. .A
v... 7»:

F: A. .L
x... 1‘.

 

 

THESIS

 

3 cot/3 LIBRARY
MiCth‘a. 3[ate
University

 

 

 

This is to certify that the
dissertation entitled

FUNCTIONAL ANALYSIS OF THE POLYKETIDE SYNTHASE
GENES IN THE FILAMENTOUS FUNGUS Gibberella zeae

(ANAMORPH Fusan'um graminearum)

presented by

Shidad I. Gaffoor

has been accepted towards fulfillment
of the requirements for the

Ph.D. degree in Plant Biol_ogL

 

whom Nut/ALQ

Major Professor’s Signature
8 ll l C) 1/ 0 s-

Date

MSU is an Afiinnative ActiorVEqual Opportunity Institution

PLACE IN RETURN Box to remove this checkout from your record.
10 AVOID FINES return on or before date due.
MAY BE RECAUED with earlier due date if requested.

 

I DATE DUE

DATE DUE

DATE DUE

 

MAW W8 02802007

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 c:/ClRC/DateDue.lndd-p.15

FUNCTIONAL ANALYSIS OF THE POLYKETIDE SYNTHASE GENES IN THE
FILAMENTOUS FUN GUS Gibberella zeae (ANAMORPH F usarium graminearum)

By

Shidad I. Gaffoor

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
DOCTOR OF PHILOSOPHY
Department of Plant Biology

2005

ABSTRACT

FUNCTIONAL ANALYSIS OF THE POLYKETIDE SYNTHASE GENES IN THE

FILAMENTOUS FUNGUS Gibberella zeae (ANAMORPH F usarium graminearum)

By
Shidad I. Gaffoor

The fungus Gibberella zeae Schw. [Schwein.] Petch (anamorph Fusarium
graminearum Schwabe) is a major causal agent of the disease Fusarium Head Blight
when it infects cereals such as wheat, oats, barley and corn. The fungus produces several
mycotoxins both during infection of the grain and storage of that infected grain. The
myxotoxins characterized to date include zearalenone, fusarin C and aurofusarin which
are of polyketide origin and deoxynivalenol which is a trichothecene.

Polyketides are a class of secondary metabolites that exhibit a vast diversity of
form and function. In fungi, these compounds are produced by large, multi-domain
enzymes classified as Type I polyketide synthases (PKS). In the past, most PKS genes
were identified because they produced a compound of interest. However, with the recent
advent of the genomic era, it is possible to clone and characterize the entire suite of PKS
genes within a genome, contributing to the overall analysis of the total polyketide
potential of an organism. Although PKSs are composed of several highly conserved
domains, the extensive diversity of the PK products arise from the number and kind of
domains present on the enzyme and the type of starter and extender units selected by the

enzyme. In this study we identified all fifteen PKS genes within the genome of the

filamentous fungus G. zeae. We succeeded in identifying five genes responsible for
producing the previously identified compounds zearalenone, aurofusarin, fusarin C and
the black perithecial pigment by analysis of disrupted mutants of all fifteen genes. A
comprehensive expression study revealed several interesting expression patterns.
However we were unable to detect expression of one of the PKS genes under any of
seventeen conditions tested. This is the first study to genetically characterize a complete
set of PKS genes from a single organism.

Zearalenone is a mycotoxin of worldwide economic and health importance. It is
most commonly found as a contaminant in stored corn and wheat grain and has chronic
estrogenic effects on mammals. Zearalenone has been known to be a polyketide, derived
from the sequential addition of multiple acetate units by a polyketide synthase (PKS).
However, the genetics of zearalenone biosynthesis and the identification of associated
modifying enzymes have not been elucidated. Herein, we describe the cloning of two
genes, designated ZEAI and ZEAZ, that encode the polyketide synthases responsible for
zearalenone production in G. zeae. Disruption of either of these genes results in the loss
of zearalenone production by the resulting mutant. ZEAI and ZEAZ are transcribed
divergently from a common promoter region. Analysis of this region gives clues to the
regulation of these genes. Examination of the region of the chromosome involved in
zearalenone biosynthesis shows the presence of two possible regulatory proteins. A

putative mechanism for the synthesis of zearalenone by the two PKSs is proposed.

LL‘

Llf

IX

 

 

 

TABLE OF CONTENTS

 

 

LIST OF TABLES vii
LIST OF FIGURES .................... A A AA A A ...... viii
INTRODUCTION . ...... AA A AA A A A - A - - 1

 

FUNCTIONAL ANALYSIS OF THE POLYKETIDE SYNTHASE GENES IN THE
FILAMENTOUS FUNGUS Gibberella zeae (ANAMORPH Fusarium graminearum)

 

 

 

 

 

 

..... 18

Abstract AAAAAAAAAAAA A A - A 18
IntroductionAA A ..... A _ 19
Materials and Methods A ............ A _ AAAAAAAA A 22
Fungal strains and growth conditions. . .............................................................. 22
Identification of PKS genes. ................................................................................ 22
Fungal transformation and gene disruption. ...................................................... 24
Characterization of growth and pathogenicity of PKS mutants ........................ 26
Chemical analysis of PKS mutants. .................................................................... 27
Expression analysis of PKS genes. ...................................................................... 30
Results - - -_ - -- _ AAAAAAAAAAAAAAAA -- A -A32
Identification of PKS genes. ................................................................................ 32
Functional analysis of PKS genes. ...................................................................... 34
Expression analysis of PKS genes. ...................................................................... 35
Discussion .......... ............. A AAAAAAA - - - -A -A - A AA A 36
Acknowledgements-.- - A _ - ..... . A AAAAA - - 41

 

iv

CHARACTERIZATION OF TWO DISTINCT POLYKETIDE SYNTHASE
GENES INVOLVED IN ZEARALENONE BIOSYNTHESIS IN Gibberella zeae... 42

 

 

 

 

 

 

 

 

 

Abstract A A A - 42
Introduction AAAAAAAAA - A A- 44
Methods - -- AA -47
Fungal strains and growth conditions. ............................................................... 47
Fungal transformation. ....................................................................................... 47
Gene structure and analysis. ............................................................................... 48
Gene disruption ................................................................................................... 49
Identification of the Intercontig Region of ZEAI ............................................... 50
Expression Analysis ............................................................................................. 50
Chemical analysis of zen accumulation .............................................................. 53
Results A -_ 54
Analysis of zearalenone biosynthesis in ZEAI and ZEAZ mutants .................... 54
Identification and analysis of ZEAI and ZEA2 .................................................. 54
Identification of Cluster ...................................................................................... 55
Analysis of the promoter region .......................................................................... 56
Discussion AAAAA . AAAAAAAAAAAAAAAAA -A - -- .... 56
Acknowledgements.. ..... - - 60
CONCLUSIONS - ............ ....... 61
APPENDICES - 63
APPENDIX A: TABLES A A -- -- - -- - -- A 64
APPENDIX B: FIGURES 76

 

APPENDIX C: SOUTHERN ANALYSIS OF PKS DISRUPTED MUTANTS.... 88

APPENDIX D: EJECTION MECHANICS AND TRAJECTORY OF THE
ASCOSPORES OF Gibberella zeae (ANAMORPH Fusarium gramineamm) 104

APPENDIX E: ISOLATION OF Fusarium graminearum INSERTIONAL
MUTANTS COMPROMISED FOR MYXOTOXIN PRODUCTION AND
PATHOGENESIS ON WHEAT 112

 

BIBLIOGRAPHY 154

 

vi

 

 

lab

 

Tab

pare

le‘
entl

T4.“

T4.“

LIST OF TABLES

Table 1. Structures of the predicted polyketide synthase genes in Gibberella zeae ......... 66
Table 2. Primers used to generate disruption fragments of polyketide synthase genes.... 67
Table 3. Predicted domain architecture of ZEAI and ZE42 proteins .............................. 68
Table 4. Characteristics of the wheat head disease phenotype at day 20 conferred by the

parental isolate PH-l and nine insertional mutants ........................................................ 69

Table 5. Impact F. graminearum infection on grain weight, number and quality in the

entire head and the three different sub-regions A, B and C ............................................ 70
Table 6. The effect PH-l and the various daf mutants of F. graminearum .................... 73
Table 7. DON levels produced in vitro by various F. graminearum isolates ................. 74

Table 8. Correlation coefficients between the various phenotypes quantified in wheat
heads following F. graminearum infection .................................................................... 75

vii

 

 

 

 

 

-1 I.
'I’J
.- .

C00.

Flg.

Fig.

allcf

 

 

 

LIST OF FIGURES

Figure 1. PKS mutations affecting perithecium pigmentation ........................................ 77

Figure 2. Expression of putative PKS genes by wild type G. zeae under varying

conditions ..................................................................................................................... 79
Figure 3. Schematic representation of the zen gene cluster ............................................ 80
Figure 4. Expression analysis of ZEAI and ZEA2 in disrupted mutants .......................... 81
Figure 5. TLC analysis of ZEAI and ZEA2 disruption mutants ..................................... 82

Figure 6. Analysis of the putative shared promoter region between the start codons of
ZEAI and ZEA2 spanning 1040 bp on contig 119 ......................................................... 83

Figure 7. Proposed mechanism for zen biosynthesis by ZEAlp and ZEA2p .................. 84

Figure 8. Diagrammatic representation of a Triticum aestvum wheat head comprising
alternate parallel rows of spikelets separated by rachis segments ................................... 85

Figure 9. Macroscopic appearance of mature grain harvested from a single head infected

with daf 36 and PH-l ................................................................................................... 86
Figure 10. A wheat seedling container test used to explore root infection by F.

graminearum ................................................................................................................ 87
Figure 11. Disruption of PKS] I by single-crossover homologous recombination .......... 89
Figure 12. Disruption of A URI by single—crossover homologous recombination ............ 90
Figure 13. Disruption of ZEAI by single-crossover homologous recombination ............ 91
Figure 14. Disruption of ZEA2 by single-crossover homologous recombination ............ 92

viii

Figure 15. Disruption of PKS] 7 by single-crossover homologous recombination .......... 93

Figure 16. Disruption of GRSI by single-crossover homologous recombination ............ 94
Figure 17. Disruption of PLSPI by single-crossover homologous recombination .......... 95
Figure 18. Disruption of PKSZ by single-crossover homologous recombination ............ 96
Figure 19. Disruption of PKS5 by single-crossover homologous recombination ............ 97
Figure 20. Disruption of GzF US I by single-crossover homologous recombination ........ 98
Figure 21. Disruption of PKS6 by single-crossover homologous recombination ............ 99
Figure 22. Disruption of PKS 7 by single-crossover homologous recombination .......... 100
Figure 23. Disruption of PLGI by single-crossover homologous recombination .......... 101
Figure 24. Disruption of PKS9 by single-crossover homologous recombination .......... 002

Figure 25. Disruption of PKSI by single-crossover homologous recombination .......... 103

ix

 

 

 

 

 

Clix

a “h

and

hart

CUl.’
Um"
{ill

0le

Cart

INTRODUCTION

The class of compounds known as Polyketides (PKs) are myriad in form, function
and distribution but have a common biosynthetic origin. PKS have been traditionally
classified as a group of secondary metabolites. The secondary metabolites are defined as
a “heterogeneous group of compounds, usually of low relative molecular mass, and made
mostly but not exclusively by organisms without a nervous system (i.e. bacteria, fungi
and plants) (14). The PKs themselves have been identified in organisms ranging from
bacteria and fungi to members of the plant and animal kingdoms. Although the term
“Polyketide”, to indicate compounds composed of multiple ketomethylene groups was
coined in 1907 (14), PK compounds have been know and utilized for centuries. Their
uses are as diverse as their nature. These compounds have mainly been exploited for their
pharmacological properties ranging from immunosuppressant agents (e.g. mycophenolic
acid, rapamycin, tacrolimus), antibacterial agents (e. g. erythromycin, tetracycline,
tylosin), antifungal agents (e.g. amphotericin, griseofulvin), anticancer agents (e. g.
daunomycin), cholesterol-lowering agents (e.g. lovastatin, squalestatin, compactin),
veterinary products (e.g. avermectin, monesin), antiparasitic agents (e.g. avermictin),
antitumor agents (e. g. Doxorubicin), to murder weapons, a historic example of this last is
the use of confine-containing hemlock to execute Socrates (14, 30, 100, 127).

Although numerous PKs have been widely exploited by humans, their purpose in
the producing organism remains a mystery. Large quantities of resources are employed
by an organism to produce a bank of these compounds. These resources include the

carbon, nitrogen and energy resources needed to synthesize the compound as well as the

resources required to store and maintain the genetic information coding for the enzymes
and the transcription factors needed to regulate the production of the necessary enzymatic
machinery. Therefore it seems highly unlikely that an organism would continue to
produce these compounds if they serve no ecological or evolutionary advantage.
Numerous studies over the past decades have resulted in the assignment of functions to a
relatively few compounds. While pathogenicity and virulence factors dominate the list of
roles for PKs, they also play a role in eliminating competitors, resisting environmental
stress, as signaling molecules and as avirulence factors as described below.

A pathogenicity factor is defined as a metabolite produced by a pathogen that is
essential for that pathogen to infect and cause disease on its host (2). When possible, the
role of a compound as a pathogenicity factor is verified by using mutant strains of the
wild type pathogen that are unable to produce the compound in pathogenicity assays to
show that these strains are unable to cause disease. In Magnaporthe grisea, the
dihydroxynaphthalene (DHN) melanin which is a black pigment formed by the
polymerization of a monomer of PK origin (49) is produced in the appresoria. This
compound has been shown to be necessary for the build-up of appressorial turgor
pressure required for direct penetration of the host (9). Disruption of the PKS gene
involved in producing this compound resulted in the inability of the fungus to penetrate
the host and cause disease (62). T-toxin produced by Cochliobolus heterostrophus (138)
and PM toxin produced by Mycosphaerella zeae-maydis (141) are host-specific toxins of
PK origin. These toxins are able to bind to specific proteins in the mitochondria of T-

cytoplasm maize and have been shown to be essential for pathogenicity. These fungi are

 

 

 

 

 

 

 

 

Ulla;

ICC

COT

sh

rad 1

 

ellli.

 

 

 

 

unable to cause disease in cultivars of maize that do not produce the specific proteins
recognized by the toxins.

There are also several instances where PK compounds play a role in virulence on
their plant or animal host. A virulence factor has been defined as a metabolite produced
by a pathogen that are helpful but not essential for disease induction (2). The phytotoxin
coronatine produced by Pseudomonas syringae which contains a PK component,
comnafacic acid; causes diffused chlorosis on the host (10). Disruption of coronatine
production resulted in a reduction of virulence (21 ). Similarly, null mutants of the
cercosporin PKS gene of Cercospora nicotianae produced significantly fewer lesions
compared to the wild type (33). DHN melanins produced by several fungi including
Sporothrix schenckii (108), Exophiala dermatitidis (112) and Aspergillusfumigatus (126)
confer an increased virulence compared to the corresponding albino mutants of these
species that are unable to produced this pigment. In other fungi like Altemaria altemata
(63), Verticillium dahliae (55) and Moniliniafructicola (107) the melanization has been
shown to increase resistance to harsh environmental conditions, specially exposure to UV
radiation and thereby increase the ability to cause disease. It has been hypothesized that
the increased virulence in these fungi is due to the melanin’s being able to quench the
reactive oxygen species produced by the host in response to infection (60). Recently, a
hybrid PK-non-ribosomal peptide compound has been shown to act as an avirulence
factor in M. grisea. Disruption of the gene coding for this compound abolished the
recognition of the fungus by the resistant rice cultivars (l9).

PKs may permit the producing organism to better colonize a particular niche by

either eliminating competition or by helping the organism to resist environmental

 

 

SIC

 

m4}
Sign
me]

Elm

 

gllc
m0}
SUll
Cilia
Sew
Sllcg

Slit}r

 

stresses. Several organisms eliminate competition from surrounding organisms by
secreting antibiotic compounds. Mupirocin (pseudomonic acid A) produced by P.
fluorescens exhibits strong antibacterial activity against the gram-positive staphylococci
and streptococci (11). Soraphen A, 3 PK produced by Sorangium cellulosum is a potent
fungicide. This compound is able to bind and thereby inhibit the activity of the eukaryotic
acetyl-CoA carboxylase (131), a key enzyme in fatty acid biosynthesis. Dimycocerosyl
phthiocerol, a compound of PK origin is a major cell wall lipid of Mycobacterium avium.
When the pksIZ gene required for the biosynthesis of this compound is disrupted, the
mutant colonies became drug susceptible (97) thereby making these organisms less able
to resist adverse environmental conditions. Although the above compounds have been
identified in culture and their role in vivo has not been investigated as yet, further studies
may reveal a competitive edge for the producing organism. PKs may also play a role as
signaling molecules. For instance DIF-l which is a chlorinated PK acts as a signaling
molecule to coordinate development in Dictyostelium (121). Although roles have been
assigned to several PKs, a large number of them remain unaccounted for.

There are several hypotheses for the role of PKs in the producing organism. Any
given organism may produce numerous compounds which when considered individually
may not contribute significantly to the fitness of the organism, but when considered as a
suite of compounds acting synergistically may give the organism a competitive edge (31).
Challis and Hopwood (31) describe the role played by the streptogamins produced by
several Streptomyces spp. A single organism produces two types of compounds, type A
streptogamins which have a mixed polyketide/nomibosomal peptide origin and type B

streptogamins which have a nonribosomal peptide origin. When exposed to individually,

 

4—.—

ll

 

 

an
bu.

 

llcr.

3C1;

 

dilr

Cat“

the

are

both type A and B streptogamins are bacteriostatic by binding to two different sites on
the bacterial ribosome. However the binding of streptogamin A to the ribosome increases
the affinity of streptogamin B to its binding site by up to 40-fold. The binding of both
compounds simultaneously is irreversible. Thus compounds that are bacteriostatic
individually become bactericidal when acting synergistically. Additional roles may
include a shunt for eliminating unbalanced metabolic intermediates (48) and a
mechanism to engage cellular machinery when resources are scarce (25).

PKs are produced by polyketide synthases (PKS), multi-dornain enzymes that
iteratively catalyze the condensation of several rounds of CoA thioesterified carboxylic
acids. Unlike fatty acid synthases which are limited to condensation of acetate and
malonate thioesters, PKSs are able to utilize larger carboxylic acids that may even be
branched or cyclic, in addition to using acetate and malonate moieties. This is one source
of the immense diversity of PK compounds. The basic PKS consists of B-ketoacyl
synthase (KS); B-ketoacyl transferase (AT) and acyl carrier protein (AC) domains
required condense the carboxylic moieties. In addition to these, a PKS may also contain
B-ketoacyl reductase (KR), dehydratase (DH), enoyl reductase (ER), methyl transferase
(MT) and cyclase (CY) domains that further tailor the PK backbone. This variability in
domain architecture and the ability of the PKS to selectively utilize these domains during
each round of catalysis is another source of PK diversity. PKSs are classified based on
the coding of the genes. All the domains of a type I PKSs are coded by a single gene and
are the most prevalent type of PKS in the fungi. The domains of type II PKSs are coded

by separate genes and are generally found among prokaryotes. Type III PKSs are found

 

 

 

 

 

 

 

prel

 

the

 

)et
Plx'l
is k
lhel
pl:
of r

an;

 

rec

an .‘

 

in both prokaryotes and plants. Of the three requisite domains, this type of PKSs contain
only 3 KS domain, and therefore does not fit the classical definition of the PKS (37).

The type I PKSs are further classified as being modular or iterative. The modular
enzymes are composed of several modules, each module containing the numerous
domains required to add on and modify a single carboxylic acid. Thus it is possible to
predict the number and type of carboxylic acids that are condensed by these enzymes and
the expected structure of the final compound by examination of the predicted amino acid
sequence of a modular enzyme.

The iterative enzymes are composed of a single suite of domains that act
iteratively. The KS, AT and AC domains involved in chain elongation are active during
each round of condensation while the other domains (e. g. KR and MT domains) that
catalyze modification reactions are active during selective rounds of condensation.
Although numerous PKSs belonging to this class have been identified recently due to the
sequencing of several fungal genomes, the products of a majority of these genes have not
yet been identified. Unlike the modular PKSs, not enough is known about the iterative
PKSs to be able to predict the nature of the compound that is produced. However enough
is known that it is possible to identify the catalytic domains coded by the enzyme and
thereby predicts the broad class of compound that is produced. The kind of domains
present and the extent of their activity during each condensation cycle determine the state
of reduction of the final compound. If the enzyme contains the reducing domains KR, DH
and ER, the resulting compound is classed as a reduced compound. The KR domain will

reduce the ketone group to an alcohol, the DH domain will further reduce this alcohol to

an alkene by the removal of a molecule of H20 and the ER domain fully reduces the

alkene to an alkane. PKSs that have all three reducing domains that are active during
most of the condensation cycles result in highly reduced compounds that are linear such
as T-toxin (109) and fumonisin (103). The PKS that produces the backbone of fusarin C
has only KR and DH domains (115). The product of this PKS is not as extensively
reduced. The absence of these reducing domains results in the production of a compound
that is unreduced. Since the unreduced compounds have their ketone groups intact it
makes the PK backbone highly reactive and the resulting molecules tend to be cyclic (76,
133). This cyclization may occur via a Claisen type condensation or a Knoevenagel
(aldol-like) type condensation. With the characterization of an increasing number of
entire fungal PKS sequencess, it is possible to identify a PKS as being reducing, by
simply determining the conserved domains present in the amino acid sequence.
Previously, the sequence of the KS domain was the information most readily available for
a larger proportion of the PKS genes. Bingle er al analyzed the sequences of KS domains
from several characterized and putative fungal PKSs and identified a dichotomy in the
sequences. Closer examination of the characterized PKSs revealed that the sequence of
the KS domains predicted if the gene would be classified as being reducing or non-
reducing. They referred to these two groups the MSAS type and wA type PKSs (16).

A major portion of the PKs studied to date are of bacterial origin, the
Actinomycetes being the major contributors (31). Mining the numerous genomes that
have been recently sequenced indicates that the filamentous fungi rival prokaryotes in the
number of putative PKS genes identified in each organism. While Neurospora crassa is
predicted to have only seven PKS genes (20), C. heterostrophus is predicted to have 25

with several other Ascomycetes ranging inbetween (73). Evidence suggests that the

lichens may prove to have the largest number of PKS genes within a single organism
(86). PKs of bacterial origin have been extensively studied and their vast diversity
exploited for numerous uses. Though this resource is not yet exhausted, the vast array of
potential PKS genes along with genes for numerous other “natural products” that are
emerging with the each new genome that is sequenced, represent an untapped goldmine
of novel compounds that can be investigated for various activities from antibiotics and
anti-cholesterol agents to numerous other industrial uses.

In the past the study of PKSs involved the identification of a bioactive compound
and the subsequent elucidation of the biosynthetic pathway. Identification and cloning of
the pathway genes came last. The most productive method of isolating the PKS genes
was to use degenerate primers to amplify the highly conserved KS domain (16, 103).
Other options were to screen mutant libraries generated by either random insertional
mutagenesis (80) or by exposure to either chemical mutagens or ionizing radiation. Since
the mutants generated by random insertional mutagenesis are “tagged” because the
mutation is caused by the insertion of a plasmid containing a selectable marker, it is
possible to identify the locus where the plasmid is inserted with a relative degree of ease
once a mutant of interest has been identified. However, the generation of such a library is
labor and resource intensive. On the other hand using either chemical mutagens or
ionizing radiation is both easier and cheaper, although it is laborious to identify the
mutated gene in the mutant of interest. With the availability of whole genome sequences
this tedious and time consuming venture has been greatly simplified. It is still not simple
to visualize a compound based on the sequence of the synthetic gene(s), however we are

able to identify these genes and manipulate them with much more case. Upregulation of

genes in the native system or expression in a heterologous system should facilitate the
identification and characterization of the compound produced. This pool of novel
compounds can be further expanded by modification of the biosynthetic genes or by the
combination of parts of different genes. The ultimate goal would be to tailor the
biosynthetic gene(s) to produce the required compound. This would enable the
production of compounds with very specific activity, an invaluable attribute especially
for the pharmaceutical and agrochemical industries. PKS genes are a prime for this
purpose since they are multidomain enzymes. The synthetic product can be modified by
manipulating the domains or swapping domains from other PKS genes thereby modifying
the extent of reduction of the ketide and the kind of carboxylic acid incorporated during
the condensation cycle. An exhaustive study of PKS genes in fungi should provide the
necessary database to formulate these modifications. Since the advent of the Golden Age
of antibiotic discovery in the 1950’s, a large number of secondary metabolites of
pharmaceutical interest were identified (31). Although a number of compounds have been
discovered in recent years, the rate of discovery has declined drastically while the need
for novel compounds has grown. Several factors have contributed to this demand
including the emergence of resistant strains and novel strains of pathogens and the
growing prominence of previously obscure diseases like aspergillosis or candidiasis due
to compromised immune systems as a result of HIV/AIDS infections or patients using

antirejection drugs. The need to identify novel compounds has never been greater.

The fungus Gibberella zeae Schw. [Schwein.] Petch (anamorph Fusarium
graminearum Schwabe) is a major causal agent of the disease Fusarium Head Blight
when it infects cereals such as wheat, oats and barley and corn. Characteristic symptoms
of the disease include the initial water soaked brownish spots on the developing head that
spread throughout the head progressing to premature bleaching of the spikelets (94). As
the season progresses, the normally vertical awns become deformed and horizontal on the
infected spikelets. The saprophytic mycelia of the fungus are able to over winter in the
debris left over in the field after the previous year’s harvest. In springtime, when as
conditions become warmer and in the presence of adequate moisture perithecia begin to
develop on the exposed parts of these debris. Perithecia are the sexual fruiting bodies
produced by asocomycetous fungi including G. zeae. The fungus undergoes sexual
reproduction to produce meiotic spores known as ascospores within the asci, which are
sac like structures. The perithecium develops around these structures and may offer a
degree of protection both from physical forces and UV radiation since it is composed of
heavily pigmented cells. In G. zeae this appears to be a melanin-like black pigment.
Under optimal conditions the mature ascospores are forcibly ejected from the perithecia.
Although the exact signals that trigger ascospore discharge are not known as yet; light,
temperature and moisture have been shown to play a role (110, 125). Ascospore
discharge in G. zeae occurs around the time of anthesis in the wheat heads. The airborne
ascospores are deposited on the extruded anthers where they initiate a primary infection
(96). Wheat heads are most susceptible to infection during this period (46). Macroconidia
(asexual spores) also develop on the debris and are able to infect the anthers (99). The

germinating spores grow saprophytically as they proceed to colonize the dead anthers.

10

 

 

 

 

 

at."

 

(7°
‘7‘

fur

SU\

 

 

 

The hyphae subsequently penetrate the ovary and eventually infect the floral bracts
including the inner and outer glumes, lemma and palea initiating an infection. As the
fungal hyphae ramify throughout the spikelet, it also spreads to other spikelets on the
wheat head as the disease progresses and eventually spreads through the culm to colonize
the vegetative tissue. While infection results in sterile florets if the fungus reaches the
ovary prior to fertilization, infections that occur during the later stages [from fertilization
to the soft dough stage (99)] of grain development result in low weight, deformed grain
that is extensively colonized by the myceliurn. The macroconidia persist in the
atmosphere may cause secondary infections in the tillers that mature later on (46) and it is
possible that they infect and colonize the vegetative parts. This infected vegetative matter
that is left over in the field at harvest acts as a source of inoculum during the following
season.

A consequence of Fusarium Head Blight infections is the contamination of the
grain with the numerous mycotoxins produced by the fungus. To date the characterized
mycotoxins produced by this fungus include deoxynivalenol (DON), zearalenone (zen),
fusarin C and aurofusarin. Although infection can be rampant under conducive conditions
such as high moisture and low temperature, the extent of infection is not always a reliable
indicator of the extent of mycotoxin contamination since mycotoxin production continues
post harvest. The pathogen’s interactions with stressful environmental conditions
including fungicides (79) and competing micro-organisms (89) may also result in
unexpected levels of mycotoxins. Studies show that DON is produced throughout seed

development in the infected plant (4) and levels of the toxins may increase during storage

11

 

 

 

ALT;

 

Sb
lg 'n
lrit'
re‘. ,
rlh
001;
all:
enz

tha:

 

Vin.

inc}

(l7). Zen is generally detected during storage of grain under sub-optimal conditions (57).
Aurofusarin and fusarin C have not been investigated in depth as yet

DON, also known as vomitoxin; is a type B trichothecene compound. Although
the type B compounds are much less potent than the type A compounds, the effects of
exposure to the type B compounds are likely to be of greater importance in practical
situations due to their prevalence, their wide spread effect on numerous species and
synergistic effects with the co-occun'ing mycotoxins fusaric acid and fumonisins (38).
Symptoms of exposure to DON in humans and animals include a decrease in food intake
or feed refusal, vomiting and digestive disorders. This results in losses in weight gain
(35), an undesirable feature in animals reared for meat production. Swine are the most
susceptible to DON, whereas poultry and ruminants are affected to a lesser extent (35). It
is believed that the microflora in the rumen of the ruminants are able to break down the
trichothecene compounds and thereby reduce their toxicity (38). Extensive studies have
revealed that all trichothecenes are able to bind to a single site on the eukaryotic 60S
ribosomal subunit and thereby inhibit peptidyl transferase activity which is required for
polypeptide elongation and termination. In addition to the effects on animals, DON also
affects the host plant during pathogenesis. Disruption of the Tri5 gene coding for the
enzyme that catalyzes the first committed step in trichothecene biosynthesis has shown
that DON acts as a virulence factor since the strains unable to produce it are reduced in
virulence (105).

Fusarin C, a mycotoxin of PK origin, is produced by a number of Fusaria
including G. zeae (115). Toxicological studies of this compound have demonstrated that

the mutagenic activity of this compound is comparable to that of aflatoxin B1 (27). It has

12

 

 

 

also
“3?
as a
tile
Stu-
ac."
lllh
dm
syrr

will

b} (
gm
ml

2115i-

 

 

also been implicated in esophageal cancer. Aurofusarin is a homodimeric
naphthoquinone with a deep carmine hue (114). Aurofusarin has recently been classified
as a mycotoxin because studies have shown that changes in egg yolk color and a negative
effect on meat quality in chicken were associated with exposure to this compound.
Studies revealed that exposure to aurofusarin affected carotenoid and vitamins A and E
accumulation in the egg yolk, thereby affecting the antioxidant status (42). In chicken,
this would not only reduce the consumer value of the eggs but also affect the
development of the chicken embryo. Descriptions of Fusarium Head Blight disease
symptoms are linked to the pink or red hue aurofusarin lends to the infected tissue (54)
which has been detected in concentrations as high as 4.2 mg/kg in stored grain (71).
During the 19503 and 19605 there were severe epidemics of maize ear rot caused
by G. zeae in Minnesota and the surrounding states. Farmers who used this contaminated
grain to feed swine initially reported symptoms of vomiting and feed refusal which was
eventually attributed to trichothecene contamination. In addition to these symptoms they
also noticed symptoms of hyperestrogenism in the swine (129). This outbreak led to the
study of zen as a mycotoxin. The initial studies were pioneered by Stob (118) and
Christensen (34) who identified it as the compound responsible for causing the
hyperestrogenic syndrome in swine. This was followed by identification of the structure
of the compound as a 6-(10-hydroxy-6-oxo-trans-l-undecenyl)—B resorcylic acid lactone
by Urry (130). Much work has also been done to elucidate the biosynthetic mechanisms
of zen. Steele (116) used a two pronged approach to show that zen was synthesized via a
PK pathway. They were able to show that only labeled acetate and malonate moieties

which are precursors for the PK pathway, were incorporated into zen while precursors of

13

 

 

 

 

 

[0

l...

ill

0.0

S»

ZCll

 

 

other pathways involved in secondary metabolism (shikimate, senecioate and mevalonic
acid) were not incorporated in any significant amount. They confirmed their findings
using degradation studies. Despite this, no efforts had been made to identify the genes
involved in the biosynthesis of zen to date even though the biosynthetic mechanism of
several other PK mycotoxins such as fumonisin (101) and aflatoxins (23) to name a few
have been studied in great detail. Therefore the quest for the genes involved in zen
biosynthesis is pertinent and timely.

As a mycotoxin, zen has been shown to have estrogenic activity on consumption
by mammals. Therefore ingestion of zen can have a range of effects similar to exposure

to high levels of estrogen. However, poultry appear to be resistant to the adverse effects

of this compound. Acute tests indicate that zen has a very low toxicity (LD50=2-10 g/kg

body weight), while chronic investigations reveal that it has adverse effects on mammals
at levels as low as 1.5-3 mg/kg body weight) (98). Swine, specially pre-pubertal gilts,
have been found to be the most sensitive to zen exposure, affecting the reproductive
system and reproductive health of these animals (78). Low doses (1 ppm) of exposure to
zen result in fertility disorders in swine and cattle while higher doses (50—100 ppm)
adversely affect reproductive processes such as ovulation, conception, implantation, fetus
development and the newbom’s viability. Some of the more common symptoms of
hyperestrogenism include enlargement of mammary glands, vulvovaginitis, atrophy of
ovaries and spontaneous abortions in females and enlargement of mammary glands and
atrophy of testes in males [ reviewed by (35)]. These adverse effects of zen have lead to a

much more comprehensive investigation of the effects of exposure to this compound.

14

In addition to cereals, zen has also been shown to contaminate a range of other
foodstuffs including sorghum, sesame seed meal, pecans and bananas (75). Processing of
some foods has led to increased levels of the toxin. It may also be transmitted to humans
from contaminated feed via milk products (75) and via meat products from cattle treated

with zearanol, a derivative commercially used as a grth promoter (66). Although zen

has fairly low toxicity and carcinogenicity levels with an LDSO of 2-10 g/kg (75), chronic

exposure and synergistic effects of other environmental estrogens of both plant and
anthropogenic origin establish effects on mammals as low as 1.5-3 mg/kg body weight.
These levels have been detected in world wide food supplies (38, 98). More susceptible
sub-populations such as the unborn and very young would be affected by much lower
levels of the toxin (113). It is thought that zen is able to elicit these effects by its ability to
bind the human nuclear estrogen receptor (69, 83). Although zen does not have a typical
steroidal structure, studies have shown that it is able to bind to the estrogen receptor,
albeit with a 10-100 fold lesser efficiency than the native 17B-estradiol (75).

The effects of the several mycotoxins presented here are observed by feeding the
sensitive test subjects relatively pure forms of the compounds. However in nature,
especially under agricultural conditions the feedstuffs will be contaminated with several
species of Fusarium, Aspergillus and numerous other fungi notorious for producing
mycotoxins including fumonisins, aflatoxins. Even though the animals or humans may
not usually encounter lethal doses of any one toxin, they will be exposed to varying levels
of several toxins, each exerting its characteristic impact. Over time these effects will be
cumulative and cause greater damage. In addition, some of the toxins may have

synergistic effects which are much more deleterious (38).

15

In summary PKs are a family of compounds produced by a wide range of
organisms, but most extensively studied in bacteria and fungi. These compounds have a
wide range of activities that have long been exploited by man. In recent years they have
yielded a number of useful compounds and revolutionized several fields including
medicine and agriculture. Several PKs have also been found to play important roles in the
producing organisms as pathogenicity and virulence factors and less commonly as
signaling molecules and avirulence factors. In fungi, PKs are produced by the iterative
condensation of a variety of carboxylic acids by multidomain enzymes. The specific
carboxylic acid incorporated into the compound, the kinds of domains present in the
enzyme and specific domains that are active during a particular round of condensation all
contribute to the immense diversity of PKs.

G. zeae, the fungus that infects cereals to cause the devastating disease Fusarium
Head Blight, produces three characterized PK mycotoxins, namely zearalenone,
aurofusarin and fusarin C. The toxigenic effects of zearalenone have been studied
extensively since the 1960’s. Both aurofusarin and fusarin C had been identified
previously; however their importance of mycotoxins was recognized only recently. The
PKS genes involved in the biosynthesis of these compounds have been identified, but
much of the biochemistry remains to be understood. Further study of the biochemistry of
these and other PK compounds is pertinent with the present demand for novel compounds
for a variety of purposes, most importantly for use as antibiotics and agrochemicals.

In this study we have identified and characterized all fifteen of the PKS genes
encoded in the genome of G. zeae and were able to assign function to five of the genes.

Characterization of these genes will enable us to identify the corresponding PK

16

compounds themselves and also demarcate the gene cluster encoding the enzymes needed
to tailor the PK backbone. This study would not only yield novel compounds to be
assayed for bioactivity but also the information needed to modify the genes to modify the
compound as needed. We were also able to specifically identify two PKS genes involved
in the biosynthesis of zen. This is the first reported instance where two PKS genes may

be involved in producing the backbone of a PK compound.

17

FUNCTIONAL ANALYSIS OF THE POLYKETIDE SYNTHASE GENES IN THE

FILAMENTOUS FUNGUS Gibberella zeae (ANAMORPH Fusarium graminearum)

Iffa Gaffoor, Daren W. Brown, Ron Plattner, Robert Proctor, Weihong Qi, and Frances

Trail

Abstract

Polyketides are a class of secondary metabolites that exhibit a vast diversity of
form and function. In fungi, these compounds are produced by large, multi—domain
enzymes classified as Type I polyketide synthases (PKS). In this study we identified and
functionally disrupted 15 PKS genes from the genome of the filamentous fungus
Gibberella zeae. We found that five of them are responsible for producing the
mycotoxins zearalenone, aurofusarin, fusarin C and the black perithecial pigment. A
comprehensive expression analysis of these genes revealed diverse expression patterns.
during grain colonization, plant colonization, sexual development, and mycelial growth.
We were unable to detect expression of one of the PKS genes under any of 18 conditions
tested. This is the first study to genetically characterize a complete set of PKS genes from

a single organism. The role of PKs in the fungal life cycle and in evolution is discussed.

18

(31

Cl

PF

Introduction

Secondary metabolites are a remarkably diverse class of cellular products that
often exhibit taxonomic specificity. In microbes, these unique biochemicals are usually
produced after a period of active growth has depleted the substrate (13, 18) and
biosynthesis often coincides with differentiation, especially sporulation (12). Polyketides
(PKs; derived from poly-ketone) are a class of secondary metabolites produced by most
organisms, but they have been most extensively examined in bacteria and fungi. In fungi,
PKs include a range of compounds such as the mycotoxins aurofusarin (114) aflatoxin
(15), and zearalenone [zen, (130)] and the green spore pigment of A. nidulans (84, 133).

Secondary metabolites are generally considered “nonessential” for organismal
growth under culture conditions (12). However, their role in life cycles in the natural
environment is not well understood. Many functions have been proposed for PKs,
including: 1) a shunt for eliminating unbalanced metabolic intermediates (48): 2) a
mechanism to engage cellular machinery when resources are scarce (24); and 3) a means
to control differentiation (135). However, the most plausible explanation for the diversity
of secondary metabolites is that the ability to produce a wide variety of compounds is
ecologically and evolutionarily advantageous as a resource for bioactive compounds (31,
47). For example, several actinomycetes synthesize two chemically unrelated
metabolites that act against the same target organism (31). Thus unrelated compounds
may be selected for the same activity when important to organism survival.

The study of fungal PKs has been limited by the difficulty of detecting and
characterizing the PK itself. Complete analysis of the genetic potential of fungi to

produce PKs became possible only recently when the genomic sequences of several

19

 

In

0V.

Uil".
00."
do:
can

revs

 

do:
dilll‘
let;
and
All
con

PK.‘

muj
Kro
iron
man.

Still;

fungal species became available. Now, the selective cloning of genes encoding
polyketide synthases (PKSs) can precede identification of a product and contribute to the

overall analysis of the total PK potential of an organism.

PKs are synthesized by adding successive acetate groups to form a chain of C2

units with alternating ketones and the resulting chain is modified to form a unique
compound which could be either linear or aromatic. The minimal PKS consists of three
domains; a ketosynthase (KS) domain, an acyltransferase (AT) domain and an acyl
carrier protein (ACP) domain. Such an enzyme is said to be non-reducing and the
resulting PK is aromatic with unmodified ketone groups. In addition to the three requisite
domains, some PKS5 may also have a B-keto reductase (KR) and a dehydratase (DH)
domain and occasionally enoyl reductase (ER) domain which are able to reduce the
ketone groups to varying extents (51, 93). The resulting enzymes are said to be reducing
and produce linear PK compounds. Reducing PKSs often also have a methyl transferase
(ME) domain. Variability in the type, number and activity of these domains after each
condensation cycle contributes to further diversity of metabolites generated by fungal
PKSs.

Sequence comparisons of the fungal KS domains support the existence of two
major groups of PKSs: the reducing PKS5 and the non-reducing PKSs (16, 92). Recently,
Kroken er al. (73) conducted a thorough phylogenetic analysis of putative PKS genes
from the fungal genomes of Neurospora crassa, Cochliobolus heterostrophus, Gibberella
monilrformis, Botryotiniafuckeliana, Saccharomyces cerevisiae, Eremothecium gossypii,

Schizosaccharomyces pombe, G. zeae and previously characterized fungal and bacterial

20

 

FU\..
\l‘hc.
“hi.
prod

chi

 

COM
137i
etlcn
antler
Show

Chro

pr Ode,

306’ tr

 

PKS genes. This analysis also suggests that the filamentous fungi rival the actinomycetes
in PK numbers and diversity.

In fungi, many PKS genes so far characterized have been found within a gene
cluster, which also includes genes for further modification of the PK. The aflatoxin
biosynthetic gene cluster is one example consisting of the PKS gene, two genes that
encode for a fatty acid synthase, seven monooxygenase genes and seven dehydrogenase

genes that are required for aflatoxin biosynthesis (139, 140).

The filamentous fungus Gibberella zeae [Schwein.] Petch (anamorph

Fusarium graminearum Schwabe) is a major causal agent of Fusarium head blight of
wheat and barley worldwide and produces the trichothecene mycotoxin deoxynivalenol,
which is a significant contaminant of human food and animal feed (36). The fungus also
produces three PK derived mycotoxins zen (130), aurofusarin(114) and fusarin C (115).
Zen is an important source of environmental estrogens when contaminated grain is
consumed by humans (74) and may also have effects on sexual development in fungi (91,
137). The toxicological effects of aurofusarin and fusarin C have not been studied
extensively. Aurofusarin is known to have adverse effects on avian species; it affects the
antioxidant composition and the fatty acid profile of the eggs (42). Fusarin C has been
shown to have mutagenic properties in the Ames test. It has also been shown to cause
chromosomal aberrations in mammalian cell cultures (53).

We initiated the work described here to identify the genes responsible for
production of zen in G. zeae (52). During the investigation, the genomic sequence of G.

zeae was completed, allowing us to identify all 15 PKS genes. To determine the functions

21

 

Fun;

lFGS

0.
80(

On \lc

 

of the products of these PKS genes in the life cycle of G. zeae, we have genetically
disrupted each of the 15 PKS genes and characterized the mutated transforrnants. A
complete analysis of the phenotypes of the individual mutants indicates a variety of roles,
some obvious and others more subtle, for these PKs in the growth and development of the
organism. We also analyzed the expression of each of the genes under a range of
developmental, nutritional and pathogenic conditions. This is the first study to genetically

characterize a complete set of PKS genes from a single organism.

Materials and Methods
Fungal strains and growth conditions.
The strain of G. zeae used for this study was a Michigan field isolate, PH-l

(FGSC 9075, NRRL 31084). All strains were maintained as mycelia in 30 % glycerol at -

o
80 C and subcultured on V8 juice medium (128) as needed. PH-l was also maintained

. . 0 .
on sterile son] at -20 C for use as inoculum.

Identification of PKS genes.

To identify the set of putative PKS genes from the G. zeae genome, we analyzed
the first released version of the sequence, before automated gene calling had been done.
The genomic sequence of G. zeae was obtained from the Broad Institute at MIT
(http://wwwbroadmitedul). Ab initio gene identification was accomplished using
FGENESH (http://wwwsoftberrycom) with organism-specific parameters for

Neurospora crassa (26). The local F. graminearum genome database, predicted ORF

22

U54

W

588

pre

rm

lwc

BL.-

 

 

database, predicted protein database and EST database were set up using FORMATDB in
the NCBI stand-alone BLAST tool (ftp://ftp.ncbi.nih.gov/blast/executableg). Sequence
similarity searches were applied to the local F. graminearum database using BLASTN,
BLASTP, and TBLASTN in the NCBI stand-alone BLAST tool. Default parameters were
used but the cut off E-value was set at 1 instead of 10. The initial queries for the searches
used the nucleotide sequences for F. graminearum PKS clones to perform the BLASTN
search against the F. graminearum genome database. For each PKS gene identified, the
predicted protein sequence was used to perform the TBLASTN search against the F.
graminearum genome database to identify additional related sequences. Similarly, the
twelve known fungal PKSs obtained from NCBI were used to perform TBLASTN and
BLASTP, searching against the F. graminearum genome database and predicted protein
database. The twelve known fungal PKS sequences were aligned using the CLUSTAL W
(122) default parameters in slow/accurate mode. The multiple alignment was used as
input for the HMMBUILD module of HMMER 2.2g (41) to build the profile Hidden
Markov Model (HMM). The profile HMM was used to search the F. graminearum
predicted protein database using HMMSEARCH. The default cutoff values were used to
filter the query results. Twelve previously characterized fungal PKS sequences
(Aspergillus nidulans wAp, GenBank Q03149; A. fumigatus ALB 1p, GenBank
AAC39471; A. terreus LOVBp, GenBank AAD39830; A. terreus MSASp, GenBank
AAC49814; A. parasiticus PKSL2p, GenBank AAC23536; Cochliobolus heterostrophus
P KS 1 p, GenBank AAB08104; Colletom'chum lagenarium PKSlp, GenBank
B[\4418956; Emericella nidulans PKSSTp GenBank Q12397; G. moniliformis FUMlp,

GenBank AAD43562; G. fujikuroi PKS4p, GenBank CAD19100; Nodulisporium sp.

23

 

 

.lnm

WlM

Fun

then
phen
arnpl
each]
[be $0

phmpf

 

ATCC74245 PKS 1p, GenBank AAD38786; and Penicillium patulum MSASp, GenBank
P22367) were used as input for the motif discovery tool Multiple Expectation-
maximization for Motif Elicitation (MEME) to build PKS motif profiles (6). The log-
odds matrix of the motif(s) was used to search the F. graminearum predicted protein
database by using the Motif Alignment Search Tool (MAST) (7) with default parameters.
The search results were also curated manually as described above. For each putative gene
identified, and for known fungal PKS genes used in this study, BLASTP, CDART and
RPS_BLAST searches were applied to the GenBank nr database and the conserved
domain database, respectively, using NCBI web services
(http://www.ncbi.nlm.nih.gov/BLAST[) to obtain and compare domain structures of these
genes. Each putative PKS gene was also used to perform a TBLASTN search against the
F. graminearum EST database to investigate the transcription of the predicted genes.
Amino acid (aa) sequences were analyzed by the PILEUP and PRETTY programs of the

Wisconsin Package version 103-UNIX (40).

Fungal transformation and gene disruption.

To determine functions of each of the 15 PKS genes, we genetically disrupted
them individually and subsequently analyzed the disrupted transformants for changes in
phenotype under a variety of conditions. Disruption vectors were generated by PCR
amplification of a 500 bp-l750 bp fragment located downstream of the start codon of
each predicted gene (Table 1, Appendix A). The amplified fragment was then ligated into
the SmaI site of pHYG4, a vector carrying the selectable marker hygromycin B

Phosphotransferase (hph ) (29). These vectors were used to transform the wild type PH-l

24

2b

dis

 

pl}.

Sit~
LO

C01

1501
“Al
l}\ll
“Cifi

Cit}

 

0N
protr
Solul
PM
0. l ’i;
Petr] .
RM 1

San l.

 

 

as described below. Genes were disrupted by single crossover integration of the
disruption vector into the homologous portion of the genome.

Transformations were performed on germinated conidia using a previously
published protocol (104) with the following modifications. Approximately 0.3 g soil

stock was used to inoculate carboxymethylcellulose (CMC, Sigma Chemical Co., St.

0
Louis, M0) medium which was then incubated for 72 hr at 25 C at 250 rpm (28).

Conidia were harvested by centrifugation and germinated in YEPD (0.3% yeast extract,
1% bactopeptone, and 2% D-glucose) broth for 12-14 h at room temperature at 175 rpm.
Isolation of protoplasts occurred in 25 mg/ml driselase (InterSpex Products, Inc. San
Mateo, CA.), 0.05 mg/ml chitinase (Sigma Chemical Co., St. Louis, MO), and 5 mg/ml
lysing enzyme (Sigma Chemical Co., St. Louis, MO) in a 1.2 M KCl buffer. Protoplasts
were collected by filtration through a 30 um Nitex nylon membrane (Tetko Inc., Kansas
City, MO) and washed three times in STC buffer (1.2 M sorbitol; 10 mM Tris-HCl, 50

mM CaC12, pH 8.0). Transformation was performed in a 500 pl volume with 106-108

protoplasts, 25 ug of the disruption vector, and was mediated by 30% polyethylene glycol
solution (30% PEG 8 000, 10 mM Tris-HCl, 50 mM CaClz, pH 8.0) in STC buffer).
Protoplasts were transferred to 250 ml Regeneration Medium (RM; 0.1% yeast extract,
0.1% casein enzyme hydrosylate, 0.8 M sucrose and 0.75% agarose) and distributed to
Petri plates (15 ml each). Cultures were incubated for 15 hr and then overlaid with 10 ml
RM amended with 150 ug/ml hygromycin B (HygB; Calbiochem-Novabiochem Corp.,
San Diego, CA) to recover transformants. Putative transformants were selected within 4-
7 days and hygromycin resistance was confirmed by growth on V8 juice medium

amended with 450 ug/ml HygB. Hygromycin resistant (Hng) colonies were transferred

25

to a 2% water agar medium and genetically pure single spore isolates were obtained for
further analysis.

Single spore isolates of putative transformants were screened for gene disruption
using Southern blot analysis. Genomic DNA was isolated from putative transformants as
previously described (61, 68) and cut independently with two different restriction
enzymes. The restriction enzymes chosen for each analysis were paired such that one
recognized a unique site within the disruption vector and one recognized sites only
outside the vector. Restriction cut DNA was separated by electrophoresis and Southern
analysis was performed for each of the digested samples. Probes were based on the
specific amplicon used for gene disruption and a portion of hph (588 bp). Based on
Southern data, we selected, for further analysis, two independent disruption mutants for
each PKS gene and one transformant that resulted from ectopic integration of each
vector. All nucleic acid manipulations and molecular procedures were carried out

according to standard methods (11 1).

Characterization of growth and pathogenicity of PKS mutants.

Transformants were characterized for their ability to produce perithecia and to
discharge normal ascospores and their mycelial growth compared to the parent PH-l.
Both PKS mutants and the ectopic transformant for each target PKS were center
inoculated onto carrot agar (70) in 100 mm Petri dishes, and two diameters were
measured per plate after 3.5 days of growth (days after inoculation - dai) to determine the
area of the growing colony. The experiment was performed in triplicate for each isolate.

A mixed model ANOVA (SAS PROC UNIVARIATE) was used to compare the growth

26

 

{till

U‘Cl

rates between the mutants and the wild-type. Differences in grth rate were compared
using a Tukey’s comparison (72). Once the mycelia grew to the edge of the plate, mature
perithecia were generated as previously described (70). On 10 dai, the gross morphology
of the perithecia were observed and ascospore discharge was characterized as previously
described (123).

Transformants were screened for changes in pathogenicity on wheat. Five
greenhouse virulence tests were conducted on the wheat cultivar Wheaton essentially as

described (39). Inocula were generated by grth on mung bean liquid medium for 4 d at

O
28 C with shaking at 200 rpm (5). The macroconidia were filtered, concentrated by

centrifugation, rinsed and suspended in water. Wheat heads were inoculated by injecting

a drop of water containing approximately 10 macroconidia into one floret of a spikelet

located in the lower third of each head. Ten heads were injected for each treatment and
control heads were injected with water. Injected heads were enclosed in plastic bags for
three days. Visual disease assessments were recorded at 2- to 3- day intervals 18 to 21
days after inoculation and overall disease severity was calculated as a percentage of
blighted spikelets in each head. The wheat heads were allowed to mature, then were

harvested and individually threshed to collect seeds.

Chemical analysis of PKS mutants.

Transformants were tested to detect the loss of ability to produce zen, fusarin C,

aurofusarin. To test whether zen was accumulating in the disrupted transformants, we

used thin layer chromatography (TLC). Transformants were grown on Uncle Ben’s®

27

 

(‘3

3C

20:

pl!

Original Converted Rice (MasterFoodServices, San Antonio, TX), a vitamin-
supplemented parboiled rice, found to stimulate zen production (95, 117). Rice (25 g)
was aliquoted into Erlenmeyer flasks and soaked in 20 ml of distilled water for 2 h. After

autoclaving for 1 h, the clumps of rice were broken up and allowed to stand over night.

The following day the rice was re-autoclaved for l h and inoculated with 10 -10

conidiospores in 2 ml of distilled water. The culture was transferred to Petri dishes (100
mm X 25 mm), taped with Tenderskin hypoallergenic paper tape (The Kendall Company,
Mansfield, MA) and incubated at room temperature for one week. During this period,

cultures were monitored to confirm uniform colonization of rice across all samples. After

. 0
one week, the cultures were transferred to an incubator at 11 C for two more weeks

0
(120). At harvest, the cultures were dried in an oven at 55 C for 3—4 days and ground to

a fine powder using a domestic coffee grinder. For TLC analysis, 200 mg of each
powdered sample was extracted in 100% methanol for two hours and TLC was
performed as previously described (120). The area on the TLC plate with a similar RF to
authentic zen was collected, resuspended in methanol, and a spectrum analysis performed
according to Mirocha et al. (88).

Although the trichothecene mycotoxins deoxynivalenol (DON) and 3-acetyl DON
are not derived from a PK, their critical importance in the wheat disease process
prompted us to examine if any of the PKS mutants were affected in DON production.
Quantitative combined measurements on both mycotoxins were made on transformants

grown in liquid culture under DON-inducing conditions (85) and the results were

28

compared to those of the wild type, PH-l. DON quantification data were generated using
the commercial competitive ELISA-based Veratox 5/5 kit (Neogen Corp., Lansing,
Michigan) and using a standard curve for DON ranging from 0.25 to 3.00 ppm. OD650
values were measured after the addition of the stop solution to the multiwells. To ensure
accuracy, each sample was quantified twice. DON analysis of transformants grown in
planta were performed differently. Following virulence assays, seed samples for all
transformants and for wild type PH-l were tested for DON. Harvested seeds were ground
to a fine powder and extracted with 4 ml of acetonitrile-water (86:14) per gram with

shaking for 2 h. The solvent extract was filtered through Whatman filter paper and stored

at 4 C)C until analyzed. The concentration of DON was determined by liquid

chromatography-mass spectrometry as described in Baker and Roberts (8).

For fusarin C analysis, transformants and the wild type, PH- 1 , were grown in
liquid YES medium (yeast extract 2%, sucrose 6%, pH 5.5). An equal volume of
acetonitrile was added to 16—day-old cultures. The resulting solution was mixed briefly
and filtered through 0.2 pm nitrocellulose filters. The filtrate was examined for the
presence of fusarins by HPLC-UV absorbance-mass spectrometry (MS). The HPLC
system employed an Intersil ODS3 column (10 cm, 5 um), a flow rate of 0.3 ml/min, and
a gradient solvent system beginning with waterzmethanol 65:35 (v/v) and changed to
waterzmethanol 30:70 (v/v) over the course of 5 min. The latter solvent composition was
held isocratic for 25 minutes. The HPLC column was coupled to a UV detector and the
API source of a Finnigan LCQ Deca MS system (ThermoQuest, San Jose, CA) operated
in the electrospray (ESI) mode. The presence of fusarins was determined by their

retention time and ultra-violet and mass spectra in comparison with authentic Fusarin C.

29

For example, the UV spectrum of a peak with a retention time of 19.2 min showed a
single broad peak with an absorption maximum of 365 nm that was identical to the
spectrum of fusarin C. The mass spectrum of this component was also identical to that of
fusarin C and included signals with masses of 432, 454, and 885, which correspond to the
MH+, MNa+, and 2MNa+ ions, respectively.

For aurofusarin analysis, transformants and wild type, PH-l were grown on potato
dextrose agar (PDA; Difco Laboratories, Detroit, M1) medium for 10 days. A single 10
cm agar plate per transformant was extracted by first cutting the agar into small pieces
and soaking with 30 ml of a 95:5 chloroform/methanol solution overnight. The extract
was then filtered through Whatman #1 paper. The filtrate was examined by HPLC-UV
absorbance—mass spectrometry (MS) and found to contain a broad peak at 17.0 min with
an associated molecular ion of 571 mu. This mass is consistent with that of aurofusarin,

which has been characterized (8).

Expression analysis of PKS genes.

To determine when the PKS genes were expressed in wild type PH-l, we
employed reverse transcriptase PCR (RT-PCR) of mRN A harvested under a variety of
growth and developmental conditions. Efforts were made to choose some conditions that
resembled those the fungus would encounter in nature during its normal life cycle.
Growth on nutrient rich grains was examined using rice agar (91) and moist cracked corn.
Gene expression during sexual development was examined using developing perithecia
harvested from carrot agar 4, 5 and 6 days after induction, representing very young, near-

mature and mature perithecia, respectively (123). Gene expression during plant infection

30

and colonization was observed using wheat tissue harvested from infected heads 1, 4 and
5 dai. Expression during grth on a variety of standard laboratory grth conditions
was also examined. These conditions included an undefined medium rich in reduced
nitrogen (YES) to simulate saprophytic growth under ideal conditions, a natural plant-
based medium (Potato Dextrose broth; Difco Laboratories, Detroit, MI), a synthetic,

defined minimal medium with nitrate as the sole nitrogen source [Czapek-Dox broth (0.6

g NaNO3, 0.6 g K2HPO4, 0.2 g MgSO4, 0.2 g KCl, 0.01 g FeSO4.7H20, 30 g sucrose

per liter)] and starvation conditions (Czapek—Dox broth lacking either a carbon or a
nitrogen source). The last three conditions were selected to simulate the conditions
encountered as the fungus survives winter in the plant debris. Mycelia grown in YES and
PDB were harvested at 48 h and 60 h dai, when mycelia are actively growing, and
nutrients are not yet depleted. The mycelia grown in minimal medium were harvested
after 4 days due to slower growth in these media. Mycelia grown in starvation conditions
were initiated in standard Czapek-Dox broth for 4 days before being transferred to
starvation media where they were harvested after 24 h incubation. Mycotoxin-inducing
conditions were generated on rice agar (91) and DON-inducing medium (85). In addition,
we examined conditions for conidiation (CMC medium); conidia and mycelia were
harvested 5 days after inoculation.

All samples were harvested from 2-8 independent replicate cultures, pooled,

0
frozen at -80 C and lyophilized overnight. RNA was extracted using TRIzol Reagent

(Invitrogen Life Technology, Carlsbad, CA) and treated with RNase-Free DNase I

(Roche Diagnostics Corporation, Indianapolis, IN) as per manufacturer’s instructions.

31

First strand cDNA synthesis was carried out with SuperScript II Rnase H— Reverse
transcriptase (Invitrogen life technologies, Carlsbad, CA) using random hexamers. Gene-
specific primers (Table 2, Appendix A) were used to amplify regions of each PKS gene
to identify the conditions under which they were expressed. The primers used to generate
the disruption vector were used to amplify the genes AURI, GzFUSI, PGLI, PKSZ,
PKS] 1, PKSI4, and PKS] 7. For genes KSAI, PLSPI, ZEAI, PKS], PKSS, PKS6, PKS7,
and PKSQ, alternate primers were designed. In all cases, except for PKSII and PLSPI,
primers were designed either to amplify a product that included an intron so as to
distinguish between amplicons generated from contaminating DNA and mRNA or to
span an exon—exon junction to ensure that no residual DNA was amplified. Although the
primers used to amplify the mRN A of PKS] I and PLSPI could not distinguish between a
DNA and mRNA template, they were not redesigned because these two genes had very
specific expression patterns, indicating genomic DNA was not being amplified. In all
analyses, amplification was repeated 3 to 6 times to confirm results. To thoroughly test
expression of all 15 PKS genes under conditions representing those encountered during
the life cycle, 16 different treatments were designed. Due to this large number of

conditions, quantitative PCR was prohibitively expensive.

Results

Identification of PKS genes.

We have identified fifteen putative PKS genes by analyzing the raw genomic

sequence. PKS genes were designated using the previously assigned designations (73)

32

except where function has been determined during this analysis. Examination of the
sequence using HMMER yielded eight putative PKS genes: GzF US l, AURI, PGLI,
ZEA2, PKS6 PKS9, PKS] 1 and PKS] 7. MEME/MAST applications recognized these

eight genes and an additional seven genes: ZEA I , PKS], PKSZ, PKSS, PKS7, GRSI and

-90
PLSPI . All fifteen predicted genes had expect values of E S 10 when compared to the

conserved motifs. The expect value is the probability of this match being found merely
by chance (www.ncbi.nih.gov). In addition to the 15 predicted genes, a sixteenth gene,

designated KSAI (KetoSynthase-ACP), was predicted and had the next lowest E-value of

those genes predicted, E: 10- . We included KSAl in our expression analysis for

comparison. Based on the high similarity of KSAl to B-ketoacyl- acyl carrier protein

-125
synthases (E = 3 x 10 , RPS-BLAST 2.2.9) it is unlikely that this enzyme belongs to

the PKS family. B-ketoacyl- acyl carrier protein synthases are generally involved in the
elongation step of fatty acid biosynthesis.

The complete set of domains comprising each PKS gene was identified by
BLASTX, PILEUP and PRETTY analysis (Table 1, Appendix A). These domains were
verified by aligning the predicted protein sequences with domains identified in previously
characterized PKSs (76, 102) using CLUSTAL W (122). According to the domain
analysis there are five non-reducing PKSs (A URI, GRSI, PGLI, PLSPI and ZEAI) and
10 reducing PKSs (GzFUSI, ZEA2, PKS], PKSZ, PKS5, PKS6, PKS7, PKS 9, PKSII and
PKS] 7). Using the chromosomal map of G. zeae provided by the Broad Institute

(www.broad.mit.edu), we found that 13 of the PKS genes are scattered across the four

33

chromosomes. ZEAI and ZEA2 appear to be divergently transcribed from a shared 1 kb
promoter while AURI is located 15 kb upsteam from ZEAI. The next closest PKSs are

PKS] and PKS9 which are 247 kb apart.

Functional analysis of PKS genes.

To identify the function of the PKS genes, all 15 genes were disrupted
individually using the single-crossover integration approach (Table 2, Appendix A) to
cause insertional mutagenesis of the gene. Up to 16 transformed hygromycin—resistant
transformants were examined for each gene to identify two confirmed disrupted
transformants and one ectopic transformant for further analysis. Southern analysis was
perforated on genomic DNA isolated from each transformant and from the PH-l parent
to confirm the location of the inserted plasmid in the disrupted strains (see appendix).

Growth, development, pathogenicity and mycotoxin production were analyzed for
the set of disrupted transformants of each gene to determine how the functional
disruption affected normal fungal growth and development. Mycelia] growth, as
measured by colony area relative to wild type, was similar to the wild type for
transformants disrupted in AURI, ZEA l, ZEA2, PKS] 7, PLSPI, and GzFUSI. For
transformants disrupted in ZEA2, PKS6, PKS 7, PGLI, PKS9, PKS], and PKSII,
significant increases in growth (ll3%—117%) were observed. Significant decreases in
grth (86% and 68%, respectively) were noted for the GRSI mutants and the PKSZ
mutants. Disruption of the PKS genes did not affect either perithecium production or
function in vitro and perithecia developed and discharged ascospores normally.

Disruption of the PKS genes did not significantly affect pathogenicity on wheat.

34

Several of the PKS disruptants revealed function based on the loss of a known
PK The effects of disruption of ZEAI and ZEA2 on zen production have been described
elsewhere (52). Based on the similarity between GzF US I and PKSs from related
F usarium spp. shown to synthesize fusarin C (115), we predicted that GzF US I mutants
would also be unable to synthesis fusarin C. We found this to be the case as both GzFUSI
mutants failed to synthesize fusarin C while the ectopic transformant synthesized fusarin
C at levels similar to those of the wild type. Similarly, both AURI mutants failed to
produce aurofusarin, the characteristic red mycelia] pigment and mycotoxin, in contrast
to ectopic control strains.

Examination of the PGLI mutants indicated that they did not produce the black
perithecial pigment characteristic of the perithecia of both the wild-type PH-l and the
ectopic mutant (Figure 1, Appendix B). The structure of this pigment has not been
characterized at this time.

In summary, we disrupted 15 genes and were able to determine the function of
five of them: mutants of ZEAI and ZEA2 revealed two genes responsible for zen
production; mutants of A UR 1 revealed a gene responsible for aurofusarin biosynthesis;
mutants of GzF US 1 revealed a gene responsible for fusarin C biosynthesis and the
mutants of PGLI revealed a gene involved in the biosyntheis of the black perithecial

pigment.

Expression analysis of PKS genes.

The wild type PH-l was grown under 11 different conditions and harvested at 1-3

time points for each condition. We then harvested total RNA from lyophilized mycelia

35

and used reverse-transcriptase PCR to determine the expression patterns of the 15 PKS
genes and KSAI. Results of the expression analysis revealed seven groups of genes with
similar expression patterns (Figure 2, Appendix B). We designated these groups as
follows: constitutively expressed (PKS6, KS'AI also follows this pattern); plant specific
(PLSPI); grain specific (GRSI, ZEAI, ZEA2); sexual development related (PKS7, PGLI,
PKS9, PKSII); mycelial growth related (GzF US I , PKS I , PKSZ, PKS] 7); not expressed
in planta (A URI) and expression not detected (PKSS). The sexual development group is
also expressed during grain colonization. Interestingly, PKSZ, which we relegated to the
mycelial growth related group was expressed only in YES48, a condition of active

mycelial growth.

Discussion

Here we present the first comprehensive functional analysis of all predicted PKS
genes from a single filamentous fungus. The complete set of PKS genes in G. zeae,
includes 15 distinct genes and we have identified the functions for five of them. Our work
shows that PKs affect many aspects of fungal biology and are associated with diverse life
cycle stages. Although the patterns of expression appear to be distinct among the
different genes, it is worthwhile, however, to broadly group the genes by expression
patterns (Figure 2, Appendix B), as this will provide a means for pursuing further
functional analysis. In the future we will use groups of PKS genes that are similarly
expressed to determine overlapping functions for the PK products. For example, the
group expressed only during grain colonization includes ZEAI, ZEA2 and GRSI . The

product of GRSI is not known, but it is intriguing to think that zen and the GRSI product

36

might function similarly (the function of zen, however, is not yet clear). Similarly, the
two pigment-producing PKSs have overlapping expression. We can speculate that they
both provide UV and/or desiccation protection for the sexual fruiting body. Both are
expressed in the perithecial wall, contributing to the blue-black color characteristic of G.
zeae perithecia. We are currently exploring the relationship of the groups of PKS genes
by stacking disruption of genes through mating to determine if the effects of disruption
are correspondingly enhanced by the disruption of an entire expression group.

To determine function of individual genes, each of the genes was disrupted and
the mutants examined for changes in development and pathogenicity. Interestingly, the
only PKS (PLSPI) expressed exclusively during plant infection had no pronounced effect
on pathogenicity when disrupted. This gene appears to have a disrupted ACP domain and
therefore may not produce an active compound in the wild type. A detailed analysis of
the expression of this gene over the course of plant infection and colonization would be
necessary to clarify any role it may have during plant colonization. Disruption of two
PKS genes, GRSI and PKSZ, resulted in mycelial growth inhibition during a period of
active mycelial growth. Expression of PKSZ was detected only during the early stages of
active mycelial growth in YES (Figure 2, Appendix B). A closer analysis of the disrupted
mutants of these two genes, including microarray analysis, might reveal a possible
function as a regulator in controlling mycelial proliferation. An example of a PKS that
acts as a signaling molecule is DIF-l; it acts as a signal molecule in regulation of
differentiation in Dictyostelium and is believed to be produced by a Type I PKS (64,
121). A similar phenomenon was observed in A. parasiticus in which disruption of the

PKS FLUP eliminated asexual sporulation, inhibited mycelial growth and significantly

37

reduced aflatoxin production (142). A different type of signaling was observed to involve
a PKS from Magnaporthe grisea in the initial host-pathogen interface. ACE 1 , a
homologue to GzFUSl, was shown to be an avirulence factor recognized specifically by
resistant rice (19). Such an interaction has not been observed for GzFUSI. These three
examples from other fungal species illustrate the very important life cycle roles that PKs
play.

Based on the striking phenotype of the disrupted mutants, we identified AURI as
the PKS responsible for the biosynthesis of the carmine pigment aurofusarin in G. zeae
(114). A number of the genes flanking AURI encode for enzymes consistent with the
conversion of the initial PK monomer to the final dimeric structure. A recent report is
consistent with our findings (81). In contrast to the GRSI and PKSZ disrupted mutants,
AURI disrupted transformants were able to grow faster than the wild type on PDA,
suggesting that aurofusarin production taxes the fungus thereby limiting growth or the
compound itself is inhibitory to growth. Interestingly, on carrot agar, this growth
differential was not observed for AURI mutants.

We were unable to detect expression of PKS5, under any of the conditions tested
and disruption of this gene did not yield a distinctive phenotype. It is possible that PKSS
is either expressed under highly specialized conditions hitherto untested or at very low
levels. It is also possible that PKSS may not produce a functional PKS in G. zeae, a
hypothesis that is supported by the lack of a functional KS domain.

The domain analysis of the predicted PKSs of the reducing group revealed the
presence of all of the expected domains as well as a few domains not previously

described in PKSs. The presence of an acyl-CoA reductase (AR) domain in PGLI and a

38

carnitine O-acyltransferase (CA) domain in PLSPI has not previously been described for
Type I PKSs. The predicted function of the TB, AR and CA domains is the same: release
of the PK from the enzyme. The TE (or cyclase) domain is thought to play a role in
cyclizing the nascent carbon chain (51). The AR domain may function to release the
enzyme and generate a terminal aldehyde (59); while the CA domain may function to
transfer the polyketide to carnitine or a related molecule. We also found a PKS with a
domain duplication; PGLl contains two ACP motifs. The presence of a second ACP has
been observed previously in the fungal PKS wAp (51) but the function of this apparent
redundancy in unknown. The subset of reducing PKSs that contain a non-functional ME
domain (PKS), ZEA2 and PKS7) supports previous work that suggested that the ancestral
domain structure of this type of PKS was KS-AT—DH-ME-ER-KR-ACP (73). The
pattern of amino acid insertions and deletions scattered throughout the non-functional,
remnant ME domains is perfectly conserved in the three PKSs and suggest that they share
a common ancestor.

Kroken et al. (73) described 16 putative PKS genes in G. zeae in their analysis of
several fungal genome sequences, which was based on an analysis of a preliminary 2X
coverage of the genomic sequence. Reexamination of their data indicated that the Kroken
PKSI4 and PKSI6 both correspond to the GRSI described here. In addition, PKS] and
PKS8 as described by Kroken et al. encode a single PKS, designated PKS] . Therefore,
Kroken et al. (73) describe fourteen PKS genes in G. zeae, but they did not describe
PKS] 7. However, the genome analyzed by Kroken et al. (73) and the sequence generated

by the Broad Institute each were based on different isolates of G. zeae, and although there

39

is no reason to assume the sequences might vary significantly, it is possible these
differences are due to altered genomes

There has been speculation regarding the physiological costs of producing extra
metabolites that do not contribute directly to the health of the organism (31), but that may
serve as auxiliary pools for novel compounds. The results presented here suggest that
individual mutations in 7 of 15 PKS genes results in transformants with increased grth
on a rich medium (carrot agar). This certainly implies a cost to colonization; however,
these costs were determined in a nutrient-rich, sterile environment. The present data do
not preclude the possibility that accumulation of other metabolites, resulting from
disruption of a pathway in these mutants, affects growth. In the field, G. zeae is most
often associated with plant tissue that it has initially parasitized and must subsequently
defend itself after harvest. It would not naturally encounter conditions similar to those in
culture. In nature, these fungi must balance resource acquisition with resource protection,
a prospect that may shift the value of these novel compounds. In the analysis of PKSs by
Kroken et al (73), the only fungi that did not have PKS genes in the genome were the
yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe, primitive
ascomycetes. These are also unicellular yeasts found in sugary environments, where they
colonize when the resource appears, and then seek dormancy as the sugars become
scarce. The complexity of the niche which an organism fills may well result in increased
selection for a pool of active compounds. This hypothesis is certainly supported by
studies of the actinomycetes. Members of the polyketide-rich actinomycetes (31) and the
filamentous fungi presented by Kroken are soil inhabitants. The soil provides a diverse

and competitive environment where availability of resources is in constant flux. Fungi,

40

such as G. zeae, that function in a number of capacities, including that of plant pathogen
and soil saprophyte, might need a pool of secondary metabolites from which to develop
protective mechanisms. As for functions for these secondary metabolites, we can see
biological activity in the products of 6 of the 15 PKSs described here. As genomic
sequences of fungi from a broad group of lifestyles is accomplished, we will be able to

come closer to understanding the functions of this diverse group of compounds.

Acknowledgements
The authors wish to thank the following collaborators on the G. zeae sequencing
project: Bruce Birren and Li-Jun Ma of the Broad Institute, H. Corby Kistler of the
USDA in Minnesota and J in-Rong Xu (Purdue University). They also wish to thank Lan
Xiao of The CANR Biometry Group, Statistical Consulting Center, Michigan State
University for statistical analysis of growth data. Assistance with the DON analyses was
provided by Benjamin Munn and L. Patrick Hart. This project was funded by USDA-NR1

grant 2001-352-1-10062 to FT. and the Michigan Agricultural Experiment Station.

41

 

CO

Fl:

sir

CL!

 

 

 

CHARACTERIZATION OF TWO DISTINCT POLYKETIDE SYNTHASE

GENES INVOLVED IN ZEARALENONE BIOSYNTHESIS IN Gibberella zeae

Iffa Gaffoor and Frances Trail

Abstract

Zearalenone is a mycotoxin of worldwide economic and health importance. It is most
commonly found as a contaminant in stored grain and has chronic estrogenic effects on
mammals. Zearalenone is synthesized by several species of the filamentous fungus,

F usarium. Since the 1970’s, the compound zearalenone has been known to be a
polyketide, derived from the sequential addition of multiple acetate units by a polyketide
synthase (PKS). However, the genetics of zearalenone biosynthesis has not been
elucidated. Herein, we describe the cloning of two genes, designated ZEAI and ZEA2
that encode the polyketide synthases responsible for zearalenone production in
Gibberella zeae (anamorph F usarium gramineamm). Disruption of either of these genes
results in the loss of zearalenone production by the resulting mutant. ZEAI and ZEA2 are
transcribed divergently from a common promoter region. Identifying the genes flanking
ZEAI and ZEA2 and their putative functions gives clues to the regulation of these genes.
Examination of the region of the chromosome involved in zearalenone biosynthesis

shows the presence of two possible regulatory proteins. Strikingly, no other genes

42

typically associated with polyketide modification flank the two PKS genes. An
oxidoreductase that is regulated similarly may be involved in modifications of
zearalenone to form natural derivatives. A putative mechanism for the synthesis of

zearalenone by the two PKSs is proposed.

43

Introduction

The filamentous fungus Gibberella zeae Schw. [Schwein.] Petch (anamorph
F usarium graminearum Schwabe) is a worldwide pathogen of corn and small grain
cereals such as wheat, barley, and oats. In infected grain, G. zeae produces several
mycotoxins, including the trichothecene deoxynivalenol, and the polyketides (PKs)
zearalenone (zen) and fusarin C, thereby causing losses of both yield and quality. The
genetics and biosynthesis of both deoxynivalenol and fusarin C have been the subject of
intensive study in recent years (22, 115). In contrast, the genetics and biosynthesis of zen
have received little attention (113), despite its deleterious effect on human health.

Zen is produced by several other species of F usaria, including F. culmorum, F.
sporotrichioides, F. equiseti, and F. semitectum (75). However, in North America it is
most commonly associated with G. zeae infections of com (113). The toxin may be
transmitted to humans from cattle, via milk products from cows consuming contaminated
food (75) and via meat products from cattle treated with zearanol, a zen derivative

commercially used as a bovine grth promoter (66). Although zen has fairly low

toxicity and carcinogenicity levels (LDSO of 2—10 g/kg), chronic exposure and synergistic

effects of other environmental estrogens can elicit effects on mammals at levels as low as
1.5-3 mg/kg body weight (75). Surveys carried out in several countries indicate that these
levels are present in food supplies world wide (38). More susceptible sub-populations,
such as the unborn and the very young, would be affected by much lower levels of the

toxin (113).

l3 13
The incorporation of [1- C]-acetate and [2- C]-acetate into the structure of zen

illustrates that it is a PK (87). In fungi, PKs are produced by Type I iterative polyketide
synthases (PKSs). These are large, multidomain enzymes that iteratively catalyze several
rounds of condensation of CoA thioesterified carboxylic acids, usually acetate and
malonate. A minimal PKS consists of B-ketoacyl synthase (KS), B—ketoacyl transferase
(AT), and acyl carrier protein (ACP) domains. A PKS also may have one or more other
domains, such as B-ketoacyl reductase (KR), dehydratase (DH), enoyl reductase (ER),
methyl transferase (MT), and cyclase (CY) (50). The number of reducing domains
present determines the extent of reduction of the keto group after each successive
condensation event, and in extreme cases reduction can produce a linear PK such as
fumonisin (103) and t-toxin (138). However, in the absence of reducing domains, the keto
group remains intact and yields unreduced and often cyclic PKs: including bikaverin, the
red mycelial pigment formed by Gibberellafujikuroi (76), and the green spore pigment of
Aspergillus nidulans (132, 133). The type of PK (reducing or nonreducing) has been
predicted based on analysis of the highly conserved KS domains (16, 73). Recently, a
phylogenetic analysis of the PKS genes identified in several filamentous fungi, including
G. zeae was done (73).

In fungi, genes involved in secondary metabolism are generally located within a
cluster, which may include a regulatory gene(s) (32, 101). Most clusters involved in PK
biosynthesis consist of a single PKS and several genes, such as P450 monooxygenases,
that are involved in modifying the PK backbone (65). However, clusters that include two
PKS genes exist, such as those involved in the biosynthesis of lovastatin (56) and

compactin (l). Lovastatin and compactin are very similar in structure, as are the genes of

45

their biosynthetic clusters (1). Existing evidence suggests that the two PKs composing
lovastatin are produced independently and that the shorter product (a diketide) is
subsequently added onto the longer product [a nonaketide; (56, 58)]. The diketide is not
considered to contribute to the PK backbone because of its delayed attachment to the
main molecule. In contrast, the biosynthesis of the polyketide aflatoxin, a mycotoxin
produced by Aspergillus spp., involves two fatty acid synthases, which produce a fully
reduced hexanoyl chain that acts as a primer for the PKS to complete the backbone (134).

We initiated a study to identify the PKS gene(s) involved in zen biosynthesis
using degenerative primers designed to amplify the KS region of the PKS genes. Since
initiating the study, the complete genome sequence was released by the Broad Institute
(www.broad.mit.edu) and we used sequence analysis to identify all of the PKS genes in
the G. zeae genome and to genetically disrupt each of them (Gaffoor et al., in
preparation. As part of that study), we identified two PKS genes, subsequently designated
ZEAI and ZEA2 and described here, which when genetically disrupted, caused G. zeae to
lose its ability to accumulate zen. These genes were contiguous in the genomic sequence
and transcribed divergently. ZEAl was a reducing PKS, and ZEA2 was a non-reducing
PKS and the products of both form the backbone of the zen molecule. Analysis of the
flanking region of ZEAI and ZEA2 did not reveal any other genes that are likely to be
part of the biosynthetic machinery; thus, we propose that these two PKs are solely

responsible for the synthesis of zen.

46

Methods

Fungal strains and growth conditions.

The strain of G. zeae used for this study was a Michigan field isolate, designated PH-

] (FGSC 9075, NRRL 31084). All strains were maintained on sterile soil at —20 0C for

rapid sporulation.

Fungal transformation.
Transformations were performed on germinated conidia using a previously published
protocol (104) with the following modifications. Approximately 0.3 g soil stock was used

to inoculate carboxymethylcellulose (CMC, Sigma Chemical Co., St. Louis, M0)

medium, which was then incubated for 72 hr at 25 0C at 250 rpm (28). Conidia were

harvested by centrifugation and germinated in YEPD (0.3% yeast extract, 1%
bactopeptone, and 2% D-glucose) broth for 12—14 hr at room temperature at 175 rpm.
Isolation of protoplasts occurred in 25 mg/ml driselase (InterSpex Products, Inc. San
Mateo, CA.), 0.05 mg/ml chitinase (Sigma Chemical Co., St. Louis, MO), and 5 mg/ml
lysing enzyme (Sigma Chemical Co., St. Louis, MO) in a 1.2 M KCl buffer. Protoplasts
were collected by filtration through a 30 um N itex nylon membrane (Tetko Inc., Kansas

City, MO) and washed three times in STC buffer (1.2 M sorbitol, 10 mM Tris-HCl, 50

6
mM CaC12, pH 8.0). Transformation was performed in a 500 pl volume with 10 -10

protoplasts and was mediated by 30% polyethylene glycol solution (30% PEG 8,000, 10

47

mM Tris-HCl, 50 mM CaC12, pH 8.0), STC buffer, and 25 ug of the disruption vector.
Protoplasts were transferred to 250 ml molten regeneration medium (RM: 0.1% yeast
extract, 0.1% casein enzyme hydrosylate, 0.8 M sucrose, 1% agarose) and distributed to
100 mm diameter Petri plates and incubated for 15 hr before being overlaid with 10 ml of
RM amended with 150 ug/ml hygromycin B (HygB) (Calbiochem-Novabiochem Corp.,
San Diego, CA) to recover transformants. Putative transformants were selected within 4—

7 days and hygromycin resistance was confirmed by growth on V8 juice medium

R
amended with 450 ug/ml HygB. Resistant (Hyg ) colonies were transferred to a 2%

water agar (WA) medium, and genetically pure single spore isolates were obtained for

further analysis.

Gene structure and analysis.

The genes ZEAI and ZEA2 were designated PKS8 and PKS 7, respectively by
Kroken et al. (2003), in their phylogenetic analysis. Since they are now functionally
described, we have renamed them to reflect this information. The predicted PKS protein
sequences for ZEAI and ZEA2 were analyzed by both CDART and RPSBLAST
(www.ncbi.nih.g)v) to determine domains. Subsequently, amino acid sequences of both
genes were aligned with the conserved domains from previously characterized fungal
PKS genes using ClustalW (http://wwwebiacuk) (76, 103) to assist in the manual

annotation.

48

Gene disruption

To determine the function of the two PKS genes, we generated disruption vectors
by ligation of a PCR-amplified fragment from each predicted gene into the Smal site of
pHYG4, a vector carrying the selectable marker hygromycin B phosphotransferase (hph)
(29). The location of the amplified fragments on contig 119 were: ZEAI = 2628—3760
(1133 bp) and ZEA2 = 6149-7355 (1207 bp) based on the Broad sequence. The
disruption vectors were used to transform the wild type PH-l as described above.
Putative transformants were purified by single spore isolation and screened for gene
disruption using Southern blot analysis. Genomic DNA was isolated (61, 67) from
putative transformants and cut independently with two different restriction enzymes. Two
restriction enzymes were chosen for each analysis; one recognized a site within the
disruption vector and one recognized sites outside the vector. Restriction- cut DNA was
separated by electorphoresis and Southern analysis was performed for each of the
digested samples. Probes were based on the specific amplicon used for gene disruption
and a portion of hph (588 bp long). Based on Southern data, we selected two independent
disruption mutants for each PKS gene and one transformant that resulted from ectopic
integration of each vector for further analysis. The disrupted mutants from ZEAI were
designated zeal ml and zea2m2 and the ectopic transformant , zealE. The disrupted
mutants from ZEA2 were similarly designated zea2m1 andzea2m2 and ectopic zea2E. All
other nucleic acid manipulations and molecular procedures were carried out according to

standard methods (11 1).

49

Identification of the Intercontig Region of ZEAI

Since the sequence of ZEAI was incomplete, due to the lack of sequence for the
region connection contigs 118 and 119 (www.brozfimitedu), we generated the following
primers to amplify the region spanning these two contigs. Primer
5’TACAAGCATGGCGCAACAATAGAC3’ located on contig 119 (465—488) was used
with either 5’GTGGCTGATCCCGCTCI‘TTGACG3’ (2,989—3,01 1, contig 118) or
5’GACGGCCTCAACCI'TTTCAGTG3’ (2437-2458, contig 118). The amplicons were
cloned into a pCR2.1-TOPO vector using the TOPO TA Cloning kit (Invitrogen Life
Technologies, Carlsbad, CA) and sequenced at the Genomic Technology Support Facility
at Michigan State University. The BLAST Tool ( www.ncbi.nih. gov) was used to align
the resulting sequences. Initially, the amplicon sequences were aligned to determine a
consensus sequence, and this sequence was in turn aligned with those of contigs 118 and
119 to confirm that these two contigs were physically linked and to identify the novel
sequence. The new sequence was used to link contigs 118 and 119 to form a single
contig. This new sequence was used to identify the complete gene for ZEAI and the
putative transcription start sites for both ZEAI and ZEA2 using FGENESH
(httpzllwwwsoftberrycom) with organism-specific parameters for F usarium

graminearum.

Expression Analysis
To determine whether ZEAI and ZEA2 were expressed in the disrupted
transformants, Reverse Transcriptase PCR was used. To induce zen production, cultures

were inoculated onto rice agar (91) at room temperature for five days and subsequently

50

o
transferred to an incubator at 11 C for five more days. Surface and subsurface mycelia

were harvested with a scalpel. For control conditions (noninducing), cultures were grown
in Czapek-DoxBroth (Becton Dickinson, Sparks, MD) medium for seven days. RNA was
extracted from lyophilized hyphae harvested from both conditions, using TRIzol Reagent
(Invitrogen Life Technologies, Carlsbad, CA) as per manufacturer’s instructions. First
strand cDNA synthesis was carried out with SuperScript II RNase H' Reverse
Transcriptase (Invitrogen Life Technologies, City, State) using random hexamers. Gene-
specific primers were used to amplify regions of each PKS gene to identify the conditions
under which they were expressed. Primers were designed such that the annealing region
of one primer of each pair spanned the exon junction in the mRN A, thereby ensuring
amplification of only the spliced mRNA. The following primers were used: ZEAI,
forward 5’GAAGAGGCCCCGGTAGCGATAAC3’, reverse
5’TGAAGCCACTCCAGCAGCAGAT‘T3’; ZEA2 forward

5 ’GTCTCACTGACI‘TTGTTCGCAT3’ , reverse

5 ’TCAAAGGATGTTCCT GGT'TGCT 3’ As a control, the PKS gene FG02324. 1, known
to be expressed under zen inducing conditions (Gaffoor er al., in preparation) was used
(forward 5'GGATI‘CACCGTGCCCGACAT3’ and reverse

5 ’TTCAACGCAGAGCTCCATTACGC3 ’).

To identify genes in the region of ZEAI and ZEA2 that were coregulated, rice
samples described above were used, and for noninducing conditions, mycelia was grown
in liquid YES medium (2% yeast extract, 6% sucrose) for 48 hours before harvest. In this
case, YES was used as a control because it is a rich medium, and we felt would be more

likely to upregulate genes. Extraction of RNA was performed as described above. Since

51

these genes were much smaller than the PKS genes, it was not possible to design primers
around predicted introns (several did not have introns). However, results showed
differential amplification of genes, indicating the lack of presence of DNA. The
following primers were used: FG2393.1, forward 5’-CAGTGTCTGTCCAAAGACATT-
3’, Reverse 5’-CTTGTCAACACACCAACGTA-3’; FG2394.1, forward 5’-
CCGC'I'I‘GGGCTGTCCTTATGG—3’ , reverse 5 ’-
TTCCI‘CI‘CGGTCCT’ITATGGCCAG-3 ’; fgdl 17-550, forward 5’-
TCTACATGGCAGTTCAGCAGTC- 3’, reverse 5’-ACI’ GCT CT CT ATGACT C-3’;
Fg12015, forward 5’AACTACGGT'ITATCGCGGAAGC-3’, reverse 5’-
ATGATCTCGTCGGTCAAC'I'FGG-3’; Fg12056 forward 5’-

ATI'TACCCGTTCTT CT GGGAAC-3’, reverse 5’ ACT TGTGGAAAGTGCAGAATGG-
3’, FG02398. 1, forward 5’-TCGTTCCATGCGTTACCCACTC-3’, reverse
5’CCGACTTCGACT CT GCCTT TGG-3’; For comparison, ZEAI and ZEA2 were
amplified as inducible controls. A note about gene designations: two websites have been
set up to document the functional assignments of genes in the G. zeae genome. The
Broad Institute at Massachusetts Institute of Technology website (www.broad.mit.edu)
and the Munich Information Center for Protein Sequences (MIPS) website
(www.mips.gsf.de) both record gene calls using the same gene designations with one
exception: Genes with designations above fg12000 are recorded only on the MIPS
website. In addition, fgdl 17-550 was only recognized by the MIPS website. The
designation “.1” after a gene indicates the annotation version of this gene. We will

include this designation only in the methods section.

52

Chemical analysis of zen accumulation

To test whether zen was accumulating in the disrupted transformants, we used
two methods of analysis: thin layer chromatography (TLC) and competitive ELISA. To
analyze for zen production, transformants were grown on Uncle Ben’s converted rice
(Master Food Services, San Antonio, TX), a vitamin-supplemented parboiled rice, known
to stimulate zen production (95, 116). Uncle Ben’s converted rice (25 g) was aliquoted
into Erlenmeyer flasks and soaked in 20 ml of distilled water for 2 h. After autoclaving

for l h the clumps of rice were broken up and allowed to stand over night. The following

6 8
day the rice was re-autoclaved for 1 h and inoculated with 10 -10 conidiospores

suspended in 2 ml of distilled water. This inoculated rice was transferred to Petri dishes
(100 mm X 25 mm), taped with Tenderskin hypoallergenic paper tape (The Kendall
Company, Mansfield, MA) and incubated at room temperature for one week. During this
period, cultures were observed to detect any contamination and to confirm uniform

colonization of rice across all samples. At the end of one week, when the rice was fully

. . 0
colonized, the cultures were transferred to an incubator at 11 C for two more weeks

0
(116) Samples were harvested by placing the open Petri dishes in an oven at 55 C for 3-

4 days. Samples were ground to a fine powder using a domestic coffee grinder and used
for further analysis.

For TLC analysis, 200 mg of each rice sample was extracted in 100 % methanol
for two hr and TLC was performed as previously described (120). PKS mutants that did

not produce zen were rescreened using the commercial competitive ELISA-based

53

Veratox kit for zen (Neogen Corp., Lansing, MI). Samples were prepared and assayed
following manufacturer’s directions. Extracts were initially diluted 50X prior to adding
assay reagents to ensure zen levels were within the detection limits of the kit (50—600
ppb). Uninoculated Uncle Ben’s rice was used as a control in the assay. Additionally, the
extracts were separated by TLC as previously described by Swanson et al. (120).
Following separation, the area in the zen region was collected, resuspended in methanol,

and a spectrum analysis performed according to Mirocha er al. (116).

Results

Analysis of zearalenone biosynthesis in ZEAI and ZEA2 mutants

Disruption of two PKS genes, designated ZEAI or ZEA2, by insertional
mutagenesis resulted in isolates that lacked detectable quantities of zen under inducing
conditions. Direct competitive ELISA analysis revealed high zen levels in cultures of the
parent PH-l (31.2 +/- 4.7 ppm) compared to the transformed deletion mutants (0.9 +/-
0.2), which had levels below those of the rice control extracts (1.7 ppm). Ectopic
transformed isolates produced wild type levels. TLC analysis supported these findings
(Figure 5, Appendix B). The absorbance spectrum of the band that co-migrated with zen
in wild type and ectopic controls was indistinguishable from the spectrum for zen. This

band was absent in disrupted transformants.

Identification and analysis of ZEAI and ZEA2
ZEAI and ZEA2 were transcribed divergently, with 1040 bp between their start

codons. Based on comparative sequence analysis, ZEAI spanned contigs 118 and 119,

54

with the 5’ end, including the KS and AT domains located on contig 119, and the ACP
domain at the 3’ end of contig 118. In the genomic sequence, there is a gap in the
sequence between these two contigs, leaving ZEAI incomplete. We used PCR to clone a
fragment of the G. zeae genome spanning contigs 118 and 119 and sequenced the region
(Figure 3, Appendix B). The complete mRNA of ZEAI was then predicted to be 5988 bp.
ZEA2 is located in its entirety on contig 119 and consists of the following domain
sequence: KS-AT-DH-ER-KR-ACP. Conserved domain sequences are presented in Table
3 (Appendix A).

ZEAI and ZEA2 were examined for unique sites with which to generate
insertional mutants. Single crossover integration of a unique internal fragment was
chosen because of the difficulty in disrupting these large genes and because of the
possibility of similarities among PKS genes in the genome. Southern analysis of the
transformants revealed the integration of the entire disruption plasmid at the appropriate
site and a single integration in each of three transformants examined (data not shown).
Reverse transcriptase PCR was used to confirm loss of expression of both genes in the

deletion mutants (Figure 4, Appendix B).

Identification of Cluster

Expression analysis of genes flanking ZEAI and ZEA2 was done by reverse
transcriptase PCR to identify genes in the region of ZEAI and ZEA2 that were
coregulated (Figure 4, Appendix B). Of the genes assayed, only fg12056 mips

(www.rnips.gsf.deP) and FG02393 was expressed in a similar pattern to ZEAI and ZEA2.

55

Analysis of the promoter region

Sequence analysis revealed that the ZEAI, ZEA2 intergenic region (3444—5335,
contig 119) encompasses the promoter region, and was examined for transcription
elements that would give clues to the regulation of the two PKS genes. The results of the
promoter analysis are presented in Figure 6 (Appendix B). Two TATA boxes were
identified, between the two proposed Transcription Start Sites (TSSs). In addition, nine

GATA sites and two AbaA sites were in the region.

Discussion

We have identified and disrupted two PKS genes from G. zeae that are
responsible for the biosynthesis of zen Disruption of either of the genes results in the loss
of the isolate’s ability to accumulate zen under normally inductive conditions, as
indicated by both ELISA assay and TLC analysis of extracts of induced cultures.
Interestingly, it appears that zen in G. zeae is synthesized entirely by these two PKSs
from one acetyl CoA and eight malonyl CoA molecules, a unique model for PK
biosynthesis.

Expression studies of the genes flanking ZEAI and ZEAZ indicate only FG02397
and FG02393 are expressed in a manner similar to the zen PKSs FGOZ397 has an FAD
binding domain and may be an oxygen oxidoreductase. Several natural derivatives of
ZEN have been documented (88) and this enzyme could reduce the ketone groups at
either C4 or C6 to yield natural variants. FG02393 is expressed similarly to the zen PKS
genes and has ankyrin repeat motifs and a conserved region of approximately 150

residues long that is found within various heterokaryon incompatibility proteins that

56

appear to be restricted to the ascomycetes. Ankyrin repeats are commonly involved in
protein-protein interactions and are found in transcriptional initiators. Further testing will
be needed to determine a possible role in regulating the zen PKSs. The other genes
flanking ZEA] and ZEA2 are, FGOZ394 (a putative AM toxin synthetase), FGOZ398 (a
GAL4 —type transcriptional regulator), FG03299 (a protein kinase gene) and two partial
genes, fgd117-550 (monocarboxylate transporter) and fg12015 (K+ channel, beta
subunit). FG02398 encodes a conserved GAL4~like Zn2Cys6 binuclear cluster DNA-
binding transcription factor and is expressed in both noninduced and induced conditions.
Since the promoter region shared by ZEA] and ZEA2 contains Gal4 binding sites, this
protein should be considered a possible regulator of zen production. FG02398 is
expressed in both inducing and at least one noninducing condition (Figure 3, Appendix
B). Thus, expression is not limited to conditions where the zen biosynthetic genes are
expressed. Disruption of this gene is in progress and will be used to determine its role in
regulation of the zen biosynthetic genes.

Because both ZEA] and ZEA2 are required for zen biosynthesis, a single bi-
directional promoter would ensure that both genes are expressed simultaneously, as has
been shown in other systems (43, 77, 82, 119). We plan to verify the bi-directionality of
the promoter, and the function of promoter elements by using a plasmid construct
consisting of the putative promoter region flanked by two divergently transcribed reporter
genes (106). We analyzed the 1040 bp region between ZEA] and ZEA2 for the presence
of fungal promoter elements. The ZEA I-ZEAZ intergenic region has three regions
containing GAL4-binding motifs and nine copies of the consensus sequence for binding

of the GATA factor (Figure 6, Appendix B). The GAL4 family of Zn2Cys6 binuclear

57

cluster protein transcription factors recognize a palindromic sequence in which the
5’CGG3’ motif is separated by up to eleven non-conserved bases. The pathway-specific
transcription factor for aflatoxin biosynthesis, AflR, which belongs to this family,
recognizes the sequence 5’TCGN5CGA3’ (45). Fungal GATA factors generally have a
single Zn-finger motif that is responsible for DNA binding and may be involved
chromatin remodeling (90, 136). An interaction between a GATA factor and a Zn2Cys6
binuclear cluster protein to regulate gene expression has been demonstrated in
Neurospora crassa and A. nidulans (12, 27). Thus it is possible that the zen PKS genes
are regulated in a similar manner. The annotated genome sequence indicates for F.
graminearum contains six genes with putative GATA-binding Zn-finger domains.

Two motifs recognized by the AbaA-type transcription factor were identified in
the bidirectional promoter. AbaA, along with two other transcription factors, is involved
in regulating the genes expressed during asexual reproduction (3) and has been identified
in the promoters of aflatoxin biosynthesis genes in Aspergilli (43). The role of zen in
development and the possible role of an AbaA like protein needs to be further
investigated. A single consensus sequence for the PacC transcription factor was also
present in the region, however, multiple copies of the motif are usually present when this
factor is involved in regulating a gene (82), making it an unlikely candidate for regulating
gene expression in this instance.

A proposed mechanism for synthesis of zen by the two PKSs is presented in
Figure 7 (Appendix B). The first 10 carbon additions are catalyzed by ZEA2p, which has
reductive domains KR, DH, and ER, and is thereby able to variably reduce the keto

groups on the PK chain. The keto group can be partially reduced to yield an alkene or

58

fully reduced to an alkane depending on the length of the carbon chain growing on the
ACP domain (1) as can be seen in Figure 7 (Appendix B). The remaining three rounds of
C2 additions are generated by ZEAlp, which is a non-reducing PKS, lacking KR, ER,
and DH domains. The unreduced ketones added on by ZEAlp are highly reactive and
form a ring which is rapidly arornatized due to enolization of the ketone groups. This is
most likely a nonenzymatic process. A viable alternative model would have C11 and C12
added by ZEA 1 p, not ZEA2p, a possibility that will have to be determined experimentally.
Interestingly, the ACP domain of ZEA2 appears to be divided in the resulting protein
(Table 3, Appendix A). If this ACP is nonfunctional, one possibility is that the ACP
from the ZEA] would function for both, similarly to the Type 2 PKSs. Such a mechanism
would require close association of both PKSs. The two ZEA proteins may be dimerized
or act independently. Dimerization would facilitate the transfer of the product of ZEA2 to
ZEA] (Figure 7, Appendix B). In in vitro studies, PKSs have been shown to be
promiscuous in terms of the starter unit specificity (44). Therefore, another advantage of
ZEAlp and ZEA2p being associated is that it would ensure that ZEAlp use the correct
primer to maximize the efficiency of zen biosynthesis. The interactions between these
two enzymes will have to be determined experimentally.

Since 1962, at the first characterization of the potent mycotoxin, ZEN, the
mechanism of biosynthesis and regulation of expression has remained elusive. With the
identification of the two polyketide synthase genes involved in ZEN biosynthesis, and a
putative regulatory protein, our understanding of the process of ZEN production in stored
grain will be greatly facilitated. Hopefully, such information will lead to more improved

designs for control of this toxin, worldwide.

59

Acknowledgements

This work was funded by USDA-NRI-CGP grant no. 2001-35201-10062 and the
Michigan State University Agricultural Experiment Station.

The authors would like to thank Daren Brown and Mike Pollard for insightful
discussions on zearalenone biosynthesis. We are grateful to Benjamin Munn performing

the ELISA analyses.

60

CONCLUSIONS

Analysis of a whole genome sequence has proved to be an effective method to
identify the suite of putative polyketide synthase (PKS) in a genome. The genome
sequence of the filamentous fungus Gibberella zeae released in 2003 was analyzed to
predict the PKS genes coded by this organism. Functional analysis of the fifteen
identified genes enabled the identification of numerous conditions under which these
genes were expressed. Two of the PKS genes were not expressed under any of the
conditions assayed. Some of the genes were expressed under very specific conditions
while a single PKS genes appeared to be expressed constitutively under the numerous
conditions that were tested. Disruption of the genes enabled the identification of five PKS
genes that synthesized previously identified compounds. None of the PKS disrupted
mutants were affected in sexual reproduction or showed reduction in gross symptoms
during plant infection. However, one of the disrupted mutants showed stunted grth
even in rich media even though we did not detect the expression of this gene under any of
the conditions surveyed. Since the conditions under which all eight of these genes are
expressed are known, the disrupted mutants can be cultured under these conditions to
identify the compounds produced by the PKSs. There have been no previously reported
instances where the entire complement of PKS genes encoded by a single fungal genome

have been functionally characterized.

Initially, five pairs of degenerate primers were used in an attempt to identify the

PKS gene for zearalenone production. Although several unique PKS gene fragments were

61

cloned, none of them proved to be from a PKS producing zearalenone. The availability of
the whole genome sequence and the ability to identify and examine all the PKS genes in
the genome facilitated the identification of two PKS genes responsible for zearalenone
biosynthesis. If the genome sequence had not become available, the identification of
these PKS genes would have been tedious as the other options available were to screen a
bank of mutants and thereby identify a mutant compromised in zearalenone biosynthesis
and subsequently identify the mutated gene. The other option would have been to modify
the degenerate PCR primers to yield a larger number unique PKS amplicons. Two PKSs
were shown to be required for zearalenone biosynthesis. Although two PKS genes have
been shown to be involved in the production of a single compound such as lovastatin, one
of the enzymes produces a PK chain that is a used to modify the PK backbone that is
produced by the second enzyme. Therefore the PK backbone is produced by a single
PKS. In aflatoxin biosynthesis, the PK backbone is produced by a PKS and a fatty acid
synthase. This is the first reported instance where two PKS genes contribute to the
synthesis of a single polyketide backbone. Identification these two PKS genes and
analysis of the protein sequence to determine the domain composition of each individual
gene enabled us to propose a mechanism for the biosynthesis of zearalenone by these two

PKSs.

62

APPENDICES

63

APPENDDKA

TABLES

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2
Ho aoowao A2 5
25:28“ mU<-MM-mm-EQ-H<-mM 94mm wEoBcom mmmnéfio 29E *mmomam N<mN
EoEmm , $2 ”88262 4.30-38 bomb 3me
Eamoofitom mU<-mU<-.H<-mM nwmm wEoseEéoz mvgm-mmawv mmvE ENG—On“ 30m
8o:
ommomm
535:5 mb-m0<-H<-mM amou wEozooreoZ .358 2 .EmvE $089” :35
6_ C
00942
EamEobé. mh-m0<-.w<-mv~ whom manooeéoZ .mth S mvE 1.94020? 55¢.
8355?. ooumom 3:88:55 8N9
U Eamon m0<-~§-mm-m=2-mflé<-mm omam memosoom fimmmhgwooz. Emma. “be—20m EENO
AU< Emmi
850515 -§-mm-m2 +5 -H< -mM emmm wEoneom embow$$ww cmvE ISO—flora omvE
Acmfiowmcfiioe Amo _ V
-O octhoBE—osoy 8me—
EsoEED mU<-.H<-mM «Cm mEosooreoZ :8me m _ mvE $360k Emu—m
ADO ”magnet 558 cosmewioo coca—$62.
wEnEoQ mEo< wewoaooeeOZ Eva—mac coca—.mfioo N ~
6.60 m . oEE< oz 8 mien—com scanning :oonM 050 0:00

 

ween ezunuafib E moeow 038E? cocoa—boa @08an 2: we monsosbm A 035.

65

.oofiofi: 8a 8:268 05
mo :oumammo 2 one 9522: on by: 35 23:5“. 95 momoficoeam E Bangui 2a 85» mvE 5:» uo§o8ma 333: .o: min—con— .m
.ESE;Ehoaxoaowbeumwde—V 5:80:23 mm”: :0 U83 5632 25: 828:2: AL «.3894. .N
dmaoe 8:038 23 EBEWEEBBSESEDA oBvoquaofiékav couaewfiuu ocom cocwmwmm 3555 2on 05 :o pom—am A

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Amomv
aomw:

550515 mm Re -02 C _ -- cmmnoonm _<mM
63:80—

:30515 mU<-MM-mmImE-EQ-H<-mM momm wEoéom -wmmE vaE voovoOm mmvE
Ammmv
2888 828:8 5505—55 Mam— Tm

=26:ch -mU<-MM-mw-mE-IQ-H<-mM E.— m wEoswom -oamom mmvE eonmoOm mmvE
8m:

care—CED m0<-§-mm-m§ -IQ -H<-mvn ommm 9:260”: Somalia—M -- cemmoonm EmvE
Ammmv

550:ch m0<-§-mm-:Q-H<-mM ommm wEoznoM Scinmwmob hmvE 358m EOE
. £3

5505:: mU<-MM-mm-mE-IQ-H<-mM movm wEosoom vammm-3~mw _ .mvE ooh—00m :33
6va

550515 mU<-mM-mE -EQ -H<-mvm meow mEosoom C Genoa amvE ... _N_NLOn~ 09$
3%
con—M:

:39.ch mU<-MM-mm-EQH—.<-m¥ moVN memosoom -wmooM: w 43E memofium iv?“

:e
no LootmOv a: C
2.9.2“; AU<-H<-mM wEosoocéoZ oohmmmom vmva mammoo _<m

 

 

APESV ._ “CBS.

66

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

00H<00000000h00<<<<< 0< <0.H.0< 0<< 0< 000900000090 _ mvE
0<<0HOH<<<00H000<<0000 E0<<00HOH<<0000<<<00<0H _<mv_
0h0<0<<<<0h00p00<<00000 <<0<0<<00u0<<00h<0<000<0 mmvE
0<00<00H0<FE000E<0H EE00<0E000H000 hmvE
00<H<<<000<000<0000 0h0<000<<00<<000<<<0<t omvE
t<0<00<00<00h0<000<<0h 0<<H<000<H00000000<0<<0 _ <mN
SHO<0HO0H0<<000H<0000<0 <H0<00<<0<<00H000<<000 03E
<0EOH00000E000<EOH0< 0H<<0008<00HO0H<H0808 Ems—n—
commmoemxm

P03000008H<0u000500 <00<<0900H000009<H<00<00 N<mN
0<00h<<<0h00080<0E80h 0<<<<00H00<00H000H<<00 ~<mN
0HO0HO0HOHHOH900000HOE <HHOHO0H000<0H090<0000H0 C an
0E<000EO0H<0<0<H000 <0<0<0H0<0HO0H<0H000h0<0 _ AWE
0<08<HOH<<00000< 00<<00H <00<<0H0<<000000<<0<0H< _ mm0
<<0H0<0000<0<<0<0H<0000< <0H<<000HOH0<0H<<00H0000 _ Eva
0E08<H<00EOHOH0 <<HOH000§00H000t0<< omvE
<0<0<<<<0H00<<<<000000<H 0<<<< 0<<000HOH0<<<0000H0 hmvE
0<0H<0000<00E00<<0<00F0 <0HOHHO0H00000H0< 009—0 033
0<0<0<00H<00<000000H <00H<<00<0<000000E mmvE
00H<0H<0<00b000000h< 00H<P0000<<000000<< 0,—2.0 vaE
:0HOH<0H0000.:.<0.E.0.~.00< <HOH0000HOH<H000H<H000H< _ mvE
090H0<EOE00<0<00000<0 :<00<<00<H<H000000<HO0H 30m
00:000~.0.~.00E<000.:.< 0PH<0<090000<00000E0 _ mDmN0
0<00<HH<00H00<0<000<<0E H<0<00000h000<0hh<00 Mable.
:o: .55

 

 

£33 SEE 3.35m

 

finnmv BEE panacea

 

H

academies 0:00

 

 

8.5» 3.22% ooze—boa mo mucus—web 28:9:va 880.com 9 some $085 .N 033.

67

Table 3. Predicted domain architecture of ZEA] and ZEA2 proteins.

 

 

 

 

 

 

 

 

 

 

 

 

 

Gene Protein Domain Sequence]

ZEAl B-Ketoacyl Synthase RIAFQFKWEGPTYSLDSACASTASSIH

ZEAl Acyl Transferase GIQ’SVVIGHSLGEYAALHVSGVLS

ZEAl Acyl Carrier Protein DTLIADLGVDSIMAIEIASQV

ZEA2 B—Ketoacyl Synthase NRISHFFDIHGPSATVHTACSSSLVAIH

ZEA2 Acyl Transferase GVAPVSVVGHSSGEIAAAYCIEALSHKD
ZEA2 Dehydratase DDEPWIRGHTVGTTVLFPGAGMVSIV

ZEA2 Enoyl Reductase LQRGQSVLIHAAAGGVGQAA

ZEA2 B-Ketoacyl Reductase TYLFVGGLGGLGRSLAKEFVSCGAKNIAFISR
ZEA2 Acyl Carrier Protein VTSLSS/l/IYGVDSLVALEVRNWI

 

68

 

Table 4. Characteristics of the wheat head disease phenotype at day 20 conferred by the

. . . . a
parental isolate PH-l and nine insertional mutants

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Treatment Disease phenotype
Bleachingb Chokingd Rad“:
No. of spikelets SD response
None 0 0 0
SNA only 0 0 0
PH-l 15.33 1.21 1 l
Daf mutant
10 1.17 0.26 0 0.5
11 3.17 0.98 0 0.6
14 5 1.67 0.33 0.67
15 2.44 0.82 0.33 0.5
26 1.75 0.42 0 0.83
36 2.17 0.41 0.67 1
37 3.75 2.60 0.5 1
38 1.83 0.41 0 0
43 4.17 3.96 0 0.83

 

 

 

 

 

a . . . . . . .
Point inoculation of wheat heads at anthesrs wrth agar plugs containing mycelrum of a

single isolate.

Glume, lemma and palea tissues turns from green to white / pale brown, in head regions
B and C (Figure8, Appendix B) (n=6)

0
Mean number of spikelets +/- SD ( n=6)

(1
All the spikelets above the point of inoculation (head region A, Figure 8, Appendix B
exhibit the bleached phenotype assessed on a 0 to 1 scale where 1 is completely bleached.

6
Brown streaking of rachis segments in head regions B and C assessed on a 0 to 1 scale

69

 

Table 5. Impact F. graminearum infection on grain weight, number and quality in the

entire head and the three different sub-regions A, B and C

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

ENTIRE HEAD PER SPIKELET

Grain Visible B-REGION C-REGION
Treatment wei ht Grain disease Grain Grain

(mgg) number Spikelet weight Number weight Number

No. (mg) (mg)
None 2255 c 41.3 b 0 80 c 2.1 c 144 c 2.69 c
109.38
SNA only 1718 be 37.5 b 0 67.5 be 1.79 be be 2.45 c
PH-l 219a 0.5 a 15.33 0a 0a 109.5bc 1.3b
Daf
mutant
10 1561 be 33.5 b 2.17 6.45 a 0.46 ab 92.36 b 2.32 c
11 838 ab 26 ab 3.17 0 a 0.25 a 64.36 b 1.79 be
14 1463 b 21.5 ab 5.00 27 ab 1.3 abc 123 be 2.13 be
15 1596 b 15.7 ab 2.33 5.15 a 0.47 ab 112 be 1.74 ba
26 1465 b 22.5 ab 1.75 2.86 a 0.28 a 96.08 be 1.84 be
36 936 ab 17.3 ab 2.17 0a 0.32 ab 71.55 b 2.31 c
37 873 ab 23 ab 3.75 11.57 ab 0.85 ab 69.51 b 2.4 c
38 1277 ab 30.2 b 1.83 2.19 a 0.44 ab 86.26 b 2.41 c
43 1506 b 34.5 b 4.17 24.7ab 1.39 abc 95.44 be 2.75 c
2

S at 5% 1196 27.53 60 1.48 51.46 0.94

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

02 Ho ”0 gm a 3N :08 o: o a o on: no A o a Yo a 0 TE

8 5 ”mm wdm a N9: S no no: Wm a mm" no ”so now one we a _c_ b:o <Zm
S ”S ”we mgm 9 New: o ”0 ”OS N: a of o ”3 6w one w.m a new 0:02

95
m ”E ”A m ”2 T— m :2 m..— Emofi :aoE
:aoE Ed :88 :88 3:: :88 m m
5:30 59:5: 3303 3530 SEE: Ems; #3530 c383: E30?
580 580 580 580 £50 £80 530 580 £30
:ouoomfi :053005
05328038? 5:5 -0 2005. 2:035? 037.? 5:50 2905— 00 EB: 05 gone -< 2909— 82:32.:

 

 

APESV .n 039—.

71

.bomBS 5:0 00 Boob: : m: @8355 .:_:.~w =5: - m E: 52:2: - 2 6:5 -4 - 0:50 5::0

#4

._o>o_ sen :5 0: 5:5 :o:o 80.: ago—Iran £323.68: 2: 30:2 883:: 5:5 o:_:> :3: 6: 5&3 :6: 88:5 5:82

m

.35. exon 65 a: 8:5 5:: :5: 285:3: 3.3358: 8: :8565 59:5: 65 ::5 538m .3 :otm: 533 528 :o:o E mo:_:>

m

855:3: 8:86 2:63 3858585.
0: ES, 0 :2on :3: u:: 589:»: 8:86 2:63 5:: m :25: :8: .5::_:oo:_ man mo :50: 05 05:: - < 5&8 :3:

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

m

S ”5 ”w: 0:” : Nhfi o Ho ”03 N: : of c ”3 6w on: wd : new o:oZ
29:5, o_::t:> 3:6:8 ofim

:o_wom

3 ”mo ”on cdm :: am: R ”mm no w.m : m9 mm ”8 ”m: 3 ms 9 EN m:
2 ”ac ”mu QNM :: om: OS no ”0 m6 : v 3 6m now on 5.: :: nfl mm
mm ”2 ”mm 0.3 :: mm: 02 no no Nd : m: Om Mmo ”No on: m: : we hm
91m— ”m: mdm a: w; OS no He 5o : o 3 6m ”on on: We : M: 0m
2 "Va 60 mm a: 32 02 ”o ”O md : m 8 ”00 ”mm 3: m6 n:nw_ om
N: ”om ”mm cdm : 33 we "mm ”o 2 : o 8 ”mm ”No :: Wm :: m2 2
we "m: ”mm mm :: omfl P ”3 ”no m6 : mm: mm ”2 ”mm on: Wm : mo 3
3 ”we ”Na mgm 9: on: mm ”mm 6 wd : o 3 ”mm ”3. 3: 1m : w: 2
2 moo 3w 0.3 9: mm: on: no no _ : 3 0o ”8 ”mm on md. : mom 2
5:385:

 

 

.3553 .m 2%.:

72

Table 6. The effect PH-l and the various daf mutants of F. graminearum

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Treatment % seed germinationb Aerial Biomass (g) /
Germinated Seedlingsc
Exp. 1 Exp. 2 Exp. 1 Exp. 2
None 100 95 0.24 0.33
SNA‘ 95 100 0.20 0.23
PH-l 24 l4 0.10 0.20
daf mutant
10 90 57** 0.15 0.17
11 76 66 0.21 0.23
14 62 76 0.18 0.22
15 80 38** 0.21 0.30
26 90 76 0.26 0.28
36 80 67 0.19 0.19
37 67 52 0.22 0.31
38 90 86 0.30 0.25
43 90 33** 0.21 0.35
Stande dev 21 28.5 0.04 0.03
None lOO 95 0.24 0.33

 

 

 

 

 

a
Control inoculated with only plugs of SNA

Percent seed emergence: assessment 14 days after inoculation, where 100% = 21 seeds

C
mean above ground biomass of a germinated seedling assessed 21 days after

inoculation
* in Exp 2 the overall affect of the disease was higher
“significantly lower seed germination in Exp 2

73

 

Table 7. DON levels produced in vitro by various F. graminearum isolates

ug DON

l
PH—l 284
mutant
10 2.7
l l 4.1
14 2.9
15 428
26 368
36 817

37 nd
38 179
43 203

 

1
Calculated as per g (dry weight) of mycelia

2
n.d. Not determined

74

>on E BEE—.3: Eu 8nd v 085 .23 5 2a 856 A $56508 cots—0:8

 

 

 

 
 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

m

. 59:5: in
88 o 23 use

:0. 0
$3 $3 - em» 0.?”
. . . U =omwom
m2 o 5 c mm o - “BEE 58o
. . . . m cogmom
S o as o Sm o Em o - 52» 0.93
. . . . . m SEE
E. o mom o E o 35 o 3% o - 2382. :35
. . . . . . < Sana
am. 9 wwm o arm 6 mm o gv o mom o - ES» ombfi
. . . . . . . < :9va
an o 5 c as 0 com o 3o 0 98 o a? o - spas: =30
Rho- 2:6 806. (bod .3 md .vwd wmvd- wmmd- ZOO
. . . . . . . . 85%”.
S o- . am c- Sun 0. N3. o- 08 0. VM _ 0 $2 o- cum 0. So 0 macaw—
muhé. 310- 3&6. .Nd- 30.0 NS .o- mewd- mafia- Nmod oamd mac—0:0
. . . . . . . . . . 928.5“
«ms a. E. o- was a. 2 a o- «8 0 so 0. 8w c- N a o- a. o E. o 2:. 8 9.5085

Ema; 59:5: : .
. Eda .353: :35 52:5: Ema 59:5: 3332

“Jumbo ”WWW 3.8.. 596 3.3 520 3.3 £90 28 £53. 9.30:0 32052.".
U+m+< U+m+< U U m m < < U+m+< U+m < zommoh n8:

 

 

conga: EEQEEEM E 330:8 muse: 30:3 5 course—6 méuocofi got? 05 5953 macomommoon. 5:28.80 .w 05$.

75

APPENDIX B

FIGURES

76

 

Figure ]. PKS mutations affecting perithecium pigmentation. A. AURI mutant showing
black perithecia and black stroma. B. Wild type strain showing heavily pigmented, blue-
black perithecia on red stroma. C. Mutant strain with PGLl disrupted showing albino

perithecia on red stroma.

77

Figure 2. Expression of putative PKS genes by wild type G. zeae under varying
conditions. A representative RT-PCR result is presented. Expression is indicated by the
appropriately sized band on an agarose gel (+). Absence of expression is indicated by the
lack of an appropriately sized band (-). Culture conditions are indicated as follows: 1)
Czapek-Dox, liquid 10 d; 2) potato dextrose broth, 48 h: 3) potato dextrose broth, 60 h; 4)
yeast extract sucrose, liquid, 60 h; 6-8) carrot agar, 4, 5, and 6 d after treatment to induce
perithecial development; 9-l 1) 48.72 and 96 h post inoculation of wheat head; 12) carbon
starvation conditions; 12) nitrogen starvation conditions; 14) rice agar, 9 d; 15016) corn

meal, 48 h and 96 h; 17) carboxymethyl cellulose media, 4d; 18) DON inducing media.

78

mmvE
vaE
-5<
n _ mvE
5mm
fimDmNO
:mvE
I omxm
:0;

g . 5v:

5&0

+
it

NEN
EmN
. . - _mm4m
lwllrl r, [fill 935
+ . r + .f‘,... 23*
a 2 m: a s a a __ e m m .___ m m s e” N agave;

 

79

 

 

23:28 .N 23%

.Esonm obs 2529.8 AZV 36355: 95 e @822: can 525 85% 2: mo couwoaxm 6:: on“ 323 33065 8m
wage 05 mo 885308 can “38:: 328 BE. .28 E :32? i a: 98 w: mwucoo MESS—:8 8:038 .05: 2:. .wcfiozfimmob
.3 BHSEE on .02-: Eu EB BONE“ .35» 35¢ 95. .9505 3 “63865 a 5:252“: mo :28th on: 3:035:

05 .3 cog—.8052 mmccg 1296.9. co 3530 2a wocom @2235 BE. .5620 25m =3 2: mo couficomuafl otanzom .m oSmE

 

 

 

 

 

 

 

 

   

u Z
+ —
wagcun— emou 5v.”— ~<HN ~<HN m SN _ Um ammub— EM. vamgun— mango“
and a an": o 3.2.” c @33— 33:
en— a u a: S u

m M N<HN an»: 933ch manna...—
2 U .—
m m BEEP. $9.25

0991. l I P

U<UUUOUU<U

80

Fungal Isolate

Gene

 

ZEAZ

F602324

 

Figure 4. Expression analysis of ZEA] and ZEA2 in disrupted mutants.
PCR analysis of expression of genes ZEA], ZEA2, and FGOZ324 in zeal and zeaZ
mutants and in PH-l under zen-inducing conditions. C = no cDNA added; E = ectopic

insertion.

81

      

3 eifirc

ZEN12 3w E1 ZENEZ

Figure 5. TLC analysis of ZEAl and ZEA2 disruption mutants: ZEN = zen control; 1 =
zealml; 2 = zea2m1;W = PH-1;4 = zea2m2; E1 = zeal ectopic control; E2 = zea2
ectopic control.

82

35105:: as moxon Q 53 Q H<<UU 58 AN 93 C <H<._. of. .383 35:? a .3 58855 5 ocow some Sm ABE 58m

:ozmtomcflb mmh 05:33 2.5. 45.8w Eon 5 @8855 8a moi w5u5n 885 :oumtomcab fiwcfl we 30:0:me 358.50 .2—

wnaoo so an oi: 555% N<mN 53 _<mN .3 mac—coo 53m 05 5253 :5on 68an 83% 058:9 05 no max—£2 .c oSwE

N<MN

wmmm 0H” OU<<O<SOEU<EP<UE<UH<H<<U<O<OEOU<UE<PUH<<UP<UB<U<P<

Nam <oo<o<e<oo<<<o<<oeoboo<88522.9.5552585,...o<035558555o<oo<o<o<o<oEe<eoo<<<oeoooo<o<e<oooe
<H<5
3; 05.55.?o<<o<o<<oe<ooe<<o<o<ooe<oe<eooe<ou<<oeoo<tbe<e<o<052.5uo<oeo<oe<ob<Boto<oe<<ooo<oe<e<<<o<<ooe<
«an <22.805550532503355853853oooo<<§u<<<o<otb<t<<oEooooo<o<<<<ou§<o<oe<t<o<u<<oo<<quo
<H<5 <._.<5
3% <oo<<o<eoeo<5<<558855oo<o8o<BoooEoE<92:03.80535552558503h<<<o<oooo<<oeot<<o<<
<._.<5 3<5
we: o<<<<o5<obooout<oo<5<<ooeooe<<<<§<8038595005o<<e<<8850052265600305880585423835
<<m< + <<m< <._.<5
N<MN mm...
on: ooo<eooo<oeo<o<E<o<oeoe<o<<oooo<<o<Eoeoe<58e<<ooo<e<o<oo<<Bo<E<oo<055$o<oo<obo§<o<5o<uoom<€ v.58
3<5 v
82. 55025583..o<<ooo<oer<<<<~<<<ooh<h<oueuue<oe<oe<uo<ub<eoe<5e<eo<5e<5o<e<uto<<50<obo<ot<055.200...
<._.<5 3<5 <._.<5
29. <8<o<e<o<o5<oe<<oBuo08<<80<ooo<<<<oe<o<o<<58659458003o<<8<t<083E085?8550850383:
<._.<5
83 H3308:ooo<<o<89<§obeto<<o§eooeogoe§b<<05835.3?uoB<e<<<ouoC<oe<ou<<p<<e<<055555
m <55 N 09}. _ + _lv

mnmm

wo_n

mnOn

bvov

omwv

~mn¢

_~ov

__nv

nave

momv

:QN mmh ~<m~N

83

.&<mN
can E<mN ‘3 $35—$85 con

H8 Swansea: @88on .h oSwE

mcocofihmmN

:
gi W‘MV:\OE

o
h
n_/v\m/\Ow (a

o/\p/w\o/\: J_\\ \\._J\\0

ma . = c: _
_ o mo
3. m/\2 \
n Ml/ <mN\ow:_ J. 2
_ 2 om /n N/OM
oq\/m\/¢_\_ fl__\ fl.\ oz
/ E<mN\mfl \:W\2 m ozmmmflmuchm
= . .
¢/ 0: O :0
m INN o
{m
um: 001/_\_ 2/3_\\
o
3<mN\m w/\: N/xe
___ :/ /\::/\/\V\
2 x. v _
N 0 mo
QF<mN \ m/\: /\ _/\/\ /\:%\o/w\b/o=\m/\m/~_\_
w... 2.. 2.. N~=
o o o o J m._o mo
F

Q~<mN \mNK :/2\o/\ M\ /\m/\_
= _
0 mo

84

@5895? 8856 o: .53

65 cons—605 no 852“ 05 328. .U
558% £596 60:5 818 65“ «558
.8593 :0 25895? 68683 :53
806 323 68 388.5% 685805
.m :omwom E53805 mo 85a 8:
96% .< =5wom 68865 03 >58”.
5me 65 8355 58m .5995?
8856 855.» .6 505883
355553 8: 8m 68: 85on

68: m 8E. 8533 859 6:8 3
68865 88859. 05 5:53 858:8
80.5w 8: 95 6885 203 55—8»:—
EEuwSEEM N w558:oo awn—a Bw<
.8558.“ 558.. 3 68888 8885?
m0 258 6:88 8883 w5mra58
68: 8865 233.83 58.523 a mo

coumfiomoae 83558953 .w 053m

£509. 11..
829.3» 11

9.86.305
ho EBnTIv

.......
0.

¢ 0
ooooooo
oooooooo
......
.....

a

o o...
. .DA
‘. .o
to .0.
V.. .o
O. ‘O.
... ..
Q. o.
vo. s
.0 O
..

  

 

 

85

25on 68: 505 62988
mm? 55% 0: Jim 5m
.6288? 8a noun—805

mo 58 2: 323 Q

65 £55805 .6 850m 2:
3 Amy £58585 6 850m
8: 2v o>ona w5q2o>06
88m .8 3 5m it

as 8.2% SE 835
68: 8w5w a 505 603955
58w 235: we 0053an

8.38982 .m nun—ME

 

 

86

 

PH-l dafl4 daflS SNA

Figure 10. A wheat seedling container test used to explore root infection by F.
graminearum. Three wheat seed were planted in each container at the same time as the
mycelium/conidia inoculum. The photograph was taken at 2ldays after inoculation with

the parental strain PH-l (left), the mutants daf l4 and daf 15 ( middle) or with SNA only,

as the control (right).

87

APPENDIX C

SOUTHERN ANALYSIS OF PKS DISRUPTED MUTANT S

88

 

 

l
2.1 kb 3.5 kb 1.
*‘—‘——_—— 7.4 kb

>
——w
""'.I.‘

:1:

I
:1:
w
:1:

U—I—
I
_
NI
v’r

 

   

M‘WE MIMZEWt MlM2EWt MlM2EWt

Figure 11. Disruption of PKSII by single-crossover homologous recombination.

A. Schematic of disruption vector (pPKSl 1) integrated in the chromosome at PKSII. The
numbers represent the size of the predicted fragments. B, BstBI restriction sites; H,
HindIII restriction sites; —— , genomic DNA; '''' , insert sequence used to generate
pPKSll disruption vector; ------------ , pHYG4 vector used to generate pPKSl 1. MI and M2,
two independent disrupted mutants; E, ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, E and Wt digested with BstBI (a
and b) and HindIII (c and d). Probes were generated with the insert sequence to pPKSl l
(a and c) and an internal fragment of hph] (b and d). The arrows to the lefi of the
Southern blots represent the molecular size markers in kb; 23.1, 9.4, 6.6, 4.4, 2.3 and 2.0
from top to bottom and sizes at the right indicate the hybridization signals for each isolate

in kb.

 

A XN x x x x N x
L l J I l
T r ' |

.5 kb 1.2 kb 0.5 kb 3.2 kb 2.9 kbl

 

‘_——' 7.9 kb

B

a b c
9
7.9 7.
3.2
2.7 29
1.2 .
0.5
MI M2 E Wt

M1M2E Wt Ml MZEWt M1 MZEWt

 

Figure 12. Disruption of A URI by single-crossover homologous recombination.

A. Schematic of disruption vector (pAURl) integrated in the chromosome at AURI . The
numbers represent the size of the predicted fragments. N, NruI restriction sites; X, XhoI
restriction sites; — , genomic DNA; ----- , insert sequence used to generate pAURl
disruption vector; ~ -------- — , pHYG4 vector used to generate pAURl. M1 and M2, two
independent disrupted mutants; E, ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, E and Wt digested with NruI (a and
b) and XhoI (c and d). Probes were generated with the insert sequence to pAURl (a and
c) and an internal fragment of hph] (b and d). The arrows to the left of the Southern blots
represent the molecular size markers in kb; 23.], 9.4, 6.6, 2.3 and 2.0 from top to bottom
and sizes at the right indicate the hybridization signals for each isolate in kb.

90

A Bb Bs B3 B5 Bs Bb

 

I
2.8 kb 5.7 kb 1.2 kb
< 11.8 kb =

 

 

 

Ml M2EWt M1M2E Wt MlMZEWt MlMZEWt

Figure 13. Disruption of ZEA] by single-crossover homologous recombination.

A. Schematic of disruption vector (pZEAl) integrated in the chromosome at ZEA]. The
numbers represent the size of the predicted fragments. Bb, BbsI restriction sites; Bs,
BseRI restriction sites; —— , genomic DNA; ..... , insert sequence used to generate
pZEAl disruption vector; , pHYG4 vector used to generate pZEAl. M1 and M2,
two independent disrupted mutants; E, ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, E and Wt digested with BbsI (a and
b) and BseRI (c and d). Probes were generated with the insert sequence to pZEAl (a and
c) and an internal fragment of hph] (b and d). The arrows to the left of the Southern blots
represent the molecular size markers in kb; 23.1, 9.4, 6.6, 2.3 and 2.0 from top to bottom
and sizes at the right indicate the hybridization signals for each isolate in kb.

91

 

M1M2E Wt Ml M2EWt Ml M2EWt Ml M2EWt

Figure 14. Disruption of ZEA2 by single-crossover homologous recombination.

A. Schematic of disruption vector (pZEA2) integrated in the chromosome at ZEA2. The
numbers represent the size of the predicted fragments. B, BsaBI restriction sites; S, SphI
restriction sites; _ , genomic DNA; ..... , insert sequence used to generate pZEA2
disruption vector; ............... , pHYG4 vector used to generate pZEA2. M1 and M2, two
independent disrupted mutants; E. ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, E and Wt digested with BsaBI (a
and b) and SphI (c and d). Probes were generated with the insert sequence to pZEA2 (a
and c) and an internal fragment of hph] (b and d). The arrows to the left of the Southern
blots represent the molecular size markers in kb; 23.1, 9.4, 6.6, 2.3 and 2.0 from top to
bottom and sizes at the right indicate the hybridization signals for each isolate in kb.

92

AHBH H H H B

 

1 kb 1.9 kb 3.7 kb 1.6 kb
<— 9.3 kb

V

 

1.2
M1M2E Wt Ml M2EWt Ml M2EWt Ml M2EWt

Figure 15. Disruption of PKS17 by single-crossover homologous recombination.

A. Schematic of disruption vector (pPKSl7) integrated in the chromosome at PKSI7. The
numbers represent the size of the predicted fragments. B, BsaBI restriction sites; H,
HindIII restriction sites; — , genomic DNA; ----- , insert sequence used to generate
pPKSl7 disruption vector; ........._.. , pHYG4 vector used to generate pPKS 17. M1 and M2,
two independent disrupted mutants; E, ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, E and Wt digested with BsaBI (a
and b) and HindIII (c and d). Probes were generated with the insert sequence to pPKSl7
(a and c) and an internal fragment of hph] (b and d). The arrows to the left of the
Southern blots represent the molecular size markers in kb; 23.1, 9.4, 6.6, 4.4, 2.3 and 2.0
from top to bottom and sizes at the right indicate the hybridization signals for each isolate
in kb.

93

 

 

4 13.4 kb :

   

15
15
13.4 13.4
7.7
MlMZE Wt Ml M2EWt

Figure 16. Disruption of GRSI by single-crossover homologous recombination.

A. Schematic of disruption vector (pGRS 1) integrated in the chromosome at GRSI. The
numbers represent the size of the predicted fragments. B, BstBI restriction sites; _ ,
genomic DNA; ..... ,insert sequence used to generate pGRSl disruption vector;

pHY G4 vector used to generate pGRSl. M1 and M2 two independent disrupted mutants;
E, ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, E and Wt digested with BstBI (a
and b). Probes were generated with the insert sequence to pGRSl (a) and an internal
fragment of hph] (b). The arrows to the left of the Southern blots represent the molecular
size markers in kb; 23.1, 9.4, 6.6, 4.4, 2.3 and 2.0 from top to bottom and sizes at the
right indicate the hybridization signals for each isolate in kb.

94

><

 

>
——><

l
2.1 kb 1.8 kb 3.4 kb

   

Ml EWt MlEWt

Figure 17. Disruption of PLSPI by single-crossover homologous recombination.

A. Schematic of disruption vector (pPLSPl) integrated in the chromosome at PLSPI. The
numbers represent the size of the predicted fragments. A, Ach restriction sites; —,
genomic DNA; ----- , insert sequence used to generate pPLSPl disruption vector; ‘‘‘‘‘ ~ ,
pHYG4 vector used to generate pPLSPl. M1, disrupted mutant; E, ectopic mutant; Wt,
wild type.

B. Southern analysis of genomic DNA from M], E and Wt digested with Ach (a and b).
Probes were generated with the insert sequence to pPLSPl (a) and an internal fragment
of hph] (b). The arrows to the left of the Southern blots represent the molecular size
markers in kb; 23.1, 9.4, 6.6, 4.4, 2.3 and 2.0 from top to bottom and sizes at the right
indicate the hybridization signals for each isolate in kb.

95

 

I
I
_I_w

B M
1.5 k 6.2 kb 1.6 kb I

VP 12.7 kb

 

 

     

B
d

20 20

12.7 12.7 7 7
6.2 6.2

6.5 1.6
1.5

MlMZEWt Ml M2EWt Ml M2EWt Ml M2EWt

Figure 18. Disruption of PKSZ by single—crossover homologous recombination.

A. Schematic of disruption vector (pPKSZ) integrated in the chromosome at PKSZ. The
numbers represent the size of the predicted fragments. M, MluI restriction sites; B, Bbsl
restriction sites; _, genomic DNA; ..... , insert sequence used to generate pPKSZ
disruption vector; ~~~~~~~~ , pHYG4 vector used to generate pPKSZ. M1 and M2, two
independent disrupted mutants; E, ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, E and Wt digested with MluI (a
and b) and BbsI (c and d). Probes were generated with the insert sequence to pPKSZ (a
and c) and an internal fragment of hph] (b and d). The arrows to the left of the Southern
blots represent the molecular size markers in kb; 23.], 9.4, 6.6, 4.4, 2.3 and 2.0 from top
to bottom and sizes at the right indicate the hybridization signals for each isolate in kb.

96

 

3.5 k 6.0 kb 2.9 kb

6.0

     

M1M2Wt M l M2Wt M l M2Wt

Figure 19. Disruption of PKSS by single-crossover homologous recombination.

A. Schematic of disruption vector (pPKSS) integrated in the chromosome at PKSS. The
numbers represent the size of the predicted fragments. Bs, BstBI restriction sites; Bb,
Bbsl restriction sites; _, genomic DNA; ..... , insert sequence used to generate
pPKSZ disruption vector; , pHYG4 vector used to generate pPKSS. M1 and M2,
two independent disrupted mutants; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, and Wt digested with BstBI (a and
b) and Bbsl (c and d). Probes were generated with the insert sequence to pPKSS (a and c)
and an internal fragment of hph] (b and d). The arrows to the left of the Southern blots
represent the molecular size markers in kb; 23.1, 9.4, 6.6, 4.4, 2.3 and 2.0 from top to
bottom and sizes at the right indicate the hybridization signals for each isolate in kb.

97

A Bg Bs Bs Bs Bg Bs
¥ 1 |_ +_ _

1.8 kb 5.7 kb 1.5 kb

 

 

1.8
1.5

   

MlM2EWt MlM2EWt MlM2EWt MlM2E Wt

Figure 20. Disruption of GzF US I by single-crossover homologous recombination.

A. Schematic of disruption vector (szFUS 1) integrated in the chromosome at GzFUSI.
The numbers represent the size of the predicted fragments. Bg, BglII restriction sites; Bs,
BsaBI restriction sites; _, genomic DNA; ..... , insert sequence used to generate
szFUSl disruption vector; --------------- , pHYG4 vector used to generate szFUSl. M1 and
M2, two independent disrupted mutants; 13, ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, E and Wt digested with BglII (a
and b) and BsaBI (c and d). Probes were generated with the insert sequence to szFU S
(a and c) and an internal fragment of hph] (b and d). The arrows to the left of the
Southern blots represent the molecular size markers in kb; 23.], 9.4, 6.6, 4.4, 2.3 and 2.0
from top to bottom and sizes at the right indicate the hybridization signals for each isolate
in kb.

98

 

 

2.5 kb 5.6 kb 2.3 kb
<—-—-——— 12.0 kb >
B
a b
.o
'2- 12.0 .6
.5
5

MlM2EWt MlM2EWt Ml M2EWt MlM2EWt

Figure 21. Disruption of PKS6 by single-crossover homologous recombination.

A. Schematic of disruption vector (pPKS6) integrated in the chromosome at PKS6. The
numbers represent the size of the predicted fragments. P, PpuMI restriction sites; E,
EcoNI restriction sites; _ , genomic DNA; ..... , insert sequence used to generate
pPKS6 disruption vector; ............... , pHYG4 vector used to generate pPKS6. M1 and M2,
two independent disrupted mutants; E, ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, E and Wt digested with PpuMI (a
and b) and EcoNI (c and d). Probes were generated with the insert sequence to pPKS6 (a
and c) and an internal fragment of hph] (b and d). The arrows to the left of the Southern
blots represent the molecular size markers in kb; 23.1, 9.4, 6.6, 4.4, 2.3 and 2.0 from top
to bottom and sizes at the right indicate the hybridization signals for each isolate in kb.

99

 

 

a b c d
20.0
9.2 9.2
* 9
.l 5.8
‘14

MlM2E Wt MlM2EWt Ml M2EWt Ml MZEWt

Figure 22. Disruption of PKS7 by single-crossover homologous recombination.

A. Schematic of disruption vector (pPKS7) integrated in the chromosome at PKS7. The
numbers represent the size of the predicted fragments. E, EcoNI restriction sites; B,
BstBI restriction sites; _ , genomic DNA; ..... , insert sequence used to generate
pPKS7 disruption vector; ............... , pHYG4 vector used to generate pPKS7. M1 and M2,
two independent disrupted mutants; E, ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, E and Wt digested with EcoNI (a
and b) and BstBI (c and d). Probes were generated with the insert sequence to pPKS7 (a
and c) and an internal fragment of hph] (b and d). The arrows to the left of the Southern
blots represent the molecular size markers in kb; 23.1, 9.4, 6.6, 4.4, 2.3 and 2.0 from top
to bottom and sizes at the right indicate the hybridization signals for each isolate in kb.

| {_ l +

F l

0.9 kb 1.5 kb 4.21:1»
<———— 9.6 kb ———>

b c
20.0
9.6
9.6
3.9 ,

M1M2 E Wt MlM2EWt Ml M2EWt Ml M2E Wt

2.7 kb

ADII ss 3 Silt s

      

Figure 23. Disruption of PLGI by single-crossover homologous recombination.

A. Schematic of disruption vector (pPGLl) integrated in the chromosome at PGL]. The
numbers represent the size of the predicted fragments. N, NruI restriction sites; S, SphI
restriction sites; _, genomic DNA; ..... , insert sequence used to generate pPGLl
disruption vector; .....-...... , pHYG4 vector used to generate pPGLl. M1 and M2, two
independent disrupted mutants; E, ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M] , M2, E and Wt digested with NruI (a and
b) and SphI (c and d). Probes were generated with the insert sequence to pPGLl (a and c)
and an internal fragment of hphl (b and d). The arrows to the lefi of the Southern blots
represent the molecular size markers in kb; 23.1, 9.4, 6.6, 2.3 and 2.0 from top to bottom
and sizes at the right indicate the hybridization signals for each isolate in kb.

101

A 'i i B
I
5.2 kb 5.7 kb 0.9 kb
<* 10.4 kb :

__w

 

 

     

18
18 10.4
10.4
4.7
MlM2EWt MlM2EWt MlM2EWt MlMZEWt

Figure 24. Disruption of PKS9 by single-crossover homologous recombination.

A. Schematic of disruption vector (pPKS9) integrated in the chromosome at PKS9. The
numbers represent the size of the predicted fragments. E, EcoNI restriction sites; B,
BseRI restriction sites; _, genomic DNA; ..... , insert sequence used to generate
pPKS9 disruption vector; ~~~~~ , pHYG4 vector used to generate pPKS9. M1 and M2,
two independent disrupted mutants; E, ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, E and Wt digested with EcoNI (a
and b) and BseRI (c and d). Probes were generated with the insert sequence to pPKS9 (a
and c) and an internal fragment of hph] (b and d). The arrows to the left of the Southern
blots represent the molecular size markers in kb; 23.1, 9.4, 6.6, 4.4, 2.3 and 2.0 fiom top
to bottom and sizes at the right indicate the hybridization signals for each isolate in kb.

102

Bs Bb Eb Bb BIS Eh

I -
l 0.8 k 5.6 kb 2.5 kb
< 9.0 kb :

 

 

 

MlM2EWt MlM2EWt MlM2EWt MlM2EWt

Figure 25. Disruption of PKS] by single-crossover homologous recombination.

A. Schematic of disruption vector (pPKSl) integrated in the chromosome at PKS]. The
numbers represent the size of the predicted fragments. Bs, BsaBI restriction sites; Bb,
Bbsl restriction sites; _. , genomic DNA; ..... , insert sequence used to generate
pPKSl disruption vector; ------------- , pHYG4 vector used to generate pPKS 1. M1 and M2,
two independent disrupted mutants; E, ectopic mutant; Wt, wild type.

B. Southern analysis of genomic DNA from M1, M2, E and Wt digested with BsaBI (a
and b) and Bbsl (c and d). Probes were generated with the insert sequence to pPKSl (a
and c) and an internal fragment of hphI (b and d). The arrows to the left of the Southern
blots represent the molecular size markers in kb; 23.1, 9.4, 6.6, 2.3 and 2.0 from top to
bottom and sizes at the right indicate the hybridization signals for each isolate in kb.

103

APPENDIX D

EJECTION MECHANICS AND TRAJECTORY OF THE ASCOSPORES OF

Gibberella zeae (ANAMORPH Fusarium graminearum)

104

Trail, F., L Gaffoor, and S. Vogel. 2005. Ejection mechanics and trajectory of the
ascospores of Gibberella zeae (anamorph F uarium graminearum). Fungal Genetics and

Biology 42:528-533.

Sexual reproduction in G. zeae results in the formation of meiotic ascospores
within asci which are saclike structures. Numerous asci are enclosed within a perithecium
which is an enclosed fruiting body. At maturity the ascospores are forcibly ejected from
the asci. Since the boundary layer of air surrounding the perithecia are relatively still, the
spores need to achieve sufficient acceleration to escape this boundary layer so that the
spores reach the air currents above so that the spores can be dispersed widely.

This study describes the analysis of ascus function and the source of turgor
pressure. My contribution to this study consisted of determining the average volume of

asci.

105

901

 

 

 

Available online at www.5ciencedirect.com

.mmadjmuw ru§5fi6¥§m

AND BIOLOGY
Fungal Genetics and Biology 42 (2005) 528A533

www.clsevier.com/locate/yfgbi

Ejection mechanics and trajectory of the ascospores
of Gibberella zeae (anamorph Fuarium graminearum)

Frances Trail a‘*, Ifla Gaffoor a, Steven Vogel b

a Departments of Plant Biology and Plant Pathology, Michigan State University, East Lansing, MI 48824. USA
b Department of Biology, Duke University, Durham. NC 27708, USA

Received 2 September 2004; accepted 15 March 2005

 

Abstract

Since wind speed drops to zero at a surface, forced ejection should facilitate spore dispersal. But for tiny Spores, with low mass
relative to surface area, high ejection speed yields only a short range trajectory, so pernicious is their drag. Thus, achieving high
speeds requires prodigious accelerations. 1n the ascomycete Jibberella 5551:), we determined the launch speed and kinetic energy
of ascospores shot from perithecia, and the source and magnitude of the pressure driving the launch. We asked whether the pressure
inside the ascus suffices to account for launch speed and energy. Launch speed was 34.5 m s“, requiring a pressure of 1.54 MPa and
an acceleration of 870,000 g—the highest acceleration reported in a biological system. This analysis allows us to discount the major
sugar component of the epiplasmic fluid, mannitol, as having a key role in driving discharge, and supports the role of potassium ion
flux in the mechanism.
© 2005 Elsevier Inc. All rights reserved.

Keywords: Ascospore discharge; Perithecia; Turgor pressure; Mannitol; Reynolds number; Stokes‘ Law

 

1. Introduction Pyrenomycete Gibberella zeae (Schw.) Petch (anamorph
Fusarium graminearum Schwabe). Towards this end, we
Forcible discharge of ascospores forms the basis of recently characterized the contents of the epiplasmic

spore dispersal in the Ascomycota, the largest group
of fungi. Yet despite the importance of this phenome—
non, little is known of its mechanism. Nearly 100 years
ago, Buller (1909) studied the forcible ejection of
ascospores in Ascobolus immersus. He observed fluid
accompanying the ejection and predicted the behavior
of the spores once launched from the ascus. Ingold
(1966, 1971) studied spore discharge in many groups
of fungi and speculated that glucose and ions were re-
quired to generate the turgor force for discharging
ascospores in Sordaria fimicola. Our goal is to under-
stand the physiological and genetic basis of the mech-
anism of forcible ascospore discharge in the

' Corresponding author. Fax: +1 517 353 1926.
E-mail address: trail@msu.edu (F. Trail).

1087-1845/$ - see front matter © 2005 Elsevier Inc. All rights reserved.
doi:10.1016/j.fgb.2005.03.008

fluid accompanying the discharged spores and hypoth-
esized that both mannitol and potassium ions were in-
volved in forcible discharge based on analysis of
epiplasmic sap by gas chromatography/mass spectrom-
etry and on pharmacological studies (Trail et al., 2002).
By contrast, Fischer et al. (2004) used these GC/MS
techniques to identify glycerol as the major sugar com-
ponent of epiplasmic fluid in the apothecium-forming
fungus A. immersus. ‘

In G. zeae, a wheat pathogen which relies on forcible
ejection to initiate the transfer of ascospores from the
field debris to wheat flowers, asci are contained in a
flask-shaped perithecium (Fig. 1; Booth, 1971; Shaner,
2003). Within the perithecium, asci extend singly and
in succession to the ostiole to discharge their contents
of spores and fluid into the air (Trail and Common,

 

AOL

F. Trail el al. / Fungal Genetics and Biology 42 (2005) 528—533

2000; Trail et al., 2002). Although light is important for
stimulating perithecium development (Tschanz et al.,
1975), ascospore discharge is only mildly increased in
the presence of light (Trail et al., 2002). Unlike fruiting
bodies of some other ascomycetes [the perithecial necks
of S. fimz’cola, (Ingold and Hadland, 1959), for example],
those of G. zeae do not orient to light to eject their
spores.

Here, we continue our analysis of ascus function in G.
zeae, asking about the source of turgor pressure in these
asci. From determinations of shooting range, we esti-
mated the launch speed and kinetic energy of the ascosp—
ores. We also determined the source and magnitude of
the pressure generated by the osmolytes within the as-
cus. We then asked whether that pressure suffices to ac-
count for launch speed and energy. Our findings show
that mannitol is not sufficient to generate the pressure
for discharge of the eight ascospores, but the potassium
and chloride ions in the fluid would generate the re—

quired turgor pressure.

2. Methods

2.1. Ascus measurements, shooting distance, and spore
mass

Mature perithecia of G. zeae strain PH-l (FGSC
9075, NRRL 31084), prepared as previously described
(Trail and Common, 2000), were placed in water, gently
crushed between a slide and cover slip, stained with
Calcofluor White, and observed with a Laser Scanning
Confocal microscope (Zeiss LSM 210, Germany). The
length and the width at 7—8 points of 10 mature asci
(Fig. 1C) were measured using image analysis software
(LSM version 2.1, Opton Feintechnik GmbH). Standard
calculus was applied to calculate the volume. Measure-
ments of the central perithecium cavity from base of asci
to ostiole were taken from sections (6 pm thick) through
mature perithecia cryofixed in isopentane at approxi-
mately —60 °C, affixed to slides and mounted in Gel/
Mount (Biomedia, Foster City, CA). Measurements of
sections through the center of six perithecia were used
to generate the average length of an extended ascus
reaching theostiole. The volume of the extended ascus
(Figs. 1A and B) was estimated assuming the ascus
maintained an average diameter when extending to the
ostiole.

To measure horizontal distance of spore discharge, a
glass chamber was constructed as previously described
(Aylor and Anagnostakis, 1991) to minimize free con-
vection. A block of agar containing mature perithecia
was mounted in the chamber so that spores were ejected
horizontally down the length of the chamber onto a
removable glass coverslip. Range of spores was then
measured microscopically.

%

g (29
.9

0O

0 0
O

53

o

o o 000009063,

£2

. 41??
.JJ' y
('1

we?
)3
I, .

_- a—o‘.
“31,7'
‘.
Q

3:7 It" I ' I.
i :4 fit] {21%

.1' ‘A .25" ll/ ";
”J I” /., ’31
ll )5. .I __ ,1)
11 (iii rfigliia
5“ ‘1

“‘0

.‘ A, - .
‘33.. 01-3", ~

 

Fig. 1. Longitudinal section through a mature perithecium of G. zeae.
An ascus retracting following ejection of spores and fluid (A); a mature
ascus, extending upward to the end of the ostiolar canal to discharge
(B); and a mature, unextended ascus (C). Bar =. 50 pm. Rendering
based on previous investigations (Trail and Common. 2000).

Spore mass was estimated to be 2.02 X 10’13 kg, cal-
culated from volume and density as follows. We esti-
mated mass of the ascospores from volume and
density. G. zeae has an average spore length of 21 um
and diameter of 3.5 pm (Booth, 1971). We adopted a
cylindrical shape for volume calculation and assumed
the density of water, 1000 kg m‘3, as an estimate of
spore density. A cylindrical shape overestimates volume,
since the spores taper at their ends, while using water’s
density most likely underestimates density since spores
normally sink in water. Buller ( 1909) found densities
of basidiospores to vary from slightly higher than water
to as much as 20% higher. The lighter spores contained
visible oil droplets, as do the ascospores of G. zeae. Di-
rect measurement of spores as they are discharged from
the ascus was not possible due to the rapid evaporation
of fluid as spores are released.

 

 

 

801

F. Trail el al. /Fw1gal Genetics and Biology 42 {2005) 528433

2.2. Concentrations ofmannitol, K, and Cl—

Epiplasmic fluid was collected and sugar components
identified as previously described (Trail et al., 2002).
Mannitol concentration was determined by GC/mass
spectrometry in comparison to known standards (Trail
et al., 2002). The potassium ion (39K) concentration in
epiplasmic fluid was determined by Inductively Coupled
Plasma Mass Spectrometry (Micromass Platform; ICP-
MS) using a Meinhard concentric nebulizer as the sam-
ple introduction system. Before data acquisition, the
ICP-MS was optimized while running a standard solu-
tion containing 10 ug/L of Be, Co, In, Ce, Bi, and U
using indium as the internal standard. The concentra-
tion was calculated based on linear regression of stan—
dard solutions.

2.3. Eflective radii of spores

The following formulas (Cox, 1970) were used to
approximate the drag of cylinders or long ellipsoids with
their long axes normal and parallel to flow, respectively.

4nuvl
D : ——_— .
ln(l/a) + 0.193 dnd
D : Znuvl ’
ln(1/a) + 0.807

where I and a are length and radius, respectively, of cyl-
inder or ellipsoid.

2.4. Computing trajectories

A diameter of 9.27 pm, a density of 1000 kg m’3, an
iterative interval of 20 us, a launch pitch angle of 0°, a
landing height (which mattered little) of 10 mm below
launch height, and a range of launch speeds were used
as inputs for the computer program (Vogel, 1988) used
to determine trajectories.

3. Results
3.]. Minimal pressure for ejection of ascospores

The minimal pressure required for ejection of ascosp-
ores was estimated by equating pressure—volume change
(pAV) of launch with the kinetic energy (mvz/2; m: mass,
v: speed) of the spores launched. Acceleration within the
ascus was estimated from ascus dimensions and launch
speed (02/21; 1: length), assuming constant acceleration.

The average length of a mature ascus was 0.076 mm
(standard deviation 0.0030). From that length and from
measurements of diameter, the average ascus volume at
maturity (Fig. 1C) was calculated to be 3.72 x 10‘15 1113
(standard deviation 7.8 x 10‘16). Asci stretched to

approximately 0.159 mm to release spores into the air
(Figs. 1A and B), resulting in 8.12 ><10‘15 n13 as the esti-
mated volume of the extended ascus (Fig. 1B). Spore
volume encompassed 1.61 x 10~15 m3. leaving
2.10 X 10’15 m3 for the epiplasmic fluid in the mature as-
cus, and 6.52 x 10”15 m3 in the extended ascus. Spores
clustered in the upper portion of the mature ascus, with
an acceleration distance of 0.070 mm (standard devia-
tion 0.003 mm).

Launch speed was determined from the range of the
projectiles (Fig. 2). Direct photographic determination
of launch speed was not possible due to the initial speeds
of over a million body lengths per second (determined
by dividing launch speed by spore length), the small size
of the spores, and the unpredictability of spore release.
Accounting for drag requires knowledge of both shape
and drag coefficient; with the extreme changes of speed,
the latter varies over the course of the trajectory. A
spore was assumed to tumble in flight. With no obvious
stabilizing structures, this seemed a conservative
assumption and it is supported by the photographic
observations of the late Robert M. Page (1964 and per-
sonal communication) that Pilobolus sporangia tumble
after release. A tumbling spore would incur a drag about
equal to the average of a cylinder travelling cross-wise to
flow and one travelling parallel to its long axis (see Sec-
tion 2). The average of these was set equal to the drag of
a sphere as given by Stokes’ law, D = 61tuav (u: room
temperature air viscosity, about 18 X 10‘6 Pa 5; a: ra—
dius), permitting estimation of the diameter of an equiv-
alent sphere from the dimensions of a spore. The
Reynolds number, a parameter that indicates the general
character of such flows, Re: pdv/u, was determined
using that diameter and, p, the density of air at room
temperature (1.2 kg m‘3). That, in turn, was used in a
semi-empirical equation for the drag coefficient of

 

0 2.8 3.2 4.5 5.5 6.5 7 8.5
Distance (mm)

Fig. 2. Number of ascospores discharged to various distances in still

. air. Total number of spores accumulating within a band extending

0.6 mm on either side of distance shown. Combined results from a total
of 720 spores assessed from seven independent trials.

 

 

601-

 

E Trail at al. / Fungal Genetics and Biology 42 {2005} 528—533

spheres based on maximal cross—sectional area, S
(White, 1974),

24 6
_ Re + m + 0.47
where D = Cdpsz/Z. Note that the term. 24/Re, corre-
sponds to Stokes’ law.

Using these formulas, though, requires knowing
speed—~which is what we wanted to find. Moreover, drag
will cause speed to decrease rapidly after launch. Thus,
we used an iterative approach together with successive
approximations to work back from mean distance trav-
elled to launch speed. A version of an earlier computer
program (Vogel, 1988), using the formula above, gave
a trajectory based on 3000 successive points equally
spaced in time. At each point, drag coefficient and drag
were calculated and used to get new values of speed
and direction. Launch speed for a horizontal range of
4.6 mm turned out to be 34.5 m 371. While some spores
travelled further, possible assistance by air currents sug-
gested using this more conservative figure.

From that launch speed and the distance of 0.07 mm,
the average acceleration of a spore prior to launch is
8.5X106ms_2 or 870,000g. From that launch speed
and spore mass, the energy imparted to an individual
spore comes to 1.2 x 10‘10 J. Assuming the ascus emp-
ties in launch and assuming the volume given above,
the launch energy requires a pressure of 185 kPa. To
launch eight spores would take a pressure of
1.48 MPa. To launch eight spores plus the epiplasm re-
quires slightly more~1.54 MPa. These pressures, of
course, represent minimal estimates, assuming such ide-
alizations as no pressure drop during the course of
launch, perfectly unidirectional shooting, and no other
losses. Calculations based on an estimate of spore cross
sections and force gave essentially the same results.

Cd

3.2. Identification and quantification of the osmolytes in
the epiplasmic fluid

When spores are discharged from asci of G. zeae,
droplets of epiplasmic fluid accompany the projectiles

(Fig. l; Trail et al., 2002). Analysis of this fluid revealed .

the presence of three major osmolytes: mannitol, K+,
and Cl‘. The concentration of mannitol in the dis-
charged epiplasmic fluid was determined to be
4.7 x 10‘12 g per . ascus (standard deviation
2.2 X 10””). The concentration of mannitol in the epi:
plasmic fluid would be approximately 0.012 M in the
mature ascus before it begins to extend (Fig. 1C). This
concentration will generate 0.029 MPa (Davis et al.,
2000), insufficient pressure for discharging the spores
and fluid.

Using ICP-MS analysis, we found the concentration
of K+ ions in the epiplasmic fluid to be 4.72 x 10‘11 pg
per ascus, or 0.57 M in the mature ascus (Fig. 1C) and

/‘$\

0.18 M in the fully extended ascus (Figs. 1A and B).
The corresponding pressure is 1.4 MPa in the former
and 0.45 in the latter. Associated with potassium ions
is the C15 counterion. Measurements of the counterion
by a chloride electrode indicated a final concentration
of 0.192 M in the unextended ascus, corresponding to
a pressure of 0.46 MPa. These pressures, while a little
lower than that calculated as necessary, are reasonably
close, given the assumptions involved (see Section 4).

4. Discussion

From the measurements of osmolyte concentrations
and the calculations of minimal pressures to propel eight
spores, we can infer that mannitol may be used as a
source of energy, or as a “pump-priming“ mechanism
to initiate ascus enlargement, but we can eliminate it
as the osmolyte sufficient to generate the turgor pressure
necessary for discharge. Potassium, the main osmolyte
in the epiplasmic fluid, is likely to provide the osmoti-
cum for spore discharge in G. zeae along with chloride.
Parasitic organisms and saprophytes growing on plant
debris are in potassium-rich environments, as potassium
has been sequestered in the host tissues (Benito ct al.,
2002). Therefore, the environment where perithecia are
formed is likely to be potassium rich, not potassium
limited.

The predicted spore trajectory appears in Fig. 3. It di-
vides into two almost entirely distinct portions. Drag
overwhelmingly dominates the first, causing rapid decel-
eration (initially at about 3 X 105 m 5‘2, or about 30,000
times that of gravity). Distance depends minimally on
launch angle, with maximum horizontal range occurring
with near—horizontal launches. In the second phase, the
spore falls vertically at constant speed as the forces of
drag and gravity quickly come into balance. Terminal
velocity and impact speed, 2.58 m S“, is over 10,000
times lower than launch speed. In the field, the spore

60

 

 

01
O

5
0

Height, micrometers
N (a)
O 0

_n
O
-

 

O

 

0 1000 2000 3000 4000 5000
Distance from launch, micrometers

Fig. 3. Spore trajectory. 20 us intervals between points, 34.5 ms—1
initial speed, 2.58 mm s“1 impact speed.

 
 

 

 

011

F Trail at al. / Fungal Genetics and Biology 42 (2005) 5284533

would ordinarily reach air moving well above this latter
speed by the end of the first portion.

The average pre-launch acceleration of
8,500,000 m s“2 (or almost 870,000 times that of gravity)
far exceeds the highest value of acceleration reported in a
biological system, the nematocyst discharge in the coelen-
terate, Hydra (Holstein and Tardent. 1984),
400,000 in s‘2 (propelled by a pressure of 15 MPa; Tar-
dent, 1995). It exceeds by almost a lOO-fold that of the
sporangium of the best-known ballistic fungus, Pilobolus
(Vogel, 1988). Still, one should perhaps restrain one’s awe
at such high values of acceleration. By Newton’s second
law, acceleration is force divided by mass. Force, whether
one considers achievable pressures or the tension a mus—
cle can exert, should scale very roughly with the square of
the length of the system. Mass, reflecting volume, should
scale with the cube of length. Thus acceleration will vary
inversely with length, and small systems should yield very
high values. In compensation, as it were, they accelerate
over shorter distances and therefore achieve final veloci-
ties comparable to those of larger ones.

Not only is the predicted acceleration higher than any
previous biological datum, but so also is the launch
speed relative to the length of the moving object, 1.7 mil-
lion. A few living systems do achieve higher absolute
speeds. Especially fast birds, such as diving falcons
(Tucker et al., 1998), and the explosively discharged
seeds of a euphorb, Hura crepitans (Swaine and Beer,
1977), reach or perhaps exceed 50m 3‘1, but they are
far larger than Gibberella spores. The 40-um spore clus-
ters of the perithecium-forming fungus Sordaria, from
our calculations based on data of Ingold and Hadland
(1959) come closest, with launch speeds around
30 m s‘1 and thus a speed-to-length ratio of 750,000 s‘l.

Stokes’ law has long been regarded as unreliable
above a Reynolds number of one, and various formulas
can be found in the literature of fluid mechanics that ex-
tend its predictions of drag as a function of Reynolds
number above that value, with results that correspond
closely with direct measurements. In G. zeae, with an ini-
tial Reynolds number of about 20, based on the diame-
ter of an equivalent sphere, using Stokes’ law results in a
26-fold underestimate of drag. Thus, the launch speed
needed to achieve the observed range would be nearly
26-fold lower with the use of Stokes’ law. The present
iterative approach, however awkward, thus seems pref-
erable to any explicit single calculation based on Stokes’
law. It predicts, for instance, a launch speed several
times greater for the eight-ascospore projectile of A.
immersus, for which the Reynolds number is about
300, than that estimated by Fischer et a1. (2004).

A pressure probe and a microprobe device were used
to measure pressure at the wall of the ascus in A. immer-
sus and glycerol was identified as the major sugar deriv-
ative in the epiplasmic sap (the presence of ions was not
explored; Fischer et al., 2004). This approach is not pos-

sible in perithecia-forming fungi, as the asci will not reli-
ably discharge following the destruction of the
perithecium (essential to using the probe). so access to
discharging asci is not possible. Furthermore. the small
size of the asci in G. zeae prohibits the use of this
technology.

In well—studied systems, ascospores are discharged
most prominently in association with high humidity
(MacHardy. 1996; McOnie. 1964; Pinkerton et al.,
1998; Shaner. 2003). A mechanism that relies on free
water for discharge of spores would be beneficial to
the fungus, as it ensures that spores are dispersed during
optimal conditions for germination. A feature of many
of the perithecial fungi is the formation of cirrhi, spores
exuded en masse from the ostiole. In the present system.
this occurs under drier conditions, when active discharge
is not optimal (Trail et al., 2002). We hypothesize that
mannitol serves two functions: it is generated and accu-
mulates as the ascus matures and, in the presence of suf-
ficient moisture, initiates membrane stretching, which
activates the ion channels that trigger rapid discharge.
If conditions for forcible discharge are not optimal
(10w relative humidity), the mannitol accumulates suffi-
ciently to force the extrusion of the spores from the peri-
thecium as a cirrhus. Experiments are underway to
generate genetic mutants of genes important to ion
transport and to mannitol biosynthesis to test our model
of discharge.

Acknowledgments

We thank Ken Nadler and CC. Trail for insightful
discussions, Chil Kwon for determining launch distance,
Lina Patina for assisting with the ICP-MS analysis, and
Marlene Cameron for rendering Fig. 1., Funding for this
work was provided by grants from the USDA Wheat
and Barley Scab Initiative and USDA—NRICGP
(20018531940898) and by the Michigan Agricultural
Experiment Station to F.T.

References

Aylor, D.E., Anagnostakis, S.L., 1991. Active discharge distance of
ascospores of Venturia inaequalis. Phytopathology 81, 548—551.
Benito, B., Garciadeblas, B., Rodriguez-Navarro, A., 2002. Potassium-
or sodium-efllux ATPase, a key enzyme in the evolution of fungi.
Microbiology 148, 933v94l.

Booth, C., 1971. The Genus Fusarium. CMI, London.

Buller, A.H.R., 1909. Researches on Fungi, vol. 1. Longman’s Green
and Co., New York.

Cox, R.G., 1970. The motion of long, slender bodies in a viscous fluid.
Part I. General theory. J. Fluid Mech. 44, 791—810.

Davis, D.J., Burlak, C., Money, N.P., 2000. Osmotic pressure of
fungal compatible osmolytes. Mycol. Res. 104, 800—804.

Fischer, M., Cox, J., Davis, D.J., Wagner, A., Taylor, R., Huerta, A.J.,
Money, N.P., 2004. New information on the mechanism of forcible

 

LLL

 

F Trail el al. / Fungal Genetics and Biology 42 (2005) 5287533

ascospore discharge from Ascobolus immersus. Fung. Genet. Biol.
41, 698—707.

Holstein, T., Tardent. P.. 1984. An ultrahigh—speed analysis of
exocytosis: nematocyst discharge. Science 223. 8307832.

Ingold, CT, 1966. Aspects of spore liberation: violent discharge. In:
Madelin, M.F. (Ed), The Fungus Spore. Proceedings of the
Eighteenth Symposium of the Colston Research Society. Bristol.
England. Buttersworths, London, pp. 1134132.

Ingold, CT, 1971. Fungal Spores: Their Liberation and Dispersal.
Clarendon Press, Oxford.

Ingold, C.T., Hadland. S.A., 1959. The ballistics of Sordaria. New
Phytol. 58, 46—57.

MacI-Iardy. W.E., 1996. Apple Scab: Biology. Epidemiology and
Management. APS Press, St. Paul, 545 pp.

McOnie. KC, 1964. Orchard development and discharge of ascosp-
ores of Guignardia citricarpa and the onset of infection in relation
to the control of citrus black spot. Phytopathology 54, 1448—1453.

Page, R.M., 1964. Sporangium discharge in Pilobolus: a photographic
study. Science 146, 925—927.

Pinkerton, J.N., Johnson, K.B., Stone, J.K., Ivors, KL, 1998. Factors
aflecting the release of ascospores of Anisogramma anomala.
Phytopathology 88, 122—128.

Shaner, S.. 2003. Epidemiology of Fusarium head blight of small grain
cereals in North America. In: Leonard, K.J.. Bushnell, W.R.
(Eds). Fusarium Head Blight of Wheat and Barley. APS Press. St.
Paul. pp. 84419.

Swaine. M.D., Beer. T.. 1977. Explosive seed dispersal in Hum
t'repitans. L. (Euphorbiaceae). New Phytol. 78, 6957708.

Tardent. P.. 1995. The cnidarian cnidocyte. a high-tech cellular
weaponry. BioEssays 17, 351—362.

Trail, F.. Xu. H.. Loranger, R.. Gadoury. D., 2002. Physiological
and environmental aspects of ascospore discharge in Gibhcrella
zeae (anamorph Fusarium graminearum). Mycologia 94. 181—
189

Trail. E. Common, R.. 2000. Perithecium development in Giblierella
zeae: a light microscopy study. Mycologia 92. 13(L138.

Tschanz. A.T.. Horst, R.K., Nelson, RE, 1975. Ecological aspects of
ascospore discharge in Gibbcrella zeae. Phytopathology 65. 597.

599.

Tucker. V.A.. Cade, T.J, Tucker. A.E., 1998. Diving speeds and angles
of a gyrfalcon (Falco rustico/us). J. Exp. Biol. 201. 206172070.
Vogel, S.. 1988. Life’s Devices. The Physical World of Animals and

Plants. Princeton University Press, Princeton.
White. F.M.. 1974. Viscous Fluid Flow. McGraw Hill, New York.

APPENDIX E

ISOLATION OF Fusarium graminearum INSERTIONAL MUTANTS

COMPROMISED FOR MYXOTOXIN PRODUCTION AND PATHOGENESIS

ON WHEAT

112

Trail, F., E. Mott, C. Andries, T. Farley, I. Gaffoor, M. Urban, W. Phillips, J. Pitkin,
and K. Hammond-Kosack. Isolation of Fusarium graminearum insertional mutants
compromised for mycotoxin production and pathogenesis on wheat. Molecular Plant-

Microbe Interactions.

G. zeae causes the disease Fusarium Head Blight when it infects cereal crops such as
wheat, oats and barley and corn. In wheat, the airborne spores initiate an infection by
colonizing extruded anthers during anthesis. As the wheat plant matures, the fungus
ramifies throughout the wheat head colonizing the developing grain and eventually
spreads to the vegetative tissue. This process has been studied intensively in an effort to
identify pathogenicity/virulence factors. This study was initiated to identify factors
contributing to pathogenicity/virulence. For this purpose a bank of mutants generated by
Random Insertional Mutagenesis was screened of loss of pathogenicity/virulence. My
contribution to this study was to screen 1 000 mutants whereby I was able to identify 81

mutants that showed symptoms of reduced virulence in a preliminary screen.

113

 

Title: Isolation of F usarium graminearum insertional mutants compromised for

mycotoxin production and pathogenesis on wheat.

Frances Trail‘, Ellie Mottz, Corrie Andries 1, Tom Farleyz, Iffa Gaffoor 1, Martin Urban3,

Wendy Phillips“, John Pitkins, Kim Hammond-Kosacky.

Addresses

1 Departments of Plant Biology and Plant Pathology, Michigan State University, East
Lansing MI 48824, USA

2 Department of Plant Sciences, University of Cambridge, Downing Street, Cambridge,
C82 313A, UK

3 Plant-Pathogen Interaction Division, Rothamsted Research, Harpenden, Herts, ALS
2JQ, UK

4 Biovation Limited, Babraham Hall, Babraham, Cambridge, CBZ 4AT, UK

5 Plant Protection, Monsanto Company, Main stop GG4C, 700 Chesterfield Parkway

North, Chesterfield, Missouri 63198, USA

*To whom all correspondence should be addressed.
Kim.Hammond-Kosac4k@bbs_rc.ac.uk;
Tel +44-(O)1582 763133, Ext 2240

Fax +44-(O)1582 715009

114

Abstract

A mutational analysis of pathogenicity of the head blight fungus, F usarium graminearum
(Gibberella zeae) was undertaken. Mutants were generated by random integration of a
plasmid, and were screened for their ability to infect wheat heads. From a total of 1170
transformants screened, 9 were confirmed to be highly reduced in their ability to produce
visible disease symptoms. We have called these disease attenuated _E. graminearum
mutants, daf mutants. Compared to the parental strain, a higher grain yield and/or
improved grain quality was recovered from the heads inoculated with 6 of the daf
mutants. However, when 3 head regions (above the point of inoculation, within the
visibly diseased region, and below the diseased region) were examined in detail, each daf
mutant caused a distinct phenotype on grain set, size and yield in the head regions. Two
daf mutants caused an increase in grain set above the point of inoculation. The data also
suggests that grain fill throughout the head is affected by these localized infections.
Levels of the mycotoxins, deoxynivalenol, in the threshed grain appeared to be negligible
for one mutant and absent in another mutant. Molecular genetic analysis of each daf

mutant will yield important information regarding this host-pathogen system.

Keywords:
Deoxynivalenol
Fusarium ear blight
Rachis

Wheat grain safety

115

INTRODUCTION

Worldwide, F usarium head blight infections of cereal crops cause considerable
losses to grain quality and safety (Parry et. al., 1995; Windels, 2000,
http://www.scabusa.org). F usarium infections in wheat, barley, rye and maize crops have
been steadily increasing since the early 19905 due to changes to the crop rotation, the
introduction of maize into previously solely wheat growing regions and the use of
low/minimal tillage practices (McMullen et al., 1997). The two main causative agents of
F usarium head blight disease on wheat are the homothallic F. graminearum Schw.
[sexual stage Gibberella zeae (Schw.)] and the asexual F. culmorum (Smith) Saccardo.
In Europe, the disease is more commonly called F usarium ear blight. The disease is
primarily monocyclic with head infections occurring when moist conditions prevail at
anthesis and inoculum is available (Parry et al., 1995). The air-bome fungal spores gain
entry into the plant either via colonizing the extruded anther and then the anther filament,
or by penetrating directly the exposed ovary as each floret opens (Pugh, 1933; Kang and
Buchenauer, 2000a). No specialized fungal penetration structures have been reported.
Subsequent floral tissue colonization involves a mixture of intercellular and intracellular
growth, and also saprophytic aerial growth (Pugh, 1933; Kang and Buchenauer, 2000a,
M. Urban, unpublished). Infected wheat and barley heads prematurely bleach and masses
of pink conidia form on infected spikelets under moist conditions. Grain threshed from
infected heads is often shriveled, has a “tombstone” appearance (Parry et al., 1995) and
can also be internally infected with fungal hyphae. Post-harvest, ascospores form within

perithecia that develop on crop debris remaining on the soil surface (Pugh, 1933; Parry et

116

al., 1995). The detailed biology of perithecia formation has recently been explored (Trail
and Common, 2000).

In wheat, two main types of natural resistance mechanisms to F usarium head
blight are known to exist and other resistance types have been suggested (Mesterhazy,
1995; reviewed by Bushnell et al. 2003, Mesterhazy, 2002). Type I resistance prevents
initial infection. Type II resistance reduces the rate of disease spread within an infected
ear. Exotic wheat germplasm with Type I resistance exists but is rare, whilst the
polygenic based resistance to spread within an infected ear is currently in commercial use
or under selection in breeding programs (Ban and Suenaga, 2000; Del Blanco et al.,
2003).

Many isolates of F. graminearum and F. culmorum produce mycotoxins during
colonization and post-harvest during storage. The estrogenic polyketide, zearalenone is
associated with stored grain, whereas the trichothecene mycotoxins, primarily
deoxynivalenol (DON), 3-acety1 DON, lS-acetyl DON and nivalenol (NIV) are produced
during plant colonization. Isolates representing the 7 genetic lineages of F. graminearum
can produce most chemotypes of trichothecene mycotoxins (O‘Donnell et al., 2000;
Ward et al., 2002). Legislation now limits DON concentrations in finished grain products
for human consumption to 1 ppm in the USA and 0.75 ppm in Denmark, Austria and The
Netherlands (Scholten et al., 2001). Quantities in grain samples from the Red River
Valley in the upper Midwestern USA routinely exceed these quantities (McMullen et al.,
1997). The target site for DON in plant, microbial and animal eukaryotic cells is the
peptidyl transferase protein in the ribosome, and this binding results in the inhibition of

protein synthesis (Cundliffe et al., 1974). Genes involved in trichothecene production

117

have been cloned (Hohn and Desjardins, 1992; Brown et al., 2001; Lee et al., 2002). The
role of trichothecene mycotoxins in fungal penetration is unclear (McCormick et al.,
1998;ng and Buchenauer, 1999, 2000b). However, DON production has been shown
to enhance virulence of F. graminearum towards wheat, but is not an essential
pathogenicity factor (Proctor et al., 1995).

The repertoire of F. graminearum genes required to infect and colonize cereal
host plant species and those required to complete the life cycles are poorly understood.
Besides the trichothecene biosynthetic genes (Proctor et al., 1995, 2002), targeted gene
knock-out studies have shown that two different mitogen activated protein (MAP) kinase
signaling cascades are essential for F. graminearum pathogenicity and sexual perithecia
formation and contribute to DON trichothecene production (Hou et al., 2002;
Jenczmionka et al., 2003; Urban et al., 2003).

Numerous experimental approaches are used to identify fungal genes required
for plant pathogenicity. These include gene expression pattern studies (reviewed by
Skinner et a1, 2001), targeted deletion of genes encoding a known function (for recent
examples involving Fusarium species see: Desjardins et a1, 1996; Hou et a1, 2002) or the
isolation of insertional pathogenicity mutants, (reviewed by Gold et al., 2001). Insertional
mutagenesis has the advantage of not only generating mutants but affords a method to
clone the corresponding genes. Fungal insertional mutagenesis approaches include (1)
the insertion of plasmids containing a selectable marker gene (insertional mutagenesis),
(2) [estriction enzyme mediated DNA _integration (REMI) which uses a restriction
enzyme in conjunction with a selectable plasmid during transformation, (3) transposon-

based insertional mutagenesis and (4) the random mutagenesis of cosmids by in vitro

118

activated transposons prior to fungal transformation. A114 approaches have been applied
successfully to multiple filamentous fungal species, as reviewed by Sweigard and Ebbole
(2001).

In this study, we describe the use of insertional mutagenesis to generate a library
of hygromycin resistant transformants of F. graminearum. Over 1000 transformants were
screened for reduced ability to produce visible disease symptoms. Nine pathogenicity
mutants have been identified and the pathogenic effects on wheat head development and

mycotoxin production have been characterized.

RESULTS

Molecular assessment of insertional mutagenesis

A random insertional mutagenesis approach was used to recover non-pathogenic
mutants of F usarium graminearum. To optimize the recovery of random insertional
mutants, 4 different hygromycin-based plasmids were transformed into F. graminearum.
The full details of each plasmid are given in the materials and methods section.
Substantially more hygromycin-resistant colonies were obtained following
transformation with pHA1.3 and pUCH2-8; therefore, these two plasmids were chosen to
generate a large pool of transformants. Transformation of protoplasts of F. graminearum
was conducted by incubation of protoplasts with linearized plasmid DNA, in the presence
and absence of single restriction enzymes. Rates of transformation were higher without
REMI (0.2 - 2.37 transformants (Tx)/p.g plasmid DNA using linearized pHAl .3 only and

0.08 Tx/ug plasmid DNA from pHA1.3 using REMI). The transformation rate of

protoplasts incubated with linearized pUCH2-8 was 0.2 - 1.2 Tx/ug plasmid DNA. No

119

transformants were recovered from control transformations without vector DNA. Of
5022 mutants generated, 3537 were generated by transformation with pI-IA1.3, and 1485
were generated by transformation with pUCH2-8. Thirteen (0.26%) of the 5022
insertional mutants contained mutations that prevented them from completing the sexual
life cycle as homothallic isolates. Nine of the life cycle mutants were generated by
transformation with pHA1.3, 4 were generated by transformation with pUCH2-8. All
other insertional mutants appeared phenotypically normal in culture and produced
functional perithecia by selfing.

To ascertain the average number of plasmid copies inserted into the F.

R
graminearum genome, DNA was prepared from 10 Hyg transformants generated with

each plasmid. DNA gel blot analyses revealed that 7 of the 10 transformants generated
with plasmid pUCH2.8 had single copy insertions, and 9 of the 10 transformants
generated with plasmid pHAl .3 had single copy insertion events (data not shown).
Meiotic stability tests were performed on 3 life cycle mutants (2 pHA1.3 mutants and l
pUCH2-8) to test stability. In each case, the mutant phenotype co-segregated with the
Hng phenotype, indicating the mutation is likely to be tagged (data not shown). Twelve
transformants (six transformed with each vector) were subjected to a mitotic stability test
by transferring three cycles on V8 juice medium (VM) successively amended with or
lacking HygB. No sectoring was observed and DNA gel blot analysis indicated the
integrated plasmid remained stable throughout these transfers in all transformants (data

not shown).

120

Identification of reduced pathogenicity mutants

A preliminary screen was performed in the greenhouse in which 2 wheat heads

near anthesis were inoculated with each of 1170 Hyg randomly selected transformants.

This population was comprised of 847 transformants harboring plasmid pHA1.3 and 323
transformants harbouring plasmid pUCH2.8. Infections by the parental isolate PI-I-l
caused the entire wheat head to bleach and impeded grain development. Eighty-one
transformants caused significantly lower disease symptoms on both inoculated heads.

Each of the 81 putative reduced pathogenicity mutants was re-tested initially on 2
additional wheat heads using the secondary screen. For this screen each wheat head used
had either two or three spikelets with visibly extruded anthers. Nine of the putative
reduced pathogenicity mutants were confirmed to be highly reduced in their ability to
cause disease symptoms on wheat heads. We have called these disease attenuated Ij.
graminearum mutants, daf mutants. The daf mutants 10, ll, 14, 15, 26, 37, 38 were
generated by pHAl .3, and daf 26 and daf 43 were generated by pUCH2.8. The full
infection phenotype of each daf mutant was then explored in detail by inoculating a
further 6 flowering wheat heads by placing a plug of inoculum in the lSit full sized
spikelet at the top of the wheat head (Table 4, Appendix A). In these infection tests,
hyphae of PH-l colonized the entire wheat head within 20 days and caused every spikelet
to bleach and the awns to assume a horizontal posture.

Five of the 9 pathogenicity mutants (daf 10, 15, 26, 36 and 38) caused externally
visible disease symptoms only on the two originally inoculated spikelets. The other 4

pathogenicity mutants (daf 11, 14, 37, 43) caused disease symptoms to spread down the

121

head below the point of inoculation. However, none of the 9 mutants caused visible
symptoms on more than seven spikelets at and below the point of inoculation by day 20
post inoculation. After this time no further visible disease progression occurred [Table 4,
(Appendix A) and Figure 8(Appendix B)].

F. graminearum head infection is associated with impairment of both grain set
and grain fill within the bleached spikelets (Parry et al., 1995; Bushnell et al., 2003,
Mesterhazy et al., 2002). These disease phenotypes are hypothesized to be caused by
hyphae blocking the main vascular tissue of the rachis and impairing water movement to
the developing grain or by DON -mediated inhibition of protein translation in the
developing grain (Cundliffe et al., 1974). We have termed the disease symptom, which
specifically develops above the point of infection (region A, Figure 8, Appendix B) as
choking, because it is unclear whether symptoms are related to mycelial colonization.
Five or six immature spikelets were present above the inoculated spikelet at the start of
the infection time—course. Choking was visible in all the wheat heads inoculated with
PH-l (Table 4, Appendix A). Interestingly, the 9 daf mutants caused either reduced
choking or no choking (Table 4, Appendix A). Overall, there was a positive correlation
between the extent of visible disease symptoms at and below the point of inoculation and
the extent of choking in the upper head (I: 0.719). However, pathogenicity of daf l l and
daf 43 exhibit no choking, but disease symptoms were visible on 3-4 spikelets.

A further feature of F usarium head infections is the brown streaking of rachis
tissue interconnecting the wheat spikelets. This brown streaking most probably signifies
plant cell necrosis occurring behind the advancing hyphal front. In heads inoculated with

PH-l, brown streaking occurred 2-3 rachis segments in advance of visible bleaching

122

symptoms (Table 4, Appendix A). For each of the insertional mutants, except daf 38,
streaking of the rachis occurred less frequently, but never on fewer than 50 % of the
inoculated heads. Head infection by daf 38 never caused visible disease symptoms to

develop on the rachis.

The impact of disease on grain set, grain quality and grain yield

Both grain quality and yield can be directly affected when Fusarium infects wheat
floral tissue. In contrast, fungal pathogens that attack leaves, stems and root tissues of
wheat, only indirectly affect harvestable grain, through reducing the total photosynthetic
leaf area. It is also known that some natural F. graminearum isolates are able to cause
symptomless head infections in the field (Gang et al., 1998) and (B. Hollins and K.
Hammond-Kosack, unpublished). Therefore, we decided to examine the impact of the
infection caused by each of the 9 daf mutants on both grain set and grain quality. To
investigate these parameters in detail, not only was the total grain yield per head
examined but also each head was sub-divided into 3 separate sampling regions and then
the individual grains were removed from each region with a pair of forceps and assessed
for both size and appearance. The 3 head regions were designated Region A- above the
point of inoculation, Region B — point of inoculation and below with visible disease
symptoms, and C - the rest of the head below the last visibly diseased spikelet (Figure 8,
Appendix B).

The differences in the overall impact of infection on reducing head yield and
grain quality was striking amongst the different treatments (Table 5, Appendix A).

Inoculations with PH-l caused an 87% reduction in the mature grain yield from a single

123

head (Table 5, Appendix A), when compared to the SN A inoculated heads. In contrast,
heads inoculated with daf 10, 14, 15, 26 and 43 caused grain yield reduction of only
15% or less. This group of daf mutants produced two different visible symptom types,
both types showed minimal choking. daf 14 and 43 showed the highest visible disease
symptoms on spikelets; whilst daf 10, 15 and 26 caused minimal bleaching of spikelets.
For total grain number per head only a single pattern emerged. The daf mutants 10, 38
and 43 caused a grain set that was statistically equivalent to the SNA inoculated heads.
None of these three mutants caused the choking phenotype above the point of
inoculation.

The grain recovered from the three regions of the head, defined above, was each
explored separately. Point inoculations with PH-l completely eliminated grain
development in the 2 initially inoculated spikelets and all the other spikelets exhibiting
the bleaching symptoms [Regions A and B, Figure 9 (Appendix B) and Table 5
(Appendix A)]. In contrast, the mock inoculation of SNA agar plugs permitted > 3 full-
sized (large) grains to form within each inoculated spikelet [Region B, Figure 9
(Appendix B); Table 5(Appendix A)]. For each of the 9 daf mutants with reduced
disease causing ability, some grain was recovered from the visibly diseased region.
However, this grain was typically small and shrunken (Figure 9, Appendix B). On a per
spikelet basis, the grain yield and number recovered from the visibly diseased region B
was best in the heads inoculated with either daf 14, 37 or 43. The daf mutants 14 and 43
also had some of the highest visible symptom scores (Table 4, Appendix A), which
suggests that the head infections may have been somewhat restricted to the peripheral

tissue layers. The daf 11 and 26 which only produced very restricted macroscopic disease

124

symptoms, still caused an equivalent effect to grain set as the PH-l isolate in the visibly
infected region.

Region A, above the point of inoculation, is of constant size. Spikelets in this
region typically entered anthesis 3-7 days later than the inoculated spikelets. There was
considerable grain set and development in both the untreated and SNA inoculated heads,
ie. > 4 large grains per head per region A. Infections by PH-l caused < 1 small shrunken
grain to form. In each of the mutant infected heads a mixture of large, medium and small
grains formed. For example, daf 26 mutant permitted a comparable grain number and
type to that found in control heads. In contrast, daf 10 and daf 43 appeared to permit a
significantly higher set of large grains in each head than in the untreated and SNA
inoculated heads. However, this different was not statistically significant at the 5% level
(Table 5, Appendix A).

In the symptomless region C at the bottom of the head (Figure 9, Appendix B),
grain quality and number were highly reduced by PH-l (Table 5, Appendix A). However,
when assessed on a per spikelet basis, grain weight was not affected by the PH-l
infections. Infections by each daf mutant also impacted grain development to varying
degrees in the visibly non-diseased Region C. All infections, except those involving daf
ll reduced the number of large seed recovered. Only daf mutants 10, 36, 37, 38 and 43
did not cause a statistically significant reduction in total grain number in region C. Most
of the medium and small seed isolated from region C was recovered from the 2—3
spikelets immediately adjacent to the visible diseased spikelets of each insertional mutant

(data not shown).

125

These detailed analyses of the grain within the 3 sub-head regions for each daf
mutant, have revealed a complexity to this host-pathogen interaction that was previously
not known. Each daf mutant caused a unique effect on grain set, grain quality and grain
yield that also varied between the three different head regions examined. These data also
indicate that it is not possible to predict the impact of the infection on grain number, size

and weight just by assessing the macroscopic disease symptoms.

Ability of Fusarium mutants to invade root and stem tissues

A seed germination assay in the presence or absence of F. graminearum hyphae
was established (Urban et al., 2003), to examine the ability of each daf mutant to
parasitize the root and stem base tissue of young seedlings. In the field, this type of
infection, often arising from F usarium infected crop residues or infected seed, causes a
seedling blight disease that lowers the initial crop density (Parry et al., 1995).

PH-l severely impaired both seedling emergence to between 14 and 24% of that
recovered from the uninoculated controls (Table 6, Appendix A). In the 15‘ experimental
replica, aerial seedling biomass was also significantly reduced following PH-l infection.
The 9 daf mutants, with a reduced ability to invade wheat heads at flowering, permitted
both good seedling emergence and seedling grth in both experimental replicas [Table
6 (Appendix A), Figure 10 (Appendix B)]. For reasons unknown, 3 daf mutants caused a
significantly greater impact on seedling emergence, in experiment 2, but this effect was
still considerably less than PH- 1.

When the wheat roots were washed free of vermiculite, clear differences between

the root systems were visible. Infections by PH-l caused extreme stunting of the roots

126

system with only 2-3 short main roots, no lateral roots or root hairs and roots were a light
brown color (data not shown). In contrast, the roots recovered from the mutant-inoculated
plants were all large, with many primary, secondary and tertiary roots and appeared very
similar to those of the uninoculated plants. Microscopic examination of trypan blue
stained roots, revealed that hyphae of PH-l had infected the roots and colonized both
intercellularly and intracellularly the various tissue layers. In contrast, microscopic
observations of roots inoculated with each daf mutant failed to identify the presence of
fungal mycelium inside root tissue (data not shown). It is possible that small peripheral
root infections formed by a mutant were removed when the vermiculite was washed away

from the roots and thereby lost from the subsequent analyses.

In vitro growth and sexual and asexual spore production of the daf mutants

The in vitro hyphal growth rates for the daf mutants were compared on SNA and
VM media for 5 days. No statistically significant differences to the PH-l strain were
evident in the daily rate of hyphal extension on either growth media (data not shown). For
each daf mutant the onset of asexual conidiation and the overall abundance of conidia
formed on both SNA and VM plates were comparable to that observed for PH-l (data not
shown).

Perithecia] formation was assessed by growing each daf mutant on carrot agar.
Eight of the 9 daf mutants produced normal sized perithecia containing abundant
ascospores in an identical manner to PH- 1. For daf 38 perithecia, developed after an

additional 5 days in culture compared to other mutants and the wild type.

127

DON mycotoxin production

In vivo, DON production was measured in the grain harvested from the 3 head
regions, where sufficient material remained for the assay, by competitive ELISA. PH-l
produced DON in all grain samples examined within the range 200-405 ug/ g dry weight
seed (n = 9). The daf 10 and daf ll mutants produced no detectable DON levels in any of
the grain samples that were assayed. The daf 15, daf 26, and daf 38 mutants produced
low levels of DON in grain ranging between 5 and 30 ug/ g dry weight seed, and daf 14,
daf 36, daf 37 and daf 43 produced wild type levels. DON production in vitro (Table 7,
Appendix A) did not correlate well with DON production in the wheat head. Only daf 36
and daf 43 produced wild type levels of DON in vitro as well as in wheat grain. The daf
10, daf 1 l, and daf l4 mutants produced low DON levels in vitro and the DON detected
in cultures of the daf 15, daf 26, daf 36, daf 38, and daf 43 mutants were in the range of

PH-l.

DISCUSSION

Screening of a Fusarium graminearum population of 1170 isolates, mutagenized
through plasmid insertion, identified 9 mutants with a reduced ability to invade and cause
disease on wheat heads. In vitro each mutant exhibited a growth rate and phenotype
equivalent to the parental PH-l isolate. This result represents a pathogenicity mutant
recovery rate of 0.8 %. This frequency of reduced and non-pathogenic mutant recovery is
similar to what has been observed in several other plasmid insertion studies of
ascomycetous fungi that are pathogenic towards plants (for example: Sweigard et al.

1998; Thon et al. 2000). The attenuated disease phenotype of the nine F. graminearum

128

mutants could be caused by (1) an inability of the mutants to produce the correct
pathogenicity factors, (2) the production of pathogenicity factor(s) in an incorrect spatial
and temporal order, or (3) the ill-timed synthesis of compounds that activate plant
defense responses. We have called these disease dttenuated E. graminearum mutants, daf

mutants.

The nine F. graminearum daf mutants with reduced pathogenicity towards wheat
floral tissue, also exhibited a non-pathogenicity phenotype towards the roots of wheat
seedlings. Therefore a common mechanism must exist that permits F. graminearum
hyphae to infect and colonize physiologically distinct plant tissue types. In contrast to our
results, an exploration of the ability of several leaf pathogenicity mutants of the rice blast
fungus (Magnaporthe grisea) for their ability to invade barley leaf and root tissue
(Dufresne and Osbourn, 2001), identified 3 distinct sub—groups of pathogenicity mutants.
Some M. grisea pathogenicity genes were required to cause disease on either leaf or root,
whilst a third sub-group of the pathogenicity genes were required for general plant
infection. For leaf penetration, but not root tissue penetration, M. grisea requires the
formation of highly melanized appressoria, whereas, F. graminearum does not form any
specialized infection structure to complete plant tissue infection. The molecular
mechanisms of pathogenicity of wide host range, generalized fungal pathogens, such as
F. graminearum, have not been well studied. These mutants should provide many clues
into this type of interaction. The isolation of additional pathogenicity mutants from the

remaining insertional mutants generated in this study is underway.

129

Comparison of each daf mutant’s various disease phenotype

Quantitative assessment of 3 distinct macroscopic disease symptoms on wheat
heads was used in this study to differentiate between the various mutant infection
phenotypes. The symptoms evaluated were, (1) the number of spikelets exhibiting
bleaching on glumes, lemma and palea tissue at and below the point of inoculation (ear
regions B and C), (2) brown streaking on the rachis segments in advance of spikelet
bleaching (ear regions B and C) and (3) the total bleaching of all spikelets above the point
of inoculation (ear region A), termed choking [Table 4 (Appendix A) and Figure 8 (,
Appendix B)]. The data indicate that daf 38 caused the least severe disease symptoms,
when measured by any of the 3 criteria examined. However, the other eight daf mutants
are difficult to rank precisely, because although there is a good relationship between the
total number of bleached spikelets and the formation of the choking phenotype (r =
0.719), there was only a modest relationship between choking and brown streaking on the
rachis (r = 0.599) and the relationship between spikelet bleaching and brown streaking on
the rachis was poor (r = 0.417) (Table 8, Appendix A). A tentative ranking of the daf
mutant’s order according to increasing disease symptom severity is 38< 26, 10 < (15, 36)
<11, 37, 43 <14. The recovery of only a modest to low correlation in the severity of 2 of
the 3 symptom phenotypes indicates that greater than 50 % of the variation observed
between the mutants can be attributed to additional independent biological causes. The
underlying cause of the choking phenomena has not been explored for each daf mutant.
Choking may be caused by direct hyphal colonisation, constriction of the vascular tissue

with hyphae solely at the point of inoculation, caused by fungal hyphae or plant defense

130

responses or a mixture of these scenarios. It is also plausible that the underlying cause
may differ between daf mutants.

Of considerable economic importance is the impact of F. graminearum head
infection on total grain yield, quality and safety. Therefore it was considered very
important to evaluate these parameters when assessing disease severity. In addition,
natural F. graminearum isolates are also capable of causing symptomless head infections,
ie. without bleaching symptoms on glumes, lemma and palea tissue. By separately hand
threshing the A, B and C head region separately (Table 4, Appendix A), our analyses
distinguished between the impacts of both macroscopically visible disease and
symptomless infections on grain set and grain fill for each mutant. Region A above the
point of inoculation was considered separately, because an effect on grain number and
grain fill in this region is likely to be influenced by the progress of the infection in the
lower region of the head and may not have arisen through direct colonization. Grain set
and grain fill in the upper regions of the head could be particularly influenced by
interaction components transported through the xylem vessels from the lower infected
head regions. PH-l severely reduced grain recovery and quality in both the visible
disease and non-diseased regions of the car. A tentative ranking of the daf mutant’s order
according to increasing severity on grain number and grain quality is 10 < (43,38) <
(26,36,37) < (14,] l) < 15, whilst the ranking based on total grain yield recovered per
wheat head increases in the order (1 l, 36, 37) < 38 < (10, 14, 15, 26, 43). For increasing
DON production in harvested grain the ranking is (10, 11) < (15, 26,38) < (14, 36, 37,

43). The comparison of these rankings is particularly informative and indicates the

existence of 3 very distinct daf mutants. The large infections of daf 43 are mainly

131

restricted to peripheral tissue and cause minimal impact on grain yield and quality, but
produce normal DON levels in the grain. Whereas daf 15 produces modest visible
infections (< 3 spikelets with visible disease symptoms) that have a large impact on grain
number and grain quality throughout the ear and is only a modest producer of DON in
viva. Although the dof 10 mutant causes some visible symptoms, it results in minimal

effects on grain yield and quality and is a DON non-producer in viva.

Inter-relationships between the various head phenotypes examined

Table 8 (Appendix A) shows the correlation coefficients for the comparisons
among the 3 macroscopic disease symptoms, grain number and quality recovered from
the 3 head regions A, B, and C (Figure 9, Appendix B), and the total grain yield and grain
number per head. R values of > 0.70 and < 0.25 are considered to indicate respectively,

high and low correlations. Seven of the 66 comparisons gave high R values and seven
gave low R values. Of greatest significance, were the seven highest negative relationships
between the extent of spikelet bleaching (region B) and choking (region A) and the total
grain number, total grain weight and the large grains recovered from both head regions A
and C. Some of these negative relationships could have been anticipated because the
larger the visibly diseased head region B, the smaller head region C becomes. Similarly
in head region A, a high negative correlation between the extent of choking and total
grain number was expected. This R value ties in well with field observations where grain

numbers above the diseased area tend to be very low. However, these findings also

indicate that at least for the wheat cultivar Bobwhite, increased grain fill outside of the

visibly diseased area does not compensate for the loss of grain fill within the diseased

132

area, even through presumably the total available photosynthates arriving into the head
has remained relatively constant. Indeed, the strong negative relationship between
choking at the top of the inoculated head and the lack of large grain recovered from the
symptonfless head region C is particular informative. This result suggests that grain fill
throughout the head is affected even when the visible Fusarium infection is highly
\ocalised. However, it is known that the infection front in the F. graminearum-wheat
interaction may be up to 2 cm ahead of symptom development (Strausbaugh and Maloy,
1986', Trail and Guenther, unpub.).
Three of the 7 high positive correlations identified in Table 8 (Appendix A) were
between the number of large grains recovered in head regions A and C, between grain
number and large grain in head region A, and between the spikelet bleaching and the
choking phenotype. The correlation between total grain number and regional grain
number was best for head regions A and C, whilst total grain weight correlated best with
the number of large grains in regions A and C. Overall the data presented in Table 8
(Appendix A) reinforces the notion that a series of highly complex host-pathogen inter-
relationships are activated when F. graminearum infects a developing wheat head. Some
of these relationships may be caused directly by factors released from the fungal hyphae.
Others correlations may reflect the consequences of the activation of plant defense
responses, which frequently occurs later in compatible plant-pathogen interactions

(Hammond-Kosack and Jones, 1996).

133

Enhanced grain numbers in head region A

Infections of wheat heads by daf 10 and daf 43 appeared to cause in each head
inoculated an increased recovery of grain from the non-choked head region A, compared
to the same region in the control heads (Table 5, Appendix A). Although this increase
was not statistically significant at P<0.05, this consistent trend in two independent daf
mutants and merits further comment. Flowering and grain fill in head region A would
have taken place after the F. graminearum inoculation. Many fungi are known to
synthesize phytohormones, especially F usarium species. For example Gibberella
fitjikuroi is known to produce gibberellins (Yabuta and Hayshi, 1939). Artemenko et al.

(1999) also noted that F. graminearum conidia contain the gibberellins GA3, GA7 and

their conjugates GA4, Ga13 and iso—GA7. During conidia germination in vitro

gibberellins were secreted into the culture medium, and the authors suggest that
gibberellins function as compatibility factors during plant invasion. However, this
hypothesis was not tested experimentally. Thus is it possible that the contained fungal
hyphae are modifying the hormonal balance in the plants, thereby enhancing fertilization
and/or reducing aborting of immature grain. Recently, a nonpathogenic mutant of the
cucurbit pathogen Colletotrichum magna was shown to interact with the host as a
mutualistic endophyte, increasing fruit yields and protecting from disease in field trials
(Redman et a1, 2002). Certainly, the availability of such a mutant for biological control of

wheat scab would be desirable.

134

DON production

PH-l produces large amounts of DON both in wheat grain and in vitro (Table 7,
Appendix A). For 7 of the 9 daf mutants in planta DON levels of > 5 pg per g dried
grain were recovered from multiple independent samples, indicating that these mutants
are still DON producers. Only daf 10 and 11 did not produce detectable DON in planta.
In culture, all of the mutants produced some level of DON, although for daf 10, daf 11
and daf 14, the levels were extremely low. Daf 14 produced wildtype levels of DON in
planta and extremely low levels in culture. This discrepancy could indicate differences in
regulation of DON production in culture versus in planta. The mutant daf 11 produced no
detectable mycotoxin production in planta, but has the ability to cause bleaching of at
least 3 spikelets, and to lower grain number and quality in both the visibly diseased and
non-visibly diseased head regions. This result indicates that DON production in F.
graminearum hyphae is not required to cause disease on wheat heads. In culture,
however, both daf 10 and daf 11 produced low, but detectable levels of DON, indicating
the cultures are capable of producing this mycotoxin. It will be interesting to identify the
mutated genes in these isolates, as they may be involved in regulation of DON
production. In addition, it is possible daflO and dafll now produce a different repertoire
of trichothecene mycotoxins, for example nivalenol, to compensate for the loss of DON
mycotoxin production. It will be interesting to determine the exact mycotoxin chemotype
of each daf mutant when growing under both in planta and in vitro conditions. Some
isolates belonging to genetic lineage group 7 are known to produce other types of
mycotoxins (O’ Donnell et al., 2000; Ward et al., 2002). The isolate PH-l is known to

produce 3- acetyl DON, DON , lS-acetyl DON (Hou et al., 2002) and zearalenone (Trail

135

unpublished) but does not produce nivalenol ( C. Kistler, pers comm). In Table 8
(Appendix A), it is also worthy to note that there is a positive correlation of > 0.65
between both the choking and rachis browning symptoms and the levels of in planta

DON production. These significance of these observations will be explored in greater
detail.

Comparison of the daf mutant phenotypes to other known F. graminearum gene
disruptants

Prior to this study, relatively few F. graminearum genes had been identified that

contribute to pathogenicity towards wheat heads. These genes are either involved in
biosynthesis of the trichothecene mycotoxins, or are MAP kinase genes, intimately
involved in fungal development. Tri5 encoding trichodiene synthase (Proctor et al.,
1995), and Tri8, a C-3 esterase involved in trichothecene biosynthesis (McCormick and

Alexander, 2002) have both been disrupted in F. graminearum and eliminate DON

mycotoxin production. TrilO, a regulatory gene for the DON pathway, and TriI 01,
required for biosynthesis of the trichothecene T-2 toxin, have been disrupted in F.
sporotrichioides, a closely related DON-producing species (Tag et al., 2001 ; McCormick
et a1, 1999). However, the F. graminearum mutants harboring a disrupted Tri5 gene are
still able to infect wheat heads and cause some disease symptoms (Proctor et al., 1995;

Hui et al., 1997). Two homologues of the mitogen activated protein (MAP) kinases,
gPMKll MAP] (Jenczmionka et al., 2003; Urban et al., 2003) and MGVI (Hou et al.,

2002), have been disrupted in F. graminearum. Both gene knockouts separately reduce

disease symptom production on wheat heads. It is worth noting that the MAP kinase

136

studies each used a different parental F. graminearum strain from that used to generate
the 9 daf mutants reported in this study. However, 2 striking differences are worthy of
comment. First, the MAP] disruption (Urban et al., 2003) caused the most dramatic
reduction to pathogenicity. On wheat heads, map] hyphal colonization was restricted to
anther tissue. Secondly, daf 10 and daf 11 identified in this study, eliminate DON
mycotoxin production, almost as effectively as the Tri5 mutation. The Mgvl and Map]
mutations only confer a quantitative reduction in mycotoxin production in vitro and in

vivo.

Efficiency of plasmid insertion and REMI techniques

We observed a decrease (2.5 to 30 times fewer transformants) in the frequency of
transformation associated with inclusion of a restriction enzyme in the transformation
mixture. However, we did not extensively test the use of REMI in this system as others
have done (Redman and Rodriguez, 1994; Then et al., 2000). REMI mutagenesis has
also been associated with enhancing single-vector insertion and a higher percentage of
transformants with random single integrations (Mullins and Kang, 2001). We had a
relatively high frequency of single copy integrations (90%) using pHA 1.3 without the
REMI procedure. Of the 4 hygromycin conferring plasmids tested for F. graminearum
transformation, the plasmid pHAl .3 gave the highest and most consistent transformation
efficiency. This pUC based plasmid, contains the hph coding region linked to the
Aspergillus parasiticus TrpC promoter and TrpC 3’ non-coding region, instead of the
corresponding A. nidulans regulatory sequences. Also downstream of the hph gene, is a

telomeric region from Fusarium oxysporum. Studies in F. oxysporum with this telomeric

137

sequence showed that it enhances chromosomal rearrangement when inserted into a
transformation vector (Powell and Kistler, 1990). In other fungal species, the latter
sequence has been shown to enhance stability and increase integration fi'equency
(Redman and Rodriguez 1994; Powell and Kistler, 1990). In the present study,
transformation of F. graminearium with pHA1.3 appears to enhance the frequency of
integration as compared to other plasmids tested. Furthermore, these integrations appear
to be stable as indicated by the segregation analysis and the mitotic stability tests. The
plasmid pHA1.3 has recently been used successfully to generate 176 REMI mutants
reduced in pathogencity of the curcurbit pathogen Colletotrichum magna with a recovery

efficiency of 0.012% (Redman et al., 1999).

Future prospects

The nine daf mutants identified in this study cause highly reduced disease
symptoms on both wheat heads and roots. The pathogenicity screen was slow and
expensive because inoculations were performed on the flowering heads of intact wheat
plants. The perfect correlation between the head and root pathogenic ability of the nine
independent daf mutants, suggests it would be feasible to undertake the primary
screening using initially only the seedling root test and then to re-test all the non-root
invading mutants obtained for their ability to invade head tissue. By adopting this
indirect screening strategy, a considerable savings of time and space would be obtained.
However, this type of screen would miss the very interesting class of F. graminearum

mutants solely compromised in head infection ability.

138

The nine daf mutants, with various infection phenotypes will be an extremely
useful resource when trying to correlate specific changes in global plant and fungal gene
expression with certain aspects of the infection biology. Wheat transcriptome analyses of
infection involving PH-l and mutants 10 and 11 will be able identify the plant genes
specifically induced and repressed by mycotoxin production. An exploration of head
region A, involving uninoculated heads and those infected with mutants 10 and 43 should
identify the patterns of gene expression associated with the enhanced grain phenotype.
Furthermore, the availability of over 8000 ESTs from various growth conditions on
dbEST (Trail et al., 2003; http://cogeme.ex.ac.uk/index.html) and the genomic sequence
of F usarium graminearum PH-l, ( http://www-
genome.wi.mit.edu/annotation/fungi/fusarium/ ) will permit parallel investigation of the

global changes in fungal gene expression hyphae accompanying the different interaction

types.

139

MATERIALS AND METHODS
Strains and growth conditions

F. graminearum strain PH-l (NRRL 31084; Trail and Common, 2000) was
isolated from infected wheat in Michigan. The PH-l strain belongs to genetic lineage
group 7 (O’Donnell et al., 2000). Nitrate-non-utilizing mutants 4232 and 4233 (Bowden
and Leslie, 1999) were provided by R. Bowden (Kansas State University). All strains
were maintained as soil stocks at -20 C and were induced to produce perithecia on carrot

agar as described by (Klittich and Leslie, 1988). Cultures were routinely cultured on

SNA plates (synthetic nutrient-poor agar) containing 0.1% KHzPO4 ,0.1% KNO3 , 0.1%

MgSO4 x 7 H20, 0.05% KCl, 0.02% Glucose, 0.02% Saccharose, 2% Bacto Agar

[Difco] supplemented with 200ppm Biotin and 200ppm Thiamine) at 22 C under
continuous white and blue fluorescent lights. In addition, strains were grown on V8 juice
agar (36% V8 juice, 0.5% CaCO3, 1.4% Bacto-agar), and Oatmeal agar [Crawford, 1986

#233].

Vectors for transformation of F. graminearum

Four plasmids were originally tested for transformation frequency, and all harbor
the coding region on E. coli for the hygromycin B phosphotransferase gene (hph).
Plasmids pUCATPH (Lu et al, 1994) and pCB1004 (Sweigard et al., 1998) have the hph
coding region linked to the Aspergillus parasiticus trpC promoter and terminator

sequences, but are constructed with different backbone plasmids and other small

140

sequence modifications. Plasmid pHA1.3 is constructed similarly to pUCATPH, but has a
telomeric region from F usarium oxysporum inserted downstream of the trpC terminator
(Redman and Rodriguez, 1994). Plasmid pUCH2-8 has the hph coding region fused to

promoter 1 from Cochliobolus heterostrophus (Turgeon et al., 1987).

Fungal transformation
Transformations were performed on germinated conidia using a previously published
protocol (Proctor et al., 1995) with the following modifications. Approximately 0.3 g soil

stock was used to inoculate carboxymethylcellulose (CMC) medium and incubated for 72

hr at 25 cDC at 250 rpm (Cappellini and Peterson, 1965). Conidia were harvested by

centrifugation and germinated in YEPD (0.3% yeast extract, 1% bactopeptone, and 2%
D-glucose) broth for 12 - 14 hours at room temperature (RT) at 175 rpm. Isolation of
protoplasts occurred in 25 mg/ml driselase, 0.05 mg/ml chitinase (Sigma Chemical Co.,
St. Louis), and either 0.5 mg/ml mureinase (USB-Amersham Pharmacia Biotech Inc.,
Piscataway, NJ) or 5 mg/ml lysing enzyme (Sigma Chemical Co., St. Louis) in a 1.2 M
KCl buffer. Protoplasts were collected by filtration through a 30 um Nitex nylon

membrane (Tetko Inc., Kansas City, MO) and washed three times in STC buffer (1.2 M

sorbitol; 10 mM Tris-HCl, 50 mM CaC12, pH 8.0) Transformation took place in the

presence of 30% polyethylene glycol solution (10 mM Tris-HCl, 50 mM CaC12, pH 8.0),

STC buffer and linearized plasmid. Restriction enzyme mediated integration (REMI)

transformations included an additional 10, 50, or 100 units of Ndel or HindIII.

141

Protoplasts recovered on Regeneration Medium (RM: 0.1% yeast extract, 0.1% casein
enzyme hydrosylate, 0.8 M sucrose , 1% agarose) for 15 hr and then were overlaid with
10 ml of RM amended with 150 ug/ml hygromycin B (HygB) (Calbiochem-
Novabiochem Corp., San Diego, CA). Putative transformants were selected within 4 - 7

days and retested for hygromycin resistance on V8 juice medium amended with 450

R
ug/ml HygB. Hygromycin resistant (Hyg ) colonies were transferred to a 2% water agar

(WA) medium and hyphal-tipped to obtain genetically pure isolates.

Mitotic and meiotic stability tests

Twelve transformants that were Hyg (six containing pHA1.3 and six containing

pUCH2-8) were placed on VM amended with HygB, and incubated at 25 0C for 7 days.

Mycelia were transferred to VM without HygB and incubated under the same conditions.
This procedure was repeated three times, DNA was collected from mycelia at each
transfer and DNA gel blot analysis was performed to determine mitotic stability of the
inserts. To test meiotic stability and to test for co-segregation of the Hng marker and
the mutant phenotype, transformants were mated with nitrate-non-utilizing (nit),
hygromycin sensitive mutants 4232 and 4233. Ascospores were selected from eight
recombinant perithecia and germinated on MMTS medium (Bowden and Leslie, 1999)
which distinguishes nit mutants from wild type. Colonies were then placed on VM
amended with HygB. Inheritance of mutations was compared to expected Mendelian

ratios.

142

DNA isolation and gel blot analyses

For DNA isolation, isolates were grown in YES broth (2% yeast extract,
6% sucrose) for 4 - 6 days. Mycelium was collected by filtration and ground to a fine
powder in liquid nitrogen. DNA was isolated according to the manufacturer’s instructions
using DNeasy Plant Maxi Kit (Qiagen Inc., Valencia, CA). DNA gel blot analyses were

performed as previously described (Trail and Koeller, 1993).

Infection assays on wheat plants

Preliminary screening of mutants was carried out on greenhouse grown wheat,
cultivar Norm. Seeds (4 per 6” pot) were sown in high porosity professional planting mix
(Michigan Peat Company, Houston, TX). Plants were fertilized weekly, starting two
weeks after germination until they reached the boot stage. Plants at early anthesis were
selected for inoculation. Mutant strains of G. zeae were induced to produce perithecia on
carrot agar. Ascospores were harvested using sterile distilled water and filtered through
Miracloth (Calbiochem, La Jolla CA) Miracloth. Each spore suspension was streaked
onto a plate of V8 agar to ensure viability and purity of spores. Spore suspensions that
were inviable or showed contaminants after culture for 4 days were eliminated from the
trial. Plants were inoculated by placing 10 pl of the spore suspension within the floral
chamber of a floret midway along the head. Each mutant was inoculated in duplicate and
ascospores harvested from PH-l were inoculated on other heads as controls. The plants
were placed in a misting chamber (misting frequency 10 s every 6 min) for 72 h and

returned to standard greenhouse conditions. Wheat heads were assessed 8 to 13 days post

143

inoculation for development of symptoms relative to that of PH-l. Symptoms observed
were the extent of bleaching on the heads (two or more spikelets from the point of
inoculation), deformation of the awn and extent of seed set. If one of the two heads
showed these symptoms, the strain was considered pathogenic.

For the secondary screen, wheat seeds of spring cultivar Bobwhite were sown in
Levingtons C2 coarse potting compost. Seedlings were transplanted singly into 10 cm

pots and grown for an additional 2 months in a controlled environment growth room at

O O
18 C during the 16-hr day and 16 C during the 8-h night, at 50% relative humidity.

Light was supplied by a mixture of metal hyalide and incandescent lamps to produce a
fluence level of 207 microM at 86.2 W/msq at the plant surface. Once the plants entered
anthesis, individual attached heads were selected that bore 2 to 5 spikelets with extruded
anthers. A small agar plug (2mm diameter) cut from the hyphal edge of each F usarium
insertional mutant growing on SNA media was then inserted into the first full sized single
floret down from the head apex (Figure 8, Appendix B). A second hyphal agar plug was
inserted into an adjacent spikelet. The glumes of the two inoculated spikelets were
marked with a waterproof pen. After inoculation the entire plant was placed into a high
humidity chamber (> 95% relative humidity) for the next 3—4 days. Light was also
excluded from the plants for 16 hours post-inoculation. The plants were then returned to
the standard grth room conditions. All 81 putative mutants were screened initially in
this fashion and wheat heads were assessed at day 20 post-inoculation for disease
symptoms. In this manner, the 9 daf mutants were identified. These were then inoculated
onto a minimum of 6 heads per mutant for a detailed study. Wheat heads were assessed at

days 4, 8, 12, 16 and 20 days post inoculation for disease. Disease symptoms were

144

quantified by (a) counting the total number of spikelets at and below the point of
inoculation exhibiting bleaching symptoms, (b) noting the extent of brown streaking on
the rachis segments below the point of inoculation and (c) examining the head region
above the point of inoculation for bleaching.

The ability of certain insertional mutants to invade young wheat seedlings was
explored by germinating Bobwhite wheat seeds in a mixture of vermiculite and F usarium
hyphae. A 50 ml plastic container tube with drainage holes at the base (Steuwe and Sons,

Inc, Oregon, USA) was two-thirds filled with moist sterile vermiculite. Into the top

th
surface was incorporated 1/8 of an entire 7 day old SNA plate (diam 1.0cm) of

3
F usarium that had been chopped into small pieces (5 mm ). Three Bobwhite wheat

seeds, from a stock known to give 100% germination, were placed onto the surface of the
vermiculite/ hyphal agar surface, and then a further 15 ml of moist sterile vermiculite was
added to completely cover completely the seeds. Seven identical containers were set up
for each insertional F usarium isolate tested. The finished containers were placed

vertically in racks. Control containers were established with SNA agar only. To each

nd
container was added 10 ml of water ever 2 day for the 7 days and then daily thereafter.

At 14 days after sowing each container was scored non-destructively for seedling
emergence. At 21 days after sowing, each container was disassembled, the vermiculite
gentle washed from the root system and the roots then scored for browning discoloration

and physical appearance. In addition, the aerial parts of the emerged seedlings above the

145

st
1 leaf sheath were excised and the fresh weight determined. The experiment was

repeated on 2 separate occasions.

Trypan blue staining and microscopy

Root tissue samples was taken at 21 days after inoculation from each insertional
F usarium isolate interaction. Conventional histochemical staining of fungal hyphae was
performed using lactophenol-trypan blue and destaining with chloral hydrate (Keogh et
al., 1980). Microscopic observations were made on a Carl Zeiss “ Axioskop 2”

instrument under phase contrast.

Grain sampling

After the completion of the inoculation experiment, the heads were allowed to
ripen naturally in the controlled growth room environment. Once both the inoculated
and non-inoculated heads on a single plant were ripe, each head was harvested separately.
The heads were divided into 3 regions. Region A represented all spikelets above the point
of inoculation, Region B contained all spikelets which displayed any visible signs of
disease and included the originally inoculated pair, whilst Region C consisted of any
spikelets below the visible disease symptoms. A pair of forceps was used to remove any
grain found in each spikelet in each of the 3 separate regions and the physical
appearance of this grain was recorded. The grain was rated as large (L) if the seed was
full, rounded and golden, medium (M) if the grain was not full sized, darkened or

covered in mycelium/conidia, small (S) if the grain was shrivelled and < 1/4 of the size of

146

the healthy grain or absent/prematurely aborted (A). In order to ascertain the extent to
which visible infections influenced grain development in the non-symptom expressing
regions, the spikelets in region C were sampled sequentially in a downwards direction,
and the results obtained from each pair of spikelets noted. A numerical scoring system
was then used to semi-quantify the total grain yield per head 1:3, M=2, 8:1 and A =0.1
In addition, the total weight of grain recovered from the 3 regions of the car was
determined. Two different types of control heads were also harvested, these had either
been inoculated with agar only plugs (indicated as SNA) or were non-inoculated heads

put through the standard inoculation procedure (indicated as None).

Fungal growth rate and spore production

To measure fungal growth rates, mycelium plugs from 1 week old cultures on
SNA minimal agar plates were transferred onto fresh agar plates using a 5 mm cork
borer. Fungal growth was recorded as colony diameter in daily intervals during 5 days.

Experiments were done in at least 3 replicates.

DON measurement

Quantitative combined DON and 3-acetyl DON measurements were made using
the commercial competitive ELISA-based Veratox 5/5 kit (Neogen Corp., Lansing,

Michigan USA) and deploying a standard curve for DON ranging from 0.25 to 3.00 ppm.

OD650 values were measured after the addition of the stop solution to the multiwells. To

ensure accuracy, each biological sample was quantified twice. The kit does not

147

distinguish DON and 3-acetyl DON, and does not detect 15-acetyl DON. Throughout the

paper, the designation DON will indicate DON and 3-acetyl DON combined.

Statistical analyses
Statistical analyses were conducted according to Snedecor and Cochran ( 1980)

and using either the SAS statistical package or the data analysis tools in MS Excel.

ACKNOWLEDGEMENTS

The experiments were conducted under the UK MAFF import license PHL
39A/3490 (1/2001) and plant inoculations and fungal culture were conducted under the
UK MAFF license PHL 39A/3493 (5/2001). The authors thank Benjamin Munn for his
technical assistance in performing the DON assays and Chil Kwon, John Guenther and
Lukesha Davis for their assistance with the pathogenicity assays. Alan Todd provided
guidance on the various the statistical analyses undertaken. This work was supported in
part by The Monsanto Company, the USDA Wheat and Barley Scab Iniatitive, and the

Michigan State University Agricultural Experiment Station.

148

REFERENCES

Artemenko, E. N., Devyatkina, G. A., and Sadovskaya, V. L. 1999. Involvement of
gibberellins from germinating conidia of Fusarium graminearum Schw. in the
pathogenesis of Fusarium Wheat Head Blight. Russ. J. Plant Physiol. 46: 252-254.

Ban, T. and Suenaga, K (2000) Genetic analysis of resistance to Fusarium head blight
caused by Fusarium graminearum in Chinese wheat cultivar Sumai-3 and the Japanese
cultivar Saikai 165. Euphytica 113: 87-99.

Bowden, R.L., and Leslie, J.F. 1999. Sexual recombination in Gibberella zeae.
Phytopathology 89: 1 82-188.

Brown, D.W., McCormick, S.P., Alexander, N .J., Proctor, R.H., Desjardins, A.E. 2001.
A genetic and biochemical approach to study trichothecene diversity in F usarium
sporotrichioides and F usarium graminearum. Fungal Genet. Biol. 32: 121-133.

Bushnell, W.R., Hazen, BE, and Pritsch, C. 2003. Histology and physiology of
Fusarium head blight. Pp. 44-83 In: Fusarium Head Blight of Wheat and Barley, K.J.
Leonard and W.R. Bushnell, eds. APS Press, St. Paul.

Cappellini, R. A., and Peterson, J. L. 1965. Macroconidium formation in submerged
cultures by a non-sporulating strain of Gibberella zeae. Mycologia 57:962-966.

Cundliffe, E., Cannon, M. and Davies, J. 1974. Mechanism of inhibition of eukaryotic
protein synthesis by trichothecene fungal toxins. Proc. Natl. Acad.Sci USA 71: 30-34.

Del Blanco I.A., Frohberg R.C., Stack R.W., Berzonsky W.A. and Kianian SF. (2003)
Detection of QTL linked to Fusarium head blight resistance in Sumai 3-derived North
Dakota bread wheat lines. Theor Appl Genet. 106: 1027-1031.

Desjardins, A.E., Proctor, lR.H., Bai, G., McCormick, S.P., Shaner, G., Buechley, and

Hohn, TM. 1996. Reduced virulence of trichothecene-nonproducing mutants of
Gibberella zeae in wheat field tests. Molecular Plant Microbe Interactions 9: 775-781.

Dufresne, M. and Osbourn, A. E. 2001. Definition of tissue-specific and general
requirements for plant infection in a phytopathogenic fungus. Mol. Plant-Microbe
Interaction 14: 300-307.

Gang, G., Miedaner, T., Schuhmacher, U., Schollenberger, M. and Geiger, H.H. 1998.
Deoxynivalenol and nivalenol production by F usarium culmorum isolates differing in
aggressiveness towards winter rye. Phytopathol. 88: 879-884.

Gold, S.E., Garcia-Pedradas, MD. and Martinez-Espinoza, A. D. (2001) New (and used)
approaches to the study of fungal pathogenicity. Annu. Rev. Phtyopathol. 39:337-365.

149

Hammond-Kosack KB. and Jones J .D.G 1996. Inducible plant defence mechanisms and
resistance gene function. The Plant Cell 8: 1773-1791.

Hohn, TM. and Desjardins, A.E. 1992. Isolation and gene disruption of the Tox5 gene
encoding trichcodiene synthase in Gibberella pulicaris. Mol. Plant-Microbe Interact.
5:249-256.

Hon, 2., Xue, C., Peng, Y., Katan, T., Kistler H. C. and Xu LR 2002. A MAP kinase
gene (MGVI) in F usarium graminearum is required for female fertility, heterokaryon

formation, hyphal grth and plant infection. Mol. Plant-Microbe Interact. 15: 1119-
1127.

Hui, Y., Evans, C.K., Kolaczkowski, E.K., Dill-Macky, R. and Mirocha, CJ. 1997.
Chemistry, physiology and role of deoxynivalenol in pathogenicity. Bull. Inst. Compr.
Agr. Sci. Kinki Uni 5: 1-11.

Jenczmionka N.J., Maier F.J., Losch AP. and Schafer W. (2003) Mating, conidiation
and pathogenicity of F usarium graminearum, the main causal agent of the head-blight
disease of wheat, are regulated by the MAP kinase gpmkl. Curr Genet. 43 :87-95.

Kang, Z. and Buchenauer, H. 1999. Immunocytochemical localisation of F usarium toxins
in infected wheat spikes by Fusarium culmorum. Physiol. Mol. Plant Pathol. 55: 275-
288.

Kang, Z. and Buchenauer, H. 2000a. Cytology and ultrastructure of the infection of wheat
spokes by Fusarium culmorum. Mycol. Res. 104: 1083-1093.

Kang, Z. and Buchenauer, H. 2000b. Ultrastructural and immunocytochemical
investigations of pathogen development and host responses in resistant and susceptible
wheat spikes infected by Fusarium culmorum. Physiol. Mol. Plant Pathol. 57: 255-268.

Keogh, R.C., Deverall, B. J. and Mcleod, S. 1980. Comparison of histological and
physiological responses to Phakopsora pachyrhizi in resistant and susceptible soybean.
Trans. Br. Mycol. Soc. 74: 329-333.

Klittich, C. J. R., and Leslie, J. F., 1988. Nitrate reduction mutants of Fusarium
moniliforme (Gibberellafujikuroi). Genetics 118:417—423.

Lee, T., Han, Y.K., Kim, K.H., Yun, SH, Lee, Y.W. 2002. Tri13 and Tri7 determine
deoxynivalenol- and nivalenol-producing chemotypes of Gibberella zeae. Appl Environ.
Microbiol. 68: 2148-2154.

Lu, S.W., Lyngholm, L., Yang, G., Bronson, C., Yoder, O.C.and Turgeon, B.G. 1994.

Tagged mutations at the Tax] locus of Cochliobolus heterostrophus by restriction
enzyme-mediated integration. Proc. Natl. Acad. Sci (USA) 26: 12649-12653.

150

McCormick SP and Alexander NJ. 2002. F usarium Tri8 encodes a trichothecene C-3
esterase. Appl. Environ. Microbiol. 68: 2959-2964.

McCormick S. P, Alexander N .J ., Trapp SE. and Hohn T.M. 1999. Disruption of
TR1101,the gene encoding trichothecene 3-O-acetyltransferase, from Fusarium
sporotrichioides. Appl. Environ. Microbiol. 65: 5252-5256.

McCormick, S.P., Hohn, T.M., Desjardins, A.E., Proctor, RH. and Alexander, NJ. 1998.
Role of toxins in plant microbial interactions. Phytochemical Signals and Plant-Microbe
Interact. 32: 17-30.

McMullen, M., Jones, R and Gallenberg, D. 1997. Scab of wheat and barley: a re-
emerging disease of devastating impact. Plant Disease 81: 1340-1348.

Mesterhazy, A. 1995. Types and components of resistance to F usarium head blight of
wheat. Plant Breeding 114: 377-386.

Mesterhazy, A. 2002. Role of deoxynivalenol in agressiveness of F usarium graminearum
and F. culmorum and in resistance to F usorium head blight. European Journal of Plant
Pathology 108: 675—684.

Mullins, ED. and Kang S. 2001. Transformation: a tool for studying fungal pathogens of
plants. Cell. Mol. Life Sci. 58:2043-2052.

O’Donnell, K., Kistler, H.C., Tacke, B. K and Casper, H.H. 2000. Gene genealogies
reveal global phylogeographic structure and reproductive isolation among lineages of

F usarium graminearum, the fungus causing wheat scab. Proc. Natl. Acad. Sci USA 97:
7905-7910.

Parry, D.W., Jenkinson, P and McLeod, L. 1995. F usarium head blight (scab) in small
grain cereals-a review. Plant Pathol. 44: 207-238.

Powell W.A. and Kistler, HQ 1999. In vivo rearrangement of foreign DNA by Fusarium
oxysporum produces linear self-replicating plasmids. J. Bact. 172: 3163-3171.

Proctor, R.H., Hohn, T.M., and McCormick, SP. 1995. Reduced virulence of Gibberella
zeae caused by disruption of a trichothecene toxin biosynthetic gene. Mol. Plant-Microbe
Interact. 8: 593-601.

Proctor, R.H., Desjardins, A.E., McCormick, S.P., Plattner, R.D., Alexander, N .J., and
Brown, D.W. 2002. Genetic analysis of the role of trichothecene and fumonisin

mycotoxins in the virulence of F usarium. European Journal of Plant Pathology 108: 691-
698.

Pugh, G.W. 1933. Factors affecting infection of wheat beads by Gibberella saubinetti. J.
Agr. Res. 46: 771-797.

151

Redman, R. S., and Rodriguez, R. J., 1994. Factors affecting the efficient transformation
of Colletotrichum species. Exp. Myc. 18:230-246.

Redman, R.S., Ranson, J. C., and Rodriguez, R.J. 1999. Conversion of the pathogenic
fungus Colletotrichum magna to a nonpathogenic, endophytic mutualist by gene
disruption. M01. Plant-Microbe Interact. 12: 969-975.

Redman R.S., Roossinck M.J., Maher 8., Andrews Q.C., Schneider W.L., and Rodriguez,
R.J. 2002. Field performance of cucurbit and tomato plants colonized with a
nonpathogenic, mutualistic mutant (path-1) of Colletotrichum magna (T eleomorph :
Glomerella magna; Jenkins & Winstead) Symbiosis 32: 55-70.

Scholten, O.E., Ruckenbauer, P., Visconti, A., van Osenbruggen, W.A., and den N ijs,
A.P.M. 2001: Food Safety of Cereals: A chain-wide approach to reduce F usarium
Mycotoxins. (Commission of the European Communities).

Snedecor, G.W. and Cochran, W.G. 1980 Statistical Methods. Ames, IA: Iowa State
University Press.

Skinner, W., Keon, J. P. R. & Hargeaves, J. A. 2001 Gene information for fungal plant
pathogens from expressed sequences. Curr. Opin. Microbiol. 4: 381-386.

Stausbaugh, CA. and Maloy, O. C. 1986 Fusarium scab of irrigated wheat in central
Washington. Plant Disease 70 :1104—1106.

Sweigard, I.A., Carroll, A.M., Farrall, L., Chumley, F. G., and Valent, B. 1998.
Magnaportha grisea pathogenicity genes obtained through insertional mutagenesis. Mol
Plant-Microbe Interact. 1 1: 404-412.

Sweigard, J. A. and Ebbole, D. J. 2001. Functional analysis of pathogenicity genes in a
genomics world. Curr. Opin. Microbiol. 4: 387-392.

Tag A.G., Garifullina G.F., Peplow A.W., Ake C., Phillips T.D., Hohn T.M. and
Beremand MN. 2001. A novel regulatory gene, TriIO, controls trichothecene toxin
production and gene expression. Appl. Environ. Microbiol. 67: 5294-5302.

Thon, M.R., Nuckles, EM. and Vaillancourt, L.J. 2000. Restriction enzyme-mediated

integration used to produce pathogenicity mutants of Colletotrichum graminicola. Mol.
Plant-Microbe Interact. 13: 1356-1365.

Trail, F., and Common, R. 2000. Perithecia] development of Gibberella zeae: A light
microscopy study. Mycologia 92: l 30- 138.

152

Trail, F. and Koller, W. 1993. Diversity of cutinases from plant pathogenic fungi:
Purification and characterization of cutinases from Altemaria brassicicola.. Physiological
and Molecular Plant Pathology 42: 205-220.

Trail, F., Xu, J.-R., San Miguel, P., Halgren, R. G. and Kistler, H. C. 2003. Analysis of
Expressed Sequence Tags from Gibberella zeae (anamorph F usarium graminearum).
Fungal Genetics and Biology 38: 187-197.

Turgeon, B. G., Garber, R. C., and Yoder, O. C. 1987. Development of a fungal
transformation system based on selection of sequences with promoter activity. Mol. Cell
Bio. 7:3297-3305.

Urban, M., Mott, E, Farley, T, Phillips, W and Hammond-Kosack KB. 2003. The
F usarium graminearum MAP] gene is essential for pathogenicity and perithecia
formation Mol. Plant-Pathol. (in press).

Ward, T.J., Bielawski, J .P., Kistler, H.C., Sullivan, E., and O’Donnell, K. 2002. Ancestral
polymorphism and adaptive evolution in the trichothecene mycotoxins gene cluster of
phytopathogenic F usarium. Proc. Natl. Acad. Sci. USA 99:9278-9283.

Windels, C. E. 2000. Economic and social impacts of Fusarium head blight: Changing
farms and rural communities in the Northern Great Plains. Phytopathol. 90: 17-21.

Yabuta, T. and Hayshi, T. 1939. Biochemical studies on the ‘bakanae’ fungus of rice. II.

Isolation of ‘gibberellin’, the active principle which makes the rice seedlings grow
slenderly. J. agric. Chem. Soc. Japan. 15: 257-266.

153

BIBLIOGRAPHY

Abe, Y., T. Suzuki, C. Ono, K. Iwamoto, M. Hosobuchi, and H. Yoshikawa.
2002. Molecular cloning and characterization of an NIL-236B (compactin)

biosynthetic gene cluster in Penicillium citrinum. Molecular Genetics and
Genomics 267 :636-646.

Agrios, G. N. 1997. Plant Pathology, 4th ed. Harcourt Brace & Company, San
Diego, CA.

Andrianopoulos, A., and W. E. Timberlake. 1994. The Aspergillus nidulans
abaA gene encodes a transcriptional activator that acts as a genetic switch to
control development. Molecular and Cellular Biology 14:2503-2515.

Argyris, J., D. Van Sanford, and D. TeKrony. 2003. F usarium graminearum
Infection During Wheat Seed Development and Its Effect on Seed Quality. Crop
Science 43: 1782-1788.

Bai, G. H., and G. Shaner. 1996. Variation in F usarium graminearum and
cultivar resistance to wheat scab. Plant Disease 80:975-979.

Bailey, T. L., and C. lEIkan. 1994. Fitting a mixture model by expectation
maximization to discover motifs in biopolymers. Proceedings, International
Conference on Intelligent Systems for Molecular Biology 2:28-36.

Bailey, T. L., and M. Gribskov. 1998. Combining evidence using p-values:
application to sequence homology searches. Bioinforrnatics 14:48-54.

Baker, P. M., and J. C. Roberts. 1966. Studies in mycological chemistry. Part
XXI. The structure of aurofusarin, a metabolite of some Fusarium species.
Journal of the Chemical Society:2234-2237.

Bastmeyer, M., H. B. Deising, and C. Bechinger. 2002. Force exertion in fungal
infection. Annual Review Of Biophysics And Biomolecular Structure 31:321-
341.

154

10.

ll.

12.

13.

14.

15.

16.

17.

18.

19.

Bender, C. L., F. Alarcon-Chaidez, and D. C. Gross. 1999. Pseudomonas
syringae phytotoxins: Mode of Action, Regulation, and Biosynthesis by Peptide
and Polyketide Synthetases. Microbiology and Molecular Biology Reviews
63:266-+.

Bender, C. L., V. Rangaswamy, and J. Loper. 1999. Polyketide Production by
Plant-Associated Pseudomonads. Annual Review of Phytopathology 37:175-196.

Bennett, J. W. 1983. Differentiation and secondary metabolism in mycelial
fungi, p. 1-32. In B. J.W. and A. Ciegler (ed.), Secondary metabolism and
differentiation in fungi. Marcel Dekker, New York.

Bennett, J. W. 1995. From Molecular Genetics and Secondary Metabolism to
Molecular Metabolites and Secondary Genetics. Canadian Journal of Botany
73:S917-S924.

Bentley, R., and J. W. Bennett. 1999. Constructing polyketides: From collie to
combinatorial biosynthesis. Annual Review of Microbiology 53:411-446.

Bhatnagar, D., K. C. Ehrlich, and T. E. Cleveland. 2003. Molecular genetic
analysis and regulation of aflatoxin biosynthesis. Applied Microbiology and
Biotechnology 61:83-93.

Bingle, L. E. H., T. J. Simpson, and C. M. Lazarus. 1999. Ketosynthase
domain probes identify two subclasses of fungal polyketide synthase genes.
Fungal Genetics and Biology 26:209-223.

Birzele, B., A. Prange, and J. Kramer. 2000. Deoxynivalenol and ochratoxin A
in German wheat and changes of level in relation to storage parameters. Food
Additives and Contaminants 17:1027-1035.

Bode, H. B., B. Bethe, R. Hiifs, and A. Zeeck. 2002. Big Effects from Small
Changes: Possible Ways to Explore N ature's Chemical Diversity. Chembiochem
3:619-627.

Bohnert, H. U., I. Fudal, W. Dioh, D. Tharreau, J. L. Notteghem, and M. H.
Lebrun. 2004. A Putative Polyketide Synthase/Peptide Synthetase from

Magnaporthe grisea Signals Pathogen Attack to Resistant Rice. Plant Cell
16:2499-2513.

155

20.

21.

22.

23.

24.

25.

26.

27.

Borkovich, K. A., L. A. Alex, O. Yarden, M. Freitag, G. E. Turner, N. D.
Read, S. Seiler, D. Bell-Pedersen, J. Paietta, N. Plesofsky, M. Plamann, M.
Goodrich-Tanrikulu, U. Schulte, G. Mannhaupt, F. E. Nargang, A. Radford,
C. Selitrennikoff, J. E. Galagan, J. C. Dunlap, J. J. Loros, D. Catcheside, H.
Inoue, R. Aramayo, M. Polymenis, E. U. Selker, M. S. Sachs, G. A. Manluf,
I. Paulsen, R. Davis, D. J. Ebbole, A. Zelter, E. R. Kalkman, R. O'Rourke, F.
Bowring, J. Yeadon, C. Ishii, K. Suzuki, W. Sakai, and R. Pratt. 2004.
Lessons from the genome sequence of Neurospora crassa: Tracing the path from
genomic blueprint to multicellular organism. Microbiology And Molecular
Biology Reviews 68:1-+.

Brooks, D. M., G. Hernandez-Guzman, A. P. Kloek, F. Alarcon-Chaidez, A.
Sreedharan, V. Rangaswamy, A. Pefialoza-Vazquez, C. L. Bender, and B. N.
Kunkel. 2004. Identification and Characterization of a Well-Defined Series of
Coronatine Biosynthetic Mutants of Pseudomonas syringae pv. tomato DC3000.
Molecular Plant-Microbe Interactions 17: 162- 174.

Brown, D. W., R. B. Dyer, S. P. McCormick, D. F. Kendra, and R. D.
Plattner. 2004. Functional demarcation of the Fusarium core trichothecene gene
cluster. Fungal Genetics and Biology 41:454-462.

Brown, M. P., C. S. Brown-Jenco, and G. A. Payne. 1999. Genetic and
molecular analysis of aflatoxin biosynthesis. Fungal Genetics and Biology 26:81-
98.

Bu'Lock, J. D. 1961. Intermediary metabolism and antibiotic synthesis.
Advances in Applied Microbiology 3:293-342.

Bu'Lock, J. D. 1961. Intermediary metabolism and antibiotic synthesis.
Advances in Applied Microbiology 3:293-342.

Burset, M., I. A. Seledtsov, and V. V. Solovyev. 2001. SpliceDB: database of
canonical and non-canonical mammalian splice sites. Nucleic Acids Research
29:255-259.

Cantalejo, M. J ., P. Torondel, L. Amate, J. M. Carrasco, and E. Hernandez.
1999. Detection of fusarin C and trichothecenes in Fusarium strains from Spain.
Journal Of Basic Microbiology 39: 143-153.

156

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

Cappellini, R. A., and J. L. Peterson. 1965. Macroconidium formation in
submerged cultures by a non-sporulating strain of Gibberella zeae. Mycologia
57:962-966.

Carroll, A. N., J. A. Sweigard, and B. Valent. 1994. Improved vectors for
selecting resistance to hygromycin. Fungal Genetics Newsletter 41:22.

Chakravarti, R., and V. Sahai. 2004. Compactin - a review. Applied
Microbiology and Biotechnology 64:618-624.

Challis, G. L., and D. A. Hopwood. 2003. Synergy and contingency as driving
forces for the evolution of multiple secondary metabolite production by
Streptomyces species. Proceedings Of The National Academy Of Sciences Of
The United States Of America 100: 14555-14561.

Chang, P. K., K. C. Ehrlich, J. E. Linz, D. Bhatnagar, T. E. Cleveland, and J.
W. Bennett. 1996. Characterization of the Aspergillus parasiticus niaD and niiA
gene cluster. Current Genetics 30:68-75.

Choquer, M., K. L. Dekkers, H. Q. Chen, L. H. Cao, P. P. Ueng, M. E. Daub,
and K. R. Chung. 2005. The CT B1 gene encoding a fungal polyketide synthase

is required for cercosporin biosynthesis and fungal virulence of Cercospora
nicotianae. Molecular Plant-Microbe Interactions 18:468-476.

Christensen, C. M., G. H. Nelson, and C. J. Mirocha. 1965. Effect on the white
rat uterus of a toxic substance isolated from F usarium. Applied Microbiology
13:653.

Conkova, E., A. Laciakova, G. Kovac, and H. Seidel. 2003. Fusaria] toxins and
their role in animal diseases. Veterinary Journal 165:214-220.

Conkova, E., A. Laciakova, G. Kovac, and H. Seidel. 2003. Fusaria] Toxins
and their Role in Animal Diseases. Veterinary Journal 165:214-220.

Cox, R. J., and F. Glod. 2004. Fungal polyketide synthases in the information
age, p. 69-96. In J. S. Tkacz and L. Lange (ed.), Advances in Fungal
Biotechnology for Industry, Agriculture, and Medicine. Kluwer
Academic/Plenum Publishers, New York.

157

38.

39.

41.

42.

43.

45.

46.

47.

D'Mello, J. P. F., C. M. Placinta, and A. M. C. Macdonald. 1999. Fusarium
mycotoxins: A review of global implications for animal health, welfare and

productivity. Animal Feed Science and Technology 80:183-205.

Desjardins, A. E., D. W. Brown, S. H. Yun, R. H. Proctor, T. Lee, R. D.
Plattner, S. W. Lu, and B. G. Turgeon. 2004. Deletion and Complementation of
the Mating Type (MAT) Locus of the Wheat Head Blight Pathogen Gibberella
zeae. Applied and Environmental Microbiology 70:2437-2444.

Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of
sequence analysis programs for the VAX. Nucleic Acids Research 12:387-395.

Durbin, R., S. Eddy, A. Krogh, and G. Mitchison. 1998. Biological Sequence
Analysis: Probabilistic Models of Proteins and Nucleic Acids. Cambridge
University Press., Cambridge.

Dvorska, J. E., P. F. Surai, B. K. Speake, and N. H. C. Sparks. 2001. Effect of
the mycotoxin aurofusarin on the antioxidant composition and fatty acid profile of

quail eggs. British Poultry Science 42:643-649.

Ehrlich, K. C., B. G. Montalbano, J. W. Cary, and P. J. Cotty. 2002. Promoter
elements in the aflatoxin pathway polyketide synthase gene. Biochimica et
Biophysica Acta-Gene Structure and Expression 1576: 171-175.

Feng, B., and G. A. Marzluf. 1998. Interaction between major nitrogen
regulatory protein NIT2 and pathway-specific regulatory factor NIT4 is required
for their synergistic activation of gene expression in Neurospora crassa.
Molecular and Cellular Biology 18:3983-3990.

Fernandes, M., N. P. Keller, and T. H. Adams. 1998. Sequence-specific
binding by Aspergillus nidulans AflR, a G6 zinc cluster protein regulating
mycotoxin biosynthesis. Molecular Microbiology 28: 1355-1365.

Fernando, W. G. D., T. C. Paulitz, W. L. Seaman, P. Dutilleul, and J. D.

Miller. 1997. Head blight gradients caused by Gibberella zeae from area sources
of inoculum in wheat field plots. Phytopathology 87:414-421.

Fim, R. D., and C. G. Jones. 2000. The evolution of secondary metabolism — a
unifying model. Molecular Microbiology 37 :989-994.

158

48.

49.

50.

51.

52.

53.

54.

55.

56.

Foster, J. W. 1949. Chemical Activities of the fungi. Academic Press, New
York.

Fujii, I., Y. Mori, A. Watanabe, Y. Kubo, G. Tsuji, and Y. Ebizuka. 2000.
Enzymatic synthesis of 1,3,6,8-tetrahydroxynaphthalene solely from malonyl

coenzyme A by a fungal iterative type 1 polyketide synthase PKSl. Biochemistry
39:8853-8858.

Fujii, I., A. Watanabe, and Y. Ebizuka. 2004. More functions for
multifunctional polyketide synthases, p. 97-125. In J. S. Tkacz and L. Lange (ed.),

Advances in Fungal Biotechnology for Industry, Agriculture, Medicine. Kluwer
Academic/Plenum Publishers.

Fujii, I., A. Watanabe, U. Sankawa, and Y. Ebizuka. 2001. Identification of
Claisen cyclase domain in fungal polyketide synthase WA, a naphthopyrone
synthase of Aspergillus nidulans. Chemistry & Biology 8:189-197.

Gaffoor, 1., and F. Trail. 2005. Characterization of two distinct polyketide
synthase genes involved in zearalenone biosynthesis in Gibberella zeae. Applied
and Environmental Microbiology - Submitted.

Gelderblom, W. C. A., P. G. Thiel, W. F. O. Marasas, and K. J.
Vandermerwe. 1984. Natural Occurrence of Fusarin C, a Mutagen Produced by

F usarium moniliforme, in Corn. Journal of Agricultural and Food Chemistry
32:1064-1067.

Goswami, R. S., and H. C. Kistler. 2004. Heading for disaster: Fusarium
graminearum on cereal crops. Molecular Plant Pathology 5:515-525.

Hawke, M. A., and G. Lazarovits. 1994. Production and manipulation of
individual microsclerotia of Verticillium dahliae for use in studies of survival.

Phytopathology 84:883-890.

Hendrickson, L., C. R. Davis, C. Roach, D. K. Nguyen, T. Aldrich, P. C.
McAda, and C. D. Reeves. 1999. Lavastatin biosynthesis in Aspergillus terreus:
characterization of blocked mutants, enzyme activities and a multifunctional
polyketide synthase gene. Chemistry & Biology 6:429-439.

159

57.

58.

59.

60.

61.

62.

63.

65.

Homdork, S., H. Fehrmann, and R. Beck. 2000. Influence of Different Storage
Conditions on the Mycotoxin Production and Quality of F usarium-infected Wheat
Grain. Journal of Phytopathology 148:7-15.

Hutchinson, C. R., J. Kennedy, C. Park, S. Kendrew, K. Auclair, and J.
Vederas. 2000. Aspects of the biosynthesis of non-aromatic fungal polyketides by
iterative polyketide synthases. Antonie Van Leeuwenhoek International Journal of
General and Molecular Microbiology 78:287-295.

Ishige, T., A. Tani, K. Takabe, K. Kawasaki, Y. Sakai, and N. Kato. 2002.
Wax Ester Production from n-Alkanes by Acinetobacter sp. Strain M- l:
Ultrastructure of Cellular Inclusions and Role of Acyl Coenzyme A Reductase.
Applied and Environmental Microbiology 68:1192-1195.

Jacobson, E. S., E. Hove, and H. S. Emery. 1995. Antioxidant Function Of
Melanin In Black Fungi. Infection And Immunity 63:4944-4945.

Jurgenson, J. E., R. L. Bowden, K. A. Zeller, J. F. Leslie, N. J. Alexander,
and R. D. Plattner. 2002. A genetic map of Gibberella zeae (F usan'um
graminearum). Genetics 160: 1451-1460.

Kawamura, C., J. Moriwaki, N. Kimura, Y. Fujita, S. Fuji, T. Hirano, S.
Koizumi, and T. Tsuge. 1997. The Melanin Biosynthesis Genes of Alternaria
alternata Can Restore Pathogenicity of the Melanin-Deficient mutants of
Magnaporthe grisea. Molecular Plant-Microbe Interactions 10:446-453.

Kawamura, C., T. Tsujimoto, and T. Tsuge. 1999. Targeted Disruption of a
Melanin Biosynthesis Gene Affects Conidia] Development and UV Tolerance in
the Japanese Pear Aathotype of Altemaria altemata. Molecular Plant-Microbe
Interactions 12:59-63.

Kay, R. R. 1998. The Biosynthesis of Differentiation-Inducing Factor, a
Chlorinated Signal Molecule Regulating Dictyostelium development. Journal of
Biological Chemistry 273:2669-2675.

Keller, N. P., and T. M. Hohn. 1997. Metabolic pathway gene clusters in
filamentous fungi. Fungal Genetics and Biology 21: 17-29.

160

66.

67.

68.

69.

70.

71.

72.

73.

74.

75.

76.

Kennedy, D. G., S. A. Hewitt, J. D. G. McEvoy, J. W. Currie, A. Cannavan,
W. J. Blanchflower, and C. T. Elliot. 1998. Zeranol is formed from Fusarium
spp. toxins in cattle in viva. Food Additives and Contaminants 15:393-400.

Kerenyi, 2., K. Zeller, L. Homok, and J. F. Leslie. 1999. Molecular
standardization of mating type terminology in the Gibberella fujikuroi species
complex. Applied and Environmental Microbiology 65:4071-4076.

Kerenyi, 2., K. Zeller, L. Homok, and J. F. Leslie. 1999. Molecular
standardization of mating type terminology in the Gibberella fujikuroi species
complex. Applied and Environmental Microbiology 65:4071-4076.

Kiang, D. T., B. J. Kennedy, S. V. Pathre, and C. J. Mirocha. 1978. Binding
Characteristics Of Zearalenone Analogs To Estrogen Receptors. Cancer Research
38:3611-3615.

Klittich, C. J. R., and J. F. Leslie. 1988. Nitrate Reduction Mutants of F usarium
moniliforme (Gibberellafujikuroi). Genetics 118:417-423.

Kotik, A. N., and V. A. Trufanova. 1998. Detection of naphtoquinone
fusariotoxin aurofusarin in wheat. Mikologiya I Fitopatologiya 32:58-61.

Kramer, C. Y. 1956. Extension of Multiple Range Tests to Group Means with
Unequal Numbers of Replications. Biometrics 12:307-310.

Kroken, S., N. L. Glass, J. W. Taylor, O. C. Yoder, and B. G. Turgeon. 2003.
Phylogenomic analysis of type I polyketide synthase genes in pathogenic and
saprobic ascomycetes. Proceedings of the National Academy of Sciences of the
United States of America 100:15670-15675.

Kuiper-Goodman, T., P. M. Scott, and H. Watanabe. 1987. Risk Assessment
of the Mycotoxin Zearalenone. Regulatory Toxicology and Pharmacology 7:253-
306.

Kuipergoodman, T., P. M. Scott, and H. Watanabe. 1987. Risk assessment of
the mycotoxin zearalenone. Regulatory Toxicology and Pharmacology 7:253-306.

Linnemannstons, P., J. Schulte, M. D. Prado, R. H. Proctor, J. Avalos, and B.
Tudzynski. 2002. The polyketide synthase gene pks4 from Gibberella fujikuroi

161

77.

78.

79.

80.

81.

82.

83.

84.

85.

encodes a key enzyme in the biosynthesis of the red pigment bikaverin. Fungal
Genetics and Biology 37:134-148.

Lohr, D. 1997. Nucleosome transactions on the promoters of the yeast GAL and
PHO genes. Journal of Biological Chemistry 272:26795-26798.

Long, G. G., M. Diekman, J. F. Tuite, G. M. Shannon, and R. F. Vesonder.
1982. Effect of Fusarium roseum corn culture containing zearalenone on early
pregnancy in swine. Am J Vet Res 43:1599-603.

Magan, N., R. Hope, A. Colleate, and E. S. Baxter. 2002. Relationship between
grth and mycotoxin production by F usarium species, biocides and
environment. European Journal of Plant Pathology 108:685-690.

Maier, F. J., and W. Schafer. 1999. Mutagenesis via insertional or restriction
enzyme-mediated-integration (REMI) as a tool to tag pathogenicity related genes
in plant pathogenic fungi. Biological Chemistry 380:855-864.

Malz, S., M. N. Grell, C. Thrane, F. J. Maier, P. Rosager, A. Felk, K. S.
Albertsen, S. Salomon, L. Bohn, W. Schafer, and H. Giese. 2005.
Identification of a gene cluster responsible for the biosynthesis of aurofusarin in

the Fusarium graminearum species complex. Fungal Genetics and Biology
42:420-433.

Martin, J. F. 2000. Molecular control of expression of penicillin biosynthesis
genes in fungi: Regulatory proteins interact with a bidirectional promoter region.
Journal of Bacteriology 182:2355-2362.

Martin, P. M., K. B. Horwitz, D. S. Ryan, and W. L. McGuire. 1978. Phyto-
Estrogen Interaction With Estrogen Receptors In Human Breast-Cancer Cells.
Endocrinology 103: 1860- 1 867.

Mayorga, M. E., and W. E. Timberlake. 1992. The Developmentally Regulated
Aspergillus nidulans wA Gene Encodes a Polypeptide Homologous to Polyketide
and Fatty Acid Synthases. Molecular & General Genetics 235:205-212.

McCormick, S. P., L. J. Harris, N. J. Alexander, T. Ouellet, A. Saparno, S.
Allard, and A. E. Desjardins. 2004. TriI in F usarium graminearum encodes 3
P450 oxygenase. Applied and Environmental Microbiology 70:2044-2051.

162

86.

87.

88.

89.

91.

92.

93.

94.

95.

Miao, V., M. F. Coeffet-LeGal, D. Brown, S. Sinnemann, G. Donaldson, and
J. Davies. 2001. Genetic approaches to harvesting lichen products. Trends In
Biotechnology 19:349-355.

Mirocha, C. J., and S. V. Pathre. 1979. Mycotoxins - Their biosynthesis In
fungi - Zearalenone biosynthesis. Journal Of Food Protection 42:821-824.

Mirocha, C. J. S. V., C. M. Pathre, and Christensen. 1977. Zearalenone, p.
345-36. In J. V. Rodricks, C. W. Hesseltine, and M. A. Mehlman (ed.),

Mycotoxins in human and animal health. Pathotox Pulishers, Inc., Park Forest
South, 1L.

Munkvold, G. P. 2003. Epidemiology of F usarium diseases and their mycotoxins
in maize ears. European Journal of Plant Pathology 109:705-713.

Muro-Pastor, M. I., R. Gonzalez, J. Strauss, F. Narendja, and C.
Scazzocchio. 1999. The GATA factor AreA is essential for chromatin
remodelling in a eukaryotic bidirectional promoter. Embo Journal 18:1584-1597.

Nelson, R. R. 1971. Hormonal Involvement in Sexual Reproduction in the fungi
with special reference to F-2, a fungal estrogen, p. 181-200. In S. Adai and S.
Ouchi (ed.), Morphological and Biochemical Events in Plant-Parasite Interaction.
The Phytopathological Society of Japan, Tokyo.

Nicholson, T. P., B. A. M. Rudd, M. Dawson, C. M. Lazarus, T. J. Simpson,
and R. J. Cox. 2001. Design and utility of oligonucleotide gene probes for fungal
polyketide synthases. Chemistry & Biology 8: 157-178.

O’Hagan, D. 1991 . The Polyketide Metabolites. Ellis Horwood Limited, West
Sussex, England.

Parry, D. W., P. Jenkinson, and L. McLeod. 1995. Fusarium Ear Blight (Scab)
In Small-Grain Cereals - A Review. Plant Pathology 44:207-238.

Pathre, S. V., P. V. Khadikar, and C. J. Mirocha. 1989. Biosynthesis of
zearalenone — A simple and efficient method to incorporate [C-13]acetate label by
using solid cultures. Applied and Environmental Microbiology 55:1955-1956.

163

96.

97.

98.

99.

100.

101.

102.

103.

104.

Paulitz, T. C. 1996. Diurnal release of ascospores by Gibberella zeae in
inoculated wheat plots. Plant Disease 80:674-678.

Philalay, J. S., C. O. Palermo, K. A. Hauge, T. R. Rustad, and G. A.
Cangelosi. 2004. Genes Required for Intrinsic Multidrug Resistance in
Mycobacterium avium. Antimicrobial Agents and Chemotherapy 48:3412-3418.

Placinta, C. M., J. P. F. D'Mello, and A. M. C. Macdonald. 1999. A review of
worldwide contamination of cereal grains and animal feed with Fusarium
mycotoxins. Animal Feed Science and Technology 78:21-37.

Pritsch, C., G. J. Muehlbauer, W. R. Bushnell, D. A. Somers, and C. P.
Vance. 2000. Fungal development and induction of defense response genes

during early infection of wheat spikes by Fusarium graminearum. Molecular
Plant-Microbe Interactions 13:159-169.

Procopiou, P. A., B. Cox, B. E. Kirk, M. G. Lester, A. D. McCarthy, M.
Sareen, P. J. Sharratt, M. A. Snowden, S. J. Spooner, N. S. Watson, and J.
Widdowson. 1996. The Squalestatins: Inhibitors of Squalene Synthase. Enzyme

Inhibitory Activities and in Vivo Evaluation of C3-Modified Analogues. Journal
of Medicinal Chemistry 39: 141 3- 1422.

Proctor, R. H., D. W. Brown, R. D. Plattner, and A. E. Desjardins. 2003. C0-
expression of 15 contiguous genes delineates a fumonisin biosynthetic gene
cluster in Gibberella moniliformis. Fungal Genetics and Biology 38:237-249.

Proctor, R. H., A. E. Desjardins, R. D. Plattner, and T. M. Hohn. 1999. A
Polyketide Synthase Gene Required for Biosynthesis of Fumonisin Mycotoxins in
Gibberellafujikuroi Mating Population A. Fungal Genetics and Biology 27: 100-
112.

Proctor, R. H., A. E. Desjardins, R. D. Plattner, and T. M. Hohn. 1999. A
polyketide synthase gene required for biosynthesis of fumonisin mycotoxins in

Gibberella fujikuroi slating population A. Fungal Genetics and Biology 27:100-
112.

Proctor, R. H., T. M. Hahn, and S. P. McCormick. 1995. Reduced Virulence of
Gibberella zeae Caused by Disruption of a Trichothecene Toxin Biosynthetic
Gene. Molecular Plant-Microbe Interactions 8:593-601.

164

105.

106.

107.

108.

109.

110.

111.

112.

113.

Proctor, R. H., T. M. Hohn, and S. P. McCormick. 1997 . Restoration of wild-
type virulence to Tri5 disruption mutants of Gibberella zeae via gene reversion
and mutant complementation. Microbiology-Uk 143:2583-2591.

Punt, P. J., P. A. Greaves, A. Kuyvenhoven, J. C. T. Vandeutekom, J. R.
Kinghom, P. H. Pouwels, and C. Vandenhondel. 1991. A twin-reporter vector
for simultaneous analysis of expression signals of divergently transcribed,
contiguous genes in filamentous fungi. Gene 104:119-122.

Rehnstrom, A. L., and S. J. Free. 1996. The isolation and characterization of
melanin-deficient mutants of Moniliniafructicola. Physiological and Molecular
Plant Pathology 49:321-330.

Romero-Martinez, R., M. Wheeler, A. Guerrero-Plata, G. Rico, and H.
Torres-Guerrero. 2000. Biosynthesis and functions of melanin in Sporothn'x
schenckii. Infection and Immunity 68:3696-3703.

Rose, M. S., S. H. Yun, T. Asvarak, S. W. Lu, 0. C. Yoder, and B. G.
Turgeon. 2002. A decarboxylase encoded at the Cochliobolus heterostrophus
translocation-associated ToxlB locus is required for polyketide (T-toxin)

biosynthesis and high virulence on T-cytoplasm maize. Molecular Plant-Microbe
Interactions 15:883-893.

Rossi, V., S. Giosue, and R. Bugiani. 2003. Influence of air Temperature on the
Release of Ascospores of Venturia inaequalis. Journal of Phytopathology-
Phytopathologische Zeitschrift 151:50-58.

Sambrook, J., D. W. Russell, and J. Sambrook. 2001. Molecular Cloning: A
Laboratory Manual, Third ed. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York.

Schnitzler, N., H. Peltroche-Llacsahuanga, N. Bestier, J. Ziindorf, R.
Liitticken, and G. Haase. 1999. Effect of Melanin and Carotenoids of Exophiala
(Wangiella) dennatitidis on Phagocytosis, Oxidative Burst, and Killing by Human
Neutrophils. Infection and Immunity 67:94-10].

Schoental, R. 1988. Zearalenone, its role in breast and sex-organ tumors. Breast
Cancer Research and Treatment 12: 140-140.

165

114.

115.

116.

117.

118.

119.

120.

121.

122.

123.

Shibata, S., E. Morishita, T. Takeda, and K. Sakata. 1966. The structure of
aurofusarin. Tetrahedron Letters Volume 7.:4855-4860.

Song, Z. S., R. J. Cox, C. M. Lazarus, and T. J. Simpson. 2004. Fusarin C
biosynthesis in F usarium moniliforme and F usarium venenatum. Chembiochem
5:1196-1203.

Steele, J. A., LiebermaJr, and C. J. Mirocha. 1974. Biogenesis of zearalenone
(F-2) by F usarium roseum "graminearum". Canadian Journal of Microbiology
20:531-534.

Steele, J. A., Lieberman.Jr, and C. J. Mirocha. 1974. Biogenesis of
Zearalenone (F—2) by F usarium roseum graminearum. Canadian Journal of
Microbiology 20:531-534.

Stob, M., S.~ Baldwin, J. F. Tuite, F. N. Andrews, and K. G. Gillette. 1962.
Isolation of an anabolic, uterotrophic compound from corn infected with
Gibberella zeae. Nature 196:1318.

Svaren, J., and W. Horz. 1997. Transcription factors vs nucleosomes:
Regulation of the PH05 promoter in yeast. Trends in Biochemical Sciences 22:93-
97.

Swanson, S. P., R. A. Corley, D. G. White, and W. B. Buck. 1984. Rapid thin-
layer chromatographic method for determination of zearalenone and zearalenol in

grains and animal feeds. Journal Of The Association Of Official Analytical
Chemists 67:580-582.

Thompson, C. R. L., and R. R. Kay. 2000. The Role of DIF-l Signaling in
Dictyostelium Development. Molecular Cell 6: 1509-1514.

Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. Clustal W: Improving
the sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice. Nucleic
Acids Research 22:4673-4680.

Trail, F., and R. Common. 2000. Perithecia] development by Gibberella zeae: a
light microscopy study. Mycologia 92:130-138.

166

124.

125.

126.

127.

128.

129.

130.

131.

132.

133.

Trail, F., I. Gaffoor, and S. Vogel. 2005. Ejection mechanics and trajectory of
the ascospores of Gibberella zeae (anamorph F uarium graminearum). Fungal
Genetics and Biology 42:528-533.

Trail, F., H. X. Xu, R. Loranger, and D. Gadoury. 2002. Physiological and
environmental aspects of ascospore discharge in Gibberella zeae (anamorph
Fusarium graminearum). Mycologia 94: 181-189.

Tsai, H. F., Y. C. Chang, R. G. Washbum, M. H. Wheeler, and K. J. Kwon-
Chung. 1998. The Developmentally Regulated albl Gene of Aspergillus

fumigatus: Its Role in Modulation of Conidia] Morphology and Virulence. Journal
of Bacteriology 180:3031-3038.

Tsukamoto, Y., L. M. Cole, and J. E. Casida. 2000. Avermectin Chemistry and
Action: Ester- and Ether-type Candidate Photoaffinity Probes. Bioorganic &
Medicinal Chemistry 8: 19-26.

Tuite, J. 1969. Plant Pathological Methods, Fungi and Bacteria.

Tuite, J., G. Shaner, G. Rambo, J. Foster, and R. W. Caldwell. 1974. The
Gibberella ear rot epidemics of corn in Indiana in 1965 and 1972. Cereal Science
Today 19:238-241.

Urry, W. H., H. L. Wehrmeister, E. B. Hodge, and P. H. Hidy. 1966. The
structure of zearalenone. Tetrahedron Letters 7:3109-3114.

Vahlensieck, H. F., L. Pridzun, H. Reichenbach, and A. Hinnen. 1994.
Identification of the Yeast ACCl gene-product (Acetyl-Coa Carboxylase) as the
target of the polyketide fungicide Soraphen-A. Current Genetics 25:95-100.

Watanabe, A., I. Fujii, U. Sankawa, M. E. Mayorga, W. E. Timberlake, and
Y. Ebizuka. 1999. Re-identification of Aspergillus nidulans wA gene to code for
a polyketide synthase of naphthopyrone. Tetrahedron Letters 40:91-94.

Watanabe, A., Y. Ono, I. Fujii, U. Sankawa, M. E. Mayorga, W. E.
Timberlake, and Y. Ebizuka. 1998. Product identification of polyketide
synthase coded by Aspergillus nidulans wA gene. Tetrahedron Letters 39:7733-
7736.

167

134.

135.

136.

137.

138.

139.

140.

141.

142.

Watanabe, C. M. H., D. Wilson, J. E. Linz, and C. A. Townsend. 1996.
Demonstration of the catalytic roles and evidence for the physical association of
type I fatty acid synthases and a polyketide synthase in the biosynthesis of
aflatoxin B-l. Chemistry & Biology 3:463—469.

Weinberg, E. D. 1971. Secondary Metabolism - Raison D‘étre. Perspectives in
Biology and Medicine 14:565-&.

Wilson, R. A., and H. N. Arst. 1998. Mutational analysis of AREA, a
transcriptional activator mediating nitrogen metabolite repression in Aspergillus
nidulans and a member of the "streetwise" GATA family of transcription factors.
Microbiology And Molecular Biology Reviews 62:586-+.

Wolf, J. C., and C. J. Mirocha. 1973. Regulation of Sexual Reproduction in
Gibberella zeae (F usarium roseum graminearum) By F-2 (Zearalenone).
Canadian Journal of Microbiology 19:725-734.

Yang, G., M. S. Rose, B. G. Turgeon, and O. C. Yoder. 1996. A Polyketide
Synthase is Required for Fungal Virulence and Production of the Polyketide T-
Toxin. Plant Cell 8:2139-2150.

Yu, J. J., P. K. Chang, J. W. Cary, M. Wright, D. Bhatnagar, T. E.
Cleveland, G. A. Payne, and J. E. Linz. 1995. Comparative Mapping of
Aflatoxin Pathway Gene Clusters in Aspergillus parasiticus and Aspergillus
flavus. Applied and Environmental Microbiology 61:2365-2371.

Yu, J. J., P. K. Chang, K. C. Ehrlich, J. W. Cary, D. Bhatnagar, T. E.
Cleveland, G. A. Payne, J. E. Linz, C. P. Woloshuk, and J. W. Bennett. 2004.

Clustered Pathway Genes in Aflatoxin Biosynthesis. Applied and Environmental
Microbiology 70: 1253-1262.

Yun, S. H., B. G. Turgeon, and O. C. Yoder. 1998. REMI-induced mutants of
Mycosphaerella zeae-maydis lacking the polyketide PM-toxin are deficient in
pathogenesis to corn. Physiological and Molecular Plant Pathology 52:53-66.

Zhou, R., R. Rasooly, and J. E. Linz. 2000. Isolation and analysis of fluP, a
gene associated with hyphal grth and sporulation in Aspergillus parasiticus.
Molecular & General Genetics 264:514-520.

168

 

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

llHIlllll‘lllllllllllllllllllHHIIIIIHIMWIIMl