T.
:6” .

y...
.
.

§w..am.!;,§umuv. {My
)4 vhfhrtun . .
.. 3

:
LP
$32
if.“ u

%

v1

Shun:

.mw .
a .21.
1?. fit

 

, .. I... 2...
7“»? . 16.)..1»

”as.
2.. ... a.
. nJ. ‘
. $3 .
u} v
n.1, ...
.3: m n .
Mum: ӣqu
J.Lu4.”Mm.. o.
a. 3.. .
mmnumfk
fifiw‘qn...
2. 1

‘. i .
2... .
f... #4..
Wyatt“;
.3

 

 

 

 

 

in", I
. I
. .91..

1 V L:
‘4. (.30!
I) Iva:

x,

in“.
L nu.

(Gr.

29!};
' .u-i.
fink? V

. 13%.; :u
, 5.22:..fiunvflii
E......um.‘_nmmm£. a ausfih E ELE.‘ , . .

 

#63“?
,a l '
3%... 1%.... 45.1.???
: x ‘ 1; r
.3 .

 

2 LIBRARY
3 005 Michigan State
‘ University

 

 

This is to certify that the
dissertation entitled

Regulation of human small nuclear RNA gene transcription by
the oncogneic protein kinase CK2

presented by

Liping Gu

has been accepted towards fulfillment
of the requirements for the

Doctoral degree in Department of Biochemistry

 

 

and Molecular Biology
Ago/114%

Major fidfessor’s Signature
pg” (/0!

Date

MSU is an Affirmative Action/Equal Opportunity Institution

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2/05 ammonium-ms

REGULATION OF HUMAN SMALL NUCLEAR RNA GENE TRANSCRIPTION BY
THE ONCOGENIC PROTEIN KINASE CK2
By

Liping On

A DISSERTATION
Submitted to
Michigan State University
for the Degree of
DOCTORAL OF PHILOSOPHY
Department of Biochemistry and Molecular Biology

2005

ABSTRACT

HUMAN SMALL NUCLEAR RNA GENE TRANSCRIPTION REGULATED BY THE

ONCOGENIC PROTEIN KINASE CK2
By

Liping Gu

Protein kinase CK2 participates in many cellular processes including cell cycle,
cell differentiation, stress response, and apoptosis. One important role of CK2 is to
transduce extracellular signals into the nucleus to control gene expression. CK2 appears
to globally regulate protein-coding gene transcription by RNA polymerase II and non-
coding gene transcription by RNA polymerases I and III. Human small nuclear RNA
genes are transcribed by either RNA polymerase II or RNA polymerase III depending
upon their promoter architectures. CK2 regulates RNA polymerase III-specific U6
snRNA gene transcription, but whether CK2 plays a role in regulating the closely related

polymerase II-specific U1 snRNA gene transcription has been uncertain.

Herein, I report that CK2 inhibits U1 snRNA gene transcription by RNA
polymerase II. CK2 associates with U1 gene promoters, and U1 snRNA expression
negatively correlates with endogenous CK2 levels. Thus, CK2 plays a direct role in U1
gene regulation in living cells. CK2 phosphorylates the general transcription factor
snRNA activating protein complex (SNAPC) that is required for human snRNA gene
transcription. SNAPC phosphorylation reduces its DNA binding affinity as supported by

the observations that CK2 phosphorylation of a recombinant partial SNAPC can inhibit its

PSE-specific binding before and after DNA association has occurred. Importantly, CK2
phosphorylation of mini-SNAPc restricts promoter recognition by SNAPC on a U1
promoter and permits higher order complex formation with TBP on a U6 promoter,
indicating that the cooperation between SNAPc and TBP can counteract CK2 inhibition
of DNA binding by SNAPC for RNA polymerase III-specific preinitiation complex
assembly. Therefore, CK2 may differentially regulate snRNA gene transcription by
selectively influencing pre-initiation complex assembly for RNA polymerase II and
polymerase III transcription of human snRNA genes depending upon the promoter
architectures.

Further investigation showed that SNAP190, the largest subunit of SNAPC, is
phosphorylated in vivo and can be phosphorylated in vitro. CK2 phosphorylates the N-
terminal half of SNAP19O at two regions that contain multiple CK2 consensus sites
(amino acid 20-63 and 514-545) as determined by mass spectrometric analysis. The
region within SNAP19O that is required for CK2 inhibition is contained within amino
acids 506-719 encompassing a serine rich region with multiple CK2 consensus sites. The
downregulation of SNAPC DNA binding activity by CK2 phosphorylation may contribute

to reduced U1 snRNA gene transcription by RNA polymerase II.

iv

T o my family

ACKNOWLEDGEMENTS

I gratefully acknowledge my mentor R. William Henry for his encouragement,
support, patience, and understanding. It was a great fortune for me to meet Bill and to
join his laboratory when I arrived in Michigan several years ago. Thank you very much
for mentoring me during these years in the Ph. D. program and teaching me how to

become a scientist.

I would also like to thank the members of my thesis committee, Zachary F.
Burton, Kathleen A. Gallo, James H. Geiger, John L. Wang, and R. William Henry for

their time and effort in my guidance during these years.

I would like to thank the members of the Henry lab including Craig Hinkley,
Heather Hirsch, Zakir Ullah, Gauri Jawdekar, Anastasia Gridasova, Tharakeswari
Selvakumar, and Xianzhou Song for sharing their expertise and friendship. I would also
like to thank my friends and colleagues in this department and other departments. Special
thanks to Rhonda Hussain, Susanne Hoffmann-Benning, Keith Ray, and Walter Esselman

and his student Weiqin Chen for technique assistance.

I would like to thank my husband Ruanbao Zhou and my son Kai Ruan for their
tremendous support throughout all these years. I would also like to thank my parents and

siblings in China for their love and understanding.

TABLE OF CONTENTS

List of Figures ....................................................................................... ix
Key to symbols and abbreviations ............................................................... xi
Chapter One

Introduction and literature review

1. Human small nuclear RNA gene transcription ................................................ 1
1.1 The functional significance of snRNAs

1.2 Human snRNA gene transcription
1.2.1 The structures of human snRNA gene promoters
1.2.2 Trans-acting factors required for snRNA gene transcription
1.2.2.1 The DSE binding factors
1.2.2.2 The PSE binding factor
1.2.2.3 The TATA box binding factor
1.2.3 Composition of RNA pol II and pol 1H transcription initiation complexes
1.2.3.1 The basal transcription machinery for pol II-specific snRNA genes
1.2.3.2 The basal transcription machinery for pol III-specific snRN A genes
1.2.4 Other factors involved in regulating human snRN A gene transcription
2. Protein Kinase CK2 .............................................................................. 15
2.1 CK2 structure and chemical properties
2.1.1 CK2 holoenzyme
2.1.2 Regulation of CK2 enzymatic activity

2.1.3 Dual-substrate and dual-cosubstrate specificity of CK2

vi

2.2. CK2 participates in various cellular processes
2.2.1 CK2 localization
2.2.2 CK2 in cell proliferation
2.2.3 CK2 in cell survival and apoptosis
2.2.4 CK2 and cancer
2.2.5 CK2 in stress response
2.3. The role of CK2 in transcription regulation
2.3.1 CK2 phosphorylation controls transcription at different levels
2.3.2 The role of CK2 in protein-coding gene expression

2.3.3 The role of CK2 in non-coding gene transcription

3. Main hypothesis and experimental design .................................................... 33
4. References ......................................................................................... 35
Chapter Two
Cooperation between SNAPC and TBP antagonizes protein kinase CK2 inhibition of
DNA binding by SNAPC
Abstract ....................................................................................... 55
Introduction .................................................................................. 56
Materials and Methods ..................................................................... 60
Results ........................................................................................ 65
Discussion ..................................................................................... 90
References ................................................................................... 93
Chapter Three
CK2 phosphorylation of SNAP190 negatively regulates SNAPC function
Abstract ...................................................................................... 98
Introduction .................................................................................. 99
Materials and Methods ................................................................... 102

vii

Results ...................................................................................... 107

Discussion .................................................................................. 127
References ................................................................................. 130
Chapter Four
Summary and Future Plan
Summary and future plan ................................................................ 134
References ..................................................................................... 141

viii

LIST OF FIGURES

Figure 1-1. Schematic representation of cis-elements of human snRNA promoters ..... 3

Figure 1-2. SNAP190 acts as a scaffold protein at snRNA promoters ..................... 7

Figure [-3. Composition of snRN A transcription initiation complexes for

transcription by RNA polymerases II and III ................................... 12
Figure 11-1. CK2 inhibits U1 snRNA in vivo gene expression ............................ 67
Figure 11-2. CK2 represses U1 in vitro transcription ......................................... 71
Figure 11-3. Endogenous CK2 associates with SNAPC ..................................... 74
Figure 11-4. Endogenous SNAPC is phosphorylated ........................................ 79

Figure 11-5. Endogenous CK2 phosphorylates the N-terminal region of
SNAP190 ........................................................................... 82

Figure 11-6. TBP and SNAPC cooperate at U6 but not at U1 promoter probes
to overcome CK2 inhibition of DNA binding by SNAPC . . . . . . . . ....87

Figure 111-1. SNAPC function is modulated by protein kinase CK2 ...................... 108
Figure 111-2. Endogenous CK2 phosphorylates the N-terminus of SNAP190
in the region within amino acids 20-63 containing multiple

CK2 consensus sites .............................................................. 111

Figure III-3. Endogenous CK2 phosphorylates the N-terminus of SNAP190

ix

in the serine rich region within amino acids 514-545 containing

multiple CK2 consensus sites ................................................... 114

Figure III-4. Deletion of CK2 phosphorylation regions within SNAP190
did not affect the transcription properties of SNAPC ........................ 118

Figure III-5. A functional comparison between mini-SNAP
complexes m8 and mSAC ......................................................... 123

2, 3-DPG
6-TG
APE/Ref- 1
ARC

ATFl

bPrP

Brfl -TFIIIB
Brfl-TFIIIB
ChIPs

Chk2
CHOP/GADDI 53

CK2
CO-IP
CoREST

CPE
CREB
CTCF
CTD
C-terminal
Da

DEK
DHN l

DPE

DRB
DSB

KEY TO SYMBOLS AND ABBREVIATIONS

2, 3-diphosphoglycerate

6-thioguanine

apurinic endonuclease

apoptosis repressor with caspase recruitment domain
activating transcription factor-l

bovine prion protein

TFIIIB complex composed of TBP, Brfl and del

TFIIIB complex composed of TBP, Bra and del
chromatin immunoprecipitations

checkpoint kinase 2

C/EBP homologous protein transcription factor/growth arrest and
DNA damage inducible protein

casein kinase 2 or casein kinase H

co-immunoprecipitation

corepressor for the repressor element 1 silencing transcription
factor

core promoter element

CAMP-dependent response element binding protein
CCCTC-binding factor

carboxy terminal domain of RNA polymerase 11 largest subunit
carboxy-terminal

Dalton

proto-oncogene protein transcribed from a gene named dek

dehydrin protein 1
downstream promoter element

5, 6-dichloro- l -B-D-ribofl.1ranosylbenzimidazole
double-strand breaks

xi

DSE
d-siRNA
dsRNA
ecto-CKZ
EMSA
FACT
FCPl
FGF-Z
GAPDH
GTFs
HDAC
HEXIM 1
HP]

HS 1
HSFl
HTH
ICB90
1P

IR

IKBu
MALDI-TOF MS

MEFZC

mini- SNAPC
mRNA

MS

mS
mSA(N+C)
mSAC
mSAN

MT A-2

distal sequence element

Dicer generated small interfering RNA

double stranded RNA

CK2 released from the surface of intact cells
electrophoretic mobility shift assay

facilitating chromatin-mediated transcription
TFIIF-associated CTD phosphatase 1

fibroblast growth factor-2
glyceraldehyde-3-phosphate dehydrogenase

the general transcription factors

histone deacetylase

hexamethylene bisacetamide-inducible protein 1
heterochromatin-associated protein 1
haematopoietic lineage cell-specific protein 1
heat shock factor-1

helix- turn-helix motif

Inverted CCAAT box Binding Protein of 90 kDa
immunoprecipitation

ionizing radiation

Inhibitor of kappaB alpha

matrix-assisted laser desorption/ionization—time of flight mass

spectrometry
myocyte enhancer factor-2C

complex composed of SNAP43, SNAPSO, SNAP190 (1-719)
messenger RNA

mass spectrometry

mini- SNAPC

complex composed of SNAP43, SNAPSO, SNAP190 (63-505)
complex composed of SNAP43, SNAPSO, SNAP190 (1-505)
complex composed of SNAP43, SNAPSO, SNAP190 (63-719)
multithreaded architecture

xii

muTATA
NAP-2

NE
NFATc
NFKB
N-terminal
OIR
PA-PLA l or
PBP

PEST domain
PIC

PK6OS
PKA

pol

13131386

PSE

pSer
P-TEF b
PTF

pThr

PTP

PTyr
Q-TOF MS/MS

quercetin
RB
RbAp48
RNAi
RNPS
RNPS 1
rRN A
RRR

mutant TATA box sequence

nucleosome assembly protein 2

nuclear extract

nuclear factor of activated T cells

nuclear factor kappa B

amino-terminal

Oct-1 interact region

phosphatidic acid-preferring phospholipase 1A
proximal sequence element binding protein
proline-glutamic acid-serine-threonine domain
Pre-initiation complex

protein kinase 608

protein kinase A

RNA polymerase

phosphatase

proximal sequence element

phosphoserine

positive transcription elongation factor-b
proximal sequence element transcription factor
phosphothreonine

phosphotyrosine phosphatase

phosphotyrosine

quadrupole time of flight mass spectrometry

3, 3’, 4’, 5, 7-pentahyroxyflavone

the retinoblastoma tumor suppressor protein
the Rb-associated protein

RNA interference

ribonucleoprotein particles

RNA-binding protein prevalent during S phase
ribosomal RNA

arginine rich region

xiii

RT-PCR
SANT
SBF

SL 1 /T IF -IB
SNAPC
snRNAs
snRNPs
SOD
SPH
SRR
SSB
SSRPl
Staf

SV 40
TAF
TBB
TBP
TGE running buffer
TLC
TLE
TLR-3
tRNA
TRR
uPA
UPE
UV
VSMC
WCE
thSE
thATA
XRCCl

reverse transcriptase polymerase chain reaction
DNA-binding domain in SWI-SNF, ADA, N-CoR and TFIIIB
the SPH binding factor

promoter selectivity factor or transcription initiation factor 1B
the snRNA activating protein complex

small nuclear RN As

small nuclear ribonucleoprotein particles

superoxide dismutase

SphI postoctamer homology

serine rich region

single-strand breaks

structure-specific recognition protein 1

the selenocysteine tRN A gene transcription activating factor
Simian virus 40 large T antigen

TBP-associated factor

4, 5, 6, 7-tetrabromobenzotriazole

TATA binding protein

buffer containing 50 mM Tris, 380 mM glycine, 2 mM EDTA
thin layer chromatography

thin layer electrophoresis

Toll-like receptor 3

transfer RNA

TBP recruitment region

urokinase

upstream promoter element

ultraviolet light

vascular smooth muscle cell

whole cell extract

wild type PSE sequence

wild type TATA box sequence

the X-Ray cross-complementing group 1 protein

xiv

CHAPTER 1

INTRODUCTION AND LITERATURE REVIEW

1. Human small nuclear RNA gene transcription

1.]. The functional significance of snRNAs

The final products of human small nuclear RNA genes are small nuclear RNAs
(snRNAs), which play fundamental roles in processing of other RNAs. For example, U1,
U2, and U6 snRN As are essential components of small nuclear ribonucleoprotein
particles (snRNPs) that control pre-messenger (m) RNA splicing (Burge et al., 1999). U3
snRNA is involved in ribosomal (r) RNA processing (Fatica, et al., 2002; Grandi, et al.,
2002), while H1 snRNA is the catalytic subunit of RNase P responsible for transfer (t)
RNA maturation (Bartkiewicz et al., 1989). In addition, snRNA functions in regulating
mRNA gene transcription. For example, U1 snRNA associates with TFHH and stimulates
TFIIH-dependent RNA polymerase (pol) H transcriptional initiation (Kwek etal., 2002).
78K snRNA, on the other hand, associates with a positive transcription elongation factor-
b (P-TEFb) (Peng et al., 1998; Wei et al., 1998) and the hexamethylene bisacetamide-
inducible protein 1 (HEXIMl) (Ouchida et al., 2003; Michels et al., 2003). HEXIMl
sequesters the 7 SK-P-TEFb ribonucleoprotein particle (RNP) and represses P-TEFb
kinase and transcriptional activities by inhibiting P-TEFb phosphorylation of the carboxy
terminal domain (CTD) of RNA pol II (Nguyen et al., 2001; Yang et al., 2001; Yik et al.,

2003; Chen et al., 2004; Yik et al., 2005). Futhermore, snRNA can mediate a preimmune

signal. For example, U1 snRNA, a component of U1-70-kDalton (kDa) RNP, is capable
of inducing innate immunity signaling through activation of Toll-like receptor 3 (TLR-3)
(Hoffman et al., 2004). Human snRNAs fimction in diverse cellular processes, the levels
of snRNA gene transcription need to be well regulated when cells undergo cell
proliferation, differentiation and embryo development (Caceres et al., 1992; Cheng etal.,
1997; Glibetic et al., 1992; Lund et al., 1987; Meissner et al., 1995; Nash et al., 1987;

Robert et al., 2002).

1.2 Human snRNA gene transcription

Human snRNA genes are transcribed by either RNA pol II or RNA pol III. The
polymerase specificity depends upon their promoter architectures (for a review, see

Hernandez, 2001).

1.2.1 The structures of human snRNA gene promoters

U1 and U2 snRNA gene promoters are representatives of pol H-specific snRNA
promoters, whereas U6 and 78K snRNA gene promoters are representatives of pol III-
specific snRNA promoters. As illustrated in Figure I-l, two distinct and conserved cis-
acting regulatory regions that are important for snRNA gene transcription are present in
both human RNA pol II and pol III snRNA gene promoters. A proximal sequence
element (PSE) is located in the core promoter region centered near position -55 relative to
the transcription initiation start site and a distal sequence element (DSE) is located in the

regulatory region near position —220, and serves as a transcriptional enhancer. The PSE is

Figure 1-1. Schematic representation of cis-elements of human snRNA promoters.
The cis-elements on RNA pol II transcribed snRNA gene promoters, such as the U1
snRNA promoter, include a proximal sequence element (PSE) centered near position -55
relative to the transcription initiation start site and a distal sequence element (DSE) near
position -200 at the regulatory region. RNA pol III-transcribed snRN A genes, represented
by the U6 snRNA promoter, contain an additional TATA-box near position -25 adjacent
to the PSE at the core promoter.

* Images in this dissertation are presented in color.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

.90 E05 28 869 E08. zoo.
e \\
5.5. T mmm mmo
AIL \\
P+ mm- mm. com-
A... .8. .20an 9.3 <zmcm o:
.20an 28 no.8. 329.52
\\ ,
wwa mwn.
AL \\
F... mm- com-

c. .3. .20an mean <zmcm S

sufficient to nucleate the assembly of a RNA pol II transcription initiation complex and to
direct basal RNA pol II transcription in vitro. The basal RNA pol III snRNA gene
promoters additionally contain a TATA box located around position -25 and at a fixed
distance downstream of the PSE. Together the PSE and TATA box direct basal RNA pol
III transcription (Hernandez and Lucito 1988; Mattaj et a1. 1988; Kunkel and Pederson

1989; Lobo and Hernandez 1989).

1.2.2 Trans-acting factors required for snRNA gene transcription

1.2.2.1 The DSE binding factors

All human snRNA genes contain a DSE encompassing an octamer sequence
ATGCAAAT that is recognized by the Oct—1 or Oct-2 POU domain (Murphy et a1, 1992).
In addition, many snRNA gene DSEs contain a GC-box (GGGGCGGGGA) and an SphI
postoctamer homology (SPH) motif that are recognized by the transcription factor Spl
(Ares et al., 1987) and a zinc finger containing transcription factor referred to as the SPH
binding factor (SBF) (Roebuck et al, 1990; Zamrod and Stumph, 1990) or as the
selenocysteine tRNA gene transcription activating factor (Stat) (Schuster et al., 1995;
Schaub et al., 1997; Myslinski etal., 1998; Rincon et al., 1998), respectively. Oct-1 binds
to the octamer sequence of the DSE and activates snRNA transcription by direct protein-
protein contacts with the basal transcription factor called the snRNA activating protein
complex (SNAPC) (Henry et al., 1995; Mittal etal., 1996; Henry et al., 1998b; Ford etal.,

1998; Mittal et al., 1999; Hovde et al., 2002).

1.2.2.2 The PSE binding factor

The PSE binding factor is a multi-subunit complex called SNAPC (Sadowski et a1.
1993), also referred to as the proximal sequence element transcription factor (PTF)
(Murphy et al., 1992) or the proximal sequence element binding protein (PBP)
(Waldschmidt et al., 1991; Meissner et al., 1995). SNAPC consists of at least five
subunits SNAP190, SNAP50, SNAP45, SNAP43, and SNAP19, which are named
according to their apparent molecular masses. The cDNAs encoding the SNAP19 (Henry
et al. 1998b), SNAP43 (Henry et. a1, 1995) or PTF y (Y oon and Roeder, 1996), SNAP45
(Sadowski et al., 1996) or PTF 8 (Yoon and Roeder, 1996), SNAPSO (Henry et. a1, 1996)
or PTF [3 (Bai et al., 1996), and SNAP190 (Wong et al., 1998) subunits have been
isolated. The protein-protein contacts within SNAPC have been mapped by reconstitution
of partial complexes and coimmunoprecipitations of various in vitro translated full-length
or truncated SNAPC subunits (Henry et al., 1996; Henry et al., 1998a; Henry eta1., 1998b;
Wong et al., 1998; Mittal et al., 1999; Ma and Hernandez, 2001; Gu and Henry,
unpublished data). As summarized in Figure I-2, SNAP190 interacts with SNAP45,
SNAP43 and SNAP19, while SNAP50 joins the complex by interacting with SNAP43.
Further analysis revealed that SNAP190 (Yoon et al. 1995) and SNAPSO (Henry et a1.
1996; Bai et al., 1996) are in close contact with the DNA when SNAPC is bound to the
PSE. SNAP190 possesses a Myb DNA binding domain consisting of four complete
repeats (RaRbRcRd) and a half repeat (Rh) (Wong et a1. 1998), and a baculovirus-
assembled recombinant SNAPc with an RhRaRb deletion within SNAP190 is capable of

binding specifically to the PSE and directing snRN A gene transcription (Wong et al.

Figure 1-2. SNAP190 acts as a scaffold protein at snRNA promoters. Domains within
SNAP190 that interact with other SNAPC subunits and other trans-regulators at snRNA
promoters are shown. TRR]: TBP recruitment region 1; TRR2: TBP recruitment region 2
and OIR: Oct-l interaction region (modified from Ma and Hernandez, 2001) (Ford etal.,
1998; Ma and Hernandez, 2001; Ma and Hernandez, 2002; Hinkley et al., 2003; Gu and
Henry, unpublished data).

  

 

 

 

 

BN— 50 m «cm... 8m
.U I]: I BE<zm
«a 8.. re. a... 5. a 5.. m 8 a .
cacao;
I .. u mea<zm . mi<zm
a.” .8 8. P 8..” .
_ .8m<zm

    

 

 

 

 

  

    

 

 

 

 

2v

—

1998), while RcRd deletion is not, suggesting that the RcRd repeats contribute to
recognition of the PSE on the promoter (Mittal et al. 1999). Moreover, a mini-SNAPC
consisting of full-length SNAP43, full-length SNAPSO, and a truncated SNAP190 (1-514)
encompassing the Myb DNA binding domain can recognize the PSE and support snRNA
in vitro transcription by both RNA pol II and pol 1H (Mittal et al., 1999). Thus, SNAP190
plays a central structural role by serving as a scaffold protein within SNAPC and

contributes to the PSE recognition on snRNA gene promoters.

1.2.2.3 The TATA box binding factor

The TATA box on pol III-specific snRNA gene promoters is recognized by a
TFIIIB-like complex (Waldschmidt et al. 1991; Murphy et a1. 1992; Sadowski et al. 1993;
Yoon et a1. 1995; Schramm et al. 2000; Teichmann et al. 2000) designated Brfl-TFIIIB.
This TFIHB complex consists of the TATA binding protein (TBP), TFIIB-related factor 2
Brf2 (Willis 2002), originally called BRFU (Schramm et al. 2000; Cabart and Murphy,
2001) or TFIIIBSO (Teichmann et al. 2000), and a SANT domain (a putative DNA-
binding domain in SWI-SNF, ADA, N-CoR and TFIIIB) containing protein de1
(Schramm et al. 2000). Brf2 recognizes the TBP/TATA-box complex through its TFHB-
related core domain (Cabart and Murphy 2001). Another type of TFIIIB designated Brfl-
TFIHB fimctions specifically for tRNA and SS rRNA transcription and is composed of

TBP, Brfl, and del (Kassavetis etal., 1992).

1.2.3 Composition of RNA pol II and III transcription initiation complexes

1.2.3.1 The basal transcription machinery for pol II-specific snRNA genes

The RNA pol II-specific snRNA promoters contain only a PSE in the core
promoter region. SNAPC binding to the PSE is required for nucleating the assembly of a
RNA pol II transcription preinitiation complex and directing basal RNA pol II
transcription in vitro. TBP is also needed for the TATA-less snRNA gene transcription by
RNA pol II (Sadowski et al., 1993). TBP cofractionates with SNAPc (Henry et al., 1995),
and RNA pol II-specific U1 snRN A transcription in vitro can be reconstituted by addition
of those SNAPC [TBP enriched fractions to an endogenous TBP depleted HeLa nuclear
extract (Sadowski et al., 1993). The interaction between TBP and SNAPC is further
confirmed by coimmunoprecipitation and GST-pulldown experiments (Henry et al., 1995;
Sadowski et al., 1996; Ma and Hernandez, 2002; Hinkley et al., 2003). As the TBP used
in U1 snRN A transcription is not part of the TBP-containing TFIID complex required for
TATA box-containing pol II-specific mRNA promoters, or the TBP-containing TFIIIB
complex required for TATA-less pol III-specific tRNA and 5S rRNA promoters
(Sadowski et al., 1993; Yoon et al., 1996), it is likely that SNAPC serves as a TBP-
associated factor (TAF) for the recruitment of TBP to the pol II-specific snRNA gene
promoters (Henry et al., 1995). Other components required for pol II-specific snRNA
transcription were also identified by reconstitution of transcription with recombinant
factors or with purified factors from extracts. The general transcription factors (GTFs)
TFIIA, TFIIB, TFIIF, and TFHE have been determined to be parts of the pol H-specific

snRNA transcription initiation complexes (Figure 1-3, top panel). As these general

10

transcription factors and SNAPC are not sufficient to initiate transcription from the U1
promoter, it was speculated that additional factors are required for pol II-specific snRNA

gene transcription (Kuhlman et al., 1999).

1.2.3.2 The basal transcription machinery for pol III-specific snRNA genes

The RNA pol III-specific snRNA promoters contain two core elements: a PSE
and a TATA box that are recognized by SNAPC and Brfl-TFIIIB, respectively.
Recombinant SNAPC, Brfl-TFIIIB, and highly purified RNA pol III are sufficient for
directing pol III-specific U6 snRNA gene transcription in vitro (Hu et al., 2003). The
PSE-bound SNAPC plays a critial role for recruitment of the TATA box binding complex
Brfl-TFIIIB (Ma and hemandez, 2002; Hinkley et al., 2003) (as illustrated in Figure 1-3,
bottom panel). F uther studies indicate that within SNAPC, SNAP190 contributes to Brf2-
TFIIIB recruitment (Ma and Hernandez, 2002; Hinkley et a1, 2003). The SNAP190 RcRd
repeats (also named TBP recruitment region 2, or TRR2) can stimulate TBP recognition
and TFIIIB recruitment to the neighboring TATA box present in the U6 snRNA promoter
(Hinkley et a1, 2003). The region within SNAP190 from amino acids 34 to 83 (named
TBP recruitment region 1, or TRRl) also contributed to cooperative binding with TBP in

the context of mini-SNAPC (Ma and Hernandez, 2002) (Figure 1-2).

In summary, the SNAPc /PSE and Oct-1/DSE protein-DNA contacts and the
SNAP190/Oct-1 protein-protein cooperative interactions are critical for RNA pol 11-
specific snRNA transcription. In the case of pol III-specific snRNA transcription,
additional TFIIIB/TATA-box protein-DNA contact is reinforced by SNAP190/TBP

protein-protein cooperative interaction. Thus, SNAPC plays a fundamental role in the

11

Figure [-3. Composition of snRNA gene transcription initiation complexes for
transcription by RNA pol II and pol III. RNA pol II initiation complex assembled on
the human U1 snRNA core promoter (top panel), and RNA pol III initiation complexes

assembled on the human U6 snRN A promoter (bottom panel).

12

u1 snRNA 9°09 ”mow

us snRNA 9e"e pmmow

 

core Pr°m°ter

SNAPC

core Pf°m°ter

    

 

assembly of transcription initiation complexes for transcription by both RNA pol II and

pol 111.

1.2.4. Other factors involved in regulating human snRNA gene transcription

Human snRNA gene transcription is regulated during cell cycle progression
(Diana et al., 2003; Hu et al., 2004) and in response to DNA damage (Gridasova and
Henry, 2005), suggesting that additional factors contribute to the regulation of these
genes. Studies by Dr. Henry’s group showed that the retinoblastoma (RB) tumor
suppressor protein, which represses pol IH-specific tRNA and SS rRNA gene
transcription, is able to repress U6 snRNA gene transcription by RNA pol III as well
(Hirsch et al., 2000), and may contribute to cell cycle regulation of these genes (Hirsch et
al., 2004). The observation that RB and RNA pol III co-occupy the human U6 snRNA
promoter suggested a unique mechanism that RB represses U6 snRNA gene through
stable promoter association with the polymerase during repression. SNAPc and TBP are
also important for RB repression of human U6 snRNA gene transcription (Hirsch et al.,
2004) and may contribute to RB promoter recruitment. Moreover, the p53 tumor
suppressor protein, a general repressor of RNA pol HI transcription, was shown to repress
snRNA gene transcription by both polymerases II and HI. Endogenous p53 associates
with U1 and U6 gene promoters, and p53 promoter occupancy is stimulated by ultraviolet
(UV) light (Gridasova and Henry, 2005). In contrast, Simian virus (SV) 40 large T
antigen, which interacts with SNAP43 and SNAP45, is capable of activating U6 snRNA

gene transcription (Damania et al., 1998).

14

Additional factors involved in regulating RNA pol III-specific snRNA gene
transcription were recently identified using a minimal RNA pol 111 system for human U6
transcription. This system utilizes recombinant SNAPC, Brfl-TFIIIB, and a highly
purified RNA pol [B complex (Hu et al., 2003). Two RNA pol 1H associated factors, [3-
actin (Hu et al., 2004) and protein kinase CK2 (Hu et al., 2003), were shown to be
involved in U6 snRNA gene transcription. CK2 co-purifies with RNA pol HI and
stimulates U6 snRNA gene transcription by phosphorylating RNA pol 111. However, CK2
phosphorylation of the de1 subunit of Brfl-TFIIIB complex during mitosis leads to
del dissociation from the endogenous U6 promoter and diminished transcription (Hu et
al., 2004). These data suggest that CK2 has both positive and negative regulatory roles in
pol IH-specific U6 snRNA transcription. However, the role of CK2 in regulating the

closely related pol II-specific snRN A gene transcription has been uncertain.

2. Protein Kinase CK2

Protein kinase CK2 (EC 2.7.1.37) (forrnly "casein kinase 2" or “casein kinase II”)
was first discovered in rat liver extracts using casein as phosphorylatable substrate
(Burnett and Kennedy, 1954). Since then CK2 has been found in protozoa, yeast, plants,

and animals (Faust and Montenarh, 2000; and references therein).

CK2 is the most conserved and the most functionally pleiotropic member among
all protein kinases characterized thus far. More than 307 CK2 substrates have been found,
many of which are involved in signal transduction, gene expression, cell proliferation,

and DNA repair (Pinna, 2002; Meggio and Pinna, 2003). Consistently, CK2 is distributed

15

in the nucleus as well as the cytoplasm in all eukaryotic cells. CK2 is essential to cell
viability (Pinna and Meggio, 1997; Ahmed et al., 2002; Unger et al., 2004). It has
become clear that CK2 plays an important role in regulating numerous cellular processes
both during normal growth (Litchfield et al., 1992; Litchfield and Luscher, 1993; Hehn et
al., 1997; Guerra and Issinger, 1999) and during cancer development (Seldin etal., 1995;

Tawfic et al., 2001).

2.1 CK2 structure and chemical properties
2.1.1 CK2 holoenzyme

CK2 predominantly exists as a heterotetrameric complex consisting of two
catalytic or subunits and two regulatory [3 subunits.

In humans, three catalytic isoforms, designated CK20L, CK2a' and CK2a", have
been identified. CKZa and CKZa' are encoded from two distinct genes (Meisner et al.,
1989; Lozeman et al., 1990) and amino acid sequences deduced from these two genes are
about 85% identical. CKZoI" is 91% identical to the CK2a. Its N-terminal sequence (1-
353) is almost identical to CK2a but its carboxy (C)-terminal sequence (354-385) is
unique. This unique C-terminal sequence is probably derived from an Alu-like exon
(W irkner et al., 1994) due to alternative splicing (Litchfield et al., 2001; Shi et al., 2001).

CK20L and CK20L' have similar enzymatic activity (Litchfield, 2003), but are not
functionally identical. First, these two isoforms show a difference in their localization.
CK2a is found ubiquitously in all cell types of tissues in eukaroytic organisms, while
CKZa' is expressed in a tissue specific manner. For example, CK2a' is detected only in

mouse testis and brain (Guerra et al., 1999), and is much more abundant in rat neurons

16

than in glia cells (Diaz-Nido et al., 1994). Second, there are functional distinctions
between CK20L and CK2a'. For instance, overexpression of the catalytically inactive
CK2a' dramatically inhibits cell proliferation in human osteosarcoma U2-OS cell lines,
while overexpression of the inactive CK20L does not (Vilk et al., 1999). Furthermore,
CK20L' is essential for normal differentiation of male germ cells (Xu et al., 1999) and
inactivation of CK2a' causes infertility in male mice (Escalier et al., 2003). Thus far,
CK20L" has been found only in the nuclei of liver tissue. CK20t" preferentially associates
with the nuclear matrix (Hilgard etal., 2002) and the translated Alu sequence of CKZa"
is necessary for directing the holoenzyme nuclear localization. CK20I" is specifically
needed for hepatocellular membrane protein trafficking of some proteins (Hilgard et al.,
2002). In addition, CK20L" appears to be involved in suppression of apoptosis mediated
by a INK signaling cascade (Hilgard et al., 2004). Thus, the three catalytic
CK20r isoforms are functionally distinct from one another.

In humans, only a single regulatory subunit designated CKZB has been identified.
Human CKZB is unusual because it does not share homology with any other regulatory
subunit of protein kinases (Jakobi et al., 1989). In Saccharomyces cerevisiae two genes
encoding CK2B subunits have been reported (Reed et al., 1994; Bidwai et al., 1995), and

in Arabidopsis three genes have been identified (Collinge and Walker, 1994; Sugano et
aL,1998)

In the CK2 holoenzyme, stable CK2 B-B dimerization mediated by the zinc-finger

140

region Cysm ~ Cys (Canton et al., 2001) is a prerequisite for the stable incorporation

of CKZa into the CK2 tetramer (Graham and Litchfield, 2000; Canton et al., 2001;

17

Boldyreff et al., 1996; Chantalat et al., 1999; Niefind et al., 2001). Then, two identical or
non-identical (Gietz et al., 1995) catalytic subunits join the complex through interaction
with both [3 subunits, although the two catalytic subunits make no direct contact with one

another in the complex (N iefind et al., 2001).

2.1.2. Regulation of CK2 enzymatic activity

Most protein kinases exist in an inactive form and their activities are turned on
only in response to specific stimuli. For example, protein kinase A (PKA) becomes active
after an inhibitory protein subunit is released upon cAMP binding. CK2 appears to be
independent of any known secondary messengers, such as CAMP, cGMP, calcium or
lipids (Kudlicki et al., 1978; Tuazon and Tuazon, 1991; Litchfield and Liischer, 1993).
Both the isolated CK2 catalytic subunits and CK2 holoenzyme exist predominantly in
their active comforrnations. There are at least two independent mechanisms governing
their activities. First, an intrinsic interaction between the activation loop (amino acids
from 175 to 188) and its N-terminal segment (amino acids from 1 to 36) within the
catalytic subunit ensures CK2a remains in its active form. Second, the association of the
catalytic or subunits with the regulatory [3 subunits can compensate for the inactive
mutants in which the contacts between the N-terminal and activation segments have been
disrupted (Samo et al., 2002), suggesting that an intermolecular interaction is important
for CK2 holoenzyme activation. Within the holoenzyme, in addition to confering stability
and stimulating the catalytic activity of CK20L with most protein substrates, CKZB is also
responsible for docking and/or recruitment of CK2 partners, including substrates such as

the nucleolar protein Nopp 140 (Li et al., 1997) and p53 (Fihol et al., 1992; Appel et al.,

18

1995), and potential CK2 regulators such as the cell surface receptor CD5 (Ramam et al.,
1998) and the fibroblast growth factor-2 (F GF-2) (Bonnet et al.,l996).

Although the CK2 catalytic subunits and holoenzyme are predominantly in their
active conformation, their activities can still be regulated. CK2 activity can be
dramatically increased in response to hormones and grth factors (Sommercom et al.,
1987; Klarlund and Czech, 1988; Ackerman and Osheroff, 1989; Ackerman et al., 1990),
which play an important role in transducing signals between extracellular growth factors
and nuclear responses. CK2 is activated during cell division, cellular differentiation, and
embryogenesis (Pinna and Meggio, 1997; Guerra and Issinger, 1999; Wilhelm et al.,
1995). CK2 is sensitive to certain stresses, such as heat shock (Gerber et al., 2000) and
UV light (Brenneisen et al., 2002). The mechanisms of CK2 up- or down-regulation are
unclear, however posttranslational modification appears to be important for CK2
“activation. For example, CKZB phosphorylation has been reported to increase CK2
activity (Ackerman et al., 1990). CK20L phosphorylation in the C-terrninal domain by
p34Cdcz inhibits CK2 holoenzyme activity (Messenger et al., 2002). In addition, CK2
activity can be regulated by other proteins through interactions with either its or subunit
or [3 subunit. For example, bovine prion protein (bPrP) targets the CK20L subunit and
stimulates CK2 holoenzyme activity (Meggio et al., 2000). FGF-2 can bind to CKZB and
trigger the CK2 holoenzyme nuclear translocation (Bonnet et al., 1996). p53 binds to
CKZB; however, the full length p53 inhibits CK2 activity while the C-terrninus of p53
stimulates CK2 activity (Schuster et al., 2001). In addition, a number of external small
molecules have been identified as CK2 inhibitors including 2,3-diphosphoglycerate (2,3-

DPG) (Hathaway and Traugh, 1983), 3,3 ,4 ,5,7-pentahyroxyflavone (quercetin) (Davies

19

et al., 2000), emodin (Yim et al., 1999), and the ATP analogue 4,5,6,7-tetrabromobenzo-
triazole (TBB) (Samo et al., 2001) and 5,6-dichloro-1-B-D-ribofuranosylbenzimidazole
(DRB) (Zandomeni et al., 1986). In contrast, basic polypeptides like polyamines
(sperrnine and spermidine) and synthetic polylysine (Meggio et al., 1992; Song et al.,
1994; Leroy et al., 1997), or proteins rich in lysine such as histones and protamine
(Sacerdoti-Sierra and Jaffe, 1997) were identified as potential CK2 stimulators.
Accumulating evidence has indicated that individual CK2 catalytic subunits and
the CK2 regulatory subunit can exist independently. The individual subunits of CK2
themselves may interact with a number of different proteins (for a review, see Guerra and
Issinger, 1999; Kom et a1, 1999). CKZB can interact with a large number of potential
interacting partners independently of CK2a. For example, CKZB can interact with
proteins involved in signal transduction including the cytoplasmic Raf serine/threonine
kinase family member A-Raf (Boldyreff and Issinger, 1997; Hagemann et al., 1997),
MAPK kinase kinase Mos (Lieberman and Ruderman., 2004), Src family protein tyrosine
kinase Lyn (Lehner et al., 2004), and tumor suppressor protein checkpoint kinase 2 (Chk2)
(Bjorling-Poulsen et al., 2005). CKZB can also interact with proteins involved in DNA
damage repair including p53 (Gdtz et al., 1999) and p21w’m/CIPI (G6tz et al., 1996;
Romero-Oliva and Allende, 2001), suggesting an additional physiological role of CKZB
beside being the regulatory protein in the CK2 tetramer (for a review, see Bibby and
Litchfield, 2005). More recently, the individual CK2 catalytic subunits have been found
to complex with other proteins. Han et al. (2001) showed that CK2a can interact with
phosphatidic acid-preferring phospholipase 1A (PA-PLAla). CK20I phosphorylation of

PA-PLAla promotes stable PA-PLAlor/CKZa complex formation in an ATP/GTP-

20

dependent manner (Han et al., 2001). Moreover, the protein kinase 608 (PK60S) (Pilecki
et al., 1992; Szyszka et al., 1996) in yeast 6OS ribosomes consists of CK2a' subunit and
superoxide dismutase (SODl) protein. Upon oxygen stress, CKZa' catalytic activity is
inhibited by the formation of inactive CK20L'/(SOD1)2 complex, indicating that CKZa'
may be involved in regulating the ribosome activity of the protein synthesis machinery

under stress conditions (Abramczyk et al., 2003).

2.1.3. Dual-substrate and dual-cosubstrate specificity of CK2

CK2 can phosphorylate not only seryl/threonyl residues but also tyrosyl residues.
For example, the tyrosyl residue in yeast nucleolar immunophilin F pr3 can be
phosphorylated by CK2 both in vivo and in vitro (Marin et al., 1999). A CK2 consensus
motif was derived from an analysis of 308 CK2 phosphorylation sites mapped within 175
CK2 substrates. CK2 recognizes a phosphorylatable residue that is followed by a series of
acidic residues (n + 3 being preferred over n + 1, and/or n + 2) (Meggio and Pinna, 1984;
Marin et al., 1986). The minimum consensus sequence of CK2 is S/T-X-X-D/E/pS/pY

(Meggio et al., 1994)

Both CK2 holoenzyme and the isolated CK2a subunit from all sources examined
to date show dual-cosubstrate specificity, meaning the ability to efficiently utilize either
ATP or GTP as a phosphoryl donor. Water molecules are critical to switch the active site
of CK2 from an ATP- to GTP-compatible state (N iefind eta1.,1999). Mg” is required for
CK2 activity. However, Mg2+ can be substituted by Mn2+ and Co”. CK2 prefers ATP as
cosubstrate in the presence of Mg2+ while it prefers GTP in the presence of an.+ (Lasa

and Pinna, 1997).

21

2.2. CK2 participates in various cellular processes

2.2.1. CK2 localization

CK2 is distributed in almost all tissues in various species at different stages of
development. CK2 can associate with specific structures including the plasma membrane,
cytoskeleton, ribosomes, nuclear matrix, nucleolus, centrosomes and nucleosome. CK2
has also been detected in various organelles such as the endoplasmic reticulum,
mitochondria, and golgi (Faust and Montenarh, 2000). Studies also show that exogenous
substrates such as fibrinogen, fibrin (Sonka et al., 1989), and vitronectin (Skubitz et al.,
1991) can trigger CK2 release from the surface of intact cells (named ecto-CKZ).
Vitronectin phosphorylation by ecto-CK2 is required for urokinase (uPA)-dependent
human vascular smooth muscle cell (V SMC) adhesion (Stepanova et al., 2002). Similarly,
complement C9 protein phosphorylation by ecto-CK2 protects cells from complement-
mediated lysis (Bohana-Kashtan et al., 2005). The level of CK2 appears to be tightly
regulated in normal cells, however, CK2 activity and protein content have been shown to

be elevated in proliferating cells (Issinger, 1993).

2.2.2. CK2 in cell proliferation

CK2 has been shown to phosphorylate a large number of proteins that are
important regulators of cell division (Allende and Allende, 1995). CK2 is required at
multiple transitions in the cell cycle including Go /Gl, 61/8 and 62M (Marshak and
Russo, 1994; Pepperkok et al., 1994; Hanna et al., 1995). High levels of CK2 have been
detected in cells undergoing mitosis (Issinger, 1993). In Saccharomyces cerevisiae, cell

cycle progression is arrested in both G1 and GZ/M phases of the cell cycle when

22

temperature-sensitive CK2 mutants are shifted to the nonperrnissive temperature (Hanna
et al., 1995). Similarly, the proliferation of primary human fibroblasts can be blocked by
inactivation of CK2 through depletion of CK2 by either RNA interference (RNAi) or
microinjection of CK2 specific antibodies. Furthermore, overexpression of the CK2a
kinase-deficient mutant (K68—>A) induced a marked inhibition of cell proliferation in
both NIH3T3 and CCL39 cells (Lebrin et al., 2001). These results indicate that CK2

plays an important role in controlling cell division and cell proliferation.

2.2.3. CK2 in cell survival and apoptosis

Biochemical and genetic evidence indicates that CK2 participates in the
maintenance of cell viability. CK2 appears to exert an anti-apoptotic role by protecting
regulatory proteins from caspase-mediated degradation (Litchfield, 2003). Inhibition of
CK2 by its specific inhibitor TBB induces apoptosis in Jurkat cells (Ruzzene etal., 2002).
Similarly, depletion of endogenous CKZa and/or CKZa ' catalytic subunits by RNAi also
causes marked apoptosis when HeLa cells have been exposed to 6-thioguanine (6-TG)
(Yamane and Kinsella, 2005a) or ionizing radiation (IR) (Yamane and Kinsella, 2005b).
However, these responses can be suppressed by introducing ARC (apoptosis repressor
with caspase recruitment domain) or by blocking caspase enzymatic activity (Yamane
and Kinsella, 2005a; Yamane and Kinsella, 2005b), suggesting that CK2 participates in
inhibition of apoptosis by negatively regulating caspase activity. A number of
antiapoptotic proteins, such as Bid (Desagher et al., 2001), Max (Krippner-Heidenreich et
al., 2001), ICB90 (Inverted CCAAT box Binding Protein of 90 kDa) (Bronner et al.,

2004), and HSI (haematopoietic lineage cell-specific protein 1) (Ruzzene et al., 2002) are

23

targeted by CK2 leading to downregulation of caspase-dependent degradation. Moreover,
increased expression of CK2 protects cells from drug-induced apoptosis (Guo et al.,
2001). Taken together, these observations indicate that CK2 plays a critical role in

maintaining cell survival.

2.2.4. CK2 and cancer
The growth-promoting and anti-apoptotic properties of CK2 may contribute to its
ability to participate in transformation. CK2 is abnormally active in a variety of human
cancers including leukemias and solid tumors (Munsterrnann et al., 1990; Landesman-
Bollag et al., 2001). The detection of higher CK2 nuclear translocation in tumor cells
suggests that CK2 nuclear association plays an important role in tumorigenesis (Faust et

al., 1999; Guo et al., 2001).

2.2.5. CK2 in stress response

Another important function of CK2 is that it acts as a downstream effector
responsible for transducing genotoxic stress signals to either the transcriptional
machinery or DNA-damage repair system. For example, in yeast, CK2 targets the TBP
component of Brfl -TFIIIB for regulation of RNA pol III-specific tRNAs and SS rRNA
gene transcription. Transcription of these genes is repressed in cells that have experienced
DNA damage, which causes the dissociation of the CK20L from the CK2/TFIIIB complex
(Ghavidel and Schultz, 2001; Schultz, 2003). Thus, CK2 acts as a terminal effector in the

signaling pathway that transduces DNA-damage signals to the RNA pol III

24

transcriptional machinery. In addition, disruption of the CKZB gene causes yeast cells to
permanently arrest in G2/M at the DNA damage checkpoint when double-strand breaks
(DSB) occur, while normal cells can override this block, suggesting a role of CK2 in
controlling adaptation to the DNA-damage checkpoint (Toczyski et al., 1997). CK2
phosphorylation of histone H4 at serine 1 appears to promote DNA DSB repair (Cheung
et al., 2005). Furthermore, in mammalian cells, CK2 facilitates DNA single-strand breaks
(SSB) repair mediated by the X-Ray cross-complementing group 1 protein (XRCCI)
(Loizou et al., 2004). CK2 can also control the activity of the DNA repair protein
apurinic endonuclease (APE/Ref-l) (Fritz and Kaina, 1999). APE/Ref-l phosphorylation
by CK2 stimulates its redox capability towards the transcription factor AP-l, thus
promoting AP-l DNA binding activity and activating its target genes. Upon CK2
inhibition, cells become more sensitive to DNA-damage reagents (Fritz and Kaina, 1999).
Moreover, CK2 has been shown to translocate to the nuclear matrix in response to heat
shock (Gerber et al., 2000). In addition, CK2 regulates p53 activity (Keller et al., 2001),
and p53 phosphorylation by CK2 is increased in response to UV irradiation (Blaydes and
Hupp, 1998). In the case of nuclear factor kappa B (NFKB), its activation is dependent
upon CK2 phosphorylation of IKBa, an inhibitory partner that associates with and
sequesteres the NFKB in the cytoplasm. Upon oxidative stress, CK2 targets IKBab for
degradation, thereby allowing NFKB proteins to translocate to the nucleus and induce
transcription (Schoonbroodt et al., 2000). These data indicate that CK2 is a key

participant in the cellular response to various stress conditions.

25

2.3. The role of CK2 in transcription regulation

Protein phosphorylation appears to be one the most important post-translational
modifications involved in the regulation of transcription factor activity. Protein
phosphorylation also impinges upon most of the signal transduction pathways. Therefore
protein phosphorylation provides a link between signal transduction and gene expression
(Karin, 1994; Bohmann, 1990; Litchfield, 2003). Phosphorylation or dephosphorylation
of transcription factors and/or other related proteins either positively or negatively

regulate their activity to control gene expression.

2.3.1. CK2 phosphorylation controls transcription at different levels

2.3.1.1. Several mechanisms have been proposed for a role of CK2

phosphorylation of transcription factors in gene regulation.

(a) Phosphorylation by CK2 influences transcription factor subcellular
localization. For example, the nuclear import of SV40 large T antigen is enhanced by
CK2 phosphorylation at serine 112 (Xiao et al., 1998); while phosphorylation of muscle-
specific transcription factor Myf-S at serine 49 by CK2 reduces its nuclear localization
(Winter et al., 1997). In contrast, CK2 phosphorylation of NFATc (nuclear factor of

activated T cells) promotes NFATc nuclear export (Porter et al., 2000).

(b) Phosphorylation of transcription factors by CK2 governs their DNA-binding
activities both positively and negatively. For example, CK2 phosphorylation of the

myocyte enhancer factor-2C (MEF2C) at serine 59 enhances the DNA binding and

26

transcriptional activity of MEF2C (Molkentin et al., 1996). Heat shock factor-l (HSF 1)
phosphorylation by CK2 at threonine 142 promotes it binding to heat shock elements and
trans-activation of the HSP70 gene (Soncin et al., 2003). In addition, the high-mobility
group domain protein SSRPl (structure-specific recognition protein 1), which plays a
role in transcription and DNA replication in the chromatin context, is targeted by CK2.
SSRPl phosphorylation at serine 510 by CK2 prevents the nonspecific DNA-binding
activity of SSRPl and FACT (facilitating chromatin-mediated transcription) complex (Li
et al., 2005). CK2 phosphorylation of the c-Myb nuclear oncoprotein at serines 11 and 12

results in reduced DNA binding (Liischer et al., 1990).

(c) CK2 phosphorylation can modulate protein-protein interaction. CK2
phosphorylation of TFIIF-associated CTD phosphatase (FCPl) enhances the interaction
between TFIIF subunit RAP74 and FCPl (Abbott et al., 2005). The trans-activation
properties of some transcription factors are also regulated by CK2-mediated
phosphorylation through influencing the recruitment of coregulators and/or RNA
polymerase to the promoter. For instance, CK2 also targets the N-terminal transcriptional
activation domain of CHOP/GADD153 (C/EBP homologous protein transcription
factor/growth arrest and DNA damage inducible protein) for phosphorylation and
downregulates its transcription activity (Ubeda and Habener, 2003). Normally, the zinc-
finger transcription factor CTCF (CCCTC-binding factor) acts as a transcriptional
repressor, but CK2 phosphorylation at serine 612 switches CTCF to an activator (El-
Kady and Klenova, 2005). Phosphorylation by CK2 on threonine 142 of HSFl promotes

trans-activation of the HSP70 gene (Soncin et al., 2003). However, CK2 phosphorylation

27

at the C-terrninal serine 386 of p53 is critical for p53-dependent repression (Hall et al.,

1 996).

(e) CK2 phosphorylation is also important for regulating the level of a
transcription factor by either stabilizing it or marking it for destruction. For example,
CK2 phosphorylation of Max at serine ll protects Max from caspase-5 mediated
degradation (Krippner-Heidenreich et al., 2001). Ubiquitin-directed proteasomal
degradation of the c-Myc oncoprotein is protected by CK2 phosphorylation in its C-
terminal proline-glutamic acid-serine-threonine (PEST) domain (Channavajhala and
Seldin, 2002). In contrast, CK2 phosphorylation of IKBG. at serine 283 and threonines 291
and 299 in its C-terrninal PEST domain accelerates its degradation, which is important
for NFKB nuclear translocation and transcription activation (Lin et al., 1996; McElhinny

et al., 1996).

2.3.1.2. CK2 in chromatin remodeling processes

Evidence for CK2 function in chromatin remodeling processes is increasing.
Firstly, histone cytoplasmic-nuclear translocation is influenced by CK2 phosphorylation.
CK2 targets a histone chaperone protein called nucleosome assembly protein 2 (NAP-2)
for phosphorylation and prevents histones/NAP-Z complex transport from the cytoplasm
into the nucleus (Rodriguez et al., 2000). Secondly, chromatin associations and/or
chromatin-related protein-protein interactions are affected by CK2-mediated

phosphorylation. For example, a chromatin-associated phosphotyrosine phosphatase

28

PTP-SZ phosphorylation by CK2 results in its dissociation from chromatin (Nambirajan
et al., 2000). DNA binding activity of the human chromatin protein DEK is also
downregulated by CK2 phosphorylation (Kappes et al., 2004). Histone deacetylases
(HDAC) 1 and HDACZ phosphorylation by CK2 increases its binding affinity to
interacting partners, including the Rb-associated protein (RbAp48), MTA-2
(multithreaded architecture), mSin3A, and CoREST (a corepressor for the repressor
element 1 silencing transcription factor) (Pflum et al., 2001; Tsai and Seto, 2002; Sun et
al., 2002). In addition, HDACI phosphorylation at serine 421 and 423 by CK2 promotes
its enzymatic activity (Pflum et al., 2001), which is proposed to alter the balance of
histone (dc-)acetylation of its target genes. Furthermore, several high mobility group
nonhistone chromosomal proteins (HMGs) and the heterochromatin-associated protein 1
(HPl) are phosphorylated by CK2, which then affect their DNA binding and their
interaction with specific transcription factors (Wisniewski et al., 1999; Zhao et al., 2001;
Krohn et al., 2002). Thirdly, CK2 function in chromatin remodeling processes is fiirther
supported by the observation that the level of CK2 is higher in the active than in inactive
nucleosomes from normal prostate (Guo et al., 1998), and that CK2 co-localizes with
productively transcribing RNA pol II on polytene chromosomes of Chironomus salivary
gland cells (Egyhazi et al., 1999). CK2 can be recruited to the promoter by either
complexing with histones and general chromatin remodeling factors (Gavin et al., 2002;
Ho et al., 2002; Krogan et al., 2002), or interacting with other transcription factors such
as ATFl, CREB, c-Fos or c-Jun through the basic leucine-zipper domains (Yamaguchi et

al., 1998). Thus, CK2 may participate in promoting the conformational transition of

29

inactive nucleosomes to the active form and/or in the function of transcriptionally active

nucleosomes.

2.3.2. The role of CK2 in protein-coding gene expression

Numerous lines of evidence have established that CK2 plays an important role in
regulating protein-coding gene transcription by RNA pol II. A comparative genome-wide
expression analysis of Saccharomyces cerevisiae CK2 deletion strains and corresponding
wild types were performed by Barz and coworkers (2003). Their studies showed that of
roughly 900 gene products proposed to be involved in cell cycle regulation, the
expression of 283 protein-coding genes depend on or are affected by CK2 (Barz et al.
2003). CK2 not only phosphorylates a large number of transcription factors or effectors
of DNA/RNA structure or translational elements (Meggio and Pinna, 2003), which are
important for regulating protein-coding gene expression, but also directly targets the
basal transcriptional machinery. For example, CK2 phosphorylates two subunits of RNA
pol 11 [214,000 and 20,500 Daltons (Da)], and these modifications are required for
transcriptional activity (Dahmus, 1981). The general transcription factors TFIIA, TFIIE,
and TFIIF are also phosphorylated by CK2. Pre-initiation complex (PIC) formation on
the Ad-MLP promoter was stimulated by CK2 phosphorylation of TFIIA, TFIIF, and
RNA pol 11. However, the mRNA synthesis was dramatically inhibited by CK2
phosphorylation of RNA pol II (Cabrejos et al., 2004). One possibility is that CK2
phosphorylation of RNA pol 11 increases the formation of a PIC but inhibits RNA pol [1
recycling. Indeed, CK2 also fimctions to recruit a CTD-specific phosphatase FCPl to the

transcriptional machinery to facilitate RNA pol II recycling. CK2 phosphorylation of

30

F CPI stimulates its phosphatase activity and enhances the interaction between TFIIF
subunit RAP74 and PCP] (Egyhazi et al., 1999; Abbott et al., 2005). CK2 has been
shown to associate with the RNA pol II elongation complex (Krogan et al., 2002). Also, a
study with TATA-less DPE (downstream promoter element)-dependent transcription
indicates that CK2 along with the coactivator PC4 is required for DPE-specific
transcription (Lewis et al., 2005). Moreover, activation of pre-mRNA splicing by human
RNPS] (RNA-binding protein prevalent during S phase) is regulated by CK2
phosphorylation (Trembley et al., 2005). Taken together, these data strongly suggest that

CK2 plays a role in regulating protein coding gene expression.

2.3.3. The role of CK2 in non-coding gene transcription

Non-coding RNAs trancribed by RNA polymerases I, II, and III play important
catalytic and structural roles in the RNA processing and protein synthesis. Research from
numerous labs shows that CK2 is involved in controlling transcription of non-coding
genes, such as RNA pol I-specific rRNA (Saez-Vasquez et al., 2001), RNA pol III-
specific tRNA and SS rRNA (Hockman and Schultz, 1996; Ghavidel et al., 1999;
Johnston et al., 2002), and RNA pol III-specific U6 snRNA (Hu et al., 2003; Hu et al.,
2004)

RNA pol l holoenzyme is a multi-subunit complex with at least 2MD in mass and
is composed of 30 or more polypeptides (Seither et al., 1998; Albert et al., 1999; Hannan
etal.,1999). RNA pol I transcribes the tandemly repeated genes that encode the precursor
of 188, 5.68 and 28S rRNAs. Initially, transcription factor UBF (Upstream Binding

Factor) binds to upstream promoter element (UPE), and SLI/T IF -IB (promoter selectivity

31

factor or transcription initiation factor IB) recognizes the core promoter element (CPE).
SL-l and UBF function cooperatively in the formation of the initiation complex which
then facilitates RNA pol I transcription. It has been reported that CK2 copurifies with
epitope-tagged RNA pol 1 from mammalian cells (Harman et al., 1998). Also, the CK2
activity associates stably with the rRNA promoter in plants (Saez-Vasquez et al., 2001).
CK2 targets the key DNA-binding transcription factor UBF in the C-terrninal hyperacidic
tail, which is essential for transactivation (O’Mahony et al., 1992; Voit et al., 1992; Voit
etaL,l995)

CK2 is also involved in RNA pol III transcription of tRNA and SS rRNA
(Hockman and Schultz, 1996; Ghavidel et al., 1999; Johnston et al., 2002). The general
transcriptipn factors TF 111A, Brfl -specific TFIIIB, and TFIIIC are required for tRNA and
5S rRNA gene transcription by RNA pol 111. It has been reported that endogenous human
CK2 associates stably with TFIIIB and phosphorylates the BRF component of Brfl-
specific TFIIIB (Johnston et al., 2002). CK2 can also target the TBP subunit of Brfl-
specific TFIIIB for phosphorylation (Ghavidel and Schultz, 1997; Ghavidel et al., 1999;
Ghavidel and Schultz, 2001). Furthermore, recent studies showed that RNA pol III-
specific U6 snRNA gene transcription is also regulated by CK2 (Hu et al., 2003, Hu et al.,
2004). CK2 occupies U6 snRNA gene promoters, and CK2 phosphorylation of the RNA
pol III holoenzyme stimulates U6 transcription (Hu et al., 2003). CK2 also targets the
de1 component of Ber-specific TFIIIB complex during mitosis. Phosphorylated del,
in turn, disassociates from the U6 promoter, and thus downregulating U6 transcription in

a cell cycle dependent fashion (Hu et al., 2004). Taken together, these data strongly

32

suggest that CK2 plays an important role in regulating non-coding gene transcription by

RNA pol I and pol 111.

As mentioned previously, some non-coding snRNA genes are transcribed by
RNA pol 11. Whether CK2 plays a role in regulating RNA pol II-specific snRNA gene
transcription is unknown. Because CK2 appears to globally regulate non-coding gene
transcription and human U1 and U6 snRNA genes share similar promoter elements and
their gene products have related functions, it is reasonable to hypothesize that CK2 also
regulates U1 snRNA gene transcription by RNA pol 11. Thus, the major focus of this

thesis has been to investigate the role of CK2 in U1 snRNA gene transcription.

3. Main hypothesis and experimental design

The main objective of this doctoral thesis research is to explore the role of CK2
for snRNA gene transcription and to investigate the mechanism of CK2 regulation. To
directly test this idea, CK2 promoter occupancy was detected by a chromatin
immunoprecipitation (ChIP) assay. Nascent U1 snRNA transcripts in Hela cells were
monitored by reverse transcriptase polymerase chain reaction (RT-PCR) following
endogenous CK2 depletion by RNAi. U1 snRNA gene transcription in the presence of
CK2 and/or CK2 inhibitors was employed in vitro to understand the mechanism of CK2
regulation. The general transcription factor SNAPC was identified as a potential CK2
target by an in vitro kinase assay and mass spectrometry (MS). The ability of SNAPc to
bind DNA and to recruit TBP in the presence of CK2 was tested using an electrophoretic

mobility shift assay (EMSA).

33

In the current studies, we demonstrated that CK2 downregulates U1 snRNA gene
transcription by RNA pol II. Decreased levels of endogenous CK2 correlates with
increased U1 expression while CK2 associates with U1 gene promoters, indicating that it
plays a direct role in U1 gene regulation. CK2 phosphorylates the general transcription
factor SNAPc that is required for both RNA pol II and III transcription. SNAPC
phosphorylation by CK2 inhibits binding to snRNA gene promoters. However, restricted
promoter access by phosphorylated SNAPC can be overcome by cooperative interactions
with TBP at the U6 promoter but not at a U1 promoter. We have further determined that
within SNAP190, CK2 phosphorylates the N-terminal half of SNAP190 at two regions
that contain multiple consensus CK2 sites (amino acid 20-63 and 518-557) by mass
spectrometric analysis. To test whether these regions are important for SNAPC function,
partial SNAPC complexes containing full length SNAP43, full length SNAPSO, and
various truncated SNAP190 molecules [SNAP190 (1-719), SNAP190 (63-719),
SNAP190 (1-505), or SNAP190 (63-505)] were co-expressed and tested for DNA
binding and function in transcription. All four complexes maintain normal DNA binding
activity in electrophoretic mobility shifi assays. Furthermore, these complexes all support
U1 and U6 snRNA gene transcription using SNAPC depleted HeLa nuclear extracts in
vitro, indicating that these regions are not essential for SNAPC activity. However, the
SNAP190 (1-719)-containing SNAPC complex shows less DNA binding and
transcription activity upon CK2 treatment, while the SNAP190 (1-505)-containing
SNAPC complex shows no change under this condition. Thus, SNAP190 phosphorylation

by CK2 plays a negative regulatory role on SNAPC function.

34

References

Abbott, K.L, Renfrow, M.B., Chalmers, M.J., Nguyen, B.D., Marshall, A.G., Legault, P.,
Omichinski, J.G. (2005). Enhanced binding of RNAP ll CTD phosphatase F CPI to
RAP74 following CK2 phosphorylation. Biochemistry 44, 2732-2745.

Abramczyk, 0., lion, P., Zielinski, R., Pilecki, M., Hellman, U., Szyszka, R. (2003). The
protein kinase 60S is a free catalytic CK2alpha' subunit and forms an inactive complex

with superoxide dismutase SODl. Biochem Biophys Res Commun 307, 31-40.

Ackerman, P., and Osheroff, N. (1989). Regulation of casein kinase II activity by

epidermal growth factor in human A-431 carcinoma cells. J Biol Chem 264, 11958-11965.

Ackerman, P., Glover, C. V., and Osheroff, N. (1990). Stimulation of Casein Kinase II by
Epidermal Growth Factor, Relationship Between the Physiological Activity of the
Kinase and the Phosphorylation State of its [3 Subunit. Proc Natl Acad Sci U S A 87, 821-
825.

Ahmed, K., Gerber, D.A., and Cochet, C. (2002). Joining the cell survival squad, An
emerging role for protein kinase CK2. Trends in Cell Biology 12, 226-230.

Albet, A.C., Denton, M., Kermekchiev, M., Pikaard, CS. (1999). Histone
acetyltransferase and protein kinase activities copurify with a putative Xenopus RNA
polymerase I holoenzyme self-sufficient for promoter-dependent transcription. Mol Cell
Biol 19, 796-806.

Allende, J.B., Allende, CC. (1995). Protein kinases. 4. Protein kinase CK2, an enzyme
with multiple substrates and a puzzling regulation. F ASEB J 9, 313-23.

Appel, K., Wagner, P., Boldyreff, B., Issinger, O.G. and Montenarh, M. (1995). Mapping
of the interaction sites of the growth suppressor protein p53 with the regulatory beta-
subunit of protein kinase CK2. Oncogene 11, 1971 1978.

Ares, M. Jr., Chung, J.S., Giglio, L., Weiner, A.M. (1987). Distinct factors with Spl and
NF-A specificities bind to adjacent functional elements of the human U2 snRNA gene
enhancer. Genes Dev 8, 808-817.

Bai, L., Wang, Z., Yoon, J.B., Roeder, RC. (1996). Cloning and characterization of the
beta subunit of human proximal sequence element-binding transcription factor and its

involvement in transcription of small nuclear RNA genes by RNA polymerases II and 111.
Mol Cell Biol 16, 5419-5426.

Bartkiewicz, M., Gold, H. A., and Altman, S. (1989). Identification and characterization

of an RNA molecule that copurifies with RNase P activity from HeLa cells. Genes Dev 3,
489-499.

35

Barz, T., Ackermann, K., Dubois, G., Eils, R., Pyerin, W. (2003). Genome-wide
expression screens indicate a global role for protein kinase CK2 in chromatin remodeling.
J Cell Sci 116, 1563-1577.

Bibby, A.C., Litchfield, D.W. (2005). The Multiple Personalities of the Regulatory
Subunit of Protein Kinase CK2, CK2 Dependent and CK2 Independent Roles Reveal a
Secret Identity for CK2beta. Int J Biol Sci 1, 67-79.

Bidwai, A. P., Reed, J. C., Glover, C. V.C. (1995). Cloning and Disruption of CKBI, the
Gene Encoding the 38-kDa B Subunit of Saccharomyces cerevisiae Casein Kinase II
(CKII). Deletion of CKII Regulatory Subunits Elicits a Salt-Sensitive Phenotype. J Biol
Chem 270, 10395-10404

Bjorling-Poulsen, M., Siehler, S., Wiesmuller, L., Meek, D., Niefind, K., Issinger, O.G.
(2005). The 'regulatory' beta-subunit of protein kinase CK2 negatively influences p53-
mediated allosteric effects on Chk2 activation. Oncogene 2005 May 23, [Epub ahead of
print]

Blaydes, J.P., HUpp, TR. (1998). DNA damage triggers DRB-resistant phosphorylation
of human p53 at the CK2 site. Oncogene 17, 1045 1052.

Bohana-Kashtan, O., Pinna, L.A., Fishelson, Z. (2005). Extracellular phosphorylation of
C9 by protein kinase CK2 regulates complement-mediated lysis. Eur J Immunol 35,
1939-1948.

Bohmann, D. (1990). Transcription factor phosphorylation, a link between signal
transduction and the regulation of gene expression. Cancer Cells 2, 337 344.

Boldyreff, B., Issinger, O.G. (1997). A-Raf kinase is a new interacting partner of protein
kinase CK2 beta subunit. F EBS Lett 403, 197-199.

Boldyreff, B., Mietens, U., Issinger, O.G. (1996). Structure of protein kinase CK2,
dimerization of the human beta-subunit. FEBS Lett 379, 153 156.

Bonnet, H., F ilhol, O., Truchet, 1., Brethenou, P., Cochet, C., Amalric, F. and Bouche, G.
(1996). Fibroblast growth factor-2 binds to the regulatory beta subunit of CK2 and
directly stimulates CK2 activity toward nucleolin. J Biol Chem 271, 24781 24787.

Brenneisen, P., Wlaschek, M., Schwambom, E., Schneider, L.A., Ma, W., Sies, H.,
Scharffetter-Kochanek, K. (2002). Activation of protein kinase CK2 is an early step in
the ultraviolet B-mediated increase in interstitial collagenase (matrix metalloproteinase-l ,
MMP-1) and stromelysin-l (MMP-3) protein levels in human dermal fibroblasts.
Biochem 365, 31 40.

36

Bronner, C., Trotzier, M.A., Filhol, O., Cochet, C., Rochette-Egly, C., Scholler-Guinard,
M., Klein, J.P., Mousli, M. (2004). The antiapoptotic protein ICBP90 is a target for
protein kinase 2. Ann N Y Acad Sci 1030, 355-60.

Burge, C.B., Tuschl, T., Sharp, RA. (1999). Splicing of precursors to mRNAs by the
spliceosomes. In, RF Gesteland, TR Cech and JF Atkins, eds, The RNA World (2nd
Edition ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1999), pp. 525
560.

Burnett, G., Kennedy, ER (1954). The enzymatic phosphorylation of proteins. J Biol
Chem 211, 969-980.

Cabart, P., Murphy, S. (2001). BRFU, a TFIIB-like Factor, Is Directly Recruited to the
TATA-box of Polymerase 111 Small Nuclear RNA Gene Promoters through Its
Interaction with TATA-binding Protein. J Biol Chem 276, 43056-43064.

Cabrejos, M. E., Allende, C. C, Maldonado, E. (2004). Effects of phosphorylation by
protein kinase CK2 on the human basal components of the RNA polymerase II
transcription machinery. J Cell Biochem 93, 2-10.

Caceres, J.F., McKenzie, D., Thimmapaya, R., Lund, E., Dahlberg, J.E. (1992). Control
of mouse Ula and Ulb snRNA gene expression by differential transcription. Nucleic
Acids Res 20, 4247-4254.

Canton, D.A., Zhang, C., Litchfieldi, D.W. (2001). Assembly of protein kinase CK2,
investigation of complex formation between catalytic and regulatory subunits using a
zinc-finger-deficient mutant of CKZB. Biochem J 358, 87-94.

Channavajhala, P., Seldin, D. C. (2002). Functional interaction of protein kinase CK2 and
c-Myc in lymphomagenesis. Oncogene 21, 5280 5288.

Chantalat, L., Leroy, D., Filhol, O., Nueda, A., Benitez, M.J., Chambaz, E.M., Cochet, C.,
Dideberg, O. (1999). Crystal structure of the human protein kinase CK2 regulatory
subunit reveals its zinc finger-mediated dimerization. EMBO J 18, 2930 2940.

Chen, R., Yang, Z., Zhou, Q. (2004). Phosphorylated positive transcription elongation
factor b (P-TEFb) is tagged for inhibition through association with 78K snRNA. J Biol
Chem 279, 4153-4160.

Cheng, Y., Lund, E., Kahan, B.W., Dahlberg, J.E. (1997). Control of mouse U1 snRNA
gene expression during in vitro differentiation of mouse embryonic stem cells. Nucleic
Acids Res 25, 2197-54204.

Cheung, W.L., Turner, F.B., Krishnamoorthy, T., Wolner, B., Ahn, S.H., Foley, M.,
Dorsey, J.A., Peterson, C.L., Berger, S.L., Allis, CD. (2005). Phosphorylation of histone

37

H4 serine 1 during DNA damage requires casein kinase II in S. cerevisiae. Curr Biol 15,
656-60.

Collinge, M.A., Walker, JC. (1994). Isolation of an Arabidopsis thaliana casein kinase 11
beta subunit by complementation in Saccharomyces cerevisiae. Plant Mol Biol 25, 649-
658.

Dahmus, ME. (1981). Purification and Properties of Calf Thymus Casein Kinases I and
II. J Biol Chem 256, 3332-3339.

Damania, B., Mital R, Alwine JC. (1998). Simian virus 40 large T antigen interacts with
human TFIIB-related factor and small nuclear RNA-activating protein complex for
transcriptional activation of TATA-containing polymerase III promoters. Mol Cell Biol
18,1331-1338.

Davies, S.P., Reddy, H., Caivano, M., Cohen, P. (2000). Specificity and mechanism of
action of some commonly used protein kinase inhibitors. Biochem J 351, 95-105.

Desagher, S., Osen-Sand, A., Montessuit, S., Magnenat, E., Vilbois, F ., Hochmann, A.,
Joumot, L., Antonsson, B., Martinou, JC. (2001). Phosphorylation of bid by casein
kinases I and II regulates its cleavage by caspase 8. Mol Cell 8, 601 611.

Diana, C. B., Pombo, A., Murphy, S. (2003). Interaction of proteins with promoter
elements of the human U2 snRNA genes in vivo. Gene 315, 103-112.

Diaz-Nido, J ., Mizuno, K., Nawa, H., Marshak, DR. (1994). Regulation of protein kinase
CK2 isoforrn expression during rat brain development. Cell Mol Biol Res 40, 581-585.

Egyhazi, E., Ossoinak, A., F ilhol-Cochet, O., Cochet, C., Pigon, A. (1999). The binding
of the alpha subunit of protein kinase CK2 and RAP74 subunit of TFIIF to protein-coding
genes in living cells is DRB sensitive. Mol Cell Biochem 191, 149-59.

El-Kady, A., Klenova, E. (2005). Regulation of the transcription factor, CTCF, by
phosphorylation with protein kinase CK2. F EBS Lett 579, 1424-34.

Escalier, D., Silvius, D., Xu, X. (2003). Sperrnatogenesis of mice lacking CKZalpha',
failure of germ cell survival and characteristic modifications of the sperrnatid nucleus.
Mol Reprod Dev 66, 190-201.

Fatica, A., Tollervey, D. (2002). Making ribosomes, Curr Opin Cell Biol 14, 313 318.

Faust, M., Montenarh, M. (2000). Subcellular localization of protein kinase CK2, A key
to its function. Cell Tissue Res 301, 329-340.

38

Faust, R.A., Niehans, G., Gapany, M., Hoistad, D., Knapp D., Cherwitz, D., Davis, A.,
Adams, G.L., Ahmed, K. (1999). Subcellular immunolocalization of protein kinase CK2
in normal and carcinoma cells. Int J Biochem Cell Biol 31, 941 949.

Filhol, O., Baudier, J., Delphin, C., Loue-Mackenbach, P., Chambaz, E. and Cochet, C.
(1992). Casein kinase II and the tumor suppressor protein p53 associate in a molecular
complex that is negatively regulated upon p53 phosphorylation. J Biol Chem 267, 20577
20583.

Ford, E., Strubin, M., Hernandez, N. (1998). The Oct-1 POU domain activates snRNA
gene transcription by contacting a region in the SNAPC largest subunit that bears
sequence similarities to the Oct-l coactivator OBF -1. Genes Dev 12, 3528-3540.

Fritz, G., Kaina, B. (1999). Phosphorylation of the DNA repair protein APE/REF-l by
CKII affects redox regulation of AP-l. Oncogene 18, 1033 1040.

Gavin, A. C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J.,
Rick, 1. M., Michon, A. M. et al. (2002). Functional organization of the yeast proteome
by systematic analysis of protein complexes. Nature 415,141-147.

Gerber, D.A., Souquere-Besse, S., Puvion, F ., Dubois, M.F., Bensaude, O., Cochet, C.
(2000). Heat-induced relocalization of protein kinase CK2. Implication of CK2 in the
context of cellular stress. J Biol Chem 275, 23919 23926.

Ghavidel, A., Hockman, D.J., Schultz, MC. (1999). A review of progress towards
elucidating the role of protein kinase CK2 in pol III transcription, regulation of the TATA
binding protein. Mol Cell Biochem 191, 143-148.

Ghavidel, A., Schultz, MC. (1997). Casein kinase II regulation of yeast TFIIIB is
mediated by the TATA-binding protein. Genes Dev 11, 2780-2789.

Ghavidel, A., Schultz, M. C. (2001). TATA binding protein-associated CK2 transduces
DNA damage signals to the RNA polymerase III transcriptional machinery. Cell 106,
575-584.

Gietz, R.D., Graham, K.C., Litchfield, D.W. (1995). Interactions between the subunits of
casein kinase II. J Biol Chem 270, 13017 13021.

Glibetic, M., Larson, D.E., Sienna, N., Bachellerie, J.P., Sells, B.H. (1992). Regulation of
U3 snRNA expression during myoblast differentiation. Exp Cell Res 202, 183-189.

Gdtz, C., Scholtes, P., Prowald, A., Schuster, N., Nastainczyk,W., Montenarh, M. (1999).

Protein kinase CK2 interacts with a multi-protein binding domain of p53. Mol Cell
Biochem 191, 111-120.

39

Gdtz, C., Wagner, P., Issinger, O.G., Montenarh, M. (1996). p21WAF1/CIP1 interacts
with protein kinase CK2. Oncogene. 13, 391-398.

Graham, K.C., Litchfield, D.W. (2000). The regulatory beta subunit of protein kinase
CK2 mediates formation of tetrameric CK2 complexes. J Biol Chem 275, 5003 5010.

Grandi, P., Rybin, V., Bassler, J., Petfalski, E., Strauss, D. Marzioch, M., Schafer, T.,
Kuster, B., Tschochner, H., Tollervey, D., et al. (2002). 908 pre-ribosomes include the
358 pre-rRNA, the U3 snoRNP, and 408 subunit processing factors but predominantly
lack 6OS synthesis factors, Mol Cell 10, 105 115.

Gridasova, A.A., Henry, R.W. (2005). The p53 Tumor Suppressor Protein Represses
Human snRNA Gene Transcription by RNA Polymerases II and III Independently of
Sequence-Specific DNA Binding. Mol Cell Biol 25, 3247-3260.

Guerra, B., Issinger, O.G. (1999). Protein kinase CK2 and its role in cellular proliferation,
development and pathology. Electrophoresis. 20, 391-408.

Guerra, B., Siemer, S., Boldyreff, B., Issinger, O.G. (1999). Protein kinase CK2,
evidence for a protein kinase CKZB subunit fraction, devoid of the catalytic CK2a
subunit, in mouse brain and testicles. FEBS Lett 462, 353-357.

Guo, C., Davis, A.T., Yu, S., Tawfic, S., Ahmed, K. (1999). Role of protein kinase CK2
in phosphorylation nucleosomal proteins in relation to transcriptional activity. Mol Cell
Biochem. 191, 135-142.

Guo, C., Yu, S., Davis, A.T., Wang, H., Green, J.E. Ahmed, K. (2001). A potential role
of nuclear matrix-associated protein kinase CK2 in protection against drug-induced
apoptosis in cancer. cells. J Biol Chem 276, 5992-5999.

Guo, C., Davis, A. T., Ahmed, K. (1998). Dynamics of protein kinase CK2 association
with nucleosomes in relation to transcriptional activity. J Biol Chem 273, 13675-13680.

Hagemann, C., Kalmes, A., Wixler, V., Wixler, L., Schuster, T., Rapp, U.R. (1997). The
regulatory subunit of protein kinase CK2 is a specific A-Raf activator. F EBS Lett 403,
200-202.

Hall, S.R., Campbell, L.E., Meek, D.W. (1996). Phosphorylation of p53 at the casein
kinase 11 site selectively regulates p53-dependent transcriptional repression but not
transactivation. Nucleic Acids Res 24, 1119-26

Han, M.H., Han, D.K., Aebersold, R.H., Glomset, J.A. (2001). Effects of protein kinase

CK2, extracellular signal-regulated kinase 2, and protein phosphatase 2A on a
phosphatidic acid-preferring phospholipase A1. J Biol Chem 276, 27698 27708.

40

Hanna, D.E., Rethinaswamy, A., Glover, C.V.C. (1995). Casein kinase II is required for
cell cycle progression during G, and Gle in Saccharomyces cerevisiae. J Biol Chem
270, 25905-25914.

Harman, R.D., Cavanaugh, A., Hempel, W.M., Moss, T., Rothblum, L. (1999).
Identification of a mammalian RNA polymerase I holoenzyme containing components of
the DNA repair/replication system. Nucleic Acids Res 27, 3720-3727.

Hannan, R.D., Hempel, W.M., Cavanaugh, A., Arino, T., Dimitrov, 8.1., Moss, T.,
Rothblum, L. (1998). Affinity purification of mammalian RNA polymerase 1.
Identification of an associated kinase. J Biol Chem 273, 1257-1267.

Hathaway, G.M., Traugh, J .A. (1983). Casein kinase 11. Methods Enzymol. 99, 317-31.

Hehn, E.M., Young, A.V., Pelech, S.L., Sanghera, J.S., Shah, R.M.(1997).
Developmental alterations in casein kinase 2 activity during the morphogenesis of quail
secondary palate. Anat Rec 247, 102-108.

Henry, R.W., Ford, E., Mital, R., Mittal, V., Hernandez, N. (1998a). Crossing the line
between RNA polymerases, transcription of human snRNA genes by RNA polymerases
II and 111. Cold Spring Harb Symp Quant Biol 63, 1 1 1-120.

Henry, R.W., Ma, 8., Kobayashi, R., Hernandez, N. (1998b). SNAP19 mediates the
assembly of a functional core promoter complex (SNAPC) shared by RNA polymerases II
and III. Genes Dev 12, 2664-2672.

Henry, R.W., Mittal, V., Ma, 3., Sadowski, C.L., Kobayashi, R., Hernandez, N. (1996).
Cloning and characterization of SNAPSO, a subunit of the snRNA-activating protein
complex SNAPC. EMBO J 15, 7129-7136.

Henry, R.W., Sadowski, C.L., Kobayashi, R., Hernandez, N. (1995). A TBP-TAF
complex required for transcription of human snRNA genes by RNA polymerases II and
111. Nature 374, 653-657.

Hernandez, N., Lucito, R. (1988). Elements required for transcription initiation of the
human U2 snRNA gene coincide with elements required for snRNA 3' end formation.
EMBO J 7, 3125-3134.

Hernandez, N. (2001). Small nuclear RNA genes, a model system to study fundamental
mechanisms of transcription. J Biol Chem 276, 26733-26736.

Hilgard, P., Czaja, M.J., Gerken, G., Stockert, RJ. (2004). Proapoptotic function of

protein kinase CK2alpha" is mediated by a JNK signaling cascade. Am J Physiol
Gastrointest Liver Physiol 287, G] 92-201.

41

Hilgard, P., Huang, T., Wolkoff, A.W., Stockert, R,J. (2002). Translated Alu sequence
determines nuclear localization of a novel catalytic subunit of casein kinase 2. Am J
Physiol Cell Physiol 283, 472 483.

Hinkley, C.S., Hirsch, H.A., Gu, L., LaMere, 8., Henry, R.W. (2003). The Small Nuclear
RNA-activating Protein 190 Myb DNA Binding Domain Stimulates TATA Box-binding
Protein-TATA Box Recognition. J Biol Chem 278, 18649-18657.

Hirsch, H.A., Gu, L., Henry, R.W. (2000). The retinoblastoma tumor suppressorprotein
targets distinct general transcription factors to regulate RNA polymerase III gene
expression. Mol Cell Biol 20, 9182-9191.

Hirsch, H.A., Jawdekar, G.W., Lee, K.A., Gu, L., Henry, R.W. (2004). Distinct
mechanisms for repression of RNA polymerase III transcription by the retinoblastoma
tumor suppressor protein. Mol Cell Biol 24, 5989-5999.

Ho, Y., Gruhler, A., Heilbut, A., Bader, G. D., Moore, L., Adams, S. L., Millar, A.,
Taylor, P., Bennett, K. et a1. (2002). Systematic identification of protein complexes in
Saccharomyces cerevisiae by mass spectrometry. Nature 415,180-183.

Hockman, D.J., Schultz, M.C. (1996). Casein kinase II is required for efficient
transcription by RNA polymerase 111. Mol Cell Biol 16, 892-898.

Hoffman, R.W., Gazitt, T., Foecking, M.F., Ortmann, R.A., Misfeldt, M., Jorgenson, R.,
Young, S.L., Greidinger, EL. (2004). U1 RNA induces innate immunity signaling.
Arthritis Rheum 50, 2891-2896.

Hovde, S., Hinkley, C.S., Strong, K., Brooks, A., Gu, L., Henry, R.W., Geiger, J. (2002).
Activator recruitment by the general transcription machinery, X-ray structural analysis of
the Oct-l POU domain/human U1 octamer/SNAP190 peptide ternary complex. Genes
Dev 16, 2772-2777.

Hu, P., Samudre, K., Wu, S., Sun, Y., Hemandez, N. (2004). CK2 phosphorylation of
del executes cell cycle-specific RNA polymerase III transcription repression. Mol Cell
16, 81-92.

Hu, P., Wu, 8., Hernandez, N. (2003). A minimal RNA polymerase III transcription
system from human cells reveals positive and negative regulatory roles for CK2. Mol
Cell 12, 699-709.

Hu, P., Wu, 8., Hernandez, N. (2004). A role for beta-actin in RNA polymerase III
transcription. Genes Dev 18, 3010-3015.

Issinger, O.G. (1993). Casein kinases, pleiotropic mediators of cellular regulation.
Pharrnacol Ther 59, 1-30.

42

Jakobi, R., Voss,H., Pyerin,W.(1989). Human phosvitin/casein kinase type 11. Molecular
cloning and sequencing of full-length cDNA encoding subunit beta. Eur J Biochem 183,
227-233.

Johnston, I.M., Allison, S.J., Morton, J.P., Schramm, L., Scott, P.H., White, RJ. (2002).
CK2 forms a stable complex with TFIIIB and activates RNA polymerase III transcription
in human cells. Mol Cell Biol 22, 3757-3768.

Kappes, F ., Damoc, C., Knippers, R., Przybylski, M., Pinna, L.A., Gruss, C. (2004).
Phosphorylation by protein kinase CK2 changes the DNA binding properties of the
human chromatin protein DEK. Mol Cell Biol 24, 6011-6020.

Karin, M. (1994). Signal transduction from the cell surface to the nucleus through the
phosphorylation of transcription factors. Curr Opin Cell Biol 6, 415 424.

Kassavetis, G.A., Joazeiro, C.A., Pisano, M., Geiduschek, E.P., Colbert, T., Hahn, S.,
Blanco, J .A. (1992). The role of the TATA-binding protein in the assembly and function
of the multisubunit yeast RNA polymerase III transcription factor, TFIIIB. Cell 71, 1055-
1064.

Keller, D. M., Zeng, X., Wang, Y., Zhang, Q. H., Kapoor, M.,. Shu, H., Goodman, R.,
Lozano, G., Zhao, Y., Lu, H. (2001). A DNA damage-induced p53 serine 392 kinase
complex contains CK2, hSpt16, and SSRPl. Mol Cell 7, 283-292.

Klarlund, J. K., Czech, M. P. (1988). Insulin-like grth factor I and insulin rapidly
increase casein kinase II activity in BALB/c 3T3 fibroblasts. J Biol Chem 263, 15872-
15875

Kom, 1., Gutkind, S., Srinivasan, N., Blundell, T.L., Allende, C.C., Allende, J.E. (1999).
Interactions of protein kinase CK2 subunits. Mol Cell Biochem 191, 75-83.

Krippner-Heidenreich, A., Talanian, R.V., Sekul, R., Kraft, R., Thole, H., Ottleben, H.,
Lilscher, B. (2001). Targeting of the transcription factor Max during apoptosis,

phosphorylation-regulated cleavage by caspase-5 at an unusual glutamic acid residue in
position P1. Biochem J 358, 705-715.

Krogan, N. J., Kim, M., Ahn, S. H., Zhong, G., Kobor, M. S., Cagney, G., Emili, A.,
Shilatifard, A., Buratowski, S., Greenblatt, J. F. (2002). RNA polymerase II elongation

factors of Saccharomyces cerevisiae, a targeted proteomics approach. Mol Cell Biol 22,
6979-6992.

Krohn, N. M., Yanagisawa, S., Grasser, K. D. (2002). Specificity of the stimulatory
interaction between chromosomal HMGB proteins and the transcription factor Dof2 and

its negative regulation by protein kinase CK2-mediated phosphorylation. J Biol Chem
277, 32438-32444.

43

Kudlicki, W., Grankowski, N., Gasior, E. (1978). Isolation and properties of two protein
kinases from yeast which phosphorylate casein and some ribosomal proteins. Eur J
Biochem 84, 493 498.

Kuhlman, T.C., Cho, H., Reinberg, D., Hernandez, N. (1999). The general transcription
factors 11A, 113, 11F, and IIE are required for RNA polymerase II transcription from the
human U1 small nuclear RNA promoter. Mol Cell Biol 19, 2130-2141.

Kunkel, G. R., Pederson, T. (1989). Transcription of a human U6 small nuclear RNA
gene in vivo withstands deletion of intragenic sequences but not of an upstream
TATATA box. Nucleic Acids Res 17, 7371-7379.

Kwek, K.Y., Murphy, 8., F urger, A., Thomas, B., O'Gorman, W., Kimura, H., Proudfoot,
N.J., Akoulitchev, A. (2002). U1 snRNA associates with TFIIH and regulates
transcriptional initiation. Nat Struct Biol 9, 800-5.

Landesman-Bollag, E., Romieu-Mourez, R., Song, D.H., Sonenshein, G.E., Cardiff, R.D.,
Seldin, DC. (2001). Protein kinase CK2 in mammary gland tumorigenesis. Oncogene 20,
3247 3257.

Lasa, M., Marin, O., Pinna, LA. (1997). Rat liver Golgi apparatus contains a protein
kinase similar to the casein kinase of lactating mammary gland. Eur J Biochem 243, 719-
725

Lebrin, F., Chambaz, E.M., Bianchini, L. (2001). A role for protein kinase CK2 in cell
proliferation, evidence using a kinase-inactive mutant of CK2 catalytic subunit alpha.
Oncogene. 20, 2010-2202.

Lehner, B., Semple, J.I., Brown, S.E., Counsel], D., Campbell, R.D., Sanderson, CM.
(2004). Analysis of a high-throughput yeast two-hybrid system and its use to predict the

function of intracellular proteins encoded within the human MHC class III region.
Genomics 83, 153-167.

Leroy, D., Heriche, J. K., Filhol, O., Chambaz, E. M., Cochet, C. (1997). Binding of
Polyamines to an Autonomous Domain of the Regulatory Subunit of Protein Kinase CK2
Induces a Conformational Change in the Holoenzyme. J Biol Chem 272, 20820 20827.

Lewis, B.A., Sims, R.J. 3rd., Lane, W.S., Reinberg, D. (2005). Functional
characterization of core promoter elements, DPE-specific transcription requires the
protein kinase CK2 and the PC4 coactivator. Mol Cell 18, 471-481

Li, Y., Keller, D.M., Scott, J.D., Lu, H. (2005). CK2 phosphorylates SSRPl and inhibits
its DNA-binding activity. J Biol Chem 280, 11869-11875.

Li, D., Meier, T., Dobrowolska, G., Krebs, EC. (1997). Specific interaction between
casein kinase 2 and the nucleolar protein Nopp140. J Biol Chem 272, 3773 3779.

44

Lieberman, S.L., Ruderrnan, J.V. (2004). CK2 beta, which inhibits Mos function, binds to
a discrete domain in the N-terminus of Mos. Dev Biol 268, 271-279.

Lin, R., Beauparlant, P., Makris, C., Meloche, S., Hiscott, J. (1996). Phosphorylation of
IkappaBalpha in the C-terminal PEST domain by casein kinase II affects intrinsic protein
stability. Mol Cell Biol 16, 1401-1409.

Litchfield D.W. (2003). Protein kinase CK2, structure, regulation and role in cellular
decisions of life and death. Biochem J 369, 1 15.

Litchfield, D.W., Liischer, B., Lozeman, F.J., Eisenman, R.N., Krebs, E.G.(l992).
Phosphorylation of casein kinase II by p34cdc2 in vitro and at mitosis. J Biol Chem 267,
13943-13951.

Litchfield, D. W., Llischer, B. (1993). Casein kinase II in signal transduction and cell
cycle regulation. Mol Cell Biochem 127-128, 187-199.

Litchfield, D.W., Bosc, D.G., Canton, D.A., Saulnier, R.B., Vilk, G., Zhang, C. (2001).
Functional specialization of CK2 isoforms and characterization of isoforrn-specific
binding partners. Mol Cell Biochem 227, 21 29.

Lobo, S.M., Hernandez, N. (1989). A 7 bp mutation converts a human RNA polymerase
II snRNA promoter into an RNA polymerase III promoter. Cell 58, 55-67.

Loizou, J.I., El-Khamisy, S.F., Zlatanou, A., Moore, D.J., Chan, D.W., Qin, J., Samo, S.,
Meggio, F ., Pinna, L.A., Caldecott, K.W. (2004). The protein kinase CK2 facilitates
repair of chromosomal DNA single-strand breaks. Cell 117, 17 28.

Lozeman, F.J., Litchfield, D.W., Piening, C., Takio, K., Walsh, K.A., Krebs, E.G.(l990).
Isolation and characterization of human cDNA clones encoding the alpha and the alpha'
subunits of casein kinase II. Biochemistry 29, 8436-8447.

Lund, E., Bostock, C.J., Dahlberg, LE. (1987). The transcription of Xenopus laevis
embryonic U1 snRNA genes changes when oocytes mature into eggs. Genes Dev 1, 47-
56.

Ltischer, B., Christenson, E., Litchfield, D.W., Krebs, E.G., Eisenman, RN. (1990). Myb
DNA binding inhibited by phosphorylation at a site deleted during oncogenic activation.
Nature 344, 517 522.

Ma, 3., Hernandez, N. (2001). A Map of Protein-Protein Contacts within the Small
Nuclear RNA-activating Protein Complex SNAPC. J Biol Chem 276, 5027-5035.

Ma, B., Hernandez, N. (2002). Redundant cooperative interactions for assembly of a
human U6 transcription initiation complex. Mol Cell Biol 22, 8067-8078.

45

Marin, O., Meggio, F., Samo, S., Cesaro, L., Pagano, M.A., Pinna, L,A. (1999). Tyrosine
Versus Serine/I‘hreonine Phosphorylation by Protein Kinase Casein Kinase-2, a study
with peptide substrates derived from immunophilin fpr3. J Biol Chem 274, 29260-29265

Marin, O., Meggio, F., Marchiori, F ., Borin, G., Pinna, L.A. (1986). Site specificity of
casein kinase-2 (TS) from rat liver cytosol. A study with model peptide substrates. Eur J
Biochem 160, 239-244.

Marshak, D. R., Russo, G. L. (1994). Regulation of protein kinase CKII during the cell
division cycle. Cell Mol Biol Res 40, 513-517

Mattaj, I.W., Dathan, N.A., Parry, H.D., Carbon, P., Krol, A. (1988). Changing the RNA
polymerase specificity of U snRNA gene promoters. Cell 55, 435-442.

McElhinny, J.A., Trushin, S.A., Bren, G.D., Chester, N., Paya, CV. (1996). Casein
kinase II phosphorylates I kappa B alpha at S-283, S-289, S-293, and T-291 and is
required for its degradation. Mol Cell Biol 16, 899-906.

Meggio, F., Pinna, L.A. (1984). Subunit structure and autophosphorylation mechanism of
casein kinase-TS (type-2) from rat liver cytosol. Eur J Biochem 145, 593-599.

Meggio, F ., Boldyreff, B., Marin, O., Marchiori, F., Perich, J.W., Issinger, O.G., Pinna,
L.A. (1992). The effect of polylysine on casein-kinase-2 activity is influenced by both the
structure of the protein/peptide substrates and the subunit composition of the enzyme. Eur
J Biochem 205, 939-45.

Meggio, F., Marin, O., Pinna, L.A. (1994). Substrate specificity of protein kinase CK2.
Cell. Mol Biol Res 40, 401-409.

Meggio, F., Negro, A., Samo, S., Ruzzene, M., Bertoli, A. (2000). Bovine prion protein
as a modulator of protein kinase CK2. Biochem J 352, 191-196.

Meggio, F ., Pinna, L. A. (2003). One-thousand-and-one substrates of protein kinase CK2?
The FASEB Journal 17, 349-368.

Meisner, H., Heller-Harrison, R., Buxton, J., Czech, MP. (1989). Molecular cloning of
the human casein kinase II alpha subunit Biochemistry 28, 4072-4076.

Meissner, W., Ahlers, A., Seifart, K.H. (1995). The activity of transcription factor PBP,
which binds to the proximal sequence element of mammalian U6 genes, is regulated
during differentiation of F9 cells. Mol Cell Biol 15, 5888-5897.

Messenger, M.M., Saulnier, R.B., Gilchrist, A.D., Diamond, P., Gorbsky, G.J., Litchfield,

D.W. (2002). Interactions between Protein Kinase CK2 and Pinl. evidence for
phosphorylation-dependent interactions. J Biol Chem 277, 23054-23064.

46

Michels, A.A., Nguyen, V.T., Fraldi, A., Labas, V., Edwards, M., Bonnet, F ., Lania, L.,
Bensaude, O. (2003). MAQI and 78K RNA interact with CDK9/cyclin T complexes in a
transcription-dependent manner. Mol Cell Biol 23, 4859-4869.

Mittal, V., Cleary, M.A., Herr, W., Hernandez, N. (1996). The Oct-1 POU-specific
domain can stimulate small nuclear RNA gene transcription by stabilizing the basal
transcription complex SNAPC. Mol Cell Biol 16, 1955-1965.

Mittal, V., Ma, 8., Hernandez, N. (1999). SNAPC, a core promoter factor with a built-in
DNA-binding damper that is deactivated by the Oct-1 POU domain. Genes Dev 13,
1807-1821.

Molkentin, J.D., Li, L., Olson, EN. (1996). Phosphorylation of the MADS-Box
transcription factor MEFZC enhances its DNA binding activity. J Biol Chem 271, 17199-
17204.

Munstermann, U., Fritz, G., Seitz, G., Yiping, L., Schneider, H.R., Issinger, O.G. (1990).
CKII is elevated in solid tumors and rapidly proliferating non-neoplasic tissue. Eur J
Biochem 189, 251 257.

Murphy, 8., Yoon, J.B., Gerster, T., Roeder, RC. (1992). Oct-l and Oct-2 potentiate
functional interactions of a transcription factor with the proximal sequence element of
small nuclear RNA genes. Mol Cell. Biol 12, 3247 3261.

Myslinski, E., Krol, A., Carbon, P. (1998). ZNF76 and ZNF143 are two human homologs
of the transcriptional activator Staf. J Biol Chem 273, 21998-2006.

Nambirajan, S., Radha, V., Kamatkar, S., Swarup, G. (2000). PTP-SZ, a nuclear tyrosine
phosphatase, is phosphorylated and excluded from condensed chromosomes during
mitosis. J Biosci 25, 33-40.

Nash, M.A., Kozak, S.E., Angerer, L.M., Angerer, R.C., Schatten, H., Schatten, G.,
Marzluff, W.F. (1987). Sea urchin maternal and embryonic U1 RNAs are spatially
segregated in early embryos. J Cell Biol 104, 1133-1142.

Nguyen, V.T., Kiss, T., Michels, A.A., Bensaude, O. (2001). 78K small nuclear RNA
binds to and inhibits the activity of CDK9/cyclin T complexes. Nature 414, 322-325.

Niefind, K., Guerra, B., Ermakowa, 1., Issinger, O.G. (2001). Crystal structure of human
protein kinase CK2, Insights into basic properties of the CK2 holoenzyme. EMBO J 20,
5320-5331.

Niefind, K., Putter, M., Guerra, B., Issinger, O.G., Schomburg, D. (1999). GTP plus
water mimic ATP in the active site of protein kinase CK2. Nat Struct Biol 6, 1100-1103.

47

O'Mahony, D.J., Smith, S.D., Xie, W., Rothblum, L]. (1992). Analysis of the
phosphorylation, DNA-binding and dimerization properties of the RNA polymerase I
transcription factors UBF] and UBF2. Nucleic Acids Res 20, 1301-1308.

Ouchida, R., Kusuhara, M., Shimizu, N., Hisada, T., Makino, Y., Morimoto, C., Handa,
H., Ohsuzu, F ., Tanaka, H. (2003). Suppression of NF-kappaB-dependent gene
expression by a hexamethylene bisacetamide-inducible protein HEXIMl in human
vascular smooth muscle cells. Genes Cells 8, 95-107.

Peng, J., Zhu. Y., Milton. J.T., Price, DH. (1998). Identification of multiple cyclin
subunits of human P-TEFb. Genes Dev 12, 755-762.

Pepperkok, R., Lorenz, P., Pyerin, W. (1994). Casein kinase II is required for transition
of GO/Gl, early GI, and 01/8 phases of the cell cycle. J Biol Chem 269, 6986-6991.

Pflum, M. K., Tong, J. K., Lane, W. S., Schreiber, S. L. (2001). Histone Deacetylase
1 Phosphorylation Promotes Enzymatic Activity and Complex Formation J Biol Chem
276, 47733-47741.

Pilecki, M., Grankowski, N., Jacobs, J., Gasior, E. (1992). Specific protein kinase from
Saccharomyces cerevisiae cells phosphorylating 6OS ribosomal proteins. Eur J Biochem
206, 259-267.

Pinna, L.A. (2002). Protein kinase CK2, a challenge to canons. Journal of Cell Science
115, 3873-3878

Pinna, L.A., Meggio, F. (1997). Protein kinase CK2 ("casein kinase-2") and its
implication in cell division and proliferation. Prog Cell Cycle Res 3, 77-97.

Porter, C.M., Havens, M.A., Clipstone, NA. (2000). Identification of amino acid residues
and protein kinases involved in the regulation of NFATc subcellular localization. J Biol
Chem 275, 3543-3551.

Raman, C., Kuo, A., Deshane, J ., Litchfield, D.W., Kimberly, RP. (1998). Regulation of
casein kinase 2 by direct interaction with cell surface receptor CD5. J Biol Chem 273,
19183 19189.

Reed, J.C., Bidwai, A.P., Glover, C.V.C. (1994). Cloning and disruption of CKBZ, the
gene encoding the 32-kDa regulatory beta'-subunit of Saccharomyces cerevisiae casein
kinase II. J Biol Chem 269, 18192-18200.

Rincon, J.C., Engler. S.K., Hargrove, B.W., Kunkel, GR. (1998). Molecular cloning of a
cDNA encoding human SPH-binding factor, a conserved protein that binds to the

enhancer-like region of the U6 small nuclear RNA gene promoter. Nucleic Acids Res 26,
4846-4852.

48

Robert, C., McGraw, S., Massicotte, L., Pravetoni, M., Gandolfi, F., Sirard, MA. (2002).
Quantification of housekeeping transcript levels during the development of bovine
preimplantation embryos. Biol. Reprod. 67, 1465-1472.

Rodriguez, P., Pelletier, J ., Price, G.B., Zannis-Hadjopoulos, M. (2000). NAP-2, histone
chaperone function and phosphorylation state through the cell cycle. J Mol Biol 298, 225-
238.

Roebuck, K.A., Szeto, D.P., Green, K.P., Fan, Q.N., Stumph, W.E. (1990). Octamer and
SPH motifs in the U1 enhancer cooperate to activate U1 RNA gene expression. Mol Cell
Biol 10, 341-352.

Romero-Oliva, F ., Allende, J,E. (2001). Protein pZIWAn/Cm is phosphorylated by protein
kinase CK2 in vitro and interacts with the amino terminal end of the CK2 beta subunit.
Journal of Cellular Biochemistry 81, 445-452.

Ruzzene, M., Penzo, D., Pinna, L.A. (2002). Protein kinase CK2 inhibitor 4,5,6,7-
tetrabromobenzotriazole (TBB) induces apoptosis and caspase-dependent degradation of
haematopoietic lineage cell-specific protein 1 (H81) in Jurkat cells. Biochem J 364, 41-
47.

Sacerdoti-Sierra, N., Jaffe, CL. (1997). Release of ecto-protein kinases by the protozoan
parasite Leishmania major. J Biol Chem 272, 30760-5.

Sadowski, C.L., Henry, R.W., Kobayashi, R., Hernandez, N. (1996). The SNAP45
subunit of the small nuclear RNA (snRNA) activating protein complex is required for
RNA polymerase II and III snRNA gene transcription and interacts with the TATA box
binding protein. Proc Natl Acad Sci U S A 93, 4289-4293.

Sadowski, C.L., Henry, R.W., Lobo, S.M., Hernandez, N. (1993). Targeting TBP to a
non-TATA box cis-regulatory element, a TBP-containing complex activates transcription
from snRNA promoters through the PSE. Genes Dev 7, 1535-1548.

Saez-Vasquez, J., Meissner, M., Pikaard, CS. (2001). RNA polymerase I holoenzyme-
promoter complexes include an associated CK2-like protein kinase. Plant Mol Biol 47,
449-459.

Samo, S., Reddy, H., Meggio, F., Ruzzene, M., Davies, S.P., Donella-Deana, A., Shugar,
D., Pinna, L.A. (2001). Selectivity of 4,5,6,7-tetrabromobenzotriazole, an ATP site-
directed inhibitor of protein kinase CK2 ('casein kinase-2'). FEBS Lett 496, 44-48.

Samo, S., Ghisellini, P., Pinna, L. A. (2002). Unique activation mechanism of protein
kinase CK2, the N-terminal segment is essential for constitutive activity of the catalytic
subunit but not of the holoenzyme. J Biol Chem 277, 22509-22514.

49

Schaub, M., Myslinski, E., Schuster, C., Krol, A., Carbon, P. (1997). Staf, a promiscuous
activator for enhanced transcription by RNA polymerases II and III. EMBO J 16, 173-
181.

Schoonbroodt, S., Ferreira V., Best-Belpomme M., Boelaert J.R., Legrand-Poels S.,
Komer M., Piette J. (2000). Crucial role of the amino-terminal tyrosine residue 42 and
the carboxyl-terminal PEST domain of IKB in NF -1(B activation by an oxidative stress. J.
Immunol 164, 4292 4300.

Schramm, L., Pendergrast, P.S., Sun, Y., Hernandez, N. (2000). Different human TFIIIB
activities direct RNA polymerase III transcription from TATA-containing and TATA-
less promoters. Genes Dev 14, 2650-2663.

Schultz, M.C. (2003). DNA damage regulation of the RNA components of the
translational apparatus, new biology and mechanisms. IUBMB Life 55, 243-7.

Schuster, N., Gdtz, C., Faust, M., Schneider, E., Prowald, A. (2001). Wild-type p53
inhibits protein kinase CK2 activity. J Cell Biochem 81, 172-183

Schuster, C., Myslinski, E., Krol, A., Carbon, P. (1995). Staf, a novel zinc finger protein
that activates the RNA polymerase III promoter of the selenocysteine tRNA gene. EMBO
J 14, 3777-3787.

Seither, P., Iben. S., Grummt, I. (1998). Mammalian RNA polymerase 1 exists as a
holoenzyme with associated basal transcription factors. J Mol Biol 275, 43-53.

Seldin, D., Leder, P. (1995). Casein kinase II? transgene-induced murine lymphoma,
relation to theileriosis in cattle. Science 267,894-897.

Shi, X., Potvin, 8., Huang, T., Hilgard, P., Spray, D.C., Suadicani, S.O., Wolkofi', A.W.,
Stanley, P., Stockert, RJ. (2001). A novel casein kinase 2 alpha-subunit regulates
membrane protein traffic in the human hepatoma cell line HuH-7. J Biol Chem 276,
2075 2082.

Skubitz, K.M., Ehresmann, D.D., Ducker, T.P. (1991). Characterization of human
neutrophil ecto-protein kinase activity released by kinase substrates. J Immunol 147, 638-
650.

Sommercom, J., Mulligan, J. A., Lozeman, F. J., Krebs, E. G. (1987). Activation of
Casein Kinase II in Response to Insulin and to Epidermal Growth Factor. Proc Natl Acad
Sci USA. 84, 8834-8838.

Soncin, F., Zhang, X., Chu, B., Wang, X., Asea, A., Ann Stevenson .M, Sacks, D.B.,
Calderwood, SK. (2003). Transcriptional activity and DNA binding of heat shock factor-
1 involve phosphorylation on threonine 142 by CK2. Biochem Biophys Res Commun
303, 700-706.

50

Song, Q., Combest, W.L., Gilbert, LL (1994). Spermine and polylysine enhanced
phosphorylation of calmodulin and tubulin in an insect endocrine gland. Mol Cell
Endocrinol 99, 1-10.

Sonka, J ., Kubler, D., Kinzel, V. (1989). phosphorylation by cell surface protein kinase of
bovine and human fibrinogen and fibrin. Biochim Biophys Acta 997, 268-277.

Stepanova, V., Jerke, U., Sagach, V., Lindschau, C., Dietz, R., Haller, H., Dumler, I.
(2002). Urokinase-dependent human vascular smooth muscle cell adhesion requires
selective vitronectin phosphorylation by ecto-protein kinase CK2. J Biol Chem 277,
10265-10272

Sugano, S., Andronis, C., Green, R.M., Wang, Z.Y., Tobin, EM. (1998). Protein kinase
CK2 interacts with and phosphorylates the Arabidopsis circadian clock-associated 1
protein. Proc Natl Acad Sci U S A 95, 11020-11025.

Sun, J. M., Chen, H. Y., Moniwa, M., Litchfield, D. W., Seto, E., Davie, J. R. (2002).
The transcriptional repressor Sp3 is associated with CK2-phosphorylated histone
deacetylase 2. J Biol Chem 277, 35783-35786.

Szyszka, R., Boguszewska, A., Shugar, D., Grankowski, N. (1996). Halogenated
benzimidazole inhibitors of phosphorylation, in vitro and in vivo, of the surface acidic
proteins of the yeast ribosomal 6OS subunit by endogenous protein kinases CK-II and
PK6OS. Acta Biochim P01 43, 389-396.

Tawfic, S., Yu, S., Wang, H., Faust, R., Davis, A., Ahmed, K. (2001). Protein kinase
CK2 in neoplasia. Histol Histopathol 16,573-582

Teichmann, M., Wang, Z., Roeder, R.G. (2000). A stable complex of a novel
transcription factor IIB- related factor, human TFIIIBSO, and associated proteins mediate
selective transcription by RNA polymerase III of genes with upstream promoter elements.
Proc Natl Acad Sci U S A 97, 14200-1425.

Toczyski, D.P., Galgoczy, D.J., Hartwell, L.H. (1997). CDCS and CKII control
adaptation to the yeast DNA damage checkpoint. Cell 90, 1097 1106.

Trembley, J.H., Tatsumi, S., Sakashita, E., Loyer, P., Slaughter, C.A., Suzuki, H., Endo,
H., Kidd, V.J., Mayeda, A. (2005). Activation of pre-mRNA splicing by human RNPSl
is regulated by CK2 phosphorylation. Mol Cell Biol 25, 1446-14457.

Tsai, S. C., Seto, E. (2002). Regulation of histone deacetylase 2 by protein kinase CK2. J
Biol Chem 277,31826-31833.

51

Tuazon, P.T., Traugh, J .A. (1991). Casein kinase 1 and II—multipotential serine protein
kinases, structure, function, and regulation. Adv. Second Messenger Phosphoprotein Res
23, 123 164.

Ubeda, M., Habener, J.F. (2003). CHOP transcription factor phosphorylation by casein
kinase 2 inhibits transcriptional activation. J Biol Chem 278, 40514-40520.

Unger, G.M., Davis, A.T., Slaton, J.W., Ahmed, K. (2004). Protein kinase CK2 as
regulator of cell survival, implications for cancer therapy. Curr Cancer Drug Targets 4,
77-84.

Vilk, G., Saulnier, R.B., St Pierre, R., Litchfield, D.W. (1999). Inducible expression of
protein kinase CK2 in mammalian cells. Evidence for functional specialization of CK2
isoforms. J Biol Chem 274, 14406 14414

Voit, R., Kuhn, A., Sander, E.E., Grummt, I. (1995). Activation of mammalian ribosomal
gene transcription requires phosphorylation of the nucleolar transcription factor UBF.
Nucleic Acids Res 23, 2593-2599.

Voit, R., Schnapp, A., Kuhn, A., Rosenbauer, H., Hirschmann, P., Stunnenberg, H.G.,
Grummt, I. (1992). The nucleolar transcription factor mUBF is phosphorylated by casein
kinase II in the C-terminal hyperacidic tail which is essential for transactivation. EMBO J
11, 2211-2218.

Waldschmidt, R., Wanandi, 1., Seifart, K.H. (1991). Identification of transcription factors
required for the expression of mammalian U6 genes in vitro. EMBO J 10, 2595-2603.

Wei, P., Garber, M.B., Fang, S.M., Fischer, W.H., Jones, K.A. (1998). A novel CDK9-
associated C-type cyclin interacts directly with HIV-1 Tat and mediates its high-affinity,
loop-specific binding to TAR RNA. Cell 92, 451-462.

Wilhelm, V., Rojas, P., Gatica, M., Allende, C. C., Allende, J. E. (1995). Expression of
the subunits of protein kinase CK2 during oogenesis in Xenopus laevis. Eur J Biochem
232, 671-676.

Willis, I.M. (2002). A universal nomenclature for subunits of the RNA polymerase III
transcription initiation factor TFIIIB. Genes Dev 16, 1337-1338.

Winter, 3., Kautzner, 1., Issinger, O.G., Arnold, H.H. (1997). Two putative protein kinase
CK2 phosphorylation sites are important for Myf-S activity. Biol Chem. 378, 1445-1456.

Wirkner, U., Voss, H., Lichter, P., Ansorge, W., Pyerin, W. (1994). The human gene

(CSNK2A1) coding for the casein kinase II subunit alpha is located on chromosome 20
and contains tandemly arranged Alu repeats. Genomics 19, 257 265.

52

Wisniewski, J. R., Szewczuk, Z., Petry, 1., Schwanbeck, R., Renner, U. (1999).
Constitutive phosphorylation of the acidic tails of the high mobility group 1 proteins by
casein kinase II alters their conformation, stability, and DNA binding specificity. J Biol
Chem 274,20116 20122.

Wong, M.W., Henry, R.W., Ma, 8., Kobayashi, R., Klages, N., Matthias, P., Strubin, M.,
Hernandez, N. (1998). The large subunit of basal transcription factor SNAPC is a Myb
domain protein that interacts with Oct-1. Mol Cell Biol 18, 368-377.

Xiao, C.Y., Jans, P., Jans, DA. (1998). Negative charge at the protein kinase CK2 site
enhances recognition of the SV40 large T-antigen NLS by importin, effect of
conformation. FEBS Lett 440, 297-301.

Xu, X., Toselli, P.A., Russell, L.D., Seldin, DC. (1999). Globozoosperrnia in mice
lacking the casein kinase II alpha' catalytic subunit. Nat Genet 23, 118-121.

Yamaguchi, Y., Wada, T., Suzuki, F., Takagi, T., Hasegawa, J., Handa, H. (1998). Casein
kinase II interacts with the bZIP domains of several transcription factors. Nucleic Acids
Res 26, 3854-3861.

Yamane, K., Kinsella, T.J. (2005a). Casein kinase 2 regulates both apoptosis and the cell
cycle following DNA damage induced by 6-thioguanine. Clin Cancer Res 11, 2355-2363.

Yamane, K., Kinsella, T.J (2005b). CK2 inhibits apoptosis and changes its cellular
localization following ionizing radiation. Cancer Res 65, 4362-4367.

Yang, Z., Zhu, Q., Luo, K., Zhou, Q. (2001). The 7SK small nuclear RNA inhibits the
CDK9/cyclin T1 kinase to control transcription. Nature 414, 317-322.

Yik, J .H., Chen, R., Nishimura, R., Jennings, J.L., Link, A.J., Zhou, Q. (2003). Inhibition
of P-TEF b (CDK9/Cyclin T) kinase and RNA polymerase II transcription by the
coordinated actions of HEXIMI and 7SK snRNA. Mol Cell 12, 971-982.

Yik, J.H., Chen, R., Pezda, A.C., Zhou, Q. (2005). Compensatory contributions of
HEXIM] and HEXIM2 in maintaining the balance of active and inactive positive
transcription elongation factor b complexes for control of transcription. J Biol Chem 280,
16368-16376.

Yim, H., Lee, Y. H., Lee, C. H., Lee, S. K. (1999). Emodin, an anthraquinone derivative
isolated from the rhizomes of Rheum palmatum, selectively inhibits the activity of casein
kinase II as a competitive inhibitor. Planta Med 65, 9 13.

Yoon, J.B., Murphy, S., Bai, L., Wang, Z., Roeder, R.G. (1995). Proximal sequence
element-binding transcription factor (PTF) is a multisubunit complex required for
transcription of both RNA polymerase II- and RNA polymerase III-dependent small
nuclear RNA genes. Mol Cell. Biol 15, 2019 2027.

53

Yoon, J.B., Roeder, R.G. (1996). Cloning of two proximal sequence element-binding
transcription factor subunits (gamma and delta) that are required for transcription of small
nuclear RNA genes by RNA polymerases II and III and interact with the TATA-binding
protein. Mol Cell Biol 16, 1-9.

Zamrod, Z., Stumph, W.E. (1990). U4B snRNA gene enhancer activity requires
functional octamer and SPH motifs. Nucleic Acids Res 18, 7323-7330.

Zandomeni, R., Zandomeni, M.C., Shugar, D., Weinmann, R. (1986). Casein kinase type
II is involved in the inhibition by 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole of
specific RNA polymerase II transcription. J Biol Chem 261, 3414-3419.

Zhao, T., Heyduk, T., Eissenberg, J. C. (2001). Phosphorylation site mutations in

heterochromatin protein 1 (HPl) reduce or eliminate silencing activity. J Biol Chem
276,9512-9518.

54

CHAPTER TWO

COOPERATION BETWEEN SNAPC AND TBP ANTAGONIZES PROTEIN

KINASE CK2 INHIBITION OF DNA BINDING BY SNAPC

Abstract

Protein kinase CK2 regulates RNA polymerase III transcription of human U6
snRNA genes, both negatively and positively, depending upon whether the general
transcription machinery or RNA polymerase III is preferentially phosphorylated. Human
U1 snRNA genes share similar promoter architectures as that of U6 genes, but are
transcribed by RNA polymerase II. Herein, we report that CK2 inhibits U1 snRNA gene
transcription by RNA polymerase II. Decreased levels of endogenous CK2 correlates
with increased U1 expression while CK2 associates with U1 gene promoters, indicating
that it plays a direct role in U1 gene regulation. CK2 phosphorylates the general
transcription factor SNAPC that is required for both RNA polymerase II and III
transcription, and SNAPC phosphorylation inhibits its binding to snRNA gene promoters.
However, restricted promoter access by phosphorylated SNAPc can be overcome by
cooperative interactions with TBP at a U6 promoter but not at a U1 promoter. Thus, CK2
may have the capacity to differentially regulate U1 and U6 transcription even though

SNAPC is universally utilized for human snRNA gene transcription.

This work was published as the following manuscript: Gu L, Esselman WI, Henry RW. (2005)
Cooperation between SNAPC and TBP antagonizes protein kinase CK2 inhibition of DNA
binding by SNAPC. J Biol Chem. 2005 Jun 14; [Epub ahead of print]

55

Introduction

Protein kinase CK2 is an important regulator of cellular growth (Guerra and
Issinger, 1999; Meggio and Pinna, 2003; Pinna, 2002; Pinna and Meggio, 1997) and
abnormal CK2 activity may contribute to tumor progression (Tawfic et al., 2001). CK2
is a tetrameric enzyme composed of two catalytic subunits or and or’ and two copies of the
regulatory [3 subunit (Niefind et al., 2001). One role for CK2 is to function as a
regulatory protein that controls gene transcription. For example, general RNA synthesis
in yeast is impaired when a temperature sensitive mutant of the CK2a’ subunit is shifted
to a restrictive temperature (Hanna etal., 1995). This decline in total RNA synthesis also
suggests that expression of highly transcribed genes encoding ribosomal (r), transfer (t),

and small nuclear (sn) RNAs is sensitive to levels of functional CK2.

In yeast, CK2 is important for active RNA polymerase III transcription (Hockman
and Schultz, 1996), and yet paradoxically, CK2 has been proposed to be the terminal
effector in a DNA damage response pathway that represses RNA polymerase III
transcription (Ghavidel and Schultz, 2001). In humans, CK2 exhibits differential effects
on gene transcription during the cell cycle. During mitosis, CK2 inhibits RNA
polymerase III transcription, whereas at other stages CK2 can stimulate transcription (Hu
et al., 2004). The nature of the regulation is dictated by CK2 target selection. One key
target for CK2 is the general transcription factor TFIIIB (Ghavidel and Schultz, 1997; Hu
et al., 2003; Johnston et al., 2002). There are at least two versions of human TFIIIB that
function for transcription of distinct classes of genes (Schramm and Hernandez, 2002).
The Brfl -TFIIIB complex functions for SS rRNA and tRNA transcription and is

composed of the TATA-box binding protein (TBP) and the TBP associated factors, deI

56

and Brfl. The Brfl-TFIIIB complex functions for U6 snRNA transcription and is
composed of TBP plus de1 but Brf2 instead of Brfl. Brfl -TFIIIB phosphorylation
during M-phase results in the selective release of deI from tRNA promoters (F airley et
al., 2003). Hernandez and colleagues further demonstrated that del is the critical CK2
target within Brfl-TFIIIB for mitotic repression of U6 transcription (Hu et al., 2004). As
de1 is a shared component of both TFIIIB complexes, CK2 may target this factor to
repress global RNA polymerase III transcription. However, CK2 inhibitors also interfere
with Brfl -TFIIIB binding to the TFIIIC complex (Johnston et al., 2002), which itself
recognizes intragenic promoter elements of SS rRNA and tRNA genes, suggesting that
CK2 also has a stimulatory role in RNA polymerase III transcription through enhanced
preinitiation complex assembly. Consistent with this positive role, CK2 can also activate
RNA polymerase III transcription in human cells (Johnston et al., 2002), and in this
process may additionally phosphorylate RNA polymerase III itself (Hu et al., 2003).
Together, these data point to an important but complex role for CK2 control of RNA

polymerase III transcription.

Human U6 snRNA genes are interesting because they are transcribed by RNA
polymerase III and yet their promoters are similar to other snRNA genes, such as U1 and
U2, which are transcribed by RNA polymerase 11 (Henry et al., 1998a; Hernandez, 2001;
Lobo and Hernandez, 1994). Consequently, the mechanisms regulating human snRNA
gene transcription by RNA polymerases II and 111 may also be shared. Nonetheless, the
RNA polymerase II-transcribed genes do not use TFIIIB and thus rely on other factors for
regulatory intervention. Regardless of po1ymerase specificity, all human snRNA genes

contain a distal sequence element (DSE) encompassing an octamer element that is

57

recognized by Oct-1. Additional sites for the Spl (Ares et al., 1987) and STAF (Schaub
et al., 1997) transcriptional activator proteins are adjacently located to the DSE at some
snRNA genes (Hernandez, 1992). Oct-1 activates snRNA transcription by direct protein
contacts (Ford et al., 1998; Hovde et al., 2002; Mittal et al., 1999) with the basal
transcription factor called the snRNA activating protein complex (SNAPC) (Sadowski et
al., 1993), which is also referred to as the proximal sequence element transcription factor
(PTF) (Murphy et al., 1992). SNAPC binds to the proximal sequence element (PSE)
common to the core promoters of human snRNA genes and functions for both RNA
polymerase 11 and III transcription (Henry et al., 1998a; Henry et al., 1996; Henry et al.,
1998b; Henry et al., 1995; Sadowski et al., 1996; Sadowski et al., 1993; Wong et al.,
1998). SNAPC contains at least five proteins called SNAP190 (PTFOL), SNAPSO (PTFB),
SNAP45 (PTFB), SNAP43 (PTFy), and SNAP19 (Bai et al., 1996; Henry et al., 1996;
Henry et al., 1998b; Henry et al., 1995; Sadowski et al., 1996; Wong et al., 1998; Yoon
and Roeder, 1996). The largest subunit SNAP190 plays a centrally important role in
human snRNA gene transcription first by serving as the scaffold for SNAPc assembly
though interactions with most other members of SNAPC (Ma and Hernandez, 2001; Ma
and Hernandez, 2002). Once the complex is assembled, SNAP190 further recognizes the
PSE through its Myb DNA binding domain (Wong et al., 1998) and is also the direct
target for Oct-1 (Ford et al., 1998; Mittal et al., 1996). In an unexpected twist, SNAP190
can make DNA contacts within the U1 DSE and stimulate the binding of Oct-1 to this
enhancer, suggesting that in some contexts coordinated binding of the activator and
general transcription machinery is important for transcriptional activation (Hovde et al.,

2002)

58

Human U6 snRNA genes, but not U1 genes, also contain a TATA box that is
located adjacently to the PSE, and this promoter arrangement dictates that transcription
occurs by RNA polymerase III (Lobo and Hernandez, 1989). The TATA box is
recognized by the TBP component of the Brf2-TFIIIB complex (Cabart and Murphy,
2001; Cabart and Murphy, 2002; Hinkley et al., 2003; Ma and Hernandez, 2002; Zhao et
al., 2003). SNAPc, through its SNAP190 subunit, stimulates TBP binding to the U6
TATA box as an early critical step in RNA polymerase III transcription (Hinkley et al.,

2003; Ma and Hernandez, 2002).

TBP is also required for human snRNA gene transcription by RNA polymerase II
(Sadowski et al., 1993), but how TBP is recruited to these TATA-less promoters is
unclear. Nonetheless, it is likely that SNAPC contributes to TBP activity at these genes.
SNAPC and TBP co-purify extensively during the biochemical fractionation of SNAPC
(Henry et al., 1995), and those fractions enriched for SNAPC and TBP can reconstitute
U1 snRNA transcription in vitro from extracts that have been depleted of endogenous
TBP (Sadowski et al., 1993). Thus, SNAPC plays a pivotal role in snRNA gene
transcription by providing core promoter recognition, serving as a target for transcription
activation by Oct-1, and coordinating TBP activity and pre-initiation complex assembly
for both RNA polymerases II and 111. Additional RNA polymerase 11 general
transcription factors are also required for U1 transcription including TFIIA, TFIIB, TFIIE,
and TFIIF (Kuhlman et al., 1999). As in RNA polymerase III transcription, CK2 also has
a complex role in regulating RNA polymerase II transcription. CK2 phosphorylation of
TFIIA and TFIIE stimulates preinitiation complex assembly at the adenovirus major late

promoter while TFIIF phosphorylation can stimulate RNA polymerase II elongation. In

59

contrast, CK2 phosphorylation of RNA polymerase II inhibits transcription, potentially

by impairing elongation (Cabrejos et al., 2004).

The striking parallel between RNA polymerase II and III transcription of human
snRNA genes prompted an investigation into the role of phosphorylation in U1
transcription. In this study, we report that CK2 inhibits overall U1 snRNA gene
transcription by RNA polymerase II and can phosphorylate SNAPC to inhibit its DNA
binding. Interestingly, cooperative interactions of SNAPC with TBP at U6 but not at U1
promoter DNA can overcome the repressive effects of CK2. Together, these data suggest
that CK2 may differentially affect preinitiation complex assembly for RNA polymerase II

and III transcription of human snRNA genes depending upon the promoter architectures.

Materials and Methods

Chromatin immunoprecipitation assays

ChIP assays from HeLa cells were performed using the anti-CKZa (Ab245), anti-
CK213(Ab278) antibodies (Yu etal., 1991) as well as anti-SNAP43 (CS48) (Henry et al.,
1995) and anti-TBP antibodies described previously (Hirsch et al., 2004). Enrichment of

genomic sequences in the immunoprecipitation reactions was measured by PCR as

previously described (Hirsch et al., 2004).

RNAi

CK20t and CK2a' cDNA were generated with a T7 promoter at both ends by RT-

PCR using total RNA from HeLa cells as a template. The primers for CK2a are CK2a

60

forward 5 -GCGTAATACGACTCACTATAGGAAATAATGAAAAAGTTGTTG-3 ,
and CK20t reverse 5 -GCGTAATACGACTCACTATAGGCTCTTGCAGTAAGCCGT
GAC-3 . The primers for CK2a' are CKZOt' forward 5 -GCGTAATAC GACTCACTAT
AGGCAACAATGAGAGAGTGGTTG-3 , and CKZa' reverse 5 -GCGTAATACGACT
CACTATAGGTCTGTTGATGGTCGTATCGC-3 . LacZ cDNA with a T7 promoter at
both ends was generated by PCR using pPelican-lacZ as a template. The primers used
are lacZ forward 5 - TTAATACGACTCACTATAGGGAGACGATAACCACCACGCT
CATCG-3 , and lacZ reverse 5 - TTAATACGACTCACTATAGGGAGAGCGTTACC
CAACTTAATCGCC-3 . Resultant cDNAs were subjected to in vitro transcription with
T7 polymerase to produce double stranded (ds) RNA. After DNase I treatment, dsRNA
was incubated with recombinant Dicer and resultant Dicer generated small interfering
RNA (d-siRNA) were purified according to the manufacturer’s instructions (lnvitrogen).
Approximately 250 ng of d-siRNA for lacZ, CK2a, or CK20L plus 250 ng CKZa’ d-
siRNA were transfected into HeLa cells using Lipofectamine 2000 (lnvitrogen). Cells
were harvested 30 hr later and total RNA was extracted using TriZol (Gibco). Reverse
transcription (RT)-PCR was carried out using Titan One Tube RT-PCR System (Roche).
The primers used to amplify U1 primary transcript are U1 prim forward 5 -
ACTTGCTGCTTCACCACGAA-3 , and U1 prim reverse 5 -
ACAGCCTCATACGCCTCACT-3 . The primers used to amplify the total U1 snRNA
population are U1 forward 5 -ATACTTACCTGGCAGGGGAG-3 , and U1 reverse 5 -
CAGGGGAAAGCGCGAACGCA-3 . RT-PCR products were separated by 3% Tris
borate EDTA agarose electrophoresis, stained with ethidium bromide, and visualized with

Kodak imaging software.

61

In vitro transcription assays

In vitro transcription of human U1 and U6 snRNA genes were performed as
described previously (Lobo and Hernandez, 1989), with the following modifications.
The HeLa cell nuclear extracts were pre-incubated with Dignam buffer D either with or
without recombinant CK2 and kinase inhibitors for 60 min at 30°C prior to initiating
transcription by addition of transcription buffers, nucleoside triphosphates, and DNA
templates. The amounts of recombinant CK2, and kinase inhibitors used are indicated in
the figure legend. Transcripts were separated by denaturing PAGE and visualized by

Phosphorlmager analysis (Molecular Dynamics).

Expression and purification of recombinant proteins

GST-SNAP19O (1-719) was expressed in Escherichia coli BL21 (DE3) using the
vector pSBet-GST-SNAP190 (1-719) and was purified for in vitro kinase assays by
affinity chromatography using glutathione-sepharose beads (Amersham Biosciences).
Recombinant mini-SNAPC, containing SNAP190 (1-719), SNAP43, and SNAPSO, was
co-expressed in E. coli using the vector combination pSBet-GST-SNAP190 (1-719) and
pE’I21-His-SNAP43/HA-SNAP50. Recombinant mini-SNAPC was affinity purified
using glutathione agarose beads followed by digestion with thrombin to release the

complex from the GST-tag, and dialysis against Dignam buffer D containing 80 mM KCl.

62

Immunoprecipitation and in vitro kinase assays

For the experiment presented in Figure 11-3 A, 60 and 180 ILL of HeLa cell
nuclear extract (~10 mg/mL) was incubated with 20 uL of rabbit anti-SNAP43 (C848)
(Henry et al., 1995), anti-SNAP190 (C8398, C8402) (Henry et al., 1995), anti-CKZOL
(AB245) (Yu er al., 1991) or pre-immune antibodies covalently coupled to protein-G
agarose beads. Recovered proteins were analyzed by Western blot using a mouse mAb
against CK2a (Transduction Laboratories). For Figure II-3 B, 40 1.1L of HeLa cell
nuclear extract was used for each immunoprecipitation. After extensive washing with
HEMGT-ISO buffer (20 mM Hepes, pH 7.9, 0.1 mM EDTA, 5 mM MgC12, 10%
glycerol, 0.5% Tween-20, 150 mM KCI), the beads were suspended in 40 11L of
HEMGT-ISO buffer containing 2 uL of y[32P]-ATP (6000 Ci/mmol, 150 mCi/mL), and
the samples were incubated at 30°C for 15 min. The beads were then washed extensively
in HEMGT-ISO buffer and proteins were separated by 12.5% SDS-PAGE. Radiolabeled
proteins were visualized by autoradiography. For Figure 11-3 C, 100 uL of HeLa cell
nuclear extracts were used for immunoprecipitation. After kinase reactions, proteins
were separated by SDS-PAGE and transferred to nitrocellulose membrane. Radiolabeled

proteins were detected first by autoradiography. Subsequently, Western blot analyses

were performed using anti-SNAP190 (C8402) antibodies.

For Figure II-SB and 5C, approximately 5 pg of GST-SNAP190 (1-719) was
bound to glutathione agarose beads (10 11L). Immobilized GST-SNAP190 (1-719) was
incubated with 10 uL HeLa cell nuclear extract for 30 min at 30°C. The beads were

washed extensively with HEMGT-ISO. In vitro kinase assays were then performed

63

directly on the beads. Kinase reactions were also performed using untreated GST-
SNAP190 (1-719) plus 10 units of recombinant CK2 (New England Biolabs). Where
indicated, kinase reactions were performed in the presence of 20 nM y[32P]-ATP or
y[32P]-GTP with or without D-ribofuranosyl benzimidazole (DRB; Sigma) or 3,3 ,4 ,5,7-

pentahyroxyflavone (quercetin; Sigma).

T typtic phosphopeptide mapping

To obtain material for thin layer chromatography (TLC) analysis, approximately 1
pg GST-SNAP190 (1-719) was labeled with y[32P]-ATP by using HeLa cell nuclear
extracts or recombinant CK2. Phosphorylated G8T-SNAP190 (1-719) was gel purified
prior to digestion with sequencing grade modified trypsin (Promega). The tryptic
fragments from each of these reactions were spotted individually or were combined at a
1:1 ratio and spotted onto a cellulose TLC plate. Peptides were separated in the first
dimension by electrophoresis in pH 1.9 buffer (formic acid (88% w/v)/glacia1 acetic
acid/dH20, 25:78:897, v/v/v) and in the second dimension by chromatography in
chromatography buffer (n-butanol/pyridine/ glacial acetic acid/dHZO, 15:10:13:12,

v/v/v/v) prior to detection by Phosphorlmager analysis (van der Geer and Hunter, 1994).

Phosphoamino Acid Analysis

Endogenous SNAP190 was immunoprecipitated, phosphorylated in vitro in the
presence of 2 uL of y[32P]-ATP (6000 Ci/mmol, 150 mCi/mL), separated by 7.5% SDS-
PAGE, and transferred to nitrocellulose membrane. The ~l90 kDa radioactive protein

corresponding to SNAP190 was excised and hydrolyzed in 5.7N HCl for 1 hr at 100°C.

64

Recovered amino acids were vacuum dried and dissolved in 10 ILL pH 1.9 buffer
containing unlabeled phosphoserine, phosphothreonine and phosphotyrosine mixture.
The mixture was separated by one-dimensional electrophoresis (500V) on cellulose thin
layer chromatography (TLC) plates (Eastman Kodak Co.) for 1 hr at 0 °C in pH 2.5
buffer [67% pH 3.5 buffer (glacial acetic acid/pyridine/water, 50:5:945, v/v/v, containing
0.5 mM EDTA) and 33% pH 1.9 buffer (glacial acetic acid/88% formic acid/water,
78:25:897, v/v/v)]. Unlabeled amino acid standards were visualized by spraying the
cellulose plates with ninhydrin. The 32P-labeled amino acid residues were visualized by

autoradiography with a phosphorimager.

Electrophoretic mobility shift assays

Approximately 100 ng of purified mini-SNAPC and/or 30 ng TBP were
preincubated alone or with 15 or 150 units CK2 and/or 7 mM ATP for 30 min at 30°C.
EMSAs were then performed using DNA probes containing a wild-type mouse U6 PSE
with a wild-type or mutant human U6 TATA box as described previously (Hinkley et al.,

2003; Mittal and Hernandez, 1997).

Results

CK2 inhibits U1 snRNA gene transcription.
The conservation of similar promoter architectures among the human snRNA
gene family suggests that these genes could be coordinately regulated. That CK2

regulates human U6 snRNA gene transcription by RNA polymerase III (Hu et al., 2003)

65

prompted us to examine whether CK2 similarly regulates human snRNA gene
transcription by RNA polymerase II. First, chromatin immunoprecipitation (ChIP)
experiments were performed to determine whether endogenous CK2 could associate with
the promoter regions of both U6 and U1 snRNA genes. As shown in Figure II-l A, both
U6 and U1 promoter regions were enriched in immunoprecipitation reactions using anti-
CKZa antibodies (lane 7), while U1 but not U6 promoter regions were enriched in the
anti-CKZB immunoprecipitation reactions (lane 8). Similar results were obtained in
experiments performed with different antibodies directed against CK2a and CK2|3 (data
not shown). Possibly the epitopes recognized by the CKZB antibodies may be occluded
by other transcription factors at the U6 promoter. However, this result stands in contrast
with that noted previously (Hu et al., 2003), wherein a more robust CKZB association
with this U6 promoter was noted and only weak Ul promoter association by any CK2
subunit was detected. The reason for this discrepancy is unclear, but differences in
chromatin immunoprecipitation or cell growth conditions could potentially affect
promoter recovery by CK2 antibodies. The levels of U1 and U6 promoter recovery in
this reaction were less than that those observed in either anti-SNAP43 (lane 6) or anti-
TBP (lane 9) reactions, but markedly greater than that seen in reactions using IgG (lane
5). No significant enrichment of the GAPDH exon 2 or U1 upstream regions was
observed in any reactions. Therefore, endogenous CK2 associates with the promoter
regions of both U1 and U6 genes, and suggests the possibility that CK2 could
additionally affect human snRNA gene expression by RNA polymerase II.

To test whether endogenous CK2 influences human U1 gene expression in living

cells, CK2 levels were reduced by RNA interference (RNAi), and the effect on U1

66

Figure II-l. CK2 inhibits U1 snRNA in vivo gene expression. (A) Endogenous CK2
associates with snRNA gene promoters. Chromatin immunoprecipitation experiments
were performed using HeLa cell chromatin and the indicated antibodies. Enrichment of
the U6 and U1 promoter regions was detected by PCR and was compared to recovery of
the U1 upstream regions (U1 up) and GAPDH exon 2 (GAPDH), as negative controls.
(B) U1 primary transcripts accumulate after CK2 reduction. CK2 levels were reduced by
transient transfection of dicer generated small interfering RNA (Myers et al., 2003)
corresponding to CK20t (lane 7), or CK2a plus CKZOL’ (lane 8). Cells were also treated
with LacZ d-siRNA as a reference (lane 6). Levels of the U1 primary transcript and total
U1 population were monitored by RT-PCR (top). Endogenous CK2 and actin levels were
measured by Western analysis (bottom). For reference, lanes 1-5 contain two-fold
decreasing increments of material harvested from untreated cells to serve as a standard

curve for each assay.

67

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

68

A Q
a a .. .
Input 2 Q Q m
(g, a) o o 1-
~ - a :5 a :5
- c- - a —- .- U6
- - “ - — -- - U1
- «- -- U1 up
- .- - GAPDH
1 2 3 4 5 6 7 8 9
B d-siRNA
w 1
Input 5
fir-m..- mfg U1primary
RT-PCR
u- - '9 an- U1 total
'- r“ "" “r“ CK2a
Western
~-— '“" "" - Actin
1 2 3 4 5 6 7 8

snRNA production was monitored by RT-PCR (Figure II-l B). As a negative control,
RNAi was also performed using lacZ-specific RNA. As it was demonstrated that
phosphorylation of the carboxy terminal domain (CTD) of RNA polymerase II
contributes to 3 processing of human U2 snRNA (Jacobs et al., 2004; Medlin et al.,
2003), it was possible that CK2 could also play a role in U1 3 processing. Therefore, in
this experiment, different primer combinations were used to detect either the primary U1
snRNA transcript that is normally processed rapidly or the total U1 snRNA steady state
population. Lanes 1-5 (top panel) shows that amplification of the U1 primary transcript
and total U1 snRNA levels were directly correlated with the amount of RNA included in
the reaction. Interestingly, U1 primary transcript levels were increased in cells treated
with CK2a RNAi (lane 7) and this effect was enhanced by RNAi directed against both
CK2a and CKZOL’ (lane 8) as compared to cells treated with LacZ-specific RNAi (lane 6).
Steady state U1 snRNA levels remained effectively unchanged by any of these treatments,
consistent with their abundant and extremely stable nature. In this experiment,
endogenous CK2 levels were reduced approximately 2-4 fold relative to the levels
observed in the LacZ-RNAi treated cells, whereas actin levels were unaltered by any of
the treatments (bottom panel). The increase in U1 primary transcripts with reduced CK2
levels suggests that endogenous CK2 normally stimulates U1 3 processing and/or

inhibits U1 transcription.

To determine whether CK2 plays a direct role in U1 snRNA gene transcription,
recombinant CK2 and commonly used inhibitors of CK2 were tested for their effect using
in vitro U1 transcription assays. One characteristic of CK2 is that it can be inhibited by

both DRB and quercetin, and therefore, these inhibitors were selected. As a positive

69

control for CK2 activity, in vitro U6 transcription was also examined (Figure 11-2 A).
First, U6 transcription was inhibited with increasing amounts of the kinase inhibitor DRB
(lanes 2 and 3) and DRB action was reversed by addition of CK2 (lane 4). Together,
these data suggest that CK2 has an overall positive role in U6 transcription, consistent
with observations previously described (Hu et al., 2003). No measurable effect on U1
transcription was observed by addition of recombinant CK2 (compare lanes 5 and 6),
perhaps because the HeLa cell extracts used for these experiments contain high levels of
CK2 and CK2 activity is not rate limiting for transcription. U1 transcription was
inhibited by DRB (lane 7),but inhibition was not reversed by addition of CK2 (lane 8),
suggesting, in addition to CK2, DRB inhibits a kinase activity that is important for U1
snRNA gene activity. Indeed, the DRB sensitive elongation factor p-TEFb, which
phosphorylates the CTD of RNA polymerase 11 (Price, 2000), also contributes positively

to efficient U1 transcription in vitro (data not shown).

Next, the effect of quercetin in U1 transcription was tested. As shown in Figure
11-2 B, and in contrast with DRB, quercetin addition stimulated U1 transcription (lanes 2
and 3). The increased background in reactions containing quercetin indicates this
inhibitor may have non-specific positive effects on transcription possibly from cryptic
promoters on the reporter plasmid. While quercetin can inhibit a variety of kinases, the
increase in Ul-specific transcription was reversed by addition of increasing amounts of
recombinant CK2 (lanes 4 and 5), suggesting that CK2 has a direct and overall negative
role in controlling U1 transcription. Previously, U2 snRNA gene transcription by RNA
polymerase II in nuclear run-on assays was not sensitive to DRB (Jacobs et al., 2004;

Medlin et al., 2003), suggesting that CK2 is not involved in the transcription of these

70

Figure II-2. CK2 represses in vitro U1 transcription. (A) CK2 reverses inhibition of
U6, but not U1, transcription by the kinase inhibitor DRB. In vitro U6 transcription
assays were performed in the absence (lane 1) or presence of DRB (lane 2, 1 uM DRB;
lanes 3 and 4, 7 uM DRB). The reaction shown in lane 4 also contains 10 units of
recombinant CK2. In vitro U1 transcription assays were performed using a U1 G-less
cassette in the absence (lanes 5 and 7) or presence of 10 units of recombinant CK2 (lanes
6 and 8), either in the absence (lanes 5 and 6) or presence of 7 uM DRB (lanes 7 and 8).
(B) In vitro U1 transcription is sensitive to the CK2 inhibitor quercetin. Additional U1
transcription assays were performed in the absence (lane 1) or presence of 1 uM (lanes 2)
and 7 uM quercetin (lanes 3-5), respectively, while an additional 10 and 100 units of

CK2 were added to reactions shown in lanes 4 and 5, respectively.

71

+

DRB

‘lDRBI I
——— +cK2 -_:':—.+ CK2

 

a...»-

U6 “on“? or U1

 

 

 

 

 

-_—--—+ 10 IC

 

 

1234 5678

Quercetin

 

 

Pa}. -'. . stile-.1 1'.
"-IN' '2: ”’1’ A."
,
, .1 A. '
I '. 1'.-
L1

 

 

 

72

U1

genes. The possibility remains that U1 and U2 gene transcription are differentially
sensitive to regulation by CK2. Nonetheless, as U1 and U2 genes utilize similar promoter
elements and general transcription factors for efficient transcription, a role for CK2 in U2

transcription cannot yet be dismissed.

Endogenous CK2 targets SNAP190 for phosphorylation at multiple sites.

SNAPc recognizes the core promoters of human snRNA genes and plays an
important early role in coordinating transcription of snRNA genes by both RNA
polymerases II and III. The findings that CK2 can affect both human U1 and U6
transcription (Hu et al., 2003) implicates SNAPC as a potential target for CK2. First, we
examined whether CK2 co-purifies with SNAPc. As shown in Figure II-3 A, endogenous
CK2 from HeLa cell nuclear extract was recovered with SNAPC during
immunoprecipitation using anti-SNAP190 (lanes 4 and 5) or anti-SNAP43 (lane 3)
antibodies but not while using IgG antibodies (lane 2). These levels of recovered CK2
are significantly less than that observed in reactions using antibodies against CK2a (lane
7), suggesting that only a minor proportion of CK2 is associated with SNAPc or that the
interaction between SNAPC and CK2 is not stable. In separate experiments, recombinant
CK2 alone did not cross-react with the anti-SNAP43 antibodies (data not shown),
suggesting that recovery of CK2 in these assays requires SNAPC. These results indicate
that endogenous CK2 associates with SNAPC.

Next, to determine whether any subunits of SNAPC can be phosphorylated by

SNAPc-associated kinase(s), including CK2, the anti-SNAP43 immuno-precipitated

73

Figure 11-3. Endogenous CK2 associates with SNAPC. (A) HeLa cell nuclear extracts
were immunoprecipitated with pre-immune (lane 3), anti-SNAP190 (lane 4, CS398; lane
5, C8402), anti-SNAP43 (lane 6, C848), or anti-CK2a (lane 7, Ab245) antibodies, as
indicated. Recovered proteins were analyzed by Western blot analysis using antibodies
directed against the or subunit of CK2. Lanes 1 and 2 contain 3 and 1 uL of nuclear
extract, respectively. (B) Multiple subunits of SNAPC are phosphorylated in vitro by a
SNAPc-associated kinase activity. Immunoprecipitation reactions were performed from
HeLa cell nuclear extracts using anti-SNAP43 (lane 1) or pre-immune (lane 2) antibodies
that were immobilized on protein G agarose beads. After extensive washing, an in vitro
kinase assay was performed on the beads in the presence of 2 uL of y[32P]-ATP (6000
Ci/mmol, 150 mCi/mL). Proteins were then separated by 15% SDS-PAGE and
radiolabeled proteins were detected by autoradiography. The positions of SNAP190 and
SNAP43 are labeled whereas a protein that migrates similarly to SNAP19 is indicated by
an asterisk. (C) SNAP190 co-migrates with a 190-kDa phosphoprotein. HeLa cell nuclear
extracts were immunoprecipitated with pre-immune (lane 1), anti-SNAP43 (lane 2), or
anti-SNAP190 antibodies (lanes 3 and 4). Recovered samples were subjected to an in
vitro kinase assay in the presence (lanes 1-3) or absence (lane 4) of y[32P]-ATP. Proteins
were separated by 7.5% SDS-PAGE and transferred to nitrocellulose membrane.
Radiolabeled proteins were detected by autoradiography for 1 hour (lanes 1-4). This
membrane was then used for Western blot analysis using antibodies directly against
SNAP190. Lanes 5 and 6 are the same as lanes 3 and 4 but exposed on film for 5
seconds. The position of SNAP190 is indicated.

*The experiment in B was performed by RW Henry.

74

 

. ea...

mvm<zm .o
om Fn.<zm a
om..m<zm o

88.9..

5%. m2

234567

 

 

1

m
m
m
i.

 

;<-SNAP43

|
l
I
l
l
a
l
|

 

 

 

. + a SNAP431P

        

 

 

 

d

E
Q aSNAP19OIP
a. 1 fl
+ + — + — tlazPlATP
“a Hg- 4—SNAP190
5 e

N
0)

4 I

 

kinase assay a SNAP190
Western

76

proteins were directly assayed for kinase activity by incubation with 2 1.1L of y[32P]-ATP
(6000 Ci/mmol, 150 mCi/mL). As shown in Figure II-3 B, robust phosphorylation of a
190 kDa protein was observed in the anti-SNAP43 immunoprecipitated samples (lane 1),
suggesting that SNAP190 is extensively phosphorylated in this assay. After a longer
exposure (as shown in Figure II-3 B), proteins of 60 kDa, 43 kDa (labeled SNAP43) and
19 kDa (labeled *) in size were additionally observed. The identity of the 60 kDa protein
is unknown; however, these results suggest that SNAP43 and SNAP19 were also
phosphorylated in these assays but to a much lesser extent than SNAP190.

To confirm the identity of the proteins phosphorylated by the SNAPc-associated
kinase, immunopurified SNAPC was used for in vitro kinase assays followed by Western
blot analysis using SNAPc-specific antibodies (Figure II-3 C). A 190 kDa protein is
phosphorylated in kinase assays using material recovered by either anti-SNAP43 (lane 2)
or anti-SNAP190 (lane 3) immunoprecipitation, but not by immunoprecipitation with
preimmune antibodies (lane 1). As expected, no phosphorylation was observed when
y[32P]-ATP was not included in the kinase reaction (lane 4). Lanes 5 and 6 show the
results of anti-SNAP190 Western blot analysis for the same reactions shown in lanes 3
and 4. SNAP190 is detected in both reactions regardless of whether y[32P]-ATP is added
or not. Importantly, SNAP190 as detected by Western blot analysis co-migrated with the
190 kDa protein that is phosphorylated by the SNAPc-associated kinase, indicating that
the 190 kDa phosphoprotein is indeed SNAP190. In similar experiments, SNAP43 co-
migrated with the 43 kDa phosphoprotein (data not shown), suggesting that SNAP43 is
also phosphorylated by the SNAPc-associated kinase. A similar experiment performed to

determine whether the 19 kDa phosphoprotein observed in the in vitro kinase assays is

77

SNAP19 was inconclusive because our anti-SNAP19 antibodies were not sensitive
enough to detect SNAP19 in this assay. Taken together, these results demonstrate that a
SNAPc-associated kinase phosphorylates SNAP190 and SNAP43.

To determine whether endogenous SNAPC is phosphorylated, anti-SNAP43
immunoprecipitation reactions were performed from HeLa cell nuclear extracts and
recovered proteins were directly analyzed by Pro-Q diamond staining (Molecular Probes),
which specifically detects phosphorylated proteins. As shown in Figure II-4, a protein of
approximately 190 kDa was detected in the anti-SNAP43 immunoprecipitated sample
(lane 5) that was not observed in a similarly immuno-precipitated sample treated with
phosphatase (lane 6), indicating that this protein is phosphorylated. The 190 kDa protein
was not detected in the sample recovered by immunoprecipitation with non-specific
antibodies (lane 4). Furthermore, the 190 kDa protein co-migrated with HA-tagged
SNAP190 recovered by anti-HA immune-precipitation from transiently transfected HeLa
cells (lane 7), suggesting that the endogenous 190 kDa phosphoprotein is SNAP190.
This same gel was analyzed by Sypro ruby staining to detect the total level of recovered
proteins. The 190 kDa protein was detected in both the untreated (lane 2) and
phosphatase-treated (lane 3) samples, although SNAP190 staining was reduced in the
latter sample. In all immuno-precipitated samples, significant levels of IgG heavy chain
were detected by Sypro ruby staining (bottom panel), but not by Pro-Q diamond staining,
further demonstrating that phosphorylated proteins are specifically detected in this assay.
Therefore, we conclude that endogenous SNAP190 is phosphorylated. Other subunits of

SNAPC were not detected in these assays (not shown) perhaps because they are not

78

Figure 11-4. Endogenous SNAPC is phosphorylated. HeLa cell nuclear extracts were
immuno-precipitated by either pre-immune (lanes 1 and 4) or anti-SNAP43 antibodies
(lanes 2-3 and 5-6). The protein complex recovered by anti-SNAP43
immunoprecipitation was left untreated (lanes 2 and 5) or dephosphorylated by calf
intestine alkaline phosphatase (lanes 3 and 6). As an additional size marker, HA-
SNAP19O was over expressed in HeLa cells by transient transfection and was immuno-
precipitated using an anti-HA antibody (lane 7). Proteins were separated by 7.5% SDS-
PAGE and were stained first with Pro-Q diamond phosphoprotein dye (lanes 4-7) and
then with SYPRO Ruby total protein dye (lanes 1-3).

79

 

 

1 fl
LL LL
9 a
a a a
—. Z Z
9 co cn
a. ti 5
:....- -t
jet-T: fag 1‘}.
l
- f . ‘— s-L — .- chain
1 2 3 4 5 6
M I l— I

 

total protein stain phosphoprotein stain

80

Figure 11-4. Endogenous SNAPC is phosphorylated. HeLa cell nuclear extracts were
immuno-precipitated by either pre-immune (lanes 1 and 4) or anti-SNAP43 antibodies
(lanes 2-3 and 5-6). The protein complex recovered by anti-SNAP43
immunoprecipitation was left untreated (lanes 2 and 5) or dephosphorylated by calf
intestine alkaline phosphatase (lanes 3 and 6). As an additional size marker, HA-
SNAP190 was over expressed in HeLa cells by transient transfection and was immuno-
precipitated using an anti-HA antibody (lane 7). Proteins were separated by 7.5% SDS-
PAGE and were stained first with Pro-Q diamond phosphoprotein dye (lanes 4-7) and
then with SYPRO Ruby total protein dye (lanes 1-3).

79

 

 

' ' I | 1—1
°—- 1- e e
s a e e
% 9: 2% it: e
c—? z z 5. z z <
9 ‘3 ‘3 9 ‘3 ‘3 =5
0- a.
‘ ' + - - + — pptase
T" T " , ' we
“':7" *“ . _ -
t.‘...':‘11 . a“ .. film SNAP190

|
I l ' ’ . IgG
1 . ‘ 1 heavy
L ‘ l l m3 ' ,_ V l chain
. 1 2 34 4 5 6 7
total protein stain phosphoprotein stain

80

phosphorylated in vivo or the recovered levels of phosphorylated protein in these assays
were below the threshold of detection using the Pro-Q diamond stain.

We had previously observed that recombinant SNAP43 was preferentially
phosphorylated when assembled into SNAPC and furthermore, efficient SNAP43
phosphorylation required SNAP190 (1-719), suggesting that SNAP190 is responsible for
recruiting a kinase activity to the complex (data not shown). In those experiments,
SNAP190 (1-719) was also extensively phosphorylated. Therefore, to determine whether
CK2 interacts with SNAP190, GST-SNAP190 (1-719) was used to affinity purify
kinase(s) activity from HeLa nuclear extracts and anti-CK2 Western analysis was
performed (Figure II-S A). Significant amounts of CK2 associated with GST-SNAP190
(1-719) relative to that observed in reactions containing GST (compare lanes 5 and 6 to
lanes 3 and 4), indicating that CK2 can interact with SNAP190.

To investigate whether CK2 is the predominant kinase that associates with GST-
SNAP190 (1-719) in these assays, the effect of kinase inhibitors on GST-SNAP190 (l-
719) phosphorylation by the HeLa cell-derived kinase was investigated. As shown in
Figure 11-5 B (top panel), both DRB (lanes 2-4) and quercetin (lanes 5-7) were effective
in limiting the extent of GST-SNAP190 (1-719) phosphorylation as compared to the
untreated sample (lane 1). A second hallmark of CK2 is that it is capable of utilizing
GTP as a phosphoryl group donor. Indeed, robust phosphorylation of GST-SNAP190 (1-
719) was observed when y3zP]-GTP was included in the reaction (bottom panel, lane 1),
and this GTP-based phosphorylation was inhibited by DRB (lanes 2-4) and quercetin
(lanes 5-7), consistent with the idea that endogenous CK2 can associate with and

phosphorylate SNAP190.

81

 

Figure II-S. Endogenous CK2 phosphorylates the N-terminal region of SNAP190. (A)
Endogenous CK2 can interact with SNAP190 (1-719). Approximately 3 pg of
recombinant GST (lanes 3 and 4) or GST-SNAP190 (1-719) (lanes 5 and 6) were bound
to glutathione agarose beads and incubated with 60 and 180 uL of HeLa cell nuclear
extract. Associated proteins were separated by 12.5% SDS-PAGE for anti-CK2a
Western analysis. Lanes 1 and 2 contain 3 and 1 11L of nuclear extract, respectively.
(B) The SNAP190-associated kinase activity exhibits properties of CK2. Recombinant
GST-SNAP190 (1-719) bound to glutathione agarose beads was pre-treated with HeLa
cell nuclear extracts, washed, and was then incubated with either y[32P]-ATP (top panel)
or y[32P]-GTP (bottom panel) in the presence of l, 7, 50 uM DRB (lanes 2, 3 and 4,
respectively) or 1, 7, 50 uM quercetin (lanes 5, 6 and 7, respectively). GST-SNAP190
(1-719) in lane 8 was treated with recombinant CK2 (10 units). The amounts of GST-
8NAP190 (1-719) used in each reaction were visualized by Coomassie blue staining prior
to autoradiography. (C) Recombinant CK2 and the SNAP190-associated kinase from
HeLa cell nuclear extracts phosphorylate the same regions within SNAP190 (1-719).
Analysis of tryptic fragments obtained from radiolabeled GST-SNAP190 (1-719)
phosphorylated by the SNAP190 associated kinase (left panel) or by recombinant CK2
(middle panel) was performed by two dimensional thin layer electrophoresis in the first
dimension followed by thin layer chromatography in the second dimension. The tryptic
peptides obtained from each of these samples were mixed at 1:1 ratio for analysis (right
panel). The major phosphopeptides are indicated. The directions of electrophoresis and
chromatography are indicated by arrows. (D) CK2 phosphorylates SNAP190 at serine
residues. Radioactively labeled endogenous SNAP190 was acid hydrolyzed and
dissolved in pH 1.9 buffer containing cold phosphoserine, phosphothreonine and
phosphotyrosine. The mixture was separated by one dimensional thin layer
electrophoresis and phosphoamino acids were visualized with ninhydrin (lane 1).
Subsequently, radiolabeled phosphoamino acids were detected by Phosphorlmager
analysis (lane 2). Identical results were obtained with full length HA-SNAP190 and
GST-SNAP190 (1-719) (not shown).

82

Input esr leer-190

 

 

 

 

 

HeLa NE 3

 

DRB Quercetin

-fi an. #3:: .- ' I mad
7|"me- E —- j Ioaraph

S‘II-Udu-IQCImmmio

 

 

 

 

 

 

I2 3"45‘3'7 a
In vitro klnase assay

83

 

 

 

 

 

 

 

PTI‘I' 412”; .
pW - '-__‘;':-;j
615-4: ”‘3
T _ Incorwlata
W
1 2

TLE phosphoamlno acld analysis

84

To further examine the extent of SNAP190 phosphorylation by endogenous CK2,
GST-SNAP190 (1-719) was phosphorylated either by recombinant CK2 or by
endogenous kinase(s) present in the HeLa cell extract that are capable of associating with
SNAP190. Subsequently, phosphorylated GST-SNAP190 (1-719) was digested with
trypsin and the radiolabeled peptides were compared by two-dimensional TLC (Figure 11-
5 C). This analysis revealed two major SNAP190 tryptic peptides that were
phosphorylated by the kinase recruited from HeLa cell extracts (left panel) and by
recombinant CK2 (middle panel). The tryptic peptides from both these kinase reactions
were then mixed and analyzed as before (right panel). As had been observed for the
individual analysis of the tryptic peptides, only two predominant spots were observed,
suggesting that recombinant CK2 and the kinase activity from HeLa cells phosphorylate
SNAP190 within the same regions, thus providing additional evidence confirming that
the HeLa cell-derived kinase is CK2. Endogenous SNAP190 that was phosphorylated by
HeLa cell derived CK2 was also hydrolyzed for phosphoamino acid analysis (Figure II-S
D), which revealed that phosphorylation was occurring predominantly on serine residues
in this assay. Given the above observations, we conclude that the major SNAP190

associated kinase in HeLa nuclear extracts is CK2.

CK2 restricts SNAPC promoter recognition.

An examination of the amino acid sequence of SNAP190 (1-719) revealed a total
of 13 CK2 consensus motifs containing serines, most of which are clustered around
regions involved in cooperative promoter recognition by SNAPC in the presence of TBP

(Hinkley et al., 2003; Ma and Hernandez, 2002). Other CK2 sites are contained within

85

the Myb DNA binding domain of SNAP190, in particular, the Rh and Ra Myb repeats
(Wong et al., 1998). As CK2 had previously been shown to inhibit DNA binding by
other Myb-domain proteins (Luscher et al., 1990), these observations immediately
suggested the possibility that CK2 could potentially inhibit both DNA binding and TBP
recruitment by SNAPC.

To test whether CK2 could affect DNA binding by SNAPC, EMSAs were
performed with DNA probes resembling either a U6 (wild type PSE and TATA) or U1
promoter (wild type PSE with mutant TATA). The recombinant SNAPc used in these
reactions is a partial complex containing full-length SNAP43 and SNAPSO along with
SNAP190 (1-719), hereafter referred to as mini-SNAPC, and this complex is competent
for both U1 and U6 promoter binding. As shown in Figure II-6, robust U6 promoter
binding was observed by recombinant mini-SNAPC in the absence (lane 2) or presence of
increasing amounts of recombinant CK2 (lanes 3 and 4) or ATP (lane 5) alone. However,
PSE recognition by mini-SNAPC was dramatically inhibited by the addition of ATP along
with recombinant CK2 (lanes 6 and 7), suggesting that SNAPC phosphorylation by CK2
inhibits its ability to recognize the PSE.

In addition to direct promoter recognition, SNAPC functions to recruit TBP to the
TATA-box that is adjacent to the PSE within human U6 snRNA genes (Mittal and
Hernandez, 1997). Therefore, the effect of mini-SNAPC phosphorylation on its ability to
cooperatively bind with TBP on the U6 promoter was tested. In these assays, full-length
human TBP alone does not bind well to the U6-specific probe either in the presence or

absence of CK2 and ATP (lane 8, and data not shown, respectively). As expected,

86

Figure II-6. TBP and SNAPC cooperate at U6 but not at U1 promoter probes to
overcome CK2 inhibition of DNA binding by SNAPC. EMSA was performed using
U6-like (thSE, thATA) or Ul-like (thSE, muTATA) probes in the absence (lane 1)
or presence of recombinant mini-SNAPC (lanes 2-7 and 9-17). Reactions shown in lanes
8-17 also contained recombinant full-length human TBP. As indicated, reactions were
performed in the absence or presence of increasing amounts of recombinant CK2 (15 or
150 units) and ATP (7 mM). The reaction in lane 11 contained 150 units of CK2. The
positions of the mini-SNAPc/DNA and mini-SNAPc/TBP/DNA complexes are indicated.

87

Q.
mSNAPc E2 mSNAPc+TBP

I I l

----+++ +-++ -——+++ ATP

- A-A CK2

 
   
  

- miniSNAPc/TBP
, _ -miniSNAPc

 

 

 

 

1 2 3 4 5 e 7 e 91011121314151617

L._ 1L., 1
EMSA

88

formation of a super shifted complex is observed with mini-SNAPC and TBP in reactions
performed without CK2 and ATP (lane 9). Addition of only ATP to similar reactions did
not affect cooperative DNA binding by mini-SNAPC and TBP (lane 10), but interestingly,
cooperative DNA binding by mini-SNAPC and TBP was maintained in reactions
containing ATP and CK2 under conditions where DNA binding by mini-SNAPC alone
was impaired (lane 11). Reduced formation of the mini-SNAPc/DNA complex in this
reaction indicates that most of the mini-SNAPC is likely phosphorylated. Therefore, CK2
restricts promoter recognition by mini-SNAPC alone while permitting higher order
complex formation with TBP on the U6-specific probe.

Next, whether TBP could overcome CK2-mediated inhibition of DNA binding by
SNAPc on U1 -specific probes was tested. On these TATA-less probes, only PSE binding
by mini-SNAPC was observed in the absence (lane 12) or presence of CK2 (lanes 13 and
14) or ATP (lane 15) individually. TBP also did not rescue PSE recognition by mini-
SNAPC on the Ul-related probe in reactions containing CK2 and ATP (lanes 16 and 17).
Therefore, TBP requires direct promoter recognition via the TATA box to overcome
CK2-imposed restricted promoter recognition by mini-SNAPC. Together, these results
suggest the intriguing possibility that CK2 inhibits DNA binding by SNAPc while
permitting robust promoter recognition by SNAPC and TBP on DNA probes containing

an appropriate arrangement of promoter elements.

89

 

Discussion

Human snRNA genes are transcribed by two different RNA polymerases
depending upon the core promoter structure of these genes. Within the core promoter,
the PSE is common to all human snRNA genes regardless of polymerase specificity and
consequently the basal transcription factor SNAPC that binds this element is used for
transcription by RNA polymerases II and 111 (Henry et al., 1996; Henry et al., 1998b;
Henry et al., 1995; Sadowski etal., 1996; Wong et al., 1998). Our data demonstrates that
CK2 inhibits RNA polymerase II transcription of human U1 snRNA genes in vitro and in
vivo. This observation is consistent with chromatin immunoprecipitation experiments
demonstrating that CK2 is present at endogenous human U1 and U6 snRNA gene
promoters in HeLa cells (Hu et al., 2003), which directly links this kinase to the

regulation of snRN A gene transcription in the cell.

The data presented herein further support a role for SNAPc as a target for CK2
regulation. In other experiments examining the role of CK2 for human U6 transcription,
SNAPC phosphorylation had minimal impact (Hu et al., 2004), raising the possibility that
SNAPC is not a target for CK2 regulation. As noted by the authors of that study, the
recombinant SNAPC used was expressed in insect cells and it could have been already
phosphorylated, and thus refractive to further effects of CK2. In that system, CK2
stimulated transcription by phosphorylating RNA polymerase 111, but also inhibited
transcription by phosphorylating the de1 subunit of TFIIIB (Hu et al., 2004). To
determine whether CK2 affects SNAPC function we examined the effect of
phosphorylation on recombinant SNAPC expressed in E. coli. Our studies indicate that

CK2 does impair SNAPC binding to the PSE within the U6 promoter but adjacent TBP

90

binding to the TATA-box can rescue SNAPC recruitment. Thus, CK2 may play an
important role in ensuring that SNAPC is not engaged in non-productive pre-initiation
complex formation at inappropriate sites in the genome by restricting DNA binding and
requiring multiple factors for promoter recognition. In contrast, TBP did not rescue
SNAPC binding to DNA containing the Ul-like arrangement of promoter elements,
suggesting that SNAPC phosphorylation by CK2 could be important for the repressive
effects of CK2 observed in U1 transcription. Whether CK2 can disable SNAPC already
bound to DNA is not known, but if so, this would suggest that CK2 could act after
preinitiation complex assembly. It will be important to determine the cellular context for

CK2 action on SNAPC.

In our assays, we observed that two subunits of SNAPC, SNAP190 and SNAP43,
were phosphorylated by CK2. Both SNAP43 and SNAP190 interact with TBP and are
candidates for regulatory intervention by CK2 to influence TBP recruitment at snRNA
gene promoters. However, we favor the idea that SNAP190 plays a dominant role in this
process. First, SNAP190 is a better substrate for CK2. Second, SNAP190 contains an
unusual Myb DNA binding domain consisting of four and a half Myb repeats (Wong et
al., 1998) and CK2 was shown previously to inhibit DNA binding by the c-Myb nuclear
oncoprotein (Luscher et al., 1990). That phosphorylated SNAPC can bind DNA
cooperatively with TBP in reactions wherein SNAPC is unable to bind DNA alone
(Figure II-6) argues that most SNAPC in these reactions is phosphorylated and against the
idea that CK2 inhibits SNAPC though phosphorylation of a residue that is critical for
DNA interaction. Instead, we speculate that phosphorylation induces a conformational

change in SNAP190 rendering it unable to recognize the PSE. Interestingly, a number of

91

CK2 sites within SNAP190 are located adjacently to the TBP-recruiting region (TRR)-1
and TRR-2 that are involved in TBP recruitment to the U6 promoter (Ma and Hernandez,
2002). TRR-2 coincides with the SNAP190 Re and Rd Myb repeats, and interaction with
TBP may unveil the SNAP190 Myb DNA binding domain to allow promoter recognition.
It is not known that these same regions are important for TBP recruitment to U1
promoters, but as we demonstrate, TBP does not overcome CK2-mediated inhibition of
DNA binding by SNAPC to Ul-Iike arrangement of promoter elements. This notion
further suggests that CK2 may have the capacity to differentially regulate U1 and U6
transcription even though SNAPC is universally used for snRNA gene transcription. As
with human U6 transcription, it remains possible that CK2 phosphorylates different
factors during the cell cycle to enact either positive or negative outcomes on U1

transcription.

92

References

Ares, M., Jr., Chung, J. S., Giglio, L., and Weiner, A. M. (1987). Distinct factors with
Spl and NF-A specificities bind to adjacent functional elements of the human U2 snRNA
gene enhancer. Genes Dev 1, 808-817.

Bai, L., Wang, Z., Yoon, J. B., and Roeder, R. G. (1996). Cloning and characterization of
the beta subunit of human proximal sequence element-binding transcription factor and its
involvement in transcription of small nuclear RNA genes by RNA polymerases II and III.
Mol Cell Biol 16, 5419-5426.

Cabart, P., and Murphy, 8. (2001). BRFU, a TFIIB-like factor, is directly recruited to the
TATA-box of polymerase 111 small nuclear RNA gene promoters through its interaction
with TATA-binding protein. J Biol Chem 276, 43056-43064.

Cabart, P., and Murphy, 8. (2002). Assembly of human small nuclear RNA gene-specific
transcription factor IIIB complex de novo on and off promoter. J Biol Chem 277, 26831-
26838.

Cabrejos, M. E., Allende, C. C., and Maldonado, E. (2004). Effects of phosphorylation by
protein kinase CK2 on the human basal components of the RNA polymerase II
transcription machinery. J Cell Biochem 93, 2-10.

Fairley, J. A., Scott, P. H., and White, R. J. (2003). TFIIIB is phosphorylated, disrupted
and selectively released from tRN A promoters during mitosis in vivo. EMBO J 22, 5841-
5850.

Ford, E., Strubin, M., and Hernandez, N. (1998). The Oct-1 POU domain activates
snRNA gene transcription by contacting a region in the SNAPc largest subunit that bears
sequence similarities to the Oct-1 coactivator OBF -1. Genes Dev 12, 3528-3540.

Ghavidel, A., and Schultz, M. C. (1997). Casein kinase II regulation of yeast TFIIIB is
mediated by the TATA-binding protein. Genes Dev 11, 2780-2789.

Ghavidel, A., and Schultz, M. C. (2001). TATA binding protein-associated CK2
transduces DNA damage signals to the RNA polymerase III transcriptional machinery.
Cell 106, 575-584.

Guerra, B., and Issinger, O. G. (1999). Protein kinase CK2 and its role in cellular
proliferation, development and pathology. Electrophoresis 20, 391-408.

Hanna, D. E., Rethinaswamy, A., and Glover, C. V. (1995). Casein kinase II is required

for cell cycle progression during G1 and GZ/M in Saccharomyces cerevisiae. J Biol
Chem 270, 25905-25914.

93

Henry, R. W., Ford, E., Mital, R., Mittal, V., and Hernandez, N. (1998a). Crossing the
line between RNA polymerases: transcription of human snRNA genes by RNA
polymerases II and 111. Cold Spring Harb Symp Quant Biol 63, 111-120.

Henry, R. W., Ma, 8., Sadowski, C. L., Kobayashi, R., and Hernandez, N. (1996).
Cloning and characterization of SNAPSO, a subunit of the snRNA- activating protein
complex SNAPC. EMBO J 15, 7129-7136.

Henry, R. W., Mittal, V., Ma, B., Kobayashi, R., and Hernandez, N. (1998b). SNAP19
mediates the assembly of a functional core promoter complex (SNAPc) shared by RNA
polymerases II and III. Genes Dev 12, 2664-2672.

Henry, R. W., Sadowski, C. L., Kobayashi, R., and Hernandez, N. (1995). A TBP-TAP
complex required for transcription of human snRNA genes by RNA polymerase II and 111.
Nature 374, 653-656.

Hernandez, N. (1992). Transcription of vertebrate snRNA genes and related genes. In
Transcriptional Regulation, 8. McKnight, and K. Yamarnoto, eds. (Cold Spring Harbor,
Cold Spring Harbor Laboratory Press), pp. 281-313.

Hernandez, N. (2001). Small nuclear RNA genes: a model system to study fundamental
mechanisms of transcription. J Biol Chem 276, 26733-26736.

Hinkley, C. S., Hirsch, H. A., Gu, L., LaMere, 13., and Henry, R W. (2003). The
SNAP190 Myb DNA binding domain stimulates TBP-TATA box recognition. J Biol
Chem 278, 18649-18657.

Hirsch, H. A., Jawdekar, G. W., Lee, K. A., Gu, L., and Henry, R. W. (2004). Distinct
Mechanisms for Repression of RNA Polymerase III Transcription by the Retinoblastoma
Tumor Suppressor Protein. Mol Cell Biol 24, 5989-5999.

Hockman, D. J., and Schultz, M. C. (1996). Casein kinase II is required for efficient
transcription by RNA polymerase 111. Mol Cell Biol 16, 892-898.

Hovde, 8., Hinkley, C. 8., Strong, K., Brooks, A., Gu, L., Henry, R. W., and Geiger, J.
(2002). Activator recruitment by the general transcription machinery: X-ray structural
analysis of the Oct-1 POU domain/human U1 octamer/SNAP190 peptide ternary
complex. Genes Dev 16, 2772-2777.

Hu, P., Samudre, K., Wu, 8., Sun, Y., and Hernandez, N. (2004). CK2 phosphorylation of
del executes cell cycle-specific RNA polymerase III transcription repression. Mol Cell
16, 81-92.

Hu, P., Wu, 8., and Hernandez, N. (2003). A minimal RNA polymerase III transcription

system from human cells reveals positive and negative regulatory roles for CK2. Mol
Cell 12, 699-709.

94

Jacobs, E. Y., Ogiwara, 1., and Weiner, A. M. (2004). Role of the C-terminal domain of
RNA polymerase II in U2 snRNA transcription and 3' processing. Mol Cell Biol 24, 846-
855.

Johnston, 1. M., Allison, S. J., Morton, J. P., Schramm, L., Scott, P. H., and White, R. J.
(2002). CK2 forms a stable complex with TFIIIB and activates RNA polymerase III
transcription in human cells. Mol Cell Biol 22, 3757-3768.

Kuhlman, T. C., Cho, H., Reinberg, D., and Hernandez, N. (1999). The general
transcription factors IIA, IIB, 11F, and IIE are required for RNA polymerase II
transcription from the human U1 small nuclear RNA promoter. Mol Cell Biol 19, 2130-
2141.

Lobo, S. M., and Hernandez, N. (1989). A 7 bp mutation converts a human RNA
polymerase II snRNA promoter into an RNA polymerase III promoter. Cell 58, 55-67.

Lobo, S. M., and Hernandez, N. T. (1994). Transcription of snRNA genes by RNA
polymerases II and III. In Transcription: Mechanisms and Regulation, R. C. Conaway,
and J. W. Conaway, eds. (New York, Raven Press, Ltd.), pp. 127-159.

Luscher, B., Christenson, E., Litchfield, D. W., Krebs, E. G., and Eisenman, R. N. (1990).
Myb DNA binding inhibited by phosphorylation at a site deleted during oncogenic
activation. Nature 344, 517-522.

Ma, 8., and Hernandez, N. (2001). A map of protein-protein contacts within the small
nuclear RNA-activating protein complex SNAPC. J Biol Chem 276, 5027-5035.

Ma, 3., and Hernandez, N. (2002). Redundant cooperative interactions for assembly of a
human U6 transcription initiation complex. Mol Cell Biol 22, 8067-8078.

Medlin, J. E., Uguen, P., Taylor, A., Bentley, D. L., and Murphy, 8. (2003). The C-
terminal domain of pol II and a DRB-sensitive kinase are required for 3' processing of U2
snRNA. EMBO J 22, 925-934.

Meggio, F ., and Pinna, L. A. (2003). One-thousand-and-one substrates of protein kinase
CK2? Faseb J 17, 349-368.

Mittal, V., Cleary, M. A., Herr, W., and Hernandez, N. (1996). The Oct-1 POU-specific
domain can stimulate small nuclear RNA gene transcription by stabilizing the basal
transcription complex SNAPc. Mol Cell Biol 16, 1955-1965.

Mittal, V., and Hernandez, N. (1997). Role for the amino-terminal region of human TBP
in U6 snRNA transcription. Science 275, 1136-1140.

95

Mittal, V., Ma, 8., and Hernandez, N. (1999). SNAP(c): a core promoter factor with a
built-in DNA-binding damper that is deactivated by the Oct-l POU domain. Genes Dev
13, 1807-1821.

Murphy, 8., Yoon, J. B., Gerster, T., and Roeder, R. G. (1992). Oct-1 and Oct-2
potentiate functional interactions of a transcription factor with the proximal sequence
element of small nuclear RNA genes. Mol Cell Biol 12, 3247-3261.

Myers, J. W., Jones, J. T., Meyer, T., and Ferrell, J. E., Jr. (2003). Recombinant Dicer
efficiently converts large dsRNAs into siRNAs suitable for gene silencing. Nat
Biotechnol 21, 324-328.

Niefmd, K., Guerra, B., Ermakowa, I., and Issinger, O. G. (2001). Crystal structure of
human protein kinase CK2: insights into basic properties of the CK2 holoenzyme. EMBO
J 20, 5320-5331.

Pinna, L. A. (2002). Protein kinase CK2: a challenge to canons. J Cell Sci 115, 3873-
3878.

Pinna, L. A., and Meggio, F. (1997). Protein kinase CK2 ("casein kinase-2") and its
implication in cell division and proliferation. Prog Cell Cycle Res 3, 77-97.

Price, D. H. (2000). P-TEFb, a cyclin-dependent kinase controlling elongation by RNA
polymerase 11. Mol Cell Biol 20, 2629-2634.

Sadowski, C. L., Henry, R. W., Kobayashi, R., and Hernandez, N. (1996). The SNAP45
subunit of the small nuclear RNA (snRNA) activating protein complex is required for
RNA polymerase II and III snRN A gene transcription and interacts with the TATA box
binding protein. Proc Natl Acad Sci U S A 93, 4289-4293.

Sadowski, C. L., Henry, R. W., Lobo, S. M., and Hernandez, N. (1993). Targeting TBP to
a non-TATA box cis-regulatory element: a TBP- containing complex activates
transcription from snRNA promoters through the PSE. Genes Dev 7, 1535-1548.

Schaub, M., Myslinski, E., Schuster, C., Krol, A., and Carbon, P. (1997). Staf, a
promiscuous activator for enhanced transcription by RNA polymerases II and III. EMBO
J 16, 173-181.

Schramm, L., and Hernandez, N. (2002). Recruitment of RNA polymerase III to its target
promoters. Genes Dev 16, 2593-2620.

Tawfic, 8., Yu, S., Wang, H., Faust, R., Davis, A., and Ahmed, K. (2001). Protein kinase
CK2 signal in neoplasia. Histol Histopathol 16, 573-582.

96

van der Geer, P., and Hunter, T. (1994). Phosphopeptide mapping and phosphoamino
acid analysis by electrophoresis and chromatography on thin-layer cellulose plates.
Electrophoresis 15, 544-554.

Wong, M. W., Henry, R. W., Ma, 8., Kobayashi, R., Klages, N., Matthias, P., Strubin, M.,
and Hernandez, N. (1998). The large subunit of basal transcription factor SNAPc is a
Myb domain protein that interacts with Oct-1. Mol Cell Biol 18, 368-377.

Yoon, J. B., and Roeder, R. G. (1996). Cloning of two proximal sequence element-
binding transcription factor subunits (gamma and delta) that are required for transcription
of small nuclear RNA genes by RNA polymerases II and III and interact with the TATA-
binding protein. Mol Cell Biol 16, 1-9.

Yu, I. J., Spector, D. L., Bae, Y. S., and Marshak, D. R. (1991). Immunocytochemical
localization of casein kinase 11 during interphase and mitosis. J Cell Biol 114, 1217-1232.

Zhao, X., Schramm, L., Hernandez, N., and Herr, W. (2003). A shared surface of TBP

directs RNA polymerase II and III transcription via association with different TFIIB
family members. Mol Cell 11, 151-161.

97

CHAPTER THREE

CK2 PHOSPHORYLATION OF SNAP190 NEGATIVELY REGULATES

SNAPC FUNCTION
Abstract

Human small nuclear RNAs play fundamental roles in regulating protein-coding
gene transcription and in processing of other RNAs. The general transcription factor
snRNA activating protein complex (SNAPC) is required for all human snRNA gene
transcription. In our previous study discussed in chapter 2, we showed that SNAP190,
the largest subunit of SNAPC, is phosphorylated in vivo and can be phosphorylated in
vitro by the protein kinase CK2. In this report we investigate further the role of CK2 in
regulating the transcriptional properties of SNAPC and demonstrate that SNAPC DNA
binding and transcription activity is inhibited by CK2 phosphorylation. Within SNAP190,
CK2 phosphorylates the N-terminal half of SNAP190 at two regions that contain multiple
CK2 consensus sites (amino acid 20-63 and 514-545) as determined by mass
spectrometric analysis. Partial SNAP complexes containing full-length SNAP43, full-
length SNAPSO, and various truncated SNAP190 molecules [SNAP190 (1-719),
SNAP190 (63-719), SNAP190 (1-505), SNAP190 (63-505)] were co-expressed and
tested for function in DNA binding and transcription. All four complexes maintain
normal DNA binding activity in electrophoretic mobility shift assays. Furthermore, these
complexes all support U1 and U6 snRNA gene transcription using SNAPC depleted HeLa

nuclear extracts in vitro, indicating that these regions are not essential for SNAPc activity.

98

Moreover, we have further determined that the region of SNAP190 (506-719) harboring
one set of the CK2 sites is required for CK2 inhibition, suggesting that CK2
phosphorylation of SNAP190 in the region of amino acid (514-545) negatively regulates
SNAPC function by inhibiting DNA binding by the adjacent DNA binding domain within

SNAP 1 90.

Introduction

Human snRN A activating protein complex (SNAPC) is a basal transcription factor
required for snRNA gene transcription by both RNA pol II and pol III (Sadowski et al.,
1993; Waldschmidt et al., 1991; Meissner et al., 1995; Murphy et al., 1992). SNAPC
consists of at least five subunits called SNAP190 (PTFa), SNAPSO (PTFB), SNAP45
(PTFS), SNAP43 (PTFy), and SNAP19 (Wong etal., 1998; Henry et al., 1996; Bai et al.,
1996; Sadowski et al., 1996; Yoon and Roeder, 1996; Henry et al., 1995; Henry et al.,
1998). The largest subunit SNAP190 plays a central structural role within SNAPc for
interacting with SNAP45, SNAP43 and SNAP19, while SNAPSO joins the complex by
interacting with SNAP43 (Henry et al., 1996; Henry et al., 1998a; Wong et al., 1998;
Mittal et al., 1999; Ma and Hernandez, 2001). Upon complex assembly, the Myb DNA
binding domain within SNAP190 further recognizes the proximal sequence element (PSE)
located in the core promoter region of snRNA gene promoters. This Myb DNA binding
domain consists of four complete repeats (RaRbRcRd) and a half repeat (Rh) (Wong et
al., 1998) and the RcRd repeats alone have been shown to be sufficient for this
recognition (Mittal et al., 1999). Furthermore, SNAP190 is an activation target of a

human enhancer-binding factor Oct-1, which binds to an octamer sequence in the distal

99

sequence element (DSE) located in the regulatory region. The cooperative binding of
Oct-1 and SNAPC is mediated by direct protein-protein contact between SNAP190 and
the POU-specific domain of Oct-1 (Mittal et al., 1996; Ford et al., 1998) and protein-
DNA contact between SNAP190 and the DNA phosphate backbone within the enhancer
(Hovde et al., 2002). A positioned nucleosome that resides between the DSE and the
PSE in the natural snRN A promoters is proposed to enhance interaction between Oct-l
and SNAP190 (Zhao etal., 2001). In addition, SNAP190 interacts with TBP to stimulate
TBP recognition and TFIIIB recruitment to the neighboring TATA box present in the
human U6 snRNA promoter (Ma and Hernandez, 2002; Hinkley et al., 2003). Together,
these results suggest that SNAP190 plays a pivotal role in snRNA gene transcription by
facilitating direct core promoter recognition, serving as a target for the Oct-1 activator,
and coordinating TBP activity and preinitiation complex assembly for both RNA pol II

and pol III.

In our previous studies we demonstrated that SNAP190 is phosphorylated both in
vivo and in vitro (Figure II-4 and Figure II-3 B). Protein kinase CK2 associates with and
phosphorylates the N-terminal half of SNAP190 at multiple serine residues (Figure II-S).
CK2 is distributed ubiquitously in eukaryotic organisms, and predominantly exists in
tetrameric complexes consisting of two catalytic subunits and two regulatory subunits.
CK2 is an important regulator of cellular growth and proliferation (reviewed in Guerra
and Issinger, 1999; Meggio and Pinna, 2003; Pinna, 2002; Pinna and Meggio, 1997).
One role for CK2 is to function as a downstream effector of signaling pathways to
regulate gene expression. CK2 phosphorylation of transcription factors may govern their

DNA-binding activities and transcription properties (Bieker etal., 1998; Armstrong et al.,

100

1997; Tsutsui et al., 1999). Specifically, CK2 has been shown to directly target the basal
transcription machinery. For example, CK2 has been shown to phosphorylate two
subunits of RNA pol II (Dahmus, 1981) and the general transcription factors TFIIA,
TFIIE, and TFIIF (Cabrejos et al., 2004). CK2 copurifies with epitope-tagged RNA pol I
(Harman et al., 1998) and RNA pol III (Hu et al., 2003). Furthermore, CK2 forms a
stable complex with Brfl -specific TFIIIB which is required for tRNA and 58 rRNA gene
transcription by RNA pol III. CK2 targets two components of Brfl -TFIIIB including
BRFl (Johnston et al., 2002) and TBP (Ghavidel and Schultz, 1997; Ghavidel et al., 1999;
Ghavidel and Schultz, 2001). CK2 phosphorylation of TBP and BRFl can activate tRNA
and 58 rRNA gene transcription by RNA pol III (Johnston et al., 2002; Ghavidel and
Schultz, 1997; Ghavidel et al., 1999). In addition, CK2 phosphorylation of RNA pol III
holoenzyme stimulates U6 snRNA gene transcription (Hu et al., 2003); however, CK2
downregulates U6 transcription by phosphorylating the de1 component of Ber-TFIIIB
during mitosis (Hu et al., 2004).

The observation that CK2 occupies human U1 gene promoters and decreased
levels of endogenous CK2 correlates with increased U1 expression suggests that CK2
plays a direct role in U1 gene regulation (Figure II-l). CK2 targets the general
transcription factor SNAPC for phosphorylation. It is unclear, however, whether CK2

phosphorylation of SNAPC contributes to U] and probably U6 snRNA gene regulation.

Here, the role of CK2 in regulating the transcriptional properties of SNAPC was
investigated. Our findings revealed that CK2 phosphorylation of SNAPC inhibits snRNA
gene transcription by both RNA pol II and pol III in vitro. CK2 target sites within

SNAP190 (1-719) have been identified and are located in the serine rich region (Wong et

101

al., 1998) downstream of the Myb-DNA binding domain, as well as in the N-terminal
region overlapping with TBP-recruitrnent region 1 (TRRI) (Ma and Hernandez, 2002).
Mini-SNAP complexes containing full-length SNAP43, full-length SNAPSO, and
truncated SNAP190 lacking the N-terminal region (Aaa 1-62) and/or the serine rich
region (Aaa 506-719) are capable of directing snRNA gene transcription, indicating that
CK2 plays a regulatory role. Further analysis showed that the region of SNAP190 (506-
719) is critical for CK2 inhibition, suggesting that CK2 phosphorylation of SNAP190 in

the region of amino acid (514-545) plays a negative role in regulating SNAPc function.

Materials and Methods

Expression and purification of recombinant proteins

The GST-SNAP190 (1-719) protein used for experiments described in Figures III-
2 and III-3 was overexpressed in E. coli BL21 (DE3) using the vector pSBet-GST-
SNAP190 (1-719) and purified by affinity chromatography using glutathione-sepharose
beads (Amersham Biosciences) followed by extensive washing in HEMGT-lSO buffer
(20 mM HEPES [pH 7.9], 0.5 mM EDTA, 10 mM MgC12, 10% glycerol, 0.1% Tween 20)
containing protease inhibitors (0.1 mM phenylmethylsulfonyl fluoride, 1 mM sodium bis-
sulfate, 1 mM benzarrridine, 1 CM pepstatin A) and 1 mM dithiothreitol. Bound protein

was then used directly for in vitro kinase assays and phosphopeptide mapping.

The various truncated versions of GST-SNAP190 fusion protein [GST-SNAP190

(1-719), GST-SNAP190 (63-719), GST-SNAP190 (1-505), and GST-SNAP190 (63-505)]

102

used for experiments described in Figure III-4 B were expressed in E. coli BL21 (DE3)
using the vectors pSBet-GST-SNAP190 (1-719), pSBet-GST-SNAP19O (63-719), pSBet-
GST-SNAP190 (1-505), and pSBet-GST-SNAP190 (63-505), respectively. The proteins
were purified for in vitro kinase assays by affinity chromatography using glutathione-

sepharose beads. Bound proteins were then used directly for in vitro kinase assays.

Recombinant mini-SNAP complexes containing full-length SNAP43, full-length
SNAPSO, and various truncated SNAP190 molecules [SNAP190 (1-719), SNAP190 (63-
719), SNAP190 (1-505), and SNAP190 (63-505)] were co-expressed in E. coli using the
vector combination pET21-His-SNAP43-HA-SNAP50 and pSBet-GST-SNAP190 (l-
719), pSBet-GST-SNAP19O (63-719), pSBet-GST-SNAP190 (1-505), or pSBet-GST-
SNAP190 (63-505), respectively. Various recombinant mini-SNAP complexes
[SNAP190 (1-719)/43/50, SNAP190 (63-719)/43/50, SNAP190 (1-505)/43/50, and
SNAP190 (63-505)/43/50, hereafter designated m8, mSAN, mSAC, mSA(N+C),
respectively] were purified by GST tag affinity chromatography and released from the
GST-tag by thrombin cleavage. The protein complexes were then dialyzed against
Dignam buffer D (Dignam et al., 1990) containing 80 mM KC1 prior to in vitro

transcription assay and EMSAs.

In vitro kinase assays

For the experiment presented in Figure III-4 B, approximately 3 pg of various
truncated GST fusion SNAP190 molecules [GST-SNAP190 (1-719), GST-SNAP190

(63-719), GST-SNAP190 (1-505), and GST-SNAP190 (63-505)] bound to glutathione-

103

sepharose beads (10 pL) were washed with HEMGT-ISO buffer. In vitro kinase assays
were performed directly on the beads by incubation with 10 units of recombinant CK2
(New England Biolabs) in the presence of 8 nM y[32P]ATP for 15 minutes at room
temperature. The beads were then washed extensively in HEMGT-ISO buffer and
proteins were separated by 12.5% SDS-PAGE. The amount of GST-SNAP190 proteins
used in each reaction was detected by staining with Coomassie Blue. Radiolabeled
proteins were visualized by autoradiography.

For the experiments presented in Figure III-1 and Figure III-5, in vitro kinase
assays were performed by incubating mini-SNAP complexes with recombinant CK2 in
the absence or presence of unlabeled ATP for 30 minutes at 30°C (EMSA) or at room
temperature (in vitro transcription assay). The amounts of CK2 and ATP used are

indicated in the figure legends.

EMSAs

PSE-specific DNA binding by SNAPC was assayed by EMSA as described
previously (Sadowski et al., 1993) using a DNA probe containing a wild-type mouse U6
PSE with mutant human U6 TATA box (Hinkley et al., 2003; Mittal and Hernandez,
1997) with the following modifications. For the experiments presented in Figure III-5 B
(panel a), approximately 20 ng of purified mini-SNAP complexes mS or mSAC were
preincubated alone or with 5 or 50 units recombinant CK2 and/or 1 mM ATP for 30 min
at 30°C. EMSAs were then performed by addition of the DNA probes and incubated for
an additional 30 min at 30°C. For the experiments presented in Figure III-5 B (panel b),

EMSAs were performed by incubating mS or mSAC with the DNA probes for 30 min at

104

30°C. Subsequently, 5 or 50 units of recombinant CK2 and/or 1 mM ATP were added,
and reactions were incubated for an additional 30 min at 30°C. Samples were
fractionated on a 5% nondenaturing polyacrylarnide gel (39:1) in TGE running buffer

(50 mM Tris, 380 mM glycine, 2 mM EDTA).

Immunodepletions and in vitro transcription assays

To deplete SNAPC from HeLa nuclear extracts (Henry et al., 1995), 150 pL of
extract was incubated with 50 pL of protein A agarose beads pre-coupled to pre-immune
or anti-SNAP190 antibodies (C8402) (Wong et al., 1998) for 1 hour at room temperature.
In vitro transcription of human U1 and U6 snRNA genes was performed as described

previously (Lobo and Hernandez, 1989) with the following modifications.

For the reconstitution reactions whose results are depicted in Figure III-4 C, the
transcription reactions were performed in a total volume of 36 pL containing 1 pg of the
DNA templates, 8 pL of HeLa nuclear extracts or 14 pL immuno-depleted extracts. The
amounts of recombinant mini-SNAP complexes are indicated in the figure legend. U6
transcripts were analyzed by RN ase T1 protection as described previously (Lobo and
Hernandez, 1998). The RN As were separated by denaturing PAGE and visualized by

autoradiography or by Phosphorlmager analysis (Molecular Dynamics).

For Figure III-l and Figure III-5 A, recombinant mini-SNAPC mS or mSAC was
preincubated with Dignam buffer D either with or without recombinant CK2 and ATP,
and/or quercetin as indicated in the figure legends. In vitro transcriptions were initiated

by addition of transcription buffers, nucleoside triphosphates, 1 pg of DNA template, and

105

8 pL of HeLa nuclear extracts or 14 pL immuno-depleted extracts, and incubated for
additional 60 min (U6) or 90 min (U 1) at 30°C. The amounts of each protein and ATP

used are indicated in the figure legends.

Phosphopeptide mapping by matrix-assisted laser desorption/ionization-time of flight
mass spectrometry (MALDI-TOF MS) and by ,B-elimination coupled with quadrupole
time of flight mass spectrometry (Q-TOF MS/MS)

To map the sites of SNAP190 phosphorylation, approximately 1 pg of GST-
SNAP190 (1-719) immobilized on glutathione sepharose beads was treated with 50 pL
HeLa cell nuclear extract in a total volume of 200 pL adjusted with HEMGT-ISO buffer.
After 1 hr incubation at room temperature, the beads were washed extensively with
HEMGT-ISO buffer and a kinase assay was performed in the presence of 8 nM
y[32P]ATP and 1 mM unlabeled ATP. The phosphorylated GST-SNAP190 (1-719) was
digested with trypsin followed by phosphopeptide purification through a Gallium spin
column (Posewitz and Tempst, 1999) according to the manufacturer's instructions (Pierce
Biotechnology). The purified peptides were directly analyzed or were dephosphorylated
with calf intestine alkaline phosphatase (New England Biolabs) prior to analysis by
MALDI-TOF mass spectrometry (Perseptive Biosystems, Inc., Farmingham, MA) in a
positive ion reflector mode using or-cyano-4-hydroxycinnamic acid as a matrix (Liao et
al., 1994). The purified peptides were also subjected to Ba(OH)2 treatment for B-
elimination (Jiang and Wang, 2004) prior to liquid chromatography coupled with tandem

mass spectrometric analysis using the Waters CapLC system (Waters Corp., Milford, MA)

106

coupled to an LCQ DECA quadrupole ion trap mass spectrometer (ThermoFinnigan, San

Jose, CA) through the Picoview nanospray source (New Objectives, Cambridge, MA).

Results
SNAPC function is modulated by CK2.

The observation that CK2 occupies human U1 and U6 snRNA gene promoters
and CK2 phosphorylates the general transcription factor SNAPc prompted us to
investigate whether CK2 regulates the transcriptional properties of SNAPc. First, we
depleted endogenous SNAPC from a transcription extract with anti-SNAP190 antibodies
and tested the abilities of mini-SNAPC (m8) to restore transcription in the SNAPc-
depleted HeLa nuclear extract. As shown in Figure III-1, U1 transcription was
dramatically diminished upon depletion with anti-SNAP190 antibodies beads (lane 2)
comparing to the signal from depletion with preimmune antibodies (lane 1). With
addition of recombinant m8 to the depleted extract, similar levels of U1 transcription
were observed compared to lane 1, suggesting that m8 is competent for U1 transcription.
To assess the roles of CK2 phosphorylation of SNAPC in U1 transcription, recombinant
m8 was preincubated with CK2 in the presence of ATP. CK2 activity was then inhibited
by addition of CK2 inhibitor quercetin prior to initiation of transcription by addition of
SNAPc-depleted extracts, the transcription buffers, nucleoside triphosphates, and DNA
template. Although CK2 inhibitor quercetin inhibits overall U1 transcription (comparing
lane 6 to lane 3), decreasing amounts of U1 transcripts with 30 minute preincubation of
CK2 and m8 were observed (comparing lane 5 to lane 4), indicating that SNAPC

phosphorylation by CK2 inhibits its transcription activity.

107

Figure III-1. SNAPC function is modulated by protein kinase CK2. 20 ng
recombinant m8 was preincubated with either Dignam buffer D (lanes 3, 4 and 6) or
Dignam buffer D containing 20 units of recombinant CK2 and 1 mM ATP (lane 5) for 30
min at room temperature, then complemented with 20 units of CK2 and 1 mM ATP (lane
4). 2 mM quercetin was added to the reactions in lanes 4 and 5 to block CK2 activity or
to the reaction in lane 6 as a control. The U1 transcription was initiated by addition of
either a preimmune-depleted HeLa nuclear extract (lane 1) or an anti-SNAP43 immuno-
depleted HeLa nuclear extract (lanes 2 ~ 6). The correctly initiated transcripts are labeled
U1 5'. Readthrough transcripts (RT) from cryptic mRNA-type promoters in the U1
transcription experiment (Sadowski et al., 1993) and an internal control (IC) included in
the reaction mixtures to monitor RNA handling and recovery are indicated to the right of

the gel.

108

mS Quercetin

1 /ranscription start
I I
0

 

 

1 J
30 min 120 min

)

CK2+ATP

 

C1: — + + +l Quercetin

——++++mS
———++—CK2+ATP

min CK2+ATP added

  

— RT
- U1 5‘

In vitro transcription

109

Multiple phosphorylation sites in SNAP190 are identified by mass spectrometry.

As an initial step towards investigating the function of SNAP190 phosphorylation by
CK2, phosphopeptide mapping of SNAP190 was performed by mass spectrometry. First,
GST-SNAP190 (1-719) was used as the bait to recover endogenous CK2 fiom HeLa cell
nuclear extracts prior to performing an in vitro kinase assay in the presence of y[32P] ATP.
Phosphorylated GST-SNAP190 (1-719) was then gel purified, digested with trypsin,
followed by phosphopeptide purification through a Gallium column (Posewitz and Tempst,
1999). The resultant peptides were analyzed directly by MALDI-TOF MS or were
dephosphorylated by alkaline phosphatase prior to analysis. Theoretically, a peptide that is
phosphorylated at a single site should give a mass addition of +80 Da to the mass calculated
from its sequence and the mass should be converted back to the calculated value after
treatment of the peptide with phosphatase. As shown in Figure III-2 A, five peaks with
approximately 80 Da or multiples of 80 Da differences are observed (top panel), indicating
that these masses may represent a population of one peptide with different phosphorylated
status. Phosphatase treatment reveals only one peak at m/z 4624.83 Da (bottom panel),
further confirming that the mass spectral peaks at m/z 4704.53, 4784.38, 4864.42, and
4944.95 (top panel) correspond to the peptide with m/z 4624.17 Da bearing 1, 2, 3, and 4
P03" group(s), which can be removed by phosphatase treatment. These data strongly suggest
that a non-phosphopeptide with approximately m/z 4624 Da can be phosphorylated at

multiple sites. By careful comparison with the predicted masses of GST-SNAP190 (1-719)

110

Figure III-2. Endogenous CK2 phosphorylates the N-terminus of SNAP190 in the
region within amino acids 20-63 containing multiple CK2 consensus sites. (A)
Tryptic phosphopeptide of SNAP190 identified by MALDI-TOF MS. GST-SNAP190
(1-719) was incubated with HeLa cell nuclear extracts to recover associated CK2.
Samples were then used for an in vitro kinase assay to radiolabel GST-SNAP190 (1-719).
Proteins were digested with trypsin followed by affinity purification of phosphopeptides
through a Gallium column. The purified tryptic fragments were analyzed by MALDI-
TOF MS before (top panel) and after calf intestine alkaline phosphatase treatment
(bottom panel). The peaks present in the top MALDI-TOF MS spectrum at m/z 4704.53,
4784.38, 4864.42, and 4944.95 Da correspond to the mass of the SNAP190 peptide from
amino acids 20-63 (calculated MH+ m/z is 4624.07-4626.79 Da, observed MH+ m/z is
4624.17 Da) with l, 2, 3, 4 phosphate groups. After phosphatase treatment, these peaks
shift to the peak at m/z 4624.83 Da. (B) Sequence of the SNAP190 tryptic peptide
containing amino acids 20-63. CK2 consensus sites within these peptides are bracketed.
Serine residues that match CK2 consensus motif within this peptide are highlighted with

asterisks.

111

 

4704.53 (-) phosphatase

 

 

 

 

 

 

Relative Intensity

 

 

 

 

 

 

 

 

4784.38
4624.1 7
: E (+) phosphatase
' l
5 :
— — — :4
4400 4600 4800 5000 5200

Mass (m/z)

* *‘k 63

20 "k *
ILDPGSSGSHVEISE8SLESDSEADSLPSEDLDPADPPISEEER
l___l I I I I__l

 

*
CK2 consensus: SXXD/E

112

tryptic peptides, only SNAP190 (20-63) matches this criterion (calculated MH+ at m/z
4624.07~4626.79). The amino acid sequence of SNAP190 (20-63) is given in Figure III-2 B.
Five CK2 consensus sites are found in this 44 amino acid region of SNAP190, indicating that
this peptide is likely phosphorylated by CK2.

The phosphorylated GST-SNAP190 (1-719) tryptic peptides were also analyzed
by B-elimination coupled with Q-TOF MS/MS. In this assay, phosphorylation of
numerous fragments encompassing the serine rich region within a 514-545 was
observed. Figure III-3 A shows one example of MS/MS ion after B-elimination of m/z
627.11 Da, which corresponds to amino acid residues 519-543
[(5’9SSTSSSGSSSGSSGGSSSSSSSSSE543+3H)3+] according to MS/MS data. 13-
elimination removes the phosphoric acid groups from phosphorylated serine and leaves
unmodified serine unattacked, which leads to a net 18 Da loss relative to unmodified
serine (Byford, 1991; Resing et al., 1995). A total of 20 y-series product ions (ions from
the C-terminal end) and 6 b-series product ions (ions from the N-terminal end) was
observed within this spectrum (Figure 3A, top panel), the y(5)++, y(6)++, y(7)++, y(9)H,
y(10)H, y(13)H, y(l6)++, y(17)++, and y(18)++ ions were highlighted in the enlarged
spectrum (bottom panel). The mass differences between y(5)++ and y(6)++ is 43.5 (87/2)
Da, indicating serine 538 is not phosphorylated, while the mass differences between
y(6)*+ and ya)”, y(9)**and y(10)+*, y(16)Hand y(17)+*, y(17)Hand y(18)++ are 34.5
[(87-18)/2] Da due to B-elimination of phosphoserine. Within this peptide, a total of
fourteen different serine residues has a net mass 18 Da loss, suggesting that fourteen

serines are phosphorylated. We analyzed a total of 62 spectra data encompassing the

113

Figure III-3. Endogenous CK2 phosphorylates the N-terminus of SNAP190 in the
serine rich region within amino acids 514-545 containing multiple CK2 consensus
sites. (A) Q TOF MS/MS of the ion of
[(519SSTSSSGSSSGSSGGSSSSSSSSSE543+3H)3*] with m/z 627.11 Da after 13-
elimination. The sequence of the peptide segment corresponding to amino acid residues
519-543, the b-series and y-series fragment ions were shown above the spectrum. The
>15)”, >46)”. 3'0)”. W9)”, Y(10)H, 3'03)”, K16)”, W17)”. and W18)” ions were
highlighted in the enlarged spectrum in the mass range of m/z 200-700 (bottom panel).
"8 - 18" designates a dehydroalanine, which results from the B-elimination of
phosphoserine (labeled as p8 in the peptide sequence). (B) Each of the 20 serines in the
serine rich region could be phosphorylated. A total of 62 MS/MS spectra data from
numerous phosphopeptides encompassing the serine rich region aa 514-545 were
analyzed. The occurrence of phosphorylation at each amino acid residue is shown in y-
axis; the corresponding amino acid sequence is indicated in x-axis. (C) Sequence of the
SNAP190 peptide containing amino acids 514-545. CK2 consensus sites within these
peptides are bracketed underneath. Serine residues that match CK2 consensus motif
within this peptide are highlighted with asterisks. Other sites that are bracketed above
indicate the possible CK2 sites generated by the nascent phosphoserines.

114

y2

“4444-444-wipers-1444444

D19

W3 1110”? 117116115114
M3 M4 b16

y19y18y17y16

b7

y24 y23 y21

 

 

 

 

 

 

 

 

 

 

 

 

m m
a an ............... .- flu 1 ....... is... .............
l u. . IIIIII
I H I r IIIIII it: ....... -
m am.-
I I .I I I > ..................
I 1 8 .16: 1.8 50> ...... W
A” P} IIIIIIIIIIIIIIII III I “M
I AM 1
IIIIIIM I W m
.3... E:..:...............-................. .... 1 s
AVSS...‘ K IIIIIIIIIII J1I llllll ++AM a) IIIIIIII
+4.8... ......... vm ............ 1 En ........ m
3 fl;
m
+1 rm: ++¢N~O>w ..... m M +1639. ........................ “
13:9. 68...... m
6.? ---.+.+...m............. .... II II I I 18.: .....................
.xk.x-- -w . -IIIIIII. m .zo:os:-:-:-->s
1.3.2 ........... met-unnuuuu m s I IIIIIII Ia... .............. m
is... ......... p m... ..... m is ..........
4.9.8 ............... M.
aim-1.4 ....... ,..-...u.... .............
.2; tag...
A30» ................... + 4.6-.) ---------- m M I T IIIIIII 1.9; .................. W
IE. 1.2. ................ .m- IIIIII ta; ................
- IIIIIIIIIIIIII S
1...... as .......... m a:
llllll + IIIIIIIIIIIIIIIIIIIIIIIII
as. ........... m
3.22:. 9.5.9". 2.2!: 2.1....

115

GammmaHBZmuquWawmmman

 

 

 

 

 

 

 

I IE

HSVRWSSTSS8088808800888888888850

 

 

 

SNAP190 aa 514—545

E.

514 *** 545
HSVRWSSTSSSGSSSGSSGGSSSSSSSSSEED

*
CK2 consensus: SXXD/E

 

 

116

serine rich region and the numbers are summarized in Figure III-3 B, showing that each
of the 20 serines in this serine rich region was phosphorylated. Although other kinases
derived from HeLa nuclear extracts could contribute to phosphorylation in this region,

CK2 is likely the major kinase responsible for phosphorylation in this region (Figure II-5).
SNAP190 (514-545) has three CK2 consensus substrate recognition sequences at the C-
terrninal side of multiple blocks of contiguous serine residues, that is, Glum, Glus“, and
Asp545 (illustrated in Figure III-3 C). As a result, Serm, Sers‘", and Ser542 are the first
sites that can be phosphorylated. Phosphorylation introduces a negative charge to that
residue, which potentially creates a new CK2 site at a nearby serine residue located at the
N - 3 position. Therefore, the initial phosphorylation at Serm‘542 leads to propagation of
upstream serine phosphorylation. This observation is ftuther supported by recent study

that CK2 can phosphorylate seven contiguous serine residues (Serm’84

) in the serine tract
78sssssssmn87 in dehydrin (DHNl) protein (Jiang and Wang, 2004).

A schematic representation of SNAP190 and the position of the CK2 sites relative
to other functional regions are shown in Figure III-4 A (top panel). Interestingly, the
CK2 phosphorylated region aa (514-545) is adjacent to the Myb DNA binding domain,
and both CK2 phosphorylated regions are adjacent to the TBP-recruiting regions (TRRl
and TRR2) in SNAP190 that are involved in cooperative promoter recognition by SNAPC
and TBP, suggesting a potential role for CK2 in controlling DNA binding and/or TBP
recruitment. Our previous data demonstrated that PSE-specific DNA binding by m8 was
inhibited by CK2, and that cooperation between SNAPC and TBP can antagonize CK2
inhibition of DNA binding by SNAPC (Figure II-6). The mechanism of the inhibitory

effect of CK2 phosphorylation on SNAPC DNA binding is under investigation.

117

Figure III-4. Deletion of CK2 phosphorylation regions within SNAP190 did not
affect the transcription properties of SNAPC. (A) A schematic representation of full-
length SNAP190 and the position of the CK2 sites relative to other functional regions are
shown (top panel). Myb domain: Myb DNA binding domain; SRR: the serine rich region;
RRR: the arginine rich region; TRRl: TBP-interacting region 1; TRR2: TBP-interacting
region 2; OIR: Oct-1 interacting region, 43/19: SNAP43 and SNAP19 interacting region;
and 45: SNAP45 interacting region (modified from Ma and Hernandez, 2001). The wavy
vertical line around position 719 indicates the C-terminus of the truncated SNAP190
protein used for these studies. Sequence of the SNAP190 amino acids 1-719 is also given
and thirteen CK2 sites are highlighted (bottom panel). (B) SNAP190 phosphorylation
was diminished in the deletion mutants. Schematic representation of various GST fusion
proteins containing truncated SNAP190 is shown on the left side. The GST fusion
proteins were overexpressed in E. coli and purified for in vitro kinase assays by affinity
chromatography using glutathione-sepharose beads. Phosphorylation signals were
detected by autoradiography (lane 1), and the amount of GST-SNAP190 proteins used in
each reaction was detected by staining with Coomassie Blue (lane 2). (C) SNAP190
deletion mutants are competent for both U1 and U6 transcription. Partial SNAP
complexes mS, mSAN, mSAC, and m8A(N+C), were assembled by co-expressed in E.
coli and purified through affinity chromatography. The titrations of the mini-SNAP
complexes were over a threefold range. The correctly initiated transcripts are labeled U6
and U1 5'.

118

.Hzgmmmg maggmmm Baum—ONAOH ugomghz ggmgubs. Saddam Hmm
Ray—Mdnvdmm Edmundnudm mm>mom4m4m >O>mmBMMOm fidhfimdmxm UGOmdmmOMm How

 

«g5» Eda—Ha u again mgmfimo mu ammo"; may—Human m H2.
gnaw; $30335 3:55.88 Huang? Sm
5853mm 9:25.22 moomuoaoom «nausea—M2 Roam—Bo: 4533mm”. Sm
Humane—Em Bumzosba Humenmmomm szmHumxnm 8523.5. mmqozHoon in
umemmooxma «gnaw-m: mob—052......“ Sumoaqmoa momgmxmaq SEE; SA
35553 flames? Eugene—ax Engages $3qu >3 HS
mag game-um... a? Eda-Sang S
m 8935 Imaqmafi o mam $5. 39323 535.39. Damage. H

mm 5...
Pa 2....

82 a: :28 _
as as...
9.0 5.0

 

  

 

 

 

119

 

 

 

 

 

 

 

 

 

 

 

1 719 F1"
GST-190(1-719) IGSL] l [3" T”
63 719 i' I
GST-190(63-719) Esrffi I l. ,:l
1 505 I T
GST-190(1-505) l I“, T
63 505 I I
GST-190(63-505) r—jesr I. I l fl
1 2
g a SNAP190 dep NE
8 I
a
%_ mSAN mSAC mSAN-I-C

 

 

j J

O

i
l. "r - -.. N

 

, ’]—us

 

 

..“”-~--“-- I. *

1

120

Heal—U1 5

234567891011121314

SNAP190 deletion mutants diminish phosphorylation but remain functional for
transcription.

Computer-assisted screening (Blom et al., 1999) of the amino acid sequence of
SNAP190 (1-719) reveals a total of thirteen putative CK2 phosphorylation sites
containing serines (highlighted in Figure III-4 A, bottom panel). There are six sites

clustered in the N-terminal region (Serzs, Ser”, Set”, Ser“, Sets9 and Set“) and three

540 541 542
, Ser

sites in the serine rich region (Ser , and Ser ). Because mass spectrometric
analysis of SNAP190 (1-719) revealed that at least 4 serines are phosphorylated in the N-
tenninal region and up to 20 in the serine rich region. We therefore assumed that a
truncated SNAP190 lacking the N-terminal region and/or the serine rich region would be
a poor substrate for CK2 phosphorylation. The GST fusion deletion mutants containing
SNAP190 (63-719), SNAP190 (1-505), and SNAP190 (63-505) were expressed in E. coli,
purified through glutathione sepharose beads (Figure III-4 B lane 2, right panel), and
tested for CK2 phosphorylation in an in vitro kinase assay by recombinant CK2. As
shown in Figure III-4 B lane 1, as compared to GST-SNAP190 (1-719), GST-SNAP190
(63-719) phosphorylation was slightly decreased, while GST-SNAP190 (1-505)
phosphorylation was dramatically reduced, indicating that the serine rich region we
mapped harbors the majority of CK2 phosphorylation sites within SNAP190 (1-719). The
truncated polypeptide lacking both the N-terminal region and the serine rich region GST-
SNAP19O (63-505) was phosphorylated less well than GST-SNAP190 (1-719) and GST-
SNAP19O (1-505). Collectively, these findings demonstrate that CK2 phosphorylates

SNAP190 (1-719) predominantly at two regions aa (20—63) and aa (514-545).

121

Next, we asked whether these SNAP190 deletion mutants are capable of
reconstituting snRN A gene transcription in an in vitro transcription system. Partial SNAP
complexes containing full-length SNAP43, full-length SNAPSO, and various truncated
SNAP190 molecules mS, mSAN, mSAC, and mSA(N+C) were assembled in E. coli and
tested for function in transcription. In our experiments, a titration for each complex was
performed and showed that all four complexes can support both U1 and U6 snRNA gene
transcription equally well using SNAPc depleted HeLa nuclear extracts in vitro (Figure
III-4 C). Thus, these recombinant mini-SNAP complexes are capable of mediating
transcription by both RNA polymerases II and III. Thus, the regions of a (1-62) and/or
a (506-719) are not essential for SNAPC activity and may play a regulatory role on

SNAPC function.

The region of SNAP190 (506-719) is required for CK2 inhibition.

To further investigate a role of CK2 phosphorylation in snRNA transcription, we
tested the SNAPC function in the presence of recombinant CK2 using the partial SNAP
complexes m8 and mSAC. As shown in Figure III-5 A, both mini-SNAP complexes mS
and mSAC were able to reconstitute U6 transcription in the SNAPc-depleted HeLa
nuclear extracts (comparing lanes 3 and 6 to lane 2). However, when mS was
preincubated with CK2 at 30°C for 30 minutes in the presence of ATP, U6 transcription
was decreased remarkably (lane 3), while addition of same amount of CK2 and ATP
without preincubation did not affect U6 transcription (lane 5), indicating that allowing

mS phosphorylation by CK2 causes U6 transcription downregulation. Moreover, when

122

Figure III-5. A functional comparison between mini-SNAP complexes mS and
mSAC. (A) U6 transcription of m8 and mSAC showed differential sensitivity upon CK2
treatment. Approximately 100 ng of purified mS and mSAC were used in each reaction.
SNAPC were preincubated with either Dignam buffer D (lanes 3, 5, 6, and 8) or Dignam
buffer D containing 20 units of recombinant CK2 and 1 mM ATP for 30 min. The
reactions in lane 5 and 8 were then complemented with equal concentration of CK2 and
ATP prior to initiation of transcription. The correct transcripts are labeled U6. (B) PSE-
specific DNA binding by mS and mSAC was assayed by EMSA. Approximately 20 ng
of purified mini-SNAP complex mS (lanes 2 ~ 7) and mSAC (lanes 8 ~ 13) were
preincubated alone (lanes 2 and 8) or with 5 units (lanes 3, 6, 9, and 12) or 50 units (lanes
4, 7,10,13, and 14) of CK2 and/or 1 mM ATP (lanes 5 ~ 7 and 11 ~ 14) for 30 min at
30°C. EMSA was then performed using a DNA probe containing a wild-type mouse U6
PSE with mutant human U6 TATA box as described previously (Mittal and Hernandez,
1997), and incubated for an additional 30 min at 30°C (left panel). Alternatively, EMSA
was performed by preincubating mS (Lanes 15 ~ 17) and mSAC (Lanes 18 ~ 20) with the
DNA probe for 30 min at 30°C (lanes 8 ~ 10). Then, 5 units (lanes 16 and 19) or 50 units
(lanes 17, 20 and 21) of CK2 and/or 1 mM ATP (Lanes 8 ~ 10) were added and reactions
were incubated for an additional 30 min at 30°C (right panel). The reaction shown in
lane 1 contains probe alone, and the reaction in lanes 14 and 21 contained only 50 units
CK2 and 1 mM ATP. The positions of the protein/DNA complexes are indicated.

123

mS transcription start

‘0 ¥_30 min 1g). min
ICK2+ATP (30 min preincubation)
ICK2+ATP (0 min preincubation)

 

 

m
E aSNAP43 depleted NE
r
%_ mS mSAC
G — l fir I
(.3 _ _ + + — + + CK2+ATP
30 0 30 0 min preincubation

 

124

 

 

 

 

 

 

 

0 30min 60min
3 r i
a IIMini-SNAPc+CK2/ATP +Probe J
b FMini-SNAPc+Probe +CK2/ATP l
a mS mSAC b m8 mSAC
- F u l- r II I— mS or mSAC
_—4-4—4-A+ -‘ —A+CK2
--—-+++———++++ +++ ++++ ATP
m PSE
.. .. - e. .0...- u ‘ O.- + mglAC/PSE

 

 

 

 

172 3 4 5 6 7 8 91011121314 15161718192021

125

mSAC and CK2 were preincubated and tested for U6 transcription, no difference was

observed compared to the same sample without preincubation (comparing lane 7 to lane

8), suggesting that the region of SNAP190 (506-719) is critical for CK2 inhibition.

As mentioned previously, the CK2 phosphorylated region aa (514-545) is
adjacent to the Myb DNA binding domain (Figure III-4 A), and CK2 phosphorylation of
SNAP190 at the region aa (514-545) might block the ability of the Myb domain to
recognize the PSE sequence. To test this, EMSA was performed with approximately
equal amounts of mS or mSAC that was preincubated with either CK2 or ATP or both for
30 minutes, followed by addition of a DNA probe. As shown in Figure III-5 B (panel a),
robust DNA binding was observed by Iris (lane 2) and mSAC (lane 8), even in the
presence of ATP (lanes 5 and 11) or increased amounts of CK2 (lanes 3—4 and 9-10).
However, preincubation of mS with ATP along with CK2 diminished mS/PSE complex
formation (lanes 6 and 7), but did not affect mSAC /PSE complex formation (lanes 12
and 13). These data strongly suggest that CK2 phopshorylation of SNAP190 (506-719)

plays a negative role in SNAPC DNA binding.

SNAPC DNA binding can be prevented by CK2 phosphorylation of SNAPC
(Figure III-5 B, panel a), thus, whether the SNAPc/DNA complex can be disrupted by
CK2 phosphorylation of SNAPC after DNA binding had occurred was tested. To address
this, EMSAs was performed by allowing SNAPc/DNA complexes to form followed by
CK2 phosphorylation. As shown in Figure III-5 B (panel b), when mS bound to PSE,
subsequent addition of CK2 and ATP leads to less complex formation (comparing lanes

16 and 17 to lane 15). A similar response for mSAC mutant was not observed. Thus,

126

CK2 phosphorylation in the serine rich region of SNAP190 can inhibit SNAPc PSE

binding both before and after DNA binding has occurred.

Taken together, we conclude that the region of SNAP190 (506-719) is critical for
CK2 inhibition. CK2 targets SNAP190 for phosphorylation in the serine rich region,

which in turn inhibits SNAPc DNA binding activity and transcription properties.

Discussion

Previously I have demonstrated that CK2 inhibits overall U1 snRNA gene
transcription in human HeLa cells. CK2 targets the snRNA activating protein complex
(SNAPC) for phosphorylation. Here, I provide additional evidence that CK2 may
downregulate snRN A gene transcription by inhibiting SNAPC DNA binding and
transcription activity. The CK2 phosphorylation sites within SNAP190 were identified
by mass spectrometry, and the region in SNAP190 that is required for CK2 inhibition
was narrowed down to the region between aa 506-719 encompassing a serine rich region

with multiple CK2 consensus sites.

It has been determined that SNAPC PSE-specific DNA binding activity was
inhibited by CK2 (Figure II-6). The mechanism of the inhibitory effect of CK2
phosphorylation on SNAPC DNA binding is not known; however, it is unlikely due to
phosphorylation at a critical residue within the SNAP190 Myb domain, because this same
complex is capable of binding DNA when TBP is present (Figure II-6). For the same
reason, that phosphorylation outside the Myb DNA binding domain would affect

intermolecular interactions between SNAP190 and SNAP43 is unlikely. Instead, we

127

favor the idea that CK2 phosphorylates SNAP190 outside the Myb DNA binding domain,
leading to intramolecular interactions in SNAP190 that block SNAP190 Myb domain
PSE recognition. Two CK2 target regions within SNAP190 (1-719) have been identifed
by mass spectrometric analysis. One region (aa 20-63) is located in the N-terminal
region upstream of the SNAP43 interacting region (Ma and Hernandez, 2001), consistent
with our prediction that the SNAP43 interacting region within SNAP190 is not a CK2
target. Another region (aa 514-545) is located in the serine rich region downstream of the
Myb-DNA binding domain. Deletion mutant of SNAP190 (1-505) lacking the serine rich
region was generated and tested for transcriptional properties in the presence of CK2.
Both DNA binding and transcription activities of mSAC were not affected by CK2
(Figure III-5), while mS was sensitive to CK2 treatment, suggesting that CK2
phosphorylation of SNAP190 in the serine rich region downregulates SNAPc DNA
binding and transcription activity. It is interesting that the serine rich region with CK2
consensus sites in SNAP190 is conserved between mouse (accession number:
AK077522.1) and human, thus, if CK2 phosphorylation of this serine rich region has a

physiological function, it could be restricted to those organisms.

It has been proposed previously that the fiill-length SNAP190 contains a built-in
damper located in the region from a 506-1469, which downregulates SNAP190 binding
to DNA (Mittal et al., 1999). It will be interesting to determine the exact location of this
damper. In our experiments, when comparing the DNA binding activities of SNAP
complexes m8 and mSAC using equal concentrations, we observed that mSAC has higher
DNA binding affinity than mS (Figure III-5 B), raising the possibility that the region of

SNAP190 aa (506-719) acts as a damper of DNA binding. Within SNAP 190, there is an

128

arginine rich region located between the Myb domain and the serine rich region
(illustrated in Figure III-4 A) and we speculate that a conformational change in SNAP190

mediated by the interaction between the negatively charged residues (Glum’ 544’ ”d 546,

545) and the positively charged arginines is unfavorable for SNAPc/PSE complex

and Asp
formation. CK2 phosphorylation introduces more negative charges in the serine rich
region, which will strengthen the interaction between the serine rich region and the
arginine rich region, and make it more unfavorable for the PSE recognition. The
observation that the weak DNA binding activity of mS was further diminished by CK2
treatment (Figure III-5 B) further supports this charge effect mechanism for inhibition of

DNA binding.

Another interesting finding in this study is that SNAPC DNA binding inhibited by
CK2 occurred both before and after SNAPc/PSE complex had formed (Figure III-5).
This observation raises the possibility that the CK2 phosphorylation sites within SNAPc
might be exposed so that CK2 can reach them even when SNAP190 is complexed with
the PSE. CK2 phosphorylation not only prevents the free SNAPc from binding DNA, but
it can also increase the off-rate of SNAPC from the promoter. This double checkpoint

mechanism ensures a maximum CK2 inhibition on snRNA gene transcription.

129

References

 

Armstrong, S.A., Barry, D.A., Leggett, R.W., Mueller, CR. (1997). Casein kinase II-
mediated phosphorylation of the C terminus Spl decreases its DNA binding activity. J
Biol Chem 272, 13489-13495.

Bai, L., Wang, Z., Yoon, J .B., Roeder, R.G. (1996). Cloning and characterization of the
beta subunit of human proximal sequence element-binding transcription factor and its
involvement in transcription of small nuclear RNA genes by RNA polymerases II and III.
Mol Cell Biol 16, 5419-5426.

Bieker, J .J ., Ouyang, L., Chen, X. (1998). Transcriptional factors for specific globin
genes. Ann NY Acad Sci 850, 64-69.

Byford, M.F. (1991). Rapid and selective modification of phosphoserine residues
catalysed by Ba2+ ions for their detection during peptide microsequencing. Biochem J
280, 261-265.

Cabrejos, M.B., Allende, C.C., Maldonado, E. (2004). Effects of phosphorylation by
protein kinase CK2 on the human basal components of the RNA polymerase II
transcription machinery. J Cell Biochem 93, 2-10.

Dahmus, ME. (1981). Purification and Properties of Calf Thymus Casein Kinases I and
II. J Biol Chem 256, 3332-3339.

Dignam, J .D. (1990). Preparation of extracts from higher eukaryotes. Methods Enzymol
182, 194-203.

Ford, E., Strubin, M., Hernandez, N. (1998). The Oct-1 POU domain activates snRNA
gene transcription by contacting a region in the SNAPC largest subunit that bears

sequence similarities to the Oct-1 coactivator OBF -1. Genes Dev 12, 3528-3 540.

Ghavidel, A., Hockman, D.J., Schultz, M.C. (1999). A review of progress towards
elucidating the role of protein kinase CK2 in polymerase III transcription, regulation of
the TATA binding protein. Mol Cell Biochem 191, 143-148.

Ghavidel, A., Schultz, M.C. (1997). Casein kinase II regulation of yeast TFIIIB is
mediated by the TATA-binding protein. Genes Dev 11, 2780-2789.

Ghavidel, A., Schultz, M. C. (2001). TATA binding protein-associated CK2 transduces

DNA damage signals to the RNA polymerase III transcriptional machinery. Cell
106,575-584.

130

Guerra, B., Issinger, O.G. (1999). Protein kinase CK2 and its role in cellular proliferation,
development and pathology. Electrophoresis. 20, 391-408.

Hannan, R.D., Hempel, W.M., Cavanaugh, A., Arino, T., Dimitrov, S.I., Moss, T.,
Rothblum, L. (1998). Affinity purification of mammalian RNA polymerase 1.
Identification of an associated kinase. J Biol Chem 273, 1257-1267.

Henry, R.W., Ford, E., Mital, R., Mittal, V., Hernandez, N. (1998a).Crossing the line
between RNA polymerases, transcription of human snRN A genes by RNA polymerases
II and 111. Cold Spring Harb Symp Quant Biol 63, 111-120.

Henry, R.W., Ma, B., Kobayashi, R., Hernandez, N. (1998b). SNAP19 mediates the
assembly of a functional core promoter complex (SNAPC) shared by RNA polymerases II
and III. Genes Dev 12, 2664-2672.

Henry, R.W., Mittal, V., Ma, B., Sadowski, C.L., Kobayashi, R., Hernandez, N. (1996).
Cloning and characterization of SNAPSO, a subunit of the snRNA-activating protein
complex SNAPC. EMBO J 15, 7129-7136.

Henry, R.W., Sadowski, C.L., Kobayashi, R., Hernandez, N. (1995). A TBP-TAP
complex required for transcription of human snRNA genes by RNA polymerases II and
111. Nature 374, 653-657.

Hinkley, C.S., Hirsch, H.A., Gu, L., LaMere, B., Henry, R.W. (2003). The Small Nuclear
RNA-activating Protein 190 Myb DNA Binding Domain Stimulates TATA Box-binding
Protein-TATA Box Recognition. J Biol Chem 278, 18649-18657.

Hovde, S., Hinkley, C.S., Strong, K., Brooks, A., Gu, L., Henry, R.W., Geiger, J. (2002).
Activator recruitment by the general transcription machinery, X-ray structural analysis of
the Oct-1 POU domain/human U1 octamer/SNAP190 peptide ternary complex. Genes
Dev 16, 2772-2777.

Hu, P., Samudre, K., Wu, S., Sun, Y., Hernandez, N. (2004). CK2 phosphorylation of
del executes cell cycle-specific RNA polymerase III transcription repression. Mol Cell
16, 81-92.

Hu, P., Wu, S., Hernandez, N. (2003). A minimal RNA polymerase III transcription
system from human cells reveals positive and negative regulatory roles for CK2. Mol
Cell 12, 699-709.

Jiang, X., Wang, Y. (2004). Beta-elimination coupled with tandem mass spectrometry for
the identification of in vivo and in vitro phosphorylation sites in maize dehydrin DHNl
protein. Biochemistry 43, 15567-15576.

131

 

Johnston, I.M., Allison, S.J., Morton, J.P., Schramm, L., Scott, P.H., White, RI. (2002).
CK2 forms a stable complex with TFIIIB and activates RNA polymerase III transcription
in human cells. Mol Cell Biol 22, 3757-3768.

Liao, P.C., Leykam, J ., Andrews, P.C., Gage, D.A., Allison, J. (1994). An approach to
locate phosphorylation sites in a phosphoprotein: mass mapping by combining specific
enzymatic degradation with matrix-assisted laser desorption/ionization mass
spectrometry. Anal Biochem 219, 9-20.

Lobo, S.M., Hernandez, N. (1989). A 7 bp mutation converts a human RNA polymerase
II snRNA promoter into an RNA polymerase III promoter. Cell 58, 55-67.

Ma, B., Hernandez, N. (2001). A Map of Protein-Protein Contacts within the Small
Nuclear RNA-activating Protein Complex SNAPc. J Biol Chem 276, 5027-5035.

Ma, B., Hernandez, N. (2002). Redundant cooperative interactions for assembly of a
human U6 transcription initiation complex. Mol Cell Biol 22, 8067-8078.

Meggio, F., Pinna, L. A. (2003). One-thousand-and-one substrates of protein kinase CK2?
The FASEB Journal 17, 349-368.

Meisner, H., Heller-Harrison, R., Buxton, J ., Czech, MP. (1989). Molecular cloning of
the human casein kinase II alpha subunit Biochemistry 28, 4072-4076.

Mittal, V., Cleary, M.A., Herr, W., Hernandez, N. (1996). The Oct-1 POU-specific
domain can stimulate small nuclear RNA gene transcription by stabilizing the basal
transcription complex SNAPC. Mol Cell Biol 16, 1955-1965.

Mittal, V., Ma, B., Hernandez, N. (1999). SNAPC, a core promoter factor with a built-in
DNA-binding damper that is deactivated by the Oct-1 POU domain. Genes Dev 13,
1807-1821.

Murphy, S., Yoon, J .B., Gerster, T., Roeder, R.G. (1992). Oct-l and Oct-2 potentiate
functional interactions of a transcription factor with the proximal sequence element of
small nuclear RNA genes. Mol Cell. Biol 12, 3247—3261.

Pinna, L.A. (2002). Protein kinase CK2, a challenge to canons. Journal of Cell Science
115, 3873-3878

Pinna, L.A., Meggio, F. (1997). Protein kinase CK2 ("casein kinase-2") and its
implication in cell division and proliferation. Prog Cell Cycle Res 3, 77-97.

Resing, K.A., Johnson, R.S., Walsh, K.A. (1995). Mass spectrometric analysis of 21

phosphorylation sites in the internal repeat of rat profilaggrin, precursor of an
intermediate filament associated protein. Biochemistry 34, 9477-87.

132

Sadowski, C.L., Henry, R.W., Kobayashi, R., Hernandez, N. (1996). The SNAP45
subunit of the small nuclear RNA (snRN A) activating protein complex is required for
RNA polymerase II and III snRNA gene transcription and interacts with the TATA box
binding protein. Proc Natl Acad Sci U S A 93, 4289-4293.

Sadowski, C.L., Henry, R.W., Lobo, S.M., Hernandez, N. (1993). Targeting TBP to a
non-TATA box cis-regulatory element, a TBP-containing complex activates transcription
from snRNA promoters through the PSE. Genes Dev 7, 1535-1548.

Tsutsui, H., Geltinger, C., Murata, T., Itakura, K., Wada, T., Handa, H., Yokoyama, K.K.
(1999). The DNA-binding and transcriptional activities of MAZ, a myc-associated zinc
finger protein, are regulated by casein kinase II. Biochem Biophys Res Commun 262,
198-205.

Waldschmidt, R., Wanandi, I., Seifart, K.H. (1991). Identification of transcription factors
required for the expression of mammalian U6 genes in vitro. EMBO J 10, 2595-2603.

Wong, M.W., Henry, R.W., Ma, B., Kobayashi, R., Klages, N., Matthias, P., Strubin, M.,
Hernandez, N. (1998). The large subunit of basal transcription factor SNAPc is a Myb
domain protein that interacts with Oct-1. Mol Cell Biol 18, 368-377.

Yoon, J .B., Roeder, R.G. (1996). Cloning of two proximal sequence element-binding
transcription factor subunits (gamma and delta) that are required for transcription of small
nuclear RNA genes by RNA polymerases II and III and interact with the TATA-binding
protein. Mol Cell Biol 16, 1-9.

Zhao, X., Pendergrast, P.S., Hernandez, N. (2001). A positioned nucleosome on the
human U6 promoter allows recruitment of SNAPC by the Oct-1 POU domain.
Mol Cell 7, 539-549.

133

CHAPTER FOUR

SUMMARY AND FUTURE PLAN

CK2 is a highly conserved, ubiquitous kinase that appears to influence non-
protein coding gene transcription, such as RNA pol I-specific rRNA and RNA pol III-
specific tRNA, 5S rRNA and U6 snRNA gene transcription. Whether CK2 regulates
RNA pol II-specific snRNA gene transcription has been uncertain. Here we report that
CK2 regulates U1 snRNA gene transcription by RNA pol II. Inhibition of CK2 by either
depleting it using RNAi in cells (Figure II-l B) or blocking CK2 activity with its specific
inhibitor in human cell extracts (Figure II-2 B) stimulates U1 snRNA synthesis. The
promoter occupancies of both CKZa- and CKZB subunits on the U1 gene in human cells
(Figure II-l A) provide further evidence that CK2 is in close proximity with U1
transcriptional machinery. Thus, these observations demonstrate that CK2 is involved in

regulating RNA pol II-specific snRN A transcription.

Previously, it has been demonstrated that CK2 targets TFIIIB and RNA pol III for
RNA pol III-specific U6 snRNA transcription regulation (Hu et al., 2003; Hu etal., 2004).
However, TFIIIB or RNA pol III are not required for U1 transcription by RNA pol II.
One candidate target for CK2 regulation is the basal transcription factor SNAPC, which is
used for all snRNA gene transcription by both RNA pol II and pol III. SNAPc plays a
pivotal role in snRN A gene transcription by providing core promoter recognition, serving
as a target for transcription activation by Oct-1, and coordinating TBP activity thereby

promoting preinitiation complex assembly for both RNA pols II and III. Indeed,

134

endogenous CK2 associates with SNAPC and phosphorylates the SNAP190 subunit
(Figure II-3). SNAP190 likely plays a central role in coordinating SNAPC
phosphorylation by recruiting CK2 to the complex. This idea is supported by the
observation that GST-SNAP190 (1-719) can recruit CK2 from HeLa cell nuclear extracts

(Figure II-S A).

Although CK2 is involved in regulating snRNA gene transcription by both RNA
pol II and III, the mechanism of its function is unclear. Hu et al. (2003; 2004) discovered
that CK2 stimulates U6 snRNA gene transcription by targeting RNA pol 111. On the other
hand, CK2 inhibits U6 transcription by phosphorylating del. Notably, CK2 treatment of
recombinant SNAPc did not affect U6 transcription in their minimal RNA pol 111 system
(Hu et al., 2003). Our experiments demonstrate that mini-SNAPC phosphorylation by
CK2 inhibits its DNA binding activity and TBP is capable of counteracting this inhibition.
As shown in Figure II-6, CK2 inhibition of SNAPc DNA binding is not altered by the
addition of TBP for the U1 like probe (Figure II-6, right panel). This observation
supports the proposal that downregulation of SNAPc DNA binding activity by CK2 may
contribute to reduced U1 snRN A gene transcription. However, CK2 inhibition can be
reversed by the addition of TBP for the U6 like probe (Figure II-6, middle panel), which
can explain why U6 snRNA gene transcription was not affected by CK2 phosphorylation
of SNAPc (Hu etal., 2003). These findings indicate that cooperation between SNAPc and

TBP antagonizes CK2 inhibition of DNA binding by SNAPC.

It has been demonstrated that CK2 targets SNAPC for phosphorylation. Whether
CK2 phosphorylation of SNAPC directly contributes to CK2 downregulation of U1

snRNA gene transcription was tested. As a first, I have established an in vitro

135

transcription system wherein the endogenous SNAPc was immuno-depleted and
reconstituted with recombinant E. coli assembled mini-SNAPC to support transcription
(Figure III-1 and Figure III-4 B). In this system, mini-SNAP complexes alone are capable
of reconstituting snRNA gene transcription by both RNA pol II and pol III in the SNAPC-
depleted HeLa nuclear extracts without addition of recombinant TBP and ATP mix (0.3
M ATP, 10 Kg of phosphocreatine kinase per ml, and 10 mM creatine kinase) (Ma and
Hernandez, 2002). Next, this system was used to directly test the effect of SNAPc
phosphorylation by CK2 for transcription. I observed that preincubation of SNAPC with
CK2 and ATP exhibited less U1 (Figure III-1) and U6 snRNA transcripts (Figure III-5 A),

suggesting that CK2 phosphorylation inhibits SNAPC transcription activity.

To further investigate the mechanism of SNAPc phosphorylation by CK2,
phosphopeptide mapping of SNAP190 (1-719) was performed by mass spectrometry.
The MS data revealed that SNAP190 was phosphorylated at two regions that contain
multiple CK2 consensus sites [amino acid (a) 20-63 and 514-545]. As the serine rich
region from amino acids 514-545 represents the majority of CK2 phosphorylation within
SNAP190 (1-719) (Figure III-3 B and Figure III-4 B), the importance of this region for
CK2 regulation of SNAPC function was tested. Mini-SNAP complexes containing
SNAP43, SNAPSO, and SNAP190 (1-719) (mS) or SNAP190 lacking the serine rich
region SNAP190 (1-505) (mSAC) were compared for DNA binding and transcription
activity in the presence of CK2. As described in Figure III-5, mS showed lower DNA
binding affinity than mSAC and it was sensitive to CK2 treatment. Thus, SNAP190 (506-
719) plays an important role in downregulating SNAPC DNA binding activity and CK2

phosphorylation enhances this negative regulation.

136

It has been determined that SNAPc PSE-specific DNA binding activity was
inhibited by CK2 (Figure II-6) and the region of SNAP190 (506—719) is required for CK2
inhibition (Figure III-5). The mechanism of the inhibitory effect of CK2 phosphorylation
on SNAPC DNA binding is not known. We favor the idea that CK2 phosphorylates
SNAP190 outside the Myb DNA binding domain, leading to intramolecular interactions
in SNAP190 that masks PSE recognition by the SNAP190 Myb domain. An alignment of
the SNAP190 Myb domain with the human c-Myb protein showed that SNAP190 Rd
repeat (a 451-503) and c-Myb R3 repeats have 30% identity (Wong et al., 1998). NMR
studies of c-Myb indicate that the R3 repeat is composed of three helices (Jamin et al.,
1993). Computational modeling of SNAP190 (1-719) revealed that within the SNAP190
Myb domain, Rd repeat may also contain three helices with the last helix extended to
residue 510, meaning that the arginine rich region (a 506-511) is part of the helix- turn-
helix (HTH) motifs important for DNA binding. Therefore, I hypothesized a charge-
directed mechanism in which the heavily negative charges in the serine rich region
introduced by CK2 phosphorylation can attract the positively charged arginines and may
influence the HTH motif in the DNA binding domain. To test this idea, I have made the
non-phosphorylatable mutant complex by disrupting the CK2 consensus sites in
SNAP190 (EED543'545—>AAA) and the phospho-mimetic mutant with S—+D substitution
(SSSS549'542—»DDDD). My preliminary data shows that DNA binding activity of the non-
phosphorylatable mutant mS (EED543'545—>AAA) is less sensitive to CK2 treatment,
while the phospho-mimetic mutant mS (SSSS549'542—>DDDD) itself exhibites weak DNA
binding compared to wild type mS, suggesting a charge effect mechanism. If so, then a

mutant with R—+Q substitution (RRRRR506'5“—+QQQQQ) in SNAP190 will deactivate

137

the CK2 inhibition by phophorylating the serine rich region. This mutant has been
constructed. The ability of DNA binding and transcription of this mutant can be tested in

an EMSA and in vitro reconstitution transctiption system.

To explore whether the N-terminal region (a 20-63) of SNAP190 also
contributes to CK2 inhibition, the non-phosphorylatable mutant with SNAP190 (861.2835,
39’ 41’ 59—*AAAAA) was generated and tested for DNA binding activity. My preliminary
data shows that DNA binding activity of the non-phosphorylatable mS (Serzs' 35' 39’ 41’
59—->AAAAA) is less sensitive to CK2 treatment compared to wild type mS. However, the
double mutant ms (Ser28’35’39’4"59-—»AAAAA /EED543'545—iAAA) DNA binding did not
alter upon CK2 treatment. These results suggest that CK2 phosphorylation at both
regions (aa 20-63 and aa 514—545) of SNAP190 negatively regulates SNAPC function.

Further experiments to test mutant SNAPC DNA binding activity and their abilities to

direct snRN A transcription are needed to understand the mechanism.

It has been proposed that in the full length SNAPc, SNAP190 had a built-in
damper located within the C-terminal two-thirds of SNAP190 aa (506-1469) to
downregulate its binding to DNA, which was deactivated by a direct protein-protein
contact between SNAP190 (aa 869-912) and the Oct-1 POU domain (Mittal et al., 1999).
In the context of mini-SNAP complexes, upon CK2 treatment, DNA binding activity of
mS containing SNAP190 aa (1-719) was greatly reduced, while mSAC lacking the serine
rich region did not change (Figure III-5), however, mS(EED543'545—+AAA) with the non-
phosphorylatable serine rich region was also reduced, but to a lesser degree comparing to
mS. These observations imply that the region of SNAP190 aa 506-719 probably acts as a

damper of DNA binding. As the cooperative binding between TBP and SNAPC can

138

 

overcome the CK2 inhibition (Figure II-6), it is not clear whether TBP functions through
direct contact with the CK2 phosphorylated region of SNAP190 (a 20-63), or TBP has
higher affinity to interact with SNAP190 RcRd than the CK2 phosphorylated region of
SNAP190 (aa 514-545) in order to release CK2 inhibition. To test this, TBP recruitment
to the promoter DNA by the various deletions or point-mutations within mini-SNAP
complexes can be measured by EMSA. The region within SNAP190 that is targeted by
CK2 to inhibit DNA recognition can be determined by comparing the deletions or
mutations in SNAP190 in the context of mini-SNAPC. Thus, we might be able to
distinguish which region contributes to DNA recognition inhibition and the mechanism

for TBP antagonizing fimction.

Previously, we had demonstrated that SNAP190 is phosphorylated in vivo (Figure
II-4). Endogenous SNAP190 has been reported to be phosphorylated in HeLa cells
(Beausoleil et al., 2004). It is unclear, however, whether CK2 sites in SNAP190 we
mapped in vitro are also phosphorylated in the cells. Raising antisera specifically
recognize phosphoserines in SNAP190 (anti-phospho-SNAP19O antibody) will help us to
answer the questions about whether the CK2 sites in SNAP190 are also phosphorylated
in the cells. It will also be interesting to know whether SNAP190 phosphorylation by
CK2 is regulated in a cell cycle dependent manner and/or whether the level of CK2

phosphorylation correlates with snRNA gene transcription.

In conclusion, CK2 negatively regulates human U1 snRNA gene transcription by
inhibiting the basal transcription factor SNAPC DNA binding and transcription activity.

The cooperation between SNAPC and TBP can antagonize CK2 inhibition of DNA

139

binding by SNAPC, implying that CK2 may differentially regulate snRNA gene

transcription by different RNA polymerases.

140

References

Beausoleil, S. A., Jedrychowski, M., Schwartz, D., Elias, J.E.,Villén, J., Li, J., Cohn, M. A.,
Cantley, L.C., Steven P. Gygi, SP. (2004). Large-scale characterization of HeLa cell nuclear
phosphoproteins. PNAS 101, 12130-12135.

Hu, P., Samudre, K., Wu, S., Sun, Y., Hernandez, N. (2004). CK2 phosphorylation of
del executes cell cycle-specific RNA polymerase III transcription repression. Mol Cell
16, 81-92.

Hu, P., Wu, S., Hernandez, N. (2003). A minimal RNA polymerase III transcription
system from human cells reveals positive and negative regulatory roles for CK2. Mol
Cell 12, 699-709.

Jamin, N., Gabrielsen, O.S., Gilles, N., Lirsac, P.N., Toma, F. (1993). Secondary
structure of the DNA-binding domain of the c-Myb oncoprotein in solution. A
multidimensional double and triple heteronuclear NMR study. Eur J Biochem 216, 147—
154.

Ma, B., Hernandez, N. (2002). Redundant cooperative interactions for assembly of a human
U6 transcription initiation complex. Mol Cell Biol 22, 8067-8078.

Mittal, V., Ma, B., Hernandez, N. (1999). SNAP(c): a core promoter factor with a built-in
DNA-binding damper that is deactivated by the Oct-1 POU domain. Genes Dev 13, 1807-
1821.

Wong MW, Henry RW, Ma B, Kobayashi R, Klages N, Matthias P, Strubin M, and

Hernandez N. (1998). The large subunit of basal transcription factor SNAPC is a Myb domain
protein that interacts with Oct-l. Mol. Cell. Biol. 18:368-377.

141