 

ta.l ( .
All-.15313ﬂ03 1. E)-

,IO'I'.‘ . ..‘O¢'»._uv.- L:o..ﬂ..l..!‘clu!ll.?v“ I1. ‘ . ‘
._ . . . . V ‘ﬁmﬁgﬁma

. . u 5 I I...» .l . A) . :
iwwﬁakég , . .,._‘.;m,.?s.vua§aﬁhﬁ _ ,
. . ....?.... I V . . . : . Wk. n5

 

THESlS

.. LIBRARY
loo 5 Michigan State
108/5? 35? 5 Ll University i

This is to certify that the
dissertation entitled

USE OF HALOTHANE GAS TO IDENTIFY PIGS WITH
NOVEL POLYMORPHISMS IN THE SKELETAL MUSCLE
CALCIUM RELEASE CHANNEL

presented by

Chuck P. Allison

has been accepted towards fulﬁllment
of the requirements for the

Doctoral degree in Animal Science

 

 

WEE-Dam}

Major Professor’s Signature
lO- (3- 04

Date

 

MSU is an Afﬁrmative Action/Equal Opportunity Institution

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 c/CIRC/Dateouejndd-ots

 

USE OF HALOTHANE GAS TO IDENTIFY PIGS WITH NOVEL POLYMORPHISMS IN
THE SKELETAL MUSCLE CALCIUM RELEASE CHANNEL

By

Chuck P. Allison

A DISSERTATION
Submitted to
Michigan State University
in partial fulﬁllment of the requirements
for the degree of
DOCTOR OF PHILOSOPHY
Department of Animal Science

2004

ABSTRACT

USE OF HALOTHANE GAS TO IDENTIFY PIGS WITH NOVEL POLYMORPHISMS IN
THE SKELETAL MUSCLE CALCIUM RELEASE CHANNEL

By

Chuck P. Allison
The objective of this study was to determine if novel polymorphisms exist in the skeletal
muscle calcium release channel gene (R YR!) that affect stress susceptibility, mobility
status, and meat quality of commercial swine. Greater than 25% of the pigs (11 = 46/184)
in two HAL-l 843-free-sire lines exhibited a severe abnormal response to halothane (HS-
H), whereas less than 2% of the pigs (n = 2/181) from two other lines were characterized
as HS-H. Pigs classiﬁed as HS-H were more prone to becoming non-ambulatory (NA)
during rigorous handling compared with pigs exhibiting no abnormal response (HS-L; P
< 0.02). Following an 8 h rest after handling, pigs were transported to harvesting
facilities. Lower ultimate pH values and higher drip losses were observed in HS-I and
HS-H pigs compared to HS-L pigs (P < 0.05). No differences in ryanodine binding were
observed between halothane categories. Twenty-two single nucleotide polymorphisms
(SNPs) were identiﬁed in the RYRI . Although these SNPs are not predicted to alter the
amino acid sequence, some appear to be associated with HS, mobility status, ryanodine
binding, and meat quality. Collectively, these data demonstrate that some HAL-1843-
normal pigs are sensitive to halothane anesthesia and are more susceptible to becoming
NA than HS-L or HS-I pigs. The genotype-phenotype associations suggest that SNPs in
the RYRI may be markers for differences in other proteins that affect stress susceptibility,

mobility status, and meat quality.

This dissertation is dedicated to my parents who have always believed in me and given
me the courage to pursue my dreams. This is also for Melissa, who has sacriﬁced
closeness with her family so that I can ﬁlrther my education, and has been there with love
and encouragement every step of the way.

ACKNOWLEDGEMENTS

This work would have not been possible without the orchestrated help of so many
that I am extremely indebted to. I would ﬁrst like to thank Dr. Roger Johnson for
allowing me to work on an independent study project under his direction and for
ultimately creating a position within his meat quality program for me, prior to attending
Michigan State University. Through interaction with Dr. Johnson, I was able to gain an
understanding of the problems facing the swine and meat industries, as well as an intense
desire to learn more.

I would like to thank my major professor, Dr. Matthew Doumit for his guidance,
friendship and for challenging me to think outside the box both in the laboratory and in
the classroom. Additionally, I would like to thank him for taking a chance and accepting
me into his program and allowing me to stay for my Ph. D. after he had seen what he had
acquired. Dr. Doumit has gone above and beyond the call of duty to ensure that I fully
understand the basic principles of meat science. I will always be grateful for the
opportunity to work under his direction and am honored to have Matt as a teacher and
mentor. I would also like to thank the members of my guidance committee, Drs. Al
Booren, Ron Bates, Roger Johnson, Gale Strasburg, and Cathy Ernst for their valuable
input and advice in my research, graduate program and this dissertation. I would also
like to acknowledge the efforts of Dr. Rob Tempelman for his assistance with the design
and analyses of the projects described in this dissertation. I am also grateful for the
friendship and guidance of Dr. Winnie Chiang. At no point in time has she refused to
help me and was very instrumental in the ryanodine binding assays and troublesome PCR

reactions. I am greatly appreciative of all her help. I would also like to thank Ms. Emily

iv

Helman. I certainly appreciate the time and effort that she put into collecting the meat
quality data on the pigs harvested at Coopersville and for keeping the lab in shape. I also
thank Ms. Nancy Raney for her help with genotyping of animals and for teaching me the
ﬁner arts of PCR.

I would like to thank Tom Forton, Jennifer Dominguez, and the Meat Lab crew
for harvesting some of the pigs used in these studies, as well as giving us access to the
meat lab to harvest other pigs. I would also like to thank Dr. George Bohart and his crew
at the veterinary clinic for use of the anesthesia equipment and for their help with
understand the signiﬁcance of the response we were observing.

I thank my lab mates, Matt Ritter, Nick Berry, Aaron Grant, and Guillermo Ortiz
Colon for a lot of fun times (yet incredibly scientiﬁc), their constructive criticism and
their willingness to help with my research program. I would also like to thank Brigitte
Grobbel, Nick Ehrke, and Sarah Erickson who have worked in the lab and whose
willingness to help has not gone unnoticed. I certainly appreciate all of the work you
guys have done.

Lastly, I would like to thank Melissa and Colton who have allowed me to follow
my dreams and have both been there in the trenches to encourage me along. Melissa left
a job that she enjoyed and good friends in a city that was thirty minutes from her parents.
She unwaveringly changed her life to move to Michigan so I could continue my
education. Her courage, commitment and strength have been both inspirational and
guiding. A wise man once told me that there is nothing like a child waiting at home to
greet you after a bad day. He was right. I will always be indebted to Melissa and Colton

for the sacriﬁces that they have made for me.

TABLE OF CONTENTS

LIST OF TABLES ......................................................................................................... viii
LIST OF FIGURES ......................................................................................................... ix
LIST OF ABBREVIATIONS .......................................................................................... x
INTRODUCTION ............................................................................................................. 1
LITERATURE REVIEW ................................................................................................. 3
A. Postmortem Changes in Skeletal Muscle .................................................................. 3

1. Red, Firm, and Non-exudative .............................................................................. 5

2. Pale, Soft, and Exudative Pork 5

3. Dark, Firm, and Dry Pork ...................................................................................... 8

B. Link Between Halothane Anesthesia and Malignant Hyperthermia ......................... 9

C. Porcine Stress Syndrome ......................................................................................... 12
D. Identiﬁcation of a Calcium Release Problem .......................................................... 13

E. Ryanodine Receptor ................................................................................................. l6

1. Physical Structure of the Ryanodine Receptor ................................................... 17

2. Gene Structure of the Ryanodine Receptor ........................................................ 19

3. Function of the Ryanodine Receptor .................................................................. 19

4. In Vitro Modulators of the Ryanodine Receptor ................................................ 21

5. Studies on Ryanodine Receptor Polymorphisms ............................................... 21

F. Genetic Basis of Porcine Stress Syndrome .............................................................. 23
G. Current Status of the Problem ................................................................................. 24
CHAPTER 1 ..................................................................................................................... 26
A. Abstract .................................................................................................................... 26
B. Introduction .............................................................................................................. 27
C. Materials and Methods ............................................................................................ 28

1. Animals and Halothane Challenge Test ............................................................. 28

2. Animal-Handling Model .................................................................................... 3O

3. Meat Quality Data Collection ............................................................................. 32

4. Statistical Analysis ............................................................................................. 33

D. Results and Discussion ............................................................................................ 34

E. Implications .............................................................................................................. 45
CHAPTER 2 ..................................................................................................................... 47
A. Abstract .................................................................................................................... 47
B. Introduction .............................................................................................................. 48
C. Materials and Methods ............................................................................................ 49

1. Animals and Halothane Testing .......................................................................... 49

2. Animal Transport, Sampling, and Handling Model ............................................ 50

vi

3. Blood Metabolites ............................................................................................... 51

4. Statistical Analysis .............................................................................................. 52

D. Results and Discussion ............................................................................................ 53

E. Implications .............................................................................................................. 63
CHAPTER 3 ..................................................................................................................... 64
A. Abstract .................................................................................................................... 64
B. Introduction .............................................................................................................. 65
C. Materials and Methods ............................................................................................ 66

1. Animals and Halothane Testing .......................................................................... 66

2. Preparation of Heavy Sarcoplasmic Reticulum ................................................... 67

3. Ryanodine Binding Assay ................................................................................... 69

4. Isolation of RNA ................................................................................................. 69

5. Reverse Transcription and Polymerase Chain Reaction ..................................... 7O

6. Isolation and PCR ampliﬁcation of Genomic DNA ............................................ 71

7. PCR Product Sequencing .................................................................................... 76

8. Statistical Analysis .............................................................................................. 76

D. Results and Discussion ............................................................................................ 76

E. Implications .............................................................................................................. 88
LITERATURE CITED ................................................................................................... 9O

vii

Table 1.1

Table 1.2

Table 1.3

Table 1.4

Table 1.5

Table 2.1

Table 2.2

Table 2.3

Table 2.4

Table 3.1

Table 3.2

Table 3.3

Table 3.4

Table 3.5

Table 3.6

Table 3.7

LIST OF TABLES
Line designations and halothane response for both experiments ..................... 35

Carcass composition and meat quality data separated by trial, line, and
halothane response. ........................................................................................... 39

Carcass composition and meat quality as affected by halothane response within
genetic lines (Exp. 2). ........................................................................................ 4O

Carcass composition and meat quality as affected by halothane response within
genetic lines (Exp. 2) ......................................................................................... 42

Effect of halothane response on carcass composition and meat quality of pigs
slaughtered at two separate packing plants following an animal-handling model

........................................................................................................................... 44
Observation recorded in response to rigorous handling ................................... 54
Number of prods received per pig separated by halothane sensitivity and

mobility status ................................................................................................... 57

Blood metabolites separated by halothane sensitivity and sampling time ........ 59
Blood metabolites separated by test period and mobility status ....................... 60

Product size, primer sequence, and annealing temperatures used for PCR
ampliﬁcation and sequencing of the Porcine ryanodine receptor gene ............. 72

Product size, primer sequence, and annealing temperatures used for PCR
ampliﬁcation and sequencing of cDNA nucleotides 3,942, 4,332, 4,365, and
7,809 of the ryanodine receptor gene ................................................................ 75

Silent single nucleotide polymorphisms identiﬁed in the porcine ryanodine
receptor gene ..................................................................................................... 77

Halothane sensitivity, the occurrence of non-ambulatory pigs, ryanodine

binding, and meat quality traits among RYRI genotypes .................................. 79
Halothane sensitivity, ryanodine binding, non-arnbulatory pigs, and meat
quality traits among RYRI genotypes ................................................................ 81

Halothane sensitivity and non-ambulatory pigs among RYRI genotypes ........ 83

Halothane sensitivity, non-ambulatory pigs, ryanodine binding, and meat
quality traits among RYRI genotypes ................................................................ 87

viii

LIST OF FIGURES

Figure 1.1 Representative example of muscle rigidity observed in pigs subjected to 3%
halothane .......................................................................................................... 31

Figure 3.1 Sequence of PCR product ampliﬁed to determine nucleotide sequence at
position 3,942 ................................................................................................... 74

Figure 3.2 Sequence of PCR product ampliﬁed to determine nucleotide sequence at
position 4,332 and 4,365 .................................................................................. 74

Figure 3.3 Sequence of PCR product ampliﬁed to determine nucleotide sequence at
position 7,809 ................................................................................................... 75

Figure 3.4 Representative chromatogram depicting disagreements between cDNA and
gDNA sequences .............................................................................................. 85

LIST OF ABBREVIATIONS
ADP — Adenosine Diphosphate
ADARl — Adenosine Deaminase acting on RNA
AMP — Adenosine Monophosphate
ATP — Adenosine Triphosphate
BHB — Beta-hydroxybutyrate
BUN - Blood Urea Nitrogen
CPK - Creatine Phosphokinase
cDNA — Complementary Deoxyribonucleic Acid
DFD — Dark, Firm, and Dry
DHP — Dihydropyridine Receptor
DNA — Deoxyribonucleic Acid
FD — Fat-O-Meter Fat Depth
FKBP12 — FK506 Binding Protein 12
HAL-1843-normal — C/C at nucleotide 1843
HCW — Hot Carcass Weight
HN - Halothane Non-Sensitive
HS — Halothane Sensitive
HS-L — Halothane Sensitive Low
HS-I — Halothane Sensitive Intermediate
HS-H — Halothane Sensitive High
IVCT — in vitro Contracture Test

L6 — Minolta (CIE) L“ values taken at d 6 postmortem

L7 — Minolta (CIE) L“ values taken at d 7 postmortem
LD — Longissimus Dorsi

LM — Longissismus Muscle

MD — F at-O-Meter Muscle Depth

MH — Malignant Hyperthermia

MSU - Michigan State University

NA — Non-ambulatory

NADH — Nicotinamide Adenine Dinucleotide, reduced form
NAD+ - Nicotinamide Adenine Dinucleotide

NEFA — Non-esteriﬁed Free Fatty Acid

PCR — Polymerase Chain Reaction

PRKAG3 - protein kinase, AMP activated, gamma 3 subunit
PSE — Pale, Soft, and Exudative

PSS — Porcine Stress Syndrome

Rn' - Rendement Napole

RNA — Ribonucleic Acid

RYRl — Skeletal Muscle Ryanodine Receptor

RYRI — Skeletal Muscle Ryanodine Receptor Gene
RYR2 — Cardiac Muscle Ryanodine Receptor Gene
RYR3 — Brain Ryanodine Receptor Gene

SNP — Single Nucleotide Polymorphism

SR — Sarcoplasmic Reticulum

xi

INTRODUCTION

Research to date has been unable to conclusively establish factors that are
responsible for sudden death losses and inferior quality pork (Cassens, 2000). The
economic loss associated with inferior meat color and reduced water-holding capacity has
been estimated to be $.90 per market hog harvested (Stetzer and McKeith, 2003). During
2003, 98,400,000 market pigs were harvested in federally inspected plants (Cattle-fax,
2003). Thus, one can estimate that $88,560,000 was potentially lost due to inferior
quality pork products. Additionally, the number of dead and non-arnbulatory pigs that
arrive at harvesting facilities appears to be increasing (Ivers et al., 2002a and 2002b; Ellis
et al., 2003). Unfortunately, the ﬁnancial losses from dead and non—ambulatory pigs are
currently difﬁcult to quantify. Based on an estimated frequency of occurrence at
approximately 1% (Ellis et al., 2003; Ritter et al., 2004) and the value of a market hog
being approximately $100.00, the ﬁnancial loss can be expected to exceed $90 million a
year. Although changes, such as removal of the HAL-1843 polymorphism from many
nucleus herds, have been implemented to reduce non-ambulatory pigs and inferior pork
quality, these measures have been largely ineffective (Cassens, 2000).

Rempel et a1. (1993) subjected 240 pigs to a halothane challenge test and
genotyped these animals for the HAL-1843 polymorphism in the skeletal muscle calcium
release channel gene (ryanodine receptor; RYRI) using a DNA based test. Based on
Mendelian ratios, the authors expected 88 of the animals to respond abnormally to
halothane; however, they observed a total of 143. In addition, 66 pigs considered non-
reactors (carrier and negative genotypes) responded abnormally to halothane. Most

importantly, seven pigs (result of carrier-to-carrier mating, n=121) classiﬁed as

homozygous normal (C/C at nucleotide 1843 in the RYRI ; HAL-1843-normal) exhibited
an abnormal response to the halothane anesthesia. Thus, it seems reasonable to
hypothesize that other mutations may occur in RYRl that would lead to altered calcium
regulation and inferior meat quality. Indeed, twenty-three other mutations in the human
RYRI have been identiﬁed that are linked to halothane sensitivity (Girard et al., 2001).

It is unclear if HAL-1 843-normal pigs that exhibit an abnormal response to
halothane perform differently than those that are considered to exhibit a normal response
to halothane. Moreover, it is unknown if any of the twenty-three human RYRI
polymorphisms are also found in the pig. Thus, I hypothesize that pigs contain other
polymorphisms in the RYRI gene that will have adverse effects on RYRl function and
cellular regulation of calcium. Novel polymorphisms could account for the perceived
increase in the number of dead and non-ambulatory pigs, and pork products that exhibit
pale color and reduced water-holding capacity. In order to test this hypothesis, I have
established the following objectives: 1) identify a population of HAL-1 843 -normal pigs
that exhibit an abnormal response to halothane anesthesia, 2) determine the relationship
between halothane sensitivity and carcass composition or meat quality, 3) assess whether
halothane sensitive pigs are more prone to becoming non-ambulatory or dying when
subjected to rigorous handling, 4) quantify differences in ryanodine binding between
halothane sensitive and non-sensitive pigs, 5) screen the R YRI cDNA for novel
polymorphisms and 6) evaluate the association between polymorphisms and halothane

sensitivity, mobility status, carcass composition and meat quality.

LITERATURE REVIEW

Postmortem Changes in Skeletal Muscle

Once an animal has been exsanguinated, muscle cells are deprived of oxygen
and are no longer capable of generating energy via aerobic metabolism. The cells are
therefore forced to switch to anaerobic metabolism to generate the energy needed for
cellular function. The biochemical reactions that occur in the skeletal muscle cell just
prior to and after exsanguination are largely responsible for the ultimate quality of meat.
The muscles of living pigs have been demonstrated to be moderately dark in color, ﬁrm
in texture and dry in appearance (Briskey, 1964b). The magnitude of change in muscle
characteristics from those of living muscle is a direct result of muscle temperature and the
rate and extent of postmortem pH decline.

The net products of anaerobic glycolysis of one glucose molecule are two
molecules of adenosine triphosphate (ATP), two molecules of lactate, and two hydrogen
ions. Thus, postmortem demands for ATP will result in hydrogen ion accumulation,
which will in turn cause the muscle pH to decline. The rate of glycolysis is therefore
determined by the energy utilization of the cell. The major sites of ATP utilization are
the myoﬁbrillar (myosin) ATPase, calcium ATPase, and sodium/potassium ATPase.
Myosin ATPase catalyzes the hydrolysis of ATP to adenosine diphosphate (ADP) and
inorganic phosphate releasing the tension generated from muscle contraction and
repositions the myosin head to a 90° angle (Bechtel and Best, 1985). The amount of ATP
hydrolyzed by myosin ATPase during a single muscle twitch is approximately 0.3

mmoles/L (Infante and Davies, 1962). The calcium ATPase functions to resequester

calcium into the sarcoplasmic reticulum (SR) so that relaxation of skeletal muscle can
occur. Bechtel and Best (1985) calculated the amount of ATP to resequester the calcium
released during a single muscle twitch to be about 0.1 mmole/L. The sodium/potassium
pump is responsible for maintaining a net negative charge on the inside of the cell. This
is accomplished by the removal of three sodium ions and the uptake of two potassium
ions into the cell. Thus, it can be estimated that 1 umole/L of ATP is needed to remove
the sodium ions that entered the cell during an action potential (Bechtel and Best, 1985).

The extent of anaerobic glycolysis is related to the amount of glucose or glycogen
that is available to be processed through glycolytic metabolism and the stability of
glycolytic enzymes. Monin et al. (1981) demonstrated that glycolytic potential, a
measure of available substrates and end products of anaerobic metabolism, could be
measured early postmortem and used as an indicator of potential lactate formation and
consequently hydrogen ion accumulation. Eventually, anaerobic metabolism will cease
to replenish muscle ATP and permanent actin-myosin crossbridges will form. At this
point the muscle is said to be in rigor.

Forrest et al. (1963) noted that the ultimate morphology of porcine muscle ranged
from pale, soft and exudative to dark, ﬁrm and dry in appearance. The patterns of pH
decline (Briskey, 1964a), and the pH and temperature relationships in the muscle prior to
the onset of rigor mortis are associated with the ultimate meat quality classiﬁcation

(Sayre and Briskey, 1963). A brief description of each condition will follow.

Rediirm, and Non-exudative Pork

The National Pork Producers Council’s Pork Quality Solutions Team has
developed targets for red, ﬁrm, and non-exudative fresh pork quality (normal). These
targets are to be used as ranges for pork longissimus traits measured at 24 hr postmortem.
This group suggests that ultimate pH values should range from 5.6 to 5.9 and color
should be from 3 to 5 visually on a six-point scale (1 = pale; 6 = dark red) or when
measured objectively in the range of 49 to 37 (Minolta CIE L). Most importantly, they
suggest that drip loss should not exceed 2.5%.

Wismer-Pedersen and Briskey (1961) demonstrated that when glycolysis proceeds
at an intermediate rate, which requires 6-12 h until lactate production ceases, the muscle
exhibits a grayish pink to red color, moderately ﬁrm structure and dry appearance. In
1963, Sayre and Briskey reported that if the pH of the muscle is above 6.0 at 2 h
postmortem and temperature is below 35°C at the onset of rigor, the muscle would
exhibit normal properties regardless of the ultimate pH. Additionally, they observed
highly signiﬁcant correlations between muscle protein solubility and water-holding
capacity. Scopes and Lawrie (1963) demonstrated that as the normal ultimate pH of 5.5
is attained, certain sarcoplasmic proteins are already denatured. These data demonstrated
that even under normal glycolytic conditions, there is a gradual drop in the solubility of
sarcoplasmic proteins and a slight decrease in water-holding capacity of the meat.

Pale. Soft. and Exudative Pork
Pale, soft, and exudative (PSE) pork is often associated with a rapid pH decline
that results in low muscle pH in combination with high muscle temperature. Fujii et al.

(1991) suggested that PSE pork is associated the HAL-1843 polymorphism in RYRl.

This polymorphism appears to result in a hypersensitive gating of the calcium release
channel where channel opening is facilitated and closing is inhibited. Although it is
currently possible to identify pigs that are homozygous or heterozygous for this
polymorphism, breeds and lines of pigs that do not possess this genetic defect still
produce pork carcasses that exhibit PSE characteristics (Pommier and Houde, 1993).

A survey of 14 packing plants by Kauffman et al. (1992) revealed that
approximately 16% of pork products exhibited PSE characteristics. Moreover, the Pork
Quality Chain Audit (Cannon et al., 1996) and the National Pork Producers Council
(1991), found that >10% of all pork carcasses generated in the United States contained
PSE meat. Results from the most recent Pork Chain Audit suggest that the percentage of
PSE meat in the swine industry has increased from 10.2% to 15.5% in the last ten years
(Stetzer and McKeith, 2003). This translates into production losses that are estimated to
have increased $0.56 per carcass over the same time period. Collectively, it can be
estimated that approximately $161 million dollars were lost last year due to pork products
with inferior color and reduced water-holding capacity.

Pale, watery meat can develop as a result of excitement of pigs prior to stunning
causing an increase in body temperature and rate of anaerobic metabolism. As previously
described, the increase in glycolytic rate accelerates hydrogen ion accumulation in the
muscle, which in turn causes muscle pH to decline. The fact that PSE characteristics are
hard to induce in pigs that are less susceptible to stress suggests that there is an innate
difference among genetic lines that causes some pigs to have a greater predisposition to

develop inferior quality pork products (Gerrard, 1997).

Briskey et al. (1959) demonstrated that, although normal at death, muscles that
were ultimately PSE had signiﬁcantly lower pH values and higher muscle temperatures at
40 min postmortem than red, ﬁrm and non-exudative product. Moreover, the pH values
decreased rapidly to 5.5 or lower, while the temperature remained at 36-41°C. A rapid
drop in pH accompanied by a high temperature results in the denaturation of
approximately 20% of the sarcoplasmic and myoﬁbrillar proteins (Honikel and Kim,
1986). This helps to explain the undesirable pale color and exudative characteristics
associated with PSE muscle after harvest.

As postmortem muscle pH approaches the isoelectric point of myosin (5.1), the
net protein charge is reduced, as are repulsive forces between myoﬁlaments (Wismer-
Pedersen, 1971). This results in a decrease in the spacing observed between
myoﬁlaments. Thus, fresh meat with a lower ultimate pH will have less net protein
charge, decreased myoﬁlament spacing (i.e. less space for water to be trapped) and less
interaction with water, which is a polar substance.

Potentially, the most important aspect of PSE pork is the reduced water-holding
capacity of the meat. The inability of meat to bind water affects proﬁtability of packers,
functionality and versatility of the product, and most importantly acceptability by
consumers (Topel et al., 1976). Kauffman et al. (1978) demonstrated that during transit
PSE hams lost three times more moisture than normal hams and seven times more
moisture than dark, ﬁrm, and dry hams (DFD). Additionally, moisture losses during
curing, smoking and chilling are higher in PSE hams than those observed in normal or

DFD hams. Compared to normal hams and shoulders, hams and shoulders with severe

PSE exhibit 33% and 11% lower water-holding capacities, respectively (Cannon et al.,
1995)

Warriss and Brown (1987) reported a biphasic relationship between 45-minute
postmortem pH, reﬂectance, and drip loss. These authors demonstrated that muscles with
a lower 45-minute pH had more drip loss and were paler. According to Offer (1991),
denaturation of sarcoplasmic proteins has a major inﬂuence on the increase in paleness,
while denaturation of the myoﬁbrillar proteins is responsible for decreases observed in
water-holding capacity. Honikel and Kim (1986) suggested that the wateriness observed
in PSE muscle is determined by breaks in the cell membrane through which ﬂuid can
quickly exude from the cell. Additionally, they observed the myoﬁbrillar protein myosin
in the drip from PSE muscles and suggest that myosin would not be able to escape the
cell if the membranes were intact.

Dark, Firm, and Dﬂ Pork

Briskey et al. (1959) demonstrated that if there was a very limited pH decline and
rigor mortis took place at a relatively high pH, the muscle remained dark red in color,
ﬁrm in texture and dry in appearance. These authors also noted that if glycolysis
proceeded extremely slowly and rigor mortis occurred over a long period of time, the
same ultimate muscle quality would occur.

Dark, ﬁrm, and dry pork is often associated with long-term stress that results in
depletion of muscle glycogen prior to harvest. As a result, there is less glycogen to fuel
anaerobic glycolysis. Fewer lactate and hydrogen ions accumulate and a higher ultimate
pH (>6.0) is often observed. Because of the high ultimate pH, proteins in DFD meat

have a relatively high net protein charge and undergo minimal protein denaturation. Both

of these factors contribute to an increase in myoﬁlament spacing (Wismer-Pedersen,
1971), high water holding capacity and minimal extracellular ﬂuid accumulation
(Kauffman et al., 1994).

Kauffman et al. (1999) subjected eight pork loins representing DF D and PSE
conditions to a series of objective and subjective measures to demonstrate extremes in
meat quality. When compared with PSE loins, DFD loins averaged 1.5 units higher
ultimate pH, 4.7% less drip loss and 136% more bound water. Additionally, DFD loins
were darker, ﬁrmer, and more tender.

With all the positive factors associated with DFD pork (i.e. increased water
holding capacity, decreased light reﬂectance, and decreased protein denaturation) it
would seem that DFD pork would be the target of producers and processors. However,
there are negatives associated with DFD meat that make it undesirable. Many of the
bacterial species that grow on meat survive within a pH range of 5.0-8.0 with optimum
growth occurring around pH 7.0 (Cannon et al., 1995). This makes DFD meat a prime
target for bacteria growth. It has also been documented that the dark appearance of DFD
meat does not appeal to the average American consumer (Kauffman, 1993).

Link Between Halothane Anesthesia and Malignant Hyperthermia

Halothane was ﬁrst synthesized in 1956 by Suckling (Chapman et al., 1967).
Shortly thereafter, halothane became the anesthesia of choice in both human and animal
medicine, replacing ether and chloroform anesthesia. Denbourough and Lovell (1960)
published the ﬁrst preliminary report documenting an abnormal response to halothane,
which was followed by a more detailed report (Denbourough et al., 1962). These authors

reported that during a routine surgery, a young, previously healthy patient was very

apprehensive about being anesthetized. Doctors assured the patient that new procedures
were in place and a newly synthesized anesthesia was much safer than those used in the
past. Shortly after induction of anesthesia the patient responded with a rapid rise in heart
rate and body temperature and also exhibited severe muscle rigidity of the limbs.
Doctors were able to reverse this abnormal response by discontinuing the halothane and
allowing the patient to breathe oxygen. A search of the patient’s genealogy revealed that
ten relatives had demonstrated an abnormal response to ethyl chloride and diethyl ether
anesthesia. All ten relatives died as a result of the inability to reverse the complications
associated with the abnormal responses to the anesthesia.

Following Denborough’s observations, other anesthesiologists began reporting
complications during routine surgeries. As a result of the increased occurrence of
unexplainable death loss in otherwise healthy individuals, Dr. R.A. Gordon, Professor of
Anesthesia at University of Toronto, organized a symposium bringing together several
anesthesiologists who had experience with complications in patients exposed to
anesthesia during surgery (Britt, 1987). During this symposium, Dr. Gordon coined the
term “Malignant Hyperthermia” (MH) to describe the inherited, potentially lethal
syndrome in which affected individuals respond abnormally to certain anesthetic agents.
The abnormal response includes skeletal muscle rigidity, hypermetabolism and increased
body temperature.

Early research efforts to understand the mechanisms by which halothane elicited
the above responses were hampered by low frequency of occurrence (1 : 15,000 in
children and 1:50,000 in adults; Britt, 1970). Moreover, approximately 70% of MH

episodes were fatal and many times patients exhibiting an MH response had previously

undergone uneventful anesthesia (Britt, 1970). Thus, there was an apparent need for an
animal model that possessed MH and exhibited similar phenotypic responses as to those
observed in humans. An animal model would also provide the ability to test various
anesthetics and drug intervention techniques.

The identiﬁcation of an “ideal” animal model came as a complete surprise to
human anesthesiologists. Dr. Neville Woolfe, an experimental animal pathologist in
Cambridge, recanted the symptoms observed during routine anesthesia of three littermate
Landrace pigs to Dr. Gordon (Britt, 1987). Once pigs lost consciousness, instead of
becoming ﬂaccid and respiration slowing, they responded with severe muscle rigidity,
increased body temperature and discoloration of the skin. Shortly after induction of the
anesthesia, all three pigs expired. Upon hearing the description of the response these pigs
had to halothane, Dr. Gordon immediately knew they had suffered a MH reaction.
Shortly thereafter in Cape Town, South Africa, researchers working with the Liver
Research Group reported similar ﬁndings in South African Landrace pigs (Harrison et al.,
1968). These authors reported that shortly after the induction of anesthesia, six of the
ﬁrst pigs anesthetized exhibited an increase in body temperature, blotching of the skin
and severe muscle rigidity very sporadically and unpredictably. In this study, therapeutic
interventions showed to be fruitless and all pigs died with core body temperatures
ranging from 42.5 to 45 °C and blood pH values 5 6.85 (Harrison et al., 1968).
Following these two reports, MH was discovered in Poland-China pigs in Oklahoma
(Jones et al., 1972), and in Pietrain pigs in Belgium (Van den Hende and Lister, 1976)
and Minnesota (Elizondo et al., 1976). It was soon realized that the MH trait was

worldwide in swine populations.

11

The discovery of halothane sensitive pigs has proven very useful in treatment and
prevention of human MH. However, not all drugs implicated in the initiation of MH in
man have elicited a response in the MH pig (Harrison, 1987). Conversely, all MH
humans do show an abnormal response to all drugs shown to trigger a MH response in
pigs.

Porcine Stress Syndrome

Prior to the discovery of halothane sensitive pigs, swine producers had noted that
some pigs exhibited open-mouth breathing, blotching of the skin, muscle rigidity, and an
increase in body temperature when placed in a stressful environment, such as handling or
transportation. If the stressor was not removed or the perception of danger did not cease,
these pigs might become non-ambulatory or possibly die. Topel et al. (1968) coined the
term porcine stress syndrome (PSS) to characterize this abnormal response to
psychological and environmental stressors.

Porcine stress syndrome and MH in pigs are accepted as manifestations of the
same muscle defect (Harrison, 1972). As indicated above, stressors such as ﬁghting,
manhandling, transportation or changes in temperature can trigger PSS, whereas MH is
triggered by exposure to various anesthetics. In both cases, the resultant meat quality is
typically PSE. Topel (1972) suggested that when PSS was experimentally studied 60 to
70% of the pigs developed PSE. Furthermore, if the intensity of the stress was reduced
and the duration of the stressor was increased, DFD musculature was often observed in
meat from these pigs.

Due to the similarities in phenotypic responses, Harrison (1972) proposed that a
link existed between PSS, PSE, and MH. To test this hypothesis, postmortem changes in

muscle pH and water-holding capacity were evaluated in pigs that were halothane non-

sensitive (n = 7), halothane sensitive (n = 3), and halothane sensitive and anesthetized
with halothane immediately prior to exsanguination (n = 3). Results from this study
demonstrated that MH susceptible pigs exhibit a similar rate of pH decline and reduction
in water-holding capacity that had been implicated in PSE pork products. The pigs that
were subjected to halothane immediately prior to exsanguination exhibited the most rapid
decline in pH, reaching ultimate pH shortly following death.

The similarities between PSS, PSE, and MH also led Webb and Jordan (1978) to
develop the halothane challenge ﬁeld test. These authors demonstrated that removal of
halothane sensitive pigs from herds would be effective at reducing the incidence of PSE
pork and sudden death. Thus, progressive pig farmers could identify problem pigs at the
weanling stage and select away from the undesirable traits of PSS from their herds,
thereby reducing the occurrence of PSE pork.

Identification of a Calcium Release Problem

Although swine producers had a tool to reduce PSS and human medicine had a
model to test anesthesia and drugs to prevent MH episodes, there was still an intense
desire to understand how halothane elicited the phenotypic responses that were observed.
Using conventional microscopy, Harrison et al. (1969) examined sections of tissue from
brain, liver, kidney, adrenals, and skeletal muscle. The only tissue that showed
histological abnormalities was skeletal muscle removed from a pig dying of MH. These
authors noted that changes were consistent with ﬁber damage and destruction observed in
extreme cases of rigor mortis. It is generally accepted that ATP depletion in skeletal
muscle is associated with the development of rigor. Thus, initial investigations were

targeted at quantifying differences in ATP concentration between halothane sensitive and

13

halothane non-sensitive pigs. Muscle biopsies were removed from anesthetized pigs,
divided into three sections and subjected to one of three treatments: 1) frozen
immediately, 2) incubated for 30 min at 38°C in Krebs-Ringer solution, then frozen and
3) incubated for 30 min at 38°C in Krebs-Ringer solution with 4% halothane vapor
bubbled through the solution, then frozen. From these studies, Harrison (1979)
demonstrated that the in vitro rate of ATP depletion in halothane sensitive muscle was
double that of muscle from halothane non-sensitive pigs. Furthermore, the addition of
halothane vapor during the 30 min incubation enhanced the rate of ATP depletion in the
sample from the halothane sensitive pig and had no effect on the tissue from the
halothane non-sensitive pig. However, when these studies were monitored in viva it was
observed that ATP levels in halothane sensitive pigs were maintained early in the course
of the MH response in spite of the severe muscle rigidity (Harrison, 1979). The levels of
ATP declined only after creatine phosphate levels were almost completely exhausted.
Both activation of myoﬁbrillar ATPase and glycolysis could be attributed to the
rapid release of calcium from the SR. Release of calcium from the SR can activate both
calcium and myoﬁbrillar ATPases, which in turn can initiate glycolysis to re-
phosphorylate the ATP needed to fuel both ATPases (Infante and Davies, 1962; Bechtel
and Best, 1985; Pate and Cooke, 1989). Calcium ions can also directly activate
glycolysis by their stimulatory effect on phosphorylase kinase (Ozawa et al., 1967;
Heilmeyer et al., 1970). Because of the apparent association of the MH phenotype with
calcium release, Harrison et al. (1971) administered procaine, a classical inhibitor of
caffeine-induced muscle contraction, to a pig that had previously demonstrated an MH

response to halothane. Following administration of Procaine, the pig was subjected to

14

halothane anesthesia and exhibited no abnormal response. Based on these results,
Procaine provided the ﬁrst speciﬁc therapy for MH in humans until the discovery of
dantrolene (Harrison, 1987). However, there was still a need to understand the
biochemical mechanism responsible for the phenotypic response observed in both human
and pig MH.

Further evidence suggesting a putative role for calcium in the manifestation of
MH has been reported. Experiments performed by Cheah and Cheah (1978)
demonstrated that halothane enhanced the rate of calcium release by two fold in pigs that
were sensitive to halothane versus those that were not. Further, Kim et al. (1984)
reported that the initial rates of calcium release induced by halothane are at least 70%
higher in MH SR compared to that of non-MH SR. Nelson and Sweo (1988) reported
that halothane increased the rate of calcium induced calcium release. More recently in a
review article, Mickelson and Louis (1996) stated that collectively their work would
suggest that halothane stimulates the release of calcium from all pigs regardless of their
halothane sensitivity. Indeed, Mitchell et al. (1980) demonstrated that the effect of
halothane on muscle metabolism was similar in both halothane sensitive and non-
sensitive pigs. However, in halothane sensitive pigs the changes in muscle metabolism
were much greater than those observed in halothane non-sensitive pigs. Interestingly,
halothane sensitive pigs have been reported to have an increased rate of calcium release
even in the absence of halothane (Mickelson et al., 1988). Mickelson et al. (1986)
reported that SR puriﬁed from MH-positive pigs were more sensitive to calcium, opening
at lower calcium concentrations and requiring higher concentrations to close the

channels. These ﬁndings, coupled with the fact that halothane enhances the rate of

15

calcium release two-fold in halothane sensitive pigs, supports the notion that aberrant
calcium release is the probable driving force behind the development of MH.

Ryanodine Receptor

The primary calcium storage organelle in skeletal muscle is the sarcoplasmic
reticulum, based on its location (sarcoplasm) and overall structure as an extensive
network (reticulum). In early descriptions of the SR, Porter (1956) surmised that it was
simply a specialized version of the endoplasmic reticulum common to most cells and its
location with respect to the myoﬁbrils suggested some functional importance in skeletal
muscle contraction. Both of these early insights are now generally accepted. The SR has
been implicated in skeletal muscle contraction and relaxation through its orchestrated
control of cytoplasmic calcium concentration (Huxley, 1971). Furthermore, Villa et al.
(1993) demonstrated that the SR initially develops as an endoplasmic reticulum and as
the muscle cell differentiates, the endoplasmic reticulum begins expressing muscle
speciﬁc proteins and is then considered SR. The ﬁrst proteins puriﬁed from the SR were
calsequestrin, a high capacity calcium binding protein (MacLennan and Wong, 1971);
calcium ATPase which is responsible for shuttling calcium ions out of the cytoplasm into
the lumen of the SR (MacLennan, 1970); and the RYRl, which is the SR calcium release
channel protein (Kawarnoto et al., 1986).

A considerable amount of research has been conducted to determine if differences
exist in the release or uptake properties of the SR between halothane sensitive and non-
sensitive pigs. The bulk of the research focused on calcium release from the SR and
early reports suggested no difference in the rate of calcium uptake between pigs that
produce PSE pork compared to those that result in normal musculature (Greaser et al.,

1969). Moreover, Mickelson et al. (1988) demonstrated that heavy SR isolated from

16

halothane sensitive pigs had a higher afﬁnity for ryanodine compared to SR prepared
from halothane non-sensitive pigs. These ﬁndings suggest that the probability of ﬁnding
a RYRl in the open conﬁguration is greater in muscle from halothane sensitive pigs.
These authors also demonstrated that RYRl iSolated from skeletal muscle of halothane
sensitive pigs were more sensitive to calcium, opening at lower calcium levels and
requiring a higher calcium concentration to close the channel compared to halothane non-
sensitive pigs. This phenomenon had previously been observed in MH susceptible
humans (Endo et al., 1983).
Physical Structure of the Ryanodine Receptor

The SR calcium channel protein is an oligomeric protein complex located at the
triadic junctions between the SR terminal cistemae and sarcolemmal T-tubules (Fleischer
et al., 1985) and constitutes about 2-3% of the total SR protein. The channel protein is
most typically referred to as the RYRl , because it speciﬁcally binds the plant alkaloid
ryanodine. Puriﬁcation of the functional receptor has revealed a complex with an
apparent molecular weight of 2260 kDa consisting of four individual monomers of
identical size (565 kDa) with a quatrefoil shape (Lai et al., 1988). The center of the
homotetramer has a diameter of 1 to 2 run that most likely represents the calcium channel
(Zucchi and Ronca-Testoni, 1997). The hydrophobic domain of the RYR] comprises the
baseplate, which spans the SR membranes and forms the channel. The hydrophilic
domain forms the cytoplasmic foot that spans the gap between T-tubule and the terminal
cistema of the SR membrane. Both the N- and C-terminus of the RYRl are believed to
be located in the cytoplasm of the cell. Based on three-dimensional image

reconstructions there appears to be a mass on the lurnenal side of the RYRl that is most

17

likely involved in the regulation of calcium release from the SR (Wagenknecht et al.,
1989)

Results from hydropathy plots of the primary amino acid sequence reveal two
potentially different arrangements for the transmembrane spanning regions of the RYRl.
Early reports suggested that the carboxy terminus spans the membrane four times and the
amino and carboxy termini are on the cytoplasmic surface (Takeshima et a1, 1989). In
later studies, Zorzato et al. (1990) proposed that the RYR] transversed the membrane 10
to 12 times and both the amino and carboxy termini were in the cytoplasmic domain.
More recent work utilizing site-speciﬁc antibodies (Grunwald and Meissner, 1995)
supports the conclusion of Takeshima et al. (1989), whereas cryoelectron microscopy
data (Wagenknecht and Raderrnacher, 1995) favor the results of Zorzato et al. (1990).

The RYR has been puriﬁed, cloned and sequenced ﬁ'om a variety of species, and
three isoforrns have been identiﬁed. In mammalian tissues three isoforrns of the RYR
have been observed and are labeled according to the tissue in which they are
predominately expressed. The RYRl is considered to be skeletal muscle speciﬁc
(Takeshima et al., 1989), RYR2 is associated with cardiac muscle (Otsu et al., 1990) and
RYR3 is found in the brain (Hakamata et al., 1992). The three isoforrns share an overall
homology of approximately 70% in primary structure consisting of about 5,000 amino
acid residues and are encoded by three different genes on different chromosomes. It is
generally accepted that there is only one RYR isoforrn (RYRl) in mammalian skeletal
muscle, whereas in most non-mammalian skeletal muscles there are two isoforrns (or- and

B-RYR; Airey et al., 1990).

Gene Structure of the Ryanodine Receptor

The human RYR] gene is located on chromosome l9ql3.1 (MacKenzie et al.,
1990). It resides in a linkage group containing human glucose phosphate isomerase
(GPI). The porcine RYR] gene has been localized to chromosome 6p11-q21 (Harbitz, et
al., 1990). This region in the pig also includes GPI, suggesting that parts of human
chromosome 19 and pig chromosome 6 are homologous (MacLennan and Phillips, 1992).

Phillips et al. (1996) reported the complete cDNA sequence and intron/exon
boundaries of the human RYRI gene. Using the alignment of 16 genomic phage clones, a
cosmid clone and several long polymerase chain reaction products, these authors
concluded that the RYRl gene is 160 kb in length and contains a total of 106 exons.
Exons were reported to range from 15 to 813 bp, while introns range from 85 to 16,000
bp. The average exon and intron sizes were reported to be 144 and 1,377 bp,
respectively. Once the gene is transcribed into mRNA, the full-length translatable
sequence remaining is 15,393 nucleotides in length. This corresponds to the 5,131 amino
acids that encode the protein. The N-terminal 4,000 amino acid residues form a large,
loosely packed cytosolic foot domain, with the balance forming the transmembrane
domain (Wagenknecht and Radermacher, 1997).
Function of the Ryanodine Receptor

The RYRl is the primary mechanism through which calcium stored in the
terminal cistemae of the SR can be released into the cytoplasm of the cell. The RYRl is
not strongly voltage gated and is not activated directly by transverse tubule or SR
membrane potential changes (Catterall, 1991). Therefore, a chemical signal must be

released to activate RYR] opening. Indeed, when a nerve impulse is received at the

19

neuromuscular junction, acetycholine is released at the motor end plate. Acetylcholine
diffuses to the muscle cell membrane and binds to its receptor, which itself is a sodium
channel that opens and allows an inﬂux of sodium to cause a wave of depolarization that
travel down the sarcolemma and T-Tubules. The wave of depolarization causes a
conformational change in the dihydropyridine receptors (DHP) located in the T-Tubules.
The DHP serves as the voltage sensor in the T-tubule membrane. Binding of the DHP to
the RYR] causes the RYRl to open and allow calcium to ﬂood out of the SR. The
released calcium has two fates at this point 1) it can be sequestered back to the SR by the
calcium pump or 2) the calcium can accumulate in the sarcoplasm and initiate muscle
contraction. When cytoplasmic calcium exceeds the threshold concentration required to
initiate muscle contraction (>10'6 M), it will rapidly bind to troponin C. The activated
troponin interacts with tropomyosin causing it to shift its position along the actin
ﬁlament. The shift by tropomyosin allows the myosin head to attach to the actin
molecule and initiates a crossbridge cycle (Potter et al., 1995). Pate and Cooke (1989)
suggested the following basic cycle occurred during skeletal muscle contraction after the
actin-myosin crossbridge had formed. Inorganic phosphate is released from the myosin
head and the sarcomeres will shorten generating the force needed for locomotion.
Simultaneously, ADP is released and ATP attaches to the myosin head causing
dissociation of the actin-myosin complex. Subsequently, the hydrolysis of ATP to ADP
and inorganic phosphate by myosin ATPase repositions the myosin head to a 90° angle.
Assuming the nerve stimulus ceases, the sarcolemma and the transverse tubules become

repolarized. The calcium ATPase pumps the calcium back into the SR and the calcium

20

ions re-associate with calsequestrin. Additionally, tropomyosin regains its original
position over the myosin-binding site. The muscle returns to the resting state.
In Vitro Modulators of the Rvagdine Receptor

Modulators of the RYR] appear to be very abundant in skeletal muscle. Under
physiological conditions, calcium is one of the most important modulators of the RYRl
activity (Coronado et al., 1994). Calcium has been demonstrated to have a dual effect on
the RYRl , it can activate opening of the channel at low concentrations and induce
closing of the channel at high concentrations. Magnesium has been demonstrated to
inhibit the effects of calcium on the RYRl. It has been proposed that magnesium might
compete with calcium for the high-afﬁnity binding site on the RYRl (Pessah et al.,
1987), bind to the calcium inhibitory binding site (Kirino et al., 1983) or could block the
calcium channel (Smith et al., 1986).

Other modulators of the RYR] include ATP, which enhances calcium release
from the SR (Meissner, 1984) and caffeine, which increases the mean open time of the
channels. Wu and Hamilton (1998) suggested that FK506 binding protein 12 (F KBP12)
bound to RYR] would reduce the mean open time of the channel. It is also thought that
FKBP12 is involved in skeletal muscle E-C coupling. Calmodulin, a ubiquitous calcium
binding protein, can activate or inhibit RYR] activity. At nanomolar calcium
concentration, calmodulin is an activator, but at micromolar calcium concentration,
calmodulin is an inhibitor of RYRl (Rodney et al., 2000).

Studies on Ryanodine Receptor Polvmomhrsﬂ
Tong and co-workers (1997) introduced ﬁfteen of the known human MH

mutations into rabbit RYR] cDNAs, expressed each of the polymorphisms in HEK-293

21

cells and measured the intracellular response of the wild type versus mutated channels to
caffeine and halothane. The results of this study demonstrated that all of the mutants had
numerically lower threshold levels for halothane and caffeine to stimulate opening of the
RYRl. Fourteen of the mutations caused more pronounced response to halothane and
caffeine compared to the wild type RYRl. The authors concluded that these observations
were most likely due to intrinsic differences in the gating properties of the mutated
RYRl.

In a comparison of genotype-phenotype concordance of a Swiss MH human
population, Girard and co-workers (2001) determined the frequency of all published
RYR] polymorphisms. These authors utilized the in Vitro contracture test (IVCT) to
determine the effects of these polymorphisms on skeletal muscle contraction. The most
commonly observed polymorphism corresponded to a valine substituted for a methionine
at position 2168 (27%). The results of the IVCT suggested that the arginine to cysteine at
residue 614 leads to the highest muscle tension when subjected to halothane, followed by
substitutions of valine to methionine, glycine to arginine, and arginine to cysteine at
residue 2,168, 2,434, and 2,458, respectively. Currently, the arginine to cysteine
substitution at residue 615 is the only reported polymorphism in the pig RYRl.

Other research reports have demonstrated that deletion of amino acid sequence
can result in functional differences in RYR]. Bhat and co-workers (1997) constructed a
RYR] deletion mutant in which 2.4 kb of nucleotide sequence were removed (a 1,641 -
2,437). They then expressed the sequence in a Chinese hamster ovary cell line. Removal
of these amino acids (aa 1,641 — 2,437) from the foot region of the RYR] altered ion

conductance and calcium-dependent regulation of the calcium release channel.

22

Genetic Basis of Porcine Stress Syndrome

For almost two decades, halothane screening of pigs was used to identify animals
that were stress-susceptible. Although the halothane test was effective at identifying
homozygous positive animals, it did not effectively distinguish between carriers and
homozygous normal animals (Webb and Jordan, 1978). Due to incomplete penetrance,
not all homozygous positive pigs react abnormally to halothane. Additionally, Reik et al.
(1983) reported responses to halothane that were not deﬁnitive. Some pigs would exhibit
muscle rigidity in the front limbs, but not the back and others would become rigid and
then relax. In all cases, these pigs were recorded as halothane non-sensitive, even though
their reactions were borderline or conﬂicting.

Advances in the understanding of the defect in calcium metabolism led to the
discovery of an alteration in amino acid sequence from an arginine to cysteine at residue
615 in the porcine RYR] (Fujii et al., 1991). It has been determined that the C1843T
polymorphism results in a hypersensitive calcium release channel, which results in
elevated sarcoplasmic calcium and increased energy consumption due to elevated myosin
ATPase and calcium ATPase activity. Increased ATPase activity leads to elevated
muscle temperatures and accelerated glycolytic metabolism, which often results in the
development of inferior quality pork products. Based on the ﬁndings of Fujii et al.
(1991), a DNA based test was established that could distinguish between homozygous
positives (TIT), carriers (C/T) and homozygous normals (C/C) for the RYR]
polymorphism (HAL-1843). As a result of this work, halothane gas testing of swine was

discontinued.

23

In a comparison of the DNA based test and the halothane challenge test, Rempel
et al. (1993) evaluated a total of 240 pigs. Based on Mendelian ratios, the authors
expected 88 of the animals to respond abnormally to the halothane anasthesia; however,
they observed a total of 143. In addition, when comparing halothane vs DNA tests, 66
pigs, which were classiﬁed as HAL-1843 normal or heterozygous, responded abnormally
to halothane. Most importantly, seven pigs (result of carrier-to-carrier mating, n=121)
classiﬁed as HAL-1843-normal exhibited an abnormal response to halothane. Thus, it is
reasonable to hypothesize that other mutations may occur in the RYRl protein that would
lead to altered calcium regulation and inferior meat quality. Indeed, twenty-three other
mutations in the human RYR] have been linked to MH (Girard et al., 2001). However,
linkage between RYRl and human MH has not been found in all human cases studied.
These disagreements raise questions with regards to the causal nature of the mutations in
the RYR] . Other reasons for disagreement may include the possibility that multiple MH
mutations might be segregating in one family or the in vitro contracture test may fail to
provide a phenotypic response with sufﬁcient accuracy to compare to genetic analyses
(MacLennan, 1995). F urtherrnore, novel polymorphisms in other genes may inﬂuence
the MH response.

Current Status of the problem

In the last decade a considerable amount of research has focused on reducing the
frequency of PSE pork products. For the most part, U.S. swine producers have
eliminated the HAL-1843 polymorphism from their herds because of its association with
increases in the number of dead pigs and inferior quality pork products. There has also

been an increased awareness of the Napole status of pigs (Rn' gene; Milan et al., 2000) or

24

the so-called “Hampshire effect” because of its deleterious effects on ultimate meat
quality. As a result of Milan’s work, Ciobanu et al. (2001) reported the discovery of
economically important alleles in the protein kinase, AMP activated, gamma 3 subunit
(PRKAG3) that affect glycogen content of the muscle and subsequently the ultimate
quality of the pork products. Strategic breeding decisions based on PRKAG3 should
have a signiﬁcant economic impact on the pig industry and ultimately for the consumer.

Improvements in animal handling have been implemented at both the farm and
plant levels to reduce perceived stressors associated with human interaction. Alleyways,
loading chutes, lairage pens, ﬁnal drive alleyways, and restraining chutes have been
designed to be more animal and user friendly. Yet, it can be estimated that approximately
$161 million dollars were lost last year due to inferior color and reduced water-holding
capacity of pork products (Stetzer and McKeith, 2003). Additionally, it has been
estimated that the frequency of non-ambulatory pigs arriving at harvesting facilities is
about 1%, but could be higher on a given harvest day (Ellis et al., 2003, Ritter et al.,
2004). It is interesting to note that these non-ambulatory pigs observed today exhibit
similar characteristics to those described by Topel et al. (1968).

The work reported in this dissertation has been designed to address two key areas
facing the swine industry, non-ambulatory pigs, and inferior quality pork products.
Identiﬁcation of novel screening tools to identify pigs that are more stress susceptible and
prone to producing inferior pork quality should be very beneﬁcial to swine producers and

harvesting facilities.

25

CHAPTER 1
THE EFFECTS OF HALOTHANE SENSITIVITY ON CARCASS COMPOSITION
AND MEAT QUALITY IN HAL-1843-NORMAL PIGS
ABSTRACT
The objectives of this study were to determine the incidence of halothane
sensitivity (HS) in HAL-1843-normal pigs, and the relationships between HS and carcass
composition or meat quality. In Exp. 1, piglets (Lines A, B, C, and D; n= 168, 170, 168,
and 169, respectively) were obtained from mating a HAL-1843 -normal sire line to four
HAL-1843-normal dam lines. In Exp. 2, piglets from lines A and B (n = 87 and 90,
respectively) were included with piglets (Lines E, F, G, and H; n = 94, 92, 89, and 89,
respectively) obtained from mating four HAL-1843-normal sire lines to a single HAL-
1843-normal dam line. Pigs were subjected to 3% halothane at approximately 9 weeks of
age. In Exp. 1, HS was observed in 48% of the pigs. Using a scoring system to better
characterize the halothane response (Exp. 2), 25, 42, and 33% of the pigs from line E and
40, 33, and 27% of the pigs from line G were categorized as HS-low (HS-L), HS-
intermediate (HS-I), and HS-high (HS-H), respectively. In lines F and H, 13 and 18% of
the pigs were HS-I and 0 and 2% were HS-H, respectively. No consistent effects due to
HS were observed in carcass composition or meat quality. However, when a subset of
pigs from Exp. 2 were subjected to more extensive handling and transportation prior to
slaughter, ultimate pH was lower and drip loss was higher in LM from HS-H compared to
HS-L pigs (P < 0.05; n = 71). These results demonstrate that some HAL-1843-nonnal
pigs respond adversely to halothane. Additionally, HS may be associated with inferior

pork quality under adverse antemortem conditions.

26

INTRODUCTION

Porcine stress syndrome (PSS) is characterized by open-mouth breathing,
blotching of the skin, hyperthermia, muscle rigidity, and either loss of mobility or death
(Topel et al., 1968). These same characteristics have also been documented in some
cases when humans (Denborough etal., 1962) and pigs (Hall et al., 1966; Harrison et al.,
1968) are subjected to halothane anesthesia. Because of these similarities, the halothane
challenge test was implemented to predict stress susceptibility of swine (Webb and
Jordan, 1978).

Fuj ii et al. (1991) compared the full-length cDNA sequence of the sarcoplasmic
reticulum calcium release channel (ryanodine receptor; RYRl) of a halothane sensitive
(HS) Pietrain and a halothane non-sensitive (HN) Yorkshire. These researchers identiﬁed
a C1843T polymorphism (HAL-1843), which codes for an amino acid change of arginine
to cysteine at residue 615. Due to the association of the HAL-1843 polymorphism with
the incidence of PSS and an increase in the frequency of PSE pork, most swine breeding
companies eliminated this polymorphism from their herds.

It was anticipated that removal of pigs with the HAL-1843 polymorphism from
pig populations would serve the same purpose as eliminating pigs that were HS.
However, Rempel et al. (1993) demonstrated that 23% of the pigs classiﬁed as
homozygous normal (C/C) at nucleotide] 843 in the RYRI (HAL-l 843-normal) responded
abnormally to halothane anesthesia. Thus, it seems reasonable to hypothesize that other
mutations may occur in the RYR] or other proteins involved in calcium regulation that
would lead to altered ability to control cytoplasmic calcium concentration. Indeed, 23

other mutations in the human RYR] have been identiﬁed that are linked to halothane

27

sensitivity (Girard et al., 2001). It is unclear what proportion of HAL-1 843 -normal pigs
are HS, and it is unknown if sensitivity to halothane is associated with PSS or an increase
in the frequency of inferior quality pork. Therefore, we hypothesize that some HAL-
1843-normal pigs respond abnormally to halothane anesthesia and are more prone to
producing inferior quality pork products.
MATERIAL AND METHODS

Animals and Halothane Challenge Test

The Michigan State University Animal Use and Care Committee approved the
protocol for animal handling and halothane administration (# 04/02-057-00). A total of
1,216 crossbred pigs were subjected to a halothane challenge test in two separate
experiments. In Exp. 1, piglets (Lines A, B, C, and D) were randomly selected from
progeny generated by inseminating four commercially available, HAL-1843-normal dam
lines (Lines D1, D2, D3, and D4, respectively) with pooled semen from a commercially
available, HAL-1843-normal sire line (81). Piglets used in Exp. 2 (Lines E, F, G, and H)
were randomly selected from progeny generated by inseminating a single commercially
available, HAL-1843-normal dam line (D5) with pooled semen from four commercially
available, HAL-1843-normal sire lines (81, 82, S3, and S4). Two lines from Exp. 1 (A
and B) were also included in Exp. 2. In both experiments, sire and dam lines were
assumed to be HAL-l843-normal based on selection against the detrimental allele in
these lines of pigs for many generations. All piglets were shipped to the New Ulm Test
Station in New Ulm, MN at approximately 17 d of age and individually identiﬁed upon

arrival.

28

A random sample of 20 pigs from each dam line was evaluated for the known
polymorphism (HAL-1843) in the RYR] . A 659 base pair product of the genomic DNA
surrounding the polymorphism site was ampliﬁed using the polymerase chain reaction
(PCR), and the PCR product was digested with BsiHKA I (New England Biolabs Ltd.,
Beverly, MA; O’Brien et al., 1993). The DNA from a known HAL-1843 mutant was
used as a positive control. All experimental samples were conﬁrmed to be normal at
nucleotide 1843.

Pigs weighed an average of 15.7:28 kg and were eight weeks old in Exp. 1,
whereas pigs in Exp. 2 were 22.8:34 kg and were nine weeks of age, when halothane
testing was performed. This is similar to the age shown by Carden and Webb (1984) to
elicit the highest probability of an abnormal response. The halothane test was
administered similarly to that described by Webb and Jordan (1978). Pigs were exposed
to 3% halothane in a closed system, with a delivery rate of 2 lein for a total of 4 (Exp.
1) or 3 (Exp. 2) min. Pigs were placed in a sitting position on an elevated platform and a
mask was applied to the snout of each pig. Care was taken to ensure that the mask fully
covered the mouth of the pig to maximize inhalation of halothane. At approximately 1
min into the test, the pigs were unconscious and were placed ﬂat on their backs. Limb
rigidity, blotching of the skin, and muscle tremors were documented. Animals exhibiting
any of these symptoms were considered to be HS.

In order to more precisely characterize the response to halothane in Exp. 2, a
scoring system was developed. Each limb was individually evaluated for rigidity and
scored on a scale of 1 to 4 (1 = no stiffness, 2 = minor stiffness with some straightening

of limb, 3 = stiffness with no ﬂexion at knee, hock or pastem, and 4 = stiffness with no

29

ﬂexion at knee, hock or pastem and shoulder or hip immobile). A representative example
of the muscle rigidity can be observed in Figure 1.1. Blotching was scored on a scale of
1 to 3 over the entire belly of the pig (1 = no discoloration, 2 = minor blotching or
pinking, and 3 = severe blotching or purple). Tremors were often observed from the
middle to end of the testing period in the front limbs and shoulder, and were scored on a
scale of 1 to 3 (1 = no tremors, 2 = minor tremors, and 3 = severe tremors). The average
limb rigidity score was added to the blotching and tremor scores to calculate the
halothane response. The cumulative halothane score was more highly correlated to
phenotypic traits of interest than any individual or combination of responses observed.
Pigs were then categorized into three groups based on their cumulative score: HS-low
(HS-L; 3.00 to 4.00), HS-intermediate (HS-I; 4.01 to 5.49) and HS-high (HS-H; > 5.49).

In order to determine the probability of misclassifying a pig’s response to
halothane, 177 pigs from lines A and B (Exp. 2) were subjected to halothane on two days
with one day of rest between evaluations. Different evaluators scored the response to
halothane on each day, but all other procedures were as previously described.
Animal-Handling Model

Eighty pigs from lines E and G were used in an animal-handling model described
by Marr et al. (2004). Brieﬂy, ten groups of eight pigs each were briskly moved through
a 36.6 m long aisle that was 2.1 m wide at each end and 0.6 m wide in the middle 18.3 m.
Each group was moved down and back four times with each pig receiving a minimum of
one electrical prod per pass (8 prods/pig). Following the model, four of these pigs were
euthanized because they were deemed to be in distress by an attending veterinarian. The

remaining pigs were allowed 8 h of rest and then transported to one of two slaughter

30

Figure 1.1. Representative example of muscle rigidity observed in pigs subjected to 3%
halothane anesthesia. Panel A depicts a pig classiﬁed as halothane sensitive due to the
muscle rigidity in the front limbs compared to the very ﬂaccid pig observed in panel B.

 

31

facilities. All procedures for the animal-handling model were approved by the ELAN CO
Animal Use and Care Committee (#03033).
Meat Quality Data Collection

Meat quality data were collected on 281 pigs in Exp. 1 and 293 pigs in Exp. 2,
respectively. Pigs were marketed over a six-week time frame in Exp. 1 (September —
October) with the heaviest pigs in each pen being shipped at two-week intervals. In Exp.
2, all pigs were marketed during the month of January, with lines A and B marketed on
two days and lines E-H being marketed on three days. In order to maintain a balanced
design, pigs were matched for line, gender, and halothane response when possible. Pigs
were transported (~ 580 km) to a commercial slaughter facility and held in lairage for a
minimum of two hours prior to slaughter. Pigs were rendered unconscious via carbon
dioxide stunning (Plant A). Pigs subjected to the animal-handling model had an initial
transport of about 1000 km (n = 80), with a ﬁnal transportation distance of approximately
484 km (n = 76) to one of two commercial slaughter facilities that both utilize electrical
stunning (n = 52; Plant B or n = 24; Plant C) and allowed at least two hours of rest prior
to slaughter. Pigs representing each of the three-halothane categories and both sire-lines
were transported to Plant C to obtain an early postmortem tissue sample for further
biochemical analyses. The remaining pigs were transported to Plant B due to the
proximity of the slaughter facility to the testing facility. Data from ﬁve pigs were lost at
Plant B. Hot carcass weight (HCW), Fat-O-Meater fat depth (FD) and muscle depth
(MD) were collected prior to carcasses entering the cooler (Plants A and B), and HCW,
fat depth and LM area were measured at plant C. Carcass composition data from plants

A and B were used to calculate percent lean with the following equation: 58.86 — (0.61 *

32

FD) + (0.12 * MD); whereas, percent lean for pigs slaughtered at plant C was calculated
using the current fat-ﬁ'ee lean yield equation (N PPC, 2000). At approximately 1 h
postmortem, pH was measured in the ham (Exp. 1) and in the LM between the 5"‘/6th ribs
(Exp. 1 and 2). Following a 22-h chill, ultimate pH of the LM was measured between the
5"‘/6th ribs, and body wall thickness was determined on the hanging carcass in the
geometric center of the right side belly. Following carcass fabrication, loins were
collected and L*, a*, and b* values were taken at the 5th/6th rib interface using a ColorTec
PCM (Clinton, NJ) with a 10° observer and 16-m oriﬁce using D65 illuminant.
Subjective color, ﬁrmness and marbling were also evaluated on the LM at the same
interface (N PPC, 2000). Forty-gram samples were removed from each LM at the 5m/6th
rib, trimmed of external fat, placed in a funnel, and stored in an airtight container until 7
d postmortem. Following storage, samples were re-weighed to determine drip loss.
Similar traits were measured on pigs slaughtered at Plant C, with pH (45 min and 22 h)
and color (d 1) being measured at the last rib. Drip loss was measured by suspending
duplicate 2.54-cm thick chops for 7 d in sealed bags at 4°C. The difference between
initial and ﬁnal weights was used to calculate ﬂuid loss.
Statistical Analysis

Differences within halothane sensitivity across lines of pigs were analyzed using
the GEN MOD procedure of SAS (SAS Inst. Inc., Cary, NC). The statistical model
included the dependent variable halothane category and the independent effect of sire-
line. Differences in lines A and B between experiments were also estimated using the
GEN MOD procedure. The HS-I and HS-H numbers were pooled to compare to the HS

percentage observed in Exp. 1. Probability (p) of misclassifying a pig on one test was

33

calculated from the proportion of disagreement (d) between the outcomes of the two tests,
where d = 2p(1-p) (Webb and Smith, 1976).

Least squares means of meat quality traits were compared using mixed model
analysis of variance procedures. The model statement included the ﬁxed effects of line,
gender, halothane class and all possible two-way interactions with slaughter day included
as a random effect. The only signiﬁcant (P < 0.05) two-way interaction was
line*halothane class. Thus, means are reported separately for each halothane class within
line. Although not signiﬁcant (P > 0.1), all other two—way interactions were left in the
statistical model as they accounted for some of the variation observed in the traits of
interest. In Exp. 2, meat quality data of lines A and B were evaluated separately from
lines E through H because lines A and B were slaughtered on separate days. Carcass
composition models included HCW within line“ gender as a covariate and the same ﬁxed
and random effects were used for meat quality traits. Meat quality data from different
slaughter facilities were analyzed separately from each other using the mixed model
procedure of SAS, with the ﬁxed effects of line, gender and halothane class. Carcass
composition models included HCW as a covariate and all means were compared using a
protected least signiﬁcant difference test (Freud and Wilson, 1997).

RESULTS AND DISCUSSION
Mating schemes and halothane responses for both experiments are
reported in Table 1.1. In Exp. 1, progeny were generated using a single commercially
available, HAL-1843 -normal sire line to inseminate four different commercially

available, HAL-1843-normal dam lines. All of the lines tested had > 30% incidence of

34

Table 1.1. Line designations and halothane response for both experiments

 

 

 

Exp. 1 Exp. 2
Halothane sensitive Halothane sensitivitv'
Visual
__Line is DarIL n m _a__Lcn__ln.te.rme.diate__tliglJ_
A S1 D1 168 32%° 87 58%° 33%” 9%°
B 31 02 170 58%” 90 57%“ 35%b 8%°
c 31 03 168 36%° —- -- - -
0 s1 D4 169 62%” - -- -— -
E 31 05 —- ~- 94 25%° 42%b 33%”
F 52 05 -- —- 92 67%” 13%° 0%°
c 63 05 - - 89 40%d 33%” 27%”
H 84 ps -- -- 89 60%” 18%c 2%°

 

 

I'Low = 3.00 - 4.00, Intermediate = 4.01 - 5.49, High = 5.50 or greater.
b"""'°V\Iithin a column, percentages lacking a common superscript differ (P < 0.05).

35

HS pigs. Two of the lines tested exhibited a higher frequency of sensitivity to halothane
compared to the other two lines (B and D > A and C; P < 0.01). This result indicates a
signiﬁcant contribution to the observed halothane response from the dam line.

To determine if the observed halothane sensitivity was unique to the sire line used
in Exp. 1, progeny from four commercially available, HAL-1843 -normal sire lines mated
to a single commercially available, HAL-1843-normal dam line were evaluated in Exp. 2
along with the progeny from two of the lines from Exp. 1. Additionally, the magnitude
of the halothane response was characterized by assigning numerical scores to classify the
visually observed responses. Based on this scoring system, lines F and H had more pigs
classiﬁed as HS-L and fewer HS-I than the other genotypes tested (P < 0.05; Table 1.1).
Line E had the fewest HS-L pigs (P < 0.05), and lines E and G had more pigs classiﬁed
as HS-H than the other lines tested (P < 0.05). In both experiments, no differences were
observed in the halothane response between barrows and gilts (P > 0.05). This is in
agreement with the results of Sather and Murray (1989), who demonstrated that the
distribution of halothane sensitive pigs was unaffected by the gender of the animal.

In contrast to the results in Exp. 1, no differences in halothane response were observed in
Exp. 2 between lines A and B (P > 0.70; Table 1.1). Percentage of pigs classiﬁed as HS
(HS-I + HS-H for Exp. 2) in line A was similar in both experiments (P = 0.12). In Exp.
2, line B had fewer HS-I and HS-H pigs compared to the percentage of HS pigs in Exp. 1
(43% vs. 58%, respectively; P < 0.05). This observation may be due to differences in
time of year, within line variation in the halothane response, or the implementation of a
scoring system in Exp. 2. Similar to the results in Exp. 1, the response to halothane

differed among progeny from a single sire line in Exp. 2 depending upon the dam line (A

36

vs. B vs. E). Line E had fewer HS-L and more HS-H responsesthan lines A and B (P <
0.05). Based on the results from Exp. 2, the halothane response of progeny appears to be
inﬂuenced by both sire and dam line.

In previous repeatability studies, pigs that did not show a deﬁnitive response were
classiﬁed as “doubtful” and were pooled with non-responders (Webb and Smith, 1976;
Webb and Jordan, 1978). In our study, HS-I and HS-H were considered to be HS,
whereas HS-L pigs were considered to be HN. Thirteen percent of the pigs were positive
on the ﬁrst test day only and 23% were positive on the second test day only. Using these
percentages, the frequency of disagreements between the ﬁrst and second tests was 36%,
and the probability of misclassifying a pig on one test was estimated to be 24%.
Disagreements between halothane responses on separate test days have been reported.
Webb and Smith (1976) tested 335 pigs 28 d apart and observed a 10% disagreement
between the two tests. In a second study, Webb and Jordan (1978) showed a 9%
disagreement when 394 pigs were tested 21 d apart. The probability of misclassifying a
pig on one test in these two studies was calculated to be 6 and 5%, respectively. The
higher probability of misclassifying a pig in Exp. 2 is most likely due to a different
evaluator scoring the response on the second day. In fact, when a single evaluator scored
the response of HAL-1843-normal crossbred pigs subjected to three halothane tests every
other day in a ﬁve-day period, the probability of misclassifying a pig on one test was
calculated to be 10.5% (unpublished observations). This evaluator’s classiﬁcation (d 1)
was used to determine the relationship between HS and carcass composition or meat
quality for all pigs in Exp. 2. It is also possible that the high frequency of disagreement

was a result of considering pigs that exhibited a “mild” response to be more similar to the

37

HS group than the HN group as previously described. When disagreements are only
considered between HS-H pigs in Exp. 2, the probability of misclassifying a pig on one
test would be 14%. The probability of misclassifying a pig in the current study may also
be greater than previous reports due to the lack of pigs with the HAL-1843
polymorphism, which exhibited a more severe response to halothane in previous studies.
Pigs that are HS are typically leaner and heavier muscled, equating to more total
pounds of lean tissue (Monin et al., 1980). However, the increased propensity to stress
related death (O’Brien and MacLennan, 1992) and poor quality pork negate the beneﬁt of
more lean muscle tissue. Pigs that are classiﬁed as HS generally have lower initial pH,
higher muscle temperature, lighter color, and poorer water-holding properties (Klont et
al., 1993; Sather et al., 1991; Warriss and Listen, 1982). In the current experiments, no
consistent differences were observed between halothane response and carcass
composition or meat quality in HAL-1843-normal pigs. Means for carcass composition
and meat quality data for lines A through D collected at Plant A are reported by
experiment, line, and halothane status in Tablel .2. In Exp. 1, line A pigs that were HS
had a lighter ﬁnal live weight that resulted in a lighter hot-carcass weight compared to
HN pigs (P < 0.05). However, this difference was not (P > 0.25) observed in any other
lines. Ham pH, measured at 22 h postmortem, was higher in HS pigs from lines B and D
(P < 0.05) compared to HN pigs in the respective lines. No signiﬁcant differences were
observed in loin pH or drip loss between groups of pigs with different sensitivity to
halothane (P > 0.20). Loins from HS pigs of line D were darker and ﬁrmer, based on
subjective scores, than loins from HN pigs (P < 0.05). When the halothane response for

lines A and B was scored (Exp. 2), no differences were observed between halothane

38

.390 v A: Loam: not»: Haw—omega .8588 a wet—oa— memoE .38 28 0:: one—cow a 55:53
.868 .8an E a: $2 1 S 6:6 6.2% u _.

.Aooom .UAEZV be :5 Eu bo> n m 3 .0863 :5 com bo> n r

.868 .9376 62 5:93 6.66 u 6 e be» 56.5.. 6.3 u r

6.28 32.0% 208

a $5865 $29 .3 cos—mm”: 538% 26:9» 9 6:3 05 mo 05805 a 86 mos—3 E 528 .6262 a 6.8863 mos—g *6 5:95 .556on
v2 8 50% 65 :0 83.668 6 26 82? *6 “Co—o6 him: a 6.28:2: .82? .5 3:95 Sop—Em: 8 805.3: :0 2:23.: a 6.3 mos—g Lu

.3. 6.3 no 2363 3688 Ho: @3866 :6 so “some: 2826

.< Eu:— coﬁwssm an 386:8 Sec :6.6
63:38 28526: n m: use 63:28-5: 2.6526: n 2:.

 

 

 

 

 

3 arm 6w hm hm 6.~ on elm am .eooawilllszaa s:
_6 .5 .3 mm 3 _.N _.N 3 Na .28... 68.5: s:
_6 .66 .3 mm 66 an 66 6.... mm .28. 6.8 s:
_6 3. m6 3. 3. an S. S. 3. .x. .62 e5
NB. 9.6 8.6 2.6 66 66.6 $6 8.6 £6 .3
$6 $6 :6 $6 $6 .86 .36 £6 .66 a...
666 626 «a? 3.9. 5.9 65.6 3.3. :66 66.? a:

36 86 N66 .66 .66 ”66 86 M66 66 526.586 6 mm

86 :6 26 26 26 86 36 :6 :6 68.2586 6 _
:6 Zn

8.6 .86 .36 6.6 666 .86 .86 86 36 66:65.8 a «N

86 26 S6 86 86 26 26 :6 26 56:25.8. 6 _
:6 pa:
2 an. 3. $6 at. 6.. Na. 66.. we. use 665.25 :63 >68
66 N66 6... :6 N66 666 666 6.3 36 0.x. .26; 53
66 36 M66 :6 N66 6.? 6m 36 5.... use .586 s:
3 NS 52 6.2 E: 6.2 6.3 ”.2 6.2 .56 .586 6a
2 6.2. 66” 56 3.» E” 6.5 .3» .3» me. .E .888 so:
a... a6: 6.2. a6: 3: 3: 66: .3 : .3: ms. .2 2.: as...
mm mm 6... 2 a. 6.6. on a. .8328 co 62

2% m: 2: mm zm m: zm m: E
o 25 o 25 m 25 < 2.5

a

. 6389.2 65536: 98 6:: 46.5 .3 “688636 See 3:626 :38 was coEmoquo $3.80 .N.: 2an

39

.808 .0632: 8.: .8: $2 u o: 9 “a: .8: 6\6: n :»
.Aooom .UAEZV DU 86 8.6: bo> u m 9 .6863 :8» c8 bo> u r
.866» .8626 62 6.66.56 .686 u 6 6. .26 6.66666 .28 u 6..

65.8 30:26 808

6 68388 8265 .b 66:85 88386 30:96 9 83 65 Mo 2888 a 26 68.8 .b ”Co—co .5262 a 688%.: 62:? *6. 60:85 88886

:8 8 88m 05 no 95868 a 26 62:? *6 ”Co—8 Sim: a 638:8: 68—? L 68—85 883m: 8 805.68 .8 0.5808 6 26 62:63 .46
.8. 5.3 :0 Emma...» 6828 Ho: 368:8 86 co :86: 8826
.< 8.68 68.6826 :6 368:8 S8 :6...
55:88 86526: :wE u 2%: 86 203588 86526: 86:58.68: u Tm: ”83:88 86526: 32 u 4-2:.

 

 

 

N6 6.» 6.» 6.~ 6.» 6.6 6.» .28. 68.836.
.6 6.» 6.» 6.» 6.6 8 6.» .28. .855... 26
N6 6.» ».~ 6.» 6.» N.» 6.» .28. .28 26
6.6 6.» 6.» a.» 6.» Z 6... 2.. ...6_ 68
66.6 66.» 66.» 66.» 8» 6...» 6».» 2.6
66.6 66.6 66.6 86 :6 666 66.6 a.
66.6 66. 66 N66. 66.»... 66.3. 8.6.. 66.6.. .8

666 6».6 66.6 6.»6 56 66.6 66.6 22.25.66 6 N»

666 »».6 :6 66.6 86 :6 £6 68:85.66 6 6
:6 s:
6.6 ».»6 6.66 6.»... »66 6. 6 6 6.66 .666 .8526. :8. >66».
66 5.6 .66 5.6 6.66 6.66 6.66 .8 .22. 83
6.» 6.»6 6.66 6.66 26 6.»6 6.66 .82 6.86 26
6.6 6.»_ 6.66 6.»_ 6.»6 6.»_ 6.: .56. 6.86 8
6.» :6 ».N6 6.66 6.66 6.66 6.66 6.. 6.. .828 .6:
6.» 22 662 3.2 6.62 6.62 6.62 66 .63 2.6 .866
6 3 N6 » »_ »_ 8.828 66 .62

28 3-8 6-8 6-8 88 6-8 6-8
m 266 < 266

63 9.5 68: 88% 85:5 .8808»: 686526: .3 888% 8 5:8: 808 :8» 83:86:88 8880 .m._ 636,—.

40

sensitivity and carcass composition or meat quality (P > 0.30; Table 1.3).

Carcass composition and meat quality data collected at Plant A, separated by line
(B through H) and HS class, for Exp. 2 are presented in Table 1.4. The low number of
pigs in line E and G were a result of pigs from these lines being used for further testing in
an animal-handling model. No differences were observed for live weight across lines (P
> 0.26). However, pigs classiﬁed as HS-I and HS-H had higher HCW than HS-L in line
B (P < 0.05). In line G, HS-I carcasses had greater fat depths than HS-L carcasses (P <
0.05). Muscle depths of loins from HS-I carcasses were greater than those from HS-L
carcasses in line F (P < 0.05). Likewise, the HS—H carcasses in line H were found to
have greater LM depths than HS-I, but were similar to HS-L (P < 0.05). These
differences are similar to those previously reported where muscling tends to increase with
halothane susceptibility (Monin et al., 1980). However, no differences were seen in
percent lean or body wall thickness between HS categories across these lines (P > 0.20).
Initial (1 h) and ultimate pH values were similar across all lines by halothane response.
Lightness (L*) values were lower in HS-H than both HS-L and HS-I in line G (P < 0.05),
although this difference was not detected in the subjective color evaluation (P > 0.50). In
contrast, Monin et al. (1980) demonstrated that as susceptibility to halothane increases,
reﬂectance values tend to increase.

The lack of a consistent relationship between halothane sensitivity and carcass
composition or meat quality is surprising given the previous reports demonstrating the
detrimental effects of sensitivity to halothane on these traits. In this study, it is possible
that the increase in human contact prior to slaughter and the use of C02 stunning to

render the pigs unconscious masked the effects of sensitivity to halothane. Indeed, use of

41

.Amod v A: BEE Sto— «atomoasm .8883 a wet—us 2:38 .25.. use us: otocow a 55:5?

.253 .UAEZV “ﬂ .E._ o\oo_ n e 8 3m .E._ o\.._ .I. r.

.958 .UAEZV bu 28 8.6 be.» H m 8 b3“? new $8 be.» n 5
A88 .oﬁzv B. 3&3 15 u o 3 saw 52:3 .28 u _
65.8 30:0» 20:. a 828:2: mos—g an hoswEw

.550on 26:0» 9 0:3 05 mo 2388 a 2a 839 .b 528 825.. a 880%.: mos—g am .5536 888on v2 3 5un

Bu .8 95308 a 2m 33? {a ”Co—co him: a 830%5 823 *4 6:36 $2.2m: 8 $0513 mo 8:32: a 2m 83? *4...

.3. :5 .«o 2303 33.8 8: 3323 SN no 389 832
.:-m: 3 358a? 203 m on: 5 $3 020

v

.< :83 Suﬁsm—m an 380:8 8% :5
53328 0552a: 59: n mix 28 5332.8 0.8523 SEEP—~85 u TmI 53:55..” 05522 26— " 4mm“

 

 

 

No on aim 3 2.. 3 E 5. _.m 3 3 Z geoomlm.=_.__|§ellzq
no 3 3 8 3 Z 3 mm 3 _.~ 3 8 ”28... museum 3:
No 3 E «a 3. mm mm mm on on 3. am cocoa 58 s:
:3 S. 2 3m to tm «N 3 3 S 2 as .x. .32 95
85 “8.2 .86 x22 a.” 85 2: ed a; 3.» Ed 2.” ab
and 2a m2 EA and a: «mm ”3 m3 m: 3 a? a.“
a: 8.2. as. ohm... >83 .2.? .2.? 2.3 and. and. 3:9. Es. a...
85 NE 8d 3m 3m 8w $6 5m 3m NS NS 86 Eueoéma ; mm
mod 86 ”S 2.0 86 NS 8.0 m3 «3 8.0 2.0 86 Eoeoﬁma £
:a s:
2 3m 33 at. a: Zn ca. 5:. v.3. :2. new 2w. veséoﬁozzaa zoom
3 Em «.3 3% 3m 2% 3m 3m in 3% new mam xx. .20; 53
S 3% 3% p20 36 MS MS .36 3% as as v.8 seesaw s:
E M: 3; 3. :3: x02 an: EN EN 3: we om aegsaouam
2 2.: Ma 3 5w «:8 NS 2a 0.8 .32 .32 2.8 3. 330580330:
3. 32 ES 32 as: 3: 3: 3: is 3.2 22 3.2 ﬁsﬁeag=§a
N 2 an a. 8 z w 3 a an N 83830 do .02
2% :.m: Ex 4.? aim: E: .3: E: .10.: :-m: SE .3:
m 25 o 2.: on 25 m 2.:

nAN dxmv won: 335% £515 «030%»: 05523 .3 380% mm >596 “38 98 858.380 mango e..— 033.

42

C02 stunning has been shown to reduce the occurrence of PSE musculature in pigs
compared to the use of electrical stunning systems (Channon et al., 2002). Furthermore,
Velarde et al. (2001) demonstrated that the percentage of PSE loins was signiﬁcantly
higher in electrically stunned pigs compared to those stunned with C02 (35.6% vs. 4.5%).

The subset of pigs used in the animal-handling model (from Exp. 2) were
subjected to two transportations, one prior to the handling model (~1,000 km) and the
other following the handling model to one of two slaughter facilities (~484 km).
Following the post-handling transportation, a minimum of 2 h rest was allowed prior to
slaughter. It was anticipated that these pigs would produce pork products that were
darker, ﬁrmer, and less exudative than normal in appearance as a result of the more
extensive transport and handling that these animals endured. Carcass composition and
meat quality results of these pigs are shown in Table 1.5. No differences were observed
in initial (45 min or 1 h) LM pH values (P > 0.80); however, LM from HS-H pigs had
lower ultimate pH (P < 0.05) at plant B, and this trend was also observed in pigs
slaughtered at plant C (P = 0.12). This lower ultimate pH was associated with greater
ﬂuid loss from HS-H pigs (P < 0.05). Objective color values were similar between HS—L
and HS-H pigs, but subjective color scores indicated that LM from HS-H pigs was
perceived to be lighter in color than that of the HS-L pigs (P < 0.05) at plant B.

One plausible explanation for the observed difference in ultimate pH and drip loss
may be that HS animals are more sensitive to stress and have become conditioned to
recover more quickly when subjected to a stressful situation compared to HS-L animals.
To our knowledge, no other reports have been published describing this phenomenon. If

this were the case, the HS pigs would be expected to replenish glycogen stores more

43

.306 v at “ohm—u .83— Etomoasm 5888 a mat—oa— mSon .32 can 0:: 385% a £55»?

.Socm .UAEZV E .E._ $0— " S 9 5 .E._ .x: u :
.Aooom .UAEZV bu Ea SE bo> u m 8 E895 v5 «8 bo> n F

.258 .8sz B. 5:92. 15 u c 2 be» 52:3 .28 u __v
65.3 26:?» PSE a ““8865

82? E 5:95 5.58% 26:?» 3 0:3 of mo 2:32: a 2m 82? .3 528 525.. a 83035 829» *a 5:35 8.58% to.
8 59% 05 mo 2:988 a 0.3 mos—g .h ”Co—8 .5sz a 8:865 mos—g *4 .235 32.2%: 8 305:3 mo 2:32: a 2m mun—g Lo

. 6 23.3 $— 35 8 E 23.8 3. Nmo mo 3303 «$88 “on @8253 5 no 393 3825

55:88 2852a: 29: .I. :.m: can 53328 28522 8238.85 H _.mm 53:65,,” 28522 Bo. n Aim“

 

 

 

44

3 2 M: 5 3 NM NM .283
3 2 5 .2 3 3 2 028m 38.5 s:
3 mm mm 3. 2. >2 *3 ‘28” .28 s:
3 “E *3 E 3 *3. 3a .x. .32 35
we 8.» ad on» .3 R an a...
S 2 85 no 3 h. _- S- 0%
3 can «.8 «SM S 2* v.8 ”L

3 c3 Fm 3m 3 E.“ 32 58:32. a «N

..- -.. 9o «3. 5m 53:58 ._ _

3 :6 3.0 a}. i 89858 55 2.
an s:
3 2m 3m 2m 2 3m 2m 9.x. .2”; 53
M: «.8 «.3 2% £50 .83 s:
E i 3 2» 25 gas .596 s:
2 EN EN EN 3 2a 0.8 see 53% E
3 a? w. a 98 3. 2o 25 9. .E 528 a:
h a w R S maaoao .6 .02

2% :.m: an em: 2% Fm: 17mm
0 Eda m Em:

BEE mczvcwnéag 5 350:3
3529 wcﬂowa 3338 95 3 @8833? $1“ mo 3:56 :88 98 536888 8858 so «3.89.2 2852a: mo 80km .mg 2an

rapidly following a stressor than HN pigs, accounting for the lower ultimate pH observed
in the HS pigs. The lower ultimate pH would result in a decrease in the net protein
charge and would most likely account for the observed increase in ﬂuid loss (Hamm,
1986)

Based on these results, we conclude there are HAL-1843-normal pigs that are
susceptible to halothane anesthesia. The relationship between halothane sensitivity and
carcass composition or meat quality is inconsistent across lines of pigs when transport
and handling of pigs is minimized. However, these results suggest that, when subjected
to multiple stressors, halothane sensitive pigs may be more prone to producing inferior
pork than halothane non-sensitive pigs. More work is needed to better understand the
physiological differences that account for variable responses to halothane anesthesia and
the inﬂuence of the physiological differences on pork carcass composition and meat
quality.

IMPLICATIONS
The HAL-1843 polymorphism in the skeletal muscle calcium release channel (ryanodine
receptor) has been eliminated from most commercial populations. Nevertheless, some
pigs continue to exhibit characteristics similar to porcine stress syndrome, and are
sensitive to halothane anesthesia in the absence of the HAL-1843 polymorphism. The
full implications of sensitivity to halothane are unclear; however, halothane sensitive pigs
that are subjected to multiple stressors appear to be more prone to producing inferior
quality pork than halothane non-sensitive pigs. These ﬁndings support the notion that

novel polymorphisms may exist in the ryanodine receptor or other proteins involved in

45

calcium homeostasis that may be associated with stress susceptibility and production of

inferior quality pork products.

46

CHAPTER 2
EFFECTS OF HALOTHANE SENSITIVITY ON MOBILITY STATUS AND BLOOD

METABOLITES OF HAL-l 843-NORMAL PIGS FOLLOWING RIGOROUS HANDLING

ABSTRACT
The objective of this study was to determine if HAL-1 843-normal pigs that respond
abnormally to halothane anesthesia are more likely to become non-ambulatory (NA)
when subjected to rigorous handling than pigs that exhibit a normal response. Pigs
exhibiting low (HS-L; n = 33), intermediate (HS-I; n = 10), and high (HS-H; n = 47)
sensitivity to halothane were moved through a 36.6 m long aisle that was 2.1 m wide at
each end and 0.6 m wide in the middle 18.3 m. Ten groups of eight pigs were briskly
moved down the aisle and back four times receiving a minimum of one electrical prod
per pass (8 prods/pig). Prior to testing, rectal temperature was measured, open-mouth
breathing, and skin discoloration were visually evaluated and a blood sample was
collected from each pig. Following the test, pigs were returned to pens and the same
measurements were taken immediately post-test and l h post-test (no blood at 1 h time).
Pigs that were HS-H were more prone to becoming NA than HS-L pigs (P < 0.02). No
differences were observed in blood metabolites between the different halothane
sensitivity categories (P > 0.25). However, pigs that became NA had elevated blood
metabolite levels prior to testing (P < 0.05). Collectively, these data suggest HS-H pigs
are more susceptible to becoming NA than HS-L or HS-I pigs. The elevated pre-test
blood metabolites of NA pigs suggests that they were in a hyper-metabolic state that

predisposes them to becoming NA.

47

INTRODUCTION

Pigs affected with porcine stress syndrome (PSS) were shown to be more prone to
becoming non-ambulatory (NA) when subjected to adverse handling conditions or during
transport to harvesting facilities (Topel et al., 1968). Moreover, pigs affected with PSS
exhibit an abnormal response to halothane anesthesia (Harrison, 1972). Because of this
association, the halothane challenge test was used for two decades to reduce PSS in swine
populations.

The frequency of NA pigs arriving at harvesting facilities or pigs that become NA
prior to harvest has been estimated to be about 1%, but could be higher on a given harvest
day (Ellis et al., 2003; Ritter et al., 2004). This presents a signiﬁcant problem to the
swine industry and greater scrutiny will most likely be placed on the use of meat from
NA animals in the future. In addition to primary concerns about animal welfare, extra
workers are required to handle these animals, harvesting facilities are required to track
the product from these animals, and the ultimate meat quality is unpredictable. It is
interesting to note that NA pigs currently observed in the swine industry exhibit
characteristics similar to those described by Topel et al. (1968).

Fuj ii et al. (1991) identiﬁed a single nucleotide polymorphism (C1843T) in the
skeletal muscle calcium release channel gene (R YR!) of swine that results in an arginine
to cysteine change in the amino acid sequence at residue 615. It was expected that
removal of this polymorphism would substantially reduce the characteristics associated
with PSS. However, Rempel et al. (1993) demonstrated that 30% of the pigs considered
to be free of the known detrimental polymorphism (HAL-1843-normal) exhibited an

abnormal response to halothane anesthesia. More recently, Allison et a1. (2004) reported

48

that the incidence of halothane sensitive pigs in several commercial, HAL-1843-normal
lines ranged from O — 62%. It is unclear if pigs that are HAL-1843-normal and halothane
sensitive respond differently to stressors than animals that are HAL—1843-positive and
exhibit sensitivity to halothane. Therefore, we hypothesize that HAL-1843-normal pigs
that respond abnormally to halothane anesthesia will be more prone to becoming NA
when subjected to rigorous handling than pigs that exhibit a normal response to
halothane. .
MATERIALS AND METHODS

Animals and Halothane Testing

Pigs used in this study were selected from those halothane tested by Allison et al.
(2004). Brieﬂy, four commercially available, HAL-1843-norma1 sire lines were used to
inseminate a single dam line. When progeny were approximately nine weeks of age they
were subjected to 3% halothane for 3 min. The response to halothane was scored by
visually evaluating limb rigidity on a scale of one to four and skin discoloration and
tremors on a scale of one to three. In each case, the higher number indicated a more
severe response. The average limb rigidity was added to the discoloration and tremor
score to calculate the halothane score for each pig. This score was then used to
categorize pigs into three groups: halothane sensitive — low (HS-L; < 4.0), HS-
interrnediate (HS-I; 4.01 — 5.49), and HS-high (HS-H; >5.49). Of the four commercial
lines evaluated by Allison et al. (2004), two of the lines exhibited less than 2% HS-H
pigs, whereas the remaining two lines exhibited greater than 25% HS-H pigs. Therefore,
thirty-three HS-L (n = 33), ten HS-I (n = 10), and thirty-seven HS-H (n = 37) were

selected from the two lines possessing greater than 25% HS-H pigs.

49

Animal Transport. Sampling,_and Handlingmodel

Pigs were loaded into semi-trailer compartments in their test groups of eight, with
additional non-test pigs ﬁlling the remainder of the compartment. Pigs were transported
approximately 1100 km to the testing facilities and upon arrival were allowed 3 h of rest
with access to water to mimic marketing conditions. The eight pigs that comprised a test
group were housed four to a pen, in two pens. The temperature of the building was
maintained at approximately 183° C.

The animal-handling model used for this study was based on a model previously
described by Benjamin et al. (2001). All procedures for the handling model were
performed in accordance with the Eli Lilly Animal Care and Use Committee (#03033).
After a 3 h rest and prior to testing, a rectal temperature was collected, skin discoloration,
and open-mouth breathing were visually evaluated on a binary scale and a blood sample
was collected from the vena cava following snare restraint (pre-test). Blood (10 ml) was
removed from each animal as quickly as possible (generally < 1 min) to reduce erroneous
results in metabolites. The handling course was constructed to be 36.6 m long and 2.1 m
wide at each end. The middle 18.3 m was reduced to 0.6 m wide to mimic a single-ﬁle
chute. Ten groups of eight pigs each were moved down and back (1 lap) four times. The
animal handler was provided a sort board, an electric prod, and was instructed to move
the pigs at a fast walking pace. In addition to the handler-imposed prods, an additional
person was stationed in the middle of the aisle and was instructed to prod each pig on
each pass (eight times total). Electric prods were approximately 0.5 sec in duration.
Following the completion of the fourth lap, pigs were returned to their pen, where rectal

temperature, skin discoloration, and open-mouth breathing were recorded. A blood

50

sample was collected within 10 min following the handling model (post-test) from all
eight pigs as described above. One hour following the test, rectal temperatures were
recorded and skin blotchiness and open-mouth breathing were visually assessed (1h post-
test). Following the 1 h post-test observations, the pigs were allowed access to feed and
water.

Pigs were deemed NA by an on-site veterinarian using the criteria deﬁned by
Benjamin et al. (2001). Brieﬂy, if the pig was unwilling to move or had a rectal
temperature greater than or equal to 41°C and showed multiple signs of distress (open-
mouth breathing, skin discoloration or muscle tremors) it was classiﬁed as NA. One pig
became NA while moving through the course. This pig was not required to ﬁnish the
course and was humanely moved to the nearest pen and allowed access to water. Post-
test observations of this pig began immediately upon removal from the course. Two pigs
were deemed, by an on-site weterinarian, to be in severe metabolic distress following the
handling model and were immediately euthanized. Two additional pigs were euthanized
due to visual signs of metabolic distress prior to post-test transport.

Blood Metabolites

Blood samples were allowed to stand at room temperature for 1 h and were then
centriﬁiged at 3000 x g for 15 minutes. Serum was collected and stored at -20° C until
analyses were performed. Serum samples were analyzed using the Monarch Chemistry
System (Allied Instrumentation Laboratory, Lexington, MA) for acetoacetate, [3-
hydroxybutyrate (BHB), creatine phosphokinase (CPK), glucose, glycerol, lactate, non-
esteriﬁed free fatty acids (NEFA), blood urea nitrogen (BUN), ammonia, phosphorus,

triglycerides, and total protein. Acetoacetate and B-hydroxybutyrate were analyzed using

51

an enzymatic method quantifying D(-)-B-hydroxybutyrate and acetoacetic acid in serum
(Williamson, et al., 1962). Creatine phosphokinase was analyzed by monitoring the
conversion of NADH to NAD+ spectrophotometrically (Rosalki, 1967). Glucose was
determined using the hexokinase method coupled to glucose-6-phosphate dehydrogenase
(Kunst, et al., 1984). Glycerol was quantiﬁed using an enzymatic method reported by
Wieland (1984). Lactate was measured via enzymatic conversion described by Olsen
(1962). Non-esteriﬁed free fatty acid concentration was determined using the
colorimetric method of Shimizu et al. (1980). Blood urea nitrogen and ammonia
concentration were determined by enzymatic analysis (Kerscher and Ziegenhom, 1985;
Bergmeyer and Beutler, 1985). Serum phosphorus concentration was measured by using
a colorimetric assay (Fiske and Subbarrow, 1925) and triglyceride levels were determined
indirectly via an enzymatic method that measures the glycerol released from triglycerides
upon hydrolysis by lipase (Esders and Goodhue, 1980). Total protein was determined by
measuring total Kjeldahl nitrogen (Doumas, 1975).
$1165th Analysis

Differences in the number of non-ambulatory pigs, percent discolorations, and the
number of pigs exhibiting open-mouth breathing within different classiﬁcations of
halothane sensitivity were analyzed by logistic regression using the GEN MOD
procedure of SAS (SAS Inst. Inc., Cary, NC). The statistical model included the
dependent variable mobility status, discolorations or open-mouth breathing and the
independent effect of halothane category, line, gender, and mobility status. Mobility
status was not included as an independent effect when it was evaluated as a dependent

effect.

52

Prods per pig was also analyzed by logistic regression using the GEN MOD
procedure of SAS. The statistical model included the dependent variable of prods per pig
with the independent effects of gender, line and halothane category. Rectal temperature
was analyzed using a protected least signiﬁcant difference test utilizing the mixed model
procedure of the SAS software. The statistical model included the ﬁxed effects of
gender, line and halothane category with the random effect of group. Blood metabolites
were compared between ambulatory and NA pigs using the ﬁxed effects of gender, line,
halothane category and mobility status with the random effect of group. Blood
parameters were also compared between halothane categories using the ﬁxed effects of
gender, line, mobility status, and time with the random effect of group.

RESULTS AND DISCUSSION

This study was designed to determine if halothane sensitive pigs were more prone
to becoming NA when subjected to rigorous handling than pigs that respond normally to
halothane. A controlled handling model has previously been shown to increase the
frequency of NA pigs, thereby allowing for comparisons to be made between ambulatory
and NA pigs (Benjamin et al., 2001). This model system also reduces the inconsistencies
of previous handling and transport observed in commercial harvesting facilities, and
allows relationships between handling inputs and metabolic effects on individual animals
to be quantiﬁed.

No pigs became NA during transportation or during the lairage rest prior to the
model. However, nine animals became NA as a result of the rigorous handling (11.3%;
Table 2.1). This represents approximately half of the NA pigs that were observed by

Benjamin et al. (2001 ). A clear explanation for this observation is not readily available,

53

Table 2.1. Observations recorded in response to rigorous animal handling

 

 

HALOTHANE SENSITIVITYa’b
HS-L HS-I HS-H
n 33 10 37

%Non-Ambulatory° 9.0f 10.0ﬁg 18.7g

. . d
% Dlscoloratlons

Pree 0" 0" 0"
Postc 33.2y 35.4y 39.8y
1 h poste 10.8" 9.0" 8.1"
% Open-mouth Breathingd
Pree 0x 0x 0x
Poste 68.3f’y 65.9"y 47.21%y
1 h postc 3.0" 9.0" 7.0"

 

"Halothane sensitive-low (HS-L); HS-intermediate (HS-l); HS-high (HS-H).
bPercentages are adjusted for gender, line, and halothane sensitivity.

cPig that was unwilling to move and/or showing multiple signs of stress.

dVisually evaluated indicators of stress. Scored as either exhibiting the phenotype or not.

cTime when trait was evaluated. Pre - prior to test, Post - immediately following the
model and l h post - 1 h following handling model.

f’gMeans with different superscripts within I‘OWS differ (P < (105)-

U Means with different superscripts within a column and trait differ (P < 0.05).

54

but could be due to the pigs in the current study being more accustomed to handling and
interaction with people. According to van Putten (1982) each pig has to experience how
to react to various stresses. After exposure to various situations, experiences are

less stressful and ﬁ'ightening to these pigs. Pigs used by Benjamin et al. (2001) would
have been tested in the same facility as they were reared and these authors indicate that
there was minimal contact and interaction with the pigs prior to the rigorous handling.
Thus, these pigs would have had little opportunity to be exposed to events similar to
those imposed on the day of the handling compared to the pigs described in the current
study. It is possible that lack of exposure to stressful situations could account for the
increased number of NA pigs in the study described above (Benjamin et al., 2001).

In the current study, pigs classiﬁed as HS-H were more prone to becoming NA
than HS-L pigs (P < 0.02; Table 2.1). All but one of the nine pigs became NA after
returning to their pens following movement through the model. The only animal that
became NA in the alleyway of the course did not exhibit discoloration of the skin or an
elevated rectal temperature, but appeared to be experiencing labored breathing.
However, this HS-L pig was classiﬁed as NA because it was unwilling to move and was
resting in a sitting position.

No differences were observed due to halothane sensitivity in the number of
animals exhibiting skin discoloration or in rectal temperature assessed over the three
evaluation times (Table 2.1). However, a lower percentage of HS-H pigs exhibited open-
mouth breathing compared to the HS-L or HS- I pigs (P < 0.05; Table 2.1). This
observation suggests that some halothane sensitive pigs may become conditioned to

stressors or are better able to adapt to stressful experiences than pigs less sensitive to

55

halothane (van Putten, 1982). A greater proportion of pigs exhibited open-mouth
breathing and skin discolorations following the handling model (post-test) than at the pre-
test or 1 h post-test observations within halothane status (Table 2.1; P < 0. 05). However,
no differences were observed in these visual characteristics between pre-test or 1 h post-
test observations. No differences were observed in rectal temperatures among pigs of
different halothane categories (P > 0.30). Rectal temperatures were highest in pigs
immediately after the handling course (39.7°C) compared to pre- or post- test
temperatures (38.6°C vs. 39.0°C, respectively; P < 0.05). Temperatures were still
elevated l h post-test compared to pre-test values (390°C vs. 38.6°C, respectively), but
were lower than those observed immediately following the handling (39.7°C vs. 39.0°C;
P < 0.05). The observed increase in open-mouth breathing, skin discoloration and rectal
temperature coincides with the normal ﬂight response of pigs exposed to exercise or a
stressful situation (Fraser and Broom, 1990).

Electric prods were used in this study to exaggerate the effects of rigorous
handling. These prods were of a short duration (0.5 sec) and recorded individually for
each pig. Pigs classiﬁed as HS-H received fewer prods per pig than those classiﬁed as
HS-L (P < 0.05; Table 2.2). This observation is opposite of anticipated results. Pigs
classiﬁed as HS-H were expected to be more stress susceptible and subsequently more
likely to fatigue faster. This would place the pig closer to the animal handler and would
result in these pigs receiving more prods. Interestingly, when mobility status is
accounted for in the statistical model, HS-H pigs that remained ambulatory received

fewer prods per pig than HS-L pigs (P < 0.05; Table 2.2) and HS-H tended to receive

56

Table 2.2. Number of prods received per pig separated by halothane sensitivity and
mobility status

Halothane Sensitivity“

 

 

HS-L HS-I HS-H SE
Overall
Prods/pig 15.3b 14.8b‘c 13.50 0.78
Ambulatory
Prods/pig 15.1b 14.8b’c 12.6” 0.73
Non-ambulatory
Prods/pig 18.1 15.2 19.2y 2.6

 

aObservations: 33 Halothane sensitive-low (HS-L), 10 halothane sensitive
intermediates (HS-I) and 37 halothane sensitive high (HS-H) pigs.

b’cMeans within rows with different superscript differ (P < 0.05)
x’y Means within columns with different superscript differ (P < 0.001)

57

fewer prods than HS-I pigs (P = 0.10). This observation suggests that HS-H pigs may
have generally been in front of the group, or farther away from the animal handler than
HS-L or HS-I pigs. Pigs that were HS-H and became NA received almost seven more
prods per pig compared to the ambulatory pigs (P < 0.05; Table 2.2). These ﬁndings are
in agreement with those of Benjamin et a1. (2001) who reported that NA pigs received
more handling inputs than ambulatory pigs when subjected to rigorous handling. It is
unclear if the pigs in the present study became NA as a result of the increased number of
prods or if these pigs were slowed by physical or metabolic limitations associated with
halothane sensitivity and thus received more prods from the handler.

No differences were observed in the blood metabolites among HS categories (P >
0.35; Table 2.3). This is in contrast to previous reports demonstrating that HS pigs are
more susceptible to stress and have a greater autonomic response to stimulation than
halothane non-sensitive pigs (Gregory and Lister, 1981). In a classical stress response
situation, HS pigs have been shown to be in a hyper-metabolic state and have elevated
levels of blood metabolites (Jones et al., 1972; Veum et al., 1979; Heinze and Mitchell,
1989). The increase in blood metabolites following the rigorous handling indicates that
these animals were being physically challenged, regardless of halothane sensitivity
category (P < 0.001; Table 2.3).

Pigs that became NA in this study had elevated levels of blood CPK, glycerol,
lactate, NEFA, ammonia and BUN prior to initiation of the handling model (P < 0.05;
Table 2.4). This would suggest that animals that became NA during the model were in a
hyper-metabolic state prior to the test. Elevation of these metabolites prior to handling

could be an indication of a chronic excitability of these pigs (Barnett and Hemsworth,

58

69.030 203 noochEu 02 60.28 58 £53 850 2350.2 5923 35.90 203 means—o

8.9 n. 2.28.088 2: a 5e... .320 25522 553 .8. :85 28.2..

.82 2.. 2.30:2 2a

2 .23 22985.5 :35 8; 82m .83 foxy .5... 9228 228.2 B 215; 82586.25 8228 82.22 2 ﬁrm; 32.9528 226.»: an sconce;

 

 

 

mz 3.0 v n. 8.4 9% 34 «an RN o3 mum new .29: 882%..
mz 55 v a 3.0 a.» E as :6 2 3 ms in :92“. .88
m2 33 v a and ﬂ: «.9 5.2 Ba Nﬁ 2: oﬂ .2? 23m
mz 585 v a med 3; a? 3; ad 3 m.» 3 .525 mascagn.
wz 38.0 v n. 5.9. 33 tuna :8? 8.2 38 38 4.2m .525 385%
mz 58.0 v a 5.: ma: ode o. x: 8.8 :8 33. 3mm :8... Emz
wz 685 v n. «3 «.3 SN tow m3 3 mm. on $2.2 28 263
wz 33o v a Raw 3% 3% 38 8.: 3: Z? 32 .585 .9829
wz 58d v n. 35 NE NE on: 5.? Q; E «.5 .29: 8820
wz wz 8.8% 38: 3mg 388 8.38 3:8 382 32.2 ._5_ Eu
wz :3 v n. 2d to no no mod to S S .29. 055395.23
wz 686 v n. :3 ms 3 3 2d 5 ma 3 .22. oﬁmomomoa.
onmbiI immk 2mm Ital: _-m_.. .5: 2mm In... 5: ._-m_.. mtz: .mtdmsmz
8.5.25 59-59. 55-me

oﬁﬂ wax—9:8 Ea bm>£maom 05523 3 con—830m mot—3808 woo—m .m.~ 2an

59

.33. v A: St? cocoa “.2 £55 .032 Etoﬁoaam .5588 a mac—02 .532...

59236..-.52 n <2 3.3235 n <.

 

 

 

 

I... .....l 8% 8....1 8... .2.. o... $8 8.... 0.8.82.3.
N... .... 8... .... t... .2 8... N... .2. 538.. .8...
o... .2... o... .8... 8... .3... R... .o... .2.... 75m
8... .8... o... .8... ...o m... m... 8.. .2.... 58.8....
8... .38.. 8.8 .3... on... .8... .... .8... .52.... 388.5.
8... N... 8.. .9... .3. .38 8.... N... 8.2.5 $52
8.. 3.... .8 mm... a... .8. z... .8... 6.2:... 883
8... .8... .m... .8... a... .6... v... .88. .52.... .88....
8... 2.... o... 8.... 8.. 8... N... .3. .2.... 3.820

.88 .8... 2... .8... 3.... .82.. 8...... .8... .5. .30
a... .m... ...o .8... ...o a... 8... o... .2.... 88838.28...
.2. 8.. a... o... R... v... 8... o... .2.... 3888.8...
m. <7. m. < m. <7. m. < 8.5 5.0%

“mouuumom 3310.5

.98.. 52308 E... cocoa “.8 .3 @8830. 853808 coca .vd 2an

60

1986). Following rigorous handling, blood metabolites increased and CPK, glycerol,
NEFA, ammonia, and BUN continued to be higher in NA pigs compared to ambulatory
pigs (P < 0.05; Table 2.4). These data suggest that the increased number of

prods received by NA pigs resulted from a pre-existing condition(s) that impaired the
movement of these pigs through the course.

The elevation of blood metabolites is characteristic of a metabolic challenge or
physical stress (Warriss et al., 1992). The elevated blood lactate indicates an increase in
the work being done by these muscles. Lactate and hydrogen ions are the end products of
anaerobic glycolysis and increase proportionately to the energetic needs of the cell.
Elevated blood lactate is often associated with animals that are in a state of metabolic
acidosis. Elevated blood CPK levels are typically associated with muscle cell damage
and damage to the cells would be expected with increases in lactate and hydrogen ion
concentration as a result of an increase in glycolytic metabolism (Heinze and Mitchell,
1989). Increases in glycerol and NEFA (P < 0.01; Table 2.3 and 2.4) reﬂect an acute
lipolytic response, in which triglycerides are mobilized from fat to provide energy needed
to accommodate both physical and psychological stress. In addition, increases in ATP
utilization would also initiate muscle glycolysis to replenish the energy needed for the
cell to survive. Previous work has demonstrated that ammonia production is proportional
to the work that is being done by muscle (Dudley et al., 1983). The observed increase in
ammonia is most likely from the catalysis of adenosine monophosphate to inosine
monophosphate and ammonia by the enzyme adenosine monophosphate deaminase.
Increases in ammonia can be toxic to the muscle cells if allowed to accumulate

(Lowenstein, 1972). To prevent acctunulation, the ammonia is processed through the

61

urea cycle, which would increase BUN values. The urea is then sequestered from the
blood by the kidneys and is excreted from the body. It is also possible that some
ammonia is generated from the mobilization of amino acids from proteins. However,
under the short-term stress described in this study, it is unlikely that ammonia generated
from protein catabolism contributes signiﬁcantly to the BUN values.

We speculate that HAL-1843-normal pigs that respond abnormally to halothane
exhibit differences in calcium release from the sarcoplasmic reticulum, similar to that
previously demonstrated in halothane sensitive Pietrains (Mickelson et al., 1988). It is
reasonable to expect that halothane sensitive pigs have become conditioned to stressors
and may have a higher tolerance level for stress. This may explain the decrease observed
in the number of HS-H animals exhibiting open-mouth breathing. However, we did
observe a higher incidence of NA pigs in the HS-H category and HS-H pigs that became
NA received more prods than their ambulatory counterparts. This suggests that there is
variability in the threshold level of stress required to induce a metabolic insult that results
in the NA phenotype.

Following the handling model, pigs from each halothane sensitivity category were
transported to two harvesting facilities. The meat quality data from these pigs have been
reported elsewhere (Allison et al., 2004). Brieﬂy, no differences were observed in the
initial pH, but HS-I and HS-H pigs had a lower ultimate pH than HS-L (5.93 vs 5.77, HS-
L vs. HS-H, respectively at Plant B and 5.94 vs 5.77 and 5.80, HS-L vs HS-I and HS-H,
respectively at Plant C). The lower ultimate pH was associated with approximately 58%
more purge loss from HS-H and HS-I loins compared to HS-L loins. These observations

support the notion that halothane sensitive pigs were able to recover from rigorous

62

handling more quickly and thus had more muscle glycogen available for conversion to
lactate and hydrogen ions during postmortem anaerobic glycolysis.

Collectively, these data suggest that HAL-1843-normal HS pigs are more prone to
becoming NA when subjected to rigorous handling. Some pigs appear to exhibit chronic
elevation of key blood metabolites, and these pigs are more susceptible to becoming NA.
Further work is needed to understand the biological link between halothane sensitivity
and stress susceptibility or meat quality. It is of utmost importance to the swine industry
to better understand the cascade of events that result in an animal becoming NA in order
to develop intervention or prevention strategies.

IMPLICATIONS

Although non-ambulatory pigs occur at a low frequency, the economic impact to
the swine industry is staggering. Research to understand the mechanisms responsible for
pigs becoming non-ambulatory under commercial conditions is of great importance.
These data suggest that HAL-1843-normal pigs, which exhibit halothane sensitivity, are
more prone to becoming non-ambulatory when subjected to rigorous handling.
Furthermore, blood metabolites measured in pigs that became non-ambulatory were
elevated prior to the model. This suggests that these pigs have pre-existing
hypermetabolic condition(s) that make them more prone to becoming non-ambulatory.
Understanding the biological cause(s) of the hypermetabolic condition that renders pigs
non-ambulatory is essential for the development of effective strategies to reduce the

incidence of non-ambulatory pigs.

63

CHAPTER 3
NOVEL POLYMORPHISMS IN THE SKELETAL MUSCLE RYANODINE RECEPTOR
GENE ARE ASSOCIATED WITH HALOTHANE SENSITIVITY, RYANODINE
BINDING, AND MEAT QUALITY IN HAL-1843-NORMAL PIGS
ABSTRACT
The objective of this study was to determine if differences exist in the coding
region of the ryanodine receptor gene (R YRI) between HAL-l 843-normal pigs that
responded abnormally to halothane compared to those that exhibited a normal response.
Total RNA was isolated from pigs exhibiting either a normal response (11 = 3) or a severe
abnormal response (n = 3) to halothane. Twenty-two single nucleotide polymorphisms
(SNP) were detected in 15,108 bases of cDNA sequence, but none were predicted to alter
the amino acid sequence of the RYRl protein. However, the SNPs can be categorized
into four haplotypes (H1, H2, H3 and H4) that are associated with halothane sensitivity
(HS), ryanodine binding, non-ambulatory pigs and meat quality. Total RNA (n = 28) and
genomic DNA (n = 41) were extracted from skeletal muscle of pigs for which HS,
mobility status and meat quality data were known. Regions corresponding to RYRl
cDNA nucleotides 3,942, 4,332, 4,365, and 7,809 were ampliﬁed and direct sequenced.
Although not signiﬁcant, pigs with genotype A (Hl/Hl) exhibited lower HS, lower
afﬁnity for ryanodine (higher kd), and less ﬂuid-loss from loin chops than pigs with
genotype B (HZ/H2). Six pigs containing at least one copy of H2 became non-
ambulatory during rigorous handling, whereas no non-ambulatory pigs were observed
among the H1 homozygotes. Collectively, these data suggest that SNPs in RYRl are
associated with HS, ryanodine binding, mobility status, and meat quality of HAL-1843-

normal pigs.

64

INTRODUCTION

Stress susceptibility and inferior carcass quality have plagued the swine industry
for many years. For almost two decades the results of the halothane test were used to
reduce the incidence of porcine stress syndrome (PSS). However, complete removal of
PSS was hampered by some pigs not reacting to halothane gas yet were in fact
homozygous positive for the HAL-1843 polymorphism. Additionally, removal was
slowed by the inability to discern between pigs exhibiting a mild response and no
abnormal response to halothane.

Harrison (1971) demonstrated that Procaine, a calcium release blocker, could
prevent an abnormal response to halothane in a pig that had previously been classiﬁed as
halothane sensitive. This discovery helped lead to the isolation, puriﬁcation, and
characterization of a transmembrane spanning protein (Kawarnoto et al., 1986) that was
later demonstrated to form a calcium ion channel (Imagawa et al., 1987; Inui et al., 1987;
Lai et al., 1988). This protein has been termed the ryanodine receptor due to its high
afﬁnity for the plant alkaloid ryanodine. Using [3H]-ryanodine, Mickelson et al. (1988)
demonstrated that the calcium dependent gating mechanism of the receptor is abnormal,
leading to a greater probability of open channels in halothane sensitive pigs.

In 1991, F ujii et al. reported the discovery of eighteen single nucleotide
polymorphisms (SNP) in the skeletal muscle calcium release channel gene (RYRl).
Only one of these (C1843T) was predicted to alter the amino acid sequence, resulting in
an arginine being replaced by a cysteine at residue 615. Due to the association of this
SNP with PSS and inferior pork quality, most genetics programs eliminated the

undesirable allele from their herds.

65

Despite the removal of the HAL-1843 polymorphism, an increase in the number
of non-ambulatory pigs arriving at commercial slaughter facilities has been reported
(Ellis et al., 2003; Ritter et al., 2004). Furthermore, a recent survey of the pork industry
revealed that inferior product quality has increased from 10.5 to 15.5% in the last decade
(Stetzer and McKeith, 2003). Thus, it seems reasonable to hypothesize that other
mutations may exist in RYRl that lead to altered calcium regulation. To date, twenty-
three other mutations in the human RYRl have been identiﬁed that are linked to
halothane sensitivity (Girard et al., 2001). Therefore, we hypothesize that novel
polymorphisms in the RYRl are associated with abnormal halothane sensitivity (HS),
loss of mobility, and inferior meat quality of HAL-l 843-normal pigs.

MATERIALS AND METHODS

Animals and halothane testing

Pigs used in this study were selected from those halothane gas tested as
described by Allison et al. (2004). Brieﬂy, four commercially available, HAL-1843-
normal sire lines were used to inseminate a single dam line. Progeny were subjected to
3% halothane for 3 min at approximately nine weeks of age. The response to halothane
was scored by visually evaluating limb rigidity on a scale of one to four and skin
discoloration and muscle tremors on a scale of one to three. In each case, the higher
number reﬂects a more severe response. The average limb rigidity was added to the
discoloration and tremor score to calculate the halothane score for each pig. This score
was then used to categorize pigs into three groups: halothane sensitive — low (HS-L; <
4.01), HS-intermediate (HS-I; 4.01 — 5.49), and HS-high (HS-H; >5.49). Greater than

25% of the pigs in two sire lines evaluated by Allison et al. (2004) demonstrated a severe

66

abnormal response to halothane (HS-H), whereas the remaining lines exhibited less than
2% of the pigs in this category. From the two lines that responded most adversely to
halothane, thirty-three HS-L, ten HS-I and thirty-seven HS-H pigs were selected and
subjected to a rigorous handling model (Marr et al., 2004). Following the handling
model, twenty-eight pigs were transported to a commercial abattoir for muscle sampling
and meat quality evaluation (Allison et al., 2004; plant B). Tissue samples (~6.3 cm
thick chop) from 10 pigs in each halothane-sensitivity category were removed from the
longissimus dorsi (LD) within 20 min postmortem, diced into 0.5 cm3 cubes, frozen in
liquid nitrogen, and stored at -80°C. The remaining pigs (n = 52) were transported to a
separate commercial abattoir, where a skeletal muscle tissue sample was collected and
frozen for DNA extraction (Allison et al., 2004; plant A).
Preparation of Heavy Sgcowmic Reticulum

Heavy sarcoplasmic reticulum (SR) vesicles were prepared as previously
described (Mickelson et al., 1986; Mickelson et al., 1988). Brieﬂy, frozen LD samples
(75 g) were homogenized in 5 vol (w/v) of ice-cold homogenization buffer (0.1 M NaCl,
5 mM maleic acid, pH 7.0), a mixture of protease inhibitors (0.2 mM
phenylmethylsulfonyl ﬂuoride, lug/ml each of pepstatin, leupeptin, aprotinin, and
benzamidine) and 30 mM beta-mercaptoethanol. Homogenization was performed in the
cold using a Waring Blender for 8 x 15 sec burst. Following centrifugation of the
homogenate for 30 min at 3,300 x g, the pellet was discarded and the supernatant ﬂuid
was ﬁltered through sixteen layers of cheesecloth. The ﬁltered supernatant ﬂuid was
centrifuged for 30 min at 16,300 x g. Following centrifugation, the supernatant was

decanted and the pellet was resuspended in 10 ml of 0.6 M KCl, 5 mM maleic acid

67

(pH6.8), protease inhibitors, and 30 mM beta-mercaptoethanol. This suspension was
then centrifuged at 130,000 x g for 40 min in a Beckman Ti-70 rotor. The resulting
supernatant ﬂuid was decanted and the pellet was resuspended in 10 ml of 10% sucrose
buffer (10% sucrose (w/v), 0.4 M KCl, 5 mM maleic acid, pH 7.0, and protease
inhibitors). The sample was centrifuged at 130,000 x g for 40 min in a Beckman Ti-70.
Supernatant ﬂuid was decanted and the pellet (crude SR) was resuspended in 10 ml of the
10% sucrose buffer, frozen in liquid nitrogen, and stored at -80°C.

Prior to separating the heavy and light SR using discontinuous sucrose gradients,
samples were removed from the -80°C and allowed to thaw at 4°C. The sample volume
was adjusted to 20 ml with 10% sucrose buffer and centrifuged at 130,000 x g for 40 min
in a Beckman Ti-70 rotor. Following centrifugation, the supernatant was decanted and
the pellet was resuspended in 10 ml of the 10% sucrose buffer. The resuspended pellet
(2.5 ml) was applied to a sucrose gradient composed of 12 ml of 22% sucrose (w/v; top
layer), 13 ml of 36% sucrose and 5 ml of 45 % sucrose (bottom layer) containing 0.4 M
KCl, 5 mM maleic acid (pH 7.0), and protease inhibitors. The tubes were centrifuged at
100,000 x g in a Dupont-Sorvall AH-629 rotor for 5 h at 4°C. The material banding at
the interface of 36 and 45% sucrose was removed by aspiration with a 10 ml serological
pipet, placed in a clean tube and adjusted to a 10 ml volume with 10% sucrose buffer.
This fraction is considered to contain proteins associated with the heavy SR (Mickelson
et al., 1986). Samples were centrifuged at 130,000 x g for 40 min and the resulting
pellets were resuspended in 1 ml of 10% sucrose buffer. Approximately 20 ul of each
sample was removed for protein determination and 25 mM dithiothreitol (ﬁnal) was

added to the remaining sample. Samples were frozen in liquid nitrogen and stored at -

68

80°C until analyses. Protein content of the heavy SR was determined using the method
of Lowry (1951) with BSA as a standard.
Ryanodine BindingAssav

Ryanodine binding assays were performed as previously described for pig skeletal
muscle (Mickelson, 1988). Brieﬂy, 0.2 mg of heavy SR protein/m1 was incubated for 90
min at 37°C in a buffer containing 100 mM KCl, 10 mM PIPES buffer (pH 7.0), 0.5 mM
PMSF, and a CaClz-EGTA-nitrilotriacetic acid buffer set to give a free calcium
concentration of 6 uM. Nine concentrations of ryanodine (Perkin Elmer Life Sciences,
Boston, MA; 0 — 600 nM) were used to evaluate ryanodine-binding kinetics. Each
ryanodine concentration included 10 nM [3 H] ryanodine and the balance was unlabeled
ryanodine (Calbiochem, San Diego, CA). Non-speciﬁc binding of ryanodine was
determined by adding 20 pM unlabeled ryanodine to the incubation buffer. Following
incubation, samples were ﬁltered onto Whatman GF/B ﬁlters. Tubes containing the
sample were rinsed twice with 5 ml of ice-cold 0.1 M KCl and 10 mM PIPES (pH 7.0)
and ﬁltered onto the Whatman GF/B ﬁlter. Filters were rinsed with an additional 20 ml
of ice-cold 0.1 M KCl and 10 mM PIPES (pH 7.0) to remove any unbound [3 H]
ryanodine. Filters were placed in scintillation cocktail overnight and the amount of [3 H]
ryanodine on each ﬁlter was determined by liquid scintillation counting. Speciﬁc
ryanodine binding was calculated by subtracting total binding - non-speciﬁc binding.
The Kd and Bmax values for these data were calculated by constructing Scatchard plots.
Lsolartion of RNA

Total RNA was isolated from six pigs categorized as HS-H with a low K, (n = 3;

K; < 105.3) and HS-L with a high K, (n = 3; K, > 196.1) using TRI-Reagent (Molecular

69

Research Center, Inc., Cincinnati, OH). Frozen LD muscle (200 mg) was homogenized
in 2 ml of TRI-Reagent using a Tissue Tearor (setting 4; Bartlesville, OK). The
homogenate was centrifuged at 12,000 x g for 10 min. Following centrifugation, the
supernatant was harvested and 0.2 ml of l-bromo-3-chloropropane was added to the
supernatant. This mixture was allowed to stand at room temperature for 15 min and then
centrifuged at 12,000 x g. The aqueous phase was transferred to a fresh tube and total
RNA was precipitated by the addition 0.5 ml of isopropanol and 0.5 ml of a high salt
precipitation solution (0.8 M sodium citrate and 1.2 M NaCl). The RNA was allowed to
precipitate at room temperature for 10 min and was then centrifuged at 12,000 x g for 8
min. Following centrifugation, the supernatant was decanted and the pellet was washed
with 75% ethanol and ﬁnally centrifuged at 12,000 x g. The resulting pellet was
resuspended in nuclease free water to a concentration of approximately lug/pl. The
quantity and quality of the extracted total RNA were estimated spectrophotometrically
and by electrophoresis on 1% native agarose gels, respectively.
Reverse Traﬂcription and Polymerase Chain Reaction

Reverse transcription (RT) and ampliﬁcation of complementary DNA (cDNA)
were performed using the Access RT-PCR kit from Promega (Madison, WI). This kit
allows for RT and polymerase chain reaction (PCR) to be performed in a single-tube.
Sequence speciﬁc forward and reverse primers (18-22 bases in length; Table 3.1) were
designed to amplify PCR products approximately 600 bp in length using the known pig
ryanodine receptor gene sequence (Fujii et al., 1991) and Oligo 5.1 software
(NBI/Genovus, INC., Plymouth, MN). For each primer set, ~5 ug of total RNA was used

as the template and RT and PCR were carried out in the presence of 1 x AMV/T ﬂ

70

reaction buffer (Promega), 0.2 mM dNTPs, 1 uM forward and reverse primers, 2 mM
magnesium sulfate, and 5 U of AMV reverse transcriptase and Tﬂ DNA polymerase in a
50 pl volume. Samples were then placed in an MJ Research FTC-200 thermocycler
(Waltham, MA). For RT, samples were incubated at 48°C for 45 min. Following RT,
the temperature was increased to 94°C for 2 min to inactivate the AMV enzyme and
denature the cDNA sequence. The samples were then subjected to 35 cycles of 94° C for
10 seconds, 59 - 65° C for 20 sec (depending upon optimal annealing temperature of
primer pairs; Table 3.1), and 72° C for 20 see. A ﬁnal extension of 3 min at 72° C was
included to allow the polymerase to ﬁnish extending any truncated products. To amplify

G/C rich regions corresponding to exons 89 —91 , 5% dimethyl sulfoxide and l M Betaine

were added to the reaction mixture.

Following ampliﬁcation, lul of the PCR product was visualized on a 1% agarose
gel to verify that the product of predicted size was ampliﬁed. The remaining PCR
product was puriﬁed using a Qiagen PCR puriﬁcation kit (Qiagen, Inc., Valencia CA)
according to manufacturer’s speciﬁcations, except that 20 pl of elution volume was used
instead of the recommended 50 [.11. Puriﬁed PCR products were visualized on a 1%
agarose gel and concentration was estimated by comparison to the k-Hind III ladder (5
pl) run in an adjacent lane.

Isolationé and PCR Ampliﬁcation of Genomic DNA

Genomic DNA was isolated from skeletal muscle using DNAzol ((Molecular

Research Center, Inc., Cincinnati, OH). Brieﬂy, 100 mg of tissue was gently

homogenized in 2 ml of DNAzol with a Tissue Tearor (setting 2; Bartlesville, OK).

71

Table 3.1. Product size, primer sequences and annealing temperatures used for PCR
ampliﬁcation and sequencing of the porcine ryanodine receptor gene
Primer sequence ( 5' - 3')

 

Prod Prod size 13 ‘ Forward Reverse Annealing
num (bp) "°“ temp (0C)
lb 653 5'UTR - 6 GGTTCCCAGAGGTCTCCGAC TGCAGGTAACGCTCAGAGGA 62
2 573 2 - 7 GGGCGAAGATGAGGTCCAGT TGCATGAAGGAGGCGTCAAC 62
3 616 7 - l 1 GTGTCTCCTCTGAGCGTTAC AGAATGGCCTTCTT CTT GAG 59
4 578 ll - 15 C'ITACCTATGCTGCCCCAGA CT GACCAGCCAATCCAAGTT 59
5 567 15 - 18 ACTGTGCCCT’ITT CT CCAAC GTCCTGTCCAGAGATGCAGC 59
6 596 18 - 22 GGCTITGACGGGCTGCATCT AGGCTGTGGAAGTCCACGAG 62
7 645 21 - 25 CCCCATCTGGAGCGTATCCG CTTCTCAGCCCGGAAGATGC 62
8 657 25 - 28 CATCTI‘CCGGGCTGAGAAGT CTCAGCCGGAGAAAGAGCAT 61
9 621 28 - 30 CCTGACCCACCGCACCTG TCCCCCATGGTCACCGTCAC 62
10 642 30 - 34 CCAGGAACCCAGCTGCGT CGCTCGGACAGCTCCAGG 61
11 633 33 - 34 CTGGGCGGTGCAGTGTCA TCCACAGAGCCCCCGACA 63
12 601 34 - 37 CTCTGCGGGACAAAGCAC ATCTGCTCCTGGGGTGGG 58
13 558 36 - 39 TGACCGCTGCCGAGACTG GGCCCATCTGCACGATGA 61
14 545 39 - 41 GGGCAGCCGCTI‘GATGA CGGCAGAAGTAGCAGAGGAA 60
15 531 40 - 44 CAGAGCATTGGGAACATGAT CAGCCGCACCACCAC 59
16 508 43 - 47 CTGCGC'ITI'GCTGTCTITGT CACCATCGACGCCTTGT 61
17 604 47 - 51 ATGTCAGCATCCTTCGTGCC ATI'I‘CTTATGGGCCAGCGAG 60
18 614 50 - 55 CACCTCGGAGGAAGAGCTGC AGCTCCCGGGACAGGGTAAC 59
19 630 55 - 62 CCTGACCTCAGCGGCGTI‘AC GTGAAGGCAGTTGACCACGG 60
20 621 62 - 66 CAGCCGTGGTCAACTGCCTI‘ CGTGTGGCATCTCCGTGTAC 61
21 623 66 - 69 GAGCGGCTCATGGCAGACAT TCGCGCTTGAAGTTGTGGGA 63
22 613 68 - 73 GGCACACTGGCTGACGGAAC CCGGCGCTGC’ITAGACAAGA 61
23 613 73 - 79 TCTGGAGCAGATGGAGCACC GGCATTGCCTCCG'ITCAGGA 6O
24 627 79 - 85 CCATGGTATCGTCCACCCT G TCATCATGTGGGCGAACACG 58
25b 615 85 - 88 CGGGAACCAGCAGAGCCTAG CCCAGGTAGGGCCGGAAGTA 60
26 303 88 - 89 AG'ITCGCCAACCGCTTCCA ACTCGCCACCCTCGTTCACC 61
27c 429 89 GGCGAGTCGGAGAAGATGGAG CAGGCCGCCACCAAAGA 65
28c 637 89 - 91 CTGCI‘ CT GGGGCT CGCTCTI‘ GGGCAAGGAATCGCAGAGTG 64
29 621 91 - 96 TCCACCCCCTCCAAAGAAGG ATGTCCCCGTGCI‘TGTCCAG 61
30 555 93 - 98 OCT GGTGGCCTTTCT CT GC TGT'ITGCCATTGTGGGTGAC 60
31 593 98 - 104 CGCTGCCCACCTCCTG CCTGACCCGTGTGTTCTGTC 58
32 314 102 - 3'UTR ATACGACACCACACGGGTC GTCACCTCTCCCCTAGCTGC 58

 

‘UTR = Untranslated region; Exon number based on accession number M91452.

bPCR product was puriﬁed from a 1% agarose gel prior to sequencing.

cIncluded 1 M Betaine and 5% DMSO in reaction mixture.

72

Following homogenization, proteinase K (400 pg/ml) was added to the homogenate and
stored overnight at room temperature. Following incubation, the homogenate was
centrifuged at 10,000 x g for 10 min and the supernatant ﬂuid was removed by pipetting.
DNA was precipitated by the addition of 1 ml of ethanol and samples were allowed to
settle for 3 min prior to centrifugation at 5,000 x g. Following centrifugation, the
supernatant ﬂuid was removed and the pellet was rinsed with 75 % ethanol. The samples
were allowed to sediment for 1 min and were centrifuged at 1,000 x g for 2 min. The
supernatant ﬂuid was removed and samples were rinsed and centrifuged again.
Following the second centrifugation, the ethanol was removed and pellets were
resuspended 1 x Tris -— EDTA buffer (.1 M Tris and 50 mM EDTA, pH 8.0) and
incubated at 60°C for 2 h.

The standard PCR reaction mixture, in a ﬁnal volume of 10 pl, consisted of 10 —
50 ng of template DNA, 1 pM forward and reverse primers, 0.1 mM dNTPs, 1x Buffer
(50 mM KCl, 10 mM Tris-HCl, pH 9.0 and 1% Triton x-100), 1.75 mM magnesium
chloride, and 0.05 U of Taq polymerase (Promega). The ampliﬁcation conditions
consisted of an initial denaturation of 94°C for 3 min, followed by 32 cycles at 94°C for
30 s, 67 - 69°C for 30 3 (depending upon optimal annealing temperature of primer pairs;
Table 3.2), and 72°C for 45 s. A ﬁnal extension of 10 min at 72°C was included to allow
the polymerase to ﬁnish extending any truncated products. The sequence of the
ampliﬁed genomic products is shown in Figures 3.1-3.3. In each case, the forward and

reverse primers are underlined, intron/exon boundaries are indicated, and the nucleotide

of interest is indicated in bold.

73

Figure 3.1. Sequence of PCR product ampliﬁed to determine nucleotide sequence at
position 3,942 (shown in bold). Forward and reverse primers (underlined) were designed
50 bases upstream of nucleotide 3,769 (5’ - v) and complementary to RYRl cDNA
nucleotides 4,106 — 4,125 (3’ - v), respectively. Sequence between symbols (7)
corresponds to exon 28.

V
5'-ccaatagccc agcccccttc ccgcctcagt gcctcctacc tgccccacag gtgtctcgtg

 

tggacggcac cgtggacacg cccccctgcc tgcgcctgac ccaccgcacc tggggctccc

ctctttctcc

agaacagtct
acttccgctg
aggatgaggc
ggcgctgggg

gcactgccca

ggtggagatg
caccgcaggg

ccgggcagca

cgaggctgag

ggctggggta

gccacccccc
gaacctgatc

ggcggcaaag

gaggcccagc

ggctgagcct
tggcaccacc
ccgactatga
aaggaactgc

ctcccagggc

ccctgtccag
tggcctgcag
aaacctgcgc

0339939999

V
agaaaat-B’

 

ttccaccagc
ccccctgctg
cgctcagctg

gcacccgggg

Figure 3.2. Sequence of PCR product ampliﬁed to determine nucleotide sequence at
positions 4,332 and 4,365 (shown in bold). Forward and reverse primers (underlined)
were designed 104 bases upstream of nucleotide 4,297 (5’ - v) and complementary to the
intron sequence 188 bases downstream of nucleotide 4,457 (3’ - v), respectively.
Sequence between symbols (v) corresponds to exon 30.

5’-aaaccctcag

ctggtcttcc
gggtcttcgc
accagcacga
atgagcaggg
tctcctctct
ctgttttttg

gttcccctgg

aggatgctgg

cgcctgaccg

tggccaggag

catgaacttc
caacatccac
tcctgcgtat
tttttttgtt

gccggcatca

gactccagag
ctggcgcccc
cccagctgcg
gacctcacca
V
agcaggtacg
cttccttcca
tttgtttttg

aacctgcttc

aaatcaatgc
ctttgtctcc
tgtgggtggg
aggtccgggc

gggaggggtg

tggctccttc
tttttgtttt

gcaacggtga

agagtcccag
V
gcagtactat
ctgggtcacc
ggtgacggtg
ggcgctggca
tctgtgtctt

tgtacctgcg

cccaggaagc
tactcggtga
cctgactacc
accatggggg
cctcctccct
gcctcctcct

acctgtgcaa

caatgccaggﬁtt-B’

 

74

Figure 3.3. Sequence of PCR product ampliﬁed to determine nucleotide sequence at
position 7,809 (shown in bold). Forward primer and reverse primers (underlined) were
designed corresponding to cDNA nucleotides 7,618 — 7,636 and 7,818 - 7,836,
respectively.

5'-gccactttca gcaccacgga aatggcactg gcgctgaacc gctacctatg cctggccgtg

 

ctgccactca tcaccaagtg tgcgccactc ttcgcgggaa ccgagcatcg tgccatcatg
gtggactcca tgcttcacac ggtgtaccgc ctgtcccgtg gccgctcgct caccaaggcg

cagcgcgacg ttatcgagga atgcctgatg gcgctctgc—3’

 

Table 3.2. Product size, primer sequences and annealing temperatures for PCR
ampliﬁcation and sequencing gDNA nucleotides of the ryanodine receptor gene.

Primer Sequence ( 5' - 3')
Prod .Prod Forward Reverse Anneal
Num Srze (bp) temp (0C)
01 407 CCAATAGCCCAGCCCCCTTC ATI'TTCTGCCCTGGGAGGCT 69
GZ 472 AAACCCTCAGAGGATGCTGG AACCTGGCATTGTCACCGTT 67
G3 219 GCCAC'ITTCAGCACCACGG GCAGAGCGCCATCAGGCAT 69

 

75

Four aliquots of template DNA from each pig were ampliﬁed. Following
ampliﬁcation, tubes were combined and 1 pl of the PCR product was visualized on a 1%
agarose gel to verify that the product of predicted size was ampliﬁed. The remaining
puriﬁed PCR products were visualized on a 1% agarose gel and concentration was
determined by comparison to the k-Hind III ladder.

PCR Product Sequencing

Approximately 50 ng of DNA or 100 ng of cDNA ﬁom each puriﬁed PCR
product was sent to the Genomics Technical Support Facility on the campus of Michigan
State University. Cycle sequencing of each PCR product was performed using Applied
Biosystems (Foster City, CA) big dye terminator version 3.1 and the forward primer used
to amplify the PCR product. Sequences were collected using the Applied Biosystems
ABI PRISM 3100 Genetic Analyzer. Reverse primers were used to conﬁrm SNPs that
were observed in the forward direction.

Statisticgal Analysis

Least squares means of halothane sensitivity (HS), ryanodine binding, mobility
status and meat quality traits by genotype were analyzed by ordinary least squares
procedures utilizing the general linear model soﬁware of SAS (Cary, NC) with a
protected least signiﬁcant difference test (Freud and Wilson, 1997). The statistical model
included the ﬁxed effect of gender and genotype. No signiﬁcant differences were
observed between genotypes.

RESULTS AND DISCUSSION
To determine if novel polymorphisms existed in RYRl of HAL-1 843-normal

pigs, the two hot spot regions of the cDNA, where polymorphisms are known to cluster

76

.59 .._m .o as“. 3 8:82 E5 5 $292.28.

 

o < < o 0 h ... < O < < 0 O 0 ._. 0 O 0 < 0 0 ._. v
o < < o ._. U 0 < 0 < < 0 0 0 0 < O O < 0 0 ._. m
h 0 0 ._. ._. 0 O U 0 h 0 0 ._. ._. o < ._. ._. 0 0 < 0 N
o < < o o ._. ... < < < < ._. 0 0 .r 0 0 O < 0 O ._. w

 

man: #83 .3.me .KFNF Luv: 3o: Know Luca .83 .88 ._.wa «mow» hook .280 home .Nmmv .Nvmm mmmm :3 0:; comp 2:. an:
22.8.82
.82 62820:: «a wﬁtﬁm 33%/Em 56863. “SE ._a 8 FEB 32%
2me8> 8m cop—£33 3:253. 05 no 3me ﬂ war—38:: 628282 .23 5 8:835 0.8 _ 252%: 9 2628 mEmE&o§_a
02820:: 23% .oaow ABS 5 8332 058.8%.— oEoHoa 05 E 95352 mEmE&o§_oa 02820:: Bwnmm 82mm .m.m £an

 

 

 

77

in human RYR] (nucleotides 105 — 1,845 and 6,489 — 7,374), were sequenced. An
additional residue at the 3’ end of the transcript (nucleotide 14,694) was also evaluated.
Single nucleotide polymorphisms were identiﬁed at nucleotides 747, 1,200, 1,418, 1,971 ,
6,960, 14,034, and 14,889 between the initial six pigs evaluated (Table 3.3). None of
these SNPs were predicted to alter the amino acid sequence of RYR] (silent SNPs).
However, these SNPS can be categorized into two haplotypes (H1 and H2). Based on
preliminary observations, genotype A (HI/HI) appeared to be associated with lower HS,
lower afﬁnity for ryanodine (higher Kd), and more favorable water-holding capacity
compared to genotype B (HZ/H2; Table 3.4). One non-ambulatory pig was observed in
genotype A. However, upon further screening of his RYR] cDNA sequence, he was
found to be heterozygous at two locations, thus removing him from genotype A.

None of the SNPs identiﬁed in the hot spot regions were predicted to alter the
amino acid sequence, yet the SNPs appeared to be associated with phenotypic traits of
interest. This led to the hypothesis that these SNPS were markers for allelic variants that
could possibly cause amino acid substitutions that would alter functionality of RYRl in
the remaining coding sequence. Therefore, primers were designed to sequence the entire
coding region (15,160 bases) to determine if SNPs existed that could alter the amino acid
sequence of RYRl.

A total of 22 SNPs were observed among the six animals that were initially
screened. Similar to the preliminary observations, none of the SNPS identiﬁed were
predicted to alter the amino acid sequence of RYR]. However, the SNPs could be
categorized into four haplotypes (H1 — H4; Table 3.3). Relative to H1, H2 was different

at all twenty-two nucleotides, H3 was different at seven nucleotides and H4 was different

78

Table 3.4. Halothane sensitivity (HS), the occurrence of non-ambulatory pigs (NA),
ryanodine binding (Kd), and meat quality traits among RYR] genotypes

 

 

Genotype“
A B C

(1/1) (2/2) (1/2)
n 3 2 1
HS 4.3 7.0 3.5
NA 1 1
Kd 158.40 100.25 208.33
Drip loss, % 1.2 3.3 1.0
L* 38.38 37.53 36.6
Initial pH 6.45 6.42 6.63

Ultimate pH 5.85 5.86 5.91

*The number in parentheses refers to the
haplotype presented in Table 3.2.

 

79

at two nucleotides (Table 3.3).

Thirteen of the SNPs identiﬁed in the current study have been previously reported
(F ujii et al., 1991; Table 3.3). The nucleotides indicated in H1 at these 13 nucleotides are
identical to those reported in the Pietrain sequence by Fujii et al. (1991). The remaining
nine are identical to the Yorkshire and Pietrain sequences. In the present study, the 13
nucleotides reported by Fujii et al. (1991) to be associated with the Pietrain sequence
were observed in pigs with a lower HS, a lower afﬁnity for ryanodine, and lower ﬂuid-
loss (H1; Table 3.4). Pigs containing the alternate allele at these locations (H2) exhibited
inferior phenotypes in the traits evaluated. The reason(s) for this is unclear. One
possible explanation is that the HAL-1843 polymorphism accounted for the major
detrimental effect on RYRl and masked the positive effects associated with other SNPs
that occurred in the Pietrain cDNA sequence. In the absence of the HAL-1843
polymorphism, SNPs observed in H2 may contribute disproportionately to the perceived
increase in non-ambulatory pigs and inferior meat quality.

Based on the haplotype analysis, we chose to sequence cDNA regions containing
SNPS at nucleotides 3,942, 4,332, 4,365, and 7,809 of RYRlin the remaining pigs
harvested at plant B (n = 28). These regions collectively deﬁned the observed haplotypes
indicated in Table 3.3. Due to the limited number of animals available for genotyping, no
statistical differences were observed between genotypes. Halothane sensitivity,
ryanodine binding, mobility status, and meat quality traits within the observed genotypes
are reported in Table 3.5. Pigs with genotype A had a lower HS, no non-ambulatory pigs,

a lower afﬁnity for ryanodine, and a higher initial pH, compared to pigs of genotyped B.

80

Table 3.5. Halothane sensitivity (HS), ryanodine binding (dissociation constant, Kd),
non-ambulatory pigs (NA), and meat quality traits among RYR] genotypes

 

 

GENOTYPE*
A B C D E F G

TRAIT L1/ 1) (2/2) ( 1/2) (1/3) (1/4) (3/2) (4L1) SD
n 3 8 6 1 3 3 4
HS 3.9 5.5 4.8 3 4.7 5.8 4.4 1.6
NA 0 3 0 0 1 l 2 -
Kd 168.50 108.90 147.06 217.39 100.06 173.08 189.90 58.53
Drip Loss, % 2.13 2.29 1.93 1.00 0.78 2.79 0.15 1.83
CIE L* 40.26 38.46 39.32 37.94 38.63 41.29 38.59 2.74
Initial pH 6.63 6.34 6.44 6.43 6.41 6.55 6.67 0.22

Ultimate pH 5.84 5.86 5.84 5.94 5.87 5.65 5.92 0.22

*The number in parentheses refers to the haplotype presented in Table 2. For association studies,
nucleotides 3942, 4332, 4365, 9456 and 9471 were used to generate genotype information. These
regions deﬁne the haplotypes presented in Table 3.2.

81

Three non-ambulatory pigs were also observed in genotype B. The heterozygote (HI/H2;
C) pigs were intermediate between A and B for HS and initial pH. Pigs with
heterozygous genotypes were also observed between haplotypes 1/3 (D), 1/4 (E), 3/2 (F),
and 4/2 (G). The HS of genotypes E and G were similar to genotype C, whereas
genotype F was more similar to B. Genotype F and G ryanodine binding characteristics
were more similar to genotype A, while genotype E was more like to B. Likewise, the
initial pH values of genotypes F and G were similar to A, while genotype E was
comparable to genotype C. The remaining non-ambulatory pigs were also observed in
these three genotypes.

To increase the number of animals for association studies, DNA was isolated
from skeletal muscle of the remaining pigs subjected to rigorous handling that were
harvested at plant A (n = 41). Genomic DNA was used for these analyses because the
tissue samples that were available were collected at d 7 postmortem. The HS and
mobility status for each genotype is reported in Table 3.6. Even though the number of
observations was increased, no statistical differences were observed among genotypes.
However, the HS and mobility status of pigs in genotypes A and B was consistent with
preliminary observations reported in Table 3.5. Genotype A exhibited the lowest HS and
no non-ambulatory pigs were observed, while genotype B exhibited a higher HS and a
greater number of non-ambulatory pigs. Genotype F exhibited the highest HS and similar
number of non-ambulatory pigs as genotype B. Genotypes C, D, and H exhibited similar
HS to one another, with the remaining non-ambulatory pigs being observed in genotype
D. These are the only comparable data that was collected between these pigs and those

harvested at plant B.

82

Table 3.6. Halothane sensitivity (HS) and non-ambulatory pigs (NA) among RYR]
genotypes

 

 

 

GENOTYPE"
A B C D F H
TRAIT (1/1) (2/2) (1/2) (1/3) (3/2) (3/3) SD
n 4 12 16 15 14 8 ---
HS 3.8 5.1 4.8 4.9 5.3 4.4 1.2
NA 0 3 0 2 3 0 --
*The number in parentheses refers to the haplotype presented in Table 3.2.

83

To our knowledge, no reports have documented associations between silent SNPS
in RYR] and HS, mobility status or meat quality. One possible explanation for the
associations observed in this study may be that one allele is more efﬁciently translated or
the occurrence of one allele may stabilize the mRNA transcript relative to the alternative
allele. Changes in translational efﬁciencies are possible if the secondary structure of the
mRNA is more tightly folded, thereby slowing the ability of the RNA polymerase to
translate the mRN A into a peptide. However, based on the ryanodine binding
characteristics there are no differences observed in receptor number (Bmax). More
research is needed to understand the mechanism by which SNPS that do not alter the
amino acid sequence can inﬂuence phenotypic traits.

Allelic variation was observed in the gDNA at nucleotides 3,942 and 7,809
similar to that observed in the cDNA sequence. However, all gDNA that was evaluated
exhibited a guanine and a thymine at nucleotides 4,332 and 4,365, respectively. This was
unexpected, as we had observed differences at these nucleotides in the cDNA sequence.
To determine if this was a novel occurrence, gDNA was extracted from skeletal muscle
of pigs genotyped as A (n = 3), B (n = 3) and C (n = 2) according to their cDNA
sequence. A representative chromatogram from a pig genotyped as B based on cDNA
sequence compared to his corresponding gDNA sequence can be observed in Figure3.4.
Nucleotides 4,332 and 4,365 are adenosine and cytosine, respectively in the cDNA
sequence, whereas in the gDNA sequence these nucleotides are guanine and thymine.
The observed differences at these two nucleotides in the cDNA are consistent with F ujii
et al. (1991); however, these authors do not report gDNA sequence of the pigs used in

their study.

84

Figure 3.4. Representative chromatogram depicting disagreements between cDNA (top)
and gDNA (bottom) sequences. Panels A and C are representative of nucleotide 4,332
and panels B and D are nucleotide 4,365.

 

85

Because these two nucleotide changes do not occur in the gDNA sequence, they
cannot be used as predictors of phenotypic variation. Given this ﬁnding, the genotypes
reported in Table 3.5 reﬂect both genotypic and apparent post-transcriptional
(phenotypic) nucleotide changes. The appropriate genotype-phenotype association
results can be observed in Table 3.7. With the new classiﬁcation, genotypes E and G
become pooled with genotypes D and F, respectively. This re-classiﬁcation does not
affect the associations seen in genotypes A and B, however it does dilute out the
differences that were observed in genotypes D and F .

It is unclear why the disagreements between the gDNA and cDNA sequence are
observed. One plausible explanation for this occurrence is some form of post-
transcriptional modiﬁcation of the mRN A has occurred, although very little has been
published about this phenomenon in mammalian tissue. One modiﬁcation that is of
interest is RNA editing by adenosine deaminase acting on RNA (ADARl) that leads to
site-speciﬁc conversion of adenosine to inosine (A-to-I) in pre-mRN A. Levanon et al.
(2004) identiﬁed 12,723 potential A-to-I editing sites in 1,637 different genes by a
computational search of available expressed sequences. Experimentally, Wang et al.
(2004) demonstrated an essential requirement for ADARI to promote survival of
numerous tissues by editing RNAs required for protection against stress-induced
apoptosis. The percent apoptotic cells increased from ~3% to 27% in ADARl null
mouse embryonic ﬁbroblasts compared to wild type, suggesting that expression levels of
antiapoptotic genes are down-regulated in ADARl null embryos. Because the pigs used
in the current study were subjected to rigorous handling prior to slaughter, it is possible

that the mRN A could have been modiﬁed as a result of RNA editing. Since the highest

86

Table 3.7. Halothane sensitivity (HS), non-ambulatory pigs (NA), ryanodine binding
(Kd), and meat quality traits among RYR] genotypes

 

 

GENOTYPE*
A B C D F

TRAIT (1/1) (2/2) (1/2) (1/3) (3/2) SD
n 3 8 6 4 7
HS 3.9 5.5 4.8 4.25 5 1.43
NA 0 3 0 1 2 -
Kd 168.50 108.90 147.06 139.17 184.29 52.34
Drip Loss, % 2.13 2.29 1.93 1.16 2.05 1.42
CIE L* 40.26 38.46 39.32 38.40 39.67 2.78
Initial pH 6.63 6.34 6.44 6.41 6.62 0.20

Ultimate pH 5.84 5.86 5.84 5.89 5.82 0.23
*The number in parentheses refers to the haplotype presented in Table 3.2.

87

occurrence of non-ambulatory pigs is observed in genotype B, it is possible that this
nucleotide change may serve as a survival mechanism. Without this mechanism of
protection, these pigs may have died. Disagreements between gDNA and cDNA
sequence may be an indication of a predisposition to becoming non-ambulatory or
producing inferior quality meat products.

Collectively, these data suggest that novel polymorphisms and post-
transcriptional modiﬁcations in RYR] are associated with HS, mobility status and meat
quality in HAL-1843-normal pigs. Although the post-transcriptional modiﬁcations are
not heritable, they do appear to be associated with the phenotypes observed. Further
work is needed to understand the mechanism by which silent SNPs in the RYR]
inﬂuence HS, mobility status and meat quality. Additionally, understanding the
downstream effects of post-transcriptional modiﬁcations and identiﬁcation of what
predisposes some pigs to this phenomenon is of interest.

IMPLICATIONS

Although the HAL-1843 polymorphism has been eliminated from most genetic
populations, lines of pigs continue to exhibit characteristics similar to those affected by
porcine stress syndrome. These data suggest that novel polymorphisms in the skeletal
muscle calcium release channel gene may be associated with halothane sensitivity,
mobility status and meat quality. However, the polymorphisms identiﬁed do not alter the
amino acid sequence. Thus, they may inﬂuence protein synthesis rates, stability of the
mRN A transcript or may be markers for polymorphisms that do alter the amino acid
sequence in proteins associated with the ryanodine receptor. Understanding the

biological effects of these silent polymorphisms is of interest for the development of

88

effective strategies to reduce the occurrence of non-ambulatory pigs and inferior meat

quality.

89

LITERATURE CITED

Airey, J .A., C.F. Beck K. Murakami, S.J. Tanksley, T.J. Deerinck, M.H. Ellisman, and
J .L. Sutko. 1990. Identiﬁcation and localization of two triad junctional foot

protein isoforrns in mature avian fast twitch skeletal muscle. J. Biol. Chem.
65:14187-14194.

Allison, C.P., R.C. Johnson, and ME. Doumit. 2004. The effects of halothane
sensitivity on carcass composition and meat quality in HAL-1843-normal pigs. J.
Anim. Sci. 82(Suppl. 2):58.

Barnett, J .L., and PH. Hemsworth. 1986. The impact of handling and environmental

factors on the stress response and its consequences in swine. Lab. Ani. Sci.
36:366-369.

Bechtel, P.J., and RM. Best. 1985. Integration of ATP production and consumption.
Rec. Meat Conf. Proc. 38:26-31.

Benjamin, M.B., H.W. Gonyou, D.J. Ivers, L.F. Richardson, D]. Jones, J .R. Wagner, R.
Seneriz, and DB. Anderson. 2001. Effect of animal handling method on the

incidence of stress response in market swine in a model system. J. An. Sci.
79(Suppl. 1): 279 (Abstr.).

Bergmeyer, H.U., and H0. Beutler. 1985. Ammonia. In: Methods of Enzymatic
Analysis. Third ed. Bergmeyer, H.U., editor. 8:454—461. Verlag Chemie,
Deerﬁeld Beach, FL.

Bhat, M.B., J. Zhao, S. Hayek, E.C. Freeman, H. Takeshima, and J. Ma. 1997. Deletion
of amino acids 1641-2437 from the foot region of skeletal muscle ryanodine

receptor alters the conduction properties of the Ca release channel. Biophysical J.
1320-1328.

Briskey, E.J., R.W. Bray, W.G. Hoekstra, P.H. Phillips, and RH. Grummer. 1959. The
chemical and physical characterstics of various pork ham muscle classes. J.
Anim. Sci. 18:146.

Briskey, E.J. 1964a. Inﬂuence of ante and postmortem handling practices on properties
of muscle which are related to tenderness. Proc. Campbell Soup Co. Meat

Tenderness Symp.

Briskey, E.J. 1964b. Etiological status and associated studies of pale, soﬁ, exudative
porcine musculature. Adv. Food Res. 13:89-105.

Britt, B.A., and W. Kalow. 1970. Malignant hyperthermia. A statistical review. Can.
Anaesth. Soc. J. 17:293.

90

Britt, BA. 1987. A history of malignant hyperthermia. In Malignant Hyperthermia.
Edited by Beverley Britt. Martinus Nijhoff Publishing. pp. 103-136.

Cannon, J .E., J .B. Morgan, J. Heavner, F.K. McKeith, G.C. Smith, and D.L. Meeker.
1995. Pork quality audit: A review of the factors inﬂuencing pork quality. J.
Musc. Foods. 6:369-402.

Cannon, J .E., J .B. Morgan, J. Heavner, F.K. McKeith, G.C. Smith, and D.L. Meeker.
1996. Pork quality audit survey: Quantiﬁcation of pork quality characteristics. J.
Musc. Foods. 7:29-44.

Carden, A.E., and A.J. Webb. 1984. The effect of age on halothane susceptibility in
pigs. Anim. Prod. 38:469-475.

Cassens, R.G. 2000. Historical perspectives and current aspects of pork meat quality in
the USA. Food Chemistry. 69:357-363.

Catterall, WA. 1991. Excitation-contraction coupling in vertebrate skeletal muscle: A
tale of two calcium channels. Cell. 64:871-874.

Cattle-fax. (2003). USDA Data Page. www.cattle-faxcom/dgttg. Accessed January 16,
2003.

Channon, H.A., A.M. Payne, and RD. Warner. 2002. Comparison of C02 stunning with

manual electrical stunning (50 Hz) of pigs on carcass and meat quality. Meat Sci.
60:63-68.

Chapman, J. R. Hill, J. Muir, C.W. Suckling, and DJ. Viney. 1967. Impurities in
halothane: their identities, concentrations and determination. J. Pharm.
Pharmacol. 19:231-239.

Cheah, KS, and A.M. Cheah. 1978. Calcium movements in skeletal muscle
mitochondria of malignan hyperthermic pigs. Febs Lett. 95:307-310.

Ciobanu, D., J. Bastiaansen, M. Malek, J. Helm, J. Wollard, G. Plastow, and M.
Rothschild. Evidence for new alleles in the protein kinase adenosine

monophosphate activated y3-subunit gene associated with low glycogen content in
pig skeletal muscle and improved meat quality. Genetics. 159:1151-1162.

Coronado, R., J. Morrissette, M. Sukhareva, and D.M. Vaugharn. 1994. Structure and
function of ryanodine recptors. Am. J. Physiol. 266:C1485-C1504.

Denborough, M.A., and R.R.H. Lovell. 1960. Anaesthetic deaths in a family. Lancet.
276:45.

91

Denborough, M.A., J .F . Forster, R.R.H. Lovell, P.A. Maplestone, and JD. Villiers.
1962. Anaesthetic deaths in a family. Br. J. Anaesth. 34:395-6.

Doumas, B.T. 1975. Standards for Total Serum Protein Assays: A Collaborative Study.
J. Clin. Chem. 21 :1 159.

Dudley, G.A., R.S. Staron, T.F. Murray, R.C. Hagerrnan, and A. Luginbugh. 1983.
Muscle ﬁber composition and blood ammonia levels after intense exercise in
humans. J. Appl. Physiol. 54: 582.

Ellis, M, F.K. McKeith, D.N. Hamilton, M.J. Ritter, and TM. Bertol. 2003.
Understanding the physiology and quality of the modern pig - Analysis of the
current situation: What do downers cost the industry and what can we do about it?
Proc. of the Pork Quality Symposium. 56‘" Rec. Meat Conf.

Elizondo, G., P.B. Addis, W.E. Rempel, C. Madero, F.B. Martin, D.B. Anderson, and
D.N. Marple. 1976. Stress response and muscle properties in Pietrain (P),
Minnesota no 1 (M) and PxM pigs. J. Anim. Sci. 43:1004-1014.

Endo, M., S. Yagi, T. Ishizuka, K. Horiuti, Y. Koga, and K. Amaha. 1983. Changes in
the Ca-induced Ca release mechanism in the sarcoplasmic reticulum of the muscle
from a patient with malignant hyperthermia. Biomed. Res. 4:83.

Ensembl. (2004). Ensembl Genome Browser. www.cnsemblorg. Accessed May 20,
2004.

Esders, T.W., and CT. Goodhue. 1980. US. Patent 4241178. Process and composition
for the quantiﬁcation of glycerol, ATP and triglycerides.

F iske, C.M., and Y. Subbarrow. 1925. The colorimetric determination of phosphorus. J.
Biol. Chem. 66: 375.

Forrest, J .C., R.F. Gundlach, and E.J. Briskey. 1963. A preliminary survey of the
variation in certain pork ham muscle characteristics. Proc 15th Res. Conf. Am.
Meat Inst. Found, 81.

Fraser, A.F., and D.M. Broom. 1990. Reactivity to predators and social stimuli. In: Farm
Animal Behavior and Welfare. Third ed., (Fraser, AF. and D.M. Broom. Editors).
pp 69-78.

Freud, R.J. and W.J. Wilson. 1997. Statistical Methods. Rev. Ed. Academic Press. San
Diego, CA.

Fujii, J ., K. Ostu, F. Zorzato, S.D. Leon, V.K. Khama, J .E. Weiler, P.J. O’Brien, and

DH. MacLennan. 1991. Identiﬁcation of a mutation in porcine ryanodine
receptor associated with malignant hyperthermia. Science. 253:448-451.

92

Fleischer, S., E. Ogunbunmi, M. Dixon, and E. F leer. 1985. Localization of Ca2+ release
channels with ryanodine in junctional terminal cistemae of sarcoplasmic
reticulum of fast skeletal muscle. Proc. Natl. Acad. Sci. USA 82:7256-7259.

Gerrard, DE. 1997. Pork quality: Beyond the stress gene. Proc. National Swine
Improvement Federation. Vol. 22.

Girard, T., A. Urwyler, K. Censier, C.R. Mueller, F. Zorzato, and S. Treves. 2001.
Genotype-phenotype comparison of the Swiss malignant hyperthermia
population. Human Mutation. 449:1-8.

Greaser, M.L., R.G. Cassens, E.J. Briskey, and W.G. Hoekstra. Post-mortem changes in
subcellular fractions from normal and pale, soft, exudative porcine muscle. 1.
Calcium accumulation and adenosine triphophatase activities. J. Food Sci.
34:120-124.

Gregory N.G., and D. Lister. 1981. Autonomic responsiveness in stress-sensitive and
stress-resistant pigs. J. Vet. Pharmacol. Ther. 4:67-75.

Grunwald, R., and G. Meissner. 1995. Lumenal sites and C terminus accessibility of the

skeletal muscle calcium release channel (ryanodine receptor). J. Biol. Chem.
270:11338-11347.

Hall, L.W., M. Woolf, J .W.P. Bradley, and D.W. Dolly. 1966. Unusual reaction to
suxarnethonium chloride. Br. Med. J. 2:1305.

Hamm, R. 1986. Functional properties of the myoﬁbrillar system and their
measurements. In “Muscle as a Food” (Bechtel, P., ed.). Academic press, Inc.
pp. 135-199.

Harbitz, 1., B. Chowdhary, P.D. Thomsen, W. Davies, U. Kaufman, S. Kran, I.
Gustavsson, K. Christensen, and J .G. Hauge. 1990. Assignment of the procine
calcium release channel gene, a candidate for the malignant hyperthermia locus,
to the 6p11----q21 segment of chromosome 6. Genomics. 8:243-248.

Harrison, G.G., J .F. Biebuyck, J .F. Terblanche, D.M. Dent, R. Hickman, and SJ.
Saunders. 1968. Hyperpyrexia during anaesthesia. Br. Med. J. 3:594-5.

Harrison, G.G., S.J. Saunders, J .F. Biebuyck, R. Hickman, D.M. Dent, V. Weaver, and J.
Terblanche. 1969. Anaesthetic-induced malignant hyperpyrexia and a method
for its prediction. Brit. J. Anaesth. 41:844-854.

Harrison, G.G. 1971. The effect of procaine and curare on the initiation of malignant
hyperpyrexia. in Int. Symp. Malignant Hyperthermia. R.A. Gordon, B.A Britt
and W. Kalow, Eds. Charles C. Thomas, Springﬁeld, IL. 271.

93

Harrison, G.G. 1972. Pale, soft exudative pork, porcine stress syndrome and malignant
hyperpyrexia--an identity? J. S. Afr. Vet. Assoc. 43:57-63.

Harrison, G.G. 1979. Porcine malignant hyperthermia in malignant hyperthermia. B.A.
Britt, ED. Int. Anes. Clinics. 17:25.

Harrison, G.G. 1987 . Porcine malignant hyperthermia - the saga if the “hot” pig. In
Malignant Hyperthermia. Edited by Beverley Britt. Martinus Nijhoff Publishing.
pp. 103-136.

Hakarnata, Y., J. Nakai, H. Takeshima, and K. Imoto. 1992. Primary structure and
distribution of a novel ryanodine receptor/calcium release channel from rabbit
brain. FEBS Lett. 312:229-235.

Heilmeyer, L.M., R. Meyer, R.H. Haschke, and EH. Fischer. 1970. Control of
phosphorylase activity in a muscle glycogen particle. 11. Activation by calcium.
J. Biol. Chem. 245:6649-6656.

Heinze, PH, and G. Mitchell. 1989. Stress resistant and stress susceptible landrace

pigs: comparison of blood variables aﬁer exposure to halothane or exercise on a
treadmill. Vet. Rec. 124: 163.

Honikel, K.O., and OJ. Kim. 1986. Causes of the development of PSE pork.
F leischwirtsch. 66:349-353.

Huxley, AF. 1971. The activation of striated muscle and its mechanical response. Proc.
Roy. Soc. (London). 1:27.

Imagawa, T., J .S. Smith, R. Coronado, and KP. Campbell. 1987. Puriﬁed ryanodine
receptor from skeletal muscle sarcoplasmic reticulum is the Ca2+ permeable pore
of the calcium release channel. J. Biol. Chem. 262: 16636-16643.

Infante, A.A., and RE. Davies. 1962. Adenosine triphosphate breakdown during a
single isotonic twitch of frog satorius muscle. Biochem and Biophys Res. Comm.
9:410-415.

Inui, M., A. Saito, and S. Fleischer. 1987. Isolation of the ryanodine receptor from
cardiac sarcoplasmic reticulum and identity with the feet structures. J. Biol.
Chem. 262:15637-15642.

Ivers, D.J., R.K. McGuffey, T.A. Armstong, D]. Jones, D.H. Mowrey, L.F. Richardson,
R. Seneriz, J .R. Wagner, K.L. Watlkins, and DB. Anderson. 2002a. Effect of
dietary cation-anion difference (DCAD) on stress responses in ﬁnisher swine
exposed to a stress model system. Proc. Midwest Anim. Sci. Meetings 3:9.

94

Ivers, D.J., L.F. Richardson, D.J. Jones, L.E. Watkins, K.D. Miller, J .R. Wagner, R.
Seneriz, A.G. Zimmerrnann, K.A. Bowers, and DB. Anderson. 2002b.
Physiological comparison of downer and non-downer pigs following
transportation and unloading at a packing plant. Proc. Midwest Anim. Sci.
Meetings 3:10.

Jones, E.W., T.E. Nelson, I.L. Anderson, D.D. Kerr, and T.K. Burnap. 1972. Malignant
hyperthermia of swine. Anesth. 36:42.

Kauffman, R.G., D. Waccholz, D. Henderson, and J .V. Lochner. 1978. Shrinkage of
PSE, normal and DF D hams during transit and processing. J. Anim. Sci.
46:1236-1240.

Kaufﬁnan, R.G., R.G. Cassens, A. Scherer, and D.L. Meeker. 1992. Variations in pork
quality: history, deﬁnition, extent, resolution. National Pork Producers Council
Publication. Des Moines, Iowa.

Kauffman, R.G. 1993. Opportunities for the meat industry in consumer satisfaction.
Food Techology. Nov. 132-134.

Kauffman, R.G., ST. 100, C. Schultz, R. Warner, and C. Faustman. 1994.
Measuringwater-holding capacity in post-rigor muscle. Reciprocal Meat
Conference Proceedings. 47,70-72.

Kauffman, R.G., R.L. Russell, and ML. Greaser. 1999. Using pork to teach students
quality variations and how they are measured. J. Anim. Sci. 77:2574-2577.

Kawamoto, R.M., J .P. Brunschwig, K.C. Kim, and AH. Caswell. 1986. Isolation,
characterization, and localization of the spanning protein from skeletal muscle
triads. J. Cell. Biol. 103:1405 — 1414.

 

Kerscher, L., and J. Ziegenhom. 1985. Urea. In: Methods of Enzymatic Analysis.
Third ed. Bergmeyer, H.U. editor. 8:444-453. Verlag Chemie, Deerﬁeld Beach,
FL.

Kim, D.H., F.A. Sreter, S.T. Ohnishi, J .F. Ryan, J. Roberts, P.D. Allen, L.G. Meszaros,
B. Antoniu, and N. Ikemoto. 1984. Kinetic studies of Ca2+ release from

sarcoplasmic reticulum of normal and malignant hyperthermia susceptible pig
muscle. Biochim. Biophys. Acta. 775:320—327.

Kirino, Y., M. Osakabe, and H. Shimizu. 1933. Ca2+ - induced Ca2+ release from

fragmented sarcoplasmic reticulum: Ca2+ -dependent passive Ca2+ efﬂux. J.
Biochem. 94:1111-1118.

95

Klont, R.E., E. Lambooy, and J .G. van Logtestijn. 1993. Effect of preslaughter
anesthesia on muscle metabolism and meat quality of pigs of different halothane
genotypes. J. Anim. Sci. 71:1477-1485.

Kunst, A., B. Draeger, and J. Ziegenhom. 1984. D-Glucose. In: Methods of Enzymatic
Analysis, Third ed. Bergmeyer, H.U., editor. 62163-172. Verlag Chemie,
Deerﬁeld Beach, FL.

Lai, F.A., H.P. Erickson, E. Rousseau, Q.Y. Liu, and G. Meissner. 1988. Puriﬁcation
and reconstitution of the calcium release channel from skeletal muscle. Nature
(Lond.) 331:315-319.

Levanon, E.Y., E. Eisenberg, R. Yelin, S. Nemzer, M. Hallegger, R. Shemesh, Z.Y.
F ligelman, A. Shoshan, S.R. Pollock, D. Sztybel, M. Olshansky, G. Rechavi, and
M.F. J antsch. 2004. Systematic identiﬁcation of abundant A-to-I editing sites in
the human transcriptome. Nat. Biotechnol. 22:1001-1005.

Lowenstein, J .M. 1972. Ammonia production in muscle and other tissues: the purine
nucleotide cycle. Physiol. Rev. 52: 382-414.

Lowry, O.H., N.J. Rosebrough, A.L. Farr, and R.J. Randall. 1951. Protein measurement
with the Folin phenol reagent. J. Biol. Chem. 193:265-275.

MacKenzie, A.E., R.G. Komeluk, F. Zozato, J. Fujii, M. Phillips, D. Iles, B. Wieringa, S.
Leblond, J. Bailly, H.F. Williard, C. Duﬂ‘, R.G. Worton, and DH. MacLennan.
1990. The human ryanodine receptor gene: Its mapping to 19q13.1, placement in

a chromosome 19 linkage froup, and exclusion as the gene causing myotonic
dystrophy. Am. J. Hum. Genet. 46:1082-1089.

MacLennan, DH. 1970. Puriﬁcation and properties of an adenosine triphosphatase from
sarcoplasmic reticulum. J. Biol. Chem. 245:4508-4518.

MacLennan, DH, and PT. Wong. 1971. Isolation of a calcium-sequestering protein
from sarcoplasmic reticulum. Proc. Natl. Acad. Sci. 68:1231-1235.

MacLennan, DH. 1992. The genetic basis of malignant hyperthermia. TiPS. 13:331-
334.

MacLennan, DH, and MS. Phillips. 1992. Malignant hyperthermia. Science.
256:789-794.

MacLennan, DH. 1995. Discordances between phenotype and genotype in malignant
hyperthermia. Curr. Opin. Neur. 8:397-401.

Marr, A.L., C.P. Allison, N.L. Berry, D. B. Anderson, D. J. Ivers, L. F. Richardson, K.
Keffaber, R.C. Johnson, and M. E. Doumit. 2004. Impact of halothane

96

 

 

sensitivity on mobility status and blood metabolites of HAL-1843-normal pigs
following an aggressive handling model. J. Anim. Sci. 82(Suppl. 2):33.

Meissner, G. 1984. Adenine nucleotide stimulation of Ca2+-induced Ca2+release in
sarcoplasmic reticulum. J. Biol. Chem. 259:2365-2374.

Mickelson, J .R., J .A. Ross, B.K. Reed and CF. Louis. 1986. Enhanced Ca2’-induced
calcium release by isolated sarcoplasmic reticulum vesicles from malignant
hyperthermia susceptible pig muscle. Biochim. Biophys. Acta. 862:318-328.

Mickelson, J .R., EM. Gallant, L.A. Litterer, K.M. Johnson, W.E. Rempel, and CF.
Louis. 1988. Abnormal sarcoplasmic reticulum ryanodine receptor in malignant
hyperthermia. J. Biol. Chem. 263:9310-9315.

Mickelson, J .R., and CF. Louis. 1996. Malignant hyperthermia: Excitation-contraction
coupling, Ca2+, release channlel and cell Ca2+ regulation defects. Phys. Rev.
76:537-592.

Milan, D., J. Jeon, C. Looft, V. Amarger, A. Robic, M. Thelander, C. Rogel-Gaillard,
S.Paul, N. Iannuccelli, L. Rask, H. Ronne, K. Lundstrom, N. Reinsch, J. Gellin, E.
Kalm, P. LeRoy, P. Chardon, and L. Andersson. 2000. A mutation in PRKAG3

associated with excess glycogen content in pig skeletal muscle. Science.
288:1248-1251.

Mitchell, G., J .J . Heffron, and A.J. van Rensburg. 1980. A halothane-induced
biochemical defect in muscle of normal and malignant hyperthermia-susceptible
Landrace pigs. 59:250-256.

Monin, G., P. Sellier, L. Ollivier, R. Goutefongea, and J .P. Girard. 1980. Carcass
charactersitcs and meat quality of halothane negative and halothane positive
Pietrain pigs. Meat Sci. 52413-423.

Monin, G., P. Selleir, L. Olliver, R. Goutefonges, and J .P. Girard. 1981. Carcass
characteristics and meat quality of halothane negative and halothane positive
pietrain pigs. Meat Sci. 5:413.

National Pork Producers Council (NPPC). 1991. Procedures to evaluate market hogs.
Des Moines, IA. 3rd ed.

National Pork Producers Council (N PPC). 2000. Pork composition and quality
assessment procedures. Des Moines, IA.

Nelson, TE, and T. Sweo. 1988. Ca2+ uptake and Ca2+ release by skeletal muscle
sarcoplasmic reticulum: differing sensitivity to inhalation anesthetics.
Anesthesiology. 69:571-577.

97

 

 

O’Brien, P.J., and DH. MacLennan. 1992. Application in the swine industry of a DNA-
based test for porcine stress syndrome. Proc. of American Association of Swine
Practitioners. pp433-435.

O’Brien, P.J., H. Shen, C.R. Cory, and X. Zhang. 1993. Use of a DNA-based test for the
mutation associated with porcine stress syndrome (malignant hyperthermia) in
10,000 breeding swine. JAVMA. 203:842-851.

Offer, G. 1991. Modelling of the formation of pale, soft and exudative meat: effect of
chilling regime and rate and extent of glycolysis. Meat Sci. 30:157-184.

Olsen, G. F. 1962. Optimal conditions for the enzymatic determination of L-lactic acid.
Clin. Chem. 8:1-10.

Otsu, K., H.F. Willard, V.K. Khanna, F. Zorzato, N.M. Green, and DH. MacLennan.
1990. Molecular cloning of cDNA encoding the Ca2+ release channel (ryanodine

receptor) of rabbit cardiac muscle sarcoplasmic reticulum. J. Biol. Chem.
265:13472-13483.

Ozawa, E., K. Hosoi, and S. Ebashi. 1967. Reversible stimulation of muscle
phosphorylase b kinase by low concentrations of calcium ions. J. Biochem.
61:531-533.

Pate E., and R. Cooke. 1989. A model of crossbridge action: the effects of ATP, ADP
and Pi. J. Muscle Res. Cell Motil. 10:181-196.

Pessah, I.N., R.A. Starnbuck, and J .E. Casida. 1987. Cay-activated ryanodine
bindingzmechanisms of sensitivity and intensity modulation by Mgr”, caffeine and
adenine nucleotides. Mol. Pharmacol. 31:232-238.

Phillips, M.S., J. Fujii, V.K. Khanna, S. DeLeon, K. Yokobata, P.J. De Jong, and DH.
MacLennan. 1996. The structural organization of the human skeletal muscle
ryanodine receptor (RYRl) gene. Genomics. 34:24-41.

Pommier, S.A., and A. Houde. 1993. Effect of the genotype for malignant hyperthermia
as determined by a restriction endonuclease assay on the quality characteristics of
commercial pork loins. J. Anim. Sci. 71:420.

Porter, KR. 1956. The sarcoplasmic reticulum in muscle cells of Amblystoma larvae. J.
Biophys. Biochem Cytol. 2: 163-170.

Potter, J .D., Z. Sheng, B.S. Pan, and J. Zhao. 1995. A direct regulatory role for troponin
T and a dual role for troponin C in the Ca2+ regulation of muscle contraction. J.
Biol. Chem. 270:2557-2562.

98

Rempel, W.E., M. Lu, S.E. Kandelgy, C.F.H. Kennedy, L.R. Irvin, J .R. Mickelson, and
CF. Louis. 1993. Relative accuracy of the halothane challenge test and a
molecular genetic test in detecting the gene for porcine stress syndrome. J. Anim.
Sci. 71:1395-1399.

Reik, T.R., W.E. Rempel, C.J. McGrath, and PB. Addis. 1983. Further evidence on the
inheritance of halothan reaction in pigs. J. Anim. Sci. 57:826-831.

Ritter, M.J., M. Ellis, J. Brinkman, J .M. DeDecker, M.E. Kocher, K. Keffaber, B.A.
Peterson, J. M. Schlipf, and B. F. Wolter. 2004. The effects of stocking density
during transport of slaughter weight pigs on the incidence of dead and non-
ambulatory pigs at the packing plant. Proc. 57th Reciprocal Meats Conference.

Rodney, G. G., B. Y. Williams, G. M. Strasburg, K. 2Beckingham, and S. L. Hamilton.
2000. Regulation of RYRl activity by Ca2+ and calmodulin. Biochem. 26: 7807-
7812.

Rosalki, SB. 1967. An improved procedure for serum creatine phophokinase
determination. J. Lab. and Clin. Med. 69:696-705.

Sather, AP, and AC. Murray. 1989. The development of a halothane-sensitive line of
pigs. Canadian J. Anim. Sci. 69:323-331.

Sather, A.P., A.C. Murray, S.M. Zawadski, and P. Johnson. 1991. The effect of the
halothane gene on pork production and meat quality of pigs reared under
commercial conditions. Canadian J. Anim. Sci. 71 :561-574.

Sayre, RN, and E.J. Briskey. 1963. Protein solubility as inﬂuenced by physiological
conditions in the muscle. J. Food Sci. 28:675.

Scopes, R.K., and R.A. Lawrie. 1963. Postmortem lability of skeletal muscle proteins.
Nature 197:1202.

Shimizu S, Y. Tani, H. Yamada, M. Tabata, and T. Murachi. 1980. Enzymatic
determination of serum free fatty acids: A colorimetric method. Anal. Biochem.
107: 193-198.

Shomer, N.H., J .R. Mickelson, and CF. Louis. 1995. Ca2+ release channels of pigs
heterozygous for malignant hyperthermia. Muscle and Nerve. 18:1167-1176.

Smith, J. S. R. Coronado, and G. Meissner. 1986. Single channel measurements of the
calcium release channel from skeletal muscle sarcoplasmic reticulum. Activation
by Ca2 and ATP and modulation by Mgz. J. Gen. Physiol. 88: 573- 588.

Stetzer, A.J., and PK. McKeith. 2003. Quantitative strategies and opportunities to
improve quality, Phase I. In Benchmarking Value in the Pork Supply Chain.

pp.1-6.

99

Takeshima, H., S. Nishimura, T. Matsumoto, H. Ishida, K. Kangawa, N. Minamino, H.
Matsuo, M. Ueda, M. Hanaoka, T. Hirose, and S. Numa. 1989. Primary structure
and expression from complementary DNA of skeletal muscle ryanodine receptor.
Nature (Lond.) 339:439-445.

Tong, J ., H. Oyarnada, N. Demaurex, S. Grinstein, T.V. McCarthy, and DH.
MacLennan. 1997. Caffeine and halothane sensitivity of intracellular Ca2+
release is altered by 15 calcium release channel (ryanodine receptor) mutations
associated with malignant hyperthermia and/or central core disease. J. Biol.
Chem. 272(42):26332-26339.

Topel, D.G., E.J. Bicknell, K.S. Preston, L.L Christian, and CY. Matsushima. 1968.
Porcine Stress Syndrome. Mod. Vet. Pract. 49:40-60.

Topel, DG. 1972. International symposium on pork quality. Univ. of Wisconsin.
Madison.

Topel, D.G., J .A. Miller, P.J. Berger, R.E. Rust, F.C. Parrish, and K. Ono. 1976.
Palatability and visual acceptance of dark, normal and pale colored porcine m.
longissimus. J. Food Sci. 41:628-631.

Tripathy, A., L. Xu, G. Mann, and G. Meissner. 1995. Calmodulin activation and
inhibition of skeletal muscle Ca2+ release channel (ryanodine receptor). Biophys.
J. 69:106-119.

Treves , S., F. Larini, P. Menegazzi, T.H. Steinberg, M. Koval, B. Vilsen, J .P. Andersen,
and F. Zorzato. 1994. Alteration of intracellular Ca2+ transients in COS-7 cells
transfected with the cDNA encoding skeletal-muscle ryanodine receptor carrying
a mutation associated with malignant hyperthermia. Biochem. J. 301:661-665.

van den Hende, C., D. Lister, E. Muylle, L. Ooms, and W. Oyaert. 1976. Malignant
hyperthermia in Belgian Landrace pigs, rested or exercised before exposure to
halothane. Br. J. Anaesth. 48:821.

van Putten, G. 1982. Handling of slaughter pigs prior to loading and during loading on a
lorry. In: Moss, R. (ed.) Transport of animals intended for breeding, production
and slaughter. Current topics in veterinary medicine animal science. 18:15-25.
Martinus Nijhoff, The Hague.

Velarde, A., M. Gispert, L. Faucitano, P. Alonso, X. Manteca, and A. Diestre. 2001.
Effects of the stunning procedure and the halothane genotype on meat quality and
incidence of haemorrhages in pigs. Meat Science. 58:313-319.

Veum, T.L., M.R. Ellersieck, T.L. Durham, W.R. McVickers, S.N. MacWilliams, and
J .F. Lasley. 1979. Response of stress-susceptible and stress-resistant Hampshire
pigs to electrical stress I. physiological and biochemical effects. J. Anim. Sci.
48:446.

100

Villa, A., P. Podini, A. Nori, M.C. Panzeri, A. Matini, J. Meldolesi, and P. Volpe. 1993
The endoplasmic reticulum-sarcoplasmic reticulum connection. 11. Postnatal

differentiation of the sarcoplasmic reticulum in skeletal muscle ﬁbers. Exp. Cell
Res. 209:140-148.

Wagenknecht, T., R. Grassucci, J. Frank, A. Saito, M. Inui, and S. Fleischer. 1989.

Three—dimensional architecture of the calcium channel/foot structure of
sarcoplasmic reticulum. Nature (Lond.) 338:167-170.

Wagenknecht , T., and M. Raderrnacher. 1995. Three-dimensional architecture of the
skeletal muscle ryanodine receptor. F EBS Lett. 369:43-46.

Wagenknecht , T., and M. Radermacher. 1997. Ryanodine receptors: structure and
macromolecular interactions. Curr Opin Struct Biol. 2:258-265.

Wang, Q., M. Miyakoda, W. Yang, J. Khillan, D.L. Stachura, M.J. Weiss, and K.

Nishikura. 2004. Stress-induced apoptosis associated with null mutation of
ADARI RNA editing deaminase gene. J. Biol. Chem. 279:4952-4961.

Warriss, RD, and D. Listen. 1982. Improvements of meat quality in pigs by beta-
adrenergic blockade. Meat Sci. 7: 1 83-187.

Warriss, RD, and SN, Brown 1987. The relationship between initial pH, reﬂectance
and exudation in pig muscle. Meat Sci. 20:65-74.

Warriss P.D., S.N. Brown, J .E. Edwards, M.H. Anil, and DP. Fordham. 1992. Time in

lairage needed by pigs to recover from the stress of transport. Vet Rec. 131 :194-
196.

Webb, A.J., and C. Smith. 1976. Some preliminary observations on the inheritance and
application of halothane-induce MHS in pigs. Proc. of the Third International

Conference on Production Disease in Farm Animals. Pudoc, Wageningen. pp
211-213.

Webb, A.J., and C.H.C Jordan. 1978. Halothane sensitivity as a ﬁeld test for stress-
susceptibility in the pig. Anim. Prod. 26:157-168.

Wieland, OH. 1984. Glycerol. In: Methods of Enzymatic Analysis. Third ed.
Bergmeyer, H.U. editor. 6:504-510. Verlag Chemie, Deerﬁeld Beach, FL.

Williamson, D.H., J. Mellanby, and HA. Krebs. 1962. Enzymatic determination of D(-)-
B-hydroxybutyric acid and acetoacetic acid in blood. Biochem. J. 82:90-98.

Wismer-Pedersen, J ., and E.J. Briskey. 1961. Rate of anaerobic glycolysis versus
structure in pork muscle. Nature 189:318.

101

 

Wismer — Pederson, J. 1971. “Chemistry of Animal Tissues — Water.” In the Sciences
of Meat products, 2"d edition. Pg. 184. J .F . Price and BS. Schweigert, eds. W.H.

Freeman and Company, San Fransisco.

Wu, Y., and S.L. Hamilton. 1998. Functional interactions of cytoplasmic domains of the
skeletal muscle Ca2+ release channel. TCM. 8:312-319.

Zorzato, F., J. Fujii, K. Otsu, M. Phillips, N.M. Green, F .A. Lai, G. Meissner, and DH.
MacLennan. 1990. Molecular cloning of cDNA encoding human and rabbit

forms of the Ca2+ release channel (ryanodine receptor) of skeletal muscle
sarcoplasmic reticulum. J. Biol. Chem. 26522244 — 2256.

Zucchi, R., and S. Ronca-Testoni. 1997. The sarcoplasmic reticulum Ca2+
channel/ryanodine receptor: modulation by endogenous effectors, drugs and
disease states. Pharm. Rev. 49:1-51.

102

      

S

I ll

   

Illlllllllllllllll