.I r. l.
.L .1 :1 1 6. VI
1”. .Ii-lr. -

y. I I:
J}!
. 3:30..

 

 

 

 

 

1L!
€10.24!!!” .. .JI‘A.‘ «(1" I14.» ).viol5.
. , .... .. hid-a.” r: .n} f..; u
.2}. ‘ raglan? . . , A, ..»..,4C»:n g t

v.\.. ‘ :9!

LIBRARY
Michigan State
University

This is to certify that the
dissertation entitled

VP16-dependent association of chromatin-modifying
coactivators and under-representation of histones at IE gene
promoters dun'ng HSV-1 infection

presented by

Francisco Javier Herrera

has been accepted towards fulfillment
of the requirements for the

 

 

 

 

PhD. degree in Biochemistry and Molecular
Biology
/ .
... * r7"
haw/Afl— "(1
Major Pfieswignature
/ 2 / / 5/. a/
Date

MSU is an Afiinnetlve Action/Equal Opportunity Institution

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2105 ovatifiteoueindd-p. 1 5

VP16-DEPENDENT ASSOCIATION OF CHROMATIN-MODIFYING
COACTIVATORS AND UNDER-REPRESENTATION OF HISTONES AT IE GENE
PROMOTERS DURING HSV-l INFECTION

By

Francisco Javier Herrera

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Biochemistry and
Molecular Biology

2004

ABSTRACT
VP16-DEPENDENT ASSOCIATION OF CHROMATIN-MODIFYING
COACTIVATORS AND UNDER-REPRESENTATION OF HISTONES AT IE GENE
PROMOTERS DURING HSV-l INFECTION
By

Francisco Javier Herrera

During infection by herpes simplex virus type 1 (HSV-l ), the virion protein VP16
activates the transcription of viral immediate early (IE) genes. Genetic and biochemical
assays have Shown that the potent transcriptional activation domain of VP16 can
associate with general transcription factors and with chromatin-modifying coactivator
proteins of several types. The latter interactions are particularly intriguing because
previous reports indicate that HSV-l DNA does not become nucleosomal during lytic

infection.

In the present work, chemical crosslinking and immunoprecipitation assays were
used to probe the presence of activators, general transcription factors, and chromatin
modifying coactivators at IE gene promoters during infection of HeLa cells by wildtype
HSV-l and by RPS, a viral strain lacking the VP16 transcriptional activation domain.
The presence ofVP16 and Oct-1 at IE promoters did not depend on the activation
domain. In contrast, the associations of RNA polymerase II, TATA-binding protein,
histone acetyltransferases (p300 and CBP) and ATP-dependent remodeling proteins
(BRG-l and hBRM) with IE gene promoters were Observed in wildtype infections but

were absent or reduced in cells infected by RPS. Contrary to the previous evidence for

non-nucleosomal HSV-l DNA, histone H3 was found associated with viral DNA at early
times of infections. Interestingly, histone H3 was under-represented at the IE gene
promoters in a manner dependent on the VP16 activation domain. Thus, the VP16
activation domain is responsible for recruiting general transcription factors and
coactivators to IE promoters and also for the reduced levels of histones present at those

promoters.

iv

To my Family

ACKNOWLEDGMENTS

I may not have enough words to thank my mentor Steve Triezenberg for his
tremendous dedication in teaching me how to become a scientist. It was a great fortune
for me to receive his mentoring during these years in the PhD program. Long
remembered will be the always intellectually stimulating discussions at the blackboard
addressing the last result, idea, paper or model proposed in our lab or from others. His
dedication for excellence in science and his exquisite clarity will always be a model for

me to follow in the years to come. I will always be grateful for these years.

I would also like to thank the past and present members of the laboratory,
Kanchan Champhekar , Amy Hark, Dawn Greensides, Nathan Lord, Yaopan Mao, Seren
Ottosen, Dean Shooltz, Kostas Vlachonasios and Billy Yang for sharing their expertise
and their friendships in those, most of the times, long hours at the bench. It was great for
me to find such good fiiends from all over the globe here in the lab. Special thanks to
James Doroghazi and Daniel Ducat for helping me to develop some of the techniques
used in this project. Many thanks to Min-Hao Kuo and members from his lab for

interesting discussions and insightful ideas.

I would like to thank the members of my thesis committee, David Amosti, Bill
Henry, Suzanne Thiem and John Wang for their time and efforts in helping during these

years. Thank you very much for always being available to answer my questions and for

your kind disposition. Many thanks to people in the Department of Biochemistry and

Molecular Biology for making me feel at home all these years.

I would like to thank my fiiends for the great moments that we spend during these
years. It was very important to receive their support and help. I know that for all these
years many names Should be included and for that I am afraid of not having the necessary
space. But I cannot leave without mentioning the “Chilean community” especially
Rodrigo Gutierrez, Gastén Etchegoyen and the Coronado family for their close friendship
and support and the same for the “Argentineans” especially Clarisa Bejar and Alejandra
Yep. Many thanks to my friends form the program especially Heather Hirsh and Kirsten
F ertuck. Thank you to my all-time friends from my undergraduate years, to Luis
Larrondo for all those endless conversations about science and life that many times
happened to occur in so diverse places, to Sergio Quezada, F rancisca Cerda, Natalia
F rias, Claudio AlarcOn and Pablo de Ioannes for those great reunions in New York, New

Hampshire, Michigan and Santiago.

I would like to finish by expressing my gratitude to Setsuko for her interminable
support through all these years. Thank you for helping me so much in the difficult
moments and for sharing all those fantastic times. My gratitude to my family in Chile, my
mother Ana Maria and brothers Matias, Fernando and Rodrigo and his family. Even
though the physical distance, their close presence has been fundamental for me during

these years. I am in debt to them for much of this accomplishment.

vi

TABLE OF CONTENTS

List of Figures ........................................................................................ x

List of Tables ........................................................................................ xii

List of Abbreviations ................................................................................ xiii

Chapter I:

Literature review ................................................................................ 1-42

1.1. Transcriptional activation in eukaryotes ......................................................... 1

1.1.1. Promoter architecture ................................................................... 2

1.1.1.1.Corepromoter ............................................................. 2

1.1.1.2. Proximal promoter and enhancers ...................................... 3

1.1.2. Transcriptional activators ............................................................ 5

1.1.2.1. DNA binding domains ...................................................... 6

1.1.2.2. Activation domains ....................................................... 7

1.1.3. Action of activators at promoters ................................................... 9
1.1.3.1. Stepwise recruitment of basal transcription

machinery ............................................................................. 10

1.1.3.1.]. TFIID, TBP and TAFSIO

1.1.3.1.2. TFIIA, TFIIB, TFIIF and TFIIH ........................... 12

1.1.3.2. Holoenzyme recruitment .................................................. 13

1.1.3.2.1. Mediator complex .............................................. 14

1.1.4. Chromatin and chromatin-modifying coactivators...............................15
1.1.4.1. Covalent modifications ofhistones.....................................16

1.1.4.1.1. Acetylation. ................................................... 17
1.1.4.1.2. Methylation ................................................... 18
1.1.4.1.3. Phosphorylation ................................................ 20
1.1.4.1.4. Ubiquitinylation ................................................ 20

1.1.4.2. ATP—dependent chromatin remodeling
complexes .......................................................................... 21
1.1.4.3. Chromatin dynamic ..................................................... 24
1.1.5. Post-initiation effects of activators ............................................... 25
1.2. Transcriptional activation of herpes simplex virus genes ................................. 26
1.2.1. Herpes viruses ...................................................................... 26
1.2.2. Herpes Simplex virus ............................................................... 27
1.2.2.1. Virion structure .......................................................... 28
1.2.2.2. Viral genome ............................................................. 29
1.2.2.3. Cascade of viral gene expression ...................................... 3]

vii

1.2.3. Activation of viral IE genes during infection ................................... 34

1.2.3.1. Virion protein 16 ......................................................... 34
1.2.3.2. VP16 induced complex ................................................. 37
1.2.4. VP16 as a model transcriptional activation
domain ....................................................................................... 38
1.3. Main hypothesis and experimental setting .................................................... 41
Chapter 11:
Recruitment of transcription factors to IE viral
promoters during HSV—l infection ......................................................... 43-75
2.1. Introduction ..................................................................................... 43
2.2. Materials and methods ........................................................................ 46
2.2.1. Cells and viruses ...................................................................... 46
2.2.2. Chemical crosslinking and immunoprecipitation assays ...................... 47
2.2.3. Gene expression assays ............................................................ 49
2.2.3.1 . Analysis of viral gene expression in cells
expressing a dominant negative form of ARC92 ............................. 50
2.3. Results ........................................................................................... 51
2.3.1 . VP16 associates with [B gene promoters with or
without its transcriptional activation domain ........................................... 51
2.3.2. The VP16 AD is required to recruit general transcription
factors to IE promoters during infection ................................................ 58
2.3.3. The VP16 AD recruits chromatin-modifying coactivators
to [B gene promoters during infection ................................................... 62
2.3.4. ARC92 mediator subunit and IE gene expression .............................. 66
2.4. Discussion ...................................................................................... 71
Chapter [11:
Association of histones with viral DNA .................................................. 76-100
3.1. Introduction ..................................................................................... 76
3.2. Materials and methods ........................................................................ 78
3.2.1. Cells and viruses .................................................................... 78
3.2.2. Chemical crosslinking and immunoprecipitation
assays ........................................................................................ 79
3.2.3. Sequential chromatin immunoprecipitation protocol .......................... 81
3.3. Results ........................................................................................... 82

viii

3.3.1. Histone H3 is present on viral DNA but under-

represented at IE gene promoters ......................................................... 82
3.3.2. Histone H3 is detected in all classes of viral
promoters in the absence of the VP16AD ............................................... 89
3.3.3. Histone H3 occupancy of viral promoters decreases
at 4 hours post-infection ................................................................... 93
3.4. Discussion ....................................................................................... 97
Chapter IV:
Discussion and future work ............................................................... 101-123
4.1. Chromatin-modifying coactivators at viral IE gene
promoters ........................................................................................... 101
4.1.1. Functional role of coactivators on viral gene
expression .................................................................................. 102
4.1.2. Additional chromatin-modifying coactivators
at IE gene promoters ...................................................................... 103
4.1.3. VP16AD subdomains ............................................................ 105
4.2. Is HSV-l DNA non-nucleosomal during lytic infection? ......................................... 106
4.3. Association of histone with incoming HSV—l DNA ..................................... 110
4.4. Does VP16 prevent deposition or promote disassembly
of histones at viral IE gene promoters? ............................................................................ 111
4.5. Are histones displaced from all classes of HSV-1 gene
promoters during cascade of gene expression? ................................................................ 117
4.6. Chromatin and other animal viruses ........................................................ 118
4.6.1. Human immunodeficiency virus type-1 ........................................ 119
4.6.2. Simian virus 40 ..................................................................... 120
4.6.3. Adenovirus .......................................................................... 121
4.6.4. Herpesviruses ....................................................................... 123
Appendix A: Chromatin immunoprecipitation assays .................................... 126

Appendix B: Quantitative RT-PCR analysis for viral
gene expression .................................................................................... 136

LIST OF FIGURES

Figure l. HSV—l structure ......................................................................... 30
Figure 2. Schematic representation of three temporal classes of HSV-1

gene promoters ....................................................................................... 35
Figure 3. K08 and RPS viral strains ............................................................. 53

Figure 4. Detection of VP16 and Oct-1 at viral IE promoters during
infection ................................................................................................ 54

Figure 5. Detection of VP16 and Oct-1 at viral 1E promoters during
infection using ChIP followed by quantitative PCR analysis .................................. 57

Figure 6. General transcription factors are recruited to IE promoters
by the VP16 AD ..................................................................................... 59

Figure 7. Recruitment of RNA Pol H at different classes of viral
promoters ............................................................................................. 61

Figure 8. Recruitment of histone acetyl transferases CBP and p300
to IE promoters during HSV-l infection ......................................................... 63

Figure 9. Recruitment of ATP-dependent chromatin remodeling
complexes to IE promoters during HSV-l infection ............................................ 65

Figure 10. Recruitment of mediator subtmit ARC92 to ICP27 promoter
during HSV-l infection ............................................................................. 68

Figure 11. Effect of dominant negative form of ARC92 on IE gene
expression ............................................................................................. 70

Figure 12. Acetylated histone H3 at K9, K14 (AcH3) is not detected at
IE gene promoters during early times of infection .............................................. 84

Figure 13. Histone H3 associates with HSV—l DNA during infection
and is under-represented at transcriptionally active IE gene promoters ...................... 86

Figure 14. Histone H3 associates with viral promoters at low multiplicities
of infection and is under-represented at .IE gene promoters ................................. 88

Figure 15. Histone H3 is not detected at IE gene promoters that are

associated with RNA Pol II during infection by KOS virus ................................... 90

Figure 16. Histone H3 associates with all classes of viral promoters
during infection of RPS virus ....................................................................... 92

Figure 17. Histone H3 occupancy at IE gene promoter is dependent

on VP16AD .......................................................................................... 94
Figure 18. Histone H3 occupancy of viral promoters decreases

at 4 hpi ................................................................................................ 96

Figure 19. Standard curves for quantitative real-time PCR used for
analysis of CbIP samples ......................................................................... 135

Figure 20. qRT-PCR analysis of viral gene expression of cells
infected by KOS or RPSviralstrains ............................................................. 141

xi

LIST OF TABLES

Table 1. Oligonucleotides used in semi-quantitative PCR reactions
analysis of ChIP samples ........................................................................... 133

Table 2. Oligonucleotides used in quantitative real-time PCR analysis
of ChIP samples .................................................................................... 134

Table 3. Oligonucleotides used in quantitative real-time PCR analysis
of cDNA samples ................................................................................... 138

xii

Ab

AcH3

ATP
BRM
BRG-l
CBP
ChIP
CMV
DE gene

EBV

GTF

hpi
HSV—l
ICP

IE gene

LIST OF ABBREVIATIONS

amino acid

antibody

aceylated histone H3

activation Domain
activator-recnrited cofactor
adenosine S’-triphosphate
Brahma

Brahma-related gene 1
CREE-binding protein
chromatin immunoprecipitation
cytomegalovirus

delayed early gene

Epstein-Bar virus

glycoprotein C

general transcription factor
histone acetyl transferase
human immunodeficiency virus
hours post-infection

herpes simplex virus type 1
infected cell polypeptide

immediate early gene

xiii

IFN-B
IP
KSHV

L gene
MOI
ORF
PCR
PIC

pfu
qPCR
RNA Pol II
RT-PCR
SNF
SW1
TAF
TBP

TFII

UAS

interferon beta

immunoprecipitation

Kaposi’s sarcoma-associated herpes virus
late gene

multiplicity of infection

open reading frame

polymerase chain reaction

pre-initiation complex

plaque forming unit

quantitative polymerase chain reaction
RNA polymerase II

reverse transcriptase PCR

sucrose non-fermentable

mating-type switching

TBP-associated factor

TATA-binding protein

transcription factor, RNA polymerase II
thymidine kinase

upstream activating sequences

virion protein

xiv

Chapter I
Literature Review

1.1. Transcriptional activation in eukaryotes‘.

The genome of an organism not only encodes the information to produce
thousands of proteins but also regulatory sequences that dictate when each of these genes
is to be expressed. In case of protein-encoding genes, these regulatory sequences are
recognized by trans-factor proteins that are able to modulate the activity of the RNA
polymerase 11 (RNA Pol II). The interplay of trans-factors and regulatory sequences is a
critical step in regulating gene expression and therefore is important for cellular process

including cell homeostasis, growth, differentiation and diseases.

The cis-acting regulatory sequences for genes transcribed by RNA Pol II typically
comprise a combination of core promoter elements and upstream activating or repressing
sequences [reviewed in (262)]. The core promoter serves as the binding Site for the basal
transcriptional factors and defines the transcriptional startpoint. The upstream activating
or repressing sequences (UASS and URSS) are recognized by transcriptional activators
and repressors that modulate the activity of core promoters, helping to control the

transcription of genes.

 

’ Part of this chapter was published in “Herrera F J , Shooltz D and Triezenberg SJ (2004). Mechanisms of
Transcriptional activation in eukaryotes. Handbook of Experimental Pharmacology. Vol 1663-3 1”.

1

1.1.1. Promoter architecture.

1.1.1.1. Core promoters.

One of the more prominent features in core promoters is the TATA box, typically
located about 30 bp upstream of the transcription start. Although initial models proposed
that the TATA box was necessary for transcription of RNA Pol H genes, analysis of a
subset of promoter sequences (205 sequences) from Drosophila Showed a 42%
prevalence of TATA box containing promoters (160). Similarly in a subset of human
promoters (1031 sequences) the prevalence of TATA containing promoter was 32%
(274). These results reveal that although the consensus TATA box is present in many
gene promoters, it is not a necessary feature of every RNA Pol 11 promoter. Surrounding
the start site itself may be found an initiator (Inr) element involved in defining the correct
start site for transcription. Two other core promoter motifs present downstream of the
transcription start site have been identified in Drosophila and humans. The downstream
promoter element (DPE) is present at +28 to +32 relative to +1 start site and is involved
in TFIID binding (125). The motif ten element (MTE) is located at +18 to +27 and its
activity is dependent on Inr but independent of TATA box and DPE (171). Furthermore,
a TFIIB recognition element (BRE), flanking the TATA box, has been described in some
organisms [reviewed in (262)]. Differences among core promoters of various genes, with
respect to the presence and strength of these core elements, have pronounced effects on
how those promoters respond to particular transcriptional activators. This specificity may

allow a particular enhancer to differentially regulate various target genes, and may allow

a particular core promoter to selectively respond to different enhancers. For example, the
Spl activation domain strongly activates core promoters containing TATA elements, Inr
elements, or both, whereas the Gal4-VP16 activator is most effective at a core promoter
with both TATA and Inr (68). In an ”enhancer trapping” study in Drosophila, many
enhancers were able to drive expression fi'om both TATA dependent and DPE dependent
promoters, but some enhancers preferentially activated either one or the other core
promoter (36). The mechanistic differences leading to enhancer-core promoter
specificity may involve the recruitment of transcriptional cofactors that display core
promoter specificity. For example, the transcriptional cofactor NC2 represses
transcription from TATA dependent promoters, but activates transcription from DPE
dependent promoters (307). Thus, either direct or indirect recruitment of transcriptional
cofactors by an activator may differentially regulate transcription from different core

promoters, leading to activator-promoter specificity.

1.1.1.2. Proximal promoter and enhancers.

In addition to the core promoter elements, transcription of many genes depends on
cis-acting regulatory elements termed enhancers or upstream activating sequences (UAS),
which provide the binding sites for transcriptional activators. These DNA elements can
vary in sequence and affinity for a particular DNA binding domain, and may exist in
promoter-proximal locations or hundreds to thousands of basepairs upstream or

downstream of a promoter.

Combinations of activator binding sites may be clustered into more complex
regulatory elements. In such cases, cooperative binding of activators can lead to the
formation of large DNA-protein structures termed enhanceosomes, resulting in
synergistic effects on transcription. In the prototypical virus-inducible IFN-B
enhanceosome [reviewed in (196)], a cluster of three different activator binding sites
direct the expression of IFN-B in response to viral infection. However, none of the
activator binding sites act alone; only the combination of all three activator binding sites
recapitulates the logic necessary to drive proper expression and specificity of the IFN- [3
gene. In this model system, the enhancer represents not simply the sum of individual
activator functions, but rather an integration of inputs from different sources interpreted

by the particular combination of transcription factors present at the enhancer.

Taking this organizational theme one step further, many genes may have multiple
enhancers, each of which is poised to respond to particular developmental, growth, or
environmental signals. Each of these independent enhancers may be Simultaneously
signaling to the core promoter either to stimulate or repress transcription, depending on
the signal inputs received by the regulatory proteins that bind there. This diverse and
sometimes conflicting information must be integrated and interpreted at the promoter to
make a final decision on whether or not transcription is to proceed. This “information
display” model for genes with multiple enhancers has arisen from studies of
developmentally related genes in Drosophila (152), but will likely be relevant for many

hormonally or pharrnacologically regulated genes in humans as well.

With the increasing availability of genomic sequences for prominent experimental
organisms, computational analysis for identifying cis-acting regulatory sequences has
become a powerful tool. In some cases, these searches focus on a particular cis
regulatory element, such as the estrogen response elements in mammalian genomes (11).
Other programs are designed for broader application, searching for sites corresponding to
any of the transcription factors in the TRANSFAC database and combining site searches
to increase the likelihood of identifying legitimate regulatory regions rather than
idiosyncratic consensus sequence matches (22, 89, 132). These computational
approaches yield results that still must be validated by direct evidence of the function of
putative elements in gene regulation and their interaction with specific transcription
factors. Although this is Often done on a case-by-case basis, either by mutational analysis
of the cis elements or by in vitro binding assays, more global assessments are also now
possible. For several transcription factors in yeast (241) and in mammalian cells (240,
301 ), genomic mapping of transcription factor binding sites has been accomplished by
combining chemical crosslinking and immunoprecipitation (chromatin IP or “ChIP”
assays) with DNA microarrays comprising intergenic or putative regulatory sequences

(so-called “ChIP on chip” assays).

1.1.2. Transcriptional activators.

The dual frmctions of a transcriptional activator protein, cis-element recognition

and transcriptional activation, are typically firlfilled by distinct regions of the protein’s

primary structure. For example, the DNA binding domain of the yeast Gal4 protein
resides within the amino-terminal 100 amino acids, whereas the major transcriptional
activation domain resides within the carboxyl-terminal 120 amino acids. This modular
design seems advantageous both for evolutionary and technological appropriation. In the
latter sense, a fusion protein linking the DNA-binding domain of Gal4 with the
transcriptional activation domain of the VP16 protein fi'om herpes simplex virus (250) is
widely used in both in vitro and in viva investigations into the mechanisms of
transcriptional activation. A second example, comprising a fusion of the DNA binding
domain of the tetracycline repressor with the VP16 activation domain, allows the
regulation of DNA binding by the presence or absence of the tetracycline ligand (86).
This regulatable artificial activator can function in a wide range of eukaryotes ranging

fi'om plants to mammals (85, 87, 302).

1.1.2.1. DNA binding domains.

The DNA binding domains of a large number of eukaryotic transcriptional
activator proteins have been extensively characterized by genetic, biochemical, and
structural approaches. Recent reviews catalog the known structures and specificities
(182) and highlight the common themes in structure and recognition (77). In many cases,
the binding activity or specificity of a DNA binding domain may be modulated by ligand
binding, dimerization with other DNA binding proteins, or by association with other

factors [reviewed by (189)].

The principles of protein:DNA interaction have now been established to a
sufficient degree to permit the design of DNA binding modules of engineered specificity
(16, 70). This is particularly true for the zinc-finger families of transcription factors (51,
127, 257, 310). This ability to tailor novel chimeric transcriptional activators for
recognition of DNA sequences that might not serve as native regulatory elements has

profound implications for potential technological application (172, 174, 327).

1.1.2.2. Activation domains.

In contrast to DNA binding domains and despite substantial research, relatively
little is known about the structures of transcriptional activation domains (TADS). By
analysis of primary sequence, TADS have been broadly classified based on the abundance
of particular amino acids, resulting in acidic, glutarnine rich, proline rich, and other
classes (200, 282). Despite these amino acid preferences, however, careful mutational
analyses have indicated that the most critical elements of activation domains are

fiequently the patterns of hydrophobic and aromatic amino acids (6, 38, S4, 113, 282).

Less is known about the secondary and tertiary structures of activation domains.
A number of biophysical analyses of various regulatory proteins have shown that
activation domains are largely unstructured in solution under physiological conditions
(56, 221, 254, 259). However, key amino acids in an activation domain can become

conformationally constrained upon interaction with a target protein, suggesting that the

most promising targets for structural studies will be binary complexes between activators
and targets. For example, circular dichroism spectra indicate that the c-Myc
transactivation domain is induced to form a helical structure upon binding to TATA
binding protein (TBP) (192). The activation domains of VP16 and of the estrogen
receptor also become conformationally constrained upon interaction with TBP (260,
299). Furthermore, the VP16 activation domain appears to become helical upon binding a
TBP associated factor, human TAF 9 (284). An amphipathic helix from the p53
activation domain fills a hydrophobic cleft in the MDM2 oncoprotein (159). An
amphipathic helix structure is also seen in the interface between the activator CREB and
its coactivator protein CBP (236). These examples support the model that an activator
target provides a folding template for an unstructured activation domain, which might

allow activation domains to interact with a number of different target proteins.

In some cases the tables may be turned: that is, an activation domain may provide
the folding template for a potential target. Nuclear hormone receptors have a conserved
C-terminal activation domain, known as AF-2. Ligand binding leads to a conformational
change in the activator that opens a hydrophobic groove for interaction with
transcriptional co-activators. In this case, the unstructured LxxLL peptide motif present
in several coactivators (101) folds into an amphipathic helix upon binding the AF -2

region of a hormone receptor [reviewed in (298)].

Although in many cases the activation domains seem to adopt a-helical structures,

that rule is not universal. Mutational and biophysical analysis of the Gal4 activation

domain suggested that it might form a B-strand instead (287). The activation domain of
E2F-2, upon interaction with the Rb tumor suppressor protein, assumes a combination of
helical and B-strand conformations (164). Together, these observations suggest that
activators and their target proteins bind to each other using a highly diverse set of

interaction surfaces.

1.1.3. Actions of activators at promoters.

Once localized to a promoter, a transcriptional activator can interact with a
number of different targets, including RNA Pol II, the basal transcription factors, the
mediator complex, coactivators, and chromatin-remodeling machinery. A common
theme in models of activation is recruitment, where a promoter-bound activator localizes
either a component of the transcriptional machinery or a transcriptional cofactor. This
model is supported by evidence of direct physical interactions of activators with basal
transcription factors, and by activator bypass experiments [reviewed in (231)]. In the
latter experiments, a component of the transcriptional machinery is fused directly to a
DNA binding domain, and this artificial recruitment serves to activate transcription.
Conceivable, in a variation of recruitment, a transcriptional activator may modulate the
activity of components of the transcriptional machinery, facilitating the assembly of the

preinitiation complex.

1.1.3.1. Stepwise recruitment of basal transcription machinery.

Transcription of protein-coding genes requires the assembly of a preinitiation
complex (PIC) comprising RNA Pol H, the general transcription factors (GTFS), and a
number of associated factors. In the stepwise model of PIC assembly, the TATA-binding
protein (TBP)-containing TFIID complex binds to a promoter, followed by TFIIA,
TFIIB, TFHF and RNA Pol H, and TFIIE and TFIH-I (34). TFIID is the only general
transcription factor that can specifically bind a promoter in the absence of interactions
with other GTFS, suggesting that it nucleates the assembly of the PIC. Any step of PIC
assembly might be rate limiting, and the recruitment of GTFS by association with

activators may facilitate assembly.

1.1.3.1.1 TFIID, TBP and TAFs.

The TFIH) protein complex comprises the TATA binding protein (TBP) and
several TBP-associated factors (TAFS) (35, 232). TBP binds selectively to the TATA
core promoter element, while the TAFs extend the footprint to include the Inr and DPE
elements. Studies in vitro Show that although TBP is sufficient for basal transcription,

the TAFs are required for activated transcription (61 , 190, 253).

TBP can bind directly to transcriptional activation domains, as demonstrated by in
vitro binding assays using a wide range of activator proteins, and mutations in activators
that weaken activation also weaken interaction with TBP (111, 213, 260). While these

results might suggest that activators simply recruit TBP, other evidence suggests that the

10

mechanism is more complicated. The acidic activator Gal4 binds TBP competitively
with TATA DNA (317) and TBP and Gal4 do not bind cooperatively to promoters (318),
suggesting that competition for the DNA binding domain of TBP may be involved in

activation mechanisms.

The TFIID complex associates with TATA box DNA more slowly than does
isolated TBP, implying that the TAFS contain inhibitory functions (143). Some
activators, including VP16 and the Zta protein of Epstein-Barr virus, can stimulate the
assembly of a TFIm-TFIIA-DNA complex (141, 169), but do not stimulate a ternary
complex when TBP is used instead of TFIID, suggesting that activators may counteract
inhibitory functions of the TAFs. This ability of activators to stimulate ternary complex
assembly appears to be relevant for activation, since mutations in the activation domain
that reduce transcriptional activation potential in viva also diminish the in vitro D-A

assembly fimction (142).

Other TAFS have a direct affinity for certain transcriptional activators, suggesting
a more direct role in recruitment or modulation of activity. For example, the glutamine-
rich activators Spl , NFAT, and CREB interact with the TAP 4 protein fiom Drosophila or
human cells (46, 72, 83, 137, 247, 311) and the acidic VP16 and p53 activation domains
can interact with TAF 9 (84, 140, 284). These interactions cannot always be interpreted
to imply an effect on TFIID, since a significant number of these TAF proteins are present
in protein complexes lacking TBP that nonetheless influence transcriptional activation

(91, 305).

ll

1.1.3.1.2. TFIIA, TFIIB, TFIIF and TFIIH.

TFIIA is a positive cofactor in PIC assembly, as it binds cooperatively with TFHD
at TATA DNA elements. TFIIA also functions as an antirepressor, inhibiting the TBP-
DNA destabilizing actions of Motl and NC2 [reviewed in (232)]. The formation of the
ternary TFIID-TFIIA-DNA complex is a rate-limiting step in PIC formation, and
activators can enhance this step (141, 169). Some evidence points to direct association of

the VP16 AD with subunits ofTFIIA (141, 142).

TFIIB also stabilizes the TBP-TATA complex, and serves as a docking site for
other components of the PIC. Several activators including the VP16 TAD have been
shown to bind TFHB with high affinity (173), and the TAD-TFHB connection has been
implicated in transcriptional activation (245). Interaction with the VP16 TAD has been
shown to alter the conformation of TFIIB, possibly priming it for incorporation in the
PIC (100, 244) or altering TFHB-DNA contacts (69). Although this evidence is
intriguing in pointing to TFIIB as a potential activator target, other reports have failed to

find evidence supporting this association (84, 260).

TFIIH, which contains both protein kinase and nucleic acid helicase activities,
also appears as a target for activation domains. The activation domains of VP16, p53,
and E2F1 can interact with TFIIH (223, 315) and recruitment of [III may stimulate
promoter escape (153), but no clear evidence exists that activators stimulate the
enzymatic activities of TFIHI. TFIIF and TFIIE might also be targets for activation

domains. The serum response factor (SRF) interacts with the RAP74 subunit of TFIIF

12

(121), and Fos-Jun dimers can interact with both TFHF and TFIIE (191). Although the
mechanistic implications of these interactions have not yet been fully developed, the dual
role of TFIIF as both an initiation and elongation factor suggests the possibility that
activators might modulate promoter escape or elongation in addition to assembly of the

preinitiation complex.

1.1.3.2. Holoenzyme recruitment.

Many of the models described in preceding sections are predicated on the premise
that transcriptional activation involves a sequential recruitment of the basal transcription
factors and RNA Pol II to form the PIC at the target promoter. This premise was
challenged, however, by the biochemical purification from yeast cells of an
extraordinarily large protein complex comprising RNA Pol H stably associated with a
subset of GTFS together with additional polypeptides (the Mediator proteins, described
below) (138). Certain transcriptional activators were shown capable of recruiting this
“holoenzyme” to a promoter in a manner sufficient to achieve transcriptional activation in
vitro (103, 138). The model arising from these observations is that rather than separately
and sequentially recruiting each general transcription factor, activation might more
simply involve recruitment of the distinct TFIID and holoenzyme complexes. A similar
RNA Pol H holoenzyme complex has been also purified fi'om human cells (144),
suggesting that the recruitment of the holoenzyme by activators might be an
evolutionarily conserved mechanism [reviewed by (95)]. Kinetic and thermodynamic

questions arising from the two competing models have not been fully resolved. How

13

could the stepwise assembly occur quickly enough (given diffusion parameters for each
component) for efficient transcriptional activation? And yet, how can a complex the size
of the holoenzyme be translocated to specific genes at Specific times quickly enough to

respond to transcriptional activation?

1.1.3.2.]. Mediator complex.

The mediator complex, first identified as a component of the yeast RNA Pol H
holoenzyme (138), is composed of ~20 subunits forming three major domains (Gal 11,
Med9/10 and Srb modules) that wrap around the RNA Pol H [reviewed by (25, 209)].
Homologues of the yeast mediator subunits and similar protein complexes have Since
been identified in a wide range of organisms. Mammalian protein complexes resembling
yeast mediator were described independently by several laboratories using biochemical
purifications of proteins stably bound to different activator proteins (reviewed by (185,
235). These different purifications lead to very similar complexes (variously termed
TRAP, DRIP, ARC, CRSP, SMCC and PC2) suggesting that different activators bind the
same or highly related human mediator complexes. The slight differences in protein
compositions of these human mediators might represent variations due in differences in
the biochemical purifications or might represent different forms of the mediator complex

that associate with different activators.

Several activators are known to interact physically and functionally with the

mediator complex and the particular mediator subunits involved in these interactions are

14

being identified. For example, the p53 tumor suppressor protein interacts with the
TRAP80 subunit of the human mediator complex whereas the thyroid hormone receptor
and PPARyZ interact with TRAP220 (79, 112). The VP16 activation domain may
associate either with TRAP80 or with ARC92 (112, 201). Interferon-stimulated
transcription depends on an interaction of STAT3 with the DRIP150 mediator component
(163). These and other examples indicate that the mediator complex can be considered as
a modular interface connecting activators with RNA Pol H allowing the integration of

different signals during transcriptional activation.

1.1.4. Chromatin and Chromatin-modifying coactivators.

Transcription activation must overcome the physical barriers presented by the
packaging of eukaryotic DNA into chromatin. It is now clear that histones are not only a
static scaffold for the compaction of DNA but rather they participate actively in the
regulation of gene expression. Transcriptional activators affect chromatin with at least
the assistance of two general classes of coactivator proteins. Some of these coactivators
are enzymes that covalently modify amino acids within the histones themselves. These
modifications then either directly alter chromatin structure, or serve as recognition signals
for binding additional proteins that modulate that structure (110). Other coactivators use

the energy of ATP to remodel chromatin by Sliding or removing nucleosomes.

15

1.1.4.1. Covalent modifications of histones.

Covalent modifications that have been identified in histone proteins include
acetylation, methylation, phosphorylation, ubiquitinylation, and ADP- ribosylation
[reviewed by (18)]. The panoply of such modifications on the various histones has been
likened to a “code” (119, 269) that, when deciphered and integrated, signals whether and
how strongly a given gene is to be expressed. This code might be considered in several
levels. First, any given modification at a given position on a given histone might either
be present or absent. This implies the existence of complementary enzymes that either
put on or take off the modifying mark. Second, at any given nucleosome or at several
nucleosomes in any given promoter, various sets of such signals might be present. Third,
the signals might occur sequentially -— that is, one modification might serve as a signal to
permit or stimulate another, or conversely one modification might block or inhibit the
deposition of another. In recent years much effort has been dedicated to correlate
specific histone modifications with the levels of gene expression of particular loci. The
mechanisms involved in “reading” this histone code might involve the binding of proteins
to a particular histone modification or to specific combinations of these modifications.
For instance, bromodomains and chromodomains, present in many transcription factors,
can bind acetylated and methylated histones respectively. The bromodomain of the
histone acetyltransferase GCNS can itself bind to acetylated histone H3 peptides (108),
which might contribute to the stability of these complexes at promoters of actively
transcribed genes (98). The heterochromatin protein HP], through its chromodomain,

binds methylated H3-K9, a modification prominent in heterochromatin regions. In

16

contrast, the chromodomain present in the Polycomb protein binds to methylated H3-
K27, demonstrating that different chromodomains can bind different methylated residues

in the histone proteins (74, 197).

1.1.4.1.]. Acetylation

Hyperacetylation Of the amino-terminal tails of histones (especially of H3 and
H4) is generally correlated with gene activation, and conversely hypoacetylation is
associated with gene repression [reviewed by (248)]. The acetylation of the e-amino
group of lysine residues by HATS neutralizes the positive charge of the lysine side chain,
which may affect the affinity of histones for DNA, altering the packaging of the
chromatin, or may affect protein-histone interactions contributing to the recruitment of
specific transcription factors to active promoters. An important connection between
histone modification and transcriptional activation was made when genetic evidence for
transcriptional coactivator proteins was linked to biochemical evidence for histone
acetylation (31, 188). The first of these enzymes identified was GCNS, a histone
acetyltransferase (HAT) present in the yeast multiprotein complexes termed SAGA and
ADA. GCNS is recruited to promoters by activators and contributes to the
hyperacetylation Of histones associated with the promoter region during transcriptional
activation (156, 162). Homologs of the yeast GCNS in other organisms play similar roles
in transcription regulation, implying conserved mechanisms of regulation through

evolution (37, 158, 292).

17

Several distinct families of evolutionarily conserved HATS have been identified in
a wide range of organisms [reviewed by (41)]. These groups include the GNAT family
(QCNS-related N—acetyltransferase), the MYST family (MOZ, be2/Sa33, §a82 and
Iip60), the highly related p300 and CBP coactivators, and the basal transcription factors
TAF 1 and TFIIIC. A major challenge is to define the roles for each family and each
member of those families, including which sites on which histones serve as substrates;
which genes are affected by acetyltransferase activity; and which regulatory proteins
establish those effects. This challenge is made more difficult because the various HATS

likely have both unique and overlapping activities.

Intriguingly, many of these HAT enzymes can also acetylate substrates other than
histones and might thereby alter (either positively or negatively) the function of the target
protein. Known non-histone substrates include activator proteins such as p53, c-Myb,
E2F, GATA-l , and MyoD; the general transcription factors TFIIE and TFHF; and the
high-mobility-group (HMG) chromatin-associated proteins [reviewed by (268)]. Thus the
relevant in viva substrates of a particular HAT might not necessarily be restricted to the

bistones.

1.1.4.1.2. Methylation.

Methylation of histones occurs on both Arg and Lys residues, most prominently
in histones H3 and H4 [reviewed by (145)]. Individual Lys residues can accommodate
one, two or three methyl groups, and each isomer can exert a distinct and separate

downstream effect. In contrast to histone acetylation, which typically is associated with

18

transcriptionally active genes, methylation of certain histone amino acids corresponds to
active loci whereas methylation of other residues is associated with inactive genes or
even heterochromatic regions (96). Thus, methylation of Arg3 of histone H4 is
associated with transcriptional activation, as is methylation of lysines 4, 36 and 79 of
histone H3. In contrast, methylation of lysines 9 and 27 of histone H3 or of Ly320 of
histone H4 are correlated with transcriptional repression or silencing. Interestingly,
histone methylation is not associated solely with nucleosomes near the promoter, but
extends throughout the coding region of the gene. For instance, trimethylation of H3-K4
by the Set-1 enzyme is a mark of the early phase of transcriptional elongation (218)
whereas Set-2 methylation of H3-K36 seems to mark subsequent stages of elongation

(150).

Discrete enzymes are responsible for methylating different amino acids in the
histones. The Arg methyltransferases best known for their transcriptional role are
CARMl and PRMTl , both especially prominent as coactivators for nuclear hormone
signaling (319). The Lys-specific histone methyltransferases typically possess a
conserved catalytic domain known as the SET domain originally found in the SUV39,
E(Z) and trithorax proteins of Drasaphila (161). Curiously, whereas the enzymes that
attach other covalent modifications all have complimentary removal enzymes (histone
deacetylases or phosphatases, for example) no histone demethylase have yet been
described (13). Interestingly, an alternative activity has been recently described that
might serve as the enzyme responsible for Arg demethylases. The human enzyme

peptidylarginine deirrrinase 4 (PAD4/PADI4) can catalyse the deirnination of methylated

19

arginines to produce citrulline resulting in the removal of the methylation mark (55, 297).

The fate of the citrulline-containing nucleosomes is still unknown.

1.1.4.1.3. Phosphorylation.

Phosphorylation of histones, most notably at Ser10 of H3, has been correlated
with both mitotic condensation of chromosomes and activation of gene expression in
yeast, insects and mammals (45, 176, 220). For transcriptional activation, this
modification stimulates the subsequent acetylation of H3 Lysl4 (177). Several kinases
responsible for the phosphorylation of H3 Ser10 have been identified. In yeast, SNF-1
phosphorylates H3-S l 0 during transcription activation of genes involved in the
biosyntbesis of inositol (176). In mammalian cells, the immediate early response to EGF
through the MAP kinase pathway results in the phosphorylation of H3 at the c-fos and
c-jun gene promoters by the MSKl and MSK2 kinases (45, 264, 281). The Ikk-or is the
kinase responsible for the phosphorylation of H3 at promoters of NF-kB-regulated genes
during cytokine-induced gene expression (7, 321). The Aurora family of H3 kinases is
responsible for mitotic phosphorylation (222). Histone phosphatases have also been
identified, most notably the Glc7 protein (73), but their roles in chromatin modification

and gene regulation are relatively poorly defined at this point.

1.1.4.1.4. Ubiquitinylation.
Ubiquitinylation is another covalent modification observed in histones. Histones
H2A and H2B are most often the targets of this modification, although ubiquitinylation of

H3 and H1 has also been described. In contrast to the ubiquitin-proteasome proteolytic

20

pathway, in which multiple ubiquitin moieties might be added, histone ubiquitinylation
typically comprises addition of a single group and does not seem to be associated with

protein degradation [reviewed by (207)].

Monoubiquitinylation of histones might affect higher-order chromatin folding or
might affect histone-protein interactions by creating binding sites for particular
transcription factors [reviewed by (328)]. In yeast, transcriptional activation by Gal4
depends (in part) on both ubiquitinylation of HZB (by the ubiquitin ligase Rad6) and on
subsequent removal of the ubiquitin by a Ub-Specific protease, pr8. This latter enzyme
is a component of the SAGA complex which also contains the GCNS histone
acetyltransferase, suggesting an intimate relationship between histone ubiquitinylation
and acetylation. Failure either to add or remove ubiquitin results in diminished gene
activation and in altered levels of gene-associated methylation of Lys4 and Ly336 of

histone H3, both modifications linked to transcription activation (104).

1.1.4.2. ATP-dependent chromatin remodeling complexes.

The second general class of chromatin-modifying transcriptional coactivators is
composed by the ATP-dependent chromatin remodeling complexes. These multiprotein
complexes use the energy from ATP to “remodel” chromatin by mechanisms that include
alterations of DNA-histone contacts. The ATPase subunits of these complexes belong to

the SNF2-like family of ATPases and can be classified in different subfamilies according

21

to the presence of other protein motifs such as bromodomains, chromodomains and
SANT domains [reviewed by (64, 212)]. These complexes have both common and
distinctive biochemical characteristics and are involved not only in transcription
activation but also in other cellular functions that involve unwrapping of DNA such as

DNA repair, homologous recombination and chromatin assembly [reviewed by (184)].

ATPases of the SNF2 subfamily contain a bromodomain and in general are part of
multiprotein complexes of approximate 10-12 subunits designated SWI/SNF and RSC in
yeast and Brahma in Drasaphila. SWI/SNF subunits were identified in yeast genetic
screens focused on mating type switching (SW1 alleles) or sucrose metabolism (sucrose
non-fermentable alleles, SNF). These protein complexes can relocate nucleosomes, alter
DNAase accessibility patterns and alter the superhelicity of DNA in vitra [reviewed by
(212)]. The human genome encodes two SNF2 homologs, BRG-l and BRM, present in
similar but distinct protein complexes. These complexes regulate different set of genes as
demonstrated by the variations in mutant phenotypes. In yeast, SWI/SNF seems to
control approximate 5% of yeast genes whereas RSC seems to play a more global effect
in gene regulation (217, 270). In mice, null mutations of the Brg-l gene result in death of
homozygotic embryos during the peri-implantation stage, whereas BRM-l- mutant mice
develop normally although cell proliferation seems to be misregulated (33, 242). The
recruitment of SWI/SNF to gene promoters by activators has been observed in viva and in
vitra, in biological systems ranging fiom yeast to human. Mammalian activators

including nuclear receptors, erythroid Kruppel-like factor, C/EBPB, c-Myc, MyoD, HSF-

22

l and viral activators such as EBNA2 and VP16 are known to recruit human SWI/SNF

complexes during transcriptional activation [reviewed by (212)].

Members of the ISWI subfamily of ATPases contain a SANT domain and are
present in complexes comprising 2-4 subunits. These complexes include NURF,
CHRAC and ACF from Drasaphila, and vertebrate complexes such as RSF, hACF,
hCHRAC and NORC. Biochemical characterizations indicate that several of these
complexes are involved in the assembly of chromatin [reviewed by (184)]. Members of
the CPD] subfamily of ATPases are characterized by the presence of a chromodomain
and are present in complexes including NurD and Mi-2. These complexes also contain
HDAC activities and are known to be recruited by certain repressor proteins (136, 255).
The yeast In080 and Swrl ATPases comprise another subfamily. In080 is present in a
large multiprotein complex that also contains DNA helicase activity. This complex is
involved in transcription of genes encoding enzymes for phospholipid biosyntbesis and
also of genes such as PHOS, GAL], CYCl and ICLl involved in unrelated pathways
(63). Besides its role in transcription, this complex seems to play a role in DNA damage
repair (261 ). The Swrl ATPase is present in a complex that is able to exchange histone
H2A variants (202). Other ATPases known to have chromatin-remodeling activities
include the Arabidopsis DDMl , involved in maintaining normal levels of DNA
methylation (117); Rad54, involved in homologous recombination (S); and CSB

(Cockayne Syndrome protein B) involved in DNA excision repair (49).

23

The mechanisms of these remodeling activities are not yet fully understood but
include local and stable alterations of the DNA-histone contacts leading to sliding of
nucleosomes along the DNA or transfer of nucleosomes from one DNA to another in
trans. These protein complexes can also alter the superhelicity of DNA in vitra [reviewed
by (212)]. Repositioning of nucleosomes may alleviate chromatin-mediated transcription
repression, for example by exposing DNA binding sites for additional activators or by
exposing core promoter elements that might be critical for the binding of general

transcription factors and the formation of the pro-initiation complex.

1.1.4.3. Chromatin dynamics.

Chromatin remodeling occurring during transcription activation might not only
involve covalent modifications of histones and localized modifications of histones-DNA
contacts, but also seems to involve more dramatic histone dynamics. Accumulating
evidence indicates that histones might be actively exchanged during activation of genes.
The histone H3 is exchanged with the histone variant H3.3 during transcription activation
in Drasaphila and human cells by DNA replication-independent mechanisms (3, 116,
275). The histone H2A-H2B dimers are destabilized by the elongating RNA Pol H in
vitra in a process facilitated by the FACT complex (17, 139). Collectively this evidence
indicates that the histone content or composition at a particular locus can vary during

transcriptional activation and outside of S-phase.

24

The loss of histones during transcription activation has been observed at the PhoS
promoter in Saccharamyces cerevisieae (23, 239). The displacement of histone H3 occurs
upon transcriptional activation and is reversed during transcriptional repression (2). The
mechanism for the loss of histones in this promoter involve histone disassembly rather
than histone sliding (24) and requires the activity of the histone chaperone Asf-l (2).
Genome wide analyses of yeast promoters have recently revealed that nucleosome

depletion is a wide spread phenomena occurring at the promoters of active genes (21,

165).

1.1.5. Post-initiation effects of activators.

Although most studies of transcriptional activation have focused on recruitment
and initiation, subsequent steps including promoter escape and elongation can also be
stimulated by activator proteins. Several lines of evidence indicate that activators might
also work in post-initiation steps. One well-characterized example corresponds to the
human and Drasaphila gene encoding heat shock protein 70 (hsp70). The uninduced
hsp70 gene contains a paused polymerase near the 5’ end of the gene. In response to heat
shock, not only does the transcriptional initiation rate increase, but the pausing time is
dramatically reduced (29, 249). Transcriptional activators can also stimulate rates of
transcriptional elongation. For example, the heat shock factor-1 (HSF-l) involved in the
activation of hsp70 gene and the viral activators VP16 and ElA can stimulate elongation

by mechanisms that apparently different from that of stimulation of initiation (30, 324).

25

The interaction of VP16, HIV tat, c-myc, and NF-kB with the elongation factor P-TEF b
(a kinase that modifies the carboxyl-terminal tail of RNA Pol II) further illustrates this
link (14, 47, 128, 129, 157). These post-initiation effects of activators might be regulated
by covalent modification occurring during transcriptional activation. The ubiquitinylation
of LexA-VP16 enhances the interaction with P-TEFb and rescues the elongation defect of
the mutant LexA-VPI 6F 422A indicating that ubiquitylation of activators might help

stimulating transcription elongation (157).

Transcription and RNA processing have often been considered as separate and
sequential events, but a more recent perspective views these as a single integrated
pathway [reviewed by (230)]. Capping, splicing and polyadenylation are tightly coupled
to RNA Pol H through the carboxyl-terminal domain of the largest subunit (reviewed by
(186). Selection of splice sites in the nascent RNA can be influenced by promoter
elements in a manner that is independent of the promoter strength, suggesting that

activators might also regulate alternative splicing decisions (53) (9) (219).

1.2. Transcriptional activation of herpes simplex virus genes.

1.2.1. Herpes viruses.

Viruses from the Herpesviridae family infect most animal species and those that

infect humans include pathogens such as herpes simplex virus type 1 (HSV—l ), herpes

26

simplex virus type 2 (HSV-2), varicella-zoster virus (V ZV), cytomegalovirus (CMV),
Epstein-Barr virus (EBV) and Kaposi’s sarcoma-associated herpes virus (KSHV).
Viruses from the Herpesviridae family are formed by a double-stranded DNA genome
enclosed in an icosahedral capsid of approximately 100-110 nm in diameter. The capsid
is contained within a lipid envelope of cellular origin that contains glycoprotein spikes on
its surface. Between the capsid and envelope is the tegument, which is the structure

containing viral proteins involved in the initial steps in the subsequent infection (246)

Viral genomes fiom the Herpesviridae family encode a large number of enzymes
involved in nucleic acid metabolism and DNA synthesis including DNA polymerases,
helicase and primase. The synthesis of the DNA and assembly of the capsid occur in the
nucleus of the cell. Herpesviruses are able to establish lytic and latent infections in their
natural host. The production of the newly synthesized virion particles during lytic
infection results in the destruction of the infected cell. The specific cell type that is
infected during lytic and latent cycles varies among different herpesviruses. The
Herpesviridae family is divided into three subfamilies according to different biological

properties: Alphaherpesvirinae, Betaherpesvirinae and Gammaherpesvirinae (246).

1.2.2. Herpes simplex virus 1.

HSV-l is a prototypical virus in the subfamily Alphaherpesvirinae. This

subfamily is characterized by broad host range, relatively short reproductive cycle, rapid

27

spread in culture, efficient destruction of infected cells and capacity to establish latent

infections in sensory ganglia (20).

Primary infections by HSV-1 usually occur at mucosa] and skin surfaces. The
histopathologic characteristic of a skin lesion caused by HSV infections include
alterations of the cell membranes and changes in the chromatin structure within nuclei
followed by degeneration of nuclear structures. Infection by HSV-1 also results in the
fusion of plasma membranes leading to the formation of multinucleated cells or
polykaryocytes. After cell lysis, clear fluid containing viruses, cell debris, inflammatory
cells and multinucleated cells accumulate between the epidermis and dermal layer

forming vesicles (243).

HSV-1 can enter the sensory nerves near primary infection sites and establish
latency by unknown mechanisms. In latently infected neurons, the genome remains
mostly Silent expressing only the latent associated transcript (LAT). During latency the
viral genome stays as a circular and extrachromosomal DNA packaged into nucleosomal
structures (60, 194). Reactivation of the latent virus can be induced by several stimuli
through molecular mechanisms not well characterized and seems to require the IE protein

ICPO and LAT [reviewed by (20)].

1.2.2.1. Virion structure.

28

The HSV-1 virion particle contains approximately 30 different types of proteins.
About 10 of these proteins are membrane proteins present in the envelope of the virus
(Figure 1A). These membrane proteins are usually glycosylated and include proteins
known to be involved in attachment of the virus to the cell surface (such as glycoprotein
C) and for the viral entry (such as glycoprotein B, H and L) [reviewed by (265)]. The
capsid is formed by four predominant viral proteins, VPS, VP19C, VP23 and VP26
where VP5 is the major structural component of the capsomers [reviewed by (106)]. The
remaining virion proteins are present in the tegument. These proteins are delivered to the
newly infected cells helping to start the new infection cycle. Among these tegument
proteins delivered to the infected is the viral trans-activator VP16, VP13-14, virion host

shutoff (VHS) and VP1-2.

1.2.2.2. Viral genome.

HSV-1 is a relatively large DNA virus encoding genes involved in regulation of
gene expression, DNA replication, virion structme and assembly. The herpes virus
contains a linear double-stranded DNA genome of about 150 kbp and is formed by two
unique segments of DNA referred as unique long (UL) and unique short (Us) (Figure 1B).
These turique fiagments are flanked by inverted repeated DNA segments (RL and R3).
The inverted repeat sequences of RL are designated ab and a’b’ and the repeats of RS a’c’

and ca. The viral DNA is linear in the virion particle and whether it becomes circular

29

 

 

 

 

 

‘ Glycoprotein
Envelope
‘ Capsid
DNA
Tegument
100 nm
B.

1 UL Us 150Kbp
9 9 <- 4- 9 4- 9 IE
rceo rcez7 rcpo ICP4 rem

rcpzz rce47
‘-
TK ] DE
9 <- L
90 VP16

Figure l. HSV-1 structure. (A) HSV-1 virion particle is formed by a double-stranded
DNA genome enclosed in the capsid. The capsid is contained vvitbin a lipid envelope.
The structure between the capsid and the envelope is referred as the tegument. (B) HSV-1
viral DNA is composed of two unique sequences (U L and Us) flanked by inverted repeats
RL and Rs (closed boxes). The approximate location and orientation of the IE genes and
selected DE and L genes are shown by arrows.

30

upon entry to the nucleus remains controversial (114, 226, 252). The HSV-l genome
codes for approximately 80 polypeptides expressed in a temporal cascade during lytic
infection [reviewed by (303)]. The viral DNA stays episomal and seems to be primarily
non-nucleosomal druing lytic infection. Nuclease assays have shown that little or none of
the viral DNA delivered to infected cells was digested to fiagrnent Sizes consistent with
nucleosomes (166, 167, 205). Electron microscopy studies showed the accumulation of
non-nucleosomal DNA in infected cells (206). Viral DNA was localized to an
interchromosomal space that excludes cellular chromatin (233) and does not incorporate
histone H2B (203). Moreover, the viral DNA in the virion particle is not associated with

histones but with polyamines sperrrridine and Spermine (82, 225)

This mostly non-nucleosomal character of the DNA is restricted to lytic infection
since during latent infections herpes simplex resides as a episomal circular DNA
associated with histones (60). A large part of the evidence indicating HSV-1 as non-
nucleosomal has been obtained at later times during infection, reflecting the nucleosomal

status of the progeny or newly synthesized DNA.

1.2.2.3. Cascade of viral gene expression.

The temporal cascade of viral gene expression can be broadly divided into three
main classes: immediate early (IE), delayed-early (DE) and late (L) genes. The IE genes

namely ICPO, ICP4, ICP22, ICP27 and ICP47 were initially identified as viral genes

31

expressed upon infection in the absence of de nova protein synthesis [reviewed by (303)].
ICP4 is essential for virus replication in experimental conditions and is required for the
efficient expression of DE and L genes. The ICP4 activation domain and DNA-binding
domain have been mapped, however no clear consensus binding site has been identified
on DE and L gene promoters. The ICP4 activation domain can interact with general
transcription factor TFHD providing an explicit mechanism by which ICP4 might be

helping the recruitment of the preinitiation complex at viral promoters (40, 92).

ICPO is known to transactivate viral and cellular gene promoters. No cis element
has been identified as responsible for the recruitment of this protein to target promoters.
ICPO is a RING-finger containing protein and possesses ubiquitin conjugating enzyme
activity (E3)(303). During infection, ICPO is required for the disassembly of nuclear
domain NDIO, a process that involves the degradation of specific proteins such as PML
and Sp100 through the ubiquitin-proteasome system. These observations connect the E3
ligase activity of ICPO with a known early event in viral infection requiring the Ub-
proteasome pathway (94). The increasing evidence connecting transcriptional activation
with the Ub-proteasome pathway in eukaryotes and the known role of certain E3 ligases

as coactivators suggest that ICPO might be a coactivator during viral gene expression.

ICP27 is another IE gene essential for viral replication. Current evidence indicates
that ICP27 regulates gene expression at the post-transcriptional level. ICP27 contains an
RNA binding domain and has been shown to regulate 3’ RNA processing, inhibit RNA

splicing and stimulate the nuclear export of intronless viral mRNAs. The roles of ICP22

32

and ICP47 protein are by comparison less understood. ICP22 is involved in the efficient
expression of a subset of late genes and it is known to alter the phosphorylated status of
RNA Pol H. ICP47 is known to inhibit the process of presenting antigenic peptides on
the cell surface [reviewed by (94, 303)]. The IE promoters are the most complex herpes
gene promoters in terms of cis elements that are required for proper temporal expression.
Each of the IE promoters contains a different arrangement ofVP16 responsive cis
elements (TAATGARAT), TATA box, and binding sites for cellular activators Spl and

GABP (Figure 2).

The DE genes are the second group of genes to be expressed during lytic
infection. Abundant levels of mRN A for DE genes are detected at 3-4 hours post-
infection [reviewed by (303)]. The promoter region of the thymidine kinase (TK) gene,
one of the prototypical DE genes, contains Spl binding sites, CAAT elements and a
TATA box element (Figure 2). The expression of the DE genes requires IE proteins

although the binding sites for viral activator such as ICP4 have not been identified.

The third group of viral genes to be expressed are the L genes. This group can be
subdivided into leaky-late and true-late genes depending on whether viral DNA
replication is absolutely required for their expression. True-late gene promoters usually
contain a TATA box and Initiator (Inr) element and sometimes downstream promoter
elements (Figure 2). Leaky-late genes contain additional cis elements upstream of the
core promoter. VP16 is an example of leaky-late genes whereas gC is a true-late gene. L

gene expression is readily detected about 6-8 hours post infection. The mechanisms

33

linking DNA replication with late gene expression are unknown. The different promoter
architecture of viral genes may result in the differential requirement of cofactors that are
necessary for viral gene expression. The increasing simplicity of viral promoter from IE
to L suggests that fewer transcription factors may be necessary later in infection in order

to activate the expression of viral genes.

1.2.3. Activation of viral IE genes during infection.

1.2.3.1. Virion protein 16.

The virion protein 16 (V P16) is part of the tegument in the virion particle and is
present at an estimated number of 1000-1500 copies per virion (102, 266). VP16
translocates to the nucleus by uncharacterized mechanisms where it activates the
transcription of the IE genes. The activation of the IE genes triggers the cascade of viral
gene expression resulting in lytic infection. VP16 binds the IE promoter in a complex
with two cellular proteins, Oct-1 and HCF-l , at the TATGARAT elements present at the
IE promoters. This ternary complex formed at the IE gene promoters is referred as the
VP16 induced complex (VIC) (147, 229, 267, 316).

VP16 does not have a DNA binding domain and does not bind DNA in a
sequence-specific manner. However, basic residues on the surface of VP16 apparently
make DNA contacts in the context of the VP16 induced complex (10). VP16 is a 490 aa

protein comprising a core domain (1-410 aa) and an acidic activation domain at the C-

34

Immediate early

promoters
III I I I I m
VIC VIC GABP Sp1 TATA ICP4
Delayed early

promoters E

Sp1 CAAT Sp1 TATA

 

Late

promoters g

-200 -100 -50 TATA Inr Downstream
Activation
site

Figure 2. Schematic representation of three temporal classes of HSV-1 gene promoters.
Immediate early (IE) gene promoters contain binding Sites for the VP16-induced complex
(VIC) Shown in closed boxes. IE gene promoters also have a TATA box element and
binding sites for cellular activators GABP and Sp] and viral activators ICP4. Delayed
early (DE) gene promoters contain typically contain a TATA box element and binding
sites for cellular activators such as Sp] binding sites and CAAT elements. Late (L) gene
promoters usually contain only the core promoter elements TATA box, Initiator (Inr) and
downstream activation site. Figure modified fi'om J. Weir (2001) Gene 271: 117.

35

terminal and (aa 413-490). The core domain is involve in the interaction with HCF-l and
Oct-1 in the VIC and the activation domain of VP16 is required for the efficient
activation of the IE genes both in transfection experiments and during HSV-1 infection

(1,276,283,295)

A virus carrying a 12-base pair DNA insertion in the VP16 gene shows reduced
levels of IE expression and results in a high particle to plaque forming unit ratio at low
multiplicity of infection (1). This DNA insertion results in additional 4 amino acids in the
VP16 core domain and abolishes the interaction with Oct-1 in vitra (1). The 8MA HSV-1
virus strain with the VP16 gene replaced by the Lac-Z gene is not viable and must be
grown on a complementary cell line expressing VP16. In the absence ofVP16 delivered
in trans, the 8MA virus does not replicate, but Shows the accumulation of immature
virion particles indicating a role of VP16 in virion assembly and maturation (300). A
viral strain carrying temperature sensitive mutations on VP16 gene (C78A, C102A and
C176A) also resulted in low yield of infectious particles at non-permissive temperature
apparently due to problem in virion maturation (228). These experiments revealed that
VP16 also plays a role in virion assembly and maturation (300). The HSV-1 viral strain
RPS contains a deletion in the VP16 activation domain and shows reduced and altered
levels of IE gene expression and high ratio of particle to plaque forming unit (263, 276,
323). Collectively, this evidence indicates that VP16 is required for the efficient
activation of IE genes early in infection as well as for the correct virion assembly during

late times of infection.

36

1.2.3.2. VP16 induced complex.

Oct-1 confers most of DNA binding capability to the VP16 induced complex. The
Oct-1 DNA binding is formed by a POU-specific domain and POU-homeo domain that
binds the TAATGARAT element on IE gene promoters [reviewed by (313)]. This
bipartite DNA binding domain not only is present in Oct-1 but also in other transcription
factors including Bit-1, Oct-2 and fine-86 and thus its denomination as the POU domain.
The POU-homeo domain of Oct-1 also interacts with VP16, helping in the formation of

the VIC at the responsive elements present in the IE gene promoter (267).

Host cell factor 1 (HCF-l) was identified as a VP16 interacting protein and is
required for the stability of the VP16 induced complex (80). HCF-l is a 2035 a protein
cleaved post-translationally into two subunits (HCF -1N and HCF-lc) that remain
associated through non-covalent interactions (148, 308). Several domains have been
mapped in HCF-l including the Kelch domain required for VP16/Oct-1 interaction, SAS
domains (self association sequences), a basic and acidic region and an activation domain
that cooperates with VP16 to activate transcription (179, 313). HCF -1 has been shown to
interact with several other protein including cellular activators GABP, Spl and LZIP and
with coactivator proteins. The basic domain of HCF-l interacts with Sin3 histone
deacetylase complex and the Kelch domain with SetllAsha histone methyltransferase
complex (314). Besides its role in [B gene expression during infection, HCF -1 seems to
be involved in promoting cell growth and division (88, 313). The molecular mechanism

involved in controlling cell growth might include HCF-l as coactivator of cellular

37

activators LZIP and GABP, and as corepressor of the cell cycle arrest inducer Miz—l

[reviewed by (313)].

1.2.4. VP16 as a model transcriptional activation domain.

The activation domain of VP16 (VP16AD) has been extensively studied as a
model of acidic transcriptional activators, usually fused to a heterologous DNA-binding
domain (e. g. Gal4-VP16AD). Different studies have shown the interaction of VP16AD
with general transcription factors, including TFIIA, TFIIB, TFIIH and TBP. This
suggests that VP16AD may activate transcription by increasing the affinity of RNA Pol II
to a particular promoter through its direct interaction with general transcription factors
(84, 111, 140, 213, 260, 315). Consistent with this model, in vitra experiments have
demonstrated the ability of VP16AD to promote the formation of the ternary complex

formed by TFIIA, TFIID, and TATA box (141).

VP16AD can also interact with coactivator, adaptor and mediator proteins.
Mutation of the Ada2 gene relieves the toxicity produced by overexpression of Gal4-
VP16AD in yeast, suggesting functional interaction between VP16AD and the yeast
HAT—containing coactivator complexes ADA/ SAGA (19). Moreover, the VP16AD can
interact physically and functionally with SAGA/ADA complex in vitra (98, 291). AdaZ
protein and more recently Tra] , components of the HAT-containing coactivator complex

SAGA/ADA and NuA4, have been implicated as direct VP16AD targets (15, 28).

38

VP16AD also interacts physically and/or functionally with another yeast HAT-containing

coactivator NuA4 complex (285, 291).

In mammalian cells, Gal4-VP16AD interacts with two highly related HAT
coactivators CBP and p300. In vitra, Gal4-VP16 requires p300 to activate transcription
from chromatin templates and in transfection experiments Gal4—VP 1 6 activity is
augmented by increasing amounts of CBP and p300 encoding plasmids (146, 154, 296).
Moreover, GST pull-down assays have Shown the direct interaction of VP 1 6AD with
CBP and p300 (296). The activity of Gal4-VP16AD in transfection experiments is also
augmented by the human homologues of yGCNS (hGCNS and PCAF) and yADA2
proteins (3 7, 296). Moreover, targeting the VP16AD to an heterologous locus in

mammalian cells result in the recruitment Of CBP, p300, PCAF and GCNS (195).

VP16AD also interacts with TAF 9, another type of coactivator protein present in
TFIID and SAGA complexes (140, 284). Another type of coactivators are the ATP-
dependent chromatin remodeling complexes. The Gal4- VP16AD also have been shown
to interact in vitra with the yeast SWI/SNF complex (97, 214) and in viva LexA-VP16AD
recruits mammalian SWI/SNF to an heterologous promoter integrated into condensed

chromatin (195).

The mediator complex also has been proposed as the direct target of VP16AD in
the cellular transcriptional machinery. Trap80 (MED17) component of the mediator-like

TRAP/SMCC complex was the first mediator subunit identified as VP16AD target by

39

testing a limited mediator subunit set using GST pull-down assays (112). Recently, more
extensive analyses of VP16AD interactions with the mediator complex identified the

ARC92 (MED2S) subunit as direct target of VP16 in the mediator complex (20], 322).

The VP16AD can be divided into two sub-domains each capable of activating
transcription when artificially targeted to a promoter. These two sub-domain, namely
VP16N (aa 410 to 456) and VP16C (aa 450 to 490) seems to utilize different mechanism
to activate transcription as suggested by their functional and structural differences.
VP16C but not VP16N can interact with TFIIA and TAP 9 in in vitra assays (84, 140) and
can stimulate TFIIA-TFIID complex assembly (142). Moreover, the different patterns of
acidic amino acids surrounding the critical phenylalanines residues of VP16N and
VP16C are consistent with distinct mechanism of action (54, 238, 272). The presence of
these two sub—domains in the VP 16AD might be in part responsible for the ability of

VP16 to interact with multiple targets.

The large list of putative targets for the VP16AD raises the question of which
interactions are relevant or most important in viva. The association of chromatin-
modifying complexes with VP16AD in heterologous systems is particularly intriguing
since the viral DNA does not seem to be packaged in nucleosomes during lytic infection
(for references see section 1.2.2.). Thus, there would seem to be no reason for VP16 to
recruit an ATP-dependent chromatin remodeling complex such as SWI/SNF or a HAT-
containing protein complex such as human GCNS to a non-nucleosomal IE promoter.

Several alternatives may explain these apparently contradictory observations. VP16

40

might require chromatin-modifying coactivators during activation of IE genes to serve
roles other than chromatin remodeling. Perhaps some of these coactivators are essential
structural components of the preinitiation complex. Alternatively, some of the enzymatic
activities of these chromatin remodeling complexes could use substrates other than
histones. For instance, several HATS are known to acetylate general transcription factors,
activators or HMG proteins. Thus in some cases the relevant in viva target for the

acetylase activity may not be histones.

The association ofVP16 with chromatin-modifying coactivators might indicate
that histones are associated with viral DNA and thus chromatin remodeling might play a
role during transcriptional activation of viral genes. The failure to effectively detect
nucleosomes on viral DNA might be a result Of low levels of histone occupancy on viral
DNA or fiom the difficulties of detecting a small fiaction of the incoming DNA being

associated with histones.

Another alternative is that VP16 might not require chromatin-remodeling

coactivators to activate transcription from a non-nucleosomal viral DNA template. Then

the interactions of VP16 with chromatin remodeling complexes observed in heterologous

or in vitra might not reflect the in viva mechanisms used by VP16 during infections.

1.3. Main hypothesis and experimental setting.

41

The main objective of this doctoral thesis research is to explore the role of
chromatin modifying coactivator proteins in activation of IE genes by VP16 during
herpes simplex virus infection. To that end, chromatin immunoprecipitation assays were
adapted to study the recruitment of cofactors to the IE gene promoters during herpes
simplex infection of cultured cells. Using this approach, the presence of selected
activators, general transcription factors and coactivators proteins on IE gene promoters
was tested. The dependence on the activation domain of VP16 for the recruitment of
different transcription factors was tested by using the RPS viral strain lacking the VP16
activation domain. The association of histones (histone H3) with incoming viral DNA
was also tested using ChIP assays. The fimctional role of selected chromatin remodeling
complexes was explored by trying to alter their expression levels with overexpression and
RNAi strategies followed by HSV infections and RT-PCR to quantify IE gene
expression. The results of these experiments indicate that, contrary to prevalent models,
chromatin transactions might play an important role during the expression of viral genes

at early times during infection.

42

Chapter 11

Recruitment of transcription factors to IE viral promoters during HSV-1 infection2

2.1. Introduction.

The activation domain of VP16 (VP16 AD) from herpes simplex virus type I
(HSV-1) has been widely used as a model for the study of transcriptional activation in
eukaryotes. During infection, VP16 triggers the cascade of viral gene expression by
activating transcription of the viral immediate-early (IE) genes (303). VP16 forms a
DNA-binding complex with the cellular proteins Oct-1 and HCF-l at specific cis
elements present in the IE gene promoters (147, 229, 267, 316). The patent activation
domain of VP16 (52, 283), often artificially fused to a heterologous DNA-binding
domain (250), can activate transcription in a wide range of organisms including yeast,
insects, plants and mammals (19, 250, 286, 306) indicating that mechanisms of

transcriptional activation are broadly conserved through evolution.

Interactions of the VP16 AD with general transcription factors (GTFS) including
TFIIB, TFHH, TBP and TBP-associated factors (TAFS) suggest that the VP16 AD might
activate transcription by stimulating the assembly of an RNA polymerase 11 (RNA Pol H)
pro-initiation complex (84, 11], 140, 173, 284, 315). Consistent with this model, in vitra
experiments have demonstrated the ability of the VP16 AD to promote the formation of

the ternary complex formed by TFHA, TFIID, and TATA box DNA (142). Other

 

2 Part of this chapter was published in “Herrera F1 and Triezenberg SJ (2004). VP16-dependent association
of chromatin-modifying coactivators and underrepresentation of histones at immediate-early gene
promoters during herpes simplex virus infection. Jomnal of Virology 78(18): 9689-9696”.

43

potential targets of the VP16 AD include chromatin-remodeling coactivator or adaptor
proteins. The VP16 AD can interact physically or functionally with histone
acetyltransferase (HAT) proteins including the yeast ADA/ SAGA and NuA4 complexes
and the human coactivators CBP, p300 and hGCNS complex (15, 19, 146, 154, 195, 285,
296). Acetylation of nucleosomal histones near gene promoters is generally correlated
with increased transcription (110, 268). In particular, CBP and p300 are very similar and
ubiquitously expressed coactivators involved in cell cycle control, differentiation and
apoptosis, with histone acetyltransferase (HAT) and factor acetyltransferase (FAT)
activities (293). Despite the sequence similarity of CBP and p300, gene deletion
experiments suggest that the two proteins serve nonredundant but overlapping functions

(131,237,277,325)

The VP16 AD can also interact in vitra with the ATP-dependent chromatin
remodeling complex SWI/SNF (97, 214). This protein complex can relocate
nucleosomes, alter DNAase accessibility patterns and alter the superhelicity of DNA in
vitra [reviewed by (212)]. The mechanism by which SWI/SNF acts in transcriptional
activation requires the DNA-dependent ATPase activity of the largest subunit known as
SWIZ/SNFZ. The repositioning of nucleosomes in cis (through tracking or sliding of
nucleosomes along DNA) or the transfer of histone octarners to different DNA segments
in trans might alleviate chromatin-mediated repression and therefore might contribute to
transcriptional activation (224, 304). BRM and BRG-l (BRM related gene-1) are the
mammalian homologs of the ATPase subunit of yeast SWI/SNF complex. These

ATPases have high sequence Similarity but play different biological roles as indicated by

the phenotypes of mutant mice (33, 242), and are differentially recruited to various gene

promoters during cellular proliferation and differentiation (123).

The large list of putative targets for the VP16 activation domain raises the
question of which are more relevant for the in viva firnction ofVP16. The main purpose
of this thesis work is to explore the in viva function of some of the VP16 putative targets
during the activation of HSV-1 viral genes. To that end, we developed chromatin
immunoprecipitation assays (ChIP assays) to test for the presence ofVP16 and Oct-1 and
for selected general transcription factors at the IE gene promoters during HSV-1 infection
of cultured cells. The dependence on the activation domain for the recruitment of these

factors was tested using the RPS viral strain lacking the VP16AD.

The association of chromatin-modifying coactivators with the VP16 AD in
heterologous systems is particularly intriguing since previous evidence indicates that
HSV-1 DNA is not packaged in nucleosomes during lytic infection (for further details see
Chapter 3). Thus, the purpose for recruiting chromatin-remodeling coactivators to viral
IE gene promoters remains enigmatic. Given that the association of VP16 with such
coactivators has arisen solely fiom artificial or heterologous experimental contexts, we
tested whether the chromatin-modifying coactivator proteins were associated with viral

IE gene promoters during infection.

Using ChIP assays, we found that HATS (p300 and CBP) and also ATP-
dependent chromatin remodeling enzymes (BRG-l and BRM) were present at viral IE

promoters. The recruitment of the HATS and general transcription factors (TBP and RNA

45

Pol H) was fully dependent on the VP16 activation domain, whereas the recruitment of
the SWI/SNF components was only partially dependent on VP16. The ARC92 mediator
subunit was also detected at one IE gene promoter (ICP27) and its efficient recruitment
was also dependent on VP16AD. These results uncover some of the transcription factors
recruited to IE gene promoters during infection and suggest that chromatin—modifying

coactivators are among the proteins involved in the activation of these genes.

2.2. Materials and Methods

2.2.1. Cells and viruses.

HeLa and Vero cells were grown in Dulbecco’s modified Eagle’s medium
supplemented with 10% fetal calf serum. Stocks of wildtype HSV-1 (strain K08) and the
VP16 truncation mutant RPS (276) were prepared in Vero cells and titered by plaque
assays. For gene expression and ChIP assays, HeLa cells (approx. 3 x 107) were infected
with KOS at a multiplicity of infection ranging from 1 to 10 pfu/cell in different
experiments. Infections with RPS were performed using comparable virion numbers
(approximately 100-fold lower pfu than in KOS infections). In some experiments,
cycloheximide (60 ug/ml) was added to the medium for two hours prior to and during

infection to inhibit protein translation.

46

2.2.2. Chemical crosslinking and immunoprecipitation assays.

To crosslink protein-DNA complexes, formaldehyde was added to the medium
overlaying infected cells to a final concentration of 1% for 15 min. The crosslinking
reactions were quenched by adding glycine to a final concentration of 125 mM. Cells
were collected, resuspended in a hypotonic buffer, and dounce homogenized to release
nuclei which were collected by centrifugation. Nuclear pellets were sonicated to obtain
DNA fiagrnents with an average length of 300-400 basepairs. Aliquots corresponding to

10% of the input material were reserved.

Prior to immunoprecipitation, samples were precleared using protein-G agarose
beads (Upstate, Charlottesville VA). Immunoprecipitations were performed using
specific antibodies at concentrations ranging from 10 to 50 pg/ml at 4°C overnight.
Antigen-antibody complexes were precipitated using protein-G agarose beads. The beads
were washed extensively before protein-DNA complexes were eluted using 100 u] of 50
mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS for 20 min at 65 °C. A second eluate,
using 150 pl TE with 0.67% SDS, was added to the first. The combined eluates are
referred to as the pellet sample. Crosslinks were reversed by adding NaCl to 200 mM and
10 pg of RNAase A and incubating at 65°C overnight. Afier ethanol precipitation,
samples were digested with proteinase K (Boehringer) at 42°C for 2 hours and then
extracted with phenol/chloroform. After another ethanol precipitation, DNA samples

were resuspended in 75 [.1] TE pH 8.0.

47

ChIP assays were performed using antibodies or antisera directed against VP16
(283), Oct-1 (a gift from W. Herr, Cold Spring Harbor Laboratory), TBP (a gift from R.
W. Henry, Michigan State University), RNA polymerase II (8WG16, Covance), CBP (A-
22, Santa Cruz Biotechnology), p300 (N-15, Santa Cruz Biotechnology), Brm (N-19,
Santa Cruz Biotechnology), BRGl (H-88, Santa Cruz Biotechnology) or ARC92 (a gift
from A. Naars, Harvard University). Control lPs using pre-irnmune sera exhibited

essentially the same results as mock IPS using no antibody (data not shown).

Semi-quantitative polymerase chain reactions (PCRS) were performed to detect
specific viral or cellular gene fragments in the irnmunoprecipitated samples. These
fragments included the promoters of the HSV IE genes (ICPO, ICP27, and ICP4); the
coding region of the ICP27 gene; the promoters of viral DE (TK) and L (V P16,
glycoprotein C) genes; and the promoters of cellular genes U3 snRNA and IFN-B (See
details in appendix A). Parallel PCRs were routinely performed on serial dilutions of
input samples (typically corresponding to 0.5%, 0.1%, and 0.02% of the total material) to
confirm that observed signals were within linear range of the assay and were comparable
between different set of primers. Standard PCR conditions included 0.25 pM of each
primer, 2.5 U T aq DNA polymerase (Invitrogen), 0.] mM each deoxynucleotide
triphosphate, 2 mM MgC12, 10% Enhancer solution (Invitrogen), with incubation at 95°C
for 5 min followed by 30 to 35 cycles of 95°C for 30 sec, 65°C for 30 sec and 72°C for 1
min and ending with 5 min at 72°C. The Enhancer solution was omitted fi'om reactions
amplifying the ICP27 ORF, U3 snRN A promoter, and IFN-B promoter fiagments.

Annealing of primers for amplification of the IFN-B promoter and the GAPDH ORF was

48

performed at 55 °C. Negative images of ethidium bromide-stained gels of representative

experiments are shown.

Quantitative real time PCR (qPCR) analysis was also used to quantify specific
viral and cellular DNA fragments in the immunoprecipitated samples. qPCR were
performed on a ABI Prism 7700 Sequence Detection System using SYBR Green Core
Reagents (Applied Biosystems). Standard PCR conditions included 3 [L of template (IP
sample or input dilution), 0.25 M of each primer, 0.75 U Taq DNA polymerase
(Applied Biosystems) and 2-3 mM MgC12 in 30 [LL final volume. Parallel PCRs were
routinely performed on serial dilutions of input samples (3%, 1%, 0.3%, 0.1%, 0.03%,
0.01% of the input material) to obtain standard curves for each PCR. The standard curves
were used to determine the percentage of input present in each IP sample. The
enrichment of a particular promoter over background levels (No Ab sample) was
determined using 2'ACt (see appendix A for further details). Error bars Shown in figures

represent range of the technical duplicates.

2.2.3. Gene expression assays.

The steady-state levels of viral mRNAs (ICP27, TK, and VP16) expressed in
infected HeLa cells were determined using reverse-transcriptase PCR assays. Total RNA
was isolated from infected cells using TRI-Reagent following the directions provided by
the manufacturer (Molecular Research Center). cDNA was prepared using 1 ug total

RNA and a randomly-primed reverse transcription system (Promega). Viral gene cDNAs

49

encoding ICP27, TK and VP16 were amplified using PCR conditions described
previously (44) and analyzed on ethidium bromide stained agarose gels. Negative images

are shown.

cDNA levels were also analyzed using quantitative real time PCR (qPCR).
Appendix B describes in detail the protocol used in reverse transcriptase qPCR analysis
(qRT-PCR). In brief, viral gene fiagments were amplified using SYBR Green Core
reagents and the ABI Prism 7700 Sequence Detection System (Applied Biosystems).
PCR conditions included 0.1-0.25 11M each primer and 2-3 MgClz in 30 [IL final volume.
Relative levels of viral gene expression were obtained with the 2”“ method (175) using
wild type infections as standard and 18S rRNA as endogenous control. Bars represent the
average expression levels of 3 independent infections each measured in duplicate. Errors

bars indicate the range of the biological triplicates.

2.2.3.1. Analysis of viral gene expression in cells expressing a dominant negative

form of ARC92.

The VP16 binding domain (V BD) on ARC92 mediator subunit (MEDZS) resides
between amino acids 402 and 590 and shows a dominant negative effect on Gal4-
VP16AD activation of plasmid-based reporter gene (322). To explore the role of
mediator complex and in particular the role of ARC92 subunit we tested whether ARC92
VBD interferes with IE gene expression during infection. Approximately 4 x 10‘5 HeLa

cells were transfected with a plasmid expressing the ARC92 VBD or the empty vector as

50

a control. To select the cells that received the plasmid, the samples were co-transfected
with pBABE plasmid encoding a puromycin resistant gene and grown on media
containing puromycin 2 jig/m1. Two days after initial transfection of cells, control plates
(mock transfections) did not Show cell survivors indicating that the puromycin treatment
efficiently selected transfected cells. This selection of transfected cells is of importance
since subsequently all cells are infected with HSV-1. Low levels of transfections might
reduce any potential effect on viral gene expression of the peptide delivered by

transfected plasmids.

The selected cells fiom both samples (empty vector and ARC92 VBD) were
collected and seeded to grow overnight on media without puromycin. Infections were
performed in duplicate for each condition (empty vector or ARC92 VBD) with wild type
HSV-1 viral strain KOS at MOI of 1 pfir/cell. Total RNA and proteins were isolated at
two hours post-infection. To quantify viral gene expression, RNA was reversed
transcribed and used as a template for quantitative PCR (qRT-PCR). cDNA levels were
obtain using 2'AACt analysis and 188 rRNA as endogenous control (see appendix B for

details).

2.3. Results.

2.3.1. VP16 associates with IE gene promoters with or without its transcriptional

activation domain.

51

The VP16 protein comprises a core domain (encompassing amino acids 1-410)
and a transcriptional activation domain (amino acids 413-490) (Figure 3A.). The core
domain interacts with two cellular proteins, Oct-1 and HCF-l , to form a DNA-binding
complex at specific cis regulatory elements in the viral IE gene promoters (147, 229, 267,
316). The VP16 AD is required for efficient transcription of viral IE genes both in
transfection experiments and during HSV-l infection (276, 283, 295). Infection of HeLa
cells by RPS (Figure 3B), a mutant viral strain lacking sequences encoding the VP16 AD

results in little IE gene expression (276, 323).

Chemical crosslinking and immunoprecipitation (ChIP) assays were adapted to
detect the association of Specific proteins with viral promoters during lytic infection by
HSV-1. HeLa cells were fixed with formaldehyde at 2 hours post-infection, when
transcription of IE genes is robust. Sonicated nuclear lysates were immunoprecipitated
with antisera directed against VP16 or Oct-1, or with protein-G agarose beads alone (no
antibody). PCR products representing the promoters of the IE genes ICPO and ICP4 were
more abundant in reactions using the VP16 and the Oct-1 IPs than in the samples lacking
primary antibodies (Figure 4), fulfilling the expectation that these proteins are associated
with IE promoters during infection. Little or no PCR product corresponding to the VP16
promoter was detected in the VP16 and Oct-l IPs, as expected for a late gene promoter.
The cellular U3 snRNA gene contains an Oct-1 binding Site and is activated upon HSV-1
infection in the absence of the nova protein synthesis and by VP16 delivered by

transfection (133, 271).

52

HSV-1 strains

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

__| VP16
A VP16 l\/-RP5
H
Activation
Domain
B.
IE gene expression
aKos
8 1-5 l naps
lMock
3
To 1.0 - l l
>
E
:2 0.5 -
O
I!
0.0 - . ”1 7 T“
ICP27 ICPO ICP4

Figure 3. K08 and RPS viral strains. (A) Schematic representation of the VP16 protein
encoded by the HSV-1 strains KOS (wildtype) and RPS (lacking sequences encoding the
VP16 AD). (B) qRT-PCR analysis of steady-state mRNA levels of viral IE (ICP27, ICPO
and ICP4) genes in cells infected by KOS, RPS or mock infected for 2 h. Relative values
were obtained with 2'AACt method using 18S rRNA as endogenous control. Errors bars

indicate range of biological triplicates.

53

 

Promoter

 

 

KOS
ICPO

-1:— ---—- RPS

--m--' KOS
a- “Mr-- e- - RPS

.... . - .- KOS
VP16 .
I :— RPS
on v: u . KOS
U3 snRNA '_
Q 6 RPS

Figure 4. Detection of VP16 and Oct-1 at viral IE promoters during infection. Cross-
linking and immunoprecipitation (ChIP) assays using antibodies against VP16 or Oct-1 in
lysates of cells infected for 2 h by KOS or RPS. Controls include precipitations
performed without specific antisera (N 0 Ab) and aliquots of samples prior to precipitation
(0.5%, 0.1%, 0.02% input). Samples were analyzed using PCR detecting viral IE gene
promoters (ICPO, ICP4), a viral L gene promoter (V P16) and the promoter of the cellular
U3snRNA gene. Negative images of ethidium bromide-stained gels are Shown.

54

The presence of the octarner sequence at the U3 snRNA promoter suggests that
VP16 might bind to the U3 snRNA promoter through interactions with Oct-1 . Thus the
presence of Oct-1 and VP16 at the U3 snRNA during infection was tested using ChIP
assays. Figure 4 shows that anti-Oct-l, but not anti-VP16, immunoprecipitated the
promoter region of the cellular U3 snRNA gene. This result does not support the

hypothesis that VP16 directly activates the U3 snRN A.

To test whether the VP16 AD was required for association with the IE promoters,
parallel ChIP assays were performed using cells infected with the VP16 truncation
mutant RPS. The binding of VP16 and of Oct-1 to the IE promoters was not altered by
the absence of the VP16 AD (Figure 4). The comparable Signals arising from the input
samples of the two infections ensures that comparable amounts of viral DNA were
present in the nuclear extracts. The association of Oct-1 with the U3 snRNA promoter
was likewise unaffected. Therefore, the reduced expression of IE genes in RPS infections
does not result fiom a failure of the activator to associate with its target genes, but likely

arises from a defect in transcriptional activation per se.

The DNA immunoprecipitated by anti-VP16 and anti-Oct-l serum in ChIP assays
of cells infected with wild type virus (KOS) was also analyzed using quantitative real
time PCR (qPCR). The ChIP assays were performed as in figure 4 but the
immunoprecipitated samples were analyzed using 2‘ACt analysis to quantify the
differences between the IP samples and the “No Ab” sample (for details see appendix A).

The enrichment of IE gene promoters ICPO and ICP27 was detected using both

55

antibodies as observed previously on ethidium bromide-stained gels for ICPO and ICP4
gene promoters (Figure 5). The VP16 promoter region was not significantly
immunoprecipitated above background levels (“No Ab” sample) in either anti-VP16 or
the anti-Oct-l 1P samples. As observed previously, the cellular U3 snRN A gene promoter
was immunoprecipitated with antibodies against Oct-1 but not with antibodies against

VP16.

Input dilutions were used in parallel PCR reactions during qPCR analysis to
quantify the percentage of input present for a given viral DNA fiagrnent in each IP
sample (see appendix A for further details). ChIP assays using VP16 and Oct-1 typically
resulted in the immunoprecipitation of approximately 0.2 - 0.1% of the input sample used
in each 1P (data not shown). The results obtained with quantitative real time PCR are
consistent with the results obtained with the semi-quantitative analysis using ethidium
bromide—stained gels. Thus, these results confirmed that ChIP assays using antibodies
against VP16 and Oct-1 result in the specific enrichment of IE gene promoters during

early times of infection.

56

254
20‘
15‘

Fold IP

 

 

 

ICPO ICP27 VP16 U3 snRNA

Figure 5. Detection of VP16 and Oct-1 at viral IE promoters during infection using ChIP
followed by quantitative PCR analysis. ChIP assays were performed using antibodies
against VP16 or Oct-1 in lysates of cells infected for 2 h by KOS. Samples were analyzed
using real time PCR detecting viral IE gene promoters (ICPO, ICP27), a viral L gene
promoter (VP16) and the promoter of the cellular U3snRNA gene. Relative [P values
were obtained comparing values of immunoprecipitations samples with precipitations
performed without specific antisera (N 0 Ab) using 2"” analysis. Error bars indicate the
range of the technical duplicates for the qPCR analysis.

57

2.3.2. The VP16 AD is required to recruit general transcription factors to IE

promoters during infection.

Transcription of HSV-1 genes depends on general transcription factors and RNA
Pol H from the infected host cell (303). During infection of HeLa cells by wildtype virus
(KOS), IE gene mRNAs were readily detected at 2 hpi (Figure 3B). In contrast, infection
by RPS (lacking the VP16 AD) resulted in a dramatic reduction in viral gene expression,
consistent with prior reports (276, 323). To test whether this decreased expression
corresponded to a failure to recruit the general transcription machinery to IE gene
promoters, ChIP assays were performed using antibodies directed against the general
transcription factor TBP and RNA Pol II. As shown in figure 6, PCR products
corresponding to the promoters of the IE genes ICPO, ICP4 and ICP27 were readily

detected in the TBP and RNA Pol H IPs from cells infected with wildtype virus at 2 hpi.

In contrast, these PCR products were not detected in parallel IPs from cells
infected with RPS. The presence of the U3 snRN A promoter fragments in the IPS from
both KOS— and RPS-infected cells demonstrates that the IP reactions were successful. We
conclude that the recruitment of TBP and RNA Pol H (and also TFHF, data not shown) to
IE gene promoters require the VP16 AD, and that the lack of IE gene transcription

observed in RPS infections correlates with the absence of GTFS at those promoters.

S8

Antibody

 

 

 

3 Input
1:. E <
a
Promoter I‘-1 d). z
p - - KOS
ICPO
RP5
—— h— ms
ICP4 ,
Q -. RP5
ICP27 -
Q‘- ~ RP5
.. - ‘ .- .. Kos
U3snRNA

w- i‘mm5

 

Figure 6. General transcription factors are recruited to IE promoters by the VP16 AD.
ChIP assays using antibodies against TBP and Po] H in lysates of cells infected for 2 h
with KOS or RP5. Immunoprecipitated samples were analyzed using PCR detecting viral
IE gene promoters ICPO, ICP27, ICP4, and the cellular U3snRNA promoter. Controls
include precipitations performed without specific antisera (No Ab) and aliquots of
samples prior to precipitation (0.5%, 0.1%, 0.02% input). Negative images of ethidium
bromide-stained gels are shown.

59

In the course of these experiments, we noted that DE and L gene promoters were
also associated with RNA Pol H at 2 hpi (Figure 7B), even though transcription of these

genes is not readily detected until 4 hpi (Figure 7A). Because IE gene products

themselves are transcriptional regulatory proteins that can further stimulate expression of
IE genes (as a positive feedback loop) as well as DE and L genes, the observation of TBP

and RNA Pol II at the IE promoters may arise from the action of IE proteins rather than

ofVP16.

To test this hypothesis, cells were infected by KOS in the presence of
cycloheximide to inhibit IE protein synthesis. This treatment effectively blocked the
cascade of viral gene expression, as no DE or L gene mRNAs were detected at 2 or 4 hpi
in the presence of cycloheximide (Figure 7A). ChIP assays of cycloheximide-treated cells
detected RNA Pol H at the ICPO promoter albeit to an apparently reduced level (Figure
7B). This result suggests that recruitment of RNA Pol H to IE promoters arises directly
from VP16 activity and not by action of IE proteins themselves. In contrast, the
association of RNA Pol II with DB and L genes (TK and VP16, respectively) was
abolished in the presence of cycloheximide. Therefore, the presence of RNA Pol H at DE

and L genes does indeed depend on IE protein synthesis, whereas its presence at IE gene

promoters does not.

60

2 hpl 4 hpi

cr-rx[-+-+

Antibody

.n
<

O
2

 

Pol II

Promoter

 

ICPO

cw-
TK
-

VP16

‘
-w-I-

Gene

 

ICP27 (IE)

TK (DE)

VP16 (L)

Input
CHX

-I-

m

+

Figure 7. Recruitment of RNA Pol H at different classes of viral promoters. (A) RT-
PCR analysis of steady-state mRNA levels of viral IE (ICP27), DE (TK) and L (VP16) in
cells infected with KOS in the presence or in the absence of cycloheximide. (B) ChIP
assay performed using antibodies against Pol H in lysates for KOS infections in the
presence or absence of cycloheximide, using PCR to detect promoters of the viral genes
ICPO, TK and VP16. Controls include precipitations performed without specific antisera
(N 0 Ab) and aliquots of samples prior to precipitation (0.5%, 0.1%, 0.02% input).
Negative images of ethidium bromide-stained gels are shown.

61

2.3.3. The VP16 AD recruits chromatin-modifying coactivators to IE gene

promoters during infection.

The association of chromatin-modifying coactivators with the VP16 AD in
various heterologous systems led us to ask whether some of these factors are present on
active IE gene promoters during HSV-1 infection. ChIP assays were performed on
extracts of HeLa cells infected with KOS or RP5, using antibodies specific to the closely
related histone acetyltransferases CBP and p300. In extracts fiom KOS-infected cells,
antibodies directed against CBP or against p300 immunoprecipitated the promoters of the
ICPO, ICP4 and ICP27 genes (Figure 8), demonstrating that these HATS are recruited to
IE viral promoters druing HSV infection. Interestingly, CBP was preferentially associated
with the ICPO and ICP4 gene promoters whereas p300 was preferentially associated with
the ICP27 promoter. Therefore, these two highly related HATS can be differentially

recruited to IE gene promoters, despite the similarities in the cis regulatory elements at

those promoters.

During infection of HeLa cells by RPS (i.e., in the absence of the VP16 AD),
recruitment of CBP and p300 to viral IE promoters was drastically reduced (Figure 8).
No specific PCR signal was detected for the ICPO and ICP27 promoters in samples
immunoprecipitated with either anti-CBP or anti-p300, and only a weak signal was
detected for the ICP4 promoter in the anti-CBP sample. These results reveal that the

VP16 AD is required for the efficient recruitment of CBP and p300 to HSV-1 IE

promoters during infection.

62

 

 

 

 

Antibody *5
CL
5
o. o g e\°
Promoter In S o u;
U a. z o
. KOS
rcpo E -
- RP5
III m - KOS
ICP4
-.... . » - RP5
w a 5 K08
ICP27

Figure 8. Recruitment of histone acetyl transferases CBP and p300 to IE promoters
during HSV-1 infection. ChIP assays were performed using antibodies specific for CBP
or p300 in lysates of cells infected with KOS or RPS for 2 h. Immunoprecipitated
samples were analyzed using PCR detecting viral IE gene promoters ICPO, ICP27, ICP4.
Controls include precipitations performed without specific antisera (N 0 Ab) and aliquots
Of samples prior to precipitation (0.5% input). Negative images of ethidium bromide-
stained gels are shown.

63

We also tested for the presence of another class of coactivator complex, namely,
the ATP-dependent chromatin remodeling complex SWI/SNF. BRM and BRG-l are the
ATPase subunits of two distinct human SWI/SNF complexes [reviewed by (212)]. ChIP
assays of nuclear extracts fiom KOS-infected cells using antibodies against BRG-l and
BRM precipitated the promoters of the ICPO, ICP4 and ICP27 genes, indicating that the
human SWI/SNF complexes are recruited to IE promoters during infection. Similar to the
HAT complexes described above, BRG-l and BRM showed different preferences for
interacting with various IE promoters. The ICPO and ICP4 promoter fragments were

preferentially detected in the BRG-l IP samples, whereas the ICP27 promoter fragment

was preferentially detected in the BRM IP sample (Figure 9).

In the absence of the VP16 AD (i.e., in RPS infection), the association of BRG-l
and BRM with the ICPO promoter was lost. In contrast, BRG-l (but not BRM) was still
associated with the ICP4 promoter, and BRM (but not BRG-l) was still associated with
the ICP27 promoter. Therefore, the ATP-dependent remodeling complexes are indeed

recruited to viral DNA templates during lytic infection, and specific remodeling

complexes preferentially associate with distinct IE gene promoters. Moreover, the VP16
AD is required or important for the association of these complexes with some promoters
but not with others. This latter conclusion suggests that other activators present at IE

promoters (for instance, Oct-1 or HCF-l) might contribute to the recruitment of BRG-l

or BRM.

 

Promoter

 

ICPO

-- a. K08
,. - RP5

rcp4 "'5
_

.— - W . KOS
.- - RP5

ICP27

Figure 9. Recruitment of ATP—dependent chromatin remodeling complexes to IE
promoters during HSV-1 infection. ChIP assays were performed using antibodies specific
for Brg-l or Brm in lysates of cells infected with KOS or RP5 for 2 h.
Immunoprecipitated samples were analyzed using PCR detecting viral IE gene promoters
ICPO, ICP27, ICP4. Controls include precipitations performed without specific antisera
(No Ab) and aliquots of samples prior to precipitation (0.5% input). Negative images of
ethidium bromide-stained gels are shown

65

 

 

The recruitment of HATS and SWI/SNF complexes to viral IE promoters was
apparently the direct result of the VP16 AD and not a consequence of IE proteins
themselves. In ChIP experiments performed on KOS-infected cells in the presence of
cycloheximide, the ICPO and ICP27 promoter fragments were present in the IP pellets
obtained using antibodies recognizing CBP, p300, BRM, or BRGl (data not shown),

indicating that recruitment of these coactivators does not depend on IE protein synthesis.

2.3.4. ARC92 mediator subunit and IE gene expression.

The mediator has been proposed as the target for different mammalian activators
including nuclear receptors, SREBP, p53 and viral activators EIA and VP16 [reviewed
by (210)]. The interaction of mediator complex with the activation domain of VP16 has
been studied in vitra and in heterologous systems using Gal4-VP16AD. The TRAP80
(MED17) subunit of the mediator complex interacts physically with VP16AD in binding
reactions in vitra suggesting that is the direct target for VP16AD in the mediator complex
(112). More recently, two independent studies identified another mediator subunit,
ARC92 (MED25), as target of VP16AD in the mediator complex. The ARC92 interacts
not only in binding assays but also in firnctional tests indicating that ARC92 is required

for the activity of Gal4-VP16AD (201, 322).

These experiments indicate that the mediator complex is another target for the

VP16AD and suggest that it might be involved in the activation of IE genes during

66

infection. To explore the role of the mediator complex and in particular the role of
ARC92 in the activity of VP16 during infection we performed ChIP using antibodies
against ARC92. ChIPs were performed under the same conditions used to detect
transcriptional activators, general transcription factors and chromatin-modifying
coactivators. HeLa cells were infected with K08 and RP5 viruses for 2 h. Chromatin was
fixed and immunoprecipitated with anti-ARC92 and with the pro-immune serum as

control.

Figure 10 Shows that in KOS infections the ICP27 gene promoter is
immunoprecipitated above background levels by anti-ARC92 serum. The
immuprecipitation of the ICP27 gene promoter is not detected in RP5 infected cells
indicating the VP16AD is required for the efficient recruitment of ARC92 to the ICP27
gene promoter. Specific immunoprecipitation of the other IE promoters ICP4 and ICPO
was not detected neither in KOS or RPS infected cells. These results suggest that ARC92
mediator subunit is also part of the transcription factors recruited to the IE promoter
ICP27 and again indicate that differential recruitment of cofactors is detected among IE

promoters at two hours post-infection.

To further explore the role of ARC92 in the activation of IE genes, we tested
whether a dominant negative form of ARC92 interferes with IE gene expression. The
VP16 binding domain (V BD) on ARC92 resides between amino acids 402 and 590 and
shows a dominant negative effect on Gal4—VP16AD activation of plasmid-based reporter

gene (322). To test whether ARC92 VBD interferes with IE gene expression,

67

 

 

g Input

Promoter 2:: E ‘_
___- ......"7 KOS

ICPO
p ., ~ RP5
- - «~- ~ K08

ICP4 ,
-—--- I- - ~ RP5
.. ...... -u— — V KOS

ICP27 ‘ ,

~' I'- w. RP5

Figure 10. Recruitment of mediator subunit ARC92 to ICP27 promoter during HSV-1
infection. ChIP assays were performed using antibodies specific for ARC92 in lysates of
cells infected with KOS or RP5 for 2 h. Immunoprecipitated samples were analyzed
using PCR detecting viral IE gene promoters ICPO, ICP27, ICP4. Controls include
precipitations performed with pre-immune serum (PI) and aliquots of samples prior to
precipitation (0.5%, 0.1% and 0.02% input). Negative images of ethidium bromide-
stained gels are shown

68

cells were transfected with a plasmid expressing ARC92 VBD and subsequently infected
with HSV-1 for two hours. To select the cells that received the plasmid, the samples were
co-transfected with pBABE plasmid encoding a puromycin resistant gene and grown on
media containing puromycin 2 jig/ml. The selected cells from both samples (empty
vector and ARC92 VBD) were collected and seeded to growth overnight on media
without puromycin. Infections were performed in duplicate for each condition (empty
vector or ARC92 VBD) with wild type HSV-1 viral strain KOS at MOI of 1 pfu/cell.
Viral gene expression was quantified using quantitative RT-PCR (qRT-PCR). Relative
cDNA levels were obtained using 2M0 analysis and 188 rRNA as endogenous control
(see appendix B for details). Figure 11A shows a representative result for these
experiments. The presence of the dominant negative form of ARC92 did not affect the
steady state levels of RNA levels of ICP4 and ICP27 when compared to infections
performed in parallel cells transfected with the empty vector. The expression of the
ARC92 VBD peptide was continued in the same samples using irnmuno blot analysis of
protein extracts. As expected, Figure 113 shows that a specific peptide is detected by
antibodies directed against ARC92 only in samples transfected with vector expressing
ARC92 VBD and not with the empty vector. The ARC92 VBD is a 188 amino acid
peptide and thus a predicted molecular of approximately 19 kDa. These results Show that
the presence of ARC92 VBD does not affect the expression levels of IE gene under these
conditions and thus they failed to add support to the hypothesis that the interaction of
VP16 with ARC92 is required for the expression of IE genes. One caveat for these results
is that we have not tried to replicate in our hands the dominant negative effect of ARC92

VBD observed on Gal4-VP16AD activity and thus no positive control was included.

69

A. qRT-PCR B. Immunoblot analysis

 

 

ICP4 gene expression ARC
2 2.0 kDa Vector 92 VBD
w —
E 1.5 80'
3 1.0
ti
3 0.5 39-
o:
0.0 30-
Vector ARC92 VBD
17-
ICP27 gene expression
3 2.0
g 1.5
E 1.0
E 0.5
0
9‘ o.o

Vector ARCSZ VBD

Figure 11. Effect of dominant negative form of ARC92 on IE gene expression. (A)
Quantitative RT-PCR analysis of the steady-state mRNA levels of viral IE ICP24 and
ICP27 genes in cells infected for 2 h with KOS in the presence or absence of plasmid
expressing ARC 92 VBD. (B) Immunoblot analysis using antibodies against ARC92 of
protein samples from the same infected cells used to analyze gene expression on panel A.

2.4. Discussion.

Although much has been learned about mechanisms of transcriptional activation
by using VP16 and other activation domains in heterologous or in vitra experimental
systems, the validity of the models arising fiom such studies is best tested in an
appropriate biological context. Here we probe the physiological role of putative targets of
VP16 by analyzing the recruitment of general transcription factors and transcriptional
coactivator proteins to IE viral gene promoters by VP16 during HSV-1 infection of

cultured mammalian cells.

We demonstrate that the recruitment of TBP and RNA Pol H (as representative
GTFS) depends on the VP16 activation domain, indicating that at least part of the in viva
mechanism of transcriptional activation by VP16 is the establishment of a pre-initiation
complex on target gene promoters. This conclusion is consistent with previous evidence
that VP16 can interact directly in vitra with GTFS including TBP, TFIIB, TFIIA and
TFIIH (84, 111, 140, 173, 284, 315) and can stimulate in vitra assembly of a
TFIID/TFIIA/DNA complex (142). Our results do not exclude the possibility that later
stages of transcription, such as promoter escape or elongation, might also be stimulated

by VP16 (324).

Our results also indicate that two different types of chromatin-modifying
complexes, HATS and ATP-dependent chromatin remodeling complexes, are recruited to

viral IE gene promoters during HSV-1 infection. The recruitment of the HATS p300 and

71

CBP was fully dependent on the VP16 AD, whereas recruitment of the SWI/SNF proteins
BRM and BRG-l to some but not all IE promoters was affected by the VP 1 6 truncation
mutant. The ability of VP16 to recruit these HATS and remodeling enzymes during
infection in viva is consistent with results from assays using the Gal4-VP16 fusion
protein in transfection or in vitra experiments (146, 195, 214, 296). The presence of BRM
and BRG] at some IE promoters during RPS infection indicates that both VP16-
dependent and VP16-independent mechanisms can recruit these proteins. In other
circumstances, recruitment of SWI/SNF complexes has been shown to be independent of
a given activation domain and yet dependent on the DNA-binding domain of a regulatory
protein (44, 124, 126). We cannot yet distinguish whether the partial recruitment of
BRG] and BRM to IE promoters depends on the core domain of VP16 or on other
activators that bind these promoters. Although hSWI/SNF has been implicated as a
component of the RNA Pol H holoenzyme (48, 215), our results are not fully consistent
with that model. In the absence of the VP16 AD, we observed BRG] and BRM present at
certain IE promoters despite the absence of RNA Pol H, indicating these ATPases can be

recruited independent of the RNA Pol H holoenzyme as seen in in vitra systems (326).

We find it intriguing that the coactivators were differentially recruited to the
various IE promoters. For example, the ICPO and ICP4 promoters seemed to favor the
presence of CBP, whereas the ICP27 promoter was prominently associated with p300.
Likewise, BRG-l was somewhat preferred at ICPO and ICP4 promoters, whereas BRM
was slightly more prevalent at the ICP27 promoter. Together, these observations suggest

that BRM and p300 may cooperate specifically at certain promoters, whereas BRG-l and

72

CBP function together at other promoters. The presence of ARC92 mediator subunit at
the ICP27 promoter but not at the ICPO and ICP4 promoters further illustrates the

differential recruitment of transcriptional coactivators.

Curiously, these promoter preferences exist even though the important cis
regulatory elements, including TAATGARAT, GA-rich, and Spl-binding sites, are
common to all of the IE promoters. The differential recruitment may reflect additional,
undefined promoter elements that might distinguish the various promoters. Alternatively,
the specific arrangements of the binding sites within the various IE promoters (and thus
the quaternary structure of the various regulatory proteins) might be responsible for
preferential coactivator recruitment. Whether the promoter-specific differences in
coactivator recruitment have functional consequences for gene expression remains to be
determined. Collectively, our results reveal that the assembly of the transcription
machinery can be accomplished through multiple pathways, and that subtle differences in

promoters might have significant effects on the recruitment of particular factors.

Other transcriptional regulators including Oct-1, HCF 1-1, GABP and Spl also
bind to the IE promoter regions (122, 229, 267, 303). We presume that the binding of
these regulators to their cognate cis elements is not affected by the presence or absence of
the VP16 AD, and in fact we show that Oct-l is present at IE promoters during RPS
infection. However, the presence of these regulatory proteins is apparently not sufficient
to recruit either the HATS or GTFS to the IE promoters, since the recruitment was

ineffective during RP5 infection. This conclusion is somewhat surprising, given evidence

73

that CBP and p300 can interact in vitra with GABP and Spl (12, 273, 294). This

reinforces the value of testing such interactions in an appropriate in viva context.

The presence of coactivator proteins at IE promoters during infections, detected
by ChIP assays, does not demonstrate that these factors are required for the expression of
viral genes. Alternative approaches might be used to test whether these coactivators are
required for the efficient expression of viral genes including RNA interference (RN Ai),
mutant cell lines and overexpression and dominant negative strategies. To that end, we
developed quantitative reverse-transcriptase PCR (qRT-PCR) to analyze viral gene
expression in cultured cells (see appendix B for details). To test the fimctional roles of
these coactivators we explored RN Ai approaches delivering the siRNA by transfections
or by plasmids encoding the sequence producing siRN A within the cells. The results fi'om
these experiments did not show consistent and robust reduction of targeted coactivators
(CBP, p300, Brg-l and Brm) and so no clear answer has been Obtained thus far on the

effect on IE gene expression (data not shown).

The VP16AD binding domain of ARC92 (ARC92 VBD) is an effective dominant
negative factor for the activity of Gal4-VP16AD in transfection experiments (3 22). We
explored the role of the mediator subunit ARC92 on VP16 activity during infection in a
collaborative effort with Dr. Anders Naar at Harvard Medical School. We used the same
strategy developed by Naar and collaborators to study Gal4-VP16AD but now tested the
dominant effect of ARC92 VBD on VP16 activity during HSV-1 infections. Several

transfection conditions were used to test whether the presence of ARC92 VBD might

74

interfere with VP16 activity during infection. The negative results obtained with these
experiments do not add support to the hypothesis tested. Different strategies might be
used to further test the role of ARC92 and mediator on IE gene expression including
ChIP assays using antibodies against other mediator subunits and RNAi strategies to

knock down the expression of the ARC92 or other mediator subunits.

75

Chapter [11

Association of histones with viral DNA3

3.1. Introduction.

The presence of CBP, p300, Brgl and Brm coactivator proteins at IE gene
promoters detected by ChIP assays suggests that the activation of IE genes during
infection requires chromatin-modifying coactivators (see chapter II). These results are in
agreement with the well documented recruitment of chromatin-modifying coactivators by
the activation domain of VP16 in in vitra or heterologous systems (see chapter I for
further details). However, they raise the question of why these chromatin modifying
coactivators are recruited to an apparently non-nucleosomal DNA template during

infection.

Several different alternatives might explain these seemly contradictory
observations. Perhaps, the enzymatic activities of these chromatin-modifying coactivators
might be involved in roles other than nucleosomal remodeling. Several histone acetyl
transferases are known to acetylate substrates other than histones, such as activators p5 3,
c-Myb, E2F, GATA-l, MyoD, the general transcription factors TFIIE and TFHF and the
high-mobility-group (HMG) chromatin-associated proteins [reviewed by (248, 268)].

This evidence indicates that some HATS might not be modifying only histones but also

 

3 Part of this chapter was published in “Herrera PI and Triezenberg SJ (2004). VP16-dependent association
of chromatin-modifying coactivators and underrepresentation of histones at immediate-early gene
promoters dining herpes simplex virus infection. Journal of Virology 78(18): 9689-9696”.

76

other proteins involved in transcriptional activation as part of potential cascades of

covalent modification controlling transcriptional activation [reviewed by (75)].

Among the best-characterized chromatin remodeling complexes is the yeast
SWI/SNF. This protein complex can relocate nucleosomes, alter DNAase accessibility
patterns and alter the superhelicity of DNA in vitra [reviewed by (212)]. Although
SWI/SNF complexes have been characterized by their ability to modify nucleosomal
structure, naked DNA also stimulates SWI/SNF ATPase activity. Interestingly, SWI/SNF
ATPase activity induces change in DNA topology in nucleosomal and naked DNA
templates (78, 99). Thus, some of these SWI/SNF enzymatic activities in non-
nucleosomal templates might be relevant for activating transcription on nucleosome-flee

HSV-1 viral DNA.

Another non-nucleosomal role for CBP and p300 during transcriptional activation
might be their function as a structural component required for the formation of the pre-
initiation complex or as a part of the holoenzyme (211). Thus CBP and p300 might not be
recruited to the IE gene promoters to acetylate histones but as an integral component of
the pre-initiation complex. In principle, hSWI/SNF might also be recruited to HSV-1 IE
gene promoters as part of the RNA Pol H holoenzyme (48, 215). However, the results
obtained with RP5 infections indicate that BRG-l and BRM are recruited to HSV-1 IE
gene promoters when RNA Pol II is not present at IE promoters, suggesting that BRG-l
and BRM are not recruited as part of the RNA Pol H holoenzyme but rather by specific

interactions with activators present at IE gene promoters (see chapter II).

77

Alternatively, the presence of chromatin-modifying coactivators at viral gene
promoters might suggest that incoming viral DNA associates with histones and thus the
recruitment of these factors represents a mechanism used by the virus to remodel
chromatin. This hypothesis contradicts prevalent models describing the HSV-1 DNA as
non—nucleosomal during lytic infections. However, much of the evidence describing viral
DNA as non-nucleosomal has been obtained for the newly synthesized DNA. Therefore
we tested whether incoming viral DNA is associated with histones at two hours post-
infection using ChIP assays. We used ChIP assays with antibodies that recognized
acetylated histone H3 (K9, K14) and a C-terminal epitope of histone H3 for assessing
total levels of histone H3 regardless of covalent modifications. We performed these ChIP
assays using the same conditions used to detect activators, general transcription factors
and coactivator proteins (see chapter I] for further details). Defining the nucleosomal
status of incoming viral DNA might help to understand the possible roles of chromatin-

modifying coactivators in viral gene expression.

3.2. Materials and methods.

3.2.1. Cells and viruses.

HeLa and Vero cells were grown in Dulbecco’s modified Eagle’s medium

supplemented with 10% fetal calf serum. Stocks of wildtype HSV-1 (strain K08) and the

78

VP16 truncation mutant RPS (276) were prepared in Vero cells and titered by plaque
assays. For gene expression and ChIP assays, HeLa cells (approx. 3 x 107) were infected
with KOS at a multiplicity of infection ranging from 0.1 to S pfu/cell. Infections with
RPS were performed with comparable amount of viral DNA to infected cells as in wild
type infections, using multiplicity of infection ranging fiom 0.1 to 0.5 pfir/ml. The levels
of viral DNA delivered during infection are reflected on the input titration used for the
PCR analysis of IP samples. Typically input titration used 0.5%, 0.1% and 0.02% of

input material used in each IP reaction.

3.2.2. Chemical crosslinking and immunoprecipitation assays.

To crosslink protein-DNA complexes, formaldehyde was added to the medium
overlaying infected cells to a final concentration of 1% for 15 min. The crosslinking
reactions were quenched by adding glycine to a final concentration of 125 mM. Cells
were collected, resuspended in a hypotonic buffer, and dounce homogenized to release
nuclei which were collected by centrifugation. Nuclear pellets were sonicated to obtain
DNA fragments with an average length of 300-400 basepairs. Aliquots corresponding to

10% of the input material were reserved.

Prior to immunoprecipitation, samples were precleared using protein-G agarose
beads (Upstate, Charlottesville VA). Immunoprecipitations were performed using
specific antibodies at concentrations ranging fiom 10 to 50 ug/ml at 4°C overnight.

Antigen-antibody complexes were precipitated using protein-G agarose beads. The beads

79

were washed extensively before protein-DNA complexes were eluted using 100 pl of 50
mM Tris-HCI pH 8.0, 10 mM EDTA, 1% SDS for 20 min at 65 °C. A second eluate,
using 150 pl TE with 0.67% SDS, was added to the first. The combined eluates are
referred to as the pellet sample. Crosslinks were reversed by adding NaCl to 200 mM and
10 pg of RNAase A and incubating at 65°C overnight. After ethanol precipitation,
samples were digested with proteinase K (Boehringer) at 42°C for 2 hours and then
extracted with phenol/chloroform. After another ethanol precipitation, DNA samples

were resuspended in 75 pl TE pH 8.0.

ChIP assays were performed using antibodies or antisera directed against VP16
(283), Oct-1 (a gift from W. Herr, Cold Spring Harbor Laboratory), histone H3 acetylated
at Lys9 and/or Lysl4 (Upstate), a C-terminal epitope of histone H3 (ab1791, Abcam),
and RNA polymerase H (8WGl6, Covance). Control IPs using pre-immune sera

exhibited essentially the same results as mock IPs using no antibody (data not shown).

Semi-quantitative polymerase chain reactions (PCRS) were performed to detect
specific viral or cellular gene fiagments in the immunoprecipitated samples. These
fragments included the promoters of the HSV IE genes (ICPO, ICP27, and ICP4); the
coding region of the ICP27 gene; the promoters of viral DE (TK) and L (V P16,
glycoprotein C) genes; and the promoters of cellular genes U3 snRNA and IFN-B (See
further details in appendix A). Parallel PCRs were routinely performed on serial dilutions
of input samples (typically corresponding to 0.5%, 0.1%, and 0.02% of the total material)

to confirm that observed signals were within linear range of the assay and were

80

comparable between different set of primers. Standard PCR conditions included 0.25 pM
of each primer, 2.5 U T aq DNA polymerase (Invitrogen), 0.1 mM each deoxynucleotide
triphosphate, 2 mM MgC12, 10% Enhancer solution (Invitrogen), with incubation at 95°C
for 5 min followed by 30 to 35 cycles of 95°C for 30 sec, 65°C for 30 sec and 72°C for 1
min and ending with 5 min at 72°C. The Enhancer solution was omitted from reactions
amplifying the ICP27 ORF, U3 snRN A promoter, and IFN-B promoter fragments.
Annealing of primers for amplification of the IFN-B promoter and the GAPDH ORF was

performed at 55 °C.

Quantitative real time PCR analysis (qPCR) was also used to quantify specific
viral and cellular DNA fragments in the immunoprecipitated samples. qPCR were
performed on a ABI Prism 7700 Sequence Detection System using SYBR Green Core
Reagents (Applied Biosystems). Standard PCR conditions included 3 pL of template (IP
sample or input dilution), 0.25 pM of each primer, 0.75 U Taq DNA polymerase
(Applied Biosystems) and 2-3 mM MgC12 in 30 pL final volume. Parallel PCRs were
routinely performed on serial dilutions of input samples (3%, 1%, 0.3%, 0.1%, 0.03%,
0.01% of the input material) to obtain standard curves for each PCR and to determine the
percentage Of input present in each IP. Each sample was measured in duplicate. Error

bars represent range of the technical duplicates.

3.2.3. Sequential chromatin immunoprecipitation protocol.

81

A sequential chromatin immunoprecipitation protocol (Sequential-ChIP) was used
to test co-occupancy of RNA Pol H and histone H3 at the same DNA fiagment. The first
immunoprecipitation and subsequent elution was performed using antibodies directed
against RNA Pol H and the same conditions described on section 3.2.2. The eluted
material (before reversing the cross-links) was subjected to a second irnmunoprecititation
using antibodies directed against histone H3. After the second immunoprecipitation, the
samples were treated following the same protocol described for standard ChIP (section
3.2.2). An aliquot of the eluted material from the first immunoprecipitation was reserved
to test whether the first IP reaction was successful. Semi-quantitative PCR analyses of
first and second [P were performed as in section 3.2.2. Parallel PCRS were used on serial
dilutions of input samples (0.5%, 0.1%, and 0.02% of the total material) to confirm that
the observed Signals were within the linear range of the assay and were comparable

between different set of primers.

3.3. Results.

3.3.1. Histone H3 is present on viral DNA but under-represented at IE gene

promoters.

The presence of chromatin-modifying coactivators at viral promoters prompted us
to test whether histones associate with viral DNA during early times of HSV-1 lytic

infection. Initial experiments used ChIP assays to detect the presence of acetylated

82

histone H3 (K9, K14) on IE gene promoters. We tested first the presence of histones on
viral DNA using this antibody because it has been extensively used in ChIP assays and
because hyperacetylation of histone H3 (K9, K14) generally correlates with gene
expression. Therefore, these modifications might be expected on IE promoters if these
promoters are associated with histones during early times of infection. Approximately 6 x
107 HeLa cells were infected with KOS virus at a multiplicity of infection of 10 plaque
forming units per cell. Cells were fixed at two hours post infection by adding
formaldehyde directly to the medium at a final concentration of 1%. Chromatin was
prepared and immunoprecipitations were performed using the same conditions described

on Chapter H for activators, general transcription factors and coactivators.

Antibodies against acetylated histone H3 on K9, K14 (AcH3) were used along
with antibodies against VP16 and Oct-1 as positive control for the ChIP assay. PCRS
were performed to analyze the levels of IE gene promoters and the cellular U3 snRN A
gene promoter in the IP samples. Figure 12 shows that antibodies directed against VP16
and Oct-1 immunoprecipitated IE gene promoters (ICPO, ICP27 and ICP4) as expected.
Antibodies against Oct-1, but not antibodies against VP 1 6, immunoprecipitated the U3
snRN A promoter as previously observed (see chapter 11). In parallel IP samples, the IE
gene promoters ICPO, ICP4 and ICP27 were not detected using antibodies against
acetylated histone H3. The efficient precipitation of U3 snRN A gene promoter using anti-
AcH3 serum indicates that the [P was successful. This result indicates that acetylated
histone H3 on K9 and K14 is not detected on IE gene promoters at early times of

infection.

83

 

3
2 °/o Input

 

o ‘7
Promoter g 8
ICP27 - -

ropo -—. ----

ICP4 l!- m -

U3 snRNA - --

Figure 12. Acetylated histone H3 at K9, K14 (AcH3) is not detected at IE gene
promoters during early times of infection. ChIP assays were performed using antibodies
specific for VP16, Oct-1 and acetylated histone H3 at K9, K14 (AcH3), in lysates of cells
infected for 2 h by KOS at MOI:10. Controls include precipitations performed without
specific antisera (No Ab) and aliquot of sample prior to precipitation (2% input). Samples
were analyzed using PCR detecting viral IE gene promoters (ICPO, ICP4, ICP27), and the
promoter of the cellular U3snRNA gene. Negative images of ethidium bromide-stained
gels are Shown.

84

The absence of acetylated histone H3 (K9, K14) is in agreement with models
describing viral DNA as non-nucleosomal, but does not necessarily demonstrate that
histones are not associated with viral DNA. To more directly test whether histone H3 is
associated with viral DNA regardless of covalent modifications, ChIP assays were
performed on extracts of infected cells using an antiserum that recognizes a C-terminal
epitope of histone H3. Approximately 6 x 107 HeLa cells were infected with KOS virus at
a multiplicity of infection of S pfu/cells for 2h. After crosslinking, chromatin was
prepared and immunoprecipitations were performed with antibodies directed against
AcH3 and total H3. PCRS were performed to analyze the immunoprecipitated levels of
viral gene promoters and selected cellular promoters as positive controls for the IP
reactions. Figure 13 shows that the promoter regions of ICP27, ICPO and ICP4 were not
immunoprecipitated above control levels in AcH3 IP sample as observed previously.
Similarly, no clear immunoprecipitation of IE gene promoters was detected using
antibodies against H3. The cellular U3 snRN A gene promoter was detected in both
samples as expected, confirming that both IPs were successfirl. The IFN-B promoter was
detected in the anti-H3 sample but not effectively with AcH3 antibody indicating that the
levels of histone H3 acetylation (K9, K14) at IFN-B are relatively law under these
conditions. These results show that our ChIP conditions differentiate a hyperacetylated
(U3 snRNA) from a hypoacetylated promoter (IFN- B). As further controls, we analyzed
the promoter regions of a viral DE gene (TK) and two viral late genes (VP16 and gC).
Unexpectedly, the TK, VP16 and gC gene promoters were immunoprecipitated with the
anti-H3 and at some extent with the anti-AcH3 antisera, indicating that some regions of

the viral DNA do associate with histones

85

Promoter

 

ICPO
ICP4
ICP27

TK

 

VP16
wgn-iu
us snRNA -- - M
IFN [3 m - Q as?

 

ICP27ORF 5" “ -5"

Figure 13. Histone H3 associates with HSV-1 DNA during infection and is under-
represented at transcriptionally active IE gene promoters. ChIP assays were performed
using antibodies specific for histone H3 acetylated at lysines 9 and 14 (AcH3) or for a
carboxyl-terminal epitope of histone H3, in lysates of cells infected for 2 h by KOS at
MOI:5. Controls include precipitations performed without specific antisera (No Ab) and
aliquots of samples prior to precipitation (0.5%, 0.1% and 0.02% input). Samples were
analyzed using PCR detecting viral IE gene promoters (ICPO, ICP4, ICP27), DE (TK), L
(V P16, gC), the promoter of cellular genes U3snRNA and IFN-B and the coding region
of IE gene ICP27 (ICP27 ORF). Negative images of ethidium bromide-stained gels are
shown.

86

Moreover, the coding region of ICP27 was also immunoprecipitated in both IP samples,
indicating that the dearth of histones at IE genes seems to be restricted to the promoter

region of IE genes.

To test whether the association of histones with viral DNA was dependent on
multiplicity of infection and thus an the amount of viral DNA delivered to the cell
nucleus, we performed similar ChIP analysis using anti-AcH3 and anti-H3 in cells
infected with KOS virus at multiplicity of infection of 0.1 pfu/cell. As shown in figure 14
the IE promoters were not immunoprecipitated above background levels in either IP
sample, consistent with the previous experiments using cells infected at higher
multiplicity of infections. The comparatively low levels of PCR amplification of the input
samples is in agreement with reduced levels of DNA delivered by lower multiplicity of
infection. The cellular U3 snRN A gene promoter was immunoprecipitated in both IP
samples indicating that ChIP assays were successful. The promoter regions of TX and
VP16 were inmmunoprecipitated with anti-H3 antisera indicating that the association of
histones with DB and L gene promoters is not affected by low multiplicity of infections,
although the acetylation levels of histone H3 seem to be reduced. This result shows that
the differential detection of histone H3 between IE gene promoters and a DB and L gene
promoter does not change at low multiplicities of infection and confirms that histories are

associated with DB and L gene promoters.

87

Antibody

 

 

 

 

 

 

 

 

 

 

 

.9 Input
” <
Promoter g n o -
< I z
ICPO
ICP4 T , a... "
TK - tins
VP16 ~ ~
U3 snRNA -‘ .

 

 

 

Figure 14. Histone H3 associates with viral promoters at low multiplicity of infections
and is tmder-represented at IE gene promoters. ChIP assays were performed using
antibodies specific for histone H3 acetylated at lysines 9 and 14 (AcH3) or for a
carboxyl-terminal epitope of histone H3, in lysates of cells infected for 2 h by KOS at
MOI: 0.1. Controls include precipitations performed without specific antisera (No Ab)
and aliquot of sample prior to precipitation (0.5%, 0.1% and 0.02% input). Samples were
analyzed using PCR detecting viral IE gene promoters (ICPO, ICP4), DE (TK), L (V P16),
and the promoter of cellular U3snRNA gene. Negative images of ethidium bromide-
stained gels are shown

88

These results indicate that histone H3 is under-represented at the actively
transcribed IE gene promoters during early times of infection. To further test whether the
promoters of actively transcribed IE genes are relatively deprived of histones, we
performed sequential immunoprecipitations using antibodies directed against RNA Pol H
followed by antibodies against histone H3. The first IP reaction result in the enrichment
of viral promoters engaged on transcription (or at least with RNA Pol H at the promoter)
and the second IP is aimed to detect the association of histones at those promoters. Figure
15A shows that the IE gene promoter ICPO and ICP4 and cellular U3 snRN A gene are
immunoprecipitated with antibodies against RNA Pol H as expected. The second
immunoprecipitation using anti-H3 serum resulted in little or no enrichment of IE gene
promoters over background levels (No Ab sample) (Figure ISB). In contrast, the U3
snRN A gene promoter was efficiently detected the second [F indicating that the
sequential-ChIP was successful. This result indicates that the actively transcribed IE gene
promoters are relatively deprived of histones compared to the cellular gene U3 snRN A
and suggest that chromatin-modifying coactivators detected at IE gene promoters are

associated with promoters containing relatively low levels of histones.

3.3.2. Histone H3 is detected in all classes of viral promoters in the absence of the

VP16AD.

The results described in section 3.3.1 suggest that transcription activity is

correlated with the under-representation of histones at viral IE gene promoters. To test

89

A. First lP:

 

U3snRNA - M-— “W

 

B. Second IP:
Antibody
2 Input
Promoter 5:, 2° -

 

rceo p -u...
ICP4 a k...

us snRNA an. d- c-

Figure 15. Histone H3 is not detected at IE gene promoters that are associated with RNA
Pol H during infection by KOS virus. Double-ChIP assays were performed using
antibodies specific for RNA Pol H (A, first IP) and for a carboxyl-terminal epitope of
histone H3 (B, second IP), in lysates of cells infected for 2 h by KOS at M01: 5.
Immunoprecipitated samples fi'om first IP and from the second [P were analyzed using
PCR detecting viral IE (ICPO, ICP4) and the cellular U3 snRNA. Controls include
precipitations performed without specific antisera (N 0 Ab) and aliquots of samples prior
to precipitation (0.5%, 0.1%, 0.02% input).

90

this hypothesis, we assayed the association of histone H3 at IE gene promoters during
infection by the RP5 virus, when transcription of those genes is diminished. In marked
contrast to the previous result, the anti-H3 antiserum efficiently immunoprecipitated the
IE gene promoters in extracts from RP5-infected cells (Figure 16). These promoter
fiagments were not evident in IP using the anti-AcH3 antiserum. This result strengthens
the correlation between transcription and absence of histones, and indicates the VP16 AD
is responsible for either preventing deposition of histones or for the removal of histones
fiom viral IE gene promoters. Moreover, in RP5 infections the TK, VP16 and gC gene
promoters and the ICP27 ORF were also immunoprecipitated by the anti-H3 antiserum
but not by the antiserum recognizing acetylated H3. The presence of the cellular gene
promoters (U3 and IFN-B) in the IP pellets was the same for the two infections,
confirming that the IP reactions were successful. We conclude that transcriptional
activation of IE genes by VP16 has downstream effects on the acetylation status of

histones associated with DB and L gene promoters.

To further examine the differences in histone H3 occupancy between K08 and
RPS infections, ChIP assays were analyzed using quantitative real time PCR. ChIP assays
using anti-H3 antiserum were performed in cells infected with K08 and RP5 for 2 hours.
Parallel immunoprecipitations using no antibodies were performed as control for
background signals (No Ab sample). Aliquots of samples prior to precipitation (1%,
0.3%, 0.1%, 0.04% input) were used to obtain standard curves for the quantification of

the IP samples.

91

>
:3
:r.
0'
a
<

 

 

 

fl 2 Input
Promoter :5 n o
< :1: z ‘—
rcao - —' '
ICP4 1”- i -
ICP27 — __‘_ fi ‘
TK ,, - . - nus
VP16 ' - * - W
gC - - i“ ‘
us snRNA -- ", -'
IFN [3 i !
ICP27 ORF D - t

Figure 16. Histone H3 associates with all classes of viral promoters during infection of
RP5 virus. ChIP assays were performed using antibodies specific for histone H3
acetylated at lysines 9 and 14 (AcH3) or for a carboxyl-terminal epitope of histone H3, in
lysates of cells infected for 2 h by RP5 at M01: 0.]. Immunoprecipitated samples were
analyzed using PCR detecting viral IE (ICPO, ICP4, ICP27), DE (TK) or L (VP16, gC)
gene promoters, the cellular U3 snRNA or IFN-B promoters, or the coding region (ORF)
of ICP27. Controls include precipitations performed without specific antisera (No Ab)
and aliquots of samples prior to precipitation (0.5%, 0.1%, 0.02% input).

92

To account for the background levels of immunoprecipitated materials the
percentage input from No Ab samples was subtracted from the percentage input of IP

samples (Normalized IP).

Figure 17 Shows that during wild type infection histone H3 is under-represented at
IE gene promoter ICPO and ICP27 compared to the levels of histone H3 observed in RP5
infections. This result is consistent with the previous experiments using semi-quantitative
PCR analysis. These results confirmed that histone H3 levels are dependent on the
presence of the activation domain of VP16 and on the levels of transcription of the IE
genes. In contrast, no clear difference is detected on histone H3 occupancy between wild
type infections and RPS infections at the DE gene promoter TK or L gene promoter gC.
This result indicates that the absence of the activation domain of VP] 6 results primarily
in differences on histone H3 occupancy at VP 1 6-dependent genes (IE) but not on DE
(TK) and L (gC) genes at early times of infection. This result also further strengthens the
inverse correlation between histone H3 occupancy and levels of transcription at the IE

gene promoters.

3.3.3. Histone H3 occupancy of viral promoters decreases at 4 hours post-infection.

The under-representation of histone H3 at IE gene promoters observed dming
infections by wild type KOS compared to infections by RP5 virus shows an inverse

correlation between transcription activity and histone H3 occupancy at those

93

ICPO ICP27

Normalized IP
Norrnalrzed IP

 

 

TK C
0.3 0.3 g
E 1 E
E 0.2 E 0.2
E 3
E 0.1 E 0.1
O O
z z
0 0
K05 RP5 KOS RP5

Figure 17. Histone H3 occupancy at IE gene promoter is dependent on VP16AD. ChIP
assays were performed using antibodies specific for a carboxyl-terminal epitope of
histone H3, in lysates of cells infected for 2 h by KOS at MOI: S and by RPS at M0]:
0.0]. Immunoprecipitated samples were analyzed using quantitative real time PCR
detecting viral IE (ICPO, ICP27), DE (TK) or L (gC) gene promoters. Controls include
precipitations performed without specific antisera (No Ab) and aliquots of samples prior
to precipitation (1%, 0.3%, 0.1%, 0.04% input) used to obtain standard curves for the
quantification of the IP samples. Normalized IP = (% input IP - % input No Ab).

94

IE gene promoters. This result suggests that histone occupancy at viral promoters might
change as infection progresses and the levels of viral transcription increases. To test that
hypothesis, ChIP assays using antibodies specific for a carboxyl-terminal epitope of
histone H3 were performed in cells infected with wild type infections for 2 and 4 hours.
As a control, parallel immunoprecipitations were performed with no antibodies (No Ab
samples). The immunoprecipitated samples were analyzed using quantitative real time
PCR. Input dilutions (1%, 0.3%, 0.1% and 0.04% input) were included for each PCR
analysis to obtain standard curves for the quantification of the IP samples. To obtain the
specific IP levels, the percentage of input detected in No Ab samples was subtracted from

the percentage of input detected in IP samples (normalized IP).

Figure 18 shows that histone H3 occupancy at the IE genes promoters ICPO and
ICP27 decreased at 4 hours compared to the levels observed at 2 hours post-infection.
These results further strengthen the inverse correlation between high levels of
transcription and levels of histone H3 at the gene promoter. Interestingly, the levels of
histones detected at the promoter of viral delayed early gene TK and leaky-late gene
VP16 are also decreased at 4 hours compared to the levels observed at 2 hpi during wild
type infections. Transcription fi'om these two genes is not detected at 2 hours but is
readily observed at 4 hours (see figure 7A). Thus the decreased in histone H3 signals
correlates with the activation of TK and VP16 during the progression of the cascade of
viral gene expression. This result indicates that the inverse correlation observed between
histone H3 occupancy and transcription levels at IE gene promoters also is present at a

DB and a leaky-late viral gene. The expression of the true-late genes such as gC requires

95

Normalized IP Normalized IP

Normalized lP

ICPO ICP27

   

   

0.15 0.3
E
0.10 "
g 0.2
E
0.05 o 0.1
2
0
thi 4hpi 2hpi 4hpi
TK VP16
0.3 0.
E:
'u
02 £3 0.
E
0.1 0 0.1
2
0 0
2hpl 4hpi 2hpl 4hpl
QC
0.
0.
0.1
0

 

2hpi 4hpi

Figure 18. Histone H3 occupancy of viral promoters decreases at 4 hpi. ChIP assays
were performed using antibodies specific for a carboxyl-terminal epitope of histone H3,
in lysates of cells infected for 2 h or 4 h by KOS at M01: 5. Immunoprecipitated samples
were analyzed using quantitative real time PCR detecting viral IE (ICPO, ICP27), DB
(TK), leaky-late (VP16) and true-late (gC) gene promoters. Controls include
precipitations performed without specific antisera (N 0 Ab) and aliquots of samples prior
to precipitation (1%, 0.3%, 0.1%, 0.04% input) used to obtain standard curves for the
quantification of the IP samples. Normalized IP = (% input IP - % input No Ab).

96

DNA replication and occurs later in infection than viral DE and leaky-late genes. The
histone H3 occupancy at the gC gene promoter was not clearly affected when comparing
2 h and 4 h samples. This result indicates that as infection progresses from 2 hours to 4
hours histone H3 occupancy is primarily affected at the genes actively transcribed. It also
suggests that histone depletion during transcriptional activation might occur at all classes

of viral promoters.

3.4. Discussion

The recruitment of chromatin-modifying proteins to IE gene promoters might
seem superfluous given previous evidence that HSV-1 DNA is not packaged in
nucleosomes during lytic infection. In striking contrast to that model, our ChIP
experiments detected a distinct association of HSV-1 DNA with histone H3, although this
assay does not directly demonstrate that H3 is present in nucleosomal structures. ChIP
assays using antibodies specific to other core histones (or variant histones), or other
physical assays might be used to assess whether nucleosomes or some other histone
based structures are present on viral DNA. Interestingly, in cells infected by wildtype
virus, histone H3 was under-represented at IE gene promoters compared to DB (TK) and

L (V P16 and gC) gene promoters at early times of infection.

97

The histone H3 levels also decreased at the DE (TK) and leaky-late (V P16) gene
promoters at times when these genes are actively transcribed. Thus, the histone H3
(perhaps in nuclesosomes) is not only under-represented at the IE gene promoters but
seems to also become under-represented at a DB and a leaky-late gene. Similarly, higher
levels of histone H3 were detected at IE promoters during RP5 infection, when those
genes are transcriptionally silent. These results indicate that the VP16 AD is required
either to exclude histones from IE promoters or to remove them, perhaps through the

action of the chromatin remodeling coactivators.

Consistent with our observations, recent reports demonstrated that nucleosomes
are under-represented in the fully remodeled PHOS promoter in yeast upon transcription
induction (23, 239). Furthermore, the under-representation of nucleosomes at actively
transcribed genes seems to be a general phenomenon in yeast (21, 165) (see chapter IV
for further details). The effect of the VP16 AD on acetylation of histones associated with
viral DNA is also noteworthy. Although acetylated H3 was associated with the ICP27
ORF and the DE and L gene promoters during infection by wildtype virus, that
acetylation was absent during RP5 infection. This result suggests that the cascade of viral
gene expression requires histone modifications that are directly or indirectly dependent
on the VP16 activation domain. Given that robust expression of DE and L genes is
observed later than at 2 hours, the H3 acetylation detected in wild type KOS infections at
DE and L gene promoters might represent early events in the remodeling of these

promoters.

98

The presence of CBP, p300, BRG-l and BRM at IE promoters may reflect the
mechanism by which histones are excluded from these promoters. These enzymes might
also fulfill other functions for transcriptional activation in the absence of histones. For
instance, CBP and p300 might be required for pro-initiation complex formation or as a
part of the RNA Pol II holoenzyme (211). Another possibility is that CBP and p300 may
acetylate and thus regulate the activities of other proteins such as activators, HMG
proteins, coactivators and general transcription factors (248, 268). Although SWI/SNF
complexes are best known for their ability to modify nucleosomal structure, naked DNA
also stimulates SWI/SNF ATPase activity, and conversely SWI/SNF ATPase activity
induces changes in DNA topology in nucleosomal and naked DNA templates (78, 99).
Thus, SWI/SNF enzymatic activities on non-nucleosomal templates might be relevant for

activating transcription on nucleosome-free HSV-1 viral DNA.

The relative levels of histone H3 occupancy detected at gene promoters by ChIP
assays relies on the effective recognition of the histones by the specific antibodies used in
the 1P reactions. The changes in IP efficiency per se can be monitor by using internal
controls when comparing two different IP samples. For instance, internal control used for
ChIP assays using anti-AcH3 and anti-H3 antibodies included the promoter of the cellular
genes U3 snRNA and IFN-B. However, changes in ChIP signal at a particular locus might
also occur by epitope masking or by differences in crosslinking efficiencies between
proteins and DNA at different loci or conditions. Our ChIP analyses do not distinguish
whether epitope masking perhaps due to presence of large protein complexes (such us a

RNA Pol H or coactivator complexes) or differences in crosslinking efficiency at

99

different loci are affecting IP efficiency within a particular IP sample. The use of
polyclonal antibodies (such us anti-AcH3 and anti-H3 used in these experiments) might

help to reduce potential problems in interpreting ChIP results due to epitope masking.

100

Chapter IV

Discussion and future work

4.1. Chromatin-modifying coactivators at viral IE gene promoters.

Large efforts have been made in the last decade toward understanding the
mechanisms of chromatin remodeling during transcriptional activation in eukaryotes. We
now know that nucleosomes are not just a static structure compacting DNA but instead
they are highly modified during transcriptional activation. Some of this remodeling
occurs by adding covalent modifications on particular histone residues and thus changing
the structure of the nucleosome. Nucleosomes are also remodeled by changing the
interactions between DNA and histones by ATP-dependent complexes. Chromatin-
modifying coactivators are involved in transcriptional activation in organisms ranging

fi'om yeast to humans.

However, the role of chromatin-modifying coactivators during transcriptional
activation of HSV-1 genes is largely unexplored. Current models describe that viral DNA
during lytic infection does not become nucleosomal and therefore chromatin modifying
coactivators might not be necessary for the activation of HSV-1 genes. Nonetheless, the
activation domain of VP16 has been shown to interact with several chromatin-modifying

coactivators in vitro or in heterologous systems (see chapter I for further details).

101

These observations led us to establish ChIP assays to test specifically whether
chromatin-modifying coactivators were recruited to viral gene promoters during lytic
infections. The results described on Chapter 11 indicate the presence of the HATS CBP
and p300 and the ATPases subunits of human SWI/SNF complex Brg-l and Brm. The
presence of these coactivators at IE viral gene promoters led us further to test whether
incoming viral DNA was associated with histones. The results described on Chapter HI
show that histones (at least histone H3) are associated with incoming HSV-l DNA

suggesting that chromatin remodeling might be required during activation of viral genes.

Several questions remain to be explored regarding the role of chromatin-
modifying coactivators on viral gene expression, including whether chromatin-modifying
coactivators are required for the expression of viral genes and whether other coactivators
known to interact with activators present at IE promoters are also involved in the

expression of IE genes.

4.1.1. Functional role of coactivators in viral gene expression.

The presence of CBP, p300, BRG-l and BRM at IE promoters suggest that these
coactivators participate in the expression of viral genes. However, whether these
chromatin-modifying coactivators are required for the expression of IE genes during
infection remain to be determined. Several approaches might be used to explore this

question. One approach might be to use mutant cell lines defective for particular

102

coactivators. Mutant cells lines defective for the expression of p300, CBP, BRG-l and
BRM might be obtained fi'om the corresponding knockout mice (33, 155, 242, 325).
Since p300, CBP and Brg-l knockout mice have an embryonic lethal phenotype,
embryonic fibroblast cells might be used to test whether these coactivators are required
for the activity of VP16 during infection. 3T3-derived cell lines expressing an inducible
dominant negative mutant (tet-off system) form of hBRM and hBRG-l have been
obtained from T. Imbalzano lab (58). These cell lines might also be used to address the
requirement of the ATPase activity of hBRM or BRGl complexes for the expression of
IE genes. Another alternative is to use an overexpression approach to test for functional
interactions between VP16 and these coactivators. Increasing amounts of a plasmid
encoding particular coactivators might be transfected into HeLa cells to test whether IE
gene expression is affected on those cells. RNA interference might also be used to test
whether these coactivators are required for the expression of IE gene. Initial attempts
using plasmids expressing siRNA targeting CBP, p300, BRG-l and BRM have shown
variable and sometimes modest reductions of the levels of mRN As encoding these
coactivators (data not shown). Improved RNAi approaches including the use of siRN A
pools and validated siRN A sequences to target human genes might be used to more

effectively knockdown the expression of these coactivators.

4.1.2. Additional chromatin-modifying coactivators at [E gene promoters.

103

Other chromatin-modifying coactivators might also be involved in the expression
of IE genes during infection. Possible candidates include coactivators known to interact
with the activators present at [E promoters. The mammalian homolog of the yeast
ADA/SAGA complex, known to interact with Gal4-VP16 in yeast, contains either
hGCNS or PCAF as a catalytic subunit (reviewed in Sterner and Berger, 2000).
Furthermore, Gal4—VP1 6 interacts with GCNS and PCAF in vitro and in heterologous
systems (97, 195, 296). PCAF also interacts with CBP and p300, and thus the presence of
these HATS might also contribute to the recruitment of PCAF to the IE gene promoters.
HCF -1 interacts with the human Sin3 deacetylase and with Setl/Ash2 histone H3-K4
methyl transferase (314). Thus, antibodies against hGCNS and PCAF, Sin3 and Set]

might be used in ChIP assays to test for their presence at IE promoters.

A recent report identified a family of chromatin modifying coactivator proteins
associated with viral DNA at 6 hours post infection (280). This study used a proteomic
approach to identify proteins interacting with a viral protein, ICP8, involved in viral
DNA replication. Immunoprecipitation assays were used to pull down ICP8 and the
interacting proteins were identified by mass spectrometry and immunoblot detection
assays. Several chromatin-modifying coactivators co-immunoprecipitated with ICP8 in a
manner dependent on DNA. These results strengthen the conclusion that chromatin-
modifying coactivators associate with viral DNA during infection. However, this
approach did not distinguish the region on which these chromatin-modifying proteins are
bound to the viral DNA. The chromatin-modifying proteins identified include hSNF2

(TSWI complex), BRG—l and BRM and several BRG-l or BRM associated factors

104

(BAFs), histone deacetylase mSIN3a, histone deacetylase 2, nucleosome-associated
protein-l-like (NAP-l-like) and REST corepressor (280). One possibility is that these
coactivators might be associated with viral promoters. Thus, ChIP assays might be used
to test for the presence of these proteins at IE and other viral promoters during infection.
Since is not clear to which promoter these proteins might be recruited during infection, it
might be interesting to use microarray technology to assess the occupancy of these
factors using an unbiased approach in these ChIP assays (so-called “ChIP on chip”
assays). These “ChIP on chip” assays might also be use to study the recruitment of other
transcription factors in a global manner for all viral promoters during infection. A
difficulty on establishing “ChIP on chip” assays is that HSV—l promoter arrays are not

currently available.

4.1.3. VP16AD subdomains.

ChIP results obtained with RP5-infected cells indicates that the activation domain
of VP16 is required for the efficient recruitment of TBP, RNA Pol II, CBP, p300 and
partially required for the recruitment of BRG-l and BRM to IE promoters (see Chapter II
for details). The VP16AD can be divided in to two sub-domains, namely VP16N (aa 410
to 456) and VP16C (aa 450 to 490), each capable of activating transcription when fused
to a heterologous DNA binding domain. The different patterns of acidic amino acids
surrounding the critical phenylalanines residues of VP16N and VP16C (54, 238, 272) and

functional differences between these two subdomains (84, 140, 295) suggest that VP16N

105

and VP16C may utilize distinct mechanisms of action. Two recombinant viruses RP3 and
RP4, lacking the C-terminal and N-terminal portion of VP16 AD respectively, (276)
might be used in ChIP assays to determine which subdomain is required for the efficient

recruitment of these transcription factors.

4.2. Is HSV-1 DNA non-nucleosomal during lytic infection?

The association of histones with HSV-1 DNA has been studied using different
approaches including nuclease digestion assays of infected cells, electron and
fluorescence microscopy and protein analysis of virion particles (see Chapter I for further
details). The conclusion from these experiments is that most, if not all, viral DNA is non-
nucleosomal during lytic infection. The viral DNA is not associated with histones in the
virion particles and is thought to use the polyamines (spermidine and spermine) contained
in the virion to counteract the negative charge of the DNA inside the capsid (82, 225).
Upon entering the nucleus of the infected cells, prevalent models describe viral DNA as
non-nucleosomal during lytic infection. Only during latent infections does HSV-1 DNA
associates with histones, forming nucleosomal structures similar to that of cellular

chromatin as probed by nuclease digestions assays (60).

However, the mechanisms that would maintain viral DNA free of histones afier
entering the nucleus are largely unknown. It has been suggested that the virion protein 22

(VP22) might help maintaining viral DNA in a non-nucleosomal state by inhibiting

106

histone deposition activities (288). VP22 is one of the most abundant protein components
of the virion particle with approximately 2000 copies per virion (168). Together with
other tegument proteins, VP122 is delivered to the newly infected cells upon infection
where can be localized either in the cytoplasm or the nucleus of infected cells (67, 204,
227). VP22 interacts in vitro with two histone chaperones, template activator factor I a
and B (T AF -Ia and TAP-ID), and inhibits the TAP -1 dependent histone deposition (288).
Thus, the association of VP22 with viral DNA might serve as an inhibitor of histone
deposition during early time of infection (288). This is clearly not the only VP22 fimction
during infection. VP22 also associates with microtubules during infection and is capable
of spreading to neighboring but uninfected cells, suggesting a role in modulating

intracellular trafficking (66).

At later times dining infection the decrease in histone synthesis (320) and the
formation of the replication compartments that exclude cellular chromatin (233) might
contribute to maintain newly synthesized viral DNA free of nucleosomes. The absence of
nucleosomes on replicated viral DNA might help to package non-nucleosomal viral DNA

into newly formed capsids.

Contrary to our expectations, chromatin immunoprecipitation results described in
chapter III detected the association of histone H3 with incoming viral DNA at early times
of infection. These results do not yet indicate that canonical nucleosomes are formed on
viral DNA. Nonetheless, these observations contradict prevalent models describing viral

DNA deprived of histones during lytic infection. A detailed analysis of previous

107

approaches used to explore specifically the association of histones with the incoming
viral DNA might help to reconcile these seemly contradictory results. One study used
micrococcal nuclease digestion to analyze viral DNA on infected Vero cells (166). The
results of this study show that most incoming DNA was insensitive to nuclease digestion
perhaps due to the presence of encapsidated DNA. As noted by the authors, the viral
DNA that was digested yielded heterogeneous fragments and a portion with the size
expected for nucleosomal DNA (166). In cell preparations from brainstems of acutely
infected mice most of the viral DNA was nonnucleosomal, but again a minor fiaction of
viral DNA fragments of the size expected for nucleosomes was consistently detected
using micrococcal digestions (205). In another study the nucleosome-like fragments were
not detected among incoming viral DNA digested with staphylococcal nuclease and the
TK coding region as a probe to detect viral DNA (167). Thus, in two reports using
nuclease digestion sensitivity assays some fraction of the incoming viral DNA was

observed with characteristics consistent with nucleosomal DNA.

As for later times in infection, dramatic changes in cellular chromatin are
observed resulting in the perinuclear accumulation of cellular chromatin. Viral DNA
replication occurs within this newly formed electron transparent regions in the replication
compartments (233, 234). Electron microscopy studies have shown the accumulation of
naked viral DNA in infected cells. Interestingly, the presence of non-nucleosomal DNA
was dependent on viral DNA replication, thus the status of incoming viral DNA was not
clear (206). The exclusion of cellular chromatin in the replication compartment has been

also studied using fluorescence microscopy. Cells expressing a fusion protein of histone

108

H2B and the green fluorescence protein (OF P) were infected with HSV-1 and the nuclear
changes were observed during late times of infection. The characteristic perinuclear
distribution of cellular chromatin was again observed and no incorporation of H2B-GFP

on replication compartments was detected (203).

A recent study explored once again the association of histones with incoming
viral DNA using micrococcal nuclease digestion, with the addition of ChIP assays as a
more direct method to test the association of histones with viral DNA (135). The nuclease
digestion assay showed again the absence of the DNA ladder characteristic of regularly
spaced nucleosomes at different times during lytic infections. However, a small fiaction
of mononucleosome size viral DNA was observed. The ChIP assays showed the
association of acetylated H3 (K9, K14) with the ICPO, TK and VP16 promoters. The
acetylation signal observed at 1 and 3 hpi is in overall agreement with the relative AcH3
levels observed at 2 hpi described in Chapter III. The levels of histone H3 were not
monitored in this study, but the low levels of histone H3 acetylation detected at the ICPO
promoter by Kent et a1. is in agreement with the under-representation of histones
observed at this promoter (see chapter HI). Interesting, the acetylation levels of histone
H3 were drastically reduced at the TK and VP16 promoter at 6 hpi. This decrease might
represent the deacetylation of histone H3 by HDACs or it might indicate that histone H3
levels are reduced at those promoters at 6 hpi. Similar results were observed with
antibodies directed against methylated histone H3 (K4). The authors concluded that the
HSV-1 genome is at least partially nucleosomal, although apparently not in a regular

repeating structure, moreover the histone modifications observed at viral genes correlate

109

with histones modifications observed at actively transcribed genes in other biological

systems (135).

4.3. Association of histones with incoming HSV-l DNA.

One model consistent with all of the above observations would describe the
association of histones with at least a fraction of the incoming viral DNA. Histones might
be deposited on viral DNA by replication dependent or replication independent
mechanisms using preexisting pools of canonical histones or any of the histone variants.
The incoming viral DNA associated with histones might be actively engaged in the
productive infection cycle and thus might require chromatin remodeling activities during
transcription of the viral genes. The presence of histone and formation of chromatin on
viral DNA might repress viral gene expression until the proper activation signal is
present. The observed cascade of viral gene expression during lytic infections might be
dictated in part by the repressive effect of nucleosomes on viral DNA. At later times in
infection, the newly replicated viral DNA accumulates in regions that exclude cellular
chromatin and would not become associated with histones. This nucleosome fiee viral
DNA would then be packaged in capsids during virion assembly. The down-regulation of
histone synthesis during infection (320) might also contribute to the accumulation of

newly synthesized viral DNA deprived of nucleosomes.

110

This new model describing the incoming viral DNA as nucleosomal would
predict that the expression of viral genes requires chromatin modifying coactivators. This
is consistent with the association of HATS (CBP and p3 00) and ATP-dependent
chromatin remodeling complexes (BRG-l and BRM) with IE promoters (see chapter 11).
It would also help to explain why the viral activator VP16 evolved the capability to

interact with chromatin-modifying coactivators and to remodel chromatin domains.

The association of histones with incoming viral DNA might result in a repressive
environment for the transcription of viral genes. In different cell types, such as sensory
neurons, the absence of the correct cofactors or differences in metabolic states might
result in the inability of the virus to counteract the repressive effect of chromatin resulting
in latent infections. During latency, the viral DNA is associated with histones and is
transcriptionally silenced with the exception of the LAT genes [reviewed by (20)]. Using
ChIP assays hyperacetylation of histone H3 (K9, K14) has been observed at the LAT
promoter but not at the repressed ICP4 and DNA Pol viral gene promoters on latent
HSV-1 genomes (151). These results suggest that chromatin remodeling might be

involved during reactivation of latent viral DNA.

4.4. Does VP16 prevent deposition or promote disassembly of histones at viral IE

gene promoters?

111

Chromatin immunoprecipitation analyses of histone H3 on viral DNA at early
times of infection Show that histone H3 is under-represented on IE gene promoters
compared to DB (TK) and L (VP16 and gC) promoters. These lower levels seems to be
restricted to the promoters since the ICP27 ORF is efficiently immunprecipitated with
antibodies recognizing H3 (total H3 and AcH3 K9, K14). Since viral DNA is not
associated with histones in the virion particle, the low levels of histones detected at the IE
promoters might either result from the active disassembly of the nucleosomes upon
activation of the IE gene or from preventing the deposition of histone at those promoters.
The reduction of histone H3 levels between 2 and 4 hours post infection at the [CFO and
ICP27 gene promoter suggest that histone might be displace from the IE promoter. Time
course experiments might be used to test more explicitly the dynamics of histone H3
occupancy at [B gene promoters during the first hours of infection. Alternatively, RP5
infected cells might be subsequently infected with HSV-2 to test whether the levels of

histone H3 are reduced at the HSV-1 IE promoters by VP16 delivered by HSV-2.

In RP5 infections the expression of the IE genes is highly reduced (see Chapter II
for further details). Under these conditions, the levels of histone H3 detected by ChIP
assays at two hours post infections are higher that those observed in wild type (KOS)
infections. This result indicates that the level of histones H3 at [E promoters inversely
correlates with the levels of transcription of those genes. One hypothesis might predict
that the high density of RNA Pol H at IE genes during wild type infections results in the
under-representation of histone H3 at the IE gene promoters. ChIP assays performed with

cells treated with transcriptional inhibitors might be used to distinguish whether

112

transcription per se is required for the low levels of histones detected at the IE gene

promoters.

Alternatively, the under-representation of histones at IE promoters might be a
result of a protein activity recruited directly or indirectly by VP16AD. This protein
activity might either prevent the deposition of histone or induce the active disassembly of
nucleosomes at the IE promoters. Precedents for both notions are found in the literature.
van Leeuwen et al. proposed that the inhibitory activity of VP22 on TAF-I mediated
histone deposition might contribute to maintain viral DNA deprived of histone (see
further details on section 4.1). The model proposed by the authors assumes that VP22
binds non-specifically throughout the viral DNA preventing histone deposition. An
alternative, and testable hypothesis, might propose that the under-representation of
histones is the result of the localized activity of VP22 at IE promoters on the incoming
viral DNA. Since VP22 binds to DNA without apparent sequence specificity, the
targeting of VP22 to IE promoters might not involve direct cis-element recognition. The
activation domain of VP16 interacts with VP22 and thus provides a specific mechanism
for the recruitment of VP22 to IE promoters (65). It is interesting to note that the
overexpression of TAF-Ia interferes with the progression of HSV-1 infection apparently
by a general inhibition of viral gene expression (288). Perhaps, high levels of TAP-I
overcome VP22 inhibition resulting on increased histone deposition on viral DNA and
the silencing of the cascade of viral gene expression. ChIP assays might be used to

address whether VP22 and TAP-I are recruited to IE promoters or other loci on viral

113

DNA. Overexpression of TAF -1 might be used to test whether histone deposition on viral

DNA is increased by higher levels of TAP-1.

The disassembly of nucleosomes upon transcriptional activation at yeast promoter
has been recently observed using ChIP assays. The first two of such studies used ChIP
analysis for histones H3 and H2B at the endogenous Ph05 gene promoter. Upon
activation, the nucleosomes were first hyperacetylated and then displaced or removed
from the promoter (239). Another independent study used topological, sedimentation,
nuclease digestion and ChIP analyses to Show that nucleosomes are unfolded in the active
Ph05 promoter (23). To distinguish between disassembly or sliding of the nucleosomes,
the Ph05 promoter was excised from the chromosomal locus forming chromatin circles.
Upon activation of the Ph05 promoter the number of nucleosomes was diminished in the
chromatin circle indicating that nucleosomes are disassembled rather than moved to an
adjacent location (24). This nucleosomal displacement is also observed in another yeast
promoter (Pho8) and is reversible since the histone levels are restore to normal levels
after transcription of the gene has been repressed (2). This disassembly of nucleosomes

requires the histone chaperone Asf-l and is essential for transcriptional activation (2).

More recently, genome-wide analysis of histone occupancy on Saccharongaces
cerevisiae using “ChIP on Chip” assays determined that nucleosomal depletion is
observed on promoters of actively transcribed genes (21, 165). During rapid mitotic
growth, the amount of histones at gene promoters was inversely proportional with the

level of transcription (165). Furthermore changes in global transcription program by heat

114

shock or a change in carbon source resulted in the increase in nucleosome occupancy at
repressed gene promoters and decreased occupancy at the promoters that become active.
Histone depletion was generally observed only at the promoter region, but was also
observed at the coding region of heavily transcribed genes (165). Another study reported
that upon activation of Gall promoter in yeast, nucleosomes were not only under-
represented at the promoter region but also at the coding region. The reduced levels of
histone H3 were not observed in the ORF of other three genes transcribed at lower levels
than the galactose regulated reporter gene. The authors concluded that histones are
displaced fi'om actively transcribed promoters and suggested that histone depletion at
ORF might be observed only at heavily transcribed genes (149). These recent reports
collectively indicate that nucleosome depletion at gene promoters is a general
phenomenon in yeast and suggest that it might occur during transcriptional activation in

other eukaryotic organisms.

The cascade of events during transcriptional activation of a silenced locus has
been observed in mammalian cells using light microscopy and a combination of
fluorescent fusion proteins (116). Several interesting observations arose from these
eXperiments including the replacement of canonical histone H3 by histone variant H3.3
during transcriptional activation of the silenced locus. The replacement of the histone H3
upon gene activation implies the active exchange of nucleosomes, or at least of
nucleosome components, at an active gene promoter. This active exchange might be the
result of the disassembly and subsequent reassembly of nucleosomes during

transcriptional activation in a manner analogous to the Ph05 promoter. It will be

115

interesting to test whether the overall levels of histones are decreased at the promoter
region during gene activation. Histone H3 replacement has been previously observed in
Drosophila where actively transcribed regions including ribosomal DNA arrays become
enriched with histone H3.3 (3). Furthermore, certain histone modifications associated
with transcriptional activation, such as acetylation of Lys9 and Lysl4 of H3, are over-
represented in H3.3 compared to histone H3, strengthening the link between histone H3.3
and transcriptionally active genes (193). Collectively this evidence suggests that histones
can be disassembled and reassembled at actively transcribed genes and that this assembly
might result in the enrichment of nucleosomes with particular histone variants including

histone H3.3.

Since many of the steps that control gene regulation are conserved among
eukaryotes, some of these mechanisms involving balance between histone disassembly
and histone deposition might be relevant for viral gene expression. It would be interesting
to study the mechanisms involved in the deposition of histones on incoming viral DNA
and whether any of the histone variants are associated with the viral DNA. The ChIP
assays described in Chapter [U do not discriminate between histone H3 variants and thus
the question of which histone H3 is associated with viral DNA remains open. Recently
developed antibodies (Abcam) that specifically recognized histone H3.3 might be used in
ChIP experiments to directly test whether this histone variant is associated with viral

DNA.

116

4.5. Are histones displaced from all classes of HSV-1 gene promoters during cascade

of gene expression?

The disassembly of nucleosomes during transcriptional activation has been
observed in yeast promoters (see section 4.3. for details) and thus might be an integral
step in transcriptional activation in eukaryotes. The IE gene promoters show an inverse
correlation between levels of histones and transcription activity. In that context, the
activation of the DE and Late genes might require the disassembly of the nucleosomes
present at those promoter regions. The differences observed in histone H3 occupancy
between 2 and 4 hours post-infection at IE genes [CFO and ICP27 as well as at the TK
and VP16 gene promoter further suggest that histone disassembly might occur during
viral gene activation. Time course experiments using ChIP assays detecting the levels of
histones might be used to test whether the histone content decreases at all classes of viral

promoters as the cascade of viral gene expression progresses.

The decreasing complexity in the architecture of viral promoters between IE, DE
and L promoters might result in differences in the ability of these promoters to
recruitment chromatin-modifying coactivators. It is tempting to speculate that the true-
late gene promoters consisting only of core promoter elements might not be able to
overcome the repressive effect of nucleosomes. It is well established that true-late genes
require viral DNA replication in order to be transcribed [reviewed by (303)]. No

mechanisms have been accepted for this seemly paradoxical phenomenon where DE and

117

L genes require the same IE proteins to be expressed but L genes remains silenced until

DNA replication occurs.

One hypothesis consistent with the model described above (section 4.1.2.) might
predict that IE, DE and leaky-late promoters recruit chromatin modifying coactivators
and thereby overcome the repressive effect of nucleosomes. The different cis elements
upstream of the IE, DE and leaky-late core promoters might be involved in the
recruitment of these coactivators. True-late genes consisting only of core promoters
might not be able to overcome the repressive effect of nucleosomes. Only after DNA
replication might the core promoter become accessible for the binding of the general
transcriptional machinery allowing transcription. The presence of newly synthesized
template DNAS devoid of histones might help exposing the core promoter elements.
Time course ChIP experiments might be used in combination with inhibitors of viral

DNA replication to test the predictions arising from this model.

4.6. Chromatin and other animal viruses.

The genetic material of many viruses is targeted to the nucleus where is
transcribed and replicated using cellular factors. Thus, the association of viral DNA with
histones has been studied in several viruses including retroviruses and DNA viruses. The
results of these studies reveal both common and distinct strategies to overcome the

repressive environment that chromatin poses to viral gene expression. The role of

118

chromatin in the expression of genes of a retrovirus (HIV), double stranded circular DNA
virus (SV40), double stranded linear DNA virus (adenovirus) and other herpesviruses

(CMV, EBV and KSHV) will be discussed to illustrate these differences and similarities,.

4.6.1. Human immunodeficiency virus type-l.

The viral RNA of the human immunodeficiency virus type 1 (HIV -1) is reverse
transcribed and integrated into the host genome. The viral DNA is packaged into
chromatin and remains transcriptionally silent in the absence of stimuli [reviewed by
(187)]. The reactivation of HIV-1 occurs from a nucleosomal template and thus the virus
has evolved mechanisms to recruit chromatin-modifying coactivators to activate the
transcription of viral genes. The long terminal repeat (LTR) region of viral DNA contains
a core promoter and enhancer-like sequences that direct the viral gene expression during
reactivation of the integrated viral DNA. The LTR core promoter and enhancer-like
region contain DNA sequences recognized by several different cellular activators,
including Spl, NF-KB and nuclear receptors [reviewed by (187)]. Any of these cellular
activators that bind to the LTR promoter might recruit chromatin-modifying coactivators
during the reactivation of the viral genes. It has been shown that the transcriptional
activation of the long terminal repeat (LTR) of HIV by thyroid hormone receptor (TR)
requires chromatin disruption and histone acetylation (107). The Tat protein is the viral
transactivator that activates LTR expression. Tat binds to a cis- element present in the

nascent viral RNA (trans-activation response region, TAR) and helps to recruit an

119

elongation-competent RNA Pol H to the viral promoter boosting viral gene expression.
Tat interacts with the positive elongation factor P-TEFb and with HATS including CBP,
PCAF, GCN 5 and TIP60 [reviewed by (27)]. Thus, Tat and any of the cellular activators
bound to the LTR promoter might recruit HATS and chromatin-modifying coactivators to
influence chromatin structure. It has been shown that activation of LTR by Tat results in
the hyperacetylation of histone H3 and H4 and displacement of positioned nucleosomes
at the promoter (183, 289, 290). Collectively this evidence shows that HIV -1 life cycle
involves the association of viral DNA with chromatin and that the virus has evolved
mechanisms to use the cellular machinery to remodel chromatin during transcription of

viral genes.

4.6.2. Simian virus 40.

Simian virus 40 (SV40) is a double stranded circular non-enveloped DNA virus.
The viral DNA is packaged into nucleosomes in the virion and remains associated with
histones during lytic infection (review by (130) and references therein). SV40, a
relatively small virus, contains two transcriptal units expressed in a temporal cascade.
The early gene transcript due to differential splicing, encodes the large T antigen (LT),
small T antigen (ST) and 17K T antigen (17KT) [reviewed by (251)]. These viral proteins
induce cell cycle progression producing the proper environment for viral DNA
replication. The SV40 genome contains a nucleosome-free region that includes the

promoter directing early gene expression and the viral origin of replication (115, 256).

120

The absence of histones in these regions is thought to facilitate the binding of cellular
transcription factors for the expression of the early genes. Viral early expression is then
followed by viral DNA replication and late gene expression. The transcription start site of
the late promoter is associated with nucleosomes and remains transcriptionally silent until
viral DNA synthesis occurs [reviewed by (251 )]. Thus, nucleosomes are present on SV40
throughout lytic cycle. The absence of nucleosomes at the promoter region and the
dependence of late gene expression on viral DNA replication suggest that chromatin

might be inhibitory for the expression of viral genes.

4.6.3. Adenovirus.

Adenovirus is a non-enveloped double stranded linear DNA virus. The viral DNA
on the virion particle is associated with four viral encoded proteins polypeptide V, VII,
mu and the terminal protein (I'P). Among these core proteins, the basic viral protein VII
is the most tightly bound to the viral DNA (reviewed by (130) and references therein).
Micrococcal nuclease digestion assays have shown that during infection viral DNA is
protected resulting in the formation of discrete nucleosomal-like fragments. However, the
length of the protected DNA fragment does not seem to correspond to the size of the
nucleosomal repeat of cellular chromatin (57, 199, 279). These results suggest that
structures different than canonical nucleosomes are assembled on viral DNA during
infection. Indeed, at least some fraction of the viral DNA remains associated with protein

VII during lytic infection (42, 120). Thus, the association of protein VII with the viral

121

DNA observed in the virion particle is maintained throughout early times of infections
and might be responsible for the nuclease protection of the viral DNA observed during
infection. However, the absence of histones on viral DNA during infection has not been

demonstrated (120).

The major viral activator of early gene expression, ElA, interacts with chromatin-
modifying coactivators such as CBP/p300, TRRAP/GCN 5 and ATP-dependent
chromatin remodeling complexes (8, 76, 181). These interactions however are not
necessarily an indication of chromatin remodeling on viral promoters, since ElA have
been shown to activate cellular genes and disrupt normal cellular gene expression leading
to cell cycle progression and tumorgenesis. The mechanisms used by EIA for disrupting
the cellular gene expression also include displacement of HATS from their cellular

functional targets and modulation of the catalytic activity of the targeted HATS [reviewed

by (39)]-

ElA has been shown to influence the chromatin structure of targeted cellular
genes. The association of BIA with E2F responsive genes results in the elimination of
histone H3 K-9 methylation and in the acetylation of the same residue on histone H3
(81). As for the viral gene expression, the activation of the early promoter by EIA in
transfection assays requires the HAT activity of CBP/p300 and results in the
hyperacetylation of histone H4 at the transfected early promoter (71 ). These results
obtained with the adenovirus early promoter suggest that the activation of viral promoter

during infection might require chromatin remodeling activities; however the actual role

122

of chromatin and chromatin modifying activities during adenovirus infection remains

largely unknown (120).

4.6.4. Herpesviruses

Examples of well-studied herpesviruses where the association of histones with
viral DNA and the role of chromatin during infections have been explored include
cytomegalovirus (a beta-herpesvirus), Epstein-Barr virus and Kaposi’s sarcoma-

associated herpesvirus (both gamma-herpesviruses).

In the case of CMV, latency is established in monocytes and reactivation of the
virus is observed during differentiation to macrophages (109, 198). The reactivation of
viral gene expression induces changes in DNase I hypersensitive sites at the promoter
region of the major immediate early protein (MIEP) (216). The CMV reactivation is also
stimulated by inhibitors of histone deacetylase trichostatin A, further connecting changes
in chromatin structure with activation of viral genes (208). In non-permissive cells the
MIEP promoter is associated with heterochromatin protein 1 (HPl) suggesting the
formation of heterochromatin-like structures on the silent viral genome (208). During
reactivation, the MIEP promoter is associated with acetylated histone H3 and histone H4
indicating the presence of nucleosomes on CMV DNA (208, 278). AS for chromatin-

modifying activities that might be recruited to viral genes, the immediate early protein

123

IE86 has been shown to interact with HAT P/CAF and the viral activator pUL69 with the

Spt6 subunit of the FACT complex (Facilitates Chromatin Transcription) (32, 309).

Epstein-Barr virus establishes latent infection in B lymphocytes. The latent viral
DNA is organized in nucleosomes and maintained as an extrachromosomal episome (62,
258). During latent infections the viral activator EBNA2 activates the expression of viral
proteins require for the immortalization of lymphocytes (50). The activation domain of
EBNA2 can interact with chromatin-modifying coactivators including HATS CBP, p300
and P/CAF and the human SWI/SNF complex (296, 312). The activation of two viral
promoters by EBNA2 results in the hyperacetylation of histones H3 and H4 (4). During
the early stages of the lytic reactivation cycle the viral activator Zta activates the
expression of several viral genes (134, 170). Zta interacts with CBP and stimulates its
HAT activity in vitro (43). Dming reactivation of EBV infected cells CBP is recruited to

viral promoters resulting in hyperacetylation of histone H3 and H4 (59).

Kaposi’s sarcoma-associated herpes virus (KSHV) is maintained as a multicopy
episome in latenly infected B-lymphocytes. During latency only a small group of viral
genes are expressed and are thought to contribute to deregulate the cell cycle [reviewed
by (118)]. The reactivation of the latent KSHV requires the viral transcriptional activator
protein Rta (90, 180). Inhibitors of histone deacetylases trichostatin-A and sodium
butyrate stimulate KSHV reactivation suggesting a role of chromatin in regulation of
viral gene expression. Rta interacts physically and functionally with CBP and SWI/SNF

and induces changes in chromatin structure on responsive genes during reactivation (93,

124

178). The promoter of the ORFSO coding for Rta contains a positioned nucleosome at the
transcription start site that is remodel upon transcriptional activation observed during

reactivation from latency (178).

Collectively this evidence indicates that viruses have evolved mechanisms to
modulate chromatin structure during their life cycle. The presence of nucleosomes on
viral DNA is generally associated with gene repression and thus viral activators are
known to recruit chromatin-modifying coactivators to remodel the chromatin structure of
promoters. Examples of chromatin-modifying coactivators that interact with viral
activators are major HAT such as CBP and p300 and mammalian SWI/SNF complexes.
Interesting, during lytic infections by different types of viruses including polyomaviruses
(SV40), adenovirus, and HSV-1 late gene expression is coupled to viral DNA replication
(reviewed by (130) and references therein) suggesting that changes in chromatin
configurations during DNA replication might be another mechanism to overcome

repressive effects of chromatin.

The presence of nucleosomes in viruses fi'om the Herpesviruses family is well
established during latency. The role of chromatin remodeling has been studied during
reactivation of Beta- and Gamma-herpesviruses. For Alpha-herpesviruses (HSV-1) the
role of chromatin remodeling during reactivation remain largely unexplored and only
very recently the role of chromatin remodeling has been addressed on viral gene

expression during lytic infection (105, 135).

125

Appendix A

Chromatin immunoprecipitation assays

A. 1 . Chromatin immunoprecipitation protocol.

The chromatin immunoprecipitation protocol used for studying association of
proteins with viral DNA during herpes simplex virus infection is based on protocols
described in (26) and in Current Protocols in Molecular Biology (Chapter 21).

ChIP assays typically used one pl 50 tissue culture dish with 2 x107 cells per
immunoprecipitation sample. The protocol described below was typically used for three

immunoprecipitation reactions.

Day 1:

1. Seed 3 p150 tissue culture dishes each with approximately 1 x 107 HeLa cells.

Day 2:
2. HSV-1 infection. Use multiplicity of infection of 5 pfu/cell.
2.1. Wash cells with 10 ml DMEM w/o FBS and add inoculum in 4 mL of
DMEM w/o FBS.
2.2. Incubate 1 hour at 37 °C with periodic rocking of the plates.
2.3 Aspirate inoculum. Wash cells with 10 mL of DMEM w/o F BS.
2.4 Add 25 mL of DMEM 2% F BS. Incubate at 37 °C.

3. Cross link protein and DNA complexes with formaldehyde.

126

3.1. Add 0.69 mL formaldehyde 37% directly to the medium to obtain 1%
final concentration. Incubate at room temperature for 15 minutes.
3.2. Quench cross link reactions by adding 3.67 mL of glycine 1 M to yield
125 mM final concentration.

4. Prepare chromatin samples.
4.1 Wash with cold PBS supplemented with 0.5 mM fresh PMSF
(PBS/PMSF).
4.2 Add 10 ml of PBS/PMSF. Scrape cells. Transfer to a 50 ml conical tube.
4.3 Collect cells by centrifugation (1,000 rpm for 5 min).
4.4. Wash pellet with 10 mL PBS/PMSF. Centrifuge.
4.5. Resuspend cells in 3 ml swelling buffer (5 mM PIPES pH 8.0, 85 mM
KCl, 0.5 % IGEPAL CA-630, 0.5 mM PMSF, 100 ug/ml leupeptin and
aprotinin). Incubate on ice for 20 min.
4.6. Disrupt cells using 20 strokes of dounce homogenize with B pestle.
4.7. Collect samples by centrifugation. 4,000 rpm for ‘10 min.
4.8. Resuspend pellet in 0.5 mL sonication buffer (1% SDS, 10 mM EDTA, 50
mM Tris-HCl pH 8.1, 0.5 mM PMSF, 100 ug/ml leupeptin and aprotinin).
Incubate on ice 10 min.
4.9. Sonicate samples on ice to obatain DNA fragments of 200-500 bp in
average using sonicator. (Use microtip with 5 pulses of 30 seconds each. Cycle
time 1 second. Out put control: 3).

4.10. Centrifuge samples at 14,000 rpm for 10 min at 4 °C. Save supernatant.

127

5. Immunoprecipitations.

Day 3:

5.1. Prepare 50% slurry of protein-G agarose (Upstate) in triton lysis buffer:
(50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% Triton X-100, 1% BSA.
supplemented with 10 ug/ml salmon sperm DNA). Wash protein-G beads with
triton lysis buffer 5 times. Centrifuge at 500 rpm for 5 min between washes.

5.2. Add 40 uL protein-G agarose beads (50% slurry) to supernatant fi'om step
4.10. Incubate at 4 °C for 2 h on rotator. Centrifuge at 500 rpm for 5 min.
Supematants are referred as precleared samples.

5.3. Incubate 150-180 uL of the precleared sample (from step 5.2.) plus 0.9

mL triton lysis buffer plus antibody (10-50 ug/ml) overnight at 4 °C. Retain at

least 20 uL of precleared sample to prepare 10% input samples.

5.4. Add 40 uL of protein-G beads. Rotate for 4-5 hours at 4 C.

5.5. Centrifuge at 500 rpm for 5 min. Save supernatant in case unbound
fraction need to be analyzed.

5.6. Wash beads by adding 1 ml Triton wash buffer. Rotate 5 min at room
temperature.

5.7. Repeat step 5.5 with Lysis Buffer 500 (0.1% sodium deoxycholate, 1 mM
EDTA, 50 mM HEPES pH 7.5, 500 mM NaCl, 1%, Triton X-100) then
LiCl/detergent (0.5% sodium deoxycholate, 1 mM EDTA, 10 mM EDTA, 250
mM LiCl, 0.5% IGEPAL CA-630, 10 mM Tris-HCl pH 8.0) and finally with Tris-

EDTA pH 8.0.

128

6. Elution:
6.1. Add 100 uL elution buffer (10 mM EDTA, 1% SDS, 50 mM Tris-HCl pH
8.0) to the beads. 20 min at 65 °C. Transfer supernatant to a new tube.
6.2. Add 150 uL TE/0.67% SDS to the beads, invert several times and then
centrifuge up to full speed. Combine this second elution (150 pl) with the first —

step 6.1 .-. (This combined material is referred to as the precipitate).

7. Reverse cross links.
7.1. Add 62.5 uL of 1M NaCl to yield 200 mM final concentration and 10 ug
of RNAase A to reverse crosslinks. Incubate samples at least 6 hours at 65 °C.
7.2. In parallel prepare 10% input sample. Use 15-18 p.L of precleared sample
from step 5.2. plus TE/0.67% SDS to 250 uL. Usually this incubation is

overnight.

Day 4:
8. Purification of precipitated DNA.
8.1. Precipitate samples with 2 volumes of ethanol.
8.2. Resuspend samples in 100 uL of TE pH 7.5 plus 5X proteinase K buffer
and 20 pg of proteinase K. Incubate at 42 °C for 2 hours.
8.3. Extract with phenol/chloroform/isoamylalcohol (1 vol = 125 uL) *.
8.4. Precipitate with 2 volumes of ethanol and 1/ 10 volume 3M sodium acetate

(pH 5.3).

129

8.5. Resuspend in 75 uL TE pH 8.0.

‘2 Alternatively DNA can be purified after proteinase K treatment using
QIAquick PCR purification kit (QIAGEN cat# 28104). Elute DNA using 75 uL of

TE pH 8.0.

PCR analysis.

Precipitated samples can be analyzed using semi-quantitative polymerase chain
reaction (PCR) follow by ethidium bromide stained agarose gels or using quantitative
real-time PCR (qPCR). PCR conditions used for analysis of ChIP samples are described

below.

Semi-quantitative PCR.

PCR were performed to detect specific viral or cellular gene fragments in the
immunoprecipitated samples. These fragments included the promoters of the HSV IE
genes (ICPO, ICP27, and ICP4); the coding region of the ICP27 gene; the promoters of
viral DE (TK) and L (V P16, glycoprotein C) genes; and the promoters of cellular genes
U3 snRNA and IFN-B (Table 1). Parallel PCRS were routinely performed on serial
dilutions of input samples (typically corresponding to 0.5%, 0.1%, and 0.02% of the total
material) to confirm that observed signals were within linear range of the assay and were
comparable between different set of primers. Standard PCR conditions included 0.25 M
of each primer, 2.5 U Taq DNA polymerase (Invitrogen), 0.1 mM each deoxynucleotide

triphosphate, 2 mM MgC12, 10% Enhancer solution (Invitrogen), with incubation at 95°C

130

for 5 min followed by 30 to 35 cycles of 95°C for 30 sec, 65°C for 30 sec and 72°C for 1
min and ending with 5 min at 72°C. The Enhancer solution was omitted from reactions
amplifying the ICP27 ORF, U3 snRNA promoter, and IFN-B promoter fragments.
Annealing of primers for amplification of the IFN-B promoter and the GAPDH ORF was

performed at 55 °C.

Quantitative real-time PCR.

qPCR was used to quantify specific viral and cellular gene fi'agments in the
immunoprecipitated samples. qPCR were performed using SYBR Green PCR core
reagents kit (Applied Biosystems) on an ABI Prism 7700 Sequence Detection System
(Applied Biosystems). The fragments analyzed included the promoters of the HSV IE

genes ICPO and ICP27; the coding region of IE genes; the promoter and coding regions

of viral DE (TK) and L (V P16, gC) genes; and the promoter of cellular genes U3 snRNA

and IFN-B (Table 2). Parallel PCRS were routinely performed on serial dilutions of input
samples (3%, 1%, 0.3%, 0.1%, 0.03%, 0.01% of the input material) to obtain standard
curves for each PCR. IP and input dilution samples were routinely analyzed in duplicate.
Figure 19 shows representative standard curves for qPCR detecting IE gene promoters
ICPO, ICP27, L gene promoter VP16 and the promoter of the cellular gene U3 snRNA.
The standard curves were used to determine the percentage of input present in each IP
sample for a given fragment of DNA. To account for the background
immunoprecipitation, the % input of “N 0 Ab” samples was subtracted fi'om the % input
of IP samples and reported as “normalized 1P” signal. The intercept with y-axis of a
particular standard curve might be used to compare the amounts of viral DNA when two

131

different infections are analyzed. Standard PCR conditions included 3 uL of template (IP
sample or input dilution), 0.25 M of each primer, 0.75 U Taq DNA polymerase

(Applied Biosystems) and 2-3 mM MgC12 in 30 uL final volume.

132

Table l. Oligonucleotides used in semi-quantitative PCR reactions analysis of ChIP
samples. PCR primers were designed to detect viral immediate early (IE), delayed early
(DE) and late (L) gene fragments. Selected cellular (C) gene fiagments were also used.
The orientation of the primer compare to the transcript unit is designed as (F) for forward
and (R) for reverse direction. PCR end point are relative to the transcription start site (+1)
of each gene.

 

 

Gene Class Region Oligonucleotide sequence PCR ends
(F) S’CCCTGGGGTTCCGGGTATGGTAATGAG

ICPO E P (R) 5’-GGCTAACTTAT‘ACCCCACGCCTTI‘CCCC ‘322 ‘° '12
(F) 5’GGGCTCGTATCTCATTACCGCCGAACC

ICP4 IE P (R) 5’GGCGTCCTCGGGCTCATATAGTCCCAG '376 t" '9

P (F) S’GTGTAGCCTGGATCCCAACGACCCC .231 to _3
1 (31,27 E (R) S’CGGCCGGGTGGTGGATGTCCTTATAC
ORF (F) 5’-TGCATCCT‘I‘CGTGTITGTCATI‘CTGG 1099 to 1249

(R) S’GCCGTCMCTCGCAGACACGACTC
(F) 5’- GAGCGTCCGTTGGGCGACAA

PK DP P (R) 5'- T‘T‘CGAGGCCACACGCGTCAC '297 ‘° '
(F) S’CAGCCCGCTCCGCTI‘CTCG _

VP16 L P (R) S’GCCGCCCCGTACCTCGTGAC 272 t" '47
(F) S’GGCGTCGCCTGCACAGGAAG _ _

gc L P (R) S’CCCGTGTCCGGAATTI‘ 269 ‘° 7
(F) S’GCACCACACCAGGAGCAAAC _ _

”3 C P (R) S’CGCTAGTTCCGATGCCATTAGG 295 ‘° 7'
(F) S’CCTCACAGTFFGTAAATC’I'I‘T'ITCC _

“'3 C P (R) 5’-TCGAAAGGT1‘GCAGTTAGAATG ‘97 ‘° ‘2

GAPDH c ORF (F) 5 -AGGTCATCCCTGAGCTGAAC 731 to 980

(R) S’GCAATGCCAGCCCCAGCGTC

 

 

133

Table 2. Oligonucleotides used in quantitative real-time PCR analysis of ChIP samples.
PCR primers were designed to detect viral immediate early (IE), delayed early (DE) and
late (L) gene fiagments. Selected cellular (C) gene fragments were also used. The
orientation of the primer compare to the transcript unit is designed as (F) for forward and
(R) for reverse direction. PCR end point are relative to the transcription start site (+1) of
each gene. (N .A.= not available)

 

 

Gene Class Region Oligonucleotide sequence Location
P (F) S’GGCCGTGCATGCTAATGATA -172 to _20
[CPO 1E (R) 5’-CTTATACCCCACGCCTTI‘CC
ORF (F) S’CTGTCGCCTTACGTGACCAA 3022 to 3133
(R) S’CCATGTFTCCCGTCTGGTC
P N.A. N.A.
ICP4 IE ,
ORF (F) 5 -GAAGTTGTGGACTGGGAAGG 4125 to 4257
(R) 5’-GT‘TGCCGTTI‘ATTGCGTCTT
P (F) 5’-TGGTGTCTGATTGGTCCTTG 429 to _6
ICP27 IE (R) 5’-CGGGTGGTGGATGTCCTTAT
ORF (F) 5’-TGCATCCTTCGTGT'ITGTCATI‘CTGG 1099 to 1249
(R) S’GCCGTCMCTCGCAGACACGACTC
P (F) 5'- GAGCGTCCGTTGGGCGACAA _297 to 1
TK DE (R) 5’- T'I‘CGAGGCCACACGCGTCAC
ORF (F) 5’-TACCCGAGCCGATGACTTAC 354 to 506
(R) 5’-AAGGCATGCCCATTGTT‘ATC
P (F)5’-CAGCCCGCTCCGCTTCTCG _272 to 47
VP16 L (R) S’CCCGCCCCGTACCTCGTGAC
ORF (F) 5’-T‘G'I'1'1‘GACTGCCTCTGT'I‘GC 925 to 1079
(R) 5’-GTTAAGGTGCTCGCGAATGT
P (F) 5’-TCGGGCGATTGATATAT‘IT1T _l 31 to _”
gC L (R) 5’-TGTCCCCTTCCGGAATTI‘AT
ORF (F) 5’-AGAGGAGGTCCTGACGAACA 663 to 806
(R) S’GCCCGGTGACAGAATACAAC
(F) 5’-GCACCACACCAGGAGCAAAC
”3 C P (R) S’CGCTAGTTCCGATGCCATTAGG '295 ‘° '7'
In”, c P (F) 5 CCTCACAGTTTGTAAATCT'ITITCC -197 to 12

(R) 5’-TCGAAAGGTTGCAGTTAGAATG

 

134

ICPO promoter

 

\135

y = -2.3x + 23.3 _15

on
O

F

 

 

 

 

R’=1.0
-5 -4 -3 -2 -1 0 1
Logaminput]

VP16 promoter

2

 

'35
L

\‘25
N

=-. + . '
y 17x 216 _15

a
O

 

 

 

 

R2=1.0
-5 -4 -3 -2 -1 0 1
L093[%input]

2

ICP27 promoter

 

  

 

 

 

 

  

 

 

 

35
'5 25
y = -1.7x + 20.8
R2= 1.0
-5 -4 -3 -2 -1 0 1 2
Log 3 [96 input]
U3 snRNA promoter
8
y = -1.8x + 23.4
R2= 1.0
-5 -4 -3 -2 -1 0 1 2

Log 3 [% input]

Figure 19. Standard curves for quantitative real-time PCR used for analysis of ChIP
samples. 10% input material were prepared in parallel with immunoprecipitation samples
and subsequently 3-fold diluted to obtain a range from 3% to 0.012% input.

135

Appendix B

Quantitative RT-PCR analysis for viral gene expression

B. l . qRT-PCR protocol.

Quantitative real-time PCR analysis (qRT-PCR) was established to measure viral
gene expression during infection of cultured cells. Gene expression analyses were
typically performed by infecting approximately 2 x106 HeLa cells at multiplicity of
infection of 1-10 pfu per cell. Total RNA was isolated at 2 hours post-infection using
TRI-Reagent following the instructions provided by the manufacturer (Molecular
Research Center). cDNA was prepared using 1 pg total RNA and a randomly-primed
reverse transcription system (Promega). cDNA samples were then analyzed using qRT-

PCR analysis as described below.

cDNA samples from infected cells were analyzed with quantitative PCR using
SYBR Green PCR core reagents kit (Applied Biosystems) on an ABI Prism 7700
Sequence Detection System (Applied Biosystems). PCR conditions included 0.25 [AM
each primer and 2-3 mM MgC12. Relative levels of viral gene expression were obtained

2M0 method (175). The two samples a and b, measuring gene “x” and using

using the
gene “y” as endogenous control, the equation used for obtaining AACt was [Ct(X)a-

Ct(Y)a]—[Ct(X)b-Ct(Y)b]. PCR detecting 18S rRNA was used as an endogenous control
to normalize gene expression. The use of 188 rRNA controls for potential differences in

cDNA preparation between samples. Since the Tri-Reagent protocol allows the

simultaneous isolation of DNA and RNA from the infected cells, viral gene expression

136

can be normalized to the amount of viral DNA delivered during each infection. This
control is important especially when comparing gene expression levels between difierent
viral strains that might have different infectivity. To compare the amount of DNA
delivered between infections, total DNA was isolated from infected cells following the
instructions provided by the manufacturer (Molecular Research Center) and used for
qPCR analysis detecting a viral DNA fragment. Relative levels of viral DNA delivered
between infections were calculated with the 2'MC‘ method (175) and using 188 rDNA

gene as endogenous control.

137

Table 3. Oligonucleotides used in quantitative real-time PCR analysis of cDNA samples.
PCR primers were designed to detect viral immediate early (IE), delayed early (DE) and
late (L) genes. The cellular (C) gene coding for 18S rRNA was used as endogenous
control. The orientation of the primer compare to the transcript unit is designed as (F) for
forward and (R) for reverse direction. PCR endpoints are relative to the transcription start

 

 

site (+1) of each gene.
Gene Class Oligonucleotidc sequence PCR end
points

ICPO IE (F) S’CTGTCGCCTI‘ACGTGACCAA 3022 to 3133
(R) S’CCATGTTFCCCGTCTGGTC

ICP4 [E (F) 5’-GAAGTTGTGGACTGGGAAGG 4125 to 4257
(R) 5’-GT‘TGCCGTT1‘AT'1‘GCGTCTT

ICP22 IE (F) 5’-T'ITGGGGAGTT'I‘GACTGGAC 1575 to 1712
(R) S’CAGACACTTGCGGTCFTCTG

ICP27 [E (F) 5’-TGCATCCTT‘CGTGT'ITGTCATTCTGG 1099 to 1249
(R) S’GCCGTCAACTCGCAGACACGACTC

ICP47“ IE (F) S’GTACGACCATCACCCGAGTC 808 to 935
(R) 5’-GACGGCACGCCTTITAAGTA

TK DE (F) 5’-TACCCGAGCCGATGAC'ITAC 354 to 506
(R) 5’-AAGGCATGCCCATTGTTATC

VP16 L (F) 5’-TGTTTGACTGCCTCTGTTGC 925 to 1079
(R) 5’-GTT‘AAGGTGCTCGCGAATGT

gC L (F) 5’-AGAGGAGGTCCTGACGAACA 663 to 806
(R) S’GCCCGGTGACAGAATACAAC

18S rRNA C (F) S’CCGCAGCTAGGAATAATGGA 850 to 975

(R) 5’-CGGTCCAAGAA1TI‘CACCTC

 

 

* The ICP47 primer overlaps with the USll transcript. At early times of infections USll
is not expressed and thus this PCR detects ICP47 gene expression levels.

138

B.2. Assay validation.

B.2.l. Standard curves for qPCR primer pairs.

In order to validate qRT-PCR analysis for viral gene expression, each PCR primer
pair was tested using standard curves prepared with two fold dilutions of DNA template.
These standard curves were used to confirm that the assays yielded the expected linear
relationship between logarithm of the template concentration and the Ct values for the
range used in gene expression analysis during infection (data not shown). The slope of
the standard curve was used to confirm that each cycle resulted in a doubling of template
as expected when using the 2'AACt method for relative quantification. The presence of a
single product in each reaction was verified by analyzing the dissociation curves

generated by the ABI Prism 7700.

B22. Analysis of viral gene expression of KOS, RP5 and mock infected cells.

The specificity of the qRT-PCR analysis was tested by comparing viral gene
expression of KOS, RP5 and mock-infected cells. RP5 virus lacking the activation
domain of VP16 is defective for IE gene expression (263, 276, 323). Mock infections
were included to further test the Specificity of the PCR reactions for viral gene
expression. Infections were performed in triplicate at a multiplicity of infection of 1

plaque forming unit per cell for KOS. RP5 infections used multiplicity of infection of

139

0.01 plaque forming unit to deliver Similar amount of viral DNA. Infections were
performed by incubating the appropriate viral inculum in 200 uL DMEM without FBS in
p60 tissue culture plates. After one hour, the inoculum was washed and 2 mL of DMEM
with 2% FBS was added. Afier one additional hour of incubation at 37 °C, total DNA and

RNA was isolated and cDNA was prepared as described on B2].

Figure 20 shows the result of qRT—PCR analysis of IE gene expression at 2 hours
post-infection using the 2'AACt method and normalized to the amount of DNA delivered in
each infection. As expected, RP5 infections resulted in reduced expression of IE genes
compared to viral gene expression in KOS infection (Figure 20A). Little or no signal is
detected in mock-infected samples further showing the specificity of the qPCR for viral
gene expression. To normalize for the amount of viral DNA delivered during KOS and
RP5 infections, total DNA was analyzed using qPCR detecting the ICP27 promoter (as a
probe for viral DNA) and 18S rDNA as an endogenous control. Figure 20B shows that
RP5 infections did not deliver the same amount of viral DNA in these parallel infections.
This observation reinforces the importance of analyzing the levels of viral DNA delivered
when comparing gene expression levels between different viral strains. Using this
analysis of the amount of viral DNA delivered during infection, the inoculum volumes
can be corrected so subsequent infections using the same viral stocks will deliver

comparable amounts of DNA.

140

 

 

   

 

 

   

 

 

   

'2 1 ICPO l.” 1 5 ICP4
0 .5q 0 . 1
5 1 0 E 1 0d
3 ' E '
3' 0.5. 5 0.51
o

& oi I! 0-

K08 RP5 Mock KOS RP5 Mock
3 ICP27 .2 ICP47
g 1.51 g 1.5%
2 1 0- 2 1 01
E ' 3
a; 0.5. a; 0.5-
3 7:
05 0. a: 0.

K08 RP5 Mock KOS RP5 Hook
1, ICP22
% 1.5‘
3 1.0-
.2
S 0.5-1
7»
a: 01

KOS RP5 Mock

B.

3 Viral DNA
g 1.5-
2
g 1.0
E 0.54
o
a: 0 4

K08 RP5 Mock

Figure 20. qRT-PCR analysis of viral gene expression of cells infected by KOS or RP5
viral strains. A) qRT—PCR analysis of viral gene expression in KOS, RP5 and mock-
infected cells normalized to the amount of DNA delivered in each infection. B) Amount
of viral DNA delivered in KOS, RP5 and mock infected cells. Errors bars represent the
range of values obtained between biological triplicates, each measured in duplicate.

141

10.

11.

References

Ace, C. 1., T. A. McKee, J. M. Ryan, J. M. Cameron, and C. M. Preston.
1989. Construction and characterization of a herpes simplex virus type 1 mutant
unable to transinduce immediate-early gene expression. J Virol 63:2260-9.

Adkins, M. W., S. R. Howar, and J. K. Tyler. 2004. Chromatin disassembly
mediated by the histone chaperone Asfl is essential for transcriptional activation
of the yeast PHOS and PHO8 genes. Mol Cell 14:657-66.

Ahmad, K., and S. Henikoff. 2002. The histone variant H3.3 marks active
chromatin by replication-independent nucleosome assembly. Mol Cell 9:119]-
200.

Alazard, N., H. Gruffat, E. Hiriart, A. Sergeant, and E. Manet. 2003.
Differential hyperacetylation of histones H3 and H4 upon promoter-specific
recruitment of EBNA2 in Epstein-Barr virus chromatin. J Virol 77:8166-72.

Alexeev, A., A. Mazin, and S. C. Kowalaykowski. 2003. Rad54 protein
possesses chromatin-remodeling activity stimulated by the Rad51-ssDNA
nucleoprotein filament. Nat Struct Biol 10: 1 82-6.

Almlof, T., A. E. Wallberg, J. A. Gustafsson, and A. P. Wright. 1998. Role of
important hydrophobic amino acids in the interaction between the glucocorticoid
receptor tau l-core activation domain and target factors. Biochemistry 37:9586—
94.

Anest, V., J. L. Hanson, P. C. Cogswell, K. A. Steinbrecher, B. D. Strahl, and
A. S. Baldwin. 2003. A nucleosomal function for IkappaB kinase-alpha in NF-
kappaB-dependent gene expression. Nature 423:659-63.

Arany, L, D. Newsome, E. Oldread, D. M. Livingston, and R. Eckner. 1995.
A farme of transcriptional adaptor proteins targeted by the BIA oncoprotein.
Nature 374:8] -4.

Anboenf, D., A. Honig, S. M. Berget, and B. W. O'Malley. 2002. Coordinate
regulation of transcription and Splicing by steroid receptor coregulators. Science
298:416-9.

Babb, R., C. C. Huang, D. J. Anfiero, and W. Herr. 2001 . DNA recognition by
the herpes simplex virus transactivator VP16: a novel DNA-binding structure.
Mol Cell Biol 21:4700-12.

Bajic, V. B., S. L. Tan, A. Chong, S. Tang, A. Strom, J. A. Gustafsson, C. Y.
Lin, and E. T. Liu. 2003. Dragon ERE Finder version 2: A tool for accurate

142

12.

13.

14.

15.

16.

17.

l8.

19.

20.

21.

22.

detection and analysis of estrogen response elements in vertebrate genomes.
Nucleic Acids Res 31:3605-7.

Bannert, N., A. Avots, M. Baler, E. Serfling, and R. Kurth. 1999. GA-binding
protein factors, in concert with the coactivator CREB binding protein/p3 00,
control the induction of the interleukin 16 promoter in T lymphocytes. Proc Natl
Acad Sci U S A 96:1541-6.

Bannister, A. J., R. Schneider, and T. Kouzarides. 2002. Histone methylation:
dynamic or static? Cell 109:801-6.

Barboric, M., R. M. Nissen, S. Kanazawa, N. Jabrane-Ferrat, and B. M.
Peterlin. 2001. NF-kappaB binds P-TEFb to stimulate transcriptional elongation
by RNA polymerase H. Mol Cell 8:327-37.

Barlev, N. A., R. Candau, L. Wang, P. Darpino, N. Silverman, and S. L.
Berger. 1995. Characterization of physical interactions of the putative
transcriptional adaptor, ADA2, with acidic activation domains and TATA-
binding protein. J Biol Chem 270:19337-44.

Beerli, R. R., and C. F. Barhas, 3rd. 2002. Engineering polydactyl zinc-fmger
transcription factors. Nat Biotechnol 20:135-41.

Belotserkovskaya, R., S. Oh, V. A. Bondarenko, G. Orphanides, V. M.
Studitsky, and D. Reinberg. 2003. FACT facilitates transcription-dependent
nucleosome alteration. Science 301:1090—3.

Berger, S. L. 2002. Histone modifications in transcriptional regulation. Curr Opin
Genet Dev 12:142-8.

Berger, S. L., B. Pine, N. Silverman, G. A. Marcus, J. Agapite, J. L. Regier,
S. J. Triezenberg, and L. Guarente. 1992. Genetic isolation of ADA2: a
potential transcriptional adaptor required for function of certain acidic activation
domains. Cell 70:251-65.

Bernard Roizman, A. S. 1993. Herpes Simplex Viruses and Their Replication. In
R. J. W. a. C. L. Bernard Roizrnan (ed.), The Human Herpesviruses. Raven Press,
Ltd., New York.

Bernstein, B. E., C. L. Liu, E. L. Humphrey, E. O. Perlstein, and S. L.
Schreiber. 2004. Global nucleosome occupancy in yeast. Genome Biol 5:R62.

Boardman, P. E., S. G. Oliver, and S. J. Hubbard. 2003. SiteSeer:
Visualisation and analysis of transcription factor binding sites in nucleotide
sequences. Nucleic Acids Res 31:3572-5.

143

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

Boeger, H., J. Griesenheck, J. S. Strattan, and R. D. Kornberg. 2003.
Nucleosomes unfold completely at a transcriptionally active promoter. Mol Cell
11:1587-98.

Boeger, H., J. Griesenheck, J. S. Strattan, and R. D. Kornberg. 2004.
Removal of promoter nucleosomes by disassembly rather than sliding in vivo.
Mol Cell 14:667-73.

Boube, M., L. Joulia, D. L. Cribbs, and H. M. Bourbon. 2002. Evidence for a
mediator of RNA polymerase II transcriptional regulation conserved from yeast to
man. Cell 110:143-51. ’

Boyd, K. E., and P. J. Farnham. 1999. Coexamination of site-specific
transcription factor binding and promoter activity in living cells. Mol Cell Biol
19:8393-9.

Brigati, C., M. Giacca, D. M. Noonan, and A. Alhini. 2003. I-HV Tat, its
TARgets and the control of viral gene expression. FEMS Microbiol Lett 220:57-
65. ~

Brown, C. E., L. Howe, K. Sousa, S. C. Alley, M. J. Carrozza, S. Tan, and J.
L. Workman. 2001. Recruitment of HAT complexes by direct activator
interactions with the ATM-related Tral subunit. Science 292:2333-7.

Brown, S. A., A. N. Imbalzano, and R. E. Kingston. 1996. Activator-dependent
regulation of transcriptional pausing on nucleosomal templates. Genes Dev
10: 147 9-90.

Brown, S. A., C. S. Weirich, E. M. Newton, and R. E. Kingston. 1998.
Transcriptional activation domains stimulate initiation and elongation at different
times and via difl‘erent residues. Embo J 17:3146-54.

Brownell, J. E., J. Zhou, T. Ranalli, R. Kohayashi, D. G. Edmondson, S. Y.
Roth, and C. D. Allis. 1996. Tetlahymena histone acetyltransferase A: a homolog
to yeast Gcn5p linking histone acetylation to gene activation. Cell 84:843-51.

Bryant, L. A., P. Mixon, M. Davidson, A. J. Bannister, T. Kouzarides, and J.
H. Sinclair. 2000. The human cytomegalovirus 86-kilodalton major immediate-
early protein interacts physically and functionally with histone acetyltransferase
P/CAF. J Virol 74:7230-7.

Bultman, S., T. Gebuhr, D. Yee, C. La Mantia, J. Nicholson, A. Gilliam, F.
Randazzo, D. Metzger, P. Chambon, G. Crabtree, and T. Magnuson. 2000. A
Brgl null mutation in the mouse reveals functional differences among mammalian
SWI/SNF complexes. Mol Cell 6: 1287-95.

144

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

45.

46.

Buratowski, S., S. Hahn, L. Guarente, and P. A. Sharp. 1989. Five
intermediate complexes in transcription initiation by RNA polymerase 11. Cell
56:549-61.

Burley, S. K., and R. G. Roeder. 1996. Biochemistry and structural biology of
transcription factor HD (TFIID). Annu Rev Biochem 65:769-99.

Butler, J. E., and J. T. Kadonaga. 2001. Enhancer-promoter specificity
mediated by DPE or TATA core promoter motifs. Genes Dev 15:2515-9.

Candau, R., P. A. Moore, L. Wang, N. Barlev, C. Y. Ying, C. A. Rosen, and
S. L. Berger. 1996. Identification of human proteins functionally conserved with
the yeast putative adaptors ADA2 and GCNS. Mol Cell Biol 16:593-602.

Candau, R., D. M. Scolnick, P. Darpino, C. Y. Ying, T. D. Halazonetis, and S.
L. Berger. 1997. Two tandem and independent sub-activation domains in the

amino terminus of p53 require the adaptor complex for activity. Oncogene
15:807-16.

Caron, C., E. Col, and S. Khochbin. 2003. The viral control of cellular
acetylation signaling. Bioessays 25:58-65.

Carrozza, M. J., and N. A. DeLuca. 1996. Interaction of the viral activator
protein ICP4 with TFIH) through TAF250. Mol Cell Biol 16:3085-93.

Carrozza, M. J., R. T. Utley, J. L. Workman, and J. Cote. 2003. The diverse
functions of histone acetyltransferase complexes. Trends Genet 19:321-9.

Chatterjee, P. K., M. E. Vayda, and S. J. Flint. 1986. Adenoviral protein VH
packages intracellular viral DNA throughout the early phase of infection. Embo J
5:1633-44.

Chen, C. J., Z. Deng, A. Y. Kim, G. A. Blobel, and P. M. Lieberman. 2001.
Stimulation of CREB binding protein nucleosomal histone acetyltransferase
activity by a class of transcriptional activators. Mol Cell Biol 21:476-87.

Cheng, S. W., K. P. Davies, E. Yung, R. J. Beltran, J. Yu, and G. V. Kalpana.
1999. c-MYC interacts with INTI/hSNFS and requires the SWI/SNF complex for
transactivation flmction. Nat Genet 22: 102-5.

Chenng, P., K. G. Tanner, W. L. Chenng, P. Sassone-Corsi, J. M. Denu, and
C. D. Allis. 2000. Synergistic coupling of histone H3 phosphorylation and
acetylation in response to epidermal growth factor stimulation. Mol Cell 5:905-
15.

Chiang, C. M., and R. G. Roeder. 1995. Cloning of an intrinsic human TFIID
subunit that interacts with multiple transcriptional activators. Science 267 :53 1 -6.

145

47.

48.

49.

50.

51.

52.

53.

54.

55.

56.

57.

Cho, E. J., M. S. Kobor, M. Kim, J. Greenblatt, and S. Buratowski. 2001.
Opposing effects of Ctkl kinase and Pop] phosphatase at Ser 2 of the RNA
polymerase II C-terminal domain. Genes Dev 15:3319-29.

Cho, H., G. Orphanides, X. Sun, X. J. Yang, V. Ogryzko, E. Lees, Y.
Nakatani, and D. Reinberg. 1998. A human RNA polymerase II complex
containing factors that modify chromatin structure. Mol Cell Biol 18:5355-63.

Citterio, E., V. Van Den Boom, G. Schnitzler, R. Kanaar, E. Bonte, R. E.
Kingston, J. H. Hoeijmakers, and W. Vermeulen. 2000. ATP-dependent
chromatin remodeling by the Cockayne syndrome B DNA repair-transcription-
coupling factor. Mol Cell Biol 20:7643-53.

Cohen, J. 1., F. Wang, J. Mannick, and E. Kieff. 1989. Epstein-Barr virus
nuclear protein 2 is a key determinant of lymphocyte transformation. Proc Natl
Acad Sci U S A 86:9558-62.

Corbi, N., M. Perez, R. Maione, and C. Passananti. 1997. Synthesis of a new
zinc finger peptide; comparison of its 'code' deduced and 'CASTing' derived
binding sites. FEBS Lett 417:71-4.

Cousens, D. J., R. Greaves, C. R. Goding, and P. O'Hare. 1989. The C-
terminal 79 amino acids of the herpes simplex virus regulatory protein, Vmw65,
efficiently activate transcription in yeast and mammalian cells in chimeric DNA-
binding proteins. Embo J 8:2337-42.

Cramer, P., C. G. Pesce, F. E. Baralle, and A. R. Kornblihtt. 1997. Functional
association between promoter structure and transcript alternative splicing. Proc
Natl Acad Sci U S A 94:11456-60.

Cress, W. D., and S. J. Triezenberg. 1991. Critical structural elements of the
VP16 transcriptional activation domain. Science 251:87-90.

Cuthbert, G. L., S. Daujat, A. W. Snowden, H. Erdjument-Bromage, T.
Hagiwara, M. Yamada, R. Schneider, P. D. Gregory, P. Tempst, A. J.
Bannister, and T. Kouzarides. 2004. I-Iistone deimination antagonizes arginine
methylation. Cell 118:545-53.

Dahlman-Wright, K., H. Baumann, I. J. McEwan, T. Almlof, A. P. Wright, J.
A. Gustafsson, and T. Hard. 1995. Structural characterization of a minimal
functional transactivation domain from the human glucocorticoid receptor. Proc
Natl Acad Sci U S A 92: 1699-703.

Daniel], E., D. E. Groff, and M. J. Fedor. 1981. Adenovirus chromatin structure
at different stages of infection. Mol Cell Biol 1:1094-105.

146

58.

59.

60.

61.

62.

63.

65.

66.

67.

68.

69.

de La Serna, I. L., K. A. Carlson, D. A. Hill, C. J. Guidi, R. O. Stephenson, S.
Sif, R. E. Kingston, and A. N. Imbalzano. 2000. Mammalian SWI-SNF
complexes contribute to activation of the hsp70 gene. Mol Cell Biol 20:2839—5 1.

Deng, Z., C. J. Chen, M. Chamberlin, F. Lu, G. A. Blobel, D. Speicher, L. A.
Cirillo, K. S. Zaret, and P. M. Lieberman. 2003. The CBP bromodomain and
nucleosome targeting are required for Zta-directed nucleosome acetylation and
transcription activation. Mol Cell Biol 23:2633-44.

Deshmane, S. L., and N. W. Fraser. 1989. During latency, herpes simplex virus
type 1 DNA is associated with nucleosomes in a chromatin structure. J Virol
63:943-7.

Dynlacht, B. D., T. Hoey, and R. Tjian. 1991. Isolation of coactivators
associated with the TATA-binding protein that mediate transcriptional activation.
Cell 66: 563-76.

Dyson, P. J., and P. J. Farrell. 1985. Chromatin structure of Epstein-Barr virus.
J Gen Virol 66 ( Pt 9):]931-40.

Ebbert, R., A. Birkmann, and H. J. Schuller. 1999. The product of the
SNF2/SW12 paralogue INOSO of Saccharomyces cerevisiae required for efficient
expression of various yeast structural genes is part of a high-molecular-weight
protein complex. Mol Microbiol 32:741-51.

Eisen, J. A., K. S. Sweder, and P. C. Hanawalt. 1995. Evolution of the SNF2
family of proteins: subfamilies with distinct sequences and frmctions. Nucleic
Acids Res 23:2715-23.

Elliott, G., G. Mouzakitis, and P. O'Hare. 1995. VP16 interacts via its
activation domain with VP22, a tegument protein of herpes simplex virus, and is
relocated to a novel macromolecular assembly in coexpressing cells. J Virol
69:7932-41.

Elliott, G., and P. O'Hare. 1998. Herpes simplex virus type 1 tegument protein
VP22 induces the stabilization and hyperacetylation of microtubules. J Virol
72:6448-55.

Elliott, G., and P. O'Hare. 1997. Intercellular trafficking and protein delivery by
a herpesvirus structural protein. Cell 88:223-33.

Emami, K. H., W. W. Navarre, and S. T. Smale. 1995. Core promoter
specificities of the Spl and VP16 transcriptional activation domains. Mol Cell
Biol 15:5906-16.

Evans, R., J. A. Fairley, and S. G. Roberts. 2001. Activator-mediated
disruption of sequence—specific DNA contacts by the general transcription factor
TFIIB. Genes Dev 15:2945-9.

147

70.

71.

72.

73.

74.

75.

76.

77.

78.

79.

80.

81.

82.

Falke, D., and R. L. Juliano. 2003. Selective gene regulation with designed
transcription factors: implications for therapy. Curr Opin Mol Ther 5: 161-6.

Fax, P., O. Lehmkuhler, C. Kuhn, H. Esche, and D. Brockmann. 2000.
EIAIZS-mediated activation of the adenovirus type 12 E2 promoter depends on
the histone acetyltransferase activity of p300/CBP. J Biol Chem 275:40554-60.

Felinski, E. A., and P. G. Quinn. 1999. The CREB constitutive activation
domain interacts with TATA-binding protein-associated factor 110 (T AF 1 10)
through specific hydrophobic residues in one of the three subdomains required for
both activation and TAF 1 10 binding. J Biol Chem 274:11672-8.

Feng, Z. H., S. E. Wilson, Z. Y. Peng, K. K. Schlender, E. M. Reimann, and
R. J. Trumbly. 1991. The yeast GLC7 gene required for glycogen accumulation
encodes a type 1 protein phosphatase. J Biol Chem 266:23796-801.

Fischle, W., Y. Wang, S. A. Jacobs, Y. Kim, C. D. Allis, and S.
Khorasanizadeh. 2003. Molecular basis for the discrimination of repressive
methyl-lysine marks in histone H3 by Polycomb and HP] chromodomains. Genes
Dev 17:1870—81 .

Freiman, R. N., and R. Tjian. 2003. Regulating the regulators: lysine
modifications make their mark. Cell 112:11-7.

Fuchs, M., J. Gerber, R. Drapkin, S. Sif, T. Ikura, V. Ogryzko, W. S. Lane,
Y. Nakatani, and D. M. Livingston. 2001. The p400 complex is an essential
E1 A transformation target. Cell 106:297-307.

Garvie, C. W., and C. Wolberger. 2001. Recognition of specific DNA
sequences. Mol Cell 8:937-46.

Gavin, 1., P. J. Horn, and C. L. Peterson. 2001. SWI/SNF chromatin
remodeling requires changes in DNA topology. Mol Cell 7 :97-104.

Ge, K., M. Guermah, C. X. Yuan, M. Ito, A. E. Wallberg, B. M. Spiegelman,
and R. G. Roeder. 2002. Transcription coactivator TRAP220 is required for
PPAR gamma 2-stimulated adipogenesis. Nature 417:563-7.

Gerster, T., and R. G. Roeder. 1988. A herpesvirus trans-activating protein
interacts with transcription factor OTF-l and other cellular proteins. Proc Natl
Acad Sci U S A 85:6347-51.

Ghosh, M. K., and M. L. Harter. 2003. A viral mechanism for remodeling
chromatin structure in G0 cells. Mol Cell 12:255-60.

Gibson, W., and B. Roizman. 1971. Compartmentalization of Spermine and
spermidine in the herpes simplex virion. Proc Natl Acad Sci U S A 68:2818-21.

148

83.

84.

85.

86.

87.

88.

89.

90.

91.

92.

93.

Gill, G., E. Pascal, Z. H. Tseng, and R. Tjian. 1994. A glutamine-rich
hydrophobic patch in transcription factor Spl contacts the dTAFIIl 10 component
of the Drosophila TFIID complex and mediates transcriptional activation. Proc
Natl Acad Sci U S A 91:192-6.

Goodrich, J. A., T. Hoey, C. J. Thut, A. Admon, and R. Tjian. 1993.
Drosophila TAF 1140 interacts with both a VP16 activation domain and the basal
transcription factor TFIIB. Cell 75:519-30.

Gossen, M., and H. Bujard. 2002. Studying gene function in eukaryotes by
conditional gene inactivation. Annu Rev Genet 36:153-73.

Gossen, M., and H. Bujard. 1992. Tight control of gene expression in
mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci U S A
89:5547-51.

Gossen, M., S. Freundlieb, G. Bender, G. Muller, W. Hillen, and H. Bujard.
1995. Transcriptional activation by tetracyclines in mammalian cells. Science
268: 1 7 66-9.

Goto, H., S. Motomura, A. C. Wilson, R. N. Freiman, Y. Nakabeppu, K.
Fukushima, M. Fujishima, W. Herr, and T. Nishimoto. 1997. A single-point
mutation in HCF causes temperature-sensitive cell-cycle arrest and disrupts VP16
function. Genes Dev 11:726-3 7.

Grabe, N. 2002. AliBaba2: context specific identification of transcription factor
binding sites. In Silico Biol 2:S1-15.

Gradoville, L., J. Gerlach, E. Grogan, D. Shedd, S. Nikiforow, C. Metroka,
and G. Miller. 2000. Kaposi's sarcoma-associated herpesvirus open reading
frame 50me protein activates the entire viral lytic cycle in the HH-B2 primary
effusion lymphoma cell line. J Virol 74:6207-12.

Grant, P. A., D. Schieltz, M. G. Pray-Grant, D. J. Steger, J. C. Reese, J. R.
Yates, 3rd, and J. L. Workman. 1998. A subset of TAF(II)S are integral
components of the SAGA complex required for nucleosome acetylation and
transcriptional stimulation. Cell 94:45-53.

Grondin, B., and N. DeLuca. 2000. Herpes simplex virus type 1 ICP4 promotes
transcription preinitiation complex formation by enhancing the binding of TFIID
to DNA. J Virol 74:1 1504-10.

Gwack, Y., H. J. Back, H. Nakamura, S. H. Lee, M. Meisterernst, R. G.
Roeder, and J. U. Jung. 2003. Principal role of TRAP/mediator and SWI/SNF
complexes in Kaposi's sarcoma-associated herpesvirus RTA-mediated lytic
reactivation. Mol Cell Biol 23:2055-67.

149

94.

95.

96.

97.

98.

99.

1 00.

101.

102.

103.

104.

105.

Hagglund, R., and B. Roizman. 2004. Role of ICPO in the strategy of conquest
of the host cell by herpes Simplex virus 1. J Virol 78:2169-78.

Hampsey, M., and D. Reinberg. 1999. RNA polymerase II as a control panel for
multiple coactivator complexes. Curr Opin Genet Dev 9: 132-9.

Hampsey, M., and D. Reinberg. 2003. Tails of intrigue: phosphorylation of
RNA polymerase II mediates histone methylation. Cell 113:429-32.

Hassan, A. H., K. E. Neely, and J. L. Workman. 2001. Histone
acetyltransferase complexes stabilize swi/snf binding to promoter nucleosomes.
Cell 104:817-27.

Hassan, A. H., P. Prochasson, K. E. Neely, S. C. Galasinski, M. Chandy, M.
J. Carrozza, and J. L. Workman. 2002. Function and selectivity of

bromodomains in anchoring chromatin-modifying complexes to promoter
nucleosomes. Cell 111:369-79.

Havas, K., A. Flaus, M. Phelan, R. Kingston, P. A. Wade, D. M. Lilley, and T.
Owen-Hughes. 2000. Generation of superhelical torsion by ATP-dependent
chromatin remodeling activities. Cell 103:1133-42.

Hayashi, F., R. Ishirna, D. Liu, K. I. Tong, S. Kim, D. Reinberg, S. Bagby,
and M. Ikura. 1998. Human general transcription factor TFIIB: conformational
variability and interaction with VP16 activation domain. Biochemistry 37 :7941-
51.

Heery, D. M., E. Kalkhoven, S. Hoare, and M. G. Parker. 1997. A signature
motif in transcriptional co-activators mediates binding to nuclear receptors.
Nature 387:733-6.

Heine, J. W., R. W. Honess, E. Cassai, and B. Roizman. 1974. Proteins
specified by herpes simplex virus. XII. The virion polypeptides of type 1 strains. J
Virol 14:640-51.

Hengartner, C. J., C. M. Thompson, J. Zhang, D. M. Chao, S. M. Liao, A. J.
Koleske, S. Okamura, and R. A. Young. 1995. Association of an activator with
an RNA polymerase 11 holoenzyme. Genes Dev 9:897-910.

Henry, K. W., A. Wyce, W. S. Lo, L. J. Duggan, N. C. Emre, C. F. Kao, L.
Pillus, A. Shilatifard, M. A. Osley, and S. L. Berger. 2003. Transcriptional
activation via sequential histone H2B ubiquitylation and deubiquitylation,
mediated by SAGA-associated pr8. Genes Dev 17 :2648-63.

Herrera, F. J., and S. J. Triezenberg. 2004. VP16-dependent association of
chromatin-modifying coactivators and underrepresentation of histones at
immediate-early gene promoters during herpes simplex virus infection. J Virol
78:9689-96.

150

106.

107.

108.

109.

110.

111.

112.

113.

114.

115.

116.

117.

118.

Homa, F. L., and J. C. Brown. 1997. Capsid assembly and DNA packaging in
herpes simplex virus. Rev Med Virol 7 :107-122.

Hsia, S. C., and Y. B. Shi. 2002. Chromatin disruption and histone acetylation in
regulation of the human immunodeficiency virus type 1 long terminal repeat by
thyroid hormone receptor. Mol Cell Biol 22:4043-52.

Hudson, B. P., M. A. Martinez-Yamout, H. J. Dyson, and P. E. Wright. 2000.
Solution structure and acetyl-lysine binding activity of the GCN 5 bromodomain. J
Mol Biol 304:355-70.

Ibanez, C. E., R. Schrier, P. Ghazal, C. Wiley, and J. A. Nelson. 1991 . Human
cytomegalovirus productively infects primary differentiated macrophages. J Virol
65:6581-8.

Iizuka, M., and M. M. Smith. 2003. Functional consequences of histone
modifications. Curr Opin Genet Dev 13:154-60.

Ingles, C. J., M. Shales, W. D. Cress, S. J. Triezenberg, and J. Greenblatt.
1991. Reduced binding of TFIID to transcriptionally compromised mutants of
VP16. Nature 351:588-90.

Ito, M., C. X. Yuan, S. Malik, W. Go, J. D. Fondell, S. Yamamura, Z. Y. Fu,
X. Zhang, J. Qin, and R. G. Roeder. 1999. Identity between TRAP and SMCC

complexes indicates novel pathways for the frmction of nuclear receptors and
diverse mammalian activators. Mol Cell 3:361-70.

Jackson, B. M., C. M. Drysdale, K. Natarajan, and A. G. Hinnebusch. 1996.
Identification of seven hydrophobic clusters in GCN4 making redundant
contributions to transcriptional activation. Mol Cell Biol 16:5557-71.

Jackson, S. A., and N. A. DeLuca. 2003. Relationship of herpes simplex virus

genome configuration to productive and persistent infections. Proc Natl Acad Sci
U S A 100:7871-6.

Jakobovits, E. B., S. Bratosin, and Y. Aloni. 1980. A nucleosome-flee region in
SV40 minichromosomes. Nature 285:263-5.

Janicki, S. M., T. Tsukamoto, S. E. Salghetti, W. P. Tansey, R.
Sachidanandam, K. V. Prasanth, T. Ried, Y. Shav-Tal, E. Bertrand, R. H.

Singer, and D. L. Speetor. 2004. From silencing to gene expression: real-time
analysis in single cells. Cell 116:683-98.

Jeddeloh, J. A., T. L. Stokes, and E. J. Richards. 1999. Maintenance of
genomic methylation requires a SWI2/SNF2-like protein. Nat Genet 22:94-7.

Jenner, R. G., and C. Boshoff. 2002. The molecular pathology of Kaposi's
sarcoma-associated herpesvirus. Biochirn Biophys Acta 1602:1-22.

151

119.

120.

121.

122.

123.

124.

125.

126.

127.

128.

129.

130.

Jennwein, T., and C. D. Allis. 2001. Translating the histone code. Science
293: 1074-80.

Johnson, J. S., Y. N. Osheim, Y. Xue, M. R. Emanuel, P. W. Lewis, A.
Bankovich, A. L. Beyer, and D. A. Engel. 2004. Adenovirus protein VII
condenses DNA, represses transcription, and associates with transcriptional
activator ElA. J Virol 78:6459-68.

Joliot, V., M. Demma, and R. Prywes. 1995. Interaction with RAP74 subunit of
TFIIF is required for transcriptional activation by serum response factor. Nature
373:632-5.

Jones, K. A., and R. Tjian. 1985. Spl binds to promoter sequences and activates
herpes simplex virus 'immediate-early' gene transcription in vitro. Nature
317: 1 79-82.

Kadam, S., and B. M. Emerson. 2003. Transcriptional Specificity of Human
SWI/SNF BRGI and BRM Chromatin Remodeling Complexes. Mol Cell 11:377-
89.

Kadam, S., G. S. McAlpine, M. L. Phelan, R. E. Kingston, K. A. Jones, and
B. M. Emerson. 2000. Functional selectivity of recombinant mammalian
SWI/SNF subunits. Genes Dev 14:2441-51.

Kadonaga, J. T. 2002. The DPE, a core promoter element for transcription by
RNA polymerase II. Exp Mol Med 34:259-64.

Kal, A. J., T. Mahmoudi, N. B. Zak, and C. P. Verrijzer. 2000. The Drosophila
brahma complex is an essential coactivator for the trithorax group protein zeste.
Genes Dev 14:1058-71.

Kamiuchi, T., E. Abe, M. Imanishi, T. Kaji, M. Nagaoka, and Y. Sugiura.
1998. Artificial nine zinc-finger peptide with 30 base pair binding sites.
Biochemistry 37: 13827-34.

Kanazawa, S., T. Okamoto, and B. M. Peterlin. 2000. Tat competes with
CHTA for the binding to P-TEFb and blocks the expression of MHC class H
genes in HIV infection. Immunity 12:61-70.

Kanazawa, S., L. Soucek, G. Evan, T. Okamoto, and B. M. Peterlin. 2003. c-
Myc recruits P-TEFb for transcription, cellular proliferation and apoptosis.
Oncogene 22:5707-11.

Kasamatsu, H., and A. Nakanishi. 1998. How do animal DNA viruses get to the
nucleus? Annu Rev Microbiol 52:627-86.

152

131.

132.

133.

134.

135.

136.

137.

138.

139.

140.

141.

Kawasaki, H., R. Eckner, T. P. Yao, K. Taira, R. Chin, D. M. Livingston, and
K. K. Yokoyama. 1998. Distinct roles of the co-activators p300 and CBP in
retinoic-acid-induced F9-cell differentiation. Nature 393:284-9.

Kel, A. E., E. Gossling, I. Renter, E. Cheremushkin, O. V. Kel-Margoulis,
and E. Wingender. 2003. MATCH: A tool for searching transcription factor
binding sites in DNA sequences. Nucleic Acids Res 31:3576-9.

Kemp, L. M., and D. S. Latchman. 1988. Differential regulation of octarner-
containing cellular genes by the herpes simplex virus virion protein Vmw65 is
mediated by sequence differences in the octarner element. Embo J 7:423 944.

Kenney, S., J. Kamine, E. Holley-Guthrie, J. C. Lin, E. C. Mar, and J.
Pagano. 1989. The Epstein-Barr virus (EBV) BZLFl immediate-early gene
product differentially affects latent versus productive EBV promoters. J Virol
63: 1 729-36.

Kent, J. R., P. Y. Zeng, D. Atanasiu, J. Gardner, N. W. Fraser, and S. L.
Berger. 2004. During lytic infection herpes simplex virus type 1 is associated
with histones bearing modifications that correlate with active transcription. J
Virol 78:10178-86.

Kim, J., S. Sif, B. Jones, A. Jackson, J. Koipally, E. Heller, S. Winandy, A.
Viel, A. Sawyer, T. Ikeda, R. Kingston, and K. Georgopoulos. 1999. Ikaros
DNA-binding proteins direct formation of chromatin remodeling complexes in
lymphocytes. Immunity 10:345-55.

Kim, L. J., A. G. Seto, T. N. Nguyen, and J. A. Goodrich. 2001. Human
Taf(II)130 is a coactivator for NFATp. Mol Cell Biol 21:3503-13.

Kim, Y. J., S. Bjorklund, Y. Li, M. H. Sayre, and R. D. Kornberg. 1994. A
multiprotein mediator of transcriptional activation and its interaction with the C-
terminal repeat domain of RNA polymerase H. Cell 77:599-608.

Kireeva, M. L., W. Walter, V. Tchernajenko, V. Bondarenko, M. Kashlev,
and V. M. Studitsky. 2002. Nucleosome remodeling induced by RNA
polymerase 11: loss of the H2A/H2B dimer during transcription. Mol Cell 9:541-
52.

Klemm, R. D., J. A. Goodrich, S. Zhou, and R. Tjian. 1995. Molecular cloning
and expression of the 32-kDa subunit of human TFIH) reveals interactions with
VP16 and TFHB that mediate transcriptional activation. Proc Natl Acad Sci U S
A 92:5788-92.

Kohayashi, N., T. G. Boyer, and A. J. Berk. 1995. A class of activation
domains interacts directly with TFHA and stimulates TFIIA-TFIID-promoter
complex assembly. Mol Cell Biol 15:6465-73.

153

142.

143.

144.

145.

146.

147.

148.

149.

150.

151.

152.

153.

Kohayashi, N., P. J. Horn, S. M. Sullivan, S. J. Triezenberg, T. G. Boyer, and
A. J. Berk. 1998. DA-complex assembly activity required for VP16C
transcriptional activation. Mol Cell Biol 18:4023-31.

Koknbo, T., D. W. Gong, S. Yamashita, M. Horikoshi, R. G. Roeder, and Y.
Nakatani. 1993. Drosophila 230-kD TFHD subunit, a functional homolog of the
human cell cycle gene product, negatively regulates DNA binding of the TATA
box-binding subunit of TFIID. Genes Dev 7:1033-46.

Koleske, A. J., and R. A. Young. 1994. An RNA polymerase 11 holoenzyme
responsive to activators. Nature 368:466-9.

Kouzarides, T. 2002. Histone methylation in transcriptional control. Curr Opin
Genet Dev 12:198-209.

Kraus, W. L., E. T. Manning, and J. T. Kadonaga. 1999. Biochemical analysis
of distinct activation fimctions in p300 that enhance transcription initiation with
chromatin templates. Mol Cell Biol 19:8123-35.

Kristie, T. M., J. H. LeBowitz, and P. A. Sharp. 1989. The octamer-binding
proteins form multi-protein-DNA complexes with the HSV alpha TIF regulatory
protein. Embo J 8:4229-38.

Kristie, T. M., J. L. Pomerantz, T. C. Twomey, S. A. Parent, and P. A. Sharp.
1995. The cellular Cl factor of the herpes simplex virus enhancer complex is a
family of polypeptides. J Biol Chem 270:4387-94.

Kristjuhan, A., and J. Q. Svejstrup. 2004. Evidence for distinct mechanisms
facilitating transcript elongation through chromatin in vivo. Embo J 23:4243-52.

Krogan, N. J., M. Kim, A. Tong, A. Golshani, G. Cagney, V. Canadien, D. P.
Richards, B. K. Beattie, A. Emili, C. Boone, A. Shilatifard, S. Buratowski,
and J. Greenblatt. 2003. Methylation of histone H3 by Set2 in Saccharomyces

cerevisiae is linked to transcriptional elongation by RNA polymerase 11. Mol Cell
Biol 23:4207-1 8.

Kubat, N. J., R. K. Tran, P. McAnany, and D. C. Bloom. 2004. Specific
histone tail modification and not DNA methylation is a determinant of herpes
simplex virus type 1 latent gene expression. J Virol 78:1139-49.

Kulkarni, M. M., and D. N. Arnosti. 2003. Information display by
transcriptional enhancers. Development 130:6569-75.

Kumar, K. P., S. Akoulitchev, and D. Reinberg. 1998. Promoter-proximal
stalling results from the inability to recruit transcription factor HH to the
transcription complex and is a regulated event. Proc Natl Acad Sci U S A
95:9767-72.

154

154.

155.

156.

157.

158.

159.

1 60.

161.

162.

163.

164.

165.

Kundu, T. K., V. B. Palhan, Z. Wang, W. An, P. A. Cole, and R. G. Roeder.
2000. Activator-dependent transcription fi'om chromatin in vitro involving
targeted histone acetylation by p300. Mol Cell 6:551-61.

Kung, A. L., V. I. Rebel, R. T. Bronson, L. E. Ch'ng, C. A. Siefi’, D. M.
Livingston, and T. P. Yao. 2000. Gene dose-dependent control of hematopoiesis
and hematologic tumor suppression by CBP. Genes Dev 14:272-7.

Kuo, M. H., J. Zhou, P. Jambeck, M. E. Churchill, and C. D. Allis. 1998.
Histone acetyltransferase activity of yeast Gcn5p is required for the activation of
target genes in vivo. Genes Dev 12:627-39.

Knrosn, T., and B. M. Peterlin. 2004. VP16 and ubiquitin; binding of P-TEFb
via its activation domain and ubiquitin facilitates elongation of transcription of
target genes. Curr Biol 14:1112-6.

Kusch, T., S. Guelman, S. M. Abmayr, and J. L. Workman. 2003. Two
Drosophila Ada2 homologues function in different multiprotein complexes. Mol
Cell Biol 23:3305-19.

Kussie, P. H., S. Gorina, V. Marechal, B. Elenbaas, J. Moreau, A. J. Levine,
and N. P. Pavletich. 1996. Structure of the MDM2 oncoprotein bound to the p53
tumor suppressor transactivation domain. Science 274:948-53.

Kutach, A. K., and J. T. Kadonaga. 2000. The downstream promoter element
DPE appears to be as widely used as the TATA box in Drosophila core
promoters. Mol Cell Biol 20:4754—64.

Lachner, M., and T. Jenuwein. 2002. The many faces of histone lysine
methylation. Curr Opin Cell Biol 14:286-98.

Larschan, E., and F. Winston. 2001. The S. cerevisiae SAGA complex
firnctions in vivo as a coactivator for transcriptional activation by Gal4. Genes
Dev 15:1946-56.

Lau, J. F., I. Nusinzon, D. Burakov, L. P. Freedman, and C. M. Horvath.
2003. Role of metazoan mediator proteins in interferon-responsive transcription.
Mol Cell Biol 23:620-8.

Lee, C., J. H. Chang, H. S. Lee, and Y. Cho. 2002. Structural basis for the
recognition of the E2F transactivation domain by the retinoblastoma tumor
suppressor. Genes Dev 16:3199-212.

Lee, C. K., Y. Shibata, B. Rao, B. D. Strahl, and J. D. Lieb. 2004. Evidence for
nucleosome depletion at active regulatory regions genome-wide. Nat Genet
36:900-5.

155

166.

167.

168.

169.

170.

171.

172.

173.

1 74.

175.

176.

Leinbach, S. S., and W. C. Summers. 1980. The structure of herpes simplex
virus type 1 DNA as probed by micrococcal nuclease digestion. J Gen Virol
51:45-59.

Lentine, A. F., and S. L. Bachenheimer. 1990. Intracellular organization of

herpes simplex virus type 1 DNA assayed by staphylococcal nuclease sensitivity.
Virus Res 16:275-92.

Leslie, J., F. J. Rixon, and J. McLauchlan. 1996. Overexpression of the herpes
simplex virus type 1 tegument protein VP22 increases its incorporation into virus
particles. Virology 220:60-8.

Lieberman, P. M., and A. J. Berk. 1994. A mechanism for TAFs in
transcriptional activation: activation domain enhancement of TFHD-TFHA--
promoter DNA complex formation. Genes Dev 8:995-1006.

Lieberman, P. M., J. M. Hardwick, J. Sample, G. S. Hayward, and S. D.
Hayward. 1990. The zta transactivator involved in induction of lytic cycle gene
expression in Epstein-Barr virus-infected lymphocytes binds to both AP-l and
ZRE sites in target promoter and enhancer regions. J Virol 64:1143-55.

Lim, C. Y., B. Santoso, T. Boulay, E. Dong, U. Ohler, and J. T. Kadonaga.
2004. The MTE, a new core promoter element for transcription by RNA
polymerase II. Genes Dev 18:1606-17.

Lin, Q., C. F. Barbas, 3rd, and P. G. Schultz. 2003. Small-molecule switches
for zinc finger transcription factors. I Am Chem Soc 125:612-3.

Lin, Y. S., 1. Ha, E. Maldonado, D. Reinberg, and M. R. Green. 1991. Binding
of general transcription factor TFIIB to an acidic activating region. Nature
353:569-71.

Liu, P. Q., E. J. Rebar, L. Zhang, Q. Liu, A. C. Jamieson, Y. Liang, H. Qi, P.
X. Li, B. Chen, M. C. Mendel, X. Zhong, Y. L. Lee, S. P. Eisenberg, S. K.
Spratt, C. C. Case, and A. P. Wolffe. 2001. Regulation of an endogenous locus
using a panel of designed zinc finger proteins targeted to accessible chromatin
regions. Activation of vascular endothelial growth factor A. J Biol Chem

276:1 1323-34.

Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta C(T')) Method.
Methods 25:402-8.

Lo, W. S., L. Duggan, N. C. Tolga, Emre, R. Belotserkovskya, W. S. Lane, R.
Shiekhattar, and S. L. Berger. 2001. Snfl -a histone kinase that works in
concert with the histone acetyltransferase Gcn5 to regulate transcription. Science
293:1142-6. '

156

177.

178.

179.

l 80.

181.

182.

183.

184.

185.

1 86.

187.

188.

Lo, W. S., R. C. Trievel, J. R. Rojas, L. Duggan, J. Y. Hsu, C. D. Allis, R.
Marmorstein, and S. L. Berger. 2000. Phosphorylation of serine 10 in histone
H3 is functionally linked in vitro and in vivo to Gcn5-mediated acetylation at
lysine 14. Mol Cell 5:917-26.

Lu, F., J. Zhou, A. Wiedmer, K. Madden, Y. Yuan, and P. M. Lieberman.
2003. Chromatin remodeling of the Kaposi's sarcoma-associated herpesvirus
ORF50 promoter correlates with reactivation from latency. J Virol 77:11425-35.

Luciano, R. L., and A. C. Wilson. 2002. An activation domain in the C-terminal
subunit of HCF-1 is important for transactivation by VP16 and LZIP. Proc Natl
Acad Sci U S A 99:13403-8.

Lukac, D. M., R. Renne, J. R. Kirshner, and D. Ganem. 1998. Reactivation of
Kaposi's sarcoma-associated herpesvirus infection from latency by expression of
the ORF 50 transactivator, a homolog of the EBV R protein. Virology 252:304-
12.

Lundblad, J. R., R. P. Kwok, M. E. Laurence, M. L. Harter, and R. H.
Goodman. 1995. Adenoviral BIA-associated protein p300 as a functional
homologue of the transcriptional co—activator CBP. Nature 374:85-8.

Luscombe, N. M., and J. M. Thornton. 2002. Protein-DNA interactions: amino
acid conservation and the effects of mutations on binding specificity. J Mol Biol
320:991-1009.

Lusic, M., A. Marcello, A. Cereseto, and M. Giacca. 2003. Regulation of HIV-
1 gene expression by histone acetylation and factor recruitment at the LTR
promoter. Embo J 22:6550—61 .

Lusser, A., and J. T. Kadonaga. 2003. Chromatin remodeling by ATP-
dependent molecular machines. Bioessays 25:1192-200.

Malik, S., and R. G. Roeder. 2000. Transcriptional regulation through Mediator-
like coactivators in yeast and metazoan cells. Trends Biochem Sci 25:277-83.

Maniatis, T., and R. Reed. 2002. An extensive network of coupling among gene
expression machines. Nature 416:499-506.

Marcello, A., M. Lusic, G. Pegoraro, V. Pellegrini, F. Beltram, and M.

Giacca. 2004. Nuclear organization and the control of I-HV -1 transcription. Gene
326: 1-1 1.

Marcus, G. A., J. Horinchi, N. Silverman, and L. Guarente. 1996.
ADA5/SPT20 links the ADA and SPT genes, which are involved in yeast
transcription. Mol Cell Biol 16:3197-205.

157

189.

190.

191.

192.

193.

194.

195.

196.

197.

198.

1 99.

200.

201.

Marmorstein, R., and M. X. Fitzgerald. 2003. Modulation of DNA-binding
domains for sequence-specific DNA recognition. Gene 304:1-12.

Martel, L. S., H. J. Brown, and A. J. Berk. 2002. Evidence that TAP-TATA
box-binding protein interactions are required for activated transcription in
mammalian cells. Mol Cell Biol 22:2788-98.

Martin, M. L., P. M. Lieberman, and T. Curran. 1996. F os-Jun dimerization
promotes interaction of the basic region with TFHB-34 and TFIIF. Mol Cell Biol
16:21 10-8.

McEwan, I. J., K. Dahlman-Wright, J. Ford, and A. P. Wright. 1996.
Functional interaction of the c-Myc transactivation domain with the TATA
binding protein: evidence for an induced fit model of transactivation domain
folding. Biochemistry 35:9584-93.

McKittrick, E., P. R. Gafken, K. Ahmad, and S. Henikofi'. 2004. Histone H3.3
is enriched in covalent modifications associated with active chromatin. Proc Natl
Acad Sci U S A 101:1525-30.

Mellerick, D. M., and N. W. Fraser. 1987. Physical state of the latent herpes
simplex virus genome in a mouse model system: evidence suggesting an episomal
state. Virology 158:265-75.

Memedula, S., and A. S. Belmont. 2003. Sequential Recruitment of HAT and
SWI/SNF Components to Condensed Chromatin by VP16. Curr Biol 13:241-6.

Merika, M., and D. Thanos. 2001. Enhanceosomes. Curr Opin Genet Dev
11:205-8.

Min, J., Y. Zhang, and R. M. Xu. 2003. Structural basis for specific binding of
Polycomb chromodomain to histone H3 methylated at Lys 27. Genes Dev
1 7: 1 823-8.

Minton, E. J., C. Tysoe, J. H. Sinclair, and J. G. Sissons. 1994. Human
cytomegalovirus infection of the monocyte/macrophage lineage in bone marrow. J
Virol 68:4017-21.

Mina, M. A., and J. Weber. 1982. Structure of adenovirus chromatin. Biochim
Biophys Acta 696:76-86.

Mitchell, P. J., and R. Tjian. 1989. Transcriptional regulation in mammalian
cells by sequence-specific DNA binding proteins. Science 245:371-8.

Mittler, G., T. Stuhler, L. Santolin, T. Uhlmann, E. Kremmer, F. Lottspeieh,
L. Berti, and M. Meisterernst. 2003. A novel docking site on Mediator is critical
for activation by VP16 in mammalian cells. Embo J 22:6494-6504.

158

202.

203.

204.

205.

206.

207.

208.

209.

210.

211.

212.

213.

Mizuguchi, G., X. Shen, J. Landry, W. H. Wu, S. Sen, and C. Wu. 2003. ATP-
Driven Exchange of Histone H2AZ Variant Catalyzed by SWRl Chromatin
Remodeling Complex. Science.

Monier, K., J. C. Armas, S. Etteldorf, P. Ghazal, and K. F. Sullivan. 2000.
Annexation of the interchromosomal space during viral infection. Nat Cell Biol
2:661-5.

Morrison, E. E., A. J. Stevenson, Y. F. Wang, and D. M. Meredith. 1998.
Differences in the intracellular localization and fate of herpes simplex virus

tegument proteins early in the infection of Vero cells. J Gen Virol 79 ( Pt
10):2517-28.

Muggeridge, M. 1., and N. W. Fraser. 1986. Chromosomal organization of the

herpes simplex virus genome during acute infection of the mouse central nervous
system. J Vir0159:764-7.

Muller, U., C. H. Schroder, H. Zentgraf, and W. W. Franke. 1980.
Coexistence of nucleosomal and various non-nucleosomal chromatin
configurations in cells infected with herpes simplex virus. Eur J Cell Biol 23: 197-
203.

Muratani, M., and W. P. Tansey. 2003. How the ubiquitin-proteasome system
controls transcription. Nat Rev Mol Cell Biol 4: 192-201 .

Murphy, J. C., W. Fischle, E. Verdin, and J. H. Sinclair. 2002. Control of
cytomegalovirus lytic gene expression by histone acetylation. Embo J 21:1112-
20.

Myers, L. C., and R. D. Kornberg. 2000. Mediator of transcriptional regulation.
Annu Rev Biochem 69:729-49.

Naar, A. M., B. D. Lemon, and R. Tjian. 2001. Transcriptional coactivator
complexes. Annu Rev Biochem 70:475-501.

Nakajima, T., C. Uchida, S. F. Anderson, J. D. Parvin, and M. Montminy.
1997. Analysis of a cAMP-responsive activator reveals a two-component
mechanism for transcriptional induction via signal-dependent factors. Genes Dev
11:738-47.

N arlikar, G. J., H. Y. Fan, and R. E. Kingston. 2002. Cooperation between
complexes that regulate chromatin structure and transcription. Cell 108:475-87.

Nedialkov, Y. A., and S. J. Triezenberg. 2004. Quantitative assessment of in
vitro interactions implicates TATA-binding protein as a target of the VP16C
transcriptional activation region. Arch Biochem Biophys 425:77-86.

159

214.

215.

216.

217.

218.

219.

220.

221.

222.

223.

224.

225.

Neely, K. E., A. H. Hassan, A. E. Wallberg, D. J. Steger, B. R. Cairns, A. P.
Wright, and J. L. Workman. 1999. Activation domain-mediated targeting of the
SWI/SNF complex to promoters stimulates transcription from nucleosome arrays.
Mol Cell 4:649-55.

Neish, A. S., S. F. Anderson, B. P. Schlegel, W. Wei, and J. D. Parvin. 1998.
Factors associated with the mammalian RNA polymerase 11 holoenzyme. Nucleic
Acids Res 26:847-53.

Nelson, J. A., and M. Groudine. 1986. Transcriptional regulation of the human
cytomegalovirus major immediate-early gene is associated with induction of
DNase I-hypersensitive sites. Mol Cell Biol 6:452-61.

Ng, H. H., F. Robert, R. A. Young, and K. Struhl. 2002. Genome-wide location
and regulated recruitment of the RSC nucleosome-remodeling complex. Genes
Dev 16:806-19.

Ng, H. H., F. Robert, R. A. Young, and K. Struhl. 2003. Targeted recruitment
of Set] histone methylase by elongating Pol 11 provides a localized mark and
memory of recent transcriptional activity. Mol Cell 1 1:709-19.

Nogues, G., S. Kadener, P. Cramer, D. Bentley, and A. R. Kornblihtt. 2002.
Transcriptional activators differ in their abilities to control alternative splicing. J
Biol Chem 277:431 10-4.

Nowak, S. J., and V. G. Corces. 2000. Phosphorylation of histone H3 correlates
with transcriptionally active loci. Genes Dev 14:3003-13.

O'Hare, P., and G. Williams. 1992. Structural studies of the acidic
transactivation domain of the Vmw65 protein of herpes simplex virus using 1H
NMR. Biochemistry 31:4150-6.

Pascreau, G., Y. Arlot-Bonnemains, and C. Prigent. 2003. Phosphorylation of
histone and histone-like proteins by aurora kinases during mitosis. Prog Cell
Cycle Res 5:369-74.

Pearson, A., and J. Greenblatt. 1997. Modular organization of the E2F 1
activation domain and its interaction with general transcription factors TBP and
TFIHi. Oncogene 15:2643-58.

Phelan, M. L., G. R. Schnitzler, and R. E. Kingston. 2000. Octamer transfer
and creation of stably remodeled nucleosomes by human SWI-SNF and its
isolated ATPases. Mol Cell Biol 20:6380—9.

Pignatti, P. F., and E. Cassai. 1980. Analysis of herpes simplex virus
nucleoprotein complexes extracted from infected cells. J Virol 36:816-28.

160

226.

227.

228.

229.

230.

231.

232.

233.

234.

235.

236.

237.

Poffenberger, K. L., and B. Roizman. 1985. A noninverting genome of a viable
herpes simplex virus 1: presence of head-to-tail linkages in packaged genomes
and requirements for circularization after infection. J Vim] 53:587-95.

Pomeranz, L. E., and J. A. Blaho. 1999. Modified VP22 localizes to the cell
nucleus dm'ing synchronized herpes simplex virus type 1 infection. J Virol
73:6769-81.

Poon, A. P., and B. Roizman. 1995. The phenotype in vitro and in infected cells
of herpes simplex virus 1 alpha trans-inducing factor (VP16) carrying
temperature-sensitive mutations introduced by substitution of cysteines. J Virol
69:765 8-67.

Preston, C. M., M. C. Frame, and M. E. Campbell. 1988. A complex formed
between cell components and an HSV structural polypeptide binds to a viral
immediate early gene regulatory DNA sequence. Cell 52:425-34.

Proudfoot, N. J., A. Furger, and M. J. Dye. 2002. Integrating mRNA
processing with transcription. Cell 108:501-12.

Ptashne, M., and A. Gann. 1997. Transcriptional activation by recruitment.
Nature 386:569-77.

Pugh, B. F. 2000. Control of gene expression through regulation of the TATA-
binding protein. Gene 255: 1-14.

Puvion-Dutilleul, F., and S. Besse. 1994. Induction of complete segregation of
cellular DNA and non-encapsidated viral genomes in herpes simplex virus type 1
infected HeLa cells as revealed by in situ hybridization. Chromosoma 103:104-
10.

Puvion-Dutilleul, F., and E. Puvion. 1989. Ultrastructural localization of viral
DNA in thin sections of herpes simplex virus type 1 infected cells by in situ
hybridization. Eur J Cell Biol 49:99-109.

Rachel, C., and L. P. Freedman. 200] . Mediator complexes and transcription.
Curr Opin Cell Biol 13:274-80.

Radhakrishnan, 1., G. C. Perez-Alvarado, D. Parker, H. J. Dyson, M. R.
Montminy, and P. E. Wright. 1997. Solution structure of the KD( domain of
CBP bound to the transactivation domain of CREB: a model for
activatorzcoactivator interactions. Cell 91:741-52.

Rebel, V. 1., A. L. Kung, E. A. Tanner, H. Yang, R. T. Bronson, and D. M.
Livingston. 2002. Distinct roles for CREB-binding protein and p300 in
hematopoietic stem cell self-renewal. Proc Natl Acad Sci U S A 99:14789-94.

161

238.

239.

240.

241.

242.

243.

244.

245.

246.

247.

248.

249.

250.

Regier, J. L., F. Shen, and S. J. Triezenberg. 1993. Pattern of aromatic and
hydrophobic amino acids critical for one of two subdomains of the VP16
transcriptional activator. Proc Natl Acad Sci U S A 90:883-7.

Reinke, H., and W. Horz. 2003. Histones are first hyperacetylated and then lose
contact with the activated PHOS promoter. Mol Cell 1 1: 1599-607.

Ren, B., H. Cam, Y. Takahashi, T. Volkert, J. Terragni, R. A. Young, and B.
D. Dynlacht. 2002. E2F integrates cell cycle progression with DNA repair,
replication, and G(2)/M checkpoints. Genes Dev 16:245-56.

Ren, B., F. Robert, J. J. Wyrick, O. Aparicio, E. G. Jennings, 1. Simon, J.
Zeitlinger, J. Schreiber, N. Hannett, E. Kanin, T. L. Volkert, C. J. Wilson, S.
P. Bell, and R. A. Young. 2000. Genome-wide location and function of DNA
binding proteins. Science 290:2306-9.

Reyes, J. C., J. Barra, C. Muchardt, A. Camus, C. Babinet, and M. Yaniv.
1998. Altered control of cellular proliferation in the absence of mammalian
brahma (SNF2alpha). Embo J 17 :6979-91 .

Richard Whitley and John Gnann, J. 1993. The epidemiology and Clinical
Manifestations of Herpes Simplex Virus Infections. In R. J. W. a. C. L. Bernard
Roizman (ed.), The Human Herpes Viruses. Raven Press, Ltd., New York.

Roberts, S. G., and M. R. Green. 1994. Activator-induced conformational
change in general transcription factor TFHB. Nature 371:717-20.

Roberts, S. G., 1. Ha, E. Maldonado, D. Reinberg, and M. R. Green. 1993.
Interaction between an acidic activator and transcription factor TFIIB is required
for transcriptional activation. Nature 363:741-4.

Roizman, B. 1993. The Family Herpesviridae. In R J. W. a. C. L. Bernard
Roizman (ed.), The Human Herpes Viruses. Raven Press, Ltd., New York.

Rojo-Niersbach, E., T. Furukawa, and N. Tanese. 1999. Genetic dissection of
hTAF (11)] 30 defines a hydrophobic sm'face required for interaction with
glutamine-rich activators. J Biol Chem 274:33778-84.

Roth, S. Y., J. M. Denu, and C. D. Allis. 2001. Histone acetyltransferases. Annu
Rev Biochem 70:81-120.

Rongvie, A. E., and J. T. Lis. 1988. The RNA polymerase II molecule at the 5'
end of the uninduced hsp70 gene of D. melanogaster is transcriptionally engaged.
Cell 54:795-804.

Sadowski, 1., J. Ma, S. Triezenberg, and M. Ptashne. 1988. GAL4-VP16 is an
unusually potent transcriptional activator. Nature 335:563-4.

162

251.

252.

253.

254.

255.

256.

257.

258.

259.

260.

261.

262.

263.

Saenz-Robles, M. T., C. S. Sullivan, and J. M. Pipas. 200] . Transforming
functions of Simian Virus 40. Oncogene 20:7899-907.

Sandri-Goldin, R. M. 2003. Replication of the herpes simplex virus genome:
does it really go around in circles? Proc Natl Acad Sci U S A 100:7428-9.

Sauer, F., S. K. Hansen, and R. Tjian. 1995. Multiple TAFIIs directing
synergistic activation of transcription. Science 270: 1783-8.

Schmitz, M. L., M. A. dos Santos Silva, H. Altmann, M. Czisch, T. A. Holak,
and P. A. Baeuerle. 1994. Structural and functional analysis of the NF-kappa B
p65 C terminus. An acidic and modular transactivation domain with the potential
to adopt an alpha-helical conformation. J Biol Chem 269:25613-20.

Schultz, D. C., J. R. Friedman, and F. J. Rauscher, 3rd. 2001. Targeting
histone deacetylase complexes via KRAB-zinc finger proteins: the PHD and
bromodomains of KAP-l form a cooperative unit that recruits a novel isoform of
the Mi-2alpha subunit of NuRD. Genes Dev 15:428-43.

Scott, W. A., and D. J. Wigmore. 1978. Sites in simian virus 40 chromatin
which are preferentially cleaved by endonucleases. Cell 15:1511-8.

Sera, T., and C. Uranga. 2002. Rational design of artificial zinc-finger proteins
using a nondegenerate recognition code table. Biochemistry 41:7074-81.

Shaw, J. E., L. F. Levinger, and C. W. Carter, Jr. 1979. Nucleosomal structure
of Epstein-er virus DNA in transformed cell lines. J Virol 29:657-65.

Shen, F., S. J. Triezenberg, P. Hensley, D. Porter, and J. R. Knutson. 1996.
Critical amino acids in the transcriptional activation domain of the herpesvirus
protein VP16 are solvent-exposed in highly mobile protein segments. An intrinsic
fluorescence study. J Biol Chem 271:4819-26.

Shen, F., S. J. Triezenberg, P. Hensley, D. Porter, and J. R. Knutson. 1996.
Transcriptional activation domain of the herpesvirus protein VP16 becomes
conformationally constrained upon interaction with basal transcription factors. J
Biol Chem 271:4827-37.

Shen, X., G. Mizuguchi, A. Hamiche, and C. Wu. 2000. A chromatin
remodelling complex involved in transcription and DNA processing. Nature
406:541-4.

Smale, S. T., and J. T. Kadonaga. 2003. The RNA polymerase 11 core promoter.
Annu Rev Biochem 72:449-79.

Smiley, J. R., and J. Duncan. 1997. Truncation of the C-terminal acidic
transcriptional activation domain of herpes Simplex virus VP16 produces a

163

264.

265.

266.

267.

268.

269.

270.

27].

272.

273.

274.

phenotype similar to that of the in1814 linker insertion mutation. J Virol 71:6191-
3.

Soloaga, A., S. Thomson, G. R. Wiggin, N. Rampersaud, M. H. Dyson, C. A.
Hamlin, L. C. Mahadevan, and J. S. Arthur. 2003. MSK2 and MSK] mediate
the mitogen- and stress-induced phosphorylation of histone H3 and HMG-14.
Embo J 22:2788-97.

Spear, P. G., and R. Longnecker. 2003. Herpesvirus entry: an update. J Virol
77:10179-85.

Spear, P. G., and B. Roizman. 1972. Proteins specified by herpes simplex virus.
V. Purification and structural proteins of the herpesvirion. J Virol 9: 143-59.

Stern, S., M. Tanaka, and W. Herr. 1989. The Oct-1 homoeodomain directs
formation of a multiprotein-DNA complex with the HSV transactivator VP 1 6.
Nature 341:624-30.

Sterner, D. E., and S. L. Berger. 2000. Acetylation of histones and transcription-
related factors. Microbiol Mol Biol Rev 64:43 5-59.

Strahl, B. D., and C. D. Allis. 2000. The language of covalent histone
modifications. Nature 403:41-5.

Sudarsanam, P., V. R. Iyer, P. 0. Brown, and F. Winston. 2000. Whole-
genome expression analysis of snf/swi mutants of Saccharomyces cerevisiae. Proc
Natl Acad Sci U S A 97:3364-9.

Suh, D., H. Busch, and R. Reddy. 1986. Isolation and characterization of a
human U3 small nucleolar RNA gene. Biochem Biophys Res Commun 137:1133-
40.

Sullivan, S. M., P. J. Horn, V. A. Olson, A. H. Koop, W. Niu, R. H. Ebright,
and S. J. Triezenberg. 1998. Mutational analysis of a transcriptional activation

region of the VP16 protein of herpes simplex virus. Nucleic Acids Res 26:4487-
96.

Suzuki, T., A. Kimura, R. Nagai, and M. Horikoshi. 2000. Regulation of
interaction of the acetyltransferase region of p300 and the DNA-binding domain
of Sp] on and through DNA binding. Genes Cells 5:29-41.

Suzuki, Y., T. Tsunoda, J. Sese, H. Taira, J. Mizushima-Sugano, H. Hata, T.
Ota, T. Isogai, T. Tanaka, Y. Nakamura, A. Suyama, Y. Sakaki, S. Morishita,
K. Okubo, and S. Sugano. 2001. Identification and characterization of the

potential promoter regions of 1031 kinds of human genes. Genome Res 11:677-
84.

164

275.

276.

277.

278.

279.

280.

281.

282.

283.

284.

285.

286.

Tagami, H., D. Ray-Gallet, G. Almonzni, and Y. Nakatani. 2004. Histone
H3.] and H3.3 complexes mediate nucleosome assembly pathways dependent or
independent of DNA synthesis. Cell 116:51-6].

Tal-Singer, R., R. Pichyangkura, E. Chung, T. M. Lasner, B. P. Randazzo, J.

Q. Trojanowski, N. W. Fraser, and S. J. Triezenberg. 1999. The transcriptional
activation domain of VP16 is required for efficient infection and establishment of
latency by HSV-1 in the mmine peripheral and central nervous systems. Virology

259:20-33.

Tanaka, Y., 1. Narnse, T. Hongo, M. Xu, T. Nakahata, T. Maekawa, and S.
Ishii. 2000. Extensive brain hemorrhage and embryonic lethality in a mouse null
mutant of CREB-binding protein. Mech Dev 95: 133-45.

Tang, Q., and G. G. Maul. 2003. Mouse cytomegalovirus immediate-early
protein 1 binds with host cell repressors to relieve suppressive effects on viral
transcription and replication during lytic infection. J Virol 77: 1357-67.

Tate, V. E., and L. Philipson. 1979. Parental adenovirus DNA accumulates in
nucleosome-like structures in infected cells. Nucleic Acids Res 6:2769-85.

Taylor, T. J., and D. M. Knipe. 2004. Proteomics of herpes simplex virus
replication comparnnents: association of cellular DNA replication, repair,
recombination, and chromatin remodeling proteins with ICP8. J Virol 78:5856-
66.

Thomson, 8., A. L. Clayton, and L. C. Mahadevan. 2001. Independent
dynamic regulation of histone phosphorylation and acetylation during immediate-
early gene induction. Mol Cell 8:1231-41.

Triezenberg, S. J. 1995. Structure and function of transcriptional activation
domains. Curr Opin Genet Dev 5: 190-6.

Triezenberg, S. J., R. C. Kingsbury, and S. L. McKnight. 1988. Functional
dissection of VP] 6, the trans-activator of herpes simplex virus immediate early
gene expression. Genes Dev 2:718-29.

Uesugi, M., O. Nyanguile, H. Lu, A. J. Levine, and G. L. Verdine. 1997.
Induced alpha helix in the VP16 activation domain upon binding to a human TAF.
Science 277: 13 10-3.

Utley, R. T., K. Ikeda, P. A. Grant, J. Cote, D. J. Steger, A. Eberharter, S.
John, and J. L. Workman. 1998. Transcriptional activators direct histone
acetyltransferase complexes to nucleosomes. Nature 394:498-502.

Van Doren, M., A. L. Williamson, and R. Lehmann. 1998. Regulation of
zygotic gene expression in Drosophila primordial germ cells. Curr Biol 8:243-6.

165

287.

288.

289.

290.

291.

292.

293.

294.

295.

296.

297.

Van Hoy, M., K. K. Leuther, T. Kodadek, and S. A. Johnston. 1993. The
acidic activation domains of the GCN4 and GAL4 proteins are not alpha helical
but form beta sheets. Cell 72:587-94.

van Leeuwen, H., M. Okuwaki, R. Hong, D. Chakravarti, K. Nagata, and P.
O'Hare. 2003. Herpes simplex virus type 1 tegument protein VP22 interacts with
TAF-I proteins and inhibits nucleosome assembly but not regulation of histone
acetylation by INHAT. J Gen Virol 84:2501-10.

Van Lint, C., S. Emiliani, M. Ott, and E. Verdin. 1996. Transcriptional
activation and chromatin remodeling of the HIV-1 promoter in response to
histone acetylation. Embo J 15:1112-20.

Verdin, E., P. Paras, Jr., and C. Van Lint. 1993. Chromatin disruption in the
promoter of human immunodeficiency virus type 1 during transcriptional
activation. Embo J 12:3249-59.

Vignali, M., D. J. Steger, K. E. Neely, and J. L. Workman. 2000. Distribution
of acetylated histones resulting from Gal4-VP16 recruitrrrent of SAGA and NuA4
complexes. Embo J 19:2629-40.

Vlachonasios, K. E., M. F. Thomashow, and S. J. Triezenberg. 2003.
Disruption mutations of ADA2b and GCN5 transcriptional adaptor genes
dramatically affect Arabidopsis growth, development, and gene expression. Plant
Cell 15:626-38.

Vo, N., and R. H. Goodman. 2001. CREB-binding protein and p300 in
transcriptional regulation. J Biol Chem 276:13505-8.

Vogel, J. L., and T. M. Kristie. 2000. The novel coactivator C1 (HCF)
coordinates multiprotein enhancer formation and mediates transcription activation
by GABP. Embo J 19:683-90.

Walker, 8., R. Greaves, and P. O'Hare. 1993. Transcriptional activation by the
acidic domain of Vmw65 requires the integrity of the domain and involves
additional determinants distinct from those necessary for TFIIB binding. Mol Cell
Biol 13:5233-44.

Wang, L., S. R. Grossman, and E. Kieff. 2000. Epstein-Barr virus nuclear
protein 2 interacts with p300, CBP, and PCAF histone acetyltransferases in
activation of the LMP] promoter. Proc Natl Acad Sci U S A 97 :430-5.

Wang, Y., J. Wysocka, J. Sayegh, Y. H. Lee, J. R. Perlin, L. Leonelli, L. S.
Sonbuchner, C. H. McDonald, R. G. Cook, Y. Don, R. G. Roeder, 8. Clarke,
M. R. Stallcup, C. D. Allis, and S. A. Coonrod. 2004. Human PAD4 Regulates

Histone Arginine Methylation Levels via Demethylirnination. Science 306:279-
83.

166

I

 

298.

299.

300.

301.

302.

303.

304.

305.

306.

307.

308.

309.

Warnmark, A., E. Treuter, A. P. Wright, and J. A. Gustafsson. 2003.
Activation firnctions 1 and 2 of nuclear receptors: molecular strategies for
transcriptional activation. Mol Endocrinol 17:1901-9.

Warnmark, A., A. Wikstrom, A. P. Wright, J. A. Gustafsson, and T. Hard.
2001. The N-terminal regions of estrogen receptor alpha and beta are unstructured
in vitro and Show different TBP binding properties. J Biol Chem 276:45939-44.

Weinheimer, S. P., B. A. Boyd, S. K. Durham, J. L. Resnick, and D. R.
O'Boyle, 2nd. 1992. Deletion of the VP16 open reading flame of herpes simplex
virus type 1. J Virol 66:258-69.

Weinmann, A. S., S. M. Bartley, T. Zhang, M. Q. Zhang, and P. J. Farnham.
2001. Use of chromatin immunoprecipitation to clone novel E2F target promoters.
Mol Cell Bi0121:6820-32.

Weinmann, P., M. Gossen, W. Hillen, H. Bujard, and C. Gatz. 1994. A
chimeric transactivator allows tetracycline-responsive gene expression in whole
plants. Plant J 5:559-69.

Weir, J. P. 2001. Regulation of herpes simplex virus gene expression. Gene
271:117-30.

Whitehouse, 1., A. Flaus, B. R. Cairns, M. F. White, J. L. Workman, and T.
Owen-Hughes. 1999. Nucleosome mobilization catalysed by the yeast SWI/SNF
complex. Nature 400:784-7.

Wieczorek, E., M. Brand, X. Jacq, and L. Tora. 1998. Function of TAF(H)-
containing complex without TBP in transcription by RNA polymerase 11. Nature
393: 187-91.

Wilde, R. J., S. E. Cooke, W. J. Brammar, and W. Schuch. 1994. Control of
gene expression in plant cells using a 434:VP16 chimeric protein. Plant Mol Biol
24:381-8.

Willy, P. J., R. Kobayashi, and J. T. Kadonaga. 2000. A basal transcription
factor that activates or represses transcription. Science 290:982-5.

Wilson, A. C., K. LaMarco, M. G. Peterson, and W. Herr. 1993. The VP16
accessory protein HCF is a family of polypeptides processed flom a large
precursor protein. Cell 74:] 15-25.

Winkler, M., T. aus Dem Siepen, and T. Stamminger. 2000. Functional
interaction between pleiotropic transactivator pUL69 of human cytomegalovirus
and the human homolog of yeast chromatin regulatory protein SPT6. J Virol
74:8053-64.

167

310.

311.

312.

313.

314.

315.

316.

317.

318.

319.

320.

321.

Wolfe, S. A., E. 1. Ramm, and C. O. Pabo. 2000. Combining structure-based
design with phage display to create new Cys(2)His(2) zinc finger dimers.
Structure Fold Des 8:739-50.

Wolstein, 0., A. Silkov, M. Revach, and R. Dikstein. 2000. Specific interaction
of TAF 11105 with OCA-B is involved in activation of octamer-dependent
transcription. J Biol Chem 275: 16459-65.

Wu, D. Y., A. Krumm, and W. H. Schubach. 2000. Promoter-specific targeting
of human SWI-SNF complex by Epstein-Barr virus nuclear protein 2. J Virol
74:8893-903.

Wysocka, J., and W. Herr. 2003. The herpes simplex virus VP16-induced
complex: the makings of a regulatory switch. Trends Biochem Sci 28:294-304.

Wysocka, J., M. P. Myers, C. D. Laherty, R. N. Eisenman, and W. Herr.
2003. Human Sin3 deacetylase and trithorax-related Setl/Ash2 histone H3-K4
methyltransferase are tethered together selectively by the cell-proliferation factor
HCF-l . Genes Dev 17:896-911.

Xiao, H., A. Pearson, B. Conlombe, R. Truant, S. Zhang, J. L. Regier, S. J.
Triezenberg, D. Reinberg, O. Flores, C. J. Ingles, and et al. 1994. Binding of
basal transcription factor TFIHI to the acidic activation domains of VP16 and
p53. Mol Cell Biol 14:7013-24.

Xiao, P., and J. P. Capone. 1990. A cellular factor binds to the herpes simplex
virus type 1 transactivator Vmw65 and is required for Vmw65-dependent protein-
DNA complex assembly with Oct-1. Mol Cell Biol 10:4974—7.

Xie, Y., C. Denison, S. H. Yang, D. A. Fancy, and T. Kodadek. 2000.
Biochemical characterization of the TATA-binding protein-Gal4 activation
domain complex. J Biol Chem 275:31914-20.

Xie, Y., L. Sun, and T. Kodadek. 2000. TATA-binding protein and the Gal4
transactivator do not bind to promoters cooperatively. J Biol Chem 275:40797-
803.

Xu, W., H. Cho, and R. M. Evans. 2003. Acetylation and methylation in nuclear
receptor gene activation. Methods Enzymol 364:205-23.

Yager, D. R., and S. L. Bachenheimer. 1988. Synthesis and metabolism of
cellular transcripts in HSV-1 infected cells. Virus Genes 1:]35-48.

Yamamoto, Y., U. N. Verma, S. Prajapati, Y. T. Kwak, and R. B. Gaynor.

2003. Histone H3 phosphorylation by IKK-alpha is critical for cytokine-induced
gene expression. Nature 423:655-9.

168

322.

323.

324.

325.

326.

327.

328.

Yang, F., R. DeBeaumont, S. Zhou, and A. M. Naar. 2004. The activator-
recruited cofactor/Mediator coactivator subunit ARC92 is a functionally
important target of the VP16 transcriptional activator. Proc Natl Acad Sci U S A
101:2339-44.

Yang, W. C., G. V. Devi-Rao, P. Ghazal, E. K. Wagner, and S. J.
Triezenberg. 2002. General and Specific alterations in programming of global
viral gene expression during infection by VP16 activation-deficient mutants of
herpes simplex virus type 1. J Virol 76:]2758-74.

Yankulov, K., J. Blau, T. Pnrton, S. Roberts, and D. L. Bentley. 1994.
Transcriptional elongation by RNA polymerase H is stimulated by transactivators.
Cell 77:749-59.

Yao, T. P., S. P. Oh, M. Fuchs, N. D. Zhou, L. E. Ch'ng, D. Newsome, R. T.
Bronson, E. Li, D. M. Livingston, and R. Eckner. 1998. Gene dosage-
dependent embryonic development and proliferation defects in mice lacking the
transcriptional integrator p300. Cell 93:361-72.

Yudkovsky, N., C. Logic, S. Hahn, and C. L. Peterson. 1999. Recruitment of
the SWl/SNF chromatin remodeling complex by transcriptional activators. Genes
Dev 13:2369—74.

Zhang, L., S. K. Spratt, Q. Lin, B. Johnstone, H. Qi, E. E. Raschke, A. C.
Jamieson, E. J. Rebar, A. P. Wolffe, and C. C. Case. 2000. Synthetic zinc
finger transcription factor action at an endogenous chromosomal site. Activation
of the human erythropoietin gene. J Biol Chem 275:33850-60.

Zhang, Y. 2003. Transcriptional regulation by histone ubiquitination and
deubiquitination. Genes Dev 17:2733-40.

169

   

l"llijlflfllllllljljfllllllllll