3.533 . a-
5,;
a)
. L.
a

2T}
f “K”

.H.
.34

J...
.rw

 

 

 

 

 

 

 

>. .10.- 1.
:1 v. :31. {a a

 

«Egg?

 

mm LIBRARY
5 Michigan State
.1005 University

 

T

This is to certify that the
dissertation entitled

Integrated Management Strategies and Pathogen Detection in
the Potato-Streptomyces Spp. Pathosystem

presented by

Elise C. Hollister

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Botany and Plant Pathology

 

 

W

Major Professor's Signature
w m 1005‘

Date

 

MSU is an Affirmative Action/Equal Opportunity Institution

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE
oéfitézt‘

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 cjcrl-RC/DataoueJnOd-pJS

INTEGRATED MANAGEMENT STRATEGIES AND PATHOGEN DETECTION IN
THE POTATO-ST REPT 0M Y CES SPP. PATHOSYSTEM

By

Elise C. Hollister

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Botany and Plant Pathology

2005

ABSTRACT

INTEGRATED MANAGEMENT STRATEGIES AND PATHOGEN DETECTION IN
THE POTATO-S T REPT OMY CES SPP. PATHOSYSTEM

By

Elise C. Hollister

The cultivated potato, Solanum tuberosum L., is the world’s most important
dicotyledonous food crop. It is surpassed only by wheat, rice, and corn as the world’s
fourth most important human food source. This research examined the potential use of
environmentally friendly disease management tools in reducing the severity of an
important bacterial disease, potato common scab, as well as examined the potential use of
molecular methods for detection and quantification of the pathogens that cause this
disease (Streptomyces Spp.).

Controlled environment and field experiments were conducted to determine the
effectiveness of cultivar resistance and soil moisture in reducing disease incidence and
severity. Cultivar resistance against common scab appeared to be the most effective
means of decreasing scab incidence and severity. When cultivar resistance was
combined with carefully maintaining soil moisture, near field capacity, control of the
disease was slightly enhanced. Common scab reduction also occurred for scab-
susceptible cultivars when soil moisture was maintained at near field capacity; however,
the amount of control was not as effective as the reduced disease incidence and severity
of the intermediately resistant and resistant cultivars.

The use of resistance activators for elicitation of systemic acquired resistance

(SAR) in potato to common scab in field experiments produced variable results. While

many of the elicitor treatments resulted in more scab free tubers in one year, the
following two years no significant differences were noted. Temperature and soil
moisture may have been important variables that led to the interannual variability in these
experiments. Analysis of tuber tissue for the pathogenesis related (PR) protein, chitinase,
was carried out to determine if the activity of this enzyme (a marker for SAR) was
increased. No increase in chitinase activity was observed, thus suggesting that resistance
was not induced by the activators.

PCR and real time PCR were used as methods of pathogen detection and
quantification, respectively. The necl gene, which is associated with pathogenicity in
Streptomyces Spp., was used to rapidly screen isolates obtained from soil from fields
cropped to potato in the major potato production counties of Michigan. The pathogen
was isolated and detected in each county sampled. Real time PCR was used to quantify
pathogen populations from three Michigan fields. Results indicated slight differences in
pathogen population between the fields. PCR was found to be the better method for
identification of the causal agent, while real time PCR was useful when quantification
was needed. These findings demonstrate that cultivar resistance is the primary method
for managing common scab of potato. Soil moisture application is also an important
management strategy, especially when scab-susceptible cultivars are planted. SAR may
provide more scab-free tubers if combined with other management methods. As a stand-
alone disease management tool, it offered no control against this particular genus of
pathogens. Also, detection of the pathogenic Streptomyces spp. was achieved more
economically and accurately by PCR. Real time PCR was a reliable method for

quantification, but is much less economic if it is to be used as a diagnostic tool.

“Scab remains one of the most important and least satisfactorily controlled
of potato diseases. ”
John C. Walker (1969)

iv

To my grandmothers, Elizabeth Ruth Fulghum and Beatrice Mardell Poole,
two very special and exceptionally intelligent women who can fully

appreciate the opportunities that have been given to me in my lifetime.

ACKNOWLEDGEMENTS

I would first like to thank my advisor, Dr. Ray Hammerschmidt, for introducing
me to plant pathology and for providing me with many great opportunities and support. I
also would like to thank Dr. Willie Kirk for his continual support and assistance, as well
as his sense of humor. I would also like to thank my other two committee members, Dr.
Dave Douches, for his support and continual supply of potato tubers, and to Dr. Dennis
Fulbright, for his useful comments and advice.

I am very thankful to the people I have worked with in the laboratory especially
Amy Peterson-Dunfee and Luis Velasquez for their unending friendship and support and
Samantha Hollosy for her encouragement and sense of humor. I especially thank
Chandra Laskey for her assistance and friendship. I am grateful to the all of the
personnel in Dr. Willie Kirk’s laboratory, especially Rob Schafer and Devan Berry for
their many hours of technical assistance in my field experiments, and Dr. Kathleen Baker
for her knowledge and assistance during my first year. I also thank a number of people
who have helped me in this undertaking including Kim Maxson-Stein, Christopher Long,
Dr. James Tiedje’s laboratory, Meg Goecker, Julie Klepaski, Andrea Cogal, Debby
Williams, and the staff of the MSU Genomics Technology Support Facility, particularly
Therese Best.

I am grateful to the many potato growers in Michigan who allowed me to sample
soils from their fields. Without their cooperation, a large portion of this project would
have been impossible. I am indebted to the Michigan Potato Industry Commission for
providing me with annual fimding for my project. I thank all of the personnel from Muck

Soils Experiment Station and the Plant Pathology Research Station, particularly Ronald

vi

Gnagey and Clifford Zehr, for their assistance with my field plots. I thank all of the
personnel in the research greenhouses, especially David Freville for his assistance with
my research conducted in the greenhouses. I am very appreciative of Lee Duynslager for
his technical assistance with computers. I am grateful to all of the professors that have
shared their knowledge especially Dr. Connie Page and Dr. Alvin Smucker.

Finally, I would like to thank my friends and family, particularly my parents,
Gregory and Elizabeth Poole, for their continual support, and I especially thank my

wonderful husband, Bob, for his endless encouragement and support.

vii

TABLE OF CONTENTS

ABSTRACT ................................................................................. ii
DEDICATION .............................................................................. v
ACKNOWLEDGEMENTS ............................................................... vi
TABLE OF CONTENTS .................................................................. viii
LIST OF TABLES .......................................................................... x
LIST OF FIGURES ........................................................................ xii
INTRODUCTION: LITERATURE REVIEW ....................................... 1
Importance of the Potato ............................................... 1
Streptomyces scabies, the Causal Agent of Potato Common Scab 2
The Infection Process .................................................. 5
The Role of Enzymes in Pathogenesis ............................... 6
The Role of Thaxtomins in Pathogenesis ........................... 7
Common Scab Management Strategies .............................. 9
Cultivar Resistance ............................................ 9
Chemical Control .............................................. 14
Soil Moisture ................................................... 15
Biological Control ............................................. 17
Induced or Acquired Resistance ............................. 18

CHAPTER I

EVALUATION OF PCR-BASED DETECTION OF PATHOGENIC

S T REPT OMY CES SPP. IN SOIL POPULATIONS OF MICHIGAN ’S

MAJOR POTATO PRODUCTION COUNTIES AND ASSESSMENT OF
REAL TIME QPCR AS A METHOD FOR PATHOGEN QUANTIFICATION.

Introduction ............................................................... 23
Materials and Methods ................................................... 25
Results ..................................................................... 38
Discussion ................................................................. 55

viii

CHAPTER II
ASSESSMENT OF CULTIV AR RESISTANCE AND SOIL MOISTURE
APPLICATION AS A MEANS TO MANAGE POTATO COMMON SCAB.

Introduction ............................................................... 62

Materials and Methods .................................................. 64

Results ..................................................................... 74

Discussion ................................................................. 85
CHAPTER III

ASSESSMENT OF FOUR COMPOUNDS ON ELICITATION OF THE
SYSTEMIC ACQUIRED RESISTANCE RESPONSE IN POTATO TO
COMMON SCAB INFECTION.

Introduction ................................................................ 92

Materials and Methods ................................................... 95

Results ...................................................................... 109

Discussion .................................................................. 132
CHAPTER IV

EVALUATION OF FOUR ANTIMICROBIAL COMPOUNDS ON GROWTH
INHIBITION OF THREE ST REPT OMY CES SCABIES STRAINS IN VITRO.

Introduction ............................................................... 141
Materials and Methods .................................................. 144
Results ..................................................................... 148
Discussion ................................................................. 160

CONCLUDING REMARKS: SUMMARY OF THE DISSERTATION AND
FUTURE RESEARCH

Summary of the Dissertation ........................................... 165
Future Research .......................................................... 171
LITERATURE CITED ................................................................... 174

ix

LIST OF TABLES

Introduction: A Review of the Literature
Table 1 A list of species within the genus Streptomyces that are
causal agents of potato scab, and their reference and
year of publication.

CHAPTER 1: Evaluation of PCR-based detection of pathogenic Streptomyces
spp. in soil populations of Michigan’s major potato production counties and
assessment of real time PCR as a method for pathogen quantification.
Table 1-1 Primers used in PCR and real time PCR targeted against
necI , the genus Streptomyces and the pBluescript plasmid.

CHAPTER II: Assessment of cultivar resistance and soil moisture application
as a means to manage potato common scab.
Table 2-1 Weed and insect management program used in the 2002

field trial.

Table 2-2 Weed and insect management program used in the 2003
field trial.

Table 2-3 Effects of irrigation and inoculation on mean oversize,

grade A, grade B, total, and marketable yields of Atlantic
tubers harvested from the 2003 field trial conducted at the
Michigan State University Plant Pathology Research Station
in East Lansing, Michigan, USA.

CHAPTER HI: Assessment of four compounds on elicitation of the systemic
acquired resistance response in potato to common scab infection.

Table 3-1 Trade names, active ingredients, source of active
ingredients, and registrants of the naturally occurring
biological chemicals evaluated for inducing resistance in
potato to common scab infection in field trials.

Table 3-2 Soil fertility and weed, insect, and disease management
programs used in the 2001 field trial.

Table 3-3 Soil fertility and weed, insect, and disease management
programs used in the 2002 field trial.

Table 3-4 Soil fertility and weed, insect, and disease management
programs used in the 2003 field trial.

Table 3-5 Application methods, number of years tested, application

rates, and active ingredient rates of the naturally occurring
chemicals evaluated for inducing resistance in potato to
common scab infection in field trials.
Table 3-6 Effects of natural compounds and application method
on mean total yields per 50 plants in 2001, 2002, and 2003.
Table 3-7 Effects of natural compounds and application method
on mean marketable yields per 50 plants in 2001, 2002,
and 2003.

31

68

72

84

96

97

99

101

102

117

118

Table 3-8

Table 3-9

Table 3-10

Table 3-11
Table 3-12
Table 3-13
Table 3-14

Effects of natural compounds and application method

on mean oversize yields per 50 plants in 2001, 2002,

and 2003.

Effects of natural compounds and application method

on mean grade A yields per 50 plants in 2001, 2002,

and 2003.

Effects of natural compounds and application method

on mean grade B yields per 50 plants in 2001, 2002,

and 2003.

Effects of natural compounds on plant emergence in 2001.
Effects of natural compounds on plant emergence in 2002.
Effects of natural compounds on plant emergence in 2003.
Effects of natural compounds and application methods on
mean chitinase activity of potato tuber tissue in 2001, 2002,
and 2003.

CHAPTER IV: Determination of minimum inhibitory concentrations of four
antimicrobial compounds on three Streptomyces scabies strains.

Table 4-1

Table 4-2

Table 4-3

Table 4-4

Table 4-5

Table 4-6

Table 4—7

Table 4-8

Table 4-9

Concentrations, modes of action, and antimicrobial

spectra of four antimicrobial compounds tested in vitro
against three Streptomyces scabies strains.

Comparison of effects of five concentrations of copper

(II) sulfate on the average area of grth of three
Streptomyces scabies strains.

Comparison of effects of five concentrations of copper

(II) sulfate on the grth of three Streptomyces scabies
strains as determined by average reflective intensity.
Comparison of effects of five concentrations of gentamicin
on the average area of growth of three Streptomyces scabies
strains.

Comparison of effects of five concentrations of gentamicin
on the growth of three Streptomyces scabies strains as
determined by average reflective intensity.

Comparison of effects of five concentrations of penta-
chloronitrobenzene on the average area of growth of three
Streptomyces scabies strains.

Comparison of effects of five concentrations of penta-
chloronitrobenzene on the growth of three Streptomyces

scabies strains as determined by average reflective intensity.

Comparison of effects of five concentrations of vancomycin
on the average area of grth of three Streptomyces scabies
strains.

Comparison of effects of five concentrations of vancomycin
on the growth of three Streptomyces scabies strains as
determined by average reflective intensity.

xi

119

120

121

122
123
123
125

146

150

151

153

153

156

156

158

159

LIST OF FIGURES

Introduction: A Review of the Literature

Figure 1

Structure of Thaxtomin A, a phytotoxin associated with
virulence in plant pathogenic Streptomyces species.

Chapter 1. Evaluation of PCR-based detection of pathogenic Streptomyces spp.
in soil populations of Michigan’s major potato production counties and
assessment of real time PCR as a method for pathogen quantification.

Figure 1-1

Figure 1-2

Figure 1-3

Figure 1-4

Figure 1-5

Figure 1-6

Figure 1-7

Figure 1-8

Figure 1-9

Figure 1-10

Figure 1-11

Map of Michigan counties from which soil was collected
fiom potato fields for isolation of Streptomyces species
in 2000, 2001, 2002, and 2003.

Ratios of actinomycetes obtained from 11 Michigan
counties identified as Streptomyces species by PCR
detection in 2000.

Percentages of Streptomyces spp. isolates obtained from
11 Michigan counties in which me] was detected by
PCR in 2000.

Ratios of actinomycetes obtained from 12 Michigan
counties identified as Streptomyces species by PCR
detection in 2001.

Percentages of Streptomyces spp. isolates obtained from
12 Michigan counties in which necI was detected by
PCR in 2001.

Ratios of actinomycetes obtained from 8 Michigan
counties identified as Streptomyces species by PCR
detection in 2002.

Percentages of Streptomyces spp. isolates obtained from
8 Michigan counties in which necI was detected by
PCR in 2002.

Ratios of actinomycetes obtained from 7 Michigan
counties identified as Streptomyces species by PCR
detection in 2003.

Percentages of Streptomyces spp. isolates obtained from
7 Michigan counties in which necl was detected by
PCR in 2003.

Picture of an agarose gel taken under UV light exhibiting
seven of the necI-containing Streptomyces isolates obtained
from county 5 in 2001. The PCR products from necI
amplification are 720 bp.

Mean quantity of DNA from necI -containing S. scabies
detected by real time PCR from soil samples collected
from a controlled environment experiment.

xii

26

41

42

43

44

45

46

47

48

49

51

Figure 1-12

Figure 1-13

Number of samples in which necI-containing
Streptomyces spp.were detected by classical PCR in
pre-screening before real time PCR analysis. Twenty
samples per field were screened for nec1 by classical

PCR to determine which samples required quantification
using real time PCR. The detection of necI was not
statistically significant between the fields as determined

by a one-way AN OVA.

Average cycle threshold (Ct) values obtained from the three
Michigan potato fields. The average quantification values
(Ct values) were obtained by real time PCR using primers
that were derived from necI to detect the relative quantities
of presumably pathogenic Streptomyces species DNA in
each of the soil samples between the three fields.

Chapter 11. Assessment of cultivar resistance and soil moisture application as a
means to manage potato common scab.

Figure 2-1

Figure 2-2

Figure 2-3

Figure 2-4

Figure 2-5

Figure 2-6

Compartmentalized boxes lined with plastic sheeting.

Each box contains individual water content reflectometers
and irrigation outlets.

Picture of a modified disease assessment key based on the
one developed by James (1971). The numbers represent the
percent coverage of scab lesions on the tuber surface. This
key was used for disease assessment in all experiments that
required scab evaluation in this dissertation.

Effects of four soil moisture application regimes and a
scab-susceptible cultivar, Atlantic, on average scab severity
of harvested tubers in two independent trials conducted in a
controlled environment. Asterisk denotes a statistically
significant difference as determined by an AN OVA

at alpha=0.05.

Effects of four soil moisture application regimes and

an intermediately scab-resistant cultivar, Boulder,

on average scab severity of harvested tubers in two
independent trials conducted in a controlled environment.
Effects of four soil moisture application regimes and

a scab-resistant cultivar, Liberator, on average scab severity
of harvested tubers in two independent trials conducted in a
controlled environment.

Evaluation of the effects of four soil moisture application
regimes and three cultivars with varying levels of resistance
to common scab on average scab severity of harvested
tubers in a field trial

xiii

53

54

65

67

75

76

76

78

Figure 2-7

Figure 2-8

Evaluation of the effects of soil wetting and drying cycles
on average scab severity of harvested tubers from cultivar
Atlantic conducted in two controlled environment trials.
Due to no significant trial effect according to an ANOVA
at alpha=0.05, results of the two trials were combined.
Two of the soil moisture regimes were applied continuously
at 9% and 29% volumetric water contents. The other two
regimes were applied weekly and alternated between 14%
and 21% volumetric water contents on a weekly basis.
Evaluation of the effects of soil wetting and drying cycles
on average scab severity of harvested tubers from cultivar
Atlantic in a field trial in 2003.

Chapter III. Assessment of four compounds on elicitation of the systemic acquired
resistance response in potato to common scab infection.

Figure 3-1

Figure 3-2

Figure 3-3

Figure 3—4

Figure 3-5

Figure 3-6

Figure 3-7

Effects of natural resistance activators and application
method on scab incidence and severity of harvested

tubers in 2001.

Effects of natural resistance activators, natural compounds,
and application method on scab incidence and severity of
harvested tubers in 2002.

Effects of natural resistance activators, natural compounds,
and application method on scab incidence and severity of
harvested tubers in 2003.

Plots used for assessment of natural compounds at Muck
Soils Experiment Station in 2003. Plots in 2001 and 2002
were similar to the ones pictured here.

Comparison of the effects of natural resistance activators
and application method on mean yields in 2001. Means
with the same letter are not significantly different according
to t-test at a=0.05. The t-test was conducted within yield
category due to significant yield category effect as
determined by a one-way AN OVA at alpha =0.05.
Comparison of the effects of natural compounds, resistance
activators and application method on mean yields in 2002.
Means with the same letter are not significantly different
according to t-test at a=0.05. The t-test was conducted
within yield category due to significant yield category
effect as determined by a one-way AN OVA at alpha =0.05.
Comparison of the effects of natural compounds, resistance
activators and application method on mean yields in 2003.
Means with the same letter are not significantly different
according to t-test at a=0.05. The t-test was conducted
within yield category due to significant yield category
effect as determined by a one-way AN OVA at alpha =0.05.

xiv

80

83

110

111

111

113

114

115

116

Figure 3-8

Figure 3-9

Figure 3-10
Figure 3-11
Figure 3-12
Figure 3-13

Figure 3-14

Figure 3-15

Figure 3-16

Chitinase activity assays of tuber tissue from plants treated
with natural compounds in 2003.

Effects of natural compounds and application method on
tuber tissue slices from various depths challenged with
Streptomyces scabies.

Effects of challenged tuber tissue on average chitinase
activity.

Daily precipitation data collected from Laingsburg,
Michigan for the 2001 field trial.

Daily precipitation data collected from Laingsburg,
Michigan for the 2002 field trial.

Daily precipitation data collected from Laingsburg,
Michigan for the 2003 field trial.

Daily average soil temperature data taken from depths of
50.8 mm (2 in) and 101.6 mm (4 in) collected from
Laingsburg, Michigan for the 2001 field trial.

Daily average soil temperature data taken fiom depths of
50.8 mm (2 in) and 101.6 mm (4 in) collected from
Laingsburg, Michigan for the 2002 field trial.

Daily average soil temperature data taken from depths of
50.8 mm (2 in) and 101.6 mm (4 in) collected from
Laingsburg, Michigan for the 2003 field trial.

XV

126

127

128

129

129

130

130

131

131

LITERATURE REVIEW

Importance of the Potato

The potato (Solanum tuberosum L.), native of South America’s Andean
highlands, has been cultivated for at least 7,000 years according to studies using scanning
electron microscopy and radiocarbon dating (Martins, 1976). Some archaeological
evidence suggests that wild potatoes were eaten 13,000 years ago in Chile (Simpson and
Ozorgaly, 1995). The potato is a member of the Solanaceous plant family, which is made
up of approximately 96 genera and 2800 species, with the greatest diversity in the
American tropics (Walters and Keil, 1996). Solanaceae is one of the most economically
important plant families. In addition to the potato, it includes the following major crops:
tomato (Lycopersicon esculentum), eggplant, (Solanum melongea), bell peppers and chili
peppers (Capsicum species), tomatillo (Physalis philadelphica), and tobacco (Nicotiana
tabacum).

Solanum, the genus to which the cultivated potato tuber belongs, contains
approximately 1,000 species. Yet, the cultivated potato belongs primarily to Solanum
tuberosum. This cultivated species is a tetraploid, which consists of two subspecies, S.
tuberosum subsp. tuberosum and S. tuberosum subsp. andigena. At least six additional
cultivated species: Solanum ajanhuiri, S. phureja, S. stenotomum, S. chaucha, S.
juzepczukii, and S. curtilobum and more than 230 wild species are generally recognized
(Harris, 1992). Due to the extensive work of plant breeders, agronomists, and plant
pathologists, today the potato is grown worldwide as it has become well adapted to cool

temperate zones of the high altitudes of the Andes, at sea level in temperate zones in

North America, Europe, southern Chile and Argentina, and at appropriate altitudes in
intermediary latitudes. As a result of these factors, the potato ranks first as the most
important dicotyledonous food crop, and is surpassed only by wheat, rice, and corn to be
the world’s fourth most important human food source. Hence, understanding diseases
that affect the yield and market quality of such a high-value crop is extremely critical so

that proper disease management strategies can be established.

Streptomyces scabies, The Primary Causal Agent of Potato Common Scab

Common scab of potato is caused by several Gram-positive filamentous species
of Streptomyces, but Streptomyces scabies is the predominant causal agent. Originally
named Oospora scabies, the organism was described as a “bacteria-like fungus”
(Thaxter, 1890). Over twenty years passed before it was determined that it was in fact a
bacterium, and it was renamed Actinomyces scabies (Gussow, 1914). Eventually the
actinomycetes were subdivided, and the pathogen was placed it into the genus
Streptomyces (Waksman and Henrici, 1948).

Streptomyces scabies is an aerobic, soil-bome bacterium that causes a range of
symptoms on the surface of potato tubers including superficial cork-like lesions,
erumpent cushion-like raised scabby lesions, and pitted lesions, which extend through the
tuber periderm into the cortex and vascular storage parenchyma. This bacterium is the
most important plant pathogen in the genus Streptomyces worldwide, and common scab
of potato ranks fourth in severity of potato diseases (Hooker, 1981) and affects potatoes
where ever they are grown. Pathogenic streptomycetes are able to cause a variety of

diseases, including pod wart of peanut, scab disease on radish, carrot, red beet and sugar

beet roots, as well as root rots on the fibrous roots of many plants, such as celery, sweet
potato and eggplant.

In addition to S. scabies, other species within the genus Streptomyces, such as S.
acidiscabies and S. caviscabies have more recently been identified as causal agents of
potato scab. Currently, there is a growing list of more than thirty Streptomyces species
capable of enciting scab lesions on potatoes (Table 1). It is likely that there are more
species that cause scab, but they have yet to be identified.

Historically, identification of the pathogen has been difficult and inaccurate due to
the variability of morphological and physiological characteristics, which were used as the
basis for taxonomy. Only within the last decade have the most efficient methods of
DNA-based methods been used for rapid identification of the various species and strains.
Hence, taxonomic studies of the genetically diverse causative organisms have only

recently been consistent since the development and use of DNA-based detection methods.

TABLE 1. A list of species within the genus Streptomyces that are causal agents
of potato scab, and their reference and year of publication.

 

 

Year
Potato Scab Causal Agent Reference Published

Streptomyces scabies Thaxter 1890
Streptomyces violaceus Rossi-Doria 1891
Streptomyces intermedius Kruger 1904
Streptomyces clavifer Millard and Burr 1926
Streptomyces fimbriatus Millard and Burr 1926
Streptomyces sampsonii Millard and Burr 1926
Streptomyces setonii Millard and Burr 1926
Streptomyces wedmorensis Millard and Burr 1926
Streptomyces candidus Krasil'nikov 1941
Streptomyces globisporus Krasil'nikov 1941
Streptomyces Iongisporus Krasil'nikov 1941
Streptomyces albidoflavus Waksman and Henrici 1948
Streptomyces n’mosus Sobin et al . 1953
Streptomyces aureofaciens Corbaz 1964
Streptomyces fla veolus Corbaz 1964
Streptomyces gn‘seus Pridham 1970
Streptomyces atroolivaceous Archuleta and Easton 1981
Streptomyces cinerochromogenes Archuleta and Easton 1981
Streptomyces corchorusii Archuleta and Easton 1981
Streptomyces diastatochromogenes Archuleta and Easton 1981
Streptomyces Iydicus Archuleta and Easton 1981
Streptomyces resistomycificus Archuleta and Easton 1981
Streptomyces collinus Dey et al. 1981
Streptomyces acidiscabies Lambert and Loria 1989
Streptomyces caviscabies Goyer et al. 1996
Streptomyces turgidiscabies Miyajima et al. 1998
Streptomyces europaeiscabiei Bouchek-Mechiche et al. 2000
Streptomyces stelliscabiei Bouchek-Mechiche et al. 2000
Streptomyces species strain VKM Ac-2124 Shashkov et al . 2002
Streptomyces Iuridiscabiei Park et al. 2003
Streptomyces niveiscabiei Park et al . 2003
Streptomyces puniciscabiei Park et al. 2003

The Infection Process

Streptomyces scabies produces non-fragmenting substrate mycelia that colonize the soil,
and it uses extracellular hydrolytic enzymes to obtain nutrition from the organic
compounds present in the soil. Like fungi with non-motile spores, this bacterium
produces spores for aiding in dispersal. The pathogen is spread through soil water, by
wind-blown soil, and on infected seed tubers (Agrios, 2005). The spores and mycelia of
the bacteria overwinter in the soil on infected plant tissue. The spores also contribute to
the survival over periods of drought, freezing temperatures, and anaerobic conditions
produced by water saturation (Agrios, 2005). Streptomyces scabies has been introduced
into the majority of soils by infected seed tubers. Agricultural machinery can also be a
means of dispersal for the pathogen (Agrios, 2005). Once the bacteria have been
introduced into a field, they persist and may survive indefinitely.

The smooth gray spiral spore chains arise from fragmentation of the aerial hyphae
formed from the substrate mycelium. As the cross walls of the aerial hyphae constrict, the
spores are pinched off at the tip and eventually break away. The spores produce one or
two germ tubes that are able to penetrate directly through the immature stomata and
immature lenticels yet to form a protective barrier, as well as wounds on the periderm of
the potato tuber, which is most susceptible to infection during early tuber development.
This period of rapid growth begins when the tuber diameter has reached twice that of the
stolon and will continue for six to eight weeks, depending on cultivar (Loria et al., 1997).
Once the bacterium has gained entry into the tuber, it grows between or through a few

layers of cells, which die, and the pathogen derives nutrients from them (Agrios, 2005).

In response to the bacteria, the living cells surrounding the lesion rapidly divide
and produce many cork layers around the site of entry that isolate the bacteria and many
plant cells as well (Agrios, 2005). Normally, numerous groups of cork cell layers are
produced, and as they are pushed outward from the periderm and sloughed off, the
bacteria are able to grow and multiply in the additional dead cells, leading to the
development of large scab lesions, which are darker in color than healthy skin. Such a
lesion can enlarge through the growing season and produce any or all of the three major
scab symptoms: a) superficial, russet, or surface scab refers to the cork-like lesions that
are darker than the healthy skin; b) cushion-like, erumpent, or raised scab refers to the
corky growth that protrudes from the periderm; and c) pitted or deep scab that penetrates
into the tuber and produces dark, sunken lesions. If infections occur when the tuber is
immature, then one or more of the lesion type(s) will increase in severity as the tuber
enlarges during the growing season. The lesion depth is dependent upon the cultivar
used, on soil conditions, and on the invasion of scab lesions by secondary organisms,
including insects, which are able to chew the cork layers and allow S. scabies to invade
the tuber to a much greater depth (Agrios, 2005). The mechanisms that enable the
pathogen to invade the plant and trigger the host’s response of cork production are not

fiilly understood.

The Role of Enzymes in Pathogenesis
The role of degradative enzymes during host invasion is not well documented.
The role of cellulolytic and pectinolytic activity of S. scabies has been investigated.

There is a high activity of pectic acid trans-eliminase, but there was no strict correlation

between enzyme activity and virulence (Knosel, 1970). However, since the pathogen
first attacks the middle lamellae of the cells (Lapwood, 1973), it is possible to suggest
that the activity of this enzyme functions as a virulence factor. One report of the
production of indoleacetic acid from tryptophan by S. scabies suggested that this product
may be important in pathogenesis (Hirata, 1959), but the evidence is inconclusive.
Slightly more focus on esterase has demonstrated that pathogenic S. scabies are capable
of breaking down suberin with this heat-stable enzyme (McQueen and Schottel, 1987).
Since suberin, a complex polymer composed of fatty acid polyesters and phenolic
compounds, acts as a physical barrier to pathogens, it has been suggested that esterase
produced by S. scabies may play a role in pathogenicity. Further investigation of the role
of enzymes during the infection process is required because informative correlations

between enzymes and pathogenesis are currently unavailable.

The Role of Thaxtomins in Pathogenesis

In contrast to the role of enzymes, much attention has been paid to scab
phytotoxins in pathogenesis. S. scabies produces a class of phytotoxins, known as
thaxtomins, which have been associated with potato scab. Thaxtomins were first isolated
from potato tubers and were characterized as unique 4-nitroindol-3-yl-containing 2,5
dioxopiperazines (King et al., 1992). Thaxtomin A (Figure 1) is the predominant
phytotoxin produced by both S. scabies and S. acidiscabies, but there are 10 additional
related compounds that have been isolated and characterized (King and Lawrence, 1996;

King et al., 1992).

N02 0
CH3
W“
N
N H3C/ OH
H OH
0

Figure 1. Structure of Thaxtomin A, a phytotoxin associated with virulence in plant
pathogenic Streptomyces species.

Most literature has reported thaxtomin synthesis as a necessary pathogenicity
factor. A gene, necI, was cloned from a S. scabies strain and subsequently used to
transform Streptomyces Iividans, which is not pathogenic to potato. The transformation
conferred the ability of Streptomyces lividans to necrotize and colonize potato tuber disks
and produce scab like symptoms on immature tubers (Bukhalid and Loria, 1997). The S.
lividans expressing necI did not produce thaxtomin A, but did produce an unidentified,
extracellular, water-soluble compound that caused necrosis on potato tuber disks. In
another study, this gene was structurally conserved among all but one pathogenic
Streptomyces spp. strains (Bukhalid et al., 1998). The pathogenic strain that failed to
hybridize to necI and the transformed S. lividans suggested that the fimction of the gene
is not always directly involved in thaxtomin A biosynthesis, but that it is a greater than
99% predictor of pathogenicity (Bukhalid and Loria, 1997). The complete nucleotide
sequences of two peptide synthetase genes (txtA and MB) were determined from S.
acidiscabies (Healy et al., 2000). They found that the involvement of the thaxtomin A

and thaxtomin B peptide synthetase catalytic domains was consistent with the formation

of N-methylated cyclic dipeptides such as thaxtomins. Based on hi gh-performance liquid
chromatography analysis, thaxtomin A production was abolished in txtA gene disruption
mutants, which were avirulent on potato tubers. The authors demonstrated that the
introduction of the thaxtomin synthetase cosmid into a MA mutant restored pathogenicity
and thaxtomin A production. Most studies conclude that thaxtomin biosynthesis is
necessary for pathogenicity. However, a recent study where S. scabies and S.
acidiscabies isolates were screened for thaxtomin production, one of the pathogenic
isolates was unable to produce thaxtomin A in planta (El-Sayed, 2000). The production
of other thaxtomins was not assessed. This suggests that thaxtomin production increases
a pathogen’s virulence and is not a required component of pathogenicity. Another recent
study by Kers et al. (2005) supports the notion that thaxtomins aid in virulence.
Although thaxtomins may not be determinants of pathogenicity, they have been well
studied and characterized. The pathogenicity factors required for infection in plant

pathogenic Streptomyces species are yet to be identified.

Common Scab Management Strategies

Cultivar Resistance

One of the most important management strategies in control of common scab is
the use of resistant cultivars; hence, the extensive effort of breeders and agronomists is
necessary for improved development of cultivars that display favorable agronomic traits
and resistance to common scab. Potato cultivars are well documented to widely vary in
their susceptibility to scab infections caused by Streptomyces species (Blodgett and

Stevenson, 1946; McKee, 1958; McKee, 1963; and Douches et al., 1996). If the lesions

cover more than five percent of the tuber surface, the potatoes fail to make US. No. 1
grade (U SDA-Agricultural Marketing Service, 1991). Methods for evaluation of scab
infections have been developed to compare levels of scab resistance. These rating
systems have been devised because the percentage of surface area covered and the type of
lesion can vary from tuber to tuber within a plot.

One rating system rated each tuber and classified the percentage of tuber surface
infected with scab into five categories (Emilsson and Gustafson, 195 3). They designated
lesion categories: superficial, ordinary, deep, and elevated, as well as computed the total
percentage of tuber surface covered with scab, but chose the most prevalent type of lesion
in the plot to rate the type of lesion. Another similar rating system was devised for each
tuber, but then created an overall scab index combining the percentage surface area
covered and the type of lesion (Bjor and Roer, 1980). However, a superior system for
rating resistance to scab with two separate indices was created: surface area covered (AI)
and the type of lesion (LI) (Goth et al., 1993). It was found by cluster analysis on both
AI and LI were superior to the overall index of Bj or and Roer in comparisons for
discriminating among potato cultivars (Goth et al., 1993). Numerous laboratory (King et
al., 1989; Lawrence et al., 1990) and greenhouse (Bjor and Roer, 1980; Hooker, 1950;
McKee, 1958; Wiersema, 1970) methods for screening scab resistance in breeding
material have been proposed. However, field trials are necessary to evaluate the true
value of resistance to scab because numerous variables, such as the variation in
aggressiveness of scab isolates (Elesawy and Szabo, 1979; Keinath and Loria, 1989), soil
temperature (Stevenson et al., 2001), soil moisture levels (J ellis, 1974; Lapwood et al.,

1971), and soil pH (Davis et al., 1974), are known to heavily influence the severity of

10

scab. These variables additionally make the quantification and categorization of scab
resistance in breeding material extremely difficult.

An important method in breeding selection is one that is measured by the size of
response to selection in a breeding population. This method works for quantitative traits,
whose response to selection is dependent upon the degree of genotypic and phenotypic
variance in the population, heritability, and intensity of selection (Tai et al., 1996).
Diploid interspecific hybrids that are selected for their resistance to scab and their ability
to produce 2n male gametes were a good source of resistance (Tai et al., 1996). The
examination of the transmission of resistance from diploid parents to their tetraploid
progenies through 4x-2x matings indicated that the selection for scab resistance in potato
is based on individual seedlings or best families.

The principal cultivated potato (Solanum tuberosum subsp. tuberosum) is a
tetraploid that displays tetrasomic inheritance (Harris, 1992). As a consequence, genetic
analysis has proved difficult, particularly for quantitative traits. The first well-
documented report of the genetic nature of scab resistance was proposed with the
assumption that scab resistance was due to a single, dominant gene (Sc); (Krantz and
Bide, 1941). They divided the segregating progeny of a tetraploid cross into five genetic
groups ranging from nulliplex to quadruplex for Sc. Lauer and Bide (1963) reported that
a single gene could explain scab resistance, but that for effective resistance, the gene
must be a duplex. Cipar and Lawrence (1972) concluded that the scab resistance in fact
involved more than one locus and that inheritance was relatively simple at the diploid
level. Alam (1972) hypothesized that two independent loci were required for scab

resistance where one locus, one or more dominant alleles confer resistance (Sc 1) and the

11

second locus, homozygous recessive alleles confer resistance (scz). Murphy et al. (1995)
studied the transmission of scab from diploid parent to the tetraploid level and was able
to support Alam’s hypothesis.

Estimates of broad-sense heritability (N yquist, 1991) are important because both
additive and non—additive genetic variances are usable. The magnitudes of the additive
and nonadditive components of these genetic variances are not known. The high broad-
sense heritability estimate suggested that a genotype identified as scab resistant would
remain scab resistant in many different growing environments (Haynes et al., 1997).
This group documented significant genotype x environment interaction for both AI and
LI. The genotypic material whose resistance to disease was close to immune remained
fairly stable in different environments. However, for both of the indices, the genotype x
environment variance was only one-half to one-third of the variance due to the
environment.

Tuber Periderm Development. The mechanisms of scab resistance have been
closely associated with tuber periderm development. Lutrnan (1919) concluded that the
thickness of the tuber skin determined its resistance to scab. Darling (1937) noted that
the lenticel was the primary avenue of infection and that resistant cultivars had lenticels
that were smaller and consisted of small, closely associated, suberized cells whereas
those of the susceptible cultivars were large and composed of loosely arranged, spherical
cells. Fellows (1927) proposed that the tuber must be actively growing if infection is to
occur. This was based on scab infections occurring only in immature stomata and
lenticels that are formed in new and rapidly growing protective tissue (Fellows, 1927).

Most attention has been given to younger tubers since Sanford (1926) had shown that the

12

infection occurred during the early stages of tuberization. Histological studies showed
that the outer-most cell layers of the periderm were remaining in a living, nucleated
condition in a resistant cultivar, while those of the susceptible lines were not (Cooper et
al., 1954). They proposed resistance to be closely associated with the nature of the
development of the periderm during tuberization.

Chlorogenic Acid Content. The role of Chlorogenic acid in cultivar resistance to
scab has been studied. Johnson and Schaal (1952) demonstrated a close correlation
between the amount of Chlorogenic acid in the tuber’s peripheral layers and scab
resistance. Susceptible tubers possessed about half the quantity of the acid of the
resistant cultivars. They suggested that Chlorogenic acid lowers the pH of the cells,
thereby acting as an unsuitable medium for the bacteria or that the acid itself or its
quinone may be directly or indirectly involved in the formation of the suberized
periderm. Emilsson and Gustafsson (1953), however, were unable to support the Johnson
and Schaal (1952) study. They found no correlation with scab resistance and Chlorogenic
acid. Further investigations on the role of Chlorogenic acid and phenol oxidase in cultivar
resistance to scab produced no correlations (Holm and Adams, 1960).

Thaxtomin Sensitivity. The relative susceptibilities of cultivars to S. scabies and
their corresponding sensitivities to thaxtomin A have shown to be positively correlated
(Acuna et al., 2001). This suggests that different degrees of modification of the
phytotoxin to the tuber tissues to yield less bioactive metabolites may be an important
component of cultivar resistance. Such assumptions are consistent with the fact that
many xenobiotics, such as herbicides, are metabolized after being introduced into plant

tissue. The metabolism by oxidation, hydrolysis, or conjugation (usually to

13

carbohydrates, glutathione, or amino acids), often leads to detoxification of the original
active compounds (Kaufman, 1976). Some of these transformations can be accompanied
by microbial agents. King and Lawrence (2000) described microbially induced
conjugation of thaxtomin A and thaxtomin B to make 0—glucosides 3 and 4, respectively.
They noted a relative loss of bioactivity when these conjugates were applied to the
surfaces of aseptically cultured potato minitubers.

Chemical Control

Decreased scab incidence was reported when soil was treated with the fungicide
pentachloronitrobenzene, (Hooker, 1954). Pentachloronitrobenzene (PCNB) was found
to vary in effectiveness depending on the method and rate of application. The reduction
of scab severity using this fungicide was effective at exceedingly high rates according to
Davis, et al. (1974). Analogues of daminozide (N-dimethylaminomaleamic and N-
(dimethylamino)-methylsuccinamic acids) were found to decrease scab incidence when
applied as a foliar spray or applied directly to soil (McIntosh and Bateman, 1979).
Another study tested 30 compounds related to an effective scab control foliar spray, 3,5~
dicholorphenoxyacetic acid. None of the compounds were more effective than 3,5 -D,
and those that were as effective also demonstrated negative effects on tuber yield,
number, and shape (McIntosh et al., 1985). Substituted benzoic and picolinic acids
reduced scab in greenhouse experiments; however, the foliage in some of the treatments
was damaged (McIntosh and Bateman, 1988), suggesting that systemic acquired
resistance may have been involved in the scab reduction.

Sulfur, when combined with 90% available soil moisture, was effective in

reducing scab incidence and severity (Davis et al., 1974b). Other studies confirmed these

14

results (Davis et al., 1974a and Davis, et al., 1976). However, sulfur applied without
added soil moisture was ineffective in reducing scab infection in all studies and the
possible effects of sulfur on yield were not published in any of these studies. Sulfur was
effective in reducing Streptomyces soil rot of sweet potato, a disease caused by a closely
related pathogen; however, yields were decreased (Ristaino and Averre, 1992).

Captafol (McIntosh, 1977) and ethionine (McIntosh and Burrell, 1980) were
effective in decreasing scab severity, with little reduction in yield. However, none of
these are currently available in commercial formulations to control scab disease.
Attempts to control Streptomyces soil rot, a disease of sweet potato caused by a related
pathogen, Streptomyces ipomoea, with sulfirr and soil fumigation with Telone C-17
reduced disease. Fumigation proved effective, but the sulfur treatments significantly
reduced yield (Ristaino and Averre, 1992). More recently, efforts to control common
scab with sodium hypochlorite and thiophanate-methyl seed treatments provided no
significant reductions in scab infections (Errampalli and Johnston, 2000). Currently,
there are no conventional pesticides registered to control common scab; therefore, the
focus and establishment of other control methods is essential.

Soil Moisture

One study that initiated the use of irrigation to control scab was conducted by
Sanford (1923). Soil moisture treatments applied in high amounts were shown to
significantly reduce the severity of scab infection by S. scabies. Consequently, many
studies using irrigation as a means to control scab followed Sanford. Irrigation applied
during the early stages of tuberization was shown to speed the swelling of the tubers and

significantly decreased incidence of scab (Lapwood et al., 1970). At high water

15

potentials at or near field capacity, the actinomycete populations on the lenticels were
low, and the bacterial populations were high, which suggested that irrigation might
decrease the population of S. scabies in tuber lenticels by increasing populations of scab-
antagonistic bacteria.

The amounts of irrigation that effectively control scab, the appropriate timing of
irrigation, and the reduction in scab infection are variable between reports. Some have
reported that the incidence of potato scab increased with soil moisture (Starr et al., 1943)
or that precipitation, which led to high soil moisture content, did not reduce scab
infection on tubers (Goto, 1985). However, this may be due to the soil type, since dry
soils have been shown to increase incidence and severity of disease or could be due to
evaporation of precipitation. This also may be due to the water repellent nature of sand,
which is exacerbated by high temperatures. Although relatively few studies associate
increased scab infection with increased soil moisture, the majority of reported irrigation
experiments to control scab demonstrate that S. scabies is inhibited in soils with high
moisture levels. Irrigation for four weeks after tuber initiation at a 15 mm soil moisture
deficit was found to decrease scab most effectively in one study (Lapwood, 1973).
According to another experiment, five weeks of irrigation following tuber initiation was
found to substantially reduce scab, while two weeks of irrigation after initiation was not
sufficient to provide management of scab (Lewis, 1970). Although there is variation in
relation to timing of irrigation, which is most likely due to environmental and cultivar
effects, irrigation that provides adequate soil moisture at or near field capacity during
tuberization is one of the most important crop management methods of controlling this

disease without significantly reducing yield. However, a study by Davis et al. (1974b)

16

underscores the importance of combining irrigation with other methods to control
common scab. They irrigated soils to greater than 90 percent available soil moisture
during the early stages of tuber development and this was not sufficient alone to produce
tubers of adequate quality for market standards. Studies that combine soil moisture
management and cultivar resistance are needed. Yet, maintenance of sufficient soil
moisture should not be overlooked and is particularly important because there are no
resistant cultivars completely immune to the disease and there are no commercially
available effective chemicals that have been developed to control this disease.

Biological Control

Scab decline due to a biological factor was first demonstrated by the application
of 1 percent suppressive soil plus 1 percent alfalfa meal into disease conducive soils
(Menzies, 1959). Several Streptomyces species isolated produced bacteriocins against
virulent isolates. They also reduced the number of scab lesions on potato tubers grown in
a field experiment (Lorang, 1988). Strains of Streptomyces antagonistic to the pathogen
were isolated from potatoes grown in a soil that became suppressive to scab after twenty-
three years of potato monoculture (Lorang et al., 1989). The decreased severity of potato
scab caused by the antagonistic Streptomyces strains did not affect yield in the tuber plots
(Liu etal., 1995). All of the suppressive isolates have been found in soils that have been
cropped to potatoes for over 20 successive seasons and had subsequently become
naturally suppressive to the pathogen (Menzies, 1959). All of the strains are non-
pathogenic and are members of the genus Streptomyces. It has been demonstrated in
vitro that these isolates produce antibiotics that are inhibitory toward pathogenic S.

scabies strains (Liu et al., 1996; Lorang et al., 1995). Organisms in this genus produce a

17

variety of antibiotics with a diversity of structures, including polyketides, B-lactams and
peptides in addition to many other secondary metabolites that have anti-fungal, anti-
tumor, and immunosuppressive activities (Chater and Hopwood, 1993).

The antibiotics produced by the suppressive isolates, which have been found in
the naturally suppressive soils, may play a primary role in inhibiting the potato scab
pathogen. The mechanism of antibiosis as a biological control measure has been well
understood in other systems (Kerr, 1980; Silo-Sub, etal., 1994). Understanding the
nature and diversity of the streptomycete antibiotics is necessary for characterizing the
mechanism of biological control of potato scab. Also, the availability of these antibiotics
for application to disease-conducive soils may be an effective way to potentially augment
the activity of these biocontrol organisms. It seems that the suppressive strain would
either need to outcompete pathogenic S. scabies for the available resources or be able to
inhibit the pathogen directly (Liu et al., 1996). A recent attempt to disinfest seed
potatoes of S. scabies with a Streptomyces phage in vivo significantly disinfested seeds
and hence, reduced contamination of soil from seed-tuber-borne inoculum and reduced
infection of daughter tubers (McKenna et al., 2001). Since no chemicals are available for
scab control, effective scab-antagonistic biocontol agents should be further explored.

Induced or Acquired Resistance

A phenomenon in many plant species is demonstrated when a plant is able to
respond to pathogen infection due to the induction of a broad-spectrum resistance to
subsequent infection by the same or other pathogens. This phenomenon is known as
systemic acquired resistance (SAR), or induced resistance. The broad immunity of SAR

arises as a result from infection with a necrotizing pathogen, a naturally occurring

18

compound in nature, or a synthetic chemical compound. SAR development is triggered
by a virulent or avirulent pathogen, a natural elicitor, or a synthetic chemical elicitor.
Following the induction of resistance is usually an accumulation of salicylic acid and
pathogenesis-related (PR) proteins. Van Loon et al. (1994) proposed a PR-protein
nomenclature, which comprises 11 families of proteins. PR-protein examples are
chitinases (PR-3 family), B-1,3 glucanases (PR-2 family), and osmotin (PR-5 family),
which all show antimicrobial activity in vitro.

Early work on the induced resistance phenomenon was reviewed by Chester
(1933), and he termed it physiological acquired immunity. Pioneering studies by Ross
(1966) experimentally proved that a localized, necrotic infection could lead to resistance
against further infection by the same or by many different pathogens. The Food Quality
Protection Act, signed into legislation in 1996, has led to an increased interest in
development of biopesticides, some of which elicit the SAR pathway of resistance. Since
the EPA annually reviews the conventional pesticides, each year many are unregistered
for use, due to persistence in environment, carcinogenicity, and toxicity leading to
negative impacts on human health, environmental quality, and endangered species.
Therefore, much interest has been focused on development of natural inducers of plant
resistance, which, unlike conventional agricultural pesticides, are environmentally
friendly (Ozeretskovskaya, 1995 and Hammerschmidt and Dann, 1997).

Chitosan, a polymer of B-l,4-D-glucosamine, is non-toxic, biodegradable, and
biocompatible. Chitosan has been used as an elicitor for plant protection from pathogens
(Hadwiger et al., 1984). Treatment with Chitosan has enhanced resistance of tomato to

F usarium oxyporum f. sp. radicis-lycopersici (Benhamou and Thériault, 1992), has been

19

an effective elicitor of resistance in potato to late blight (Vasyukova et al., 2000),
effectively reduced leaf rust of peanut against Puccinia arachidis (Sathiyabama and
Balasubramanian, 1998), and also activated protective mechanisms against the root-knot
nematode, Meloidogyne incognita (V asyukova et al., 2001). Beausejour et al. (2003)
found that combining Chitosan with Streptomyces melanosporofaciens, a biocontrol
agent, led to a greater reduction of common scab incidence and severity than by applying
them as separate treatments. Their findings support the general notion that induced
resistance should not be used as a stand-alone tool in the management of plant diseases.
Harpin, a protein isolated from Erwinia amylovora, the bacterium that causes fire
blight of pome fruits, was identified as an elicitor of plant defenses by Wei et al. (1992).
The protein is responsible for eliciting the development of the hypersensitive response
(HR), which is a rapid, localized cell death. The HR is associated with many broad-
spectrum host defensive responses, including generation of reactive oxygen species and
lignification of the host cell wall. In addition to the hypersensitive response, the
resistance activator harpin has been correlated with induction of mitogen-activated
protein kinase activity (Desikan et al., 1999), which is an important component of
signaling during plant pathogen interactions (Ligterink et al., 1997). SAR induction by
harpin is mediated through salicylic acid and the NIMI gene (Dong et al., 1999). One
study found that transgenic potato plants expressing harpin protein had reduced the lesion
growth rate of Phytophthora infestans, and concluded that the hypersensitive response in
potato was a promising approach to enhance disease resistance (Li and Fan, 1999). Like

Chitosan, harpin is able to protect against a broad range of phytopathogens. Also, it is a

20

low risk biopesticide that is much safer than conventional pesticides and is
biodegradable.

A recent study reported that benzothiadiazole (BTH) effectively induced
resistance in greenhouse-grown potato plants against Alternaria solani and Erysiphe
cichoracearum (Bokshi et al., 2003). BTH was also effective in reducing the severity of
early blight in field-grown plants and reduced the severity of dry rot of field-grown tubers
(Bokshi et al., 2003). Increased B-1,3-glucanase activity in all plant organs, except roots,
was detected for up to 45 days after treatment. The potential use of these naturally
derived elicitors has not been thoroughly investigated in relation to induction of
resistance to potato common scab. Further investigations that combine resistance
activators with other management methods are required.

As previously mentioned, there are no chemicals registered for scab control and
current management strategies are limited, not always practical and not always firlly
effective. Current disease management recommendations to growers for control of potato
common scab include the following: plant disease-flee seed, use resistant cultivars (most
potatoes currently demanded by the market are susceptible) and apply careful irrigation
during early tuber development. The primary goal of this thesis is to investigate the
usefulness of management strategies and molecular diagnostic methods for potato scab.
The four main objectives of this study are to: 1) assess the effects of combining cultivar
resistance with soil moisture application on potato common scab severity (Chapter II); 2)
determine the effects of four compounds on induction of resistance in potato to common

scab (Chapter III); 3) evaluate two PCR-based methods for detection and quantification

21

of pathogenic Streptomyces species (Chapter I); and 4) determine the effects of

antimicrobial compounds on the growth of Streptomyces scabies in vitro (Chapter IV).

22

Chapter I

EVALUATION OF PCR-BASED DETECTION OF PATHOGENIC
S T REPT 0M Y CES SPECIES IN SOIL POPULATIONS OF
MICHIGAN ’S MAJOR POTATO PRODUCTION COUNTIES AND
ASSESSMENT OF REAL TIME PCR AS A METHOD FOR
PATHOGEN QUANTIFICATION.

INTRODUCTION

Fresh market standards for potatoes permit very few blemishes on the surface of
US. Grade A potatoes (U.S.D.A., 1991). The specifications for potato common scab
infection are less than 5% surface area of the tuber can be covered by scab lesions for
US. Grade A. By identifying fields with the lowest levels of inoculum, production of
higher quality tubers is more likely. Fields with high levels of inoculum should be
avoided and when used, require a judgment between risk and value loss (Wale, 2004).

Current methods of pathogenicity testing for Streptomyces species on tuber and
tap root crops are based on laborious thaxtomin or melanin production assays (Leiner et
al., 1996; Lawrence et al., 1990; Kinkel et al., 1998; Goth and Webb, 1986; Keinath and
Loria, 1990; and Wanner, 2004), which are partial indicators of pathogenicity, or are
based on inconvenient, time-consuming potato tuber pathogenicity tests (Schaad, 2001).

Soil-bome plant pathogens, particularly persistent ones in which long rotations
have little to no effect, create a severe risk to potato growers if environmental conditions
are favorable for disease development and susceptible cultivars are planted. Determining
disease risk based on populations of soilbome pathogens, such as Streptomyces scabies,

may be a valuable tool that can reduce the epidemics associated with soilbome diseases.

23

The necI gene, closely correlated with pathogenicity in S. scabies, was suggested
for use in detection of causal agents of scab (Bukhalid et al., 1998). Recent studies using
tree] as a screening tool in PCR assays have successfully identified necI as a
pathogenicity indicator by Bukhalid et al., 1998; Bukhalid et al., 2002; Park et al., 2003;
and Wanner, 2004 . The most current recommendation for S. scabies identification is
PCR using necI (Schaad et al., 2001). Recent development of conventional and
quantitative real time PCR assays in other pathosystems in identification of soil-borne
plant pathogens in soil and plant material suggests that this approach may be useful in
quantifying pathogenic Streptomyces spp. directly in soil (Lees et al., 2002; Cullen et al.,
2002; Cullen et al., 2001;and Bell et al., 1999). Rapid detection of this pathogen is
critical so that disease risk assessment can be established. Methods using necl
(presumed to be a likely predictor of plant pathogenicity; Bukhalid et al., 1998) in PCR
detection of isolates obtained from soil and in DNA extracted directly from soil using real
time PCR were evaluated. The objectives of this study were to 1) evaluate PCR detection
of pathogenic Streptomyces species obtained from soil populations of Michigan’s major
potato production counties; and 2) assess the usefulness of real time quantitative PCR as
a method for pathogen quantification in soil sampled fi'om a controlled environment

experiment and from Michigan potato production soils.

24

MATERIALS AND METHODS

PCR DETECTION OF PATHOGENIC STREPTOMYCES SPP. IN MICHIGAN
Soil Sampling

Soil samples were obtained from Michigan potato fields in major potato production
counties for isolation of Streptomyces spp. to be used for PCR detection experiments. In
2000, soil samples were collected from commercial potato production fields or from
Michigan State University potato research fields within the following counties: Bay,
Delta, Dickinson, Kalkaska, Luce, Monroe, Montcahn, Otsego, Presque Isle, Saint
Joseph, and Sanilac (Figure 1-1). In 2001, soil samples were collected from commercial
potato production fields or from Michigan State University potato research fields within
the following counties: Clinton, Delta, Dickinson, Huron, Luce, Mecosta, Montcalm,
Otsego, Presque Isle, Saginaw, Saint Joseph, and Tuscola (Figure 1-1). In 2002, soil
samples were collected from commercial potato production fields or from Michigan State
University potato research fields within the following counties: Dickinson, Kalkaska,
Luce, Monroe, Montcalm, Otsego, Presque Isle, and Saint Joseph (Figure 1-1). In 2003,
soil samples were collected from commercial potato production fields or from Michigan
State University potato research fields within the following counties: Luce, Marquette,
Monroe, Montcalm, Otsego, and Presque Isle (Figure 1-1). Soil was taken from one
location per field (from at least 10 m from edge of field inside the plant canopy). Debris
was removed from the upper layer of soil and soil was collected at a depth of 15 cm with

a hand shovel until approximately 700 g of soil was obtained from each field.

25

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

O

—0@
OP
0

 

 

O 2000

O 2001 ,i L

 

_
d—

 

 

 

 

A 2002
9 2003 i i T AI—

Figure 1-1. Map of Michigan counties from which soil was collected fiom potato fields for
isolation of Streptomyces species in 2000, 2001, 2002, and 2003.

26

Isolation of Streptomyces spp. From Soil

Plant debris and stones were manually removed from the soil samples. The soil
samples were air dried for 10 days at room temperature to reduce non-filamentous
bacteria. Soil (10 g) was placed in sterile 500 ml Erlenmeyer flasks and 90 m1 of 0.1%
weight/volume sterile water agar was added. The Erlenmeyer flasks were placed on an
orbital shaker at 200 rpm for 2 hours. Serial lO-fold dilutions were made in 0.85%
sodium chloride. The first dilution was made in 9 ml of the saline solution. Subsequent
dilutions were prepared in 900 ml volumes. Aliquots of 100 pl were applied to water
agar (WA; 14 g of agar per liter of sterilized distilled water adjusted to a pH of 7.2 with l
M NaOH) and STR, a semi-selective Streptomyces medium developed by Conn et al.
(1998) with a glass spreader. STR medium is (per liter of distilled water): soluble potato
starch, 5.0 g; yeast extract, 4.0 g; bacto peptone, 0.6 g; protease peptone number 3, 0.6 g;
NaCl, 10 g; KzHPO4, 1.0 g; MgSO4'7HzO, 0.5 g; agar, 17 g; and 1 ml of a micro-element
stock solution (FeSO4, 10 mg; ZnSO.;, 1 mg; and MnCl, 1 mg dissolved in distilled
water). The pH of STR is 7.2. After autoclaving, the following antibiotics were added:
200 ppm cycloheximide (dissolved in 70% ethanol), 5.6 ppm nystatin (dissolved in 95%
ethanol), 0.6 ppm rifampicin (dissolved in methanol), and 15 ppm nalidixic acid
(dissolved in 0.1 N sodium hydroxide). Cultures were incubated at 30°C for at least 10
days. Colonies were selected for further analysis (DNA extraction and PCR) based on
having morphological features characteristic of Streptomyces scabies. These features

included substrate and aerial mycelium formation and sporulation on STR and WA.

27

Genomic DNA Extraction

In 2000 and 2001, DNA was extracted from isolates with typical Streptomyces
scabies colony morphology by the following method. Cultures of each single colony
isolate were prepared in 100 ml of oatmeal broth in sterile 250 ml Erlenmeyer flasks. To
prepare oatmeal broth, rolled oats (20 g) in distilled water (1 l) were boiled for 10
minutes and then strained through 4 layers of cheesecloth, yielding 800 ml of filtrate.
Micronutrient stock solution (lml) (FeSO4'7HzO, 0.1 g; MnC12'4H20, 0.1 g;
ZnSO4’7HzO, 0.1 g; distilled H20, 100 ml) was added to the filtrate, and the volume was
brought to 1 l. The pH was adjusted to 7.2 with 1M sodium hydroxide before
sterilization by autoclaving. Cultures were incubated on an orbital shaker at 185 rpm for
at least 72 hours at room temperature. Cells were collected from liquid cultures and
centrifuged for 1 minute at 6,000 rpm. Cells were subsequently washed with 2 ml of
0.1X SSC (1X SSC is 0.15 M sodium chloride plus 0.015 M sodium citrate). Cell lysis
buffer (1 ml) was added (0.1 M sodium phosphate (pH 7.0) plus 20 % weight/volume
sucrose) and 2.5 mg/ml of lysozyme (from chicken egg white) per sample and incubated
for at least three hours at 37°C. DNA extraction buffer (400 pl) was added to each
sample (200 mM Tris pH 7.0, 25 mM EDTA, 0.5% weight/volume sodium dodecyl
sulfate). The supernatant was collected (1 ml) by centrifugation at room temperature for
2 minutes at 13,000 rpm and was extracted twice with a 500 pl of a phenol: chloroform:
iso-amyl alcohol solution (25:24: 1) and each concluded with centrifugation at room
temperature for 5 minutes at 13,000 rpm. A one volume of iso-propanol was added and
mixed well by inversion, the samples were centrifuged at room temperature for 5 minutes

at 13,000 rpm and the DNA was vacuum-dried for 20 minutes. Vacuum-dried samples

28

were resuspended in 50 ul of sterile nuclease free water and stored at -20°C. In 2002 and
2003, DNA was extracted from isolates with typical S. scabies colony morphology by the
following method. Single colony isolates were streaked onto 5 Petri dishes (100 mm x 15
mm) of potato, dextrose agar (PDA). PDA was purchased and prepared as described by
Sigma Chemical Company at 39.0g/l of distilled water, Saint Louis, Missouri, USA, and
the pH was adjusted to 7 .2 with 1 M NaOH. Cultures were incubated at room
temperature or 30°C for approximately 10 days and spores were collected with a sterile
spatula and placed into a sterile 1.5 ml microcentrifuge tube. A total of 300 mg of spores
was obtained per isolate. The spores were suspended in 500 ml of AutoGen CTAB
(purchased from AutoGen, Holliston, Massachusetts, USA), vortexed, and incubated for
at least 1.5 hours at 65°C. The lysed spore suspension was transferred to sterile AutoGen
tubes and submitted to the Genomics Technology Support Facility at Michigan State
University, East Lansing, Michigan, USA, for genomic DNA extraction using the
AutoGenprep 850alpha® robot using the machine’s plant/flingal protocol and reagents.
Gel electrophoresis was used to verify the DNA extraction process before proceeding
with PCR. In all years DNA samples (10 pl) were stained in a Ficoll® -based loading
dye (15% Ficoll® type 400 (purchased from Amersham Biosciences, Buckinghamshire,
England), 0.25% bromophenol blue, and 0.25% xylene cyanol FF) and loaded into 1%
agarose gels made of 1X TAE (1X TAE is 40 mM Tris, 40 mM acetic acid, and 1 mM
EDTA) and electrophoresed. Agarose gels were then stained for at least 10 minutes in an
ethidium bromide stock solution (10 mM Tris-HCl, 1 mM EDTA, 1 mg/ml ethidium

bromide) and viewed under UV light.

29

PCR Detection of Streptomyces spp. and necl

The sets of primers used to screen the isolates for the genus Streptomyces were
developed by Bukahlid et al. (1998) and Edwards et al. (1989). The sequences of these
primers are If: 5’-GTTGTCTTCGG CGAGGGCGTGCAGG-3’ and Ir: 5’-AGCG
GAAGGATTTGCGACCACCAACG-3’ and pA: 5’-AGAGTTTGAT CCTGGCTCAG-
3‘ and pH: 5’-AAGGAGGTGATCCAGCCGCA-3’ (Table 1-1). In 2000 and 2001, two
subsamples per field were screened until 20 bacterial isolates were positively identified as
Streptomyces spp. In 2002 and 2003, one sample per field was screened until 20 isolates
were identified as Streptomyces spp. These isolates were then subjected to further
screening for pathogenicity using a set of primers for amplification of necI , a gene highly
correlated with plant pathogenicity in Streptomyces spp and highly conserved among
plant pathogenic Streptomyces species. These primers were developed by Bukahlid,
Chung, and Loria (1998). The sequences of these primers are Nf (5’-
ATGAGCGCGAACGGAAG CCCCGGA-3’) and Nr (5’-GCAGGTCGTCACG
AAGGATCG-3’) (Table l-l). PCR amplification was carried out with REDTaq® DNA
polymerase (5.0 U; Sigma Chemical Company, Saint Louis, Missouri, USA) using all
REDTaq® reagents (10X PCR buffer: 100 mM Tris-HCl, pH 8.3, 500 mM KCl, 15 mM
MgC12 and 0.01% gelatin; 10 mM dNTP mix: 10 mM each of dATP, dCTP, dGTP, and
dTTP) with sterile water double processed for tissue culture (Sigma Chemical Company,
Saint Louis, Missouri, USA). The thermal cycler parameters used for all PCR reaction
was: DNA denaturing at 94°C for 1 min., annealing at 50°C for 2 min., and elongation at
72°C for 2 min. for 25 cycles. DNA from the S. scabies strain DP and sterile water was

included in all PCR experiments as positive and negative controls, respectively. The

30

amplified DNA was electrophoresed on 1% agarose gels made of 1X TAE or 1X TBE
(1X TBE is 89 mM Tris, 89 mM boric acid, 2 mM EDTA). Agarose gels were then
stained for at least 10 minutes in an ethidium bromide stock solution (10 mM Tris-HCl, 1

mM EDTA, 1 mg/ml ethidium bromide) and viewed under UV light.

TABLE 1-1. Primers used in PCR and real time PCR targeted against nec1, the
genus Streptomyces and the pBluescript plasmid.

 

 

Primers Nucleotide sequence (5'-3') '22: [(31 ISL Reference
nec1

Nf ATGAGCGCGAACGGAAGCCCCGGA 250 Bukhalid eta]. 1998

Nr GCAGGTCGTCACGAAGGATCG 250 Bukhalid etal. 1998
Streptomyces

If GTTGTCTI'CGGCGAGGGCGTGCAGG 250 Bukhalid etal. 1998

Ir AGCGGAAGGATTTGCGACCACAACG 250 Bukhalid etal. 1998
Streptomyces

pA AGAG'ITI'GATCCTGGCTCAG 150 Edwards et al. 1989

pH AAGGAGGTGATCCAGCCGCA 150 Edwards et al. 1990
real time nec1

qnec1f GCCGCTCGGAGAGTACGA 300 This study"

qnec1 r AAGCGCTGGGCATTG'I‘I’G 300 This study“
real time pBlue

pBluef TGGGCTGTGTGCACGAAC 300 This study'

pBluer TCAAGACGATAGTI'ACCGGATAAGG 300 This study3
' Designed by using Primer Express (version 1.0) software (PE Applied Biosystems)

QUANTIFICATION OF PATHOGENIC STREPTOMYCES SPP. SOIL
POPULATION S
1. Assessment of Pathogen Populations in a Controlled Environment Experiment
Soil Sampling

Soil was sampled from the second trial of the controlled environment continuous soil
moisture experiment conducted in Chapter 2. Soil was taken from one location per
treatment at a depth of 15 cm with a hand shovel until approximately 300 g of soil was

obtained from each treatment.

31

Soil DNA Extraction

Plant debris and stones were manually removed from the soil samples. DNA was
extracted from soil by a combination of bead beating and chemical lysis methods
developed by McVeigh et al. (1996) and Krsek and Wellington (1999). TNPE (50 mM
Tris-HCl, 10 mM EDTA, pH 8.0, 100 mM NaCl, 1% (w/w) polyvinylpolypyrolidone)
and 0.5 g glass beads (diameter 0.1 mm) were added to 1 g of soil and bead beaten on a
paint shaker at full speed for 10 minutes. Samples were cooled on ice for 1 hour.
Lysozyme (5 mg/ml) was added and samples were incubated at 37°C for 1 hour and then
incubated with sodium dodecyl sulfate at final concentration 1% at 65°C for 30 minutes.
Samples were centrifuged at 10 minutes at 3,600 x g at room temperature to recover
supernatant that contained the DNA. The supernatant was extracted with a 1:1 volume of
Tris-equilibrated phenol, followed by two extractions with a 1:1 volume of
phenol/chloroform/iso-amyl alcohol (25:24zl). A 1/ 10 volume of 5 M NaCl plus 1
volume of 30% polyethylene glycol were added. Samples were placed on ice for at least
15 minutes and subsequently centrifuged for 20 minutes at 10,000 x g at room
temperature. Supernatant was discarded, and samples were vacuum dried and
resuspended in 50 pl of sterile nuclease free water and stored at -20°C. Gel
electrophoresis was used to verify the DNA extraction process before proceeding with
PCR. DNA (10 pl) was stained in a Ficoll®-based loading dye (15% Ficoll® type 400
(purchased from Amersham Biosciences, Buckinghamshire, England), 0.25%
bromophenol blue, and 0.25% xylene cyanol FF) and loaded into 1% agarose gels made
of IX TAE (1X TAE is 40 mM Tris, 40 mM acetic acid, and 1 mM EDTA) and

electrophoresed. Agarose gels were then stained for at least 10 minutes in an ethidium

32

bromide stock solution (10 mM Tris-HCl, 1 mM EDTA, 1 mg/ml ethidium bromide) and

viewed under UV light.

Classical PCR

Classical PCR was performed as described above in PCR Detection of
Streptomyces spp. and nec1, except 2 pl of bovine serum albumin (100 ng/ pl) was added
to correct for possible interference from contaminating substances (e.g., humic
substances, fulvic acid, and phenolic compounds) in the DNA samples extracted from the

soil) to verify the use of the primers before proceeding with real time PCR.

Real Time PCR

PCR primers to quantify pathogenic Streptomyces spp. populations were derived from
the nec1 gene (Table l-l). The primers used were developed using the Perkin Elmer
Applied Biosystems (Foster City, California, USA) primer design software Primer
Express® version 1.0 under the parameters required for use with the ABI Prizm® 7700
sequence detection system. The primer sequences for the forward and reverse primers
based on nec1 were N1f5’- GCCGCTCGGAGAGTACGA —3’ and Nlr 5’ —
AAGCGCTGGGCATTGTTG —3’ (Table 1-1). Primer and template concentrations for
real time PCR using the SYBR® green PCR master mix (purchased from Perkin Elmer
Applied Biosystems, Foster City, California, USA) were optimized empirically. Initial
primer concentrations of the real time PCR reactions were 300 pM. All PCR reactions
were carried out in MicroAmp® Optical 96-well reaction plates and optical caps
(purchased from Perkin Elmer Applied Biosystems, Foster City, California, USA) using

1X SYBR® green PCR master mix and sterile nuclease free PCR-grade water (purchased

33

from Sigma Chemical Company, Saint Louis, Missouri, USA). pBluescript® (purchased
from Stratagene, La J olla, California, USA) was used as a genetic normalizer and to
correct for possible interference from PCR-inhibiting substances (e.g., humic substances,
fulvic acid, and phenolic compounds) in the DNA samples extracted from the soil in all
of the real time PCR reactions as a linearized plasmid (10 p1 pBluescript® was digested
with 1.5 p1 EcoR V, purchased from Invitrogen Corporation, Carlsbad, California, USA).
Sterile nuclease free water and DNA from Streptomyces scabies were used as negative
and positive controls, respectively. The real time PCR parameters used via the Perkin
Elmer Applied Biosystems Prizm® 7 700 sequence detection system were 50°C for 2
minutes for one cycle; 95°C for 10 minutes for one cycle; and 95°C for 15 seconds and
60°C for 1 minute for 40 cycles. All real time PCR reactions were run in repetitions of 4
reactions per DNA sample and all sets of reactions were repeated. Cycle threshold (Ct)
values were established based on when real time PCR reactions were in transition

between linear and log phases.

11. Assessment of Pathogen Populations in Three Michigan Potato Fields
Soil sampling

Soil was sampled from three Michigan potato production fields in Montcalm county.
The three fields varied in the amount of common scab infection that was observed on
tubers (cultivar Snowden) at the end of the growing season and were classified by the
grower as extremely low infection rate, moderately low infection rate, and severe
infection rate (field not harvested due to severe scab infection). Soil was collected in 20
locations per field in a zigzag pattern at a depth of 15 cm with a hand shovel until

approximately 700 g of soil was obtained from each sample per field location.

34

Soil DNA Extraction

DNA was extracted from soil using a BIO 101 FastPrep® bead mill homogenizer
(purchased from BIO 101, Carlsbad, California, USA) and the corresponding F astDNA®
SPIN kits for soil (purchased from B10 101, Carlsbad, California, USA). DNA was
extracted from 2.5 g of soil per soil sample using the above materials as described by
BIO 101 with the F astPrep® bead mill homogenizer at speed 5.5 for 40 seconds,
followed by an incubation on ice for 10 minutes, repeated 5 times, with a final incubation
on ice for 1 hour. Gel electrophoresis was used to verify the DNA extraction process
before proceeding with PCR. DNA (10 pl) was stained in a Ficoll®-based loading dye
(15% Ficoll® type 400 (purchased from Amersham Biosciences, Buckinghamshire,
England), 0.25% bromophenol blue, and 0.25% xylene cyanol FF) and loaded into 1%
agarose gels made of 1X TAE (1X TAE is 40 mM Tris, 40 mM acetic acid, and 1 mM
EDTA) and electrophoresed. Agarose gels were then stained for at least 10 minutes in an
ethidium bromide stock solution (10 mM Tris-HCl, 1 mM EDTA, 1 mg/ml ethidium

bromide) and viewed under UV light.

Classical PCR
Classical PCR was performed to determine which samples detected nec1 before
proceeding with real time PCR. Classical PCR was performed as described above in

PCR Detection of Streptom yces spp. and nec1.

Real Time PCR
PCR primers to quantify pathogenic Streptomyces spp. populations were derived from

the nec1 gene (Table 1-1). These were the same primers used in the controlled

35

environment experiment in this chapter (Table 1-1). Primer and template concentrations
for real time PCR using the SYBR® green PCR master mix (purchased from Perkin
Elmer Applied Biosystems, Foster City, California, USA) were optimized empirically.
Initial primer concentrations of the real time PCR reactions were 300 pM. All PCR
reactions were carried out in MicroAmp® Optical 96-well reaction plates and optical
caps (purchased from Perkin Elmer Applied Biosystems, Foster City, California, USA)
using 1X SYBR® green PCR master mix and sterile nuclease free PCR-grade water
(purchased from Sigma Chemical Company, Saint Louis, Missouri, USA). Sterile
nuclease free water and DNA fiom Streptomyces scabies were used as negative and
positive controls, respectively. The real time PCR parameters used via the Applied
Biosystems Prizm® 7700 sequence detection system were 50°C for 2 minutes for one
cycle; 95°C for 10 minutes for one cycle; and 95°C for 15 seconds and 60°C for 1 minute
for 40 cycles. All real time PCR reactions were run in repetitions of 4 reactions per DNA
sample and all sets of reactions were repeated. Cycle threshold (Ct) values were
established based on when real time PCR reactions were in transition between linear and

log phases.

Data Analysis

An analysis of variance (AN OVA) was run to test the effects of county and year
for 1) the ratios of Streptomyces species obtained and 2) the percentages of nec1 detected
for the evaluation of PCR-based detection of pathogenic Streptomyces species in soil

populations of Michigan’s major potato production counties.

36

An AN OVA was run to test the effects of soil moisture application on quantity of
presumed pathogenic Streptomyces scabies populations as determined in the assessment
of real time PCR as a method for pathogen quantification in the controlled environment
experiment. A t-test with comparison of least significant difference was used to
determine the differences in quantities between samples.

An AN OVA was run to determine whether there were differences in amount of
scab observed at harvest between three Michigan potato fields in the assessment of real
time PCR as a method for pathogen quantification.

For all statistical analyses, an outcome was deemed statistically significant if the
probability for a Type I Error was 5% or less (alpha = 0.05). The GLM (general linear
model) for AN OVA and LSD (least significant difference) of the means for t-tests were

conducted using SAS® version 8 software (SAS Institute, Inc.; Cary, North Carolina).

37

RESULTS
EVALUATION OF PCR-BASED DETECTION OF PA T HOGENIC ST REPT OMYCES
SPECIES IN SOIL POPULA T IONS OF MICHIGAN ’S MAJOR POTATO PRODUCTION
COUNTIES

In 2000, Streptomyces species were isolated from all of the eleven counties
sampled (Figure 1-2). Because the isolates of the Streptomyces scabies morphology
obtained from soil were screened with PCR primers specific for the genus Streptomyces
until 40 Streptomyces spp. were identified per county, the ratios of Streptomyces spp. per
total isolates screened was highly variable between counties and hence, no trends were
found of the total number of actinomycetes isolated. The PCR protocols indicated that a
range of 26-36% from counties 2, 3, 8, 9, and 10 were Streptomyces spp.; fipm 46-54%
for counties 1, 4, 7, and 11 were Streptomyces spp.; and 57% and 75% were Streptomyces
spp. fi'om counties 5 and 6, respectively (Figure 1-2). In 2000, Streptomyces spp. with
nec1 were detected in each county sampled. Most of the Streptomyces spp. screened with
PCR primers for nec1 made up less than 50% of the streptomycete population. The nec1-
containing Streptomyces spp. from counties 3, 5, and 8 ranged from 23% to 28% of the
total streptomycete isolates analyzed; from 38-48% of the streptomycetes recovered fiom
counties 1, 7, 9, and 10 and streptomycetes isolated from four of the fields were positive
for nec1 at or over 50% and was 70% for county 11 (Figure 1-3).

In 2001, Streptomyces spp. were again isolated at variable ratios to the total
actinomycete isolates recovered. The actinomycete collections were screened until 40
isolates tested positive Streptomyces spp. per county, which again led to no obvious

trends across the counties tested in relation to the percentages of this genus detected. The

actinomycete isolates ranged from 28-34% Streptomyces spp. for counties 1, 3, 5, and 12;

38

from 42-50% streptomycetes for most of the other counties; and greater than 50%
streptomycetes for counties 6 and 8 (Figure 1-4). In 2001, nec1 was detected in isolates
collected from all fields. The nec1 gene was most commonly found in isolates
representing less than 50% of the streptomycetes recovered for most of the counties
screened (Figure 1-5). Isolates from nearly half of the counties sampled tested positive
for nec1 at frequencies between 30-40% for counties 1, 3, 5, 7 and 10; between 48-55%
for counties 4, 6, 11, and 12; and 88% and 75% for counties 8 and 9, respectively, which
was significantly higher than the presence of nec1 in the other counties (Figure 1-5).

In 2002, variable percentages of total streptomycetes (as percentages of
actinomycetes) were screened until 20 isolates tested positive for the genus Streptomyces
per county. Streptomyces spp. were most commonly isolated at or less than 50% of the
time from the actinomycetes recovered (Figure 1-6). The actinomycete isolates ranged
from 34-50% Streptomyces spp. for counties 1, 2, 3, 6, 7, and 8; and 57% and 63% were
identified by PCR as Streptomyces spp for counties 4 and 5 (Figure 1-6). In 2002, nec1
was detected in Streptomyces spp. from all of the counties sampled. Most of the isolates
contained nec1 around or less than 50% of the total screened Streptomyces spp. (Figure
1-7).

In 2003, percentages were variable for the isolates screened until 20 Streptomyces
spp. were obtained per county. Streptomyces spp. were isolated from each of the
counties. Actinomycete isolates were identified by PCR as 28-3 8% Streptomyces spp. for
counties 4, 5, 6, and 7; and 51%, 47%, and 50% Streptomyces spp. from counties 1, 2,
and 3, respectively (Figure 1-8). The nec1 gene was detected in Streptomyces spp. from

each of the counties sampled in 2003. In 2003, nec1 was detected in 30-50% of the

39

Streptomyces spp. isolates obtained from counties 3, 4, 5, and 7; and in 65%, 60%, and
70% of the Streptomyces spp. from counties 1, 2, and 6, respectively (Figure 1-9).
Detection of nec1 by PCR is shown below (Figures 1-10 to 1-21).

An analysis of variance (ANOVA) determined that for the ratios of Streptomyces
species obtained that neither county nor year resulted in a significant effect on differences
of ratios obtained. An ANOVA determined that there was a significant county effect in
relation to Streptomyces species in which nec1 was detected, but that year effect was not

significant.

40

 

80 ~7*—~ v

70 "

60

Streptomycetes (ratio of actinomycetes)

 

 

   

Michigan Counties Surveyed
Figure 1-2. Ratios of actinomycetes obtained from 11 Michigan counties identified as
Streptomyces species by PCR detection in 2000.

41

 

80

70'

6077’ w ~ .....

40

30

20 ,,

 

Streptomyces Isolates with nec1 (in percent)

 

2 3 4 5 6 7 8 9 10 11

Michigan Counties Surveyed

Figure 1—3. Percentages of Streptomyces spp. isolates obtained from 11 Michigan
counties in which nec1 was detected by PCR in 2000.

42

 

Streptomycetes (ratio of actinomycetes)

 

 

Michigan Counties Surveyed

Figure 1—4. Ratios of actinomycetes obtained from 12 Michigan counties identified as
Streptomyces species by PCR detection in 2001.

43

 

 

I

  
 

(O
O

 

Streptomyces Isolates with nec1 (in percent)

Michigan Counties Surveyed

Figure 1—5. Percentages of Streptomyces spp. isolates obtained from 12 Michigan
counties in which nec1 was detected by PCR in 2001.

44

 

Streptomycetes (ratio of actinomycetes)

 

 

Michigan Counties Surveyed

Figure 1-6. Ratios of actinomycetes obtained from 8 Michigan counties identified as
Streptomyces species by PCR detection in 2002.

45

 

 

Streptomyces Isolates with nec1 (in percent)

1 3 4 5 6 7 8

Michigan Counties Surveyed

Figure 1-7. Percentages of Streptomyces spp. isolates obtained from 8 Michigan
counties in which nec1 was detected by PCR in 2002.

46

 

Streptomycetes (ratio of actinomycetes)

 

Michigan Counties Surveyed

Figure 1-8. Ratios of actinomycetes obtained from 7 Michigan counties identified as
Streptomyces species by PCR detection in 2003.

47

 

BOT

70

60

50 "

40

Streptomyces Isolates with nec1 (in percent)

 

 

3 4 5

Michigan Counties Surveyed

Figure 1-9. Percentages of Streptomyces spp. isolates obtained from 7 Michigan
counties in which nec1 was detected by PCR in 2003.

48

— 12,000 bp
— 5,000 bp

2,000 bp

1,650 bp
1,000 bp
850 bp
650 bp

Ill

 

Figure 1-10. Picture of an agarose gel taken under UV light exhibiting seven
of the nec1-containing Streptomyces isolates obtained from county 5 in 2001.
The PCR products from nec1 amplification are 720 bp.

49

ASSESSMENT OF REAL TIME PCR AS A METHOD FOR PA THO GEN
QUANTIFICA TION

Controlled Environment

Quantification experiments of DNA extracted directly from soil from the first trial
of the continuously applied soil moisture in a controlled environment experiment
conducted in Chapter 2 led to significant differences (as determined by t-test) between
the amounts of pathogen DNA detected for the irrigation treatments. Real time PCR
primers derived from nec1 sequence detected differences in the mean quantity of DNA
obtained from the different irrigation regimes. The two drier soil treatments contained
slightly more DNA than the two more moist soil treatments. The detection of nec1-
containing S. scabies averaged 1.5E'5 pg/ml DNA for the least irrigated moisture
treatment (9% volumetric water content) (Figure 1-11). The corresponding mean cycle
threshold value for this soil moisture treatment was 26 cycles (Figure 1-1 1).
Streptomyces scabies with nec1 were detected at an average of 1.0 E'5 pg/ml DNA for the
14% volumetric water content irrigation treatments (Figure 1-11). This irrigation
treatment also had an average cycle threshold value of 26 cycles (Figure 1-11). The
mean quantity of pathogen DNA from samples obtained fiom the 21% volumetric water
content was extremely low (near zero) and averaged 2.9 E'7 pg/ml (Figure 1-11). The
cycle threshold for 21% volumetric water content averaged 29 cycles (Figure 1-11). The
samples from the most irrigated treatment (29% volumetric water content) had an average
cycle threshold value of 33 cycles and contained a mean quantity of DNA near zero of

2.4 E'7 pg/ml of pathogenic S. scabies DNA (Figure 1-1 1).

50

35
i 3 0.0000002

 

//

0 Standards

//

 

 

O Negative control
30 _ A 9% Soil Volumetric H20
.0 9 a V 14% Soil Volumetric H20
32 0000015 9 21 % Soil Volumetric H20
8 25 .' g f, I 29% Soil Volumetric H20
E o
'—
32 o
0 20 ‘
>
0
15 ‘ .
10 r 7
0.0000 0.0001 0.01

Mean Quantity of DNA (pg/ml)

Figure 1-11. Mean quantity of DNA from nec1-containing S. scabies detected by real
time PCR from soil samples collected from a controlled environment experiment.

51

 

Three Michigan Potato Fields

Pathogenic Streptomyces spp. were detected by classical PCR in all three of the
Michigan potato fields tested. There were differences in the twenty samples per field that
were screened for presence of pathogenic Streptomyces spp. Seven out of 20 (35%) of
the samples screened from field one, which had the highest amount of scab infection on
tubers, contained pathogenic Streptomyces spp. DNA (Figure 1-12). Field two, which
had a moderate amount of scab infections at harvest, had 4 of 20 samples (20%) with
pathogenic Streptomyces spp. DNA (Figure 1-12). Only 2 of 20 samples (10%) from the
third field, which had low levels of infection at harvest, contained pathogenic
Streptomyces spp. (Figure 1-12). The differences in nec1 detection were not statistically
significant between the three fields as determined by a one-way AN OVA. Differences in
the quantity of pathogenic Streptomyces spp. DNA as determined by real time PCR were
detected between the three fields. The relative quantities of pathogenic Streptomyces spp.
DNA per sample as determined by cycle thresholds generated by real time PCR were
somewhat consistent between the 7 samples from field one. Six of the seven samples had
average Ct values that ranged from 10.4 to 14.4 cycles (Figure 1-13). One of the samples
from field one had a lower average Ct value of 23.6 cycles (Figure 1-13). Two of the
samples from field two had Ct values that averaged 12.6 and 12.2, respectively (Figure l-
13), which were similar values to the majority of samples from field one. The other two
samples from field two had higher Ct values that averaged 20.1 and 22.2 cycles (Figure
1-13). The samples from the third field, which had the lowest amount of scab infection,
had average Ct values of 17.7 and 12.6 cycles, values that were to those detected in the

other two fields (Figure 1-13).

52

 

 

 

 

s 40%---“ 7 7 777, ,‘
E . a I FIeId1 I
:j I III Field2 I
I .

8 I 1:] Fleld3 I

c 30 . ~ ~ . .
t I I
8 I I
a) I
.2 I a I
9: + I
g 20‘ I
I
I. I I
a I a I
E 10‘ 777777 I
<0 I I I I
U) I I I I
E I I I
,. 7 777 ______ 7777, 7. 777777

Severe Infection Moderate Infection Low Infection
Scab Severity of Field

Figure 1-12. Number of samples in which nec1-containing Streptomyces spp. were
detected by classical PCR in pre-screening before real time PCR analysis. Twenty
samples per field were screened for nec1 by classical PCR to determine which samples
required quantification using real time PCR. The detection of nec1 was not statistically
significant between the fields as determined by a one-way AN OVA.

53

I FieId1
I [I FieIdZ
1:] Field3

I
I I
I
I
I
I
I
I
I

N
01

N
O

I
I
 ‘
I
II

 

 

 

 

 

 

 

 

Cycle Threshold (Relative DNA/sample)
(J1

*I
..... I
0 - .
Severe Infection Moderate Infection Low Infection
Scab Severity of Field

Figure 1-13. Average cycle threshold (Ct) values obtained from the three Michigan
potato fields. The average quantification values (Ct values) were obtained by real
time PCR using primers that were derived from nec1 to detect the relative quantities
of presumably pathogenic Streptomyces species DNA in each of the soil samples
between the three fields.

54

DISCUSSION

Both of the molecular tools discussed in this chapter are helpfiil and are very
important in current plant and animal health diagnostics. The use of PCR and real time
PCR technologies in plant disease diagnostics has been extensively studied, and there are
numerous reports and reviews supporting its use in agriculture (Ward et al, 2005; Schena
et al., 2004; Levin, 2004; Gachon et al., 2004; Holzricher and Milanovich, 2003;
McCartney et al., 2003; Schaad and Frederick, 2002; and Martin et al., 2000). Both
technologies are helping to shape the future of plant disease diagnostics and the type of
assay desired depends on requirements of the information needed and the resources
available. Until recently, diagnostic procedures used for the detection of plant pathogenic
Streptomyces species have been laborious and time consuming, often taking weeks to
obtain results. The recent development of nucleic acid based detection has allowed for a
rapid screening of many plant pathogens in soil and plant material, including the potato
scab pathogens Streptomyces scabies and S. turgidiscabies (Lehtonen et al., 2004).
Furthermore, current recommendations in the manual used by many plant disease
diagnosticians to identify the causal agents of common scab of potato suggest the use of
nec1 for use in PCR assays (Schaad et al., 2001). nec1 is highly correlated with plant
pathogenicity in the genus Streptomyces.

In 2000, Streptomyces spp. were isolated at varying percentages of total
microorganisms screened between the counties. This suggested that either other related
genera with similar morphological characteristics were frequently isolated and comprised

the other percentage of organisms isolated or that Streptomyces spp. were somewhat

55

more difficult to isolate from some soils versus others, particularly for the soil from
counties with lower percentages of isolated streptomycetes (Figure 1-2). Other related
microorganisms with similar morphological characteristics and/or commonly isolated soil
actinomycetes that probably comprised the other percentages of microorganisms isolated
include the following genera: Nocardioidies, Streptoverticillium, Microbiospora,
Micromonospora, Chainia, Streptosporangium and Saccharopolyspora. The detection of
nec1 in 2001 was variable between the counties sampled, suggesting that although it was
present in each of the counties tested, the amount of pathogens relative to Streptomyces
spp. isolated were not consistent. Also, it is possible that for some of the counties in
which high percentages of the Streptomyces isolates contained nec1, such as counties 4
and 11, that the same isolate may have possibly been predominant in that particular soil
sample, could have grown on organic debris in the soil sample, may have been isolated
repeatedly and does not necessarily indicate that the proportion of the scab pathogen in a
sample is actually that high and prevalent in actual soil populations. This is likely since
most Streptomyces species are non-pathogens that exist as saprophytes and because there
are more than 530 species of Streptomyces currently described (Garrity et al., 2004).

In 2001, Streptomyces spp. were isolated from each county, but no specific
correlations were found between the percentages of this genera of bacteria and other
genera with similar morphological characteristics (Figure 1-4). Similar to 2000,
Streptomyces spp. were isolated from soil samples from most of the counties at
approximately 50% of the total microorganisms isolated. Again, this suggests that other
genera of soil microbes have similar morphological characteristics to Streptomyces were

frequently isolated and that diagnostic methods for scab detection should not be based on

56

morphological observations of isolates alone. The percentage of these isolates varied in
their levels of detection of nec1, but less than 50% of the population with nec1 was the
trend, which was consistent with the results of nec1 screening of Streptomyces spp. in
2001 (Figure 1-3 and 1-5). Again, the higher percentages of Streptomyces spp. with nec1
in certain counties suggests that multiple isolations of the same isolate may have occurred
and that some isolates may have grown in the laboratory during the soil drying process
and/or the isolation process.

In 2002, no consistencies were found across counties in relation to the percentage
of Streptomyces spp. isolated in comparison to other groups of microorganisms (Figure l-
6). Again, this illustrates the fact that soil is very heterogeneous and that isolation of
Streptomyces spp. based on morphology is not necessarily a good indicator that the
organism is a streptomycete since there are related Actinobacteria with morphological
characteristics that can not be easily distinguished from Streptomyces. The results
underscore the importance of screening DNA from the organisms by PCR or an
alternative nucleic acid-based detection approach (Figure 1-6). Similar to the results
from the previous two years, in 2002, nec1 detection was highly variable between the
locations, farms, and soil types from the different counties. The percentages of nec1 in
the populations assessed were similar to those found in 2000 and 2001. Because some of
the percentages of Streptomyces spp. with nec1 were somewhat high at 50% and 55% for
counties 5, and 4 and 7, respectively, it is possible that multiple isolations of the same
isolate may have occurred, as was previously mentioned (Figure 1-7). Alternatively,

some growth of microorganisms may have occurred in the laboratory in the soil debris

57

from the time between the samples were allowed to air dry and between subsequent
incubation on media.

The isolation of Streptomyces spp. in 2003 was consistent with the other three
years. Again, no trend was found in relation to the frequencies in which Streptomyces
spp. were isolated. It is likely that Streptomyces spp. populations vary highly between
soil samples and because only one sample was obtained from each field, results may be
skewed. Similar to the previous three years, the detection of nec1 in relation to the
percent of Streptomyces spp. containing the gene was highly variable across the counties.
The percentages of Streptomyces spp. with detection of nec1 were relatively high for
counties 1, 2, and 6, which suggests that, as noted with counties sampled in other years
with high percentages of Streptomyces spp. containing nec1, that growth of certain
microbes may have occurred in the laboratory during sample processing periods or that
multiple isolations of an individual isolate may have occurred.

Real time PCR was a useful tool in determining DNA quantities of pathogenic
Streptomyces spp. and Streptomyces scabies in soil samples in which potatoes were
grown in a controlled environment and actual production fields (Figures 1-11 and 1-13).
Real time PCR detection based on primers derived from nec1 found similar quantities of
DNA in samples across irrigation treatments. The procedure produced consistent and
precise quantifications in all of the S. scabies inoculated samples collected from the
controlled environment experiment. Furthermore, the assay was able to detect
differences between the pathogenic S. scabies populations found in the drier versus the
more moist soil irrigation treatments. The slight differences in pathogenic DNA detected

indicate that addition of soil moisture may have slightly inhibited the growth of S.

58

scabies. Since the pathogen favors drier soils, it is a possibility that growth of S. scabies
was slightly higher in the drier soils. This finding does not exclude, however, the
likelihood that the nature of control of potato common scab via irrigation is solely by
grth reduction of the pathogen since scab infections quickly recur when irrigation
treatments are halted and because biocontrol of scab, as well as scab decline in soils
cropped to potato for many years, are well-documented phenomena.

It is likely that classical PCR may be a better detection and risk assessment tool
that real time PCR for scab quantification and detection. This assessment is based on the
results where real time PCR was used to detect pathogenic Streptomyces spp. populations
in three Michigan fields. Classical PCR of DNA extracted directly from soil indicated
that the three fields had varying percentages of pathogenic Streptomyces spp. present per
the 20 samples tested per field (Figure 1—12). Furthermore, there was a correlation
between the amount of infection that occurred in the field at harvest and the percent at
which pathogenic Streptomyces spp. were detected by using PCR primers for the nec1
gene. As the severity of infection per field increased, the number of samples with nec1
detection increased, showing a positive correlation between scab incidence and risk for a
subsequent growing season for a potato crop or other susceptible host. Also, these
findings have implications for cultural practices, such as rotation crops, cover crops,
tillage, etc. Conventional PCR using primers for nec1 was a good indicator of risk for the
fields as well as the amount of scab infection to confirm the amount of scab infection
observed at harvest. Quantitative real time PCR was able to detect differences in the
amount of pathogenic Streptomyces spp. DNA found in each sample per field; however,

no correlations were found between the amount of DNA from the pathogens per sample

59

and the amount of risk in the field per se. In other words, similar amounts of pathogen
DNA were found between fields 1, 2, and 3, which indicates that risk may not be
different. Also, because the amount of DNA varied in each sample within a county, it is
difficult to know what quantity of pathogenic Streptomyces spp. is “too high” or “risky”
and hence to be at unsuitable levels for the grower to crop a field to potato. In addition,
some samples in a given field had low amounts of DNA and others high, again, making
useful correlations between pathogenic Streptomyces spp. DNA and risk assessment very
difficult, if not impossible. Furthermore, quantitative real time PCR is a time consuming
and very expensive process that requires special equipment with limited availability. The
use of quantitative real time PCR as a diagnostic tool is unlikely to be a favorable plant
disease diagnostic method for growers because of the expense incurred to process a
single sample and because classical PCR, which is a less expensive procedure than real
time PCR and uses machinery that is much more available, is more likely to be an
affordable tool for diagnosticians to use for identification of diseases on plants and in soil
samples obtained by growers. Also, it is not the method of choice because only a small
portion of a sample can be analyzed in efforts to keep the costs down. As a result, the
pathogen may not be detected in a soil sample because such a small amount of the soil
sample is processed. In contrast to this expense, classical PCR is much more affordable
and requires machinery that is much more available, which allows for more extensive
sampling within a field and allows a greater sample size and number of subsamples to be
processed. Classical PCR allows more extensive profiling of plant pathogens in fields or
in plant samples, while quantitative real time PCR gives precise answers to the amount of

pathogen present in a sample. This is potentially very useful for determining

60

pathogenicity of populations of Streptomyces prior to cultivation of potatoes, especially
because soilbome inoculum is the primary source of infection within a field and the
spores are resistant to desiccation. Also, it is important because pathogenic
streptomycetes are found in soils that have not previously been cropped to potato (Loria,
2001 and Loria et al., 1997). Although the importance of seed-bome inoculum must not
be overlooked because it is provides the introduction of pathogenic Streptomyces strains
to new fields where they were previously not present. Furthermore, seed-bome inoculum
is the primary means of dispersal of different species and strains of plant pathogenic

Streptomyces between continents.

61

Chapter II

ASSESSMENT OF CULTIVAR RESISTANCE AND SOIL
MOISTURE APPLICATION AS A MEANS TO MANAGE POTATO
COMMON SCAB

INTRODUCTION

Sanford (1923) pioneered research on the use of irrigation to control potato
common scab. Soil moisture, when applied at or near field capacity, significantly
decreased the severity of scab infection. Subsequently, many studies were conducted to
evaluate irrigation as a way to reduce scab (Adams et al., 1987; Curwen, 1980; Davis, et
al., 1974; Lapwood et al., 1970; Lapwood et al.; 1971; Lapwood and Adams, 1973;
Lapwood, 1973; and Wilson et al., 2001). Irrigation applied during the early stages of
tuberization significantly decreased scab incidence (Lapwood et al., 1970). At high
water potentials, actinomycete populations on the lenticels were low and non-
actinomycete bacterial populations were high, suggesting that irrigation might decrease
the population of pathogenic Streptomyces species in tuber lenticels by increasing
populations of scab-antagonists.

The amount of irrigation that effectively controls scab, the appropriate timing of
irrigation, and the reduction in scab infection vary between research reports. Some have
reported that the incidence of potato scab increased with soil moisture (Starr et al., 1943)
or that precipitation did not reduce scab infection on tubers (Goto, 1985). However, this
may be due to the soil type and cultivar used, since dry soils have been shown to increase
incidence and severity of disease or this could be due to rapid evaporation of

precipitation. Lack of scab reduction by precipitation may be due to the water repellent

62

nature of sand; a phenomenon extensively studied by soil scientists (Cann, 2000; Dekker
et al., 2001; McKissock et al., 2002; Wang et al., 2000; and Yang et al., 1996). The
water repelling is also exacerbated by high temperatures (Dekker et al., 2001 and Yang et
al., 1996). The Cann (2000), McKissock et al. (2002), and Wang et al. (2000) studies
suggest the use of hi gh-ponding irrigation methods and clay spreading to mediate the
hydrophobic sands. Nearly all studies that used irrigation to control scab reported a
decrease in scab severity in soils with high moisture contents.

Irrigation for four weeks after tuber initiation at a 15 mm soil moisture deficit was
found to decrease scab most effectively in one study (Lapwood, 1973). According to
Lewis (1970), five weeks of irrigation at or near field capacity following tuber initiation
was found to substantially reduce scab, while two weeks of irrigation after initiation was
not sufficient to manage scab. Although there is variation in relation to timing of soil
moisture application, irrigation that provides adequate soil moisture at or near field
capacity during tuberization is one of the most important methods of managing this
disease without significantly reducing yield. However, Davis et al. (1974) emphasized
the importance of combining irrigation with other methods to control common scab since
90% available soil moisture during the early stages of tuber development was not
sufficient alone to produce tubers of adequate quality for market specifications.
Although reported results are variable, maintenance of sufficient soil moisture is
particularly important because there are no resistant cultivars completely immune to the
disease and there are very few methods available to manage this disease. The objectives
of this chapter are to 1) evaluate the combined effects of cultivar resistance and irrigation

on scab; and 2) determine effects of soil- wetting and drying cycles on scab infection.

63

MATERIALS AND METHODS

Effects of Cultivar Resistance and Soil Moisture Application on Scab Infection
1. Controlled Environment Trials

Three cultivars that vary in scab susceptibility were used. Atlantic was selected
for evaluation because it is scab-susceptible and is widely used in potato production as a
chip processing cultivar (Webb et al., 1978). Also selected for evaluation were Boulder,
a cultivar with intermediate scab resistance (Douches et al., 2003), and Liberator, a
cultivar with strong resistance to scab (Douches et al., 2001). The latter two cultivars
were developed by the Michigan State University Potato Breeding and Genetics Program.

In a greenhouse, compartmentalized wooden boxes (30.5 cm x 60.9 cm x 91.4
cm) made of wood were constructed. The boxes were lined with plastic to ensure each
soil moisture treatment was contained within the box to avoid leakage and contamination.
Each box was completely filled with sterilized sand. CS 615® water content
reflectometers (Campbell Scientific, Incorporated, Logan, Utah, USA) were calibrated
according to the manufacturer’s guidelines before use and then were placed in a vertical
orientation at 15 cm soil depth. The water content reflectometers, which recorded
volumetric water contents of each of the sandy soil moisture treatments, were connected
to a CR 10X® data logger (Campbell Scientific, Incorporated, Logan, Utah, USA) (Figure

2-1). Soil moisture data were downloaded with a laptop computer every other week.

64

J .-.- scar/1‘21" I
it? I'fi‘hwt‘ g :u_ h-

I

 

Figure 2-1. Compartmentalized boxes lined with plastic sheeting. Each box contains
individual water content reflectometers and irrigation outlets.

Whole potatoes from each cultivar were planted into the compartmentalized boxes
(3 replications per cultivar per box) and were subjected to four soil moisture treatments as
a completely randomized design. The soil moisture applications were made daily with a
Mini-8-G watering relay (Batrow, Incorporated, Short Beach, Connecticut, USA) at the
following volumetric water contents: 9% (above permanent plant wilting point), 14%
(less than field capacity), 21% (near field capacity), and 29% (near saturation). These
volumetric water content values were recorded and determined with CS 615‘19 water
content reflectometers.

The sand around the base of each plant was evenly inoculated 3 days after
planting with a spore suspension from Streptomyces scabies strain DP (scraped from
cultures grown on PDA at 30°C for 14 days in the dark) at 2.3 x 109 spores per plant.

Non-inoculated boxes were used as the negative controls.

65

The moisture applications to the sand began 14 days after planting (when greater
than 95% of the plants had emerged) and were applied through the duration of the
experiment. The sand was fertilized, based on recommendations of the soil tests, with
168 kg/ha nitrogen, 117 kg/ha phosphorus, and 308 kg/ha potassium 30 days after
planting. Inflorescences were clipped from the peduncles of the plants as they appeared
to promote maximum tuber development. Both independent trials of this experiment
were implemented in the same boxes (to maintain separation of inoculation and control
treatments) and were carried out for at least 6 weeks of irrigation treatments because
early tuber development (the beginning 68 weeks after planting) is the most critical

period of time in which potatoes are susceptible to common scab.

Disease Assessment

Tubers were harvested manually and washed carefully to remove soil and debris
so that scab incidence, severity, and lesion type could be assessed. Scab infections were
determined by a key developed by James (1971) (Figure 2-2). This scale determines
coverage of scab on the surface of the potato as a percentage over the entire tuber surface

area.

66

Figure 2-2. Picture of a modified
disease assessment key based on the
one developed by James (1971).
The numbers represent the percent
coverage of scab lesions on the

evaluation in this dissertation.

 

II. 2002 Field Trial

Potato tubers free of scab (Grade A) were manually cut into seed pieces and
allowed to heal 4 days before planting. The tubers (cultivars Atlantic, Boulder, and
Liberator) were planted by hand at the Michigan State University Plant Pathology
Research Station, East Lansing, Michigan, USA in a Riddles-Hillsdale sandy loam on 21
May 2002. Plot dimensions were one-row by 37 m and were replicated 3 times. The
plots were covered with black plastic to exclude additional rainfall. A split block design
was used. Drip-tape irrigation was placed onto plots and CS 615® water content
reflectometers were buried vertically under at least 15 cm of soil and were completely
covered with the black plastic sheeting at planting. All rows were irrigated until
emergence and were inoculated at 0.5 l per 37 m row with a suspension of Streptomyces
scabies strain DP at 106 CFU/ml on 30 May 2002 and inoculation was repeated on 5 June
2002. Two inoculations were applied because the field had no history of scab and had
not previously been cropped to potatoes. Non-inoculated plots were retained as negative
controls. Irrigation treatments began 14 days after planting and irrigation schedules were

optimized to closely correspond to the greenhouse experiment irrigation treatments:

67

tuber surface. This key was used
for disease assessment in all
experiments that required scab

volumetric water contents of 10% (slightly above permanent plant wilting point), 16%
(less than field capacity), 21% (near field capacity), and 27% (near saturation). Soil
volumetric water content was measured as described above for controlled environment
experiments. Fertilizer (formulated according to results of soil tests) was drilled into
plots before planting. Additional nitrogen (final N 25 kg/ha) was applied to the growing
crop through the irrigation 42 days after planting. Weeds were controlled by manual
weeding, billing, and with herbicides listed in Table 2-1.

TABLE 2-1. Weed and insect management program used in the 2002 field trial.
Application Date

 

Pesticide Registrant Application Rate

 

(days after planting)

Herbicide

Dual 8E Syngenta Crop Protection, Inc.8 2.3 I/ha 10 DAP

Basagran BASF Wyandotte Corporationb 2.3 I/ha 20 and 40 DAP

Poast BASF Wyandotte Corporationb 1.8 l/ha 51 DAP
Insecticide

Admire 2F Bayer Crop Science, L.P.° 1.5 l/ha at planting

Sevin 80$ Bayer Crop Science. L.P.c 1.4 kg/ha 27 and 51 DAP

Thiodan 3EC Southern Agricultural Insecticidesd 2.7 l/ha 51 and 76 DAP

Pounce 3.2EC Bayer Crop Science, L.P.° 0.6 I/ha 40 DAP

a'Greensboro, North Carolina, USA
bFlorham Park, New Jersey, USA
°Research Triangle Park, North Carolina, USA
dPalmetto, Florida, USA

Insects were controlled as described in Table 2-1. Bravo® (Syngenta Crop
Protection, Incorporated, Greensboro, North Carolina, USA) at 1.8 l/ha was applied for
management of fungal diseases weekly from 4 June to 7 September with an ATV rear-
mounted R&D spray boom delivering 2.7 l/ha and using three XR11003VS nozzles per

row. Vines were killed with diquat desiccant Regione® 2EC (Syngenta Crop Protection,

Greensboro, North Carolina, USA) at 46 l/ha on 26 August. Plots were mechanically

68

harvested on 10 September. Tubers were washed to remove soil and debris and

individual treatments were evaluated for scab incidence and severity (Figure 2-2).

Effects of Drying of Soil During Early Tuber Development on Scab Infection
1. Controlled Environment Trials

Atlantic was selected for evaluation because of its susceptibility to common scab.
Whole potato tubers (Grade A) were planted in a greenhouse into the compartmentalized
boxes used in the previous controlled environment trials as described above in
replications of 3 tubers/box. The plots were replicated twice. Soil moisture data were
collected as described above. The plants were subjected to four soil moisture treatments
as a completely randomized design. The soil moisture applications were made daily with
a Mini-8-G watering relay (Batrow, Incorporated, Short Beach, Connecticut, USA) at the
following four volumetric water contents: continuously applied 9% (above permanent
plant wilting point) as an irrigation positive control, two reversing schedules of weekly
alternation of 14% (less than field capacity) as a drier soil condition treatment with a
weekly alternation of 21% (near field capacity) as a moist soil condition treatment, and
continuously applied 29% (near saturation) as an irrigation negative control. These
volumetric water content values were recorded and determined by the CS 615® water
content reflectometers. The boxes that were previously infested with Streptomyces
scabies strain DP (as described above) were implemented as the inoculation treatments.
The non-inoculated boxes were used as negative controls. The soil moisture applications

began 14 days afier planting (when greater than 95% of the plants had emerged) and were

69

applied through the duration of the experiment. The soil was fertilized, based on the
recommendations of the soil tests, with 168 kg/ha nitrogen, 117 kg/ha phosphorus, and
308 kg/ha potassium 30 days after planting. Inflorescences were clipped from the
peduncles of the plants as they appeared to promote maximum tuber development. The
second execution of this experiment was implemented in the same boxes (to maintain
separation of inoculation and control treatments) and was carried out for 6 weeks of
irrigation treatments. Early tuber development occurs during this time and this is when
potatoes are most susceptible to common scab. Tubers were harvested manually and
washed carefully to remove soil and debris so that scab incidence, severity, and lesion
type could be assessed. Scab infections were determined based on the method of James
(1971) (Figure 2—2).
11. 2003 Field Trial

Potato tubers free of scab were manually cut and allowed to heal 4 days before
planting. Potato tubers (cultivar Atlantic) were planted by hand at the Michigan State
University Plant Pathology Research Station, East Lansing, Michigan, USA in a Riddles-
Hillsdale sandy loam on 27 May, 2003. Plot dimension were one-row by 37 m and were
replicated 6 times and covered in black plastic to exclude additional rainfall. A split
block design was used. Drip-tape irrigation was placed onto plots and CS 615® water
content reflectometers were buried vertically under at least 15 cm of soil and were
completely covered with the black plastic sheeting at planting. All rows were irrigated
until emergence. On 28 May, 2003 and 1 July, 2003, the rows were inoculated with a
suspension of Streptomyces scabies isolate DP (106 CFU/ml) at a rate of 0.5 1 of

inoculum per 37 m row. Two soil inoculations were applied because the field had only

70

previously been cropped to potatoes once and the potatoes had relatively low infection
rates. Non-inoculated plots were retained as the negative control. Irrigation treatments
began 14 days afier planting and irrigation schedules were optimized to closely
correspond to the greenhouse experiment irrigation treatments: volumetric water contents
of continuously applied 10% (slightly above permanent plant wilting point) as a positive
irrigation control, two alternating schedules of weekly alternation of 14% (less than field
capacity) as a drier soil condition treatment with a weekly alternation of 21% (near field
capacity) as a moist soil condition treatment, and continuously applied 26% (near
saturation) as a negative irrigation control. Soil volumetric water content was measured
as described above. Fertilizer (formulated according to results of soil tests) was drilled
into plots before planting. Additional nitrogen (urea, final N 25 kg/ha) was applied to the
growing crop through the irrigation 39 days after planting. Weeds were controlled by
manual weeding, hilling, and with herbicides listed in Table 2-2. Insects were controlled
as described in Table 2-2. For late blight control, Bravo® (Syngenta Crop Protection,
Incorporated, Greensboro, North Carolina, USA) at 1.8 1/ha was applied weekly from 16
June 2003 to 18 August 2003 with an ATV rear-mounted R&D spray boom delivering
2.7 1/ha and using three XR11003VS nozzles per row. Vines were killed with diquat
desiccant Reglone® 2EC (Syngenta Crop Protection, Greensboro, North Carolina, USA)
at 46 1/ha on 25 August. Plots were mechanically harvested on 10 September. Potatoes
were carefully washed to remove soil and debris for evaluation of the effects of the
treatments on scab incidence and severity using the key by James (1971) (Figure 2-2).
To evaluate the potential effects of irrigation on yield, potatoes from each harvested plot

were placed onto a Tew Fruit and Vegetable processing machine with sizers (Tew

71

Manufacturing Corporation, Penfield, New York, USA) and weighed. US #1 potatoes
were weighed separately as grade A and oversize, and all others smaller than US#1 were

weighed and classified grade B.

TABLE 2-2. Weed and insect management program used in the 2003 field trial.
Application Date

 

Pesticide Registrant Application Rate

 

(days after planting)

Herbicide

Dual 8E Syngenta Crop Protection, Inc.8 2.3 I/ha 10 DAP

Basagran BASF Wyandotte Corporation” 2.3 I/ha 20 and 40 DAP

Poast BASF Wyandotte Corporationb 1.8 I/ha 52 DAP
Insecticide

Admire 2F Bayer Crop Science, L.P.c 1.5 I/ha at planting

Sevin 80$ Bayer Crop Science, L.P.c 1.4 kg/ha 29 and 45 DAP

Thiodan 3EC Southern Agricultural Insecticidesd 2.7 I/ha 52 and 72 DAP

Pounce 3.2EC Bayer Crop Science, L.P.° 0.6 I/ha 40 DAP

8Greensboro, North Carolina, USA

bFlorham Park, New Jersey, USA

°Research Triangle Park, North Carolina, USA
“Palmetto. Florida, USA

Data Analysis

A two-way analysis of variance (ANOVA) was run to. test the effects of trial,
treatment, and the interaction of trial and treatment for the evaluation of effects of
cultivar resistance and soil moisture application on scab infection in the controlled
environment trials. An AN OVA was run to test the treatment effects on the average scab
severity observed in the field trial. A t-test with comparison of least significant
difference was conducted to determine the differences in scab between treatments.

An ANOVA was run to determine whether there were differences in amount of

scab observed in the controlled environment trials conducted to evaluate the effects of

72

drying of soil during early tuber development on scab infection. A t-test with comparison
of least significant difference was conducted to determine the differences in scab between
treatments for the controlled environment trials and the field trial. Yield data from the
field trial were analyzed with a t-test with comparison of least significant difference to
determine differences between treatments within each yield category.

For all statistical analyses, an outcome was deemed statistically significant if the
probability for a Type I Error was 5% or less (alpha = 0.05). The GLM (general linear
model) for AN OVA and two-way AN OVA and LSD (least significant difference) of the
means for t-tests were conducted using SAS® version 8 software (SAS Institute, Inc.;

Cary, North Carolina).

73

RESULTS

Effects of Cultivar Resistance and Soil Moisture Application on Scab Infection
Controlled Environment Trials

In trial one in the controlled environment, the cultivar Atlantic produced tubers
with an average scab severity of 6-10% surface coverage when the soil moisture was
maintained at 9% volumetric water content (Figure 2-3). When the volumetric water
content was increased by 5%, a slight reduction in scab severity occurred; however, soil
moisture application at 21% volumetric water content greatly reduced the scab severity to
less than an average of 0-5% (Figure 2-3). The infections were eliminated with the most
wet soil application treatment at 29% volumetric water content (Figure 2-3). The second
trial in the controlled environment with Atlantic produced similar results. The scab
severity increased to nearly an average of 11-25% scab coverage when soil moisture was
maintained at the dry 9% volumetric water content (Figure 2-3). The amount of
infections was significantly reduced with the 5% increase in soil volumetric water content
(Figure 2-3). Soil moisture applied at 21% volumetric water content, like trial one,
restored tubers to the marketable table stock quality with a scab severity that averaged
less than 0-5% surface cover. Similar to trial one, infections did not occur with
application of soil moisture at 29% volumetric water content.

The cultivar with an intermediate level of scab resistance, Boulder, had very low
amounts of infection in trial one in the controlled environment (all average scab severity
values were low enough for table grade tubers). When soil moisture was applied at 9%

volumetric water content, the average scab severity averaged less than 0-5% (Figure 2-4).

74

When soil moisture was increased by 5%, the infections were nearly eliminated (Figure
2-4). No infections occurred with 21 and 29% volumetric water content (Figure 2-4) in
either trial. In trial two, soil moisture maintained at 9% volumetric water content
produced tubers with an average scab severity of slightly greater than 0-5% (Figure 2-4).
Average scab severity decreased with the 14% soil moisture application to levels
acceptable for marketable table stock (Figure 2-4). Trial one and trial two in the
controlled environment with the resistant cultivar, Liberator, produced tubers with no
scab infections at all soil moisture applications (Figure 2-5). All controls were free of
scab infection. A two-way AN OVA determined trial, treatment, and the interaction

between trial and treatment to be significant at the alpha = 0.05 level.

 

Trial 1 Trial 2
11-25 I
I Inoculated ’ 9123* I Inoculated
0184* Control D Control

 

 

 

 

Percent Scab Cover

 

   

9 14 21 29 9 14 21 29

Volumetric Water Content (%)

Figure 2—3. Effects of four soil moisture application regimes and a scab-susceptible
cultivar, Atlantic, on average scab severity of harvested tubers in two trials conducted in a
controlled environment. Asterisk denotes a statistically significant difference as
determined by an ANOVA at alpha=0.05.

75

Trial 1 Trial 2

 

11-25
I Inoculated I Inoculated

El Control E] Control

 

 

 

 

 

9’
_a
O

0.114

Percent Scab Cover
0
an

   

Figure 2-4. Effects of four soil moisture application regimes and an intermediately
scab-resistant cultivar, Boulder, on average scab severity of harvested tubers in two
independent trials conducted in a controlled environment.

 

Trial 1 Trial 2

11-25
I Inoculated I Inoculated
I] Control [I Control

 

 

 

 

 

Percent Scab Cover

 

 

Volumetric Water Content (%)

Figure 2-5. Effects of four soil moisture application regimes and a scab-resistant
cultivar, Liberator, on average scab severity of harvested tubers
in two independent trials conducted in a controlled environment.

76

2002 Field Trial

The results from the field trial showed similar trends to the results obtained from
the controlled environment trials. Atlantic, the scab-susceptible cultivar, produced tubers
with an average scab severity of 15% when soil moisture was maintained at 10%
volumetric water content (Figure 2-6). The average scab severity was significantly
reduced to approximately 9% when the soil moisture was increased to 16% volumetric
water content (Figure 2-6). Maintaining soil moisture at 21% and 27% further decreased
the scab severity to 6 and 5.5% respectively; however, the reductions were not sufficient
for the tubers to be considered market quality for tablestock (Figure 2-6). Boulder, the
intermediately scab-resistant cultivar, had very low levels of scab infection at all soil
moisture treatments and tubers were of market quality for table stock at each treatment.
The average scab severity was 4% when soil moisture was maintained at 10% volumetric
soil water content (Figure 2-6). An increase in soil moisture application to 16% soil
water content decreased the average scab severity to 2% (Figure 2-6). At 21 and 27%
volumetric soil water contents, scab infections were nearly eliminated, at 1 and less than
1%, respectively (Figure 2-6). Liberator, the scab-resistant cultivar, like the
intermediately scab-resistant cultivar, had very low levels of scab infection at all soil
moisture treatments. At 10% volumetric soil water content, tubers had an average scab
severity of 1% (Figure 2-6). At 16% volumetric water content, the average scab severity
slightly decreased; however, this difference was insignificant (Figure 2-6). The greater
soil moisture applications of 21 and 27% volumetric water contents produced tubers that

were statistically identical to those from the two lower soil moisture applications (Figure

77

2-6). The non-inoculated controls for all cultivars tested were not infected with scab

(Figure 2-6).

 

Average Scab Severity (%)

 

 

Volumetric Soil Water Content (%)

Figure 2-6. Evaluation of the effects of four soil moisture application regimes and three
cultivars with varying levels of resistance to common scab on average scab severity of
harvested tubers in a field trial.

78

Effects of Drying of Soil During Early Tuber Development on Scab Infection
Controlled Environment Trials

There was no significant difference between the two trials conducted in the
controlled environment according to an AN OVA conducted at alpha = 0.05; therefore,
the results from the trials were combined. The scab-susceptible cultivar, Atlantic,
produced tubers with an average scab severity of 12.5% for the two trials when the soil
moisture was 9% volumetric water content (Figure 2-7). When soil moisture application
was applied weekly at 14% volumetric water content, alternating with a weekly 21%
volumetric water content regime, the average scab severity was significantly reduced to
6.1% (Figure 2-7). When soil moisture was applied at the reverse of these two regimes
(21% alternating 14% volumetric water content), the average scab severity was 8.3%,
slightly higher than the previous irrigation regime (Figure 2-7). Soil moisture application
at 29% volumetric water content reduced the average scab severity to less than 1%

(Figure 2-7). All controls were scab-free.

79

I7 Inoculated 7

Average Scab Severity (%)

 

   

I] Control ,. I

I

I

I

I

I

' I

I

" I

I

I

_______ I

I

"""""" I

........ .l

......... I

I

""""" I

d d d I

I In- I_ ID
14 Alternating 21 21 Alternating 14 29

Weekly Volumetric Soil Water Content (%)

Figure 2-7. Evaluation of the effects of soil wetting and drying cycles on average scab
severity of harvested tubers from cultivar Atlantic conducted in two controlled environment
trials. Due to no significant trial effect according to an ANOVA at alpha=0.05, results of
the two trials were combined. Two of the soil moisture regimes were applied continuously
at 9% and 29% volumetric water contents. The other two regimes were applied weekly and
alternated between 14% and 21% volumetric water contents on a weekly basis.

80

2003 Field Trial

The average scab severity of Atlantic tubers irrigated at 10% volumetric soil
water content was much higher than the two previous trials that were conducted in the
controlled environment, at 31.2% scab cover (Figure 2-8). When one of the
wetting/drying the soil moisture regimes was applied at 14% weekly alternating with
21% weekly volumetric water content, the average scab severity was significantly
reduced to 25.9% when compared to the driest soil (Figure 2-8). The 21% weekly
volumetric soil water application regime alternating with 14%weekly volumetric soil
water content produced tubers of similar infection rates (and statistically identical) to the
inverse watering regime, with an average scab severity of 22.6% (Figure 2-8) surface
coverage. The average scab severity was reduced to less than 3% when the soil moisture
was maintained at 26% volumetric water content (Figure 2-8). The non-inoculated
controls at each moisture regime had 2.5% or less average scab infections due to some
possible plot overlapping from plots that were inoculated with Streptomyces scabies in
the previous year’s trial (Figure 2-8).

There was no significant difference among treatments for the total yield obtained
(ranged from 10.2-12.8 kg/ 10 plants) (Table 2-3). Marketable yields (grade A plus
oversize tubers) were similar across all treatments: 9.9-12.3 kg/ 10 plants (Table 2-3).
The weight of tubers in the oversize class (greater than 500 g) were statistically the
greatest with the alternating 21/14% (moist-dry soil) volumetric water content regime at
3.1-3.4 kg/ 10 plants (Table 2-3). All other oversize yields were similar to each other,
except the alternating 14/21% (dry-moist soil), which produced only 1.7-2.0 kg/ 10 plants

of oversize tubers, a statistically significant less amount (Table 2-3). Grade A yields

81

were significantly higher, 9.4-9.6 kg/ 10 plants, for plants grown under the moist soil and
for the control of the alternating dry/moist soil (Table 2-3). Grade A yield was
significantly lowest for plants grown under the driest of the irrigation regimes (Table 2-
3). Grade B yields were similar across most of the treatments. The highest Grade B
yields were obtained from plants that were inoculated and grown under the alternating
21/14% (moist-dry soil) volumetric water content regime at 1.5 kg/ 10 plants (Table 2-3).
The lowest Grade B yields were in the non-inoculated plants under the alternating

21/14% (moist-dry soil) volumetric water content regime at 0.2 kg/ 10 plants (Table 2-3).

82

 

    

‘ ;A W
I Inoculated

I

D, Control I

A I

o\° I

3‘ I

'E b I

g . I

a) I I

U) ‘ I

D I

m I

° I

(I) I

a’ I

a) ,

1‘3 I
9

< .............. I

c ______ C a I

14 Alternating 21 21 Alternating 14 26

Weekly Volumetric Soil Water Content (%)

Figure 2-8. Evaluation of the effects of soil wetting and drying cycles on average scab
severity of harvested tubers from cultivar Atlantic in a field trial in 2003.

83

TABLE 2-3. Effects of irrigation and inoculation on mean oversize, grade A, grade B,

total, and marketable yields of Atlantic tubers.

 

Average Yield per Category (in kgl10 plants)

 

Treatment Oversize S.E. Grade A S.E. Grade 8 SE. Total S.E. Marketable S.E.
Dry Soil
Inoculated 2.9 abc 0.38 7.1 b 0.47 0.3 ab 0.08 10.4 a 0.82 10.0 a 0.81
Control 2.9 abc 0.48 7.0 b 0.92 0.3 ab 0.07 10.2 a 1.07 9.9 a 1.03
Alternating
Moist/Dry Soil
Inoculated 3.4 a 0.53 8.9 ab 0.85 0.5 a 0.17 12.8 a 0.80 12.3 a 0.74
Control 3.1 ab 0.54 8.8 ab 0.64 0.2 b 0.05 12.1 a 0.75 11.9 a 0.76
Alternating
Dry/Moist Soil
Inoculated 2.0 be 0.54 8.8 ab 0.75 0.3 ab 0.11 11.0 a 0.77 10.8 a 0.82
Control 1.7 c 0.42 9.6 a 0.42 0.3 ab 0.04 11.7 a 0.25 11.4 a 0.25
Moist Soil
Inoculated 2.3 abc 0.19 9.5 a 0.62 0.3 ab 0.07 12.1 a 0.75 11.8 a 0.70
Control 2.3 abc 0.59 9.4 a 1.17 0.3 ab 0.09 12.1 a 1.56 11.7 a 1.56

 

S.E. standard error of the mean

Means with the same letter are not significantly different based on t-test conducted within yield
category at a=0.05.

84

DISCUSSION

There is an extensive literature that spans nearly 80 years on the use of irrigation
for effective management of potato common scab (Sanford, 1923; Wellings and Rosser,
1969; Lapwood, 1966; Lapwood and Hering, 1968; Lapwood and Hering, 1970;
Lapwood et al., 1970; Lapwood et al., 1971; Lapwood et al., 1973; Lapwood and Adams,
1973; Lewis, 1970; Davis et al., 1974; Davis et al., 1976; Curwen, 1978; Curwen, 1980;
Adams et al., 1987; Wilson et al., 2001). Irrigation has also been used to manage similar
diseases, namely radish scab, carrot scab, and Streptomyces soil rot, which are caused by
related pathogenic Streptomyces species, (Levick et al., 1981; Levick etal., 1985;
Schoneveld, 1993; Ristaino and Averre, 1992; and Ristaino, 1993). The effects of
irrigation on plant disease were thoroughly reviewed by Rotem and Palti (1969).

Sanford (1923) originally showed that increasing soil moisture consistently
decreased potato common scab. The results in this research demonstrated that when soil
moisture was maintained at 14%, scab infections were severe on tubers (Figure 2-3,
Figure 2-6, Figure 2-7, and Figure 2-8). However, when soil moisture was increased to
22%, scab infections could be greatly reduced. When soil moisture application was
further increased to 29% and 34%, infections were eliminated or very minimal and in
both cases were not severe enough to reduce marketability. The results from the Sanford
study (1923) are consistent with results from this study, in which irrigation regimes
greater than the 9% soil moisture, incrementally decreased the average scab severity of a
susceptible cultivar. Like the Sanford (1923) study, which implemented 14%, 22%, 29%,

and 34% soil moisture regimes, this dissertation reports similar scab severity values at

85

relatively equivalent irrigation schedules of 9%, 14%, 21%, and 29% (Figure 2-3).
Similar to the Sanford report (1923), this dissertation found that 29% soil moisture was
sufficient to nearly eliminate scab infection on cultivars with susceptibility to common
scab (Figure 2-3 and Figure 2-4). Potato growers are urged to irrigate when daily soil
water approximates 65 to 70 percent available soil water (King and Stark, 1997). The
amount required of irrigation applied should be at a soil water content to field capacity or
less if the grower implements light, frequent irrigation (King and Stark, 1997).

Irrigation applied during the early stages of tuberization was shown to speed the
swelling of the tubers and significantly decreased the incidence of scab infections
(Lapwood et al., 1970 and Lapwood et al., 1973). The results of the Lapwood et al.
(1970 and 1973) studies are also consistent with this study in that increased soil moisture
significantly reduced scab severity of scab-susceptible cultivars (Figure 2-3 and Figure 2-
4). In the Lapwood et al. (1970 and 1973) studies, the scab infections on the susceptible
cultivars, Majestic, King Edward, and Record were reduced to less than 1—3% surface
area infections under the highest soil moisture regime. The reduction was significant
compared to the soils that were maintained as dry (non-irri gated) where the mean scab
surface area values for these cultivars ranged 30% to 9% infection. These results were
very similar to the findings in this study, in which scab infections were quite severe on
the most susceptible cultivar, Atlantic, and ranged from 6-10% and 11-25% in controlled
environment trials (Figure 2-3) and about 15% in the field trial (Figure 2-6).

The results of irrigation on scab infections of an intermediately susceptible
cultivar, Boulder, in this study, were similar to the results with the cultivars Record and

King Edward in the Lapwood et al. (1970 and 1973) reports where moist soils reduced

86

scab infection to less than 1% of the surface area. Lapwood et al. (1970 and 1973) found
that scab infections were not significantly reduced by irrigation when applied to a scab-
resistant cultivar, Pentland Crown, because scab infections were less than 1% (nearly 0%)
for all irrigation regimes except the non-irrigated control, which had 1.3% scab. Their
findings are similar to this study where maintaining high soil moisture volumes applied to
the resistant cultivar, Liberator, did not significantly reduce infection. Scab infections
were not detected on Liberator in the controlled environment trials (Figure 2-5) and were
less than 2% in the field experiment, regardless of soil moisture application (Figure 2-6).
The results in this study are nearly identical to Lapwood et al. (1970 and 1973). The
inference from this study and the Lapwood et al. (1970 and 1973) studies is that frequent
irrigation at or near field capacity during tuberization are required to manage common
scab for a susceptible potato crop, but such intensive irrigation is not necessary to
manage potato common scab in resistant cultivars. This has important implications for
the use of soil moisture and the development of scab resistance in breeding programs, as
well as leads to environmentally friendly and sustainable ecological benefits because
reduced water usage leads to a reduced probability of nitrogen leaching from soils that
occurs during some irrigation events. Issues such as these are critical in current
agriculture. Water usage is becoming limited (Rosegrant et al., 2002) and is of a growing
major concern and environmental quality concerns arise fiom agricultural fertilizer and
pesticide usage combined with irrigation and the resulting effects of leaching toxic
substances into ground water (Francaviglia et al., 2000; Close et al, 2003; Stewart and
League, 2003; Tiktak et al., 2004; Lee and Jose, 2005; Zhang et al., 2005; and Vazquez

et al., 2005).

87

Irrigation for four to six weeks after tuber initiation at a 15 mm soil moisture
deficit was found to decrease scab most effectively in one study (Lapwood, et al., 1973).
According to another report, five weeks of irrigation following tuber initiation was found
to substantially reduce scab, while two weeks of irrigation after initiation was not
sufficient to provide management of scab (Lewis, 1970). Although there is variation in
relation to timing of irrigation, which is most likely due to environmental and cultivar
effects, irrigation that provides adequate soil moisture at or near field capacity during
tuberization is one of the most important crop management methods of controlling this
disease without significantly reducing yield. Studies by Wellings and Rosser (1969) and
Lapwood and Hering (1970) conclude that the third week afier tuber initiation was the
week that, if plants were non-irrigated, led to the development of the most severe scab
infections compared with any other week since this was the critical time period for
irrigation. This study supports the conclusions of Wellings and Rosser (1969) and
Lapwood and Hering (1970): when soils were maintained with an alternating dry/wet
cycle such that the third week the soil was drier, the average scab severity at the end of
the field trial found tubers grown under this regime to be the most infected by scab
(Figure 2-9). The effects of soil wetting and drying when studied in the field neither
refute nor support the critical nature of the third week in development of scab infections.

It is apparent that maintaining sufficient soil moisture can significantly reduce
scab infection on susceptible cultivars (Figure 2-3, Figure 2—4, Figure 2-6, Figure 2-7,
and Figure 2-8; Lapwood et al., 1970; and Lapwood et al., 1973). Even if soil moisture
is applied on a weekly basis, but not maintained through the duration of early tuber

development, scab infections can still be severe (Figure 2-7 and Figure 2-8). The results

88

of this study emphasize the importance of continuous maintenance of soil moisture versus
allowing soils to dry during early tuberization. The effects of soil wetting and drying on
scab development in this study were very similar to results in other studies where soil
moisture was not maintained continually (Lapwood and Hering, 1968; and Lapwood and
Adams, 1973). Not only does the tuber quality in relation to reduced scab infection
benefit from maintaining sufficient soil moisture during the early stages of tuber
development, but also yield values are enhanced. In this study and others (Lapwood et
al., 1970; Lapwood et al., 1971; and Lapwood etal., 1973) yields significantly increased
when soil moisture was maintained at or near field capacity compared to the drier soils
with no negative effects on tuber size. In this study grade A yields were significantly
greater when soil moisture was maintained at field capacity (Table 2-3).

The mechanism(s) involved in common scab management via irrigation have not
been well studied and consequently are poorly understood. The effects of irrigation on
scab infection are variable and highly dependent on the type of soil, cultivar planted, soil
temperature, microbial populations, and other environmental factors. The stomata and
immature lenticels of potato tubers are the infection courts of Streptomyces scabies
(Fellows, 1926). The internodes of the potato tuber rapidly expand during early tuber
development. Each intemode is susceptible to scab for 10 to 15 days until the lenticels
are fully suberized (Lapwood and Hering, 1970). Early infections on tubers of
susceptible cultivars may lead to scab infections severe enough that the harvested crop is
unsaleable (this study; Lapwood and Hering, 1970; W. Kirk, personal communication).

Lewis (1970) showed that when soil conditions were moist, there were high non-

actinomycete bacteria to actinomycete populations and conversely dry soil conditions

89

favored small ratios between non-actinomycete bacteria to actinomycete populations. He
hypothesized that antagonistic bacteria may be responsible for the reduction of scab
infection by irrigation because lenticels had few actinomycetes at high water potentials.
Also, after irrigation events Lewis (1970) commonly isolated Pseudomonas spp., which
rapidly overgrew Streptomyces scabies in vitro. Adams and Lapwood (1978) also rarely
found actinomycetes on tubers surfaces that were sampled from wet soils and found that
in dry soils actinomycete hyphae colonized lenticels. Sanford (1926) suggested the
possibility that there could be antibiotic relations between the soil microflora and that the
physical or chemical properties of the soil may effect scab development. Sanford (1926)
also demonstrated that certain bacteria inhibited growth of S. scabies by producing acidic
compounds and found one that inhibited the pathogen by some other method than high
acidity. It is possible that the effects of irrigation on common scab of potato are also due
to decreased soil aeration since S. scabies is a strong aerobe. However, there is little
research available to support this hypothesis.

Whether microbial antagonism that leads to competitive exclusion or antibiosis,
transient anaerobic conditions, or some other suppressive factor is responsible for
inhibiting scab during irrigation is yet to be determined. Nonetheless, irrigation is used
by many growers to manage the disease. However, a study by Davis et al. (1974)
highlights the importance of combining irrigation with other methods to control common
scab. They irrigated soils to greater than 90 % available soil moisture during the early
stages of tuber development and this alone was not sufficient to produce tubers of
adequate quality for market standards. Their study emphasizes the importance of

integrating other management methods and underscores the importance of the roles that

90

other factors play in irrigation, such as differences in managing scab obtained with
irrigation vary with soil type, cultivar planted, and microbial populations. More studies
that combine soil moisture management and cultivar resistance are needed. Although the
importance of incorporating careful soil moisture management when a susceptible
cultivar is cropped cannot be undermined, the usage of water for irrigation at high levels
can be negated if a resistant cultivar is selected for cropping. This has sizeable ecological
implications and will be more important as water shortages increase. Maintenance of
sufficient soil moisture with susceptible cultivars should not be overlooked and is
particularly important because there are no resistant cultivars with complete immunity to
the disease and there are no effective chemicals that have been developed to control this
disease. More research must be conducted to further understand the nature of disease
control that is achieved by the use of soil moisture application. This will allow for risk
assessment, as well as determination of the benefits of irrigation, and can integrate
knowledge on a per field basis for cultivar selection for cropping, irrigation regimes, and
other practices. If indeed the basis of scab management via irrigation is microbial
antagonism, then populations of the antagonist(s) in fields should be enumerated. Also, if
the organisms are not sufficiently present, then alternative disease management strategies
would need to be implemented to control common scab. Furthermore, the possibility of

developing a biocontrol agent could result from such research.

91

Chapter III

ASSESSMENT OF FOUR COMPOUNDS ON ELICITATION OF
THE SYSTEMIC ACQUIRED RESISTANCE RESPONSE IN
POTATO TO COMMON SCAB INFECTION.

INTRODUCTION

Systemic acquired resistance (SAR) is a broad-spectrum immunity in plants that
results from treatment with a natural or synthetic chemical or from a localized infection
with a necrotizing pathogen (Kessmann et al. 1994). Induced plants exhibit increased
production of pathogenesis-related (PR) proteins, decreased lesion size and/or number,
increased resistance to a broad spectrum of pathogens, and is dependent on salicylic acid
signaling (Hammerschmidt, 1999). Salicylic acid-mediated induced resistance involves
the rapid induction of a number of putative defense mechanisms, which may include
modifications of the plant cell wall and/or production of one or more of the following: PR
proteins, phytoalexins, oxidative enzymes, and active oxygen species. Induced resistance
was first discovered by Ray and Beauverie in 1901. In 1933, Chester reviewed this
phenomenon. Induced resistance has since been documented in numerous plant species,
and has been extensively researched for more than thirty years in economically important
plant families, such as Solanaceae (tobacco: Ross, 1961; Sequira and Hill, 1974; and
Pritchard and Ross, 1975) and Cucurbitaceae (cucumber: Kuc et al., 1975; and
Hammerschmidt et al., 1976).

The 1996 F QPA (Food Quality Protection Act) coupled with environmental
concerns have lead to a new era of reduced pesticide application and development of

alternative strategies to manage plant diseases. Unlike resistance activators, pesticides

92

are potentially damaging to the environment, toxic to humans and animals, provide
coverage against pathogens for shorter periods of time, and usually are targeted toward a
single-site metabolic mode of action (Ozeretskovskaya, 1995). Incorporating SAR into
plant disease management programs will result in a safer environment, reduced risks on
human and animal health, and provide long lasting, systemic protection against a wide
range of pathogens while delaying the incidence of pesticide resistance.

Systemic acquired resistance in potato has been reported in response to infections
caused by fungi and oomycetes (Muller and Borger, 1940; Chalova et al., 1976; Chalova
et al., 1977; Bostock et al. 1986), bacteria (Dutton et al., 1997), viruses (Roberts, 1979),
and nematodes (Rahimi et al., 1993 and Rahimi et al., 1998). Muller and Borger (1940)
first discovered local induced resistance in potato tubers after application of an
incompatible race of Phytophthora infestans to compatible races of P. infestans and
F usarium caeruleum. Glucans and lipoglycoproteins isolated from mycelium of P.
infestans elicited non-specific resistance against P. infestans and resulted in production of
high concentrations of rishitin and lubimin, two of the potato sesquiterpenoid
phytoalexins (Chalova et al., 1976 and Chalova et al., 1977). Chitin, chitosan, and
hydrosylates of chitosan induced resistance in potato tuber tissue to P. infestans
(Vasyukova et al., 2000 and Vasyukova et al., 2001). Oligogalacturonides from
Phytophthora sojae effectively induced resistance in potato to infection by Erwim'a
carotovota ssp. atroseptica (Dutton et al., 1997). The use of SAR against common scab
has not previously been reported. The limited effectiveness reached with current potato

common scab management strategies and the successful use of resistance activators in

93

other pathosystems warrants an investigation of this approach to manage common scab of

potato.

94

MATERIALS AND METHODS

Experimental Design

Snowden, a scab-susceptible cultivar, was planted in a Houghton muck soil in
2001, 2002, and 2003 at Muck Soils Experiment Station in Laingsburg, Michigan, USA
as a randomized complete block design with 4 replications per treatment. In 2001, harpin
and chitosan were tested as seed, in-furrow, pre-emergence, and early-emergence foliar
application methods. In 2002 and 2003 harpin, chitosan, formononetin, and saponins

were tested as in-furrow and foliar application methods.

Resistance Activators
Harpin

Harpin was purchased as Messenger® from Eden Bioscience Corporation, Bothell,
Washington, USA (Table 3—1). The active ingredient in Messenger®, 3% harping“, is a 44
kD protein isolated from Erwim’a amylovora, the causal agent of fire blight of apple.
Chitosan

Chitosan was purchased as Elexa® 4 Plant Defense Booster from GlycoGenesys,
Incorporated (formerly known as SafeScience, Inc.), Boston, Massachusetts, USA (Table
3-1). The active ingredient in Elexa® 4, 4% chitosan, is deacylated chitin, which is
extracted from the shells of Malacostraca (crab species) after the edible portions have

been removed.

95

F ormononetin

Formononetin (potassium salt of 4’-methoxy, 7-hydroxy isoflavone) was
purchased as Myconate® from VAMTech, L.L.C., Lansing, Michigan, USA (Table 3-1).
The active ingredient of Myconate®, 100% formononetin, is an isoflavone extracted from
the roots of Melilotus officinalis (clover) that were stressed by phosphorus deficiency.
Saponins

A saponin mix was purchased as Heads Up® Plant Protectant from Heads Up
Plant Protectants, Incorporated, Great Falls, Virginia, USA (Table 3-1). The saponin mix

is an extract of Chenopodium quinoa (quinoa) roots containing quinoa saponins at

49.65%.

TABLE 3-1. Trade names, active ingredients, source of active ingredients, and
registrants of the naturally occurring biological chemicals evaluated for inducing
resistance in potato to common scab infection in field trials.

 

 

Trade Name Active Ingredient (Al) Al Source Registrant
Messenger harpin protein Eminia amylovora Eden Bioscience Corp.
Elexa 4 poly-D-glucosamine Malacostraca shells GlycoGenesys, Inc.
Myconate formononetin Melilotus officinalis VAMTech, L.L.C.

Heads Up quinoa saponins Chenopodium quinoa Heads Up Plant Protectants, Inc.

Field Experiments
2001 Field Trial

Snowden (U S#1) potatoes were mechanically cut and allowed to heal 4 days
before planting. Potatoes (cut seed, approximately 42-56 g; cultivar Snowden) were

planted at the Muck Soils Experiment Station in Laingsburg, Michigan, USA on 11 July

96

into two-row by 7.6 m plots with 86.4 cm with tubers 30 cm apart replicated four times in

a randomized complete block design. The two-row beds were separated by a 1.5 m

unplanted row. All rows were irrigated until emergence and were inoculated at 0.1 l/7.6

m row with a spore suspension of Streptomyces scabies strain DP prepared at 106

spores/m1 on 13 July. Weeds were controlled by billing and as described in Table 3-2.

Fertilizer was drilled into plots before planting, formulated according to results of soil

tests and additional nitrogen was applied as described in Table 3-2. Insects and diseases

were controlled as described in Table 3-2.

TABLE 3-2. Soil fertility and weed, insect and disease management programs used in

the 2001 field trial.

 

Application Date

 

Chemical Registrant Application Rate (days after planting)

Herbicide

Dual 8E Syngenta Crop Protection, Inc.“ 2.3 I/ha 10 DAP

Basagran BASF Wyandotte Corporationb 2.3 I/ha 20 and 40 DAP

Poast BASF Wyandotte Corporationb 1.81/ha 58 DAP
Insecticide

Admire 2F Bayer Crop Science, L.P.° 1.5 |/ha at planting

Sevin 80$ Bayer Crop Science, L.P.c 1.4 kg/ha 31 and 55 DAP

Thiodan 3EC Southern Agricultural Insecticidesd 2.7 |/ha 65 and 87 DAP

Pounce 3.2EC Bayer Crop Science, L.P.c 0.6 l/ha 48 DAP
Fungicide

Bravo Syngenta Crop Protection, Inc.8 1.8 I/ha weekly 24/7 to 19/9
Fertilizer

Urea Al Reem, lnc.° 31 kg/ha 45 DAP

8Greensboro, North Carolina, USA

”Florham Park, New Jersey, USA

cResearch Triangle Park, North Carolina, USA
“Palmetto, Florida, USA

°Detroit, Michigan, USA

97

Applications of harpin (Messenger®) and chitosan (Elexa® 4) were applied
according to specified labeled rate as four different treatment methods: seed pieces, in-
furrow, pre-emergence, and early emergence foliar applications and untreated plots were
maintained as controls. Harpin seed treatments at 47 m1/45 kg and chitosan seed
treatments at 40 ml/45 kg were coated in the Gustafson® metered slurry seed treater
(Seedburo Equipment Company, Chicago, Illinois, USA) with the entire tuber surface
being exposed (Table 3-2). In furrow applications of harpin at 0.47 kg/ha and chitosan at
2.3 l/ha were made over the seed at planting, applied with a single nozzle R&D spray
boom delivering 46 l/ha at 551 kPa per treatment and using one XR11003VS nozzle per
row (Table 3-2). Pre-emergence applications of harpin at 1.9 kg/ha and of chitosan at 9.1
l/ha were applied on 20 July and were repeated as early emergence foliar harpin and
chitosan applications on 30 July at 1.9 kg/ha and at 9.1 l/ha, respectively (Table 3-2).
Vines were killed with diquat desiccant Reglone® 2EC (Syngenta Crop Protection,
Greensboro, North Carolina, USA) at 46 1/ha on 30 September. Half-plots (7 .6 m row)
were harvested manually on 19 October and individual treatments were evaluated based

on scab incidence and severity.

2002 Field Trial

Snowden (US#1) potatoes were mechanically cut and allowed to heal 4 days
before planting. Potatoes (cut seed approximately 42-56 g; cultivar Snowden) were
planted at the Muck Soils Experiment Station in Laingsburg, Michigan, USA on 7 June
into two-row by 7.6 m plots with 86.4 cm with tubers 30 cm apart replicated four times in

a randomized complete block design. The two-row beds were separated by a 1.5 m

98

unplanted row. All rows were irrigated until emergence and were inoculated at 0.1 l/7.6
m row with a spore suspension of Streptomyces scabies strain DP prepared at 106
CFU/ml on 13 June. Weeds were controlled by hilling and as described in Table 3-3.
Fertilizer was drilled into plots before planting, formulated according to results of soil
tests and additional nitrogen was applied as described in Table 3-3. Insects and diseases

were controlled as described in Table 3-3.

TABLE 3-3. Soil fertility and weed, insect and disease management programs used in
the 2002 field trial.

 

Chemica' Registrant Application Rate App"°a"°" Date

 

(days after planting)

Herbicide

Dual 8E Syngenta Crop Protection, Inc.8 2.3 l/ha 10 DAP

Basagran BASF Wyandotte Corporationb 2.3 |/ha 20 and 40 DAP

Poast BASF Wyandotte Corporation” 1.8 l/ha 55 DAP
Insecticide

Admire 2F Bayer Crop Science, L.P.° 1.5 l/ha at planting

Sevin 80$ Bayer Crop Science, L.P.° 1.4 kg/ha 30 and 55 DAP

Thiodan 3EC Southern Agricultural Insecticidesd 2.7 I/ha 63 and 82 DAP

Pounce 3.2EC Bayer Crop Science, L.P.° 0.6 l/ha 47 DAP
Fungicide

Bravo Syngenta Crop Protection, Inc.3 1.8 I/ha weekly 21/6 to 18/9
Fertilizer

Urea AI Reem, lnc.° 31 kg/ha 45 DAP

8Greensboro, North Carolina, USA
bFlorham Park, New Jersey, USA
cResearch Triangle Park, North Carolina, USA
dPalmetto, Florida, USA
°Detroit, Michigan, USA
Applications of harpin (Messenger®), chitosan (Elexa® 4), formononetin

(Myconate®), and saponins (Heads Up®) were applied according to specified labeled rate

as in-furrow and foliar treatment methods and untreated plots were maintained as

99

controls. In-furrow applications of harpin at 0.47 kg/ha, chitosan at 2.3 l/ha,
formononetin 0.09 kg/ha, and saponins at 0.17 kg/ha were made over the seed at planting,
applied with a single nozzle R&D spray boom delivering 46 l/ha at 5 51 kPa and using
one XR11003VS nozzle per row (Table 3-2). Foliar applications of harpin at 1.9 kg/ha,
chitosan at 9.1 l/ha, formononetin at 0.35 kg/ha, and saponins at 0.74 kg/ha were made
over the rows, applied with a single nozzle R&D spray boom delivering 234 1/ha at 551
kPa and using one XR11003VS nozzle per row on 15 and 22 July (Table 3-2). Vines
were killed with diquat desiccant Reglone® as described above on 20 September. Half-
plots (7.6 m row) were machine harvested on 27 September and individual treatments

were evaluated based on scab incidence and severity.

2003 Field Trial

Snowden (U S#1) potatoes were mechanically cut and allowed to heal 4 days
before planting. Potatoes (cut seed, approximately 42-56 g; cultivar Snowden) were
planted at the Muck Soils Experiment Station in Laingsburg, Michigan, USA on 4 June
into two-row by 7.6 m plots with 86.4 cm with tubers 30 cm apart replicated four times in
a randomized complete block design. The two-row beds were separated by a 1.5 m
unplanted row. All rows were irrigated until emergence and were inoculated at 0.1 l/7.6
m row with a spore suspension of Streptomyces scabies strain DP prepared at 106
CFU/ml on 12 June. Weeds were controlled by hilling and as described in Table 3-4.
Fertilizer was drilled into plots before planting, formulated according to results of soil
tests and additional nitrogen was applied as described in Table 3-4. Insects and diseases

were controlled as described in Table 3-4.

100

TABLE 3-4. Soil fertility and weed, insect and disease management programs used in
the 2003 field trial.

 

Chemical Registrant Application Rate Application Date

 

(days after plantingL

Herbicide

Dual 8E Syngenta Crop Protection, Inc.” 2.3 Ilha 10 DAP

Basagran BASF Wyandotte Corporation” 2.3 Ilha 20 and 40 DAP

Poast BASF Wyandotte Corporation” 1.8 l/ha 55 DAP
Insecticide

Admire 2F Bayer Crop Science, LP.c 1.5 l/ha at planting

Sevin 80$ Bayer Crop Science, L.P.° 1.4 kg/ha 30 and 55 DAP

Thiodan 3EC Southern Agricultural Insecticides” 2.7 Ilha 65 and 81 DAP

Pounce 3.2EC Bayer Crop Science, LP.” 0.6 l/ha 45 DAP
Fungicide

Bravo Syngenta Crop Protection, Inc.” 1.8 Ilha weekly 4/6 to 7/9
Fertilizer

Urea AI Reem, Inc.” 31 kg/ha 45 DAP

”Greensboro, North Carolina, USA

”Florham Park, New Jersey, USA

cResearch Triangle Park, North Carolina, USA
”Palmetto, Florida, USA

”Detroit, Michigan, USA

In-furrow and foliar applications of harpin (Messenger®), chitosan (Elexa® 4),
formononetin (Myconate®), and saponins (Heads Up®) were applied as described above
and untreated plots were maintained as controls. Vines were killed with diquat desiccant
as described above on 28 August. Half-plots (7.6 m row) were machine harvested on 15

September and individual treatments were evaluated based on scab incidence and

severity.

101

TABLE 3-5. Application methods, number of years tested, appliation rates, and
active ingredient rates of the naturally occurring chemicals evaluated for inducing
resistance in potato to common scab infection in field trials.

 

 

. . . Years . . Active Ingredient
Chemical Application Method Evaluated Application Rate Rate” (in %)
harpin

seed treatment 1 1.04 mI/kg 1.650

in-furrow spray 3 0.47 kg/ha 0.107

pre-emergence spray 1 1.9 kg/ha 0.400

foliar spray 3 1.9 kg/ha 0.400
chflosan

seed treatment 1 0.89 ml/kg 0.400

in-furrow spray 3 2.3 Ilha 0.002

pre-emergence spray 1 9.1 Ilha 0.008

foliar spray 3 9.1 Ilha 0.008
formononetin

in-furrow spray 3 0.09 kg/ha 0.012

foliar spray 3 0.35 kg/ha 0.050
saponins

in-furrow spray 3 0.17 kg/ha 0.013

foliar spray 3 0.74 kg/ha 0.055

”percentage of formulated product

Evaluation of Resistance Activators
Disease Assessment

Harvested tubers were carefully washed to avoid damage to the periderm and soil
and debris was removed so that common scab incidence and severity could be assessed.
One hundred sixty tubers per resistance activator treatment (40 tubers per plot, replicated
4 times) were assessed for scab incidence, rate of scab infection, and scab lesion type(s)
that occurred on the tuber surface. This was done by a visual determination of percent
coverage of the entire tuber surface area using a key for assessment of potato common

scab developed by James (1971).

102

Yield

Potato tubers were evaluated for yield one day after harvest to avoid
underestimation of yields due to tuber rot. Potatoes from each harvested 7.6 m half-plot
were placed onto a Tew Fruit and Vegetable processing machine with sizers (Tew
Manufacturing Corporation, Penfield, New York, USA) and weighed. US #1 potatoes
were weighed separately as grade A and oversize, and all others smaller than US#1 were

weighed and classified grade B.

Plant Emergence

To determine effects of the natural compounds on plant emergence, plants in each
plot were counted. The counting of plants began once emergence was apparent, usually
14 days afier planting. Emergence counts continued each season until no more plant

germination was evident.

Chitinase Activity

Glycol chitin preparation. A glycol chitin (1 % w/v) stock solution was prepared
by a modification of the method of Molano et al (1979). Glycol chitosan (5 g) was
dissolved in 100 ml of 10 % acetic acid and simultaneously ground in a mortar with a
pestle. The solution was incubated overnight at 22°C. The solution was vacuum-filtered
through Whatrnan® (Whatman, Incorporated, Florham Park, New Jersey, USA) number 4
filter paper and acetic anhydride (7.5 ml) was added to the filtrate and stirred until a gel
formed. The gel was cut into small (1 cm”) pieces and methanol was added until the gel

pieces were completely saturated. The mixture was homogenized in a blender for 4

103

minutes on the highest speed and then centrifuged at 27,000 x g at 4°C for 5 minutes.
The pellet was re-suspended in a 1:1 volume of methanol, re-homogenized for 4 minutes
on the highest speed and centrifuged at 27,000 x g at 4°C for 5 minutes. Sterile distilled
water (500 ml) containing 0.02% (w/v) sodium azide was added to the pellet and
homogenized in a blender for 4 minutes on the highest speed and the solution was stored
at 4°C.

Protein extraction. Tubers were removed from storage at 4°C and washed with
distilled water to remove any remaining soil particles. The apical and stolon ends were
removed. A 17 mm diameter core borer was used to core twice through the cut ends of
the potato. The two cylinders were sliced from both the apical and stolon ends into small
5.15 mm thick disks so that the two outermost (closest to the apical and stolon ends)
slices could be used for protein extraction from each cylinder (8 slices/tuber). Each slice
was treated with liquid nitrogen and ground with a mortar and pestle in 3 ml of
homogenization buffer (0.01 M sodium phosphate pH 6.0 containing 1 % w/w
polyvinylpyrrolidone). The homogenate was filtered through a double layer of
Calbiochem® miracloth (EMD Biosciences, San Diego, California, USA). The filtrate

was centrifuged at 10,000 rpm for 20 minutes at 4°C. The supernatant was stored at -

20°C. Protein was extracted from 96 samples per resistance activator treatment (3 tubers
per plot yielded 24 potato tuber disks, replicated 4 times).

Chitinase Activity Assay. An agarose gell % (w/v) was prepared with 40 ml 0.01
M sodium phosphate (pH 6.0) and was brought to a boil in a microwave. The 1 % glycol
chitin stock solution (prepared as described above; 0.4 ml) was added and stirred and 30

ml of the sodium phosphate was poured into a plastic petri dish (15 cm diameter). The

104

agarose gel was allowed to harden for 30 minutes and 3 mm diameter wells (1.5 cm
apart) were pierced with a 3 mm diameter core borer. The agarose in each well was
vacuum-suctioned from the gel with a Pasteur pipette. Protein extracts were loaded at 5
ul/ protein sample in 3 replications per gel. The petri dish was incubated for 4 hours at
37°C in a water bath. The gels were stained in a solution of 50 ml of 500 mM Tris-HCl
with 0.01 % Calcoflour brightener 28® (purchased from Sigma Chemical Company, St.
Louis, Missouri, USA) for 10 minutes and then rinsed twice to remove the staining
solution. Distilled water (sufficient to cover gel) was added to the petri dish and
incubated over night at 22 °C in the dark to allow the color to develop. The following
day the water was removed from the gels and the gels were photographed under UV light.
The activity of chitinase was determined as a diameter expressed in cm using Adobe
Photoshop® version 6.0 software (Adobe Systems Incorporated, San Jose, California,
USA) under maximal contrast using crop and diameter tools. Chitinase activity was
assessed by the method of Velasquez and Hammerschmidt (2004) for 288 samples per
resistance activator treatment (96 potato tuber disks per treatment were analyzed in

replications of 3).

Challenge Inoculations

Tuber Disk Preparation. Tubers from the different field treatments were removed
from storage at 4°C and allowed to warm to 22°C overnight. The tubers were washed
thoroughly with distilled water and surface sterilized by soaking for 10 minutes in a
sterile beaker containing 10% sodium hypochlorite (Clorox bleach) solution prepared in

sterile distilled water, followed by a 5 minute soak in sterile distilled water to remove the

105

solution. The apical and stolon ends of the tubers were removed with a sterile knife. A
sterile 17 mm diameter core borer was used to core through the cut ends of the potato.
The cylinder was sliced into six 5.15 mm thick disks, which were rinsed twice with
sterile distilled water and placed into sterile 100 mm x 15 mm plastic petri dishes lined
with sterile Whatman® (Whatman, Incorporated, Florham Park, New Jersey, USA)
number 1 filter paper moistened with sterile distilled water.

Inoculum Preparation. Streptomyces scabies strain DP was grown on 100 mm x
15 mm diameter plastic petri dishes containing PDA (prepared as described in chapter 1)
at 30°C in the dark. After an incubation period of 12 days, the spores were carefully
removed from the cultures with a sterile spatula and were re-suspended as a spore
suspension at 109 spores/m1 of 0.1 % Tween® 80 (as a wetting agent). A spore lawn was
created by inoculating 100 pl of the spore suspension with a sterile glass spreader onto a
fresh plate of PDA and incubated for 12 days at 30°C in the dark. Small (6.17 mm) plugs
containing spores were pierced through the medium with a 6.17 mm diameter core borer
and were immediately used as inoculum.

Tuber Disk Challenge Inoculation. The spore inoculum (prepared as described
above) was inverted and placed in the middle of the potato tuber disks (prepared as
described above) on 5 of the 6 disks. The other disk was treated with a 6.17 mm diameter
of PDA as a control. The disks were incubated at 30°C in the dark for 4 days and the
sterile filter paper was remoistened with sterile distilled water as necessary so that the
tuber disks did not dry out. The diameter of the infection was measured with a digital

caliper. All samples were frozen with liquid nitrogen until needed. Chitinase activity

106

was evaluated for all challenged tissue (as previously described). Forty-eight samples per

resistance activator treatment were evaluated.

Weather Data

Precipitation and soil temperature data collected from depths of 50.8 mm and
101.6 mm (2 in and 4 in) for 2001, 2002, and 2003 were downloaded directly from the
Michigan State University Muck Research Farm Station in Laingsburg, Michigan of the

Michigan Automated Weather Network database at www.agweather.geo.msu.edu/mawn/.

Data Analysis

A two-way analysis of variance (ANOVA) was run to test the effects of year,
treatment, and the interaction between year and treatment for the evaluation of resistance
activators and their effects on scab as determined by the disease assessment. For yield
evaluation, a two-way ANOVA was run that tested the effects of year, treatment, and the
interaction between year and treatment for the effects of resistance activators on yield
Yield data from the field trials were analyzed with a t—test with comparison of least
significant difference to determine differences between resistance activator treatments
and application methods within each yield category.

A two-way AN OVA was run that tested the effects of year, treatment, and the
interaction between year and treatment to determine whether there were differences in
chitinase activities detected in tuber tissue treated with the resistance activators. T-tests
with comparison of least significant difference were conducted to determine the

differences in chitinase activity detected between the treatments for the trials conducted

107

in 2001, 2002, and 2003, as well as the chitinase activity detected in challenged tuber
tissue after the challenge inbculation.

For all statistical analyses, an outcome was deemed statistically significant if the
probability for a Type I Error was 5% or less (alpha = 0.05). The GLM (general linear
model) for two-way AN OVA and LSD (least significant difference) of the means for t-
tests were conducted using SAS® version 8 software (SAS Institute, Inc.; Cary, North

Carolina).

108

RESULTS

Evaluation of Resistance Activators
Disease Assessment

A two-way ANOVA that tested the effects of year, treatment, and year/treatment
interaction on disease found year, treatment and year/treatment interaction to be
significant at a = 0.05, so each year was analyzed individually. In 2001, the majority of
harvested tubers had 5% or less scab infection (Figure 3—1). Slightly more disease free
tubers resulted from treatments with chitosan and harpin (Figure 3-1). However, only the
pre-emergence chitosan application was significantly better than the control. More tubers
of Grade A market quality (at or less than 5% scab lesions) resulted from harpin seed
treatments. All other treatments were not different than the control. The incidence and
severity of scab infections with greater than 5% lesions were similar regardless of
treatment. Harpin and chitosan applications neither eliminated nor significantly reduced
severe infections that ranged from 50-100% scab coverage (Figure 3-1).

In 2002, the majority of harvested tubers had 6-10% scab infection (Figure 3-2).
Only the in-firrrow application of chitosan resulted in more disease free tubers than the
untreated control (Figure 3-2). Treatment with the four compounds resulted in no
increase of Grade A marketable tubers when compared to the control. In fact, the foliar
formononetin application resulted is significantly fewer marketable tubers than the
control. All of the in-furrow applications resulted in more tubers with 11-25% scab

infection than the untreated control. In furrow and foliar applications with chitosan,

109

saponins, harpin, and formononetin provided little to no reduction in tubers in the more
severe disease categories of 26-49% and 50-100% scab cover (Figure 3-2).

In 2003, the majority of harvested tubers had 11-25% scab infection (Figure 3-3).
There were no significant differences between the incidence of tubers without scab across
all treatments (Figure 3-3). Tubers in the Grade A marketable category were either no
different than the untreated control or were significantly less than the control. In-furrow
and foliar harpin applications and foliar chitosan applications resulted in fewer tubers in
the Grade A category than the untreated control (Figure 3-3). Most of the harvested
tubers were classified with 11-25% scab and there were no treatment differences in this
range. The incidence of severe scab infections that ranged from 26-49 and 50—100%

were not reduced when treated with natural compounds (Figure 3-3).

 

    
 
 

CHITOSAN Control
60 rrrrrr ~ » rrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr 5 Seed ., r , ----------
. .... . .................................. In-Furrow.... . ......
ll Pro-emergence

  
  

 

  
 

    
   

Total Tubers in Category (in %)

 

, ' Isle
0 0.5-5 6-10 11-25
Scab Coverage on Tuber (in °/o)

 

26-49 50-100

Figure 3-1. Effects of natural resistance activators and application method on scab
incidence and severity of harvested tubers in 2001.

110

  
  
 
 

 

I Control
13 Chitosanm
Saponins
I

E

"""""""""" H swim"
..Eormonon in

   

 

Total Tubers in Category (in %)

....................

 
 

II: I . .
0.5-5 6-10 11-25 26-49 50-1 0
Scab Coverage on Tuber (in %)

Figure 3-2. Effects of natural resistance activators, natural compounds, and
application method on scab incidence and severity of harvested tubers in 2002.

- Chitosan -----

 

 

 
   
  

N
01

Total Tubers in Category (in %)
a

.3
O

Scab Coverage on Tuber (in %)

Figure 3-3. Effects of natural resistance activators, natural compounds, and
application method on scab incidence and severity of harvested tubers in 2003.

111

Yield

A two-way AN OVA that tested the effects of year, treatment, and year/treatment
interactions on marketable-, grade A-, grade B- and total-yields, found year to be
significant at a = 0.05, so each of these yield categories were evaluated individually
(within years). Only oversize yield was analyzed between years because there was no
significant year effect. Figure 3-4 shows plots from which the harvested tubers were
obtained for yield data. In 2001, total and marketable yields ranged from 9.5-13 kg/SO
plants and 7.4-9.2 kg/SO plants, respectively, for furrow, foliar, seed, and pre-emergence
harpin treatments (Figure 3-5). Total and marketable yields were between 9.4-11.2 kg/50
plants and 73-103 kg/SO plants, respectively, for all chitosan treatments (Figure 3-5).
Marketable and total yields for the control were 9.5 kg/SO plants and 6.8 kg/SO plants,
respectively. There were no negative effects on total or marketable yields due to elicitor
treatment in 2001 (Table 3-6 and Table 3-7). Oversize yields ranged from 0.0 kg/SO
plants to 0.8 kg/SO plants. These differences were not significant at a = 0.05 (Table 3-8).
Grade A and B yields averaged about 8.8 kg/50 plants and 1.5 kg/50 plants, respectively
across all treatments. The treatment differences were not significant (Table 3-9 and
Table 3-10).

In 2002, total and marketable yields for plants treated with in-furrow applications
of saponins were significantly higher (9.4 kg/50 plants and 7.1 kg/50 plants, respectively)
than all other treatments (Figure 3-6). Total and marketable yields for all other
treatments were similar: 6.8-8.3 kg/SO plants and 5.0-6.3 kg/SO plants, respectively. The
only yields less than the control resulted from the foliar chitosan application (5.9 and 4.4

kg/50 plants for total and marketable yields, respectively) (Table 3-6 and Table 3-7).

112

Oversize yields ranged from 0.004 kg/50 plants and were not significantly different
across all 9 treatments (Table 3-8). Grade A yields were significantly greater than the
control when plants were treated with in-furrow applications of saponins (Table 3-9). All
other treatments were similar, except foliar chitosan applications, which resulted in lower
Grade A yields than the untreated control (Table 3-9). There were no treatment
differences on yield in the Grade B category (Table 3-10).

In 2003, total yields of all treatments ranged from 8.6-12.1 kg/50 plants and
marketable yields were 7.6-10.5 kg/50 plants (Figure 3-10). There were no negative
effects of the natural compounds on yields in 2003 (Table 3-6 and Table 3-7). Oversize
yields were not statistically significant (0.2-0.4 kg/SO plant; Table 3-8). Grade A and B
yields averaged 10.1 kg/50 plants and 1.2 kg/50 plants, respectively across all nine

treatments and these differences were not significant (Table 3-9 and Table 3—10).

 

Figure 3-4. Plots used for assessment of natural compounds at Muck Soils
Experiment Station in 2003. Plots in 2001 and 2002 were similar to the ones
pictured here.

113

 

18

- Total Yield
E ”Marketable Yield '1

  

Average Yield per 50 plants (in kg)

 

 

 

 

Furrow Foliar Seed Pre-emergence Furrow Foliar Seed Pre-emergence

Harpin Chitosan Control
Treatment

Figure 3-5. Comparison of the effects of natural resistance activators and application
method on mean yields in 2001. Means with the same letter are not significantly
different according to t-test at a=0.05. The t-test was conducted within yield category
due to significant yield category effect as determined by a one-way ANOVA at

alpha = 0.05.

114

 

14 ‘ - Total Yield
,7 __a [:l .Marketabletield

 

     

 

A 12 """"
U)
x
.E
3 10
E ab
’5- I
o 8
L0
g- i
E 6
.9
>.
‘3, 4
S
a)
>
< 2 .
I ,
Furrow Foliar Furrow Foliar Furrow Foliar Furrow Foliar Untreated
Harpin Chitosan Formononetin Saponins Control
Treatment

Figure 3-6. Comparison of the effects of natural compounds, resistance activators and
application method on mean yields in 2002. Means with the same letter are not
significantly different according to t-test at a=0.05. The t-test was conducted within
yield category due to significant yield category effect as determined by a one-way
ANOVA at alpha = 0.05.

115

 

 

- Total Yield
”D ”Marketable ”Yield

  

_L
N

_s
0

Average Yield per 50 plants (in kg)
co

    

 

 

 

 

 

 

4 ‘ ............
2 I ~
Furrow Foliar Furrow Foliar” Furrow Foliar Furrow Foliar Untreated
Harpin Chitosan Formononetin Saponins Control
Treatment

Figure 3-7. Comparison of the effects of natural compounds, resistance activators and
application method on mean yields in 2003. Means with the same letter are not
significantly different according to t-test at a=0.05. The t-test was conducted within
yield category due to significant yield category effect as determined by a one-way
ANOVA at alpha = 0.05.

116

TABLE 3-6. Effects of natural compounds and application method on mean total

yields per 50 plants in 2001, 2002, and 2003.
2001 2002 2003

 

Treatment Mean (kg) Std.Error Mean (kg) Std. Error Meaflkg) Std. Error
Harpin

In Furrow 13.0 a 2.9 7.9 ab 2.2 8.7 a .

Foliar 10.6 a 2.4 7.3 ab 1.2 11.2 a 1.1

Seed 9.5 a 2.6 nt nt

Pre-emergence 11.8 a 3.1 nt nt
Chitosan

In Furrow 10.2 a 2.2 8.3 ab 2.1 12.1 a 2.1

Foliar 11.2 a 4.2 5.8 b 0.9 9.8 a 1.6

Seed 9.4 a 2.3 nt nt

Pre-emergence 10.1 a 3.3 nt nt
Formononetin

In Furrow nt 6.8 ab 1.6 11.5 a 2.1

Foliar nt 7.4 ab 1.8 9.0 a 0.5
Saponins

In Furrow nt 9.4 a 2.7 9.9 a 1.3

Foliar nt 7.8 ab 3.3 9.2 a 1.4
Control 9.5 a 2.0 8.4 ab 2.2 8.6 a 0.9
nt Not Tested

 

Means with the same letter are not significantly different according to t-test at a=0.05.
t-test conducted within year due to significant year effect (ANOVA a = 0.05).

117

TABLE 3-7. Effects of natural compounds and application method on mean

marketable yields per 50 plants in 2001, 2002, and 2003.
2001 2002 2003

 

 

 

Treatment Mean (kg) Std.Error Mean (kg) Std. Error Mean (kg) Std. Error
Harpin
In Furrow 9.2 a 3.0 5.9 ab 2.3 7.9 a 0.8
Foliar 7.4 a 2.1 5.5 ab 1.2 10.0 a 1.3
Seed 8.2 a 1.6 nt nt
Pre-emergence 8.4 a 2.8 nt nt
Chitosan
In Furrow 7.3 a 2.1 6.3 ab 2.4 10.5 a 2.6
Foliar 8.1 a 4.0 4.4 b 0.8 8.7 a 1.7
Seed 7.9 a 1.7 nt nt
Pre-emergence 10.3 a 2.7 nt nt
Formononetin
In Furrow nt 5.0 ab 0.5 10.2 a 1.9
Foliar nt 5.5 ab 0.7 7.8 a 0.7
Saponins
In Furrow nt 7.1 a 0.9 8.7 a 1.3
Foliar nt 5.7 ab 1.0 8.0 a 1.5
Control 6.8 a 1.7 6.3 ab 2.0 7.6 a 1.0
nt Not Tested -

Means with the same letter are not significantly different according to t-test at a=0.05.
t-test conducted within year due to significant year effect (ANOVA a = 0.05).

118

TABLE 38 Effects of natural compounds and application method on mean
oversize yields per 50plants in 2001, 2002, and 2003.

 

2001 2002 2003

 

 

Treatment Meaflkg) Std.Error Mean (kg) Std. Error Mean (kg) Std. Error
Harpin

In Furrow 0.8 a 0.4 0.7 a 0.3 0.8 a 0.2

Foliar 0.6 a 0.2 0.4 a 0.1 0.7 a 0.2

Seed 0.0 a nt nt

Pre-emergence 0.5 a 0.1 nt nt
Chitosan

In Furrow 0.3 a 0.1 0.4 a 0.1 0.9 a 0.4

Foliar 0.2 a 0.1 0.4 a 0.1 0.3 a 0.2

Seed 0.0 a nt nt

Pre-emergence 0.1 a 0.0 nt nt
Formononetin

In Furrow nt 0.2 a 0.1 0.8 a 0.3

Foliar nt 0.4 a 0.2 0.8 a 0.4
Saponins

In Furrow nt 1.0 a 0.4 0.9 a 0.2

Foliar nt 0.3 a 0.1 0.2 a 0.2
Control 0.4 a 0.2 0.3 a 0.1 0.3 a 0.2
nt Not Tested

Means with the same letter are not significantly different according to t-test at a=0.05.

119

TABLE 3-9. Effects of natural compounds and application method on mean
grade A yields per 50 plants in 2001, 2002, and 2003.

 

2001 2002 2003

 

 

Treatment Mean (kg) Std.Error Mean (kg) Std. Error Mean (kg) Std. Error
Harpin

In Furrow 10.4 a 1.6 6.4 ab 0.9 8.8 a 0.8

Foliar 8.5 a 0.8 6.2 ab 0.6 11.5 a 1.4

Seed 7.9 a 0.8 nt nt

Pre-emergence 9.8 a 1.3 nt nt
Chitosan

In Furrow 8.6 a 0.9 7.2 ab 1.0 11.9 a 2.7

Foliar 9.5 a 1.7 4.9 b 0.4 10.3 a 1.9

Seed 8.2 a 0.7 nt nt

Pre-emergence 8.3 a 1.3 nt nt
Fonnononefin

In Furrow nt 5.9 ab 0.6 11.6 a 2.0

Foliar nt 6.4 ab 0.9 8.7 a 0.4
Saponins

In Furrow nt 7.6 a 0.9 9.7 a 1.4

Foliar nt 6.7 ab 1.3 9.5 a 1.6
Control 7.9 a 0.9 7.4 ab 1.0 9.0 a 1.1
nt Not Tested

Means with the same letter are not significantly different according to t-test at a=0.05.
t-test conducted within year due to significant year effect (ANOVA a = 0.05).

120

TABLE 3-10. Effects of natural compounds and application method on mean
grade B yields per 50 plants in 2001, 2002, and 2003.

 

2001 2002 2003

 

 

Treatment Mean JkgLStdError Mean jkgLStd. Error Mean (kg) Std. Error
Harpin

In Furrow 1.8 a 0.1 0.8 a 0.1 0.9 a 0.3

Foliar 1.6 a 0.3 0.7 a 0.2 1.2 a 0.1

Seed 1.6 a 0.4 nt nt

Pre-emergence 1.5 a 0.3 nt nt
Chitosan

In Furrow 1.4 a 0.1 0.7 a 0.1 1.6 a 0.4

Foliar 1.4 a 0.3 0.5 a 0.1 1.1 a 0.1

Seed 1.2 a 0.3 nt nt

Pre-emergence 1.8 a 0.3 nt nt
Formononetin

In Furrow nt 0.7 a 0.2 1.3 a 0.6

Foliar nt 0.7 a 0.1 1.1 a 0.1
Saponins

In Furrow nt 0.8 a 0.2 1.2 a 0.2

Foliar nt 0.8 a 0.3 1.2 a 0.1
Control 1.3 a 0.2 0.7 a 0.1 1.0 a 0.1
nt Not Tested

Means with the same letter are not significantly different according to t-test at a=0.05.
t-test conducted within year due to significant year effect (ANOVA a = 0.05).

121

Plant Emergence
In 2001, the natural compounds and application methods did not effect plant

emergence (Table 3-11). At 14 days after planting, more than 20% of all plants had
emerged. Two weeks later, plant emergence was near 100% for all treatments (Table 3-
11). In 2002, there were no significant differences between the compounds and
application methods on plant emergence. At 18 days after planting, more than 50% of
the plants emerged (Figure 3-12). Emergence values increased consistently over the
following weeks across all treatments. The final emergence count of treatments ranged
from 80-92% (Figure 3-12). In 2003, plant emergence was not negatively influenced
treatment with natural compounds when compared to the control (Figure 3-13). At 19
days after planting, more than 29% of plants had emerged. By the end of the season, 99-
100% of all plants emerged (Figure 3-13). This was the highest emergence rate between

the 3 years.

TABLE 3-11. Effects of natural compounds on plant emergence in 2001.

 

Percentage of Plants Emerged
Treatment 7/25/01 7/27/01 7/30/01 8/1/01 8/3/01 8/8/01
14 DAP 16 DAP 19 DAP 21 DAP 23 DAP 28 DAP

 

Harpin
In Furrow 25 49 87 91 93 96
Foliar 25 51 86 93 96 98
Seed 29 49 74 82 84 88
Pre-emergence 38 57 94 95 96 97
Chitosan
In Furrow 26 55 87 94 96 98
Foliar 28 47 84 93 95 97
Seed 33 59 92 97 98 99
Pre-emergence 26 47 86 91 93 96
Control 21 34 86 96 97 98
DAP Days after planting

122

TABLE 3-12. Effects of natural compounds on plant emergence in 2002.

 

Percentage of Plants Emerged
Treatment 6/25/02 7/1/02 7/8/02 7/1 5/02 7/22/02 8/5/02 8/7/02
18 DAP 24 DAP 31 DAP 38 DAP 45 DAP 59 DAP 61 DAP

 

 

Harpin

In Furrow 61 63 65 65 65 90 90

Foliar 55 57 63 66 67 88 88
Chitosan

In Furrow 51 53 60 60 60 83 83

Foliar 53 55 58 59 60 80 80
Formononetin

In Furrow 55 58 65 66 67 85 85

Foliar 61 64 71 71 72 90 90
Saponins

In Furrow 59 60 67 67 67 90 90

Foliar 58 58 65 66 66 84 84
Control 59 59 65 66 68 92 92
DAP Days after planting

TABLE 3-13. Effects of natural compounds on plant emergence in 2003.

 

Percentage of Plants Emerged
Treatment 6/23/03 7/1/03 7/8/03 7/15/03 7/22/03 7/29/03
19 DAP 27 DAP 34 DAP 41 DAP 48 DAP 55 DAP

 

Harpin

In Furrow 53 84 95 98 99 100

Foliar 31 87 91 96 99 99
Chitosan

In Furrow 29 87 89 98 100 100

Foliar 45 84 89 96 99 100
Formononetin -

In Furrow 47 86 88 99 100 100

Foliar 59 88 95 97 99 99
Saponins

In Furrow 35 81 95 100 100 100

Foliar 57 84 95 97 98 99
Control 53 84 95 1 00 100 100
DAP Days after planting

123

C hitinase Activity

A two-way ANOVA that tested the effects of year, treatment, and year/treatment
interaction on chitinase activity found year, treatment and year/treatment interaction to be
significant at a = 0.05, so each year was analyzed individually. In 2001, the average
chitinase activity of tuber tissue was highest for the untreated control at 1.4 cm2 (Table 3-
14). Average chitinase activity of harpin and chitosan treatments ranged from 1.34-1.36
cm2 and 1.28-1.39 cm”, respectively (Table 3-14). In 2002, average chitinase activity
was highest in tuber tissue from plants treated with in-furrow and foliar formononetin
applications at 1.26 cm2 (Table 3-14). Average chitinase activity of chitosan, harpin, and
saponins was 1.14-1.24 cm”, 1.24-1.25 cm”, and 1.22-1.25 cm”, respectively (Table 3-

14). Average chitinase activity of the untreated control was lower than the other values at
1.19 cm2 (Table 3-14). In 2003, average chitinase activity of tuber tissue was greatest for
plants treated with foliar applications of harpin at 1.74 cm2 (Table 3-14). The lowest
average chitinase activity was detected in samples that were treated with in-firrrow
applications of saponins at 1.41 cm2 (Table 3-14). All other activities ranged from 1.54-
1.71 cm2 (Table 3-14). Figure 3-8 shows typical results of the chitinase activity assay

used to detect differences in the production of this PR-protein, which is a marker for

systemic acquired resistance.

124

TABLE 3-14. Effects of natural compounds and application methods on mean
chitinase activity of potato tuber tissue in 2001, 2002, and 2003.

2001 2002 2003

 

 

 

Treatment Mean gm”) Std.Error Mean (cmz) Std. Error Mean (cmz) Std. Error
Harpin

In Furrow 1.34 cde 0.01 1.25 ab 0.02 1.65 cd 0.02

Foliar 1.34 de 0.02 1.24 ab 0.02 1.74 a 0.02

Seed 1.36 bcd 0.01 nt nt

Pre-emergence 1.34 cde 0.01 nt nt
Chitosan .

In Furrow 1.38 abc 0.01 1.24 ab 0.02 1.71 ab 0.02

Foliar 1.32 ef 0.02 1.14 d 0.03 1.67 be 0.12

Seed 1.39 ab 0.01 nt nt

Pre-emergence 1.28 f 0.01 nt nt
Formononetin

In Furrow nt 1.26 a 0.04 1.62 cd 0.02

Foliar nt 1.26 a 0.02 1.54 e 0.03
Saponins

In Furrow nt 1.22 b 0.02 1.41 f 0.02

Foliar nt 1.25 ab 0.02 1.61 d 0.02
Control 1.40 a 0.01 1.19 c 0.03 1.63 cd 0.02
nt Not Tested

Means with the same letter are not significantly different according to Host at a=0.05.
t-test conducted within year due to significant year effect (ANOVA a = 0.05).

125

1

it

.9 9‘ :3.”

i = a...

Harpin Foliar

 

Figure 3-8. Chitinase activity assays of tuber tissue from plants treated with natural
compounds in 2003.

Challenge Inoculations

Tuber slices from the untreated control challenged with Streptomyces scabies
resulted in necrotic diameters of approximately 8 mm regardless of the depth from which
the tuber slice was taken (Figure 3-9). The necrotic diameters of the other challenged
tissues ranged from approximately 7-9 mm for the slices at all depths of tissue (Figure 3-
9). The average chitinase activity of the challenged tuber tissue was greatest in tubers
from plots that were treated with foliar applications of harpin. The average chitinase
activity of this treatment was 1.68 cm2 (Figure 3-10). Therefore, it is possible that harpin
may enable the tuber to respond to pathogen attack. The average chitinase activity of

challenged tissue was lower from tubers obtained fi'om the in-furrow treatments with

126

harpin and formononetin than the untreated control. All other average chitinase activities

were comparable to the control (Figure 3-10).

   

In Farm

I 1.00mm

1:] 6.15m
21.60mm

0 Uninoculated

In Furrow

E Ingram“
7%

”II 11.30mm

. ////////////// /_//////// ////////// ////// ////////
__________________________________.____________________ ___.I__I_____

In Furrow

H /////////////////////////////////////////////
______==_____==_=_________=__==._.________=_=__=__=_____________________==_______

Saponins Forrmnonetin Chitosan Hapin
In FunOiM

, m a.
//////////////////// /////////////////////,%
======_____=___:: I. I ___._________________________=._ i:EI__

Foliar

H ,///////// //////// /////////// //////%/////////////
_=______===_=___=_===__=_

Foliar
Treatment: Elicitor and Application Method

 

Fella

 

Unlreabd Saponins Formononetin Chitosan l-la'pln
Folia'

Control

 

AEE EV w_mo._ooz .6 86:55

Figure 3-9. Effects of natural compounds and application method on tuber tissue
127

slices from various depths challenged with Streptomyces scabies.

 

 

 

     

 

    

 

 

 

 

 

 

a I Inoculated
1.687 ----- ~ ---------- 7' , """ rrrr
A b T 1:] Control
N
E bcde I
3, """""""""" béd" ' ”
> ' cdef
: h ' cdef
E _______ r" I W
21.60 Ta I
a) i
(I)
(U
E
L_:—) I
1.52
1.44 _ ,e , ‘ #_ . a
Foliar Furrow Foliar Furrow Foliar Furrow Foliar Furrow Untreated
Saponins Chitosan Harpin Formononetin Control
Treatment

Figure 3-10. Effects of challenged tuber tissue on average chitinase activity.

Weather Data

Precipitation was greatest in 2001, with a total of 259.15 mm rainfall from 1 June
to 30 September. In 2002 and 2003, the total precipitation for this time period was
219.65 mm and 154.02 mm, respectively. The soil temperatures at 50.8 mm and 101.6

mm fluctuated, but were similar for 2001, 2002, and 2003.

128

 

 

 

 

 

 

 

 

30
Total Precip. = 259.15 m
A = Date Planted
B = \fines Killed
E 20 -----
E
v
IE
8 B
E 10 A 9/30
:E‘ 7/11
l r A A r A ‘r fir ’ r j i n
6/1 6/15 6/29 7/13 7/27 8/10 8/24 9/7 9/21

2001 Field Trial

Figure 3-11. Daily precipitation data collected from Laingsburg, Michigan for the
2001 field trial.

 

  

 

 

 

 

 

40
Total Precip. = 219.65 mm
A = Date Planted
B = Vines Killed
A 30 """"""""""""""""""""""""""" " """"
E
E
E
i:
.9 , .........................
E 20
E
0
[:13 B
2, ________ 9/20
'5 10 ' """"""""""""""""""""""""
C.)
V
w A I A i
' 6/1 6/15 6/29 7/13 7/27 8/10 8/24 9/7 9/21

2002 Field Trial
Figure 3-12. Daily precipitation data collected from Laingsburg, Michigan for the
2002 field trial.

129

 

 

 

 

 

 

 

30

Total Precip. = 154.02 mm
A = Date Planted
B = \fines Killed

E

E 20 ,, , _. _. .. .....

.E

C

.9

E

:1-

§ 10 A B

2, 6’4 8/28

'5

D l 1

6/1 671 5 6729 7/1 3 7/27 8/1 0 8l24 977 9721

2003 Field Trial

Figure 3-13. Daily precipitation data collected from Laingsburg, Michigan for the 2003
field trial.

 

so
_.— 50.8 mm Depth
" - 101.6 mm Depth

   

 

Soil Temperature (in degrees C)

 

 

 

6/1 6715 6729 7713 7/27 8l10 8724 9/7 é/21

2001 Field Trial

Figure 3-14. Daily average soil tenrperature data taken from depths of 50.8 mm and
101.6 mm collected from Laingsburg, Michigan for the 2001 field trial.

130

 

30 + 50.8 mm Depth

“ 132:: ~ 101.6 mm Depth

 

 

 

 

58, H- 'UJ ”Neal'filguat
a)
'o
.5 hill”
9
3
C5
«‘13
Q10r ....................................................
E
Q)
'—
'5
a)
6/1 6715 6729 7/13 7/27 8/‘10 8724 977 9/21

2002 Field Trial
Figure 3-15. Daily average soil temperature data taken from depths of 50.8 mm and
101.6 mm collected from Laingsburg, Michigan for the 2002 field trial.

 

30

—I— 50.8 mm Depth
"- "21:“ ~ 101.6 mm Depth

'0
O

 

_s
C

Soil Temperature (in degrees C)

 

 

 

6/1 671 5 6729 771 3 7/27 8/1 0 8724 9/7 9/21

2003 Field Trial

Figure 3-16. Daily average soil temperature data taken from depths of 50.8 mm and
101.6 mm collected from Laingsburg, Michigan for the 2003 field trial.

131

DISCUSSION

Chitosan has been used as an elicitor for plant protection from pathogens
(Hadwiger et al., 1984). Treatment with chitosan enhanced resistance of tomato to
F usarium oxyporum f. sp. radicis-lycopersici by causing a reduction in the number of
lesions caused by the pathogen and by increasing the constitutive physical barriers in
tissues (Benhamou and Thériault, 1992). Seed treatments with chitosan were effective in
reducing fungal growth in plants by mechanisms characteristic of SAR, including
increased production of phenolic compounds and [3-1,3-glucans (Benhamou et al., 1994).
Chitosan elicited resistance in potato to Phytophthora infestans by reducing the number
of necrotic cells compared to the control (Vasyukova et al., 2000). Chitosan also reduced
disease in peanut against leaf rust caused by Puccinia arachidis by reducing the number
and size of lesions as well as reduced sporulation and was accompanied by increases is
salicylic acid, chitinase and glucanase activity (Sathiyabama and Balasubramanian,
1998). Chitosan activated protective mechanisms in tomato against the root-knot
nematode, Meloidogyne incognita (V asyukova et al., 2001). In this study in 2001, only
the pre-emergence chitosan application produced slightly more disease free tubers than
the untreated control (Figure 3-1). However, this small increase was not correlated with
an increase in chitinase activity (Table 3-14), suggesting SAR was not responsible for the
difference. More likely pathogen population variability and heterogeneity of soil
conditions may have been more important in this difference. Although other small
differences were noted, the standard error of the mean negates the other chitosan

treatments as ineffective in reducing scab incidence and severity. Since the majority of

132

the harvested tubers in 2001 were free of disease or had 5% or less scab cover on tuber
surface area, regardless of treatment (Figure 3-1), it is very likely that the environmental
conditions were not highly favorable for scab development in this year. Plant emergence
in 2001 was not fully uniform through early plant development at 14 and 16 days after
planting (Table 3-11), but the differences had no effects on total tuber yield (Table 3-6)
and were more likely due to heterogeneity within the field, seed health, or presence of
seed rotting pathogens rather than effects of resistance activators. There were no
negative effects of chitosan on tuber yield or tuber size in 2001 (Table 3-6, Table 3-7,
Table 3-8, Table 3-9, Table 3-10, and Figure 3-5). In 2002, the in-furrow chitosan
application produced slightly more disease free tubers by a few percent than the untreated
control (Figure 3-2). However, because these differences were not substantially better
than the control (Figure 3-2) and because only small increases in chitinase activity were
detected (Table 3—14), heterogeneity of soil conditions and pathogen dispersal within the
field more likely explain these differences. F oliar applications of chitosan were not
effective in reducing disease severity. In 2002, the severity of scab was greater than in
2001. The majority of tubers harvested were rated with infections in the 6-10% and 11-
25% scab coverage categories. The higher disease severity in 2002 suggests that perhaps
disease pressure and environmental conditions were more conducive for scab infection
than in the previous year, particularly precipitation (Figures 3-11, 3-12, 3-13, 3-14, 3-15,
and 3-16). The low infection rates and lack of severe infections in the disease category of
50-100% scab coverage are probably better explained by weather conditions during early
tuber development or other soil factors, such as pathogen distribution. Plant emergence

in 2002 was somewhat uniform during early plant development, but differences were

133

noted 31 days after planting, but were more obvious by the time germination had ceased
and plants were last counted (Table 3-12). There were no negative effects that resulted
the from in-furrow application of chitosan on yield; however, there were negative effects
that resulted from the chitosan foliar treatment. Plants treated with foliar chitosan
applications had the lowest Grade A (Table 3-9), marketable (Table 3-7 and Figure 3-6),
and total yields (Table 3-6 and Figure 3-6) than all other treatments. However, this
difference is likely explained by plant emergence (Table 3-12). Plant emergence was
lowest for this treatment combination as well. However, the reduced emergence for this
compound and treatment method was not observed in 2001 and 2003, which suggests that
poor field conditions, seed health, or presence of seed rotting pathogens rather than
negative effects of the natural compound on plant germination may have been responsible
for the reduced emergence and hence, yield. In 2003, neither of the chitosan applications
was effective in reducing scab incidence or severity. Like 2002, the majority of tubers
harvested in 2003 were classified with infections in the 6-10% and 11-25% scab coverage
categories (Figure 3-3). This suggests that the similar disease severities in 2002 and 2003
may have been due to similar disease pressures and environmental conditions between
these two years and less total precipitation than in 2001 (Figures 3-11, 3-12, 3-13, 3-14,
3-15, and 3-16). Plant emergence in 2003 was quite variable at 19 days after planting;
however, these differences were negligible by 27 days after planting (Table 3-13). There
were no negative effects of chitosan on tuber yield or size (Table 3-6, Table 3-7, Table 3-
8, Table 3—9, Table 3-10, and Figure 3-7).

Harpin, a protein originally isolated from Erwim'a amylovora, the bacterium that

causes fire blight of pome fruits (Wei et al.,1992) is an elicitor of plant resistance. Since

134

its discovery, a number of other harpins have been isolated from other genera of gram
negative bacteria. The harpin proteins are responsible for eliciting the development of
the hypersensitive response (HR), which is a rapid, localized cell death that is associated
with many broad-spectrum host defensive responses, including generation of reactive
oxygen species and lignification of the host cell wall. In addition to the HR, the
resistance activator harpin has been correlated with induction of mitogen-activated
protein kinase activity (Desikan et al., 1999), which is an important component of
signaling during plant pathogen interactions (Ligterink et al., 1997). SAR induction by
harpin is mediated through salicylic acid and the NIMI gene (Dong et al., 1999). One
study found that transgenic potato plants expressing harpin protein resulted in reductions
in the growth rate of Phytophthora infestans, and concluded that the hypersensitive
response in potato was a promising approach to enhance disease resistance (Li and Fan,
1999). Strobe] et al. (1996) found that a harpin protein purified fiom Pseudomonas
syringae pv. syringae 61 was able to induce SAR in cucumber to Colletotrichum
lagenarium, Pseudomonas syringae pv. lachrymans and tobacco necrosis virus. Tobacco
leaves sprayed with harpin resulted in the HR and production of PR-proteins (Peng et al.,
2003). They also found that harpin, when sprayed on mutant Arabidopsis plants deficient
in SAR regulatory genes, failed to induce SAR and plants were unable to produce the
HR. This emphasizes the requirement of the HR for SAR. A recent study found that
harpin, when combined with a bacteriophage, significantly reduced bacterial spot of
tomato caused by Xanthomonas campestris pv. vesicatoria and increased total marketable
yields (Obradovic et al., 2004). Two studies found that harpin significantly reduced blue

mold infection in apple caused by Penicillium expansum (de Capdeville et al., 2002 and

135

de Capdeville et al., 2003). Spraying plants with harpin three days before harvest in the
latter study found that harpin effectively reduced the infection by the pathogen that
causes fruit decay (and produces patulin, a carcinogenic mycotoxin) and could lead to
fewer post-harvest fungicide applications in apple production. Like chitosan, harpin is
able to protect against a broad range of phytopathogens. Also, because it is derived from
a bacterium, it is a low risk, biodegradable biopesticide considered much safer than
conventional pesticides. In this study in 2001, all four harpin treatments did not reduce
the incidence or severity of scab infections. Slight, yet significant, differences in the
production of chitinase, a commonly used marker for systemic acquired resistance, were
detected in tuber tissue. However, the greatest activity of chitinase was detected in the
tuber tissue from plants that were untreated; therefore, induced resistance is not
correlated with the low levels of scab infection on the tubers or any increases in the
amount of disease free tubers (Table 3-14). Although plant emergence in 2001 was not
fully uniform through early plant deve10pment at 14 and 16 days after planting (Table 3-
11), these slight differences had no effects on total tuber yield (Table 3-6) and were more
likely due to heterogeneity within the field or seed health rather than effects of resistance
activators. There were no negative effects of harpin on tuber yield or tuber size (Table 3-
6. Table 3-7, Table 3-8, Table 3-9, Table 3-10, and Figure 3-5). In 2002, harpin foliar
and in-furrow treatments did not decrease the incidence and severity of scab on tubers
(Figure 3-2), but neither treatment reduced the marketability of the tubers. Plant
emergence in 2002 was somewhat uniform during early plant development, but
differences were noted 31 days afier planting, but were more obvious by the time

germination had ceased and plants were last counted (Table 3-12). There were no

136

negative effects of harpin on tuber size or yield in 2002 (Table 3-6, Table 3-7, Table 3-8,
Table 3-9, Table 3-10, and Figure 3-6). In 2003 harpin in-furrow and foliar treatments
produced more than 10% fewer tubers in the 5% or less scab infection marketable
category (Figure 3-3), which suggests a possibility that harpin may have either negatively
affected the host by altering its response to infection by pathogenic Streptomyces species
or perhaps by favoring the group of pathogens in some unidentified manner.
Furthermore, harpin in-furrow and foliar applications resulted in nearly 10% increases in
severe scab infections in the 7.6-49% and 50-100% categories, respectively (Figure 3-3).
This also suggests that harpin treatments may favor scab development, although it is
possible that variability of pathogen populations and ideal soil conditions may have been
more prevalent in plots where plants were treated with harpin. Chitinase activity of tuber
tissue was highest for plants treated with foliar applications of harpin, which also
produced tubers with the highest scab severity of any treatment; therefore, no correlations
between chitinase activity and disease severity could be made (Table 3-14). Plant
emergence in 2003 was quite variable at 19 days after planting; however, these
differences were negligible by 27 days afier planting (Table 3-13). There were no
negative effects of harpin on tuber yield or size (Table 3-6, Table 3-7, Table 3-8, Table 3-
9, Table 3-10, and Figure 3-7).

Saponins are a diverse group of anti-fungal secondary metabolites that serve as
constitutive chemical defenses that ward off pathogenic microbes. Although primarily
produced by dicots, the saponins produced by oats are both steroidal and triterpenoid
saponins. Papadopoulou et al. (1999) found that oat mutants deficient in saponin

production had compromised resistance to disease and concluded that saponins were

137

involved in disease resistance. Another study by Haralampidis et al. (2001) published
similar findings using saponin-deficient mutants. The authors postulated that saponin
production may have been lost in many modern cereals during selection and suggests that
a gene involved in saponin production may be utilized in crops. Although one of the
requirements of resistance activators is that they are not antimicrobial, a recent review on
the mechanisms and applications of induced resistance cites examples of fungicidal
compounds as effective activators of resistance (Hammerschmidt, 2004). This suggests
that antimicrobial compounds may signal changes in the host response that lead to
increased resistance or that the fungicide application may result in the release of elicitors
by the pathogens or some other unidentified indirect mode of action. In this study, the
foliar application of saponins produced slightly more disease free tubers by a few percent
than the untreated control in 2002 (Figure 3-2). However, because these differences were
not substantially better than the control (Figure 3-2) and because only small increases in
chitinase activity were detected (Table 3-14), heterogeneity and variability of
environmental conditions and pathogen dispersal within the field more likely explain
these differences. Plant emergence, yield and tuber size were not negatively influenced
by treatment with saponins (Table 3-12, Table 3-6. Table 3-7, Table 3—8, Table 3-9, Table
3-10, and Figure 3-6). In 2003, saponin foliar and in-furrow treatments did not reduce
scab incidence or severity (Figure 3-3) and did not increase chitinase production in tubers
(Table 3-14). Plant emergence in 2003 was quite variable at 19 days after planting;
however, these differences were negligible by 27 days after planting (Table 3-13). There
were no negative effects of the natural compounds on tuber yield or size (Table 3-6,

Table 3-7, Table 3-8, Table 3-9, Table 3—10, and Figure 3-7).

138

F orrnononetin (7-hydroxy-4'-methoxyisoflavone, also known as 4'-O-
methyldaidzein) is an intermediate of bioactive isoflavonoids isolated from leguminous
plant species. Recently, peanut plants inoculated with Bradyrhizobium spp. responded by
production of two phytoalexins, medicarpin and formononetin (Azpilicueta et al. , 2004).
F ormononetin was active against Cladosporium cucumerinum and the authors concluded
that the phytoalexins were involved in defense against pathogen attack. In a recent study,
formononetin crown soak and soil drench applications increased the amount of vesicular
arbuscular mycorrhizae and reduced the percentage of lesions on roots on asparagus
caused by F usarium species (Elmer, 2002). In this study in 2002, foliar and in-furrow
applications of formononetin produced tubers with the highest detected chitinase
production (Table 3-14), yet with the least beneficial effects on reducing scab incidence
and severity. In fact, formononetin foliar applications significantly reduced the
percentage of tubers that had 5% or less scab infection when compared to the untreated
control (Figure 3-2); therefore, negatively affecting tuber marketability. Plant
emergence, yield, and tuber size were not affected by formononetin foliar and in-furrow
applications (Table 3-12, Table 3-6, Table 3-7, Table 3-8, Table 3-9, Table 3-10, and
Figure 3-6). In 2003, neither of the formononetin treatments substantially reduced scab
infection rate, severity, or induced resistance (Figure 3-3). Plant emergence in 2003 was
not influenced by formononetin treatments (Table 3-13). There were no negative effects
of formononetin on tuber yield or size (Table 3-6, Table 3-7, Table 3-8, Table 3-9, Table
3-10, and Figure 3-7).

Saponins, formononetin, chitosan, and harpin did not reduce infection when

challenged with Streptomyces scabies (Figure 3-9). The challenged tuber tissue was

139

necrotized at similar severities for all four natural compounds and application methods.
None of the treatments substantially reduced necrosis at any depth of tuber tissue that was
tested (Figure 3-9). When the chitinase activity of the challenged tissue was assessed,
none of the treatments resulted in an increased activity that correlated with a decrease in
scab incidence or severity of the harvested tubers (Figure 3-3) or the challenged tuber
tissue (Figure 3-9). The only treatment with significant increases in chitinase activity
after challenge by S. scabies was the harpin foliar treatment (Figure 3-10), which also
resulted in tubers with the highest scab incidence and severity of any of the nine
treatments in all 3 years tested. In this study, none of the treatments with natural
compounds were effective in reducing scab incidence or severity, inducing resistance, or
decreasing infections afier pathogen challenge. This indicates that other natural
compounds should be assessed, perhaps in combination with other scab disease
management strategies. It is likely that integrating strategies, such as combining
resistance activators with biocontrol agents, soil moisture management, cultivar
resistance, composts, or compounding more than one resistance activator may be
effective in reducing the severity of scab infections. The combined effects of harpin and
a bacteriophage were effective in reducing bacterial spot tomato (Obradovic et al., 2004).
The combined effects of Streptomyces melanosporofaciens and chitosan, a resistance
activator and grth stimulator of streptomycetes, (Clermont and Beaulieu, 2003) were
effective in reducing potato common scab. As these studies, and others, have
demonstrated, integrating strategies is critical to achieve effectiveness when using

resistance activators.

140

Chapter IV

EVALUATION OF FOUR ANTIMICROBIAL COMPOUNDS ON
GROWTH INHIBITION OF THREE S T REPT 0M Y CES S CABIES
STRAINS IN VIT R0.

INTRODUCTION

Chemical control of common scab of potatoes has been extensively studied, yet
there are no chemicals currently registered for scab control. The fungicide
pentachloronitrobenzene (PCNB) has been used to control common scab in many studies
(Curwen, 1980; Nugent, 1956; Curwen, 1978; Davis et al., 1974; Davis et al., 1976; Fink,
1956: Menzies, 1957; Potter et al., 1959: Hooker, 1954; and Houghland and Cash, 1954).
However, treatment with PCNB led to decreases in yield and phytotoxicity In addition,
PCNB was ineffective at low soil water potentials and required excessively high rates for
efficacy.

Analogues of daminozide (N-dimethylaminomaleamic and N- (dimethylamino)-
methylsuccinamic acids) were found to decrease scab incidence (McIntosh and Bateman,
1979). Another study tested 30 compounds in an attempt to identify an effective scab
control foliar spray. Of those tested, 3,5-dicholorphenoxyacetic acid (3,5 -D), was the
most effective. None of the other compounds tested were more effective than 3,5-D.
Some compounds that were as effective also demonstrated phytotoxicity (McIntosh et al.,
1985). Substituted benzoic and picolinic acids reduced scab in greenhouse experiments,
but they were also phytotoxic (McIntosh and Bateman, 1988). Forty quinones,
polyhydroxybenzenes and related derivatives were also tested against common scab

(McIntosh, 1976). Unsubstituted and phenyl-, chloro-, 2,5- and 2,6-dichloro-compounds

141

were effective as quintozene and 4-tert-butyl catechol was more effective, but yields
were sometimes reduced.

Captafol (McIntosh, 1977 and McIntosh, 1973) and ethionine (McIntosh and
Burrell, 1980) were effective in decreasing scab severity, with little to no reduction in
yield, but these are unavailable to control scab disease. Sulfur and soil fumigation with
Telone C-17 reduced Streptomyces soil rot, a disease of sweet potato caused by a related
pathogen, S. ipomoea. Fumigation proved effective, but the sulfur treatments
significantly reduced yield (Ristaino and Averre, 1992). More recently, efforts to control
common scab with sodium hypochlorite and thiophanate-methyl seed treatments
provided no significant reductions in scab infections (Errampalli and Johnston, 2000).

Few studies have evaluated antimicrobial chemicals in relation to in vitro
toxicities of Streptomyces scabies. Daminozide, even at high concentrations in potato
dextrose agar, was only weakly toxic to three S. scabies isolates. Quintozene (PCNB)
was much more toxic to S. scabies (McIntosh and Bateman, 1979). Six dichlorobenzoic
acids were tested against S. scabies. The 2,5-isomer was the most effective in controlling
scab in plants, yet was the least toxic in culture tests (McIntosh et al., 1988), indicating
that the control attained was not due to antibiotic activity of the compound and was
possibly an effect on the plant. McIntosh et al. (1981) and Burrell (1982) showed that
3,5-D was no more toxic in vitro than other disubstituted acids that were only slightly
active against scab development in field tests. Both studies suggested the mode of action
of the compound is alteration of the host, suggesting systemic acquired resistance could
have been involved in the reduction of infection. Due to the apparent ability of S. scabies

to grow and survive at high concentrations of broad ranges of microbicides, the goal of

142

this study is to examine the effects of four antimicrobial compounds on the growth of

three S. scabies strains in vitro.

143

MATERIALS AND METHODS

Rationale for the Design of Experiment

Four antimicrobial compounds were evaluated for their ability to inhibit growth of
Streptomyces scabies. Vancomycin, a glycopeptide antibiotic produced by Streptomyces
orientalis that interferes with cell wall synthesis (Nieto and Perkins, 1971), and
gentamicin, an aminoglycoside antibiotic produced by Micromonospora purpurea that
inhibits protein synthesis by binding to L6 protein of the 50 S ribosomal subunit (Lorian,
1986, Korzybski et al., 1978), were selected for evaluation. Both antibiotics target gram-
positive bacteria and they each have different modes of action. Pentachloronitrobenzene
(PCNB), which inhibits protein synthesis by reacting with —NH2 groups and —SH groups
of proteins (Agrios, 1997), and copper, which inactivates some enzymes and denatures
non-specific proteins (Cu2+ reacts with the sulthydryl groups of cysteine) (Agrios, 1997),
were selected for evaluation because both antimicrobial compounds are well-documented
agricultural pesticides. These four compounds were tested at five concentrations against

three Streptomyces scabies strains: 88-21, DP, and Onaway (Table 4-1).

Antimicrobial Compound Screening

PDA was purchased from Sigma Chemical Company (St. Louis, Missouri, USA)
and prepared as described by Sigma (39.0 g PDA mixture/l distilled water). Vancomycin
hydrochloride, gentamicin solution, PCNB, and copper (II) sulfate, pentahydrate (all

purchased from Sigma Chemical Company) were prepared at 0.1, 1, 10, 100, and 1000

144

ppm stock solutions. After sterilization when the PDA had cooled to 50°C, vancomycin,
gentamicin, PCNB, and copper sulfate were added at the five concentrations and stirred
with a magnetic stirrer to ensure equal distribution of the compound throughout the
medium. Each solution was applied in 25 ml aliquots into 100 mm x 15 mm polysterene
petri dishes. The medium was allowed to cool and surface was dried before use. Spores
were harvested fiom 12 day old cultures of Streptomyces scabies strains 88-21, DP, and
Onaway (grown at 30°C on PDA on 100 mm x 15 mm petri dishes in the dark) with a
sterile spatula. Spores were suspended in 0.1 % Tween® 80 (Sigma Chemical Company,
St. Louis, Missouri, USA) as a wetting agent due to their hydrophobicity. The
concentration was adjusted to 1010 spores/m1 with a hemacytometer. Two hundred
microliters of the spore suspension were inoculated onto the medium containing the
antimicrobial compounds with a glass spreader. The agar surface of the petri dishes was
allowed to dry, sealed with Parafilm® M (purchased from Sigma Chemical Company, St.
Louis, Missouri, USA), and stored in the dark at 22°C. Uninoculated media and
unamended media were used as average reflective intensity (see below) and negative
controls, respectively. Seven days after inoculation, growth of the isolates was assessed.
Twenty replications per each compound per concentration were tested against each S.

scabies strain in two independent trials.

145

TABLE 4-1. Concentrations, modes of action, and antimicrobial spectra
of four antimicrobial compounds tested in vitro against three Streptomyces

scabies strains.

 

 

Antimicrobial Compound Streptomyces scabies Mode of Antimicrobial
and Concentrations (in ppm) Strains Action Spectrum
Pentachloronitrobenzene Fungi;
0.1 Gram-positive
1 protein bacteria;
10 88-21, DP, Onaway synthesis Gram-negative
100 inhibitor bacteria;
1000 mycoplasmas
Vancomycin hydrochloride
0.1
1 cell wall Gram-positive
10 88-21, DP, Onaway synthesis bacteria
100 inhibitor
1000
Gentamicin sulfate
0.1 Gram-positive
1 ' protein bacteria;
10 88-21 , DP, Onaway synthesis Gram-negative
100 inhibitor bacteria;
1000 mycoplasmas
Copper (ll) sulfate
0.1 enzyme
1 inactivation; Fungi;
10 88-21, DP, Onaway protein Gram-negative
100 denaturation bacteria;
1000

Image Analysis of Growth Inhibition

Seven days after inoculation, petri dishes were scanned using a HP Scanjet® 3670
Scanner (Hewlett-Packard Development Company, LP, Palo Alto, California, USA)
using the highest resolution and color photograph settings so that the images could be
used for image analysis. Two parameters, average reflective intensity (ARI) values and

area of growth, were used to evaluate the effects of the compounds on the growth

146

inhibition of the Streptomyces scabies strains. ARI values, which are based on how light
or dark a pixel is and the intensity of light that is reflected from each pixel, were
determined using the Sigma Scan Pr05® image analysis software program (SPSS UK,
Surrey, UK). All petri dish images were calibrated based on size and analyzed with the
same light intensity and manual threshold settings for the ARI measurement to ensure all
images were identically measured . Growth area measurements were made using the
APS Assess® image analysis software (American Phytopathological Society Press, St.
Paul, Minnesota, USA). All petri dish images were calibrated based on size and analyzed
under identical settings of intensity and leaf as area of interest setting (medium and
bacteria were analyzed as leaves and lesions, respectively) to ensure consistency amongst

measurements.

Data Analysis

Average growth area and average reflective intensity data from the trials of the
four compounds were analyzed with a t-test with comparison of least significant
difference to determine the differences between growth inhibition compared across the
concentrations tested. For all statistical analyses, an outcome was deemed statistically
different at the confidence interval of 5% or less (alpha = 0.05). The LSD (least
significant difference) of the means for t-tests were conducted using SAS® version 8

software (SAS Institute, Inc.; Cary, North Carolina).

147

RESULTS

Copper (11) sulfate

Copper sulfate at 0.1 ppm only slightly reduced the growth of the Streptomyces
scabies strain DP from 7,652 mm2 to 7,397 mm2 (Table 4-2). Although this difference in
growth was significant from the untreated control, 0.1 ppm clearly had no apparent
inhibitory effects on DP. An increase in copper sulfate to 1.0 ppm further inhibited
growth of DP to 7,115 mmz. However, a ten-fold increase to 10 ppm did not
substantially decrease growth any further than 0.1 ppm since statistical analysis found 1.0
and 10 ppm to result in similar areas of growth (Table 4-2). At 100 ppm, the average
growth area of DP was further inhibited to 6,659mm2. Only at 1,000 ppm was the growth
of DP completely inhibited (Table 4-2). When average reflective intensity (ARI) data
were used to analyze the growth of DP, no significant differences were found between
the untreated control (0 ppm) and 0.1 ppm c0pper sulfate, which were 156 units and 15 3
units, respectively (Table 4-3). Detectable reductions in growth were found with ARI
values of DP when grown on copper sulfate at 1.0 ppm (Table 4-3). ARI measurements,
like the growth measurements, found 10 ppm and 100 ppm to have similar effects of
grth inhibition of DP (Table 4-2 and Table 4-3). ARI values for DP grown on medium
amended with 1,000 ppm copper sulfate were drastically lower than all of the other ARI
values determined for the other concentrations of this compound (Table 4-3).

The S. scabies strain 88-21 responded similarly to DP when grown on medium
amended with 0.1 ppm copper sulfate. Although growth was statistically different from

2

the untreated control (reduced from 7,730 mm2 on unamended medium to 7,395 mm on

0.1 ppm copper sulfate), the difference in growth was not substantial (Table 4-2). Copper

148

sulfate at 1.0 and 10 ppm significantly reduced the growth of strain 88-21 to levels that
were statistically identical at 6,993 mm2 and 6,803 mmz, respectively (Table 4-2). Like
DP, 88-21 was even further inhibited to 6,486 mm2 as the concentration of copper sulfate
was increased to 100 ppm (Table 4-2). The growth of strain 88-21 was completely
inhibited at 1,000 ppm copper sulfate (Table 4-2). When ARI values are used to compare
the effects of copper on growth of 8821, no significant differences were found between 0
and 0.1 ppm (Table 4-3). Differences in grth were detected when copper sulfate was
used at 1.0 ppm, as the ARI values for the untreated control and 0.1 ppm copper sulfate
were 154 units, and was reduced to 145 units with the ten-fold increase to 1.0 ppm (Table
4-3). Copper sulfate at concentrations of 10 and 100 ppm decreased ARI values both
significantly and incrementally (Table 4-3). The no growth ARI values for strain 88-21
were significantly reduced at 1,000 ppm copper sulfate when compared to 100 ppm
(Table 4-3).

Similar to the results of the other two S. scabies strains, the growth of Onaway
was significantly reduced from 7,661 mm2 to 7,023 mm2 when grown on medium
amended with 0.1 ppm copper sulfate (Table 4-2). Copper sulfate at 1.0 ppm
significantly reduced the growth of the Onaway strain even further to 6,819 mm2 (Table
4-2). Unlike the other strains, however, the average growth area of Onaway at 10 ppm
and 100 ppm of coma sulfate produced statistically similar results at 6,523 mm2 and
3,633 mmz, respectively. For the other two strains, 100 ppm copper sulfate resulted in a
statistically significant reduction in growth when compared with 10 ppm (Table 4-2).
Consistent with the results of the other two strains, medium amended with 1,000 ppm

copper sulfate completely inhibited the growth of Onaway (Table 4-2). When ARI data

149

were used to compare the effects of copper sulfate on growth inhibition of Onaway, quite
different results were obtained when compared to the strains DP and 88-21. ARI values
were not significantly different from the untreated control and 0.1, 1.0, and 10 ppm
copper sulfate at 168, 169, 167, and 161 units, respectively (Table 4-3). Differences in
growth were detectable with ARI values obtained for 100 ppm copper sulfate (Table 4-3).
Consistent with the other strains, ARI values for Onaway were significantly reduced at

1,000 ppm copper (Table 4-3).

TABLE 4-2. Comparison of effects of five concentrations of copper (H) sulfate
on the average area of growth of three Streptomyces scabies strains.

S. scabies 0.1 ppm 1.0 ppm 10 ppm 100 ppm 1000 ppm 0 ppm
strain A (mm2)iSE A (mmz):SE A (mmz):SE A (mm2)1SE A (mmz):SEA (mmz):SE

 

DP 7397 54.2 b 7115 40.5 c 7080 40.3 c 6659 96.0 d 0 e 7652 31.1 a
88-21 7395 66.8 b 6993 73.0 c 6803 64.8 c 6486 147.5 d 0 e 7730 29.6 a

Onaway 7023 81.1 b 6819 76.3 b 6523 43.4 C 6366 130.7 c 0 d 7661 39.2 a

A area

SE standard error of the mean

Effect of strain was significant according to AN OVA at a = 0.05.

Means with the same letter are not significantly different according to t-test at
a=005

150

TABLE 4-3. Comparison of effects of five concentrations of copper (II)
sulfate on the growth of three Streptomyces scabies strains as determined
by average reflective intensity.

8. scabies 0.1 ppm 1.0 ppm 10 ppm 100 ppm 1000 ppm 0 ppm
strain ARI:SE ARI:SE ARI:SE ARI_+_SE ARI 1 SE ARI :SE

 

DP 153 2.0a 151 1.9 ab 1401.9 b 1412.6 b 42 (NG) 0.4 c 156 1.7 a
88-21 154 3.0 a 145 2.8 ab 137 2.5 be 128 3.1 c 43 (NG) 0.4 d 154 3.3 a

Onaway 169 1.8 a 167 1.4 a 161 1.9 a 129 5.4 b 43 (NG) 0.3 C 168 2.0 a

ARI average reflective intensity

SE standard error of the mean

NG No growth detected

Effect of strain was significant according to ANOVA at a = 0.05.
Means with the same letter are not significantly different according to
t-test at a = 0.05.

Gentamicin

Without antibiotics, strain DP grew at an average area of 7,652 mm2 (Table 4-4).
Addition of 0.1 ppm gentamicin to the medium significantly reduced the grth to 6,999
mm2 (Table 4-4). A ten-fold increase of gentamicin to 1.0 ppm did not further decrease
the growth of DP, and the amount of growth at this concentration was very similar to the
growth that resulted from 0.1 ppm gentamicin (Table 4-4). Gentamicin at 10, 100, and
1,000 ppm completely inhibited the growth of DP (Table 4-4). The ARI of DP without
gentamicin was 156 units (Table 4-5). This value was significantly reduced to 135 and
136 units for 0.1 and 1.0 ppm gentamicin, respectively (Table 4—5). The ARI values did

not detect differences in growth between 0.1 and 1.0 ppm concentrations. ARI values

151

were similar across all three gentamicin concentrations that resulted in no growth (Table
4-5).

The growth of S. scabies strain 88-21 was significantly reduced from 7,730 mm2
on the unamended medium to 1,034 mm2 when 0.1 ppm gentamicin was added (Table 4-
4). Increasing the antibiotic concentration to 1.0 ppm further decreased the average
growth area of 88-21 to 6,227 mm2 (Table 44). Like DP, 88-21 was unable to grow on
gentamicin at concentrations of 10, 100, and 1,000 ppm (Table 4-4). Strain 88-21 has an
ARI value of 154 units when grown without antimicrobial compounds (Table 4-5). This
value was significantly reduced to 148 and 140 units, respectively when 0.1 and 1.0 ppm
gentamicin was added to the growth medium (Table 4-5). As with DP, differences in
growth between 0.1 and 1.0 ppm gentamicin were not detected with ARI values (Table 4-
5). ARI values for 10, 100, and 1,000 ppm gentamicin, concentrations that resulted in no
growth, were very similar Table (4-5).

The effects of gentamicin on Onaway were similar to the 88-21 strain.
Gentamicin at 0.1 ppm concentration significantly reduced growth when compared to the
untreated control from 7,661 mm2 to 6,514 mm2 (Table 4-4). When the concentration of
gentamicin was increased to 1.0 ppm, the average growth area of Onaway was further
significantly inhibited to 6,018 mm2 when compared to the growth that resulted from
treatment with 0.1 ppm gentamicin (Table 4-4). Consistent with the responses to the
other two strains, Onaway was unable to grow in the presence of 10, 100, and 1,000 ppm
gentamicin (Table 4-4). The growth of Onaway was reduced significantly from 168 units
without gentamicin to 145 units with the addition of 0.1 ppm gentamicin. Medium

amended with 1.0 ppm gentamicin did not further decrease growth according to the ARI

152

values (Table 4-5). The ARI values were consistent at 10, 100, and 1,000 ppm, which

were categorized as no growth detected (Table 4-5).

TABLE 4-4. Comparison of effects of five concentrations of gentamicin on the
average area of growth of three Streptomyces scabies strains.

8. scabies 0.1 ppm 1.0 ppm 10 ppm 100 ppm 1000 ppm 0 ppm
strain A (mm2) 1 SE A (mm2) 1 SE A (mm2)1SE A (mm2)1SE A (mm2)1SE A (mm2) 1 SE

 

DP 6999 50.6 b 6930 67.8 b 0 c 0 c 0 c 7652 31.1 a
88-21 7034 71.3 b 6227 172.9 c 0 d 0 d 0 d 7730 29.6 a
Onaway 6514 221.4 b 6018 197.5 c 0 d 0 d 0 d 7661 39.2 a
A area of growth

SE standard error of the mean

Effect of strain was significant according to ANOVA at a = 0.05.

Means with the same letter are not significantly different according to t-test at
a=005

TABLE 4-5. Comparison of effects of five concentrations of gentamicin on the
growth of three Streptomyces scabies strains as determined by average reflective
intensity.

8. scabies 0.1 ppm 1.0 ppm 10 ppm 100 ppm 1000 ppm 0 ppm
strain ARI1SE ARI1SE ARI 1 SE ARI 1 SE ARI 1 SE ARI1SE

DP 135 3.1 b 136 4.0 b 48(NG) 0.1 C47 (NG) 0.2 c 43 (NG) 0.1 c 156 1.7 a
88-21 138 5.2 b 140 3.1 b 43 (NG) 0.1 C44 (NG) 0.2 c 43 (NG) 0.1 c 154 3.3 a

Onaway 145 4.0 b 144 3.9 b 45 (NG) 0.1 c 43 (NG) 0.4 c 43 (NG) 0.1 c 168 2.0 a

ARI average reflective intensity

SE standard error of the mean

Effect of strain was significant according to ANOVA at a = 0.05.

Means with the same letter are not significantly different according to t-test at
a = 0.05.

153

Pentachloronitrobenzene

Pentachloronitrobenzene (PCNB) at 0.1 ppm significantly reduced the growth of
strain DP to 7,369 mm2 when compared to the untreated control at 7,652 mm2 (Table 4-
6). When the concentration of PCNB was increased to 1.0 ppm, growth was again
significantly reduced to 7,121 mmz; however, an increase to 10 ppm reduced the growth
to 6,905 mm2, which was not statistically different from growth that resulted from 1.0
ppm PCNB. Growth of DP was significantly reduced at 100 ppm PCNB when compared
to the 1.0 and 10 ppm concentrations. Only the 1,000 ppm PCNB treatment completely
inhibited the growth of DP (Table 4-6). When ARI data were evaluated, no differences
in grth of strain DP were found between 0 and 0.1 ppm PCNB, which were 156 and
151 units, respectively (Table 4-7). ARI values for 1.0, 10, and 100 ppm were 122, 122,
and 123 units, respectively (Table 4-7). These values were statistically identical and
were significantly smaller than the ARI values determined for 0 and 0.1 ppm PCNB
(Table 4-7). The ARI value for no growth (1 ,000 ppm), 43 units, was much smaller
compared to the other ARI values for which growth did occur (Table 4-7).

The growth of strain 88-21 was significantly reduced from 7,730 mm2 to 7,057
mm2 when 0.1 ppm PCNB was added to the medium (Table 4-6). The average growth
area was slightly reduced to 6,955 mm2 with PCNB at a 1.0 ppm concentration; however,
this difference was not statistically significant (Table 4-6). The area of growth of 88-21
was substantially further reduced to 6,430 mm2 with PCNB at 10 ppm and was again
reduced to 5,851 mm2 when the concentration of PCNB was increased to 100 ppm (Table
4~6). PCNB completely inhibited the growth of 88-21 at the 1,000 ppm concentration

(Table 4-6). The ARI value for growth of strain 88-21 grown on medium amended with

154

0.1 ppm was reduced from 154 units to 144 units (Table 4-7). The ARI value for the 1.0
ppm PCNB treatment was ftuther reduced to 141 units, which was statistically different
from the 0.1 ppm value (Table 4-7). The 10 and 100 ppm concentrations of PCNB
further reduced ARI values of 96 and 83 units, respectively, which were both statistically
significant (Table 4-7). When the concentration of PCNB was increased to 1,000 ppm,
the ARI value was severely diminished to 45 units (Table 4-7).

The average growth area of Onaway was significantly reduced from 7,661 mm2 to
7,063 mm2 with the addition of 0.1 ppm PCNB to the growth medium (Table 4-6). When
the concentration of PCNB was firrther increased to 1.0 ppm, the average growth area of
Onaway was not significantly reduced (Table 4-6). At concentrations of 10 and 100 ppm
PCNB; however, growth was significantly reduced to 5,004 mm2 and further reduced to
4,055 mmz, respectively (Table 4-6). Like the other two strains, treatment of Onaway
with 1,000 ppm PCNB resulted in no growth (Table 4-5). The ARI values obtained for
Onaway grown in the presence of 0.1 ppm PCNB were significantly reduced from 168 to
159 units when compared to the untreated control (Table 4-7). An increase in
concentration to 1.0 ppm significantly reduced the ARI value to 99 units (Table 4-7).
PCNB and 10 and 100 ppm concentrations each significantly reduced ARI values to 72
and 52 units, respectively (Table 4-7). The ARI values determined for 1,000 ppm PCNB
were consistent with the ARI values of other treatments that resulted in no growth (Table

4-7).

155

TABLE 4-6. Comparison of effects of five concentrations of pentachloronitro-
benzene on the average area of grth of three Streptomyces scabies strains.

8. scabies 0.1 ppm 1.0 ppm 10 ppm 100 ppm 1000 ppm 0 ppm
strain A (mm2) 1 SEA (mm2) 1 SEA (mm2) 1 SEA (mm2) 1 SE fimm2)1SEA (mm2) 1 SE

 

DP 7369 56.0 b 7121 58.7 c 6905 50.5 c 6172 164.3 d 0 e 7652 31.1 a
88-21 7057 74.9 b 6955 86.9 b 6430 40.1 c 5851 198.3 d 0 e 7730 29.6 a

Onaway 7063 47.9 b 6877 42.0 b 5004 316.1 c 4055 312.9 d 0 e 7661 39.2 a

A area of growth

SE standard error of the mean

Effect of strain was significant according to ANOVA at a = 0.05.

Means with the same letter are not significantly different according to t-test at
a=005

TABLE 4-7. Comparison of effects of five concentrations of pentachloro-
nitrobenzene on the growth of three Streptomyces scabies strains as
determined by average reflective intensity.

8. scabies 0.1 ppm 1.0 ppm 10 ppm 100 ppm 1000 ppm Oppm
strain ARI1 SE ARI1 SE ARI 1 SE ARI 1 SE ARI 1 SE ARI1 SE

 

DP 151 3.0 a 122 2.3 b 122 2.6 b 123 4.5 b 43 (NG) 0.2 c 156 1.7 a
88-21 144 2.7 ab 141 2.5 b 96 1.0 c 83 1.4 d 45 (NG) 0.3 e 154 3.3 a

Onaway 159 2.5 b 99 2.2 c 72 1.4 d 52 0.4 e 42 (NG) 0.2f 168 2.0 a

ARI average reflective intensity

SE standard error of the mean

Effect of strain was significant according to AN OVA at a = 0.05.
Means with the same letter are not significantly different according to
t-test a= 0.05.

156

Vancomycin

The average area of growth of DP was inhibited to 7,265 mm2 when grown on a
medium amended with 0.1 ppm vancomycin (Table 4-8). When the concentration of
vancomycin was increased ten-fold, grth was completely inhibited (Table 4-8). DP
was unable to grow at 1.0, 10, 100, and 1,000 ppm concentrations of vancomycin (Table
4-8). The ARI values obtained for growth of DP on medium amended with 0.1 ppm
vancomycin averaged 113 units, which was significantly reduced when compared to the
untreated control (Table 4-9). The ARI values obtained from 1.0, 10, 100, and 1,000
ppm concentrations, all which resulted in no growth, were similar (Table 4-9).

The average growth area of 88-21 was significantly reduced from 7 ,730 mm2 to
7,477 mm2 when grown in the presence of 0.1 ppm vancomycin (Table 4-8). Like DP,
the 88-21 strain was completely inhibited when inoculated on medium amended with 0.1,
10, 100 and 1,000 ppm concentrations of vancomycin (Table 4-8). The averaged ARI
value for 88-21 grown on medium containing 0.1 ppm vancomycin was not significantly
reduced when compared to the untreated control; however, it was significantly reduced
for the other concentrations (Table 4-9). The ARI values for 1.0, 10, 100, and 1,000 ppm
vancomycin were consistent with each other (Table 4-9).

The average growth area of Onaway was significantly reduced from 7,661 mm2 to
7,302 mm2 when grown on a medium containing 0.1 ppm vancomycin (Table 4-8). As
was demonstrated with the other two strains, no growth was detected for Onaway at 0.1,
10, 100, and 1,000 ppm vancomycin (Table 4-8). The ARI value for the growth of
Onaway at 0.1 ppm vancomycin was 107 units (Table 4-9). This value was significantly

lower than the untreated control, which averaged 168 units (Table 4-9). The ARI values

157

for 0.1, 10, 100, and 1,000 ppm vancomycin were significantly lower than the 0.1 ppm

ARI value (Table 4-9).

TABLE 4-8. Comparison of effects of five concentrations of vancomycin on
the average area of growth of three Streptomyces scabies strains.

S. scabies 0.1 ppm 1.0 ppm 10 ppm 100 ppm 1000 ppm 0 ppm
strain A (mm2) 1 SE A (mm2) 1 SE A (mm2)1SE A (mm2)1SE A (mm2)1SE A (mm2) 1 SE

 

DP 7265 61.9 b 24 11.4 c 0 c 0 C 0 c 7652 31.1 a
88-21 7477 74.8 b 40 12.8 c 0 c O c 0 C 7730 29.6 a

Onaway 7302 65.6 b 31 11.9 c 0 C 0 c 0 c 7661 39.2 a
A area of growth

SE standard error of the mean

Effect of strain was significant according to ANOVA at a = 0.05.

Means with the same letter are not significantly different according to t-test at
a = 0.05.

158

TABLE 4.9. Comparison of effects of five concentrations of vancomycin on the
grth of three Stretpomyces scabies strains as determined by average reflective
intensity.

 

S. scabies 0.1 ppm 1.0 ppm 10 ppm 100 ppm 1000 ppm Oppm
strain ARI1SE ARI 1 SE ARI 1 SE ARI 1 SE ARI 1 SE ARI1SE

DP 113 6.5 b 45 (NG) 0.6 c 45 (NG) 0.1 c 44 (NG)0.1 c 48 (NG) 0.1 c 156 1.7 a
88-21 161 3.7 a 42 (NG) 0.2 b 42 (NG) 0.1 b 47 (NG)0.1 b 45 (NG) 0.1 b 154 3.3 a

Onaway 107 6.7 b 42 (NG) 0.4 c 44 (NG) 0.1 c 48 (NG)0.1 c 49 (NG) 0.1 c 168 2.0 a

ARI average reflective intensity

SE standard error of the mean

Effect of strain was significant according to ANOVA at a = 0.05.

Means with the same letter are not significantly different according to t-test a= 0.05.

159

DISCUSSION

There is a wealth of more than 50 years of literature on testing chemicals to
control potato common scab. However, there are no effective chemicals registered to
manage this disease, which already has a limited number of available control measures.
C0pper sulfate probably has the longest history of use of any antimicrobial agent to aid in
plant disease control (Agrios, 1997). In the mid-1700s, c0pper sulfate was used in
England to control wheat smut (Agrios, 1997). In 1885, Millardet, noticed an effect of a
mixture farmers were using on their grapes to discourage pilferers, and determined that
copper sulfate and hydrated lime was very effective in controlling downy mildew. This
became known as the Bordeaux mixture and was used to manage diseases of many other
plants. The Bordeaux mixture remains as one of the most widely used fungicides
worldwide (Agrios, 1997). The Bordeaux mixture, fixed coppers and cupric hydroxide
are also used to manage a broad spectrum of bacterial leaf spots, blights and other
diseases caused by bacteria. In this study, copper sulfate was effective in vitro in
inhibiting S. scabies strains only at 1,000 ppm. However, such a high concentration as
this, if tested on potato plants inoculated with S. scabies, would most certainly lead to
phytotoxicity and hence, reduce yield. In this study, the data obtained for the average
area of growth determined by digital analysis were more precise in determining
differences in concentrations of copper sulfate than ARI data, which were also
determined by digital analysis. The average growth area data were more precise and

statistical differences were more accurate than the ARI data.

160

In the late 1990s, a Mexican company applied for registration of an agricultural
formulation of gentamicin with the US. Environmental Protection Agency (EPA).
Currently, the formulation is used in Mexico and Central America on a variety of crops to
control fire blight in field tests (McManus and Stockwell, 2001). Gentamicin is clinically
very important in treating a wide variety of human infections. The EPA and Center for
Disease Control questioned all antibiotic use on plants, and in October of 1999, the
request for registration of gentamicin for use on crop plants in the US. was denied.
Currently, the only antibiotics registered in the US. for use on plants are streptomycin
and oxytetracycline (Agrios, 1997). In this study, gentamicin was effective at 10 ppm in
complete inhibition of growth of the three S. scabies strains tested. Again, image
analysis data using the average growth areas were more precise than the ARI data in
detecting differences between the different concentrations of gentamicin tested. Because
the registration of this antibiotic was not accepted, it is unknown how well this antibiotic
would work in the soil, and it is not known if gentamicin could control the disease in
planta, other methods of controlling the disease are needed.

Vancomycin, often referred to as the last resort antibiotic in medicine, is clinically
one of the most important antibiotics in treating human infections caused by bacteria such
as Staphylococcus aureus or Clostridium diflicile. Produced by Streptomyces orientalis,
vancomycin is only effective against gram-positive bacteria, such as Streptococci,
Corynebacteria, Clostridia, Listeria, and Bacillus species. In this study, vancomycin was
able to severely reduce growth of S. scabies at a low concentration and completely
inhibited growth of all three S. scabies strains at a minimal concentration of 1.0 ppm.

Like the data obtained from the other antimicrobial agents, average area as determined by

161

digital analysis were better indicators of differences found between the different
concentrations of vancomycin tested rather than the ARI data. The fact that ARI values
did not find differences in growth between 0 and 0.1 ppm vancomycin illustrates this
notion.

Pentachloronitrobenzene (also known as PCNB, Blocker, Terraclor, Terraclor
Super X, Quintozene and Tritisan) was effective in controlling common scab in many
studies (Curwen, 1980; Nugent, 1956; Curwen, 1978; Davis et al., 1974; Davis et al.,
1976; Fink, 1956: Menzies, 1957; Potter et al., 1959: Hooker, 1954; and Houghland and
Cash, 1954). PCNB treatments also led to phytotoxicity, were ineffective at low soil
water potentials, and effectively decreased scab infections only with excessively high
application rates. The long lasting soil fungicide is primarily used against Rhizoctonia
and Plasmodiophora to control vegetable, turf, and ornamental diseases (Agrios, 1997).
The results in this dissertation are consistent with results of other studies in that only the
highest dose was able to inhibit growth of the three S. scabies strains tested. The lower
concentrations were ineffective. Again, digital analyses were more accurate in
determining differences between PCNB concentrations when the average area data were
used. If tested in planta, the 1,000 ppm concentration (2,719 lbs/A or 3,045 kg/ha),
which effectively inhibited growth of S. scabies in vitro, would most likely have
phytotoxic effects and hence, negative effects on yield.

The three strains used in this study all responded similarly to the antibiotics at the
five concentrations at which they were tested. Small differences were noted occasionally,
but no apparent differences occurred. This suggests that it may be possible, when

screening antimicrobial compounds against S. scabies, to gain accurate results by using a

162

small number of strains during the screening process. In this study, PDA worked well as
the growth medium to which antibiotics were added. This is consistent with another
study that screened antimicrobial agents against S. scabies using PDA as the screening
medium (McIntosh and Bateman, 1979). Based on the results obtained by digital
analysis for average area of grth and ARI, it was determined that the average growth
area was a better predictor than ARI of differences in growth between the five
concentrations of the four antimicrobial compounds tested against the three strains.
Furthermore, using digital analysis to determine growth area is a model system that
should work well for most organisms instead of measuring them with a caliper or any
other manual means of obtaining growth measurements.

This study found that S. scabies was able to grow at high concentrations of two
agriculturally important antimicrobial agents, copper sulfate and PCNB. Gentamicin and
vancomycin, antibiotics targeted against gram-positive bacteria, were both effective in
eliminating growth of S. scabies at low concentrations. The results from this study
indicate that only very high concentrations of agriculturally important broad-spectrum
microbicides are effective in eliminating growth of the scab causal agent. In addition,
antibiotics targeted specifically toward gram-positive bacteria, were effective, but not at
lower concentrations, in growth inhibition of S. scabies. More studies are needed, but it
is likely that only very specific antibiotics targeted toward this group of organisms will be
the only compounds that will effectively eliminate growth at concentrations less than 100
ppm. Also, it is important to sample soils to find strains of bacteria that can adapt to soils
and produce scab inhibitory antibiotics in the rhizosphere soil. This may lead to the

development of an effective biocontrol agent against plant pathogenic streptomycetes.

163

Furthermore, these antibiotics are not fit for use in agriculture. The results of this study
imply that disease management methods other than chemical control must be investigated
for potato common scab due to the pathogen’s ability to grow well at high concentrations

of broad-spectrum microbicides.

164

CONCLUDING REMARKS: SUMMARY OF THE DISSERTATION
AND FUTURE RESEARCH

Summary of the Dissertation

Researchers, plant disease diagnosticians, extension agents, and growers rely
upon rapid, reliable, and precise results from assays used for pathogen detection. Many
of the current techniques used for plant pathogen detection involve extraction of nucleic
acids following time-efficient nucleic acid detection methods (Louws et al., 1999; Schaad
and Frederick, 2002; and Schena et al., 2004). Understanding the distribution, as well as
quantity, of plant pathogens in a given unit area of land may enable risk reduction, site
specific disease management strategies and profit maximization through decreased
pesticide management costs and increased crop yields as well as increased marketability.
Chapter 1, “Evaluation of PCR-Based Detection of Pathogenic Streptomyces Species in
Soil Populations of Michigan’s Major Potato Production Counties and Assessment of
Real Time PCR as a Method For Pathogen Quantification,” examined the usefulness of
two nucleic acid based detection methods for use in the potato-Streptomyces patho-
system (Chapter I).

This study has provided evidence that supports a more time-effective technique
than previously described methods for the detection of pathogens responsible for causing
potato common scab. This method was tested in numerous locations in Michigan and
was repeated for four years. PCR detection of nec1, a gene highly correlated with plant
pathogenicity in the genus Streptomyces (Bukhalid and Loria, 1997; Bukhalid et al.,
1998; Bukhalid et al., 2002; Healy et al., 1999; Kreuze et al., 1999; and Park et al., 2003)

was an effective method for the detection of pathogenic streptomycetes without

165

performing laborious and time-consuming pathogenicity tests on potato tubers (Chapter
I). F urthermore, this study supports the findings of other studies that have found plant
pathogenic Streptomyces species to be ubiquitously present in soil microorganism
populations (Chapter 1). Other researchers have provided evidence that the pathogens
have even been detected in soils not previously cropped to potato (Loria, 2001 and Loria
etal,l997)

In addition, the study also integrated quantification of pathogenic Streptomyces
species directly from soil using quantitative real-time PCR for detailed results that may
eventually be useful in cases where specific diagnostics of plant pathogens are required
(Chapter I). Precise estimations of pathogen populations may become increasingly
important in plant disease diagnostics and management, particularly for diseases with
limited control measures and especially as the introduction of alien pathogens into new
geographical areas, such as Phakopsora pachyrhizi (causal agent of soybean rust),
becomes more prevalent and threatening to agricultural and horticultural plants as well as
plants in natural ecosystems. However, the expense of quantitative real time PCR will
likely negate its ability for frequent use as a diagnostic tool for the majority of plant
diseases and its use may be limited to diseases such as soybean rust and sudden oak
death. Because classical PCR can provide precise and accurate information, the
quantitative techniques may not be used nearly as often for other plant pathogens until the
costs are reduced.

Chapter 11, “Assessment of Cultivar Resistance and Soil Moisture Application as
a Means to Manage Potato Common Scab,” uniquely investigated the effects of an

integration of cultivar resistance and soil moisture application on potato common scab.

166

This study provides evidence that cultivar resistance is the most effective method of
managing potato common scab. This study, like other reports that span the literature for
more than 80 years, found that soil moisture applied at or near field capacity was able to
significantly reduce the severity of scab infections on susceptible cultivars. I also found
that integrating cultivar resistance into a potato production regime might negate irrigating
soils to such high soil moisture volumes (Chapter 11).

Similar to other studies, I found that only the high soil moisture volumes were
effective in reducing scab infections on susceptible cultivars (Chapter II). Soil moisture
applied at lower percentages only slightly reduced scab infections on susceptible
cultivars. In addition, my work supports the findings of other researchers who have
concluded that soil moisture must be applied continuously during the critical susceptible
period, and that allowing the soil to dry can lead to scab infections during the periods in
which drier soil conditions were investigated.

The uniqueness of my research comes from examination of the results obtained
from experiments in which the scab resistant cultivar, Liberator was used (Chapter II).
This study provides direct evidence that supports the possibility that moderate to high
levels of irrigation are probably not necessary to reduce scab infections when a cultivar
with a high level of scab resistance is planted. This is increasingly important since
irrigation that reduces scab infections on susceptible cultivars is not always highly
efficient because of soil moisture evaporation, which is accelerated in warmer
temperatures, as well as the water repellent nature of certain soils, which also increases as
temperature increases. These factors and others often lead to irrigation of susceptible

cultivars that is reached with an undesirable level of effectiveness. Also, as irrigation

167

becomes restricted in certain geographical areas and because limited water resources are
an emerging problem worldwide, this may become a concern in the near future,
especially as water usage peaks as a crucial issue, particularly in regions where water is
extremely limited. Furthermore, water quality concerns arising flom irrigation have been
continually raised due to the leaching of dangerous pesticides and fertilizers into ground
water that occurs with events of heavy irrigation. Clearly, continuously irrigating soils to
high soil moisture volumes for potato common scab management may soon become a
concept of the past as these issues surrounding water quality and water use are
increasingly critical.

Chapter III, “Assessment of Four Compounds on Elicitation of the Systemic
Acquired Resistance Response in Potato to Common Scab Infection,” provides what may
be the most detailed study to address the feasibility of systemic acquired resistance in
potato to common scab (Chapter HI). Chitosan and harpin, well-documented resistance
activators, caused slight reductions of common scab infection as well as slight increases
in harvested tubers flee of scab infections for some of the treatment methods tested in the
first trial. However, a lack of increased chitinase activity in the tubers indicated that the
decrease in disease was not due to systemic acquired resistance (SAR). In other words,
chitinase activities were not increased in the tubers that were sampled flom the treatments
that exhibited fewer scab infections (Chapter ID). This suggested that SAR was not
directly responsible for these differences and that other factors, such as reduced pathogen
populations or patchy soil moisture may better explain these changes.

However, these results were not consistently reproduced in the two trials that

followed. Chitosan and harpin treatments in the second and third trials did not support

168

result in reduced scab. There were no reductions in scab infections, no increases in the
quantity of tubers flee of scab infections, and systemic resistance was not induced in
tuber tissue. Furthermore, some of the treatments responded more poorly than the
untreated control to treatments with harpin, particularly for tubers that were categorized
as having severe common scab infections (Chapter HI). Forrrrononetin and saponins,
both natural plant-based compounds, were also tested in two of the trials as two different
application methods. Neither compound significantly reduced scab infections or
increased the numbers of scab flee tubers. Chitinase activities were not increased in
tissues treated with formononetin or saponins.

Although slight increases in tubers flee of scab infection occurred in the first trial,
increased chitinase activities were not correlated with these differences. Slight weather
differences between the first, second, and third trials may explain some of the variability
observed. It is likely that some of the treatments that responded well the first year were a
result of weather conditions less favorable for scab development compared to the two
following years as well as pathogen variability within a field. The lack of severe
infections in the first trial compared to the following two trials supports this conclusion.

Chapter IV, “Evaluation of Four Antimicrobial Compounds on Growth Inhibition
of Three Streptomyces scabies Strains In Vitro,” provides one of the more extensive
studies on antimicrobial compounds directly tested against S. scabies.
Pentachloronitrobenzene (PCNB) and copper sulfate, pesticides with significant
agricultural use, were barely effective in reducing growth at the all but the highest
concentration tested. These slight reductions in growth that occurred flom each ten-fold

increase in concentration were difficult to detect with the unaided eye, however, the use

169

of computerized image analysis enabled detection of slight occasional reductions in
grth as concentrations of the two were increased. PCNB and copper sulfate were only
effective in completely inhibiting growth of the three S. scabies strains tested when the
concentrations were excessively high at 1,000 ppm (Chapter IV).

This study also evaluated the effects of two clinically important antibiotics,
gentamicin and vancomyin, both targeted against gram-positive bacteria, on growth
inhibition of S. scabies. These antibiotics were effective in inhibiting growth of the three
tested strains of S. scabies at relatively low concentrations. The three strains were able to
grow well at the lower concentrations tested; however, the concentrations that were
effective in inhibiting growth of S. scabies were much lower than the two other
compounds tested (Chapter IV).

The results from this study indicate that broad-spectrum antimicrobial
compounds, such as PCNB and copper sulfate, were not highly effective in inhibiting
growth of S. scabies at concentrations less than 1,000 ppm. Furthermore, their use in
planta would likely lead to phytotoxicity at such high concentrations. In addition,
because the two antibiotics, gentamicin and vancomyin, were effective in inhibiting the
growth of S. scabies at the lower concentrations tested, it is possible that only specific
antimicrobial compounds targeted toward this group of organisms will be effective in
managing scab. Furthermore, it is possible to speculate that broad-spectrum
antimicrobial compounds will only be effective in reducing or inhibiting growth of S.
scabies at concentrations that are too high to be feasible in terms of economics,
environmental quality and plant toxicity. The image analyses used in this study indicated

that for Streptomyces species the area of growth was a better and more precise indicator

170

of small responses to ten-fold increases in antimicrobial compound concentrations than
the average reflective intensity measurements. The results of this study indicate that

methods other than chemical control should be researched to manage this potato disease.

Future Research

The results flom this research probe further examination regarding pathogen
detection and disease management in the potato-Streptomyces pathosystem. Among the
numerous future analyses that are of critical priority in potato scab research include the
following list. These issues are probably the highest priority necessities for
understanding and controlling this disease and must include the questions listed below:

0 Perform a more comprehensive examination of the mechanism(s) of pathogenicity
in the genus Streptomyces. More research in needed on nec1, the gene closely
associated with pathogenicity. The gene products of nec1 need to be more
extensively evaluated and its precise identification and function must be fully
described to better understand its role in pathogenicity. Genetic comparisons of
pathogenic Streptomyces species having and lacking this gene should be
conducted since it is documented that most, but not all, of the pathogenic
streptomycetes contain this gene. These comparisons between strains with and
without nec1 may provide usefirl insight into the missing link to the Streptomyces
spp. pathogenicity factor. Primers and probes can then eventually be developed
that will enable detection of all, not just the majority, of pathogenic Streptomyces

species.

171

Assess the mechanism(s) underlying the effective control of potato common scab
by irrigation. Experiments are needed that determine if the management of this
disease is due to a biological factor, an abiotic factor, or both. The biological
components of scab reduction via irrigation include possibilities of documented
evidence of competitive exclusion at the lenticels and immature stomata as well
antibiotics produced flom other soil dwelling microbes. Also, the reduction of
populations due to the change in the physical soil environment needs to be
examined. A more comprehensive understanding of the mechanism(s) involved
will enable maximized control of potato common scab via irrigation as well as
locations where it may not be effective based on soil microorganism populations
and/or soil texture. This may become more important as water resources become
increasingly limited.

Analyze cultivars with high levels of resistance to scab. Since this study indicated
that scab resistance is more effective in managing the disease than irrigation,
more extensive studies using cultivar resistance are needed. Highly scab resistant
cultivars should be assessed under different irrigation regimes in regions where
they are to be grown. This may allow for regional irrigation optimization under
ideal experimental conditions performed on land owned by universities, rather
than growers. This will provide evidence to support the findings of this study that
indicate irrigation is needed in scab resistant cultivars only to sustain growth and
yield, not minimize scab infection while reducing the reliance upon and use of

irrigation.

172

0 Compare combinations of resistance activators, moisture application, and
biocontrol agents to determine if synergistic effects are possible. Because
induced resistance must be incorporated with other disease management methods,
it is possible that combining resistance activators with other control measures,
such as irrigation and biocontrol agents may lead to enhanced protection against
infection caused by Streptomyces spp. Completely randomized, factorial
experiments that reduce scab infections may provide insight into combinations of
methods that may be useful to growers. Furthermore, numerous cultivars should
be tested in these trials since cultivars with the same level of resistance may
respond differently to inducing agents. As environmental quality and human
health concerns are constantly escalating flom agricultural pesticide usage, this

will become an increasingly important possibility.

New research investigating the mechanism(s) of pathogenicity in the genus
Streptomyces, the mechanism(s) responsible for control of common scab via irrigation,
and the reduced reliance upon irrigation via cultivar resistance, and the combination of
resistance activators with other disease management methods may enable better
understanding of the host-pathogen interaction, as well as provide valuable insight into
new and exciting ways to manage potato common scab, which remains one of the least

adequately controlled of all potato diseases.

173

LITERATURE CITED

Acuna, I.A., Strobel, G.A. Jacobsen, B.J.Corsini, D.L. 2001. Glucosylation as a
mechanism of resistance to thaxtomin A in potatoes. Plant Science. 161: 7 7-88.

Adams, M. 1., Read, P.J., Lapwood, D.H., Cayley, G. R. and Hide, GA. 1987. The effect
of irrigation on powdery scab and other tuber diseases of potatoes. Annals of
Applied Biology. 1 10: 287-294.

Adams, M. J. and Lapwood, DH. 1978. Studies on the lenticel development, surface
microflora and infection by common scab (Streptomyces scabies) of potato tubers
growing in wet and dry soils. Annals of Applied Biology. 90: 335-343.

Agrios, G.N. 1997. Plant Pathology, 4th edition. San Diego, Academic Press.

Alam, Z. 1972. Inheritance of scab resistance in 24—chromosome potatoes. Ph.D.
Thesis, Department of Horticulture and Agronomy. Madison, University of
Wisconsin.

Archuleta, J .G. and Easton, GD. 1981. The Cause of Deep-Pitted Scab of Potatoes.
American Potato Journal. 58: 385-392.

Azpilicueta, C.E., Zawoznik, MS. and Tomaro, ML. 2004. Phytoalexins synthesis is
enhanced in groundnut plants inoculated with Bradyrhizobium sp. (Arachis). Crop
Protection. 23: 1069-1074.

Beausejour, J ., Clermont, N., and Beaulieu, C. 2003. Effect of Streptomyces
melanosporofaciens strain EF-76 and of chitosan on common scab of potato.
Plant and Soil. 256: 463-468.

Bell, K.S., Roberts, J ., Verrall, S., Cullen, D.W., Williams, N.A., Harrison, J .G., Toth,
I.K., Cooke, D.E.L., Duncan, J.M., and Claxton, J .R. 1999. Detection and
quantification of Spongospora subterranea f. sp. subterranea in soils and on
tubers using specific PCR primers. European Journal of Plant Pathology. 105:
905-915.

Benhamou, N. and Theriault, G. 1992. Treatment with Chitosan Enhances Resistance of
Tomato Plants to the Crown and Root-Rot Pathogen F usarium oxysporum f. sp.
radicis lycopersici. Physiological and Molecular Plant Patholog). 41: 33-52.

Benhamou, N., Lafontaine, RI. and Nicole, M. 1994. Induction of systemic resistance to

Fusarium crown and root-rot in tomato plants by seed treatment with chitosan.
Phytopathology. 84: 1432-1444.

174

Bjor, TA. and Roer, L. 1980. Testing the resistance of potato varieties to common scab.
Potato Research. 23: 33-47.

Blodgett, EM. and Stevenson, F .J . 1946. The new scab resistant potatoes, Ontario,
Seneca, and Cayuga. American Potato Journal. 23: 315-329.

Bokshi, A.I., Morris, SC. and Deverall, B.J. 2003. Effects of benzothiadiazole and
acetylsalicylic acid on B-l,3-glucanase activity and disease resistance in potato.
Plant Pathology 52: 22-27.

Bostock, R.M., Schaeffer, DA. and Hammerschmidt, R. 1986. Comparison of elicitor
activities of arachidonic acid, fatty acids and glucans flom Phytophthora infestans
in hypersensitivity expression in potato tuber. Physiological and Molecular Plant

Pathology. 29: 349-360.

Bouchek-Mechiche, K., Gardan, L., Normand, P., and Jouan, B. 2000. DNA
relatedness among strains of Streptomyces pathogenic to potato in France:
description of three new species, S. europaeiscabiei sp. nov., and S. stelliscabiei
sp. nov. associated with common scab, and S. reticuliscabiei sp. nov. associated
with netted scab. International Journal of Systematic and Evolutionary
Microbiology. 50: 91-99.

Bukhalid, RA. and Loria, R. 1997. Cloning and expression of a gene flom Streptomyces
scabies encoding a putative pathogenicity factor. Journal of Bacteriology. 179:
7776-7783.

Bukhalid, R.A., Chung, S.Y. and Loria, R. 1998. nec1, a gene conferring a necrogenic
phenotype, is conserved in plant-pathogenic Streptomyces spp., and linked to a
transposase pseudogene. Molecular Plant Microbe Interactions. l 1: 960-967.

Bukhalid, R.A., Takeuchi, T., Labeda, D. and Loria, R. 2002. Horizontal transfer of the
plant virulence gene, nec1, and flanking sequences among genetically distinct
Streptomyces strains in the diastatochromo genes cluster. Applied and
Environmental Microbiology. 68: 738-744.

Burrell, M.M. 1982. The translocation of 3,5-dichlorophenoxyacetic acid in relation to
its effect on potato common scab. Journal of Experimental Botany. 33: 215-220.

Cann, MA. 2000. Clay spreading on water repellent sands in the south east of South
Australia - promoting sustainable agriculture. Journal of Hydrology. 231: 333-
341.

Chalova, L.I., Ozereskovskaya, O.L., Yurganova, L.A., Baramidze, V.G., Prostendo,
M.A., D'yakov, Y.T., and Metlitskii, L.V. 1976. Metabolites of phytopathogenic
fungi as inductors of defense responses in plants. Doklady Akademii Nauk SSSR.
230: 722-725.

175

Chalova, L.I., Bararnidze, V.G., Yurganova, L.A., Dyakov, Y.T., Ozereskovskaya, D.L.
and Metlitskii, L.V. 1977. Isolation and characteristics of inductors of defense

responses in potato flom cytoplasm of Phytophthora infestans. Doklady Akademii
Nauk SSSR. 235: 1215-1216.

Chater, K.F. and Hopwood, DA. 1993. Streptomyces In Bacillus subtilis and other
Gram-positive bacteria: biochemistry, physiology, and molecular genetics.
Sonenshein, A.L., Hoch, J .A., and Losick, R. Washington, DC, American Society
for Microbiology: 83-89.

Chester, KS. 1933. The problem of acquired physiological immunity in plants.
Quarterly Review of Biology. 8: 275-324.

Cipar, MS. and Lawrence, CH. 1972. Scab resistance of haploids flom two Solanum
tuberosum cultivars. American Potato Joumal._ 49: 117-119.

Clerrnont, N. and Beaulieu, C. 2003. Effect of Streptomyces melanosporofaciens strain
EF-76 and of chitosan on common scab of potato. Plant and Soil. 256: 463-468.

Close, M. E., Magesan, G.N., Lee, R., Stewart, MK. and Hadfield, J.C. 2003. Field
study of pesticide leaching in an allophanic soil in New Zealand. 1: Experimental
results. Australian Journal of Soil Research. 41: 809-824.

Conn, K.L., Leci, E., Kritzman, G. and Lazarovits, G. 1998. A quantitative method for
determining soil populations of Streptomyces and differentiating potential potato
scab-inducing strains. Plant Disease. 82: 631-638.

Cooper, D.C., Stokes, G.W., and Rieman, G. H. 1954. Periderm development of the
potato tuber and its relationship to scab resistance. American Potato Journal. 31:
58-66.

Corbaz, R. 1964. Study of the streptomycetes causing the common scab of potato.
Phytopathologische Zeitschrift. 51: 351-360.

Cullen, D.W., Lees, A.K., Toth, I.K. and Duncan, J.M. 2001. Conventional PCR and
real-time quantitative PCR detection of Helminthosporium solani in soil and on
potato tubers. European Journal of Plant Pathology. 107: 387-398.

Cullen, D.W., Lees, A.K., Toth, I.K. and Duncan, J .M. 2002. Detection of
Colletotrichum coccodes flom soil and potato tubers by conventional and
quantitative real-time PCR. Plant Pathology. 51: 281-292.

Curwen, D. 1978. Effects of PCNB and irrigation programs on the incidence of scab

(Streptomyces scabies) on Russet Burbank potatoes. American Potato Journal.
55: 373-373.

176

Curwen, D. 1980. Effects of chemical treatments and irrigation programs on the
incidence of scab (Streptomyces scabies) on Russet Burbank potatoes. American
Potato Journal. 57: 474-475.

Darling, HM. 1937. A study of scab resistance in the potato. Journal of Agricultural
Research. 54: 305-317.

Davis, J.R., Garner, J .G. and Callihan, RH. 1974 8. Effects of Gypsum, Sulfur,
Terraclor and Terraclor Super-X for Potato Scab Control. American Potato
Journal. 51: 35-43.

Davis, J.R., McMaster, G.M., Callihan, R.H., Garner, J.G., and McDole, RE. 1974 b.
The relationship of irrigation timing and soil treatments to control potato scab.
Phytopathology. 64: 1404-1410.

Davis, J .R., McMaster, G.M., Callihan, R.H., Nissley, RH. and Pavek, J.J. 1976.
Influence of soil moisture and fungicide treatments on common scab and mineral
content of potatoes. Phytopathology. 66: 228-233.

de Capdeville, G., Wilson, C.L., Beer, S.V. and Aist, JR. 2002. Alternative disease
control agents induce resistance to blue mold in harvested 'Red Delicious' apple
fluit. Phytopathology. 92: 900-908.

de Capdeville, G., Beer, S.V., Watkins, C.B., Wilson, C.L., Tedeschi, L.O., Aist, J .R.
2003. Pre- and post-harvest harpin treatments of apples induce resistance to blue
mold. Plant Disease. 87: 39-44.

Dekker, L.W., Doerr, S.H., Oostindie, K., Ziogas, AK. and Ritsema, C]. 2001. Water
repellency and critical soil water content in a dune sand. Soil Science Society of
America Journal. 65: 1667-1674.

Desikan, R., Clarke, A., Atherfold, P., Hancock, IT, and Neill, SJ. 1999. Harpin
induces mitogen-activated protein kinase activity during defence responses in
Arabidopsis thaliana suspension cultures. Planta. 210: 97-103.

Dey, S.K., Singh, N. and Singh, H. 1981. Streptomyces collinus Linderbein - A new
species causing common scab of potato. Current Science. 50: 830-830.

Dong, H.S., Delaney, T.P., Bauer, D.W. and Beer, S. V. 1999. Harpin induces disease
resistance in Arabidopsis through the systemic acquired resistance pathway
mediated by salicylic acid and the NIMI gene. Plant Journal. 20: 207-215.

Douches, D.S., Maas, D., Jastrzebski, K. and Chase, R.W. 1996. Assessment of potato

breeding progress in the USA over the last century. Crop Science. 36: 1544-
1552.

177

Douches, D.S., J astrzebski, K., Coombs, J ., Chase, R.W., Hammerschmidt, R. and Kirk,
W.W. 2001. Liberator: A round white chip-processing variety with resistance to
scab. American Journal of Potato Research. 78: 425-431.

Douches, D.S., Coombs, J., Jastrzebski, K., Hammerschmidt, R., Kirk, W.W., Long, C.,
Chase, R.W. and Snapp, S. 2003. Boulder: A round white multipurpose potato
variety. American Journal of Potato Research. 80: 345-352.

Dutton, M.V., Rigby, NM. and Macdougal, A]. 1997. Induced resistance to Erwinia
carotovora ssp. atroseptica, through the treatment of surface wounds of potato

tubers with elicitors. Journal of Phytopathology. 145: 163-169.

Edwards, U., Rogall, T., Blocker, H., Emde, M. and Bottger, EC. 1989. Isolation and
direct complete determination of entire genes. Characterization of a gene coding
for 16S ribosomal RNA. Nucleic Acids Research. 17: 7843-7853.

Elesawy, AA. and Szabo, I. M. 1979. Isolation and characterization of Streptomyces
scabies strains flom scab lesions of potato tubers: Designation of the Neotype
strain of Streptomyces scabies. Acta Microbiologica Academiae Scientiarum
Hungaricae. 26: 311-320.

Elmer, W.H. 2002. Influence of formononetin and NaCl on mycorrhizal colonization
and Fusarium crown and root rot of asparagus. Plant Disease. 86: 1318-1324.

El-Sayed, E.S.A. 2000. Production of thaxtomin A by two species of Streptomyces
causing potato scab. F olia Microbiologica. 45: 415-422.

Emilsson, B. and Gustafsson, N. 1953. Scab resistance in potato varieties. Acta
Agricultura Scandanavia. 3: 33-52.

Errampalli, D. and H.W. Johnston 2001. Control of tuber-borne black scurf (Rhizoctonia
solani) and common scab (Streptomyces scabies) of potatoes with a combination
of sodium hypochlorite and thiophanate-methyl preplanting seed tuber treatment.

Canadian Journal ofPlant Pathology-Revue Canadienne De Phytopathologie.
23: 68-77.

Fellows, H. 1926. Relation of growth in the potato tuber to potato scab resistance.
Journal of Agricultural Research. 32: 757-781 .

Fellows, H. 1927. Relation of growth in the potato tuber to potato scab resistance.
Journal of Agricultural Research. 32: 757-781.

Fink, HQ 1956. Vapam and PCNB soil treatments for potato scab control. Plant
Disease Reporter. 40: 190-192.

178

Francaviglia, R., Capri, E., Klein, M., Hosang, J ., Aden, K., Trevisan, M., and Errera, G.
2000. Comparing and evaluating pesticide leaching models: results for the Tor
Mancina data set (Italy). Agricultural Water Management. 44: 135-151.

Gachon, C., Mingam, A. and Charrier, B. 2004. Real-time PCR: what relevance to plant
studies? Journal of Experimental Botany. 55: 1445-1454.

Garrity, G.M., Bell, J., and Lilbum, T.G. 2004. Taxonomic Outline of the Prokaryotes.
Bergey's Manual of Systematic Bacteriology, Second Edition, Release 5.0. New
York, Springer.

Goth, R.W. and Webb, RE. 1986. Rapid method to assess virulence of potato scab
isolates of Streptomyces scabies. American Potato Journal. 63: 427-427.

Goth, R.W., Haynes, K.G., and Wilson, DR. 1993. Evaluation and characterization of
advanced potato breeding clones for resistance to scab by cluster analysis. Plant
Disease. 77: 911-914.

Goto, K. 1985. The relative importance of precipitation and sugar content in potato peel
for the detection of the incidence of common scab (Streptomyces scabies). Soil
Science and Plant Nutrition. 31: 419-425.

Goyer, C., Faucher, E. and Beaulieu, C. 1996. Streptomyces caviscabies sp nov, flom
deep-pitted lesions in potatoes in Quebec, Canada. International Journal of
Systematic Bacteriology. 46: 635-639.

Gussow, HT. 1914. The systematic position of the organisms of the common potato
scab. Science. 39: 431-433.

Hadwiger, L.A., Fristensky, B., and Riggleman, RC. 1984. Chitin, Chitosan, and
Related Enzymes. New York, Plenum.

Hammerschmidt, R., Acres, S. and Kuc, J. 1976. Protection of cucumber against
Colletotrichum lagenarium and Cladosporium cucumerinum. Phytopathology.

66: 790-793.

Hammerschmidt, R. and Dann, E.K. 1997. Induced resistance to disease. In:
Environmentally Safe Approaches to Crop Disease Control. Eds. Rechcigl, NA.
and Rechcigl, J.E. Boca Raton, CRC Press: 177-198.

Hammerschmidt, R. 1999. Induced disease resistance: how do induced plants stop
pathogens? Physiological and Molecular Plant Pathology. 55: 77-84.

Hammerschmidt, R. 2004. Induced resistance: mechanisms and practical applications.

In: Fungal Disease Resistance in Plants: Biochemistry, Molecular Biology, and
Genetic Engineering. Punja, Z.K., ed. Binghamton, Haworth Press, Inc.

179

Haralampidis, K., Bryan, G., Qi, X., Papadopoulou, K., Bakht, S., Melton, R. and
Osbourn, A. 2001. A new class of oxidosqualene cyclases directs synthesis of

antimicrobial phytoprotectants in monocots. Proceedings of the National
Academy of Sciences of the United States of America. 98: 13431-13436.

Harris, PM. 1992. The Potato Crop, 2nd ed. Great Britain, St. Edmundsbury Press.

Haynes, K.G., Goth, R.W., Young, R]. 1997. Genotype x environment interactions for
resistance to common scab in tetraploid potato. Crop Science. 37: 1163-1167.

Healy, F.G., Bukhalid, R.A., and Loria, R. 1999. Characterization of an insertion
sequence element associated with genetically diverse plant pathogenic
Streptomyces spp. Journal of Bacteriology. 1815: 1562-1568.

Healy, F.G., Wach, M., Krasnoff, S.B., Gibson, D.M., and Loria, R. 2000. The txtAB
genes of the plant pathogen Streptomyces acidiscabies encode a peptide sythetase

required for phytotoxin thaxtomin A production and pathogenicity. Molecular
Microbiology. 38: 794-804.

Hirata, S. 1959. Studies on the phytohorrnone in the malformed portion of the diseased
plants: 10. Bulletin Miyazaki. 5: 85-92.

Hohn, ET. and Adams, AP. 1960. An investigation of the relationship of the
Chlorogenic acid and phenol oxidase content of a potato variety and its resistance
to common scab. Enzymologia. 22: 245-250.

Holzrichter, JP. and Milanovich, ER 2003. Optical techniques for identifying animal
and plant pathogens. Journal of Modern Optics. 50: 1949-1956.

Hooker, W.J. 1950. A technique for observing tuber enlargement and scab development
in potatoes. Phytopathology. 40: 390-391.

Hooker, W.J. 1954. Pentachloronitrobenzene soil treatment for potato scab and
Rhizoctonia control. Plant Disease Report. 38: 187-192.

Hooker, W.J. 1981. Compendium of Potato Diseases. St. Paul, American
Phytopathological Society.

Houghland, G.V.C. and Cash, LC. 1954. Effectiveness of certain soil fungicides in
control of potato scab. Plant Disease Reporter. 38: 777-780.

J ellis, G.J. 1974. Improving the reliability of screening in the field for resistance to
common scab Streptomyces scabies. Potato Research. 17: 356.

Johnson, G. and Schaal, LA. 1952. Relation of Chlorogenic acid to scab resistance in
potatoes. Science. 115: 627-629.

180

Kauflnan, DD. 1976. Bound and conjugated pesticide residues. American Chemical
Society Symposium. No. 29, 1-10.

Keinath, AP. and Loria, R. 1989. Population dynamics of Streptomyces scabies and
other Actinomycetes as related to common scab of potato. Phytopathology. 79:
68 1-687.

Keinath, AP. and Loria, R. 1990. Melanin producing Streptomyces spp. respond to
potato plant growth and differentially to potato cultivars. Canadian Journal of
Microbiology. 36: 279-285.

Kerr, A. 1980. Biological control of crown gall through production of Agrocin. Plant
Disease. 64: 25-30.

Kers, J. A., Cameron, K.D., Joshi, M.V., Bukhalid, R. A., Morello, J .E., Wach, M.J.,
Gibson, D.M. and Loria, R. 2005. A large, mobile pathogenicity island confers
plant pathogenicity on Streptomyces species. Molecular Microbiology. 55: 1025 -
1033.

Kessmann, H., Staub, T., Hofinann, C., Maetzka, T. and Herzog, J. 1994. Induction of
systemic acquired disease resistance in plants by chemicals. Annual Review of
Phytopathology. 32: 439-459.

King, B. A. and Stark, J .C. 1997. Potato Irrigation Management. University of Idaho

Cooperative Extension System. College of Agriculture. Extension Bulletin 789:
1-16.

King, R.R., Lawrence, C.H., Clark, M.C., and Calhoun, LA. 1989. Isolation and
characterization of phytotoxins associated with Streptomyces scabies. Chemical
Communication. 13: 849-850.

King, R.R., Lawrence, CH, and Calhoun, LA. 1992. Chemistry of phytotoxins
associated with Streptomyces scabies, the causal organism of potato common
scab. Journal of Agricultural and Food Chemistry. 40: 834-837.

King, RR. and Lawrence, CH. 1996. Characterization of new thaxtomin A analogues
generated in vitro by Streptomyces scabies. Journal of Agricultural and Food
Chemistry. 44: 1108-1110.

King, R.R., Lawrence, CH, and Calhoun, LA. 2000. Microbial glucosylation of

thaxtomin A, a partial detoxification. Journal of Agricultural and Food
Chemistry. 48: 512-514.

181

Kinkel, L.L., Bowers, J .H., Shimizu, K., Neeno-Eckwall, EC, and Schottel, J .L.
1998. Quantitative relationships among thaxtomin A production, potato scab
severity, and fatty acid composition in Streptomyces. Canadian Journal of
Microbiology. 44: 768-776.

Knosel, D. 1970. Interaction of cellulolytic and pectinolytic activities of the plant
pathogen Actinomyces scabies. Phytopathologische Zeitschrift. 67: 205-213.

Korzybski, T., Kowszyk-Gindifer, Z. and Kurylowicz, W. 1978. Antibiotics.
Washington DC, American Society of Microbiology.

Krantz, EA. and Bide, CJ. 1941. Inheritance of reaction to common scab in the potato.
Journal of Agricultural Research. 63: 219-231 .

Krasil'nikov, NA. 1941. Guide to the actinomycetes. Moscow, Akad. Nauk.: 1-158.

Kreuze, J .F., Suomalainen, S., Paulin, L. and Valkonen, J PT. 1999. Phylogenetic
analysis of 16S rRNA genes and PCR analysis of the nec1 gene flom
Streptomyces spp. causing common scab, pitted scab, and netted scab in Finland.
Phytopathology. 896: 462-469.

Krsek, M. and Wellington, E...MH 1999. Comparison of different methods for the
isolation and purification of total community DNA flom soil. Journal of
Microbiological Methods. 39: 1-16.

Kruger, F. 1904. Investigations from the biological department for land and forestry at
imperial public health authorities. Berlin, Paul Parey- Julius Springer Publishing
house. 4: 275-318.

Kuc, J ., Shockley, G. and Kearney, K. 1975. Protection of cucumber against
Colletotrichum lagenarium by Colletotrichum lagenarium. Physiological Plant
Pathology. 7: 195.

Lambert, DH. and Loria, R. 1989. Streptomyces acidiscabies Sp. Nov. International
Journal of Systematic Bacteriology. 39: 393-396.

Lapwood, DH. 1966. The effects of soil moisture at the time potato tubers are forming
on the incidence of common scab (Streptomyces scabies). Annals of Applied
Biology. 58: 447-456.

Lapwood, DH. and Hering, T.F. 1968. Infection of potato tubers by common scab
(Streptomyces scabies) during brief periods when soil is drying. European Potato

Journal. 11:177-187.

Lapwood, DH. and Hering, T.F. 1970. Soil moisture and the infection of young potato
tubers by Streptomyces scabies (common scab). Potato Research. 13: 296-304.

182

Lapwood, D.H., Wellings, L.W., and Rosser, W.R. 1970. The control of common scab
of potatoes by irrigation. Annals of Applied Biology. 66: 397-405.

Lapwood, D.H., Wellings, L.W., and Hawkins, J.H. 1971. Irrigation as a practical
means to control potato common scab. Plant Pathology. 20: 157-163.

Lapwood, DH, and Adams, M.J. 1973. The effect of a few days rain on the distribution
of common scab (Streptomyces scabies) on young potato tubers. Annals of
Applied Biology. 73: 277-283.

Lapwood, D.H., Wellings, L.W. and Hawkins, J .H. 1973. Irrigation as a practical means
to control potato common scab (Streptomyces scabies): final experiment and
conclusions. Plant Pathology. 22: 35-41.

Lauer, RI. and Bide, C]. 1963. Evaluation of parent clones of potato for resistance to
common scab by the 'highest scab' method. European Potato Journal. 6: 35-44.

Lawrence, C.H., Clark, M.C., and King, RR. 1990. Induction of common scab
symptoms in aseptically cultured potato tubers by the vivotoxin, thaxtomin.
Phytopathology. 80: 606-608.

Lee, K. H. and Jose, S. 2005. Nitrate leaching in cottonwood and loblolly pine biomass
plantations along a nitrogen fertilization gradient. Agriculture Ecosystems &
Environment. 105: 615-623.

Lees, A.K., Cullen, D.W., Sullivan, L. and Nicolson, M.J. 2002. Development of
conventional and quantitative real-time PCR assays for the detection and
identification of Rhizoctonia solani AG-3 in potato and soil. Plant Pathology.
5 1 : 293-302.

Lehtonen, M.J., Rantala, H., Kreuze, J .F ., Bang, H., Kuisma, L., Koski, P., Virtanen, E.,
Vihlrnan, K. and Valkonen, J PT. 2004. Occurrence and survival of potato scab

pathogens (Streptomyces species) on tuber lesions: quick diagnosis based on a
PCR-based assay. Plant Pathology. 53: 280-287.

Leiner, R.H., Fry, B.A., Carling, DE. and Loria, R. 1996. Probable involvement of
thaxtomin A in pathogenicity of Streptomyces scabies on seedlings.

Phytopathology. 86: 709-71 3.

Levick, D.R., Stephens, CT. and Lacy, ML. 1981. Etiology and control of radish scab.
Phytopathology. 71: 889-890.

Levick, D.R., Evans, T.A., Stephens, CT. and Lacy, ML. 1985. Etiology of radish scab
and its control through irrigation. Phytopathology. 75: 568-572.

183

Levin, RE. 2004. The application of real-time PCR to food and agricultural systems: A
review. Food Biotechnology. 18: 97-133.

Lewis, B.G. 1970. Effects of water potential on the infection of potato tubers by
Streptomyces scabies in soil. Annals of Applied Biology. 66: 83-88.

Li, R.G. and Fan, Y.L. 1999. Reduction of lesion growth rate of late blight plant disease
in transgenic potato expressing harpin protein. Science in China Series C - Life
Sciences. 42: 96-101.

Li gterink, W., Kroj, T., zur Nieden, U., Hirt, H., and Scheel, D. 1997. Receptor—
mediated activation of a MAP kinase in pathogen defense of plants. Science.
275: 2054-2057.

Lin, Y.-S., Kieser, H.M., Hopwood, D.A., and Chen, CW. 1993. The chromosomal
DNA of Streptomyces lividans 66 is linear. Molecular Microbiology. 10: 923-
933.

Liu, D., Anderson, N.A., and Kinkel, LL. 1995. Biological control of potato scab in the
field with antagonistic Streptomyces scabies. Phytopathology. 85: 827-831.

Liu, D., Anderson, N.A., and Kinkel, LL. 1996. Selection and characterization of
strains of Streptomyces suppressive to the potato scab pathogen. Canadian
Journal of Microbiology. 42: 487-502.

Lorang, J .M., Anderson, N.A., Lauer, EL, and Wildun, D.K. 1989. Disease decline in a
Minnesota scab plot. American Potato Journal. 66: 531.

Lorang, J .M. 1998. Heterokaryosis and inhibitory reactions among isolates of
Streptomyces scabies causing scab on potato. Ph.D. Thesis. Department of Plant
Pathology. Minneapolis, University of Minnesota.

Lorang, J .M., Liu, D., Anderson, NA. and Schottel, J .L. 1995. Identification of potato
scab inducing and suppressive species of Streptomyces. Phytopathology. 85: 261-
268.

Loria, R., Bukhalid, R.A., Fry, BA. and King, RR. 1997. Plant pathogenicity in the
genus Streptomyces. Plant Disease. 81: 836-846.

Loria, R. 2001. Common Scab. In: Compendium of Potato Diseases. Second Edition.
Edited by W. R. Stevenson, Loria, R., Franc, G.D., Weingartner, D.P. St. Paul,
APS Press.

Lorian, V. 1986. Antibiotics in Laboratory Medicine. Baltimore, Williams and Wilkins.

184

Louws, F .J ., Rademaker, J .L.W., and de Bruijn, F]. 1999. The three Ds of PCR-based
genomic of phytobacteria: diversity, detection, and disease diagnosis. Annual
Review of Phytopathology. 37: 81-125.

Lutman, BR 1919. Resistance of potato tubers to scab. Vermont Agricultural
Experimental Station Bulletin. No. 215: 30.

Martin, R.R., James, D. and Levesque, CA. 2000. Impacts of molecular diagnostic
technologies on plant disease management. Annual Review of Phytopathology.

38: 207-239.

Martins, R. 1976. New archaeological techniques for the study of ancient root crops in
Peru. Ph.D. Thesis. Department of Botany. Birmingham, University of
Birmingham.

McCartney, H.A., Foster, S.J., Fraaije, BA. and Ward, E. 2003. Molecular diagnostics
for fungal plant pathogens. Pest Management Science. 59: 129-142.

McIntosh, AH. 1973. Glasshouse tests of chemicals for control of potato common scab.
Annals of Applied Biology. 73: 189-196.

McIntosh, AH. 1976. Glasshouse tests of quinones, polyhydroxybenzenes and related
compounds against potato common scab. Annals of Applied Biology. 83: 239-
244.

McIntosh, A.H. 1977. Field trials of chemicals for control of common scab by
soil treatment. Potato Research. 20: 225-229.

McIntosh, AH. and Bateman, G.L. 1979. Effects of foliar sprays of daminozide on
the incidence of potato common scab. Annals oprplied Biology. 92: 29-38.

McIntosh, AH. and Burrell, M.M. 1980. Movement of ethionine in potato plants after
foliar application against common scab. Physiological Plant Pathology. 17: 205-
212.

McIntosh, A.H., Bateman, G.L., Chamberlain, K., Dawson, G.W. and Burrell, M.M.
1981. Decreased severity of potato common scab after foliar sprays of 3,5-

dichlorophenoxyacetic acid, a possible anti-pathogenic agent. Annals of Applied
Biology. 99: 275-281.

McIntosh, A.H., Chamberlain, K. and Dawson, G.W. 1985. Foliar sprays against

potato common scab: compounds related to 3,5-dichlorophenoxyacetic acid. Crop
Protection. 4: 473-480.

185

McIntosh, A.H., Bateman, G.L. and Chamberlain, K. 1988. Substituted benzoic and
picolinic acids as foliar sprays against potato common scab. Annalsof Applied
Biology. 112: 397-401.

McKee, R.K. 1958. Assessment of resistance of potato varieties to common scab.
European Potato Journal. 1: 65-80.

McKee, R.K. 1963. Scab resistance of potato varieties. Plant Pathology. 12: 106-109.

McKenna, F., El-Tarabily, K.A., Hardy, G.E.S. and Dell, B. 2001. Novel in vivo use
of a polyvalent Streptomyces phage to disinfest Streptomyces scabies-infected
seed potatoes. Plant Pathology. 50: 666-675.

McKissock, I., Gilkes, R]. and Walker, EL. 2002. The reduction of water repellency by
added clay is influenced by clay and soil properties. Applied Clay Science. 20:
225-241.

McManus, P. and Stockwell, V0. 2001. Antibiotic use for plant disease management in
the United States. Online. Plant Health Progress.

McQueen, D.A.R., and Schottel, IL. 1987. Purification and characterization of a novel
extracellular esterase flom pathogenic Streptomyces scabies that is inducible by
zinc. Journal of Bacteriology. 169: 1967-1971.

Menzies, JD. 1957. Dosage rates and application methods with PCNB for control of
potato scab and Rhizoctonia. American Potato Journal. 34: 219-226.

Menzies, J .D. 1959. Occurrence and transfer of a biological factor in soil that suppresses
potato scab. Phytopathology. 49: 648-652.

Millard, W.A. and Burr, S. 1926. A study of twenty-four strains of Actinomyces and
their relation to types of common scab of potato. Annals of Applied Biology. 13:
5 80—644.

Miyajima, K., Tanaka, F., Takeuchi, T., and Kuninaga, S.. 1998. Streptomyces
turgidiscabies sp. nov. International Journal of Systematic Bacteriology. 48:
495-502.

Muller, KC. and. Borger, H. 1940. Experimentelle untersuchungen uber die
Phytophthora - resistanz der kartoffel. Arbeiten Biologischen Anst. Reichsanstalt.
23: 189-231.

Murphy, A.M., Dejong, H., et al. 1995. Transmission of resistance to common scab
flom the diploid to the tetraploid level via 4x-2x crosses in potatoes. Euphytica.
82: 227-233.

186

Nieto, M. and Perkins, HP. 1971. Physicochemical properties of vancomycin and
iodovancomycin and their complexes with diacetyl-L-lysyl—D-alanyl-D-alanine.
Biochemistry Journal. 123: 773-787.

Nugent, T.J. 1956. Soil treatments with PCNB Terraclor for control of potato scab.
Plant Disease Reporter. 40: 428. '

Nyquist, W.E. 1991. Estimation of heritability and prediction of selection response in
plant populations. Critical Reviews in Plant Science. 10: 235-322.

Obradovic, A., Jones, J .B., Momol, M.T., Balogh, B. and Olson, SM. 2004.
Management of tomato bacterial spot in the field by foliar applications of
bacteriophages and SAR inducers. Plant Disease. 88: 736-740.

Ozeretskovskaya, O. L. 1995. Induced resistance in the Solanaceae. In: Induced
Resistance to Disease in Plants. Eds. Hammerschmidt, R. and Kuc, J. Dordrecht,
Kluwer: 3 1-62.

Papadopoulou, K., Melton, R.E., Leggett, M., Daniels, M.J. and Osbourn, A.E. 1999.
Compromised disease resistance in saponin-deficient plants. Proceedings of the
National Academy of Sciences of the United States of America. 96: 12923-12928.

Park, D.H., Kim, J.S., Kwon, S.W.,Wilson, C.,Yu, Y.M., Hur, J .H. and Lim, CK.
2003. Streptomyces Iuridiscabiei sp nov., Streptomyces puniciscabiei sp nov and
Streptomyces niveiscabiei sp nov., which cause potato common scab disease in

Korea. International Journal of Systematic and Evolutionary Microbiology. 5 3:
2049-2054.

Park, D.H., Yu, Y.M., Kim, J .S., Cho, J .M., Hur, J .H. and Lim, CK. 2003.
Characterization of streptomycetes causing potato common scab in Korea. Plant
Disease. 87: 1290-1296.

Peng, J .L., Dong, H.S., Dong, H.P., Delaney, T.P., Bonasera, J .M. and Beer, S.V. 2003.
Harpin-elicited hypersensitive cell death and pathogen resistance require the
NDRI and EDS] genes. Physiological and Molecular Plant Pathology. 62: 317-
326.

Potter, H.S., Hooker, W.J., Cargo, W., and Stachwick, GT. 1959.
Pentachloronitrobenzene and urea-formaldehyde for potato scab control in

Michigan. Plant Disease Reporter. 43: 633-637.

Pridham, T. G. 1970. New names and new combinations in the order Actinomycetales.
Bulletin of the United States Department of Agriculture. 1424: 1-55.

187

Pritchard, D.W. and Ross, AF. 1975. Relationship of ethylene to formation of tobacco
mosaic virus lesions in hypersensitive responding tobacco leaves with and without
induced resistance. Virology. 64: 295-307.

Rahimi, 8., Perry, RN. and Wright, DJ. 1993. Induction and detection of pathogenesis-
related proteins in leaves and roots of potato plants infected with pathotypes of
Globodera pallida. Fundamental and Applied Nematology. 16: 549-556.

Rahimi, 8., Perry, RN. and Wright, DJ. 1998. Detection of chitinases in potato plants
following infection with the potato cyst nematodes, Globodera rostochiensis and
G. pallida. Nematologica. 44: 181-193.

Ristaino, J.B. and Averre, CW. 1992. Effects of irrigation, sulfur, and fumigation
on Streptomyces soil rot and yield components in sweet-potato. Phytopathology.
82: 670-677.

Ristaino, J .B. 1993. Infection of sweet potato fibrous roots by Streptomyces ipomoeae —
influence of soil water potential. Soil Biology and Biochemistry. 25: 185-192.

Roberts, DA. 1979. Induced resistance to tobacco mosaic virus in hypersensitive plants
unaffected by syrnptomless infection by potato virus X. Phytopathology. 69:
53 1-532.

Rosegrant, M.W., Cai, X. and Cline, SA. 2002. Global Water Outlook to 2025:
Averting an Impending Crisis. Washington, DC, International Food Policy
Research Institute and International Water Management Institute Food Policy
Report: 1-36.

Ross, AF. 1961. Systemic acquired resistance induced by localized virus infections in
plants. Virology. 14: 340-358.

Ross, AF. 1966. Systemic effects of local lesion formation. In Viruses of Plants,
ed. Beemster, A.B.R. and Dijkstra, J. pp. 127-150. Amsterdam, North-Holland.

Rossi-Doria, T. 1891. On some species of Streptothrix found in connection to
Actinomyces. Annals of the Institute of Hygiene. 1: 399-438.

Rotem, J. and Palti, J. 1969. Irrigation and plant diseases. Annual Review of
Phytopathology. 7: 267-288.

Sanford, GB. 1923. The relation of soil moisture to the development of common
scab of potato. Phytopatholog. 13: 231-236.

Sanford, GB. 1926. Some factors affecting the pathogenicity of Actinomyces scabies.
Phytopathology. 16: 525-547.

188

Sashkov, A.S., Tul'skaya, E.M., Evtushenko, L.I., Denisenko, V.A., Ivanyuk, V.G.,
Stomakhin, A.A., Naumova, 1.3., and Stackebrandt, E. 2002. Cell wall anionic

polymers of Streptomyces sp. MB-8, the causative agent of potato scab.
Carbohydrate Research. 337: 2255-2261.

Sathiyabama, M. and Balasubramanian, R. 1998. Chitosan induces resistance
componenets in Arachis hypogaea against leaf rust caused by Puccinia arachidis
Speg. Crop Protection. 17: 307-313.

Schaad, N.W., Jones, J .B., and Chun, W. 2001. Laboratory Guide for Identification of
Plant Pathogenic Bacteria. Saint Paul, APS Press.

Schaad, NW. and Frederick, RD. 2002. Real-time PCR and its application for rapid
plant disease diagnostics. Canadian Journal of Plant Pathology-Revue
Canadienne De Phytopathologie. 24: 250-258.

Schena, L., Nigro, F., Ippolito, A. and Gallitelli, D. 2004. Real-time quantitative PCR: 2
new technology to detect and study phytopathogenic and antagonistic fungi.
European Journal of Plant Pathology. 110: 893-908.

Schoneveld, J. A. 1993. Effect of irrigation on the prevention of scab in carrots. Acta
Horticulturae. 354: 135-144.

Sequeira, L. and Hill, L.M. 1974. Induced resistance in tobacco leaves - grth of
Pseudomonas solanacearum in protected tissues. Physiological Plant Pathology.
4: 447-455.

Silo-Sub, L.A., Lethbridge, B.J., Raffel, S.J., He, H., Clardy, J ., and Handelsman, J.
1994. Biological activities of two fungistatic antibiotics produced by Bacillus
cereus UW85. Applied and Environmental Microbiology. 60: 2023-2030.

Sobin, B.A., Finlay, AC. and Kane, J .H. 1953. In Guide to the Classification and
Identification of the Actinomycetes and their Antibiotics, Waksman, SA. and
Lechlevalier, H.A., eds. Baltimore, The Williams and Wilkins Company.

Starr, G.H., Cykler, J .F., and Dunnewald, T.J. 1943. The effect of moisture and other
factors on potato scab. American Potato Journal. 20: 279-287.

Stevenson, W.R., Loria, R., Franc, G.D., and Weingartner, DP. 2001. Compendium of
Potato Diseases. St. Paul, APS Press.

Stewart, I. T. and Loague, K. 2003. Development of type transfer functions for regional-

scale nonpoint source groundwater vulnerability assessments. Water Resources
Research. 39: 1359.

189

Strobel, N.E., Ji, C., Gopalan, S., Kuc, J .A. and He, S.Y. 1996. Induction of systemic
acquired resistance in cucumber by Pseudomonas syringae pv. syringae 61 HrpZ
(Pss) protein. Plant Journal. 9: 431-439.

Tai, GO and Murphy, A., and DeJong, H. 1996. Comparison of efficiency of
alternative selection strategies: An example of selection for resistance to common
scab in potatoes. Canadian Journal of Plant Science. 76: 849-852.

Thaxter, R. 1890. The potato scab. Connecticut Agricultural Experimental Station
Annual Report. 15: 81-95.

Tiktak, A., de Nie, D.S., Pineros Garcet, J .D., Jones, A., and Vanclooster, M. 2004.
Assessment of the pesticide leaching risk at the Pan-European level: The
EuroPEARL approach. Journal of Hydrology. 289: 222-23 8.

U.S.D.A. 1991. United States standards for grades of potatoes. USDA-Agricultural
Marketing Service, Washington, DC.

van Loon, L.C., Pierpoirnt, W.S., Boller, T., Conejero, V. 1994. Recommendations
for naming plant pathogenesis-related proteins. Plant Molecular Biology Report.
12: 245-264.

Vasyukova, N.I., Chalenko, G.I.,Gerasimova, N.G., Perekhod, B.A., Ozeretskovskaya
O.L., Il'ina, A.V., Varlamov, VP, and Albulov, AL 2000. Chitin and Chitosan
Derivatives as Elicitors of Potato Resistance to Late Blight. Applied Biochemistry
and Microbiology. 36: 372-376.

Vasyukova, N.I., Zinov'eva, S.V., Il'inskaya, L.I., Perekhod, B.A., Chalenko, G.I.,
Gerasimova, N.G., Il'ina, A.V., Varlamov, VP. and Ozeretskovskaya, CL. 2001.
Modulation of plant resistance to diseases by water-soluble chitosan. Applied
Biochemistry and Microbiology. 37: 103-109.

Vazquez, J .C.G., Grande, J .A., Barragan, F.J., Ocana, J.A., De La Torre, ML. 2005.
Nitrate accumulation and other components of the groundwater in relation to
cropping system in an aquifer in southwestern Spain. Water Resources
Management. 19: 1-22.

Velasquez, L. and Hammerschmidt, R. 2004. Development of a method for the
detection and quantification of total chitinase activity by digital analysis. Journal
of Microbiological Methods. 59: 7-14.

Waksman, SA. and Henrici, AT. 1943. The nomenclature and classification of the
Actinomycetes. Journal of Bacteriology. 46: 337-341.

190

Waksman, SA. and Henrici, AT. 1948. Family 111: Streptomycetaceae. In Bergey's
Manual of Determinative Bacteriology, 6th ed. Breed, R.S., Murray, B.G.D. and
Hitchens, A.P. eds. The Williams & Wilkins Co., Baltimore: pp. 929-980.

Wale, SJ. 2004. Integrating knowledge of soilbome pathogens to minimize disease risk
in potato production. Australasian Plant Pathology. 33: 167-172.

Walter, DR. and Keil, DJ. 1996. Vascular Plant Taxonomy. Dubuque, Kendall Hunt
Publishing.

Wang, Z. Wu, Q.,J. Wu, L. ,,Ritsema C. J., Dekker, L. W. and Feyen, J. 2000. Effects of
soil water repellency on infiltration rate and flow instability. Journal of
Hydrology. 231. 265- 276.

Wanner, LA. 2004. Field isolates of Streptomyces differ in pathogenicity and virulence
on radish. Plant Disease. 88: 785-796.

Ward, E., Foster, S.J., Fraaije, BA. and McCartney, HA. 2004. Plant pathogen
diagnostics: immunological and nucleic acid-based approaches. Annals of
Applied Biology. 145: 1-16.

Webb, R.E., Wilson, D.R., Shumaker, J .R., Graves, B. and M. R. Henninger, Watts, J .,
Frank, J .A. and Murphy, H]. 1978. Atlantic - new potato variety with high
solids, good processing quality, and resistance to pests. American Potato Journal.
55: 141-145.

Wei, Z.M., Laby, R.J. Zumoff, C.H.,Bauer, D.W., He, S.Y., Collrner, A., and Beer, S.V.
1992. Harpin, elicitor of the hypersensitive response produced by the plant
pathogen Erwinia amylovora. Science. 257: 85-88.

Wellings, L.W. and Rosser, W.R. 1969. Irrigation of potatoes and the control of
common scab. Plant Pathology. 18: 1-9.

Wiersema, HT. 1970. A reliable method for testing scab resistance in the greenhouse.
Proceedings of the 4th Triennial Conference of the European Association for
Potato Research, Brest, France, Inst.

Wilson, C.R., Pemberton, RM. and Ransom, L.M. 2001. The effect of irrigation
strategies during tuber initiation on marketable yield and development of common

scab disease of potato in Russet Burbank in Tasmania. Potato Research. 44:
243-25 1 .

Yang, B.J., Blackwell, RS. and Nicholson, DE 1996. A numerical model of heat and

water movement in filrrow-sown water repellent sandy soils. Water Resources
Research. 32: 3051-3061.

191

Zhang, Y.M., Hu, C.S., Zhang, J .B., Chen, D.L., and Li, X.X. 2005. Nitrate leaching
in an irrigated wheat-maize rotation field in the North China Plain. Pedosphere.
15: 196-203.

192

   

i“1111111111111111111