion seen in SMS is
indicated in orange and spans ~3.5 Mb and bins 4-10. The SMS critical interval
indicated in red spans ~l.5 Mb and bins 6-8. The approximate location of the SMS-
REPs are indicated in blue.

21

This region encompasses ~3.5 Mb of DNA roughly between the proximal and distal
SMS-REPS (Figure 1) (Juyal et al. 1996; Elsea et al. 1997). In molecularly defining
the SMS critical region, markers were also mapped to common SMS region along
chromosome 17p. The authors mapped 85 additional markers to chromosome 17p
surrounding the SMS critical region (Elsea et a1. 1997).

Mapping of the markers was facilitated by the creation of a somatic cell
hybrid mapping panel of overlapping 17p deletions (Figure 1) (Guzzetta et al. 1992;
Patel et al. 1992; Elsea et a1. 1997). The rodentzhuman hybrid cells were grown and
maintained to harbor the human chromosome 17 of interest (Guzzetta et al. 1992).
The boundaries of the overlapping deletions were used to divide the p-arm of
chromosome 17 into 14 bins. The SMS critical interval contained bins six, seven, and
eight as delineated by the unusual deletions canied by HOU142-540, and patients
with deletions overlapping the SMS critical region carried by HOU261-765 and
HOU92-357 (Figure 1) (Elsea et al. 1997). The SMS common deletion was reported
to span bins 3 and 10/11 as delineated by numerous patients with overlapping 17p
deletions (Figure 1) (Elsea et al. 1997).

A preliminary physical map of the region created using YAC clones was
reported in 1997 along with the data showing the presence of the SMS-REPS (Chen
et al. 1997). The map and contig reported contained many gaps, and only some of the
markers were in the correct order. The orientation of some of the map was inverted
based on data reported in the delineation of the critical region. The problems with
this initial map likely stem from the lack of markers in the region, and the fact that

YAC clones are very prone to recombination during propagation.

22

RATIONALE

We undertook construction of a physical map and contig of the 1.5 Mb critical
interval using BAC, PAC, and cosmid clones. These clones are more stable than the
YAC clones used in previous physical maps (Chen et al. 1997). In construction of the
physical map, new markers, ESTs, and genes were mapped to the SMS region. Initial
characterization of the genes using bioinforrnatics and northern expression analysis
was performed in order to prioritize the candidate genes for further study to determine

the role, if any, they play in the SMS phenotype.

RESULTS
Mapping of new genes and markers using a somatic cell hybrid mapping panel
DNA isolated fi'om the rodentzhuman hybrid cells making up the mapping
panel was used in PCR reactions and Southern analysis to fine map newly obtained
markers. The panel includes hybrids retaining a deleted human chromosome 17 from
SMS patients and non-SMS patients harboring different sized 17p deletions. The
following control cell lines were used for mapping along human chromosome 17;
MHZZ-6 retains one entire normal human chromosome 17; LS-l carries an iso-q 17
chromosome, and 88H5 carries a fused chromosome of l7p:Xq. In order to exclude
positive products resulting fiom the endogenous rodent DNA in the cell lines rodent
parental lines a23 and Cl-lD were used.
As the study of the human genome progressed, new markers and ESTs were

reported, and their sequences were submitted to public databases at The National

23

Center for Biotechnology Information (NCBI; http://www.ncbi.n1m.nih.gov)
including dbEST, dbSTS, and GenBank, as well as to The GDB Human Genome
Database (http://www.gdb.org). Members of the laboratory regularly searched the
databases to identify newly deposited information. The reagents necessary for fine
mapping the markers to the SMS critical interval were obtained or created as
described below.

To map newly identified genomic markers to the region, specific
oligonucleotide primer pairs were obtained for use in PCR using template DNA
isolated from the rodentzhuman somatic cell hybrids. PCR reactions were performed,
and products were analyzed for presence or absence of the expected banding pattern
based on a positive human control sample. Once markers mapped within the SMS
region, they could be used for screening of gridded clone libraries as described below.

Newly identified EST sequences were obtained as clones through The
Integrated Molecular Analysis of Genomes and their Expression (I.M.A.G.E.)
consortirun (http://image.llnl.gov) or other international EST consortiurns located in
Germany and Japan. Plasmid DNA was isolated and sequenced to ensure the correct
clone was sent. The clone DNA was used as probe in Southern analysis to filters
created through EcoRl digestion of the hybrid DNAs and controls. Banding patterns
were analyzed to determine map location of the ESTs (Figure 2). Cloned EST DNA

was also used in initial characterization of the ESTs as described below.

24

 

. .éeéee ..
NairLé-tbli 03
gaazs§a§~§=
=>.>.>~ mhg¢°
Emmiiiii =2
>20kb—> pm- 1: .1

Figure 2. Somatic cell mapping of the RA]! gene.

Fine mapping of RA]! within the SMS critical interval was performed by hybridizing
the ~2.0 kb insert fiom EST DKFZp434A139Q2 to a panel of EcoRI digested somatic
cell hybrids. The hybrids carry deleted chromosome 17 from SMS patients
(Hy14720-D, Hy540-1D, and Hy484—2D), and non SMS patients with overlapping
deletions along 17p (Hy765-1D and Hy357-2D). Proper positive and negative
controls are described in the text (M822-6, Hy88H5, LS-l, a23, and Cl-lD). A >20
kb band representing the RA]! gene is evident in total human DNA, MI-122-6, and
Hy88H5 (present but faint because of limited exposure time), demonstrating that
RA]! is deleted in all SMS patients and maps to the central portion of the SMS critical
region.

25

Construction of the physical map and contig of the SMS critical region

Construction of a continuous path of large insert clones across the critical
region was started while the Human Genome Project (HGP) was in its infancy.
Sequence data was slow to appear within the SMS critical interval, and sequence data
that did appear contained large gaps. Additionally, the markers identified by the HGP
that matched those that we had previously fine-mapped to the region usually were in a
different order than our data showed. These problems were likely caused by incorrect
construction of the sequence fiagments produced by shotgun sequencing due to the
highly repetitive nature of the DNA in the region.

In order to find large insert clones mapping to the region, we repeatedly
screened the RPll BAC library using the markers and ESTs mapping to the SMS
critical region. PCR amplified marker, isolated EST DNA, or isolated cosmid DNA
was used as probe and hybridized to the gridded arrays using standard Southern
protocol. Positive clones are identified by specific spotting patterns displayed on the
grid and decoded using a key provided by the library creators (Figure 3).

Positive BACs were obtained and DNA was isolated using a modified Qiagen
protocol designed in the lab. An initial contig was created using a combination of
Ala-PCR and analysis of the EcoRI restriction patterns of the BACs. In order to
determine the marker order on the individual BACs, Southern analysis was performed
using the collection of markers mapped to the region as probes on EcoRI digested

BAC DNA (Figure 4). Using these methods we were able to construct three contigs

26

 

Figure 3. Screening of the gridded RPll BAC library with D17S740.

The gridded RPCI-ll BAC library was screened using ESTs and genomic markers
with lcnown map positions inside the SMS critical region. Clones are spotted in
duplicate within a 4 x 4 grid on the array. An example of the gridding pattern of the
library is indicated in the upper left. Standard Southern technique with radio-labeled
DNA probes was used in the screening. In the example above, the library was
screened with the genomic marker D17S740. Positive clones are noted with black
arrows. Positive clones were ordered and verified for map position by EcoRI
Southern analysis.

27

.2
E
2 u
0 NO '-
A) '_ °" N—nfag Noe: B) E
o I: Guts—mhlnuam r:
g u mam—mmvnvu o n" N "‘
a 2 ages: m. - .. a—e “an
5 u 903 £32 0 r: "' I~
2 = Susan. 39. f 6I 353:3:32
a E oceanic—welt)?
= 000%0%0
- E 1 can._a_r:.o

'j, g bc189D22
‘. pc178F10

 

Figure 4. Mapping of RAII to BACs/PACs.

A) Eight micrograms of DNA from BACs and PACs mapping within the SMS
critical region and human genomic DNA (10 pg) were digested and then
electrophoresed overnight in circulating buffer. The gel was photographed and DNA
was transferred to nylon membranes using standard Southern technique. B) An
autoradiograph of the Southern blot is shown. The insert from plasmid
DKFZp434A139Q2 represents the 3’ end of the RAII gene and was used as a probe.
The blue arrows indicate pc253P07 and a faint corresponding band in the digested
human DNA lane.

28

>1) lb

within the critical region, but were unable to fill the gaps with the BAC resources
available at the time. As our project continued, the speed of data conring from the
HGP began to increase. We were able to fill gaps in our contig using sequence data
from the high-throughput genomic sequences (HTGS) being deposited into the public
databases. We searched the HTGS databases using BLAST analysis with known
marker and EST sequences which we had already mapped. Using this approach we
were able to electronically identify numerous RPCI BACs/PACs and CIT BACs
mapping to the SMS critical region. We obtained the positive BACs and PACs and
confirmed the results obtained in silica using Southen analysis on EcaRI digested
DNA and PCR analysis.

Additional alignments and conti g organization were performed using the
UCSC Genome Browser (http://genome.ucsc.edu) and Ensembl
(http://www.ensebl.org). Using these methods, we were able to construct a fluid path
of clones with a minimum tiling path of 16 BACs and 2 PACs (Figure 5) (Lucas et al.
2001). In this map several overlapping clones were included to provide greater
coverage (Figure 5).

Transcriptional orientation of the genes in the region was determined using
the data from the HGP, sequencing of cosmids, and known overlap of genes, such as
the 3' ends of the FLII and LLGLI genes (Campbell et al. 1997). Cosmid genomic
clone DNA was isolated fi‘om previously mapped cosrnids (J uyal et al. 1996; Elsea et
al. 1997) as well as from screening of gridded filters of the Los Alarnos flow sorted
chromosome 17-specific cosmid library (Kallioniemi et al. 1994). At the time of

publication, we were able to determine transcriptional orientation of 18 of the

29

expressed sequences mapping to the critical region (Lucas et al. 2001). The contig as
published in 2001 (Lucas et al. 2001) contained 17 known genes, 12 ESTs, and 6
genomic markers (Figure 5).
Analysis and characterization ESTs mapped to the SMS critical region

Through the creation of the physical map of the SMS critical region we were
able to identify numerous expressed sequences mapping to the region. These
sequences were not only important in creation of the map, but because of their map
location likely represented positional candidate genes for SMS. Clones for 13 of the
ESTs were commercially obtained and plasmid DNA was isolated. The plasmid
DNA was sequenced and database analysis of the DNA sequence was performed
against online databases. Further, the DNA sequences of the ESTs were translated in
all 6 flames and the amino acid sequences were examined to look for homologous
genes and/or sequence motifs. Tissue expression patterns were then explored by
probing commercially available multiple tissue northem (MTN) blots of adult and
fetal tissues with the ESTs obtained. Northern analysis of EST DKFZp434A139Q2 is
shown in Figure 6. The clone represents the 3' end of the human retinoic acid
induced l (RAII) gene. The analysis shows an ~8.0 kb transcript in all tissues
examined. Examination of all ESTs was performed as discussed above. Summary of
the genes mapping within the SMS critical region as defined by the deletion carried
by HOUl42-540 are described in Tables 2-4. Table 1 shows seven ESTs reported to

map to the SMCR by our lab in 2001 (Lucas et al. 2001); those indicated in gray no

30

Figure 5. Transcription map of the ~1.5 MB SMS critical interval (adapted from
Lucas at al., 2001).

The SMS critical interval as of 2001 (Juyal et al., and Elsea et al., 1997) spanned
between the two vertical hatch marks. This distance is roughly between the proximal
and middle SMS-REPS. The contig is comprised of overlapping BAC and PAC
clones which span the distance from the genomic marker D17S40 to the proximal end
of the distal SMS-REP. Markers, ESTs, and known genes were mapped to the contig
though a combination of PCR mapping, Southern hybridization to digested BAC and
PAC DNA, and database analysis of draft human genome sequence. Overlap of some
BAC/PAC sequence confirmed the position of clones in the absence of available
markers. Refinement of the SMS critical region has been performed and will be
discussed firrther in Chapter 3. Genes shown in blue no longer map within the SMS
critical region.

31

.1

 

  

   
 

32

 

g
98-x“: o M 3 lo manage
2 C m o
J n is. m. m 1
M / / _IV h l . B
can?» ”Q su no Emmy .vnw 1w3nsro M
7025213 02 3 O 4 J 10_V23 5 14F
8 7 83MPLF1 962A2321R3 3:3 Y2P1PR7 S 7 8
WWI 8 PMlBl osm1 2TD61MSC1 6211I4SR 166
on” RST BWTKMEH 67 FWJMSOMSPaCDOJRJDmO7FPTPP
Um 7 ADOR MlME LEMO TOLGHOL.L OlNLmSR H
l _w»» mmlhumm lmslwwww»...mmmnmmmwmmmmfmmime «h
4 _ 111... 1111111 11...1:.WHH1...H.111111111111121 11.1 111 I
285ng 0.0:.
Unmmwzfi 1|.
UnwAOHo.I.I.I°
coquoil
U0www§wD OD}
OqumuH
e $835.»;
63523» i
035% a 3.33qu
e333;
OOHHHEO 1+:
eowmszuo Toto-Or
confine};
enmmmpirflrbl
enumHHSrOrOrO
uowwommwlllbl
538:3;
.0359}
O - won—Sena 33me I -EHOm UnsoHanOIUITnTIII
- 1. no: I - 1 Name: 0
e w 5838.99
D -29 cue—vane I -Eamroa monsoon." UnwanMWM-Ou
U0 3...:
O - wow . Unwummfig
aano canon no" 8:98am an» mzm N;
1 523311.
. . . nu
- Canaan 32.on ”Hgmonuncefi Unwmmqul
I -5595 mono noose: entwmeITsaq _
608.25 - E

 

 

 

I

 

 

 

 

 

 

 

2
g m
‘3’ 3 ci
3 “a” 5 E s a
.3 :I .2 J - a
kb 9.. A A a: :2 a.
9.5—1.1‘F
2.4 I
1.35——

 

 

 

 

B-Actin

B)

Brain
Lung
Liver
Kidney

 

 

 

 

 

 

 

l.35-—*

 

B-Actin

Figure 6. Human RAII northern analysis.

The ~2.0 kb insert from EST DKFZp434A139Q2 represents the 3' end of the RA]!
gene. The insert was hybridized to A) adult and B) fetal multiple tissue northern blots
from Clontech. An ~8.0 kb transcript is evident in all adult and fetal tissues. B-actin
is included as an mRNA loading control for both blots.

33

Table l. ESTs mapped by Lucas et al. within the 2001 ~1.5 Mb critical interval
which have been identified as known genes.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

EST amplimer(s) Unigene Tissue expression Protein motifs Known gene
(GenBank accession)
WI~13499 Hs.78582 2.2 kb transcript in all GTP-binding DRGZ
(GenBank R41366) adult and fetal protein motif (GenBank
tissues' X80754)
D1782021 Hs.13434 1.8 kb transcript in all Mitochondrial ATPAFZ
(GenBank AA281720) adult and fetal leader (GenBank
tissues; highest in sequence AF052185)
heart
A003A44 Hs.8125 6.5 kb transcript in all VHS and GAT TOM1L2
(GenBank AA236905) Hs.12537 adult tissues, highest domains (GenBank
stSG9692 in heart, brain, sk. NM_144678)
(GenBank AF038192) muscle
DKFZp434A139Q2 Hs.278684 8.0 kb transcript in all CAG repeat, RAII
(GenBank AL133649) adult tissues nuclear (GenBank
localization AY172 136)
signal, PHD
zinc finger
domain
'NlB1041 Hs. 106359 5 lib transcript in all Member of RASDI
(GenBank T16275) adult tissuesc Ras subfamily (GenBank ,
NM 016084) :
WI-l 1472 Hs. 16614 1.6 kb transcript in Hydrolase NT5M
(GenBank R72633) adult heart, brain, and domain (GenBank
skeletal muscle” NM 020201) -
stSGZ6124 Hs.84883 6.0 kb transcript in all KOG4807: M—RIP (interim '1
(GenBank AI570799) adult and fetal tissues domain from gene symbol)
F -actin (GenBank
binding NM_OlS 134)
protein

 

 

Note: Genes have been ordered proximal to distal and shading indicates gene is
located outside of the current SMS critical interval (V langos et al., 2003). Protein
motifs identified from NCBI conserved domain database and NCBI protein-protein
BLAST alignments. “Results reported in Vlangos et al., 2000; orthem results
similar to those reported in Rarnpazzo et al., 2000; cNorthern results similar to those
reported in Tu and Wu, 1999.

34

Table 2. Novel ESTs mapped by the Elsea lab within the 2001 ~1.5 Mb critical

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

interval.
EST Amplimer Unigene Tissue expression Protein motifs
(GenBank Accession) _
T78887 Hs. 187422 Clontech MTE blot showed 378 bp LINE] repeat
(GenBank AA730163) expression in heart, GI tract,
germ cell, lung, kidney,
lacenta
stSG8339 Clontech MTE blot 93 bp MIR repeat
(GenBank H57290) showed faint expression in
heart, GI tract, brain, lung,
placenta, germ cell
FL20308 Hs.356770 3.5 and 4.0 kb transcript in KOG4176:
(GenBank BCO62339) all adult and fetal tissues uncharacterized
examined conserved domain
MGC3048 Hs.115437 4.4 kb and 4.0 transcript in KOG4635: domain
(GenBank BC000636) adult heart, sk. muscle, found in vacuolar import
kidney, pancreas and fetal and degradation proteins
liver and lung; 4.0 kb
transcript in adult and fetal
brain, lung and placenta
DKFZp586M1120 Hs.159068 Unigene reports 5.8 kb 43% similarity (140 aa
(GenBank AL136926) transcript and ESTs from alignment) to sd322
several adult tissues protein homolog
(GenProt $68209)
FLJ23022 Hs.287717 Unigene reports SAGE tags none
(GenBank from several adult tissues
NM 025051)
A006Y21 Hs.31652 Unigene reports ESTs from 322 bp Alu repeat;
(GenBank H50830) several adult tissues 85.7% alignment to
phospholipase D active
site motif
FLJ22382 Hs.46783 ESTs from several adult none
; (GenBank AK026035) tissues
FLJ11532 Hs.296656 ESTs from brain and 78 bp Alu repeat
' (GenBank AK021594) embryo
A004R11 Hs. 16899 2.4 kb transcript in adult and none
. (GenBank T91728) fetal liver
‘ A006R41/FLJ10193 Hs.235195 6.0 kb transcript in adult Moderately similar to
(GenBank A1500641) skeletal muscle and fetal Drosophila protein
brain RH42446p (GenProt
AAN71576)
MGC13008 Hs.326732 ESTs from none
(GenBank rhabdomyosarcoma
NM 032686)

 

 

 

 

 

 

Note: Genes have been ordered proximal to distal and shading indicates that this
gene is localized outside of the current SMS critical interval (V langos et al. 2003). It
remains a possibility that some of these unique ESTs can contains genomic
contamination or may be cloning artifacts. Protein motifs were identified from NCBI
conserved domain database and NCBI protein-protein BLAST alignments.

35

Table 3. ESTs recently mapped by other groups within the 2001 ~1.5 Mb critical

 

 

 

 

 

 

 

 

 

 

 

interval.
EST Unigene Tissue Expression Protein motifs Reference
Amplimer
(GenBank Accession)
SMCR8 Hs.513986 2.8, 3.0, and 6.5 kb KOG3715: Bi et al.
(Genbank AF467440) transcript in all adult domain found in (2002)
and fetal tissues LST7 permease
Golgi transport
protein
SMCR7 Hs.100448 2.4 and 3.4 kb KOG3963: motif Bi et a1.
(GenBank AF467443) transcripts in all adult found in Mab—Zl- (2002)
and fetal tissues, like cell fate
predominantly in heart proteins
and sk. muscle
SMCR6 Hs.443639 RT—PCR demonstrated none Bi et al.
(GenBank BF 51 1382) expression in all tissues (2002)
SMCR5 Hs.352643 RT-PCR demonstrated none Bi et a1.
(GenBank AF467442) expression in all tissues (2002)
SMCR4 none RT-PCR demonstrated none Bi et al.
(GenBank BG992883) expression in all adult (2002)
tissues and fetus
SMCR3 Hs.373 802 RT—PCR demonstrated none Bi et al.
(GenBank AA609047) expression in all adult (2002)
tissues and fetus
SMCR2 none RT-PCR demonstrated none Bi et a1.
expression in adult (2002)
brain, and fetus
SMCR9 - none. RT-PCR demonstrated wa PDZW. 'Bi et al.- 1.
expression in all adult " "(20023 "g
_ tissues and fetus ':
i“ BED ' Flier-396533 3.8 kb transcript in all KOG3715: -' Nickersoniis
(GenBank AFS 17523) adult tissues domain found in et al. ”2:.
LST7 aa permease , (2002) - ii
Golgi transport

 

 

 

 

 

 

 

 

Followrng the publication of our physical and transcription map in 2001 (Lucas et al.,

2001), several other genes were mapped to this region by other groups. Genes have
been ordered proximal to distal and shading indicates that this gene is localized

outside of the current SMS critical interval (Vlangos et al., 2003).

identified from NCBI conserved domain database.

36

Domains were

longer map within the critical region and will be discussed in Chapter 3. ESTs listed
in Table 2 are additional novel ESTs we have since mapped to the SMCR. The
current expression and bioinformatic information about these expressed sequences is
included. Some of the sequences listed in Table 2 are novel and/or do not show
banding patterns upon northern analysis. These sequences may be artifacts from EST
cloning in the form of genomic sequence. It is also possible that the sequences are
not expressed in tissues represented or are expressed at too low of a level to be
detected on northern analysis. Further bioinformatic analysis may reveal more about
these possible transcripts as the genomic sequence is polished. Additional groups
have mapped EST sequences within the 1.5 Mb region represented by the deletion
carried by HOU142-540. These sequences are shown in Table 3. Any of the EST
sequences mapping within the SMS critical region may represent genes that play a
role in modification or expression of the SMS phenotype. It is also possible that
genes mapping outside the critical region may have an effect on the phenotype due to
breakpoint location within the expressed sequence or disruption or deletion of yet to
be discovered promoter or enhancer sequences. Though, the focus of this work is on
genes mapping within the SMS critical region as they are most likely responsible for

the characteristics making up the SMS phenotype.

Summary of known candidate genes mapping within the SMS critical region
Mapping of genes and ESTs to the SMS critical region provided us with
numerous potential positional candidate genes for SMS. We were most interested in

genes showing expression during fetal development or in brain tissues. Those genes

37

containing known protein motifs important in cell signaling, DNA binding, or
protein-protein interaction domains were given priority. We believed genes with
these characteristics were likely to be most susceptible to changes in dosage.

Several genes mapping within the SMS critical region have been well
characterized by others and are no longer candidates of high priority for SMS; these
include TOP3A (Hanai et al. 1996; Fritz et al. 1997; Elsea et a1. 1998), FLII
(Campbell et al. 1993; Chen et al. 1995; Campbell et a1. 1997; Campbell et al. 2002),
MYOISA (Wang et al. 1998; Liang et al. 1999), SREBFI (Hua et al. 1995; Smith et
al. 2002), PEMT 2 (Sesca et al. 1996; Vance 1996; Vance et al. 1997; Walkey et al.
1997), and COPS3 (Elsea et al. 1999; Potocki et al. 2000b; Yan et al. 2003). Further,
gene targeting of mouse orthologs of the six genes listed above (Tap3a, F Iiih, Myal5,
Srebfl, Pemt, and Caps3) show no phenotype in heterozygous mice (Table 4). This is
in contrast to the report indicating an SMS like physical phenotype in mice with
heterozygous deletion of the syntenic SMS region on mouse chromosome 11 (Walz et
al. 2003). Combined, these data suggest that these six genes are not likely dosage-
sensitive in the hemizygous state and are no longer high priority candidates for our
study.

The candidate genes of most interest to the lab during my tenure included
LLGLI, DRGZ, ATPAF2, TOMILZ, and RAII . The contribution of these genes to the
SMS phenotype was unknown at the beginning of this project. Studies of RAII,
DRGZ, and T 0M1L2 will be discussed at length in chapters 4, 5, and 6, respectively.
A summary of the two remaining candidate genes LLGLI and AT PAFZ is given

below:

38

Table 4. SMS candidate ggne disruption in mouse'.

 

 

 

 

 

 

 

 

 

 

Gene Publication Heterozygous Homozygous phenotype
disrupted phenotype
Pemt Walkey et al. No abnormal No abnormal phenotype on
(1997) phenotype normal diet
Srebfl Shimano et al. No abnormal No abnormal phenotype in live
(1997) phenotype births, ~65% embryonic lethal
My015 Probst et al. No abnormal Profound deafness and vestibular
(1998) phenotype defects
Fliih Campbell et al No abnormal Embryonic lethal, can be rescued
(2002) phenotype with human FLII transgenically
Tap3a Li and Wang No abnormal Embryonic lethal
(1998) phenotype

 

 

“Table is adapted from Vlangos et al., 2003.

39

Lethal giant larvae homolog 1 (LLGLI):

LLGLI (NCBI Entrez Gene ID#3996; Unigene Hs.513983; OMIM 600966) is the
human homolog of the Drosophila tumor suppressor gene, D-lethal (2) giant larvae
(D-lgl). When disrupted, D-lgl can produce trunors in the irnaginal disks and
abnormal transformation of the adult optic centers in larval brains. D-lgl was found
to be associated with the cytoskeleton (Strand et al. 1995). In the initial description,
human LLGLI was reportedly expressed in brain, kidney, and muscle, with little
expression reported in heart and placenta (Strand et a1. 1995). Current electronic
expression profiling of human ESTs in Unigene shows highest expression levels in
stomach. Antibodies against LLGLI were able to co-irnmunoprecipitate LLGLI and
non-muscle myosin heavy chain. This protein interaction is conserved in Drosophila
(Strand et al. 1995). LLGLI and D-lgl are also associated with a serine kinase, which
is able to specifically recognize and phosphorylate serine residues within the protein
likely allowing for regulation (Strand et a1. 1995). LLGLI was first mapped to
chromosome l7p11.2 with FISH and confirmed with Southern blotting (Strand et al.
1995). It is interesting that the 3' end of LLGLI overlaps with the 3' end of the FLII
gene (Campbell et al. 1997) which helped in orientation of these genes during

construction of our transcription map (Lucas et al. 2001).

ATP synthase mitochondrial F1 complex assembly (A TPAFZ; formerly ATPIZ):
Originally, AT PAF 2 (NCBI EntrezGene ID# 91647; Unigene Hs.13434;
OMIM 608918) was investigated by our group as the novel EST arnplimer D17S2021

(Elsea et a1. 1997). The ATPAFZ gene is the human homolog of the yeast nuclear

40

gene Atp12p as determined via BLAST analysis (Lucas et al. 2001). The role of the
AthZp gene is reportedly limited to ATP synthase assembly, and it is required to
mediate formation of the Fla subunit of the yeast mitochondiral ATPase (Wang et al.
2000; Wang et al. 2001). We examined expression patterns of ATPAFZ via
commercially available northern blots where a 1.8 kb transcript was noted in all
tissues examined (Table 2). An equivalent function for the yeast and human
homologs was proven by showing that transfection of the ATPAFZ cDNA into an
inviable yeast atpaf? mutant rescues the phenotype (Wang et al. 2001). Partial
deficiency of complex V of the oxidative phosphorylation system has been associated
to recessive missense mutation of the ATPAFZ in one patient (De Meirleir et a1.
2004). Heterozygous carriers of the reported mutation appear normal (De Meirleir et
al. 2004). It is unclear what percentage of gene function is lost in the reported
patients with DNA changes. Complete abolishment of gene function is likely
incompatible with life (De Meirleir et al. 2004); thus, the homozygous patient must
have some gene function. It is interesting that the affected patient displays features
consistent with SMS including infantile hypotonia and poor sucking, a prominent
nasal bridge, and hypoplastic kidneys (De Meirleir et al. 2004). At this point it is
unclear if haploinsufficiency of AT PAF 2 via hemizygous deletion has any role in the

SMS phenotype.

41

SUMMARY

Using genomic markers and ESTs mapping to chromosome 17p11.2, we were
able to create a fluid genomic contig and transcription map across the 1.5 Mb SMS
critical region. In constructing of the contig and transcription map we were able to
identify many positional SMS candidate genes. Initial characterization of the
candidate sequences led us to focus on five potential candidate genes. Additional in
depth analysis of these genes will focus on identifying the cellular function of these

genes, as well as any potential role they may play in generation of the SMS

phenotype.

42

MATERIALS AND METHODS

DNA isolation

BAC and PAC DNA extrgztion: BAC and PAC clones were obtained from Research
Genetics (now Invitrogen) and BAC/PAC Resources. Plasmid DNA was isolated
from E. cali cultures using a modified Qiagen very low copy protocol created in our
lab. Bacteria containing individual BACs or PACs were streaked on antibiotic
selective LB agar plates. Single colonies were picked and grown with continuous
shaking for 16 to 18 hours at 37°C in 2 ml of Luria-Bertani broth (LB) containing
appropriate selective antibiotic (12.5 jig/ml chloramphenicol for BACs or 100 ug/ml
kanamycin for PACs). Starter cultures were diluted 1/500 in 250 ml LB containing
selective antibiotic and grown for 16 to 18 hours at 37°C while shaking. Bacteria
were pelleted by spinning at 6000 x g for 15 minutes at 4°C. The supernatant was
removed, followed by immediate resuspension of the pellet in 60 ml of buffer P1 (50
mM Tris-HCl, pH 8.0, 10 mM EDTA, pH 8.0, 0.1 mg/ml RNase A). Sixty milliliters
of lysing buffer P2 (0.2 N NaOH, 1% sodium dodecyl sulfate{SDS}) were added to
the cells and solutions were gently mixed via inversion to ensure complete cell lysis.
Sixty milliliters of buffer P3 (3 M potassium acetate) were immediately added to the
lysed solution and gently mixed. Tubes were placed on ice for thirty minutes to
ensure complete precipitation of cellular debris. Following this incubation, the tubes
were centrifuged at 4°C at 220,000 x g. Supernatant containing plasmid DNA was
promptly filtered through filter paper (Whatrnan #4). The BAC/PAC DNA was
precipitated by adding 0.7 volumes of room temperature isopropanol and centrifuged

at 215,000 x g for 30 minutes at 4°C. The pelleted DNA was allowed to dry slightly

43

(inverted for 5 minutes) and then resuspended in 500 p1 sterile 1x TE buffer (10 mM
Tris-HCl, pH 8.0, 1 mM EDTA). After the DNA was completely resuspended, 5 ml
of buffer QBT (0.75 M NaCl and 50 mM MOPS buffer containing 15% isopropanol
and 0.15% Triton X-100, pH 7.0) was added to the plasmid DNA. Resuspended
DNA was applied to a buffer QBT equilibrated Qiagen Tip 500. The column was
washed three times with 10 ml of buffer QC (1 M NaCl, 50 mM MOPS buffer, pH
7.0 containing 15% isopropanol). The BAC/PAC DNA was precipitated from the
column by using 15 ml of buffer QF (1.25 M NaCl, 50 mM Tris, pH 8.5, containing
15% isopropanol) preheated to 65°C. The purified DNA was precipitated by adding
0.7 ml of room temperature isopropanol and centrifuged at 215,000 x g at 4°C for 30
minutes. The supernatant was decanted and the plasmid pellet was allowed to air dry
for ~10 minutes. The pellet was resuspended in 200 pl sterile 1x TE. Purified
BAC/PAC DNA was electrophoresed on a 1% TBE agarose gel and visualized under
a UV transilluminator after staining with ethidium bromide. Finally, DNA quantity
and quality was determined using a spectrophotometer.

EST plasmid DNA isolation: EST clones representing markers mapping to

 

chromosome 17p11.2 were obtained (Research Genetics, Incyte Genomics, the
German Genome Project, or RIKEN) and grown on LB agar plates containing
appropriate antibiotic for selection. Individual colonies were then picked and grown
in 5 ml LB broth containing antibiotic. DNA was isolated from bacterial cultures
using the Qiagen miniprep kit according to manufacturer’s instructions. After
isolation plasmid DNA was electrophoresed on a 1% TBE agarose gel and visualized

under a UV transilluminator after staining with ethidium bromide. DNA quantity and

44

quality was determined using a spectrophotometer.

Southern analysis: Standard Southern analysis was used to map markers to
BACs/PACs within the contig and to the hybrid mapping panel. BAC or PAC DNA
(6 pg), human genomic DNA (9 pg), or rodent-human hybrid DNA (15 pg) was
digested with 4 U/pg of EcoRI and 2.5 mM spermidine for ~16-18 hours at 37°C.
Digested DNAs were electrophoresed on 1% TAE agarose gels (TAE; 0.04 M Tris-
acetate, 1 mM EDTA) with continuous buffer recirculation at room temperature.
Gels were depurinated in two gel volumes of 0.25 N HCl followed by denaturation in
2 gel volumes of 0.4 N NaOH. DNA was transferred to an Amersham Hybond-N+
nylon membrane via wicking with 10x SSC (SSC; 20x stock solution is 3 M NaCl,
0.3 M Na-citrate). After transfer, DNA was UV-crosslinked to the membrane using a
Stratalinker (Stratagene). Membranes were prehybridized and hybridized in a
solution of 1 M NaCl, 1% SDS, 10% dextran sulfate, and 0.1 mg/ml herring sperm
DNA at 65°C with rotation in a hybridization oven. All DNA probes (purified PCR
products or plasmid inserts) were labeled with 32P-dCTP using an Amersham
Rediprime H kit. Unincorporated nucleotides were removed with a sperrnine and
herring sperm DNA precipitation followed by radioactivity quantification in a
Brinkrnan scintillation counter. During preassociation, ~106 cpm/ml of probe was
annealed to 0.25 mg/ml placental DNA to mask repeat sequences and then hybridized
to the membrane for ~l6-18 hours. Blots were washed for 20-30 minutes in 0.1x
SSC, 0.1% SDS at room temperature, followed by a stringent wash in preheated 0.1x

SSC, 0.1% SDS at 65°C. The blots were exposed to X-ray film with two intensifying

45

screens at -80°C for 1-5 days before developing.

Database searches: Extensive information about the genes and ESTs in the region
was obtained through the National Center for Biotechnology Information (NCBI)
website (http:/www.ncbi.nlm.nih.gov), including Unigene, the EST database
(dbEST), and the STS database (dbSTS). Draft assembly of the hmnan genome
project was found at the UCSC genome bioinfonnatics site
(http://www.genome.ucsc.edu) and through Project ENSEMBL
(http://www.ensembl.org). Supplementary marker information was derived from the
Genome Database (http://www.gdb.org). Sequence alignments and unfinished high-
throughput genome sequence BLAST searches were conducted through the Baylor
College of Medicine Search Launcher (http://searchlauncher.bcm.tmc.edu) or NCBI.
Conserved sequence domains were identified through databases at NCBI

(http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi).

PCR: The polymerase chain reaction (PCR) was performed in 25 p1 volumes.
Amplification of 50—100 ng of template DNA was performed using 1 U of Taq
polymerase in a cocktail consisting of 0.8 pM of each primer, 0.25 mM dNTPs, and
1x PCR buffer (10x buffer contains 100mM Tris-HCl pH 8.3, 15 mM MgC12, 500
mM KCl, 0.01% gelatin). Amplification was performed in an Applied Biosystems
(ABI) or MJ Research therrnocycler at the following conditions, unless otherwise
noted: initial denature at 94°C for 4 minutes, followed by 30 cycles of 94°C for 1

minute, 55°C for 1 minute, and 72°C for 3 minutes, followed by a final extension of

46

72°C for 10 minutes. PCR products were then electrophoresed on 1% or 2% TBE

agarose gels, stained with ethidium bromide, and visualized on a UV transilluminator.

Northern analysis: The expression of various ESTs was visualized using human
multiple tissue, fetal, and brain 11 northern blots purchased from Clontech.
Prehybridizations and hybridizations were performed in 5x SSPE (0.75 M Nacl, 0.05
M NaHzPO4, 5 mM EDTA), 10x Denhardt’s solution (0.2% BSA, 0.2% ficoll, 0.2%
polyvinylpyrrolidone), 100 pg/ml herring sperm DNA, 2.0% SDS, and 50%
deionized formarnide at 42°C with rotation in a hybridization oven. Radiolabeled
probes were created as described for Southern analysis. Approximately 106 cpm/ml
of probes was denatured and added to prehybridized filters. Filters were hybridized
for ~18 to 20 hours at 42°C, followed by washing in 2x SSC, 0.05% SDS for ~30
minutes at room temperature with 1 to 2 changes of wash solution. Filters were then
transferred to a wash of 0.1x SSC, 0.1% SDS for ~30-40 minutes at 50°C. The blots
were exposed to X-ray film between two intensifying screens at -80°C for 2-5 days

before developing.

47

Chapter 111

Analysis of 17p11.2 deletions using fluorescent in sitn hybridization

BACKGROUND

Until the early 19903 detection of chromosomal anomalies, including
microdeletion disorders, depended on staining and analysis of the entire chromosome
complement. This was usually accomplished by techniques such as Geimsa staining,
also known as G-banding. The chromosomes were stained with a mix of the toxic
dyes methylene azure and eosin, which bind to the phosphate groups of DNA. The
regions of the chromosome where the DNA is more densely packaged
(heterochromatin) stains darker than regions where the DNA is more loosely
packaged (euchromatin). Thus, staining reveals a recognizable pattern of bands along
the chromosomes. Using this standard technique, the entire genome usually shows
~350 distinct bands. Analysis of the number of total chromosomes and the banding
patterns uncovers the chromosomal abnormalities.

This standard karyotype analysis works very well for detection of aneusomy
(i.e. Down syndrome, trisomy 21) and large segmental anomalies (i.e. translocations,
inversions, deletions, or duplications) and is still routinely used today. Though the
technique is very reliable, there are limitations. Increasing the ntunber of bands to the
550 or 850 level by preparing chromosomes of increased metaphase length helps
intensify the sensitivity of the test. Even so, small anomalies involving less than ~1.5
Mb of DNA cannot be unambiguously detected. Technological advances using

fluorescent dyes have aided greatly in the detection of these smaller anomalies.

48

The use of fluorescent in situ hybridization (FISH) for gene mapping dates
back to the late 19708 when it was used to map the human globin genes to the long
arms of chromosomes 4 and 5 (Cheung et al. 1977). It wasn’t until 1986 that FISH
was reported as a use for detecting chromosomal anomalies using human genomic
DNA as a probe (Pinkel et al. 1986). DNA probes made of genomic DNA
representing known loci were labeled with nucleotides conjugated with haptens such
as biotin or digoxigenin. The labeled nucleotides are incorporated, at a defined
density, into the nucleic acid probes by DNA polymerases. The labeled probes were
then hybridized to denatured metaphase chromosomes much in the way radiolabeled
probes are hybridized to Southern blots. The labeled probes are detected with
fluorescently labeled antibodies to the hapten, and viewed using a properly equipped
fluorescent microscope. The number of fluorescent signals detected is a direct
measure of DNA copy number (Figure 7). If a microdeletion syndrome is detected
via karyotype, the deletion is usually confirmed via FISH. Additionally, FISH may
be ordered directly without a prior karyotype if a specific chromosomal anomaly is
suspected. The current guidelines for diagnosis of microdeletion syndromes,
including SMS, recommend testing and/or confirmation via FISH (ACMG/ASHG
positional statement. 2000).

Technology has advanced to make FISH experiments faster and cheaper.
Today, the flourochrome is attached directly to the nucleotide. This negates the need
for secondary antibody detection. The probes are more robust and emit a greater
amount of light fi'om the same excitation input. Initial FISH experiments in the Elsea

Laboratory were performed with indirect labeling methods, but we have since

49

‘— nol tIL‘I

not do!

l

1101 \It‘I

 

Figure 7. Examples of not deleted and deleted FISH experiments.

Metaphase chromosomes were hybridized with fluorescently labeled BAC probes.
Green signals are indicative of clones mapping within the SMS critical region.
The red signals represent a BAC mapping to l7q and is used as a control. A)
Green and red signals of both chromosomes 17 indicate that this patient is not
deleted for the test probe. B) In this patient sample the green test probe is only
present on one chromosome 17, while the red control probe is present on both
chromosomes 17. This indicates that this patient is deleted for this test probe.

50

switched to using directly labeled probes. All FISH experiments described herein
have been performed with directly labeled FISH probes.

FISH is not only a wonderful diagnostic tool but also a powerful tool for
research of microdeletion syndromes. Using probes mapping in the region of the
disorder, it is possible to determine which DNA sequences are absent or present.
SMS patients displaying the full phenotype of the disorder may have different sized
deletions (Trask et al. 1996). The smallest region of overlap of the deletions carried
by these patients defines the syndrome critical region. The genes mapping within this
region are the positional candidate genes for the disorder. This method has been used
successfiilly in many microdeletion disorders including Smith-Magenis syndrome

(Bettio et al. 1995; Gong et al. 1996; Juyal et al. 1996; Elsea et a1. 1997).

RATIONALE

In studying deletions of chromosome 17p11.2 associated with Smith-Magenis
syndrome, we were most interested in patients with deletions overlapping the SMS
critical region (described in Chapters 1 and 2). Using FISH analysis on SMS patient
samples we identified deletions that overlapped the smallest SMS deletion known at
the time. Detailed analysis of the unusual deletions carried by these patients allowed
us to reduce the size of the SMS critical region and the number of candidate genes.
The work presented in this chapter resulted in the following publications; (V langos et

al. 2003; Vlangos et al. 2004).

51

RESULTS
FISH detection of 17p11.2 deletions and refinement of the SMS critical region

Using FISH, we characterized the 17p11.2 deletion size in 22 patient samples.
Clinical analysis of the patients was obtained from patient medical records, and from
a questionnaire developed in house (Appendix A). Because the common SMS
deletion was reported to occur in >90% of SMS patients we expected that the
majority of our patient cohort would harbor the common SMS deletion (Chen et a1.
1997; Lupski 1998; Potocki et al. 2000b; Bi et al. 2002; Shaw et al. 2002). Thorough
FISH analysis using probes mapping along chromosome l7p11.2 revealed that 8 of
our 22 patient samples carried the common SMS deletion (Figure 8). The number of
patients with the SMS common deletion was significantly lower than we expected.

Four of the 22 patient samples analyzed showed deletions that were
uncommon, but that did not overlap the 1.5 Mb SMS critical region (Figure 8). These
patients all showed the complete spectrum of the SMS phenotype. The unusual
deletions these patients carry do give further insight into the mechanisms causing
17p11.2 deletions associated with SMS, as the deletions are not due to NAHR
between the SMS-REP sequences. These data indicate that the true incidence of the
SMS common deletion may be lower than < 90% previously reported (Chen et al.
1997; Lupski 1998; Potocki et al. 2000b; Bi et al. 2002; Shaw et al. 2002).

Since 1997 the SMS critical region has been defined by a single l7p11.2
deletion spanning ~1.5 Mb of DNA (Elsea et al. 1997). In our analysis of l7p11.2
deletions associated with SMS, we were very interested in finding patients displaying

the SMS phenotype whose deletions overlapped the 1.5 Mb carried by HOU142-540.

52

Through thorough FISH analysis on the patient samples received, we found three
patients who carry deletions overlapping with the deletion carried by patient
HOUl42-540 (Figure 8).

SMS135 is the first patient referred to us whose deletion helped narrow the
smallest region of overlapping deletion on chromosome 17p11.2 associated with
SMS. SMSIBS is a 3 year, 8 month-old male of Filipino descent who displays the
characteristic SMS phenotype (Figure 9A, Table 5). FISH with clones mapping along
chromosome 17p11.2 allowed for identification of his deletion breakpoints. FISH
data indicate that the proximal breakpoint of this deletion occurs at or near the
proximal SMS-REP. The distal breakpoint, however, occurs within the current SMS
critical interval (Figure 8). FISH analysis indicated that this patient is not deleted for
genomic clones on l7p11.2 from the SMS-REPD through BAC RP11-335P17
containing the COPS3 gene (Figure 8). The patient is deleted for BAC CTD-40123,
containing the PEMT2 gene (Figure 8). Finer mapping with cosmids was performed
using clones from the chromosome 17 library (LA17NC01) (Kallioniemi et al. 1994)
for RASDI (c107A2) and PEMT2 (c26ElO) (Figure 10). The patient is deleted for
c26E10 and not deleted for c107A2 which places the distal breakpoint in the ~30 kb
between these cosmids.

Two additional patient samples, SMS182 and M2359 (Figure 9A and 9B,
Table 5), were sent to us for analysis because high resolution karyotyping showed
possible interstitial deletion of chromosome 17p11.2 though diagnostic testing for
SMS with commercially available FISH probes was negative in both cases. We

strongly suspected SMS in both patients, and performed FISH analysis using probes

53

Figure 8. Summary of 17p11.2 deletions identified in this study.

Probes used in FISH analysis and their respective locus are indicated in the table to
the left. Deletions found in the course of this study are indicated by the ideograms.
Hatched boxes indicated DNA that is not deleted. Open boxes indicated DNA that is
deleted. The critical deletion as reported in J uyal et al., 1996 and Elsea et al., 1997 is
indicated for reference. The number of patients determined to carry each deletion is
listed under each ideogram.

54

 

 

 

 

 

 

 

 

 

 

 

 

 

 

C
.9
ad
_d_)

O
'O
.5
'C
O

 

 

 

 

 

 

 

 

Locus Probe
PMP22 bc76406
FOXO3B bc815l9
srs-we7727 bc529l10
REP-D bc198H15
TNFRSF13B pc48J14
cCI17-638 bc989815
D17S740 bc367GQ
COPS3 bc335P17
PEMT2 bc40l23
RAI1 pc253P07
FLII bc347A12
FLII c62F2
SHMT1 bc219k23
017329 bc457L16
MFAP4 bc187M2
ULK2 b07807
D17S446 c105G12
01782201 bc746M1

 

 

 

 

Common deletion

 

55

 

 

 

Uncommon deletions

 

V F

 

 

 

 

 

 

 

lJl

i

1

Lil

 

 

 

 

 

 

 

 

 

 

mapping along l7p11.2.

The proximal breakpoints for both SMS182 and M2359 map within the region
between the FL]! and LLGLI genes (Figures 8 and 10). Distally, the deletion carried
by SMS182 extends into 17p12 near the ADORA2B gene. The distal breakpoint for
M2359 is located near the genomic marker STS-W67727 in 17p11.2 (Figures 8 and
10). Using the proximal deletion breakpoint for these two patients and the distal
breakpoint for patient SMS135, we determined that the smallest shared region of
deletion of studied SMS patients is ~700 kb (Figure 10) and currently contains 11

known genes (V langos et al. 2004).

Commercially available diagnostic FISH probes for SMS will not detect all cases
Both SMS182 and M2359 display characteristics typical of the SMS
phenotype for their respective ages. Both patients tested negative for SMS using
commercially available SMS FISH probes. Utilizing genomic probes mapping along
17p11.2 for FISH, we were able to determine that both SMSl82 and M2359 carry
interstitial deletions of 17p11.2 and that both patients are deleted for the RA]! gene.
As will be discussed further in Chapter 4, patients carrying mutations in the
RA]! gene mapping within the SMS critical region display features consistent with
the SMS phenotype (Slager et al. 2003; Bi et al. 2004; Girirajan et al. 2005).
Characteristics that are not seen patients with mutation in the RAII gene include short
stature, infantile hypotonia, and cardiac and/or renal anomalies. These features occur
at a greater frequency in SMS patients who harbor a 17p11.2 deletion than in the

general population and thus, are included in the SMS phenotype. It is possible that

56

Figure 9. SMS patients with unusual deletions used to refine the smallest region
of overlapping deletion in SMS.

The three patients who carry deletions allowing for refinement of the SRO in SMS all
display typical SMS facial features; A) SMS135 at age 3 years, 8 months, B) SMS182
at age 19 months, and C) M2359 at age 10 years. D) FISH analysis of metaphase
chromosomes from SMS135 indicate he is not deleted for bc3073J20 as green test
signal is only detected on one chromosome 17. This probe is deleted original SMS
critical interval described be Elsea et al., 1997. E) Metaphase chromosomes from
SMSl35 indicate he is deleted for the pc253P07 probe containing the RA]! gene. F)
Metaphase chromosomes from M2359 indicate he is also deleted for the pc253P07
probe. Both SMS182 and M2359 both tested negative for SMS using currently
available commercially available FISH probes.

57

 

 

 

58

Figure 10. Location of SMS FISH probes in relation to l7p11.2 deletions.

The genomic region of chromosome 17p11.2 is represented and indicates the location
of the three SMS-REPS, as well as genes and markers mapping to this region. The
red hatched bar indicates the smallest region of DNA that is deleted in all SMS
patients carrying a 17p11.2 deletion, the open/closed bars indicate deletions of SMS
patients in this study. The open portion of the bars represents deleted DNA, while the
closed portion represents non-deleted DNA. The green bars represent the currently
available FISH probes from Vysis and Cytocell. The red bar represents the PAC
RP1-253P07 used in our FISH experiments. The purple bars represent the previously
available FISH probes from Oncor. The blue bars indicate experimental test probes
used in this study. This figure is not to scale.

59

7
2
WW. w n L
we. 7mwm 0
mm Emma... H u
so Dru...) M .5

 

”3-3:.ch

0.52 U. emmmm I

gait... SI '2: _-~ _ 20m.
033.. Income

.1 9 w 8
.l 2 8 fi
m S S 7
7 7 l

' all 1
s w 0 0 0

. .. ”11......3/

. l

 

I <5? mzm Edda I U _ ammo 3030
I980: mgm Edda

 

mZ—mBm

 

 

9323 I

 

 

38% ll

 

 

 

IOCENGS l

 

 

 

WAILSEIV.

I also»: 8E8 it Have

I 00389.93 wove

I W333: b3 .

I 988265 enodaieo Samoa “EB—ego

 

60

Table 5. Phenotypic comparison of SMS patients with 17p deletions'I

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

SMS126 HOU142 SMS135 SMS182 M2359
Cormnon -540 Unusual Unusual Unusual
SMS Smallest 17p1 1.2 17p1 1.2 17p1 1.2
deletion SMS deletion deletion deletion
deletion
to date
Features common in >75% of SMS Pts.
Craniofacial/Skeletal
Brachycephaly - - + + +
Midface hypoplasia + + + + +
Progrthism (relative to age) + + N N +
Tented upper lip + + + + +
Broad, square face + - + + +
Brachydactyly + - + + +
Short stature + + - -
Otol_a_rmgologic abnormalities
Chronic ear infections/PE tubes + + N + +
Hoarse, deep voice + + N N +
Neurological
Mental retardation + + + + +
jpeech delay + + + + +
Motor delay + - + + +
Infantile hypotonia + - + + +
Sleep disturbance + + + + +
Behavioral
Self-hugginghind wringing + + + N +
Onychotillomania + + N N -
Polyembolokoilorrrania + + N N +
Head banging / face slapping + + N + +
Hmd-bifigg + + N N +
Attention seeking + + N N +
Features common in 50 - 75% of SMS
patients
Hearing 1088 + + - + -
Myopia + + - - -
Strabismus - + + + -
Iris abnormalities - + - - .-
Synophrys - + - + +
Scoliosis + - + N +
Features common in < 50% of SMS
patients
Cardiovascular anomalies + + - - -
Renal anomalies - + - - -
Seizures - + - + -
Cleft lip/palate - - - - -
Gender/Age at evaluation Female Male Male Male Male
41y 10y, 14y, 3y 8m 14m, 2y 10y
15y

 

' Modified from the Gene-Reviews website (www.genereviews.com) and Slager et al., (2003)

Note: +, feature present; -, feature not present; and N, feature not evaluated/ too young to evaluate

61

 

haploinsufficiency of RAII may also cause these characteristics; however, we have
not yet identified patients with RA]! mutations who display these features. It is also
possible that haploinsufficiency of another gene(s) mapping to l7p11.2 is responsible
for these characteristics. Thus, studies of patients with unusual deletions will
continue in order to narrow SMS region and the number of possible candidate genes
to further understand genotype:phenotype correlation in SMS.

Narrowing of critical region in microdeletion syndromes is common and can
greatly aid in the search for causative genes as has been seen in Rubinstein-Taybi
syndrome [del(16)(pl3.3)], due to haploinsufficiency of CREBBP (Petrij et al. 1995),
and Alagille syndrome [del(20)(p12)] due to haploinsufficiency of JAG] (Li et al.
1997b; Oda et al. 1997b). As the critical regions are further reduced and the
causative genes for the microdeletion syndromes are located, it is important that FISH
probes are moved to represent these causative genes. Clinical FISH for Alagille
syndrome associated deletions is now conducted with a probe containing the entire
JAGI gene, while clinical FISH for Rubinstein-Taybi associated deletions is
conducted with a contig of five cosrrrids covering the CREBBP gene
(http://www.genereviews.org).

It is important to note that so far, all SMS patients who carry a 17p11.2
deletion are deleted for the RAII gene (Figures 8 and 10). Currently available
commercial FISH probes do not contain RAII . We have shown here that these
currently available commercial FISH probes from Vysis Inc. (A subsidiary of Abbot
Laboratories) and Cytocell Technologies will not detect all cases of SMS with a

l7p11.2 deletion. We suggest that all future diagnostic FISH tests be performed with

62

probes containing the RAII gene. This will require that companies offering
commercial FISH probes re-evaluate the location of their probes based on current
data. Certain patients suspected to have SMS who previously tested negative with
currently available FISH probes (i.e. those containing FLII or D17S29) may need to
be re-tested with a probe containing RAJ], but we strongly recommend careful
consideration of the SMS phenotype by thorough clinical re-evaluation before costly
re-testing is pursued. It is also important to note that patients tested with the Oncor
D178258 FISH probe, which is no longer commercially available, do not need to be
re-tested by FISH. The D178258 probe is a cosmid, and the genetic marker D17S258
is located within an intron of the RAII gene (Figure 10). Some patients may display
the typical SMS phenotype yet still test negative with FISH probes containing the
RA]! gene. These patients may be candidates for further testing and sequencing of

the RAII gene as will be discussed in Chapter 4.

The SMS common deletion occurs less frequently than reported

The deletion seen with greatest fiequency, known as the common deletion, is
~3.5 Mb and was been reported to occur in 90% - 95% of SMS patients (Chen et al.
1997; Lupski 1998; Potocki et al. 2000b; Bi et al. 2002; Shaw et al. 2002). The
remaining ~5% are reported to be deletions of differing sizes, though size
distribution, larger or smaller, has not been reported. During our FISH analysis we
noticed that unusual deletions were occurring more frequently than expected. We
reviewed the deletions of patients reported in the literature in addition to those

reported here (Table 6). To date, including the 16 new SMS patients with l7p11.2

63

deletions reported here, there are a total of 85 reported SMS patient deletions fully
characterized (Juyal et al. 1996; Chen et al. 1997; Yang et al. 1997; Potocki et al.
2000b; Bi et al. 2002; Park et al. 2002). The common deletion was reported as either
the presence of a junction fragment on a PF GE Southern blot resulting from
homologous recombination between SMS-REPP and SMS-REPD (Chen et al. 1997)
or by FISH analysis. The common deletion has been detected in 60/85 (70.59%)
SMS deletions, while unusual deletions have been found in 25/85 (29.41%) SMS
deletions (Table 6). Approximately 30% of SMS deletions are likely mediated by
other sequences, including the middle SMS-REP and/or other LCR elements, or the
location of the SMS region within the pericentromeric region on the chromosome.
An analysis of the August 2001 release of the human genome sequence discovered
169 sequences flanked by similar duplications of which only 24 are known to be
associated with human disease (Bailey et al. 2001).

It is thought that 5—10% of the human genome is duplicated (Ji et al. 2000)
leaving many repetitive sequences uncharacterized. Newly described LCR elements
have been characterized which flank the SMS-REP sequences, and these newly
characterized LCRs are postulated to mediate recombination in unusual deletions
(Park et al. 2002). The data presented here firrther suggest that LCRs yet to be
characterized mediate recombination at a much higher rate than previously thought.
Additionally, many microdeletion syndromes occur in the pericentromeric region of
the chromosome (Williams syndrome del(7)(q11.2), DiGeorge syndrome
del(22)(q11.2), Smith-Magenis syndrome del(17)(pll.2), NFl del(17)(q11.2), and

Prader-Willi/Angelman syndromes del(15)(q11-q13)). The location of these

syndromes in the pericentromeric region of the chromosome may also facilitate the

homologous recombination leading to unusually sized deletions.

SUMMARY
Analysis of SMS patient samples has allowed us to narrow the smallest region
of overlapping deletion of chromosome l7p11.2 associated with Smith-Magenis
syndrome from 1.5 Mb to ~700 kb. This region contains the RA]! gene, which likely
causes the majority of the SMS phenotype when in the hemizygous/haploinsufficient
state. Currently available commercial FISH probes for SMS do no contain the RA]!
gene, and not all SMS patients with 17p11.2 deletions are deleted for the currently
available commercial FISH probes. Thus, not all SMS patients with deletions will be
diagnosed with these probes. This will require that companies offering commercial
FISH probes re-evaluate the location of their probes based on current data.
Further, we have determined that the ~3.5Mb common SMS deletion
occurs less frequently then the >90% reported. The common deletion occurs in ~70%
of SMS patients. Other newly described, or undiscovered repetitive sequences likely

contribute to the recombination of chromosome 17p11.2 leading to SMS.

65

Table 6. Frequency and type of SMS patient deletions‘.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Publication Total # Common Deletion other
completeb Deletion than common

Juyal et al. 59 50 9

(1996)

Yang et al. 1 0 l

(1997)

Chen et al., 2 2 0

(1997)

Park et al., 1 0 1

(1998)

Potocki et 4 0 4

al., (2000)

Bi et al., 2 0 2

(2002)

Vlangos et 11 7 4

al., (2003)

This Report 5 l 4

Total 85 60/85 (70.6%) 25/85 (29.4%)

 

‘ Modified from Vlangos et al., 2003

b Total number complete represents fully characterized

deletions. If patients have multiple reports, they are

counted only once.

66

 

MATERIALS AND METHODS

Patient and sample ascertainment: Contact between potential research participants
was established between the patient’s guardian and/or medical care provider and the
project Principal Investigator (Dr. Sarah H. Elsea, Ph.D.). Research samples and
completed questionnaire (see appendix A) were collected in accordance with
Institutional Review Board approved protocols at Michigan State University, Virginia
Commonwealth University, and The National Institutes of Health. Peripheral blood
samples were collected and shipped to the Elsea laboratory for preparation of

transformed lymphoblastoid cell lines, metaphase chromosomes, and genomic DNA.

Clinical descriptions afSMS135, SMS182, and M2359:

Patient SMS135: SMS135 is a male of Filipino descent evaluated at age 3 years, 8
months by collaborator Dwight Yim, M.D. SMS135 displays the common SMS
facial features including a distinct tented upper lip, brachycephaly, and midface
hypoplasia (Figure 9A, Table 5). SMS135 also has speech and motor delay, short
stature, brachydactyly, and was hyptonic as an infant. He is mentally retarded, has
stereotypic self-hugging behavior, and experiences sleep disturbance common in
SMS patients. SMS135 also has myopia and scoliosis, which are seen in < 50% of
SMS patients. SMS135 has not yet developed self-injurious behaviors, though these
may develop with further aging. Commercial FISH testing was positive for SMS.

The patient was referred because of the family’s interest in SMS research.

Patient SMSlSZ: SMSlS2 is healthy, non-verbal male evaluated at 14 months

67

(Figure 9B) and again at 2 years (Table 5). At age two years his height was 83.82 cm
(15%ile), weight 12.93 kg (60%ile), head circumference 47.94 cm (25%ile), and BMI
18.41 (88%ile). He displays the common physical and neurological SMS
characteristics expected for his age (Fig. 9B and Table 5). The parents of SMS182
also reported that he developed significant sleep disturbance at ~18 months of age,
and head-banging and face slapping upon becoming frustrated at age 3. He displays
some features seen less commonly in SMS, including hearing loss, strabismus,
synophrys, and seizures (Table 5). High-resolution karyotypes at two different
facilities showed an interstitial deletion of one chromosome 17p11.2. Commercial

FISH testing, performed using the Vysis SMS probe, was negative (Fig. 13).

Patient M2359: Evaluated by colleagues at NIH and in Australia, M2359 (Figure 9C,
Table 5) is a male evaluated at 10 years of age with height 144.15 cm (90%ile),
weight 43.4 kg (97%ile), head circumference 55.5 cm (90%ile), and BMI 20.89 (90-
95%ile). He has nearly all features most common to SMS, including typical
craniofacial anomalies, speech and motor delay, mental retardation, and infantile
hypotonia. In addition, he has synophrys, scoliosis, and bifid uvula. He displays a
majority of the characteristic behaviors seen in SMS patients including self-hugging,
polyembolokoilomarria, head banging, hand biting, and attention seeking, and he has
evidence of nail damage, although he does not yet display nail yanking as is often
seen in older SMS patients (Finucane et al. 2001). Significant sleep disturbance was
reported by parents and validated by actigraphy. He does not have short stature or

cardiac/renal anomalies. A high-resolution karyotype of M2359 showed a suspected

68

deletion of one chromosome 17p11.2 region. FISH was performed with SMS probes

from Vysis and Cytocell, but both tests were negative.

Isolation of metaphase chromosomes: Two hundred and fifty microliters of whole
blood collected in a sodium heparin Vacutainer was inoculated in 5 ml of RPMI
media (Gibco) supplemented with 10% fetal bovine serum and 1x
antibiotic/antimycotic solution (Gibco). Fifty nricroliters of the mitogen
phytohemaggultinin (PHA) were added to a final concentration of 1 x, tubes were
mixed well and incubated at 37°C under 5% C02 for 72 hours with gentle mixing at
least once per 24 hours. After 72 hours incubation, synchronization of the cell cycle
was started by the addition of 10 pl of 50 pM methotrexate. After 16—18 hours
incubation at 37°C under 5% C02, 50 pl of 1 mM thymidine was added. Cells were
incubated another 4 hours at 37°C under 5% C02. Harvest of synchronized cells was
started by the addition of 25 pl of 10 pg/ml colchicine. Cells were incubated 30

minutes at 37°C under 5% C02 before centrifugation at room temperature for 8
minutes at 1,200 rpm. Supernatant was discarded, followed immediately by the
addition of 6 ml of 75 mM KCl. Cells were incubated at room temperature for 15
rrrinutes before the addition of 10—12 drops of ice cold fixative (3:1 methanolzacetic
acid) with a Pasteur pipette. Tubes were immediately mixed and centrifiiged as
above. All but 0.5 ml of the supernatant was removed, and cells were resuspended in
1 ml fixative and gently mixed. Five milliliters of additional fixative was
immediately added and tubes were mixed and centrifuged as above. After

centrifugation, the supernatant was completely removed and cells were resuspended

69

in 5 ml of fixative. Centrifugation and washing with fixative was repeated 2
additional times. After final centrifugation, the pellet was resuspended in ~4 ml
fixative and incubated overnight at 4°C. After incubation metaphase chromosome

spreads were prepared on glass slides using standard cytogentic methods.

Fluorescent in situ hybridization: Probes for FISH were chosen based on mapping
information from our recently completed SMS critical interval contig, which was
constructed with large insert bacterial artificial chromosomes (BACs) and P1 artificial
chromosomes (PACs). Additional probes (BACs, PACs, and cosnrids) were obtained
using mapping data obtained during construction of our conti g, and from online
databases, including the Genome Browser at UCSC (http://www.genome.ucsc.edu)
and GenBank at NCBI (http://www.ncbi.nlm.nih.gov). FISH probes were created
using BAC, PAC, or cosmid DNA isolated as described in Chapter 2 and labeled by
using a commercially available nick translation kit to incorporate Spectrum Green or
Spectrum Orange dUTP by following manufacturer instructions (Vysis Inc.).
Metaphase chromosomes were prepared for hybridization by incubating at 37°C in 2x
SSC for 30 rrrinutes. Slides were dehydrated by placing in an ethanol series (70%,
80%, 95%, and 100%, two minutes each) and allowed to air dry. Chromosomes were
then denatured at 72°C for two minutes in a solution of 70% deionized fonnanride
and 2 x SSC at pH 7.0 and immediately dehydrated in ethanol as above. Probe DNA
(100 ng BAC/PAC or 180 ng cosmid) was precipitated in the presence of 1 pg COT-1

DNA and 2 pg human placental DNA by adding 0.1 volume of 3 M sodium acetate

and 2.5 volumes 100% ethanol. The probes were placed at -80°C for 15 minutes then

70

immediately centrifuged at 4°C at > 12,000 x g for 30 minutes. The supernatant was
discarded and the precipitated probe was dried to completion in a SpeedVac. The
probe was then resuspended in 3 pl H20 and 7 pL hybrisol VII (Oncor Inc.). The
probes were denatured for five minutes at 72°C and hybridized to chromosomes at
37°C for 14—16 hours. Slides were washed per manufacturer recommendations
(Vysis Inc.) and counterstained using Vectashield antifade with DAPI (Vector Labs).
Analysis of the FISH experiments was canied out on a Zeiss Axioplan2 microscope

and photographed with a Harnarnatsu black and white camera using Zeiss AxioVision

software version 2.0 (Carl Zeiss Inc).

71

Chapter IV
Analysis of Smith-Magenis syndrome patients without a FISH detectable

l7p11.2 deletion

BACKGROUND AND RATIONALE

Analysis of patient deletion sizes by FISH reduced the SMS critical region
(SMCR) from 1.5 Mb to ~700 kb. This narrowing of the SMCR greatly reduced the
number of candidate genes fi'om >30 to 11. However, of 22 patient samples analyzed
using FISH, we were unable to detect a 17p11.2 deletion in six samples even though
thorough clinical analysis of these patients indicated a strong suspicion of SMS. We
believed that these patients indeed had SMS and hypothesized that there may be
dominant mutations in a gene within the SMS critical region that could cause SMS.
We therefore undertook direct sequencing of three SMS candidate genes on samples
from patients without a detectable SMS deletion. Sequencing was performed on
exonic DNA sequence from the RAS-dexamethasone induced 1 (RASDI ) gene, the
developmentally regulated GTP-binding protein 2 (DRGZ) gene, and the retinoic acid
induced l (RAII) gene. In our investigation of these 3 genes, we found dominant
frameshift mutations in the RA]! gene in 4 of the 6 patients samples tested resulting

in two publications from the lab (Slager et al. 2003; Girirajan et al. 2005).

72

RESULTS
Mutation analysis in SMS patients without a FISH detectable deletion

As described in Chapter 3, thorough FISH analysis was performed on
metaphase chromosomes from suspected SMS patients. In six patient samples we
were unable to detect a deletion of chromosome 17p11.2. Though FISH can detect
smaller deletions than G-banding, it does have limitations. Standard FISH analysis
will not detect deletions smaller than ~40 kb. Nor will FISH detect small
chromosomal anomalies (i.e. inversions or translocations) occurring
intrachromosomally within the same sub-band, though these would be extremely rare.

The clinical description of many of our patient samples without FISH
detectable deletions strongly suggested Smith-Magenis syndrome. The patients
displayed craniofacial abnormalities, sleep disturbances and characteristics behaviors,
including onychotillomania, polyembolokoilomania, spasmodic self-hugging, and
explosive and aggressive episodes (Table 7). Because of these features, we decided
that firrther analysis of individual genes within the SMS critical region using these
patient samples was warranted.

We theorized that mutations in a gene, or genes, mapping within the SMS
critical region might cause the phenotype seen in these patients. We started this study
by systematically sequencing three candidate genes, RASDI , DRGZ, and RAII on
DNA isolated from patient SMS129 (Figure 11A). These genes were three of our
best candidates based on the initial characterization methods described in Chapter 2.
Using PCR amplification and sequencing of all exons from the RASDI, gene we

detected several previously reported SNPs, but no deleterious DNA changes were

73

 

 

B)O

SMSlZ8 SMSlZ7

 

 

 

 

 

 

 

 

C)GESVILLGPTVGTESK
AGGGGAGTC TCATCCTGCTGGGCCCI‘ACAGTGGGCA GAGTCAAA

I I“. {l . I I ll
1-. . ._.. .‘ .1 1.1-1.1411. “II “Milli/WM

Normal allele

G E S R V K G
AGGGGAGTC+GAGTCAAAGG

WW

Deleted allele -

Figure 11. SMS129 RAII mutation analysis.

A) SMS129 pictured at age19 and 30. B) Pedigree analysis of the SMSlZ9, his
parents (SMS127 and SMS128) and one sibling (SMS164). The RA13/ 14 PCR
product is present in lanes 1, 3, 5, and 7; note doublet in affected individual SM8129.
The PspOMI digestion of the RA13/l4 PCR product is shown in lanes 2, 4, 6, and 8;
note undigested mutant allele in affected individual SMS129 which is not present in
the parents or sibling. The 29 bp mutation was not detected in 102 Caucasian control
samples which were analyzed by PCR amplification and PspOMI restriction
digestion. C) The sequence tracing represents the the 29 bp deletion detected
following direct sequencing of the RA13/14 amplimer of RA]! fi'om SMS129, as well
as the wild type sequence detected on the other allele; this deletion eliminates a
PspOMI restriction site, misincorporates 8 amino acids (4 of which are shown in the
diagram) and produces a downstream stop codon.

74

found. Amplification and sequencing of the exons of the DRGZ I gene showed no
changes, polymorphic or mutagenic, from the consensus sequence available from the
human genome project. This was not a surprise as the DRGZ gene is highly
conserved through evolution as will be discussed in Chapter 5.

Interestingly, a deletion of 29 base pairs was found in exon three of the RAII
gene on one allele in individual SMSlZ9 (Slager et al. 2003). This deletion was
clearly demonstrated as two distinct bands representing the normal and deleted allele
when the PCR product was run on a 2% agarose gel (Figure 11B). Both bands were
extracted and purified from the agarose gel, cloned, and then sequenced. The
chromatograms fiom the cloned PCR products revealed one normal allele, and one
allele missing 29 base pairs (Figure 11C). This 29 base pair deletion produces a
frameshift that introduces 8 incorrect amino acids, followed by a stop codon,
truncating the protein produced by this allele (Slager et al. 2003). Bioinformatic
sequence analysis using web based programming of the deleted allele revealed the
abolishment of a PspOMI restriction site (Figure 11B). Using direct sequencing and
restriction digest analysis of DNA isolated from the parents and sibling of SMS129
(SMS127, SMS128, and SMS164) we determined that the 29 base pair deletion
occurred de novo and is not familial (Figure 11B). Though, low level and/or garnetic
mosaicism cannot be ruled out using this methodology]. The PspOMI restriction
analysis allowed for screening of 100 normal individuals (200 chromosomes) for this

deletion (Slager et al. 2003). The deletion was not detected in any of the normal

 

1 DHPLC analysis of DNA isolated fi'om blood revealed that the mother of SMSlZ9 is ~20% mosaic for the
same 29 base pair mutation. The mother is phenotypically normal.

75

chromosomes analyzed and thus, does not represent a normal polymorphism.
Haploinsufficieny of the RAN protein due to the 29 base pair deletion likely causes
the SMS phenotype seen in SM8129.

With the discovery of a dominant frameshifi mutation in SM8129, we
undertook sequencing of additional patients in whom a 17p11.2 deletion could not be
detected by FISH analysis. Dominant fiameshift mutations were found in SMS153,
SMSlS6, and SMS159. As reported by the lab in 2005, amplification of exon 3 of
the RAII gene in SMS153 (Figure 12B) shows a 19 base pair deletion beginning at
nucleotide 253 (Figure 12) (Girirajan et al. 2005). Similar to the mutation carried by
SMS129, the deleted allele of SMS153 incorporates 60 incorrect amino acids into the
RMI protein followed by a premature stop codon. The deletion was not seen in
parental DNA samples, nor in >110 normal chromosomes analyzed (Girirajan et al.
2005).

Analysis of RA]! exon 3 amplified from template DNA from SMS156 and
SMSlS9 revealed single base pair deletions causing introduction of premature stop
codons (Slager et al. 2003). In the case of SMS156 (Figure 14A, Table 7) a single
cytosine within a run of 6 C’s ending at nucleotide position 5265 of the RA]! mRNA
was deleted on one allele (Figure 14B). The 5265delC causes a frameshift on the
coding DNA strand introducing 74 incorrect amino acids before the addition of a
premature stop codon. Bioinformatic analysis of the DNA sequence indicated that
this single nucleotide deletion abolishes a Bgll restriction enzyme recognition site.
The 5265delC mutation was not found in either parent of SMS156 (SMS154 and

SM8155) or in 100 normal control samples (equal to 200 chromosomes).

76

 

 

uo AGGCAGCAAGGCCTGCAGCGGAGGCCGGCT Deletedallele

253de| 19

Figure 12. SMS153 RAII mutation analysis

A) SMS153 pictured at age 19. B) The sequence tracing represents the
the 19 bp deletion detected following direct sequencing RAII exon 3
from SMS153, as well as the wild type sequence detected on the other
allele.

Figure 13. SMS156 RAII mutation analysis.

A) SMS156 pictured at age 31. B) Pedigree analysis of the SMSlS6, her parents
(SMS154 and SMS155). The RA25/26 PCR product is present in lanes 1, 3, and 5
and the Bgll digestion of the RA25/26 PCR product is shown in lanes 2, 4, 6, and 8
(note undigested mutant band present in SMS156 which is not present in parental
samples). The 5265delC mutation was not detected in 110 Caucasian control DNA
samples which were analyzed by PCR amplification and BglI restriction digestion.
C) The sequence tracing fi'om the RA25/26 RAII amplimer reveals the 5265 delC in
exon 3 on one allele; this mutation eliminates a BglI restriction site, misincorporates
74 amino acids, eliminates a BglI restriction site, and produces a downstream stop
codon

78

 

3 E

 
 

 

 

 

mama. mam—um
was:
_ N u a u a
.22... IV
unmet
3.5..
0V Hulxl.l_.lllm|-mllwl > e _. > x Fe =e.._=e_s:o_o

 

O 7. 1 O>OOOOHO>OOOOOG>Dnfi0>nnfifinOO>>OO>GODO

GOO >>Ofififinn
>Ofiflfido>finflnnfi>fifidfi>fififififififi>>06>fififififi

 

3:33:13;

 

 

 

 

 

 

1 O P .—. > O _. a. Z 1 m I >

> >

a

mwammofln

79

Figure 14. SMSlS9 RAII mutation analysis. A) SMSlS9 pictured at age 11. B)
SMSlS9 pictured at age 19. C) The 1449delC mutation in RA]! exon 3 on one
allele is shown, which misincorporates 34 (12 of which are shown in the sequence
tracing) amino acids and produces a premature stop codon. As no known restriction
site was altered by the 1449delC mutation, amplified and sequenced the amplimer
containing the l449delC mutation from >100 Caucasian samples (including the
parents of SMSlS9), and this mutation was not detected in this population.

80

 

F -mI uoI ImI k <I PFF HIP Inl =c~.—=M~_ ”:25"

>> > a. > >
0 .000 00000fi>0 0>0000>000000 000 ~5—:d::.mu:m_¢

LLL LLL L L, L

I

 

34390—0

81

Table 7. Phenotypic comparison of SMS patients with 17p deletions and RA]! mutations

SMS HOU14 SMS SMS SMS SMS]
126 2-540 129 153 156 59
typical small
deletion deletion
Features common in >75% of SMS
Patients
Craniofacial/Skeletal

Midface

relative to
Tented

face

Short stature
abnormalities
Middle anomalies
voice

++

N
Mental retardation

Motor
Infantile
disturbance
SMS behavior
Self behavior
Features common in 50 — 75% of SMS

+ +
+ +
+ +
+ +
+ +
+ +
+ +

loss
Ocular abnormalities

Scoliosis
Features common in < 50% of SMS

Cardiovascular anomalies + -
Renal anomalies - - - - -
Seizures - - - - +
Cleft - - - - - -
Gender/Age at evaluation Female Male Male Female Female Male
41 10,14, 14 14 17, 21 13
and 16

 

82

Similar to the mutation in SMS156, DNA isolated and amplified from
SMSlS9 (Figure 14 and Table 7) showed a deletion of a cytosine in a run of 4 C’s on
one allele starting at base pair 1449 of the RA]! mRNA (Figure 14) (Slager et al.
2003). The deletion of the cytosine at base pair 1449 causes incorporation of 34
incorrect anrino acids before addition of a premature stop codon. Bioinformatic
analysis of this mutation did not reveal abolishment or addition of a restriction site.
Thus, template DNA from the family of SMSlS9 and normal control DNAs was
amplified from exon 3 of the RA]! gene and sequenced. The l449delC deletion was
not detected in the parental or control samples analyzed.

Additional dominant mutations in the RA]! gene have now been reported
from DNA isolated fi'om patients without a FISH detectable 17p11.2 (Bi et al. 2004;
Girirajan et al. 2005). The total number of SMS patients carrying dominant
mutations in the RAII gene totals 9 (Bi et al. 2004; Girirajan et al. 2005).

Though the frame shift and nonsense mutations reported have been theorized
to prematurely truncate the RAN protein (Slager et al. 2003; Bi et al. 2005; Girirajan
et al. 2005). Because SMS is also associated With microdeletion of 17p1 1.2 including
the RA]! gene, a dominant gain of function mutation in the RAII gene is unlikely.
Research reported in the last 10 years indicates that premature stop codons caused by
a frameshift or nonsense mutation may trigger decay of the mRNA before it is
translated into a protein product (Cheng and Maquat 1993; Belgrader et al. 1994).
Currently, research in the Elsea Laboratory is underway to determine whether
premature stop codons in the RAII mRN A trigger the nonsense mediated decay

pathway. It is likely that nonsense mediated decay of the mutant RAII mRNAs

83

causes haploinsufficiency of the RAN protein.

The retinoic acid induced 1 (RAII) gene

The mouse ortholog of RA]! was cloned prior to the discovery of the human
gene. In 1995 a Japanese group identified Rail, then called Gt], as a transcript that
was up-regulated in mouse embryonal carcinoma cells following treatment with
retinoic acid (Imai et a1. 1995). Mouse embryonal carcinoma cells are known to
differentiate into neuronal and glial cells when treated with retinoic acid. The
original study aimed to understand the genetic factors underlying this differentiation
(Irnai et al. 1995). RNA in situ hybridization and irnmunohistochemistry revealed
that Rail gene expression is localized throughout the adult mouse brain, specifically
in neurons (Irnai et al. 1995). The role, if any, the Rail gene plays in neuronal
development has yet to be reported.

As discussed in Chapter 2, our group mapped the human RAII gene to the
middle of the SMS critical region as the EST clone DKFZp434A139 (Figures 3, 5,
and 6) (Lucas et al. 2001). Further, using commercially available adult and fetal
tissue northern blots we determined that the RAII gene is expressed as an ~8.0 kb
transcript in all tissues examined (Figure 6). Upon publication of these data in 2001
(Lucas et al. 2001), we were unable to determine any possible cellular role for the
RA]! gene due to lack of any homology of our EST to known proteins.

Further complicating analysis of the gene was the number of different EST 8
deposited into the databases that were thought to represent the RAII/Rail genes. In

2003, the major human RAII transcript was cloned fiom SKN SH neuroblastoma cells

84

treated with retinoic acid, the sequence was deposited as GenBank accession
AY172136 (Toulouse et a1. 2003). This group identified both the 5' and 3' UTR
sequences, as well as the presence of an upstream CpG island and a putative retinoic
acid response element immediately upstream of exon 1 (Toulouse et al. 2003). The
mouse Rail gene is represented by Genbank accession AY5481752. Bioinformatic
analysis indicates that both mouse and human sequences contain a bibartite nuclear
localization signal, a polyglutarnine tract, a polyserine tract, and a conserved extended
PHD domain at the carboxy end of the amino acid sequence (Girirajan et al. 2005).

In depth bioinformatic analyses were performed in the lab by fellow graduate
student Santhosh Girirajan on the human and mouse RAIl/Rail protein sequences.
The human and mouse sequences are well conserved with 84% identity and 89%
similarity. It was determined that the polyserine tracts seen in these proteins are
similar to the human DRPLA and Drosophila hairless gene. Consistent with the
original RAII /Rai1 cloning experiments, both DRPLA and hairless are reported to
play a role in neuronal development (Maier et al. 1992; Onodera et al. 1995; Seranski
et al. 2001; Girirajan et al. 2005). Additionally, polyserine and polygutarnine
stretches are known to modulate transcriptional activation (Gerber et al. 1994). The
extended PHD domain in the carboxy terminal of the protein is similar to that seen in
the trithorax nuclear proteins. In Drosophila these proteins maintain stable
expression of homebox-like genes (Paro 1993; Aasland et al. 1995). The PHD-finger
domains likely bind zinc ions and act similarly to Zn-RING finger containing proteins
(Aasland et al. 1995). Currently, no evidence has been reported on the binding of

RAIl/Rail to DNA, RNA, or other proteins. The only other protein sharing

85

homology to RAIl/Rail is the human ARI gene also known as transcription factor 20,
or TCF20 (Seranski et al. 2001; Girirajan et al. 2005).

The protein homology of RAIl/Rail indicates that the gene is involved in
transcription at some level, either as a bonefide transcription factor or a
transcriptional co-activator. No reports of the in viva function of the RAH/Rail gene
currently exist. Members of the lab have shown that a GFP-Rail fusion protein is
localized within the nucleus. Further study of the RAH/Rail genes will help

understand their role in mammalian development and in expression of the SMS

phenotype.

SUMMARY

The discovery of 9 dominant RAII mutations together with data analyzed
from heterozygous krrock-out of mouse Rail (Bi et al. 2005) indicate that
haploinsufficiency of the RAII gene is the cause of the craniofacial, neurological,
otolaryngological, and behavioral characteristics seen in SMS. Additional in depth
studies are underway to better understand the cellular and biochemical role of the
RAII gene.

Currently, we postulate that other genes in the region may play a role in the
more variable characteristics seen in SMS patients with l7p11.2 deletions, including
cleft lip/palate, and visceral anomalies including the kidney and heart. Due to the
fiequency of hearing loss in SMS patients we also believe that additional genes
affecting hearing may map to the SMS critical region. We are continuing to study the
role that additional genes mapping within the SMS critical region play toward

expression of the SMS phenotype.
86

MATERIALS AND METHODS

Patient ascertainment: SMS129, SMS156, and SMSlS9 were evaluated by Brenda
Finucane, CGC at the Elwyn Inc. (formerly Elwyn Institute). Clinical data for
SMS153 were collected by Dr. Sarah H. Elsea, Ph.D. via contact with the patient’s
health care provider, and through our in house questionnaire (Appendix A). All
clinical data and samples were collected in accordance with Institutional Review
Boards at Elwyn Inc., Michigan State University (MSU), and Virginia

Commonwealth University 0! CU).

Clinical description ofSMS129, SMS153, SMS156, and SMS159:

SMS129: SMS129 is a 30-year-old male who was admitted to residential placement
at age 14 because of aggressive and disruptive behaviors which could no longer be
managed at home. He was the product of an uncomplicated full term pregnancy,
weighing 7 lbs.,1 oz. Motor milestones were normal, with no history of hypotonia,
but speech development was significantly delayed. From an early age he exhibited
aggressive and self-injurious behaviors, including onychotillomania and
polyembolokoilarnarria, as well as sleep disturbance, and frequent self-hugging. He is
obese and has spina bifida occulta. His behavior is currently stable, although he
continues to require residential placement and psychotropic medications because of
aggression. Results of fragile X and chromosome analyses at age 14 were normal.
At ages 21 and 30, he was reevaluated in the genetics clinic and felt to have many
behavioral and physical characteristics of SMS. A repeat cytogenetic study (650

band resolution) was normal, as were results of chromosome analysis on skin

87

fibroblasts and FISH for del(17)(p1 1.2).

_S_l\_/1_$l_53: SMS153 is a l9-year-old obese, white female. Pregnancy was normal,
though delivery was by emergency cesarean section because of failure to progress and
a decreased fetal heart rate upon inducing contractions. SMS153 was diagnosed in
the operating room with Down syndrome because of floppy muscle tone, upslanting
palpebral fissures, midface hypoplasia and presence of a simian crease. Laboratory
studies performed were negative for Down syndrome.

Motor and speech were significantly delayed. When she did begin speaking
her voice was noted as hoarse. Her facial features are consistent with the SMS
phenotype and include brachycephaly, tented upper lip, and broad square face.
SMS153 suffers hour the self-injurious behaviors commonly seen in SMS patients.
These have been particularly difficult on the family. SMS153 also suffers from the
characteristic SMS sleep disturbance.

SMS156: SMSlS6 is a 31-year-old obese, white female. Pregnancy and delivery
were normal; birth weight was 8 lbs. Motor milestones were achieved on time, and
there was no history of hypotonia. Speech development was mildly delayed
compared to that of her siblings. The patient has a history of mild mental retardation
and emotional disturbance, including aggressive and defiant behaviors, which
prompted residential placement during adolescence. She had self-injurious behaviors,
including onychotillomania and polyembolokoilamania, as well as significant sleep
disturbance. Her behavior improved in the residential setting, and she was able to
return home to live with her parents at age 21. On reevaluation at age 31, her

behaviors had stabilized, and she required no psychotropic medications. She

88

continues to exhibit skin and nail picking, and when excited, the self-hugging
stereotypy typical of people with SMS. She also has a persistent habit of inserting
string into her nose. Her facial features are subtly similar to those seen in patients
with a l7p11.2 cytogenetic deletion. Chromosome and fragile X analyses at age 17
were normal, as were results of subsequent FISH studies for deletion 17p11.2.

$148122: SMSlS9 is a 19-year-old male patient who has a history of mild mental
retardation, self-injury, and aggressive behaviors which resulted in residential
placement at age 13. Pregnancy and delivery were uncomplicated; birth weight was 8
lbs.1 oz. A functional heart murmur was detected in childhood and later resolved.
Motor milestones were significantly delayed (walked at 21 months) due to infantile
hypotonia. Speech developed within normal limits. Since early childhood, the
patient has exhibited self-hugging behavior when excited. Macrocephaly was noted
in infancy, and MRI studies of his head and spine at age 11 revealed mild
hydrocephalus, Amold-Chiari malformation, and spina bifida occulta. On physical
exam at age 13, he was obese and had facial features suggestive of SMS. The patient
also had gynecomastia and hypogonadism. Results of fragile X and cytogenetic
studies were normal, including FISH analysis for deletion l7p11.2. At age 19, the
patient lived at home and received homebound school services. He suffers from
recurrent, debilitating syncopal episodes likely related to his Amold-Chiari
malformation. These episodes were temporarily alleviated by brainstem
decompression surgery at age 15 but have gradually increased since then. The patient
continues to present behavioral problems, including onychotillomania, which are

treated with psychotropic medications. Polyembolokoilarnania has not occurred for

89

several years.

Fluorescent in situ hybridization (FISH): FISH on patient chromosomes without

detectable l7p11.2 deletions was performed as described in Chapter 3.

Isolation of patient genomic DNA: In order to isolate template suitable for PCR
amplification, DNA was isolated from peripheral blood or buccal cells fiom all

putative SMS patients, parental and sibling controls, and Caucasian control samples.

DNA isolation from whole blood: Approximately 15-50 ml of whole blood was
collected and centrifuged at 2500 RPM plasma was removed, and the remaining cells
were mixed with “red blood cell lysis solution A” (0.32 M sucrose, 10 mM Tris, pH
7.5, 5 mM MgCl2 and 1% Triton X-100) and placed on ice for 30 minutes. The
mixture was then centrifuged at 2500 RPM, the supernatant was removed, and 50 ml
of solution A were added to the pellet. This solution was placed on ice for 20
minutes, centrifuged as above, and the supernatant was removed. The pellet was
resuspended in 5 ml of solution B (10 mM Tris, pH 7.5, 400 mM NaCl, and 2 mM
EDTA, pH 8) and digested overnight at 37°C with the addition of 100 pl of 20% SDS
and 50 pl of 20 mg/ml proteinase K solution. The following day, 3 ml of saturated
phenol pH 8.0 were added to the solution while rocking, and then the samples were
centrifuged at 2500 RPM for 15 minutes. The upper phase was removed with a
Pasteur pipet and transferred to a new 15 ml polypropylene tube and 3 ml of

chloroform:isoamy1 alcohol (24: 1) were added to the aqueous phase with rocking for

90

15 minutes. Following another centrifugation at 2500 rpm, the DNA upper phase was
removed and the DNA was precipitated with 2 volumes of 95% ethanol. The DNA
was removed with a Pasteur pipet and allowed to sit 70% ethanol for 5 minutes, then

placed in 200 pl of 1x TE, pH 7.5.

DNA isolation from buccal cells: Genomic DNA was isolated fi‘om buccal cells by
boiling the cheek brushes in 400 pl of 50 mM NaOH at 95°C for 10 minutes. The
brush was then discarded and the sample was placed on ice for 10 minutes. This

solution was neutralized with 40 pl of l M Tris, pH 8.0.

RAIl PCR amplification and sequencing reactions: Analysis of RAII in patient and
control DNA was performed by PCR and subsequent sequencing and analysis of PCR
products was performed by Rebecca Slager in the Elsea Lab. PCR primers covering
the entire RAII coding sequence, 5’ and 3’ untranslated regions (UTR), and
alternative splice variants were generously provided by Dr. Laura Schmidt of NCI-
Frederick or were designed by this laboratory and synthesized at the Michigan State
University Macromolecular Structure Sequencing and Synthesis Facility. PCR was
performed in a 25 pL volume with 50-200 ng DNA template as described in Chapter
2. Informative primer sequences and conditions are indicated in Appendix B.

In order to check each PCR amplification 5 pL of the reaction was
electrophoresed in 2% agarose gels containing ethidium bromide. Successful
reactions were then purified using the Qiagen Gel Extraction Kit according to
manufacturer’s instructions, or treated enzymatically in the following manner: 2 pL

of USB shrimp alkaline phosphatase (1 units/pL) and 1 pL USB exonuclease I (10
91

units/pL) were added to 5 pL of PCR amplification mixture, the solution was mixed
and incubated at 37°C for 15 minutes in a thennocycler, and then inactivated at 80°C
for 15 minutes. A sequencing reaction containing at least 10-40 ng of purified PCR
product template in distilled water and 30 pmol of sequencing primer (the forward or
reverse PCR primer or an internal primer) was then prepared and sequencing was
conducted at the Michigan State University Genomics Technology Support Facility or
the Virginia Commonwealth University Nucleic Acid Research Facility using an ABI

PRISM® 3100 Genetic Analyzer or ABI PRISM® 3730xl DNA Analyzer.

Sequence analysis: PCR amplified RAIII fragments were analyzed for mutation by
pairwise BLAST analysis at NCBI (http:/lwww.ncbi.n1m.nih.gov/BLAST) against the
published GenBank sequence for the RAII mRNA (GenBank Accession: AJ271790
and AY172136) and the genomic sequence data from the RAII locus (GenBank
Accession: AJ271791 and NT_010718). SNP databases at NCBI
(http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=snp) were also queried in order to
identify polymorphic DNA changes. Sequencing chromatograms were also
thoroughly visually inspected in order to identify sequence anomalies missed in the

automated sequence analysis.

Restriction enzyme analysis of RAIl mutations: The 29 base pair deletion detected in
SMS129 abolishes a PspOMI restriction site. Parental and 100 normal control DNA
samples were tested for this deletion via restriction analysis. PspOMI digestion of the

amplimer from primer pair RA13/14 (Appendix B) normally cleaves the 493 base

92

pair product into 361 base pair and 132 base pair fragments. PspOMI does not cleave
the allele with the 29 base pair deletion. PCR products were digested for 2 hours at
37°C with 1-2 U of PspOMI, then resolved on a 2% agarose gel in 1x TBE buffer
containing ethidium bromide. Agarose gels were photographed on an AlphaImager
using software version 5.5.

The 5265delC mutation detected in SMSlS6 abolishes a Bgll restriction site.
Parental and 100 normal control DNA samples were tested for this deletion via
restriction analysis. Bgll digestion of the amplimer fiom primer pair RA25/26
(Appendix B) normally cleaves the 496 base pair product into 171 base pair and 325
base pair fragments. Bgll does not cleave the 5265delC allele. PCR products were
digested for 2 hours at 37°C with 4-5 U of Bgll, then resolved on a 2% agarose gel in
1x TBE buffer containing ethidium bromide. Agarose gels were photographed on an
AlphaImager using software version 5.5. Restriction analysis was performed by

Rebecca Slager in the Elsea Lab.

Analysis of control samples: Analysis normal control samples for mutations that
could not be resolved with restriction analysis were directly sequenced and analyzed

as described in the methods above.

93

Chapter V

Developmentally regulated GTP-binding protein 2 (DRGZ)

BACKGROUND

Guanine triphosphate hydrolases (also known as GTPases or G-proteins)
make up a superfarnily of proteins that act as regulatory molecules. The GTPases are
known as molecular switches because they are activated while they are bound to GTP
and switched off upon hydrolysis of the GTP to GDP. This group of proteins is
expansive and is made up of three well-known sub-families; the monomeric GTP-
binding protein Ras and its homologs, bacterial translation elongation factors, and the
heterotrimeric G proteins (Bourne et al. 1991).

All G-proteins work in the same mechanistic manner even though the primary
structures are extremely divergent. The proteins maintain their fimction in the
absence of long stretches of homology through conservation of four distinct domains
that allow for conserved folding of the GTP binding core. The differences in primary
structure allow for the extreme diversity seen in overall protein firnction, while
conservation of the short GTP binding domains create the very well conserved
secondary structure necessary for GTP binding and hydrolysis.

As additional expressed sequences became available additional sub-fanrilies
of GTPases were described. One such family includes the developmentally regulated
GTP-binding proteins (DRG) proteins. The DRG proteins retain the G1-G4 binding

motifs necessary for GTP-binding, though they do not share similarity to any of the

94

well-known GTPase sub-families. One member of the DRG family maps within the
SMS critical region on chromosome 17 (Schenker and Trueb 1997; Vlangos et al.
2000). The map location of the developmentally regulated GTP-binding protein 2
(DRGZ) gene and limited information about its possible role in development, made it
one of our best SMS candidate genes. In addition to fine mapping of the gene, we
undertook characterization of DRGZ through expression patterning at the RNA and

protein levels.

Cloning and identification of mammalian DRG genes

In 1992 a subtractive cloning approach was used to identify genes that are
expressed at high levels in developing and differentiating mouse brain when
compared to adult brain. This approach identified many potential transcripts
including the Nedd3 gene (neural precursor cell expressed, developmentally
downregulated-3) (Kumar et al. 1992). Identification and characterization of a longer
cloned sequence for Nedd3 showed that it contained short regions of homology to
Drosophila and Halabacterium sequences deposited in public databases. Early
bioinformatic analysis of the three related sequences revealed that they all shared
domains of GTP-binding. In vitro analysis of the Nedd3 protein showed its ability to
bind GTP. Based on the results fi‘om the in vitra GTP-binding assay and the
subtractive cloning method enriching for developmental genes used in its original
identification the Nedd3 gene was assigned the name developmentally regulated
GTP-binding protein (Sazuka et al. 1992b).

The putative human homolog of Drg was also identified by subtractive cDNA

95

cloning where it was shown to be expressed in human fibroblasts but repressed in
virally transformed cells (Schenker et al. 1994). Using FISH techniques, the human
gene was mapped to chromosome l7p12 -)13 (Schenker and Trueb 1997). Searches
of DNA databases revealed that there were at least 2 DRG genes in humans, DRGI
and DRGZ. In 2000 we reported that the human gene identified by Schenker et al is
actually DRGZ, while original murine Drg gene is actually homologous to human

DRGI (V langos et al. 2000).

RATION ALE

Our lab mapped the DRG2 gene to chromosome 17p11.2 within the SMS
critical region. In order to begin to understand the function of DRGZ and any role it
might play in SMS, we looked at RNA expression patterns of the gene in adult and
developing human and developing mouse. We employed irnmunohistochemistry
techniques to determine spatial and temporal expression through mouse development.
At the cellular level, localization of the protein was performed using green
fluorescent protein technique. The data presented in this chapter are currently being

drafted into a manuscript for publication.

96

RESULTS
Identification of the STS WI-l3499 as DRGZ and mapping to the SMS critical
region

In order to clarify the map location and identification of DRGZ to
chromosome 17p11.2, we used the sequence tagged site (STS) WI-l3499. We and
others previously mapped STS WI-13499 to chromosome 17p11.2 (Elsea et al. 1997;
Liang et al. 1999). Subsequent BLAST searched and Unigene analysis of the
published WI-13499 sequence indicated 94% identity to the DRGZ gene. The STS
WI-13499 was created from the I.M.A.G.E. cDNA clone 29328. Analysis of the
DNA sequence of clone 29328 revealed that it bore 99% identity to DRGZ. Lower
identity of the DRGZ sequence to WI-l3499 was likely due to one-pass sequencing
errors. To ensure that we were truly looking at a single-copy gene and that clone
29328 (WI-13499) and the reported DRGZ sequences were representative of the same
gene, we fully sequenced clone 29328 and the PCR product WI—13499 and aligned
them to the reported DRGZ sequences from GenBank. The results indicate that the
sequences are truly identical and representative of the same locus.

DRG2 was originally mapped to chromosome 17p13 -) p12 by FISH
(Schenker and Trueb 1997). Experiments using Southern analysis (Figure 15) and
PCR mapping with somatic cell hybrids retaining portions of chromosome 17 indicate
that DRGZ maps more proximally on chromosome 17, to band 11.2 and the SMS
critical region. In order to confirm our mapping data, we obtained a 1,300 base pair

DRGZ clone from Dr. B. Trueb (originally reported in Schenker ant Trueb, 1997) and

97

17p

13.3
13.2

13.1 I

12
11.2

 

 

 

 

 

 

MH22-6 —

255-110 — —

‘ 485-3D _

540-1D — —

357-2D _ —
—

 

c b
a: “9
E m ‘é’é’i—
: a “O
:: oo :23
Kb
Q0. a»
E! ‘t 12
3:3“? ' _/11
-10
,. —9
##“II‘ -8
' —7
“L It» -6
O
-5

 

 

 

Figure 15. Somatic cell mapping of DRGZ.

EcoRI digests of humanm rodent, and hybrid genomic DNAs is shown. The entire
~l.9 kb insert from IMAGE clone 29328 was PCR amplified and used as a probe.
Bars above the blot indicate relative regions of chromosome 17 deleted in human and
hybrid DNAs. Arrows to the left indicate chromosome 17 specific genomic bands.

98

obtained the same mapping results using the somatic cell hybrid mapping panel.
These data confirmed that DRGZ maps within the SMS critical region (V langos et al.

2000).

Bioinformatic analysis of DRGZ

By direct sequencing we determined that clone 29328 contained an EST insert
of 1,917 base pairs. Our southern analysis showed that the DRGZ gene likely spans a
minimum genomic region of 32 kb (V langos et al. 2000). Alignment of the cloned
EST sequence to the latest version of the human genome sequence shows that DRGZ
is composed of 13 coding exons spanning 20 kb of DNA. A potential ATG start site
begins at base number 76 and fits the Kozak consensus sequence of ACCATGG
(Kozak 1986). Six-frame translation of the DNA sequence showed an open reading
frame resulting in a product of 364 amino acids. This protein has an estimated
molecular weight of 40.5 kDa. Four conserved GTP binding domains remain intact
in the DRGZ protein (Figure 16). The G1 domain is unique to this subfamily of G-
proteins and has been termed OBG/GTPI based on the orthologous B.subtilis and S.
pombe genes.

Alignment of DRG2 amino acid sequences reveals striking homology through
evolution (Figure 16). The human sequence is 98.6% identical to the mouse
sequence, 93.9% identical to the Xenopus, 80.5% identical to Drosophila sequence,
and 65.9% identical to the fission yeast sequence. Though the DRGZ sequences are
well conserved through evolution, DRG] and DRGZ only share 57% identity at the

amino acid level. It is interesting that human DRG2 is more similar to the fission

99

HS DRGZ

.4 ..
._ . ._3 ..-..

 

1 ...I‘:'...‘" 515:." '.: .-, :‘
Mm Dr92 1 '.LE1-3111‘1'1‘T £1.11; 1::II1 11E1'111. (3.:11.1 911:1 £r1~21011hp
X1 Dr92 1 1L1:.1:ISE1E.1‘:1..-:1"1')111Ti‘311'.3'J1..1_.1‘”:11':13n1:LPQQLLEPof “‘1‘1KJEKJ1‘D 1111
Dm DRG2 1 -E1IgEILRLI bTHrI1AT1IMLG131~1L11YR§QL1LF {Kr-E1b01FDVLx
Sp GTPl 1 .. -«:. III'“I' 13G; '
H8 DRGZ 'i'..EI7.33.1.1.31‘1'3Yi3KL}1EI'I..L71.1-'.1:117..‘7':‘:.»';~.i7'-'13 FITLlCIPK‘: .711'3'1'1'1313311C21313D1.1I"~3i-
MN Drgz 31 F‘HLIDFP)‘UF3TELQLHI TH)HM%SLEFIILrCIPD IE"KGANIQLLDLPC1L
X1 Drgz 5UMRV :£LIGFPS I‘C:1.3TFISLIIT TnSEsnLIEFTTIICIPGVIEI1GANIQLLDLPG-.
Dm DRGZ '6 - ' g. : MAIIQLLDLF.1
sp GTPl .. - - .-._ :. I~.‘ - .. ' ‘ :1 .

 

. .v‘..‘,. .. ....-..... .-...,, .. . ..... ,... .....-....,
8 . .. i~', ,w- .n f .. .. . .. . ‘. . ~- . . ~~ .. r—g J .
...._7-.. ..- . -.'*‘- ... .... ‘ ........... 3 . .. . . .. . 1.. ..., ..-.-......

Mm DrgZ inAQGE-GRGRQVIAL'AP: I‘AUVV Evil-21.3.3.1 Egg. (2 11.2131. E E1. 1381131 R1 IIKflK’ r [I 1 . ;'
x1 Drgz vNAflQGKGRGRQVIA”ARTiDVV MMI.DAIKG ’ORSLI.EI LL3\LIVLN1EAPUI.r
Dm DRGZ " 3.:‘1AQGKG1'JL31‘30‘JIA r1I1'TAD . :1 (811 .E 151.135" (JIPIJ‘JKéI‘ [)1 J11

 

Sp GTPl v 3:7. ,‘C‘ -. ‘, - " ‘ 1 .3 "7 .1 713111.11" QPE‘II

H8 DRG2 71.13? ’,".“IEI.'~'.I,‘.':;I.'. . .Ei'r '-.":~'. IT. "
Mm Drgz z'I 313GIS1II: - ' ‘“ I Z .‘-.'QI311311'E;'£K1113AE I31 rLDCfiI‘DEFID "1. 1311111.

X1 DrgZ ‘ .1113 3 ’3 1 31.. 1.'I‘OC;31~31‘CI.‘~.'Q.. 11.11171 'KaE-‘II “131' 1. F REDCTPDEFI D‘.’ "JGIJR" 1.
Dm DRG2 :/:"1‘ _. . ITuaKIFI; A13 LWHJFTEUEFHN.

Sp GTPl "I? , fi~ " . r . .-. ~ ... ~

H8 DRG2 ., . -... , .-.U- .. . .
Mm Drgz -L.V.NKIDQ1.d‘LVDkIAPK1U3.‘lbLUHRIULDILLEH.‘1 LALICIITKKI
x1 Drgz
Dm DRGZ
Sp GTPl

 

Ha DRGZ .e 3g:1::v: I“ - . H ._- . “v:~ . . -
Mm Drgz AF DflrrLIIGa..1a (METHRILfiuQFYYAL“‘b rr.er .
x1 Drgz Icy DAIIIPI x mm (IFIHRTLaquP..LI QISIRLSPOR
Dm DRG2 . :ng 11131 by . C1n111 RTL.‘ A311 1 .11.? .\31L 11314.11:
Sp GTPl Si"TV SIR "”' i"‘ 12.-I’u7rc ” ‘3"7'

Ha DRG2
Mm Drgz
X1 Drgz
Dm DRG2
Sp GTPl

 

Figure 16. Alignment of DRGZ amino acid sequences. Amino acid sequences
from human DRG2 (Hs DRGZ), mouse DRGZ (Mm DRG2), Xenopus (X1 Drg2),
Drosophila DRG2 (Dm DRG2), and fission yeast gtpl (Sp gtpl) were obtained and
aligned using the CLUSTALW 1.8 program at the Baylor College of Medicine
Search Launcher web site (http://searchlauncher.bcm.tmc.edu). The black shading
indicates identical amino acids, the grey shading indicates similar amino acids, the
white shading indicates differing amino acids. The star indicates stop codon, and the
- indicates a gap in alignment. Afier alignment, the figure was created using the
BOXSHADE program (http://http://www.ch.embnet.org/sofiware/BOX_form.html).

100

yeast DRG2 than to the human DRGl sequence.

Previously published phylogenetic analysis of the DRG sequences available in
2000 revealed that 2 genes seen in higher organisms likely evolved fi'om a gene
duplication event (Li and Trueb 2000). Only a single DRG gene is present in
bacteria. These data reveal that the DRGZ proteins are more similar to the DRG gene

seen in bacteria and that the DRG] proteins are likely the result of gene duplication.

Expression levels of DRGZ/DrgZ using northern analysis

Since DRGZ is thought to be developmentally regulated, we characterized
both human and mouse DRGZ/DrgZ using northern analysis on adult and fetal tissues.
Northern analysis of human tissues on a commercially available blot showed an ~2.2
kb transcript in all adult and fetal tissues represented (Figure 17A and 17B).
Expression was not significantly elevated in any human tissue analyzed. Rather, the
gene seems to be expressed at fairly equal levels in all tissues represented on the
northern blots. Electronic expression profiling of human samples using the Unigene
database at NCBI currently shows highest levels of Drg2 expression in cervix and
small intestine.

In order to characterize the expression pattern of Drg2 in the developing
mouse, we utilized a northern blot representing embryonic day 5.5 to day 18.5. The
blot does not contain RNA fiom maternal or placental tissues. Using a full-length
EST clone for Drg2 as a probe a ~2.0 kb transcript representing Drg2 expression was
seen in all developmental days at a consistent level (Figure 17C). The blot did not

reveal any drastic peaks or depression in gene expression during development. This

101

is in contrast to reports of mouse Drg] where there was a significant decline in gene
expression starting afier embryonic day 10 (Sazuka et al. 1992a). Electronic
expression profiling of mouse Drg2 indicate expression in all tissues examined and at
all developmental stages. Our studies, thus far, do not indicate that DRG2/Drg2 is

developmentally regulated at the RNA level.

Spatial and temporal expression of Drg2 using immunohistochemistry

In order to understand the expression pattern of the Drg2 protein in the
developing mouse embryo we undertook irnmunohistochemistry (II-1C) experiments
on sectioned C57Bl/6J embryos. The IHC experiments were performed using a
polyclonal antibody designed to an 11 amino acid sequence near the carboxy end of
the DRGZ protein (Figure 16). The sequence of DRGZ was extensively analyzed in
the design of the peptide used to create the antibody. The sequence was run through
computer programs generating a hydropathy plot showing regions of hydrophilic
amino acids most likely to reside on the outside of the folded protein. BLAST
analysis of all deposited amino acid sequences revealed no known homology to any
other proteins (known or predicted) except DRG2. The 11 amino acid sequence does
not occur in the DRG] protein. The antibody produced by this peptide is recognized
in mouse Drg2, Xenopus drg2, and Drosophila DRGZ allowing for experimental use
in multiple organisms. The peptide was injected into two rabbits for polyclonal

antibody production.

102

 

 
 
  

 

 

 

 

 

A) 2 B)
U
‘2 33$ .. a
a ‘- OD
“win Eggs
mm 5.415QO an .4 .452
T" 3 , “E
2.4— '
C
H 1.35
1.35_ : DRGZ
DRGZ
2.4a8 C." I.‘ 2.4
1.35— " 1.35 .
B—Actin B—Actm
C) In try try us II} In no In In
W ‘n ‘n. V1“ 6 -« Nviv vi \0' [‘06
W \O l\ 00 ON .— v-I r—I v—l '- —a —c —I —t
LL] Lil-l [L] m LL} LL] m LL} LL] LU LU LL] LL] LL]

 

 

 

Figure 17. Northern analysis of DRGZ/DrgZ.

A) Human DRGZexpression analysis is seen throughout all tissues in this Clontech
adult multiple tissue northern blot. B) Human DRGZ is seen in all tissues present in
this fetal Clontech multple tissue blot. C) A consistent expression of an ~1.7 kb
transcript throughout mouse development is visualized. Northern analysis was
performed on a mouse embryonic blot purchased from SeeGene USA (Rockville,
MD). IMAGE clone 4910172 representing mouse Drg2 was used as a probe. B-actin
was used as a loading control.

103

ELISA analysis of the polyclonal antisera showed that the antibody could
detect the DRG2 peptide at 1:100,000 dilution. The polyclonal antiserum from rabbit
8139 was further tested in order to determine whether or not it had the ability to
recognize the mouse Drg2 protein. The mouse Drg2 gene was cloned into a vector
containing a cytomegalovirus (CMV) promoter. The plasmid was transfected into
COS-7 cells allowing for Drg2 expression from the CMV promoter. Lysate from
cells transfected with varying amounts of DNA was used to create a western blot.
The DRGZ polyclonal antiserum from rabbit 8139 was used to detect the Drg2
protein expressed in the transfected cells. The western analysis revealed an ~40 kDa
band of varying intensity which correlated directly with the amount of EST DNA
transfected into the COS—7 cells (Figure 18). The Drg2 banding pattern was not
detected in untransfected cells. These data show that the antiserum has the ability to
detect the proper epitope.

Sectioned mouse embryos representing embryonic day 8 though birth were
examined via IHC to determine the spatial expression pattern of the Drg2 gene
through development. Gestation in the mouse is a fairly rapid process lasting ~21
days. Dissection of embryos prior to day 8 was not attempted due to the small size of
the embryo. At embryonic day 8 Drg2 is highly expressed within the neural tube,
migrating neural crest, and somites (Figure 19A), while low level staining is present

throughout the rest of the embryonic section.

104

 

bowel) cocoon
60211100111
iooo 100::
Eomwxoomwxo
kDaE, , { 1..
191-
97 f
64 -~
51 —' S
i _ (fl 2-..... 40.7 kDa
39" M
l

28f

Figure 18. Transfection of Drg2 into COS-7 cells.

COS-7 cells were transfected with the full length Drg2 sequence under control of the
CMV promoter. Cell lysate from tranfected cells was run on a western blot and
analyzed with a polyclonal antibody created to the Drg2 protein. A 40.7 kDa band is
seen in transfected cells. The band intensity correlates directly with the amount of
DNA added to the cells. The amount of DNA input into the cells is indicated at the

top of the figure.

105

Figure 19. Protein expression of Drg2 during mouse development.

A) An 8.5 day mouse embryo transverse sectioned is stained with anti-Drg2.
Expression is seen throughout the embryo, and is highest in the neural tube and neural
crest. C) A 10 day sagital section shows Drg2 expression throughout the embryo
with highest expression in the developing brain and neural tube. E) and G) A day 12
and day 14 embryo respectively stained with Drg2 antibody showing expression in
the developing nervous system. I) and K) show a 16 day and 19 day mouse embryo
respectively and show expression in the neural tissue and spinal ganglia. B D, F, H,
J, and L) Show corresponding pre-immune serum controls for respective embryos.

106

 

 

 

 

 

 

 

 

 

 

 

 

 

 

107

 

 

 

 

 

 

 

 

 

 

 

 

108

 

 

 

 

 

 

By embryonic day 10, the most impressive development has occurred in the
embryonic brain. The optic vesicle is beginning its transformation into the optic cup.
Expression at this time is seen throughout the embryo with higher expression in the
optic stalk, forebrain, hindbrain, and neural tube (Figure 19C). Between
developmental day 10 and 12 significant maturing has occurred in the mouse embryo.
The heart, vascular system, digestive system, and external features are more clearly
defined. Drg2 expression at embryonic day 12 is clearly seen in the developing
spinal cord, optic recess, and the developing brain (Figure 19E). At developmental
days 14 and 15 the most drastic changes are in the skeletal system where the pre-
cartilage has developed into mature cartilage. Additionally, the heart has continued to
develop, and the components have reached their post-natal configuration. Drg2
expression at day 14 is very clear in the developing neural tissues of the entire brain
and spinal cord. Additionally, expression is seen in the cervico-thoracic ganglia
(Figure 196). The expression in these ganglia mirrors the reported expression of
Drg] in day 14 embryos as measured by RNA in situ hybridization (Sazuka et al.
1992a) Expression of Drg2 at day 15 is seen diffusely throughout the developing
mouse, with higher expression still being seen in the developing brain and neural
tissues (Figure 191). At embryonic day 20, Drg2 expression is seen diffusely
throughout the entire developing animal. In Figure 19K slightly higher expression
can still be noted in the brain and spinal ganglia.

Analysis of the RNA expression patterns of Drg2 in the developing mouse did
not reveal developmental regulation as reported with Drg]. As with the RNA

expression, analysis of the spatial and temporal expression of the gene using IHC also

109

reveals expression at all developmental stages evaluated. Greater expression was
noted in the developing neural tissue throughout development. These results are
similar to those reported for Drg] expression as reported using RNA in situ
experiments. Both human DRG homologs may play an interesting role in neural

development.

Cellular localization of Drg2

The spatial and temporal expression patterns of Drg2 revealed in the
developing mouse embryo show that the gene is expressed throughout development,
especially in developing neural tissue. In order to further understand the biochemical
role of the Drg2 gene, we used green fluorescent protein (GFP) techniques to evaluate
the spatial expression of the gene at the cellular level.

The Drg2 gene was cloned into a vector containing the sequence of the GFP
gene. Cloning was performed such that the Drg2 gene was cloned directionally and
in frame with the GFP gene. Expression of the GFP-Drg2 fusion protein was
performed by transfection of COS-7 cells. Examination of cells transfected with the
GFP-Drg2 fusion protein revealed localization to the endoplasmic reticulum (ER)
and/or Golgi apparatus (Figure 20).

Transfection of COS-7 cells was repeated in order to verify the cellular
localization with ER and Golgi control stains. After transfection but before
visualization, cells were treated with a dye that localizes to. the ER and fluoresces a
blue-white color under a long-pass DAPI filter. Ceramide stain localizing to the

Golgi apparatus fluoresces red under a rhodamine or Texas red filter. The two

110

control stains co-localize with the GFP-Drg2 fusion protein indicating that Drg2
likely functions in the ER and Golgi apparatus.

The best studied GTPases associated with the Golgi apparatus and the ER are
the ADP-ribosylation factor (ARF) genes and the (Rab) genes. ARF activity has been
shown to regulate intracellular vesicular membrane trafficking and stimulate a
phospholipase D isoform. Phospholipase D may be involved in cell morphology
alterations through intracellular protein trafficking (Hammond et al. 1997).
Homozygous mutations in a homologous ARF like gene have been shown to be one
possible cause of Bardet-Biedl syndrome type 3 (Fan et al. 2004).

The Rab proteins regulate vesicular transport in endocytosis and exocytosis.
They are small GTPases that are distantly related to the Ras proteins. The role of the
Rab proteins seems to be as a regulator of the sequential events that must occur for
proper vesicular transport (Rodman and Wadinger-Ness 2000). Rab genes have been
associated with Griscelli syndrome which manifests with immunological anomalies
and partial albinism. Recently, it has been suggested that Rab genes may be one of
the many causes of Batten disease (Luiro et al. 2004). These genes are also currently
being investigated as the cause of many cancers (Cheng et al. 2005). Many additional
GTPases including Rabs, ARFs, and DRGs (and their associated proteins) are being

investigated for roles in human genetic diseases.

111

Figure 20. Cellular localization of Drg2.

COS-7 monkey fibroblast cells were transfected with a Drg2-pcDNADEST47
construct, allowing expression of a Drg2-GFP fusion protein. Cells were treated with
Bodipy TR Ceramide and ER-Tracker Blue-White to stain the golgi apparatus and
endoplasmic reticulum, respectively. A) Drg2-GP P fluorescence is visualized under a
FITC filter, B) ER fluorescence under a DAPI filter and C) Golgi fluorescence under
a rhodamine filter, D) A merged image of the DAPI and rhodamine filter showing
colocalization of the ER and Golgi, and E) A merged image of the DAPI, FIT C, and
rhodamie filters showing co-loclaization of Drg2-GFP to the ER and Golgi.

112

 

113

SUMMARY

Developmentally regulated GTP-binding protein-2 was named because of its
homology to Drgl, a possible developmentally regulated gene. The Drg] gene was
originally reported as being developmentally regulated because of the subtractive
cloning method used in its original isolation (Sazuka et al. 1992b). Further, at the
RNA level Drg] is reported to be highly expressed at embryonic day 10 with
decreasing expression seen through birth and into adulthood (Sazuka et al. 1992a).
Unfortunately, the authors of this paper failed to include positive controls in their
analysis of gene expression.

Expression of Drg2 during development is highest in the developing neural
tissues. The Drg2 gene may function in the developing neural tissue by regulating
protein trafficking in the Golgi apparatus and the ER. It may directly interact with
proteins being moved through the cell, or similar to its relatives Rab and Alf it may
regulate the formation of the vesicles used in the trafficking system. Further
biochemical analysis of the protein will help reveal its fimction in the developing
neural tissue and its role at the cellular level. Any role that the gene may play in the
SMS phenotype will need to be further evaluated upon resolution of the protein

biochemistry, and/or creation of a Drg2 targeted mouse.

114

MATERIALS AND METHODS

Alignment of orthologous DRGZ proteins: DRG2 protein sequence fi'om Homo
sapien (I.M.A.G.E. clone 29328 and Genbank accession NP_001379), Mus musculus
(I.M.A.G.E. clone 4910172 and Genbank accession NP_067329), Drosophila
melanogaster (Genbank accession NP_53673 3), and Schizosaccharomyces pombe
(Genbank accession JT0741) were aligned using ClustalW 1.8 at the Baylor College
of Medicine Search Launcher (http:/lsearchlauncher.bcm.tmc.edu). Aligned sequence
was graphically transformed using Boxhade 3.21

(http://www.ch.embnet.org/software/BOX_form.html)

Northern Analysis: A mouse embryonic northern blot was obtained commercially
(SeeGene USA, Rockville, MD). Northern analysis was performed as described in
Chapter 2. Human B-actin DNA (Clontech Inc.) cross reacts with all mammalian B-
actins and was used as a control probe on the mouse blot. Northern analysis of B-
Actin was also canied out as described in Chapter 2, except that 5x105 CPM/ml was

used, and the hybridization temperature was reduced to 42°C.

Cloning of Drg2 into a GFP vector: The Gateway cloning system from Invitrogen
was employed to clone the Drg2 EST sequence into a vector containing the GFP
sequence. The Gateway system uses site-specific recombination properties of

bacteriaphage lamba to shuttle cloned sequences between various vectors. The entire

115

coding sequence for mouse Drg2 was amplified from I.M.A'.G.E clone 4910172 using
primer pair SHE242/243. Primer SHE242 anneals to the 5’ end of the Drg2 coding
sequence and contains a Kozak consensus sequence upstream of the m start site
for the Drg2 gene allowing for proper gene expression upon transfection (SHE242:
5’-CACC;£I‘_GGGGATCTTGGACA-3’). SHE243 anneals to the 5’ end of the Drg2
coding sequence and was designed without the Drg2 stop codon to allow for proper
in-frame read-trough transcription to the GFP gene (SHE243: 5’-
CTTCACAATCTGCATGA). PCR product fiom SHE242/SHE343 amplification
was cloned into the pENTR vector from Invitrogen per manufacturer instructions.
Using the Gateway recombination technology, the Drg2 sequence was moved
fiom the ent1y vector (pENTR) to a vector containing C-terminus GFP expression
(pDEST47) per manufacturer instructions (http://www.invitrogen.com). All cloning
reactions were confirmed via direct sequencing of the product. Plasmid DNA was

isolated using the protocols described in Chapter 2.

Calcium-phosphate transfection of COS-7 cells: COS-7 cells were grown to
confluence in T-25 flasks for Drg2 expression or on sterile cover glass in 6 well
plates for GFP-Drg2 fusion protein expression. Cells were grown to ~60%
confluence in commercially available RPMI media (Invitrogen) supplemented with
10% fetal bovine serum, and 1x antibiotic/antimycotic solution (Invitrogen). Media
on cells was changed 2 hours prior to transfection. DNA to be transfected was
isolated and diluted to a total volume of 500 pl in ddHZO. To the DNA 50 pl of 2.5 M

CaClz was added. DNA solution was briefly vortexed. Five hundred microliters of

116

2x HeBS (2x HeBS is 50 mM HEPES [pH 7.1], 280 mM NaCl, 1.5 mM Na21-1P04)
was placed in a 15 ml conical tube. Air was bubbled through the HeBS solution with
a sterile 5 ml pipette connected to a battery operated pipette aid. While bubbling
HeBS, the DNA solution was added dropwise. The 15 ml tubes were vortexed
briefly, and incubated at room temperature for 15 minutes. After 20 minutes the
DNA solution was added to the cells. Cells were incubated for 7 hours at 37°C under
5% C02. After incubation, media was replaced and cells were allowed to grow for 2
days.

After 2 days, the coverglass with cells transfected with GFP-Drg2 plasmid
DNA was removed and rinsed with sterile lx Hank’s balanced salt solution (HBSS;
Invitrogen). Cells not stained with Golgi or ER control stains were mounted onto
glass slides with Vectashield with DAPI (Vector Labs) and viewed on a fluorescent
AxioPlan2 microscope (Zeiss). Fluorescing cells were photographed using an
AxioCam and AxioVision software version 4 (Zeiss). Cells grown to be stained prior
to viewing were rinsed with HBSS and a mixture of 1 nM ER tracker blue white-
solution (Invitrogen), 5 1.1M BODIPY TR ceramide (Invitrogen) in RPMI media or
HBSS was added. Staining mixture was allowed to incubate for 30 minutes before
cells were rinsed with HBSS and mounted to glass slides with Vecatshield without
DAPI (Vector Labs). Cells were viewed and photographed as above.

Cells transfected for Drg2 expression were removed from the T-25 flasks
using 2 ml 1x Trypsin-EDTA (Invitrogen). Cells were collected in 15 ml tubes via
centrifugation, rinsed in 1x HBSS, and pelleted via centrifirgation. Cell pellets were

lysed in 200 pl 1x Laemmli buffer (2x Laemmli buffer is 4% SDS, 120 mM Tris pH

117

6.8), 1x protease inhibitor (Boehringer) for lysis. Lysate was vortexed briefly and run
through a 20-gauge needle in order to shear the DNA. Lysate was stored at -20°C

until use.

Western blotting: Protein samples were prepared for western blotting in 1x loading
dye (Invitrogen) and 1x reducing agent (Invitrogen) to a total volume of 25 pl.
Samples were heated to 65°C for 10 minutes prior to separation on polyacrylamide
gels. Invitrogen’s western blotting system includes precast 5-12% Bis-Tris
acrylamide gel (Invitrogen) run and transferred in an XCell western blotting
apparatus. Protein gels were run and transferred to PVDF membrane per

manufacturer instructions.

Western analysis was performed using antibodies in a 1:1000 dilution. A
chromogenic WestemBreeze kit from Invitrogen was used for western analysis

following manufacturer instructions (http://www.invitrogen.com).

Immunohistochemistry: IHC was performed using a polyclonal antibody designed
and created by Alpha Diagnostics. Timed matings were performed using C5 7Bl/6J
(The Jackson Laboratory). Embryos were dissected and fixed in 4%
paraformaldehyde overnight. Sectioning in paraffin blocks was performed at the
Michigan State University Histology Lab. Sections were de-waxed in xylene, and re-
hydrated through an ethanol series before use. The sections were exposed to antigen
unmasking by heating to boiling in a microwave, boiling continued for 5 minutes in

antigen unmasking solution (Vector Labs). Blocking was performed overnight at

118

room temperature in a humid chamber. Blocking reagent was 1x BM blocking
reagent (Roche), 5% goat serum, 0.2% Tween 20, 1x PBS. Sera were diluted 1:1000
in blocking solution and incubated to sections overnight at room temperature.
Sections were washed and stained using the Vectastain Elite ABC Kit and DAB/Ni

detection (Vector Labs) per manufacturer instructions.

119

Chapter VI

Target of myb-l (chicken) like 2 (TOMILZ)

BACKGROUND

In addition to studies involving the DRGZ gene, I also embarked on
characterization of the novel EST stSG9692. The stSG9692 EST was previously
mapped to the SMS critical interval (Elsea et al. 1997), though no additional
information was available upon beginning the study. Through sequence analysis we
determined that stSG9692 represents the 3' UTR of a gene known as target of myb-l
(chicken) like 2 (T 0M1L2). Initial characterization using northern analysis revealed
low—level expression in all adult human tissues studied, including the brain. At this
point in the study, we had identified dominant fi'ame shift mutations in the RAII gene
in persons with SMS. Study of the TOM112 gene was given less priority in favor of

studies of the RA]! gene.

RATIONALE

Bioinformatic and northern analysis of TOMILZ was performed in our initial
charaterization of all the known genes and ESTs mapping to the SMS critical region.
Upon finding mutations in SMS patients in the RAII gene research of TOM 1L2 was
given less priority. Study of TOM1L2/Tom112 resumed upon discovery of a mouse
embryonic stem cell line fi'eely available to academic researchers carrying a gene-
trapping vector inserted within the T om] 12 gene. The gene trapping method disrupts

genes by random insertion in the genome. The ES cells were obtained and mice

120

carrying the targeted Tom112 were generated. In addition to the initial
characterization of the TOM1L2 gene, we also analyzed the Tom112 mice in order to
determine if any of the SMS characteristics could be recapitulated in the gene-trapped

\

mice.

RESULTS
Bioinformatic analysis of TOMILZ

Initial database searching of the small amount of sequence available for EST
stSG9692 revealed only that it was represented by IMAGE clone 23808. This clone
was commercially obtained and DNA was isolated and sequenced. When compared
to nucleotide databases at NCBI, the sequence only aligned with the small amount of
sequence available for itself and the now completely sequenced PAC RP1-253P07.
Six frame translation of the clone sequence did not reveal an open reading frame.

As newer gene prediction software became available we were able to match
the cloned EST sequences to predicted genes reported online
(http://www.genome.ucsc.edu). Searching the Gene Scan program at the Golden Path
website (http://genome.ucsc.edu), we found that clone 23808 was predicted to lie
within the 3' untranslated region of a predicted gene with accession ctg17005.29l.
This predicted gene spans 53.1kb and is made up of 15 exons. BLAST analysis at
NCBI showed sequence homology to the gene target of mybl (chicken) homolog
(T 0M1). T 0M1 was originally identified in chicken cells as a gene target of the
proto-oncogene v-myb when chicken myelomonicytic cells were transformed with

avian myeloblastosis virus or avian leukemia virus E26 (Burk et al. 1997). The

121

human T 0M1 gene was mapped to chromosome 22ql3. l , expression analysis showed
a 2.3 kb transcript in all adult tissues. In situ hybridization was performed on mouse
embryo and demonstrated ubiquitous expression (Seroussi et al. 1999).

We wanted to confirm the predicted Tom] 12 sequence in vivo in preparation
for further experiments on mouse Tom] 12. RT-PCR using RNA isolated fiom mouse
tail was used to amplify the Tom112 cDNA. The resulting cDNA was isolated and
sequenced. The T om! 12 gene in mouse contains 15 exons and spans 122 kb (Figure
22). Six frame translation of the cDNA sequence revealed an open reading frame
resulting in a 507 amino acid product.

Sequence analysis of the TOMILZ/ Tom] 12 sequences using BLAST programs
at NCBI show two conserved domains within the sequence. There is a VHS domain
present, which is seen in proteins involved in vesicular trafficking and endocytosis
(Lohi and Lehto 1998). Also present within the predicted sequence is a GAT domain
thought to be responsible for stabilizing membrane-bound ARF 1 in the GTP state

(Takatsu et al. 2001).

Northern Analysis of TOM1L2

Expression analysis was carried out using commercially available northern
blots from Clontech (Figure 21). Hybridization was carried out on the multiple tissue
and brain 2 northern blots. The expression pattern on both northern blots revealed that
the transcript of this EST is ~6.5 kb. Expression pattern in the adult tissues (Figure
19A) shows approximately equal expression levels in heart, brain, skeletal muscle
and kidney. Lower levels of expression are seen in placenta, lung, liver, and
pancreas.

122

 

    

 

 

 

 

 

 

 

 

 

X
.8
a *3 E 333 3
'3 5 2 8 '5 .3 '3 a
S W 8 = 8 '9‘ ._ -— H 0
c.55ws§§§ 8933£fi§§§
3885.23'25 bau'ngeoa
kb EmE—l—lmxm kb OUEmOmr—
9.5 9.5: i
7'5 if ' 7.5 f- 1!! u- I- 4 1
44 %. 4 ’ 4.4— 1a? a“ \
TOM 1 L2 TOM 1 L2
2.4—‘ .. ..‘ 2.4— -...
1.35— 1.35—
B-actin B-actin

Figure 21. T 0M1L2 northern analysis.

The ~ 2 kb insert from clone 23808, representing the 3’ end of human T 0M1L2, was
hybridized to Clontech northern blots. Panel A) shows hybridization signal of ~65 kb
to the Clontech multiple tissue northern blot. Panel B) shows hybridization of ~6.5
kb to the Clontech Brain Two northern blot. B-actin blots are shown as controls for
both blots.

123

Expression in the brain (Figure 213) is fairly equal in the cerebellum, cerebral cortex,
medulla, occipital pole, frontal lobe, and temporal lobe. There is slightly lower

expression in the putamen and a very low level signal is seen in the spinal cord.

TOMILZ gene trapped ES cell lines

. Gene trapping is a method of disrupting gene function that is rapid and fairly
inexpensive when compared to traditional gene lmockout methods. The gene-trap
relies on a vector that randomly inserts itself into the genome. The vector is equipped
with a reporter gene flanked by a splice acceptor and polyadenylation sites. If the
vector lands within a gene it disrupts the mRNA by creating a fusion RNA of the
endogenous gene and sequence from the vector which codes for reporter and selector
genes. An antibiotic resistance gene within the gene vector allows for positive
selection of cells in which the vector has properly inserted. The insertion site of the
gene-trap vector is determined using 5’ RACE experiments. Amplification fiom
vector sequence in the fusion mRNA into the endogenous RNA allows for
determination of the insertion site. The gene-trap method has been verified and used
successfully to knock-out gene expression in a multitude of genes (Skarnes et al.
1992; Mitchell et al. 2001).

Access to databases of gene-trapped ES cell lines are available for searching
on the Internet. The cells are freely available to academic researchers from gene-
trapping centers around the world. Using BLAST analysis for SMS candidate genes
we determined that a cell line was available with a gene-trap in Tom112 from the

BayGenomics consortium (http:l/www.baygenomics.ucs£edu). Bioinformatic

124

analysis of the 5’ RACE performed from the XG909 cell line indicated that the gene-
trapping vector inserted between exons 10 and 11 in the mouse T om112 gene (Figure
22A and 22B). The gene product resulting for this gene-trapped allele in the Tom112

gene would be missing 147 amino acids from the carboxy end.

XG909 genotyping and creation of XG909 mice

Genotyping of the XG909 cell line (and mice subsequently developed fi‘om
the cell line) was performed by Southern analysis. Digestion of mouse genomic DNA
was performed with Bgll . When Southern blots are probed with a PCR product fiom
the intronic sequence between Tom112 exons the wild type allele is indicated by a
band of 2812 base pair (Figures 22B and 22C). The insertion of the gene-trap vector
between exons 10 and 11 shifts the native 2812 base pair band up to an ~3800 base
pair band (Figures 22B and 22C). Wildtype animals only have the ~2800 base pair
band. Heterozygous animals display both the ~2800 base pair and ~3800 base pair
bands. Homozygous targeted animals show only the 3800 base pair band.

The XG909 cell line was obtained and sent to the Transgenic Animal Model
Core (TAMC) at the University of Michigan for creation of gene-trapped founder
mice. The XG909 cell line was expanded and then injected into C57Bl/6J for
creation of a chimeric (founder) line of mice. The XG909 cell line was created from
129/OlaI-Isd embryonic stem cells. These mice have white coat color, while the
C57Bl/6J mice have black coats. Chimeric animals are a mix of both cell lines and
display a mottled coat with patches of black or white fur (Figure 22D). Male chimera

animals were mated with C57Bl/6J females to produce an F1 line. Chimeras whose

125

germ cells were of the 129/OlaHsd lineage produced agouti colored offspring when
mated with C57B1/6] animals. Agouti color results fi'om crossing of white and black
coated animals. One-half of the agouti animals were expected to carry the gene-
trapped Tom112 allele. The F l agouti animals were genotyped, and brother and sister

carriers were mated in order to obtain an F2 generation for phenotypic analysis.

Analysis of the F2 generation of Tom112 gene-trapped mice

Brother sister mating of carrier F 1 gene-targeted Tom112 mice resulted in 15
F2 offspring. The gene-target occurs at an autosomal locus and should follow simple
Mendilian inheritance; v. should be XG909”, 1/2 should be XG909“; and v. should
be XG909"’. or the 15 F2 nrice 3 XG909”, 3 XG909”; and 9 XG909"' were
obtained, which is not in a Mendelian fashion. Increasing the number of offspring
may bring the inheritance back to agreement with Mendelian inheritance.

The F2 offspring were physically assessed using the guide in Appendix B.
Mice were thoroughly evaluated for physical, neurological, and behavioral anomalies
at age 5 and 13 weeks. All physical measurements were within normal range. Total
body length, body weight, and cage hang time measurements were statistically

analyzed as described below.

126

Figure 22. Genetic analysis of the XG909 cell line.

A) A schematic representation of the Tom112 gene with location of the pGTlle
gene-targeting vector. The Tom112 gene is composed of 15 exons. The gene-
trapping vector inserted into the intron between exons 10 and 11. B) A schematic of
the wild type and targeted alleles in the XG909 cell line. The insert causes a
Bgll frament to increase fi'om 2812 bp to ~3 800 bp. The Bgll sites are indicated in
red, the probe used in Southern analysis is indicated in blue, the pGTlle vector is
indicated in green. C) Southern analysis of F1 mice generated from the XG909 cell
line. Mice heterozygous for the trapped allele are seen in the first and last lanes as
indicated by the presence of both the 2812 bp and ~3800 bp bands. D) Photograph
of the chimeric animals generated from the XG909 cell line.

127

A)

, lllllll ,
5'i Illllll 3

 

B)
59

 

Wild type allele = 2812 kb

     

Q

5,

 

Gene-trapped allele = ~3800 kb

Trapped
allele

Wild type
allele

 

128

The data obtained from the mice studies were grouped based on the age at
evaluation and their genotype. The means and standard deviations of the groups were
compared using the student t-test. Also, comparisons within the groups were
performed by the analysis of variance (ANOVA). Comparisons of all the three groups
at 5 weeks and 13 weeks indicated statistically significant difference between
homozygous trapped and wild-type littermates only in length at 13 weeks.

Total body length was measured fiom the tip of the nose to the tip of the tail
while the mice were under light anesthetic. At 5 weeks, there is no statistically
significant difference in body length between groups (variance of 0.78 and mean
comparisons showed a student t test value of 2.7 (p=0.08)(Figure 21A). A significant
difference was seen while comparing the lengths of 13 week-old mice.

A significant p-value of 0.02, at Df=3 was obtained when comparing the
means and standard deviation (student t-test value of 2.3). A significant difference
was seen between the means from the homozygous trapped and wild type (p=0.03)
and between normal and the heterozygous mice (p=0.01), though no difference can be
deduced between the transgenic and the heterozygous mice (Figure 23B). This
cannot be a conclusive evidence of the difference as power calculations were not
performed for adequacy of the sample size for evaluation.

Weight assessments performed at 5 weeks and 13 weeks showed no
significant differences between the genotypes (p=0.48 and 0.315 and variance of 0.28
and 0.24 respectively)(Figures 23C and 23D). Comparison of mean values of each
group by student t-test, gave a value of 2.36.

Analysis of the hang time of the mice to the cage tops did not show statistical

129

significance (p=0.55 at 5 weeks and 0.0505 at 13 weeks). The ANOVA showed an R2

value of 0.24 and 0.56. (Figures 23B and 23F)

SUMMARY

The T 0M1L2 gene was first mapped as an EST during definition of the SMS
critical region (Elsea et al. 1997). Using bioinformatic analysis and RT-PCR we were
able to identify the full length sequence of the human and mouse TOMILZ/TomlLZ
genes. Northern analysis revealed expression in all human adult tissues studies.
Work on the TOM1L2 gene was placed on hold upon discovery of mutations in the
RAII gene in some SMS patients.

Mouse analysis of the Tom112 gene began when we discovered that
embryonic stem cells with a gene-trapping vector in the Tom112 gene were available
at no cost. We created mice from these embryonic stem cells in order to try to
identify any phenotype due to dosage changes in Tom112 expression. Initial
evaluation of the F2 generation of gene-trapped only showed statistical differences in
total body length at 13 weeks of age between wild-type and homozygous trapped
mice. Though, due to the small number of animals analyzed the statistical analysis
lacks the power needed to be reliable. In order to determine whether the gene trap is

having an effect on phenotype additional F2 mice are currently being generated.

130

Figure 23. Statistical analysis of XG909 mouse measurements.

Mice were measured at 5 and 13 weeks for length and weight. Hang time from the
cage top was also assessed. Data was analyzed using the student t-test and ANOVA
with JMP software. Student t-test results are indicated by overlapping circles.
AN OVA analysis is represented by the diamonds. Measurements for heterozygous
mice are colored green, wild type measurements are colored yellow, and homozygous
targeted are colored red. A) Comparison of length at 5 weeks. B) Comparison of
length at 13 weeks. C) Comparison of weight at 5 weeks. D) Comparison of length

at 13 weeks. E) Comparison of cage top hang time at 5 weeks. F) Comparison of
cage top hang time at 13 weeks.

131

A)

B)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

155
”E 150- I
e. A l
g) 145- _
140-
l
135-
130 I i r .
+/- +/+ -/- BOW
student's
Genotype
175
170
.
A
E 165
M
'E) 160 _— __
c:
’3 155
150
145
140 ' .r I
+/. +/+ ./- Each pair
student's t-test
Genotype
Group 1 Group Difference Lower CL Upper CL p-Value Difference
2
+/ +/- | 1.80000 3.6426 19.95736 0.0102961
+/ -/- 7.66250 0.5980 14.72698 0.0368724
-V- +/- 4.13750 -1 . 1281 9.40305 0.1075639
Figure 23

132

 

 

 

C)

 

 

E

Weight (g)
i

17.5 -

15

 

12.5

r++|

{CD

\>
J

 

 

 

Each Pair
Stuthit's t-test

 

 

D)

 

 

 

E

Weight (g)
i

17.5 -1

15

 

12.5

n—q

)
/

<0!

 

 

Each Pair
Student's t-test

 

 

Figure 23 continued

133

E)

F)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

7"
6o- l—i- ‘ \
E 50- \
E __ _
‘5' 40‘
i”
:1 30'1
20'
10' ‘
G l I ' ' r ‘ j v' ‘
+4 +/+ 4. W
Studen
Genotype
7G \
60- A
50?“ I ‘ m 1
E 40'
m _
g 30
20
10- l
u l +/ ' +/+' _/_ Each pair
Studenttesn
Genotype
Figure 23 continued

134

 

 

MATERIALS AND METHODS

Norhtern analysis: Northern analysis was performed as described in Chatper 2.

Mouse DNA isolation from tail biopsies: Tail biopsies were obtained fi'om 21 day old
mice after weaning. Biopsies were digested/lysed over night in 600 pl lx TNES (10
mM Tris, pH 7.5, 400 mM NaCl, 10 mM EDTA, and 0.6% SDS), and 35 pl of 10
mg/ml overnight at 55°C. After digestion/lysis DNA was isolated using P:C:I as

described in Chapter 2.

Southern analysis: Eight micrograms of mouse DNA was digested with 34 U Bgll
overnight at 37°C. Southern blots were created fi'om digested DNA as described in
Chapter 2. Probe for southern analysis was generated by PCR amplification of the
intron between Tom112 exons 10 and 11 was performed as described in chapter 2.
Southern hybridization, washes, and detection were performed exactly as described in

Chapter 2.

Mouse assessment: Assessments of the F2 mouse generation was performed using
the guide attached as Appendix C. All protocols for work with mice were approved

by Animal Use Committees at MSU and VCU.

Statistical analysis: Analyses were performed using the JMP software, version 5.1

with the significance value set at 0.05.

135

Chapter VII

Discussion

Through the research presented here significant progress has been made in the
understanding of the genes that play a role in Smith-Magenis syndrome. Our efforts
have resulted in construction of a contig of large insert clones across the 1.5 Mb SMS
critical interval that included a transcription map of the region (Lucas et al. 2001).
Analysis of SMS patients with 17p11.2 deletions allowed for two refinements of the
smallest deletion region of overlap in SMS (V langos et al. 2003; Vlangos et al. 2004).
The SMS critical region has been reduced fi'om 1.5 Mb to ~700 kb. Correspondingly,
the number of genes mapping within this interval has also been reduced from ~40 to
11 (V langos et al. 2004).

Research on samples from patients who display the SMS phenotype but in
whom a deletion could not be detected with extensive FISH analysis yielded the most
insight into the genetic basis of SMS. Systematic sequencing of genes mapping
within the SMS critical region led to discovery of dominant fiameshifi mutations in
the RA]! gene. Nine total SMS patients with RAII mutations have been reported
since our initial findings in three patients (Slager et al. 2003; Bi et al. 2004; Girirajan
et al. 2005).

Research on the expression pattern of the DR GZ gene revealed dynamic
expression in the developing mouse nervous system. Though DRGZ is no longer
thought to be developmentally regulated, it likely does play an important role in the

proper development of the nervous system. Though its role in SMS is still

136

inconclusive, the results of the IHC experiments presented here make it tempting to
hypothesize that haploinsufficieny of DRGz may play some role in infantile
hypotonia seen in SMS patients with a deletion but not seen in patients with

mutations in RA]! .

Future studies in the Elsea Laboratory

My work in the Elsea Laboratory has helped develop an environment full of
opportunity with regard to research on SMS and the genes mapping to chromosome
l7p11.2. Additional research on TOMILZ, DRGZ, and RA]! will yield additional
insight into human genetic disease. In order to fitrther understand the function of
these genes, and any possible role they may play in human disease, the following

research is proposed.

TOM1L2/Tom112

Mice with gene trapped Tom112 alleles did not show an overt phenotype in
either the heterozygous or homozygous state in the C5 7Bl/6J background. Many
questions remain with respect to the gene-targeted Tom112 allele. Although we were
able to determine the genotype of the Tom112 mice, we did not yet study whether
expression levels of the Tom112 gene were affected by the gene-trapping. Because
the ES cells cannot survive the positive antibiotic selection in propagation of the cell
line it is unlikely, but not impossible, that the gene-trapping vector inserted
incorrectly. PCR analysis and direct sequencing of the vector insertion location could

be used to measure the accuracy and location of the insert site. PCR primers have

137

been designed throughout the vector and flanking genomic sequence to amplify
across the insertion breakpoint. The PCR reactions to accomplish this task need to be
optimized.

Unlike traditional gene targeting via “knocking-out,” gene-trapping does not
guarantee a null allele. Genes that have been gene-targeted can be leaky and result in
a hypomorphic allele instead of a true null allele. Though no publications are
reported regarding the efficiency of null alleles in gene-trapping, the groups
promoting gene-trapping report that ~10% of gene-trap lines are leaky
(http://genetrap.gsf.de). One report characterizing two gene trap lines that were leaky
report that the actual percentage of leaky lines may be upwards of 50% (V oss et al.
1998). To determine whether a null or hypomorphic allele has been generated
measurement of gene expression in Tom112 gene-trapped mice should be
investigated.

Tom112 expression could be analyzed fiom the normal and trapped alleles at
both the RNA and protein levels. Northern analysis of RNA isolated from the
Tom112 mouse line probed with 5’ sequence from the Tom112 gene should reveal the
normal ~65 kb message but should also show a shifted band of RNA containing the
Tom112-vector fusion RNA. Some studies using this technique have found that the
normal RNA is preferentially expressed over the trapping exons resulting in normal
gene expression in the homozygous trapped mice (McClive et al. 1998; Voss et al.
1998). Further complicating the analysis is that the varying expression can be tissue
specific (McClive et al. 1998).

Additional analysis could be performed at the protein level. We have created

138

a polyclonal antibody near the amino terminal of TOM1L2/Tom112. Protein
expression of the trapped allele could be analyzed via western analysis in order to
determine whether protein levels are reduced in the gene-trapped mice. The recent
reports of leaky gene trapping in mice and previous reports of gene trapping in
Drosophila suggest that the method may not reduce gene expression from trapped
alleles as much as predicted.

Even if the Tom112 gene-trapped mice are hypomorphic they may be very
useful in studying Tom112 gene expression in mice. In addition to positive selection
by antibiotic resistance, the gene-trapping vector allows for expression analysis by
expression of the lacZ reporter gene. Gene expression can be studied by staining
mouse sections or whole mount mice for LacZ expression. Expression analysis could
be performed both in developing mouse embryos and adult tissues. LacZ expression
could be verified by RNA ISH and/or IHC to the Tom112 gene.

Conserved domains within the Tom112 gene predict that it plays a role in
trafficking of proteins fi'om the trans-Golgi network to the lysozome. I have cloned
the full length Tom112 sequence into the Gateway system entry vector in proper
orientation for use in GFP studies. GFP studies would provide insight into the
cellular localization of the Tom112 protein. Human genetic disease related to
trafficking is not rare, and includes mannosidosis, Neiman-Pick disease, and
Zellweger syndrome. Though the role T 0M1L2 plays in human genetic disease

remains unknown, it is a good candidate gene that should be explored further.

139

DRGZ/Drgz

From the data presented we hypothesize that the DRGZ/DrgZ genes likely
play an important role in mammalian development. The highly conserved
evolutionary sequence and the expression patterns seen in the developing mouse
make DR GZ/DrgZ an interesting gene for further research as the role that DRGZ may
play in SMS or other genetic disorders is still unknown.

With the discovery of novel genes comes the job of characterizing function,
regulation, and possible interactions with other proteins. In order to determine the
biochemical fiinction of DRG2 the lab plans to use techniques to pursue any protein-
protein interactions involving DRG2. Proposed experiments involve the use of yeast
two hybrid assays to study possible protein-protein interactions. The yeast two
hybrid assay was first reported in 1989 as a screen for binary protein interactions
(Fields and Song 1989). The assay involves cloning your protein of interest into a
plasmid with a DNA binding domain such as GAL4. The GAIA fusion protein is the
“bait” that allows for screening for interactions with “prey" proteins. Prey proteins
are created from cDNA libraries where the clones are created fitsed to a
transcriptional activating domain. Fusion of the bait and prey allow for expression of
a reporter gene such as B«galactosidase, or for genes allowing for growth in selective
media. Positive yeast colonies are screened to determine which cDNAs interact with
the bait protein. The yeast two hybrid assay is a powerful tool for determination of
protein-protein interactions. The technique has been very successful in identification
of proteins in cell signaling pathways (F ashena et al. 2000).

The yeast two hybrid is a good assay for finding protein-protein interactions in

140

novel genes, but it is not without faults. The false positive rate can be very high,
though newer techniques are being developed to reduce the number of false hits.
Further, many interactions that naturally occur in vivo may not occur in this system.
The yeast two hybrid system operates in the nucleus in order to activate the reporter
gene. Transmembrane proteins, an extremely important class of signaling molecules,
cannot be studied effectively with this assay. Interactions with proteins that require
post-translational modification such as glycosylation before becoming active rrright
also be missed in the traditional yeast two hybrid assay (Stagljar 2003). With these
limitations in mind, the lab also plans to use coirnmunoprecipitation techniques to
identify interactions that may be missed with the yeast two hybrid assay and to verify
any positive interactions identified. We hypothesize that if we are able to determine
the protein partners of DRGZ, we may further understand its role in mammalian
development.

The expression patterning in the developing mouse shows that Drg2 likely
plays a role in the developing nervous system. Generation of a Drg2 knock-out

mouse may reveal any phenotype associated with dosage changes in the Drg2 gene.

RAH/Rail

Our finding of SMS patients with dominant fiameshift mutations in the RA]!
gene unraveled some of the mystery behind the etiology of SMS; however, it also
created many more questions that need to be addressed. Though research will
continue on other candidate genes in the SMS region, the thrust of the work in the lab

will focus on research of the RAII gene.

141

Mouse modeling to study the effect of dosage changes in Rail has begun.
With the hypothesis that Rail is a dosage sensitive gene, the lab has generated a line
of transgenic Rail mice with multiple copies of a BAC containing the Rail gene.
Current work in the lab involves assessing whether increased dosage of the Rail gene
results in a phenotypic effect. Mice in the line generated carry between 2 and 5
copies of a BAC containing the Rail gene. Phenotypic measurements taken thus far
have not revealed a difference between normal littermates and those with increased
Rail copy number (Rebecca Slager, MSU Ph.D. Dissertation, 2004). Though
increased copy number at the DNA level has been confirmed, it is unknown if the
level of Rail expression is also increased. Experiments to determine expression
levels at the RNA level will likely begin soon.

The transgenic mice were created in conjunction with an Rail targeted
knockout project. At this time, Rail has been successfully knocked-out in embryonic
stem cells. The targeted cells are in queue for injection into blastocysts for creation
of chimeric animals. Thorough physical and behavioral analysis of the Rail
knockout animals is planned.

As discussed in Chapter 1, mice deficient for the portion of mouse
chromosome 11 syntenic to human chromosome 17p11.2 show a distinct phenotype
overlapping with some of the features seen in the SMS phenotype (Walz et al. 2003;
Walz et al. 2004). Recently, it has been shown that inactivation of the Rail gene
recapitulates the physical features seen in the deletion mice (Bi et al. 2005).
Behavioral studies of the Rail targeted mice were not reported. Both mouse studies

reported were performed in a mixed C57BI/6J x 129Sva background (Walz et al.

142

2003; Walz et al. 2004; Bi et al. 2005). The Rail knockout mouse that the Elsea lab
is creating will be in a full C57BL/6J background. There are many documented
reports showing that phenotypic differences in knockout animals can vary greatly in
different background strains (Dobkin et al. 2000; Fleming et al. 2001; Humphries et
al. 2001). It is preferential to analyze behavior and circadian rhythm of mutant mice
in a firll C57B1/6J background. Differences in phenotype may be found between the
knockout mice produced in different labs.

Not much is known about the biochemistry of RAIl/Rail. By sequence
analysis it is postulated to act in transcriptional regulation (Seranski et al. 2001;
Girirajan et al. 2005). Studies utilizing GFP show that Rail is localized to the
nucleus (Elsea lab unpublished data and Bi et al. 2005). Initial studies of Rail in
yeast show that there are two functional transcriptional transactivation domains
present near the N-terminal end of the protein (Bi et al. 2005). It is unknown if the
protein interacts directly with DNA or acts through association with other
transcription factors.

Vitamin A (retinol) and its derivatives are extremely important in embryonic
development (Ross et al. 2000). Retinoic acid (RA) is the product of oxidation of
vitamin A. Rail was originally cloned because of increased expression in response to
retinoic acid (Irnai et al. 1995). However, the correlation between RA, RAll, and
development is unknown. It has been shown that RA plays a direct role in the proper
regulation of the Hox genes (Langston and Gudas 1994). Correct expression of the
~38 known Hox genes is crucial for proper development (Langston and Gudas 1994;

Ross et al. 2000). The lab may choose to investigate whether RAIl acts in the

143

signaling pathway in response to RA resulting in Hox gene regulation. This could be
performed by testing to see if RAIl binds to the promoters of any of the large number
of Hox genes. The spatial and temporal expression of most of the Hox genes during
development is known (Langston and Gudas 1994; Ross et al. 2000).

In addition to identification of the potential DNA binding function of RAIl,
determination of any protein-protein interactions would help determine potential
partners in transcriptional activation and help determine the transcriptional targets of
RAH/Rail. The yeast two hybrid assay or coimmunoprecipitation are two of the best
techniques to study protein interactions. These are techniques that would also be of
use in studying other novel genes in the lab. Determining which proteins act with
RAIl/Rail rrright lead to investigation of a potential second locus for SMS.

The lab has a cohort of samples from patients without detectable l7p11.2
deletions in whom mutations in RA]! have not been located. It is possible that dosage
changes in genes that interact with RAIl could phenocopy the characteristics seen
with haploinsufficiency of RAIl. Heterogeneity in Rubinstein-Taybi syndrome
(RSTS) has recently been reported (Roelfsema et al. 2005). RSTS is characterized by
mental retardation, craniofacial and skeletal anomalies, EEG abnormalities and
seizures, and an increased incidence of tumor formation (Petrij et a1. 1995).
Rubinstein-Taybi syndrome was originally reported associated with a hemizygous
deletion of chromosome 16p 1 3.3. Research then revealed that heterozygous
mutations in the CREBBP gene mapping to 16p13.3 also caused Rubinstein-Taybi
(Petrij et al. 1995). It is interesting to note that the CREBBP and RAII genes are

likely transcriptional co-activators that both contain a PHD domain (Kalkhoven et al.

144

2003). The PHD domain in CREBBP has been shown to be extremely important in
acetyltransferase activity towards histones and CBP. This reduction in
acyltransferase activity led directly to reduction in coactivator function for the
transcription factor CREB (Kalkhoven et al. 2003). The authors of this study
postulate that disruption of the PI-ID domain in CREBBP alone may be enough to
cause RSTS (Kalkhoven et al. 2003).

Research of the CREBBP gene found that it sometimes interacts with the
EP300 gene as a transcriptional coactivator in the regulation of gene expression
through various signal transduction pathways (Weaver et al. 1998; Roelfsema et a1.
2005). Some patients who were clinically diagnosed with RSTS do not have
detectable deletions of chromosome l6p13.3 or mutations in CREBBP. Mutations in
the EP300 gene were found in samples fi'om this cohort of patients by direct DNA
sequencing (Roelfsema et al. 2005). It is possible that SMS may display
heterogeneity similar to that seen in RSTS. Research on our cohort of SMS patients

without 17p11.2 deletion or RAll mutation may reveal a second locus for SMS.

Conclusion

The research presented here sets the groundwork for continuing study of the
genes mapping to chromosome l7p11.2. We now know that the RAII gene is dosage
sensitive and that haploinsufficiency of M11 leads to most of the characteristics in
the SMS phenotype. Currently, we can only speculate on the many developmental
pathways that RAll could potentially play a role. Further research using in vivo and
in vitro techniques, as well as physical and behavioral analysis of Rail mouse
models, will help determine the true biochemical role of M11 .

145

Though M11 is the cause of the majority of the characteristics seen in the
SMS phenotype we cannot yet say that it is the only gene involved. Patients with
mutations in RA]! do not display short stature, infantile hypotonia, or visceral
anomalies seen in some SMS patients with a l7p11.2 deletion. Further research into
other genes including DRGZ and TOM 1 L2 may show that these genes are responsible
for these characteristics.

Clinically, we have improved the diagnostic testing for SMS by identification
of a more efficient FISH probe and by helping implement commercially available
RAII mutation screening. With improved testing and knowledge of SMS, patients
can begin to receive intervention through proper therapies at an earlier age. Early
intervention greatly increases the quality of life for SMS patients and their families.
Further work using the research presented here will no doubt answer even more

questions with regard to SMS and proper mammalian development.

146

Appendix A

Features of Smith-Magenis Syndrome
A Questionnaire for Parents and Guardians

This questionnaire is designed for parents or guardians of children diagnosed with
Smith-Magenis syndrome (SMS). The information provided in this survey will be
used to better understand the correlation of the syndrome phenotype (the
“syrnptoms”) and the genotype (the DNA content). We will use the information
collected to try to determine the gene or genes that play a role in SMS. Participation
in this survey is completely voluntary. All answers will be kept strictly confidential.
Survey participants will not gain any direct benefit for participating in the survey,
however, this information will be very important for understanding the genes
involved in SMS.

If at anytime you have additional questions during the course of this study about the
research or your rights as a research subject, you may address them to The Michigan
State University Committee on Research Involving Human Subjects at (517) 355-
2180. In the event that any problem or question arises you may contact Dr. Sarah
Elsea at (517) 355-5597, or email at elsea@msu.edu.

 

I agree to voluntarily participate in this survey titled “Features of Smith-Magenis
syndrome: a questionnaire for parents and guardians.” Participants may refirse to
participate or discontinue involvement AT ANY TIME without penalty.

Signature Date

 

 

Please Print Name

 

This Consent form is not valid without The Institutional Review Board stamp of
certification.

 

For Office Use Only:

S #
F ' ID
SMS ID
M 9

R/I Sent?
Date S Sent
Date S Rec’d

 

147

Personal Information:

Your name

 

Your relationship to person with
SMS

 

Patient’s
name

 

Patient’s sex Patient’s date of
birth

 

Mother’s
Name

Father’s
Name

Mother's date of birth Mother's Ethnic Background

 

Father's date of birth Father's Ethnic Background

 

 

Address information is optional (see below):

Street
address

 

City
State

Zip/Postal Code
Country

 

Telephone Number (with area
code)

e-mail
address

 

Pregnancy/Birth/Diagnosis:

148

Was the pregnancy considered normal?

 

(If not, please explain any complications in the space below)

Was your child carried to
term?

 

If not, how premature was your
child?

 

What was your child’s birth
weight?

 

What was your child’s length at
birth?

At what age was your child diagnosed with
SMS?

 

How was the diagnosis confirmed (e. g. FISH,
karyotype)?

 

In the space below please explain any other features that pertain to the
pregnancy/birth of your child:

149

Physical Features:

Ifyour child displays or has been diagnosed with any of the following features, please

circle yes or no.

If you can recall when the feature first became apparent or was

diagnosed, please indicate in the space to the right. Additional comments may be
made in space to the right or at the end of this section.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

F eature/Question Cirlce Age of onset/Additional comments
Short stature Yes
No
Smaller than average midface Yes
(hypoplasia) No
General shortness of the head Yes
(brachycephaly) No
Large forehead (frontal bossing) Yes
No
Broad nasal bridge Yes
N o
Abnormal ear shape Yes
No
Down-turned upper lip Yes
N o
Projecting of the jaw Yes
(prognathism) No
Cleft lip Yes If yes, has it been corrected? and
No when?
Cleft palate Yes If yes, has it been corrected? and
No when?
Dental abnormalities Yes If yes please explain in space
No below
Unison of the eyebrow into one Yes
large brow No
(synophryS)
Upslanting eyes Yes
No
Iris anomalies Yes
No
Presence of a wandering eye Yes
(strabismus) N 0
Does the eye wander toward the Yes
nose (esotropia) No
or is wandering away from the Yes
nose (exotropia) No
Micro cornea Yes

 

150

 

 

No

 

 

 

 

 

 

 

 

 

Hoarse Voice Yes
No

Short, broad hands Yes
No

Decreased use of hands Yes
No

Fusion of the fingers or toes Yes
syndactyly) No

Cold hands/feet Yes
No

Difficulty finding shoes that fit Yes
No

Hammer toes Yes
No

High arched feet (pes cavus) Yes
No

Flat feet (pes planus) Yes
No

 

Curvature of the spine (scoliosis) Yes
Has surgery been performed to No

 

 

 

 

 

 

 

 

 

correct/prevent? If yes, at what age?
Yes
No
Skeletal/vertebral changes Yes If yes, please explain below
No
Elbow limitations (decreased Yes
abaility to extend arm fully) No
Abnormal gait Yes
No
Dry skin or psoriasis Yes
N 0
Muscle weakness Yes
No
Decreased tolerance to exercise Yes
N o

 

In the space below please explain any other features that may pertain to the physical

appearance of your child.

151

 

Development:

Please indicate the age at which your child performed the following features.

 

When did your child first...

Ag

 

high

 

Smile

 

Roll over

 

Sit up without aid

 

Crawl

 

Pull themselves up to standig

 

Stand without aid

 

Take first steps

 

Begin to walk

 

Speak first word

 

 

Speak in complete sentences

 

 

 

If your child displays or has been diagnosed with any of the following features with
regard to development, please circle yes or no. If you can recall when the feature first
became apparent or was diagnosed, please indicate in the space to the right.
Additional comments may be made in space to the right or at the end of this section.

 

 

 

 

 

 

F eature/Question Circle Age of onset or diagnosis/additional
comments
Was your child hypotonic Yes
N o
(“florapr”)
Do you know the developmental Yes Age?
No
age of your child
Has your child had their IQ Yes Measurement:
N 0
measured Age of measurement:
Does your child attend school Yes
No
Is it a special school/program Yes
No
Does your child have an aide at Yes
No

 

 

 

152

 

 

school

 

 

 

Does (did)your child use sign Yes Age used?
No

language

Did you notice a change in Yes
No

frustration level when your child

 

 

 

began to communicate more
effectively
Medical History:

If your child displays or has been diagnosed with any of the following features with

regard to their medical history, please circle yes or no. If you can recall when the

feature first became apparent or was diagnosed, please indicate in the space to the

right. Additional comments may be made in space to the right or at the end of this

 

 

 

 

 

 

 

section.
F eature/Question Circle Age of onset or diagnosis/additional
comments
Vision problems due to myopia Yes
No
(nearsightedness)
Wear glasses Yes
No
Retinal detachment Yes
No
Macular degeneration Yes
N 0
Hearing impairment Yes Specify:
No

 

 

 

153

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

If yes, has the impairment been Yes How?
No
corrects
Frequent ear infections (Otitis Yes # per year
No
media)
Have ear tubes been inserted Yes
No
Sinus infection Yes
No
Peripheral neuropathy Yes
No
Decreased sensitivity to pain Yes If yes, please explain which parts of
No
body below
Muscle cramps
Seizures Yes Types:
No
Is medication used to control? Yes Explain:
No
Tremors Yes
No
Congenital heart defects Yes
No
Breathing problems . Yes
No
Feeding problems during infancy Yes
No
Swallowing problems Yes
No
Excessive choking Yes
No
Excessive drooling Yes
No
Difficulty digesting foods Yes
No
Regular constipation problems Yes
No
Bowel obstruction Yes
No
Regular loose bowel movements Yes
No

 

 

 

154

 

 

 

 

 

 

 

Frequent urinary tract infections Yes
No
Kidney abnormality Yes
No
Diabetes Yes
N o
Obesity Yes
No
High cholesterol Yes
No

 

 

 

Please list any medications your child receives in the space below:

Please list other items you believe would be helpful below:

155

 

Appendix B

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

RAII gene amplification primers
RAIl Forward Primer Reverse Primer Annealing
Exon Temp
1 RA1:CCI‘TCCCTCCCTCCCTCCC RA2:CACCCCTGCAGGTAGTGG 65°C
'ITCC CT G
1+2 RA3:CGCI‘ATGCTGGTGAGGAG RA4:CCGACTGGTAGGCATGAA 64 °C
AGCC GATTC
2 RAS :CCATGACAGGCCGCTGAC RA6:CAGGGAGCTT GTCCTT CT G 62 °C
TGC AAG
I'24-3 RA7:CT GACCACAGCCAC'I'T CA RA8:CACGGACTCGGGCITGGC 63 °C
TGCC CI‘T CG
3 RA9:CAGC'IT CCT CT ACT GCAAC RA 1 0:GCGAAGGCCACGGAAGG 60 °C
CAG GTCTT C
3 M1 1 :GCCCGACTCCTTGCAGCT RA 1 2:CCGGTCAGCC'I'1’GGCCAC 65 °C
GGAC CT CGG
3 RAl3zGGACTTCAAGCAGGAGG RA14:CAGAGAGGCGTCCGAGG 64 °C
AGGTGG TGGTG
*3 RA 1 5 :CACATGAAGCAGGTGAA RA 1 6:CTGGAGGCAGCCTTGGG 65 °C
GAGG TGAG
*3 RA] 7:CG'ITCT CT CACGGCCCT G RA18:GCCACTGGCGTTGCTGCT 68 °C
AGTG GCTGC
*3 RA19:GCGCT CAAAAGGAAGTC RA20:CCACAT'I'I‘ACCAGGCCI‘T 64 °C
GGCC ‘ C'I'T CC
‘3 RA21:CCCI'TTCCGACAAAGACC RA22:GTGTGGCCTGGCTGTTTC 64 °C
GTGG TGTG
‘3 RA23:GGAGGAGCTGGGCCTGG RA24 :CAAGTGCATCGTGGAGG 64 °C
CCT C AGAGG
4 RA25:CCTGGCCACACTCCCTGG RA26:CTGCCGGAGCCTCCTTGC 68 °C
AGG TGCAC
5 SHEl :TGTGCAGCTGCCGCCACT SHE2 :ACT CT GCAGATTGTCCCG 57 °C
AGA
6 SHES :GCACACACCACCAACCC SHE6:AATGCCTCATITCCATGT 62 °C
TCACT CC
7 SHE7:GGTGCACAGGTTGCCCIT SHE8:GCTGTCCTTGCTGTGGGT 59 °C
AAT TCT
8 RA45 :GGACTGTGAAGGAGGTG RA46:GGAGTGGAGTGGAGTGT 66 °C
CGAGG GGAGG
9 RA35zGAGGCTCCTGTGCTAC'IT RA36zG'I‘TGACACAGCCCAACC 64 °C
TGCC ATGTGC
9 RA37:GCACATGGTTGGGCTGTG RA38bzGTCAATAAAGATACAAC 62 °C
TCAAC GATTG
9 RA39:CAGCTCGATACACACAA RA40:CCGTTGTGCACCACCAGG 64 °C
TCT'T C GACC
9 RA41:GGTCCCTGGTGGTGCACA RA42 :GTGGGAGACGGCTTTGTC 64 °C
ACGG CT GG
9 RA43 :CCAGGACAAAGCCGTCT RA44:GACTGTGAAGTCCGAGG 57 °C
CCCAC TCGTC

 

 

 

 

Primer pairs noted with "' require addition of Q solution of 5 M betaine

156

 

APPENDIX C

This mouse assessment was developed by the project PI, Dr. Sarah H. Elsea. The form usually has entried for
mice up to one year old.

 

Elsea lab physical and behavioral assessment for transgenidgene-targeted mice

Name of investigator:

Mouse number: Sex:

DOB: Coat color:
Strain: Genotype:

‘Please note any physical or behavioral abnormalies, even if not specifically indicated on this form"I
Directions for performing most of the physical and behavioral tests are given at the end of this form
Please perform the assays requiring anesthesia last!

{“131 l“""1".’1’"".“ {{T‘ Y;:5 HP“); Vt" “writ“ Fag“ f

 

 

 

 

 

 

 

 

 

 

 

 

 

{.4 i he. ,
,- v; 3* “rt t 5‘51 i: Q. "6* t .312: ‘5' ‘
Whisker appearance and length (in mm)
Skin or fur abnormalities? yes/no yes/no yes/no
If so, where?
Bald patches? yes/no yes/no yes/no
If so, where?
Condition of genital/rectal areas
Condition of nails
Condition of teeth
Cage movement? yes/no yes/no yes/no
Briefly describe
Righting? Did mouse Did mouse Did mouse
right itself? right itself? right itself?
yes/no
time in secs: time in secs: time in secs:
Sound orienting? Right: Right: Right:
yes/no yes/no yes/no
Left: Left: Left:
yes/no yes/no yes/no
Pupil constriction/dilation? Right eye: Right eye: Right eye:
Constriction? Constriction? Constriction?
yes/no yes/no yes/no
Dilation? Dilation? Dilation?
yes/no yes/no yes/no
Left eye: Left eye: Left eye:
Constriction? Constriction? Constriction?
yes/no yes/no yes/no
Dilation? Dilation? Dilation?
yes/no yes/no yes/no

 

 

 

 

 

 

 

 

 

 

Distance from outer ear to outer ear (rmn)

 

 

Whisker response? Normal/ Normal/ Normal!
Normal/abnormal
If abnormal, please comment abnormal abnormal abnormal
Eye blink? Right eye: Right eye: Right eye:
Ifno, please comment yes/no yes/no yes/no
Left eye: Lefl eye: Left eye:
yes/no yes/no yes/no
Ear twitch? Right ear: Right ear: Right car:
If no, please comment yes/no yes/no yes/no
Left ear: Left ear: Left ear:

 

 

Distance from outer eye to outer eye (mm)

 

Distance from top of head to tip of nose (mm)

 

Distance from tip of nose to tip of warm)

 

Length of trunk from mandible (mm)

 

 

 

 

If so, please comment

 

 

 

 

Length of limb -front left (m) From toe to From toe to From toe to
knee: knee: knee:
From knee to From knee to From knee to
hip: hip: hip:
Length of limb-front right (m) From toe to From toe to From toe to
knee: knee: knee:
From knee to From knee to From knee to
hip: hip: hip:
Length of limb-back left (m) From toe to From toe to From toe to
knee: knee: knee:
From knee to From knee to From knee to
hip: hip: hip:
Length of limb-back right (rmn) From toe to From toe to From toe to
knee: knee: knee:
From knee to From knee to From knee to
thigh: thigh: thigh:

Wild running? yes/no yes/no yes/no

 

158

 

 

 

 

 

 

 

 

 

 

 

 
  
   
  
   

 

 

 

 

 

Ifunusual gaitz please comment

 

159

  
 
 

Freezing? yes/no yes/no yes/no
If so, please comment
Sniffing? yes/no yes/no yes/no
Licking? yes/no yes/no yes/no
Rearing? yes/no yes/no yes/no
Defecation? yes/no yes/no yes/no
Urination? yes/no yes/no yes/no
Movement around entire cage? yes/no yes/no yes/no
Postural reflex Cage shake Cage shake
Was animal able to stay upright for 10s test? from side to from side to
If no, please comment side: side:
yes/no yes/no
Cage shake up Cage shake up
and down: and down:
yes/no Yes/no
Response to being picked up by tail Normal] Normal/
Normal/abnormal abnormal abnormal
If abnormal, please comment
Cage top hang test (seconds) Test 1: Test 1:
Test three times (max 60 seconds)
Test 2: Test 2:
Test 3: Test 3:
Gaiting test Normal Normal/
Normal/abnormal abnormal

 

 

 

Hot plate test (seconds) Time:

Note time in seconds and appropriate assessment
(using letters) of mouse‘s response:

a. jump

b raise paw
c. paw lick Response:
d. paw shake
e other (please comment)

Response:

Max trial time is 30 seconds

 

 

Has this animal displayed normal breeding behavior?
# of litters?

Size of litters?

Comments:

Cause of death?
Euthanasia or other
Date of death:
Age at death:

 

 

160

 

Description of physical tests
Righting: turn the mouse onto its back and measure time in seconds for mouse to
right itself; comment if mouse is unable to right itself or unusual
response is noted
Sound orienting: make brief, sharp sound to the right and left of mouse; note if
mouse turns head in appropriate direction
Pupil constriction/dilation: with a pen-light, shine a beam of light in the direction
of the mouse’s eye; constriction should occur when
light is shone and dilation should occur when light is
removed
Whisker response: lightly brush the whiskers of freely moving animal with a small
paint brush and note response (normal mice will stop moving
their whiskers and may turn head)
Eye blink: approach the eye with the tip of a clean cotton swab and note if eye
blinks (test both eyes)
Ear twitch: touch with ear with the tip of a clean cotton swab and note if ear
twitches (test both ears)

Bodily measurements

Anesthesize the mouse with isofluorane prior to conducting measurements. A cotton
ball at the bottom of the jar is soaked with 300 pL of isofluorane and the mice are
placed in the chamber. A cover is placed on the jar but oxygen flow is retained by
not sealing the jar completely. At this isofluorane concentration, the mice take
approximately 3 minutes to lose consciousness. Once the mice are asleep, we carry
out the measurements, which takes <5 rrrinutes. If the mice wake up during the
procedure, they are placed back in the chamber. After every third mouse, an
additional 300 pL of isofluorane is added. The mice tolerate this dosage of anesthesic
well and wake up and move about within 5 minutes of performing the measurements.

Sensorimotor and reflexes

Postural reflex: place mouse in empty cage shake from side to side and up and
down for 10 seconds each; note mouse’s ability to maintain
upright position

Response to being picked up by tail: note response when mouse is picked up by tail

for 10 8; normal response is to raise head,
extend extremities and reach for ground when
lowered

Cage top hang test: hang mouse in empty cage with a cage top; measure

time in seconds for mouse to remain hanging and note crawling movement along cage
top; repeat test three times (max 60 seconds)

Gaiting test: gaiting is measured by coloring each mouse’s foot with one color
(using non-toxic materials) and walking mouse through a small tunnel

161

on white paper
Hot-plate test: place mouse on analgesic hot plate set at 60°C and measure
time in seconds for mouse to display a common response
(jump, raise paw, paw lick or paw shake) or an unusual
response (note and comment); max trial time is 30 secs.

162

REFERENCES

--------- (2000) Technical and clinical assessment of fluorescence in situ
hybridization: an ACMG/ASHG position statement. 1. Technical
considerations. Test and Technology Transfer Committee. Genet Med 2:356-
361

Aasland R, Gibson TJ, Stewart AF (1995) The PHI) finger: implications for
chromatin-mediated transcriptional regulation. Trends Biochem Sci 20:56-59

Alagille D, Odievre M, Gautier M, Dommergues JP (1975) Hepatic ductular
hypoplasia associated with characteristic facies, vertebral malformations,

retarded physical, mental, and sexual development, and cardiac murmur. J
Pediatr 86:63-71

Allanson J E, Greenberg F, Smith AC (1999) The face of Smith-Magenis syndrome: a
subjective and objective study. J Med Genet 36:394-397

Bailey J A, Yavor AM, Massa HF, Trask BJ, Eichler EE (2001) Segmental
duplications: organization and impact within the current human genome
project assembly. Genome Res 11:1005-1017

Belgrader P, Cheng J, Zhou X, Stephenson LS, Maquat LE (1994) Mammalian
nonsense codons can be cis effectors of nuclear mRNA half-life. Mol Cell
Biol 14:8219-8228

Bettio D, Rizzi N, Giardino D, Grugrri G, Briscioli V, Selicomi A, Carnevale F,
Larizza L (1995) FISH analysis in Prader-Willi and Angelman syndrome
patients. Am J Med Genet 56:224—228

Bi W, Ohyarna T, Nakarnura H, Yan J, Visvanathan J, Justice MJ, Lupski JR (2005)
Inactivation of Rail in mice recapitulates phenotypes observed in
chromosome engineered mouse models for Smith-Magenis syndrome. Hum
Mol Genet

Bi W, Saifi GM, Shaw CJ, Walz K, Fonseca P, Wilson M, Potocki L, Lupski JR
(2004) Mutations of RAM , a PHD-containing protein, in nondeletion patients
with Smith-Magenis syndrome. Hum Genet 115:515-524

Bi W, Yan J, Stankiewicz P, Park SS, Walz K, Boerkoel CF, Potocki L, Shaffer LG,
Devriendt K, Nowaczyk MJ, Inoue K, Lupski JR (2002) Genes in a refined
Smith-Magenis syndrome critical deletion interval on chromosome l7p11.2
and the syntenic region of the mouse. Genome Res 12:713-728

Botta A, Novelli G, Mari A, Novelli A, Sabani M, Korenberg J, Osborne LR, Digilio
MC, Giannotti A, Dallapiccola B (1999) Detection of an atypical 7q11.23

163

deletion in Williams syndrome patients which does not include the STXlA
and FZD3 genes. J Med Genet 36:478—480

Boume HR, Sanders DA, McCormick F (1991) The GTPase superfamily: conserved
structure and molecular mechanism. Nature 349:117-127

Brzezinski A (1997) Melatonin in humans. N Engl J Med 336:186-195

Burk O, Worpenberg S, Haenig B, Klempnauer KH (1997) tom-1, a novel v-Myb
target gene expressed in AMV- and E26-transformed myelomonocytic cells.
Embo J 16:1371-1380

Campbell HD, Fountain S, McLennan IS, Berven LA, Crouch MF, Davy DA, Hooper
JA, Waterford K, Chen KS, Lupski JR, Ledermann B, Young IG, Matthaei KI
(2002) Fliih, a gelsolin-related cytoskeletal regulator essential for early
mammalian embryonic development. Mol Cell Biol 22:3518-3526

Campbell I—ID, Fountain S, Young IG, Claudianos C, Hoheisel JD, Chen KS, Lupski
JR (1997) Genomic structure, evolution, and expression of human FLII, a
gelsolin and leucine-rich-repeat family member: overlap with LLGL.
Genomics 42:46-54

Campbell HD, Schimansky T, Claudianos C, Ozsarac N, Kasprzak AB, Cotsell JN,
Young IG, de Couet HG, Miklos GL (1993) The Drosophila melanogaster
flightless-I gene involved in gastrulation and muscle degeneration encodes
gelsolin-like and leucine-rich repeat domains and is conserved in
Caenorhabditis elegans and humans. Proc Natl Acad Sci U S A 90:11386-

l 1390

Cassidy SB, Allanson JE (2001) Management of genetic syndromes / edited by
Suzanne B. Cassidy, Judith E. Allanson. Wiley-Liss, New York

Chen KS, Gunaratne PH, Hoheisel JD, Young IG, Miklos GL, Greenberg F, Shaffer
LG, Campbell I-ID, Lupski JR (1995) The human homologue of the
Drosophila melanogaster flightless-I gene (flil) maps within the Smith-
Magenis microdeletion critical region in 17p11.2. Am J Hum Genet 56:175-
1 82

Chen KS, Manian P, Koeuth T, Potocki L, Zhao Q, Chinault AC, Lee CC, Lupski JR
(1997) Homologous recombination of a flanking repeat gene cluster is a

mechanism for a common contiguous gene deletion syndrome. Nat Genet
1 7: 1 54-163

Chen KS, Potocki L, Lupski JR (1996) The Smith-Magenis syndrome [del(17)p11.2]:
clinical review and molecular advances. Ment Retard Dev Disabil Res Rev
2: 122-129

Cheng J, Maquat LE (1993) Nonsense codons can reduce the abundance of nuclear
mRNA without affecting the abundance of pre-mRNA or the half-life of

164

cytoplasmic mRNA. Mol Cell Biol 13:1892-1902

Cheng KW, Lahad JP, Gray J W, Mills GB (2005) Emerging role of RAB GTPases in
cancer and human disease. Cancer Res 65:2516-2519

Cheung SW, Tishler PV, Atkins L, Sengupta SK, Modest EJ, Forget BG (1977) Gene
mapping by fluorescent in situ hybridization. Cell Biol Int Rep 1:255-262

Curran ME, Atkinson DL, Ewart AK, Morris CA, Leppert MF, Keating MT (1993)
The elastin gene is disrupted by a translocation associated with supravalvular
aortic stenosis. Cell 73:159-168

de Almeida J C, Reis DF, Martins RR (1989) Interstitial deletion of (l7)(pl 1.2). A
rrricrodeletion syndrome. Another example. Ann Genet 32: 184-186

De Leersnyder H, Bresson JL, de Blois MC, Souberbielle J C, Mogenet A, Delhotal-
Landes B, Salefianque F, Munnich A (2003) Beta l-adrenergic antagonists
and melatonin reset the clock and restore sleep in a circadian disorder, Smith-
Magenis syndrome. J Med Genet 40:74-78

De Leersnyder H, De Blois MC, Claustrat B, Romana S, Albrecht U, Von Kleist-
Retzow J C, Delobel B, Viot G, Lyonnet S, Vekemans M, Munnich A (2001a)
Inversion of the circadian rhythm of melatonin in the Srrrith-Magenis
syndrome. J Pediatr 139:111-116

De Leersnyder H, de Blois MC, Vekemans M, Sidi D, Villain E, Kindermans C,
Munnich A (2001b) beta(1)-adrenergic antagonists improve sleep and
behavioural disturbances in a circadian disorder, Snritlr-Magenis syndrome. J
Med Genet 38:586-590

De Meirleir L, Seneca S, Lissens W, De Clercq I, Eyskens F, Gerlo E, Smet J, Van
Coster R (2004) Respiratory chain complex V deficiency due to a mutation in
the assembly gene ATP12. J Med Genet 41 : 120-124

Dobkin C, Rabe A, Dumas R, El Idrissi A, Haubenstock H, Brown WT (2000) Fmrl
knockout mouse has a distinctive strain-specific learning impairment.
Neuroscience 100:423-429

Donnai D, Karmiloff-Smith A (2000) Williams syndrome: from genotype through to
the cognitive phenotype. Am J Med Genet 97:164-171

Dykens EM, F inucane BM, Gayley C (1997) Brief report: cognitive and behavioral
profiles in persons with Snrith-Magenis syndrome. J Autism Dev Disord
27:203-21 1

Eichler EE (1998) Masquerading repeats: paralogous pitfalls of the human genome.
Genome Res 8:758-762

Elsea SH, Fritz E, Schoener-Scott R, Meyn MS, Patel PI (1998) Gene for
topoisomerase III maps within the Smith-Magenis syndrome critical region:

165

analysis of cell-cycle distribution and radiation sensitivity. Am J Med Genet
75: 104-108

Elsea SH, Mykytyn K, Ferrell K, Coulter KL, Das P, Dubiel W, Patel PI, Metherall
JE (1999) Henrizygosity for the COP9 signalosome subunit gene, SGN3, in
the Smith-Magenis syndrome. Am J Med Genet 87:342-348

Elsea SH, Purandare SM, Adell RA, Juyal RC, Davis JG, Finucane B, Magerris RE,
Patel PI (1997) Definition of the critical interval for Smith-Magenis
syndrome. Cytogenet Cell Genet 79:276-281

Ewart AK, Morris CA, Ensing GJ, Loker J, Moore C, Leppert M, Keating M (1993)
A human vascular disorder, supravalvular aortic stenosis, maps to
chromosome 7. Proc Natl Acad Sci U S A 90:3226-3230

Fashena SJ, Serebriiskii I, Golerrris EA (2000) The continued evolution of two-hybrid
screening approaches in yeast: how to outwit different preys with different
baits. Gene 250:1-14

Fields S, Song 0 (1989) A novel genetic system to detect protein-protein interactions.
Nature 340:245-246

F inucane B, Dinigl KH, Simon EW (2001) Characterization of self-injurious
behaviors in children and adults with Srrrith-Magenis syndrome. Am J Ment
Retard 106:52-58

Finucane BM, J aeger ER, Kurtz MB, Weinstein M, Scott CI, Jr. (1993) Eye
abnormalities in the Srrrith-Magenis contiguous gene deletion syndrome. Am J
Med Genet 45:443-446

Fleming RE, Holden CC, Tomatsu S, Waheed A, Brunt EM, Britton RS, Bacon BR,
Roopenian DC, Sly WS (2001) Mouse strain differences determine severity of

iron accumulation in er knockout model of hereditary hemochromatosis.
Proc Natl Acad Sci U S A 98:2707-2711

Fritz E, Elsea SH, Patel PI, Meyn MS (1997) Overexpression of a truncated human
topoisomerase III partially corrects multiple aspects of the ataxia-
telangiectasia phenotype. Proc Natl Acad Sci U S A 94:4538-4542

Gerber HP, Seipel K, Georgiev O, Hofferer M, Hug M, Rusconi S, Schaffner W
(1994) Transcriptional activation modulated by homopolymeric glutamine and
proline stretches. Science 263:808-811

Girirajan S, Elsas Ii LJ, Devriendt KH, Elsea SH (2005) RAIl variations in Smith-
Magerris syndrome patients without l7p11.2 deletions. J Med Genet

Gong W, Emanuel BS, Collins J, Kim DH, Wang Z, Chen F, Zhang G, Roe B, Budarf
ML (1996) A transcription map of the DiGeorge and velo-cardio-facial
syndrome minimal critical region on 22q11. Hum Mol Genet 5:789-800

166

Greenberg F, Guzzetta V, Montes de Oca-Luna R, Magenis RE, Smith AC, Richter
SF, Kondo I, Dobyns WB, Patel PI, Lupski JR (1991) Molecular analysis of
the Smith-Magenis syndrome: a possible contiguous-gene syndrome
associated with del(17)(p11.2). Am J Hum Genet 49: 1207-1218

Greenberg F, Lewis RA, Potocki L, Glaze D, Parke J, Killian J, Murphy MA,
Williamson D, Brown F, Dutton R, McCluggage C, Friedman E, Sulek M,
Lupski JR (1996) Multi-disciplinary clinical study of Smith-Magenis
syndrome (deletion 17p11.2). Am J Med Genet 62:247-254

Guzzetta V, Franco B, Trask BJ, Zhang H, Saucedo-Cardenas O, Montes de Oca-
Luna R, Greenberg F, Chinault AC, Lupski JR, Patel PI (1992) Somatic cell
hybrids, sequence-tagged sites, simple repeat polymorphisms, and yeast
artificial chromosomes for physical and genetic mapping of proximal 17p.
Genomics 13:551-559

Hanai R, Caron PR, Wang JC (1996) Human TOP3: a single-copy gene encoding
DNA topoisomerase HI. Proc Natl Acad Sci U S A 93:3653-3657

Hol FA, Hamel BC, Geurds MP, Hansmann I, Nabben FA, Daniels 0, Mariman EC
(1995) Localization of Alagille syndrome to 20p11.2-p12 by linkage analysis
of a three-generation family. Hum Genet 95:687-690

Hua X, Wu J, Goldstein JL, Brown MS, Hobbs I-IH (1995) Structure of the human
gene encoding sterol regulatory element binding protein-1 (SREBFl) and
localization of SREBF 1 and SREBF2 to chromosomes 17p11.2 and 22q13.
Genomics 25:667-673

Humphries MM, Kiang S, McNally N, Donovan MA, Sieving PA, Bush RA,
Machida S, Cotter T, Hobson A, Farrar J, Humphries P, Kenna P (2001)
Comparative structural and functional analysis of photoreceptor neurons of
Rho-/- mice reveal increased survival on C57BL/6J in comparison to 129Sv
genetic background. Vis Neurosci 18:43 7-443

Imai Y, Suzuki Y, Matsui T, Tohyarna M, Wanaka A, Takagi T (1995) Cloning of a
retinoic acid-induced gene, GT1, in the embryonal carcinoma cell line P19:

neuron-specific expression in the mouse brain. Brain Res Mol Brain Res 31 :1-
9

J i Y, Eichler EE, Schwartz S, Nicholls RD (2000) Structure of chromosomal
duplicons and their role in mediating human genorrric disorders. Genome Res
10:597-610

J uyal RC, Figuera LE, Hauge X, Elsea SH, Lupski JR, Greenberg F, Baldini A, Patel
PI (1996) Molecular analyses of 17p11.2 deletions in 62 Smith-Magenis
syndrome patients. Am J Hum Genet 58:998-1007

Kalkhoven E, Roelfsema JH, Teunissen H, den Boer A, Ariyurek Y, Zantema A,
Breuning MH, Hennekam RC, Peters DJ (2003) Loss of CBP

167

acetyltransferase activity by PHD finger mutations in Rubinstein-Taybi
syndrome. Hum Mol Genet 12:441-450

Kallionienri OP, Kallioniemi A, Mascio L, Sudar D, Pinkel D, Deaven L, Gray J
(1994) Physical mapping of chromosome 17 cosmids by fluorescence in situ
hybridization and digital image analysis. Genomics 20: 125-128

Kozak M (1986) Point mutations define a sequence flanking the AUG initiator codon
that modulates translation by eukaryotic ribosomes. Cell 44:283-292

Krantz ID, Piccoli DA, Spinner NB (1999) Clinical and molecular genetics of
Alagille syndrome. Curr Opin Pediatr 11:558-564

Kumar S, Tomooka Y, Noda M (1992) Identification of a set of genes with
developmentally down-regulated expression in the mouse brain. Biochem
Biophys Res Commun 185:1155-1161

Langston AW, Gudas LJ (1994) Retinoic acid and homeobox gene regulation. Curr
Opin Genet Dev 4:550-555

Li B, Trueb B (2000) DRG represents a family of two closely related GTP-binding
proteins. Biochirn Biophys Acta 1491 : 196-204

Li DY, Toland AE, Boak BB, Atkinson DL, Ensing GJ, Morris CA, Keating MT
(19973) Elastin point mutations cause an obstructive vascular disease,
supravalvular aortic stenosis. Hum Mol Genet 6: 1021-1028

Li L, Krantz ID, Deng Y, Genin A, Banta AB, Collins CC, Qi M, Trask BJ, Kuo WL,
Cochran J, Costa T, Pierpont ME, Rand EB, Piccoli DA, Hood L, Spinner NB
(1997b) Alagille syndrome is caused by mutations in human J aggedl, which
encodes a ligand for Notchl. Nat Genet 16:243-251

Liang Y, Wang A, Belyantseva IA, Anderson DW, Probst F J , Barber TD, Miller W,
Touchman JW, J in L, Sullivan SL, Sellers JR, Camper SA, Lloyd RV, Kachar
B, Friedman TB, Fridell RA (1999) Characterization of the human and mouse
unconventional myosin XV genes responsible for hereditary deafness DFNB3
and shaker 2. Genorrrics 61 :243-258

Lockwood D, Hecht F, Dowman C, Hecht BK, Rizkallah TH, Goodwin TM,
Allanson J (1988) Chromosome subband 17p11.2 deletion: a minute deletion
syndrome. J Med Genet 25:732-737

Lohi O, Lehto VP (1998) VHS domain marks a group of proteins involved in
endocytosis and vesicular trafficking. F EBS Lett 440:255-257

Lowery MC, Morris CA, Ewart A, Brothman LJ, Zhu XL, Leonard CO, Carey J C,
Keating M, Brothman AR (1995) Strong correlation of elastin deletions,
detected by FISH, with Williams syndrome: evaluation of 235 patients. Am J
Hum Genet 57:49-53

168

Lucas RE, Vlangos CN, Das P, Patel P1, Elsea SH (2001) Genomic organisation of
the approximately 1.5 Mb Srrrith-Magenis syndrome critical interval:
transcription map, genomic contig, and candidate gene analysis. Eur J Hum
Genet 9:892-902

Luiro K, Yliannala K, Ahtiainen L, Maunu H, J arvela I, Kyttala A, J alanko A (2004)
Interconnections of CLN3, Hookl and Rab proteins link Batten disease to
defects in the endoch pathway. Hum Mol Genet 13:3017-3027

Luo B, Aster JC, Hasserjian RP, Kuo F, Sklar J (1997) Isolation and fimctional
analysis of a cDNA for human J agged2, a gene encoding a ligand for the
Notchl receptor. Mol Cell Biol 17:6057-6067

Lupski JR (1998) Genomic disorders: structural features of the genome can lead to
DNA rearrangements and human disease traits. Trends Genet 14:417-422

Lynch HJ, Wurtrnan RJ, Moskowitz MA, Archer MC, Ho MH (1975) Daily rhythm
in human urinary melatonin. Science 187 :169-1 71

Maier D, Stumm G, Kuhn K, Preiss A (1992) Hairless, a Drosophila gene involved in
neural development, encodes a novel, serine rich protein. Mech Dev 38: 143-
156

McClive P, Pall G, Newton K, Lee M, Mullins J, Forrester L (1998) Gene trap
integrations expressed in the developing heart: insertion site affects splicing of
the PTl-ATG vector. Dev Dyn 212:267-276

Meng X, Lu X, Li Z, Green ED, Massa H, Trask BJ, Morris CA, Keating MT (1998)
Complete physical map of the common deletion region in Williams syndrome
and identification and characterization of three novel genes. Hum Genet
1 03 :590-599

Mitchell KJ, Pinson KI, Kelly OG, Brennan J, Zupicich J, Scherz P, Leighton PA,
Goodrich LV, Lu X, Avery BJ, Tate P, Dill K, Pangilinan E, Wakenight P,
Tessier-Lavigrre M, Skarnes WC (2001) Functional analysis of secreted and
transmembrane proteins critical to mouse development. Nat Genet 28:241-249

Morris CA, Demsey SA, Leonard CO, Dilts C, Blackburn BL (1988) Natural history
of Williams syndrome: physical characteristics. J Pediatr 113:318-326

Oda T, Elkahloun AG, Meltzer PS, Chandrasekharappa SC (1997a) Identification and
cloning of the human homolog (JAGl) of the rat J aggedl gene from the

Alagille syndrome critical region at 20p12. Genomics 43:376-379

Oda T, Elkalrloun AG, Pike BL, Okajima K, Krantz 1D, Genin A, Piccoli DA,
Meltzer PS, Spinner NB, Collins F S, Chandrasekharappa SC (1997b)

Mutations in the human J aggedl gene are responsible for Alagille syndrome. Nat
Genet 16:235-242

Onodera O, Oyake M, T akano H, Ikeuchi T, Igarashi S, Tsuji S (1995) Molecular
169

cloning of a firll-length cDNA for dentatorubral-pallidoluysian atrophy and
regional expressions of the expanded alleles in the CNS. Am J Hum Genet
57:1050-1060

Osborne LR (1999) Williams-Beuren syndrome: unraveling the mysteries of a
microdeletion disorder. Mol Genet Metab 67: 1-10

Park SS, Stankiewicz P, Bi W, Shaw C, Lehoczky J, Dewar K, Birren B, Lupski JR
(2002) Structure and evolution of the Smith-Magenis syndrome repeat gene
clusters, SMS-REPS. Genome Res 12:729-738

Paro R (1993) Mechanisms of heritable gene repression during development of
Drosophila. Curr Opin Cell Biol 5:999-1005

Patel PI, Roa BB, Welcher AA, Schoener-Scott R, Trask BJ, Pentao L, Snipes GJ,
Garcia CA, Francke U, Shooter EM, et al. (1992) The gene for the peripheral
myelin protein PMP-22 is a candidate for Charcot-Marie-Tooth disease type
1A. Nat Genet 1:159-165

Petrij F, Giles RH, Dauwerse HG, Saris JJ, Hennekam RC, Masuno M, Tommerup N,
van Ommen GJ, Goodman RH, Peters DJ, et al. (1995) Rubinstein-Taybi
syndrome caused by mutations in the transcriptional co-activator CBP. Nature
376:348-351

Pinkel D, Straume T, Gray JW (1986) Cytogenetic analysis using quantitative, high-
sensitivity, fluorescence hybridization. Proc Natl Acad Sci U S A 83:2934-
2938

Pollet N, Dhome-Pollet S, Deleuze JF, Boccaccio C, Driancourt C, Raynaud N, Le
Paslier D, Hadchouel M, Meunier-Rotival M (1995) Construction of a 3.7-Mb

physical map within human chromosome 20p12 ordering 18 markers in the
Alagille syndrome locus. Genorrrics 27 :467-474

Potocki L, Chen KS, Park SS, Osterholm DE, Withers MA, Kimonis V, Summers
AM, Meschino WS, Anyane-Yeboa K, Kashork CD, Shaffer LG, Lupski JR
(2000a) Molecular mechanism for duplication 17p11.2- the homologous
recombination reciprocal of the Smith-Magenis microdeletion. Nat Genet
24:84-87

Potocki L, Glaze D, Tan DX, Park SS, Kashork CD, Shaffer LG, Reiter RJ, Lupski
JR (2000b) Circadian rhythm abnormalities of melatonin in Srrrith-Magenis
syndrome. J Med Genet 37:428-433

Rodman S, Wadinger-Ness A (2000) Rab GTPases coordinate endocytosis. J Cell Sci
1 1 3: 1 83-192

Roelfsema JH, White SJ, Ariyurek Y, Bartholdi D, Niedrist D, Papadia F, Bacino CA,
den Dunnen J T, van Ommen GJ, Breuning MI-I, Hennekam RC, Peters DJ
(2005) Genetic heterogeneity in Rubinstein-Taybi syndrome: mutations in

170

both the CBP and EP300 genes cause disease. Am J Hum Genet 76:572-580

Ross SA, McCaffery PJ, Drager UC, De Luca LM (2000) Retinoids in embryonal
development. Physiol Rev 80: 1021-1054

Sazuka T, Kinoshita M, Tomooka Y, Ikawa Y, Noda M, Kumar S (1992a) Expression
of DRG during murine embryonic development. Biochem Biophys Res
Commun 189:371-377

Sazuka T, Tomooka Y, Ikawa Y, Noda M, Kumar S (1992b) DRG: a novel
developmentally regulated GTP-binding protein. Biochem Biophys Res
Commun 189:363-370

Schenker T, Lach C, Kessler B, Calderara S, Trueb B (1994) A novel GTP-binding
protein which is selectively repressed in SV4O transformed fibroblasts. J Biol
Chem 269:25447-25453

Schenker T, Trueb B (1997) Assignment of the gene for a developmentally regulated
GTP-binding protein (DRG2) to human chromosome bands 17pl3-->p12 by
in situ hybridization. Cytogenet Cell Genet 79:274-275

Schmickel RD (1986) Contiguous gene syndromes: a component of recognizable
syndromes. J Pediatr 109:231-241

Seranski P, Hoff C, Radelof U, Henrrig S, Reinhardt R, Schwartz CE, Heiss NS,
Poustka A (2001) RM] is a novel polyglutarrrine encoding gene that is deleted
in Smith-Magenis syndrome patients. Gene 270:69-76

Seroussi E, Kedra D, Kost-Alimova M, Sandberg-Nordqvist AC, Fransson 1, Jacobs
JF, Fu Y, Pan HQ, Roe BA, Irnreh S, Dumanski JP (1999) TOM] genes map
to human chromosome 22q13.1 and mouse chromosome 8C1 and encode

proteins similar to the endosomal proteins HGS and STAM. Genonrics
57:380-388

Sesca E, Perletti GP, Binasco V, Chiara M, Tessitore L (1996)
Phosphatidylethanolarnine N-methyltransferase 2 and CTP-phosphocholine
cytidylyltransferase expressions are related with protein kinase C isozymes in
developmental liver growth. Biochem Biophys Res Commun 229:158-162

Shaw CJ, Bi W, Lupski JR (2002) Genetic proof of unequal meiotic crossovers in
reciprocal deletion and duplication of 17p11.2. Am J Hum Genet 71 :1072-
108 1

Skarnes WC, Auerbach BA, Joyner AL (1992) A gene trap approach in mouse
embryonic stem cells: the lacZ reported is activated by splicing, reflects
endogenous gene expression, and is mutagenic in mice. Genes Dev 6:903-918

Slager RB, Newton TL, Vlangos CN, Finucane B, Elsea SH (2003) Mutations in
RAIl associated with Smith-Magenis syndrome. Nat Genet 33:466-468

Smith AC, Dykens E, Greenberg F (1998a) Behavioral phenotype of Srrrith-Magenis
l 71

syndrome (del 17p11.2). Am J Med Genet 81:179-185

Smith AC, Dykens E, Greenberg F (1998b) Sleep disturbance in Smith-Magenis
syndrome (del 17 p11.2). Am J Med Genet 81:186-191

Smith AC, Gropman AL, Bailey-Wilson J E, Goker-Alpan O, Elsea SH, Blancato J,
Lupski JR, Potocki L (2002) Hypercholesterolemia in children with Smith-
Magenis syndrome: del (l 7) (p11.2p11.2). Genet Med 4:118-125

Smith AC, McGavran L, Robinson J, Waldstein G, Macfarlane J, Zonona J, Reiss J,
Lahr M, Allen L, Magenis E (1986) Interstitial deletion of (17)(p1 1.2p1 1.2) in
nine patients. Am J Med Genet 24:393-414

Stagljar I (2003) Finding partners: emerging protein interaction technologies applied
to signaling networks. Sci STKE 2003:pe56

Stankiewicz P, Lupski JR (2002) Genome architecture, rearrangements and genomic
disorders. Trends Genet 18:74-82

Stankiewicz P, Shaw CJ, Dapper JD, Wakui K, Shaffer LG, Withers M, Elizondo L,
Park SS, Lupski JR (2003) Genome architecture catalyzes nonrecurrent
chromosomal rearrangements. Am J Hum Genet 72:1101-1116

Strand D, Unger S, Corvi R, Hartenstein K, Schenkel H, Kalrnes A, Merdes G,
Neumann B, Krieg-Schneider F, Coy JF, et a1. (1995) A human homologue of
the Drosophila tumour suppressor gene l(2)gl maps to l7p11.2-12 and codes
for a cytoskeletal protein that associates with nonmuscle myosin H heavy
chain. Oncogene 11:291-301

Stratton RF, Dobyns WB, Greenberg F, DeSana JB, Moore C, F idone G, Runge GH,
Feldman P, Sekhon GS, Pauli RM, et al. (1986) Interstitial deletion of
(17)(p11.2p11.2): report of six additional patients with a new chromosome
deletion syndrome. Am J Med Genet 24:421-432

Takatsu H, Katoh Y, Shiba Y, Nakayarna K (2001) Golgi-localizing, gamma-adaptin
ear homology domain, ADP-ribosylation factor-binding (GGA) proteins
interact with acidic dileucine sequences within the cytoplasmic domains of
sorting receptors through their VpsZ7p/Hrs/STAM (VHS) domains. J Biol
Chem 276:28541-28545

Tassabehji M, Metcalfe K, Donnai D, Hurst J, Reardon W, Burch M, Read AP (1997)
Elastin: genomic structure and point mutations in patients with supravalvular
aortic stenosis. Hum Mol Genet 6: 1029-1036

Toulouse A, Rochefort D, Roussel J, J oober R, Rouleau GA (2003) Molecular
cloning and characterization of human RAIl, a gene associated with
schizophrenia. Genomics 82:162-171

Trask BJ, Mefford H, van den Engh G, Massa HF, Juyal RC, Potocki L, Finucane B,
Abuelo DN, Witt DR, Magenis E, Baldini A, Greenberg F, Lupski JR, Patel

172

PI (1996) Quantification by flow cytometry of chromosome-17 deletions in
Smith-Magenis syndrome patients. Hum Genet 98:710-718

wain O, Yule W (1991) A cognitive and behavioural phenotype in Williams
syndrome. J Clin Exp Neuropsychol 13:232-244

Uitto J, Christiano AM, Kahari VM, Bashir MM, Rosenbloom J (1991) Molecular
biology and pathology of human elastin. Biochem Soc Trans 19:824-829

Urban Z, Helms C, F ekete G, Csiszar K, Bonnet D, Munnich A, Donis-Keller H,
Boyd CD (1996) 7ql 1.23 deletions in Williams syndrome arise as a
consequence of unequal meiotic crossover. Am J Hum Genet 59:958-962

Vance DE (1996) Phosphatidylethanolarnine N-methyltransferase: unexpected
findings from curiosity-driven research. Eur J Med Res 1:182-188

Vance DE, Walkey CJ, Cui Z (1997) Phosphatidylethanolarnine N-methyltransferase
from liver. Biochim Biophys Acta 1348: 142-150

Vlangos CN, Das P, Patel PI, Elsea SH (2000) Assignment of developmentally
regulated GTP-binding protein (DRG2) to human chromosome band 17p11.2
with somatic cell hybrids and localization to the Srrrith-Magenis syndrome
critical interval. Cytogenet Cell Genet 88:283-285

Vlangos CN, Wilson M, Blancato J, Smith AC, Elsea SH (2004) Diagnostic FISH
probes for del(l7)(pl l.2p11.2) associated with Smith-Magenis syndrome
should contain the RAIl gene. Am J Med Genet A 132Az278-282

Vlangos CN, Yirn DK, Elsea SH (2003) Refinement of the Srrrith-Magenis syndrome
critical region to approximately 950kb and assessment of l7p11.2 deletions.
Are all deletions created equally? Mol Genet Metab 79:134-141

Voss AK, Thomas T, Gruss P (1998) Compensation for a gene trap mutation in the
murine microtubule-associated protein 4 locus by alternative polyadenylation
and alternative splicing. Dev Dyn 212:258-266

Walkey CJ, Donohue LR, Bronson R, Agellon LB, Vance DE (1997) Disruption of
the murine gene encoding phosphatidylethanolarnine N-methyltransferase.
Proc Natl Acad Sci U S A 94:12880—12885

Walz K, Caratini-Rivera S, Bi W, Fonseca P, Mansouri DL, Lynch J, Vogel H,
Noebels J L, Bradley A, Lupski JR (2003) Modeling del(17)(p11.2p11.2) and
dup(17)(p11.2p11.2) contiguous gene syndromes by chromosome engineering
in mice: phenotypic consequences of gene dosage imbalance. Mol Cell Biol
23:3646-3655

Walz K, Spencer C, Kaasik K, Lee CC, Lupski JR, Paylor R (2004) Behavioral
characterization of mouse models for Smith-Magenis syndrome and
dup(l7)(pl 1.2p1 1.2). Hum Mol Genet 13:367-378

173

Wang A, Liang Y, Fridell RA, Probst FJ, Wilcox ER, Touchman JW, Morton CC,
Morell RJ, Noben-Trauth K, Camper SA, Friedman TB (1998) Association of

unconventional myosin W01 5 mutations with human nonsyndrorrric
deafness DFNB3. Science 280:1447-1451

Wang ZG, Sheluho D, Gatti DL, Ackerman SH (2000) The alpha-subunit of the
mitochondrial F(l) ATPase interacts directly with the assembly factor Atp12p.
Embo J 19:1486-1493

Wang ZG, White PS, Ackerman SH (2001) Atpl 1p and Atp12p are assembly factors
for the F(l)-ATPase in human mitochondria. J Biol Chem 276:30773-30778

Weaver BK, Kumar KP, Reich NC (1998) Interferon regulatory factor 3 and CREB-
binding protein/p300 are subunits of double-stranded RNA-activated
transcription factor DRAF 1. Mol Cell Biol 18: 1359-1368

Yan J, Walz K, Nakarnura H, Carattini-Rivera S, Zhao Q, Vogel H, Wei N, Justice
MJ, Bradley A, Lupski JR (2003) COP9 signalosome subunit 3 is essential for

maintenance of cell proliferation in the mouse embryonic epiblast. Mol Cell
Biol 23:6798-6808

Yang SP, Bidichandani SI, F iguera LE, Juyal RC, Saxon PJ, Baldini A, Patel PI
(1997) Molecular analysis of deletion (17)(pll.2p11.2) in a family
segregating a 17p paracentric inversion: implications for carriers of
paracentric inversions. Am J Hum Genet 60:1184-1193

174

K-